Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Contents SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 2...

Author: David George Furth

40 downloads 992 Views 10MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

Contents

SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology

Editor David G. Furth

i

ii

David Furth

This page intentionally left blank

Contents

Special Topics in Leaf Beetle Biology Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology Editor David G. Furth

Sofia-Moscow 2003

iii

iv

David Furth SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology Edited by David G. Furth

Pensoft Series Faunistica No 29 ISSN 1312-0174

First published 2003 ISBN 954-642-170-7

© PENSOFT Publishers All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form by any means, electronic, mechanical, photocopying, recording or otherwise, without the prior written permission of the copyright owner. Pensoft Publishers, Acad. G. Bonchev Str., Bl.6, 1113 Sofia, Bulgaria Fax: +359-2-70-45-08, e-mail: [email protected], www.pensoft.net Printed in Bulgaria, February 2003

Contents

v

TABLE OF CONTENTS Dedication: Pierre H. A. Jolivet David G. Furth ........................................................................................................................................ vii FISCB: Events in Iguassu Falls, Brazil, 25-27 August 2000 ................................................................... xi Survey and quantitative assessment of flea beetle diversity in a Costa Rican rainforest (Coleoptera: Chrysomelidae: Alticinae) David G. Furth, J. T. Longino, M. Paniagua ........................................................................................ 1 The diversity of the Chrysomelidae fauna in Costa Rica: Insights from a Malaise trapline R. Wills Flowers, and P. E. Hanson ..................................................................................................... 25 Nepal as a centre of speciation for Himalayan Chrysomelid fauna Eva Sprecher-Übersax ............................................................................................................................ 53 Leaf Beetle fauna of the Carpathian Basin (Central Europe). Historical background and perspectives (Coleoptera: Chrysomelidae) Károly Vig ................................................................................................................................................. 63 Systematic position of the subfamilies Megalopodinae and Megascelinae (Chrysomelidae) based on the comparative morphology of the internal reproductive system Kunio Suzuki .......................................................................................................................................... 105 Cladistic analysis of the Oedionychines of southern Brazil (Galerucinae: Alticini) based on two molecular markers Catherine Duckett and K. M. Kjer .................................................................................................... 117 Present status of a taxonomic revision of Afrotropical Monolepta and related groups (Galerucinae) Thomas Wagner ..................................................................................................................................... 133 Interspecific differentiation in eggs and first instar larvae of the genus Procalus Clark 1865 (Chrysomelidae: Alticinae) Viviane Jerez ........................................................................................................................................... 147 Feeding behavior of Fulcidax monstrosa (Chlamisinae) on its host plant Byrsonima sericea (Malpighiaceae) V. Flinte, Margarete V. Macedo, R. C. Vieira and J. B. Karren ..................................................... 155 Natural enemies of Neotropical cassidinae (Coleoptera: Chrysomelidae) and their phenology Flavia Nogueira de Sá and João Vasconcellos-Neto ...................................................................... 161 Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) Astrid Eben and A. Espinosa de los Monteros ............................................................................... 175 A review of the biology and host plants of the Hispinae and Cassidinae (Coleoptera: Chrysomelidae) of Australia Trevor J. Hawkeswood ......................................................................................................................... 183 Performance and food preference of Botanochara impressa (Panzer, 1798) (Chrysomelidae, Cassidinae): A laboratory comparison among four species of Ipomoea (Convovulaceae) S. M. Kerpel and Lenice Medeiros .................................................................................................... 201

vi

David Furth

Notes on the biology and host plants of the Australian leaf beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) Trevor J. Hawkeswood and P. H. Jolivet ........................................................................................... 209 Biological and ecological studies on Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) Fernando A. Frieiro-Costa and João Vasconcellos-Neto .............................................................. 213 Chemical signaling between host plant (Ulmus minor) and egg parasitoid (Oomyzus gallerucae) of the Elm Leaf Beetle (Xanthogaleruca luteola) Torsten Meiners and M. Hilker .......................................................................................................... 227 Advantages and disadvantages of abdominal shields of chrysomelid larvae: Mini-review Caroline Müller and M. Hilker ........................................................................................................... 243 Distribution of toxins in chrysomeline leaf beetles: Possible taxonomic inferences Jacques M. Pasteels, A. Termonia, D. Daloze and D. M. Windsor .............................................. 261 Flight polymorphism observed in an alpine leaf beetle and associated costs Nicole M. Kalberer and Martine Rahier ........................................................................................... 277 Population ecology of the polymorphic species Chelymorpha cribraria (Col.: Chrysomelidae) in Rio de Janeiro, Brazil Gonçalves, R. O. and Margarete V. Macedo .................................................................................... 285 Genetic diversity of the phytophagous beetle Docema darwini Mutchler, 1925 (Coleoptera, Chrysomelidae), endemic to the Galápagos Islands Peter Verdyck, D. Konjev and D. Hilde ............................................................................................ 295 Subaquatic Chrysomelidae Pierre Jolivet ........................................................................................................................................... 303 ABSTRACTS Vertical stratification of Chrysomelid fauna in Panama Elroy Charles (presented by Yves Basset) ........................................................................................ 335 Systematic position of two polymorphic species of Chelymorpha Boh. (Coleoptera: Chrysomelidae: Cassidinae) João Vasconcellos-Neto, D. Windsor, Z. J. Buzzi, and V. Rodriguez .......................................... 336 Phylogeny and biogeography of the genus Procalus Clark (Chrysomelidae: Alticinae) Viviane Jerez ........................................................................................................................................... 337 Chemical defense in Neotropical Leaf Beetles. Jacques M. Pasteels, D. Windsor, N. Plasman, D. Daloze, J.C. Braekman and T. Hartmann ...... ............................................................................................................................................................ 338 Molecular phylogeny of the genus Cyrtonus (Coleoptera: Chrysomelidae) Irene Garneria, C. Juan and E. Petitpierre ....................................................................................... 339

Contents

vii

Pierre H. A. Jolivet Pierre H. A. Jolivet (born in Avranches, Manche, France, on 12 October 1922) is certainly the best-traveled and most knowledgeable Chrysomelid biologist of modern times. I first contacted him in early 1973, early in my studies of Alticinae. At that time he was living in South Korea and I in Israel. Ever since then we have been in more or less continual contact, although between his moving around the world and mine it has been rather like trying to catch a flea beetle, always jumping around. For example, he was stationed (working primarily for Food and Agriculture Organization of the United Nations or the World Health Organization) in Sudan, Morocco, Papua New Guinea (1961-70), Thailand (1970), France (1971-72), South Korea (1972-74), Upper Volta (Burkina Fasso, 1975-77), Afghanistan (1977), Sudan (1978), Thailand (1978), La Reunion (197879), Mauritius (1979), Senegal (1979-80), South Vietnam (1980-83), Cape Verde Islands (1983-84), etc., but also he was, and still is, continually travelling from wherever he is actually living. A true Chryso-globe-trotter, but he has always maintained his home base in Paris.

Fig. 1. Fifth International Symposium on the Chrysomelidae, Iguassu Falls, Brazil, 25 August 2000: Madeleine Jolivet, David Furth, Thomas Wagner, Pierre Jolivet (photo: K. Suzuki).

viii

David Furth

Between 1941-1946 he received multiple degrees in general and applied zoology, general and applied botany, geology, mineralogy, chemistry from the Université de Rennes. Early in his career he published a remarkable faunistic treatment of the Chrysomeloidea of the Balearic Islands (Jolivet, 1953). About the same time he did a brilliant doctoral thesis (1954) at the University of Paris (Sorbonne) on the wing morphology of Chrysomeloidea (Jolivet, 1957, 1959) as a student of one of the truly great French biologists Pierre P. Grassé (author of Traité de Zoologie). Of course, his favorite creatures are species of the genus Timarcha, the Tenebrionid-like, apparently primitive Chrysomelinae. After his B. Sc. at the University of Caen (1941), he became passionate about this group which was the subject of his zoology diploma at the University of Rennes (M.Sc., 1943) and his first publication about Timarcha was the same year (Jolivet, 1943). In one of his first letters to me while I was conducting my Ph.D. fieldwork in Israel, he urged me to look there for the “missing link” between the Timarcha known from Turkey and the ones known from Libya. He has published numerous articles about all aspects of Timarcha biology, ecology (natural history), systematics, etc. But his recent editorial in the bulletin of the Balearic natural history society (Jolivet, 2000) or his more appropriately titled “Timarchophilia or Timarchomania: Reflections on the genus Timarcha” (Jolivet, 1999) truly summarize his passion. Yes, Pierre Jolivet has that “inordinate fondness

Fig. 2. Fourth International Symposium on the Chrysomelidae, Firenze, Italy, 30 August 1996: Mauro Daccordi, Carlo Leonardi, Pierre Jolivet (photo: D. Furth).

Contents Dedication: Pierre H. A. Jolivet

ix

for beetles”, especially for Timarcha, but also for all Chrysomelidae, and even for all insects and their natural history. The first of his approximately 400 scientific publications concerned hybridization in two species of Chrysolina (Jolivet, 1942). He has authored or edited many books concerning Chrysomelidae, ants and plants, carnivorous plants, general entomology, etc. He has also described Chrysomelidae species new to science in the subfamilies Orsodacninae, Donaciinae, Sagrinae, Criocerinae, Clytrinae, Cryptocephalinae, Chlamisinae, Eumolpinae, Chrysomelinae, Galerucinae, Alticinae, and Hispinae. Pierre has been an inspiration to me and to dozens of other chrysomelid workers around the globe. He always has very interesting stories and information concerning almost any group of chrysomelids as well as many other insect groups. I have never ceased to be fascinated by his discussion about a wide variety of subjects. If, as the proverbial saying goes, “variety is the spice of life” then Pierre Jolivet has had and will continue to have the fullest and “spiciest” of lives. Pierre Jolivet is a true Renaissance biologist. He and Madeleine (his wife of 40 years) have attended and participated in all five International Symposia on the Chrysomelidae: 1984 (Hamburg); 1988 (Vancouver); 1992 (Beijing); 1996 (Firenze); 2000 (Iguassu). So it is with the greatest honor, pleasure and the unanimous concurrence of my chrysomelid colleagues everywhere that I dedicate this Fifth International Symposium on the Chrysomelidae in Brazil (FISCB) to Pierre H. A. Jolivet .

Fig. 3. Madeleine and Pierre Jolivet, collecting on FISCB field trip in Parana, Brazil, 27 August 2000 (photo: D. Furth).

x

David Furth

Fig. 4. Pierre and Madeleine Jolivet at XX International Congress of Entomology, Beijing, China, 3 July 1992 (photo: K. Suzuki).

LITERATURE CITED Jolivet, P. 1942. Hybridization probable de deux ChrysomPles: C. polita X C. menthastri. Bull. Soc. Ent. Fr. 47(9):141. Jolivet, P. 1943. Sur un cas de “phorJsie” observJ chez deux espPces du genre Timarcha. Bull. Soc. Linn. Norm. 9(3):107-108. Jolivet, P. 1953. Les Chrysomeloidea (Coleoptera) des Sles BalJares. Mem. Inst. Roy. Sci. Natur. Belgique 2(50):1-88. Jolivet, P. 1957. L’aile des Chrysomeloidea (Coleoptera), PremiPre Part. Mem. Ent. Inst. Roy. Sci. Natur. Belgique 2(51):1-180. Jolivet, P. 1959. Recherches sur l’aile des Chrysomeloidea (Coleoptera), DeuxiPme Part. Mem. Ent. Inst. Roy. Sci. Natur. Belgique 2(58):1-152. Jolivet, P. 1999. Timarchophilia or Timarchomania reflexions on the genus Timarcha (Coleoptera, Chrysomelidae). Nouv. Rev. Ent. (N.S.) 16(1):11-18. Jolivet, P. 2000. CrisomPlids, una font d’inspiraci\ [Leaf Beetles, a source of inspiration]. Boll. Soc.Hist. Natur. Balears 43:9-13.

David G. Furth, Editor 8 July 2002

Contents

xi

Fifth International Symposium on the Chrysomelidae (Iguassu Falls) Brazil The Fifth International Symposium on the Chrysomelidae (FISCB) was held as part of the XXI International Congress of Entomology (ICE) on Friday, Saturday and Sunday (25-27 August 2000), in Iguassu Falls, Parana, Brazil. As planned Friday was a full day of 17 oral presentations, Saturday consisted of 8 posters and 5 oral presentations, Sunday was a field trip to a local preserve in Parana. Friday ORAL PRESENTATIONS were moderated by David Furth (Organizer) and João Vasconcellos-Neto (Co-Organizer). The Symposium was dedicated to Pierre Jolivet. Each presentation was 20 minutes. The order, titles and authors of the oral presentations were as follows, with the presenters in bold letters: Introduction – Dedication to Pierre Jolivet (David G. Furth) Alticinae diversity in Costa Rica – David G. Furth (USA), Maylin Paniagua (Costa Rica), John T. Longino (USA); The diversity of the Chrysomelidae fauna in Costa Rica: Insights from a Malaise trapline – R. Wills Flowers (USA) and Paul E. Hansen (Costa Rica); Nepal as a center of speciation for Himalayan Chrysomelid fauna – Eva Sprecher-Ubersax (Switzerland); The Leaf Beetle fauna of the Carpathian Basin: What do we really know? Historical background and perspectives – Karoly Vig (Hungary); Phylogenies of the Oedionychina – Catherine N. Duckett (Puerto Rico, USA); Phylogeny and biogeography of the genus Procalus (Clark) (Chrysomelidae: Alticinae) – Viviane Jerez (Chile); Phylogeny and biogeography of Afrotropical Monolepta and related taxa – Thomas Wagner (Germany); Systematic position of two polymorphic species of Chelymorpha Boh. (Coleoptera: Chrysomelidae: Cassidinae) – Joao Vasconcellos-Neto (Brazil), D. Windsor (USA), Z. J. Buzzi (Brazil), and V. Rodriguez (USA); Systematic position of the subfamilies Megapodinae and Megascelinae (Chrysomelidae) based on the comparative morphology of the internal reproductive system – Kunio Suzuki (Japan); Chemical signaling between a host plant and egg parasitoid of a galerucine leaf beetle – Torsten Meiners and M. Hilker (Germany); Chemical defense in Neotropical Leaf Beetles – Jacques Pasteels, D. Windsor (USA), N. Plasman, D. Daloze, J. C. Braekman (Blegium), T. Hartmann (Germany); The abdominal shields of Tansy feeding Cassidine species – Defense versus attraction – Caroline Muller (USA) and M. Hilker (Germany); Polymorphism in a Cassidinae species – Margarete V. Macedo, R. O. Gongalves and J. Vasconcellos-Neto (Brazil); Molecular phylogeny of the genus Cyrtonus (Coleoptera: Chrysomelidae) – Irene Garneria, C. Juan, and E. Petitpierre (Spain); Genetic patterns in phytophagous beetles of the Galapagos Archipelago -Peter Verdyck, K. Desender, H. Dhuyvetter (Belgium); Subaquatic Chrysomelidae – Pierre Jolivet (France); Vertical stratification of Chrysomelid fauna in Panama – Elroy Charles (Guyana), presented by Yves Bassett (USA/Panama). Saturday POSTERS: Interspecific differentiation in eggs and larvae of Procalus (Chrysomelidae: Altcinae) – Viviane Jerez (Chile); Biological and ecological studies on Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) – F. A. Frieiro-Costa and J. Vasconcellos-Neto, (Brazil); Biological data and population abundance of three species of Cassidinae (Coleoptera:

xii

David Furth

Chrysomelidae) in a Brazilian tropical forest – Flavia N. Sa and J. Vasconcellos-Neto (Brazil); The evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) – Astrid Eben and A. Espinosa de los Monteros (Mexico); Lining on a hairy surface: Movement and feeding behavior of Gratiana spadicea (Coleoptera: Chrysomelidae: Cassidinae) on its host plant Solanum sisymbriifolium (Solanaceae) – Lenice Medeiros and G. R. P. Moreira (Brazil); Feeding specialization and host defense in Chrysomelinae Leaf Beetles did not lead to an evolutionary dead end – A. Termonia (Belgium), T. H. Hsiao (USA), Jacques Pasteels, M. Milinkovitch (Belgium); Systematic position of two polymorphic species of Chelymorpha Boh.(Coleoptera: Chrysomelidae: Cassidinae) – Jono Vasconcellos-Neto (Brazil), D. Windsor (USA), Z. J. Buzzi(Brazil), and V. Rodriguez (USA). Saturday ORAL PRESENTATIONS: Scenes from the four previous international symposia on Chrysomelidae – David G. Furth (USA); Molecular phylogeny, chromosomes, and host plant affiliation in Chrysolina and Oreina (Coleoptera: Chrysomelidae) – Eduard Petitpierre, C. F. Garin, B. De Astorza, C. Juan, and I. Garneria (Spain); Cost of flight dispersal in Oreina cacaliae (Coleoptera: Chrysomelidae) – Nicole M. Kalberer and M. Rowell-Rahier (Switzerland); Influence of natural enemies in the populations of two Stolaini species (Coleoptera: Chrysomelidae: Cassidinae) in a Brazilian tropical forest – Flavia N. Sa and J. Vasconcellos-Neto(Brazil); Searching for Sumacs and flea beetles: From African poison arrows to Mexican poison ivy – David G. Furth (USA). Sunday FIELD TRIP was to a new local reserve (a state conservation area) in the state of Parana called Cabeca do Cachorro (Dog’s Head) in Toledo County, about 130 kilometers northeast of Iguassu Falls. Unfortunately it was a rainy day, nevertheless 18 of us (from 10 countries) rented 2 minivans with drivers and we drove for about 90 minutes to the small town near the reserve. However, because of the rain, the 8 kilometers of dirt road to the reserve from the main highway was too muddy for the minivans and so we went into the small town in order to try to locate someone with better vehicles who could transport us to the reserve. We waited in a small restaurant for about 2 hours where we had a typical Parana lunch. Then two vehicles from the reserve took us in several trips to the reserve. We managed to have several hours to wander the reserve and fortunately the rain finally stopped. The director of the reserve gave us a warm welcome and he said he was very proud that his reserve could host such an international group of scientists.

David G. Furth (ed.) 2003 © PENSOFTSurvey Publishers and Quantitative Assessment of Flea Beetle Diversity in aSpecial Costa Rican 1 Topics in Leaf... Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 1-23

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican Rainforest (Coleoptera: Chrysomelidae: Alticinae) David G. Furth1, John T. Longino2, and Maylin Paniagua3 1

Section of Entomology, National Museum of Natural History, Smithsonian Institution, P.O. Box 37012, Washington, D. C. 20013-7012 USA. Email: [email protected] 2 The Evergreen State College, Olympia, Washington, 98505 USA 3 Project ALAS, La Selva Biological Station, Puerto Viejo de Sarapiquí, Costa Rica

ABSTRACT Only 113 species in 43 genera of Alticinae are recorded in the literature from Costa Rica. The Arthropods of La Selva project (ALAS) carried out a quantitative inventory of the Alticinae at the La Selva Biological Station, a rainforest site in the Atlantic lowlands of Costa Rica. In addition, collections were examined for additional alticine material for Costa Rica as a whole. The quantitative inventory yielded 3221 specimens from Malaise traps, 2260 from canopy fogging, and 203 from miscellaneous other methods. A total of 247 species in 68 genera was obtained. The abundance distribution was bimodal, deviating from a lognormal by an overabundance of rare species. Canopy fogging was more efficient than Malaise trapping when compared on a per sample basis, but Malaise traps were far more efficient than canopy fogging on a per individual basis. Thus, over a long time Malaise trapping is more efficient. There was broad overlap in the species composition of the two sampling methods, and combining methods did not improve efficiency over single methods. Fogging multiple species of trees captured species at a higher rate than fogging single species when species accumulation curves were compared on a per individual basis, but not when compared on a per sample basis. Richness estimates did not stabilize as sample size increased, and the species accumulation curve was logarithmic, with no evidence of approaching a plateau. However, final richness estimates were only 10-15% higher than observed species richness, and the singletons curve was beginning to decline. Adding additional records from elsewhere in Costa Rica, there are about 350 species in 89 genera known from the country as a whole. This study recorded 10 genera new to Central America and 47 new to Costa Rica. Based on this study we predict there may be 1000 species of Alticinae in Costa Rica. All Central American countries certainly have a much higher actual diversity than is recorded in the literature.

RESUMEN En la literatura de Costa Rica unicamente se han registrado 112 especies de 43 géneros de Alticinae. El proyecto Artrópodos de La Selva (ALAS), realizó un inventario cuantitativo de los Alticinae en la

2

David G. Furth, John T. Longino & Maylin Paniagua

Estación Biológica La Selva, localizada en el bosque tropical lluvioso, en las tierras bajas del atlántico de Costa Rica. Además, se examinaron colecciones para incluir material adicional de los Alticinae. El inventario cuantitativo dió un resultado de 3,221 especimenes en trampas de Malaise, 2260 especimenes de la fumigación del dosel, y 203 obtenidos por otros métodos. Un total de 247 especies en 68 géneros fueron obtenidos. La distribución de abundancia fue bi-modal, desviándose del logaritmo normal por la sobre abundancia de especies raras. La fumigación del dosel fue más eficiente que las trampas de Malaise cuando comparamos por muestra, pero las trampas de Malaise fueron mucho más eficientes que la fumigación del dosel cuando comparamos a nivel de individuos. De este modo a largo plazo las trampas de Malaise son más efectivas. Obtuvimos un amplio traslape en la composición de las especies de los dos métodos de muestreo, y si los combinamos esto no ayuda a la eficacia sobre métodos individuales. La fumigación de multiples especies de árboles registró una alta proporción de especies comparada con la fumigación de árboles de la misma especie, cuando las curvas de acumulación fueron comparadas a nivel individual, pero no cuando las comparamos a nivel de muestra . Las estimaciones de riqueza no se estabilizaron cuando incrementamos el tamaño de muestra, y la curva de acumulación de especies fue logarítmica, sin ninguna evidencia de que alcance la estabilidad. Sin embargo, las estimaciones finales de riqueza fueron de 10-15% más altas que la observada en la riqueza de las especies, y la curva de “singletons” empezó a declinar. Añadiendo registros adicionales de otros lados de Costa Rica, encontramos que hay cerca de 350 especies en 89 géneros conocidos para todo el país. Basado en éste estudio predecimos que hay cerca de 1000 especies de Alticinae en Costa Rica. Todos los paises Centroamericanos poseen una diversidad más alta de la que se indica en la literatura. INTRODUCTION The Chrysomelidae are a major component of tropical arthropod biodiversity (Wagner, 2000), and the flea beetles (Alticinae) comprise the largest subfamily. These highly diverse, phytophagous insects have important ecological roles as abundant herbivores, and many species have become important agricultural pests that affect human welfare. Detailed knowledge of species-level diversity patterns is important for conservation biology, natural product development, biodiversity monitoring, community ecology, and systematics research. Costa Rica is attempting to develop such knowledge through a nation-wide biodiversity inventory carried out by the Instituto Nacional de Biodiversidad (INBio). An important contribution to INBio’s national inventory effort is the Arthropods of La Selva project (ALAS, Longino, 1994), which provides inventories for many arthropod taxa at one lowland rainforest site, La Selva Biological Station. This long-term, large-scale inventory is a collaboration of locally-trained people (parataxonomists) and taxonomic specialists from many institutions. We contribute to this effort by reporting here a detailed assessment of alticine diversity. Inventory and monitoring using arthropods can often be more informative than using vertebrates, because invertebrates are often more sensitive indicators of environmental change and usually consist of more diverse species assemblages. Too often diversity studies and resulting planning for conservation or sustainable use concentrates on well-known groups (e.g., mammals, birds, and plants) and have ignored the most diverse (“hyperdiverse”) organisms (e.g., arthropods, nematodes, and fungi) (Colwell and Coddington, 1994). More knowledge of the correlation between the well-known and hyperdiverse groups is needed before the “indicator group” strategy can be reliably applied to biodiversity surveys and estimates (Colwell and Coddington, 1994). Good inventory information about invertebrates can be very useful for management and planning in conservation efforts and

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

3

areas, assessing the sustainable use of natural resources, and measuring changes in an ecosystem in response to natural processes or human activities (Kremen et al., 1993). Some invertebrate groups can be more effective indicators than others and Alticinae offer great potential, not only because of their high diversity, but also because of the relatively close association with their food plants. However, a requirement for an effective indicator group is that they can be readily and accurately identified to the species level. This is still a steep challenge for Neotropical Alticinae because of few specialists, few reliably determined collections, few monographs and keys, and lack of easy accessibility to good collections. There are many implications of diversity studies in tropical rainforests. It is well known that much of the world’s biological diversity resides in tropical rainforests, especially in the canopies of such forests, and that much of this diversity consists of species and even genera previously unknown to science. Therefore, purely from the perspective of discovery such surveys are fascinating and exciting. Many models, predictions and attempts at application of the results of diversity surveys and inventories have been made with the goal of conservation. Some studies have applied the results of diversity studies to statistical modeling and others have used them to demonstrate optimum and effective sampling methods for estimating biological diversity (Longino and Colwell, 1997). For hyperdiverse taxa, intensive local inventories are a valuable starting point for understanding diversity at larger spatial scales. There are a variety of reasons why it is important to know local species richness or diversity, including the study of geographical patterns of species richness, chronological changes in species richness, causes of tropical diversity, altitudinal changes in diversity, and application to conservation issues and sustainable use (Longino, et al. 2002). Ecologists have devised methods for estimating species richness based on quantitative sampling (Soberón and Llorente, 1993, Colwell and Coddington, 1994), but traditional methodologies of collecting species information in the field have been inconsistent and non-quantitative (Colwell and Coddington, 1994, Longino et al. 2002). Many studies of species diversity have relied on observed species richness, which is always an underestimate of true community richness. Most diversity studies use limited sampling techniques carried out over a limited amount of time, which results in observed richness being far lower than true community richness. Since the early 1980s there have been many attempts to estimate the global species richness of insects. For many of the studies on which the estimates have been based in tropical rainforests the main sampling method has been canopy fogging (Erwin, 1982). Subsequently there has also been significant debate as to whether the global estimates of species richness are accurate (Gaston, 1991, Erwin, 1991). These global estimates usually rely on assumptions of host specificity of insect herbivores, assumptions that are rarely tested. Novotny and Basset (2000) have made significant progress in revealing patterns of host specificity in chrysomelid communities. They conducted a three-year study in Papua New Guinea, in which they sampled from thousands of trees and carried out extensive feeding tests on live material. More recently Novotny et al. (2002) indicates that most herbivores in tropical forests have lower host specificity than assumed in many previous species richness/abundance studies. Our study does not address host plant relationships, but relies almost entirely on various mass-sampling techniques. In a quantitative survey of the ants of La Selva, Longino et al. (2002) emphasized that it is difficult to estimate species richness for diverse faunas without a major sampling effort. They found that when single methods were examined, a high proportion of species were rare, species accumulation curves did not appear asymptotic, various richness estimates failed to stabilize, and the richness estimates were usually much higher than the observed richness. In contrast, when multiple sampling

4

David G. Furth, John T. Longino & Maylin Paniagua

methods were employed, the proportion of rare species declined, and the species accumulation curve showed signs of approaching an asymptote. Richness estimates still did not stabilize, but they did closely converge with observed richness (i.e., no more than 6% above observed). Longino et al. (2002) proposed that convergence of estimated and observed species richness was a good indicator of inventory completeness. Specialized collecting by an ant expert (Longino) was an important method. Longino found 293 of 437 species, a higher proportion than any other single method. Quantitatively structured sampling was good for estimating relative abundance of common species, but under-represented many species due to the limited scope and number of methods. Specialized collecting, actually the non-quantitative application of many methods, made it unlikely that there was a large pool of rare, unseen species at La Selva. Thus, a combination of non-quantitative specialist (taxonomist) collecting and quantitatively structured sampling resulted in a relatively complete inventory. In surveys, inventories and other biological diversity studies the subject of species rarity is often discussed, but its cause is still somewhat enigmatic. Rarity is often quantified in terms of singletons (species known from one specimen), doubletons (species known from two specimens), uniques (species known from one sample, regardless of how many individuals occur in each sample), and duplicates (species known from two samples). Richness estimates are highly influenced by rare species, and often an attempt is made to partition rare species into low density elements of local communities and those that somehow do not belong (“tourists”). Longino et al. (2002) used natural history and distribution data to classify a number of the unique ant species as geographic or methodological “edge” species, the former being common outside of La Selva but rare on the property itself, and the latter possibly common at La Selva but not easily captured with any of the methods used. They also pointed out that species rare in ecological samples are often not rare to museum taxonomists. For taxonomists, rare species are often methodological edge species. It was striking how many of the La Selva uniques were known from additional collections outside of La Selva. Only 7 of 437 ant species were known from only one collection in the world. Our current knowledge of alticine diversity is based on a history of collecting by taxonomists rather than quantitative inventories. There are over 500 genera of Alticinae and probably 8,000 species worldwide. Of these, over 230 genera have been described from the Neotropical Region (Seeno and Wilcox, 1982). The only key to Neotropical genera was done by Scherer (1962). However, since then about 50 new genera have been described, making even genus-level determinations extremely difficult. Faunal records for Costa Rican Alticinae have gradually accumulated over time. In the Biologia Centrali Americana, Jacoby (1884-1892) recorded 16 genera and 38 species. In the Coleopterorum Catalogus, Heikertinger and Csiki (1939-1940) recorded 16 genera and 39 species. Wilcox (1975) recorded 29 genera and 51+ species. Based on all the previous literature Furth and Savini (1996, 1998) listed 41 genera and 107 species. Furth (1998) added 3 Blepharida Chevrolat species records, Savini (1999) added Heikertingerella marini Bechyné and Bechyné, Duckett and Moya (1999) described Ptocadica tica, and Savini and Furth (2001) added Neosphaeroderma coerulea (Jacoby), raising the total number of recorded species to 113. Furth and Savini (1996, 1998) listed the following Alticinae diversity from some other Central American countries: Panama with 70 genera and 270 species; Mexico with 75 genera and 391 species; and a total from all Central America of 113 genera and 884 species. These totals were taken from previous catalogues, checklists, monographs, revisions and other taxonomic publications. As for most arthropod groups, relatively little comprehensive new fieldwork had been attempted in order to more accurately or realistically understand the Alticinae diversity of Costa Rica. Nor

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

5

have there been many attempts to survey museum collections in order to determine this diversity based on various collecting events of many entomologists over time. Large numbers of undetermined Alticinae reside in many institutional collections and in private collections. Part of this is because this largest subfamily of the Leaf Beetles (Chrysomelidae) is very confused nomenclaturally and taxonomically and very few specialists can even reliably determine correct generic names much less specific ones. So the quantity of undetermined Alticinae continues to grow in collections and few specialists have tried to do significant sorting. Point surveys of alticine diversity are few. Farrell and Erwin (1988) found 126 common species of chrysomelids at a single site in Peru, but 64 (mostly Alticinae) could not even be identified to genus. We present here an analysis of the alticine fauna of La Selva, based on an intensive program of structured sampling, and we review the knowledge of the fauna for Costa Rica as a whole. The results reveal how little we know of the Neotropical alticine fauna in general, and suggest efficient sampling methods for future surveys. METHODS Study Site The study site is La Selva Biological Station (Heredia, Costa Rica) [84° 01’W, 10° 26’N]. It consists of a lowland tropical rainforest of about 1500 hectares with elevations from 50-150 meters and a mean annual rainfall of 4 meters. The habitat is a mosaic of lowland rainforest, second growth forest of various ages and abandoned pastures (McDade et al., 1993). Project ALAS The Alticinae inventory was conducted as part of Project ALAS (http://viceroy.eeb.uconn.edu.ALAS/ ALAS.html). Project ALAS is a large collaborative effort to survey the arthropods of La Selva Biological Station. A generalized set of sampling methods has been applied to a wide range of arthropod taxa, from spiders and mites to many groups of Coleoptera, Diptera, Lepidoptera and Hymenoptera. Field sampling and sample processing has been carried out largely by a resident staff of four persons (including the third author) recruited from communities surrounding La Selva and trained in entomological techniques (parataxonomists, sensu Janzen, 1991). A relational database of collection, specimen, and identification data is managed using the biodiversity database application Biota (Colwell, 1996). This on-going project is a collaboration with the Instituto Nacional de Biodiversidad in Costa Rica (INBio, Gamez, 1991). All specimens resulting from this project are labeled with INBio barcodes (in addition to standard locality labels). Specimens are deposited in the INBio collections facility in Santa Domingo de Heredia, Costa Rica, with the exception of those distributed to taxonomic specialists or collaborators, following INBio and Costa Rican regulations. Sampling Methods in this Study Malaise traps. A program of quantitative sampling was initiated in March 1993. Sixteen areas were selected on a La Selva station map, stratified by soil type (alluvial vs. residual) and forest type (primary vs. secondary). This design yielded four replicates for each soil and forest type combination. Sites were easily accessible from a trail system, but widely dispersed. A Malaise trap (Marris House,

6

David G. Furth, John T. Longino & Maylin Paniagua

with black vertical panel and white roof) was erected in each area. Malaise traps are open-sided tents with a collecting head in which flying or crawling arthropods are trapped and accumulate. The collecting head was a plastic bottle containing 75% ethanol. Malaise traps were placed in light gaps and potential flyways and maintained from March 1993 to March 1994, for a total of 13 months. At the beginning and the middle of each month, the collecting bottle with accumulated arthropods was removed and replaced with a fresh bottle of ethanol. After the first two months four distant traps were changed to a monthly sampling regime, resulting in a few one-month samples, but these are less than 5% of the processed samples. New traps were installed and a second series of Malaise samples was taken from June 1995 until June 1996. The traps were installed at the same sites as previously, excluding the 4 most distant sites. This sampling program yielded a total of 664 samples. Finally, a single Malaise trap was installed in a recent treefall gap near the laboratory in 1999, from which 6 samples were processed. Fogging. Canopy fogging was done using the general procedures of Erwin (1983), Adis et al. (1984), and Stork (1988). During the 1993-1994 sampling period, eighteen trees were selected for canopy fogging: six individual trees of the most common tree species at La Selva (Pentaclethra macroloba (Willd.) O. Ktze., Fabaceae), six individual trees of a species of intermediate abundance (Virola koschnyi Warb., Myristicaceae), and one individual each of trees from six additional families. Six areas were chosen on a La Selva station map, such that the areas were dispersed across the available primary forest, and at the same time accessible from the trail system. In each area three trees were selected: a Pentaclethra, a Virola, and one of the six unique species. Trees were chosen that had large crowns, little overlap with adjacent crowns, and good access for climbing. The three trees in a group were usually fogged on consecutive days, and the 6 groups were fogged at approximately twomonth intervals over one calendar year. A second set of fogging samples was obtained in October and November of 1994. Seven sets of three trees were fogged, all compressed into this two-month period instead of spread over a year. Again each group of three contained a Pentaclethra macroloba, a Virola koschnyi, and a distinct species in the “other” category. Finally, a set of six samples was taken in late December 1999 and early January 2000. These were from diverse species in a variety of families, all from one area in primary forest. Arthropods were captured in funnels slung beneath tree crowns. Ropes were strung from trunk to trunk between the focal tree and neighboring trees to form an irregular network 2-3m high above ground level. Forty funnels, each intercepting an area of 1 square meter, were suspended from these ropes, distributed as evenly as possible in the area beneath the crown of the focal tree. The funnels were composed of ripstop nylon mounted on a metal hoop, with a threaded ring at the bottom for the attachment of a plastic sample bottle. Palm leaves and other vegetation immediately above the funnels were clipped or bent back, but otherwise the understory vegetation was left intact. Funnels were left upside down on the ground overnight to avoid accumulation of debris before fogging. Before dawn the next morning the funnels were re-suspended and the bottles filled with 75% ethanol. An operator climbed to the first branches at the base of the crown, 15 to 20m above ground level, and commenced fogging at about 0600hrs. We used a Golden Eagle DynaFogger, on setting 6, to fog 3.8 l of Pyrethrins 123 insecticide (Summit Chemical Co.). This is a 3% solution of a natural pyrethrin insecticide with synergists, in a petroleum distillate carrier. The operator gradually fogged in a 360 degree circle, attempting to cover the crown evenly. Following fogging, a two-hour drop time was allowed, after which the sides of the funnels were washed down with ethanol and the bottles were collected. Fogging events were classified into three “treatments” related to tree species: Pentaclethra macroloba, Virola koschnyi, and “diverse” (comprising many species of trees from many

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

7

families). At the time of this analysis 29 fogging events had been processed: 7 Pentaclethra macroloba, 9 Virola koschnyi, and 13 diverse. Other. A few specimens were hand collected or netted by the ALAS staff and visiting scientists. A few specimens were collected at lights and one in a Berlese sample. The first author collected at La Selva by selective sweeping of the vegetation for several days in August of 1989 and for 2 days in January 1995. Species Identification The first author identified the ALAS samples first to genus using published literature on the Neotropical Alticinae fauna as well as an unpublished key to genera. In addition specimens were determined to genus or species by comparison to types or reliably identified specimens from a variety of institutional collections. Many identifications were possible because of the indefinite loan to the first author of M. Jacoby specimens in the F. C. Bowditch Collection (Museum of Comparative Zoology, Harvard University). Specimens were identified to actual species name or to genus name with a morphospecies name (e..g., Acallepitrix DF-002). Such morphospecies names were used consistently throughout the study and vouchers are deposited both at INBio and the U. S. National Museum of Natural History (USNMNH). Unique vouchers are temporarily maintained by the first author for further identifications and until either more specimens are discovered or the project is concluded, in which case uniques will be deposited at INBio. Generic author names can be found in Furth and Savini (1996, 1998). In addition to the ALAS project specimens, the first author has examined and determined specimens from additional collections at INBio and USNMNH, both from La Selva and from elsewhere in Costa Rica. These additional collections add notable genus and species records to the knowledge of the Alticinae diversity of Costa Rica. Inventory Efficiency and Richness Estimation Data were analyzed using the program EstimateS (Version 5, R. K. Colwell, http:// viceroy.eeb.uconn.edu/estimates). This program calculates species accumulation curves and associated values for a variety of richness estimators, presenting the mean of a user-designated number of random re-orderings of the samples. Species accumulation curves were “sample-based rarefaction curves” (sensu Gotelli and Colwell, 2001) and were examined based on number of samples (a measure of species density) and number of individuals (a measure of species richness) (Gotelli and Colwell, 2001). Inventory efficiency was investigated using the combined curve method of Longino and Colwell (1997). Species accumulation curves for Malaise samples, fogging samples, and the two methods combined were examined. In like manner, the three fogging treatments were compared with the combined curve method. The fogging treatments were also compared with respect to within-sample measures of diversity, using 1-way ANOVA. Two variables were examined: number of species, and number of species following rarefaction. Rarefaction was calculated using the Coleman equation, with each fogging sample rarefied to the sample size (number of individuals) of the smallest fogging sample. Species richness was estimated with two estimators: fitting of the Michaelis-Menten equation to the smoothed species accumulation curve and the Abundance-based Coverage Estimator (ACE) (Colwell and Coddington 1994, Chazdon et al. 1998, and see the EstimateS website for references

8

David G. Furth, John T. Longino & Maylin Paniagua

and calculation methods). Richness estimates were evaluated by plotting them as a function of sample size, with presence of a plateau being indicative of a reliable richness estimate, and convergence with observed species richness being a measure of inventory completeness (e.g., Longino et al., 2002). RESULTS This survey more than doubled the known diversity of Costa Rican Alticinae, at both the generic and species level (Tables 1 and 2). Generic diversity rose from 43 previously known genera to 89 reported here (Table 1). Of these 46 new genera, 3 are new to science, 10 new to Central America (8 from La Selva) and 33 are new to Costa Rica ( 26 from La Selva). From Table 1, of the 10 genera new to Central America are: Andiroba Bechyné and Bechyné; Calipeges Clark; Chaparena Bechyné (not recorded from La Selva); Coroicona Bechyné; Egleraltica Bechyné and Bechyné; Loxoprosopus Guerin; Palmaraltica Bechyné; Paralacticoides Bechyné and Bechyné (not recorded from La Selva); Roicus Clark; and Stenophyma Baly. And of the 33 genera new to Costa Rica, 7 are not recorded from La Selva: Acrocyum Jacoby; Calliphron Jacoby; Euphenges Clark; Hydmosyne Clark; Lacpatica Bechyné and Bechyné; and Megasus Jacoby; Octogonotes Drapiez. In addition, the following 12 genera have been previously recorded from Costa Rica (Furth and Savini, 1996, 1998, Furth, 1998), but were not found at La Selva during the current ALAS Project sampling: Ayalaia Bechyné and Bechyné; Blepharida Chevrolat; Cacoscelis Chevrolat; Chalatenanganya Bechyné and Bechyné; Diphaulaca Chevrolat; Distigmoptera Blake; Hylodromus Clark; Macrohaltica Bechyné; Megistops Boheman; Pedilia Clark; Pseudogona Jacoby; and Resistenciana Bechyné. Specimens of all the above genera are represented in the collections of INBio and/or USNMNH. Species richness rose from 113 species recorded for the country as a whole to 247 species and morphospecies known from La Selva alone (Table 2). Only 11 of the La Selva species were previously recorded from Costa Rica. Even though most of the species from La Selva have only a morphospecies name, the first author believes that almost all of these are not conspecific with any of the species in the same genera previously recorded from Costa Rica. Adding records of additional species examined in collections but not known to occur at La Selva, the total for Costa Rica is about 350 species. The Total column of Table 2 indicates species abundance with a typical pattern for rich tropical faunas with a few common species and many “rare” species, represented by either a single (singleton) specimen or by 2 (doubleton) specimens. There were relatively few “abundant” species (more than 200 specimens captured): “Aphthona” robusta; Genaphthona transversicollis; Glenidion jacobyi (Bechyné); Heikertingerella DF-001; Hypolampsis DF001; and Neothona DF-001. It is perhaps not surprising that two of these belong to the two most diverse Neotropical genera of Alticinae Heikertingerella and Hypolampsis (Furth, unpublished), and many species were represented by relatively few specimens. Of the 74 species that can be considered as “rare”: 26 species were represented by singletons (uniques) and 48 species by doubletons. Fig. 4 demonstrates the situation of the rare and very rare species (doubletons and uniques, respectively). The doubletons continue to increase slightly and the uniques decline slightly with increased sampling. It is also interesting that the total of singletons is continually higher than that for doubletons. Until the host plant relationships of the Alticinae of La Selva are better understood or until host plant testing of the species is conducted along with the sampling, especially for canopy fogging, it will be difficult to discern the cause or reasons for the rare and very rare species there. As demonstrated by this and other surveys, rare species are a

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

9

Table 1. Genera of Alticinae currently known from Costa Rica. This list was compiled from previous literature records (Furth and Savini, 1996, 1998 and included references), the ALAS quantitative sampling program, additional hand collecting by the senior author and others, and additional examination of museum collections at INBio and USNMNH. An “x” in the La Selva column indicates genera known from La Selva. An “x” in the Costa Rica column indicates genera known from Central America but newly reported for Costa Rica. An “x” in the Central America column indicates genera known from the Americas but newly reported for Central America. An “x” in the New Genus column indicates genera new to science. A number of genera (e.g., Ayalaia, Chalatenanganya, etc.) have no “x” indication in any of the columns, this is because these genera have been recorded in the literature as being from Costa Rica, but were not found in this study of La Selva. * “Aphthona” is not considered as a separate genus because it actually belongs to another genus of the Aphthonini (sensu Bechyné) included here. Genus Acallepitrix Acanthonycha Acrocyum Alagoasa Allochroma Andiroba “Aphthona”* Asphaera Ayalaia Bellacincta Blepharida Brasilaphthona Cacoscelis Calipeges Calliphron Centralaphthona Cerichrestus Chaetocnema Chalatenanganya Chaparena Coroicona Cyrsylus Dinaltica Diphaltica Diphaulaca Disonycha Distigmoptera Egleraltica Epitrix Epitrix A Euphenges Exartematopus Exoceras Genaphthona Gioia Glenidion

La Selva

Costa Rica

x x

x

Central America

New Genus

x x x x x x

x

x

x

x

x

x x x x x x x x

x x x x x x x

x x x x x x x x x

x x x x

10

David G. Furth, John T. Longino & Maylin Paniagua

Table 1. Continued. Genus Heikertingerella Heikertingeria Homotyphus Hydmosyne Hylodromus Hypolampsis Lacpatica Leptophysa Longitarsus Loxoprosopus Lupraea Macrohaltica Margaridisa Megasus Megistops Mesodera Monomacra Monoplatini Monotalla-like Nasigona Neodiphaulaca Neosphaeroderma Neothona Notozona Octogonotes Omophoita Palmaraltica Panchrestus Paralacticoides Parasyphraea Parchicola Pedilia Phenrica Phylacticus Physimerus Platiprosopus Plectotetra Pseudogona Ptocadica Resistenciana Rhinotmetus Roicus Sparnus Sphaeronychus Stegnea Stenophyma Strabala

La Selva x x x x x x x x

Costa Rica

Central America

New Genus

x x x x x x x x

x x x x x x x x x x x

x x x x x x

x x x

x x

x x x x x x x

x x x x

x x x x x x x x

x x x x x x

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

11

Table 1. Continued. Genus Styrepitrix Syphrea Systena Tetragonotes Trichaltica Varicoxa Walterianella Total Genera Grand Total: 89

La Selva

Costa Rica

x x x x x x x 68

x

Central America

New Genus

10

3

x 33

Table 2. Alticine species known from La Selva Biological Station. Trap bias (“M” for Malaise traps, “F” for canopy fogging) was examined with a binomial test for each species, with the binomial probability equal to the proportion of all individuals across all species in canopy fogging samples (0.41). * = p<0.05, ** = p<0.01, *** = p<0.001. “Other” indicates species captured by methods other than Malaise traps and fogging, including hand collecting by the senior author. Species Acallepitrix DF-001 Acallepitrix DF-002 Acanthonycha DF-001 Acanthonycha DF-002 Acanthonycha DF-003 Alagoasa DF-001 Alagoasa DF-002 Alagoasa DF-003 Alagoasa DF-004 Alagoasa gemmata (Jac.) Alagoasa montana (Jac.) Allochroma basalis (Jac.) Allochroma DF-001 Allochroma DF-002 Allochroma DF-004 Allochroma DF-005 Allochroma DF-006 Allochroma DF-007 Allochroma DF-008 Allochroma guatemalensis Jac. near Andiroba DF-001 Andiroba DF-001A Andiroba DF-002 Andiroba DF-003 Andiroba DF-004 “Aphthona robusta “ (Jac.) Asphaera DF-001 Asphaera DF-002

Fogging

Malaise

Total

1 0 2 0 0 0 0 2 0 0 44 1 19 0 8 0 7 0 1 7 0 0 0 0 0 36 8 0

5 2 3 1 0 0 5 0 0 0 101 12 1 11 0 1 0 1 0 0 141 10 14 9 50 165 3 0

6 2 5 1 0 0 5 2 0 0 145 13 20 11 8 1 7 1 1 7 141 10 14 9 50 201 11 0

Trap Bias

Other + +

M** M** F*** M** F***

+ + + + + + + + + +

F** F** M*** M** M*** M** M*** M*** F*

+ + + + + +

12

David G. Furth, John T. Longino & Maylin Paniagua

Table 2. Continued. Species Asphaera DF-003 Asphaera DF-004 Asphaera DF-005 Asphaera nobilitata (Fab.) Asphaera reichei (Har.) Bellacincta clarki (Jac.) Brasilaphthona DF-001 Brasilaphthona DF-002 Brasilaphthona DF-003 Brasilaphthona DF-004 Brasilaphthona DF-005 Brasilaphthona DF-006 Brasilaphthona DF-007 Brasilaphthona palpalis (Jac.) (?) Calipeges DF-001 Centralaphthona DF-001 Centralaphthona DF-002 Centralaphthona DF-003 Cerichrestus clarki Jac. Cerichrestus DF-001 Cerichrestus DF-002 Cerichrestus DF-003 Cerichrestus DF-004 Chaetocnema DF-001 Chaetocnema DF-002 Chaetocnema DF-003 Chaetocnema DF-004 Chaetocnema DF-005 Chaetocnema DF-006 Chaetocnema DF-007 Coroicona DF-001 Cyrsylus DF-002 Cyrsylus DF-003 Cyrsylus recticollis Jac. (?) Dinaltica DF-001 Dinaltica DF-002 Diphaltica DF-001 Disonycha DF-001 Disonycha trifasciata Clark Egleraltica DF-001 Epitrix DF-001 Epitrix DF-002 Epitrix DF-003 Epitrix DF-004 Epitrix DF-005 Epitrix DF-006 Epitrix DF-007

Fogging

Malaise

Total

0 0 1 14 0 17 0 0 0 3 0 3 3 0 3 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 92 0 0 0 93 0 0 0 0 14 1 0 0 0 0 0 0

4 1 0 147 3 21 17 17 0 0 4 3 17 1 1 1 2 1 14 14 1 7 2 6 1 1 1 1 0 0 15 9 11 25 36 62 17 0 0 7 4 1 0 2 0 1 0

4 1 1 161 3 38 17 17 0 3 4 6 20 1 4 1 3 1 14 14 1 7 2 6 2 1 1 1 0 0 107 9 11 25 129 62 17 0 0 21 5 1 0 2 0 1 0

Trap Bias

Other

M***

+ + +

M*** M***

+ + +

M* + +

M*** M***

+ +

M* M*

+ + + + + +

F*** M** M** M*** F*** M*** M***

+ + + + + +

F* + + + + + +

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

13

Table 2. Continued. Species EpitrixA DF-001 EpitrixA DF-002 EpitrixA DF-003 EpitrixA DF-004 Exartematopus DF-002 Exoceras DF-001 Exoceras DF-002 Exoceras DF-003 Exoceras DF-004 Exoceras DF-005 Genaphthona DF-001 Genaphthona transversicollis (Jac.) near Gioia DF-001 Glenidion jacobyi (Bech.) Heikertingerella DF-001 Heikertingerella DF-002 Heikertingerella DF-003 Heikertingerella DF-004 Heikertingerella DF-005 Heikertingerella DF-006 Heikertingerella DF-007 Heikertingerella DF-008 Heikertingerella DF-009 (?) Heikertingerella DF-010 Heikertingerella DF-011 Heikertingerella DF-012 Heikertingerella DF-013 Heikertingerella DF-014 Heikertingerella DF-015 Heikertingerella DF-016 Heikertingerella DF-017 Heikertingerella DF-018 Heikertingerella DF-019 Heikertingerella DF-020 Heikertingerella DF-021 Heikertingerella DF-022 Heikertingerella marini Bech.& Bech. Heikertingeria DF-001 Heikertingeria DF-002 Heikertingeria DF-003 Homotyphus DF-001 Homotyphus DF-002 Homotyphus DF-003 Homotyphus DF-004 Homotyphus DF-005 Homotyphus DF-006 Homotyphus DF-007

Fogging

Malaise

Total

15 0 0 0 0 2 0 0 3 0 14 0 3 216 203 3 9 0 2 0 15 2 0 109 44 57 0 1 7 13 1 0 4 0 0 1 0 0 1 2 0 12 0 0 0 1 0

15 17 3 14 2 73 45 15 5 1 92 213 10 116 233 7 3 1 0 1 78 15 0 35 26 16 4 9 14 1 0 2 1 0 1 0 6 8 7 1 0 0 4 2 2 0 2

30 17 3 14 2 75 45 15 8 1 106 213 13 332 436 10 12 1 2 1 93 17 0 144 70 73 4 10 21 14 1 2 5 0 1 1 6 8 8 3 0 12 4 2 2 1 2

Trap Bias

Other

M***

+

M*** M*** M*** M***

+

M*** M*** F*** F*

+ +

F*

M*** M**

+ +

F*** F*** F***

+

M* F***

+ M* M*

+ + +

F***

+

14

David G. Furth, John T. Longino & Maylin Paniagua

Table 2. Continued. Species Homotyphus DF-008 Hypolampsis DF-001 Hypolampsis DF-002 Hypolampsis DF-003 Hypolampsis DF-004 Hypolampsis DF-005 Hypolampsis DF-006 Hypolampsis DF-007 Hypolampsis DF-007A Hypolampsis DF-008 Hypolampsis DF-009 Hypolampsis DF-010 Hypolampsis DF-011 Hypolampsis DF-012 Hypolampsis DF-013 Hypolampsis DF-014 Hypolampsis DF-015 Hypolampsis DF-016 Hypolampsis DF-017 Leptophysa DF-001 Leptophysa DF-002 Longitarsus DF-001 Longitarsus DF-002 Longitarsus DF-003 Longitarsus DF-004 Loxoprosopus DF-001 Loxoprosopus DF-002 Lupraea DF-001 Lupraea DF-002 Lupraea DF-003 Lupraea DF-004 Lupraea DF-005 Lupraea DF-006 Lupraea DF-007 Lupraea DF-008 Lupraea DF-009 Lupraea DF-010 Lupraea DF-011 Lupraea subrugosa (Jac.) near Margaridisa DF-001 Margaridisa managua (Bech.) (?) Mesodera fulvicollis Jac. near Monomacra chontalensis (Jac.) Monomacra DF-001 Monomacra DF-002 Monomacra violacea (Jac.) Monoplatini new genus

Fogging

Malaise

Total

0 289 0 1 0 7 12 0 0 0 2 1 5 1 0 0 0 1 6 1 0 2 0 0 0 8 0 0 42 79 6 19 5 18 3 0 0 0 46 0 5 0 0 8 0 0 82

1 16 11 3 4 1 6 6 0 2 2 4 1 0 0 1 12 0 0 2 1 3 2 1 0 2 5 2 1 2 36 10 9 2 2 1 2 0 1 0 28 36 6 5 1 13 1

1 305 11 4 4 8 18 6 0 2 4 5 6 1 0 1 12 1 6 3 1 5 2 1 0 10 5 2 43 81 42 29 14 20 5 1 2 0 47 0 33 36 6 13 1 13 83

Trap Bias

Other

F*** M*

+

F** F* M*

+ + + +

+ + M** F** + + + F* + F*** F*** M*** F** F*** + F*** M*** M*** M* M*** F***

+ + + + + + + +

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

15

Table 2. Continued. Species Monotalla-like (near) DF-001 Monotalla-like (near) DF-002 Monotalla-like (near) DF-003 Nasigona DF-001 Neodiphaulaca zenda Bech.&Bech. (?) Neosphaeroderma coerulea (Jac.) Neothona DF-001 Notozona DF-001 Omophoita aequinoctialis (Linn.) Omophoita clerica (Erichs.) Palmaraltica DF-001 Panchrestus denticollis Blake Parasyphraea DF-001 (near minuta) Parasyphraea DF-002 Parasyphraea DF-003 Parasyphraea DF-004 Parasyphraea minuta (Jac.) Parchicola DF-001 Parchicola DF-002 Parchicola DF-003 Phenrica DF-001 Phenrica DF-002 Phenrica DF-003 Phylacticus major Jac. Phylacticus ustulatus Clark Physimerus DF-001 Platiprosopus DF-001 Platiprosopus DF-002 Plectotetra DF-001 Ptocadica bifasciata Jac. Ptocadica straminea Har. near Rhinotmetus DF-001 Rhinotmetus DF-002 Rhinotmetus DF-003 Rhinotmetus DF-004 Rhinotmetus DF-005 Roicus DF-001 (n.sp.) Roicus DF-002 (n.sp.) Sparnus apicalis Jac. (n.sp.) near Sparnus chiriquiensis Jac. (?) Sparnus DF-001 Sparnus DF-002 Sparnus DF-003 Sparnus DF-004 Sparnus flavicollis Jac. Sphaeronychus DF-001 Sphaeronychus DF-002

Fogging

Malaise

Total

Trap Bias

Other

23 2 0 0 0 0 185 4 3 5 0 4 7 17 4 14 3 1 0 0 0 0 0 1 2 6 7 0 0 0 0 0 0 0 1 6 0 0 0 0 1 1 10 1 2 9 1

5 1 2 2 47 2 67 0 83 1 0 4 66 86 71 3 30 5 2 0 1 1 2 0 16 4 0 1 2 9 9 0 1 6 12 4 2 0 1 1 0 0 0 0 0 3 7

28 3 2 2 47 2 252 4 86 6 0 8 73 103 75 17 33 6 2 0 1 1 2 1 18 10 7 1 2 9 9 0 1 6 13 10 2 0 1 1 1 1 10 1 2 12 8

F***

+ +

M*** + F*** F* M***

+ +

M*** M*** M*** F*** M***

M**

+ + + + + + + + +

F** M** M**

+ + +

M* M** + + +

F*** F*

16

David G. Furth, John T. Longino & Maylin Paniagua

Table 2. Continued. Species Sphaeronychus puncticollis (Jac.) near Stegnea DF-001 Stenophyma modesta Weise (?) Strabala subcostata (Jac.) Styrepitrix boqueronica Bech.&Bech. Syphrea DF-001 Syphrea DF-002 Syphrea DF-003 Syphrea DF-004 Syphrea DF-005 Syphrea DF-006 Syphrea DF-007 Syphrea DF-008 Syphrea DF-009 Systena DF-001 Systena DF-002 Tetragonotes DF-001 Trichaltica DF-001 Trichaltica variabilis (Jac.) Varicoxa clarki (Jac.) (?) Varicoxa minuta (Jac.) Varicoxa ustulata centralis Bech. Walterianella DF-001 Walterianella DF-002 Walterianella DF-003 Walterianella DF-004 Walterianella DF-005 Walterianella DF-006 Walterianella DF-007 Walterianella oculata (Fabr.) Walterianella tenuicincta (Jac.) Total Individuals Total Species Grand Total Species: 247

Fogging

Malaise

Total

Trap Bias

25 0 78 0 0 6 0 0 0 4 0 0 0 0 0 0 16 2 1 0 24 0 0 0 0 2 0 0 2 6 3 2260 112

7 13 4 0 62 14 15 0 11 5 1 2 2 3 5 2 3 2 36 0 67 36 0 0 0 1 2 2 0 10 0 3221 191

32 13 82 0 62 20 15 0 11 9 1 2 2 3 5 2 19 4 37 0 91 36 0 0 0 3 2 2 2 16 3 5481 216

F*** M*** F***

Other

+ M*** M***

+ + +

M** + + + + F*** M*** M** M***

+ + + + + + + +

114

significant part of rainforest ecology, albeit often difficult to study, and should be viewed as a potentially separate and informative aspect of the rainforest community for more targeted study (Novotny and Basset, 2000). The first author collected over 63 species in 1989 and 1995, ten of these were only collected then, they are represented in Table 2 by a +: Chaetocnema DF-006; Chaetocnema DF-007; Disonycha trifasciata Clark; Epitrix DF-007; Hypolampsis DF-007A; Longitarsus DF-004; Lupraea DF-011; Margaridisa DF-001; Parchicola DF-003; and Strabala subcostata (Jacoby). The abundance distribution for alticines at La Selva clearly reveals a mode at the fourth octave (Fig. 1). However it does not appear symmetrically lognormal. There is an overabundance of rare species in the lowest octave, resulting in a secondary peak.

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

17

Figure 1. Abundance distribution for quantitative sampling of alticine diversity at La Selva Biological Station. Abundances are based on total number of individuals summed across fogging and Malaise samples. Octave assignment follows Preston (1948, see also Longino et al., 2002), in which abundance classes or “octaves” have boundaries 0.5, 1, 2, 4, 8, etc. If a species falls on a boundary, then its abundance is evenly split between the two adjacent octaves, adding 0.5 to each one. The first visible octave is 1–2, which contains one half the singletons plus one half the doubletons (the other half of the singletons necessarily ignored).

The 670 Malaise samples yielded 3221 specimens and the 29 canopy fogging samples yielded 2260 specimens (Table 2). Based on binomial tests, of the 216 species collected in the Malaise trapping and canopy fogging program, 60 show a bias toward Malaise traps and 37 show a bias toward canopy fogging (Table 2). Canopy fogging is far more productive than Malaise traps on a per sample basis, but the reverse is true on a per individual basis (Fig. 2). Combining the two methods does not improve inventory efficiency in either case (Fig. 2). The average number of species captured per canopy fogging event was 17.7 (range 8 to 33). There was no significant difference in number of species among fogging treatments (Pentaclethra macroloba, Virola koschnyi, “other”). The smallest number of individuals in any canopy fogging event was 21. When all fogging events were rarified to 21 individuals, the average number of species was 9.4 (range 4.0 to 13.8) and there continued to be no significant treatment effect. The three fogging treatments did not differ in species accumulation rate based on number of samples (Fig. 3). However, the diverse treatment was more efficient than the two monospecific treatments when based on number of individuals (Fig. 3). The overall species accumulation curve for the combined Malaise and fogging samples shows no sign of approaching a plateau (Fig. 4). It appears more logarithmic than asymptotic. Richness estimates based on Michaelis Menton and ACE also are not asymptotic. For the full dataset, the two estimators

18

David G. Furth, John T. Longino & Maylin Paniagua

Figure 2. Sample-based rarefaction curves for the Alticinae of La Selva, based on (A) number of samples and (B ) number of individuals. On a per sample basis there is relatively little difference in efficiency of Malaise traps versus canopy fogging, and the combination of methods is not more productive than single methods. Malaise trapping is far more productive than canopy fogging when based on number of individuals.

are 10 and 15% above the observed richness, respectively. When the final richness estimates are compared to the total known fauna of 247 species, which includes some species collected by other methods and not collected by Malaise or fogging, Michaelis Menten underestimates richness and ACE hits it almost exactly. The singleton curve was beginning to decline.

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

19

Figure 3. Sample-based rarefaction curves for alticinae in canopy fogging samples, broken down by three fogging treatments, based on (A) number of samples and (B) number of individuals.

DISCUSSION This study dramatically increased the known diversity of Costa Rican Alticinae. The number of genera increased from 43 to 89, and the number of species from 112 to about 350. Given that most of this increase was due to an intensive survey at a single site, it is evident that there will be many more genera and species discovered when similar or even less intensive inventory projects are conducted elsewhere in Costa Rica. This will be especially true if fieldwork, including various collecting methods, is conducted in other ecological zones (e.g. Pacific lowland rain forests, montaine cloud

20

David G. Furth, John T. Longino & Maylin Paniagua

Figure 4. Species richness estimates of Alticinae at La Selva, based on combined Malaise and canopy fogging samples. Known species richness includes species collected by other methods.

forests, dry forests, etc.). Additional new records for Costa Rica will also certainly be generated from more comprehensive examination of various institutional historical collections. Therefore, although there is no completely accurate way to predict or estimate the actual number of Alticinae in Costa Rica, the first author predicts that there are approximately 1000 species of Alticinae present in Costa Rica. This also means that the estimate by Flowers (1995, in litt.) of 2000 species of Chrysomelidae is probably too low. The fact that this survey for one site so dramatically increased the known diversity of Costa Rica, combined with the fact that we know nothing about faunal turnover with distance, reveals that we are still largely ignorant of the magnitude of tropical alticine diversity, and that we have just scratched the surface in our attempts to know it. The quantitative results for the intensive La Selva survey revealed a diverse community. The abundance distribution was similar to a lognormal, with a well-revealed mode, but with an overabundance of rare species generating a secondary mode in the lowest abundance class. This distribution was reminiscent of the heuristic model proposed in Longino and Colwell (1997), in which observed distributions are a result of two overlapping distributions, one a roughly lognormal distribution comprised of the local or resident community, and one a unimodal distribution with the mode at the lowest abundance class, comprised of a large pool of vagrant or “tourist” species. The distribution also matches the new zero sum multinomial distribution of Hubbell (2001), a neutral model of community composition that relies on explicit demographic and speciation

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

21

mechanisms, but not on competitive interactions among species or niche partitioning. As demonstrated by this and other surveys, rare species are a significant part of rainforest ecology, albeit often difficult to study, and should be viewed as a potentially separate and informative aspect of the rainforest community for more targeted study (Novotny and Basset, 2000, Wagner, 2000). The survey revealed that Malaise trapping and canopy fogging differed in efficiency, with Malaise traps being more efficient on a per individual basis and fogging being more efficient on a per sample basis. About 140 2-week Malaise samples were required to yield the same number of species as the 29 canopy fogging samples. Canopy fogging often generated large numbers of a few common species, which resulted in a lower efficiency on a per individual basis. Also, although individual species often showed a greater abundance in one method versus the other, it was usually a matter of relative abundance differences rather than presence/absence differences. There was little evidence for a unique high canopy fauna only obtained by fogging. If anything, more species showed a greater abundance near ground level than in the canopy. Thus, combining methods did not improve the rate of species capture relative to single methods. Longino et al. (2002) found a similar redundancy of Malaise traps and fogging when examining the same samples for ants. This suggests that alticine sampling does not require both methods, and that one method can be selected. Individual projects can weigh the relative cost of field sampling, comparing the cost of obtain a set of fogging samples to the cost of Malaise samples. An advantage of canopy fogging is that it can be done rapidly, whereas Malaise trapping requires either time or a large number of traps. An advantage of Malaise trapping is that it is logistically easier and can be more easily carried out at remote sites. This result is contradictory to the popular notion that the rainforest canopy is a reservoir of abundant and largely unexplored biodiversity, and that canopy fogging is the best way to sample it. We may find that for hyperdiverse herbivorous groups such as alticines, only a small proportion of the community is comprised of high canopy specialists, and a larger fraction of the community is found in low herbaceous vegetation, early successional stages, forest edges, river margins, treefall gaps, and landslides. The ALAS fogging program was structured to investigate the effect of tree species on fogging efficiency. The expectation was that if there were some degree of host specificity among arthropods, then fogging multiple species of trees would produce more species than fogging single species of trees. The results for ants revealed no or little effect of tree species (Longino and Colwell, 1997, Longino et al., 2002), but since most ants are not phytophagous such a result was expected. This survey of Alticinae is the first to examine a phytophagous group. Thus it was somewhat of a surprise to find relatively little tree species effect. It is obvious from the biology of alticines that there are all degrees of host specificity, and this has been quantified recently in studies that include feeding trials (Novotny and Basset, 2000), even if within large or related plant genera as for other tropical chrysomelids (Novotny et al., 2002). It may be that the complexity of individual tree crowns masks any tree species effect. Fairly large-scale canopy fogging as carried out here captures arthropods from a column of fogged vegetation. Although that column contains primarily the crown of the focal tree, it also contains the edges of adjacent crowns, lianas in the focal tree, and countless species of epiphytes. What has not been thoroughly investigated in this study, is whether additional methods such as sweep-net sampling and beating would improve inventory efficiency and to what degree collecting by taxonomic specialists would improve the rate of species capture. It was clear from the studies of ant diversity (Longino and Colwell, 1997, Longino et al., 2002) that specialist collecting is very efficient and contributes greatly to inventory work, and similar results are to be expected for any

22

David G. Furth, John T. Longino & Maylin Paniagua

taxonomic group, including alticines. The process of specialist collecting as well as expert identification of specimens from institutional collections and field surveys could be accomplished much faster and more effectively if there were resources available to train and employ additional specialists, especially in the countries with high biological diversity. ACKNOWLEDGMENTS This work has been supported by National Science Foundation grants BSR-9025024, DEB9401069, DEB-9706976, and DEB-0072702. We thank E. O. Wilson and P. Perkins (Harvard University) for the long-term loan of the F. C. Bowditch Collection, which enabled the first author to reliably compare and determine many of the ALAS specimens. The following individuals also provided access to additional specimens: Charles Staines and Richard White (USNMNH); R. Wills Flowers (Florida A. & M. University); Angel Solis (INBio); Julian Donahue (Los Angeles County Museum of Natural History). LITERATURE CITED Adis, J., Y. Lubin, and G. G. Montgomery 1984. Arthropods from the canopy of inundated and terra firme forests near Manaus, Brazil, with critical considerations on the pyrethrum-fogging technique. Studies Neotropical Fauna Envir. 19:223-236. Chazdon, R. L., R. K. Colwell, J. S. Denslow, and M. R. Guariguata 1998. Statistical methods for estimating species richness of woody regeneration in primary and secondary rain forests of northeastern Costa Rica, pp. 285-309. In: F. Dallmeier and J. A. Comiskey (Eds.), Forest Biodiversity Research, Monitoring and Modeling: Conceptual Background and Old World Case Studies. Parthenon Publishing, Paris, France. Colwell, R. K. 1996. Biota: The Biodiversity Database Manager. Sinauer Associates. Sunderland, Massachusetts. Colwell, R. K. and J. A. Coddington 1994. Estimating terrestrial biodiversity through extrapolation. Phil. Trans. R. Soc. Lond. B 345:101-118. Duckett, C. and S. Moyá 1999. A new species of Ptocadica Harold (Coleoptera: Chrysomelidae: Alticini) from Costa Rica and Panama. Coleopt. Bull. 53(4):311-319. Erwin, T. L. 1982. Tropical forests: Their richness in Coleoptera and other arthropod species. Coleopt. Bull. 36:74-75. Erwin, T. L. 1983. Beetles and other insects of tropical forest canopies at Manaus, Brazil, sampled by insecticidal fogging, pp. 59-75. In: S. L. Sutton, T. C. Whitmore, A. C. Chadwick (Eds.), Tropical rain forest: Ecology and management. Blackwell Scientific, Oxford, UK. Erwin, T. L. 1991. How many species are there?: Revisited. Conservation Biol. 5:330-333. Farrell, B. D. and T. L. Erwin 1988. Leaf-beetle community structure in an amazonian rainforest canopy, pp. 73-90. In: P. Jolivet, E. Petitpierre, T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publisher, Dordrecht. Furth, D. G. 1998. New World Blepharida Chevrolat, 1836 (Coleoptera: Chrysomelidae: Alticinae). Mem. Ent. Soc. Wash. No. 21:1-109. Furth, D. G. and V. Savini 1996. Checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 10(1-4): 45-67. Furth, D. G. and V. Savini 1998. Corrections, clarifications, and additions to the 1996 checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 12(1-2):133-138.

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

23

Gamez, R. 1991. Biodiversity conservation through facilitation of its sustainable use: Costa Rica’s National Biodiversity Institute. Trends Ecol. Evol. 6:377-378. Gaston, K. 1991. The magnitude of global insect species richness. Conservation Biol. 5(3):283-296. Gotelli, N. and R. K. Colwell 2001. Quantifying biodiversity: Procedures and pitfalls in the measurement and comparison of species richness. Ecology Letters 4:379-391. Heikertinger, F. and E. Csiki 1939-1940. Chrysomelidae, Halticinae. Coleopterorum Catalogus. Volume XXV, Pars 166, pp. 1-336, Pars 169. pp. 337-635. Uitgeverij Dr. W. Junk, Gravenhage. Hubbell, S. P. 2001. The unified neutral theory of biodiversity and biogeography. Princeton, New Jersey, USA, Princeton University Press. Janzen, D. H. 1991. How to save tropical biodiversity. Amer. Ent. 37:159-171. Jacoby, M. (1885-1892). Biologia Centrali-Americana, Insecta, Coleoptera, Galerucidae. Halticinae. Phytophaga 6(1):263-625. Supplement to Phytophaga 6(1):1-374. Kremen, C., R. K. Colwell, T. L. Erwin, D. D. Murphy, R. F. Noss and M. A. Sanjayan 1993. Terrestrial arthropod assemblages: Their use in conservation planning. Conservation Biol. 7(4):796-808. Longino, J. T. 1994. How to measure arthropod diversity in a tropical rainforest. Biology International 28:3-13. Longino, J. T. and R. K. Colwell. 1997. Biodiversity assessment using structured inventory: Capturing the ant fauna of a lowland tropical rainforest. Ecological Applications 7:1263-1277. Longino, J. T., R. K. Colwell and J. A. Coddington 2002. The ant fauna of a tropical rainforest: Estimating species richness three different ways. Ecology 83:689-702. McDade, L. A., K. S. Bawa, H. A. Hespenheide, G. S. Hartshorn (Eds.). 1993. La Selva, ecology and natural history of a Neotropical rainforest. University of Chicago Press, Illinois, USA. Novotny, V. and Y. Basset 2000. Rare species in communities of tropical insect herbivores: Pondering the mystery of singletons. Oikos 89:564-572. Novotny, V., Y. Basset, S. E. Miller, G. D. Weiblen, B. Bremer, L. Cizek, and P. Drozd 2002. Low host specificity of herbivorous insects in a tropical forest. Nature 416:841-844. Preston, F. W. 1948. The commonness, and rarity, of species. Ecology 29:254–283. Savini, V. 1999. El género Heikertingerella Csiki (Coleoptera:Chrysomelidae: Altcicinae) en Venezuela. Bol. Ent. Venezolana 14(2):95-190. Savini, V. and D. G. Furth 2001. The status of Heikertingerella, Monotalla, Pseudodibolia, and Sphaeroderma (Coleoptera: Chrysomelidae: Alticinae) in the New World. Proc. Ent. Soc. Wash. 103(4):903-912. Scherer, G. 1962. Bestimmungsschlüssel der neotropischen Alticinen-Genera (Coleoptera: Chrysomelidae: Alticinae). Ent. Arbeiten Museum G. Frey 13(2): 497-607. Seeno, T. N. and J. A. Wilcox 1982. Leaf beetle genera (Coleoptera: Chrysomelidae). Entomography 1:1-221. Soberón M., J. and J. Llorente B. 1993. The use of species accumulation functions for the prediction of species richness. Conservation Biol. 7:480-488. Stork, N. E. 1988. Insect diversity: Facts, fiction, and speculation. Biol. J. Linnaean Soc. 35:321-337. Wagner, T. 2000. Influence of forest type and tree species on canopy-dwelling beetles in Budongo Forest, Uganda. Biotropica 32(30):502-514. Wilcox, J. A. 1975. Checklist of the beetles of Canada, United States, Mexico, Central America and the West Indies. The Leaf Beetles (Red Version). North American Beetle Fauna Project 1(7):1-166.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT LeafPublishers Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats 25 Special Topics in Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 25-51

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats R. Wills Flowers1 and Paul E. Hanson2 Center for Biological Control, Florida A.& M. University, Tallahassee FL, 32307. E-mail: [email protected] 2 Escuela de Biología, Universidad de Costa Rica, San Pedro Montes de Oca, Costa Rica 1

ABSTRACT Species richness and community structure of the Chrysomelidae in Malaise trap samples from eight sites between central and southern Costa Rica were analyzed. Estimates of species richness and Coleman richness curves were calculated. The chrysomelid community at La Selva was shown to be significantly more diverse than any of the other sites. Three experimental metrics, similar to those routinely used in aquatic biological monitoring, were derived from the community data. All three separated a highly altered site from other sites with similar altitudes and vegetation structure.

INTRODUCTION Recent studies on insect biodiversity, driven in part by the realization that many natural communities may not be around much longer to study, have been evolving from basic inquiries into species richness to more applied goals of using insects to assist in conservation decisions. Not surprisingly, much interest has focused on tropical insect biodiversity. Sampling programs have focused on beetles (Erwin 1982, Stork 1997), moths (Pogue 1999, Solis and Pogue 1999), Homoptera (McKamey 1999), and weevils (Wolda et al. 1998). Less numerous but equally important are diversity studies of temperate insect communities, examples of which are works on litter beetles (Carlton and Robison 1998), soil arthropods of Redwood forests (Hoekstra et al. 1995), and Ichneumonidae (Hymenoptera) (Skillen et al. 2000). Although leaf beetles (Chrysomelidae) in the tropics are almost always collected by both general collectors and inventory studies, there have been as yet few studies of their diversity in tropical ecosystems. This has been due to the huge diversity of the family – 37,000 described species (Klausnitzer 1981) and possibly up to 60,000 species (Reid 1995). Although Farrell and Erwin (1988) were among the first to report on the diversity of tropical forest canopy chrysomelids based on their work in the Western Amazon, it has been in the Old World where more detailed studies of tropical canopy Chrysomelidae from New Guinea (Basset and Samuelson 1996) and Central Africa (Wagner 1999) have been accomplished. Since Chrysomelidae are easily collected, readily noticed by the non-specialist (if only as “that mess of shiny little flea beetles we get in all our samples”), and a

26

R. Wills Flowers & Paul E. Hanson

major component of tropical herbivore guilds (Basset and Samuelson 1996, Farrell and Erwin 1988), continued avoidance of this family by most tropical ecologists postpones the emergence of any true understanding of insect communities or plant-herbivore interactions. For Neotropical Chrysomelidae, reliable identification keys to genera are still lacking for genera of some of the largest and most ubiquitous subfamilies. Despite this very real taxonomic impediment, the national biological inventory efforts in Costa Rica have advanced systematic knowledge (or at least reduced its uncertainty) to the point where coarse-grained analyses of entire chrysomelid communities are possible. Simultaneously, inventory efforts have resulted in analyzable samples of insect communities in which the Chrysomelidae are important components. One such inventory effort is the “Malaise network”, set up by the junior author and hymenopterists of The Natural History Museum (Great Britain), which has been active in various forms since 1984 (Hanson 1995). This inventory is being conducted with Malaise traps at various localities in Costa Rica, encompassing a broad spectrum of vegetation types and altitudes. This paper reports in the chrysomelid communities collected from eight localities ranging from central Costa Rica to its the Osa Peninsula and from sea level to 3000m. MATERIALS AND METHODS Trap Sites All Chrysomelidae specimens came from general Malaise trap samples which in most cases represent a bottle run of between one and two months (although consistency of sampling was sometimes marred by random events such as animal damage, windstorms, and occasional delays in changing bottles due to bad weather). Traps were sited to maximize catches of Hymenoptera, which means that most traps were located at forest edges. To minimize vandalism and theft, seven of the traps were located on private farms, whose owners were paid to look after the traps and change the collecting bottles (Hanson 1995). Trap samples were processed as described by Hanson (1995). The sites treated in this paper are shown in Fig. 1, and listed below in roughly north-south order: HEREDIA, Estación Biológia La Selva, 3 km S Puerto Viejo, 100 m, 10°26´N, 84°01´W. April 1992–April 1993; 8 samples. SAN JOSE, Zurqui de Moravia, 1600 m, 10°03´03"N, 84°00´22"W. On the main highway east from San Jose to Limón, just before entering Braulio Carillo National Park behind the restaurant “La Fonda”, on the edge of, and overlooking, a cloud forest rich in epiphytes. June 1990–Aug. 1995; 26 samples. CARTAGO, 4 km NE Cañon, Genesis II, 2350 m, 09°42–43´N, 83°54–55´W; Steve and Paula Friedman. January 1995–April 1996; 7 samples. SAN JOSE, Cerro de la Muerte, 19 km S and 3 km W of Empalme, 2600 m, 09°39´N, 83°52´W. The trap was placed under a young oak tree in a pasture approx. 10 m from the edge of cloud forest. March 1990–June 1993; 8 samples. SAN JOSE, 6 km N of San Gerardo, 2800 m. On a steep slope, at the edge of primary oak forest. 9°36´N, 83° 48´W April 1992–April 1993; 6 samples. CARTAGO, Cerro de la Muerte, Villa Mills, 3000 m, 09°34´N, 83°44´W. Located behind the restaurant “La Georgina”, in slightly altered oak forest with bamboo understory. July 1990–December 1991; 3 samples.

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

27

Fig. 1. Map of Costa Rica, showing locations of Malaise trap sites.

PUNTARENAS, Reserva Forestal Golfo Dulce, 24 km W of Piedras Blancas, 200 m, 08°46´N, 83°24´W, at the very edge of primary lowland forest. November 1990–February 1993; 17 samples. PUNTARENAS, Peninsula Osa, Puerto Jimenez, 10 m, 08°32´N, 83°19´W. Just before arriving at the first intersection in Puerto Jimenez is the house of Carlos Luis Madrigal (ex bicycle repairman). The trap is located in full sun, in a grassy, totally trashed site, with weedy bushes and trees nearby. November 1990–April 1993; 11 samples. Data Analysis Chrysomelidae collected in this study were separated from the Malaise samples at the University of Costa Rica by the junior author and his students. The specimens were then mounted and identified to genus and then further separated into morphospecies by the senior author with the

28

R. Wills Flowers & Paul E. Hanson

assistance of the following specialists: Shawn M. Clark (State of West Virginia Department of Agriculture, Galerucinae: Galerucini); David G. Furth (United States National Museum, Galerucinae: Alticini); and Charles L. Staines (United States National Museum, Hispinae: Hispini). Vouchers of all species and morphospecies are deposited in the collections of the University of Costa Rica, the Instituto Nacional de Biodiversidad (Costa Rica), the Florida State Collection of Arthropods (Gainesville, Florida) and the United States National Museum of Natural History (Washington, DC). Data was analyzed using EstimateS (Colwell 1997) to generate estimators of species richness and calculate diversity indices. This program generates a species accumulation curve from observed data (Sobs) and the following estimators of species richness: abundance based coverage (ACE), incidence based coverage (ICE), Chao1, Chao2, first order Jackknife (Jack1), second-order Jackknife (Jack2), bootstrap, Coleman richness expectation, Michaelis-Menten averaged over randomizations (MMRuns), and Michaelis-Menten computed once for mean species accumulation curve (MMMean). Data were calculated using 100 randomizations. For all sites, relative proportions of subfamilies and major tribes of leaf beetles were calculated, and for all morphospecies in which at least fifteen individuals were collected, seasonal occurrence data was plotted. RESULTS A total of 6753 chrysomelids belonging to 512 morphospecies was collected by the eight traps in this study. Table I shows numbers of individuals, morphospecies, alpha diversity, range of estimated species numbers, and most common morphospecies for each of the eight trap sites. The highest number of observed species was found in La Selva (near still intact lowland rain forest), followed by Zurqui (submontane forest) and Piedras Blancas (fragmented lowland rainforest). Sites at high altitudes in Cerro de la Muerte had much lower species richness. In five of the eight sites, the most common chrysomelid was a flea beetle; in two of these (all at high altitude) the flea beetle was a flightless species of Longitarsus in which hind wings are completely absent. Community composition by subfamilies/major tribes for each site is shown in Fig. 2. In all sites the dominant tribe or subfamily was Alticini, and this dominance became more pronounced as the Table I. Malaise trap catches of Chrysomelidae. Sites are listed in order from north to south. Abbreviations: Alt., altitude in meters; Nind, number of individuals; Sobs, observed species in all samples at a site; ST, theoretical species numbers (from maximum and minimum accumulation curves; Alpha, alpha diversity, Most common species, most abundant species in Malaise samples at a site. Site La Selva Zurqui Genesis II San Gerardo Empalme Villa Mills Piedras Blancas Pto Jimenez

Alt. (m)

NIND

Sobs

ST

75 1600 2350 2800 2600 3000 200 10

678 2198 958 632 647 280 902 430

120 114 78 19 40 24 104 68

165-234 129-157 90-169 24-31 47-67 27-47 130-188 81-119

Alpha

Most common species

42.37 Metrioidea sp. 7 (Galerucini) 29.4 Brachypnoea atra Har.(Eumolpinae) 20.06 Acalymma subaeneum Jac.(Galerucini) 3.92 Longitarsus sp. 7 (Alticini) 12.15 Syphraea sp. 2 (Alticini) 6.28 Longitarsus sp. 7 (Alticini) 30.39 Omophoita simulans Jac.(Alticini) 22.75 Longitarsus sp. 5 (Alticini)

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

29

Fig. 2. Community structure of Chrysomelidae taken in Malaise traps at eight Costa Rican sites, shown as percentages of individuals. a, Zurqui; b, La Selva;c, Genesis II; d, Empalme; e, San Gerardo; f, Villa Mills; g, Piedras Blancas; h, Puerto Jimenez. , Alticini; , Galerucini; , Eumolpinae;

, Criocerinae;

, Cryptocephalinae;

, Cassidini;

, Hispini. Taxa present at 1% or less not shown.

altitude increased. Since most of the traps were set in agricultural areas near forest, it was not possible to draw many conclusions about the effect of land use on chrysomelid communities. However, the two Pacific lowland sites consist of a site next to primary forest (Piedras Blancas) and a site in a completely altered agricultural-small town area; both originally were covered with the same type of primary forest. The communities differ principally in that the altered site (Puerto Jimenez) had fewer alticines and more eumolpines that the primary forest site. Species discovery curves showing the observed species and the estimators that produced the highest and lowest estimates for each site are shown in Figs. 3–9. Data for Villa Mills is not shown because of the small number of samples taken from this site. Only for the Zurqui site (27 samples) does the observed species line begin curving toward an asymptote. The bootstrap consistently produced the most conservative estimates, while the highest estimator varied from site to site. Coleman curves for all sites except Villa Mills are shown in Fig. 10. These curves allow comparison between sites despite the inconsistencies in sampling effort. Colman curves show La Selva to be the most species rich site by a considerable degree. Genesis II, Piedras Blancas, and Zurqui form a group of sites with similar species richness, while Puerto Jimenez, Empalme and San Gerardo have decreasing species richness.

30

R. Wills Flowers & Paul E. Hanson

Fig. 3. Species accumulation curve and maximum and minimum richness estimators for La Selva. Sobs, observed species numbers; ICE, incidence based coverage.

Fig. 4. Species accumulation curve and maximum and minimum richness estimators for Zurqui. Sobs, observed species numbers; MMMeans, Michaelis-Menten computed once for mean species accumulation curve; Jack 2, second order Jacknife.

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

31

Fig. 5. Species accumulation curve and maximum and minimum richness estimators for Genesis II. Sobs, observed species numbers.

Fig. 6. Species accumulation curve and maximum and minimum richness estimators for Empalme. Sobs, observed species numbers; ICE, incidence based coverage.

32

R. Wills Flowers & Paul E. Hanson

Fig. 7. Species accumulation curve and maximum and minimum richness estimators for San Gerardo. Sobs, observed species numbers; ICE, incidence based coverage.

Fig. 8. Species accumulation curve and maximum and minimum richness estimators for Piedras Blancas. Sobs, observed species numbers; Jack 2, second order Jacknife.

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

33

Fig. 9. Species accumulation curve and maximum and minimum richness estimators for Puerto Jimenez. Sobs, observed species numbers; ICE, incidence based coverage.

Fig. 10. Coleman richness expectation curves for all sites except Villa Mills. Dotted lines show 95% confidence intervals.

34

R. Wills Flowers & Paul E. Hanson

Table II. Between-site diversity in Costa Rican Chrysomelidae as expressed by the Morisita-Horn similarity index.

Zurqui Piedras Blancas Puerto Jimenez Genesis II Empalme Villa Mills San Gerardo La Selva

Zurqui Piedras Puerto Genesis II Empalme Villa Mills Blancas Jimenez

San Gerardo La Selva

–

0 0 0 0.01 0.17 0.8 –

0 –

0 0.12 –

0.05 0 0 –

0.01 0 0 0.09 –

0 0 0 0.03 0.19 –

0.1 0.17 0.04 0 0 0 0 –

Morisita Index values (Table II) for all pairs of sites were low or non-existent, suggesting that the Costa Rica Chrysomelidae fauna is highly diverse and even with the influence of agricultural areas on most of the sites, few species are widespread. The greatest similarities were between the high altitude sites of San Gerardo and Villa Mills, with lower similarities between Empalme and San Gerardo; and between the lowland La Selva and Piedras Blancas, although these sites are in the Atlantic and Pacific coastal plains, respectively. Limitation of the sampling made it difficult to come to any conclusions about the seasonality of chrysomelid species. Many species were present in irregularly fluctuating numbers that appeared to be related to the total number of chrysomelids in the samples. Other chrysomelids had a single very high peak, but at sites where there was only a year or less of regular samples, this could mean either seasonality or irregular aseasonal fluctuations. Only Zurqui, Piedras Blancas, and Puerto Jimenez were collected sufficiently to allow identification of possible species with repeating seasonal activity bands, and only three such species were identified, all at Zurqui (Fig.11). In these cases, adults were captured in successive years during relatively short monthly periods. DISCUSSION Since the sampling methods used in this study were designed to maximize collecting efficiency of Hymenoptera, value of the data for ecological studies of Chrysomelidae (or any other group) was not a consideration during design of the project. The variation in numbers of samples and the frequent irregularities in collection periods and in functioning of the traps limit the ecological information that can be extracted from the data. But such inventories are often the only source of data on tropical insect faunas, and the logistics of tropical field work combined with the limited and erratic funding of tropical biodiversity studies mean that intensive, quantitative sampling studies will never occur in most tropical areas. Hence, using available if imperfect inventory data is the only option for getting at ecological information for most groups of tropical insects. In our data, flea beetles (Galerucinae: Alticini) predominated at all sites, and their proportion increased with increasing trap altitude. This gives quantitative support to Scherer’s (1988) assertion that flea beetles attain their highest diversity in the Neotropics. Wagner (1999), in a fogging study in East African forests found Alticini to be the most diverse group of Chrysomelidae at some, but not all of his study sites. On the other hand, Basset and Samuelson (1996) in a study of New Guinea

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

35

Fig. 11. Seasonal abundance at Zurqui for total Chrysomelidae and for three seasonal species. a, total Chrysomelidae: b, Tetragonotes sp.1; c, Tetragonotes sp.2; d, Neodiphaulaca, sp. 1.

36

R. Wills Flowers & Paul E. Hanson

forest herbivores found Alticini third in abundance below Galerucinae s.s. and Eumolpinae. Our data also suggest that chrysomelid communities have a high beta diversity with few broadly distributed species. Unsurprisingly, diversity decreased as altitude increases. What was unexpected was the degree of separation between the La Selva and Zurqui sites in terms of diversity (Fig.10). For many nonchrysomelid taxa, the Zurqui site has been the most productive of all the Costa Rican Malaise trap sites (PEH, unpubl. data). Also somewhat unexpected, given that Malaise traps were designed to catch flying insects, were the large numbers of flightless species that appeared in traps at some of the high altitude sites. These chrysomelids (mostly flea beetles but in one case a eumolpine) evidently are actively moving around and climbed up the trap netting as they would the stalk of a plant. Although Malaise traps are not generally used for collecting Chrysomelidae, our results show that this method can be very productive. Despite intensive collecting of Chrysomelidae over a ten year period by the parataxonomists of the Costa Rica National Biodiversity Inventory (INBio), our samples contained many species not found in the INBio collections, long series of species that were collected in small numbers by conventional means, and several new generic records for Costa Rica. Based on the species accumulation curves, none of the sites was sampled long enough for a curve to reach an asymptote. Only at the Zurqui site (with 27 samples) was this condition approached. We would recommend a minimum of thirty samples taken at regular intervals for any future Malaise trap – based inventory of Chrysomelidae. Can tropical Chrysomelidae be ecological indicators? Entomologists should play a leading role in bringing conservation biology perspectives to sustainable agriculture. Two of the immediate research needs are on the effects of agricultural activities at boundary areas, and maintaining biological diversity on agricultural lands (Van Hook 1994). The use of insects as indicators of ecological integrity has a long history in aquatic entomology (Karr and Chu 1999). Kremen et al. (1993) noted the utility of arthropod indicators for monitoring water quality and recommended increased efforts to translate the experience of aquatic entomologists into the terrestrial realm. However, finding appropriate terrestrial insects as indicators has been more problematical. Not surprisingly, much of the work to date has been on Lepidoptera, especially butterflies, which are readily noticed and taxonomically well known (Solis 1999, Kerr et al. 2000). Interest has usually focused on taxonomically well-worked Coleoptera such as Carabidae (Niemelä et al. 1988, 1993, Dufrêne and Legendre 1997, Heliölä et al. 2001) and Scarabaeinae (Davis 2000, Halffter and Favila 1993, Nummelin and Hanski 1989). Other recommended groups include dragonflies, wasps and bees (Kremen et al. 1993). However, after an intensive five-year study in Florida, it was found that an undescribed springtail (Collembola) and two planthoppers (Cicadellidae) were useful indicators of hardwood encroachment in longleaf pine forests (Provencher et al. 2001). There has been only one published monitoring study using Chrysomelidae (Staines and Staines 1998) as an indicator group. Current capture records were compared to historical species lists as a measure of environmental change on Plummers Island, Maryland. It has often been noted (at least within the hearing of the senior author) that Chrysomelidae would make an excellent indicator family, if only its taxonomy and biology were better known. Monitoring studies of aquatic insects today generally fall into two very broad categories: multivariate analyses and multimetric indices. While both types of study have their own advantages, multimetric indices are gaining favor because of their ease of construction and interpretation, and because they can use ecological data that do not meet the sometimes elaborate replicability standards

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

37

required for multimetric analyses. As the name implies, multimetric botic indices are constructed of metrics (biological attributes that change along a gradient of human influence) of stream invertebrates. Examples of these are total species richness, species richness of individual orders, numbers of disturbance tolerant (or intolerant) organisms, proportion of tolerants (or of intolerants), and enumeration of biota by types of feeding or other habits (Karr and Chu 1999). Successful biotic indices are always regionally based and are composed of those metrics that reliably separate effects of human impact from other ecological and meteorological effects. In contrast to the well-known aquatic invertebrate communities of North America and Europe where biotic indices have reached a high degree of development, our understanding of the taxonomy and biology of the chrysomelid fauna of Costa Rica, as measured by our trap samples is still incomplete. In spite of this, and the shortcomings of the sampling coverage already noted, it is still possible to show how Chrysomelidae-based metrics could be used to monitor human impact. As a sort of mini-experiment, we postulate three metrics and then apply them to the three lowland sites (La Selva, Piedras Blancas, Puerto Jimenez) and the mid-elevation site (Zurqui). As described in the methods, one site (Puerto Jimenez) has been heavily impacted by humans, while these impacts have been less at the other sites. Species richness has been shown to be a robust metric in aquatic biomonitoring (Karr and Chu 1999, Resh and McElravy 1993, Lenat and Resh 2001). In our data, species richness at Puerto Jimenez is substantially less than at the other sites (Table 1). A drawback to using total richness for tropical Chrysomelidae can be seen in Appendix I: the plethora of possible species and the need for expert sorting to recognize them. As a possible way of working around this obstacle (until we reach the Promised Land of adequately supported taxonomic research), the following three proportional metrics use taxonomic groups at the genus level or above. These metrics were derived from the senior author’s ten years of collecting experience in low- and mid-elevation forest and small-farm habitats. Their use does not depend on the ability to recognize morphospecies. PROPORTION OF ALTICINI THAT ARE MONOPLATINA. The Monoplatina are a subgroup of the Alticini distinguished by the swollen apical tarsomere, a narrow quadrate pronotum, and dense setae on the upper surface. They are very numerous in primary forest, forest edge, and second growth habitats with diverse plant communities. Predicted response to human disturbance: decrease. PROPORTION OF EUMOLPINAE THAT ARE BRACHYPNOEA AND RHABDOPTERUS. Both these genera are large, diverse, and very opportunistic in their feeding. Also, both contain species that have adapted to human disturbance and are abundant in agricultural and even urban settings (RWF, unpublished data). Both genera can be recognized using existing generic keys for Central America (Flowers 1996) or even for the United States (Arnett 1963). Predicted response to human disturbance: increase. PROPORTION OF GALERUCINI THAT ARE DIABROTICINES. Species of the genus Diabrotica have very successfully colonized agroscapes in both North and Central America. In some heavily agricultural areas, they can be almost the only Chrysomelidae encountered. In the Neotropical Region there are several other genera closely related to and resembling Diabrotica, some of which also contain agricultural pests. These all can be crudely distinguished by bifid tarsal claws, and a Diabrotica-like appearance. Predicted response to human disturbance: increase. Figure 12 shows that all three metrics behaved as predicted and separated Puerto Jimenez from Piedras Blancas. Two of the metrics (% Monoplatina and % Diabroticines) separated Puerto Jimenez from all three less impacted sites. The third metric (% Brachypnoea – Rhabdopterus) was less successful, failing to separate Zurqui and La Selva from Puerto Jimenez, even though the two former sites are have clearly been less impacted than the latter. They are uninformative when applied to our high

38

R. Wills Flowers & Paul E. Hanson

Fig. 12. Performance of three Chrysomelidae-based metrics for lowland and mid-elevation Malaise trap catches. 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 000000000000000 00 000 000 000 000 000 000 000 000 000 000 000 000 000 000 , % of Alticini that are Monoplatina; 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0000000000000000 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0000000000000000

, % of Eumolpinae that are Brachypnoea and Rhabdopterus; , % of Galerucini that are Diabrotica and related genera.

altitude trap sites, but this is not surprising. Aquatic biotic indices that work in lowland rivers are not designed to be applied to alpine streams. These and any other metric derived from community attributes must be extensively tested before confidence is placed in their predictive value. For our metrics, an adequate test would include trapping in a range of land use types within a region (such as the Osa Peninsula or Sarapiquí). This would include trapping well inside primary forest (reference condition), in lightly impacted areas at forest edges or in fragments (as in most of our sites) and in heavily impacted areas. We agree with Staines and Staines (1998) that the Chrysomelidae have great potential in biological monitoring. The success of aquatic biological monitoring has come from the pooled research and experience of many aquatic biologists over the course of several decades. We hope that this initial effort will persuade other workers to add their own data and expertise to construct a similar knowledge base for the Chrysomelidae. ACKNOWLEDGMENTS We all those who helped collect trap samples and maintained the Malaise traps during this study. We also thanked the specialists who assisted with identifications: David G. Furth, Alticini; Shawn M. Clark, Galerucini; and Charles L. Staines, Hispinae. The work by RWF was supported in by a grants from INBio and the Biodiversity Resources Development Project, GEF World Bank, and by a grant (FLAX 91005) from CSREES, USDA to Florida A&M University. LITERATURE CITED Arnett, R. 1963. Beetles of the United States. Catholic University of America Press, Washington, D.C. 1112 + xi pp.

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

39

Basset, Y. and G. A. Samuelson 1996. Ecological characteristics of an arboreal community of chrysomelids in Papua New Guinea, pp. 243-262. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology 2: Ecological Studies. SPB Academic Publishing, Amsterdam, The Netherlands. Carlton, C. E. and H. W. Robison 1998. Diversity of litter-dwelling beetles in the Ouachita Highlands of Arkansas, USA (Insecta: Coleoptera). Biodiversity and Conservation 7:1589-1605. Colwell, R. K. 1997. EstimateS: statistical estimation of species richness and shared species from samples, version 5. User’s guide and application. http://viceroy.eeb.u-conn.edu/estimates Davis, A. J. 2000. Does reduced-impact logging help preserve biodiversity in tropical rainforests? A case study from Borneo using dung beetles (Coleoptera: Scarabaeoidea) as indicators. Environmental Entomology 29:467-475. Dufrêne, M. and P. Legendre 1997. Species assemblages and indicator species: the need for a flexible asymmetrical approach. Ecological Monographs 67:345-366. Erwin, T. 1982. Tropical forests: their richness in Coleoptera and other arthropod species. Coleopterists Bulletin 36:74-75. Farrell, B. D. and T. L. Erwin 1988. Leaf-beetle community structure in an Amazonian rainforest canopy, pp. 73-90. In: P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Flowers, R. W. 1996. La subfamilia Eumolpinae (Coleoptera: Chrysomelidae) en América Central. Publicación especial no. 2 de la Revista de Biología Tropical. 59 pp. Halffter, G. and M. E. Favila 1993. The Scarabaeinae (Insecta: Coleoptera): An animal group for analyzing, inventorying and monitoring biodiversity in tropical rainforest and modified ecosystems. Biology International 27:15-21. Hanson, P. E. 1995. Sampling Costa Rican Hymenoptera, pp 10-13. In: P. E. Hanson and I. D. Gauld (Eds.). The Hymenoptera of Costa Rica. Oxford University Press, Oxford, United Kingdom. Heliölä, J., M. Koivula and J. Niemelä 2001. Distribution of carabid beetles (Coleoptera, Carabidae) across a boreal forest–clearcut ecotone. Conservation Biology 15:370-377. Hoekstra, J. M., R. T. Bell, A. E. Launer, and D. D. Murphy 1995. Soil arthropod abundance in coastal redwood forest: Effect of selective timber harvest. Environmental Entomology 24:246-252. Karr, J. R. and E. W. Chu 1999. Restoring life in running waters. Island Press, Washington, D.C. 207 + xv pp. Kerr, J. T, A. Sugar and L. Packer 2000. Indicator taxa, rapid biodiversity assessment, and nestedness in an endangered ecosystem. Conservation Biology 14:1726-1734. Klausnitzer, B. 1981. Beetles. Exeter Books, New York, New York. 214 pp. Kremen, C., R. K. Colwell, T. L. Erwin, D. D. Murphy, R. F. Noss and M. A. Sanjayan. 1993. Terrestrial arthropod assemblages: Their use in conservation planning. Conservation Biology 7:796-808. Lenat, D. R. and V. H. Resh 2001. Taxonomy and stream ecology-the benefits of genus- and species-level identifications. Journal of the North American Benthological Society 20:287-298. McKamey, S. H. 1999. Biodiversity of tropical Homoptera, with the first data from Africa. American Entomologist 45:213-221. Niemelä, J., Y. Haila, E. Halme, T. Lahti, T. Pajunen and P. Punttila 1988. The distribution of carabid beetles in fragments of old coniferous taiga and adjacent managed forest. Annales Zoologici Fennici 25:107-119. Niemelä, J., D. Langor and R. J. Spence 1993. Effects of clear-cut harvesting on boreal ground-beetle assemblages (Coleoptera: Carabidae) in western Canada. Conservation Biology 7:551-561. Nummelin, M. and I. Hanski 1989. Dung beetles of the Kibale Forest, Uganda: Comparison between virgin and managed forests. Journal of Tropical Ecology 5:349-352.

40

R. Wills Flowers & Paul E. Hanson

Pogue, M. G. 1999. Preliminary estimates of Lepidoptera diversity from specific sites in the Neotropics using complementarity and species richness estimators. Journal of the Lepidopterists Society 53:65-71. Provencher, L., A. R. Litt, K. E. M. Galley, D. R. Gordon, G. W. Tanner, L. A. Brennan, N. M. Gobris, S. J. McAdoo, J. P. McAdoo and B. J. Herring 2001. Restoration of fire-suppressed longleaf pine sandhills at Eglin Air Force Base, Florida. Final report to the Natural Resources Management Division, Eglin Air Force Base, Niceville, Florida. Science Division, The Nature Conservancy, Gainesville, Florida. [pdf file on CD-ROM] Reid, C. A. M. 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea), pp. 559-631. In: J. Pakaluk and S. A. Slipinski (Eds.), Biology, phylogeny, and classification of Coleoptera: papers celebrating the 80th birthday of Roy A. Crowson. Muzeum i Instytut Zoologiii PAN, Warszawa, Poland. Resh, V. H. and E. P. McElravy 1993. Contemoprary quantitative approaches to biomonitoring using benthic macroinvertebrates, pp. 159-194. In: D. M. Rosenberg and V. H. Resh (Eds.), Freshwater Biomonitoring and Benthic Macroinvertebrates. Chapman and Hall, New York, New York. 488 + ix pp. Skillen, E. L., J. Pickering and M. J. Sharkey 2000. Species richness of the Campopleginae and Ichneumoninae (Hymenoptera: Ichneumonidae) along a latitudinal gradient in eastern North American old-growth forests. Environmental Entomology 29:460-466. Scherer, G. 1988. The origins of the Alticinae, pp. 113-130. In: P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Solis, M. A. 1999. Insect biodiversity: perspectives from the systematist. American Entomologist 45:204-205. Solis, M. A., and M. G. Pogue 1999. Lepidopteran biodiversity: patterns and estimators. American Entomologist 45:206-212. Staines, C. L. and S. L. Staines 1998. The leaf beetles (Insecta: Coleoptera: Chrysomelidae): potential indicator species assemblages for natural area monitoring, pp. 233-243. In: G. D. Therres (Ed.), Conservation of Biological Diversity: a Key to the Restoration of the Chesapeake Bay Ecosystem and Beyond. Maryland Department of Natural Resources, Annapolis, Maryland. Stork, N. E. 1997. Measuring global biodiversity and its decline, pp. 41-68. In: M. Reaka Kudla, D. E. Wilson, and E. O. Wilson (Eds.), Biodiversity II: Understanding and Protecting Our Biological Resources. Joseph Henry Press, Washington, D.C. Van Hook, T. 1994. The conservation challenge in agriculture and the role of entomologists. Florida Entomologist 77:42-73. Wagner, T. 1999. Arboreal chrysomelid community structure and faunal overlap between different types of forests in Central Africa, pp. 247-270. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology 1. Backhuys Publishers, Leiden, The Netherlands. Wolda, H., C. W. O’Brien and H. P. Stockwell 1998. Weevil diversity and seasonality in tropical Panama as deduced from light-trap catches (Coleoptera: Curculionoidea). Smithsonian Contributions to Zoology, No. 590. 79 pp.

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats

41

APPENDIX List of species of Chrysomelidae from Malaise traps in eight localities in Costa Rica Taxon Chrysomelinae Calligrapha sp. 1 Plagiodera sp.1 Criocerinae Lema sp.1 Lema sp.2 Lema sp.3 Lema sp.4 Lema sp.5 Lema sp.6 Lema sp.7 Lema sp.8 Lema sp.9 Lema sp.10 Lema sp.12 Lema sp.13 Lema sp.14 Cryptocephalinae Cryptocephalus sp.1 Cryptocephalus sp.2 Cryptocephalus sp.3 Cryptocephalus sp.4 Cryptocephalus sp.5 Cryptocephalus sp.6 Cryptocephalus sp.7 Lexiphanes sp. 1 Pachybrachys sp.1 Eumolpinae “Alethaxius” sp.1 “Alethaxius” sp.2 Allocolaspis sp.1 Allocolaspis sp.2 Allocolaspis sp.3 Anachalcoplacis sp.1 Antitypona sp.1 Antitypona sp.2 Antitypona sp.4 Antitypona sp.5 Antitypona sp.6 Antitypona submetallica Apterodina sp.1 Brachypnoea atra Brachypnoea colonensis

La Selva

Zurqui Genesis Empalme San II Gerardo

Villa Mills

Piedras Puerto Blancas Jimenez

— —

1 2

— —

— —

— —

— —

— —

— —

— — 18 — 15 — — — — — 1 1 1

0 11 4 4 2 2 1 4 1 1 — — —

6 — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — 1 — 3 — — — — — — — —

— — — — — — — — —

— 2 3 2 2 — — 1 —

20 — — — — — — — 1

— — — — — 5 2 — —

— — — — — 6 — — —

— — — — 5 — — — —

— — — — — — — — —

— — — — — — — — —

— — — — 1 1 — — — — — — — 18 —

— 1 14 3 — — — 3 3 2 — 11 — 263 —

1 — — — — — 4 — — — — — — — —

— — — — — — — — — — — — 118 — —

— — — — — — — — — — — — — 1 —

— — — — — — — — — — — — — — —

— — — — — — — 7 — — 2 — — — —

— — — — 6 — — — — — — — — — 3

42

R. Wills Flowers & Paul E. Hanson

Taxon Brachypnoea modestum Brachypnoea sermyla Brachypnoea viridis gp. Brachypnoea sp.4 Brachypnoea sp.5 Brachypnoea sp.6 Brachypnoea sp.7 Brachypnoea sp.9 Brachypnoea sp.10 Brachypnoea sp.11 Brachypnoea sp.12 Caryonoda sp.1 Chalcophana discolor Chalcophana mutabilis Chalcophana rufipennis Chalcophana storkani Chalcophana tosticornis Colaspis deleta Colaspis sanjoseana Colaspis sp.2 Colaspoides batesi Colaspoides placidula Dryadomolpus sp.1 Dryadomolpus sp.2 Ephyraea exigua Habrophora sp. 1 Hylax pseudoviolaceus Hylax sp.1 Hylax sp.2 Lamprosphaerus sp.1 Megascelis sp.1 Megascelis sp.2 Megascelis sp.3 Megascelis sp.4 Megascelis sp.5 new genus 1 new genus 2 Nodocolaspis femoralis Percolaspis sp.1 Percolaspis sp.2 Phanaeta ruficollis Phanaeta sp.1 Phanaeta sp.3 Rhabdopterus fulvipes Rhabdopterus sp.1 Rhabdopterus sp.2 Rhabdopterus sp.3

La Selva 11 — 9 — — — — — — — — — — 1 — — — 1 — 1 — — — — — — 2 — — — — 1 2 1 2 — — — — — — — — 3 — — —

Zurqui Genesis Empalme San II Gerardo — — — 24 15 — 12 6 3 21 1 — 6 — 1 1 6 — 3 — 2 — — — — 3 — 2 18 1 2 — — — — — — — — — — 34 — — 1 2 —

— — — 17 1 2 — — — — — — — — — — — — — — — — 4 — — — — — — — — — — — — — 15 — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — 1 — — — — — — — — — — — — 4 — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

Villa Mills — — — — — — — — — — — — — — — — — — — — — — — 6 — — — — — — — — — — — — — — — — — — — — — — —

Piedras Puerto Blancas Jimenez 5 — — — — — — — — — — 1 — 1 — — — — — — — 4 — — 1 — 10 — — — — — — — — — — — 17 — 3 — 2 29 — — 14

15 12 — — — — — — — — — — — — — — — — — 1 — — — — — — 1 — — — — 2 — — — — — 2 1 4 — — — 72 — — —

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats Taxon Spintherophyta servula Spintherophyta sp.1 Spintherophyta sp.3 Typophorus nigritus Typophorus sp.3 Typophorus sp.4 Typophorus sp.5 Typophorus variabilis Xanthonia sp.1 Zenocolaspis inconstans Zenocolaspis jansoni Galerucinae: Alticini Acallepitrix sp. 1 Acallepitrix sp. 2 Acallepitrix sp. 3 Acallepitrix sp. 4 Acallepitrix sp. 5 Acallepitrix sp. 6 Acallepitrix sp. 7 Acallepitrix sp. 8 Acallepitrix sp. 9 Acallepitrix sp. 10 Acallepitrix sp. 11 Acallepitrix sp. 12 Acallepitrix sp. 13 Acallepitrix sp.14 Acanthonycha quadrituberculata Acanthonycha roseocarmina Acanthonycha stali Alagoasa sp. 1 Alagoasa sp. 2 Alagoasa antennalis Alagoasa sp. 3 Alagoasa sp. 5 Alagoasa sp. 6 Allochroma sp. 1 Allochroma sp. 2 Allochroma sp. 3 Allochroma sp. 4 Allochroma sp. 5 Allochroma sp. 6 Allochroma sp. 7 Allochroma sp. 8 Allochroma sp. 9 Andiroba sp. 1 Apthona sp. 1 Apthona sp. 2

La Selva

Zurqui Genesis Empalme San II Gerardo

Villa Mills

43

Piedras Puerto Blancas Jimenez

— — 1 2 — — 2 — — 2 3

— 4 — — — — — 106 — — —

— — — — — — — 24 — — —

— — — — — — — — — — —

— — — — — — — — 3 — —

— — — — — — — — — — —

1 — — — 21 12 — — — — —

— — — 14 — — — — — 6 —

— — — — — — — — 4 3 — — — — — 4 — — — 1 — — 2 — — — — — — — — — 16 — —

1 13 3 4 1 1 2 4 1 2 1 — — 2 13 13 — 2 10 22 — — — 2 2 5 1 — — — — — — — 10

255 — — — — — — — — — — — — — — — — 1 — — — — — 1 — — — — — — — — — 1 1

— 1 — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — 1 4 — — — 5 — — — — 1 — — — — — 5 1 3 1 3 9 — —

— — — — — — — — — — — 2 2 — — — — — — — 2 — — — — — — 1 — — — — — — —

44

R. Wills Flowers & Paul E. Hanson

Taxon Asphaera nobilitata Asphaera pallida Asphaera quadrifasciata Asphaera reichei Asphaera sp. 1 Asphaera sp. 5 Brasilaphthona palpalis Brasilaphthona robusta Jac. Brasilaphthona sp. 10 Brasilaphthona sp. 2 Brasilaphthona sp. 3 Brasilaphthona sp. 4 Brasilaphthona sp. 5 Brasilaphthona sp. 6 Brasilaphthona sp. 7 Brasilaphthona sp. 8 Brasilaphthona sp. 9 Centralaphthona sp. 1 Centralaphthona sp. 2 Centralaphthona sp. 3 Centralaphthona sp. 5 Centralaphthona sp. 9 Centralaphthona sp. 10 Centralaphthona sp. 11 Cerichrestus sp.1 Chaetocnema sp. 1 Chaetocnema sp. 2 Chaetocnema sp. 3 Chaetocnema sp. 4 Chaetocnema sp. 5 Chaetocnema sp. 6 Chaparena sp.1 Dinaltica sp. 1 Dinaltica sp.2 Dinaltica sp.3 Diphaltica nr. crassicornis Diphaltica sp.1 Diphaltica sp.3 Disonycha sp.1 Disonycha sp.2 Disonycha sp.3 Epitrix sp.1 Epitrix sp.2 Epitrix sp.3 Epitrix sp.4 Epitrix sp.5 Epitrix sp.6

La Selva — — — 1 — — — 2 — 6 — — — 19 1 2 1 — — 3 5 — 9 14 1 — — — — 1 — 23 — — — — — — — 2 2 — — 1 — 1 —

Zurqui Genesis Empalme San II Gerardo — 4 — — 3 — 75 — — — — — — — — — — 2 1 2 — — — — — 2 6 2 1 — — — 13 1 — — 60 1 1 — — 17 1 23 2 16 —

— — — — — — 3 — — — — — — — — — — 4 — — — — — — — 3 1 — — — — — — — — 1 41 — — — — 38 7 9 14 — —

— — — — — — — — — — 22 3 — — — — — — — — — 1 — — — — — — — — — — — — — — 1 — — — — — — 10 — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — 1 — — — — — — 6 — — —

Villa Mills — — — — — — — — — — 3 — — — — — — — — — — — — — — — — — — — 1 — — — — — — — — — — — — 1 — — —

Piedras Puerto Blancas Jimenez 35 — 67 — — 2 — 17 — 3 — — 1 — — — — — — — — — — — 2 — — — — — — — — — 1 — — — — — — — — — — — —

— — 1 — — — — 1 11 1 — — — — — — — — — — 1 — — — — — — 1 — 4 — — — — — — — — — — — — — — — — 1

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats Taxon Epitrix sp.7 Eugoniola sp.1 Exoceras nr. hippocephalus Exoceras nr. pallidus Exoceras sp.1 Exoceras sp.2 Exoceras sp.4 Exoceras sp.5 Exoceras sp.6 Exoceras sp.7 Exoceras sp.9 Exoceras sp.10 Genaphthona sp.1 Genaphthona sp.2 Genaphthona sp.3 Gioia sp.1 Gioia sp.2 Gioia sp.3 Gioia sp.4 Gioia sp.5 Glenidion sp.1 Glenidion sp.2 Glenidion sp.3 Heikertingerella sp.1 Heikertingerella sp.2 Heikertingerella sp.3 Heikertingerella sp.4 Heikertingerella sp.5 Heikertingerella sp.6 Heikertingerella sp.7 Heikertingerella sp.8 Heikertingerella sp.9 Heikertingerella sp.10 Heikertingerella sp.11 Heikertingerella sp.12 Heikertingerella sp.13 Heikertingerella sp.14 Heikertingerella sp.15 Heikertingeria sp.1 Heikertingeria sp.2 Heikertingeria sp.3 Homotypus sp.2 Homotypus sp.3 Homotypus sp.5 Homotypus sp.6 Homotypus sp.7 Homotypus sp.8

La Selva — — — 1 — — — — 2 — 1 4 — 48 2 — — — — 2 — — — — — — — — 2 2 1 — — 42 50 11 5 1 — — 1 — — 1 3 — 1

Zurqui Genesis Empalme San II Gerardo — 1 — — — — 1 5 5 1 — — 1 — — — — — — — 6 — — — — — 257 14 2 — — — — — — — — — 3 — — 2 5 — — — —

— — 2 1 2 1 — — — — — — — — — 1 2 — — — — — — 13 28 3 — — — — — — — — — — — — — — — — — — — — —

— — — 55 9 — — — — — — — — — — — — — — — — — — 3 14 1 — — — — — 36 1 — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — 9 — — — — — — 22 — — — — — — — — — — — — — — —

Villa Mills — — — — 2 — — — — — — — — — — — — — — — — — — — 1 1 — — — — — — — — — — — — — — — — — — — — —

45

Piedras Puerto Blancas Jimenez — — — — — — — — — — 1 — — — — — — 15 5 — — 8 4 — — — — — — 17 1 — — — — — — — — 1 — — — — 8 2 —

2 — — — — — — — — — — — — — — — — — — — — — — — — — — — 6 6 — — — — — — — — — — — — — 2 — — —

46

R. Wills Flowers & Paul E. Hanson

Taxon Hypanthus sp.1 Hypanthus sp.2 Hypolampsis sp.1 Hypolampsis sp.2 Hypolampsis sp.3 Hypolampsis sp.4 Hypolampsis sp.5 Hypolampsis sp.6 Hypolampsis sp.7 Hypolampsis sp.8 Hypolampsis sp.9 Hypolampsis sp.11 Hypolampsis sp.12 Hypolampsis sp.13 Hypolampsis sp.14 Hypolampsis sp.16 Hypolampsis sp.18 Hypolampsis sp.19 Hypolampsis sp.20 Hypolampsis sp.21 Hypolampsis sp.22 Hypolampsis sp.23 Hypolampsis sp.24 Hypolampsis sp.25 Hypolampsis sp.26 Hypolampsis sp.27 Hypolampsis sp.28 Hypolampsis sp.29 Hypolampsis sp.30 Iphitrea sp.2 Iphitrea sp.3 Iphitrea sp.4 Iphitrea sp.5 Leptophysa sp.1 Longitarsus sp.2 Longitarsus sp.3 Longitarsus sp.4 Longitarsus sp.5 Longitarsus sp.6 Longitarsus sp.7 Longitarsus sp.8 Lupraea godmani(?) Lupraea nr. smithi Lupraea sp.1 Lupraea sp.4 Lupraea sp.6 Lupraea sp.7

La Selva — — — — — — — — — — 1 — — — — — — — — 2 — — — — — — — 1 5 — — — — — — 13 — — — — — — 1 — — — —

Zurqui Genesis Empalme San II Gerardo — 1 — — — — — — — 15 14 11 2 1 1 1 1 3 — — — — — — — — — — — 8 1 — — — — 4 7 5 — — — 3 7 — — 32 5

2 — 19 4 9 2 24 1 1 — — — — — — — — — — — — — — — — — — — — — — — — 7 13 — 1 1 — — — 8 4 34 4 2 —

— — — 1 — — 1 — — — — — — — — — — — — — — — — — 15 5 — — — — — — — — 5 — — — — 26 34 — 2 55 — — —

— — — — — — — — — — — — — — — — — — — — — — — — 3 — 1 — — — — — 7 — — — — — — — 390 — — 2 3 — —

Villa Mills — — — 7 — — 1 — — — — — — — — — — — — — — — — — 10 — 7 — — — — — — — — — — — — 2 120 — — 7 — — —

Piedras Puerto Blancas Jimenez — — — — — — — — — — 1 — — — — — — — 37 0 1 2 1 2 — — — — — — — 1 — — — — — — 5 — — — — — — — —

— — — — — — — — — — — — — — — — — — 4 1 — — — — — — — — — — — — — — — — — — 107 — — — — — — — —

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats Taxon Lupraea sp.8 Lupraea sp.9 Lupraea sp.10 Lupraea sp.11 Lupraea sp.12 Lupraea sp.13 Lupraea sp.14 Lupraea sp.15 Lupraea sp.16 Lupraea sp.17 Lupraea viridis (Jac.) Macrohaltica crypta Marcapatia sp. 1 Margaridisa sp.1 Megasus bimaculatus Jac. Monomacra nr. obscura (Jac) Monomacra sp.1 Monomacra sp.5 Monomacra sp.7 Monomacra sp.8 Monomacra sp.9 Monomacra sp.11 Monomacra sp.12 Monomacra variabilis (Jac.) Monomacra violacea Monotalla sp.1 Monotalla sp.2 Monotalla sp.3 Monotalla sp.4 Nasigona tibialis B&B Neodiphaulaca elegans Neodiphaulaca sp.2 Neodiphaulaca zenda Neothona sp.1 Neothona sp.2 new genus 1 new genus 2 new genus 4 new genus 5 nr. Margaridisa nr. Neothona Octogonotes fulvomarginatus Omophoeta abbreviata Omophoeta aequinoctialis Omophoeta simulans Omophoeta sp.1 Panchrestus sp.1

La Selva — — — — — — 8 2 1 1 — — — — — — — — — — — 2 1 — 5 — — — — — — — — — — — — — 1 — — — 1 5 — — 2

Zurqui Genesis Empalme San II Gerardo 1 6 12 2 — — — — — — — 16 — — — 44 — 1 — — — — — 7 — 16 7 — — 85 56 — — — — 5 — — — — — 33 — — — — —

— — — — — — — — — — 7 — — — — — 1 — — — 1 — — — — 6 1 — — 1 — 4 — 41 — — — — — 21 — 1 — — — — —

— — — — — 5 — — — — 13 — — — — — 1 — — 5 2 — — — — 1 — — 6 — — 6 — — — — — — — — 14 — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — 2 — — — — — — — — — — — — — — — — — — — — —

Villa Mills — — — — — — — — — — — — 4 — — — — — — — — — — — — 2 — — — 2 — — 3 — — — — — — 38 — — — — — — —

47

Piedras Puerto Blancas Jimenez — — — — 3 — — — — — — — — 1 4 — — — 12 1 — — — — — — — 3 — — — — — — 11 — 16 1 — — — — 2 61 133 1 —

— — — — — — — — — — — — — 1 — — — — — — — — — — — — — 2 — — — — — — 27 — — — — — — — 1 2 — — —

48

R. Wills Flowers & Paul E. Hanson

Taxon Parasyphraea sp.1 Parasyphraea sp.2 Parasyphraea sp.3 Parasyphraea sp.4 Parasyphraea sp.5 Phenrica sp.1 Phenrica sp.2 Phylacticus sp.1 Phylacticus sp.2 Plectotetra sp.1 Plectotetra sp.2 Plectotetra sp.3 Plectotetra sp.4 Plectotetra sp.5 Plectotetra sp.6 Prasona sp.1 Ptocadica sp.1 Rhinometus sp.1 Rhinometus sp.2 Roicus sp.1 Sphaeronychus fulvus (Baly) Sphaeronychus sp.1 Sphaeronychus sp.2 Strabala sp.1 Syphraea sp.1 Syphraea sp.2 Syphraea sp.4 Syphraea sp.7 Systena sp.1 Systena sp.2 Tetragonotes sp.1 Tetragonotes sp.2 Tetragonotes sp.3 Tetragonotes sp.4 Tetragonotes sp.5 Tetragonotes sp.6 Tetragonotes sp.7 Trichaltica sp.1 Trichaltica sp.2 Varicoxa sp.1 Varicoxa sp.2 Varicoxa sp.3 Walterianella sp.1 Walterianella sp.2 Walterianella sp.3 Walterianella sp.4 Walterianella sp.5

La Selva — — 38 — 1 5 1 — — — — — — — — — — 3 — 1 — — — 2 — — — — — 2 — — — — — — — — — — — 2 — — — — —

Zurqui Genesis Empalme San II Gerardo 12 8 — — — — — — 3 — — — 21 6 11 1 — — 2 — 45 — — 1 1 6 — — 18 1 — 64 25 10 2 1 — 3 — 1 7 — — 41 21 3 7

— — — — — — — 1 — — 11 1 — — — — — — — — 1 — — — 11 21 1 — 3 — 1 1 — — — — — — — — — — 1 — — — —

— — — — — — — — — 2 — — — — — — — — — — 2 — — — — 143 — — — — — — — 1 — — — — — — — — 2 — — — —

— — — — — — — 1 — — — — — — — — — — — — 8 — — — — 29 — — — — — — — — — — — — — — — — — — — — —

Villa Mills — — — — — — — — — — — — — — — — — — — — — — 47 — — 9 — — — — — — — — — — — — — — — — — — — — —

Piedras Puerto Blancas Jimenez — — 23 1 — — — — — — — — — — — — 5 5 — — — 4 — 1 — — — 2 — — — — — — — — — — 15 — — 1 — — — — 1

— — 1 — — — — — — — — — — — — — — — — — — 2 — — — — — — — 5 — — — — — — 4 — — 1 — 10 — — — — —

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats Taxon Walterianella sp.6 Walterianella sp.7 Galerucinae: Galerucini Acalymma subaeneum Acalymma sp.3 Acalymma sp.5 Acalymma sp.6 Acalymma sp.7 Caraguata sp.1 Cerotoma sp.1 Cerotoma sp.2 Chthoneis sp. 1 Cochabamba sp.1 Cochabamba sp.2 Coelomera sp.1 Coelomera sp.2 Coelomera sp.3 Deinocladius cartwrighti Diabrotica nr. adelpha Diabrotica rodgersi Diabrotica sp.1 Diabrotica sp.5 Diabrotica sp.6 Diabrotica sp.7 Diabrotica sp.8 Diabrotica sp.9 Diabrotica sp.10 Dircema sp. 1 Elyces sp.1 Gynandrobrotica lepida Gynandrobrotica strouhali Gynandrobrotica ventricosa Isotes sp.2 Isotes sp.3 Isotes sp.4 Isotes sp.5 Isotes sp.6 Isotes sp.7 Luperosoma sp.1 Malacorhinus nr. ntennatus Malacorhinus sp.1 Masurius (?) sp.1 Masurius (?) sp.2 Masurius (?) sp.3 Metrioidea sp.1 Metrioidea sp.2 Metrioidea sp.3

La Selva

Zurqui Genesis Empalme San II Gerardo

Villa Mills

49

Piedras Puerto Blancas Jimenez

— 1

7 —

— —

— —

— —

— —

— —

— —

— 1 — 11 — — — 3 — — — — — 5 — 3 — — — — — — 1 20 1 — 1 1 — — — — 2 1 1 5 — — — — 4 — — 3

2 2 1 — — 3 — — — — — 2 — — — 7 5 — 4 2 — — — — — 3 — — — 6 2 — — — — — — 2 2 — — 4 — 30

135 — — — — — — — — 1 — — — — — — — 1 — — — — — — — — — — — — — — — — — — — — — — — 4 17 —

— — — — — — — — — — 1 — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — 5 — —

— — — — — — — — — — — — — — — — — 1 — — — — — — — — — — — — — — — — — — — — — — — 136 — —

— — — — — — — — — — 2 — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — 1 — —

— — — — — — — — 5 — — — 3 — 4 — — — 5 — 2 2 1 — — — — — — — — 1 3 — — — 60 — — 1 — — — —

— — — 2 14 — 2 — — — — — — — — — — — — 2 — — — — — — — — 21 — 1 — — — — — — — — 1 — — — —

50

R. Wills Flowers & Paul E. Hanson

Taxon Metrioidea sp.4 Metrioidea sp.5 Metrioidea sp.6 Metrioidea sp.7 Metrioidea sp.8 Metrioidea sp.9 Metrioidea sp.10 Metrioidea sp.11 Metrioidea sp.12 Metrogaleruca sp.1 Neobrotica sp.1 Neobrotica sp.2 new genus. 1 new genus. 2 new genus. 3 new genus. 4 new genus. 5 Ophraella sp.1 Ophraella sp.2 Paranapicaba dorsoplagiata Paranapicaba sp.2 Paranapicaba sp.3 Paranapicaba sp.4 Paranapicaba sp.5 Paranapicaba sp.6 Paratriarius adonis Paratriarius smaragdina Paratriarius sp.2 Paratriarius sp.3 Paratriarius sp.4 Hispinae: Cassidini Aslamindium sp.1 Charidotella zona Coptocycla sp.1 Deloyala guttata Ischnocodia sp.1 Microctenochira sp.1 Microctenochira sp.2 Microctenochira sp.3 Microctenochira sp.4 Plagiometriona sp.1 Plagiometriona sp.2 Spaethiella sp.1 Tapinaspis sp.1 Hispinae: Hispini Baliosus sp.1 Cephaloleia consanguinea

La Selva

Zurqui Genesis Empalme San II Gerardo

Villa Mills

Piedras Puerto Blancas Jimenez

2 — — 52 — — 11 — — — — — — — — — — — 1 — 3 — — 9 4 — — — — 2

25 10 7 — — — — — — — 1 1 1 — — 2 — — — 7 16 6 1 — — 7 1 — — —

— — — — — — — — — — — — — 2 1 — — — — — — — — — — — — — — —

— — — — — — — — 5 — — — — — — — 1 — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — 47 1 8 8 3 — — — — — — — — — — — — 6 — — — — — — 6 7 —

— — — 3 — — — — — 2 — — — — — — — 1 — — — — — — — — — — — —

— 3 — 1 — — — 1 1 — — — —

1 — 1 — — — — — — 1 — — 1

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — — — — — — — — — —

— — — — 1 — — 1 — — — 1 —

— — — — — 2 2 — — — 1 — —

— 4

— —

— —

— —

— —

— —

— —

1 —

Leaf Beetle (Coleoptera: Chrysomelidae) Diversity in Eight Costa Rican Habitats Taxon Cephaloleia dorsalis Cephaloleia gillvipes Cephaloleia histrionica Cephaloleia mauliki Cephaloleia ruficollis Cephaloleia stevensi Cephaloleia tenella Cephaloleia trivittata Cephaloleia sp.4 Cephaloleia sp.2 Chalepus nr. amiculus Chalepus nr. bellulus Chalepus sp.2 Chalepus sp.4 Chalepus sp.5 Charistena ruficollis Chelobasis bicolor Heptispa sp.1 Pseudispa fulvolimbata Sceloenopla antennata Sceloenopla sp.2 Sceloenopla sp.4 Sceloenopla sp.5 Sceloenopla sp.6 Sceloenopla sp.7 Solenispa leptomorpha Stenispa sp.1 Sumitrosis gestroi Sumitrosis pallescens Uroplata fusca Xenochalepus sp.1 Lamprosomatinae Lamprosoma sp.1 Oomorphus sp.1 Subtotal Individuals Subtotal Species Total Individuals Total Species

La Selva

Zurqui Genesis Empalme San II Gerardo

Villa Mills

51

Piedras Puerto Blancas Jimenez

2 — — — 2 — 1 — — 1 1 1 — — 4 — — — 4 — — 1 — 1 — — — — — — —

— 2 1 1 — — — — — — 6 — 1 — — — — — — 3 1 — — — 1 — 1 7 — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — 19 — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — — — — — — — — — — — — — — — — — — — — — — — — — — —

— — — — — 1 — 2 — — — — — 1 — — 1 1 7 — — — 1 — — — — — — — 1

— — — — — — — — 2 — — — — — — 4 — 2 — — — — — — — — — — 4 1 1

— — 687 133

1 3 2203 208

— — 962 80

— — 665 46

— — 631 19

— — 282 24

— — 901 106

— — 424 65

6755 513

52

R. Wills Flowers & Paul E. Hanson

This page intentionally left blank

© PENSOFT Publishers Sofia - Moscow

David G. Furth (ed.) 2003 Nepal as a centre of speciation for Himalayan Chrysomelid 53 Special Topicsfauna in Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 53-62

Nepal as a centre of speciation for Himalayan Chrysomelid fauna Eva Sprecher-Uebersax1 1

Museum of Natural History, Augustinergasse 2, CH – 4001 Basel, Switzerland. E-mail: [email protected]

ABSTRACT Nepal is a very interesting country for faunistical questions because zoogeographically it is situated just between the Palaearctic and the Oriental Regions. No other country shows such an extreme contrast of altitudes over such a short distance and, consequently, the fauna is extremely interesting. A catalogue of the Chrysomelidae of Nepal, published in 1999, includes 797 species. Since then, additional species have been reported. In general, the Nepalese fauna is typically oriental, but some Palaearctic elements are known, such as Phratora vitellinae, a species widely distributed in the whole Palaearctic Region, and Cryptocephalus polymorphus and Novofoudrasia rufiventris, both known from Central Asia. Until now 12 Palaearctic genera were found, all with local species, e.g. Thelyterotarsus, Sclerophaedon or Galeruca. Only 25 species were found at altitudes of more than 4000 m, among them 15 endemic species. The number of endemic genera is unusually large, 12 such genera were found: Nepalolepta, Aphthonaria, Ascuta, Chabriella, Himalalta, Martensomela, Paraminota, Schawalleria, Yetialtica, Aphthonotarsa, Asiorella and Lipraria. Nearly all are found at very high altitudes, they are mostly apterous and belong mainly to the Alticinae. There are also several endemic species of Phaedon and Sclerophaedon, which replace each other from east to west. The isolation in the mountain regions, the extreme altitudes and the reduction of wings may explain this high number of endemic genera and species. The very high mountains and the deep river valleys separate the region into isolated habitats and offer good conditions for isolating populations and generating new species. At altitudes over 3000 m only 6 subfamilies are reported, above 4000 m only 1 Cryptocephalinae, 7 Chrysomelinae, 6 Galerucinae and 11 Alticinae were found. The large number of Alticinae at high altitudes is quite remarkable: 27% of all Alticinae were found above 3000 m, 39% of all Chrysomelid species at this altitude are Alticinae. Several species are differentiated into western and eastern subspecies, e.g. Chrysolina dhaulagirica dhaulagirica and Meristata pulunini occidentalis in the west and C. dhaulagirica arunensis and M. pulunini pulunini in the east of Nepal. Nepalogaleruca is known with 4 species, N. angustilineata has a central-western distribution, N. elegans a more eastern one, 2 additional species were found in the central zone.

INTRODUCTION For faunistic questions Nepal is a very interesting country because zoogeographically it is situated just on the frontier between the Palaearctic and the Oriental Region and shows an especially rich

54

Eva Sprecher-Uebersax

pattern of different landscapes. It’s area measures 147’181 km2. While the lowest point in the southern part has an altitude of only 62 meters and a climate with subtropical character, the northern part is situated fully in the high mountains on the top of the world reaching 8848 meters where the climate is rough. The distance from the north to the south of the country is only 250 kilometres, but the altitude differs in nearly 8800 meters (Fig. 1). No other country shows such an extreme contrast on such a short distance and, consequently, the fauna there is extremely rich and interesting. In the last 30 years many entomological expeditions went to Nepal, so good possibilities to study large material in different collections are given. In 39 of the 75 Nepalese districts beetles were collected, that means in about half of all western, central and eastern districts (Fig. 2). Each district has an average size of about 2000 km2. A catalogue of the Chrysomelidae of Nepal, published in 1999 by Medvedev and Sprecher, includes 797 species. Since then, a lot of additional species have been reported. It is to be supposed that the real existing number of the Nepalese Chrysomelidae will still increase by further 20%. One of the reasons of this species number which is obviously quite smaller than expected is that the lowlands in the south of the country are still poorly investigated and that namely there in the rain forests a rich abundance of species might exist which is still undiscovered. The Alticinae with 230 and the Galerucinae with 219 species are by far the largest subfamilies in this country followed by the Eumolpinae with 79 species (Tab. 1). Generally the Nepalese fauna is typically oriental, but some Palaearctic elements are known, e.g. Phratora vitellinae (Linnaeus), a species widely distributed in the whole Palaearctic region, Plagiodera versicolora (Laicharting), a transpalaearctic species, or Cryptocephalus polymorphus Solsky and Novofoudrasia rufiventris (Weise), both known from Central Asia. Till now 12 Palaearctic genera were found, all with local species, they are Thelyterotarsus

Fig. 1. The profile of Nepal from south to north showing the big difference of altitude in a very short distance (Donner, 1994).

55

Nepal as a centre of speciation for Himalayan Chrysomelid fauna

Fig. 2. The 75 districts in Nepal (Donner, 1994). In 39 of them beetles were collected. (The 3 small districts Kathmandu, Lalitpur and Bhaktapur are here united as Kathmandu-Valley) Tab. 1. The Chrysomelid subfamilies with the number of species, of genera, of endemic genera, of endemic, Palaearctic and apterous species, species found at > 3000 m and at > 4000 m. subfamily

species genera endemic endemic palaearctic species genera species species > 3000 m

Sagrinae 2 Donaciinae 1 Criocerinae 34 Zeugophorinae 6 Megalopodinae 7 Clytrinae 34 Cryptocephalinae 51 Chlamisinae 8 Lamprosomatinae 4 Eumolpinae 79 Chrysomelinae 42 Galerucinae 219 Alticinae 230 Hispinae 52 Cassidinae 28 total 797

1 1 3 1 2 10 5 1 2 26 15 73 63 18 9 230

0 0 0 0 0 0 0 0 0 0 0 1 11 0 0 12

0 0 1 1 3 4 14 4 2 17 18 44 86 4 2 200

0 0 0 0 0 0 2 0 0 0 4 1 1 0 0 8

0 0 2 2 0 3 6 0 0 14 14 43 58 0 0 142

species apterous > 4000 m genera 0 0 0 0 0 0 1 0 0 0 7 6 11 0 0 25

0 0 0 0 0 0 0 0 0 0 4 3 18 0 0 25

Weise, Crosita Motschulsky, Phratora Chevrolat, Linaeidea Motschulsky, Sclerophaedon Daccordi and Medvedev, Semenovia Weise, Oreomela Jacobson, Galeruca Muller, Galerucella Crotch, Stenoluperus Ogloblin, Batophila Foudras, Minota Kutschera and Novofoudrasia Jacobson. Only 25 species were found at an

56

Eva Sprecher-Uebersax

altitude of more than 4000 m, among them 15 endemic species and the transpalaearctic Chrysomela populi (Linnaeus) (Tab. 2). All known Chrysomelid subfamilies are found in Nepal except some small ones such as the Aulacoscelinae, Orsodacninae, Megascelinae and Synetinae. The worldwide geographical representation of the Chrysomelidae by subfamilies differs from area to area. Generally

Tab. 2. Species found at an altitude of more than 4000 meters (the distribution in Nepal is mentioned as numbers of districts, the altitude in 1000 m-steps in letters A - E) endemic Species

x x x x x x

x

x x

x x x x

x x

altitude

distribution in Nepal general distribution

Cryptocephalus exsulans Suffrian, 1854 Chrysomela populi Linné, 1758

A, B, C, D, E widely distributed B, C, D, E

widely distributed

Oreomela himalayensis nepalica Medv. & Sprecher, 1998 Phaedon lesagei Daccordi, 1984 Sclerophaedon brendelli Daccordi & Medv., 1998 Sclerophaedon takizawai Daccordi & Medv., 1998 Semenovia daccordii Medv. & Sprecher, 1998 Semenovia nagaja Daccordi, 1982 Arthrotidea nepalensis (Kimoto, 1970) Cneorane tibialis Chûjô, 1966 Galeruca indica Baly, 1878 Meristata pulunini (Bryant, 1952) Nepalogaleruca angustilineata Kimoto & Tak., 1972 Nepalogaleruca schmidti Medv. & Sprecher, 1997 Altica himalayensis Chen, 1936

E

NW 24

D, E E

CE 48, CE 50, CE 51 Nepal CW 37 Nepal

D, E

CW 34, CW 38, CW 48 Nepal

D, E

CW 30, CW 38

Asiorestia schenklingi (Csiki, 1940) Asiorestia thoracica Medvedev, 1990 Batophila femorata Scherer, 1989 Benedictus medvedevi Döberl, 1991 Bhutajana nepalensis Scherer, 1989 Chaetocnema (C.) alticola Maulik, 1926 Chaetocnema (C.) cognata Baly, 1877 Paraminota minima Scherer, 1989 Paraminota nepalensis Döberl, 1991 Taizonia minima (Scherer, 1969)

Nepal, Bhutan, China, India Nepal, Bhutan, whole palaearktic Nepal

Nepal

C, E E 69, E 74 A, B, C, D, E widely distributed

Nepal Nepal, India

B, C, D, E C, D, E B, C, D, E C, D, E

widely widely widely widely

Nepal, India Nepal, India Nepal Nepal

E

CW 38

distributed distributed distributed distributed

A, B, C, D, E widely distributed D, E E C, D, E E E B, D, E

CW 40, E 69, E 74 CE 51, E 69 CW 30, CE 51 CE 51 CE 51 CW 30, CE 48, E 69

B, E

CW 39, E 69

D, E E B, C, D, E

CW 37, CE 51 CW 40, CE 51 widely distributed

Nepal Nepal, India, China, Taiwan Nepal, India Nepal Nepal Nepal Nepal Nepal, India Nepal, India, Bhutan, Sri Lanka Nepal Nepal Nepal, India

Nepal as a centre of speciation for Himalayan Chrysomelid fauna

57

speaking the Oriental fauna has a combination of Galerucinae and Alticinae dominant. The high proportion of Alticinae as is the case in Nepal is a character of high mountain. MATERIALS AND METHODS In the following museum collections a large amount of material was studied: Naturhistorisches Museum Basel (Switzerland), Naturkundemuseum Erfurt (Germany), Staatliches Museum für Naturkunde Stuttgart (Germany), Staatliches Museum für Tierkunde Dresden (Germany). Furthermore, all information found in the available literature concerning Nepalese leaf beetles was included. For information about the distribution of each species the country was divided into 5 zones following the phytogeographical zones of Dobremez in 1976 (Fig. 3) and vertically into 5 zones of altitude in 1000 m steps. RESULTS Additions to the Chrysomelid Catalogue of Nepal One species not yet mentioned in the catalogue is Trachyaphthona hiunchulii Sprecher. The catalogue of the Chrysomelidae of Nepal was published knowing well that it was just a provisional result and that in future several species new for Nepal as well as new for science would be added. Because new material from Nepal is continuously at our disposal, the research of Nepalese Chrysomelidae is far from finished. So, soon after the catalogue’s publication a new Alticinae species belonging to the genus Trachyaphthona Heikertinger was discovered. Heikertinger (1924) described Trachyaphthona and Zipangia Heikertinger as independent genera, because a main feature of Zipangia is a basal transverse furrow on the prothorax, which is absent in Trachyaphthona. But this characteristic is not constant enough to separate both genera, therefore, Ohno (1961) synonymized them. Scherer (1969) mentioned again both genera giving reasons for it by the basal transverse furrow on the prothorax of Zipangia. However, as the development of this furrow is not always distinct and transition stages from furrowless to a weak furrow till a distinct one exist, all concerned species in our catalogue are mentioned as Trachyaphthona. In 1979 Scherer described 2

Fig. 3. To study the horizontal distribution the country was divided into 5 zones using the phytogeographical zones of Dobremez (1976) and further dividing the central part (C) into a western and an eastern one. (O = west, NO = north-west, C = central, E = east zone)

58

Eva Sprecher-Uebersax

further species of this genus from the Himalayas. Therefore, together with the new described species 12 species of Trachyaphthona from the Himalayas are known till now. T. hiunchulii shows an only weak furrow. Besides the shape of the aedeagus it differs from T. fulvicornis Scherer by the rounded sides of the prothorax, from T. infuscaticornis Scherer by the absence of spots on the elytra and the unicoloured antenna and from T. subcostata Medvedev by a non-ribbbed surface of the elytra. Further distinctive remarks were given in a key (Sprecher, 2000). The holotype was found in 1993 by Schmidt in the Annapurna Mts. near Ulleri south of Ghorepani at an altitude of 2000 m and is deposited in the Naturkundemuseum Erfurt in Germany. The 4 paratypes are from the same locality, 2 are deposited in the Naturkundemuseum Erfurt, 2 in the Naturhistorisches Museum Basel (Switzerland). Derivatio nominis: a peak in the Annapurna mountains near Ulleri, the village where the specimens were found gives the name. The massif of Annapurna consists of a chain of several very high peaks. One of them is the Hiunchuli. This peak and the Annapurna South are situated the nearest to Ulleri. While the Annapurna I with its 8091 m reaches the 8000 m-line, the Hiunchuli measures only 6441 m. Additional species not yet mentioned in the catalogue of the Chrysomelidae of Nepal are: Temnaspis quadrimaculata Bryant, Lema terminata Lac., Lilioceris cheni Gr./Kim., L. cyaneicollis (Pic), Aspidolopha melanophthalma (Lac.), Clytra gracilis (Lac.), Smaragdina dohertyi (Jac.), S. flavobasalis (Jac.), Coenobius birmanicus Jac., Cryptocephalus evae Lop., C. gestroi Jac., Basilepta beccarii (Jac., ), B. makiharai Kim., Cleorina fulva Jac., Colaspoides nepalensis Kim., Lypesthes albidus Pic, Platycorynus undatus (Ol.), Xanthonia oblonga Tak./Basu, Chrysolina tangalaensis Kim., Arthrotus nigripennis (Jac.), Aulacophora foveicollis (Lucas), Hesperomorpha hirsuta (Jac.), Monolepta lineata Weise, M. semiluperina Kim., M. severini (Jac.), M. trifasciata Jac.M. quadrisignata, Morphosphaera margaritacea Lab., Paridea ruficollis Jac., Pyrrhalta digambara Mlk., P. medvedevi Spr./Zoia, P. tatesuji Kim., P. indica Lab., Pseudoides marginalis (Chujo), Sastracella collaris Kim., Stenoluperus emotoi Kim., S. thundmensis Kim., S. verticalis Kim., Amphimela apicalis Kim., A. subgeminata Kim., Amphimeloides sexmaculatus Kim./Tak., Aphthona basantapurica Kim., A. dobangensis Kim., A. opaca All., Aphthonoides picea Scherer, Aphthonomorpha minuta Chen, Batophila castanea Scherer, Chaetocnema nigrica (Motsch.), Hemipyxis intermedia Jac., H. neelys (Mlk.), H. nigricornis Baly, Hespera dakshina Mlk., H. fulvimembris Kung/Chen, H. lomosa Mlk., H. naini Scherer, H. rufipes Mlk., H. strigiceps Kim., Letzuella viridis Chen, Longitarsus cheni Scherer, Luperomorpha nepalica Kim., Manobia shimai Kim., Manobidia major Kim., Maulika bengalensis Lop., Pentamesa haroldi (Baly), Phygasia hookeri Baly, Psylliodes shira Mlk., Sphaeroderma luteipenne Weise, S. nakanishii Kim., Tegyrius piceus Kim., Dactylispa higoniae (Lewis), D. platycanthoides Kim., Hispa ramosa Gyll (Kimoto 2001, Kimoto & Takizawa 2002, Lopatin 2002, Sprecher & Zoia 2002). Vertical Distribution The vertical distribution of the Nepalese leaf beetles is divided in 5 different zones. In each zone there are some typical species that are only found at this altitude and connected with food plants of this zone: At an altitude till 1000 m 299 species were found, 46 species only there, e.g. Aetheodactyla dimitiatipennis Baly, Galerucella birmanica (Jacoby), Aspidomorpha miliaris (Fabricius). It is a torrid zone with a typical vegetation of monsoon forests and agricultural fields with rice, corn, millet, tobacco etc. At an altitude of 1000-2000 m the biggest number of species was reported, that is totally 542 species and 159 only there, e.g. Chlamisus stercoralis Gressitt, Basilepta puncticolle (Lefèvre), Paridea tetraspilota (Hope). It is a subtropical zone with rather warm summer and rather cold winter. Bamboo, different grasses, lemon trees and Alnus nepalensis are growing there. At the following altitude of 2000-3000 m the climate is temperate. Rhododendron and conifers are the typical vegetation, there are still some fields with cabbage, carrots etc. 415 Chrysomelid species were registered there, 79

Nepal as a centre of speciation for Himalayan Chrysomelid fauna

59

only in this zone, e.g. Oomorphoides nepalensis Takizawa, Dercetisoma persimilis (Kimoto), Aphthonoides rotundipennis Scherer. At an altitude of 3000-4000 m the number of species is distinctly decreasing, only 146 species were registered and 21 exclusively there, e.g. Phaedon indicus Chen, Mimastra suwai Takizawa, Martensomela aptera Medvedev. Many of them are apterous. It is a subalpine zone reaching the tree limit and with a dry, frigid and windy climate. Rhododendron and Ericaceae, some potatoes

Cassidinae Hispinae Alticinae Galerucinae Chrysomelinae Eumolpinae Lamprosomatinae Chlamisinae Cryptocephalinae Clytrinae Megalopodinae Zeugophorinae Crocerinae Donaciinae Sagrinae 0

5

10

15

20

25

30

35 %

Fig. 4. The distribution of subfamilies (in %) at an altitude till 1000 meters.

Cassidinae Hispinae Alticinae Galerucinae Chrysomelinae Eumolpinae Lamprosomatinae Chlamisinae Cryptocephalinae Clytrinae Megalopodinae Zeugophorinae Crocerinae Donaciinae Sagrinae 0

10

20

30

40

50 %

Fig. 5. The distribution of subfamilies (in %) at an altitude between 3000 and 4000 meters.

60

Eva Sprecher-Uebersax

and barley are still growing. Finally, in the alpine zone at more than 4000 m only 25 species could be found, 7 exclusively there, e.g. Nepalogaleruca schmidti Medvedev and Sprecher, Asiorestia thoracica Medvedev, Paraminota nepalensis Döberl (Tab. 2). Almost all of them are apterous. This is the zone between the tree limit and the snow-line with extremely cold winter temperatures and a only short and cool summer. At an altitude of over 3000 m only species from Criocerinae, Zeugophorinae, Clytrinae, Cryptocephalinae, Eumolpinae, Chrysomelinae, Galerucinae and Alticinae were found, at more than 4000 m only 1 Cryptocephalinae, 7 Chrysomelinae, 6 Galerucinae and 11 Alticinae. The large number of Alticinae at high altitudes is very remarkable: 29% of all Alticinae were found above 3000 m, 39% of all Chrysomelid species at this altitude are Alticinae, while in lower altitudes Galerucinae and Eumolpinae are also quite numerous (Figs. 4, 5). Horizontal Distribution Also the horizontal distribution is interesting. The different occurrence of species is caused by the different climates in the western and eastern region which influence the vegetation: 657 species were found in the east of Nepal, 335 species only there, 432 in the west, 118 only there and 627 in the central zones, 321 only there. The east of Nepal reaching from the Arun till Sikkim shows a monsoon climate, while the west from the Dhaulagiri till the Indian boundaries is more dry with a meso- and xerophile vegetation. In the centre of the country the climate is less moist than in the east with a coexistence of hydro- and mesophile plants. Some species are differentiated in western and eastern subspecies, e.g. Chrysolina dhaulagirica dhaulagirica Medvedev and Meristata pulunini occidentalis Medvedev in the west and C. dhaulagirica arunensis Medvedev and M. pulunini pulunini (Bryant) in the east. The subspecies Chrysolina dhaulagirica arunensis differs from the nominative form in the bronze, not dark blue upperside, the feebler elytral rows of punctures, a more narrow red basal margin of the elytra and a smaller size. Meristata pulunini occidentalis differs from the typical M. pulunini by the colour: while the nominative form shows 2 small and round spots on the prothorax and a small and round preapical spot on the elytra, the western subspecies has only a single large transverse black patch in the middle of the prothorax and a rather large, distinctly transverse and often curved preapical spot on the elytra. Nepalogaleruca Kimoto is known with 4 species, N. angustilineata Kimoto and Takizawa has a more western distribution, N. elegans Kimoto a more eastern one, 2 further species were found in the central part. N. angustilineata which is found higher in the mountains has the blackish margins of the dorsal surface much more expanded than N. elegans which lives in lower regions. Species, which were only registered in the west, are e.g. Cryptocephalus notogrammus Suffrian or Smaragdina minutissima (Lopatin), both known from Afghanistan, Pakistan and India. Trachyaphthona fulvicornis Scherer and Nepalicrepis darjeelingensis Scherer, both known from India, are examples of species found only in the east. From the subfamilies Sagrinae, Zeugophorinae, Megalopodinae, Chlamisinae and Lamprosomatinae there are no species exclusively found in the west, also the Criocerinae have only a few species there. Among the Alticinae, Galerucinae and Hispinae there are also fewer species exclusively found in the west, but much more exclusively found in the east. Therefore, the moist climate in the east might be more favourable for some Chrysomelid species. Endemic Species Studying the Nepalese Chrysomelidae the most amazing fact is that the number of endemic genera is unusually large. Not less than 12 such genera were found, they are: Nepalolepta Medvedev

Nepal as a centre of speciation for Himalayan Chrysomelid fauna

61

Fig. 6. A relief of Nepal (Donner, 1994) showing the deep river valleys and the very high mountains separating the region into isolated habitats.

belonging to the Galerucinae as well as Aphthonaria Medvedev, Ascuta Medvedev, Chabriella Medvedev, Himalalta Medvedev, Martensomela Medvedev, Paraminota Scherer, Schawalleria Medvedev and Yetialtica Medvedev belonging to the Alticinae, all apterous, and Aphthonotarsa Medvedev, Asiorella Medvedev and Lipraria Medvedev, also Alticinae, but with wings. Nearly all are found at very high altitudes, 80% of them are apterous and they belong mainly to the Alticinae. There are also several endemic species which replace each other from east to west, e.g. Sclerophaedon besucheti (Daccordi), S. brendelli Daccordi and Medvedev, S. nepalicus Daccordi and Medvedev, S. takizawai Daccordi and Medvedev, Semenovia daccordii Medvedev and Sprecher and S. nagaja Daccordi or Asiorestia himalayana Medvedev and Sprecher, A. irrorata Medvedev, A. nepalica Medvedev, A. thoracica Medvedev and A. wittmeri Medvedev. The genus Sclerophaedon is mostly distributed in Europe, Semenovia is mainly found in China and Asiorestia is widely known in the Holarctic zone. DISCUSSION The rich spectrum of Chrysomelid species is due to the numerous faces of the Nepalese countryside. At high altitudes there are a lot of specialized species adapted to the rough mountainous conditions while pest species occur in lower regions where agricultural fields are found. Such large occurrence of endemics as is found in Nepal is in fact quite uncommon. However, there is no doubt that in the future some of them will probably be found also in other places of the Himalayan region. Till now there is no knowledge about the existence of these species in neighbouring countries, therefore, it is unknown if disjunctions do exist. The isolation in the mountain regions, the extreme

62

Eva Sprecher-Uebersax

altitudes and the reduction of wings may explain this high number of endemic genera and species. The very high mountains and the deep river valleys separating the region into isolated habitats offer good conditions for isolating populations and generating new species (Fig. 6). Therefore, Nepal might be a centre of speciation of Himalayan Chrysomelid species, which are spreading out from there into neighbouring regions. ACKNOWLEDGEMENTS I am extremely grateful to Lev Medvedev who encouraged me to do this study. I am also thankful to all persons who gave me the opportunity to study the collections in different museums. LITERATURE CITED Dobremez J.-F. 1976. Le Népal. Ecologie et biogéographie. Ed. Centre nature Recherche Scientifique. 355 pp. Donner W. 1994. Lebensraum Nepal - eine Entwicklungsgeographie. Institut für Asienkunde, Hamburg. 728 pp. Heikertinger, F. 1924. Die Halticinengenera der Palaearktis und Nearktis. Koleopterologische Rundschau 11(12):25-70. Kimoto S. 2001. The Chrysomelidae (Insecta: Coleoptera) collected by the Kyushu University Scientific Expedition to the Nepal Himalaya in 1971 and 1972. Bull. Kitakyushu Mus. Nat. Hist. 20: 17-80. Kimoto S. and Takizawa H. 2002. Chrysomelid beetles of Nepal Collected by the Himalaya Expedition 1979 of the National Science Museum, Tokyo. Bull. Natn. Sci. Mus. Tokyo, Ser. A 28 (3): 143-149. Lopatin I. K. 2002. New data on the leaf-beetles of the South and East Asia (Coleoptera, Chrysomelidae). Descriptions and synonymic remarks. Eurasian Entomol. J. 1 (1): 83-86. Medvedev L. and E. Sprecher 1999. Katalog der Chrysomelidae von Nepal. Entomologica Basiliensia 21:261354. Ohno M. 1961. On the species of the genus Trachyaphthona Heikertinger and the new genus Sphaeraltica. Tokyo Univ. Bull. Dept. Lib. Arts 2: 73-91. Scherer, G. 1969. Die Alticinae des indischen Subkontinentes (Coleoptera-Chrysomelidae). Pacific Insect Monographs 22:1-251. Scherer G. 1979. Ergebnisse der Bhutan-Expedition 1972 des Naturhistorischen Museums in Basel (Coleoptera: Chrysomelidae, Alticinae), 1.Teil. Entomologica Basiliensia 4:127-139. Sprecher-Uebersax E. 2000. Trachyaphthona hiunchulii, eine neue Alticinen-Art in Nepal. Entomologica Basiliensia 22:203-207. Sprecher-Uebersax E. and Zoia S. 2002. Pyrrhalta medvedevi sp. nov., a new species from the Nepal Himalayas (Coleoptera: Chrysomelidae, Galerucinae). Mitt. Schweiz. Ent. Ges. 75: 161-167.

© PENSOFT Publishers Leaf Beetle Fauna Sofia - Moscow

David G. Furth (ed.) 2003 of the Carpathian Basin (Central Europe): Historical Background... 63 Special Topics in Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 63-103

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background and Perspectives (Coleoptera, Chrysomelidae) Károly Vig1 1

Department of Natural History, Savaria Museum, H-9700 Szombathely, Kisfaludy S. u. 9., Hungary. Email: [email protected]

ABSTRACT First papers concerning the beetle fauna of the Carpathian Basin (Central Europe) are from the XVIII century (Scopoli 1772; Conrad 1782; Townson 1797). Due to the flourishing scientific interest, the exploration of the fauna accelerated in the XIX century. The results accumulated made possible to elaborate the unique volumes of the catalogue entitled Fauna Regni Hungariae published between 1897 and 1920. Authors of the catalogue presented all faunistical data for all animal taxa known from the Carpathian Basin at that time. In the paper concerning the beetle fauna one can find locality data of 508 leaf beetle species (Kuthy 1897). In the middle decades of the XX century a huge project, the series of Fauna Hungariae was launched. As a part of this monumental work the late Zoltán Kaszab revised the leaf beetle material of the Carpathian Basin preserved in the Hungarian Natural History Museum (Budapest) and published the result as a 63rd volume of the series (Kaszab 1962a). According to Kaszab’s work the fauna of the Carpathian Basin includes 628 species and subspecies of Chrysomelidae. It is necessary to note, that Kaszab incorporated more than 50 species into his key that could occur on the recent territory of Hungary. During the seventies and nineties exhaustive collections were carried out in the territory of Hungarian National Parks and other protected areas of the country. The results of these investigations added new species to the checklist of the Chrysomelidae of the area and a lot of localities meant new records to the distribution of some rare species. Summarizing the new evidences the fauna of the Carpathian Basin includes 666 species and subspecies of Chrysomelidae (this number includes all questionable taxa.). On the other hand 525 species or subspecies (with some doubtful species) are known from the present-day territory of Hungary. Recently similar considerable collections are being concluded in Hungary, though their results still have not been published yet. We do hope that these investigations will enrich the fauna with new species or at least some new distribution records. In this paper author defines the territory of the Carpathian Basin as a biogeographical unit and outlines the faunistical researches are to be done on the area in the future.

HISTORICAL BACKGROUND The first entomological work by a Hungarian, András Regéczi Horváth, was published in 1637, in Wittenberg, entitled: “Disputatio Physica de Insectis” (Fig. 1.). In the XVIII century other zoological

64

Károly Vig

Fig. 1. The front page of the first entomological paper written by Hungarian author, András Regéczi Horváth. It was published in 1637 in Wittenberg.

works followed it, but already in Hungarian language. In 1702 the “Egy Jeles Vadkert” (“A Prominent Game Preserve”) was published, by Gáspár Miskolci (Miskolci 1702) after which János Molnár (Molnár 1783) and István Gáti (Gáti 1792, 1795) published a natural history work in Hungarian language. In these works, however, few words were written about insects. One of the first publications on beetles appeared in the book of Giovanni Antonio Scopoli dealing with description of new beetle species. Eighteen of these species were found in the territory of historical Hungary (Scopoli 1772). A similar situation can be found in the case of data by Antoine Guillaume Olivier (Olivier 1789) and Christian Creutzer (Creutzer 1799). Mátyás Piller and Lajos Mitterpacher published an excellent description about their two-month research trip in Szerémség (now in Serbia), in 1782 in Latin language and described 42 new beetle species (Piller and Mitterpacher 1783). An anonymous author published 74 beetle species from Bars County (now in Slovakia)(Anonymous 1792). József Conrád listed 30 beetles, mostly Lamellicornia, from Sopron County (Conrád 1782). In the period prior to 1800, the work that dealt with the largest number of beetles, and which described many new species concerning the Carpathian Basin, was the travel book and the attachment of this book by an English nobleman, Robert Townson (Townson 1797) (Fig. 2). The imposingly rich species list and some habitat descriptions constitute the first comprehensive coleopterological work published about Hungary (Merkl 1999). A few years later in the list published on his own collection, Tóbiás Koy enumerated 2,765 beetle species (Koy 1800) (Fig. 3.).

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

Fig. 2. The front cover of the book published by Robert Townson on his journey in Hungary in the year 1793. Its appendix “Entomologia” is an important piece of the early entomological literature of Hungary and it is considered to be the first faunistic list of beetles from present-day Hungary.

65

Fig. 3. The front cover of the paper published by Tóbiás Koy on his own insect collection. In his list 2,765 beetle species were enumerated. This booklet is a unique rarity.

In the XIX century, the publications concerning the Hungarian insect fauna were increasingly widening. According to the discoveries up to that date, Imre Frivaldszky could publish an excellent book in 1865. In this pioneer work Frivaldszky firstly recognized the characteristic species for the Carpathian Basin from the aspects of zoogeography and fauna development and presented the characteristic species to it (Frivaldszky 1865). Taking into consideration the one and half century passed we can deservedly state that the study of Imre Frivaldszky is still a milestone in the knowledge about the Hungarian fauna. A relative of Imre Frivaldszky, János Frivaldszky, made the lion’s share of explorations of the Hungarian beetle-world, touring through and through historical Hungary together with the preparator János Pável and collecting a significant quantity of material during their expeditions. The results of the work has been published in the form of reports. The influence of his activity has been spread all over the Carpathian Basin. The work of the two Frivaldszky’s formed the scientific basis for the regular exploration of the Hungarian fauna, the start of which can be dated to the second half of the XIX century. The results of the research work have been summarized in a huge study book, published at the end of the

66

Károly Vig

century, being unique in those times: the work presenting the faunistical knowledge on the whole Carpathian Basin. The book “A Magyar Birodalom Állatvilága – Fauna Regni Hungariae” (The Fauna of the Hungarian Empire), has been published in several volumes. This work constituted a decisive starting point for all faunistic activities for long decades (Fig. 4.). Although the Arthropoda part was indicated as published in 1900 (Fig. 4), we do not generally know the dates for all the individual chapters within the Arthropoda, but we do know that the Coleoptera chapter was published in 1897 by Dezső Kuthy. Who could the undertaking rely on? Could the small number of zoologists undertake the exhaustive work of collection, work-up and publication? Although the period after the Conciliation between Hapsbourg-Austrian Empire and Hungary in 1867, the economical boost, social “peace” created a much more flexible atmosphere for the scientific research than we can find today, the answer is still: “perhaps not”. The Hungarians, considering the number in the society, offered a large number of internationally renowned zoologists to the world. It should be enough to mention the names of Imre Frivaldszky, János Frivaldszky, Ottó Herman, Sándor Mocsáry, Győző Szépligeti, Géza Horváth, Kálmán Kertész, Ernő Csiki, Lajos Bíró. We must not forget, however, that besides these personalities, all over the country, a large number of amateur entomologists (in the noblest sense of the word) were working in the exploration of the neighbouring living world: teachers, doctors, pharmacists,

Fig. 4. The front page of volume Arthropoda of the book “A Magyar Birodalom Állatvilága – Fauna Regni Hungariae” (The Fauna of the Hungarian Empire). All arthropod taxa known from the Carpathian Basin at that time was gathered into this unique volume.

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

67

church and other officials. Many people were bending over insect boxes day after day with magnifying glasses with the help of what was at the time excellent entomological books in the quiet and familiarity of the country houses, and teachers’ rooms. If the attempts proved to be without results, the experts of the Natural History Museum, Budapest, could always find time to examine the collected material. The school yearbooks, newsletters and the starting zoological papers meant publication opportunity for the results consisted mainly of the animal species’ list found in the environs of certain towns and villages. Where are these collections today? The storms of the last century left one or two of them behind. The chaos of the wars, the lack of care, and laziness caused the loss of the collections that documented the abundance of the fauna of the Carpathian Basin at that time. Therefore, unfortunately enough, the data included in some rare publications can be accepted only with doubt by zoologists of today. The chapter dealing with the beetles in the “A Magyar Birodalom Állatvilága” – “Fauna Regni Hungariae” (The Fauna of the Hungarian Empire) has been compiled by Dezső Kuthy. In the enumeration a total of 6,043 beetle taxa are presented, constituting 60% of the today known taxa in Hungary. The list contains the occurrence data of 508 leaf beetle species (Kuthy 1897). RESULTS OF THE XX CENTURY Hungary, as a losing party in the First World War, and according to the Trianon Peace Treaty, lost two thirds of her area and one third of her population. The regions being under Hungarian rule were attached to Austro-Hungarian Empire’s successor states. Hungary got only the inner areas of the Carpathian Basin. The researcher familiar with the Central-European faunistical literature, therefore, can encounter several versions (our faunal region, the area of the historical Hungary, the area of the Carpathian Basin) that mean the same thing in the literature, but these are different than the present territory of Hungary. The term “Carpathian Basin” geographically means the mountains of the Carpathians and the territory enclosed by the arch of the Carpathians and the high mountains of the Alps, bordered in the southwest by the Dinaric Mountains. This border is more or less arbitrary. The contour line roughly follows the altitude 600 meters on the outer slopes of the Carpathians and on the eastern slopes of the Alps. In the case of the Dinaric Mountains it follows the altitude 200 meters. This territory belongs to 11 countries (Austria, Bosnia and Herzegovina, Croatia, Czech Republic, Hungary, Poland, Romania, Slovakia, Slovenia, Ukraine, and Yugoslavia). The entire territory of Hungary and Slovakia belongs to this entity (Móczár 1972; Vidlička and Sziráki 1997) (Fig. 5.). The change of area of Hungary as well as the change of the taxonomical-systematical knowledge caused large-scale faunistical exploration work concerning the present territory of Hungary. In the 1950s a research program commenced within a framework of new booklets that are still published. The authors of “Magyarország Állatvilága – Fauna Hungariae” (The Hungarian Fauna) series present the taxa of the Hungarian animal kingdom, providing identification keys for determination. As a part of this monumental undertaking, the late Zoltán Kaszab worked up the Budapest Natural History Museum’s full Carpathian Basin leaf beetle collection, about 100,000 specimens. The collection includes the old, so-called historical collections and the recent collections as well. The huge collection includes almost all species and varieties published from territory of present-day Hungary and the Carpathian Basin. The result of this has been published in the 63rd volume of the “Magyarország Állatvilága” (Kaszab 1962a) (Fig. 6.). The most important data were published in a

68

Károly Vig

Fig. 5. The schematic map of the Carpathian Basin and the adjoining territories. The continuous line represents the contour line of the basin, the dotted lines represent the borders of countries (modified after Vidlička and Sziráki 1997).

separate publication (Kaszab 1962b). According to that study there were 628 species and 829 varieties known in the Carpathian Basin. A species (Longitarsus pannonicus) and two subspecies (Chrysomela [=Chrysolina] aurichalcea problematica; C. hemisphaerica bechyéana),1 as well as 83 varieties were new to science while 4 species, 5 subspecies and 7 forms proved to be synonyms and 2 subspecies and 4 forms had to be renamed.2 These taxonomical and nomenclatural results were to be expected as nobody dealt before in detail with the leaf beetles of the Carpathian Basin. Taking into consideration the topographical, orographical relations of the Carpathian Basin and its rich flora, this number of 628 leaf beetle taxa is not incredible at all. However, it has to be mentioned that Zoltán Kaszab indicated the presence of several species based on literature data only, while the species had no voucher specimen in the collections. Or, if there was a voucher 1

Today, the species and perhaps the two subspecies described by Zoltán Kaszab are not valid taxa. In the time when Zoltán Kaszab’s faunistical work had been carried out, special attention was paid to differentiation and documentation of different forms. Today, due to the changes in species concept, these taxonomical categories, as manifestations of the variety within the species level, have less importance. This, however, is true for the zootaxonomy only. The botanists are still paying special attention to the differentiation of these micro-taxa. 2

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

69

Fig. 6. The cover page of the leaf beetle monograph by the late Zoltán Kaszab published as a 63rd volume of the series Fauna Hungariae.

specimen, the label had a mark of the country name only (e.g. “Hungaria” or “Hungaria cent”). Besides these, almost 50 species were included in the identification key, which do not presently occur in Hungary, they can be found somewhere in the Carpathian Basin only. The third phase of the Hungarian fauna research is the knowledge of the living world of the areas under environment protection. The experts of the Hungarian Natural History Museum (Budapest) researched mainly the fauna and flora of the national parks while the researchers working in other cities’ museums were researching the areas related to a particular museum. Besides this most recent scientific material, mostly found in the Hungarian Natural History Museum (Budapest), the provincial museums also have coleopterological materials of inestimable value. The collections began to grow in the 1950s and 1960s when the newly graduated members of the natural science researchers and museologists began to work. These collections were carried out in more “untouched” parts of Hungary, in several habitats that were later diminished or intensely degraded. Based on the material collected we can form a picture of the former areas and their vegetation. By studying the material of collections and comparing it with the present data we can predict the short time-scale flora and fauna changes. In parallel with this, the evaluation of data provides a pivot point for the changes in distribution and population relations of certain species. It is not accidental that the study of the collections found in museums has a prominent role in the strategic research program commenced by the Hungarian Academy of Sciences.

70

Károly Vig

In the beginning years of the above-mentioned research, a book about the Bátorliget Natural Protection Area was published in 1953. As a result of the intensive collection and study, Bátorliget became the best-researched area of the country. The beetles were studied by Zoltán Kaszab and Viktor Székessy (Kaszab and Székessy 1953). They indicated the presence of 152 leaf beetle species in the area (and 22 varieties as well). After forty years, the experts of the museum examined again the fauna of the area and revised the material collected in the 1950s, therefore, 190 leaf beetles are known from that area today (Merkl 1991). Besides these large-scale programs, several provincial research programs commenced reviewing the natural values of a given region or protected area. The realization of the program entitled: “A Bakony Természeti Képe” (The Natural History of Bakony Mt.) commenced in 1962 in the Bakony Museum (Veszprém). This was the first such undertaking in the country serving as a model for similar research later. In the southern part of the Transdanubia, the Barcs Landscape Protection Area, the BédaKarapancsa Landscape Protection Area, the Boronka Landscape Protection Area as well as along the Dráva River intensive research work has been carried out. After the fashion of the programs mentioned above the Department of Natural History of the Savaria Museum (Szombathely) commenced the research program entitled „Az Alpokalja Természeti Képe” (Natural History of Praenoricum). On the commission of the Fertő–Hanság National Park, the colleagues of the Savaria Museum researched the living world of the Őrség Landscape Protection Area in 1994-95. The exploration of the fauna of the Hortobágy National Park resulted in four new species, which are missing, from Kaszab’s Chrysomelidae book (Tomov and Gruev 1981). Chaetocnema picipes (Marsham) was found from the forests of the national park, and recently was collected at several other localities. Its distribution is much wider than it appeared to be earlier. Revision of the Chaetocnema concinna (Marsham) material of Hungarian collections will result in further locality data of this species. Longitarsus junicola (Foudras) specimens collected in the Hortobágy NP were confused with Longitarsus lycopi (Foudras), however, Carlo Leonardi (Milan, Italy) has selected and identified some specimens. There were three additional specimens from the Kiskunság NP, which were also identified by Carlo Leonardi (Gruev et al. 1987). Longitarsus salviae Gruev was first recorded from Hortobágy NP and later was collected from other parts of the country. Longitarsus noricus Leonardi was until now known from Nagyvázsony (Transdanubia), but, in fact it has a wide distribution in the country. The late Josef Král (Prague, Czech Republic) was the first who dared to revise the Hungarian material of Longitarsus pratensis group. He reported two species as new to the Hungarian fauna: Longitarsus strigicollis Wollaston (as L. bombycinus Mohr) and Longitarsus reichei (Allard). Two specimens of Longitarsus strigicollis were collected in the Kiskunság NP (Gruev et al. 1987), while Longitarsus reichei seems to have wider distribution in the country since that time. Almost two decades later, on the basis of the most recent systematic results, Blagoy Gruev (Plovdiv, Bulgaria) and Otto Merkl (Budapest, Hungary) revised again the Hungarian material of Longitarsus pratensis group (Gruev and Merkl 1992). There are two other Longitarsus species missing from the faunal book. Longitarsus bertii Leonardi occurs all over the country, while Longitarsus medvedevi Shapiro has only a few data up to now. Both species had been collected a long time ago, but were misidentified. Finally, Longitarsus brisouti Heikertinger deserves also a note. It is a very rare species in Hungary; only two additional specimens were captured during the collecting programs (Tomov and Gruev 1981). One Altica and one Phyllotreta species were also added to the checklist. Both Altica cornivorax Král and Phyllotreta astrachanica Lopatin, formerly confused with Phyllotreta diademata (Foudras) (Gruev 1982), are widely distributed species all over the country.

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

71

The species listed above come mainly from the Great Plain of Hungary, but many rare species were found on the hilly areas of the country as well. While the northeastern part of Hungary, the Bükk and the Zemplén Mountains were open for entomological research, the western areas along the Austrian and Yugoslavian borders were closed due to the well-known political situation. Only when the program “Natural History of Praenoricum” started in 1976 was there opportunity for entomological collecting behind the “iron curtain” on the territory of the Őrség and of the Kőszegi Mt. These investigations resulted in many new localities to the distribution of mountainous species that were formerly known from the Bükk or Zemplén Mt. only (see for more details Vig 1992). The leaf beetle fauna of the Western Transdanubia has been studied in the middle 1990s (Vig 1996). The area covered contained the territory of Őrség, from where the results concerning the leaf beetle fauna had already been published (Vig and Rozner 1996). The most noteworthy result was the discovery of three species that were new to the Hungarian fauna. Cryptocephalus querceti Suffrian and Chrysolina eurina (Frivaldszky) are rare in our faunistic region, while the distribution of Oulema duftschmidi (Redtenbacher) can only be confirmed after the revision of the whole Hungarian Oulema melanopus (Linnaeus) material. The Bükk National Park is situated in the northeastern part of Hungary. The territory of the national park consisting of karstic highland and an extensive submountain region covers the largest part of the Bükk Mountains. Only very little has been known up to now about the chrysomelid fauna of this region. Between 1954 and 1956 several organized collecting trips were carried out by the Hungarian Natural History Museum, but on a limited basis. The old material is mainly originates from this fieldwork. An intensive collecting program has been carried out by the same museum between 1981 and 1985. It covered various habitats all over the national park and yielded many more specimens. A total of 278 leaf beetle species were collected in the Bükk NP of which four species Chrysolina aurichalcea (Mannerheim); Neocrepidodera motschulskii (Konstantinov); Dibolia carpathica Weise and Minota halmae (Apfelbeck) proved to be new to the Hungarian fauna (Tomov et al. 1996). The morphological characters of one old Chrysolina aurichalcea specimen known from the territory fits well the description of subspecies Chrysolina aurichalcea problematica (Kaszab) from Transylvania. However, another specimen from the nearby Mátra Mt. is identical to the northern subspecies Chrysolina aurichalcea bohemica (G. Müller). Since that time several specimens were collected in the territory of the Aggtelek National Park (Jósvafő: Nagyoldal) (Vig 1999). Its subspecific division, if any, needs further clarification. A single Minota halmae specimen was collected. It was the first voucher Hungarian specimen. A re-examination of the Minota material collected in the Carpathian Basin resulted in the discovery of two further specimens from Zirc (Bakony Mt.). At the same time a lot of old Minota carpathica Heikertinger specimens were known from the Bükk Mt. The Hungarian material was elaborated by the late Zoltán Kaszab who identified it as M. obesa carpathica Heikertinger, Maurizio Biondi (L’Aquila, Italy) raised it to a species rank. The Aggtelek National Park is situated on a southern extension of the Gömör–Torna Karst, which is connected to the Slovak Karst. Until the 1990s scarcely anything had been known on the non-cavernicolous fauna of the territory. This statement especially concerns the insects, consequently there was no data for the Chrysomelidae of the territory. Only several random collections were made by the late Zoltán Kaszab yielding a few specimens only. An intensive collecting program has been carried out by the staff of the Hungarian Natural History Museum (Budapest). Identification of the chrysomelid material yielded 243 species. Two species, Longitarsus pallidicornis Kutschera and Longitarsus monticola Kutschera proved to be new for the Hungarian fauna. The collecting resulted the first voucher specimens of Longitarsus nanus (Foudras) from the recent territory of Hungary.

72

Károly Vig

Two interesting Lilioceris specimens were also caught. The sclerotized parts of the genitalia of these specimens differ from the genuine Lilioceris merdigera (Linnaeus). There is no detectable difference in external morphology, if only that, the tarsal joints are red, while these joints are black in specimens of genuine Lilioceris merdigera. Further specimens are needed to clarify the status of these species. Psylliodes illyricus Leonardi and Gruev was described from Hungary and from the Balkan region (Leonardi and Gruev 1993). Since that time, several additional specimens were captured in the territory of the Aggtelek NP (Vig 1999). The next study considered the leaf beetle material data gathered in the area of the Duna–Dráva National Park, more exactly, at the Barcsi Borókás Landscape Protection Area in the 1970s and 1980s as well as at the Dráva-side areas in 1992-94 and later, in 1996-97. 156 leaf beetle taxa could be shown from the examined area. The collection of two specimens of Chrysolina eurina constitutes a prominent faunistical data – this species up to this time has been known from the Őrség only. The leaf beetle fauna is interesting because of numerous rare (or rated as rare) species (Vig 1998a). The evaluation of the Villány Hills commenced in 1997. Numerous experts contributed to the fieldwork. 161 leaf beetle species with more than 1,400 specimens were collected from the area (Vig 2000). The author has studied the Mátra Museum’s (Gyöngyös) leaf beetle collection. The collection includes 210 leaf beetle species and more than 3,000 specimens. During the work, five leaf beetle species were found from the Bükk Mountains area that were missing from the publication on the Bükk National Park leaf beetle fauna. The following taxa are uncertain concerning distribution, and taxonomic status: Chrysolina aurichalcea taxons of subspecies rank (ssp. bohemica and ssp. problematica), the members of Chrysolina hemisphaerica species complex and the members of Chrysolina rufa species complex (Vig 1998b). The Savaria Museum at Szombathely has bought in 1995 the leaf beetle collection of Attila Podlussány, an amateur coleopterologist. The collection has 13,000 leaf beetle specimens, mostly deriving from the Carpathian Basin as well as the Balkan Peninsula. Recently the author studied the specimens from northern, central and southeastern Europe (except Turkey), about 10,000 specimens. This part of the collection represents 442 taxa. During the study, the differentiation of several highaltitude species could be clarified regarding the Balkan Peninsula. Two new species to the Hungarian fauna could be found (Lilioceris schneideri (Weise); Cassida bergeali Bordy) (Vig 2002). A specimen of the Cassida bergeali Bordy, was captured by Slovak colleagues (Jan Bezděk and Aleš Bezděk) in Hungary, therefore, this was the first proof of Hungarian occurrence of the species (in coll. K. Vig). The Cassida leucanthemi Bordy species was described near Cassida sanguinolenta O. F. Müller that is common in the Carpathian Basin. Since the Cassida leucanthemi has been found in Poland (Borowiec and Świętojańska 1997), it is expected to occur in Hungary as well. The revision of the whole Carpathian Basin material regarding the Cassida sanguinolenta and Cassida vibex Linnaeus is necessary. Similarly, concerning the Galerucella nymphaeae (Linnaeus) it turned out that it is a complex of several related species (Lohse 1989). In this case also a full revision of the material from the Carpathian Basin is needed in order to decide which species of the complex can be found in the affected area. In the fauna book of Zoltán Kaszab (Kaszab, 1962a), only two Lilioceris-species were mentioned: Lilioceris lilii (Scopoli) and the Lilioceris merdigera. In the revision work on the genus (Berti and Rapilly 1976) the authors indicated the occurrence of Lilioceris faldermanni (Guérin-Meneville) and Lilioceris schneideri from Hungary. The voucher specimen of Lilioceris schneideri has actually been found (Vig 2002).

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

73

Diabrotica virgifera Le Conte a serious pest of maize, was introduced to Serbia by organized charities during the Balkan War. It was firstly discovered near Belgrade. Its range in Serbia has expanded and reached the southern border of Hungary in the 1990s. Recently it has become established in the warm, southern counties (mainly in Békés County) of the country, but it reached the southern border of Slovakia as well. Cryptocephalus species and forms included in the hypochaeridis group were critically studied by Carlo Leonardi and Davide Sassi. They, among others, elevated C. hypochaeridis hypochaeridis (Linnaeus) and C. hypochaeridis transiens Franz to a species rank and described a new species, C. solivagus Leonardi and Sassi. All three species occur in the territory of the Carpathian Basin (Leonardi and Sassi 2001) but, on the other hand, their exact distribution is unknown yet. In the following some additional species are mentioned that are known from the Carpathian Basin fauna, therefore, their occurrence in Hungary is to be expected or, they have to be deleted from the fauna of Hungary (for details see Strejček 1993; Gruev and Döberl 1977): Phyllotreta acutecarinata Heikertinger; Aphthona beckeri Jacobson and Longitarsus nimrodi Furth are recorded from Slovakia, thus these species are expected to occur in Hungary. Longitarsus bulgaricus Gruev is known from Herkulesfürdő (=Baile Herculane, Romania), thus this species also a member of the leaf beetle fauna of the Carpathian Basin (Gruev and Döberl 1997). Longitarsus callidus Warchałowski is distributed from Asia Minor through southeast Europe to Austria, thus the occurrence of this species in Hungary was quite probable. Recently this species was collected in the territory of the Fertő–Hanság National Park (Vig in press a). In the surrounding of Hungary, Longitarsus celticus Leonardi is known from Austria (environs of Vienna) and Ukraine. Psylliodes laticollis Kutschera is known from Croatia (Dalmatia). Mantura mathewsi (Stephens) distributed near Hungary in Austria, Croatia, Slovakia and Ukraine (Carpathians) while Neocrepidodera brevicollis (J. Daniel) is known from south Austria and Slovakia. Occurrence of all of these species in Hungary is quite probable. Altica fruticola (Weise) was originally described from Transsylvania (Romania). Recently it is known from Austria, Romania and Ukraine (Carpathians). Its occurrence in Hungary is probable. Crepidodera nigricoxis (Allard) is distributed in the Balkan Peninsula, Slovenia and Austria. Its occurrence is expected in the southern parts of Transdanubia (Hungary). Cryptocephalus bameuli Duhaldeborde was recently decribed from Cryptocephalus flavipes Fabricius material. This species is suspected to occur in the whole Palearctic Region, thus its occurence in Hungary is not surprizing (Duhaldeborde 1999). One specimen of Cryptocephalus marginellus Olivier and one specimen of Cryptocephalus czwalinai Weise are known both from Siófok (coll. Lichtneckert). The occurrence of these species in the recent territory of Hungary is questionable, thus they distribution needs further confirmation. The species Chrysolina substrangulata Bourdonné was described based on a single specimen, with a locality indicated as “Hungaria” (Bourdonné 1986). There is little chance that record was from Hungary, because in our limestone mountains, the most possible places for the occurrence of the species (e.g. Bükk Mt., Villány Hills or the Aggtelek Karst), intensive collections were recently performed. It can be supposed that the species is from the present-day Croatia or Slovenia. In these places another species of the Bechynia subgenus, the Chrysolina milleri (Weise) also occurs. The occurrence of Sclerophaedon carniolicus (Germar) has been indicated based on literature data by Zoltán Kaszab, from the Mecsek Mt. The examination on the specimen kept in the Janus Pannonius Museum (Pécs) reveals that the identification was a mistake and the species has to be deleted from the Hungarian fauna (Vig in press b). Kaszab (1962b) described a species: Longitarsus panonicus Kaszab that turned out to be a junior synonym of Longitarsus tristis Weise. It had been listed as an endemic species for the Carpathian Basin.

74

Károly Vig

The whole area of Slovakia and Hungary constitutes a geographical unit of the Carpathian Basin, therefore, it is natural that the researchers of these countries could have a higher contribution to the knowledge of the Basin’s fauna. The Slovakian colleagues are working with high intensity (Strejček 1993; Čižek 1995; Čižek et al. 1995; Zúber 1995; Bezděk and Bezděk 1998; Čižek and Fornůsek 2000) and based on their work the Hungarian fauna also was increased with a flea beetle species: Aphthona aeneomicans Allard (Čižek and Fornůsek 2000). A significant part of the neighbouring Romania also belongs to the Carpathian Basin. Unfortunately, Romania in recent times has no expert in leaf beetles, therefore, Hungarian experts and a foreign colleague carried out the revision of the Romanian flea beetles. As a result of the revision, four species new to the Romanian fauna were found: Chaetocnema picipes; Chaetocnema montenegrina Heikertinger; Longitarsus absynthii Kutschera and Longitarsus kutscherae (Rye) (Gruev et al. 1993). All four species were found in Transylvania, therefore, they form a part of the leaf beetle fauna of the Carpathian Basin. Summarizing the new evidence the fauna of the Carpathian Basin includes 666 species and subspecies of Chrysomelidae, including all questionable taxa. On the other hand 525 species or subspecies (with some doubtful species) are known from the present-day territory of Hungary. Finally, a brief remark should be added. It is evident that new faunistic results come from places where significant collecting has been carried out. Recently, similar significant work has been concluded in several parts of Hungary (for example, in the territory of the Fertő–Hanság National Park and the Kőrös–Maros National Park) and in the Carpathians, though their results still have not published. We hope that these investigations will enrich the fauna with new species or at least some new distribution records. OVERVIEW AND FUTURE POSSIBILITIES The diversity of the insects according to our present knowledge exceeds any other group of living origanisms and at the same time this diversity is highly jeopardized. Besides the protection of this biodiversity, it is also necessary to become familiar with this diversity as much as possible, to document its element species with specimens, to preserve them and to make them available for future research. The entomological collections play a decisive role in this task. Unfortunately, the role of these collections has been underestimated over a long period, collectionsbased scientific work has been deemed unnecessary by many and the financial support for collections maintenance has been minimal. This has happened for several reasons in Hungary (Papp 1983; Mahunka and Vásárhelyi 1990). Despite the supposed awareness the leading role of taxonomy in biodiversity, there has been little support and relief. The problem is even worse because taxonomy is bound to specimen collections which voucher the scientific experience through specimens, and their continuous development and protection. The ever-increasing pressure of collections maintenance and conservation burdens each institution, mainly museums, with the exponential growth of the costs and work. Of course, at the same time the collection thus reduces the overall ability and flexibility of the institution to do a great variety of things. Therefore, in several cases the research institutions which are exempt from the “burden” of collections, thus avoid those large costs and become more flexible to use the majority of their resources for other things they consider to be more “popular” or appealing to the public or more effective for fund raising. In the competition for resources, especially funding, the museums start with a handicap, because expectiations of their history, culture and society require the unconditional preservation of their collections (Vásárhelyi 1998).

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

75

The decrease of social appreciation of the taxonomical research and its low level of support for decades is responsible for the “aging and decline” of this profession. Certain groups have no Hungarian – or even European – expert anymore. The negative comments above characterize not only Hungarian taxonomy, but similar tendencies can be observed in other countries of Europe. Although the participants of the “Rio Conference” declared the importance of the preservation of biodiversity and its knowledge, little has been done beyond the solemn declarations and nothing has been done for the creation of the financial foundation to ensure this. In Hungary, the site for taxonomic work is in most cases a museum. The restricted financing of public collections as well as the decrease of appreciation of professionalism in museums means that less and less are “born” as museum researchers. Glancing around, we can see that in all countries of the Carpathian Basin there is a similar situation. Although taxonomic research is not always burdened with political problems, it is still a delicate question to answer who can perform taxonomic work, not only the study, but also the collection management (curation). Who is allowed to coordinate a faunal exploration program for the whole Carpathian Basin? Should a single country monopolize this task? The nostalgic reminiscences of the historical past do entitle us to proclaim ourselves as the best participants of this work? (Taking into consideration that the majority of collections of the Carpathian Basin representing almost all groups of the living world are kept in Budapest!) At the XVIII National Meeting of the Hungarian Muselogists of Natural Sciences (Piliscsaba, 79 August 2000), entitled “Museums of Natural Sciences in the Carpathian Basin”, experts from Hungary and neighbouring countries accepted a co-operative declaration and drafted outlines for future joint research. The context of this collaboration depends on many factors and on the researchers themselves. Scientific experts consider it more important to know and preserve the elements of the living world, in spite of the impediments of politics, economics and history. The leaf beetle fauna of the Carpathian Basin is still unexplored. Both the nomenclature changes and new taxonomic examination methods can help rewrite the older manuals. We can state with reasonable hope that the future still has many of tasks for taxonomists for whom research is equally a source of joy and a profession. AN UPDATED CHECK-LIST OF CHRYSOMELIDAE OF THE CARPATHIAN BASIN István Rozner updated the leaf beetle fauna of the Carpathina Basin in 1996 (Rozner 1996). Unfortunately, due to the systematic, nomenclatoric changes, new faunistic evidence appeared since that time and some errors and misspellings were made, the list needs strong revision. The systematics and nomenclature are based generally on Mroczkowski (1990), Kippenberg and Döberl (1994, 1998), and Gruev and Döberl (1997) in the following check-list. The names used by Kaszab (1962a) differing from those in the present follow them and are after equal sign (=). The taxa in brackets ([ ]) are expected to occur in the recent territory of Hungary but do occur in the Carpathian Basin or in the adjoining territories as well. A question mark (?) means that the validity of the taxa is questionable. Orsodacninae Orsodacne Latreille, 1802 Orsodacne cerasi (Linnaeus, 1758) Orsodacne lineola (Panzer, 1794)

76

Károly Vig

Zeugophorinae Zeugophora Kunze, 1818 Zeugophora flavicollis (Marsham, 1802) [Zeugophora frontalis Suffrian, 1840] Zeugophora scutellaris Suffrian, 1840 Zeugophora subspinosa (Fabricius, 1781) Donaciinae Haemoniini Chen, 1964 Macroplea Samouelle, 1819 = Haemonia Latreille Macroplea appendiculata (Panzer, 1794) Macroplea mutica balatonica (Székessy, 1941) Donaciini Kirby, 1837 Donacia Fabricius, 1775 [Askevoldia Kippenberg, 1994] [Donacia (Askevoldia) reticulata Gyllenhal, 1817] Donacia s. str. Donacia (s. str.) antiqua Kunze, 1818 Donacia (s. str.) aquatica (Linnaeus, 1758) Donacia (s. str.) bicolora Zschach, 1788 Donacia (s. str.) brevicornis Åhrens, 1810 Donacia (s. str.) crassipes Fabricius, 1775 Donacia (s. str.) dentata Hoppe, 1795 Donacia (s. str.) impressa Paykull, 1799 Donacia (s. str.) malinovskyi Åhrens, 1810 = Malinovskyi Ahrens Donacia (s. str.) marginata Hoppe, 1795 Donacia (s. str.) obscura Gyllenhal, 1813 [Donacia (s. str.) polita Kunze, 1818] Donacia (s. str.) semicuprea Panzer, 1796 Donacia (s. str.) simplex Fabricius, 1775 [Donacia (s. str.) sparganii Åhrens, 1810] Donacia (s. str.) thalassina Germar, 1811 Donacia (s. str.) versicolorea (Brahm, 1790) = versicolor Brahm Donacia (s. str.) vulgaris Zschach, 1788 Donaciella Reitter, 1920 Donacia (Donaciella) cinerea Herbst, 1784 Donacia (Donaciella) clavipes Fabricius, 1792 Donacia (Donaciella) tomentosa Åhrens, 1810 Plateumarini Askevold, 1990 Plateumaris Thomson, 1859 Plateumaris s. str. Plateumaris (s. str.) sericea (Linnaeus, 1758)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = discolor Panzer Juliusina Reitter, 1920 Plateumaris (Juliusina) braccata (Scopoli, 1772) Plateumaris (Juliusina) consimilis (Schrank, 1781) Plateumaris (Juliusina) rustica (Kunze, 1818) = affinis Kunze Criocerinae Lemini Heinze, 1962 Lema Fabricius, 1798 Lema cyanella (Linnaeus, 1758) Oulema Gozis, 1886 = Lema Lacordaire Oulema duftschmidi (Redtenbacher, 1874) Oulema erichsonii (Suffrian, 1841) = Erichsoni Suffrian Oulema gallaeciana (Heyden, 1870) = lichenis Voet Oulema melanopus (Linnaeus, 1758) Oulema rufocyanea (Suffrian, 1847) Oulema septentrionis (Weise, 1880) Oulema tristis (Herbst, 1786) Criocerini Latreille, 1807 Crioceris O. F. Müller, 1764 = Crioceris Fourcroy Crioceris asparagi (Linnaeus, 1758) Crioceris duodecimpunctata (Linnaeus, 1758) [Crioceris paracenthesis (Linnaeus, 1767)] Crioceris quatuordecimpunctata (Scopoli, 1763) Crioceris quinquepunctata (Scopoli, 1763) Lilioceris Reitter, 1912 = Crioceris Fourcroy [Lilioceris faldermanni (Guérin-Meneville, 1829)] Lilioceris lilii (Scopoli, 1763) Lilioceris merdigera (Linnaeus, 1758) Lilioceris schneideri (Weise, 1900) Clytrinae Clytrini Kirby, 1837 Labidostomis Germar, 1822 = Labidostomis Redtenbacher Labidostomis cyanicornis Germar, 1822 Labidostomis humeralis (Schneider, 1792) Labidostomis longimana (Linnaeus, 1761) Labidostomis lucida axillaris (Lacordaire, 1848)

77

78

Károly Vig Labidostomis pallidipennis (Gebler, 1829) [Labidostomis taxicornis (Fabricius, 1792)] = taxicornis Redtenbacher Labidostomis tridentata (Linnaeus, 1758) Cheilotoma Chevrolat, 1837 = Chilotoma Redtenbacher Cheilotoma musciformis (Goeze, 1777) Lachnaia Chevrolat, 1837 = Lachnaea Redtenbacher Lachnaia sexpunctata (Scopoli, 1763) = Lachnaea longipes Fabricius Tituboea Lacordaire, 1848 = Antipa De Geer Tituboea macropus (Illiger, 1800) [Tituboea sexmaculata (Fabricius, 1781)] [Miopristis Lacordaire, 1848] [Miopristis bimaculata (Rossi, 1790)] Clytra Laicharting, 1781 Clytra appendicina Lacordaire, 1848 Clytra laeviuscula (Ratzeburg, 1837) Clytra quadripunctata (Linnaeus, 1758) Coptocephala Chevrolat, 1837 Coptocephala chalybaea (Germar, 1824) Coptocephala rubicunda (Laicharting, 1781) Coptocephala scopolina (Linnaeus, 1767) Coptocephala unifasciata (Scopoli, 1763) Smaragdina Chevrolat, 1837 = Cyaniris Redtenbacher Smaragdina s. str. [Smaragdina (s. str.) chloris (Lacordaire, 1848)] Monrosia L. Medvedev, 1971 Smaragdina (Monrosia) affinis (Illiger, 1794) Smaragdina (Monrosia) aurita (Linnaeus, 1767) Smaragdina (Monrosia) flavicollis (Charpentier, 1825) [Smaragdina (Monrosia) graeca (Lefévre, 1872)] [Smaragdina (Monrosia) hypocrita Lacordaire, 1848] Smaragdina (Monrosia) salicina (Scopoli, 1763) = cyanea Fabricius ? Smaragdina (Monrosia) tibialis hungarica (Weise, 1895) Smaragdina (Monrosia) xanthaspis (Germar, 1824)

Cryptocephalinae [Stylosomini Chapuis, 1874] [Stylosomus Suffrian, 1848] [Stylosomus tamaricis (Herrich-Schäffer, 1838)]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Stylosomus minutissimus (Germar, 1823)] Pachybrachini Chapuis, 1874 Pachybrachis Chevrolat, 1837 = Pachybrachys Suffrian [Pachybrachis carpathicus (Rey, 1883)] Pachybrachis fimbriolatus (Suffrian, 1848) Pachybrachis flexuosus (Weise, 1882) Pachybrachis hieroglyphicus (Laicharting, 1781) Pachybrachis hippophaes (Suffrian, 1848) = hippophäes Suffrian [Pachybrachis pallidulus suturalis (Weise, 1882)] = suturalis Weise [Pachybrachis picus (Weise, 1882)] Pachybrachis sinuatus (Mulsant et Rey, 1859) = haliciensis Suffrian [Pachybrachis scripticollis Faldermann, 1837] Pachybrachis tessellatus (Olivier, 1791) Cryptocephalini Gyllenhal, 1813 Cryptocephalus Geoffroy, 1762 = Cryptocephalus Fourcroy Disopus Stephens, 1839 Cryptocephalus (Disopus) pini (Linnaeus, I758) Protophysus Chevrolat, 1837 = Proctophysus Redtenbacher Cryptocephalus (Protophysus) schaefferi Schrank, 1789 Cryptocephalus (Protophysus) villosulus Suffrian, 1847 Asionus Lopatin, 1988 Cryptocephalus (Asionus) apicalis Gebler, 1830 Cryptocephalus (Asionus) bohemius Drapiez, 1819 Cryptocephalus (Asionus) gamma Herrich-Schäffer, 1829 [Cryptocephalus (Asionus) gamma semilugens Dudich, 1924] Cryptocephalus (Asionus) quatuordecimmaculatus Schneider, 1792 Cryptocephalus (Asionus) reitteri Weise, 1882 = Reitteri Weise Lamellosus Tomov, 1979 Cryptocephalus (Lamellosus) laevicollis Gebler, 1830 Heterichnus Warchałowski, 1991 [Cryptocephalus (Heterichnus) carinthiacus Suffrian, 1848] Cryptocephalus (Heterichnus) coryli (Linnaeus, 1758) Cryptocephalus s. str. Cryptocephalus (s. str.) aureolus illyricus Franz, 1949 Cryptocephalus (s. str.) bameuli Duhaldeborde, 1999 Cryptocephalus (s. str.) bicolor Eschscholtz, 1818 Cryptocephalus (s. str.) biguttatus (Scopoli, 1763) [Cryptocephalus (s. str.) bimaculatus Fabricius, 1781]

79

80

Károly Vig Cryptocephalus (s. str.) bipunctatus (Linnaeus, 1758) Cryptocephalus (s. str.) androgyne Marseul, 1875 = caerulescens Sahlberg Cryptocephalus (s. str.) cordiger (Linnaeus, 1758) Cryptocephalus (s. str.) decemmaculatus (Linnaeus, 1758) [Cryptocephalus (s. str.) distinguendus Schneider, 1792] Cryptocephalus (s. str.) elongatus Germar, 1824 Cryptocephalus (s. str.) flavipes Fabricius, 1781 Cryptocephalus (s. str.) frenatus Laicharting, 1781 Cryptocephalus (s. str.) gridellii Burlini, 1950 = Gridellii Burlini Cryptocephalus (s. str.) hypochaeridis (Linnaeus, 1758) = hypochoeridis hypochoeridis Linnaeus Cryptocephalus (s. str.) imperialis Laicharting, 1781 Cryptocephalus (s. str.) janthinus Germar, 1824 Cryptocephalus (s. str.) laetus Fabricius, 1792 Cryptocephalus (s. str.) marginatus Fabricius, 1781 [Cryptocephalus (s. str.) marginellus Olivier, 1791] Cryptocephalus (s. str.) moraei (Linnaeus, 1758) = Moraei Linnaeus Cryptocephalus (s. str.) nitidulus Fabricius, 1787 Cryptocephalus (s. str.) nitidus (Linnaeus, 1758) Cryptocephalus (s. str.) octacosmus Bedel, 1891 Cryptocephalus (s. str.) octomaculatus Rossi, 1790 Cryptocephalus (s. str.) octopunctatus (Scopoli, 1763) Cryptocephalus (s. str.) parvulus O. F. Müller, 1776 Cryptocephalus (s. str.) quadriguttatus Richter, 1820 Cryptocephalus (s. str.) quadripustulatus Gyllenhal, 1813 Cryptocephalus (s. str.) quinquepunctatus (Scopoli, 1763) Cryptocephalus (s. str.) sericeus (Linnaeus, 1758) s. str. [Cryptocephalus (s. str.) sericeus zambanellus Marseul, 1875] Cryptocephalus (s. str.) sexpunctatus (Linnaeus, 1758) Cryptocephalus (s. str.) signatifrons Suffrian, 1847 = signatifrons Fabricius Cryptocephalus (s. str.) solivagus Leonardi and Sassi, 2001 = hypochoeridis hypochoeridis Linnaeus (partim) Cryptocephalus (s. str.) transiens Franz, 1949 = hypochoeridis transiens Franz Cryptocephalus (s. str.) trimaculatus Rossi, 1790 [Cryptocephalus (s. str.) turcicus Suffrian, 1847] Cryptocephalus (s. str.) variegatus Fabricius, 1781 Cryptocephalus (s. str.) violaceus Laicharting, 1781 Cryptocephalus (s. str.) virens Suffrian, 1847 Cryptocephalus (s. str.) vittatus Fabricius, 1775

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Burlinius Lopatin, 1965 Cryptocephalus (Burlinius) bilineatus (Linnaeus, 1767) [Cryptocephalus (Burlinius) carpathicus J. Frivaldszky, 1883] Cryptocephalus (Burlinius) chrysopus Gmelin, 1790 Cryptocephalus (Burlinius) connexus Olivier, 1808 [Cryptocephalus (Burlinius) czwalinae Weise, 1882] = Czwalinai Weise Cryptocephalus (Burlinius) elegantulus Gravenhorst, 1807 Cryptocephalus (Burlinius) exiguus Schneider, 1792 Cryptocephalus (Burlinius) frontalis Marsham, 1802 Cryptocephalus (Burlinius) fulvus (Goeze, 1777) Cryptocephalus (Burlinius) labiatus (Linnaeus, 1761) Cryptocephalus (Burlinius) macellus Suffrian, 1860 Cryptocephalus (Burlinius) ocellatus Drapiez, 1819 Cryptocephalus (Burlinius) ochroleucus Fairmaire, 1859 = ochroleucus Stephens Cryptocephalus (Burlinius) pallifrons Gyllenhal, 1813 = pallidifrons Gyllenhal Cryptocephalus (Burlinius) planifrons Weise, 1882 Cryptocephalus (Burlinius) populi Suffrian, 1848 Cryptocephalus (Burlinius) punctiger Paykull, 1799 Cryptocephalus (Burlinius) pusillus Fabricius, 1776 Cryptocephalus (Burlinius) pygmaeus Fabricius, 1792 = vittula Suffrian Cryptocephalus (Burlinius) querceti Suffrian, 1848 Cryptocephalus (Burlinius) rufipes (Goeze, 1777) Cryptocephalus (Burlinius) saliceti Zebe, 1855 Cryptocephalus (Burlinius) strigosus Germar, 1824 Lamprosomatinae Oomorphus Curtis, 1831 = Lamprosoma Kirby Oomorphus concolor (Sturm, 1807) = Kolbei Scholtz Eumolpinae Colaspini Jacobson, 1908 Pales Chevrolat, 1837 = Eupales Lefévre Pales ulema (Germar, 1813) Adoxini Baly, 1863 Bromius Chevrolat, 1837 = Adoxus Kirby Bromius obscurus (Linnaeus, 1758) s. str. Bromius obscurus villosulus (Schrank, 1781)

81

82

Károly Vig

Myochroini Jacobson, 1908 Pachnephorus Chevrolat, 1837 = Pachnephorus Redtenbacher Pachnephorus pilosus (Rossi, 1790) Pachnephorus tessellatus (Duftschmid, 1825) Pachnephorus villosus (Duftschmid, 1825) Eumolpini Thomson, 1859 Eumolpus Illiger, 1798 = Chrysochus Redtenbacher Eumolpus asclepiadeus (Pallas, 1773) Chrysomelinae Timarchini Motschulsky, 1860 Timarcha Dejean, 1821 = Timarcha Latreille = Metallotimarcha Motschulsky (partim) Timarcha s. str. Timarcha (s. str.) goettingensis (Linnaeus, 1758) Timarcha (s. str.) pratensis (Duftschmid, 1825) Timarcha (s. str.) rugulosa Herrich-Schäffer, 1838 Timarcha (s. str.) tenebricosa moravica Bechyné, 1945 Metallotimarcha Motschulsky, 1860 Timarcha (Metallotimarcha) metallica (Laicharting, 1781) [Timarcha (Metallotimarcha) gibba Hagenbach, 1825] Entomoscelini Chevrolat, 1843 Entomoscelis Chevrolat, 1837 Entomoscelis adonidis (Pallas, 1771) Entomoscelis sacra (Linnaeus, 1758) Chrysomelini Latreille, 1802 Leptinotarsa Chevrolat, 1837 = Leptinotarsa Stål Leptinotarsa decemlineata (Say, 1824) Crosita Motschulsky, 1860 Crosita salviae (Germar, 1824) Chrysolina Motschulsky, 1860 = Chrysomela Linnaeus Threnosoma Motschulsky, 1860 [Chrysolina (Threnosoma) cribrosa (Åhrens, 1812)] = cribrosa Ahrens Chrysolina (Threnosoma) fimbrialis (Küster, 1845) s. str. ? [Chrysolina (Threnosoma) fimbrialis avulsa Bechyné, 1946] ? Chrysolina (Threnosoma) fimbrialis hungarica (Fuss, 1861) ? [Chrysolina (Threnosoma) obenbergeri Bechyné, 1950] = Obenbergeri Bechyné [Chrysolina (Threnosoma) weisei (J. Frivaldszky, 1883)]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = Weisei J. Frivaldszky Ovostoma Motschulsky, 1860 Chrysolina (Ovostoma) globipennis (Suffrian, 1851) s. str. ? [Chrysolina (Ovosoma) globipennis deubeli Bechyné, 1950] = globipennis Deubeli Bechyné [Chrysolina (Ovosoma) globipennis euminuta Bechyné, 1950] Chrysolina (Ovostoma) olivieri (Bedel, 1892) s. str. = caerulea caerulea Csiki = caerulea collina Csiki ? [Chrysolina (Ovostoma) olivieri montanella Bechyné, 1950] = caerulea montanella Bechyné Chrysolina (Ovosoma) olivieri slovaka Bechyné, 1946 ? [Chrysolina (Ovosoma) olivieri subalpina Csiki, 1952] Timarchida Ganglbauer, 1897 Chrysolina (Timarchida) deubeli (Ganglbauer, 1897) = Timarchida Deubeli Ganglbauer Synerga Weise, 1900 Chrysolina (Synerga) coerulans (Scriba, 1791) Chrysolina (Synerga) herbacea (Duftschmid, 1825) Euchrysolina Bechyné, 1950 Chrysolina (Euchrysolina) graminis (Linnaeus, 1758) [Heliostola Motschulsky, 1860] [Chrysolina (Heliostola) lichenis moravica (Weise, 1882)] [Chrysolina (Heliostola) lichenis rhipaea (Weise, 1898)] [Chrysolina (Heliostola) carpathica (Fuss, 1856) s. str.] [(Chrysolina (Heliostola) carpathica gabrieli (Weise, 1903)] = carpathica Gabrieli Weise [Chrysolina (Heliostola) schneideri (Weise, 1882)] Erythrochrysa Bechyné, 1950 Chrysolina (Erythrochrysa) polita (Linnaeus, 1758) Bechynia Bourdonné, 1977 Chrysolina (Bechynia) substrangulata Bourdonné, 1986 Chrysolina s. str. Chrysolina (s. str.) staphylaea (Linnaeus, 1758) Chrysomorpha Motschulsky, 1860 [Chrysolina (Chrysomorpha) cerealis (Linnaeus, 1767) s. str.] = cerealis bivittata Schrank Chrysolina (Chrysomorpha) cerealis alternans (Panzer, 1799) = cerealis plorans Bechyné Sphaerochrysolina Kippenberg, 1994 [Chrysolina (Sphaerochrysolina) biharica (Breit, 1919)] Chrysolina (Sphaerochrysolina) rufa squalida (Suffrian, 1851) = rufa diminuta Bechyné = lapidaria Bechyné = lapidaria pachysomoides Bechyné

83

84

Károly Vig = menthae Duftschmid Chrysolina (Sphaerochrysolina) rufa crassicollis (Suffrian, 1851) = crassicollis Suffrian ? [Chrysolina (Sphaerochrysolina) rufa rementina (Bechyné, 1950)] = crassicollis rementina Bechyné ? [Chrysolina (Sphaerochrysolina) rufa robusta (Breit, 1919)] = crassicollis robusta Breit [Chrysolina (Sphaerochrysolina) umbratilis (Weise, 1887) s. str.] ? [Chrysolina (Sphaerochrysolina) umbratilis erudita (Bechyné, 1952)] Cyrtochrysolina Kippenberg, 1994 [Chrysolina (Cyrtochrysolina) marcasitica (Germar, 1824) s. str.] Chrysolina (Cyrtochrysolina) marcasitica turgida (Weise, 1882) Colaphoptera Motschulsky, 1860 Chrysolina (Colaphoptera) globosa (Panzer, 1802) s. str. ? [Chrysolina (Colaphoptera) globosa banatica (Csiki, 1940)] ? [Chrysolina hemisphaerica bechynéana (Kaszab, 1962)] = hemisphaerica Béchyana Kaszab [Chrysolina hemisphaerica fallaciosa (G. Müller, 1949)] = hemisphaerica Germar = fallaciosa Franzi Bechyné ? [Chrysolina (Colaphoptera) hemisphaerica plumbeonigra (Reitter, 1912)] = purpurascens plumbeonigra Reitter Chrysolina (Colaphoptera) hemisphaerica purpurascens (Germar, 1822) = crassimargo Germar = purpurascens Germar Ovosoma Motschulsky, 1860 [Chrysolina (Ovosoma) atrovirens (J. Frivaldszky, 1876)] Chrysolina (Ovosoma) susterai Bechyné, 1950 = morio Krynicki Minckia E. Strand, 1935 Chrysolina (Minckia) chalcites (Germar, 1824) Chrysolina (Minckia) oricalcia (O. F. Müller, 1776) Colaphodes Motschulsky, 1860 Chrysolina (Colaphodes) haemoptera (Linnaeus, 1758) Colaphosoma Motschulsky, 1860 Chrysolina (Colaphosoma) sturmi (Westhoff, 1882) = diversipes Bedel Taeniosticha Motschulsky, 1860 Chrysolina (Taeniosticha) reitteri (Weise, 1884) =? lurida lineata Papp Stichoptera Motschulsky, 1860 Chrysolina (Stichoptera) kuesteri (Helliesen, 1912) = Küsteri Helliesen Chrysolina (Stichoptera) gypsophilae (Küster, 1845) Chrysolina (Stichoptera) rossia (Illiger, 1802)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = Rossia Illiger Chrysolina (Stichoptera) sanguinolenta (Linnaeus, 1758) Anopachys Motschulsky, 1860 Chrysolina (Anopachys) aurichalcea bohemica (G. Müller, 1948) ? Chrysolina (Anopachys) aurichalcea problematica (Kaszab, 1962) Chrysolina (Anopachys) eurina (J. Frivaldszky, 1883) = eurina perplexa Breit Sphaeromela Bedel, 1892 Chrysolina (Sphaeromela) varians (Schaller, 1783) = lichenis Havelkai Bechyné Hypericia Bedel, 1892 Chrysolina (Hypericia) cuprina (Duftschmid, 1825) Chrysolina (Hypericia) didymata (Scriba, 1791) [Chrysolina (Hypericia) geminata (Paykull, 1799)] Chrysolina (Hypericia) hyperici (Forster, 1771) ? Chrysolina (Hypericia) quadrigemina (Suffrian, 1851) = cuprina ab. quadrigemina Suffrian Chalcoidea Motschulsky, 1860 Chrysolina (Chalcoidea) analis (Linnaeus, 1767) Chrysolina (Chalcoidea) carnifex (Fabricius, 1792) Chrysolina (Chalcoidea) cinctipennis (Harold, 1874) Chrysolina (Chalcoidea) marginata (Linnaeus, 1758) Craspeda Motschulsky, 1860 Chrysolina (Craspeda) limbata (Fabricius, 1775) s. str. = limbata Kavani Bechyné (partim) ? [Chrysolina (Craspeda) limbata findeli (Suffrian, 1851)] = limbata Findeli Suffrian [Taeniochrysea Bechyné, 1950] [Chrysolina (Taeniochrysea) americana (Linnaeus, 1758)] Fastuolina Warchałowski, 1991 = Dlochrysa Motschulsky Chrysolina (Fastuolina) fastuosa (Scopoli, 1763) Oreina Chevrolat, 1837 = Chrysochloa Hope Allorina Weise, 1902 [Oreina (Allorina) bidentata Bontems, 1981] = tristis Fabricius Oreina (Allorina) luctuosa (Olivier, 1804) = rugulosa Suffrian [Intricatorina Kühnelt, 1984] [Oreina (Intricatorina) intricata (Germar, 1824) s. str.] = intricata Germar [Oreina (Intricatorina) intricata anderschi (Duftschmid, 1825)] = intricata Anderschi Duftschmid Oreina s. str.

85

86

Károly Vig

Oreina (Oreina) alpestris (Schummel, 1844) s. str. = alpestris Schummel [Oreina (Oreina) alpestris banatica (Weise, 1884)] = alpestris ab. banatica Weise [Oreina (Oreina) alpestris variabilis (Weise, 1883)] = variabilis Apfelbecki Winkler [Oreina (Oreina) bifrons decora (Richter, 1820)] = bifrons decora Richter [Oreina (Oreina) bifrons heterocera (Reitter, 1917)] = bifrons Obenbergeri Marchand [Oreina (Oreina) speciosa bosnica Apfelbeck, 1912] = gloriosa bosnica Apfelbeck [Oreina (Oreina) viridis (Duftschmid, 1825) s. str.] = viridis Duftschmidt [Oreina (Oreina) viridis merkli (Weise, 1884)] = viridis ab. Merkli Weise [Protorina Weise, 1894] [Oreina (Protorina) plagiata (Suffrian, 1861) s. str.] [Oreina (Protorina) plagiata commutata (Suffrian, 1861)] = plagiata croatica Weise Virgulatorina Kühnelt, 1894 Oreina (Virgulatorina) virgulata (Germar, 1824) s. str. = virgulata Germar Oreina (Virgulatorina) virgulata praefica (Weise, 1884) = virgulata ab. praefica Weise [Chrysochloa Hope, 1840] [Oreina (Chrysochloa) cacaliae (Schrank, 1785) s. str.] = cacaliae dinarica Apfelbeck [Oreina (Chrysochloa) cacaliae senecionis (Schummel, 1843)] [Oreina (Chrysochloa) speciosissima (Scopoli, 1763) s. str.] [Oreina (Chrysochloa) speciosissima fuscoaenea (Schummel, 1843)] = speciosissima ab. Letzneri Weise [Oreina (Chrysochloa) speciosissima juncorum (Suffrian, 1851)] Phaedonini Weise, 1915 Colaphus Dahl, 1823 = Colaphellus Weise Colaphus sophiae (Schaller, 1783) Gastrophysa Chevrolat, 1837 = Gastroidea Hope Gastrophysa polygoni (Linnaeus, 1758) Gastrophysa viridula (De Geer, 1775) Phaedon Dahl, 1823 = Phaedon Latreille Phaedon Phaedon armoraciae (Linnaeus, 1758)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = veronicae Bedel Phaedon cochleariae (Fabricius, 1792) Phaedon laevigatus (Duftschmid, 1825) [Phaedon salicinus (Heer 1845)] = veronicae ab. salicinus Heer Neophaedon Jacobson, 1901 Neophaedon pyritosus (Rossi, 1792) [Sternoplatys Motschulsky, 1860] [Sternoplatys segnis (Weise, 1884)] Sclerophaedon Weise, 1882 [Sclerophaedon carniolicus (Germar, 1824)] [Sclerophaedon carpathicus Weise, 1875] Sclerophaedon orbicularis (Suffrian, 1851) Prasocuris Latreille, 1802 Prasocuris s. str. Prasocuris junci (Brahm, 1790) Prasocuris phellandrii (Linnaeus, 1758) Hydrothassa C. G. Thomson, 1866 Prasocuris (Hydrothassa) flavocincta (Brullé, 1832) Prasocuris (Hydrothassa) glabra (Herbst, 1783) [Prasocuris (Hydrothassa) hannoveriana (Fabricius, 1775)] = hannoverana Fabricius Prasocuris (Hydrothassa) marginella (Linnaeus, 1758) Plagiodera Chevrolat, 1837 = Plagiodera Redtenbacher Plagiodera versicolora (Laicharting, 1781) = versicolor Laicharting Linaeidea Motschulsky, 1860 = Melasoma Stephens Linaeidea aenea (Linnaeus, 1758) = aeneum Linnaeus Chrysomela Linnaeus, 1758 = Melasoma Stephens Strickerus Lucas, 1920 Chrysomela (Strickerus) cuprea Fabricius, 1775 = cupreum Fabricius Chrysomela (Strickerus) lapponica Linnaeus, 1758 = lapponicum Linnaeus Chrysomela (Strickerus) vigintipunctata (Scopoli, 1763) = vigintipunctatum Scopoli Pachylina Medvedev, 1969 Chrysomela (Pachylina) collaris Linnaeus, 1758 = collare Linnaeus Chrysomela s. str. Chrysomela (s. str.) populi Linnaeus, 1758

87

88

Károly Vig

Chrysomela (s. str.) saliceti Suffrian, 1849 Chrysomela (s. str.) tremula Fabricius, 1787 = tremulae Fabricius Phratorini Weise, 1915 Gonioctena Chevrolat, 1837 = Phytodecta Kirby Spartoxena Motschulsky, 1860 Gonioctena (Spartoxena) fornicata Brüggemann, 1873 Gonioctena s. str. Gonioctena (s. str.) decemnotata (Marsham, 1802) = rufipes De Geer Gonioctena (s. str.) flavicornis (Suffrian, 1851) [Gonioctena (s. str.) kaufmanni (Miller, 1881)] = Kaufmanni Miller Gonioctena (s. str.) linnaeana (Schrank, l781) = Linnaeana Schrank Gonioctena (s. str.) viminalis (Linnaeus, 1758) Spartophila Stephens, 1834 Gonioctena (Spartophila) olivacea (Forster, 1771) Goniomena Motschulsky, 1860 Gonioctena (Goniomena) intermedia (Helliesen, 1913) Gonioctena (Goniomena) pallida (Linnaeus, 1758) Gonioctena (Goniomena) interposita (Franz et Palmén, 1950) Gonioctena (Goniomena) quinquepunctata (Fabricius, 1787) Phratora Chevrolat, 1837 = Phyllodecta Kirby Chaetoceroides Strand, 1935 Phratora (Chaetoceroides) vulgatissima (Linnaeus, 1758) Phratora s. str. Phratora (s. str.) atrovirens (Cornelius, 1857) Phratora (s. str.) laticollis (Suffrian, 1851) Phratora (s. str.) tibialis (Suffrian, 1851) Phratora (s. str.) vitellinae (Linnaeus, 1758) Galerucinae Galerucini Latreille, 1802 Diabrotica Chevrolat, 1844 Diabrotica virgifera Le Conte, 1858 Galerucella Crotch, 1873 Galerucella s. str. = Hydrogaleruca Laboissière Galerucella (s. str.) aquatica (Fourcroy, l785) = nymphaeae ab. aquatica Fourcroy Galerucella (s. str.) grisescens (Joannis, 1866) [Galerucella (s. str.) kerstensi Lohse, 1989]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Galerucella (s. str.) sagittariae (Gyllenhal, 1813)] Galerucella (s. str.) nymphaeae (Linnaeus, 1758) Neogalerucella Chujó, 1962 Galerucella (Neogalerucella) calmariensis (Linnaeus, 1767) Galerucella (Neogalerucella) lineola (Fabricius, 1781) Galerucella (Neogalerucella) pusilla (Duftschmid, 1825) Galerucella (Neogalerucella) tenella (Linnaeus, 1761) Xanthogaleruca Laboissière, 1934 Xanthogaleruca luteola (O. F. Müller, 1766) Pyrrhalta Joannis, 1866 Pyrrhalta viburni (Paykull, 1799) Lochmaea Weise, 1883 Lochmaea caprea (Linnaeus, 1758) = capreae Linnaeuas Lochmaea crataegi (Forster, 1771) Lochmaea suturalis (C. G. Thomson, 1866) Galeruca O. F. Müller, 1764 = Galeruca Fourcroy Haptoscelis Weise, 1886 Galeruca (Haptoscelis) melanocephala (Ponza, 1805) Emarhopa Weise, 1886 Galeruca (Emarhopa) rufa Germar, 1824 Galeruca s. str. Galeruca (s. str.) dahli (Joannis, 1866) = Dahli Joannis [Galeruca (s. str.) interrupta (Illiger, 1802) s. str.] Galeruca (s. str.) interrupta circumdata Duftschmid, 1825 [Galeruca (s. str.) interrupta hungarica J. Frivaldszky, 1876] Galeruca (s. str.) laticollis Sahlberg, 1837 [Galeruca (s. str.) littoralis Fabricius, 1787] Galeruca (s. str.) pomonae (Scopoli, 1763) Galeruca (s. str.) tanaceti (Linnaeus, 1758) Sermylassini Mroczkowski, 1990 Sermylassa Reitter, 1912 Sermylassa halensis (Linnaeus, 1767) Agelasticini Chapuis, 1875 Agelastica Chevrolat, 1837 = Agelastica Redtenbacher Agelastica alni (Linnaeus, 1758) Luperini Chapuis, 1875 Phyllobrotica Chevrolat, 1837 = Phyllobrotica Redtenbacher Phyllobrotica adusta (Creutzer, 1799) Phyllobrotica quadrimaculata (Linnaeus, 1758)

89

90

Károly Vig Euluperus Weise, 1886 Euluperus major Weise, 1886 Euluperus xanthopus (Duftschmid, 1825) Calomicrus Dillwyn, 1829 = Luperus Fourcroy Calomicrus circumfusus (Marsham, 1802) Calomicrus pinicola (Duftschmid, 1825) Luperus Geoffroy, 1762 = Luperus Fourcroy [Luperus aetolicus Kiesenwetter, 1861] [Luperus caucasicus mixtus Weise, 1879] [Luperus cyanipennis Küster, 1848] ? Luperus carniolicus Kiesenwetter, 1861 Luperus flavipes (Linnaeus, 1767) Luperus longicornis (Fabricius, 1781) Luperus luperus (Sulzer, 1776) = lyperus Sulzer [Luperus nigripes Kiesenwetter, 1861] Luperus rugifrons Weise, 1886 Luperus saxonicus (Gmelin, 1790) Luperus viridipennis Germar, 1824 Luperus xanthopoda (Schrank, 1781)

Alticinae = Halticinae Phyllotreta Chevrolat, 1837 = Phyllotreta Stephens [Phyllotreta acutecarinata Heikertinger, 1941] Phyllotreta armoraciae (Koch, 1803) Phyllotreta astrachanica Lopatin, 1977 Phyllotreta atra (Fabricius, 1775) Phyllotreta austriaca Heikertinger, 1909 Phyllotreta balcanica Heikertinger, 1909 Phyllotreta christinae Heikertinger, 1941 = Christinae Heikertinger [Phyllotreta corrugata Reiche, 1858] Phyllotreta cruciferae (Goeze, 1777) Phyllotreta diademata Foudras, 1859 [Phyllotreta dilatata C. G. Thomson, 1866] = tetrastigma ab. Weiseana Csiki [Phyllotreta erysimi Weise, 1900 s. str.] Phyllotreta exclamationis (Thunberg, 1784) Phyllotreta flexuosa (Illiger, 1794) [Phyllotreta ganglbaueri Heikertinger, 1909] = Ganglbaueri Heikertinger

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Phyllotreta hochetlingeri Fleischer, 1917] = Hochetlingeri Fleischer Phyllotreta nemorum (Linnaeus, 1758) Phyllotreta nigripes (Fabricius, 1775) s. str. Phyllotreta nodicornis (Marsham, 1802) Phyllotreta ochripes (Curtis, 1837) Phyllotreta procera (Redtenbacher, 1849) Phyllotreta punctulata (Marsham, 1802) = aerea Allard Phyllotreta scheuchi Heikertinger, 1941 = Scheuchi Heikertinger Phyllotreta striolata (Fabricius, 1803) = vittata Fabricius Phyllotreta tetrastigma (Comolli, 1837) Phyllotreta undulata Kutschera, 1860 [Phyllotreta variipennis (Boieldieu, 1859) s. str.] Phyllotreta vittula (Redtenbacher, 1849) Aphthona Chevrolat, 1837 Aphthona abdominalis (Duftschmid, 1825) Aphthona aeneomicans Allard, 1875 s. str. Aphthona atrovirens (Förster, 1849) [Aphthona beckeri Jacobson, 1897] Aphthona cyanella (Redtenbacher, 1849) Aphthona cyparissiae (Koch, 1803) [Aphthona czwalinae Weise, 1888] = Czwalinai Weise [Aphthona erichsoni (Zetterstedt, 1838)] = Erichsoni Zetterstedt Aphthona euphorbiae (Schrank, 1781) Aphthona flava Guillebeau, 1895 Aphthona flaviceps Allard, 1859 Aphthona franzi Heikertinger, 1944 = Franzi Heikertinger Aphthona herbigrada (Curtis, 1837) Aphthona lacertosa (Rosenhauer, 1847) Aphthona lutescens (Gyllenhal, 1808) [Aphthona nigriceps (W. Redtenbacher, 1842)] Aphthona nigriscutis Foudras, 1860 Aphthona nonstriata (Goeze, 1777) = caerulea Fourcroy Aphthona ovata Foudras, 1860 Aphthona pallida (Bach, 1856) Aphthona placida (Kutschera, 1864) Aphthona pygmaea (Kutschera, 1861) Aphthona semicyanea Allard, 1859 s. str.

91

92

Károly Vig [Aphthona stussineri Weise, 1888] = Stussineri Weise Aphthona venustula (Kutschera, 1861) Aphthona violacea (Koch, 1803) Longitarsus Latreille in Berthold, 1827 Longitarsus s. str. Longitarsus (s. str.) absynthii Kutschera, 1862 = absinthii Kutschera Longitarsus (s. str.) aeneicollis (Faldermann, 1837) = suturalis Marsham Longitarsus (s. str.) albineus (Foudras, 1860) Longitarsus (s. str.) apicalis (Beck, 1817) Longitarsus (s. str.) atricillus (Linnaeus, 1761) Longitarsus (s. str.) ballotae (Marsham, 1802) Longitarsus (s. str.) bertii Leonardi, 1973 = ferrugineus Foudras (partim) Longitarsus (s. str.) brisouti Heikertinger, 1912 = Brisouti Heikertinger Longitarsus (s. str.) brunneus (Duftschmid, 1825) Longitarsus (s. str.) callidus Warchałowski, 1967 [Longitarsus (s. str.) celticus Leonardi, 1975] Longitarsus (s. str.) cerinthes (Schrank, 1798) = nervosus cerinthes Schrank Longitarsus (s. str.) curtus (Allard, 1860) Longitarsus (s. str.) echii (Koch, 1803) Longitarsus (s. str.) exsoletus (Linnaeus, 1758) s. str. = exoletus Linnaeus [Longitarsus (s. str.) fallax Weise, 1888] Longitarsus (s. str.) ferrugineus (Foudras, 1860) = Waterhousei Kutschera Longitarsus (s. str.) foudrasi Weise, 1893 = Foudrasi Weise Longitarsus (s. str.) fulgens (Foudras, 1860) Longitarsus (s. str.) ganglbaueri Heikertinger, 1912 s. str. = Ganglbaueri Heikertinger Longitarsus (s. str.) gracilis Kutschera, 1864 Longitarsus (s. str.) helvolus Kutschera 1863 = membranaceus Foudras Longitarsus (s. str.) holsaticus (Linnaeus, 1758) Longitarsus (s. str.) jacobaeae (Waterhouse, 1858) Longitarsus (s. str.) juncicola (Foudras, 1860) Longitarsus (s. str.) kutscherae (Rye, 1872) = melanocephalus var. Kutscherae Rey Longitarsus (s. str.) languidus Kutschera, 1863 Longitarsus (s. str.) lateripunctatus personatus Weise, 1893

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Longitarsus (s. str.) lewisii (Baly, 1874) = scutellaris Rey (partim) Longitarsus (s. str.) linnaei (Duftschmid, 1825) = Linnaei Duftschmidt Longitarsus (s. str.) longipennis Kutschera, 1863 Longitarsus (s. str.) longiseta Weise, 1889 Longitarsus (s. str.) luridus (Scopoli, 1763) s. str. Longitarsus (s. str.) lycopi (Foudras, 1860) Longitarsus (s. str.) medvedevi Shapiro, 1956 Longitarsus (s. str.) melanocephalus (De Geer, 1775) Longitarsus (s. str.) membranaceus (Foudras, 1860) Longitarsus (s. str.) minimus Kutschera, 1863 = pratensis ab. minimus Kutschera Longitarsus (s. str.) minusculus (Foudras, 1860) Longitarsus (s. str.) monticola Kutschera, 1863 = curtus ab. monticola Kutschera Longitarsus (s. str.) nanus (Foudras, 1860) Longitarsus (s. str.) nasturtii (Fabricius, 1792) Longitarsus (s. str.) niger (Koch, 1803) Longitarsus (s. str.) nigerrimus (Gyllenhal, 1827) Longitarsus (s. str.) nigrofasciatus (Goeze, 1777) s. str. [Longitarsus (s. str.) nimrodi Furth, 1979 ] Longitarsus (s. str.) noricus Leonardi, 1976 Longitarsus (s. str.) obliteratus (Rosenhauer, 1847) Longitarsus (s. str.) ochroleucus (Marsham, 1802) s. str. Longitarsus (s. str.) pallidicornis Kutschera, 1863 = Hubenthali Wanka Longitarsus (s. str.) parvulus (Paykull, 1799) Longitarsus (s. str.) pellucidus (Foudras, 1860) Longitarsus (s. str.) pratensis (Panzer, 1794) Longitarsus (s. str.) pulmonariae Weise, 1893 Longitarsus (s. str.) quadriguttatus (Pontoppidan, 1765) Longitarsus (s. str.) rectilineatus (Foudras, 1860) = rectelineatus Foudras Longitarsus (s. str.) reichei (Allard, 1860) [Longitarsus (s. str.) rubellus (Foudras, 1860)] Longitarsus (s. str.) rubiginosus (Foudras, 1860) Longitarsus (s. str.) salviae Gruev, 1975 Longitarsus (s. str.) scobripennis Heikertinger, 1913 Longitarsus (s. str.) scutellaris (Mulsant & Rey, 1874) Longitarsus (s. str.) strigicollis Wollaston, 1864 = bombycinus Mohr Longitarsus (s. str.) substriatus Kutschera, 1863 Longitarsus (s. str.) succineus (Foudras, 1860) Longitarsus (s. str.) suturellus (Duftschmid, 1825)

93

94

Károly Vig Longitarsus (s. str.) symphyti Heikertinger, 1912 Longitarsus (s. str.) tabidus (Fabricius, 1775) s. str. Longitarsus (s. str.) tristis Weise, 1888 = pannonicus Kaszab Testergus Weise, 1893 Longitarsus (Testergus) anchusae (Paykull, 1799) [Longitarsus (Testergus) bulgaricus Gruev, 1973] Longitarsus (Testergus) fuscoaeneus Redtenbacher, 1849 s. str. Longitarsus (Testergus) pinguis Weise, 1888 Altica O. F. Müller, 1764 = Haltica O. F. Müller Altica brevicollis Foudras, 1860 s. str. Altica brevicollis coryletorum Král, 1964 Altica carduorum Guérin-Méneville, 1858 [Altica carinthiaca Weise, 1888] Altica cornivorax Král, 1969 = ampelophaga Guérin-Méneville [Altica fruticola (Weise, 1888)] Altica helianthemi (Allard, 1895) = pusilla Duftschmid Altica impressicollis (Reiche, 1862) Altica lythri Aubé, 1843 Altica oleracea (Linnaeus, 1758) s. str. ? [Altica oleracea breddini (Mohr, 1958)] Altica palustris (Weise, 1888) Altica quercetorum Foudras, 1860 s. str. Altica quercetorum saliceti (Weise, 1888) Altica tamaricis Schrank, 1785 s. str. Hermaeophaga Foudras, 1860 Hermaeophaga mercurialis (Fabricius, 1792) Batophila Foudras, 1860 Batophila fallax Weise, 1888 [Batophila moesica Heikertinger, 1948] = moesiaca Heikertinger Batophila rubi (Paykull, 1799) Lythraria Bedel, 1897 Lythraria salicariae (Paykull, 1800) Ochrosis Foudras, 1860 Ochrosis ventralis (Illiger, 1807) Neocrepidodera Heikertinger, 1911 = Crepidodera Stephens [Neocrepidodera brevicollis (J. Daniel, 1904)] Neocrepidodera corpulenta (Kutschera, 1860) Neocrepidodera crassicornis (Faldermann, 1837) s. str. [Neocrepidodera cyanescens (Duftschmid, 1825) s. str.]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Neocrepidodera cyanipennis (Kutschera, 1860)] Neocrepidodera femorata (Gyllenhal, 1813) Neocrepidodera ferruginea (Scopoli, 1763) [Neocrepidodera impressa (Fabricius, 1801) s. str.] [Neocrepidodera melanostoma (Redtenbacher, 1849)] Neocrepidodera motschulskii (Konstantinov, 1991) = sublaevis Motschulsky Neocrepidodera nigritula (Gyllenhal, 1813) [Neocrepidodera norica (Weise, 1890)] [Neocrepidodera puncticollis (Reitter, 1880)] = cyanipennis var. puncticollis Reitter [Neocrepidodera transsilvanica (Fuss, 1864)] = transsylvanica Fuss Neocrepidodera transversa (Marsham, 1802) Orestia Germar, 1845 [Orestia alpina (Germar, 1824)] [Orestia aubei Allard, 1859] = Aubéi Allard Orestia carpathica Reitter, 1879 [Orestia paveli J. Frivaldszky, 1877] = Páveli J. Frivaldszky Derocrepis Weise, 1886 Derocrepis rufipes (Linnaeus, 1758) Hippuriphila Foudras, 1860 Hippuriphila modeeri (Linnaeus, 1761) = Modeeri Linnaeus Crepidodera Chevrolat, 1837 = Chalcoides Foudras Crepidodera aurata (Marsham, 1802) Crepidodera aurea (Geoffroy, 1785) = aurea Fourcroy Crepidodera fulvicornis (Fabricius, 1792) Crepidodera lamina (Bedel, 1901) [Crepidodera nigricoxis Allard, 1879] Crepidodera nitidula (Linnaeus, 1758) Crepidodera plutus (Latreille, 1804) = Plutus Latreille Epitrix Foudras, 1860 = Epithrix Foudras Epitrix atropae Foudras, 1860 Epitrix intermedia Foudras, 1860 Epitrix pubescens (Koch, 1803) Minota Kutschera, 1859 Minota carpathica Heikertinger, 1911 = obesa carpathica Heikertinger

95

96

Károly Vig

Minota halmae (Apfelbeck, 1906) = obesa Walt (sensu Kaszab 1962) [Minota obesa (Waltl, 1839)] Podagrica Chevrolat, 1837 = Podagrica Foudras Podagrica fuscicornis (Linnaeus, 1767) = fuscicornis chrysomelina Waltl Podagrica malvae (Illiger, 1807) s. str. [Podagrica malvae semirufa (Küster, 1847)] Podagrica menetriesi (Faldermann, 1837) = Menetriesi Faldermann Mantura Stephens, 1831 Mantura chrysanthemi (Koch, 1803) [Mantura mathewsi (Stephens, 1832)] Mantura obtusata (Gyllenhal, 1813) Mantura rustica (Linnaeus, 1767) Chaetocnema Stephens, 1831 Tlanoma Motschulsky, 1845 Chaetocnema (Tlanoma) breviuscula (Faldermann, 1884) Chaetocnema (Tlanoma) chlorophana (Duftschmid, 1825) Chaetocnema (Tlanoma) concinna (Marsham, 1802) Chaetocnema (Tlanoma) conducta (Motschulsky, 1838) Chaetocnema (Tlanoma) major (Jacquelin du Val, 1852) s. str. [Chaetocnema (Tlanoma) orientalis (Bauduér, 1874)] Chaetocnema (Tlanoma) picipes (Marsham, 1802) = concinna Marsham (partim) Chaetocnema (Tlanoma) scheffleri (Kutschera, 1864) = Scheffleri Kutschera Chaetocnema (Tlanoma) semicoerulea (Koch, 1803) s. str. = semicaerulea Koch Chaetocnema (Tlanoma) tibialis (Illiger, 1807) Chaetocnema s. str. Chaetocnema (s. str.) aerosa (Letzner, 1846) Chaetocnema (s. str.) arenacea (Allard, 1860) Chaetocnema (s. str.) arida Foudras, 1860 Chaetocnema (s. str.) aridula (Gyllenhal, 1827) Chaetocnema (s. str.) compressa (Letzner, 1846) Chaetocnema (s. str.) confusa (Boheman, 1851) Chaetocnema (s. str.) hortensis (Geoffroy, 1785) = hortensis Foudras [Chaetocnema (s. str.) montenegrina Heikertinger, 1912] Chaetocnema (s. str.) mannerheimii (Gyllenhal, 1827) = Mannerheimi Gyllenhal Chaetocnema (s. str.) obesa (Boieldieu, 1859) Chaetocnema (s. str.) procerula (Rosenhauer, 1856)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Chaetocnema (s. str.) sahlbergii (Gyllenhal, 1827) = Sahlbergi Gyllenhal Chaetocnema (s. str.) subcoerulea (Kutschera, 1864) = subcaerulea Kutschera Sphaeroderma Stephens, 1831 Sphaeroderma rubidum (Graëlls, 1858) Sphaeroderma testaceum (Fabricius, 1775) Argopus Fischer von Waldheim, 1824 Argopus ahrensii (Germar, 1817) = Ahrensi Germar Argopus bicolor Fischer von Waldheim, 1824 Argopus nigritarsis (Gebler, 1823) Apteropeda Chevrolat, 1837 = Apteropeda Stephens [Apteropeda globosa (Illiger, 1794)] Apteropeda orbiculata (Marsham, 1802) [Apteropeda splendida Allard, 1860] Mniophila Stephens, 1831 Mniophila muscorum (Koch, 1803) s. str. Dibolia Latreille, 1829 Eudibolia Khnzorian, 1968 Dibolia (Eudibolia) femoralis Redtenbacher, 1849 s. str. [Dibolia (Eudibolia) russica Weise, 1893] Dibolia (Eudibolia) schillingii (Letzner, 1847) = Schillingi Letzner Dibolia s. str. Dibolia (s. str.) carpathica Weise, 1893 Dibolia (s. str.) cryptocephala (Koch, 1803) Dibolia (s. str.) cynoglossi (Koch, 1803) Dibolia (s. str.) depressiuscula Letzner, 1847 Dibolia (s. str.) foersteri Bach, 1859 = Foersteri Bach Dibolia (s. str.) occultans (Koch, 1803) Dibolia (s. str.) phoenicia Allard, 1866 = orientalis Weise Dibolia (s. str.) rugulosa Redtenbacher, 1849 Dibolia (s. str.) timida (Illiger, 1807) Psylliodes Latreille, 1827 = Psylliodes Berthold Psylliodes s. str. Psylliodes (s. str.) aereus Foudras, 1860 s. str. Psylliodes aereus austriacus Heikertinger, 1911 = aerea austriaca Heikertinger Psylliodes (s. str.) affinis (Paykull, 1799) Psylliodes (s. str.) attenuatus (Koch, 1803)

97

98

Károly Vig = attenuata Koch Psylliodes (s. str.) brisouti Bedel, 1898 = napi ab. Brisouti Bedel Psylliodes (s. str.) chalcomerus (Illiger, 1807) = chalcomera Illiger Psylliodes (s. str.) chrysocephalus (Linnaeus, 1758) s. str. = chrysocephala Linneaus Psylliodes (s. str.) circumdatus (Redtenbacher, 1842) = circumdata Redtembacher [Psylliodes (s. str.) cucullatus (Illiger, 1807)] = cucullata Illiger Psylliodes (s. str.) cupreatus (Duftschmid, 1825) = cupreata Duftschmidt Psylliodes (s. str.) cupreus (Koch, 1803) = cuprea Koch Psylliodes (s. str.) dulcamarae (Koch, 1803) [Psylliodes (s. str.) frivaldszkyi Weise, 1888] = Frivaldszkyi Weise [Psylliodes (s. str.) glaber (Duftschmid, 1825)] = glabra Duftschmidt Psylliodes (s. str.) hyoscyami (Linnaeus, 1758) = hyosciami Linnaeus Psylliodes (s. str.) illyricus Leonardi & Gruev, 1993 = picina Marsham (partim) Psylliodes (s. str.) instabilis Foudras, 1860 Psylliodes (s. str.) isatidis Heikertinger, 1912 Psylliodes (s. str.) kiesenwetteri Kutschera, 1864 = gibbosa Kiesenwetteri Kutschera [Psylliodes (s. str.) laticollis Kutschera, 1864] Psylliodes (s. str.) luteolus (O. F. Müller, 1776) = luteola O. F. Müller Psylliodes (s. str.) napi (Fabricius, 1792) s. str. [Psylliodes (s. str.) napi flavicornis Weise, 1883] = napi var. flavicollis Weise Psylliodes (s. str.) picinus (Marsham, 1802) = picina Marsham [Psylliodes (s. str.) picipes Redtenbacher, 1849] [Psylliodes (s. str.) pyritosus Kutschera, 1864] = pyritosa Kutschera [Psylliodes (s. str.) rambouseki Heikertinger, 1909 s. str.] [Psylliodes (s. str.) rambouseki forojuliensis Heikertinger, 1926] = Rambouseki forojuliensis Heikertinger [Psylliodes (s. str.) sturanyi Apfelbeck, 1906] = Sturányi Apfelbeck [Psylliodes (s. str.) subaeneus Kutschera, 1864 s. str.]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = subaenea Kutschera Psylliodes (s. str.) thlaspis Foudras, 1860 Psylliodes (s. str.) toelgi Heikertinger, 1914 = Tölgi Heikertinger Psylliodes (s. str.) tricolor Weise, 1888 = sophiae Heikertinger [Psylliodes (s. str.) vindobonensis Heikertinger, 1914] Semicnema Weise, 1888 Psylliodes reitteri Weise, 1888 s. str. = Semicnema Reitteri Weise Hispinae Hispa Linnaeus, 1767 Hispa atra Linnaeus, 1767 Cassidinae Cassida Linnaeus, 1758 Cassida s. str. Cassida (s. str.) atrata Fabricius, 1787 Cassida (s. str.) aurora Weise, 1907 Cassida (s. str.) bergeali Bordy, 1995 Cassida (s. str.) berolinensis Suffrian, 1844 Cassida (s. str.) denticollis Suffrian, 1844 Cassida (s. str.) ferruginea Goeze, 1777 Cassida (s. str.) flaveola Thunberg, 1794 Cassida (s. str.) inquinata Brullé, 1832 [Cassida (s. str.) leucanthemi Bordy, 1995] Cassida (s. str.) lineola Creutzer, 1799 Cassida (s. str.) nebulosa Linnaeus, 1758 Cassida (s. str.) pannonica Suffrian, 1844 Cassida (s. str.) panzeri Weise, 1907 Cassida (s. str.) prasina Illiger, 1798 Cassida (s. str.) rubiginosa O. F. Müller, 1776 Cassida (s. str.) rufovirens Suffrian, 1844 Cassida (s. str.) sanguinolenta O. F. Müller, 1776 Cassida (s. str.) sanguinosa Suffrian, 1844 Cassida (s. str.) seladonia Gyllenhal, 1827 Cassida (s. str.) stigmatica Suffrian, 1844 Cassida (s. str.) vibex Linnaeus, 1767 Cassidulella Strand, 1928 Cassida (Cassidulella) nobilis Linnaeus, 1758 Cassida (Cassidulella) vittata Villers, 1789 Pseudocassida Desbrochers, 1891 Cassida (Pseudocassida) murraea Linnaeus, 1767 Mionycha Weise, 1891

99

100

Károly Vig Cassida (Mionycha) azurea Fabricius, 1801 Cassida (Mionycha) margaritacea Schaller, 1783 Cassida (Mionycha) subreticulata Suffrian, 1844 Lordiconia Reitter, 1926 Cassida (Lordiconia) canaliculata Laicharting, 1781 Hypocassida Weise, 1893 Cassida (Hypocassida) subferruginea Schrank, 1776 Odontionycha Weise, 1891 Cassida (Odontionycha) viridis Linnaeus, 1758 Mionychella Spaeth, 1952 Cassida (Mionychella) hemisphaerica Herbst, 1799 Pilemostoma Desbrochers, 1891 Cassida (Pilemostoma) fastuosa Schaller, 1783

ACKNOWLEDGEMENTS The author would like to express his hearty thanks to Blagoy Gruev (Plovdiv, Bulgaria) and Horst Kippenberg (Herzogenaurach, Germany) for their help reviewing the checklist of Chrysomelidae of the Carpathian Basin. Many thanks are due also to David Furth (Smithsonian Institution, USA) for his valuable help. My research on leaf beetles was supported by the János Bolyai Scholarship of the Hungarian Academy of Sciences. LITERATURE CITED Anonymus. 1792. Beitrag zur Entomologie von Ungarn. Neues Ungarisches Magazin 2(5):337. Berti, N. and M. Rapilly 1976. Faune d’Iran. Liste d’espèces et révision du genre Lilioceris Reitter (Coleoptera, Chrysomelidae). Annales de la Société Entomologique de France, Paris (N.S.) 12(1):31-73. Bezděk, J. and A. Bezděk 1998. Cassida bergeali Bordy, 1995 (Coleoptera, Chrysomelidae) – first record for Slovakia. Entomological Problems 29(1):18. Borowiec, L. and J. Świętojańska 1997. Cassida leucanthemi Bordy, 1995 i C. bergeali Bordy, 1995 (Coleoptera: Chrysomelidae: Cassidinae), nowe dla fauny Polski [Cassida leucanthemi Bordy, 1995 and C. bergeali Bordy, 1995 (Coleoptera: Chrysomelidae: Cassidinae), new to the fauna of Poland]. Wiad. entomol. (1996) 15(4):237-240. Bourdonné, J-. C. 1986. Chrysolina (Bechynia) substrangulata, nouvelle espèce de Hongrie (Coleoptera, Chrysomelidae). Nouvelle Revue d’Entomologie (N. S.) 3(2):235-241. Čižek, P. 1995. Nové druhy brouků (Coleoptera, Chrysomelidae) pro území Slovenska [The species of beetles (Coleoptera, Chrysomelidae) new for the territory of Slovakia]. Klapalekiana 31:71. Čižek, P. and R. Fornůsek 2000. Příspěvek k poznání dřepčíků (Coleoptera: Chrysomelidae: Alticinae) Čech, Moravy, Slovenska a Mad’arska I. [Beitrag zur Kenntnis der Flohkäfer (Coleoptera: Chrysomelidae: Alticinae) von Böhmen, Mähren, der Slowakei und Ungarn I.] Klapalekiana 36:29-32. Čižek, P., J. Hejkal and J. Stanovský 1995. Příspěvek k poznání brouků čeledi Chrysomelidae (Coleoptera) Čech, Moravy a Slovenska [Contribution to the knowledge of the family Chrysomelidae (Coleoptera) from Bohemia, Moravia and Slovakia]. Klapalekiana 31: 1-10. Conrád, J. 1782. Bemerkungen über die Entomologie überhaupt; nebst Beiträgen zur Kenntniß der um Oedenburg befindlichen Insekten. Ungarisches Magazin 2:5-19. Creutzer, C. 1799. Entomologische Versuche. Karl Schaumburg und Comp., Wien.

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

101

Duhaldeborde, F. 1999. Description de Cryptocephalus (s. str.) bameuli n. sp., nouvelle espèce paléarctique à large répartition géographique (Coleoptera, Chrysomelidae). Nouvelle Revue d’Entomologie (N. S.) 16:123-135. Frivaldszky, I. 1865. Jellemző adatok Magyarország faunájához. A Magyar Tudományos Akadémia Évkönyvei 11(4):1-274 + XIII. Gáti, I. 1792. Természet históriája. [The locality of the edition is not indicated] Gáti, I. 1795. A természet históriája, melyben az ásványoknak, plántáknak és az állatoknak három világok, azoknak megismertető bélyegeivel, természetekkel, hasznokkal, hazájokkal, rendbeszedve és a gyenge elméhez alkalmaztatva, mind együtt magyar nyelven legelőször bocsátja ki. Wéber S. P, Pozsony. [The second edition also in Pozsony, at 1798] Gruev, B. 1982. Neue Angaben über einige Blattkäfer aus der Alten Welt (Insecta, Coleoptera, Chrysomelidae). Faunistische Abhandlungen staatliches Museum für Tierkunde in Dresden 9(8):109-114. Gruev, B. and M. Döberl 1997. General distribution of flea beetles in the Palaearctic subregion (Coleoptera, Chrysomelidae, Alticinae). Scopolia 37:1-496. Gruev, B. and O. Merkl 1992. To the geographic distribution of the Longitarsus pratensis-group (Coleoptera, Chrysomelidae: Alticinae). Folia Entomologica Hungarica (1991) 52:15-20. Gruev, B., O. Merkl and K. Vig 1993. Geographical distribution of Alticinae (Coleoptera, Chrysomelidae) in Romania. Annales Historico-Naturales Musei Nationalis Hungarici 85:75-132. Gruev, B., V. Tomov and O. Merkl 1987. Chrysomelidae of the Kiskunság National Park (Coleoptera), pp. 227241. In: S. Mahunka (Ed.), The fauna of the Kiskunság National Park 2. Akadémiai Kiadó, Budapest. Kaszab, Z. 1962a. Levélbogarak – Chrysomelidae. In: V. Székessy (Ed.), Magyarország Állatvilága (Fauna Hungariae 63), Coleoptera IV, IX(6):1-416. Akadémiai Kiadó, Budapest. [in Hungarian] Kaszab, Z. 1962b. Beiträge zur Kenntnis der Chrysomeliden-Fauna des Karpaten-beckens nebst Beschreibung neuer Formen (Coleoptera). Folia Entomologica Hungarica (N. S.) 15(3):25-93. Kaszab, Z. and V. Székessy 1953. Bátorliget bogárfaunája (Coleoptera) [Beetle fauna of Bátorliget], pp. 194285. In: V. Székessy (Ed.), Bátorliget élővilága. Akadémiai Kiadó, Budapest. [in Hungarian with German summary] Kippenberg, H. and M. Döberl 1994. 88. Familie: Chrysomelidae, pp. 17-142. In: G. A. Lohse and W. H. Lucht (Eds.), Die Käfer Mitteleuropas 3. Supplementband mit Katalogteil. Goecke & Evers, Krefeld. Kippenberg, H. and M. Döberl 1998. 88. Familie: Chrysomelidae, pp. 313-324. In: W. H. Lucht and B. Klausnitzer (Eds.), Die Käfer Mitteleuropas 4. Supplementband. Goecke & Evers, Krefeld. Koy, T. 1800. Alphabetisches Verzeichniss meiner Insecten-Sammlung. Gedruckt mit königl. UniversitätsSchriften, Ofen [Buda]. Kuthy, D. (1897). Ordo Coleoptera, pp. 5-214. In: Fauna Regni Hungariae, III. (Arthropoda). Királyi Magyar Természettudományi Társulat, Budapest. Leonardi, C. and B. Gruev 1993. Notes on systematics and geographical distribution of some Psylliodes included in the cluster of Ps. picinus (Marsh.), with description of a new species (Coleoptera, Chrysomelidae). Atti della Società Italiana di Scienze Naturali e del Museo Civicio di Storia Naturale di Milano (1992) 133(2):13-32. Leonardi, C. and S. Sassi 2001. Studio critico sulle specie de Cryptocephalus del gruppo hypochaeridis (Linné, 1758) e sulle forme ad esse attribuite (Coleoptera, Chrysomelidae). Atti della Società Italiana di Scienze Naturali e del Museo Civicio di Storia Naturale di Milano 142(1):3-96. Lohse, G. A. 1989. Hydrogaleruca-Studien. Entomologische Blätter 85(1-2):61-69. Mahunka, S. and T. Vásárhelyi 1990. A zoológia Magyarországon. Fontos-e kutatnunk hazánk élővilágát? [The state of zoology in Hungary. Is it important to research our fauna?] Magyar Tudomány 1990(9):1055-1060. [in Hungarian]

102

Károly Vig

Merkl, O. 1991. Reassessment of the beetle fauna of Bátorliget, NE Hungary (Coleoptera), pp. 381-498. In: S. Mahunka (Ed.), The Bátorliget Nature Reserve – after forty years. Volume 1. Hungarian Natural History Museum, Budapest. Merkl, O. 1999. “Entomologia” by Robert Townson, pp. 95-116. In: P. Rózsa (Ed.), Robert Townson’s travels in Hungary. Kossuth Egyetemi Kiadó, Debrecen. Miskolci, G. 1702. Egy Jeles Vad-Kert, Avagy az oktalan állatoknak öt könyvekbe foglaltatott teljes historiája. Lőcse. Móczár, L. 1972. A Kárpát-medence Hymenoptera faunakatalógusainak (I-XXIV.) lelőhely jegyzéke (Cat. Hym. XXV.) [Das Fundortverzeichnis des Faunenkatalogs der Hymenopteren I-XXIV. des Karpatenbeckens (Cat. Hym. XXV)]. Folia Entomologica Hungarica (N. S.) 25(7):111-164. Molnár, J. 1783. A természet három országának rövid ismertetése, kezdet gyanánt. Magyar Könyv Háza 1(4):175-232. Mroczkowski, M. 1990. Coleoptera: Chrysomelidae, pp. 1-279. In: Burakowski, M. Mroczkowski and J. Stefańska (Eds.), Katalog fauny Polski, część XXIII, 16, Warszawa. Olivier, A. G. 1789. Entomologie ou historie naturelle des Insectes, avec leurs caracteres génériques et spécifiques, leur description, leur synonymie, et leur figure enluminée. Coléoptères. Tome premier. L’Imprimerie de Baudouin, Paris. Papp, L. 1983. A zootaxonómia hatékonyságának egyes kérdései [Certian question of the efficiency of zootaxonomy]. Állattani Közlemények 70:63-67. [in Hungarian with English summary] Piller, M. and L. Mitterpacher. 1783. Iter per Poseganam, Slavoniae provinciam mensibus Junio et Julio 1782 sesceptum. Typis Regiae Universitatis, Budae. Rozner, I. 1996. An updated list of the Chrysomelidae of Hungary and adjoining parts of the Carpathian Basin (Coleoptera). Folia Entomologica Hungarica 57:243-260. Scopoli, J. A. 1772. Annus V. Historico-Naturalis. Hilscher. Lipsiae. Strejček, J. 1993. Chrysomelidae, pp. 123-132. In: J. Jelinek (Ed.), Check-list of Czechoslovak Insects IV (Coleoptera). Folia Heyrovskyana Supplementum 1. Praha. Tomov, V. and B. Gruev. 1981. The chrysomelid (Coleoptera) fauna of the Hortobágy National Park, pp. 159168. In: S. Mahunka (Ed.), The fauna of the Hortobágy National Park 1. Akadémiai Kiadó, Budapest. Tomov, V., B. Gruev, K. Vig and O. Merkl 1996. Chrysomelidae (Coleoptera) of the Bükk National Park, pp. 327-349. In: S. Mahunka, L. Zombori and L. Ádám (Eds.), The fauna of the Bükk National Park 2. Magyar Természettudományi Múzeum, Budapest. Townson, R. 1797. Travels in Hungary, with a short account of Vienna in the year 1793. London. Vásárhelyi, T. 1998. Gyűjtemények múltja és jövője [Past and future of our collections]. Természet Világa (Természettudományi Közlöny) 129(12):540-543. [in Hungarian] Vidlička, L’. and Gy. Sziráki. 1997. The native cockroaches (Blattaria) in the Carpathian Basin. Folia Entomologica Hungarica 58:187-220. Vig, K. 1992. Contribution to the knowledge of the Chrysomelidae (Coleoptera) of the Carpathian Basin, pp. 602-606. In: L. Zombori and L. Peregovits (Eds.), Proceedings of the 4th ECE/XIII. SIEEC, Gödöllő 1991. Vig, K. 1996. A Nyugat-magyarországi-peremvidék levélbogár faunájának alapvetése (Coleoptera, Chrysomelidae sensu lato) [Leaf beetle fauna of Western Transdanubia (Hungary)]. Preanorica Folia Historico-naturalia 3:1-178. [In Hungarian, with English and German summaries] Vig, K. 1998a. A Duna–Dráva Nemzeti Park levélbogár faunája (Coleoptera: Chrysomelidae sensu lato) [Leaf beetle fauna of the Duna–Dráva National Park]. Dunántúli Dolgozatok, Természettudományi Sorozat 9:249-268. [in Hungarian, with English summary]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

103

Vig, K. 1998b. Leaf beetle collection of the Mátra Museum, Gyöngyös (Coleoptera, Chrysomelidae sensu lato). Folia Historico Naturalia Musei Matraensis 22:175-201. Vig, K. 1999. Leaf beetle fauna of the Aggtelek National Park (Coleoptera, Chrysomelidae sensu lato), pp. 265287. In: S. Mahunka (Ed.), The fauna of the Aggtelek National Park 1. Magyar Természettudományi Múzeum, Budapest. Vig, K. 2000. A Villányi-hegység levélbogár faunája (Coleoptera: Chrysomelidae sensu lato) [Leaf beetle fauna of the Villány Hills (South Hungary)]. Dunántúli Dolgozatok, Természettudományi Sorozat 10: 229-248. [in Hungarian, with English summary] Vig, K. (2002). Beetle collection of the Savaria Museum (Szombathely, Hungary) II, Leaf beetle collection of Attila Podlussány. Specimens from North, Middle and Southeastern Europe (excluding Turkey). (Coleoptera, Chrysomelidae). Preanorica Folia Historico-naturalia 5:1-171. Vig, K. (in press a). Leaf beetle fauna of the Fertő–Hanság National Park. In: S. Mahunka (Ed.), The fauna of the Fertő–Hanság National Park. Magyar Természettudományi Múzeum, Budapest. Vig, K. (in press b). Leaf beetle collection of the Janus Pannonius Museum, Pécs (Coleoptera, Chrysomelidae). A Janus Pannonius Múzeum Évkönyve, Természettudományok. Vig, K. and I. Rozner 1996. Leaf beetle fauna of Őrség (Coleoptera: Chrysomelidae sensu lato). In: K. Vig (Ed.), Natural history of Őrség Landscape Conservation Area II, Savaria a Vas megyei Múzeumok Értesítője 23(2):163-202. Zúber, M. 1995. Faunistické správy zo Slovenska. Entomofauna Carpathica 9(1):28. [in Slovakian]

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers Systematic Position of the Subfamilies Megalopodinae and Megascelinae ... Beetle Biology 105 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 105-116

Systematic Position of the Subfamilies Megalopodinae and Megascelinae (Chrysomelidae) Based on the Comparative Morphology of Internal Reproductive System Kunio Suzuki1 1

Department of Biology, Faculty of Science, Toyama University, Toyama, 930-8555 Japan. E-mail: [email protected]

ABSTRACT The internal reproductive systems (IRS; the whole system for male and the spermathecal organ for female) are reported for three Panamanian genera (Megalopus, Mastosthetus, and Agathomerus) of Megalopodinae for the first time. They show fundamentally the same characteristics as those of Japanese Colobaspis japonica (Baly) studied by Suzuki (1988). Several common stable characters could be found for these four megalopodine genera and Zeugophora (Zeugophorinae). This strongly indicates that Megalopodinae and Zeugophorinae, as well as the Australasian Palophaginae studied by Kuschel and May (1990), must constitute sister groups derived from one monophyletic stock as suggested by Suzuki (1988, 1994a, 1996), Reid (1995) and Suzuki and Windsor (1999). The IRSs of two (one Panamanian and one Mexican) Megascelis species of Megascelinae clearly indicate a close relationship to those of Eumolpinae. The male IRS of Megascelinae is reported for the first time. As several workers have pointed out Megascelinae and Eumolpinae are sister groups of a single monophyletic group. Based mainly on the results of the comparative morphology of the IRS and several other morphological characters (hind wing venation, male external genitalia, etc.), that have been considered phylogenetically important, the systematic position of Megalopodinae and Megascelinae is discussed. KEY WORDS: systematic position, Chrysomelidae, Megalopodinae, Megascelinae, internal reproductive system (IRS)

INTRODUCTION I visited the Smithsonian Tropical Research Institute (STRI), Panama, in July 1997 and, therefore, had a fortunate opportunity to dissect fresh material of several species of three phylogenetically important subfamilies Aulacoscelinae, Megascelinae, and Megalopodinae with the aid of Donald M. Windsor (STRI). The geographical distribution of the first and second groups is restricted in Central and South America. Several workers have proposed hypotheses about the systematic position of these three subfamilies within the superfamily Chrysomeloidea and/or the family Chrysomelidae (cf. Reid, 1995; Suzuki, 1996). I have also occasionally given a review of higher classification of the

106

Kunio Suzuki

family Chrysomelidae since 1980 (cf. Suzuki, 1996). But until today no reliable system covering the whole of this family has been established. Suzuki and Windsor (1999) already published the results of comparative morphological studies on Aulacoscelis sp., a species closely related to Aulacoscelis melanocera Duponchel and later described as a new species A. appendiculata (Cox and Windsor, 1999). It was clearly established that the subfamilies Aulacoscelinae and Orsodacninae are sister groups of single monophyletic stock (Suzuki and Windsor, 1999). This conclusion also supports the proposal by Reid (1995). In this paper, I would like to report the results of the comparative morphology of both male and female internal reproductive systems (IRS) of other two subfamilies Megalopodinae and Megascelinae and to give some comments on their systematic position. Subfamily Megalopodinae The subfamily Megalopodinae auct. should be classified into the three sister groups. Suzuki (1996) treated all of them as ‘tribes’; that is, Megalopodini, Zeugophorini and Palophagini. Table 1 shows the previous and current studies that have been made for the IRS of the subfamily Megalopodinae s. str. (Suzuki’s ‘tribe Megalopodini’) Table 1. IRS studies of Megalopodinae s. str. Colobaspis japonica (Baly) † and ‡ Suzuki (1974, 1988) Colobaspis sp. ‡: Present study Agathomerus sp. † and ‡: Present study Mastostethus sp. ‡: Present study Megalopus sp. † and ‡: Present study

The male and female IRSs of the subfamily Megalopodinae s. str. have been reported so far for only one Japanese species Colobaspis japonica (Baly) (Suzuki, 1988). The IRSs of three genera, Megalopus, Mastosthetus, and Agathomerus, of this subfamily s. str. are reported here for the first time. Fig. 1 shows both male and female IRSs of Colobaspis japonica from Japan cited in Suzuki (1988). The male IRS of C. japonica is characteristic in having a fused testis, long lateral ejaculatory ducts, a well-developed ejaculatory sac, and very long posterior ejaculatory duct. Fig. 2 shows the female spermathecal organ (SptO) of Colobaspis sp. whose locality is unknown. The female SptOs of the two Colobaspis species examined are quite similar to each other and have very specialized spermathecal capsules, long spermathecal ducts, and a very long spermathecal gland. Fig. 3 shows the male IRS and female SptO of Megalopus sp. In the male IRS an apparently fused testis, long vas efferens, and long common and posterior ejaculatory ducts with a well-developed ejaculatory sac are characteristic. Other than the subfamily Megalopodinae s. str., fused testes can be seen only in the species of the subfamilies Galerucinae and Alticinae. In the female SptO, a strongly specialized spermathecal capsule, a long spermathecal duct, and a very long spermathecal gland are characteristic of Megalopodinae. Fig. 4 shows the SptO of Mastostethus sp. It is very similar to those of Colobaspis species and Megalopus sp. I could not observe the male IRS of this Mastostethus species. Fig. 5 shows the male IRS and female SptO of Agathomerus sp. Both male and female systems are identical with those of previous four species of the three genera. Table 2 shows the main characteristics in both male and female IRSs of the subfamily Megalopodinae s. str.

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

107

Fig. 1. The male IRS (a) and female SptO (b) of Colobaspis japonica (Baly) (Megalopodinae, ‘Megalopodini’) from Japan. Scale bar 1.0 mm. (after Suzuki 1988).

Fig. 2. The female SptO of Colobaspis sp. (locality unknown; Museum of Comparative Zoology Coll.). (Megalopodinae, ‘Megalopodini’). Scale bar 1.0 mm.

108

Kunio Suzuki

Fig. 3. The male IRS (a) and female SptO (b) of Megalopus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Chiriqui Prov., 1300 m alt., 4-VII-1997, J. Wappes leg.). Scale bar 1.0 mm.

Fig. 4. The female SptO of Mastostethus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Cerro Campana, 16-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm.

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

109

Fig. 5. The male IRS (a: whole system; b: a right half of Tes part, peritoneal sheath removed) and female SptO (c, d) of Agathomerus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Cerro Campana, 16-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm. Table 2. Main IRS characteristics in Megalopodinae s. str. Male 1. Fused testis, including 4 sperm tubes Common in the three genera (Megalopus, Agathomerus, Colobaspis) and present in all Galerucinae+Alticinae. 2. A pair of tubular accessory glands 3. A very long ejaculatory duct, with a well-developed ejaculatory sac Female 1. A very specialized spermathecal capsule 2. A very long spermathecal duct 3. A very long and well-developed spermathecal gland

A combination of the above three male characteristics is seen in only the subfamily Megalopodinae s. str. and a combination of the three female characteristics in only the subfamilies Megalopodinae s. str. and Zeugophorinae s. str. These characteristics are very stable in their fundamental morphological structures. Especially, I would like to point out the importance of the combination of these and

110

Kunio Suzuki

relative size of each of the elementary parts making up the system. The subfamily Megalopodinae s. str., which has been generally accepted so far, should be regarded as one monophyletic group along with the generally accepted the subfamilies Zeugophorinae s. str. and Palophaginae s. str. In my system each of these three groups is treated as an independent ‘tribe’ within the subfamily Megalopodinae, respectively. Table 3 shows the previous studies of the IRS of the subfamilies Zeugophorinae s. str. and Palophaginae s. str. Table 3. IRS studies of Zeugophorinae s. str. and Palophaginae s. str. Zeugophorinae s. str. Zeugophora (Pedrillia) annulata (Baly) † and ‡ Suzuki (1974, 1988) Zeugophora (Pedrillia) bicolor (Jacoby) † and ‡ Suzuki (unpublished) Zeugophora (Pedrillia) vitinea (Oke) ‡: Reid, 1989 Zeugophora (Pedrillia) williamsi Reid ‡: Reid, 1989 Palophaginae s. str. Palophagus bunyae Kuschel et May ‡: Kuschel and May (1990) Palophagus australiensis Kuschel et May ‡: Kuschel and May (1990) Cucujopsis setifer Crowson ‡: Kuschel and May (1990)

Fig. 6 shows the IRSs of both sexes of Zeugophora (Pedrillia) annnulata from Japan cited in Suzuki (1988). Besides non-fused testis, both male and female IRSs are basically identical with those of the previous four genera of the subfamily Megalopodinae s. str. Fig. 7 shows the female SptOs of two Palophagus species, P. bunyae and P. australiensis, and Cucujopsis setifer. Though those figures are schematic, they show well the fundamental characteristics, of members of the megalopodine groups.

Fig. 6. The male IRS (a) and female SptO (b) of Zeugophora (Pedrillia) annulata (Baly) (Megalopodinae, ‘Zeugophorini’) from Japan. Scale bar 0.5 mm. (after Suzuki 1988).

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

111

Fig. 7. The female SptOs of two Palophagus species, P. bunyae Kuschel et May (a) and P. australiensis Kuschel et May (b), and of Cucujopsis setifer Crowson (Megalopodinae, ‘Palophagini’). Scale bar 1.0 mm. (after Kuschel and May 1990).

Subfamily Megascelinae Table 4 shows the studies of the IRS of the subfamily Megascelinae s. str., namely Suzuki’s ‘tribe Megascelini’. Table 4. IRS studies of Megascelinae s. str. Megascelis sp.1 ‡: Suzuki (1974, 1988) Megascelis sp.2 † and ‡: Suzuki (unpublished) Megascelis puella Lacordaire, 1845 † and ‡: Present study

Concerning the male and female IRSs of the ‘tribe Megascelini’ no reliable information has been obtained, except the SptO of Megascelis sp. studied by Suzuki (1974, 1988). The male IRS of the subfamily Megascelinae s. str. is reported here for the first time. I was able to dissect two (one Panamanian and one Mexican) species of the genus Megascelis. The main characteristics of both male and female IRSs in the two Megascelis species can be compiled as in Table 5. Table 5. Main IRS characteristics in Megascelinae s. str. Male 1. A long and thick vas deferens 2. Very long accessory glands

112

Kunio Suzuki

3. An anterior ejaculatory duct forming a weekly developed ejaculatory sac and a short posterior ejaculatory duct Female 1. A very specialized proximal part of spermathecal capsule 2. A slender and long spermathecal duct 3. A long spermathecal gland

A combination of the above characteristics in both sexes is seen in only the subfamilies Megascelinae s. str. and Eumolpinae auct. Fig. 8 shows both male IRS and female SptO of Megascelis puella from Panama. The IRS of another Mexican species is almost same as that of M. puella in both sexes. Fig. 9 shows the male IRS and female SptO of Colposcelis variabilis of the subfamily Eumolpinae s. str., Suzuki’s ‘tribe Eumolpini’, from Japan cited in Suzuki (1988). One can quickly find that no fundamental difference is seen in the IRSs of either sex of the species belonging to the subfamilies Megascelinae s. str. and Eumolpinae auct. DISCUSSION Based on the results of the comparative morphology of the IRS, I would like to consider the systematic position of the subfamilies Megalopodinae s. str. and Megascelinae s. str. and the phylogenetic relationships among them and their relatives. I propose the following two hypotheses about the phylogenetic relationships among the three subfamilies studied.

Fig. 8. The male IRS (a) and female SptO (b) of Megascelis puella Lacordaire (Eumolpinae, ‘Megascelini’) from Panama (Gamboa, 15-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm for a, 0.5 mm for b.

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

113

Fig. 9. The male IRS of Colposcelis variabilis (Baly) (a) and female SptO of Basilepta fulvipes (Motschulsky) (b) (Eumolpinae, ‘Eumolpini’) from Japan. Scale bar 0.5 mm for a, 0.25 mm for b. (after Suzuki 1988).

1. The subfamily Megalopodinae s. str., together with the subfamilies Zeugophorinae s. str. and Palophaginae s. str., constitutes a monophyletic group (Suzuki’s ‘subfamily Megalopodinae’), but they have a close phylogenetic relationship with some ancestral forms of the family Cerambycidae (e.g. Lamiinae) rather than with any other groups of the family Chrysomelidae. 2. The subfamilies Megascelinae and Eumolpinae are sister groups which might have originated from an ancestral form and constitute a monophyletic group (Suzuki’s ‘subfamily Eumolpinae’). The two hypotheses proposed here are basically consistent with my higher classification system of the family Chrysomelidae proposed since Suzuki (1980) and with the results of the comparative morphology of external genitalia and hind wing venation (Suzuki, 1994a). For the results of comparison of the IRS with other phylogenetic and/or systematic characters like external genitalia, hind wing venation, and so on, refer to my recent papers listed in the References section below. Finally, I would like to take this opportunity to mention briefly the phylogenetic relationship of the subfamilies Orsodacninae and Aulacoscelinae. Recently I have published the results of IRS studies of the subfamily Aulacoscelinae (Suzuki, 1994 b; Suzuki and Windsor, 1999). Table 6 shows the previous studies, which have been made for the IRSs of the subfamilies Orsodacninae and Aulacescelinae. Table 6. IRS studies of Orsodacninae and Aulacoscelinae Orsodacninae Orsodacne arakii Chûjô † and ‡: Suzuki (1974, 1988) Orosodacne lineola Panzer † and ‡: Mann and Crowson (1981) Aulacoscelinae Aulacoscelis melanocephala Jacoby ‡: Suzuki (1994b)

114

Kunio Suzuki Aulacoscelis confusa Monrós ‡: Suzuki (1994b) Aulacoscelis costaricensis Bechyné ‡: Suzuki (1994b) Aulacoscelis tibialis Jacoby ‡: Suzuki (1994b) Aulacoscelis variabilis variabilis Jacoby ‡: Suzuki (1994b) Aulacoscelis candezei Chapuis ‡: Suzuki (1994b) Aulacoscelis sp. † and ‡: Suzuki and Windsor (1999) Janbechynea (Janbechynea) elongata (Jacoby) ‡: Suzuki (1994b)

Fig. 10 shows the male IRS and female SptO of Aulacoscelis sp. from Panama cited in Suzuki and Windsor (1999). Fig. 11 shows the male IRS and female SptO of Orsodacne arakii from Japan cited in Suzuki (1988). It can easily be recognized that these two groups have many characteristics in common in both sexes. Until I examined the male IRS of Aulacoscelis sp. from Panama, I retained my previous opinion of the systematic position of the subfamily Aulacoscelinae (Suzuki, 1996). But, their IRS obviously indicated a direct relationship to the subfamily Orsodacninae. Through comparative morphological studies of the hind wing venation and male and female IRSs, I have confirmed the effectiveness of these morphological characters in considering the phylogenetic relationships among higher taxa. I would like to retain my previous phylogenetic system, which is a revised version of that of Suzuki (1994a) paper as shown in Fig. 12 (Suzuki 1994a, 1996; Suzuki and Windsor, 1999). I am convinced that this system is consistent with the data, which have been obtained from morphological as well as other aspects of biology.

Fig. 10. The male IRS (a) and female SptO (b) of Aulacoscelis sp. (Orsodacninae, ‘Aulacoscelini’) from Panama. Scale bar 1.0 mm. (after Suzuki and Windsor, 1999).

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

115

Fig. 11. The male IRS (a) and female SptO (b) of Orsodacne arakii Chûjô (Orsodacninae, ‘Orsodacnini’) from Japan. Scale bar 0.5 mm for a, 0.25 mm for b. (after Suzuki 1988).

Fig. 12. Supposed phylogenetic relationships among the ‘subfamilies’ and ‘tribes’ of the family Chrysomelidae (after Suzuki and Windsor 1999).

116

Kunio Suzuki

ACKNOWLEDGEMENTS I deeply thank D. M. Windsor of the Smithsonian Tropical Research Institute, Panama, for his kind help and hospitality during my stay in Panama. I also thank D. G. Furth for his constant assistance and friendship. LITERATURE CITED Cox, M. L. and D. M. Windsor 1999. The first instar larva of Aulacoscelis appendiculata n. sp. (Coleoptera: Chrysomelidae: Aulacoscelinae) and its value in the placement Aulacoscelinae. J. Nat. Hist. 33:1049-1087. Kuschel, G. and B. M. May 1990. Palophaginae, a new subfamily for leaf-beetles, feeding as adult and larva on Araucarian pollen in Australia (Coleoptera: Megalopodinae). Invert. Taxon. 3:697-719. Mann, J. S. and R. A. Crowson 1981. The systematic position of Orsodacne Latr. and Syneta Lac. (Coleoptera Chrysomelidae), in relation to characters of larvae, internal anatomy and tarsal vestiture. J. Nat. Hist. 15:727-749. Reid, C. A. M. 1989. The Australian species of the tribe Zeugophorini (Coleoptera: Chrysomelidae: Megalopodinae). Gen. Appl. Ent. 21:39-47. Reid, C. A. M. 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea) , pp. 559-631. In: J. Pakaluk and S. A. Slipinski (Eds.), Biology, Phylogeny, and Classification of Coleoptera (Papers Celebrating the 80th Birthday of Roy A. Crowson). Museum i Instytut Zoologii PAN, Warszawa. Vol. 2. Suzuki, K. 1974. Phylogeny of the family Chrysomelidae based on the comparative morphology of the internal reproductive system (Insecta: Coleoptera). Ph D. Thesis, Tokyo Metropolitan University, 186 pp. Suzuki, K. 1988. Comparative morphology of the internal reproductive system of the Chrysomelidae (Coleoptera), pp. 317-355. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.). Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht/Boston/ London. Suzuki, K. 1994a. Comparative morphology of the hindwing venation of the Chrysomelidae (Coleoptera), pp. 337-354. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht/Boston/London. Suzuki, K. 1994b. The systematic position of the subfamily Aulacoscelinae (Coleoptera: Chrysomelidae), pp. 45-59. In: D. G. Furth (Ed.), Proc. 3rd Int. Symp. Chrysomelidae, Beijing, 1992. Backhuys Publ., Leiden. Suzuki, K. 1996. Higher classification of the family Chrysomelidae (Coleoptera), pp. 3-54. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology, Vol. 1: The Classification, Phylogeny and Genetics. SPB Academic Publishing, Amsterdam. Suzuki, K. and D. M. Windsor 1999. The internal reproductive system of Panamanian Aulacoscelis sp. (Coleoptera: Chrysomelidae, Aulacoscelinae) and comments on the systematic position of the subfamily. Entomological Science 2:391-398.

LEGEND FOR FIGURES Abbreviations for the male internal reproductive system (IRS) and female spermathecal organ (SptO) used in Figures 1-12: AG: accessory gland; EdC: common ejaculatory duct; EdL: lateral ejaculatory duct; EdP: posterior ejaculatory duct; ES: ejaculatory sac; GC: genital chamber; IS: internal sac; ML: median lobe; MO: median orifice; MS; median strut; SptC: spermathecal capsule; SptD: spermathecal duct; SptGl: spermathecal gland; ST: sperm tube; SV: seminal vesicle; Tes: testis; Tg: tegmen; Vd: vas deferens; Ve: vas efferens. (see also Suzuki 1988)

© PENSOFT Publishers Sofia - Moscow

David G. Furth (ed.) 2003 Cladistic Analysis of the Oedionychines of Southern Brazil ... Beetle Biology 117 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 117-132

Cladistic Analysis of the Oedionychines of Southern Brazil (Galerucinae: Alticini) Based on Two Molecular Markers Catherine N. Duckett1,2 and Karl M. Kjer2 1

University of Puerto Rico, San Juan, Puerto Rico, 00931-3360. Email: [email protected] 2 Rutgers University, Cook College, New Brunswick, NJ 08901. Email: [email protected]

ABSTRACT A phylogenetic analysis of the southern Brazilian oedionychine genera based on two molecular markers, EF1-alpha and COI, is presented. The Oedionychina is strongly supported as a monophyletic group based on the genera analyzed including the African genus, Physodactyla. The monoplatines analyzed form a monophyletic group which is not the sister taxon of the Oedionychina. The closest taxon analyzed to the Oedionychina is Hemipxyis, and the character of apical hind tarsomere-globosely swollen does not appear to define monophyletic groups within the Oedionychina. There is apparently considerable variation among populations within some species for the COI marker fragment used and not in others. COI can be useful for associating larvae with adults with appropriate sampling of other sympatric congeners. Genetic heterogeneity of the genera Alagoasa and Capraita is discussed.

RESUMEN Se presenta un análisis filogenético de las especies oedionychine del sur de Brasil, basado en dos marcadores moleculares, EF1-alpha y COI. En base a las especies analizadas, entre ellas, la especie africana, Physodactyla rubiginosa, la Oedionychina se muestra como un grupo monofilético. Los monoplatinos analizados forman un grupo monfilético que no es hermano taxonómico de la Oedionychina. El grupo taxonómico más próximo a la Oedionychina que se analizó es Hemipyxis. El carácter globoso de los tarsos apicales de las patas traseras no parece definir grupos monofiléticos en la Oedionychina. Aparentemente, hay variaciones considerables del fragmento del marcador COI que se utilizó entre las poblaciones dentro de algunas especies. No así en otras. El marcador COI puede ser útil para asociar larvas y adultos con una muestra adecuada de otros congéneres simpátricos. Se discute la heterogeneidad genética de Alagoasa y Capraita. INTRODUCTION The Oedionychina sensu Bechyné and Bechyné consists of 23 genera, 4 from the Old World and 19 from the New World; they are large jewel-like beetles with robust jumping legs, which are also known for their globosely swollen hind tarsal segment, and the pronotum with lateral flanges produced

118

Catherine N. Duckett & Karl M. Kjer

forward (see Fig.1)(Bechyné and Bechyné 1966). Oedionychina is a diverse group with more than 600 species in the New World alone; some species are economically important crop pests (Martorell 1975) some are also being investigated as possible biocontrol agents (Samuelson 1985, Hill pers. comm.). These flea beetles constitute an ecologically significant component of the Neotropical fauna. As a group, they are among the largest (by weight) of the flea beetles, and, in some areas, are very common. Oedionychina is also notable as one of the few suprageneric groups of Alticini that most workers consider valid and monophyletic (Scherer 1983,1988; Seeno and Wilcox 1982; Virkki 1989; Virkki and Santiago-Blay 1996). Most Oedionychina are brightly colored and many participate in mimicry complexes (Begossi and Benson 1988; Duckett 1998). Because the Oedionychina includes many morphologically different and speciose mimicry complexes, (Balsbaugh 1988, Begossi and Benson 1988), some mimetic species participate in mimicry complexes with species from other genera, (e.g. Asphaera auripennis Harold and Alagoasa libentina (Germar)). Moreover, others like Alagoasa plaumanni Bechyné are polymorphic and may participate in as many as 5 mimicry complexes that may include species from the same genus or different genera (Bechyné 1955a). Both polymorphism within species and mimeticism between genera can complicate our ability to accurately reconstruct the phylogeny by making homology assessments based on morphology difficult. Although the Oedionychina is generally assumed to be monophyletic no phylogenetic hypothesis of the relationships among the genera has been proposed and doubts about the monophyly of the genera have been expressed informally and formally (Swigonova and Duckett, 1998; Flowers 2001; see Taxonomic History for discussion). Given these doubts and the need for phylogenetic tests of taxonomic hypotheses, we undertook this study to test the monophyly of the oedionychines of southern Brazil, which is part of a larger study of the Oedionychina world-wide, with the objective to identify the genera most in need of taxonomic revision. Because of the extreme lack of phylogenetic (or even taxonomic) work in the flea beetles, any cladistic hypothesis is valuable; moreover, any understanding of relationships among out-group taxa will be useful as well. This study has three basic objectives. The primary goal is to test monophyly of the sub-tribe Oedionychina and to investigate the generic level relationships of the common southern Brazilian genera using nuclear and mitochondrial DNA sequence data. Mimicry and its concomitant selection pressures towards external similarity may be one of the reasons the Oedionychina have been considered so difficult by traditional taxonomists (Begossi and Benson 1988, Scherer 1983). However, use of molecular characters is particularly conducive to elucidating problems in mimicry (Brower 1996). The second objective is to examine the putative phylogenetic utility of the globosely swollen hind tarsus to group genera (see Fig. 1). The Oedionychina has two phenetic groups which appear in Scherer’s keys (1962, 1983) and reflect Horn’s 1889 division of the group into ‘Oedionyches’ (with very globosely swollen hind tarsi) and the ‘Aspicelae’ with less swollen hind tarsi. Because of this characteristic the Oedionychina have also been considered associated with the monoplatines and the pseudolampsines (Clark 1860, 1865) (see Taxonomic History below). There is currently little evidence to support or refute these groupings and we test them here. Finally, we wish to present evidence of genetic variability within and among species of oedionychine for both genetic markers used, especially cytochrome oxidase I (COI), which may permit accurate association of larvae with adults in many species. Investigation and discussion of intraspecific genetic variability is essential to the scientific credibility of molecular phylogenetics (Reid 1995).

Cladistic Analysis of the Oedionychines of Southern Brazil ...

119

Fig. 1. Dorsal habitus of Paranaita generosa, (Harold). 8 mm. Luz Elvia Diaz, illustrator.

Taxonomic History The Oedionychina have been recognized (at least informally) since the 1860’s when Clark (1860, 1865) recognized 6 genera including the diverse genera Oedionychus Berthold, 1827, Asphaera Chevrolat, 1842, Omophoita Chevrolat, 1837 as well as the smaller genera Eutornus Clark, 1865 from Africa, Aspicela Dejean, 1837 from the Andes and Pachyonchis Clark, 1860 from the Mid-Atlantic USA. Clark (1860) hypothesized that the monoplatines are the sister group of the oedionychines by morphological association. Chapuis (1875) formally described the tribe-Oedionychites. Horn (1889) divided the oedionychines into two series the Oedionyches and Aspicelae. The Aspicelae included the genera with less globosely swollen hind tarsi, at that time only Omophoita, Asphaera and Aspicela. Except for Hamletia Crotch, 1873 which is a synonym of Pachyonchis only two new genera were described until the 1950’s, Chlöephaga Weise 1899 and Philopona Weise 1903 from Africa and Asia. However, Chlöephaga is a homonym of a genus of birds and consequently was replaced with Capraita Bechyné 1957. Leng (1920) formalized the Oedionychini and Aspicelini as tribes of the subfamily Alticinae. Most New World species were described in the genera Oedionychus, Asphaera and Omophoita for the next 75 years until each genus included about 200 species. However, in 1996, Konstantinov and Vandenberg recognized Oedionychus as nomen nudum, making Oedionychis Latreille 1829 the generic basis for the sub-tribe (Konstantinov and Vandenberg 1996). In the 1950’s Bechyné split Oedionychus and Asphaera (Bechyné 1951, 1955a,b, 1956, 1957, 1959 b), adding 17 more generic names to the Oedionychina. Oedionychus was restricted to a small group of species in Spain and North Africa, and most of the new world species were placed in Kuschelina, Bechyné 1951, Alagoasa Bechyné, 1955, Paranaita Bechyné, 1955, Walterianella Bechyné, 1955 and Wanderbiltiana Bechyné, 1955. Genera for species of specialized morphology were also proposed: Pydixaltica for the erotyloid mimic Oedionychus variegata Jacoby (Bechyné 1956), Callangaltica for the highly hemispherical Amazonian species O. batesi Baly, (Bechyné 1958), Nycteronychis (Bechyné 1955b)

120

Catherine N. Duckett & Karl M. Kjer

for O. trivitatta Baly from Rio de Janiero, Araoua for O. umbricata Oliver (Bechyné 1955b). Cuyabasa Bechyné, 1956 has 3 species with metallic blue elytra and pronotal angles, which are barely produced forward and has been shunted between the Oedionychina and the Disonychina (Bechyné and Bechyné 1966 and in litteris, Seeno and Wilcox 1982). A recent cladistic analysis places Cuyabasa (Duckett 1999) as an oedionychine. However, these genera have proved taxing to work with; Scherer (1983), describing his key to the Oedionychine genera referred to the new genera proposed by Bechyné as ‘presenting great difficulties, which also is apparent in this key’ (Scherer 1962, 1983). However, most morphologically generalized species were placed in Alagoasa or Kuschelina. Some of these changes were done in litteris or on museum labels and were later formalized by Furth and Savini (1996, 1998). Many taxonomists have informally speculated that Kuschelina and Alagoasa as currently defined may overlap and that Alagoasa may be an artificial assemblage (Swigonova and Duckett 1998). Omphoita and Asphaera have been confused both physically and taxonomically for a long time (Leng 1920, Bechyné 1955a, b, 1958, Bechyné and Bechyné 1973, 1977, Flowers 2001); as we note below even the identity of the type species of the genera is debated. Both genera have a slightly (rather than highly) globose hind tarsus and neither has been revised. Horn (1889) recognized Asphaera as an invalid name and used Homophoeta Erichson instead. Jacoby (1888; 1890) refused to recognize the validity of Horn’s Homophoeta and used Asphaera without formal taxonomic treatment. In 1955 a, b, and 1957 Bechyné considered Asphaera Chevrolat 1843 (sic) as a synonym of Omophoita Chevrolat 1857. In 1955 he presented Omophoita as reserved for the species removed from Asphaera and Homophoeta as a subgenus, defined by the discrete character of a white frons apparently bordered by sutures. In 1957 Bechyné presented Homophoeta as if it were a genus in its own right (Bechyné 1957), and 6 species formally in Asphaera were presented as Omophoita. Later, Bechyné 1963 and Bechyné and Bechyné (1977) defined Omophoita by a “primitive”, irregular setation on the labrum and Asphaera by the 4 regular punctuations. In 1963 Bechyné recognizes Homophoeta as a junior synonym of Omophoita with O. equestris (F.) as the type species. However, Scherer in his 1983 key continued to use Homophoeta, recognizing H. albicollis (F.) as the type. Asphaera was split by Bechyné (1955b, 1958, 1959b, 1963) into 5 genera , 4 with the root ‘asphera’ in their names: Rhynchasphaera Bechyné 1955, (3 species) Longasphaera Bechyné 1955 (monotypic), Pleurasphaera Bechyné, 1958 (monotypic), Palmaraltica Bechyné, 1959, (3 species); and Asphaerina Bechyné 1963 (monotypic). As stated above, most of the remaining species of Asphaera were informally transferred to Omophoita including both the species that are variously, though invalidly, considered as the type species for Asphaera: A. auripennis Harold (Scherer 1962, 1983) and Chysomela nobilitata F. (Bechyné, 1963; Bechyné and Bechyné 1978). Despite the confusing situation of Asphaera and Omophoita, some of the other oedionychine genera are quite distinctive, species of Paranita, are similar in general appearance, being very highly and hemi-spherically vaulted with coarse elytral punctations (Fig. 1). Walterianella is also easy to recognize as it is very dorso-ventrally flat, because of this it is sometimes confused with Capraita, which is small, and dorso-ventrally flattened and by definition has an indentation of the vertex and a prebasal pronotal indentation (Bechyné and Bechyné 1977). METHODS Collection, Amplification, and Sequencing In the field, collected chrysomelids were placed in 95% ethanol, and either brought promptly to the lab for DNA extraction or frozen. Two legs were removed from the specimens and the rest was

Cladistic Analysis of the Oedionychines of Southern Brazil ...

121

retained as a voucher, see table 1 for extraction number , color form of species, collection locality and Genbank accession number of each sequence. The legs were placed in a labeled Eppendorf tube and ground under liquid nitrogen, using micro tissue grinders (Phenix Research). DNA was extracted with SDS, Proteinase-K, and phenol/chloroform as described by Hillis and Davis (1986). Dried DNA pellets were resuspended in 100-250 ul of TE (Tris-EDTA). Most of this material is separated as a stock DNA collection and kept at -70oC. The rest was kept in a frost free freezer in the lab for PCR. Phenol, buffers, water, oil, etc. were aliquoted into single-use portions to avoid potential contamination. Samples were amplified on a thermal cycler using reaction conditions as described in Sambrook et al. (1989). Amplified DNA was separated on a 1.5% low melting point agarose gel (NuSieve 3:1, FMC Bioproducts). Bands of DNA were cut from the agarose gel, purified with GeneClean (Bio 101), and sequenced on an ABI 377 automated sequencer using the manufacturer’s recommendations (Applied Biosystems), except that we used one half the recommended enzyme concentration, in a half volume reaction. Molecular Markers, Primers and Phylogenetic Analyses Two protein coding molecular fragments were amplified: 481 base pairs of Elongation Factor Alpha (EF-1α) (primers 90F 5’ ATCGAGAAGTTCGAGAARGARGC-3’ and 580R 5’-CCAYCCCTTRAACCANGGCAT-3’) and 466 bp of Cytochrome Oxidase I (COI) primers (Simon et al. 1994) (1791-F 5’GGATCACCTGATATAGC-ATTCCC-3’, and 2191-R 5’-CCYGGTAAAATTAAAATATAAACTTC-3’). Sequence data was aligned by eye and checked using MacClade 4.0 by translation into codons. Misalignment resulting in frame shift “mutations” or stop codons was reassessed; a one codon insertion is present in Aedmon morissoni’s COI sequence. Sequences were submitted to Genbank under accession numbers AF466310- AF466345 and AF479419- AF479484 (See Table 1). Table. 1. Collection, extraction and Gen-bank accession numbers for specimens studied. Species name

form

Aedmon morissoni Alagoasa apicalis Alagoasa bicolor1 Alagoasa bicolor2 Alagoasa cruxnigra or nr Alagoasa cruxnigra Red larva Alagoasa formosa lavender Alagoasa formosa spotted Alagoasa formosa stripped Alagoasa libentina Alagoasa libentina Alagoasa nigroscutata Alagoasa plaumanni spotted Alagoasa plaumanni spotted Alagoasa plaumanni red Alagoasa plaumanni white

extraction# 207 126 AB AB2 313 318 302 204 200 303 314 315 031 079 320 112

locality

COI-accession# alpha EF1 accession#

Puerto Rico:South Coast Brazil:PA, Piraquara. Puerto Rico: Vega Alta. Puerto Rico: Vega Alta. Brazil:SC, Morro do Baú Brazil:SC, Morro do Baú Brazil:RS, Maqiné Brazil:RS, San Francisco de Paula Brazil:RS, Maqiné Brazil:PA,Estancia Betancia. Brazil:SP, São Paulo City. Brazil:SC, Morro do Baú Brazil:RS, Cangucu, Coxilhia do Fogo. Brazil:RS, Maqiné Brazil:PA, Piraquara Brazil:RS, San Francisco de Paula

AF479421 AF479463 AF479464 AF479465 AF479466 AF479438 AF479467 AF479468 AF479469 AF479470 AF479471 AF479472 AF479473 AF479474 AF479475 AF479476

AF466312 AF466333 AF466334 AF466335 AF466336

AF466337

AF466339 AF466340

122

Catherine N. Duckett & Karl M. Kjer

Table. 1. Continued. Species name

form

extraction#

Allochroma sp, nr nigripes Asphaera abdominalis Asphaera lustrans Asphaera auripennis Asphaera deleta Asphaera unicolor Aspicela scutata Aspicela undescribed sp pink Blepharida sp nr ornata Capraita clarissa Capraita clarissa2 Capraita conspurcatus Capraita nigrosignata Capraita obsidiana Capraita quercata Capraita sexmaculata Disonycha conjuncta Hemipyxis balyi Hemipyxis plagioderoides Hemipyxis plagioderoides Hypolampsis sp. Kuschelina concinna Kushelina petaurista Kushelina petaurista Kushelina rugiceps Oedionychis cinctus Oedionychis cinctus Omophoita equestris1 Omophoita equestris3 Omophoita equestris2 Omophoita equestris4 Omophoita octoguttata Omophoita personata Omophoita sericella Omophoita sp. Yellow larva Omophoita sp. Yellow larva Paranaita bilimbata Paranaita crotchi Paranaita opima red Paranaita opima white Physodactyla rubiginosa Walterianella argentinensis Walterianella biarcuata Walterianella bucki

locality

COI-accession# alpha EF1 accession#

709 241 309 115 124 113 233 245

Brazil:PA, Areia Branca Mexico:DF, UNAM, Parque escutorico. USA:TX, Brazil:PA, Piraquara Brazil:PA, Piraquara Brazil:SP, São Paulo City. Colombia: Cali. Ecuador: Napo.

AF479422 AF479444 AF479445 AF479446 AF479447 AF479448 AF479442 AF479443

209 040 b40 251 309 310 216 300 061 218 308 208 101 317 215 312 080 388 388a 049 142 b49 316 042 107 027 322 323 026 305 001 201 253 098 239 039

South Africa:Kwa-zulu Natal AF479419 Brazil:RS, Maqiné AF479449 Brazil:RS, Maqiné AF479450 Mexico:DF, UNAM, Parque escutorico. AF479451 USA:TX, AF479452 USA:TX AF479453 USA:NJ, Dividing Creek AF479454 USA:TX AF479455 Brazil:RS, Maqiné AF479420 China: Beijing AF479424 Japan: Toyama, Kureha Hills. AF479425 China: Beijing AF479426 Brazil:RS, San Francisco de Paula AF479423 USA:Texas. AF479477 USA:NJ, Dividing Creek AF479478 USA:Texas. AF479479 Brazil:RS, Maqiné AF479480 Spain: Malaga AF479428 Spain: Malaga AF479429 Brazil:RS, Maqiné AF479432 Brazil:RS, Piraquara AF479433 Brazil:RS, Maqiné AF479434 Brazil:RS, Maqiné AF479439 Brazil:RS, Maqiné AF479430 Brazil:RS, Porto Alegre, Jardim BotanicoAF479431 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479435 Brazil:PA, Almirante Tamandaré. AF479436 Brazil:SP, São Paulo City. AF479437 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479481 Brazil:PA, Almirante Tamandaré. AF479482 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479483 Brazil:RS, Bom Jesus AF479484 AF466345 South Africa:Kwa-zulu Natal, Howick AF479427 Brazil:RS, San Francisco de Paula AF479456 Mexico:Veracruz, highway 125. AF479457 Brazil:RS, Maqiné AF479458

AF466314 AF466321 AF466322 AF466323

AF466310 AF466324 AF466325 AF466326 AF466311 AF466315 AF466316 AF466314 AF466341 AF46634 AF466319 AF466320 AF466317 AF466318

AF466343 AF466344 AF466327 AF466328

Cladistic Analysis of the Oedionychines of Southern Brazil ...

123

Table. 1. Continued. Species name

form

Walterianella bucki Walterianella fusconotatta Walterianella interuptovittata Wanderbiltiana concolor Wanderbiltiana nitida or nr

extraction# 305 310 203 140 012

locality

COI-accession# alpha EF1 accession#

Brazil:PA, Piraquara Brazil:SC, Morro do Baú Brazil: RS, Truinfo, Copesul plant. Brazil:PA, Piraquara Brazil:RS, Cangucu, Coxilhia do Fogo.

AF479459 AF466329 AF479460 AF479462 AF466332 AF479461 AF466330

Because we could not amplify and sequence both markers for all taxa at this time, we performed 3 analyses, all equally weighted parsimony and the result of 500-1000 heuristic searches using TBR branch swapping with random addition. These analyses included a combined analysis of a smaller taxon set (n=34), for which both markers are available (see Fig. 2) and two additional for larger taxon sets for which only EF-1a (n=35) (Fig. 3) and Cytochrome Oxidase I were available (n= 63 sequences) (see Fig. 4). All phylogenetic and statistical analyses were performed with PAUP 4.08b (Swofford 2001) except where noted below. Branch support was calculated using bootstrap (Felsenstein 1985) and decay indices (Bremer 1988; Donaghue et al.1994). We used PAUP to calculate bootstrap support and Autodecay 3.0 (Eriksson 1999) combined with PAUP to calculate decay index. Bootstrap values are the result of 500 replicates each composed of 10 heuristic searches. Decay index was calculated using 100 heuristic searches with random addition branch swapping per node. Base frequencies across taxa were calculated and were submitted to a Chi-squared test to evaluate homogeneity among taxa. Taxon Sampling The goal was to analyze both genetic markers for at least two and as many as five, species of each of the major oedionychine genera present in southern Brazil. When congeners could not be obtained from Southern Brazil, taxa from other localities were substituted. The monotypic genera of Pydixaltica, Pleaurasphaera, and Longasphaera were unavailable. This work is regarded as preliminary because not all genera and relatively few species are represented. However, all of the genera present in southern Brazil, which are not monotypic, are represented. We chose 9 species in 8 genera as outgroups based on recent phylogenetic hypotheses as well as the morphological work cited above. These genera are: Blepharida Chevrolat, Hemipxyis Dejean, Disonycha Chevrolat, Hypolampsis Clark, Allochroma Clark and Aedmon Clark. Morphological work has variously supported monophyly of the New World monoplatines and disonychines, as well as the Old World taxa Hyphasis Haroldand Hemipxyis as sister taxa to the oedionychines (Maulik1926, Bechyné 1968; Seeno and Wilcox 1982). Because Clark (1860, 1865) placed the monoplatines as the closest relatives of the oedionychines we included the monoplatine species Aedmon morissoni Clark, Allochroma sp, and Hypolampsis sp. Based on characters of the abdomen, pronotum and unstated ecological characters, Bechyné and Bechyné (1966) asserted that the Disonychina was the sister taxon on the Oedionychina. Although Duckett’s (1999) phylogenetic analysis of the Disonychina does not support this relationship, we included Disonycha conjuncta (Gremar) as an outgroup to test this hypothesis. Hemipyxis is hypothesized to be a very close relative of oedionychines based on morphology and cytogenetics (Seeno and Wilcox 1982, Petitpierre et al. 1988). Moreover, Bechyné

124

Catherine N. Duckett & Karl M. Kjer

Fig. 2. Phylogram of combined data from COI and EF-1a gene fragments, branch length proportional to number of base changes, as estimated by parsimony. All taxa are from Brazil except where noted; Brazilian and U.S. states are indicated given standard abbreviations, e.g. RS= Rio Grande do Sul, PR= Paraná, n and s indicate northern and southern localities within states. Bootstrap support is presented above the branch; decay indices are shown below the branch. “nr’ indicates the node was not recovered in bootstrap analyses. Note the strong support for the Oedionychina node. Taxa with reduced swelling of hind tarsomere indicated by vertical bars. Tree length is 1856, 826 nucleotides.

Cladistic Analysis of the Oedionychines of Southern Brazil ...

125

Fig. 3. Strict consensus phylogram 66 trees of EF1a nucleotide data, branch length represents number of base changes, all trees 752 in length, 444 nucleotides. Locality labels and bootstrap support values arepresented as described for Figure 2. Taxa with reduced swelling of hind tarsomere indicated by vertical bars.

(1968) included Hemipyxis as a oedionychine. This transitional status makes it a particularly suitable outgroup for the Brazilian oedionychines because it is either an outgroup to the Oedionychina as whole or a functional outgroup for the New World taxa. In order to increase the probability of correctly polarizing our characters we also included Blepharida in our analysis, which has been predicted to be a primitive alticine (Heikertinger and Ciski 1940, Seeno and Wilcox 1982).

126

Catherine N. Duckett & Karl M. Kjer

Fig. 4. Strict consensus phylogram 29 trees of COI nucleotide data, branch length represents number of base changes, all trees 1454 steps in length, 424 nucleotides. Locality labels and bootstrap and jackknife support are presented as described for Figure 2.

Cladistic Analysis of the Oedionychines of Southern Brazil ...

127

Because the two most recent phylogenetic hypotheses of relatedness among select flea beetle genera differ regarding the monophyly of the flea beetles (Farrell 1998; Lingafelter and Konstantinov 2000) there is additional motivation for this comprehensive outgroup sampling. Farrell (1998) in an analysis using 18S Ribosomal DNA and Reid’s (1995) morphological data, concluded that the galerucines and the alticines are both monophyletic, in striking contrast to Reid’s conclusion. Conversely, Lingafelter and Konstantinov (2000) hypothesize paraphyly of the Galerucini sensu stricto with respect to the Alticini. This disagreement is profound, and each hypothesis suggests a different potential outgroup for our study. Farrell’s (1998) analysis included the oedionychine, Alagoasa bicolor (Linn.), placing it well within the flea beetles as sister to Hyphasis. However, although Lingafelter and Konstantinov did not analyze an Oedionychine, they found that Disonycha was basal and Allochroma apical in their analysis. A Blepharida species was included by Lingafelter and Konstantinov (2000) and found to be apical; Podontia Dalman is hypothesized to be a close relative of Blepharida by classical taxonomy, and found to be close to Alagoasa by Farrell (1998). Although Allochroma, Disonycha, and Blepharida were included in our study a priori, comparison to these studies is additional motivation for their inclusion. For reasons of accuracy and documentation of molecular variation, most species were resequenced from more than one individual. Different individuals are represented on the cladogram by different numbers or an indication of color-morph and/or locality e.g. Alagoasa plaumanni, white nRG (north Rio Grande do Sul State and Alagoasa plaumanni, spotted sRG, (South Rio Grande do Sul State). Wanderbiltian nitida (Fabr.), and Oedionychus cinctus (Olivier) were re-sequenced from one individual to check the accuracy of the sequence. RESULTS We present 3 analyses; a combined analysis of a smaller taxon set, for which both markers are available (Fig. 2.) and two additional cladograms for larger taxon sets for which only EF-1a (Fig. 3) and Cytochrome Oxidase I were available (Fig. 4). Branch support is given for all nodes where support is calculable, bootstrap support is given above the line and Bremer Decay indices below the line. In the combined data set, there are 868 included characters of which 456 characters are constant; 86 variable characters are parsimony-uninformative (autapomorphies), and 326 characters are parsimonyinformative. We obtained one most parsimonious tree with a length of 1856 steps (see Fig. 2). The EF-1α data alone is presented in Figure 3. Only one taxon, Walterianella fusconotata (Jacoby) was added to the matrix. In this data set, there are 444 characters of which 255 characters are constant and 42 variable characters are parsimony-uninformative (autapomorphies) 127 characters are parsimony-informative. In the analysis of COI data alone a reduced outgroup set was used (only Hemipyxis species)(see Figure 4) because the increased number of taxa creates a computational burden and we were confident of the choice of Hemipyxis as the closest outgroup, from the analyses of the other genes. Moreover, several preliminary analyses had been performed using all or select pairs of outgroup taxa presented in the combined analysis in addition to the two Hemipyxis species (not shown). Analyses using these additional outgroups produced a larger number of most parsimonious cladograms and much longer shortest trees (the shortest tree was 70 steps longer). Significantly, in these analyses Hemipyxis was always resolved as the sister taxon to the oedionychines. Figure 4 is the strict consensus tree of 29 most parsimonious trees with number of base changes shown, 182 characters are constant, 60 variable nucleotides are autapomorphic, and 182 parsimony informative characters are present.

128

Catherine N. Duckett & Karl M. Kjer

Some insect genes have been shown to harbor severe compositional biases, which complicate phylogenetic analyses (Collins et al. 1994). Oedionychine mt DNA exhibits an AT bias (64%). The EF-1α shows a 55% AT base composition. Importantly, base composition appears similar in all lineages, and a chi square test of heterogeneity showed no significant heterogeneity in either of the genes. CONCLUSIONS Combined analysis of COI and Ef1-α markers indicate that the taxa sampled from the Oedionychina constitute a monophyletic group with very strong bootstrap and Bremer support for the monophyly of these taxa (Fig. 2). Additionally, separate analyses of each gene also support the monophyly of the Oedionychina (Figs. 2 and 3) with high levels of support. The COI tree is especially interesting because the Old World taxa Oedionychis Latreille and Physodactyla Chapuis are represented. Physodactyla is apparently an oedionychine, which agrees with Bechyné (1968), and is in contrast to Scherer (1969) and the Seeno and Wilcox (1982) catalog where it is placed as transitional between the Oedionychina and the Monoplatina. Our own morphological analysis (unpublished) also supports Physodactlya as an oedionychine. Moreover, the combined analysis supports the assertion that neither Disonycha conjuncta nor the 3 monoplatine genera sampled are sister taxa to the Oedionychina. All analyses resolved Hemipyxis as the sister group of Oedionychina (of the taxa sampled), including analysis of COI data for all taxa in Figures 2 and 3 (not shown). Interestingly, the 3 monoplatine taxa Aedmon morissoni, Allochroma sp. and Hypolampsis sp are also very strongly supported as a monophyletic group with bootstrap support of 99, in separate and combined analyses of both genes. Beyond the statements above, few taxonomic generalizations can be made. Although the combined analysis resulted in a fully resolved cladogram the support for many of the nodes is weak (Fig. 2). Moreover, because none of the genera included has been revised, recommendations of the taxonomic placement of species not included in this analysis would be imprudent. Although, the phylogenies implied by the analysis of the combined and EF1a data are congruent, many of the relationships implied by the COI data do conflict with the other two hypotheses, e.g. the relationship between Alagoasa bicolor and A. libentina. Although the relationships in the COI tree are not strongly supported, the conflict exists. It is apparent that the “great difficulty” Scherer (1983) cites for morphological study of the genera of the Oedionychina is also present in these molecular characters. Given the caveats above, there are several ideas suggested by the cladograms which are interesting to discuss and will hopefully stimulate further research. One of these is the fact that these trees all fail to support the taxonomic utility of the highly globosely swollen hind apical tarsomere. If it evolved only once, then the monoplatines would group with the Oedionychina. If the highly globose vs. slightly globose were a phylogenetically relevant criterion then the genera Paranaita, Capraita, Wanderbilitiana, Walterianella, Alagoasa and Kuschelina would fall together, and separated from Omophoita, Asphaera and Aspicela which have less globosely swollen apical tarsomeres. We have indicated the taxa with slightly swollen tarsomeres with vertical bars on the right side of the phylograms in Figures 2 and 3. As clearly shown by the discontinuous bars, these analyses do not support the idea that the Omophoita, and Asphaera together are a monophyletic group (see barred groups in Figs. 2 and 3). The strong support for the monophyly of Paranaita is noteworthy and congruent with the morphological cohesiveness of the genus . The only other grouping that is strongly supported in all 3 analyses is the Alagoasa plaumanni-cruxnigra clade, which is also interesting ecologically (see below).

Cladistic Analysis of the Oedionychines of Southern Brazil ...

129

All analyses also strongly suggest the paraphyly of Alagoasa and surprisingly of Capraita. Alagoasa has been informally maligned as a ‘trash basket’ (Swigonova and Duckett 1998) and here we present the first phylogenetic analysis that suggests that the genus, as currently defined, is not monophyletic. However, the multiple placements of Capraita species at more than one place in all 3 analyses is highly suggestive that Capraita should be viewed as a potentially artificial taxon and it is certainly in need of revision. The COI data set that includes 6 species from a wide geographic range (southern Brazil to New Jersey, USA) shows 3 distinct groups of Capraita. Asphaera and Omophoita have also been suggested to be synonymous (Flowers 2001) but here the combined data did not support this hypothesis. Instead, they seem to support 3 grouping of species from this generic grouping. However, because these genera are composed of more than 200 species with distributions throughout the Neotropics we plan further study of these Asphaera and Omophoita including more species from more widely distributed localities. We have included more taxa in the analysis of COI (Fig. 4) for two reasons: to show genetic divergences within and among taxa and to see if COI is useful for associating larvae with adults. In order to document genetic variation and to test whether externally different morphs differ genetically we sequenced up to 4 individuals of some species. As shown (Fig. 4) some taxa are extremely homogeneous within and among localities, for example Omophoita equestris from the same locality in northern Rio Grande do Sul and Paraná States a show very little genetic differentiation. On the other hand, two individuals of Capraita clarissa (Bechyné), (from the same locality, show a surprising amount of variation, (see also Paranaita opima (Germar) from northern and southern Río Grande do Sul State.) Other notably variable taxa include Alagoasa plaumanni, which has 18 published color morphs and is distributed from southern Río Grande do Sul state to Río de Janiero. As shown, COI from the various localities is significantly divergent and these differences have strong support indices. We feel that it could be significant that the spotted morphs from 400 km apart are apparently more closely related to one another than to another morph (white) collected 45 km away. It is also interesting that Alagoasa cruxnigra Jacoby or near is very near A. plaumanni. Alagoasa plaumanni and A. cruxnigra both feed on different species in the genus Eupatorium (Asteraceae)(Duckett, unpublished data). The larvae of A. cruxnigra were originally sequenced to support their association with the adult. Duckett found the adults and larvae feeding on the same plant but was not able to rear adults from the larvae. Because A. nigroscutata was also found abundantly in the same collecting site, although never on the host plant, we sequenced the larvae to test the presumed association. The sequence from the larva was identical to the A. cruxnigra adult sequence and this sequence is 12.6% divergent from that of A. nigroscutata. We also tried to associate abundant yellow larvae with adults found in their vicinity (Duckett and Pedreros unpublished data). These larvae, which appear morphologically identical are found in Paraná and São Paulo states associated with Omophoita personata (Illiger) or near in Paraná and Omophoita sexnotata Harold in São Paulo. Although these larvae can be correctly placed in genus Omophoita, unfortunately we are unable to identify these larvae to species at this time. In summary, the Oedionychina is strongly supported as a monophyletic group based on the genera analyzed including Physodactyla. The monoplatines analyzed form a monophyletic group which is not the sister taxon of the Oedionychina. The closest taxon analyzed to the Oedionychina is Hemipxyis, and the character of apical hind tarsomere-globosely swollen does not appear to be useful as predicted. There is apparently considerable variation within some species for the COI marker fragment used and not in others. COI can be useful for associating larvae with adults, if appropriate caution is exercised- host plant associations of adults and larvae must be noted and sympatric closely related adults also sequenced.

130

Catherine N. Duckett & Karl M. Kjer

ACKNOWLEDGEMENTS We thank David G. Furth and Alexander Konstantinov (at the U. S. National Museum of Natural History), Chris Reid (Australian Museum), Edward G. Riley (Texas A & M University), Shawn Clark and two anonymous reviewers for valuable discussion and/ or comments on the manuscript. We thank Joe Gillespie, Sung Jin Kim, Bradley Lovett and Zuzana Swigonova for help in the lab. We are most grateful to the following individuals for helping to collect or identify specimens used in this paper: Shawn Clark, Wills Flowers, David Furth, Beth Grobbelaar, Ting Hsiao, Luciano Moura, Salvador Mandry, Eduard Petitpierre, Chris Reid, Ed Riley, Atilano Contreras, Roger Blahnik, Joe Gillespie, Doug Tallamy, Jose Henriqe Pedroso, Kunio Suzuki, and Niilo Virkki. We are grateful to Luz Elvia Diaz for the habitus drawing of Paranaita generosa. David Furth and Charles Staines (Smithsonian Institution), Wills Flowers (Florida A & M University), Alexander Konstantinov (Systematic Entomology Lab, USDA), Ed Riley (Texas A. & M. University) kindly helped with consultations of the literature. We also thank Aurora Lauzardo who translated the abstract and Sheila Ward who proofread the manuscript. We are most grateful for financial support to CND in the form of NSF grant DEB 97-07534076, Fondos Institutionales para Investigacion from Univ of Puerto Rico and to NSF grant DEB-9974036 to both of us. We are especially grateful to the following persons who facilitated our obtaining permits or our understanding of the permit process in their respective countries and cheerfully provided us with abundant hospitality: Atilano Contreras (Mexico), Maria Helena Galileo (Fundacão Zoobotanica, Brazil), Beth Grobbelaar (Institute of Plant Protection, South Africa), and Luciano Moura (Fundacão Zoobotanica, Brazil). CND thanks the Gilson Moreira Family of Coxhilia do Fogo, Cangucu in Rio Grande do Sul State, J. H. Pedreros of Universidade Federal do Paraná, Curitiba, and Lenice Medeiros and Artur Muller of Porto Alegre for lodging and/or generous hospitality while collecting. LITERATURE CITED Balsbaugh, J. 1988. Mimicry and the Chrysomelidae. In: Biology of the Chrysomelidae, P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. pp. 261-284. Bechyné, J. 1951. Chrysomeloidea Americains nouveaux ou peu connus (Coleoptera). Bull. Mens. Soc. Linn. Lyon 32(8):325-239. Bechyné, J. 1955a. Troisième note sur les chrysomeloidea neotropicaux des collections de l’institut Royal des sciences naturelles de Belgique (Col. Phytophaga) deuxieme partie. Inst. Roy. Sci. Nat. Belg. 31(19):1-28, 60 figs. Bechyné, J. 1955b. Reise des Herrn G. Frey in Sudamerika: Alticidae (Col. Phytophaga). Ent. Arb. Mus. Frey 6:74-266; 3 plates. Bechyné, J. 1956. Les espèces du genero Wanderbiltiana (Col. Phytoph. Alticidae) Dusenia. 7:329-340. Bechyné, J. 1957. Provisorische Liste der Alticiden von Rio Grande do Sul (Col. Phytoph. Chrysomeloidea). Iheringia Zool. 3:1-52. Bechyné, J. 1958. Notizen zu den neotropischen Chrysomeloidea (Col. Phytophaga). Ent. Arb. Mus. Frey 9(2):478-706, 2 Figs. Bechyné, J. 1959a. Notes sur quelques Oedionychini de Madagascar. Bull. Mens. Soc. Linn. Lyon 28(10):318-323. Bechyné, J. 1959b. Beitrage zur kenntnis der Alticidenfauna Boliviens (Coleopt. Phytophaga). Beitr. Neotrop. Fauna 1(4):269-381. Bechyné, J. 1963. Notes sur quelques Chrysomeloidea neotropicaux nouveaux ou peu connus (Col. Phytophga). Bull. mens. Soc. Linn. Lyon 32(8):325-239.

Cladistic Analysis of the Oedionychines of Southern Brazil ...

131

Bechyné, J. 1964. Notizen zu den Madagasischen Chrysomeloidea (Col. Phytophaga). Mitt. Munch. Entomol. Gesell. 54:68-161. Bechyné, J. 1968. Contribution a la Faune du Congo (Brazzaville). Mission A. Villiers et A. Descarpentries. LXXXI/ Coleopteres, Alticidae. Bull. Inst. Fr. Africa. Noire Ser. A. 30 (4):1687-1728. Bechyné, J. and B. Springlová de Bechyné, 1966. Evidenz der bisher bekannten Phenrica-Arten . (Col. Phytophaga, Alticidae). Ent. Tidskr. 87(3-4):142-170. Bechyné, J. and B. Springlová de Bechyné. 1973. Notas sobre algunos Phytophaga de origen paleantártico (Coleoptera). Rev. Chilena. Entomol. 7:25-30. Bechyné, J. and B. Springlová de Bechyné. 1977. Zur Phylogenesis einiger neotropischen Alticiden (Coleoptera, Phytophaga). Studies Neotropical Fauna and Environment 12(2):81-146. Bechyné, J. and B. Springlová de Bechyné. 1978. Sobre algunos alticidae (Alticinae y Oedionychinae) (Coleoptera:Phytophaga) Rev. Fac. Agron. (Maracay) 26:67-83. Begossi, A. and W. Benson. 1988. Host plants and defense mechanisms in Oedionychina (Alticinae), . pp 5771. In: Biology of the Chrysomelidae, P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Bremer, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795-803. Brower, A.V.Z.1996. Parallel race formation and the evolution of mimicry in Heliconius butterflies: a phylogenetic hypothesis from mitochondrial DNA sequences. Evolution 50:195-221. Chapuis, F. 1875. In: Lacordaire, Histoire naturelle des insectes. Genera des coleopteres. Vol. 11, Famille des Phytophages, 420ppl, pls. 124-134. Paris. Clark, H. 1860. Catalog of Halticidae in the collection of the British Museum, part 1, 301 pp., 10pls. Clark, H. 1865. An Examination of Halticidae of South America. Journ. Ent. 2:375-412. Collins, T.M., P.H. Wimberger, and G. Naylor. 1994. Compositional bias, character-state bias, and characterstate reconstruction using parsimony. Syst. Biol. 43:482-496. Donoghue, M. J., R. G. Olmstead, J. F. Smith, and J. D. Palmer. 1992. Phylogenetic relationships of Dipsacales based on rbcl sequences. Ann. Miss. Bot. Gard. 79:333-345. Duckett, C. N. 1998. Looking for larvae in Brazil. Chrysomela 35:8-9. Duckett, C. N. 1999.A preliminary cladistic analysis of the subtribe Disonychina with special emphasis on the series Paralactica (Chrysomelidae: Galerucinae: Alticini), pp. 105-136. In: Advances in Chrysomelidae Biology. M. L. Cox (Ed.). Backhyus Publishers, Leiden, The Netherlands. Eriksson, T. 1999. Autodecay 4.0. A program distributed by the author. Department of Botany, Stockholm University. Stockholm. Farrell, B. D.1998. “Inordinate Fondness” Explained: Why are there so many beetles? Science 281:555-559. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791. Flowers, R. W. 2001. Seed feeding by a multispecies swarm of flea beetles (Coleoptera: Chrysomelidae: Galerucinae: Alticini). Proc. Ent. Soc. Wash. 103:257-259. Furth, D. G. and V. Savini, 1996. Checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 10(1-4):45-68. Furth, D. G. and V. Savini, 1998. Corrections, clarifications, and additions to the 1996 checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 12(1-2):133-138. Heikertinger, F. and C. Csiki. 1940. Coleopterorum Catalogus, Halticinae, II, 25(169):337-635. Horn, G. H. 1889. A synopsis of the Halticini of boreal America. Trans. Amer. Ent. Soc.16:163-320. Jacoby, M. 1888. Biologia Centrali-Americana. Insecta: Coleoptera, 625 pp. vol vi. part 1. Phytophaga (part) London.

132

Catherine N. Duckett & Karl M. Kjer

Jacoby, M. 1890. Biologia Centrali-Americana. Insecta: Coleoptera. vol vi. part 1. supplement. Phytophaga (part) London, 375 pp., 43 plates. Leng, C. W. 1920. Catalogue of the Coleoptera of America, North of Mexico, 470 pp. Mount Vernon, N.Y. Lingafelter, S. W. and A. S. Konstantinov. 2000. The monophyly and relative rank of alticine and galerucine leaf beetles: A cladistic analysis using adult morphological characters (Coleoptera: Chrysomelidae). Ent. Scand. 30:397-416. Maddison, W. P., and D. R. Maddison. 2000. MacClade: Analysis of Phylogeny and Character Evolution. Version 4.0. Sinauer, Sunderland, MA. Martorell, L. F., 1975. Annotated food plant catalog of the insects of Puerto Rico. Agricultural Experiment Station. University of Puerto Rico. Maulik, S. 1926. The fauna of British India, including Ceylon and Burma. Coleoptera, Chrysomelidae (Chrysomelinae and Halticinae). London. 442 pp. Petitpierre, E., C. Segarra, S. J. Yadav, and N. Virkki. 1988. Chromosome numbers and meioformulae of Chrysomelidae, pp.161-186. In: Biology of the Chrysomelidae. P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Reid, C. A. M., 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea), pp. 559-631. In: J. Pakaluk and S. A. Slipinski (Eds.). Biology, Phylogeny, and Classification of Coleoptera: Papers Celebrating the 80th Birthday of Roy A. Crowson. Muzeum i Instytut Zoologii PAN, Warszawa. Samuelson, G. A. 1985. Description of a new species of Alagoasa (Coleoptera: Chrysomelidae) from Sothern Brazil associated with Lantana (Verbenaceae). Revta. Bras. Ent. 29(3/4):579-585. Scherer, G. 1962. Bestimmungsschluessel der neotropischen Alticinen-genera (Coleoptera:Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 13(2):497-607. Scherer, G. 1969. Beitrag zur Kenntnis de Alticinae Afrikas (Coleoptera: Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 21:298-304, 4 figs. Scherer, G. 1983. Diagnostic Key for the Neotropical Alticine Genera, (Coleoptera: Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 31/32:1-89. Scherer, G. 1988. The origins of the Alticinae, pp. 115-130. In: Biology of the Chrysomelidae. P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Seeno, T.N. and J. A. Wilcox, 1982. Leaf Beetle Genera (Coleoptera: Chrysomelidae). Entomography 1:1-222. Sidow, A. and A. C. Wilson. 1991. Compositional statistics evaluated by computer simulations, pp. 129-146. In: M. M. Miyamoto and J. Cracraft (Eds.). Phylogenetic analysis of DNA sequences. Oxford University Press, Oxford. Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu and P. Flook. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Ent. Soc. Amer. 87:651-701. Swigonova, Z. and C. N. Duckett. 1998. The 1998 Mid-Atlantic states field trip. Chrysomela, 36:7. Swofford, D. L. 2001. PAUP*: Phylogenetic Analysis Using Parsimony, Version 4.08b Computer program distributed by Sinauer. Virkki, N. 1989. On the cytological justification of the flea beetle subtribes Oedionychina and Disonychina (Bechyné and Springlová de Bechyné 1966). Entomography 6:545-550. Virkki, N. and J. A. Santiago-Blay. 1996. Atypical cytology in some neotropical flea beetles (Coleoptera: Chrysomelidae: Alticinae: Oedionychina) from one of the most intense natural radiation sites known, Morro do Ferro (Brazil). Cytobios 85:167-184.

© PENSOFT Publishers Present Status Sofia - Moscow

David G. Furth (ed.) 2003 of a Taxonomic Revision of Afrotropical Monolepta and ... Beetle Biology 133 SpecialRelated Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 133-146

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related Groups (Galerucinae) Thomas Wagner1 1

Universität Koblenz-Landau, Institut für Biologie, Universität sstr. 1, 56070 Koblenz, Germany. Email: [email protected] 12th contribution to the taxonomy, phylogeny and biogeography of afrotropical Galerucinae.

ABSTRACT A taxonomic revision of the Afrotropical “Monoleptites” sensu Wilcox (1973) was started recently. Herein, external and genitalic characters are described and illustrated for major genera whose type species were described from continental Africa, i.e. Monolepta Chevrolat, 1837, Candezea Chapuis, 1879, Barombiella Laboissière, 1931, Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892), Monoleptocrania Laboissière, 1940, and additionally Bonesioides Laboissière, 1925, and the recently described Afromaculepta Hasenkamp and Wagner, 2000. Primary types of 285 species and about 55,000 specimens from all major collections of Afrotropical insects were studied. Characters previously used for generic delimitation, like open prothoracic coxal cavities or relative length of the basi-metatarsus differ significantly in several taxa within genera and are therefore misleading for generic delimitation. Only the genitalic structures of both sexes allow a reliable delimitation and identification of genera. “Monoleptites” and all species-rich genera were found to be polyphyletic and many species need to be transferred to other genera. Additionally, species described in Monolepta and Candezea from Asia, Australia or Central America appear heterogeneous. In particular, species of Central America cannot be considered congeneric to Monolepta and Candezea.

INTRODUCTION Since 1993, canopy dwelling arthropod communities in Central and East African forests have been studied (Wagner 1997, 1999b). Arthropods were predominantly collected by insecticidal canopy fogging, which allows a quantitative sampling, particularly of surface dwelling insects like the Chrysomelidae (Basset et al. 1997). Studying the diversity of arthropods is dependant on species numbers, but the taxonomic status and generic delimitation of many tropical insects is still unsatisfactory, and the only way to get species numbers is to assign the material to morpho-types. This was carried out for beetles, where particularly the Chrysomelidae turned out as one of the most abundant and species-rich beetle groups in the canopies of African forests (Wagner 1999b). Additionally, many taxonomists are generously identifying material of various groups, but for most galerucine taxa, which were amazingly abundant in our samples, there was obviously no

134

Thomas Wagner

specialist. Thus, a taxonomic revision of beetles which were assigned to the Section “Monoleptites“ in the most recent catalogue on the Galerucinae (Wilcox 1973) was started in 1997. In addition to material collected during field studies in Rwanda, Kivu, Uganda and Kenya, specimens and type material from numerous collections were studied (Table 1). Since the first paper of this revision, published four years ago (Wagner 1999a), further material has been investigated and several results were published more recently or are in press (Hasenkamp and Wagner 2000; Stapel and Wagner 2000; Schmitz and Wagner 2001; Freund and Wagner 2002; Middelhauve and Wagner 2001; Wagner 2000a, b, 2001a, b, 2002a, b). Herein, a synopsis of the taxonomic revision is presented. External Table 1. Collections, specimens and numbers of primary types of Afrotropical Monolepta and related groups (“Monoleptites“ sensu Wilcox 1973) studied. collection Musée Royal d’ Afrique Centrale, Tervuren Institut Royal des Sci. Nat. de Belgique, Brussel Natural History Museum, London Museum für Naturkunde, Berlin Musée National d’ Histoire Naturelle, Paris Naturhistoriska Centralmuseet, Helsinki Plant Protection Institute, Pretoria Hungarian Natural History Museum, Budapest National Museum of Kenya, Nairobi Transvaal Museum, Pretoria National Museum of Namibia, Windhoek Zoologisches Institut und Zoolog. Museum, Hamburg Swedish Museum of Natural History, Stockholm Zoologisk Museum, Universitet Kobenhavn Naturhistorisches Museum, Basel Naturhistorisches Museum, Wien Deutsches Entomologisches Institut, Eberswalde Museo Civico di Storia Naturale, Genova South African Museum, Cape Town Naturkundemuseum Erfurt University Museum, Oxford Zoological Institute St. Petersburg Museo Zoologico de “La Specola”, Firenze Zoolog. Forschungsinstitut und Museum Koenig, Bonn Smithsonian Institution, Washington Instituto de Investigacao Científica Tropical, Lisboa Bishop Museum, Honolulu Zoologische Staatssammlung, München The Manchester Museum, Manchester Museum für Tierkunde, Dresden Staatliches Museum für Naturkunde, Stuttgart Forschungsinstitut Senckenberg, Frankfurt Museu du Histórica Natural, Coimbra Museo Civico di Storia Naturale, Trieste Natuurhistorisch Museum, Leiden

specimens

primary types

25000 8500 3900 3600 2800 2000 1800 1300 1100 700 550 470 450 400 400 260 220 250 250 200 170 170 170 150 120 100 100 75 70 50 40 30 20 15 10 55440

39 30 80 58 31 19 9 1 1 7 1 1 4 2 2 285

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

135

and genitalic characters of major galerucine genera with elongated basi-metatarsi are given and illustrated. Described Genera, Species Numbers, History and Material Investigated In the most recent catalogue of the Galerucinae (Wilcox 1973), species which are characterized by an elongated basi-metatarus and lacking any pronotal depressions are assigned to the ‘Monoleptites’. Most species were described between 1890 and 1950 (Wagner 1999a), whilst for the last 35 years no further species have been described from Africa. With very few exceptions, the descriptions by previous authors were based on external characters only. Studies of the genitalic structures, in particular the median lobes, now allow a much better characterization of Monolepta and other taxa. In addition, the phylogenetic delimitation of Monolepta from other, presumably closely related taxa, was inconsistent and required redefinition. In addition to Monolepta, Candezea Chapuis, 1879, Barombiella Laboissière, 1931, Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892), and Monoleptocrania Laboissière, 1940 were described from continental Africa. Furthermore, Bonesioides Laboissière, 1925 which was placed in the “Scelidites“ (Wilcox 1973) needs to be involved in this revision. About one third of the species originally described in those genera need to be transferred to other taxa according to their phylogenetic position, and some new genus-names, like the recently described Afromaculepta Hasenkamp and Wagner, 2000, are necessary. A total of 285 primary types of 306 nominal species of Afrotropical “Monoleptites“ could be located in 35 institutional collections (Table 1). Type material of a few remaining species, most of them described in the 19th century, is not available, and other type material was destroyed by fires such as those of 1944 in Hamburg, and 1978 in Lisbon. About 55,000 dried specimens have been studied up to now in this revision, nearly half of them from the Africa Museum in Tervuren (Table 1). About 70 % of all specimens studied were not identified to species before. Monolepta Chevrolat, 1837 This is the largest genus of the Galerucinae and comprises approximately 600 nominal species (Wilcox 1973). Most of them were described from tropical Africa, Australia and South-East Asia, with a few others from adjacent palaearctic sites and from Central America. Monolepta was originally proposed with 21 species of Galerucinae from Africa and 18 species from tropical Asia and New Guinea. Chevrolat (1849) designated Crioceris bioculata Fabricius, a species described from the Cape of Good Hope, as geno-type (Fig. 1). Erichson (1843) was the first author who adapted the name for a new species, Galeruca (Monolepta) pauperata. The name, derived from “mono” = one and “leptos” = thin, refers to the long first article of the metatarsus which is longer than the other articles together. A character often used for delimitation of Monolepta from other galerucine genera, the prothoracic coxal cavities being open or closed, varies greatly among Monolepta species. Chapuis (1875) and Weise (1923), described Monolepta as a group with closed prothoracic coxal cavities, whilst Weise (1893) previously described this genus as having open prothoracic coxal cavities. They are comparatively widely open in Monolepta bioculata (Wagner 1999a), but among other “true“ Monolepta there are species with closed or widely open coxal cavities. A much better external character for Monolepta is the relative length of the basal antennal articles, where the second and third articles are approximately of same length (Fig. 2), while in most other

136

Thomas Wagner

taxa the third article is significantly longer (Figs. 8, 13, 19, 31). However, several less diverse taxa share this character and only the dissection of the genitalia allows a reliable allocation to Monolepta for both sexes. Species of Monolepta are characterized by an elongated median lobe, which is bilaterally symmetrical, has no incisions at the apex or at the apex of the tectum, and bears symmetrically arranged endophallic armatures, usually with three distinct types of spiculae (Figs. 3, 4). The spermatheca is also of distinct shape (Fig. 5), and there are two pairs of well sclerotized bursal sclerites of different sizes and shapes. Many Afrotropical species originally described in Monolepta are not closely related to the geno-type and need to be transferred to other monophyletic groups. Furthermore, about 30 species described in Monolepta from SE Asia and Australia, and 10 species from Central America were studied recently. Most of these species, including all from Central America, are not congeneric with Monolepta bioculata. About 95% of Afrotropical Monolepta species were described between 1880 and 1950, usually on the basis of a few external characters and coloration only, but coloration patterns have been found to be highly variable in many species. Thus, some species were described several times, and up to nine synonyms for widely distributed species could be found (Fig. 6; Wagner, unpublished data). About 20,000 specimens of Afrotropical Monolepta were examined. The taxonomic revision of Monolepta is not yet complete, and thus the number of species occurring in tropical Africa is not precisely known. Prior to the recent revision, 180 Afrotropical species of Monolepta were described

Figs. 1-5. Characters of Monolepta bioculata (Fabricius); 1: body shape and colour pattern (dot-shaded: red; without signature: yellow); 2: basal antennal articles; 3: aedeagus, median lobe, lateral view, including endophallic armature; 4: aedeagus, same dorsal view; 5: spermatheca. Scale bars for Fig. 1, and Figs. 2-5 (and all following figures) each 1 mm.

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

137

20 18

synonyms

16

described species without synonyms

14 12 10 8 6 4 2

2000

1980

1960

1940

1920

1900

1880

1860

1840

1820

1800

1780

0

Fig. 6. Numbers of Monolepta species described from tropical continental Africa per decade and numbers of synonyms found (only “true“ Monolepta species sensu Monolepta bioculata are included).

Figs. 7-11. Characters of Candezea occipitalis (Reiche); 7: body shape and colour pattern; 8: basal antennal articles; 9: aedeagus, median lobe, lateral view, including endophallic armature; 10: aedeagus, same dorsal view; 11: spermatheca.

138

Thomas Wagner

Figs. 12-17. Characters of Afrocrania latifrons (Weise); 12: body shape; 13: basal antennal articles (male); 14: aedeagus, median lobe, lateral view, including endophallic armature; 15: aedeagus, same dorsal view; 16: aedeagus, same ventral view, without endophallic armature; 17: spermatheca.

(Wagner 1999a; Wilcox 1973). About 40 of these species were found to be synonyms and roughly 90 needed to be transferred to other genera due to their phylogenetic relationships. In addition to the 50 remaining valid species, roughly the same number of species was recently described (e.g. Wagner 2000a, 2000b, 2001a, 2001b, 2002a) or awaits description. Therefore, about 100 species of Monolepta exist in tropical Africa (Figs. 6, 42). Only a few Monolepta species are distributed pan-Afrotropically and known from different biomes. Those which occur in savannas are often more widely distributed, while forest dwelling species are usually more restricted, and a high degree of endemism is found in montane areas. The diversification of Monolepta is obviously strongly effected by geographical speciation in isolated montane forests. Twelve species, e.g. M. umbrobasalis Laboissière, M. wittei Laboissière, and several new species, are endemic to montane forests along the Albertine Rift (Kivu, western Uganda, Rwanda, Burundi). Ten are restricted to east African mountains in Kenya and Tanzania, mainly to Mt. Kenya, Mt. Kilimanjaro and to the Eastern Arc Mountains mosaic. These include M. usambarica Weise, M. deleta Weise, M. miltinoptera Weise, and M. alluaudi Laboissière. Additionally, nine species are restricted to Ethiopia and Eritrea. In the latter area, the degree of endemism is highest, since nine of 16 species, e.g. M. longiuscula Chapuis, M. postrema Chapuis, M. euchroma Fairmaire, M. nigropicta Laboissière, M. gobensis Laboissière, and M. nigrocruciata Laboissère, are only known from Ethiopia and Eritrea. To a lesser extent, montane regions in Cameroon show a high species diversity and some endemism (Wagner 2002b). Many Monolepta species, particularly those with restricted distribution in montane forest areas, are obviously evolutionary young species. The Quarternary extension of the forest biome may have

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

139

been crucial for the present distribution pattern. In the late Pleistocene, the climate, particularly in Central and East Africa, was much cooler and drier (Hamilton 1981, 1989). The upper border for forest vegetation was about 1000 m lower than at present (Bonnefille et al. 1990, Lovett 1993), and most lowland areas, including the Congo Basin, were too dry for forest vegetation and covered by savannas. The proposed forest refugial core areas in Africa coincide well with the highest degree of endemism and highest diversity of Monolepta species in montane areas. Candezea Chapuis, 1879 Candezea was established for “Monoleptites“ with long antennae and tarsi, elongate epipleura and the third antennal article much longer than the second (Fig. 8). Monolepta occipitalis Reiche, a species described from Ethiopia, was designated as geno-type (Fig. 7), and further 45 species from tropical Africa were subsequently described in this genus (Fig. 42). Particularly here, delimitation to other genera was very inconsistent, and e.g. Weise (1892) used Candezea only as a subgenus within Monolepta. Genitalic characters were studied for most African species originally described in this genus, and it turned out that this group is also clearly polyphyletic. Based on external characters, the number of species in Candezea will be reduced to only eight species (Kurtscheid and Wagner, in prep.), while the others need to be transferred to other genera. Candezea are comparatively large Galerucinae with a total length between 5.7 and 8.1 mm. The pronotum and elytra are yellow or pale yellowish brown, the latter with irregular small black spots (Fig. 7) or a reddish apex in some species. The median lobe is slender, round in cross-section, with three similar pairs of strong hooked spiculae (Figs. 9, 10), and males of some species are sexual dimorphic with carinate elytra. The spermatheca is characterized by a long, curved cornu (Fig. 11), and there is only one pair of strongly sclerotized, spiny sclerites on the bursa. Candezea species are distributed in savannas and forests of east, central and southern Africa, but not known from West Africa. Some species, like C. flaveola (Gerstäcker) and C. irregularis (Ritsema), are very abundant. Most of the about 12,000 specimens of Candezea examined belong to these two species. Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892) Weise described a slender, brownish yellow Galerucinae with elongated basi-metatarsi, with males characterized by a cavity on the frons and curved fourth antennal articles, Pseudocrania latifrons Weise, which was the type species of the genus by monotypy (Figs. 12, 13). A few years later another species was described in this group: Pseudocrania nigricornis Weise, a species Weise later synonymized with Monolepta africana Jacoby as Monolepta foveolata Karsch (Weise 1903). Hincks (1949) found Pseudocrania Weise to be a junior homonym of Pseudocrania M’Coy, a fossil group of Brachiopoda, and consequently the name was changed to Afrocrania. In addition to the species described by Weise, two more species in which the males have head cavities were found (Middelhauve and Wagner 2001). However, among the 1000 specimens studied, there are also species in which the males lack a head cavity, which need to be transferred to Afrocrania or described in new genera. These species have a peculiar sexually dimorphic character, complex folded extrusions along the suture at the elytral base in males. Furthermore, there are some species with simple, shallow “hump-backed“ extrusions at the elytral base. Afrocrania are slender Galerucinae, with elongated antennal articles and a uniform pale brownish dorsum. The pronotum is significantly narrowed at the base, while Monolepta and Candezea have a wide pronotal

140

Thomas Wagner

base. The median lobe of Afrocrania is slender, the apical part is usually elongated, and the apex is often slightly enlarged (Figs. 14-16) and has an apically pointed tectum, which is broad in the middle and narrowed at base. The endophyllic armature has two types of endophallic spiculae: one pair of hooked spiculae and one pair, or in a few species, two pairs of slender usually straight spiculae. Spermathecae and (Fig. 17) bursal sclerites of Afrocrania are similar to those of Candezea. Afrocrania is distributed throughout the Afrotropical region, but most species are known from small areas and seem to be restricted to western parts of central Africa (Gabon and Cameroon) and to southern Congo. Monoleptocrania Laboissière, 1940 Next to the above listed species-rich taxa, there are also some phylogenetically isolated taxa which include only single species. One of them was described by Laboissière in 1940, when he transferred Galeruca foveata Olivier, 1807, which was listed in Monolepta by Weise (1924), to his new genus Monoleptocrania. Monoleptocrania foveata can be clearly distinguished from all other Galerucinae with elongated basi-metatarsi by an impression on the vertex, which is shallow and approximately circular in females, but deep and pentagonal in males (cf. Stapel and Wagner 2000; Fig. 18). This was noticed by Olivier (1807) and later also by Thomson (1858) when both authors named the species after this conspicuous character (Galeruca foveata, Galeruca cavifrons Thomson). Thomson‘s choice is not very favourable since it is not the frons (like in males of some Afrocrania species), but the vertex, which bears the cavity. Within our revision of the Afrotropical “Monoleptites“ no further species of this genus could be found (Stapel and Wagner 2000). Body shape, coloration, relative length of the basal antennal articles (Fig. 19), and female genitalic structures (Fig. 23) are most similar to Afrocrania, and both genera are surely closely related. However, morphometric measurements and particularly the male sexually dimorphic characters and genitalia (Figs. 20-22) have many peculiarities and emphasize the generic delimitation. Few specimens are available of this species which is only known from a few locations in the coastal region of west and central Africa from Sierra Leone to northern Namibia. Most specimens have been found in Gabon, and all available specimens were collected before 1910. Afromaculepta Hasenkamp and Wagner, 2000 In the third edition of the Dejean catalogus, Chevrolat (1837) transferred Crioceris bioculata Fabricius, 1781 as geno-type in his new genus Monolepta, along with several new species. One of them was Monolepta frontalis (Fig. 25), which is clearly not closely related to the type species of Monolepta. This species was recently transferred as geno-type to Afromaculepta a long with Monolepta decemmaculata Jacoby, and its four synonyms, with Monolepta octomaculata Jacoby, and with three new species. Afromaculepta are characterized by a small body size, predominantly yellow coloration, small, symmetrically arranged black spots on the elytra (Fig. 24), second and third antennal articles of same length (Fig. 25), and a very different genital pattern as compared to all other groups listed here (Figs. 26-29; Hasenkamp and Wagner 2000). About 1000 specimens, one third of them recently collected in southern Africa, could be studied. The other genera listed above include many species which are distributed in or are even restricted to, wet tropical forests where Afromaculepta species do not occur. This genus has its highest diversity in the South African savanna of Natal and Transvaal, where up to five species occur sympatrically

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

141

Figs. 18-23. Characters of Monoleptocrania foveata (Olivier); 18: body shape; 19: basal antennal articles; 20: aedeagus, median lobe, lateral view, including endophallic armature; 21: aedeagus, same dorsal view; 22: aedeagus, same ventral view, without endophallic armature; 23: spermatheca.

Figs. 24-29. Characters of Afromaculepta frontalis (Chevrolat); 24: body shape and colour pattern; 25: basal antennal articles; 26: aedeagus, median lobe, lateral view, including endophallic armature; 27: aedeagus, same dorsal view; 28: aedeagus, same ventral view, without endophallic armature; 29: spermatheca.

142

Thomas Wagner

(Wagner 2002b). All species appear adapted to dry habitats; A. ursulae Hasenkamp and Wagner and A. namibiae Hasenkamp and Wagner, 2000, in particular occur mainly in dry savannas and deserts in Transvaal, Botswana or Namibia. Only A. decemmaculata (Jacoby) has a much wider distribution and is known from Senegal in the west to Eritrea in the east, as well as throughout eastern Africa to the western Cape Province in South Africa and Namibia on the west coast. However, this widely distributed species does not occur in the Guineo-Congolian rainforest biome. Bonesioides Laboissière, 1925 Laboissière (1925) designated Ootheca coerulea Allard, an entirely metallic blue galerucine with moderately elongated basi-metatarsi, as geno-type (Fig. 30). Examination of the type material revealed that external morphological characters (Fig. 31), as well as genitalic structures (Figs. 32-35), are very similar to many species originally described in Barombiella Laboissière, and most of the metallic-blue or -green species described in this genus need to be transferred to Bonesioides (Fig. 42). About 850 specimens were examined, and these included material of eleven newly described species. A total of 21 species is now known in Bonesioides (Freund and Wagner in press).

Figs. 30-35. Characters of Bonesioides coerulea (Allard); 30: body shape; 31: basal antennal articles; 32: aedeagus, median lobe, lateral view, including endophallic armature; 33: aedeagus, same dorsal view; 34: aedeagus, same ventral view, without endophallic armature; 35: spermatheca.

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

143

Bonesioides shows strong morphological differences from the other genera listed above. Within Bonesioides, the relative length of the basi-metatarus differs remarkably, and, in some species, it is much less elongated. Most Bonesioides are clearly associated with more humid conditions in Africa. The evolutionary origins of this group are presumably located in the central African forest block, and only a few species are probably secondarily adapted to drier conditions of savannas. Barombiella Laboissière, 1931 Originally described as Barombia Jacoby, Laboissière (1931) found this to be a junior homonym to Barombia Karsch (Orthoptera) and substituted the genus name. Most of the metallic coloured species need to be transferred to Bonesioides (see above). Barombiella metallica (Jacoby), the geno-type (Fig. 36) is an abundant species known throughout the Guineo-Congolian forest from Sierra Leone to eastern Congo. It has many peculiarities, like large body size, yellow antennae and legs, slightly elongated third antennal article (Fig. 37), strongly trapezoidal pronotum, broad median lobe without endophallic spiculae (Figs. 38-40), and shape of spermatheca (Fig. 41). Therefore, a separation from all other species mainly decribed by Laboissière in Barombiella is warranted. Some of those species, characterized by slender body shape, dorso-ventrally compressed thorax, and pale yellow elytra, need to be transferred to Galerudolphia Hincks.

Figs. 36-41. Characters of Barombiella metallica (Jacoby); 36: body shape; 37: basal antennal articles; 38: aedeagus, median lobe, lateral view, including endophallic armature; 39: aedeagus, same dorsal view; 40: aedeagus, same ventral view, without endophallic armature; 41: spermatheca.

144

Thomas Wagner

Monolepta 180 described species - 40 synomyns - 90 "non"- Monolepta + ~ 50 new species 1 Ootheca 1 Beiratia

7

~ 100 species

3 2

Bonesioides 3 described species

+ 5 from Barombiella - 9 synomyns + 11 new species = 21 species

~ 120 nom. species

Candezea

Afromaculepta Galerudolphia Barombiella Monoleptocrania

45 described species - 9 synomyns - 29 "non"- Candezea + 1 new species = 8 species

several new taxa names

1

Afrocrania 4 described species - 2 synonym - 2 "non"-Afrocrania + 11 new species = 12 species

Fig. 42. Taxonomic change in species rich genera studied. Only Afrotropical species (excluding Madagascar) are included.

CONCLUSION AND FUTURE OUTLOOK The revision clearly shows that “Monoleptites“, as well as all of its species rich taxa are typological, polyphyletic groups and many species need to be transferred to other genera. Characters previously used for generic delimitation, like open prothoracic coxal cavities or relative length of the basimetatarsus, differ significantly in several taxa and are not useful to characterize monophyletic groups. Only the genitalic structures of both sexes allow a reliable delimitation and identification of such monophyla, i.e. genera. Additionally, species described in Monolepta and Candezea from Asia, Australia or Central America appears heterogeneous, and, in particular species of Central America, cannot be considered congeneric to these taxa. Since the taxonomic revision is nearly finished for several species-rich taxa, the phylogenetic position of these groups can now be addressed. This will include taxa outside tropical Africa, and in addition to external and genitalia characters, molecular characters will be included in a comprehensive approach. ACKNOWLEDGEMENTS Special thanks are due to the students who performed the main work on the revision of the many taxa: Agnes Kurtscheid (Candezea), Jens Middelhauve (Afrocrania), Heidi Stapel (Monoleptocrania), Ruth Hasenkamp (Afromaculepta) and Wolfram Freund (Bonesioides, Barombiella). Thanks are also extended to Bernhard Misof and Eva-Maria Levermann for valuable comments

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

145

on the manuscript. This study was supported by Deutsche Forschungsgemeinschaft (grant no. Schm 1137/2-2 and Wa 1393/3-2). LITERATURE CITED Basset, Y., N. D. Springate, H. P. Aberlencand, and G. Delvare 1997. A review of methods for sampling arthropods in tree canopies, pp. 27-67. In: N. E. Stork, J. Adis and R. K. Didham (Eds.). Canopy arthropods. Chapman and Hall, New York. Bonnefille, R., J. C. Roeland and J. Guiot 1990. Temperature and rainfall estimates for the past 40,000 years in equatorial Africa. Nature 346:347-349. Chapuis, F. 1875. Familie de Phytophages. In: Th. Lacordaire and F. Chapuis (Eds.), Historie naturelle des insects. Genera des Coléoptères, 11: 420. Paris. Chapuis, F. 1879. Phytophages Abyssiniens du musée civique d’histoire naturelle de Gênes. Annali di Museo Civico Storia Naturale Genova 15:5-31. Chevrolat, L. A. A. 1837. Chrysomelidae. In: Dejean (Ed.), Catalogue des coléoptères de la collection de M. le Compte Dejean. 3rd. Edition, revue, corrigee et augmentee, 5: 407. Paris. Chevrolat., L. A. A. 1849. Galérucites. In: D’Orbigny, Ch. (Ed.), Dictionaire universel d’histoire naturelle. Vol. 6:4-6. Paris. Erichson, W. F. 1843. Beitrag zur Insecten-Fauna von Angola. Archiv für Naturgeschichte, 9:199-267. Freund, W. and T. Wagner in press. Revision of Bonesioides Laboissière, 1925 (Coleoptera; Chrysomelidae; Galerucinae) from continental Africa. Journal of Natural History. Hamilton, A. C. 1981. The quaternary history of African forests: its relevance for conservation. Journal of African Ecology 19:1-6. Hamilton, A. C. 1989. African forests, pp. 155-182. In: H. Lieth and M. J. A. Werger, (Eds), Ecosystems of the world 14B: Tropical rainforest ecosystems. Elsevier, Amsterdam. Hasenkamp, R. and T. Wagner 2000. Revision of Afromaculepta gen. n., a monophyletic group of Afrotropical Galerucinae leaf beetles (Coleoptera: Chrysomelidae). Insect Systematics and Evolution 31:3-26. Hincks, W. D. 1949. Some nomenclatorial notes on Chrysomelidae, No. 1, Galerucinae. Annals and Magazine of Natural History 2 (12):607-622. Laboissière, V. 1925. Supplément au Catalogus Coleopterorum, pars 78 (Galerucinae), de J. Weise, pécédé de remarques sur la classification des Galerucini. Encyclopédie Entomologique 1:33-62. Laboissière, V. 1931. Galerucini (Coleoptera Chrysomelidae) d’Angola. Revue Suisse de Zoologie 38:405-418. Laboissière, V. 1940. Observations sur les Galerucinae des collections du Musée Royal d’Histoire Naturelle de Belgique et descriptions de nouveaux genres et especes. Bulletin du Musée Royal d‘Histoire Naturelle de Belgique 16(25) :1-16. Lovett, J. C. 1993. Climatic history and forest distribution in eastern Africa, pp. 23-29. In: J. C. Lovett and S. K. Wasser (Eds), Biogeography and ecology of the rain forest of Eastern Africa. Cambridge University Press. Middelhauve, J. and T. Wagner 2001. Revision of Afrocrania Hincks, 1949 (Coleoptera: Chrysomelidae, Galerucinae). Part I: Species with head cavities and extended elytral extrusions in males. European Journal of Entomology 98:511-531. Olivier, G. A. 1807. Entomologie, ou histoire naturelles des insects. Coléoptères 6:663. Schmitz, J. and T. Wagner 2001. Afromegalepta gen. nov. from tropical Africa (Coleoptera: Chrysomelidae: Galerucinae). Entomologische Zeitschrift 111:283-286. Stapel, H. and T. Wagner 2000. Revision of Monoleptocrania Laboissière, 1940 (Coleoptera, Chrysomelidae, Galerucinae). Mitteilungen des Internationalen Entomologischen Vereins 25: 137-145.

146

Thomas Wagner

Thomson, J. 1857. Voyage du Gabon. Insects. I. ordre Coléoptères. Archives Entomologiques 2:29-239. Wagner, T. 1997. The beetle fauna of different tree species in forests of Rwanda and East-Zaire, pp. 167-181. In: N. E. Stork, J. Adis and R. K. Didham (Eds.), Canopy Arthropods. Chapman and Hall, London. Wagner, T. 1999a. An introduction to the revision of the Afrotropical Monolepta and related taxa (Galerucinae, Chrysomelidae, Coleoptera). Courier Forschungs-Institut Senckenberg 215:215-220. Wagner, T. 1999b. Arboreal chrysomelid community structure and faunal overlap between different types of forests in Central Africa, pp. 247-270. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology 1. Backhuys Publ., Leiden. Wagner, T. 2000a. New Monolepta species (Coleoptera: Chrysomelidae, Galerucinae) from Eastern Africa. Entomologische Zeitschrift 110:34-40. Wagner, T. 2000b. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part I: species with red and black coloured elytra, pronotum and head, with description of new species. Entomologische Zeitschrift 110:226-237. Wagner, T. 2001a. New Monolepta-species (Coleoptera, Chrysomelidae, Galerucinae) from Central and Southern Africa. Entomologische Blätter 96:199-210. Wagner, T. 2001b. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part II: Species with red head, prothorax and elytra. With description of new species. Bonner Zoologische Beiträge 50:49-65. Wagner, T. 2002a. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part III: Species with red elytra and yellow prothorax. With description of new species. Deutsche Entomologische Zeitschrift 49:27-45. Wagner, T. 2002b. Biogeographical and evolutionary aspects of Afrotropical Monolepta, Afromaculepta and Bonesioides (Coleoptera, Chrysomelidae, Galerucinae). Cimbebasia 17: 237-244. Weise, J. 1892. Chrysomeliden und Coccinelliden von der Insel Nias, nebst Bemerkungen über andere, meist südostasiatische Arten. Deutsche Entomologische Zeitschrift 1892:385-400. Weise, J. 1893. Chrysomelidae. In: W. F. Erichson, et al.(Eds.). Naturgeschichte der Insecten Deutschlands. 6:569-768, Berlin. Weise, J. 1923. Uebersicht der Galerucinen.Wiener Entomologische Zeitung 40:124. Weise, J. 1924. Chrysomelidae: Galerucinae. In: Junk, W. (Ed.), Coleopterorum Catalogus. 78:1-225, Junk, ‘sGravenhage. Wilcox, J. A. 1973. Chrysomelidae: Galerucinae: Luperini: Luperina. In: Junk, W. (Ed), Coleopterorum Catalogus. Suppl. 78(3):433-664, Junk, ‘s-Gravenhage.

David G. Furth (ed.) 2003 © PENSOFT Publishers Interspecific Differentiation in Eggs and First Instar Larvae in The Genus ... Beetle Biology 147 SpecialProcalus Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 147-153

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus Clark 1865 (Chrysomelidae: Alticinae) Viviane Jerez1 1

Departamento de Zoología, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción. Casilla 160 - C, Concepción, Chile. Email: [email protected]

ABSTRACT The structure and ornamentation of chorion, micropyle, head, eggs bursters and other features in eggs and first instar larvae of six Procalus species are described. Pairs of P. mutans , P. reduplicatus, P. silvai, P. viridis , P. artigasi and P. ortizi , were collected in the field and maintained in plastic cages in order to obtain the eggs and larva. For each species, the structure of chorion, micropyle, head, labrum, mandibles, labium, tarsungulus and egg bursters were examined and described. Chorion ultrastructure and egg bursters were studied with scanning electron microscopy. The results of this study demonstrate that the eggs of Procalus have an exochorion sculptured into polygonal cells; the micropyle is rounded, slightly invaginated with interspecific differences in the number and diameter of aeropyles. Also, differences in the mandible teeth, anterior margin of labrum and tarsungulus are observed. Finally, the egg bursters and chaetotaxy, shows interspecific differences in relation to the position, form and length of the hatching spine and setae.

RESUMEN Se analizó y describió la estructura y ornamentación del corion, micropila, cabeza, ruptor ovi y otras estructuras de los huevos y del primer estadio larvario en seis especies del género Procalus. Para ello, parejas de P. mutans , P. reduplicatus, P. silvai , P. viridis , P. artigasi and P. ortizi , fueron recolectadas en terreno y mantenidas en cajas de crianza para obtener huevos y larvas. Para cada especie, se describió la estructura del corion, micropila, cabeza, labro, mandíbulas, labio, tarsungulus y ruptor ovi mediante microscopía óptica y electrónica de barrido. Los resultados de este estudio muestran que los huevos de Procalus tienen un exocorion esculpido en células poligonales; la micropila es redondeada, débilmente invaginada y con diferencias interespecíficas en el número y diámetro de las aeropilas. También existen diferencias en los dientes mandibulares, margen anterior del labro y tarsungulus. Finalmente en relación a los “ruptor ovi” se encontró diferencias interespecíficas en relación a la posición, forma y largo de la espina de eclosión y del número de setas.

148

Viviane Jerez

INTRODUCTION In insects and especially Coleoptera, the chorionic microsculpture contains important diagnostic characters at the family and generic level. Nevertheless, current systematics studies have not considered the diagnostic value of the egg chorion and micropyle to separate closely related species (Rowley and Peters, 1972; Jerez, 1999a). Otherwise, morphological characters of larvae, might reveal congruence and incongruity into the classification systems proposed for the adults insects that can not to be separated using only imaginal characters (Jerez, 1995, 1996; Reid, 2000). Procalus Clark, 1865 is a genus of flea beetles that comprises nine species, widespread in the Mediterranean Zone of Chile. Lithrea and Schinus species are the host plants and both genera are of the family Anacardiaceae (Jerez, 1999b). A description on the habitat and morphology of eggs and larval stage of genus Procalus, and a complete revision of genus was done by Jerez, 1999 a and b. The egg of Procalus species show a polygonal patterns on the eggshell, that change in the micropilar area. Three larval instars are recognized and clearly distinguished by the width of head capsules and morphological patterns (Jerez, 1999b). My observations in the genus Procalus, have demonstrated interspecific differences exist in the eggshell and in the larval morphology; furthermore there are differences in the chaetotaxy of the eggs bursters. The aim of this paper is to compare the chorionic microsculpture and mycropyle of the eggs and the first instar larvae in all six species of Procalus: P. mutans (Blanchard, 1851), P. viridis (Phil. and Phil., 1864), P. reduplicatus Bechyné, 1951, P. silvai Jerez, 1999a, P. artigasi Jerez, 1999a and P. ortizi Jerez 1999a. MATERIALS AND METHODS To obtain the eggs and first instar larvae, pairs of adults of each species were collected in field and maintained in rearing boxes and provided with food plants. The eggs and larvae were fixed in 70º alcohol. The eggs were dehydrated in pure alcohol, coated with gold, and the chorion ultrastructure was studied with a scanning electron microscope (SEM). The larvae were prepared for observation under optical and SEM following the method described by Jerez (1999). The labrum, mandibles, egg bursters and legs were dissected and illustrated with the aid of a camera lucida adapted to an Olympus microscope. RESULTS Egg Description The eggs of Procalus species are oval in shape, tapering at both ends. The eggshell or chorion is reticulated and displays a layer of polygonal (pentagonal - hexagonal) cells. The polygonal cells are distributed throughout all over the surface of chorion, as seen using SEM except in the micropilar area (Fig. 1). Some species have small pores, uniformly distributed (Fig. 2). The micropyle is located at the anterior end of the egg and can be recognized by its circular and slightly depressed form; a pore is located in the middle. The inner space of the micropyle appears usually smooth or finely reticulated and aeropyles are open and regularly distributed. The aeropyles vary in number and diameter in the species (Fig. 3). The chorion of P. mutans and P. reduplicatus is characterized by the presence of small interpolygonal pores lacking in the remaining species. Eggs of P. mutans, P. viridis, P. silvai, P. artigasi and P. ortizi are

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus ...

149

Figs. 1-4. Chorion ultrastructure of Procalus eggs. 1. P. ortizi, m: micropyle. 2. P. ortizi, p: pore. 3. P. reduplicatus, ae: aeropyle, pm: micropylar pore. 4. P. silvai, ae: aeropyles, p: pore.

pierced with a few aeropyles around the micropilar area (Fig. 4) and only P. reduplicatus has a lot of aeropyles. The inner space of micropyle is smooth in P. mutans, P. viridis, P. reduplicatus and P. artigasi (Fig. 5) while it is finely reticulated in P. silvai and P. ortizi (Fig. 4). First Instar Larva Diagnosis: The first instar larva is recognized by the curved body, head and prothoracic shield strongly sclerotized and eggs bursters situated on a pair of mesothoracic dorsal sclerites (Jerez, 1999a). Description: Head hypognathous, rounded and strongly sclerotized; epicranium smooth, bearing setae; epicranial suture Y-form; frontal sutures elongate, strongly divergent and slightly curved; frontoclypeal suture obvious; frontal region dorsally depressed. Clypeus rectangular not fused with the labrum. Labrum subcircular and medially emarginate. Antenna two segmented; segment 1 with rigid setae; segment

150

Viviane Jerez

Figs. 5-8. 5. P. viridis, micropilar area, ae: aeropyles; m: micropyle; p: pore. 6. Head capsule of the first instar larva of P. silvai, a: antennae; c: clypeus; fr: frons; la: labrum, m: mandibles; o: ocellus. 7. Chaetotaxy of eggs bursters of P. reduplicatus larvae. ls: long setae; bsp: bursting spine; ss: small setae. 8. Chaetotaxy of the egg bursters of P. mutans larvae. bsp: bursting spine ss: small setae.

2 very small. One stemmata lateral and dorso-lateral to the antennae. Mandibles palmate bearing five apical teeth. Maxillary palpi three segmented; labial palpi two segmented. Thorax rounded laterally, with surface glabrous; prothoracic shield strongly sclerotized, formed by two transverse mid-dorsal plates bearing microsetae. Ecdysial suture well developed. Egg bursters situated dorsolaterally and posterior to mesothoracic spiracle bearing three or four setae (Fig. 7). Mesothoracic spiracle annular and uniforous. Legs short and stout, five segmented, including tarsungulus. Abdomen with eight segments, curved form and rounded in cross section. Cuticle smooth, bearing microsetae. IX segment rounded on the apex, bearing rigid setae. X segment serves as an anal pseudopod. Anal opening vertical. Ambulatory lobes occur ventrally in all abdominal segments. Spiracles annular and uniforous with peritreme obvious. The first instar larvae of the six Procalus species exhibit all the morphological features described in this study. However, there are differences in the mandibular teeth, anterior margin of labrum,

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus ...

151

form at tarsungulus and number of egg burster setae. Thus, the second mandibular teeth can be quadrangular in P. mutans and P. ortizi, (Figs. 15, 20) or pointed in P. viridis, P. reduplicatus, P. silvai and P. artigasi (Figs. 16, 17, 18, 19). In some species the labrum is sinuate (P. mutans and P. ortizi), (Figs. 9, 14); in others he can be emarginate ( P. viridis, P. reduplicatus, P. silvai and P. artigasi) (Figs. 10, 11, 12, 13). The tarsungulus can be incurved (Fig. 23, 24) or perpendicular to the central axis (Fig. 22, 25). Finally, the egg bursters setae vary in the species. There are three in P. viridis, P. reduplicatus and P. artigasi (Fig. 7) and four in P. mutans, P. silvai and P. ortizi. (Fig. 8). DISCUSSION In Chrysomelidae, the form and chaetotaxy of labrum of the adult and larval stage, are in general important diagnostic characters for all subfamilies (Steinhausen, 1994); however, in the Procalus species analyzed, the labrum form reveals an important diagnostic character at the specific level. The presence of the egg bursters in larvae of first instar, has been useful to separate Alticinae from Galerucinae, because they are lacking in the latter subfamily (Cox, 1994). Thus, this character in Procalus species justifies the inclusion of genus in Alticinae. Furthermore, the analysis of the eggshell,

Figs. 9-14. Labrum of the first instar larvae of the Procalus species. 9. P. mutans. ma: anterior margin; sd: dorsal setae; sl: lateral setae; sm: marginal setae; sbm: submarginal setae. 10 .P. viridis. 11. P. reduplicatus. 12. P. silvai. 13. P. artigasi. 14. P. ortizi .

152

Viviane Jerez

Figs. 15-20. Mandibles of the first instar larvae of the Procalus species. 15. Teeth of P. mutans. 16. P. viridis. 17. P. reduplicatus. 18. P. silvai. 19. P. artigasi. 20. P. ortizi.

Figs. 21-26. Tarsungulus of the first instar larvae of the Procalus species. 21. P. mutans, sm: medial setae; h: hook. 22. P. viridis. 23. P. reduplicatus. 24. P. silvai. 25. P. artigasi. 26. P. ortizi.

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus ...

153

micropyle, labrum, mandibles, tarsungulus and egg bursters demonstrate the usefulness of these structures as taxonomic and phylogenetic markers. ACKNOWLEDGEMENTS The author is grateful to David Furth for his encouragement and for correcting and revising the manuscript. This research was supported by FONDECYT 1940995 and Grant DIUC 200.113.055 - 1.0. Finally, I am very grateful to the members of the Electronic Microscopy Laboratory of the University of Concepción. LITERATURE CITED Cox, M. L. 1994. Egg bursters in the Chrysomelidae, with a review of their occurrence in the Chrysomeloidea (Coleoptera), pp. 75-110. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers. 582 pp. Jerez, V. 1995. Stenomela pallida Erichson, 1847. Redescripción, ontogenia y afinidad con el género Hornius (Chrysomelidae - Eumolpinae). Gayana Zool. 59(1):1-12. Jerez, V. 1996. Biology and phylogenetic remarks of the subantarctic genera Hornius, Stenomela, and Dictyneis (Chrysomelidae - Eumolpinae), 3:239-258. In: P. Jolivet, and M. L.Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishing. 365 pp. Jerez, V. 1999a . Filogenia y Biogeografía del Género Procalus Clark, 1865, (Coleoptera - Chrysomelidae) y su relación con Anacardiaceae. Tesis Doctoral. Universidad de Concepción. 300 pp. Jerez, V. 1999b. Biology and ecology of the genus Procalus Clark, 1865, endemic to the andinopatagonian region (Alticinae), pp. 545 - 555. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publishers, Leiden, The Netherlands, 671 pp. Jerez, V. 2000. Microescultura coriónica en huevos de Lysathia atrocyanea (Phil. and Phil.) (Coleoptera: Chrysomelidae). Rev. Chilena Ent. 27:75 - 78. Nordell - Paavola, A.; S. Nokkala; S. Koponen and C. Nokkala 1999. The utilization of chorion ultrastructure and chorion polypeptide analysis in recognizing taxonomic units in north european Galerucini (Col. Chrysomelidae), pp. 95 - 104. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publishers, Leiden, The Netherlands, 671 pp. Reid, C. A. M. 2000. Spilopyrinae Chapuis: a new subfamily in the Chrysomelidae and its systematic position placement (Coleoptera). Invertebrate Taxonomy 14:837-862. Rowley, W. A. and D.C. Peters. 1972. Scanning Electron Microscopy of the eggshell of four species of Diabrotica (Coleoptera: Chrysomelidae). Ann. Ent. Soc.Amer. 65(5):1188-1191. Steinhausen, W. 1994. Larvae of palearctic Timarcha Latreille, 1:119-125. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers. 582 pp.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

© PENSOFT Publishers Feeding Behavior of Sofia - Moscow

David G. Furth (ed.) 2003 Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ... Beetle Biology 155 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 155-159

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima sericea (Malpighiaceae) Vivian Flinte1, Margarete V. Macedo1, Ricardo C. Vieira2, and Jay B. Karren3 1

Laboratório de Ecologia de Insetos, Depto. de Ecologia, CP 68020, IB, UFRJ, Rio de Janeiro, Brasil. Email: [email protected] 2 Laboratório de Anatomia Fisiológica, Depto. de Botânica, IB, UFRJ, Rio de Janeiro, Brasil 3 Dept. of Biology, Utah State University Extension, Utah, USA

ABSTRACT Adults and larvae of Fulcidax monstrosa feed on Byrsonima sericea, chewing its stems. The histological analysis of attacked stems shows that F. monstrosa feeds on the upper layers of tissue with a rasping action, consuming the following tissues from the outside to the inside: periderm, cortical parenchyma and phloem, stopping exactly at the outer layer of the xylem. Often the stem is chewed along its whole circumference, and since the phloem is the vascular tissue which transports organic substances to the entire plant, its removal leads to death and drying up of the attacked stems. The larvae are responsible for most of the damage on the host plant, since they are more numerous and are restricted to a relatively few young stems.

RESUMO Adultos e larvas de Fulcidax monstrosa se alimentam de Byrsonima sericea, raspando seus ramos. A análise histológica de ramos jovens e de ramos mais velhos mostra que F. monstrosa raspa as camadas superiores de tecido, consumindo, de fora para dentro, os seguintes tecidos: periderme, parênquima cortical e floema, parando exatamente na fronteira do xilema. Freqüentemente, o ramo é raspado em toda a sua circunferência e, como o floema é o tecido vascular que trasporta as substâncias orgânicas para toda a planta, a sua remoção causa a morte e o ressecamento dos ramos atacados. As larvas são responsáveis pelo maior dano à planta, já que são mais numerosas e ficam restritas aos ramos. INTRODUCTION Chlamisinae includes small, robust and cylindrical beetles, which have the head hidden under the prothorax almost to the eyes. When disturbed, they retract their legs into grooves on the underside of the body and fall to ground, remaining motionless (Borror and DeLong, 1969). Many of them exhibit metallic brilliant colors and protuberances on the surface of the body. The larvae are enclosed

156

Vivian Flinte, Margarete V. Macedo, Ricardo C. Vieira & Jay B. Karren

in a case made of their own excrement and move about with this case, which serves as a shelter. Because the case is smaller than the body, the abdomen is folded in a U-shape inside the case. Pupation takes place in this fecal case. Fulcidax monstrosa was first described from Cajennae (Guyana) by Fabricius (1798) as Clythra monstrosa, who referenced Olivier’s Clythra monstrosa. It appears that Olivier’s name was not applied to a properly described specimen, so the original description is attributed to Fabricius. Later, it was cited with different names by several authors: Chlamys monstrosa Olivier (1808), Fulcidax azureus Voet (1806), Poropleura monstrosa Lacordaire (1848) and finally Fulcidax monstrosa Blackwelder (1946), with distribution in Brazil and Guyana. F. monstrosa is one of the largest species in the subfamily, dark blue colored, brilliant on the top and dull on the venter, with a strong elevation on the pronotum and many irregular excavations in four series on the elytra (Costa Lima, 1955). The female lays single eggs on young stems of its host plant Byrsonima sericea, then covers it with her excrement. When the larva hatches it uses the fecal covered eggshell as its first shelter. As it begins to feed, it adds more excrement layers to accommodate its growth and development (Erber, 1988; Olmstead, 1994). There is evidence (Wallace, 1970) that the excrement case of one species of Chlamisus helps protect its larvae from attacks by ants. Byrsonima sericea DC. is a member of the family Malpighiaceae and can occur in the form of a bush or a tree in the restinga (coastal sand dunes). The leaves are green on the adaxial surface and golden and pilose on the abaxial surface. The older stems exhibit a gray coloration while the young ones are green. The geographic distribution of B. sericea is restricted to Martinique and, in Brazil, to the states of Ceará, Piauí, Pernambuco, Sergipe, Bahia, Goiás, Espírito Santo, Minas Gerais, Rio de Janeiro and Paraná (Pereira, 1953). Field observations showed that adults and larvae of F. monstrosa feed on B. sericea and plants on which larvae were found had a considerable number of dried up stems. Our study describes the feeding behavior of F. monstrosa and the effect of this type of feeding on the host plant B. sericea. MATERIAL AND METHODS The behavioral field observations of F. monstrosa were made in Macaé (22o 19’S and 41o 44’W) at the National Park of Jurubatiba Restinga, RJ, Brazil, in an area where the host plant B. sericea is abundant. The restinga is an environment of coastal sand dunes and contains an enormous diversity of habitats e.g. bush restinga, paludous restinga, forests, swamps, rivers, lagoons and others. The ecological importance of the littoral area included between the municipal districts of Macaé and Quissamã was already recognized in 1992 by UNESCO, who considered this area as a “reserve of the biosphere”. Histological analysis of non-attacked stems on advanced secondary growth (older ones) and of attacked and non-attacked stems on initial secondary growth (younger ones) was made to evaluate the damage caused by F. monstrosa on its host plant. The stems were collected soon after being fed upon by F. monstrosa and fixed in alcohol 70GL. Cross sections 20mm thick were cut from samples of non-attacked older stems using a sliding microtome. Samples of the younger attacked and non-attacked stems were free hand cross cut. The sections of both samples were stained with the Safrablau technique (Bukatsch, 1972). To verify the presence of starch in the stem tissues, a drop of IKI (Iodine- Potassium Iodide) was placed onto the free-hand sections for more than five minutes (Ruzin, 1999).

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ...

157

RESULTS AND DISCUSSION Besides B. sericea, there are at least four other species of Malpighiaceae at the National Park of Jurubatiba Restinga, but F. monstrosa was only found feeding on B. sericea. The same happened at the Restinga of Jacarepiá, RJ, where F. monstrosa only occurred on the same host plant. While F. monstrosa seems to be monophagous in these areas, there are records of other species of the genus feeding on more than one Malpighiaceae species (Jolivet and Hawkeswood, 1995). F. monstrosa females lay their single eggs on young stems of B. sericea (Fig. 1A). Larvae hatch from the round excrement case wherein the egg was located and starts feeding upon the stems. Often the whole circumference of the stem is chewed by the larva (Fig. 1B), causing the death of the attacked stem from its damaged point to the top. Upon completion of its development the larva closes the case and pupates within it (Fig. 1C). The anatomical cross section of older stems shows the following tissues: periderm; cortical parenchyma with sclereids, fiber bundles and crystalliferous idioblasts with prismatic crystals; phloem; well-developed xylem and medullar parenchyma (Fig. 2A). In contrast, the younger stem has a smaller medulla, a less developed xylem ring and a fiber ring that surrounds the phloem (Fig. 2B); in

Figure 1. (A) Female of Fulcidax monstrosa ovopositing on a stem of Byrsonima sericea. Scale: 20mm; (B) Stem of B. sericea chewed in its whole circumference. Scale: 3mm; (C) Pupa of F. monstrosa. Scale: 5mm.

Figure 2. Cross sections of an older stem (A) and of a younger stem (B) of Byrsonima sericea. (A) The older stem has fiber bundles dispersed in the cortical parenchyma and presents a thicker xylem. Scale: 300µm; (B) The chewing of Fulcidax monstrosa stops exactly at the outer layer of the xylem. Scale: 150µm. P = periderm; C = cortical parenchyma; F = fiber ring; Ph = phloem; X = xylem; M = medulla; FB = fiber bundles.

158

Vivian Flinte, Margarete V. Macedo, Ricardo C. Vieira & Jay B. Karren

Figure 3. Dried up stems of Byrsonima sericea which have been chewed by Fulcidax monstrosa larvae.

addition, trichomes can be found on the epidermis. The anatomical section of an attacked stem (Fig. 2B), clearly shows that the beetle chews, from the outside to the inside, the following tissues: periderm, cortical parenchyma, fiber ring and phloem, stopping exactly at the outer edge of the xylem. The phloem is probably the most nutritional valuable tissue for F. monstrosa, since it is the vascular tissue responsible for the transport of organic substances such as sugars and hormones. The IKI test proved that starch is not used for the nutrition of F. monstrosa because it only occurs in the medullar parenchyma. With the removal of the phloematic tissue, the transport of organic substances is interrupted, compromising the survival and development of the young stems, leading to their death and desiccation. Field and laboratory observations showed that both larvae and adults of F. monstrosa feed preferably on young stems, probably because of the less lignified cortex. A significant number of dried up stems, which show signs of the characteristic feeding of F. monstrosa can be found on one single plant, showing that the damage to the host plant is not restricted to the loss of the consumed tissues (Fig. 3). The anatomical sections also reveal that adults and larvae chew the same plant tissues. The larvae are responsible for most of the damage on the host plant, since they are less mobile, are not capable of flying, and are more numerous. Consequently, each larva is restricted to a few stems of the plant and tends to chew until completely girdling the stem. Adults, however, are often feeding on several different stems, not strongly damaging each one. ACKNOWLEDGMENTS Financial support came from CNPq/PELD and FAPERJ. Vivian Flinte has a scholarship from CNPq/PIBIC.

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ...

159

LITERATURE CITED Blackwelder, R. E. 1946 Checklist of the Coleopterous insects of Mexico, Central America, the West Indies and South America. Part 4. Bull. U. S. Nat. Mus. 185:551-763. Borror, D. J. and DeLong, D. M. 1969. Introdução ao Estudo dos Insetos. pp. 260-262. Editora Edgard Blücher Ltda. São Paulo. 653pp. Bukatsch, F. 1972. Bemerkung zur Doppelfarbung Astrablau-Safranin. Mikrokosmos 61(8):225. Costa-Lima, A. 1955. Insetos do Brasil. 9o Tomo. Coleópteros. 3a Parte. Escola Nacional de Agronomia, 289pp. Erber, D. 1988. Biology of Camptosomata. Clytrinae-Cryptocephalinae-Chlamisinae-Lamprosomatinae [pp. 513-552]. In: P. H. Jolivet, E. Petitpierre, T. H. and Hiaso (eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. 640pp. Fabricius, J. C. 1798. Supplementum Entomologiae Systematicae Hafniae. 572pp. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the world. An Essay about the Relationships between the Leaf-beetles and their Food-plants. Backhuys Publishers Leiden. 281pp. Lacordaire, J. T. 1848. Monographie des Coléoptères Subpentamères de la Famille des Phytophages, Vol. 2. Mém. Soc. Roy. Sci. Liège. Vol 5. 890pp. Olivier, A. G. 1808. Entomologie ou histoire naturelle des insectes, avec leurs caractères générique et spécifiques, leur description, leur synonymie, et leur figure enlumineé. Coléoptères vol. 6. Paris. Olmstead, K. L. 1994. Waste products as chrysomelid defenses [pp. 311-318]. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, The Netherlands. xxiii + 582pp. Pereira, E. 1953. Contribuição ao conhecimento da Família Malpighiaceae. Arquivo do Serviço Florestal, RJ. Ministério da Agricultura, Vol. 7. 70pp. Ruzin, S. E. 1999. Plant Microtechnique and Microscopy. New York. Oxford University Press. 322pp. Voet, J. E. 1806. Catalogus Systematicus Coleopteroum. Vol. 2. La Haye. Wallace, J. B. 1970. The defensive function of a case on a chrysomelid larva. J. Georgia Ent. Soc. 5:19-24.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

© PENSOFT Publishers Natural Enemies Sofia - Moscow

David G. Furth (ed.) 2003 of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ... Beetle Biology 161 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 161-173

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and Their Phenology Flávia Nogueira-de-Sá1,2 and João Vasconcellos-Neto1 1 Universidade Estadual de Campinas, Institute of Biology, Department of Zoology. Campinas, SP, Brazil, 13083-970. 2 Graduate Program in Ecology, Universidade Estadual de Campinas, SP, Brazil. Email: [email protected]

ABSTRACT Three species of Cassidinae, Stolas chalybea, Stolas areolata and Anacassis phaeopoda (Tribe Stolaini), were investigated to better understand their interactions with natural enemies in a tropical forest. The majority of parasitoids reared from these species were Hymenoptera, but some dipterous parasites were also observed on larvae of the three species. The only parasite reared from adults was a nematode. Some heteropterans and arachnids preyed on adults and larvae. A one-year census of invertebrates on host plants of targeted Cassidinae revealed that the abundance of potential predators fluctuated synchronously with the abundance of the beetles, sometimes with a small lag. This suggests that populations of invertebrate predators may have an influence on the regulation of Cassidinae populations. Our results support the well-accepted hypothesis that natural enemies do control herbivore populations.

RESUMO Três espécies de Cassidinae, Stolas chalybea, Stolas areolata e Anacassis phaeopoda (Tribo Stolaini), foram investigadas em uma floresta tropical para melhor se entender suas interações com inimigos naturais. A maioria dos organismos parasitas obtidos destes cassidíneos foram Hymenoptera, mas nós também observamos Diptera em larvas das três espécies. O único parasita observado em adultos foi um nematódeo. Alguns heterópteros e aracnídeos foram observados predando adultos e larvas. Um ano de censo de invertebrados nas plantas hospedeiras dos Cassidinae estudados revelou que a abundância de predadores potenciais flutuou sincrônicamente com a abundância dos besouros, algumas vezes com um atraso. Isto sugere que as populações de predadores invertebrados podem influenciar a regulação das populações de Cassidinae. Nossos resultados apoiam a hipótese de que inimigos naturais controlam populações de herbívoros. INTRODUCTION The importance of natural enemies in controlling herbivore populations was emphasized in the 1960 “landmark” paper by Hairston, Smith and Slobodkin. According to these authors, populations of herbivores are unlikely to be limited by food supply or by fluctuations in climate. Recent work upholds

Flávia Nogueira-de-Sá & João Vasconcellos Neto

162

the importance of predators and parasitoids in the suppression of many phytophagous insect populations (Oksanen and Ericson, 1987; Denno et al., 1990; Hawkins et al., 1997; Keese, 1997; Cornell et al., 1998). Cox (1996) further points out that predators and parasitoids are not mutually exclusive; other authors contend that predation and parasitism are inversely related (see Keese, 1997; Monteiro, 1981 for examples). Losses suffered by parasitoid populations due to predation of their hosts may depend on the degree to which the risks of predation and parasitism covary (Memmott et al., 1993). Due to the large impact predators and parasitoids exert on populations of phytophagous insects, including chrysomelids, many programs for biological control have been successful (Cox, 1996). Natural enemies have imposed a selective pressure on Cassidinae. Therefore, they influenced diverse physical, behavioral and possibly chemical adaptations for defense. Despite these attributes, Table 1. List of taxonomic groups of natural enemies of Chrysomelidae at egg, larval, pupal and adult stages of development and their respective effects on their prey/hosts. Taxa of natural enemy

Stage of development of the beetle - Effect Protozoa (Microsporidia and Eggs, larvae and pupae – Intracellular Gregarines) parasite, extremely pathogenic Ants (Formicidae) Egg – Predator Hymenopterans (e.g. Egg – Parasitoid, heavily impact Eulophidae and Tetracampidae) populations. Bacteria (Bacillus) Larvae - Parasite Nematodes (Mermithidae) Larvae and adults - Parasite, kill hosts. Virus Larvae and adults – Intracellular parasite, causes pathological damage or significant mortality. Hymenopterans (e.g. Larvae – Parasitoid Ichneumonidae and Pteromalidae) Diptera:(Tarchinidae) Tachinidae Larvae – Parasitoid

Hymenopterans (Mutilidae and Eumenidae) Spiders (Theridiidae and Thomisidae) Hetropterans (Pentatomidae and Reduviidae)

Larvae – Predator

Beetles (Carabidae) Hymenopterans (Chalcididae and Pteromalidae) Fungi (Laboulbeliales) Flies (Tachinidae)

Larvae - Predator Pupae – Parasitoid

Birds

Adults - Predator

Larvae - Predator Larvae - Predator

Adults - Parasite, low damage Adults – Parasitoid

Example of reference Toguebaye et al., 1988; Theodoridès, 1988 Windsor, 1987; Olmstead, 1996 Cox, 1994; Olmstead, 1996 Peterson and Schalk, 1994. Poinar, 1988 Selman, 1988 Cox, 1994 Olmstead, 1996; Logan et al., 1987; Cappaert et al., 1991a; Charlet, 1992; Heineck-Leonel and Salles, 1997; Keese, 1997. Cox, 1994 Kosior, 1975 (as cited in Olmstead, 1996) Windsor, 1987; Logan et al., 1987; Cappaert et al., 1991a; Cloutier and Bauduin, 1995; FrieiroCosta, 1995; Cox, 1996; Paleari, 1997; Nogueira-de-Sá and Macêdo, 1998 Eisner and Eisner, 2000 Cox, 1994; Nogueira-de-Sá and Macêdo, 1998 Balazuc, 1988 Kosior, 1975 (as cited in Olmstead, 1996) Chittenden, 1924; Yeung, 1934 (both as cited in Olmstead, 1996)

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

163

natural enemies can heavily impact tortoise beetle populations in the field (Olmstead, 1996). Life tables and population studies of various Cassidinae species indicate that most enemy-induced mortality takes place in the egg or larval stage. Roughly 65% of reported enemy-cassidine interactions involve larvae and pupae (Olmstead, 1996). Most records for insect enemies of Chrysomelidae are from the Holartic, with far fewer records coming from the tropical regions of the New World, Africa, and Asia (Cox, 1996). Considering such data it is possible to notice that natural enemies of Chrysomelidae are represented by organisms of many different taxa. They vary from intracellular parasites to large avian predators (see examples of most frequent ones at Table 1 or see a more extent list at Cox (1994) and Olmstead (1996)). Besides, these data suggest that Cassidinae is the most frequently parasitized subfamily among the Chrysomelidae (Olmstead, 1996). Cox (1994) attributed this to the sedentary behavior of larvae, hence their predictability on host plants. Abundance of enemies of Cassidinae is another important parameter in chrysomelid mortality to be taken into account. There is evidence that predation and parasitism are density-dependent interactions and that populations of natural enemies are synchronized to that of their prey. Charlet (1992) observed that Myiophanus macellus (Reinhard) (Diptera: Tachinidae), a larva parasitoid of Zygogramma exclamationis (F.) (Chrysomelidae), showed synchrony with its host and a functional response to larval populations, maintaining even rates of parasitism. Cappaert et al. (1991b) detected a significant correlation between number of eggs of Leptinotarsa decemlineata (Say) and predators (or group of predators), suggesting a synchrony between them. During this study the peak of predator abundance coincided with the peak of beetle oviposition, sometimes with a small lag. A significant relationship was also detected between egg density and the rate of egg damage. According to the authors, these observations indicate that predation of L. decemlineata is density-dependent. Considering the importance of predation records Neotropical Chrysomelidae and the earlier evidence of synchony between enemies and hosts we studied the parasitoids, parasites and predators attacking the cassidines Stolas chalybea (Germar), S. areolata (Germar), and Anacassis phaeopoda Buzzi. Our objectives were to identify the natural enemies and to follow populations of hosts and Cassidinae prey in an Atlantic forest area in Brazil. MATERIALS AND METHODS Study Area This work was conducted at Serra do Japi (23° 11’S/46° 52’ W), a mountain ridge located at the southern limit of the tropical zone in São Paulo state, Brazil. This site was chosen because of the rich community of Chrysomelidae that inhabits the area. The climate in the region corresponds to the subtropical moist type, with two distinct seasons: a warm and rainy summer and a cold and dry winter. The forest is seasonal with the period of leaf fall from April to September, approximately (Leitão-Filho, 1992). During this same period, populations of insects are lower (F. Nogueira-de-Sá and J. Vaconcellos-Neto, personal observation). Natural Enemies Mortality during egg stage for each cassidine species was estimated by the difference between average number of individuals per egg cluster and larval groups. To estimate mortality during the larval stage, we considered the difference between the average number of individuals per three

164

Flávia Nogueira-de-Sá & João Vasconcellos Neto

classes of development: larvae in the first and second instar, larvae in the third and fourth instar and larvae in the fifth instar. Because the three species of Cassidinae were specialist on their host plants at Serra do Japi, data was obtained by censusing 60 individuals of Calea pinnatifida (R. Br.) Less. (Asteraceae) and Mikania cordifolia (L.f.) Willd. (Asteraceae), host plants of S. chalybea and S. areolata respectively, and 30 individuals of Baccharis trimera DC. (Asteraceae), host plant of A. phaeopoda, every fifteen days, from October, 1997 to September, 1998. In the census, we visually inspected each host plant, recording the number of individuals in each group of eggs or larvae encountered. During the summer, around every week from December until March, we collected egg clusters, larvae and adults of S. chalybea, S. areolata and A. phaeopoda (for this species egg clusters were not collected) and maintained in laboratory conditions (room temperature, humidity and photoperiod) to obtain their parasitoids. The beetles were reared in plastic boxes (11 cm height, 10 cm ∅) and we provided them with new leaves of their host plant every other day. Beetles were also inspected every two days for parasitoid emergence. Eggs were maintained until hatching, larvae were maintained until pupation and adults were reared for a month. Because egg clusters of S. chalybea were more abundant and easier to find in the field, to know the fate of eggs, we recorded the number of eggs infected by fungi, parasitized, preyed upon or hatched (these last three conditions were evaluated by marks on the eggs) from every egg cluster found during study period (not only on censused host plants). Abundance of Natural Enemies on Host Plants The influence of natural enemies on the three cassidine species was evaluated during the census described earlier, by recording the number of potential predators of the cassidines found on host plants. Predator species found in less than 10% of the plant censuses were not included in the analysis below. Therefore we only considered heteropterans, spiders and ants, which were the main potential predators found on the host plants. We only recorded the organisms that we considered able to kill the beetles in any stage of their development. The Spearman rank correlation index was used to determine the relationship, if any, between the abundance of the three beetle species and main potential predators in the area. We tested Cassidinae abundance (using data of Nogueira-de-Sá and Vasconcellos-Neto, 2003) versus the number of plants with predators in each census, and Cassidinae abundance versus the number of predator morphospecies observed in each census. We also correlated abundance of each of the three species with lags of 30, 45, 60 and 75 days (Lags 1, 2, 3 and 4) versus the abundance of their potential predators. Organisms Studied Host plants and insects were identified by specialists and voucher specimens are deposited in collections their respective institutions. RESULTS Natural Enemies We estimated that the greatest mortality of S. chalybea, S. areolata and A. phaeopoda was between the egg phase to 1st and 2nd instar larvae. The average number of larvae in groups at that stage was

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

165

66.98%, 87.5% and 65.65% lower than the average number of egg in clusters of S. chalybea, S. areolata and A. phaeopoda respectively (Fig. 1). Decrease in the mean size of larval groups was also observed between 1st-2nd instar larvae and 3rd-4th instar larvae (42.46%,and 11.5% for S. chalybea and A. phaeopoda respectively) and between 3rd-4th and 5th instar larvae, it was of 20.20% and 39.91% for S. chalybea and S. areolata respectively (Fig. 1). Infection by fungi, parasitism and predation together accounted for the death of 60.58% of S. chalybea eggs in the field (n=319 eggs) (Fig. 2). We obtained six different parasitoid species from eggs, all Microhymenoptera. Two other species were phoretic on S. chalybea elytra (Table 2). Phoretic parasitoids were not commonly observed. Only two species were reared from the eggs of S. areolata (Table 2). Neither species parasitized all eggs in a cluster. We have not investigated the occurrence of parasitoids from the eggs of A. phaeopoda at Serra do Japi because they were too rare. We obtained the same species of Tachinidae (Diptera), Eucelatoria parkeri (Sabrosky), as a larval parasitoid from S. chalybea and A. phaeopoda (Table 2).We obtained a second species of Tachinidae from larvae of S. areolata (Table 1), which infected all larvae within a single group. The nymphs of the pentatomids, Stiretrus decemguttatus (Lepeletier and Serville)) and Oplomus catena (Drury) (Hemiptera: Pentatomidae: Asopinae), and some other non-identified Asopinae nymphs

20 18

S. chalybea

No. individuals/group

16

S. areolata A. phaeopoda

14 12 10 8 6 4 2

*

*

0 Egg cluster

1st-2nd instar 3rd-4th instar

5th instar

Fig. 1. Mean and standard deviation of the number of individuals per group of each developmental stage found on their host plants in the field (Atlantic forest, Brazil). * Standard deviation could not be calculated because n= 1.

166

Flávia Nogueira-de-Sá & João Vasconcellos Neto

% of eggs

40 30 20 10 0 Predator

Fungi

Parasitoid

Alive

Fig. 2. Fate of Stolas chalybea eggs (n=319) in the field.

Table 2. Egg and larval parasitoids of Stolas chalybea, S. areolata and Anacassis phaeopoda found at Serra do Japi, SP and their rate of parasitism. Parasitoid species EULOPHIDAE (HYMENOPTERA) Emersonella sp.1 Emersonella sp.2 Emersonella sp.3* Emersonella sp.4 Tetrastichus sp. Paracryas sp. 1 Paracryas sp. 2* ENCYRTIDAE (HYMENOPTERA) Ooencyrtus sp. TACHINIDAE (DIPTERA). Eucelatoria parkeri Tachinidae sp. % of parasitism Egg parasitoids** Larva parasitoids** Adult parasitoids**

S.chalybea Egg Larva

S. areolata Egg Larva

X X X X X X X

X

A. phaeopoda Egg Larva

X

X X 51.93 (n=181) 19.39 (n=98) 0 (n=100)

X 28.57 (n=84) 46.15 (n=26) 0 (n=30)

X Not investigated 20 (n=5) 0 (n=7)

* Phoretic species. ** Sample size (n) corresponds to the number of hosts examined.

preyed upon S. chalybea larvae. Some species of spiders, like a species of Misumenops F. O. P. Cambridge (Thomisidae) and Achearanea tesselata (Keyserling) (Theridiidae) for example, also preyed upon larvae. Adults S. chalybea were observed attached to the web of Nephila clavipes (Linneaus) (Tetragnathidae) (R. Xavier, personal communication), and also to the webs of other unindentified spiders. The nematode, Hexamermis sp. (Mermithidae), parasitized 3% of adults of S. chalybea (n=100). It was not reared from the other two species of cassidines.

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

167

We did not detect in the field any natural enemy that would weaken the beetles instead of killing them; besides we did not observe any cassidine that did not seem to be “healthy”. In the absence of predators and under laboratoy conditions, mortality rates of larvae and adults of S. chalybea were 5.2% (n= 77) and 10% (n= 50), and of S. areolata were 16.67% (n= 12) and 10% (n= 30). Abundance of Potential Predators on Cassidinae Host Plants Ants (Formicidae) attending Aleyrodidae homopterans or foraging on plants, spiders and heteropterans (especially Pentatomidae) were the most frequent predators found on Cassidinae host plants. Censuses of host plants of S. chalybea, S. areolata and A. phaeopoda over the course of a year showed that potential predators were not found all year round. The temporal occurrence of predators was similar on the three host plant species (Fig. 3). Abundance of potential predators of cassidines on C. pinnatifida and on M. cordifolia were positively correlated with the abundance of their prey, S. chalybea and S. areolata (Table 3). No significant correlation was detected for the potential predators of A. phaeopoda on its host plant B. trimera. DISCUSSION This study confirms the large variety of potential enemies of Cassidinae. However, we add new records of the natural enemies attacking beetles on different stages of development and some peculiarities of the interactions. For instance, rates of S. areolata egg parasitism were lower in this study than indicated by some records in the literature. We observed that 28.57% of S. areolata eggs were parasitised, whereas Carroll (1978) and Paleari (1997) found egg parasitism rates of 37.93 and 88%, respectively. On the other hand, Nakamura and Abbas (1989) observed that eggs of two species of Aspidomorpha (A. miliaris (Fabricius) and A. sanctaecrucis (Fabricius)) were parasitized by one species of parasitoid each [respectively Tetrastichus Haliday sp. (Eulophidae), Cassidocida aspidomorphae Crawford (Tetracampidae)] and at rates of 39.8% and 27.7%, respectively. The relatively low abundance of the S. areolata population and the habit of ovipositing on neighboring plants Table 3. Correlation between the abundance of Stolas spp. and the number of host plants with potential predators and the number of species of predators throughout 1997 -1998 in an Atlantic forest area in Brazil.

Species

Development phase**

S. chalybea

Eggs Larvae Lag 2 adults Eggs Lag 2 eggs Lag 4 eggs

S. areolata

Number of Plants with Predators X Cassidinae 0.549* (n= 20) 0.458* (n= 20) Ns (n= 18) Ns (n= 20) 0.596* (n= 18) 0.647* (n= 16)

Number of species of Predators X Cassidinae 0.580 (n= 20) Ns (n=20) -0.480* (n= 18) 0.489* (n= 20) Ns (n= 18) 0.669* (n= 16)

* r significant at p< 0,05. ns.- non significant ** For every development phase, we also tested the correlation between Cassidinae with 1, 2 , 3 and 4 Lag periods and Number of plants with predators and between Cassidinae and number of species of predators. Results not mentioned in the table above were not significant on both correlations.

168

Flávia Nogueira-de-Sá & João Vasconcellos Neto

Predator/Plant

Calea pinnatifida Hemiptera Spider Ant

1,4 1,2 1 0,8 0,6 0,4 0,2 0

O

N

D

J

F

M

A

M

J

J

S Time

Predator/Plant

Mikania cordifolia Hemiptera Spider Ant

1,4 1,2 1 0,8 0,6 0,4 0,2 0 O

N

D

J

F

M

A

M

J

J

S Time

Predator/Plant

Baccharis trimera 1,4 1,2 1 0,8 0,6 0,4 0,2 0

Spider Ant

S

0

N

D

J

F

M

A

M

J

A

S Time

Fig. 3. Frequency of potential predators of Stolas chalybea, S. areoloata and Anacassis phaeopoda found on their host plants The number of individuals of Baccharis trimera censused was half the number of each of the other species.

(Nogueira-de-Sá and Vasconcellos-Neto, 2003) may explain the low parasitism. This latter factor may reduce the likelihood that they will be found by parasitoids that use plant chemical cues to find their herbivorous hosts (Vinson, 1976; Rowell-Rahier and Pasteels, 1992; Köpf et al., 1997 and

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

169

Meiners and Hilker, 1997). However, predation on S. areolata eggs of this species was not quantified. Although the studies of Carroll (1978) and Paleari (1997) were conducted in the Amazon region, well known for its high biodiversity, we observed in the Atlantic forest a higher diversity of parasitoids attacking Cassidinae eggs. Species of Emersonella Giralt (Eulophidae) represented 50% of the species of egg parasitoids that we obtained. This genus has been frequently collected by other authors (e.g. Carroll, 1978; Nakamura and Abbas, 1989; Frieiro-Costa, 1995 and Paleari, 1997) and causes high mortality eggs in the field. Most cases indicate that Emersonella attacks Cassidinae species in the tribe Stolaini, the same of Stolas Billberg and Anacassis Spaeth. According to Paleari (1997), similarity of host body size and shape and reproductive potential are characteristics that might explain the susceptibility of more than one species of Cassidinae to parasitism by Emersonella spp. Parasitism of eggs of different species by the same parasitoid species is quite common (M. Tavares, personal communication). Mortality was highest during the egg stage probably due to the wider diversity of natural enemies. Parasitism, fungi infection and predation had similar impact on eggs of S. chalybea. The main Cassidinae egg predators are hymenopterans, hemipterans and arachnids according to Olmstead (1996). These groups were very common on the studied host plants. Ant predation might have been the most influential mortality factor because we observed many host plants with ants (especially Myrmicinae and Ponerinae) attending nymphs of Aleyrodidae homopterans. The hemipteran bug, Stiretrus decemguttatus, which was observed preying on larvae of S. chalybea, may be also a potential predator of eggs. According to Paleari (1997), most records of this species suggests that it mostly preys on eggs and pupae, and is restricted to Chrysomelidae. In the literature, larval parasitism rates are highly variable in time. The Tachinidae, Myiophanus macellus (Reinhard), parasitized larvae of Zygogramma exclamationis at rates varying from 0 to 100% during different study years (Charlet 1992). Different authors, studying Tachinidae parasitism on different species of Chrysomelidae [like Leptinotarsa decemlineata (Cappaert et al., 1991a), Zygogramma exclamationis (Charlet, 1992) and Diabrotica speciosa (Germ.) (Heineck-Leonel and Salles, 1997)], also found completely different rates of parasitism in the course of a single year or in different years. Therefore, a single year data, as we present at this study, may not reflect parasitism patterns for longer periods. Our observation of a single tachinid species (Eucelatoria parkeri Sabrosky) attacking different prey species (Stolas chalybea and Anacassis phaeopoda, as presented here and S. fuscata (Klug) and S. prolixa (Boheman) (Guimarães, 1977)) is not uncommon in nature. Other species of Eucelatoria Townsend attack at least four different genera of Neotropical Chrysomelidae (Guimarães, 1977). Other cases of tachinids parasitizing different species of Chrysomelidae were reported by Logan et al. (1987) and Keese (1997). Many authors consider predation as the most important mortality factor for phytophagous insects (Bernays, 1997; Gomes-Filho, 1997 and Hawkins et al., 1997). There are some examples in which low parasitism is compensated by predation (see Monteiro, 1981 and references therein). Invertebrate predators are often considered generalized feeders, and the presence of these generalist species in the field increases the chances of predation. In our case, ants and pentatomid heteropterans were the most common invertebrate predators of Cassidinae found in the field, thus we expect that they caused high mortality. Ants that attack larvae and pupae have a substantial impact on populations of Cassidinae (Olmstead, 1996). However, Carroll (1978) has observed that only young larvae fall victim to foraging ants. Although we did not observe any ant attack during our study, we only observed older larvae being preyed upon by pentatomid bugs. Paleari (1997) describes a similar

170

Flávia Nogueira-de-Sá & João Vasconcellos Neto

situation: attacks on fourth and fifth instar larvae of Botanochara sedemcimpustulata (Fabricius), Zathrephina lineata (Fabricius) and Chelymorpha aff. alternans Boheman (all Stolaini) were caused by the pentatomid Stiretrus decemguttatus. This author suggested that the predators obtained more food by feeding on older larvae. In our study, we did not detect any negative influence of vertebrate predators. Nogueira-de-Sá (1999) conducted an exclusion experiment to detect the most important group of predators of S. chalybea and observed that flying invertebrates seemed to be the main organisms responsible for larvae mortality. Also, chicks only rarely preyed upon these larva (Nogueira-de-Sá, unpublished data). However, Gomez (1997) suggested that predation by vertebrates upon Cassidinae may be higher than generally assumed and perhaps, of great impact. In her work, she suggested that the disappearance of larvae of Eurypedus Gistel (Cassidinae) was due to a lizard or an avian predator. The literature includes few observations on natural enemies of adult Cassidinae. Because parasitism by nematodes is frequently low (see also Heineck-Leonel and Salles, 1997), it is not expected to constitute an important influence in decreasing S. chalybea populations. Predators, like spiders and heteropterans (including S. decemguttaus) were observed on host plants and at the study area, suggesting their high importance. Nevertheless, adult Cassidinae definitely did not seem to be the preferred prey for those predators, or they must be well protected against them. Thanatosis, dropping off their host plants and regurgitating were the possible defensive strategies observed in the field for the three studied species. Predation experiments on Chelymorpha cribraria (Fabr.) adults (Cassidinae: Stolaini) showed that they were unpalatable to birds and spiders (Vasconcellos-Neto, 1988). Potential predators of S. chalybea, S. areolata and A. phaeopoda had a pattern of occurrence over the year very similar to their cassidine prey. They were more abundant on host plants in the summer months, coinciding with higher abundance of Cassidinae (Nogueira-de-Sá and Vasconcellos-Neto, in press). Synchrony between prey and predators or parasitoids has been detected by other authors (Charlet, 1992 and Cappaert et al., 1991b). We believe the same synchrony occurs with the populations of both Stolas species and Anacassis and their parasitoids, because of the decrease of insect populations during winter months. Low, but significant positive correlations between S. chalybea and S. areolata and the occurrence and richness of predators on their host plants suggest their influence on potential predators. Significant results with lag, may indicate that occurrence and richness of predators not only was related to the abundance of their prey at the present time, but also may increase their population as a response to higher abundance of Cassidinae in the past. Negative correlation between the richness of potential predators and Lag 2 adults is the only exception, and we believe that this may be influenced by other factors but the availability of their prey in the past. Because host plants of Cassidinae were so abundant in the field, we believe that they are not a limiting factor to the beetles. Additionally, in our previous investigations on S. chalybea, S. areolata and A. phaeopoda, at the same site, we have observed that some abiotic factors, like rain and temperature, only weakly explained the low numbers and the fluctuation of these populations in the field (Nogueirade-Sá and Vasconcellos Neto, 2003). Therefore, it seems to us that natural enemies are important in regulating Cassidinae populations, as its is believed for many phytophagous insects (see Hairston et al., 1960, Oksanen and Ericson, 1987; Denno et al., 1990; Hawkins et al., 1997; Keese, 1997; Cornell et al., 1998, for instance). Although more direct observations on the influence of predators and more intense collections of these beetles, specially S. areolata and A. phaeopoda, are still needed, this work supports the hypothesis of the control of herbivore populations by their natural enemies.

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

171

ACKNOWLEDGEMENTS The authors acknowledge the following professionals for their valuable work of identification of studied organisms: Caroline Chaboo (Cornell University, USA) and José Z. Buzzi (UFPR, Brazil) (Cassidinae), Jorge Tamashiro (Unicamp, Brazil) and João Semir (Unicamp, Brazil) (Asteraceae), Marcelo Tavares (Uniara, Brazil) (Microhymenoptera), José H. Guimarães (MZUSP, Brazil) (Tachinidae), Luis C.C.B. Ferraz (ESALQ/USP, Brazil) (Nematoda), Jocélia Grazia (UFRGS, Brazil) (Hemiptera) and. Adalberto J. Santos (Unicamp, Brazil) (Arachnida). We thank Antonio M. Rosa for field assistance and Lauro, Ivan and the staff of Ecological House at Serra do Japi for care and logistic support. We also thank Kleber del Claro, Margarete Macêdo, Donald Windsor and an anonymous reviewer for comments on earlier drafts of this manuscript. This research was supported by a grant from FAPESP to FNS (97/03311-2). LITERATURE CITED Balazuc, J. 1988. Laboulbeniales (Ascomycetes) parasitic on Chrysomelidae), pp. 389-398. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Bernays, E. A. 1997. Feeding by lepidopteran larvae is dangerous. Ecological Entomology 22:121-123. Cappaert, D. L, F. A. Drummond and P. A. Logan 1991a. Incidence of natural enemies of the Colorado potato beetle, Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) on a native host in Mexico. Entomophaga 36(3):369-378. Cappaert, D. L, F. A. Drummond and P. A. Logan 1991b. Population dynamics of the Colorado potato beetle (Coleoptera: Chrysomelidae) on native host in Mexico. Environmental Entomology 20(6):1549-1555. Carroll, C. R. 1978. Beetles, parasitoids and tropical morning glories: a study in host discrimination. Ecological Entomology 3:79-85. Charlet, L. D. 1992. Seasonal abundance and parasitism of the Sunflower beetle (Coleoptera: Chrysomelidae) on cultivated Sunflower in the Northern Great Plains. Journal Economical Entomology 85(3):766-771. Cloutier, C. and F. Bauduin 1995. Biological control of the colorado potato beetle Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) in Québec by augmentative releases of the two-spotted stinkbug Perillus bioculatus (Hemiptera: Pentatomidae). The Canadian Entomologist 127:195-212. Cornell, H. V., B. A. Hawkins and M. E. Hochberg 1998. Towards an empirically-based theory of herbivore demography. Ecological Entomology 23:340-349. Cox, M. L. 1994. The Hymenoptera and Diptera parasitoids of Chrysomelidae, pp. 419-467. In: P. H. Jolivet, M. L. Cox and E. Petitipierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Dordrecht, The Netherlands. Cox, M. L. 1996. Insect predators of Chrysomelidae, pp. 23-91. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers, Amsterdam, The Netherlands. Denno, R. F., S. Larsson and K. L. Olmstead 1990. Role of enemy-free space and plant quality in host-plant selection by willow beetles. Ecology 71(1):124-137. Eisner, T. and M. Eisner 2000. Defensive use of a fecal thatch by a beetle larva (Hemisphaerota cyanea). Proceedings of the National. Academy of Science (USA) 97(6):2632-2636. Frieiro-Costa, F. 1995 Biologia de populações e etologia de Omaspides tricolorata (Boheman, 1854) (Coleoptera: Chrysomelidade: Cassidinae) na Serra do Japi – Jundiaí, SP. Ph.D Thesis. Universidade Estadual de Campinas.

172

Flávia Nogueira-de-Sá & João Vasconcellos Neto

Gomez, N. E. 1997. The fecal shields of larvae of tortoise beetles (Cassidinae: Chrysomelidae): a role in chemical defense using plant-derived secondary compounds. Ph.D Thesis Universität Carolo-Wilhelmina zu Braunschweig. Guimarães, J. H. 1977. Host -parasite and parasite-host catalogue of South American Tachinidae (Diptera). Museu de Zoologia da Universidade de São Paulo 28(3). São Paulo, Brazil. Gomes-Filho, A. 1997. Predação no fitófago tropical Eurema albula (Cramer, 1775) Lepidoptera: Pieridae): uma avaliação experimental. MSc. Thesis. Universidade Estadual de Campinas. Hairston, N. G., F. Smith and L. B. Slobodkin. 1960. Community structure, population control and competition. American Naturalist 44: 421-425. Hawkins, B. A., H. V. Cornell and M. E. Hochberg 1997. Predators, parasitoids, and pathogens as mortality agents in phytophagous insect populations. Ecology 78(7):2145-2152. Heineck-Leonel, M. A. and L. A. B. Salles 1997. Incidência de parasitóides e patógenos em adultos de Diabrotica speciosa (Germ.) (Coleoptera: Chrysomelidae) na região de Pelotas, RS. Anais Sociedade de Entomologia 26(1):81-85. Keese, M. C. 1997. Does escape to enemy-free space explain host specialization in two closely related leaffeeding beetles (Coleoptera: Chrysomelidae). Oecologia 112:81-86. Köpf, A., N. Rank; H. Roininen and J. Tahvanainen 1997. Defensive larval secretions of leaf beetles attract a specialist predator Parasyrphus nigritarsis. Ecological Entomology 22:176-183. Leitão-Filho, H. F. 1992 A flora arbórea da Serra do Japi, pp. 40-62. In: Morellato, L. P. C (Org.), História Naural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Editora da Unicamp. Logan, P. A., R. A. Casagrande, T. H. Hsiao and F. A. Drummond 1987. Collections of natural enemies of Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) in Mexico. 1980-1985. Entomophaga 32(3):249-254. Meiners, T. and M. Hilker 1997. Host location in Oomyzus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle Xanthogaleruca luteola (Coleoptera: Chrysomelidae). Oecologia 112:87-93. Memmot, J., H. C. J. Godfray and B. Bolton 1993. Predation and parasitism in a tropical herbivore community. Ecological Entomology 18:348-352. Monteiro, R. F. 1981. Regulação populacional em Ithomiinae (Lep.: Nymphalidae): ecologia da interação parasitóide x hospedeiro. M.Sc. Thesis, Universidade Estadual de Campinas. Nakamura, K. and I. Abbas 1989.Seasonal change in abundance and egg mortality of two tortoise beetles under a humid-equatorial climate in Sumatra (Coleoptera, Chrysomelidae, Cassidinae), pp. 487-495. In: D. G. Furth and T. N. Seeno (Eds.). Proceedings of the Second International Symposium on the Chrysomelidae. Entomography 6:343-552. Nogueira-de-Sá, F. 1999. Influência da interação com plantas hospedeiras (Asteraceae) e inimigos naturais de três espécies de Cassidinae (Coleoptera: Chrysomelidae) na Serra do Japi, SP. M.Sc. Thesis, Universidade Estadual de Campinas. Nogueira-de-Sá, F. and M. V. Macêdo 1998. Host plant preference of Plagiometriona flavescens (Coleoptera: Chrysomelidae) for two Solanaceous species, pp. 287-297. In: M. Biondi, M. Daccordi and D. G. Furth (Eds.), Proceedings of the Fourth International Symposium on the Chrysomelidae. Atti Museo Regione di Scienze Naturali, Torino, 327 pp. Nogueira-de-Sá, F. and J. Vasconcellos-Neto 2003. Host plant utilization and population abundance of three tropical species of Cassidinae (Coleoptera: Chrysomelidae). Journal of Natural History (in press). Oksanen, L. and L. Ericson 1987. Preface: Why should we care about predation and parasitism? Oikos 50(3):274-275. Olmstead, K. 1996. Cassidinae defenses and natural enemies, pp. 3-21. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers. Amsterdam, The Netherlands.

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

173

Paleari, L. M. 1997. Partilha de recurso entre Botanochara sedecimpustulata (Fabricius, 1781) e Zatrephina lineata (Fabricius, 1787) (Coleoptera, Chrysomelidae, Cassidinae), em Ipomoeae asarifolia (Convolvulaceae), na Ilha de Marajó, Pará, Brasil. Ph.D. Thesis. Universidade Estadual de Campinas. Peterson, J. K. and J. M. Schalk 1994. Internal Bacteria in the Chrysomelidae, pp. 393-405. In: P. H. Jolivet and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Poinar, G. O. Jr. 1988. Nematode parasites of Chrysomelidae, pp. 433-448. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, the Netherlands. Rowell-Rahier, M. and J. M. Pasteels 1992. Third trophic level influences of plant allelochemicals, pp. 243-277. In: G. A. Rosenthal and M. R. Berembaum (Eds.), Herbivores: Their interactions with secondary plant metabolites. Vol. II: Evolutionary and Ecological Processes. Academic Press. San Diego. Selman, B. J. 1988. Viruses and Chrysomelidae, pp. 379-387. In: P. H. Jolivet; E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, the Netherlands. Théodoridès, J. 1988. Gregarines of Chrysomelidae, pp. 417-431. In: P. H. Jolivet; E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Toguebaye, B. S., B. Marchand and G. Bouix 1988. Microsporidia of the Chrysomelidae, pp. 399-416. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Vasconcellos-Neto, J. 1988. Genética Ecológica de Chelymorpha cribraria, F. 1775 (Cassidinae, Chrysomelidae). Ph.D. Thesis. Universidade Estadual de Campinas. Vinson, S. B.1976. Host selection by insect parasitoids. Annual Review of Entomology 21:109-133. Windsor, D. M. 1987. Natural history of a subsocial tortoise beetle, Acromis sparsa Boheman (Chrysomelidae, Cassidinae) in Panama. Psyche 94:127-150.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFTEvolution Publishers of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) 175 Special Topics in Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 175-182

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) Astrid Eben1 and Alejandro Espinosa de los Monteros2 1

Departamento de Ecología Vegetal, Instituto de Ecología, A.C., Km 2.5 Antigua Carretera a Coatepec, 91000 Xalapa, Veracruz, Mexico. Email: [email protected] 2 Departamento de Ecología y Comportamiento Animal, Instituto de Ecología, A.C., Km 2.5 Antigua Carretera a Coatepec, 91000 Xalapa, Veracruz, Mexico

ABSTRACT The association of Diabroticites with bitter Cucurbitaceae was interpreted as an example for chemically mediated plant-insect coevolution. This hypothesis is based on experiments with a limited number of species distributed in the USA, where they were apparently introduced from Mexico and Mesoamerica together with corn and squash. We recovered a maximum parsimony phylogeny of 19 Mexican Diabroticite species from six different genera based on 472 bp of COI and 43 external morphological characters. Our preliminary results corroborate the monophyly of the genera Diabrotica and Acalymma. Nonetheless, other currently recognized groups (e.g., fucata group) were not recovered as natural lineages. The evolutionary scenario depicted from this phylogeny allows us to conclude that the genus Acalymma diverged after the specialization of ancestral Diabroticites on Cucurbitaceae. An ancestor which was specialized on Cucurbitaceae gave rise to the polyphagous genus Diabrotica. Within this genus, the basal species have a host range from polyphagous to narrow, feeding on Poaceae, Fabaceae or a few other families. The species in the virgifera group have a larval host plant range restricted to Poaceae. Nevertheless, all species feed as adults on bitter cucurbits in the wild. Our data corroborate the hypothesis that the kairomonal response to secondary compounds in Cucurbitaceae is a relic of the ancestral host plant association. Furthermore, the data suggest that specialization is not a dead end in the evolution of Diabroticites. Instead, host plant range apparently became restricted and broadened several times within the evolution of the section.

RESUMEN La asociación de las Diabroticinas con calabazas amargas fue interpretada como un ejemplo de coevolución insectos-plantas mediada por compuestos químicos. Esta hipótesis, sin embargo, está basada en experimentos realizados con un número limitado de especies distribuidas en los EUA. Más aun, dichas especies fueron introducidas desde México y Mesoamérica junto con maíz y calabazas. Usando parsimonia reconstruimos una filogenia para 19 especies de Diabroticinas de seis géneros diferentes basada en 472 bp del gen mitocondrial COI y 43 caracteres morfológicos externos. Nuestros

176

Astrid Eben & Alejandro Espinosa de los Monteros

resultados corroboraron la monofilia de los género Diabrotica y Acalymma. Sin embargo, otros grupos comúnmente aceptados (e.g., grupo fucata) no fueron identificados como naturales en este análisis El escenario evolutivo inferido a partir de esta filogenia permite concluir que el género Acalymma radió posteriormente a la especialización de las Diabroticinas ancestral en Cucurbitaceae. Un ancestro especializado en Cucurbitaceae dio origen al género polífago Diabrotica, dentro del cual, la polifagia caracteriza a los linajes basales. Por otro lado, las especies del grupo virgifera presentan un ámbito de plantas hospederas restringido a Poaceae y Cucurbitaceae. Bajo condiciones naturales, sin embargo, todas las especies de Diabrotica se encuentran asociadas a flores de calabazas amargas. Nuestros datos preliminares corroboran la hipótesis que la respuesta kairomonal hacia compuestos secundarios de cucúrbitas puede ser el vestigio de la asociación ancestral con calabazas. Finalmente, la especialización no es un callejón sin salida en Diabroticinas. El uso de hospederos se ha restringido y ampliado varias veces durante la historia evolutiva de este grupo. INTRODUCTION Beetle species of the section Diabroticites (Chrysomelidae: Galerucinae: Luperini) are distributed in the New World, mainly in the tropics (Krysan and Branson 1983). One of the major questions concerning this herbivorous group is how to explain its radiation onto a large variety of plant families. It is striking that the majority of the Diabroticites share the Cucurbitaceae as a common host plant family. Current knowledge of the species of economic importance distributed in the USA indicates that Acalymma Barber spp. are monophagous on cucurbits, whereas Diabrotica Chevrolat spp. show a higher plasticity. Traditional classification has divided the latter genus in the grassfeeding virgifera group and the polyphagous fucata group (Smith and Lawrence 1967). Nevertheless, data on host plants of Neotropical species are scarce, especially for genera that are not of economic interest (Eben and Barbercheck 1996). Unfortunately, due to the lack of a phylogenetic hypothesis, we have been unable to understand the evolution of host plant relationships in these insects. The objective of this study was to recover a historical hypothesis about the interrelationships of Diabroticites. Based on this hypothesis we will infer an evolutionary scenario for host plant use in Diabroticites. Individual scenarios will be addressed to evaluate the plasticity of Diabroticites to invade plants of economic importance. MATERIAL AND METHODS Insects: Nineteen Diabroticite species, one Ceratomite species and one outgroup species were used for this study. All adult beetles were collected in the state of Veracruz, Mexico. Host plant use was confirmed with feeding choice assays (Eben et al. 1997). Molecular Characters: Total genomic DNA was extracted from frozen tissue using a Chelex 5% solution w/v following the method suggested by Singer-Sam et al. (1989). To minimize the risk of amplifying translocated nuclear copies, the mitochondrial COI gene region was isolated and amplified as a single fragment using specifically designed PCR primers. This fragment covers the sequence between the primers

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae)

177

S1718 (5´ ggaggatttggaaattgattagttcc 3´) and Nancy (5´cccggtaaaattaaaatataaacttc 3´). Detailed PCR and sequencing strategies are described elsewhere (Espinosa de los Monteros 2000). For all taxa, both strands were sequenced to guarantee accuracy. Morphological Characters: Forty three external morphological characters of adult insects were used as an additional data set for phylogenetic reconstruction (Appendix). Phylogenetic Analysis: Phylogenetic hypotheses were recovered by maximum parsimony conducted with the program PAUP* (Swofford 2000). The large number of taxa included in this study did not allow the use of exhaustive searching algorithms. Therefore, parsimony analyses were performed using heuristic searches. One thousand replicate searches with random addition of taxa were performed to eliminate input order bias. During all analysis, character polarization was established by outgroup comparison, and nucleotide transformations were considered unordered. Branch length was optimized using delayed transformation (DELTRAN) which favors parallelisms over reversals. Branch swapping was done using the tree bisection reconnection algorithm (TBR). In those cases in which the solution included multiple equally parsimonious trees, the signal was identified using strict consensus trees. Retention and consistency indexes were computed to evaluate the level of homoplasy in the most parsimonious tree. Evolutionary scenarios were reconstructed with the aid of the program MacClade v. 3.0. To avoid circularity, the characters mapped were not included in the phylogenetic analysis. RESULTS AND DISCUSSION Phylogenetic analyses of each data set (i.e. morphology and DNA) were performed. The 43 morphological characters yielded three equally parsimonious trees of 70 steps in length, 0.464 CI, and 0.635 RI (Fig. 1). An exploratory analysis of the DNA sequences revealed that the COI gene presents some saturation of transitions (Fig. 2A). After dividing the COI sequences by codon position, a clear saturation pattern can be observed on 3rd position transitions (Fig. 2B). Based on this evidence, a weighting scheme was applied downloading 3rd position transitions 1:2 with respect to 1st and 2nd positions and 3rd position transversions. The DNA analyses resulted in one most parsimonious tree of 1293 steps, 0.365 CI, and 0.371 RI (Fig. 3). A partition homogeneity test showed that the data matrices for the DNA and morphology were compatible for combined analysis (p=0.034). A more robust result is expected once compatible independent data sets are pooled together. The total evidence approach resulted in a single most parsimonious tree of 1387 steps, 0.360 CI, and 0.371 RI (Fig. 4). Slight differences can be observed on the three different analyses presented here. However, a common pattern in the phylogenetic relationships for the Diabroticites is evident. First, Acalymma sensu stricto is a monophyletic group, and apparently Amphelasma Barber is its sister taxon. These lineages are closely related to the genus Diabrotica and are sister groups of each other. Diabrotica as currently defined is a paraphyletic group. Most probably, Isotes Weise and Paratriarius Schaeffer have to be included within Diabrotica to create a natural group. The so-called virgifera group appears to be a monophyletic lineage. On the other hand, the fucata group is polyphyletic, and should therefore be removed from natural classifications. The genus Gynandrobrotica BechynJ is not monophyletic. The

178

Astrid Eben & Alejandro Espinosa de los Monteros

Figure 1. Strict consensus of three equally parsimonious trees based on 43 morphological characters.

Figure 2. Saturation plot for the COI gene. a) global pattern for transition and transversion; b) saturation on transitions by codon position.

genus Cerotoma Chevrolat is the sister group of one of the Gynandrobrotica. A more exhaustive analysis of these genera must be undertaken before reaching a definite conclusion. The evolutionary scenario suggests that the ancestor of the Diabroticites was monophagous on cucurbits (Fig. 5 and Fig. 8). One of the most basal lineages, that encompasses Cerotoma atrofasciata Jacoby and Gynandrobrotica lepida (Say), independently gained fabaceous plants (i.e. beans) as secondary hosts. Nevertheless, in the more basal lineages of the remaining Diabroticites, a monophagy on cucurbits was retained. The basal lineages include all the species of the genus Acalymma. The monophagy was also maintained in Amphelasma cavum (Say). However, this species switched to an unrelated plant family, the Lamiaceae. Apparently, the large diversity encountered in the genus Diabrotica might be the result of the acquisition of polyphagy (Fig. 6). Finally, a tendency towards

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae)

179

Figure 3. Single most parsimonious tree based on DNA characters only.

Figure 4. Single most parsimonious tree based on a total evidence analysis.

Figure 5. Historical scenario for the evolution of diet breadth in Diabroticites.

Figure 6. Historical scenario for the invasion of Fabaceae.

the loss of host families in apical lineages of Diabrotica is suggested by the scenario, resulting in a secondary return to monophagy on cucurbits. A particular scenario regarding Fabaceae suggests

180

Astrid Eben & Alejandro Espinosa de los Monteros

Figure 7. Historical scenario for the invasion of Poaceae.

Figure 8. Reconstructed evolutionary scenario for the evolution of host use in Diabroticite beetles.

that Diabroticites adapted to this family four times (Fig. 6). This might have independently happened at least three times within the genus Diabrotica. Our field records and bioassays demonstrated that D. undecimpunctata duodecimnotata Harold does not feed on beans, which is explained in the evolutionary scenario as a secondary loss. In the same manner, the invasion of corn apparently occurred independently three times within Diabrotica, and we postulate one secondary loss of this host in D. scutellata Jacoby (Fig. 7). In conclusion, in the Diabroticites, specialization on Cucurbitaceae is apparently an ancestral state, yet, does not represent a dead end in the evolution of the group (Fig. 8). ACKNOWLEDGEMENTS We thank the Departamento de Sistematica Vegetal (Instituto de Ecologia, Xalapa) for permission to use the Laboratory of Molecular Systematics. This research was partly funded by the Departamento de Ecologia Vegetal (902-16). LITERATURE CITED Eben, A. and M. E. Barbercheck 1996. Field observations on host plant associations and natural enemies of Diabroticite beetles (Chrysomelidae: Luperini) in Veracruz, Mexico. Acta Zool. Mex. 67:47-65. Eben, A., M. E. Barbercheck and M. Aluja S. 1997. Mexican Diabroticite beetles: I. Laboratory tests on host breadth of Acalymma and Diabrotica spp. Ent. Exp. Appl. 82:53-62. Espinosa de los Monteros, A. 2000. Higher-level phylogeny of Trogoniformes. Mol. Phylogenet. Evol. 14:20-34.

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae)

181

Krysan, J. L. and T. F. Branson 1983. Biology, ecology and distribution of Diabrotica. In: D. T. Gordon, J. K. Knoke, L. R. Nault and R. M. Ritter (Eds.). Proceedings International Maize Virus Disease Colloquium and Workshop, 2-6 August 1982. The Ohio State University, Ohio Agricultural Research and Development Center, Wooster. Singer-Sam, J., R. L. Tanguay and A. D. Riggs 1989. Use of Chelex to improve PCR signals from a small number of cells. Amplifications: a forum for PCR users 3:11. Smith, R. F. and J. F. Lawrence 1967. Clarification of the status of the type specimens of Diabroticites (Coleoptera, Chrysomelidae, Galerucinae). University of California Publications in Entomology, Volume 45, 174 pp. University of California Press, Berkeley. Swofford, D. L. 2000. PAUP* Phylogenetic analysis using parsimony (* and other methods) version 4.0b8. Sinauer Associates, Sunderland, Massachusetts, USA.

APPENDIX Morphological characters of Diabroticite species and outgroup taxa. All characters apply to adult beetles. 1. 2. 3. 4. 5.

Body size (0) smaller or equal to 5 mm, (1) larger than 5 mm. Color of thorax and elytra (0) same or (1) different. Color of thorax : (0) pale, yellow, green, (1) black, (2) combination of two colors, or (3) red, orange. Thorax bifoveate : (0) yes, (1) no, or (2) with transverse groove. Pattern on elytra : (0) no pattern, (1) transverse bands, (2) large spots, (3) small spots, (4) one stripe, (5) two or more stripes, (6) circles. 6. Hairs on elytra arranged (0) in rows, (1) irregularly, or (2) no hairs present. 7. Elytral punctures : (0) uniform, (1) variable, or (2) striate. 8. Elytra with (0) or without (1) sinuate sulci. 9. Raised areas or depressions on elytra : (0) absent or (1) present. 10. Metallic, shiny coloration of elytra : (0) yes, (1) no. 11. Elytra with variable color pattern : (0) yes, (1) no. 12. Elytra : (0) stripes connected at base, (1) not connected, (2) no stripes. 13. Elytra : (0) apical angle pointed, (1) apical angle not pointed, truncate. 14. Elytra : (0) with humeral vittae, (2) without humeral vittae. 15. Elytra : (0) with strongly punctured plicae in posthumeral area, (1) without such structures. 16. Elytra : (0) with pale outer line, (1) without pale outer line. 17. Antennae : (0) uniform color of all segments, (1) not all segments of the same color. 18. Antennal insertion : (0) close to eyes, (1) not close to eyes. 19. Antennae : (0) third segment longer than second, (1) third segment equal to second. 20. Antennae : (0) third segment as long as fourth, (1) third segment not as long as fourth, (2) third segment longer than fourth. 21. Legs : (0) tarsal claws bifid, (1) tarsal claws appendiculate. 22. Legs : (0) several tarsal segments with an adhesive patch, (1) no adhesive patch, (2) only one segment with adhesive patch. 23. Legs : (0) tibia with apical spurs, (1) tibia without apical spurs. 24. Legs : (0) first segment of midtarsus as long as following segments together, (1) first segment of midtarsus short, sub equal to the following segments.

182

Astrid Eben & Alejandro Espinosa de los Monteros

25. Legs : (0) uniform color, (1) not uniformly colored. 26. Legs : (0) same color as abdomen, (1) not same color as abdomen. 27. Abdomen : (0) black, (1) pale, brownish, yellow 28. Size of eyes : (0) large, (1) small. 29. Front excavated : (0) with prominant median tubercle and thin lamella above arcuate, marginate in middle, (1) excavation without tubercule and lamella, (2) no excavation. 30. Apical segment of maxillary palpi : (0) no setae, (1) one seta, (2) 2 or more setae. 31. Labrum : (0) anterior margin slightly to strongly concave, (1) anterior margin even or convex. 32. Number of setae at labral margin : (0) none, (1) 2-3, (2) 4 or more. 33. Form of setae at labrum : (0) stout, short, (1) long, slender, (2) no setae. 34. Elongated setae at rear margin of wings : (0) absent, (1) present. 35. Color of head : (0) same color as thorax, (1) not same color as thorax. 36. Shape of thorax : (0) as broad as long (quadriculate), (1) not as broad as long (transverse), (2) longer as broad. 37. Thorax : (0) narrowed at middle, (1) not narrowed at middle. 38. Pronotum marginate : (0) yes, (1) no. 39. Pronotum at front and posterior end with pointed corners : (0) yes, (1) no. 40. Elytra covering entire abdomen (0), or (1) leaving one segment visible. 41. Third and fourth antennal segments of males modified : (0) absent, (1) present. 42. Elytra of males at apex with depressions and hairs : (0) absent, (1) present. 43. Clypeus in males excavated : (0) absent, (1) present.

© PENSOFT Publishers A Review Sofia - Moscow

David G. Furth (ed.) 2003 of the Biology and Host Plants of the Hispinae and Cassidinae 183 Special Topics in ... Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 183-199

A Review of the Biology and Host Plants of the Hispinae and Cassidinae (Coleoptera: Chrysomelidae) of Australia Trevor J. Hawkeswood1 1

270 Terrace Road, North Richmond, New South Wales, 2754, Australia. Email: [email protected]

ABSTRACT The biology and host plants of the Australian Hispinae and Cassidinae are reviewed from the literature and discussed. Some of these genera/species represent relictual endemics while others are extensions of larger genera which are poorly represented on the Australian continent. The species discussed here are as follows: Aproida balyi Pascoe, 1863, Brontispa castanea Lea, 1926, Eurispa vittata Baly, 1858, Hispellinus multispinosus (Germar, 1848), Promecotheca callosa Baly, 1876, P. varipes Baly, 1858 (Hispinae), Aspidimorpha deusta (Fabricius, 1775), A. interrupta (Fabricius, 1775), A. maculatissima (Boheman, 1856), Cassida compuncta (Boheman, 1855), C. diomma (Boisduval, 1835), Notosacantha dorsalis (Waterhouse, 1877) (Cassidinae).

INTRODUCTION The Hispinae and Cassidinae, two distinctive groups of the highly speciose beetle family Chrysomelidae, are mostly tropical in distribution with most of the genera and species occurring in South America (Seeno and Wilcox, 1982; Jolivet and Hawkeswood, 1995). Australia, compared to other tropical areas, including the neighbouring Pacific region is very depauperate in genera and species. The following genera of Hispinae are known from Australia (from Seeno and Wilcox, 1982 and other references cited therein): Aproida Pascoe, 1863, Eurispa Baly 1858, Leucipa Chapuis 1875, Brontispa Sharp 1903, Heterrachispa Gressitt 1957, Promecotheca Blanchard 1853, Hispellinus Weise 1897. The following genera of Cassidinae are known from Australia (Seeno and Wilcox, 1982 and other references): Notosacantha Chevrolat 1837, Aspidimorpha Hope 1840, Cassida Linnaeus 1758, Thlaspidula Spaeth 1901, Meroscalsis Spaeth 1903, Emdenia Spaeth 1915, Austropsecadia Hincks 1950. For the Australian taxa, biological data and host plant information are presently only available for Aproida, Eurispa, Brontispa, Promecotheca, Hispellinus, Aspidimorpha, Cassida and Notosacantha. These aspects are summarised and discussed below.

184

Trevor J. Hawkeswood

HISPINAE Aproida Pascoe, 1863 Aproida balyi Pascoe (Fig. 1) Distribution: Australia (Queensland, New South Wales). Host-plants: Eustrephus latifolius Benth. and Hook. (Philesiaceae) (Monteith, 1970; Hawkeswood, 1987; Samuelson, 1989); Convallaria sp. (Convallariaceae) (Hawkeswood, 1987). Biology: Monteith (1970) first provided some brief notes on the biology of this species, noting that all of the life-stages are passed completely exposed on the host plant, including the pupa, which is rather peculiar among the Hispinae. The female lays one egg at a time in an ootheca on a leaf of the host plant; the larvae, as they grow older, resemble cherry slugs or other sawfly larvae (Hawkeswood, 1987; Jolivet and Hawkeswood, 1995). The pupa, which is suspended from the withered skin of the final instar, closely resembles the pendant flower buds of the host plant (Monteith, 1970; Hawkeswood, 1987, Jolivet and Hawkeswood, 1995). Further biological and behavioural details are provided by Hawkeswood (1987) who also provided the first published coloured photograph of the insect, and noted that the adults mimic certain grasshoppers or rainforest bugs. Tillyard (1926) had previously noted that the general appearance of this beetle was like that of a coreid bug. Life-stages: The larva, pupa and adult are illustrated by Monteith (1970). The adult is also illustrated by Pascoe (1863), Hawkeswood (1987), Samuelson (1989) and Lawrence and Britton (1994). Brief comments on the larval appearance are provided by Hawkeswood (1987), Jolivet and Hawkeswood (1995). Published Collection Records with Biological Data: Brookfield, Gold Creek, Brisbane, Queensland, 4 Sept. 1983, J. Conran, from Eustrephus leaves (Philesiaceae) (Samuelson, 1989); Springbrook Plateau,

Fig. 1. Aproida balyi Pascoe. Adult on the leaves/stems of the host plant Eustrephus latifolius (Philesiaceae) at Cunninghams Gap, south-eastern Queensland. (Photo: T. J. Hawkeswood, from Hawkeswood, 1987).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

185

Queensland, 24 Nov. 1982, J. Conran, laying eggs and feeding on the leaves of Eustrephus sp. (Philesiaceae) (Samuelson, 1989). Brontispa Sharp, 1903 Brontispa castanea Lea Distribution: Lord Howe Island. Host plant: Howea forsteriana (C. Moore and F. Muell.) Wendl. and Drude (Arecaceae) (Lea, 1926). Biology: Undescribed. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: Lord Howe Island, A.M. Lea (I.7628, holotype), from kentia palm (Howea forsteriana (C. Moore and F. Muell.) Wendl. and Drude (Arecaceae) (Lea, 1926). Eurispa Baly, 1856 Eurispa vittata Baly Distribution: Australia (Queensland, New South Wales, Victoria, Tasmania). Host-plants: Gahnia sp. (Cyperaceae) (Kershaw, 1906); “sedges” (Cyperaceae) (Froggatt, 1907; Tillyard, 1926; McKeown, 1942); Gahnia sieberiana Kunth. (Cyperaceae) (Hawkeswood, 1991; Hawkeswood and Takizawa, 1997). Biology: Kershaw (1906) noted that this species (cited as Euryspa) was collected from “common rushes” (presumably Gahnia sp., Cyperaceae) at Ferntree Gully, Victoria, while Froggatt (1907) briefly noted that the beetle (also cited as Euryspa) was associated with “sedges” (Cyperaceae) but did not elaborate on this record. Tillyard (1926) briefly noted that the genus Eurispa contained “numerous slender species” that were found on sedges (Cyperaceae). McKeown (1942) briefly noted that the species fed on sedges and often occurred in large numbers in swampy areas. Further details on the biology of this hispine have been provided by Hawkeswood (1991) and Hawkeswood and Takizawa (1997): adults and larvae of E. vittata are usually found in the tight spaces between the basal unfolded parts of the leaves of the native sedge plant, Gahnia sieberiana Kunth (Cyperaceae); during mating, adults are often located and exposed on unfolded leaves at or near the ends of the leaves at the tops of plants; young larvae are mostly found feeding on the newer, recently unfolded foliage in the centre of plants or amidst leaf bundles, at or near the tops of plants; they later crawl downwards towards the more tightly clustered leaves at the bases of the plants; wherever they feed, the larvae and adults chew extensive patches of mesophyll tissue between the parallel veins of the host plant leaves; these areas later become brownish in colour and are thus conspicuous on the plants; feeding by larvae and adults is usually extensive on several leaves per leaf bundle and occurs in one area for a period of time before they move to another area on the same leaf or an adjacent leaf; the mature larvae pupate at or near the base of the plant or leaf bundle between very tightly clustered leaf bases; adults are present concealed amongst the tight foliage for most of the year but numbers increase during the months of November to January but gradually decline again during February to April, reaching their lowest level during June and July; adults which remain through the coldest months are most likely overwintering and undergoing some kind of dormancy as they are sluggish when collected; larvae are usually not present during the winter but young larvae first appear on the

186

Trevor J. Hawkeswood

host plants during late October to early November; adults usually dropped to the ground or slid down the leaf blade towards the base of the plant if disturbed and were never observed taking or engaging in flight, even during hot, humid days. Further details on biology can be found in Hawkeswood and Takizawa (1997). Life-stages: The larva, pupa and adult are described by Hawkeswood and Takizawa (1997). Published Collection Records with Biological Data: 5 larvae, 3 pupae, 12 adults, Hastings Point, New South Wales, Nov.-Dec. 1995, T.J. Hawkeswood, from the foliage of Gahnia sieberiana Kunth (Cyperaceae) (Hawkeswood and Takizawa, 1997). Hispellinus Weise, 1897 Hispellinus multispinosus (Germar) Distribution: Australia (Queensland, New South Wales). Host-plants: “grasses” (Poaceae) (Froggatt, 1907; Tillyard, 1926; Hawkeswood, 1987, 1988). Biology: Froggatt (1907) briefly noted that this species (as Monochirus multispinosus) was common on grass blades in southern coastal New South Wales. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: 1, James Cook University campus, Townsville, Queensland, 29 Nov. 1981, T.J. Hawkeswood, amongst grass (Poaceae) (Hawkeswood, 1988); 2, Townsville, Queensland, 20 Dec. 1981, T.J. Hawkeswood, amongst grass (Hawkeswood, 1988). Promecotheca Blanchard, 1853 Promecotheca callosa Baly Distribution: Australia (Queensland,). Host-plant: “native palms” (Cocos nucifera?) (Arecaceae) (Froggatt, 1914). Biology: Froggatt (1914) briefly noted that this species (named by him as the Queensland Coconut Hispid) had been found on unidentified “native palms” in northern Australia and by the vernacular inferred that the species was also a feeder on coconut, although finally stated that “nothing has been recorded of the exact food-plant of this beetle.”. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: None available. Promecotheca varipes Baly Distribution: Australia (Northern Territory), Papua New Guinea. Host-plant: Pandanus sp. (Pandanaceae) (Froggatt, 1914). Biology: Froggatt (1914) briefly noted that this species (named by him as the Port Darwin Coconut Hispid) had been found on the foliage of an unidentified Pandanus sp. (Pandanaceae). [I am not certain why it should be called a coconut hispid when it occurs on Pandanus- Froggatt gives no indication of the coconut as a host in this paper]. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: None available.

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

187

CASSIDINAE Aspidimorpha Hope, 1840 Aspidomorpha deusta (Fabricius) (Fig. 2) Distribution: Australia (Queensland, Northern Territory), Malaysia, Indonesia, Papua New Guinea, Philippines. Host-plants: Ipomoea pes-caprae Roth. (Convolvulaceae) (Hawkeswood, 1987; 1988; Bach, 1998); Ipomoea batatas (L.) Lam. (Convolvulaceae) (Hawkeswood, 1988; Borowiec, 1992). Biology: Hawkeswood (1988) provided brief observations on the biology of this species in northeastern Queensland. This is one of the first insects described from Australia, the type being collected by Banks and Solander, presumably from the Endeavour River at Cooktown (Radford, 1981). They probably collected the species from I. pes-caprae which is widely and commonly distributed on north Queensland sand dunes. All life stages appear to be restricted to leaves of I. pes-caprae at Townsville, Tully and Port Douglas (Hawkeswood, 1988). Feeding by larvae and adults results in minor damage to leaves, often causing a shot-hole effect similar to that of the related species A. maculatissima Boheman on I. abrupta R. Br. (Hawkeswood, 1982). No other chrysomelids or other beetles appear to utilize the plant for food at Townsville. [However, Ipomoea pes-caprae is a common food plant of adult and larval Cassidinae on the beaches in the Pacific and Far-East (Jolivet and Hawkeswood, 1995)]. Further notes on the biology of this species and a colour illustration of the adult of A. deusta are provided in Hawkeswood (1987). [In Indonesia, where A. deusta also occurs, it has been recorded

Fig. 2. Aspidimorpha deusta (Fabricius). Adult and immature larva on the leaf of Ipomoea pes-caprae (Convolvulaceae) at Port Douglas, north-eastern Queensland. (Note. a tourist resort now covers the area where this beetle was photographed). (Photo: T. Helder, from Hawkeswood, 1987).

188

Trevor J. Hawkeswood

from Ipomoea carnea (Convolvulaceae) (Nakamura and Abbas, 1987, 1989: host plant cited as Ipomea; Noerdjito and Nakamura, 1999)]. Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: 11, between Pallarenda and Townsville, Queensland, 23 Jan. 1981, T.J. Hawkeswood (Hawkeswood, 1988); 2, Pallarenda, 30 Jan. 1981, T.J. Hawkeswood (Hawkeswood, 1988); 1, Pallarenda, 20 Feb.1981, T.J. Hawkeswood (Hawkeswood, 1988); 4, 1 km S of Port Douglas, 24 May 1981 T.J. Hawkeswood (Hawkeswood, 1988); 13, Brampston Beach near Tully, Queensland, 28 May 1981, T.J. Hawkeswood (Hawkeswood, 1988) [all specimens collected on leaves of Ipomoea pes-caprae Roth. (Convolvulaceae)]. Aspidomorpha interrupta (Fabricius) (Fig. 3) Distribution: Australia (Queensland, Northern Territory). Host-plants: Ipomoea triloba L. (Convolvulaceae) (Hawkeswood, 1988). Biology: A rare and poorly known species, which probably feeds on leaves of Ipomoea triloba at Townsville, although the early life stages have not been collected, while the behaviour and feeding biology are unknown. Adults are ready fliers, often alighting on vegetation, not regarded by the author as food plants, such as grasses (Poaceae) a common component of the Townsville vegetation (Hawkeswood, 1988). Evans (1985) reported A. interrupta on Glycine max L. (Fabaceae: Leguminosae) but this is not a food plant, only an incidental record (Hawkeswood, 1988).

Fig. 3. Aspidimorpha interrupta (Fabricius). Adult female on the leaf of Ipomoea triloba (Convolvulaceae) at Mt. Elliot, about 15 km south of Townsville, north eastern Queensland. (Photo: T. J. Hawkeswood, from Hawkeswood, 1988).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

189

Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1988). Published Collection Records with Biological Data: 1, Mt. Elliot, c. 15 km S of Townsville, Queensland, 11 May 1981, T. Helder, on Ipomoea triloba L. (Hawkeswood, 1988); 2, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood and P. Singh, amongst Panicum grass (Poaceae) (Hawkeswood, 1988); 1, Mt. Louisa, Townsville,13 Dec.1981, TJH & A. Taplin, amongst Themeda and Bothriochloa grass (Poaceae) (Hawkeswood, 1988). Aspidimorpha maculatissima Boheman (Fig. 4) Distribution: Australia (Queensland, Northern Territory). Host-plants: Ipomoea abrupta R.Br. (Convolvulaceae) (Hawkeswood, 1982, 1987, 1988); Ipomoea batatas (L.) Lam., I. velutina R. Br. (Convolvulaceae) (Hawkeswood, 1982, 1988). Biology: Hawkeswood (1982) provided detailed observations on the biology of this species. The oothecae are usually placed on the abaxial (lower) surface of mature, healthy leaves of the food plants (Hawkeswood, 1982). The larvae, when first hatched, feed together near the discarded ootheca and begin to radiate outwards after 1-1.5 days, feeding on epidermal and palisade mesophyll tissue; as the larvae grow older, they either disperse and feed on different leaves or may form small groups of up to five larvae on the one large leaf (Hawkeswood, 1982). Feeding by adults and larvae results in small holes being formed between the major veins. Hawkeswood (1982) found that despite such feeding, no leaves were killed by the larvae or adults and that defoliation did not occur. The amount

Fig. 4. Aspidimorpha maculatissima Boheman. Adult resting with legs and antennae retracted on leaf of the host plant, Ipomoea abrupta (Convolvulaceae) at Townsville, north-eastern Queensland. (Photo: T. Helder, from Hawkeswood, 1987).

190

Trevor J. Hawkeswood

of leaf material consumed was usually 5-10% of the total leaf area by the time individual larvae had pupated (no adults were found on leaves occupied by larvae) (Hawkeswood, 1982). Despite the presence of many other Ipomoea species in the Townsville area, A. maculatissima was only found on I. abrupta and at Herveys Range on I. velutina, but it appears that the species may occasionally feed on on sweet potato (I. batatas) (Hawkeswood, 1982). The duration of the life-stages is as follows: Eggs6-10 days to hatch after being laid; First instar larva- 4-5 days; Second instar larva- 3-5 days; Third instar-larva- 3-5 days; Fifth instar larva- 2-4 days; Pupae- 3-7 days; Adults- more than 5 days-3 weeks and possibly more (Hawkeswood, 1982). A species of Pediobius (Eulophidae: Hymenoptera) has been recorded as a pupal parasitoid (Hawkeswood, 1982). A brief summary of the biology of this species was provided by Hawkeswood (1987, 1988) from Hawkeswood (1982). Life-stages: The egg, larva and pupa have been described by Hawkeswood (1982). The adult and pupa have been illustrated in colour by Hawkeswood (1987). Published Collection Records with Biological Data: Gordonvale, Queensland, 22 Dec. 1930, (collector unknown), on sweet potato (Ipomoea batatas, Convolvulaceae) (Hawkeswood, 1982); James Cook University campus, Townsville, 8, 10 Feb., 22 April, 5 May 1981, T.J. Hawkeswood, from Ipomoea abrupta (Convolvulaceae) (Hawkeswood, 1982); Herveys Range, 35 km west of Townsville, Queensland, 18 April 1981, T.J. Hawkeswood, from Ipomoea velutina (Convolvulaceae) (Hawkeswood, 1982). Cassida Linnaeus, 1758 Cassida compuncta (Boheman) Distribution: Australia (Queensland, New South Wales). Host-plant: Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997). Biology: Feeding by both larvae and adults of this species occurs mostly on the underside of the leaves and results in small to medium-sized, irregular to rounded holes measuring 2-8 mm in diameter or large eaten-out areas; foliage is chewed so that most of the palisade mesophyll is consumed (Hawkeswood et al., 1997). Larvae are cryptically coloured in bright green and are very difficult to find amongst the tightly packed foliage at the tops of plants where twining is greatest; in one instance, many early to later instar larvae were observed resting or feeding on the upper surface of a number of leaves at the end of a branch section of the host plant where they were orientated parallel to the main leaflets and with their faecal shields held over the dorsum of the body, they were often difficult to find, as the green matched the colour of the leaflets and the narrow shield of cast skins resembled curled up necrotic leaf margins etc; in response to direct strong sunlight, the larvae will orientate their bodies in a direct line with the incidence of light, and place the row of cast skins over their bodies for protection, but if the heat is too intense, they will seek cover under the leaves; adults are particularly wary and will fly from the host plants during hot periods of the day if disturbed; during other times, they may simply drop from the plants to the ground below where they are usually indistinguishable amongst leaf litter and twig debris (Hawkeswood et al., 1997). The species has only been recorded from Ipomoea cairica but one adult has been found overwintering in the tightly clustered leaves of the sedge Gahnia erythrocarpa R.Br. (Cyperaceae) during August 1992 in northern New South Wales (LeBreton and Hawkeswood, 1993; Hawkeswood et al., 1997). Life-stages: The egg has not been described. The larva, pupa and adult have been described by Hawkeswood et al. (1997).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

191

Published Collection Records with Biological Data: 17 larvae, 7 pupae, Hastings Point, New South Wales, 15-18, 18-24 March 1997 (respectively), T.J. Hawkeswood, from leaves of Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997); 2 and 3 adults, Hastings Point, New South Wales, 28 Feb., 24 March 1997 (respectively), T.J. Hawkeswood, feeding and resting on the underside of leaves of Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997). Cassida diomma (Boisduval) (Fig. 5) Distribution: Australia (Queensland). Host-plants: Ipomoea sp. (Convolvulaceae) (Hawkeswood, 1987); Ipomoea triloba L., I. batatas (L.) Lam. (Convolvulaceae) (Hawkeswood, 1988). Biology: Although widespread, this species is apparently short-lived and the early life stages have not been collected; it is most likely that, with further examination of Ipomoea plants in the Townsville area, the eggs, larvae and pupae of C. diomma will be revealed (Hawkeswood, 1988, beetle cited as Metriona holmgreni). Adults appear to utilize I. triloba and I. batatas as food plants in the Townsville area, and are active fliers, often found alighting amongst grass or flying amongst weeds and other vegetation near the host plants. The specimens obtained from curled leaves of C. anacardioides were probably overwintering and did not utilize this plant for food (Hawkeswood, 1988). Hawkeswood (1987) previously mentioned that this species (cited as Metriona holmgreni) is often found on food plants in disturbed habitats recolonised by Ipomoea species. Adults are active in sunlight and fly readily if disturbed; the larvae are dark green and flat, with marginal spines- like adults, they chew small holes in the host plant leaves, without killing the leaves. Hawkeswood (1987) also mentioned

Fig. 5. Cassida diomma (Boisduval). Adult on leaf of an Ipomoea sp. (Convolvulaceae) at Brisbane, Queensland. (Photo: D. G. Knowles, from Hawkeswood, 1987).

192

Trevor J. Hawkeswood

that the species occurs in rainforests, vine forest and disturbed areas near rainforests. [Borowiec (1990) also recorded this species from Papua New Guinea where it was recorded from Ipomoea batatas (L.) Lam. (cited incorrectly as Ipomena batatas)]. Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: 12, Townsville Common, Queensland, 17 May 1981, T.J. Hawkeswood, on leaves of Ipomoea triloba (Linn.) (Convolvulaceae) (Hawkeswood, 1988); 2, Townsville Common, 15 Aug. 1981, T.J. Hawkeswood, in curled leaves of Cupaniopsis anacardioides (A. Rich.) Radlkf (Sapindaceae) (Hawkeswood, 1988), 6, Mt. Louisa, Townsville, 23 Oct. 1981, A. Taplin, on leaves of I. batatas (L.) Lam. (Hawkeswood, 1988); 3, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood, on leaves of Panicum sp. (Poaceae) (Hawkeswood, 1988); 3, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood & R Singh, on Panicum grass (Hawkeswood, 1988); 3, Pallarenda, 6 km N of Townsville, 30 Nov. 1981, T.J. Hawkeswood, flying around passionfruit vines, Passiflora foetida R. Br. (Passifloraceae) (Hawkeswood, 1988). Notosacantha Chevrolat, 1837 Notosacantha dorsalis (Waterhouse) (Fig. 6) Distribution: Australia (Queensland). Host-plant: Acacia crassa Pedley subsp. crassa (Mimosaceae) (Hawkeswood, 1987, 1989, 1994; Monteith, 1991).

Fig. 6. Notosacantha dorsalis (Waterhouse). Adults on a leaf the food plant Acacia crassa (Mimosaceae) in the Barakula State Forest., Queensland. Note the characteristic parallel feeding pattern of the adults which follow the venation of the leaves. (Photo: T. J. Hawkeswood, from Hawkeswood, 1987, 1989).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

193

Biology: Hawkeswood (1987, 1989) noted that this beetle (cited as Hoplionota dorsalis) is restricted to Eucalyptus-Callitris woodlands and Eucalyptus-Acacia dry sclerophyll forests of semi-arid Queensland where the adults feed during summer in a characteristic manner on the moderately broad, phyllodinous leaves of A. crassa subsp. crassa; the adults prefer feeding on young plants of A. crassa (0.5-1.2 m high) and this results in extensive grooves between the main longitudinal leaf veins which later darken to a brown colour (Hawkeswood, 1989). The beetles feed on the cutical, epidermal and mesophyll (chlorenchyma) and vascular tissues and they tend to remain on the host plants during the day and in the hotter afternoons, they tended to occupy sites on leaf surfaces facing away from the direct sunlight (Hawkeswood, 1989). Most feeding damage occurs on the adaxial (upper) surface of the leaves and feeding damage is not affected by the size of the phyllode since small leaves were consumed in similar fashion as larger leaves (Hawkeswood, 1989). Also feeding did not appear to result in the death of of any leaves or plants, i.e. no plants were defoliated. Hawkeswood (1987, 1989) also noted that N. dorsalis adults retract their legs and antennae when touched or disturbed and attach themselves strongly onto the leaf surface and that their colour pattern is undoubtedly associated with their behaviour pattern; the colour pattern matches in part the colour of the chewed areas on the phyllodes and when motionless, the adults resemble a necrotic leaf spot or a birddropping (see colour plate 157 in Hawkeswood, 1987 and Fig. 6. this paper). These are most probably procryptic adaptations against predation by birds (Hawkeswood, 1989, 1994). Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: None available. DISCUSSION Hispinae Aproida Pascoe, is a genus of three known species from the tropical and subtropical rainforests of Queensland and north-eastern New South Wales (Samuelson, 1989) but biological data are only available for the most common and widespread species, A. balyi Pascoe. The host plant, Eustrephus latifolius (Philesiaceae), is known as the Wombat Berry and is a glabrous, much-branched climber, often extending to several metres in length and is widespread in eastern Australia in moist communities especially on the margins of rainforest and coastal swamps. Aproida balyi is the only chrysomelid recorded as utilising this plant as a host (Jolivet and Hawkeswood, 1995). Only the leaves are consumed by the adults and larvae and even though flowering plants are inhabited, flowers are not consumed. The beetle may be common in some areas and absent in others. Samuelson (1989) commented on the fact that the genus Aproida was closely related to the genera of the Oriental Anisoderini but that further studies were required to tell whether there was any true relationship. Wurmli (1975) vaguely suggested that the adult Aproida facies were most similar to the Australian Eurispa but mentioned that the true affinities were unclear. Samuelson (1989) compared some of the adult head morphology of the two genera and even on these characters, his conclusions indicated very little similarity. The morphology, host plants, adult behaviour, larvae, pupae and eggs of Aproida are most unusual among the Hispinae and it is possible that a detailed study of all aspects of the life stages and biology of A. balyi and the other two known species of the genus would lead to placing these Coleoptera in a separate subfamily of the Chrysomelidae (although this group would be closer to Hispinae than to

194

Trevor J. Hawkeswood

Cassidinae) and to this end I will be researching this species in the future once suitable material again becomes available The striking mimicry of rainforest bugs or grasshoppers (Hawkeswood, 1987, Jolivet and Hawkeswood, 1995) is one of the most peculiar features of A. balyi. It could become evident that Aproida, an obviously archaic genus with little genetic plasticity, is at an evolutionary dead-end, having emerged/speciated in the Cretaceous (or soon after) and only managed to survive in the wet forests of eastern Australia after the drying out of the Australian continent during the Tertiary. Samuelson (1989) noted that the obvious great phylogenetic distance between Aproida and its closest (as yet unknown) relative and its geographical restriction suggest a long period of isolation and Gondwanian origins. Brontispa Sharp is a genus represented by many species throughout the Indian-Pacific region and especially in Papua New Guinea (e.g. Gressitt, 1960, 1963), although very few species are known from Australia and much less their biology. The only published host data for an Australian species appears to be the old record of Lea (1926) and nothing since has been published on the biology of the genus in Australia. It is apparent that both the species in question, B. castanea and its host plant, the kentia palm (Howea forsteriana), are both endemics to Lord Howe Island (situated about 1,000 km from the east coast of Australia and one of its Territories) and have co-evolved over a long period of time after being separated on the island from congeners probably originating from the northwest where Brontispa is better developed in terms of species numbers. However, even though the species has been restricted in time and space, B. castanea’s food selection is in keeping with that of the genus overall: Jolivet (1989) and Jolivet and Hawkeswood (1995) list over 25 genera of Arecaceae known to be utilised by Brontispa species, although as far as I am aware, Howea has not been recorded as a host for any other hispine or any other chrysomelid, although future detailed field work on Lord Howe Island may reveal further species of Coleoptera from Howea. Eurispa Baly is a small genus of about 6-8 species occurring in eastern Australia and southern Papua New Guinea. They appear to be associated with sedges such as Gahnia (Cyperaceae) (Jolivet, 1989; Jolivet and Hawkeswood, 1995) and reports from grasses (Poaceae) [(e.g. Monteith (1970) and Lawrence and Britton (1994)] appear to be erroneous (Hawkeswood and Takizawa 1997). Hawkeswood and Takizawa (1997) discussed the possible evolution, host-plant co-evolution and relationships of Eurispa. It seems probable that E. balyi is one of only a few species of Australian Hispinae which were able to colonise areas that became colder (and drier) during the evolution of the Australian landmass. Gressitt (1959) made the interesting observation that hispine beetles (at least species from the Oriental region) are less tolerant of cold than their host plants (Hawkeswood and Takizawa, 1997). This may explain why Hispinae are largely absent from the southern areas of Australia and Tasmania, i.e. these areas were already cold in the Tertiary when migration of ancestral Coleoptera from hotter, more tropical/equatorial regions occurred; these “warm” to “hot adapted” species failed to adapt to the colder regions, although E. balyi appears to be an exception (Hawkeswood and Takizawa, 1997). Hispellinus Weise is another widespread tropical and subtropical genus which is poorly represented in Australia. The host-plants are various taxa of grasses (Poaceae) (Jolivet, 1989; Jolivet and Hawkeswood, 1995). The most common, well-known and most readily collected Australian species, H. multispinosus, has been recorded a number of times from grasses (Poaceae) (Froggatt, 1907; Tillyard, 1926; Hawkeswood, 1987, 1988) but the identity of these grasses has never been determined, presumably because of their often inadequate taxonomy and their difficulty of being readily and accurately identified. H. multispinosus has also been collected from Papua New Guinea where it has been recorded from Imperata sp., Saccharum officinarum L. and Themeda sp. (Poaceae) (Gressitt, 1963).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

195

This host-selection is in keeping with other members of the genus which have been recorded from such grass genera as Saccharum, Zea, Miscanthus and Themeda (e.g. Gressitt, 1960, 1963; Takizawa, 1978; Jolivet and Hawkeswood, 1995). The greater diversity of Hispellinus species in the PapuaOriental area suggests that the genus originated there with a some incursions into Australia where few species have survived/evolved. The genus, like other Australian Hispinae (viz. Brontispa and Promecotheca), is badly in need of revision and further detailed biological studies. Promecotheca Blanchard is a moderately large, Asian and Indo-Australian genus (Seeno and Wilcox, 1982; Jolivet and Hawkeswood, 1995). Host-plants of various members of the genus include genera of Arecaceae, Flagellariaceae, Zingiberaceae, Poaceae, Heliconiaceae, Pandanaceae and Marantaceae (Jolivet, 1989; Jolivet and Hawkeswood, 1995). Arecaceae are among the most regularly utilised host plants, and like Hispellinus, the host selections of the two Australian species, P. callosa and P. varipes are in keeping with the trophic selections of extra-Australian species. Also, as with the case of Hispellinus in Australia, the greater species development of Promecotheca in the Papua-Oriental area suggests that the genus originated there with a some incursions into Australia where few species have survived/evolved and these are now restricted to hot, tropical northern Australia (Queensland and the Northern Territory). A lack of suitable host plants for evolving/colonising Hispinae cannot be proposed for the lack of speciation of Hispinae in Australia, because the main plant hosts of the subfamily in the Oriental region, i.e. Poaceae, Cyperaceae, Pandanaceae, Arecaceae and Araceae are well represented in the Australian flora (Hawkeswood and Takizawa, 1997). For instance, the family Zingiberaceae is well represented in Australian tropical and subtropical rainforests, but as yet (as far as I am aware), no Chrysomelidae have been collected from them, yet Alpinia, Elettaria and Zingiber are hosts to many Chrysomelidae (including Hispinae) in New Guinea and elsewhere (e.g. Gressitt, 1957, 1959, 1960, 1963, 1965; Gressitt and Kimoto, 1963; Kimoto et al., 1984; Schmitt, 1988; Hawkeswood and Samuelson, 1995; Jolivet and Hawkeswood, 1995). Likewise, the Pandanaceae is well represented in Australia, especially in the northern parts of the continent, but only one species of Hispinae, Promecotheca varipes Baly has been recorded from Pandanus in Australia (Froggatt, 1914; this paper see above). Pandanus is also well utilised by Chrysomelidae (especially Hispinae) in New Guinea, the Solomon Islands and other Pacific regions (e.g. Gressitt, 1957, 1960, 1963, 1965; Jolivet and Hawkeswood, 1995). Cassidinae Notosacantha dorsalis is the only species of Cassidinae known to feed on Acacia species (Mimosaceae). Jolivet and Hawkeswood (1995) noted that certain extra-Australian species of the genus have been known to feed on Areca (Arecaceae) in Asia and (accidentally?) on Phyllanthus sp. (Euphorbiaceae) in Vietnam. These records are not very conclusive nor extensive but it is most unlikely that these species of Notosacantha or others feed on Acacia as does the Australian N. dorsalis. As mentioned by Hawkeswood (1994), only one species of Notosacantha is known from Acacia and that the relationships of Australian Notosacantha with the Asian species are unclear. Notosacantha is poorly represented in Australia and as with Hispellinus, Brontispa and Promecotheca of the Hispinae, as well as Cassida and Aspidimorpha (see below), the native representatives appear to be derived from the Papua-Oriental region. As pointed out by Hawkeswood (1989), N. dorsalis appears to be a relictual cassidine closely related to Aspidimorpha (cited as Aspidomorpha) and that it was highly probable that the species originated from an ancestor of Aspidimorpha during the drying out of the central Australian landmass

196

Trevor J. Hawkeswood

during the Tertiary period. During my observations on N. dorsalis in the Barakula State Forest of Queensland (Hawkeswood, 1989), I did not find any evidence of eggs, larvae or pupae, although collecting at other times will undoubtedly locate them. The species was originally described from the Mackenzie River in semi-arid central Queensland (Waterhouse, 1877) from a similar habitat to that where my observations were undertaken. It is apparent that N. dorsalis is the only cassidine species known to inhabit Acacia in inland, semi-arid Queensland. Since the genus Notosacantha as a whole is tropical and subtropical in distribution, I believe N. dorsalis is a relict species from a time when the Australian continent was much wetter and with more luxuriant vegetation. The inland dried out during the Tertiary and later periods of geological time leaving this as a relictual species which was well adapted due to its secretive behavior and mimicry (at least in the adult stage) and predadpted for feeding on hard, sclerophyllous leaved Acacia species and extremes of climatic conditions (in all stages). [These semi-arid areas are extremely hot during summer- viz. 40°C and often freezing during winter, less that 0°C]. I agree with Monteith (1991) that a detailed morphological study of Notosacantha larvae and adults is required, but also aspects of their eggs, host-plants, defence mechanisms and behaviour need to be addressed. The genus appears to have many interesting behaviours and host plants. For instance, Medvedev and Eroskina (1988) studied the biology of Notosacantha siamensis Spaeth from south-east Asia and illustrated the larva which they found to be a leaf miner. Rane et al. (2000) described the life history of Notosacantha viscaria (Spaeth) which feeds on the mangrove Carallia brachiata (Rhizophoraceae). This is the only chrysomelid known to feed on this genus of plant (Hawkeswood and Jolivet, unpub. data). The genera Cassida and Aspidimorpha Hope (previously Aspidomorpha) utilise a large number of genera and families as host plants (Jolivet, 1988, Jolivet and Hawkeswood, 1995) although Aspidimorpha has a much narrower host selection (Jolivet and Hawkeswood, 1995). Ipomoea (Convolvulaceae) is a predominant host plant genus for both Cassida and Aspidimorpha (Jolivet and Hawkeswood, 1995) and this trend is evident in the Australian species for which the host -plants are known. All of the Australian species of Cassida and Aspidimorpha where biological details are known (see above) have only been recorded from Ipomoea and no other hosts. As with the various genera of Australian Hispinae noted above, Cassidinae and Aspidimorpha are poorly represented in the Australian fauna. Like the world Hispinae in general, Cassida and Aspidimorpha are mostly tropical and their poor species development in Australia would appear not to have resulted from a paucity of food-plants, but the effects of cooling (and drying) of the southern Australian landmass during various times during the Tertiary and during more recent periods such as the Pleistocene. The present concentration of species of Australian Hispinae and Cassidinae in the northern tropical and subtropical regions (Western Australia, Northern Territory and Queensland) indicates support for this suggestion although the real situation may have been more complicated than this scenario. CONCLUSIONS Compared to other tropical regions of the world the Australian representation of Hispinae and Cassidinae appears to be rather depauperate. In addition., biological information on most species is lacking and most of the genera need revision. Further detailed studies on some of the groups viz. Aproida and Notosacantha will undoubtedly and significantly add to the meagre knowledge already existing and clarify aspects of evolution and host-plant selection. It appears likely that the Hispinae and Cassidinae of Australia have been derived from at least two sources (a) Gondwanaland (e.g. Aproida, Eurispa) and (b) later invasion from the Papuan-Oriental area (Brontispa, Hispellinus,

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

197

Promecotheca, Aspidimorpha, Cassida, Notosacantha) but very few species were apparently able to survive the climatic changes of the Australian continent in post-Tertiary times. However, much remains to be learned of the evolutionary relationships of these groups to each other and to other species/ genera in the Pacific and elsewhere and further studies should shed more light on the reasons why Australia, despite the development of suitable host plants and tropical/sub-tropical habitats is so depauperate in species of these two subfamilies. ACKNOWLEDGEMENTS I would like to thank the indomitable Professor Pierre H. Jolivet for assistance and encouragement over two decades. I dedicate this paper to him, a truthful, great biologist, an accurate inquirer and documenter of the extremely complicated natural world. LITERATURE CITED Bach, C. 1998. Seedling survivorship of the beach morning glory, Ipomoea pes-caprae (Convolvulaceae). Australian Journal of Botany 46:123-133. Borowiec, L. 1990. A review of the genus Cassida L. of the Australian Region and Papuan Subregion (Coleoptera: Chrysomelidae: Cassidinae). Genus 1:1-51. Borowiec, L. 1992. A review of the tribe Aspidomorphini of the Australian Region and Papuan Subregion (Coleoptera: Chrysomelidae: Cassidinae). Genus 3:121-184. Evans, M. L. 1985. Arthropod species in soybeans in southeast Queensland. Journal of the Australian Entomological Society 24:169-177. Froggatt, W. W. 1907. Australian Insects. William Brooks & Co., Sydney. pp. 449. Froggatt, W. W. 1914. Australasian Hispidae (sic) of the genera Bronthispa (sic) and Promecotheca which destroy coconut palm fronds. Bulletin of Entomological Research 5:149-152. Gressitt, J. L. 1957. Hispine beetles from the South Pacific (Coleoptera: Chrysomelidae). Nova Guinea 8:205324 + plate XV. Gressitt, J. L. 1959. Host relations and distribution of New Guinea hispine beetles. Proceedings of the Hawaiian Entomological Society 17:70-75. Gressitt, J. L. 1960. Papuan-West Polynesian Hispine beetles (Chrysomelidae). Pacific Insects 2:1-90. Gressitt, J. L. 1963. Hispine beetles (Chrysomelidae) from New Guinea. Pacific Insects 5:591-714. Gressitt, J. L. 1965. Chrysomelid beetles from the Papuan subregion. I. (Sagrinae, Zeugophorinae, Criocerinae). Pacific Insects 7:131-189. Gressitt, J. L. and S. Kimoto 1963. The Chrysomelidae (Coleoptera) of China and Korea. Pacific Insects Monographs 1B:301-1026. Hawkeswood, T. J. 1982. Notes on the life history of Aspidomorpha maculatissima Boheman (Coleoptera: Chrysomelidae: Cassidinae) at Townsville, north Queensland. Victorian Naturalist 99:92-101. Hawkeswood, T. J. 1987. Beetles of Australia. Angus and Robertson Publishers, Sydney. 248 pp. Hawkeswood, T. J. 1988. A survey of the leaf beetles (Coleoptera: Chrysomelidae) from the Townsville district, northern Queensland, Australia. Giornale Italiano di Entomologia 4:93-112. Hawkeswood, T. J. 1989. Studien zu Biologie und Verhalten des australischen Schildkäfers Hoplionota dorsalis Waterhouse (Coleoptera: Chrysomelidae). Entomologische Zeitschrift 99:346-349. Hawkeswood, T. J. 1991. Some preliminary notes on the biology and host plant of Eurispa vittata Baly (Coleoptera: Chrysomelidae) from north-eastern New South Wales. Victorian Entomologist 21:132-134.

198

Trevor J. Hawkeswood

Hawkeswood, T. J. 1994. Review of the biology and host plants of Australian Chrysomelidae (Coleoptera) associated with Acacia (Mimosaceae), Chapter 12, pp. 191-204. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Hawkeswood, T. J. and G. A. Samuelson 1995. Notes on some leaf beetles from the Passam area, East Sepik Province, and Port Moresby area, Central Province, Papua New Guinea (Insecta, Coleoptera, Chrysomelidae). Spixiana 18:165-176 Hawkeswood, T. J. and H. Takizawa 1997. Taxonomy, ecology and descriptions of the larva, pupa and adult of the Australian hispine beetle, Eurispa vittata Baly (Insecta, Coleoptera, Chrysomelidae). Spixiana 20:245-253. Hawkeswood, T. J., H. Takizawa and P. H. Jolivet 1997. Observations on the biology and host plants of the Australian tortoise beetle, Cassida compuncta (Boheman), with a description of the larva, pupa and adult (Insecta: Coleoptera: Chrysomelidae). Mauritiana 16:333-339. Jolivet, P. 1988. Sélection trophique chez les Cassidinae (Col. Chrysomelidae). Bulletin de la Societe Linnéenne de Lyon 57:301-320. Jolivet, P. 1989. Sélection trophique chez les Hispinae (Coleoptera Chrysomelidae Cryptostoma). Bulletin de la Societe Linnéenne de Lyon 58:297-317. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the World. An essay about the relationships between the leaf-beetles and their food-plants. Backhuys Publishers, Leiden, The Netherlands. 281 pp. Kershaw, J. A. 1906. Excursion to Upper Ferntree Gully. Victorian Naturalist 22:148-151. Kimoto, S., J. Ismay and G. A. Samuelson 1984. Distribution of chrysomelid pests associated with certain agricultural plants in Papua New Guinea (Coleoptera). Esakia 21:49-57. Lawrence, J. F. and E. B. Britton 1994. Australian Beetles. Melbourne University Press, Carlton, Victoria. 192 pp. Lea, A. M. 1926. Notes on some miscellaneous Coleoptera with descriptions of new species. Part VI. Transactions of the Royal Society of South Australia 50:45-84. LeBreton, M. and T. J. Hawkeswood 1993. Notes on some Coleoptera collected from the foliage of Gahnia erythrocarpa R. Br. (Cyperaceae) in north-eastern New South Wales. Sydney Basin Naturalist 2:35-36. McKeown, K.C. 1942. Australian Insects. An Introductory Handbook. Royal Zoological Society of New South Wales, Sydney. 304 pp. Medvedev, L. N. and G. A. Eroskina 1988. Place of the genus Notosacantha in the system of Chrysomelidae and relationships between the subfamilies Hispinae and Cassidinae. Zoologischekii Zhurnal Mosckva 67:698704. (In Russian) (Not seen). Monteith, G. B. 1970. Miscellaneous Insect Notes. Life history of the chrysomelid, Aproidea (sic) balyi Pascoe. News Bulletin of the Entomological Society of Queensland 72:9-10. Monteith, G. B. 1991. Corrections to published information on Johannica gemellata (Westwood) and other Chrysomelidae (Coleoptera). Victorian Entomologist 21:147-154. Nakamura, K. and I. Abbas 1987. Preliminary life-table of the spotted tortoise beetle, Aspidomorpha miliaris (Col., Chrysomelidae) in Sumatra. Researches in Population Ecology 29:229-236. Nakamura, K. and I. Abbas 1989. Seasonal change in abundance and egg mortality of two tortoise beetles under a humid equatorial climate in Sumatra (Coleoptera, Chrysomelidae, Cassidinae). Entomography 6:487-495. Noerdjito, W. A. and K. Nakamura 1999. Population dynamics of two species of tortoise beetles, Aspidomorpha miliaris and A. sanctaecrucis (Coleoptera: Chrysomelidae: Cassidinae) in East Java, Indonesia. 1. Seasonal changes in population size and longevity of adult beetles. Tropics 8:409-425.

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

199

Pascoe, F. P. 1863. Notices of new or little-known genera and species of Coleoptera. Part IV. Journal of Entomology 2:26-56. Radford, W. P. K. 1981. The Fabrician types of the Australian and New Zealand Coleoptera in the Banks Collection at the British Museum (Natural History). Records of the South Australian Museum 18:155-197. Rane, N., S. Ranade and H. V. Ghate 2000. Some observations on the biology of Notasacantha vicaria (Spaeth) (Coleoptera: Chrysomelidae: Cassdidinae). Genus 11:197-204. Samuelson, G. A. 1989. A review of the hispine tribe Aproidini (Coleoptera: Chrysomelidae). Memoirs of the Queensland Museum 27:599-604. Schmitt, M. 1988. The Criocerinae: biology, phylogeny and evolution, Chapter 28, pp. 475-495. In: P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Seeno, T. N. and J. A. Wilcox 1982. Leaf beetle genera (Coleoptera: Chrysomelidae). Entomography 1:1-221. Takizawa, H. 1978. Notes on Taiwanese chrysomelid-beetles, 2. Kontyu 46:596-602. Tillyard, R. J. 1926. The Insects of Australia and New Zealand. Angus and Robertson, Sydney. 660 pp. + xvi. Waterhouse, C. O. 1877. New Coleopterous insects from Queensland. Annals of the Magazine of Natural History 4(19):423-425. Wurmli, M. 1975. Gattungmonographie der altweltlichen Hispinen (Coleoptera: Chrysomelidae: Hispinae). Entomologische Arbeiten Museum G. Frey 26:1-83. (Not seen, cited from Samuelson, 1989).

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT PublishersPerformance and Food Preference of Botanochara Impressa (Panzer) ... Beetle Biology 201 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 201-208

Performance and Food Preference of Botanochara impressa (Panzer) (Chrysomelidae, Cassidinae): A Laboratory Comparison Among Four Species of Ipomoea (Convolvulaceae) Solange Maria Kerpel1 and Lenice Medeiros2 1

Programa de Pós-Graduação em Ecologia, Universidade Federal do Rio Grande do Sul (UFRGS). Porto Alegre, 91501-970, RS, Brazil. Email: [email protected]. 2 Depto de Biologia e Química, CP 560, Universidade Regional do Noroeste do Estado do Rio Grande do Sul (UNIJUI). Ijuí, 98700-000, RS, Brazil. Email: [email protected].

ABSTRACT Botanochara impressa (Panzer) is a Neotropical cassidine that feeds on leaves and flowers of members of the Convovulaceae, mainly in the genus Ipomoea. In Ijuí County, Rio Grande do Sul State, Brazil, both larvae and adults feed on leaves of I. aristolochiaefolia and I. batatas (L.) Lam. Larvae and adults were reared on four sympatric species of Ipomoea; I. aristolochiaefolia, I. batatas, I. longicuspis, and I. cairica (L.) Sweet to determine the food plant influence on their survival, development time, fecundity, and egg viability. Larval and adult host-plant preference was determined in a choice trial, offering simultaneously leaf discs of the four Ipomoea species. No larvae or adults developed on I. cairica. The survival rate was greater for larvae reared on I. batatas, but the development time did not differ among the three host plants. Adult longevity and fecundity did not differ among the three Ipomoea hosts. A greater percentage of eggs on I. longicuspis were viable than on the other two hosts. Both larvae and adults rejected I. cairica. Adults did not show preference for any of the three species of Ipomoea while larvae preferred I. aristolochiaefolia. The possible mechanisms involved with the observed patterns are discussed. KEY WORDS: host-plant selection, preference, Botanochara impressa, Chrysomelidae, Cassidinae, Ipomoea

RESUMO Botanochara impressa (Panzer) é um cassidíneo Neotropical que se alimenta de flores e folhas dos membros de Convovulaceae, sobretudo do gênero Ipomoea. No município de Ijuí, estado do Rio Grande do Sul, Brasil, as larvas e os adultos se alimentam de folhas de I. aristolochiaefolia e I. batatas (L.) Lam. Larvas e adultos foram criados em quatro espécies simpátricas de Ipomoea; I. aristolochiaefolia, I. batatas, I. longicuspis e I. cairica (L.) Sweet, a fim de determinar a influência das plantas hospedeiras na sobrevivência, tempo de desenvolvimento, fecundidade e viabilidade dos ovos. A preferência alimentar de larvas e adultos foi verificada em um experimento de escolha, oferecendo-se, simultaneamente, discos foliares das quatro espécies de Ipomoea. Nenhuma larva ou adulto se

202

Solange Maria Kerpel & Lenice Medeiros

desenvolveu em I. cairica. A taxa de sobrevivência foi maior para as larvas criadas em I. batatas, mas o tempo de desenvolvimento não diferiu entre as três plantas hospedeiras. A longevidade e fecundidade dos adultos não diferiram entre as três espécies de Ipomoea. A maior viabilidade dos ovos foi encontrada naqueles depositados por fêmeas alimentadas com I. longicuspis. As larvas e adultos rejeitaram I. cairica. Os adultos não apresentaram preferência por qualquer Ipomoea, enquanto as larvas preferiram I. aristolochiaefolia. Os possíveis mecanismos envolvidos com os padrões observados são discutidos. INTRODUCTION Food utilization by any herbivore is not an indiscriminate event. On the contrary, there is often a strong correspondence between plant and animal taxa, suggesting the occurrence of coevolution between the herbivores and their hosts (Ehrlich and Raven, 1964; Cates, 1980; Futuyma et al., 1993). The selection of food by insects involves complex behavioral mechanisms (Dethier, 1980, 1982; Feeny et al., 1983) and, although the host represents a nutritional resource, nutritionally adequate plants are not always selected and vice-versa (Hanson, 1983; Thompson, 1988; Denno et al., 1991). The cassidine beetles tend to be highly specialized in their feeding habits. In general, both larvae and adults feed in a limited group of plants and in some cases on a single host (Buzzi, 1988, 1994; Jolivet, 1988; Jolivet and Hawkeswood, 1995). Buzzi (1994) listed 170 Neotropical cassidine species and their hosts, pointing that near 50% are strictly monophagous, and 24.1% live on only two plant species. Although the Cassidinae represents an important group for experimental studies on the evolution and maintenance of insect-plant interactions, there are still relatively few studies available for most species. Botanochara impressa (Panzer) is abundant in the Neotropics, and is found in Argentina, Bolivia, Brazil, Paraguay, and Peru feeding on leaves and flowers of several species of Convovulaceae, mainly on genus Ipomoea Linn. (Borowiec, 1996; Buzzi, 1988, 1994; Habib and Vasconcellos-Neto, 1979). Habib and Vasconcellos-Neto (1979) studied some biological aspects of B. impressa in Campinas, SP, Brazil. In that locality larvae and adults feed on leaves of I. acuminata (Vahl) Roem. & Schult. and I. purpurea (L.) Roth, which grow in cotton fields. The authors suggest that B. impressa should be evaluated as a biological agent to control Ipomoea weeds. Indeed, due to their food specialization some Cassidinae have been investigated as potential agents for the biological control against weedy plants in some world regions (Hill and Hulley, 1995, 1996; Olckers and Zimmermann, 1991; Siebert, 1975). In Ijuí County, Rio Grande do Sul State, Brazil, both larvae and adults feed on leaves of I. aristolochiaefolia G. Don. and I. batatas (L.) Lam., whose tubers are used in human diet and are economically important. In this region, B. impressa is found in field from mid December to the end of April, the populations peak is in February (Kerpel and Medeiros, unpublished). The aim of this study was to use laboratory trials to compare performance and food preferences of B. impressa on four species of Ipomoea, which naturally occurs in disturbed places, such as highway borders, fallow lands, and in soybean and maize fields in Ijuí, RS, Brazil. MATERIALS AND METHODS Larvae and adults of B. impressa were collected in spring and summer of 1996 and 1997, from naturally occurring Ipomoae batatas, and kept in an environmental chamber (25 ± 1°C; 14:10 L:D; ca.

Performance and Food Preference of Botanochara Impressa (Panzer) ...

203

70% relative humidity), at the Zoology Department of University of Northwest of Rio Grande do Sul State (UNIJUI), Ijuí, RS, Brazil. The plants used to feed the insects were grown from seedlings and tubers of I. aristolochiaefolia and I. batatas, respectively. The leaves of I. longicuspis Meissn. and I. cairica (L.) Sweet were taken from field plants. The leaves used to feed insects were always freshly picked. To determine the larval survival and development time on the four Ipomoea species, eggs were collected from females that were kept on potted plants of I. batatas. Four groups of 100 eggs were transferred to plastic Gerboxes (11.5 cm sides X 3.5 cm high) covered with moistened filter paper, and containing fresh leaves of one of each host plant, I. batatas, I. aristolochiaefolia, I. longicuspis or I. cairica. The food was changed daily, and the life stage of the beetles were noted, until their death or adult emergence. Larval survivorship curves were compared with logrank tests (a = 0.05) (Motulsky, 1999). The development time on each host plant was compared by ANOVA followed by Tukey’s tests (a = 0.05). Just after adult emergence, ten pairs were isolated and maintained in plastic Gerboxes containing leaves of the same host plant on which the male and female developed. The lifespan, fecundity and egg viability were determined for each pair. The results on longevity were compared through nonparametric tests (Kruskal-Wallis) because the variances were not equal (Zar, 1996). Fecundity was compared by ANOVA followed by Tukey’s tests (a = 0.05). Egg viability was determined based on the percent of hatched eggs related to total deposited. Percentages hatched on each specie of Ipomoea were compared with Chi-square tests ((a = 0.05). The choice trials were conducted with first instar larvae from eggs deposited by females reared in I. batatas, I. aristolochiaefolia or I. longicuspis (n=20 per host plant). Immediately after hatching, larvae were placed in petri dishes (5.6 cm of diameter) that were lined with moistened paper filter. Four discs (area=113 mm2 per disc) perforated from fresh leaves of each host plants were placed in alternate and equidistant positions, following specific and variable combinations to avoid any position effect (Singer, 1986). The larvae were placed in the center of the dishes and kept in an environmental chamber (conditions as described above) for 24 hours. The same procedure was used for the adults, but each adult was offered eight leaf discs, two of each host plant. The consumed area of each leaf disc was determined based on the overlapping of these on graph paper and counting the number of missing squares. The leaf area consumed was compared through the nonparametric Kruskal-Wallis tests, since residuals did not follow the normal distribution (Zar, 1996). RESULTS The larvae of B. impressa fed I. batatas leaves had significantly higher survival, compared to those fed I. aristolochiaefolia and I. longicuspis. When fed I. cairica, all larvae died while in the first instar, although some individuals survived for eight days (Figure 1). Larval developmental time did not differ among the other three species of Ipomoea. Adult longevity and fecundity, expressed as mean egg number per female during their life, also did not vary in relation to host-plants species. Egg viability varied depending on the maternal host plant and was greater for those fed I. longicuspis followed by those fed I. batatas and I. aristolochiaefolia (Table 1). The results of the choice tests confirm that both larvae and adults do not feed on I. cairica. The adults did not show preference for any species of Ipomoea, as the area consumed did not significantly differ among the three Ipomoea that were not rejected. On average, larvae consumed significantly more I. aristolochiaefolia than I. longicuspis and I. batatas (Table 2).

204

Solange Maria Kerpel & Lenice Medeiros

I. batatas

I.aristolochiaefolia

I. longicuspis

I. cairica

100

Survivors (%)

80 a

60 b

40

b

20 c

0 0

5

10

15

20

25

30

Time (days) Fig. 1. Survival curves of Botanochara impressa (n=100) from hatching to adult emergence, fed on one of four Ipomoea species. Lines followed by the same letters do not significantly differ (Logrank tests; α = 0.05). Table 1. Performance components of Botanochara impressa larvae and adult fed three Ipomoea species. Host-plant

Mean (± SE) larval Mean (± SE) adult Mean (± SE) egg Egg viability development time (days)1 longevity, in days (n=60)2 number (per 9 females)1 (%)3

I. aristolochiaefolia 25.5 ± 1.18a(n=24) I. batatas 26.8 ± 1.15a(n=33) I. longicuspis 24.8 ± 0.96a(n=34)

142.8 ± 23.88a 136.7 ± 20.31a 118.7 ± 12.57a

798.1 ± 266.4a 1093 ± 186.5a 617.2 ± 133.1a

48.8c 53.9b 68.7a

Means followed by different letters significantly differ (ANOVA followed by Tukey´s tets; α = 0.05). Means followed by different letters significantly differ (Kruskal-Wallis tests; α = 0.05). 3 Percent followed by different letters significantly differ (Chi-aquare tests; α = 0.05). 1

2

Table 2. Mean (± SE) leaf area consumed by Botanochara impressa larvae (n=60) and adults (n=49) under a choice test with four Ipomoea species. Plant species I. aristolochiaefolia I. batatas I. cairica I. longicuspis

Leaf area (mm2) consumed by larvae

Leaf area (mm2) consumed by adults

4.267 ± 0.599a 0.767 ± 0.288b 0 1.208 ± 0.373c

72.39 ± 13.98a 39.67 ± 10.26a 0.20 ± 0.2b 33.59 ± 8.77a

Means followed by different letters significantly differ (Kruskal-Wallis tests; α = 0.05).

Performance and Food Preference of Botanochara Impressa (Panzer) ...

205

DISCUSSION Throughout its geographical range, B. impressa feeds on several Ipomoea species (Buzzi, 1994, 1996; Habib and Vasconcellos-Neto, 1979). At Ijuí County, I. aristolochiaefolia, I. batatas, I. longicuspis and I. cairica are very common and occur together at the same localities. Frequently their branches are intertwined, but B. impressa is never found feeding on I. longicuspis and I. cairica in the field. Under laboratory conditions both larvae and adults did not accept I. cairica. In fact, all larvae died due to starvation when reared with this plant, as they did not ingest the plant. Also, no larvae choose I. cairica during the choice tests, and only one adult did. The mechanisms involved in host plant selection by herbivore insects have been widely studied and several factors are thought to mediate host choice (e.g. Cates, 1980; Dethier, 1982; Feeny et al., 1983; Hanson, 1983; Jaenike, 1990; Jones, 1991; Rausher, 1992; Bernays and Chapman, 1994). The acceptance of a host plant by herbivores is mediated by two major kinds of mechanisms: pre- and post- ingestives (Scriber and Slansky, 1981). The pre-ingestive mechanisms are related to plant attributes associated with the herbivore’s capability of initial consumption, and include characteristics such as leaf toughness, density of trichomes, types and concentration of volatile allelochemicals (Dethier, 1980, 1982; Scriber and Slansky, 1981). Considering that in this study both larvae and adults of B. impressa rejected I. cairica it is possible that this plant presents some chemical and/or mechanical restrictions that impairs its use by this beetle. Although B. impressa do not feed on I. longicuspis under natural conditions, this plant was suitable to larval development and adult survival in the laboratory. In addition, the viability of the eggs deposited by females fed with this plant was greater than those deposited by females reared on their natural host plants. The incorporation of new host plants in herbivores’ diet must be favored by similar chemical properties among food plants (Erhlich and Raven, 1964). In this sense it is probable that I. longicuspis presents chemical similarities (nutritional and allelochemicals) to the natural B. impressa host plants, I. batatas and I. aristolochiaefolia. This idea is reinforced by the fact that other cassidine species are found utilizing these three Ipomoea as food in Ijuí (Kerpel and Medeiros, 1996). The greater egg viability from females that were reared on I. longicuspis indicates that in addition to being a suitable host, this plant may provide nutritional contents that are better assimilated by females. The question that arises is why I. longicuspis is not used by B. impressa under natural conditions. The best host plants in laboratory may not be the best in the field, considering that larvae on this host can be prone to natural enemies attacks, and also to competition (Bernays and Graham, 1988). The larvae of cassidine usually carry a shield formed from old exuviae and/or feces behind their back, which provide protection from predators (Eisner, 1967; Olmstead and Deeno, 1993; Olmstead, 1994). It has been shown that host-plants metabolites can be incorporated into cassidine larval shields (Morton and Vencl, 1998). Muller and Hilker (1999) showed that plant derived volatiles from fecal shields of Cassida spp vary depending on host chemical composition and, in some cases, attract generalist predators. So, it is possible that larvae can be better protected on some hosts than on others, which could help explain why plants that are suitable to survival and development on laboratory are not used under natural conditions. Also, field variation in plant abundance and/or nutritional quality may affect its use as a host, although this cannot be easily incorporated into laboratory trials (Nylin and Janz, 1996). For cassidine beetles, the host plant of larvae and adults is usually the same and one could expect a similar food-plant effect on both. However, for B. impressa there was not a tight correspondence between larval and adult preference and performance. The adults consumed more I. aristolochiaefolia

206

Solange Maria Kerpel & Lenice Medeiros

than the other Ipomoea, but the differences were not significant, indicating no preference for any host. It is probably because the three Ipomoea confers similar longevity and fecundity. On the other hand, I. batatas provided the higher larval survival rate, but I. aristolochiaefolia was preferred on the choice tests. The lack of correspondence between the preferred plants and those that provides better performance is not unusual. In fact, it has been demonstrated that for some species of insect the females prefer hosts that do not confer the best larval performance (Deeno et al., 1990; Thompson, 1988; 1996). We believe that B. impressa larvae preferred I. aristolochiaefolia due to its leaf anatomical properties. Additional observations (Kerpel and Medeiros, unpublished) showed that this plant presents smoother leaves with very low trichome density compared to I. batatas and I. longicuspis. For newly hatched larvae these leaf characteristics may facilitate and or not impair feeding activity, although this plant does not confer the best performance. Additional observations and experiments are necessary to better explain this apparent contradiction. ACKNOWLEDGEMENTS The authors thank the colleagues Thiago K. dos Santos and Candice G. Spies for helping on laboratory tests and rearing. We also are grateful to David Furth who encouraged us to write this manuscript, and to Karen Olmstead for useful comments that improved the manuscript. Financial support granted to Solange M. Kerpel came from a CNPq scholarship (PIBIC). LITERATURE CITED Bernays, E. A. and M. Graham. 1988. On the evolution of host specificity in phytophagous arthropods. Ecology 69:886-892. Borowiec, L. 1996. Faunistic records of Neotropical Cassidinae (Coleoptera: Chrysomelidae). Pol. J. Entomol. 65:119-251. Buzzi, Z. 1988. Biology of Neotropical Cassidinae, pp. 559-580. In: P. Jolivet; E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, Buzzi, Z. 1994. Host plants of Neotropical Cassidinae, pp. 205-212. In: P. Jolivet; M. L. Cox, E. Petitpierre and T. H. Hsiao (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Cates, R.G. 1980. Feeding patterns of monophagous, oligophagous and polyphagous herbivores: the effect of resource abundance and plant chemistry. Oecologia 46:22-31. Deeno, R. F., S. Larsson and K. L. Olmstead. 1990. Role of enemy-free space and plant quality in host-plant selection by willow beetles. Ecology 71(1):124-137. Eisner, T., E. V. Tassel and J. E. Carrel. 1967. Defensive use of a “fecal shield” by a beetle larva. Science 158:1471-1473. Dethier, V. G. 1980. Evolution of receptor sensitivity to secondary plant substances with special reference to deterrents. Am. Natur. 115: 45-66. Dethier, V. G.1982. Mechanism of host-plant recognition. Entomol. Exp. Appl. 31:49-56. Ehrlich, P. R. and P.H. Raven. 1964. Butterflies and plants: A study in coevolution. Evolution 18:586-608. Feeny, P., L. Rosenberry and M. Carter. 1983. Chemical aspects of oviposition behavior in butterflies, pp. 2776. In: S. Ahmad (Ed.), Herbivorous insects: Host seeking behavior and mechanisms. New York, Academic Press.

Performance and Food Preference of Botanochara Impressa (Panzer) ...

207

Futuyma, D. J., M. C. Keese and S. J. Scheffer. 1993. Genetic constraints and the phylogeny of insect-plant associations: responses of Ophraella communa (Coleoptera: Chrysomelidae) to host plants of its congeners. Evolution 47:888-905. Habib, M. E. M. and J. Vascocellos-Neto. 1979. Biological studies of Botanochara impressa Panzer, 1789 (Coleoptera: Chrysomelidae). Rev. Biol. Trop. 27(1):103-110. Hanson, F. E. 1983. The behavioral and neurophysiological basis of food plant selection by lepidopterous larvae, pp. 3-23. In: S. Ahmad (Ed.), Herbivorous insects: Host seeking behavior and mechanisms. Academic Press, New York. Hill, M. P. and P. E. Hulley. 1995. Biology and host range of Gratiana spadicea (Klug, 1829) (Coleoptera: Chrysomelidae: Cassidinae), a potential biological control agent for the weed Solanum sisymbriifolium Lamarck (Solanaceae) in South Africa. Biol. Control 5:345-352. Hill, M. P. and P. E. Hulley. 1996. Suitability of Metriona elatior (Klug) (Coleoptera: Chrysomelidae: Cassidinae) as a biological control agent for Solanum sisymbriifolium Lamarck (Solanaceae). African Entomol. 4:117-123. Jaenike, J. 1990 Host specialization in phytophagous insects. Ann. Rev. Ecol. Syst. 21:243-273. Jolivet, P. 1988. Food habits and food selection of Chrysomelidae: bionomic and evolutionary perspectives, pp. 1-20. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Jolivet, P. and T. J. Hawkeswood. 1995. Host-plants of Chrysomelidae beetles of the world: an essay about the relationships between leaf beetles and their food-plants. Leiden, Backhuys Publishers, 281 pp. Jones, R. E. 1991. Host location and oviposition on plants, p. 108-137. In: W. J. Bailey and J. Heidsdill-Smith (Eds.), Reproductive behavior of insects: Individuals and populations. New York, Chapman and Hall. Kerpel, S. M. and L. Medeiros 1996. Ciclo evolutivo de Botanochara impressa (Panzer, 1798) (Coleoptera, Chrysomelidae, Cassidinae) em quatro espécies de Convovulaceae. In: III Congresso de Ecologia do Brasil, 1996, Brasília, DF, Brasil. Resumos, v. 1:355. Muller, C. and M. Hilker. 1999. Unexpected reactions of a generalist predator towards defensive devices of cassidine larvae (Coleoptera, Chrysomelidae). Oecologia 118:166-172. Morton, T. C. and F. V. Vencl. 1998. Larval beetle form a defense from recycled host-plant chemicals discharged as fecal wastes. J. Chem. Ecol. 24:765-785. Motulsky, H. 1999. Analyzing data with graph pad prism software. Graph Pad Software, San Diego. Nylin, S. and N. Janz. 1996. Host plant preferences in the comma butterfly (Polygonia c-album): Do parents and offspring agree? Ecoscience 3:285-289. Olckers, T. and P. E. Hulley. 1995. Importance of pre-introduction surveys in the biological control of Solanum weeds in South Africa. Agric. Ecos. and Environm. 52:179-185. Olmstead, K. L. 1994. Waste products as chrysomelid defenses, pp. 311-318. In: P. Jolivet; M. L. Cox, E. Petitpierre and T. H. Hsiao (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Olmstead, K. L. and R. F. Deeno. 1993. Effectiveness of tortoise beetle larval shields against different predator species. Ecology 74(5):1394-1405. Rausher, M. D. 1992. Natural selection and the evolution of plant-insect interactions, pp. 20-88. In: B. D. Roitberg and M. B. Isman (Eds.), Insect chemical ecology: An evolutionary approach. Chapman and Hall, New York. Scriber, J. M. and F. Slansky, Jr. 1981. The nutritional ecology of immature insects. Ann. Rev. Entomol. 26: 183-211. Siebert, M. W. 1975. Candidates for the biological control of Solanum eleagnifolium Cav. in South Africa. I. laboratory studies on the biology of Gratiana lutescens (Boh.) and Gratiana pallidula (Boh.) (Coleoptera: Cassidinae). J. Entom. Soc. South Africa 38: 297-304.

208

Solange Maria Kerpel & Lenice Medeiros

Singer, M. C. 1986. The definition and measurement of oviposition preference in plant feeding insects, pp. 6594. In. J. Miller and J.A. Miller (Eds.), Plant-insect interactions. New York, Springer-Verlag. Thompson, J. N. 1988. Evolutionary ecology of the relationship between oviposition preference and performance of offspring in phytophagous insects. Entomol. Exper. et Appl. 47:3-14. Thompson, J. N. 1996. Trade-offs in larval performance on normal and novel hosts. Entomol. Exper. Appl. 80:133-139. Zar, J. H. 1996. Biostatistical analysis. 3rd edition. New Jersey, Prentice Hall, 662p.

© PENSOFT Publishers Notes on the Sofia - Moscow

David G. Furth (ed.) 2003 Biology and Host Plants of the Australian Leaf BeetleSpecial Podagrica 209 Topics in ... Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 209-212

Notes on the Biology and Host Plants of the Australian Leaf Beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) Trevor J. Hawkeswood1 and P. H. Jolivet2 1

270 Terrace Road, North Richmond, New South Wales, Australia, 2754 Email: [email protected] 2 67 Boulevard Soult, F-75012 Paris FRANCE

ABSTRACT A new host plant Solanum stelligerum Sm. (Solanaceae) is recorded for the Australian flea beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) from Victoria Point, Brisbane, Queensland. Little is known of the biology of this species which has been previously recorded from species of Abutilon, Gossypium, Hibiscus, Sida (Malvaceae) and Duboisia, Solanum (Solanaceae) as well as from the purported host of Mentha (Lamiaceae).

INTRODUCTION The biology of the Australian flea beetle fauna (Coleoptera: Chrysomelidae: Alticinae) is poorly known. Recent publications by the first author and others (viz. Hawkeswood, 1988; Hawkeswood and Furth, 1994) have greatly increased the known host plants of a number of native species but there is almost an unlimited amount of data to be gathered at the present time. The need for more general biological observations has never been more acute due to a lack of entomologists, funding and the disappearance of beetle habitats through clearing and fires. Recent observations on the host plants and feeding behaviour of Podagrica submetallica (Blackburn) a native Australian species are provided below. OBSERVATIONS During 26 December 2000, the first author closely examined several living plants of Solanum stelligerum Sm. (Solanaceae) at Eprapah Park, Victoria Point, near Brisbane, south-eastern Queensland during hot, moist weather conditions, with temperatures over 30 degrees Celsius. The Solanum plants were growing in two main clumps either side of a sealed track in the northern area of the park. The largest clump of the population of S. stelligerum was on the northern part of the track and appeared to be the least affected by feeding damage caused by P. submetallica. The southern part of the Solanum population was comprised of approximately 6 plants, all of which displayed feeding damage. Approx.

210

Trevor J. Hawkeswood & P. H. Jolivet

90-95% of the leaves of each plant had tiny holes resulting from Podagrica feeding. The leaves are linear-lanceolate to ovate-lanceolate and measure mostly 3-10 cm long and 1-1.5 cm wide. No beetles were observed on the adaxial (upper) side of the leaves and the flowers/fruits were also not affected. Examination of the abaxial (underside) of the leaves revealed a small number (less than 10) of adult P. submetallica but no larvae or eggs. The adults were very active and flicked away at the slightest disturbance. It appeared that most of the adult generation had completed its life stage and only a few beetles remained, two of which were collected for further reference. No other plants harboured beetles and no other insects were found on the Solanum plants at the time. Solanum stelligerum is commonly called Devil’s Needles because of the very sharp and dangerous prickles on the stems and sometimes on the leaves, which easily prick human fingers causing an awful sensation and often drawing blood. The undersurface of the leaves is covered in stellate and other hairs forming a dense tomentum. The adaxial side of the leaves is coloured dark green and the tomentose undersurface is greyish to light brownish in colour. Feeding by P. submetallica is between the minor veins and results in removal of 25-60% of the leaf mesophyll tissues. The position and size of the feeding holes indicate that the beetles nibble for a period of time, mostly creating irregular-shaped holes measuring 1.0-1.5 mm in diameter, before moving off to another part of the same leaf or another leaf. The large number of affected leaves and feeding holes indicates that the population of P. submetallica was probably much larger earlier in the season as the few beetles detected on 26 December could not have been responsible for all of the feeding damage observed. DISCUSSION Habitat The site at Victoria Point, south-eastern Queensland, comprises a complex mosaic of swampland (mangrove community) and vine-infested sclerophyll woodland habitats and which has suffered considerable degradation over the past 50 years or so, through frequent fires of various intensities and scope, partial clearing of shrubs and other vegetation, selective logging and some invasion by non-native plant species, e.g. Ochna serrulata (Hochst.) Walp. (Ochnaceae), Lantana camara L. (Verbenaceae), Cinnamomum camphora (L.) Nees and Eberm. (Lauraceae). However there remains a high diversity of native plants within the site, e.g. the tree (canopy) stratum is comprised of such species as Eucalyptus intermedia R. T. Baker, Eucalyptus umbra R.T. Baker, Eucalyptus crebra F. Muell., Lophostemon confertus Wilson & Waterhouse, Melaleuca quinquenervia (Cav.) S. T. Blake, Syncarpia glomulifera (Sm.) Niedenzu (Myrtaceae), Glochidion ferdinandii (Muell. Arg.) F. M. Bail. (Euphorbiaceae), Elaeocarpus reticulatus Sm. (Elaeocarpaceae), Casuarina littoralis Ait. (Casuarinaceae), Alphitonia excelsa (Fenzl) Benth. (Rhamnaceae) and others. The shrub layer is mostly sparse as a result of fires and partial habitat clearing, but comprises smaller specimens of the above-mentioned native trees as well as Acacia falcata Willd., A. fimbriata A. Cunn. ex G. Don., A. leiocalyx (Domin) Pedley, (Mimosaceae), Ficus coronata Spin, F. opposita Miquel (Moraceae), Notolaea ovata R. Br. (Lauraceae), Jacksonia scoparia R. Br. (Fabaceae), Psychotria loniceroides Sieb. ex DC. (Rubiaceae), Solanum stelligerum Sm. (Solanaceae) and Callistemon citrinus (Curtis) Skeels (Myrtaceae). There is a preponderance of native and introduced vines and brambles at the site indicating the disturbed nature of the habitat. These vines and brambles include the following species: Parsonsia straminea (R.Br.) (Apocynaceae), Passiflora suberosa Sims (Passifloraceae), Rubus moluccanus L. (Rosaceae), Eustrephus latifolius R. Br. ex Ker-Gawl. (Philesiaceae) and Cayratia clematidea (F. Muell.) Domin, Cissus antarctica Vent. (Vitaceae). The site also contains

Notes on the Biology and Host Plants of the Australian Leaf Beetle Podagrica ...

211

numerous species of native and introduced ferns and grasses as well as other small native herbs, e.g. Lomandra spp. (Lomandraceae), Pseuderanthemum variabile (R. Br.) Radlkofer (Acanthaceae). The site, despite being altered from its original condition by human-induced influences and by the effects from the introduction of non-native plants and animals (e.g. dogs and cats), is probably in a disclimactic state, but with a majority of the pre-settlement plant species still extant, such that a relatively high biodiversity of plant species is still present. In effect, the reserve acts as an island community surrounded by housing developments. Associated with this plant diversity appears to be a comparatively high diversity of insect species (Hawkeswood, 1980-2000, personal observations). Host plants of P. submetallica Seven species of chrysomelid were obtained from the Park during a morning’s survey despite fire having damaged most of the site during the previous year. The record of P. submetallica from Solanum stelligerum is one of the interesting discoveries since no Australian chrysomelid has been recorded previously from this plant which is endemic to coastal areas of eastern Australia (Robinson, 1997). However, P. submetallica has been recorded previously from one other Solanum species (introduced) and other genera from the Solanaceae as well as Malvaceae: Abutilon sp. (Malvaceae)(Turner, 1934; Hawkeswood and Furth, 1994); Sida cordifolia L. (Malvaceae) (Hawkeswood, 1988; Hawkeswood and Furth, 1994); Hibiscus cannabinus L. (Malvaceae)(Kay and Brown, 1991; Hawkeswood and Furth, 1994); Sida rhombifolia L., Gossypium hirsutum L., Hibiscus heterophyllus Vent. (Malvaceae), Duboisia leichhardtii (F.Muell.) F. Muell., Solanum mauritianum Scop. (Solanaceae) (Hawkeswood and Furth, 1994). The beetle has also been recorded feeding (presumably) from the flowers of Leucaena sp. (Caesalpiniaceae) in Queensland (Hawkeswood and Furth, 1994). From the information which has been recorded to date, it appears that adults of P. submetallica may feed on flowers as well as leaves of host plants, although some species of Podagrica may show flower or leaf-feeding only and not both. Seed feeding has not been verified but a possibility. Turner (1934) briefly noted that this species (cited as Nisotra submetallica) fed as adults on the flowers of Abutilon sp. (Malvaceae) on Masthead Island, off the Queensland coast. Hawkeswood (1988) recorded adults feeding on the petals and pollen from the open flowers of Sida cordifolia L. (Malvaceae) in north-eastern Queensland. Hawkeswood and Furth (1994) suggested, based on the data present at that time, that P. submetallica is closely associated with Malvaceae and possibly Solanaceae. The new record above from Brisbane, Queensland confirms that Solanaceae are also important in the nutrition of this alticine. Jolivet (1991) and Jolivet and Hawkeswood (1995) noted that various genera of Malvaceae were the preferred hosts of Podagrica (and the closely related if not synonymous Nisotra) but did not list Solanaceae. Malvaceous plants may still be the preferred hosts of P. submetallica and other Podagrica (Nisotra) species, but in the absence of these, the secondary hosts become the plants consumed in any one area. Such a strategy is common in Alticinae and other subfamilies of Chrysomelidae, and this has been undoubtedly one factor leading to their evolutionary success as well as pre- and post-mating feeding and feeding on pollen and flowers of non-host plants (e.g. Hawkeswood and Furth, 1994; Jolivet and Hawkeswood, 1995). Furthermore, it is interesting to note that Froggatt (1907) briefly noted that this species (cited as Nisotra submetallica) fed on “mint” leaves (presumably Mentha sp., Lamiaceae); Jolivet (1991) and Jolivet and Hawkeswood (1995) regarded the record of Mentha sp. as a host by Froggatt (1907) as a record of an accidental occurrence and that the record needed confirmation in the absence of recent observations. However, it should be noted that for the European species, P. malvae (Illiger) which normally feeds on certain Malvaceae (e.g. Biondi, 1993; Vig, 1996;

212

Trevor J. Hawkeswood & P. H. Jolivet

Petitpierre, 1999) has also recently been recorded from an unidentified species of Marrubium (Lamiaceae) by Petitpierre (1999), as well as Asteraceae and Cistaceae (Helianthemum sp.) (Petitpierre, 1999). This kind of host-plant selection (polyphagy) by alticines such as Podagrica suggests a preadaptation in the adult stage for feeding on non-related host-plants. Hence the Australian P. submetallica may also possess a pre-adaptation for feeding on Lamiaceae (and other plant groups such as Solanaceae) during times of shortage or absence of the normal hosts of Malvaceae. This preadaptation may have been an important factor in the evolutionary success of these chrysomelid beetles as well as the food selection of not only leaves but flowers and pollen of the host plants as additional and important nutritive sources during egg production. It should be noted that botanically, the Lamiaceae and Malvaceae are not closely related. Further field observations throughout the range of this species in Queensland should yield further hosts. ACKNOWLEDGEMENTS Thanks are expressed to M. Biondi (Italy), E. Petitpierre (Spain) and K. Vig (Hungary) for sending their valuable reprints to the authors. Rod Eastwood, Brisbane, Queensland sent the first author a copy of the paper by Kay and Brown (1991). REFERENCES Biondi, M. 1993. Il popolamento a Coleoptera Chrysomelidae dell’appennino umbro-marchigiano: considerazioni zoogeografiche ed ecologiche. Biogeographica 27:321-365. Froggatt, W. W. 1907. Australian Insects. W. Brooks & Co., Sydney. Hawkeswood, T. J. 1988. A survey of the leaf beetles (Coleoptera: Chrysomelidae) from the Townsville district, northern Queensland, Australia. Giornale Italiano di Entomologia 4:93-112. Hawkeswood, T. J. and D. G. Furth 1994. New host plant records for some Australian Alticinae (Coleoptera: Chrysomelidae). Spixiana 17:43-49. Jolivet, P. 1991. Selection trophique chez les Alticinae (Col. Chrysomelidae). Bulletin de la Societe Linnéenne de Lyon 60:26-40, 53-72. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the World. An essay about the relationships between the leaf-beetles and their food-plants. Backhuys Publishers, Leiden, The Netherlands, 281 pp. Kay, I. R. and J. D. Brown 1991. Insects associated with kenaf in northern Queensland. Australian Entomological Magazine 18:75-82. Petitpierre, E. 1999. Catalog dels coleopters crisomelids de Catalunya IV. Alticinae. Bull. Inst. Cat. Hist. Nat. 67:91-129. Robinson, L. 1997. Field guide to the native plants of Sydney. Revised 2nd Edition, Kangaroo Press, Kenthurst, Sydney, 448 pp. Turner, A. J. 1934. Notes on insects of Masthead Island, Qd. In: H. Hacker, Exhibits. Minutes Entomological Society of Queensland, June 1934, 20:1-2. Vig, K. 1996. Leaf beetle fauna of Western Transdanubia (Hungary)(Coleoptera: Chrysomelidae sensu lato). Praenorica, Folia Hist. Nat. 3:1-178. (In Hungarian with English title and summary).

David G. Furth (ed.) 2003 © PENSOFTBiological Publishers and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ... Beetle Biology 213 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 213-225

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) F. A. Frieiro-Costa 1 and João Vasconcellos-Neto 2 1

Programa de Pós-Graduação em Ecologia.Universidade Estadual de Campinas - Inst. Biologia Depto. Zoologia. Campinas, SP, Brazil, 13083-970 2 Universidade Estadual de Campinas - Inst. Biologia - Depto. Zoologia CP 6109. Campinas, SP, Brazil, 13083-970. Email: [email protected]

ABSTRACT We studied a population of Omaspides tricolorata Boheman 1854, a species with maternal care at Serra do Japi, Jundiaí, São Paulo State, Brazil (23º 11’ S; 46º 52’ W) during almost three years (1988-1990). The life cycle of this species is closely tied to season and phenology of its host plant, Ipomoea alba L. (Convolvulaceae). Egg-clutch size varied form 28 to 80 eggs with an average of 55.1 ± 12.2 eggs (n = 56 clutches). Incubation period of egg stage was 15.5 ± 4.4 days (n = 120 clutches); mean duration of larval stage, containing five instars, was 28.0 ± 5.2 days (n = 86 larval groups) and pupal stage lasted 13.7 ± 5.3 days (n = 48 pupal groups). Immature life cycle lasted 57.3 ± 5.7 days (n = 48) and during these two months female took care of its offspring. All these biological data were obtained under field conditions. Adults appeared in October (spring), remained active until April when they entered diapause, and were hidden during winter dry season, starting the next reproductive cycle again in the next spring. The first egg-clutches were found in October (1988) or November (1989), showing two peaks of egg-clutch abundance: one in December and the other in February. The last egg-clutches were observed in April (1989) and March (1990), and females and their offsprings need at least two months to complete their life cycle. At this time (May) the cold dry season starts and the host plant shows old leaves, which fall during the winter. Females feed only during larval development of their offspring or before laying eggs. One female can take care of only two generations each reproductive period. Maternal care and cycloalexy are important behavior against natural enemies.

INTRODUCTION In spite of the great diversity of chrysomelid beetles, few studies examing their natural history, biology and population dynamics have been carried out in the field. Despite the fact that many species have singular ways of life, presenting extremely peculiar morphological and behavioural characteristics, studies on natural history are almost always left aside.

214

F. A. Frieiro-Costa & João Vasconcellos-Neto

Some tropical populations of Chrysomelidae beetles are active throughout the year (Nakamura et al., 1989; Macêdo et al. 1994; Sá and Macêdo, 1999). Nonetheless, other authors, studying other chrysomelid species in subtropical areas or close areas, show that they may undergo a winter diapause and reproduce in the summer. This seasonal pattern of population dynamics was described for Cassidinae (Frieiro-Costa, 1995; Becker and Freire 1996; Garcia and Paleari 1993; Sá and VasconcellosNeto, 2002), Chrysomelinae (Medeiros and Vasconcellos-Neto, 1994; Vasconcellos-Neto and Jolivet, 1998); Alticinae (Del-Claro, 1991b) and Megalopodinae (Nogueira-Pinto, 2000) in this same region. This same seasonality was observed for other insect groups like butterflies (Vasconcellos-Neto, 1991; Brown, 1992) and Tettigoniidae orthopterans (Del-Claro, 1991a). In this work we studied the biology, reproductive behaviour and population dynamics of the beetle Omaspides tricolorata Boheman (Chrysomelidae: Cassidinae) in natural conditions. Adults and larvae feed on one annual plant, Ipomoea alba L. (Convolvulaceae), with scandent habit and native to tropical America. Study Area This work was conducted in southeastern Brazil, at Serra do Japi (23º 11’ S / 46º 52’ W), a mountainous area covered by a semideciduous mesophitic altitude forest (Leitão-Filho, 1992) at the south limit of tropical zone in São Paulo State, Brazil. The climate in the area is classified as Cwa, according to Koppen system, corresponding to the tropical moist type. Because of the large range of altitude (700 m to 1300 m above sea level), mean temperature varies from 11.8º to 18.4º C in July (the coldest month) to 18.4º to 22.2º C in January (warmest month) (Pinto, 1992). Rainfall is higher

Fig. 1. Omaspides tricolorata female taking care of her offspring. Female can copulated with male when taking care its egg-clutch.

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

215

in December and January when precipitation can reach 250 mm per month, but during the winter, June to August, the colder months, mean precipitation in this period is 41 mm. Climatic conditions result in two distinct seasons during the year: a warm and rainy summer and a cold and dry winter (Pinto, 1992). We concentrated our study along one track “Paraiso III” (1000 to 1070 m of altitude) at one extension of 3.6 km. At this site, vegetation was basically of short trees (20 m high) of low diameter (Leitão-Filho, 1992). MATERIALS AND METHODS We made 111 trips to Serra do Japi, totalizing 1009 hours of observation, and of these, 45 were nocturnal, during two Omaspides tricolorata biological cycles (August 1988 to August 1990). We marked and counted 332 individuals of Ipomoea alba along the 3.6 km in Paraíso III track boards. The number of plants was not constant during the period; those that grew or regrew during the cycle were incorporated into the total number, and those that died were deducted. For each plant found during the visits, the following plant phenology aspects were registered: branch re-growth; presence of young, mature and senescent leaves; and senescence period with leaves loss and branch dryness. For each plant, we registered the number of adult beetles (males and females) which were classified as young or mature, depending on the chitinization degree and elytral color. Each adult had its elytra slightly scraped and was individually numbered with permanent ink so that we could follow its longevity, number of offspring, period of offspring care and development time. Numbering the mother beetle also represented a way of offspring individualization. It was also registered the presence of guarded or non guarded egg-clutch by the mother, being each egg-clutch in this way followed until adults’ emergence. After larval eclosion and adult emergence, the rest of the egg clutch and exuviae were taken to the laboratory where egg and pupae number were counted. The accompanying observation of each offspring development period, in their different stages, was done in field conditions. Feeding Habits Omaspides tricolorata adults are found in feeding and reproductive activities from the middle of October (spring) until April, entering diapause from May on. This species is monophagous, feeding only on Ipomoea alba, despite occurring on four other Convolvulaceae species in the study area (Ipomoea cairica, I. bona-nox, Ipomoea sp. and Merremia sp.). Ipomoea alba is a liana which grows in open areas supported by other support-plants and little shaded places along tracks and small roads in forest areas. Each plant contains on average three branches with eighteen leaves per branch. Leaves measure on average 100.3 ± 30.3 mm in length and 80.9 ± 40.3 mm in width (n = 30 plants). The plant loses its already senescent leaves from the middle of autumn on and the branches dry. New branches regrow about the end of winter (September), having mature leaves again in the beginning of spring. From October to March, there is a large quantity of mature leaves and from April and May on leaves begin to show signs of senescence and then fall during the winter. This cycle probably repeats itself as a function of climatic seasonality. Herbivory marks left on leaves by larvae or adults are good indicators of the beetle development stage. First and second larval stadia feed only between the veins, scratching the leaf surface and leaving the leaf with a skeletonized appearance. Third and fourth larval stadia eat the leaf entirely,

216

F. A. Frieiro-Costa & João Vasconcellos-Neto

including the veins (main and secondaries) and the petiole. Adults only feed on the foliar surface, beginning either an undamaged leaf or at some already existant holes in the leaf surface. Immediately after eclosion, larvae place themselves around the egg-clutch and begin to feed, moving on and eating the leaf in the direction of the petiole and from there go on to another leaf. The larval group, when moving from an eaten leaf to an intact leaf, walks in line on the petiole and main vein to the distal edge of the leaf, and only then do they begin to feed. Maternal Care and Cycloalexy Omaspides tricolorata females lay eggs in clutches and take care of them during the entire egg development not feeding on her host plant. When larvae eclose, they stay around the egg-clutch before starting to feed. After that, they abandon the egg-clutch and, during the day, form defense rings (cycloalexy) in which the external individuals keep themselves with the anal regions turned to the outside and the heads turned towards the inside of the circle. Whenever the larvae are in cycloalexy, the guarding-mother remains over or close to them. In evening crepuscule, larvae go in a line to the distal leaf portion to feed, and afterwards return to the ring formation during morning crepuscule. When the female notices the appearance of a natural enemy through its movement on the leaf, it attacks it. Defense ring formation (cycloalexy) was also described for the larvae of other chrysomelid species, including tortoise beetles (Vasconcellos-Neto and Jolivet, 1988,1994). When larvae complete development, they migrate to the plant base, forming an aggregation on one of the branches, staying one attached to the other. During pre-pupae and pupae phase, the mother guards over its offspring until the adults emerge. Contrary to some subsocial insect species in which females take care of only one offspring and then die (e.g. Dias, 1975; 1976), O. tricolorata females can be active for at least two reproductive cycles. In some situtations, when the female is attacked or notices some imminent danger, she may fall to the ground, abandoning the offspring for some minutes, escaping from a potential predator’s action. Because the egg-clutch is located in regions less visited by ants, the guardian mother can come back before it has been attacked. BIOLOGY Egg-clutch O. tricolorata egg-clutch consists of eggs solidly fixed together, positioned on the edge of a firmly tight peduncle of the leaf. The egg shape is oval, measuring 1.42 ± 0.11 in length and 0.61 ± 0.15 in width and they are not covered by membrane, feces or some other type of secretion, as is usually the case in tortoise beetles (Muir and Sharp, 1904; Gressitt, 1952; Chapman, 1969; Kosior, 1975; Hinton, 1981; Crowson, 1981; Frieiro-Costa, 1984; Buzzi, 1988; Jolivet, 1988). Shortly after oviposition, the eggs are amber-colored, changing gradually to straw yellow as the chorion hardens. This characteristic permits differentiation of the recently placed egg-clutches from those in place for more than five hours. The egg-clutches have a shape similar to a lozenge, containing on average 55.1 ± 12.2 eggs (n = 3,085 eggs in 56 clutches). Adults occur not only on plants that received direct solar light during the majority of the day, but also on plants in shaded locations. Nonetheless, the majority of the egg-clutches were on shaded plant leaves (n = 205) and only one egg clutch occured in a sunny location. Egg-clutches were placed on leaves measuring on average 100.6 ± 30.0 mm and 90.6 ± 20.8 mm in width (n = 134),

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

217

with no preference for larger leaves, as these did not significantly differ in relation to the average size of the plant leaves. All egg-clutches were located on the abaxial surface of the leaves. Of these, 183 (89.30%) were deposited in the distal edge, always on the main vein and the other 22 egg-clutches (10.70%) were located on the leaf surface. On the leaf surface, there was no preference for a specific location; however, none of the egg-clutches were on the half of the leaf closest to the petiole. Six egg-clutches found on the leaf blade were on leaves which had the edge eaten by some other herbivores and we never observed egg-clutches on leaves which were green-colored and had the texture modified by age or some other factor. According to Chapman (1969) and Singer (1986), the choice of the egg deposition site has great importance on the survival of eggs and on the survival of the immatures after the eclosion. Other researchers have noticed that many cassidinae species prefer the abaxial surface to deposit their eggs. Frers (1922) observed that Chelymorpha indigesta (Boheman), C. variabilis (Boheman) and Metriona argentina Spaeth (a non-subsocial cassidinae) prefer to place their eggs on the abaxial leaf surface of their host plants, but the causes for this were not discussed. Kosior (1975), from his and many other authors’ observations mentioned that the majority of species in the genus Cassida prefer to oviposit on the abaxial leaf surface of their host plants, suggesting that this behavior is adaptive and would be acting as protection against environmental physical factors and against natural enemies. According to Frieiro-Costa (1984), the temperature is the ecological factor responsible for the oviposition on the Solanum sisymbriifolium Lam. (Solanaceae) abaxial leaf surface by Gratiana spadicea (Klug). In O. tricolorata, the temperature is probably one of the determinant factors of this kind of behavioral pattern, because, with one exception, no egg-clutches were found on plants exposed to the sun most of the day. Differences between the nutritional qualities and leaf toughness together with microclimate could be determining this population pattern of host plant use. In Serra do Japi, during summer, the temperature in open areas can reach 38ºC on the hottest days (Pinto, 1992), which can dehydrate and provoke the death of the O. tricolorata larvae. According to Wigglesworth (l972), Leptinotarsa sp. (Chrysomelinae) larvae die when water quantity in their bodies falls below 60 %; and Maw (1976) observed that the Cassida hemisphaerica Herbst. (Chrysomelidae: Cassidinae) first stadium larvae are very susceptible to dehydration. The oviposition behavior on distal portions of the leaf may have been selected for by ant predation. Ants visit the extrafloral nectaries located on leaf basal region of I. alba. Although ants patrol the leaf, the basal region closest to the extrafloral nectaries is visited with higher frequency. The eggclutches which were abandoned by the mother (n = 23) were attacked by ants. The necessary time for the egg incubation was 15.5 ± 4.4 days (n = 120 clutches). All eggs belonging to one egg clutch eclosed on the same day, with an interval of some hours between the first and the last one. Larval Stage The larval stage has five stadia and completes its development in 28.0 ± 5.2 days (n = 86 offspring). The larvae are straw-yellow colored with some brown spots in the upper region. They are long and dorso-ventrally flat, with various lateral spines and a furca on the last abdominal segment. The exuvia of each molt remains tightly attached to the furca, where feces can also be accumulated, forming a dorsal shield that may have a role in the defense against natural enemies. This has been noted for some other Cassidinae species (see Eisner et al. 1967; Olmstead and Denno, 1992, 1993; Olmstead, 1996). To accumulate the exuviae is a common peculiarity of all representatives of this

218

F. A. Frieiro-Costa & João Vasconcellos-Neto

subfamily (Muir and Sharp, 1904; Frers, 1922; 1925; Takizawa, 1980; Freire, 1982) and allows one to determine the exact larval stadium by counting of the cephalic capsules. In general, cassidinae larvae lose the dorsal shield when pupating (Frers, 1922; Siebert, 1975; Vasconcellos-Neto, 1987; Buzzi, 1988), but O. tricolorata keeps it tightly attached to the last exuvia furca, which remains also tightly attached to the pupa. The greatest larval activity (feeding or displacement) occurred from the evening crepuscule continuing until approximately 11PM, when there is a pause. Activities resume around 4AM, ceasing by the end of morning crepuscule, which occurred around 6AM. Only when the day was cloudy, or shortly after it rained and temperatures were milder, were the larvae found feeding during other morning hours. In the afternoon, larvae were only active immediately after eclosion. Pre-pupal and Pupal Stages Larvae remained on leaves until the end of the fifth stadium, after which, they moved down onto one of the host plant branches to a more shaded and protected place near to the ground. Here they positioned themselves evenly overlapping, fixed by the abdominal edge, and begin the pre-pupae stage. Most of the time, larvae searched for the main branch and positioned themselves close to the region where this branch emerged from the ground. On two occasions, we found pupae fixed in circles on leaves, but in small numbers of three to five, respectively. Both of these sets were preyed upon, the one with five pupae by ants and other by a mantis. Shortly after reaching the pupal stage, they were yellow in coloration, which gradually darkens, and after approximately 24 hours, they were bright dark brown in color. The average duration of this phase (pre-pupae and pupal stages) was 13.7 ± 5.3 days (n = 48 offsprings). The total period of immature development was 57.3 ± 5.7 days. Comparing these results to those of non-subsocial tropical Cassidinae development (Freire, 1982; Vasconcellos-Neto and Habib, 1979; Vasconcellos-Neto, 1987; Buzzi, 1988), it was noticed that from egg development until adult emergence, O. tricolorata required an average period approximately two times longer. Windsor (1987) studied the tortoise beetle Acromis sparsa (Boheman) (Coleoptera: Chrysomelidae: Cassidinae) in Panama and observed that pupal development time varied from 10 to 17 days, but he did not refer to the other stages. Adult Stage Adults of Omaspides tricolorata adults average 10 mm in length and 5 mm in width. Generally, females are larger than males, and do not present other morphological characteristics that allow for easy identification of the sexes. Sexually matured adults have straw-yellow elytra, with a black line delineating the internal disc and light brown pronotum. When they emerge from pupa, the teneral adults have translucent elytra, and the black lines are not visible. Gradually, they become light green with slightly darker pronotum. After five or six hours, the elytra acquire the pronotal color and the black line is completely defined. The complete hardening of the elytra takes from five to seven days and they retain the light-green coloration during the rest of the cycle until entering diapause. These young adults were never observed in copula and/or guarding offspring in the same emergence cycle. All individuals found in copula and/or having offspring under their care had straw yellow coloration. In many species of the genus Cassida, adults only reach the final coloration after leaving diapause (Kosior, 1975).

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

219

POPULATION DYNAMICS Omaspides tricolorata adults diapause during the beginning of spring (October) in both cycles. Adult populations continued to be recruited from diapause until December and, from January on, the population increase happened through young greenish-colored adults recruitment. Young adults do not generally reproduce in the same cycle of their emergence, but only in the next cycle, after diapause. In both cycles, the adult population reached its peak during March. From mid-April with the reduction of precipitation, mean temperature and photoperiod, the adult population on I. alba started to decline, reaching zero in May. From the first week of May, they entered diapause, remaining this way during autumn and winter. Adults were sheltered under trunks, tree bark, bromeliaceae rosettes, and in other cavities close to the ground which gave them shelter. With the beginning of the spring rains, adults left their diapause sites (Fig. 2). The first egg-clutches were found by the end of October or beginning of November, occurring in two peaks: one in December and other in February (Fig. 3). The reproductive cycle goes from October to the beginning of April. In this six-month period, adults leaving diapause need to obtain necessary food to invest in reproduction, i.e., to find a partner, mate, oviposit their first egg-clutch (30 days) and take care of their offspring for at least two months. Generally, the mother stays with their adult offspring recently emerged, until the elytra are partially hard and they disperse (7 days). After that, the female must invest in feeding (20 days) to produce a second set of offspring, which for many individuals generally occurs between January and February. In this way, investing two more months taking care of their second set of offspring, it is then time to enter diapause. Therefore, a successful female can produce up to two sets of offsprings per reproductive cycle. According to ADULTS OF OMASPIDES TRICOLORATA 500

NUMBER OF INDIVIDUALS

450 400 350 300 250 200 150 100 50 0 A 88

S

O

N

D

J 89

F

M

A

M

J

J

A

S

O

N

D

J 90

F

M

A

M

J

J

A

Fig. 2. Omaspides tricolorata adult population dynamics (88/89 and 89/90) in Serra do Japi, Jundiaí, State of São Paulo, during two reproductive cycles. The number of host plant reached 155 individuals in the study site during the first cycle and 177 in the second. There are 332 marked individuals of I. alba in the study site.

F. A. Frieiro-Costa & João Vasconcellos-Neto

220

NEW EGG-CLUTCHES 60

Nº OF NEW CLUCTHES

50

40

30

20

10

0 A 88

S

O

N

D

J 89

F

M

A

M

J

J

A

S

O

N

D

J F 90

M

A

M

J

J

A

Fig. 3. Number of O. tricolorata new egg-clutches monthly found, during two reproductive cycles 88/89 and 89/90, in Serra do Japi.

Williams (1966) and Cockburn (1991), the cost in offspring care, during four stages in the development cycle, must be replenished at some time. For O. tricolorata this replenishment is done in the period which precedes each oviposition and partially during the larvae feeding period. The Ipomoea alba population, which goes through the winter without leaves, begins to regrow leaves from the end of August and September, developing new and mature leaves by October. Adults of O. tricolorata begin to appear in their host plants in October and the majority only initiate oviposition during December, because there were difficulties in finding mates, or because they only abandoned their diapause sites after higher temperatures and denser rains. In this period, there are enough resources and good conditions for feeding and larvae development. On average, adults take care of their offspring for two months, the majority of the females are only ready for new oviposition in February. From then on, the amount of oviposition begins to diminish because most of the females are with offspring through the end of March and begining of April, until May when ovipositions are interrupted. From April on, the mean temperature begins to decrease and the majority of the host plant leaves are already senescent. Any other offspring at this time would have low probability of completing their development. During winter, the majority of the host plants are without leaves and some branches are completely dried. Clutch Survivorship In the first cycle, we followed the development of 74 egg clutch development. All of them, without exception were totally or partially attacked by natural enemies. A total of 23 egg clutches (31.1%) were attacked and totally destroyed. Of the 51 egg clutches where at least one individual

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

221

reached the larval stage, 12 (23.5%) were totally consumed by predators and/or parasitoids. Of the 39 remaining clutches, at least one individual managed to reach pupal stage. Natural enemies completely attacked 15 of these (38.5%), resulting in 23 offsprings, that reached the adult stage. Number of offspring in which there were adult emergences corresponds to 59% of the total of assemblages which reached pupal stage, and to 31.1% of those assemblages which were followed since egg stage. In total, 223 adults of these 23 offsprings emerged. In the second cycle, we followed the development of 131 egg clutches, 56.5% more than the previous period. In 81 of these (61.8%), there was eclosion of at least one egg. Of these clutches, 34 (42.0%) were totally preyed upon and, the 47 (58.0%) were partially attacked with some larva reaching pupal stage. From 25 clutches, (53.1%), at least one adult managed to emerge. The total number of adults derived from these assemblages was 288. In the two studied cycles, of the 205 egg clutches we followed there were emergences in 49 (23.4%) of those assemblages initially present in nature. Considering the number of clutches and the mean number of eggs per clutch, the total of adults which emerged in relation to the initial total of eggs corresponds to 5.5% survival in the first cycle and 4% survival in the second. In analyzing these data, it is observed that the percent assemblage survivorship is great when compared to other insects in general (Abbas, Nakamura and Hasyim, 1985; Nakamura, Pudjiastuti and Katakura, 1992) and particularly compared to other Cassidinae. This greater survivorship can be attributed to parental care efficiency, which reduces attacks by natural enemies on offspring and allow a greater number to reach the adult phase. Clutch Number and Longevity A total of 27 females produced two offspring in the same cycle, with 9 in the first and 18 in the second. The time interval between two offspring was 20.3 ± 4.1 days (n = 8). After oviposition, females remained without food for 16 days until larval eclosion. During offspring care, they feed only during the larval development period, remaining on average 14 more days without feeding during pre-pupae and pupa stages. Adults fed again when their adult offspring emerged. Due to the long period which is invested by females until the adult emergence, it would be expected a smaller interval between two offspring for females to better explore the available resources, however, according to Trivers (1974), females need to recompose their energetic sources to exert offspring care again. In the second cycle, we observed 6 of the 44 marked females from the previous period (13.7%) with new offspring. These results demonstrate that females of this species have great longevity, while males have an estimated longevity of one year, because marked individuals from one cycle were never found in another. Once climatic seasonality decreases the reproductive period and time dedicated to offspring is long. This great longevity seems adaptative as it allows females to reproduce in two cycles. This relation between parental care and longevity is indicated for various insects (see Michener, 1969; Wilson, 1971; 1975; Mattews and Mattews, 1978; Eickwort, 1981; Talllamy and Wood, 1986). The necessary investment to take care of immatures is only worthwhile if the reproduction rate of offspring, that received care is greater than that of offspring that did not receive suppport from their mothers. For example, according to Hassell (1978), Tallamy (1984) and Tallamy and Wood (1986), eggs placed in groups can be more attractive to predators, than if isolated singly. This kind of selective pressure may favor the evolution of parental care in the Cassidine.

222

F. A. Frieiro-Costa & João Vasconcellos-Neto

CONCLUDING REMARKS Omaspides tricolorata is a monophagous herbivore, which is subsocial and gregarious. In the study area , it is active in nature from October to May. It has a long immature development period (two months) when compared to tortoise beetles species without parental care. Females stay over the offspring from oviposition to the emergence of the new adults. Taking care of offspring is an essential behavior, especially during egg and larval stages, for their survivorship of immature stadia. Climatic seasonality and phenology of its host plant greatly affects population dynamics of this tortoise beetle. Phenology of I. alba and herbivoros, O. tricolorata, are synchronized and depend on enviromental seasonality. ACKNOWLEDGMENT We would like to gratefully acknowledge the financial support received by CAPES through the PICD (FAFC) grant and CNPq through the research grant (JVN - Proc. Nº 300539/94-0); Prefeitura Municipal de Jundiaí and Guard Municipal for the authorization for working in the field and all the logistic support. LITERATURE CITED Abbas, I., K. Nakmura and A. Hasyim 1985. Survivorship and fertility schedules of a Sumatran epilachnine “species” feeding on Solanum torvum under laboratory conditions (Coleoptera: Coccinellidae). Appl. Ent. Zool. 20:50-55. Becker, M. and A. J. P. Freire 1996. Population ecology of Gratiana spadicea (Klug), a monophagous Cassidinae on an early successional Solanaceae in Southern Brazil, pp. 271-287. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology, volume 2: Ecological studies. SPB Academic Publishing, Amsterdam, The Netherlands. Brown, K. S. Jr. 1992. Borboletas da Serra do Japi: diversidade, hábitos, recursos alimentares e variação temporal. In: L. P. C. Morellato (Org.). História Natural da Serra do Japi: Ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. Unicamp. Campinas. 321 pp. Buzzi, Z. J. 1988. Biology of neotropical cassidinae. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dordrecht. 615 pp. Chaboo, C. S. 2001. Revision and phylogenetic analysis of Acromis Chevrolat (Coleoptera: Crysomelidae: Cassidinae: Stolaini). The Coleopterists Bulletin 55(1):75-102. Chapman, R. F. 1969. The insects: Structure and function. London, Hodder and Stoughton Ltd. 819 pp. Clutton-Brock, T. H. 1991. The evolution of parental care. Princeton University Press. Princeton. 352 pp. Cockburn, A. 1991. An introduction to evolutionary Ecology. Blackwell Scientific Publications. Oxford. 370 pp. Crowson, R. A. 1981. The biology of the coleoptera. Academic Press. London. 802 pp. Del-Claro, K. 1991a. Polimorfismo mimético de Scaphura nigra Thunberg 1824 (Tettigoniidae: Phaneropterinae). M. Sc. Thesis. Universidade Estadual de Campinas. Del-Claro, K. 1991b. Notes on mimicry between two tropical beetles in south-eastern Brazil. J. Trop. Ecol. 7:407-410. Dias, B. F. S. 1975. Comportamento pré-social de sínfitas do Brasil Central. I. Themos olfersii (Klug) (Hymenoptera, Argidae). Studia Ent. 18(1-4):401/32.

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

223

Dias, B. F. S. 1976. Comportamento pré-social de sínfitas do Brasil Central. II. Dielocerus diasi Smith, 1975 (Hymenoptera, Argidae). Studia Ent. 19(1-4):461/501. Eickwort, G. C. 1981. Presocial insects. In: H. R. Hermann (Ed.), Social Insects. vol.II. Academic Press. New York. 459 pp. Eisner, T., E. Van Tassel and J. E. Carrol 1967. Defensive use of a fecal shield by a beetle larva. Science 158:1471/73. Freire, A. J. P. 1982. Flutuação na abundância e distribuição espacial de Gratiana spadicea (Coleoptera: Chrysomelidae: CassidInae) em Solanum sisymbriifolium Lam (Solanaceae). Dissertação de Mestrado, Universidade Federal do Rio Grande do Sul. Porto Alegre, 154 pp. Frers, A.G. 1922. Metamorfosis de coleópteros argentinos. Physis 5:245-262. Frers, A.G. 1925. Metamorfosis de coleópteros argentinos. Physis 8:82-92. Frieiro-Costa, F. A. 1984. Natalidade e mortalidade no estágio de ovo em uma população natural de Gratiana spadicea (Klug, 1829) (Coleoptera: Chrysomelidae: Cassidinae) em Solanum sisymbriifolium Lam (Solanaceae). Dissertação de Mestrado, Universidade Federal do Rio Grande do Sul. Porto Alegre, 116 pp. Frieiro-Costa, F. A. 1995. Biologia de populações e etologia de Omaspides tricolorata (Boheman, 1854) (Coleoptera: Chrysomelidae: Cassidinae) na Serra do Japi - Jundiaí - SP. Tese de Doutorado. Universidade Estadual de Campinas. Campinas. 1995. 179 pp. Garcia, M. A. and L. M. Paleari 1993. Ciclo de vida e potencial de crescimento populacional de Charidotis punctatostriata (Coleoptera, Chrysomelidae, Cassidinae) em laboratório. Revista Bras. Ent. 37(2):329-334. Gressitt, J.L. 1952. The tortoise beetles of China (Chrysomelidae: Cassidinae). Proc. Calif. Acad. Sci., 27(17):433592. Habib, M. E. M. and J. Vasconcellos-Neto 1978. Biological studies on Botanochara impressa Panzer, 1798 (Coleoptera, Chrysomelidae). Rev. Biol. Trop. 27(1):103-110. Hassell, M. P. 1978. The dynamics of arthropod predator-prey systems. Princeton University Press. Princeton, 237 pp. Hinton, H.E. 1981. Biology of insects eggs. Pergamon Press Oxford. 1.125 pp. Jolivet, P. 1988. Les soins parentaux chez les Chrysomélides (Col.). Entomologiste, (Paris), 44(2): 93/101. Kosior, A. 1975. Biology, ecology and economic importance of Cassids (Coleoptera: Chrysomelidae: Cassidinae) of the Ojców National Park. Acta Zool. Cracow 20 (9):251-292. Leitão-Filho, H. F. 1992. A flora arbórea da Serra do Japi. In: L. P. C. Morellato (Org.). História Natural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. Unicamp. Campinas. 321 pp. Macêdo, M. V., R. F. Monteiro and T. M. Lewinsohn 1994. Biology and ecology of Mecistomela marginata (Thunberg, 1821) (Hispinae: Alurnini) in Brazil, pp. 567-571. In: P. H. Jolivet, M. L. Cox and E. Petitipierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Mattews, R. W. and J. R. Mattews 1978. Insect behavior. John Wiley and Sons. New York, 507 pp. Maw, M. G. 1976. Biology of the tortoise beetle, Cassida hemisphaerica (Coleoptera: Chrysomelidae) a possible biological control agent for bladder campion, Silene cucubalus (Cariophilaceae) in Canada. Can. Ent. 108(9):945-954. Medeiros, L. and J. Vasconcellos-Neto 1994. Host plants and seasonal abundance patterns of some Brazilian Chrysomelidae, pp. 185-189. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Michener, C. D. 1969. Comparative social behavior of bees. Ann. Rev. Entomol. 14:299-342. Muir, F. E. S. and D. Sharp 1904. On the egg-case and early stages of some Cassidinae. Trans. Ent. Soc. Lond. 1:1-23.

224

F. A. Frieiro-Costa & João Vasconcellos-Neto

Nakamura, K. and I. Abbas 1987. Preliminary life table of the spotted tortoise beetle, Aspidomorpha miliaris (Coleoptera: Chrysomelidae) in Sumatra. Res. Popul. Ecol. 29:229-236. Nakamura, K. and I. Abbas 1989. Seasonal change in abundance and egg mortality of tortoise beetle (Coleoptera, Chrysomelidae, Cassidinae) under humid-equatorial climate in Sumatra. Entomography 6:487-495. Nakamura, K., L. E. Pudjiastuti and H. Katakura 1992. Survivorship and fertility schedules of three epilachnine species under laboratory conditions in Bogor, West Java. In: K. Nakamura and H. Katakura (Eds.), Evolutionary Biology and Population Dynamics of Herbivorous Ladybeetles in Indonesia. Saporo. 91 pp Nogueira-Pinto, Y. Y. A. 2000. Herbivoria em Erechtites valerianaefolia DC. (Asteraceae): Distribuição de ataque dos herbívoros e respostas compensatórias da planta. Ph. D. Thesis. Universidade Estadual de Campinas. Campinas, SP. Olmstead, K. 1996. Cassidinae defenses and natural enemies, pp. 3-21. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers, Amsterdam, The Netherlands. Olmstead, K. and R. F. Denno 1992. Cost of shield defense in tortoise beetles (Coleoptera: Chrysomelidae). Ecol. Entomol. 17:237-243. Olmstead, K. and R. F. Denno 1993. Effectiveness of tortoise beetle larval shields against different predator species. Ecology 74:1394-1405. Pinto, H. S. 1992. Clima da Serra do Japi. In: L. P. C. Morellato (Org.), História Natural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. da Unicamp. Campinas. 321 pp. Sá, F. N. and M. V. Macêdo 1999. Behavior and population fluctuation of Plagiometriona flavescens (Boheman) (Chrysomelidae: Cassidinae), pp. 299-305. In: M. L. Cox (Ed.), Advances in Chrysomelidae 1. Backhuys Publishers, Leiden, The Netherlands. Sá, F. N. and J. Vasconcellos-Neto 2002. Host plant utilization and population abundance of three species of cassidinae (Coleoptera: Chrysomelidae) in a tropical forest area in Brazil. Journal of Natural History. (in press) Siebert, M. W. 1975. Candidates for the biological control of Solanum elaeagnifolium Cav. (Solanaceae) in South Africa. 1. Laboratory studies on the biology or Gratiana lutescens (Boh.) and Gratiana pallidula (Boh) (Col., Cas.). J. Ent. Soc. S. Afr. 38 (2):297-304. Singer, M. C. 1986. The definition and measurement of oviposition preference in plant-finding insects, pp. 6594. In: J. R. Miller and T. A. Miller (Eds.), Insects-plant interactions. Springer-Verlag. New York. 342 pp. Takizawa, H. 1980. Immature stages of some indian Cassidinae (Col., Chrys.). Insect Matsum. 21:19-48. Tallamy, D. W. 1984. Insect parental care. Bioscience 34(1):20-24 Tallamy, D. W. and T. K. Wood 1986. Convergence patterns in subsocial insects. Ann. Rev. Entomol. 31:369390. Trivers, R. L. 1974. Parent-offspring conflict. Amer. Zool. 14: 249-264. Vasconcellos-Neto, J. 1987. Genética ecológica de Chelymorpha cribraria F. 1775 (CassidInae, Chrysomelidae). Tese de Doutorado. Universidade Estadual de Campinas. Campinas. 254 pp. Vasconcellos-Neto, J. 1991. Interactions between Ithomiine butterflies and Solanaceae: feeding and reproductive strategies, pp. 291-313. In: P. W. Price, T. M. Lewinsohn, G. W. Fernandes and W. W. Benson (Eds.), Plant-animal interactions. Evolutionary ecology in tropical and temperate regions. John Wiley and Sons Inc., New York, USA. Vasconcellos-Neto, J. and P. Jolivet 1988. Une nouvelle stratégie de defense: La stratégie de défense annulaire (cycloalexie) chez quelques larvas de Chysomélides brésiliens. Bull. Soc. Ent. Fr. 92 (9-10):291-299. Vasconcellos-Neto, J. and P. Jolivet 1994. Cycloalexy among chrysomelid larvae, pp 303-309. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Netherlands.

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

225

Wigglesworth, V. B. 1972. The principles of insect physiology. 7ª Edição. Chapman and Hall. London. 827 pp. Williams, G. C. 1966. Natural selection, the costs of reproduction and a refinement of Lack’s principle. Amer. Natur. 100: 687-690 Wilson, E. O. 1971. The insect societes. Belknap Press of Harvard University Press. Cambridge. 548 pp. Wilson, E. O. 1975. Sociobiology - The new synthesis. Belknap Press of Harvard University Press. Cambridge. 697 pp. Windsor, D. M. 1987. Natural history of a subsocial tortoise beetle, Acromis sparsa Boheman (Chrysomelidae, Cassidinae) in Panama. Psyche 94(1-2):127-150. Wood, T. K. 1976. Biology and presocial behavior of Platycotis vittata (Homoptera: Membracidae). Ann. Ent. Soc. Am. 69:807-811. Wood, T. K. 1977. Role of parent females and attendant ants in the maturation of the treehopper, Entylia bactriana (Homoptera: Membracidae). Sociobiology 2:257-272. Wood, T. K. 1984. Life history patterns of tropical membracids (Homoptera: Membracidae). Sociobiology 8:299-344.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers Chemical Signalling Between Host Plant (Ulmus minor) and Egg Special Parasitoid 227 Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 227-241

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid (Oomyzus gallerucae) of the Elm Leaf Beetle (Xanthogaleruca luteola) Torsten Meiners1 and Monika Hilker1 1

Freie Universität Berlin, Institut für Biologie, Angewandte Zoologie / Ökologie der Tiere, Haderslebener Str. 9, 12163 Berlin, Germany. Email: [email protected]

ABSTRACT Eggs of the elm leaf beetle Xanthogaleruca (Pyrrhalta) luteola (Coleoptera, Chrysomelidae) experience heavy parasitization by the egg parasitoid Oomyzus gallerucae (Hymenoptera, Eulophidae) in the field. We investigated the tritrophic interactions between the elm leaf beetle, its host plant, the field elm (Ulmus minor = U. campestris = U. procera), and its egg parasitoid. This paper summarizes our research on this tritrophic system and relates the specific utilization of infochemicals to the biology of the organisms involved. We found that oviposition of X. luteola induces the elm leaves to release volatiles that attract the egg parasitoid (induced synomones). Studies on the mechanism of this synomone induction revealed that neither intact elm leaves nor leaves damaged by feeding beetles released attractive volatiles. But oviduct secretion of X. luteola, which glues the eggs onto the leaves, was proved to elicit the emission of the attractive synomones. The eggs are always glued onto a small epidermal wound, which is inflicted to the lower leaf surface by the female prior to oviposition. The oviduct secretion only functions as synomone elicitor when applied onto such a wound. Scratching a leaf by a scalpel to mimic the wound and application of oviduct secretion results into the release of synomones. Our studies on the specificity of the synomone induction showed that the attractiveness of induced volatiles was specific both for the Ulmus species and the herbivore species depositing eggs. Further steps in the egg parasitoid’s host location process are mediated by kairomones from host feces and egg masses. These kairomones were also shown to be host specific, since O. gallerucae clearly discriminates between host and non-host (e.g. Galerucella lineola) cues during host finding and host recognition. The tritrophic system studied here is characterized by oligophagous and monophagous relationships on the second and the third trophic level. These intrinsic characteristics of the tritrophic system might have been a prerequisite for the development of such selective responses of a parasitoid towards specific infochemicals and of the specific indirect defense reaction of the plant to oviposition of the chrysomelid host. KEY WORDS: elm leaf beetle, Oomyzus gallerucae, infochemicals oviposition behavior, synomones, kairomones, host specificity

228

Torsten Meiners & Monika Hilker

INTRODUCTION Most plants are endowed with constitutive (permanent) and inducible resistance systems against pathogens and herbivores. Herbivore feeding (mechanic damage of leaf tissue) can induce plants to produce chemicals that in turn decrease herbivore preference or performance on the plant (Tallamy and Raupp, 1991). While there is increasing knowledge on non-volatile induced chemicals (e.g., proteinase inhibitors, resistance related plant hormones) affecting the fitness of herbivores by killing them or reducing growth and fecundity (Karban and Baldwin, 1997), almost nothing is known about their effect on the third trophic level - the carnivores. Up to now, the use of induced plant volatiles seemed to be limited to larval parasitoids or predators (Dicke, 1994; Rutledge, 1996; Turlings and Benrey, 1998). Contrary to larval parasitoids, egg parasitoids should not rely on volatiles induced in plants by the feeding of herbivores. For egg parasitoids, volatiles of undamaged or damaged leaves are easy to detect but would not indicate the presence of host eggs with great reliability, except when the parasitoids have learned to connect plant volatiles with the presence of host eggs (Honda and Walker, 1996). Host eggs themselves would be a reliable odor source, but these odors have a low detectability, because eggs hardly emit any odors (Kaiser et al., 1989). Some egg parasitoids have applied an infochemical detour strategy (Vet and Dicke, 1992) to find their hosts’ eggs by orientating to cues from non-target life stages, e.g. sex or aggregation pheromones (Lewis et al., 1982; Noldus, 1988; Van Huis et al., 1994; Leal et al., 1995; Arakaki et al., 1996, 1997; Collazza et al., 1997). Much of the research on chemical cues mediating interactions between parasitoids and herbivorous hosts refers mainly to parasitoids of aphids or braconid wasps attacking lepidopterous larvae (Rutledge, 1996; Turlings and Benrey, 1998). However, the most diverse group of insect herbivores is the leaf beetles (Coleoptera: Chrysomelidae). A multitude of chrysomelid-plant relationships have evolved (Jolivet et al., 1988; Jolivet et al., 1994; Jolivet and Cox, 1996) that in turn might influence the range and the success of their hymenopteran and dipteran endo- and ectoparasitoids (Cox, 1994; Hilker and Meiners, 1999). Reproduction in parasitoids is based on the completion of different steps: host (micro-) habitat location, host location, host recognition, and host acceptance (e.g., Vinson, 1998). The foraging strategies of parasitoids are hypothesized to be largely shaped by their degree of specialization with respect to both their host specificity and the host plant range of the concerning herbivores. The specialist egg parasitoid Oomyzus gallerucae Fonscolombe (Hymenoptera, Eulophidae) feeds monophagously on the host Xanthogaleruca luteola (Mueller) (Coleoptera, Chrysomelidae) and the the beetle feeds on different elm (Ulmus) species (Fig. 1). In spring overwintering females of the elm leaf beetle deposit their yellow eggs (30-40 per batch) in rows exclusively on the under-surface of elm leaves. These eggs were often parasitized by O. gallerucae. Both, beetles and parasitoids undergo 2-3 generations in Southern France. X. luteola is known as a pest on different elm species in Europe, North America and Australia. O. gallerucae has repeatedly been introduced into the United States for biological control of the elm leaf beetle (Ehler et al., 1987; Hall and Johnson, 1983). The main goal of this paper is to provide information on the understanding of tritrophic level interactions between plants, herbivores, and egg parasitoids. A first overview on the interactions of X. luteola, its host plant U. minor Mill., and the egg parasitoid O. gallerucae was given by Hilker and Meiners (1999). Here we summarize now in detail the information we have gained so far on the tritrophic interactions in this system. First, answers to the following questions will be given: Does

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

229

Trophic Level III

Egg parasitoid: Oomyzus gallerucae

II

Herbivore: Xanthogaleruca luteola

I

Host plants: Ulmus spec.

Fig. 1. Trophic relationships of egg parasitoid, chrysomelid host, and host plants. Arrows indicate feeding relationships and orientation pattern.

the egg parasitoids O. gallerucae use any chemical cues (kairomones) from its chrysomelid hosts during the different stages of host approach? Are there any volatiles (synomones) from the chrysomelids’ foodplants involved in the host location and host finding of the eulophid wasp? Do the leaf beetles induce the emission of volatiles in host plants that affect the parasitoids’ host search? Which factor does elicit the induction of plant synomones? Is the induction of plant synomones by leaf beetle eggs locally restricted to the leaf carrying eggs or is it a systemic effect? How specific are the kairomones from the hosts and the synomones from the host plants for hostsearching O. gallerucae? How do the egg parasitoids solve the above outlined reliability/detectability problem? Then the specific utilization of infochemicals in this tritrophic system will be discussed from the viewpoint of each trophic level and related to the biology of the organisms involved. METHODS Insects and Rearing Conditions Adults and eggs of X. luteola were collected from 1992 - 1999 in Southern France. For detailed rearing conditions see Meiners and Hilker, 1997. Females of the tansy leaf beetle Galeruca tanaceti Linn., larvae of the lepidopteran species Opisthograptis luteolata (Linn.) (Geometridae) (feeding on U. minor) and eggs of Galerucella lineola (from leaves of Salix fragilis Linn.) were collected in the environs of Berlin. All insects were kept at 20 °C and 16h/8h [l:d], except the tansy leaf beetle, which was kept at 20 °C and 12h/12h [l:d]. Adults of X. luteola and caterpillars of O. luteolata were fed leaves of U. minor (except the experiment required another feeding regime), G. tanaceti were fed Chinese cabbage (Brassica pekinensis L.).

230

Torsten Meiners & Monika Hilker

Bioassays All observations and behavioral assays except for the olfactometer tests were made by using a stereomicroscope. The events of all bioassays were recorded by the Noldus Observer programme 3.0 (Wageningen, NL). Only experienced female parasitoids with prior contact to host eggs were studied. These females encountered host eggs two days prior to the experiments for a period of 24 h. Kairomones and Synomones Utilized in Habitat Location The effect of odors from the habitat of X. luteola was studied in a four arm airflow olfactometer similar to the one described by Vet et al. (1983) (for details see Meiners et al., 1997). In order to elucidate volatiles attractive to the parasitoids (kairomones) that are emitted by the host itself, the attractiveness of the following odor sources was tested: (a) 20 egg masses (48 hours old) of X. luteola that had been cautiously removed from elm leaves by using a razor blade, (b) 10 gravid females of X. luteola, (c) feces of 20 adult beetles that had been collected for 48 hours, (d) 10 third instar larvae of X. luteola, (e) and feces of 30 third instar larvae that had been collected for 48 hours. All experiments concerning plant volatiles were conducted with elm twigs with 15–20 leaves that were treated on the day of cutting. All treated twigs were tested only 72 h after treatment. During the period before testing, the twigs were kept in water at 20°C, 16L:8D, and 2000 lux. To investigate if any synomones from elm leaves attract the egg parasitoids and if they are emitted systemically, the following treatments were tested: undamaged elm leaves, elm leaves damaged by feeding of 20 adult beetles, twigs with feeding-damaged elm leaves onto which 15-20 egg masses were oviposited, feeding-damaged leaves (that had never contact with eggs) and eggs separately, feeding-damaged elm leaves where the egg masses were removed after oviposition, and leaves (without eggs) on a twig neighbored to leaves with egg masses (for details see Meiners and Hilker, 1997; Meiners et al., 2000). For oviposition, a gravid elm leaf beetle gnaws a small groove into the under-surface of a leaf and glues several rows comprising a total of about 10 to 30 eggs with its oviduct secretion into this groove. In order to elucidate when and how the elm leaf beetle female deposits a synomone elicitor and how the signal is transferred in the plant, the effects of volatiles from differently treated elm twigs and from elm leaf beetle eggs on the parasitoids were tested using the following odor sources: leaves that were scratched with a sharp scalpel and freshly oviposited egg masses transferred onto the wounds, scratched leaves with oviduct secretion smeared into the scratches, undamaged leaves with eggs transferred onto the undersurface (see also Meiners and Hilker, 2000). Data were statistically evaluated by FriedmanANOVA and pair wise comparisons were made using Wilcox-Wilcoxon tests. Kairomones Utilized in Host Finding To investigate whether contact cues from non-host feces and kairomones from feces of its host species elicit a response in O. gallerucae, elm leaves were offered for 48 hrs to adult elm leaf beetles or to caterpillars of O. luteolata in rearing containers. A piece of a filter paper contaminated with feces from caterpillars and a piece of filter paper contaminated with host-feces was offered sequentially in a Petri dish for three minutes to a female of O. gallerucae (n=15). When contacting host feces or host eggs, O. gallerucae shows a frequent drumming behavior with her antennae. The duration of antennal drumming on the filter paper was recorded (see Meiners et al., 2000). Data were statistically evaluated by Wilcoxon signed rank test for matched pairs.

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

231

Kairomones Utilized in Host Recognition An egg mass dummy made of filter paper, a non-host egg mass of G. lineola and a host egg mass of X. luteola were offered separately in Petri dishes to a female of O. gallerucae. The duration of antennal drumming on the dummy and the egg masses was recorded each for three minutes (n=10). Data were statistically evaluated by Kruskall-Wallis ANOVA and pair wise comparisons were made using the Mann-Whitney U test. RESULTS Kairomones and Synomones Utilized in Habitat Location Odors of elm leaf beetle eggs, of gravid females, and of larvae were not attractive to female O. gallerucae. However odor of feces from larvae and from adult beetles showed a kairomonal effect and attracted the parasitoids (Table 1; Meiners and Hilker, 1997). The odor from undamaged field elm leaves and the odor from elm leaves damaged by feeding of adult beetles were not attractive to O. gallerucae (Table 2; Meiners and Hilker, 1997). However, oviposition of the elm leaf beetle on elm leaves has an attractive effect towards the egg parasitoids. A combination of odors of feeding damaged leaves (that never had contact with eggs) and odor from egg masses was not active. However, odor of leaves where eggs have been removed 72 h after oviposition did affect the behavior of the female parasitoids. This shows that oviposition of the elm leaf beetle induces the emission of synomones attractive to O. gallerucae. Since also leaves neighbored to leaves with eggs emitted these synomones, the induction is systemic – a signal is transported from the site of oviposition to other Table 1. Response of female Oomyzus gallerucae to odours from its host Xanthogaleruca luteola. + preference of odour source over control odours; n.s. not significant; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • • •

eggs gravid females feces of adult leaf beetles larvae feces of larvae

RESPONSE

N

P

+

25 25 20 20 25

n.s. n.s. *** n.s. ***

+

Table 2. Response of female Oomyzus gallerucae to odours from differently treated Ulmus minor leaves. Feeding damage by Xanthogaleruca luteola. + preference of odour source over control odours; — avoidance; n.s. not significant; * p < 0.05; ** p < 0.01; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • • • • •

intact elm leaves artificially damaged elm leaves elm leaves damaged by feeding elm leaves damaged by feeding onto which eggs were deposited feeding damaged elm leaves and eggs combined feeding damaged elm leaves (eggs removed) neighboured leaves (systemic)

RESPONSE — + + +

N

P

25 25 20 40 25 30 36

n.s. * n.s. *** n.s. ** *

232

Torsten Meiners & Monika Hilker

leaves. The elicitor is located in the oviduct secretion that coats the eggs. Epidermal wounding is necessary (possibly by mediating direct contact of the elicitor with the plant cells), but is not active alone (Table 3; Meiners and Hilker, 2000). Leaves of U. glabra Huds. carrying eggs of the elm leaf beetle did not emit odors that significantly attracted O. gallerucae. Eggs of G. tanaceti transferred onto leaves of U. minor did not induce these leaves to emit an odor that attracted or arrested O. gallerucae (Table 4; Meiners et al., 2000). Kairomones Utilized in Host Finding When offering filter paper pieces treated with feces of adult elm leaf beetles and filter paper pieces treated with feces of the geometrid larvae of O. luteolata fed on elms, the parasitoids showed significantly longer drumming behavior when contacting the host feces (Table 5; Meiners et al., 2000). Kairomones Utilized in Host Recognition The dummy, non-host eggs and host eggs elicited significantly different degrees of host recognition behavior in O. gallerucae. Antennal drumming was significantly longer on the eggs of the chrysomelid Table 3. Response of female Oomyzus gallerucae to odours from differently treated Ulmus minor leaves. Scratching done by scalpell. + preference of odour source over control odours; — avoidance; n.s. not significant; ** p < 0.01; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • •

scratched elm leaves scratched elm leaves with transplanted eggs scratched elm leaves and oviduct secretion undamaged elm leaves and transplanted eggs

RESPONSE

N

P

+ +

20 32 31 21

n.s. ** *** n.s.

Table 4. Response of female Oomyzus gallerucae to odours from leaves of two elm species treated with eggs of different galerucine leaf beetles. n.s. not significant (Friedman – ANOVA). TESTED ODOUR SOURCE change of the plant species: • Ulmus glabra leaves with eggs of X. luteola change of the herbivore: • Ulmus minor leaves with eggs of Galeruca tanaceti

N

P

22

n.s.

22

n.s.

Table 5. Specificity of host finding cues. Response of female Oomyzus gallerucae to contact with feces from host and non-host herbivores feeding on Ulmus minor. * p < 0.05; *** p < 0.001(Wilcoxon signed rank test). TEST PARAMETER Duration [s] of antennal drumming spent on substratum

FECES OF Lepidopteran larva (Opistograpthis luteola)

N

P

Elm leaf beetles 21.3 + 24.2 68.4 + 43.8

1.9 + 4.0 45.3 + 23.8

15 15

*** *

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

233

Table 6. Specificity of host recognition cues. Response of female Oomyzus gallerucae to contact with egg masses from host and non-host galerucine leaf beetles and a filter paper dummy. * p < 0.05; *** p < 0.001(Wilcoxon signed rank test). TESTED EGG MASS filter paper dummy Galerucella lineola Xanthogaleruca luteola

Duration of antennal drumming [s]

N

P

0.2 + 0.4 6.7 + 5.3 60.1 + 37.1

10 10 10

a b c

non-host than on the filter paper dummy, but duration of antennal drumming on host eggs was by far the longest (Table 6; Meiners et al., 2000). DISCUSSION The use of semiochemicals (chemicals involved in the chemical interactions between organisms) in tritrophic systems should be influenced by the ecological setting, the evolutionary potential of the users, and the evolutionary consequences of their use (Price, 1981). In the following we will look at different factors that might influence the host location of parasitoids. First we will outline how plants, leaf beetles, the parasitoids themselves and associated organisms may influence the suitability of kairomones and synomones for the host search of parasitoids. Then a connection is drawn between infochemical use of the parasitoid, its life history and the phenology of its host. The final conclusion suggests further directions in studying tritrophic level interactions. How do Plants Influence Host Search of Parasitoids? Plants can influence the interactions between parasitoids and herbivores in different ways (reviewed in Price et al., 1980; Godfray, 1994). For example, plants may provide food (nectar) for the parasitoids (Patt et al., 1997; Baggen and Gurr, 1998), plant architecture can affect the parasitoids’ host searching process (Wang et al., 1997; Romeis et al., 1998), plant quality and toxins can influence the parasitoids via host quality (e.g., Reitz and Trumble, 1996). Finally plants can attract parasitoids by emitting volatiles. The emission of specific plant volatiles that are only induced after herbivore feeding was shown in the last ten years for different tritrophic systems (Turlings et al., 1990; 1991; Dicke, 1994; Mattiacci et al., 1994; Du et al., 1996; 1998). It has been suggested that the primary function of these induced chemicals is defense against herbivores and micro-organisms (Turlings and Tumlinson, 1991). The plant would only gain secondary benefit from attracting parasitoids. Although egg parasitoids are of great importance as biological control agents (Wajnberg and Hassan, 1994) and much is known about their use of kairomones in host location and host recognition (e.g., Strand and Vinson, 1982; Noldus and van Lenteren, 1985; Frenoy et al., 1992; Mattiacci et al., 1993; Aldrich et al., 1995; Conti et al., 1996; Lee et al., 1997), little is known about synomone use in egg parasitoids (Honda and Walker, 1996; Romeis et al., 1997) and up to this study nothing was known about the use of induced synomones. The induced chemicals in the field elm attracting egg parasitoids of O. gallerucae after oviposition of the elm leaf beetle (Table 2; Meiners and Hilker, 1997; 2000) might also have served primarily as defense against micro-organisms or to prevent further egg depositions or future feeding of developing larvae. Up to now it is unknown whether induced elm leaves affect the performance of elm leaf

234

Torsten Meiners & Monika Hilker

beetles, but there are some studies which have shown that herbivore-induced changes influence oviposition site preference and feeding behavior of other herbivorous insects (e.g., Baur, et al., 1996; McAuslane and Alborn, 1998; Anderson and Alborn, 1999). Specific volatiles emitted by plants in response to oviposition of an arthropod can allow egg parasitoids to track directly the host’s lifestage needed for reproduction. This mechanism represents an elegant solution of the reliability/detectability problem for egg parasitoids by providing them with both detectable and reliable information on the presence of host eggs. How do the Hosts Influence the Host Search of Parasitoids? Organisms should avoid giving away any clue that might deliver information on their presence to predators or parasitoids. However, since organisms have to feed, to defend themselves against enemies, and to reproduce from time to time they inevitably leave traces in their environment that can be used by their antagonists as kairomones. Although much is known about infochemical use by parasitoids during host search (Vinson, 1991; Rutledge, 1996; Hilker and Meiners, 1999), there is little information on how hosts might influence this process to avoid parasitization. Feeding on different plant species might alter the kairomonal activity of a herbivore’s feces in a way that it becomes unrecognizable to the parasitoid. Being polyphagous can also influence synomone use of parasitoids. Females of X. luteola might avoid plant synomone induction by choosing other elm species than the field elm for egg deposition or by changing their oviposition behavior (Meiners et al., 2000). However, these changes might affect their progeny’s fitness negatively in other ways. How Can the Internal State of Parasitoids Affect Host Location? The patterns of host selection and host use by arthropod parasitoids are assumed to show high plasticity, responding to environmental conditions and physiological states (Heimpel et al., 1996). Intraspecific intrinsic variation in foraging behavior of parasitoids is assumed to have three major sources: physiological state of the parasitoid, phenotypic plasticity (learning capacity), and genotypically fixed differences between individuals (Lewis et al., 1990). The physiological state of the female parasitoids was shown to have a strong effect on the number of ovipositions (Van Roermund et al., 1997). The host value varies dynamically with parasitoid state variables such as egg load and prior experience (Mackauer et al., 1996). These and other internal factors like age (Hérard et al., 1988), mating status (Guertin et al., 1996) and general health status (Hamm et al., 1988) can influence the parasitoids’ response to infochemical cues by modifying the parasitoids’ activity, motivation and reactivity. A lack of mature eggs can reduce the response to olfactory cues (Shahjahan, 1974), hungry parasitoids are supposed to react to plant volatiles indicating food, whereas females foraging for hosts are supposed to orient to host or host plant cues (Lewis et al., 1990). Experience of female parasitoids can alter their response to semiochemicals during host search (Honda and Walker, 1996; Du et al., 1997; Steidle and Schöller, 1997; Geervliet et al., 1998). This plasticity is assumed to be more prevalent in specialist parasitoids than in generalists, which possess a larger niche breadth (Vet et al., 1990). Genotypically fixed differences among individuals are adapted to different foraging environments and can be reflected in the geographic variation of infochemical use. The females of O. gallerucae became experienced by oviposition and motivated for host searching prior to the experiments (Meiners and Hilker, 2000). Age, mating status and physiological needs of

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

235

the parasitoids were taken into account (Hamerski and Hall, 1988; Köpf, 1993; Stein, 1995). This standardization of the parasitoids’ rearing conditions does not reflect the situation in the field. Further investigations on the infochemical use of parasitoids should include the variation of internal factors, especially when the studies are carried out with respect to application of parasitoids as biological control agents. How Are the Interactions in the Investigated Tritrophic System Influenced by Other Species? Systems focusing on the three species of three trophic levels cannot be looked at isolated from trophic and communicational relationships with other organisms. Price (1981) gives an excellent overview over all possible interactions in multitrophic systems. The study of semiochemicals in a certain system has to take into account the influence of associated plants and insects on the communicational interactions in the respective system. Associated plants and insects are plants growing near the host plant and other insects in the foodwebs based on these plants. Feces of non-hosts feeding on the same plant did not elicit host finding behavior in O. gallerucae (Table 4, Meiners et al., 2000). This mechanism prevents the studied parasitoids from mistaking cues from non-host herbivores for host cues. Does the Use of Certain Kairomones and Synomones by O. gallerucae Correspond to the Life History of this Parasitoid or to the Phenology of its Host? In the linear trophic system O. gallerucae - X. luteola - U. minor the egg parasitoid can ‘concentrate’ on infochemicals from one specific host and from a few species of the genus Ulmus. The specialist O. gallerucae uses host cues and host plant cues (emanating after host-plant interaction) for habitat location. O. gallerucae parasitizes monophagously eggs of X. luteola, which is restricted to elms as foodplants. This means that the female parasitoids can rely on elm-specific synomones and host-specific kairomones in locating the host’s habitat. The use of fecal host kairomonal (Table 1) and specifically induced elm volatiles (Table 2) reflects the host specificity of O. gallerucae and the narrow foodplant range of X. luteola. The fact that infochemicals from both first and second trophic level affect foraging behavior of O. gallerucae might be explained by the phenologies of the parasitoid and the host. When overwintering females of O. gallerucae start foraging for host eggs in spring, the population density of likewise overwintered X. luteola might be very low. In that case volatiles from feces would not be a very detectable host location cue for the parasitoids and induced synomones might be responsible for parasitization success of O. gallerucae. This situation changes when the population size of elm leaf beetles increases during the season with the emergence of further generations of X. luteola. Egg parasitoids are dependent on having enough time to develop in their host’s eggs (Vinson, 1998). Consequently parasitoid females have to find host eggs within a certain period of time. This period might be important for the eulophid O. gallerucae, because eggs of the elm leaf beetle X. luteola develop within seven days. O. gallerucae has to find and parasitize host eggs within three days after oviposition of the elm leaf beetle (Stein, 1995). The induction time of 72 hrs chosen in the experiments corresponded with this period. As a consequence the selection pressure on O. gallerucae to utilize chemicals connected with oviposition might be very high and favor the specific synomone use described in Meiners and Hilker (2000). To summarize, the degree of host specialization of the egg parasitoid reflects in infochemical use during host location processes. The specialist O. gallerucae uses host cues and host plant cues for habitat location. In the host finding process O. gallerucae uses contact kairomones from the feces of

236

Torsten Meiners & Monika Hilker

its host (Meiners and Hilker, 1997; Meiners et al., 2000) and is thus able to locate their chrysomelid hosts in the habitat. CONCLUSIONS AND OUTLOOK Our work provides new aspects of the interaction between plants, chrysomelid herbivores, and eulophid egg parasitoids. It was shown for the first time that oviposition of a phytophagous insect induces a plant to emit volatiles that are attractive to an antagonist of the herbivore. To fully understand the phenomenon of the attraction of the egg parasitoid O. gallerucae by volatile synomones induced in the field elm by oviposition of X. luteola, it is necessary to undertake further investigations on the chemical nature and the specificity of the induced volatiles and the inducing elicitor. Geographic variation of infochemical use by parasitoids is likely to occur, but it has hardly been studied so far. Variation in chemicals within a plant species or chemical differences between host plants utilized by a single herbivorous species may alter considerably the chemical environment in which the herbivore and its enemy live thus modifying the interactions between all three trophic levels. Natural populations are likely to be highly variable in space and time. Different selection pressures may operate on all trophic levels in different geographic environments or they may change with time in one single location. For example, different elm species show differences in the constituent secondary plant metabolites (Santamour, 1972). It would be interesting to study variation in searching behavior and infochemical use of the egg parasitoid O. gallerucae on a geographical scale. A plant’s capacity to make up for tissue losses by herbivory is to some extent dependent on its life form (Whitham et al., 1991). Therefore long-lived trees might have other strategies of host defense than short-lived annuals or biennials (Coley et al., 1985). The allocation of resources between direct and indirect defense might differ for both plant types and that might affect their interactions with the antagonists of their herbivorous enemies. Hawkins (1994) showed that the complexity of the plant architecture has an effect on parasitoid species richness with herbs having less parasitoid species than shrubs and the latter less than trees in natural habitats. The authors discuss several reasons for this phenomenon concerning the host’s foodplant - habitat interactions. It might be possible that different infochemical abilities between the different plant types influence the parasitoid species richness. Evaluating plant specificity of volatile induction in elm species by the oviposition of X. luteola might help to gain information on the evolution of the tritrophic communication between elms, elm leaf beetles and O. gallerucae. If there is a general mechanism of induction, close relatives to the field elm should also attract O. gallerucae, and the effect should diminish with increasing distance from the original system. The role of induced plant responses for the second trophic level, the elm leaf beetles, remains to be elucidated. This work was mainly focused on the infochemical use of volatiles by the third trophic level, the parasitoids. Contrary to the growing knowledge on the use of induced plant volatiles by predators and parasitoids, only little is known about how herbivores are influenced by herbivoreinduced secondary plant chemicals in their performances like foodplant orientation, feeding behavior or oviposition site preference (Baur et al., 1996; Bolter et al., 1997; McAuslane and Alborn, 1998). The study of interactions between elms and elm leaf beetles seems to be promising to supply additional information on the use of volatile infochemicals by the second trophic level, the herbivores. Consideration of the third trophic level (natural enemies of herbivores) when studying insect-plant interactions helps to improve ecological understanding and offers also the possibility to improve biological control (Poppy, 1997). Knowledge of the chemical nature of kairomones and synomones

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

237

could be applied for biological control. Useful parasitoids could be directed with the help of an odor stimulus to threatened plant cultures before the host density reaches a critical level. This might work at least in some cases where plants in distinct areas need protection. Elms and unwillingly elm leaf beetles have been introduced into North America and Australia. The control of the elm leaf beetle has gained increasing interest and financial support (Dahlsten et al., 1994; Kwong and Field, 1994). While the release of O. gallerucae and thus biological control of the elm leaf beetle has succeeded in some cases in North America, it has failed in Australia. If the chemical nature of the kairomones and synomones that lead O. gallerucae to its host and the physiology of the plant reaction are known, this knowledge might be employed to improve protection of elms against the elm leaf beetle in the field. ACKNOWLEDGEMENTS We thank Katja Hadwich and Christine Westerhaus for their help in culturing and testing the insects and Eva Häffner for providing drawings on plants, beetles and parasitoids. Two anonymous reviewers gave valuable comments on this manuscript. This research was supported in part by DFGgrants Hi-416/3-2 and Hi-416/3-3. LITERATURE CITED Aldrich, J. R., Rosi, M. C. and F. Bin 1995. Behavioral correlates for minor volatile compounds from stink bugs (Heteroptera: Pentatomidae). Journal of Chemical Ecology 21:1907-1920. Anderson, P. and H. T. Alborn 1999. Effects on oviposition behaviour and larval development of Spodoptera littoralis by herbivore-induced changes in cotton plants. Entomologia Experimentalis et Applicata 92:45-51. Arakaki, N., S. Wakamura, and T. Yasuda 1996. Phoretic egg parasitoid, Telenomus euproctidis (Hymenoptera: Scelionidae), uses sex pheromone of tussock moth Euproctis taiwana (Lepidoptera: Lymantriidae) as a kairomone. Journal of Chemical Ecology 22:1079-1085. Arakaki, N., S., Wakamura, T. Yasuda and K. Yamagishi 1997. Two regional strains of a phoretic egg parasitoid, Telenomus euproctidis (Hymenoptera: Scelionidae), that use different sex pheromones of two allopatric tussock moth species as kairomones. Journal of Chemical Ecology 23:153-161. Baggen, L. R. and G. M. Gurr 1998. The influence of food on Copidosoma koehleri (Hymenoptera: Encyrtidae) and the use of flowering plants as a habitat management tool to enhance biological control of potato moth, Phthorimaea opercullela (Lepidoptera: Gelechiidae). Biological Control 11:9-17. Baur, R., V. Kostal, B. Parrian and E. Städler 1996. Preferences for plants damaged by conspecific larvae in ovipositing cabbage root flies: influence of stimuli from leaf surface and roots. Entomologia Experimentalis et Applicata 81:353-364. Bolter, C. J., M. Dicke, J. J. A. Van Loon, J. H. Visser and M. A. Posthumus 1997. Attraction of Colorado potato beetle to herbivore-induced plants during herbivory and after its termination. Journal of Chemical Ecology 23:1003-1023. Colazza, S., M. C. Rosi and A. Clemente 1997. Response of egg parasitoid Telenomus busseolae to sex pheromone of Sesamia nonagrioides. Journal of Chemical Ecology 23:2437-2444. Coley, P. D., J. P. Bryant and F. S. Chapin III 1985. Resource availability and plant antiherbivore defense. Science 230:895-899. Conti, E., W. A. Jones, F. Bin and S. B. Vinson 1996. Physical and chemical factors involved in host recognition behavior of Anaphes iole Girault, an egg parasitoid of Lygus hesperus Knight (Hymenoptera: Mymaridae, Heteroptera: Miridae). Biological Control 7:10-16.

238

Torsten Meiners & Monika Hilker

Cox, M. L. 1994. The hymenoptera and diptera parasitoids of Chrysomelidae, pp. 419-468. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Press, Dordrecht. Dahlsten, D. L., D. L. Rowney and S. M. Tait 1994. Development of integrated pest management pro grams in urban forests: The elm leaf beetle (Xanthogaleruca luteola (Muller)) in California, USA. Forest Ecology and Management 65:31-44. Dicke, M. 1994. Local and systemic production of volatile herbivore-induced terpenoids: their role in plantcarnivore mutualism. Journal of Plant Physiology 143:465-472. Du, Y. J., M. Poppy and W. Powell 1996. Relative importance of semiochemicals from first and second trophic levels in host foraging behavior of Aphidius ervi. Journal of Chemical Ecology 22:1591-1605. Du, Y., G. M. Poppy, W. Powell, J. A. Picket, L. J. Wadhams and C. M. Woodcock 1998. Identification of semiochemicals released during aphid feeding that attract parasitoid Aphidius ervi. Journal of Chemical Ecology 24:1355-1368. Du, Y., G. M. Poppy, W. Powell and L. J. Wadhams 1997. Chemically mediated associated learning in the host foraging behavior of the aphid parasitoid Aphidius ervi (Hymenoptera: Braconidae). Journal of Insect Behavior 10:509-522. Ehler, L. E., R. L. Bugg, M. B. Hertlein, H. P. Sauter and K. Thrarinsson 1987. Patch-exploitation patterns in an egg parasitoid of the elm leaf beetle. Entomophaga 32:233-239. Frenoy, C., C. Durier, and N. Hawlitzky. 1992. Effect of kairomones from egg and female adult stages of Ostrinia nubialis (Hübner) (Lepidoptera, Pyralidae) on Trichogramma brassicae Bezdenko (Hymenoptera, Trichogrammatidae) female kinesis. Journal of Chemical Ecology 18:761-773. Geervliet, J. B. F., A. I. Vreugdenhil, M. Dicke and L. E. M. Vet 1998. Learning to discriminate between infochemicals from different plant-host complexes by the parasitoids Cotesia glomerata and C. rubecula. Entomologia Experimentalis et Applicata 86:241-252. Godfray, H. C. J. 1994. Parasitoids. Behavioral and evolutionary ecology. Princeton, Princeton University Press. 473 pp. Guertin, D. S., P. J. Ode, M. R. Strand and M. F. Antolin 1996. Host-searching and mating in an outbreeding parasitoid wasp. Ecological Entomology 21:27-33. Hall, R. W. and N. F. Johnson 1983. Recovery of Tetrastichus gallerucae (Hymenoptera: Eulophidae), an introduced egg parasitoid of the elm leaf beetle (Pyrrhalta luteola) (Coleptera: Chrysomelidae). Journal of the Kansas Entomological Society 56:297-298. Hamerski, M. R. and R. W. Hall 1988. Laboratory rearing of Tetrastichus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle (Coleoptera:Chrysomelidae). Journal of Economic Entomology 81:1503-1505. Hamm, J. J., E. L. Steyer and W. J. Lewis 1988. A baculovirous pathogenic in the parasitoid, Microplitis croceipes (Hymenoptera, Braconidae). Journal of Invertebrate Pathology 52:189-191. Hawkins, B. A. 1994. Pattern and process in host-parasitoid interactions. Cambridge: University Press. Heimpel, G. E., J. A. Rosenheim and M. Mandel 1996. Egg limitation, host quality, and dynamic behavior by a parasitoid in the field. Ecology 77:2410-2420. Hérard, F., M. A. Keller, W. J. Lewis and J. H. Tumlinson 1988. Beneficial arthropod behaviour mediated by airborne semiochemicals. III. Influence of age and experience on flight chamber responses of Microplitis demolitor Wilkinson. Journal of Chemical Ecology 14:1583-1596. Hilker, M. and T. Meiners 1999. Chemical cues mediating interactions between chrysomelids and parasitoids, pp. 197-216. In: M. J. Cox (Ed.), Advances in Chrysomelidae Biology. Backhuys Publishers. Leiden, The Netherlands.

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

239

Honda, J. Y. and G. P. Walker 1996. Olfactory response of Anagrus nigriventris (Hym.: Mymaridae): Effects of host plant chemical cues mediated by rearing and oviposition experience. Entomophaga 41:3-13. Jolivet, P. H. A. and M. L. Cox (Eds.). 1996. Chrysomelidae biology, (Vol. I-III). SPB Academic Publishing bv., Amsterdam. Jolivet, P. H. A., M. L. Cox and E. Petitpierre (Eds.). 1994. Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Jolivet, P. H. A., E. Petitpierre and T. H. Hsiao 1988. Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Kaiser, L., M. H. Pham-Delègue, E. Backchine and C. Masson 1989. Olfactory response of Trichagramma madidis Pint. et Voeg.; effect of chemical cues and behavioural plasticity. Journal of Insect Behavior 2:701710. Karban, R. and I. T. Baldwin 1997. Induced responses to herbivory. The University of Chicago Press, Chicago. Köpf, A. 1993. Die Bedeutung der Galerucinen-Anthrachinone für Parasitoide und Prädatoren. Diplomarbeit, Universität Bayreuth. Kwong, R. M. and R. P. Field 1994. Elm leaf beetle life history and distribution in southern Victoria. Plant Protection Quarterly 9:43-47. Leal, W.-S., H. Higuchi, N. Mizutani, H. Nakamori, T. Kadosawa and M. Ono 1995. Multifunctional communication in Riptortus clavatus (Heteroptera: Alydidae): Conspecific nymphs and egg parasitoid Oocencyrtus nezarae use the same adult attractant pheromone as chemical cue. Journal of Chemical Ecology 973-985. Lee, H. P., K. S. Boo, S. O. Kim and K. S. Lee. 1997. Gypsy moth kairomones affecting host acceptance behavior of the egg parasitoids Ooencyrtus kuvanae (Hymenoptera: Encyrtidae). Korean Journal of Applied Entomology 36:88-95. Lewis, W. J., D. A. Nordlund, R. C. Gueldner, P. E. A. Teal and J. H. Tumlinson 1982. Kairomones and their use for management of entomophagous insects. XIII. Kairomonal activity for Trichogramma spp. of abdominal tips, excretion and a synthetic sex pheromone blend of Heliothis zea (Boddie) moths. Journal of Chemical Ecology 8:1323-1331. Lewis, W. J., L. E. M. Vet, J. H. Tumlinson, J. C. van Lenteren and D. R. Papaj 1990. Variations in parasitoid foraging behavior: essential element of a sound biological control theory. Environmental Entomology 19:1183-1193. Mackauer, M., J. P. Michaud and W. Völkl 1996. Host choice by aphidiid parasitoids (Hymenoptera: Aphidiidae): Host recognition, host quality, and host value. Canadian Entomologist 128:959-980. Mattiacci, L., M. Dicke and M. A. Posthumus 1994. Induction of parasitoid attracting synomone in brussels sprouts plants by feeding of Pieris brassicae larvae: role of mechanical damage and herbivore elicitor. Journal of Chemical Ecology 20:2229-2247. Mattiacci, L., S. B. Vinson, H. J. Williams, J. R. Aldrich and F. Bin 1993. A long-range attractant kairomone for egg parasitoid Trissolcus basalis, isolated from defensive secretion of its host, Nezara viridula. Journal of Chemical Ecology 19:1167-1181. McAuslane, H. J. and H. T. Alborn 1998. Systemic induction of allelochemicals in glanded and glandless isogenic cotton by Spodoptera exigua feeding. Journal of Chemical Ecology 24:399-416. Meiners T. and M. Hilker 1997. Host location in Oomyzus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle Xanthogaleruca luteola (Coleoptera: Chrysomelidae). Oecologia 112:87-93. Meiners T. and M. Hilker 2000. Induction of plant synomones by oviposition of a phytophagous insect. Journal of Chemical Ecology 26:221-232. Meiners T., C. Westerhaus and M. Hilker 2000. Specificity of chemical cues used by a specialist egg parasitoid during host location. Entomologia Experimentalis et Applicata 95:151-159.

240

Torsten Meiners & Monika Hilker

Noldus, L. P. J. J. 1988. Response of the egg parasitoid Trichogramma pretiosum to the sex pheromone of its host Heliothis zea. Entomologia Experimentalis et Applicata 48:293-300. Noldus, L. P. J. J. and J. C. van Lenteren 1985. Kairomones for the egg parasite Trichogramma evanescens Westwood. II. Effect of contact chemicals produced by two of its hosts, Pieris brassicae L. and Pieris rapae L. Journal of Chemical Ecology 11:793-800. Patt, J. M., G. C. Hamilton and J. H. Lashomb 1997. Foraging success of parasitoid wasps on flowers: interplay of insect morphology, floral architecture and searching behavior. Entomologia Experimentalis et Applicata 83:21-30. Poppy, G. M. 1997. Tritrophic interactions: Improving ecological understanding and biological control? Endeavour 21:61-65. Price, P. W. 1981. Semiochemicals in evolutionary time, pp. 251-279. In: D. A. Nordlund, R. L. Jones and W. J. Lewis (Eds.), Semiochemicals, their Role in Pest Control. J. Wiley, New York. Price, P. W., C. E. Bouton, P. Gross, B. A. McPheron, J. N. Thompson and A. E. Weis 1980. Interactions among three trophic levels: Influence of plants on interactions between insect herbivores and natural enemies. Annual Review of Ecological Systematics 11:41-65. Reitz, S. R. and J. T. Trumble 1996. Tritrophic interactions among linear furanocoumarins, the herbivore Trichoplusia ni (Lepidoptera: Noctuidae), and the polyembryonic parasitoid Copidosoma floridanum (Hymenoptera: encyrtidae). Environmental Entomology 25:1391-1397. Romeis, J., T. G. Shanower and C. P. W. Zebitz 1997. Volatile plant infochemicals mediate plant preference of Trichogramma chilonis. Journal of Chemical Ecology 23:2455-2465. Romeis, J., T. G. Shanower and C. P. W. Zebitz 1998. Physical and chemical plant characters inhibiting the searching behaviour of Trichogramma chilonis. Entomologia Experimentalis et Applicata 87:275-284. Rutledge, C. E. 1996. A survey of identified kairomones and synomones used by insect parasitoids to locate and accept their hosts. Chemoecology 7:121-131. Santamour, F. S. 1972. Flavonoid distribution in Ulmus. Bulletin Torrey Botanical Club 99:127-131. Shahjahan, M. 1974. Erigeron flowers as a food and attractive odour source for Peristenus pseudopallipes, a braconid parasitoid of the tarnished plant bug. Environmental Entomology 3:69-72. Steidle, J. L. M. and M. Schöller 1997. Olfactory host cues and learning in the granary weevil parasitoid Lariophagus distinguendus (Hymenoptera: Pteromalidae). Journal of Insect Behavior 10:331-342. Stein, C. 1995. Untersuchungen zur Bedeutung chemischer und physikalischer Signale für die Parasitoide von Blattkäfer-Eiern der Unterfamilie Galerucinae durch die Parasitoide Oomyzus gallerucae und O. galerucivorus (Chalcidoidea; Eulophidae). Diplomarbeit, Universität Bayreuth. Strand, M. R. and S. B. Vinson 1982. Source and characterization of an egg recognition kairomone of Telenomus heliothidis, a parasitoid of Heliothis virescens. Physiological Entomology 7:83-90. Tallamy, D. W. and M. J. Raupp 1991. Phytochemical induction by herbivores. New York: John Wiley. Turlings, T. C. J. and B. Benrey 1998. Effects of plant metabolites on the behavior and development of parasitic wasps. Ecoscience 5:321-333. Turlings, T. C. J. and J. H. Tumlinson 1991. Do parasitoids use herbivore-induced plant chemical defenses to locate hosts? Florida Entomologist 74:42-50. Turlings, T. C. J., J. H. Tumlinson, F. J. Eller and W. J. Lewis 1991. Larval-damaged plants: source of volatile synomones that guide the parasitoid Cotesia marginiventris to the microhabitat of its host. Entomologia Experimentalis et Applicata 58:72-85. Turlings, T. C. J., J. H. Tumlinson and W. J. Lewis 1990. Exploitation of herbivore-induced plant odors by host seeking parasitic wasps. Science 250:1251-1253.

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

241

Van Huis, A., C. Schütte, M. H. Cools, P. Fanget, H. Van der Hoek and S. P. Piquet 1994. The role of semiochemicals in host location by Uscana lariophaga, egg parasitoid of Callosobruchus maculatus. Proceedings of the 6th International Working Conference on Stored-product Protection 2:1158-1164. Van Roermund, H. J. W., J. C. Van Lenteren and R. Rabbinge 1997. Analysis of foraging behavior of the whitefly parasitoid Encarsia formosa on a leaf: A simulation study. Biological Control 8:22-36. Vet, L. E. M. and M. Dicke 1992. Ecology of infochemical use by natural enemies in a tritrophic context. Annual Review of Entomology 37:141-172. Vet, L. E. M., W. J. Lewis, D. R. Papaj and J. C. van Lenteren 1990. A variable-response model for parasitoid foraging behaviour. Journal of Insect Behavior 3:471-490. Vet, L. E. M., J. C. Lenteren, M. van, Heymanns and E. Meelis 1983. An airflow olfactometer for measuring olfactory responses of hymenopterous parasitoids and other small insects. Physiological Entomology 8:97106. Vinson, S. B. 1991. Chemical signals used by parasitoids, pp. 15-42. In: F. Bin (Ed.), Proceedings of the 4th European workshop, Insect prasitoids, (Perugia, April 3-5: 1991). Redia, Perugia. Vinson, S. B. 1998. The general host selection behavior of parasitoid Hymenoptera and a comparison of initial strategies utilized by larvaphagous and oophagous species. Biological Control 11:79-96. Wajnberg, E. and S. A. Hassan 1994. Biological control with egg parasitoids. Oxford University Press, Oxford. Wang, B., D. N. Ferro and D. W. Hosmer 1997. Importance of plant size, distribution of egg masses, and weather conditions on egg parasitism of the European corn borer, Ostrinia nubilalis by Trichogramma ostriniae in sweet corn. Entomologia Experimentalis et Applicata 83:337-345. Whitham, T. G., J. Maschinski, K. C. Larson and K. N. Paige 1991. Plant responses to herbivory, the continuum from negative to positive and underlying physiological mechanisms, pp. 227-256. In: P. W. Price, T. M. Lewinsohn, G. W. Fernandes and W. W. Benson (Eds.), Plant-Animal Interactions. Evolutionary Ecology in Tropical and Temperate Regions. John Wiley, New York.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers The Advantages and Disadvantages of Larval Abdominal Shields the 243 Specialon Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 243-259

The Advantages and Disadvantages of Larval Abdominal Shields on the Chrysomelidae: Mini-review Caroline Müller1,2 and Monika Hilker2 1

Institute of Evolutionary and Ecological Sciences, Leiden University, P.O. Box 9516, NL - 2300 RA Leiden, The Netherlands. E-mail: [email protected] 2 Freie Universität Berlin, Institut für Zoologie, Haderslebener Str. 9, 12163 Berlin, Germany

ABSTRACT Several chrysomelid larvae, namely members of the Criocerinae, Alticinae, Hispinae, and Cassidinae, collect their faeces and the latter two also exuviae at their abdominal tips and form a so-called abdominal shield. Possible protective functions of these shields towards unfavourable abiotic and biotic factors have been discussed for a long time. It has been suggested that the shields are used as a defensive device against predators. During recent years more and more experiments have been conducted in total in 15 different chrysomelid species to study the effectiveness of these structures towards predators such as Araneae, Dermaptera, Neuroptera, Heteroptera, Coleoptera, and Hymenoptera. The effectiveness of the chrysomelid shields against these different antagonists varies from advantageous effects, meaning that the attacker can be repelled or deterred, to disadvantageous effects, meaning that some predators are even attracted by the shield. These conflicting reactions of predators were found in Cassida stigmatica and C. denticollis, tortoise beetles larvae feeding on tansy [Tanacetum (Chrysanthemum) vulgare, Asteraceae]. In this mini-review, the experiments on the defensive effectiveness of larval shields in these tansy feeding cassidine species are outlined and embedded in a summary of experimental studies on the effectiveness of the larval shields of Criocerinae, Hispinae, Alticinae, and Cassidinae. The overview considers the studies with respect to (a) the shield type (faecal or exuvial), (b) the taxonomy and type of the predatory species, (c) the host plant chemistry, (d) the role of physical cues of the shields (mobility, detachability), and (e) the larval behaviour (aggregation).

INTRODUCTION Herbivorous insects may defend against predators and parasitoids by an array of devices that include specific morphological structures, noxious chemicals, and movements that serve to repel enemies. For the large beetle familiy Chrysomelidae, the effectiveness of defensive devices has been studied for all life stages. These include eggs covered by faeces or secretions (e.g. Pasteels et al. 1988a, Hilker 1994); larvae with spines, eversible glands, or abdominal shields (e.g. Pasteels and Grégoire 1984, Dettner 1987, Blum 1994); the pupal stage, with exuvia of the last larval instar,

244

Caroline Müller & Monika Hilker

which may contain exocrine glands filled with volatile secretions (Matsuda and Sugawara 1980, Cox 1994); and the adults, with their pronotal and elytral glands or their digestive regurgitates or reflex bleeding (e.g. Pasteels et al. 1982, Rowell-Rahier et al. 1995). However, benefits from the evolution of effective defensives against generalist enemies may be offset by costs from specialist predators or parasitoids that evolve means to counter the defences. For example, the glandular secretion of several chrysomeline larvae effectively deter ants (Pasteels et al. 1986), but are used by specialists like predatory syrphid larvae as chemical beacons, or kairomones (Köpf et al. 1997). Furthermore, some antagonists have learning abilities and can habituate to previously encountered “defensives” (Pasteels and Grégoire 1984). Additionally, the production of defensives can be costly. Several cost-benefit studies have demonstrated the trade-offs, or costs (Pasteels et al. 1988b, Olmstead and Denno 1992). This paper focuses on the effectiveness of the abdominal shields of larval members of chrysomelid subfamilies, namely members of the Criocerinae, Alticinae, Hispinae, and Cassidinae. The larval cases of Camptosomata will not be considered here (therefore, see Olmstead 1994). In the cassidines, shields are formed by an unusual procedure. At every moult, the exuviae stay attached to two caudal processes that project forward from the abdominal tip close to the anal turret. Moist faeces or faecal strands are glued on the shield in a symmetrical manner (Eisner and Eisner 2000). Barbs on the processes of early instar-larvae may help in the retention of shield material (McBride et al. 2000). The consistency and chemistry of faecal shields is highly variable from species to species and from host to host (Fiebrig 1910, Olmstead 1994, Gómez 1997, Vencl et al. 1999). In some species, shields consist of exuviae only (exuvial, or skin shield). Larval shields are sometimes retained by the pupal stage (Steinhausen 1950). Even though the shields of tortoise beetle larvae have fascinated scientists for several generations, their functions still remain poorly understood. The larval shields as well as faecal coverings of the Cassidinae, Alticinae, Hispinae and Criocerinae were suggested to act as protective devices against abiotic and biotic factors (see discussion for references). However, unequivocal proof of their functions is lacking in the majority of cases. Olmstead (1994, 1996) already excellently reviewed the defensive role of waste products of Chrysomelidae and devices of defence in cassidine species. However, at the time of these reviews, the chemicals present in the abdominal shields and their relationship to the phytochemical profile of the host plant had not yet been studied (Olmstead 1994). Furthermore, since these former reviews, new methods have been used to study the modes of action of the abdominal shields’ defences. These methods include contact bioassays with larvae reared on a different diet (Vencl et al. 1999), contact bioassays with dummies, and olfactometer bioassays (Müller and Hilker 1999, Müller 2002). In the present overview, we outline new studies on the effectiveness of the abdominal shields of two cassidine species, Cassida stigmatica Suffrian and C. denticollis Suffrian that specialise on the plant tansy (Tanacetum vulgare Linn.) (Asteraceae). Larvae of C. stigmatica have exuvial shields while those of C. denticollis have faecal shields. Interactions with four different potential invertebrate predators were tested in bioassays. They were the ant workers (Myrmica rubra L., Hymenoptera: Formicidae), adult earwigs (Forficula auricularia L., Dermaptera: Forficulidae), adult ladybird beetles (Coccinella septempunctata L., Coleoptera: Coccinellidae), and larval lacewings (Chrysoperla carnea Steph., Neuroptera: Chrysopidae). The results of these tritrophic studies are integrated into a review of published laboratory and field studies on the effectiveness of larval abdominal shields in the Chrysomelidae.

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

245

MATERIALS AND METHODS Plant Leaves of Tanacetum vulgare were collected from a field site close to the laboratory. Tanacetum vulgare is chemically quite diverse and occurs in different chemotypes (Schantz and Järvi 1966, Holopainen et al. 1987). The chemotypes are characterised by a quantitatively and qualitatively different pattern of mono- and sesquiterpenes. Because different chemotypes were present at the field site, the leaves we offered as larval food were assumed to represent a random mixture of the available chemotypes. Herbivores Adults of Cassida stigmatica and C. denticollis were collected at rural sites in Berlin, Germany, and were reared in plastic containers (20 x 20 x 6 cm, Gerda GmbH & Co., Schwelm, Germany) with a gauze lid (120 mm). The containers were lined with filter paper. Leaves of T. vulgare were offered as food plant. The adults laid eggs on the plant (C. stigmatica) or on the filter paper (C. denticollis). Hatching larvae were kept in additional plastic containers on T. vulgare leaves. Rearing conditions were 20ºC, 75 % r.h. and L16:D8. Predators Earwigs (Forficula auricularia) and ladybird beetles (Coccinella septempunctata (Linn.)) were collected from tansy plants at the field site. Single individuals were maintained in Petri dishes (diam. 9 cm) on moistened filter paper and were fed daily with the aphids, Metopeurum fuscoviride Stroy and Aphis fabae Scop. Larvae of the lacewing Chrysoperla carnea acquired from a laboratory culture of Neudorff, Emmerthal, Germany, were maintained on an aphid diet (M. fuscoviride) on tansy plants kept in a green house. A colony of M. rubra was kept in the laboratory. Contact Bioassays The predator responses to cassidine larvae were tested in dual choice bioassays. Individual earwigs, ladybird beetles or lacewing larvae or groups of ants (n = 20) were offered to a larva of one of the Cassida species with its abdominal shield intact and one larva of the same species whose shield had been carefully removed with forceps. The response variables measured were contact frequency, number of bites, and the number of consumed larvae. For further details see Müller and Hilker (1999), Müller (2002). Olfactometer Bioassays Reactions of ladybird beetles towards volatiles of C. denticollis faecal shields were tested in a Yshaped olfactometer (length of Y-arms: 10 cm, diam. 1 cm) with an air-flow of 90 ml/min. Incoming air was purified and saturated with constant humidity by passing it through a glass cylinder with charcoal, and a cylinder with distilled water, respectively. Intact faecal shields (150 mg, 2nd-3rd instar) were placed in a test cylinder connected to one of the Y-tube arms. An empty cylinder was

246

Caroline Müller & Monika Hilker

connected to the other control arm. Individual ladybird beetles were released at the basis of the Y and their decisions recorded. For further details see Müller (2002). The reactions of the ant M. rubra towards shield volatiles were tested in a T-shaped static olfactometer (Hilker 1989), placed on gauze. Intact faecal shields of C. denticollis (5th instar) or exuvial shields of C. stigmatica (5th instar) were offered below one of the T-arms, 1 – 2 cm away from the crossing of the T. Individual ants were released at the base of the T. Decisions of the ants for either T-arm was recorded. For further details see Müller and Hilker (1999). RESULTS The defensive effectiveness of the two abdominal shield types of tansy feeding cassidine larvae was diverse (Table 1). Earwigs contacted larvae with, and without shields at a similar frequency, but consumed more larvae without shields. Adult ladybirds did not discriminate between C. stigmatica larvae with, and without exuvial shields. Cassida denticollis larvae with faecal shields were contacted significantly more often by the ladybird beetles. However, they consumed finally more larvae without Table 1. Predator reactions to larvae with and without abdominal shields. Predators were tested in dual choice contact assays offering either larvae of Cassida stigmatica with and without exuvial shield, or larvae of C. denticollis with and without faecal shield. Predators were tested individually with the exception of Myrmica rubra, where ants were tested in groups of 20. (For detailed methods see Müller and Hilker 1999 and Müller 2002). Contact frequency (fr.) was analysed with the Wilcoxon signed-rank test for matched pairs; the number of prey consumed or of bites (M. rubra) was analysed with the sign test. n.s. not significant; * P<0.05; ** P<0.01.

Predator species

Observed behaviour

Forficula auricularia

contact fr. P mean ± sd consumed prey

Coccinella 7-punctata

P n contact fr. P mean ± sd consumed prey

C. stigmatica with – without exuvial shield No differentiation n.s. 3.5±2.4 - 3.4±4.0 Preferred larvae without shield ** 5 - 18 No differentiation n.s. 7.2±2.8 – 7.1±3.2 No differentiation

P n.s. n 10 - 8 Chrysoperla consumed prey (not tested) carnea P n Myrmica contact fr. Preferred larvae with shield rubra P * mean ± sd 114.0±13.8 – 77.1±11.5 bites Preferred larvae with shield P * mean ± sd 12.7±10.5 – 5.0±4.2

C. denticollis with – without faecal shield No differentiation n.s. 4.6±2.9 – 3.3±2.4 Preferred larvae without shield ** 5 - 19 Preferred larvae with shield ** 8.3±3.1 – 4.9±2.9 Preferred larvae without shield ** 2 - 15 No differentiation n.s. 10 - 12 Preferred larvae with shield * 94.3±21.3 – 71.1±14.6 Preferred larvae with shield ** 18.2±12.7 – 2.0±1.2

No. tested predators / Test period 20 / 10 min 20 / 12 h

15 / 5 min 17 / 12 h

22 / 6 h 10 groups/ 5 min 10 groups/ 5 min

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

247

faecal shields. Lacewing larvae consumed C. denticollis larvae with and without shield in comparable amounts. Ant workers treated larvae of both cassidine species with intact shields with higher aggressiveness, they contacted and bit these larvae more frequently. In cases, where larvae with abdominal shields were contacted significantly more often, the predators’ response to volatiles from these shields was tested (Table 2). While volatiles of faecal shields of C. denticollis were neither attractive nor repellent for ladybird beetles, they were attractive for ant workers. Volatiles from exuvial shields of C. stigmatica had no effect on ants. DISCUSSION Literature accounts on suggested and tested protective functions of the abdominal shields of tortoise beetle larvae towards abiotic and biotic factors are discussed. The results of our case study of tansy feeding cassidine species are integrated into this overview. Suggested Protective Functions of Abdominal Shields without Testing (a) mainly against abiotic conditions: Earliest references mention advantageous shield functions such as protection against sun and flies (Réaumur 1737), reduction of desiccation (Rye 1866, Weise 1893, Karren 1964, Maw 1976, Messina and Root 1980, Verma and Shrivastava 1985, Erber 1988) or protection against rain (Weise 1893). Steinhausen (1950) believes that this protective function against sun is not necessary, because of the larvae’s behaviour. They feed and rest on the lower surface of the leaf when the sun intensity is highest. However, a thermoregulatory function of the shields has to our knowledge never been studied. (b) against predators and parasitoids: A protective effect against predators is suggested more generally (Bethune 1909, Fiebrig 1910, Eisner et al. 1967, Wellso and Hoxie 1988). Steinhausen (1950) points out especially the protection against predators that search for their food by vision, for example most bird species. A misleading Table 2: Predator reactions to volatiles of abdominal shields or blank controls. Individual predators were offered either exuvial shields of Cassida stigmatica or faecal shields of C. denticollis against blank air in dualchoice olfactometer assays. (For detailed methods see Müller and Hilker 1999 and Müller 2002). Data for Coccinella septempunctata were analysed with the binomial test; data for Myrmica rubra with the sign test. n.s. not significant; *** P<0.001. Predator species Coccinella septempunctata P n Myrmica rubra P n

C. stigmatica with – without exuvial shield (not tested)

No. tested

No differentiation n.s. 74 - 76

150

-

C. denticollis with – without faecal shield No differentiation n.s. 37 - 43 Preferred odour of larvae with shield *** 108 - 32

No. tested 80 140

248

Caroline Müller & Monika Hilker

of predators might occur, since the larvae covered by faeces resemble “pieces of dirt” (Le Sage 1983). A similar camouflage idea is mentioned by Jones (1994): faecal shields of Cassida viridis L. larvae mimic “bird dropping or other rubbish”. The shield might also function as a gluestick. Remains of cells of the host plants, algae, cysts, aphids and honey beetles could be found in faecal shields of C. viridis (Engel 1936). Finally, cassidine species carrying a reduced shield or no shield might be more prone to parasitism (Windsor 1987). Bioassay Guided Statements about the Effectiveness of the Abdominal Shields General: overview of tests on the effectiveness of shields: Beginning with the study of Eisner et al. (1967), the effectiveness of shields against predators as biotic factors was investigated in several laboratory bioassays. For most of these bioassays, larvae of particular species were offered in dual choice designs, one larva with its intact shield, and one larva, where the shield had been removed. The tests described in the literature on the effectiveness of abdominal shields are summarised in Table 3. Species that are mentioned as effective larval enemies (i.e. kill the larvae) without regarding the shield’s influence, are not listed (therefore, see Steinhausen 1950, Williams 1950, Kosior 1975, Olmstead and Denno 1993, Cox 1996, Olmstead 1996). In total, fifteen different chrysomelid species were tested. Out of these, fourteen build faecal shields, while one species carries exuviae only on the caudal processes. The effectiveness of the shields on different invertebrate predators is very variable. While some predators preferred to attack larvae without shields (Eisner et al. 1967, Olmstead and Denno 1993, Gómez 1997, Morton and Vencl 1998, Vencl and Morton 1998, Vencl et al. 1999, Gómez et al. 1999, Eisner and Eisner 2000, Müller 2002), others did not make any differences between larvae with and without attaches (Olmstead and Denno 1993, Müller 2002). Workers of the ant Myrmica rubra were shown to be attracted by cassidine larvae, feeding on tansy (Müller and Hilker 1999), even though they are generalists. A correlation between the shield’s effectiveness and the mouthpart type of the tested predators does not exist. However, with increasing length of mouthparts predators may well circumvent the shield defence of their prey (Olmstead and Denno 1993). Effectiveness of different shield types: Differences in the effectiveness of abdominal shields are also due to the type of shield. While faecal shields of C. denticollis are finally successful in protecting the larvae from being consumed by ladybirds, exuvial shields on C. stigmatica are not (Table 1). In contact bioassays, ants attack both, tansy feeding cassidine larvae with exuvial and with faecal shields more frequently than larvae without shields, but in olfaction bioassays, only volatiles of faecal shields are already attractive. Lilioceris trilinea White and L. lilii (Scopoli) are covered by faeces, but these shields are stationary and cannot be moved. However, several chrysomelid larvae, including L. trilinea and L. lilii, respond to predator attacks additionally by regurgitating (Schaffner and Müller 2001, Evans et al. 2000). Effectiveness of shields against different predator taxa: When considering the defensive effectiveness of the larval shields with respect to larval age from a taxonomic point of view, effectiveness varies towards the different predator taxa. Bioassays have

mandibulate

F. auricularia

Forficulidae

P. sp.

Salticidae

chelicerate

mandibulate

Phidippus sp. C.L. Koch

Salticidae

chelicerate

chelicerate

DERMAPTERA Forficulidae Forficula auricularia L.

O. salticus

Oxyopes salticus Hentz

Cassida stigmatica Suffr. (exuvial shield) Cassida denticollis Suffr. (faecal shield)

D. guttata

C. bicolor

Charidotella bicolor (F.) (faecal shield: thick, dense mass, held tightly against the body when larva are disturbed) Deloyala guttata (Oliv.) (faecal shield: feathery structure, swatted at predators)

Carnivore: species Mouthpart type Chrysomelid of carnivore species

Oxyopidae

ARANEAE Oxyopidae

Carnivore: familiy

yes (3rd instar)

no (3rd instar)

no (2nd, 3rd, 5th instar)

yes (3rd instar) no: (2nd, 5th instar)

yes (3rd instar) no (2nd, 5th instar)

no (2nd, 3rd instar)

Effectiveness of shield (yes = deterrent)

dual choice, contact, feeding

dual choice, contact, feeding

dual choice, feeding

dual choice, feeding

dual choice, feeding

dual choice, feeding

Bioassay

Host plant chemistry taken into account

Müller 2002

Müller 2002

Olmstead and Denno 1993

Olmstead and Denno 1993

Olmstead and Denno 1993

Olmstead and Denno 1993

Reference

Table 3. Tested effects of abdominal shields in chrysomelid larvae on carnivorous arthropods. With the exception of the Eulophidae and Ichneumonidae (parasitoids) all carnivorous species mentioned are predators. The predators’ mouthpart type, characteristics of the abdominal shield (when species mentioned first), the defensive effectiveness of the shield, the type of bioassay used for testing the effects (“dual choice”: a larva with and a larva without shield were offered), and references are given. Furthermore it is noted, when the influence of the host-plant chemistry has been taken into account.

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

249

Podisus maculiventris (Say) P. maculiventris

Stiretrus anchorago (F.)

Pentatomidae

Pentatomidae

piercing-sucking

piercing, sucking

piercing, sucking

piercing, sucking

Carabidae

L. fuscata

mandibulate

COLEOPTERA Carabidae Lebia fuscata Dejean mandibulate

Pentatomidae

Nabidae

Nabis americoferus (Carayon) N. americoferus

Nabidae

piercing, sucking

piercing, sucking

G. punctipes

Lygaeidae

no (2nd instar) feeding

Effectiveness of shield (yes = deterrent)

Deloyala guttata (Oliv.)

Charidotella bicolor (F.)

yes (2nd instar), no (3rd, 5th instar) no (2nd, 3rd, 5th instar)

yes (2nd, 3rd instar), no (5th instar) Deloyala guttata yes (2nd, 3rd (Oliv.) instar), no (5th instar) C. bicolor no: (2nd, 3rd, 5th instar) D. guttata no (2nd, 3rd, 5th instar) C. bicolor no (2nd, 3rd, 5th instar) D. guttata no (2nd, 3rd, 5th instar) Hemisphaerota cyanea yes (Say) (faecal shield: loose assemblage of strands)

piercing, sucking Charidotella bicolor (F.)

piercing, sucking Cassida denticollis Suffr.

Carnivore: species Mouthpart type Chrysomelid of carnivore species

NEUROPTERA Chrysopidae Chrysoperla carnea Steph. HETEROPTERA Lygaeidae Geocoris punctipes (Say)

Carnivore: familiy

Table 3. Continued.

dual choice, feeding

dual choice, feeding

dual choice, feeding dual choice, feeding dual choice, feeding dual choice, feeding dual choice, feeding

dual choice, feeding

dual choice, feeding

dual choice,

Bioassay

Host plant chemistry taken into account

Olmstead and Denno 1993

Olmstead and Denno 1993

Olmstead and Denno 1993 Olmstead and Denno 1993 Olmstead and Denno 1993 Olmstead and Denno 1993 Eisner and Eisner 2000

Olmstead and Denno 1993

Olmstead and Denno 1993

Müller 2002

Reference

250 Caroline Müller & Monika Hilker

Coccinella septempunctata (L.) C. septempunctata

C. septempunctata

C. septempunctata

Cycloneda sanguinea

Coccinellidae

Coccinellidae

Coccinellidae

Coccinellidae

HYMENOPTERA Formicidae Azteca sp.

Coccinellidae

C. maculata

Coccinellidae

Coccinellidae

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

Calleida viridipennis mandibulate (Say) Coleomegilla maculata mandibulate (De Geer)

Carabidae

no

Effectiveness of shield (yes = deterrent)

Coptocycla leprosa (Boh.) (faecal shield: sticky, spherical like)

yes (different instars)

yes (2nd instar) no (3rd, 5th instar) D. guttata yes (2nd instar) no (3rd, 5th instar) Cassida stigmatica no (2nd, 3rd Suffr. instar) Cassida denticollis yes (2nd, 3rd Suffr. instar)but: larvae with shield per se attractive C. bicolor yes (2nd instar), no (3rd, 5th instar) D. guttata yes (2nd instar) no (3rd, 5th instar) Hemisphaerota cyanea yes (Say)

Hemisphaerota cyanea (Say) C. bicolor

Carnivore: species Mouthpart type Chrysomelid of carnivore species

Carnivore: familiy

Table 3. Continued.

field, dual choice, survival

dual choice, feeding

dual choice, feeding

dual choice, feeding

dual choice, contact, feeding dual choice, contact, feeding

dual choice, feeding

dual choice, feeding dual choice, feeding

Bioassay

Eisner and Eisner 2000

Olmstead and Denno 1993

Olmstead and Denno 1993

Müller 2002

Müller 2002

Olmstead and Denno 1993

Eisner and Eisner 2000 Olmstead and Denno 1993

Reference

probably due Gómez 1997 to host plant chemistry (Cordia curassavica)

Host plant chemistry taken into account

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

251

Formica subsericea Say

F. subsericea

F. subsericea

F. subsericea

Myrmica rubra (L.)

M. rubra

M. rubra

Formicidae

Formicidae

Formicidae

Formicidae

Formicidae

Formicidae

Formicidae

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

mandibulate

Effectiveness of shield (yes = deterrent)

Attractive (4., 5th instar)

Cassida stigmatica Suffr.

attractive (4., 5th instar)

Cassida sanguinosa attractive Suffr. (faecal shield) (4., 5th instar)

Cassida denticollis Suffr.

Plagiometriona clavata yes (3rd instar) (Fab.) (faecal shield, mobil)

Neolema sexpunctata yes (2nd, 3rd Say (faecal shield) instar)

Blepharida rhois yes (3rd instar) (Forster) (faecal shield, viscous) Lema trilinea White yes (2nd, 3rd (faecal shield, instar) stationary)

Cassida rubiginosa yes Müll. (faecal shield)

Formica exsectoides Forel

Formicidae

mandibulate

Carnivore: species Mouthpart type Chrysomelid of carnivore species

Carnivore: familiy

Table 3. Continued. Host plant chemistry taken into account Eisner et al. 1967

Reference

dual choice, contact duration, frequency, bites dual choice, contact duration, frequency, bites

dual choice,

linked to host chemistry (Tanacetum vulgare) linked to host chemistry (Tanacetum vulgare) linked to host chemistry (Tanacetum vulgare)

Müller and Hilker 1999

Müller and Hilker 1999

Müller and Hilker 1999

due to host Vencl and plant chemistry Morton 1998 (Rhus glabra) single choice, due to host Morton and contact frequency, plant chemistry Vencl 1998 removal (Solanum dulcamara) single choice, due to host Morton and contact frequency, plant chemistry Vencl 1998 removal (Commelina communis) single choice, due to host Vencl et al. 1999 contact frequency, plant chemistry removal (Solanum dulcamara)

single choice, observations, bites, killings dual choice, removal

Bioassay

252 Caroline Müller & Monika Hilker

(damage by oviposition and host feeding)

Eulophidae

(not identified)

(damage by oviposition and host feeding)

Ichneumonidae Lemophagus pulcher Szepligeti

Effectiveness of shield (yes = deterrent)

Cassida stigmatica Suffr.

attraction

Eurypedus yes (different nigrosignata Boh. instars) (faecal shield, filament like) Lilioceris lilii (Scop.) attraction (faecal shield, stationary)

M. rubra

Formicidae

mandibulate

Carnivore: species Mouthpart type Chrysomelid of carnivore species

Carnivore: familiy

Table 3. Continued. Reference

Müller 1999

Schaffner and Müller 2001

due to host plant Gómez 1997, chemistry (Cordia Gómez et al. 1999 curassavica)

Host plant chemistry taken into account

dual and multiple linked to host choice, contact chemistry duration, (Lilium martagon) frequency, ovipositor probing dual choice, contact, oviposition

dual choice, removal

Bioassay

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

253

254

Caroline Müller & Monika Hilker

been elaborated with different invertebrate predators: 2 species of the Araneae, 1 Dermaptera, 1 Neuroptera, 4 Heteroptera, 5 Coleoptera, and 5 Hymenoptera species. In several cases shields are protective, especially in smaller larvae (2nd instar). In larger larvae and against the tested species of Araneae and Neuroptera, shields are not effective. In the Hymenoptera, shields are repulsive against most ant species, while one ant, M. rubra, is even attracted by shields from different larval cassidine species, fed on T. vulgare. Also, parasitoids are attracted by the abdominal shields. To investigate which predator species are indeed feeding on the larvae in the field, monoclonal antibodies have been developed for Cassida rubiginosa (Bacher et al. 1999). Using such techniques might help to choose the relevant predators for future studies. Effectiveness of shields against parasitoids: Although Windsor (1987) suggested that shields might serve as protection against parasitism, two behavioural studies on parasitoids proved the opposite (Schaffner and Müller 2001, Müller 1999). The investigated parasitoids were attracted by faecal (L. lilii) as well as exuvial (C. stigmatica) shields. As specialists, these parasitoids use such characteristic structures as important cues for host finding and acceptance. Faeces are utilised as kairomones also in other than tortoise beetles larvae by specialist predators and parasitoids to locate their prey (Grégoire et al. 1991, Meiners and Hilker 1997, Steidle and Schöller 1997, Hilker and Meiners 1999). Exuviae of a lepidopteran species serve a braconid as kairomone (Takabayashi and Takahashi 1986). Relationship between shield effectiveness and host plant chemistry: The role of the host plant chemistry in several predator-prey interactions has been taken into account more and more during the recent years. The faecal shields of several species often reflects the chemical composition of the larvae’s host plant (Gómez 1997, Müller and Hilker 1999), sometimes with modifications (Morton and Vencl 1998). A wide range of different chemicals has been detected in the abdominal shields: phytol, fatty acids, tannins and their metabolites (Neolema sexpunctata (Say), Morton and Vencl 1998, Blepharida rhois (Forster), Vencl and Morton 1998, Plagiometriona clavata, Vencl et al. 1999), steroidal glycoalkaloids, saponins (Lema trilinea, Morton and Vencl 1998), and terpenoids (Eurypedus nigrosignata (Boheman), Gómez et al. 1999, Cassida spp., Müller and Hilker 1999, Blepharida schlechtendalii Furth, Evans et al. 2000). Several mono- and sesquiterpenes and sesquiterpene derivatives of the host plant tansy are stored qualitatively unaltered in the faecal shields of C. denticollis and even evaporate from exuvial shields of C. stigmatica, however, in much lower concentrations (< 4 % compared to faecal shields) (Müller and Hilker 1999). Deterrent (e.g. Vencl et al. 1999) as well as repellent (Gómez 1997) effects of larval shields were shown to be linked to the larvae’s host plant chemistry. Evidence was given in two ways. Synthetic chemicals were tested on baits offered to the predators. Also, tortoise beetle larvae that had been reared on lettuce as control diet were tested against predators. Since these larvae could not acquire any noxious components from the lettuce, their faecal shields had no longer deterrent effects (Morton and Vencl 1998). In other tritrophic sytems, almost no match could be found between the host plant chemistry and the larval faeces. The larval body and faeces of the alticine, Blepharida flavocostata Jacoby, did not contain palmitic acid, phytol, and the terpenoids characteristic for the host plant Bursera biflora (Rose) Standl. (Evans et al. 2000).

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

255

Abdominal shields as physical barriers: mobility: In addition to the chemically defensive effects of the abdominal shields, also physical ones may be important. The fact, that ladybird beetles touched larvae of C. denticollis with intact shields even more often than larvae without shield, but consumed more of the latter (Table 1), indicates that the initial attractiveness of faecal shields must be due to visual stimuli such as contrast, movement or size (Müller 2002). Caterpillar larvae on which a C. denticollis shield was glued were consumed as often as caterpillar larvae without attached shields. These dummies could not move the shield (Müller in press). Active movement of shields in Cassida species probably helps to drive off predators such as ants or earwigs and ladybird beetles (Eisner et al. 1967, Table 1). In Blepharida flavocostata, the rapid side-to-side movements of the abdomen in response to predator attacks are described as a “boxinglike display” (Evans et al. 2000). Abdominal shields as physical barriers: detachability: The ease of detaching the shield can be an important factor for the larvae to survive a predator’s attack. In 20 min long contact bioassays, the half of Cassida sanguinosa Suffr. larvae lost their faecal shields due to manipulations by M. rubra foragers (Müller 1999). In the field, this would give the larvae the possibility to escape from its enemy. The ease with which shields can be detached is influenced by their consistency, and is also dependent on the host water content and ambient humidity (Fiebrig 1910, Engel 1936). Shield stability is probably also due to the degree of melanisation. For example, Gómez (1997) found a high phenoloxidase activity in faeces of some shield carrying cassidine larvae. Effectiveness of abdominal shields and aggregation: In two of the tortoise beetle larvae, the effects of aggregation on predation was studied. Larvae of Acromis sparsa Boheman do carry only very small shields, but they aggregate and are defended by their mother (Windsor 1987). Aspidomorpha miliaris (F.) larvae carry exuvial shields. They are protected against several vertebrate species such as lizards, birds and invertebrates like mantids, when aggregating as well as when not aggregating. Spiders can overcome their prey only, when the larvae are not aggregating (Chattopadhyay and Sukul 1994). The effectiveness is probably due to host plant chemistry Ipomoea fistulosa (Chattopadhyay and Sukul 1994). CONCLUSIONS The effectiveness of the larval shields in tortoise beetles is dependent on the type of antagonist species and on the host plant. Our finding about the tansy feeding cassidine species suggests that generalisations about shield functions are difficult to make since shield efficacy varies with the predatory species. The shields are not only known as defensive devices against predators, but also as disclosing cue that is used by predators and parasitoids to locate the prey. The advantages of defence versus the disadvantages of chemical, mechanical or visual cues that attract enemies poses an evolutionary dilemma. This cost-benefit analysis needs to be studied for each species individually. Furthermore, additional studies are needed to verify the suggested function as protection against unfavourable abiotic conditions. To our knowledge, the influence of microorganisms present in the

256

Caroline Müller & Monika Hilker

abdominal shields has not been investigated at all and might offer new insights. Costs for shield building could not be found in Charidotella bicolor (Fabr.), Deloyala guttata (Olivier), and Chelymorpha cassidea (Fabr.), when comparing developmental time, body mass, and survival of larvae with shields and larvae, whose shields were regularly removed (Olmstead and Denno 1992). However, it seems likely that costs do exist, at least metabolic ones, for example in those species which chemically modify dietary precursors (Morton and Vencl 1998). Finally, phylogenetic aspects of shield evolution need to be investigated in much more detail, particularly with respect to advantages and disadvantages of the shield defensive strategy (Vencl et al. 1999). ACKNOWLEDGEMENTS The study on the tansy feeding cassidines was supported by a grant of the Freie Universität Berlin. We thank an anonymous reviewer for useful comments on an earlier draft of this manuscript. LITERATURE CITED Bacher, S., D. Schenk and H. Imboden 1999. A monoclonal antibody to the shield beetle Cassida rubiginosa (Coleoptera, Chrysomelidae): A tool for predator gut. Biological Control 16:299-309. Bethune, C. J. S. 1909 Insect affecting vegetables. Ontario Department of Agriculture Bulletin 171:32-33. Blum, M. S. 1994. Antipredatory devices in larvae of the Chrysomelidae: a unified synthesis for defensive electicism, pp. 277-288. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, Boston, London. Chattopadhyay, A. K. and N. M. Sukul 1994. Anti-predator strategy of larval aggregation pattern in Aspidomorpha miliaris (Chrysomelidae: Coleoptera). Entomon 19:125-130. Cox, M. L. 1994. The Hymenoptera and Diptera parasitoids of Chrysomelidae, pp. 419-468. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Cox, M. L. 1996. Insect Predators of Chrysomelidae, pp. 23–91. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelid Biology, vol. 2: Ecological Studies. SPB Academic Publishing, Amsterdam. Dettner, K. 1987. Chemosystematics and evolution of beetle chemical defense. Annual Review of Entomology 32:7-48. Eisner, T., E. v. Tassel and J. E. Carrel 1967. Defensive use of a “fecal shield” by a beetle larva. Science 158:1471-1473. Eisner, T. and M. Eisner 2000. Defensive use of a fecal thatch by a beetle larva (Hemisphaerota cynea). Proceedings of the National Academy of Sciences 97:2632-2636. Engel, H. 1936. Biologie und Ökologie von Cassida viridis L. Zeitschrift für Morphologie und Ökologie der Tiere 30:42-96. Erber, D. 1988. Biology of Camptosomata, pp. 513-552. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Evans, P. H., J. X. Becerra, D. L. Venable and W. S. Bowers 2000. Chemical analysis of squirt-gun defense in Bursera and counterdefense by chrysomelid beetles. Journal of Chemical Ecology 26:745-754. Fiebrig, K. 1910. Cassiden und Cryptocephaliden Paraguays. Zoologische Jahrbücher Supplement XII:11-264. Gómez, N. E. 1997. The fecal shields of larvae of tortoise beetles (Cassidinae: Chrysomelidae): a role in chemical defense using plant-derived secondary compounds. Ph.D. Thesis, Technische Universität CaroloWilhelmina, Braunschweig, Germany.

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

257

Gómez, N. E., L. Witte and T. Hartmann 1999. Chemical defense in larval tortoise beetles: essential oil composition of fecal shields of Eurypedus nigrosignata and foliage of its host plant, Cordia currasavica. Journal of Chemical Ecology 25:1007-1027. Grégoire, J. C., M. Baisier, A. Drumont, D. L. Dahlsten, H. Meyer and W. Francke 1991. Volatile compounds in the larval frass of Dendroctonus valens and Dendroctonus micans (Coleoptera: Scolytidae) in relation to oviposition by the predator, Rhizophagus grandis (Coleoptera: Rhizophagidae). Journal of Chemical Ecology 17:2003-2020. Hilker, M. 1989. Larvensekrete der Chrysomelinen mit intraspezifischer Repellentwirkung. Mitteilungen der Deutschen Gesellschaft für Allgemeine und Angewandte Entomologie 7:136-140. Hilker, M. 1994. Egg deposition and protection of eggs in Chrysomelidae, pp. 263-276. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Hilker, M. and T. Meiners 1999. Chemical cues mediating interactions between chrysomelids and parasitoids, pp.197-216. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology. Backhuys Publishers, Leiden. Holopainen, M., R. Hiltunen and M. Schantz 1987. A study of tansy chemotypes. Planta Medica 53:284-287. Jones, R. A. 1994. Do tortoise beetle pupae mimic lacewings ? British Journal of Entomology and Natural History 7:67-70. Karren, J. B. 1964. Protective coloration and form of North American genus Exema. Proceedings of North Central Branch, Entomological Society of America 19:77-79. Kosior, A. 1975. Biology, Ecology, and Economic Importance of Cassids (Coleptera, Chrysomelidae, Cassidinae) of the Ojców National Park. Acta Zoologica Cracovlensia 20:251-392. Köpf, A., N. E. Rank, H. Roininen and J. Tahvanainen 1997. Defensive larval secretions of leaf beetles attract a specialist predator Parasyrphus nigritarsis. Ecological Entomology 22:176-183. LeSage, L. 1983. Note sur la distribution présente et future du criocére du lys, Lilioceris lilii (Scopoli) (Coleoptera: Chrysomelidae) das l’est du Canada. Naturaliste Canadien 110: 95-97. Matsuda, K. and F. Sugawara 1980. Defensive secretion of chrysomelid larvae Chrysomela vigintipunctata costella (Marseul), C. populi L. and Gastrolina depressa Baly (Colepotera: Chrysomelidae). Applied Entomolology and Zoology 15:316-320. Maw, M. G. 1976. Biology of tortoise beetle, Cassida hemisphaerica (Coleoptera: Chrysomelidae), a possible biological control agent for bladder campion, Silene cucubalus (Caryophyllaceae) in Canada. Canadian Entomologist 108:945-954. McBride, J. A., C. E. Bach and G. K. Walker 2000. Developmental changes in the caudal and lateral processes of larvae of Aspidomorpha deusta (Fabricius) (Coleoptera : Chrysomelidae : Cassidinae). Australian Journal of Entomology 39:167-170. Meiners, T. and M. Hilker 1997. Host location in Oomyzus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle Xanthogaleruca luteola (Coleoptera: Chrysomelidae). Oecologia 112:87-93. Messina, F. J. and R. B. Root 1980. Association between leaf beetles and meadow goldenrods (Solidago spp.) in Central New York. Annals of the Entomological Society of America 73:641-646. Morton, T. C. and F. V. Vencl 1998. Larval beetles form a defense from recycled host plant chemicals discharged as fecal wastes. Journal of Chemical Ecology 24:765-785. Müller, C. and M. Hilker 1999. Unexpected reactions of a generalist predator towards defensive devices of cassidine larvae (Coleoptera: Chrysomelidae). Oecologia 118:166-172. Müller, C. 1999. Chemische Ökologie des Phytophagenkomplexes an Tanacetum vulgare L. (Asteraceae). Ph.D. Thesis, Freie Universität Berlin, Logos-Verlag, Germany. Müller, C. 2002. Variation in effectiveness of abdominal shields of cassidine larvae against predators. Entomologia Experimentalis et Applicata 102:191-198.

258

Caroline Müller & Monika Hilker

Olmstead, K. L. and R. F. Denno 1992. Cost of shield defence for tortoise beetles (Coleoptera: Chrysomelidae). Ecological Entomology 7:237-243. Olmstead, K. L. and R. F. Denno 1993. Effectiveness of tortoise beetle larval shields against different predator species. Ecology 74:1394-1405. Olmstead, K. L. 1994. Waste products as chrysomelid defenses, pp. 311-318. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Olmstead, K. L. 1996. Cassidine defenses and natural enemies, pp. 3-21. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology, vol. 2: Ecological Studies. SPB Academic Publishing, Amsterdam. Pasteels, J. M., J. C. Braekman, D. Daloze and R. Ottinger 1982. Chemical defence in chrysomelid larvae and adults. Tetrahedron 38:1891-1897. Pasteels, J. M. and J.-C. Grégoire 1984. Selective predation on chemically defended chrysomelid larvae. A conditioning process. Journal of Chemical Ecology 10:1693-1700. Pasteels, J.M. D. Daloze and M. Rowell-Rahier 1986. Chemical defense in chrysomelid eggs and neonate larvae. Physiological Entomology 11:29–37. Pasteels, J. M., J.-C. Braekman and D. Daloze 1988a. Chemical defense in the Chrysomelidae, pp. 233-252. In: P. Joliviet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Pasteels, J. M., M. Rowell-Rahier and M. J. Raupp 1988b. Plant-derived defense in chrysomelid beetles, pp. 235272. In: P. Barbosa and D. K. Letourneau (Eds.), Novel aspects of insect-plant interactions. John Wiley & Sons, New York. Réaumur. 1737. Mémoires L’Historie de Insects 3. Rowell-Rahier, M., J. M. Pasteels, A. Alonso-Mejia and L. P. Brower 1995. Relative unpalatability of leaf-beetles with either biosynthesized or sequestered chemical defense. Animal Behaviour 49:709-714. Rye, E. C. 1866. An introduction to the study of our indigenous Coleoptera. pp. 280. Lovell Reeve and Company, London. Schaffner, U. and C. Müller 2001. Exploitation of the faecal shield of lily leaf beetle, Lilioceris lilii (Coleoptera: Chrysomelidae), by the specialist parasitoid Lemophagus pulcher (Hymenoptera: Ichneumonidae). Journal of Insect Behavior 14:739-757. Schantz, M. v. and M. Järvi 1966. Infraspezifische chemische Variabilität der Bestandteile des ätherischen Öls von Chrysanthemum vulgare L. [reprinted from “Scientiae Pharmaceuticae I” Proceedings of the 25th Congress of Pharmaceutical Sciences Prague 24 - 27 Aug 1965]. Butterworth, London. Czechoslovak Medical Press. Prague: 255-259. Steidle, J. L. M. and M. Schöller 1997. Olfactory host location and learning in the granary weevil parasitoid Lariophagus distinguendus (Hymenoptera: Pteromalidae). Journal of Insect Behavior 10:331-342. Steinhausen, W. 1950. Vergleichende Morphologie, Biologie und Ökologie der Entwicklungsstadien der in Niedersachsen heimischen Schildkäfer (Cassidinae, Chrysom. Col.) und deren Bedeutung für die Landwirtschaft. Ph.D. Thesis Technische Hochschule Carolo-Wilhelmina, Braunschweig, Germany. Takabayashi, J. and S. Takahashi 1986. Effect of kairomones in the host searching behavior of Apanteles kariyai WATANABE (Hymenoptera: Braconidae), a parasitoid of the common armyworm, Pseudaletia separata WALKER (Lepidoptera: Noctuidae). II. Isolation and identification of arrestants produced by the host larvae. Applied Entomology and Zoology 21:114-118. Vencl, F. V. and T. C. Morton 1998. The shield defense of the sumac flea beetle, Blepharida rhois (Chrysomelidae: Alticinae). Chemoecology 8:25-32. Vencl, F. V., T. C. Morton, R. O. Mumma and J. C. Schultz 1999. Shield defense of a larval tortoise beetle. Journal of Chemical Ecology 25:549-566.

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

259

Verma, K. K. and R. K. Shrivastava. 1985. Separate niches for two species of Aspidomorpha Iliving on Ipomoea fistulosa M. and de Dary (Coleoptera: Chrysomelidae). Entomography 3:437-446. Weise, J. 1893. Naturgeschichte Insekten Deutschlands. In: W. F. Erichson (Ed.), Coleoptera, Chrysomelidae. vol. 6. Berlin. Wellso, S. G. and R. P. Hoxie 1988. Biology of Oulema, pp. 497-511. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Williams, J. R. 1950. The introduction of Physonota alutacea Boheman (Col. Cassid.) into Mauritius. Bulletin of Entomological Research 40:479-480. Windsor, D. M. 1987. Natural history of a subsocial tortoise beetle, Acromis sparsa Boheman (Chrysomelidae: Cassidinae) in Panama. Psyche 94:127-150.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences 261 Special Topics in Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 261-275

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences Jacques M. Pasteels1, Arnaud Termonia1,2, Désiré Daloze3 and Donald M. Windsor4 Laboratory of Animal and Cellular Biology, P.O. Box 160/12, University of Brussels, 50 Av. F.D. Roosevelt, B-1050, Belgium. Email: [email protected] 2 Unit of Evolutionary Genetics, University of Brussels, cp 300, IMBM, rue Jeener and Brachet 12, B-6041, Gosselies, Belgium 3 Laboratory of Bio-organic Chemisry, P.O. Box 160/07, University of Brussels, 50 Av. F.D. Roosevelt, B-1050, Belgium 4 Smithsonian Tropical Reasearch Institute, Apartado 2072, Balboa-Ancon, Panama 1

ABSTRACT From a survey of the toxins produced by the pronotal and elytral defensive secretions in 114 chrysomeline species (20 genera sensu Daccordi 1994), three major groups of species are recognized which are considered as natural supra-generic taxa. These ensembles, however, do not perfectly fit existing classifications (e.g. Daccordi in Seeno and Wilcox 1982 or Daccordi 1994). Species secreting isoxazolinone glucosides esterified by nitropropanoic acid are considered as Chrysomelina sensu stricto which includes so far Chrysomela, Linaeidea, Plagiodera, Gastrophysa, Phaedon (including Hydrothassa), Prasocuris, Phaedonia and Phratora. This supra-generic taxon is supported by larval characters, i.e. serial defensive glands, and by mtDNA phylogeny. The co-occurrence of serial glands in larvae and the adult toxins is so constant that the existence of serial glands in larvae is enough to qualify beetles as members of this taxon (e.g. Mesoplatys or Gastrolina). However, Colaspidema is excluded from it. Species secreting cardenolides or polyoxygenated steroids are considered as Chrysolinina sensu stricto, including so far Chrysolina (sensu Daccordi 1994), Ambrostoma, Zygogramma, Cosmogramma, Calligrapha and Stilodes. Polyoxygenated steroids are only secreted by members of three Chrysolina subgenera, Sphaeromela, Hypericia and Chalcoidea, which could be raised to disinct genera. Species secreting triterpene saponins are considered as Doryphorina sensu stricto, including so far Platyphora, Leptinotarsa, Labidomera and Desmogramma. While the classification proposed here is based on a restricted number of genera, we believe it may be useful in the building of a new and more natural classification of chrysomeline leaf beetles.

INTRODUCTION Chrysomeline (Chrysomelini) suprageneric classification is notoriously difficult. For historical and pragmatic reasons, it is based on adult external morphology. Many of these characters may be homoplasic (i.e. due to convergent or parallel evolution), limiting their usefulness. Besides, gradual

262

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

changes between morphs seems to be frequent, and Mauro Daccordi with his wonderful Italian sense of humour, once suggested to the senior author of this paper that all Chrysomeline leaf beetles should belong to a single genus: Chrysomela Linnaeus. However, speciation normally is preceded by divergence of traits that can be used for building a natural classification of leaf beetles. Hence, leaf beetles experts explored additional attributes which may prove useful in classifying the Chrysomelini, e.g. morphology of immature stages (Bourdonné pers. com., Petitpierre and Juan 1994, Cox 1996 and references therein), caryotypes (Petitpierre 1988, Petitpierre et al. 1988), defensive toxins (Pasteels 1993), DNA sequences (Mardulyn et al. 1997, Hsiao and Pasteels 1999, GomezZurita et al. 1999). Our current research on the evolution of chemical defense in leaf beetles was not initially aimed at solving taxonomic problems. On the contrary, we hoped to be able to use current classifications for a better understanding of the evolution of leaf beetle defense. However, from our studies on chemical defense in Holarctic species, patterns emerged that were not consistent with current classifications (Pasteels 1993). Our recent studies of chemical defense in Neotropical leaf beetles reinforce this conclusion and disclose additional patterns that we will report here. For the following reasons, only the distribution of three main classes of compounds, known to be released as defensive compounds from exocrine glands of adult chrysomelines, will be considered: isoxazolinone glucosides esterified by nitropropanoic acid, cardenolides and other steroids, and pentacyclic triterpene saponins. First, these compounds are easily detected either by mass spectrometry or thin-layer chromatography, even when secretions of only few individuals are available (these methods are fully described in papers reporting the identification of the beetle toxins, e.g., Daloze et al. 1991, 1995, Pasteels et al. 1982, 2001, Plasman et al. 2000a and b). Second, they are either synthesized by the beetles themselves or are derived from precursors widely distributed in the plant kingdom. Thus, oligophagy (as is the rule in all beetle taxa considered in this study) does not constrain beetle chemical defense. Third, they have yet to be found occurring together and hence appear mutually exclusive. Fourth, these compounds require very different metabolic mechanisms and biosynthetic pathways, so far unique to leaf beetles within the whole animal kingdom. Thus, convergence or parallel evolution of these traits appears extremely unlikely, suggesting that each class of toxin is a synapomorphy, defining a distinct clade. It should be stressed here, that the occurrence of a toxin in a secretion is more informative than its absence, as a secondary loss of a synthetic ability is more likely to occur by a single mutation than the independent evolution of a multi-steps biosynthetic pathway requiring different enzymes. Several apparent exceptions were observed to the pattern, some species lacking the expected compound suggested by current classification. These exceptions will be discussed one by one. If the secretion contains compounds belonging to one or the other classes defining the other clades, we will consider this a strong indication of miss-classification. If the secretion does not contain any diagnostic compound, apparent contradiction with current classification will be discussed in the light of other available characters. Besides these three classes of compounds, leaf beetles secretions contain a large diversity of other compounds (review in Pasteels et al. 1988a, 1994) that will not be discussed for one of the following two main reasons. First, their occurrence is narrowly constrained by the secondary chemistry of a small subset of host plants, and appears to be a secondary evolution in species which colonized those plants, e.g. sequestered pyrrolizidine alkaloids in some Chrysolina Motschulsky (Chrysochloa Hope, Frigidorina Khhnelt and Intricatorina Khhnelt) or Platyphora Gistel species (Pasteels et al. 1995, 2001). In these cases, parallel evolution cannot always be ruled out (Hsiao and Pasteels 1999). Second,

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

263

the presence of some compounds in the secretions cannot be detected without ambiguity by straightforward methods and they were not systematically searched for. Some of these compounds are possibly plesiomorphic characters as suggested by their tentative identification in unrelated taxa, e.g. some amino acid derivatives. Others appear as compounds yet observed in the secretions of a single species in admixture with more widespread toxins, e.g. chlorogenic acid in Platyphora ligata (StDl) or N,N,N-trimethylcadaverine in Platyphora opima (StDl) found together with triterpene saponins (Plasman et al. 2000a and b). In the future, some of these compounds could prove to be useful taxonomic characters when additional secretions are analyzed. The two most recent and exhaustive classifications of chrysomeline leaf beetles will be used for discussing our results. Both were published by Daccordi (in Seeno and Wilcox 1982, and in Daccordi 1994). As different patterns were observed within the large genus Chrysolina, its subgeneric division will be taken into account. Although there are divergent opinions on the status of some taxa as Chrysolina subgenera or as distinct genera, Daccordi’s 1994 list of subgenera will be used for the sake of consistency. Daccordi’s 1994 classification mainly differs from his earlier one by the fusion of the subtribes Doryphorina Yuasa 1936 and Chrysolina Chen 1936 in a single substribe Chrysolina, now subdivided into several groups of genera, by including the Gonioctenina Wilcox 1972 within the Paropsina Weise 1915, and by moving some genera from one subtribe to another. MATERIALS AND METHODS Chemical data were compiled from literature (reviews in Pasteels et al. 1988a and 1994, Daloze et al. 1995, Plasman et al. 2000a and b, 2001, Pasteels et al. 2001). Additional species were surveyed for the purpose of this study. Direct comparison by thin layer chromatography of unknown secretion extracts and those of related species, previously analyzed, identified nitropropanoic acid and isoxazolinone glucosides. Thin layer chromatography followed by spraying with Kedde’s reagent revealed the presence of cardenolides in secretion extracts. Mass spectroscopy analyses of the raw extracts as described in Pasteels et al. (2001) were used for detecting triterpenes and cardenolides. RESULTS Isoxazolinone Glucosides Esterified by Nitropropanoic Acid (Fig. 1) Isoxazolinone and nitropropanoic acid glucosides were reported from various legumes (e.g. Astragalus Linn., Coronilla Linn., Indigophera Linn., Lathyrus Linn., Pisum Linn., Harlow et al. 1975, Lambein et al. 1976, Gistine1979, Ikegami et al. 1984, Majak et al. 1992). Nitropropanoic acid was also reported from fungi (Turner 1971), but from no insects other than leaf beetles. It is well known that nitropropanoic acid is a potent neurotoxin responsible for cattle poisoning (Coburn et al. 1975). Leaf beetles do not obtain these compounds from their food plants, but synthesize them from aspartic acid (Randoux et al. 1991). In the defensive secretion, the major compounds are isoxazolinone glucosides esterified by one or two nitropropanoic acid residues (Pasteels et al. 1982, 1994). An esterase present in the secretion releases free nitropropanoic acid and the glucoside of isoxazolinone from the esterified glucosides illustrated in Fig.1 (Daloze, Kirk and Pasteels, unpublished data). In experiments with the ant Myrmica rubra Linn., the glucoside of isoxazolinone did not proved to be highly toxic, but to be an efficient ant deterrent (Pasteels et al. 1988b ).

264

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

Fig. 1. Isoxazoline glucosides esterified by nitropropanoic acid. Table 1. List of species secreting isoxazolinone glucosides esterified by nitropropanoic acid. Chrysomela aeneicollis (Schaeffer), collaris L., confluens Rogers, cuprea F., interrupta F., lapponica L., laurentia Brown, populi L., saliceti (Weise), schaefferi Brown, scripta F., tremulae F., vigintipunctata (Scop.) Gastrophysa cyanea Melsheimer, viridula (De Geer) Linaeidea aenea (L.) Phratora americana (Schaeffer), atrovirens (Corn.), laticollis(Suffr.), tibialis (Suffr.), vitellinae (L.), vulgatissima (L.). Plagiodera versicolora (Laich.), viridipennis Stal Phaedon cochleariae (F.), (Hydrothassa) marginella (L.), (Prasocuris) phellandrii (L.) Phaedonia circumcincta (Sahlb.)

Leaf beetles secreting these compounds are listed in Table 1. Taxa known to produce them or not were replaced in both Daccordi’s classifications in Tables 2A and 2B. Cardenolides and Polyoxygenated Steroids (Figs. 2 and 3) Cardenolides or cardiac glycosides are notorious plant toxins occurring as free genins, but more often as complex glycosides. The genins are steroids characterized by the presence of a five-membered lactone ring at C17. They were found in species of twelve plant families, above all in Asclepiadaceae and Apocynaceae. They inhibit the Na+/K+ pump in various tissues including cardiac tissue and some are used to treat heart disease. Besides, they are extremely bitter and emetic (see Malcom 1991 for a review of cardenolide distribution in plants and insects and of cardenolide biological activity).

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

265

Table 2. Distribution of genera with taxa secreting isoxazolinone glucosides esterified by nitropropanoic acid (in bold) according to Daccordi’s 1982 (A) and 1994 (B) classifications. A Subtribe Doryphorina Calligrapha, Cosmogramma, Desmogramma, Labidomera, Leptinotarsa, Platyphora, Stilodes, Zygogramma. Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina, Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina) Subtribe Chrysomelina Chrysomela, Colaspidema, Linaeidea, Gastrophysa, Phaedon (including Hydrothassa and Prasocuris), Phaedonia, Plagiodera Subtribe Gonioctenina Gonioctena, Phratora B Subtribe Paropsina Gonioctena Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina, Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina) **** Calligrapha, Zygogramma **** Stilodes, Leptinotarsa, Labidomera **** Stichosa (= Desmogramma), Platyphora Subtribe Chrysomelina Colaspidema, Gastrophysa **** Phaedon (including Hydrothassa and Prasocuris) **** Phratora **** Chrysomela, Linaeidea, Plagiodera, Phaedonia

Contrary to other insects which sequester cardenolides from plants (e.g. danaid butterflies and milkweed bugs, Brower and Glazier 1975, Scudder et al. 1986), leaf beetles are able to synthesize their own cardenolides from cholesterol (Van Oycke et al. 1987) and hence from ubiquitous plant sterols as all herbivorous insects must derive their sterols from plants. Cardenolides in leaf beetle secretions are diverse (34 fully identified so far and the structure of many more remain to be determined), differing either by their genin (six recognized so far) or by their sugar moieties (reviews in Pasteels et al. 1988a and 1994, Daloze et al. 1995). Leaf beetle cardenolides were found to deter ants at a concentration of 10-3 M and toxic at concentration of 10-2 M, much below the concentration in the secretions, about 10-1 M (Pasteels et al. 1988b).

266

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

Fig. 2. Examples of cardenolides secreted by leaf beetles. (1) periplogenin-3-O-ß-D-allopyranoside secreted by Chrysolina (Oreina) gloriosa; (2) sarmentogenin-3-O-ß-D-xylopyranosyl-(1→4)-ß-D-allopyranoside secreted by Chrysolina (Allochrysolina) fuliginosa.

Fig. 3. Examples of steroid compounds secreted by leaf beetles. (1) polyoxygenated steroid glycoside secreted by Chrysolina (Hypericia) brunsvicencis; (2) polyoxygenated sreoid secreted by Chrysolina (Sphaeromela) varians; (3) 20-hydroxyecdysone 22-acetate secreted by Chrysolina (Chalchoidea) carnifex.

Leaf beetle polyoxygenated steroid glycosides are also diverse (13 identified so far, 12 different aglycones). All aglycones show a common oxidation pattern (at C-6, C-16, C-20, C-25) strongly suggesting a common evolutionary origin. Most compounds (the only exception is the ecdysteroid found in Chrysolina carnifex (Suffrian), see below) were isolated from beetles feeding on Hypericum Linn. which is devoid of these steroids (Daloze et al. 1985, 1991, Randoux et al. 1990). As far as we know, such steroids are unknown from other sources and must be synthesized by the leaf beetles from ubiquitous plant sterols as demonstrated for cardenolides. Recently, an ecdysteroid (obviously related to the abovementioned polyoxygenated steroids) was identified in the secretion of C. carnifex (Braekman, Daloze and Pasteels, unpublished results). Whereas ecdysteroids are known as molting hormones in arthropods,

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

267

they were reported as defensive compounds in plants and pycnogonids (archaic marine arthropods) with a strong feeding deterrent activity (review in Tomaschko 1997). However, no ecdysteroid was reported from the food plant of C. carnifex, Artemisia scoparia Waldst. et Kit. (Asteraceae). Species secreting cardenolides and polyoxygenated steroids are listed in Table 3 and this distribution is superimposed on Daccordi’s classifications in Tables 4A and 4B. Pentacyclic Triterpene Saponins (Fig. 4) Again, these are well known plant toxins with haemolytic and cytotoxic activities, disrupting cell membranes (Mahato and Nandy 1991). Six different saponins were identified in leaf beetles secretions (Plasman et al. 2000 a and b, 2001). Only one of them was previously known from Fagus silvatica Linn., not a food plant of chrysomeline beetles. All triterpene aglycones (five recognized so far, only differing by the position of one or two hydroxyl groups) are ß-amyrin derivatives. Insects are unable Table 3. List of species secreting steroids glycosides. 1. CARDENOLIDES Ambrostona quadriimpressum Motschulsky Calligrapha alni Schaeffer, argus Stal, multipunctata bigsbyana (Kirby), fulvipes Stal, philadelphica (L.) Chrysolina (Allochrysolina) lepida (Olivier), fuliginosa (Olivier), (Allorina) bidentata (Bontems), coerulea (Olivier), (Chrysochloa) elongata (Suffrian), speciosissima (Scopoli), (Chrysolina) banksi (F.), staphylea (L.), (Chrysomopha) cerealis (L.), (Colaphodes) haemoptera (L.), (Erythrochysa) polita (L.), (Euchrysolina) graminis (L.), virgata (Motschulsky), (Fastuolina ) fastuosa (Scopoli), (Frigidorina) frigida (Weise), (Intricatorina) intricata (Germar), (Maenadochrysa) femoralis (Olivier), (Melasomoptera ) lucida (Olivier), grossa (F.), (Menthastriella) coerulans (Scriba), herbacea (Duftschmid), viridana (Küster), (Minckia) peregrina (Herrich-Scäffer), (Oreina) alpestris variabilis (Weise), bifrons (F.), gloriosa (F.), speciosa (L.), viridis (Duftschmid), (Taeniochrysea) americana (L.), (Virgulatorina) virgulata (Germar) Cosmogramma kimbergi Boheman Stilodes flavicans Stal, fuscolineata Stal Zygogramma sexvitatta Stal, signatipennis Stal, suturalis (F.) 2. POLYOXYGENATED STEROID GLUCOSIDES OR ECDYSTEROID Chrysolina (Chalcoidea) carnifex (F.), (Hypericia ) brunsvicensis (Gravenhorst), hyperici (Förster), geminata (Paykull), quadrigemina (Suffrian), (Sphaeromela ) varians (Schaller)

268

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

Table 4. Distribution of genera with taxa secreting cardenolides (bold) or polyoxygenated steroid glucosides (bold and underlined) according to Daccordi’s 1982 (A) and 1994 (B) classifications. A Subtribe Doryphorina Calligrapha, Cosmogramma, Stichosa (Desmogramma), Labidomera, Leptinotarsa, Platyphora, Stilodes, Zygogramma Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina,Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina) Subtribe Chrysomelina Chrysomela, Colaspidema ,Linaeidea, Gastrophysa, Phaedon (including Hydrothassa and Prasocuris), Phaedonia, Plagiodera Subtribe Gonioctenina Gonioctena, Phratora. B Subtribe Paropsina Gonioctena Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina, Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina). **** Calligrapha, Zygogramma **** Stilodes, Leptinotarsa, Labidomera **** Stichosa (Desmogramma), Platyphora Subtribe Chrysomelina Colaspidema, Gastrophysa **** Phaedon (including Hydrothassa and Prasocuris) **** Phratora **** Chrysomela, Linaeidea, Plagiodera

to biosynthesize pentacyclic triterpenes and it was recently demonstrated that the beetles sequestered ß-amyrin from their food plant to synthesize their own saponins (Braekman, Daloze, Dooms, Pasteels, Plasman, Termonia, unpublished results). Since ß-amyrin is a common constituent of plant cuticular waxes (Gültz 1994), leaf beetles are little, if at all, constrained by their food plants to secrete these saponins. Species secreting saponins are listed in Table 5 and saponin distribution in beetles superimposed on Daccordi’s classifications in Tables 6 A and 6B.

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

269

Fig. 4. Examples of pentacyclic triterpene saponins secreted by leaf beetles. (1) secreted by Platyphora ligata; (2) secreted by Desmogramma subtropica. Table 5. List of species secreting triterpene saponins. Labidomera trimaculata (F). Leptinotarsa behrensi Harold, calceata StDl, haldemani (Rogers), lineolata (StDl), close to texana Schaeffer, undecimlineata StDl Platyphora albovirens (StDl), amabilis (Baly), arangoi (Steinh.), bella (Baly), boucardi (Jacoby), decorata (Jacoby), eucosma (StDl), heliogenia (Bechyné), haroldi (Baly), close to iquitonensis (Bechyné), kollari (StDl), ligata (StDl), microspina (Bechyné), opima (StDl), panamensis (Jacoby), petulans (StDl), close to salvini (Baly), spectabilis (Baly), vespertina (Baly) Strichosa (Desmogramma) subtropica Bechyné

Table 6. Distribution of genera with taxa secreting triterpene saponins (bold) according to Daccordi’s 1982 (A) and 1994 (B) classifications. A Subtribe Doryphorina Calligrapha, Cosmogramma, Stichosa (Desmogramma), Labidomera, Leptinotarsa, Platyphora, Stilodes, Zygogramma. Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina, Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina) Subtribe Chrysomelina Chrysomela, Colaspidema, Linaeidea, Gastrophysa, Phaedon (including Hydrothassa and Prasocuris), Phaedonia, Plagiodera Subtribe Gonioctenina Gonioctena, Phratora.

270

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

Table 6. Continued. B Subtribe Paropsina Gonioctena Subtribe Chrysolinina Ambrostoma, Chrysolina (Allochrysolina, Allorina, Chalcoidea, Chrysochloa, Chrysolina, Chrysomorpha, Colaphodes, Erythrochrysa, Euchrysolina, Fastuolina, Frigidorina, Hypericia, Intricatorina, Maenadochrysa, Melasomoptera, Menthastriella, Oreina, Sphaeromela, Taeniochrysea, Virgulatorina) **** Calligrapha, Zygogramma **** Stilodes, Leptinotarsa, Labidomera **** Stichosa (Desmogramma), Platyphora Subtribe Chrysomelina Colaspidema, Gastrophysa **** Phaedon (including Hydrothassa and Prasocuris) **** Phratora **** Chrysomela, Linaeidea, Plagiodera

DISCUSSION Three clear-cut groups of chrysomeline beetles were recognized on the basis of the toxins they produce. For reasons argued in the Introduction, we suggest that they are natural taxa. However, they fit neither of Daccordi’s classifications, although Daccordi’s (1994) more recent classification seems in somewhat better agreement with our data than the former ( in Seeno and Wilcox 1982 ). We do not intend to suggest an alternative classification to Daccordi’s. We are, of course, aware that a classification cannot be built on a single class of characters, regardless of how convincing those characters may appear, and even more importantly before most if not all chrysomeline taxa could be studied. The following discussion is intended to provide a building block in the progressive construction of a natural classification of chrysomeline leaf beetles. Even if it could be overly simplistic at this stage of our survey of beetle toxins, we will tentatively assign these three groups to the Chrysomelina, Chrysolinina and Doryphorina sensu stricto, discussing the possible boundaries of these subtribes and their relationships, in the hope that this will stimulate further studies to enlarge the set of characters useful in the classification of these beetles. Nitropropanoic acid and isoxazolinone secreting species or Chrysomelina sensu stricto This seems the most convincing natural taxon in our study, as it has the support of independent morphological characters. All beetles secreting nitropropanoic acid and isoxazolinone have larvae characterized by nine serial pairs of thoracic and abdominal exsertile defensive glands. Reciprocally, all studied species whose larvae possess serial glands were found to produce these compounds (this represents a large proportion of existing taxa in the Holarctic Region, see Table 1). The agreement

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

271

between larval characters (serial defensive thoracic and abdominal defensive glands) and adult characters (nitropropanoic and isoxazolinone defensive compounds) looks so tight that we would not hesitate to include in this taxon, besides those listed in Table1, taxa that are known to possess serial glands in the larval stage, but that were unavailable for studying the adult toxins, e.g. Gastrolina Baly or Mesoplatys Baly. Finally, a recent mtDNA phylogeny fully confirms that the Chrysomelina as here defined is a monophyletic clade (Termonia et al. 2001). Members of this Chrysomelina sensu stricto were placed in two different subtribes in Daccordi’s 1982 classification (Table 2A), however, the 1994 classification fits better our data as it now includes Phratora Chevrolat, but not Gonioctena Chevrolat, within the Chrysomelina (Table 2B). Indeed, in contrast to Phratora larvae, those of Gonioctena lack the serial glands diagnostic of the Chrysomelina sensu stricto. Also, our preliminary survey of the adult defensive secretions in ten species of Gonioctena belonging to 5 subgenera revealed that their secretions contain amino acid derivatives, but not nitropropanoic acid or isoxazoline glucosides (Braekman, Daloze, Mardulyn and Pasteels, unpublished data). However, the Chrysomelina sensu Daccordi 1994 includes taxa that do not meet our criteria for belonging to the Chrysomelina sensu stricto, e.g. Colaspidema atra Olivier (Pasteels, 1993). Molecular phylogenies published by Hsiao (1994, see his Fig. 4) confirms that C. atra belongs to a lineage very distantly related to that of the Chrysomelina sensu stricto, strongly suggesting that the Chrysomelina sensu Daccordi 1994 is still an unnatural ensemble. Unfortunately, we have no alternative to offer for classifying C. atra except as Chrysomelini incertae sedis and we cannot define at this stage the exact boundaries of the Chrysomelina sensu stricto. Cardenolides and polyoxygenated steroids secreting species or Chrysolinina sensu stricto Although the polyoxygenated steroids (including an ecdysteroid) are quite distinct compounds from the cardenolides, and are only secreted by members of three Chrysolina subgenera, we are lumping together all species secreting steroids in a single suprageneric taxon. These species share the ability to use plant sterols for synthesizing toxins and this particularity makes them very distinctive from the other two groups recognized here. Excluding the species secreting polyoxygenated steroids from the cardenolide secreting species is untenable considering their undisputed affinities with the other Chrysolina. However, polyoxygenated steroids seem distinct enough from cardenolides that species secreting them could deserve generic rather than subgeneric status. This is strengthened by other evidence. Hypericia Bedel and Sphaeromela Bedel species feed on Hypericum, an unusual food plant for Chrysolina, and adult morphological characters isolate them from the other Chrysolina (Bourdonné and Doguet 1991). Also, phylogenies based on mtDNA sequence confirm that Hypericia and Sphaeromela form a monophyletic lineage (Hsiao and Pasteels 1999). Chrysolina carnifex, which secrete an ecdysteroid, belongs to the subgenus, Chalcoidea Motschulsky, that Jean-Claude Bourdonné is in the process of raising to the generic level on the basis of larval morphological characters (Bourdonné pers. com.). Our results point to an unsuspected affinity between Hypericia, Sphaeromela and Chalchoidea. Additional species must be studied to confirm this, and new molecular phylogenies will be very instructive in this respect. Thus far, only one Chrysolina species, Chrysolina (Chrysochloa) cacaliae (Schrank) does not secrete steroids. However, this is a recent secondary evolution from synthesis of cardenolides to sequestration of plant pyrrolizidine alkaloids. Other Chrysochloa species synthesize both cardenolides and sequester pyrrolizidine alkaloids (Pasteels et al. 1995). The Chrysolinina sensu stricto as here recognized includes taxa classified by Daccordi (1982) in the Chrysolinina, but also in the Doryphorina (Table 4A). In 1994, Daccordi fused the two subtribes

272

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

into the Chrysolinina. This change is only partly consistent with our data. Zygogramma Chevrolat, Stilodes Chevrolat, Calligrapha Chevrolat and Cosmogramma Erichson should indeed be placed among the Chrysolinina, but not necessarily Leptinotarsa StDl, Labidomera Chevrolat, Platyphora and Desmogramma Erichson (see below). Also, the distribution of cardenolides and triterpenes among taxa does not fit Daccordi’s groups of genera of his 1994 Chrysomelina (Tables 4B and 6B). Species secreting triterpene saponins or Doryphorina sensu stricto Thus far triterpene saponins are known from members of four genera, all previously classified by Daccordi (1982) within the Doryphorina (Tables 5 and 6A). Secretion of saponins requires the use of very different plant precursors and biosynthetic pathways than the secretion of toxins in the other genera, justifying their grouping in a different suprageneric taxon. Also, Hsiao’s phylogenies based on mtDNA sequences demonstrated that at least three of these genera, Platyphora, Labidomera, and Leptinotarsa form a monophyletic lineage distinct from the Calligrapha and Zygogramma lineage, now placed in the Chrysolinina sensu stricto (see above). It remains unclear whether the Doryphorina sensu sticto is a sister clade of the Chrysolinina sensu stricto or a subset of it (see Fig 4. in Hsiao 1994). More research is needed to determine the hierarchy and boundaries of the suprageneric taxa here recognized. Not all Platyphora and Leptinotarsa species secrete saponins. We could not detect saponins in the secretions of P. sphaerica (Jacoby), L. decemlineata Say, L. tlascalana StDl, and L. typographica Jacoby. None of these species, however, secrete toxins that characterize the other two groups. We consider this absence of saponins as a secondary loss, easier to evolve than independent acquisition of a synthetic ability (see Introduction), even if we cannot explain why the capacity of secreting saponins could have been lost in these species. FINAL COMMENTS Three clear-cut groups of Chrysomeline genera are recognized by the toxins they secrete, but to suggest a classification on this basis would be, at best, very preliminary and tentative. First, as ironically stated by Mauro Daccordi in a private discussion with the senior author of this paper, the categories are possibly clear-cut only because a restricted number of species were studied, but when more species will be added to the study, the picture could become completely blurred. Second, it would be, of course, circular reasoning to only use the observed distribution of beetle toxins to build a classification that is then used to explain the present distribution of toxins among taxa and the evolution of chemical defense in leaf beetles. We still lack a natural classification of chrysomeline leaf beetles that could allow us to interpret our data in an evolutionary perspective. Our goal was to stimulate taxonomists to reconsider chrysomeline classification by all possible means to reach a more natural classification. We believe that chemical secretion data are useful, but the major advances will come from comparisons of DNA sequences. Work in this direction is in progress in our laboratories. ACKNOWLEDGEMENTS This research was supported by a grant from the Belgium ‘Fonds National de la Recherche Scientifique’ (2.4519.00) to JMP. A.T. is supported by a PhD grant from the ‘Fonds pour la formation

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

273

à la Recherche dans l’ Industrie et dans l’ Agriculture’. Many colleagues were of invaluable help by sending material and/or by their vivid discussions, not implying that they always share our view: J.C. Bourdonné, M. Daccordi, M. Hayashi, T. Hsiao, H. Kippenberg, L. LeSage, and E. Petitpierre. Most of our Neotropical taxa were identified by M. Daccordi. LITERATURE CITED Bourdonné, J.-C. and S. Doguet. 1991. Données sur la biosystématique des Chrysolina L.S. (Coleoptera: Chrysomelidae: Chrysomelinae). Annales de la Société Entomologique de France (NS) 27:29-64. Brower, L. P. and S. C. Glazier. 1975. Localization of heart poisons in the monarch butterfly. Science 188:1925. Coburn, W. M., F. R. Stermitz and R. D. Thomas. 1975. Nitro compounds in Astralagus species. Phytochemistry 14:2306-2308. Daccordi, M. 1982. Chrysomelinae. In: Seeno, T. N. and J. A. Wilcox. 1982. Leaf beetle genera (Coleoptera: Chrysomelidae). Entomography 1:75-95. Daccordi, M. 1994. Notes for phylogenetic study of Chrysomelinae, with descriptions of new taxa and a list of all the known genera (Coleoptera: Chrysomelidae, Chrysomelinae), pp. 60-84. In: D. G. Furth (Ed.), Proceedings of the Third International Symposium on the Chrysomelidae. Beijing, 1992. Backhuys, Leiden. Daloze, D., Braekman, J.-C. and J. M. Pasteels. 1985. New polyoxygenated steroidal glucosides from Chrysolina hyperici. Tetrahedron Letters 26:2311-2314. Daloze, D., J.-C. Braekman, A. Delbrassine and J. M. Pasteels. 1991. Polyoxygenated steroid sophorosides from the defence glands of Chrysolina quadrigemina (Coleoptera; Chrysomelidae). Journal of Natural Products 54:1553-1557. Daloze, D., F. Broeders, J.-C. Braekman, J. Araujo and J. M. Pasteels. 1995. New cardiac glycosides containing 2-deoxyhexoses from the defensive secretion of adult Chrysolina banksi (Coleoptera: Chrysomelidae). Biochemical Systematics and Ecology 23:113-119. Gistine, D. L. 1979. Aliphatic nitro compounds in crownvetch; a review. Crop Science 19:197-203. Gomez-Zurita, J., C. F. Garin, C. Juan, and E. Petitpierre. 1999. Mitochondrial 16s rDNA sequences and their use as phylogenetic markers in leaf-beetles with special reference to the subfamily Chrysomelinae, pp. 2538. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology 1. Backhuys Publishers, Leiden. Gülz, P. G. 1994. Epicuticular leaf waxes in the evolution of the Plant Kingdom. Journal of Plant Physiology 143:453-464. Harlow, M. C., F. R. Stermitz and R. D. Thomas. 1975. Isolation of nitro compounds from Astralagus species. Phytochemistry 14:1421-1423. Hsiao, T. H. 1994. Molecular tecniques for studying systematics and phylogeny of Chrysomelidae, pp. 237248. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer, Dordrecht. Hsiao, T. H. and J. M. Pasteels. 1999. Evolution of host-plant affiliation and chemical defense in ChrysolinaOreina leaf beetles as revealed by mtDNA phylogenies, pp. 321-342. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology 1. Backhuys Publishers, Leiden. Ikegami, F., F. Lambein, Y. H. Kuo and I. Murakoshi. 1984. Isoxazolinon-5-one derivatives in Lathyrus odoratus during development and growth. Phytochemistry 23:567-1569. Lafont, R., A. Bouthier and I. D. Wilson. 1991. Phytoecdysteroids: Structures, occurrence, biosynthesis and possible ecological significance, pp. 197-214. In: I. Hrdy (Ed), Insect Chemical Ecology. Academia, Praha.

274

Jacques M. Pasteels, Arnaud Termonia, Désiré Daloze & Donald M. Windsor

Mahato, S. B. and A. K. Nandy. 1991. Triterpenoid saponins discovered between 1987 and 1989. Phytochemistry 30:1357-1390. Majak, W., M. Benn, D. McEwan and M. A. Pass. 1992. Three nitropropanoyl esters of glucose from Indigofera linnaei. Phytochemistry 31:2393-2395. Malcom, S. B. 1991. Cardenolide-mediated interactions between plants and herbivores, pp. 251-296. In: G. A. Rosenthal and M. R. Berenbaum (Eds.), Herbivores: Their Interactions with Secondary Plant Metabolites. Second Edition. Vol 1. The Chemical Participants. Academic Press, San Diego. Mardulyn, P., M. C. Milinkovitch and J. M. Pasteels. 1997. Phylogenetic analyses of DNA and allozyme data suggest that Gonioctena leaf beetles (Coleoptera, Chrysomelidae) experienced convergent evolution in their history of host-plant family shifts. Systematic Biology 46:722-747. Pasteels, J. M. 1993. The value of defensive compounds as taxonomic characters in the classification of leaf beetles. Biochemical Systematics and Ecology 21:135-142. Pasteels, J. M., J.-C. Braekmanand, D. Daloze and R. Ottinger. 1982. Chemical defense in chrysomelid larvae and adults. Tetrahedron 38:1891-1897. Pasteels, J. M., Braekman, J.-C. and D. Daloze. 1988a. Chemical defense in the Chrysomelidae, pp. 233-252. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer, Dordrecht. Pasteels, J. M., M. Rowell-Rahier and M. J. Raupp. 1988b. Plant-derived defense in chrysomelid beetles, pp. 235-272. In: P. Barbosa and D. K. Letourneau (Eds.), Novel Aspects of Insect-Plant Interactions. Wiley, New York. Pasteels, J. M., M. Rowell-Rahier, J.-C. Braekman and D. Daloze. 1994. Chemical defense of adult leaf beetles updated, pp. 289-301. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer, Dordrecht. Pasteels, J. M., S. Dobler, M. Rowell-Rahier, A. Ehmke and T. Hartmann. 1995. Distribution of autogenous and host-derived chemical defenses in Oreina leaf beetles (Coleoptera, Chrysomelidae). Journal of Chemical Ecology 21:1163-1179. Pasteels, J. M., A. Termonia, D. M. Windsor, L. Witte, C. Theuring and T. Hartmann. 2001. Pyrrolizidine alkaloids and pentacyclic triterpene saponins in the defensive secretions of Platyphora leaf beetles. Chemoecology 11:113-120. Petitpierre, E. 1988. Cytogenetics, cytotaxonomy and genetics of Chrysomelidae, pp. 131-160. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer, Dordrecht. Petitpierre, E. and C. Juan. 1994. Genome size, chromosomes and egg-chorion ultrastructure in the evolution of Chrysomelinae, pp. 213-225. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer, Dordrecht. Petitpierre, E., C. Segarra, J. S. Yadav and N. Virkki. 1988. Chromosome numbers and meioformulae of Chrysomelidae, pp. 161-186. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer, Dordrecht. Plasman, V., J.-C. Braekman, D. Daloze, M. Luhmer, D. M. Windsor and J. M. Pasteels. 2000a. Triterpene saponins in the defensive secretion of a chrysomelid beetle, Platyphora ligata. Journal of Natural Products 63:646-649. Plasman, V., J.-C. Braekman, D. Daloze, D. M. Windsor and J. M. Pasteels. 2000b. Triterpene saponins, quaternary ammonium compounds, phosphatidyl cholines, and amino acids in the pronotal and elytral secretions of Platyphora opima and Desmogramma subtropica. Journal of Natural Products 63:1261-1264. Plasman, V., M. Plehiers, J.-C. Braekman, D. Daloze, J.-C. de Biseau and J. M. Pasteels. 2001.Chemical defense in Platyphora kollari Baly and Leptinotarsa behrensi Harold (Coleoptera; Chrysomelidae). Hypothesis on the origin and evolution of leaf beetles toxins. 2001. Chemoecology 11:107-112.

Distribution of Toxins in Chrysomeline Leaf Beetles: Possible Taxonomic Inferences

275

Randoux, T., J.-C. Braekman, D. Daloze and J. M. Pasteels. 1990. New polyoxygenated steroid glycosides from the defence glands of several species of Chrysolinina beetles (Coleoptera: Chrysomelidae). Tetrahedron 46:3879-3888. Randoux, T., J.-C. Braekman, D. Daloze and J. M. Pasteels. 1991. De novo biosynthesis of ∆3-isoxazolin-5-one and 3-nitropropanoic acid derivatives in Chrysomela tremulae. Naturwissenschaften 78:313-314. Scudder, G. G. E., L. V. Moore and M. B. Isman. 1986. Sequestration of cardenolides in Oncopeltus fasciatus. Morphological and physiological adaptations. Journal of Chemical Ecology 12:1171-1187. Tomaschko, K.-H. 1997. Ecdysteroids in pycnogonids: hormones and interspecific allelochemicals, pp.171188. In: K. Dettner, G. Bauer and W. Voelki (Eds.), Vertical Food Web Interactions, Ecological Studies, vol. 30. Springer- Verlag, Berlin. Termonia, A., T. H. Hsiao, J. M. Pasteels and M. C. Milinkovitch. 2001. Feeding specialization and host-derived chemical defense in Chrysomeline leaf beetles did not lead to an evolutionary dead end. Proceedings of the National Academy of Sciences 98:3909-3914. Turner, W. B. 1971. Fungal Metabolites, pp. 303-304. Academic Press, London. Van Oycke, S., J.-C. Braekman, D. Daloze and J. M. Pasteels. 1987. Cardenolide biosynthesis in chrysomelid beetles. Experientia 43:460-462.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers Flight polymorphism observed in an alpine leaf beetle and associated costs 277 Special Topics in Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 277-284

Flight polymorphism observed in an alpine leaf beetle and associated costs Nicole M. Kalberer1,2 and Martine Rahier2 1,2 2

Eidg. Forschungsanstalt für Agrarökologie und Landbau, Reckenholzstr. 191, 8046 Zürich, Switzerland. Institut de Zoologie, Université de Neuchâtel, Rue Emile Argand 11, CH-2007 Neuchâtel, Switzerland. E-mail: [email protected]

ABSTRACT Flight polymorphism in an alpine population of the leaf beetle Oreina cacaliae (Coleoptera: Chrysomelidae) was observed in the field. One part of this population engaged in flight in autumn and spring (flyers) whereas the other part did not fly and got active after overwintering, later in the season (nonflyers). The flyers fed on a spring host plant Petasites paradoxus Baumgartner since they emerged earlier than the main host Adenostyles alliariae. By comparing life history parameters of the two morphs of O. cacaliae, we tested possible costs associated with flight. Flyers (males and females) were smaller in size than nonflyers, measured as elytra length. Within the nonflyer group small females larviposited significantly fewer larvae than large females. Flying reduced reproduction and survival only when the beetles did not have access to food after their flights, which might represent the situation in the field since beetles risk not to be able to feed while flying from spring to summer host. Insect dispersal by flight may be an investment, by a portion of the population, in colonising and exploiting resources in new habitats, with a risk of reduced reproduction and survival. KEY WORDS: dispersal by flight, cost, reproduction, survivorship, Coleoptera, Chrysomelidae, Oreina cacaliae.

INTRODUCTION In several herbivorous insect species flight polymorphism has been observed. Advantages of the flying morph might be for the escape from deteriorating patches of host plants and for the colonisation of more nutritious and less crowded stands that occur elsewhere (Denno et al. 1989). But there may also be costs associated with dispersal such as increased predation risk or the failure to find a suitable habitat, as well as costs in terms of life history traits such as reproduction and survival (Roff 1984). In many systems the difference in morphology between morphs is obvious without any tedious analysis of flight behavior, therefore wing polymorphism has provided an easy way to assess costs of flight. However, the costs assessed in such studies are often due to the possession of flight muscles and wings rather than to actual flight since winged individuals do not always migrate or

278

Nicole M. Kalberer & Martine Rahier

even fly (Rankin and Burchsted 1992). In addition, flight activity is usually tested under artificial circumstances, the insect being fixed to a pin or tethered to a mill (Solbreck 1974). In our Oreina cacaliae (Schrank) (Coleoptera: Chrysomelidae) system, we distinguish two classes of beetles: a) flyers, that leave their main host plant patch in autumn to overwinter away from their host plants and that emerge early in spring to fly to the spring host Petasites paradoxus (Asteraceae) where they feed until the main host Adenostyles alliariae Kerner (Asteraceae) comes out, and b) nonflyers, that overwinter in the ground below the host plant patches of A. alliariae and emerge in early summer at the same time as that host plant and never feed on another plant (Kalberer 2000). The objective of this study was to determine whether there is a correlation between dispersal polymorphism and performance in O. cacaliae beetles. Specifically we examined whether flyers differed from nonflyers in: (1) fecundity, (2) size, and (3) survivorship. METHODS Beetles and Collection Sites All beetles were collected in the Swiss Alps near La Fouly in the Val Ferret (Valais) at 1500 m above sea level (45°56’10” N latitude, 7°05’95” E longitude). The flyer group was collected on the spring host P. paradoxus and the nonflyer group was collected on A. alliariae as soon as this main host emerged. The flyers were collected between mid April (1998) and mid May (1997, 1999), and nonflyers between end of May (1997 and 1998) and beginning of June (1999). Beetles were sexed using sexual dimorphism of the tarsi (Lohse and Lucht 1994). Male and Female Size In 1998, the length of the elytra of 98 flyers and 144 nonflyers were measured with a calliper after collection in the field to determine whether there was a difference in size between the two groups. Data on size of male and female beetles in the flyer and nonflyer group, respectively, were analysed with a two-factor ANOVA using ‘size’ as the dependent variable and ‘sex’ and ‘flying state’ as factors. Female Fecundity The fecundity of female flyers and nonflyers was determined in the laboratory during the whole reproductive season for three consecutive years. Females were individually kept in plastic containers lined with a thin layer of moist plaster and a filter paper to ensure constant humidity. They were maintained in an incubator at a day temperature of 16°C and a night temperature of 12°C and a 16L: 8D regime. This ensured a temperature rhythm concordant with natural conditions in the field at the beginning of June. Every week, the number of offspring was counted, the occurrence of dead females was noted, food foliage and filter paper were replaced and the plaster bottom in the pots was moistened. The number of offspring was summed over the season, starting with the first day that a female larviposited. Observations were continued for at least three weeks after the last larva was found. In 1997, the females of the flyer group were fed with flowering P. paradoxus until the emergence of A. alliariae. As soon as A. alliariae from the field was available, both groups were

Flight polymorphism observed in an alpine leaf beetle and associated costs

279

fed with this main host plant, in all years. In 1998, the flyers were not fed in the four week period between their collection and the emergence of A. alliariae in the field. Because of the high mortality in the unfed flyer group of 1998, three groups were maintained in 1999: flyers not fed, flyers fed with P. paradoxus until the emergence of A. alliariae and nonflyers fed with A. alliariae from the beginning. Because nonflyers overwinter in close vicinity from the main host A. alliariae, it is very likely that they have access to food immediately after overwintering. Female Survival Every week we checked for female mortality in the plastic containers in the lab. A log-rank test was used to test for differences in survival curves between females of the unfed and fed flyers and nonflyers (Harrington and Flemming, 1982). A Bonferroni correction was used to adjust the critical significance levels for multiple pairwise comparisons (Rice, 1989). Relationship between Number of Larvae Produced and Female Survival To test the influence of survival time on reproduction, number of days living versus number of larvae produced in the flyer and nonflyer group of 1997 was subjected to a regression analysis. RESULTS There is no morphological difference detectable by eye to distinguish flyers from nonflyers in the field. By collecting flyers from P. paradoxus we were sure that they had reached that plant by flying in spring. The possibility that O. cacaliae overwintered in the soil or the leaf litter next to P. paradoxus and had not flown to these spring host patches after overwintering at sites away from A. alliariae, could be excluded, because in autumn beetles were observed at overwintering sites at a cliff away from both host plants and never close to P. paradoxus. In addition, the level of infestation of P. paradoxus patches seemed to be related to the distance from the nearest overwintering place with patches close to the overwintering place infested earlier than the ones further away. O. cacaliae beetles found on the spring host P. paradoxus at a distance between 75 and 450 m from their overwintering places were regarded as flyers, whereas beetles collected in a patch of A. alliariae at a time when this plant was producing its first leaves were considered as nonflyers. At the time the nonflyers were collected from A. alliariae, the flyers were still present on P. paradoxus flowers. Beetles were observed on P. paradoxus as long as this plant was flowering (flowering precedes leaf emergence in this species). Since we recaptured four beetles that had been marked the previous year in the same A. alliariae patch after one year, we can be sure that at least some beetles, nonflyers, stayed in the same host plant patch for at least two consecutive years. Size of Flyers and Nonflyers The size of the beetles (length of elytra) was measured in 1998. Male beetles, flyers as well as nonflyers, were smaller than female beetles of the same group (Fig. 1). Female as well as male flyers were smaller in size than nonflyers (two-factor ANOVA: MS=0.27, F=5.394, P<0.0211, n=54 female flyers, n=51 female nonflyers, n=44 male flyers, n=94 male nonflyers).

280

Nicole M. Kalberer & Martine Rahier 7.9 7.8

size (mm)

7.7 7.6

female male

7.5 7.4 7.3 7.2 7.1

flyer

nonflyer

Fig. 1. Flyers (males and females) are smaller in size than nonflyers and males are smaller than females (mean size and SE, F= 5.4, P<0.02, for flying group, F= 313.8, P< 0.001 for sex, two factor ANOVA, n=54 female flyers, n=51 female nonflyer, n=44 male flyer, n=94 male nonflyer).

Larval Production

Total number of larvae

To analyze quantitative differences in the total number of larvae produced in the different flying group and the different years we used an ANOVA (MS=20682.7, F=30.56, P<0.0001, n=265) followed by a Bonferroni/Dunn post-hoc test. Unfed flyers produced significantly fewer larvae than nonflyers in 1998 and 1999 at the 5% level (Fig. 2). Interestingly, when flyers were fed (in 1997 and 1999), the total number of larvae they produced was not different from beetles of the nonflyer group. 70

a

a

60

Unfed flyers Fed flyers Nonflyers

a

50 40

b

30

b

20

c

10

c

0

1997

1998

1999

Fig. 2. Total number of larvae per female produced over a whole season in the different dispersal groups (mean and SE). n=39 flyer 1997, n=30 fed flyer 1999, n=50 flyer 1998, n=30 flyer 1999, n=39 nonflyer 1997, n=50 nonflyer 1998, n=30 nonflyer 1999. Different letters indicate significant differences (ANOVA: MS = 2082.7, F=30.86, P<0.001, n=265).

Flight polymorphism observed in an alpine leaf beetle and associated costs

281

Female Survival Female survivorship curves showed that less than 10% of the unfed flyers survived the first 28 days after larviposition had started, whereas between 55 and 90% of both, fed flyers and nonflyers lived longer than 28 days (Fig. 3). There was no difference in survivorship within the nonflyer group of the three years (log-rank test, Chisq=4.4, df =1, P= ns between 1997 and 1998; Chisq=0, df=1, P=ns between 1997 and 1999; Chisq=1.4, df =1, P=ns) and no difference within the unfed flyer groups (Chisq=0, df=1, P=0.86). Survivorship was significantly different between the unfed flyers and the fed flyers (Chisq=47.3, df=1, p<0.0001 for flyer unfed 1998/flyer fed 1999, Chisq=13.5, df=1, P<0.001 for flyer unfed 1998, flyer fed 1997, Chisq = 45.8, df = 1, P< 0.001 for flyer fed 1999 flyer unfed 1999, Chisq 15.2, df =1, P < 0.001 for flyer fed 1997/flyer unfed 1999). Regression between Larva Production and Life Span A positive relationship was found between female longevity and the total number of larvae produced (Fig. 4); (y= 11.34x +0.91, R2=0.41, F = 53.21, P <0.0001, n = 78). The analysis was done with data from the flyer and nonflyer group of 1997, because in the flyer group of 1998 too few larvae were laid.

flyer unfed 98 flyer unfed 99 flyer fed 97 flyer fed 99 nonflyer 97 nonflyer 98 nonflyer 99

females alive (%)

100

75

50

25

0 0

7

14

21

28

35

42

49

56

63

70

77

84

91

98

number of days Fig. 3. Survival curves of adult O. cacaliae females of the unfed flyer (circles), fed flyers (triangles) and nonflyer (squares) groups during three years. Day zero is the day that beetles were collected in the field.

282

Nicole M. Kalberer & Martine Rahier

Number of larvae

140

y = 11.338x + 0.91 R2 = 0.412

120 100 80 60 40 20 0

0

10

20

30

40

50

60

70

80

90 100

Longevity (days) Fig. 4. Regression analysis on the number of larvae laid per individual female over the 1997 season (flyer and nonflyer) and the corresponding number of days that females lived (F = 53.21, P d≤0.0001, n = 78).

DISCUSSION The distinct flight behavior of O. cacaliae observed in Val Ferret allowed us to distinguish flyers from nonflyers. Like many other Coleoptera, males of O. cacaliae were smaller than females. The flyer beetles, males as well as females, were significantly smaller than the nonflyers. Sub-optimal nutrition in a bad host plant patch might have resulted in smaller beetles, thus it seems adaptive for small beetles to fly away from this environment and reproduce in another habitat. Roff (1991) suggested that bioenergetic constraints mandate that migrants should be as large as they can be to maximize the distance they can travel without refuelling, and thus predicts that migrants will be larger, on average, than nonmigrants. This prediction was not supported in O. cacaliae. Preliminary observations suggested that wing size and beetle size are correlated, thus smaller beetles probably do not have a better flight potential in O. cacaliae. The O. cacaliae flyers produced significantly fewer larvae than the nonflyers, only if the flyers were not fed. Fed flyers produced as many larvae as nonflyers in O. cacaliae. Access to food before and after flight seems to be an important factor for the number of larvae produced. In other insect orders, access to food after flight was shown to be important to reduce the cost of flight on reproduction, too. In the migrant bug, Oncopeltus fasciatus (Dallas), flights of several hours over 6 days had no effect on life history characteristics of female bugs unless they were also starved over that period, which reduced fecundity and longevity (Slansky 1980). Our mark-recapture studies with O. cacaliae showed that flyers travelled distances between 110 and 950 m when flying from spring to the summer host, and the risk not to be able to feed during that time is high since many beetles were observed on the snow away from any potential host. Therefore we consider that the situation presented in 1998, where the flyers were not fed in the lab, could be more realistic than the one of 1997 were the flyers were fed with P. paradoxus between their collection on P. paradoxus in the field and emergence of A. alliariae. The reality probably lies between these two extreme nutritional status.

Flight polymorphism observed in an alpine leaf beetle and associated costs

283

As for reproduction, feeding after flight was an important factor for female longevity. For unfed flyers in 1998 and 1999 more than 90% of females died within 28 days after reproduction started, more than twice as many compared to fed flyer and nonflyer groups. In the unfed flyer group of 1998 and 1999, 60 and 85% respectively died within 3 weeks after collection, representing the approximate time they needed to find A. alliariae patches in the field (Kalberer 2000). The 1999 study, where a fed and an unfed flyer group were maintained together with a nonflyer group, confirmed that feeding is the factor leading to the difference in survival as well as in reproduction. Fed flyer beetles survived significantly better than unfed flyers in both years. Survival was linked positively with reproduction since the females continued to larviposit during three months. O. cacaliae females do not need to remate in spring (Dobler and Rowell-Rahier 1996), but are able to start a new colony directly after overwintering. Nevertheless, mating in this species has been observed in spring, especially on the spring host of the flyers, P. paradoxus. Thus, if selection on males acts during the winter season, females may increase their fitness by remating with males that successfully overwintered (Stevens and Cauley 1989). In addition, sperm which became inviable during the winter may be replaced by remating in spring. O. cacaliae lives in a relatively stable environment, where parasites are rare, in the Swiss Alps. A. alliariae patches provide everything beetles need to survive, reproduce and complete their life cycle. Those patches can persist for several years (some are known to us for more than 15 years). Nevertheless catastrophic events like flooding (as observed at a site in the Val Ferret in 1997 and 2000) can completely destroy a host plant patch within hours. In the absence of reliable environmental cues, it may be advantageous to spread the risk (den Boer 1968). Selection might have favoured individuals that produce heterogeneous offspring, some of which stay in the patch (nonflyers), and some of which disperse to other patches (flyers) (Davis 1984). Our results indicate that possible costs exist in survival and reproduction when the flying beetles have no access to food after flight. Since there is a high degree of patchiness in plant communities and beetles continually try to find high quality host plants, investing energy in dispersal may be justified. ACKNOWLEDGEMENTS We thank Yves Borcard and Estelle Labeyrie for their help with handling the beetles in 1999. We further acknowledge Bernd Hägele for improving the manuscript. LITERATURE CITED Boer, P. J. den 1968. Spreading the risk and stabilization of animal numbers. Acta Biotheoretica 18:165-194. Davis, M. A. 1984. The flight and migration ecology of the red milkweed beetle (Tetraopes teraophthalmus). Ecology 65:230-234. Denno, R., K. L. Olmstead and E. S. McCloud 1989. Reproductive cost of flight capability: a comparison of life history traits in wing dimorphic planthoppers. Ecological Entomology 14:31-44. Dobler, S. and M. Rowell-Rahier 1996. Reproductive biology of viviparous and oviparous species of the leaf beetle genus Oreina. Entomologia Experimentalis et Applicata 80:375-388. Harrington D. and T. Fleming 1982. A class rank test procedure for censored survival data. Biometrica 69:55366. Kalberer, N. M. 2000. Dispersal, its influence on reproduction and host-plant recognition in the alpine leaf beetle Oreina cacaliae. Thesis. University of Neuchâtel, Switzerland.

284

Nicole M. Kalberer & Martine Rahier

Lohse, G. A. and W. H. Lucht 1994. Die Käfer Mitteleuropas 14. Page 73. Evers, Fischer, Yena, Germany. Rankin M. A. and J. C. A. Burchsted 1992. The cost of migration in insects. Annual Review of Entomology 37:533-559. Rice W. R. 1989. Analyzing tables of statistical tests. Evolution 43:22-225 Roff, D. A. 1984. The cost of being able to fly: a study of wing polymorphism in two species of crickets. Oecologia 63:30-37. Roff, D. A. 1991. Life history consequences of bioenergetic and biomechanical constraints on migration. American Zoologist 31:205-215. Slansky, F., 1980. Food consumption and reproduction as affected by tethered flight in female milkweed bugs (Oncopeltus fasciatus). Entomologia Experimentalis et Applicata 28:277-286. Solbreck, C. 1974. Maturation of post-hibernation flight behaviour in coccinellid Coleomegilla maculata (de Geer). Oecologia 17:265-275. Stevens, L. and D. E. M. Cauley 1989. Mating prior to overwintering in the important willow leaf beetle, Plagiodera versicolora (Coleoptera: Chrysomelidae). Ecological Entomology 14:219-223.

David G. Furth (ed.) 2003 © PENSOFT Publishers Population Ecology Of The Polymorphic Species Chelymorpha cribraria 285 Special Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 285-294

Population Ecology Of The Polymorphic Species Chelymorpha cribraria (Coleoptera: Chrysomelidae) In Rio De Janeiro, Brazil Rodrigo de O. Gonçalves1 and Margarete V. de Macedo1 1

Laboratório de Ecologia de Insetos, Depto. de Ecologia, CP 68020, IB, UFRJ, Rio de Janeiro, Brasil. Email: [email protected]

ABSTRACT Chelymorpha cribraria F. 1775 (Chrysomelidae: Cassidinae) is a polymorphic species in which different forms are represented by combinations of pronotum and elytra coloration. This species is found feeding on Ipomoea pes-caprae and I. imperati (Convolvulaceae) leaves in coastal sand dunes (“restinga”) in Rio de Janeiro State, Brazil. In this study we describe the biology and the population fluctuation of the species at National Park of Restinga of Jurubatiba, in Carapebus County, Rio de Janeiro, Brazil. Different forms of C. cribraria were collected in the field and reared in laboratory, under controlled conditions of temperature and photoperiod in a climatic chamber, at 20, 25, 30 and 35°C. In the field, larvae clearly showed two abundance peaks, differently from adults, which were more uniformly frequent throughout the year. Pupae and egg clutches were rare most of the months. As leaves of the host plant species were available all this time, it is possible to say that the availability of the resource does not affect the population fluctuation. C. cribraria was least abundant during dry periods in the field. This information, associated with the fact that the temperature was important for immature development, 30°C with shorter development time, followed by 25°C and no development at 20 and 35°C, strongly suggest that climatic factors play an important role in determining its population fluctuation.

RESUMO Chelymorpha cribraria F. 1775 (Chrysomelidae: Cassidinae) é uma espécie polimórfica cujas diferentes formas são representadas pelas combinações da coloração de pronoto e élitro. Essa espécie é encontrada se alimentando em folhas de Ipomoea pes-caprae e I. imperati (Convolvulaceae) em vegetação de restinga no estado do Rio de Janeiro, Brasil. Neste estudo, descrevemos a biologia e a flutuação populacional desta espécie no Parque Nacional da Restinga de Jurubatiba, no município de Carapebus, Rio de Janeiro, Brasil. Diferentes formas de C. cribraria foram coletadas no campo e criadas em laboratório, sob condições de temperatura e fotoperíodo controlados numa câmara climática, a 20, 25, 30 e 35°C. No campo, larvas mostraram dois picos de abundância, diferentemente dos adultos, que se apresentaram mais uniformemente freqüentes ao longo do ano. Pupas e desovas foram raros na maioria dos meses. Como as folhas da planta hospedeira estavam disponíveis por todo o período,

286

Rodrigo de O. Gonçalves & Margarete V. de Macedo

é possível dizer que a disponibilidade quantitativa do recurso não afetou a flutuação populacional. Os períodos mais secos foram exatamente os que mostraram as menores densidades de C. cribraria. Estes dados, juantamente com os resultados da criação em diferentes temperaturas, onde 30°C foi a condição com menor tempo de desenvolvimento, seguido por 25°C, e com as temperaturas de 20 e 35°C sem desenvolvimento, sugerem que fatores climáticos representem um papel importante na determinação da flutuação populacional. INTRODUCTION Unlike temperate areas, temperature does vary dramatically in the tropics. Instead, humidity and precipitation are very important factors, and the latter can influence the tropical insect dynamics (Delinger, 1986; Wolda, 1988). The effects of these abiotic factors may directly affect insect reproduction, development and other activities (Tanaka and Tanaka, 1982). The host plant availability may also affect the phytophagous insect dynamics (Janzen and Schoener, 1968; Janzen, 1973; Wolda, 1978a, b, 1980, 1988). The host plant can be influenced by the abiotic conditions and thus it can affect the insects that use it as a resource. There is also evidence that host plant quality may vary seasonally (Hsiao, 1986), and this variation may influence insect phenology. Despite the high diversity of Chrysomelidae beetles, few works have dealt with the ecology of the neotropical species (e.g. Carroll, 1978; Vasconcellos-Neto, 1988; Medeiros and VasconcellosNeto, 1994; Macêdo et al., 1994; Windsor et al., 1995; Macêdo et al., 1998). Even their biology and host plant association much remains to be investigated. Studying Neotropical Cassidinae Buzzi (1994) mentions 11 Chelymorpha Chevrolat species, 10 of them feed on Convolvulaceae plants, all species in the genus Ipomoea Linn. Chelymorpha cribraria F. 1775 (Chrysomelidae: Cassidinae) is a polymorphic species in which different forms are represented by the combination of pronotum and elytra coloration (Vasconcellos-Neto, 1988). In coastal sand dunes (“restinga”) in Rio de Janeiro State, Brazil, this species is found feeding on Ipomoea pes-caprae (Linn.) R. Br. and I. imperati leaves. In this study we describe the biology and the population fluctuation of the species at National Park of Restinga of Jurubatiba, in Carapebus County, Rio de Janeiro, Brazil. MATERIALS AND METHODS Study Area The study was conducted at National Park of Restinga of Jurubatiba (Fig. 1), which spreads over three counties: Macaé, Carapebus and Quissamã, between 22° and 22° 23´S and 41° 15´ and 41° 45´W. At the Restinga, the rain distribution is strongly seasonal, with minimum values in winter (41mm) and maximum in summer (189mm); there is a lack of water between June and September. The mean annual temperature is 22.6°C, with maximum values in January (29.7°C) and minimum in July (20.0°C) (Henriques et al, 1986). This study site (Fig. 2) was in the first vegetation zone, called halophytic and creeping psammophyte (Araujo et al, 1998). This vegetation zone begins after the shore line and usually exhibits a clear zonation. Its mean width varies from 5m to 10m, although it is possible to find larger ones (Araujo et al, 1998). Approximately 16 species occur in this community, and the most common are Blutaparon portulacoides (A. St.-Hil.) Mears (Amaranthaceae), Panicum racemosum Rasp. (Poaceae), Sporobolus virginicus

Population Ecology Of The Polymorphic Species Chelymorpha cribraria ...

287

21°

Brazil

22°

State of Rio de Janeiro

Carapebus Macaé 23°

44

°

43

42

°

°

4000m

500m

500m

Study site

Atlantic Ocean

Figure 1. National Park of “Restinga de Jurubatiba”, Rio de Janeiro, Brazil (from Petrucio, 1998).

Figure 2. Study site, between the Atlantic Ocean (right) and the road (left).

288

Rodrigo de O. Gonçalves & Margarete V. de Macedo

(L.) Kunth (Poaceae) and Mariscus pedunculatus (R. Brown) T. Koyama (Cyperaceae). All these plant species have a large distribution along the Brazilian coast (Lacerda et al, 1993). Although not mentioned above, Ipomoea pes-caprae (Convolvulaceae), which is the beetle host plant, is a vine that shows the same distribution pattern. Behavior and Biology In the field, the oviposition site (on the host plant or on a nearby plant), as well as larvae, pupae, and adults location was also recorded. Different forms of C. cribraria adults were collected in the field and reared in laboratory, under controlled conditions of temperature and photoperiod at a climatic chamber. The insects were reared at 20°, 25°, 30° and 35°C. For each temperature value, 30 virgin couples were chosen, and placed in different plastic boxes, fed Ipomoea pes-caprae leaves every day. The couples were also observed daily in order to find egg clutches for the first 16 days. Whenever they were found, they were counted and separated in relation to their oviposition day. The plastic boxes containing egg clutches were observed daily and on the day larvae hatched, they were separated in another plastic box and fed Ipomoea pes-caprae. The larval boxes were cleaned daily and the larvae were fed every day until their pupation. The pupae were also separated in another box containing the whole information about the individuals. By the time the adults emerged, information about the day, sex and form was recorded. The sex is determined by their body size and abdominal shape - males are smaller and have round body, females are bigger and have longer body. The oviposition rate was calculated as: number of eggs / number of ovipositing females / number of days. Population Fluctuation A 200m transect, parallel to the beach, marked at each 1m was used to sample the beetles from March 1998 until May 1999. Monthly, 50 points were randomly chosen to place a quadrat of 0.35 x 0.45m, in which the numbers of host plant leaves, adults, pupae, larvae and egg clutches were reported. Sex and form of each adult found was also recorded. The density of individuals was presented as number of each beetle developmental stages in 100 leaves. Climatic data were given by the Meteorological Station of Fazenda São Lázaro. RESULTS AND DISCUSSION Behavior and Biology During the study, 511 adults, 110 pupae, 648 larvae and 161 egg clutches were found at the study area and at nearby areas. Oviposition may occur on the host plants I. pes-caprae (73.29%) and I. imperati (0.62%) or on nearby plants (26.09%). Larvae are found on both Ipomoea species, but mainly on I. pes-caprae (93.98% on I. pes-caprae and 1.85% on I. imperati) and on nearby plants (4.17%). In this case, they were generally close to pupation. During the first instars, larvae are found in aggregations, and through all larvae stages, the shield defense is constructed from feces and exuviae. Larvae may pupate on the host plant I. pes-caprae (36.36%) or on nearby plants (63.64%). Adults can also be

Population Ecology Of The Polymorphic Species Chelymorpha cribraria ...

289

found on nearby plants (3.52%), but they are found most of the time at their host plants I. pes-caprae (96.09%) and I. imperati (0.39%). The shorter development time was found at 30°C (Table 1). No individuals succeeded in reaching maturity at 20° and 35°C. Moreover, the survivorship of the couples was also much lower at these temperatures. The oviposition rate was quite different among the temperatures. At both extreme temperatures, the oviposition rate was far lower than that at 25° and 30°C, the latter being the best condition for females to reproduce (Table 2). At 30°C, the development time is shorter and the oviposition rate is higher in comparison with lower temperatures, as was also observed in other studies (Ekesi et al, 1999; Kapatos and Stratopoulou, 1999; Nahrung and Merrit, 1999). Many of the eggs collected in the field were attacked by the parasitoid Emersonella Girault sp. (Eulophidae, Hymenoptera). Population Fluctuation In general, C. cribraria, in any development phase, could be found in the field during all the study. However, from May to July 1998 and again in April and May 1999, were the months with less number of individuals recorded (Fig. 3). Larvae clearly showed two abundance peaks, in March and September 1998, differently from adults, which were more uniformly frequent during the year. Pupae and egg clutches were rare most of the months. It is probable that although they can be found in all months, the reproduction does not occur throughout the year, which does not mean that the species undergo a diapause. It seems that C. cribraria is somewhere in the middle between other cassidinae species such as Plagiometriona flavescens (Boheman) (Sá and Macedo, 1999) and Aspidomorpha miliares (Fabricius) (Nakamura et al, 1989), which are reproductively active all the year, and Echoma marginata (Linn.) (Windsor et al, 1995), in the other extreme, which undergo a seasonal diapause. Leaves of the host plant species were available all this time (Fig. 4). It is possible to say that the availability of the resource does not affect the population fluctuation as the monthly number of egg clusters, larvae, pupae and adults were not significantly correlated with the monthly number of leaves at 0,05 P level. However, resource quality is still a variable to be investigated. Table 1. Average and standard deviation of the time (days) spent in each stage of development for insects raised at 25°C and 30°C. Egg Larva Pupa Total

Male at 25°C 9.41 ± 0.84 16.73 ± 1.78 5.64 ± 1.14 31.69 ± 1.75 (n=183)

Female at 25°C 9.28 ± 0.63 17.12 ± 1.51 5.53 ± 0.99 31.95 ± 1.66 (n=159)

Male at 30°C 6.79 ± 0.88 13.32 ± 1.59 3.79 ± 0.79 23.93 ± 1.96 (n=262)

Female at 30°C 6.81 ± 0.72 13.87 ± 1.54 3.72 ± 0.91 24.40 ± 1.71 (n=193)

Table 2. Relation of eggs per ovipositing female per day at the different temperatures.

Eggs Ovipositting females Days Oviposition rate

20°C 25 2 16 0.78125

25°C 2,060 20 16 6.438

30°C 4,735 22 16 13.452

35°C 0 0 16 0

Number/100leaves

290

Rodrigo de O. Gonçalves & Margarete V. de Macedo 90 80 70 60 50 40 30 20 10 0

egg clutches larvae pupae adults

Mar Apr May Jun

Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May

Months

Number of leaves

Figure 3. Density of Chelymorpha cribraria adults, pupae, larvae and egg clutches at National Park of “Restinga de Jurubatiba”, Rio de Janeiro, Brazil, along the study.

500 450 400 350 300 250 200 150 100 50 0 Mar Apr May Jun

Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May

Months

Figure 4. Number of leaves of Ipomoea pes-caprae from March 1998 until May 1999 in the sample at National Park of “Restinga de Jurubatiba”, Rio de Janeiro, Brazil.

The climatic diagram (Fig. 5) clearly shows that the periods ranging from May to July 1998 and April and May 1999 were the driest ones during the study. These periods were exactly the ones exhibiting lowest C. cribraria densities. So, it is probable that climatic factors play an important role in determining C. cribraria population fluctuation in number. However the only significant correlation between number of insects and climatic factors was obtained for number of adults and month rainfall (r= 0.58; P= 0.02). The high influence of temperature in the development, reproduction and survivorship of C. cribraria (Tables 1 and 2) also suggests the importance of abiotic factors on its population fluctuation pattern. So, for this species, despite of the occurrence of its resource throughout the year, it cannot continuously reproduce because of the great importance of variation in rainfall and temperature for the species. This is quite different from other cassidinae species for which the continuous occurrence of food resource permits their continuous reproduction, for example Plagiometriona flavescens (Sá and Macedo, 1999).

Population Ecology Of The Polymorphic Species Chelymorpha cribraria ...

291

Figure 5. Average monthly temperature and total precipitation values along from March 1998 to May 1999.

M S

Figure 6. Some individuals of C. cribraria on an I. pes-caprae leaf. M – metallic form, S – spotted form.

Although other different forms were obtained in the laboratory during the procedures for the biology description, only four forms were found in the field: the Metallic; the Spotted, with spots on the pronotum and on both elytra; the Red/black, with a black pronotum (Bp) and red elytra; and the Bp spotted, with spots on both elytra, such as the Spotted form, and black pronotum, such as the Red/black form. The first two forms are shown in Fig. 6. The sex ratio found in the field was 1:1 (Table 3).

292

Rodrigo de O. Gonçalves & Margarete V. de Macedo

Table 3. Sex ratio and proportion of the forms in the field. Form \ Sex Metallic Spotted Red/black Bp Spotted Total

Male 235 19 2 0 256

Female 225 22 7 1 255

Total 460 (90.02%) 41 (8.02%) 9 (1.76%) 1 (0.20%) 511

Table 4. Forms obtained from the laboratory breeding between the phenotypes: Metallic (M), Spotted (S), Black Pronotum Spotted (BPS) and Red and Black (RB). Sample sizes are given by the number of couples (nc) and number of adults obtained from the couples (na).

Metallic Spotted BP Spotted Red/Black

Metallic M (nc= 10) (na= 406) M, S (nc= 4) (na= 383) S, RB (nc= 5) (na= 722) M, RB (nc= 5) (na= 296)

Spotted

BP Spotted

Red/Black

M, S (nc= 3) (na= 204) S, BPS, RB (nc= 2) (na= 796) M, S, BPS, RB (nc= 4) (na= 209)

S, BPS, RB (nc= 2) (na= 238) S, BPS, RB (nc= 2) (na= 306)

M, RB (nc= 2) (na= 134)

Preliminary data obtained from breeding in the laboratory show that the most common form, the metallic one, is exactly the recessive homozigote (Table 4). So important questions raised from these data are - how can such a polymorphic pattern be maintained in the field? Which selection pressures may be important in this population? Vasconcellos-Neto (1988) discussed some pressures which could be affecting one C. cribraria population and believed that visually oriented predators could be responsible for the selection and maintenance of C. cribraria polymorphism, because he found that different forms belong to mimetic Mullerian rings with Coccinelidae and other Chrysomelidae species. However, this author did not record the abundance of the different forms in the field. ACKNOWLEDGMENTS The authors are greatly indebted to Zundir Buzzi for the insect identification and to João Vasconcellos-Neto for his suggestions. We also would like to thank the anonymous reviewer for helpful comments. We are grateful to IBAMA for providing the license to work at National Park of Restinga of Jurubatiba. Financial support came from FUJB, CNPq/PELD and FAPERJ. Rodrigo Gonçalves had scholarship from CNPq/PIBIC. LITERATURE CITED Araujo, D. S. D., F. R. Scarano, C. F. C. Sá, B. C. Kurtz, H. L. T. Zaluar, R. C. M. Montezuma and R. C. Oliveira 1998. Comunidades vegetais do Parque Nacional da Restinga de Jurubatiba, pp. 39-62. In: F. A. Esteves

Population Ecology Of The Polymorphic Species Chelymorpha cribraria ...

293

(Ed.), Ecologia das Lagoas Costeiras do Parque Nacional da Restinga de Jurubatiba e do Município de Macaé (RJ). NUPEM/UFRJ, Macaé, RJ, Brasil. Buzzi, Z. J. 1994. Host plants of Neotropical Cassidinae, pp. 205-212. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Leiden. Carroll, C.R. 1978. Beetles, parasitoids and tropical morning glories: a study in host discrimination. Ecological Entomology 3:79-85. Delinger, D. L. 1986. Dormancy in tropical insects. Annual Review of Ecology and Systematics 31:239-264. Ekesi, S., N. K. Manania and I. Onu 1999. Effects of temperature and photoperiod on development and oviposition of the legume flower thrips, Megalurothrips sjostedri. Entomologia Experimentalis et Applicata 93(2):149-155. Henriques, R. P. B., D. S. D. Araujo and J. D. Hay 1986. Descrição e classificação dos tipos de vegetação de restinga de Carapebus, RJ. Revista Brasileira de Botânica 9: 173-189. Janzen, D. H. 1973. Sweep samples of tropical foliage insects: effects of seasons, vegetation, elevation, time of day and insularity. Ecology 544:687-701. Janzen, D. H. and W. Schoener 1968. Sweep samples of tropical foliage insects: effects of seasons, vegetation, elevation, time of day and insularity. Ecology 49:96-110. Kapatos, E. T. and E. T. Stratopoulou 1999. Duration times of the imature stages of Cacopsyla pyri L. (Homk. Psyllidae) estimated under field conditions, and their relationship to ambient temperature. Journal of Applied Entomology 123 (9):555-559.Lacerda, L. D., D. S. D. Araujo and N. C. Maciel 1993. Dry coastal ecosystems of the tropical Brazilian coast, pp: 477-493. In: E. Van der Maarel (Ed.), Dry coastal ecosystems: Africa, America, Asia, Oceania,. Elsevier, Amsterdam. Macêdo, M. V.; R. F. Monteiro and T. M. Lewinsohn 1994. Biology and ecology of Mecistomela marginata (Thunberg, 1821) (Hispinae: Alurnini) in Brazil, pp. In: P. H. Jolivet, M. L. Cox, and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Acad. Publ. Macêdo, M.V., J. Vasconcellos-Neto and P. Jolivet 1998. New biological data on the apterous beetle Elytrosphaera lahtivirtai Béchyné (Chrysomelidae: Chrysomelinae) and remarks on the biology and distribution of the genus, pp: 271-279. In: M. Biondi, M. Daccordi and D. G. Furth (Eds.), Proceedings of the Fourth Symposium on the Chrysomelidae. Atti del Museo Regionali di Scienze Naturali di Torino. Torino. Medeiros, L. and J. Vasconcellos-Neto 1994. Host plants and seasonal abundance patterns of some Brazilian Chrysomelidae, pp. 185-189. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Acad. Publ. Nahrung, H. F. and J. D. Merrit 1999. Moisture is required for the termination of egg diapause in the chrysomelid beetle, Homichloda barkeri. Entomologia experimentalis et applicata 93 (2):201-207. Nakamura, K., I. Abbas and A. Hasyim 1989. Survivorship and fertility schedules of two Sumatran tortoise beetles, Aspidomorpha miliaris and A. sanctaecrucis (Coleoptera: Chrysomelidae) under laboratory conditions. Research on Population Ecology 31:25-34. Petrucio, M. M. 1998. Caracterização das lagoas Imboassica, Cabiúnas, Comprida e Carapebus a partir da temperatura, salinidade, condutividade, alcalinidade, O2 dissolvido, pH, transparência e material em suspensão, pp. 109-122. In: F. A. Esteves (Ed.), Ecologia das lagoas costeiras do Parque Nacional da Restinga de Jurubatiba e do município de Macaé (RJ). NUPEM, Macaé. Sá, F. N. and M. V. Macêdo 1999. Behavior and population fluctuation of Plagiometriona flavescens (Boheman) (Chrysomelidae: Cassidinae), pp. 299-306. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publishers, Leiden. Tanaka, L. K. and S. K. Tanaka 1982. Rainfall and seasonal changes in arthropod abundance on a tropical oceanic island. Biotropica 14:114-123.

294

Rodrigo de O. Gonçalves & Margarete V. de Macedo

Vasconcellos-Neto, J. 1988. Genetics of Chelymorpha cribraria, Cassidinae: colour patterns and their ecological meanings, pp.217-232. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Leiden. Windsor, D., M. V. Macêdo and A. T. Siqueira-Campos 1995. Flower feeding by species of Echoma Chevrolat (Coleoptera: Chrysomelidae: Cassidinae) on Mikania (Asteraceae) in Panama and Brazil. Coleopterists Bulletin 49:101-108. Wolda, H. 1978a. Fluctuations in abundance of tropical insects. American Naturalist 112:1017-1045. Wolda, H. 1978b. Seasonal fluctuations in rainfall, food and abundance of tropical insects. Journal of Animal Ecology 47:369-381. Wolda, H. 1980. Seasonality of tropical insects I leafhoppers (Homoptera) in las Cumbres – Panama. Journal of Animal Ecology 49:277-290. Wolda, H. 1988. Insect seasonality: Why? Annual Review of Ecology and Systematics 19:1-18.

David G. Furth (ed.) 2003 © PENSOFT Publishers Genetic Diversity of the Phytophagous Beetle Docema darwiniSpecial Mutchler 295 Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 295-301

Genetic Diversity of the Phytophagous Beetle Docema darwini Mutchler, 1925 (Coleoptera: Chrysomelidae), Endemic to the Galápagos Islands Verdyck Peter1,2, Desender Konjev2 and Dhuyvetter Hilde1,2 1

Evolutionary Biology Group, Department of Biology, University of Antwerp (RUCA), Groenenborgerlaan 171, B-2020 Antwerpen, Belgium. Email: [email protected] 2 Department of Entomology, Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussel, Belgium

ABSTRACT Genetic variability of the saltbush flea beetle Docema darwini, endemic to Galápagos, is studied by means of Cellulose Acetate Gel Electrophoresis. The results are compared with genetic variability in other Galápagos beetle species and with Chrysomelidae in general. Genetic variability in Docema darwini is lowest on the youngest islands, while most of the variability is conserved on the oldest islands. Compared to other beetle species, D. darwini has relatively low genetic variability.

RESUMIN La variabilidad genética del escarabajo Docema darwini, endémico de Galápagos es estudiada mediante la Electroforesis con Gel de Acetato de Celulosa. Los resultados de la variabilidad genética son comparados con otras especies de escarabajos de Galápagos y en general con los Chrysomelidae. Los resultados demuestran que la variabilidad genética de Docema darwini es muy baja en las islas más jóvenes y la mayor variabilidad genética se presenta en las islas más viejas. Comparado con otras especies de escarabajos, D. darwini tiene una variabilidad genética relativamente baja. INTRODUCTION The Galápagos Islands are situated in the Pacific Ocean about 1000 km from the South American coast and straddling the equator. There are 13 large islands, 6 smaller ones and 107 islets and rocks, with a total land area of about 8000 square kilometers. The islands are volcanic in origin and several volcanoes in the west of the archipelago are still very active (e.g. volcanic eruption on Cerro Azul, Isabela in February 2000). The islands belong to different age categories: San Cristobal and Espanola are estimated near 3 million years, the more central islands Floreana, Santa Cruz, Pinzon and Baltra are between 0.7 and 1.5 million years old, and the islands Fernandina, Isabela, Santiago, Pinta, Marchena and Genovesa are less than 0.7 million years of age (Desender et al., 1992).

296

Verdyck Peter, Desender Konjev & Dhuyvetter Hilde

In 1959, Ecuador designated 97% of the land area of the Galápagos as a national park, and the islands are also recognised internationally as a ‘Man and the Biosphere Reserve’ and as a ‘World Heritage Site’ by UNESCO. Management of the islands is done by the National Park Service and scientific research is managed by the Charles Darwin Foundation and coordinated by the Charles Darwin Research Station. Galápagos has been called the “showcase of evolution”, and for biologists it is indeed a living laboratory for the study of evolution. Island archipelagoes are ideal for studies on geographic isolation and speciation. In Galápagos we find many examples of endemic groups whose members differ from one island to another. Some famous examples include the 13 species of Darwin’s finches (Geospizinae), the giant tortoises (Geochelone elephantopus), the mockingbirds (Mimus spp.), the Opuntia cacti, the Scalesia trees, the Lava lizards (Tropidurus spp.) and the Bulimulus land snails. The highest diversity in organisms on the Galápagos archipelago, however, is to be found in the “invertebrates”. Peck (1993) estimates a diversity of 1945 marine and 1995 terrestrial (and freshwater) invertebrate species, with a clearly higher degree of endemism in the terrestrial invertebrates (53% endemics versus only 18 % endemics for the marine invertebrates). Peck (1996) shows that of the 1739 insect species (712 of which are endemics) on the Galápagos, 418 species belong to the Coleoptera (258 of which are endemic). It is very surprising that from the large beetle family Chrysomelidae, with over 35.000 species described (Jolivet, 1988), only seven species (Samuelson, pers. comm.) are present on Galápagos. Although the knowledge of the invertebrate fauna of Galápagos is limited in comparison with the knowledge of the vertebrates and plants, in recent years a growing amount of studies on evolutionary ecology, systematics and population genetics of terrestrial arthropods has been done (e.g.: Desender et al., 1992; Baert and Maelfait, 1997, Cook and Peck, 2000, Verdyck and Desender, 2000). As far as phytophagous insects are concerned, the knowledge is rather limited. There are few close (species specific) plant-insect relationships and an unusually large proportion of plants do not require insect pollination (McMullen, 1993). Peck (1996) observed that most plant feeding insects are generalists in their selection of host plants and found no evidence of a radiation of phytophagous insect species on the endemic plant genera such as Scalesia Arn. (Asteraceae) or Darwiniothamnus Harling (Asteraceae). In this study, we present results of our investigations on the population genetics (using allozyme electrophoresis) of an endemic Chrysomelid beetle Docema darwini Mutchler of several Galápagos Islands and compare these results with data available for other beetle groups. Docema darwini is a monophagous flea beetle of Galápagos, feeding on saltbush (Cryptocarpus pyriformis HBK, Nyctaginaceae). Although this species has also been referred to as Nesaecrepida darwini (e.g. Verdyck and Desender, 1999, 2000), because this name is not yet available, we will conservatively retain the original combination for this species. The species has been used for population genetic studies (Verdyck and Desender, 1999), which detected that the populations have a metapopulation structure (indicating regular extinctions and recolonisations). Feeding preferences have been studied recently (Verdyck and Desender, 2000) and indicate that the animals prefer feeding on smaller, less vital plants. The combination of information about the genetic variation of several groups of organisms may help to evaluate which sites in the Galápagos are rich in genetic diversity, knowledge that might be useful to develop management strategies for these species.

Genetic Diversity of the Phytophagous Beetle Docema darwini Mutchler ...

297

MATERIALS AND METHODS Here we study 15 populations of D. darwini from 7 Galápagos islands, collected during two expeditions (March-April 1996 and 1998) (see Fig. 1 and Table 1). Material was frozen in the field in liquid nitrogen, and stored at –80°C in the lab. For each population between 20 and 50 individuals (mean sample size per locus varies between 19 and 45.3) were available. For allozyme electrophoresis the abdomen of each individual was homogenised in 35 µl of distilled water. Twelve clearly interpretable loci were selected of which 2 (APK2 [Arginine Phosphokinase, EC 2.7.3.3], MDH3 [Malate Dehydrogenase EC 1.1.1.37]) were monomorphic, 6 (APK1 [Arginine Phosphokinase EC 2.7.3.3], GOT2 [Glutamate-Oxaloacetate Transferase EC 1.1.1.49], IDH2 [Isocitrate Dehydrogenase EC 1.1.1.42, MDH2 [Malate Dehydrogenase, EC 1.1.1.37], PEP-D [Peptidase, EC 3.4.11], 6GPDH [Glucose-6-Dehydrogenase, EC 1.1.1.49]) showed less than 5% polymorphism and 4 (IDH1 [Isocitrate Dehydrogenase, EC 1.1.1.42], ME [Malate Dehydrogenase, EC 1.1.1.40], MDH1 Malate Dehydrogenase, EC 1.1.1.37], PEP-A [Peptidase, EC 3.4.11]) were highly polymorphic. We tested for deviation from Hardy-Weinberg equilibrium using exact probability tests, correcting for errors resulting from multiple tests by means of the tablewide sequentially rejective Bonferroni procedure (Holm, 1979; Rice, 1989). Four genetic variability measures (mean number of alleles per locus, percentage of loci polymorphic, direct count heterozygosity [Hobs] and expected heterozygosity under Hardy-Weinberg conditions [Hexp]) were calculated. All analyses were performed using

GALAPAGOS ISLANDS (ECUADOR) DARWIN PINTA MARCHENA

WOLF

GENOVESA

SANTIAGO

13-14 5

FERNANDINA

9

11

SANTA CRUZ

RABIDA

12 1-4 ISABELA

50 km

6-7

8 15

10 SAN CRISTOBAL

FLOREANA

ESPANOLA

Fig. 1. Map of the Galápagos islands (300 m-interval elevation contours) and location of the sampling sites (numbers as indicated in Table 1)

298

Verdyck Peter, Desender Konjev & Dhuyvetter Hilde

Table 1. Genetic variability at 12 loci in all populations of D. darwini, standard errors are indicated in parentheses (*: a locus is considered polymorphic if more than one allele was detected; **: unbiased estimate expected heterozygosity) Population number and code

Locality (Island)

1 BAH96A

Bahia Tortuga (Santa Cruz) 2 BAH96B Bahia Tortuga (Santa Cruz) 3 BAH98L Bahia Tortuga (Santa Cruz) 4 BAH98W Bahia Tortuga (Santa Cruz) 5 BART Bartholome 6 CDR96 7 CDR98 8 EST 9 ITHA 10 LOB 11 RABI 12 SAP 13 SULLA 14 SULLB 15 VIL

CDRS (Santa Cruz) CDRS (Santa Cruz) El Estero (Sierra Negra – Isabela) Ithabaca (Santa Cruz) La Loberia (San Cristobal) Rabida Caleta Sapho (San Cristobal) Bahia Sullivan (Santiago) Bahia Sullivan (Santiago) Villamil (Sierra Negra – Isabela)

Mean Sample size per locus 43. 3 (1.7) 41.2 (3.1) 38.8 (1.1) 39.3 (0.8) 42.5 (2.1) 45.3 (2.8) 43.0 (2.0) 42.9 (1.8) 38.8 (1.3) 39.8 (2.2) 19.0 (1.0) 41.2 (1.8) 33.3 (1.3) 29.5 (0.5) 40.9 (1.9)

Mean number of alleles per locus 1.3 (0.1) 1.3 (0.1) 1.3 (0.1) 1.3 (0.2) 1.1 (0.1) 1.3 (0.1) 1.4 (0.2) 1.0 (0.0) 1.6 (0.2) 1.3 (0.2) 1.3 (0.2) 1.6 (0.2) 1.1 (0.1) 1.1 (0.1) 1.1 (0.1)

Percentage of loci polymorphic * 25.0 33.3 25.0 16.7 8.3 33.3 33.3 0.0 50.0 25.0 16.7 50.0 8.3 8.3 8.3

Mean Heterozygosity Direct HdyWbg count expected ** 0.024 (0.019) 0.008 (0.003) 0.017 (0.011) 0.017 (0.015) 0.033 (0.033) 0.052 (0.038) 0.061 (0.039) 0.000 (0.000) 0.021 (0.009) 0.045 (0.040) 0.021 (0.017) 0.064 (0.049) 0.031 (0.031) 0.036 (0.036) 0.039 (0.039)

0.022 (0.017) 0.008 (0.003) 0.026 (0.020) 0.019 (0.017) 0.034 (0.034) 0.052 (0.038) 0.059 (0.038) 0.000 (0.000) 0.020 (0.016) 0.046 (0.042) 0.020 (0.016) 0.062 (0.044) 0.034 (0.034) 0.037 (0.037) 0.034 (0.034)

BIOSYS-1 (Swofford and Selander, 1989). As a comparison, allele frequency data from literature were used to calculate genetic variability in other Galápagos beetles and continental Chrysomelidae. RESULTS Exact probability tests (Bonferroni-corrected) showed not a single significant deviation from Hardy-Weinberg equilibrium. Table 1 gives the list of the populations and the different genetic variability measures. With exception of the population of El Estero, all populations are at least variable for one of the loci. The mean number of alleles per locus is 1.273 (min.: 1.0, max.: 1.6). The lowest number of alleles is found on the younger islands Isabela and Santiago (with its satellite

Genetic Diversity of the Phytophagous Beetle Docema darwini Mutchler ...

299

island Bartolomé). Highest values are found on the islands Santa Cruz (middle age) and San Cristobal (old). The number of polymorphic loci shows the same results. For the heterozygosity values however, the resulting picture is different. The mean Hexp is 0.032 (min.: 0.000, max.: 0.059). With the exception of El Estero, where the heterozygosity is zero (because there are no variable loci), the lowest heterozygosities are found on the island of Santa Cruz at Bahia Tortuga (four populations in total) and the northern population of Ithabaca. The southern populations of Santa Cruz (CDRS), on the other hand , show much higher heterozygosity values (but not a higher number of alleles per locus). DISCUSSION Desender and Verdyck (2000) studied genetic variation in six populations of the Galápagos caterpilar hunter Calosoma granatense Gehin (Carabidae, Coleoptera) at five polymorphic loci and found a mean number of alleles per locus of 3.733 and expected heterozygosity (Hexp) value of 0.435. The data on C. granatense showed a somewhat different picture as compared to Docema darwini. For the mean number of alleles per locus the highest numbers were found on the old islands San Cristobal (over 3 million years old) and Floreana (between 0.7 and 1.5 million years old). The north of Santa Cruz (between 0.7 and 1.5 million years old) and two populations of Isabela (less than 0.7 million years old) had the same value, and the South of Santa Cruz showed the lowest value. This can possibly be explained by the very small sample size of the two populations of Santa Cruz in that study. For Hexp, the populations of Santa Cruz showed the highest variability, followed by Floreana. Finston and Peck (1995, 1997) studied population structure and gene flow in thirteen Galápagos beetle species (35 populations) of the genus Stomion Waterhouse (Tenebrionidae, Coleoptera). Based on their allele frequency data we calculated both genetic variability measures (analysis not shown) for the Stomion species and found a mean number of alleles per locus of 2.249 and an expected heterozygosity of 0.204. For the genus Stomion there are only a few species that live both on old and young islands. We find that for the species S. laevigatum Waterhouse, the populations of the young island Santiago (less than 0.7 million years old) and the middle aged island Santa Cruz show a higher genetic variability for both mean number of alleles per locus and Hexp, compared to the populations of the youngest island Isabela. For the species S. longulum Van Dyke, the populations of Santa Cruz have a higher number of alleles per locus on the island of Santa Cruz compared to Isabela, but the situation is less clear for the heterozygosity. For Hexp, the populations of the port of Villamil (Isabela) show a higher Hexp than those of Santa Cruz, but these are again higher than the population of Cero Azul (Isabela). Hsiao (1989) gives an overview of genetic variability estimates amongst Coleoptera and reports heterozygosity values between 0.081 and 0.206 for Chrysomelidae. He states that the heterozygosity values found for Coleoptera (mean heterozygosity is 0.187 ± 0.017) are the highest of the insect orders studied. Verdyck (1998) gives an overview of genetic variability measures in several continental Chrysomelidae genera (in total 91 populations of 53 species) (including data from Futuyma and McCafferty, 1990; Manguin et al., 1993; Rowell-Rahier, 1992; Rowell-Rahier and Pasteels, 1994 and Mardulyn, 1996) and found mean number of alleles of 1.570, 1.741, 1.950 and 2.050 and mean Hexp values of 0.083, 0.093, 0.161 and 0.262 for the genera Gonioctena Redtenbacher, Ophraella Wilcox, Galerucella Crotch and Oreina Chevrolat, respectively. We can conclude that heterozygosity values in all populations of D. darwini are low compared to those found in continental Chrysomelidae and other beetles. Populations of Docema darwini from Isla Isabela (the youngest island investigated in our study) show the lowest genetic diversity for all

300

Verdyck Peter, Desender Konjev & Dhuyvetter Hilde

measures, which can be explained by a more recent colonisation of this island by a small number of individuals. The highest genetic variability is found on the old island of San Cristobal and the south of the middle aged island of Santa Cruz. It would be advisable to include populations of the old island Espanola (3 million years old) and the middle age island Floreana to further test this hypothesis of more genetically diverse beetle populations on older islands. The general picture of such a higher degree of genetic variability on older islands is confirmed by the genetic data of the Carabid beetle C. granatense and the wingless Tenebrionidae of the genus Stomion. In order to conserve as much genetic diversity as possible, populations (and of course their biotopes) on the oldest islands should be protected most urgently. The lower genetic variability in Docema compared to Calosoma and Stomion might be explained by a more recent colonisation of the islands by this species, and/or by recent or recurrent bottlenecks (e.g. this could be possible due to dying of hostplant, due to extreme climatic variations like El Niño events). ACKNOWLEDGEMENTS This work is supported by the projects RAFO/1 VERD KP99 and BOF-NOI (EV 44.72) of the University of Antwerp. We also thank the Entomology Department of the Royal Belgian Institute of Natural Sciences, the Belgian DWTC, the Leopold III foundation and the Fund for Scientific Research – Flanders for their financial support. Excellent cooperation and field logistic support were provided during our 1998 expedition by the Charles Darwin Research Station (CDRS, Santa Cruz, Galápagos), R. Bensted-Smith, Director and his staff, and the Galápagos National Park Service. TAME airline kindly issued reduced travel tickets. Also sincere thanks to L. Baert, J-P. Maelfait and L. Roque for their help with the fieldwork and G. Estevez for the translation of the abstract in Spanish. P. Verdyck is a Postdoctoral Fellow of the Fund for Scientific Research – Flanders (Belgium) (F.W.O.). LITERATURE CITED Baert, L. and J.-P. Maelfait 1997. Taxonomy, distribution and ecology of the lycosid spiders occurring on the Santa Cruz Island, Galápagos Archipelago, Ecuador, pp. 1-11. In: M. Zapka (Ed.), Proceedings of the 16th European Colloquium on Arachnology. Cook, J. and S. B. Peck 2000. Aphodiinae (Coleoptera: Scarabaeidae) of the Galápagos Islands. The Canadian Entomologist 132:281-300. Desender, K., L. Baert and J.-P. Maelfait. 1992. Distribution and speciation of carabid beetles in the Galápagos Archipelaga (Ecuador). Bulletin van het Koninklijk Belgisch Instituut voor Natuurwetenschappen, Entomologie 62:57-65. Desender, K. R. C. and P. Verdyck 2000. Genetic differentiation in the Galápagos caterpillar hunter Calosoma granatense (Coleoptera, Carabidae), pp. 25-34. In: P. Brandmayr, G. Lövei, T. Zetto Brandmayr, A. Casale and A. Vigna Taglianti (Eds.), Natural History and Applied Ecology of Carabid Beetles. Pensoft Publishers, Sofia. Finston, T. L. and S. B. Peck 1995. Population structure and gene flow in Stomion: A species swarm of flightless beetles of the Galápagos Islands. Heredity 75:390-397. Finston, T. L. and S. B. Peck 1997. Genetic differentiation and speciation in Stomion (Coleoptera: Tenebrionidae): Flightless beetles of the Galápagos Islands, Ecuador. Biological Journal of the Linnean Society 61:183-200.

Genetic Diversity of the Phytophagous Beetle Docema darwini Mutchler ...

301

Futuyma, D. J. and S. S. McCafferty 1990. Phylogeny and the evolution of host plant associations in the leaf beetle genus Ophraella (Coleoptera, Chrysomelidae). Evolution 44(8):1885-1913. Hsiao, T. 1989. Estimation of genetic variability amongst Coleoptera., pp. 143-180. In: H. D. Loxdale and J. den Hollander (Eds.), Electrophoretic studies on agricultural pests. Clarendon Press, Oxford. Holm, S. 1979. A simple sequentially rejective multiple test procedure. Scandinavian Journal of Statistics 6:6570. Jolivet, P. 1988. Food habits and food selection of Chrysomelidae. Bionomic and evolutionary perspectives, pp. 1-24. In: Jolivet, P., E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Manguin, S., R. White, B. Blossey and S.D. Hight. 1993. Genetics, taxonomy and ecology of certain species of Galerucella (Coleoptera: Chrysomelidae). Annals of the Entomological Society of America 86(4):397-410. Mardulyn, P. 1996. Phylogénie du genre Gonioctena (Coleoptera: Chrysomelidae) basée sur des caractères moléculaires (allozymes et séquences d’ADN mitochondrial). Evolution des associations spécifiques avec les plantes hotes et de la défense des larves. Université Libre de Bruxelles, 140 pp. McMullen, C. K. 1993. Flower-visiting insects of the Galápagos Islands. Pan-Pacific Entomologist 69:95-106. Peck, S. B. 1993. Galapagos species diversity: is it on the land or in the sea? Noticias de Galapagos 52:18-21. Peck, S. B. 1996. Origin and development of an insect fauna on a remote archipelago: the Galápagos islands, Ecuador, pp. 91-122. In: A. Keast and S. E. Miller (Eds.), The origin and evolution of Pacific island biotas, New Guinea to Eastern Polynesia: Patterns and processes. SPB Academic Publishing bv, Amsterdam. viii + 531 pp. Rice, W. R. 1989. Analyzing tables of statistical tests. Evolution 43(1):223-225. Rowell-Rahier, M 1992. Genetic structure of leaf-beetles populations: microgeographic and sexual differentiation in Oreina cacaliae and O. speciosissima. Entomologica Experimentalis et Applicata 65: 247-257. Rowell-Rahier, M. and J. Pasteels 1994. A comparison between allozyme data and phenotypic distances from defensive secretion in Oreina leaf beetles (Chrysomelinae). Journal of Evolutionary Biology 7:489-500. Swofford, D. L. and R. B. Selander. 1989. Biosys-1: A computer program for the analysis of allelic variation in population genetics and biochemical systematics. Illinois Natural History Survey, 43 pp. Verdyck, P. 1998. Genetic diversity and host plant use in the phytophagous Chrysomelidae: An evaluation of the niche width variation hypothesis, pp. 219-232. In: M. Biondi, M. Daccordi, D. G. Furth (Eds.), Proceedings of the Fourth International Symposium on the Chrysomelidae. Museo Regionale di Scienze Naturali, Torino. Verdyck, P. and Desender, K. 1999. Hierarchical population genetic analysis reveals metapopulation structure in a phytophagous Galápagos beetle. Belgian Journal of Zoology 129:95-104. Verdyck, P. and Desender, K. 2000. Leaf feeding preferences in the monophagous saltbush flea beetle Nesaecrepida darwini (Coleoptera: Chrysomelidae). Bulletin van het Koninklijk Belgisch Instituut voor Natuurwetenschappen 70:255-258.

24

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 Subaquatic Chrysomelidae 303 Special Topics in Leaf Beetle Biology

© PENSOFT Publishers Sofia - Moscow

Proc. 5th Int. Sym. on the Chrysomelidae, pp. 303-332

Subaquatic Chrysomelidae Pierre Jolivet1 1

67 Boulevard Soult, F-75012. Paris, France. E-mail: [email protected]

ABSTRACT Some Chrysomelidae live near water, such as certain chrysomelines, galerucines and alticines, and some even spend their entire life in the middle of rivers and ponds, like Galerucella nymphaeae (L.), Galerucella birmanica (Jacoby) or Neolochmaea boliviensis Béchyné, on the leaves of floating macrophytes (Nymphaeaceae, Trapaceae, Onagraceae, Cabombaceae). All these leaf-beetles are adapted to temporary submersion, especially the larvae, and their development in certain cases, can be highly specialized. Adults of certain species can retain oxygen through a pile of hydrofuge hairs or plastron situated on the abdomen or on the thorax. They can even retain air under the elytra or remain inside an air bubble. Some species of Hispinae, like Cephaloleia Chevrolat, can also live inside water-tanks (bracts, phytotelmata) of the inflorescences of Heliconia spp., using similar adaptations, and, at least one species of Longitarsus (L. nigerrimus (Gyllenhal)), feeds on Utricularia vulgaris L, U. minor L., carnivorous plants, and seems to live partly under and outside water in bogs, in Middle and Northern Europe, among Sphagnum. Exosoma lusitanica (L.) larvae live inside semi-liquid decomposed magma within bulbs of Amaryllidaceae. If the adaptation of the adults seems sometimes imperfect, often the larvae (Galerucella nymphaeae, G. birmanica, Cephaloleia puncticollis) are well adapted to submersion. Jäch (1998) classifies these insects among « phytophilous water beetles » selected among five other divisions. The biology of these semi-aquatic leaf-beetles has been mostly ignored in the literature, the only recognised truly aquatic leaf-beetles being the Donaciinae, even if, they have an aerial adult period (reproduction), which is sometimes short (Neohaemonia Szekessy and relatives and few Donacia Fabr.) or long, including the adult feeding phase, as for most Donacia and Plateumaris Thompson. KEY WORDS: Galerucella, Neolochmaea, Cephaloleia, Longitarsus, Exosoma, semiaquatic habits, air cushion, plastron, aquatic plants.

INTRODUCTION Officially, the Donaciinae are the only aquatic Chrysomelidae in the larval stage (all species) (Houlihan, 1969, Thorpe and Crisp, 1949) and in the adult stage (among the Macroplea Samouelle and related, and very probably few Donacia, but with the exception of the period of dispersion and mating, which always occurs outside water). See also Böving (1910) and Böving and Craighead (1930). Donaciinae and other beetles can be involved in pollinization of aquatic plants, including Nuphar ( Lippok et al., 2000).

304

Pierre Jolivet

Subaquatic leaf-beetles and weevils have been recently studied by various authors ( Buckingham and Buckingham, 1981; Buckingham et al., 1986; Habeck, 1979; Habeck and Wilkerson, 1980; Anon. 1970, 1994, etc.), mostly because of their economic impact in biological control of aquatic and semi-aquatic weeds in America, Asia and Africa. Various leaf-beetles and weevils have been studied and used towards that end. On the other hand, subaquatic or aquatic species have been discovered among purely terrestrial groups, such as the Dynastinae and various Scarabaeidae (Martinez, 1977; Jolivet, 1993) and evidently among the caterpillars of several moths. Weevils also contain some truly aquatic species such as the Bagoinae and also many subaquatic ones (Nilsson, 1996; Leiler, 1987; Champion, 1913; Mantovani et al., 1992; Poot, 1972). Invertebrate herbivory behavior on submerged macrophyte has been studied by Jacobsen and Sand-Jensen (1995) and in time of flood by Joy (1910). Many leaf-beetles can be subaquatic and practically all can resist submersion, being light and generally surrounded by an air bubble when immersed. Many of those beetles have hydrophobic body surfaces, which cannot be wetted (Buckingham et al., 1986; Langer and Messner, 1984). Many weevils or leaf-beetles are able to remain underwater for many hours or even days, having sometimes a hairy plastron or scales or cuticular projections which hold a layer of air. Either the oxygen diffuses from the water around the plastron or the insect taps the plant’s air supply. Pupae rest in cocoons that are attached to the plant or are inside the stem. Some species swim beneath the water surface or only on the surface or do not swim at all. The last ones crawl over the plant and some species walk upside down. Most of these beetles fly well for dissemination and migration. More species probably will be discovered chiefly in the tropics, with an aptitude to lead a subaquatic life, mostly among swamp frequenting species, and species living along rivers and lakes on hydrophytes. Alticines and galerucines remain the best candidates for that. It is evident that most chrysomelids are totally terrestrial, like cassidines and hispines, for instance. Cassids will float over the water but they cannot swim. They live on purely terrestrial plants or climbers, not especially near water. Hispines however show some exceptions within the inflorescences of Heliconiaceae. Let us see which are the best examples of semi-aquatic chrysomelids and let us compare them with what is known about the weevils, another phytophagous beetle family. The habit is actually practically unknown among Bruchidae and Cerambycidae. However, cerambycid larvae can survive a long time in floating wood in fresh or sea water. That does not mean a special adaptation to aquatic life, but a strong resistance and a protection from the surrounding tissue. There are even few cerambycoid beetles semi-aquatic and associated with aquatic plants, boring into stems and roots below water (La Rivers, 1951). Weevil larvae, and possibly bruchid larvae, for instance, can survive perfectly in seeds inside bird stomachs (Chung and Waller, 1986; Jordano, 1989; Traveset, 1993; Guix and Ruiz, 1995-97). No marine or brackish water frequenting leaf beetle is known, with the exception of Macroplea mutica (F.), feeding on Zostera Linn in the Baltic Sea or in other brackish surroundings. Within the extrachorion of leaf-beetle eggs, there are different kinds of air-spaces, especially the species which lay eggs in the soil (e.g. Diabrotica spp.) (Hinton, 1976,1981; Selman, 1994). These air spaces are acting as a plastron which function as lungs when the soil is flooded. That is true for galerucines but also it applies to the eggs of aquatic Donaciinae and several subaquatic species. Not much is known on the structure of the eggshells and their use. Most of the papers deal with taxonomy and chemistry of the chorion. Nordell-Paavola et al. (1999) mention that in aquatic species, like the Galerucella nymphaeae complex, the egg pores have a respiratory function and when the egg pores are numerous they constitute plastrons which function as lungs when the eggs are submerged.

Subaquatic Chrysomelidae

305

Many insects, including mosquitos, live inside the phytotelmata, including the pitcher of carnivorous plants. Frank and Lounibos (1983) give many examples. Culicidae are specially adapted to all kinds of pitchers, including the leaf sheaths of Bromeliaceae (Tropical America), or Musaceae (Africa and Asia). Many aquatic insects (Gerridae and other Hemiptera, Dytiscidae, Hydrophilidae) show special adaptations to pitchers and natural water holes or leaf sheaths. All Odonata larvae are aquatic (with the exception of one Hawaian species). Many live inside phytotelmata and the adults dive or not to lay their eggs. The big species of South America project them from distance with their long and bent abdomen and probably it is the same in South Africa. Many insects feed inside the pitchers of carnivorous plants. That, in theory, must diminish the decay of undigested prey and help the plant to better manage its digestion problems. In principle, the insects are hairy and are provided with setae, which can retain air bubbles. In a recent paper, resuming ancient observations in Borneo, Clarke and Kitching (1995) and Kitching (2000) proved that the carnivorous plant, Nepenthes bicalcarata Hooker f. was a truly myrmecophilous plant. The fact was really discovered by Beccari (1884) and mentioned by many authors before the Australians (Jolivet, 1986; 1996; Hölldobler and Wilson, 1990). It harbors Camponotus ants in the hollow leaf tendrils. This ant dives with impunity into the plant pitcher and bring back its prey, without any damage from the digestive enzymes. The ant’s body is covered with hairs like other species of the genus. Many insects and spiders, adapted to aquatic life, are surrounded with air bubbles, isolating them from the outside world. Frank (1996) has observed in Mexico in the water bracts of Heliconia bourgaeana Petersen a staphylinid, Platydracus sp. which plunge head and thorax inside the water with open mandibules to capture diptera larvae. Another problem: the presence of hairs on the sternal part of a beetle or elsewhere is not essentially linked to aquatic life. It is evident that a 100% terrestrial Timarcha, for example T. tenebricosa F. is practically hairless, but a species such as Zygogramma exclamationis (F.), not less terrestrial, has sparse hairs on its body. The presence of a plastron is definitively linked with aquatic life in the Donaciinae, but it is less certain among several subaquatic species, even if it can be proved among most subaquatic weevils. OBSERVATIONS AND DISCUSSION Review of Aquatic and Semi-Aquatic Plant-Eating Beetles Many beetle families frequent rivers, streams, ponds, water falls and lakes (lentic, lotic and hydropetric habitats) (such as the Elmidae, the Dryopidae, the Psephenidae, the Dytiscidae, the Hydrophilidae, many Curculionidae, etc.) According to Crowson (1981), there are at least ten separate evolutionary lines in which aquatic habits, of either adults and larvae, or both, have been developed. Some are carnivorous (Dytiscidae), or herbivorous (Donaciinae) or predators in the larval stage, and saprophagous and phytophagous in the adult stage (Hydrophilidae). Many feed only on algae and mosses, others on higher plants, sometimes sucking mainly the sap of plants (Donaciinae) in the larval stage (Evans, 1975). Some aquatic Dynastinae, such as Chalepides fuliginosus (Burmeister), feed on Eleocharis sp. (Cyperaceae) and algae on the bottom of pools in Brazilian central mountains. Probably their larvae are borers into the stems of certain Vellozia (Velloziaceae). They have adopted the aerodynamic shape of the dytiscids, their waterproof hairs and the air chamber below the elytra. (Joao Vasconcellos-Neto, unpublished). The elytral structures linked with the respiration of submersed beetles have been studied by Messner and Langer (1984). There is an augmentation of tracheal

306

Pierre Jolivet

branches, an aeriferous epithelium set with trichomes inside and intraelytral airspaces. Other aquatic beetles sieve organic particles, the phytoplankton, the zooplankton and the diatoms, similar to mosquito larvae, in muddy areas such as the scirtids (helodids). An excellent review of aquatic beetles, their physiology and biology was recently presented by Paulian (1988; 1993). Buckingham and Bennett (1989) have studied a semi-aquatic scarabeid, Dyscinetus morator (Fabricius), another dynastine, in Florida, feeding on waterhyacinth and supporting perfectly 3 hour submersion. Thorpe and Crisp (1949) studying the plastron respiration of several insects, mostly beetles, found that, among the European weevils, some are unable to swim and others, for example Eubrychius (= Phytobius) velutus (Beck), are expert swimmers, having a virtually perfect plastron mechanism. See also Wimmer and Sprick (2000) on Eubrychius Thompson and Bagous Germar on Myriophyllum. Eubrychiopsis lecontei (Dietz) has also been studied on Myriophyllum spicatum L. in Washington state (Tamayo et al., 1999). Hydrostatic control exists among some aquatic beetles, such as Elmis spp. and others. The process of bubble respiration can only function if there is a tension difference between the bubble and the water (Thorpe, 1950). Plastron respiration of Macroplea mutica (F.) and Elmis aenea Müller has been studied by Messner (1982) and the water-protecting properties of insect hairs by Crisp and Thorpe (1948). Many water weevils are fully aquatic and effective swimmers and show plastron respiration, as in Eubrychius velutus (Morris, 1991), which is well adapted with its elongate legs with fringes of swimming setae, reduced bilobing of the tarsal segments and reduced antennae. It has also a streamlined form. Some species of Bagous also swim quite well when the temperature is high (Angus, 1966), but several species of this genus are poor or even non-swimmers. According to Menier (1970), Bagous limosus Gyllenhal lives completely immersed on the stems and leaves of Potamogeton polygonifolius L., but it shows no special morphological adaptations to aquatic life. However, Menier admits that the beetle swims very well and in a very peculiar and unique way. The antennae are extended, unlike other Bagous species. Many English and French entomologists have studied the behavior in the water of several Bagous among the Sphagnum, giving the host-plants (Angus, 1966; Ruter, 1937 and 1941; Massee, 1961; Read, 1978; Morris, 1963,1976a and b; Hoffman, 1954; etc.). According to Hoffmann (loc. cit.), Bagous spp. are covered with pellicular wax and scales, which makes them waterproof. Many are excellent swimmers and can stay immersed a long time. Angus (loc. cit.) notes that Bagous limosus performs a dog-paddle action by using the front legs, the other pairs making walking movements. The beetle is capable of diving. Ruter (1937, 1941) studied the biology of two species: Bagous subcarinatus Gyllenhal and B. limosus Gyllenhal. He confirmed the waterproof properties of the hairs and scales, the capture of oxygen bubbles from aquatic plants, the cutting of stems of Ceratophyllum to feed and to obtain air, the swimming abilities, etc. Hinton (1976) reviewed the plastron structure of the Bagoini. There are 17 species of Bagous in Florida (Buckingham et al., 1986; Peck and Thomas, 1998) and the adults of some species have plastrons. See also O’Brien and Marshall (1979). The larvae tunnel inside aquatic plant tissue (leaves and stolons) and pupate inside leaf petioles. The plastron scales of Lissorhoptrus oryzophilus Kuschel, unlike those of Eubrychius velutus (Beck), are supported by numerous vertical pillars and the plastron is not hairy (Hinton, 1976). All the above species, as in species of Bagous, have independently evolved the ability to swim. In California, the weevil Stenopelmus rufinasus Gyllenhal lives and feeds on the leaves of the floating fern Azolla filiculoides Lam. Neither the larvae nor the adults remain submerged for long periods, but the species is really subaquatic (Richerson and Grigarick, 1967). However, the beetle is unable to swim and can only crawl slowly beneath the water, dragging an air bubble. American species of Listronotus Jekel are generally associated with aquatic and subaquatic plants (O’Brien, 1981). Many

Subaquatic Chrysomelidae

307

species show excellent swimming abilities with a rapid dog paddlelike stroke of the forelegs. The hind legs control the direction of movement. A general review of the biology of the aquatic weevils of China has been done by Caldara and O’Brien (1995). Recently, the swimming behavior of an aquatic weevil, Lissorhoptrus oryzophilus was reestudied (Hix et al., 2000). Many curculionids are truly aquatic (Dieckmann, 1972), and others qualify as subaquatic (Roudier, 1957; Morris, 1960,1976 a and b), which means that they feed on hydrophytes and when dropped into the water they survive easily and positively skate or swim over the surface and resist immersion. As in the leaf beetles, truly terrestrial weevils, if dropped into the water, flounder around and finally die. Morris (loc. cit.) mentioned several of these subaquatic species feeding, for instance, on water cress (as in leaf-beetles, Phaedon cochleariae F.) which are well adapted to any fall in water, swimming and skating until they reach dry land or their food-plant. These species of curculionids have unwettable scales and always escape drowning. Roudier (1957) states that the weevil Phytobius (=Litodactylus) leucogaster (Marsham), a Holarctic weevil, can stay underwater a long time. He stated that it remains attached to Myriophyllum verticillatum L., surrounded by an air bubble. Buckingham and Bennett (1981), studying the same species in Florida found that the larvae and adults feed in the ovaries, buds, stems or flowers of watermilfoil. The cocoon is formed in an excavation of a submersed stem. When the adults crawl into the water, their bodies are surrounded by a thin silvery layer of air, which confirms Roudier’s assertion. They have the ability to survive long periods of submergence. Morris (1995) tested several weevils of different subfamilies for their ability to swim on the surface of water. He found swimming abilities among Baridiinae and Cleoninae, but mostly among Ceutorhynchinae. As far as I know, weevils in phytotelmata or water holes are so far unstudied. However, it seems that C. W. O’Brien has recently found one (unpublished). The fact is also unknown among leaf-beetles, except among the hispines adapted to Heliconia Linn. inflorescences, but the alticines adapted to live among peat-moss (Sphagnum spp.) or mosses are perfectly adapted to move in that specialized medium, whether they feed on them or on higher plants. Read (1982) found that the weevil, Hypera rumicis (L.) was capable of swimming quite efficiently, when other species of Hypera Germar are not. Read attributed its abilities to frequentating the subaquatic water dock, Rumex hydrolapathum Hudson. Hylobius transversovittatus on Lythrum salicaria L. is not a real aquatic weevil (Blossey et al., 1994a). Walking strategy of insects has been recently studied by Graham (1985). Some weevils do not show any ability to swim on the surface of water, even those feeding on watercress. Wetting of parts of the body was observed among them, even sinking or dying (Morris, 1995). According to Morris, the ability to swim in Ceutorhynchinae is closely related to the hydrofuge properties of the weevils’ bodies, hydrofuge scales or setae. Some species with scales can be easily wetted and these are not subaquatic. Aptitude to swim is frequent among weevils living on aquatic or semi-aquatic plants, but not absolutely general. There are a few exceptions among the Ceutorhynchinae living on watercress and Rorippa-species. Similar findings are expected among the leaf-beetles. Leaf-beetles feeding on waterside plants Many chrysomelids feed on plants growing on river banks and on the borders of lakes and ponds. Most of them belong to Chrysomelinae (Phaedon Latreille on watercress, Chrysolina Motschulsky on mint), Galerucinae (Galeruca Mhller, Galerucella Crotch), and Alticinae (Altica Geoffroy). All of them are well known (Balachowsky, 1963; Balachowsky and Mesnil, 1936; Jolivet, 1997), but poorly studied biologically. The data we have on them deals with larval development, food selection, but

308

Pierre Jolivet

rarely in relation to water. All of these species escape drowning, as larvae and adults, like the weevils mentionned above, but they do not have any specialized morphological adaptation to water. Chrysolina polita (L.) and C. herbacea (Duftschmid) will swim eventually to reach the host plant when dropped accidentally in water, but they have no propensity to do so. Chrysolina herbacea (Fig. 12) and C. polita, for instance, have a sparsely pilose abdomen but the remainder are totally smooth. It has been shown recently (Warren, 1993) that water mint plants (Mentha aquatica L.) growing on land have much more herbivore damage than those growing in water. The water barrier may prevent effective exploitation of emergent aquatic plants by terrestrial herbivores. That is why the herbivores on aquatic plants must have minimum adaptative facilities. Wesenberg-Lund (1943) and various other authors quote some leaf-beetles, on several hydrophytes, such as Prasocuris phellandrii (L.) on various aquatic Apiaceae including Oenanthe aquatica Poiret, P. junci (Brahm) on Veronica beccabunga L. (Scrophulariaceae) and Nasturtium officinale R. Br. (Brassicaceae), Hydrothassa hannoverana (Fabricius) on Caltha palustris L. (Ranunculaceae), Aphthona coerulea (Fourcroy) on Iris pseudacorus L. (Iridaceae) etc. However, many of these water frequenting beetles will also eventually accept in nature terrestrial plants of the same families. An Australian alticine, Altica ignea (Blackburn) has been found congregating in New South Wales on Myriophyllum verrucosum Lindl. (Haloragidaceae) and two other plants (Vestjens, 1979), on the edge of a lake. Feeding was observed only on the red-flowering water milfoil including plants growing in shallow water. The beetles were seen wriggling across the surface of water. The Indian Altica coerulea (Olivier) and several other East Asian Altica feed on various semi-aquatic plants like Jussiaea repens L. (Sankaran et al., 1967). All Hydrothassa Thompson species generally frequent hydrophytes. Bertrand (1954, 1972) also mentioned these semiaquatic species in his study of Donaciinae. Agelastica alni (Linne) is common on Alnus glutinosa (L.) (Betulaceae) on river banks, but can also accept, like the East Asian species, terrestrial and arbustive Rosaceae (Fig. 13). Some of these beetles are better adapted to immersion than others. For instance, some of those insects are hairless on the underside (Prasocuris obliquata Crotch, Hydrothassa marginella (Linne), Aphthona coerulea (Fourcroy) when others have a hairy abdomen (Hydrothassa hannoverana (F.), Prasocuris phellandrii (L.), P. junci (Brahm), Sclerophaedon carniolicus (Germar) etc.). Hairiness of certain species is probably a preadaptation, not the result of a special adaptation to aquatic life. Several Galerucella (G. calmariensis (L.), G. pusilla (Duftschmid)) are feeding on Lythrum salicaria L., a wetland plant, in Europe (Laboissière, 1934; Bergeal and Doguet, 1992; Jolivet and Hawkeswood, 1995) and have been introduced into North America (Nötzols et al., 1998, Blossey and Hunt, 1999, Hight et al., 1995). Galerucella tenella feeds on Rosaceae, on terrestrial plants, but in humid areas. The biology of Galerucella calmariensis and G. pusilla on L. salicaria has been studied in the USA by Blossey (1995a, b, c), Blossey and Schroeder (1995), Blossey and Schat (1997), Blossey and Hunt (1999) and Malecki et al. (1993). Many species of leaf beetles, in South East Asia and Africa, feed on rice plants belonging to the genera Lema Fabricius, Oulema Des Gozis (Criocerinae), Dactylispa Weise, Dicladispa Gestro, Hispellinus Weise, Rhadinosa Weise (Hispinae) and others (White and Brigham, 1996, Jäch (1998). However they are real terrestrial insects and do not show special water adaptation, like hairy plastron. Probably their natural buoyancy helps them when they fall in water and they can reach the plants again. Leaf-beetles do not have scales as in weevils and use only hairs when in water. Some are specially adapted, such as the Donaciinae, with plastron respiration, but among the semi-aquatic species it is a rare exception, which however exists. Theoretically, the plastron is a thin film of air over the general body surface communicating with the spiracles (Klausnitzer, 1981). It is generally linked with a hairy cushion. According to some authors, the plastron acts as a physical gill. Sometimes, but not always, the plastron impedes swimming and some beetles with plastrons remain on aquatic

Subaquatic Chrysomelidae

309

plants. Semi-aquatic leaf-beetles are not generally good swimmers and that situation suits them well. They crawl along the host-plants. Swimming abilities are really exceptional among them. Some Galerucinae, for example Agelastica alni L. in Europe and several Sastra Baly spp. in New Guinea, feeding on Betulaceae along streams, are especially resistant to immersion. That is not only because of their light-weight, but may also be due to other morphological details, such as hairy venter. Phaedon cochleariae (F.), a common chrysomeline on Nasturtium officinale R. Br. and many other Brassicaceae, including the hydrophyte Rorippa amphibia Bess., all emergent plants, can tolerate prolonged immersion (Fig. 11). They often have been seen swimming quite fast with their six legs on the surface of the water (Read, 1992). Movement through the water, according to Read, is made by rapid strokes of the forelegs, followed by the midlegs, and then by the hind pair of legs. While swimming, the beetles keep their antennae clear of the water and hold them back over the sides of the pronotum. Read also tested other species of Phaedon, P. tumidulus (Germar) and P. armoraciae (L.) for their swimming ability. I am here quoting Read (loc. cit .) who sees a useful adaptation in the ability to swim in terrestrial beetles, associated with aquatic or semi-aquatic vegetation : P. tumidulus adults when thrown into the water do not attempt to make swimming strokes and merely flounder about. On the other hand, P. armoraciae makes feeble strokes, but movement through the water is slow and restrained. The swimming strokes of P. cochleariae seem quite similar to those made by some surface-swimming curculionids in the Ceuthorhynchinae and the Hyperinae, which are well adapted species. Phaedon armoraciae feeds, in swampy areas, on various Brassicaceae such as Nasturtium amphibium and N. palustre, and P. tumidulus feeds, only on dry areas, on Apiaceae (Umbelliferae). There is probably a relationship, in this ability to swim or not with life in aquatic or dry areas. Other species of Phaedon, for example P. veronicae Bedel, lives on Veronica beccabunga L. and other Scophulariaceae, but also on Rorippa amphibia Bess., an aquatic Brassicaceae.The New Zealand chrysomeline Allocharis marginata Sharp, for instance, feeds in the mountains, according to some authors, larva and adult, along rivers, on Veronica salicifolia Foerster. Little is known of the swimming abilities of those beetles, if any. According to Dr. W. Kuschel (pers. comm.), some species are feeding also on Celmisia spp. (Asteraceae), which is a purely terrestrial plant. There must exist in many parts of the tropics, some other genera or species of chrysomelids adapted to water submersion and even with swimming and underwater breathing abilities. Leaf Beetles Adapted to Life in Heliconia Inflorescenses To Frank and Lounibos (1987), phytotelmata resemble islands where some colonizers can be more or less selective. Seifert (1975) had compared clumps of Heliconia inflorescences to ecological islands. See also Kitching (2000). For Hispinae associated with Heliconia bracts, which are really pitchers, the beetles are highly selective and choose only a few species of plants on which the adults and larvae feed. Phytotelmata in that case resemble swamps (the « grand marécage fractionné » of Picado, 1913) and colonization occurs by flight, the adult beetles being attracted by the odour, the shape and probably the red colour of the inflorescence. Heliconia species are pollinated by hummingbirds (Stiles, 1975). Heliconia caribaea Lamarck and several community structures have been studied in Puerto Rico by Richardson (1999), Richardson and Hull (2000) and Richardson et al. (2000). Island faunas are impoverished comparatively to the continent. For certain authors, including Crowson (1981), Donaciinae and Hispinae are related. Farrell (1998), using DNA sequences from the ribosomal subunits and from morphological characters, found relationships between the two subfamilies, formerly placed at the two extremities of the

310

Pierre Jolivet

Fig. 1. Galerucella grisescens (Joannis). A subaquatic galerucine from France, feeding on various hydrophytes (after Laboissiere, 1934). Fig. 2. Trichobalya bowringii (Baly). A terrestrial galerucine from Vietnam, more setose than Fig. 1 (after Laboissiere, 1936). Fig. 3. Waterlily leaf with three zones of microhabitats for Galerucella nymphaeae (Linn.). p = pupa; e = eggs; f = feeding area (after Kaufmann, 1970). Fig. 4. Galerucella nymphaeae larval abdomen and the larval hold-fast organ (pygopod) (after Kaufmann, 1970). Fig. 5. Stlyized view of Heliconia imbricata (Kuntze) Baker from Costa Rica showing dissected bract with inquiline insects. The water-penny-like larvae of Cephaloleia puncticollis (Baly) is on the edge of the bract entering the water (after Seifert and Seifert, 1976b). Fig. 6. Diagrammatic representation of the insects living in the water-filled floral bracts of Heliconia aurea from Rancho Grande reserve, Venezuela. Cephaloleia neglecta Weise larvae are visible on the top left two bracts (after Seifert, 1982).

Subaquatic Chrysomelidae

311

Fig. 7. Galerucella nymphaeae, adult from France on Nymphaeaceae (after Balachowsky,1963). Fig. 8. Galerucella nymphaeae, larva (after Laboissiere, 1934). Fig. 9. Galerucella nymphaeae, pupa with remains of larval skin (after Laboissiere, 1934). Fig. 10. Exosoma lusitanica (Linn.) on Narcissus sp. (Amaryllidaceae), in France (after Balachowsky, 1963). Fig. 11. Phaedon cochleariae (Fabricius) on various Brassicaeae, including Nasturtium in France (after Balachowsky, 1963). Fig. 12. Chrysolina herbacea (Duftschmid) on Mentha aquatica Linn., M. rotundifolia Linn. and various other Labiatae along streams and ponds in France (after Balachowsky, 1963). Fig. 13. Agelastica alni (Linn.) on Alnus glutinosa Gaertner in humid areas of France (after Balachowsky, 1963).

312

Pierre Jolivet

classification. Hsiao and Windsor (1999) consider the Cephaloleiini, with their flattened water-penny larvae, as being related with the Donaciinae. Both groups are closely tied to monocots. Without entering the arcane of cladistics, we can easily find several common characters between the two groups, but the Donaciinae are aquatic and, as adults, benefit from the waterproof hairs of the venter. Theoretically, Hispines are terrestrial only, but there are exceptions. According to Seifert (1982) in tropical America, the Heliconia beetles, including the hispines of the genus Cephaloleia, are associated either with the young cylindrically rolled leaves (the rolled-leaf hispines) (Auerbach and Strong, 1981; Strong, 1977a and b; Strong, 1984), while a different group of beetles and other insects, including several Cephaloleia, live in the water-filled floral bracts (the flower beetles). It is evident that the Heliconia floral bracts evolved as a defence against flower-feeding and seed-eating insects, but also as a protection against predators and parasitoids for the insect hosts. Exactly like the mining or galling habit, even if there are very few predators in those small bodies of water (carabid and staphylinid beetles, ants, scavenger tettigonids, etc.). Seifert (1982) showed that there is a succession among the insects frequenting the Heliconia bracts: insects adapted to clear water are found inside younger bracts and insects tolerant to detritus inside the older bracts. The much older bracts and rotting flower parts and inhabited only by decomposers such as mites and Collembola (Seifert and Seifert, 1979a and b). During several trips to Panama and Nicaragua, I have been interested by certain Hispines, larvae and adults, partially or totally immersed in Heliconia phytotelmata (the inflorescences) and feeding on the internal epidermis of the bracts. Cephaloleia puncticollis Baly larvae, for instance, strip mine the surface of the younger, wetter bracts of the inflorescences and move sequentially to younger bracts as the older ones dry and harden (Strong, 1977a and b). They eventually feed also on the bases of the flowers themselves in a semi-aquatic environment, inside the bracts. Cephaloleia neglecta Weise, from Venezuela, and C. puncticollis, from Central America, act as symbionts with other insects in the Heliconia community (Seifert and Seifert, 1979a). The destruction of the bract surface increases the food source for scavenger insects. Really, both competitive and symbiotic effects occur (Seifert and Seifert, 1976a). Cephaloleia larvae inside the bracts can be dislodged by syrphid larvae. Heliconia inflorescences are water-filled and serve as small aquatic habitats for a variety of arthropods and protozoa. According to authors, the bracts, even in the dry season, contain as much as 6 cc of water, or more according to species. Many authors have made the same observations, but the hispines have been mainly studied from the perspective of plant selection (Strong, 1977-1984). Not all Heliconia species are attacked by C. puncticollis, but only those with erect inflorescences that collect water in the cup-shaped bracts. During the flowerless season, C. puncticollis lives in and feeds on the rolled leaves of Heliconia just like other non-aquatic species (Strong, 1983). In Costa-Rica, Seifert and Seifert (1976b) studied the life-histories of eight species of insects, including Cephaloleia puncticollis, which live in the water-filled bracts of Heliconia wagneriana Petersen and H. imbricata (Kuntze) Baker. These hispines forage exclusively in Heliconia pitchers. Unlike most members of the Hispinae, which feed on the cylindrically rolled young leaves of various Heliconia species, larvae of C. puncticollis feed mostly on Heliconia imbricata inflorescences. I repeat herewith the observations of Seifert and Seifert (loc. cit.): “oviposition occurs in June; eggs are laid in clusters from 1 to 6 on the inside of the bracts; larvae feed by rasping the inside of the bract and rarely the flower itself. Larval development lasts about 60 days. Pupae are attached directly to the bract and the adults emerge after 15 days. Densities of C. puncticollis larvae varied among inflorescences, but they are never numerous. There are very few predators inside the bract, such as earwigs, spiders and even staphylinids, for example Odontolinus fasciatus (Sharp), feeding mostly on mosquito larvae”.

Subaquatic Chrysomelidae

313

Finally, the extreme rarity of predators makes the inflorescence, like the rolled leaves, a good environment for the larvae and a very good protection. Development times for Cephaloleia puncticollis seem to be geared to the time at which H. imbricata inflorescences begin to rot, even if pupae are found sometimes in inflorescences in which substantial rotting has occurred. For Seifert and Seifert (1976b, 1979a), selection must favor eclosion to adult forms before the death of the inflorescence and must reduce the development time of the larvae. Heliconia wagneriana produces a new bract pair about every nine days and each inflorescence remains for about eleven weeks and H. imbricata produces a new bract pair every week. Both Heliconia bloom during the rainy season from mid- May through September. Cephaloleia beetles are more abundant in June and July. Because of the low nitrogen content in the Heliconia leaves, larval development of the hispines is prolonged and may require over two hundred days, at least for the ones living inside rolled leaves. That is why some special adaptation is needed for Cephaloleia puncticollis feeding in the water filled inflorescence. Several species of Cephaloleia, living inside Heliconia (Heliconiaceae) inflorescences, seem adapted in some ways to a semi-aquatic life, as adults and larvae, since the bract normally contains water. C. puncticollis, for instance, inside the inflorescences of Heliconia imbricata (Kuntze) Baker, copulates, oviposits and feeds, but eventually, adults, not larvae, may also be found feeding in the rolled leaves of the plant (Strong, 1977a). Egg density and parasitism was studied by Morrison and Strong (1981) for Cephaloleia consanguinea. Leaf-feeding Cephaloleia feed near the edges and Arescini tend to feed away from the edges, probably to avoid competition. According to Staines (1996), adults of C. puncticollis were also collected on Heliconia latispatha Bentham and on Musa sp. According to Staines (1991, 1996), the Neotropical genus Cephaloleia Chevrolat contains 185 species, including 65 in Central America. A related genus Chelobasis (Arescini) lives in the rolled leaves of Heliconia species, both larvae and adults. Other Arescini genera, including Arescus Perty, Xenarescus Weise and Nympharescus Weise, etc. show a similar biology. There are hispine species which have larvae that feed on the bracts and adults that feed on the leaves (Strong, 1977b), but there is also one hispine larva that feeds both on leaves and bracts (Seifert and Seifert, 1979b; Seifert, 1982). It is evident that for leaf-feeding larvae, utilization of the inflorescences, even for a short time, adds an additional food source. Chelobasis perplexa Baly, in Costa Rica, feeds, in the larval stage, only on rolled-leaves of Heliconia and has a long minimal developmental time of 240 days (Strong and Wang, 1977). Xenarescus monoceros (Olivier), in Rancho Grande, Venezuela, feeds on rolled leaves or inflorescences of various species of Heliconia and has a minimal development time of 228 days (Seifert and Seifert, 1979b). These larvae prefer leaves rather than bracts and occasionally move from plant to plant. As we know, hispines that feed inside the bracts grow more rapidly than the ones growing inside the rolled leaves. This is the case for bivalent species such as X. monoceros. However, those larvae inside the bracts suffer the effects of competition with Cephaloleia neglecta and move rapidly from bracts (inflorescences) to the rolled leaves to complete their development. In the young inflorescence bracts of Heliconia aurea Rodriguez, which accumulate large amounts of water, larvae of X. monoceros and larvae and adults of C. neglecta are often found together. Bract-feeding Cephaloleia puncticollis from Costa-Rica and C. neglecta Weise from Rancho Grande certainly grow at a more rapid rate than do leaf-feeding species (Figs. 5, 6). A short but good review of the rolled- leaf hispine beetles is given by Hogue (1993) summarizing previous research. The colorful inflorescence of Heliconia consists of the peduncle, the part of the stem between the terminal leaf sheath and the basal bract, the modified leaf-like structures called the inflorescence bracts, the rachis connecting adjacent bracts, and a coil of flowers within each bract (Berry and Kress, 1991). The inflorescence can last from several days to several weeks, which allows time for

314

Pierre Jolivet

beetles to develop. Eventually, after 8 to 11 weeks, the inflorescence will cease to produce flowers and will rot away. The inflorescence bracts are usually bright red, yellow, or both but they can be also green in some species. Each bract contains a varying number of hermaphroditic flowers. Only certain Cephaloleia, for example C. puncticollis, possesses a setose venter which can be considered a special adaptation to life in water inside the inflorescence. These Cephaloleia are bright red like the background of the inflorescence, which is certainly a case of homochromy. Other Cephaloleia are orange in color. According to Seifert (1982), even if this coloration suggests that the beetles could be distasteful (aposematism), their taste is quite innocuous. The teneral adult is soft and dull coloured, and the bright red only appears several days after emergence. Harvey (1988) studying the Heliconia leaf-curl communities in south-eastern Peru, stated that, in case of flooding, adult hispines fail to survive 24 hours submergence. He dealt only with the rolled-leaf species, bract-frequenting species being adapted to a long immersion. Harvey (loc. cit.) also linked hispine abundance to Heliconia density. The insect community associated in Venezuela with Heliconia caribaea Lamarck has been studied by Machado-Allison et al. (1983) and community structure by Naeem (1988, 1990) for Heliconia imbricata. I studied the presence of the setose venter in many Cephaloleia spp. and found 13 spp. with and 17 spp. without this character. Staines (1996), who produced a monograph on those Cephaloleia and various catalogues (Maes and Staines (1991), said (pers. comm.) that some Heliconia leaf-roll beetles, such as Chelobasis Gray spp., do not have abdominal hairs. It is very probable that their relationships with water are different and many Cephaloleia and other genera do not develop inside water inflorescences. Many species of Cephaloleia, outside C. puncticollis and C. neglecta are reddish in color, and probably are living also inside the bracts. Others, yellow and black and dull in color, probably live among appressed leaves. Statistically, the red ones seem have an abdomen hairier than the dull ones, but without any SEM study it is impossible to link completely hairiness with aquatic life. Water-penny larvae of Cephaloleia are specially adapted to live inside humid rolled leaves of Heliconia or inside the water-filled bracts of the plant. They greatly resemble the water pennies, the larvae of Psephenidae, a family well adapted to life in running water, but Cephaloleia larvae do not have the abdominal gills or anal filaments of the psephenids. They respire by means of spiracles only. Their integument is strongly sclerotized. Their shape is certainly an adaptation to the leaf surface and a protection against dessication. The larva moves easily among the humid tissues of the leaves or inside the water of the bract. The pair of thoracic spiracles opens on the ventral surface, the first seven abdominal pairs lie on each side and open on the dorsal surface, like the 9th pair which is well developed and dorsal, a classic correlation with the development of the onisciform body. Those larvae are internal surface feeders, not real leaf miners. They scrape the leaf surface, crawling forward with each scoop of the mandibles and defecating, thus leaving a linear trail often littered with fecal pellets. Probably, those pellets are eaten in the bract by various scavengers. As mentionned by Hogue (1993), they do not puncture the leaf. As many as eight hispine species may intermingle at a single site (Strong, 1982a and b). The larva of one Cephaloleia species from Costa Rica has been described by Maulik (1933b) and distributional correlation between hispine beetles and their host-plants was studied later on (Maulik, 1937). Other Cephaloleia larvae were described by Maulik (1932, 1933a); Bruch, (1937); Monros and Viana, (1947), etc. Apparently, the larvae of only rolled-leaf species have been succinctly described and as yet no bract- frequenting and subaquatic species have been mentionned. Some larvae of Cephaloleiini, in contrast to those of Arescini, are almost as wide as long, but others are elongate. Costa-Lima (1955) quoted Cephaloleia species from doubtful plants from the data of Bondar (1931a and b, 1938). Strangely enough, Costa-Lima (1955) did not mention

Subaquatic Chrysomelidae

315

anything about the specialized biology of the species. Staines (1996) summarizing the biology of the Central American Cephaloleia stated that most species feed on the rolled leaves of various Zingiberales, including Heliconiaceae, when the leaves are tender and wet. Oviposition sites vary according to the species and can be leaf surfaces, petioles, immature leaves or, for the specialized species, the inflorescence bracts. Larvae with their water penny appearance look like trilobites. Larvae develop very slowly (up to eight moults) and the inflorescence-feeding species remain inside the bract. Pupation often occurs on the stalk. Larvae and, after emergence, adults of many dorso-ventrally flattened Hispinae from palm-trees, Musaceae and other Monocotyledons all live inside a wet medium. Folded and rolled leaves protect these larvae from predators and parasitoids, but if such surroundings are very wet, it resembles a mine not a water tank. My investigations among hispines show that the setose venter is not necessarily linked to an aquatic life, truly found only among certain species of Cephaloleia. Mecistomela Jacobson (Macedo et al., 1994), Coraliomela Jacobson and Alurnus Fabr. species developing on palm trees generally have a setose venter. Chelobasis perplexa Baly and C. bicolor Gray have a smooth abdomen, as do the Chalepus, Octotoma Dejean, Baliosus Weise species, and all the other American genera examined. Leaf Beetles Living on Aquatic or Semi-aquatic Plants Several beetles, such as Galerucella nymphaeae (L.) ( Servadei, 1938; Doyen and Ulrich,1978), feed in the middle of rivers and lakes on various Nymphaeaceae, including Nymphaea alba L. and Nuphar luteum L. However, the species has been divided into different taxa, some more terrestrial, but living on various hydrophytes of the river banks like Lysimachia vulgaris L., Potamogeton natans L., Polygonum amphibium L., Rumex hydrolapathum L., Sagittaria sagittifolia L., Comarum palustre L., etc. (Laboissière, 1934). The species studied by Gadeau de Kerville (1886) is the Rumex form. Another species, Galerucella grisescens (Joannis) also lives near water on Lysimachia vulgaris L. and Hydrocharis morsus-ranae L. (Fig. 1). Galerucella nymphaeae has a setose venter with the dorsal body surface smooth. Various papers have been recently written on the Galerucella nymphaeae complex. For Nokkala and Nokkala (1994, 1996, 1998), the assortment of food plants of G. nymphaeae is dichotomous: one group living on aquatic plants whose leaves float on water, and the other group on semiaquatic and terrestrial plants. In Finland, either the beetle feeds on Nuphar luteum (G. nymphaeae (L.)) or on Comarum palustre L. and Rubus chamaemorus L. (Rosaceae) (G. sagittariae (Gyllenhal)). For the Finnish authors, Hippa and Koponen (1986), both species, still genetically quite similar, are separated and parapatric or sympatric, G. nymphaeae itself, being the original form. The eggs are different in the two forms and the surface structure of the eggs is adapted either to humid or drier habitats. However, both forms can be successfully hybridized in the laboratory despite genetic differences. The differences in the structure of the larval cuticle between the two species of Galerucella are apparently due to adaptation to different habitats (Hippa and Koponen, 1975, 1979, 1986; Nordell-Paavola et al., 1999, in print). It seems (C. Nokkala, pers. comm.) that the larval cuticle of G. sagittariae, having no papillae do not tolerate submersion in water. Larvae and adults of G. sagittariae lose their grip on the leaf in the water and drown. The adults of G. nymphaeae tolerate submersion very well. In G. nymphaeae, the larval papillae retain a film of air when the larvae are submerged, and a silvery-looking air film surrounds these larvae. They can survive under water for long periods. Also, the first instar larvae of G. sagittariae do not survive on leaves of water lilies and they do not tolerate submersion in water. Galerucella nymphaeae completes its life cycle on the upper side of the floating leaves of water lilies, where all life-stages, eggs, larvae, pupae and adults, occur (Setala and Makela, 1991, Kouki, 1991a,

316

Pierre Jolivet

1991b, 1993). A lily pad can be divided into three microhabitat zones: the marginal zone of feeding by larvae, the innermost zone of pupation, which is always dry, and the zone of oviposition which excludes that of feeding (Kaufmann, 1970). Balachowsky and Mesnil (1936) and Balachowsky (1963) have summarized the biology of Galerucella nymphaeae in France. For Lohse (1989), four species had been confused under the name of G. nymphaeae in Europe, including G. nymphaeae, G. sagittariae, G. kerstensi Lohse (= G. sagittariae, sensu Joannis, 1866) and G. aquatica (Fourcroy). Palmen already (1975) divided the species into G. nymphaeae and G. sagittariae (Figs. 3, 4, 7, 8, 9). Generally, larvae and even adults of G. nymphaeae aggregate together on Nymphaea leaves. There is surely an aggregation pheromone involved and Grevstad and Herzig (1997) found that the related G. calmariensis (L.) was strongly attracted to conspecifics when settling after dispersal. See also Blossey et al. (1994b). Cronin et al. (1998) studying the feeding selectivity of G. aff. nymphaeae on Nuphar variegata Aiton and Nymphaea odorata Aiton in Michigan, stated that larvae and adults feed only on the upper surface of floating and emergent Nuphar. For them, the American form is a terrestrial beetle that lives on islands of dry macrophyte leaves. However, terrestrial insect or not, Galerucella aff. nymphaeae is specially adapted to withstand a long immersion. Population densities and instar distributions of G. aff. nymphaeae were studied by Wallace and O’Hop (1985) on Nymphaeaceae in Georgia, USA, Weiss and West (1920) in New Jersey and Otto and Wallace (1989) compared the biology of the two siblings in Georgia and S. Sweden. Old observations on the biology were made by Scott (1924). See also observations by Cassani (1981) and Kelley (1985) in Florida, of Cronin et al. (1998, 1999) in Michigan, Indiana and North Carolina. However, no studies were made of water adaptation of these species. Galerucella aff. nymphaeae was widely distributed from Canada (Bousquet, 1991 ; Campbell et al., 1989) to the USA. Mating habits of G. nymphaeae have been studied on Nymphaea leaves by Parri et al. (1998). Cronin et al. (1999) suggest that there are two different ecotypes in North America. Differences between Dutch feeding varieties of Galerucella nymphaeae have been reviewed by Pappers et al. (2001, 2002). To Hippa et Koponen (loc. cit.) and to Nokkala et al. (1998), the North American material of the G. nymphaeae complex feeding on Nuphar advena (Soland.), N. luteum (L.) Sibth. and Sm., Nymphaea alba L., N. odorata Ait., (Nymphaeaceae), Brasenia schreberi Gmel., (Cabombaceae), does not fit the European material and must belong to a different species (Manguin et al., 1993). Feldmann (2001) quotes G. nymphaeae as abundant on Trapa (Trapaceae) on the Hudson River in the state of New York. That species has not yet been named and previously all the American, Asian and European authors considered it as conspecific with the palaearctic G. nymphaeae (Wilcox, 1965, 1971, 1979; Jolivet and Hawkeswood, 1995; Balbsbaugh and Hays, 1972; Weise, 1924; Laboissière, 1934, Wallace and O’Hop, 1985, etc.). Authors including Ogloblin (1936) clearly separated the various forms of the European species together with their food-plants. Galerucella nymphaeae is mentioned from Central Asia by Lopatin (1984), Medvedev and Dubeshko (1992) and Medvedev and Zaitsev (1978) and from Mongolia by Medvedev (1982), Byelorussia by Lopatin (1986) together with G. grisescens. Galerucella grisescens (Joannis), but not G. nymphaeae, is found in Japan on semi-aquatic plants (Kimoto, 1964). Galerucella. nymphaeae, with G. grisescens, is common in China, Mongolia and NE Asia on various species of Nuphar and Nymphaea (Gressitt and Kimoto, 1963). However, Yu et al. (1996), in China, quoted only Galerucella grisescens on Rumex Linn., Polygonum Linn., Fragraria Linn. and Sorbaria (Seringe ex. Candolle) A. Braun. In Taiwan, Kimoto and Takizawa (1997) noted G. grisescens and G. nipponensis (Laboissière), the last one possibly the equivalent of G. nymphaeae, the three species belonging to the subgenus Hydrogaleruca sensu Laboissière, (1922). In Japan, Kimoto (1964) mentioned G. nipponensis on hydrophytes: Brasenia schreberi J. Gmelin (Cabombaceae), Ludwigia ovalis Miq.(Onagraceae), Trapa

Subaquatic Chrysomelidae

317

japonica Flerov. (Trapaceae), but also on non-hydrophytes, such as Lycopus lucidus Turcz. (Labiatae). The biology of G. nipponensis (Laboissiere) was totaly unknown and it is apparently distributed in Japan, Korea, Taiwan and SE Siberia (Dubeshko and Medvedev, 1989). Recent papers by Tanaka and Nakasuji (2002a, 2002b), Ikeda and Nakasuji (2002) give details on its biology on Trapa japonica. The biology of the subaquatic American species aff. G. nymphaeae has been studied by Kaufmann (1970) in Alaska. The larvae require very moist surroundings, but normally remain on the surface of water lily leaves. They can be immersed without problem and adults are capable of walking on or skimming the water surface. Like many other galerucine larvae, the larvae of G. nymphaeae possess, what Kaufmann (1970) called a papilla, on the last abdominal segment. This is really the tenth segment, below the ninth, and it is the pygopod serving in progression. This organ can be inflated by blood pressure and serves as a hold-fast organ by creating a vacuum between it and the leaf surface. It assists also in locomotion and enables the larva to cling to the lily pad while under water. Recently, Bolser and Hay (1998) tested whether grazing by the specialist beetle Galerucella aff. nymphaeae induced resistance to herbivory in the water lily, Nuphar luteum, in America. The answer is not clear. Galerucella birmanica (Jacoby), adults and larvae, feed on the leaves of the aquatic waternut, the singhara or Trapa bispinosa Roxb. It is a floating aquatic herb and the seeds of most of the 30 known species of Trapa Linn. are edible. The Trapaceae are closely related to Onagraceae. Maulik (1936) was the first to mention G. birmanica on Trapa bispinosa and Wilcox (1971) quotes some biological references. Lefroy (1909-1910) as a nomen nudum and Husain and Shah (1926) described the species as Galerucella singhara Husain and Shah which means that the relationship insect/plant was already known (Pruthi, 1969). The biology and anatomy of the insects have been studied in detail by Khatib (1934-1946) and Verma (1969). To be noted the cryptonephridic arrangement of Malphigian tubules is lacking in the aquatic Donacia and is poorly developed in the semiaquatic Galerucella birmanica (Jacoby) (Saini, 1964; Jolivet and Verma, 2002). This provides support for the view that this anatomical feature helps water conservation. Probably the same happens with Galerucella nymphaeae. Another galerucine, Exosoma lusitanica (L.) (not lusitanicum !), in the larval stage, lives in a semiaquatic media, a mixture of water and decomposed magma, inside the bulbs of various Amaryllidaceae (Narcissus tazetta L., N. poeticus L., and many others) (Mayet, 1907 ; Laboissière, 1934) (Fig. 10). It could be that the special bicameral spiracles of the larva is an adaptation to life inside its very special aquatic environment (Böving and Craighead, 1930; Crowson, 1994). Very probably, many other species of Exosoma Jacoby have a similar biology and should be reexamined for possible special adaptations. Longitarsus nigerrimus (Gyllenhal) lives among sphagnum in peat bogs and very probably feeds on Utricularia vulgaris L., a carnivorous hydrophyte. It can be easily submerged and probably swims, but at least it floats well. The species is not hairy below and does not seem preadapted to a semi-aquatic life in such surroundings very poor in oxygen. Its legs, including femora, and antennae are hairy, but that seems normal for a Longitarsus. The elytra are smooth and the pronotum not especially hairy. Many notes were published on L. nigerrimus (Heikertinger, 1909; Künnemann, 1918; Ihssen, 1943; Doguet, 1994), but we still need detailed information about its biology. It could be probably compared to Bagous life-history. Experiments in aquaria have never been attempted. We are reduced to hypotheses about its larval biology as probably being on the roots of semiaquatic plants. The species is not rare and probably exists everywhere in northern and middle Europe to the Ukraine, in most of the swamps and bogs harboring a Sphagnum, Juncus Linn.and Drosera Linn. climax vegetation. This species also exists in Britain and curiously all the excellent British observers such as Read, Morris, Allen, etc.

318

Pierre Jolivet

have not yet reported it. Joy (1932) mentioned it in England on Plantago maritima L., which is a mistake and Cooter’s book (1991) gave Utricularia spp. as host-plant, probably after Ihssen (1943). Kevan also (1967) stated, in England, the beetle in sphagnum in bogs and on Utricularia Linn., which is supposed to be the host of some species of Bagous. Utricularia being a freshwater emergent, the beetle must probably live above water most of the time. According to Shirt’s Red Data Book (1987), L. nigerrimus was considered to be an endangered species, since it had not been officially collected in England since 1930, but recent captures confirm its persistence in swampy areas. There are similar references about swamps in Denmark, Finland, Italy (Biondi, 1990), Russia (Medvedev and Roginskaja, 1988), but no one dealt with original captures. According to Heikertinger (1909) this beetle lives in Sphagnum moss in peat bogs and could feed on several hydrophytes or subhydrophytes, like Mentha arvensis L., Lycopus europaeus L., and Lythrum salicaria L. Derenne (1963), probably simply guessing, also mentions Mentha aquatica L. as a host, but the only reliable observation is by Ihssen (1943) of L. nigerrimus feeding on Utricularia vulgaris L. and various other species including U. intermedia Hayne and U. minor L. – this is the only case of a chrysomelid feeding on a carnivorous plant. The biology was confirmed in Germany by Mohr (1960, 1962) on Utricula intermedia who suggested an underwater life among the Sphagnum. Recently a paper by Booth (2000) studied the biology of L. nigerrimus in England and mentioned Utricularia minor as host plant. Booth affirmed that the beetle cannot swim under water. It is extremely surprising that until now no leaf-beetle in the world has been mentioned feeding on Nepenthes Linn., Sarracenia Linn., Heliamphora Betham, Darlingtonia J. Torrey, Drosera, and other carnivorous plants in Australia-New Guinea. Chrysomelids are often captured by those plants, namely Sarracenia in North America. There must certainly be some cases of phytophagy still to be reported. No chrysomelid beetles have been so far reported from myrmecophilous plants, but some of them act as phytotelmata (Beccari, 1884). On the contrary, weevils are sometimes abundant on carnivorous plants. It is probable than L. nigerrimus is hooked by its tarsi to the plants under water and can survive like the Bagous on the oxygen liberated by the aquatic plants. It could also, but it seems improbable, tap oxygen by cutting the stems as do many aquatic (Donacia) or subaquatic beetles (weevils). A closer scrutiny of the biology of L. nigerrimus is needed. Recently, Bameul (1999) mentions that L. nigerrimus is perfectly capable to survive immersion, to walk under water but seems unable to walk properly on the surface, as do Chaetocnema aerosa (Letzner). Many species of Alticinae have a subaquatic life on hydrophytes, including species of Disonycha Chevrolat, Phrenica BechynJ, Lysathia BechynJ, Pseudolampsis Horn and Agasicles Jacoby (Brigham, 1982), without any important modification of their morphology. There is not always a true waterproof plastron for these species, but many of them have a setose venter. About ten Dysonycha species are found in Florida, mostly eating holes in leaves on terrestrial plants. Their biology is rather poorly known (Coulson, 1977) and the pupae are often found in the soil on shore (Buckingham et al., 1986). Disonycha glabrata (F.) and D. pennsylvanica (Illiger) feed on various hydrophytes, for example Alternanthera philoxeroides (Mart.) Griseb. and on various amaranths and possibly on Polygonum. Disonycha uniguttata (Say) lives in and on Typha latifolia L. in open water, its biology was discovered by Bob Esser (unpublished), Gainesville nematologist. It has a setose venter. Disonycha argentinensis Jacoby failed to control terrestrial alligator weed (Alternanthera philoxeroides (Mart.) Griseb.) in Australia and New Zealand. Pseudolampsis guttata (LeConte) lives well-camouflaged (Balsbaugh, 1969; Habeck, 1979) among floating ferns (Azolla caroliniana Willd.), in Florida. The eggs, covered dorsally with erect papillae, probably an adaptation to water, are laid on the underside of the plant, and the larvae feed on the

Subaquatic Chrysomelidae

319

emerged leaves (Buckingham and Buckingham, 1981; Buckhingham et al., 1986). The larva is green and the pale brown cocoon is found on the plant itself. The adult has a setose venter and hairy legs and can be surrounded by air when submerged Buckingham (pers. comm.). Many of them carry an air bubble underwater which is surely a useful adaptation to immersion. The beetle destroys Azolla Lam. assisted by an aquatic weevil, Stenopelmus rufinasus Gyllenhal. Biology of Pseudolampsis guttata and P. darwini (Scherer) from Brazil, on Azolla spp., is summarized by Casari and Duckett (1997). Due to its lack of specificity ( Hill and Oberholzer, 2002), P. guttata has been considered as unsuitable for release in South Africa. Agasicles hydrophila Selman and Vogt, from Argentina, has a densely setose venter, which is useful in an aquatic environment. However, it seems that one must not attach too much importance to details common to some terrestrial and aquatic species. Most of the species of Agasicles feed on aquatic Amaranthaceae (Chapman et al., 1999,), mostly Alternanthera phylloxeroides (Martius), the floating alligatorweed imported in the southeast of the United States, but have also been captured on other species including Alternanthera sessilis (Linn.) R. Br.and A. hassleriana Chod., etc. Pupation takes place inside the stem of the host plant. This habit protects the pupa against the rise of the water level but the pupa can be killed by long immersion. Releases of A. hydrophila (Buckingham et al., 1983; White, 1996; Stewart et al., 1999; Vogt et al., 1992; Zeiger, 1967) have been made in the United States and New Zealand with some success. All the Agasicles species feed only on amphibious amaranths (Vogt et al., 1979, 1992). A flavone feeding stimulant seems to be involved in the host specificity. Apparently, A. hydrophila has been introduced elsewhere in SE Asia, including Taiwan (Kimoto and Takizawa, 1997) to control the exotic weed A. phylloxeroides. Vogt et al. (1979) concerned the evolution and morphology of the South American disonychine flea beetles and their amaranthaceous hosts. The relationships with water and hydrophytes is also well studied. Agasicles species do not have any host plants other than amphibious amaranths and are reasonably adapted to a subaquatic life. Lysathia ludoviciana (Fall) is widespread in Florida and feeds, as adults and larvae, usually on Myriophyllum aquaticum (Velloso) Verde (Haloragidaceae) introduced from South America (Habeck and Wilkerson, 1980; Sutton, 1985). This plant, like many floating weeds, is both submerged and emergent. Adults and larvae of the flea beetle occur on the top of the plant. The pale brown oval cocoon is attached to the stem. The oblong yellow eggs are attached to the underside of the leaves and to each other by a glue-like substance. Ludwigia peploides (H.B.K.) Raven (Onagraceae) is probably the normal host-plant in Texas (Campbell and Clark, 1983; Vogt and Cordo, 1976). Plants, like Myriophyllum spp., contain dense accumulations of crystalline calcium oxalate in raphides, a dietary preference for some chrysomelids (Hasman and Inanc, 1957). In Argentina, Lysathia flavipes (Boheman) feeds on Ludwigia peploides (H. B. K.) Raven and on Myriophyllum aquaticum (Velloso) Verde (Cordo and DeLoach, 1982). Many species of Altica are common along rivers or lakes on subaquatic plants, including Polygonum (Polygonaceae), Lythrum Linn. (Lythraceae) or various Ludwigia Linn. spp. (Onagraceae). Most Altica species are entirely terrestrial, and, despite that these Altica are able to swim a little and to withstand a certain amount of immersion, there are not special adaptations to aquatic life. Several species are common in Europe and temperate and tropical Asia. Considering the hairiness of the subaquatic Alticinae, it does not seem that it is really linked to the frequentation of water. However, I have found that Lysathia spp. from Costa Rica possess a hairy abdomen, as well as Macrohaltica jamaicensis (L.) from Central America, normally on Gunnera insignis (Oersted) A. DC. (Haloraginaceae), but also often on hydrophytes around ponds. Lysathia ludoviciana Fall, from Alacha Co., Florida, has the sternum covered with dense setae, as in Donacia. It

320

Pierre Jolivet

is totally smooth above. Agasicles hygrophila Selman and Vogt and Pseudolampsis guttata ( LeConte) have both a hairy sternum, and P. guttata also has the dorsum with setae. It can be easily surrounded by an air bubble underwater. Altica species seem for the most part smooth dorsally and ventrally, but they cannot be considered as subaquatic since most of them have an entirely terrestrial life. At the most, a few of them frequent hydrophytes along streams and ponds. In a recent paper, Bameul (1999) mentions Chaetocnema aerosa (Letzner) as showing adapations to life in a semiaquatic environment. The beetle, and probably other related species of Chaetocnema Stephens in Asia, feeds on water plants of the genus Eleocharis R. Brown in swampy areas. According to Bameul, the beetle skates on the surface film, an air bubble remaining captive beneath the head and the thorax in case of submersion. How far the subelytral cavity helps in retaining air is difficult to ascertain. It works certainly for many subaquatic beetles. Lipids covering appendices and teguments repel certainly water and helps the buoyancy as for most of the leaf beetles. Other beetles, such as Neolochmaea boliviensis Bechyné, a galerucine, live and feed in the Amazonian floodplains on the free-floating aquatic macrophyte, Ludwigia natans Humb. and Bonpl., an Onagraceae. Its biology has been summarized by Medvedev et al., (1993). The beetle seems abundant in lakes and water-channels around Manaus. Most of the Neolochmaea Laboissiere are not aquatic and this species is exceptional. For instance, Neolochmaea tropica Jacoby, in Venezuela, normally feeds on Borreria G. F. Meyer sp. (Rubiaceae) and no aquatic or subaquatic host-plant species is mentioned in Venezuela (Bechyné, 1997). I had already observed this species on Borreria verticillata in Brazil and other species of the genus are also Rubiaceae feeders (on Diodia Linn. for instance). (Jolivet and Hawkeswood, 1995). According to previous authors, neither the cuticle of imagines and larvae of N. boliviensis, nor the surface of their host-plant possess repellent epicuticular waxes, as observed for the semi-aquatic grasshopper Paulinia acuminata (DeGeer) (Orthoptera Pauliniidae) and its foodplant, the floating aquatic fern Salvinia auriculata Aublet. However, larvae and adults of N. boliviensis were observed feeding temporarily on submerged leaves of their host-plant, which means that the insect, like Galerucella nymphaeae, is perfectly adapted to temporary submersion, probably due to waterproof hairs. The beetle is specific in its feeding refusing another floating plant, Pistia stratiotes L., an Araceae. There must be many semiaquatic leaf beetles of unknown behavior in the tropics. Galerucine beetles are the best candidates for adaptation to floating plants in slow running rivers and lakes, but there are numerous alticines feeding on hydrophytes, especially in tropical America. CONCLUSIONS Insects and vascular plants are very rarely encountered in the marine environment. A debate on the topic was recently opened in Functional Ecology (van der Hage, 1996). There are limiting factors and angiosperms are rare there, producing long pollen fibres, and no insects feed on them in the sea. All the adaptations of aquatic and subaquatic insects were made in fresh water in relation mostly to vascular plants. That is a rule for all insects including beetles. It is possible that the rostrum or snout of adult weevils helped them in better tapping the underwater plants (Danforth et al., 1999), and that the leaf-beetles were at a slight disadvantage for that. Donaciinae larvae easely obtain their oxygen from the intercellular gas-containing spaces in stems and roots of water plants using another technique. Adults also tap the oxygen with their mouthparts. Macroplea adults are plastron insects and get their oxygen directly. Nevertheless, the whole success of the chrysomelids, bruchids, even of the cerambycids, as leaf, seed or wood-feeders, does not presuppose any kind of inferiority. Donaciines tap the hydrophytes without any problem.

Subaquatic Chrysomelidae

321

Subaquatic leaf-beetles, except perhaps a few galerucines living on floating hydrophytes, are not really adapted to aquatic life as are the Donaciinae, for instance. Weevils, bearing hairs or scales, seem generally to be better-adapted thanks to their hydrofuge cover. The presence of a setose venter or dorsal plastron among some leaf-beetles is probably just an accident and not a preadaptation to aquatic life. For Seifert (1984), the insect communities living inside the water-filled bracts of Heliconia are ideal for studies on community structure. Hispines living there are just exceptions, the majority of them developing in rolled leaves of the plant. No Heliconia-feeding hispine larvae and adults were found, in the bract of the local plants, in Martinique or Guadeloupe, by Seifert (loc. cit .). It is a consequence of depauperate island biota. Large bract inflorescences contain more water and have greater insect richness. The development of the Cephaloleia and other insects inside the bract, seems to closely follow the development and the death of the inflorescence. The development time of hispine larvae is shorter in the bract than in the rolled leaves, since the inflorescence is going to rot earlier than the leaf. Hispine beetles have greater success in younger bracts. They probably all have a different behaviour according to the genus and species. Some are setose ventrally, others not. Plastron respiration and morphology have been studied (Thorpe, 1950, Thorpe and Crisp, 1949) in aquatic insects, mostly Coleoptera. Hinton (1976) reviewed the plastron in bugs and beetles. He showed that the system among Donaciinae was made of plastron hairs, when, in the case of the weevils, plastron scales are well represented. Weevils and other plastron-bearing beetles that live in still waters can sometimes swim, whereas, those beetles that live in running waters cannot swim. Hairy cover exists among several subaquatic leaf-beetles, but generally it is localized on the sternum, sometimes on the plastron. Plastron scales and a wax cover are always missing among subaquatic chrysomelids and any real adaptation to water is missing, even if beetles such as Phaedon cochleariae or Galerucella nymphaeae, seem to swim well and to resist a prolonged submersion. The nymphs of some subaquatic grasshoppers, such as Paulinia acuminata, in the Neotropics, are not only well camouflaged, but also water repellent because of epicuticular waxes (Barthlott et al., 1994). Let us also underline that waxes in aquatic weevils are probably also a protection from dryness. The various species of Hydrolutos Issa and Jaffe (Orthoptera: Anostostomatidae: Lutosini), from the Venezuelan tepuys, can remain submerged a long time in the bottom of rock pools (Issa et Jaffe, 1999), exactly like the Chalepides Casey (Col. Scarabaeidae, Dynastinae), on the top of the Brazilian mountains. These Venezuelan Anostostomatidae have, like Paulinia Blanchard, the pleura, thorax and abdomen completely covered with setae and wax forming a physical plastron (Issa and Jaffe., loc. cit.). Common among weevils, epicutilar waxes remain unknown among leaf-beetles. Cephaloleia puncticollis and C. neglecta inside Heliconia bracts and Longitarsus nigerrimus under sphagnum cover are probably better adapted. However, no adaptation comparable to that of the weevils exists among the chrysomelids. A great number of fully terrestrial galerucines are very hairy, ventrally or all over the body. Let us note, among many others, a few examples: Galeruca spp., for example G. littoralis F., G. tanaceti (L.), Strobiderus Jacoby spp. and Trichobalya bowringii Baly, from SE Asia, Apophylia keniensis Laboissière, from Kenya, etc. Even, many Neotropical species of Diabrotica show a more or less setose venter. These beetles have in no way any relationships with any aquatic or subaquatic plant even if they are covered with setae. Preadaptation can be mostly invoked, when dealing with most of these subaquatic chrysomelids, but the flat and oval penny-like larvae of Cephaloleia are certainly adapted to life inside the moist rolled-leaves of Heliconiaceae as well as in the water-filled bracts of several Heliconia. Galerucella nymphaeae adults and larvae are certainly adapted to a long immersion when their leaf pad is temporarily submersed by waves or rising water.

322

Pierre Jolivet

Other species of chrysomelids, whether alticines, galerucines and chrysomelines, contain some species which, in one way or the other, show some kind of adaptation to water. Donaciines remain, however, the only truly aquatic chrysomelids. ACKNOWLEDGEMENTS The following have kindly helped this work in providing documentation or original observations: Gary Buckingham and Bob Esser (Florida State Collection of Arthropods, Gainesville, FL); Christina Nokkala (University of Turku, Finland); M. G. Morris (Institute of Terrestrial Ecology, Wareham); R. W.J. Read (Hensingham, Cumbria, England); Serge Doguet (Paris, France). I thank also Michael Cox (CAB, Natural History Museum, London, England), for linguistic help. SELECTED BIBLIOGRAPHY Angus, R.B. 1966 (1965). A note on the swimming of Bagous limosus (Gyll.) (Col. Curc.). Ent. Month. Mag. 101:102. Anon. 1970. The Annual Exhibition. 1° Nov. 1969. Proc. Brit. Ent. Nat. Hist. Soc. 3:17-23. Anon. 1994. South American focus of biocontrol search. Eos 81. Spring 1994:15. Auerbach, M. J. and D. R. Strong 1981. Nutritional ecology of Heliconia herbivores: experiments with plant fertilization and alternative hosts. Ecological Monogr. 51(1):63-83. Balachowsky, A. S. 1963. Coléoptères. In: Traité d’Entomologie appliquée à l’Agriculture 1(2)., pp. 618-621. Masson and Cie. Publ., Paris. Balachowsky, A.S. and L. Mesnil 1936. Les Insectes nuisibles aux Plantes cultivées. Paris, pp. 1481-1482. Balsbaugh, E. U. 1969. Pseudolampsis (Col. Chrys. Alt.). Distribution and synonymy. Col. Bull. 23:16-18. Balsbaugh, E.U. and K. L. Hays 1972. The Leaf-beetles of Alabama (Coleoptera Chrysomelidae). Bull. Ala. Agric. Stn. (Auburn) 441:1-223. Bameul, F. 1999. Observations sur l’altise Chaetocnema aerosa (Letzner): distribution, habitat, plantes associées et adaptation au milieu aquatique (Col. Chrys.). Nouv. Rev. Ent. (N.S.) 16(3):199-209. Barthlott, W., K. Riede, and M. Wolter 1994. Mimicry and ultrastructural analogy between the semi-aquatic grasshopper Paulinia acuminata (Orth. Pauliniidae) and its foodplant, the water-fern Salvinia auriculata ( Fil. Salviniaceae ). Amazoniana 13(1-2):47-58. Beccari, O. 1884. Piante ospitatrici ossia piante formicarie dell Malesia e delle Papuasia. Malesia 2:1-340. Bechyné, J. 1997. Evaluacion de los datos sobre los Phytophaga dañinos en Venezuela (Coleoptera). Parte 1 and 2. Vilma Savini (Ed.). Boletin de Entomologia Venezolana. Ser. Mon. 1:1–459. Bergeal, M. and S. Doguet 1992. Catalogue des Coléoptères de l’Ile de France. III. Chrysomelidae. Suppl. Bull. ACOREP, 15:78 pp. Berry, F. and W. J. Kress 1991. Heliconia. An identification guide. Smithsonian Institution Press, Washington, 334 pp., pls Bertrand, H. 1954. Les Insectes Aquatiques d’Europe. I Paul Lechevalier Publ., Paris, 556 pp. Bertrand, H. 1972. Larves et Nymphes des Coléoptères Aquatiques d’Europe. Paris, 804 pp. Biondi, M. 1990. Elenco commentato dei crisomelidi alticini della fauna italiane. Frag. Entomol. Roma 22(1):109-183. Blossey, B. 1995a. Impact of Galerucella pusilla Duft. and G. calmariensis L. (Col. Chrys.) on field populations of purple loosestrife (Lythrum salicaria L.), pp. 27-31. In: E. S. Delfosse, and R. R. Scott (Eds.), Proc. VIII Intern. Symp. Biol. Control Weeds, Canterbury, New Zealand, CSIRO, Melbourne.

Subaquatic Chrysomelidae

323

Blossey, B. 1995b. A comparison of various approaches for evaluating potential biological control agents using insects on Lythrum salicaria. Biol. Control 5:113-122. Blossey, B. 1995c. Coexistence of two leaf-beetles in the same fundamental niche. Distribution, adult phenology and oviposition. Oikos. 74 :225-234. Blossey, B. and T. R. Hunt, T. R. 1999. Mass rearing methods for Galerucella calmariensis and G. pusilla (Col. Chrys.), biological control agents of Lythrum salicaria (Lythraceae). J. Econ. Entomol. 92(2):325-334. Blossey, B. and M. Schat 1997. Performance of Galerucella calmariensis (Col. Chrys.) on Different North American populations of purple loosestrife. Environ. Entomol. 26(2):439-445. Blossey, B. and D. Schroeder 1995. Host specificity of three potential biological weed control agents attacking flowers and seeds of Lythrum salicaria (purple loosestrife). Biol. Control 5:47-53. Blossey, B., D. Schroeder, S. D. Hight, and R. Malecki 1994a. Host specificity and environmental impact of the weevil Hylobius transversovittatus, a biological control agent of purple loosestrife (Lythrum salicaria). Weed Science 42:128-133. Blossey, B., Schroeder, D., Hight, S. D. and Malecki, R. A. 1994b. Host specificity and environmental impact of two leaf beetles (Galerucella calmariensis and G. pusilla) for the biological control of purple loosestrife (Lythrum salicaria). Weed Sci. 42:134-140. Bolser, R.C. and M. E. Hay 1998. A field test of inducible resistance to specialist and generalist herbivores using the water lily Nuphar luteum. Oecologia 116 (1-2):143-153. Bondar, G. 1931a. Notas biologicas sobre alguns Hispineos brasileiros. Cor. Agr. Bahia 9(6):88. Bondar, G. 1931b. Notas biologicas sobre alguns Hispineos brasileiros. O. Campo 2(6):74-75. Bondar, G. 1938. Hispineos (Col. Chrys.) da Bahia e suas plantas hospedadoras. In Not. Ent. Bahia II. Rev. Ent. 8:17-20. Booth, R. G. 2000. A review of Longitarsus nigerrimus (Gyllenhal) (Chrysomelidae) records from the British Isles. The Coleopterist 9(1):15-18. Bousquet, Y. (Ed.) 1991. Checklist of the beetles of Canada and Alaska. Research Branch Agriculture Canada No. 1861:1-430. Böving, G. 1910. Natural history of the larvae of Donaciinae. Int. Revue Ges. Hydrobiol. Hydrograph. Biol. Suppl. 1(1):1-108+1-4, pls. Böving, A. G. and F. C. Craighead 1930. An illustrated synopsis of the principal larval forms of the order Coleoptera. Ent. Amer. 11(n.s.) (1):1-86, pls. Brigham, W. U. 1982. Aquatic Coleoptera. In: A. R. Brigham, W. U. Brigham, and A.Gnilka (Eds.) Aquatic Insects and Oligochaetes of North and South Carolina. Midwest Aquatic Entreprises, Mahomet, Ill. 1:10.110.136. Bruch, C. 1937. Metamorfosis y etologia de dos Hispidos (Col. Hisp.). Rev. Mus. La Plata (n. s.) 1:31-47. Buckingham, G. R. and C. A. Bennett 1981. Laboratory biology and behavior of Litodactylus leucogaster, a ceutorhynchine weevil that feeds on waterfoils. Ann. Ento. Soc. Amer. 74(5):451-458. Buckingham, G. R. and C. A. Bennett 1989. Dyscinetus morator (Fab.) (Col. Scarab.) adults attack waterhyacinth, Eichhornia crassipes (Pontederiaceae). Col. Bull. 43(1):27-33. Buckingham, G. R., D. Boucias, and R. F. Theriot 1983. Reintroduction of the alligatorweed flea beetle (Agasicles hydrophila Selman and Vogt) into United States from Argentina. J. Aquat. Plant. Management 21:101102. Buckingham, G. R. and M. Buckingham 1981. A laboratory biology of Pseudolampsis guttata (LeConte) (Col. Chrys.) on waterfern Azolla caroliniana Willd. (Pterid. Azollaceae). Col. Bull. 35(2):181-188. Buckingham, G. R., K. H. Haag, and D. H. Habeck 1986. Native insect enemies of aquatic macrophytes. Beetles. Aquatics 8(2):28-34.

324

Pierre Jolivet

Caldara, R. and C. W. O’Brien 1995. Curculionidae. Aquatic weevils of China (Coleoptera). In: Water Beetles of China. M. A. Jäch, and L. Jl (Eds.). Wien, Austria. 1:389-408. Campbell, J. M. and W. J. Clark 1983. Observations on host selection by Lysathia ludoviciana (Chrysomelidae), a beetle with potential for biological control of certain aquatic weeds. Texas J. Sci. 35(2):165-167. Campbell, J. M., M. J. Sarazin, and D. B. Lyons 1989. Canadian Beetles (Col.) injurious to crops, ornementals, stored products, and buildings. Research Branch Agriculture Canada, # 1826:1-491. Casari, S. A. and C. N. Duckett 1997. Description of immature stages of two species of Pseudolampsis (Col. Chrys.) (Col. Chrys.) and the establishment of a new combination in the genus. J. N. Y. Ent. Soc. 105(12):50-64. Cassani, J. R. 1981. Native insect versus native weed. Aquatics 3(3):14-15. Champion, G. C. 1913. Note on the Equisetum-eating larva of Bagous claudicans Boheman. Ent. Mon. Mag. 24(49):88. Chapman, C. A., R. B. Emberson, R. M. Syrett and C. M. A. Frampton, 1999. The effect of temperature on the development and survival of Agasicles hygrophila Selman and Vogt (Col. Chrys.), a biological control agent for alligator weed (Alternanthera philoxeroides). N. Zealand J. Zool. 26(1):11-20. Chung, J. C. and D. M. Waller, 1986. Patterns of insect predation on seeds of smooth sumac (Rhus glabra L.). Amer. Midl. Nat. 116:315-322. Clarke, C.M. and R. L. Kitching 1995. Swimming ants and pitcher plants: a unique ant-plant interaction from Borneo. Journ. Trop. Biol. 11:589-602. Cooter, J. (Ed.) 1991. A Coleopterist’s handbook. (3rd ed.). The Amateur Entomologists’ Society. 294 pp. Cordo, H. A. and DeLoach, C. J. 1982. The Flea Beetle Lysathia flavipes that attacks Ludwigia ( water primrose) and Myriophyllum (parrotfeather) in Argentina. Col. Bull. 36(2):298-301. Costa-Lima, A. da. 1955. Insetos do Brasil. 9. Coleopteros. 3. Rio de Janeiro, 289 pp. Coulson, J. R. 1977. Biological control of alligatorweed 1959-1972. A review and evaluation. USDA Tech. Bull., Washington, D. C. 1547:1-98. Crisp, D.J. and W. H. Thorpe 1948. The water-protecting properties of insect hairs. Trans. Faraday Soc. Disc. 3:210-220. Cronin, G., T. Schiacher, D. M. Lodge, and E. L. Siska, 1999. Intraspecific variation in feeding preference and performance of Galerucella nymphaeae (Chrys., Col.) on aquatic macrophytes. J. N. Amer. Benthological Soc. 18(3):391-405. Cronin, G., K. D. Wissing and D. M. Lodge 1998. Comparative feeding selectivity of herbivorous insects on water lilies: aquatic vs. semi-terrestrial insects and submersed vs. floating leaves. Freshwater Biol. 39:243257. Crowson, R. A. 1981. The Biology of Coleoptera. Academic Press, London. 802 pp. Crowson, R. A. 1994. A long perspective on chrysomelid evolution. In: P. Jolivet, M. L. Cox, and E. Petitpierre (Eds.) Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publ., Dordrecht, XIX-XXIII. Danforth, B. N., J. Ascher and R. S. Anderson 1999. Flowers and insect evolution. Science 283:143. Derenne, E. 1963. Catalogue des Coléoptères de Belgique. Fasc. IV. Chrysomeloidea. Chrysomelidae. Soc. R. Ent. Belg., Bruxelles, 104 pp. Dieckmann, L. 1972. Beiträge zur Insektenfauna der DDR : Col. Curculionidae, Ceutorhynchinae. Beiträge zur Entomologie 22:3-128. Doguet, S. 1994. Coléoptères Chrysomelidae. 2: Alticinae. Faune de France, Paris 80:1-694. Doyen, J. T. and G. Ulrich 1978. Aquatic Coleoptera, pp. 203-231. In: R. W. Merritt and K. W. Cummins (Eds.). An introduction to the Aquatic Insects of North America. Kendall and Hunt, Dubuque. Dubeshko, L.N. and L. N. Medvedev 1989. Ecology of leaf-beetles of Siberia and the Far East. Moscow. 224 pp.

Subaquatic Chrysomelidae

325

Evans, G. 1975. The life of beetles. George Allen and Unwin, Ltd. 232 pp. Farrell, B. D. 1998. Inordinate fondness explained: Why are there so many beetles? Science 281:555-559. Feldman, R. S. 2001. Taxonomic and size structures of phytophilous macroinvertebrate communities in Vallisneria and Trapa beds of the Hudson River, New York. Hydrobiologia 452:233-245. Frank, J. H. 1996. Fauna de Heliconia bourgaeana. Mem. VI Latinoamericano Congreso de Entomologia, Merida 26-30 mayo 1996:38-39. Frank, J. H. and L. P. Lounibos 1983. Phytotelmata: Terrestrial Plants as Hosts for Aquatic Insect Communities. Plexus Publ. Inc., Medford. 293 pp. Frank, J. H. and L. P. Lounibos 1987. Phytotelmata: Swamps or islands? Florida Ent. 70(1):14-20. Gadeau de Kerville, H. 1886. Evolution et biologie des Bagous binodulus Herbst et Galerucella nymphaeae L. Ann. Soc. Ent. Fr. 6:423-430. Graham, D. 1985. Pattern and control of walking in insects. Advances in Insect Physiology 18:31-140. Gressitt, J.L. and S. Kimoto 1963. The Chrysomelidae (Col.) of China and Korea. 2. Pacific Insects Mon. 1 B:301-1026. Grevstad, F. S. and A. L. Herzig 1997. Quantifying the effects of distance and conspecifics on colonization: experiments and models using the loosestrife leaf beetle, Galerucella calmariensis. Oecologia 110:60-68. Guiz, J. C. and X. Ruiz 1995. Toucans and thrushes as potential dispersers of seed-predatory weevil larvae in Southeastern Brazil. Can. J. Zool. 73:745-748. Guiz, J. C. and X. Ruiz 1997. Weevil larvae dispersal by Guans in Southeastern Brazil. Biotropica 29(4):522525. Habeck, D. H. 1979. Host plant of Pseudolampsis guttata (LeConte). Col. Bull. 33(2):150. Habeck, D. H., K. Haag, and G. R. Buckingham 1986. Native insect enemies of aquatic macrophytes. Moths. Aquatics 8(1):17-22. Habeck, D. H. and R. Wilkerson 1980. The life-cycle of Lysathia ludoviciana (Fall) on parrotfeather Myriophyllum aquaticum (Velloso) Verde. Col. Bull. 34(2):167-170. Harvey, R. 1988. The ecology of arthropod communities associated with Heliconia leaf-curls in Tambopata Wildlife reserve, South Eastern Peru. The Entomologist 107(1):11-19. Hasman, M. and N. Inanc 1957. Investigations on the anatomical structure of certain submerged, floating and amphibious hydrophytes. Rev. Fac. Sci. Univ. Istanbul, Ser. B. Sci. Nat. 22:37-153. Heikertinger, F. 1909. Erweiterung der Kenntnis der Halticinenfauna Niederösterreichs. Verhandl. Der k.-k. zool.-botanischen Ges.Wien 59: 26-28. Hight, S. D., B. Blossey, J. Laing, and R. Declerck-Floate 1995. Establishment of Insect Biological Control Agents from Europe against Lythrum salicaria in North America. Environ. Ent. 24(4):967-977. Hill, M. P. and Oberholzer, I. G. 2002. Laboratory host range testing of the flea beetle, Pseudolampsis guttata (LeConte) ( Col. Chrys. ), a potential natural enemy for red water fern, Azolla filiculoides Lamarck ( Pterid. Azollaceae) in South Africa. Coleopt. Bull. 56(1 ):79-83. Hinton, H. E. 1976. Plastron respiration in bugs and beetles. J. Insect Physiol. 22:1529-155O. Hinton, H. E. 1981. Biology of insect eggs. Pergamon Press, vols. 1-3, 1125 pp. Hippa, H. and S. Koponen 1975. On the damage caused by the species of Galerucella (Col. Chrys.) on cloudberry (Rubus chamaemorus L.) in Finland and Northern Norway. Rep. Kevo Subantarctic Res. Station 12:54-59. Hippa, H. and S. Koponen 1979. Experiments on biological control of leaf beetles (Col. Chrys.) on the cloudberry, (Rubus chamaemorus L.). Rep. Kevo Subarctic Res. Stat. 15:8-10. Hippa, H. and S. Koponen 1986. Morphological, cytological, ecological and ethological evidence of reproductive isolation between Galeruca nymphaeae (L.) and G. sagittariae (Gyll.) (Col. Chrys.) in Fennoscandinavia. Ann. Ent. Fennici 52:49-62.

326

Pierre Jolivet

Hix, R. L., D. T. Johnson and J. L. Bernhardt 2000. Swimming behavior of an aquatic weevil, Lissorhoptrus oryzophilous (Col. Curculionidae). Florida Ent. 83(3):316-324. Hoffmann, A. 1950-1954-1958. Coléoptères Curculionides. Faune de France 52, 59, 62. Paul Lechevalier Publ., Paris, 1839 pp. Hogue, C.L. 1993. Latin American insects and entomology. Univ. Cal. Press, Berkeley, CA. 536 pp. Hölldobler, B. and E. O. Wilson 1990. The ants. Harvard University Press, Boston. 732 pp. Houlihan, D. F. 1969. Respiratory physiology of the larva of Donacia simplex, a root-piercing beetle. J. Insect. Physiol. 15:1517-1536. Hsiao, T. H. and D. M. Windsor 1999. Historical and biological relationships among Hispinae infered from 12S MTDNA Sequence Data, 39-50. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publ., Leiden, The Netherlands. Hussain, M. A. and S. A. Shah 1926. The Red pumpkin beetle Aulacophora abdominalis Feb. and its control; with a short note on A. atripennis Feb. Mem. Dept. Agric. India Ent. Ser. 9. Ihssen, G. 1943. Uber die Lebensweise von Longitarsus nigerrimus Gyllh. Koleopter. Rundschau. 22:253-255. Ikeda, K. and F. Nakasuji 2002. Spatial structure-mediated indirect effects of an aquatic plant, Trapa japonica, on interaction between a leaf beetle, Galerucella nipponensis, and a water strider, Gerris nepalensis. Popul. Ecol. 44:41-47. Issa, S. and K. Jaffe 1999. Hydrolutos : Un género nuevo y cuatro especies nuevas de Lutosini Neotropicales (Orthoptera, Anostostomatidae). Nouv. Rev. Ent. (N. S.), 16(2):111-121. Jäch, M. A. 1998. Annotated checklist of aquatic and riparian/littoral beetle families of the world, pp. 25-42. In: Water Beetles of China (Col.). II. M. A. Jäch and L. Ji (Eds.) Wien. Jacobsen, D. and K. Sand-Jensen 1995. Variability of invertebrate herbivory on the submerged macrophyte Potamogeton perfoliatus. Freshwater Biol. 34(2):257-263. Joannis, M. L. 1866. Monographie des Galérucides, in de Marseul, M. Mémoires d’Entomologie. L’Abeille 3:1508. Jolivet, P. 1986. Les Fourmis et les Plantes. Boubée and Co., Publ., Paris. 254 pp. Jolivet, P. 1993. La Serra do Cipo au Brésil. Bull. ACOREP 17:7-11. Jolivet, P. 1996. Ants and plants. An example of coevolution. Backhuys Publ., Leiden. 303 pp. Jolivet, P. 1997. Biologie des Coléoptères Chrysomélides. Boubée and Co. Publ., Paris. 279 pp. Jolivet, P. and T. J. Hawkeswood 1995. Host plants of Chrysomelidae of the World. Backhuys Publ., Leyden. 281 pp. Jolivet, P. and K. K. Verma 2002. Biology of leaf-beetles. Intercept, Andover, U. K. 332 pp. Jordano, P. 1989. Pre-dispersal biology of Pistacia lentiscus (Anacardiaceae): Cumulative effects on seed removal by birds. Oikos 55:375-386. Joy, N. H. 1910. The behaviour of Coleoptera in time of floods. Trans. Ent. Soc. London 4:379-385. Joy, N. H. 1932 (1976). A practical handbook of British Beetles. 1. Classey Ltd., reprint. 622 pp. Kaufmann, T. 1970. Studies on the biology and ecology of Pyrrhalta nymphaeae (Col. Chrys.) in Alaska with special reference to population dynamics. Amer. Midland Nat. 83(2):496-509. Kelley, J. 1985. Update on Pyrrhalta nymphaeae (Galerucella) in Central Florida. Aquatics 7(4):17. Kevan, D. K. 1967. The British species of the genus Longitarsus Latreille (Col. Chrys.). Ent. Month. Mag. 103(1235-1237):83-110. Khatib, M. H. 1934. The Life-history and Biology of Galerucella birmanica Jac. (Col. Phyt. Chrys. Galer.) and the external morphology of larva and pupa. I. Indian J. Agric. Sci. 4(4):715-732. Khatib, M. H. 1946. Studies in Galerucinae. The external morphology of Galerucella birmanica (Jacoby) (Col. Phyt. Gal.). Indian J. Agric. Sci., pp.1-38.

Subaquatic Chrysomelidae

327

Kimoto, S. 1964. The Chrysomelidae of Japan and the Ryukyu Islands. VI. J. Fac. Agric. Kyushu Univ. 13(2):287400. Kimoto, S. and H. Takizawa 1997. Leaf beetles (Chrysomelidae) of Taiwan. Tokai University Press, Tokyo. 581 pp. Kitching, R. I. 2000. Food webs and container habitats. The natural history and ecology of phytotelmata. Cambridge University Press, Cambridge, U.K. 431 pp. Klausnitzer, B. 1983. Beetles. Exeter Books, Simon and Schuster Publ., New York. 214 pp. Kouki, J. 1991a. Tracking spatially variable resources: An experimental study on the oviposition of the waterlily beetle. Oikos 61:243-249. Kouki, J. 1991b. Small-scale distributional dynamics of the yellow water-lily and its herbivore Galerucella nymphaeae (Col. Chrys.). Oecologia 88:48-54. Kouki, J. 1993. Female’s preference for oviposition site and larval performance in the water-lily beetle,Galerucella nymphaeae (Col. Chrys.). Oecologia 93:42-47. Künnemann. 1918. Kleine Coleopterologische Mitteilungen. Ent. Blätter 14:350. Laboissière, V. 1922. Etude des Galerucini de la Collection du Musée du Congo Belge. Rev. Zool. Africaine 10:1-44. Laboissière, V. 1934. Galerucinae de la Faune Française. Ann. Soc. Ent. Fr. 103:1-108. Langer, C. and B. Messner 1984. Steroscan investigation on plastron of submersly living beetles of the genus Eubrychius and Bagous (Col. Curc.). Zool. Jb. Anat. 111:155-174. La Rivers, I. 1951. The Cerambycoid semi-aquatic Coleoptera of the Nevada area. Great Basin Naturalist 11(3-4):97-104. Lefroy, M. H. 1909. Indian insect life. Calcutta. 786 pp. Lefroy, M. H 1910. Life history of Indian insects. Mem. Dept. Agric. India, Ent. Ser. 2:139-163 Leiler, T. E. 1987. Entwicklung und Lebensweise des Rüsselkäfers Bagous frit Hbst. (Col.) Ent. Bl. Biol. Syst. Käfer 83(1):13-16. Lippok, B., A. A. Gardine, P. S. Williamson and S. S. Renner, 2000. Pollination by flies, bees, and beetles of Nuphar ozarkana and N. advena (Nympheaceae). Amer. J. Bot. 87(6):898-902. Lohse, G. A. 1989. Hydrogaleruca-Studien (Col. Chrys. Gattung Galerucella Crotch). Ent. Blätter 85(1-2):61-69. Lopatin, I. K. 1984. Leaf beetles (Chrysomelidae) of Central Asia and Kazakhstan. Amerind Publ., New Delhi. 416pp. Lopatin, I. K. 1986. Identification book of Chrysomelidae (Coleoptera) of Byelorussia. Minsk. 130 pp. Macedo, M. V., M. R. Ferreira, and T. M. Lewinsohn 1994. Biology and ecology of Mecistomela marginata (Thumberg, 1821), Hispinae, Alurnini, in Brasil, pp. 568-571. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.) Novel Aspects of the Biology of Chrysomelidae. Kluwer Acad. Publ., Dordrecht, Holland. Maes, J.-M. and C. L. Staines 1991. Catalogo de los Chrysomelidae (Col.) de Nicaragua. Rev. Nicar. Entomol. 18:1-53. Machado-Allison, C.E., D. J. Rodriguez, R. R. Barrera and C. Gomez Cova 1983. The insect community associated with inflorescences of Heliconia caribaea Lamarck in Venezuela, pp. 247-270. In: J. H. Frank and L. P. Lounibos (Eds.). Phytotelmata. Plexus Publ. Inc., Medford. Malecki, R. A., B. Blossey, S. D. Hight, D. Schroeder, L. T. Kok and J. R. Coulson . 1993. Biological control of purple loosestrife. Bioscience 43(10):680-686. Manguin, S., R. White, B. Blossey and S. D. Hight, 1993. Genetics, taxonomy, and ecology of certain species of Galerucella (Col. Chrysomelidae). Ann. Ent. Soc. Amer. 86(4):397-410. Mantovani, R., G. Galanti and A. Nocentini 1992. Biological observations on Bagous rufimanus Hoffmann (Col. Curc.) with description of immature stages. Aquatic Insects 14:117-127.

328

Pierre Jolivet

Martinez, A. 1977. Scarabaeidae in Biota Acuatica de Sudamerica Austral. Harlbert Publ., San Diego, CA, pp. 244-245. Massee, A. M. 1961. Notes on the aquatic weevils of the tribe Bagoinae (Col. Curc.). Trans. Kent Field Club 1:143-144. Maulik, S. 1916. On Cryptosome beetles in the Cambridge University Museum of Zoology. Proc. Zool. Soc. London : 567-589. Maulik, S. 1932. On the structure of larvae of hispine beetles. II. Proc. Zool. Soc. London, pp. 293-322. Maulik, S. 1933a. On the structure of larvae of hispine beetles. III. Proc. Zool. Soc. London, pp. 669-680. Maulik, S. 1933b. On the structure of larvae of hispine beetles. IV. Proc. Zool. Soc. London , pp. 935-939, fig. Maulik, S. 1936. Coleoptera Chrysomelidae. Galerucinae. Fauna of British India. Taylor and Francis, London, U.K. 648 pp. Maulik, S. 1937. Distributional correlation between hispine beetles and their host-plants. Proc. Zool. Soc. London A, pp. 129-159. Mayet, V. 1907. Métamorphoses du Malacosoma lusitanicum (Col.). Bull. Soc. Ent. Fr. : 115-117 Medvedev, L. N. 1982. The leaf-beetles of Mongolia Peoples’ Republic. Identification book. Moscow. 304 pp. Medvedev, L.N. and L. N. Dubeshko 1992. Identification book of the leaf-beetles of Siberia. Moscow. 220 pp. Medvedev, L. N. and E. J. Roginskaja 1988. Catalog of host-plants of the leaf-beetles of the USSR. Moscow. 190 pp. Medvedev, L.N. and Y. M. Zaitsev 1978. Identification book of the leaf-beetles of Siberia. Moscow. 184 pp. Medvedev, L. N., Y. M. Zaitsev, J. Adis and O. Rebell 1993. The larva of the neotropical leaf-beetle genus Neolochmaea Laboissière, 1927, with notes on the life-history of N. boliviensis Bechyne, 1955, in Central Amazonian floodplains (Col. Chrys. Gal.). Russian Entomol. J. 2(5-6):33-38. Menier, J. 1970. Modalité natatoire chez Bagous limosus Gyll. (Col. Curc.). C. R. Acad. Sc. Paris D 270:11381140. Merritt, R. W. and K. W. Cummins 1978. An introduction to the aquatic insects of North America. Kendall/ Hunt Publishing Company, Dubuque, Iowa, USA. 441 pp. Messner, B. 1982. Die Plastronatmung bei den Käfern Macoplea mutica (Col. Chrys.) und Elmis aenea (Col. Dryop.). Zool. Jb. Anat. 107 :458-464. Messner, B. and C. Langer 1984. Respiratory elytra as adaptation of beetles living in water. Zool. J. Anat. 111:469-484. Mohr, K. H. 1960. Erdflöhe.- Wittenberg. Neue Brehm Bücherei. 261pp. Mohr, K. H. 1962. Bestimmungtabelle und Faunistik der mitteleuropaischen Longitarsus-arten. Ent. Blätt. 58(2):55-118. Monros, F. and M. J. Viana, 1947. Revision sistematica de los Hispidae Argentinos (Ins. Col.). Anal. Mus. Argent. Cien. Natur. « Bernardo Rivadavia ». Entom. 162:9-324. Morris, M.G. 1960. Species of weevils to illustrate the adaptations to aquatic life. Proc. S. London Ent. Nat. Hist. Soc. p. 43. Morris, M. G. 1963. Notes on Huntingdonshire weevils (Col. Curc.), with special reference to Monks Wood and Woodwalton Fen National Nature Reserves. Ent. Gazette 14:129-139. Morris, M. G. 1976a. An introduction to the biology of weevils (Presidential address). Proc. Brit. Ent. Nat. Hist. Soc. 9:66-82. Morris, M. G. 1976b. A note on the habits of Rhinoncus albicinctus Gyll. (Col. Curc.). Ent. Month. Mag. 111:14. Morris, M. G. 1991. Weevils. Richmond Publ. Co., Ltd., Slough. 76 pp. Morris, M. G. 1995. Surface swimming in some Curculionidae. Mem. Ent. Soc. Wash. 14:129-136.

Subaquatic Chrysomelidae

329

Morrison, G. and D. R. Strong 1981. Spatial variations in egg density and the intensity of parasitism in a Neotropical chrysomelid (Cephaloleia consanguinea). Ecol. Ent. 6:55-61. Naeem, S. 1988. Predator-prey interactions and community structure: Chironomids, mosquitoes and copepods in Heliconia imbricata (Musaceae). Oecologia 77:202-209. Naeem, S. 1990. Resource heterogeneity and community structure: A case study in Heliconia imbricata Phytotelmata. Oecologia 84:29-38. Nilsson, A. 1996. Aquatic Insects of North Europe. A taxonomic handbook.1. Apollo Books, Stenstrup. 274 pp. Nokkala, C. and Nokkala, S. 1994. Sympatric speciation in Galerucella, pp. 259-262. In: P. Jolivet, M. L. Cox, and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Acad. Publ., Dordrecht, Holland. Nokkala, C. and S. Nokkala 1996. Genetic isolation within Galerucella nymphaeae species complex. Hereditas 124:294. Nokkala, C. and S. Nokkala 1998. Species and habitat races in the chrysomelid Galerucella nymphaeae species complex in northern Europe. Ent. Exper. Appl. 89:1-13. Nokkala, C., S. Nokkala and A. Nordell-Paavola 1998. European and North American populations of Galerucella nymphaeae (Col. Chrys.): two separate species revealed by chorion polypeptide analysis. Eur. J. Entomol. 95 (2): 269-274. Nordell-Paavola, A., S. Nokkala, S. Koponen and C. Nokkala 1999. The utilization of chorion ultrastructure and chorion polypeptide analysis in recognizing taxonomic units in North European Galerucini (Col. Chrys.), pp. 95-104. In: M. L. Cox (Ed.) Advances in Chrysomelidae Biology I. Backhuys Publ., Leiden, The Netherlands. Nötzols, R., B. Blossey and E. Newton 1998. The influence of below ground herbivory and plant competition on growth and biomass allocation of purple loosestrife. Oecologia 113:82-93. O’Brien, C. W. 1981. The larger Listronotus of America, North of Mexico (Curculionidae, Col.) Trans. Amer. Entomol. Soc. 107:69-123 O’Brien, C. W. and G. B. Marshall 1979. U. S. Bagous, bionomic notes, a new species and a new name. Southwestern Entomol. 4:141-149. Ogloblin, D. A. 1936. Chrysomelidae, Galerucinae. Faune de l’URSS. Insectes, Coléoptères 26 (1). Acad. Sc. URSS, Moscow-Leningrad. 455 pp. Otto, C. and J. B. Wallace 1989. Life cycle variation and habitat longevity in waterlily leaf beetles. Horlarct. Ecol. 12:144-151. Palmen, E. 1975. Zur Systematik finnischer Chrysomeliden 1. Gattung Galerucella Crotch. Ann. Ent. Fenn. 11(2):140-147. Pappers, S. M., H. van Dommelen, G. van der Velde, and N. J. Ouborg 2001. Differences in morphology and reproductive traits of Galerucella nymphaeae from four host plant species. Ent. Exper. Appl. 99(2):183-191. Pappers, S. M., van der Velde, G. and Ouborg, N. J. 2002. Host preference and larval performance suggest host race formation in Galerucella nympaeae. Oecologia 130:433-440. Parri, S., R.V. Alatalo and J. Mappes 1998. Do female leaf beetles Galerucella nymphaeae choose their mates and does it matter? Oecologia 114(1):127-132. Paulian, R. 1988. Biologie des Coléoptères. Lechevalier-Masson Publ., Paris. 719 pp. Paulian, R. 1993. Les Coléoptères à la conquête de la Terre. Boubée and Co., Publ., Paris. 246 pp. Peck, S. B. and M. C. Thomas 1998. A distributional checklist of the beetles (Coleoptera) of Florida. Arthropods of Florida and Neighboring Land Areas 16, FDACS Ent. Contr. 862:1-180. Picado, C. 1913. Les Broméliacées épiphytes comme milieu biologique. Bull. Sci. France et Belgique 47 : 215360.

330

Pierre Jolivet

Poot, P. 1972. Dicranthus elegans F. Ent. Bl., Biol. Syst. Käfer 68:188-189. Pruthi, H. S. 1969. Textbook of agricultural entomology. New Delhi. 977 pp. Read, R. W. J. 1978. Records of Curculionidae (Col.) from West Cumbria. Entom. Gaz. 29:76. Read, R. W. J. 1982. Swimming behaviour in Hypera rumicis (Linnaeus) (Col. Curc.). Entom. Record 94:160-161. Read, R.W. J. 1992. Swimming in Phaedon cochleariae (F.) (Chrys.). Coleopterist 1(3):27-28. Richardson, B. A. 1999. The bromeliad microcosm and the assessment of faunal diversity in a Neotropical forest. Biotropica 31(2):321-336. Richardson, B. A. and G. A. Hull 2000. Insect colonisation sequences in bracts of Heliconia caribaea in Puerto Rico. Ecol. Ent. 25:460-466. Richardson, B. A., C. Rogers and M. J. Richardson 2000. Nutrients, diversity and community structure of two phytotelm systems in a lower montane forest, Puerto Rico. Ecol. Ent. 25:348-356. Richerson, P. J. and A. A. Grigarick 1967. The life-history of Stenopelmus rufinasus (Col. Curc.). Ann. Ent. Soc. Amer. 60(2):351-355. Roudier, A. 1957. Localités nouvelles françaises ou espagnoles de Curculionides. Description d’une sousespèce nouvelle. L’Entomologiste 13(2-3):24-36. Ruter, G. 1937. Les moeurs aquatiques de Bagous subcarinatus Gyll. Rev. Fr. Ent. 4(3):153-157. Ruter, G. 1941. Bagous limosus Gyll. Rev. Fr. Ent. 8:156-157. Saini, R. S. 1964. Histology and physiology of the cryptonephridial system of insects. Trans. R. Ent. Soc. Lond. 116(14):347-392. Sankaran, T., D. Srinath and K. Krishna 1967. Haltica coerulea Olivier (Col. Halticidae) as a possible agent of biological control of Jussiaea repens L. Tech. Bull. Common. Inst. Biol. Contr. 8:117-138. Scott, H. M. 1924. Observations on the habits and life history of Gallerucella (sic) nymphaeae (Col.). Trans. Amer. Microsc. Soc. 43:11-16. Seifert, R. P. 1975. Clumps of Heliconia inflorescences as ecological islands. Ecol. 56:1416-1422. Seifert, R. P. 1982. Neotropical Heliconia insect communities. Quart. Rev. Biol. 57:1-28. Seifert, R. P. 1984. Does competition structure communities? Field studies on Neotropical Heliconia insect communities, pp. 54-63. In: D. R. Strong, D. Simberloff, L. G. Abele and A. B. Thistle (Eds.), Ecological communities: Conceptual issues and the evidence. Princeton University Press, Princeton, NJ. Seifert, R. P. and F. H. Seifert, 1976a. A community matrix analysis of Heliconia insect communities. Amer. Natur. 110:462-483. Seifert, R. P. and F. H. Seifert 1976b. Natural history of insects living in inflorescences of two species of Heliconia. J. N. Y. Ent. Soc. 84:233-242. Seifert, R. P. and F. H. Seifert 1979a. A Heliconia insect community in a Venezuelan cloud forest. Ecol. 60:462-467. Seifert, R. P. and F. H. Seifert 1979b. Utilization of Heliconia (Musaceae) by the beetle Xenarescus monocerus (Olivier) (Chrys. Hispinae) in a Venezuelan forest. Biotropica 11:51-59. Selman, B. J. 1994. Eggs and oviposition in chrysomelid beetles, pp. 69-74. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Acad. Publ., Dordrecht, The Netherlands. Servadei, A. 1938. Reperti sulla biologia e morfologia della Galerucella nymphaeae L. (Col. Chrys.). Redia 24:1-31. Setala, H. and Makela, J. 1991. Galerucella nymphaeae (Col. Chrys.) grazing increases Nuphar leaf production and affects carbon and nitrogen dynamics in ponds Oecologia 86:170-176. Shirt, D.B. (ed.). 1987. British Insects Red Data Book. Nature Conservancy Council, London, pp. 233-234. Staines, C. L. 1991. Type species of New World Hispinae genera (Col. Chrys.). Insecta Mundi 5:247-248. Staines, C. L. 1996. The genus Cephaloleia (Col. Chrys.) in Central America and the West Indies. Rev.Biol. Trop. Spec. Publ. 3:1-73.

Subaquatic Chrysomelidae

331

Stewart, C. A., R. B. Chapman, R. M. Emberson, P. Syrett, and C. M. A. Frampton 1999. The effect of temperature on the development and survival of Agasicles hydrophila Selman and Vogt (Col. Chrys.), a biological control agent for alligator weed (Alternanthera philoxeroides). New Zealand J. Zool. 26(1):11-20. Stiles, F. G. 1975. Ecology, flowering, phenology, and hummingbird pollination of some Costa Rica Heliconia species. Ecol. 56:285-301. Strong, D. R. 1977a. Rolled-leaf hispine beetles (Chrys.) and their Zingiberales host plants in Middle America. Biotropica 9(3):156-169. Strong, D. R. 1977b. Insect species richness: Hispine beetles of Heliconia latispatha. Ecol. 58 (3):573-582. Strong, D. R. 1981. The possibility of insect communities without competition: Hispine beetles on Heliconia, pp. 183-194. In: R. F. Denno and H. Dingle (Eds.). Insect life history patterns habitat and geographic variation. Springer-Verlag, New York. Strong, D. R. 1982a. Potential interspecific competition and host specificity: Hispine beetles on Heliconia. Ecol. Ent. 7:217-220. Strong, D. R. 1982b. Harmonious coexistence of hispine beetles on Heliconia in experimental and natural communities. Ecol. 63(4):1039-1049. Strong, D. R. 1983. Chelobasis bicolor (Abejonde Platanillo, Rolled Leaf Hispine), pp. 708-711. In: D. H. Janzen (Ed.) Costa Rican Natural History. University of Chicago Press, Chicago. Strong, D. R. 1984. Exorcising the ghost of competition past: Phytophagous Insects, pp. 3-41. In: D. R. Strong (Ed.), Ecological Communities. Princeton University Press. Strong, D. R. and Wang, M. D. 1977. Evolution of insect life histories and host plant chemistry: hispine beetles on Heliconia. Evolution 31:854-862. Sutton, D.L. 1985. Parrot-feather. Aquatics 7(4):6-10. Tamayo, M., C. W. O. O’Brien, R. P. Creed Jr., C. E. Grue and K. Hamel 1999. Distribution and classification of aquatic weevils (Col. Curc.) in the genus Eubrychiopsis in Washington state. Ent. News 110(2):103-112. Tanaka, M. and F. Nakasuji 2002a. Availability of a Leaf Beetle, Galerucella nipponensis, as Prey for an aquatic predator, Gerris nepalensis. Jpn. J. Appl. Entomol. Zool. 46:44-46. Tanaka, M. and F. Nakasuji 2002b. Dynamic interaction between a leaf beetle, Galerucella nipponensis, and aquatic plant, Trapa japonica. II. Dispersal behavior of larvae. Popul. Ecol. 44:1-6. Thorpe, W. H. 1950. Plastron respiration in aquatic insects. Biol. Rev. 25:344 -390. Thorpe, W. H. and D. J. Crisp 1949. Studies on plastron respiration IV. Plastron respiration in the Coleoptera. J. Exp. Biol. 26:219-260. Traveset, A. 1993. Weak interactions between insect and avian frugivores: The case of Pistacia terebenthus L. (Anacardiaceae). Vegetatio 107-108:191-203. Van der Hage, J. C. H. 1996. Why are there no insects and so few higher plants in the sea? New thoughts on an old problem. Funct. Ecol. 10:546-547. Verma, K. K. 1969. Functional and developmental anatomy of the reproductive organs in the male of Galerucella birmanica Jac. (Col. Phytophaga Chrysomelidae). Ann. Sci. Nat. (Zool.) Ser. 12° sér., 11(2):139-234. Vestjens, W. J. M. 1979. Notes on the leaf beetle Haltica ignea Blackburn (Col. Chrys. Halt.) at lake Cowal, New South Wales. Aust. Ent. Mag. 5(6):113-114. Vogt, G. B. and H. A. Cordo 1976. Recent South American field studies of prospective biocontrol agents of weeds. Proc. Res. Planning Conf. Aquatic Plant Control Prog., Charleston, SC. US Army Eng. Waterways Exp. Sta. Misc. Paper A-76-1:36-55. Vogt, G. B., J. U. Mc Guire and A. D. Cushman 1979. Probable evolution and morphological variation in South American Dysonichine flea beetles and their Amaranthaceous hosts. USDA Tech. Bull. 1593:1-148.

332

Pierre Jolivet

Vogt, G. B., P. C. Quimby and S. H. Kay 1992. Effects of weather on the biological control of alligatorweed in the Lower Mississipi Valley Region, 1973-1983. USDA Tech. Bull. 1766:1-143. Wallace, J. B. and J. O’Hop 1985. Life on a fast pad: Waterlily leaf beetle impact on water lilies. Ecol. 66:15341544. Warren, P. H. 1993. Insect herbivory on water mint: You can’t get there from here? Ecography 16(1):11-15. Weise, J. 1924. Chrysomelidae. 13. Galerucinae. Col. Cat. Junk-Schenkling (Eds.), Berlin. 225 pp. Weiss, H. B. and E. West 1920. Notes on Galerucella nymphaeae L., the pond-lily leaf-beetle (Col.). Can. Ent. 52(8):237-239. Wesenberg-Lund, C. 1943. Biologie der Süsswasserinsekten. Verlag J. Springer, Berlin. 682 pp. White, D. and W. U. Brigham 1996. Aquatic Coleoptera, pp. 399-473. In: R. W. Merrritt and K. W. Cummins (Eds.), An introduction to the aquatic insects of North America. Dubuque, Kendall/Hunt Publ. White, R. E. 1996. Leaf beetles as biological control agents against injurious plants in North America, pp. 373399. In: P. Jolivet and M. Cox (Eds.), Chrysomelidae Biology 2, Ecological Studies. SPB Academic Publ., Amsterdam, The Netherlands. Wilcox, J. A. 1965. A synopsis of the North American Galerucinae (Col. Chrys.). Bull. N. Y. St. Mus. Sci. Serv. 400:1-221. Wilcox, J. A. 1971. Chrysomelidae Galerucinae. Col. Cat. Suppl., Haag 78(1):1-220. Junk Publ., Den Haag. Wilcox, J. A. 1979. Leaf-beetle host plants in North Eastern North America (Col. Chrys.). World Natural History Publ., Kinderhook, N.Y. 30 pp. Wimmer, W. and P. Sprick 2000. Records of weevils (Col. Curc.) on Myriophyllum species, with special regard to M. heterophyllum Michaux, in Lower Saxony, Germany. Braunsweiger Naturkundliche Schriften 6(1):123130. Yu, Peiyu, S. Wang and X. Yang 1996. Economic insect fauna of China. 54. Col. Chrysomeloidea. II. Science Press, Beijing. 324 pp. Zeiger, C. F. 1967. Biological control of aligatorweed with Agasicles n. sp. in Florida. Hyacinth Control Journal 6:31-34.

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

ABSTRACTS

333

334

David G. Furth, John T. Longino & Maylin Paniagua

This page intentionally left blank

David G. Furth (ed.) 2003 © PENSOFT Publishers Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa 335 Special Rican Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, p. 335

Vertical Stratification of Chrysomelid Faunas in Panama Elroy Charles Tropenbos-Guyana Programme, 12E Garnett St, Campbelville, Georgetown, Guyana. Email: [email protected]. Current Address: 232 South Road, Bourda, Georgetown, Guyana. Email: [email protected]

A community study of Chrysomelidae was conducted at a wet and a dry forest in Panama, in the canopy and understorey. Canopy access was facilitated by construction cranes at both sites. In both forests, a projected area of 8100m2 area was surveyed in the understorey and canopy. During 8 months, sampling effort with beating (n=1000 samples), flight-intercept traps (n=10) was similar in each stratum of each forest type. Chrysomelids collected with beating were tested for feeding on the foliage of the plant from which they were collected. All insects were sorted to morphospecies. In total, 5412 individuals were collected representing 286 species. Although the species richness was similar at the two forest types (176 and 165 species at the dry and wet sites, respectively), their abundance and species diversity differed significantly between the two sites (3313 individuals collected in the dry forest). Thirteen subfamilies were represented with Alticinae, Eumolpinae, Cryptocephalinae and Galerucinae being the most abundant and diverse groups. Cassidinae, Cryptocephalinae, Eumolpinae and Hispinae were more abundant in the dry forest. Over 70% of the number of individuals at each site were collected from the canopy, which was more diverse than the understorey at both sites. At the dry site, Hispinae and Megascelinae were more abundant within the understorey than in the canopy, whereas Cryptocephalinae and Lamprosomatinae showed the reverse. Out of 29 common species (n ; 16 individuals), 13 species were more abundant in the canopy, 8 species were more abundant in the understorey, and 8 species were indifferent with regard to the strata. At the wet forest site, Alticinae, Chlamisinae, Crytocephalinae, Eumolpinae, and Lamprosomatinae were more abundant in the canopy than in the understorey. Out of 26 common species, 18 species were more abundant in the canopy, 3 species were more abundant in the understorey, and 5 species were indifferent with regard to the strata. Some of the species collected were host-specific, whilst others were generalists. The production of young leaves and flowers was significantly higher in the canopy than the understorey at both forest sites. This may explain some of the differences observed in chrysomelid faunas between the two strata. At both forest sites, the proportion of non-feeding individuals was significantly higher in the understorey than in the canopy. This suggests that food resources may be more scattered in the understorey than in the canopy and the implications for chrysomelids resident in the two strata are shortly discussed. Index terms: Canopy; Chrysomelidae; Species diversity ; Stratification

© PENSOFTDavid Publishers 336 G. Furth, John T. Longino & Maylin Paniagua Sofia - Moscow

David G. Furth (ed.) 2003 Special Topics in Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, p. 336

Systematic position of two polymorphic species of chelymorpha Boh. (Coleoptera: Chrysomelidae: Cassidinae) J. Vasconcellos-Neto 1, D. Windsor 2, Z. J. Buzzi 3 and V. Rodriguez 2 1

Universidade Estadual de Campinas - Inst. Biologia - Depto. Zoologia. Campinas, SP, Brazil, 13083-970. E-mail: [email protected] 2 Smithsonian Tropical Research Institute, Apartado 2072, Balboa, Panama. 3 Universidade Federal do Paraná, Dpto de Zoologia, 80000 Curitiba,PR,Brazil.

The genus Chelymorpha, first mentioned by Chevrolat Dej. Cat., was created by Boheman (1854 in the second volume of Monographia Cassidarum. According to Spaeth (1909) the essential characteristics of the genus are the head not totally hidden under pronotum; conformation of antennal groove and the ventral side of the pronotum adjacent; the conformation of pronotal bases, the tooth of the tarsal claws and the absense of one line of punctuations separating the discal margin form the disc. The strange conformation of the prosternum cannot be considered as essential character of the genus because there exist modifications in some species as in some individuals. Chelymorpha has 101 species, distributed between Patagonia and Canada (Blackwelder, 1946) the genus received relatively little attention; only five studies on the biology os species in this group are known. Some valid species are really chromatic forms within a single highly polymorphic species. Zollessi (1968) and Vaio et al. (1975) described the morphological variability existing within C. variabilis. VasconcellosNeto (1987, 1988) studied the genetic bases of eight morphological forms of C. cribraria. Windsor also studied three forms of C. alternans occurring in Panama. Utilizing information from genetic crosses, external morphology and internal genitalic morphology, we found at least 14 Chelymorpha species existing in diverses localities of south America should be united under a single name, Chelymorpha cribraria F. 1775. We also found three species in Central America should be unified, at least temporarily, under the name Chelymorpha alternans Boh. 1854 . Interspecific mating was easily obtain under laboratory conditions, and both species of females laid infertile eggs.

David G. Furth (ed.) 2003 © PENSOFT Publishers Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa 337 Special Rican Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, p. 337

Phylogeny and Biogeography of the Genus Procalus (Clark) (Chrysomelidae : Alticinae) V. Jerez Depto. de Zoología, Facultad de Ciencias Naturales y Oceanográficas, Univ. de Concepción, Casilla 160-C. Concepción. CHILE. E-mail: [email protected]

The genus Procalus is a small genus of flea beetles represented by nine species: P. mutans, P. viridis, P. lenzi, P. reduplicatus, P. malaisei, P. silvai, P. artigasi, P. ortizi and P. vilosensis . This genus is endemic to Austral South America associated with the genera of Anacardiaceae, Lithrea and Schinus. The area of distribution of Procalus and its host plants, is included in the eco-region named Mediterranean zone or Central Chile, characterized by a high percentage of endemic fauna and flora. The objectives of this article are to test the monophyly of Procalus, to identify characters shared by two or more species within the genus and to discuss biogeographic distribution. In this work, a phylogenetic analysis of Procalus was done by means Hennig 86 (Farris,1988) using morphological and biological characters of adults, eggs and larvae stage of all species. The cladistic analysis resulted in a parsimonious tree of 114steps. (CI: 0.56, RI: 0.42) that allows to establish the monophylly of Procalus, supported by eight synapomorphies:(1) association with Anacardiaceae, (2) mandibles of males with a tuberculate mola, (3) sternite VIII of males with a concavity, (4) metafemoral spring constant, (5) egg shell constituted by a simple extra chorion (6) mycropyle indistinct, (7) larvae with the anterior margin of labrum emarginate and (8) egg bursters present in mesothorax. By means of PAE (Parsimonious analysis of endemicity), it was determined that some species present large distribution ranges, comprising all the Mesomorphic zone of Chile; contrarily other species have more restricted distribution areas constituting endemic areas. It is hypothesized that the diversification of Procalus, could be due to speciation mechanisms generated in the last glacial period and that the current distribution of the genus could reflect in part their evolutionary history. Index terms: Procalus, Anacardiaceae, phylogeny, biogeography, Chile.

© PENSOFTDavid Publishers 338 G. Furth, John T. Longino & Maylin Paniagua Sofia - Moscow

David G. Furth (ed.) 2003 Special Topics in Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, p. 338

Chemical Defense in Neotropical Leaf Beetles J. M. Pasteels1, D. Windsor2, N. Plasman3, D. Daloze3, J. C. Braekman3 and T. Hartmann4 1 ULB, Animal and Cellular Biology, Av. F. D. Roosevelt, 50, 1050 Brussels, Belgium, [email protected]; 2 STRI, Balboa-Aucon, Panama; 3 ULB, Organic Chemistry; 4 Pharmaceutical Biology, Technical. University, D-38106 Braunschweig, Germany.

Elytral and pronotal defensive secretions were investigated in the genera Platyphora, Desmogramma, Calligrapha, Zygogramma and Stylodes. Triterpenic saponines are secreted by Platyphora spp. and Desmogramma conjuncta together with idiosyncratic compounds. Besides, several Platyphora spp. feeding either on Asteraceae, Boraginaceae or Apocynaceae, sequester from their host-plants pyrrolizidine alkaloids of the lycopsamanine type. The secretions of Calligrapha, Zygogramma and Slylodes spp. are characterized by the presence of cardenolides. The biosynthetic origins of these compounds are discussed. The evolution of host-derived and autogenous defense in Neotropical leaf beetles and the evolution of host-shifts are discussed and compared to those recognized in European Chrysolinina. The current classifications of Chrysomeline leaf beetles are assessed in the light of these results. Index terms: Chrysomelidae, chemical defense, sequestration, host-plant relationship, evolution.

David G. Furth (ed.) 2003 © PENSOFT Publishers Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa 339 Special Rican Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, p. 339

Molecular Phylogeny of the Genus Cyrtonus (Coleoptera: Chrysomelidae) I. Garneria, C. Juan and E. Petitpierre Lab. Genètica, Dept. Biologia, UIB, 07071 Palma de Mallorca (Spain). E-mail: [email protected]

The genus Cyrtonus comprises some 40 species mainly inhabiting the Iberian Peninsula, three of which can also be found in France. Furthermore, one species lives in Morocco and another in the Balearic Islands. There is not a phylogenetic hypothesis available for this genus. The objective of this research is to elucidate the phylogenetic relationships within the genus Cyrtonus. A fragment of 509 bp of mitochondrial 16S rDNA was sequenced in 14 species. Two species were used as outgroups, one of Chrysolina and another of Timarcha. Phylogenetic trees were constructed using methods of maximum parsimony and maximum likelihood. The results were compared with the chromosomal data available for 11 species. In general, the chromosomal number is congruent with the phylogenetic tree except for C. cylindricus and C. contractus, both with 2n = 28 chromosomes but related to taxa with 2n = 40. Thus, the diploid number seems to have evolved from 28 to 40 chromosomes. Index Terms: 16S rDNA

Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Lepidoptera of Israel: Noctuidae (Pensoft Series Faunistica)

Forest And Dragonflies: 4th Wda Symposium of Odonatology, Pontevedra, Spain, July 2005 (Faunistica) (Pensoft Series Faunistica)

Distributional Atlas & Catalogue of the Leaf Beetles of Bulgaria: (Coleoptera: Chrysomelidae) (Faunistica)

Sea Slugs of the Red Sea (Pensoft Series Faunistica)

Zoogeography of Bulgaria Bibliography: Scroll 1 (Pensoft Series Faunistica)

Dragonflies and Damelflies of South Africa (Pensoft Series Faunistica)

BIOMAT 2009 : International Symposium on Mathematical and Computational Biology, Brasilia, Brazil, 1-6 August 2009

Proceedings of the Ninth International Symposium on Cyclodextrins

The Millipedes (Diplopoda) of the Asian Part of Russia (Pensoft Series Faunistica)

Catalogue of the Malaysian Chrysomelidae (Insecta: Coleoptera) (Faunistica)

Proceedings of the International Congress of Mathematicians, August 21-29, 1990, Kyoto, Japan (International Congress of Mathematicians Proceedings)

Special Topics in the Theory of Piezoelectricity

Special Topics in the Theory of Piezoelectricity

Advances in Bioinformatics and Computational Biology: Second Brazilian Symposium on Bioinformatics, BSB 2007, Angra dos Reis, Brazil, August 29-31,

Proceedings of the 25th International Congress of Papyrology, Ann Arbor, July 29-August 4, 2007

Frontiers of Fundamental Physics : Proceedings of the Sixth International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Leaf Of The Lotus

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Annotated Catalogue of the Carabid Beetles of Albania (Coleoptera: Carabidae): v. 64 (Pensoft Series Faunistica)

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Computer mathematics : proceedings of the Fourth Asian Symposium (ASCM 2000)

Characterisation of Porous Solids VIII: Proceedings of the 8th International Symposium on the Characterisation of Porous Solids (Special Publication)

Proceedings of the symposium on algebraic geometry in East Asia

Smart Graphics: 9th International Symposium, SG 2008, Rennes, France, August 27-29, 2008, Proceedings

Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Lepidoptera of Israel: Noctuidae (Pensoft Series Faunistica)

Forest And Dragonflies: 4th Wda Symposium of Odonatology, Pontevedra, Spain, July 2005 (Faunistica) (Pensoft Series Faunistica)

Distributional Atlas & Catalogue of the Leaf Beetles of Bulgaria: (Coleoptera: Chrysomelidae) (Faunistica)

Sea Slugs of the Red Sea (Pensoft Series Faunistica)

Zoogeography of Bulgaria Bibliography: Scroll 1 (Pensoft Series Faunistica)

Dragonflies and Damelflies of South Africa (Pensoft Series Faunistica)

BIOMAT 2009 : International Symposium on Mathematical and Computational Biology, Brasilia, Brazil, 1-6 August 2009

Proceedings of the Ninth International Symposium on Cyclodextrins

The Millipedes (Diplopoda) of the Asian Part of Russia (Pensoft Series Faunistica)

Catalogue of the Malaysian Chrysomelidae (Insecta: Coleoptera) (Faunistica)

Proceedings of the International Congress of Mathematicians, August 21-29, 1990, Kyoto, Japan (International Congress of Mathematicians Proceedings)

Special Topics in the Theory of Piezoelectricity

Special Topics in the Theory of Piezoelectricity

Advances in Bioinformatics and Computational Biology: Second Brazilian Symposium on Bioinformatics, BSB 2007, Angra dos Reis, Brazil, August 29-31,

Proceedings of the 25th International Congress of Papyrology, Ann Arbor, July 29-August 4, 2007

Frontiers of Fundamental Physics : Proceedings of the Sixth International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Leaf Of The Lotus

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Annotated Catalogue of the Carabid Beetles of Albania (Coleoptera: Carabidae): v. 64 (Pensoft Series Faunistica)

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Computer mathematics : proceedings of the Fourth Asian Symposium (ASCM 2000)

Characterisation of Porous Solids VIII: Proceedings of the 8th International Symposium on the Characterisation of Porous Solids (Special Publication)

Proceedings of the symposium on algebraic geometry in East Asia

Smart Graphics: 9th International Symposium, SG 2008, Rennes, France, August 27-29, 2008, Proceedings

Recommend Documents