International Review of Cytology, Volume 83

INTERNATIONAL REVIEW OF CYTOLOGY VOLUME83 ADVISORY EDITORS DONALD G. MURPHY H. W. BEAMS ROBERT G. E. MURRAY HOWARD A...

Author: Geoffrey H. Bourne | James F. Danielli

9 downloads 2136 Views 17MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

INTERNATIONAL

REVIEW OF CYTOLOGY VOLUME83

ADVISORY EDITORS DONALD G. MURPHY H. W. BEAMS ROBERT G. E. MURRAY HOWARD A. BERN RICHARD NOVICK GARY G. BORISY ANDREAS OKSCHE PIET BORST MURIEL J. ORD BHARAT B. CHATTOO VLADIMIR R. PANTIC STANLEY COHEN W. J. PEACOCK RENE COUTEAUX DARRYL C. REANNEY MARIE A. DIBERARDINO LIONEL I. REBHUN CHARLES J. FLICKINGER JEAN-PAUL REVEL OLUF GAMBORG M. NELLY GOLARZ DE BOURNE JOAN SMITH-SONNEBORN WILFRED STEIN YUKIO HIRAMOTO HEWSON SWIFT YUKINORI HIROTA K. TANAKA K. KUROSUMI DENNIS L. TAYLOR GIUSEPPE MILLONIG TADASHI UTAKOJI ARNOLD MITTELMAN AUDREY MUGGLETON-HARRIS ROY WIDDUS ALEXANDER YUDIN

INTERNATIONAL

Review of Cytology EDITED BY

G. H. BOURNE

J. F. DANIELLI

St. George’s University School of Medicine

Danielli Associates Worcester, Massachusetts

St. George’s, Grenada

West lndies

ASSISTANT EDITOR K. W. JEON Department of Zoology University of Tennessee Knoxville, Tennessee

VOLUME83

1983

ACADEMIC PRESS

A Subsidiary of Harcourt Brace Jovanovich. Publishers

New York London Paris San Diego San Francisco SBo Paulo Sydney Tokyo Toronto

0

COPYRIGHT 1983, BY ACADEMIC PRESS, INC. ALL RIGHTS RESERVED. NO PART OF THIS PUBLICATION MAY BE REPRODUCED OR TRANSMITTED IN ANY F O R M OR BY ANY MEANS, ELECTRONIC OR MECHANICAL, INCLUDING PHOTOCOPY, RECORDING, OR ANY INFORMATION STORAGE AND RETRIEVAL SYSTEM, WITHOUT PERMISSION IN WRITING FROM THE PUBLISHER.

ACADEMIC PRESS, INC. 111 Fifth Avenue, New York,

New York 10003

Uniied Kingdom Edition published by ACADEMIC PRESS, INC. ( L O N D O N ) LTD. 24/28 Oval Road, London NWl 7DX

LIBRARY OF

CONGRESS CATALOG CARD

NUMBER: 52- 5203

I S B N 0-12-364483-6 PRINTED IN THE UNITED STATES OF AMERICA 83 84 85 86

9 8 1 6 5 4 3 2 1

Contents CONTRIBUTORS .............................................................

vii

Transposable Elements in Yeast VALERIE MOROZWILLIAMSON

I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yeast Transposable Element Ty ................................. Other Transposable Elemen .................. ...... IV. Discussion ...... ................................. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. 111.

1

2 20 21 23

Techniques to Study Metabolic Changes at the Cellular and Organ Level ROBERTR. DEFURIAA N D MARYK. DYGERT

I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nuclear Magnetic Resonance Spectroscopy as a Method to Study Adenosine Triphosphate Metabolism at the Organ Level . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Relationship of the Energetic State of Cells and Their Biology.. . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

27

11.

28 46 60

Mitochondrial Form and Function Relationships in Vivo: Their Potential in Toxicology and Pathology ROBERTA. SMITHA N D MURIELJ. ORD

............... 1. Introduction ........................ 11. The Chondriome of the Eukaryotic Cell.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 111. Mitochondrial Cristae c Activity ....................... IV . The Form of the Chon V. Mitochondrial Inclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI . The Potential of Modem Staining Methods in Monitoring Mitochondrial Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VII. Mitochondriagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ........................................ VIII. Concluding Remarks References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. Note Added in Proof . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . .

V

63 64 76 85 101

109 118

122 125 134

vi

C0NT EN T S

Heterogeneity and Territorial Organization of the Nuclear Matrix and Related Structures M. BOUTEILLE, D. BOUVIER, AND A. P. SEVE

............................................... I. Introduction 11. Definitions . ..... 111. Toward an Anatomy of atin St ........................... IV. Role of Nonchromatin Structures in Nuclear Organization. . . V. Involvement of Nonchromatin Structures in Gene E VI. Three-Dimensional Organization of Nonchromatin Structures . . . . . . . . . . . . . . . . . VII. Prospects on Nonchromatin Structure Characterization Based on ......... Fractionation Experiments. ............................... VIII. Conclusion . . . . . . . . . . . . . ... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

135 137

160 166 177

Changes in Membrane Properties Associated with Cellular Aging A. MACIEIRA-COELHO

.......................................

183

11. Cell Volume.. . . . . . . . . . . . . . . . . 111. Adhesion.

IV. V. VI. Vil.

Mechanis Relationship between Cell-Substra Putative Mechanisms for Membrane-Dependent Manifestations of Aging., . . . . . . .......... Conclusions . . . . . . . . . . . . . . . . . . References .....................................................

212 215 217

Retinal Pigment Epithelium: Proliferation and Differentiation during Development and Regeneration OLGAG . STROEVAA N D VICTOR I. MITASHOV Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell Proliferation in Growth and Differentiation of the Retinal Pigment Epithelium in High Vertebrates and Humans.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Proliferation of Pigment Epithelium Cells in Process of Retinal and Lens Regeneration. . . ........... IV. General Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . 1. 11.

INDEX. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CONTENTSOF RECENTVOLUMESAND SUPPLEMENTS. .............................

22 I 223 263 285 287 295 299

Contributors

Numbers in parentheses indicate the pages on which the authors' contributions begin.

M. BOUTEILLE ( 1 35), Laboratoire de Pathologie Cellulaire, Institut Biome'dical des Cordeliers, 75270 Paris Cedex 06, France D. BOUVIER ( 1 3 9 , Laboratoire de Pathologie Cellulaire, Institut Biome'dical des Cordeliers, 75270 Paris Cedex 06, France ROBERTR. DEFURIA(27), Department of Biology and Biotechnology, Worcester Polytechnic Institute, Worcester, Massachusetts 01609 MARY K . DYGERT(27), Department of Chemistry, Smith College, Northampton, Massachusetts 01060 A. MACIEIRA-COELHO ( 183), Dipartement de Pathologie Cellulaire, Institut de Cancirologie et dlmmunogine'tique (INSERM U 50), 94804 Villejuif, Cidex, France VICTORI. MITASHOV (22 1 ), N. K. Koltzov Institute of Developmental Biology, Academy of Sciences of the USSR, Moscow 11 7808, USSR MURIEL J . ORD(63), Department of Biology, University of Southampton, Southampton SO9 3TU, England, and MRC Toxicology Research Unit, Carshalton, Surrey, England A. P. SEVE( 1 3 3 , Laboratoire de Pathologie Cellulaire, Institut Biome'dical des Cordeliers, 75270 Paris Cedex 06, France

ROBERTA. SMITH(63),Department of Anatomy, University of Glasgow, Glasgow GI2 8QQ, Scotland OLGA G. STROEVA(221), N. K . Koltzov Institute of Developmental Biology, Academy of Sciences of the USSR, Moscow 117808, USSR VALERIE MOROZWILLIAMSON ( l ) , ARC0 Plant Cell Research Institute, Dublin, California 94568

vii

This Page Intentionally Left Blank

INTERNATIONAL REVIEW OF CYTOLOGY, VOL. 83

Transposable Elements in Yeast VALERIEMOROZWILLIAMSON ARC0 Plant Cell Research Institute, Dublin, California Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yeast Transposable Element Ty . . . . . . . . . . . . . . . . . . . . . . A. Physical Structure . . . . . . . . . . . . . . . . . . . . ......... B. Transcription . . . . . . . . . C. Transposition . . . . . . . . . D. Effects of Tyl Insertion ............... E. Associated Gene Conversion. .................... F. Transposable Elements a 111. Other Transposable Elements in Yeast.. ....................... IV. Discussion . . . . . . . . . . . . . . . ................. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

I.

1

11.

10

20 21 23

I. Introduction Transposable elements are DNA sequences that move to new genomic locations at a much higher rate than that of the bulk of the cellular DNA. Such mobile elements were first defined genetically as controlling elements in maize (McClintock, 1952, 1957) and have been studied on the molecular level in diverse organisms, such as bacteria, yeast, and fruit flies (Kleckner, 1977: Carlos and Miller, 1980; Green, 1980; Shapiro and Cordell, 1982). Certain general properties characterize these elements. Physically, these transposable DNAs have a direct and/or inverted repeat of DNA sequence at each end. The ability to cause deletions or chromosomal rearrangements is characteristic of these elements, and many have been shown to affect the expression of chromosomal genes by inserting adjacent to or into these genes. The first transposable element found in the yeast Saccharomyces cerevisiae was named Tyl by Cameron et al. (1979). It was observed as a moderately repetitive DNA sequence, one copy of which was present adjacent to a tyrosine tRNA gene in one yeast strain but not in others. Analysis of the hybridization spectrum of this element to DNA from various laboratory yeast strains indicated that its locations in the yeast genome varied from strain to strain, a finding suggesting that it was transposable. Evidence for transposition was also obtained after prolonged growth at 37°C. Soon after, analysis of mutations in expression of the HIS4 gene, which codes for activities required for histidine biosynthesis, revealed that two unstable His- mutations were caused by insertion of DNA

Copyright 0 1983 by Academic Press. Inc. All rights of reproduction in any form reserved. ISBN 0-12-364483-6

2

VALERIE MOROZ WILLIAMSON

sequences homologous to Tyl upstream from the structural gene (Roeder et al., 1980). Other mutations, such as one that resulted in 20-fold overproduction of iso-2-cytochrome c (Errede et al., 1980a,b) and seven different mutations that altered the expression of alcohol dehydrogenase (Ciriacy, 1976, 1979, Williamson et al., 1981), were also found to be due to insertion of Tyl-like sequences into their regulatory regions. Other genetic phenomena such as deletions, translocations, and inversions were observed in connection with Tyl-like DNA sequences in yeast (Chaleff and Fink, 1980). Similarities are apparent in the features of Tyl , Drosophila transposable elements such as copia, and integrated proviral forms of retroviruses in birds and mammals (see Cold Spring Harbor Symp. Quant. Biol. 45, 1980). These elements are each composed of an internal DNA segment of several thousand base pairs flanked by a direct repeat of a DNA sequence that is several hundred base pairs long. They are bounded by the terminal dinucleotides 5’TG . . . CA3’ and are flanked by direct repeats 4-6 base pairs long, which appear to have been generated by duplication of a target DNA sequence upon integration of the element. All are transcribed into nearly full length polyadenylated RNA. There is evidence that copia, Ty, and proviruses can each alter the expression and regulation of adjacent genes (Bingham etal., 1981: Hayward etal., 1981; Payne etal., 1982). Similarities between Ty, copia, and proviruses are a recurring theme in this article and point to the likelihood that these fascinating elements have a common origin. Saccharomyces cerevisiae is very useful as a eukaryotic model system for molecular biologists. Features of the yeast system that make this organism particularly advantageous include ease of growth, small genome size, availability of selectable markers, ease of genetic manipulation, and availability of techniques for transformation with exogenous DNA (Beggs, 1978: Hinnen et al., 1978). A number of useful shuttle vectors are available, and it is relatively easy to integrate DNA sequences into the yeast genome by homologous recombination. Using these techniques, investigators can, for example, replace a chromosomal DNA sequence with one that has been specifically altered in vitro (Scherer and Davis, 1979). Because of the advantages mentioned earlier, much has been and can be learned from the study of the properties of transposable elements in this organism. 11. Yeast Transposable Element Ty

A. PHYSICAL STRUCTURE Ty is defined as a family of disperse, repetitive DNA sequences, each of which is homologous to the original Ty 1 sequence discovered by Cameron et al. (1979). Ty family members consist of an internal 5.3-kilobase (kb) fragment of DNA [epsilon (E) DNA] bounded by copies of the direct repeat sequence delta

3

TRANSPOSABLE ELEMENTS IN YEAST

RNA

Y M

5.0

15'

FIG. 1. General structure of Ty element DNA. Black bars represent the delta ( 8 ) sequences, which are present in directly repeated orientation; white bar represents the epsilon (e) region, and dashed lines represent chromosomal DNA sequence. A 5-base pair sequence of target DNA is duplicated upon transposition and one copy is present at each end after Ty integration. Arrows represent length and direction of the major RNA transcripts that have been characterized (Elder et a / ., 1982). Numbers represent the lengths of the nucleic acid sequences shown in kilobases (kb).

( 6 ) , which is about 0.3 kb long (Fig. 1). Members of this family have been observed as single units on several different chromosomes in yeast. Cameron et al. (1979) isolated from a yeast genomic library DNA clones that contain parts of two adjacent elements, a finding indicating that Ty copies also occur either tandemly or as free circles. Approximately 30 copies of the complete element per haploid genome are present in most laboratory strains of S. cerevisiae, although the number and,distribution of the copies varies from strain to strain (Cameron er al., 1979; Eibel et al., 1980; Fink et al., 1980). The number of Ty copies in wild-type isolates of S . cerevisiae is in general lower than in laboratory strains. Eibel et al. (1980) examined 21 natural isolates and found that the number of copies of Ty ranged from 4 to 20. Saccharomyces norbensis, which is closely related to standard laboratory strains of S. cerevisiae and produces viable spores when crossed with S. cerevisiae strains, appears to have no sequences that strongly hybridize to the epsilon region of Ty (Fink et al., 1980). Its genome does, however, contain sequences that hybridize with a probe for the delta sequence (Roeder and Fink, 1982b). Numerous Ty elements have been cloned, and many others have been studied indirectly by analyzing Southern hybridization profiles using adjacent DNA sequences as probes. The length of most of the Ty DNA sequences is about 5.9 kb. However, others may differ in length; for example, the cloned element Tyl-17 (Kingsman et a l . , 1981) is somewhat longer because of an insertion near its right end. A comparison of the restriction enzyme cleavage maps of several cloned Ty elements is given in Fig. 2. Significant sequence heterogeneity, as reflected by restriction site polymorphism, exists among Ty elements. The restriction maps shown, as well as Southern analyses and heteroduplex analyses, allow division of these elements into two broad classes. The first class is exemplified by element Tyl(S13) (Fig. 2). Elements of this class generally contain one or two EcoRI sites. Those that have been tested cross-hybridize strongly to the original Tyl, which is adjacent to the Tyr tRNA-coding gene. Elements of the second

4

VALERIE MOROZ WILLIAMSON

Class 1 (Tyl) X Bg S

EE

b

b

Bg S

H

E

Bg

S

Bg

1

I

I

I

1

1

I

I

I

I

I

1

1

Bg

EE

I

1

1

I

I

1 1

I

I

I

H

EE

Bg

I

1

I

1 1

I

I

I

I

&l

I

EE

Bg

S

Bg

I 1

I

I

1

I

I

I

E I I

Bg I

I

I

I

1

1

X Bg S

b

H

B

I

I

H

B

X

& Ty ADH2-2';

I

I

I I

Class 2 (Ty2) X Bg S

S Bg

I

I

TyCYC7-H2

I

I I

I

Ty912

S Bg

I

1

XBgS

x

h T y l (S13)

I

X Bg S

x

X

Bg

Bg

Bg

I

I

I

I

Ty AD1

X Ty ADH2-6';

Ty AD

X

v//////n

Ty 1-161

X

r///////////

rx//7v/A

b

H

Ty 1-17; Ty 917

X

d Ty ADH2-3'

FIG.2. Comparison of cloned Ty elements. Solid bars represent delta sequence; white bars represent epsilon regions. Crosshatched areas indicate the approximate locations of regions that are nonhomologous to Tyl because of insertions (in the case of Tyl-161) or substitutions (for the Class 2 elements). Restriction enzyme cleavage sites are designated as follows: B, BarnHI: Bg, BgllI; E, EcoR1; H, HindIII, S, SalI; and X, XhoI. Only restriction enzyme cleavage sites that have been determined for all the elements shown are presented here. References for these restriction maps are Tyl(S13). Cameron et a/.. 1979, and Eibel et al.. 1980; Ty912 and Ty917, Fink eta/.. 1980, and Roeder and Fink, 1982b; TyCYC7-H2, Errede et al., 1980a,b; TyADH2-2', -3c, -fF, -7c, and -8c, Williamson et al., 1983; and Tyl-161 and Tyl-17, Kingsman e t a / . , 1981.

class contain no EcoRI sites but contain a BarnHI restriction site in the corresponding region. Elements belonging to Class 1 or Class 2 are often referred to as Tyl or Ty2, respectively. In cases where heteroduplex analysis has been done between Tyl and Ty2 elements, two substitution loops are seen (Kingsman et al., 1981 ; Williamson et al., 1983). One substitution of about 1 kb begins about 2 kb from the left end of the Ty elements and encompasses the EcoRI sites of the Class 1 elements and the HindIII and BarnHI sites of the Class 2 elements. Closer examination indicates that there may be some homology within this substitution (V. M. Williamson, unpublished). The second substitution loop is about 2 kb

TRANSPOSABLE ELEMENTS IN YEAST

5

long and begins about 3 kb from the left end of the Ty element. Fink et al. (1980) have shown that a Clul fragment about 1.6 kb long from this region of Ty9 17 does not cross-hybridize to Class 1 Ty elements. Heteroduplex and Southern hybridization studies have shown that this 2-kb region is conserved among Class 1 Ty elements: however, it has not been determined whether the corresponding region is conserved among Class 2 elements. The BglII restriction site shown near the left delta is conserved in all published examples. In fact, the left-most kilobase of DNA sequence appears to be conserved among all Ty elements. The five-base pair (bp) nucleotide sequence TACCA is present in direct repeat orientation at the ends of the epsilon region (i.e., at the delta-epsilon junctions) in both classes of Ty elements (Farabaugh and Fink, 1980; Gafner and Philippsen, 1980; Williamson et a l . , 1983). The proportion of elements in each of the two classes and of restriction site variants within each class varies considerably from strain to strain. For example, genomic blotting analysis by Eibel et al. (1980) indicates that in some yeast strains none of the DNA fragments that cross-hybridize with Tyl appear to contain restriction sites for EcoRI. Two Australian yeast strains that they examined lack at least two of the three BgllI restriction sites shown in Fig. 2 within their Ty elements. Similar experiments by Cameron et al. (1979) suggest that none of the Ty family members in strain S288C contain Hind111 restriction sites and that the fraction of Ty elements containing one versus two EcoRI sites varies from strain to strain. The 330-bp DNA sequence delta, which is found at the ends of all Ty elements, also occurs at other loci in the genome and is present in about 100 copies per genome (Cameron et al., 1979). It is difficult to obtain a good estimate of the number of deltas in a genome because these repetitive DNA sequences occur both as single and clustered units. Cameron et al. (1979) found several delta sequences in a 12.5-kb DNA fragment containing a tyrosine tRNA gene ( S U M ) : sequence analysis has shown that five delta sequences are present as two pairs of inverted sequences and one single delta (Gafner and Philippsen, 1983; Rothstein and Helms, 1982). Another problem in estimating the number of delta sequences in a genome is that some solo delta sequences have diverged in sequence to such an extent that hybridization to a single prototype delta would not be observed (P. Philippsen, personal communication). Recombination between delta sequences at the ends of Ty elements is one potential mechanism for generation of solo delta sequences. In fact, several cases have been observed where a Ty element is lost from a particular place in the yeast genome, leaving behind a single (solo) delta sequence (Roeder et ul., 1980; Ciriacy and Williamson, 1981). It is possible that deltas themselves are transposable, but no evidence for this has been obtained. The DNA sequences of several Ty-associated delta elements have been determined; these are compared in Fig. 3. The deltas at opposite ends of each Ty are

6

VALERIE MOROZ WILLIAMSON 100

TGAGAAAlGGGTGAATGTTGAGATAAlTGTTGGGATlCCAlTGTlGAlAAAGGCTAlAAlATTAGGTATACAGAAl~TAClAGAAGlTClCCTCGAGGAl

AG

G T TG G T TGGT GG AA 1

RAT AAT

AG

1 AT A

1

1

T

A

T T

A A

-

GT

A A

Gl

-

pi1

GG A A 1

T

1

A G AG T

A

.

GT

-

Gl

G

-

2w llAGGAAlCCAlAAAAGGGAAlClGCAATTClACACAAllClATAAAlAlTATl-AlCAl--CGllTlAlATGllAAlAllCAllGAlCClAlTACAllA TC 1 A1 T 1 C AA 1 CG CC TC 1

A

917

1

A 1C TC T A

917 L i R

1

A

AOHZ-ZC,

8C

T 1

TC TC

A A

AT T

AT T

T C AA T C AA

T CG

1 CG

CC CC

T...

.

1 1

lCAAlCCTlGCGlTlCAGCllCCAClAAlllAGAlGACTAlTTCTCAlCATTlGCGlCAlCTTCl-AACACCGlATAlGAlAAlAlAClAGlAACGTAAA 1

Annz-Ic 1 GA

T GA

8C

TA TA T

C C

lACTAGTT~GlAGAlGAlAGT*GAlllTlATlCCAACA

c

A

T T

G G

A A GA

C C

G

G C

FIG. 3. Comparison of the DNA sequence of deltas at the ends of Ty elements. The complete sequence of the TyADH2-2[ delta is shown, and nucleotides that differ from this in the other delta sequences that have been determined are indicated. Ty elements are identified on the left margin, and the sequence is presented such that the 5' to 3' strand (left to right) of Fig. 2 is shown. Where the left (L) and right (R) deltas of a particular Ty element differ, both are presented. A dash (-) indicates that a nucleotide is not present in the delta sequence shown. References for these sequences are as follows: ADH2-2r, -3c, -6l, -7<, -@, Williamson e t a l . , 1983; B10/D15, Gafner and Philipsen, 1980, Ty912 and Ty917, Roeder and Fink, 1982b.

often identical, but in some cases differ by a few nucleotides. Delta sequences are AT rich (about 70%) and vary in length from 333 to 337 base pairs. Regions of patchwork homology between delta sequences occur. For example, the element ADH2-7" delta is identical to the ADH2-2" delta for the first 100 nucleotides but resembles the ADH2-6" delta much more strongly for the following 100 nucleotides (Fig. 3). Some regions of DNA sequence are identical for all Tyassociated deltas. Sequences that are three or more nucleotides long and that are identical for the 18 delta elements diagramed in Fig. 3 are underlined in Fig. 4. Completely conserved sequences of 10 nucleotides or greater are boxed. The possibility that these conserved regions are important for regulation and initiation of transcription, for initiation of translation, and/or for transposition is discussed later. Solo delta sequences are less conserved than Ty-associated deltas, and several changes within the conserved regions are seen (Rothstein and Helms, 1982; P. Philippsen, personal communication). Not only are some regions of delta sequence highly conserved in yeast, but DNA sequence homology exists between delta sequences and the direct repeats at the ends of Drosophila copia

TRANSPOSABLE ELEMENTS IN YEAST

7

elements and retrovirus long terminal repeats (LTRs). The delta sequences are bounded by the nucleotides 5' TG . . . TATTCCAACA 3'. These exact nucleotides also bound the copia element of Drosophila (Eibel et al., 1980; Levis et al., 1980). Retroviruses and copia elements, but not Ty elements, contain somewhat longer and often imperfect inverted repeats at their ends. This homology at the ends and additional sequence homology within the terminal repeats (Ju and Skalka, 1980) has led several scientists to propose a common origin for Ty elements, copia elements, and retroviruses. Copia element direct repeats differ from delta sequences in that they do not occur as solo sequences in the Drosophila genome (Levis et al., 1980).

B. TRANSCRIPTION Ty elements are transcribed into two abundant poly(A) RNA species of about 5.0 and 5.7 kb (Fig. 1). The 5'- and 3'-ends of the 5.7-kb transcripts have been determined (Elder et al., 1983) and are indicated in Figs. 1 and 4. As is the case for other eukaryotic transposable elements and for retroviruses, the terminal direct repeats are involved in initiation and termination, respectively, of transcription (Varmus, 1982). The Ty transcripts are initiated within one delta sequence 93-97 bp from the epsilon region (labeled 3 in Fig. 4), then proceed through the epsilon region and terminate about 295 bases into the other delta (4 in Fig. 4), beyond the

ATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAG TATAATAGTATATGCCACAATCTTMCGTTTACWmTATC

'CCCAACAATJ A T c T c A A C A T T C A C c c A T T T C T c A GGGTTGTTA TAGAGTTGTAAGAGGGTAAAGAGT

FIG. 4. Conserved and functionally important regions of delta sequence. DNA sequence of both strands of delta from TyADH2-2" is shown. Note that the top strand is the complement of the sequence shown in Fig. 3. Sequences of three base pairs or longer that are conserved for all 18 Tyassociated delta sequences represented in Fig. 3 are underlined, and completely conserved regions of 10 bp or longer are boxed. Region 1 in conserved in all Ty-associated deltas, in Drosophila copiu elements, in spleen necrosis virus long terminal repeats, and in yeast sigma elements. Region 2 contains a TATA sequence that is present upstream from several highly expressed yeast genes. Regions 3 and 4 contain transcription initiation and termination sites, respectively. Number 5 indicates the start (ATG) of an open reading frame that proceeds into the Ty element.

8

VALERIE MOROZ WILLIAMSON

sequence corresponding to the transcription initiation site. Because delta sequences of a Ty element are usually identical, transcription of this RNA would require read-through of termination signals. A model involving RNA secondary structure to explain this has been proposed for proviral RNA synthesis (Benz et al., 1980). Because the transcription termination site in the 3' delta is past the transcription initiation site in the 5' delta, the longer Ty RNA species contains direct repeats at its ends (corresponding to the region between 3 and 4 of Fig. 4), as does retroviral genomic RNA. Sequence heterogeneity at the 3'-end of the Ty RNA indicates that many different Ty elements are transcribed (Elder et al., 1983). The size of the transcript and results of R-loop analysis make the presence of large intervening sequences unlikely. The shorter species of RNA appears to be initiated at the same position as the 5.7-kb species, but it terminates within'the epsilon region of the Ty element. These transcripts together account for several percent of the total poly(A) RNA in logarithmically growing or stationary haploid yeast cells (Elder etal., 1980). The level of RNA varies with the mating capability of the cells. Cells that can mate (for example, MATa or MAT CY haploid cells) have high levels of Ty RNA in both log phase and stationary phase. In cells that cannot mate but can sporulate (for example, MAT a/MAT CY diploid cells), the amount of Ty transcript in log-phase cells is about 1/5 that in haploid cells and, in stationary cells, is 1/20 that in haploid cells; The level of 5.0-kb RNA is also lower in nonmating cell types than in mating cell types and is lower in stationary phase than in log phase for both cell types (Elder et al., 1980). About 40 nucleotides downstream from the transcription start site is the beginning of an AUG-initiated open reading frame, which proceeds into the epsilon region of the Ty element (labeled 5 in Fig. 4). Presently it is not certain that translation actually initiates here in the cell, and it is not clear that any proteins are translated from the Ty transcripts. Possibly this sequence codes for a protein involved in transposition or regulation of Ty transcription. It will be interesting to compare any proteins coded for by the two classes of Ty elements. As mentioned earlier and as shown in Fig. 4, several regions of the delta sequence are conserved among Ty-associated delta elements. One of the conserved regions follows the transcription initiation site (3 in Fig. 4), and another includes the translation initiation codon (4 in Fig. 4). About 80 base pairs upstream from the transcription initiation site is another conserved sequence, TATAAA (2 in Fig. 4). This exact sequence is present 80 to 100 base pairs upstream from the transcription initiation sites of a number of other highly transcribed yeast genes, a finding suggesting that this sequence is important for the high level of transcription of yeast genes (Dobson et al., 1982; Russell et al., 1983). A rather long stretch of conserved sequence occurs just upstream from here in the delta sequence, and a function for these sequences in Ty transcription promotion or regulation seems likely. Other conserved regions of delta sequence precede the transcription termination site of the 5.7-kb transcript (Elder er al.,

TRANSPOSABLE ELEMENTS IN YEAST

9

1983); and the sequence TAGT, which may be important for transcription termination in yeast (Zaret and Sherman, 1982), is present in one of these conserved regions. C. TRANSPOSITION As do most other transposable elements, Ty generates duplications of target DNA at the site of its integration. Investigators that work with bacterial transposable elements propose that this short repeat is generated by the integration process (Grindley and Sherratt, 1979; Shapiro, 1979). One mechanism often proposed is that a staggered, double-stranded cut is made in the DNA, the ends of a linear form of a transposable element are attached to the protruding end of each strand, and the single-stranded regions are then filled in to produce a short repeat of target DNA at each end of the element. The length of the repeat generated in the target DNA varies for different transposable elements but is characteristic for each particular type of element. In prokaryotes, the length of this repeat ranges from 3 to 12 bp (Calos and Miller, 1980). A 5-bp duplication of target DNA resides at each end of the inserted Ty element. The same size duplication is generated at the site of copia and SNV (spleen necrosis virus) provirus insertion. These three elements each contain the sequence CAACA at the end of the direct repeat sequence, and it has been suggested that this sequence may be common to eukaryotic transposable elements that generate 5-bp repeats (Levis et al., 1980). When a Tyl element is transposed, a copy appears to remain at the original location (Cameron et al., 1979). This implies that, as is true for bacterial transposable elements, replication is involved in the transposition process (Calos and Miller, 1980). The structural similarity between the nearly full length RNA species transcribed from Ty elements and the retrovirus RNA genomes suggests that the Ty RNA species may act as an intermediate in transposition by mechanisms similar to proviral integration. The steps in this pathway have been studied extensively in retroviruses (reviewed by Varmus, 1982). Retroviral RNA genomes are reverse-transcribed into double-stranded DNA molecules before integration into the host genome. The primer for the reverse-transcription process is a tRNA species that is complementary to a sequence of DNA adjacent to the long terminal repeat of the retrovirus. There is, in fact, homology of the 3’-end of the yeast fMet tRNA with the right epsilon-delta junction of Ty (Eibel el al., 1980). There is also evidence that a free, supercoiled, circular form of the Ty element exists at about one copy per 3 x lo4 yeast cells (P. Ballario, P. Filetici, N. Junakovic, and F. Pedone, personal communication). Extrachromosomal circular copies of the eukaryotic transposable element copia are also found in cultured Drosophilia cells (Flavell and Ish-Horowicz, 1981), but it is not clear in either case that these are involved in transposition. The possibility remains that these

10

VALERIE MOROZ WILLIAMSON

transposition events involve direct replicative transfer of DNA from the donor to the target site, as appears to occur for prokaryotic transposition (Shapiro, 1979; Harshey et al., 1982). The 5-bp duplicated sequence of target DNA, as well as the surrounding DNA in the region of Ty insertion, has been determined for several Ty elements. In some cases short stretches of homology of target DNA with sequences within the delta have been noted: and in one case a Ty element was found to insert within a solo delta in the opposite orientation (Gafner and Philippsen, 1980). However, for five cases in which the Ty element was found upstream from the ADH2 gene, no extensive homology was seen between delta and the target DNA region (Williamson et al., 1983). It may be that although delta homology can promote Ty integration, homology is not required for integration. One characteristic of all Ty integration sites studied so far is that they are AT rich. It is also significant that all the Ty insertion sites determined so far have been between yeast structural genes rather than within coding regions. Because many of the insertion sequences were identified because of an alteration of adjacent gene expression by Ty insertion, one could argue that the insertion sites observed are biased for intergenic insertion. However, when Eibel and Philippsen ( 1982) examined cleaved genomic DNA from 200 spontaneous lys2- mutants, in no case was there a Ty insertion into the coding sequence, which is 4200 bp long. In two cases, Ty insertion had occurred into the promotor region. Ty elements and 6 sequences are also found in the neighborhood of tRNA genes (Cameron et al., 1979: Gafner et al., 1982; Eigel et al., 1982). Thus one can postulate that certain features of intergenic DNA promote Ty insertion, that coding region DNAs inhibit insertion, or that Ty insertion into a coding region is detrimental to the cell beyond inactivation of that gene.

D. EFFECTSOF Tyl INSERTION ON GENEEXPRESSION Several mutants in S.cerevisiae are altered in gene expression as a result cf insertion of a Ty element upstream from a structural gene. In some cases this insertion has resulted in loss of expression of the adjacent gene. Two mutations, his4-912 and his4-917, have been described where transposition of Ty to a location upstream from the HIS4 gene has produced a His- phenotype (Roeder et a f . , 1980). In one case, the element Ty912 (see Fig. 2) is oriented so that the direction of transcription of the Ty element is the same as that of the affected gene. In the other case, transcription of the Ty element Ty917 is away from the gene. For mutations his4-912 and hid-917, the sites of insertion are 98 and 8 base pairs upstream from the transcription start sites, respectively (Fink et a f . , 1980). Three cases where insertion of a Ty element into the promotor of the LYS2 gene has resulted in reduced expression of LYS2 have also been observed (Eibel

TRANSPOSABLE ELEMENTS IN YEAST

11

and Philippsen, 1982). Many cases have been reported where increased production or altered regulation of the adjacent gene product has resulted from insertion of a Ty element into the 5'-flanking region of a gene. For example, two mutations, CYC7-H2 and CYP3-4, have been described where insertion of Ty results in overproduction of iso-2-cytochrome c (Errede et al., 1980a; Clavilier et al., 1976; Montgomery et al., 1982). Seven different mutations (ADH2-Ic, -2c, -3c, -6c,-7=,8, -99' have been identified in which insertion of a Ty element results in constitutive expression of the glucose-repressible isozyme of alcohol dehydrogenase (ADHII) (Williamson er al., 1981). Six revertants of a his 3 promotor deletion were due to insertion of Ty (Scherer et al., 1982). For all characterized Ty-associated mutations except his#-912, the Ty element is inserted so that the direction of transcription of Ty is away from that of the affected structural gene. In most cases the expression of the associated gene is affected by the mating competence of the yeast strain. Specifically, the 20-fold overproduction of cytochrome c associated with mutation CYC7-H2 is seen in cells with the ability to mate (for example, MAT a or MAT a haploid cells) but only a I- to 4-fold increase is seen in cells incapable of conjugation (i.e., in MAT aIMAT a diploid cells or in haploid cells carrying certain sterile mutations: ste7, s t e l l , and stel2, but not ste.5) (Rothstein and Sherman, 1980; Errede et al., 1980a,b). Cis-dominant overproducing mutations at loci involved in arginine catabolism and urea utilization (CARI, CAR2, and DUR1,2; mutations cargA +Oh,cargB Oh, and durOh, respectively) are affected by the mating condition of the cells in a similar manner (Lemoine et al., 1978; Deschamps and Wiame, 1979). Errede et al. (1980a) proposed the term ROAM (regulated overproducing alleles responding to mating signals) to categorize such mutations. Since then, the two mutations, cargA Oh-1 and cargA +Oh-2, have each been shown to contain a Ty element upstream from the arginase structural gene (Jauniaux et al., 1981, 1982). The mating effect has also been shown to occur for all of the positively affected Ty mutations at the ADH2 locus. However, for ADH2, the ROAM effect is clearly evident only when the cells are grown on a nonfermentable carbon source such as glycerol (Young er al., 1982). Ty-associated mutations have many interesting characteristics that have facilitated investigation of the Ty elements themselves. For example, many of these mutations are unstable, and further changes in gene expression occur spontaneously. These changes in expression are most commonly accompanied by loss of the Ty element with retention of a single delta sequence in front of the gene. +

+

'Designations for alcohol dehydrogenase genes have been changed recently (Michael Ciriacy, personal communication). Therefore, designations here may differ from those presented in earlier publications. The structural gene coding for ADHII has been changed from ADR2 to ADH2. Mutations that overproduce ADHII because of insertion of Ty adjacent to the structural gene ADH2 have been changed from ADR3-2<, ADR3-3c, etc. to ADH2-2c, ADH2-3=, etc.

12

VALERIE MOROZ WILLIAMSON

Other genomic DNA changes such as translocations, inversions, and transpositions have also been associated with alterations in expression of these genes. For example, the Ty-associated His- mutations his4-912 and his4-917 regain a His+ phenotype at high frequencies ( l o p 5 and respectively) (Roeder et al., 1980). These phenotypically His+ yeast strains do not revert to true wildtype expression. They are cold sensitive and recessive for HIS4 expression and have retained a single delta sequence in place of Ty (Chaleff and Fink, 1980; Roeder and Fink, 1980). More complex rearrangements such as translocations, inversions, transpositions, and deletions were associated with the phenotypic reversion when revertants were isolated from a diploid strain homozygous at his4-912 (Chaleff and Fink, 1980; Roeder and Fink, 1980). These will be discussed further in Section II,F. The seven mutants that overproduce ADHII as a result of Ty insertion are also unstable, and the frequency of spontaneous ADHII- derivatives varies considerably (from l o p 3 to lo-'), depending on the particular Ty element and on yeast strain background differences (Ciriacy and Williamson, 1981). Most of these ADHII- derivatives retain a single delta sequence in place of the Ty element and differ from wild type in that they no longer express high levels of ADHII activity under derepression conditions. However, some do express a small amount of ADHII when derepressed. Other ADHII- mutations appear to contain more complex DNA rearrangements similar to those seen with his4-912. Unlinked loci that are involved in Ty-associated gene expression have been identified. Mutations that occur at three different loci and that result in a His+ phenotype associated with Ty-insertion mutations his4-912 and his4-917 have been described (Roeder et a/., 1980). These are called spm for supressor-mutator, after the phenotypically similar system in maize. Mutation spml suppresses the His- phenotype of both his4-912 and his4-917. Mutations spm2 and spm3 suppress the his4-917 mutation but not the his4-912 mutation (Roeder and Fink, 1982b). All three spm mutations suppress the cold sensitivity of the His+ revertants, which carry a single copy of 6. Unlinked reversions of a his3- mutation that has a Ty element 5' to the HIS3 structural gene have also been observed to occur at a high frequency (Scherer and Davis, 1980b). Mutations that occur at four different loci (called tyel -tye4 for Ty effectors) and that reduce expression of Ty-associated ADHIl mutations have been reported (Ciriacy and Williamson, 1981). Dubois et a/. (1982) have isolated unlinked recessive mutations (roc for ROAM mutation~control)in two complementation groups (rocl and roc2); these mutations reduce overproduction in all tested ROAM mutations (cargA Oh; cargB+Oh, durOh, and CYC7-H2). These roc mutations have no affect on the mating ability of the yeast in which they exist. The rocl, roc2, and ste7 mutations also result in reduced Ty RNA levels. Certain mutations conferring sterility, ste7, s t e l l , and stel2, both affect expression of ROAM mutations and alter Tyassociated gene expression. Errede et a/. (1980a,b) have proposed that ROAM +

TRANSPOSABLE ELEMENTS IN YEAST

13

mutations and perhaps some genes required for the mating process may share a positive regulatory determinant (PRD) that is present only in haploid cells. Genetic and functional relationships among the SPM, TYE, R O C , and STE loci have not yet been established. As mentioned earlier, transcription of the Ty element as well as the transcription of ROAM mutations is regulated by the mating condition and perhaps other gene products in the yeast cell. Also, for the ROAM mutations, the direction of transcription of the Ty element is away from the affected gene; thus we have two divergent transcripts that appear to be coordinately regulated by trans-acting elements in the yeast cell. Several examples of coordinately regulated divergent transcripts have been described in yeast, for example, the mating loci (Nasmyth et al., 1980), the galactose utilization genes (St. John and Davis, 1981), and the’ histone genes (Hereford et al., 1979). Much work has been done in an attempt to answer the question, How do Ty elements produce their effects on adjacent genes? The five Ty-insertion mutants with mutations at the ADH2 locus differ in the level and regulation of ADHII activity, in the site of insertion of the element, in the DNA sequence of the deltas, and in the restriction maps of the elements themselves (Williamson et al., 1981, 1983). In these mutants, the element has inserted 71, 107, 115, 145, and 156 base pairs upstream from the ADH2 transcription initiation site. The site of transcription initiation appears to be the same in each of these mutants as it is in the wild-type yeast strain (Williamson et al., 1983). The iso-2-cytochrome coverproducing allele, CYP3-4, contains a Ty insertion 192 base pairs upstream from the wild-type transcript initiation site and this initiation site is also not altered in the mutant strain (Montgomery et al., 1982). These observations indicate that Ty does not alter gene expression by providing a new transcription initiation site but must act by a more indirect mechanism. The mutant in which the element is inserted closest to the ADH2 structural gene (mutation ADH2-8‘) has the lowest ADHII activity, perhaps because the insertion site is closer to the gene than the “TATA” sequence that is thought to be important in eukaryotic transcript initiation. Other than this, there is no clear correlation between the site of insertion or the Ty restriction map and activity. Roeder and Fink (1982a) found that different Ty elements inserted at the same site in the HIS4 regulatory region can result in His - , His , and cold-sensitive His phenotypes. However, no clear correlation between the Ty restriction map and its effect on gene expression was seen. To determine what portions of the Ty element are responsible for overproduction of cytochrome c, B. Errede (personal communication) deleted portions of the Ty element 5‘ to the CYC7 gene in the cloned mutant CYC7-H2 and examined the effects of these alterations on CYC7 expression. These studies indicated that only regions to the right of the right-most SalI site in TyCYC7-H2 (see Fig. 2) were required for overproduction of iso-2-cytochrome c; these regions were +

+

14

VALERIE MOROZ WILLIAMSON

also sufficient to cause the ROAM effect. These results are particularly interesting when one considers that expression on glucose-containing medium of the normally glucose-repressed ADH2 is produced by both classes of Ty elements described earlier and that both classes of Ty elements, Tyl and Ty2, cause the ADH2 gene expression to fall under mating type control. Yet these two elements are mostly nonhomologous in this right-hand region and share only about 400 base pairs of homology, including the 330-bp delta element. In vitro alterations of the cloned wild-type ADH2 by Beier and Young (1982) offer some clues as to how Ty elements may produce their effects. Their results show that removal of repressing sequences beginning 170 bp upstream from the ADH2 coding sequence, or displacement of these sequences to a site’ far upstream from the gene, allows constitutive expression of the ADH2 gene product. This is the same region that is moved 5.6 kb farther away from the gene by Ty insertion. Thus displacement of a repressor sequence may explain constitutive expression of ADH2 and overproduction of other ROAM mutants. A model is shown in Fig. 5 (see also Williamson et al., 1983). Similarly, displacement of activating sequences by Ty insertion could explain loss of expression of HIS4 and LYS2. Of course, this displacement does not fully explain the phenotype of the ROAM mutants, as these genes are now under the influence of positive regulatory determinants (PRDs) of Ty transcription (see Fig. Sb), possibly coded for by ROC and TYE loci. Excision of Ty to leave a solo delta in front of ADH2 results in little or no ADH2 expression. Sequences needed for positive activation may be displaced or interrupted by delta insertion or the solo delta sequence may itself somehow inhibit transcription.

E. ASSOCIATED GENECONVERSION A major difficulty in the study of Ty properties has been the existence of about 30 copies of this element in most laboratory yeast strains. One approach to overcoming this difficulty involves marking a Ty element by inserting a unique DNA sequence into it. Analysis of yeast cells in which the marked Ty has been inserted back into the yeast genome has revealed that frequent gene conversion events are associated with Ty elements (Roeder and Fink, 1982a). Gene conversion or nonreciprocal recombination involves the cuiiversion of a DNA sequence at one region of genomic DNA to that of another homologous region. Several cases of both interchromosomal and intrachromosomal gene conversion in yeast have been described, and such changes are implicated in maintaining homology between tandem genes or between homologous genes on different chromosomes (Scherer and Davis, 1980a; Klein and Petes, 1981; Jackson and Fink, 1981). For example, Scherer and Davis (1980a,b) constructed a plasmid in which a promo-

15

TRANSPOSABLE ELEMENTS IN YEAST

ADHZ

R

A

5'

B

C

R

6

h

'L

R

+3'

6

ADH2

6 m

ADH2

m

ADH2

EXPRESSION

(-1 Glucose

(+) Glucose

+. +.

-

+

+

&

FIG. 5 . Model for effects of Ty on ADHZ expression. A . The ADH2 wild-type gene is repressed by glucose and expressed only when glucose is absent from the medium. A region (R) upstream from the gene prevents expression ofADH2 in the presence of glucose. B. Insertion of a Ty element results in displacement of R and allows constitutive expression of ADHZ. This expression is at least partially under control of positive regulatory determinants (PRD), which affect expression of both Ty and ADH2. C. Excision of Ty to leave a solo delta (6) in front of ADH2 is a frequent (and reversible) occurrence and results in little or no ADH2 expression depending, perhaps, on the site of insertion or sequence of the delta.

tor-less HIS3 gene was inserted inside a Ty element on a plasmid. This plasmid was used to transform a yeast strain containing a small deletion within the genomic copy of HIS3 gene and was found to integrate into many distinguishable sites by homologous recombination with various genomic Ty elements. Analysis of these transformed cells showed the appearance of a His+ phenotype at a frequency of 10V7. His+ phenotype always mapped to the genomic copy of the HIS3 gene and involved gene conversion of the deletion-containing his3 by the promotor-less HIS3 inside the Ty element. This interchromosomal gene conversion also occurred when the promotor-less his3 gene was inserted near the GAL gene cluster, a result indicating that insertion into a Ty element was not required for the recombinational events to occur. Roeder and Fink ( 1 982a) found that gene conversion between Ty elements is a common occurrence. They inserted a functional LIRA3 gene into the Hind111 sites of the transposable elements, Ty912 and Ty917 (Fig. 2), which were responsible

16

VALERIE MOROZ WILLIAMSON

for the His- phenotype to produce the modified elements Ty912 (URA3) and Ty917 (URA3). Replacement of elements Ty912 and Ty917 with the modified elements in yeast strains that were ura3 - resulted in a Ura phenotype, a result indicating that the URA3 gene in the Ty element was still functional. Analysis of Ura- derivatives of these strains revealed that the Ura- phenotype was often caused by conversion of the URA3-containing Ty to another Ty element. For the Ty917 element, 21 independent Ura- derivatives were isolated, and 13 of these appeared to be due to conversion of the marked Ty917 element with other Ty elements. Ty elements from both classes were associated with conversion events, and no changes in restriction patterns outside of the elements were seen. Most of the Ura- derivatives from the Ty912 (URA3) strain contained a single delta sequence in place of the Ty element, but two Ty912 replacement events have been detected. It will be interesting to see whether differences between the elements Ty912 and Ty917 or other factors account for the different conversion versus deletion frequencies. It is curious that no hybrid Tyl-Ty2 elements have been reported. Perhaps this means that gene conversion between Ty elements is a specialized process, initiating and terminating only in certain regions of the Ty element, such as in the deltas. +

AND DNA REARRANGEMENTS F. TRANSPOSABLE ELEMENTS

Transposable elements in many systems appear to cause chromosomal rearrangements such as deletions, inversions, and translocations. Several types of chromosomal rearrangements have been reported to be associated with yeast Ty elements or delta sequences. Most of these have been detected because of changes caused in expression of nearby genes. The most frequently observed alteration involves excision of a Ty to leave behind a single copy of the direct repeat, delta (as shown in Fig. 5C). Such excision mutations for the Ty associated with the hid-912 mutation were observed because they change the phenotype from His- to cold-sensitive His . The reversions occur at a frequency of about l o p 5 . For the ADH2C mutants, excision of the Ty element results in loss of the constitutive expression of ADHII and occurs at frequencies ranging from 10W3 to depending on the particular Ty insertion and yeast strain background. The spm2 mutation, which suppresses the His - phenotype of mutation his4-917, leads to a 100- to 1000-fold increase in the frequency with which his4-912 reverts to His as a result of excision of Ty leaving a solo 6 (Roeder et al., 1980). Deletion events in which entire genes are deleted have been associated with the presence of Ty or 6 sequences. In general, deletions in yeast are rather rare events, but loci have been described where deletions occur at a high frequency. A well-studied case involves the COR region of S . cerevisiae, a region that encompasses three genes: one gene codes for iso- 1-cytochrome c (CYCI), the +

+

17

TRANSPOSABLE ELEMENTS IN YEAST

second gene ( O S M I ) is involved in osmotic stability, and the third gene (RAD7) is involved in control of sensitivity to UV irradiation. These three genes have been observed to delete together at high frequency (10 5- 10 per cell division) in certain yeast strains (DELI strains) (Liebman et al., 1979). Molecular analysis of the COR region in DELI strains has shown that in these yeast strains this region is flanked by Ty elements in direct repeat orientation (Shalit et al., 1981; Liebman et al., 1981). Nondeleting strains are missing one or both of these Ty elements. Analysis of 10 deletion mutations derived from DELI strains showed that the 13-kb COR region is deleted in all cases and that most frequently (6 out of 10 cases) one Ty element remains at this chromosomal location. More complex rearrangements are associated with the other four deletion mutations. In one case, two tandem Ty elements remain; in another case, most of both Ty elements remain but appear to have undergone an inversion; in a third case, most of both inserts are missing and a single 0.3-kb insert, most likely a delta, remains; in a fourth case, one altered Ty element remains. Another example of a deletion event mediated by Ty involves the DNA between the LEU2 and the HIS4 loci, which are both on chromosome 111 but are separated by a sizable genetic distance of 20 centimorgans. While analyzing Ura- revertants of the Ty917 (URA3) in a strain that carried the Ty element Tyl-17 near the LEU2 locus, Roeder and Fink (1982a) obtained a strain in which this entire 20-centimorgan region had been deleted. A single Ty element of Class 1 remained at the deletion end points between LEU2 and HIS4 in this strain. Because Ty917 and Tyl-17 are both Class’2 elements, Roeder and Fink (1982a) proposed that a gene conversion event had occurred between a Class 1 Ty element at a different locus and the two Ty elements that were involved in the deletion event (illustrated in Fig. 6111). Similar gene conversion events could also explain some of the deletions observed at the DELI locus. Figure 6 outlines three possible mechanisms for deletion of a region of chromosomal DNA flanked by Ty elements in direct repeat orientation: sister chromatid exchange, intrastrand recombination, and gene conversion. These or similar mechanisms could explain many, but not all, of the deletions described earlier. It is not known which, if any, of these mechanisms were involved in producing the deletions described earlier. As a possible clue to the true mechanism, it has been observed that yeast strains with the rad.52-1 mutation, which confers X-ray sensitivity, are not altered in the DELI phenotype (Liebman and Downs, 1980). The RAD52 gene is involved in mitotic and meiotic recombination and in mating-type switching (Malone and Esposito, 1980). Another interesting property of the DELI phenotype that needs explanation is that the effect can occur in trans to cause deletion of the COR region from the chromosome where the region is not surrounded by Ty (Liebman et al., 1981). There is evidence suggesting that Ty elements can function similarly to bacterial insertion sequences in that when two of these elements border a genomic ~

~

18

VALERIE MOROZ WILLIAMSON

I

3 +

=

II

A

TvX

U

A

TvZ

E

U

FIG.6 . Possible mechanisms for Ty-associated deletions. Three models are shown for deletion of a region of chromosomal DNA (BD), which is surrounded by Ty elements (TyX and TyY) in direct repeat orientation. I. Deletion by sister chromatid exchange. Unequal crossing over would result in one chromatid containing a duplication of BD and in the other containing a deletion of the same region. 11. Deletion by intrastrand recombination between neighboring Ty elements. Intrastrand recombination would result in looping out of the region between TyX and TyY to leave a deletion of BD on the chromosomal copy and a free circle containing BD and a Ty element. 111. Deletion by gene conversion. Elements TyX and TyY provide homology for gene conversion by TyZ, an element from another locus in the yeast genome.

TRANSPOSABLE ELEMENTS IN YEAST

19

DNA sequence the whole sequence can become transposable. A mutant that contains an increased amount of iso-I-cytochrome c has been shown to have undergone transposition of the entire 12-kb COR region to a new position on a different chromosome (Stiles et al., 1980, 1981). The original copy was retained at its normal position on chromosome X , a finding suggesting that this was a transposition event. However, the possibility remains that this event was due to gene conversion with a Ty element that already existed on chromosome VII. Strong similarities in structure and function of the CYCI-OSMl-RAD7 (COR) gene cluster to the gene cluster CYC7-RAD23-ANPIIwhich occurs on a different chromosome, were observed by McKnight et al. (1981). These similarities suggest that these gene clusters are related by an ancient transposition event that may have involved a circular intermediate, because the order of genes is permuted. Other chromosomal rearrangements have been observed to be associated with Ty mutations at the HIS4 and ADH2 loci. Genetic and molecular analyses of his4-912 revertants of a diploid strain homozygous at his4-912 showed that reciprocal translocations, inversions, transpositions, and deletions are in some cases associated with phenotypic reversion (Roeder and Fink, 1980; Chaleff and Fink, 1980). Two cases were seen where reciprocal translocations had occurred, one between chromosomes I and 111 and another between chromosomes XI1 and 111. In these two His+ revertants, one of the translocation breakpoints occurs within element Ty912. One explanation for these events is that recombination has occurred between the Ty912 element on chromosome 111 and another Ty element on chromosome I or XII. Other revertants contain deletions extending from within the Ty element into the his4 gene. Many of the revertants of his4-912 contain additional mutational events beyond those required for the his4 reversion. Such “concerted events” include occurrence of reversion of the his4 mutation on both copies of the chromosome, appearance of a Leu2- phenotype, and aneuploidy. Chaleff and Fink (1980) suggest the Ty element at his4 may play a central role in generation of these events. Major genetic rearrangements were also observed for Ty-associated mutants at the ADH2 locus. Four out of 700 secondary ADHII- mutants isolated from a strain carrying the Ty-associated mutation ADH2-9‘, had also become ade4 (Ciriacy and Williamson, 1981). The ADE4 locus is tightly linked genetically to ADH2 and is physically 6-10 kb downstream from the ADH2 coding region (Ciriacy and Breilmann, 1982). Each of these mutations appears to result from a single genetic event and to involve a translocation or large inversion. Delta sequences themselves are sufficient to cause DNA rearrangements. A region of the yeast genome that was reported to delete at a high frequency is the SUP4 (tyrosine tRNA) locus. Of 56 spontaneous mutations at this locus, 16 were classified as deletions. Ten of these deletions had lost 2100 bp and six had lost 2800 bp (Rothstein, 1979). This region of the genome contains five delta se-

20

VALERIE MOROZ WILLIAMSON

quences, and it is thought that these delta sequences are responsible for promoting the deletion events. In another example, a solo delta sequence near the 5’ end of the ADHII structural gene (ADH2) was shown to promote a number of DNA rearrangements (Ciriacy and Breilmann, 1982). Rearrangements detected included reintegration of a Ty sequence at the delta site, inversion, and transposition of ADH2 along with 3’ flanking material. Southern hybridization experiments did not indicate loss of a Ty element associated with appearance of Ty at the delta sequence. Two possible mechanisms for this event are gene conversion by a Ty element at a different location or integration of a free circle containing a single Ty element. 111. Other Transposable Elements in Yeast

The eukaryotic transposable elements studied so far have as a rule been moderately repeated DNA sequences such as Ty. Yeast has quite a small genome, as compared to other eukaryotes, and much less repeated DNA. It follows that yeast may not have the variety of transposable elements that are found in other eukaryotes such as Drosophila (Potter et a l . , 1979; Young, 1979). A candidate for a second family of yeast transposable elements is the repeated sequence sigma, which was observed by del Rey et al. (1982) to be present in at least 20-25 copies per haploid yeast genome. Although there has been no direct evidence for transposition by this element, its genomic locations vary considerably from strain to strain. This element is located within 16 or 18 bp of the 5’ end of several tRNA genes but has been found in either orientation with respect to the tRNA transcript. DNA sequence analysis of sigma elements shows they are 340-341 bp long, are AT rich (65% AT), are very homologous, and lack a long open reading frame. These elements contain a number of direct and inverted repeats; of particular interest is an 8-bp inverted repeat present at the ends of the element. This repeat is homologous to the ends of delta sequences (1 in Fig. 4). Each sigma element is flanked by a 5-bp direct repeat, presumably generated from target DNA sequences upon integration of the element. No function for sigma in tRNA transcription is obvious because the majority of tRNA genes do not contain sigma sequences and the presence of sigma does not prevent transcription (del Rey et a f . , 1982). The occurrence of repeated DNA sequences such as delta and sigma upstream from yeast tRNA genes appears to be widespread (Baker et a l . , 1982; Eigel and Feldmann, 1982). It is tempting to postulate a role for these elements in propagation of tDNA copies or in regulation of their transcription. A very interesting case of specialized transposition in yeast-mating-type switching-has been studied extensively at both genetic and molecular levels (reviewed by Herskowitz and Oshima, 1981). The MAT locus of yeast codes for transcripts involved in conferring either the a or a mating type to a haploid yeast

TRANSPOSABLE ELEMENTS IN YEAST

21

cell. Two silent copies of the MAT locus, H M L and HMR, are present on the same chromosome (chromosome 111) as MAT and carry silent copies of genetic information coding for the a or (Y transcripts. This information can be transferred to the MAT locus at high frequency (every cell division) in yeast strains that carry the homothallism gene, H O . The MAT locus and the HML and HMR regions contain homologous sequences surrounding a central sequence that codes for a or (Y transcripts. The mating-type switching is a specialized case of directed gene conversion in which the a and (Y transcript coding sequences located between the homologous regions are switched from the silent (HML or H M R ) locus to MAT. More recent evidence suggests that chromatin structure and a double-stranded cut in the DNA at MAT are integral for the switching process (Nasmyth, 1982; Strathem et al., 1982). Events that involve transposition of the HlS4C gene and that are not associated with Ty elements have been reported (deBruijn and Greer, 1981; Greer et a l . , 1980; Greer and Fink, 1979).HIS4C is the third of three enzymatic activities that are coded for by a single polypeptide at the HIS4 locus. There is a strong preference for particular target sites in these transposition events, and the transpositions are very unstable because of precise excision and frequent loss of the chromosome carrying the transposed gene.

IV. Discussion Transposable elements have been found in many kingdoms in the biological world. Hypotheses for their function range from classifying them as selfish DNA-parasitic sequences that exist merely to propagate themselves-to proposing a major role for these sequences in evolution or development (Doolittie and Sapienza, 1980; Orgel and Crick, 1980). Of course these roles are not necessarily exclusive. Although transposable elements may have arisen as parasites, their mutagenic properties and ability to alter gene expression and to nucleate rearrangement of DNA sequences through transposition, recombination, and gene conversion raise the possibility that these sequences are important in the evolutionary process. The number and types of Ty elements differ in yeast strains around the world. This observation could indicate that “infection” with Ty DNA is a recent event or that gene conversion between Ty elements is a major factor in determining the Ty makeup of any given strain. It may be, for example, that certain T y elements have a selective advantage, either for the cell or for their own survival within it, under different circumstances. There also seems to be an upper limit on the number of Ty elements in a cell. Wild-type yeast have up to 20 copies, and lab strains contain approximately 30 copies. It may be that more copies are detrimental. All Saccharomyces strains studied so far have delta or

22

VALERIE MOROZ WILLIAMSON

delta cross-hybridizing sequences. Perhaps these short, repeated structures do have some vital function. One hypothesis for Ty function is to increase survival capability by enabling stressed yeast to adapt to a new environment. Such a hypothesis might suggest that under certain conditions Ty elements are activated in a cell, jump through the genome, and cause changes in gene expression. Some of these changes could result in a selective advantage for the altered cell. As precedent for this hypothesis, early genetic work by McClintock (1950) showed that transposable controlling elements in maize were activated by genetic shock such as a breakage-fusion-bridge cycle caused by the presence of a dicentric chromosome. Also there is evidence that the rate of copiu transposition is greatly enhanced in dysgenic Drosophilu hybrids (Rubin et ul., 1982). Chaleff and Fink (1480) propose that Ty-associated alterations may occur as concerted events because cells that are altered in their his4-912 phenotype often appear to have other unrelated alterations. Many eukaryotic mutations that affect the regulation of gene expression are caused by transposable elements or are linked to them. In yeast, a high proportion of mutations that affect gene expression and that have been characterized are, in fact, due to Ty insertion. Genes that are altered in expression by Ty insertions are now also mutable, i.e., subject to further changes in expression by conversion of one Ty to another, excision of Ty to leave behind a delta, transposition, translocation, or other events. Any or all of these processes could be important in optimizing gene expression in an organism adapting to a new environment. Another possible role for transposable elements involves creation of gene duplications by transposition of a gene or group of genes to a new locus. The CYCI -0SMl-RAD7 and CYC7-RAD23-ANPI gene clusters mentioned earlier (McKnight et ul., 1981) could be an example of such an ancient transposition event. One could also imagine that the genomic rearrangements caused by recombination or conversion events such as those reported at the HIS4 and ADH2 loci between the repeated Ty DNA elements have importance for processes such as speciation. All this, of course, is quite speculative, and the true nature of these elements-in yeast and other organisms-remains to be deciphered.

ACKNOWLEDGMENTS I would like to thank the following individuals for generously providing me with manuscripts before publication and with unpublished results: M. Ciriacy, S. Roeder, G . Fink, P. Philippsen, P. Ballario, R. T. Elder, B . Errede, I. C. Jauniaux, and D. Montgomery. 1 would also like to thank A . Blechl, B . Williams, P. Philippsen, R. Simpson, M. Ciriacy, B. Errede, E. Gregerson, and P. Filner for critically reading the manuscript and providing many helpful suggestions. I am grateful to Karen Long for many hours of manuscript preparation.

TRANSPOSABLE ELEMENTS IN YEAST

23

REFERENCES Baker, R. E., Eigel, A., Vogtel, D., and Feldmann, H. (1982). EMBO J . 1, 291-295. Beggs, J. D. (1978). Nature (London) 275, 104-109. Beier, D., and Young, E. T. (1982). Nature (London) 300, 724-728. Benz, E. W., Jr., Wydro, R. M., Nadal-Ginard, B., and Dina, D. (1980). Narure (London) 288, 665-669. Bingham, P. M., Levis, R., and Rubin, G. M. (1981). Cell 25, 693-704. Calos, M. P., and Miller, J. H. (1980). Cell 20, 579-595. Cameron, I. R., Loh, E. Y.,and Davis, R. (1979). Cell 16, 739-751. Chaleff, D. T., and Fink, G. R. (1980). Cell 21, 227-237. Ciriacy, M. (1976). Mol. Gen. Genet. 145, 327-333. Ciriacy, M. (1979). Mol. Gen. Genet. 176, 427-431. Ciriacy, M., and Breilmann, D. (1982). Curr. Genet. 6 , 55-61. Ciriacy, M., and Williamson, V. M. (1981). Mol. Gen. Genet. 182, 159-163. Clavilier, L., Pere-Aubert, G., Somlo, M., and Slonimski, P. P. (1976). Biochimie 58, 155-172. DeBruijn, F., and Greer, H. (1981). Mol. Cell. Biol. 1, 381-386. Del Rey, F. I., Donahue, T. F., and Fink, G. R. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 4 138-4 142. Deschamps, J., and Wiame, J-M. (1979). Genetics 92, 749-758. Dobson, M. J., Tuite, M. F., Roberts, N. A . , Kingsman, A. J., and Kingsman, S. M. (1982). Nucleic Acids Res. 10, 2625-2637. Doolittle, W. F., and Sapienza, C. (1980). Nature (London) 284, 601-607. Dubois, E., Jacobs, E., and Jauniaux, J. C. (1982). EMBO J. 1, 1133-1 140. Eibel, H., and Philippsen, P. (1982). f n t . Conf. Yeasr Genet. Mol. Biol. 11th 17. (Abstr.) Eibel, H., Gafner, J., Stotz, A., and Philippsen, P. (1980). Cold Spring Harbor Symp. Quant. Biol. 45, 609-617. Eigel, A,, and Feldmann, H. (1982). EMBO J. 1, 1245-1250. Elder, R. T., St. John, T. P., Stinchcomb, D. T., and Davis, K.W. (1980). Cold Spring Harbor Symp. Quant. Biol. 45, 581-584. Elder, R. T., Loh, E. Y., and Davis, R. W. (1983). Proc. Narl. Acad. Sci. U.S.A. 80, 2432-2436. Errede, B., Cardello, T. S., Sherman, F., Dubois, E., Deschamps, J., and Wiame, J.-M. (1980a). Cell 22, 427-436. Errede, B., Cardello, T. S., Wever, G . , and Sherman, F. (1980b):Cold Spring Harbor Symp. Quant. Biol. 45, 961-981. Farabdugh, P. J., and Fink, G. R. (1980). Nature (London) 286, 352-356. Fink, G., Farabaugh, P., Roeder, G., and Chaleff, D. (1980). Cold Spring Harbor Symp. Quanr. Biol. 45, 575-580. Flavell, A. J., and Ish-Horowicz, D. (1981). Nature (London) 292, 591-595. Gafner, J., deRobertis, E., and Philippsen, P. (1982). Int. Conf. Yeast Genet. Mol. Biol.. 11th 16. Gafner, J., and Philippsen, P. (1980). Nature (London) 286, 414-418. Gafner, J., and Philippsen, P. (1983). In preparation. Gehring, W. J., and Paro, R. (1980). Cell 19, 897-904. Green, M. M. (1980). Annu. Rev. Genet. 14, 109-120. Greer, H., and Fink, G. R. (1979). Proc. Narl. Acad. Sci. U.S.A. 76, 4006-4010. Greer, H., Igo, M., and DeBruijn, F. (1980). ColdSpring HarborSymp. Quant. Biol. 45, 567-574. Grindley, N. D. F., and Sherratt, D. (1979). Cold Spring Harbor Symp. Quant. Biol. 43, 1257- 1261. Harshey, R. M., McKay. R., and Bukhari, A. I. (1982). Cell 29, 561-571.

24

VALERIE MOROZ WILLIAMSON

Hayward, W. S., Neel, B. G., and Astrin, S . M. (1981). Nature (London) 290, 475-480. Hereford, L., Fahrner, K., Woolford, J . , Jr., Rosbash, M., and Kaback, D. B. (1979). Cell 18, 1261-1271. Herskowitz, I., and Oshima, Y. (1981). In “The Molecular Biology of the Yeast Saccharomyces” (J. N. Strathem, E. W. Jones, and J. R. Broach, eds.). Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Hinnen, A,, Hicks, J. B., and Fink, G. R. (1978). Proc. Narl. Acad. Sci. U.S.A. 75, 1929-1933. Jackson, J. A., and Fink, G. R. (1981). Nature (London) 289, 144-148. Jauniaux, J. C., Dubois, E., Crabeel, M., and Wiame, J. M. (1981). Arch. In!. Physiol. Biochim. 89, B11 I-Bl12. Jauniaux, J. C., Dubois, E., Vissers, S., Crabeel, M., and Waime, J. M. (1982). EMBO J . 1, 1125-1 132. Ju, G . , and Skalka, A. M. (1980). Cell 22, 379-386. Kingsman, A. J., Gimlick, R. L., Clark, L., Chinault, A. C., and Carbon, J. (1981). J . Mol. Biol. 145, 619-632. Kleckner, N. (1977). Cell 11, 11-23. Klein, H. L., and Petes, T. D. (1981). Nature (London) 289, 144-148. Lemoine, Y.,Dubois, E., and Wiame, J.-M. (1978). Mol. Gen. Genet. 166, 251-258. Levis, R., Dunsmuir, P., and Rubin, G. M. (1980). Cell 21, 581-588. Liehrnan, S . , Shalit, P., and Picologlou, S. (1981). Cell 26, 401-409. Liebman, S . W., and Downs, K. M. (1980). Mol. Gen. Genet. 179, 703-705. Liebrnan, S. W . , Singh, A,, and Sherman, F. (1979). Genetics 92, 783-802. McClintock, B. (1950). Proc. Narl. Acad. Sci. U.S.A. 36, 344-355. McClintock, B. (1952). Cold Spring Harbor Symp. Quant. Biol. 16, 13-47. McClintock, B. (1957). Cold Spring Harbor Symp. Quant. Biol. 21, 197-206. McKnight, G. L., Cardillo, T. S., and Sherman, F. (1981). Cell 25, 409-419. Malone, R. E., and Esposito, R. E. (1980). Proc. Null. Acad. Sci. U.S.A. 77, 503-507. Montgomery, D. L., Boss, J. M., McAndrew, S. J., Marr, L., Walthall, D. A,, and Zitomer, R. S. (1982). J . Biol. Chem. 257, 7756-7761. Nasrnyth, K. A. (1982). Cell 30, 567-578. Nasmyth, K. A., Tatchell, K . , Hall, B. D., Astell, C., and Smith, M. (1980). Cold Spring Harbor Symp. Quant. Biol. 45, 961-981. Orgel, L. E., and Crick, R. H. C. (1980). Nature (London) 284, 604-607. Payne, G. S., Bishop, J. M.,and Varmus, H. E. (1982). Nature (London) 295, 209-214. Potter, S. S., Brorein, W. J., Jr., Dunsmuir, P., and Rubin, G. M. (1979). Cell 17, 415-427. Roeder, G . S., and Fink, G. R. (1980). Cell 21, 239-249. Roeder, G. S., and Fink, G. R. (1982a). Proc. Natl. Acad. Sci. U.S.A. 79, 5621-5625. Roeder, G. S., and Fink, G. R. (1982b). In “Mobile Genetic Elements” (J. A. Shapiro, ed.). Academic Press, New York. Roeder, G. S., Farabaugh, P. J., Chaleff, D. T . , and Fink, G. R. (1980). Science 209, 1375-1380. Rothstein, R. (1979). Cell 17, 185-190. Rothstein, R. J., and Helms, C. (1982). Inr. Conj. Yeasr Genet. Mol. Biol., 11th 19. (Abstr.) Rothstein, R. J., and Sherman, F. (1980). Genetics 94, 891. Rubin, G. M., Brorein, W. J., Dunsmuir, P., Flavell, A. J., Levis, R., Strobel, E., Toole, J . J., and Young, E. (1980). Cold Spring Harbor Symp. Quant. Biol. 45, 619-628. Rubin, G. M., Kidwell, M. G . , and Bingham, P. M. (1982). Cell 29, 987-994. Russell, D. W., Smith, M . , Williamson, V. M . , and Young, E. T. (1983). J. Biol. Chem. 258, 2674-2682. Scherer, S., and Davis, R. W. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 4951-4955. Scherer, S., and Davis, R. W. (1980a). Science 209, 1380-1384.

TRANSPOSABLE ELEMENTS IN YEAST

25

Scherer, S . , and Davis, R . W. (1980b). Cold Spring Harbor Symp. Quant. Biol. 45, 584-591. Scherer, S., Mann, C., and Davis, R . W. (1982). Nature (London) 298, 815-819. Shalit, P., Loughney, K., Olson, M . V., and Hall, B. D. (1981). Mol. Cell. Biol. 1, 228-236. Shapiro, J. A. (1979). Proc. Nail. Acad. Sci. U . S . A . 16, 1933-1973. Shapiro,d. A,, and Cordell, B. (1982). Biol. Cell 43, 31-54. St. John, T . P., and Davis, R. W. (1981). J . Mol. Biol. 152, 285-316. Stiles, J . I . , Friedman, L. R., and Sherman, F. (1980). ColdSpring Harbor Symp. Quanr. B i d . 45, 961-981. Stiles, J. I . , Friedman, L. R., Helms, C., Consaul, S., and Sherman, F. (1981). J . Mol. Biol. 148, 331-346. Strathem, J . N., Klar, A. J. S . , Hicks, J . B., Abraham, J. A , , Ivy, J. M . , Nasmyth, K. A . and McGill, C. (1982). Cell 31, 183-192. Varmus, H. E. (1982). Science 216, 812-820. Williamson, V. M., Young, E. T., and Ciriacy, M. (1981). Cell 23, 605-614. Williamson, V. M., Cox, D., Young, E. T., Russell, D. W . , and Smith, M. (1983). Mol. Cell. B i d . 3, 20-3 1. Young, M. W. (1979). Proc. Nail. Acad. Sci. U.S.A. 76, 627446278, Young, T., Williamson, V., Taguchi, A., Smith, M., Sledziewski, A., Russell, D . , Osterman, J., Denis, C., Cox, D., and Beier, D. (1982). I n “Genetic Engineering of Microorganisms for Chemicals” (A. Hollaender, R. D. DeMoss, S. Kaplan, J. Konisky, D. Savage, and R. S . Wolfe, eds.). Plenum, New York. Zaret, K. S . , and Sherman, F. (1982). Cell 28, 563-573.

This Page Intentionally Left Blank

INTERNATIONAL REVIEW OF CYTOLOGY, VOL. 83

Techniques to Study Metabolic Changes at the Cellular and Organ Level ROBERTR. DEFURIA*AND MARYK. DYGERT” *Department of Biology and Biotechnology, Worcester Polytechnic Institute, Worcester, Massachusetts, and ?Department of Chemistry, Smith College, Northampton, Massachusetts Introduction ..................... ............. Nuclear Magnetic Resonance Spectros hod to Study Adenosine Triphosphate Metabolism at the Organ Level . . . . . . . . . . A. Overview . . . . . . . . . . .......................... B. Measurement of Chem ange Using NMR . . . . . . . . . . . C . Applicability to Reactions Occurring in Vivo. . . . . . . . . . . . . . . . D. Studies of the Exchange Reaction Catalyzed by Creatine Phosphokinase . . . . . . . . . . . . . . . . . . . . . . . . E. ATPase Activity.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F. Computer Modeling of the Bloch Equations . . . . . . . . . . . . . . . . G . Summary and Conclusions ............ Ill. Relationship of the Energetic St A. Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Difficulties in Interpretation of Experimental Data . . . . . . . . . . . C. ATP/ADP Compartmentation and the Cell Cycle . . . . . . . . . . . . D. Normal Values for “Energetic State” .... E. Some Specific ATP Costs.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F. Measurement nd Its Potential for Restoration at the Cellular Level ................................. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

I.

21

11.

28 28 29 33 34 40 42 44 46 46 48 50 52 55 58 60

I. Introduction This article discusses some experimental data concerning adenosine triphosphate (ATP) in cells and organs. It is divided into two parts. The first part reviews two sophisticated 31P-nuclear magnetic resonance (NMR) techniques. They are called saturation transfer and inversion transfer and are designed to measure the chemical exchange of phosphorus nuclei among the major phosphate-containing metabolites in cells. This NMR section is a reflection on the types of frustrations that one encounters with a variety of subtle ambiguities associated with NMR data. We are grateful to Gaith Alach, who has developed a computer simulation of the NMR equations that describe the saturation and inversion experiments and who has made some of his data available to us. The second part recognizes that 21 Copyright 0 1983 by Academic Prcsr, lnc. All rights or reproduclion in any form reserved. ISBN 0-12-364483-6

28

ROBERT R. DeFURIA AND MARY K. DYGERT

ATP has graduated from the biochemical literature to the cell biology literature. This graduation was alluded to at the occasion of the twenty-fifth anniversary of the Journal of Cell Biology. In the Journal’s supplement, “Discovery in Cell Biology,” it was acknowledged that the “merger between mitochondria1 research and cell biology had just begun,” and that the next major problem was ‘‘to decipher the language through which the nucleus and mitochondria talk to each other” (Ernster and Schatz, 1981).

11. Nuclear Magnetic Resonance Spectroscopy as a Method to Study Adenosine Triphosphate Metabolism at the Organ Level A. OVERVIEW The vast majority of techniques for studying metabolic changes at the cellular and organ level require eventual destruction of the tissue and subsequent analysis of an extract. The exciting promise of NMR spectroscopy is that it provides a spectroscopic technique for observing tissue metabolites directly and nondestructively. Using wide-bore magnets, an NMR spectrum can now be obtained from any tissue, perfused organ, or whole animal, which can be maintained in a stable physiological state in the magnet. In principle, any compound containing one of the 172 nuclei with nonzero spin (”P, ‘H, 13C, 19F, 23Na) can be observed provided it is present in sufficient concentration, which is approximately millimolar. To date, 31P is the most frequently observed nucleus for the study of metabolic changes in vivo. There are three reasons for the popularity of 31P experiments: (1) 31P has a spin of 1/2, and, hence, the resonance lines are not broadened by quadrupolar relaxation; (2) 31P is the naturally abundant phosphorus isotope, thus eliminating the need to enrich the sample; (3) the spectra obtained are sufficiently simple and the resonance lines are reasonably well resolved so that line assignments can be made. It is useful to distinguish between feasibility studies that demonstrate that NMR spectra can be obtained from a biological sample and studies that address a specific physiological problem. Much of the early 31P NMR spectra obtained on living tissue provided an independent confirmation of intracellular concentrations of phosphorus-containing metabolites previously determined by traditional physicochemical techniques. Other studies have demonstrated that the chemical shift of certain resonance lines can provide a sensitive measure of the pH of the environment of the resonating nuclei. In addition, the line widths of these pH-dependent resonances provide information concerning the existence of intracellular metabolic compartments of differing pH. This early work amply demonstrated the feasibility of NMR as a probe of in vivo biochemistry. Numerous review articles and several

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

29

monographs offering excellent descriptions of the NMR technique as well as some analyses of the data obtained have appeared in recent years (O’Neill and Richards, 1979; Gadian and Radda, 1981; Yoshioka, 1980; Roberts and Jardetzky, 1981; Burt et al., 1979; Shaw, 1981; Gadian et al., 1979; Radda and Seeley, 1979; Shulman er af., 1979; Ugurbil et al., 1979; and Ingwall, 1982). This article describes one category of NMR experiments that is designed to measure chemical exchange rates in vivo. Kinetic studies can be divided into two categories, depending on whether or not the tissue is in a metabolic steady state. The changes in metabolite levels that occur in a non-steady-state condition can be determined directly from changes in the intensity of the various resonance lines. In a steady-state codition, metabolite concentrations do not change over long periods of time. Understanding a steady-state metabolism requires measuring the rates at which various metabolites are turning over by determining the magnitudes of the various chemical fluxes into and out of each metabolite pool. Nuclear magnetic resonance provides a means of measuring some of these unidirectional fluxes. Briefly, a particular resonance site is magnetically labeled by either saturating or inverting the magnetization in that site, and the transfer of that magnetic perturbation to other sites is followed. It is tempting to interpret these double resonance experiments like experiments that employ radioactive isotopes of metabolites. When it first became apparent that these NMR techniques could be used in vivo, it was believed that it would become possible to measure the “intracellular flow of phosphate current. Unlike radioisotopes, however, magnetically labeled nuclei rapidly lose their label as a result of relaxation processes that become more efficient when nuclei are involved in chemical exchange. These factors impose limitations on the processes that can be studied by double resonance techniques. Adequate attention must be given to these limitations, otherwise data may be obtained that can be meaningless or misinterpreted. The following sections present the theoretical basis for these experiments in an effort to describe these limitations. A summary and analysis of the in vivo data published to date and the results of a computer simulation of a simple exchange process will be presented in order to demonstrate the types of problems that occur. ”

B. MEASUREMENT OF CHEMICAL EXCHANGE USINGNMR There are several ways in which NMR data can yield information concerning chemical exchange rates. The first methods developed involved analysis of NMR line widths and their temperature dependence; see, for example, Johnson (1965) or Kaplan and Fraenkel (1980). The line widths of resonances obtained from typical living tissues, however, are quite broad. These line widths are dominated by magnetic field heterogeneities caused by variations in magnetic susceptibility throughout the sample and at the sample-air interface in the case of perfused

30

ROBERT R. DeFURlA AND MARY K. DYGERT

organs. The existence of microcompartmentalization of various metabolites contributes additional line broadening. For these reasons, line shape analysis has not been attempted for in vivo studies. Alternate techniques for determining rates are the double or multiple resonance methods. These experiments serve to expose the coupling between two or more nonequivalent spin systems. In these experiments a particular nucleus is selectively saturated (or inverted). If, however, this spin system is coupled to another, either by chemical exchange, scalar spin coupling, or dipole-dipole interactions, the perturbation at this site will be transferred in part to the second site. The theoretical basis for experiments in which the two sites are coupled solely by chemical exchange has been developed in detail in a series of articles by Forsen and Hoffman (1963, 1964). It is outlined here in a manner that will aid in discussing the various problems, alluded to earlier, that arise in the application of the technique. 1. Saturation Transfer for Two Chemically Exchanging Sites Consider a nucleus that can exist in two different electronic environments, A and B, and that can resonate at two different Lamour frequencies W , and W,. Assume further that these nuclei are not spin coupled, that W , and W , are well resolved, and that the two sites are chemically interconverting. The chemistry can be represented by ~ A B

A G B kaA

At equilibrium the law of mass action requires the unidirectional fluxes kAB[A] and kBA[B]to be equal. When the nuclei have obtained their Boltzmann distribution over the energy states made available by the magnetic field, an appropriate NMR experiment measures the z component of the bulk magnetization, which is directly proportional to the concentrations of A and B; hence, k,,MO,

= k,,MO,

(2)

Following any perturbation, the time dependence of the magnetization in either site A or site B is given by a Bloch equation that has been modified to include the effect of chemical exchange: dM,ldt

=

(MI

- M,)/T,,

- k,,M,

+ k,,M,

(34

where T , , and T , , are intrinsic longitudinal relaxation times of the nuclei in sites A and B, respectively. These coupled differential equations have a general

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

31

solution describing MA(t)and M B ( t ) following a perturbation. However, by judicious choice of boundary conditions, two special experiments that lead to a simplification of these solutions emerge. These experiments are the saturation transfer experiment and the inversion transfer experiment. In the saturation transfer experiment, one nucleus, either A or B, is selectively saturated. Saturation at A, for example, gives MA = 0. As a consequence of this saturation, Eqs. (3a) and (3b) are uncoupled, and the remaining differential equation dM,ldt

=

(ME - M , ) I T , , - k,,M,

(4)

has a simple solution: M B ( t ) = MO,/(l

+ k,,T,,)

(I

+

e-f’TIB)

where 1 / ~ ~= , l / T , , -I-k,, defines the relaxation time of B in the presence of chemical exchange. There are several approaches com,monly used to evaluate k,, from a saturation transfer experiment. The simplest is to saturate site A until the steady state in B corresponding to dM,ldr = 0 is achieved. In this limit M B ( t ) = M;, which is given by

ME

=

ME( 1

+ k B A T I B ) -I

Using an independent determination of T I , , k,, is computed. It is important to note, however, that T i , is an intrinsic relaxation time (i.e., an NMR lifetime) and, therefore, must be measured in the absence of chemical exchange. This can become a serious problem in the in vivo experiments as complete inhibition of the chemistry will lead to loss of steady-state conditions and to tissue death. In nonsteady state T I , cannot be measured, whereas in the case of tissue death changes in the cellular milieu may alter TI,. If the chemistry cannot be prevented, there are three alternative ways to obtain a correct measure of T I B .Two of these methods take advantage of the fact that saturation at site A uncouples the differential equations [Eqs. (3a) and (3b)l so that the relaxation in site B is characterized by a single exponential with time constant T,,. In the saturation transfer experiment, if the selective saturation is applied for times shorter than that required to reach a steady state in site B, a plot of ln[M, - M;] versus time gives a line from which T , , is evaluated. Alternatively, the same Ti, can be measured by carrying out a conventional T i experiment such as progressive saturation while maintaining saturation at site A. If site A is not saturated, a third method of obtaining T I , is outlined by Gadian et a/. (1981). The results of a conventional T I experiment can be analyzed with this method, but the general solution to the coupled Bloch equations is required in order to obtain the appropriate time constant.

32

ROBERT R . DeFURIA AND MARY K . DYGERT

Having determined k,, by one of the preceding techniques, the unidirectional flux k,,MO, can be calculated, and, because the reaction is at equilibrium, the reverse flux is simultaneously determined. A check is provided by carrying out the experiment in reverse, i.e., saturate B and observe changes in A. From Eq. (6) limitations on the magnitude of rate constants measurable by this technique are established. Rates for which k,,T,, 4 1 cannot be measured. Ideally, the rate constant should be approximately equal to l/TIB.If we assume that a 5% change in M B ( t ) is the smallest that can be detected, the product k,,T,, must be 0.05. For T, values on the order of 1 second, a lower limit of 0.05 on k,, is set. Fortunately, many phosphorus exchanges occurring in vivo fall within this range and can be detected. 2 . Inversion Transfer This is a variation of the saturation transfer experiment in which a site is selectively inverted by application of a selective 180" pulse. Immediately following inversion MA = - M i . Substitution of this condition into Eq. (3b) gives

which, using Eq. ( 2 ) , gives

The experimental quantities measured are M g and MB(r) at various times after application of the inversion at A . The latter quantity is obtained by application of a pulse sequence ( 1 80", - T - 90"observe - de1ay)n. MB(t) obtained by varying T in the pulse sequence is plotted and extrapolation to t = 0 enables estimation of an initial slope dM,/dr at t = 0. In this analysis a flux is equated directly with a slope, and it is not necessary to measure a TI. Extrapolation to zero time is possible because a resonance line can be inverted very rapidly ( l o p 5 seconds). Saturation, on the other hand, requires a pulse of much longer duration, and, hence, early time points describing M B ( t ) cannot be experimentally determined. Even for the inversion transfer experiment it may be difficult to accurately determine an initial slope of M B ( t ) versus time. The option of using general solutions to Eqs. (3a) and (3b) is still available but requires evaluation of the T,'s. Under conditions in which more than two sites are undergoing exchange, this simple inversion transfer experiment has a distinct advantage over the saturation transfer method. This will be discussed later.

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

33

Although there are other double resonance experiments that can be devised, the two described here enable the most straightforward analysis of the data and are the techniques that have been employed in the in vivo work published to date. TO REACTIONS OCCURRING in Vivo C. APPLICABILITY

One immediately obvious drawback to the preceding methods is that a condition of chemical equilibrium between the two sites A and B is required. Chemical reactions occurring in vivo are rarely at equilibrium. The binding of proteins and cations such as Ca2+ and Mg2+ to metabolites are examples of processes at equilibrium, but the unidirectional on-off rates in these cases are so rapid that only a single resonance line, having a chemical shift that is a weighted average of the chemical shift of the bound and unbound species, is seen. Such systems cannot be studied by double resonance techniques. In metabolic pathways some reactions are maintained far from equilibrium (often regulatory reactions), whereas others are found near equilibrium. If, however, there is a net flux through the pathway, then even for the near-equilibrium reactions, the unidirectional flux in the forward direction must exceed that in the reverse direction by an amount equal to the net flux through the pathway. It is important to consider whether the models derived earlier are applicable to the steady state or whether equilibrium is an absolute requirement. In simplest terms, if the reaction A G B is to be in a steady state, there must be a chemical input into A and an output from B as represented in Eq. (9): +AeB+

(9)

From this simple scheme it is obvious that the two-site model [Eqs. (3a) and (6)] is no longer sufficient to describe the magnetization behavior in this system. Yet, under certain circumstances the two-site model may serve as an adequate approximation. Some of these circumstances will become apparent in the ensuing discussion of actual in vivo experiments. Others will be demonstrated by the results of a computer model of the Bloch equations [Eqs. (3a) and (3b)l and similar equations for three-site chemical exchange. An example of a simple twosite chemical exchange is the reaction catalyzed by creatine phosphokinase (CPK) in v i m : PCr

+ A D P e A T P + Cr

(10)

A phosphate (P) initially bound to creatine (Cr) will, after a short time, be found in the terminal phosphate position of ATP (yATP). The Bloch equations [Eqs. (3a) and (3b)l correctly model this system. In vivo, however, there are numerous alternate pathways involving yATP, and the Bloch equations must be modified to account for these exchanges. By analogy to Eqs. (3a) and (3b), one can write

34

ROBERT R

dMpc,ldt = (MO,,, and

where all the kt are pseudo-first-order rate constants. The flux in the forward direction, for example, is given by k*,c$40,cr. The alternate sites undergoing exchange with yATP are taken into account by the last two terms of Eq. (12). Saturation of yATP enables simple solution of Eq. (1 l), and the forward flux can be determined as before. Saturation of PCr, on the other hand, is not sufficient to uncouple Eq. (12) from other time-dependent variables, the Mx; and the simple solution is no longer applicable. What is required in order to use the analysis presented in Section II,B is a multiresonance experiment in which all sites undergoing exchange with yATP are simultaneously saturated; and this same multisite saturation would also obtain the appropriate T, . Analysis of the changes in yATP by a two-site model will incorrectly determine the reverse flux. For the inversion transfer experiment, because the data are extrapolated to t = 0, this problem is eliminated. The reason for this is that prior to the onset of transfer of a perturbation in site A to site B, the last two terms in Eq. (12) cancel as they must if ATP levels are to remain constant. This condition holds only at t = 0. At other times, magnetizations are no longer proportional to concentration, and these terms do not cancel. The creatine phosphokinase exchange has been studied in a number of in vivo preparations. These data will now be reviewed in light of the limitations outlined.

D. STUDIESOF THE EXCHANGE REACTION CATALYZED B Y CREATINE PHOSPHOKINASE Although we intend to focus primarily on the in vivo studies, the in vitro studies of the CPK reaction using solutions of purified enzyme demonstrate the feasibility of the techniques described earlier. Numerous groups have examined this exchange (Brown et al., 1978; Meyer et al., 1982) and have demonstrated that at equilibrium, the unidirectional fluxes are equal, as is expected. The data of Meyer et al. (1982) is of particular interest in that the saturation transfer and inversion transfer techniques are shown to give equivalent results. They demonstrate further (Fig. 1) that the flux varies linearly with the amount of enzyme present in solution. We have confirmed these results in unpublished experiments and have found, in addition, that when normalized to the same quantity of

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

35

12

8

X 3

4

-I

u.

Y

n 0

CREATINE KINASE ACTIVITY

IU/rnl

x

FIG. 1 , Creatine phosphokinase unidirectional flux calculated from NMR (ATP inversion transfer) (bars indicate 2 SE). I n v i m experiments in v i t r i ( 0 )and in a nonworking cat biceps muscle (0) experiments were made on solutions containing 25 mM phosphocreatine, 8 mM ATP, 3 mM creatine, 50 mM Na+ imidazole, 10 mM MgS04, 10 mM NaCI, 100 mM potassium acetate, 50 pA4 EDTA, 0.5 mM P-mercaptoethanol, 1 mg/ml BSA, pH 7.0, 28"C, and creatine kinase in various amounts. Reproduced from Meyer et a/. (1 982).

catalytic groups, the same flux is sustained by different isozymes (MM and BB) of CPK. It is generally accepted that the function of the creatine phosphokinase reaction in vivo is to buffer changes in ATP concentration brought about by changes in the rate of ATP utilization; or more specifically, as will be discussed in the second part of this article, functions to buffer changes in the chemical potential energy available from ATP. In order to function effectively in this role one would expect to find sufficient CPK activity to rapidly equilibrate PCr and ATP, and, hence, the unidirectional fluxes in the CPK equilibrium would be expected to be rapid relative to the net rate at which ATP is being utilized in other reactions. The double resonance experiments described previously can be exploited to measure these unidirectional fluxes, making a comparison possible in vivo. These fluxes have been determined in skeletal muscle, cardiac muscle, and brain.

36

ROBERT R. DeFURIA AND MARY K . DYGERT

The CPK reaction was first studied in vivo in a frog skeletal muscle preparation by Brown er al. (1978, 1980), and a complete account of that work has appeared (Gadian et al., 1981). In these studies, the frog gastrocnemii muscles were maintained at 4°C in Ringer solution containing 2 mM NaCN in order to maintain the tissue in an anoxic condition. In a preliminary report (Brown, 1978), the unidirectional fluxes measured by the saturation transfer technique were found to be equal; but, in a later work, a discrepancy was found. Values of 1.7 pmol g wet weight-' sec-' and 1.2 pmol g wet weight-' sec-I are now reported for the forward and reverse fluxes, respectively. Because these fluxes must be equal in order to maintain constant PCr levels, the discrepancy in fluxes is a clear indication that complexities exist. The terminal phosphate of ATP might be exchanging with alternate sites, for example. Accordingly, we will assume that only the forward flux PCr-ATP is an interpretable value. Taking the forward measured flux (1.7 pmol g- I sec- I ) as the correct measure of the CPK activity, the ability of this enzyme to keep pace with changes in ATP levels can be assessed. There are no measurements of lactate production made on these anaerobic muscles, but an ATP restoration rate (or the equivalent net hydrolysis rate) can be estimated by monitoring changes in the P, resonance during contraction. This rate (0.75- 1 .O pmol g - I sec- I ) corresponds to the ATP restoration rate that occurs during contraction and, therefore, will overestimate the rate at rest. However, even this overestimate is less than the unidirectional flux through the CPK reaction by roughly a factor of 2. To demonstrate that CPK activity is always sufficient to keep PCr and ATP equilibrated, the CPK flux during contraction would be of interest. The investigators made an attempt to measure this quantity, but changing PCr levels (a non-steady state) during contraction rendered the forward flux unmeasurable. Furthermore, although ATP levels remained in a steady state during contraction, the alternate pathway contributions exposed in the resting state may have made an even greater contribution during contraction, thus rendering the reverse flux unmeasurable. Therefore, the data are not available to enable a correct comparison to be made. As these muscles age during the course of an experiment, PCr levels become depleted. A series of measurements of the reverse flux were made at various PCr levels, but because these measurements are difficult to interpret, they will not be discussed here. The CPK reaction has also been studied in a cat skeletal muscle preparation (Kushmeric el al., 1980; Meyer and Kushmeric, 1981). This preparation was perfused, stable, and aerobic rather than anaerobic. The CPK fluxes were measured using the inversion transfer experiment with extrapolation to t = 0. The advantage of this extrapolation procedure was discussed earlier, and one would expect the forward and reverse unidirectional fluxes to be equal. A typical set of spectra for the case in which ATP is inverted are shown in Fig. 2. From spectra such as these fluxes of 4.8 and 4.4 pmol g wet weight-' sec-' were reported

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

/

I

I

37

II 10.0

FIG. 2. Example of a yATP phosphate inversion transfer experiment in an excised cat biceps preparation. Spectra were accumulated as follows. First a low-power 180" selective inverting pulse was applied at the Lamour frequency of the yATP. All nuclei were then left unperturbed for a specific delay time (given at the right of each spectrum) to allow inverted nuclei to undergo chemical exchange. After this delay, the usual high-power broad bandwidth 90"-pulse was applied. The system was then given 15 seconds to recover, and the process repeated. The dashed line connects phosphocreatine (PCr) peaks to emphasize the decrease in magnetization that occurs in the PCr peak because of the transfer of inverted yATP nuclei from ATP to PCr. Reproduced from Meyer et a / . (1982).

for the forward and reverse flux, respectively. The oxygen consumption rate in this steady-state nonworking muscle is reported as 0.06 pmol g - ' min- I , which, using a P:O, ratio of 6 . 2 , corresponds to an ATP utilization rate of 0.006 pmol g- I sec- I . For this muscle, then, the unidirectional fluxes through the CPK reaction are roughly 700 times more rapid than the ATP utilization rate, whereas in frog muscle these fluxes differed only by a factor of 2. The likely explanation for this tissue difference is that for frog muscle the ATP utilization rate was based on changes observed during contraction. Stimulation of the cat muscle can cause an increase in ATP utilization rate of 20- to 100-fold, and the CPK flux would then exceed this rate by only a factor of 7. The CPK flux greatly exceeds the net ATP utilization rate at rest, but during contraction these rates become almost equal, though the former always exceeds the latter. Similar fluxes can also be measured in cardiac muscle, which is undergoing continual contraction followed by relaxation during each heart beat. For skeletal muscle the measurements made during contraction were found to be of questionable validity because of the non-steady-state PCr concentrations. In heart, however, even though PCr concentrations (and ATP, to a lesser extent) fluctuate with

38

ROBERT R. DeF’URIA AND MARY K. DYCERT

each cardiac cycle (Fossel et al., 1980), the NMR experiment averages these concentrations over many beats of the heart. As a consequence, constant PCr and ATP levels are recorded and analysis of a saturation transfer experiment provides a measure of the average unidirectional flux of the CPK reaction from PCr to ATP. But, as is the case in the skeletal muscle preparations, alternate pathways out of ATP probably render a two-site analysis inadequate for evaluation of either the reverse CPK flux or the T , of ATP. The earliest reports in which CPK activity was studied in heart were by Nunnally and Hollis (1979), using rabbit heart, and by Brown et al. (1978), using the rat heart. In both reports, pseudofirst-order rate constants are reported rather than fluxes, so the comparison to skeletal muscle cannot be made for these data. Both, however, find the forward and reverse rates to be unequal. This result is predicted when a two-site model is used to simulate multisite exchange. Nunnally and Hollis (1979) offer an interesting alternative explanation for these unequal fluxes that merits discussion. These authors rule out the possibility that alternate pathways out of ATP render the reverse rate unmeasurable by the two-site model. They argue that if such pathways were to exist magnetization would be expected to appear in the Pi resonance upon prolonged saturation of yATP, and no such changes were observed. They decided that the unequal fluxes are computed because the correct yATP concentration is not known. Thus, they argue that of the total ATP measured by the intensity of its NMR line, only a fraction is available to the CPK enzymes. It is true that such a compartmentalization of either component involved in the exchange would generate an incorrectly measured flux. Meyer et al. (1982) have considered this compartmentalization issue and have presented a theoretical analysis of the effect that such a compartmentalization would have on the saturation and inversion transfer experiments. However, their analysis concerns a special case in which the T , of the compartmentalized component remains the same in each compartment and is, therefore, incomplete. They show that the inversion transfer experiment (in the limit as t approaches zero) measures the correct flux, whereas the saturation transfer experiment does not. This suggests that, if the alternate pathway contributions can be ruled out and if constant T , ’ s are assumed, a compartment might be exposed by comparing the results of a saturation transfer experiment with that of an inversion transfer experiment. The computer modeling of these exchange reactions, which is presented in a later section, demonstrates that unless these special conditions hold, it may be difficult to distinguish compartmentalization from alternate pathway effects. Nunnally and Hollis present additional data obtained from potassium chloride-arrested hearts and hearts recovering from an episode of ischemia. Both these preparations were not in a stable physiological state, and for this reason the data is difficult to interpret. Additional data comparing T , ’ s of ATP obtained from control and anoxic hearts are presented; but, because the effect of the presumed

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

39

compartmentalization has not been taken into account, the variation in T,'s may be a side effect. The CPK reaction in cardiac muscle has been examined more extensively in an article by Matthews et al. (1981). In a nonworking mode (i.e., when the left ventricle is not emptying its contents into the aorta but is made to contract isovolumetrically), the rat heart gives different results than the rabbit heart. For the rat heart, in contrast to the rabbit heart, saturation of yATP produces changes in the intensity of Pi, a result indicating that alternate pathways out of yATP have a significant effect. Nonetheless, provided no compartments exist, the forward flux can be measured and is reported to be 14.6 pmol g dry weight-' sec-' (reverse = 1.8 Fmol g dry weight-' sec-I). Using a wet weight:dry weight ratio of 5, taken from Ingwall (1982), this becomes 73 pmol g wet weight-' sec - I , which is roughly 13 times greater than that observed in the nonworking cat skeletal muscle. Using the oxygen consumption measurements reported by these authors, net ATP utilization rates in these hearts can be estimated to be 10.5 pmol g - sec - Again, the CPK flux exceeds the net ATP utilization rate, here by a factor of 7. The data from heart that has been discussed were obtained from preparations that were in a nonworking mode. It will be of interest to see if these results concerning the CPK reaction continue to hold in a working heart, (where the left ventricle is allowed to empty), as the work load of the left ventricle is made to increase. Can the ATP utilization rate ever exceed the CPK flux? It appears as if conditions can be found in which CPK activity may become limiting. Ingwall and Fossel(l980) have studied hearts from spontaneously hypertensive rats. The CPK flux in the forward direction in these hypertrophied hearts was found to be decreased as compared to normal controls. This result has intriguing implications in terms of the proposed function of the CPK reaction. The CPK reaction has also been studied in two species of brain tissue: the turtle brain (Wemmer et al., 1982) and the rat brain (Shoubridge et al., 1982). From rat brain measurements the forward flux is reported to be 1.64 pmol g wet weight-' sec- I , and, as usual, the reverse flux cannot be evaluated by the twosite model. Oxygen consumption measurements were not made on these preparations, but an estimate of 3 pmol g wet weight-' min-' compiled from other sources is available. Taking this as an upper estimate (because the rats in this preparation were anesthetized), a maximal net ATP utilization rate is 0.3 Fmol g - sec- I . This is less than the CPK flux by roughly a factor of 5. The authors of this article use an NMR method to obtain an independent measure of the ATP synthesis rate. This approach will be discussed in the next section. Their value, like that estimated here from 0, consumption, is also less than the CPK flux. The turtle brain measurements are reported as rate constants rather than as fluxes. Because the rate constant is pseudo-first order, it cannot be compared with these

'.

40

ROBERT R. DeFURIA AND MARY K . DYGERT TABLE I

TI VALUES(SECONDS)in Vivo A N D in Vitro PCr

yATP

p,

0.6 2.I 1.8 2 0.1

0.9 1-3 1.2 +. 0.01

1.9 +. 0.2

4 . 8 t 0.5 3.7 3.2 5 .O 5.5

I .6 I .5 I .4 0.2 2.4 -

-

4.2

*

-

3.8 4.9

2

0.2"

-

-

3.0 0.4 -

-

Sample Rat heart Rat heart Rat heart Frog muscle Frog skeletal muscle Frog Rat brain Turtle brain E. co/i cells CPK/Mg2+ solution PCr/Mg2+ solution"

Reference Matthews e t a / . (1981) Brown et al. (1978) Nunnally and Hollis ( 1979) Cohen and Burt (1977). Brown et a/. (1978) Gadian et a/. (1981) Shoubridge et a/. (1982) Wemmer et al. (1982) Brown et a / . (1977) Brown et al. (1978) Cohen and Burt (1977)

(INot undergoing chemical exchange.

constants obtained from other preparations. In this work, however, an interesting study is made concerning the value of the CPK rate constants in the brain of a diving turtle. Unfortunately, PCr levels decrease continually throughout the dive; and as in the case of stimulated skeletal muscle, the CPK fluxes can be only crudely estimated. The intrinsic relaxation times of various components determined in saturation transfer experiments are compiled in Table I. For PCr, because it is presumably involved in a two-site exchange reaction, the two-site model correctly provides an intrinsic T I ,which, therefore, can be compared to a T I obtained from solutions containing phosphocreatine (PCr). The extent to which these quantities differ may be an indication that there are intracellular factors other than chemical exchange that contribute to the NMR relaxation. Other variations seen in Table I, however, are most likely due to experimental error. For yATP and Pi, the twosite model does not adequately describe the exchange, and, hence, all these T,'s are apparent values and cannot be compared confidently with intrinsic values measured in solution. One point to note is that apparent T , ' s (especially for yATP) would be expected to vary significantly as the metabolic rate changes. It is our opinion that in the related field of NMR imaging an effort should be made to exploit these differences to try to distinguish various regions in tissues that differ metabolically.

E. ATPASEACTIVITY In many of the preparations described in the previous section, changes in the intensities of both inorganic phosphate and yATP resonances are observed fol-

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

41

lowing saturation or inversion of yATP. Analysis of these changes by a two-site model provides an estimate of the flux of Pi into the ATP pool. For aerobic preparations, this flux has been equated with the net ATP synthetase rate (Matthews e? a / . , 1981; Shoubridge et a / . , 1982). There are several assumptions required in order to interpret the data in this way. First, alternate pathways into and out of the Pi pool must be neglected. Accepting this assumption, what will this kind of experiment actually measure? Unlike the CPK reaction, the exchange between Pi and yATP involves a number of enzymes, including all the ATPases of the cell. From the standpoint of the principle of microscopic reversibility, there are associated with each of the ATPases unidirectional fluxes in both the forward and reverse direction. Summing over all these ATPases means adding together all of these unidirectional fluxes, and because ATP levels remain constant, the algebraic sum of all these exchanges with ATP must be zero. The unidirectional fluxes associated with the mitochondrial ATPase might be expected to contain a contribution from one of the partial exchange reactions involved in the mechanism of oxidative phosphorylation (see Racker, 1976a). Equating the unidirectional flux measured in an NMR experiment to a net ATP synthetase rate is equivalent to assuming that these partial reactions do not occur and that each of the ATPases in the cell operates irreversibly. Because the ATP synthetase rate can be determined independently by measurement of 0, consumption rates, the validity of this assumption can be tested. In the perfused rat heart preparation (Matthews e t a / . , 1981) as well as in the rat brain (Shoubridge et a l . , 1982), excellent agreement between these rates is found. In rat heart 2.8 Fmol Pi+ATP g dry weight- I sec- I compared reasonably well with a value of 2 pmol g dry weight- sec- I determined from 0, consumption measurements. In brain, the corresponding values are 0.33 Fmol g wet weight- I sec- I and 0.3 pmol g wet weight - sec- I , respectively. In yeast cells, on the other hand, a large discrepancy between these quantities is found (Alger e t a / . , 1982). In these cells the Pi+ATP flux is 3.5 Fmol g wet weight-' sec-I, which undergoes a 10-fold reduction upon addition of oligomycin to the bathing medium. Even in the presence of oligomycin, this flux exceeds the rate of ATP production of 0.12 Fmol g- sec - I determined from 0, consumption. Oligomycin inhibits the mitochondrial ATPase that is reversed during oxidative phosphorylation. The transfer of saturation from ATP to Pi has been studied in other cells as well. Brown et a f . ( I 977) found that the transfer in Escherichia coli could be eliminated following addition of an ATPase inhibitor. In red blood cells (Gupta, 1979) and in skeletal muscle (Meyer et a / . , 1982), no such transfer could be detected. Because of the complexities associated with this exchange, it seems premature to equate the measured phosphate transfer with an ATP synthetase rate, and it may be necessary to turn to a simpler system, such as a suspension of mitochondria, in order to sort out some of these problems.

42

ROBERT R . DeFURIA AND MARY K . DYGERT

F. COMPUTER MODELING OF

THE

BLOCHEQUATIONS

Because most reactions in vivo are in a steady state rather than at equilibrium, the two-site double resonance experiments are not adequate to model these multisite exchanges. The Bloch equations can be modified to account for multisite exchange (Forsen and Hoffman, 1969), but the data obtained from living organisms are often too poor to make a multisite analysis worthwhile. The approach frequently taken is to treat the exchange as if it were two site, while assuming that the alternate pathway or compartmentalization effects are small. Computer modeling can be used to assess the validity of this approach. A set of coupled differential equations analogous to Eqs. (3a) and (3b) were solved to model the behavior of the following three-site exchange:

A S B S C FBA

FCB

where F,, denotes a unidirectional flux from site I to J . The parameters used to simulate the fluxes F A , and F,, were chosen so as to reproduce data obtained from the in vivo experiments on frog skeletal muscle (Gadian er al., 1981). The flux to C was varied, and the effect of the magnitude of this alternative flux on the computed magnetization in B is shown in Fig. 3. The calculated M , are plotted for experiments in which site A is saturated for time r (following instantaneous saturation at time t = 0); for four different values of the flux to C, namely, 0, 0.1, 1 .O, and 8.0 X FBA.As discussed earlier, the initial slopes are identical for all graphs and are thus independent of the magnitude of the alternate pathway to C. However, ME is given by the equation:

This M , differs from the two-site [Eq. (6)] for a small flux to C (0.1 X F,,) by about 3%. Because the measurement of an NMR resonance is roughly accurate to + 5 % , it is tempting to ignore this alternate pathway contribution as being negligible. But, there are two parameters needed to compute the rate constant kBA; ME and an apparent relaxation time for B , 71B. When only two sites are involved, is correctly evaluated by a progressive saturation experiment during which A is held saturated or by evaluation of the time constant associated with the simple exponential behavior of the M , versus time data. It should be apparent from the results of our computer simulation shown in Fig. 3 that when a

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

43

0.9

MB

0.8

0.7

FIG. 3. Computer simulation showing the behavior of the magnetization in site B for the three-site chemical exchange model ( A e B e C ) . The computed magnetization M , in site B is plotted as a function of the time that site A is saturated. The results for four different chemical fluxes from B to C are shown. The lower graph corresponds to a zero flux from B to C. The graphs above this one represent fluxes from B to C which are 0. I , I . O , and 8.0 times the flux from B to A, respectively. Data taken from 0. Alach, M.S. thesis, Worcester Polytechnic Institute, Biomedical Engineering Program.

third site is involved and only A is saturated, the decay of M , can no longer be modeled by a simple exponential function, and, therefore, both M$ and T,, are incorrectly calculated. Thus, the problem becomes more severe as the magnitude of the flux to C increases. The effect on M g as the flux to C increases is shown in Fig. 4. Computer modeling can also be used to simulate a compartmentalization of B and to compare compartmentalization effects to an alternate pathway effect. In Fig. 5 , M , is plotted (upper curve) for a case in which there is two-site exchange but in which 25% of the substrate B has been made inaccessible to the enzyme catalyzing the A$B exchange. This graph is very different from the two-site exchange when none of B is compartmented (lowest curve). However, it is nearly indistinguishable from the results of a three-site exchange model with no

44

ROBERT R. DeFURIA AND MARY K. DYGERT

0.75

0.70

0.65

I

I

2

I

I

4

I

I

6

I

I

8

I

FBC/FBA FIG.4. The steady-state value of the magnetization in site B (from Fig. 3). Mg,is plotted as a function of the ratio of the rate of chemical exchange from B to C to that from B to A, FBCIFA. The flux from B to A (FBA) was held constant while the flux from B to C (FBC) was varied as described in Fig. 3. The point on the graph designated with an open circle represents the value of Mg computed for the case FBClFBA = 0 with 5% of B compartmentalized so that it is unavailable for chemical exchange with site A, although it contributes to the total NMR signal from B.

compartmentalization in which F , = 0.722 X FBA.These graphs have identical A4; values but a different time dependence, reflecting the complex way in which exchange and compartmentalization contribute to the apparent relaxation in B. A systematic study showed that a 5% compartmentalization of B produced a significant change in the apparent ME.The extent of this change is indicated in Fig. 4, where it can be compared with the effect of three-site exchange. It is possible that compartmentalization of this magnitude occurs in vivo.

G. SUMMARY A N D CONCLUSIONS The double resonance experiments discussed in Section I have been successfully applied to the study of the kinetics of the creatine phosphokinase reaction in a variety of systems. Other reactions have been studied as well, but interpretation of the data is difficult as these reactions are not at equilibrium. Because of the

45

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

0.9

0.8

0.7

I

1

I

I

3

I

I

5

Seconds FIG. 5. Computer simulation showing the behavior of the magnetization in site B, M B ,when a portion of B is compartmentahzed and unavailable for chemical exchange with site A . MB is plotted as a function of the time site A is saturated. Three conditions are given to show (1) the effect of chemical compartmentation in site B and (2) that compartmentation and multisite exchange can be almost indistinguishable in a saturation transfer experiment. The lower graph represents the results for a simple two-site exchange model ( A C B ) with no compartmentation in B. The upper graph shown by (- - -) represents the results for a three-site exchange model ( A e B e C ) with no compartmentation in site B , and the chemical flux from B to C equal to 0.722 times the flux from B to A. The other upper graph shown by (-O-)represents the results for a compartmented two-site exchange model ( A e B ) with 25% of B unavailable for chemical exchange with A. Data taken from G. Alach, M.S. thesis, Worcester Polytechnic Institute, Biomedical Engineering Program.

limitations associated with the double resonance experiments, it will be necessary to supplement data obtained in this way with data obtained from other kinds of NMR experiments to obtain a complete and accurate picture of in vivo chemistry. Multisite saturation experiments, for example, could be very useful in terms of uncoupling the Bloch equations so as to reduce relaxation in the site of interest to a simple exponential process. Alternatively, it may be possible to obtain data at very early time points in an inversion transfer experiment and, thereby, exploit the advantages produced by measurement of initial slopes. A very exciting new development that will undoubtedly supplement the double

46

ROBERT R. DeFURIA AND MARY K. DYGERT

resonance methods is the application of two-dimensional Fourier transform methods to the study of chemical exchange (Jeener et al., 1979). The twodimensional methods offer several advantages over the one-dimensional magnetization transfer methods. First, in a single experiment, all the chemically exchanging sites can be simultaneously identified. Second, rate constants can be obtained independently from T , relaxation. This technique has been successfully applied to study enzyme-catalyzed reactions in viho at equilibrium (Balaban and Ferretti, 1982), and work is in progress on application of this new technique to in vivo systems. In addition to this, new NMR methodology advances are being made that enable biological preparations to be maintained in a stable physiological state in the NMR magnet for long periods of time. For example, a continuous-perfusion culture tube-probe system has been developed (Gonzalez-Mendez et al., 1982) in which cells are cultured directly in the NMR tube and perfused through a network of artificial capillary tubes. Were it not for technical advances such as these, the two-dimensional experiments could not be applied because long-term stability is required in order to acquire sufficient data. The field of whole organ enzymology is developing very rapidly, as is the field of medical imaging by NMR. The eventual merger of these two areas of research will provide an entirely new way of observing the complex chemical reactions that occur in living systems. The possibility of doing medical imaging in a manner that distinguishes normal from abnormal tissue on the basis of their differing metabolic rates is an exciting one because of the arsenal of available pharmacological agents that can be used to modify metabolic rates.

111. Relationship of the Energetic State of Cells and Their Biology A. OVERVIEW The second part of this article reviews data concerning measurements of ATP at the cellular level. We know that cells utilize the free energy available from phosphate transfers involving ATP to ensure that certain reactions are energetically favorable. It is unclear whether the availability of ATP normally limits the ability of cells to accomplish specific processes and whether there is a hierarchy to an ATP limitation such that certain processes are threatened before others. Figure 6 gives an indication of how the magnitude of the free energy available from ATP depends on ATP, ADP, inorganic phosphate, and hydrogen ion concentrations. Are there conditions when the availability of ATP limits certain cellular functions? Does the extent of this limitation follow from Fig. 6? These questions remain unanswered, but they were taken into account in the discussion that forms the remaining part of this article.

47

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

I

I

1

1

I

2

I

I

3

I

1

I

4

ATP UTILIZED, millimoles

FIG. 6. Calculated free energy available per mole of phosphate transfer in the reaction: ATP+ ADP molesiliter and is assumed to be constant. Changes in the degree to which the nucleotides are saturated with magnesium are ignored. The value of the equilibrium constant for the reaction ATP+ ADP + P, + H was chosen to be 4.56 x 10-6 (moleiliter)* so that for the initial condition: ATP = 5.0 mM, ADP = 0.02 mM. inorganic phosphate (P,) = I .O mM, there would be 10,000 calories per mole available from ATP. The following formula was used to calculate G (the calories per mole available from ATP):

+ P, + H + ,The hydrogen ion concentration, (H+),is equal to lo-'

+

G = 1417 log

[(ADP) x P, x 10-7]/(ATP) 4.57 x 10-6

G is plotted as a function of ATP utilized for three initial conditions: middle graph-5.0 mM ATP, 0.02 mM ADP, and 1 .O mM Pi; horiom graph-2.5 mM ATP, 0.01 mM ADP, and I .O mM Pi; rop graph-same as the middle graph with the addition of 20 mM phosphocreatine (PCr) and 10.0 mM creatine (Cr). In calculating G, it was assumed that PCr and Cr were maintained in chemical equilibrium with ATP and ADP by the creatine kinase reaction. To make the calculations as ATP is utilized, ADP and Pi are allowed to increase stoichiometrically.

48

ROBERT R. DeFURIA AND MARY K . DYGERT

Fritz Lipmann is credited with coining terms such as “phosphate current” and “metabolic wheel” and demonstrating that these gave insight into how cells utilize and restore chemical potential energy (Lipmann, 194 1). Recent data would not have enabled Lipmann to develop his notion of a “phosphate current” any further or have enabled Hans Krebs to leave us with any better insight into the biology of ATP than he accomplished in his famous Herter Lectures (Krebs, 1954). It is sometimes argued that “metabolic compartmentation” offers a new twist, a fresh direction for research (Bessman et al., 1978). However, the functional importance of compartmentation has yet to be demonstrated (DeFuria et al., 1980; Katz and Rognstad, 1978). Acknowledging that certain reactions involving ATP are localized in certain regions of a cell is not proof of a functional compartmentation. Most of the existing data can be understood if these reactions are viewed as a functional syncytium. That is, the effects of a chemical change in one region of the cell are felt immediately and uniformly throughout the cell. In any case, those who are interested in the biology of ATP might be advised to follow the advice of Efraim Racker, “If you have no new ideas, use new techniques” (Racker, 1976b).

B. DIFFICULTIES IN INTERPRETATION

OF

EXPERIMENTAL DATA

Data on how the energetic state of cells is related to their biology requires a framework into which the various pieces of the puzzle can be placed. The values of two parameters provide such a framework: (1) the “free energy” available from ATP, and (2) the total rate of ATP use and restoration (i.e., the steady-state ATP turnover). With this information, any measured change in cellular ATP content, rate of use, or rate of restoration can be viewed in a proper perspective. The value of these parameters can be estimated from work related to cancer or the biology of aging. Such studies have investigated the relationship between the rate of growth of different kinds of cells in culture and their metabolism. Cells utilized in such studies have been obtained from animals (including humans) and different tissues plus normal, viral-transformed, and malignant cell cultures. Comparison of such data from different laboratories is problematic. There is variation in experimental protocols and in the normalizing parameters used to report data. The cells studied differed metabolically, and some subtle variations in experimental conditions not perceived to be relevant may have metabolic effects. Finally, an important variable to be considered is the population doubling level of the cells used (in vitro age). The remaining portion of this article is an attempt to unify the published data and find common normalizing parameters rather than stress these variances. Examples of such variances encountered are presented in the following list:

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

49

1 . Human fibroblasts derived from biopsies taken from different sites differ in terms of glucose and serine metabolism (Lemonnier et ul., 1980). Thus, it follows that even when biopsies are obtained from the same donor there are tissue-specific differences among fibroblasts, either in the metabolic pathways themselves or in their regulation. 2. Cultures of “normal” human fibroblasts can be propagated for a finite number of replications. The normal growth curve of the finite life span has three parts: (1) the initial biopsy; (2) rapid logarithmic growth; (3) slowing down of replication and eventual phase out of cells (late PDLs). The late population doubling levels (late PDLs) contain two kinds of cells: those that are leaky to inulin and loosely attached, and those that are impermeable to inulin and firmly attached (Cremer et al., 1981). This means that biochemical assays undertaken on heterogeneous cultures can be misleading, and care should be taken to decrease cell heterogeneity. The PDL of a culture is an estimate of the cumulative number of replications undergone by the cells in that culture. It is calculated as follows: PDL = Cn. where n = 3.32(log N - log N o ) . N is equal to the total number of cells in the culture at the time the PDL is calculated and No is the number of cells originally seeded to start the culture. 3. The calculated population doubling level of a culture may be misleading in that a subset of the fibroblasts, when maintained in culture, leave the cell cycle (Absher et al., 1974). Therefore, biochemical assays carried out on mass cultures of cells need to be interpreted with care. 4. For a variety of cells maintained in culture, there is evidence for “metabolic compartmentation” regarding ATP and related metabolites and enzymes (Rapaport, 1980; Eckert et al., 1980; Sinclair, 1980). This research indicates that there are nuclear-cytoplasmic gradients of ATP during a portion of the cell cycle and that creatine kinase is associated with the cytoskeleton of cultured mammalian cells. These results further complicate the interpretation of biochemical measurements made on extracts of cultured cells. 5. Cellular and nuclear volumes are closely correlated during the cell cycle, but their ratio does not remain constant (Steen and Lindmo, 1978). This fact, coupled with a nuclear-cytoplasmic gradient for ATP, makes it difficult to calculate the relevant concentration of ATP from its biochemical assay. 6. A subtle variable that complicates the comparison of metabolic data from different experiments and different cells is cell shape. It has been suggested that rates of protein and RNA synthesis are dependent on cell shape (Wittelsberger et al., 1981). 7. The pH of cell cultures in bicarbonate-buffered media has been known for some time to undergo cyclic variation in phase with normal feeding (Eagle, 1971). Use of nonvolatile buffers have effected a partial pH stabilization, but even small external oscillations may act in unison with the natural oscillations

50

ROBERT R. DeFUR.IA AND MARY K . DYGERT

that can occur in metabolic pathways to produce important effects (Richter and Ross, 1981). C. ATP/ADP COMPARTMENTATION AND THE CELLCYCLE All of the possible drawbacks discussed thus far suggest additional experiments that will eventually clarify the situation. One of us (RDF) has recently undertaken metabolic studies related to the biology of cellular aging. The possibility of a nuclear-cytoplasmic gradient for ATP and its relationship to the cell cycle and replicative potential promises to be a particularly exciting area of research. A number of reports emphasize the application of current techniques to the study of cellular energetics. In African Green monkey kidney cells (BS-C-1) and mouse fibroblasts (3T6) (both of which have indefinite life spans), adenosine increases the nuclear compartment pool of ATP and the nuclear ATP:ADP ratio. Similarly, adenine increases the total cellular pool of ATP and the total ATP:ADP ratio, but it does not induce the nuclear changes seen with adenosine (Rapaport, 1980). These data support the existence of a functional nuclear ATP compartment. Definitive evidence for metabolic compartmentation comes from isotope tracer studies, in which it can be shown that the fate of a metabolite depends on its source. An excellent example of this approach is the study of the compartmentation of glycolysis in Escherichia coli (Moses, 1978). Identical cultures were incubated with glucose, galactose, and lactose present simultaneously. However, either [ ‘‘C]glucose, [‘4C]galactose, [ 14C]glucose(lactose), or [ ‘‘C]galactose(lactose) were labeled with isotope. The specific activities of these labels were arranged so that the intracellular precursors of citrate, succinate, and glutamate achieved the same steady-state specific activities. When identical cultures differing only in their isotope label were compared, it was found that the labeling pattern of citrate, succinate, and glutamate was different when the free sugars, glucose or galactose, were labeled than when their disaccharide, lactose, was labeled. This indicates that free glucose or free galactose taken up by E . coli from their media contribute to a different intracellular metabolite pool than the glucose and galactose created by the hydrolysis of lactose by P-galactosidase. The results of an analogous experiment designed to expose a nuclear ATP pool in cultured normal fibroblasts would be very informative, although the data already obtained from the adenine and adenosine studies strongly suggest that a nuclear ATP compartment does exist. The increase in nuclear ATP induced by adenosine is greater in untransformed (“normal”) cells than in transformed (“indefinite replication”) 3T6 cells. Furthermore, such increases are reduced in primary chick embryo fibroblasts when they are transformed by Rous sarcoma virus (Rapaport, 1980), indicating that increased replicative potential is accompanied by a decrease in the nu-

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

51

clear-cytoplasmic compartmentation of ATP. It is known that a lowered ATP:ADP ratio and a decreased nuclear ATP content favor DNA replication in vitro (Rapaport et al., 1979). Increases in nuclear ATPase and AMP deaminase occur in 3T6 cells upon their entry into the S phase of their cycle (Rapaport, 1980). Taken together, these data suggest that the nuclear ATP compartment may have growth regulatory properties. Thus, a cytoplasmic influence on the cell cycle or replicative potential may be exerted through regulation of the nuclear ATP pool. If the size of the nuclear and cytoplasmic ATP pools and ATP:ADP ratios are viewed as phenotypic properties (Atkinson, 1970), then it seems that the techniques of cell hybridization and micromanipulation of cellular components (i.e., nuclei and cytoplasms) can be applied to investigate the possible role of the cytoplasm in regulating the nuclear ATP compartment. The recent availability of metabolic mutant animal cells together with cell reconstruction techniques offers a novel approach to the study of metabolic control. A variant of Chinese hamster ovary (CHO) cells has been found that contains reduced activities of phosphoglucoisomerase and phosphoglyceralkinase (Morgan and Faik, 1980). This variant has a diminished capability to convert glucose to lactate as expected, yet it grows on glucose at almost the same rate as wild-type cells. The effect of the variant’s cytoplasm on the wild-type cells would make an interesting metabolic study. Cell reconstruction experiments have been informative in defining nucleocytoplasmic relationships. Nuclear transfers in amoeba established long ago that certain phenotypes had a cytoplasmic origin (Danielli, 1959). It is known that the injection of cytoplasmic extract or fractions of cytoplasm can alter a cell’s replicative mode (Muggleton and Danielli, 1958; Danielli and Muggleton, 1959; Muggleton-Harris et al., 1982a). Cell hybridization studies using normal and transformed human fibroblast cells (Muggleton-Harris and DeSimone, 1980) and also using lens epithelial cells cultured from noncataractous and cataractous mice (Lipman and Muggleton-Harris, 1982) have shown that the cytoplasm can modify a cell’s replicative potential. Some facts of a technical nature can be learned from these kinds of hybridization studies and are relevant to the complications listed earlier (i.e., assaying heterogeneous populations of cells from mass cultures). Results from many experiments using mass cultures implied that the transformed state is dominant in somatic cell hybrids obtained from the fusion of finite life span cells with transformed or malignant cells, or their components (Stanbridge, 1976; Croce and Koprowski, 1974; Norwood et al., 1975; Stein et al., 1981). Using cloned isolates derived from a cell where a nucleus (karyoplast) is combined with a cytoplasm, it was found that the finitecontrolled life span state was dominant despite fusion with transformed or malignant components (Muggleton-Harris and Palumbo, 1979). Working at the cellular or clonal level offers several advantages over the use of mass cultures,

52

ROBERT R. DeFURlA AND MARY K. DYGERT

advantages such as the ability to select viable and defined cell components and the ability to observe and detail individual cells. Therefore, it would be worthwhile to combine such techniques with the relevant biochemical assays to study the possible cytoplasmic regulation of the nuclear ATP compartment. One such ATP assay and two other assays that measure the potential for ATP restoration are discussed in Section II1,F. D. NORMALVALUES FOR “ENERGETIC STATE” Fibroblasts are normally cultured in minimum essential medium (MEM), which contains approximately 5 mM glucose and 2 mM glutamine and is supplemented with 10% fetal bovine serum. It has been established that under these conditions greater than 50% of their ATP requirement is derived from the oxidation of glutamine, and most of the glucose carbon is converted to lactic acid (Reitzer et al., 1980). In other situations in which glucose is limiting, glutamine can provide even a larger portion of this ATP requirement (Zielke et al., 1978; Donnelly and Scheffler, 1976). It appears that the only essential need for sugar is to provide ribose-5-phosphate via the pentose pathway for nucleic acid synthesis (Romano and Connell, 1982; Reitzer et al., 1979, 1980). Glutamine is the primary energy source for human diploid fibroblasts grown in MEM lacking glucose but containing 100 pM hypoxanthine, 40 pA4 thymidine, and 100 pM uridine, which function as ribosyl donors in the form of pyrimidine nucleosides (Reitzer et al., 1980). The role of glucose as a carbon source for the pentose pathway is supported by experiments that have measured the rate of glucose uptake by fibroblasts; these experiments have shown that glucose is not a primary determinant of growth rate under the usual conditions of cell culture (Romano and Connel, 1982; McKeehan et al., 1981). The energy metabolism of cultured human fibroblast cells during aging in vitro has been studied (Goldstein et al., 1982). Old cells consumed more glucose and produced more lactate during growth, but their oxygen consumption and ATP and ADP concentrations were similar to those of young cells. Table I1 contains data that describe the energetic state of fibroblast cells maintained in culture. These data were selected from a variety of studies, and it was necessary to make a “best guess” as to the value of normalizing parameters in order to complete the table with numbers having similar units. The “best” normalizing parameter for the expression of biochemical data should reflect the “meaning” attributed to the data. Figure 6 indicates that the size of an ATP pool has meaning in terms of a concentration. In this case moles of ATP expressed on a per unit volume basis is appropriate. The extent to which cells are supplied with an essential nutrient may best be studied by expressing data per unit volume or per unit protein, an indication of cell mass is required in this case. A comparison of transport rates per unit area of cell surface is necessary to interpret differences

TABLE I1 THE ENERGETIC STATE OF FIBROBLAST CELLS UNDER “NORMAL”CULTURE CONDITIONS

Sample or reference

(

ATP turnover nanomoles/min mg protein

)

Chemical lifetime of ATP

(

Rate of growth mg pr;;kidrnin Y

) (

Protein content mg et;:ni

1

)

(set) ~

Romano and Connell (1982) Reitzer et al. (1979) Zielke et al. (1978) Donnelly and Scheffler (1976) DeFuria and Muggleton-Harris (1982) Neonatal human donor Early PDL Middle PDL Late PDL 68-year-old human donor Early PDL Middle PDL Late PDL

(

Cell volume pic2liers

73.0 45.0 28.0 292.0

0.320 0.520 0.840 0.080

1.74 x 10W5 0.83 x 1 0 - 5 1.56 X 10W5 13.9. x 1 0 - 5

0.78 0.54 0.28

0.29 0.85 I .oo

0.051 x 10-5 0.033 x 10-5

0.36 0.12 0.02

1.41 3.11 9.63

~

~

ATP conc. (d)

~~

0.625 x 10-6 0.15 x 10W6

3.33 0.80

4.4

0.001 x 10-5

1.1 x 10-6 1.3 x 2.0 x 10-6

4.7 6.2 6.0

3.2 5.8 5.6

0.020 x 10-5 0.041 x 10-5 0.002 x 10-5

1.8 x 10-6 3.3 x 10-6 12.0 x 10-6

7.6 8.4 21.0

7.2 8.8 6.6

54

ROBERT R . DeFURlA AND MARY K . DYGERT

TABLE 111 VALUES OF VARIOUS NORMALIZING PARAMETERS MEASURED UNDER THE SAME CONDITIONS FOR HUMANEMBRYO LUNGFIBROBLASTS; FLOW2000~' Percentage of in v i m life span completed mg protein/l06 cells p,l water/l06 cells prn2 surface area x IO-9/lO6 cells rng protein/pI water

40 2.0

60 0.62 2.1

80 0.69 3.0

0.34 0.23

0.23

100 I .34 6.4 0.25 0.21

QFromCremer er al. (1981).

in membrane function. All these measurements are possible, although estimation of cell surface is the most difficult to obtain. The problem encountered in comparing data from different laboratories is that the data reported are normalized to different parameters (i.e., per cell, per milligram total protein, per microliter cell water). For example, it was found that the maximal transport capacity per cell for 2-deoxyglucose increased almost 2-fold with increasing age in vitro, whereas no increase was found when the results were expressed per milligram total cell protein (Germinario et a l . , 1980). However, this work is consistent with others when the increase in surface area with in vitro age is taken into account (Cremer et ai., 1981). When the values of these normalizing parameters are measured under the same conditions, there are no contradictions. Table 111 contains data from one extensive study that used human embryo lung fibroblasts (Flow 2000) (Cremer et al., 1981). In this study cell volumes were estimated by calculations based on the size of the cell spheres seen in enlarged, phase-contrast micrographs of cells suspended in Neubauer chambers, the [3H]water space corrected by a [ 14C]inulin space, and a linear graphical interpolation of [ 14C]glucose uptake data to time zero. All these methods gave similar values. Surface areas of individual cells were determined by planimetry from enlarged negatives with the assumption of smooth spheres. The surface area per lo6 cells was estimated either by integrating the surface area of 1000 individual cells or by taking into account the mean cell space, assuming the cell sample to be uniform in size. Both estimates were in agreement despite the heterogeneity of cell size that occurred when cells were cultured to a late PDL. This indicates that in terms of cell size there was one population of cells distributed about a single mean, Cell size and the ratio of cytoplasmic to nuclear volume has been reported to change during the cell cycle. For example, in NHIK 3025 cells, which are derived from a cervical carcinoma, the mean cell volume grows exponentially during S phase whereas the rate at which nuclear volume increases is greater (Steen and Lindmo, 1978). Cellular and nuclear volumes were closely correlated during the cell cycle, but their ratio did not remain constant. The mean value of the ratio of cytoplasmic to nuclear volume was approximately 4.5. This value

55

METABOLIC MEASUREMENTS IN CELLS A N D ORGANS

oscillated from a high of 5.0 at the middle of G, to a low of 4.0 during the late S phase. During G I , G,, and M, the total cell volume growth was negligible, as it was for the nucleus. Another feature worth mentioning is that total cell protein content, expressed on a per cell basis, is dependent on the cell density of the culture. With increasing cell density, there is a corresponding decrease in the total protein per cell. For 3T3 cells the total protein per cell decreased from 0.04 X lop6 to 0.02 X mg protein/cell as the culture density increased from 0.067 X to 0.533 X cells/cm2 (Romano and Connell, 1982). E. SOMESPECIFIC ATP COSTS

The data shown in Table I1 indicate what can be expected when cultured fibroblast cells are assayed to determine their energetic state and can provide a basis with which to evaluate the energetic impact of a biochemical process. These data indicate that the chemical lifetime of ATP is on the order of 1 second. This value is consistent with NMR data on mammalian organs (Matthews et ul., 1981; Nunnaly and Hollis, 1979) and shows that the rate of ATP restoration must, even in the very short term, keep up with the rate of ATP utilization in order that a constant supply of free energy be made available from ATP (see Fig. 6). The phosphorylation of outer membrane proteins (one of the many biochemical steps in G,) represents 10% of the total ATP turnover. This phosphorylation is necessary but not sufficient for cells to move into S phase (Mastro, 1979). Serum-deprived quiescent fibroblasts incorporate [y3,P]ATP at a net rate of 0.001 kmol min-' mg protein-', and this level of phosphorylation was increased 2- to 4-fold prior to the onset of S phase when the cells were stimulated to reinitiate growth by adding serum. A 10% turnover is a conservative estimate in that the measured incorporation of [Y-~~PIATP was probably the result of the simultaneous activity of kinases and phosphatases. During anaphase, ATP is required for chromosome separation, but it does not appear that the migration of the chromosomes to separate poles represents a significant energetic cost. It is possible to increase the permeability of cells by a controlled mild lysis in a manner that is compatible with partial maintenance of chromosomal movement (Cande, 1981a,b). This method was used to study the relationship between ATP and chromosomal movements during anaphase in cells that were undergoing mitosis (Cande, 1982). Cells from the rat kangaroo (Potorous triductylis) were used for these experiments because they possess a large metaphase spindle ( l o - ' * pm). During mitosis these cells do not completely round up as do most dividing cells but remain flattened on their culture dish, which means that the position of their chromosomes can be followed under Nomarski or phase optics. It was found that chromosome position determined in this manner was within 3% of that measured from electron micrograph studies. The rate at which the chromosomes in unlysed cells separated was 2.40 0.53

*

56

ROBERT R. DeFURlA AND MARY K . DYGERT

pm/min. The chromosomes in cells that were made permeable so that the role of ATP could be studied were approximately 30% of this rate. The rate of pole separation (spindle elongation or anaphase B) was found to be dependent on the MgATP concentration in the lysis medium. This dependence appeared to be related to the sum of two processes: one whose rate was saturable at an ATP concentration less than 0.2 mM, and another whose rate was linearly related to the concentration of ATP. The contribution of the linear component in these in vitro experiments to chromosome separation velocity was small. For example, at 5 mM ATP, a change of only 0.01 pm/min resulted from a 1 mM change in ATP, and the value of the saturated component was 0.28 pm/min. The protocol utilized for these experiments makes the results misleading because the actual values for ADP and Pi concentrations were not reported, but we can hypothesize that they remained constant for the various ATP concentrations used. If 10,000 calories/mole were available from ATP at 5 mM ATP, 9864 cal/mole would have been available at 4 mM ATP. Thus, the decrease in available free energy for a 1 mM decrease in ATP under these in virro conditions was only 136 caloriedmole, whereas for the more physiological situation described by Fig. 6, where ADP and Pi increase when ATP decreases, a decrease in 2983 calories/mole of available free energy results. It follows that in vivo we would expect the change in the linear component of chromosome separation velocity to be 0.22 pm/min as opposed to the 0.01 pm/min, which was calculated previously for the in v i m situation. The dependence of the linear component of the chromosome separation velocity on the free energy available from ATP that is exposed by these in vitro experiments would be expected to be amplified in vivo. It appears that chromosome movement during anaphase does not present a significant ATP cost to the cell. The force necessary to pull one chromosome has been estimated to be 10-l3 N (Nicklas, 1971; Taylor, 1965). Moving through a distance of 20 X l o p 6 m, this force would do 2 X 10-l8 J of work or the equivalent of 0.5 X 10- l 8 cal. At 10,000 cal available per mole of ATP used, neglecting the efficiency of the biochemistry involved, this would require only 5 X moles ATP, a small fraction indeed of the 5 X 10-l4 moles ATP present in the cell. The ATP cost of protein turnover in growing tissue is substantial, amounting to a minimum of 20% of the total ATP turnover (Reeds et al., 1982). Both protein synthesis and degradation represent an ATP cost (Laramore et al., 1982). Methods used to measure protein turnover and the biochemistry of this process have been reviewed (Zak et al., 1979; Siekevitz and Zamecnik, 1981). A number of procedures are available that allow one to alter the intracellular milieu without grossly disrupting its organization, and these have been used to study metabolism and macromolecular synthesis (Heppel and Makan, 1977). One such method appears particularly interesting with regard to some of the studies already mentioned. The method has been used to study the energy requirements of protein

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

57

synthesis in transformed mouse 3T3 cells that were “permeabilized” by exogenous ATP (Kitagawa, 1980). It appears that brief treatment of cultures of transformed cells with ATP creates channels in the cell membrane and leads to the depletion of nucleotides, ions, and other acid-soluble metabolites. This situation makes it possible to control the composition of the intracellular milieu with the extracellular medium. The ATP-induced “permeabilization” is reversible, and otherwise impermeable substances can be sealed into transformed cells. Using this technique, it has been found that (1) protein synthesis in ATP-treated transformed cells was reduced to a very low level, whereas untransformed cells were not affected; (2) normal protein synthesis was restored by the addition of certain ions, glucose, and nucleotides; (3) restoration of protein synthesis was 90% inhibited by iodoacetate when ATP-treated cells were provided with the glycolytic factors inorganic phosphate, ADP, NAD, glucose or glucose-6-phosphate, or fructose- 1,6-diphosphate; (4) addition of succinate, inorganic phosphate, and ADP supported protein synthesis, a result demonstrating that mitochondrial oxidative phosphorylation as well as glycolysis could serve as .an energy source; (5) external Mg2 was necessary to support protein synthesis, but not glycolysis; (6) external ATP as the sole energy source was able to support a substantial fraction of normal protein synthesis, although ATP and phosphoenolpyruvate together were required for complete restoration. This suggests that an ATP “buffer” (i.e., an ATP synthesizing capability) is required in addition to the presence of a sufficient concentration of ATP in order that a normal rate of protein synthesis be supported. These permeability changes caused by ATP involve the phosphorylation of an endogenous membrane protein, and this process is reversed by a phosphoprotein phosphatase (Rozengurt et al., 1977; Makan, 1978; Rozengurt and Heppel, 1979). Future studies of this nature should give quantitative information as to the ATP cost of protein synthesis in cells. For example, incubation of these “permeabilized” cells with [Y’~P]ATPwould give a measure of the ATP activity associated with protein synthesis. At the present we rely on various kinds of calculations for this information. For example, it can be calculated that in a cuIture of fibroblast cells initially containing 5.0 X lo4 cells, replicating at a rate of 27.8 cells/min, 1.74 X 10W5 mg of new protein is required (Romano and Connell, 1982), which amounts to an ATP turnover of 0.03 kmol min-I mg cellular protein- as compared with a total ATP turnover of 0.073 pmol minmg cellular protein- I . It is possible that .this calculation is an underestimate because it only takes into account the energy cost of peptide bond synthesis, which is thought to be 1.1 cal/mg protein synthesized (Millward et al., 1976; Butterly and Boorman, 1976). It also assumes that 10,000 calories are available per mole of ATP. Informative experiments would arise from combining cell reconstruction with the method for permeabilizing cells with external ATP. For cells that have been reconstructed with “normal” and “transformed” compo+

’

58

ROBERT R. DeFURlA AND MARY K . DYGERT

nents, it would be interesting to determine if exogenous ATP can act as a permeabilizing agent. Another cellular process that may represent a substantial ATP cost is the Na,K-ATPase. Again, its contribution to the total ATP turnover must be calculated, and many problems associated with this calculation have been documented (Jorgensen, 1980). It has been calculated that the Na,K-ATPase accounts for 50% of the ATP turnover in kidney cells (Sejersted et al., 1977). It appears that the energetic cost of the Na,K-ATPase as a function of in vitro age, replicative potential, and the cell cycle would be a productive area to study, especially if it happens that the energetic state of the cytoplasm influences the ATP content of the nuclear pool. A change in the nuclear content of ATP is an important factor allowing entry into S phase. A substantial, alterable ATPase like the Na,KATPase could be involved in modifying the energetic state of the cytoplasm. F. MEASUREMENT OF ATP

ITS POTENTIAL FOR RESTORATION AT CELLULAR LEVEL

AND

THE

Very few methods are available that can detect 0.1 picomoles of ATP, the amount that is present in an extract from one or a few cells. One such method utilizes firefly luminescence (Lust et al., 1981). This method has been improved by the reduction of contaminating ATPase activity in the light-producing extract obtained from firefly tails. This has enabled the firefly luminescence assay to be used at a cellular level to show that the ATP content of a mouse embryo falls from a value of 0.7 picomoles per cell at the one-cell stage to 0.2 picomoles per cell at the blastocyst stage (Spielman et al., 198I ) . Other metabolites in the range of 10- l 3 to 10- l 5 moles have been measured in single mammalian preimplantation embryos (Wales, 1978). These include citrate, isocitrate, a-ketoglutarate, glycolytic intermediates, nucleotides, and inorganic phosphate. The enzymatic cycling reactions used are not simple procedures but provide the opportunity to study a multitude of biochemical parameters associated with early differentiation. ATP turnover (Table II), when compared to the maximum possible cellular ability to restore ATP, is a parameter that should be taken into account when monitoring “energetic state. ’ ’ The importance of mitochondria1 oxidative phosphorylation to ATP restoration in fibroblast cells has already been discussed. Even in the absence of glucose, ATP concentration can be maintained near normal by glutamine oxidation, but ATP concentration rapidly decreases under anaerobic conditions (Reitzer et al., 1979). An exception is the CHO cell respiration-deficient mutant, which maintains a near-normal value for the free energy available from their ATP, albeit at a 50% reduction in ATP concentration (Soderberg et al., 1980). Thus, they are able to sustain a near-normal growth rate compared to wild-type cells as long as there is a plentiful supply of glucose

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

59

(Defrancesco, 1975). Figure 6 shows that these mutants should in theory be compromised in their ability to survive decreases in ATP concentration even though they can accomplish a normal ATP turnover. For comparison, Fig. 6 shows that the presence of creatine phosphokinase (CPK) in fibroblasts (Eckert et al., 1980) has an opposite effect. Creatine phosphokinase ensures that the free energy available from ATP remains normal even in the face of an increased rate of ATP utilization. The use of rhodomine 123, a fluorescent dye that stains mitochondria, has made it possible to study how mitochondria work in situ (James and Bohman, 1981; Johnson et al., 1981 ; Johnson and Chen, 1980). Rhodomine 123 has been used to follow the increase in mitochondrial mass during the cell cycle of the human cell line HL-60 (James and Bohman, 1981). There was a disproportionate increase in mitochondrial mass relative to cell division in the early portion of the cell cycle, whereas the opposite occurred in the late portion of their cycle. Thus, the mitochondrial proliferation rate differed from the cell growth rate over the cell cycle. It would be of interest to know if these changes in mitochondrial mass affect the rate at which ATP is restored, or what is the physiological significance of such changes in the potential for aerobic ATP restoration. The mitochondrial membrane potential in living cells has also been measured by fluorescent microscopy (Johnson et al., 1981). This technique promises to supply answers to questions concerning the manner in which mitochondria impose a metabolic condition on their environment or are regulated by their environment. It was found that the mitochondria of epithelial cells near the edge of an in vitro wound had a more negative membrane potential (within 2 minutes of wounding) than those cells that were far from the wound edge. The extent to which the additional motility of the cells near a wounded area requires ATP has been studied (Gibbons, 1982), and the implication is that these cells are using and restoring ATP at a higher rate and have a greater negative mitochondrial membrane potential than their more distant counterparts. This suggests that the availability of NADH to mitochondria normally limits oxidative phosphorylation as opposed to an ADP limitation. The opposite conclusion would need to be made for mink cells (CCL64), which demonstrated a decrease in the mitochondrial membrane potential after transformation by feline sarcoma virus (Johnson and Chen, 1980). In studies related to cellular aging, it has been found that human skin fibroblasts in culture have a decreased ability to migrate into a region that has been scraped free of cells when they are taken at a later PDL or from an older donor (Muggleton-Harris et al., 1982b; Brewer and Muggleton-Harris, 1982). Experiments to evaluate the energetic state of these cells to assess the relationship between the energetic state and their functional deficiencies are ongoing. The methods and techniques described in this article demonstrate that, not only is the energetic state of cells and their components possible to assay, but modification or manipulation of metabolic defects at the cellular level is feasible.

60

ROBERT R. DeFURIA AND MARY K. DYGERT REFERENCES

Absher, P. M., Absher, R. G . , and Barnes, W. D. (1974). Exp. Cell Res. 88, 95-104. Alger, J. R., den Hollander, J . A., and Shulman, R. G. (1982). Biochemistry 21, 2957. Atkinson, D. E. (1970). Adv. Enzyme Regul. 9, 207-233. Balaban, R. S., and Ferretti, J . A. (1982). J. Mugn. Res. Med. I (Suppl. I), 15. (Abstr.) Bessman, S . P., Borreback, B., Geiger, P. J . , and Ben-Or, S. (1978). In “Microenvironments and Metabolic Compartmentation” (P.A. Srere and R. W. Estabrook, eds.), pp. I 11-128. Academic Press, New York. Brewer, L. M., and Muggleton-Harris, A. L. (1982). In preparation. Brown, T. R., Ugurbil, K., and Shulman, R. G. (1977). Proc. Nail. Acad. Sci. U.S.A. 74, 5551. Brown, T. R., Gadian, D. G., Garlick, P. B., Radda, G. K., Seeley, J. P., and Styles, P. (1978). Front. Biol. Energ. 2, 1341. Brown, T. R., Chance, E. M., Dawson, M. J . , Gadian, D. G., Radda, G. K.,and Wilkie, 0. R. (1980). J . Physiol. (London) 305, 84. Burt, C. T., Cohen, S. M., and Barany, M. (1979). Annu. Rev. Eiophys. Eioeng. 8, 1. Butterly, P. J., and Boorman, K. N. (1976). In “Protein Metabolism and Nutrition” (D. J. A. Cole, ed.), p. 179. Butterworths, London. Cande, W. Z. (1981a). I n “International Cell Biology” (H. G . Shweiger, ed.), pp. 382-391. Springer-Verlag, Berlin and New York. Cande, W. Z. (1981b). Methods Cell Eiol. 90, 368-372. Cande, W. Z. (1982). Cell 28, 15-22. Cohen, S. M., and Burt, C. T. (1977). Proc. Nail. Acad. Sci. U.S.A. 74, 4271. Cremer, T., Werdan, K., Stevenson, A. F. G., Kehner, K., and Messerschmidt, 0. (1981). J . Cell. Physiol. 106, 99-108. Croce, C. M., and Koprowski, H. (1974). Science 184, 1288-1290. Danielli, J . F. (1959). Ann. N . Y . Acad. Sci. 78, 675-687. Danielli, J. F., and Muggleton, A. L. (1959). Gerontology 3, 76-90. DeFuria, R., and Muggleton-Hams, A. L. (1982). Gerontologist 22, 187. DeFuria, R.,Ingwall, J. S . , Fossel, E. T., and Dygert, M. K. (1980). In “HeartCreatine Kinase; the Integration of Isozymes for Energy Distribution” (W. E. Jacobus and J . S. Ingwall, eds.), pp. 135-141. Williams & Wilkins, Baltimore, Maryland. Donnelly, M., and Scheffler, I. E. (1976). J . Cell. Physiol. 89, 39-52. Eagle, H. (1971). Science 174, 500-503. Eckert, B. S., Koons, S. H., Schantz, A. W., and Zobel, C. R. (1980). J. Cell Eiol. 86, 1-5. Ernster, L., and Schatz, G. (1981). J. Cell Eiol. 91, 227s-255s. Forsen, S., and Hoffman, R. A. (1963). J. Chem. Phys. 39, 2892. Forsen, S., and Hoffman, R. A. (1964). J. Chem. Phys. 40, I 189. Fossel, E. T., Morgan, H. E., and Ingwall, J. S. (1980). Proc. Nail. Acad. Sci. U.S.A. 77, 3634. Gadian, D. G., and Radda, G. K. (1981). Annu. Rev. Eiochem. 50, 69. Gadian, D. G., Radda, G . K., Richards, R. E., and Seeley, P. J . (1979). In “Biological Applications of Magnetic Resonance” (R. G. Shulman, ed.), Chap. 10. Academic Press, New York. Gadian, D. G., Radda, G. K., Chance, E. M., Dawson, M. J., and Wilkie, D. R. (1981). Eiochem. J . 194, 215. Germinario, R. J . , Oliveira, M., and Tayler, M. (1980). Gerontology 26, 181-187. Gibbons, J. R. (1982). Cell Mot. 2, 25-46. Goldstein, S., Ballantyne, S. R., Robson, A. L., and Moerman, E. I . (1982). J . Cell. Physiol. 112, 419-424. Gonzalez-Mendez, R., Wemmer, D., Hahn, G., Wade-Jardetzky, N., and Jardetzky, 0. (1982). Eiochim. Eiophys. Actu 720, 214.

METABOLIC MEASUREMENTS IN CELLS AND ORGANS

61

Gupta, R. K. (1979). Biochim. Biophys. Acta 586, 189. Heppel, L. A., and Makan, N. (1977). J . Supramol. Strucr. 6, 399-409. Ingwall, J. S . (1982). Am. J . Physiol. 242, H729. Ingwall, J . S., and Fossel, E. T. (1980). Circulation 62, 19. James, T. W., and Bohman, R. (1981). J. Cell B i d . 89, 256-260. Jeener, J . , Neier, B. H., Bachman, P., and Ernst, R. R. (1979). J . Chem. Phys. 71, 4546. Johnson, C. S. (1965). Adv. Magn. Reson. 1, 33. Johnson, L. V., and Chen, L. B. (1980). J. Cell Biol. 87, 187a-190a. Johnson, L. V., Walsh, M. L., Bockus, B. J., and Chen, L. B. (1981). J . Cell Biol. 88, 526-535. Jorgensen, P. J. (1980). Physiol. Rev. 60, 864-917. Kaplan, J. I . , and Fraenkel, G. (1980). “NMR of Chemically Exchanging Systems.” Academic Press, New York. Katz, J., and Rognstad, R. (1978). In “Microenvironments and Metabolic Compartmentation” (P. A. Srere and R. W. Estabrook, eds.), pp. 227-243. Academic Press, New York. Kittagawa, T. (1980). J. Cell. Physiol. 102, 37-43. Krebs, H. A. (1954). Bull. Johns Hopkins Hosp. 95, 19-51. Kushmeric, M. J., Brown, T. P., and Crow, M. (1980). Fed. Proc. Fed. Am. Soc. Exp. B i d . 39, 2173. Kushmeric, M. J., Meyer, R. A., and Brown, T. R. (1981). Proc. Int. Soc. Oxygen Transport Tissues, 5th. Laramore, F., Waxmond, L., and Goldberg, A . (1982). J . Biol. Chem. 257, 4187-4195. Lemonnier, F., Gautier, M., Wolfrom, C., and Lemonnier, A. (1980). J. Cell. Physiol. 104, 41 5-423. Lipman, R. D., and Muggleton-Harris, A. L. (1982). Somat. Cell Genet. 8, 791-800. Lipmann, F. ( I 941 ). Adv. Enzymol. 1, 99- 158. Lust, W. D., Feussner, G . K . , Barbehenn, E. K., and Passoneau, J. V. (1981). Anal. Biochem. 110, 258-266. McKeehan, W. L., McKeehan, K. A . , and Calkins, D. (1981). J . B i d . Chem. 256, 2973-2981. Makan, N. R. (1978). E.rp. C e l l R e s . 114, 417-427. Mastro, A. M. (1979). J . Cell. Physiol. 99, 349-358. Matthews, P. M., Bland, J. L., Gadian, G. K., and Radda, G. K. (1981). Biochem. Biophys. Res. Commun. 103, 1052. Meyer, R., and Kushmerick, M. J. (1981). Fed. Proc. Fed. Am. Soc. Exp. Biol. 40,615. Meyer, R. A , , Kushmerick, M. J., and Brown, T. R. (1982). Am. J . Physiol. 242, C I . Millward, D. J., Garlick, P. J., and Reeds, P. J . (1976). Proc. Nutr. Soc. 35, 339-345. Morgan, M. J . , and Faik, P. (1980). Cell Biol. Int. Rep. 4, 121-127. Moses, V. (1978). In “Microenvironments and Metabolic Compartmentation” (P. A. Srere and R. W. Estabrook, eds.), pp. 169-186. Academic Press, New York. Muggleton, A. L., and Danielli, J. F. (1958). Nature (London) 181, 1738-1739. Muggleton-Harris. A. L., and DeSimone, D. W. (1980). Somat. Cell Genet. 6 , 689. Muggleton-Harris, A. L., and Palumbo, M. (1979). Somat. Cell Genet. 5, 397-400. Muggleton-Harris. A. L . , Whittingham, D. G . , and Wilson, L. (1982a). Nature (London) 299, 460-462. Muggleton-Harris, A. L., Reisert, P. S . , and Burghoff, R. L. (1982b). Mech. Ageing Dev. 19, 37-43. Nicklas, R. B. (1971). Adv. Cell Biol. 2, 225-297. Norwood, T. H., Pendergrass, W. R . , and Martin, G. M. (1975). J . Cell Biol. 64, 551-558. Nunndlly, R. L., and Hollis, D. P. (1979). Biochemistry 18, 3642. O’Neill, I. K., and Richards, C . P. (1979). Annu. Rep. NMR Spectrosc. 10A, 133. Racker, E. (1976a). I n “A New Look at Mechanisms in Bioenergetics” (E. Racker, ed.), p. 68. Academic Press, New York.

62

ROBERT R. DeFURIA AND MARY K. DYGERT

Racker, E., ed. (1976b). “A New Look at Mechanisms in Bioenergetics,” p. 8. Academic Press, New York. Radda, G. K., and Seeley, P. J. (1979). Annu. Rev. Physiol. 41, 749. Rapaport, E. (1980). J . Cell. Physiol. 105, 267-274. Rapaport, E., Garcia-Blanco, M. A,, and Zamecnik, P. C. (1979). Proc. Nut/. Acud. Sci. U.S.A. 76, 1643- 1647. Reeds. P. J., Wahle, K. W., and Haggarty, J. (1982). Proc. Nutr. Soc. 41, 155-159. Reitzer, L. I . , Wise, B. M., and Kennel, D. (1979). J . Biol. Chem. 254, 2669-2676. Reitzer, L. J., Wise, B. M., and Kennel, D. (1980). J . Biol. Chem. 255, 5616-5626. Richter, P. H., and Ross, J. (1981). Science 211, 715-717. Roberts, J. K. M., and Jardetzky, 0. J. (1981). Biochim. Biophys. Acta 639, 53. Romano, A. H., and Connell, N. D. (1982). J . Cell. Physiol. 111, 195-200. Rozengurt, E., and Heppel, L. A. (1979). J . Biol. Chem. 254, 708-714. Rozengurt, E.,Heppel, L. A,, and Friedberg, 1. (1977). J . Biol. Chem. 252, 4584-4590. Sejersted, O.,Mathisen, O., and Kiil, F. (1977). Am. J . Physiol. F, 152-158. Shaw, D. (1981). In “NMR Imaging in Medicine” (L. Kaufman, L. E. Crooks, and A. R. Margulis, eds.), p. 147. Igaku-Shom Medical, New York. Shoubridge, E. A., Briggs, R. W., and Radda, G. K. (1982). FEBS Lett. 140,228. Shulman, R. G., Brown, T. R., and Ugurbil, K. (1979). Science 205, 160. Siekevitz, P.,and Zamecnik, P. C. (1981). J . Cell Bid. 91, 53s-65s. Sinclair, R. (1980). Cell Biol.Int. Rep. 4, 21 1-216. Soderberg, K., Nissensen, E., Bakay, B., and Scheffler, I. E. (1980). J . Cell. Physiol. 103, 169- 172. Spielman, H., Jacob-Muller, U., and Schulz, P. (1981). Anal. Biochem. 112, 100-103. Stanbridge, E. (1976). Nurure (London) 260, 17-18. Steen, H. B., and Lindmo, P. (1978). Cell Tissue Kine?. 11, 69-81. Taylor, E. W. (1965). Proc. Int. Congr. Rheol., 4th pp. 175-191. Ugurbil, K., Shulman, R. G., and Brown, T. R. (1979). In “Biological Applications of Magnetic Resonance” (R. G. Shulman, ed.), Chap. I I . Academic Press, New York. Wales, R. G. (1978). In “Methods in Mammalian Reproduction.” (J. C. Daniel, Jr., ed.), pp. 11 1-136. Academic Press, New York. Wemmer, D., Wade-Jardetzky, N., Robin, E., and’Jardetzky, 0. (1982). Biochim. Biophys. Acru 720, 281. Wittelsberger, S. C., Kleene, K., and Penman, S. (1981). Cell 24, 859-866. Yoshioka, T. (1980). JEOL News 16A, 38. Zak, R., Martin, A. F., and Blough, R. (1979). Physiol. Rev. 59, 407-447. Zielke, H. R., Ozand, P. T., Tildon, J. T . , Sevdalian, D. A., and Cornblath, M. (1978). J . Cell. Physiol. 95, 41-48.

INTERNATIONAL REVIFW OF CYTOLOGY, VOL 83

Mitochondrial Form and Function Relationships in Vivo: Their Potential in Toxicology and Pathology ROBERTA. SMITH*AND MURIELJ. O R D ~ *Department of Anatomy, University of Glasgow, Glasgow, Scotland, and ?Department of Biology, University of Southampton, Southampton, and MRC Toxicology Research Unit, Carshalton, Surrey, England I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. The Chondriome of the Eukdryotic Cell.. ...................... A. Mitochondrial Numbers .......... . ........................... B. Mitochondrial Enlargem 111. Mitochondrial Cristae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV . The Form of the Chondriome and Metabolic Activity . . . . . . . . . . . . A. Differences in Energy Demands of Different Cell Types . . . . . . B. Changes in Energy Demands within the Cell C. Mitochondrial Form Changes in Vifro . . . . . . . . . . . . . . . . . . . . . D. Mitochondrial Form Changes in Vivo E. The Mitochondria of Cells in Culture F. Chemical Manipulation of Cell Respiration . . . . . . . . . . . . . . . . . G. Mitochondrial Manipulation by Microinjection into the Living Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................. V. Mitochondrial Inclusions . . . . . . . . . . A. Granules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Crystalline Inclusions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI . The Potential of Modem Staining Methods in Monitoring Mitochondrial Function . . . . . . . . . . . . . ................. A. Oxidative and Reductive Enzymes ................. ................. B. Phosphatases. . . . . . . . . . . . . . . . . . C. Calcium Localization and Ca*+-Binding Glycoproteins., . , . , . D. Fluorescent Stains for Mitochondria of Living Cells VII. Mitochondriagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................. VIII. Concluding Remarks . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

63

64 64 73 76 85 85

87

94

98 101 102 106 109 109 115

116 1 I6 1 18

122 125

I. Introduction Mitochondria have been observed in virtually all aerobic, eukaryotic cells yet studied. Only in rare instances has it been claimed that cells lack mitochondria (Daniels and Breyer, 1967; Held et al., 1969). Their structure consists of a pair of membranes, the outer and inner mitochondria1 membranes, which enclose a matrix of variable electron density. Projecting into the matrix, often perpen63 Cvpynpht Q 1983 by Acsdcniic PIC\%Inc. All rights of reproduction in any fnrni rercrved. ISBN 0-12-364483-6

64

ROBERT A. SMITH AND MURIEL J. ORD

dicular to the inner membrane, are the cristae (cristae mitochondriales), which were first described as platelike infoldings of the inner membrane (Palade, 1953) OR, alternatively, as independent septa only seldom attaching to the inner membrane (Sjostrand, 1953). Small granular structures are frequently located in the matrix together with mitoribosomes and mitochondrial DNA. This characteristic appearance has changed little throughout evolution, as recently evidenced from electron microscopic observations of fossilized dipteran tissue dating back 400 million years (Poinar and Hess, 1982). Modification of the basic mitochondrial form is, however, widespread; changes occur in the number, size, and overall shape of the organelle, in the organization of the cristae and inner membrane, in the density of the matrical compartment, and in the presence of inclusion bodies. Such variations have been reported in mitochondria from many different tissues and in many different physiological states (Munn, 1974). The mitochondrial complement may also be dramatically changed in pathological conditions (Johannessen, 1978; Ghadially, 1982), particularly in neuromuscular disorders (Kamieniecka and Schmalbruch, 1980) and following exposure to toxic agents (Ord, 1979). The aim of this article is to assess the literature relating mitochondrial structure to functional activity and to consider specifically the changes generated by pathological lesions, whether they result from disease processes or from chemical induction. This would seem to be pertinent at this time in view of the many studies that have been performed since publication of the excellent treatise of Munn in 1974.

11. The Chondriome of the Eukaryotic Cell A. MITOCHONDRIAL NUMBERS

The majority of light microscopy staining studies and early electron microscopy (EM) reports indicate that typically a cell’s mitochondrial population, the chondriome, consists of a large number of spherical and elongated organelles with lengths of up to 4 pm. Phase-contrast microscopy [e.g., showing the several thousand mitochondria of Paramecium (Perasso and Beisson, 1978)] and modem staining reactions of living cells [e.g., the reaction of the mitochondria of HeLa cells to diaminobenzidine (Posakony et al., 1975)] can reinforce this picture of predominately spherical or short rod-shaped structures with a few longer branched forms of up to 30 pm. The number of mitochondria per chondriome varies; 700- 1600 mitochondria per cell have been estimated by stereological methods for rat hepatocytes-the variation reflecting lobular location within the liver (Loud, 1968); and similar numbers were calculated for the adrenocortical cell’s chondriome (Mazzochi et al., 1976a,b). The large free living amoeba, Chaos chaos, has been estimated to have up to 300,000 individual mitochondria with lengths reaching 8 pm (Torch,

MITOCHONDRIAL RELATIONSHIPS in Vivo

65

1955; Andresen, 1956), and the mitochondrial cloud of Xenopus oocytes was estimated to have 10,000-500,000 mitochondria, the number depending on developmental stage (Billett and Adam, 1976; Marinos and Billett, 1981) (Fig. 1). Some estimates of mitochondrial numbers in earlier studies do not always hold true, however, as more sophisticated methods of illuminating the chondriome now show. With branching, or other irregular forms, it can be difficult to determine by transmission electron microscopy (TEM) where one mitochondrion ends and another begins. To overcome this type of problem, there has been a growing interest in recent years in applying stereoscan studies to isolated mitochondrial chondriomes, high-voltage TEM to thick sections of cells, and three-dimensional reconstructioning from serially sectioned material to studies of mitochondrial numbers. Such studies suggest that in some cases, particularly in situations where the organelles are branched rather than simple rods, the chondriome may be composed of far less mitochondria than first thought. For example, Billett and Adam (1976), using steroscan on isolated preparations of the Xenopus oocyte chondriome to further characterize their TEM results, found that at least in part the sphaghetti-like cloud was a continuous structure rather than a collection of large numbers of discrete organelles, thus making the numbers of individual mitochondria lower than their original calculations. Early attempts by Bang and Bang ( 1957) at superimposing mitochondrial profiles from approximately a dozen sections of ferret epithelial cells and human liver revealed that spatial organization could be potentially visualized using serial sections and could give a more meaningful concept of mitochondrial numerical organization in a cell. It is this technique that has recently received much attention. Gaffal and Schneider (1980) used a series of 250 sections to characterize the entire chondriome of the unicellular alga Polytoma papillatum, as shown in Fig. 2. Here many of what may appear to be separate mitochondria are revealed as three large structures (one surrounding the nucleus) together with 243 simpler spherical and rodlike mitochondria. The evidence from three-dimensional reconstructions of the chondriome appears, therefore, to substantiate the proposal that many cells may contain a small number of mitochondria in branched or knotted forms; and even a single large mitochondrial structure is no longer a unique cellular condition. Thus in cells such as yeast (Hoffman and Avers, 1973), Chlorella (Atkinson et a / . , 1974), Euglena (at certain growth phases) (Calvayrac et al., 1972, 1974; Osafune, 1973; Pelligrini, 1980), and trypanosomes (Paulin, 1975), three-dimensional studies show that the chondriome consists of one mitochondrion per cell. In Polyfoma agilis (Burton and Moore, 1974), mammalian lymphocytes (Rancourt et a/., 1973, log-phase and stationary-phase yeast cells (Stevens, 1977), Friend erthyroleukemia cells (Walter, 1981), and rat diaphragm (Bakeeva er al., 1982), the chondriome consists of 50 mitochondria or less per cell with one or two of these in some cases being much larger and more complex than the other mitochondria of the cell (Gaffal and Schneider, 1980; Stevens, 1977). Small

66

ROBERT A. SMITH AND MURIEL J. ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

67

FIG. 2. The chondriome of an entire algal cell, Polytoma papillaturn, as analyzed by threedimensional reconstructuring through 228 consecutive sections. There are 246 separate mitochondria, three of which are larger and more highly reticulated than the remaining simpler forms. X 3000. Micrograph courtesy of Dr. K. P. Gaffal, Universitat Erlangen-Numberg, West Germany.

numbers of mitochondria are not claimed for all cells, however. Many cells are still shown to have large quantities of mitochondria by three-dimensional reconstructions, observations producing numbers similar to early estimates from phase-contrast microscopy and staining studies on living cells or from applications of stereological methods. For example, reconstruction of rat liver cells by Brandt et al. (1974) indicates the presence of approximately 800 mitochondria, the individual organelles being present as small spheres and disks, simple cylinders and a few other pleomorphic forms; this approaches the number estimated FIG. I . (a) and (b) The mitochondria1 cloud of a Xenopus oocyte. Note the long branched, “spaghetti”-like mitochondria. The low power micrograph shows the whole cloud (C) in close proximitytothenucleus(N). Y,Yolk;YC,yolkcell. x1200and 15,000.CourtesyofDr. F. S . Billett, Southampton. (c) Large numbers of mitochondria in a reticulocyte from a lymph node of a Crohn’s disease patient. X 10,000. (d) and (e) Reduced numbers of enlarged mitochondria in a muntjac cell cultured for 16 days. X7500 and x17,OOO. respectively. d and e courtesy of Dr. L. G. E. Bell, Southampton.

68

ROBERT A. SMITH AND MURIEL J. ORD

cell

1

A

8 L

15

3 E

eel I

1

B

8

.-5 4-

"

$

15

FIG. 3. Reconstructions (upper diagram) of mitochondria1 forms of two control human lymphocytes fixed in situ in a mesenteric node. Reconstructions are based on profiles seen in 15 serial sections. Photomicrograph is of section 8. Profiles for sections 1, 8, and 15 are shown on the reconstructions. The reconstructions were done to determine the extent to which individual profiles form simple or reticular mitochondria. Profiles away from the main group gave compact rounded or oval mitochondria-the form often present also in diseased tissue (see Fig. 4). Grouped mitochondria were

MITOCHONDRIAL RELATIONSHIPS in Vivo

69

by stereological methods (Loud, 1968) and the individual forms reported by others (e.g., Hagopiam, 1967; Stempak and Laurencin, 1976). A three-dimensional study of human sympathetic ganglia shows several hundred separate mitochondria arranged in a horseshoe accumulation in the axonal swellings. HelCn et al. (1980) suggest that this clustering may have a functional significance associated with the neurofilaments and synaptic vesicles. What governs the numbers of mitochondria in a cell? A relationship between cell size and mitochondrial numbers is suggested by Heywood (1977) from a reconstruction study of the large algal cell Gonyostomum. He considers that, if the alga contained a single mitochondrial complex instead of the 100 individual organelles it does possess, then the mitochondrion would, by necessity, have to be an extremely branched and complex structure. He further suggests that this would impose problems in the control of the cell’s growth cycle and that it may only be in smaller cells that mitochondria can optimally join to form a single or small number of complex branched structures (Fig. 3). Other three-dimensional studies with microorganisms also demonstrate a relationship between cell size and mitochondrial numbers. Thus, in Saccharomyces, Grimes et al. (1974) found up to 200 mitochondria in the diploid cell, a result that seemingly conflicts with the report of a single chondriome by Hoffman and Avers (1973), whereas Stevens (1977) found fewer than 10 in log-phase cells, but 30-50 in stationary-phase cells. Because the stationary-phase cells are larger than log-phase cells and diploid cells larger still, a size relationship holds. Berger (1973), in a study of rat hepatocytes, also suggested that mitochondrial numbers may vary in some cells so as to maintain a relatively constant mitochondrial/cytoplasmic volume. A similar conclusion has been drawn from studies of Tetrahymena (Kolb-Bachofen and Vogell, 1975), HeLa cells (Posakony et al., 1977), insect muscle (Sohal and Bridges, 1978), and Polytoma (Gaffal et al., 1982). Studies by Seiden (1976) on work-induced hypertrophy of rat limb muscle showed mitochondrial volume increases in proportion to cell volume, although he suggested that the significant 39% increase over the control volume of 7.93% in compensatory hypertrophy reflected other factors. Within a single cell type, there does seem to be some correlation between cell size and mitochondrial numbers. As oocytes of Xenopus laevis enlarge from 50 to 250 pm in diameter, there is an 800-fold increase in mitochondrial material. This has been calculated to be equivalent to mean numbers of 480 increasing to 390,000 organelles with average dimensions of 2 pm X 0.2 pm (Marinos and Billett, 1981). But to what extent can size be considered as a general factor from aggregated to the side of the nucleus, with several profiles joining to form longer, more convoluted organelles than the scattered simple forms. Such mitochondria are present in Fig. 4e, in which sections at right angles would produce two to four profiles. Sections courtesy of M. Moss and J . HermanTaylor. Reconstructions by M. J . Ord and T . Courtney, unpublished material.

70

ROBERT A. SMITH AND MURIEL J . ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

71

one cell type to another in determining mitochondrial numbers per cell? With cell size estimates for the volumes of the liver cell, Gonyostomum, lymphocyte, and yeast cell of approximately 5400 Fm', 4000 pm', 155-283 pm3, 26 km3, respectively, a rough correlation is noted with the mitochondrial calculations of 700, 100, 3-7, and 1-50, respectively. Supposing that cell size is a factor in determining mitochondrial numbers, other factors must also be involved. One factor influencing mitochondrial numbers is life cycle, differences reflecting both the constraints imposed on cell activities at some periods and the increased energy requirements at others. Thus, Polytoma papillatum (Gaffal and Kreutzer, 1977; Gaffal and Schneider, 1980), Euglena (Calvayrac et al., 1972), Tetrahymena (Kolb-Bachofen and Vogell, 19754, Chinese hamster lung cells (Dewey and Fuhr, 1976), and HeLa cells (Posakony et a/., 1977) all show variations in mitochondrial numbers related to their cell cycle/cell activity. A relationship between mitochondrial numbers and cell activity may be the causal factor in other quite different cases where alterations in the morphodynamics of the cell's chondriome is concurrent with a change in numbers (Fig. 4). As early as 1915, Lewis and Lewis suggested mitochondrial numbers in chick embryo cells in cultures increased and decreased depending upon environmental conditions. They observed in culture cells the formation of a mitochondrial network that continually changed shape: new branches appearing, old ones breaking away; and often the whole unstable complex splitting into many smaller rodlike or spherical units. The cell's nutritional state is one influence reported to affect mitochondrial numbers (Tandler et al., 1969; Vartapetian et al., 1977; Wigglesworth, 1982). Adaption to physical stimuli such as light, temperature, and oxygen tension (Pellegrini, 1980; Behrens and Himms-Hagen, 1977; Berger, 1973), hormonal factors (Salmenpera, 1976; Smith and Page, 1976), chemical treatments (Susuki, 1969; Asano and Wakabayashi, 1974; Risueno er al., 1975), and a change in the cell's overall physiological state (Larsen, 1970; Seiden, 1976; Merker et al., 1968; Calarco and McLaren, 1976) have each been reported to affect the numbers of mitochondria in the cell. Any one or all of these could relate to changes in cell activity. Two,studies are particularly useful in showing a clear increase in mitochondrial numbers with increased cell activity. Stereological studies by Mazzocchi er al. (1976a,b) indicate that increased numbers of mitochondria can result from hormonal stimulations. Administration of ACTH FIG. 4. Mitochondria1 form differences in lymphocytes from human mesenteric lymph nodes of control and diseased patients. Biopsy specimens courtesy of J. Herman-Taylor and M. Moss, St. George's Hospital, London. (a) Unstimulated node; note long, branched, and often convoluted mitochondria frequently situated close to nucleus. x 10,000. (b) Rounder mitochondria from a patient with Crohn's disease. X8000. (c) and (d) Mitochondria of a cancer patient; note close association with nucleus. X 12,000 and X20,000, respectively. (e) Higher magnification of convoluted mitochondria in a control lymph node. X20,OOO.

72

ROBERT A. SMITH A N D MURIEL J. ORD

for up to 36 days resulted in numbers per adrenal cell increasing from I124 to 1925 by organelle growth and division. This increase was prevented by treatment with dexamethasone, which blocks ACTH release by inhibiting the hypothalamohypophyseal axis. In this case, 15-day exposures caused adrenal cells to undergo a 3-fold decrease in mitochondrial number (Nussdorfer et a l . , 1975). The study by Murray et al. (198 1) of rat liver mitochondria after partial hepatectomy again shows a rise in numbers paralleling the increased activity of the remaining cells as they begin to synthesize nucleic acids in preparation for an eventual increase in cell numbers: the mitochondria of the mononuclear cells doubled, although at this point the total mitochondrial volume remained constant. They proposed that this was achieved by each organelle dividing once but not increasing in size. If one considers that single large mitochondria can “break” into many smaller mitochondria or that the number of mitochondria is a reflection of energy production taking place in the cell, then the relative volume of the chondriome as a whole to the total cell volume (or less usefully, cytoplasmic volume) would be a convenient index in considering the mitochondrial composition of the cell. This has been estimated for a number of cells and was found to vary considerably from one cell to another. Thus ratios (expressed as percentages) of mitochondria1:cell volumes of 2 , 7 , 12, and 19% have been reported for mouse lymphocytes, HeLa cells, yeast, and Polytoma agilis, respectively (Rancourt et a l . , 1975; Posakony et a l . , 1977; Stevens, 1977; Burton and Moore, 1974); whereas values of 35% of the cytoplasmic volume of parietal cells (Helander, 1976) and 60% of the cytoplasmic volume of oncocytomas (Carlsoo et a l . , 1979) being occupied by mitochondria have been calculated. Again, as with actual mitochondrial numbers per cell, this value for a cell is not a constant factor. It, too, varies as cell physiological states are altered. Thus, in Euglena, the mitochondrial volume of the single chondriome:cell volume increases from 6 to 15-16% following transfer from light to dark environments, a change indicative of a change in cell energetics (Pellegrini, 1980). During the differentiation of myeloid leukemia cells to normal macrophages, there is an approximate 4-fold increase in the mitochondria, a change that significantly enhances cytochrome oxidase activity, although the estimates of the activity for each single mitochondrion remains unaltered (Hirai et a l . , 1979). In many cases chondriome content changes (either increases or decreases) may be produced by pathological conditions in cells. Such states may also be induced by exposure of cells to toxic chemicals. For example, there is a 6.4-20.5% increase in the ratio of mitochondria1:cytoplasmic volume after 12-hour exposures of Allium rootlets to ethidium bromide, with mitochondrial numbers thought to increase by division (Risueno et a l . , 1975); a 9-10% increase after treatment of Euglena with chloramphenicol (Neumann and Parthier, 1973); and increases of 140-168% in the glioma cell chondriome after treatment with dexamethasone (Grass0 et a l . ,

MITOCHONDRIAL RELATIONSHIPS in Vivo

73

1977). Each of these results may be interpreted as an increase to meet increased energy demands of the cell during repair or as an increase due to decreased effectiveness of the treated organelles in supplying energy. Few chemicals affect one organelle only, however; and far more information on the cell’s response to a chemical is needed before the effects on mitochondria can be interpreted in isolation. For example, ethidium bromide (EB) intercalates into nuclear as well as mitochondrial DNA, indirectly. Therefore, it must affect the activity and growth of many organelles; and increases in the chondriome may be partly an indirect reflection of these. On the other hand, the presence of many EB molecules in the mitochondrion matrix introduces a direct burden on the activity of the mitochondrion, reducing its effectiveness so that numbers are augmented. Increased numbers of mitochondria are found in disease, particularly in certain neoplasms, e.g., of the thyroid (Valenta et al., 1974), of the parathyroid (McGregor et al., 1978), of the pituitary (Roy, 1978), and of the parotid gland (Tandler et al., 1970). Tandler and Shipley (1964) suggest that this may be due to a biochemical deficiency in the mitochondria, a suggestion that some of the more recent staining techniques may help to clarify. In other pathological situations, the numbers of mitochondria are reduced, e.g., in many other tumors (Pedersen, 1978) and in muscle cells (e.g., in patients with Parkinson’s disease) (Ahlqvist et al., 1975).

B . MITOCHONDRIAL ENLARGEMENT Enlarged mitochondrial profiles may result from the expansion of either the matrical or outer compartments during the adaptation to environmental conditions, to metabolic or physiological changes (Horridge, 1964), and to pathological disorders (Dmitrieva, 1968), or in response to exposure to drugs (Dantchev et al., 1979) and toxic agents (Laiho et al., 1971; Laiho and Trump, 1975). It can be caused by mitochondrial growth and/or division abnormalities, one activity becoming out of step with the other, or by situations that inhibit mitochondrial division (Merker et al., 1968). Alternatively, it can be the result of mitochondrial fusion to form giant mitochondria, or megamitochondria (Vartapetian et al., 1977; Wakabayashi et al., 1977; Sohal and Bridges, 1978; Kraus and Cain, 1980). Either process may occur with normal physiological changes as well as in stress situations. Mitochondria1 swelling, representing a genuine change in the in vivo mitochondria, is often an early general consequence of exposure to toxic chemicals-particularly those that alter the ionic balances, transport channels, or membrane permeability (Mollenhauer et al., 1981 ) and that can eventually lead to death of the cell. Grouped with these may be cases where organelle swelling is a result of fixation problems, either in the fixatives themselves or in the delayed fixation of tissues (Sjostrand, 1977; Romert and Matthiessen, 1981).

74

ROBERT A. SMITH AND MURIEL J . ORD

A possible hormonal effect on the chondriome size is implicated in the changes that occur in endometrial cells of the human uterus, where midcycle profiles up to 7 pm in diameter were reported (Merker et al., 1968). As mitochondrial numbers also increase in this instance, it would appear that the giant mitochondria result from the increased growth of individual organelles rather than by fusion. During the last days of the cycle, these mitochondria undergo a further hypertrophy (a possible consequence of cell aging) by passive swelling. Hormonal effects are also implicated in the formation of giant mitochondria in healthy women receiving extended dosing with oral contraceptives (Perez et al., 1969). The precise role of hormonal changes in the induction of large mitochondria is as yet poorly documented. The appearance of enlarged mitochondria in in vitro culturing suggests a possible link with hormonal, 0, tension, or environmental deficiencies. For example, abnormal mitochondrial growth has been recorded for astrocytes derived from human embryonic nervous tissue; in this study, 17% of profiles were long and branched (over 7 pm in length) following 26 days of culture (Rublyeva and Buravlyev, 1979). Abnormal mitochondrial growth has also been seen in HeLa cells; the threadlike structures could be in excess of 30 pm (Posakony et af., 1975). In the roots of pumpkins cultured anoxically in the presence of exogenous glucose for 12 hours, lengths of up to 55 pm were recorded. Such excessive lengths were due to the production of a complex mitochondrial form by the fusion of individual organelles (Vartapetian et al., 1977). In vivo dietary factors, such as riboflavin deficiency, may produce giant mitochondria with diameters of 8 pm in mouse hepatocytes (Tandler et al., 1968), and also in rat hepatocytes after prolonged deficiency (Tandler and Hoppel, 1980). These effects are reversible upon refeeding, normal-sized profiles being produced from the megamitochondria by septate division (Tandler et al., 1969). If galactoflavin-supplemented riboflavin diets are given in refeeding, then normal-sized organelles are generated by medial attenuation (Tandler and Hoppel, 1974). Similar megamitochondria can be produced in hepatocytes following dehydration (Bart6k et al., 1973) and by deficiencies of essential metal ions. This is well illustrated in the case of copper; upon exposure to the chelating agents cuprizon (Suzuki, 1969) and diethyldithiocarbamate (Asano and Wakabayashi, 1974), megamitochondria of up to 20 pm may be generated, i.e., individual organelles large enough for recording respiratory measurements (Suchy and Cooper, 1974). It has been suggested that the megamitochondria result from a lack of copper necessary for the production of monoamine oxidase; the evidence for this being that nialamide, which inhibits this enzyme, also induces giant mitochondrial formation (Asano et af., 1977). Copper deficiency has been shown to increase mitochondrial size in acinar cells of rat pancreas (Fell et al., 1982); whereas excess copper can cause mitochondrial swelling in yeast cells (Keyhani, 1973). Other heavy metals induce mitochondrial abnormal-

MITOCHONDRIAL RELATIONSHIPS in Vivo

75

ities, e.g., lead (Watrach, 1964; Goyer, 1968; Fowler et al., 1980), mercury (Tingle et al., 1973), cadmium (Hoffmann et al., 1975; Ord and Al-Atia, 1979), and cobalt (Lin and Duffy, 1970; Sandusky et al., 1981)-possibly indicative of ion exchanges, e.g., Cd2+ or Hg2+ ions displacing Zn2+ in critical sites, particularly in chronic exposures. At least in some cases it is seen as a rapid mitochondrial swelling rather than a result of growth processes, and swelling is a direct response to acute dosing, which creates ionic imbalance. For example, in equine myocardial cells, mitochondrial swelling results from a single dose of monensin. Monensin, derived from Streptomyces cinnamonensis, has ionophoric characteristics, with a selective affinity for Na ions. The mitochondrial swelling, therefore, suggests a failure of the osmotic control system, permitting an influx of water and a probable suppression of ATP production (Mollenhauer et al., 1981). Furthermore, the Ca2+ ionophore A23 187 caused mitochondrial swelling in cultured primary rat hepatocytes and accompanied a 60% decrease in cellular ATP concentrations (George et al., 1982). The occurrence of giant mitochondria is perhaps best documented for pathological conditions. It occurs not infrequently as a nonspecific lesion in human hepatocytes (Partin et al., 1971; Kanwar et al., 1976; Feldmann et al., 1977; Soares and Moura Nunes, 1979), but more especially in hepatocytes after alcohol ingestion (Svoboda and Manning, 1964; Iseri et al., 1966; Rubin and Lieber, 1968; Koch et al., 1978). The presence of giant mitochondria has been demonstrated in a number of different neuromuscular diseases (see Kamieniecka and Schmalbruch, 1980): that such “mitochondrial rnyopathies” reflect metabolic defects has been confirmed in many studies since the first association of abnormal mitochondria with muscular disease (Luft et al., 1962). Thus, enzyme abnormalities were correlated with myopathy in a 9-year-old girl presenting clinically with progressive muscular weakness (Ketelsen et al., 1978). Alterations and the presence of giant mitochondria were observed in a syndrome associated with carnitine deficiency in muscle and with related lipid storage disturbances (Engel and Angelini, 1973); a similar systemic camitine disorder proved fatal (Boudin et al., 1976). Larger than normal mitochondria were evident in other skeletal muscle samples (Shy et al., 1966; Watanabe et al., 1976). In a case of Keams-Shy syndrome, sweat gland mitochondria were also affected (Karpati et al., 1973); and in a case of opthalmoplegia plus mitochondrial abnormalities were observed in the cerebellum (Schneck et al., 1973). Cardiac muscle is a further site of mitochondrial myopathy, with profiles of up to 30 pm developing by the fusion of numerous individual organelles (Kraus and Cain, 1980). Mitochondria1 enlargement in myocardial and skeletal muscle cells may also result from aging (Feldman and Navaratnam, 1981) or ischaemia (Ashraf and Bloor, 1976; Hanzlikova and Schiaffino, 1977; Heffner and Barron, 1978). The swelling of mitochondria appears to be a common lesion within cells and may be one of the earliest parameters affected in the disruption of cell activity +

76

ROBERT A. SMITH AND MURIEL J. ORD

(Ghadially, 1982). Enlargement is usually accompanied by other structural changes in both normal and damaged mitochondria, as will be discussed in the following sections.

111. Mitochondria1 Cristae

The form of the inner mitochondrial membrane has been the center of debate for many years. The term cristae mitochondriale, first used by Palade (1952) to describe the internal ridges of the mitochondria in various rat tissues, has since come generally to refer to the spatial arrangement of the whole internal membrane system. From the beginning of electron microscopy, however, two interpretations developed for the basic mitochondrial structure. Palade, and many of the later workers, considered the mitochondrion to be a double membrane system, with the space between the folds of the cristae (intracristal space) being continuous with that between the inner and outer membranes (peripheral space) (Palade, 1953). Sjostrand and his co-workers on the other hand interpreted the membrane organization as being of three layers: outer, inner, and cristal system (Sjostrand, 1953; Sjostrand and Hanzon, 1954). Though the former view is perhaps more widely adopted, the latter is supported by a number of studies concerning membrane structure. Freeze-drying and carefully controlled chemical fixation procedures have been introduced to reduce organelle swelling, membrane distortion, and protein denaturation, all of which can lead to structural inaccuracies. Using these regimens, measurements of 12.5 nm for the thickness of the cristal membrane suggest that it is structurally different from the two outer membranes, which range in thickness from 4 to 7 nm. Furthermore, the cristal membranes are often so closely apposed that there is an absence of an intracristal space (Sjostrand and Kretzer, 1975; Sjostrand and Bernhard, 1976; Sjostrand, 1977). These findings provide evidence that the two membrane elements of the cristae form a composite, compact, independent unit and only rarely attach to the inner membrane. The controversy over the arrangement of the cristae to the inner membrane will continue. Membrane systems are fluid structures in which molecules can move in and out and transversely with considerable rapidity (Hochli and Hackenbrock, 1976). The inner mitochondrial membrane is composed of approximately 75% protein, whereas the outer consists of 63% proteins associated with the different lipid components. These proteins include marker enzymes, e.g., monoamine oxidase for the outer membrane and cytochrome oxidase, succinate dehydrogenase, and structural protein for the more fluid inner membrane (Colbeau et al., 1971). The protein moieties of the inner membrane consist of 55% intrinsic species (e.g., cytochrome b and cytochrome oxidase), which remain associated with the lipid vesicles after treatment with acetic acid, and

MITOCHONDRIAL RELATIONSHIPS in Vivo

77

45% extrinsic proteins (e.g., cytochrome c and ATPase subunits), which are less firmly attached to the lipid elements (Capaldi and Tan, 1974; Harmon et al., 1974). Such enzymatic complexes are intercalated periodically into a membranous framework that is probably synthesized earlier in the cell cycle-according to observations made on Chlorella inner mitochondrial membrane assembly (Forde et al., 1976). Membrane composition not only varies from one cell to another but also changes within a single cell type as a result of factors such as diet. Links are made and broken between membranes of different compositions so that mitochondrial membranes frequently appear to be connected with the membranes of other organelles, such as the nucleus, the connections enabling the transmission of substances unable to pass through the membranes. Equally important communications could thus be expected between the inner mitochondrial membranes and the cristae (Decker and Greenawalt, 1977), whether these are of a permanent nature or are merely transitory fusions of the two separate units (Fig. 5). Three-dimensional reconstructions of serial sections of mouse liver mitochondria show that certain cristae and inner mitochondrial membranes do actually join in places but that such attachment points are restricted to very narrow focuses, the “pediculi cristae” (Daems and Wise, 1966). The paucity of these continuities, however, does suggest there can be independence between the cristae and the inner membranes, so that the cristae do often appear free. Indirect support for this view comes from a study of mitochondrial morphology in the “petite” mutants of Saccharomyces cerevisiae, which completely lack mitochondrial DNA (Montisano and James, 1979). Normal cristae are totally absent in the mutant forms, although the inner and outer mitochondrial membranes are well represented. It is suggested, therefore, that the cristae are structurally different from the inner membrane or that cristae organization at least is controlled by mitochondrial DNA products although the outer and inner membranes are not necessarily so controlled. It has long been held that the number and arrangement of the cristae within the mitochondria reflects the cell’s metabolic activity, i.e., as the cristae surface increases so does the respiratory capacity of each mitochondrion (Lund et a f . , 1958; Rouiller, 1960; Hagopian, 1967) (see Section IV). Studies of the mitochondria of many different cell types suggest a high degree of plasticity in vivo (Bereiter-Hahn, 1978). Cristae from mitochondria of different tissues in an organism or of mitochondria from one tissue under different metabolic conditions can take on characteristic organizations or patterning. Such variation may be shown as structural differences of the cristal membranes themselves or as a difference in the density of their packing. The most commonly seen cristal form is a series of platelike, double-membrane structures projecting into the matrix. However, other forms of cristae are not uncommon. Mitochondria with tubular cristae are frequently observed, e.g., in the ctenophore Pleurobrachia (Horridge, 1964), in rat adrenal cells (Mazzocchi et al., 1976a,b), and in Amoeba proteus

78

ROBERT A . SMITH A N D MURIEL J . ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

79

(Flickinger, 1968a). In other tissues or cells, mitochondria may have concentric cristae, e.g., in brown adipose tissue of the squirrel Citellus lateralis during hibernation periods (Grodums, 1977). Cristae may occur as narrow lamellae, e.g., in the differentiation stages of trypanosomes (Brown et al., 1973), or as packed prismatic arrangements, e.g., in the muscles of oysters and crayfish (Murdock et al., 1977; Hawkins et al., 1980). In addition to differences in normal patterns from one cell type to another, cristae forms can be modified under certain physiological conditions, particularly under those of stress. For example, the tubular cristae of amoeba mitochondria may assume a zigzag or scalloped form in Chaos chaos at mitosis or under minimal feeding regimes (Daniels and Breyer, 1965, 1968). In addition to zigzag forms, canary muscle cell mitochondria may also, under certain conditions, have retiform cristae (Slautterback, 1965). The density and surface area of cristae have been measured by stereological methods. Such measurements show that cells with greater energy demands often have a greater cristal area. For example, James and Meek (1979) used this method to demonstrate that mitochondria of Type 1 fibers of pigeon skeletal muscle had 1.6-fold more cristae membrane than Type 2 fibers. In skeletal muscle, Type 1 fibers probably derive most of their energy by aerobic oxidation, whereas Type 2 fibers probably derive energy by aerobic glycolysis. A similar energy demand:cristal area relationship has been reported in mouse mammary gland mitochondria, with increases in cristal area paralleling higher cytochrome oxidase activity during late pregnancy and in lactating animals (Rosano et al., 1976); in endometrial cells of the human uterus, where numbers increase at midcycle (Merker et al., 1968); and in the cells of sheep embryos during cleavage stages (Calarco and McLaren, 1976). A 3-fold increase in surface area of cristal membrane has been reported for fetal rat adrenal cells after induction of steroidogenesis by ACTH treatment (Salmenpera, 1976); this cristae differentiation could be inhibited by the addition of 5-bromodeoxyuridine (Kahri et al., 1976). Following hypophysectomy, the mitochondria of rat myocardial cells had a reduced area of cristae per unit volume (Smith and Page, 1976). These examples are all indicative of altered activity states, which are related to hormonal changes and are reflected by structural modification of the mitochondria. Increases in cristae numbers or large cristae surface areas are not limited to hormone changes only. They are evident in the mitochondria of hepatomas, even FIG.5. (a) A mitochondrion of an amoeba, with outer membrane in close contact with nuclear envelope (NE). ~32,000.(b) Mitochondria of a Chinese hamster ovary cell in culture 4 hours after addition of fresh medium. Note close association with smooth endoplasmic reticulum; also note dilated cristae. x 20,000. (c) Mitochondria of a rat hepatocyte showing apparent continuity between cristae membrane and inner mitochondria1 membranes (asterisks). Other cristae appear free in the matrix (arrow). Fixation with 3% glutaraldehyde containing 3% glucose. x56,000.

80

ROBERT A. SMITH AND MURIEL J. ORD

when organelle numbers are reduced-a change indicative of a disruption in normal metabolic function (de Man, 1960). Densely packed, concentric cristae have been reported in mitochondrial myopathy (Karpati et al., 1973; Ketelsen et al., 1978); and increased numbers of stacked cristae are found in the megamitochondria of myocardial cells-a finding that is taken as evidence that these organelles result by fusion of numerous individual mitochondria (Kraus and Cain, 1980). The mitochondria of diseased cells do not always show changes in cristae number (Ahlqvist et al., 1975; Kanwar et al., 1976) although often organelle swelling-an early sign of mitochondrial lesions-is accompanied by the movement of cristae to a peripheral location (Laguens and Bianchi, 1963; Svoboda and Manning, 1964; Watanabe et al., 1976; Dodson et al., 1976). The absolute phosphorylative activity of jaundiced patients is maintained at normal levels in spite of changes in the mitochondria: Takasan et al. (1975) suggested that morphological changes, which give both enlarged mitochondria with increased cristae and ones with decreased numbers of irregularly arranged cristae in addition to normal organelles, could be an adaptive measure to preserve delicate energy levels throughout the disease. In some diseases there is a measurable decrease in cristae numbers, e.g., cristae are sharply reduced in thyroid gland cells during oncogenesis (Dmitrieva, 1968); and for blast cells of patients with acute lymphoblastic (ALL) and acute myeloblastic (AML) leukemia, it was suggested that disruption of mitochondrial protein synthesis might be responsible for the reduction in cristae within the swollen organelles because the lesion was comparable to that induced in normal lymphocytes by ethidium bromide treatments (Zafar er al., 1982). Cell aging in culture (Rublyeva and Buravlyev, 1979) and in the tissues of whole animals (Feldman and Navaratnam, 1981) is also accompanied by a disruption and decrease in cristae numbers, as are stressful changes in temperature (Michea-Hamzehpour et al., 1980) and dietary deficiencies (Tandler and Hoppel, 1974; Wigglesworth, 1982). The preservation of a functional respiratory chain and phosphorylative capacity appears important in the control of cristal numbers in aerobic cells. Organisms that exist at low oxygen tensions, e.g., liver flukes (Bjorkman and Thorsell, 1962) or cestodes (Harlow and Byram, 1971), have relatively few cristae per mitochondrial, and disrupted cristae were noted in the organelles remaining after long-term hypoxic acclimation in the tench Tenca tenca, (Johnston and Bernard, 1982). Introduction of cells to anaerobic conditions also results in reduced and disrupted mitochondrial cristae, for example, in rat myoblasts (Auclair et a/. , 1976), cucumber meristems (Coulomb and Coulomb, 1973), and wheat rootlets (Oliveira, 1977). In tomato root tip mitochondria, the cristae retain a control appearance for the first 3 days, after which an increasing number are found with only sparse cristae; this finding corresponds to an overall decrease in cytochrome oxidase activity (Morisset, 1974). In Amoeba proteus, cristae vesiculation occurs with anaerobic culturing (Smith et al., 1979) (Fig. 6a) and a concurrent reduction

MITOCHONDRIAL RELATIONSHIPS in Vivo

81

in cytochrome oxidase activity has been shown by cytochemical staining (Smith, 1978b). Similarly, in Neurospora crassa, anaerobiosis caused a paucity of cristae membrane, a result that also correlated with reduced cytochrome c oxidase activity (Howell et al., I97 1). In yeast cells, Wallace and Linnane (1964) initially concluded that mitochondria were lost altogether in the absence of oxygen, although later studies showed that the interruption of oxidative phosphorylations resulted in degradation of the normal mitochondrial cristae to produce “promitochondria1”-like structures rather than a complete depletion of organelles (Plattner and Schatz, 1969; Luzikov, 1973). Upon reaeration, cristae reform during reversion to a control mitochondrial population (Rossi and Cocucci, 1978). Several workers have followed the behavior of rice seedlings in the absence of’ oxygen. Ueda and Tsuji (1971) observed that the mitochondria of rice rootlets germinating in anaerobic conditions displayed cristal dilation and vesiculation, although Opik recorded little change in total cristae numbers under these conditions despite a reduction in cytochrome oxidase activity (Opik, 1973, 1975). Vartapetian et al. (1976) showed that the cristae increase in number and are arranged in parallel arrays within the mitochondria of rice seedlings directly following normal germination. These cristae increases were maintained for 5 days in nonexcised roots cultured anaerobically, but cristae degradation rapidly followed in excised rootlets. They further showed that excised rootlets of both rice and pumpkin retained the increased cristae membranes if exogenous glucose was provided. They proposed that in oxygen-free environments mitochondrial membranes that have lost the capacity for aerobic respiration may be able to function as collectors of energy released elsewhere by glycolysis (Vartapetian et al., 1977). This in turn suggests that the mitochondrial integrity in rootlets during extended anaerobic periods after germination, as would exist in waterlogged rice fields, may not be indicative of normal functioning per se, but rather of the plant’s capacity to transport substrates from aerial green parts for transformation to chemical and physiological energy in the root. Respiratory poisons, e.g., KCN, rotenone, and sodium azide, induce cristae dilation often accompanied by vacuolation (Oberg, 1967; Auclair et al., 1976; Smith et al., 1979; Wille and Steffens, 1981) (Fig. 6b). Chemicals that uncouple oxidation and phosphorylation affect cristae number and form (Buffa et al., 1970; Didio et al., 1975; Smith and Ord, 1979; Rydzynski and Cieciura, 1980). These results are indicative of a relationship between the mitochondrion’s form and function. However, the relationship may not be a direct one for all respiratory poisons because at least some of these agents have more than one target within the cell. For example, Buffa et al. (1977), using the more general poison fluoroacetate to decrease ATP levels and inhibit respiration, concluded that cristal modification that accompanied this inhibition was a secondary event. Indirect damage to mitochondria may be responsible for changes in cristal

82

ROBERT A. SMITH AND MURIEL J. ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

83

numbers and form. Indirect damage may be caused by a wide variety of toxic substances, e.g., MNU, hydroxylamine, dioxin, adriamycin-substances whose primary target may be nucleic acids or the protein machinery of the cell (Ord, 1979; Walling and Ord, 1982) (Fig. 6c and d). The severity of the effects of such poisons can vary greatly with different methods of drug application. This may in part be due to the uneven saturating of different detoxifying pathways or cell repair mechanisms, or to the availability of other sites to take up the chemical (Fig. 7). Furthermore, different cell organelles could be the target of a poison under different treatment conditions. Chronic and acute dosing of cells, animals, or man produce very different cell effects and may account for some of the apparent conflicting reports in the literature. With cadmium-induced effects, the induction of metallo-binding proteins may give rise to different observations depending on whether subacute, acute, or chronic doses are administered (Hoffmann et al., 1975; Ord and A1 Atia, 1979; A1 Atia, 1980). In other cases, species differences may be relevant, i.e., with cobalt toxicity an expected loss of cristae was observed in cardiac muscle taken from the dog (Sandusky et al., 198l), but decreased cristae were reported in rat myocardial cell mitochondria following treatment (Lin and Duffy, 1970). Other mitochondrial effects, particularly with metals, may occur due to the replacement of one metal ion by another or the removal of a metal ion from an essential site by competitive binding. This would appear to be the case with copper; treatment with cuprizon (a copper chelating agent) produced irregularly arranged cristae located peripherally (Suzuki, 1969), a result similar to the abnormalities induced in yeast cells grown in low copper concentrations (Keyhani, 1973). Anticancer drugs such as adriamycin (Dantchev et al., 1979) and methylglyoxal-bis-(guanylhydrazone) MGBG (Diala et al., 1980a) cause a decrease in and reorganization of cristae. After treatment with ethidium bromide, cristal loss may in part be responsible for the generation of matrical inclusions (Soslav and Nass, 1971; McGill et al., 1973; Porter et a l., 1979). Cristae are also progressively lost if mitochondrial protein synthesis is inhibited by treatment with erythromycin and chloramphenicol (Knowles, 1972; Adoutte et al., 1972). This is presumed to result from a loss of cytochromes a, a3, and b, all of which are controlled by the mitochondrial genome (Soslav and Nass, 1971). However, some level of nuclear control over cristae integrity is also suggested: if amoebae are enucleated, cristae morphology begins to show irregularities and dilation FIG. 6 . (a) Cristal vacuolation generated in Arnoebaproteus by anaerobic culturing for 5 hours in a hydrogen atmosphere. X 17,500. (b) Similar vesiculated cristae induced in amoebae by a 15-minute treatment with potassium cyanide. x 30,000. (c) Amoeba mitochondrion with widening of peripheral cristae and a reduction in the numbers of infernally located ones following a 3-hour exposure to 100 pg/ml adriamycin. ~ 2 5 , 0 0 0 (d) . Crisfae widening with 1 pg/ml adriamycin for 24-hour exposures of Chinese hamster ovary cells. This effect, reminiscent of that with amoebae only occurs with longterm, high-dose treatments and is concomitant with nucleolar damage. X24.000. ( c )and (d) courtesy of J. M. Walling, Harwell, England.

84

ROBERT A . SMITH AND MURIEL J . ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

85

after 5 days (Flickinger, 1968b). Similarly, abnormalities in the mitochondrial cristae of nonviable hybrids between Amoeba proteus and A. discoides have been attributed to alterations in nuclear control of mitochondrial metabolism (Jeon, 1975). The organization of the cristae membranes, therefore, involves a complex number of factors that depend to a large extent on the metabolic integrity of the organelle. Cells with higher metabolic demands generally have numerous, closely packed cristae, whereas those of cells grown at low oxygen tensions (cells in which basal rates are significantly lower) show relatively few cristae per profile. If respiratory function is inhibited, as in anaerobiosis, cristal organization is disrupted, as it is when mitochondrial transcription and translation are impaired. Cristal reduction is frequently an early sign of pathological change within the cell and often accompanies the enlargement of organelles and/or the eventual presence of matrical inclusions. Demonstration of whether the cristae are intimately associated with the inner membrane or completely separate entities (as Sjostrand maintains) awaits further studies. However, whatever these may show it is unlikely that they will invalidate the conclusions from existing data, which demonstrate that cristal structure is tightly linked to mitochondrial function, as will be elaborated further in the following section.

IV. The Form of the Chondriome and Metabolic Activity The energy a cell is able to generate in the form of ATP depends upon the number of available mitochondria and on the amount each mitochondrion contributes. The latter would also depend on the rate at which oxidative phosphorylative activities proceed. The question we must now ask is, “To what extent are the energy requirements of the cell reflected in the form of its chondriome?” I N ENERGY DEMANDS OF DIFFERENT CELLTYPES A. DIFFERENCES

As reviewed in the previous two sections, energy needs are met in different cells in various ways: one cell type may fulfill its energy commitments by having

FIG. 7. Mitochondria of Chinese hamster ovary cells treated with the carcinogen N-methyl-Nnitrosourethane (MNU) (doses up to 90% lethal, although the cells represented here had a viable appearance). The monitoring of mitochondrial form changes with time in toxicological and morphological studies should allow evaluation of their activity. Controls to these experiments are shown in Fig. 9. Cells were treated for 20 minutes with 0.5 or I mM MNU and were fixed after (a) 0.5 hour (X28,OOO); (b) 1 hour (X28,OOO): (cj 2 hours (X28.000); (dj and (e) 24hours(X24,000and X 16,000, respectively); (f) 3 days. The cristae in (f) were often dilated, whereas organelle size was apparently increased by either branching or elongating (growth and/or fusion and swelling) (x28.000).

86

ROBERT A. SMITH AND MURIEL I. ORD

a large number of mitochondria; another may have a smaller number of mitochondria but the mitochondria may be of larger size; and/or may increase the surface area of those cristal membranes that are capable of structural transformations. Chondriome dissimilarities are seen not only among independent single cells in which environments vary greatly but also, though to a lesser extent, among specialized cells or tissues in which each cell type is “geared” to a limited number of specific activities. Large numbers of mitochondria coincident with high cell energetics do exist in tissue in which a specific activity predominates (e.g., the production and secretion of new materials; work in the form of cell movement or muscle contraction; the transport of substances across membranes). For example, Morris and Pickering (1976), examining the ionic secretory cells of the lamprey gill, showed that high energy demands are met by a large mitochondrial complement. Brown e t a l . (1981) report a similar finding for the skin of a number of amphibia in which the epidermal cells are active in ionic regulation and possibly gaseous exchange. A change in mitochondrial numbers correlated to a change in cell energetics occurs in the muscle cells of coldacclimated rats, in which the observed significant increases are considered to reflect a greater need for heat generation and/or a slower rate of production by individual mitochondria under these conditions (Behrens and Himms-Hagen, 1977; Buser et a l . , 1982). Some transformed cells show high mitochondrial densitites, e.g., oncocytomas (Valenta et a f . , 1974; Roy, 1978); although other tumors with a high capacity for glycolysis are markedly deficient in mitochondria (Pedersen, 1978). These changes may be related to growth and division factors or to defects in respiratory chains that have reduced efficiencies in oxidative steps. With acclimation to hypoxia, the slow and fast myotomal fibers of the tench Tenca tenca showed decreases in the mitochondrial volume fraction of 23 to 15% and 5.4 to 1.8%, respectively, with a related 33% drop in cytochrome oxidase activity; under these conditions there is an enhanced capacity for glycolysis (Johnston and Bernard, 1982). In some cells a high energy requirement results in densely packed cristae arrangements rather than increased mitochondrial numbers. This has been shown for steroidogenic cells of fetal rat adrenal cortex (Salmenpera, 1976), for mouse mammary gland epithelial cells (Rosano et a f . , 1976), and for skeletal muscle fibers of both avian and mammalian origin (Slautterback, 1965; James and Meek, 1979). Durrer and Bowald (1982) quantified structural parameters in liver mitochondria of the shrew and compared them with the rat hepatocyte. They found that the 5- to 6-fold higher basal metabolic rate in the liver of this small active rodent was achieved by an increased mitochondrial matrical volume: the 84% absolute enlargement also results in a greater respiratory surface to accommodate respiratory complexes. Gross mitochondrial size may be a reflection of activity in some instances. If one considers chondriomes of equal total volume, contact with cytosol would be considerably greater if many small mitochondria were present than if the

87

MITOCHONDRIAL RELATIONSHIPS in Vivo

chondriome consisted of a few, large, branched organelles. Not only would more numerous, smaller mitochondria present more external surface for substrate exchange, but it would also enable a wider scattering of mitochondria within the cell, possibly improving the distribution of energy and, therefore, aiding synthetic activities. Until further data is available, however, we are left to speculate as to whether an assembly of mitochondria into branched networks at certain times, but into many smaller organelles at others, does correspond to a change in chondriome activity. If so, this would confirm the conclusions from observations on embryonic cells in culture reported by Lewis and Lewis as early as 1915.

B. CHANGESIN ENERGYDEMANDSWITHIN

THE

CELL

The preceding examples relate to the long-term energy commitments of cells in tissues. Many cell activities, however, can be extremely variable, with energy not required at a constant rate but changing rapidly. If output varies greatly as the cell’s needs change (i.e., responding to external and/or internal signals and substrate availability), are these changes reflected in mitochondrial morphology? Furthermore, does the chondriome respond as a whole or do mitochondria act singly so that more than one conformation is present at fixation? A number of reports have shown mitochondrial form alterations during periods of increased respiratory activity. These alterations appear as changes in the matrix density, concomitant cristal rearrangements, and associated variations in intracristal space dimensions. The process of oxidative phosphorylation and its relationship to structural parameters has often been difficult to interpret in in vivo mitochondria, however; and so isolated organelles have been used in which it is possible to precisely measure respiration, relate respiratory state to conformational changes, and monitor the effects of different ion and substrate concentrations. Although the isolated mitochondrial work will not be dealt with in detail in the present article (see further Munn, 1974) an understanding of this system is necessary as a basis for interpreting the in vivo work.

C. MITOCHONDRIAL FORMCHANGESin Vitro

Two extreme mitochondrial forms are seen in isolated preparations with changes in respiratory states: a condensed conformation, and also the expanded or orthodox configuration (Hackenbrock, 1966, 1968; Muscatello et al., 1972). The condensed form is characterized by an increase in the volume of the outer compartment and intracristal space, with a concomitant decrease in the matrical volume, a change that raises its electron density. This conformation is observed when energy levels are low during oxidative phosphorylation or when electron

88

ROBERT A. SMITH AND MURIEL J. ORD

transport is inhibited. Mitochondria with the orthodox configuration display an increase in matrical volume, a change that makes the matrix more electron translucent while the outer compartment and the intracristal space are reduced. This state is present with high levels of energization, being generated by the onset of phosphorylation. Between the two configurations, various intermediate forms have also been recorded. Although the validity of the rapid sampling for chemical fixation and negative staining methods employed in the initial studies has been criticized for membrane investigations, freeze-fracture and freeze-etch procedures have continued to demonstrate a link between mitochondrial membrane transformations and metabolic activity changes (Hackenbrock, 1972; Andrews and Hackenbrock, 1975). Low-temperature studies of rat liver mitochondria have revealed that reversible long-range lateral translational motions of intramembranous particles can be induced without destroying electron transport or oxidative phosphorylation (Hochli and Hackenbrock, 1976). More recently advances in spray-freeze-etch, which eliminates the need for cryoprotectants in the preparations, have broadly confirmed Hackenbrock’s earlier observations (Lang and Bronk, 1978). This structural change in mitochondria is currently considered to result from an osmotic modification to the matrical ionic content, a change that occurs with energization. The structural change may be induced by ionic accumulation (Hackenbrock and Caplan, 1969; Schmidt er al., 1977) and/or by nucleotide translocation (Scherer and Klingenberg, 1974) in addition to phosphorylative events. The question of whether changes seen in isolated mitochondria are partly artifacts due to the more extreme conditions of experimental manipulation has frequently been raised (Sjostrand, 1977). Shimada et al. (1978) claimed, after a scanning electron microscopic study of rat liver and monkey cardiac muscle mitochondria, that it was possible to distinguish orthodox, condensed, and swollen organelles upon isolation-the orthodox conformation being most prevalent directly following resuspension. Koukl et al. ( 1977), however, in three-dimensional reconstructions of the mitochondria from ascites tumor cells, showed that the gross form of the complex branches of mitochondria was not significantly altered during changes in respiration, structural transformations being restricted to the inner mitochondrial membrane. These authors point out that complex forms are inevitably lost during cell homogenization and subsequent subcellular fractionation, a finding that may suggest that the gross variations in the mitochondria of the scanning electron microscope study, attributed to inner membrane transformation events, are in fact partly related to the isolation procedures. Overall structural variations during energization would not necessarily be expected, except for the usual shape fluidity associated with mitochondrial mobility within the cell (Bereiter-Hahn, 1978). Assuming, however, that the inner membrane transformations of isolated organelles do broadly simulate mitochondrial behavior in situ, extrapolations can be used to interpret data on the chondriome of the intact cell. Two related

89

MITOCHONDRIAL RELATIONSHIPS in Vivo

differences cannot be overstressed, however, in assessing in vitro and in vivo data together: ( 1) the environment of isolated mitochondria markedly differs from that in the cell, with many factors missing that directly or indirectly affect function, and (2) the isolated mitochondrion is in an artificially static situation, with no link between energy production and utilization, whereas the in vivo state is very much a dynamic one. D.

MITOCHONDRIAL

FORM CHANGES in

ViVO

Data suggests that in vivo mitochondria can undergo form changes similar to the condensed-orthodox transformations seen in vitro (Hackenbrock et al., 1971). Information comes from studies of both vertebrate and invertebrate tissues, but systems spanning dramatic functional changes, such as found in germ cells or in early embryonic tissues, are particularly helpful. The energy demands, nucleotide pools, and substrate availability of germ cells will be constantly changing as cells mature, fuse, and begin to divide and form the tissues and functional organs of the embryo; any changes in mitochondrial conformations might, therefore, be related to these variations in activity. Little data of this type is available, however; although the interesting results from studies of maturing and fertilized sea urchin eggs by Innis et al. (1976) may encourage others in this direction. These authors showed that the chondriome of the unfertilized egg consists mainly of condensed mitochondria but that after fertilization orthodox forms predominate. The timing of this rapid switch in the mitochondrial population coincides with a relative decrease in the ADP concentration of the egg at fertilization. They hypothesized that changes in the adenine nucleotide balance (e.g., the ADP/ATP ratio) can affect mitochondrial configuration, though without necessarily inducing increases in phosphorylation despite a stimulation of respiration. Consideration of the release of intracellular Ca2 with fertilization may also be necessary, however, before a full interpretation of this change is made (Steinhardt et al., 1977). Mammalian female germ cell development, e.g., in hamsters and rats, has been shown to involve phases of high metabolic activity when the mitochondria are present as orthodox forms; whereas in phases of low activity, a condensed mitochondrial conformation predominates (Weakly, 1976; De Martino et al., 1979). Sperm maturation, such as in crabs (Pearson and Walker, 1975), mollusks (Anderson, 1970), and insects (Witalinski, 1982), also involves mitochondrial transformations that can be associated with functional alterations leading ultimately to a switch to glycolytic pathways. In amphibian blastulae, mitochondrial form undergoes qualitative differences, becoming more orthodox as the metabolically deficient cells of the embryo differentiate (Nelson et al., 1982; Nelson, 1982). Many in vivo studies of adult tissue cells examine and compare the chondriome of different tissues rather than following the fate of the mitochondria through different functional states in the same tissue. In general they show significant differences in chondriomes of tissues carrying out different +

90

ROBERT A. SMITH AND MURIEL J. ORD

functions but similarities among the mitochondria of cells within each tissue. Cieciura et al. ( 1979), for example, studying mitochondrial configurations in several organs of the rat, showed more condensed forms in heart and stomach cells, whereas those of the liver were in an orthodox state. They suggested that the extent of mitochondrial plasticity in various organs could be an expression of functional differences. Some authors do consider the same tissue under different states of activity. For example, Butt (1982), in a study of the nasal gland of the domestic duck, has shown that in the inactive gland only one mitochondrial type is present, a ”resting” form with intermediate matrix density; whereas, in the active secreting gland, some cells possess mitochondria of a second type, mitochondria in which a lighter matrix exists. Scothorne (1959) had previously reported a functional change in the mitochondrial phospholipid content during salt secretion by the active gland. In general, the observed uniformity of mitochondrial form throughout a tissue sample has been used as an argument for a dependency of form on the fixation regimen employed by the experimenter. A possible alternative explanation for such similarities can be suggested, however, if one considers the cellular interactions within tissues. Not only are cells within most tissues equally nourished through a comprehensive vascular system, but neighboring cells are also interconnected through gap junctions. Because these allow the passage of ions and small molecules from one cell to another, any changes in a cell produced by, for example, hormones or neurotransmitters, could affect adjacent cells. Only if junctions were blocked, as might happen with injury, would a cell exist independently from its neighbors. If this occurred, would the differences of individual cytoplasmic environments be sufficiently marked to produce chondriome variations?

E. THEMITOCHONDRIA OF CELLSIN CULTURE One way of breaking this interdependency of cells in a tissue is to isolate and grow them in culture. A uniform cultural environment is retained, but intracellular compartments remain separate. The experimenter, therefore, has more control in manipulation of the system, e.g., for nutrient or ion availability, pH, temperature, and oxygen tension, than in whole animal studies. Any mitochondrial transformations may in consequence be precisely followed. Primary cell culturing has an advantage over other systems in that mitochondrial forms can be directly related back to those of the intact tissue. Any effects due to the isolation and control growth procedures may be taken into account FIG. 8. Orthodox mitochondria of a rat hepatocyte fixed “in siru” with 3% glutaraldehyde-3% glucose. (a) G, Glycogen. X27.000. Courtesy of H . S . Johnston, Glasgow. (b) Condensed mitochondrion in a rat hepatocyte 4 hours after isolation from the liver by collagenase perfusion. X30,OOO. (c) Return to more orthodox forms after 24-hour culturing. X27,OOO.

MITOCHONDRIAL RELATIONSHIPS in Vivo

91

92

ROBERT A. SMITH AND MURIEL J. ORD

before artificially manipulating the environment. For example, in rat hepatocytes the mitochondria in situ generally have an orthodox configuration (Fig. 8a). When the liver is removed and the cells isolated by collagenase perfusion, the chondriome assumes a relatively condensed appearance (Williams et a l . , 1978; Goldfarb et a l . , 1978). After culturing in a suitable medium, the mitochondria revert to an orthodox configuration and retain this for up to 14 days (Fig. 8b and c). Variations in mitochondrial form have been reported for primary cultures of human hepatocytes, these being more evident as the period after isolation is extended (Maekubo et al., 1982). The primary culture of nervous tissue also induced chondriome changes after prolonged culturing (Rublyeva and Buravlyev, 1979). It appears, therefore, that primary cells in culture, although good for comparative information with the original tissue cell in the short term (i.e., up to 2 weeks) become questionable for long-term use, particularly as cell viability decreases. Alternatively, established cell lines of tissue cells have some use in mitochondrial work as their cycling capability makes long-term studies possible. Changes in mitochondrial form with environment are often readily evident for these cells. Figure 9 shows differences in the chondriome of Chinese hamster ovary cells under different culturing conditions: (a) after detachment with trypsin; (b) after reseeding cells; (c) 4 days later when cells have reached confluency and the nutrients are exhausted; (d) 1 hour after replenishing medium and serum while retaining cell associations and substratum attachments. In (d), the time of fixation was such that some cells retained the condensed forms of confluency cultures while others have responded to the fresh nutrient medium by changing to an orthodox chondriome. This suggests that the form of the mitochondria can vary from one cell to another, provided cell-cell communication is prevented. It is, however, noticeable that the cells respond to changes in their environment roughly “in step” and within a relatively short period of introducing fresh solutions. Free-living cells such as Amoebae, Paramecium, Tetrahymena, Euplotes, and yeasts are particularly useful in mitochondrial studies because they can be grown in the laboratory in conditions similar to their normal habitats. One of the most interesting findings from such independent cell studies is that different types of mitochondria can exist side by side within the same cell, e.g., in Amoeba FIG.9. Control Chinese hamster ovary (CHO) cell mitochondria grown in various culture conditions. (a) Dividing, nonconfluent cultures with ample nutrients and ions have cells in which orthodox mitochondria, often associated with endoplasmic reticulum, are observed. X 16,000. (b) With confluency the mitochondria are condensed and the cristae more prominent. X20.000. In (c) and (d) fresh medium was added to 3-day-old confluent cultures 1 hour before fixation; in some cells condensed or intermediate forms are seen, whereas in others the mitochondria revert to an orthodox form (d). x6000 and X25,000, respectively. (e) Fresh medium, but without serum, preserves a condensed chondriome with prominent, often blebbing, cristae. X20.000. (f)Cells fixed after a 10minute exposure to trypsin at room temperature; cristae narrow and running the length of the mitochondrion. X 28,000.

MITOCHONDRIAL RELATIONSHIPS in Vivo

93

94

ROBERT A . SMITH AND MURIEL J . ORD

(Flickinger, 1968a) and Euplotes (Jurand and Lipps, 1973). Further studies may show that this is a more widespread phenomenon, but it may be that it is limited to large cells and/or cells with slow internal distributions of nutrients and ions (because of food vacuole formation) and with unequal demands on ATP (e.g., in advancing pseudopodia or at the contractile vacuole). Figure 10 shows condensed and orthodox mitochondria in a 5050 ratio in a 48-hour starved Amoeba proteus, whereas in Fig. 10b the relative proportions were approximately 30 Type 1 to 70 Type 2 in the vicinity of the contractile vacuole of an active cell. Studies using Amoeba proteus have shown that the existence of mixed mitochondrial populations within individual cells is not a fixation artifact due to osmotic effects or to differential fixative penetration (Flickinger, 1968a); nor can it be linked with mitochondrial aging and/or DNA replication (Smith, 1978a). The mitochondrial forms grade from expanded to condensed types, with a range of intermediate forms between the two extremes (Smith and Ord, 1979). Work in our laboratory suggests that these form differences can be correlated with organelle activity, e.g., related to different cell cycle stages when metabolic demands vary, under different feeding regimes, and with altered levels of pseudopodal formation.

F. CHEMICAL MANIPULATION OF CELLRESPIRATION Some of the earliest work manipulating cell respiration in vivo and monitoring mitochondrial transformations was done by Hackenbrock and his colleagues soon after they had established a form and function relationship in the isolated mitochondrial system. In a study using Ascites tumor cells, ADP levels were raised by the addition of 2-deoxyglucose to the growth medium (Hackenbrock et al., 1971). The cells responded by a burst of respiration during which oxygen consumption doubled and ATP synthesis was stimulated. Within 6 seconds the mitochondria were transformed from orthodox to condensed forms. This artificial manipulation of the ADP/ATP pools was, however, followed by a period of respiratory inhibition. In a more comprehensive study of slices of Morris hepatomas, a number of physical and chemical treatments were used to induce orthodox, intermediate, and/or condensed mitochondria (Galeotti et al., 1976). The effects of temperature changes, the addition of exogenous glucose to regulate nucleotide pools, and the presence of respiratory inhibitors such as ouabain, oligomycin, and cyanide were all studied. The mitochondria of unincubated fresh tissues had an orthodox FIG. 10. (a) A 48-hour starved Amoeba proteus with condensed Type 1 and expanded Type I1 mitochondria coexisting in the same cell in an approximate 1 : 1 ratio. (In well-fed amoebae, a larger number of mitochondria assume the expanded form.) X25,OOO. (b) A 10-hour-old G 2 amoeba, which is in an active RNA- and protein-synthesizing phase. The mitochondria are surrounding the contractile vacuole. N, Nucleus. X7000.

MITOCHONDRIAL RELATIONSHIPS in Vivo

95

96

ROBERT A. SMITH AND MURIEL J. ORD

conformation; incubation at 1°C induced condensed conformations but with a rapid return to the orthodox form on subsequent incubation at 38°C. Cyanide treatments either with or without glucose gave condensed mitochondria, whereas ouabain produced larger numbers of intermediate forms-thus proving that mitochondria in vivo do respond to changes in metabolic states by undergoing structural transformation. The observations by Galeotti were not always directly comparable to those of in vitro studies, but any differences were attributed to the continuation of multiple metabolic reactions in intact cells during experimental manipulation, reactions that are lost with subcellular fractionation procedures. Uncoupling agents and respiratory poisons have been widely used for mitochondrial structural studies in vivo. Rydsynski and Cieciura (1980) showed that treatment of rat choroid plexus ependymal cells with 1 mM dinitrophenol for 7 minutes caused a condensation of the inner compartment in the numerous mitochondria of this active tissue. This resulted from a loss of ions and accompanying water, with a corresponding increase in the outer compartment volume. After 15 minutes, mitochondria1 swelling was observed, with the matrix becoming more electron translucent. A similar cycle of events was observed by Laiho and Trump (1975) when Ascites cells were treated with uncoupling agents. The results of Laiho and Trump (1975) agree with the data obtained by Muscatello et al. (1978) from isolated rat liver mitochondria treated with dinitrophenol and other phenol agents. All of these data demonstrate an association between uncoupling and modifications to the structure of the inner membrane’s lipoprotein complexes. Even so, the changes at the level of the elementary membrane need not be a direct expression of energization-deenergization events per se. Intermediate to condensed conformations have been generated in chick myoblasts (Buffa et al., 1970) and tomato seedling mitochondria (Morisset, 1974) with exposures to dinitrophenol, whereas higher doses or prolonged uncoupler exposures caused organelle swelling and/or rupture in several in vivo studies (Jasper and Bronk, 1968; Weinbach et al., 1967; Didio et al., 1975). We have used a number of different respiratory inhibitors and uncoupling agents on Amoeba proteus (Smith, 1978a; Smith and Ord, 1979; Smith et al., 1979). Though there were subtle differences with the different treatments (see Fig. 1 l), the general change was to a chondriome primarily of an intermediate or condensed configuration. If the cells were removed from the treatments before gross mitochondrial swelling occurred, the effects were reversible; if treatments were more prolonged, membrane rupture resulted. FIG. 1 I . Effects of uncoupling agents on the mitochondria ofAmoehaproteus. (a) An elongated, intermediate mitochondrion closely associated with a lipid droplet (L) after a 15-minute treatment with 100 p M dinitrophenol at pH 4;note dilated cristae (arrows). X33,OOO. (b) Mitochondria1 form after treatment with 5 pM pentachlorophenol for 30 minutes. x 33,000. (c) Elongated mitochondria (length = 4.4 pm) induced by a 2-minute exposure to 80 pA4 rn-chlorocarbonyl cyanide phenylhydrazone. x 26,500.

MITOCHONDRIAL RELATIONSHIPS in Vivo

97

98

ROBERT A. SMITH AND MURIEL J. ORD

Chemicals such as chlorocarbamyl cyanide phenylhydrazine (CCCP) and pentachlorophenol (PCP) are specific mitochondrial poisons. With other chemicals, mitochondria are primary targets, although other sites are vulnerable too. Mitochondria may, however, be only secondary or indirect targets, i.e., affected through changes in another organelle or overall cell metabolic activity as results from treatments with many metals and carcinogens. In some cases, inhibition of oxidative pathways (irregardless of whether it is caused directly or indirectly by a treatment) could have significant effects on the total potency of the chemical. Thus a chemical such as an alkylating carcinogen may by inhibiting respiration have a corresponding effect on the use of a damaged template for replication or for production of RNA; however, alternatively, it could change the ratio of DNA repair from an efficient excision repair pathway to a more error-prone, postreplication repair pathway. In both pathology and toxicology, a knowledge of whether oxidative phosphorylation proceeds normally could greatly facilitate our ability to understand what is taking place in the intact cell. Such deductions should be possible from EM examination if only we can interpret the changes seen in the characteristics of in vivo mitochondrial morphology in healthy cells. In vitro work is relating some of these variations to specific respiratory events. We have introduced a new “semi-vivo” system (Section IV, G) that we hope will act as a link between such data from the isolated mitochondrial work and the morphological data from in vivo studies.

G . MITOCHONDRIAL MANIPULATION BY MICROINJECTION INTO THE LIVINGCELL Our semi-vivo model system uses Amoeba proteus and the injection of metabolites or chemicals directly into the cell (Ord and Smith, 1982). In this way the mitochondrial environment can be manipulated without losing its links with other cellular activities. To date our work has aimed at establishing the extent to which cristal width, matrical density, and organelle form are dependent on normal cell variables, e..g., ADP:ATP ratios, substrate availability, and ion levels. Since the mitochondrial population of Amoeba proteus consists of condensed (Type I) and expanded (Type 11) forms with their various intermediates, the effect of an injection may be determined by monitoring the subsequent change in the ratio of Type I to Type I1 forms. Our initial ratios (see Table 2, Ord and Smith, 1982) fit an energization cycle similar to that proposed by Hackenbrock for isolated mitochondria: the proportion of condensed mitochondria increased after injection of ADP whereas the percentage in the orthodox Type I1 form increased after ATP injections (Fig. 12). When high concentrations of nucleotides were injected, the resulting mitochondrial forms often became extreme, e.g., enlarged profiles with relaxed membranes, in the case of ATP; condensed but contorted forms with ADP. Injections of deionized water supported our supposition that any change in the Type 1:Type I1 ratio was due to a disturbance in nucleotide pools and not

MITOCHONDRIAL RELATIONSHIPS in Vivo

99

simply to a cytosol-dilution artifact. Changes in the Type 1:Type I1 ratio with time suggested that if succinate accompanied ADP injections the resulting condensed form gradually switched to a more intermediate or orthodox form; after ATP injections the orthodox form remained high (90- 100%) over prolonged periods. Injections of Ca2 , PO,-, or Mg2 solutions suggested that specific ions caused changes in particular parameters contributing to the overall mitochondrial form; breaking the link between wide cristae/dense matrix/elongated forms and narrow cristae/pale matrix/expanded form in control material. Ion results, however, are far more difficult to interpret and will require further study before they can be interpreted fully. One of the chief values of the model is that nucleotide, substrate, and ion concentrations of the cell can be altered rapidly and that such changes are produced without loss of cell viability. After an initial and short-lived (i.e., seconds) surge of cytoplasm upon injection, and with some substances the induction of characteristic pseudopodal patterns, each amoeba returned to its normal +

+

FIG. 12. The effects of nucleotide injections on the Type 1:Type I1 mitochondria1 form ratio in Amoeba proteus. (a) Amoeba fixed 2-4 minutes after an injection of 3 mM ADP with most mitochondria as the Type I form. (b) Amoeba fixed 5-10 minutes after a 10 mM ATP injection with most mitochondria as the expanded Type I1 form. X I 1,500.

100

ROBERT A . SMITH A N D MURIEL J . ORD

cytoplasmic movement and pseudopodal formation. Cell adhesion and contractile vacuole activity appeared unaffected, and with moderate doses the divisions cycle was not delayed. Electron microscopic examination showed that although the added fluid initially diluted a large portion of the cytoplasm, it was eventually concentrated into numerous pools of 20-30 km diameter, which acquired single membranes separating them from the main cytosol. Such vacuoles remained for 24 hours with no indication that they followed the digestive pathways of phagocytosed or pinocytosed material, e.g., no attraction of or fusion with lysosomes. No other organelles appeared distorted or damaged by the injections. While the overall picture expressed as the ratio of Type 1:Type I1 mitochondria showed a clear association between form and ionic-osmotic control factors, single amoebae showed some individuality. Data from single amoebae suggests that the interaction between ions, substrate, and nucleotides is complex, with differences in the rate individual amoebae respond to injections; adjustments probably reflect endogenous substrate or ions levels resulting from remaining food vacuoles and from the refractile lipid spheres with their accompanying stores of Mg, Ca, and P ions (Coleman et a f . , 1973). Figure 13 sets out the changing levels of Type 1:Type I1 populations in histogram form to illustrate the distribution of mitochondrial ratios upon experimental manipulation. The use of microinjection for investigations that require the introduction of material into a cell without risk of immediate digestion is not new. In the early 1970s R. J . B. Wright and L. G. E. Bell used amoebae in a study of mitochondrial autonomy by following the fate of mouse liver and Xenopus laevis oocyte mitochondria injected into Amoeba proteus. Though they were unable to prove mitochondrial autonomy or biogenesis, EM studies did show that these foreign mitochondria could survive free in the amoeba cytoplasm for at least 24 hours and that during this time they retained intact membranes and their own specific and recognizable cristal formations (Wright, 197I). In a study concerning mitochondrial origins, Jeon and Ahn (1979) injected certain strains of bacteria into Amoeba and followed the gradual tolerance and eventual dependence that developed between the amoeba and bacterium. Though exchange of material between closely related strains of Amoeba shows a high degree of intolerance, organelle or homogenate injections from widely separated organisms (including man) into amoebae seem to be well tolerated. The amoeba system, including microinjection studies, therefore, has considerable potential for mitochondrial investigations. The disruption of the fine balance between condensed Type I and orthodox Type I1 mitochondria, the changes in the cristae, and the generation of matrical inclusions could all prove valuable in identifying damage to mitochondria by toxic chemicals (Ord, 1979). Such parameters may prove more sensitive for screening mitochondrial lesions than other cell systems at present in use, e.g., myogenic cells, human liver cells, and yeasts, where the changes in orthodox and condensed forms have been of a limited nature (Manchester et a l . , 1973; Pinchuk et a l . , 1979; Diala et a l . , 1980b).

101

MITOCHONDRIAL RELATIONSHIPS in Vivo

A

I

B

C

D

F

G

H

-u

E" 51

8 C

>.

0.54

Type I Type II

*

OP1Oo

Mitochondrial type distributions per cell.

FIG. 13. Histogram plots of the effects of nucleotide and substrate injections on the chondriome of 24-hour starved Amoeba proteus. (a) Uninjected control Type 1:Type 11 ratio. (b) Deionized waterinjected controls. (c) No significant switch in the ratios following injections of 10 mh4 sodium succinate, (d) with 10 mM ADPl10 mM sodium succinate for 1-30 minutes; however, the mitochondrial population shifted toward Type I1 forms. (e) and (f) show how 3 mM ATP injections for 1-4 minutes and 6-30 minutes, respectively, rapidly induce predominately Type 11 forms; whereas (g) and (h) illustrate how 1-4 minutes and 8-25 minutes injections with 3 mh4 ADP cause a significant shift toward Type I forms. Based on data from Table 2 of Ord and Smith (1982). The white lines mark the position where a 1 : l ratio is present.

V. Mitochondrial Inclusions In addition to DNA nucleoids (Kuroiwa, 1982) and mitochondria1 ribosomes (Borst and Grivell, 1971) within the matrix, inclusions of various forms have a

102

ROBERT A. SMITH AND MURIEL J . ORD

widespread occurrence in many different cell types. Their frequency is increased with environmental stress, in certain diseases, and after chemical exposure. This has led many authors to conclude that excessive numbers of inclusions represent an abnormality related to certain physiological and pathological changes in the cell’s metabolism. In most cases, however, their function remains obscure. Inclusions may be grouped into either dense bodies and granules, or crystalline forms that are often tubular or rodlike in structure. The filamentous crystalloids are commonly sectioned as parallel platelike arrays, often forming regularly arranged lattices. Most inclusions are located within the matrical compartment (Munn, 1974), although they may also be present intracristally or between the inner and outer membranes (Yamamoto et al., 1969; Hanzlikova and Schiaffino, 1977). A. GRANULES The small granular inclusions found in the mitochondrial matrix are thought to be associated in some way with cationic sequestration; a prominence with certain physiological and/or pathological conditions may represent an imbalance of such ions. Such a role was indicated by Peachey (1964) who, examining the mitochondria of excised toad bladder and isolated rat kidney mitochondria, demonstrated an increase in size and density of these 20-50 nm matrical granules following in vitro incubation with Ca2+, Sr2+, and Ba2+. Since that time calcium deposits have been determined by electron probe analysis, autoradiography, and histochemical staining methods in the mitochondria from many other normal tissues: the smooth muscle cells of mouse intestine (Heumann, 1976), neurosecretory cells of the brain of the desert locust (Normann and Hall, 1978), cells in the islets of Langerhans of rat pancreas (Howell and Tyhurst, 1976), and unfertilized sea urchin eggs (Cardasis et al., 1978). In human gastrointestinal tract cancers, similar electron-dense granules were seen to be composed of calcium linked to a glycoproteic substrate (Marinozzi et al., 1977), whereas the deposits in ischemic myocardial mitochondria proved to be of magnesium phosphate as well as calcium salts (Ashraf and Bloor, 1976). This does not necessarily imply that all mitochondrial granules contain calcium although they may have the potential for such ionic sequestration. Under most physiological conditions, calcium may be in such constant use that little remains to form large granular deposits in mitochondria. It may only be in cells where high levels of calcium are being used, or where calcium stores are required for rapid changes in activity, that significant calcium deposits are found in the mitochondria. For example, large numbers of mitochondrial granules have been reported in cells of calcifying tissue, particularly chondrocytes toward the active mineralization zone (Martin and Matthews, 1969); and in osteoblasts and osteocytes where the granular content varied greatly, especially following parathormone administration (Matthews, 1970). Intact mouse liver cells showed no

MITOCHONDRIAL RELATIONSHIPS in Vivo

103

mitochondrial sequestering of calcium by the small granules, until mechanical damage induced enlarged matrical inclusions similar to those observed in both intact and damaged bone tissues (Burger and Bruijn, 1979). Reports such as these suggest that small granules in normal, as opposed to moribund, mitochondria may have calcium binding as a secondary role should cellular calcium levels be artificially raised by damage to the plasmalemma or incubation in high calcium environments. This view is supported by studies of the elemental composition of matrical granules by X-ray microanalysis. Granules in the mitochondria of rat brown adipose cells, mouse gall bladder, and guinea pig kidney were all shown to contain phospholipids rather than calcium salts (Barnard and Ruusa, 1979). These findings indirectly support the alternative hypothesis that the small granules normally represent discrete sites of inner membrane assembly. Further studies using cell fractionation indicated that matrical granules are normally involved in inner membrane production, but that a calcium-precipitate fraction with a similar composition to that of the inner mitochondrial membrane may form by selective detachment should calcium levels be increased (Brdiczka and Barnard, 1980). Further support for this role comes also from reports of matrical inclusions associated with reduced numbers (e.g., Soslav and Nass, 1971; Sandusky et al., 1981) or unusual arrangements of cristae (Hawkins ef af., 1980). Studies are not yet sufficiently comprehensive to choose between membrane formation and calcium sequestering as the prime function of mitochondrial granules. One may, however, hypothesize that granules act as a “sink” for ions, molecules, or membrane components that are either stored for future recycling or removed to allow cell activities to proceed at a changed rate. If this is so, then the composition of the granules may reflect the type of activity carried out by the cell, e.g., in muscle or secretory cells, where calcium availability is important, granules may be expected to contain at least some calcium; but in brown adipose tissue, where mitochondria are active in heat generation, a role in inner membrane turnover may be of greater importance. The majority of reports on increased mitochondrial granules or size come from situations where the cell’s physiology has been altered either by a natural activity change or by introduced environmental factors. Thus hibernation and starvation stimulate the appearance of dense osmiophilic bodies in snakes (Kurosumi et al., 1966) and newts (Taira, 1979), respectively. A change from constant light to dark growth conditions results in a loss of the numerous small dense matrical granules in Phycomyces blakesleeanus, possibly reflecting changed carotene biosynthesis in the absence of light (Tu and Malhotra, 1975). Temperature changes can increase the numbers of dense granules scattered throughout the mitochondrial matrix, both short incubations at high temperatures, e.g., 15 hours at 46°C for Neurospora (Michea-Hamzehpour et al., 1980), or low temperatures, i.e., 2 hours at 1°C for human hepatoma cells (Galeotti et al., 1976); or prolonged acclimation at 6°C for 30 days for Amoeba proteus (Smith, 1979). Simi-

104

ROBERT A. SMITH AND MURIEL J . ORD

larly, granules have been generated by both low oxygen tensions as seen in myocardial infarcts and ischemic cells (Buja et al., 1976; Ashraf and Bloor, 1976) and by hyperbaric oxygen exposures as in rat renal tubules (Greene et al., 1979). In the latter case, at least, the granules did not contain calcium or phosphorus when analyzed by X-ray probes but rather represented denatured protein precipitates of degenerated cristal membranes. Dense granular deposits have been associated with the sequestration of ions other than calcium in both metabolic disease and following exposure to heavy metals (Fig. 14a). Duodenal cells treated in vivo with lead demonstrated increased staining and accumulation within the matrix adjacent to the inner membrane (Parmley et al., 1979). Dense particles were also observed in experimental cobalt cardiomyopathy in dogs (Sandusky et al., 198l), particles similar to the deposits reported in mitochondria of a patient suffering from cobalt beer-drinkers cardiomyopathy (Alexander, 1968). Iron-containing particles are present in pathological conditions such as sideroblastic anemia (Grass0 and Hines, 1969); electron probe X-ray analysis demonstrated that the iron in these substantial deposits was present as ferric phosphate and as hydrated ferric oxide (Ghadially et al., 1979), These were considered to arise from a deficiency in porphyrin or heme synthesis in the erythroblasts and reticulocytes (Ghadially, 1982). Chemicals too can produce granules or granular deposits in mitochondria. Following exposure to the insecticide Lindane, which causes hyperactivity in the neurosecretory cells of the locust Schistocerca gregaria, the mitochondria acquire dense granules larger than in controls. These are possibly linked with excessive calcium entry, although no quantification was attempted (Normann and Samaranayaka-Ramasamy, 1977). In amoeba, large doses of the carcinogen N-methyl-N-nitrosourethane induce the formation of dense granules while there is a decrease in cristae; this finding suggests that granule formation may represent mitochondrial degeneration (Ord, 1979). Granules are also present in amoebae exposed for long periods to the radio-sensitizing drug misonidazole (Smith, 1980) (Fig. 14b and c). The administration of the chemical ethidium bromide (EB) has been studied in some detail: Mitochondria1 DNA polymerase is inhibited and associated RNA synthesis suppressed, thus blocking protein synthesis. Electron-dense areas are subsequently generated within the matrix of liver cells (Soslav and Nass, 1971), Allium rootlets (Risueno et al., 1975), Amoeba profeus (Flickinger, 1973; Smith, 1980), Chinese hamster fibroblasts (McGill et al., 1973), and Ascites cells (Porter et al., 1979), and in viper spleen, where chloramphenicol gave similar results (Lunger and Clark, 1979). It was initially FIG. 14. (a) Mitochondria in a mesenteric lymph node cell of a patient with Crohn’s disease. Biopsy material obtained from J . Herman-Taylor and M . Moss, St. George’s Hospital, London. ~ 3 6 , 0 0 0 .(b) Dense granular aggregations in the mitochondria of amoebae exposed to 15 mM misonidazole for 4 days. X 20,650. (c) Persistence of mitochondrial granular bodies in Amoebae proteus 24 hours after return to control medium following a 24-hour treatment with 0.25 mM ethidium bromide. X25,OOO. From Smith (1980).

MITOCHONDRIAL RELATIONSHIPS in Vivo

105

106

ROBERT A. SMITH AND MURIEL J . ORD

thought that the electron-opaque structures represented nucleic acid aggregates; but in Allium root meristem cells, enzyme digest experiments with DNase, RNase, pepsin, and trypsin indicated that they were composed primarily of basic proteins (Risueno et al., 1975) as were other dense bodies in bovine adrenocortical cell mitochondria (Kai et al., 1977). Ethidium bromide and DNA are then complexed with the protein core of the inclusion (McGill et al., 1976). Although intramitochondrial dense bodies do occur in some human diseases (Watanabe et al., 1976; Marinozzi et al., 1977), in general these are not as prevalent as inclusions of a crystalline nature, the relevance of which are discussed in the following section.

B . CRYSTALLINE INCLUSIONS Crystalline and paracrystalline inclusions have been reported in the mitochondria of normal cells (Mugnaini, 1964; Wills, 1965; Suzuki and Mostofi, 1967; Ollerich, 1968; Davis, 1976), but in general their frequency is much higher in pathological conditions. Hepatocytes of both human and animal origin seem particularly prone to the development of crystalloids in diseased and treated liver, e.g., in diabetes (Laguens and Bianchi, 1963), in alcohol poisoning (Svoboda and Manning, 1964; Mugnaini, 1964; Iseri et al., 1966; Rubin and Lieber, 1968), during the administration of steroids and oral contraceptives (Perez et al., 1969; Tuchweber er al., 1972), in systematic scleroderma (Feldmann et al., 1977), in response to heatstroke (Kew et al., 1978), and in carcinomas (Albukerk and Duffy , 1976). Neuromuscular disorders also commonly display the presence of matrical crystalline structures (for recent reviews, see Kamieniecka and Schmalbruch, 1980; Peyronnard et al., 1980). The majority of crystalline inclusions occur as filaments, which are present either singly, in bundles, or as parallel arrays (Munn, 1974), and often take on a well-ordered lattice appearance (e.g., Heidbuechel, 1982) dependent to some extent upon the plane of sectioning (Ghadially, 1982) (Fig. 15a-c). Other crystals assume diverse shapes, i.e., rectangular (Shy et al., 1966), rhomboidal (Davis, 1976), helical (Nathaniel, 1976), polygonal, and complex honeycombs practically filling the entire matrical compartment (Suganuma and Yamamoto, 1980). Controversy over the composition of crystalline inclusions persists. In many instances they occur in organelles that have abnormal or reduced numbers of cristae. This led to the proposal that they are at least in part composed of FIG. 15. Mitochondria1 crystalloids in (a) longitudinal and (b) cross-sectional planes indicating a lamellar or platelike arrangement following treatment of amoebae with 22 pglml dioxin for I hour. x70,OOO. (c) Filaments in amoeba mitochondria induced by hydroxylamine treatments. x40,OOO. (d) The presence of both crystalline and granular inclusions in a mitochondrion of an amoeba treated for 24 hours with 10 mM misonidazole. X40,OOO. (e) Filamentous inclusions induced by prolonged culturing of amoeba at low oxygen tensions. X60,OOO.

MITOCHONDRIAL RELATIONSHIPS in Vivo

107

108

ROBERT A. SMITH AND MURIEL .I.ORD

phospholipids, i.e., in thyroid cells after treatment with potassium iodide (Fujita and Machino, 1964), in liver cells after lead poisoning (Watrach, 1964), in rat kidney tubules (Suzuki and Mostofi, 1967), in human tumors (Albukerk and Duffy, 1976; Watanabe et al., 1976; Marinozzi et a/., 1977), in neuromuscular conditions (Dodson et al., 1976; Ketelsen et al., 1978), in ischemic skeletal muscle (Heffner and Barron, 1978), in sperm cell differentiation (Ritter and Andre, 1975), and in organotypic cultures of nervous tissue (Rublyeva and Buravlyev, 1979). Following chronic alcohol administration, Svoboda and Manning (1964) demonstrated parallel arrays of filamentous inclusions approximately 12 nm in width, which they likened to the form assumed by extracted phospholipid upon fixation (Stoeckenius, 1959). Other studies using pepsin and protease digests have indicated that crystalloids are probably composed in part of protein moieties (Hanzlikova and Schiaffino, 1977; Suganuma and Yamamoto, 1980) possibly resulting from specific deficiencies, e.g., a lack of cytochrome b in a mitochondrial myopathy (MorganHughes et al., 1977), changes in several mitochondrial enzyme levels (Watanabe et al., 1976), or an absence of carnitine in a patient with a fatal syndrome preventing long-chain fatty acid transport in muscle and liver tissues (Boudin et al., 1976). In reports in which crystalline composition was not determined occurrence has been correlated with changes in cell metabolic activity, usually of a degenerate nature (Iseri et al., 1966; Ollerich, 1968; Davis, 1976; Heidbuechel, 1982). In Tetrahymena a correlation between filamentous inclusions and culture age was proposed (Elliot and Bak, 1964), and a similar conclusion was reached for the presence of crystalloids in rat placenta (Ollerich, 1968). Several studies have demonstrated bundles of fine filaments in the “inactive” mitochondria of hibernating snakes (Ebe et al., 1965; Kurosumi et al., 1966; Yamamoto et a/., 1969) or of the Japanese newt after prolonged starvation (Taira, 1979). Crystalloid inclusions are found in ischemic muscle (Hanzlikova and Schiaffino, 1977), and in anaerobically cultured cells, where tubular filaments are seen (Lund et al., 1958; Oliveira, 1977; Smith et al., 1979) (Fig. 15e). They are occasionally generated by treatment with uncoupling agents, e.g., the intracristally located inclusions of rat muscle fiber mitochondria following infusion of DNP or CCCP (Melmed et al., 1975); or in amoeba after exposure to pentachlorophenol (Smith, 1978a). Tubular inclusions were produced in the hepatic mitochondria of swine fed with the hypolipidemic agent ethylchlorophenoxy isobutyrate for 6 weeks and were functionally related to a partial uncoupling of phosphorylation (Morrison et al., 1976). Filamentous, needle-like structures have been reported after exposure of cells to heavy metals, e.g., lead (Watrach, 1964), mercury (Bubel, 1976), and cadmium (Ord and Al Atia, 1979). In some instances, spicular filamentous inclusions appear prior to the presence of granular inclusions such as in mitochondria of myocardial infarcts (Buja et al., 1976) and in mitochondria following misonidazole treatments (Smith, 1980) (Fig. 15d). Such a sequential appearance is indicative of a possible temporal relation-

MITOCHONDRIAL RELATIONSHIPS in Vivo

I09

ship between the two forms of inclusions. It would appear that the increases in both granular and crystalline inclusions when normal cell activity is impaired may prove a useful parameter in diagnostic morphological screening even though the full importance of their precise composition must await further study.

VI. The Potential of Modern Staining Methods in Monitoring Mitochondria1 Function Great advances have been made in recent years in the use of ultrastructural staining methods for the localization within mitochondria of specific enzymes (Seligman et a l . , 1968, 1971), of ionic species (Burger and de Bruijn, 1979), and of glycoproteins (Parmley et a f . , 1976; Sannes el af., 1979). There has also been the development of cationic fluorescent laser dyes for selective mitochondria1 studies of living cells (for review, see Chen et a f . , 1982). Cytochemical methods form a convenient bridge between biochemical and cytological approaches for mitochondria, hence extending functional and structural correlations. A. OXIDATIVE AND REDUCTIVE ENZYMES The most widely applied cytochemical methods have involved localizing the oxidoreductase enzyme complexes. Stains such as diaminobenzidine (DAB) for cytochrome oxidase activity and the substituted tetrazolium salts for the determination of dehydrogenases rely upon the formation at the enzyme site of a nondroplet, amorphous reaction product (RP), which is also osmiophilic and insoluble in the dehydration and embedding agents used in specimen preparation. Thus many of the problems of precise localization arising from the use of the low-contrast yielding reagents of light microscopic studies, e.g., the Nadi reagents for cytochrome oxidase or nitroblue tetrazolium for dehydrogenases, have now been overcome. 1 . Cytochrome Oxiduse

DAB has an extensive use in determining general peroxidative activities within cells; in mitochondria it specifically localizes the cytochrome c complex providing that hydrogen peroxide levels are minimized by the inclusion of catalase in the incubation media (Seligman et af., 1973). The initial step in the mitochondria1 oxidation of DAB relies upon cytochrome c acting as the electron acceptor (Seligman et af.,1968). Cytochrome c itself has a weak peroxidative activity (Cammer and Moore, 1973), but this is not sufficient for ultrastructural visualization without reoxidation by an active cytochrome oxidase complex, i.e., cytochromes a and a3 (Reith and Schuler, 1972; Roels, 1974). The cyclical polymerization of reaction product deposition to determine the whole cytochrome triplet is further enhanced by the formation during subsequent fixation of electron-opaque osmium black compounds (Anderson et a f . , 1975). A

110

ROBERT A. SMITH AND MURIEL J . ORD

requirement for active cytochrome oxidase in this mitochondrial reaction is verified by the complete inhibition of RP accumulation following potassium cyanide and heat treatments-steps that inactivate the enzyme but do not affect the peroxidative activity of cytochrome c. Where staining is only partially blocked by KCN or where reaction product is present in mitochondria of cell mutants that lack cytochrome oxidase, it is probable that a cytochrome c peroxidase is being visualized (Hirai, 1974; Stelly et al., 1975). As with other cytochemical procedures, the DAB localization of cytochrome oxidase involves a compromise between good morphological preservation and the maintenance of acceptable enzyme activity levels. Unfixed materials yield intensely stained mitochondria, but these usually show poor structural integrity, with matrical swelling a common feature (Seligrnan et al., 1968) (Fig. 16a). Fixation steps prior to DAB incubations can, however, result in an inhibition of enzyme activity, particularly when the prefixation includes glutaraldehyde (Sabatini et al., 1963; Anderson, 1970). Reports on the elimination of DAB reactivity when this aldehyde is present are numerous (Seligman et al., 1973; Roels, 1974; Pearson and Walker, 1975; Marinos, 1978; Smith, 1978b); so that only short formaldehyde exposures proved acceptable in gaining a limited improvement in structural preservation yet maintaining reasonable enzyme activity. Other workers have, however, succeeded in obtaining some positive staining with low glutaraldehyde concentrations (Anderson et al., 1975; AI-Ali and Robinson, 1979a), whereas Opik (1975) observed mitochondrial reaction product in rice seedlings even after a I-hour prefixation with 3% glutaraldehyde. Further attempts to retain structural parameters without loss of enzymatic function have included the introduction of stabilizers such as glucose and polyvinylpyrrolidone (PVP) into the incubations: providing sucrose concentrations did not exceed lo%, some osmotic protection was achieved; polyvinylpyrrolidone (PVP), however, was not recommended for this role in a study of rabbit, mouse, and rat heart, kidney, and gastric mucosa (Litwin, 1975). Mitochondria1 DAB reaction product deposition has been observed in a wide variety of tissues and cell types and develops on the outer surface of the inner membrane and on the cristal surface facing into the intracristal space. Uniform staining within the cristae is not, however, always observed in the mitochondria, e.g., in rat cardiac and skeletal tissue (Anderson et al., 1975); rat cerebral cortex (Al-Ali and Robinson, 1979a); mouse glandular tissue (Hanker et al., 1975); mouse blastocysts (Nilsson et al., 1982); or amoebae (Smith, 1978b), where a range of 1- 15 stained cristal mitochondrial profiles was demonstrated (Fig. 16b). Cytochemical localization of cytochrome oxidase has been reported in many mammalian tissues (Seligman et a!. , 1968; Novikoff and Goldfischer, 1969; Barnard et al., 1971; Hanker et al., 1975; Spector, 1975; AI-Ali and Robinson, 1979a); in amphibia (Hersey et al., 1975; Marinos, 1978); in invertebrates (Anderson, 1970; Pearson and Walker, 1975); in protozoa (Balber and Ward, 1972; Childs, 1973; Smith, 1978b); in plants (Nir and Seligman, 1971;

MITOCHONDRIAL RELATIONSHIPS in Vivo

111

Morisset. 1974; Opik, 1975; Pellegrini and De Vecchi, 1976; Oliveira, 1977); Neurospora (Sturani et al., 1977); and in cell cultures (Posakony et al., 1975; Douglas et al., 1976). Changes in cytochrome oxidase activity associated with developmental and differentiation processes may be monitored by DAB staining. Although the numbers of studies capatilizing upon the technique have been relatively few, they have raised certain interesting findings. Pearson and Walker (1975) studied the development of the acrosomal membrane complex in the crab Carcinus maenas during spermatogenesis and related it to alterations in cytochrome oxidase activity. In early stages, the well-formed mitochondria gave good DAB staining. As the spermatids matured, however, the mitochondria coalesced and incorporated only cristal fragments to form the membrane complex; at the same time the cytochrome oxidase diminished and was finally completely lost. This suggests that the enzymes for oxidative phosphorylation are not retained in the mature acrosomal complex, but rather that there is a switch to other respiratory pathways to meet the energy requirements of sperm motility. In a similar study of the prosobranch gastropods Pomacea and Viviparous, Anderson ( 1970) demonstrated the continued presence of cytochrome oxidase in the helical mitochondria1 complex that develops during sperm maturation, possibly indicating some differences between molluscan and decapod male gametogenesis. The gastropod spermatozoan mitochondrial complex does display some pecularities, however; e.g ., succinate dehydrogenase (SDH) activity, which is normally restricted to a nearly identical locus to cytochrome oxidase, was also observed in the matrical compartment (Anderson and Personne, 1970), although this may prove to be artifactual (Bogitsh, 1975). Marinos (1978) showed that in Xenopus previtellogenic oocytes, larger egg cells (> 300 pm) had a reduced cytochrome oxidase activity compared to early or midphase cells (100-200 Fm), with microdensiometric measurements showing a 50% reduction in reaction product. This result has since been confirmed polarographically; this report proposed that cytochrome oxidase synthesis is repressed during the phase of intense mitochondrial DNA replication that occurs while the oocyte is enlarging and mitochondrial numbers are increasing. Full differentiation of the mitochondria may then proceed at a later developmental stage (Marinos and Billett, 1981). Activity changes during differentiation have previously been monitored in Trypanosoma brucei (Balber and Ward, 1972). With cultures from midgut trypanosome infections, positive staining could not be demonstrated until 3 weeks after isolation from the host. Biochemical studies have shown that at this stage of differentiation there is a switch from a CN-insensitive to a CN-sensitive respiratory pathway, a change indicating the formation of a functional oxidative chain. Other studies have utilized DAB-RP localization to ascertain cytochrome oxidase activity changes with altered functional competence. For example, if mouse blastocysts were experimentally delayed from implanting in the uterus,

112

ROBERT A. SMITH AND MURIEL J. ORD

MITOCHONDRIAL RELATIONSHIPS in Vivo

113

they attained a low metabolic activity with 0.24 nl of oxygen consumed per hour per blastocyst and with trophoblast mitochondria negative for DAB staining (Nilsson et al., 1982). Injections of estrogen induced implantation, at which time there was a 2-fold increase in oxygen consumption with a corresponding switch to positive DAB reactivity for cytochrome oxidase. A requirement for oxygen in the retention and activity of cytochrome oxidase has been well documented in plants and unicellular organisms subjected to anaerobic culturing. In wheat hybrids, mitochondrial DAB reactivity is lost within 2 hours of culturing without oxygen (Oliveira, 1977), although a reduction of cytochrome oxidase activity occurs in other plant tissues only after more prolonged periods of anaerobiosis, i.e., 3-4 days for tomato rootlets and rice seedlings maintained in nitrogen environments (Moriset, 1974; Opik, 1975). Reduced DAB staining was also evident in amoebae subjected to 18 hours of anaerobic culturing prior to the cytochemical incubations (Smith, 1978b), a finding that correlated with the environmental-stressed morphological changes (Smith et ul., 1979). Treatments with chloramphenicol, which inhibits mitochondrial protein synthesis, also showed a disappearance in reaction product and further illustrated the necessity of an intact cytochrome oxidase complex for positive DAB staining (Sturani et al., 1977). We are aware of only one other report of the application of DAB methods to studies of the effects of toxic agents known to cause mitochondrial damage; this concerns the carcinogen N-methylnitrosourethane, which has an inhibitory effect on the respiratory chain (Smith, 1978b). Clearly DAB and other cytochemical markers for mitochondrial enzymes have not been exploited by toxicologists as they ought to have been when the mitochondrion has already been implicated as a target organelle by other experimental approaches. Similarly, pathologists have not capitalized on the potentials of ultrastructural cytochemistry, the reports being very sparse. Al-Ali and Robinson (1982) used DAB techniques in studies of control and traumatized cerebral cortex in rats to investigate the response of enzyme levels in reactive astrocytes to brain injury (Fig. 16c). They showed that during the first 7 days the wound margin was composed primarily of necrotic cells infiltrated with phagocytes that demonstrated little DAB staining. In the surrounding neuropil, however, there were numerical increases in the mitochondria of the hypertrophied astrocytes, and these had corresponding increases in oxidative enzyme FIG. 16. (a) Poor cell preservation, but good staining, is seen when DAB incubations are carried out on unfixed amoebae. X 12,500.(b) Mitochondria1 integrity is retained by short prefixation with 4% formaldehyde; note heterogeneity of cristae staining reaction. x26,500. (a) and (b) from Smith, (1978b). (c) Cytochrome oxidase activity with DAB reaction product in the intracristal and peripheral spaces of an astrocyte from adult rat cortex 14 days after a cerebral stab wound. F, Glial filaments. Fixation by vascular perfusion with 4% formaldehyde-0.5% gluteraldehyde. DAB reaction for 1 hour at 35°C with added cytochrome c. No counterstaining. X 10.000. (d) Similar mitochondrial staining for cytochrome oxidase in a nerve cell of control adult rat cerebral cortex. Experimental details as for (c). ~12,000.(c) and (d) courtesy of Dr. S. Y . A. AI-AIi, Glasgow.

114

ROBERT A. SMITH AND MURIEL J. ORD

activity. Normally astrocytes represent the cell type in the cortex with the lowest oxidative activity, although weak positive staining is seen in control cells (AI-Ali and Robinson, 1979a). The result suggests that astrocytes are involved in longterm wound healing and require a high metabolic activity. 2. Dehydrogenases A similar course of development of techniques occurred for the ultrastructural localization of dehydrogenases as occurred for cytochrome oxidase studies. Two different methods have mainly been employed, particularly for succinate dehydrogenase (SDH). In the first, ferricyanide is used as the artificial electron acceptor, similar to its role in biochemical assays (Kerpel-Fronius and Hajos, 1968). The second method relies upon the reduction of substituted tetrazolium salts to formazan compounds, which are subsequently made electron opaque by osmium (Seligman et al., 1971). Dehydrogenases are very susceptible to inhibition, so that only brief prefixations are possible; or, alternatively, with live tissue, dimethyl sulfoxide is added to the media to aid stain penetration (Makita and Sandborn, 1971). Cytochemical localization of specific dehydrogenases will depend upon the exogenous substrate included in the incubations, i.e., sodium succinate for SDH, lithium lactate for lactate dehydrogenase (LDH), and NADH, for NADH, diaphorase. Further, the SDH and LDH reactions are specifically inhibited by the presence of malonate and iodine, respectively. The tetrazolium method has been successfully used for many tissues, e.g., rat skeletal and cardiac muscle (Seligman et al., 1971; Kalina et al., 1972); gastropod sperm (Anderson and Personne, 1970); guinea pig cochlear cells (Spector, 1975); rat cerebral cortex (AI-Ali and Robinson, 1979b). Some of the earlier substituted tetrazolium salts were themselves osmiophilic, a condition that could lead to artifactual staining if the unreacted dye was not thoroughly washed from the tissue. The styryl derivative 2-(2'-benzothiazolyl)-5-stryl-3-(4'-phthalhydrazidyl) tetrazol chloride (BSPT), however, is not osmiophilic but does yield an osmiophilic formazan upon reduction (Kalina et al., 1972). In general, these compounds give good membrane localization of the dehydrogenases, although some diffusion into the matrical compartment is seen if incubations are extended (AI-Ali and Robinson, 1979b). In a study of SDH localization in isolated mouse liver mitochondria, Kalina et al. (1971) demonstrated a completely different staining in orthodox organelles, where fine deposits contrasfed with those in condensed mitochondria in which the reaction product on the swollen cristal membranes was of a coarse nature. These authors suggest that this reflects underlying changes in the geometrical arrangements of the enzyme complexes upon energization. Others have found the ferricyanide reaction gives more consistent staining, hence reducing the risk of nonenzymatic reaction products (Makita and Sandborn, 1971; Bogitsh, 1975; Giuli er al., 1976; Bell, 1979). This method is based upon a simultaneous coupling of the ferricyanide with copper, a reaction that

MITOCHONDRIAL RELATIONSHIPS in Vivo

115

produces a fine granular precipitate at the enzymatic site (Kerpel-Fronius and Hajos, 1968). In plant tissue, where substrate diffusion is relatively slow, this method alone has proved successful in demonstrating SDH activity (Bell, 1979). Bogitsh (1975) compared the localization of SDH activity in the sperm mitochondrial complex of the gastropod Biomphaladia glabrata, using both the ferricyanide technique and BSPT; only ferricyanide gave positive staining for SDH activity in the mitochondria of spermatids. In the mature spermatozoa mitochondrial complex, the ferricyanide method again demonstrated SDH in the intracristal space, whereas BSPT in addition gave a diffuse matrical RP. This may explain the discrepancy for SDH visualization found in other snail mitochondria with BSPT staining (Anderson and Personne, 1970). From the preceding discussion, it can be concluded that the reproducibility of available methods for localization of dehydrogenases is not as satisfactory as the use of DAB for cytochrome oxidase. It will, therefore, need further investigation, particularly in finding an enzyme marker of sufficient electron contrast and good tissue penetrability, before routinely applying the present techniques to the study of changes in enzyme activity in pathological conditions.

3 . Monoamine Oxidase The formation of osmiophilic formazans (Shannon et al., 1974) and the ferricyanide reaction intensified by DAB osmication (Hanker et al., 1973) have also been used to show a mitochondria1 tryptamine-oxidizing activity sensitive to the monoamine oxidase inhibitors pargyline and nialamide. A comparison of the two methods, however, proved that neither is totally satisfactory; not only was reaction product deposited on the outer membrane (where monoamine oxidase acts as a membrane marker), but also on the cristal membranes, particularly if ferricyanide was employed (Yo0 and Oreland, 1976). Such a widespread distribution is contrary to existing biochemical data for this enzyme and, therefore, led the authors to conclude that the present available cytochemical techniques have limitations for monoamine oxidase visualization. More recently, monoamine oxidase activity .restricted to the outer compartment has been demonstrated in the mitochondria of rat nervous and nonnervous tissues (Muller and De Lage, 1977) by using the monotetrazolium salt BSPT. B . PHOSPHATASES Mitochondria1 ATPase activities can be localized ultrastructurally by a modification of the Wachstein-Meisel reaction. Using intact and partially disrupted mitochondria isolated from rabbit liver, a Mg2 -ATPase reaction product was deposited in the matrix and between membrane fragments of submitochondrial particles (Grossman and Heitkamp, 1968). This finding is consistent with the view that the enzyme is located in headpieces of elemental particles in the cristae. The preceding method relies upon the deposition of lead salts at the +

116

ROBERT A. SMITH AND MURIEL J . ORD

enzymatic site; however, in later studies lead was replaced by neodymium nitrate, because it is known that lead can inhibit ATPase, hence leading to artifactual staining (Sotonyi et al., 1974). Other workers maintain lead nitrate can be used providing the pH is kept at 8.5 throughout the incubations-in a study of activity in lymphocytes, however, the mitochondrial staining was somewhat diffuse (Cuschieri et al., 1982). In addition to the strong reaction of an Mg2 -ATPase in the inner membrane and cristal membranes of mitochondria in the branchial heart of the cephalopod Sepia officinalis, a weaker, but identically located, reaction can also be elicited for an HC0,--ATPase (Donaubauer, 1980). A long-term chemical lesion in the mitochondria of rat spinal cord specimens has been demonstrated following X irradiation with acid-p-glycerophosphatase RP deposited along the cristae of the nerve cell’s mitochondria from 2 hours up to 22 weeks post irradiation. This enzyme was also present in human cortical biopsies of the frontal lobes of patients affected by a Huntington’s chorea (Roizin et al., 1975). Although the exact mechanisms leading to the development of the acid-p-phosphatase activity in mitochondria were not determined, the localization itself could prove of great functional interest, and such cytochemical screens should be considered in other pathological stratagems, particularly for neurological tissue. +

C. CALCIUM LOCALIZATION AND Ca2 -BINDINGGLYCOPROTEINS +

The localization of mitochondrial ionic species has been well established by cytochemical methods, particularly in the case of calcium. Lead acetate and potassium pyroantimanate osmium precipitate methods are both commonly used to visualize the Ca2+ ion (e.g., Heumann, 1976; Burger and de Bruijn, 1976; Cardasis et al., 1978; Happel and Simson, 1982). Both approaches demonstrate granules in the intracristal space and others in the matrix, often associated with the cristal membranes. In a study of mitochondria in human leukocytes, rat hepatocytes, and oyster gill epithelium, Parmley et al. (1976) demonstrated complex glycoproteins located in similar positions. Acidic glycoproteins were visualized by a technique involving dialyzed iron; and sulfated glycoproteins were demonstrated with a high-iron diamine. From this study and a later one on parietal cell mitochondria, it is considered that the sialoglycoproteins serve in Ca2+ binding and storage (Sannes et a l . , 1979). Such cells have high levels of cytochrome oxidase activity, levels that are presumed necessary for transport of the electrolytes within the cell. D. FLUORESCENT STAINSFOR MITOCHONDRIA OF LIVING CELLS For many years vital stains such as Janus green were applied to living cells in attempts to study mitochondrial form and function in vivo. As early as 1915,

MITOCHONDRIAL RELATIONSHIPS in Vivo

117

however, it was realized that even at the weakest concentrations needed to achieve staining this dye was cytotoxic to cells in culture, with death occurring after only a few hours (Lewis and Lewis, 1915). Furthermore, Janus green causes mitochondrial distortions, so that even the limited relevance to in situ mitochondrial studies is questionable. Useful stains such as DAB for mitochondria in living cells are also not without disadvantages. Therefore, the recent advances in fluorescent microscopy and the development of specific fluorescent dyes prove of great interest. Such dyes demonstrate potential differences in cells and organelles, with the charged lipophilic molecules being partitioned across the membrane in a manner dependent upon the electrical potential. When cyanine compounds were used, the staining intensity of isolated hamster liver mitochondria was altered if a potassium diffusion potential was induced by the ionophore valinomycin or if the organelles were energized by the presence of succinate (Laris et al., 1975). Whether the difference was large enough to play a significant role in the observed phosphorylation of ADP was, however, questioned in studies of isolated giant mitochondria from mice maintained on a cuprizon-containing diet (Walsh-Kinnally et al., 1978). Johnson et al. (1980) demonstrated that the cationic compound, rhodamine 123 specifically stained mitochondrial membranes in situ in gerbil fibroma cells due to the relatively high negative potential; nuclear envelopes and Golgi membranes exhibited no such staining. They also showed that the distribution within the mitochondria was altered by Rous sarcoma transformation and that changes in shape and organization occurred following colchicine treatment. Transformation of mink cells by feline sarcoma virus also caused altered rhodamine 123 staining in mitochondria, and it was suggested that this resulted from an abnormally low mitochondrial membrane potential accompanied by a relatively high pH gradient (Johnson er al., 1982). Unusual retention of the dye occurred in the mitochondria of adrenocarcinoma, transitional cell carcinomas, and chemical carcinogen-transformed epithelial cell lines (Summerhayes et al., 1982), a finding that may be useful for diagnosis and in the screening of chemotherapeutic agents such as arabinofuranosyl cytosine (Chen et al., 1982). Treatments with uncoupling agents DNP and FCCP to dissipate the electrochemical gradient resulted in a rapid loss of the specific association between the cationic probe and the organelle. Similarly, inhibitors of electron transport such as KCN, azide, antimycin A, and rotenone all released the fluorescent dye from prestained mitochondria, whereas cells using ATP at a faster rate probably had a higher membrane potential, a condition that would result in more intense staining (Johnson et al., 1981). Clearly, rhodamine 123 and other new fluorescent acridine orange derivatives (Erbrich et al., 1982) have great potential in mitochondrial structural-functional investigations, a fact that has been realized in at least one current study: Goldstein and Korczack (1982) worked on biological aging in cells having a limited in

118

ROBERT A. SMITH AND MURIEL J. ORD

vitro life span, e.g., human fibroblasts. They studied mitochondrial morphology of early and late passage fibroblasts and also considered both log-phase and confluent cultures. At confluence, the organelles were shorter and more randomly aligned than in mid-log-phase cells. Rhodamine staining was less intense, a result presumably reflecting a state of reduced oxidative activity. The staining ability was affected by the chloramphenicol analog Tevenel, following a 6-day exposure; this was presumed to be due to a gradual depletion of mitochondrial proteins, causing mitochondrial membrane leakage. Potassium cyanide caused a sudden release of fluorescence, as had previously been reported in the studies of Johnson and his co-workers. Such experimental techniques are in their infancy, but they are obviously going to yield significant data in the coming years if applied to studies of energy metabolism, to mitochondrial plasticity during proliferation and differentiation (James and Bohman, 198l), and to mitochondrial alterations observed in pathological cells (Chen et af., 1982). The choice of human fibroblasts in such studies may also be of significance in medical research, for these cells can be successfully derived from practically all patients-a situation enabling mitochondrial studies of any individual syndrome, as pointed out by Goldstein and Korczack. Such techniques, together with cytochemical staining methods, could represent areas of investigation that will become standard practice in future screening for cellular lesions.

VII. Mitochondriagenesis Three different mechanisms have been proposed by which a cell might produce its mitochondrial complement: ( I ) the division of existing mitochondria, principally by the formation of partitions or septa; (2) the generation from other cellular organelles; (3) a de novo synthesis from the cytoplasmic matrix. Data from a number of experimental approaches, particularly labeling studies (e.g., Parsons and Rustad, 1969), are consistent with the view that genesis proceeds by division processes in which the mitochondrial genome is replicated and transmitted to the daughter organelles. Such a division is not necessarily synchronous with the nuclear division cycle, although in some organisms it may indeed be restricted to specific cell cycle phases (Kolb-Bachofen and Vogell, 1975). Despite being slightly outside the scope of the present review, a brief summary of recent findings on the mitochondrial genome is included because many important advances have been made during the last few years. Early studies revealed that the mitochondrial genome differed from that of the nucleus in certain physical characters; few but the most ardent “mitochondriacs” (Borst and Grivell, 1981) could have realized, however, how unusual mitochondrial DNA actually was, with even the cherished universal code proving to be less than sacrosanct (Borst and Grivell, 1978; Barrel1 et al., 1979; Anderson et al., 1981). In higher

MITOCHONDRIAL RELATIONSHIPS in Vivo

119

organisms, mitochondrial DNA exists as circular configurations (Nass, 1966). Its replication is of a semiconservative nature (Reith and Luck, 1966), originating at precisely located displacement or D loops (Arnberg, 1972; Robberson et a/., 1972; Crews et al., 1979). In metazoan animals, mitochondrial DNA molecules consist of 15,000- 17,000 base pairs (Rasti and Dawid, 1979); in yeast, the genome is larger, with 78,000 base pairs (Borst and Grivell, 1978). A limited number of mitochondrial proteins are coded for by mitochondrial DNA upon the smaller ribosomal subunits that exist in the organelle (Soslav and Nass, 1971). It has been suggested that the actual demand for a mitochondrial transcriptional and translational system distinct from the cytoplasmic equivalents possibly evolved to overcome the problem of inserting relatively hydrophobic protein species into the inner membrane once it became isolated from the cytoplasmic machinery by the presence of an outer mitochondrial membrane (Borst, 1977). The complete sequence of the human mitochondrial genome of 16,569 base pairs has been mapped for DNA derived from a single placental preparation: genes for 12 S and 16 S rRNAs, 22 tRNAs, 5 known proteins, and 8 predicted, but as yet unknown, proteins were located, hence confirming that the information content is limited. (Anderson et al., 1981). The human map sequenced showed extreme economy, with only a few (if any) noncoding bases between the genes, which, therefore, lack leader and trailer regions, e.g., the two rRNA genes are directly surrounded by two tRNAs (Eperon et al., 1980). (A similar situation is seen in Xenopus, where only the D-loop region, i.e., 9% of the genome length, is without codons to which RNA may be hybridized (Rasti and Dawid, 1979). The heavy strand of the mitochondrial DNA is probably transcribed as a single polycistronic RNA molecule that is later processed into mature species by precise endonucleolytic cleavage (Ojala et a/., 1981). [This is also the case for the mouse (Battey and Clayton, 1978) and Xenopus (Rasti and Dawid, 1979.)] It appears that the termination signal is frequently created posttranscriptionally by polyadenylation of the RNA molecules, although in some instances AGA and AGG possibly act as termination codons (not as arginine codons as in the.classic genetic code) (Anderson eta/., 1981). Similarly, UGA, a termination codon in the universal code, is read as tryptophan in the human sequence for subunit I1 of cytochrome oxidase, and AUA is possibly read as methionine and not isoleucine in the human mitochondria (Barrel1 e f al., 1979). Only 22 tRNAs are required for the system to operate, not the 32 tRNA minimum needed for the universal code; this is probably achieved by some of the tRNAs reading four codons. The yeast mitochondrial genome also survives on less than the minimum number of tRNAs required by the wobble hypothesis of the genetic code. As in the human mitochondrion, there is no authentic 5 S RNA, and again termination codons are read differently (Borst and Grivell, 1978). Unlike human mitochondria, however, yeast mitochondrial mRNAs have nontranslatable leader

120

ROBERT A. SMITH AND MURIEL J . ORD

and trailer sequences, although some, e.g., apocytochrome b (Church et al., 1979; Lazowska et al., 1980) and the 21s rRNA gene, contain intervening sequences or “introns” (Bos et al., 1980). Mutant characterization, by gene mapping and sequencing studies, indicates that the introns are later spliced out of the mRNA copies by proteins, maturases, which are probably encoded in part by the DNA itself (Lazowska et a/., 1980). This provides an unusual negative feedback mechanism for regulatory control. In the case of the fourth intron of the cytochrome b gene, cob-box (b14), mutants have been isolated that lack not only cytochrome b but also an active subunit 1 of cytochrome oxidase, a finding suggesting that certain introns may have pleiotropic effects (Dujardin et a/., 1982). In fungal mitochondrial DNAs, introns are presumed to confer a selective advantage because they have been retained throughout evolution at nonrandomly distributed sites. One possible explanation is that the additional splicing steps enable a more precisely controlled expression of the genome in a system where selection pressures are thought to be less than in the highly economic human system in which posttranscriptional control mechanisms are important. Comparisons of nucleotide sequences of human mitochondrial DNA and present day prokaryotic DNA (Eperon et a/., 1980) would suggest that if mitochondria originated by the retention of an ancestral endosymbiont within the protoeukaryote, then such an ancestor predates any of the contemporary bacteria. This is contrary to the conclusions of studies based on comparisons of respiratory chains (John and Whatley, 1975). Electron microscopy studies demonstrate that mitochondrial DNA and mitoribosomes are present as electron-dense granules within the matrix (Nass, 1969). Studies of treatments with ethidium bromide, which intercalates mitochondrial DNA, suggest that the DNA in the dense bodies is complexed with a protein core (e.g., Risueno eta!., 1975). The mitochondria of the slime mold Physarum contain approximately 10 times more DNA than those of many other organisms, making Physarum mitochondria a useful model system. They are characterized by a large “chromosoma1”-like body composed of RNA and protein in addition to DNA (Kuroiwa, 1974). The appearance of this nucleoid throughout a presumed mitochondrial division by medial attenuation has recently been reviewed (Kuriowa, 1982). The fate of DNA throughout division has not proved as easy to demonstrate in other organisms, however, as it has been in Physarum. The presence of so-called division forms is often controversial. The “dumbbell” mitochondrial profile, often seen and claimed to be a division form, could result as easily from the plane of sectioning of a bent cylinder as from the attenuation of an organelle into two daughter mitochondria-a fact appreciated by several authors (e.g., Kolb-Bachofen and Vogell, 1975). A more convincing form was occasionally seen in fasted and refed rats: in the mitochondria of these animals, a transverse partition sepa-

MITOCHONDRIAL RELATIONSHIPS in Vivo

121

rated the internal compartment into two chambers (Fawcett, 1955). Tandler et al. (1969), while reviewing the literature from Fawcett’s observation up to 1968, pointed out that the association of partitioned forms with division can only be considered if it has also been shown that actual mitochondrial numerical increases occur during the process. In their studies, riboflavin-deficient rats developed hepatic megamitochondria; when given riboflavin intraperitoneally, many partitioned mitochondria were observed as the megamitochondria disappeared and were replaced by normal-sized organelles. In many studies cited up to 1969, septate or partitioned mitochondria were usually associated with mitochondrial increases following experimentally induced pathological changes within cells. Higher incidence has continued to reflect physiological disruption in the majority of studies since that time, e.g., the prompt division of the enlarged liver mitochondria of dehydrated rats upon rehydration (Bartok et al., 1973); the return to normal-sized organelles during the recovery of hepatocytes after ethanol poisoning (Koch et al., 1978); septate mitochondria associated with hypoxia in mouse diaphragm organ cultures (Heine and Schaeg, 1979), in cuprizon-fed mouse liver (Wakabayashi et al., 1974), in locust neurosecretory cell mitochondria after insecticide treatments (Norman and Samaranayaka-Ramasamy, 1977), and in liver cells treated with diamide (Publicover et al., 1979). In the cases of the insecticide lindane and the thioloxidizing agent diamide, it is possible that intracellular calcium levels are involved in the regulation of mitochondrial septation, as similar forms are induced in muscle mitochondria in situ by treatment with the calcium ionophore A23 187 (Publicover et al., 1977); whether such regulatory controls underlie other partitioning events remains to be seen. Partitioned forms have been reported in nonexperimental situations, although not as frequently. Numerous mitochondrial septa were seen in cardiac muscle cells, the partition consisting of two parallel membranes in direct continuity with the inner mitochondrial membrane. Some organelles showed varying degrees of constriction at the level of the plates (Tandler and Hoppel, 1972). The septate form was also very occasionally seen in Tetrahymena during late S phase when mitochondrial numbers increased dramatically; this finding was indicative of a near-synchronous organelle division in the protozoan (Kolb-Bachofen and Vogell, 1975). Characteristic partitioned forms related to rapid increases in mitochondrial numbers have been reported in fat body cells of the adult fly Calpodes ethlius (Larsen, 1970). Most of the larval mitochondria are destroyed shortly before pupation so that the fat cells of early emerging insects contain few mitochondria. By a process of growth and division of the surviving larval mitochondria, numbers increase from under 1000 to over 5000 per cell, between 23 and 27 hours after emergence, with partitioned organelles being numerous. This genesis of

122

ROBERT A . SMITH A N D MURIEL J. ORD

new mitochondrial populations has been linked to the functional changes in the larval and adult fat body, i.e., Calpodes larval cells are involved in secretion, protein uptake, and the accumulation of lipid reserves, whereas the adult cells are concerned with mobilization and utilization of fatty acids. Similar increases of dividing mitochondria are reported in the perinatal period of rat liver cells (Rohr e t a l . , 1971), and aging factors have also proved important in insect flight muscle in the generation of septate mitochondria (Sohal, 1975). The further elucidation of the mitochondrial genome, together with an appraisal of the mechanisms involved in mitogenesis, will continue to be of interest over the coming years. It may be predicted that the appearance of dividing forms in both EM-prepared material and in living cells will yield vital information concerning the semiautonomous nature of mitochondria within cells and hence the basis for a clearer understanding of mitochondrial function.

VIII. Concluding Remarks The indispensable role of mitochondrial energetics in a cell’s continuing existence has inevitably led to a plethora of research activity over the years. In many ways, however, a dichotomy of approach has resulted, with morphological studies giving much qualitative data on mitochondrial structure but minimal functional data, whereas biochemical strategems on the other hand have paid all too little attention to the conformational changes often accompanying metabolic switches. We propose that if these two diverse positions are assessed side by side a clearer understanding of mitochondria in controlled cellular environments ensues and may then reveal important implications for current applied toxicological and pathological studies. The ability to relate mitochondrial morphology to respiratory states and general functional integrity would indeed facilitate interpretation of the mode of action of certain chemical agents and would also benefit diagnostic screening of diseased tissue by the pathologist. What relevant features of a mitochondrial form and function relationship can be drawn, therefore, from the vast array of work on the chondriome? It is clear that mitochondria do vary with regard to numbers, shape, size, and complexity, both within different cells and within the same type but under altered environmental and/or physiological states. Modern refinements to three-dimensional reconstructioning techniques have shown that mitochondria can be highly branched networks spanning through the cytoplasm and often in intimate relationships with other organelles such as the nucleus (Gaffal and Schneider, 1980; Bakeeva et al., 1982). Although relatively small cells are shown to contain but a single, or at most just a handful of, organelles (Hoffman and Avers, 1973), many are still seen to possess larger numbers of simpler forms scattered throughout the cytoplasm, a finding confirm-

MITOCHONDRIAL RELATIONSHIPS in Vivo

123

ing earlier numerical estimates based on stereological and related principles (Loud, 1968; Brandt et al., 1974). It is possible that mitochondrial numbers exist in a dynamic state of flux between larger branched units and the smaller forms generated by fission to meet the specific needs of the cell or organism in response to changes in activity. Large, branched organelles may be strictly confined to certain stages of the cell’s life cycle and maturation, as seen with Euglena (Calvayrac et al., 1972) or with the specialized mitochondrial cloud in Xenopus oocytes (Billett and Adam, 1976); or they may form, disperse, and realign with great rapidity, as suggested by Lewis and Lewis (1915) in an early light microscopy study of cultured embryonic cells. Under different physiological conditions, it may be advantageous for the mitochondria to be widely dispersed throughout the cytoplasm, thus maximizing ATP availability and distribution to aid synthetic and other energy-consuming activities. At other times, mitochondria may form complex aggregations in order to concentrate the cell’s energy resources to a specific locality or activity. Modern selective mitochondria1 stains for living cells, e.g., rhodamine 123 may solve some of these unanswered questions in the near future and may also shed light on whether cytoskeletal filaments play a role in regulating a constantly changing mitochondrial distribution (Chen et al., 1982). The relationship between mitochondria1 numbers, size, and complexity seen in morphological studies may, therefore, ratify the metabolic capability of the cell and its ability to adapt to changes in activity states, whether induced by normal physiological variation (and possibly eventually leading to senescence) or by abnormal influences as in disease and contact with toxic agents. It is conceivable that in instances such as a reported case of cardiac insufficiency, an arrested ability for reciprocal switches from larger, branched organelles to smaller, simpler units may contribute to the overall disruption in cell function (Kraus and Cain, 1980). Large numbers of mitochondria are reported for some transformed cells, and these may occur to compensate defects in respiratory and other metabolic pathways. In other’ tumors, especially those with high glycolytic capabilities, a paucity of mitochondria presumably reflects a change to other means of energy production (Pederson, 1978). Similarly, with chemically induced lesions, if the delicate balance between size, number, and distribution is upset, detrimental consequences may result. Other characteristic parameters are deemed useful in assessing a relationship between mitochondrial form and function in addition to numerical and size consideration. The density of cristae and general arrangement of the internal mitochondrial membranes has been correlated to the cell’s energy requirements. Mitochondria in which cristae are tightly packed frequently have a high metabolic capacity (James and Meek, 1979); whereas cristal loss, often accompanied by organelle swelling and the generation of intramitochondrial inclusions, has been indicative of reduced energy potential. Stress conditions such as a lack of

124

ROBERT A . SMITH AND MURIEL J. ORD

oxygen (Oliveira, 1977) can lead to acute cristal degeneration and a loss of functional components (Morisset, 1974). Inner membrane transformations with concurrent changes in matrix density have been central to both in v i m (Hackenbrock, 1966) and in vivo (Weakley, 1976) observations concerned with linking activity to structure. The presence of condensed mitochondria may be equated with low levels of energization whereas expanded orthodox forms indicate high energization. An appraisal of morphological competence with respect to cristal and matrix density could, therefore, well define metabolic aptitudes. Consideration of mitochondria1 matrical inclusions has benefited greatly from the recent advances in techniques such as electron probe microanalysis. Once the composition of these has been determined, the researcher can begin to extrapolate to functional implications rather than just commenting on occurrence. This has been particularly useful for studies on calcium sequestering by matrical granules in cells with high calcium turnover (Martin and Mathews, 1969) or in mechanically damaged cells (Burger and de Bruijn, 1979). In other treated or diseased cells, inclusions have a more nonspecific underlying basis, possibly related to membrane degradation, but can still represent an informative pointer to functional change. As such, they warrant consideration in any checklist of mitochon-

FIG. 17. Types of mitochondria that can occur under different stress situations. All forms shown have been observed in our amoeba studies. General changes (e.g., in the ratio of Types I , 11, and intermediates) occur with many treatments (e.g., carcinogens, metals, uncouplers of oxidative phosphorylation); but besides these, the chemical may produce a more specific change, the extent and appearance of which will relate to both time and dose level. See also Figs. 6, 9. 1 1 , 12, 14, and 15.

MITOCHONDRIAL RELATIONSHIPS in Vivo

125

drial structural parameters linked to functional alterations (Walton and Buckley , 1975). When disease or chemical exposure drastically alter mitochondrial conformation from the expected state, it is germane to ask whether the effect has been specific to the mitochondrion itself or whether other events occurring simultaneously within the cell are augmenting, ameliorating, or even canceling any broader chondriome effect. The mitochondrion is frequently a primary target, although at times effects on other organelles may be of greater importance-the drug or toxin having but a secondary subsidary effect on mitochondria. Similarly, the agent’s mode of action can differ depending on how a dose is administered and whether the cell is able to enlist defensive mechanisms to counteract the effect. In amoebae, for example, short chronic doses of cadmium caused mitochondrial swelling and disruption leading to cell death whereas low doses produced no mitochondrial damage because the metal was immobilized by the synthesis of a metal-binding protein (Ord and Al-Atia, 1979; Al-Atia, 1980). In order to precisely define any relationship between the dynamic alterations shown by monitoring function with the more static morphological data obtained by electron microscopy, methods are needed to bridge the gap between the two data types. Current cytochemical techniques and the development of selective fluorescent stains represent to us the most exciting areas of mitochondrial research to have arisen during the last few years (Chen ef al., 1982). It is envisaged that this methodology will fill many of the gaps in mitochondrial knowledge. The development of microinjection techniques similar to our own with Amoeba (Ord and Smith, 1982) might also yield means capable of linking structure to function. The more that can be learned by these methods about the vital parameters in control cells, i.e., ( I ) mitochondrial numbers, size, shape; (2) cristal and inner membrane conformational state; (3) matrix density; and (4) presence of inclusion bodies (see also Fig. 17), the more confident will be the structurally minded toxicologist and pathologist in relating microscopic appearance of the chondriome to functional activity.

ACKNOWLEDGMENTS The helpful comments and encouragement of Professor R. J . Scothorne, Dr. F. S . Billett, and Dr. S . Y . A . AI-Ali are much appreciated. We thank Drs. K . P. Gaffal, F. Billett, S . AI-Ah, J . Walling, and Mr. H. Johnston for kindly supplying original micrographs. Our thanks to Mrs. B . Falconer foy typing the manuscript and to Miss M. Hughes and Miss C. A . Morris for photographic and art work. The technical assistance of Mrs. I. W. Vink and Mr. T. Courtney is acknowledged. REE-EKENCES Adoutte, A . , Balmefrezol, J., Beison, J . , and Andre, J . (1972). J . Cell B i d . 54, 8-19 Ahlqvist, G., Landin, S . , and Wroblewski, R . (1975). Lab. Insesr. 32, 673-680.

126

ROBERT A. SMITH AND MURIEL J. ORD

AI-Ali, S. Y. A., and Robinson, N. (1979a). J. Hisrochem. Cytochem. 27, 1261-1266. AI-Ah, S. Y. A., and Robinson, N. (1979b). Hisfochemisrry 61, 307-318. AI-Ali, S. Y. A., and Robinson, N. (1982). Hisrochem. J . 14, 31 1-321. Al-Atia, G. R. (1980). J. Protozool. 27, 128-132. Albukerk, J:, and Duffy, J. L. (1976). Arch. Pafhol. Lab. Med. 100, 168-171. Alexander, C. S. (1968). J. Lab. Clin. Med. 72, 850. Anderson, S.,Bankier, A. T., Barrell, B. G . , de Bruijn, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Rose, B. A,, Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., and Young, I. G. (1981). Nafure (London) 290,457-465. Anderson, W. A. (1970). J . Hisrochem. Cyrochern. 18, 201-210. Anderson, W. A., and Personne, P. (1970). J . Hisrochem. Cytochem. 18, 783-793. Anderson, W. A., Bara, G., and Seligman, A. M. (1975). J. Hisrochem. Cytochem. 23, 13-20. Andresen, N. (1956). C.R. Lab. Curls. 29, 436-555. Andrews, P. M., and Hackenbrock, C. R. (1975). Exp. Cell Res. 90, 127-136. Arnberg, A. C. (1972). Biochim. Biophys. Acfa 272, 487-493. Asano, M., and Wakabayashi, T. (1974). J. Electron. Microsc.'23, 189-191. Asano, M., Wakabayashi, T., Ishikawa, K., and Kishimoto, H. (1977). J. Electron Microsc. 26, 14 1- 144. Ashraf, M., and Bloor, C. M. (1976). Virchows Arch. Ser. B. Cell Pafhol. 22, 287-297. Atkinson, A. N., John, P. C. L., and Gunning, B. E. S. (1974). Protoplusma 81, 77- 109. Auclair, M. C., Adolphe, M., Moreno, G., and Salet, C. (1976). Toxicol. Appl. Pharmacol. 37, 387-399. Bakeeva, L. E., Skulachev, V. P., and Chentzov, Y. S. (1982). Ontogenez 13, 313-317. Balber, A. E., and Ward, R. A. (1972). J. Purasitol. 58, 1004-1005. Bang, B. G., and Bang, F. B. (1957). J. Ulfrusfrucf.Res. 1, 138-146. Barnard, T.,and Ruusa, J. (1979). Exp. Cell Res. 124, 339-347. Barnard, T., Afzelius, B. A , , and Lindberg, 0. (1971). J. Ulfrasfrucr. Res. 34, 544-566. Barrell, B. G . , Bankier, A. T., and Drouin, J. (1979). Nafure (London) 282, 189-194. Bart6k. I., Viragh, S., and Menyhart, J. (1973). J . Ultrastrucf. Res. 44, 49-57. Battey, J., and Clayton, D. A. (1978). Cell 14, 143-156. Behrens, W. A., and Himms-Hagen, J. (1977). J. Bioenerg. Biomembr. 9, 41-63. Bell, P. R. (1979). Historhemistry 62, 85-91. Bereiter-Hahn, J. (1978). J . Cell Sci. 30,99- 115. Berger, E. R. (1973). J. Ultrasfrucf.Res. 45, 303-327. Billett, F. S., and Adam, E. (1976). J . Embryo/. Exp. Morphol. 36, 697-710. Bjorkman, N., and Thorsell, W. (1962). Exp. Cell Res. 27, 342-346. Bogitsh, B. 3. (1975). J. Hisrochem. Cytochem. 23, 75-79. Borst, P. (1977). Trends Biochem. Sci. 2, 31-34. Borst, P., and Grivell, L. A. (1971). FEBS Lett. 13, 73-78. Borst, P.,and Grivell, L. A. (1978). Cell 15, 705-723. Borst, P., and Grivell, L. A. (1981). Nature (London) 290, 443-444. Bos, 1. L., Osinga, K. A., van der Horst, G., Hecht, N. B., Tabak, H. F., van Ommen, G-J. B., and Borst, P. (1980). Cell 20, 207-214. Boudin, G., Mikol, J . , Guillard, A., and Engel, A. G. (1976). J . Neurol. Sci. 30, 313-325. Brandt, J . T., Martin, A. P., Lucas, P., and Vorbeck, M. (1974). Biochem. Biophys. Res. Commun. 59, 1097-1 103. Brdiczka, D., and Barnard, T. (1980). Exp. Cell Res. 126, 127-135. Brown, D., Grosso, A., and De Sousa, R. C. (1981). J . Cell Sci. 52, 197-213. Brown, R. C., Evans, D. A., and Vickerman, K. (1977). Inf. J . Parusitol. 3,691-704. Bubel, A. (1976). Cell Tissue Res. 167, 65-95.

MITOCHONDRIAL RELATIONSHIPS in Vivo

127

Buffa, P., Guarriera-Bobyleva, V., Muscatello, U . , Pasquali-Ronchetti, I . (1970). Nature (London) 226, 272-274. Buffa, P., Pasquali-Ronchetti, I . , Barasa, A., and Godina, G. (1977). Cell Tissue Res. 183, 1-23. Buja, L. M., Dees, J. H., Harling, D. F., and Willerson, J. T. (1976). J . Hisrochem. Cyrochem. 24, 508-5 16. Burger, E. H., and de Bruijn, W. C. (1979). Hisrochemistry 62, 325-336. Burton, M. D., and Moore, J. (1974). J . Ulrrusrruct. Res. 48, 414-419. Buser, K. S., Kopp, B., Gehr, P., Weibel, E. R . , and Hoppeler, H. (1982). Cell Tissue Res. 225, 427-436. Butt, M. M. (1982). Ph.D. thesis, University of Glasgow, U.K. Calarco, P. G., and McLaren, A. (1976). J . Embryol. Exp. Morphol. 36, 609-622. Calvayrac, R., Butow, R. A., and Le Fort-Tran, M. (1972). Exp. Cell Res. 71, 422-432. Calvayrac, R., Butow, R. A . , and Le Fort-Tran, M. (1974). Proroplasma 80, 355-370. Cammer, W., and Moore, C. (1973). Biochemistry 12, 2502-2509. Capaldi. R. A . , and Tan, P. F. (1974). Fed. Proc. Fed. Am. Soc. Exp. Eiol. 33, 1515. Cardasis, C., Schuel, H., and Herman, L. (1978). J . Cell Sci. 31, 101-115. Carlsoo, B., Domeij, S . , and Helander, H. F. (1979). Arch. Paihol. Lab. Med. 103, 471-474. Chen, L. B., Summerhayes, I. C., Johnson, L. V., Walsh, M. L., Bernal, S. D., and Lampidis, T. J. (1982). Cold Spring Harbor Symp. Quant. Biol. 46, 141-155. Childs, G. C. (1973). J . Hisrochem. Cyrochem. 21, 26-33. Church, G. M., Slonimski, P. P., and Gilbert, W. (1979). Cell 18, 1209-1215. Cieciura, L., Rydzynski, K., and Klitonczyk, W. (1979). Cell Tissue Res. 196, 347-360. Colbeau, A., Nachbaur, J., and Vignais, P. M. (1971). Biochim. Biophys. Arm 249, 462-492. Coleman, J. R., Nilsson, J. R., Warner, R. R., and Batt, P. (1973). Exp. Cell Res. 76, 31-40. Coulomb, P., and Coulomb, C. (1972). C.R. Acad. Sci. (Paris) Ser. D 274, 214-217. Crews, S., Ojala, D., Posakony, J., Nishiguchi, J . , and Attardi, G. (1979). Nature (London) 277, 192-198. Cuschieri, A., Mughal, S . , and Kharbat, B. A. (1982). Hisrochem. J . 14, 593-607. Daems, W. T., and Wisse, E. (1966). J . Ultrastruct. Res. 16, 123-140. Daniels, E. W., and Breyer, E. (1965). J . Prorozool. 12, 417-425. Daniels, E. W., and Breyer, E. (1967). J . Prorozool. 14, 167-179. Daniels, E. W., and Breyer, E. (1968). 2. Zellforsch. 91, 159-169. Dantchev, D., Slioussartchouk, V., Paintrand, M., Hayat, M., Bourut, C., and Matht, G. (1979). Cancer Treat. Rep. 63, 875-888. Davis, L. E. (1976). Cell Tissue.Res. 171, 499-511. Decker, G. L., and Greenawalt, J. W. (1977). J . Ulrrastruct. Res. 59, 44-56. de Man, I. C. H. (1960). J . Nail. Cancer Inst. 24, 795-819. De Martino, C., Floridi, A., Marcante, M. L., Malorni, W., Scorza-Barcellona, P., Bellocci, M., and Silverstrini, B. (1979). Cell Tissue Res. 196, 1-22. Dewey, W. C., and Fuhr, M. A. (1976). Exp. Cell Res. 99, 23-30. Diala, E. S . , Evans, 1. H., and Wilkie, D. (1980a). J . Gen. Microbiol. 119, 35-40. Diala, E. S . , Mittwoch, U . , and Wilkie, D. (1980b). Er. J . Cancer 42, 112-120. Didio, L. J. A . , Amburn, 0. R., and Mock, 0. B. (1975). J . Submicrosc. Cytol. 7, 153-163. Dmitrieva, N. P. (1968). Tsitologiya 10, 933-939. Dodson, R. F., Patten, B. M., Hyman, B. M., and Chu, L. W. (1976). Cytobios 15, 57-60. Donaubauer, H. H. (1980). Hisrochemistry 69, 27-37. Douglas, W. H., Whittle, W. L., and Dell’Orco, R. T. (1976). J . Hisrochem. Cytochem. 24, 630-633. Dujardin, G., Jacq, C., and Slonimski, P. P. (1982). Nature (London) 298, 628-632. Durrer, H., and Bowald, S . (1982). Cell Tissue Res. 224, 421-439.

128

ROBERT A. SMITH AND MURIEL J. ORD

Ebe, T . , Kobayashi, S., and Yamamoto, T. (1965). J. Electron Mirrosc. 14, 203-209. Elliot, A . M., and Bak, 1. J. (1964). J . Cell Bi d. 20, 113-191. Engel, A. G., and Angelini, L. (1973). Science 179, 899-902. Eperon, I. C., Anderson, S., and Nierlich, D. P. (1980). Nature (London) 286, 460-467. Erbrich, U., Naujok, A,, Petschel, K., and Zimmermann, H. W. (1982). Hisrochemistry 74, 1-7. Fawcett, D. W. (1955). J. Natl. Cancer Insr. 15 (Suppl.), 1475-1502. Feldman, M. L., and Navaratnam, V. (1981). J. Anat. 133, 7-17. Feldmann, G., Maurice, M., Husson, J. M., Fiessinger, J. N., Camillen, J . P., Benhamou, J. P., and Housset, E. (1977). Virchows Arch. Abi. A Pathol. Anat. Histol. 374, 215-227. Fell, B. F., King, T. P., and Davies, N. T. (1982). Histochem. J. 14, 665-680. Flickinger, C. J. (1968a). Protoplasma 66, 139-151. Flickinger, C. J. (1968b). J . Cell B i d . 37, 300-315. Flickinger, C. J. (1973). Exp. Cell Res. 81, 293-300. Forde, B. G . , Gunning, B. E. S . , and John, P. C . L. (1976). J . Cell Sci. 21, 329-340. Fowler, B. A,, Kimniel, C. A,, Woods, J. S., McConnell, E. E., and Grant, L. D. (1980). Toxicol. Appl. Pharmacol. 56, 59-77. Fujita, H., and Machino, M. (1964). J . Cell Biol. 23, 383-385. Gaffal, K. P., and Kreutzer, D. (1977). Proroplasma 91, 167-177. Gaffal, K. P., and Schneider, G. J. (1980). J. Cell Sci. 46, 299-312. Gaffal, K. P., Gaffal, S. I., and Schneider, G. J. (1982). Protoplasma 110, 185-195. Galeotti, T., van Rossum,’G. D. V . , Russo, M. A,, and Palombini, G. (1976). Cancer Res. 36, 4175-41 84. George, M., Chenery, R. J . , and Krishna, G . (1982). Toxicol. Appl. Pharmacol. 66, 349-360. Ghadially, F. N. (1982). “Ultrastructural Pathology of the Cell and Matrix,” 2nd ed. Butterworths, London. Ghadially, F. N., Lalonde, J. M. A,, and Mukherjee, T. M. (1979). J. Submicrosc. Cytol. 11, 503-510. Giuli, C., Pien, C., and Zs-Nagy, 1. (1976). J. Submicrosc. Cyrol. 8, 205-214. Goldfarb, S., Barber, T. A., Pariza, M. W., and Pugh, T. D. (1978). Exp. Cell Res. 117, 39-46. Goldstein, S., and Korczack, L. B. (1981). J . Cell Eiol. 91, 392-398. Coyer. R. A. (1968). Lab. Invest. 19, 71-77. Grasso, J. A,, and Hines, J. D. (1969). Er. J. Haematul. 17, 35-44. Grasso, R. J., Moore, N. A., Boler, R. K., and Johnson, C. E. (1977). Proc. Soc. Exp. Eiol. Med. 155, 219-224. Greene, W. B., Balentine, J. D., and Hennigar, G. R. (1979). Am. J. Pathol. 96, 737-752. Grimes, G. W., Mahler, H. R., and Perlman, H. (1974). Science 185, 630-631. Crodums, E. 1. (1977). Cell Tissue Res. 185, 231-237. Grossman, 1. W., and Heitkamp, D. H. (1968). J. Histochem. Cytochem. 16. 64-653. Hackenbrock, C. R. (1966). J. Cell Eiol. 30, 269-297. Hackenbrock, C. R. (1968). J. Cell Biol. 37, 345-369. Hackenbrock, C. R. (1972). Ann. N . Y . Acad. Sci. 195, 492-505. Hackenbrock, C. R., and Caplan, A. 1. (1969). J . Cell Eiol. 42, 221-234. Hackenbrock, C. R., Rehn, T. G., Weinbach, E. C . , and Lemasters, J. J . (1971). J . CellEiol. 51, 123- 137. Hagopian, M. (1967). J. Morphol. 122, 147-168. Hanker, J . S., Kusyk, C. J . , Bloom, F. E., and Pearse, A. G . E. (1973). Histochemie 33,205-230. Hanker, J. S., Preece, J. W.. and Macrae, E. K. (1975). Hisrochemisfry 44, 225-244. Hanzlikova, V . , and Schiaffino, S. (1977). J. Ubrasrruct. Res. 60, 121-133. Happel, R. D., and Simson, J . A. V. (1982). J. Histochem. Cytochem. 30, 305-311. Harlow, D. R., and Byram, I. E. (1971). J . Parasitol. 57, 559-565.

MITOCHONDRIAL RELATIONSHIPS in Vivo

129

Harmon, H. J . , Hall, J . D., and Crane, F. C. (1974). Eiochirn. Biophys. Acta 344, 119-155. Hawkins, W. E., Howse, H. D., and Foster, C. A. (1980). Cell Tissue Res. 209, 87-94. Heffner, R. R., and Barron, S. A . (1978). J. Neurol. Sci. 38, 295-315. Heidbuechel, U. (1982). Cell Tissue Res. 221, 693-696. Hcine, H., and Schaeg, G. (1979). Aria Anat. 103, 1-10. Helander, H. F. (1976). Gastroenterology 71, 1010-1018. Held, A. A., Emmerson, R.,Fuller, M. S . , and Gleason, F. H. (1969). Scietice 165, 706-709. HelCn, P., Zeitlin, R., and Hervonen, A. (1980). Cell Tissue Res. 207, 491-498. Hersey, S. J., Simon, T. W., and Baste, C. (1975). J. Hisfochern. Cytochem. 23, 271-282. Heuniann, H. G. (1976). Cell Tissue Res. 169, 221-231. Heywood. P. (1977). J. Cell Sci. 26, 1-8. Hirai, K. I. (1974). J. Historhem. Cytochem. 22, 189-202. Hirai, K. I.. Nagata, K., Maeda, M., and Ichikawa, Y. (1979). Exp. Cell Res. 124, 269-283. Hhchli, M., and Hackenbrock, C. R. (1976). Proc. Nail. Acad. Sci. U . S . A . 73, 1636-1640. Hoffmann, E. 0 . . Cook, J. A., Di Luzio, N. R . , and Coover, J. A. (1975). Lab. Invest. 32, 655-664. Hoffman, H. P., and Avers, C. J. (1973). Science 181, 749-750. Horridge, G . A. (1964). Q . J . Microsc. Sci. 105, 301-310. Howell, N., Zuiches, C. A,, and Munkres, K . D. (1971). J. Cell Biol. 50, 721-736. Howell, S. L., and Tyhurst, M. (1976). J . Cell Sci. 21,415-422. Innis, M. A,, Beers, T. R . , and Craig, S. P. (1976). E.xp. Cell Res. 98, 47-56. Iseri, 0. A,, Lieber, C. S., and Gottlieb, L. S . (1966). Am. J. Pathol. 48, 535-555. James, N. T., and Meek, 0. A. (1979). Cell Tissue Res. 202, 493-503. James, T. W., and Bohman, R. (1981). J. Cell Eiol. 89, 256-260. Jasper, D. K., and Bronk, J . R. (1968). J. Cell Biol. 38, 277-291. Jeon, K. W. (1975). J. Protozool. 22, 402-405. Jeon, K. W., and Ahn, T. I. (1979). J. Cell. Physiol. 98, 49-58. Johannessen, J. V. (1978). “Electron Microscopy in Human Medicine, Vol. 2: Cellular Pathobiology, Metabolic and Storage Diseases.” McCraw-Hill, New York. John, P., and Whatley, F. R. (1975). Nature (London) 254, 495-498. Johnson, L. V., Walsh, M. L., and Chen, L. B. ( 1980). Proc. Natl. Acad. Sci. U.S.A. 77,990-994. Johnson, L. V., Walsh, M. L., Bockus, B. J . , and Chen, L. B. (1981). J. CellEiol. 88, 526-535. Johnson, L. V., Summerhayes, I . C., and Chen, L. B. (1982). Cell 28, 7-14. Johnston, I. A., and Bernard, L. M. (1982). Cell Tissue Res. 227, 179-199. Jurand, A,, and Lipps, H. J. (1973). Arch. Prorisrenkd. 115, 133-136. Kahri, A . I., Salmenpera, M., and Saure, A . (1976). J. Cell Eiol. 71, 951-956. Kai, 0.. Fujioka, T., and Yasuda, M. (1977). Cell Tissue Res. 185, 69-76. Kalina, M., Weavers, B., and Pearse, A. G. E. (1971). J. Hisrochem. Cytochern. 19, 124-130. Kalina, M., Plapinger, R. E., Hoshino, Y., and Seligman, A . M. (1972). J. Histochem. C.ytochem. 20, 685-695. Kamieniecka, Z., and Schmalbruch, H. (1980). In/. Rev. Cytol. 65, 321-357. Kanwar, Y. S . , Manaligod, J . R.,and Wong, P. W. K . ( 1976). Pediatr. Res. 10, 598-609. Karpati, G., Carpenter, S., Larbrisseau, A., and Lafontaine, R. (1973). J. Neurol. Sci. 19, 133-151. Kerpel-Fronius, S., and Hajos, F. (1968). Histochemir 14, 343-351, Ketelsen, U. P., Beckman, R . , and Nolte, J. (1978). J. Neurol. Sci. 35, 275-290. Kew, M. C., Minick, 0. T . , Bahu, R. M., Stein, R . J . , and Kent, G . (1978). Am. J. Pafhol. 90, 609-6 18. Keyhani, E. (1973). Exp. Cell Res. 81, 73-78. Knowles, I . (1972). Exp. Cell Res. 70, 223-226.

130

ROBERT A. SMITH AND MURIEL J. ORD

Koch, 0. R., Roatta de Conti, L. L., Bolanos, L. P., and Stoppani, A . 0. M. (1978).Ant. J. Pathol. 90, 325-344. Kolb-Bachofen, V., and Vogell, W. (1975). Exp. Cell Res. 94, 95-105. Koukl, J. F., Vorbeck, M. L., and Martin, A. P. (1977). J. Ultrastruct. Res. 61, 158-165. Kraus, B., and Cain, H. (1980). Virchows Arch. Abt. B Cell Pathol. 33, 77-89. Kuroiwa, T. (1974). J. Cell B i d . '63, 299-306. Kuroiwa, T. (1982). Inr. Rev. Cyrol. 75, 1-59. Kurosumi, K., Matsuzawa, T., and Watari, N. (1966). J. Ultrastruct. Res. 16, 269-277. Laguens, R., and Bianchi, N. (1963). Exp. Mol. Pathol. 2, 203-214. Laiho, K. U., and Trump, B. F. (1975). Lab. Invest. 32, 163-182. Laiho, K. U., Shelboume, J . D., and Trump, B. F. (1971). Am. J . Pathol. 65, 203-230. Lang, R. D. A,, and Bronk, J. R. (1978). J. Cell Biol. 77, 134-147. Laris, P. C., Bahr, D. P., and Chaffee, R. R. J. (1975). Biochim. Biophys. Acta 376, 415-425. Larsen, W. J. (1970). J. CellBiol. 47, 373-383. Lazowska, J., Jacq, C., and Slonimski, P. P. (1980). Cell 22, j33-348. Lewis, M. R., and Lewis, W. H. (1915). Am. J. Anat. 17, 339-401. Lin, 1. H., and Duffy, J. L. (1970). Lab. Invest. 23, 158-162. Litwin, J. A. (1975). Histochemistry 44, 349-355. Loud, A. V. (1968). J. Cell Biol. 37, 27-46. Luft, R., Ikkos, D., Palmieri, G., Ernster, L., and Afzelius, B. (1962). J. Clin. Invest. 41, 1776-1804. Lund, H. A., Vatter, A . E., and Hanson, J. B. (1958). J . Biophys. Biochem. Cytol. 4, 87-97. Lunger, P. D., and Clark, H. F. (1979). J. Submicrosc. Cytol. 11, 1-12. Luzikov, V. N. (1973). Subcell. Biochem. 2, 1-31. McGill, M., Hsu, T. C., and Brinkley, B. R. (1973). J. Cell B i d . 59, 260-265. McGill, M., Baur, P. S., and Hsu, T. C. (1976). Exp. Cell Res. 99, 7- 14. McGregor, D. H., Lotuaco, L. G., Rao, M. S., and Chu, L. C. H. (1978). Am. J. Parhol. 92, 69 1-7 12. Maekubo, H., Ozaki, S., Mitmaker, B., and Kalant, N. (1982). In Vitro 18, 483-491. Makita, T., and Sandbom, E. B. (1971). Histochemie 26, 305-310. Manchester, K. L., Bullock, G . , and R0etzscher.V. M. (1973). Chem. B i d . Interact. 6, 273-296. Marinos, E. (1978). J. Historhem. Cytochem. 26, 658-662. Marinos, E., and Billett, F. S. (1981). J . Embryo/. Exp. Morphol. 62, 395-409. Marinozzi, V., Derenzini, M., Nardi, F., and Gallo, P. (1977). Cancer Res. 37, 1556-1563. Martin, J. H., and Matthews, I. L. (1969). Calc. Tissue Res. 3, 184-193. Matthews, J. L. (1970). Am. J . Anat. 129, 451-458. Mazzocchi, G:, Robba, C., Belloni, A., Rigotti, P., Gambino, G., and Nussdorfer, G. G. (1976a). Cef1 Tissue Res. 168, 1-9. Mazzocchi, G., Robba, C., Neri, G . , Gottardo, G . , and Nussdorfer, G. G. (l976b). Cell Tissue Res. 172, 149-156. Melmed, C., Karpati, G., and Carpenter, S. (1975). J. Neurol. Sci. 26, 305-318. Merker, H. J., Herbst, R., and Kloss, K. (1968). 2. Zellforsch. 86, 139-152. Michea-Hamzehpour, M., Grange, F., Ton That, T. C., and Turian, G. (1980). Arch. Microbiol. 125, 53-58. Mollenhauer, H. H . , Rowe, L.D., Cysewski, S. J., and Witzel, D. A. (1981). Am. J. Vet. Res. 42, 35-40. Montisano, D. F., and James, T. W. (1979). J. Ultrastruct. Res. 67, 288-296. Morgan-Hughes, J . A . , Darveniza, P., Kahn, S. N., Landon, D. N., Sherratt, R. M., Land, J. M., and Clark, J. B. (1977). Brain 100, 617-640. Morisset, C. (1974). C . R . Acad. Sri. (Paris) Ser. D 279, 1257-1260.

MITOCHONDRIAL RELATIONSHIPS in Vivo

131

Morris, R., and Pickering, A. D. (1976). Cell Tissue Res. 173, 271-277. Morrison, E. S . , Lee, S . K., Scott, R. F., Kroms, M., and Frick, J. (1976). To.ricol. Appl. Phurmacol. 36, 99-1 10. Mugnaini, E. (1964). J. Ultrustruct. Res. 11, 525-544. Miiller, J., and De Lage, C. (1977). J. Histochem. Cytochem. 25, 337-348. Munn, E. A. (1974). “The Structure of Mitochondria.” Academic Press, New York. Murdock, L. L., Cahill, M. A., and Reith, A. (1977). J. Cell Biol. 74, 326-332. Murray, A. B., Strecker, W., and Silz, S. (1981). J. Cell Sci. 50, 433-448. Muscatello, U., Guarriera-Bobyleva, V., and Buffa, P. (1972). J. Ultrastruct. Res. 40, 235-260. Muscatello, U., Pasquali-Ronchetti, I., and Guarriera-Bobyleva, V. (1978). J. Submicrosc. Cytol. 10, 39-5 I . Nass, M. M. K. (1966). Proc. Natl. Acad. Sci. U . S . A . 56, 1215-1222. Nass, M. M. K. (1969). Science 165, 25-35. Nathaniel, D. R. (1976). J. Ultrasrrucr. Res. 57, 194-203. Nelson, L. (1982). Exp. Cell Res. 141, 483-488. Nelson, L., Lorentzon, R., Boqvist, L., and Loutrup, S. (1982). Exp. Cell Res. 137, 25-29. Neumann, D., and Parthier, B. (1973). Exp. Cell Res. 81, 255-268. Nilsson, B. O., Magnusson, C., Widehn, S., and Hillensjo, T. (1982). J. Embryol. Exp. Morphol. 71, 75-82. Nir, I., and Seligman, A. M. (1971). J. Hisrochem. C,ytochem. 19, 611-620. Normann, T. C., and Hall, T. A. (1978). Cell Tissue Res. 186, 453-463. Normann, T. C., ‘and Samaranayaka-Ramasamy, M. (1977). Cell Tissue Res. 183, 61-69. Novikoff, A. B., and Goldfischer, S. (1969). J. Histochem. Cytochern. 17, 675-680. Nussdorfer, G. G . , Mazzocchi, G., Rebuffat, P., Belloni, A. S . , Gottardo, G . , and Gambino, A. M. (1975). Cell Tissue Res. 163, 273-290. Oberg, K. E. ( I 967). Exp. Cell Res. 45, 590-602. Ojala, D., Montoya, J., and Attardi, G. (1981). Nature (London) 290, 470-474. Oliveira, L. (1977). Protoplusma 91, 267-280. Ollerich, D. A. (1968). J. Cell Biol. 37, 188-191. Opik, H. (1973). J. Cell Sci. 12, 725-739. Opik, H. (1975). J. Cell Sci. 17, 43-55. Ord, M. J. (1976). J. Theor. Biol. 62, 369-387. Ord, M. J. (1979). Inf. Rev. Cytol. 61, 229-281. Ord, M. J., and Al Atia, G. R. (1979). In “The Chemistry, Biochemistry and Biology of Cadmium” (M. Webb, ed.), p. 141. Elsevier, Amsterdam. Ord, M. J., and Smith, R. A. (1982). Cell Tissue Res. 227, 129-137. Osafune, T. (1973). J. Electron Microsc. 22, 51-61. Palade, G. E. (1952). Anat. Rec. 114, 427-452. Palade, G. E. (1953). J. Histochem. Cytochern. 1, 188-211. Parmley, R. T., Spicer, S. S., Poon, K., and Wright, J. (1976). J. Histochem. Cytochern. 24, 1159-1 168. Parmley, R. T., Barton, J. C., and Conrad, M. E. (1979). Am. J. Pathol. 96, 85-100. Parsons, J. A , , and Rustad, R. C. (1968). J. Cell Biol. 37, 683-693. Partin, J. C., Schubert, W. K., and Partin, J. S. (1971). New Engl. J . Med. 285, 1339-1343. Paulin, J . J . (1975). J . Cell Biol. 66, 404-413. Peachey, L. D. (1964). J . Cell Biol. 20, 95-109. Pearson, P. J., and Walker, M. H. (1975). Cell Tissue Res. 164, 401-410. Pedersen, P. L. (1978). Prog. Exp. Tumor Res. 22, 190-274. Pellegrini, M. (1980). J. Cell Sci. 46, 313-340. Pellegrini, S., and De Vecchi, L. (1976). J. Submicrosc. Cvtol. 8, 353-358.

132

ROBERT A. SMITH AND MURIEL J. ORD

Perasso, R., and Beisson, J. (1978). B i d . Cell. 32, 275-290. Perez, V., Gorosdisch, S., De Martire, J . , Nicholson, R., and Di Paola, G . (1969). Science 165, 805-807. Peyronnard, J. M., Charron. L., Bellavance, A,, and Marchand, L. (1980). Ann. Neurol. 7, 262-268. Pinchuk, V. G., Liushitz, V. L., Shuklinov, V. A . , and Treguhova, N. A. (1979). T.~itologia21, 25-29. Plattner, H., and Schatz, G . (1969). Biochemisfry 8, 339-343. Poinar, G. 0.. and Hess, R. (1982). Science 215, 1241-1242. Porter, C. W., Mikles-Robertson, F., Kramer, D., and Dave, C. (1979). Cancer Res. 39, 2414-2421. Posakony, J. W., England, J. M., and Attardi, G. (1975). J. Cell Sci. 19, 315-329. Posakony, J. W., England, J. M., and Attardi, 0 . (1977). J. Cell Biol. 74, 468-491. Puhlicover, S. J., Duncan, C. J., and Smith, J. L. (1977). Cell Tissue Res. 185, 373-385. Puhlicover, S . J., Duncan, C. J., Smith, J. L., and Greenaway, H. C. (1979). Cell Tissue Res. 203, 291-300. Rancourt, M. W . , McKee, A. P., and Pollack, W. (1975). J. Ultrasfruct.Res. 51, 418-424. Rasti, E., and Dawid, I. B. (1979). Cell 18, 501-510. Reith, A,, and Schuler, B. (1972). J. Histochem. Cyrochem. 20, 583-589. Reith, E., and Luck, D. J. L. (1966). Proc. Nail. Acad. Sci. U.S.A. 55, 1600-1606. Risueno, M. C., de LaTorre, C., and Gimenez-Martin. G. (1975). J. Ulirastruct. Res. 51,204-217. Ritter, C . , and Andre, J. (1975). Exp. Cell Res. 92, 95- 101. Rohherson, D. L., Kasamatsu, H., and Vinograd, J. (1972). Proc. Nail. Acad. Sci. U . S . A . 69, 737-741. Roels, F. (1974). J. Hisrochem. Cytochem. 22, 442-444. Rohr, H. P., Wirz, A.. Henning, L.C., Reide, U. N., and Bianchi, L. (1971). Lab. Invest. 24, 128- 139. Roizin, L., Orlovskaja, J . C., Liu, J. C., and Carsten, A. L. (1975). J. Hisrochem. Cytochem. 23, 402-410. Romert, P., and Matthiessen, M. E. (1981). Acta Anar. 109, 332-338. Rosano, T., Lee, S. K., and Jones, D. H. (1976). J. Cell Biol. 69, 581-588. Rossi, G. R., and Cocucci, M. (1978). Cell Dijfer. 7, 223-233. Rouiller, C. (1960). Int. Rev. Cytol. 9, 227-292. Roy, S. (1978). Acta Neuropathol. (Berlin) 41, 169-171. Ruhin, E., and Lieher, C. S. (1968). New Engl. J . Med. 278, 869-876. Rublyeva, Z. Y., and Buravlyev, V. M. (1979). Tsirologia 21, 1155-1159. Rudolph, R., Woodward, M., and Hum, I. (1979). CancerRes. 39, 3689-3693. Rydzynski, K., and Cieciura, L. (1980). J. Ultrastruct. Res. 70, 118-127. Sahatini, D. D., Bensch, K . , and Barrnett, R. J . (1963). J. Cell B i d . 17, 19-58. Salmenpera, M. (1976). J. Ulirastruct. Res. 56, 277-286. Sandusky, G. E., Henk, W. G., and Roberts, E. D. (1981). Toxicol. Appl. Phurmacol. 61, 89-98. Sannes, P. L., Katsuyama, T., and Spicer, S . S . (1979). J . Histochem. Cytochem. 27, 873-877. Scherer, B., and Klingenherg, M. (1974). Biochemistry 13, 161-170. Schmidt, G. E., Martin, A. P., and Vorheck, M. L. (1977). J. Ultrastrucr. Res. 60, 52-62. Schneck, L., Adachi, M., Briet, P., Wolintz, A., and Volk, B. W. (1973). J. Neurol. Sci. 19, 37-44, Scothorne, R. J. (1959). J. Anat. 93, 588. Seiden, D. (1976). Am. J. Anat. 145, 459-465. Seligman, A. M., Karnovsky, M. J., Wasserkrug, H. L., and Hanker, J. S. (1968). J. Cell Biol. 38, 1-14.

MITOCHONDRIAL RELATIONSHIPS in Vivo

133

Seligman, A. M . , Nir, I . , and Plapinger. R. E. (1971). J . Histochem. Cytochem. 19, 273-285. Seligman, A. M., Shannon, W. A., Hoshino, Y., and Plapinger, R. E. (1973). J . Hisrochem. Cyrochem. 21, 756-758. Shannon, W. A., Wasserkrug, H. L., and Seligman, A. M. (1974). J . Hisrochem. Cytochem. 22, 170- 182. Shimada, T., Morizono, T., Yoshimura, T . , Murakami, M., and Ogura, R. (1978). J . Electron Microsc. 27, 207-213. Shy, 0 . M., Gonatas, N. K., and Perez, M. (1966). Brain 89, 133-158. Sjostrand, F. S . (1953). Nature (London) 171, 30-32. Sjostrand, F. S . (1977). J . Ulfrastruct. Res. 59, 292-319. Sjostrand, F. S . , and Bemhard, W. (1976). J . Ultrastruct. Res. 56, 233-246. Sjostrand, F. S . , and Hanzon, J . (1954). Exp. CellRes. 7, 393-414. Sjostrand, F. S . , and Kretzer, F. (1975). J . Ultrastruct. Res. 53, 1-28. Slautterback, D. B. (1965). J . CellBiol. 24, 1-21. Smith, H . E., and Page, E. (1976). J . Ulrrasfruct. Res. 55, 31-41. Smith, R. A. (1978a). Ph.D. thesis, University of Southampton. Smith, R. A . (1978b). Hisrochemistry 58, 89-95. Smith, R. A. (1979). Protoplasma 101, 23-35. Smith, R. A . (1980). Br. J . Cancer 41, 305-308. Smith, R . A,, and Ord, M. J. (1979). J . Cell Sci. 37, 217-229. Smith, R. A., Bell, L. G. E., and Ord, M. J. (1979). Prcmplasma 99, 275-288. Soares, J. O., and Moura Nunes, J.F. (1979). Arch. Pathol. Lab. Med. 103, 364-365. Sohal, R. S . (1975). J . Morphol. 145, 337-354. Sohal, R. S . , and Bridges, R . G. (1978). J . Cell Sci. 34, 65-79. Soslav, G . , and Nass, M. M. K. (1971). J . CellBiol. 51, 514-524. Sotonyi, P., Somogyi, E . , and Kerenyi, N. A. (1974). Hisfoehemistry 42, 265-269. Spector, G. J. (1975). J . Histochem. Cytochem. 23, 216-234. Steinhardt, R., Zucher, R., and Schatten, G. (1977). Dev. B i d . 58, 185-196. Stelly, N., Balmefrezol, M., and Adoutte, A. (1975). J . Hisrochem. Cytochem. 23, 686-696. Stempak, J., and Laurencin, M . (1976). Am. J . Anat. 145, 261-282. Stevens, B. J . (1977). B i d . Cell. 28, 37-56. Stoeckenius, W. (1959). J . Biophys. Biochem. Cyfol. 5 , 491-500. Sturani, E., Signorini, R. C . , Trezzi, F., and Martegani, E. (1977). J . Submicrosc. Cyrol. 9, 83-95. Suchy, J., and Cooper, C. (1974). Exp. Cell Res. 88, 198-202. Suganuma, Y., and Yamamoto, H. (1980). J . Ulfrastruct. Res. 70, 21-36. Summerhayes, I . C., Lampidis, T. J . , Bemal, S . D., Nadakavukaren, J. J . , Nadakavukaren, K . K., Shepherd, E. L., and Chen, L. B. (1982). Proc. Nail. Acad. Sci. U.S.A. 79, 5292-5296. Suzuki, K. (1969). Science 163, 81-82. Suzuki, T., and Mostofi, F. K. (1967). J . Cell B i d . 33, 605-623. Svoboda, D. J., and Manning, R . T. (1964). Am. J . Parhol. 44,645-662. Taira, K. (1979). J . Ultrasfrucf.Res. 67, 89-94. Takasan, H., Yamada, T., Ozawa, K . , and Honjo, I. (1975). J . Elecrron Microsc. 24, 19-32. Tandler, B., and Hoppel, C. L. (1972). Anat. Rec. 173, 309-324. Tandler, B., and Hoppel, C. L. (1974). Exp. Mu/. Pathol. 21, 88-101. Tandler, B., and Hoppel, C. L. (1980). Anal. Rec. 196, 183-190. Tdndier, B., and Shipley, F. H. (1964). J . Ultrasfruet. Res. 11, 292-305. Tandler, B., Erlandson, R. A , , Smith, A . L., and Wynder, E. L. (1968).Am. J . Parhol. 52, 69-95. Tdndler, B., Erlandson, R. A , , Smith, A . L., and Wynder, E. L. (1969). J . CellBiol. 41,477-493. Tandler, B., Hutter, P. V. P., and Erlandson, R. A. (1970). Lab. Invest. 23, 567-580. Tingle, L. E., Paulat, W. A., and Cameron, I . L. (1973). 1. Profozool. 20, 301-304.

134

ROBERT A. SMITH AND MURIEL J. ORD

Torch, R. (1955). J. Protozool. 2, 167-177. Tu, J. C., and Malhotra, S. K. (1975). Cytobios 13, 217-228. Tuchweber, B., Kovacs, K . , Khan-Dekar, J. D., and Garg, B. D. (1972). J. Ulrrasrruct. Res. 39, 456-464. Ueda, K., qnd Tsuji, H. (1971). Protoplasma 73, 203-215. Valenta, L. J., Michel-Bechet. M.,Warshaw, J . B., and Maloof, F. (1974). J. Clin. Endocrinol. Metab. 39, 719-733. Vartapetian, B. B., Andreeva, I. N., and Kozlova, G. I. (1976). Protoplasma 88, 215-224. Vartapetian, B. B., Andreeva, I. N., Kozlova, G. I., and Agapova, L. P. (1977). Proroplasma 91, 243-256. Wakabayashi, T., Asano, M., and Kurono, C. (1974). J. Electron Microsc. 23, 247-254. Wakabayashi, T., Asano, M . , Ishikawa, K., and Kishimoto, H. (1977). J. Elecrron Microsc. 26, 137- 140. Wallace, P. G., and Linnane, A. W. (1964). Nature (London) 201, 1191-1194. Walling, J. M., and Ord, M. J. (1982). Er. J. Cancer 46, 500. Walsh Kinnally, K., Tedeschi. H., and Maloff, B. L. (1978). Biochemistry 17, 3419-3431. Walter, R. J. (1981). J. Cell Sci. 52, 11-35. Walton, J. R., and Buckley, I. K. (1975). Agents Act. 5, 69-88. Watanabe, H., Burnstock, G., Jarrott, B., and Louis, W. J. (1976). CellTissueRes. 172, 281-288. Watrach, A. M. (1964). J. Ultrasrruct. Res. 10, 177-181. Weakley, B. S . (1976). Cell Tissue Res. 169, 531-550. Weinbach, E. C., Garbus, J., and Sheffield, H. G . (1967). Exp. Cell Res. 46, 129-143. Wigglesworth, V. B. (1982). J. Cell Sci. 53, 337-346. Wille, J. J . , and Steffens, W. L. (1981). Proroplasma 105, 251-271. Williams, G. M . , Bermudez, E., San, R. H. C., Goldblatt, P. J., and Laspia, M. F. (1978). I n Vitro 14, 824-837. Wills, E. J . (1965). J. Cell Eiol. 24, 51 1-514. Witalinski, W. (1982). Cell Tissue Res. 226, 465-468. Wright, R. J . B. (1971). Ph.D. thesis, University of Southampton. Yamamoto, T., Ebe, T., and Kobayashi, S. (1969). Z. Zellforsch. Mikrosk. Anat. 99, 252-262. Yoo, B. N., and Oreland, L. (1976). Histochemisrry 46, 131-137. Zafar, M. N., O’Brian, M., and Catovsky, D. (1982). J. Ultrasrruct. Res. 81, 133-138.

INTERNATIONAL REVIEW OF CYTOLOGY. VOI.

X1

Heterogeneity and Territorial Organization of the Nuclear Matrix and Related Structures M. BOUTEILLE, D. BOUVIER, A N D A . P. SEVE Lahoratoire de Pathologie Cellulaire, lnstitut BiomPdical des Cordeliers. Paris. France I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....................... 11. Definitions . . . . . . . . . . . 111. Toward an Anatomy of Nonchromatin Structures . . . . . . . . . . . . . . . . A. The Nuclear Membranes and Pore Complexes . . . . . . . . . . . . . . B. The LamellaiLamina Concept. . . . . . . . . . . . . . . . . . . . . . . . . . . . C. The Nuclear Shell or Nuclear Cortex., . . . . . . . . . . . . . . . . . . . . D. The Extensive Interchromatin Matrix E. The Nucleolar Skeleton.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Role of Nonchromatin Structures in Nuclear Organization. . . . . . . . . A. DNA Superstructures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Higher Order Chromatin Structures . . . . . . . . . . . . . . . . . . . . . . . C. Chromosome Arrangement at Interphase ............ V. Involvement of Nonchromatin Structures in Gene Expression . . . . . . A. Relationship with Transcription . . . . B. Involvement in Posttranscriptional Ev VI. Three-Dimensional Organization of Nonchromatin Structures . . . . . . A. Three-Dimensional Data on HeLa Cell Histone-Depleted Nuclei . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Operational Media Necessary to Maintain Organization of Nonchromatin Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VII. Prospects on Nonchromatin Structure Characterization Based on Fractionation Experiments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . Fractionation of Achromatinic and Histone-Depleted Nuclei . . . B. Nonchromatin Structure Extraction from Isolated Nuclear ....................................... Nonchromatin Structures . . . . . . . . . . . . . . . . . VIII.

......................................... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

13.5 I36 I37 I37 142 14.5 146 1.50 1.51

I52 153 15.5

1.57 1.57 IS8 I 60 160 16.5 I66 I68

I68 174 I76 177

I. Introduction The first electron microscope studies provided evidence that the interphase nucleus is divided into structurally and functionally different territories: the

Copyrighi t I Y X 3 hy Acadciiiic Prc% Inc. All rights 01 rcproduclion in any Coomi rcwvcd ISBN O - I ? - 3 W X 3 - 6

I36

M. BOU'TEILLE ET AL

nucleoli, the dense and diffuse chromatin, and the nucleoplasm, all of them surrounded by the nuclear envelope (Hay and Revel, 1963; Swift, 1963; Bernhard and Granboulan, 1963). In contrast with the cytoplasm, the nucleus does not need membranes to partition its different territories. This situation explains the difficulty of isolating a nuclear component without its being contaminated by other components and the slow progress being made toward understanding the structure and function of the nucleus, as compared to those of the cytoplasmic organelles. The absence of intranuclear membrane-mediated compartmentalization also justifies all the present approaches to the molecular mechanisms of nuclear organization. This problem is especially acute as regards gene arrangement. Except for the preribosomal RNA genes exclusively located within the nucleoli, little is known about the intranuclear distribution of a given gene in relation to other genes. Random distribution of active genes within the nucleoplasm would require the diffuse organization of regulatory systems. An alternative model would be that active genes related to the same cellular function are segregated within clusters of transcription complexes in the same nuclear area, under the control of the same regulatory system. A number of studies dealing with nuclear organization tend toward the conclusion that the nucleus displays a nonrandom configuration at interphase. This configuration, based on the topologically defined preservation of elements from mitotic chromosomes, is often explained by specific interactions between DNA, chromatin, and what may be termed nonchromatin structures (NCS), to which, moreover, important nuclear functions have been ascribed. Aside from DNA replication (discussed in Section III,D), and RNA metabolism (discussed in Sections III,D and V, A and B), these functions include the binding of hormones (Barrack et al., 1977; Agutter and Birchall, 1979; reviewed in Shaper et al., 1979) and of carcinogens (Ueyama et al., 1981). Nonchromatin structures also reportedly are involved in the development of viral infections (Hodge et al., 1977; Buckler-White et al., 1980; Nelkin et al., 1980; Bibor-Hardy et al., 1982a,b; Hertzberg et al., 1982). If true, this would substantiate the concept of a highly structured tridimensional infrastructure subtending nuclear architecture and function. The aim of this article is to discuss most of the work that supports or disproves this concept. From the wide spectrum of references dealing with the subject, we have selected those reports that best illustrate present problems.

11. Definitions

The nonchromatin structures (NCS) of the interphase genome may be defined at both the ultrastructural and biochemical levels.

ORGANIZATION OF THE NUCLEAR MATRIX

I37

According to the regressive EDTA staining procedure of Bernhard (1969), chromatin bleaching in ultrathin sections reveals a number of structures containing RNA (Monneron and Bernhard, 1969). Of these, the perichromatin and interchromatin fibrils and granules (reviewed in Puvion and Moyne, 1981) and the nuclear bodies (reviewed in Dupuy-Coin et al., 1972) may, together with certain nucleolar components, nuclear membrane material, and pore complexes, be considered as NCS. At the biochemical level, chromatin extraction from isolated nuclei in solutions of high ionic strength, possibly followed by DNase, RNase, and detergent treatments, uncovers an ensemble of nonchromatin residues (Mayer and Gulick, 1942; Zbarsky and Debov, 1948; Wang et a l . , 1950; Mirsky and Ris, 1951; Allfrey et al., 1955; Zbarsky and Georgiev, 1959; Wang, 1961). Depending on the cell type and mode of extraction, the NCS may be organized into nuclear subfractions as diverse as those listed in Table I. Despite a certain structural and chemical variability, these isolated subfractions mostly comprise three components (Fig. 1). At the nuclear periphery, remnants of the nuclear envelope and of nuclear pores form a pore complex-lamina layer, whichmay be separated from the remainder of the structures. An internal fibrillogranular network extending inward from the peripheral lamina and crossing the nucleus constitutes the extensive interchromatin matrix. A few nucleolar residues or cores are also found and differ from the lamina and from the interchromatin matrix both in structure and chemical composition. For the sake of clarity, isolated NCS containing these three elements only will be referred to in subsequent sections as achromatinic nuclei. Other types of preparations containing nuclear DNA and RNA combined with NCS will be termed histone-depleted nuclei.

111. Toward an Anatomy of Nonchromatin Structures

Working inward from the cytoplasm to the center of the nucleus, the following structures are encountered: the perinuclear cisterna with the nuclear membranes and pore complexes, a lamella or lamina that combines with the perinuclear chromatin to form a nuclear shell or cortex, the extensive interchromatin matrix, and nucleolar cores or skeletons (Fig. 2). A. THENUCLEARMEMBRANES AND PORECOMPLEXES The most obvious NCS, located on ultrathin sections at the extreme periphery of nuclei fixed in situ, are the nuclear membranes and pore complexes. These structures have already been the subject of a number of reviews (Stevens and Andre, 1969; Franke, 1970, 1974a,b; Abelson and Smith, 1970; Franke and

TABLE I Isolated subfraction Residual nuclear proteins Isolated nuclei extracted in

-

Cells or tissues Calf thymus Rat liver

References

Rat liver and Walker carcinosarcoma Physarum po/ycephalum

Mirsky and Ris (1951) Georgiev and Chentsov (1960); Georgiev and Chentsov ( 1962) Steele and Busch (1963) Mitchelson et a / . (1979)

Ribonucleoprotein network Isolated nuclei extracted in high salt concentrations (0.8 M NaCl + 8 mM MgCI2) then treated with DNase

Walker carcinosarcoma Rat liver and Krebs ascites

Narayan er a / . (1967) Faiferman and Pogo (1975)

Nuclear protein matrix Isolated nuclei extracted with DNase, low MgCI2, high (2 M ) NaCI, Triton X-100, again DNase, and RNase

Normal and regenerating rat liver

Rat liver and hepatoma Zajdela hepatoma

Berezney and Coffey (1974); Berezney and Coffey (1977); Comings and Okada (1976); Kuzmina et a / . (1981) Buldyaeva er a / . (1978) Berezney er a / . (1979a,b)

Rat endometrium and lung Rat lung Rat thymus Rat prostate Rat uterus Bovine liver cells CHO cells

Agutter and Birchall (1979) Heminki (1977) Blaszek et a / . (1979) Shaper er a / . (1979) Barrack er a / . (1977) Wanka et a / . (1977) Hildebrand et a / . (1975)

2

1 M NaCl

-

Mouse fibroblasts Friend cells Duck erythrohlasts HeLa cells Physarum polycephalurn Terrahvmena pyriformis Cotton

Pardoll er al. (1980); Buckler-White er al. (1980) Long et al. (1979) Maundrell er al. (1981) Hodge er al. (1977) Bekers et al. (1981) Wunderlich and Herlan (1977) Plekhanova er al. (1978)

Nuclear ghosts Successive treatments of isolated nuclei with 0.5 to 1 M MgClz

HeLa cells and mouse fibroblasts BHK cells and HEp-2 cells

Riley et al. (1975) Riley and Keller (1976)

Nuclear skeletons Isolated nuclei extracted in 0.5-1 and detergents

Rat liver HeLa cells Mouse mastocytes Terrahymena pyriformis

Miller er al. (1978a,b) Herman er al. (1 976) Hancock et al. (1979) Wolfe (1980)

Nuclear scaffolds Cells or nuclei lysed in detergents and high salts or polyanions (heparin)

HeLa cells Mouse L cells

Adolph ( 1980) Razin er al. (1979)

Nuclear cages Cells directly lysed in 2 M NaCl and detergents

HeLa cells

Cook er al. (1976)

Nuclear pore-lamina Isolated nuclei lysed at low ionic strength and at alkaline pH, digested twice with DNase at 2 different pH values, then extracted in 2 M NaCl and detergent

Rat liver

Aaronson and Blobel (1975); Dwyer and Blobel (1976)

M NaCI, DNase,

W

u3

FIG. I . Nonchromatin structures and nuclear territories in HeLa cells. (A) In sitir fixed HeLa cell showing the different nuclear territories and the structures they contain. The territories comprise the dense chromatin (C), the interchromatin space (IS), and the nucleolus (N), all surrounded by the nuclear envelope (NE). The bar represents 1 pm. (B)The nonchromatin structures that remain in isolated nuclei after 2 M NaCl and nuclease extractions comprise a peripheral lamina (L) or residual nuclear envelope, an extensive interchromatin matrix (IM), which derives from the material contained in the interchromatin space, and nucleolar cores (N). The bar represents 1 pm.

ORGANIZATION OF THE NUCLEAR MATRIX

141

I

FLl rpc

’

IIB

FIG. 2. Different situations encountered at the periphery of eukaryote nuclei. Situation 1 is known to occur in protozoa and invertebrates (see references in the text). A thick fibrous lamina (FL), arranged around nuclear pores (PC) in a honeycomb pattern, lies in contact with the inner nuclear membrane (INM). In cases where a nucleolus is observed (N), it lies close to the scalloped edge of the lamina. The chromatin (black dots) is generally decondensed at the nuclear periphery. Situation I1 corresponds to that found in most vertebrate nuclei. A dense, amorphous lamella (DL) connects the chromatin (black dots) to the inner nuclear membrane (INM). The thickest lamellae (IIA and IIB) are generally found in mesenchymal cells, such as fibroblasts. The thinnest lamellae (IIC) may be found in epithelial cells. The lamella may be interrupted (HA) or only become thinner (IIB) at the level of pore complexes. The last situation (Ill) is found for instance in rodent hepatocytes, in which no intervening structure is observed with the electron microscope between the chromatin (black dots) and the inner nuclear membrane (INM). In this case, biochemical investigations revealed the existence of a very thin pore complex-lamina layer. In almost all vertebrate cells, with the main exception of germ cells, the chromatin is regularly arranged at the nuclear periphery and forms a nuclear shell (NS). This shell is particularly well seen in cells where the chromatin is highly condensed, e . g . , avian erythrocytes, and also in cases where the nucleolus is bound to the nuclear periphery (IIC). Inside the nucleus, chromatin interacts with an interchromatin matrix (M).

142

M. BOUTEILLE ET AL.

Scheer, 1974; Kasper, 1974; Franke et a l . , 1981a). Moreover, because the lipid bilayers of the nuclear membranes are dispersed by the detergents usually included in isolation media, the nuclear envelope as such is no longer present in achromatinic and histone-depleted nuclei. For these reasons, the nuclear membranes and pore complexes will not be discussed here. B. THE LAMELLA/LAMINA CONCEPT Different types of situations may prevail at the boundary between the nuclear envelope and the nuclear content (Fig. 2). 1. Presence of a Lamella Visible by Electron Microscopy

A dense amorphous layer or lamella 15 to 80 nm thick may be observed to line the inner surface of the nuclear envelope in a variety of tissues in vertebrates (Callan and Tomlin, 1950; Fawcett, 1966), including man (Fig. 3A) (Kalifat et al., 1967; Patrizi and Poger, 1967; Cohen and Sundeen, 1976). A filamentous meshwork of variable width (20-150 nm) called the fibrous lamina has been observed in certain Amoeba species (Harris and James, 1952; Pappas, 1956; Mercer, 1959; Daniels and Breyer, 1967; Flickinger, 1970), in the leech Hirudo medicinalis (Gray and Guillery, 1963; Coggeshall and Fawcett, 1964; Fawcett, 1966; Stelly et a l . , 1970), and in a gregarine (Beams et a l . , 1957). This fibrous lamina forms a typical honeycomb layer (Callan et a l., 1949) arranged around nuclear pores. It is not yet known whether these layers found in cells from vertebrate and invertebrate organisms constitute structural avatars of the same macromolecular complex. In leech neurons, for instance, the fibrous lamina appears to consist mainly of acidic proteins but no polysaccharideb (Stelly et al., 1970). In human cells, the dense lamella has been reported to contain neutral and acidic polysaccharides as well as proteins (Kalifat and Dupuy-Coin, 1970). Moreover, it is important to note that a visible layer, be it fibrous or densely amorphous, is not a constant feature of eukaryotic nuclei. In humans, for instance, Cohen and Sundeen (1976) claimed that it exists in almost all tissues, although it appears to be most developed in fibroblasts and related cells. Nevertheless, in most cases in which an intranuclear lamella was observed in humans, it was done under abnormal physiological conditions (Kalifat et a l . , 1967; Mazanec, 1967; Patrizi and Poger, 1967; Patrizi, 1968). This contradictory situation is highlighted by reports of lamellar hypertrophy or involution in injured or pathologically altered tissues (Ghadially et a l . , 1972, 1980). Such alterations in lamellar size and appearance may reflect physiological or pathological changes in the molecular events known to occur at the nuclear periphery, such as, for instance, the transfer of RNA or certain stages in its maturation. The only certainty is that the physical presence of a structurally recognizable lamella is not necessary to mediation of chromatin

ORGANIZATION OF THE NUCLEAR MATRIX

143

FIG. 3. In situ observation of nonchromatin structures at the nuclear periphery. (A) Section cut through a human keratinocyte with a well-developed dense lamella (L) surrounding the whole nucleus (N). The bar represents I km. Courtesy of C. Masson. (B) Phase-contrast and (C) fluorescence micrographs of CHO cells labeled with a fluoresceinated chicken antibody that recognizes the two immunologically related lamins A and C. Reproduced with permission from Gerace and Blobel (1982).

144

M. BOUTEILLE ET AL

interaction with the inner nuclear membrane. This function may in fact be ascribed to elements other than the lamella, i.e., to structures that are located at the same level and may include the pore complex-lamina layer or the inner nuclear membrane itself. 2. Presence of an Invisible but Isolatable Lamina Cells with no visible internal dense lamella or fibrous lamina (e.g., rodent hepatocytes) even possess a fibrous protein network connecting the pore complexes in contact with both the inner nuclear membrane and the peripheral chromatin. This network, called the pore complex-lamina layer, is still in place after isolated nuclei have been treated with high salt concentrations and nonionic detergents. It may include the protein weft of the inner nuclear membrane, plus certain nuclear pore components (Aaronson and Blobel, 1974; Richardson and Maddy, 1980). This structure, first described and isolated from rat liver by Aaronson and Blobel (1975), cannot be observed on ultrathin sections because of its thinness and close association with the membrane and the chromatin. The analysis of the pore complex-lamina is particularly illustrative of a new type of multistep methodology, which starts with the isolation of the component and leads to its in situ recognition via the use of fluorescent antibodies raised against its constituent proteins. A typical procedure for isolating rat liver pore complex-laminae (Dwyer and Blobel, 1976) is summarized in Table I. The resulting fraction is visible on ultrathin sections and on spread preparations as a tenuous network of thin fibrils in which the pore complexes are entangled (Aaronson and Blobel, 1975; Dwyer and Blobel, 1976; Richardson and Maddy, 1980). Networks resembling the mammalian pore complex-lamina were formed by extraction of nuclear envelopes manually isolated from amphibian oocytes; the extractions were done with salt and detergent treatments similar to those used to extract the mammalian structures (Scheer et al., 1976). In situ recognition of a pore-connecting lamina depends on the purification of its constitutive proteins and on the raising of specific antisera as probes. The lamina comprises three major nuclear envelope polypeptides known as lamins A, B, and C (Gerace et al., 1978), with apparent molecular weights in the 60,000-70,000 region (for a detailed analysis of these proteins, see Shelton et al., 1980, 1981, 1982). Lamins A and C of the same species contain one or more domains that are immunologically related, and some degree of cross-reaction is also observed among different vertebrate species (Gerace et al., 1978; Ely et al., 1978; Stick and Hausen, 1980). Fluorescein-labeled antibodies to these two lamins produce intense immunofluorescent staining at the periphery of a wide variety of cell nuclei, with little or no cytoplasmic or intranuclear reaction (Fig. 3B) (Gerace et a l . , 1978; Krohne et al., 1978a; Ely et al., 1978; Gerace and Blobel, 1980; Stick and Hausen, 1980; Jost and Johnson, 1981). Taken together with the bidimensional electrophoretic analysis of nuclear subfractions made by

ORGANIZATION OF THE NUCLEAR MATRIX

145

Peters and Comings (1980), these results tend to demonstrate that the lamins are exclusively located at the nuclear periphery. Nevertheless, immunocytochemical techniques remain limited in their sensitivity by antigen density. For instance, the lamins may be more widely scattered in the central area of the nucleus than at its periphery and may therefore be below the detection threshold. Preparatory procedures may also affect the antigenic properties of the lamins. At last, their antigenic determinants may be accessible in varying degrees in different regions of the nucleus (discussed in Berezney, 1979b). An isolatable lamina similar to that described in this section has been found in all cell types so far investigated from this point of view. It seems highly probable that this layer plays a predominant role in the anchorage of DNA and chromatin to the nuclear membrane. However, one cannot rule out the possibility of a third type of situation. 3. Absence of an Intervening Structure The third possibility is that chromatin and/or DNA directly interacts with the inner nuclear membrane without the aid of any interposed lamella or lamina. Arguments for such a close association of certain types of nuclear DNA with material from the nuclear membrane proper were formulated in studies of purified envelope fragments from rat liver nuclei (Franke et a/., 1973) and hen erythrocyte nuclei (Zentgraf et a/., 1975). The results support the idea that DNA or chromatin strands may be festooned over the inner nuclear surface by repeated linkage with membrane lipoproteins (discussed in Franke, 1974b). C. THENUCLEAR SHELLOR NUCLEARCORTEX The terms nuclear she// (Franke, 1974a) and nuclear cortex (Hubert et a/., 1979) refer to the outermost layers of chromatin material lining the nuclear envelope. This material is found in most vertebrate cells, except for germ cells. Whatever the type of material that may be interposed between the inner nuclear membrane and the outermost chromatin, the latter usually exhibits an original structure. This structure generally consists of distinct rows of granules or rodlike elements, regularly dispersed on the inner nuclear membrane surface facing the nucleoplasm (Davies and Small, 1968; Davies and Haynes, 1975). A typical, well-known example of a nuclear shell is found in the nucleus of avian erythrocytes (Everid et a / . , 1970; Zentgraf et al., 1975). In this material, the outermost chromatin is visible as dense granules aligned in rows or unit threads running parallel to the nuclear surface. There may be several layers of such threads, which become less and less distinct as one progresses from the membrane toward the center of the nucleus. Thin sections tangential to the nuclear envelope revealed areas in which the rows of granules were very evenly arranged, especially around the nuclear pores.

146

M. BOUTEILLE ET AL.

The nuclear shell or cortex displays properties different from those of the remainder of the chromatin (on the basis of studies of isolated nuclei). These properties may be related to the presence of nonchromatin structures (such as a pore complex-lamina layer) exclusively located at the nuclear periphery. Resistance to low ionic strength decondensation is probably the most striking of these properties. Isolated nuclei are known to lose their internal organization on exposure to media with low salt concentrations and in the absence of divalent cations (Brasch et a l . , 1971; Heumann, 1974; Aaronson and Woo, 1981). In particular, the nucleoli and dense nuclear chromatin clumps tend to mingle with the rest of the nuclear material. However, the chromatin lining the envelope remains perfectly distinguishable from the decondensed internal chromatin (Fig. 4A). The resistance of the nuclear shell to decondensation even persists in nuclei that have been deprived of their two surrounding membranes by nonionic detergents, although the layers of granules are less perfectly organized than in enveloped nuclei (Fig. 4B) (Barton et al., 1971; Hancock, 1974). This suggests that the lipid bilayers of both of the nuclear membranes are not fundamentally involved in nuclear shell organization. The latter may be attributed with greater certainty to the protein weft of the mernbrams left in place by the detergents, to the presence of a pore complex-lamina layer, or to structural chromatin proteins exclusively located at the nuclear periphery. The particular rigidity of the peripheral chromatin in isolated nuclei of muscle cells led Franke and Schinko (1969) to consider that the nuclear shell acts as a true nuclear skeleton that dictates and modulates the shape of the nucleus with the help of the subjacent cytoskeleton. The fact that the nuclear periphery may deeply penetrate the nucleus in the form of lamellar infolding or tubular canals (Bourgeois et a l . , 1979, 1983) is of great interest from this point of view (Fig. 5).

C . THEEXTENSIVE INTERCHROMATINMATRIX After passing through the nuclear periphery, one reaches the inner part of the nucleus where an interchromatin matrix is supposedly located. However, for the reasons given in Section V, there are growing doubts about the existence of this matrix as such, and it is increasingly often identified at both the ultrastructural and functional levels as a network of transcription complexes and products. 1. Structural Analogy It is now generally agreed that the in situ counterpart of the isolated interchromatin matrix lies in the areas surrounding the condensed chromatin clumps and in the interchromatin spaces (Miller et a l . , 1978a,b; Wassef, 1979; Berezney, 1979a,b; Herman et al., 1978; Puvion and Moyne, 1981; Maundrell et al., 1981). When isolated, the interchromatin matrix material closely resembles

FIG.4. The nuclear shell of HeLa cells. (A) This cultured HeLa cell was artificially swollen in a dilute phosphate buffer in the presence of EDTA. The micrograph represents a portion of the nuclear periphery. The inner chromatin (CH) is totally decondensed and gives rise to a homogeneous network. A thin layer of chromatin, the nuclear shell (NS), interrupted at pores (arrows) remains condensed. The outer nuclear membrane (ONM) is materialized by its attached cytoplasmic ribosomes. The bar represents 0.5 pm, (B) A HeLa cell treated as in (A) was lysed in the presence of the nonionic detergent NP 40. Shown is a portion of the chromatin sphere released by this treatment. Such spheres comprise an internal framework of unraveled chromatin fibers (CH) surrounded by the nuclear shell, which retains its condensed appearance. The bar represents 1 pm.

148

M. BOUTEILLE ET AL.

L-

C

A

L

B FIG.5. Hypothetical models for nuclear skeletons. (A) The nuclear structure may be subtended by only a rigid exoskeleton comprised of the nuclear pore-lamina layer (L) and its associated chromatin ( C ) . This skeleton may deeply penetrate the nucleus, and the nucleoli (N) are generally observed in contact with tubular canals or lamellar infoldings of the nuclear periphery. (B) The nucleus may also possess an endoskeleton comprising the interchromatin matrix (M) and nucleolar cores (N). In this model, the nuclear periphery only connects this endoskeleton and maintains nuclear shape.

a number of RNA-containing structures observed near these clumps and in these spaces (Berezney, 1979b). The fine structure of the interchromatin matrix isolated from rat liver (Fig. 12) is strikingly similar to that of the elements containing RNA observed in the nucleus. The matrix comprises electron-dense particles, 12-25 nm in diameter, mingled with less dense fibers. The two elements are thought to correspond to perichromatin and interchromatin fibrils and granules, and probably also to interchromatin granules with their connecting network (Berezney, 1979a,b). The latter is formed of 3- to 5-nm-thick fibers believed to be polymers of a protein called matricin (Comings and Okada, 1976; Comings, 1978; Berezney ,

ORGANIZATION OF THE NUCLEAR MATRIX

149

1979a,b). Cytochemical techniques, including fixation with the osmium-potassium ferrocyanide complex, stain these fibers, which extend inward from the inner surface of the lamina right through the whole nucleus (Goldfisher et a f . , 1980). Preferential inhibition of RNA polymerase I1 by a-amanitin in avian hepatocytes is accompanied by substantial chromatin segregation, which uncovers a network of coalescent ribonucleoprotein (RNP) structures. These structures are believed to be part of both the interchromatin granule clumps and the nuclear matrix material (Brasch and Sinclair, 1978). In HeLa and PtKl cells, they form granulofibrillar areas mainly composed of acidic proteins and RNA (Ghosh et a f . , 1978).

2 . Metabolic Analogies Essential nuclear functions are preferentially associated with both the isolated matrix and the aforementioned intranuclear material. High-resolution autoradiography has demonstrated the formation of newly synthesized heterogeneous nuclear ribonucleoproteins (hnRNP) at the borders of condensed chromatin (Fakan and Bernhard, 1971; Nash et al., 1975; Fakan et a f . , 1976; reviewed in Fakan, 1976, 1978). These nascent hnRNP are wrapped in perichromatin fibrils and give rise to interchromatin fibrils concomitantly with their transport into the interchromatin spaces, and with the first steps in hnRNP processing (reviewed in Puvion and Moyne, 1978, 1981). In achromatinic or histone-depleted nuclei, the nascent hnRNP quickly binds to the interchromatin matrix (Agutter and Birchall, 1979). The attachment of newly synthesized hnRNP to a structural framework capable of supporting its subsequent transport and maturation is one of the most exciting fields of investigation concerning nonchromatin structures and their possible involvement in gene regulation (discussed in Section V). The fact that DNA replication may also be associated with the nuclear matrix is more difficult to integrate into the concept of this matrix being a transcription complex network. High-resolution autoradiography (Fakan and Hancock, 1974; reviewed in Fakan, 1976, 1978) demonstrated that replication sites are distributed throughout the nucleus, close to the periphery of the dense chromatin aggregates. Pulse-chase experiments showed that the label subsequently migrates over the dense chromatin while the DNA is reeled through fixed replicational complexes. Several recent studies tend to demonstrate that the interchromatin matrix organizes these fixed replication sites (Berezney and Coffey, 1975; Berezney, 1979a,c; Pardoll et d . , 1980; McCready et a l . , 1980; Vogelstein et d . , 1980; Berezney and Buchholtz, 1981a; Hunt and Vogelstein, 1981; reviewed in Berezney, 1981). This is consistent with the recovery of DNA polymerase activities in nuclear matrix preparations (Smith and Berezney, 1980). Care should be taken, however, in interpreting these results, and the reasons for such caution

150

M. BOUTEILLE ET AL.

were developed in recent reviews by Hancock (1982) and Hancock and Boulikas (1982).

E. THE NUCLEOLAR SKELETON The third type of nonchromatin structure that may be encountered inside the nucleus is the nucleolar skeleton, core, or matrix. The pre-rRNA genes found in the nucleoli are probably those of the nuclear genes whose structure and function are best correlated (reviewed in Goessens and Lepoint, 1979). These genes differ radically from nonnucleolar genes in that they display repeat patterns and in that their transcription products accumulate in morphologically recognizable structures. In spite of this originality compared to extranucleolar genes, pre-rRNA genes have provided a valuable transcription model for ultrastructural studies at the molecular level (for a detailed analysis of this structure, see Scheer et ul., 1977). The same principles seem to govern the general organization of the large genes carried by lampbrush (Hill, 1979) and polytene chromosomes (Lamb and Daneholt, 1979), to the smaller single genes found in HeLa cells (Miller and Bakken, 1972), in Drosophilu embryos (McKnight and Miller, 1976), and in Chinese hamster ovary cells (PuvionDutilleul and Bachellerie, 1979). Similar principles might therefore govern the existence of nonchromatin structures in nucleoli and in the nucleoplasm. In particular, the same equivalency may be assumed to exist between a matrix and a transcription product network. It is difficult to detect any resemblance between the residual nucleolar cores usually found in chromatin-depleted and histone-depleted nuclei and any structural component of the nucleolus. In rat liver, these cores appear as highly condensed and electron-opaque bodies (Berezney and Coffey, 1974, 1977) (see, for instance, Fig. 1). When extracted from isolated nucleoli (Fig. 6), they look like condensed fibrous structures (Berezney , personal communication). The high degree of condensation that very often hinders any interpretation of such images is probably due to the presence of divalent cations in the isolation media. In HeLa cells, procedures using EDTA yield fairly decondensed nucleolar cores such as those in Fig. 9B. The fibrillar centers, or nucleolus organizing regions (NOR), which are known to contain small amounts of DNA (reviewed in Goessens and Lepoint, 1979), are indistinguishable from the dehistonized intranucleolar chromatin. This rules out the possibility that these fibrillar centers are the in situ counterpart of the nucleolar matrix. The dense fibrillar zones containing the active preribosomal genes are also not recognizable. All that remains is a homogeneous, RNase-sensitive network of 5- to 7-nm-thick fibrils with a few dense granules of various diameters. Because the ribosomal RNA precursors remain quantitatively associated with isolated nonchromatin structures (as discussed in Section V), we believe that these cores result from the unraveling of the

ORGANIZATION OF THE NUCLEAR MATRIX

151

FIG. 6. The nucleolar matrix isolated from rat liver nucleoli. This matrix appears as a highly condensed structure. Compare with the nucleolar cores of HeLa cells shown in Fig. 9. The bar represents 1 bm. Courtesy of R. Berezney.

granular and dense fibrillar zones of the nucleolus, i.e., from clusters of transcription products. Whether the cores are organized by a matrix of proteins closely linked to and hidden by the fibrillar network is not yet known. In amplified nucleoli of Xenopus oocytes, high salt extractions and nuclease digestions enable clear identification of a nucleolar skeleton comprising 4-nm-thick protein fibers (Franke et al., 1981b). The interpretation of the molecular organization of nucleolar cores in mammalian cells remains ambiguous because of unavoidable contaminations by the adhering chromatin. The cores of rat liver nucleoli are mainly composed of basic proteins (Peters and Comings, 1980). In general, these proteins are poorly represented in the remainder of the rat liver nucleus (see, for example, Todorov and Hadjiolov, 1979).

IV. Role of Nonchromatin Structures in Nuclear Organization Several roles have been attributed to the NCS in connection with the maintenance of nuclear organization. They include the coiling of DNA molecules into superhelical loops, the segregation of chromatin into condensed and diffuse zones, and the positioning of distinct chromosome segments in the nuclear vol-

152

M. BOUTEILLE ET AL.

ume. Most of the arguments substantiating the concept that NCS act as a nuclear skeleton are reviewed in this section. A. DNA SUPERSTRUCTURES When most of the nuclear chromatin is separated into its constituent parts, i.e., when the nucleosome structure is lost in 2 M NaCl or in the presence of polyanions like heparin or dextran sulfate (Adolph, 1980), the DNA molecules remain attached to a nonchromatin residue in the form of superhelical loops. This is true for cells from bovine liver (Wanka er al., 1977; Mullenders, 1979; Matsumoto, 1981) and rat liver (Pardoll et al., 1980; Berezney and Buchholtz, 1981b), for HeLa cells (Cook et al., 1976), and for mouse L cells (Razin et al., 1979). The amount of DNA remaining bound to the nonchromatin residue and the degree of its superhelical coiling vary greatly depending on the isolation procedure, and especially on stresses due to mechanical shearing or endonucleolytic cuts. For instance, extensive endonuclease digestion of isolated rat liver nuclei leaves only 1-2% of the total nuclear DNA attached to a nuclear matrix in the form of 1- to 2-kbp-long segments. Conditions that limit DNA degradation yield histone-depleted nuclei bearing nearly 80% of the total nuclear DNA with an average size of about 500 kbp (Berezney and Buchholtz, 1981b). Mild conditions that prevent shearing and nuclease activation enable recovery of 100% undamaged DNA bound to the insoluble NCS of mouse L cells (Razin et al., 1979) and HeLa cells (Cook et al., 1976). In the latter case, and also in that of mouse mammary carcinoma cells (Ide et al., 1975), the attached DNA migrates in a manner characteristic of intact circular and superhelical strands; migration is tested in sucrose gradients containing intercalating agents (ethidium bromide or actinomycin D). Superhelicity has also been demonstrated in such preparations by electron microscopy. Spread preparations obtained at an air-water interface in the presence of cytochrome c (i.e., according to Kleinschmidt, 1968) clearly showed that the DNA of histone-depleted nuclei is attached in loops to a collapsed insoluble lattice (McCready et al., 1977, 1979). The DNA in the loops appears as intertwined pairs of fibers, and sometimes as flat spirals, all configurations that are lost when nuclei are irradiated before spreading or are treated with untwisting enzyme or ethidium bromide (McCready et al., 1979). The quantity and the nature of the residual components that provide the loop attachment sites vary from a whole nuclear matrix like that described by Berezney and Coffey (1977) to a few polypeptides. In some cases, these components resemble the NCS described in the previous section (Wanka et al., 1977; Mullenders, 1979; Razin et al., 1979; Berezney and Buchholtz, 1981b). In others, they contain only polypeptides derived from a lamina (Hancock et a l ., 1979) or from the nuclear envelope (Cook et al., 1976). An extreme situation

ORGANIZATION OF THE NUCLEAR MATRIX

153

was encountered in the work of Ide et ul. (1979, where two major polypeptides sufficed to maintain the DNA in a superhelical configuration. These polypeptides resembled the protein linkers covalently integrated into the DNA (Werner et d., 1980). Taken together with the results concerning the molecular architecture of the genome of Drosophifu cells (Benyajati and Worcel, 1976), Chinese hamster cells (Hartwig, 1978), and yeasts (Pinon and Salts, 1977; Pinon, 1978), these data reinforce the concept that eukaryotic DNA is organized in loop form (IgoKemenes and Zachau, 1977). In subfractions of histone-depleted rat liver nuclei, DNA appeared to be constrained in a superhelical loop configuration through its attachment at both ends of each loop to a material assumed to be matrix proteins (Comings and Okada, 1976). In mouse P 815 cells, however, the loop attachment points seemed to be exclusively located at the level of a nuclear skeleton resembling the lamina (Hancock et al., 1979). Minute quantities of nonchromatin material seem sufficient to maintain the superhelical coiling of DNA. A model that was proposed by Lebkowski and Laemmli (1982a,b) apparently comprised two levels of DNA folding. One of these levels would only involve the lamina and would give rise to large, poorly folded loops; the second level would further constrain the first type of loop into structural and functional domains. The existence of this second level implies interactions between DNAbound proteins, especially metalloproteins, inside of the nucleus. The intranuclear distribution of these proteins is not known. They may be components of the interchromatin matrix and nucleolar cores, but they may also be evenly distributed along the DNA so that a large loop is folded into several subloops. In the latter case, such proteins might be found inside the nucleus or at its periphery (Fig. 7). Whatever the model, calculations based on the average DNA content of the nucleus have led to the estimation that a diploid mammalian genome contains about 75,000 loops or domains, varying from 20 to 200 kbp in length (discussed in Berezney and Buchholtz, 1981b; and in Hancock, 1982). STRUCTURES B. HIGHERORDERCHROMATIN

Different modes of superstructural chromatin packing were reviewed by Georgiev et al. (1978). The beaded chromatin fiber or nucleofilament formed by a chainlike array of nucleosomes is constrained into a wider solenoid or into superbeads by ionic strength-dependent linkages that primarily involve the lysine-rich histone HI (Thoma and Killer, 1981). The solenoid or superbeads are in turn folded into quinternary superstructures that give rise to the condensed chromatin areas and to the interphase arrangement of chromosomes. The continuity of the DNA double helix is not critical for the maintenance of these configurations in isolated nuclei. Nuclease digestions of nuclei isolated in media

154

M. BOUTEILLE ET AL.

A

B

FIG. 7. Different possible models of DNA superhelical coiling in the interphase nucleus. (A) The primary attachment sites ( I ) of the superhelical DNA loops are located at the peripheral nuclear lamina. The DNA molecules are festooned over the inner nuclear surface, and active genes are scattered along these molecules. (B) The primary attachment sites (1) are located at the nuclear periphery. Actively transcribed genes interact with the interchromatin matrix, an interaction that provides secondary (2) attachment sites. The subloops generated by this secondary attachment would contain nontranscribed sequences. In this model, the degree of DNA superhelical coiling would depend on the rate of transcription. Such a dependence has never been reported. (C) The primary attachment sites (1) are always located at the nuclear periphery, and the secondary sites (2) are provided by nonhistone proteins, which are tightly bound to the DNA and which cross-link the large loops into several subloops through protein-protein interactions (disulfide bridges or metalloprotein interactions, for instance). These proteins may be evenly distributed within the nuclear volume, inside of the nucleus, as well as at the nuclear periphery.

ORGANIZATION OF THE NUCLEAR MATRIX

155

that preserve their morphology do not significantly alter chromatin distribution (Sanders, 1978; Long et al., 1979). This led Grebanier and Pogo (1979) to the conclusion that nucleosomes are linked to a nuclear skeleton by disulfide bridges involving the sulfhydryl-containing histone H3. Traces of the four nucleosomal histones are coisolated with NCS and cannot be removed by thorough washing in high salt concentrations (Berezney and Buchholtz, 1981a,b). These traces increase significantly when disulfide bridge formation is favored (Kaufman et al., 1981). However, the presence of such small amounts is insufficient to explain chromatin organization in the whole nucleus. AT INTERPHASE C. CHROMOSOME ARRANGEMENT

Most of the structural components of the interphase nucleus derive from specific portions of mitotic chromosomes. This is particularly evident from threedimensional reconstructions of newt erythrocyte nuclei, where each dense chromatin block corresponds to a condensed interphase chromosome attached to the nuclear envelope (Murray and Davies, 1979). When the chromatin is more decondensed, certain nuclear components may serve as internal markers to elucidate the structural and chemical events accompanying alterations in chromatin throughout the cell cycle. These markers include the centromeres, which can now be traced with antibodies raised against kinetochore proteins (Moroi er al., 1981). The nucleoli, whose intranuclear distribution is not at all random (Bourgeois et al., 1979), and clumps of condensed chromatin like the X chromosome (reviewed in Franke, 1974a,b) may also be used. Most of these markers are usually linked to the nuclear envelope or to a dense lamella. Although it now seems certain that these links are of the utmost importance in determining nuclear organization (reviewed in Comings, 1980; and in Hancock and Boulikas, 1982), they are probably not sufficient to determine a high degree of intranuclear organization when it exists. Statistical analyses of microcinematography data have indicated that in the cell types investigated the interphase arrangement of NOR-bearing chromosomes remained highly stable in spite of cell displacement and nuclear movements (Fig. 8) (Bourgeois et al., 1981). This means that these movements are in themselves compatible with some degree of rigidity of the nuclear substance. As regards the possible involvement of the nonchromatin material in this rigidity, two hypotheses have been put forward. In the first (Comings, 1978), the high affinity of nuclear matrix proteins for repeated AT-rich DNA sequences might prove the existence of a close connection between AT-rich chromomeres and an intranuclear 'framework (Comings and Wallack, 1978). Like the interchromatin matrix, the periodic pattern revealed in metaphase chromosomes by the G-band techniques is independent of the presence of histones and is preserved under certain conditions of chromatin extraction in 2 M NaCl (Hadlaczky et al.,

0.2. 8

nucleoli -fusion

2 1

TIME (h)

+360°.

'O

1'5

I

I

2'0

,

,

I

,

215

,

I

,

,

I

I

I

315

1

1

,

.

i

B

00

.

ROTATION of the NUCLEUSW

u

FIG. 8. Kinetics of nucleolus location within the nucleus as studied by time-lapse microcinematography in L929 cells. (A) Distance between two nucleoli expressed as the ratio of the distance between the projection of the two nucleoli (d)to the corresponding diameter of the nucleus (0). (B) Rotation of the nucleus along the interphase. The arrows represent a complete rotation of +360" ( f ) or -360" ( ). Reproduced with permission from Bourgeois et al. (1981.)

ORGANIZATION OF THE NUCLEAR MATRIX

157

1981). The second hypothesis regarding the role of NCS in chromosome arrangement at interphase is that the interchromatin matrix constitutes the interphase counterpart of a metaphase chromosomal scaffold (Adolph et al., 1977; Paulson and Laemmli, 1977; Adolph, 1980; Bekers et al., 1981). This assumption essentially postulates some identity between the major constitutive proteins of these two structures (Adolph, 1980; Matsui et al., 198 1; Detke and Keller, 1982) and a certain similarity of the DNA sequences attached to them (Razin et al., 1979).

V. Involvement of Nonchromatin Structures in Gene Expression In the light of the previous section, we may consider that a certain amount of nonchromatin material is both sufficient and necessary to maintain DNA superstructures within nuclei. From a physiological point of view, the size of the loops formed by the repeated attachment of DNA to a nonchromatin scaffold is about the size of a replication unit or replicon (Berezney, 1981). This finding, combined with the fact that newly replicated DNA is preferentially associated with this scaffold has led numerous authors to devise models in which nonchromatin structures are involved in DNA replication (reviewed in Berezney, 1981; discussed in Hancock, 1982; and Hancock and Boulikas, 1982). In terms of genetic activity, the organization of nuclear DNA into superhelical domains has two implications. First, it implies that genetically active sequences occupy definite positions along the DNA loops; and second, that direct involvement of nonchromatin structures in gene regulation would only be possible when active genes are located close to the attachment points of the loops. In fact, the precise distribution of active genes within the nucleus and its influence on regulatory mechanisms is not well documented. This is probably why results that tend to demonstrate a relationship between NCS and gene activity remain controversial. This relationship may be considered at two main levels: transcription and posttranscriptional events. WITH TRANSCRIPTION A. RELATIONSHIP

The kinetics of molecular hybridization between cDNA and total mRNA from rat liver (Basler et al., 1981) or from human placenta (Norman and Bekhor, 1980) indicate that the message sequences are similarly distributed in the matrixbound and unbound DNA of achromatinic and histone-depleted nuclei. Under identical technical conditions, DNA linked to the nuclear cage of HeLa cells (see the definition of this structure in Table I) appears, on the contrary, to be highly enriched in transcribing sequences (Jackson et al., 1981). Pulse-labeling experiments have even demonstrated that RNA is synthesized in transcription complexes affixed to the nuclear cage. In HeLa cells, however, Cook and Braze11 (1980)

158

M. BOUTEILLE ET AL.

only noted a 6-fold enrichment of the globin genes in the DNA adjacent to the nuclear cage. In their study they used restriction enzymes to detach the DNA gradually from the cage and blotting to locate the globin genes in relation to the DNA anchoring sites in nonchromatin material. It should be pointed out that in HeLa cells these globin genes are probably far less clearly expressed than in differentiating erythrocytes. Using the same type of approach, but with DNase I instead of restriction enzymes, Robinson et al. (1982) found that the ovalbumin gene is preferentially linked to the nuclear matrix of ovalbumin-producing cells (chicken oviduct cells) but not to the matrix of nonproducing cells (chicken liver cells). Studies using a cDNA complementary to the globin mRNA from chick erythroblasts as a probe showed a 20-fold enrichment of globin-coding sequences in matrix-bound DNA compared to total nuclear DNA and a 1000-fold enrichment compared to DNA not bound to nonchromatin material (Bekhor and Mirell, 1979). In human term placental cells, the lactogen-coding sequences were also preferentially recovered in the DNA that remained bound to nuclear matrix proteins (Norman and Bekhor, 1979). The results for the distribution of SV40 genes in infected 3T3 fibroblast nuclei also suggest that the intranuclear distribution of DNA sequences, especially their linkage to tightly bound proteins resistant to 2 M NaCl extraction, may be related to the functionality of these sequences (Nelkin et al., 1980). Regarding the molecular nature of these proteins, biochemical and electron microscopy investigations have shown that components of the transcription complexes, including nascent hnRNP and RNA polymerase subunits, resist extraction in high salt concentrations and remain attached to the DNA template (Gariglio et al., 1979; Hancock et al., 1979). In the latter work, the clusters of transcription complexes were shown to be located on the DNA loops opposite to the attachment points. These data again compel us to envisage the possibility that what is generally accepted to be an interchromatin matrix is, in structural and functional terms, composed of residual transcription complexes distinct from the loop attachment points. Important regulatory molecules capable of interaction with the genes transcribed by core histone displacement and by increasing the rate of RNA polymerase fixation may remain in such residual complexes (Samal and Bekkhor, 1977; Bekkhor and Samal, 1977; Bekhor and Mirell, 1979; discussed in Kuo, 1982).

B . INVOLVEMENT IN POSTTRANSCRIPTIONAL EVENTS

It is widely accepted that most of the newly synthesized RNA remains linked to NCS, provided they are isolated under conditions that avoid protease and RNase activation (Smetana et al., 1963; Narayan et al., 1967; Faiferman and Pogo, 1975; Herman et al., 1978; Miller et al., 1978a,b).

ORGANIZATION OF THE NUCLEAR MATRIX

159

As far as ribosomal RNA precursors are concerned, they are observed in association with NCS after their synthesis in Tetrahyrnena macronuclei (Herlan et al., 1979) as well as in rat liver nuclei (Pardoll and Vogelstein, 1980). This association progressively decreases as rRNA processing proceeds (Herlan et al., 1979). In cell types where RNA metabolism is dominated by hnRNA synthesis and processing, most of the nascent and steady-state labeled hnRNA is retained in achromatinic nuclei (Miller et a f . , 1978a,b; Herman et al., 1978; Long et al., 1979; Maundrell et al., 1981 ; van Eekelen and van Venrooij , 198 1). The hnRNA is firmly attached to the nonchromatinous material. The attachment is thought to involve the poly(A) sequence located at the 3' end of the premessenger RNA (Herman et al., 1978) and may be mediated by a few specific proteins (van Eekelen and van Venrooij, 198 1). This is confirmed by the recovery of a 73,000MW protein in the nuclear matrix of duck erythroblasts (Maundrell et al., 1981). This protein selectively binds poly(A) and also belongs to hnRNP complexes. It is now well known that structural and chemical modifications like splicing follow hnRNA synthesis and occur within hnRNP particles. They involve a series of low-molecular-weight RNAs (1mwRNAs) that select the hnRNA sequences to be excised (introns) through complementary base recognition (reviewed in Lewin, 1980; Knowler and Wilks, 1980; Hancock and Boulikas, 1982). LmwRNAs are generally recovered as small nuclear RNP associated with hnRNP particles (30-40 S particles) under conditions that destroy nuclear architecture through sonication, proteolysis, or endonucleolytic digestion (reviewed in Reddy and Busch, 1981, and in Jacob et al., 1981). When such destruction is avoided, the lmwRNAs remain quantitatively and qualitatively associated with the NCS (Zieve and Penman, 1976; Miller er al., 1978b; Herlan et al., 1978, Maundrell et al., 1981). Immunological studies of 3T3 cells show that a subset of the proteins associated with lmwRNAs in snRNP also remain associated with the nuclear matrix (Vogelstein and Hunt, 1982). The hnRNP and snRNP particles, as well as the interchromatin matrix material, are probably pieces of the same macromolecular assembly and are generated from isolated nuclei by radically different procedures. Recent investigations of Drosophila cells demonstrated that sequence-dependent splicing of nascent transcripts occurs while the RNA is still associated with its template within the transcription complexes (Beyer et al., 1980, 1981). We therefore incline toward the conclusion that the interchromatin matrix observed on ultrathin sections corresponds to clusters of residual transcription complexes in which hnRNA synthesis and processing take place in the living nucleus. Chromatin solubilization in 2 M NaCl may uncover these clusters without fundamentally disturbing their intranuclear distribution or three-dimensional organization. Such a model might explain the preferential recovery of active genes in association with the interchromatin matrix provided this matrix is satisfactorily

160

M. BOUTEILLE ET AL.

preserved. The question remains, however, as to whether the clusters of transcription complexes are supported by an underlying protein framework or by natural interactions between DNA, RNA, and their associated proteins, or again, are artifactually created during chromatin extraction in concentrated salts. Threedimensional electron microscopy provides new elements that allow this question to be answered.

VI. Three-Dimensional Organization of Nonchromatin Structures When these structures are truly compartmentalized in the interphase nucleus, they may be expected to set up a fairly interpretable spacial organization. If, on the contrary, they are produced by the fortuitous aggregation of nuclear components during chromatin extraction, they will probably display a random distribution. Three-dimensional electron microscopy therefore constitutes a powerful approach to verifying the existence and distribution of NCS. In this laboratory, we have developed a method of three-dimensional analysis of the spacial arrangement of nuclear components in situ (Dupuy-Coin et al., 1982; Pebusque et al., 1981), using the technique of Moens and Moens (1981). We used this method here in order to examine the possible three-dimensional structure of welldefined nuclear fractions obtained by biochemical means (Bouvier et al., 1980a). A. THREE-DIMENSIONAL DATAON HELA CELLHISTONE-DEPLETED NUCLEI Nuclei were isolated from exponentially growing HeLa cells by the low-salt procedure of Hancock (1974). Nonchromatin structures were visualized by partial DNA deproteinization by thorough washing in 2 M NaC1-containing buffers, as previously described (Comings and Okada, 1976). The material obtained under these conditions corresponds to the nuclear matrix 111 (NMIII) in the nomenclature of Berezney (1979a), i.e., to histone-depleted nuclei. Such NMIII structures comprise the three nuclear matrix subcomponents, as well as appreciable amounts of nuclear DNA and RNA. Because the procedure does not include DNase or RNase digestion, this material has the advantage of allowing EM studies of DNA and RNA interaction with the NCS. Under the fluorescence microscope, acridine orange-stained NMIII structures appear as very bright spheres with both green and red staining (Fig. 9A). All the orange fluorescence typical of RNA is distributed in small patches preferentially located at the periphery of the structures and in residual nucleoli. The overall distribution and appearance of NCS on individual ultrathin sections are illustrated in Fig. 9B. NMIII structures were observed to be bound by a fibrous layer about 13 nm thick and corresponding to the lamina. A thin fibrillar material covering areas of various sizes was found inside the structures. Average thick-

ORGANIZATION OF THE NUCLEAR MATRIX

161

FIG. 9. Histone-depleted nuclei isolated from HeLa cells. HeLa cell nuclei were extracted in a 2 M NaCI-containing buffer to dissociate histones and other soluble proteins from the DNA. (A) Acridine orange-stained, histone-depleted nucleus. Such preparations showed large spheres with red clusters (RN, Residual nucleoli; IM, interchromatin matrix) scattered over a bright green background of DNA. (Reproduced with permission from Bouvier et al.. 1982.) (B) Electron micrograph of the same type of preparation. Histone-depleted nuclei comprise residual nucleoli (RN), patches of interchromatin matrix (IM), and DNA, all surrounded by a continuous lamina (L). Note the particular arrangement of DNA fibers around a nucleolar pedicle (large arrows). The bar represents I pm. Reproduced with permission from Bouvier et al. (1980a).

162

M. BOUTEILLE ET AL.

new of the fibrils was 2.7 nm, and a few denser granules 10-15 nm in diameter were also seen. This material constituted the nucleolar cores. Another component thought to be the interchromatin matrix appeared on individual sections as small patches of dense material. This material seemed more tightly packed than that in the nucleolar cores; 3- to 5-nm-thick fibrils, and granules 8-10 nm in diameter were recognized in these patches. Figure 10 shows a three-dimensional reconstruction of the lamina and nucleolar cores from photographs of every fifth section of a series of 90 sections cut through one NMIII structure. The lamina forms a continuous layer around the extracted nucleus. The nucleolar cores probably belong to one or two reticulated systems frequently in contact with the lamina. Because of the complexity of the material, it was impossible on such diagrams to plot all the NCS at the same time. Detailed analysis of 1-km-thick slices, reconstructed from a series of about 10 consecutive sections (Fig. 1I ) demonstrated that the interchromatin matrix is arranged as a network of columns, termed nucleonems (Georgiev and Chentsov, 1960). The small patches seen on individual sections must therefore result from the cross-sectioning of a complex network associated with the lamina and extending inward over a narrow band restricted to the nuclear periphery. Some of the columns of this network extend further toward the center of the NMIII structure and sometimes come in contact with a nucleolar core, thus forming a kind of pedicle. A characteristic arrangement of the DNA is often observed in such regions, in which it seems to radiate in a pufflike manner from a virtual axis. This might denote a high density of DNA cross-linking, consistent with a heterochromatic pattern of the expected chromosome segments (reviewed in Franke, 1974a) (Fig. 9B). Reconstruction of slices nearly tangential to the periphery of NMIII structures reveals that the different columns of interchromatin matrix only rarely fuse, even at the level of their association with the lamina (Bouvier et al., 1983b). Our interpretation of the three-dimensional diagrams is that the large DNA-containing areas result from the swelling of condensed chromatin during nuclear isolation at low ionic strength and subsequent nuclear extraction in 2 M NaCl. As expected from the conclusion to the previous section, the columns of interchromatin matrix might correspond to the extrachromosomal material found in the nucleoplasm near the condensed chromatin and in the interchromatin space. Similarly, solubilization of the intranucleolar chromatin and of the DNP complexes in the fibrillar centers leaves a homogeneous fibril meshwork that probably corresponds to insoluble pre-rRNP. It is important to note that the nonhistone proteins that remain tightly bound to the DNA at high ionic strength are not exclusively located in the identifiable interchromatin matrix and nucleolar cores. In the large matrix-depleted zones, DNA is also associated with tightly bound proteins that do not appear as well

ORGANIZATION OF THE NUCLEAR MATRIX

163

FIG. 10. Three-dimensional electron microscopy of the nuclear matrix components of HeLa cells. Pellets of 2 M NaCI-extracted chromatin were fixed in 2.6% buffered glutaraldehyde and postfixed in I % buffered osmium tetroxide, dehydrated with alcohol, and embedded in Epon. Series of 200 consecutive sections (100 nm thick) were mounted on single-hole, Formvar-coated grids and stained with uranyl acetate and lead citrate. Micrographs were made of every fifth section for study of the general organization of the insoluble residual structures. The outlines of the nuclear matrix components were traced from each micrograph onto transparent paper, and their coordinates were recorded with a digitizer, memorized, and subsequently recomputed to give a graphic reconstruction of the structures (left panel) and a 5'-rotated image (right panel). (A) Stereo-pair of a reconstructed residual nucleolus (RN). (B) The same residual nucleolus (RN) in place inside the perinuclear lamina (L).

164

M. BOUTEILLE ET AL

A

FIG. I I , Three-dimensional electron microscopy of the nuclear matrix components of HeLa cells. For detailed analysis of the interchromatin matrix in slices ( I p m thick) of individual extracted nuclei, micrographs were made of every consecutive section from a series of ten. (A) Stereo-pair of the interchromatin matrix (IM) in a slice (1 pm-thick) of extracted nucleus. (B) The same interchromatin matrix material in association with the perinuclear lamina (L) and residual nucleoli (RN).

ORGANIZATION OF THE NUCLEAR MATRIX

165

organized as the aforementioned NCS. Deoxyribonuclease I digestion of histonedepleted nuclei from HeLa cells releases proteins without affecting the overall morphology and organization of the intranuclear columns and of the nucleolar cores (Bouvier et al., 1983b). Razin et al. (1981), working on mouse L cells, also found salt-insoluble proteins scattered along the DNA sequences not directly interacting with nuclear matrix components.

B. OPERATIONAL MEDIANECESSARY TO MAINTAIN ORGANIZATION OF NONCHROMATIN STRUCTURES The factors responsible for maintaining the structural organization of the NCS may be summarized from the innumerable attempts made to isolate these structures. It is true that the ionic environment affects the overall morphology of NCS, especially of the interchromatin matrix. When extracted from nuclei isolated in media containing magnesium, this matrix generally displays a diffuse pattern (Fig. IB). When extracted from chromatin isolated in the absence of divalent cations, it more often looks like a network of clumps. The appearance of the nucleolar cores also depends on the presence of divalent cations in isolation buffers (see Section 111). The mere presence of NCS in achromatinic or histonedepleted nuclei is, however, independent of the presence or absence of such cations. From our experience with HeLa cell histone-depleted nuclei, an interchromatin matrix and nucleolar cores may obviously be obtained in buffers containing either EDTA or magnesium (Bouvier et al., 1980a, 1982, 1983b). The importance of the DNA depends on the mode of nuclear isolation that precedes NCS extraction. Fairly well preserved intranuclear structures are obtained after extensive DNase digestion, on condition that the nuclei are previously isolated in buffers that satisfactorily preserve their native architecture (Berezney and Coffey, 1974, 1977; Long et al., 1979; Berezney and Buchholtz, 1981b). On the other hand, swelling of nuclei in a low-salt buffer at an alkaline pH (a process that results in loss of nuclear architecture) prior to DNase digestion yields pore-lamina fractions very much depleted of their intranuclear material (Aaronson and Blobel, 1975; Dwyer and Blobel, 1976; Krohne et al., 1978b). Micrococcal nuclease (Bouvier et al., 1980b, 1983b) and DNase I1 (Dessev and Hancock, 1983) digestion applied to swollen nuclei similarly destroys intranuclear matrix organization. It has been suggested (Agutter and Richardson, 1980) that exposure of nuclei to buffers of low ionic strength and alkaline pH dislocates the nuclear matrix components except for the lamina, thus rendering their organization dependent on DNA integrity. The presence of nuclear RNA during extraction of nuclei in high salt concentrations seems necessary to obtain a whole set of NCS (Adolph, 1980; Kaufman et al., 1981; Bouvier et al., 1982). These reports stressed that intranuclear

166

M. BOUTEILLE ET AL.

NCS are lost when RNase digestion is applied to isolated nuclei before their extraction. Micrococcal nuclease, which is liable to cleave RNA, may produce results similar to those obtained with RNase (Adolph, 1980). Certain unidentified RNA species may cross-link DNA-bound matrix proteins and maintain them in structurally recognizable NCS during extraction. Digestion of these RNA species prior to extraction prevents the observation of these structures (Fig. 12A and B), even though all the proteins involved are still present (Bouvier et al., 1982). The spacially ordered interconnection of nuclear matrix proteins becomes irreversible after NCS have been extracted from nuclei. Thus, RNase digestion of NCS after their isolation no longer changes their overall morphology (Berezney and Coffey, 1974, 1977) but only induces changes consistent with a loss of RNA and protein (Maundrell et al., 1981). The involvement of DNA and RNA in maintaining NCS organization depends on the quality of nuclear preparations and the sequence of isolation steps. On the other hand, the role of proteins is invariably predominant, and all the NCS so far isolated have been reported to be destroyed by proteases. Moreover, different types of interactions between proteins are assumed to constitute factors of nuclear matrix organization. For instance, the intranuclear structures appear more labile under conditions that minimize disulfide bridge formation (Kaufman et al., 1981), i.e., in the presence of reducing agents like mercaptoethanol. A number of sulfhydryl-containing proteins indirectly bound to the DNA via other proteins may play a key role in NCS organization (Razin et al., 1981). Care should be taken in the interpretation of these results, because mercaptoethanol may also disrupt metalloprotein interactions that may be important in stabilizing histonedepleted nuclei (Lebkowski and Laemmli, 1982a,b). From both three-dimensional data and the study of the factors, we may reasonably conclude that certain RNA species interact with proteins and that both these RNA and the proteins are primarily responsible for NCS organization. The fact that after isolation procedures, these NCS still maintain a high degree of organization comprising distinct nucleolar and interchromatin material tends to rule out the possibility of fortuitous aggregation in the presence of 2 M NaCl.

VII. Prospects on Nonchromatin Structure Characterization Based on Fractionation Experiments It is surprising to note that after so much work on NCS, we still cannot characterize the specific DNA sequences preferentially associated with these structures. As seen in the previous sections, the results for such preferential association remain controversial. This is true, not only of actively transcribing genes, but also of moderately repetitive DNA (Razin et al., 1979, Pardoll and Vogelstein, 1980) and highly repetitive DNA (Hancock et al., 1979; Matsumoto,

Fio. 12. Involvement of RNA in the organization of the nuclear matrix of HeLa cells. Nuclei isolated from HeLa cells were treated with RNase prior to their extraction in 2 M NaCI. (A) Acridine orange staining. The RNase-treated material is essentially composed of light green spheres surrounded by a slightly brighter rim. Compare with Fig. 9A. (B) On ultrathin sections, histone-depleted, RNase-treated nuclei are exclusively composed of continuous laminae (L) and DNA fibers. The bar represents 1 p,m. Reproduced with permission from Bouvier er ul. (1982.)

168

M. BOUTEILLE ET AL.

1981; Basler et al., 1981). The discrepancies are obviously due to differences in NCS isolation procedures. For example, careful examination of the micrographs suggests that satellite DNA sequences are preferentially recovered in NCS preparations enriched in laminae (Hancock et al., 1979; Matsumoto, 1981). This is consistent with the high affinity of proteins resembling the lamins for natural repeated DNA and for synthetic homopolymers (Comings and Wallack, 1978). Conversely, the recovery of transcribed genes in the DNA tightly bound to NCS depends on the good preservation of interchromatin matrix material. In our opinion, this situation stems from the existence of structurally and functionally different NCS territories, which the previous sections attempted to describe. Therefore, the specificity of any one DNA sequence expected to be present in different fractions depends on the territories extracted. From this point of view, fractionation of NCS according to their intranuclear distribution appears indispensable. Two types of approach may be considered: the first involves fractionation of histone-depleted or achromatinic nuclei after their isolation, and the second includes fractionation of nuclei or chromatin under conditions that minimize protein displacement followed by extraction of the NCS-DNA complexes from the isolated subfractions. OF ACHROMATINIC AND HISTONE-DEPLETED NUCLEI A. FRACTIONATION

The first reported attempt at fractionation involved mild sonication (Berezney, 1979b). This technique allowed isolation of residual hnRNP and a purified matricin fraction by differential centrifugation of the sonicate (Fig. 13A and B). Assuming that the rat liver nuclear matrix may presently be isolated with its attached DNA (Berezney and Buchholtz, 1981b), this attempt may constitute a promising approach to the study of DNA interactions with these two subfractions. The second reported attempt at fractionation involved gradual solubilization of isolated rat liver nuclear matrices in EDTA and dilute NaOH (Kuzmina et al., 1981) and yielded four NCS fractions. Two of these fractions were not soluble in the aforementioned buffers and were considered to be the pore complex-lamina layer and the intranuclear framework. The fractions obtained were suitable for both electron microscopy and biochemical investigations. STRUCTURE EXTRACTION FROM ISOLATED B . NONCHROMATIN NUCLEAR TERRITORIES Another complementary approach consists of isolating the different nuclear territories and then extracting the NCS with their attached DNA sequences. In this laboratory, a special effort is being made to analyze NCS in terms of nuclear

ORGANIZATION OF THE NUCLEAR MATRIX

169

FIG. 13. Ultrastructure of the fractionated nuclear matrix. The interchromatin matrix of rat liver comprises a network of matricin (A) and residual RNP (B), which may be separated by sonication and differential centrifugation. The bars represent 0.25 pm. Reproduced with permission from Berezney (1979a.)

170

M. BOUTEILLE ET AL.

territories; and we have developed a procedure allowing fractionation of NCS-DNA complexes in relation to their intranuclear (interchromatin matrix + nucleolar cores) or perinuclear (pore complex-lamina) location (Hubert et al., 1981). It is not yet possible to generalize the results obtained with this procedure in HeLa cells. However, preliminary attempts to adapt it to other cell types (e.g., rat liver, mouse mascocytes, PtKl cells) have proved successful (unpublished data). As shown in Section M,C, the heterogeneous pattern of chromatin distribution within the interphase nucleus is due to the different orders of superstructural packing of the nucleosome fibers, possibly supported by the NCS. These orders are sensitive to the ionic strength environment, and the pattern of chromatin distribution may be drastically simplified by exposing cultured cell monolayers to dilute buffers (Fig. 4A). Under such conditions, the dense chromatin clumps unfold rapidly. It has been suggested that in these circumstances the particular behavior of the nuclear shell defined in Section II1,C was due to tight interactions between the outermost chromatin and material derived from the lamina (Hancock et al., 1977). To study the molecular basis of these interactions and also to fractionate NCS-DNA complexes in relation to their intranuclear and perinuclear location, we developed the fractionation procedure summarized thereafter (Hubert et al., 1981). The procedure comprises the lysis of the interphase chromatin isolated according to Hancock (1974). As shown in Fig. 14, the nuclear shell breaks in slightly alkaline Tris-buffers, and the internal mass of chromatin is expelled, together with nucleolar material. Because both the shell and the chromatin remain linked by unbroken chromatin fibers (Bouvier et al., 1980b), they must all be cut at the inner shell surface. Brief digestion with small amounts of micrococcal nuclease is sufficient to release the nuclear shells and then to purify them by sucrose gradient centrifugation. The inner chromatin may also be recovered by centrifuging the postnuclear shell supernatant fraction at high speed. It is therefore possible to obtain two purified subfractions corresponding to two different, welldefined nuclear territories (the periphery and the central area) with very low levels of cross-contamination. All steps in the procedure are presented in Fig. 15. Thanks to this model, it becomes possible to tackle the problem of the comparative organization of chromatin in relation to its location within the interphase nucleus. The intranuclear distribution of NCS can also then be studied. The chemical composition of HeLa cell nuclear shells and inner chromatin are mainly known from electrophoretic analyses (Seve et al., 1983; Bouvier et al., 1983a). As far as histones are concerned, only minor differences have been noted between the two fractions. Electrophoretic patterns of the lysine-rich histones H1, H2A, and H2B are virtually similar, as is the case for the arginine-rich histone H3 monomer. H3 dimer, however, is more abundant in the nuclear shell

ORGANIZATION OF THE NUCLEAR MATRIX

171

FIG. 14. Nuclear shell isolation from rat liver nuclei. This isolated rat liver nucleus was first allowed to swell at low ionic strength and then was exposed to a slightly alkaline Tris buffer. Under such conditions, the nuclear shell (NS) breaks, and the inner mass of chromatin (IC) is expelled together with nucleolar material (N). The bar represents 1 pm. Courtesy of J. Bureau.

than in the inner chromatin. Another difference between the two fractions is that the arginine-rich H4 histone is more acetylated in the nuclear shell. As regards DNA, the most surprising result of the present study is that, like inner chromatin DNA, nuclear shell DNA is cleaved by micrococcal nuclease and displays a typical cleavage pattern after its isolation, despite the apparent resistance of nuclear shells to the nuclease. This means that the basic structure and chemical composition of chromatin subunits are not significantly different in either fraction (Fig. 16). It is worth noting that the continuity of the DNA double helix is probably not critical for the maintenance of nuclear shell structure. This structure may be attributed with greater certainty to interactions linking nuclear shell nucleosomes to an underlying NCS. From this point of view, electrophoresis of nonhistone proteins is more informative. Here, the most striking difference between the two fractions lies in the distribution of a triplet of polypeptides with molecular weights similar to those of lamins A, B, and C (see the definition of these lamins in Section 111,B).In the inner chromatin pattern, only faint bands are found in the proteins of this molecu-

172

M. BOUTEILLE ET AL.

FIG. 15. Tentative graphic interpretation of nuclear shell isolation, based on recent concepts of chromatin organization in the interphase nucleus. This diagram shows how chromatin loops, expanding inward through the isolated nucleus and having their ends anchored at the nuclear shell (A) may separate from this nuclear shell on exposure to 20 mM Tris-HCI (pH 8.0) (B).A brief treatment with low amounts of micrococcal nuclease ( C ) cuts these loops into nucleosomes and oligonucleosome chains and releases the nuclear shell, which remains apparently intact. Extraction of the two nuclear territories thus isolated (D)in 2 M NaCl enables a study of the intranuclear distribution of nonchromatin structures.

lar weight range. Two other nonhistone proteins of 74 and 91 kilodaltons, respectively, seem to be nuclear-shell specific. A criterion for recognition of the constituent NCS proteins is their poor solubility in high salt concentrations. This is especially true of the lamins, which may form stable and highly insoluble supramolecular assemblies in the peripheral nuclear skeleton (Shelton et al., 1982). To study these proteins, it is

ORGANIZATION OF THE NUCLEAR MATRIX

173

FIG. 16. Comparative electrophoretic analysis of DNA in the inner chromatin (A) and nuclear shell fraction (B). Nuclear shell DNA is cleaved by micrococcal nuclease and displays a typical pattern, close to the nucleosome pattern.

therefore necessary to extract nuclear shell and inner chromatin fractions in 2 M NaCl solutions and to recover the insoluble material. The three lamins remain in the insoluble nuclear shell material, together with the 9 I-kilodalton protein and a number of polypeptides exceeding 100 kilodaltons (Fig. 17). The insoluble proteins of the inner chromatin fraction are qualitatively different from those of the nuclear shell. They more probably correspond to insoluble hnRNP and to proteins of the interchromatin matrix and nucleolar cores. In any case, insoluble proteins corresponding to the lamins are virtually absent from inner chromatin. Ultrathin sections are not very informative about the structure of the two fractions after their extraction in 2 M NaCl. Spread preparations obtained at an air-water interface in the presence of cytochrome c (Kleinschmidt, 1968) provide more details. For instance, on such preparations, the lamina appears after platinum shadow-casting as a thin lattice of collapsed fibers, with several granular-fibrillar areas scattered all over its surface. Improvement of lamina visualization is mainly due to the removal of chromatin subunits concomitantly with the dissociation of DNA from the complexes it forms with histones in the nucleo-

174

M. BOUTEILLE ET AL.

FIG. 17. Comparative elcctrophoretic analysis of the nonhistone proteins, which constitute nonchromatin structures in the isolated inner chromatin ( I ) and nuclear shell (2) fractions. The three lamins (A, B, and C) remain quantitatively and qualitatively associated with the 2 M NaCI-insoluble nuclear shell material. In the inner chromatin pattern, insoluble proteins are different and proteins in the molecular weight range of the lamins are virtually absent.

some cores. Radioactivity measurement, after in vivo cell labeling with [3H]thymidine, have effectively established that about 95% of the nuclear shell DNA disconnects from the insoluble lamina under our extraction conditions (Bureau et al., 1982). This means that only a very low amount of this DNA (0.05% of the total nuclear DNA) remains firmly attached to this lamina through covalent interactions. In fact, careful examination of spread nuclear shell preparations makes it possible to detect long (but less than 1 pm) DNA fragments still attached to the lamina. When studied on agarose gels, these tightly bound DNA fragments give rise to a very sharp band with a double-stranded length estimated at 2850 base pairs. In HeLa cells, the sequence family of this DNA is not presently known, and experiments with restriction enzymes are in progress to elucidate this point. In cultured mouse cells, most of the DNA that remains covalently associated with the perinuclear NCS contains satellite sequences (Hancock et al., 1979). Recent results, summarized in Hancock (1982), indicate that lamin A may be primarily responsible for the anchorage of this DNA. IN NONCHROMATIN STRUCTURES C. GLYCOPEPTIDES

Most of the literature deals with NCS in terms of proteins and nucleic acids, and very little is known about the other types of biological molecules, mainly lipids and sugars, that make up these structures. However, these molecules are of

ORGANIZATION OF THE NUCLEAR MATRIX

175

the utmost importance in explaining the mechanisms of molecular interaction and recognition. These mechanisms become clearer in c?roplasmic organelles, in the plasma membrane, and in the extracellular substance. Glycopeptides and lipoproteins no doubt also play important roles in nucleic acid interaction with other nuclear components, and the study of these roles constitutes an unexplored field for future cell biologists. It is now admitted that glycoproteins and glycosaminoglycans are components of the cell nucleus (Kaneko et al., 1972; Stein et af., 1975). Such compounds have been ascribed different hypothetical functions such as molecular recognition, routing of proteins from their cytoplasmic site of synthesis to their intranuclear site of function, and lectin binding. Until recently, the prevailing idea was that nuclear proteins containing carbohydrate side chains were essentially located at the nuclear surface (Kawasaki and Yamashina, 1972; Phillips, 1973; Mancini et af., 1973; Franke et af., 1976; Feldherr et af., 1977). More recently, however, glycoproteins have been identified among the chromosomal nonhistone proteins in whole nuclei (Rizzo and Bustin, 1977; Goldberg et al., 1978), in isolated chromatin (Reeves et al., 1981), and even in mononucleosomes (Miki et al., 1980). Nonchromatin structures were also demonstrated to contain glycoproteins (Hozier and Furcht, 1980; Sevaljevic et af., 1981). We applied our fractionation procedure to this problem by testing the ability of fluorescein-labeled lectins to bind HeLa cell chromatin, nuclear shells, and histone-depleted nuclei (Seve et af., 1983). Concanavalin A, a lectin specific for mannosyl and glycosyl residues, bound isolated HeLa cell nuclei. Fluorescence microscopy revealed an intense reaction on the nuclear shell but only a faint homogeneous fluorescence inside the nuclei. Wheat-germ agglutinin, which is mainly specific for N-acetylglucosamine, gave rise to a radically different pattern, with no fluorescence at the nuclear periphery and significant labeling of nucleoli. These lectin-binding patterns altered significantly in nuclear matrix preparations. Thus, after chromatin extraction in 2 M NaCl, concanavalin A only bound at the lamina level, and the binding sites for wheat-germ agglutinin were almost undetectable. As discussed in Section III,B, the major disadvantage of cytochemical techniques involving fluorescent markers lies in their limited sensitivity, because of the density of receptor sites. The same markers may, however, be used with a better yield to label proteins separated on polyacrylamide gels. In actual fact, proteins are far more concentrated in electrophoretic bands than in individual nuclei, and detection sensitivity is correspondingly improved (Furlan et af., 1979). Our application of this principle to the polypeptide patterns of isolated nuclear shells and inner chromatin tends to demonstrate that there are far more Con A binding sites in the shell than in the inner chromatin and that these sites are preferentially located in the peripheral lamina. The inner chromatin does contain such sites, but not as many, and they are preferentially found in proteins

176

M. BOUTEILLE ET AL.

not included in NCS. Wheat germ agglutinin, on the contrary, binds to glycoproteins of the inner chromatin fraction and its associated NCS (Seve et al., 1983). This indicates that the heterogeneity and territorial organization of NCS in the nucleus may concern molecular species other than nucleic acids and proteins.

VIIY. Conclusion

,

Presently (in 1982) the bulk of the literature contains arguments favoring the existence of nonchromatin structures in the interphase nucleus. When isolated, these structures are not the result of fortuitous aggregations caused by isolation conditions, because the in situ nuclear components from which they originate are known. The main doubt that persists concerns their involvement in nuclear physiology. Do they constitute a true nuclear skeleton with physiological implications similar to those of the cytoskeleton or of the extracellular matrix? Do they play important parts in gene regulation and viral infections? The great variety of isolation techniques and the resulting structural and chemical variations displayed by the subfractions thus obtained may explain the existing paradoxes and discrepancies concerning the interpretation of these roles. It is especially striking that we are presently unable to define with certainty the specific DNA sequence affinities of the NCS toward all the known types of DNA. In this field, it is of the utmost importance to clarify and define precisely the technical conditions for NCS isolation and to ascertain the precise origin of the subfractions obtained under such conditions. Whole nuclear matrices such as those described for rat liver nuclei are complex structures comprising radically different elements. The pore complex-lamina layer, the most stable and reproducibly obtained NCS, derives from the nuclear envelope and related structures. It undoubtedly does much to bind to itself definite DNA sequences, probably satellites, and to determine first-order DNA supercoiling. The nucleus also contains protein material that binds tightly and repeatedly to the DNA in a presently unknown pattern. This material crosslinks the interphase chromatid into subloops, thereby defining chromatin domains in which active genes and replication initiation sites occupy definite positions. Together with the pore complex-lamina layer, this protein material may be considered the true skeleton of the interphase genome. Under certain conditions of isolation, the extensive interchromatin matrix and the nucleolar cores might include such skeletal elements. However, the matrix and cores more probably derive from an intranuclear network of transcription complexes that forms around active genes and is not involved in the superhelical DNA coiling. Because of this heterogeneity and territorial organization of the nuclear matrix and related structures, it seems impossible to draw any conclusion about specific NCS-genome interactions from studies of the whole nuclear matrix. This is why

ORGANIZATION OF THE NUCLEAR MATRIX

177

fractionation experiments provide interesting prospects for characterization of the NCS and of their functional involvement in nuclear physiology.

ACKNOWLEDGMENTS We are grateful to colleagues who provided us with and allowed us to use published and unpublished micrographs for this article. Work from our laboratory was supported by grants from INSERM (U 183 and Service commun national no 18) and CNRS (ER 189 and GRECO 130023).

REFERENCES Aaronson, R. P. (1978). In “Methods in Cell Biology” (D. M. Prescott, ed.), Vol. 16, pp. 337-342. Academic Press, New York. Aaronson, R. P., and Blobel, G . (1974). J. CeU B i d . 62, 746-754. Aaronson, R. P., and Blobel, G. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 1007-101 I . Aaronson, R. P., and Woo, E. (1981). J . Cell B i d . 90, 181-186. Abelson, H. T . , and Smith, G. H. (1970). J . Ultrastruct. Res. 30, 558-588. Adolph, K. W. (1980). J. Cell Sci. 42, 291-304. Adolph, K. W., Cheng, S. M., and Laemmli, U. K. (1977). Cell 12, 805-816. Agutter, P. S., and Birchall, K. (1979). Exp. Cell Res. 124, 453-460. Agutter, P. S., and Richardson, J. C. W. (1980). J . Cell Sci. 44, 395-435. Allfrey, V. G . , Dally, M. M., and Mirsky, A. E. (1955). J. Gen. Physiol. 38, 415-424. Barrack, E. R., Hawkins, E. F., Allen, S. L., Hicks, L. L., and Coffey, D. S. (1977). Biochem. Biophys. Res. Commun. 79, 829-836. Barton, A. D., Kisielesky, W. E., Wassermann, F., and Mackevicius, F. (1971). 2. Zellforsch. 115, 299-306. Basler, J., Hastie, N. D., Pietras, D., Matsui, S. I . , Sandberg, A. A., and Berezney, R. (1981). Biochemistiy 20, 692 1-6929. Beams, H. W . , Tahmisian, T. N., Devine, R., and Anderson, E. (1975). Exp. Cell Res. 13, 200-204. Bekers, A. G. M., Gijzen, H. J . , Taalman, R. D. F. M., and Wanka, F. (1981). J. Ultrustruct. Res. 75, 352-362. Bekhor, I . , and Mirell, C. J. (1979). Biochemistry 18, 609-616. Bekhor, I., and Samal, B. (1977). Arch. Biochem. Biophys. 179, 537-544. Benyajati, C., and Worcel, A. (1976). Cell 9, 393-407. Berezney, R. (1979a). In “The Cell Nucleus” (H. Busch, ed.), Vol. 7, pp. 413-456. Academic Press, New York. Berezney, R. (1979b). J. Cell B i d . 85, 641-650. Berezney, R. (1979~).Exp. Cell Res. 123, 41 1-414. Berezney, R. (1981). In “International Cell Biology” (H. G. Schweigler, ed.), pp. 214-224, Springer-Verlag, Berlin and New York. Berezney, R., and Buchholtz, L. A. (1981a). Exp. Cell Res. 132, 1-13. Berezney, R., and Buchholtz, L. A. (1981b). Biochemistrv 120, 4995-5002. Berezney, R., and Coffey, D. S. (1974). Biochem. Biophys. Res. Commun. 60, 1410-1417. Berezney, R., and Coffey, D. S. (1975). Science 189, 291-293.

178

M. BOUTEILLE ET AL

Berezney, R., and Coffey, D. S. (1977). J . Cell Biol. 73, 616-637. Berezney, R., Basler, J., Hughes, B. B., and Kaplan, S . C. (1979a). Cancer Res. 39, 3031-3039. Berezney, R., Basler, J . , Kaplan, S. C., and Hughes, B. B. (1979b). Eur. J . CellBiol. 20, 139-142. Bernhard, W. (1969). J . Ultrastruct. Res. 27, 250-265. Bernhard, W . , and Granboulan, N. (1963). Exp. Cell Res. Suppl. 9, 19-53. Beyer, A. L., Miller. 0. L., and McKnight, S . L. (1980). Cell 20, 75-84. Beyer, A. L., Bouton, A. H . , and Miller, 0. L. (1981). Cell 26, 155-165. Bibor-Hardy,V., Pouchelet, M., St-Pierre, E., Hertzberg, M., and Simard, R. (1982a). Virology (in press). Bibor-Hardy, V., Suh, M., Pouchelet, M., and Simard, R. (1982b). J . Gen. Virol. (in press). Blaszek, I., Vauhkonen, M., and Hemminki, K. (1979). Res. Commun. Chem. Pathol. Pharmacol. 23, 611-626. Bourgeois, C. A , , Hemon, D., and Bouteille, M. (1979). J . Ultrastrucr. Res. 68, 328-340. Bourgeois, C. A., Hemon, D., Beaure d’Augeres, C., Robineaux, R., and Bouteille, M. (1981). Biol. Cell 40, 229-232. Bourgeois, C. A., Hemon, D., and Bouteille, M. (1983). To be published. Bouvier, D., Dupuy-Coin, A. M., Bouteille, M., and Moens, P. (1980a). Biol. Cell 39, 121-124. Bouvier, D., Hubert, J . , and Bouteille, M. (1980b). J . Ultrastruct. Res. 73, 288-298. Bouvier, D., Hubert, J . , Seve, A. P., and Bouteille, M. (1982). B i d . Cell 43, 143-146. Bouvier, D., Bouteille, M., Boulikas, T . , and Hancock, P. (1983a). to be published. Bouvier, D., Dupuy-Coin, A. M., Bouteille, M., and Moens, P. (1983b). to be published. Brasch, K., and Sinclair, G. D. (1978). Wirschows Arch. B . Cell Pathol. 27, 193-204. Brasch, K., Seligy, V. L., and Setterfield, G. (1971). Exp. Cell Res. 65, 61-72. Buckler-White, A. I . , Humphrey, G. W . , and Pigiet, V. (1980). Cell 22, 37-46. Buldyaeva, T. V., Kuzmina, S . N., and Zbarsky, 1. B. (1978). Proc. Nail. Acad. Sci. SSSR 241, 1161-1 164. Bureau, J., Bouvier, D., Hubert, J . , Seve, A. P., and Bouteille, M. (1982). J , Ultrasrrucr. Res. (in press). Callan, H. G . , and Tomlin, S . G. (1950). Proc. R. SOC. Ser. E 137, 367-378. Callan, H. G., Randall, J. R . , and Tomlin, S . G. (1949). Nature (London) 163, 280-289. Coggeshall, R. E., and Fawcett, D. W. (1964). J . Neurophysiol. 27, 229-289. Cohen, A. H., and Sundeen, J. R. (1976). Anat. Rec. 186, 471-475. Comings, D. E. (1978). In “The Cell Nucleus’’ (H. Busch, ed.), Vol. 4, pp. 345-371. Academic Press, New York. Comings, D. E. (1980). Hum. Genet. 53, 131-143. Comings, D. E., and Okada, T. A. (1976). Exp. CeN Res. 103, 341-360. Comings, D. E., and Wallack, A. S. (1978). J . Cell Sci. 34, 233-246. Cook, P. R., Brazell, I. A . , and Jost, E. (1976). J . Cell Sci. 22, 303-324. Cook, R. P., and Brazell, 1. A. (1980). Nucleic Acids Res. 8, 2895-2906. Daniels, E. W., and Breyer, E. P. (1967). J . Protozool. 14, 167-175. Davies, H. G., and Haynes, M. E. (1975). J . Cell Sci. 17, 263-285. Davies, H. G., and Small, J. V. (1968). Nature (London) 217, 1122-1 125. Dessev, G . , and Hancock, R. (1983). In preparation. Detke, S . , and Keller, J. M. (1982). J . Biol. Chem. 257, 3905-3911. Dupuy-Coin, A. M., Kalifat, S . R., and Bouteille, M. (1972). J . Ulrrastruct. Res. 38, 174-187. Dupuy-Coin, A. M., Bouteille, M., Moens, P., and Fournier, J. G. (1982). Biol. Cell 43, 55-68. Dwyer, N., and Blobel, G. (1976). J . Cell Biol. 70, 581-591. Eekelen, C. A. G., van, and Venrooij, W. J., van. (1981). J . Cell Biol. 88, 554-563. Ely, D., D’Arcy, A., and Jost, E. (1978). Exp. CellRes. 116, 325-331. Everid, A. C., Small, J. V., and Davies, H. G. (1970). J . Cell Sci. 7, 35-48.

ORGANIZATION OF THE NUCLEAR MATRIX

179

Faiferman, I . , and Pogo, A. 0. (1975). Biochemistry 14, 3808-3816. Fakan, S. (1976). J . Microsc. 106, 159-171. Fakan, S . (1978). In “The Cell Nucleus’’ (H. Busch, ed.), Vol. 5, pp. 3-53. Academic Press, New York. Fakan, S., and Bernhard, W. (1971). Exp. Cell Res. 67, 129-141. Fakan, S., and Hancock, R. (1974). Exp. Cell Res. 83, 95-102. Fakan, S., Puvion, E., and Spohr, G. (1976). Exp. Cell Res. 99, 155-164. Fawcett, D. W. (1966). Am. J. Anat. 119, 129-146. Feldherr, C. M., Richmond, P. A., and Noonan, K. D. (1977). Exp. Cell Res. 107, 439-444. Flickinger, C. I . (1970). Exp. Cell Res. 60, 225-236. Franke, W. W. (1970). Z. Zellforsch. 10.5, 405-429. Franke, W. W. (1974a). Int. Rev. Cytol. Suppl. 4, 71-236. Franke, W. W. (1974b). Philos. Trans. R. Soc. London Ser. B 268, 67-93. Franke, W. W., and Scheer, U. (1974). In “The Cell Nucleus’’ (H. Busch, ed.), Vol. I , pp. 219-347. Academic Press, New York. Franke, W. W., and Schinko, W. (1969). J . Cell B i d . 42, 326-331. Franke, W. W., Deumling, B., Zentgraf, H., Falk, H., and Rae, P. M. M. (1973). Exp. Cell Res. 81, 365-392. Franke, W. W., Keenan, T . W., Stadler, J . , Genz, R., Jarasch, E. D., and Kartenbeck, I. (1976). Cytobiologie 13, 28-56. Franke, W. W., Scheer, U., Krohne, G., and Jarasch, E. D. (1981a). J . Cell Biol. 91, 39s-50s. Franke, W. W., Kleinschmidt, J. A,, Spring, H., Krohne, G., Grund, C . , Trendelenburg, M. F., Stoehr, M., and Scheer, U. (1981b). J. Cell Biol. 90, 289-299. Furlan, M., Perret, B. A., and Beck, E. A. (1979). Anal. Biochem. 96, 208-214. Gariglio, P., Llopis, R., Oudet, P., and Chambon, P. (1979). J. Mol. Biol. 131, 75-105. Georgiev, G. P., and Chentsov, Y. S. (1960). Proc. Natl. Acad. Sci. SSSR 132, 199-201. Georgiev, G. P., and Chentsov, Y. S. (1962). Exp. Cell. Res. 27, 570-572. Georgiev, G. P., Nedospasov, S. A . , and Bakayev, V. V. (1978). In “The Cell Nucleus” (H. Busch, ed.), Vol. 6 , pp. 3-35. Academic Press, New York. Gerace, L., and Blobel, G. (1980). Cell 19, 277-287. Gerace, L., and Blobel, G . (1982). Cold Spring Harbor Symp. Quant. Biol. 46, 967-978. Gerace, L., Blurn, A , , and Blobel, G. (1978). J. Cell Biol. 79, 546-566. Ghadially, F. N., Fuller, J. A , , and Bhatnager, R. (1972). Arch. Paihol. 94, 303-307. Ghadially, F. N., Dick, C. E., and Lalonde, J. M. A. (1980). J . Anat. 131, 717-722. Ghosh, S., Paweletz, N., and Ghosh, 1. (1978). Exp. Cell Res. 111, 363-371. Goessens, G., and Lepoint, A. (1979). Biol. Cell 35, 211-220. Goldberg, A. H., Yeoman, L. C., and Busch, H. (1978). Cancer Res. 38, 1052-1056. Goldfischer, S . , Kress, Y., Schiller, B., and Berman, J . (1980). J . Cell Biol. 87, 50a. Gray, E. G . , and Guillery, R. W. (1963). Z. Zellforsch. 59, 738-745. Grebanier, A. E., and Pogo, A. 0. (1979). Cell 18, 1091-1099. Hadlaczky, G . , Summer, A. T., and Ross, A. (1981). Chromosoma 81, 537-555. Hancock, R. (1974). J. Mol. Biol. 86, 649-663. Hancock, R. (1982). Biol. Cell (in press). Hancock, R., and Boulikas, T. (1982). Int. Rev. Cytol. (in press). Hancock, R., Faber, A. J., and Fakan, S. (1977). In “Methods in Cell Biology” (D. M. Prescott, ed.), Vol. 15, pp. 127-147. Academic Press, New York. Hancock, R., Hughes, M. E., and Wunderli, H. (1979). Proc. Eur. Nucleolar Workshop, Weimar, Ju1.v p. 27. Harris, P., and James, T. W. (1952). Experiencia 8, 384-385. Hartwig, M. (1978). Acta Biol. Med. Ger. B 37, 421-432.

180

M. BOUTEILLE ET AL.

Hay,E. D., and Revel, J . P. (1963). J . Cell Biol. 16, 29-51. Heminki, K. (1977). Hoppe Seylers Z . Physiol. Chem. 358, 1123-1131. Herlan, G., Quevedo, R., and Wunderlich, F. (1978). Exp. CellRes. 115, 103-110. Herlan, G., Eckert, W. A , , Kaffenberger, W., and Wunderlich, F. (1979). Biochemisiry 18, 1782- 1788. Herman, R., Zieve, G., Williams, J., Lenk, R., and Penman, S. (1976). f r o g . Nucleic Acid Res. Mol. Eiol. 19, 379-392. Herman, R., Weymouth, L., and Penman, S. (1978). J. Cell Eiol. 78, 663-674. Hertzberg, M., Bibor-Hardy, V., Pouchelet, M., and Simard, R. (1982). Proc. EMBO (in press). Heumann, H. G. (1974). Chromosoma 47, 133-146. Hildebrand, C. E., Okiwaka, R. T., and Gurley, L. R. (1975). J . Cell Biol. 67, 169a. Hill, R. S. (1979). J . Cell Sci. 40, 145-169. Hodge, L. D., Mancini, P., Davis, F. M., and Heywood, P. (1977). J. Cell Eiol. 72, 194-208. Hozier, J., and Furcht, L. T . (1980). Cell Biol. Ini. Rep. 4, 1091-1099. Hubert, J., Bouvier, D., and Bouteille, M. (1979). Biol. Cell 36, 87-90. Hubert, J., Bouvier, D., Amoult, J., and Bouteille, M. (1981). Exp. Cell Res. 131, 446-452. Hunt, B. F., and Vogelstein, B. (1981). Nucleic Acids Res. 9, 349-363. Ide, T., Nakane, M., Anzai, K., and Andoh, T. (1975). Naiure (London) 258, 445-447. Igo-Kemenes, T., and Zachau, H. G. (1977). ColdSpring Harbor Symp. Quani. Biol. 42, 109-1 18. Jackson, D. A,, McReady, S . J., and Cook, R. P. (1981). Naiure (London) 292, 552-555. Jacob, M., Devilliers, G., Fuchs, J. P., Gallinaro, H., Gattoni, R., Judes, C . , and Stevenin, J. (1981). In “The Cell Nucleus” (H. Busch, ed.), Vol. 8, pp. 193-246. Academic Press, New York. Jost, E., and Johnson, R. T. (1981). J. Cell Sci. 47, 25-53. Kalifat, S. R., and Dupuy-Coin, A. M. (1970). Congr. Ini. Microsc. Eleciron., 7th. Grenoble pp. 229-230. Kalifat, S. R., Bouteille, M., and Delarue, J . (1967). J. Microsc. 6, 1019-1026. Kaneko, I., Satoh, H., and Ukita, T. (1972). Biochem. Biophys. Res. Commun. 48, 1504-1510. Kasper, C. B. (1974). In “The Cell Nucleus’’ (H. Busch, ed.), Vol. 1, pp. 349-384. Academic Press, New York. Kaufman, S. H., Coffey, D. S., and Shaper, J . H. (1981). Exp. Cell Res. 132, 105-123. Kawasaki, T., and Yamashina, I. (1972). J. Biochem. 72, 1517-1525. Keller, I. M., and Riley, D. E. (1976). Science 193, 399-401. Kleinschmidt, A. K. (1968). Meihods Enzymol. 128, 361-377. Knowler, J. T., and Wilks, A. F. (1980). Trends Biochem. Sci. October, 268-271. Krohne, G., Franke, W. W . , Ely, S., D’Arcy, A , , and Jost, E. (1978a). Cytobiologie 18, 22-38. Krohne, G., Franke, W. W., and Scheer, U. (1978b). Exp. Cell Res. 116, 85-102. Kuo. M. T. (1982). Biochemistry 21, 321-326. Kuzmina, S., Buldyaeva, T., Troitskaia, L., and Zbarsky, I. B. (1981). Eur. J. Cell Biol. 25, 225-232. Lamb, M. M., and Daneholt, B. (1979). Cell 17, 835-848. Lebkowski, J. S., and Laemmli, U. K. (1982a). J . Mol. Eiol. 156, 309-324. Lebkowski, J. S., and Laemmli, U. K. (1982b). J. Mol. Biol. 156, 325-344. Lewin, B. (1980). Cell 22, 324-326. Long, B. H., Huang, C. Y., and Pogo, A. 0. (1979). Cell 18, 1079-1090. McCready, S. J., Cox, B. S., and McLaughIin, C. S. (1977). Exp. Cell Res. 108, 473-478. McCready, S. J., Akrigg, A., and Cook, R. P. (1979). J. Cell Sci. 39, 53-62. McCready, S. J., Godwin, J . , Mason, D. W., Brazell, I. A,, and Cook, R. P. (1980). J. Cell. Sci. 46, 365-386. McKnight, S. L., and Miller, 0. L. (1979). Cell 17, 551-563.

ORGANIZATION OF THE NUCLEAR MATRIX

181

Mancini, P., Heywood, P., and Hodge, L. D. (1973). J . Cell Biol. 59, 214a. Matsui, S., Antoniades, G., Basler, J . , Berezney, R . , and Sandberg, A. A. (1981). J . Cell Biol. 91, 60a. Matsumoto, L. H. (1981). Nurure 294, 481-483. Maundrell, K., Maxwell, E. S . , Puvion, E., and Scherrer, K. (1981). Exp. CellRes. 136,435-445. Mayer, D. T., and Gulick, A. (1942). J . B i d . Chem. 146, 433-440. Mazanec, K . (1967). J. Microsc. 6, 1027-1032. Mercer, E. J. (1959). Proc. R . SOC.Ser. B 150, 216-232. Miki, B. L. A., Gurd, J. W., and Brown, I. R. (1980). Can. J. Biochem. 58, 1261-1269. Miller, 0. L., and Bakken, A. H. (1972). Arm Endocrinol. Suppl. 168, 155-177. Miller, T. E., Huang, C. Y., and Pogo, A. 0. (1978a). J. Cell B i d . 76, 675-691. Miller, T. E., Huang, C. Y., and Pogo, A. 0. (1978b). J. Cell Biol. 76, 692-704. Mirsky, A. E., and Ris, H. (1951). J . Gen. Physiol. 34, 475-492. Mitchelson, K. R., Bekers, A. G. M., and Wanka, F. (1979). J. CellSci. 39, 247-256. Moens, P. B., and Moens, T. (1981). J . Ultrusfruct. Res. 75, 131-141. Monneron, A., and Bernhard, W. (1969). J . Ulrrusrrucr. Res. 27, 266-288. Moroi, Y., Hartrnan, A. L., Nakane, P. K., and Tan, E. M. (1981). J. Cell Biol. 90, 254-259. Mullenders, L. H. F. (1979). Ph.D. thesis, Nijrnegen. Murray, A. B., and Davies, H. G. (1979). J . Cell Sci. 35, 59-66. Narayan, S. K., Steele, W. J., Smetana, K., and Busch, H. (1967). Exp. Cell Res. 46, 65-77. Nash, R. E., Puvion, E., and Bernhard, W. (1975). J. Ulrrustrucr. Res. 53, 395-405. Nelkin, B. D., Pardoll, D. M., and Vogelstein, B. (1980). Nucleic Acids Res. 8, 5623-5633. Norman, G. L., and Bekhor, 1. (1979). J . Cell B i d . 83, 158a. Norman, G. L., and Bekhor, I. (1980). J. Cell B i d . 87, 45a. Pappas, G. D. (1956). J . Biophys. Biochem. Cyrol. 2, 431-434. Pardoll, D. M., and Vogelstein, B. (1980). Exp. CeNRes. 128, 466-470. Pardoll, D. M., Vogelstein, B., and Coffey, D. E. (1980). Cell 19, 527-536. Patrizi, G. (1968). J . Microsc. 7, 293-296. Patrizi, G., and Poger, M. (1967). J. Ulrrusrrucr. Res. 17, 137-157. Paulson, J. R., and Laemmli, U. K. (1977). Cell 12, 817-828. Pebusque, M. J . , Dupuy-Coin, A. M., Cataldo, C., Sei’te, R., Bouteille, M., and Moens, P. B. (1981). B i d . Cell 41, 59-62. Peters, K. E., and Comings, D. E. (1980). J . Cell B i d . 86, 135-155. Phillips, J. L. (1973). Arch. Biochem. Biophys. 156, 377-379. Pinon, R. (1978). Chromosoma 67, 263-274. Pinon, R., and Salts, Y. (1977). Proc. Nutl. Acad. Sci. U.S.A. 74, 2850-2854. Plekhanova, L. S., Gevorkian, A. G . , Ashirova, 2. K., and Ilragimov, A. I. (1978). Biokhirniyu 43, 407-4 12. Puvion, E., and Moyne, G. (1978). Exp. Cell Res. 115, 79-88. Puvion, E., and Moyne, G. (1981). In “The Cell Nucleus” (H. Busch, ed.), Vol. 8, pp. 59-115. Academic Press, New York. Puvion-Dutilleul, F., and Bachellerie, J. P. (1979). J. Ultrusrrucr. Res. 66, 190-199. Razin, S . V., Mantieva, V. L., and Georgiev, G . P. (1979). Nucleic Acids Res. 7, 1713-1735. Razin, S . V., Chernokhvostov, V. V., Roodyn, A. V., Zbdrsky, I. B., and Georgiev, G. P. (1981). Cell 27, 65-13. Reddy, R., and Busch, H. (1981). In “The Cell Nucleus” (H. Busch, ed.), Vol. 8, pp. 261-306. Academic Press, New York. Reeves, R., Chang, D., and Chung, S. C. (1981). Proc. N d . Acud. Sci. U . S . A . 78, 6704-6708. Richardson, J . C. W., and Maddy, A. H. (1980). J . Cell Sci. 43, 253-267. Riley, D. E., and Keller, J. M. (1976). Biochim. Biophys. Actu 444, 899-911.

182

M. BOUTElLLE ET AL.

Riley, D. E., and Keller, J. M. (1978). J. Cell Sci. 29, 129-146. Riley, D. E., Keller, J. M., and Byers, B. (1975). Biochemistry 14, 3005-3013. Rizzo, W. B., and Bustin, M. (1977). J. Biol. Chem. 252, 7062-7067. Robinson, S. I., Nelkin, B. D., and Vogelstein, B. (1982). Cell 28, 99-106. Samal, B., and Bekhor, I. (1977). Arch. Biochem. Biophys. 179, 527-536. Sanders, M. M. (1 978). J. Cell Biol. 79, 97- 109. Scheer, U., Kartenbeck, J., Trendelenburg, M. F., Stadler, J., and Franke, W. W. (1976). J. Cell Bin/. 69, 1-18. Scheer, U., Trendelenburg, M. F., Krohne, G., and Franke, W. W. (1977). Chromosoma 60, 147- 167. Sevaljevic, L., Poznanovic, G., Petrovic, M., and Krtolica, K. (1981). Biochem. In?. 2, 77-84. Seve, A. P., Bouvier, D., Hubert, J., and Boureille, M. (1983). In preparation. Shaper, J . H., Pardoll, D. M., Kaufmann, S. H., Barrack, E. R., Vogelstein, B., and Coffey, D. S. (1979). Adv. Enzyme Regul. 17, 213-248. Shelton, K. R., Guthrie, V. H., and Cochran, D. L. (1980). Biochem. Biophys. Res. Commun. 93, 867-872. Shelton, K. R., Egle, P. M., and Cochran, D. L. (1981). Biochem. Biophys. Res. Commun. 103, 975--981, Shelton, K. R . , Guthrie, V. H., and Cochran, D. L. (1982). J. Biol. Chem. 257, 4328-4332. Smetana, K., Steele, W. J., and Busch, H. (1963). Exp. Cell Res. 31, 198-201. Smith, H. C., and Berezney, R. (1980). Biochem. Biophys. Res. Commun. 97, 1541-1547. Steele, W. J., and Busch, H. (1963). Cancer Res. 23, 1153-1163. Stein, G . S., Roberts, R. M., Davis, J. L., Head, W. J., Stein, J . L., Thrall, C. L., Veen, J., van, and Welch, D. W. (1975). Nature (London) 258, 639-641. Stelly, N., Stevens, B. J., and And& J . (1970). J. Microsc. 9, 1015-1028. Stevens, B. J., and Andrt, J. (1969). Handh. Mol. Cytol. pp. 837-871. Stick, R., and Hausen, P. (1980). Chromosoma 80, 217-236. Swift, H. (1963). Exp. Cell Res. Suppl. 9, 54-67. Thoma, F., and Koller, Th. (1981). J. Mol. Biol. 149, 709-733. Todorov, 1. T., and Hadjiolov, A. A. (1979). Cell Biol. In?. Rep. 3, 753-757. Ueyama, H., Matsuura, T., Nomi, S . , Nakayasu, H., and Ueda, K. (198 I ). Life Sci. 29,655-661. Vogelstein, B., and Hunt, B. F. (1982). Biochem. Biophys. Res. Commun. 105, 1224-1232. Vogelstein, B., Pardoll, D. M., and Coffey, D. S. (1980). Cell 22, 79-85. Wang, T. Y. (1961). Biochim. Biophys. Acfa 49, 239-244. Wang, T. Y., Kirkham, W. R., Dallam, R. D., Mayer, D. T., andThomas, L.E. (1950). Nature (London) 165, 974-975. Wanka, F., Mullenders, L. H. F., Bekers, A. G . M., Pennings, L. J., Aelen, J. M. A., and Eggensteyn, J. (1977). Biochem. Biophys. Res. Commun. 74,739-747. Wassef, M. (1979). J. Ulfrastrucf. Res. 69, 121-133. Werner, D., Krauth, W., and Hershey, H. V. (1980). Biochim. Biophys. Acta 608, 243-258. Wolfe, J. (1980). J. Cell B i d . 84, 160-171. Wunderlich, F., and Herlan, G. (1977). J. Cell Biol. 73, 271-278. Zbarsky, I. B., and Debov, S. S . (1948). ?‘roc. Nail. Acad. Sci. SSSR 63, 795-798. Zbarsky, 1. B., and Georgiev, G . P. (1959). Biochirn. Biophys. Acta 32, 301-302. Zentgraf, H., Falk, H., and Franke, W. W. (1975). Cyfobiologie 11, 10-29. Zieve, G., and Penman, S. (1976). Cell 8, 19-31,

INTERNATIONAL REVIEW OF CYTOLOGY. VOL 83

Changes in Membrane Properties Associated with Cellular Aging A. MACIEIRA-COELHO Dkpartement de Pathologie Cellulaire, lnstitut de Cance'rologie et d'Immunogknktique (INSERM U 50), VillejuiJ France Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell Volume. .. ..................................... Adhesion.. . . . . . . . . . . ........ A. Cell-Substratum Adhesion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Cell-Cell Adhesion . . . . . . . . ..................... C. Cell-Ligand Adhesion and Tr ..................... D. Cytoskeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Mechanisms of Cell Adhesion .......................... V. Relationship between Cell-Substratum Adhesion and Function. . . . . A. Movement.. . . . . . . .

I. 11. 111.

VI.

D. Malignancy.. . . . . Putative Mechanisms fo

......................................

183 186 I90 I90 I94 I95 203 204 207 208 208 21 1 21 1

212 215 217

I. Introduction Aging studies of the membrane at the tissue or organ level can present some difficulties; because of the heterogeneity of the cell populations, the findings may concern a mixture of cells that can age at different rates. Research on aging at a cellular level has greatly benefited from the use of cell culture because cell culture enables the maintenance over long periods of selected cell types. In particular, thanks to the work of Hayflick, the tissue culture approach has been intensified and further explored to assess changes occurring in somatic cells during aging of the organism. The starting point was the concept that somatic cells have a limited division potential and that the phenomenon is relevant to the aging process. Although forgotten, the concept had been proposed as early as 1889 by Weismann. The limited doubling potential of somatic cells I83 Copyright 0 1983 by Academic Prcss. Inc. All rights of reproduction in any forni reserved. ISBN 0-12-364483-6

184

A. MACIEIRA-COELHO

was postulated 70 years later by Swim and Parker (1957) from experiments comparing cultivated fibroblasts from different species. Subsequently Hayflick and Moorhead (1961) extended Swim and Parker’s findings with human fibroblasts, concluded that these cells are indeed endowed with a limited capacity to divide, and suggested that the phenomenon is an expression of cellular aging. Hayflick’s initial studies were made with human embryonic cells; he later compared the behavior of embryonic fibroblasts with that of adult fibroblasts and found that the latter performed fewer divisions in vitro (Hayflick, 1965). This finding, although it did not prove that the phenomenon is related to aging, suggested that during development somatic cells lose or use up their potential of division. Hayflick’s hypothesis was buttressed by the finding (Martin et al., 1970) that human fibroblasts of postnatal origin show an inverse relationship between the donor’s age and their doubling potential during serial subcultivations and that cells originating from patients with premature aging had a shorter life span than those of age-matched controls (Salk et al., 1981). There has been some disagreement, though, concerning the relationship between the fibroblast division potential and the age of the donor because of the fact that some pathological conditions can shorten the life span of fibroblasts (Goldstein et al., 1978). This again raises the problem of the mutual influences between aging and pathology. Thus, one may ask whether the division potential of fibroblasts in vitro concerns only changes in development and disease or whether it concerns also changes due to aging. In any case, these three processessdevelopment, disease, and agingare interrelated, and if it is well proved that tissue culture can be used to study the first two, this in itself justifies its use to approach the latter. We believe that the possibilitity of studying the interactions of these three phenomena is one of the main advantages of the tissue culture model and may be for the moment difficult to approach otherwise. The decline of the cell’s probability to divide is one of the most striking aspects of this system, and for this reason most studies have been done in direct or indirect relation to this parameter (Fig. 1). Experiments analyzing the cell division cycle throughout the life span of human embryonic fibroblasts revealed that changes in the cycle have a slow and progressive pattern (Macieira-Coelho, 1977). The first change that can be observed is a constant decline with each population doubling of the rate of entrance into DNA synthesis (Macieira-Coelho and Azzarone, 1982). The number of cells capable of synthesizing DNA during a 24-hour period is always high and shows only a slight decline during the second half of the life span up to the last 4-5 doublings. Toward the middle of the life span, commencement of cell division becomes more sensitive to sparse conditions. There is a stepwise increase through the life span in the sensitivity to contact inhibition of division also up to the last 4-5 doublings. This last stage (phase IV) is characterized by abrupt events, with profound disorganization of

185

CELLULAR AGING I

It

IV

4

2

ui

J

5

J

W

0

'1

lo4

,

,

,

,

,

,

,

,

,

,

,

5

10

15

20

25

30

35

40

45

50

55

,: 60

POPULATION DOUBLINGS

FIG. 1. Survival curve of a human embryonic lung fibroblast population. The points correspond to the maximal cell densities reached after each population doubling. For the definition of the different phases characterizing the cell population life span, see text (Section I). From MacieiraCoelho and Taboury (1982).

proliferation and marked metabolic changes (Macieira-Coelho and Taboury, 1982). As we shall see later in this article, modifications at the level of the membrane are also characterized in some respects by a progressive evolution or by a sudden modification apparent only in phase 1V. In some instances membrane events follow quite closely the evolution of the kinetics of proliferation, and both proliferative and membrane changes are probably related. It has been suggested (Martin et al., 1974) that the serial population doubling of human fibroblasts leads to terminal differentiation; Martin, however, viewed the differentiating stage as one preceding phase IV, which he considered a degenerative stage. Other investigators (Bell et al., 1979; Kontermann and Bayreuther, 1979) who adhered to the differentiating hypothesis considered phase IV the differentiating stage. Hayflick's concept postulates that, at least to some extent, the changes occuring in embryonic cells after serial doublings are already present in postnatal cells at the time of their explantation in vitro and are more pronounced as the age of the respective donor increases. It should be stressed that the concept should not imply that the division potential of somatic cells is exhausted when individuals reach the end point of their life span. The importance for aging lies in the fact that serial divisions cause subtle changes that progressively accumulate and modify the behavior of the cell population. It is this permanent drift created by the cell division cycle (Macieira-Coelho et al., 1982) that leads to modifications in cell-to-cell interactions, and, as we will describe later in this article, within the cell, in the mutual influences between the membrane and the functioning of the genome.

186

A. MACIEIRA-COELHO

The experiments performed with the idea of proving the Hayflick concept analyzed the changes occurring in embryonic fibroblasts during or after serial doublings and checked whether the same changes were present prematurely in postnatal fibroblasts and whether the age of the donor or diseases with premature aging accentuated those changes. This type of approach was used concerning the kinetics of cell proliferation, and indeed it was found that adult fibroblasts soon after explantation showed changes observed in embryonic fibroblasts only when they were close to the end of their doubling potential (Macieira-Coelho and PontCn, 1969). Some of these changes were later found to be accentuated with increasing age of the donor (Schneider and Mitsui, 1976). Experiments using other methodologies also favored the idea that aging in vitro triggers events analogous to aging in vivo; thus both in vitro aging and donor’s age caused identical changes in cell size (Simons and Van den Broek, 1970), enzyme heatlability (Holliday and Tarrant, 1972; Holliday, 1974; Goldstein and Singal, 1974), rate of DNA chain elongation (Petes et af., 1974; Fujiwara et al., 1977), radiation sensitivity (Macieira-Coelho et a l . , 1978), nuclear RNA content (BeMiller et af., 1981), and autofluorescence (Rattan et af., 1982). Other methodologies that are used for this type of approach and that concern the cell membrane will be described later. A relationship between the division potential of cells in vitro and the age of the donor also has been found for cells from human liver (Le Guilly et af., 1973), lens (Tassin et af., 1979), arterial smooth muscle (Bierman, 1978), keratinocytes (Rheinwald, 1979), and T lymphocytes (Walford et al., 1981). Because various aspects of fibroblasts have been studied more in detail, including studies of the cell membrane, mainly this type of cell will be dealt with in this article. We will also limit ourselves to the peripheral membrane, i.e., the plasma membrane; indeed enough data have been gathered with this model of aging to justify a review entirely devoted to the subject. In addition, the results enable postulation of new hypotheses correlating changes occurring at the cell periphery and the control of division in the nucleus; they could explain some of the mechanisms involved in. the decline of the probability of cells to reenter the division cycle after serial doublings and have implications for other aspects of cell function that play a role in the aging process. Reviews describing other aspects of membrane aging are already available (Robert, 1975; Packer et af., 1967).

11. Cell Volume

One of the first changes that was observed during cellular senescence and that suggested an involvement of the cell membrane was an increased cell volume (Simons, 1967). This was detected by measuring cell diameters under a micro-

CELLULAR AGING

187

scope with the aid of an ocular micrometer and was later confirmed with electronic counters (Macieira-Coelho and Ponttn, 1969; Simons and van den Broek, 1970; Mitsui and Schneider, 1976a; Whatley and Hill, 1979) and with measurements of the cell area on microphotographic paper (Bowman et al., 1975; Greenberg er al., 1977; BeMiller and Miller, 1979). The increase in cell volume was compared to other parameters during aging of chicken embryonic fibroblasts (Lima and Macieira-Coelho, 1972; Macieira-Coelho and Lima, 1973) to distinguish between primary and secondary events. The first detectable increase in volume was preceded by a decline in protein synthesis and coincided with a prolongation of the time needed to reach the maximal DNA synthetic activity. It was immediately followed by a decline in total RNA synthesis and an increase in the doubling time; later, cell size increased again. The data suggested that although not a primary event, the increase in volume might trigger other events along the chain leading to a decreased probability of entering the cell cycle. A close correlation between an increase in cell volume and an increase in RNA content was later found by Whatley and Hill (1979). Not only the cell area increases. Nuclear and nucleolar areas also increase; and the pattern of increase is similar for the three measures (BeMiller and Miller, 1979). There is also a good correlation between changes in area and dry mass (BeMiller and Miller, 1979). In cells of postnatal origin, the beginning of the increase in nuclear area was faster in cells from older donors (Lee ef al., 1978). The question of the relationship between volume change and the decline of the growth potential was studied by Macieira-Coelho (1970), who cocultivated young and old cells in different proportions and followed the growth and terminal cell densities of the mixed populations (Fig. 2). The decline of the maximal cell density reached by a fibroblast cell population is a characteristic of in vitro aging and is accentuated in cells obtained from older donors (Macieira-Coelho and PontCn, 1969; Schneider and Mitsui, 1976). In the cocultivation experiment, the presence of the two cell types (young and old) was checked by the volume distributions of the separated and mixed populations (Fig. 3). The results showed that the final cell density was inversely related to the number of large, old cells in the culture (Fig. 4). It was concluded that the growth arrest at progressively lower densities in older cultures can be due to an increased sensitivity to contact inhibition of division and to a decreased surface area available for attachmentold cells, being larger, need a wider area. Indeed, Blomquist ef al. (1978) found, with another system (glial cells), that the old cell is thinly spread over the substratum, with many focal points of contact and large areas of close opposition between cell and substratum. The relationship between changes in cell volume and cell division was further approached with different methodologies: tritiated thymidine-labeling of separated cells (Bowman et al., 1975); direct analysis by cinematography (Absher and Absher, 1976); and comparison of cell volume with population doubling

188

A . MACIEIRA-COELHO

1

2

3

4

5

6

7

DAYS AFTER SUBCULTIVATION FIG. 2. Growth curves of young (11) and old (111) human fibroblasts grown separately or cocultivated in 60-mm-diameter petri dishes after different inocula. Young fibroblasts were plated with initial inocula of lo6 (10 11) or 4 X 10' (4 11) cells. Old fibroblasts were inoculated at a concentration of 4 X 10' cells (4 111). One mixed culture was inoculated with 4 X los each of young and old cells (4 I1 + 4 111) and another with 4 X 105 young and 8 X 105 old cells (4 I1 + 8 111). From MacieiraCoelho ( I 970).

time (Mitsui and Schneider, 1976a). All of these approaches led to the conclusion that larger cells have a decreased probability of entering the division cycle. It was further found that the increased cell volumes are directly related to the concomitant decline in cell replication rates (Mitsui and Schneider, 1976a). Not all cells in an old population, however, are enlarged. A significant fraction have smaller sizes (Milo, 1973), and reversion from large to small size seems possible (Mitsui and Schneider, 1976b), probably through division of the large cell. The small cells could correspond to that fraction present in old populations known to have the same cycling characteristics as young cells (Kapp and Klevecz, 1976). Also, with respect to the relationship between size and the probability of division, Collins et al. (1979) found that growth factor concentration and substratum areas necessary for proliferation increase with aging of glial cells. Changes in cell volume and probability of cycling were also compared with other types of behavior by Bowman et al. (1975); these studies revealed that large cells are less motile, lack prominent bundles of microfilaments, and have a decreased ability to make cell-cell contacts. The same observations were made by Blomquist et al. (1978) on human glial cells, which toward the end of their

189

CELLULAR AGING

p . &

_ _

......

............ 4II+4m

...... .. .. ..

j2100{ m

.............. .........

w-

sq

..........

ae

..........................

........

10

......

30 30

.... . .....

20

......

10

....

...... ..___

........

10

15 20 MICRONS

25

FIG. 3 . Volume distributions found in the different cultures 24 hours after subcultivation, which is described in Fig. 2. From Macieira-Coelho (1970).

life span are flat with few microvilli, show little ruffling activity, and are almost completely devoid of macropinocytosis. Hence, it seems that decreased proliferation, increase in size, and decreased motility are closely related. A decreased motility with in vivo aging was also apparent in one of the first studies utilizing tissue culture in experimental gerontology; this study revealed that migration of cells from chicken explants was slower with tissues from older donors (Ebeling, 1921). Migration from a wound performed on a confluent

W

U

s

1 20 40 60 00 100 % PHASE

m

CELLS IN THE CULTURES

FIG. 4. Relationship between final densities and percentage of old cells (phase 111) present at inoculation, in the cultures described in Fig. 2.

190

A. MACIEIRA-COELHO

human fibroblast sheet also decreases in cultures derived from older donors (Muggleton-Harris et al., 1982).

111. Adhesion

Most functions of the plasma membrane depend primarily on the adhesion of its constituents to external molecules. Migration, cell-to-cell communication, response to hormones, growth factors and antigens, and cell division are all examples of membrane functions dependent on intermolecular forces of attraction at the cell surface. Hence, it is natural that most studies concerning the membrane during cellular senescence have analyzed the different types of adhesion. A. CELL-SUBSTRATUM ADHESION An increased volume and a larger area of attachment suggest that aging is also accompanied by changes in cell-substratum adhesion. This is an important aspect of cell behavior because it is closely related to cell functions, as will be reviewed later on. In fact, Chandrasekhar and Millis (1980) found that fibroblasts aged in vitro show a decreased cell-substratum adhesion. The main defect did not seem to depend on the membrane itself but rather upon the secretion of molecules responsible for attachment. Indeed, old cells recovered the adhesivity toward the substratum when incubated with medium conditioned by young cells or with fibronectin purified from this same medium. Some membrane alterations, however, must be present because old cells need more fibronectin than young cells for attachment. Qualitative differences were revealed, on SDSpolyacrylamide gels, between proteins precipitated from medium conditioned by young and old cells. The authors concluded that fibronectin released by late passage cells is defective. Vogel et al. (1981b) found little or no fibronectin on the surfaces. of substratum-attached, old, human fibroblasts, although they were producing fibronectin. A decreased cell-substratum adhesion is also apparent in the loss during phase IV of the retractile activity observed by Goldstein et al. (1975) and by Bell et al. (1979) on fibrin and collagen, respectively; variations in this property of normal cells must be due to changes in both the contractile apparatus and the adhesion to the organic substratum. Goldstein et al. (1975) also found a decreased retractile activity in cells derived from donors with premature aging. On the other hand, cell attachment was found to be normal in fibroblasts from patients with Werner’s syndrome (Salk et al., 1981) when attachment was measured on synthetic substrata. It is possible, though, that Werner’s syndrome cells also show decreased attachment to organic substrata.

191

CELLULAR AGING

-1.51

. .. ' ... 25 30 1

.

'

...- ' 35

.

~

-

.

40

Passage no.

FIG. 5 . Electrophoretic mobility of WI-38 cells plotted against passage number of the cells. 1 SD for approximately 120 independent particles at each point. These data reflect Values are population net negative surface charge. From H. B. Bosmann et a / . , reprinted by permission from Nature 261, 499-501, Copyright 0 1976, Macmillan Journals Limited.

*

Cell attachment depends on the electric charges at the cell surface; and, indeed, measurements of the electrophoretic mobility revealed that the net negative surface charge decreases during aging in vitro (Bosmann et al., 1976) (Fig. 5); this is in agreement with the decrease in senescent WI-38 cells of membranebound sialic acid (Milo and Hart, 1976), the molecule that is mainly responsible for the negative charge expressed at the cell surface. It has led Spataro et al. (1979) to measure the enzymes that catalyze the transfer of terminal sialic acid residues onto surface glycoproteins. Surprisingly, old cells have a higher rate of sialyltransferase activity, a result that the authors interpreted in terms of a change in receptor concentration with aging. It is interesting that the decline of the net negative surface charge follows the pattern of the decline of the rate of entrance into DNA synthesis (Fig. 6) that occurs through the in vitro aging of human fibroblasts (Macieira-Coelho and Azzarone, 1982). Both phenomena could be related because changes in surface charge can increase the time needed to reach the right amount of spreading necessary to initiate DNA synthesis. This relationship will be described with more details later. Several attempts have been made to find a biochemical basis for the changes in plasma membrane attachment to a substratum during cellular senescence. They were first made on chicken fibroblasts by Courtois and Hughes (1974), who

192

A. MACIEIRA-COELHO

POPULATION DOUBLINGS FIG.6 . Percentage of interphases labeled with [JHIthymidine during the first 24 hours after subcultivation of human embryonic lung fibroblasts at different population doubling levels. These values correspond to the first cells that enter DNA synthesis after plating and hence express the rate of initiation of the cell division cycle through the population life span. From Macieira-Coelho and Azzarone (1982).

measured the incorporation of radioactive D-glucosamine into cellular macromolecules. Labeled substances removed by trypsin from the surface were analyzed as well as the smooth membrane fractions isolated from trypsinized cells; the purity of these fractions was checked under electron microscopy. The incorporation of radioactivity into cellular macromolecules was identical in young and old cells; there was also a close similarity in chemical structure of the glycoproteins removed by proteolysis. The surface membrane of late-phase cells, however, seemed to be associated with larger amounts of mucopolysaccharides and, on the contrary, lesser amounts of several glycopeptides. The same authors also labeled cells by a short treatment with 1251 in the presence of lactoperoxidase, a method considered specific for labeling of exposed surface polypeptides (Courtois and Hughes, 1976). Their results showed that there was an increased labeling of a high-molecular-weight (220,000) glycoprotein. They claimed that the labeled substance was LETS glycoprotein and suggested that either LETS in old cells has more tyrosine residues available for iodination or the number of LETS molecules is increased. These results are contrary to those of Aizawa et al. (1980c), who found a decrease of a 220,000MW cell surface protein in old human cells. If the molecule labeled by Courtois and Hughes is fibronectin, the results are also contrary to those of Vogel et al. (1981b), who could not detect a fibronectin matrix in late-passage human embryo fibroblasts. These contradictory results cannot be attributed to differences between chicken and human cells because Fry and Weisman-Shomer (1977) also

CELLULAR AGING

193

obtained with chicken cells results opposite to those of Courtois and Hughes (1976). Schachtschabel and Wever (1978), Wever et al. (1980), and Sluke et al. ( 1981) examined the synthesis and distribution pattern of glycosaminoglycans during aging of human embryonic fibroblasts. A reduced rate of incorporation of radioactive sulfate and glucosamine occurred only during the last 4-5 doublings, with a relatively greater decline of [35S]sulfate incorporation than of [ ''C]glucosamine into extracellular glycosaminoglycans. These late changes in the synthesis of glycosaminoglycans give further support to the concept of the existence of a terminal phase (phase IV) in which there is a profound disorganization of proliferation (see Section I). Because glycosaminoglycans seem to have a regulatory function during cell growth, the authors suggested that both the decline of glycosaminoglycan synthesis and the sharp fall in the growth potential are associated phenomena. Evidence in favor of this relationship was provided by the finding that there is a relative increase, during phase IV, of [35S]sulfate and [ ''C]glucosamine incorporated into cell-bound and extracellular heparan sulfate and that treatment of young cells with heparin inhibited growth and also produced a relative increase of the radioactivity incorporated into heparan sulfate. In young cultures, heparin caused an overall increase in the synthesis rates of glycosaminoglycans. The comparison of the distribution pattern of glycosaminoglycans in old versus young cells confirmed a reduced synthesis of total glycosaminoglycans in the former with a relative increase in heparan sulfate and a relative decrease of dermatan sulfate and hyaluronic acid synthesis. The synthesis of chondroitin sulfate did not vary. The relationship between growth decline and surface proteoglycans was also investigated by Matuoka and Mitsui (1981). They confirmed that the relative amount of heparan sulfate increases in old human fibroblast populations and that this change was inversely correlated with the saturation density. On the other hand, confluent glutaraldehyde-fixed, late-passage cells were inhibitory for the growth of young cells; treatments that degraded heparan sulfate removed the inhibitory activity. The authors suggested that heparan sulfate is involved in the increased sensitivity to the various mechanisms inhibiting division during cell crowding known to be present in old fibroblast populations (Macieira-Coelho et al., 1966). Vogel and co-workers (198 la), however, came to the conclusion that glycosaminoglycan synthesis and composition are not related with this parameter; they found a general decline in the synthesis of sulfated glycosaminoglycans that are released into the medium but not of those located at the cell surface. Vogel er al. compared human embryonic fibroblasts aged in vitro and fibroblasts from young and old donors. More hyaluronic acid was produced and released into the medium by cells from the old than by those from the young donors; in addition, in old fibroblasts, there was a delayed movement of

194

A. MACIEIRA-COELHO

[35S]glycosaminoglycans(GAG) from the cytoplasm to the surface and extracellular compartment. On the other hand, the amount of [35S]GAGper milligram cell protein found at the surface and the composition of ["SIGAGs in each cell compartment did not vary. They concluded that secreted and cell-surface GAGS represent different metabolic pools and that in vitro aging has its effect primarily on the secreted pool. Although the situation is not completely clear yet in regard to the changes taking place in the proteoglycans at the cell surface, a disturbance in their synthesis and distribution certainly takes place and could be responsible in part for the alterations in cell-substratum adhesion and proliferation. Indeed, because sulfated glycosaminoglycans play a role in the binding of fibronectin to collagen (Hedman et al., 1982), the alterations described could be involved in the absence of fibronectin at the surface of the old cell (Vogel et al., 1981b). On the other hand, increases in the overall synthesis of collagen and in the ratio of the a,and a2 chains of type I collagen have been reported during rat fibroblast aging (Kontermann and Bayreuther, 1979), changes that could contribute to the diminished binding of fibronectin and render attachment looser. This interpretation fits the observation that fibronectin is required for the formation of focal adhesion sites but not for adhesion and spreading of human fibroblasts (Virtanen et al., 1982); it would explain why the old cell takes a longer time to spread on the substratum, occupies a larger area, and has more attachment sites but a weaker binding force. The increased area could be a compensation for the lower binding force. One can infer that the modifications in cell-substratum adhesion are likely caused by a disturbance in the interaction of different molecules whose synthesis is differently coordinated.

B. CELL-CELLADHESION Cell contacts are a requisite to the induction of the division cycle. Because a decreased motility will lead to a decline of the frequency of cell-cell collisions, it will also lower the probability of entering the cycle. But the decrease in cell contacts during aging is not only due to slower movements but also to a decline in intercellular adhesion, a change that must also hinder cell-to-cell communication. The first indication of decreased intercellular adhesion during aging came from the observation by Azencott and Courtois (1974). They noted that old chicken fibroblasts formed smaller aggregates than young cells and that aged single cells are less adhesive toward aggregates of young cells. Furthermore, Spataro et al. (1979) reported that the rate of attachment of young cells to confluent monolayers is more rapid than the attachment of old cells to young as well as to old cell monolayers.

CELLULAR AGING

195

Additional evidence showing a defect in cell-cell contact phenomena comes from the work of Kelley et al. (1979), who found that gap junctions are sparser and smaller and that the time needed for the formation of gap junctions is prolonged in old cells. Correspondingly, there is a delay in the arrangement of particle arrays typical of forming junctions. Kelley et al. (1977, 1980) suggested that the changes in the formation of gap junctions could be due to a defect in the association between elements of the’ cytoskeleton and the integral membrane proteins necessary for the perfect motility of the latter. Although this relationship is not yet completely understood, it is now obvious that membrane-dependent cell functions are strictly dependent upon the integrity of the cytoskeleton. The difficulty of old cells in establishing gap junctions probably explains the reduced metabolic cooperation, as measured by the exchange of radioactive precursors (Kelley et al., 1979; Kelley and Perdue, 1980). Independent of gap junction formation, there is also a difference in the distribution of the intramembrane particles visualized by freeze-fracture; younger cells exhibit more particles on P faces and aged cells more particles on the E fracture faces (Kelley and Skipper, 1977). The membrane particles that interrupt the smooth fracture plane of the membrane bilayer correspond to the integral membrane proteins that may span the membrane (Pinto da Silva et al., 1981). Kelley and Skipper (1977) suggested that the changes in the distribution of these proteins during aging may be due to modifications of the membrane fluidity. Although much has been said about membrane fluidity recently, the subject will not be dealt with here because there is a general agreement that the methods presently available to evaluate the phenomenon are not valid. The same mechanisms could be implicated in the increasing difficulty of establishing contacts and of adhering and the difficulty of fusing and forming viable hybrids between senescent fibroblasts and between young and senescent fibroblasts (Littlefield, 1973). Rohme (198 l), using inactivated Sendai virus, also found that the fusion sensitivity potential of embryonic fibroblasts decreased during in vitro aging and that of postnatal fibroblasts with donor’s age. He also suggested that the age-related decline of the fusion potential is due to modifications of the cell membrane-cytoskeleton structure.

AND TRANSPORT C. CELL-LIGAND ADHESION

Attachment of molecules to the cell surface has been extensively studied with different methodologies, sometimes with conflicting results. Rosenbloom et al. ( 1976) measured insulin binding to cultured human fibroblasts from normal donors and from patients with precocious aging and found increased binding with physiological as well as pathological aging. On the other hand, Hollenberg and Schneider (1979) could not detect any change of insulin binding to cells from

196

A. MACIEIRA-COELHO

normal donors of different age groups, Binding of epidermal growth factorurogastrone was also the same regardless of the age of the donor. Bhargava et al. (1979) measured the binding of epidermal growth factor (EGF) to human uterine smooth muscle cells and found also that there is no change during aging in the affinity of the receptors for EGF. The number of receptors, however, increases in old cells, although the response to the stimulatory action of EGF on DNA synthesis declines. Hence, the decreased effect of EGF on growth stimulation must be due to other mechanisms, which may be involved in the transmission of the signal from the cell periphery. Smooth muscle cells cultured from arteries of human donors of different ages were used by Bierman el al. (1979) to measure the binding, incorporation, and degradation of low-density lipoproteins (LDL). Binding to cell surface receptors did not change with the donor's age, but degradation of LDL decreased significantly. On the other hand, the binding, uptake, and degradation of '251-labeled LDL by human embryonic fibroblasts IMR-90 was found to decrease linearly with increasing number of population doublings; but the binding affinity was unchanged (Lee et al., 1982). The amount of LDL necessary to suppress receptor binding activity increased with aging of the culture. It is interesting that aged embryonic fibroblasts behaved like fibroblasts from heterozygotes of familial hypercholesterolemia. The authors suggested that there is a correlation between their findings and the pathogenesis of atherosclerosis. Because cultivated smooth muscle cells show the same analogy with the age of the donor concerning their life span as human fibroblasts, the differences in regard to the evolution of LDL receptors is intriguing. It is difficult for the moment to find an explanation of why fibroblasts and not smooth muscle cells should express an age-related decline in the number of LDL acceptors. The expression of prostaglandin E, (PGE,) and adrenaline receptors was measured in terms of the increase in cyclic AMP induced by these hormones (Haslam and Goldstein, 1974). Prostaglandin E, induced smaller increases in senescent cells than in young cells. On the contrary, addition of adrenaline to senescent cells caused a larger and more persistent increase in cAMP level than with young cells, a finding later confirmed by Polgar et al. (1978). These changes in the response to PGE, and adrenaline took place only during the terminal phase of the cell population life span. Even during phase IV, there was no significant difference in the molar concentration of intracellular cyclic AMP as compared to younger cells (Haslam and Goldstein, 1974). Polgar et al. (1978) on the contrary found a 3- to 4-fold increase in basal cAMP levels. Kalimi and Seifter (1979) measured the binding of dexamethasone and found a 30-50% reduction in the number of receptor binding sites per cell and also a reduction of the binding to the nuclear fraction. There was, however, no significant change in the affinity of the receptors for the hormone. Rosner and Cristofalo ( 1979) have observed high affinity glucocorticoid binding sites in

CELLULAR AGING

197

human embryonic fibroblasts whose concentration per cell decreases in old cells. Because in both works only two end points in the life span of the cell population were analyzed, it is not known whether the changes observed are progressive or just a terminal event. It would be interesting to elucidate this point further because corticosteroids are known to delay aging of these cells (Macieira-Coelho, 1966; Cristofalo, 1970). On the other hand, receptor binding for testosterone and Sa-dihydrocholestosterone, which have no effect on fibroblast life span, remains constant (Lamberigts et al., 1979). Ligand-mediated cell agglutination was used extensively to follow the presence of receptor sites for lectins during in vitro senescence. Yamamoto et al. ( 1977) found a decreased concanavalin A (Con A)-mediated cell-cell agglutination with aging of the population. The cellular capacity to bind [3H]Con A, however, increased when results were expressed per cell or per cellular protein but remained unaltered when expressed per unit area of cell surface. After trypsinization, agglutination occurred to the same extent in both aged and young cells; and after hyaluronidase treatment, the agglutination of old cells increased but not that of young cells, a result suggesting that Con A receptors do not change but become masked by other cell components. Kelley et al. (1978) also came to the conclusion that variations in Con A binding do not result from changes in the number of binding sites. Through the analysis of [3H]Con A binding, cell-to-cell agglutination, and ultrastructural distribution of Con A receptor sites, they found that differences between young and old cells are due to changes in distribution rather than number of binding sites, which is in agreement with the results obtained by the same group concerning the distribution of membrane particles. Aizawa and Mitsui (1979) developed an interesting method for following the evolution of lectin binding during aging of human fibroblasts in vitro. They adsorbed Con A to red blood cells (RBC), then the Con A-coated RBC were adsorbed to monolayers of fibroblasts, and finally the cells were dissolved in 5% SDS and the amount of adsorbed RBC was determined by measuring spectrophotometrically the hemoglobin content. The amount of RBC adsorbed to the fibroblasts via Con A-coated RBC (the RBC coating method) increased continuously throughout senescence (Fig. 7). Binding to Con A alone, however, did not change significantly, as measured after adsorption of [3H]Con A to the cells. The changes in Con A mediated RBC binding to a population of fibroblasts are dependent on the percentage of life span completed, are unrelated to cell volume or to the proportion of fast- or slow-dividing cells present, and are independent of metabolic time. However, some rare clones that are present in old cultures show minimal adsorption capacity (Aizawa and Mitsui, 1982). These observations confirm the finding of Bosmann et al. (1976) that continuous changes of the cell surface start early and progress throughout the population life span. Indeed both phenomena were correlated by Aizawa et al.; because the number of receptors

198

-

A . MACIEIRA-COELHO

6.0

30

4.0

20 E .r

u

E

0

u

0

L

2CL

n

P

4'

P

\

z

E 0

u

I I

O * 0

CI 0,

2.0

10

o c 10

I

I

20

30

1

40

L

50

L

a

0

60

P D L

FIG. 7. Adsorption of Con A-coated red blood cells (0)and 13H]Con A binding (A) to human diploid fibroblasts as a function of population doubling level (PDL). From Aizawa and Mitsui (1979).

for Con A does not change, as revealed by the direct adsorption method, they assumed that the continuous increase in RBC-coated Con A adsorption are due to more general nonspecific phenomena such as the modification of surface charge (Bosmann et al., 1976) caused by a decreased membrane-bound sialic acid (Milo and Hart, 1976). This interpretation was buttressed by experiments analyzing the effect of different enzymes on RBC adsorption. The RBC coating method was enhanced either by neuraminidase and trypsin treatment of RBC or by neuraminidase, hyaluronidase, chondroitinase, collagenase, trypsin, protamine, and poly-L-lysine treatment of fibroblasts (Aizawa et af., 1980a). Aizawa and

CELLULAR AGING

199

Kurimoto (1979a,b) and Aizawa et af. (1980b) also measured RBC binding to lectin-coated fibroblasts and found with this procedure that (fibroblast coating method) changes occurred only in the final stages of the fibroblast life span and that only nondividing cells adsorb the RBC. This finding gives further support, in addition to evidence presented elsewhere (Macieira-Coelho, 1977), that an increase in nondividing or slow-dividing cells takes place only toward the end of the fibroblast life span. Only trypsin and collagenase treatment of fibroblasts enhanced the RBC adsorption with the fibroblast coating method. The increased RBC adsorption with the latter procedure coincided with the decrease of a 220,000-MW cell surface protein (Aizawa et af.,1980a); substances that caused a decrease of this protein also increased this type of adsorption. Cytochalasin B enhanced adsorption with both methods and colchicine increased adsorption only with the fibroblast coating method (Aizawa and Kurimoto, 1979a,b), it led to the suggestion that receptor mobility via the cytoskeleton plays a role in the Con A-mediated RBC adsorption and relates Aizawa’s findings to those of Kelley et af. reported earlier. The increased Con A-mediated adsorption of RBC occurs during in vitro aging of human fetal fibroblasts cultured from lung, heart, liver, skin, and muscle, albeit to different degrees (Aizawa et af., 1980b). Postnatal fibroblasts from Werner’s syndrome showed senescent phenotype in RBC adsorption at early population doubling levels (Aizawa et af., 1980c), a finding that buttressed the analogy between in vitro and in vivo aging. Data obtained with another lectin (Aubery et al., 1980) also favor the analogy between in vitro cellular aging and human age in vivo. It concerns the binding sites of a lectin, Ricinus communis (RCAI), which is specific for P-D-galactosyl residues. With human fetal and newborn liver cells, the Scatchard plot gave biphasic curves during most of their life span in vitro (Aubery et af., 1980), a result suggesting two classes of binding sites for RCAI lectin. In the final stage of the life span, the curves suggested only one class of binding sites. The plot for adult liver cells was monophasic as early as the beginning of their life span in vitro, a result indicating the presence of only one class of binding sites. Both in vitro and in vivo aged cells recovered the two classes of binding sites after treatment with hyaluronidase, a result that was attributed to an increased hyaluronic acid at the surface of the old cell (Bernard et al., 1982). Because hyaluronic acid synthesis decreases (Sluke et af., 1981), there must be another explanation for the effect of the enzyme on the binding of this lectin. The behavior of another class of receptor, HLA antigens, go through more intriguing variations. HLA antigens were first analyzed in in vitro models of aging by Miggiano et af. (1970), who reported a stability of these antigens during serial replication of cultured fibroblasts. Later, however, Sasportes et af. (1971) claimed that HLA antigens disappear during senescence of cultivated fibroblasts

200

A. MACIEIRA-COELHO

derived from postnatal skin, during a period preceding cell degeneration and death and corresponding to a phase of apparent normal cellular multiplication. The problem was reappraised by Brautbar et al. (1972, 1973), who analyzed mass cultures of 3 different fibroblast populations of embryonic origin and 12 adult skin cultures; they could detect no change in the expression of HLA antigens up to the last population doubling. Goldstein and Singal (1972) and Goldstein et al. (1974), on the other hand, also did not find any change of the antigens in the mass culture obtained from postnatal skin, but they observed a loss of reactivity in several of the clones isolated from the same cell populations in association with a decreased plating efficiency. They suggested that their results are consistent with an immune basis of aging, a suggestion that was further supported by the finding that mass fibroblast populations obtained from the skin of patients with Progeria or Werner’s syndrome had at early population doubling levels altered or reduced expression of HLA, antigens (Goldstein et ul., 1975). Because treatment of the cells with collagenase and neuraminidase did not restore the expression of HLA,, it was thought that cellular aging was associated with a defect in the genetic expression of this antigen. Goldstein et al. recognized, however, that antigen clustering could also be responsible for restricting antibody binding. Postnatal skin fibroblasts were tested by Moley and Engelhardt (198 1) for complement-mediated cell lysis and binding of radiolabeled staphylococcal protein A . They did not find any difference during cellular senescence in antibody binding with those two assays and concluded that senescent cells do not differ in major cell surface proteins. Because the experiments were performed on mass populations, they do not exclude clonal differences as demonstrated in Goldstein’s work. Less specific receptor sites were also analyzed in terms of bacterial binding (Sugarman and Munro, 1980). Human lung fibroblasts were incubated with labeled bacteria, washed, and the remaining radioactivity measured; there was a constant proportion of binding per unit cell mass in young as well as in old cells. Although for the moment there are discrepancies concerning some experiments, the results can be summarized as follows. The molecular constitution of most of the receptors analyzed probably does not vary because the affinity for the receptor is constant; but there are differences in the number of bound molecules, differences that can be explained by the redistribution and (or) masking of the receptors. Like the changes in proliferation, some alterations occur progressively throughout the population life span and others are characteristic only of the terminal stage. In many instances, the modifications observed are identical during in vitro as well as in vivo aging. Particularly interesting is the finding that there can be a clonal evolution that goes undetected if the experiments analyze only the mass population. This could explain some contradictions, because different growth conditions can favor the proliferation of certain types of cells.

20 1

CELLULAR AGING

60

6

,I

60 ~~

9

22

:

22 28 PASSAGE NUMBER

FIG. 8. Cell-bound radioactivity I and 60 minutes after adding 1251-labeledalbumin to postnatal human lung fibroblasts at different population doubling levels in the absence (white bars) and in the presence (black bars) of polyornithine. The I-minute values correspond to adsorption and the 60minute values to uptake of albumin. From Berumen and Macieira-Coelho (1977).

In addition to the studies concerning the fixation of substances at the cell surface, many authors have analyzed their transport across the membrane. Press and Pitha (1974) measured adsorption and uptake of insulin, of different (in molecular weight) dextrans, and of DEAE-dextran and found no difference between young and old cells. They concluded that the accumulation of nonfunctional materials known to occur during cellular senescence is not due to impaired uptake. The transport of other molecules, however, was later found to be altered during cellular aging. Berumen and Macieira-Coelho (1977) analyzed the adsorption and uptake of iodinated human serum albumin ( *251SA)by serially subcultivated embryonic and postnatal lung fibroblasts. They found an increased uptake of albumin with increasing population doublings, an increase that became more pronounced during phase IV (Fig. 8). Old cultures were also more sensitive to the stimulatory action of polyornithine on protein uptake (Fig. 8). The increased uptake of albumin induced by the polyamino acid was associated with loss of proteins from the cell. On the other hand, hydrocortisone, which delays aging of embryonic lung fibroblasts, decreased the loss of cell proteins and the stimulation of albumin uptake by polyornithine. The authors suggested that the increased protein uptake caused by polyornithine and by aging occurs through an exchange mechanism in which some proteins leave the cell and other molecules

202

A. MACIEIRA-COELHO

are taken up. A disequilibrium in this pump mechanism during senescence could be one of the mechanisms responsible for the increased volume and mass observed in old cells. Sugar transport was also measured during in vitro aging of human postnatal skin fibroblasts. The V,,, of 2-deoxy-~-glucosetransport per cell increased with the percentage of life span completed but there was no variation in K,,, (Germinario et al., 1980). On the other hand, uptake of deoxyglucose and cholesterol in IMR-90 embryonic fibroblasts did not vary throughout the whole population life span (Lee et al., 1982). Cremer et al. (1981) also found that transport rates for D-glucose remained constant throughout most of the cell life span; however, during phase IV, the wide variation in the values obtained did not enable them to draw any conclusions. The variation could be due to the experimental procedure, in which suspended fibroblasts were used to measure sugar uptake. Under these conditions the viability of these cells rapidly declines, in particular during the terminal stages. The rates of uridine transport was measured by Polgar et al. (1978) in earlyand late-passage cells in resting phase and after addition of fresh serum (which stimulates cell division). The rate of uridine transport is increased in old cells, even after addition of fresh serum, although their rate of entrance into DNA synthesis is decreased. The increase in the number of transport sites in latepassage cells was interpreted as a compensation for the increase in cell volume; the net number of sites per surface area decreases. The basal cAMP levels rose 3to 4-fold per cell in late passage cultures; on the other hand, there was no change in the activity of cAMP phosphodiesterase. Overall the results suggested an alteration of the adenyl cyclase enzyme system but could not elucidate which element of the chain is affected. Uptake of zinc is stable during most of the life span of human embryonic lung fibroblasts but decreases during phase 1V (Sugarman and Munro, 1980). At this stage the amount of zinc per cell is the same, but it is significantly reduced if expressed per microgram of cell protein. In order to assess if the lipid accumulation in aging cells is due to slowing of fatty acid oxidation by mitochondria, the uptake of carnitine, an essential metabolite for fatty acid oxidation, was measured in human embryonic fibroblasts (Carnicero et al., 1982). Resting-phase cells at high population doubling levels took up carnitine more rapidly when the results were expressed per cell; when the results were expressed as a function of cell size, no difference was recorded between young and old populations. Palmitate uptake followed the same pattern. Smooth muscle cells, which do not exhibit lipid accumulation during aging, take up carnitine as rapidly as the human fibroblasts. Hence the data show that disturbances in transport take place during cellular senescence but in a selective way. In some cases, the increased transport seems

CELLULAR AGING

203

to be a consequence or a compensation for the increase in membrane surface area.

D. CYTOSKELETON As mentioned earlier, adhesion and, in general, the function of the plasma membrane of mammalian cells is highly dependent on the mobility of integral proteins; in this respect, the plasma membrane is intimately related with the cytoskeleton. As will be mentioned later, it is also through elements of the cytoskeleton that the plasma membrane transmits at least part of the information to the rest of the cell. Some aspects of the repercussion of cytoskeleton changes on the membrane during aging were described earlier, but other observations have been made. Alterations of the cytoskeleton were first reported by Bowman and Daniel (1973, who observed with scanning electron microscopy that old cells lacked prominent bundles of microfilaments and that this deficiency coincided with reduced motility and decreased ability to make cell-cell contacts and to incorporate [3H]thymidine. Kelley et af. (1980) also studied the relationship between cell adhesion and the cytoskeleton and concluded that cell spreading is prolonged in old cells and is correlated with a retarded assembly of actin bundles. In addition, detergentresistant membrane regions that are associated with underlying bundles of filaments take a longer time to develop. Because these regions seem to be due to the creation of microfilament-membrane bonds, Kelley et af. suggested that in old cells there is a defect in the synthesis and assembly of these linking elements. A disorganization of microfilaments and microtubules, together with a decrease of pinocytic vacuoles, was also reported in aging mouse fibroblasts by van Gansen et al. (1979). Anderson (1978) measured the amount of actin and analyzed its peptide composition in senescent chicken fibroblasts. He found an increased actin content in old cells, mainly of one protein species homologous to muscle actin. Anderson speculated that the slowdown of cell division and decreased cell density could be correlated with this finding, in contrast to transformed cells, which sometimes have a decreased cellular actin and microfilament content and are less sensitive to contact inhibition of division. Surprisingly, in spite of these changes concerning the cytoskeleton, old cells can contract a protein lattice with equal or greater speed than equal numbers of young cells (Bell et al., 1979). Only at the very end of their life span do they lose their contractile capacity (Goldstein et af., 1975; Bell et al., 1979). Because the interaction of human fibroblasts with fibrin is similar to that of platelets, it was suggested that the fibroblast system could be used to study how homeostasis is altered during aging in vivo (Niewiarowski and Goldstein, 1973).

204

A . MACIEIRA-COELHO

It should be pointed out, however, that in some respects, as is apparent from several of the experiments reviewed herein, the modifications observed during senescence of fibroblasts concern rate rather than qualitative changes. Thus, Crusberg et al. (1979) found that although different morphological aspects can be detected during spreading of young and old cells, after a certain lapse of time, both cell types resemble each other in regard to the number of microvilli and blebs.

IV. Mechanisms of Cell Adhesion Without going into the analysis of the specific molecules involved in cell attachment (because for the moment the situation is quite confusing), it can be stated that adhesion of a cell depends on the nature of the chemical bonds created between the membrane and its surroundings; in other words, adhesion depends on electromagnetic interactions taking place between molecules present at the cell surface. These intermolecular forces can range from a weak type (Van der Waals forces) to a strong type (covalent bond). When two atoms come close to each other, the interaction between the positively charged nuclei and the negatively charged electrons will create a distortion or polarization of the atoms and the formation of electric dipoles. The dipoles generate weak intermolecular forces of attraction called the Van der Waals forces. Under these conditions, the electron does not leave the atom and its movement is only disturbed by the proximity of the other atom. Depending on the distance between the atoms and their nature, one electron can leave one atom for another atom and create a positively and negatively charged atom, respectively. This type of bond is called an ionic bond and generates stronger forces of attraction than the Van der Waals forces. Even stronger forces of attraction can be created if an electron is shared by two atoms or more. This type of chemical bond is called a covalent bond. The strength of this type of bond will depend on the numbers of atoms involved and of electrons shared, i.e., on the electronic density (Livage, 1980). According to Curtis (1973), the adherence of a cell to a substratum depends first upon the attractive and repulsive forces between them. The repulsive forces arise from the electrostatic repulsion between identically charged surfaces. The attractive forces involve the Van der Waals forces, which at 100 A are larger than the electrostatic repulsive forces; at this distance, the two surfaces remain in equilibrium. The electric charges come mainly from the carbohydrate fraction of the protruding parts of integral proteins (Fig. 9) and from peripheral proteins associated with them as described in Singer’s fluid mosaic model of membrane structure (Singer and Nicolson, 1972). Calcium can act as a bridging agent to reduce the

CELLULAR AGING

-

205

-+

FIG.9. Schematic cross-sectional view of the lipid globular protein mosaic model of membrane structure. The phospholipids are arranged as a discontinuous bilayer with filled circles representing their ionic and polar heads and thin wavy lines their fatty acid chains. The integral proteins, with the heavy lines representing the folded polypeptide chains, are shown as globular molecules partially embedded in and partially protruding from the membrane. The protruding parts have on their surfaces the ionic residues of the protein, whereas the nonpolar residues are largely in the embedded parts. (From Singer and Nicolson (1972).

electrostatic forces of repulsion (Curtis, 1973). The narrowing of the gap between the surfaces and their binding forces will depend upon the presence of molecules creating the chemical bonds of variable strength described earlier. Concerning the fixation of a cell to a substratum, the nature of the substratum will obviously influence the stability and the strength of the binding forces. I n vivo, basal membranes play the role of substratum, and modifications of their structure contribute to age-related changes of cell adhesion and behavior. Three types of relationships between the same cell and different substrata are illustrated in Fig. 10. In one type a gap remained without any apparent substances binding the plasma membrane to the solid surface; in another type, substances seem to fill the gap; whereas in a third type, there is an intimate contact between the cell and the substratum, with disappearance of the gap in most regions of the cell surface. In addition to the nature of the substratum, the stability of adhesion will be regulated by the rate of energy transformation at the cell surface, the type of molecules secreted by the cell, the rate of turnover of these molecules, and their distribution on the cell membrane. Changes in distribution during aging are apparent from the findings describing displacement of integral proteins (Kelley and Skipper, 1977). Another mechanism that can induce redistribution of membrane components and that could play a role in cellular senescence has been proposed by Jones (1966): through expansion or contraction of the membrane, one type of electric charge could become more or less exposed; this process could explain the decline in net negative surface charge described by Bosmann et al. (1976). Changes in turnover of surface components seem possible because

FIG. 10. Mouse fibroblasts of the L cell line attached to a bovine serum albumin polymer covered with polyglutamic acid (A), and with a low (B) or a high ( C ) concentration of polylysine. The arrows indicate the limits of the solid surface facing the cell membrane. On the negatively charged surface, a gap remains between the cell membrane and the substratum; on the surface less positively charged, substances seem to fill the gap; on the surface more positively charged, there is no gap in most areas of contact with the substratum.

CELLULAR AGING

207

modifications of protein synthesis (Macieira-Coelho and Lima, 1973) and turnover (Bradley et al., 1976) are known to occur in old cells; modifications of the synthesis and secretion of specific surface molecules also take place (see Section II1,A). Furthermore, qualitative changes of macromolecules are suggested by the experiments showing the presence in aging fibroblasts of fibronectin (Chandrasekhar and Millis, 1980) and of collagen (Kontermann and Bayreuther, 1979) with different properties. Finally, the energy available at the surface is also important for cell attachment because the formation of a chemical bond frees energy; and, conversely, the rupture of a bond consumes energy. Because the mobilization of energy in the living cell is obtained through phosphorylation of proteins with the terminal phosphate group of ATP via kinases, the rate of synthesis of the latter will also regulate adhesion. In fact, kinases have been found to be responsible for variations in cell attachment and the expression of different phenotypes (Erikson et al., 1979). Hence, one can infer that changes in energy-supporting mechanisms during aging must also be responsible for the deficient adhesion. This is an area that, surprisingly, is virtually unexplored in cellular senescence. Other structures that are fundamental to cell attachment and morphology and that are also highly dependent on phosphorylation for the supply of energy are the different components of what is generally called the cytoskeleton. The integrity of these labile structures is not only important for the mobility of the membrane as a whole but also for the fluidity of its constituents. In regard to morphology there is a strong correlation between cell shape, surface extensions, and the distribution of microtubules and microfilaments (Brandes er al., 1972). Because they are spread throughout the cytoplasm, they must act as integrators, not only of space, but also of function within the cell, and changes in their organization must have repercussions at different cellular levels.

V. Relationship between Cell-Substratum Adhesion and Function It is hardly necessary to emphasize the role that the changes in the cell membrane described so far may play in aging. The membrane constitutes a protection for the cell; it is the filter through which all information flows in and out. Its integrity is important for cell-to-cell communication, and because it is the site of different types of receptors, it is fundamental for the activity of hormones and of growth control substances, for the transport of nutrients, and for the different aspects of the immune response. There is a role, however, of the cell membrane that has repercussions on cell behavior; the importance of this role has been emphasized recently, and it has many implications for aging. This role involves attachment to a substratum. Indeed, attachment is important in situations like wound healing and tissue

208

A. MACIEIRA-COELHO

regeneration; it will influence coagulation through the capacity to retract a fibrin clot; it can be a determinant for atherosclerosis through adhesion of platelets to vessel walls; and finally, to mention just a few examples, through variations in the adhesion to other cells or to different substrata, it can create conditions for the development of hyperplasia and even neoplasia. Furthermore, attachment to a substratum determines cell topology, and experiments performed in tissue culture have emphasized the profound influence of cell attachment to a substratum on cell functions, apparently through changes in topology. These experiments, although not performed with the aim of studying aging, will be reviewed here because they are fundamental to the understanding of cell behavior; they enable us to see the implications for aging of some of the changes reviewed earlier and to formulate a hypothesis explaining the mutual influences between the center and the periphery, i.e., between the genome and the external membrane. A. MOVEMENT One function that was found to be influenced by the affinity to the substratum is the movement of cells. This was done in very elegant studies by Carter (1967), who found that a nonadhesive surface could be rendered suitable for cell attachment after being sprayed with palladium. Changing the concentration of the metal changed the adherence of cells and showed that cells tend to migrate to the areas with which they have a higher affinity. This property was called haptotaxis.

B. DIVISION The control of cell division through cell substratum interactions is another aspect of cell behavior that has been extensively studied. Analysis of the transformation of fibroblasts by oncogenic viruses showed that normal cells need to be attached. to a solid surface to enter division (McPherson and Montagnier, 1964), i.e., they are anchorage dependent (Stoker et al., 1968). In addition, there is a threshold for the dimension of the area of attachment-below a certain size, growth will not take place (Stoker et al., 1968). On the other hand, it was shown that contact inhibition of cell division in fibroblastic cultures depends on the affinity of the cells toward the substratum and the neighboring cells (Macieira-Coelho, 1967). This observation led to the development of a substratum for the subcultivation of cells, a substratum made of protein polymers that could be covered with substances with different physicochemical properties (MacieiraCoelho and Avrameas, 1972). Cell attachment and spreading on these surfaces could be modulated according to the electric charge of the solid surface (Fig. 11); growth on such substrata was also influenced by the electrical charge (Fig. 12).

CELLULAR AGING

209

FIG. I I . Mouse fibroblasts from the L cell line seeded on a bovine serum albumin polymer covered with polyglutamic acid (A) and with polylysine ( B ) . From Macieira-Coelho and Avrameas (1972).

These experiments led to the conclusion that contact inhibition of cell division is substratum dependent (Macieira-Coelho and Avrameas, 1972). Pertinent to the understanding of the relationship between attachment and function was the finding that this substratum modulates cell division exclusively through a mechanical effect at the level of the cell membrane and of the associated structures (Macieira-Coelho et al., 1974); indeed, substances bound to the substratum and influencing cell behavior could be either dextrorotary or levorotary; they did not enter the cell; when bound to the polymer, they lost their capacity to influence cell metabolism and ceased to be mitogenic. It was demonstrated that cells have different stringencies for the relation between cell morphology and growth. Whereas some cell populations can grow regardless of the round or spread-out morphology, other cells can grow only on surfaces that induce a flattening of the cell (Macieira-Coelho et af., 1974). The extent of flattening needed to enter the division cycle seems to be controlled in normal cells by a protein component of the cell surface (Mallucci and Wells, 1979). Excessive flattening of the cell by this protein prevents the entrance into the DNA synthesis cycle and into mitosis and involves a transmembrane cooperation between the protein at the cell surface, integral proteins of the membrane, and contractile cytoplasmic organelles (Wells and Mallucci,

210

A. MACIEIRA-COELHO

PLASI IC

ti I S T ONE S

POLVLVSINE

EAE D E X T R A N

POLV ,LUTAMlC ACID

HEPARIN

\' I

10 8 6 2

= 0

4 3

?. - 2

L-7

6.7 I

-4

p[ I

f

I

,

L

I

I I

\

k-.

7

I

I I

\,

I

I

c - e

I

I

I I

I

I 1

\

I

I

II

,

\

L-.

I

i P

I 2 3 4

I 2 3 4

--- 1 2 3 4

I 2 3 4

I

2

3

I

2

3

DAYS AFTER SUBCULTIVATION

FIG. 12. Growth curves (0-0) and DNA synthesis (0-- -0)of L cell cultures growing on plastic and on an albumin polymer covered with the substances indicated in the figure. DNA synthesis was evaluated from the cell-bound acid-precipitable radioactivity after 30 minutes labeling with [3H]thymidine. Cell growth was considerably reduced on the surfaces covered with negatively charged substances. From Macieira-Coelho and Avrameas (1972).

1978). This finding is particularly important for the interpretation of the changes taking place in the old cell, as will be described in Section VI. Additional evidence for the relationship between morphology and cell division came from the work of Folkman and Moscona (1978), who found that the adhesiveness of cells to polystyrene can be reduced by increasing concentrations of poly(2-hydroxyethylmethacrylate). They could thus establish a close relationship between cell spreading and the initiation of DNA synthesis, a finding that is in agreement with the minimal area of attachment needed to support growth (Stoker et al., 1968). Other workers (Iwig et af., 1981) used the contraction of a collagen gel by epithelial lens cells to study this relationship. When the gel was loosened from the bottom of the culture vessel, it was contracted by the cells, which became more spheroid. During this process, a decline of uridine and thymidine incorporation could be observed. The effect of cell attachment on cell metabolism preceding the initiation of the division cycle was studied by Otsuka and Moskowitz (1975a,b). They found a

CELLULAR AGING

21 1

correlation between uptake of leucine and conditions that stimulate cell multiplication. Subconfluent cells attached to a substratum take up leucine through a transport system that has a high affinity for leucine. In cells suspended from subconfluent cultures, this transport system is gradually turned off. When cell growth is initiated by subculturing cells from suspension culture to monolayer culture, there is a marked increase in leucine uptake. Further studies on the effect of cell attachment on cell metabolism before initiation of DNA synthesis were performed by Ben-Ze’ev et al. (1980), using the system developed by Folkman and Moscona. They established that protein synthesis increases immediately after cell attachment and does not require extensive cell spreading. Nuclear events, however, such as mRNA, rRNA, and DNA synthesis, require extensive cell spreading. C. DIFFERENTIATION

Another aspect of cell behavior that has been studied in regard to cell morphology is that of cell differentiation. Emmerman et al. (1977) found that only cuboidal-shaped mammary epithelial cells cultivated on floating collagen gels showed biochemical differentiation; on other surfaces, on which the same cells had a flattened shape, there was little differentiation. Wahrmann et al. (1981) cultivated rat myoblasts on surfaces covered with different electrical charges. They observed that on negatively charged surfaces (on which the cells tend to retract) there was formation of myotubes and active myosin synthesis; on positively charged surfaces, on the contrary (on which myoblasts adhere more firmly and remain spread), there was no formation of myotubes and myosin synthesis stopped early. Although the electrical charge of the substratum seems to be fundamental for cell differentiation through its action on cell adhesiveness, the same substratum can act differently, depending on the cell type. Thus, differentiation of pituitary cells into myotubes will take place only on surfaces rendered positively charged by polylysine (Brunner and Tschank, 1982). Another observation that is relevant for the aging models described herein is the enlargement of keratinocytes before terminal differentiation. Watt and Green ( 1982) showed with cultured epidermal cells that the enlargement is accompanied by a decrease in substratum adhesiveness; a signal associated with increased cell size was considered possible. D. MALIGNANCY

An even more intriguing aspect of cell adhesiveness is its influence on malignancy. Experiments done with different types of cells have shown that the acquisition of the capacity to grow attached to a substratum can be associated with the loss of malignancy (Macieira-Coelho and Avrameas, 1973; Hochman et

212

A. MACIEIRA-COELHO

al., 1981) and that changes in cell configuration are related to the reversion of the transformed phenotype (Brouty-Boy6 et al., 1979; Brouty-Boy6 and Gresser, 1981). From all these examples, it is obvious that, if certain aspects of cell behavior such as motility, division, differentiation, and malignancy depend to such an extent upon cell attachment and subsequently on cell morphology, at least some of the cellular events occurring during aging must be related to the changes in size and morphology that are regularly observed. In brief, these experiments show that cells have to be anchored to a surface of a certain size to perform some functions. The relative binding force to the surrounding surface will regulate movement, differentiation, and division through an effect on cell metabolism. The action of the binding force on cell metabolism is indirect, of a mechanical type, and probably occurs through regulation of cell topology favorable for the respective functions. In the following section we will consider how events at the periphery could modify nuclear events and, in turn, cell functions, why they should be associated with variations in morphology, and their implications for cellular aging.

VI. Putative Mechanisms for Membrane-Dependent Manifestations of Aging From the experiments reviewed in the preceding sections, it seems that among the manifestations of cellular aging changes in cell volume, adhesion, motility, and morphology accompany quite closely the decline of growth potential. The old cell becomes immobile, overstretched and less able to divide (Fig. 13). The decline of membrane movements will render pinocytosis more difficult and hence handicap the uptake of nutrients. Other types of transport are also affected, as mentioned in Section III,C. On the other hand, changes in the mobilization of receptors and redistribution of other cell surface components will disturb the attachment of different ligands, inter alia of growth factors. Many of the modifications occurring in the membrane and in its associated structures must be caused by the genome rearrangements that occur during cell division (Macieira-Coelho, 1980), but the changes at the periphery must then be the cause of other modifications. How can the dysfunction of the plasma membrane feed back on gene activity? In other words, how can the information flow from the membrane, influence the genetic expression, and cause the decline of growth? As suggested by Puck (1977), the cytoskeleton could be the link through which flows (to some extent) the growth-regulatory information from the membrane by a process that has been named membrane impression (Brunner, 1977). Several experiments suggest that the initiation of DNA synthesis is coupled with microtubule polymerization and depolymerization. Drugs, like colchicine,

CELLULAR AGING

213

FIG. 13. Human embryonic lung fibroblasts in phase 11 (A) and phase IV (B). For the definition of the two phases, see Section I.

214

A . MACIEIRA-COELHO

that cause microtubule disruption stimulate DNA synthesis. Conversely, drugs that stabilize cytoplasmic microtubules inhibit the stimulation of DNA synthesis by growth factors in anchorage-dependent cells (Crossin and Carney, 1981). Not all drugs that change cell morphology via the cytoskeleton stimulate division; such is the case of cytochalasin B (Crossin and Carney, 1981). Because this drug is known to trigger nuclear expulsion from the cytoplasm, it is possible that the disruption of the relationship between the nucleus and the rest of the cell inhibits the initiation of the cell cycle. Indeed, the integrity of the elements composing the cytoskeleton (microfilaments, intermediary filaments, and microtubules) could be necessary for the maintenance of nuclear movements, which in many cases seem to be strictly related with the accomplishment of cellular functions. All sorts of nuclear movements have been described:.nuclear rotation, for instance, with clockwise and counterclockwise movements, is a well-known phenomenon; irregularities of the nuclear membrane can be observed in cells showing amoeboid movement; and rapid twitching movements, which could provide a pump system for nucleocytoplasmic exchanges, have also been reported (Pomerat, 1958). In addition, it is known that DNA synthesis is accompanied by nuclear swelling (Merriam, 1969) and that in human fibroblasts stimulated to proliferate there are changes in the nuclear space (Belmont et al., 1980). These movements could depend not only on the flexibility of the nuclear cage but also on the tension and relaxation of the different elements of the cytoskeleton, movements that may in this way transmit plasma membrane movements to the nucleus and couple cell and nuclear geometry (Belmont et al., 1980). These phenomena may be implicated in the requirement of a critical mass for the commencement of DNA synthesis (Zetterberg, 1970). On the other hand, it has been suggested (Berezney and Coffey, 1977) that changes in the organization of the nuclear matrix are coupled with nuclear functioning; and, indeed, differences in nuclear morphology that followed differences in cell function were found to relate closely to alterations in chromatin structures (Nicolini, 1979). This is not surprising in the presence of the increasing amount of evidence showing that the matrix is the site of anchorage of DNA-not only DNA synthesis initiation sites seem to be fixed on the matrix (Berezney and Buchholtz, 1981) but also satellite DNA (Matsumoto, 1981). Even the activation of genes could be dependent on attachment to the nuclear cage (Jackson and Cook, 1982). Thus, it is possible that nuclear movements are necessary not only for nucleocytoplasmic exchanges but also for genome activity through modulation of chromatin conformation. In regard to DNA synthesis, the steric position of initiating sites could be crucial for entrance into the S period, too much stretching or, conversely, contraction of nuclear structures may lead to the arrest of cell division. Excessive stretching is found in cellular senescence, arld contraction takes place during contact inhibition of division. In both instances, the probability of the chromatin structure to meet the right conformation

CELLULAR AGING

215

and of DNA synthesis initiation sites the right steric position would be low and could decrease the probability of entering the cell cycle. Conversely, rapid movements will increase the probability for the initiation sites to reach the configuration favorable for DNA synthesis. Hence, it seems that external as well as internal cellular movements are coupled with functions. In the cytoplasm, the function of the different organelles and uptake and excretion are obviously strictly dependent on the lability of the framework supporting the internal space. In the nucleus, because chromatin needs to be anchored to the nuclear cage, it is reasonable to assume that its activity must also depend on the plasticity of the internal framework. Concerning specifically the model of aging dealt with in this article, profound changes have been found in the nuclei and in chromatin that accompany the evolution of cell morphology. The nuclei enlarge like the rest of the cell (Fig. 13) and under electron microscopy they look lobulated. Chromatin becomes decondensed (Brock and Hay, 1977) and chromatin threads are spaced and shorter (Puvion-Dutilleul and Macieira-Coelho, 1982). The changes in the membrane and the associated structures that are responsible for the tension of the cellular scaffolding must cause the stretching of the cell. The repercussions on the nuclear cage could accentuate the decondensation of chromatin, interfere with genome expression, decrease the probability of entering the division cycle, and switch cell activity to other functions.

VII. Conclusions Motion and function are interdependent in a cell through the tension in a network of structures that extend from the periphery to the nuclear cage and that constitute a cellular scaffolding. The function of this network is regulated through the synthesis of molecules with the right steric configuration and through energy turnover! In the cell systems described herein, adhesion to a substratum is the trigger to build up tension. Cell behavior is determined by the way in which this network of structures is connected, i.e., by its topology, not by its particular shape and size. Mobility is closely linked with cell division; in the absence of movements, there is a shift from division to other functions. At the plasma membrane level, events such as cell migration, phagocytosis, pinocytosis, exocytosis, ligand-receptor interactions, transport, and cell-to-cell communication are examples of movement-dependent functions. These displacements at the cell surface are transmitted within the cell through the lability of the components of the cytoskeleton, which play the role of integrators of space and function, and which influence, inter alia, movement of organelles and molecules inside the cell and genome expression.

216

A. MACIEIRA-COELHO

During fibroblast senescence, events at the level of the membrane that lead to change in surface charge start early during the life span of the population; they could be responsible for the increasing retardation of the initiation of cell division through a delay in cell adhesion. One of the early manifestations of cellular senescence is an increase in membrane surface area and cell mass. It coincides with cell cycle and metabolic events and could be correlated with disturbances of protein uptake. A larger surface area and a disorganization of the systems linking the elements of the membrane with the cytoskeleton seem responsible for many manifestations of membrane aging such as displacement of integral proteins, response to different ligands, lack of metabolic cooperation between cells, and deficient focal adhesion sites. The deficiency in focal adhesion sites must also be caused by the absence of fibronectin at the cell surface, an absence probably due both to changes in this molecule and to disturbances in the synthesis of proteoglycans and collagen, which help to anchor fibronectin. These changes and the disorganization of the elements of the cytoskeleton lead to lack of tension and mobility of the cellular scaffolding. At the very end of the cell life span, the old cell becomes overstretched and immobile. This overstretching could contribute to the decondensation of chromatin. During this final stage of the cell life span, some distinct membrane events occur and are accompanied by a profound disorganization of proliferation. The genome rearrangements taking place at each cell division (MacieiraCoelho, 1980) could be the primum rnovens for t h e modifications occurring in the network of structures responsible for tension and movement, through variations in the synthesis of its components and of those of the energy-supplying systems. The events at the membrane level during aging are an expression of what takes place throughout the flexible network. Cellular senescence appears as a complex interaction of the differeht cellular constituents whose changes will progressively reflect on each of the other functions; it does not seem to be just a deterioration of cellular activity because the synthesis of some substances decreases and that of others increases; also, it does not seem to be an accumulation of errors, because all attempts to find them failed to provide convincing evidence that they are present. Aging at a cellular level seems rather to be a problem of coordination; at this level a change in the delicate balance between motion and function seems to play an important role. Is this a degenerative process or a programed sequence leading to differentiation? Phase 1V cells can be kept for long periods of time; they remain metabolically active and their chromatin transcribes (Puvion-Dutilleul and MacieiraCoelho, 1982). This finding has been interpreted as support for the concept of a terminal differentiation (Bell et al., 1978). No firm proof has been presented so far favoring one or the other hypothesis. Although there is still no answer to the question, progress is being made in understanding the basic mechanisms creating

CELLULAR AGING

217

the changes and how the different events relate to each other. The findings have implications for other fields of cell biology.

REFERENCES Absher, P. M., and Absher, R. G. (1976). Exp. Cell Res. 103, 247-255. Aizawa, S., and Kurimoto, F. (1979a). Mech. Ageing Dev. 11, 237-243. Aizawa, S., and Kurirnoto, F. (1979b). Mech. Ageing Dev. 11, 245-252. Aizawa, S., and Mitsui, Y. (1979). J . Cell. Physiol. 100, 383-387. Aizawa, S., and Mitsui, Y. (1982). Exp. Cell Res. 139, 416-419. Aizawa, S., Mitsui, Y., Kurimoto, F., and Matsuoka, K. (1980a). Exp. Cell Res. 125, 297-303. Aizawa, S., Mitsui, Y., Kurimoto, F., and Matsuoka, K. (1980b). Mech. Ageing Dev. 13, 297-306. Aizawa, S., Mitsui, Y., Kurimoto, F., and Nomura, K. (1980~).Exp. Cell Res. 127, 143-157. Anderson, P. J. (1978). Biochem. J . 169, 169-172. Aubery, M., Guillouzo, A., Bernard, B., and Font, J. (1980). Exp. Cell Res. 129, 273-280. Azencott, R., and Courtois, Y. (1974). Exp. Cell Res. 86, 69-74. Bell, E., Marek, L. F., Levinstone, D. S., Merrill, C., Sher, S., Young, I. T., andEden, M. (1978). Science 202, 1158-1163. Bell, E., Ivarson, B., and Merrill, C. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 1274-1278. Belrnont, A. S . , Kendall, F. M., and Nicolini, C. A. (1980). CellBiophys. 2, 165-175. BeMiller, P. M., and Miller, J. E. (1979). Mech. Ageing Dev. 10, 1-15. BeMiller, P. M., and Miller, J. E. (1981). Age 4, 97-107. BeMiller, P. M., Lee, S. C., BeMiller, J. N., and Pappelis, A. J. (1981). Mech. Ageing Dev. 15, 349-354. Ben-Ze'ev, A., Farmer, S . R., and Penman, S. (1980). Cell 21, 365-372. Berezney, R . , and Buchholtz, L. A. (1981). Exp. Cell Res. 132, 1-13. Berezney, R., and Coffey, D. S . (1977). J . Cell B i d . 73, 616-637. Bernard, B., Font, J., Aubery, M., Baffet, G., and Guillouzo, A. (1982). Mech. Ageing Dev. 19, 211-216. Berumen, L., and Macieira-Coelho, A. (1977). Mech. Ageing Dev. 6, 165-172. Bhargava, G., Rifds, L., and Makman, M. H. (1979). J . Cell. Physiol. 100, 365-374. Bierman, E. L. (1978). I n Virro 14, 951-955. Bierman, E. L., Albers, J. J . , and Chait, A. (1979). J. Geronrol. 34, 483-488. Blomquist, E., Arro, E., Brunk, U.,and Westerrnark, B. (1978). Acru Pathol. Microhiol. Scund. 86, 257-263. Bosmann, H. B., Gutheil, R. L., Jr., and Case, K. R. (1976). Nature (London) 261, 499-501. Bowman, P. D., and Daniel, C. W. (1975). Mech. Ageing Dev. 4, 147-158. Bowman, P. D., 'Meek, R. L., and Daniel, C. W. (1975). Exp. Cell Res. 93, 184-190. Bradley, M. O., Hayflick, L., and Schimke, R. T. (1976). J . Biol. Chem. 251, 3521-3529. Brandes, D., Murphy, D. G . , Anton, E. B., and Barnard, S . (1972). J. Ultrustruct. Res. 39, 465-483. Brautbar, C., Payne, R., and Hayflick, L. (1972). Exp. Cell Res. 75, 31-38. Brautbar, C., Pellegrino, M. A , , Ferrone, S., Reisfeld, R. A , , Payne, R., and Hayflick, L. (1973). Exp. Cell Res. 78, 367-375. Brock, M. A,, and Hay, R. J. (1971). J. Ultrastruct. Res. 36, 291-302. Brouty-BoyC, D., and Gresser, I. (1981). Inr. J . Cancer 28, 165-173. Brouty-BoyC, D., Gresser, I., and Baldwin, C. (1979). Int. J . Cancer 24, 253-260.

218

A. MACIEIRA-COELHO

Brunner, G. (1977). Differentiation 8, 123-132. Brunner, G., and Tschank, G. (1982). Cell Tissue Res. 224, 655-662. Camicero, H. H., Englard, S., and Seifter, S. (1982). Arch. Eiochem. Eiophys. 215, 78-88. Carter, S . B. (1967). Nature (London) 213, 256-260. Chandrasekhar, S., and Millis, A. T. J. (1980). J . Cell. Physiol. 103, 47-54. Collins, V. P., Arro, E., Blomquist, E., Brunk, U., Fredriksson, B. A,, and Westermark, B. (1979). Scanning Electron Microsc. 111, 41 1-420. Courtois, Y., and Hughes, R. C. (1974). Eur. J. Eiochem. 44, 131-138. Courtois, Y., and Hughes, R. C. (1976). Gerontology 22, 371-379. Cremer, T., Werdan, A. F. G., Stevenson, K., Lehner, K., and Messerschmidt, 0. (1981). J . Cell. Physiol. 106, 99-108. Cristofalo, V. J. (1970). In “Aging in Cell and Tissue Culture” (E. Holeckova and V. J. Cristofalo, eds.), pp. 83-1 19. Plenum, New York. Crossin, K. L., and Carney, D. H. (1981). Cell 23, 61-71. Crusberg, T. C., Hoskins, B. B., and Widdus, R. (1979). Exp. CellRes. 118, 39-46. Curtis, A. S. G. (1973). Prog. Eiophys. Mol. Eiol. 27, 317-386. Ebeling, A. H. (1921). J . Exp. Med. 34, 231-242. Emerman, J., Enami, J., Pitelka, D. R., and Nandi, S . (1977). Proc. Natl. Acad. Sci. U.S.A. 74, 4466-4470. Erikson, R. L., Collett, M. S . , Erikson, E., and Purchio, A. F. (1979). Proc. Narl. Acad. Sci. U.S. A. 76, 6260-6264. Folkman, J., and Moscona, A. (1978). Nature (London) 273, 345-349. Fry, M., and Weisman-Shomer, P. (1977). CellEiol. In!. Rep. 1, 399-407. Fujiwara, Y., Higashikawa, T., and Tatsumi, M. (1977). J . Cell. Physiol. 92, 365-374. Germinario, R. J., Oliveira, M., and Taylor, M. (1980). Gerontology 26, 181-187. Goldstein, S., and Singal, D. P. (1972). Exp. Cell Res. 75, 278-282. Goldstein, S., and Singal, D. P. (1974). Nature (London) 251, 719-721. Goldstein, S., Lin, C. C., and Singal, D. P. (1974). Exp. Cell Res. 89, 451-454. Goldstein, S., Niewiarowski, S., andsingal, D. P. (1975). Fed. Proc. Fed. Am. Soc. Exp. Eiol. 34, 56-63. Goldstein, S., Moerman, E. J . , Soeldner, J. S., Gleason, R. E., and Barnett, D. M. (1978). Science 199, 781-783. Greenberg, S. B., Grove, G. L., and Cristofalo, V. J. (1977). In Vitro 13, 297-300. Haslam, R. I., and Goldstein, S. (1974). Eiochem. J . 144, 253-263. Hayflick, L. (1965). Exp. Cell Res. 37, 614-636. Hayflick, L., and Moorhead, P. S. (1961). Exp. CellRes. 25, 585-621. Hedman, K., Johansson, S., Vartio, T., Kjellin, L , Vaheri, A , , and Hook, M. (1982). Cell 28, 663-67 1. Hochman, J., Katz, A., Levy, E., and Eshel, S. (1981). Nature (London) 290, 248-249. Hollenberg, M. D., and Schneider, E. L. (1979). Mech. Ageing Dev. 11, 37-43. Holliday, R., and Tarrant, G.M. (1972). Nature (London) 238, 26-30. Holliday, R., Porterfield, J. S . , and Gibbs, D. D. (1974). Nature (London) 248, 762-763. Iwig, M., Glaesser, D., and Bethge, M. (1981). Exp. Cell Res. 131, 47-55. Jackson, D. A., and Cook, P. R. (1982). B i d . Cell. 45, 334. Jones, P. C. T. (1966). N a m e (London) 212, 365-369. Kalimi, M., and Seifter, S. (1979). Biochirn. Eiophys. Acta 583, 352-359. Kapp, L. N., and Klevecz, R. R. (1976). Exp. Cell Res. 101, 154-158. Kelley, R. O., and Perdue, B. D. (1980). Exp. Gerontol. 15, 407-421. Kelley, R. 0 . . and Skipper, B. E. (1977). J . Ulrraswuct. Res. 59, 113-1 18. Kelley, R. 0.. Azad, R., and Vogel, K. G . (1978). Mech. Ageing Dev. 8, 203-217.

CELLULAR AGING

219

Kelley, R. O., Vogel, K. G., Crissman, H. A., Leipan, C. J . , and Skipper, B. E. (1979). Exp. Cell Res. 119, 127-143. Kelley, R. O., Trotter, J . A., Marek, L. F., Perdue, B. D., and Taylor, C. B. (1980). Mech. Ageing Dev. 13, 127-141. Konterrnann, K., and Bayreuther, K. (1979). Gerontology 25, 261-274. Larnberigts, G . , Dierickx, P., De Moor, P., and Verhoeven, G. (1979). J. Clin. Endocrinol. Metab. 48, 924-930. Lee, S. C . , BeMiller, P. M., BeMiller, J . N., and Pappelis, A. J . (1978). Mech. Ageing Dev. 7, 4 17-424. Lee, H. C., Paz, M. A., and Gallop, P. M. (1982). J. Biol. Chem. 257, 8912-8918. Le Guilly, Y., Simon, M., Lenoir, P., and Bourel, M. (1973). Gerontologia 19, 303-313. Lima, L., and Macieira-Coelho, A. (1972). Exp. Cell Res. 70, 279-284. Littlefield, J . W. (1973). J . Cell. Physiol. 82, 129-132. Livage, J . (1980). Recherche 11, 1272-1281. Macieira-Coelho, A. (1966). Experienfia 22, 390-391. Macieira-Coelho, A. (1967). Inr. J. Cancer 2, 297-303. Macieira-Coelho, A. (1970). In “Aging in Cell and Tissue Culture” (E. Holeckova and V. J . Cristofalo, eds.), pp. 121-132. Plenum, New York. Macieira-Coelho, A. (1977). Mech Ageing Dev. 6, 341-343. Macieira-Coelho. A. (1980). Geronfology 26, 276-282. Macieira-Coelho, A , , and Avrameas, S. (1972). Proc. Natl. Acad. Sci. U.S.A. 69, 2469-2473. Macieira-Coelho, A,, and Avrarneas, S. (1973). In “Tissue Culture: Methods and Applications” (P. F. Kruse and M. K. Patterson, Jr., eds.), pp. 379-383. Academic Press, New York. Macieira-Coelho, A., and Azzarone, B. (1982). Exp. Cell Res. 141, 325-332. Macieira-Coelho, A,, and Lima, L. (1973). Mech. Ageing Dev. 2, 13-18. Macieira-Coelho, A,, and PontCn, I. (1969). J. Cell B i d . 43, 374-377. Macieira-Coelho, A,, and Taboury, F. (1982). Cell Tissue Kinet. 15, 213-224. Macieira-Coelho, A,, PontCn, J . , and Philison, L. (1966). Exp. Cell Res. 42, 673-684. Macieira-Coelho, A,, Berumen, L., and Avrameas, S. (1974). J. Cell. Physiol. 83, 379-388. Macieira-Coelho, A,, Diatloff, C., Billard, M., Fertil, B., Malaise, E., and Fries, D. (1978). J. Cell. Physiol. 95, 235-238. Macieira-Coelho, A,, Bengtsson, A,, and Van der Ploeg, M. (1982). Histochemistry 75, 11-24, MacPherson, I . , and Montagnier, L. (1964). Virology 23, 291-294. Mallucci, L., and Wells, V. (1979). In “Advances in Medical Oncology, Research and Education” (M. Fox, ed.), Vol. 4, pp. 125-131. Pergamon, Oxford. Martin, G. M., Sprague, C. A,, and Epstein, C. J . (1970). Lab. Invest. 23, 86-92. Martin, G. M., Sprague, C. A , , Norwood, T. H . , and Pendergrass, W. R. (1974). Am. J . Pathol. 74, 137-154. Matsumoto, L. H. (1981). Nature (London) 294, 481-482. Matuoka, K., and Mitsui, Y. (1981). Cell Struct. Funct. 6, 23-33. Merriam, R. W. (1969). J. Cell Sci. 5, 333-349. Miggiano, V. C . , Nabholtz, M., and Bodmer, W. C. (1970). “Histocompatibility Testing.” Munksgaard, Copenhagen. Milo, G . E. (1973). Exp. Cell Res. 79, 143-151. Milo, G. E., and Hart, R. W. (1976). Arch. Biochem. Biophys. 176, 324-333. Mitsui, Y . , and Schneider, E. L. (1976a). Mech. Ageing Dev. 5, 45-56. Mitsui, Y . , and Schneider, E. L. (1976b). Exp. Cell Res. 103, 23-30. Moley, J . , and Engelhardt, D. L. (1981). J. Gerontol. 36, 136-141. Muggleton-Harris. A. L., Reisert, P. S., and Burghoff, R. L. (1982). Mech. Ageing Dev. 19,37-43. Nicolini, C . (1979). In “Chromatin Structure and Function” (C. Nicolini, ed.), Part B. pp. 613-667. Plenum, New York.

220

A. MACIEIRA-COELHO

Niewiarowski, S., and Goldstein, S. (1973). J . Lab. Clin. Med. 82, 605-610. Otsuka, H., and Moskowitz, M. (1975a). J. Cell. Physiol. 85, 665-674. Otsuka, H., and Moskowitz, M. (1975b). J . Cell. Physiol. 86, 379-388. Packer, L., Deamer, D. W., and Heath, R. L. (1967). In “Advances in Gerontological Research” (B. L. Strehler, ed.), Vol. 2, pp. 77-120. Academic Press, New York. Petes, T.D., Farber, R. A,, Tarrant, G. M., and Holliday, R. (1974). Nature (London) 251, 434-436. Pinto da Silva, P., Kachar, B., Torrisi, M. R., Brown, C., and Parkison, C. (1981). Science 213, 230-233. Polgar, P., Taylor, L., and Brown, L. (1978). Mech. Ageing Dev. 7, 151-160. Pomerat, C. (1958). Fed. Proc. Fed. Am. Soc. Exp. Biol. 17, 975-984. Press, G. D., and Pitha, I. (1974). Mech. Ageing Dev. 3, 323-328. Puck, T. T. (1977). Proc. Narl. Acud. Sci. U.S.A. 74, 4491-4495. Puvion-Dutilleul, F., and Macieira-Coelho, A. (1982). Exp. Cell Res. 138, 423-429. Rattan, S. 1. S., Keeler, K. D., Buchanan, J . H., andHolliday, R. (1982). Biosci. Rep. 2,561-567. Rheinwald, J. G. (1979). Int. Rev. Cyrol. Suppl. 10, 25-33. Robert, L. (1975). In “Mammalian Cell Membranes” (G. A. Jamieson and D. M. Robinson, eds.), Vol. 5, pp. 220-259. Butterworths, London. Rohme, D. (1981). Mech. Ageing Dev. 16, 241-253. Rosenbloom, A. L., Goldstein, S., and Yip, C. C. (1976). Science 193, 412-415. Rosner, B. A., and Cristofalo, V. J. (1979). Mech. Ageing Dev. 9, 485-496. Salk, D., Bryant, E., Au, K., Hoehn, H., and Martin, G. M. (1981). Hum. Genet. 58, 310-316. Sasportes, M., Dehay, C., and Fellous, M. (1971). Nature (London) 233, 332-334. Schachtschabel, D. 0.. and Wever, I. (1978). Mech. Ageing Dev. 8, 257-264. Schneider, E. L., and Mitsui, Y. (1976). Proc. Nail. Arud. Sci. U.S.A. 73, 3584-3588. Simons, J . W. I. M. (1967). Exp. Cell Res. 45, 336-350. Simons, J. W. 1. M., and van den Broeck, C. (1970). Gerontologia 16, 340-351. Singal, D. P., and Goldstein, G. (1973). J. Clin. Invest. 52, 2259-2263. Singer, S. J . , and Nicolson, G. L. (1972). Science 175, 720-731. Sluke, G., Schachtschabel, D. O., and Wever, J . (1981). Mech. Ageing Dev. 16, 19-27. Spataro, A. C., Bosmann, H. B., and Myers-Robfogel, M. W. (1979). Biochim. Biophys. Acta 553, 378-387. Stoker, M. G. P., O’Neil, C., Benyman, S., and Waxman, V. (1968). Int. J. Cancer 3, 683-693. Sugarman, B., and Munro, H. N. (1980). Life Sci. 26, 915-920. Swim, H. E., and Parker, R. F. (1957). Am. J . Hyg. 66, 235-243. Tassin, J., Malaise, E., and Courtois, Y. (1979). Exp. Cell Res. 123, 388-392. Van Gansen, P., Devos, L., Ozoran, Y., and Roseburgh, C. (1979). Biol. Cell. 34, 255-270. Virtanen, I., Vartio, T., Badley, R. A., and Lehto, V. P. (1982). Nature (London) 298, 660-663. Vogel, K. G . , Kendall, V. F., and Sapien, R. E. (1981a). J. Cell. Physiol. 107, 271-281. Vogel, K. G., Kelley, R. 0.. and Stewart, C. (1981b). Mech. Ageing Dev. 16, 295-302. Wahrmann, J. P., Delain, D., Bournoutian, C . , and Macieira-Coelho, A. (1981). In Vitro 17, 752-762. Walford, R. L., Janawald, S. Q., and Naeim, E. (1981). Age 4, 67-71. Watt, F. M., and Green, H. (1982). Nature (London) 295, 434-436. Weismann, A. (1889). “Essays upon Heredity and Kindred Biological Problems,” Vol. 1. Clarendon, Oxford. Wells, V., and Mallucci, L. (1978). Exp. Cell Res. 116, 301-312. Wever, J., Schachtschabel, D. O., Sluke, G . , and Wever, G. (1980). Mech. Ageing Dev. 14,89-99. Whatley, S. A., and Hill, B. T. (1979). Cell Biol. Inr. Rep. 3, 671-683. Yamamoto, K., Yamamoto, M., and Ooka, H. (1977). Exp. Cell Res. 108, 87-93. Zetterberg, A. (1970). Adv. Cell Biol. 1, 21 1-232.

INTERNATIONAL REVIEW OF CYTOLOGY, VOL. 83

Retinal Pigment Epithelium: Proliferation and Differentiation during Development and Regeneration OLGAG . STROEVA AND VICTORI. MITASHOV N. K . Koltzov Institute of Developmentul Biology, Academy of Sciences of the USSR, Moscow, USSR I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

22 1

11. Cell Proliferation in Growth and Differentiation of the Retina

Pigment Epithelium in High Vertebrates and Humans . . . . . . . . . . . . A. Differentiation and Proliferation of the Rat Retinal Pigment

........................... Epithelium . . . . . . . . . . . . . Differentiation and Prolifer Epithelium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. Conclusions ......................... 111. Proliferation of Pigmen ells in the Amphibian Retina Lens Regeneration. . . . . . . . . . A. Regeneration of the Neural Retina . . . . . . . . . . . . . . . . . . . . . . . . B. Regeneration of the Lens.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Comparison of the Characteristics of Eye Cell Proliferation during Retina and Lens Regeneration in Newts.. . . . . . . . . . . . . D. Changes in Specific Syntheses during Eye Regeneration . . . . . . IV. General Conclusions ......................... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

223 223 247

C.

259 262 263 264 275 281 283 285 287

I. Introduction The retinal pigment epithelium (RPE) is a pigmented monolayer of hexagonal cells of neural origin located between the neural retina and the choroid. The RPE is one of the most important structures in the visual system owing to the role it plays in viability and function of the neural retina. In spite of its rather simple structure, the RPE fulfils various physical and metabolic functions, which are summarized in Table I (Zinn and Benjamin-Henkind, 1979). This wide spectrum of RPE features has been intensively reviewed (Nguen-Legros, 1978; Young, 1978; Zinn and Marmor, 1979, and others). Diseases and dysfunction of the RPE 221 Copyright Q 1983 by Academic Press, Inc. All rights of reproduction in any form reserved. ISBN 0-12-364483-6

222

OLGA G . STROEVA AND VICTOR I. MITASHOV

TABLE I SELECTED FUNCTIONS OF THE RETINAL PIGMENTEPITHELIUM^ Physical 1. Serves as a barrier protecting the neurosensory retina from unwanted molecules in the choroidal circulation 2. Creates the major force responsible for the adhesion of neurosensory retina to the RPE through the transport (pumping) of specific fluids 3. Synthesizes some acid mucopolysaccharides that are found in the subretinal space and that may also play a minor role in the adhesion of neurosensory retina to the RPE 4. The microvilli have intimate structural relationships (through phagocytosis) with outer segments, which may also play a role in the adhesion of the neurosensory retina to the RPE Optical I . Absorbs light energy (melanin granules) and cuts down on light scatter, improving resolution of images 2. Acts as a pigmented barrier to prevent excess light coming through the sclera, which would decrease resolution of imagery 3 . The melanin granule’s absorption spectrum maximizes the absorption of laser (argon, ruby, and krypton) light to produce the photothermal reaction, which is the key to the laser photocoagulation process Metabolic-biochemical 1. Phagocytizes rod and cone outer segments 2. Metabolizes vitamin A (esterification, storage, and transport) 3. Synthesizes acid mucopolysaccharides that are involved in the exchange of metabolites in the subretinal space 4. Transports numerous metabolites to and from visual cells and the choroidal circulation 5. Contains numerous hydrolytic enzymes (lysosomes) for the degradation of “membranes” obtained from photoreceptor outer segments 6. Contains enzymes for the synthesis and replacement of melanin granules (tyrosinase) Transport (Ocular dipole; water flow from vitreous choroid sclera responsible for adhesion of neurosensory retina to RPE) I . Ionic pump systems H C 0 3 (carbonic anhydrase) Na + ,K + -ATPase (ouabain sensitive) Mg2+ ,Ca2+-activated ATPase CI 2. Amino acid transport systems (neurosensory retina + RPE --* choroid) Taurine Methionine 3. Vitamin A transport system (RPE 4 photoreceptors) “From Zinn and Benjamin-Henkind (1979). Courtesy of Prof. K. M. Zinn.

RETINAL PIGMENT EPITHELIUM

223

result in disorders of vision. Retinal dystrophy, referred to as retinitis pigmentosa, is one of such hereditary diseases (Merin and Auerbach, 1976; Landers et al., 1977). The RPE is involved in chorioretinal wound healing. During neural retina detachment, some RPE cells, along with macrophages of vascular origin, participate in the phagocytosis of necrotic elements. These RPE cells leave the epithelial layer and become fibroblast-like cells. Both processes are accompanied by intensive proliferation of RPE cells (Frayer, 1966; Machemer, 1968; O’Steen and Karcioglu, 1974; Machemer and Laqua, 1975; Koga et al., 1977; Inomata et al., 1979; Tso, 1979; Anderson et al., 1981, and others). Finally, the RPE is a source of the neural retina and of the lens regeneration at early stages of development in all vertebrates and in certain adult amphibians (for references, see Scheib, 1965; Stroeva, 1971; Reyer, 1962, 1977; Yamada, 1977). Until recently only one aspect of the possible relationships between RPE cell proliferation and differentiation was discussed, i.e., a withdrawal of RPE cells from reproduction as a prerequisite for intensive melanin synthesis, as has been established in chick embryos (Coulombre et a/., 1963; Whittaker, 1968; Zimmerman, 1975). The conclusions drawn for the chick have been extrapolated to other species, although they disagree with the data obtained for human RPE (Tso and Friedman, 1968; Streeten, 1969; Tso, 1979). Recent advances in laboratory technology have enabled investigators to determine that during development both cell replication and melanin synthesis are compatible in the RPE (Marshak et al., 1972; Ide, 1972; Jimbow et al., 1975; Zimmerman, 1975; Hori et al., 1981). In in vitro experiments, RPE cell proliferation proceeds either simultaneously with melanin synthesis or without it, depending on the composition of the culture medium (for references, see Whittaker, 1968, 1970; Cahn, 1968; Werner, 1968; Rodesch, 1971; Chader et al., 1975; Israel et al., 1980). Thus, we face the problem of a relationship between proliferation and differentiation during RPE development as well as during neural retina and lens regeneration. Studies in vivo are significant for understanding what processes modulated in culture take place in situ. In this article, we will consider data obtained for human, rat, and chick RPE development, because on these very species an attempt was made to estimate cell proliferation quantitatively. We will follow the same line when reviewing studies on the neural retina and lens regeneration in amphibians. We will not describe the entire development of the RPE, but only aspects that are pertinent.

11. Cell Proliferation in Growth and Differentiation of the Retinal Pigment Epithelium in High Vertebrates and Humans A. DIFFERENTIATION AND PROLIFERATION OF THE RAT RETINAL PIGMENT EPITHELIUM The RPE in rats, just as in other vertebrates, is a single layer of very flattened cells; it is 6 pm thick and its diameter ranges from 10 to 15 pm (Dowling and

224

OLGA G . STROEVA AND VICTOR I . MITASHOV

Gibbons, 1962). In adult animals, the RPE cells have basal infoldings, a relatively flat apical surface, and thin microvilli. Lateral junctional complexes are located near the apical margin of the cells. The cytoplasm includes fine, smoothsurfaced endoplasmic reticulum (SER), the Golgi complex, large mitochondria, lysosomes, and phagosomes. Melanosomes are arranged mainly in the vicinity of the apical cell surface and in microvilli (Dowling and Gibbons, 1962; Kuwabara and Weidman, 1974; Kuwabara, 1979). The RPE of albino rats does not contain pigmented granules; but numerous premelanosomes are formed at early RPE developmental stages and disappear later (Dowling and Gibbons, 1962; Brackevelt and Hollenberg, 1970; Kuwabara and Weidman, 1974). Most cells in the RPE of adult rats are binucleated (Tso and Friedman, 1967; Stroeva and Brodsky, 1968; Stroeva and Nikiphorovskaya, 1970; Kuwabara, 1979; Puzzolo and Simone, 1979). The mean area of binucleated cells is 1.6 times greater than the mean area of uninucleated cells (Marshak et a l . , 1976). 1. Melanization, Proliferation, and Capacity of RPE Cells for Neural Retina Diflerentiation for Intrauterine Development Pigmentation of the outer layer of the eye cup in rats appears at the beginning of the fourteenth day of pregnancy at the posterior pole of the eye, where RPE cells are already arranged as a single cell layer. According to electron microscopic data (Gorbunova and Stroeva, 1972; Marshak et a l . , 1972; Kuwabara and Weidman, 1974), at the stage of 13.5 days of pregnancy, RPE cells have a large nucleus with a nucleolus and a thin rim of cytoplasm that contains a few premelanosomes and mature melanosomes, the Golgi complex, channels of the rough endoplasmic reticulum (RER), and free ribosomes (Fig. 1). Mitotic RPE cells also contain premelanosomes, melanosomes, and RER; they are as differentiated as the neighboring interphasic cells with which they are tightly linked via junctional complexes (Gorbunova and Stroeva, 1972). Only single premelanosomes can be detected in the cells of the marginal RPE zones at this stage. At 17.5 days of pregnancy, the RPE is characterized by the advanced differentiation of the entire layer (Gorbunova and Stroeva, 1972; Kuwabara and Weidman, 1974). The cell cytoplasm becomes larger and melanosomes of all stages of maturity are numerous. Microvilli appear on the apical surface of the cells. The mitotic cells, including late telophase cells and spherical cells that have just divided, can be seen in the RPE at this stage. These data, documented in Fig. 2, indicate that before birth mitoses in RPE cells proceed normally, being completed by cytotomy. According to an autoradiographic study using continuous labeling with i3H]TdR (Zavarzin and Stroeva, 1964), about 40% of RPE cells are involved in reproduction in albino rat embryos at the fifteenth day of pregnancy. Some parameters of the cell cycle were estimated at this stage: G, + 0.5M was found to be 2 hours, and S was 6.5 hours. In the RPE of 18-day-old embryos, the index

RETINAL PIGMENT EPITHELIUM

225

FIG. 1 . Electron micrographs of the RPE of rat embryo at the stage of 13.5 days of pregnancy. (A) Transverse, ultrathin section of the epithelium; (B) metaphasic RPE cell. PM, Premelanosome; M , melanosome; JC, junctional complex; N , nucleus; C, cilia; G, Golgi complex; NR, neural retina; Mt, mitochondria; Ch, chromosome. From Marshak et al. (1972); Gorhunova and Stroeva (1972).

226

OLGA G . STROEVA AND VICTOR I . MITASHOV

FIG. IB. See legend on p. 225.

of labeled nuclei drops to 14.4% at the central RPE area, but it is rather high (27%)at the marginal zones. The outer layer of the eye cup easily switches into neural retina differentiation at the early stages of development (at 12-13 days of pregnancy). During the fourteenth day this pattern is manifested only at the marginal zones. The ability of the RPE for retinal differentiation falls with increasing embryonic age and could not be detected in 18-day-old embryos in experiments involving embryonic eye implantation into the anterior chamber of the adult eye (Stroeva, 1960, 1962, 197 1 ) . These data support the conventional idea about an earlier differentiation of the RPE in the central area and its growth at the expense of cell division mainly at the marginal zones. However, in the central area of the globe, RPE cell proliferation does not cease completely with the onset of melanotic differentiation.

RETINAL PIGMENT EPITHELIUM

227

FIG. 2. Electron micrographs of mitotic cells in the RPE of 17.5-day-old rat embryos. These micrographs demonstrated that during intrauterine life mitosis of RPE cells is completed by cytotomy. (A) Metaphase; (B) late telophase (the constricting furrow is indicated by the arrow); (C) and (D)RPE dividing cells at the state of cytotomy completion (cell separation is indicated by the arrow). Ch, Chromosomes; N, nucleus; PM, premelanosomes; M, melanosomes; Mt, mitochondria; JC, junctional complexes. From Marshak et al. (1972); Gorbunovd and Stroeva (1972).

2 . RPE Proliferation in Postnatal Development and Formation of Binucleated Cells Studies of the origin and function of binucleated cells have enabled examination of postnatal proliferation and its role in the growth and differentiation of the RPE in rats.

228

OLGA G . STROEVA AND VICTOR 1. MITASHOV

FIG. 2B and C. See legend on p. 227.

RETINAL PIGMENT EPITHELIUM

229

Fic.2D. See legend on p. 227

a. Pattern of Accumulation of Binucleated Cells. The RPE of gray (GR) rats [from the colony of the Institute of Developmental Biology (Moscow) and ranging in age from 1 day to 17 months] was studied in cytological experiments. Binucleated cells in the RPE were found to be formed after birth. The RPE of some animals contains about 5% binucleated cells in the central zone as early as the first day of age. Their proportion increases gradually and reaches about 50% by the fifth day and 80% by the ninth day after birth (Fig. 3a). At the periphery, the 50% level of binucleation is observed by the ninth day and does not change later (Fig. 3b) (Stroeva and Panova, 1976, 1980, 1983). The same pattern of binucleated cell formation is essential for albino Wistar rats and MSUBl rats with eyes of normal size (Fig. 4) (Stroeva et a l . , 1981). In 1-year-old rats, the percentage of binucleated cells in the central RPE zone declines up to 70% and that of uninucleated cells up to 16%, whereas the portion of trinucleated and tetranucleated cells becomes 13 and 1%, respectively (Tso and Friedman, 1967; Stroeva and Brodsky , 1968; Stroeva and Nikiphorovskaya, 1970; Marshak and Stroeva, 1973, 1974; Stroeva and Panova, 1976, 1980). These changes in the RPE cell population pattern were interpreted as an onset of aging, which occurred in rats after the fifth month of age (Stroeva and Panova, 1976); this is consistent with the data reported for other organs (Bellawy, 1974). As has been found cytospectrophotometrically (Marshak and Stroeva, 1973), the majority of uninucleated cells in the RPE are diploid and most of the binucleated ones are tetraploid, with two diploid nuclei. The same proved to be true for the RPE of MSUBl rats (Marshak and Stroeva, 1974). Starting from the seventh postnatal day, uninucleated and binucleated polyploid cells appear in the RPE, but their proportion does not exceed 1% in the central zone (Marshak and Stroeva, 1973, 1974).

230 100

s

OLGA G. STROEVA AND VICTOR I. MITASHOV

t

a

‘:id

ul A

aJ

0

c

0

c 5c

.-c0

I

L

I

0

a

P

n

0I ?

I

,

,

,

?

0 1

1 3 5 7 9 1 1 15 1 3 5 7 9 12 Age i n days in months FIG. 3. Changes in the proportions of uninucleated (filled circles), binucleated (open circles), trinucleated (filled squares), and tetranucleated (open squares) cells in the RPE throughout the postnatal life of rats. (a) Central RPE zone; (b) RPE periphery. Each point is derived from counts of 1000cells per eye (10 eyes for each measurement point), on tangential sections of the RPE. Averaged data from Stroeva and Nikiphorovskaya (1970); Marshak and Stroeva (1973); Stroeva and Panova (1976).

1

3

5 7 9 1 1 age i n d a y s

15

FIG.4. Changes in the proportion of binucleated cells in the central RPE zone of GR rats (filled circles), Wistar rats (open squares), and MSUBl rats with eyes of normal size (open circles) during the first 15 days after birth. From Stroeva er al. (1981).

RETINAL PIGMENT EPITHELIUM

23 1

FIG. 5 . Changes in labeling indices in different RPE zones of intact rat eyes after continuous labeling with ['HITdR. Animals were injected subcutaneously with [3H]TdR (specific activity, 9. I CilmM, I (*Ci/g) every 6 hours for 19 hours and were killed I hour after the last injection. Labeling indices were averaged by counting of 1000 nuclei per zone on tangential sections of the RPE, using from three to seven eyes. (a) Index of labeled nuclei in the central zone (filled circles) and at the periphery (open circles; averaged data for four quadrants); (b) labeling indices at the periphery (filled bars) and in the equatorial zones (open bars). (V) Ventral; (N) nasal; (D) dorsal; and (T) temporal; each bar represents the average data for the eyes of three animals. Vertical lines are standard errors of the means. From Stroeva and Panova (1980, 1983).

Why do multinucleated (first of all, binucleated) cells appear in the RPE of rats? Do they appear as a consequence of the RPE age or eye growth? In order to answer these questions, experiments were performed with mutant MSUB 1 rats having a variable degree of microphthalmia; the rats were bred by crossing Browman's albino rats from the Wistar colony (Browman and Ramsey, 1943; Browman, 1954) with GR rats (Stroeva and Lipgart, 1968). Seven-month-old rats in which one eye was normal and the other one microphthalmic were selected for the study. The percentage of multinucleated cells was shown to be less in microphthalmic eyes than in those of normal size in all the animals (Stroeva and NIkiphorovskaya, 1970). This finding suggested that the proportion of binucleated cells in the RPE was controlled by eye growth. The suggestion could be proved experimentally by studying the pattern of eye growth and the origin of binucleated cells. By analogy with the liver (Brodsky and Uryvaeva, 1977) and the heart (Rumyantsev, 1977), one might suggest that binucleated cells were formed in the RPE via acytokinetic mitosis. Therefore, it was necessary to find out whether any proliferative activity could be detected in the RPE of newborn rats. b. DNA-Synthesizing Cells in the RPE of Normal Rats. An autoradiographic study using [3H]TdR has actually shown that cell proliferation in the RPE reappears in newborn rats. The results of several experiments (Marshak et a l . , 1972; Marshak and Stroeva, 1973; Stroeva and Panova, 1976, 1980) have revealed that DNA-synthesizing cells are distributed nonrandomly in different zones of the

232

OLGA G. STROEVA AND VICTOR 1. MITASHOV

2 4 810 20 24 27 30 33 hours a f t e r a single PHlthymidine injection FIG. 6. Labeled mitoses curve for the RPE of 4-day-old rats. Mitotic figures from middle prophase to telophase were scored (30 to 60 mitoses per eye) on tangential sections of the RPE central zone. Each point represents the data for one eye. (Solid line, open circles) Counts at the threshold of not less than 5 grains over nucleus; (dotted line, filled circles) counts at the threshold of not less than 15 grains over a nucleus. From Stroeva and Panova (1980, 1983).

RPE (Fig. 5). The maximal proportion (ca. 20% on the average) of DNAsynthesizing nuclei was found in the central RPE zone of 2- and 3-day-old rats. Between the fourth and eighth postnatal day, about 8% of the nuclei in this zone were labeled. The labeling index declines below 5% by the ninth day and below 1% by the eleventh to fifteenth day of age (Fig. 5a). At the periphery of the RPE the index of labeled nuclei was maintained at about 7% between the third and eighth day, and then dropped simultaneously to that in the central zone (Fig. 5a). Besides the central zone, the equatorial zone in the dorsal and temporal quadrants also had high indices of labeled nuclei. In the ventral and nasal quadrants of the equatorial zone, however, the labeling indices did not differ from those of the RPE periphery (Fig. 5b). c. The Cell Cycle and Origin of Binucleated Cells. Marshak (1974) was the first to use the study of the cell cycle for proving the mitotic origin of binucleated cells. She observed that a certain percentage of labeled binucleated cells arose in the course of the cell cycle. Stroeva and Panova (1980) repeated the experiment with some modifications. They found that only uninucleated RPE cells were labeled after a single injection of [3H]TdR. Labeled binucleated cells gradually accumulated, and their proportion in the central RPE zone reached about 3% of the subpopulation of binucleated cells by the twenty-seven hour after isotope injection. Only a few (ca. 0.1%) of the labeled binucleated cells were involved in the new cell cycle. Thus, the cell cycle parameters were determined using the pulse-chase method of Quastler and Shermann (1959) for uninucleated cells only (Fig. 6 ) . They were as follows: T = 25 hours, t, = 15 hours, tG, = 2.5 hours, tG2 = 5.2 hours. In an experiment with colchicine, tM was found to be 2.3 hours. As compared to the RPE of rat embryos at the fifteenth day of pregnancy (Section II,A,l), postnatal proliferation of the RPE was accompanied by a more than 2-fold increase in ts and tcz (Stroeva and Panova, 1980, 1983).

233

RETINAL PIGMENT EPITHELIUM

f 3

4

i

5 . 6 7 0 age i n days

9

FIG. 7. Indices of labeled nuclei of RPE cells after double labeling with ["ITdR and [14C]TdR in rats. Three-day-old rats each received a single injection of [3H]TdR (12 CiimM; 1 pCilg), and three animals were killed after 2 hours. Other rats were sacrificed 24, 48, 96, 120, and 144 hours after the [7H]TdR injection (three rats per day); 2 hours before decapitation they received a single dose of [I4C]TdR (specific activity 54 mCilmM, I pCiig); only nuclei of uninucleated cells incorporated ['HITdR on the third day of age. About 50% of them became binucleated by the fourth day and the other 50% became binucleated by the fifth postnatal day, and then withdrew from the cell cycle (open bars). Only nuclei of uninucleated cells incorporated [14C]TdR on any day (dotted bars). No uninucleated cells with double label were found. Each bar is derived from cell counts in the RPE central zone on tangential sections, using three rats, 1000 cells per eye. Vertical lines represent standard errors of the means. From Panova and Stroeva (1983); Stroeva and Panova (1983).

d. The Number of Cell Cycles between the Third and the Ninth Postnatal Day. An experiment with a double thymidine label has shown that between the third and the ninth postnatal day most of the RPE cells enter the cell cycle only once (Panova and Stroeva, 1983). As in the previous experiment (Section II,A,2,c), only uninucleated cells were labeled in the RPE of 3-day-old rats after a single injection of [3H]TdR. About 50% of the labeled cells become binucleated by the fourth day, and most of the remaining 50% by the fifth postnatal day. As a result, in the RPE of 5-day-old rats, 91.2% of cells with labeled nuclei are binucleated cells (Fig. 7). Therefore, 50% of the cells that have synthesized DNA by the third postnatal day have a much longer G , as compared with the average duration of this phase found earlier (Section II,A,2,c). The fraction of new RPE cells that daily entered the cycle between the fourth and eighth postnatal days was found, using [ I4C]TdR, to be 1.7 0.3% and fell to 0.9% by the ninth day (Fig. 7). The fraction of binucleated cells involved in the cell cycle was very small, as well as in the previous experiment (Section II,A,2,c). Uninucleated cells with a double label were absent. All labeled uni-

*

234

OLGA G. STROEVA AND VICTOR I. MITASHOV

150-

130-

3

a

age in days 110 -

90

-

m

-

,70 r

-

E

.-O l aJ

5

50 -

age in m o n t h s FIG.8. Changes in weight of the eye and the scleral part throughout postnatal life in rats. Open circles refer to the weight of the globe; filled circles refer to the weight of the scleral part. Following enucleation, eyes were fixed and washed, then dried on filter paper and weighed; after that the scleral part of each eye was cut off under the ora serrata and weighed as well (each point on the figure was derived from measurement of 10 to 45 eyes. At the left, above, the gain of scleral part weight. A W / A l = [ W ( n ) - W ( n - l ) ] / [ r ( n ) - f ( n - I)], where W(n) is the weight of the scleral part of n-day-old rats and n is the age of rats in days. From Stroeva and Panova (1976, 1983).

nucleated cells became binucleated. This experiment provided further evidence for the mitotic origin of binucleated cells. Thus, the proliferation of RPE cells in the course of postnatal development can be considered as a burst of acytokinetic mitoses. As a result, the number of RPE cells remains unchanged, but their area increases as a result of the formation of binucleated cells.

3 . Growth of the Scleral Part and the RPE a. Growth of the Scleral Part in Normal Development. In rats the eye grows continuously throughout the animal’s lifetime, as can be judged by changes in its weight. However, the scleral part of the eye is characterized by discontinuous growth (Fig. 8). The highest daily gain in the weight of the scleral part has been recorded between the second and the fifth postnatal day. By the fifth postnatal

235

RETINAL PIGMENT EPITHELIUM

i/ A

60 r

a ul

N

4. O -

age in days

E

E

I I I

1

0

8

1

I

I

L

I

I

,

3 5 7 9 11 age in d a y s

,

I

,

,

I I

15"l

I

,

,

3

,

,

,

,

I

,

5 7 9

, , , 12

in m o n t h s

FIG. 9. Change in area of the scleral part of the eye throughout postnatal life in the rat. Total area of each scleral part was measured by planimetry from a photo of flat preparations. Each point is derived from measurements of 10 scleral parts. Inset, the gain of scleral part area. AS/Ar=[S(n)-S(n- l)]/[r(n)-t(n- l)], where S(n) is the area of the sclera of n-day-old rats, and r(n) is the age of rats in days. Summed data from Stroeva and Nikiphorovskaya (1970); Stroeva and Panova (1983).

day, the weight of the scleral part reaches half of that of the 1-year-old rats (Fig. 8); two other peaks in weight gain were observed between the first and third and the seventh and twelfth month of age (Fig. 8). The area of the scleral part increases continuously (Fig. 9). Within the period from the fifth postnatal day to the twelfth month of age, the weight of the scleral part of the eye increases 2-fold and the area 6-fold. Therefore, stretching plays a significant role in scleral growth. The peak of scleral growth between the second and fifth day coincides with the peak in the number of DNA-synthesizing cells in the central RPE zone (Stroeva and Panova, 1976, 1980). A causal relationship between the two factors of the RPE growth, namely, proliferation and mechanical stretching was elucidated by studying experimental microphthalmia. b. Eye Growth and RPE Cell Proliferation in Microphthalmic Rats. In chick embryos, eye growth can be retarded by lens removal (Coulombre and Coulombre, 1964). The technique is also effective for inducing microphthalmia in rats (Panova and Stroeva, 1978; Stroeva and Panova, 1980, 1983). In the central RPE zone of microphthalmic eyes obtained by lens removal at the onset of the second postnatal day, both the mean labeling indices and the proportion of binucleated cells did not differ from those for control eyes up to the fifth postnatal day. In the RPE of 7-day-old rats, however, the indices of labeled nuclei fell below the control level (Fig. lo), and new binucleated cells did not appear after

OLGA G. STROEVA AND VICTOR I. MITASHOV

50

O*

-

40 -

-

a

0 0 0

b

I

s 30

.-

W

0

3 20 C 0

a,

10

W

L1 0

-

-

2 3

5

7

9

15

age

in

2 3 days

5

7

9

15

0

C

10

o

Q

,

8 6 ' m 2 3

5

7

9

15

age in

days

FIG. 10. Indices of labeled nuclei in the different zones of the RPE of intact and microphthalmic eyes after continuous labeling with [3H]TdR. Microphthalmia was induced by lens removal from the left eye at the onset of the second postnatal day; the intact eye of each rat was used as the control. The rats were injected with [3H]TdR (specific activity 9.1 CilmM, 1 FCi/g) for 19 hours and were killed 1 hour after the last injection. Labeling indices derived from counts of 1000 nulcei per zone on tangential sections from the central RPE zone of control (a), and of microphthalmic eyes (b), as well as at the periphery of control (c) and of microphthalmic eyes (d). Each circle represents the data for one eye. In the RPE of microphthalmic eyes, indices of labeled nuclei dropped by the seventh postnatal day as compared with those of the control. Asterisks refer to the eyes in which the RPE was invaded by macrophages of vascular origin. From Stroeva and Panova (1983).

the fifth day (Fig. 11). As a result, the fraction of binucleated cells was about 30% lower in the microphthalmic eyes of 9- and 15-day-old rats than in control eyes. Moreover, the RPE of microphthalmic eyes contained no cells with large nuclei (Fig. 12), earlier referred to as polyploid cells (Section II,A,2a). Inhibition of RPE cell proliferation due to the eye growth suppression was exhibited after a lag period if the lens had been extirpated at the onset of the second postnatal day. If, however, the lens was removed at the end of the fourth postnatal day, the indices of labeled nuclei dropped as early as the first postoperative day (Table 11). Hence, cell proliferation between the second and

237

RETINAL PIGMENT EPITHELIUM

b

a

," 50 0

c

2 3 5 7 9

15 23 Age in days

9

15 Age

5

9 days

in

7

9

15

15

FIG. 11. Proportion of uninucleated and binucleated cells in the different RPE zones of intact and microphthalmic eyes (the same samples as in Fig. 10). The percentage of cells of both types is based on counting at least 1000 cells per zone on tangential sections of the RPE. The proportion of uninucleated cells (filled circles) and binucleated cells (open circles) was obtained from the central zone of the intact eyes (a) and microphthalmic eyes (b) (each circle represents the data for one eye), as well as for the periphery of the control (c), and microphthalmic eyes (d); open bars refer to uninucleated cells and filled bars to binucleated ones (each bar represents averaged data for three to five eyes). The proportion of uninucleated and binucleated cells in the RPE of microphthalmic eyes does not change after the fifth postnatal day.

L,b; '"

b

d

C

e

2040 u.!?! 20 W O

L Y

LLC

40 120 40 120 rn2 FIG. 12. Area size distribution for nuclei of RPE cells in the central zone of intact (a, b, and c) and microphthalmic (d and e) eyes of 1-day-old rats (a), of 9-day-old rats (band d), and of 15-day-old rats (c and e). Nuclear area was calculated as that of an ellipse using 50 to 70 nuclei per eye. Each histogram represents averaged data for three eyes. In the RPE of microphthalmic eyes, cells with large nuclei seen in the RPE of intact eyes are absent. The total nuclear area in the RPE of rnicrophthalmic eyes is also diminished as compared to that of intact eyes. From Stroeva and Panova (1983).

40

120

40

120

40 Nuclear

120 area ,

Y

238

OLGA G. STROEVA AND VICTOR I . MITASHOV

INDICES OF

TABLE I1 LABELED NUCLEI AT THE CENTRAL ZONE OF THE RPE OF INTACT MICROPHTHALMIC EYESOF 5-DAY-OLD-RATS"

AND

Percentage of labeled nuclei after continuous labeling with [3H]TdR in the central zone of the RPE Number of animal

Right intact eye

Left microphthalmic eyeb

10.1 8.1 5.7

8.3c

9.2

6.0~ 2.4

7.4

4.5

2.2

aFrom Stroeva and Panova (1980). bMicrophthalmia was induced by lens removal at the end of the fourth day of age rThe RPE was invaded by macrophages of vascular origin.

fifth days cannot be controlled by the intraocular pressure (Stroeva and Panova, 1980). The data obtained support the original hypothesis (Section II,A,2,a), which states that the intraocular pressure influences the RPE growth, not only as a factor causing mechanical stretching of the RPE cells, but also as a factor stimulating them to enter the cell cycle. The results can be interpreted on the basis of in vitro experiments (Folkman and Moscona, 1978; Curtis and Seehar, 1978) that have shown that cell stretching controls DNA synthesis. However, this dependence can be detected in rat eyes only after the fifth postnatal day. The data obtained reveal two periods in the postnatal proliferative activity: a period of eye growth-independent proliferation (between the second and fifth days) and a eye growth-dependent period (after the fifth day) (Stroeva and Panova, 1980, 1983). c. Eye Growth-Independent RPE Cell Proliferation and a Possible Reasonfor Binucleated Cell Formation. Three facts of interest call attention to RPE proliferation between the second and fifth postnatal day. First, during this time RPE cell proliferation is independent of the intraocular pressure (Section II,A,3,b). Consequently, the postnatal wave of acytokinetic mitoses in the RPE is not induced by the intensive growth of the scleral part (Section II,A,2,b). Most probably, eye growth-independent proliferation is the result of an earlier influence on the RPE that overlaps the inhibitory effect produced by removal of intraocular pressure. The fact that such an influence could occur as early as during intrauterine life was demonstrated by the finding on MSUBl rats with congenital microphthalmia. The proportion of binucleated cells in the central RPE zone of such eyes was identical with that of experimentally induced micro-

RETINAL PIGMENT EPITHELIUM

239

100,

FIG. 13. Changes in the proportion of binucleated cells in the central RPE zone of microphthalmic eyes in early postnatal development. Filled circles refer to eyes of GR rats, microphthalmia was induced by surgical removal of the lens at the onset of the second postnatal day; open circles refer to eyes of MSUBl rats with congenital microphthalmia. From Stroeva et al. (1981).

phthalmic eyes in GR rats (Fig. 13) (Stroeva et al., 1981). Thus, although the growth of the microphthalmic eyes in MSUBl rats had been reduced prior to birth (Stroeva and Lipgart, 1968; Stroeva, 1971), their RPE was already stimulated for the eye gr-owth-independent proliferation. Second, the pattern of postnatal RPE cell proliferation differs from that during intrauterine life (Section II,A,l). Whereas in embryos the RPE grows as a result of cell multiplication mainly in the marginal zones, after birth the greatest number of cyclic cells is located in the most differentiated zones of the RPE-the central zone and the dorsotemporal region of the equatorial zone (Section II,A,2,b). Third, the cell cycle of the RPE cells at this time is characterized by a rather prolonged G, phase (Section II,A,2,c). It occupies more than 20% of the cell cycle versus 4 to 7% of that in pigmented epithelia of the iris and ciliary body (Stroeva, 1978). On the basis of these findings, it was assumed (Stroeva and Panova, 1980, 1983) that postnatal proliferation could be of importance for the final RPE differentiation. Indeed, if the G, phase in RPE cells serves as a target for melanotropic hormone action, as has been shown for cultured cells of mouse melanomas (Varga er al., 1974; Lerner et al., 1979), then the RPE should be most sensitive to the differentiative effect of melanotropins at those developmental stages when the RPE cell proliferation is highest. Moreover, this stage should

240

OLGA G . STROEVA AND VICTOR I . MITASHOV

be a starting point for a new wave of melanogenesis in the RPE, which will be illustrated later (Section II,A,4). Formation of numerous binucleated cells in the rat RPE can be considered in terms of this hypothesis. If postnatal proliferation of the RPE plays mainly a differentiative role, it may be excessive with respect to the RPE area growth. The RPE area cannot, however, exceed the area of the scleral part of the eye, the size of which is regulated by intraocular pressure (Section I,A,3). Furthermore, the RPE must remain as a single layer, which is stretched between the neural retina and the Bruch’s membrane, for its normal development and function. Thus, the formation of binucleated cells could be considered as a solution of a difficult problem. Indeed, the area of one binucleated cell is about three-fourths of the overall area of two uninucleated cells, which would be formed if the cells underwent complete mitosis. The formation of binucleated cells enables cell proliferation with moderate growth of the RPE area. The temporal preservation of some cells in G, may be considered to be another solution for the same problem (Panova and Stroeva, 1983; Stroeva and Panova, 1983). If so, then the formation of numerous binucleated cells in the RPE of rats should be regarded as a result of excessive proliferation stimulated by some factors in addition to mechanical stretching of the eye walls. 4. Melanogenesis in the RPE during Postnatal Development of Rats and Its Correlation with Cell Proliferation a. Pattern of RPE Melanization during the First 9 Days after Birth. According to the hypothesis (Section II,A,3c), the RPE melanization during the postnatal development should have a double-phasic pattern owing to an assumed melanotropic hormone action on cyclic cells, the highest effect being expected in 2- to 3-day-old rats. In newborn rats, the cytoplasm of the RPE cells contains melanosomes of all stages of maturity (Feeney, 1973; Stroeva, et a l . , 1982a). The numbers of premelanosomes, immature melanosomes, and mature melanosomes per 100 nuclei in the central RPE zone of GR rats of various ages were counted on ultrathin cross sections of the RPE using transmission electron microscopy (Stroeva et al., 1982a). The results showed that there were actually two phases in postnatal RPE melanization. The proportion of mature melanosomes rises between the first and second day, remains constant between the second and fifth day, and sharply rises after the fifth day of age (Fig. 14a). The same result was obtained by measuring the content of melanin in RPE cells by an electron spin resonance method (Panova, 1982; Stroeva et a l . , 1982a) (Fig. 14b). The proportion of premelanosomes was rather high in the cytoplasm of the RPE of 1-day-old rats, then declined in 2-day-old animals, and increased gradually starting from the third day. It reached a maximal level by the fifth and sixth postnatal day. The RPE cell still had numerous premelanosomes as late as on the seventh and ninth day of age (Fig. 14a).

24 1

RETINAL PIGMENT EPITHELIUM

b

1

2

3

5

Age in days

9

FIG. 14. Melanization of the RPE in GR rats during early postnatal development. (a) Melanin content was measured by electron spin resonance technique. RPE layer was isolated by trypsinization, dried, and weighed ( 1 mg of RPE cells was obtained from 28-30 eyes per age stage). Melanin concentration was measured using a Varian spectrometer and calculated after Mason e t a / . (1 960); (b) RPE melanization was estimated by a count of melanosomes in 100 nuclei on transverse ultrathin sections of the central zone using transmission electron microscopic technique. Filled bars refer to mature melanosomes (stage IV); open bars, premelanosomes (stages I and 11); dotted bars refer to immature melanosomes (stage 111). From Panova (1982); Stroeva er a/.(1982a).

Simultaneously with the increase in the number of premelanosomes, synthetic processes were intensified in the cytoplasm of RPE cells. Abundant channels of RER appeared in the RPE of 5- and 6-day-old rats. The RER channels were seen throughout the cell cytoplasm and often were arranged parallel to the long axis of cells near their apical surface (Feeney, 1973; Stroeva et al., 1982a). According to Feeney (1973), the RER activity was maximal in the RPE of 10-day-old rats.

242

OLGA G . STROEVA AND VICTOR I . MITASHOV

C ' I a / ' C

.O 130 c

20

a

5110-

.-C

/

0

a

--

I

3 age

5

6 7 i n days

9

FIG. 15. [I4C]Leucine incorporation into the rat RPE in early postnatal development. Animals have received subcutaneously a single dose of [14C]leucine(specific activity 54 mCiimM; 15 FCiig) 1 hour before decapitation. RPE cells were isolated by trypsinization and processed for liquid scintillation; RPE from four eyes were used for each measurement point, experiments were duplicated. 0, First test; 0 second test. From Stroeva er al. (1982a).

The pattern of protein synthetic activity in the RPE of postnatal rats was assayed by a liquid scintillation technique using ['4C]leucine as an precursor (Stroeva et al., 1982a). The first increase of protein synthesis in the RPE was observed by the sixth postnatal day. [ 14C]Leucine incorporation dropped by the seventh day and again increased by the ninth day of age (Fig. 15). However, it is unknown whether these events are related causally to melanin synthesis. It is noteworthy that the onset of both the second phase of RPE melanization and the period of eye growth-dependent proliferation (Section II,A,3,c) coincides and takes place between the fifth and sixth postnatal day. Evidently, as soon as RPE cells become ready for the terminal phase of their melanization, a regulatory mechanism of cell proliferation ensuring only growth requirements of the RPE cell population is switched on. b. Sensitivity of the RPE to the Melanotropic Hormone Action in GR Rats. The sensitivity of the RPE of I-, 2-, 3-, 4-, and 5-day-old GR rats to adenocorticotropic hormone (ACTH) used as a melanotropin was studied in organ culture of the scleral part of the eye (Stroeva et al., 1982b; Stroeva and Bibikova, 1982). The results are documented in Figs. 16 and 17. Stimulation of melanin synthesis above the basic level by ACTH was found to be possible only in the RPE of 3day-old rats (Fig. 17; Table 111). The failure of ACTH to affect melanin synthesis in the RPE of 2-day-old rats was unexpected. It may be indicative either of our insufficient knowledge of RPE proliferation at this stage or of a peculiar state of

RETINAL PIGMENT EPITHELIUM

/ /

P

243

,O0I

/

/

4

/

z

I

0

m

I

500-

0- -0 I

3 E

a

/ I I

a 0

I I

hours FIG. 16. [3HlLeucine and ['4C]thiouracil incorporation into the RPE of 3-day-old GR rats, which were cultured with sclera and choroid and isolated by trypsinization before preparation for liquid scintillation. Culture medium (10 ml Eagle MEM, 13.9 mg anhydrous calcium chloride, 220 mg sodium bicarbonate, 8 mg bovine albumin, I ml 200 mM glutamine, 39 ml twice-distilled water, pH 7.8-7.9) contained both isotopes during all cultivations. (a) [3H]Leucine (specific activity 40 CilmM; 10 pCi/ml), and [14C]thiouracil (specific activity 20 mCilmM; 5 pCiiml) incorporation into the RPE of each explant after 16, 24, and 48 hours of cultivation. Open circles refer to [3H]leucine, and crosses refer to ['4C]thiouracil incorporation; (b) [14C]thiouracilincorporation into RPE cultured in medium without hormone (control, crosses) and in that supplemented with ACTH, 5 IUlml (experiment, open circles). From Stroeva and Bibikova (1982); Stroeva et a / . (1982b).

RPE cells due to the termination of the first phase of its melanization. Insensitivity of the RPE of 4- and 5-day-old rats to ACTH can also be interpreted in two ways: (1) the contribution of cyclic cells to the overall melanization of the RPE is insignificant due to a low level of proliferation (Fig. 5) and cannot be detected by the technique used; (2) another possible explanation is that synthetic events connected with the second phase of melanization has already commenced and made RPE cells insensitive to the exogenous hormone. It is clear that age variations in the RPE response to the melanotropin cannot be attributed to the melanin content in RPE cells. As was shown (Section II,A,4,a), the level of RPE melanization was the same in the RPE of 2-, 3-, 4-, and 5-day-old rats and nearly twice as high as in the RPE of 1-day-old animals. These data are consistent with the conclusions drawn earlier (Section II,A,4,a) that the third postnatal day may be considered as a starting stage for the second phase of RPE melanization in the postnatal development of rats. c. Postnatal Proliferation and Insensitivity to ACTH of the RPE of Mutant Rats with Inherited Retinal Dystrophy. The RPE participates in the maintenance of photoreceptor cells by phagocytizing the shed disks of their outer segments. In RCS rats, the RPE has been shown to be the primary site of action

244

STROEVA AND VICTOR I. MITASHOV

Ii1il 2

4

1

L

Age

5

d

in days

FIG. 17. Synthetic ratio (experiment:control) of melanin (filled bars) and protein (open bars) in the RPE of GR rats in the age range from the first to the fifth postnatal day. The RPE was cultured and processed from liquid scintillation as described in Fig. 16. Scleral parts of the eyes of each animal were put in separate dishes containing either medium without hormone (control) or medium supplemented with ACTH, 5 IU/ml (experiment) and cultured for 48 hours. The results were expressed as melanin and protein synthetic activity per microgram of DNA for each sample; the ratio (experiment:control) for each pair of eyes was calculated. The results obtained for all animals per age stage were averaged and processed statistically. Each bar derived from 10 to 15 pairs of eyes. From Stroeva and Bibikova (1982).

TABLE I11 ['4C]TH10URACIL AND [3H]LEUCINE lNCORPORATION INTO RPE CELLSOF 3-DAY-OLD GR RATSAFTER 48 HOURSOF CULTIVATION WITH ACTH (EXPERIMENT) AND WITHOUT HORMONECONTROL)^.^ [ I4C]Thiouracil ( c p d p g DNA)

Number of animal

Expt.

Control

I 2 3 4 5 6 7 8

2434.0 1567.2 356.4 225.0 667.5 1052.1 638.6 843.8

1089.0 536.1 163.6 478.3 648.2 430.3 569.9 306.9

Synthetic ratio of melanin< 2.2 2.9 2.2 0.4 1.o

2.4 1.1 2.7

[ 3H]Leucine c p d p g DNA

Expt.

Control

2353 822.4 173.1 149.7 401.3 168.7 130.8

2133.0 927.1 329.2 107.8 193.3 269.2 212.0

"From Stroeva e t a / . (1982b). bEach pair of eyes (experimenta1:control) was derived from one animal. CMean for eight animals is 2.0 f 0.2. dMean for eight animals is I .O f 0.1,

Synthetic ratio of proteind 1.1

0.9 0.5 I .3 2.0 0.6 0.6

RETINAL PIGMENT EPITHELIUM

age

245

in d a y s

FIG. 18. Changes in the proportion of binucleated cells in the central RPE zone of Campbell rats (open bars) and Hunter rats (filled bars) in early postnatal development. From Stroeva et a/. (1981).

of the gene for retinal dystrophy. Thus, it is incapable of ingesting the tips of the rod outer segments (ROS) (Dowling and Sidman, 1962; Dowling and Gibbons, 1962; Young and Bok, 1969; Bok and Hall, 1969, 1971; Herron et al., 1969, 1971, 1974; Custer and Bok, 1975; Mullin and LaVail, 1976; LaVail and Mullin, 1977; Edwards and Szamier, 1977; LaVail, 1979; Tamai and O’Brien, 1979). The RPE zones characterized by the highest level of proliferation in 3day-old GR rats (Stroeva and Panova, 1980, 1983) correspond to the zones most resistant to development of retinal dystrophy in RCS rats (LaVail and Battelle, 1975). This prompted the idea of using mutant rats with inherited retinal dystrophy to substantiate the hypothesis on the differentiative role of postnatal proliferation (Stroeva and Panova, 1980). If the postnatal proliferation is causally related, not only to melanotic differentiation of the RPE, but also to its phagocytic activity, then the eye growth-independent proliferation ought to be disorganized in rats with retinal dystrophy. Indeed, in mutant Campbell and Hunter rats (Yates et a/.,1974), the proportion of binucleated cells in the RPE was found to be lower than that in GR rats (Fig. 18) (Stroeva et al., 1981). Moreover, the RPE of 3-day-old Hunter rats was shown to be insensitive to the melanotropic effect of ACTH (Table IV) (Stroeva et al., 1982b). These results imply that (1) the RPE of adult Hunter rats should have a weak pigmentation as compared with that of GR rats, and (2) there may exist a causal relationship between the postnatal RPE proliferation and the capacity of RPE cells to ingest ROS disks. Although there is no direct evidence in favor of the last idea, it is interesting to notice that the hypothesis (Stroeva and Panova, 1980) predicted not

246

OLGA G. STROEVA AND VICTOR I. MITASHOV

TABLE 1V [’4C]THIOURACIL AND 13H]LEUCINE INCORPORATION INTO RPE CELLS OF 3-DAY-OLD HUNTERRATS AFTER 48 HOURSOF CULTIVATION WITH ACTH (EXPERIMENT) AND WITHOUT HORMONECONTROL)^.^

Number of animal 1

2 3 4 5 6 7 8

[ “YJThiouracil ( c p d w DNA)

Expt.

Control

461.4 1234.2 309.6 594.0 885.0 114.2 137.6 322.0

856.1 814.3 731.4 649.0 873.0 200.1 218.5 249.0

Synthetic ratio of melaninc

0.5 1.5 0.4 0.9 1.1

0.5 0.6 I .2

[3H]Leucine ( c p d p g DNA) Expt.

Control

Synthetic ratio of proteind

84.2 196.2 99.3 135.0 131.0 71.2 40.0 129.0

160.0 146.0 147.0 106.0 103.0 56.0 69.0 86.0

0.5 I .3 0.6 I .2 1.2 1.2 0.5 1.5

OFrom Stroeva et al. (198213).

bEach pair of eyes (experiment:control) was derived from one animal. CMean for eight animals is 1.0 f 0.2. dMean for eight animals is 1 .O 0.1.

*

only the disturbance of the eye growth-independent proliferation but also the insensitivity of the RPE to the melanotropic effect of ACTH in rats with inherited retinal dystrophy. 5 . Conclusions

Studies of postnatal RPE cell proliferation in rats have revealed some unexpected features of RPE growth and differentiation. First, it has been found that the RPE cell population can serve as a target for the action of differentiative agents within a very short period of postnatal development, a period that coincides with the wave of RPE cell proliferation. This finding has led to the discovery of the double-phasic character of postnatal RPE melanization in rats and has drawn attention to the role of melanotropic hormones in the differentiation of this part of the eye. Second, the dependence of RPE proliferation on eye growth was found. So, with the exception of the period of eye growth-independent proliferation, the stretching of the eye walls by intraocular pressure induces RPE cells to enter the cell cycle. Third, in early postnatal development, the RPE grows mainly at the expense of the most differentiated central zone by means of cell binucleation. The formation of numerous binucleated cells in the rat RPE during the first week after birth may be considered as a solution to the problem of combining excessive cell proliferation with moderate growth of the scleral part of the eye.

RETINAL PIGMENT EPITHELIUM

247

Evidently some regulatory mechanisms responsible for the inhibition of cytotomy are involved in postnatal development of the rat RPE. Postnatal proliferation of RPE cells in rats (Section II,A,2,b) coincides in time with the development of the outer segments of photoreceptors in the neural retina (De Robertis, 1960; Bonting er al., 1961; Weidman and Kuwabara, 1968, 1969). When cultured, the RPE of 7-day-old rats shows phagocytic activity (Edwards and Bakshian, 1980). In normal development in situ, RPE phagocytic activity was shown to begin on the tenth day of age (Dowling and Sidman, 1962; Herron et al., 1969; Birch and Jacobs, 1979; Philp and Berstein, 1981). Circadian rhythms of phagocytosis appear just after eye opening (Tamai and Chader, 1979). Therefore, the cellular basis for a definitive RPE area in terms of the ratio between uninucleated and binucleated cells is formed a day before the onset of RPE phagocytic activity. However, the capacity for phagocytosis appears even earlier, i.e., while the processes of melanization and proliferation in the RPE are still in progress. B. DIFFERENTIATION AND PROLIFERATION OF THE CHICKRETINAL PIGMENTEPITHELIUM 1. Proliferation in Normal Development of the RPE The cell population of adult chick RPE is homogeneous in terms of cell size. The proportion of binucleated cells does not exceed 3% of the entire RPE population (Coulombre et al., 1963; Tso and Friedman, 1967). The basic concepts of chick RPE growth were worked out by Coulombre and his co-workers (Coulombre, 1955, 1956; Coulombre et al., 1963). In this process they emphasized the increases of cell volume and area due to mechanical stretching of the RPE by intraocular pressure forces. Hence, they merely characterized the mitotic activity of the chick RPE in general (Coulombre et al., 1963). Their data were not quantitative, and it is possible that for this reason their results were interpreted in a rather free manner by other authors. For instance, while calculating the growth rate of RPE tissue based on measurement of the epithelium volume, Whittaker (1970) assumed the mitotic activity to cease completely in the RPE of 4-day-old embryos. On the contrary, Jimbow et al. (1975) corroborated the data of Coulombre et al. (1963) by finding abundant mitoses in the RPE of 7-day-old embryos. It would be relevant, therefore, to present here the original quotation from the paper of Coulombre er al. (1963): Even as early as the fourth day mitoses are absent in the fundus but are wide-spread and numerous in the equatorial and more anterior portions of the pigmented epithelium. Therefore, they become progressively more confined to the margin of the optic cup. The number of mitotic figures decreased sharply between the fourth and eighth day. The only region in which it proved difficult to make accurate observations was a very narrow band at the margin of the

248

OLGA G. STROEVA AND VICTOR I. MITASHOV

100\

\x- -x

I I

I I \ I I I

\ \

I

I

1

I

3 4 , . 5 d a y s old at addition

FIG.19. The percentage of cells in the pigment epithelium labeled by ['HITdR over 24 hours. From J . Zimmerman (1975). Courtesy of Dr. J . Zimrnerman and Academic Press. optic cup. However, it appears that some mitotic activity goes on in this region up to at least the twelfth day of incubation. (From Coulombre er a / . , 1963.) Courtesy of Professor A. J . Coulombre and the C. V. Mosby Company.)

In autoradiographic studies using ['HITdR, the schedule and pattern of the process were substantiated in quantitative terms, although with essential modifications. Zimmerman (1975) was the first to study quantitatively the mitotic activity in the normal RPE development of chick embryos. Using colcemide and ['HITdR in ovo (with results being recorded after 24 hours), he showed that over 90% of RPE cells divided rapidly during the second to third day of incubation. The cell cycle time was found to be about 6 hours. Between 3 and 3.5 days, most RPE cells sharply withdrew from the reproduction, and then the number of dividing cells steadily declined, reaching 8-9% by the fifth day of incubation (Fig. 19). The cells that continued to divide had a generation time equal to approximately 24 hours on the fourth day and approximately 136 hours at 4.5 days of incubation. Zimmerman (1975) used the entire RPE for the calculations, considering it as a more or less synchronized cell population. He did not take into account the regional differences in the distribution of mitotic cells noted by Coulombre et al. (1963). There are no significant morphological differences between central and marginal regions of the RPE on the fourth day, but by the fifth day, the central RPE zone becomes a single layer of flattened cells. The boundary between the central and multilayered marginal zones is clear. The zones differ significantly in the

249

RETINAL PIGMENT EPITHELIUM

-

70

60 -

a

s 50 -

b

I

3.5 4

5

6

7

days

4 of

5

6

incubation

7

3.5 4

5

6

7

FIG. 20. Indices of labeled nuclei in the RPE of chick embryos after triple injection of [3H]TdR in ovo. (a) Summed data for the entire RPE; (b) labeling indices in the central RPE zone; (c) labeling indices at the RPE periphery. Filled circles refer to the RPE of intact embryos; open circles refer ta the RPE of microphthalmic eyes, the lens being extirpated on the fourth day of incubation; filled circles refer to the RPE of the intact eyes of operated embryos (control). From Stroeva et al. (1979).

proportion of cyclic cells, a result that was substantiated in the autoradiographic study using triple injections of [3H]TdR and eye fixation 9 hours after the first injection and 1 hour after the last injection of isotope (Stroeva et al., 1979). Zimmerman (1975) paid no attention to the rise of the labeling index in the RPE between day 3.5 and day 4 of incubation, but the experiment with continuous labeling with [3H]TdR showed that it was rather significant: from 11% on day 3.5 to approximately 40% by day 4 (Fig. 20a). Regional differences in the RPE proliferation became obvious in 4-day-old embryos (Fig. 20b and c). The indices of labeled nuclei were approximately 20% in the central zone and approximately 65% in the equatorial and marginal zones (referred to as periphery) on the fourth day of incubation. During subsequent development, the labeling indices declined again, but not in the same manner in all RPE regions. In the central zone, the labeling index dropped sharply up to 5-8% by the fifth day, and remained at that level till the seventh day (Fig. 20b). As shown with pulse labeling using [3H]TdR (Stroeva et al., 1980), the level of cyclic cells remains constant till the ninth day and then falls by the twelfth day of incubation (Fig. 21a). At the periphery, the labeling index decreases steadily being approximately 40% by the fifth day and 18% by the sixth and seventh days (Fig. 20c). According to the data of pulse

250

OLGA G . STROEVA AND VICTOR I . MITASHOV

a

-

b

-

n

FIG. 21. Indices of labeled nuclei in the RPE of chick embryos after a single dose of [3H]TdR (specific activity 12 CilmM. 10 pCi per egg). (a) Intact eyes (control); (b) rnicrophthalmic eyes, the lens being extirpated on the fifth day of incubation. Open bars refer to the RPE periphery, and filled bars refer to the central RPE zone. From Stroeva er a / . (1980).

labeling, the proportion of cyclic cells in the RPE periphery is three times lower by the ninth day and six times lower by the twelfth day as compared with that of 7-day-old embryos (Fig. 21a). A few DNA-synthesizing cells scattered throughout all the regions of the RPE can still be found in 12-day-old embryos (Stroeva et al., 1980). Indirect data indicate that RPE cells of the central zone are characterized by a prolonged cell cycle, whereas peripheral cells continue to divide with short generation times. Comparison of labeling indices in the RPE of intact and microphthalmic eyes provided some evidence for such a conclusion. The microphthalmia was induced by a surgical removal of the lens from the right eye of 4day-old embryos. The left eye was used as a control. One group of embryos was given three injections of [3H]TdR and fixed either 9 hours after the first injection or 1 hour after the last isotope injection; another group received a pulse label and was fixed 9 hours after that. The experiments were performed in such a way that embryos had been incubated exactly 5 days when sacrificed (Stroeva et al., 1979). In both intact and microphthalmic eyes, the indices of labeled nuclei at the RPE periphery were higher after continuous labeling than after pulse labeling. The result for central zone was the same as that for the periphery only in microphthalmic eyes (not in intact eyes). In intact eyes the labeling induced by one or three injections of the isotope was the same (Fig. 22). These data were interpreted as an indirect indication that (1) cyclic cells in the RPE central zone were generated with a more prolonged cell cycle than at the periphery and ( 2 ) the cell cycle reprogramming in the chick RPE at this time could be affected by the intraocular pressure (Stroeva et al., 1979).

25 1

RETINAL PIGMENT EPITHELIUM

I

periphery

a

center

periphery

center

FIG. 22. Comparison of labeling indices in the RPE of intact (control) and microphthalmic eyes after single and triple doses of [)H]TdR in 5-day-old chick embryos. (a) Control eyes; (b) rnicrophthalmic eyes, the lens being extirpated on the fourth day of incubation. Open bars refer to the single dose of ['HITdR, and filled bars refer to the triple dose of the isotope. From Stroeva et a/. (1979).

2. Dependence of RPE Proliferation on Intraocular Pressure Lens extirpation from the eye of 4-day-old embryos (Stroeva et a l . , 1979) has no effect on the level of DNA-synthesizing cells in the RPE (Fig. 20). However, after the same manipulations with embryos of 5 days of incubation, the proportion of labeled nuclei in the RPE of microphthalmic eyes on the seventh, ninth, and twelfth days of incubation was 7 to 10 times lower than in the control eyes (Fig. 21b) (Stroeva et a l . , 1980). Therefore, the development of the chick RPE includes periods of both eye growth-independent and eye growth-dependent proliferation, as was found earlier in rats (Section II,A,3,b). The period of eye growth-dependent proliferation begins between the fourth and fifth day of incubation. In the microphthalmic eyes, obtained as a result of the lens removal on the fourth day of incubation, the equatorial and marginal RPE areas were broader than in the intact ones. Patches of multi- and single-layered epithelium alternated in the RPE of some microphthalmic eyes, the labeling indices being higher in the thick patches. Such patches underwent retinal differentiation during subsequent development of the embryos (Akhabadze, unpublished). Extensive retinal differentiation was observed at the marginal RPE area of one microphthalmic eye from which the lens had been removed on the fifth day of incubation (Stroeva et a l . , 1980). Observations on chick embryo microphthalmic eyes showed that the intraocular pressure affected RPE cell morphology as well as the cell cycle and

252

OLGA C. STROEVA AND VICTOR I. MITASHOV

the proportion of DNA-synthesizing cells during certain periods of the RPE development. 3. Proliferation and Melanotic Differentiation of the RPE Withdrawal of RPE cells from reproduction (or elongation of the cell cycle) in chick embryos is of key significance for RPE melanotic differentiation (Zimmerman, 1975, 1976). Before discussing these events, it would be expedient to consider RPE melanization in chick embryos, which was studied by electron microscopy, electron autoradiography, electron histochemistry, and biochemical techniques. Premelanosomes appear in the chick RPE as early as day 2.5 of incubation in the dorsocaudal area of the eye cup, but they have no tyrosinase activity yet. Tyrosinase, the key enzyme of melanin synthesis, was revealed in the cisternae of the Golgi complex at the same RPE area (Ide, 1972). The number of premelanosomes abruptly rises and weak pigmentation appears in the RPE of 3-dayold embryos between stages 19 and 20 (Ide, 1972). At this time melanosomes of all stages of maturity were found in the posterior pole of the RPE, though mature melanosomes (stage IV) were rare (Hori et a l . , 1981). Melanin synthesis could also be detected in the RPE of this stage by [14C]thiouracilincorporation (Zimmerman, 1975). Immature melanosomes (stages I, 11, and 111) predominate in the posterior area of the RPE up to the seventh day, whereas mature melanosomes (stage IV) prevail after the seventh day, and their number reaches a definitive level by the tenth day of incubation (Hori et a l . , 1981). Tyrosinase activity in the RPE of chick embryos increases steadily, reaching a maximum by the tenth day and dropping significantly by the eleventh day; it cannot be detected any more in the RPE on the fourteenth day of incubation (Miyamoto and Fitzpatrick, 1957; Doezema, 1973; Mishima et a l . , 1978). According to the data of densitometry (Whittaker, 1970), the content of melanin in the RPE of chick embryos increases steadily between the sixth and twelfth day and reaches a plateau by the thirteenth to fourteenth day of incubation. Within this schedule the process of melanization of the RPE in chick embryos develops in two phases (Zimmerman, 1975). The first phase takes place between days 3 and 4.5 of incubation and is characterized by a low rate of melanin synthesis. During the second phase, which begins between days 4 and 5 (i.e., about 24 hours after the first drop in the number of DNA-synthesizing cells), the rate of melanin synthesis increases drastically (Fig. 23) (Zimmerman, 1975). The action of bromodeoxyuridine (BUdR) in ovo as early as the second day of incubation does not prevent the initiation of melanin synthesis, but its application to the RPE of 3.5-day-old embryos delays the onset of the second phase of melanization by at least 1 day (Zimmerman et al., 1974; Zimmerman, 1975; Redfern et a l . , 1976).

RETINAL PIGMENT EPITHELIUM

253

FIG.23. The changing rate of melanin synthesis between 2 and 5 days of incubation. From J. Zimmerman (1975). Courtesy of Dr. J. Zimmerman and Academic Press.

The second phase of melanin synthesis in the chick RPE is controlled by new transcriptional events. So, the action of a-amanitin, the inhibitor of mRNA synthesis, on the RPE of 3.5-day-old embryos prevents the intensive melanin synthesis at day 4.5. However, a-amanitin treatment of 3.75-day-old embryos produces no noticeable effect on RPE melanization (Zimmerman, 1976). Experiments with BUdR have shown that during the second phase, melanin synthesis proceeds on the background of a continuous gene activity. Thus, the effect of BUdR on RPE cells of 8-day-old embryos inhibits melanin synthesis (Coleman et a l . , 1970; Redfern et al., 1976; Garcia et a l . , 1979a). Moreover, BUdR inhibits also the capacity of the RPE cells to form epithelial sheets. As a result, they grow in culture as either stellate or dendritic cells (Redfern er a l . , 1976; Garcia et a l . , 1979a). Prostaglandins, dibutyryl-CAMP, and isobutylmethylxanthine accelerate differentiation of the RPE cells in culture, inducing an increase in cell pigmentation and the ability to form colonies. On the contrary, cGMP, cortisol, a-MSH, retinol, retinene, and retinoic acid have no effect on RPE cell pigmentation (Redfern et a l . , 1976). 4. Transdifferentiation of the RPE inro Neural Retina and Lens The chick RPE can form neural retina at early embryonic stages up to the fourth day of incubation. In experiments in vivo, the RPE of 4-day-old embryos exhibits retinal differentiation as a result of neural retina extirpation and subsequent reimplantation of chick or mouse retinal pieces into the eye cavity (Cou-

254

OLGA G. STROEVA AND VICTOR I. MITASHOV a J I

c

0 0

z

_yy 2L 25 26 27 28 29

DONOR

4 35

STAGE

FIG. 24. The frequency distribution of NR-like foci in cultures of RPE as a function of the donor stage. Counts were made on the fourteenth day of culture. From Y . Tsunematsu and A. J. Coulombre (1981). Courtesy of Dr. Y . Tsunematsu and the Japanese Society of Developmental Biologists.

lombre and Coulombre, 1965, 1970). Retinal differentiation is also possible in any region of the RPE of microphthalmic eyes in case of lens removal from the eyes on the fourth day (Section 11,B,2), as well as in the RPE marginal zone after lens extirpation on the fifth day of incubation (McKeehan, 1961; Stroeva et al., 1980). The pieces of RPE (squares of about 0.4 to 1.O cm2) isolated from the posterior pole of the chick eye at stages 24-25 (the fourth day) and 26 (the beginning of the fifth day of incubation), also proved to be capable of transdifferentiation into neural retina and lentoid bodies in organ culture in vitro (Tsunematsu and Coulombre, 1981). The RPE cells in the central part of the explants were pigmented and remained polygonal in shape, whereas dividing cells at the periphery gradually lost their pigmentation and became fibroblast-like cells. By the third day, depigmented foci consisting of 50- 100 intensively proliferating cells appeared in the central part of the RPE pieces. The foci showed retinal differentiation after 7 to 14 days of cultivation, a result that was well documented by electron microscopy (Tsunematsu and Coulombre, 1981). Lentoid bodies were formed occasionally in the marginal zones of such explants. The capacity of the RPE for transdifferentiation abruptly disappeared between stages 26 and 27, i.e., during the fifth day of incubation (Fig. 24). Tsunematsu and Coulombre (1981) assumed the presence of two cell populations in the RPE of early embryo: (1) the population that could be switched to another type of differentiation under culture conditions, and (2) the stable population that remained unchanged. These assumed cell subpopulations of the RPE could be interpreted in terms of the parameters of cell proliferation. About 20% of the cells still proliferate in the central zone of 4-day-old embryos, but the number of cyclic cells falls up to 5-8% by the end of the fifth day (Section II,B,l). Tsunematsu and Coulombre (1981) suggested that a stable state in RPE cells might appear as a result of a striking increase in generation time in RPE

RETINAL PIGMENT EPITHELIUM

255

cells between the fourth and fifth day of incubation according to Zimmerman (1975). It is clear that the delay of the cell cycle reprogramming as a result of the elimination of intraocular pressure is still possible between the fourth and fifth day (Section II,B,2). As was revealed in clonal cell culture, RPE cells of 5- to 11-day-old embryos were still capable of transdifferentiation into lens cells (Yasuda et af., 1981). Embryos of 5, 8, 9, 10, 11, 15, and 20 days of incubation as well as 1-year-old chicks were used as donors. RPE cells from all developmental stages grew equally well in primary cultures. During the outgrowth, RPE cells lost their pigmentation. Numerous foci of highly pigmented, tightly packed, polygonal cells appeared in the central portion of epithelial sheets at about 18 days in confluent cultures. Cells harvested from heavily pigmented foci of epithelial sheets were taken for secondary clonal cultures. The number and size of clones, as well as their pigmentation and number of clones with lens cells were determined after 40 days of clonal growth. The percentage of cells capable of colony formation was the same regardless of the developmental stage of the donor whereas the capacity of RPE cells to transdifferentiate into lens cells in secondary cultures decreased with donor age. Colonies with lens bodies were found only in cultures derived from donors younger than 15 days of incubation, and in all of them a-,p-, and 8-crystallins were detected. No crystallins were found in the secondary cultures derived from donors older than 15 days of incubation (Yasuda et af., 1981). In secondary cultures, the cells were growing again as depigmented cells, and pigmented foci appeared when cultures reached confluence. However, the percentage of colonies with pigmented cells decreased gradually with donor age. No pigmented colonies were formed in secondary cultures if adult chicks served as donors. Pigmented cells, if any, were not organized as epithelial sheets in secondary cultures when the donors of RPE cells for primary cultures were older than 15 days of incubation. They were of the spindle or dendritic form and produced colonies of dispersed cells (Yasuda et af., 1981). Thus, the capacity for both transdifferentiation and repigmentation decreased with donor age. The results have been interpreted to indicate that the RPE consists of two different cell subpopulations: one capable of transdifferentiation and the other not; although the RPE looks like a homogeneous cell population, it is not (Yasuda et al., 1981). These results could also be discussed in terms of pattern and schedule of RPE cell proliferation in donors. Yasuda er af. (1981) did not indicate the zone of the donor eyes to which the cells taken for the primary cultures belonged. Meanwhile, between the fifth and twelfth day of incubation, chick RPE indeed consists of two subpopulations: central and peripheral cells, which differ from each other in the proportion of dividing cells as well as in the generation time of cycling cells (Section II,B,l and 2 ) . The peripheral subpopulation progressively diminishes with developmental age during this period,

256

OLGA G . STROEVA AND VICTOR I. MITASHOV

acquiring the features typical of the central one. As to the central RPE zone, it, in its turn, also consists of two cell subpopulations: cells out of the cell cycle and dividing cells. The proportion of cycling cells in that RPE area is low but constant between the fifth and ninth day and decreases noticeably by the twelfth day (Section II,B, 1). Therefore, the state of unstable determination (pigmented cells versus lentoid ones) detected in the clonal cell culture experiments (Yasuda et al., 1981) is preserved in the donor RPE as long as its cells have not completely ceased reproduction. It is of interest to compare the data on the capacity of cloning RPE cells for repigmentation in secondary culture with the developmental schedule of RPE melanization in donors. The differentiation of pigmented cells in secondary cultures was successful if donors of RPE cells for primary cultures ranged in age from the fifth to the eleventh day of incubation (Yasuda et al., 1981). This interval coincides with the phase of intensive melanin synthesis in the chick RPE, which takes place between day 4.5 and about day 12 of incubation. But the active tyrosinase could no longer be detected in the RPE of 14-day-old embryos (Section 11,B,3). It is possible to speculate, therefore, that the loss of the capacity for repigmentation in secondary culture in cells originating from adult chicks is caused by irreversible repression of genes responsible for melanin synthesis, being preceded by the period of unstable state between the fourteenth and twentieth day of incubation. The same, apparently, is valid for factors that determine the epithelial organization of the RPE (Garcia et al., 1979a; Yasuda et al., 1981). The RPE, however, could have a reserve of inhibited tyrosinase, the existence of which was demonstrated for melanoma cells S-91 and suggested for normal melanocytes (Lemer et al., 1979). In normal development this reserve of tyrosinase could be used in slow processes of both melanosome renewal and reparation of the RPE pigmentation. If so, then the absence of repigmentation in RPE cultured cells originating from adult chicks (Yasuda et al., 1981) can be attributed to the fact that the reserve of inhibited tyrosinase is exhausted as early as during RPE cell repigmentation in primary cultures. The idea of limited quantities of reparative resources for adult RPE melanization is indirectly supported by the observation that depigmentation of the central RPE area in bull frogs increases with aging (Eckmiller and Steinberg, 1981).

5. Conclusions The schedule of events reviewed in Section B is presented in Table V. It shows that differentiation of the chick RPE has been completed by the fourteenth day of incubation. Until the end of the second week of incubation, the RPE contains a subpopulation of cycling cells, which disappears simultaneously with the termination of RPE melanization and the disappearance of the RPE cell capacity for transdifferentiation into lens cells in clonal cultures. Three periods in RPE proliferation can be distinguished during this time. The first is characterized by

DEVELOPMENTAL EVENTSI N

TABLE V RtTlNAL PIGMENT EPITHELIUM OF CHICK EMBRVO

THt.

Age of embryo in days of incubation Developmental events Morphogenesis

2.5

3

3.5

4

Multiple cell layer fissure

5

4.5

6

10

8

II

I

RearrangeRearrangement of RPE periphery into meit of the singl; layer i2) central zone into single cell layer II .2)

1

1

Rapid growth of the eye ( 1 1 Flattening, and enlargement of cell area (3) Proliferation

Intensive cell proliferation The short cell cycle (6)

Sharp decrease

Sharp( decrease 1

in proponion of DNA-synthesizing cells in the central RPE zone (2.6)

13

12

14

I-Year-old chick

7

Growth of RPE cell volume (4.5) Gradual decrease in proportion of DNA-synthesizing cells at RPE periphery (2.8) Low but constant level Decrease in proportion of of DNA-synthesizing cells DNA-synthesizing cells

Nondividing cell population

in the central RPE zone (2.8) Eye growth-independent cell proliferation ( 2 )

I Eye growth-dependent cell proliferation (8)

Increase in proportion of cells with prolonged generation time (2.6)

Immature melanosomes (stages 1.II, 111) prevail (10) Synthesis

Melanosomes (stage IV) prevail (10) Maximal level of active tyrosinase (11. 12)

No active tyrosinase

Uncapable of repigmentation in long-term cell culture (17)

"(1) Coulombre (1956): (2) Stroeva ef a / . (1979): (3) Coulombre cr a / . (1963); (4) Coulombre (1955): ( 5 ) Whittaker (1970); (6) Zimmerman (1975); (7)Zimmerman(1976);(8) Stroeva e r a / . (1980);(9) Ide (1972); (10) Hori e r a / . (1981); (II) Miyamota and Fitzpatrick (1957): (12) Mishima era/. (1978); (13) Gayer (1942); (14) Orts-Llorca and Genis-Galvez (1960): (151 Coulombre and Couloi;lbre (1965. 19701: (16) Tsunematsu and Coulombre. (1981): (17) Yasuda ef a / . (19811.

258

OLGA G . STROEVA AND VICTOR I . MITASHOV

multiplication of almost all RPE cells and by short generation times and ends at day 3. In 3-day-old embryos, the first phase of RPE melanization begins against a background of intensive cell proliferation. The second period of proliferation occurs between day 3 and day 4.5 and coincides with the first phase of melanin synthesis. It is characterized by intricate changes in the parameters of proliferation. Important events responsible for the second phase of RPE melanization occur during this time. The abrupt decrease in the number of cycling cells at day 3.5 of incubation coincides with the time of mRNA synthesis, the inhibition of which prevents the onset of the second phase of RPE melanization. Zimmerman (1975) interpreted this decrease in the number of cycling cells as a withdrawal of RPE cells from reproduction. However, another interpretation seems to be more plausible. That is, a temporary block at G,-S may be responsible for such a decrease in number of DNA-synthesizing cells, a block that is eliminated as soon as mRNA synthesis is terminated. The new rise of labeling index in the RPE of 4-day-old embryos may be a consequence of such elimination. Important morphogenetic events in the central RPE zone coincide in time with the second period of cell proliferation. These are rearrangement of RPE cells into a single layer, flattening of cells, and growth of the cell area, which are causally related to both the closure of the fetal fissure and the appearance of the intraocular pressure. These events are accompanied by the reprogramming of the cell cycle correlated with the increase in generation time. The RPE of 4-day-old embryos could possibly be considered as a cell mosaic with short and prolonged cell cycles. The proportion of reprogrammed RPE cells drastically increases up to the end of the fifth day of incubation. We can postulate that the loss by RPE cells of the capacity to transdifferentiate into neural retina in vivo and in organ culture in virro is related to reprogramming of the cell cycle. One may suggest that (1) the RPE cells with a short cell cycle have retina cognins on their surfaces (Moscona and Hausman, 1977), which cause their aggregation and retinal differentiation in the absence of the stretching forces reorganizing the RPE into a single layer; (2) RPE cells lose retina cognins on their surfaces during both cell flattening and cell cycle reprogramming; (3) the mechanical tension of the RPE by the forces of the intraocular pressure, therefore, plays a key role in the reorganization of the RPE. On the basis of the preceding data, a very important conclusion can be drawn: expression of genetic information (in the form of stored mRNA molecules for melanin synthesis) depends on the RPE morphogenesis. Indeed, if the RPE is not rearranged into a single layer of very flattened cells during this time, it develops via the retinal pathway, i.e., melanotic differentiation does not occur at all. Thus, the second period of RPE cell proliferation in the chick is closely related to RPE differentiation. Within this period, RPE cells acquire the information necessary for completion of their melanotic differentiation and for the capacity for phagocytic activity. When cultured, RPE cells of 6-day-old embryos are capable

RETINAL PIGMENT EPITHELIUM

259

of ingesting disks of the photoreceptor outer segments (PhOS) (Goldman et al., 1979; Hayashi et al., 1979; Tsunematsu et al., 1981), although in situ the PhOS begin to develop in the chick neural retina as late as the seventeenth day of incubation (Govardowsky and Harckewich, 1966). The third period of proliferative activity in the chick RPE commences just as the central zone has been reorganized. It coincides in time with the second phase of melanization and is characterized by a low, though constant, level of cycling cells in the central RPE zone. Whether the same cell fraction repeatedly divides or whether different RPE cells are involved in the prolonged cell cycle is unknown. Neither do we know how many times any RPE cell divides within this period. It has been shown, however, that at this time RPE cell proliferation is the eye growth-dependent process. AND PROLIFERATION OF THE HUMAN RETINAL C. DIFFERENTIATION PIGMENT EPITHELIUM

Development and growth of the human RPE were recently reviewed by Mund and Rodrigues (1979) and Tso (1979). In this section, therefore, we shall consider only basic data on the subject in order to compare developmental events in the RPEs of the human, rat, and chick. 1. Growth and Development of the RPE According to Mann (1949), the fetal fissure of the eye cup in human embryos closes at the end of the fifth week of gestation. This is preceded by the appearance of weak pigmentation in the outer layer of the eye cup. Melanosomes of all stages of maturity are seen in the RPE cells between the seventh and twentyseventh week of pregnancy, whereas only mature or almost mature melanosomes can be detected later. These findings indicate that melanization of the human RPE is over by birth (Mund and Rodrigues, 1979). In the fetus, RPE cells of the macular area are less pigmented than in other RPE regions; whereas in adults, the highest concentration of melanin is recorded in the macular (zone 1) and midperipheral (zone 4) regions of the RPE (Fig. 25) (Tso and Friedman, 1968b). The eye diameter doubles every 2.5-3 weeks between the third week and the second month, and it doubles once more between the second and the fourth or fifth month of gestation. Then eye growth slows down during the following development. During postnatal life, the human eye grows most rapidly within the first year; and continues to grow at a relatively high rate until the third year (Mann, 1949; Streeten, 1969). From the second to the twenty-third year, the overall surface of the posterior segment of the eye increases by 30 to 40%; the surface area covered by the RPE increases correspondingly (Tso, 1979). Cell multiplication in normal development of the human RPE was examined quantitatively on eyes obtained postmortem and by means of biopsy from indi-

260

OLGA G . STROEVA AND VICTOR I. MITASHOV

1- (POSTERIOR

POLE)

2 3- (EQUATOR 1

4 5- (PER I PHERY 1 FIG. 25. Diagram illustrating division of RPE into zones from which specimens were removed. From M. 0. M. Tso and E. Friedman (1968b). Courtesy of Prof. M. 0. Tso and the American Medical Association.

viduals between the fetal age of 4 months and 96 years of life (Tso and Friedman, 1968b; Streeten, 1969). The comparison of changes in the surface area of different RPE zones and RPE cell density per standard unit area, as well as of changes in number and size of the cells, was used as an indirect index of RPE cell proliferation (Tso and Friedman, 1968b; Streeten, 1969). The primary increase in cell density in the RPE between the fourth and sixth month of gestation results from high cell proliferation. Cell density then decreases between the sixth month of gestation and the second year of life as a result of the intensive growth of the scleral part, although RPE cell number continues to increase. The surface of the posterior segment of the eye increases again between the second year and adulthood, whereas the number of RPE cells rises insignificantly. That leads to a further drop in cell density. As soon as the eye growth ceases, the RPE cells become uniform in their shape, size, and pigmentation (Fig. 26B), with the exception of the macular and peripheral zones (Fig. 26A and C) (Tso and Friedman, 1968a; Streeten, 1969). During development of the human eye, different regions of the sclera grow at various rates (Tso and Friedman, 1968b). In the RPE of the 4-month-old fetus, the most intensive growth of the RPE was noted at its posterior temporal region. However, after birth, this zone does not grow, a fact indicated by a constant distance between the optic disk and macula (Streeten, 1969). The future macular zone in the fetus possesses the highest cell density of all RPE regions. In the human fetus, RPE cells are larger at the posterior pole of the eye than at the periphery, whereas the reverse is true of adult eyes (Fig. 26) (Friedman and Tso, 1968a). During the interval from 8 to 8.5 months of gestation, foci of small cells appear among large cells in the macular area. The foci are presumed to correspond to the sites of intensive cell proliferation. By 2 to 2.5 years of life cell density in the macula becomes typical of the

RETINAL PIGMENT EPITHELIUM

26 1

FIG. 26. Bleached flat preparations of the human RPE isolated from different zones of the eye of adult individuals (hematoxylin and eosin, OcX 10, ObjX 100). (A) Macular RPE cells (age 87):'(B) equatorial RPE cells (age 87); (C) peripheral RPE cells (age 45): cells are markedly pleomorphic in terms of size, shape, and pigmentation. From M. 0. M. Tso and E. Friedman (1968a). Courtesy of Prof. M. 0. M. Tso and the American Medical Association.

adult eye. The posterior nasal RPE area is characterized by low proliferative activity in all stages of development (Streeten, 1969). At the periphery, RPE cells become progressively polymorphous, broader, more flattened, and vacuolated with age, and many of them are multinucleated (Fig. 26C). As was reported by Streeten (1969), RPE cells adjacent to the ora serrata become disproportionately large and reach a maximal size by the second year of life. The RPE cells located just posterior of that zone continue to increase in size up to 13 years. The zone of large RPE cells in the temporal quadrant extends nearly to the equator in certain adult eyes, i.e., in those eyes in which the anteroposterior eye diameter is greater than 23 mm (Streeten, 1969). The extreme flattening of RPE cells in the periphery suggests that the most intensive eye growth after birth proceeds in this area. The overall number of human RPE cells reaches 4.2 to 6.1 million in adults, with greater cell numbers in the eyes of older patients (Hogan et ul., 197 1). This is indicative of a continuous, but slight, proliferation of RPE cells in the human eye (Tso, 1979). 2 . Intruocular Pressure in Humun RPE Development As in other complex vertebrates (Stroeva, 1971), the role of intraocular pressure in human RPE differentiation is obvious in early development: if retardation of fetal fissure closure occurs, the outer layer of the eye rudiment undergoes

262

OLGA G. STROEVA AND VICTOR I . MITASHOV

retinal differentiation. This results in gross congenital malformations of the eye (Mann, 1949). Therefore, in human embryos, intraocular pressure is also involved in rearrangement of the RPE into a monolayer and hence in its choice of the melanotic pathway of differentiation. However, during subsequent development, intraocular pressure cannot be considered as the single causative factor of RPE growth. As Streeten (1969) noted, other causative factors of regional growth of the human RPE had to be located either in the neural retina or in the RPE. The discovery of eye growth-independent and eye growth-dependent RPE proliferation in animals (Sections II,A,3,b and II,B,3) suggests that similar phenomena might also occur in human RPE development. 3. Transdifferentiation of Human RPE in Culture Yasuda et al. (1978) reported that lentoids were formed in clonal cultures of retinal and iris pigmented epithelial cells taken from two 3-month-old human fetuses. In primary cultures, the cells lost their pigmentation during the phase of intensive growth and grew as fibroblast-like elements. After 30 days of cultivation, lentoids appeared within the progeny of iris cells, which continued to grow as depigmented cells. Conversely, repigmentation occurred in the central zone of RPE cell clones. These pigmented cells during outgrowth in secondary cultures again lost their pigment granules and produced two types of colonies by the twentieth day: (1) colonies of fibroblast-like cells, and (2) colonies of a mixed type, with formation of epithelial sheets in the center and fibroblast-like cells at the periphery. Lentoids appeared at the boundary between these two zones by the thirty-fifth day of cultivation in clones of the second type. An immunoelectrophoretic study revealed that lentoids contained a-,p-, and y-crystallins after 50 days in clonal cultures (Yasuda et a l . , 1978). Thus, in terms of a capacity for transdifferentiation into lens cells in clonal cultures, the RPE of the 3-month-old human fetus is comparable to that of chick embryos younger than 15 days of incubation (Section II,B,4).

D. CONCLUSIONS The comparison of RPE development in three species (rat, chick, and human) showed that the pattern and schedule of RPE growth and differentiation causally related to cell proliferation are significantly different. It might be expected, therefore, that involvement of a new species in comparative studies would enable us to understand better the control mechanisms of RPE development in vertebrates. We believe that the comparative aspect of the experimental investigations in this field is one of the ways to answer the riddle of causal relationships between growth and differentiation during RPE development in humans.

RETINAL PIGMENT EPITHELIUM

263

111. Proliferation of Pigment Epithelium Cells in the Amphibian Retina and Iris in the Process of Retinal and Lens Regeneration We shall now consider the specific features of the proliferation of pigmented cells in the eye of adult amphibians. The importance of analyzing the proliferative activity of pigmented epithelia of the amphibian eye is due to the amphibian’s striking potential for regeneration of the neural retina (NR) and lens. There are many reviews that cover both the experimental morphological studies of the regeneration of the lens and NR in amphibians (Reyer, 1954, 1962; Stone and Steinitz, 1953; Stone, 1959, 1965; Lopashov and Stroeva, 1964; Scheib, 1965) and the studies on the changes in macromolecular syntheses occurring during the formation of the lens rudiment (Yamada, 1966, 1967a,b, 1977). Most of the reviews are devoted to the regeneration of the lens. The proliferative potency of RPE and iris cells associated with the regeneration of NR and the lens have been briefly examined in reviews by Reyer (1977) and Yamada (1977). Some apsects of the quantitative characteristics of the changes in the proliferation of RPE cells in the process of NR regeneration are taken up in a review by Mitashov (1980a). However, no comprehensive analysis of the features of RPE cell proliferation that would enable an examination of the supposed mechanisms of cellular transdifferentiation in the process of regeneration has been published so far. The purpose of this section is to make generalizations from investigations pertaining to this theme. We take up the following topics: changes in the proliferative activity of RPE cells during the different periods of NR regeneration and in experiments of different types (removal of the retina or section of the optic nerve and blood vessels); assaying the probable number of proliferating RPE cells and the number of cells forming the rudiment of the retina; determining parameters of the mitotic cycles of RPE cells and the rudiment of the retina; determining the number of RPE cell divisions before the formation of the nonpigmented rudiment of the retina; the time when the changes occur in the specific syntheses of RPE cells during the formation of the retinal rudiment and the correlation of these processes with proliferation; and an assessment of the role of proliferative processes in transdifferentiation phenomena. The section concludes with a comparison of the results of studies on the proliferative activity of RPE cells and the retinal rudiment with results obtained in studies on the proliferation of the cells of the iris and the rudiment of the lens in the process of eye regeneration. In order to provide more complete information on the characteristics of the proliferative activity of the pigmented cells of the eyes of lower vertebrates during regeneration in situ, a comparison will also be made with the results of long-term in vitro experiments with clonal cell cultures of pigmented eye tissues. This outline is preceded by a brief description of the sources of retinal regeneration in amphibians.

264

OLGA G. STROEVA AND VICTOR I. MITASHOV

FIG. 27. Two retinal rudiments formed from different cellular sources. I , Cells of retinal rudiment formed from the anterior complex of the eye; 2, cells of retinal rudiment formed from RPE cells; 3, RPE cells; Ch, choroid. X280. From Mitashov (1968).

A. REGENERATION OF THE NEURALRETINA

1, Cellular Sources of Retinal Regeneration Experimental morphological studies in which different newt species were used have revealed two cellular sources of NR regeneration (Figs. 27 and 28): (1) cells in the region of the ora serrata and the ciliary part of the retina (pars ciliaris retinae) adjacent to it, tentatively called “the anterior complex” of the eye by Keefe (1973a); and (2) the cells of the outer layer of the retina, consisting of pigmented epithelium (stratum pigmenti retinae) (Wachs, 1914, 1920; Stone and Zaur, 1940; Stone, 1950a,b; Hasegawa, 1958; Gaze and Watson, 1968; Mitashov, 1968; Reyer, 1971a,b; Keefe, 1971, 1973a,b,d; Levine, 1975, 1977). The most dependable data on the role of the RPE cells in NR regeneration were obtained in experiments involving the use of [3H]TdR (Mitashov, 1968; Stroeva and Mitashov, 1970; Reyer, 1971a,b; Keefe, 1972, 1973a). The RPE cells of newts were labeled with [3H]TdR in the period of their active proliferation before the formation of the retinal rudiment (Stroeva and Mitashov, 1970). Long after injection with [3H]TdR, the eyes of the animals were fixed, and labeled cells of the retinal rudiment were found in the eye cavity. An analysis of the changes in the labeling intensity of the initial RPE cells and the formed retinal rudiment led

RETINAL PIGMENT EPITHELIUM

265

II FIG. 28. Scheme of the regenerating eye: I, Eye periphery; 11, central part of eye fundus; 1, retinal rudiment formed from the anterior complex of the eye; 2, retinal rudiment formed from RPE cells; 3, RPE cell; 4, iris; 5 , regenerating lens. All RPE cells of the eye periphery incorporate ['HIDOPA at early stages of NR regeneration, while the [3H]TdR labeling index is equal to 4 to 6%; the incorporation of ['HIDOPA into RPE cells is absent in the central part of the eye fundus during formation of retinal rudiment, the [3H]TdR labeling index of RPE cells being equal to 40 to 50%. From Mitashov (1980a).

to the conclusion that the source of retinal restoration in the central part of the fundus oculi is cells of the pigmented epithelium (Stroeva and Mitashov, 1970). The contribution of each of these cellular sources in NR regeneration is somewhat different, depending on the age of the animals and the mode of removal of the initial retina. The larger part of the retina in newt larvae develops at the expense of the cells of the anterior complex of the eye (Hasegawa, 1958; Reyer, 1971a), whereas in adult newts the contribution of the cells of the anterior complex and the pigmented epithelium varies, depending on the mode of retinal removal (Mitashov, 1977). Tests in adult newts, tests involving the dissection of the optic nerve and the blood vessels, demonstrated that NR restoration is preceded by degeneration of the initial retina. Here the marginal zones of the original retina are preserved and take part in the restorative processes. In this type of experiment, the contribution of RPE cells to NR regeneration was smaller than in tests involving the removal of the retina (Mitashov, 1969a, 1970). For a long time experimental studies on NR regeneration failed to produce quantitative data on the individual contributions by the cells of the pigmented epithelium and the anterior complex of the eye to the formation of the retinal rudiment. Such data were obtained by autoradiographic examinations of the

266

OLGA 0.STROEVA AND VICTOR 1. MITASHOV

FIG. 29. Autoradiograph of RPE cells in adult newt T . vulgaris. [3H]DOPA (15 pCi/g) was injected on the tenth day after lens removal and retinectomy. The eyes were fixed 20 hours after [3H]DOPA injection. In focus are granules of reduced silver. x900.

dynamic changes of melanin synthesis (Mitashov, 1976, 1980b; Grigoryan and Mitashov, 1979). Studied in these tests was the spatial distribution of incorporation of [3H]dihydroxyphenylalanine([3H]DOPA) in the pigmented epithelium (Fig. 29). The criterion that enabled investigators to single out from the entire RPE cell population precisely that part of it whose cells form the rudiment of the retina is the incorporation of [3H]DOPA into the cytoplasm of amphibian RPE cells, pointing to the synthesis in those cells of the specific product melanin (Model and Dalton, 1968; Model, 1973; Moran et al., 1973). In the eyes of nonoperated control newts, only a very few RPE cells situated at the root of the iris incorporate [3H]DOPA (Mitashov, 1976, 1978). During NR regeneration, the RPE cells of the central part of the fundus oculi do not incorporate [3H]DOPA for a long time, even before the protrusion of RPE cells into the vitreous body (Fig. 28). On the periphery of the eye, as in nonoperated control eyes, melanin synthesis goes on and is detected by the incorporation of [3H]DOPA, while the number of cells in the phase of melanin synthesis gradually increases in this zone. Most importantly, there is no incorporation of [3H]DOPA in the cells of the central part of the pigmented epithelium throughout the period of their transformation into cells of the retinal rudiment (Fig. 28). The formation of the first pigmented cells of the retinal rudiment (1-2 rows of cells in

RETINAL PIGMENT EPITHELIUM

267

the cavity of the eye's vitreous body) coincides in time with the repigmentation of the underlying RPE cells, which begin to incorporate [3H]DOPA as they enter into the phase of melanin synthesis. While this is occurring, the cells of the retinal rudiment containing pigment during the early stages of its formation do not incorporate ["]DOPA. In this way a clear criterion was found, enabling one to determine, when examining the dynamics of the entire regenerative process, that zone of the eye whose RPE cells take part in NR restoration. The only RPE cells transformed into the retinal rudiment are those that do not incorporate [3H]DOPA for a long time after surgery. An analysis of the pattern of distribution of RPE cells that do and do not incorporate [3H]DOPAled to the conclusion that cells in the peripheral zones of the pigmented epithelium are not involved in retinal restoration and that the RPE cells in the area of the fundus oculi alone produce the retinal rudiment (Grigoryan and Mitashov, 1979; Mitashov, 1980a,b). Besides, the spatial location of RPE cells that do and do not incorporate [3H]DOPA made it possible to calculate the number of cells transformed into the retina. This number was about Y3 of all the RPE cells in the test involving removal of the retina (Grigoryan and Mitashov, 1979) and somewhat less in the test involving section of the optic nerve and blood vessels (Mitashov, 1980b). Though the RPE cells of the peripheral zones of the eye are not involved in regeneration of the retina after its removal or after section of the optic nerve and blood vessels, conditions can be created under which the RPE cells of these zones of the eye will produce a retinal rudiment. The participation of the pigmented epithelium of the peripheral zones in the formation of the retinal rudiment was proved in a test with simultaneous removal of the retina and the entire iris, together with the ciliary part (Mitashov, unpublished). The use of (3H]TdR in this experiment enabled labeling of the proliferating cells. Retinal regeneration begins with the proliferation of the RPE cells in the peripheral zones of the eye at the site of the section. The depigmented cells forming along the edge of the section gradually shift into the interior of the eyeball. Another rudiment of the retina is formed (as in the test involving the removal of the retina) from the RPE cells of the central part of the fundus oculi. Both rudiments formed from the pigmented epithelium of different zones of the eye merge into a single retinal rudiment. The site of their fusion in the eye approximately corresponds to the site of the fusion of the retinal rudiments that emerged from the eye's anterior complex and from the pigmented epithelium of the central part of the fundus oculi in the test involving the removal of the retina. Thus, compared to preceding experimental morphological investigations on NR regeneration in newts, autoradiographic examinations using ['HITdR and [3H]DOPA not only finally proved that RPE cells have a role to play in NR regeneration, but enabled for the first time a determination of the possible number of such cells taking part in the formation of the retinal rudiment.

268 6o

OLGA G . STROEVA AND VICTOR I. MITASHOV

t

Postoperative

days

FIG.30. Change of [3H]TdR labeling index of RPE cells in adult newt T. crisfufus.[3H]TdR ( I pCilg) was injected on the fourth to thirty-fifth day after lens removal and retinectomy. Eyes were fixed 10 hours after [3H]TdR injection. Each point represents one eye. From Mitashov (1969a).

2. Proliferation of RPE and Retinal Rudiment Cells during the Process of Eye Regeneration One of the earliest events in the process of transdifferentiation of the cells of the pigmented epithelium into the retinal rudiment is the proliferation of the pigmented epithelium. The formation of a rudiment of the retina during the latter's restoration requires several divisions of RPE cells. An analysis of the specific features in the proliferative activity of these cells during the regeneration of different eye tissues is important, not only for determining the rate and time of accumulation of a sufficient number of cells for the formation of differentiated structures, but also for revealing whether there is any causal dependence between the cells' passage through the mitotic cycle and their transfer to a different pathway of development. The initiation of DNA synthesis in RPE cells was detected on the second to fourth day following removal of NR or section of the optic nerve and blood vessels (Mitashov, 1969a, 1970; Reyer, 1971a, 1977; Parshina and Mitashov, 1978; Mitashov et a l . , 1980a) and on the tenth day after devascularization of the eye (Keefe, 1973a). The incorporation of ['HITdR was also found in an insignificant percentage of cases in the cell nuclei of control eyes (Mitashov, 1970). Changes in the labeling index of the pigmented epithelium following single injections of [3H]TdR during NR restoration in different types of tests are demonstrated in Figs. 30 and 3 1. A large increase in the labeling index of RPE cells occurs shortly after the initiation of DNA synthesis. Maximum proliferative

RETINAL PIGMENT EPITHELIUM

269

Postoperative days FIG. 31. Change of [3H]TdR labeling index of RPE cells in adult newt T . vulgaris. ['HITdR (1 @/g) was injected on the fourth to the thirty-fifth day after sectioning the optic nerve and blood vessels. Eyes were fixed 10 hours after [3H]TdR injection. Each point represents one eye. From Mitashov (1970).

activity is reached on the fourth to eighth day after surgery and it remains high till the fourteenth to seventeenth day. This is the period when the first cells of the retinal rudiment are formed, which owing to their origination from pigmented epithelium still contain some pigment. This is attested by morphological pictures of regeneration and tests with [3H]DOPA (Figs. 28 and 29). In what manner does the formation of the cells of the retinal rudiment take place? A histological analysis of regeneration pictures enables one to assume the existence of two means of formation of cells of the retinal rudiment. By the first means, individual RPE cells emerge from the outer layer of the retina and move into the cavity of the vitreous body of the eye. The cells transferred into the cavity of the eye proceed to proliferate vigorously. The labeling index in the layer of the first cells of the retinal rudiment reaches 65-70% following pulse labeling with [3H]TdR and 30-40% in the pigmented epithelium (Mitashov, 1980a). The second means of cell formation is associated with the manner of division of the RPE cells in the pigmented epithelium layer. The cells transferred into the cavity of the eye upon completion of mitosis are daughter cells that become cells of the retinal rudiment, while the initial cells remain in the layer of pigmented epithelium. Quantitative data on the correlation of the two means are so far lacking. In approximately 14 to 17 days after surgery, i.e., soon after the formation of the retinal rudiment, the RPE cells gradually cease proliferative activity, although their proliferative activity continues at a lower level up to the thirtieth day after surgery. During this period the regenerating NR continues to be replenished from the pigmented epithelium, a process that leads to the restoration of the

270

OLGA G. STROEVA AND VICTOR 1. MITASHOV

postoperative

days

FIG. 32. Change of [3H]TdR labeling index of RPE cells in adult newt T . vulgaris in pulse).( and reutilization (0)tests. In a pulse-labeling test, [3H]TdR was injected on the second labeling to twelfth day after lens removal and retinectomy. (a) Single injection of [3H]TdR; (b) three injections of [3H]TdR (every 3 hours). Eyes were fixed 3 hours after a single injection of ["H]TdR or 3 hours after the last injection of [3H]TdR in the test with three injections. In the reutilization test, [3H]TdR was injected once (a) or three (b) times before lens removal and retinectomy, then lens and retina were removed 3 hours after ["]TdR injections. Eyes were fixed on the second and the twelfth day after injections of [3H]TdR. Each point represents four to six eyes. Data points give means for each day, vertical lines are standard errors of these means. From Parshina and Mitashov (1978).

initial number of RPE cells, part of which had earlier shifted into the cavity of the eye (Keefe, 1973a; Mitashov, 1974). Figures 30 and 31 show the results of changes in the labeling index of the RPE cells following a single injection with [3H]TdR. Repeated injections of [3H]TdR make it possible to label 70-91% of the cells in the pigmented epithelium (Mitashov, 1969~).By resorting to the technique of reusing the labeled precursors of DNA synthesis, up to 98.5% of the cells can be labeled (Parshina and Mitashov, 1978) (Fig. 32). The proliferative activity of the RPE cells was evaluated, not only by changes in the labeling index during subsequent stages in the regeneration of the eye, but also by determining the parameters of the mitotic cycles as well (Fig. 33) (Mitashov, 1970). The mitotic cycles were studied in the pigmented epithelium on the eighth to tenth and the fourteenth to sixteenth days following surgery on the eyes of two newt species; the values obtained are given in Table VI (Mitashov, 1969b, 1970; Mitashov et al., 1973). The total cell cycle in RPE cells on the eighth to the tenth day after surgery lasts 43 hours (Fig. 33) (Mitashov, 1970). The durations of cell cycle parameters such as S and G , and probably of

RETINAL PIGMENT EPITHELIUM

27 1

FIG.33. Labeled mitoses curve for RPE cells in adult newt T . vulgaris for the eighth to the tenth day after sectioning of the optic nerve and blood vessels. For each point, all cells (six eyes) in metaphase through telophase were scored for the presence of silver grains. Abscissa: time after single injection of I3H]TdR (hours). Ordinate: [-'H]TdR labeling mitoses (%). From Mitashov (1970).

the total cell cycle do not change in the period between the eighth and the sixteenth day after surgery (Table VI). Because the cells of the retinal rudiment in the central part of the fundus oculi are formed from pigmented epithelium, it was of interest to determine the duration of the cell cycles within the retinal rudiment. The mitotic cycles of the proliferating cells of the retinal rudiment were studied in two newt species on different experimental models: following removal of the retina and after section of the optic nerve and blood vessels (Fig. 34; Table VI) (Mitashov, 1969b, 1970; Mitashov et al., 1973). It was found that the duration of the total cell cycle in the retinal rudiment becomes 1.5-2.2 times shorter than in the layer of pigmented epithelium, not only with a sharp reduction in the duration of all the phases of the cell cycle parameters, but also with an increase in the specific time of DNA synthesis in these cells. This type of proliferation is more characteristic of embryonic rudiments (Zavarzin, 1967; Sinitsina, 197 1) and is particularly vividly demonstrated in the retinal rudiment when the duration of the cell cycles is compared with that for retinal development in newt larvae (Sinitsina, 1981) (Table VI). Thus, the proliferative activity of the cells of the retinal rudiment increases sharply following its formation from pigmented epithelium, as testified by the increasing labeled-nucleus index in the retinal rudiment and the accelerated passage of cells through the mitotic cycle. The sharp changes observed in the parameters of proliferative activity in retinal rudiment cells upon their formation from pigmented epithelium point to a rearrangement of the cell cycle and

PARAMETERS OF CELL CYCLES OF RPE CELLS AND

Newt species

T. T. T. T.

vulgaris vulgaris vulgaris vulgaris

T. cristarus T. cristatus T . crisrarus T . crisratus T . vulgaris

TABLE VI RUDIMENT DURING REGENERATION AND EYE DEVELOPMENT (HOURS)

RETINAL

Time after operation (days)

Tissue

8-10 14-16 16-18 20-22

RPE cells Retinal rudiment Retinal rudiment Retinal rudiment

18.5 4.5 5.0-5.5 3.O-4.5

20 16.5 14.5-16.5 20.0-21.0

4.5 2.5 3.5 3.5

14-16 14-16 18-20 22-24 Normal eye development

RPE cells Retinal rudiment Retinal rudiment Retinal rudiment Neural retina

-

19.0 13.0 13.1 12.5-13.0 24.0

2.5 2.5 2.5 2.5 2.5

fG,

%fM

5.5 4.0 4.0

rS

6,

%fM

T

fS/T

43.0 23.5 23.5-25 .O 28 .O-28.5 21 .o 19.7

0.44 0.70 0.62-0.66 0.71 0.74 0.62 0.67

30.5

0.78

-

-

References Mitashov Mitashov Mitashov Mitashov

(1970) (1969b) er al. (1973) er al. (1973)

Mitashov (1969b) Mitashov (1969b) Mitashov er al. (1973) Mitashov er al. (1973) Sinitsina (1981)

RETINAL PIGMENT EPITHELIUM

100.

273

T= 21 hrs S - 13 hrs G2+Y2M:2.5 hrs

G, + 1/2M 5.5 hrs

100 -

3

-

u

l

*

(u

ul

0 4._ E

-

50 -

cn

._ -c W

-

n

-

.

u

-

0

-~b U

I - -

m

u

FIG. 34. Labeled mitoses curve for regenerating NR cells in adult newt for the fourteenth to the sixteenth day after operation. (a) Lens and retina were removed (T. cristatus); (b) N. opticus and blood vessels were cut (T. vulgaris). For each point 600 cells (six eyes) in metaphase through telophase were scored for the presence of silver grains. Abscissa: time after single injection of [3H]TdR (hours). Ordinate: [3H]TdR labeling mitoses (%). From Mitashov (1969b).

274

OLGA G . STROEVA AND VICTOR I. MITASHOV

serve as a criterion of changes taking place in the properties of the cells during the process of their transdifferentiation. Thus, during this period of NR regeneration, the eye contains two subpopulations of cells that differ sharply in every aspect of their proliferative activity. It is important to determine the number of RPE cell divisions necessary for the formation of the retinal rudiment. Here one must distinguish two types of cell divisions in the pigmented epithelium: divisions aimed at the creation of the retinal rudiment and divisions connected with the restoration of the number of cells in the pigmented epithelium itself that were contributed to the formation of the retinal rudiment. We may assume that one division of the RPE cells is sufficient for the formation of the retinal rudiment. The first, still-pigmented cells of the retinal rudiment probably undergo another two or three divisions. As a result of these divisions, the retinal rudiment becomes completely depigmented. Macrophages of vascular origin play an active role in its depigmentation (Keefe, 1973c; Mitashov et al., 1979). The cells of the retinal rudiment, whose mitotic cycles are only half as long as those of the pigmented epithelium, apparently need to pass through another five to seven mitotic cycles before their descendants reveal a marker of NR differentiation-the S- 100 protein, which is specific for neural tissue (Mitashov et af., 1978). In concluding this section, let us note that more complete information regarding the changes in the proliferation of RPE cells in the process of NR regeneration is now available for the urodele amphibians. Studies on the proliferation of pigmented epithelium during retinal regeneration in other amphibian speciesaxolotls and Xenopus-are only just starting (Reyer, 1977; Levine, 1979, 1981; Mitashov et al., 1980b). The removal of the retina in adult Xenopus revealed an activation of RPE cell proliferation, with the [3H]TdR labeled-nucleus index reaching 9.0-17.3% (1.5-3.0% in the control), though NR is regenerated at the expense of cell proliferation of the anterior complex of the eye (Mitashov et al., 1980b; Mitashov and Maliovanova, 1982). 3. Transdifferentiation of RPE Cells in Vitro Because the RPE cells of different animals have long been used for studying their behavior when cultivated outside the organism, it was of interest to compare their proliferation under different conditions. Such a comparison is important not only for a comparative description of cell proliferation,under different developmental conditions, but also for revealing the mechanisms underlying cell transdifferentiation. In this section we shall examine only that experimental data pertaining to RPE cell cultivation that enabled us to shed light on the role of proliferation in the transdifferentiation process. Earlier investigations failed to achieve the transdifferentiation of RPE cells of adult newts into cells of another type of differentiation under conditions of organ culture (Stone, 1958). Quite recently Tsunematsu and Coulombre (1981) were

RETINAL PIGMENT EPITHELIUM

275

the first to obtain positive results under organ culture conditions in the early stages of development of the chicken embryo (Section 11,B). The greatest successes in studying transdifferentiation in vitro were scored using the conditions of clonal cell cultivation of dissociated RPE cells of newts and chickens (Eguchi and Okada, 1973; Eguchi, 1976, 1979; Okada, 1976, 1980; Yasuda et a l . , 1981). Most frequently formed under these conditions of cultivation are “lentoid bodies,” the formation of which requires a relatively long period of time: the transdifferentiation of the RPE cells into lentoid bodies in chicken embryos takes 60-90 days; in quail embryos, 25 days; and in adult newts, 35-40 days. Only in rare cases of adult newt RPE cell clonal cultivation did colonies appear, their morphological criteria resembling those of differentiating neural cells. The cells in these colonies had long axon-like processes, which stained positively by the Bodian method (Eguchi, 1976). During the formation in culture of lentoid bodies from the RPE cells of adult newts, it was possible to determine the duration of the cell cycles and the number of RPE cell divisions. At a low culture density (1 X lo3 cells), the mitotic cycle of the proliferating cells lasted 44 hours (Eguchi, 1976, 1979). These data fully coincide with the results of determining the duration of the mitotic cycles of RPE cells in the process of NR regeneration in vivo (Fig. 33; Table VI) (Mitashov, 1969b, 1970; Mitashov et a l . , 1973). In the clonal cultures of the pigmented epithelium of newts, lentoid bodies appear after 7-10 divisions (Eguchi, 1976, 1979). The proliferating cells of the pigmented epithelium in the process of NR regeneration undergo about the same number of cell divisions (Mitashov, 1980a). In contrast to the pigmented epithelium of newts, the pigmented epithelium of chick embryos in clonal cultures requires 50 preliminary divisions in order to form lentoid bodies. During this long period, the proliferation and accumulation of pigmented cells takes place. They become further depigrnented and form new clone cells and may produce lentoid bodies. Here an important matter must be stressed: during the formation of new pigmented cell clones following a long period of preliminary proliferation, lentoid bodies may be obtained from clones that had developed from a single pigmented cell. It takes about 12 days to produce from a single pigmented cell a mass of cells sufficient for lentoid differentiation (Eguchi and Okada, 1973). However, a long lag period in RPE cell cultivation can be avoided. Thus, in preliminary investigations during the cultivation of dissociated RPE cells of the quail in the presence of 0.5 mM phenylthiourea, Eguchi (1976, 1979) produced lentoid bodies in primary cultures without subculturing 25 days after the beginning of cultivation, an essential step in cloning. B. REGENERATION OF THE LENS 1. Proliferation of the Iris and Lens Rudiment Cells during Lens Regeneration As noted earlier, the transdifferentiation of intensively pigmented cells of the newt iris results in regeneration of the lens.. It was important for us to compare

276

GJ3

OLGA G. STROEVA AND VICTOR 1. MITASHOV

I

..:

,.... .... ... :..

.. ... ... .. '

..

.... .....

. I .

.:. .'..;::.

2 (a) A

.. ..

........

4

( b)

B

A

B

FIG. 35. Scheme of the newt iris: regions of the iris involved and not involved in lens formation. (a) and (b) Iris top view; (c) dorsal area of iris involved and not involved in lens formation; (d) inner and outer leaflets of dorsal iris participating and not participating in lens formation; 1, dorsal iris; 2, ventral ins; 3, dorsal area of iris forming the lens; 4, iris area not participating in lens formation. A,B, sections of dorsal iris at different levels. The incorporation of [3H]DOPA into the cells of dorsal iris (3) is absent during the formation of the lens rudiment, although the incorporation of [3H]DOPA into other regions of the iris is observed. Courtesy of Yamada et al. (1975).

the results of studies on the proliferation of the pigmented cells of the iris and the pigmented epithelium of the newt eye in order to obtain more complete information about cell transdifferentiation. Diverse autoradiographic examinations using [3H]TdR reveal which iris cells directly participate in the restoration of the lens (Fig. 35) (Yamada et al., 1975). In the organism, the lens is formed only from cells located in the inner and outer laminae of the distal zone of the dorsal iris (Eisenberg and Yamada, 1966; Reyer, 1971a, 1982a,b; Eguchi and Shingai, 1971; Yamada ef al., 1975). The cells of the other zones of the dorsal, ventral, and lateral iris do not form a lens, although DNA synthesis and subsequent proliferation are initiated in all zones of the iris. No incorporation of [3H]TdR was detected in the iris of control, nonoperated newts (Eisenberg and Yamada, 1966; Yamada and Roesel, 1969, 1971; Reyer, 1971a; Eguchi and Shingai, 1971), nor were any mitoses seen (Yamada and Roesel, 1971). The initiation of DNA synthesis in the inner lamina of the dorsal iris takes place on the third to fourth day after removal of the lens (Eisenberg and Yamada, 1966; Yamada and Roesel, 1969, 1971; Reyer, 1971a; Eguchi and Shingai, 1971; Grigoryan and Mitashov, 1976; Parshina and Mitashov, 1978). The number of [3H]TdR-labeled cells in the iris epithelium increases on the

277

RETINAL PIGMENT EPITHELIUM

Ia

I b ventral

80 . -970. X

,C" 60

._

.

50 .

0

5 - LO

.

$ - 30

.

a,

a 20 u -10 I

-

S

I

I-

I 2

I

,

1

6

*

,

8 1 0 1 2 2 postoperative

4

,

,

,

IIO

>0 7 0 .

dorsal

I

,

,

,

,

,

6 8 1 0 1 2 days

IIb

T

ventral

FIG. 36. Change of [3H]TdR labeling index of iris inner (la,Ib) and outer (IIaJIb) layer cells in tests. In the pulse-labeling test [3H]TdR was injected on the pulse-labeling (0)and reutilization (0) second to the twelfth day after lens removal and retinectomy. (a) Single injection of [3H]TdR dorsal part of iris; (b) three injections of ['HITdR (every 3 hours], ventral part of iris. Eyes were fixed 3 hours after a single injection of 13H]TdR or 3 hours after the last injection of [3H]TdR in the test with three injections. In the reutilization test, ['HITdR was injected once (a) or three (b) times before lens removal and retinectomy, then lens and retina were removed 3 hours after [3H]TdR injection. Eyes were fixed on the fourth to the twelfth day after injection of [3H]TdR. Each point represents four to six eyes. Bars give means for each day; vertical lines are standard errors of these means. From Parshina and Mitashov (1978).

27 8

OLGA G . STROEVA AND VICTOR 1. MITASHOV 100

-

T = 23.5 hrs

f -

-F K

"

I

10

Y

,

,

,

,

,

,

,

,

I

,

I

I

,

FIG.37. Labeled mitoses curve for lens rudiment in adult newt 7'. crisfatus for the fourteenth to the sixteenth day after lens removal and retinectomy. For each point all cells (six eyes) in metaphase through telophase were scored for the presence of silver grains. From Mitashov (1969~).

fourth to seventh day after the operation. Eguchi and Shingai (1971) revealed two elevations in the [3H]TdR index in the dorsal iris on the seventh and twelfth day after removal of the lens. Following formation of the lens rudiment and its subsequent development, the cells of the iris end the proliferation cycle. Numerous proliferating cells exist in the various portions of the iris not directly involved in the formation of the regenerating lens, as was established when determining the proliferating cell index by using a method that takes into account the phenomenon of reutilization of the labeled precursors of DNA synthesis (Fig. 36) (Parshina and Mitashov, 1978), in contrast to tests involving a single [3H]TdR injection. Determined for the period of active proliferation by the cells of the dorsal iris and the lens rudiment were the duration of mitotic cycles and their parameters on the sixth to tenth and the fourteenth to sixteenth day after the operation (Fig. 37) (Eisenberg-Zalik and Yamada, 1967; Mitashov, 1969c; Yamada et al., 1975). The most substantial results of these few studies done in different laboratories are given in Table VII. The data in that table demonstrate that in this system of regeneration, just as with the regeneration of the retina, the total duration of mitotic cycles and other related parameters of the proliferating cells become greatly reduced, the reduction accompanying an increase of the relative duration of the S phase in the mitotic cycle as the cell population of the dorsal iris follows a new pathway of differentiation. As in the case of regeneration of the neural retina from RPE cells, these data show that the changes in the parameters of the

PARAMETERS OF CELL CYCLES IN

Iris or lens region

Time after operation (days) 6- 10 6-10 6-10 6-10 14-16

TABLE VII DIFFERENTREGIONSOF THE IRIS AND LENS RUDIMENTDURING LENSREGENERATION (HOURS)

Cells not involved in lens formation Ventral Dorsal Dorsal zone forming lens cells Lens rudiment cells

aFor Norophrhalmus viridescens. bFor Trirurus cristatus.

+

b % ~

29.94 18.35 9.40 11.14 5.50

tS

40.50 32.95 27.70 27.09 16.00

tG,

+ 1/2tM 8.11 8.35 7.60 7.60 2.00

T

?SIT

References

78.55 59.65 44.70 45.85 23.50

0.51 0.55 0.63 0.59 0.68

Yamada er al. (1975p Yamada et al. (1975) Yamada e r a!. (1975) Yamada ef a!. (1975) Mitashov ( 1 9 6 9 ~ ) ~

280

OLGA G. STROEVA AND VICTOR I . MITASHOV

proliferating cells of the iris and lens rudiment may serve as an indicator of changes in some of the iris cells’ properties during the process of their gradual transdifferentiation. One of the most crucial moments in the lens regeneration-the dedifferentiation of the dorsal region of the iris, as manifested by the depigmentation of the cells and cytoplasmic shedding-begins at a late phase of the first mitotic cycle and ends in the fourth mitotic cycle (Yamada et al., 1975). Upon completion of dedifferentiation, the cells that are to become the primary lens fibers must pass through another one to two mitotic cycles before they go over to the terminal stage of fiber differentiation in which accumulation of lens crystallins takes place without DNA replication. Also different is the duration of the mitotic cycles of the cells located in different areas of the iris. Only those cells of the dorsal iris that have the shortest duration of the mitotic cycle become lens fibers (EisenbergZalik and Yamada, 1967; Mitashov, 1969c; Yamada et al., 1975). It is probable that there are alternative paths of iris cell development during lens regeneration, paths that are controlled by mitotic cycles differing in duration (Yamada, 1977). This means that the prolongation of the cell cycle and the corresponding completion of a smaller number of cell divisions may cause the absence of lens differentiation. Indeed, in vivo the lens is not formed from the cells of the ventral and proximal zones of the dorsal iris, which during regeneration complete fewer mitotic cycles. Another feature in the proliferative activity of the iris cells can be detected if the results of iris cell cultivation in vitro are compared with regeneration in vivo. 2. Transdifferentiation of the Iris Cells in Vitro Not all reports on iris cell cultivation contain information about cell proliferation. The first experiments on iris cultivation failed to produce lens (Stone and Galagher, 1958; Eguchi, 1967; Eisenberg-Zalik and Meza, 1968; EisenbergZalik and Scott, 1969; Yamada et al., 1973; Yamada and McDevitt, 1974). The first positive results were obtained when advanced stages of lens regeneration were used for cell cultivation (Eisenberg-Zalik and Meza, 1968; Eisenberg-Zalik and Scott, 1969) or when the iris was cultivated in the presence of a frog hypophysis (Connelly et al., 1973; Reese, 1973) or frog NR (Yamada et al., 1973). When transplanted for cultivation, the cells of the newt NR are in the lag phase for the first 20 days, after which they shift into the logarithmic growth phase, with a cell doubling time of 150 hours (Horstman and Zalik, 1974). The cell doubling time, when cultivating iris extracted from the newt eye 10 days after the preliminary removal of the lens, is shorter: 85 hours. Similar values of cell doubling time (84 hours) were obtained for the cell line drawn from the dorsal iris in a culture maintained for several years (Reese et al., 1976). Horstman and Zalik (1974) determined the duration of the mitotic cycle phase when cultivating iris cells and a 10-day iris (the iris cells were placed under cultivation

RETINAL PIGMENT EPITHELIUM

28 1

TABLE VIII PARAMETERS OF CELLCYCLES(HOURS) I N CELLSOF DIFFERENT REGIONS OF IRIS DURING CULTIVATION in Vitro (Noiophrhalmus viridescens)

Whole iris Dorsal iris Ventral iris Dorsal + ventral iris

26.0 46.6 42.0 44.0

36.6 34.6 34.7 35.1

7.0 7.4 6.9 7.3

69.6 88.6 83.6 86.4

Horstman and Zalik (1974) Yamada and Beauchamp (1978) Yamada and Beauchamp (1978) Yamada and Beauchamp (1978)

conditions 10 days after the preliminary removal of the lens from the eye). Similar duration values for iris cell mitotic cycles under cultivation were obtained by Yamada and Beauchamp (1978); see Table VIII. It is noteworthy that no differences were detected in the duration of the mitotic cycles of the cultivated iris cells of the dorsal and ventral zones. Following the dissociation of the iris cells of the dorsal and ventral zones and their separate cultivation, it is possible to obtain lentoid bodies from any zone of the iris (Eguchi et al., 1974), although under in vivo conditions the cells of the dorsal iris alone have this capacity, as was noted earlier (Fig. 35). A comparison of mitotic cycle duration values for in vivo lens regeneration (Table VII) and cell culture regeneration (Table VIII) revealed that with mitotic cycles of different duration under these conditions, one of the most important factors for detecting the signs of lens differentiation is the number of mitotic cycles the proliferating cells have to complete. A rough assessment indicates that for the lens to undergo regeneration under cell culture conditions, just as under in vivo conditions, the cells of the iris must complete six mitotic cycles (Yamada et al., 1975). Because the reduction of the parameters of the mitotic cycles takes place in the presence of the retina, it was suggested that some signal issuing from the retina may speed up proliferation and shorten the mitotic cycles rather than initiate cell transformation (Yamada et al., 1975; Yamada and Beauchamp, 1978).

C. COMPARISON OF THE CHARACTERISTICS OF EYECELLPROLIFERATION DURING RETINAAND LENS REGENERATION IN NEWTS A comparison of the proliferative activity of RPE cells and cells of the retinal rudiment, of the iris, and of the lens rudiment in the process of NR and lens regeneration in newts reveals much that is common and similar. First of all, during the transdifferentiation of the pigmented cells of the eye, a large reduction both of the total duration of mitotic cycles and of their individual parameters during proliferation takes place. Another feature in proliferation is that the cells

282

OLGA G. STROEVA AND VICTOR 1. MITASHOV

must complete a certain number of mitotic cycles-from 6 to 10-before characteristics of another type of differentiation are revealed in their descendants. During cultivation, the pigmented cells of the eye pass through approximately the same number of mitotic cycles as they do in situ before the characters of another type of differentiation are revealed in their descendants. Here two types of proliferation in cell cultivation must be distinguished. The first proliferative wave is the proliferation of cells in primary cultures, where cell transdifferentiation is not yet manifested. This period is characterized above all by the accumulation of a certain number of differentiated cells. It is only the next proliferative cycle of a new generation of cells, initially still intensively pigmented, that leads to the differentiation of lentoid bodies. In this final proliferative cycle of clones arising from a single pigmented cell, a breed of cells that form lentoid bodies after the passage of perhaps 10 mitotic cycles within 12 days of cultivation is obtained (Eguchi and Okada, 1973; Eguchi, 1976, 1979). Whether a shortening of both the total mitotic cycle and of its individual parameters takes place in this final cycle of proliferation is unknown. Even when it becomes possible to shorten the lag phase during the cultivation of the RPE cells of quails in the presence of 0.5 mM phenylthiourea, the earlier manifestation of lensdifferentiated cells again takes place only after previous proliferation (Eguchi, 1976, 1979). Though this preliminary work by Eguchi does not define the number of mitotic cycles required, one may conclude from the indicated time of lentoid body differentiation that their presumed number is not more than 10. However, the most important thing for an understanding of the mechanisms of cellular transdifferentiation is to reveal the causal relationship between cell proliferation and the formation of NR and lens in the process of eye restoration. This relationship is probably manifested in the dependence of the dedifferentiation of RPE and iris cells on proliferation, because cytoplasmic detachment and melanin granule expulsion occur only during the cells' passage through the mitotic cycles. There is probably also a causal relationship between the shortening time of mitotic cycles in the cells of the retinal and lens rudiments and their formation. The causal relation is manifested in that the final loss of specific features by the pigmented cells takes place only against the background of their intensive proliferation. Is it possible to single out from the aforementioned specific features in the proliferation of the eye's pigmented cells and the cells of the rudiment of the retina and lens forming from them those features that are most essential for the transdifferentiation process? The most important, perhaps, is the process of cell dedifferentiation against the background of their intensive proliferation given the certain completion of a definite number of mitotic cycles. Are these processes influenced by some extraneous factors? Such factors are most probable during the transdifferentiation of the cells of the iris into the lens. It is presumed that some substances secreted by the retina of the adult newt speed up the prolifera-

RETINAL PIGMENT EPITHELIUM

283

tion of iris cells (Yamada et al., 1975; Yamada and Beauchamp, 1978) but do not initiate the transdifferentiation process itself. Under in vivo conditions, the vitreous body may be the conductor of such substances (Gulati, 1980, 1981; Gulati and Reyer, 1980; Gulati et al., 1981). Similar results were obtained by Mitashov et al. (1983) in the experimental investigation of [3H]tryptophanincorporation in the process of lens and NR regeneration in adult newts. During transdifferentiation of pigmented cells under in vitro cultivation conditions, the external signals may come from some kind of factors in the culture medium. However, it is not known whether there exist some specific phases in the structure of the mitotic cycle to which these suggested factors may respond. Still less elaborated are the conceptions about the action of extraneous factors during in situ transdifferentiation of the pigmented epithelium in adult newts. So far such factors have not been detected in the process of NR regeneration. IN SPECIFIC SYNTHESES DURING EYEREGENERATION D. CHANCES

Another essential aspect for understanding cell transdifferentiation mechanisms in the process of eye regeneration concerns changes in the differentiation of the initial cells during the formation of the retinal and lens rudiment. We shall examine in this section the macromolecular syntheses that help to assess the changes in the differentiation of transdifferentiating cells. Let us examine these events in eye regeneration that are in the background of changing cell proliferation. Melanin synthesis is a specific characteristic of the pigmented cells of newt eyes. As already noted (Section III,A), the precursor of melanin synthesis is known-it is the amino acid DOPA, which under the effect of the enzyme tyrosinase forms melanin in the pigmented cells of newts, just as in those of mammals (Model, 1973; Moran et al., 1973). This is deposited on special protein structures, the protein matrix-premelanosomes. The simultaneous use of [3H]TdR and [3H]DOPA revealed in the RPE and iris the subpopulation of cells incorporating both precursors during different stages of eye regeneration (Grigoryan and Mitashov, 1979; Mitashov and Grigoryan, 1980a,b). Figure 28 gives the index values of cells containing [3H]TdR and [3H]DOPA for different zones of the pigmented epithelium as the restoration of the eye proceeds. The following paragraph provides a brief comparison of the basic data for the pigmented epithelium and the iris. We have already considered the details of the spatial distribution of cells in the pigmented epithelium once melanin synthesis has been initiated in them. This enabled a determination of the number of RPE cells participating in the restoration of NR (Section 111,A). We shall merely note here that against a background of melanin biosynthesis the peripheral zones of the pigmented epithelium contain only 4-6% of cells with [3H]TdR (Fig. 28). The RPE cells in the area of the fundus oculi contain no [3H]DOPA throughout the entire period of transdifferen-

284

OLGA G . STROEVA AND VICTOR 1. MITASHOV

tiation into the retinal rudiment, whereas the index of [3H]TdR-labeled cells reaches nearly 50% (Fig. 28). Thus, in this area with a background of a high RPE cell proliferation level, the synthesis of specific melanin granules comes to an end. The autoradiographic data about the distribution and location in the iris of cells in the phase of melanin synthesis indicate that melanin synthesis occurs in the cells of the outer lamina of the ciliary zone throughout the process of lens regeneration (Figs. 28 and 35). Just as in the peripheral regions of the pigmented epithelium, the metabolism of melanin being synthesized is most active in this zone of the iris (Mitashov, 1978). Along with the formation, growth, and pinching off of the regenerating lens, the number of melanin-synthesizing cells sharply increases in the outer lamina of the ciliary zone. There are no cells that incorporate [3H]DOPA in the inner lamina of the ciliary zone because all the cells are nonpigmented. During lens rudiment formation, the number of cells in the melanin-synthesizing phase drops sharply in the outer lamina of the pupillary zone, whereas the cells in the inner lamina of this zone do not synthesize melanin at all. Regarding the drop in the number of cells in the melanin-synthesizing phase in the outer and inner laminae of the pupillary zone of the dorsal iris, it is important to note the location of the cells synthesizing and not synthesizing melanin. The most noteworthy result was that no labeled cells were detected at all in the region of transition of the outer into the inner lamina of the dorsal iris (i.e., in the zone of lens rudiment formation) (Figs. 28 and 35). Thus, the transformation of iris cells into cells of another type of differentiation, just as in the case of NR regeneration from the pigmented epithelium (Mitashov et al., 1978), takes place upon termination of synthesis of specific products characteristic of the initial cell type. The termination of melanin synthesis in the iris occurs long before the detection of protein (a-, p-, and y-crystallins) specific for the lens differentiation cells in the descendants of the iris cells (Takata er al., 1964, 1965, 1966). What merits special attention is the fact that the most significant changes in the [3H]DOPA-labeledcell index occur in the dorsal iris. This is quite natural because the cells in this zone are the most depigmented in the process of lens formation. What proved most amazing and unexpected was that in the absence of [3H]DOPA incorporation in the cells of the pupillary zone of the iris forming the lens, and in the cells of the lens, there is increased activity of tyrosinase (the key enzyme of melanin biosynthesis) in these portions of the regenerating system (Achazi and Yamada, 1972). No other functions of this enzyme are known apart from the hydroxylation of tyrosine and dehydroxyphenylalanine by way of melanin biosynthesis. The absence of [3H]DOPA incorporation in lens cells, combined with high tyrosinase activity, is probably determined by the absence of the structual component premelanosomes on which melanin is synthesized and deposited. The results concerning the changes of [3H]DOPA incorporation in the cells of the dorsal area of the iris in comparison

RETINAL PIGMENT EPITHELIUM

285

with data about tyrosinase activity mean that at the molecular level pigmented cells do not lose all their characteristics during their transformation into cells of another differentiation type. What is the correlation between proliferation processes during transdifferentiation and the new proteins appearing in the lens rudiment? The specific marker proteins of the lens are the crystallins, which have been discovered only in the lens and have not been detected in any other tissues of the eye. The method of immunofluorescence has been used to determine the time of synthesis of the lens antigens during its regeneration (Takata et al., 1964, 1965, 1966). The specific proteins of lens differentiation appear for the first time in a small number of would-be lens fibers during the fourth stage of regeneration. By the simultaneous use of [3H]TdR autoradiography and immunofluorescence, Yamada (1966) demonstrated that the appearance of a-and P-crystallins takes place not earlier than 3 hours after the proliferating cells of the regenerating lens complete the final S phase; y-crystallins in the same cells of the regenerating lens appear still later: 1.5 days after completion of the last S phase. Yamada also demonstrated that along with the growth of the regenerating lens the y-crystallins are synthesized in the lens fibers only, whereas a- and P-crystallins are synthesized both in the fibers and in the lens epithelium. Thus, in this system, mutually exclusive events between the synthesis of DNA and y-crystallin in the lens fibers were discovered. At the same time, there exists a combination of proliferation and specific synthesis in the lens epithelium where DNA synthesis as well as that of a-and P-crystallins can proceed in the same cells. Thus, the transdifferentiation of pigmented cells of the eye into the retinal and lens rudiments proceeds against a background of canceled synthesis of melanin, which supplements very well the previously discovered phenomenon of cytoplasmic shedding (Dumont and Yamada, 1972) in the process of lens regeneration, The experimental results demonstrate that the changes in the indicators of differentiation of the initial cells during their transdifferentiation are probably regulated at the levels of transcription and translation.

IV. General Conclusions Recent investigations revealed that cell proliferation is of great importance in the development and transdifferentiation of the pigmented epithelia of the eye. The melanotic differentiation of the RPE melanocytes as compared to that of other pigment cells has been reviewed by Whittaker (1974) and Garcia et al. (1979b). The data discussed in this article revealed some new aspects of the regulatory mechanisms of melanotic differentiation of pigment cells. The studies in vivo have shown that ontogenic melanization of the RPE is not a process of self-differentiation. In RPE development of both chick embryos and postnatal rats, two phases of melanin synthesis were found.

286

OLGA G . STROEVA AND VICTOR I . MITASHOV

Because BUdR does not prevent the onset of the first phase of the RPE pigmentation in chick embryos, the mechanism proposed by Benson and Triplett (1974) seems to operate in the initial events of melanin synthesis. They showed that in Rana pipiens embryos, tyrosinase is synthesized as early as during neurulation and is stored in the inactive state by being bound to protein-inhibitor. The subsequent involvement of tyrosinase in melanogenesis is regulated at the posttranslational level by the specific proteases (Barisas, 1974; Slaughter and Triplett, 1975a,b). It seems that the same holds true for mammals. The data on the timing of X chromosome inactivation in mosaic mice support the idea that determination of RPE melanotic differentiation occurs no later than at the neural plate stage (Deol and Whitten, 1972). The onset of the second phase of RPE melanization in chick embryos is controlled by new transcriptional events, and in postnatal rats it seems to be melanotropin dependent. However, more studies are needed to discover the molecular mechanisms of the processes under investigation. In both species, differentiative signals for the onset of the second phase of melanin synthesis act during intensive cell proliferation, which is eye-growth independent. Conversely, the expression of the final phase of RPE melanotic differentiation proceeds against a background of low-level proliferation, which is eye-growth dependent. Causal relationships between RPE melanotic differentiation and proliferation during intrauterine life in rats still remain unknown. Finally, the finding that RPE cells of adult chick are incapable of repigmentation in long-term cell cultures suggests that gene activity necessary for melanin synthesis becomes irreversibly repressed as soon as the program of definitive melanization of the RPE has been accomplished. A peculiar type of melanin synthesis regulation was found during eye regeneration in adult newts. In the course of NR regeneration, two subpopulations of RPE cells were observed. At the RPE periphery, melanin synthesis goes on during NR restoration, and only a few cells with [3H]TdR can be distinguished. The cells of this zone are not involved in the formation of the retinal rudiment. On the contrary, RPE cells of the fundus oculi area do not synthesize melanin throughout the entire period of their transdifferentiation, which coincides in time with a high level of RPE cell proliferation. It is very important to note that RPE cells that incorporate no labeled melanin precursor are those containing some pigment. Only after the retinal rudiment has been formed do RPE cells of this zone begin to resynthesize melanin to restore the original level of melanization. Similar events were discovered during lens regeneration. The molecular mechanism of these phenomena remains obscure. Thus, a change in kinetics of cell populations seems to be one of the regulatory mechanisms of the expression of RPE melanotic differentiation. In adult newts during NR and lens regeneration, both dedifferentiation and transdifferentiation of pigment cell progeny are related not only to an increase in

RETINAL PIGMENT EPITHELIUM

287

the proportion of cyclic cells as well as to a shortening of the total cell cycle, but also to a change in specific duration of the cell cycle phases. The capacity of chick RPE for transdifferentiation into neural retina correlates with intensive proliferation and short cell cycle in situ, whereas the stabilization of RPE cells coincides in time with a decrease in a proportion of cyclic cells that replicate with prolonged generation time. Further experiments are needed for detailed analysis of such a phenomenon. Assuming that both protyrosinase and retina cognins are synthesized in all eye rudiment cells, it may .be possible to account for retinal differentiation of the RPE as well as for the appearance of pigmented cells in clonal cultures of the neural retina cells (for references, see Okada, 1980). The expression of either eye cell phenotype would depend, therefore, on cell interactions within a particular pattern of morphogenesis and environmental conditions (see, for example, Clayton et al., 1977; Prichard, 1981; de Pomerai and Gali, 1981) and ought to be dependent on the cell cycle events. The state of unstable determination (pigmented cells versus lentoid ones in long-term cell culture) is preserved as long as RPE cells of donor chick embryos have not completely withdrawn from reproduction. Thus, the state of a nondividing RPE cell population in situ is a prerequisite of manifestation of the stable RPE cell determination in culture. It seems possible to conclude, therefore, that cell proliferation not only is closely related to cell multiplication and reduction of cell volume, but is essential for RPE melanotic differentiation and for transdifferentiation into other cell types. We believe the preceding conclusions open the way for a detailed analysis of these phenomena.

ACKNOWLEDGMENTS We have the pleasure of expressing our gratitude to Professor Bruce Carlson and to our colleagues and friends Dr. A. Kostomarova and Mrs. G. Losovskaya for reading and helpful revising of the manuscript. We are also grateful to our colleagues Mrs. I. Panova and Mrs. E. Grigoryan for their valuable technical assistance during preparation of the manuscript for publication.

REFERENCES Achazi, R., and Yamada, T. (1972). Dev. B i d . 27, 295-306. Anderson, D . H . , Stem, W. T . , Fisher, S. K . , Erickson, P. A , , and Borgula, G . A . (1981). Invest. Ophrhalmol. Visual Sci. 21 (part I ) , 10-16. Barisas, B . G. (1974). J . B i d . Chem. 249, 3151-3156. Bellawy, D. (1974). In “Humoral Control of Growth and Differentiation” (J. LoBlue and A. S. Gordon, eds.), Vol. 2, pp. 219-273. Academic Press, New York.

288

OLGA G. STROEVA AND VICTOR I. MITASHOV

Benson, S. C., and Triplett, E. L. (1974). Dev. Biol. 40, 270-282. Birch, D. G., and Jacobs, G. H. (1979). Invest. Ophthalmol. Visual Sci. 18, 752-756. Bok, D., and Hall, M. 0. (1969). Invest. Ophthalmol. 8, 649-650. Bok, D., and Hall, M. 0. (1971). J. Cell Biol. 49, 664-682. Bonting, S. L., Caravaggio, L. L., and Gouras, P. (1961). Exp. Eye Res. 1, 14-24. Brackevelt, C. R., and Hollenberg, M. J. (1970). Exp. E y e R e s . 9, 124-131. Brodsky, W. Ya., and Uryvaeva, I. V. (1977). Inr. Rev. Cytol. 50, 275-332. Browman, K. (1954). Generics 39, 261-265. Browman, L., and Ramsey, F. (1943). Arch. Ophthalmol. 30, 338-351. Cahn, R. D. (1968). In “The Stability of the Differentiated State” (H. Ursprung, ed.), pp. 58-84. Springer-Verlag, Berlin and New York. Chader, G. J., Newsome, D. A,, Bensinger, R. E., and Fletcher, R. T. (1975). Invest. Ophthalmol. 14, 108-113. Clayton, R. M., de Pomerai, D. I., and Pritchard, D. J. (1977). Dev. Growth Differ. 19, 319-328. Coleman, A. W., Coleman, J. W., Kankel, D., and Werner, H. (1970). Exp. CellRes. 59,319-328. Connelly, T. G . , Ortiz, J. R., and Yamada, T. (1973). Dev. Biol. 31, 301-315. Coulombre, A. J. (1955). Am. J. Anat. 96, 153-184. Coulombre, A. J. (1956). J . Exp. Zool. 133, 211-226. Coulombre, A. J., and Coulombre, J. (1964). J . Exp. Zool. 156, 39-47. Coulombre, A. J., and Coulombre, J. (1965). Dev. Biol. 12, 79-92. Coulombre, J., and Coulombre, A. (1970). Nature (London) 228, 559-560. Coulombre, A. J., Steinberg, S. N., and Coulombre, J. L. (1963). Invest. Ophthalmol. 2, 83-89. Curtis, A. S., and Seehar, G. M. (1978). Nature (London) 274, 52-53. Custer, N. V., and Bok, D. (1975). Exp. Eye Res. 21, 153-166. Deol, M. S., and Whitten, W. K. (1972). Nature (London) New Biol. 238, 159-160. De Robertis, E. (1960). J. Gen. Physiol. 43, 1-14. Doezema, P. (1973). Comp. Biochem. Physiol. Ser. B 46, 509-517. Dowling, J. E., and Gibbons, I. R. (1962). J. Cell Biol. 14, 459-474. Dowling, J. E., and Sidman, R. L. (1962). J. Cell Biol. 14, 73-109. Dumont, J. N., and Yarnada, T. (1972). Dev. Biol. 29, 385-401. Eckmiller, M. S., and Steinberg, R. H. (1981). Invest. Ophthalmol. Visual Sci. 21, 369-394. Edwards, R. B., and Bakshian, S . (1980). Invest. Ophthalmol. Visual Sci. 19, 1184-1189. Edwards, R. B., and Szamier, R. B. (1977). Science 197, 1001-1003. Eguchi, G. (1967). Embryologia 9, 246-266. Eguchi, G. (1976). Ciba Found. Symp. 40, 241-253. Eguchi, G. (1979). In “Mechanisms of Cell Change” (J. D. Ebert and T. S. Okada, eds.), pp. 273-291. Wiley, New York. Eguchi, G., and Okada, T. S. (1973). Proc. Natl. Acad. Sci. U.S.A. 70, 1495-1499. Eguchi, G., and Shingai, R. (1971). Dev. Growth Difler. 13, 337-349. Eguchi, G., Abe, S. I., and Watanabe, K. (1974). Proc. Natl. Acad. Sci. U.S.A. 71, 5052-5056. Eisenberg, S., and Yamada, T. (1966). J . Exp. Zool. 162, 353-361. Eisenberg-Zalik, S., and Meza, I. (1968). Nature (London) 217, 179-180. Eisenberg-Zalik, S., and Scott, V. (1969). Dev. Biol. 19, 368-379. Eisenberg-Zalik, S., and Yamada, T. (1967). J. Exp. Zool. 165, 385-394. Feeney, L. (1973). Dev. Biol. 32, 101-114. Folkman, J., and Moscona, A. (1978). Nature (London) 273, 345-349. Frayer, W. C. (1966). Trans. Am. Ophthalmol. SOC.64, 586-643. Friedman, E., and Tso, M. 0. M. (1968). Arch. Ophthalmol. 79, 315-320. Garcia, R. I., Werner, I., and Szabo, G. (1979a). In Virro 15, 770-788.

RETINAL PIGMENT EPITHELIUM

289

Garcia, R. I., Szabo, G., and Fitzpatrick, T. B. (1979b). In “The Retinal Pigment Epithelium” (K. M . Zinn and M. F. Marmor, eds.), pp. 124-147. Harvard Univ. Press, Cambridge, Massachusetts. Gayer, K. (1942). J. Exp. Zool. 89, 103-145. Gaze, R. W., and Watson, W. E. (1968). In “Growth of the Nervous System” (G. E. W. Wolstenholme and M. O’Connor, eds.), pp. 53-76. Little Brown, Boston, Massachusetts. Goldman, A. I., O’Brien, P. J., Masterson, E., Israel, P., Teirstain, P., and Chader, G. (1979). Exp. Eye Res. 28, 455-467. Gorbunova, M. P., and Stroeva, 0. G. (1972). Tsitologiya 14, 1076-1083. Govardowsky, V. I., and Harckewich, T. A. (1966). In “Primary Processes in Receptor Elements of the Sensory Organs,” pp. 5-21. Nauka, Moscow. (In Russian) Grigoryan, E. N., and Mitashov, V . I. (1976). Onrogenez 7, 64-69. Grigoryan, E. N., and Mitashov, V. I. (1979). Ontogenez 10, 137-144. Gulati, A. K. (1980). J. Exp. Zool. 214, 101-108. Gulati, A. K. (1981). Anat. Rec. 199, 297. Gulati, A. K., and Reyer, R. W. (1980). J. Exp. Zool. 214, 109-118. Gulati, A, K., Zalewski, A. A., Reyer, R. W., and Reasor, M. J. (1981). Growth 45, 135-144. Hasegawa, M. (1958). Embryologia 4, 1-32. Hasegawa, M. (1965). Embryologia 8, 362-386. Hayashi, M., Matsumoto, A,, Hamashima, Y., and Tsukahara, 1. (1979). Exp. Eye Res. 28, 427-434. Herron, W. L., Riegel, B. W., Meyers, 0. E., and Rubin, M. L. (1969). Invest. Ophthalmol. 8, 595-604. Herron, W. L., Riegel, B. W., and Rubin, M. L. (1971). Invest. Ophthalmol. 10, 54-63. Herron, W. L., Riegel, B. W., Brennan, E., and Rubin, M. L. (1974). Invest. Ophthalmol. 13, 87-94. Hogan, M. J., Alvarado, J. A,, and Weddell, I . E. (1971). In “Histology of the Human Eye,” pp. 393-522. Saunders, Philadelphia, Pennsylvania. Hori, Y., Hsin-su, Yu, Miyamoto, M., and Fitzpatrick, T. B. (1981). J. Electron Microsc. 30, 8-21. Horstman, L. P.,and Zalik, S. E. (1974). Exp. Cell Res. 84, 1-14. Ide, C. (1972). Z . Zellforsch. Mikrosk. Anat. 131, 171-186. Inomata, H., Ishikawa, Y.,and Ikui, H. (1979). In “Ophthalmology” (K. Shimizu and J . A. Oosterhuis, eds.), pp. 608-61 1. Excerpta Medica, Amsterdam. Israel, P., Masterson, E., Goldman, A. I . , Wiggert, B., and Chader, D. J . (1980). Invesr. Ophthalmol. Visual Sci. 19, 720-727. Jimbow, K., Roth, S. I., Fitzpatrick, T. B., and Szabo, G . (1975). J . Cell Biol. 66, 663-670. Keefe, J . R. (1971), J . Exp. Zool. 177, 263-294. Keefe, J . R. (1972). Anat. Rec. 172, 341. Keefe, J. R. (1973a). J. Exp. Zool. 184, 185-206. Keefe, J . R. (1973b). J. Exp. Zool. 184, 207-232. Keefe, J . R. (1973~).J. Exp. Zool. 184, 233-238. Keefe, J . R. (1973d). J. Exp. Zool. 184, 239-258. Koga, N., Koshibu, A,, and Uama, M. (1977). Acta Soc. Ophthalmol. Jpn. 81, 701-719. Kuwabara, T. (1979). In “The Retinal Pigment Epithelium” (K. M. Zinn and M. F. Marmor, eds.), pp. 58-82. Harvard Univ. Press, Cambridge, Massachusetts. Kuwabara, T., and Weidman, T. A. (1974). Invest. Ophthalmol. 13, 725-739. Landers, M. B., Wolbarsht, M. L., Dowling, J. E., and Laties, A. M., eds. (1977). Adv. Exp. Med. Biol. 77.

290

OLGA G. STROEVA AND VICTOR 1. MITASHOV

LaVail, M. M. (1979). In “The Retinal Pigment Epithelium” (K. M. Zinn and M. F. Marmor, eds.), pp. 357-380. Harvard Univ. Press, Cambridge, Massachusetts. LaVail, M. M., and Battelle, B. A. (1975). Exp. Eye Res. 27, 167-192. LaVail, M. M., and Mullin, R. J. (1977). Adv. Exp. Med. Eiol. 77, 153-178. Lerner, A. B., Moellmann, G . , Varga, J. M., Halaban, R., and Pawelek, J. (1979). Cold Spring Harbor Conf. Cell Prolif. A , 187- 198. Levine, R. L. (1975). J . Exp. Zool. 192, 363-380. Levine, R. L. (1977). J . Enp. Zool. 200, 41-54. Levine, R. L. (1979). Invest. Ophrhalmol. Visual Sci. Suppl. April, 43. Levine, R. L. (1981). Rev. Can. Eiol. 40, 19-27. Lopashov, G. V., and Stroeva, 0. G. (1964). “Development of the Eye. Experimental Studies.” Israel Program for Scientific Translations, Jerusalem. Machemer, R. (1968). Am. J. Ophrhalmol. 66, 396-427. Machemer, R., and Laqua, H. (1975). Am. J . Ophthalmol. 80, 1-23. McKeehan, M. S. (1961). Anar. Rec. 141, 227-230. Mann, I. (1949). “The Development of the Human Eye.” British Medical Association, London. Marshak, T. L. (1974). Onrogenez 5 , 192-197. Marshak, T. L., and Stroeva, 0. G . (1973). Onrogenez 4, 516-519. Marshak, T. L., and Stroeva, 0. G. (1974). Arch. Anar. Histol. Embryol. 66, 94-98. Marshak, T. L., Gorbunova, M. P., and Stroeva, 0. G. (1972). Tsirologiya 14, 113-1126. Marshak, T. L., Stroeva, 0. G., and Brodsky, W. Ya. (1976). Zh. Obsch. Eiol. 35, 608-614. Mason, H. S., Ingram, D. J. E., and Allen, B. (1960). Arch. Eiochem. Eiophys. 86, 225-230. Merin, S., and Auerbach, E. (1976). Survey Ophthalmol. 20, 303-346. Mishima, H., Hasebe, H., and Fujita, H. (1978). Invest. Ophrhalmol. Visual Sci. 17, 403-41 I . Mitashov, V. I. (1968). Dokl. Akad. Nauk SSSR 181, 1510-1513. Mitashov, V. I. (1969a). Tsirologiya 11, 434-446. Mitashov, V. I. (1969b). Dokl. Acad. Nauk SSSR 189, 666-669. Mitashov, V. I. (1969~).Dokl. Acad. Nauk SSSR 189, 913-916. Mitashov, V. I . (1970). Tsitologiya 12, 1521-1529. Mitashov, V. 1. (1974). Onrogenez 5 , 79-82. Mitashov, V. I. (1976). Onrogenez 7, 495-501. Mitashov, V. I. (1977). In “Morphogenetic Cell Interactions” (Soviet-Finnish Symposium), pp. 14-15. Meilahti Medical Center, Helsinki. Mitashov, V. I. (1978). Onfogenez 9, 183-188. Mitashov, V. I. (1980a). Tsirologiya 22, 371-380. Mitashov, V. I. (1980b). Onrogenez 11, 246-240. Mitashov, V. I., and Grigoryan, E. N. (1980a). Onrogenez 11, 160-167. Mitashov, V. I., and Grigoryan, E. N. (1980b). Inr. Embryol. Conf.,12rh, Parras p. 86. (Abstr.) Mitashov, V. I., and Maliovanova, S. D. (1982). Ontogenez 13, 228-234. Mitashov, V. I., Stroeva, 0. G., and Sinitsina, V. F. (1973). Onrogenez 4, 568-580. Mitashov, V. I., Sviridov, S. M., Korochkin, L. I., Grigoryan, E. N., and Maletskaya, E. (1978). Ontogenez 9, 401-406. Mitashov, V. I., Starostin, V. I., Sludskaya, A. I., and Parshina, E. F. (1979). Ontogenez 10, 365-371. Mitashov, V. I . , Grigoryan, E. N., and Moskovkin, G. N. (1980a). In “Ontogenesis of the Brain” (S. Trojan and F. Stastny, eds.), Vol. 3, pp. 105-108. Universitas Carolina Pragensis, Prague. Mitashov, V. I., Reznikov, K. J., Moskovkin, G. N., Grigoryan, E. N., and Maliovanova, S. D. (1980b). In “Ontogenesis of the Brain” (S. Trojan and F. Stastny, eds.), Vol. 3, pp. 109-1 I I . Universitas Carolina Pragensis. Prague. Mitashov, V. I., Grigoryan, E. N., and Chernova, N. V. (1983). Onfogenez 14, 390-397.

RETINAL PIGMENT EPITHELIUM

29 1

Miyamoto, M., and Fitzpatrick, T. B. (1957). Science 126, 449-450. Model, P. G. (1973). Dev. Biol. 34, 297-308. Model, P. G., and Dalton, H. C. (1968). Dev. Biol. 17, 245-271. Moran, D., Palmer, J. D., and Model, P. G. (1973). Dev. Biol. 32, 15-27. Moscona, A. A., and Hausman, R. E. (1977). In ‘‘Cell and Tissue Interactions” (J. M. Lash and M. M. Burger, eds.), pp. 173-185. Raven, New York. Mullin, R. .I.and , LaVail, M. M. (1976). Science 192, 799-801. Mund, M. L., and Rodrigues, M. M. (1979). In “The Retinal Pigment Epithelium” (K. M. Zinn and M. F. Marmor, eds.), pp. 45-52. Harvard Univ. Press, Cambridge, Massachusetts. Nguen-Legros, J. (1978). Inr. Rev. Cyrol. Suppl. 7, 287-328. Okada, T. S. (1976). In “Tests of Teratogenicity in Vitro” (J. Ebert and M. Marois, eds.), pp. 91-105. North-Holland Pub]., Amsterdam. Okada, T. S. (1980). Curr. Top. Dev. B i d . 16, 349-380. Orts-Llorca, F., and Genis-Galvez, J. M. (1960). Acra Anar. 42, 31-70. O’Steen, W. K., and Karcioglu, Z. A. (1974). Am. J . Anar. 139, 503-517. Panova, I. G. (1982). Ontogenez 13, 202-204. Panova, I. G., and Stroeva, 0. G. (1978). Ontogenez 9, 179-183. Panova, I. G . , and Stroeva, 0. G. (1983). Zh. Obsch. Biol. 44, 108-1 13. Parshina, E. F., and Mitashov, V. I. (1978). Ontogenez 9, 616-626. Philp, N. J., and Bernstein, M. H. (1981). Exp. Eye Res. 33, 47-53. Pomerai, de, D. I . , and Gali, M. A. H. (1981). J. Embryol. Exp. Morphol. 62, 291-308. Pritchard, D. J. (1981). J. Embryol. Exp. Morphol. 62, 47-62. Puzzolo, D., and Simone, I. D. (1979). Experienria 35, 98-101. Quastler, H., and Shermann, F. (1959). Exp. Cell Res. 17, 420-438. Redfern, N., Israel, P.,Bergsma, D., Robinson, W. G., Jr., Whihehart, D., and Chader, G. (1976). Exp. Eye Res. 22, 559-568. Reese, D. H. (1973). Exp. Eye Res. 17, 435-444. Reese, D. H., Yamada, T., and Moret, R. (1976). DifSerenriarion 6, 75-82. Reyer, R. W. (1954). Q.Rev. Biol. 29, 1-46. Reyer, R. W. (1962). In “Regeneration” (20th Growth Symposium), (D. Rudnick, ed.), pp. 211-265. Ronald Press, New York. Reyer, R. W. (1971a). Dev. Biol. 24, 533-558. Reyer, R. W. (1971b). Anar. Rec. 169, 410-411. Reyer, R. W. (1977). Handb. Sens. Physiol. pp. 309-390. Reyer, R. W. (1982a). Am. J. Anar. 163, 1-23. Reyer, R. W. (1982b). Am. J . Anat. 163, 25-45. Rodesch, 1. (1971). Exp. Cell Res. 76, 55-62. Rumyantsev, P. P. (1977). Inr. Rev. Cyfol. 51, 187-273. Scheib, D. (1965). Ergebn. Anar. Enwicklungs gesch. 38, 45-1 14. Sinitsina, V. F. (1971). Arch. Anat. Histol. Embryol. 61, 58-67. Sinitsina, V. F. (1981). Ontogenez 12, 521-525. Slaughter, D., and Triplett, E. (1975a). Cell Diyer. 4, 11-22. Slaughter, D., and Triplett, E. (1975b). CellDifSer. 4, 23-34. Stone, L. S. (1950a). J. Exp. Zool. 113, 9-31. Stone, L. S. (1950b). Anar. Rec. 106, 89-109. Stone, L. S. (1958). J . Exp. Zool. 134, 69-84. Stone, L. S. (1959). In “Regeneration in Vertebrates” (C. S. Thornton, eds.), pp. 3-14. Univ. of Chicago Press, Chicago, Illinois. Stone, L. S. (1965). Invesr. Ophrhalmol. 4, 420-432. Stone, L. S., and Gallagher, S. B. (1958). J . Exp. Zool. 139, 247-262.

292

OLGA G. STROEVA AND VICTOR I. MITASHOV

Stone, L. S., and Steinitz, H. (1953). J . Exp. Zool. 124, 435-468. Stone, L. S., and Zaur, L. S. (1940). J . Exp. Zool. 85, 243-269. Streeten, B. (1969). Arch. Ophthalmol. 81, 383-394. Stroeva, 0. G. (1960). J. Embryol. Exp. Morphol. 8, 349-368. Stroeva, 0. G. (1962). Dokl. Acad. Nauk SSSR 143, 991-993. Stroeva, 0. G . (1971). “Morphogenesis and Congenital Malformations of the Eye in Mammals.” Nauka, Moscow. (In Russian) Stroeva, 0. G. (1978). Exp. Eye Res. 27, 539-551. Stroeva, 0. G., and Bibikova, A. D. (1982). Dokl. Akud. Nuuk SSSR 263, 194-197. Stroeva, 0. G., and Brodsky, W. Ya. (1968). Zh. Obsch. Eiol. 29, 177-185. Stroeva, 0. G., and Lipgart, T. A. (1968). Zh. Obsch. Eiol. 29, 689-700. Stroeva, 0. G., and Mitashov, V. 1. (1970). In “Metaplasiya Tkaneii” (M. S. Mitskevich, 0. G . Stroeva, and V. 1. Mitashov, eds.), pp. 93-105. Nauka, Moscow. (In Russian) Stroeva, 0. G., and Nikiphorovskaya, K. K. (1970). In “Intercellular Interactions in Determination and Growth” (G. V. Lopashov, G. D. Tumanishvili, and N. N. Rott, eds.), pp. 78-88. Nauka, Moscow. (In Russian) Stroeva, 0. G., and Panova, 1. G . (1976). Onrogenez 7, 170-177. Stroeva, 0. G., and Panova, I. G. (1980). Onrogenez 11, 571-582. Stroeva, 0. G., and Panova, I. G. (1983). J. Embryol. Exp. Morphol. 75. Stroeva, 0. G., Akhabadze, L. V., Panova, 1. G., and Lobacheva, V. A. (1979). Ontogenez 10, 188- 192. Stroeva, 0. G . , Akhabadze, L. V., Lobacheva, V. A,, and Panova, I. G. (1980). Zh. Obsch. Biol. 41, 298-302. Stroeva, 0. G., Panova, I. G., and Bibikova, A. D. (1981). Zh. Obsch. Eiol. 42, 99-105. Stroeva, 0. G., Panova, 1. G., Poplinskaya, V. A,, and Bibikova, A. D. (1982a). Zh. Obsch. Biol. 43, 114-120. Stroeva, 0. G., Bibikova, A. D., Ostapenko, I. A,, and Etingoff, R. N. (1982b). Eyull. Eksp. Eiol. Med. 43, 87-89. Takata, C., Albright, J. F., and Yamada, T. (1964). Exp. Cell Res. 34, 207-210. Takata, C., Albright, J. F., and Yamada, T. (1965). Science 147, 1299-1301. Takata, C., Albright, J. F., and Yamada, T. (1966). Dev. Eiol. 14, 382-400. Tamai, M., and Chader, G . J. (1979). Invest. Ophthalmol. Visual Sci. 18, 913-917. Tamai, M., and O’Brien, P. J. (1979). Exp. Eye Res. 28, 399-41 I . Tso, M. 0. M. (1979). In “The Retinal Pigment Epithelium” (K. M. Zinn and M. F. Marmor, eds.), pp. 267-276. Harvard Univ. Press. Cambridge, Massachussets. Tso, M. 0. M., and Friedman, E. (1968a). Arch. Ophthalmol. 79, 315-320. Tso, M. 0. M., and Friedman, M. (1968b). Arch. Ophthalmol. 80, 214-216. Tsunernatsu, Y., and Coulombre, A. J. (1981). Dev. Growth Dzxer. 23, 297-311. Tsunernatsu, Y., Funahashi, M., and Nakajima, A. (1981). Dev. Growth Differ. 23, 313-319. Varga, J . M., DiPasquale, A., Pawelek, J., McGuir, J. S . , and Lemer, A. B. (1974). Proc. Narl. Acad. Sci. U.S.A. 71, 1590-1593. Wachs, H. (1914). Wilhelm Roux Arch. Enrwiklungsmech. Org. 39, 384-451. Wachs, H. (1920). Wilhelm Roux Arch. Entwiklungsmech. Org. 46, 328-390. Weidman, T. A,, and Kuwabara, T. (1968). Arch. Ophthul. 79, 470-484. Weidman, T. A , , and Kuwabara, T. (1969). Invest. Ophthalmol. 8, 60-69. Werner, I. (1968). J. Cell Biol. 39, 140a-141a. Whittaker, J. R. (1968). In “The Stability of the Differentiated State” (H. Ursprung, ed.), pp. 25-36. Springer-Verlag, Berlin and New York. Whittaker, J. R. (1970). In “Control Mechanisms in the Expression of Cellular Phenotypes” (H. A. Padykula, ed.), pp. 89-108. Academic Press, New York.

RETINAL PIGMENT EPITHELIUM

293

Whittaker, I. R. (1974). In “Concepts of Development” (J. M. Lash, and J. R. Whittaker, eds.), pp. 163- 178. Sinauer, Stamford, Connecticut. Yamada, T. (1966). Am. Zool. 6 , 21-31. Yamada, T. (1967a). Curr. Top. D e v . Biol. 2, 247-283. Yamada, T. (1967b). In “Cell Differentiation” (A. V. S . de Reuck and J. Knight, eds.), pp. 1 16-126. Little Brown, Boston, Massachusetts. Yamada, T. (1977). Monogr. D e v . Biol. 13. Yamada, T . , and Beauchamp, I. 1. (1978). D e v . Biol. 66, 275-278. Yamada, T., and McDevitt, D. S . (1974). D e v . Biol. 38, 104-118. Yamada, T., and Roesel, M. E. (1969). J . Exp. Zool. 171, 425-432. Yamada, T., and Roesel, M. E. (1971). J. Exp. Zool. 177, 119-128. Yamada, T., Reese, D. H., and McDevitt, D. S. (1973). Diferentiarion 1, 65-82. Yamada, T., Roesel, M. E., and Beauchamp, I. (1975). J . Embryol. Exp. Morphol. 34, 497-510. Yasuda, K., Okada, T. S., Eguchi, G., and Hayashi, M. (1978). Exp. Eye Res. 26, 591-595. Yasuda, K., Eguchi, G . , and Okada, T. S. (1981). Cell Difler. 10, 3-11. Yates, C. M., Dewer, A. J., Wilson, H., Winterbum, A. K., and Reading, H. W. (1974). Exp. Eye Res. 18, 119-133. Young, R. W. (1978). Inr. Congr. Ser., Concil. Ophrhalmol. 23rd Kyoto No. 450, pp. 159-166. Young, R. W., and Bok, D. (1969). J. Cell Biol. 42, 392-403. Zavarzin, A. A. (1967). “DNA Synthesis and Cell Population Kinetics in Mammalian Development.” Nauka, Leningrad. (In Russian) Zavarzin, A. A , , and Stroeva, 0. G. (1964). In “Investigation of the Cell Cycles and Nucleic Acid Metabolism during Cell Differentiation” (L. N. Zhinkin and A. A. Zavarzin, eds.), pp. 116-125. Nauka, Moscow. (In Russian) Zimmerman, J. (1975). D e v . Biol. 44, 102-1 18. Zimmerman, J. (1976). J . Cell Biol. 70, 145a. Zimmerman, J., Brumbaugh, J., Biehl, J., and Holtzer, H. (1974). Exp. Cell Res. 83, 159-165. Zinn, K. M., and Benjamin-Henkind, J. V. (1979). In “The Retinal Pigment Epithelium” (K. M. Zinn and M. F. Marmor, eds.), pp. 3-31. Harvard Univ. Press, Cambridge, Massachusetts. Zinn, K. M . , and Marmor, M. F., eds. (1979). “The Retinal Pigment Epithelium.” Harvard Univ. Press, Cambridge, Massachusetts.

This Page Intentionally Left Blank

Index

A

C

Adenosine triphosphatase activity, NMR and, 40-4 1 Adenoslne triphosphate measurement, potential for restoration at cellular level and, 58-59 some specific costs, 55-58 study at organ level by NMR applicability to reactions occurring in vivo, 33-34 ATPase activity, 40-41 computer modeling of Bloch equations, 42-44 measurement of chemical exchange, 29-33 overview, 28-29 studies of creatine phosphokinase, 34-40 summary and conclusions, 44-46 Adenosine triphosphate/adenosine diphosphate, compartmentation, cell cycle and, 50-52 Aging cell volume and, 186-190 putative mechanisms for membrane-dependent manifestations of, 212-215 Amphibia, proliferation of pigment cells in, 263 changes in specific synthesis during regeneration, 283-285 comparison of eye cell regenerations in newts, 281-283 regeneration of lens, 275-281 regeneration of neural retina, 264-275

Calcium, localization, staining methods for, 1 I6 Cell(s) changes in energy demands within, mitochondria and, 87 in culture, mitochondria of, 90-94 relationship of energetic state to biology ATP/ADP compartmentation and cell cycle, 50-52 difficulties in interpretation of experimental data, 48-50 measurement of ATP and its potential for restoration at cellular level, 58-59 normal values for energetic state, 52-55 overview, 46-48 some specific ATP costs, 55-58 respiration, chemical manipulation of, 94-98 Cell adhesion aging and cell-cell, 194-195 cell-ligand, 195-203 cell-substratum, 190- 194 cytoskeleton and, 203-204 mechanisms of, 204-207 Cell cycle, ATP/ADP compartmentation and, 50-52 Cell division, cell-substratum adhesion and, 208-2 I 1 Cell-substratum adhesion, function and, 207-208 differentiation, 21 1 division, 208-21 1 malignancy, 21 1-212 movement, 208

B Bloch equations, computer modeling of, 42-44

295

2 96

INDEX

Cell types, different, differences in energy demands, 85-87 Cell volume, aging and, 186-190 Chemical exchange, measurement, NMR and, 29-33 Chick, retinal pigment epithelium, differentiation and proliferation, 247-259 Chondriome, see also Mitochondria of eukaryotic cells enlargement, 73-76 numbers, 64-73 form and metabolic activity cells in culture, 90-94 changes in energy demand within cells, 87 chemical manipulation of cell respiration, 94-98 differences in energy demand of different cell types, 85-87 form changes in virro, 87-89 form changes in vivo, 89-90 form and metabolic activity, manipulation by microinjection into living cells, 98-101 Chromatin, see also Nonchromatin structures higher order structures, nonchromatin structures and, 155- 157 Chromosomes, arrangement at interphase, nonchromatin structures and, 155-157 Creatine phosphokinase, exchange reaction, NMR and, 34-40 Cristae, mitochondrial, 76-85 Cytoskeleton, cell adhesion and, 203-204

D Deoxyribonucleic acid rearrangement, transposable elements and, 16-20 superstructures, nonchromatin structures and, 152-153 Differentiation, cell-substratum adhesion and. 211

E Energetic state, of cells, normal values for, 52-55 Enzymes, oxidative and reductive of mitochondria, staining methods for, 109-1 15

Eukaryotic cells, chondriome enlargement, 73-76 numbers, 64-73 Eye cell proliferation, comparison of characteristics during regeneration, 28 1-283 Eye regeneration, changes in specific synthesis during, 283-285

F Fluorescent stains, for mitochondria of living cells, 116-1 18

G Gene conversion, transposable element Ty and, 14-16 Gene expression effects of insertion of Ty 1 on, 10-14 involvement of nonchromatin structures in posttranscriptional events, 158- 160 transcription, 157- 158 Glycoproteins, in nonchromatin structures, 174-176

H HeLa cells, histone-depleted nuclei organization of nonchromatin structures in, 160-165 Human, retinal pigment epithelium, differentiation and proliferation, 259-262

I Interchromatin matrix, anatomy of, 146- 150 Intraocular pressure, in human RPE development, 261-262 L

Lens, regeneration in amphibia, 275-281

M Malignancy, cell-substratum adhesion and, 211-212 Melanization, proliferation and capacity of RPE cells for neural retina differentiation during uterine life, 224-227

297

INDEX Melanogenesis, in RPE, during postnatal development, 240-246 Melanniic differentiation, of RPE, proliferation and, 252-253 Mitochondria, see also Chondriome cristae of, 76-85 inclusions, 101-102 crystalline, 106- 109 granular, 102-106 microinjection into living cell, 98-101 Mitochondriagenesis, mechanism of, 118-122 Mitochondria1 function, potential of modem staining methods in monitoring calcium localization and Ca2+ -binding proteins, I16 fluorescent stains for living cells, 116-118 oxidative and reductive enzymes, 109- 115 phosphatases, 115-1 16 Movement, cell-substratum adhesion and. 208

N Neural retina, regeneration in amphibia, 264-275 Nonchromatin structures anatomy and extensive interchromatin matrix, 146- 150 lamella/lamina concept, 142-145 nuclear membranes and pore complexes, 137-142 nuclear shell or cortex, 145-146 nucleolar skeleton, 150- 151 characterization based on fractionation experiments, 166-168 achromatic and histone-depleted nuclei, 168 extraction from isolated nuclear territories, 168-174 glycoproteins in, 174-176 involvement in gene expression posttranscriptional events, 158- 160 transcription, 157- 158 role in nuclear organization, 151- 152 chromosome arrangement at interphase, 155-157 DNA superstructures, 152- 153 higher order chromatin structures, 153- 155 three-dimensional organization of in HeLa cell histone-depleted nuclei, 160- 165

operational media necessary to maintain organization, 165- 166 Nuclear membrane, pore complexes and, anatomy of, 137-142 Nuclear magnetic resonance spectroscopy, in study of ATP metabolism at organ level applicability to reactions occurring in vivo, 33-34 ATPase activity, 40-44 computer modeling of Bloch equations, 42-44 measurement of chemical exchange, 29-33 overview, 28-29 studies of creatine phosphokinase, 34-40 summary and conclusions, 44-46 Nuclear shell or cortex, anatomy of, 145-146 Nucleolar skeleton, anatomy of, 150-151 Nucleus(i) achromatic and histone-depleted, nonchromatin structure organization and, 168 nonchromatin structures, definitions, 136-137

P Phosphatases, mitochondrial, staining methods for, 115-116 Pigment epithelium cells, in amphibian retina and iris, 263 changes in specific syntheses during regeneration, 283-285 comparison of eye cell regenerations in newts, 281-283 regeneration of lens, 275-281 regeneration of neural retina, 264-275 Posttranscriptional events, nonchromatin structures and, 158-160 Proteins, Ca2+ -binding, staining methods for, I I6

R Rat, retinal pigment epithelium, differentiation and proliferation, 223-247 Retinal pigment epithelium differentiation and proliferation in chick, 247-259 in human, 259-262 in rat, 223-247

298

INDEX

growth and development in human, 259-261 proliferation in normal development, 247-250 dependence on intraocular pressure, 251-252 proliferation in postnatal development, formation of binucleated cells, 227-234 transdifferentiation into neural retina and lens, 253-256 transdifferentiation of human cells in culture, 262 S Scleral part, growth, RPE and, 234-240

T Transcription, nonchromatin structures and, 157- 158 Transposable elements, other, in yeast, 20-21

Transposable element Ty, in yeast associated gene conversion, 14-16 DNA rearrangements and, 16-20 effects of Ty 1 insertion on gene expression, 10-14 physical structure, 2-7 transcription, 7-9 transposition, 9- 10 ~

Y Yeast other transposable elements in, 20-21 transposable element Ty associated gene conversion, 14- 16 DNA rearrangements and, 16-20 effects of Ty I insertion on gene expression, 10-14 physical structure, 2-7 transcription, 7-9 transposition, 9-10

Contents of Recent Volumes and Supplements Volume 70

*

Volume 72

Cycling Noncycling Cell Transitions in Tissue Aging, Immunological Surveillance, Transformation, and Tumor GrowthSEYMOUR GELFANT The Differentiated State of Normal and Malignant Cells or How to Define a “Normal” Cell in CUltUre-MlNA J. BISSELL On the Nature of Oncogenic Transformation of CellS4ERALD L. CHAN Morphological and Biochemical Aspects of Adhesiveness and Dissociation of Cancer C e l l s HIDEOHAYASHI AND YASUJI ISHIMARU The Cells of the Gastric MUCOSB-HERBERT F. HELANDER Ultrastructure and Biology of Female Gametophyte in Flowering Plants-R. N. KAPILA N D A. K. BHATNAGAR

Microtubule-Membrane Interactions in Cilia and Fktgek3-wILLIAM L. DENTLER The Chloroplast Endoplasmic Reticulum: Structure, Function, and Evolutionary Significance-SARAH P. GIBES DNA Repair-A. R . LEHMANNA N D P. KARRAN Insulin Binding and Glucose Transport-RusSELL HILF.LAURIE K. SORGE.A N D ROGER J . GAY Cell Interactions and the Control of Development in Myxobacteria Populations-DAVID WHITE Ultrastructure, Chemistry, and Function of the Bacterial Wall-T. J. BEVERIDGE INDEX

INDEX

Volume 73 Volume 71 Protoplasts of Eukaryotic Algae-MARTHA D. BERLINER Integration of Oncogenic Viruses in Mammalian Polytene Chromosomes of Plants-WALTER CeIk
INDEX

299

300

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

Organization and Expression of Viral Genes in Adenovirus-Transformed Cells-s. J. FLINT The Plasma Membrane as a Regulatory Site in Highly Repeated Sequences in Mammalian GenOmeS-MAXlNE F. SINGER Growth and Differentiation of Neuroblastoma Cells-SiEcmIED W. DE LAAT Moderately Repetitive DNA in EvolutionROBERTA. BOUCHARD AND PAULT. V A N DER SAAC Mechanisms That Regulate the Structural and Structural Attributes of Membranous Organelles in Bacteria-CHARLEs C. REMSEN Functional Architecture of Cell SurfacesJANET M. OLIVERA N D RICHARD D. BERLIN Separated Anterior Pituitary Cells and Their ReGenome Activity and Gene Expression in Avian sponse to Hypophysiotropic HormonesAND M A R I A Erythroid Cek-KARLEN G. GASARYAN CARLDENEP,Luc SWENNEN, Morphological and Cytological Aspects of Algal ANDRIES CalCifiCation-MlCHAEL A. BOROWITZKAWhat Is the Role of Naturally Produced Electric Naturally Occurring Neuron Death and Its RegCurrent in Vertebrate Regeneration and Healulation by Developing Neural Pathwaysing?-RicHARD B. BORGENS J . CUNNINGHAM Metabolism of Ethylene by Plants-JOHN TIMOTHY DODDSAND MICHAEL A. HALL The Brown Fat Cell-JAN NEDERGAARDA N D OLOV LINDBERC INDEX

Volume 74

INDEX

Volume 77 Volume 75 Calcium-Binding Proteins and the Molecular Mitochondria1 Nuclei-TsuNEYosHi KUROIWA Basis of Calcium Action-LINDA I. VANELDIK, JOSEPHG . ZENEDEGUI, DANIELR. Slime Mold LeCtinS-JAMES R. BARTLES, WILLIAMA . FRAZIER,A N D STEVEND. MARSHAK. AND D. MARTIN WATTERSON ROSEN Genetic Predisposition to Cancer in Man: In Lectin-Resistant Cell Surface Variants of EuV i m Studies-LEVY KOPELOVICH karyotic Cells-EvE BARAKBRILES Membrane Flow via the Golgi Apparatus of Cell Division: Key to Cellular Morphogenesis in Higher Plant Celk-D~vlo G. ROBINSON AND U o o KRISTEN the Fission Yeast, SchizosacchoromycesBYRONF. JOHNSON,CODEB. CALLEJA, Cell Membranes in Sponges-WERNER E. G. BONGY. YOO, MICHAEL ZUKER,AND IAN MULLER J . MCDONALD Plant Movements in the Space EnvironmentMicroinjection of Fluorescently Labeled ProDAVIDG. HEATHCOTE teins into Living Cells, with Emphasis on Chloroplasts and Chloroplast DNA of AcerobrcCytoskeletal PrOteinS-THOMAS E. KREis laria mediferranea: Facts and HypothesesAND WALTER BlRCHMElER ANGELA LUTTKEA N D SILVANO BONOTTO Structure and Cytochemistry of the Chemical Evolutionary Aspects of Cell DifferentiationR. A. FLICKINGER A N D WLADSynapses-STEPHEN MANALOV Structure and Function of Postovulatory FolliI M I R OVTSCHAROW cles (Corpora Lutea) in the Ovaries of Non- I N D E X mammalian Vertebrates-SRiNivAs K. SAIDAPUR INDEX

Volume 76 Cytological Hybridization to Mammalian ChromOSomeS-ANN s. HENDERSON

Volume 78 Bioenergetics and Kinetics of Microtubule and Actin Filament Assembly-DissassemblyTERRELL L. HILLAND MARCW. KIRSCHNER Regulation of the Cell Cycle by SomatomedinS-HowARD ROTHSTEIN

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS Epidermal Growth Factor: Mechanisms of Action-MANJUSRI DAS Recent Progress in the Structure, Origin, Composition, and Function of Cortical Granules in Animal Egg-SARDUL s. GURAYA

30 1

Biological Interactions Taking Place at a LiquidSolid Interface-ALEXANDRE ROTHEN INDEX

INDEX

Volume 81 Volume 79

Oxidation of Carbon Monoxide by BacteriaYOUNGM. KIMA N D GEORGED. HEGEMAN The Formation, Structure, and Composition of Sensory Transduction in Bacterial Chemotaxthe Mammalian Kinetochore and KiiS--(iERALD L. HAZELBAUER AND SHlGEAKl netochore F i b e r 4 o N t . v L. RIEDER HARAYAMA Motility during Fertilization-(kRALD SCHAT- The Functional Significance of Leader and TrailTEN er Sequences in Eukaryotic mRNAs-F. E. Functional Organization in the NucleusBARALLE RONALDHANCOCKA N D TtNi BOULIKASThe Fragile X ChrOmOSOm~RANT R. The Relation of Programmed Cell Death to DeSUTHERLAND velopment and Reproduction: Comparative Psoriasis versus Cancer: Adaptive versus Studies and an Attempt at ClassificationIatrogenic Human Proliferative DiseasesJACQUES BEAULATONA N D RICHARDA. SEYMOUR GELFANT LOCKSHIN Cell Junctions in the Seminiferous Tubule and Cryofixation: A Tool in Biological Ultrastructhe Excurrent Duct of the Testes: Freezetural Research-HELMUT PLATTNERA N D Fracture Studies-TosHio NAGANOA N D Luis BACHMANN FUMIESUZUKI Stress Protein Formation: Gene Expression and Geometrical Models for Cells in Tissues-HisEnvironmental Interaction with Evolutionary AO HONDA Significance-C. ADAMSA N D R. W. R I N N ~Growth of Cultured Cells Using Collagen as 1NDk.X Substrate-JASON YANG A N D s. NANDI INDEX

Volume 80 DNA Replication Fork Movement Rates in Mammalian Cells-LEON N. KAPP AND RoetKr B. PA~NTER Interaction of Virsues with Cell Surface Receptors-MARC TARDltU, ROCHELLEL. EPS T ~ I NA , N D HOWARD L. WEINER The Molecular Basis of Crown Gall lnductionW. P. ROBERTS The Molecular Cytology of Wheat-Rye Hybrids-R. APPELS Bioenergetic and Ultrastructural Changes Associated with Chloroplast Development-A. R. WELLBURN The Biosynthesis of Microbodies (Peroxisomes, Glyoxysomes&H. KINDL Immunofluorescence Studies on Plant Cells<. E. JEFFREE,M. M. YEOMAN,A N D D. C. KILPATRICK

Volume 82 The Exon:lntron Structure of Some Mitochondrial Genes and Its Relation to Mitochondria1 Evolution-HENRY R. MAHLER Marine Food-Borne Dinoflagellate ToxinsDANIELG. BADEN Ultrastructure of the Dinoflagellate AmphieSma-LENITA c . MORRILL A N D ALFREDR. LOEBLICH111 The Structure and Function of Annulate Lamellae: Porous Cytoplasmic and Intranuclear Membranes-RICHARD G . KESSEL Morphological Diversity among Members of the Gastrointestinal Microflora-DWAYNE c. SAVAGE INDEX

302

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

Supplement 1 0 Differentiated Cells in Aging Research

Celk<ERTRUDE H. BLUMENTHAL AND DINKAR K. KASBEKAR INDEX

Do Diploid Fibroblasts in Culture Age?-EuGENE BELL, Louis MAREK, STEPHANIE SHER, CHARLOTTE MERRILL, DONALD Supplement 11A: Perspectives in Plant Cell and Tissue Culture LEVINSTONE, AND IAN YOUNG Urinary Track Epithelial Cells Cultured from Human Urine-J. S. FELIX AND J. W. Cell Proliferation and Growth in Callus Cultures-M. M. YEOMAN AND E. FORCHE LITTLEFIELD The Role of Terminal Differentiation in the Cell Proliferation and Growth in Suspension Cultures-P. J. KING Finite Culture Lifetime of the Human Epidermal KeratinOCyte-JAMES G. RHEINWALDCytodifferentiation-RlCHARo PHiLLiPs Long-Term Lymphoid Cell Cultures-GEoRcE Organogenesis in Vitro: Structural, Physiological, and Biochemical Aspects-TREVOR A. F. SMITH, PARVlN JUSTICE, HENRl THORPE FRISCHER, LEEKIN CHU, AND JAMES KROC Type II Alveolar Pneumonocytes in V i t r e Chromosomal Variation in Plant Tissues in Culture-M. w . BAYLlss WILLIAM H. J . DOUGLAS, JAMES A. K. VASIL A N D MCATEER,JAMESR. SMITH,A N D WALTER Clonal Propagation-ImRn VIMLA VASlL R. BRAUNSCHWEICER Cultured Vascular Endothelial Cells as a Model Control of Morphogenesis by Inherent and ExSystem for' the Study of Cellular Senesogenously Applied Factors in Thin Cell cence-ELLIOT M. LEVINEA N D STEPHEN Layers-K. TRANTHANH VAN M. MUELLER Androgenetic HaplOidS-INDRA K. VASIL Vascular Smooth Muscle Cells for Studies of Isolation, Characterization, and Utilization of Cellular Aging in V i m ; an Examination of Mutant Cell Lines in Higher Plants-PAL Changes in Structural Cell LipidS-oLGA 0. MALIGA BLUMENFELD, ELAINESCHWARR, VER- SUBJECT INDEX ONICA M. HEARN, A N D MARIE J . KRANEPOOL Chondrocytes in Aging Research-EDWARD J. Supplement SIB: Perspectives in Plant Cell MILLERAND STEFFANGAY and Tissue Culture Growth and Differentiation of Isolated Calvarium Cells in a Serum-Free MediumIsolation and Culture of Protoplasts-INmA K. JAMESK. BURKSA N D WILLIAM A. PECK VASlL A N D VlMLA VASlL Studies of Aging in Cultured Nervous System Protoplast Fusion and Somatic HybridizationTissue-DONALD H. SILBERBERG A N D OTTO SCHIEDER A N D INDRA K . VASIL SEUNCU. KIM Genetic Modification of Plant Cells Through Aging of Adrenocortical Cells in Culture-PEUptake of Foreign D N A - C . I. KADOA N D TER J . HORNSBY, MICHAELH. SIMONIAN, A. KLEINHOFS A N D GORDONN. GILL Nitrogen Fixation and Plant Tissue CultureThyroid Cells in CUhre-FRANCESCO S. AMKENNETH L. GlLES A N D INDRA K. VASIL BESI-IMPIOMBATOA N D HAYDENG. COON Preservation of Germplasm-LuNDsEu A. Permanent Teratocarcinoma-Derived Cell Lines WITHERS Stabilized by Transformation with SV40 and Intraovarian and in Vitro Pollination-M. ZENKTELER SVmSA Mutat ViNSeS-WARREN MALRMAN, DANIELI. H. LINZER,FLORENCEEndosperm Culture-B. M. JOHRI, P. S. SRIBROWN,ANGELIKA K. TERESKY, MAURICE VASTAVA, A N D A. P. RASTE A N D ARNOLD J. LEVINE ROSENSTRAUS, The Formation of Secondary Metabolites in Nonreplicating Cultures of Frog Gastric Tubular Plant Tissue and Cell Cultures-H. BOHM

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

303

Suppression of, and Recovery from, the Neoplastic Stat+-ROEERT TURGEON SUBJECT INDEX Plasmid Studies in Crown Gall TumorigenesisAND RICK L. STEPHENL. DELLAPORTA PESANO Supplement 12: Membrane Research: Classic The Position of Agrobucferium rhizogenesJESSE M. JAYNES AND GARYA. STROBEL Origins and Current Concepts Recognition in Rhizobium-Legume Symbioses-TERRENCE L. GRAHAM Membrane Events Associated with the Generation Of a BlaSfOCySt-MARTIN H.JOHNSON The Rhizobiurn Bacteroid State-W. D. SUTTON,C. E. PANKHURST, A N D A. S. CRAIG Structural and Functional Evidence of Cooperativity between Membranes and Cell Wall in Exchange of Metabolites and Energy between Legume and Rhizobium-JOHN IMSANDE Bacteria-MANFRED E. BAYER KONPlant Cell Surface Structure and Recognition The Genetics of Rhizobium-ADAM DOROSI A N D ANDREW W . B. JOHNSTON Phenomena with Reference to SymbiosesIndigenous Plasmids of Rhizobium-J. DEENS. REISERT PATRICIA ARIEE,P. BOISTARD,FRANCINECASSEMembranes and Cell Movement: Interactions of DELBART,A. G. ATHERLY,J . 0. BERRY, Membranes with the Proteins of the A N D P. RUSSELL CytOSkektOn-~AMES A. WEATHERBEE Electrophysiology of Cells and Organelles: Nodules Morphogenesis and DifferentiationWILLIAMNEWCOMB Studies with Optical Potentiometric IndicaA N D PHILIP c. Mutants of Rhizobium That Are Altered in tOTS-JEPPREY c . FREEDMAN Legume Interaction and Nitrogen FixationLARIS L. D. KUYKENDALL Synthesis and Assembly of Membrane and Organelle Proteins-HARVEY F. LODISH, The Significance and Application of Rhizobium WILLIAM A. BRAELL,ALANL. SCHWARTZ, in Agriculture-HAROLD L. PETERSONA N D THOMASE. LOYNACHAN GER J . A. M. STROUS, AND ASHER INDEX ZILBERSTEIN The Importance of Adequate Fixation in Preservation of Membrane UltrastructureRONALDB. LUI-TIC A N D PAUL N. Mc- Supplement 14: Intracellular Symbiosis MILLAN Liposomes-As Artificial Organelles, To- Some Eco-evolutionary Aspects of Intracellular Symbiosis-F. J. R. TAYLOR pochemical Matrices, and Therapeutic Carrier Systems-Pt.TeR NJCHOLLS Integration of Bacterial Endosymbionts in Amoebae-KwANc w . JEON Drug and Chemical Effects on Membrane TransPO~~-WILLIAM Perspective on Algal Endosymbionts in Larger 0. BERNDT INDEX FotWminifera-JOHN J . LEE The Biology of the Xenosome, an Intracellular Symbiont-A. T. SOLW Supplement 13: Biology of the Rhizobiaceae Endosymbionts of Euplofes-KLAus HECKEmbryo Culture-V. RAGHAVAN The F u t u r e a E o R c MELCHERS

MANN

The Taxonomy of the RhizobiaceaeaERALD H. ELKAN Biology of Agrobacrerium fumefaciens: Plant Interactions-L. W. MOORE AND D. A. COOKSEY Agrobacrerium rumefaciens in Agriculture and Research-FAwzi EL-FIKIA N D KENNETH L. GILES

Endonuclear Symbionts in Ciliates-HANs-DiETER GORTZ Metabolic Interchange in Algae-Invertebrate Symbiosis-cLAYToN B. COOK The Molecular Biology of Rhizobium-Legume Symbiosis-DEsH PAL s. VERMA A N D SHARONLONG Analysis of Possible Gene Transfer between an

304

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

Insect Host and Its Bacteria-like Endocytobionts-W . SCHWEMMLER Cellular and Molecular Mechanisms of Intracellular Symbiosis in Leishmaniasis-K.-P. CHANG Symbiotic Interaction between Legionella pneumophila and Human LeUkOCyteS-MARCUS A. HORWITZ Plastids-Past, Present, and Future-JEAN M. WHATLEY INDEX

Supplement 15: Aspects of Cell Regulation Cellular Factors Which Modulate Hormone Responses: Glucocorticoid Action in Perspec111 tiVe-ROBERT w . HARRISON,

Regulation of Genetic Activity by Thyroid Hormones-A. ABDUKARIMOV The Partitioning of Cytoplasmic Organelles at Cell Division<. WILLIAMBIRKY,JR. Cell Cycle Mutants-WILLIAM L. WlSSlNGER AND RICHARD J . WANG Formation of Glyoxysomes-J. MICHAEL LORD AND LYNNEM. ROBERTS Mitochondria, Cell Surface, and Carcinogenesis-D. WILKIE,I. H. EVANS,V. EGILSSON,E. S. DIALA,AND D. COLLIER Transforming Genes of Tumor CdS-ROBERT A. WEINBERC Viral Carcinogenesis-FRED RAPP The Origin of Viruses from Cells-R. E. F. MATTHEWS INDEX