International Review of Cytology, Volume 58

INTERNATIONAL REVIEW OF CYTOLOGY VOLUME 58 ADVISORY EDITORS H. W. BEAMS HOWARD A. BERN GARY G. BORISY ROBERT W. BRI...

Author: Geoffrey H Bourne | James Frederick Danielli

10 downloads 1350 Views 24MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

INTERNATIONAL

REVIEW OF CYTOLOGY VOLUME 58

ADVISORY EDITORS

H. W. BEAMS HOWARD A. BERN GARY G. BORISY ROBERT W. BRIGGS STANLEY COHEN RENE COUTEAUX MARIE A. DIBERARDINO CHARLES J. FLICKINGER M. NELLY GOLARZ DE BOURNE K. KUROSUMI MARIAN0 LA VIA GIUSEPPE MILLONIG ARNOLD MITTELMAN DONALD G. MURPHY

ROBERT G. E. MURRAY ANDREAS OKSCHE VLADIMIR R. PANTIC W. J. PEACOCK DARRYL C. REANNEY LIONEL I. REBHUN JEAN-PAUL REVEL WILFRED STEIN ELTON STUBBLEFIELD HEWSON SWIFT DENNIS L. TAYLOR TADASHI UTAKOJI ROY WIDDUS ALEXANDER L. YUDIN

INTERNATIONAL

Review of Cytology EDITED BY

G . H. BOURNE

J . F. DANIELLI

St. George's University School of Medicine St. George's, Grenada West Indies

Worcester Polytechnic Institute Worcester, Massachusetts

ASSISTANT EDITOR K . W. JEON Department of Zoology University of Tennessee Knoxville, Tennessee

VOLUME 58

ACADEMIC PRESS New York San Francisco London A Subsidiary of Harcourt Brace Jovanovich, Publishers

1979

COPYRIGHT @ 1979. BY ACADEMIC PRESS, INC. ALL RIOHTS RESERVED. NO PART OF THIS PUBLICATION MAY BE REPRODUCED OR TRANSMITTED IN ANY FORM OR BY ANY MEANS, ELECTRONIC OR MECHANICAL, INCLUDINO PHOTOCOPY, RECORDING, OR ANY INFORMATION STORAQE AND RETRIEVAL SYSTEM, WITHOUT PERMISSION IN WRITING FROM THE PUBLISHER.

ACADEMIC PRESS, MC.

111 Fifth Avenue, N e w York, New York 10003

United Kingdom Edition published by ACADEMIC PRESS, INC. (LONDON)LTD. 24/28Oval Road, London N W l 7 D X

LmIuRY OF CONORESS CATALOG CARD NUMBER:52-5203

ISBN 0-12-364358-9 PRINTED IN THE UNITED STATES OF AMERICA

79808182

987654321

Contents LISTOF CONTRIBUTORS .......................................................

vii

Functional Aspects of Satellite DNA and Heterochromatin BERNARD JOHNAND GEORGEL. GABORMIKLOS I . Introduction

...........................................................

1 12 23 82 93 97 101

II. Structural Relationships between Heterochromatin and Satellite DNA ............. III. Heterochromath and Satellite DNA Variation ................................ IV . Mechanisms of Satellite DNA and Heterochromatin Change ....................

V. The Library Hypothesis .................................................. VI . Unresolved Aspects of Satellite DNA ...................................... W . Credoand Coda ........................................................ VIII . Addendum ............................................................ References ............................................................

104

108

Determination of Subcellular Elemental Concentration through Ultrahigh Resolution Electron Microprobe Analysis THOMAS E . HUTCHINSON I . Introduction

...........................................................

II. Physical Backgmui.4 c.f Elemental Analysis by Characteristic X-ray Determination III . Instrumentation Used in Elemental Analysis by Characteristic X-ray Energy

.

115 117

Determination .......................................................... IV . Critical Reading of the Literature .......................................... V . Application of Microprobe Analysis to Specific Biological Systems .............. VI. Methods and Reviews ................................................... W . Conclusions ........................................................... References ............................................................

120 129 134

150 151 153

The Chromaffh Granule and Possible Mechanisms of Exocytosis HARVEY B. POLLARD. CHRISTOPHER J . PAZOLES. CARLE . CREUTZ. AND ORENZINDER I . Introduction

...........................................................

160

II. A Statement of the Problems and a Prologue ................................. 160 III. Chromaffin Granule Assembly ............................................ 161 IV. Approaches to the Problem of Calcium Action in Exocytosis ................... 170 V . Biochemistry of the Secretory Event (Fission) ................................ 174

.

VI Recovery of Granule Membranes after Exocytosis ............................ W . Adenylate Cyclase in Chromaffin Granule Membranes ......................... VIII . Conclusions ........................................................... References ............................................................ V

187 189 192 193

vi

CONTENTS

The Golgi Apparatus. the Plasma Membrane. and Functional Integration W . G . WHALEY AND MARIANNE DAUWALDER I . Introduction

...........................................................

II. Components of the Golgi Apparatus ........................................

III . Models for the Golgi Apparatus and Its Function ............................. IV . Movement of Vesicles out of and into Cells ................................. V . Discussion and Concluding Remarks ....................................... References ............................................................

199 202 209 232 236 238

Genetic Control of Meiosis I. N . GOLUBOVSKAYA

........................................................... .................................. 111. Conclusions ........................................................... References ............................................................ I. Introduction

II. The Characterization of Meiotic Mutations

241 249 280 286

Hypothalamic Neurons in Cell Culture

.

A TIXIER-VIDAL AND F . DE VITRY 1. Introduction

...........................................................

II. Primary Cultures .......................................................

111. Continuous Cell Lines ................................................... IV . General Conclusions .................................................... References ............................................................

291 293 314 321 328

The Subfornical Organ H . DIETERDELLMANN AND JOHNB . SIMPSON I. Introduction

...........................................................

III . Normal General Morphology of the Subfornical Organ ........................ IV . Functions ofthe Subfomicalorgan ........................................ V. Conclusions ........................................................... VI. Table. of Investigated Species ............................................. References ............................................................

333 335 336 384 399 402 416

SUBJECT INDEX.............................................................. CONTENTS OF PREVIOUS VOLUMES ..............................................

423 421

II. Development., .........................................................

List of Contributors Numbers in parentheses indicate the pages on which the authors’ contributions begin.

CARLE. CREUTZ(lS9), Clinical Hematology Branch, National Institute of Arthritis, Metabolism, and Digestive Diseases, National Institutes of Health, Bethesda, Maryland 20014 MARIANNE DAUWALDER (199), The Cell Research Institute, The University of Texas at Austin, Austin, Texas 78712

H. DIETERDELLMANN(333), Department of Veterinary Anatomy, Pharmacology, and Physiology, Iowa State -University, Ames, Iowa 5001 1

F. DE VITRY(291 ), Groupe de Neuroendocrinologie Cellulaire, Laboratoire de Physiologie Cellulaire, College de France, I I Place Marcelin Berthelot, 75231 Paris Cedex 05, France I. N. GOLUBOVSKAYA (247), Znstitute of Cytology and Genetics, Academy of Sciences of the USSR, Siberian Division, Novosibirsk, USSR THOMAS E. HUTCHINSON (1 15), Centerfor Bioengineering, University of Washington, Seattle, Washington 98195 BERNARD JOHN ( 1 ), Department of Population Biology, Research School of Biological Sciences, Australian National University, Canberra City, A.C.T. 2601 Australia GEORGEL. GABORMIKLOS( l ) , Department of Population Biology, Research School of Biological Sciences, Australian National University, Canberra City, A.C.T. 2601 Australia CHRISTOPHER J . PAZOLES (159), Clinical Hematology Branch, National Institute of Arthritis, Metabolism, and Digestive Diseases, National Institutes of Health, Bethesda, Maryland 20014 HARVEYB. POLLARD(159), Clinical Hematology Branch, National Institute of Arthritis, Metabolism, and Digestive Diseases, National Institutes of Health , Bethesda, Maryland 20014 JOHN B. SIMPSON(333), Department of Psychology, University of Washington, Seattle, Washington 98195 vii

viii

LIST OF CONTRIBUTORS

A. TIXIER-VIDAL (291), Croupe de Neuroendocrinologie Cellulaire, Laboratoire de Physiologie Cellulaire, College de France, 1I Place Marcelin Berthelot, 75231 Paris Cedex 05, France

W. G. WHALEY(199), The Cell Research Institute, The University of Texas at Austin, Austin, Texas 78712

OREN ZINDER( 159), Department of Clinical Biochemistry, Rambam Medical Center, Haifa, Israel

Functional Aspects of Satellite DNA and Heterochromatin BERNARD JOHNAND GEORGEL. GABORMIKLOS Department of Population Biology, Research School of Biological Sciences. Australian National University, Canberra, Australia

. . . . . . . . . . . . . . . . . . . .

1

11. Structural Relationshipsbetween Hetemchromatin and Satellite DNA

12 23

I. Introduction

ID. Heterochromatin and Satellite DNA Variation

.. .. .

. .

IV.

V. VI. VIi. VIII.

. . . .... .. . , . . .. . . .. ...... . . . . . .. ..

. . . . .

A. Interspecies Comparisons . . . B. Manipulation of Heterochromatin and Satellite DNA . . C. Heterochromatin Polymorphisms , . . . . . . . D. Soma-Gem Line Differentials . . . . . . . . . E. Limits of Tolerance . . . . . . . . . . . . . . Mechanisms of Satellite DNA and Heterochromatin Change A, Satellite DNA . . . . . . . . . . B. Heterochromatin . . . . . . . . . . . . The Library Hypothesis . . . . . . . . . Unresolved Aspects of Satellite DNA . . . . . . . . . Cndo and Coda . . . . . . . . . . . . . . . . Addendum . . . . . . . . . . . . . . . . References . . . . . . . . . . . .

.

.

.

. .. .

.

. ....

. . . .

. . . .

23 40 54 68 15 82

82

86 93 97 101 104

108

“We know so much about the structure, variability and location of satellite DNA, that it is surprising and increasingly significant that we know nothing about the origin and function of these special DNA sequences” (P.M.B.Walker, 1972).

I. Introduction Although classic genetics considered the eukaryote chromosome simply a linear sequence of linked gene loci, biochemical work has made it clear that many eukaryotes carry far more DNA than appears to be required in terms of this simple model. It is now generally agreed that there is considerably more DNA in the nucleus than is needed to code for all the proteins made by a plant or an animal (see Addendum, note 1). While this is usually regarded as a distinctive feature of eukaryotes, it is worth drawing attention to the fact that bacterial 1

Copyright @ 1979 by Academic Rcss, 11% All rights of npoduclion in my form ~ ~ e ~ c d . ISBN 0-12-364358-9

2

BERNARD JOHN AND GEORGE L. GABOR MIKMS

genomes, consisting almost entirely of unique DNA, may vary over a 10-fold range (Kingsbury, 1969). In eukaryotes, however, the variation applies both to the unique DNA fraction, not all of which appears to function in a conventional coding sense, and to the repetitive DNA fraction which characterizes most eukaryotes (see Addendum, note 2). It is especially true of the simple-sequence DNA which is highly repeated within a pnome. This DNA is sometimes identifiable as a satellite in buoyant density gradients, but it can be cryptic and require the presence of metal ions or antibiotics for its visualization and isolation. Figure 1 illustrates some of the striking differences which obtain between related species in terms of their satellite components. Three important facts are immediately obvious: I. In some cases (e.g., the antelope squirrel, Ammospermophilus harrisi, and the mouse, Mus rnusculus) each species has its own distinctive satellite or satellites.

BUOYANT DENSITY (g/cm3)

FIG.la and b.

SATELLATE DNA AND HETEROCHROMATIN

3

(4 Dipodomys ordii

1

i

Dipodomys ogilis

1.690

\ 17

1

L

13

1.700

D. virilis

D. omericono

FIG. 1 . Buoyant density patterns of DNA preparations centrifuged to equilibrium in neutral cesium chloride. (a) Ammospermophilus harrisi (after Mascarello and Mazrimas, 1977); (b) Mus musculus (after Walker, 1968); (c) Dipodomys ordii and D.agilis (after Mazrimas and Hatch, 1972); and (d) Drosophila virilis and D.americana. (After Gall and Atherton, 1974.)

4

BERNARD JOHN AND GEORGE L. GABOR MMLOS

2. In other cases the same satellites are present, but they differ in amount (e.g., the kangaroo rat, Dipodomys). 3. Finally there may be changes in both kind and quantity (e.g., Drosophila virilis versus D . americana).

Despite all attempts to formulate simple rules governing satellite evolution, it is now clear that each case so far analyzed has brought with it its own claims for generalization, none of which have proven sufficiently allembracing. One initial hypothesis on satellite evolution was that satellites wax and wane with amazing rapidity in evolutionary terms, so that closely related species differ drastically in amount or type of satellite. However, improved methods of DNA sequencing have led to the suggestion that closely related species appear to modulate their satellites from a common library (Salser er al., 1976). New problems have been revealed following the use of restriction endonucleases. Thus, if one examines some of the cases presented in Table I, the complexities involved in satellite DNA function soon become apparent. One of the very few investigators who appears to appreciate the diversity of satellite DNA structure is Skinner (1977). From her studies on the crab satellites, she has attempted to realistically evaluate the implications of structure for function from a molecular viewpoint. She has stressed that “a major theme. . . is the diversity, almost the individuality of various satellites.* * Some satellites have a very simple basic repeat unit, minimally 2 base pairs (bp) in the crab AT satellite. Even a mammal such as the kangamo rat can have a satellite with a simple repeat; in the case of the MS satellite it is AAG. However, the repeating sequence can be very long. For example, the 1.688 satellite of Drosophila melanogasrer is 365 bp in length. Superimposed on the short repat sequences can be a long-range periodicity which is as high as 1408 bp in calf satellite. If one considers the relationship between satellites within a species, different patterns again emerge. In D . virilis the three main satellites are clearly related to each other by single base modifications, and so the basis for changes in satellite DNA sequence appears to be simple. The same situation does not, however, obtain in kangaroo rats. Here not only are there no apparent simple rules to derive the different satellites from a common sequence, as there are in D . virilis, but the satellites are also more heterogeneous. Finally, in I). melanogasrer, even though most satellites appear to be related simply to each other, the 1.688 satellite is complex. In spite of the large amount of information which now exists on the structure of satellite DNA, it is clear that the central issue, namely, function, has not been directly tackled. Probably the most important reason for this unsatisfactory state of affairs has been the signal failure to approach the problem of function experimentally, despite the considerable effort that has gone toward elucidating structural properties. In part this refractory state of &airs stems from the assumption

TABLE I STRUCTURAL PROPERTIES OF SATELLITE DNA ~

~~

Animal

SeqUCllCC

-

AT ATCC AGTGCAG(CTG)n

Sueoka and Cheng. 1962; Skinner er al., 1974 Skinner, 1977

ACAAACT ATAAAm ACAAATT

Gall and Atherton, 1974

Crab

Fruit fly, D . virilis

I

Kanganm rat

MS

n

III

Periodicity

Refenmx

Satellite

Salser cz al., 1976

HS-a a

Fry et al., 1973; Marx and Hearst, 1975

HS-8

A C A C A T GGG AG

Mouse

Mouse satellite

GAAAAATGA and variants

235 bp, 245 bp

E. M. Southan, 1975; Bite et al., 1975; Hon and Zachou, 1977; Maio eral., 1977; Marx and Herrrst, 1975

Guinea pig

Q=I

GGGTTA and variants

Heterogeneous

E. M. Southern, 1970

215 bp

Altenburger el al., 1977; Horz et al., 1974

III

GFG~

-

TABLE I (continued) Satellite

Animal

sesw=

370 bp plus variants, 430, 1850

Field mouse, A@sylvaticus, A . flavicollis, A . microps, A . agrarius, A . mystacinw

Reference

Periodicity

C o o k , 1975

bp

SkP

Satellite D[

235 bp, 176 bp, 125 bp

Maio er al.. 1977

Calf

Satellite I

B o t c h , 1974;

Satellite I[ Satellite ID

14oobp. 1408 bP 45 bp 2350 bp 22 bp 11 bp

a

176 bp

Fittler, 1977; Maio ef al., 1977 Rosenberg er al., 1978

A

176 bp 352 bp and variants of

African green monkey

172 bpk

B

M.io

et

d..1977

Streeck and Zachau. 1978

Maio et 01.. 1977

both 170 bp 340 bP

Mmuetislis. 1978a.b

Drosophila nasutoides

II

a1

Muskmelon, Cucumis me10 D . melanogaster

l(1.706)

II (1.706) 1.672 1.672 1.686 1.688' 1.705 1 305

a Two

-

-

AATAT AATATAT AATAACATAG and variants Complex and variants AAGAG AAGAGAG

100-120 bP Complexity almost as great as E. coli

Cordeiro-Stone and Lee, 1976

570 bp

Bendich and Anderson, 1974 Bendich and Taylor, 1977

1.7 x I@' bpd

-

365 bp 250 bp'

Peacock et al., 1973, 1977a; Endow et al.. 1975; Sederoff et al.. 1975; Manteuil et al., 1975; Shen et al., 1976;Endow, 1977;Carlson and Brutlag, 1977;Shen and Hearst, 1977; Brutlag er al., 1977a,b

renaturing components, fast and slow, bThe sequence of the African Green Monkey 172 bp segment is shown in Scheme 1. In the case of humans, since none of the satellitesI-IV have been sequenced, we have used the available data on restriction fragments. Based on reassociation kinetics. The sequence variations of the cloned 1.688 satellite of D . melanogmter is shown in Scheme 2. 'Based on trioxalen binding.

BERNARD JOHN AND GEORGE L. GABOR MMLOS

8 and111

20 - A G C T T T C T G A G A A A C T G C T C T G T G T T C T G T T - A A G A C T C T T T G A C G A G A C A C A A G A C A A -

E;E4R1

40 60 A A T T C A T C T C A C A G A G T T A C A T C T T T C C C T T T T A A G T A G A G T G T C T C A A T G T A G A A A G G G A A -

80

C A A G A A G C C T T T C G C T A A G G C T G T T C T T G T G G G T T C T T C G G A A A G C G A T T C C G A C A A G A A C A C C -

100 120 A A T T G G C A A A G G G A T A T T T G G A A G C C C A T A -

EEoR1

T T A A C C G T T T C C C T A T A A A C C T T C G G G T A T -

-

Mbo I1 125 140 G A G G G C T A T G G T G A A A A A G G A A A T A T C T T C C C T C C C G A T A C C A C T T T T T C C T T T A T A G A A G G -

nina111 160 170 G T T C A A A A C T G G A A A G A C A A G T T T T G A C C T T T C T T C G A -

SCHEME 1. The nucleotide sequence of a population of uncloned 172 bp Hind III segments of the African Green Monkey (Cercopithecus aethiops). (From Rosenberg er al., 1978.)

that a knowledge of function necessarily follows from a knowledge of structure. In part too it is explained by the fact that the properties of satellite DNA have been evaluated within the framework of pmkaryotic dogma without sufficient consideration of the higher-order phenomena which characterize the biology of eukaryotes. It appears very obvious that we have now reached a stage in satellite DNA research where additional structural analyses are not revealing the nature of its

9

SATELLITE DNA AND HETEROCHROMATIN

function-and indeed there is a very good reason for this. The initial success of the pmkaryotic approach to genetic function was due to its manipulative aspects. This approach, involving perturbation of a system by mutation, deletion, substitution and translocation, proved critical. Only recently has a similar approach been applied specifically in investigating satellite DNA function, although an enormous literature exists on experimental and natural modifications of heterochromatin, which bear directly on this issue. In the absence of experimental evidence the problem has in general been discussed in terms largely modified from earlier theoretical considerations relating to the functions of hetemhromatin. A summary of the comparisons of heteruchromatin and satellite DNA functions is presented in Table 11. As can be Seen from this table, the assumption has generally been made that there is at least one positive function. However, since similar organisms have widely different

G

GA

T

A

AGG

Rae

G

TT

AAA

C

T

G

A

A

G

A

C

T

T

c c

C

~[

A A

T

T

, , , , , , , C

A

G

AG

TT

GA

G

A

G C I G , A" A A A G G G G A A T G C O T T A G G A A G T G G T A A T T A G C T--_---_--_--____-_--____ TTTC C C T T A C G C A A T C C T T C G A C C A T T A A T C G A A c c G CC

,

c

,CTCTC,G,T

G

TIT

C,

------------------- A A C T T G G A A A T C G C A A T T T G C C A G G T A A A A A G G A A A A

I.

I

TTGAACCTTTACCGTTAAACGGTCCATTTTTCCTTTT GAGAGCA G C AAA G

"2,

G ,T T ,A AA, C A LG TTTCGTTGGAAAATATCCAATTTTTTGCAGAGTCTGTTTTTCCCAATTTC A A A G C A C C T T T T A T A G G T T A A A A A C G T C T C A G A C A A A A A G G,AC GTTAAAG C A A T T T G T C TG A

---____----____ C

T SCHEME 2.

T

AT

T

T

C

T

C G A G

Sequence variations in cloned 1.688 satellite DNA. (Fmn Bmtlag. 1977b.)

10

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

TABLE I1 A COMPARtSON OF THE SUGGESTED FUNCTtONS OF HETEROCHROMATIN AND SATELLITE DNA Type of function Chromosome organization

Heterochromatin' To stabilize centromeres or telomeres

Satellite DNA To protect vital chromosome organelles such as centromeres and nucleolus organizers (Yunis and Yasmineh, 1971) To alter the properties of the centromere or to stabilize chromosome ends (Walker, 1972)

To specify folding patterns of chromosomes (Walker, 1972) Cell metabolism

To control the transfer of substances across membranes To control cell size, hence rates of growth and differentiation

To protect vital euchmmatin by forming a layer at the outer surface of the nuclear membrane (Hsu, 1975) To add to the nucleotype and so determine rates of cell division and growth (Bennett, 1971) To attract nonhomologous chromosomes and so establish proximity between chromosomes or chromosome regions that are functionally related (Yunis and Yasmineh, 1971)

Chromosome pairing

To bring about or prevent pairing

To attract homologous chromosomes at meiosis and to provide a meansof recognitionbetween such chromosomes in all forms of pairing (Peacock er al.,

of homologs To regulate crossing-over and chiasma formation

1977)

Speciation and evolution

To affect breakability and/or rejoinability of chromosomes and so facilitate the evolution of karyotypes

To determine the Occurrence or fixation of chromosome rearrangements (Hatch er al., 1976)

To establish a fertility barrier that provides for evolution by hindering the pairing of homolo gous chromosomes in hybrids between species differing in satellite sequences (Yunis and Yasmineh, 1971; Corneo, 1976; Fry and Salser, 1977) ~

~~

'Summarized by Cooper (1959).

SATELLITE DNA AND HETEROCHROMATIN

I1

amounts of satellite DNA, and since such differences are found even between species that form viable hybrids, some investigators have suggested that these sequences are simply evolutionary by-products with no particular function. This fails to explain why so many eukaryotes have been found to contain highly repeated DNA and why its amount varies so considerably even between closely related species. Equally difficult to explain is why in some cases mechanisms have evolved to regulate replication of this DNA in particular tissues independently of the rest of the genome or indeed of other repetitious sequences in the same nucleus (Endow and Gall, 1975). Thus the large amount of satellite DNA in some species, its apparent rigid conservation in sequence and, as we shall see, its effects on the genome when it is altered in amount or position lead us to be unimpressed in general with the argument that most of it constitutes a functionless burden which many eukaryotes must bear. However, for the moment we will retain an open mind and examine the hard data pertaining to function before casting a final judgment at the end of this article. A further major problem is that all attempts to infer the mode of origin and evolution of satellite DNA have been based on comparisons between related species. Yet it has long been evident that decisive evidence on these questions is difficult to obtain from a comparison of modem species. We consider it unscientific to conclude that, because two species differ drastically in the amount of satellite DNA, this of necessity implies that the excess DNA is “unimportant.” What we see in contemporary species is the end result. This means it is impossible to determine what role, if any, satellite DNA might have played in the past evolutionary history of a group of species from comparisons of this kind. There is one additional important fact we would like to draw to the attention of the reader. There is a continuing preoccupation with interpreting functions of satellite DNA at one level of biological organization, namely, the cellular level. Yet it is no more than an assumption that a solution to the problem of satellite DNA function will be found at this level. Even where some attention has been paid to other levels, as in the matter of species comparisons, functional interpretation of the differences observed has been related largely to cellular characteristics. A critical question at the population level, however, concerns the factors which impinge on a given population in relation to changing environmental conditions. Under such circumstances flexibility is inevitable if the population is to survive, yet it is commonplace among biologists to ignore such flexibility until it becomes impossible to do so. The ovemding problem for organisms is to survive until reproduction, by whatever mechanisms are available to them. The options at any time are limited. Bacteria, for example, must possess the necessary mutations, or else possibilities for gene interaction, in order to survive. However, eukaryotes may not always require a genic solution to a particular problem. If a larger or smaller body surface area is better suited to a particular environment, this may be brought about by increasing or decreasing a nontran-

12

BERNARD JOHN AND GEORGE L. GABOR MMLOS

scribed component of the eukaryotic genome. Thus satellite DNA may by its very presence, not its sequence, increase nuclear and cell volume. In order to provide a realistic evaluation of satellite DNA functions we have attempted to do four things in this article: 1. To integrate the available molecular data on satellite DNA with the classic genetic data on heterochromatin. 2. To present evidence on the manipulation of hetemchmmatin both in experimental situations and in natural populations. 3. To extend discussions on satellite DNA functionto the organism and population levels. 4. To evaluate the limitations our discussions place on the existing hypotheses of satellite DNA function.

II. Structural Relationships between Heterochromatin and Satellite DNA Because some kinds of heterochromatin are now known to contain satellite DNA (Table ID)and because a large literature exists on the properties of heterochromatin, it is necessary to consider the relationships between heterochmatin and satellite DNA in some detail. The term “heterochmmatin” was initially used to define chromosomes or chromosome segments which did not uncoil at mitotic telophase and so maintained a condensed or heteropycnotic state throughout interphase and into the subsequent prophase of the next division cycle (Heitz, 1928). It has long been clear that within the terms of this broad definition the word “heterochmmatin” covers several quite different systems. The use of the one term to cover all these systems has frequently led to the naive assumption that all forms of heterochmmatin necessarily share a unitary function or functions. Unfortunately this same simplistic view has been carried over into considerations of satellite DNA function. In respect of the de novo development of heteropycnosity in the embryo, Brown (1966) contrasted two kinds of behavior. In facultative heterochromatinization only one of a pair of homologous chromosomes of only one set of homologues becomes heteropycnotic. By contrast, in constitutve heterochmmatinization both of a given pair of homologues, or else both sets of homologs, become heteropycnotic in the same way and at the same time. Later authors have been less careful and have applied the terms facultative and constitutive to heterochromatin rather than to the process of heterochromatinization. The two best examples of facultative behavior are: (1) In XX fetnale marsupial and placental mammals one of the two X chromosomes is regularly heteropycnotic in somatic

RELATIONSHIPSBETWEEN

TABLE III HETEROCHROMATIN CONTENT AND REPEAT~DDNA CONTENT IN SELECTED EUKARYOT~S ~

~~

Repeated DNA (%) Nctcmbmatin

Species

or c banding (9)

sptellite-like

Microtus agresris

2 6 O , 17B

6

Microtus pennsylvnnicus

<5b

4

Ellobius lwescens

<5b

2

M u mnusculus

27'

8-10

Homo sapiens

17'

3

Highly rcpcatcd

19 (C.r s 1)

Rekrtnce Yaaniach aad Yunis, 1973; Schmid, 1967 Hsu artd Arrighi. 1971 Walker, 1%8;WalLercral., 1969, Jones, 1970; Parduc and Gall, 1970

23 (Cot s 1)

Gosdtn er af., 1975;Marx el al., 1976a.b; Jones,

1970. 1977 Cricetulus griseus

24'

5 (Cot Q 0.005) 12 (Cot c 0.0s)

30 (C,r c 10)

Hsu and Arrighi. 1971; Anighi el al., 1974

G d et d..1976;

Drosophila virilis. d

52

41

Drosophila ewana,8

33

0

Drosaphila naswoidcs. 6

65

60

Drosophila mlmogaster. 6

33

20-25

Cordeiro el al., 1975; Gall er o f . , 1971 Peacock er 01.. 1973

Secale cereale

35. 30

10 (C,r s 0.01)

Gill and Kimkr, 1974;

Pimpinelli et af.. 1976

cordem-stoncand I&, 1976

hjckar et al,, 1974

'Hsu and Arrighi (1971). b ~ h m i (1967). d

14

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

nuclei, forming a so called sexchromatin body. (2) In coccid bugs the entire paternal set of chromosomes behaves in a facultative fashion. This facultative behavior is assumed to result from a form of genetic imprinting in which chromosome material known to include coding DNA is temporarily and reversibly repressed. Certainly there is evidence (Cattanach, 1975) to show a lack of structural gene activity in both these facultative systems. Thus in human oocytes heterozygous for electrophoretic variants of glucosed-phosphate dehydrogenase both gene products can be detected because of the presence of a hybrid band of this enzyme. No such band is seen in somatic tissues. In general, structural genes are not continuously active, and specific genes are activated only in specific tissues. In the case of the mammalian X chromosome the genes of one homolog are able to respond to activating stimuli, whereas those of the other are not. The genes of the inactive or unresponsive X therefore behave in a manner comparable to that of nonactive autosomal genes in differentiated tissues. In contrast, constitutive heterochromatin is regarded as a permanent feature of a chromosome in which the lack of major genes is supposedly due to a lack of coding DNA. Although constitutive heterochromatin is widely believed to have no structural genes, whereas facultative heterochromatin is assumed to reflect a state of general gene inactivation, there is, as we shall see subsequently, detectable genetic activity in both types. The conclusion that constitutive heterochromatin is depauperate in structural genes rests on two facts: (1) Classic mapping techniques have consistently shown that the density of major gene loci is very much lower in regions which are constitutively heterochromatic than in comparable lengths of euchromatin. (2) Whereas constitutive material commonly reacts in a specific manner to Giemsa stain following denaturation (C banding), facultative material is said not to do so. Moreover in many cases there is a good correlation between regions composed of satellite DNA and those which show positive C banding. This latter correlation stems from the initial finding that satellite DNA is present in the procentric regions of all chromosomes of the mouse (2n = 40) except the Y.These regions are known to be constitutively heterochromatic. It has been argued by Hennig (1973) that the mouse may be unusual in at least one sense, namely, that there is only one satellite and that it is present in all the heterochromatic regions. This contrasts with his own findings on the distribution of satellite sequences in members of the Drosophila hydei group in which a particular satellite is restricted in its location to only some members of the genome (Hennig ef ai., 1970). Similarly in D . meiunoguster (2n = 8), different satellite sequences may occur within what appears to be a homogeneous block of constitutive heterochromatin (Peacock et al., 1977a,b). In still other cases a specific satellite may be restricted in its location to only one or some members of the haploid complement. For example, in the calf, Bos raurus (2n = 58), there are four distinct satellites which together make up about 10-208 of the total

SATELLITE DNA AND HETEROCHROMATIN

15

DNA. In this species C banding shows constitutive heterochromatin to be present at the centromere regions of all the autosomes but not in the X or the Y. All four satellites are preferentially sited within the blocks of autosomal heterochromatin. Satellite I (p = 1.716 gm/cm3)is present on all autosomes. Two thirds of satellite I1 (p = 1.722 gm/cm3) also shows a similar distribution, but the remainder is dispersed over the karyotype and does not appear as heterochromatin. Finally, satellites 111 (p = 1.706 gm/cm3) and IV (p = 1.709 gm/cm3) are localized to the centromeres of most, but not all, autosomes (Kurnit ef al., 1973). It is evident therefore that the C band technique does not differentiate between particular satellite DNAs. Thus not only do different species have different satellites, but different satellites may coexist within a given species and show a different distribution within what appears to be uniformly C-banded material. Moreover, despite the claim that constitutive heterochromatin may be considered “a special type of chromatin that contains most of the satellite DNA” (Yunis and Yasmineh, 1971), there is now clear evidence that the distribution of satellite DNA need not parallel the distribution of constitutive heterochromatin as defined by heteropycnosis and C banding (Table 111). Thus in humans four satellites have been identified on the basis of heavy-metal binding to DNA. Together they make up about 3% of the genome, whereas the total C-banding material amounts to about 20% (Table IV). In siru hybridization studies (Gosden er al., 1975) indicate that at least 6 of the 22 members of the haploid set have C bands which contain none of the four conventional satellites whatsoever (chromosomes 2, 3, 4, 6, 8 and 11) while 5 others (12, 16, 18, 19, and the X) contain only very small amounts. Additionally, the relative proportions of satellite sequences in the C bands of chromosomes 1 , 9 , and 16 are not simply related to the size of the bands. There is considerably more highly repetitive DNA present in the human genome, since about 23% of the DNA isolated at Cot = 1.O renatures with second-order kinetics (Marx et al., 1976a). The bulk of the renatured Cot S 1.O fraction consists of five families (p = 1.687, 1.696, 1.700, 1.703, and 1.714 gm/cm3) which are highly heterogeneous both in terms of copy number and sequence complexity. When these five renatured families are analyzed in detail, approximately half of the renatured DNA is highly repetitious, the remainder being middle repeat. The 1.687, 1.696, and 1.700 families probably correspond to satellites I, 11, and 111, respectively. The 1.703 and 1.714 components contain about 20 and 25%, respectively, of a highly repetitious fraction. Marx ef al. (1976b) point out that these highly repetitious sequences are probably interspersed with middle repeat sequences. In sifu hybridization indicates that, while conventional satellites predominate at centromeric C banded regions, the renatured 1.703 and 1.714 fractions are found over all chromosome regions. As Marx ef al. (1976b) have indicated, the complex nature of the DNA template used for cRNA production and the problems involved in optimizing in sifu hybridization show that caution

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

16

TABLE IV THERELATIVE DISTRtBLKION O F THE FOUR SATELLITE DNAS IN THE CHROMOSOM@S OF HUMANS"

Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

X Y

Satellite I 15

-

15

Satellite I1 822

-

-

-

18 598

24 1620

-

15 29 74 111

-

22 74 118

-

31 1

-

96 414 474 282

Satellite III

Satellite

IV

144

494

-

-

112

32 -

260 -

3168 32

4407

-

-

247

104

-

13

200 368 1120

650 806 1365

56

468

-

-

-

42 I74 240 84 1728

256 368 592 1576

-

117 417 702 1040 13 1898

'The proportionsof each satellite were taken to be: satellite I, 0.14%; satellite I1,0.6%; satellite 111, 0.8%; and satellite IV, 1.3%. The amount of each satellite on any chromosome is given in parts per million of the haploid genome. It is important to note that these amounts am based on the grain distributions of radioactive cRNA over entire chromosomes and not just C-banded regions. (The calculations are based on data of Gosden er al., 1975, 1977; also see Jones, 1977.)

is required in interpreting these results. Thus we still do not know with certainty what makes up the bulk of human C bands, though it is clear that they cannot all consist of conventional satellite. The possibility still exists that within C bands some of the satellite material is interspersed with middle repeat. The human situation is reviewed in more detail by Miklos and John (1979). Rye, Secale cereale (2n = 14), has approximately 19 pg of DNA in diploid nuclei and includes the components listed in Table V when measured under conventional stringency criteria (T, -25°C). Although no satellite bands form following isopycnic centrifugation, the rye genome nonetheless contains a repetitious fraction comparable to that of the satellite DNA present in the genome of other eukaryotes, and C banding reveals a predominance of constitutive hetero-

17

SATELLITE DNA AND HETEROCHROMATIN TABLE V CHARACTERIZATION OF THE RYEGENOME'

DNA fraction

Frequency of repetition

Total DNA (%)

C,r = 0-0.01 Cot = 0.01-1 = 1-100 C,r > 100 (unique)

6.0x 106 to 6.0 x 1 0 ' 3.75 x lW 8.5 x l@ 1

10 33 30.5 26.5

cot

a Data

of Ranjekar et al., 1974.

chromatin at the telomeres together with some intercalary bands and smaller centromeric bands (Fig. 2). In total this amounts to 35% of the genome, which is sufficient to accommodate most of the highly repetitious DNA. This case indicates that it is possible to have highly repetitive fractions which, probably because of their sequence properties, do not appear as conventional satellite but which nevertheless can be localized by in siru hybridization to telomeric C bands (Peacock ef al., 1978) and can be isolated by restriction digests (R. B. Flavell, personal communication). Finally there are at least two further cases on record in which large blocks of C band-positive heterochromatin do not contain satellite DNA.The clearest case is that of the Chinese hamster, Cricerulus griseus (Arrighi er al., 1974). In this species (Fig. 3) the entire Y chromosome and the whole of the long arm of the X show positive C banding and form by far the greatest proportion of the constitu-

I

I

FIG. 2. C-banded haploid complement of rye. Shaded areas represent less intense C banding, and the locations of centmmeres an indicated by dots. As pointed out by Gill and Kimber, differences in C banding may well exist among different varieties of this species. Thus some varieties appear to have only telomeric bands. (Modified from Gill and Kimber, 1974.)

18

BERNARD JOHN AND GEORGE L. GABOR MIKMS

R

1

2

3

4

5

6

7

8

X

9

Y

10

FIG.3. Haploid complement of the Chinese hamster Cricerufus griseus showing the location of C bands. Centmmere locations are indicated by dots. (Modified after Gamperi el al., 1976.)

tive hetemchromatin within the genome. At Cot Q 10.0 the amount of repetitious DNA in the genome is about 28-3246, and about 40% of this is at a Cot of less than 0.05. When Cot C 10.0 and Cot Q 0.05 fractions were copied and used for in situ hybridization, similar grain localization patterns were obtained. These results indicated that, with the exception of the centric region of the X chromosome, the constitutive heterochromatin of both sex chromosomes was "highly deficient in, if not completely devoid of, repetitive DNA Sequences" (Anighi et a!., 1974). Additionally, autosomes 9 and 10 contain a large amount of constitutive hetemchromatin covering the centromeric areas, as well as most of the arms. However, while chromosome 10 is practically covered with grains, 9 has a very light grain density. In this respect chromosome 9 resembles the sex chromosomes. Here again, however, the complexity of the template makes it impossible to arrive at an unambiguous answer concerning the structure of the heterochromatin. The final case deals with wood rats of the genus Neotoma. Much of the variation found between species within this genus concerns differences in the number of heterochromatic short arms which are totally C-band-positive. Preliminary biochemical characterization of the DNA demonstrates no obvious differences that can be correlated with this variation. The results of in situ hybridization using cRNA from a Cot Q 1.O fraction showed that the label appeared no more concentrated on the heterochromatic short arms than in the euchromatic regions (Mascarello and Hsu, 1976). This implies that the distribution of highly

SATELLJTE DNA AND HETEROCHROMATIN

19

repeated DNA is no different on the heterochromatic arms than on the euchromatic arms. This rather complex picture of satellite DNA distribution makes it clear that the constitutive heterochromatic component of a genome is not exclusively composed of simple-sequence DNA. It also indicates that it is unlikely that the biological role of satellite DNA will emerge simply and solely from consideration of its location within the genome. Earlier arguments concerning satellite DNA function were preoccupied with the centric localization of satellite DNA. Indeed, this attitude still persists. Thus Mascarello and Mazrimas (1977) comment that “given the near ubiquity of centromeric heterochromatin there can be little doubt that it serves some function or, at the very least, reflects the activity or status of some important component of the genome. It is not clear, however, that other (i.e., noncentromeric) heterochromatin blocks have any importance whatsoever.” In fact, it is now apparent that in many organisms the constitutive heterochromatin is predominantly noncentric in location (Table VI and Fig. 4),

TABLE VI SOMESPECIES WITH NONCENTRIC C BANDS‘ Species Plants Secale sp. Tulipa Allium sp. Anemone sp. Animals Cetacea (whales)

Ammospermophilus sp.

Cryptobothrus chrysophorus, N race Uromys caudimaculatus, N form

C-band distribution One or both telomeres, some interstitial Terminal and interstitial Terminal and interstitial Confined to short arms of acrocentrics Many intersitital and telomeric bands; some autosomes devoid of centric bands Three to four pairs with intersitital bands and up to three pairs with distal bands Terminal on four of the chromosomes, interstitial on one Large number of terminal bands

Reference

Bennett er a]., 1977 Fillon, 1974 Vosa, 1976; El-Gadi and Elkington, 1975 Marks and Schweizer, 1974

Amason, 1974

Mascarello and Mazrimas, 1977

John and King, 1978 Baverstock et al., 1976

‘Note that there are many species which lack centric C bands on some or all chromosomes and which are not included in this table. The interested reader is referred to Yamamoto (1978).

20

BERNARD JOHN AND GEORGE L. GABOR MIKLOS SPECIES A. cylindrica

n

8

~

rCROCENTRlCS

SUBMETA- , METACENTRICS

1 _ 2

OOBB

A. riparia

8

A. virginionc

8

A. coranaria

8

mi I

A. pavonina

8

i ki

A. blando

8

-

a b c

a

b

R a

b

FIG. 4. C-banded haploid karyotypes of six species of Anemone. Only chromosomes showing C bands an illustrated, and all of these are noncentric. (Modified from Marks and Schweizer, 1974.)

and there is certainly no longer any justification for emphasizing centric location as an important factor in determining satellite function. While regions conventionally regarded as being constitutively heterochromatic are assumed not to contain structured genes, we know of at least two instances (D. melunogaster, Hilliker, 1976, and the tomato, Lycopersicon esculentum, Khush et ul., 1965) where genes with known activity occur interspersed within heterochromatic regions. The Y chromosome of D. melunogaster poses several problems when viewed in this light. First, it appears almost totally heterochromatic and C-band-positive and has no indispensable somatic function as demonstrated by the fact that XO flies appear to be fully viable. The second fact that requires attention is that despite its high satellite DNA content this Y is known to carry the seven fertility factors which function at male meiosis. Thus, while XO flies are viable, they are also sterile. This Y behaves in a frankly facultative fashion in the sense that, while it is loaded with simple-sequence DNA,it also contains what appears to be conventional structural genes which while not active in somatic tissues are briefly active in the g e m line. They terminate their activity before the onset of the first meiotic metaphase, and after this time, like all the other chromosomes, the Y is dispensable for the subsequent differentiation of the spermatids. Do these fertility factors then represent loci within an otherwise constitutively hetemhmmatic chromosome which are nevertheless regulated in a conventional manner? Certainly these loci are not required to be sequestered

21

SATELLITE DNA AND HETEROCHROMATIN

within large blocks of satellite DNA in order to function, since in both D. virilis (Holmquist, 197Sa,b) and D . hydei (Hennig, 1972) the Y chromosomes, though again heteropycnotic and C-band-positive, cany little or no satellite! DNA. Yet the Y of D . hydei is known to carry six fertility factors which become transcriptively active during the first meiotic prophase in the form of giant loops (Hess, 1973; Hennig et al., 1973). Additionally, Leoncini (1977) has described four ethyl methanesulfonate-inducedtemperature-sensitive mutants in D. hydei, all of which affect fertility, and at least two of these occur in regions of the Y which do not give rise to loops. This raises the interesting possibility that besides the conventional fertility factors there might be other genes which affect fertility in Y chromosomes of other species of Drosophila. The Y chromosomes of certain mammals are also distinguished with respect to their heterachromatin and DNA characteristics. In primates, for example, the Y shows more variability from species to species than almost any other chromosome (Miller, 1977). The gorilla Y is longer than that of any other primate, including the human Y,and together with the latter has the most complex pattern of banding (Table VII). Note that, although satellite DNA is present on the Y of all four species, only two of them give evidence of C banding. Moreover, in both humans and gorillas, where a large block of constitutive heterachromatin is present in the long arm, the remainder of the chromosome is euchromatic. Even so, no genes are known with certainty within the euchromatin of the Y. In some mammals such as the opposum, Didelphis albiventris, the ocelot, some marmosets, and several bats the Y is so tiny as to be barely visible microscopically. Under such circumstances it appears unlikely that there are many major gene loci in these mini-Y chromosomes. TABLE VII CHARACTERISTICS OF PRIMATE

Y CHROMOSOMES'

mpenY

Human

Gorilla

Chimpanzee

Orangutan

C banding 5-Methylcytosine Q brilliant Satellite I Satellite I1 Satellite IIIc Satellite IV

Long arm

Middle of long arm

Absent Absent Absent

Absent Not studied Absent

+b

Distal end

+ + + +

+ Distal end + + + +

+ + +

Absent

+ + + +

Aftex Miller (1977). A positive in sifu hybridization reaction (+) indicatesonly that then am homologous sequences. it does not indicate that the sequences are identical. In the human Y, there is a 3500 bp HaeIII restriction fragment which s h a m some properties with satellite III. Such a spacing of HarIII sites does not occur in digests of male chimpanzee DNA (see Addendum, note 4) and this test has as yet to be carried out in the Gorilla and the Orangutan. a

22

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

The message from these several examples is clear and unambiguous. There is a variable relationship between heterochromatin, even constitutive heterochromatin, and satellite DNA. To some extent this confounds the simple division into facultative and constitutive classes. The most formidable evidence in support of this statement has been provided by Motara and Rai (1977) who showed that the expression of a C band could change as a function of the genetic background against which it was placed. Thus in the mosquito Aedes aegyprii the femaledetermining or m chromosome shows a conspicuous C band in one arm and at the centmmere. The homologous male-determiningor M chromosome has neither of these bands. In the related species Aedes mascarensis the m chromosome lacks the intercalary band in both the male and female. In Fl hybrids of A. uegyptii 0 X A . mascarensis 8 the intercalary band is unexpectedly absent in all sons and daughters but is found in the reciprocal cross. If Fl males lacking the intercalary C band are backcrossed with A . aegyptii females, two types of male progeny are produced: normal males lacking the interstitial band, and intersexes which have it. This C band thus behaves in a facultative manner despite the fact that facultative heterochromatin is supposed not to form C bands. In considering the possibilities for satellite function therefore, we need to take into consideration not only the satellite content of a chromosome or chromosome region but also its location and pattern of occumnce, that is, whether the satellite in question is interspersed with other sorts of DNA. Additionally we need to emphasize that heterochromatin may be present in eukaryotes in one of three distinct forms: 1. As a fixed component of the genome, sometimes differentiating races within a species and at other times differentiating closely related species. 2. Supernumerary to the normal complement and usually present in both the soma and germ line either in the form of heterochromatic segments on conventional members of the chromosome set, or else as separate and additional supernumerary chromosomes. In both these cases populations are polymorphic with respect to this form of heterochromatin, which is an essentially variable component of the genome differing not only between individuals within a population but also between populations. 3. As a fixed but purely germ line component which is excluded or eliminated from the soma at the early cleavage mitoses. Here too the heterochromatin may take two quite distinct forms: (a) It may exist as whole chromosomes variously described as E chromosomes in cecidomyids, K chromosomes in chironomids, and L chromosomes in sciarids. The designation E implies their elimination from the soma, K refers to their presence only in the Keimbahn or germ line, and L also indicates their limitation to the germ line. (b) It may exist as blocks of heterochromatin on standard members of the germ line chromosome set. The classic example of this is found in nematode worms, but a second case is now

SATELLITE DNA AND HETEROCHROMATIN

23

known in the copepod Cyclops (Beermann, 1977). This case is particularly interesting because, while the germ line heterochromatin is a fixed property, it is nevertheless polymorphic in terms of the amount which varies between individuals. Additionally it demonstrates that interstitially located heterochromatin can be removed from a chromosome without altering its structural integrity.

Let us begin therefore by considering the differences in hetemhromatin and satellite content that can be determined in related species, since most of the arguments concerning satellite DNA function have been based on such comparisons. 111. Heterochromatin and Satellite DNA Variation

A. INTERSPECIES COMPARISONS In the absence of direct evidence on the evolutionary history of any group of organisms, one has no recourse but to use comparisons between extant species. It is not sutprising therefore that those who have concerned themselves with the problem of satellite function should have resorted to this approach. It is, however, an approach that is fraught with danger. First, it is always difficult to determine the changes that have gone on in the past simply by comparing contemporary species whose relationships to one another are themselves matters for speculation. Within a given lineage we have only the survivors at our disposal, and these may not constitute a majority, since nature effectively buries her dead. We thus have only the successful products of change available for examination, and these may represent only a few of the changes that have gone on in that lineage. With these qualifications in mind, and taking the evidence at face value, we believe that there are only three sets of comparisons that provide sufficient documentation to allow an objective appraisal of the situation, and we turn now to a consideration of these. 1. Peromyscus

In all known species of deer mice the diploid number is invariably 48, but the number of chromosome arms varies from 56 (Perumyscus boylei and P . crinitus) to 96 ( P . eremicus, P . cullatus, P . merriami, and P . guardia). If one compares the karyotypes of P . crinitus and P . eremicus (Pathak et al., 1973), one finds (Table VIII) that the difference is due to the presence of 40 additional totally heterochromatic short arms, all of which are C-band-positive. Peromyscus eremicus possesses a satellite DNA band @ = 1.705 gm/cm3) which is lacking in P . crinitus. When radioactive cRNA transcribed from this satellite is hybridized

BERNARD JOHN AND GEOROE L. GABOR M I K U S

24

TABLE VIII KARYOTYPE ORGANIZATION IN TWO SPECIES OF &~OmySCUf

Species

2n

NA

Euchromatic

Heterochmmatic

arm

arm

Relative DNA content

Peromyscus crinitus

48

56

52

4

1.oo

Peromyscus eremicus

48

96

52

44

1.36

a

Data of Pathak ef a!. (1973); Deaven et al. (1977).

in situ with P . eremicus chromosomes, the grains localize mainly on the heterochromatin of the short arms ( H e n er a f . , 1977). Since the G-banding patterns of the euchromatic arms of these two species appear identical, the only major change demonstrable between them is the acquisition or the deletion of arms made up entirely of constitutive heterochromatin. While some species of Peromyscus are chromosomally monomorphic (i.e., fixed for a single karyotype), three species (P.dificilis, P . maniculatus, and P . melanophrys) contain populations polymorphic for arm number. Peromyscus maniculatus is the most karyotypically diverse species of this group and exists as at least seven subspecies, namely, P . m. rubidus. P . m. gracilis, P . m. bairdii, P . m. holisteri, P . m. rujinus, P . m. gambeli, and P . m. sonoriensis. Thus most if not all of the populations in Oregon, California, and Nevada are polymorphic. This extensive polymorphism involves at least seven pairs of autosomes. Moreover, the populations exhibit clinal variation in the number of short arms (Waterbury, 1972), and superimposed on this clinal system is an inverse relationship between the mean number of telocentrics and the elevation of the sample site. The karyotype of P . municulutus is thus especially variable, and this species is characterized by both polymorphism and polytypism (fixed chromosome races) for the kind of difference which elsewhere in this genus is found between species. It was initially assumed by Pathak et a f . (1973) that all cytological differences within this genus were due to changes in the number of heterochromatic arms. In Peromyscus leucopus, however, it was subsequently demonstrated that a m number varied from population to population and that the short arms were not always heterochromatic. Rather, when G-banded preparations of P . crinitus and P . leucopus were compared, it was evident that pericentric inversions had been responsible for the additional euchromatic arms in five of the largest autosomes (Arrighi et af., 1976). Not only can both types of changes be found in different species in this genus, but they may occur within a single species, even within a single population. Thus in the case of a single population of Peromyscus maniculatus nebrascensis, studied by Murray and Kitchin (1976), there was a range

SATELLITE DNA AND HETEROCHROMATIN

25

in arm number from 86 to 89. In 10 individuals studied autosome pairs 6, 7, and 9, and the X, were polymorphic. The submetacentric and telocentric forms of 7 and 9 had heterochromatic arm differences. The submetacentric form of 6 and the

X had euchromatic short arms and a G-band pattern indicative of inversion. Several investigators have suggested that a relationship might exist between satellite DNA and speciation. This suggestion stems from one or the other of two arguments: (1) Alterations in the amount of satellite DNA can be expected to create a divergence with respect to chromosome homology (Corneo, 1976; Fry and Salser, 1977); or (2) the gain of satellite DNA predisposes a chromosome to secondary structural rearrangement (Hatch et al., 1976). Either or both of these processes is then assumed to impose a degree of reproductive isolation. The Occurrence of polymorphisms involving heterochromatic differences in Peromyscus makes it clear that satellite DNA is not a sensible candidate as an isolating mechanism in this genus, since the function of a polymorphism is to allow diversity to continue to exist within a single species. Sex is the most blatant example of this princjple, but the same applies to all polymorphisms. Equally, the presence of heterochromatic short arms in Peromyscus has not led to any apparent structural differences in the euchromatic portion of the genome; all species in this genus have 2n = 48. Moreover, chromosomes with pericentric inversions lack heterochromatic arms, and those with heterochromatic arms lack inversions. Thus in this case the only rearrangements that have occurred have been in chromosomes which effectively lack satellite DNA. 2 . Drosophila There are over 1200 species in the genus Drosophila and, although only a very small number of these have been characterized biochemically, it is already clear that this genus includes species whose DNA sequences are more different from each other than members of different families in some mammalian groups (Laird, 1973). It has long been recognized that species are often distinguished by differences in chromosome number or by the arrangement of euchromatic segments. Such differences can be characterized in Drosophila with particular precision because of the extra dimension of cytological resolution afforded by the bands of the giant polytene chromosomes. Only recently, however, has special prominence been given to the existence of fixed differences in heterochromatin content among species. In extreme cases, for example the homosequential species of Hawaiian Drosophila (Carson et al., 1967; Ahearn et al., 19741, this may be the only form of chromosome difference distinguishing two species. Indeed, Holmquist (1975b) draws attention to the interesting fact that heterochromatin content in Drosophila is more taxonomically divergent than external morphological characteris. Certainly there are clear cases where concomitant with speciation there has been a loss or the gain of large heterochromatic blocks. The most striking of

26

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

these is Drosophila nasutoides in which the entire satellite component is present in one very large autosomal pair which is almost entirely heterochromatic and which represents an amplified form of the dot chromosomes found in other species of the Drosophila immigrans group to which it belongs. DNA isolated from diploid nuclei reveals four major satellites which collectively add up to 60% of the total genome. None of these are represented in polytene nuclei (Fig. 26), where the giant metacentrics are replaced by a pair of dot chromosomes. Apart from this pair of giant chromosomes the Y also shows C-band-positive behavior but, since there are no detectable differences in the satellite content of males and females, it appears that it does not contain much in the way of satellite although it is completely heterochromatic (Fig. 5 ) . Likewise, little or none of the satellites appear to be localized at the centromeres of any of the other chromosomes. Similar, though not quite so extreme, examples are found elsewhere in the genus too. The four related species, Drosophila pachea, D . nanmptera, D . acanthoptera, and species W , differ with respect to additions of heterochromatin to either the autosomes or the Y (Fig. 6). Moreover, species W and D . nannoptera are homosequential in polytene banding, though they differ strikingly in mitotic karyotype (Ward and Heed, 1970). A particularly revealing state of affairs is found in the D . virifis group where many of the interspecies hybrids are not only viable but also fertile. Figure 7

R

Sat. I silver grains

FIG. 5 . Diagrammatic representation of the mitotic complement of Drosophila nasutoides to show C banding and the location of satellite I as revealed by in situ hybridization. (After Wheeler and Altenburg, 1977.)

27

SATELLITE DNA AND HETEROCHROMATIN

D. PACHEA

-

D. ACANTHOPTERA

\

\

I I / /

PRIMITIVE

FIG.6 . Chromosome phylogeny in the D . pachea group. Heterochromatic regions are shown solid. Drosophila nannoptera and species W are homosequential. (After Ward and Heed, 1970.)

summarizes the accepted phylogeny of this group, together with the major structural rearrangements which have accompanied species transformation. This figure also summarizes the amount of satellite DNA currently present in each species. In D . virilis itself there are three major satellites which have the properties summarized in Table I (Gall and Atherton, 1974). These three satellites are related to one another by single base substitutions. Satellite I is also found in Drosophila texana, D . americana, and D . novamexicana, but none of the other two satellites can be demonstrated elsewhere in the group by analytical ultracentrifugation. This method is not sensitive enough to rule out the possibility that they might still be present in amounts less than 1%. In the other species there are minor satellites which comprise less than 5% of the genome and have buoyant densities of 1.721, 1.712, and 1.676 gm/cm3, respectively. The apparent absence of satellite DNA, even cryptic satellite DNA, in Drosophila ezoana is evident not only from the buoyant density trace but also from the reassociation data of Comings et al. (1977).

28

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

FIG. 7. Phylogenetic relationships in the D. virilis group (see White, 1977) and accompanying buoyant density profiles in neutral cesium chloride of each species (see Gall and Atherton, 1974). Hypothetical intermediates in the evolution of this group are not shown.

This particular phylogeny is of interest for five reasons: 1. It demonstrates that it is possible apparently both to lose and gain satellite DNA without any accompanying change in karyotype (D. virilis + D . novamexicana) or else with only minor accompanying change (D.virilis + D . montana). Indeed, in the extreme case (D. viriiis --* D . ezoana) all satellites have been reduced below the level of detection by analytical ultracentrifugation.

29

SATELLITE DNA AND HETEROCHROMATIN

2. Since Drosophila littoralis is derived from D. ezoana by a fusion of chromosomes 3 and 4 and D . ezoalul has no detectable satellite DNA, it is evident that structural rearrangement of the type known elsewhere in the group ( D . virilis + D . texana) can take place in the virtual absence of satellite DNA and so cannot be a satellitedependent process. 3. Since interspecific hybrids are possible between most of the species (Table IX),it is clear that there is no simple relationship between differences in satellite content and crossability. Additionally, there is a very interesting relationship between the satellite content of parental forms and the fertility of their hybrids. For example, D . texana, D . americana, and D . novamexicana have all of their satellites in common. However, crosses involving D . americana with the other two species give strikingly different results. When D . americana is the female parent, 15% of the D . americana X D . novamexicana crosses are fertile, whereas 44% of the D . americana X D . texana crosses are fertile. The corresponding figures for the reciprocal crosses are 0 and 2876, respectively. The D . novamexicana X D . americana crosses thus fare worse than the D . novamexicana x D . virilis crosses, where the corresponding figures are 20% for TABLE 1X FERTILITY OF INTERSPECIFICHYBRIDS IN THE Drosophila virilis GROUP' Fertility of F, hybridsb

P

cross D . virilis X D . novamexicana D . novamexicana X D . virilis D . virilis X D. texana D . texana X D . virilis D . virilis X D . americana D . americana X D . virilis D . virilis X D . montana D . montana X D . virilis D . virilis X D . flavomonrana D . flavomontana X D . virilis D . virilis X D . borealis D . borealis X D . virilis D . virilis X D . lacicola D . lacicola X D . virilis D . virilis X D . ezoana D . ezoana x D . virilis D . virilis X D . littoralis D . littoralis X D . virilis a

Data of Oshima (1966).

* +, Fertile; -, infertile;

0, no hybrids produced.

8

Possibility of gene exchange in BX hybrids

+ + + + + + +

Very low -

Very low 0

Very low 0

Very low Very low

30

BERNARD JOHN AND GEORGE L. GABOR MIKJAS

D . virilis x D . novamexicana crosses and 2% for D . novamexicana X D . virilis crosses (Patterson and Stone, 1952). Significantly, therefore, D . virilis differs radically from D . novamexicanu in satellite content, whereas there is no difference between D . novamexicana and D . americana. The same pattern is evident in other branches of this phylogeny. Drosophila montana and D . flavomontana have near identical buoyant density traces with only a small satellite at 1.712 gm/cm3. However, they react differently when either is crossed with D. virilis. First, there are differences in the success of reciprocal crosses. In D . virilis X D . montana crosses both male and female hybrids can be fertile, whereas in D . virilis X D.flavomontana male hybrids are never fertile (Table IX). Finally, in a situation where no satellites of any kind are evident ( D . ezoana and D . littoralip), a different response is again produced when crosses are made with D . virilis. Clearly the viability and fertility of hybrids in the D . virilis group do not depend on similarities or differences in the satellite content of parental species. 4. In the D . virilis X D . americana hybrid an average of the two parental satellite contents is expected and found in the F,. Since there is no evidence for any amplification of satellite in this hybrid (Fig. 8), it follows that somatic development is not markedly disturbed, despite the fact that the hybrid is composed of an average of the two parental satellite systems. 5. Most of the hypotheses concerning the functions of satellite DNA are based on the kind of distribution seen in the mouse, where satellite blocks are present on all the autosomes and always at procentric positions. If satellite DNA indeed functions in such basic matters as the maintenance of chromosome structure, chromosome folding, the partitioning of chromosomes in the interphase nucleus, homolog recognition, and meiotic pairing, then it is abundantly clear that D . ezouna can successfully perform all these cellular duties with no detectable satellite DNA whatsoever. Drosophila nasutoides places even more severe restrictions on these popular arguments for satellite function.

One final example relates to the picture-winged Drosophila of Hawaii. Here Craddock (1973, and personal communication) found that the major satellite components were consistent within a cytological subgroup but differed in relative amounts among such groups. Moreover, in a comparison involving 18 species she showed that homosequential forms gave very similar if not identical satellite DNA patterns. Here then is further trenchant evidence that satellite DNA differences are not necessarily correlated with speciation. 3. Dipodomys In North America, kangaroo rats, a group of nocturnal burrowing rodents, have evolved into one of the most successful residents of semiarid regions. The genus Dipodomys is believed by all morphologists who have studied it to be

31

1.692

1

’ D. virilis

1.688

B U O Y A N T DENSITY (g/cm3]

FIG.8. Analytical cesium chloride density gradients of D.virilis (a), D.americana (b), and the D. virilis X 0.americana hybrid (c). (After Gall and Atherton, 1974.)

monophyletic and to include 22 currently recognized species. All the species are remarkably similar in morphology, since all of them are specialized for rapid bipedal locomotion, and it is from this of course that the genus derives its Latin name. Current opinions regarding the pattern of phylogeny within the genus rest largely on the work of Stock (1974) who analyzed 18 of the species cytologically. The diploid number varies from 52 to 74, with three major species clusters at 52 to 54, 60 to 64, and 70 to 74, respectively, and with no intervening values. The number of autosome arms (NA) ranges from 70 to 144, and all species show a simple XWXY sex chromosome system in which both sex chromosomes are

32

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

two-armed elements. Since G- and C-banding techniques were not used in any systematic fashion in his study, Stock’s interpretation of the results is based on simple karyomorphology. With this serious limitation in mind he came to three principal conclusions regarding chromosome evolution within the group: 1. The primitive karyotype is assumed to be 2n = 72/NA = 70 in which all the autosomes are uniarmed or nearly so. This assumption is based largely on the fact that 2n = 72 types occur throughout most of the geographic range of the genus. 2. Three principal forms of change have taken place in this basic karyotype, all of which convert uniarmed chromosomes into biarmed chromosomes: (a) fusion, which leads to a reduction in chromosome number with no change in arm number; (b) pencentric inversion, which leads to an increase in the number of arms with no change in 2n; and (c) the addition of heterochromatin, which also leaves 2n unchanged but may increase the arm number. The mode of involvement of these events is then assumed to have been as follows: (a) Fusion plus subsequent pericentric inversion and/or heterochromatin addition to give 2n = 60 to 64/NA = 94to 116 2n = 72/NA = 70--(b) Fusion plus subsequent pericentric inversion and/or heterochromatin addition to give 2n = 52 to 54/NA = 96 to 104 (c) Pencentric inversion and/or heterochromatin addition to give 2n = 72 to 74/NA = 134 to 144 3. On the basis of these presumed changes five groups of kangaroo rats can be distinguished (Fig. 9).

/

\

Note, however, that nowhere in his paper does Stock offer a clear case of fusion. He is also unable to distinguish between cases in which a change in arm number results from pericentric inversion as opposed to heterochromatin addition. Without this kind of detailed information the suggested phylogeny is clearly lacking in precision. Nevertheless, Hatch et al. (1976) have accepted the validity of Stock’s conclusions and have interpreted species variation in the composition of DNA in terms of his proposed phylogeny. Eighteen species were compared, 11 of which have also been quantified in terms of their 2C content, which ranges from 6.9 to 10.9 pg/nucleus. The buoyant densities of the principal and satellite DNA fractions are the same in all the species, though each exhibits its own particular amounts. All buoyant density profiles are characterized by four fractions (Fig. lo), namely, 1.698 gm/cmg (principal, P), 1.702 gm/cm3 (intermediate density, I), 1.707 gm/cm3 (MS satellite), and 1.713 g d c m g (two heavy satellites, HS-a and HS-P). Taking only the 11 cases for which complete data are

33

SATELLITE DNA AND HETEROCHROMATIN merriomi nitrotoidor

52/100 54/104

dorerti

64/108

micropr

60/116

dephontinur venuriur peninsulorir ogilir ingenr hoormonni ponomintinur

60/116 60/116 60/116 60,62/116,110 64/90 64/94 64/96

rtephonri groviper

70/71 70m

MERRIAMI group > E l

I).}D

HEERMANNI group

b,

ordii nelroni spoctobilir olotor ornotur

FIG.9. Phylogenetic relationships in the genus Dipodomys as proposed by Stock (1974), together with the chromosome number and the arm number. The subgroups of the D . heermanni group are designated A, B, C. D, and E.

provided their results can be summarized as shown in Table X. Unfortunately in their Fig. 1, on which Table X is based, the values of the P and the I fractions have been reversed, with the net result that in all caws the amount of P is lower than the amount of 1. This must be incorrect, since in Table 2 of their 1972 paper Mazrimas and Hatch make it clear that P is always greater than I. The two main conclusions Hatch et a / . (1976) draw are based on this error (see, for example, their Fig. 2c), and in Table X and in the discussion that follows we have therefore restated them in correct terms: 1 . Species with a reduced 2n show on average a proportionately lower 2C, the difference consisting predominantly of satellite DNA, and the increase in NA is accompanied by a trend toward increasing HS satellite DNA. While this holds for broad comparisons among species. the most informative comparisons of course are those which can be made within species. Note then that Drosophila ordii monoensis (2n = 7 2 ) has a reduced 2n compared to D . ordii compactus (2n = 74) but a higher 2C (Table XI). The nature of this change, from 72 to 7 4 , cannot be accommodated by any of the three processes invoked by Stock. Dipodomys ordii compactus cames an additional metacentric (compare Fig. 1 l a and b) and is unique within the genus in having a 2n in excess of the presumed ancestral 72. Whatever the mechanism responsible for such an

34

BERNARD JOHN AND GEORGE L. GABOR MIKLOS HS-a HS- p

BUOYANT DENSITY {g/cm3\

FIG.10. Analytical cesium chloride density gradient profile of the DNA of Dipodomys ordii showing the relative proportions of the different components. The 1.713 peak contains the H S a and HS-8 satellites. The 1.707 peak contains the MS satellite. (After Salser er al.. 1976.)

increase in 2n, if indeed it is an increase, it has also been accompanied by halving of the MS satellite but with essentially no change in P, I, or HS satellites. There is a second comparison that merits consideration. Dipodomys heermanni californicus and D . heermanni saxatalis, both from northern California, differ greatly in karyotype from what is regarded as the southern subspecies of D. heermanni (Fashing, 1973). Fashing suggests that the northern and southern forms may well turn out to be separate species, which indicates that taxonomic relationships within the genus are still not completely defined. The details are summarized in Table XII. The significant feature from our point of view is that the form with the lower 2n again does not have a lower 2 C ; neither does it have a reduced satellite content. On the contrary, there is a 250% increase in the amount of HS satellite. 2. The second conclusion is that an abundance of HS satellite is associated with karyotypes consisting of grossly biarmed chromosomes, whereas a preponderance or predominance of principal DNA is associated with more nearly uniarmed karyotypes. That is, “heavy satellite DNA promotes either the initiation or else the fixation of those chromosome rearrangements, most probably pericen-

SATELLITE DNA AND HETEROCHROMATIN

35

tric inversions” which transform uniarmed chromosomes into biarmed ones (Hatch et al., 1976). Again there is an interesting comparison which allows us to examine the validity of this generalization in an intraspecific situation (Table XIII). Dipodornys spectabilis spectabilis has an all-uniarmed karyotype which Stock considers primitive. It also has approximately 10% of its genome as MS and HS satellites. Dipodomys spectabilis baileyi, however, has a rearranged karyotype and approximately 25% satellite. The higher satellite content of D . spectabilis baileyi is thus at variance with the conclusions of Hatch et al. (1976). Thus there is only 2% HS satellite in D . spectabilis spectabilis, and yet it is this satellite which is held to be responsible for rearrangements. Equally remarkable is that the

FIG. 11. Karyotypes of two species pairs (a and b, c and d, respectively) to illustrate intraspecific patterns of chromosome change in the genus Dipodomys. (a) Dipodomys ordii from Oklahoma; (b) D. ordii compacrus; note that this subspecies has an extra small metacentric (boxed) which has no obvious counterpart in other subspecies of D. ordii; (c) D. specrabiiis spectabilis; (d) D. spectabilis baileyi; note that this subspecies has 12 pairs ofsubmetacentrics (boxed) which appear to have arisen by pencentric inversion of the 12 largest acrocentrics of D. spectubilis specfabilis. (Data of Stock, 1974.)

BERNARD JOHN AND GEORGE L. GABOR MTKLOS

36

TABLE X KARYOTYPE AND NUCLEAR DNA COMPoSlTlONS OF 11 TAXAOF THE KANGAROO RAT Dipodomys’ DNA component KVOtYpe

Satellite DNA I

MS

HS

2n

NAb

2c (pg)

P

Taxon

1.698

1.702

1.707

1.713

Dipodomys speciabilis speciabilis Dipodomys speciabilis baileyi Dipodomys ordii monoensis Dipodomys ordii compacius

72 72 72 74

70 94 140 144

9.8 9.6 10.9 9.7

7.8 3.8 3.5 3.4

1.0 3.3 2.0 2.2

0.8 2.0 2.5 1.2

0.2 0.5 2.9 2.9

Dipodomys microps Dipodomys agilis perplexus Dipodomys heermani tularensis Dipodomyspanamintus leucagenys Dipodomys deserti deserti

60

8.0

9.5 6.9 7.9 8.8

3.5 4.5 3.7 4.1 4.8

1.5

64 64 64

116 110 94 96 108

1.8 1.4 1.7 2.5

1.0 1.6 1.2 1.0 1.2

2.0 1.6 0.6 1.1 0.3

Dipodomys heermani californicus Dipodomys merriami merriami

52 52

96 100

8.5 8.1

4.3 3.4

1.7 2.6

1.0 1.6

1.5 0.5

~-

~

62

~

~~

aData of Hatch et al. (1976). bNA refers to the number of autosomal arms only, the sex chromosomes

not included.

principal component, which must in many respects resemble main-band DNA, has teen halved in D . spectabilis baileyi. To judge from Stock’s karyotype photographs (our Fig. l l c and d) and the known 2C values, the difference between these two subspecies appears largely to be the result of pericentric inversion. Thus overall there is little difference in the TABLE XI KARYOTYPE AND GENOME ANALYSIS IN Dipodomys ordiia -

~

~~

~

~

Kwotypeb

~~

~~~~~~

Genome DNA

n

2C

P

I

MS

HS

Total satellite

5

- 10.9

3.5

2.0

2.5

2.9

5.4

5

-

3.4

2.2

1.2

2.9

4.1

Subspecies

2n

M

SM

ST

Dijwdomys ordii monoensis

72=

4

26

Dipodomysordiicompacrus

74

4

27

A

9.7

“Data of Stock (1974) and Hatch ei al. (1976). bTwo-armed:M, metacentric; SM,submetacentric;ST, subtelocentric. One-aned: A, acmentric. Also found in D . ordii ordii, D. ordii foetosus. D. ordii richardsoni, D. ordii senneni, and D. ordii oklahomae.

SATELLITE DNA AND HETEROCHROMATIN

37

TABLE XI1 KARYOTYPE A N D GENOME ANALYSIS IN Dipodomys heermanni' Karyotype

Genome DNA

n

Subspecies

2n

M

A

NA

52 52

46 56

4 4

64 64

32 32 32

30 30 30

94 94 94

Northern Dipodomys heermanni saxalalis Dipodomysheermanni californicus

Total satellite

2C

P

I

-

-

-

-

-

8.5

4.3

-

96

1.7

1.0

1.5

2.5

6.9

3.7

1.4 -

1.2 -

0.6

1.8

MS

HS

Southern Dipodomys heermanni rularensis Dipodomys heermanni jolensis Dipodomys heermanni swarthi

64

- - -

-

-

'Data of Fashing (1973) and Hatch er al. (1976). M, Metacentric (two-armed); A, acrocentric (one-armed).

length of the submetacentric elements of D . spectabilis spectabilis and the corresponding acrocentric elements of D . specrabilis baifeyi. Pencentric inversions are not expected to lead to an increase in satellite DNA content, and there is no obvious explanation for such an increase in this case. G-banding studies are needed to confirm whether or not pericentric inversions have indeed been involved. Several other notable exceptions to the presumed association between the presence of HS satellite and biarmed karyotypes can be found in other species too. Thus Dipodomys nirrafoides has 541104 but no HS satellite, only MS satellite. Additionally Dipodomys merriami (52/100), D . elaror (72/82), and D .

KARYOTYPE A N D ~

TABLE XI11 GENOMEANALYSIS IN Dipodomys spectabilis"

~~

KaryOtYpe

Genome DNA

n

Subspecies

2n

SM

A

2C

P

I

MS

HS

Total satellite

Dipodomys specrabilis spectabilis

72

-

35

9.8

7.8

1.0

0.8

0.2

1.0

Dipodomys spectabilis baileyi

72

12

23

9.6

3.8

3.3

2.0

0.5

2.5

OData of Stock (1974) and Hatch er al. (1976). SM, Submetacentric (two-armed); A, acmentric (one-armed).

38

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

deserti (64/108) all have much less HS satellite than would be expected for their respective arm numbers. On the basis of immunological grounds and isoenzyme content (Johnson and Selander, 1971) it has been suggested that these four species may have diverged from the ancestral stock several millions of years before the remainder. Hatch et al. (1976) therefore argue that their karyotypes may have evolved by independent mechanisms. There is, however, no hard evidence for such mechanisms from the available cytological data, and until such evidence is demonstrated there are no objective grounds for accepting such an argument. Further indications are that the changes that have occurred in the evolution of this group are much more complex than have been assumed by Hatch et al. in their discussion. In D . ordii, Bostock et al. (1972) have shown from the limited evidence there is on C-banding that (a) all chromosomes band at the centromere; (b) 3 pairs band only at the centromere; (c) 1 pair bands over its entire length; and (d) 31 pairs band in the entire short arm, though even here the centromere often stains more intensely than the short arm. By using radioactive RNA transcripts of the low-density peak (HS-/3) and a high-density peak, comprising a mixture of MS and HS-a satellites, it has been possible to show that the HS-/3 transcript binds to the centromeres of all but three chromosome pairs in a subdiploid cell line (2n = 66 to 71). Transcripts of the high-density satellite fraction, however, bind to the short arms of chromosomes which also contain HS-/3 at the centromeres and to the centromeres of the three pairs that lack HS-6. In D . merriami, however, the DNA has only two satellite components, HS-a and MS.Each of these comprises about 15% of the total nuclear DNA, and there is no HS-P. All chromosomes in this species have centric C bands, but additionally five discrete bands are also present in noncentric regions (Bostock and Christie, 1974). In Dipodomyspanamintinus yet a further C-band pattern is evident (Bostock and Christie, 1975). In addition to the conventional centric C bands, double or triple centric bands occur in the three submetacentric pairs. Moreover, some of these chromosomes also have small telomeric C bands. This range of C-band pattern within only three of the species of Dipodomys implies that the addition of heterochromatin has taken place in a variety of ways, not all of which can be expected to increase the number of autosomal arms. In addition to the difficulties we have mentioned there is the inherent difficulty of deciding the direction of evolution. According to Setzer (1949) the species can be ranked in the following order of increasing morphological specialization: D . ordii + D . microps + D . panamintinus -+ D . agilis + D . heermanni + D . ingens + D . spectabilis -+ D . merriami --* D . nitratoides + D . deserti. Converted into cytological terms this reads: 2n = 72, 74 + 60 + 64 + 60 + 64 + 64 + 72 + 52 + 54 --* 64 NA = 140,144+ 116+96+ 116+94+98+70,78,94+ 100- 104+ 108

SATELLITE DNA AND HETEROCHROMATIN

39

Clearly, here, as indeed elsewhere, there is no obvious relationship between the pattern of chromosome change and the extent of morphological change. In conclusion it is clear that, when comparisons are made at the most meaningful level, namely, within species, the relationships between satellite DNA content and karyotype change postulated by Hatch et al. (1976) are invalid. Furthermore, the data from Peromyscus and Drosophila, which we have already considered, offcr no support for their conclusions. There is also evidence from other rodents that this explanation does not hold. This evidence comes from the genus Rams, and we consider it in Section V. For the moment we need only note that in Rartus there has been a large amount of chromosome rearrangement in the absence of large quantities of heterochromatin. The molecular picture in Dipodomys, where satellites differ in amount but not in kind, appears at first sight to contrast with that in other rodents. Thus in three species of Apodemus the satellite DNAs show specific differences in density, quantity, and rates of reassociation. The same is true in Mus. Such differences had earlier led both E. M. Southern (1970) and Hennig and Walker (1970) to conclude that (1) the evolution of a satellite occurs over a time not much greater than the age of a species; and (2) satellites originate by de novo saltation of nonsatellite sequences either coincident with or after species initiation. In kangaroo rats, however, while the three major satellites (MS, HS-a, and HS-13) are not simply related to one another, the single-strand densities' for a given satellite are nearly identical among all nine species tested by Mazrimas and Hatch (1977). Thus at the level of densities in alkaline gradients there appears to be a conserved satellite system throughout the genus. Indeed, as far as HS-a satellite is concerned (Table I), very similar a satellites are found also in the pocket gopher (Thomomys bottae), the guinea pig (Cavia porcellus), and the antelope squirrel (Arnmospermophilus harrisi). Unless this similarity is fortuitous, it implies that some satellite sequences may persist over much longer periods of evolutionary time than was assumed by E. M. Southern. On this basis Salser et al. (1976) have proposed that particular simple sequences common to a variety of modem rodents may have existed in ancestral species. This concept of a basic library of satellite precursor sequences implies that conservation by natural selection is an essential feature of satellite evolution (see Addendum, note 4). In such terms rapid evolutionary changes involving satellite DNAs would for the most part be quantitative only, involving increases or decreases in the relative amount of particular library satellites. Thus the apparent disappearance of a satellite may involve no more than reduction to a level below the limits of detection by existing methods. Equally the appearance of an apparently new satellite might involve no more than the saltatoxy expansion of a sequence already present in precursor form within the basic library. It is difficult to comment objectively on the library hypothesis at this point, though we consider it in detail in Section V. For the moment we need only note two points:

40

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

1. Since all satellites in a given lineage should presumably be represented on all or most chromosomes, the minimum requirement is that each satellite be represented once per chromosome. This would be undetectable by any conventional form of technology short of the complete sequencing of each chromosome. Should complex satellites, such as the 1.688 satellite of Drosophila, prove to be conserved, this would constitute convincing evidence for a library hypothesis. 2. As presently defined, the perimeters of the library concept are delightfully vague. One can, for example, legitimately ask whether all library sequences are conserved in all members of a given lineage or whether sequencescan actually be lost from a library. It might be supposed intuitively that they can be lost either by direct deletion or else as a result of exchanges, such as Robertsonian fusions, involving loss of centromeres. The library concept was used by Salser et al. (1976) to argue for conservation of function. The alternative argument is that a library may be there by default and not for any obvious functional reason. For example, there are good grounds for arguing that heterochromatin can be lost as well as gained. Thus in the D . virilis D . ezoana conversion, which we referred to earlier in this section, the heterochromatin has been reduced in amount from 52 to 33% (Pimpinelli ef al., 1976). During such a reduction it may not always have been possible to reduce the number of satellite sequences present in heterochromatin below a particular minimum, because such sequences flank critical sites. These sequences are then retained by default and might be regarded as a special form of vestigial DNA. The three sets of species comparisons we have considered in this section provide no support for any of the hypotheses proposed for satellite DNA function at the cellular level. Nor do they provide any indication of evolutionary direction or offer any consistent basis for speciation. The perennial problem in discussing the significance of any difference found between related species is deciding whether the difference was instrumental in bringing about speciation or whether it itself is a consequence of the speciation process. We need therefore to turn to the most direct evidence currently at our disposal, evidence that considers the consequences of direct manipulation of heterochromatin and satellite DNA.

B. MANIPULATION OF HETEROCHROMATIN AND SATELLITE DNA One major legacy of prokaryotic research when applied to eukaryotic studies has been the general preoccupation of workers with cellular mechanics. This preoccupation has spawned a large number of hypotheses of a cellular nature. Thus it has been argued that satellite DNA is important in chromosome pairing, chromosome recognition, chromosome folding, centromere strength, and chromosome rearrangements. Rarely has a hypothesis been proposed which even considers an organismal or populational level of action.

SATELLITE DNA AND HETEROCHROMATIN

41

What hard data then bear on satellite DNA function? Only two options are in effect available to any investigator who wishes to study the consequences of alterations in the amount or the position of simple-sequence chromosomal DNA in an organism. The first is to use D . melanogaster, in which many heterochromatic rearrangements have been experimentally induced. The second is to let the organism itself make the rearrangements and then examine those which have survived and now occur in natural populations as polymorphisms within a species. We now examine three facets of such manipulations which have involved heterochromatin and simple-sequence DNA. 1. Centromeric Heterochromatin The most popular hypothesis of satellite DNA function at a cellular level has been that chromosome pairing is mediated by this type of DNA. This hypothesis has recently been reinforced by the finding that each chromosome of the haploid set of D . melanogaster has a specific arrangement of the different satellite DNA sequences in the centromeric heterochromatin. Thus each chromosome differs from any other by the “pattern” of satellite DNAs it carries procentrically. On the basis of this chromosomal specificity, it has been argued by Peacock et al. (1977a) that satellite DNA is involved in specific recognition processes in the cell, at “meiosis, mitosis or in interphase,” and that this chromosome specific pattern allows homologs to recognize each other, whereas satellites common to all chromosomes mediate more general recognition processes such as formation of a chromocenter. If this hypothesis were valid, deletion or rearrangement of the simple-sequence DNA in the heterochromatin ought to cause substantial difficulties in chromosome recognition processes. We can test the predictions of this hypothesis in D. melanogaster both for sex chromosomes and autosomes. a. Sex Chromosomes. When the heterochromatin of the X chromosome of D . melanogaster is systematically deleted, and tests are made for the fidelity of homolog recognition in the female, it is found that chromosomes with as much as 80% of their heterochromatin deleted still segregate perfectly normally from each other. However, the amount of recombination in such chromosomes is radically reduced from that of the control (Fig. 12; also see Yamamoto and Miklos, 1978), and there is a compensatory effect on the autosomes as well (Yamamoto, 1978). Females with huge deficiencies in X chromosome heterochromatin do not differ substantially in euchromatic genic content from control females who have normal X heterochromatin. Thus the reduction in recombination cannot be directly due to alterations in the genic content of the euchromatin. Furthermore, chromosomes with such massive deficiencies in X chromosome satellite DNA content take part in a normally appearing chromocenter in salivary gland nuclei. The larger deficiencies incorporate at least three of the major

42

BERNARD JOHN AND GEORGE L. GABOR MIKLOS MAP DISTANCE

I-

Y

I;

REGION

I

-

r I

I

I

/

I

I

/ / /

\

I

I

\ / /

I

/

, // , /

I I

t

f

.,, 0

0

1

II

I I

/

I I

L

REGION

v

I

I

/

7

EV

PERCENT HE1

I loo

-

I 78 I 68 I 52 28 18

FIG. 12. The effect of reductions in the amount of X heterochromatin on recombination in two regions (y-v and v-f) of the euchromatin of the X chromosome of D. melanogasrer. (After Yamamot0 and Miklos, 1978.)

satellites, namely, 1.686, 1.688, and 1.697 gm/cm3, as is evident from the satellite map of the X heterochromatin provided by Peacock et al. (1977a,b). In the male, an X chromosome with a deletion of some of its heterochromatin can experience severe pairing difficulties. Cooper (1964) clearly pointed out that only some of the X and Y heterochromatin was important for pairing in the male. Nevertheless some workers still argue that, since a deletion of basal X heterochromatin can cause pairing upsets in the male, and since satellite sequences predominate in this heterochromatin, it is the deletion of satellite sequences per se which is responsible for failure of pairing (Tartof, 1975; Peacock et al., 1977a; Brutlag et al., 1977b). In fact, Cooper stressed that “the conjunctive properties are viewed as an expression of mappable linear differentiations within the heterochromatic region, not as aspects of ‘heterochromatin’.” He demonstrated that the right arm of the X, the proximal one-fourth of the X heterochromatin, the distal one-third of the short arm of the Y, the distal half of the long arm of the Y, and probably the nucleolus organizer itself, did not have pairing properties. If we now superimpose on these results the details of the known satellite map, it is clear that the four major satellites (1.672, 1.686, 1.688, and 1.705 gm/cm3), or their isomers, are represented in these nonpairing regions. Since these same satellites are also present in the regions that do have pairing properties in the male, it is clear that it is not the satellite sequences per se which provide the basis for XY pairing. Rather it is deletion of specific pairing sites in the heterochromatin which leads to unsuccessful pairing. A detailed examination of such cases is found in Yamamoto and Miklos (1977, 1978) and Yamamoto (1978). If a Drosophila is constructed with two extra identical small sex chromosomes which consist almost exclusively of satellite DNA but do not have pairing sites (Fig. 13), then, on the argument that satellite DNA facilitates pairing, one might

SATELLITE DNA AND HETEROCHROMATIN

43

expect that such homologs ought to pair normally and segregate. In fact, two such identical chromosomes segregate at random from each other. b. Aurosomes. When autosomes partially deficient in their centromeric heterochromatin (Fig. 14a) are tested cytologically, it is found that they still pair normally and segregation is not upset. This applies to the hetemchromatin of both the left and right arms of chromosome 11. When most of the heterochromatin of I1 and III is interchanged by a reciprocal double insertion (Fig. 1% and the left and right arms of I1 are present as free acrocentrics, it is possible to show that pairing and segregation of all three sets of autosomes (IIL, IIR, and 111) are normal. Note that in this case, while the euchromatic portions of both homologs of 111 are unchanged, they carry radically dissimilar heterochromatic blocks. When a D. simufans fourth chromosome is introduced into an otherwise D. melanogaster genome, the D . simulans IV and D . melanogaster IV pair and segregate regularly (Yamamoto, 1978). However, these two chromosomes, while carrying the same satellite DNAs, have them in radically different amounts (Lohe, 1977). This difference, however, is no impediment to their pairing behavior. By means of a translocation it is possible to construct a chromosome IV which is deficient in the bulk of its euchromatin but whose hetemchromatin is intact (Fig. 14b). In males such a chromosome consistently fails to pair with a normal IV. Furthermore, in a triplo-IV stock having two normal IV’s and a euchromatically deleted IV, the latter chromosome is regularly a univalent at male meiosis despite the fact that its heterochromatin is unaltered. Clearly, satellite DNA cannot be involved in any manner in the pairing of chromosome IV.

I

CONTROL

EXPERIMENTAL

FIG. 13. The structure of an experimental stock of male D. melanogaster carrying two small X chromosomefragments (Xr) in comparison with that of a normal full sib control. The heterochromatic regions of chromosomes 11, 111, IV, and the Y are lightly shaded. The solid area is the basal X heterochromatin. (After Yamamoto, 1978.)

44

AcR

BERNARD JOHN AND GEORGE L. GABOR MIKMS

IL

I I R ACRO

CONTROL

E

I--

x

eu

‘

Ip T

EXPERIMENTAL TRISOMIC

EXPERIMENTAL DIPLOID

FIG. 14. (a) Experimental stock of male D. melanogaster carrying an almost complete deficiency of satellite sequences in the right arm (IIR), together with two free acrocentric derivatives of chromosome 11, termed IIL and IIR. (b) Control and experimental stocks utilizing a translocation which results in the removal of the bulk of chromosome IV euchromatin and which now cany some euchromatin from the X. The two IV’s do not pair in the experimental diploid, even though their satellite sequences are identical. Neither does the translocated IV pair with the two normal IV’s in the experimental trisomic, even though once again the satellite sequences of all three elements are identical. (After Yamamoto, 1978.)

Furthermore, when two extra identical small autosomes, consisting largely of satellite DNA originating from autosome 11, are added to a normal genome (Fig. 16), they exhibit no pairing whatsoever and segregate at random from each other. Thus their satellite content is clearly not sufficient to guarantee pairing and segregation, and obviously they cannot contain pairing sites within their heterochromatin. In summary, a systematic manipulative approach involving other deletions, translocations, and additions to the satellite sequence arrangements in the heterochromatin of chromosomes 11, 111, and IV in D. melanogaster reveals that it is euchromatic homology which is important in male chromosome pairing (Yamamoto, 1978). There is no evidence whatsoever that heterochromatin is involved in meiotic chromosome recognition processes.

45

SATELLITE DNA AND HETEROCHROMATIN

It is surprising that a satellite DNA-chromosome pairing hypothesis should have received so much attention in the face of the classic literature on heterochromatin which clearly demonstrates that in Drosophila heterochromatic deficiencies still yield normal segregation in the female (Sturtevant and Beadle, 1936). Moreover, as Cooper (1964) showed, only some of the sex chromosomal heterochromatin is important in the male, yet an overwhelming proportion of it is now known to contain satellite DNA. Second, if centromeric heterochrornatin were important in aiding preferential association of homologs, one would need to show that this leads to zygotene pairing. In the grasshopper Stauroderus scalaris, in which there are substantial procentric heterochromatic blocks in the three large metacentrics, these regions are the last to pair (John, 1976). A large number of organisms have substantial telomeric or interstitial blocks of satellite DNA or heterochromatin. Clearly, large proportions of the simplesequence DNA of a genome can exist noncentromerically (Table VI) and for this reason cannot have a centromeric role. Furthermore, some chromosomes are totally devoid of constitutive heterochromatin as measured by the C-banding procedure and, since this method overestimates the amount of satellite DNA, one can conclude with confidence that some chromosomes are effectively devoid of substantial blocks of simple-sequence DNA. It should be stressed that these

[

EXPERIMENTAL

n l ACRO

RE-

ACRO

I -

INSERTED NORMAL

m m

FIG. 15. Experimental stocks of male D. melanognsrer carrying a control having two normal

III’s and acrocentric derivatives of chromosome I1 (a), and an inseltion of chromosome I1 satellite sequences into chromosome Ill. together with a normal I11 (b). (After Yamamoto, 1978.)

46

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

CONTROL

EXPERIMENTAL

FIG.16. The structure of an experimental stock of male D. rnelanogasfer canying - - '0 extra small chromosome 11 fragments (14) in comparison with that of a normal full sib control. The hetemhromatic regions of chromosome 11 are shown as solid. (After Yamamoto, 1978.)

chromosomes pair normally and carry out cellular functions with as much ease as their nonhomologs in the same cell whose satellite endowment is far greater. Indeed, some organisms, such as the yeast Saccharomyces cerevisiae (2n > 30) and the Norwegian rat, Rattus norvegicus (2n = a), have very little satellite or highly repetitive DNA but a large number of chromosomes and a perfectly normal meiosis (see also Addendum, note 2). 2 . Telomeric Heterochromatin

Many natural populations contain substantial amounts of telomeric and interstitital heterochromatin which exists in a polymorphic state. One can use such polymorphisms in a way similar to laboratory manipulation experiments. The grasshopper Atructomorpha sirnilis has prominent telomeric blocks of heterochromatin which vary in size. Most of them contain substantial amounts of satellite DNA. When males polymorphic for chromosome 7 are investigated cytologically, it is found that the position of recombination events is markedly altered in the presence of a telomeric block of satellite DNA. Crossover events occur away from this block (Fig. 17), and quite clearly one effect of a polymorphism of this type in a population is to modify the relative frequency of gene combinations (Miklos and Nankivell, 1976). Similar examples can be found in other species of grasshoppers which contain polymorphisms for telomerically located hetemchromatin. Here, although we do not as yet know the underlying DNA sequences in the heterochmmatin, we can fairly confidently conclude that, provided the species examined are sufficiently distantly related, the sequence arrangements within the heterochromatin will be

SATELLITE DNA AND HETEROCHROMATIN

47

radically different. Thus in grasshopper genera as diverse as Percassa, Trimerotropis, Atractomorpha, and Cryptobothrus the presence of a supernumerary heterochromatic segment leads to a marked internal redistribution of chiasmata within the bivalent carrying this segment, whether it is heterozygous or homozygous; invariably the chiasmata move away from the heterochromatic segment. In at least two of these cases, there is an additional interchromosomal chiasma effect (see Section 111,~).Similarly there is an interchromosomal effect in Drosophila when either a telomeric block of satellite DNA is present (Suzuki, 1973) or the amount of centromeric satellite DNA is altered (Yamamoto, 1978). Appels and Peacock (1978) have argued that the demonstrated effect which blocks of satellite DNA have on chiasma distribution cannot be a general phenomenon even for grasshoppers. In support of this they offer a single photograph of the grasshopper Caledia captiva, with no accompanying quantitative data, in which a single bivalent has a proximal chiasma near a centric heterochromatic block. Nine other bivalents with a single chiasma in the same nucleus, however,

60

“1

5 4

PERC E N T 30

60

CENT 30

I P FIG. 17. The effect of a polymorphism, for the presence of an extra distal heterochromatic block containing satellite DNA, on the chiasma distribution in bivalent 7 of the grasshopper Atractomorpha sirnilis. The bivalent has been divided into proximal (P),medial (M), and distal (D) segments, and the proportions of single chiasmata falling in each region are as shown. (After Miklos and Nankivell, 1976.)

48

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

conform to a distribution pattern in which the chiasma is sited away from the heterochromatic block. Clearly these investigators have failed to appreciate that a statistical effect does not exclude the occurrence of proximal chiasmata (Fig. 17). 3. Interstitial Heterochromatin In the dipteran Phryne cincta (2n = 8) there are small blocks of heterochromatin in both the X chromosome and the small fourth chromosome. Normally the X has a procentric al block, but in alpine populations, where the X has twice its normal mitotic length, Wolf (1968, 1973) found it to contain two additional distal (Y blocks, termed a2and a3.These blocks in Phryne constitute an example of supernumerary heterochromatin, since they are not present in all populations of this species. By using naturally occurring inversions as markers, Wolf showed that these blocks produced a striking increase in the frequency of crossing-over in the two metacentric autosomes ( 2 and 3) of the female (Fig. 18). Thus it has been possible to demonstrate an effect of heterochromatin on crossing-over in three different ways: 1. By the use of classic gene markers in an organism (Drosophila) where the genetic background has been rigidly controlled and the heterchromatic blocks in question are known to be simple-sequence DNA. 2 . By an analysis of chiasma pattern in a single population of A . similis where individuals differ with respect to the presence or absence of a single block of heterochromatin known to contain satellite DNA. 3. By the use of inversion markers visualized in polytene chromosomes of Phryne to score recombinant progeny. 4. Supernumerary Heterochromatin

A wide variety of systems polymorphic for supernumerary heterochromatic material either in the form of extra segments, as in Atractomorpha and Phryne,

-

- HET

tHET

CHROMOSOME 3

-

-HET

+HET

CHROMOSOME 2

FIG. 18. The effect of extra blocks of a-heterochromatin present on the X chromosome of Phyrne cincra on female recombination values in autosomes 2 and 3. (Data of Wolf, 1968.)

49

SATELLITE DNA AND HETEROCHROMATIN NORMAL 9

c 3

I

wx

Bz I

I

i

INSERTED 9

-

a

C

Bz

I

I

wx I + . INSERTION of 3L

FIG.19. Diagrammatic representation of the insertion of a segment of the long arm of chromosome 3 into the short arm of chromosome 9 in maize. (After Rhoades, 1968.)

or as distinct supernumerary or B chromosomes is now known in eukaryotes. The best characterized of these systems is that of maize (2n = 20) where both classes of supernumerary material are known to occur and where both have been found to influence the recombination of linked marker genes. a. B Chromosomes. Rhoades (1968, 1978) has summarized the effects of B chromosomeson recombination in the short arm of chromosome 9 following the transposition of a euchromatic segment from chromosome 3L. This gives an inserted chromosome 9 with the structure shown in Fig. 19. Although insertion of the segment from chromosome 3L places the C locus about twice as far from W x as normal, it does not lead to an increase in crossing-over between these two loci in insertion homozygotes. In the presence of a B chromosome, however, recombination between C and Wx is doubled, and with increasing B numbers there is a demonstrable dosage effect (Table XIVA) such that the recombination values in the C - W x interval are 17.7, 37.0, 40.4, and 42.0 with zero, one, two, and three B chromosomes, respectively. Here we see a trenchant example of latency in the eukaryote genome--one that seems to have gone unappreciated in spite of its enormous implications. The recombination characteristics of a section of euchromatin have been radically altered when supernumerary material has been experimentally added to a genome. Under these TABLE XIVA

EFFECTS OF B CHROMOSOMES O N RECOMBINATION IN SELECTED REGIONS OF CHROMOSOMES 5 A N D 9 OF Zea mays'

Recombination (%) Chromosome

Region

5

9 -~~ ~

OB

1B

28

38

4B

AS-Bt

38

41

Bt-Pr

21.5

-

52 31.5

-

61 -

c-wx

17.7

31

40

42

-

~

Data of Rhoades (1968); Nel (1973).

50

BERNARD JOHN AND GEORGE L. GABOR MIKLOS TABLE XIVB

EFFECTS OF B CHROMOSOMES O N MEANC E L L CHIASMA FREQUENCIES~ Number of B’s Mean cell chiasma frequency

OB

2B

3B

4B

6B

8B

1 OB

18.9

19.5

19.7

19.8

20.3

20.4

20.0

“Data of Ayonoadu and Rees (1968).

circumstances one region (C- W x ) increases its recombination, and this is in fact accompanied by a compensatory reduction in the adjacent segment. Nel (1973) has also provided information on the effects of B chromosomes on recombination, this time in chromosome 5 . He reports that B chromosomes increase crossing-over in both the A,-Br and Bt-Pr intervals but that the effect is most pronounced in A,-Bt. This segment spans the centromere and so includes the proximal centric heterochromatin. The effect is again dose-dependent. Paralleling this effect on gene recombination, Ayonoadu and Rees (1968) showed a significant positive regression between mean cell chiasma frequency and B-chromosome frequency in maize and demonstrated that the effect was a general one involving all members of the genome (Table XIVB). Ward (1973) went even further and, using a series of translocations between the B and the autosomes, tested the effectiveness of different segments of the B on recombination between C and Wx in insertion homozygotes. In maize the B is largely heterochromatic (Fig. 20) and is about two-thirds the length of the shortest autosome (number 10). By using three of the A-B translocations which have been induced experimentally in maize it is possible to divide the B into four segments and then test the influence of these segments on crossing-over between C and Wx. Ward’s results show that different regions of the B contribute differentially to the increased recombination in the C-Wx interval. Thus Segment number 1 2 3 4 Contribution (I) 55 21 24 0

This indicates that (1) the activity of the B is not localized to any particular segment of the B, (2) the only purely euchromatic segment (segment 4) has no effect, and (3) the greatest effect is in fact produced by the region with the smallest amount of heterochromatin. While this experiment indicates that all three heterochromatin-containing segments can have an effect on recombination, it does not rule out the possibility

51

SATELLITE DNA AND HETEROCHROMATIN CENTROMERE

SEGMENT PROX. HET.

I

TB-40

1

TB--6a

2

PROXIMAL EUCHROMATIN

I

INTERSTITIAL HETEROCHROMATIN

TB-80

3

I

DISTAL I DISTAL HETEROCHROMATIN EUC.

FIG.20. Structure of the B chromosome of Zeu muys used by Ward (1973). showing major characteristics and the location of the three translocation breakpoints used to fractionate the B heterochromatin.

that the proximal euchromatic portion of segment 1 may contribute to the effect produced by this segment. We do not as yet know the molecular composition of the B heterochromatin, and the situation is complicated by the existence of different morphological types of B chromosomes in maize. However, it is known that the gross molecular characteristics of the B used by Chilton and McCarthy (1973) did not deviate sufficiently from those of the A genome to be detected by conventional methods such as filter hybridization, reassociation kinetics, and melting profiles. b. Knobs. In maize, supernumerary heterochromatic segments occur on several chromosomes, and these are termed knobs. Chromosome 10 has been particularly well studied, and it is known from Rhoades’ work that knobbed 10 (K10) increases crossing-over in both a normal and a structurally rearranged chromosome 3. K10 differs from normal 10 (N10) by the presence of a supernumerary segment at the end of the long arm. The proximal portion of this extra segment is euchromatic, as is a smaller distal segment, and a large conspicuous knob of heterochromatin lies between the two (Fig. 21). The effect of K10 on crossing-over can be summarized as follows: 1. It increases recombination in the proximal G1-Lg interval of chromosome 3 but not in the distal Lg-A region. 2. There is a fourfold increase in recombination between GI and Lg in inversion heterozygotes of chromosome 3. CENTROMERE

N.10

1 K.10 FIG.21. Diagrammatic representation of both normal chromosome 10 (NIO) and knobbed chromosome (K10)in maize.

52

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

3. In chromosome 5 there is a large increase in both sexes for the A,-Bt and the Bt-Pr intervals. 4. In chromosome 9 there is a small effect (a 14% increase) on the Sh-Wx region.

Thus, whereas K10 increases crossing-over in the centromere regions of chromosomes 3 and 5 , it produces much less of a response in chromosome 9. c. B Chromosomes and Knobs. Not only can B’s and knobs produce individual effects on recombination, but they can interact in a novel fashion when present together in a genome. Thus Chang and Kikudome (1974) showed that crossing-over was increased in the proximal Bz-Wx region of chromosome 9, and decreased in the distal Yg-Sh interval, when 6dd numbers of B chromosomes were present and chromosome 9 was simultaneously homozygous for a small terminal knob ( K 8 K 8 ) .However, when 9 is heterozygous for terminal knobs of different sizes (K*Ks),odd numbers of B’s enhance recombination in both regions. Clearly, the action of the B’s is influenced by the kind of heterochromatin present in or near the chromosome region involved. In sum, the maize data indicate that (1) the effect of B’s is not the same for all chromosomes or chromsome regions, and (2) B’s show a dosage effect, whereas knobs do not. Here then is clear evidence for different functional forms of heterochromatin. However, we do not know if the effects of the three forms of heterochromatin present in maize (procentric, knobs, and B’s) are due to differences in their location within the genome or to differences in their composition. d. The Molecular Nature of B’s and Segments. As far as the chemical character of supernumerary heterochromatin in general is concerned we still know very little. While it is clear that the heterochromatic supernumerary chromosomes of rye (Rimpau and Flavell, 1975), maize (Chilton and McCarthy, 1973), and wheat (Dover, 1975) all have DNA of a composition similar to that of the normal genome, it follows from this that all three supernumeraries necessarily contain a large repetitive component, since the greater part of the genome in these cereals is itself repetitive in character (see,for example, Table V). However, it is apparent from buoyant density profiles, in the absence or presence of actinomycin, that there are in fact differences in the character of the main band between +B and -B plants of Aegilops speltoides. There are also differences between plants containing different numbers of B’s (see Fig. 7 in Dover and Riley, 1977). Provided these differences are not attributable to changes in molecular weight between the samples shown, they do not exclude the possibility that minor differences exist in the DNA characteristics of these B chromosomes. Indications that there are indeed differences between B and A chromosomes are found in the mealy bug Pseudococcus obscurus. Here, with conventional tests, namely buoyant density and melting profiles, there are no significant

SATELLITE DNA AND HETEROCHROMATIN

53

differences between + B and -B DNA extracted from whole adult females with and without supernumerary chromosomes. However, when radioactive cRNA transcribed from + B and -B DNA was hybridized to chromosome preparations with and without B's, Klein and Eckhardt (1976) showed that (1) -B cRNA hybridized with + B cells gave the most grains on the A chromosomes, (2) + B cRNA had on average twice as many grains over the B chromosomes in + B cells as were present over the A's, and (3) the distribution of silver grains over the A's appeared to be the same using either + B cRNA or -B cRNA. Thus, while no significant differences were found between the buoyant density profiles of + B and -B DNA, there was a considerable difference in the relative amounts of labeling on the A and B chromosomes after in siru hybridization. Indeed, from this evidence, and with but one qualification, it appears that A and B chromosomes share very little DNA in common in respect to the repetitive sequences detected under the conditions of this experiment. The qualification relates to the complexity of the template from which the cRNA is obtained and the conditions of hybridization. The critical importance of both these parameters was apparent in the case of human DNA (Section 11). Supernumerary segments are more difficult to specify because in general they are too small and too few in number to allow easy biochemical characterization of their DNA. Nevertheless, in situ hybridization of cRNA produced from a cryptic satellite DNA shows that in Atractomorpha one such segment has a satellite component (Miklos and Nankivell, 1976). e. Conclusions from Manipulative Systems. Let us summarize then what we have learned from the cases in which simple-sequence DNA or heterochromatin of unknown molecular composition has been experimentally or naturally altered in amount or position within the genome.

Drosophila: 1. Chromosome pairing and segregation in meiosis are normal when massive deficiencies in satellite DNAs are present. 2. Chromosomes deficient in most of their satellite DNA are perfectly capable of participating in a polytene chmmocenter. 3. Recombination is altered when centric or telomeric satellite DNAs are manipulated (compare with the effect of interstitial heterochmmatin in Phryne). 4. The recombinational changes are both intra- and interchromosomal. Maize: 1. B chromosomes have marked interchromosomal influences on recombination (see also Section III,C), whereas knobs act intrachromosomally. 2. The DNA of the maize B is not uniform in terms of its effects on the recombination system. 3. B's and knobs can interact to modify their individual effects.

54

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

Atractomorpha: Terminal supernumerary satellite DNA alters the recombination properties of a chromosome in a manner reminiscent of Drosophila. Its effects are both intraand interchromosomal.

What has emerged from systems in which manipulation is possible is that the recombination system is strongly perturbed by alterations in the simple-sequence DNA content (Drosophila) and by other sorts of DNA (B chromosomes of maize). We need to know the arrangement of sequences within a heterochromatic block, including its constituent genic or nonsatellite content, so that we can partition the effects of such a block and evaluate the relative importance of simple-sequence versus other types of DNA to the recombination system. C. HETEROCHROMATIN POLYMORPHISMS 1. Patterns of Polymorphism

It has long been evident that the amount of heterochromatin is not necessarily constant from individual to individual within a species. Nevertheless, this fact has not been generally appreciated and has been consistently omitted from hypotheses dealing with heterochromatin and satellite DNA function. Most comparisons of heterochromatin and satellite content have dealt with differences between species of the kind referred to in Section II1,A and, perhaps for this reason, have sought explanations of satellite function in terms of differences in the structure or behavior of species. It is important to give detailed attention to the extensive heterochromatic variation now recognized in many natural populations, since the widespread occurrence of heterochromatin polymorphisms and the obvious natural dispensability of this heterochromatin has far-reaching implications for hypotheses of satellite DNA function. This variation extends all the way from large, C-banded blocks to the level of individual polytene bands. a. Humans. Polymorphisms for heterochromatic supernumerary segments have been found in most organisms that have been adequately studied. Although these polymorphisms have been recognized in grasshoppers for many years (see White, 1954). only recently has attention been given to them in mammals and especially in rodents and primates. Their occurrence in mammals is particularly significant when one recalls that the mammalian genome appears to be conservative with respect to its DNA content, with C values, rarely falling outside the limited haploid range of 2-3 pg of DNA. Lubs and Ruddle (1971) were among the first to draw attention to the considerable range of variants which occur in heterochromatic regions of human chromosomes. This was paralleled by an even more remarkable range of C-band variation. Thus Craig-Holmes et al. (1973) found 31 C-band variants among 20

55

SATELLITE DNA AND HETEROCHROMATIN

unrelated individuals while, more recently, Muller et al. (1975) reported that each of 376 newborns had a unique C-band pattern. Such variants are known to be somatically stable within the individual (Hoehn et al., 1977), and it has been confirmed that they do not result simply from differential chromosome coiling but from a genuine variation in DNA content (Geraedts et al., 1975). b. Rodents. Variations in the amount of C-band material on particular chromosomes have been observed both in wild mice and among inbred strains, in which some chromosomes have virtually no C-band material. Each inbred line appears to be homozygous for the amount of C-band material on specific chromosomes, with little or no variation between homologs (Dev et al., 1975). A particularly striking difference is found in the distribution of centric heterochromatin and the amount of mouse satellite DNA in the subspecies Mus musculus musculus and M . musculus molossinus. In M . musculus musculus, whose extremely repetitive sequences make up 8-10% of the total genome, the satellite DNA is concentrated near the centromeres of all chromosomes except the Y. These regions are heterochromatic and C-band-positive. M. musculus molossinus has about 40% less mouse satellite than M . musculus musculus (Rice and Straw, 1973), but the alteration in satellite content is not uniform throughout the karyotype. Whereas in M. musculus musculus every chromosome has about the same amount of C-band material, in M . musculus molossinus a few chromosomes have doubled amounts and many have almost none. The precise amount varies in different sublines which have been inbred for five to seven generations (Table XV). Note that, despite the striking difference in satellite DNA content TABLE XV VARIATION IN THE SIZE OF THE c BANDIN 15 OF THE 20 CHROMOSOMES OF M U S mUSCUh motossinus ( 2 n = 40) AS COMPARED T o THATOF THE C57BL16J STRAIN OF Mus musculus musculus WHEREALLTHE CHROMOSOMES REFERRED TO IN THE TABLEHAVEC-BANDS, CONTROL" EACHHAS BEENUSEDAS AN APPROPRIATE

Chromosome numberb Subline analyzed MMH individual 1 MMH individual 2 MLV MLH Individual from Dr. A. Gropp

1

+ (+)

2

*

+

3

4

5

+ + +

+ - + - -

7

9

* -

12

-

13

14

15

17

16

-

-

-

_

_ _ _ _ -

-

-

_

-

-

+

'Data of Dev et al. (1975). * +, Vety large C band; -, very small or absent C band; ( band.

-

), one

-

-

-

(-f -

19

X -

(-)

-

-

homolog only; *, two sizes of C

56

BERNARD JOHN AND GEORGE L. GABOR MIKU)S

between these two subspecies, both retain a chromosome complement of 40 telocentric elements. Rats give a similar picture to mice. Within the black rat ( R u m r u m s ) there is considerable C-band variation. Some of this variation occurs between subspecies, but the Japanese black rat (Rums ruttus runezurni) shows a pronounced pattern of polymorphism (Table XVI; also see Yosida and Sagai, 1975). Increases and decreases in C-band material thus appear to be common in rodents, a group which is currently engaged in a spectacular form of evolutionary expansion. c. Plants. A similar situation undoubtedly applies to some plants. In primitive races of maize from Mexico and Central and South America the haploid set can have heterochromatic knobs in up to 20 different places on the 10 chromosomes. Not only do different populations vary with respect to the number of such knobs and the frequency with which they occur, but there is also variation in the size of the knobs themselves. Additionally there is a relationship between the number of knobs and the elevation. In Guatemala, for example, corn from areas below 6000 TABLE XVI 13 ACROCENTRIC AUTOSOMES OF THE JAPANESE BLACKRATRams rarrus ranezumi (2n = 42) AS SEENI N A SINGLE BREEDING COLONYA N D Two WILDPOPULATIONS FROM TOKYO AND MISHIMA".~ C-BANDVARIATION IN

THE

Total individuals Breeding colony Chromosome number

+/+

+I-

-1-

I

5

2 3 4 5

0 27

6

0 4

15 0 0 2 0 0 8

0

0

12 14 14 2 14

9

14

10

0

0 0

0 14

11

3 14 11

9 0

2 0

3

0

7 8

12 13

0 0

7 27 0

"Date of Yosida and Sagai (1975). * +/+,homozygous plus C band; + I - , morphic; M, monomorphic. Unusual small C band.

Wild populations C-band pattern

+/+

+/-

C-band pattern

-1-

P

3

3

1

P

M (-I-) M (+I+)

0 1 0 0

0 1 0 0 0 0

7

M(-/-) P M(-/-) M(-I-) M(-I-) M(-/-)

0

7

1

1 I

P M (-I-)

M (-1-1 P M (-/-) M (+I+) M (-I-)

P M (+I+) P

0 0

0 5'

0

0

0

0

7

0

5 7 7 7 7

7 0

M(-/-) P M(-/-) M(-/-) M(+/+)

Not determined

heterozygous; -/ - ,homozgyous minus C band; P, poly-

SATELLITE DNA AND HETEROCHROMATIN

57

FIG.22. A diagrammatic representation of the C-band variation found in each of the six chromosomes of a single population of SciNa sibirica. (Data of Vosa, 1973.)

ft has high knob numbers, whereas highland races have low knob numbers (Longley and Kato, 1965). There is also a striking C-band variation in Scillu sibirica (Vosa, 1973) which has either large terminal or interstitial C bands. This case is of special interest because it is claimed that heterochromatic segments may either replace, or be present in addition to, euchromatic regions of the chromosome (Fig. 22). d. Dipteru. In organisms having polytene chromosomes it is possible to detect levels of polymorphism which would go undetected in conventional chromosomes. Pavan and Perondini (1967), for example, report that they identified heterozygosity for 10 bands in 136 larvae of Sciara ocellaris. Six of these occurred in chromosome A , one was found in chromosome B, and the remaining three were in chromosome C. Such heterozygous individuals are frequently found in laboratory cultures but are also present in natural populations. While

58

BERNARD JOHN A N D GEORGE L. GABOR MIKLOS

very little is known about the origin of such single-band polymorphisms, it is clear from Keyl’s work on Chironomus thummi (2n = 6 ) that they can lead to substantial differences in DNA content between individuals of a species. Chironomus thummi thummi has 27% more DNA than C. thummi piger, the two subspecies differing in the thickness of 20 individual polytene bands on the three large chromosomes (Keyl, 1965). Some forms of fixed heterozygosity involving differences in single-band width are known to be correlated with sex differentiation. For example, in Chironomus nuditarsis a heterozygous male-restricted terminal block of heterochromatin occurs at the noncentric end of one of the chromosomes which also canies a male realization factor at the same end. Other instances in which heterobands are involved in the differentiation of genetic X and Y chromosomes are known in blackflies (Procunier, 1975). In Polypedifum nubifer the female, which in this case is the heterogametic sex, carries a comparable heterozygous block of heterochromatin (Martin, 1966). The relevant question of course is not simply how much heterochromatic variation exists between individuals but rather whether this variation affects fitness. That there must be a fitness component for at least some of these polymorphic systems is demonstrated by the clinal relationship seen in the knobs of maize and the satellite-containingheterochromatic short arms of Peromyscus (Section 111,A). Were these heterochromatic structures functionless, there would be no reasonable expectation for the clinal variation they display. Likewise, the association of polytene heterobands with sex differences in dipterans carries the clear implication that this difference plays some functional role in sex determination.

2. Supernumerary Heterochromatin and Recombination A wide variety of systems carrying supernumerary heterochromatic material, either as extra segments or extra chromosomes, have now been shown to modify the frequency andor the distribution of chiasmata. The precise effect varies from species to species, but the net effect is the same in all of them (Table XVII). The supernumerary heterochromatin is capable of generating an array of genotypes among the gametes different than that produced in individuals of the same population which lack such supernumerary systems. Thus populations which are polymorphic with respect to heterochromatin content may show either an extended range, or a different range, of genetic variation. This variation results from the influence the supernumerary heterochromatin exerts on crossing-over and is particularly well illustrated in three species of grasshoppers. a. The Effect of B Chromosomes. British populations of the mottled grasshopper, Myrmeleotettix maculatus (2n = 178 and 189), are polymorphic for the presence of B chromosomes. In populations of this species from the southern half of Britain there can be up to three of these heterochromatic elements present in addition to the normal members of the chromosomecomplement

TABLE X W

CORRELATED V A J U A ~ OIN N HETEROCHROMAIIN AND RECOMBINATION^ Species Animals Phrym cincta

Type of hetemhrornatin

Two subterminal supernumerary segments (a2

Effect on recombination

Dose response

Reference

Increase cmssing+ver in autosomes 2 and 3

None

Wolf, 1%8; Wolf and Wolf, 1969

B chromosomes

lncrease both mean cell chiasma frequency and variance between cells

None

John and Ifewitt, 1%5a,b

Distal supernumerary segmentson the two smallest autosomes

Increase mean cell chiasma freqwncy

None in British populations Present in French populations

John and Hewitt, 1%. Hewitt and John, 1%8 Westerman, 1%9, 1970

Distal supernumerary segmentson the largest autosome

Increase mean cell chiasma frequency

Not tested

John, 1973

Supernumerary segment on the smallest autosome; procentric in Austria; interstitial in Spain Distal and double interstitial supernumerary segments on the two smallest autosomes

Both types increase mean cell chiasma frequency

Not tested

Shaw, 1971a

Both types increase mean cell chiasma frequency. but the interstitial category appears to exert a greater influence

Additive

Shaw, 1971b

and as)lrxated on the distal end of the X chromosome Myrmeleotenix maCUlarur

Chorthippus

prolk?Ius

chonhippus jucundus

Stethop hyrna

grossurn

Srerhophyma gracile and S. lineaturn

TABLE X W (conn'nued)

Type of hetemhromatin

Effect on recombination

Tolgudia infirmu

Distal supernumerary segment on the smallest autosome

increase mean cell chiasma frequency

Metrioptara brachypiera

Distal block of hetemhromath on the L autosome

Partial deletion of the hetemhromatin block leads to an increase in mean cell chiasma frequency

D. 1. Southern, 1970

Cibolncris purviceps

Distal blocks of heterochromath on the L, and & autnsomes

Translocation of the distal ktemchromatin blocks leads to an increase in mean cell chiasma frequency

Hewitt, 1967

Drosophilu mtlunogaster

X chromosome

Inversions involving a redeployment of X hewm chromatin produce an increased cmssover response intemhrornosomally

None

Suzuki, 1963, 1973

Oedoleonorus phryneicus

Centric block of supernumerary hetenxhromatin on the smallest autosome

Increase mean cell chiasma

Not testid

Schroeter and Hewitt, 1974

Aiructomorpha similis

Distal supernumerary block

Redistribute chiasmata away from block

Not tested

Miklos and NankiveU, 1976

Species

heemchromatin

of satellite DNA on autosome 7

Dose response

Not tested

frequency

Reference

John and Freeman, 1976

Pkaulacridium marginale

Plants Secale cereale

Supernumerary chromos o m a and supernumerary segments on the two smallest autosomes

B chromosomes Introduced by hybridization

Wild populations Zen mays

B chromosomes

Supernumerary segment on chromosome 10 (K10)

Both increase m e w cell chiasma frequency

None

Westerman and Dempsey. 1977

No effect on mean cell chiasma frequency but increase variance between cells

Variance effect additive though differential; plants most affected carry odd numbers of B 's Not tested

Jones and Rees, 1967, 1969

Increase crossingaver in chromosomes3,5, w d 9 ; increase mean cell chiasma frequency and variance between cells Increase crossing-over in chromosome 3

Additive

Rhoades, 1978

Additive

Ayonoadu and Rees, 1968

None

Rhoades, 1978

Increase mean cell chiasma frequency

Wevii: and PaunoviC, 1969

Puschkinia libanotica

B chromosomes

Increase mean cell chiasma frequency but decrease variance between cells

Additive

Barlow and Vosa, 1970

Listera ovata

B chromosomes

Increase mean cell chiasma frequency in both embryo sac mother cell and pollen mother cell

Additive but differential as in Secale

Vosa and Barlow, 1972

(continued)

TABLE X W (coIl.trnwd) species

Type of heterochromatin

Effect on recombination

Dose response

Reference

~~

Loiiwn p e r e m

B chromosomes

Reduce overall chiasma frequency but increase variance between cells

Additive

Cameron and Rees, 1967

T&wn

B chromosomes

Reduce overall chiasma fre-

Differential; plants most affected carry odd numbers of B's

Zarchi et al., 1972

Not tested

Viinika. 1973

Additive

Brandham and Bhattarai. 1977

speltoides

quency but increase interstitial chiasmata

Najas marina

B chromosomes

Reduce mean cell chiasma

freqw=Y Giberis iim0n'S

'After John (1973).

One to five B chromosomes

Increase mean cell chiasma frequency

SATELLITE DNA AND HETEROCHROMATIN

63

(John and Hewitt, 1965a,b). The presence of these B chromosomes has a striking interchromosomal effect on the mean frequency and the variance of the chiasmata formed by the normal A chromosomes (Table XVIII; also see Hewitt and John, 1965, 1967). That the B chromosome itself is responsible for the significant increase in chiasma frequency is impressively confirmed in two mosaic individuals where OB and IB cells coexist in the same testis (Table XIX; also see Hewitt and John 1967). Since in each of these cases the OB and IB cells necessarily share identical genotypes with respect to the A chromosomes, one can rule out any effect of a genetic component other than that provided by the B itself. Indeed, a mosaic provides the most stringently controlled genetic situation that it is possible to devise. A comparable situation has recently been described by Brandham and Bhattarai (1977) in the plant Gibasis linearis in which there are five cell types with a varying number of B chromosomes in an individual plant. Here too a causative relationship exists between chiasma frequency and B-chromosome content (Table XIX). b. The Effect of Supernumerary Segments. In the meadow grasshopper, Chorthippus parallelus (2n = 178 and 18?), populations are regularly polymorphic for the presence of terminal heterochromatic supernumerary segments on the two smallest pairs of the chromosome set. These four chromosomes thus exist in a multiple polymorphic system consisting of nine distinct combinations which involve from zero to four supernumerary segments. Chiasma comparisons between all nine combinations within a single population indicate that this form of supernumerary heterochromatin also leads to a significant interchromosomal effect on the mean cell chiasma frequency (Table XX; also see John and Hewitt, 1966, 1969). Numerous other populations have been scored in which only partial analyses have been possible, but all show comparable effects (John and Hewitt, 1966, 1967). Three important points emerge from Table XX: 1. Both segments show comparable effects in increasing chiasma frequency despite the low probability that their DNA content and arrangement are identical. 2. There is no apparent dosage effect of either segment when present singly. 3. There is no apparent interaction between segments when in combination with one another.

In the bog bush cricket, Metrioptera brachyptera (2n = 318 and 329 ), three of the four largest pairs of autosomes (chromosomes 2 to 4) carry substantial blocks of heterochromatin which are not represented in any of the other members of the complement. These heterochromatic blocks, like those of Atractomorpha (Fig. 17), restrict chiasma formation in their vicinity in a striking fashion. This is especially true in bivalents 3 and 4, in which over 96% of the chiasmata that form are the products of single crossovers and are localized proximally (D. I. Southem, 1967). A similar, though not as pronounced, pattern of distribution is found

TABLE XVIn THEEFFECTOF B CHROMOSOMES ON M E A N CELL CHIASMA FREQUENCYIN 47 POPULATlONS OF THE MOTTLEDGRASSHOPPERMyrmeleotettix mac~lnnrs".~ ~

Mean cell chiasma frequency

Individual

Population HB CB GU GT CA

KT CD EC EG

sz

WE LG Hh4

ow BB NP CG GI HE SH HA AG

Percent B's per population

1

2

3

4

5

6

7

8

9

10

OB

+B

0 0 0 0 0 0 0 0 0 0 0 5 11.7 13.3 15 18.75 20

12.3 13.7 13.7 13.6 13.8 13.4 13.4 13.7 13.8 13.3 14.2 13.9 12.9 13.8 13.4 13.5 14.2

12.6 13.9 13.9 13.7 14.1 13.6 13.7 14.3 14.0 13.8 14.5

13.4 14.6 14.6 14.2 14.6 14.3 15.2 14.8 15.0 15.1 15.1 15.2 14.1 14.2 14.9 15.6 15.0 14.5 14.2 14.6 15.0 14.5

14.3 14.8 14.8 14.6 15.0 15.7 15.5 15.2 15.2 15.7 15.2 15.6 14.7

14.5 15.1 15.1 14.7 15.0 15.9 15.6 15.3 15.6 15.8 15.3 15.7 14.8 14.5 16.1 16.3 15.4 14.9

15.0 15.3 15.3 14.9 15.2 16.4 15.7 15.6 15.9 15.8 15.9 15.8 15.2 14.6

15.1 15.5 16.5 15.1 15.5 16.8 15.8 16.0 16.1 16.2 16.5 16.9

13.76 14.63 14.73 14.69 14.72 14.87 14.91 14.92 14.97 14.99 15.14 15.26 14.16 14.22 14.49 15.09 14.95 14.37 13.97 14.60 14.89 14.50

-

13.4

13.3 14.4 14.4 14.2 14.6 14.3 14.9 14.7 14.7 14.9 14.7 14.6 14.1 14.1 14.2 14.8 14.8 14.1 14.1 14.6 15.0

14.1 14.7 14.7 14.4 14.9 14.6 15.5 15.0 15.1 15.2 15.2 15.4 14.7 14.3 15.1 15.7

25 25 25 26 27.7

13.0 14.3 14.3 14.0 14.5 13.7 13.8 14.6 14.3 14.1 14.7 14.2 13.9 14.0 13.5 14.6 14.4 14.0 13.8 14.5 14.7 13.9

13.0 14.1 14.1 13.5

14.1 13.0 13.9 13.4 14.4 14.3 13.6 13.6 14.1 14.3 13.7

14.3

IS.0 14.6 14.2 14.7 15.3 14.6

14.3 15.3 15.8 15.1 14.9 14.9 14.9 15.6 14.6

15.9

16.3 17.6 16.4

14.6

&&

&& '

Is.j 16.1

&&

16.7 16.7 16.8 17.6 15.5 16.7 19.8 15.3

16.6

-

-

-

14.10 15.50 14.30 16.80 17.95 16.00 14.93 16.37 16.65 17.03 16.53

HH AC BH BT BU WH

SH

ox AH ST AS LN HE

ME

cs DP

WI ME GP KL BG GR

YF TB YN

28 30 35 35 35 35 35 36 37.5 38.5 40 40 42.9 44 45 45 47 47.7 50 56 60 60 60 70 70

14.7 12.8 13.8 14.1 13.5 13.7 12.9 13.7 14.4 13.5 13.5 13.2 13.9 13.7 13.8 13.5 12.7 13.8 14.3 13.6 13.6 15.3 14.6 12.4 14.7

-

-

14.9 13.3 14.3 14.3 14.0 14.1 13.3 13.9 14.7 13.8 13.7 13.6 14.4 14.7 15.2 13.6 14.1 13.9 14.4

14.9 13.6 14.7 15.0

14.7 14.5 14.0 13.9 14.7 14.2 14.6 14.1 14.6 14.9 15.3 14.5 14.1

15.3 14.8 15.1 15.0 15.1 14.6 14.3

/4.0 15.1 l

a

14.9 14.2 15.1 15.2

15.8

15.3

16.0 15.4

16.1 &

16.5 16.0

17.0 17.4

15.5

15.9 16.4 16.2 16.6

15.1 15.2 15.3 14.6

16.0 16.2 16.4 16.6 16.9 15.3 15.4 15.6 15.5 15.8 16.4 16.9 18.0

14.3 15.2 14.3 Is.! 14.8 15.2

/4.5

14.6

14.7 15.0

15.4 15.4

15.1

15.3 15.2 15.5 14.6 15.4 15.2

15.3

LLp 16.0

I

15.5

1_6.2

a

15.7

16.8

17.0

15.4 16.3 16.4 17.0 If.O 15.6 15.8 16.3 16.8 /7.7 17.9 15.8 =I 16.1 16.3 16.5 17.4 18.2 14.8 15.1 15.4 15.5 16.5 16.8 17.5 14.5 14.6 15.0 l a 15.9 /6.0 16.7 14.7 14.9 15.1 15.4 15.7 15.8 /6.3 19.6 14.5 14.9 14.9 15.1 15.2 15.3 /5.9 16.9 14.1 14.5 14.5 14.9 14.9 15.3 16.2 18.0 &Q 15.2 15.2 15.4 15.6 16.5 16.9 17.9 13.7 13.8 15.6 16.2 16.3 16.4 16.5 17.a 17.4 !7.8 18.2 14.7 14.8 14.8 14.8 15.2 15.8 16.0 !7.o 18.2 13.6 14.3 14.4 15.3 15.6 15.8 15.8 16.1_ 17.1 15.2 15.4 15.6 16.2 16.3 16.jl 16.6 /7.1

15.44 14.32 14.73 14.83 14.97 14.73 14.13 14.38 14.93 14.35 14.77 14.18 14.65 14.86 15.56 14.50 14.00 14.60 14.66 14.58 14.07 15.90 14.87 14.53 15.16

16.83 16.40 16.95 16.78 16.80 16.95 15.60 15.33 16.80 14.60 15.82 15.95

16.42 16.86 16.52 16.50 15.74 16.36 15.62 15.95 16.25 17.18 16.00 15.26 16.51

‘Data of John and Hewitt (1965b, 1967). bThe numbers refer to 10 diplotene cells in each of 10 male individuals per population. The number of Bcontaining individuals scored in each population sample ( I ~ Cis)based on the known B-chromosome content of that population.

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

66

TABLE XIX THEEFFECTOF B CHROMOSOMES ON MEANCELLCHIASMA FREQUENCY IN TWOMOSAICINDIVIDUALS OF THE MOTTLED GRASSHOPPER Myrrneleotettix macutaius" AND O N E MOSAICINDIVIDUAL OF THE PLANT Gibasis linearis" Individual

Individual

1

n

Cell type Myrmeleotettix maculatus OB IB

Cell type

L

14.7 16.0

14.7 16.9

Number of cells

Mean cell chiasma frequency

2

13.0 13.9 14.5 14.7 15.5

Gibasis linearis

1B 28 38 48

10 10 10 200

5B OData of Hewitt and John (1967). *Data of Brandham and Bhattarai (1977).

in bivalent 2 (Table XXI). An internal control is provided by the other chromosomes which lack heterochromatic segments. In these there are many more distal single chiasmata than in chromosomes 2 to 4. The size of the blocks is variable, and individuals may be heterozygous or homozygous for reduced blocks of heterochromatin in comparison to the standard size. The normal pattern of chiasma localization in the standard forms of TABLE XX THEEFFECTSOF HETEROCHROMATIC SUPERNUMERARY SEGMENTS I N THE Two SMALLEST ON MEANCELLCHIASMA FREQUENCY SCORESIN A SINGLEPOPULATION SAMPLE OF CHROMOSOMES THE MEADOW GRASSHOPPER Chorthippus paralleluf Chromosome 7

No segments

Segment 1 heterozygote

Segment 2 homozygote

No segments

15.16 (0 segments)

16.42 (1 segment)

16.41 (2segments)

Segment 1 heterozygote

16.47 (1 segment)

16.95 (2 segments)

16.40(3 segments)

Segment 2 homozygote

17.00*(2 segments)

16.70*(3 segments)

16.71 (4segments)

Chromosome 8

Data of John and Hewitt (1969). *Except for these combinations 10 individuals in each class were scored. The sample included 75 individuals.

67

SATELLITE DNA AND HETEROCHROMATIN

TABLE XXI RELATIVE POSITIONS OF CHIASMATA IN 100 CELLSOF THE EIGHT LARGEST CHROMOSOMES OF THE BOG BUSHCRICKET Merrioprera brachyprera AT DIPLOTENE OF MALEMEIOSIS" Chiasma location Singles Bivalent number I 2 3

4 5

Heterochromatin pattern

Large distal heterochromatin block Very large distal heterochromatin block Large distal heterochromatin block

-

6 7 8 ~~~~

Proximal

Doubles Distal

Proximaldistal

3

2

95

62

12

26

98 96 50

0 0

2

18

40

60

29 17

71 83

4 32 0 0 0

~

'Data of D.1. Southern (1967).

both chromosomes 3 and 4 is such that chiasmata are conspicuously absent from interstitial regions. The presence of reduced heterochromatic blocks on chromosome 4 has two very clear generalized inter- and intrachromosomal effects on the chiasma pattern. These were particularly well demonstrated in one of the populations studied by D. 1. Southern (1970). He found that (1) there was a general increase in chiasma frequency throughout the large and medium members of the complement; and (2) accompanying this increase there was a redistribution of chiasmata; far more interstitial chiasmata were formed not only in chromosome 4 itself but generally throughout the large and medium chromosomes. Three important features emerge from this case: 1. The presence of a distal block on chromosome 4 produces a chiasma distribution in which single crossovers mainly occur away from the block and in proximal positions, and no interstitial chiasmata are found. 2. When this same block is reduced in size, chiasmata occupy interstitial positions. 3. This redistribution occurs not only in chromosome 4 itself but, remarkably, in other members of the complement too.

In the grasshopper Bryodema fuberculata (2n = 236 and 249) what we saw applying to different morphs within a given population now applies to different chromosomes within the same nucleus (KIhSterskB ef al., 1974).In this organism there is a strict localization of chiasmata, which presumably is under genic

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

68

control. All autosome pairs have procentric blocks of heterochromatin which are C-band-positive. In 9 of the 11 pairs these blocks are small in size, and here the chiasmata are always proximally sited; that is, small heterochromatic blocks do not override the effect of the genotype. In two remaining autosomal pairs (chromosomes 5 and 11), where the heterochromatic blocks are very much larger, the chiasmata invariably occur at the opposite end so that they are distally sited (Fig. 23). These large blocks are then capable of overriding the effect of the genotype These examples reinforce the effects we have already seen in Drosophilu, Phryne, Atrucfomorphu, and Zeu and point to two very important conclusions: (1) they demonstrate that it is dangerous to assume that genetic material has no function because (a) it has no apparent major gene activity in the soma, (b) because it is heterochromatic, or (c) because it consists largely of satellite DNA. (2) They emphasize that the effects of some kinds of DNA may well operate through the germ line rather than the soma, that is, through the meiotic rather than the epigenetic system. It is to the character of the germ line therefore that we now turn.

-

D. SOMA-GERM LINEDIFFERENTIALS In most animals the germ cells are set aside from the somatic cells at a very early stage of development. Recently some of the more pertinent examples of this soma-gem line differentiation have been reexamined in molecular terms. The CHROMOSOME

I

NUMBER

1,2,3,4,7,8,10

6,9

5

II

FIG.23. The relationship between the size of the heterochrornatic block and the location of single chiasrna (indicated by arrows) in the grasshopper Bryodema ruberculata. (Data of KlhSterskh er al., 1974.)

SATELLITE DNA AND HETEROCHROMATIN

69

results show that under certain circumstances the organism has a capacity to remove satellite DNA specifically from the soma, or from certain somatic tissues, leaving the germ line intact. In this section we examine and evaluate three such cases in terms of their implications for satellite function.

1 . Ciliate Protozoa Ciliate protozoa contain nuclei of two kinds, micronuclei and macronuclei. The micronucleus is diploid, divides either by mitosis or meiosis, and synthesizes only trace amounts of RNA. The macronucleus has many times the diploid level of DNA, divides by amitosis, and provides virtually all the RNA required to control the vegetative life of this unicell. Indeed, amicronucleate strains can be produced experimentally. While these are perfectly viable, they are incapable of meiosis because they lack a micronucleus and are therefore sterile. At conjugation, the macronuclei degenerate and are then replaced in the offspring by new macronuclear precursors. They arise as mitotic products of the diploid synkaryon formed by the fusion of haploid nuclei. These are produced by meiotic division of the micronucleus. Thus the distinction between micro- and macronuclei in this unicellular eukaryote parallels that between the germ line and soma in multicellular eukaryotes. In holotrichous ciliates, such as Paramecium, the macronucleus is a highly multiplied, endopolyploid version of the micronucleus. In hypotrichous ciliates the development of the macronucleus follows an entirely different and much more complex course involving two cycles of polyploidization, in the first of which polytene chromosomes are formed. In Stylonychia there are between 250 and 300 chromosomes in the early diploid macronuclear precursor. Between 5 and 100 of these despiralize and develop into polytene structures, whereas the remainder degenerate. The polytene chromosomes that develop are distinctive in two respects. First, homologous chromosomes are unpaired and, second, they are characterized by very large heterochromatic blocks which show evidence of differential replication (Ammermann er al., 1974). Following their formation these polytene chromosomes break down, and the resulting fragments become enclosed by vesicles within which most of the DNA is destroyed. The remaining DNA undergoes extensive replication accompanied by drastic changes in its composition. A comparable series of changes occurs in Oxyrricha, except that here there are four micronuclei and two macronuclei per unicell (Prescott et al., 1973).

The combined effect of these two nuclear cycles is to produce a marked reduction in the sequence complexity of the macronuclear DNA. The DNA of the micronucleus shows several buoyant density components when centrifuged to equilibrium in cesium chloride, whereas the macronuclear DNA bands as a single homogeneous peak (Fig. 24a). Thus, although both micro- and macronuclei cohabit in the same cell and are descendants of the same synkaryon, their

70

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

I

10-t

I

I 10

I

I

lo2

10'

I 10'

Cot

FIG.24. (a) Buoyant density profiles in the analytical ultracentrifugeof micro- and macronuclear DNAs of Oxyrrichia (after Prescott et al., 1973). (b) Reassociation kinetics of macro- and micronuclear DNAs of Oxyrrichia. The curves are computer fits to the data. (After Lauth et af.. 1976.)

genomes are strikingly different. Although the genome of these ciliates contains only a small amount of highly repetitive DNA most, if not all, is lost from the macronucleus, together with a very substantial proportion of the middle repetitive and the unique sequences (Fig. 24b). Those who have studied this case see two implications: (1) The sequences eliminated from the macronucleus are presumably of no importance for gene activity in this nucleus; and (2) these sequences are, however, crucial for the organization and activity of the micronucleus. At first sight it may seem incredible that these organisms should retain all their DNA in the micronucleus and yet lose so much of it from the macronucleus while still maintaining vegetative functions. The very high chromosome number present in members of this group presumably reflects a polyploid ancestry. It may be that the high DNA content provided by such a polyploid state is required for nongenic reasons. This is a point we return to consider in Section VI.

SATELLlTE DNA AND HETEROCHROMATIN

71

2. Ascarid Nematodes Ascarid nematodes provide the classic example of chromatin diminution in multicellular eukaryotes. During the early cleavage divisions in the embryo there is a selective loss of distal hetemhmmatic segments in somatic cells but not in germ cells. By characterizing the genomes of Parascaris equorum and Ascaris suis in molecular terms, both before and after elimination, Moritz and Roth (1976) showed that: 1. The germ line of P. equorum contained two light satellites which together accounted for 85% of the germ line DNA, whereas A . suis had a light shoulder which made up approximately 23% of the germ line DNA. 2. These highly repetitive satellite components were eliminated from the soma by the diminution process (Table XXII and Fig. 25). There was, however, identical single-copy DNA complexity in both the soma and the germ line, at least in A . suis. 3. In A . suis there was only a very small amount of what could possibly be termed intermediately repetitive DNA. This is difficult to explain if, as argued by P. equorum

A. ruir

1.700

GERM LINE

1.697

(dl

1.700

SOMA

I

BUOYANT DENSITY [g/cm3)

FIG.25. Buoyant density profiles of DNA centrifuged to equilibrium in neutral cesium chloride. (a) Gem line DNA of Parascaris equorwn; (b) somatic DNA of P. equorwn; (c) g e m line DNA of Ascaris suis; and (d) somatic DNA of A . suis. (Data of Moritz and Roth, 1976.)

72

BERNARD JOHN AND GEORGE L. GABOR MIKLOS TABLE XXlI CHARACTERIZATION OF THE GENOME IN Two SPECIES OF ASCARID NEMATODES" Germ line DNA content

Soma

(Pi9

Satellite content (%)

DNA content

Species

(Pg)

Satellite content (%)

DNA eliminated from soma (%)

Parascaris equorum

1.2-2.1

85 (1.697,1.692)

0.25

0

85

Ascaris lumbricoides var. suis

0.32

23 (1.697)

0.25

0

23

~~

'Data of Moritz and Roth (1976).

Davidson role.

et

al. (1977), intermediately repeated DNA has a major regulatory

This example makes it clear that, in ascarids, if satellite DNA indeed has a function, this function is germ line-limited. 3, Drosophila a. Larval Tissues. In all species of Drosophila few mitoses occur after organ formation. Rather, with the exception of the brain and the imaginal disks, all other somatic cells grow by an endomitotic process involving either polytenization (salivary glands, midgut epithelium, malphighian tubules, foot pad cells, bristle initials) or else endopolyploidy (muscle cells, hind gut epithelium, fat body, testis follicle cells, ovarian wall cells). The only diploid tissues present in a larval dipteran are the germ line, imaginal disks, and brain ganglia. One of the general findings in Diptera is that, when a comparison is made between the DNA profiles of diploid tissues and polytene tissues, satellites are seen only in the former. In D . virilis, for example, about 40% of the DNA in larval diploid tissues (brain, imaginal disks) is highly repetitive and consists of three light satellites which constitute 41% of the total (Gall et a!., 1971). The DNA from larval salivary gland nuclei, which are polytene and reach a maximum ploidy of 1024 or 2048, however, have barely detectable amounts of satellite because the heterochromatic regions which contain this satellite DNA are not significantly replicated during the process of polytenization (Fig. 26a and b). Such differential replication in larval polytene tissues reaches its most extreme form in D . nasutoides. Here, as noted in Section III,A, the mitotic complement is distinguished by the presence of a pair of very large metacentric chromosomes which are almost entirely heterochromatic in character. In the salivary gland polytene system of D . nasutoides this large heterochromatic pair is reduced to a minute dot. Correlated with this difference there is no detectable satellite DNA in

SATELLITE DNA AND HETEROCHROMATM

73

the polytene nuclei, whereas diploid nuclei contain about 50-60% of the total DNA as four satellites (Fig. 26c and d; Cordeiro-Stone and Lee, 1976). b. Adult Tissues. Most of the larval tissues in D . virilis, as in other species of Drosophila, undergo histolysis during pupation and are then replaced in the adult by cells derived from imaginal disks. Thus, in contrast to the larval salivary gland nuclei, those of the adult are not polytene but endopolyploid. These too show a reduced satellite content, but the reduction is not as marked as that of the larval polytene nuclei (Endow and Gall, 1975). Four other adult tissuesmidgut, hindgut, malpighian tubules, and thoracic muscles-also contain lower amounts of satellite DNA when adult brain is used as a diploid standard (Table XXJ3I). Of these four adult tissues only malpighian tubules show polytene nuclei, and these are 128-ploid. Significantly this is the only adult tissue to effectively lack satellite DNA. The other three tissues consist of nuclei ranging from diploid to high degrees of endopolyploidy, and all contain significant amounts of satellite DNA though the relative proportions of the satellites they carry are quite different.

D. nasutoides

D. virilis (C)

1.682 1.665

A

1.702

BUOYANT DENSITY (g/cm31

FIG. 26. Buoyant density profiles of DNAs centrifuged to equilibrium in neutral cesium chloride. (a) Drosophifa virifis imaginal disks and brains; (b) D. virilis larval salivary glands; (c) D. nasuroides imaginal disks and brains; and (d) D.nasuroides larval salivary glands. (Data from Gall er 01.. 1971; Cordeiro-Stone and Lee, 1976.)

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

74

TABLE XXIII THE SATELLITE DNA CONTENTOF SIXADULTTISSUESFROM Drosophila virilis COMPARED WITH THATOF THE WHOLEADULP Fractional amounts

Total genome (%) Main peak

Satellites I+1I

Satellite 111

Main

Tissue Malpighian tubules Midgut Hindgut Brain Salivary gland Thoracic muscle

100 73.5 65.3 53.0 76.6 64.6

-

6.1 7.3 9.4 3.1 2.9

1 .OO 1.00 1.00 1.00 1.00 1.00

-

-

20.4 27.5 38.4 20.3 32.5

0.28 0.42 0.71 0.27 0.51

0.08 0.11 0.18 0.04 0.05

351 3.8:l 3.9:l 6.7:1 10.2:l

62.2

33.1

4.7

1.00

0.54

0.08

6.7:1

Whole adult

peak

Satellites 1

+ I1

Satellite 111

(1

+ II)/IlI

"Data of Endow and Gall (1975).

It follows from this example that some satellites are not required at all in larval salivary glands or adult malpighian tubules, both of which are polytene. Moreover, as Endow and Gall (1975) point out, the replication of a given satellite is independent of that of others in the same nucleus, so that the amount and kind of satellites vary between tissues. Whether tissue difference in satellite content has a functional significance has yet to be determined. The situation in Diptera contrasts markedly with that found in mammals, where there is no difference between the amounts of satellite present either in different somatic tissues or between the amounts in the germ line and soma (see, for example, Hatch and Mazrimas, 1974). One is tempted to relate this to the fact that the soma in mammals remains essentially diploid in almost all cases, whereas in Drosophila few diploid tissues are present other than the germ line. Similarly, in ascarids few, if any, of the larval and adult somatic tissues remain in the diminished embryonic state. They too become endopolyploid. There are two important conclusions to be drawn from our consideration of germ line-soma differentiation: (1) Satellite DNA is never removed from nor differentially represented in the germ line. (2) In some cases satellite DNA can be completely eliminated from the soma. Thus 85% of the genome of Parascaris is germ line-limited. In other cases it can be differentially replicated to a level where it makes a negligible contribution to the DNA content of a particular tissue (dipteran polytene cells) or is at least underrepresented in that tissue (dipteran endopolyploid cells). These facts suggest that at least some classes of satellite DNA have more to do with the germ line than with the soma.

SATELLITE DNA AND HETEROCHROMATIN

75

E. LIMITS OF TOLERANCE 1. Tissue Cuiture Systems There is evidence that both satellite DNA and highly repetitive DNA can be lost from somatic cells in culture without affecting the viability of these cultured cells. For example, the African green monkey (Cercopifhecus uethiops) has four satellite components, a, /3, y , and 6. The major component, a satellite, is localized within the procentric heterochromatin and is present in all cell lines and all tissues. The y satellite, and presumably the 6 satellite closely associated with it, is also localized in the procentric heterochromatin. While the p satellite is present in the procentric heterochromatin, it occurs widely scattered over the entire karyotype, though the distribution is not at random. The minor satellites vary markedly within and between DNA samples from different cell lines. The actual amount ranges from 11% to quantities that are not detectable under normal conditions of ultracentrifugation (Kurnit and Maio, 1974). Maio (1971) claims that the cryptic a satellite, which comprises 20-25% of the genome, occurs in all tissues and cell lines and is constant in amount. However, Fittler (1977) reports that in his BSC-1 cell line the a satellite comprises 13% of the unfractionated DNA. Thus there may well be variation in the a component too. A similar situation occurs in the common field vole, Microtus agrestis. Here the X chromosome is a giant structure which has large blocks of constitutive heterochromatin known to be built up of highly repetitive and middle repetitive DNA. These blocks make up the entire long arm of the X, together with the proximal one-quarter of the short arm.The autosomes, in contrast, contain only very small blocks of procentric heterochromatin. J. E. K. Cooper (1977a) showed that, in cell lines selected by single-cell cloning of a culture from female skin, there could be a spontaneous loss of some of this constitutive heterochromatin, In individual lines one can lose up to 93% of the total X heterochromatin, which amounts to approximately i7% of the total DNA. It is clear therefore that the loss of the greater bulk of constitutive heterochrornatin, and hence the repetitive sequences, from these somatic cell lines does not impair their capacity to propagate in vitro. Cooper (1977b) also demonstrated that radiation-induced rearrangements of the constitutive heterochromatin of the sex chromosomes of this species, including a wide spectrum of X-A translocations, persisted in bone marrow for at least 1 year after induction. Neither deletions nor rearrangements of the constitutive heterochromatin therefore impair the viability or the proliferative capacity of bone marrow cells in vivo. These in vitro and in vivo experiments lead naturally to consideration of the limits of tolerance in both loss and gain of chromosome material. It is to this we now turn.

76

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

2 . Drosophila Drosophila melanogaster is known to tolerate considerable deficiencies of the heterochromatin in the heterozygous condition. Up to 80% of the heterochromatin of one X chromosome can be deleted with very little effect on either viability or fertility of the female (Sturtevant and Beadle, 1936; Yamamoto and Miklos, 1978). From a viability point of view the only known critical region within the X heterochromatin is the nucleolus organizer. Provided its loss is compensated for either by the organizer of an added Y or by that of an additional X or Y fragment, homozygous deletions of the X heterochromatin are also viable in females. Pairing sites occur in the heterochromatin of both the X and the Y but are functional only in male meiosis where they are critical for pairing and disjunction (K. W. Cooper, 1964). However, even where pairing and disjunction are regular, a reduction in the number of pairing sites in the X leads to a reduced recovery of the Y, because of a disturbance in spermiogenesis associated with development of the sperm head (Peacock and Miklos, 1973). Thus, while these pairing sites presumably do not represent conventional loci in the transcriptive sense, alterations in the amount of heterochromatin which decrease the number of such sites inevitably affect male fertility. Apart from the pairing sites the Y also contains seven fertility factors which function as conventional transcriptive units despite the fact that they lie embedded in a chromosome which is totally heterochromatic and consists overwhelmingly of satellite DNA. The deletion of any one of these factors leads to complete male sterility (Brosseau, 1960). Some species of Drosophila, however, have males which are exclusively XO (Drosophilaannulirnana, D . longala, and D . orbospiracula). In two other species ( D . afinis and D . narragansett) both XY and XO males are viable and fertile (Voelker and Kojima, 1971). However, when XO males of D . afinis are placed in direct competition with XY males in population cages, the frequency of XO males rapidly declines to zero within 150 days irrespective of their initial frequency. Here then is an example of a chromosome which, though not essential to either viability or fertility, nevertheless provides a fitness component. Despite this, it is known that the Y in D . afinis varies greatly in size and shape both within and between localities. A second major point of interest in this species concerns the location of the fertility factors. Since the female karyotypes appear normal, Voelker and Kojima have argued that either the fertility factors have been translocated piecemeal to other chromosomes, or other genes on other chromosomes have evolved the ability to carry out the functions of the fertility factors. They consider the second alternative more likely, since the first would have required multiple insertions. Given that there are loci of several types in the X and Y heterochromatin, is there any evidence for the occurrence of equivalent loci in the autosomal heterochromatin? It has been known for some time that the heterochromatin of

SATELLITE DNA AND HETEROCHROMATIN

77

IIL contains the It locus (Bridges, 1942; Morgan et ul., 1936), which results in an eye color mutant. More recently Hilliker (1976) has identified 13 gene loci within the heterochromatin of 11, the lethal mutant alleles of which can affect larval and pupal phases. Hilliker also confirmed the location of It in IIL and demonstrated that the ( r l ) locus occurred in the heterochromatin of IIR. While it is clear from Hilliker’s work that the heterochromatin of Drosophilu is certainly not genetically inert, in that it does indeed contain major gene loci, it is also evident that its gene density is very much below that of the euchromatin. Finally it has also recently been shown that there are no pairing sites equivalent to those in the X and the Y in any of the autosomal blocks of heterochromatin (Yamamoto, 1978). Thus when we increase or decrease the amount of heterochromatin in Drosophilu, the results clearly depend on the source of the heterochrornatin and whether it is autosomal or sex chromosomal in origin. Any phenotypic effects resulting from gains or losses of heterochromatin will then depend on: (1) the transcriptive loci present within the heterochromatin, (2) any nontranscriptive loci which may be present (e.g., pairing site loci), and (3) the satellite sequences within the heterochromatin. Additional problems ensue when heterochromatin is added as an extra chromosome rather than to an existing member of the normal genome. As far as females are concerned it is possible to construct XXY as well as XXYY individuals. The XXY females are both viable and fertile, but XXYY females have greatly reduced viability and fertility. What then are these phenotypic effects due to? Since we do not know whether the nucleolus organizers in the Y chromosomes are active in the somatic tissues of the XXYY female, in the presence of the two organizers in the X chromosomes, we cannot objectively partition the viability disturbances. There are, however, three explanations possible for these viability effects: 1. The nucleolus organizers of the Y chromosomes are somatically active, and this activity in turn leads to cellular disturbances as a result of the overproduction of rRNA. 2. The presence of the two transcriptively inactive Y’s nevertheless adds to the total DNA content of the cell irrespective of DNA type or sequence. Such a category of effect has been discussed by Bennett (1971) under the concept of nucleotype. 3. The effects are due to the presence of added satellite sequences per se.

With regard to males it is possible to construct XO, XY, XYY, and XXYY individuals. Except for the XY type all the genotypes have a fitness problem. The XO and XYYY types are completely sterile, whereas the XYY male has reduced fertility. In the XO male, infertility is due simply to the complete lack of fertility

78

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

factors. In the XYY the reduced fertility may be due to three possible causes: (1) the increase in the number of active nucleolus organizers, (2) pairing site interaction problems in the XYY trivalent which is expected to form at meiosis, or (3) the presence of added satellite sequences. Since XO males appear to be perfectly viable, the inference is that the Y chromosome is somatically inactive. If this is really so, however, it is not apparent why an XYYY individual has very reduced viability and why doses in excess of three Y’sare lethal (K.W.Cooper, 1956). The Y has an effect either via its satellite content or via the contribution it makes to the nucleotype. The addition of heterochromatic material other than that of the Y can be achieved by using centric fragments. These are well known in the case of the X chromosome, but in principle they can be made up from the hetemhromatin of any member of the complement. Such fragments can be constructed so as to consist of a centromere, a stretch of simple-sequence DNA, and a minimum of two euchromatic loci at their distal tip. Their actual size ranges from 10% of the hetemhromatin block of the X to the entire block, that is, from about 2 million to 20 million bp. Both males and females carrying one or two such extra fragments have been constructed, and there is a decrease in viability in all individuals with increasing severity as heterochromatin dosage increases (M. Yamamoto and G. L. G. Miklos, unpublished). Since the smaller fragments do not carry a nucleolus organizer, their effects must stem either from the tiny amount of euchromatin present or from their heterochromatin content. Since the amount of euchromatin is approximately constant in such a series of fragments, the effects of viability are almost certainly due to the heterochromatic component. Again, however, we cannot distinguish between the contribution this heterochromatin makes in terms of its satellite content and its effects on the nucleotype. The only whole autosome which can be added to the genome as a tri- or tetrasome is the small chromosome 1V. Though consisting predominantly of heterochromatin, it has at least 50 euchromatic bands (ca. 1% of the total euchromatic genome; Hochman, 1973). A trisomic (IV/IV/IV) fly (Grell, 1972) has lower viability than one which carries a centric fragment with the DNA equivalent of four doses of IV or an XYY individual which has the equivalent of at least 16 doses of IV.From this we can conclude that far more heterochromatin can be added to the genome than euchromatin before reaching equivalent inviability levels. Likewise, haplo-IV flies (IV/O) have erratic viability (Lindsley and Grell, 1968), whekas a female heterozygous for an 80% deficiency of its X heterochromatin (equivalent to minus three IV’s) and an XO male (equivalent to minus four IV’s), are both quite viable. Next to Drosophila the limits of tolerance to alterations in chromatin content are best known in humans. As the reader will recall, satellite DNA sensu strict0 makes up only 3% of the total human genome. It is this 3% that we refer to in the

SATELLITE DNA AND HETEROCHROMATIN

79

following discussion, and in it we do not consider the remainder of the highly or intermediately repeated DNA isolated by reassociation, which makes up about 19% of the genome. Our reason for omitting it is that its distribution is not as yet well defined (Section 11). The chromosomes of the human genome which carry the most satellite DNA are autosome 9 and the Y. In both of these the entire C-banded block appears to be occupied by satellite sequences. The X chromosome, in contrast, has virtually no satellite DNA sequences whatsoever, though one X is known to be facultatively heterochromatic in the female soma. It is most instructive therefore to compare somatic tolerance levels for the different chromosomes present in the human complement. Thus chromosome 9 and the Y have substantial blocks of constitutive heterochromatin which are rich in satellite, while the X, though facultatively heterochromatic, consists of euchromatin and is largely devoid of satellites. A majority of the larger autosomes are also essentially euchromatic, with only relatively small satellite components in their C bands. Trisomy for group-D, -E, or -G chromosomes leads to severe malformation and usually early death. Trisomy involving other autosomes (groups A, B, C, and F) is often incompatible with any appreciable degree of fetal development (Creasy et al., 1976). The same is true of deletions. However, the size of the C-banded block on chromosome 9 is very variable, and this variation has no obvious somatic effects. Humans are certainly most tolerant of changes in the number of sex chromosomes. For example, the human Y,like that of Drosophila, is rich in satellite DNA and, with the exception of the male sex-determining locus, appears to lack genes that are expressed in the soma. An extra Y is well tolerated somatically. Thus XYY individuals appear phenotypically normal and are not uncommon in the human population, and XYY abortuses are infrequent. In contrast, individuals with extra X's fare less well, despite the fact that all X's in excess of one are facultatively heterochromatinized in early embryonic development. Both XXX females and XXY males contribute to spontaneous abortion, and their incidence in the population is lower than that of XYY males (Table XXIV). Thus the facultative X chromosome which is assumed to be transcriptively inactive euchromatin appears to have a larger somatic effect than the Y which consists disproportionately of satellite sequences but which also contains euchromatin. This is reinforced by a consideration of XO female monosomics. First, 97% of all XO conceptuses abort, and those that survive show both physical and mental abnormalities. They are also sterile, since they most usually lack ovarian tissue. These observations imply either than X inactivation is not complete, or else that variations in the amount of DNA within a genome play an important role in somatic development. Barlow (1973a) provides evidence that the precise number of sex chromosomes affects the rate of cell division, which in turn has profound effects on development. Certainly the presence of extra X chromosomes can be

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

a0

TABLE XXIV RELATIVEFREQUENCIES O F SEX CHROMOSOME ABNORMALITIES IN HUMAN ABORTUSES AND NEWBORN INFANTS

Total analyzed

Type

XO

XXX

XXY

XYY

Spontaneous abortion Spontaneous abortion Total

53 39 92

3 3

1 2

-

747 233 980

1

10

14

21

18,911

Newborn

1

Reference Jacobs, 1972 Therkelsen er al., 1973 Jacobs, 1972

shown to modify the mitotic rates of cells in culture. This is especially obvious in the case of cell populations grown from skin biopsies obtained from females who are sex chromosome mosaics (Table XXV). Since each of Barlow's comparisons deals with two cell populations derived from the same mosaic source, growing under identical conditions and with the same basic genotypes, there can be no doubt that it is the difference in the content of X-derived facultative heterochromatin which leads to the variation in mitotic rates within individual mosaics. Equivalent effects can be obtained by adding extra DNA which is not facultatively heterochromatic. Thus mongolism, the most common trisomy in humans (GZI), is associated with reduced birth weight and delayed skeletal development. Hall (1965) suggested that the clinical abnormalities in this and other trisomics might be due to a slowing down of cell multiplication as a result of the polysomic TABLE XXV THEINFLUENCE OFFACULTATIVEHETEROCHROMATIN ON THE MITOTIC CYCLE TIMEOF MOSAIC CELL BUT WHICHDIFFER IN POPULATIONS WHICHHAVEIDENTICALAUTOSOMALCOMPLEMENTS X-CHROMOSOME CONTENTO

Mosaic typeb

Cell type

Amount of facultative X material

Mitotic rate (hours) ~~

45, W46,XX

45,x 46,xx

0 1

19.7 30.6

45,X/46,XXqi

45 , x

0

46,XXqi

1.28

14.7 24.6

45,x 47.XXx

0

45 ,X/47,xxx

2

15.4 27.7

'Data of Barlow (1973a). bXqE, lsochromosome for short arm of the X. In this case the Xqi is preferentially inactivated.

81

SATELLITE DNA AND HETEROCHROMATIN

state. Certainly the rate of synthesis in fibroblasts from patients with mongolism is reduced (Kabak and Bernstein, 1970). Likewise, B chromosomes lead to a substantial increase in mitotic cycle time (Fig. 27) in rye, S . cereale, and in Puschkinia libanotica (Barlow, 1973b). In this section we have seen that it is possible to lose satellite sequences, both from tissue culture and from in vivo situations, with no obvious somatic effects. Indeed, it is also possible to lose completely the satellite-rich Y chromosome of D . melanogasrer and leave the soma intact. Likewise, deletion of X and autosomal heterochromatin has little effect in cases where no functional gene loci are present within the heterochromatin. The only effects one finds are limited to the germ line. Thus there is no evidence for disturbances in chromosome organization or chromosome function at the somatic level, that is, in what has been called “housekeeping effects. This contrasts markedly with the loss of material other than pure satellites; thus an XO human female and a haplo-IV Drosophila are in considerable developmental difficulty. Additions, in general, are much more readily tolerated, and this is especially true for those involving satellite sequences. Additions of euchromatin or even facultative heterochromatin impose much more severe developmental restrictions. It appears that we need to view the phenotypic effects of alterations in DNA content, as well as their effects on fitness, in terms of at least three issues: ”

1. The consequences of changing the actual dosage of genes that become functional at some stage of the life cycle, whether these genes are in euchromatin or heterochromatin. 2. The consequences of changing nongenic sequences, whether these are or are not satellite in type. 0.00

-

-

-

- 16.66

0.06

-12.5

-

r_ Lu

YI

t

2

0.04

0.02

-

- 25.0

-0 I

I

I

1

2

I

3

4

z

-50.0

NUMBER OF B‘s FIG.27. Mitotic cycle times in S. cereale and P . libanotica carrying different numbers o f B chromosomes. (After Barlow, 1973b.)

82

BERNARD JOHN AND GEORGE L. GABOR MIKU)S

3. The consequences of simply altering the total DNA content regardless of sequence.

IV. Mechanisms of Satellite DNA and Heterochromatin Change It is clear from the sections dealing with species comparisons (section II1,A) and polymorphisms (Section II1,C) that changes in heterochromatin and satellite content are commonplace during evolution. We turn now to mechanisms for satellite and heterochromatin change to consider what implications they have for satellite DNA function. Such mechanisms may be independent of the mode of origin of satellite DNA. Alternatively the mechanism which initially generates satellite DNA may also be concerned with subsequent changes following its origin. A. SATELLITE DNA Britten and Kohne (1968) originally postulated: 1. Repeated DNA is formed by a saltatory event; that is, within a relatively short, though unspecified, period of time a sequence is multiplied many times in a genome to form identical tandem repeats, often detectable as satellites. 2. With time, and species divergence, mutations accumulate within the members of these clustered repeats, so that they gradually diverge from each other. 3. During this divergence the sequences become dispersed throughout the genome, so that clustering is gradually eroded.

Smith (1976), however, has proposed that satellite DNA-like sequences can be built up by unequal crossovers from a DNA sequence which initially does not possess any obvious periodicity. This proposal does not invoke selective forces for generating such periodicities. These two proposals involving saltation and unequal crossover have in general been tacitly invoked by most investigators without an in-depth analysis of their validity. It is only recently that hard evidence impinging on either proposal has been forthcoming. The short periodicities in repeating DNAs are readily ascertained by sequence analyses, but the advent of restriction endonuclease cleavage of satellite DNAs ushered in a finer level of analysis than had previously been possible. Long-range periodicities in satellite DNA are now apparent, and these bear on the mechanisms of satellite DNA change. We can thus ask if the mechanisms involved in such changes lead us to any conclusions on function.

SATELLITE DNA AND HETEROCHROMATIN

83

1. Mouse Satellite

Mouse satellite DNA has a short-range periodicity based on a GA,TGA sequence in the light strand and many sequences related to it. However, EndoREcoRII restriction endonuclease digestion of this satellite reveals a basic repeating unit of 245 bp, together with DNA stretches that are integral multiples of 245 (Southern, 1975; Horz and Zachau, 1977). Weak bands are also detected which correspond to 'h , 1'h ,2?4etc., % , % , 1% etc., and 36, % of the monomer length. It thus appears that, together with the variations on the monomer length, mouse satellite roughly consists of 1 million copies of a 245-bp unit. Digestion of the satellite DNA with other nucleases, however, reveals that there are between 7000 and 15,000 cleavage sites for EndoR-Hind11 and EndoR-Bsu, and these are not randomly distributed across the satellite. These latter cleavage sites are clustered on stretches of DNA which may be contiguous or, alternatively, occur as several tandem arrays. The 20% of the satellite DNA which exists as integral multiples of this 245-bp unit is held to result from random mutation of the cleavage sites following saltation. However, it is difficult to explain the clustered nonrandom distribution of the EndoR-Hind11and EndoR-Bsu sites relative to that of the EndoR-EcoRII sites. Horz and Zachau have hypothesized that, while saltatory amplification goes on, it is confined to certain regions. They point out that additional events are required to mix repeat units in such a way as to obtain the clustered versus the unclustered sites. They favor unequal crossing-over to carry out this secondary randomization but, contrary to Smith's theory, stress that unequal exchange is not used as a direct means of amplification. These data show that mouse satellite DNA has heterogeneity at several levels: (1) Related short sequences make up the bulk of the satellite, but there are many deviations from it; and (2) there is heterogeneity in the long-range periodicity of repeats, a heterogeneity which exists over and above that shown by the clustered segments of nuclease-sensitive sites. Since mouse satellite is found in the centromeric heterochromatin of all chromosomes except the Y, some of the heterogeneity may well be due to the pooling of the sequences at each centric block. It may also be that each chromosome contains sequence isomers or has its own characteristic level of homogeneity which differs from that of its nonhomologs. The pooling of all these centric regions may thus contribute to some of the observed heterogeneity. 2. African Green Monkey a and y Satellites The a satellite of the African green monkey is located in the centric heterochromatin of all chromosomes and, when digested with EndoR-HindIII, it yields a basic unit of 172 bp. Like other satellites, it also yields traces of fragments of

84

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

intermediate length. Eighty-eight percent of all units contain this cleavage site, whereas the remaining 12% have been inactivated and are randomly distributed across the satellite (Fittler, 1977). The y satellite also occurs in the centric heterochromatin of most chromosomes, but its properties are quite different from those of the a.Here, despite the presence of some homogeneous DNA lengths, there is a background of fragments of heterogeneous lengths with a register that is far more complex than just multiples of a repeat unit. Thus, of these two satellites, both of which reside in the same centric heterochromatin, the a is found to have a well defined long-range periodicity, whereas the y is extremely heterogeneous, to the point where it appears improbable that a simplified set of isomers on different chromosomes can account for such heterogeneity. 3. Guinea Pig Satellites I , II, and III The three satellites of the guinea pig, which also reside in the centromeric heterochromatin of most chromosomes, allow tracking of three different components within the same heterochromatin. Satellite I (E. M. Southern, 1970; Altenburger et al., 1977) is degraded by the nuclease Alu into very heterogeneous breakdown products which show little regularity in terms of their size. Satellite I1 is almost completely resistant to multiple nuclease attack and is thus highly homogeneous. Satellite 111, however, has a basic repeat unit of about 215 bp, but once again cleavage sites for other nucleases are clustered on small separate segments. Thus satellite I11 resembles that of the mouse, the a satellite of the African green monkey, and the 1.688 D . melanogaster satellite. Clearly guinea pig heterochromatin contains three satellites, each with its own level of heterogeneity. 4. The 1 .ti88 D.melanogaster Satellite

It will be recalled that the 1.688 satellite of D. melanogaster did not conform to the “rules” for simple-sequence DNA changes as evaluated by Endow et al. (1975) (Section 11). Carlson and Brutlag (1977) showed that the 1.688 satellite was complex, with a repeating unit of 365 bp. When digested with Hae I11 and Hinfl, there were many fewer recognition sites than one would expect from a model of amplification followed by random mutational inactivation. Furthermore, just as in other satellites, the spacing of some recognition sites does not conform to integral multiples of 365 bp, indicating that different regions of the satellite can have different arrangements of these nuclease sites. Brutlag et al. (1977b) showed that the altered Hae 111 sites were not due to modified bases but were actually variant sequences. From direct partial sequencing data (Table I) they argue that insertion and deletion mutations are rare and that the primary sequence variation is due to base substitution. Since they also

SATELLITE DNA AND HETEROCHROMATIN

85

found that the sequence 5'(TTTCC)3' occurred on both satellite strands, it seems that inversions have been involved in the evolution of this satellite. If one generates a random sequence of bases with the same base ratios found in the 1.688 satellite, it is possible to show that not only are inversions quite common, but that certain sequences, or variants of them, appear with a high frequency simply because of the high AT content. Hence, before one can draw meaningful conclusions about the biological significance of the subunit structure of the 365-bp unit which makes up the 1.688 satellite, it is necessary to allow for the frequency of inversions and those repeating sequences that occur simply on a random basis. 5. Satellite DNA and Chromatin So far we have considered only first-order phenomena, that is, DNA sequencing and long-range periodicities over and above those of a basic repeating unit or its associated variants. What of the organization of satellite DNA in chromatin? Maio et al. (1977) and Musich et al. (1977) showed that there appeared to be a relationship between the subunit structure of chromatin, as imposed by nucleosome spacing, and the repeat periodicities in satellite sequences. The mononucleosome DNA length, that is, the length of DNA around one nucleosome plus the internucleosomeDNA, varies from organism to organism, ranging from about 155 to 245 bp. It has been argued by these investigators that chromatin subunit structure may influence the higher-order organization of repetitive sequences. Thus, if nucleosomes are important in determining the register of unequal crossing-over, for example, one might expect some periodicity based on mononucleosome length. In the African green monkey the a-satellite repeat unit of 176 bp is indeed the same length as the mononucleosome distance. If this is taken as a standard, the lengths of the other sequences in other organisms are commonly multiples of it.' The Apodernus satellite has a periodicity of 352 (176 x 2) bp, whereas the mouse satellite trimer (23Y X 3 = 705) corresponds to the a tetramer (176 x 4 = 704). Satellite I1 of the sheep has segments of 235, 176, and 125 bp. Two human satellites, both at buoyant densities of 1.701 gm/cm3, have periodicities at 176 and 352 bp. Calf satellite I, which has 1408 bp, clearly represents the octamer based on a 176-bp unit. Even within one organism, however, the situation is not always simple. Whereas satellite 11of the sheep and goat does indeed correspond to multiples of 176 bp, EcoRI restriction analyses of satellite I of these species show that they cannot be simple multiples of 176 bp. 'The reader will recall from Table I that the length of the a-satellite of the African Green Monkey is 172 bp from direct sequencing, whereas Maio el al. (1976) based their calculation on 176 bp. Since the length of the other sequences have been calculated on the assumption of a 176 bp unit, and hence are only relative, this will not materially affect the conclusion. *This represents a more accurate estimate of the monomer length of mouse satellite, previously calculated as 245 bp.

86

BERNARD JOHN AND GEORGE L. GABOR MIKU)S

These remarkable findings indicate that the subunit structure of chromatin commonly influences or modulates the long-range periodicities in satellite DNA, irrespective of their short repeating units. In summarizing, it should be remembered that all the satellites we have discussed in this section are in the centromeric heterochromatin of most chromosomes. Their long-range periodicities are such that, for at least some of them, selective regional amplification followed by random mutation, followed again by a further randomization process (such as unequal exchange), may well account for much of their structure. Higher-order imposition may also be determined by the subunit structure of chromatin. No one, however, appears to have seriously asked if such heterogeneity and higher-order structure is of functional significance, or if it can be partly explained by unavoidable events that commonly occur in chromosomes, namely, replication errors, crossing-over, and structural rearrangements. Let us now turn to data on heterochromatin change and ask if a different viewpoint helps in approaching the problem of heterogeneity and functional significance of satellite DNA periodicities. B. HETEROCHROMATIN 1. Unequal Exchanges (see Addendum, note 3)

One mechanism by which heterogeneity can be introduced into an otherwise homogeneous repeating sequence is by unequal exchange. Does spontaneous exchange then take place in heterochromatin, and does it occur at a sufficiently high frequency to account for the heterogeneity that is found? The hard data pertaining to such questions are extremely few. The problem can, however, be approached by first examining the rapidity of change in heterochromatin. The documented inheritance patterns of variants for C-band heterochromatin in humans indicate that some offspring have drastically reduced amounts of centromeric C-banded material (Craig-Holmes et al., 1973, 1975), whereas others have increased amounts (Seabright et al., 1976; Ferguson-Smith, 1977). When a reduced C-banded region is detected in a child, both of whose parents have larger-sized blocks, it seems unlikely that saltation was operative. Saltation, as it is commonly invoked, cannot readily produce deletions of the type seen in parent-offspring studies. All three groups of investigators referred to above have therefore argued for unequal exchanges to produce the observed alterations in heterochromatin amount. Ferguson-Smith opts for unequal crossing-over at meiosis in the regions concerned, Seabright et al. for unequal sister chromatid exchange (SCE) at mitosis, while Craig-Holmes et al. (1975), on the basis of mosaicism, both for unequal crossing-over at meiosis as well as for mitotic exchanges between homologs. The evidence, however, is so heavily biased against meiotic recombination in heterochromatin itself (John, 1976) that un-

SATELLITE DNA AND HETEROCHROMATIN

87

equal SCEs seem more plausible. Moreover, as far as mitotic exchange between homologs is concerned, it is rare even in Drosophila where homologous chromosomes are known to show somatic pairing. In the absence of such pairing an organism would be in considerable difficulty in the matter of mitotic crossingover. If one considers saltation as a mechanism for increasing heterochromatin content, an additional pmblem is encountered. If saltatory replication occurs, it ought to produce blocks of C-banded material larger than double the size of the biggest parental block, which is the theoretical maximum due to one unequal SCE. This has not been observed in any of the human parent-offspring studies. An implicit common assumption is that exchanges of any kind are as free to occur in satellite DNA sequences as in euchromatin. It is well documented, however, that meiotic crossing-over is excluded from occurring in heterochromatin (John, 1976; Kush, 1973; Smith and Virrki, 1978). While SCEs have certainly been found in heterochromatin, nearly all the experiments demonstrating them have used bromodeoxyuridine(BrdU)-substitutedDNA in order to visualize the exchange event. If chromosomes are allowed to replicate in the presence of BrdU, T residues are replaced with BrdU. Following one additional round of replication in the absence of BrdU one chromatid of each chromosome is nonsubstituted, and this can be distinguished cytologically with a combination of the dye H33258 and Giemsa staining. Under these circumstances the substituted chromatid is not as intensely stained as its unsubstituted sister. Consequently any genuine switches of light and dark stained material within a chromatid constitute evidence for SCE. What is still not clear is the extent to which BrdU itself induces exchanges (Kato, 1976). Given that at least some of the events detected by this method represent spontaneous occurrences, then it offers a means of examining the distribution of spontaneous SCEs. Using this technique Holmquist and Comings (1975) visualized SCE in mouse L cells. They showed that different chromosomes had different amounts of SCE and that, overall, exchange was less frequent in heterochromatin than in euchromatin. Likewise, when the distribution of SCEs is analyzed in human chromosomes with the BrdU technique, there are relatively few changes at the centromeres. Indeed, in several chromosomes the midarm regions contain an excess (Galloway and Evans, 1975). Cytological analyses of ring chromosomes, however, allow the unambiguous detection of SCEs, since odd numbers of such exchanges in a ring lead to the formation of dicentrics. In a ring Y-chromosome fragment of D . melanogaster, which is known to consist almost exclusively of satellite DNA sequences, spontaneous SCEs occur with a frequency of approximately 1 in 300 cell divisions in a 20-million-bp stretch of DNA (Yamamoto and Miklos, 1978). However, even here, no evidence exists as to whether these exchanges are equal or unequal. The only evidence on inequality of exchange stems from inequality in C-band mate-

88

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

rial observed in human families, and hence is indirect. Thus, so far none of the evidence is equivocal in demonstrating unequal exchange. In D . melanogaster it is possible to generate an X chromosome completely deficient in the nucleolus organizer (XbbO). In addition, flies are known that are partially deficient in rRNA genes in either the X (bobbed mutants, Xbb) or the Y (Ybb-). The phenotypic effect of the bobbed mutation results in smaller bristles, a thinner cuticle, and a reduced growth rate. When an Xbb chromosome is maintained for several generations with a Ybb- chromosome, the Xbb reverts to the normal wild-type level of ribosomal genes (Xbb-), and this event has been called magnification. The increased amount of rDNA is heritable and shows striking stability. A Ybb- chromosome can also decrease the rDNA content of a bb- locus, an event termed gene reduction. Tartof (1973) has argued that rDNA magnification results from unequal mitotic SCE. This would produce two new sister strands, one containing a greater and the other a lesser number of rDNA tandem repeats than was originally present in either parental chromatid. Saltatory replication, however, is also capable of producing magnification, provided it is coupled with excision and reinsertion events and an extrachromosoma1 mode of replication (e.g., rolling circle). The structure of the repeating units of rDNA in the chromosomes of Xenopus luevis is compatible with a random scrambling of repeats of different length. Such heterogeneity due to spacer lengths is more likely to have arisen by unequal exchange than by saltation (Wellauer et al., 1976a,b).

2, Rearrangement-Induced Exchanges Evidence exists that alterations in the amount of heterochromatin can be induced by structural rearrangements. The studies of Baimai (1975a,b, 1977) in Hawaiian Drosophila imply that increases in centromeric heterochromatin are generated when a large inversion is present on the same chromosome and one of the breaks responsible for this inversion occurs within or near a block of heterochromatin. Baimai found that in three species, Drosophila disjuncta (1975a), D . formella (1975b), and D . recticilia (1977) the presence of an extra heterochromatic segment was specifically associated with the presence of an inversion in the same chromosome in which one of the breakpoints was near to or within the centric heterochromatin. Thus heterochromatin can be induced to undergo saltation when a disturbance (a chromosome break) occurs in it. It may be significant that the large metacentric of D . nasutoides, which carries 60% of its genome as four satellites, is an isochromosome whose mode of formation must have depended on structural rearrangement. Keyl’s (1961) study on Chironomus indicates that particular bands in polytene nuclei can be amplified when an inversion breakpoint occurs near them. Such examples surely do not stem from unequal crossing-over, and these studies of Baimai and Key1 show that structural rearrangements (particularly those in or near heterochromatin) can

SATELLITE DNA AND HETEROCHROMATIN

89

elicit a saltatory response. Thus there can be a rapid buildup of DNA at or close to an exchange breakpoint. Furthermore, an entirely heterochromatic inversion, which in general would remain undetected both cytologically as well as genetically, could cause the amount of heterochromatin to change drastically. Thus a pencentric inversion with two heterochromatic breakpoints could cause growth of a second chromosome arm. 3 . Hybrid-Induced Changes Genetic instability following hybridization is a well-known phenomenon, and the case under consideration deals with a distinctive form of instability in Nicotiuna hybrids. Specifically, when chromosomes containing blocks of heterochromatin from one species are introduced into the genetic background of another, these blocks can undergo an immense increase in size. For example, Nicotiana otophoru (2n = 2x = 24) possesses large heterochromatic segments on 5 of its 12 chromosome pairs. When this species is crossed with Nicorianu tubacum (2n = 4x = 48), which has only small scattered segments of heterochromatin in its genome, megachromosomes up to 15 times normal length are found in the FI . Such giant chromosomes form as a result of enlargement of the large heterochromatic blocks found in N . otophoru. Although the frequency of these megachromosomes is low in the F, (ca. 1 per 100cells), it can be increased by backcrossing with N . tabucum. However, backcrossing with N. otophora suppresses the formation of giant chromosomes. At least three of the five heterochromatic blocks in N . otophoru have been demonstrated to behave in this way, although it should be emphasized that in all cases the megachromosomes appear only in scattered cells. The evidence, as it stands, indicates that megachromosomes are not passed from cell to cell at mitosis, since they experience difficulty in anaphase separation as a result of the formation of dicentrics. This implies that they must originate de novo in each case and that their production may be associated with genotypically induced chromosome breakage. Presumably for the same reason they are never found in pollen grains, though they have been seen in pollen mother cells. Since some of the N . otophora Chromosomes are at least homologous with members of the T genome of the tetraploid N . tabucum and can pair, in part, with them at meiosis, it is theoretically possible to transfer heterochromatic blocks of N . otophora directly onto N . tabucum chromosomes by crossing-over, and it is this process which Gerstel and Bums (1967) hold to be responsible for increased megachromosome production in backcross hybrids. This and further evidence suggests that the ability to produce megachromosomes in a N . tabucum background is not a property of a specific piece of heterochromatin but is apparently a more general property of heterochromatin introduced into an alien N. tabucum background. As yet, the mechanism of megachromosome production is unresolved. The investigators favor the

90

BERNARD JOHN AND GEORGE L. GABOR MIKU>S

hypothesis that physical proneness to breakage may in turn lead to the broken heterochromatin continuing replication beyond one cycle, hence to megachromosome formation. This hypothesis stems from the consistent correlation they have found between breakage and the ability to produce megachromosomes, which is also reminiscent of the claim made by Baimai. 4. Heterochromatin Rules and Their Implications

The heterochromatin studies have important implications for satellite DNA heterogeneity analyses and for satellite DNA function, since they demonstrate that: 1. There is good evidence for saltation of heterochromatin following rearrangements involving a heterochromatic breakpoint (Drosophila, Chironomus). 2. Spontaneous SCE occurs in simple-sequence DNA (the ring Y of Drosophila), and its frequency varies from chromosome to chromosome of a genome (human and mouse cell lines). 3. The presence of genes in the heterochromatin (Section 1113) may restrict the types of changes that can be maintained. 4. Certain genotypes can induce or suppress the amount of heterochromatin in a genome (Nicotiana). 5 . The amount of centric heterochromatin appears to be a continuous variable in well-studied chromosomes in humans, and this may apply to other kinds of heterochromatin when other systems are carefully studied. 6. The position of heterochromatin in a chromosome can be of great importance. Thus the restrictions which apply to centric heterochromatin may not apply to heterochromatin which exists as an arm having no euchromatin distal to it. In view of what we have learned concerning heterochromatin change let us now ask if these properties allow further insight into the heterogeneity seen in satellite analyses. A simple example illustrates the problem very clearly. Assume we have a hypothetical organism with 10 chromosomes of different euchromatic length and by saltation we amplify the same sequence in the heterochromatin of each chromosome to the same level. All chromosomes now have identical amounts and arrangements of satellite DNA in their centric heterochromatin. Under what conditions would such an arrangement persist? If aberrations such as inversions with het-eu breakpoints occur, then either genes are introduced into a heterochromatic milieu or satellite sequences are distributed into the euchromatic arms. Since these types of aberrations again favor some chromosomes over others, it is clear that each chromosome in a very short space of time adopts its own heterochromatin pattern. For example, mouse L cells commonly undergo chromosome reorganization, giving rise to distinctive

SATELLITE DNA AND HETEROCHROMATJN

91

marker chromosomes. Some of these contain multiple regions of heterochromatin not only at the centromere but also along both arms. By using BrdU banding techniques Holmquist and Comings (1975) placed restrictions on some of the mechanisms by which these marker chromosomes were formed. They argued against paracentric inversion and reversed insertion, because the interstitial blocks had the same satellite polarity as those of the centromere. Comparable polarity restrictions also apply to robertsonian metacentrics found in natural populations of Mus poschiavinus (Lin and Davidson, 1974). It is known, however, that each strand of mouse satellite DNA can form partial duplexes with itself (Flamm, 1972). This suggests that such regions within the satellite may be due to inversions or reversed insertions. Since these regions are less than 50 bp in length and are spaced at intervals of approximately lo00 bp, the BrdU banding technique could hardly be expected to resolve such switches in polarity. An alternative possibility is that the metacentrics of the mouse cell line are either isochromosomes or homologous fusion metacentrics. Even if these cell line metacentrics are isochrornosomes, we are still left with the problem of how the interstitial C blocks arise in them. One possibility is that interspersed satellite sequences exist in the euchromatin and that these can undergo saltation. Alternatively, there may be nonsatellite sequences within the centric heterochromatin, and progressive saltation of both satellite and nonsatellite sequences of the centric heterochromatin may lead to the production of a banded chromosome. In principle this problem seems no different from that of explaining how the giant isochromosome of D. nasutoides comes to contain distinct satellite blocks along its arms, which are separated by other satellite blocks (Fig. 5 ) . An additional factor which contributes to the heterogeneity of satellite sequences is the introduction of gene sequences into heterochromatin. For some loci, such as the rRNA cistrons in the centric heterochromatin of D. rnelanogasfer, there is a positional restriction on their normal activity. Baker (1971) showed that, when the X was inverted so that the rRNA genes were moved to a distal euchromatic region, there was a positional effect suppression of rRNA gene activity leading to lower viability in experimentally produced XO males. These results indicate that there must be a region in the basal heterochromatin of the X which acts as a regulator of rRNA activity. Variegation also occurs for the It locus present in the heterochromatin of IIL. Here inversion of the heterochromatic segment containing It into a euchromatic portion of the chromosome causes position effect variegation of this locus (Baker, 1968). So too presumably does the movement of euchromatic material closer to the It locus. These examples highlight the general problems faced by genes which normally reside inside heterochromatin or at heterochromatic-euchromatic junctions. One might expect such genes to experience problems in maintaining their normal activity when their surroundings are altered.

BERNARD JOHN AND GEORGE L. GABOR MIKMS

92

A further type of restriction follows once gene sequences necessary for viability are introduced into heterochromatin. Now the products of unequal SCE can lead to gene duplication or deficiency (Fig. 28). The deficiency can cause lethality, whereas the consequences of duplication depend on whether one or both of these loci remain functional. Where satellite sequences flank a gene there may be severe restrictions on the extent to which these sequences can be altered and still allow efficient functioning of the gene. Satellite sequences may therefore become trapped between genes in heterochromatin. Thus, even if we allow other satellite sequences to expand or contract in a genome, we are inevitably left with remnant satellite sequences which constitute a library by default. Euchromatic sequences within heterochromatin will add still further to the heterogeneity in satellite DNA revealed by restriction endonuclease analysis. Last, what has been ignored in endonuclease analyses is that the constraints on heterochromatin may well be different depending on its position in the genome. Clearly some centric, telomeric , or interstitial blocks of satellites on some chromosomes may be more homogeneous than others, but the reasons for their homogeneity may well be the outcome of the very processes discussed above. Their homogeneity or heterogeneity may thus reflect important functional constraints on gene-heterochromatin interaction rather than on the satellite itself. As a result of such constraints, each chromosome is likely to develop its own characteristic satellite DNA pattern. It is dangerous to assume, as Peacock et al. INVERSION

1-

ib)

G

I I

X

G

G

G

DUP.

DEF.

FIG.28. The consequences associated with generating an inversion having one heterochrornatic and one euchromatic breakpoint. (a) The normal chromosome. (b) An unequal exchange following inversion which yields a duplicated chromosome carrying two doses of a euchromatic segment and the reciprocal product having a euchrornatic and heterochromatic deficiency (C). G symbolizes the presence of genes.

SATELLITE DNA AND HETEROCHROMATIN

93

(1977a) have done, that, because nonhomologs are found to have distinctive satellite patterns, these patterns facilitate homolog recognition. Indeed experimental evidence indicates that it is euchromatin, not heterochromatin, that is important for such recognition. In the case of the giant isochromosome of D . nasutoides there is certainly a homolog-specific pattern of satellite DNA, but who can believe that such an isochromosome requires 60% of the genome as satellite to affect homolog recognition when the remaining three pairs of chromosomes in the same complement recognize one another perfectly in the virtual absence of satellite DNA? It is also obvious from the continuous nature of the variation seen in human C bands that the pattern of heterochromatin is a constantly changing one and, whatever importance one wishes to attach to this pattern, its ongoing change within populations of the same species places stringent restrictions on its functions.

V. The Library Hypothesis None of the information we have compiled on any aspect of the structure of satellite DNA has yielded any clue to satellite function. This includes the large amount of data on sequences of satellites, their long-range periodicity, and their heterogeneity. One fundamental question that needs to be answered is whether the actual basic repetitive unit is itself of functional significance. Recent discussions assume it to be so because of the apparent Conservation of a given sequence in widely different rodents (Salser er al., 1976; Fry and Salser, 1977). These investigators and their colleagues have shown that there are remarkable similarities between some of the satellite sequences found in rodents. Thus the kangaroo rat, pocket gopher, guinea pig, and antelope squirrel share the sequence GGGlTA in their a satellites. However, it should be noted that there are at least 12 variants related to this particular sequence in D.ordii, which outnumber the sequence itself (Salser et al., 1976). The same is undoubtedly true for the guinea pig. Additionally within kangaroo rats themselves the actual amount of the a satellite varies from less than 2% to at least 19%. Both these facts pose serious problems for any theory of satellite function. Indeed, even if there were absolute conservation of satellite structure, which there is not, there is certainly no conservation in the amount of a satellite. Nevertheless the finding of a common a sequence has led to the hypothesis that these mammals share a common library of satellite sequences. These sequences are amplified to various degrees, so that in any given group one may see some species with large amounts of particular satellites and others with large amounts of different satellites. According to this hypothesis therefore there are really no “new” or “old” satellites, merely saltatory replication of a sequence present in a low copy number giving rise to an apparently new satellite.

94

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

The library concept, as recently stated by Fry and Salser (1977), incorporates three main features: (1) “Candidate” satellite sequences for incorporation into the library are created de novo frequently; ( 2 ) only infrequently does a candidate sequence acquire a biological function which enables it to enter the library; (3) the library of satellites is accompanied by a library of genes for recognition proteins. In effect therefore this requires a double library, one for satellite DNA and the other for genes that make satellite DNA-binding proteins. It also requires two sets of candidates whose mutual interactions need to be coordinated in space and time. Let us assume we have a number of different sequences S1. . . S, which for some reason represent candidate sequences each of which can have a copy number of fi . . .f ,,. There are at least three critical questions we can ask about such a library: (1) Are the individual sequences S, . . . S , indeed of functional significance because of their sequences? ( 2 ) Do the frequencies of a given sequence have functional significance? (3) Is there a higher-order functional significance due to sequence arrangement; for example, is centric heterochromatin of the constitution S,f, S& functionally different from an arrangement such as W A ~ I O ? Let us consider these three questions in turn. 1. Are the individual satellite sequences of functional significance? It is known that simple DNAs, like poly d(AT) and poly d(GC) have special properties such as anomalous buoyant densities and melting temperatures when examined in vitro (Wells et al., 1970). It might initially seem attractive then that short satellite sequences with anomalous properties provide an excellent means of producing special conformational constraints on DNA, constraints which unique DNA would be unable to provide. The problem really boils down to determining if simple-sequenceDNA has any special properties when it exists in chromatin in vivo and not simply as naked DNA in vitro. The little evidence that exists seems to indicate that it is the interactions provided by the nucleosomes which impose properties on satellite DNA rather than the reverse (Maio et al., 1977; Musich et al., 1977). The basic satellite sequence periodicity which varies from 3 bp (D, ordii) to 1408 bp (calf) is clearly unrelated to the average 200-bp nucleosome packing (Section IV,A). At this level therefore satellites of different complexity seem to have similar packing properties in chromatin. Is there then a functional difference between a short sequence, such as the AATAT of D. melanogaster, and the complex 365-bp satellite, which are both distributed on all chromosomes of the genome? If both sequences are capable of specifying the same function, this has important implications for the protein library. While it is not difficult to conceive of a protein capable of recognizing a short satellite sequence, it is quite

SATELLITE DNA AND HETEROCHROMATW

95

a different matter to conceive of a protein which needs a 365-bp sequence for a recognition event. Studies on the interaction of regulatory proteins with specific DNA sequences in Escherichia coli make it clear that the linear DNA sequence provides no indication of what is important for these protein-DNA interactions (Dykes et al., 1975; Gilbert et al., 1976; O’Neill, 1977). O’Neill points out that such an approach may be too simple, and that what is required is the examination of a helix in a threedimensional context. This may reveal additional positional information imposed by this helix on a given sequence. At present the functional significance of a satellite sequence in chromatin is obscure. 2. Do the frequencies of a given sequence have functional significance? As Fry and Salser comment, their model “fails to explain why there are enormous rearrangements and changes in the amounts of individual satellite DNAs during very short evolution times. ” Furthermore, they ask, How can such radical fluctuations in amount over shon evolutionary periods be consistent with functional importance sufficient to guarantee conservation of sequence over long evolutionary periods? Do such rearrangements serve a purpose? Is there special ‘machinery’to perform such arrangements? From the frst discovery of satellite DNA’s one of the popular hypotheses has been that they have a role in meiotic pairing. When we considered this role in the light of the questions posed above, it was obvious that a sudden change in the amount or location of the satellite sequences in the progency of a single individual could provide a very crude ‘species’ banier in which matings with the general population were more or less infertile.

On these tenuous grounds they have proposed that ”the very rapid quantitative changes in satellites whose sequence is strongly conserved have led us to consider that they might have a role in sympatric speciation. ” The essential basis for this argument is that differences in satellite DNA content upset meiotic pairing and so lead to infertility. Some of the best evidence concerning satellite DNA function is precisely on this point and is strongly against such a hypothesis. Thus autosomes of Drosophila with massive heterochromatin deficiencies pair perfectly well with their normal homologs. Likewise, in a D . melanogaster stock with a D . simulans IV, pairing of the D.melanogaster IV with the D.simulans IV is normal in the male (Section III,B), despite the fact that the relative amounts of satellite DNA are strikingly different in these two chromosomes. Equally, in hybrids between M . musculus musculus and M . musculus molossinus, pairing between homologs with a grossly different satellite content is normal. Likewise, in cases where a polymorphism exists for centric, interstitial, or telomeric DNA there are no pairing problems in heterozygous combinations. This is true, for example, of arm polymorphism in Peromyscus (Waterbury, 1972). Indeed, it is a sobering

96

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

thought that, since individuals of Peromyscus heterozygous with respect to the presence of heterochromatic arms suffer from “neither physical nor meiotic abnormalities,” Mascarello et al. (1974) have argued that satellite DNA is functionless. In Hawaiian Drosophila, speciation in different subgroups goes on with virtually no detectable alteration in satellite DNA buoyant densities or amounts of satellites. Thus in the D . planitibia subgroup the major satellite has buoyant densities of 1.684, 1.685, and 1.686 gm/cm3 in amounts of 31, 29, and 28%, respectively, in the three species D . silvestris, D . planitibia, and D . heteroneura. In the D . adiastola subgroup, D . ocrobasis, D . setosimentum, D . adiastola, and D . penicufipedis have no visible buoyant density satellites of any kind. In the Drosophila grimshawi subgroup, D . grimshawi, D . balioptera, D . hawaiiensis, D . silvarentis, and D . gymobasis have major satellites at densities of 1.688, 1.687, 1.685, 1.687, and 1.686 gm/cm3, respectively, in proportions of 41, 43, 43, 42, and 48% (E. M. Craddock, personal communication). Sympatric speciation in each of these three subgroups has gone on without any major chromosomal rearrangements, with almost constant satellite DNA amounts and without radical buoyant density changes. Thus within each of these subgroups the library is in effect closed-there is no borrowing or returning-and yet speciation proceeds quite normally. In rats the converse is true. Here the amount of centric C banding is in many cases below the level of detection (Yosida, 1975). In the one case where this situation has been adequately analyzed molecularly, R . norvegicus, it is clear that there is only a minute amount of highly repetitive DNA (McConaughy and McCarthy, 1970). There is no reason to doubt that the same is true for the three so-called subspecies of the Rattus sordidus group, namely, R . sordidus villosissimus (2n = 50), R . sordidus colletti (2n = 42), and R. sordidus sordidus (2n = 32), in which again no detectable C banding occurs (Baverstock et al., 1977, also personal communication). Hybrids between these forms are all expected to show a high level of infertility, since R. sordidus sordidus and R. sordidus villosissimus differ by at least nine centric fusions, while R. sordidus colletti and R . sordidus sordidus differ by five and R. sordidus colletti and R. sordidus villosissimus by four. They are thus sibling species in which speciation has been accompanied by extensive chromosome rearrangement in the absence of detectable quantities of C-band material, hence presumably of satellite DNA. Indeed, it is clear that there is no necessary correlation between the amount of satellite DNA, the presence or absence of chromosome rearrangement, and speciation. Neither is meiotic pairing upset when species hybrids are constructed from parental forms with radically different amounts of satellite DNA. 3. Is there a higher-order functional significancedue to sequence arrangement in centric heterochromatin? The finding in D . melanogaster that each chromosome has its own special arrangement of the different satellite DNAs has been

SATELLITE DNA AND HETEROCHROMATIN

97

interpreted by Peacock et al. (1977a) to be of functional significance. These investigators have argued that it is this satellite specificity that determines homolog recognition and that the common satellites on nonhomologs aid in processes such as chromocenter formation. As we have already mentioned, rearrangements of hetemchromatin in D . mefunogusterdo not impede pairing, nor do heterozygous deletions lead to nonparticipation of a chromosome in a salivary gland chromocenter (Yamamoto and Miklos, 1977, 1978; Yamamoto, 1978). Furthermore, telomeric blocks of heterochromatin present in different grasshopper species have similar intrachromosomal effects on chiasma distribution, even though their sequence arrangements must surely be different since the species concerned are so widely separated evolutionarily. When a female D . mefanogaster is synthesized with a large block of telomeric satellite DNA, recombination is decreased near this block, just as it is in the grasshopper A . simifis which has a telomeric block of quite different satellite DNA. Thus different arrangements of different satellites can have similar intrachromosomaleffects on the recombination system. Clearly, sequence arrangement of satellites is not important for some processes, and it remains to be established that it is important for any. In summary there are two obvious ways in which the predictions of the double library hypothesis can be tested. One is to look for conservation of sequence on the assumption that conserved sequences imply conserved function. While there is certainly evidence for sequence conservation, there is also good evidence for a lack of conservation in the amount of satellite. As yet there is no evidence for conserved function. The other approach is to test for the specific function accorded to a library sequence. Fry and Salser claim that differences in satellite content interfere with meiotic pairing and so form the basis for sympauic speciation. This is patently unsupported by all the available evidence. Coupled with this we have presented cases which indicate that different sequences can have comparable effects on the meiotic system. Thus, as far as it has been possible to test the predictions of the library hypothesis, all the hard data on functional aspects of satellite DNA are against it (see Addendum, note 4).

VI. Unresolved Aspects of Satellite DNA There are some aspects of satellite DNA which still require explanation under any hypothesis. Whether their investigation will contribute to an understanding of function or simply tell us about the mechanism of change is as yet unclear. Perhaps the strongest candidate for consideration from a somatic point of view is that the quantity of DNA in a nucleus (the nucleotype) may regulate fundamental characteristics such as cell size, cell cycle, and generation time quite independently of its informational content or its sequence specificity (Bennett, 1971).

98

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

While an interesting idea, the concept of nucleotype has been little tested in experimental systems (see, however, Barlow, 1973a,b, Section 111,E).The bulk of the available data stems from comparisons among unrelated diploid species of plants. Here mitotic cycle time has been shown to be inversely proportional to total DNA content, though monocots as a whole behave differently from dicots (Fig. 29) (Evans and Rees, 1971). It has been suggested therefore that alterations in DNA content are responsible for determining alterations in generation time. In support of this are two facts: (1) Most annual plants have less nuclear DNA than related perennials. This suggests that the low DNA content and the coupled shortened mitotic cycles determine a reduced generation time, as appears to be the case in Crepis (Jones and Brown, 1976). (2) In at least five families of angiosperm plants, species with large chromosomes tend to occur in temperate latitudes (Stebbins, 1966). Since chromosome size is positively correlated with DNA content, this implies that species with high DNA contents and slow patterns of growth may be localized to temperate regions, whereas low DNA content species occur in tropical regions. This hypothesis has recently been supported by Bennett (1976). These claims imply that the quantity of DNA seems to be correlated with several factors-cell size, length of mitotic cycle, basic metabolic rate, and developmental time-all of which would be subject to natural selection. Of course, the amount of DNA does not exclusively determine such characters, but

10

20

30

A0

50

2 C NUCLEAR DNA [pel

FIG.29. Mitotic cycle times in root tip meristems of different plant species having various nuclear DNA contents. (a) dicots and (b) monocots. (After Evans and Rees, 1971).

SATELLITE DNA AND HETEROCHROMATIN

99

1000

CS 500

cv

0

t NV 100 50

0

5

10

15

10

25

FIG. 30. Genome size and cell parameters in amphibians. Cell volume (CV),cell surface area

(CS), and nuclear volume (NV)in 26 anuran species plotted against DNA content. (After Olmo and Morescalchi. 1978.) The relative cell surface Cs/Sv is also plotted against DNA content for 39

species of caudate amphibians. (After Olmo and Morescalchi, 1975.)

it does of necessity influence their expression. There is some evidence from animal studies offering support for these ideas. Among anuran amphibians (frogs and toads) the amount of DNA per genome varies from less than 2 pg to greater than 20 pg. Olmo and Morescalchi (1978) showed that within a sample of 26 species the quantity of DNA was directly correlated with nuclear volume, cell volume, and cell surface area (Fig. 30). The same investigators had earlier made an equivalent demonstration with 39 species of caudate Amphibia (newts and salamanders) in which the range of DNA values is even greater, with varying 2C contents ranging from 30 to >200 pg (Ohno and Morescalchi, 1975). Moreover, in the latter they demonstrated that the relative surface (i.e., the surface/volume ratio) tended to decrease rapidly with increasing nuclear DNA content (Fig. 30).

100

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

This means that species with more DNA generally can be expected to have a lower metabolic rate, since the surface/volume ratio of the cell is directly related to its metabolism. As tempting and suggestive as these arguments may seem, they are not supported by adequate experimental data involving alterations of specific classes of DNA within a species. Additionally they make no attempt to discuss the extent to which DNA of different kinds is capable of influencing cell parameters in the same manner or to the same extent. For example, in the subfamily Antheridae (Asteraceae, Dicotyledones) several annual species have significantly more DNA than related perennials in the same genus. Despite this, the annuals develop more rapidly than the perennials. In these cases it appears that the nuclear DNA content has increased through the addition of heterochromatin (Table XXVI), without lengthening the cell cycle (Nagl, 1974). Nagl has explained this situation by making two assumptions, namely, that this heterochromatin consists of reptitive DNA and that for this reason it replicates faster than euchromatin. Neither assumption is known to be valid. Nevertheless, if these assumptions prove to be correct, they will imply that an annual species can grow and develop rapidly either by decreasing its nuclear DNA content or by increasing the percentage of heterochromatin it contains. The correlation between the duration of the mitotic cycle and DNA content is not invariable even within a species. Thus, when the DNA content of rye and Puschkiniu is increased by the addition of B chromosomes, the duration of the TABLE XXVI RELATIONSHIP BETWEEN HETEROCHROMATIN CONTENT AND CELLCYCLE TIMEIN ROOTTIPSOF ANNUALAND PERENNIAL SPECIES OF THE ANTHEMIDAE~ ~~

Hetemhromatin content (% of total DNA)

DNA content (1O-'* gm per 2C nucleus)

Habitb

(hours)

Anacyclus A. depressus A. ratliarus A. clavatus

1.62 6.84 8.55

12.42 16.92 10.48

P A A

15.9 13.6 11.0

Anthemis A. tinetoria A. cola A. austriaca

2.43 9.09 34.11

7.46 15.78 9.63

P A A

12.3 6.5 7.0

Artemisia A . annua A. absinthium

14.13 45.45

4.05 7.28

A

7.7 9.5

Species

'Data of Nag1 (1974). *P,Perennial; A, annual..

Cell cycle

time.

P

SATELLITE DNA AND HETEROCHROMATIN

101

cell cycle is increased disproportionately compared with the effect of adding standard members of the complement. Furthermore, in the Triticinae the duration of meiosis in species with different ploidy levels is inversely correlated with DNA content, whereas the mitotic cycle times show a positive correlation (Davies and Rees, 1975). None of the arguments concerning the possible functions of satellite DNA provide a convincing explanation for the enormous amount of DNA present in pedogenetic caudate amphibians and dipnoan fishes. While in the Caudata the quantity of highly repetitive DNA is generally higher in species with more DNA, this correlation is certainly not precise. In this group at least some of the interspecific differences concern all categories of DNA, though in different proportions, and the fact that this variation also involves the unique fraction is as yet unexplained. Certainly both caudates and dipnoans have large cells, so that their hypertrophied genomes may be necessary to produce such cell size. This, however, only serves to remind us of how ignorant we remain of the factors that influence cell size and the consequences of any increase in this parameter.

VII. Credo and Coda The predominant feature of satellite DNA is its variation. This variation includes its sequence, its long-range periodicity, its location within the chromosome, and its quantity within the genome. Contrary to prior assumptions it is becoming increasingly clear that each species is not necessarily characterized by a fixed amount of satellite DNA. This variability, as we have pointed out earlier, completely invalidates several of the hypotheses advanced for the function of satellite DNA and restricts others considerably. Furthermore, we have argued that it is this variability, so much of an anathema to most investigators, which is of critical importance to eukaryotes, for it provides a dimension of function unavailable to organisms having only unique DNA. The bulk of the satellite DNA provides a modulation of function which perhaps cannot be supplied in a short time span by the regulation of conventional genes. Very rapid increases in satellite amount occur, and these allow rapid perturbations at the cellular, individual, and populational levels. To achieve the same rapid response through the selection of appropriate structural genes may well be impossible. What has in fact narrowed and hampered research on satellite DNA function has been the ongoing reluctance to escape from a preoccupation with cellular mechanics and the concept of conservation. Although fashionable dogma dictates that analyses of structure and change in structure will necessarily resolve the question of function, it is obvious that such oblique approaches do not for the most part even impinge on the problem. For this reason one can have little sympathy with the hope that a knowledge of functions will miraculously emerge

102

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

as the structure of satellite DNA is defined. In fact, the contrary appears to be the case, since the structure of this type of DNA has proven to be remarkably variable. Because of this variability, it seems unlikely that satellite DNA would affect aspects of function which are themselves invariate. By using the only two objective avenues open to us, namely, manipulation of satellite DNA in D. melunogusfer and naturally occurring variants of satellite DNA in wild populations, we have shown that both lead to the same conclusions, namely, that some satellite DNA can be intimately involved in functioning in the control of recombination. This need not necessarily mean that all satellite DNA functions in this way. There have certainly been demonstrations (Schroeter and Hewitt, 1974; John and Freeman, 1975) that some heterochromatic B chromosomes and supernumerary segments do not influence mean cell chiasma frequency, These studies, however, have not excluded effects on chiasma distribution which need not influence chiasma frequency, and no adequate test has yet been made of this possibility. Alternatively, it is well known that many systems are strongly canalized, so that, even when the underlying genetic background is perturbed, no obvious phenotypic alteration is observed. For example, scutellar bristle number in Drosophilu has a canalization plateau at four bristles (Fig. 31). Alterations of the genetic background are only effective above and below two critical thresholds which operate in the epigenetic events governing bristle formation (Rendel, 1968). In an analogous way, this places a new perspective on the question of whether something which appears to have no function, or appears not to be perturbed when the genetic background is altered, is in fact functionless. With these comments in mind and on the basis of the different lines of evidence discussed in this article we believe that the following statements offer the most sound conclusions concerning the functions of satellit DNA at the present time. 1. The bulk of simple-sequence DNA can have very little to do with general cellular recognition processes or with such concepts as centromere strength. 2. Some types of satellite DNA appear to have no somatic functions but do play a role in the germ line. 3. At least one of the germ line functions is concerned with regulating the recombination between homologous chromosomes at meiosis. As such, it provides one mechanism by which a population may alter its potential variability. We do not exclude other possible germ line functions, nor do we wish to imply that there are no somatic functions. The simple fact is, however, that such functions as have been proposed have not yet been critically tested. They remain essentially armchair speculations. Indeed, as we have shown in this article, some of them are manifestly unsound. Thus it is surely no longer necessary to cling to

SATELLITE DNA AND HETEROCHROMATIN

103

MAKE

MAKE IN 6 M

FIG.31. (a) Diagrammatic representation of the canalized relationship between a phenotype (such as bristle number) and Make. Make is the resultant of a complex of influences which go toward determining the phenotype (Rendel, 1968). (b) Mean scutellar bristle number in D.mefanogasrer plotted against Make, which is expressed in standard deviations. Clearly the bristle number is canalized at a plateau of four bristles. (Data of Rendel, 1968.)

the notion that the bulk of satellite DNA is involved in a process as precise and as important as chromosome pairing. Furthermore, although excellent data exist on the interaction of DNA sequences with regulatory proteins (Gilbert e? al., 1976; O’Neill, 1977; KaoHuang et al., 1977), we still have no information about the nonhistone proteins which interact with satellite DNA (see Addendum, note 5 ) . We do not know what level of discriminationis used by a satellite DNA-binding protein when it interacts with variants of a sequence. In order to discuss conservation of a nontranscribed versus a transcribed sequence meaningfully, we need to know the functional constraints on it.

104

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

Additionally the amount of DNA classified as repetitive depends largely on the operational criteria used to characterize this DNA. Yet the important distinction is not that which is operationally convenient for the investigator (usually T,,, -25°C) but rather that which is applied by the cell itself from a functional point of view. For this reason it is difficult to decide whether the demonstrated structural conservation of at least some satellite sequences is a critical component of satellite DNA function. As Bendich and Anderson (1977) have pointed out, “We do not know what level of discrimination is used by any eukaryote to distinguish repeat from non repeat,” and we add to this quotation, ‘‘or to distinguish conserved from nonconserved elements of satellite DNA. *’ Until we have a rational basis for deciding how the cell discriminates, or fails to discriminate, between these aspects of the genome, we are unlikely to be able to resolve completely the biological role of satellite DNA.

VIII. Addendum Since a considerable number of important papers dealing with DNA sequencing, restriction endonuclease digests, and intervening sequences appeared while this article was in press, we have included brief notes on them since they qualify or extend statements made in the text.

NOTE1. INTRONS The recent finding of “split” genes allows for some rationalization of a portion of the “excess” DNA present in eukaryotes. Data on a variety of systems now indicate that when part of a chromosome is transcribed into RNA, some of the regions in this RNA are excised prior to yielding the mature messenger. Thus at least some segments of a chromosome can be viewed as gene “pieces” which are separated by intervening sequences termed “introns” [Gilbert, W.(1978). Narure (London) 271, 5011. Intervening sequences are being described and characterized so rapidly that the references below are but a guide to recent developments. In eukaryotes, introns are now known in the B-globin genes of human [Flavell, R. A., Kooter, J. M.,DeBoer, E., Little, P. F. R., and Williamson, R. (1978). Cell 15, 25; Mears, J. G., Ramirez, F., Leibowitz, D., and Bank, A. (1978). Cell 15, 151, rabbit [Van Den Berg, J., Van Doyen, A,, Mantei, N., Schambock, A., Grosveld, G., Flavell, R. A., and Weissmann, C. (1978). Nature (London) 276, 371, and mouse [Tilghman, S. M., Curtis, P. J., Tiemeier, D. C., Leder, P., and Weissmann, C. (1978). Proc. Narl. Acad. Sci. U.S.A. 75, 1309; Tiemeier, D. C., Tilghman, S. M., Polsky, F. I., Seidman, J.

SATELLITE DNA AND HETEROCHROMATIN

105

G., Leder, A., Edgell, M. H.,and Leder, P. (1978). Cell 14, 2371, the ovalbumin gene of the chicken [Breathnach, R., Mandel, J. L., and Chambon, P. (1977). Nature (London)270, 314; Lai, E. C., Woo, S. L. C., Dugaiczyk, A., Catteral, J. F., and O’Malley, B. W. (1978). Proc. Narl. Acad. Sci. U.S.A. 75, 2205; Garapin, A. C., Lepennec, J. P., Roskam, W., Penin, F., Cami, B., Krust, A., Breathnach, R., Chambon, P., and Kourilsky, P. (1978). Nature (London)273, 349; McReynolds, L., O’Malley, B. W., Nisbet, A. D., Fothergill, J. E., Givol, D., Fields, S., Robertson, M., and Brownlee, G. G. (1978). Nature (London) 273, 723; Dugaiczyk, A., Woo, S. L. C., Lai, E. C., Mace, M. L., McReynolds, L., and O’Malley, B. W. (1978). Nafure (London) 274, 328; Catteral, J . F., O’Malley, B. W., Robertson, M. A., Staden, R., Tanaka, Y.,and Brownlee, G. G. (1978). Nature (London) 275, 5101, the A immunoglobulin gene of the mouse [Tonegawa, S., Maxam, A. M., Tizard, R., Bernard, O., and Gilbert, W. (1978). Proc. Natl. Acad. Sci. U . S . A . 75, 14851, and two tRNA genes of yeast [O’Farrell, P. Z., Cordell, B., Valenzuela, P., Rutter, W. J., and Goodman, H. M. (1978). Nature (London)274,4381. Inserts of varying length have also been described in the 28s ribosomal genes of Drosophila meianogaster [Wellauer, P. K., Dawid, I. B., and Tartof, K. D. (1978). Cell 14, 2691. Not all genes however contain introns. The histone genes of the sea urchin Psammechinus miliaris [Schaffner, W ., Kunz, G., Daetwyler, H., Telford, J., Smith, H. O., and Birnstiel, M. L. (1978). Cell 14, 6551 and the 5s genes of Xenopus iuevis are not interrupted [Miller, J. R., and Brownlee, G. G. (1978). Nature (London) 275, 5561. A different form of split gene is found in the immunoglobulin A gene of mouse. The DNA sequences coding for the Variable (V) and Constant (C) regions of the gene are separated by a long stretch of DNA in the embryo but are found in close proximity in bone mmw-derived lymphocytes [Rabbitts, T. H., and Forster, A. (1978). Cell 13,319; Brack, C., Hirama, M., Lenhard-Schuller, R., and Tonegawa, S. (1978). Cell 15, 11. Here then DNA sequences which are initially separated are later brought together by the loss of an intervening sequence during normal cell differentiation. This example indicates that gene sequences in euchromatin can be excised and parallels, in a more restricted sense, the excision of interstitital heterochromatin from the chromosomes of Cyclops during the early cleavage divisions (see Section 11, p. 23). NOTE2. GENOME ORGANIZATION

In the fungus, Aspergillus nidulans, 97-98% of the genome consists of unique sequences while the remainder can be accounted for by ribosomal cistrons [Timberlake, W. E. (1978). Science 202, 9731. Thus some fungi differ quite remarkably from other eukaryotes not only in terms of their gross DNA organization but presumably also in the processes of gene regulation. This holds in spite of their

106

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

possessing a regular meiotic mechanism and coordinately controlled, unlinked, gene sets. The only sensible alternative is that the interspersion of repeated with unique DNA found in most eukaryotes has little to do with gene regulation, so that the processes would in fact be similar in all eukaryotes. NOTE3. UNEQUAL EXCHANGE Streeck and Zachau have analyzed three of the major satellite DNAs present in the calf genome by restriction endonuclease digestion [Streeck, R. E., and Zachau, H. G. (1978). Eur. J . Biochem. 89,2671. Satellite I(1.715 gm/cm3)has a major 1410 bp repeat, satellite I1 (1.723 gm/cm3) has a 45 bp repeat, while satellite I11 (1.706 gm/cm3) has a structure containing not only long- and shortrange periodicities but, additionally, a small part of it has no apparent regular periodicity at all. The long-range periodicity is of 2350 bp, whereas the shortrange ones are based on 22 and 11 bp. However, when satellite I11 is digested with either Alu or Sau 3A approximately 14% of the DNA yields fragments with no apparent regular periodicity. This irregular fraction is not found in the other two satellites. It will be of considerable interest to determine whether this fraction of satellite 111 which gives irregular cleavage patterns with Alu and Sau 3A is “conserved” in the sense of the library hypothesis of Salser. While it is fairly easy to imagine amplification of a given sequence in a “library,” it is more difficult to reconcile the heterogeneity of this portion of the satellite with a library component. Nevertheless, it is readily testable, since the library would predict retention of this irregular A h and Sau 3A pattern in the close Rlatives of the calf. In asking about the evolution of these three satellites in terms of the conventionally discussed mechanisms, namely (a) saltation followed by random divergence or (b) unequal exchange, Streeck and Zachau have argued that certainly neither the Alu nor Sau 3A patterns conform to a strict model of amplification followed by random divergence for satellite 111. They also find it difficult to account for such cleavage patterns by unequal crossing-over and go on to suggest that some of the assumptions inherent in both fashionable models may not have general validity. They therefore invoke nonrandom processes, such as selection and heterochromatin organization, in the evolution of such DNAs. Although it has long been recognized from both cytological and genetic experiments that conventional crossing-over does not occur in heterochromatin, it is only recently that this has been vindicated in molecular terms [Hotta, Y.,and Stern, H. (1979). Chromosomu, 69, 3231. These authors have shown that while both mouse satellite DNA and three human satellite DNAs (I, 11, and 111) incorporate radioactive label in the S phase of meiosis, they do not do so at pachytene. These results provide strong molecular evidence for the lack of meiotic recombination in heterochromatin since pachytene repair synthesis has been implicated in

SATELLITE DNA AND HETEROCHROMATIN

107

molecular events leading to crossing-over. Thus when one considers the mechanisms by which satellite DNAs are altered in amount, the only possibilities for unequal exchange are at the premeiotic mitoses or else at the replication division of meiosis itself. Amplification or unequal SCE events at either of these times can be expected to produce heritable changes. NOTE4. SEQUENCE CONSERVATION? A spate of sequencing data from cloned fragments can be expected to appear in the literature in the next year. This will help clarify the question of whether or not there is indeed a genuine conservation of satellite sequences, restriction fragments, spacer sequences, and gene sequences in eukaryotes. It has already been shown that an EcoRl fragment from humans and an equivalent fragment from the African Green Monkey have virtually identical lengths of 171 and 172 bp, respectively [Manuelidis, L., and Wu, J. C. (1978). Nature (London)276, 92; Rosenberg, H., Singer, M., and Rosenberg, M. (1978). Science 200, 3941. However the base sequence order is only 65% homologous. We find it quite surprising therefore that Manuelidis and Wu should argue that there is “quite good conservation” in nucleotide sequence order between these two DNAs. Barnes et ul. compared five different species of the D . melanogaster subgroup and showed that they retained the same buoyant density satellites, but at various reiteration frequencies [Barnes, S. R., Webb, D. A., and Dover, G. (1978). Chromosoma 67, 3411. This “conservation” may be more apparent than real since the 1.688 gm/cm3 satellite of D. yakuba when digested with A h I, gave a quite different repeat length to that of the 1.688 gm/cm3 satellite of D. meianogaster. In this light it is more than interesting to examine the detailed restriction results of Brutlag et al. (1977b) on the cloned 1.688 gm/cm3 satellite of D . melanogaster [Brutlag, D., Carlson, M., Fry, K., and Hsieh, T-S. (1977b). Coldspring Harbor Symp. Quant. Biol. 42, 11371. These authors have shown that there are long regions of this satellite which are missing either HueiII or HinfI sites, and other regions in which these sites are present. In terms of strict conservation, one would need to determine if both these types of periodicity occur in the 1.688 gm/cm3 satellite of other species. It is noteworthy that the 3500 bp spacing of HueIII sites in the DNA of the human Y is absent from that of the Y of the chimpanzee, although homologous DNA sequences are present in both [K. W. Jones, unpublished observations, cited in Cooke, H. (1976). Nature (London)262, 1821. if the apparent changes in the two examples provided by Barnes et al. (1978) and Jones (unpublished) are not spurious (e.g., due to restriction site methylation), then clearly we are witnessing a large-scale structural reorganization within satellite DNA which is not revealed by buoyant density or hybridization analyses. There seems little doubt that as far as satellite sequences are concerned,

108

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

considerable caution needs to be exercised in claiming sequence conservation and then extrapolating to a biologically important conservation of function. The situation is clearer in nonsatellite systems because functional constraints on messenger RNA-producing sequences are more obvious and have a clearer grounding in fact. From direct sequencing of two cloned repeats of Xempus oocyte 5 S RNA, Miller and Brownlee have argued that some form of correction mechanism is likely to be occurring in this 5 S system [Miller, J. R., and Brownlee, G. G. (1978). Nature (London) 275, 5561. They point out that their data “indicates that there are two different degrees of sequence conservation. A functionally important structure like the presumed promotor has its sequence completely conserved. The remainder of the spacer and also, surprisingly, the 5s gene sequence, seem to undergo a considerably lower level of sequence conservation. In at least two species of sea urchin, Psammechinus miliaris and Strongylocentrofus purpurafus, while the coding specificity of the histone genes is relatively unchanged, there can be remarkable differences between different histone repeat types in different individuals of the same species [Overton, G. C., and Weinberg, E. S . (1978). Cell 14,247; Schaffner, W., Kunz, G., Daetwyler, H., Telford, J., Smith, H. O., and Birnstiel, M. L. (1978). Cell 14, 6551. ”

NOTE5 . SATELLITE DNA-NONHISTONE PROTEININTERACTION There is already a claim in the literature that at least one nonhistone protein, obtained from microtubules of the hog brain, binds twice as effectively to mouse satellite DNA in vitro compared to its reaction with mouse main band DNA [Wiche, G., Corces, V. G., and Avila, I . (1978). Nature (London)273, 4031.

ACKNOWLEDGMENTS We have benefited from the encouragement and discussion provided by our colleague Masatoshi Yamamoto. Professor Arnold Bendich kindly read and criticized the manuscript. Sandy Smith and Cathy Porter kindly drew all the illustrations, while Erica Lockwood, Brenda Ballantyne, and Marilyn Miklos typed and retyped the manuscript. We sincerely thank them all.

REFERENCES Aheam, J . N . , Carson, H. L . , Dobzhansky, T., and Kaneshiro, K. Y. (1974). Proc. Narl. Acad. Sci. U.S.A. 71, 901. Altenburger, W., Horz, W., and Zachau, H. G. (1977). Eur. J . Eiochem. 73, 393. Ammermann, D., Steinbruck. G . , Berger, L. V.. and Hennig, W. (1974). Chromosoma 45, 401.

SATELLlTE DNA AND HETEROCHROMATIN

109

Appels, R., and Peacock, W. J. (1978). Int. Rev. Cyrol. (in press). Arnason, U. (1974). Heredirus 77, 1. Amghi, F. E., Hsu, T. C., Pathak, S., and Sawada, H. (1974). Cytogener. Cell Genet. 13, 268. Arrighi, F. E., Stock, A. D., and Pathak, S. (1976). Chromosomes Today 5, 323. Ayonoadu, U . , and Rees, H. (1968). Generica (The Hague) 39, 75. Baimai, V. (1975a). Can. J. Genet. Cyrol. 17, 15. Baimai, V. (1975b). Experientia 31, 779. Baimai, V. (1977). Generics 85, 85. Baker, W. K. (1968). Adv. Genet. 14, 133. Baker, W . K. (1971). Proc. Narl. Acad. Sci. U . S . A . 68, 2472. Barlow, P. W . (1973a). Humangenerik 17, 105. Barlow, P. W. (1973b). British Soc. Dev. Biol. Symposium. The Cell Cycle in Development and Differentiation, p. 133. Barlow, P. W., and Vosa, C. G. (1970). Chromosoma 30, 344. Baverstock, P. R., Watts, C. H. S., and Hogarth, J. T. (1976). Chromosoma 57, 397. Baverstock, P. R . , Watts, C. H. S . , and Hogarth, J. T. (1977). Chromosoma 61, 227. Beermann, S. (1977). Chromosoma 60, 297. Bendich, A. J., and Anderson, R. S. (1974). Proc. Narl. Acad. Sci. U . S . A . 71, 1511. Bendich, A. J., and Anderson, R. S. (1977). Biochemisrry 16, 4655. Bendich, A. J . , and Taylor, W. C. (1977). Planr Physiol. 59, 604. Bennett, M. D. (1971). Proc. R. Suc. London, Ser. B 178, 277. Bennett, M. D. (1976). Curr. Chromosome Res., Proc. Kew Chromosome Conf., 1976 p. 151. Bennett, M. D., Gustafson, J. P., and Smith, J. B. (1977). Chromosoma 61, 149. Biro, P. A., Carr-Brown, A.. Southern, E.M., and Walker, P. M. B. (1975). J . Mol. Biol. 94,71. Bostock, C. J . , and Christie, S. (1974). Chromosomu 48, 73. Bostock, C. I . , and Christie, S. (1975). Chromosoma 51, 25. Bostock, C. J . , Prescott, D. M.,and Hatch, F. T. (1972). Exp. Cell Res. 74, 487. Botchan, M. R . (1974). Nature (London) 251, 288. Brandham, P. E., and Bhattatai, S. (1977). Chromosoma 64, 343. Bridges, P. N. (1942). J. Hered. 33, 403. Britten, R. J . , and Kohne, D. E. (1968). Science 161, 529. Brousseau, G. E. (1960). Genetics 45, 257. Brown, S. W. (1966). Science 151, 417. Brutlag, D., Appels, R.,Dennis, E. S., and Peacock, W. J. (1977a). J . Mol. Biol. 112, 31. Brutlag, D., Carlson, M., Fry,K., and Hsieh, T. (1977b). Cold Spring Harbor Symp. Quanr. Bioi. 42 1137. Cameron, F. M., and Rees, H. (1967). Heredity 22, 446. Carlson, M., and Brutlag, D. (1977). Cell 11, 371. Carson, H. L., Clayton, F. E., and Stalker, H. D. (1967). Proc. Narl. Acad. Sci. U . S . A . 57, 1280. Cattanach, B . M. (1975). Annu. Rev. Genet. 9, 1. Chang, C. C., and Kikudome, G. Y . (1974). Genetics 77, 45. Chilton, M. D., and McCarthy, B. J. (1973). Generics 74, 605. Comings, D. E., Hams, D. C., Okada, T. A., and Holmquist, G. P. (1977). Exp. Cell Res. 105, 349. Cooke, H. I . (1975). J. Mol. Biol. 94, 87. Cooper, J . E. K . (1977a). Can. J . Genet. Cyrol. 19, 537. Cooper, J. E. K . (1977b). Chromosoma 62, 269. Cooper, K. W. (1956). Genetics 41, 242. Cooper, K . W. (1959). Chromosoma 10, 535. Cooper, K . W. (1964). Proc. Natl. Acad. Sci. U.S.A. 52, 1248.

110

BERNARD JOHN AND GEORGE L. GABOR MIKU)S

Cordeiro, M.,Wheeler, L., Lee, C. S., Kastritsis, C. D., and Richardson, R. H. (1975). Chromosoma 51, 65. Cordeiro-Stone, M., and Lee, C. S. (1976). J . Mol. Biol. 104, 1. Corneo, G . (1976). Evol. Theory 1, 261. Craddock, E. M. (1973). Generics 74, S55 (abstr.). Craig-Holmes, A. P., Moore, F. B., and Shaw, M. W. (1973). Am. J . Hum. Gener. 25, 181. Craig-Holmes. A. P.,Moore, F. B., and Shaw, M. W. (1975). Am. J . Hum. Genet. 27, 178. Creasy, M. R., Crolla, J. A., and Alberman, E. D. (1976). Hum. Genet. 31, 177. Davidson, E. H., Klein, W. H., and Britten, R. J. (1977). Dev. B i d . 55, 69. Davies. P. 0. L.,Rees, H. (1975). Heredity 35, 337. Deaven, L. L.,Vidal-Rioja, L.,Jett, J. H., and Hsu, T. C. (1977). Cytogenet. Cell Gener. 19,241. Dev, V. G., Miller, D. A., Tantravahi, R., Schreck, R. R., Roderick, T. H., Erlanger, B. F., and Miller, 0. J . (1975). Chromosoma 53, 335. Dover, G. A. (1975). Chromosoma 53, 153. Dover, G. A., and Riley, R. (1977). Philos. Trans. R. Soc. London, Ser. B 277, 313. Dykes, G., Bambara, R., Marians, K.,and Wu, R. (1975). Nucleic Acids Res. 2, 327. El-Gadi, A., and Elkington, T. T. (1975). Chromosoma 51, 19. Endow, S. A. (1977). J . Mol. B i d . 114, 441. Endow, S. A., and Gall, J. G. (1975). Chromosoma 50, 175. Endow, S. A,. Polan, M. L., and Gall, J. G. (1975). J . Mol. B i d . 96, 665. Evans, G. M., and Rees, H. (1971). Nature (London) 233, 350. Fashing, N. J. (1973). 1. Mammal. 54, 1018. Fergusom-Smith, M. A. (1977). Rec. Adelaide Child. Hosp. 1, 278. Fillon, W. G. (1974). Chromosoma 49, 51. Fittler, F. (1977). Eur. J . Biochem. 74, 343. Flamm, W. G. (1972). Inr. Rev. Cytol. 32, 1. Fry, K.,and Salser, W. (1977). Cell 12, 1069. Fry, K.,Poon, R., Whitcome, P., Idriss, J., and Salser, W. (1973). Proc. Narl. Acad. Sci. V.S.A. 70, 2642. Gall, J. G., and Atherton, D. D. (1974). J . Mol. B i d . 85, 633. Gall, J. G., Cohen, E. H., and Polan, M. L. (1971). Chromosoma 33, 319. Galloway, S. M., and Evans, H. J. (1975). Cyrogener. Cell Gene?. 15, 17. Gamperi, R., Vistorin, G., and Rosenkranz, W. (1976). Chromosoma 55, 259. Gatti, M., Pimpinelli, S., and Santini, G. (1976). Chromosoma 57, 351. Geraedts, 1. P. M., Pearson, P. L., Ploeg. M. V. D., and Vossepoel, A. M. (1975). Exp. Cell Res. 95, 9. Gerstel, D. V., and Bums, J . A. (1967). Generics 56, 483. Gilbert, W.. Majors, J., and Maxam, A. (1976). In "Organization and Expression of Chromosomes" (V. G . Allfrey er a l . , eds.), pp. 167-178. Dahlem Konferenzen, Berlin. Gill, B. S., and Kimber, G. (1974). Proc. Narl. Acad. Sci. U.S.A. 71, 1247. Gosden, J. R., Mitchell, A. R., Buckland. R. A., Clayton, R. P.,and Evans, H. J. (1975). Exp. Ceff Res. 92, 148. Gosden, J. R.,Mitchell, A. R., Seuanez. H. N.,and Gosden, C. M. (1977). Chromosoma 63,253. Grell, R. F. (1972). Drosophila lnf. Serv. 48, 69. Hall, B. (1965). Hereditas 52, 334. Hatch, F. T., and Mazrimas, J. A. (1974). Nucleic Acids Res. 1, 559. Hatch, F. T., Bodner, A. J., Mazrimas, J. A., and Moore, D. H. (1976). Chromosoma 58, 155. Hazen, M. W., Kuo, M. T., and Arrighi, F. E. (1977). Chromosoma 64, 133. Heitz, E. (1928). Jahrb. Wiss. Bor. 69, 762.

SATELLITE DNA AND HETEROCHROMATIN

111

Hennig, W. (1972). 1.Mol. Eiol. 71, 407. Hennig, W. (1973). fnr. Rev. Cyrol. 36, 1. Hennig, W., and Walker, P. M. B. (1970). Nature (London) 225, 915. Hennig, W.. Hennig, I., and Stein, H. (1970). Chromosoma 32, 31. Hennig, W.. Meyer, G. F., Hennig, I . , and Leoncini, 0. (1973). ColdSpring HarborSymp. Quant. Eiol. 38, 673. Hess, 0. (1973). Cold Spring Harbor Symp. Quant. Eiol. 38, 663. Hewitt, G. M. (1967). Chromosoma 21, 285. Hewitt, G. M., and John, B. (1965). Heredity 20, 123. Hewitt, G. M., and John, B. (1967). Chromosoma 21, 140. Hewitt, G. M., and John, B. (1968). Chromosoma 25, 319. Hilliker, A. J. (1976). Genetics 83, 765. Hochman, B. (1973). Cold Spring Harbor Symp. Quant. Eiol. 38, 581. Hoehn, H., Au, K., Karp, L. E., and Martin, G. M. (1977). Hum. Genet. 35, 163. Holmquist, G. P. (1975a). Chromosoma 49, 333. Holmquist, G. P. (1975b). Nature (London) 257, 503. Holmquist, G. P., and Comings, D. E . (1975). Chromosoma 52, 245. Horz, W., and Zachau, H. G. (1977). Eur. J. Eiochem. 73, 383. Horz, W., Hess, I., and Zachau, H. G. (1974). Eur. J . Eiochem. 45, 501. Hsu, T. C. (1975). Genetics 79, 137. Hsu, T. C., and Arrighi, F. E. (1971). Chromosoma 34, 243. Jacobs, P. A. (1972). Proc. Int. Congr. Hum. Genet., 4th, 1971 p. 232. John, B. (1973). Chromosoma 44, 123. John, B. (1976). Chromosoma 54, 295. John, B., and Freeman, M. (1975). Chromosoma 53, 283. John, B., and Freeman, M. (1976). Chromosoma 55, 105. John, B., and Hewitt, G. M. (1965a). Chromosorna 16, 548. John, B., and Hewitt, G. M. (1965b). Chromosoma 17, 121. John, B., and Hewitt, G. M. (1966). Chromosoma 18, 254. John, B., and Hewitt, G. M. (1967). Chromosoma 20, 155. John, B., and Hewitt, G. M. (1968). Chromosoma 25, 40. John. B., and Hewitt, G. M. (1969). Chromosoma 28, 73. John, B., and King, M. (1978). Chromosoma 65, 159. Johnson, W.E., and Selander, R. K . (1971). Syst. 2001. 20, 377. Jones, K. W. (1970). Nature (London) 255, 912. Jones, K. W. (1977). In “Molecular Structure of Human Chromosomes” (J. Yunis. ed.), pp. 295-326. Academic Press. New York. Jones, R. N., and Brown, L. M. (1976). Heredity 36, 91. Jones, R. N., and Rees, H. (1967). Heredity 22, 333. Jones, R. N., and Rees, H. (1969). Heredity 24, 265. Kabak, M. M., and Bernstein, L. H. (1970). Ann. N . Y . Acad. Sci. 171, 526. Kao-Huang, Y., Revzin, A,, Butler, A. P., O’Connor, P., Noble, D. W., and von Hippel, P. H. (1977). P r m . Natl. Acad. Sci. U . S . A . 74, 4228. Kato, H. (1976). Int. Rev. Cytol. 49, 5 5 . Keyl, H. G. (1961). Chromosoma 12, 26. Keyl, H. G. (1965). Chromosoma 17, 139. Khush, G. S. (1973). “Cytogenetics of Aneuploids.” Academic Press, New York. Khush, G. S., Rick, C. M., and Robinson, R. W. (1965). Science 145, 1432. Kingsbury, D. T. (1969). J. Eacteriol. 98, 1400.

112

BERNARD JOHN AND GEORGE L. GABOR M I K M S

KlBsterskB, I., Natarajan, A. T.,and Ramel, C. (1974). Chromosoma 44, 393. Klein, A. S., and Eckhardt, R. A. (1976). Chromosoma 57, 333. Kumit, D.M., and Maio, J. J. (1974). Chromosoma 45, 387. Kurnit, D. M., Shafit, B. R., and Maio, J. J. (1973). J. Mol. Biol. 81, 273, Laird, C.D.(1973). Annu. Rev. Genet. 7 , 177. Lauth, M. R., Spear, B. B., Heumann, J., and Prescott, D. M. (1976). Cell 7, 67. Leoncini, 0.(1977). Chromosoma 63, 329. Lin, M. S . , and Davidson, R. L. (1974). Science 185, 1179. Lindsley, D. L., and Grell, E. H. (1968). Carnegie Int. Washington Publ. 627. Lohe, A. R. (1977). Ph.D. Thesis, Australian National University, Canberra. Longley, A. E., and Kato, T. A. (1965). International Center for the improvement of maize and wheat, Mexico. Res. Bull. 1, I . Lubs, H. A., and Ruddle, F. H. (1971). Nature (London) 233, 134. McConaughy, B. L., and McCarthy, B. J. (1970). Biochem. Genet. 4, 425. Maio, J. J. (1971). 1. Mol. Biol. 56, 579. Maio, J. J . . Brown, F. L., and Musich, P. R. (1977). J. Mol. Biol. 117, 637. Manteuil, S., Hamer, D. H., and Thomas, C. A. (1975). Cell 5, 413. Manuelidis, L. (1978a). Chromosoma 66, 1. Manuelidis, L. (1978b). Chromosoma 66, 23. Marks, G. E., and Schweizer, D. S. (1974). Chrornosoma 44, 405. Martin, 1. (1966). Am. Nat. 100, 157. Marx, K. A., and Hearst. J. E. (1975). J . Mol. Biol. 98, 355. Marx, K. A., Allen, J. R., and Hearst, J. E. (1976a). Biochim. Biophys. Acra 425, 129. Marx, K. A., Allen, J. R., and Hearst, J. E. (1976b). Chromosoma 59, 23. Mascarello, J. T., and Hsu. T. C. (1976). Evolution 30, 152. Mascarello, 1. T., and Mazrimas, J. A. (1977). Chromosoma 64, 207. Mascarello, J. T., Stock. A. D., and Pathak, S. (1974). J. Mammal. 55, 695. Mazrimas. J. A., and Hatch, F. T. (1972). Nature (London), New Biol. 240, 102. Mazrimas, J . A., and Hatch, F. T. (1977). Nucleic Acids Res. 4, 3215. Miklos, G. L. G., and Nankivell, R. N. (1976). Chromosoma 56, 143. Miklos, G. L. G., and John, B. (1979). Am. J. Hum. Genet. (in press). Miller, D. A. (1977). Science 198, 1116. Morgan, L. V . , Bridges, C. B., and Schultz, J. (1936). CarnegieInst. Washington Publ. 35, 289. Moritz, K. B., and Roth, G. E. (1976). Nature (London) 259, 55. Motara, M. A., and Rai, K. S. (1977). Chromosoma 64, 125. Muller, H., Klinger, H. P., and Glasser, M. (1975). Cytogenet. Cell Genet. IS, 239. Murray, J. D., and Kitchin. R. M. (1976). Experienria 32, 307. Musich, P. R . , Maio, J. J . , and Brown, F. L. (1977). J . Mol. B i d . 117, 657. Nagl, W.(1974). Nature (London) 249, 53. Nel. P. M. (1973). Theor. Appl. Genet. 43, 196. Olmo, E., and Morescalchi, A. (1975). Experienria 31, 804. Olmo, E., and Morescalchi, A. (1978). Experientia 34, 44. O’Neill, M. C. (1977). Nucieic Acids Res. 4, 4439. Oshima, C. (1966). Mod. B i d . 9, 185. Pardue, M. L., and Gall, J. G. (1970). Science 168, 1356. Pathak, S.. Hsu, T. C., and Amghi, F. E. (1973). Cytogemt. Cell Genet. 12, 315. Patterson, J. I., and Stone, W. S. (1952). “Evolution in the Genus Drosophila.” Macmillan, New York. Pavan, C., and Perondini, A. L. P. (1967). Exp. Cell Res. 48, 202. Peacock, W . J . , and Miklos, G. L. G. (1973). Adv. Genet. 17, 361.

SATELLITE DNA AND HETEROCHROMATIN

113

Peacock, W. J., Brutlag, D., Goldring, E., Appels, R., Hinton, C. W., and Lindsley, D. L. (1973). Cold Spring Harbor Symp. Quanr. Biol. 38, 405-416. Peacock, W. J., Appels, R., Dunsmuir, P., Lohe, A. R., and Gerlach, W. L. (1977a). Inr. Cell Biol., Pap. Int. Congr.. 1st. 1976 494-506. Peacock, W.J., Lohe, A. R., Gerlach, W. L., Dunsmuir, P.,Dennis, E. S., and Appels. R. (1977b). Cold Spring Harbor Symp. Quanr. Biol. 42, 1121. Pimpinelli, S.,Santini, G., and Gatti. M. (1976). Chromosoma 57, 377. Prescott, D. M., Murti, K. G., and Bostock, C. J. (1973). Nature (London) 242, 597. Pmunier, W. S. (1975). Can. J. Zool. 53, 1638. Ranjekar, P. K.,Lafontaine, J. G., and Pallotta, D. (1974). Chromosoma 48, 427. Rendel, J. M. (1968). “Canalisation and Gene Control.” Academic Press, New York. Rhoades, M. M. (1968). In “Replication and Recombination of Genetic Material” (W. J. Peacock and R. D. Brock, eds.), pp. 229-241. Aust. Acad. Sci. Canberra. Rhoades, M. M. (1978). In “Maize Breeding and Genetics” (D. B. Walder, ed.), pp. 641-671. Wiley (Interscience), New Yo&. Rice, N. R., and Strauss, N. A. (1973). Proc. Narl. Acad. Sci. U.S.A. 70, 3546. Rimpau, J., and Flavell, R. B. (1975). Chromosoma 52, 207. Rosenberg, H., Singer, M., and Rosenberg, M. (1978). Science 200, 394. Salser, W., Bowen, S . , Browne, D., El Adli, F., Fedoroff, N., Fry, K.,Heindell, H., Paddock, G., Poon. R.. Wallace, B., and Whitcome, P. (1976). Fed. Proc.. Fed. Am. SOC.Exp. Biol. 35, 23. Schmid, W. (1967). Arch. Julius Klaus-Stifr. Verebungsforsch., Sozialanthropol. Rassenhyg. 42, 1. Schroeter, G. L., and Hewitt, G. M. (1974). Can. J . Genet. Cyrol. 16, 285. Seabright, M., Gregson, N., and Mould, S. (1976). Hum. Genet. 34, 323. Sederoff, R., Lowenstein, L.. and Birnboim. H. C. (1975). Cell 5, 183. Setzer, H. W. (1949). Publ. Mus. Nar. Hisr. Vniv. Kans. 1, 473. Shaw, D. D. (1971a). Chromosoma 30, 326. Shaw, D. D. (1971b). Chromosoma 34, 19. Shen, C. J., and Hearst, J. E. (1977). J . Mol. Biol. 112, 495. Shen, C. J., Wiesehahn, G., and Hearst, J. E. (1976). Nucleic Acids Res. 3, 931. Skinner, D. M. (1977). Bioscience 27, 790. Skinner, D. M., Beattie, W. G., Blattner, F. R., Stark, B. P., and Dahlberg, J. E. (1974). Biochemisrty 13, 3930. Smith, G. P. (1976). Science 191, 528. Smith, S. G., and Virrki, N. (1978). Anim. Cyrogener. 3, 5 (B. John, ed.). Gebriider Borntraeger, stungm. Southern, D. 1. (1967). Chromosoma 21, 272. Southern, D. 1. (1970). Chromosoma 30, 154. Southern, E. M. (1970). Nature (London) 227, 794. Southern, E. M. (1975). J . Mol. Biol. 94, 51. Stebbins, G. L. (1966). Science 152, 1463. Stock, A. D. (1974). J . Mammal. 55, 505. Stuttevant, A. H., and Beadle, G. W. (1936). Generics 21, 554. Sueoka, N., and Cheng, T. Y . (1962). Proc. Nart. Acad. Sci. U.S.A. 48, 1851. Suzuki, D. T. (1963). Genetics 48, 1605. Suzuki, D. T. (1973). Gener. Lecr. 3, 7. Oregon State Univ. Press. Tartof, K . D. (1973). Cold Spring Harbor Symp. Quant. Biol. 38, 963. Tartof, K . D. (1975). Annu. Rev. Gener. 9, 355. Therkelsen, A. J., Jensen, 0. M., Jonasson, J., Lamm. L. U., Lauritsen, J. G., Lindsten, J., and Petersen, G. B. (1973). In “Chromosome Identification” (T. Caspersson, and L. Zech, eds.), p. 251. Academic Press, New York.

114

BERNARD JOHN AND GEORGE L. GABOR MIKLOS

Viinika, Y. (1973). Hereditas 75, 207. Voelker, R. A., and Kojima, K . (1971). Evolution 25, 119. Vosa, C. G.(1973). Chromosoma 43, 269. Vosa, C. G . (1976). Chromosoma 57, 119. Vosa, C. G . , and Barlow, P. W. (1972). Caryologia 25, 1. Walker, P. M. B. (1968). Nature (London) 219, 228. Walker, P. M. B. (1972). Prog. Biophys. Mol. Biol. 23, 145. Walker, P. M. B., Flamm,W. G., andMcLaren, A. (1969). In “HandbookofMolecularCytology” (A. Lima-de-Faria, ed.), p. 53. North-Holland Publ., Amsterdam. Ward, B. L., and Heed, W. B. (1970). J. Hered. 61, 248. Ward, E. J. (1973). Chromosoma 43, 177. Waterbury, A. M. (1972). Ph.D. Thesis, University of California, Davis. Wellauer, P. K.,Dawid, 1. B., Brown, D. D., and Reeder, R. H. (1976a). J . Mol. Biot. 105,461. Wellauer, P. K., Reeder, R. H., Dawid, 1. B., and Brown, D. D. (1976b). J . Mol. Biol. 105,487. Wells, R. D., Larson, J. E.,Grant, R. C., Shortle, B. E.,and Cantor, C. R. (1970). 1. Mol. Biol. 54, 465.

Westerman, M. (1969). Chromosoma 26, 7. Westerman, M. (1970). Heredity 25, 662. Westerman, M., and Dempsey, J. (1977). Ausr. J . Biol. Sci. 30, 329. Wheeler, L. L., and Altenburg, L. C. (1977). Chromosoma 62, 351. White, M. J. D. (1954). “Animal Cytology and Evolution,” 2nd ed. Cambridge Univ. Press, London and New York. White, M. J. D. (1977). “Animal Cytology and Evolution,” 3rd ed. Cambridge Univ. Press, London and New York. Wolf, B. E. (1968). Seminar on Chromosomes, Nucleus (Calcurra) 145. Wolf, B. E. (1973). Chromosomes Today 4, 169. Wolf, B. E., and Wolf, E. (1969). Chromosomes Today 2, 44. Yamamoto, M. (1978). Ph.D. Thesis, Australian National University, Canberra. Yamamoto, M., and Miklos, G. L. G. (1977). Chromosoma 60, 283. Yamamoto, M., and Miklos, G . L. G . (1978). Chromosoma 66, 71. Yasmineh, W. G., and Yunis, J. J. (1973). Exp. Cell Res. 81, 432. Yosida, T . H. (1975). Proc. Jpn. Acad. 51, 659. Yosida, T. H., and Sagai, T. (1975). Chrornosoma 50, 283. Yunis, J. J., and Yasmineh, W. G . (1971). Science 174, 1200. Zarchi, Y., Simchen, G., Hillel, J., and Schaap, T. (1972). Chromosoma 38, 77. ZeEeviC, L., and PaunoviC, D. (1969). Chromosoma 27, 198.

.

REVIEW OF CYTOLOOY VOL. 58

1N"ATlONAL

Determination of Subcellular Elemental Concentration through Ultrahigh Resolution Electron Microprobe Analysis THOMAS E . HUTCHINSON Center for Bioengineering. University of Washington. Seattle. Washington 1. Introduction

. . . . . . . . . . . . . . . . . . . .

115

11. Physical Background of Elemental Analysis by Characteristic X-ray

Determination . . . . . . . . . . . . . . . . . . . I11 . Instrumentation Used in Elemental Analysis by Characteristic X-ray Energy Determination . . . . . . . . . . . . . . . . A . Wavelength-Dispersive Analysis . . . . . . . . . . . B . Energy-Dispersive X-ray Spectroscopy . . . . . . . . . C . Eiectron Energy Loss Spectrometry . . . . . . . . . . IV . Critical Reading of the Literature . . . . . . . . . . . . A . State of Tissue Prior to Specimen Preparation . . . . . . 8 . Specimen Preparation . . . . . . . . . . . . . . . C . Conditions of Analysis . . . . . . . . . . . . . . . D . Data Analysis . . . . . . . . . . . . . . . . . . V . Application of Microprobe Analysis to Specific Biological Systems A . Skeletal and Cardiac Muscle . . . . . . . . . . . . B . Smooth Muscle . . . . . . . . . . . . . . . . . C . Lung . . . . . . . . . . . . . . . . . . . . . D . Nerve . . . . . . . . . . . . . . . . . . . . . E . Epithelium . . . . . . . . . . . . . . . . . . . F . Kidney . . . . . . . . . . . . . . . . . . . . G . Calcifiable Tissue . . . . . . . . . . . . . . . . H . Blood . . . . . . . . . . . . . . . . . . . . . 1. Gametes and Developmental Biology . . . . . . . . . J . Chromatin in Mitosis and Aging . . . . . . . . . . . K . Microorganisms . . . . . . . . . . . . . . . . . L . Medical Diagnosis . . . . . . . . . . . . . . . . M . Elements of Particular Interest . . . . . . . . . . . . V I . Methods and Reviews . . . . . . . . . . . . . . . . VII . Conclusions . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

117 120 121 122 125 129 129 130 131 134 134 134

136 137 138 139 141 141 142 144 146 146 147

148 150 151 153

.

I Introduction Examples of mediation of cell function by elemental concentration gradients on a subcellular level are numerous; one which readily comes to mind is the 115

.

Copyright @ 1979 by Acadcmh Press Inc . All rights of reproduction in any form ~ r c w c.d ISBN 0-12--358-9

116

THOMAS E. HUTCHINSON

influence of Ca translocation within muscle cells on the contractile process. It seems probable that many other biological phenomena could be better understood if data were available on the position of elements within cells during particular phases of cell activity. In the past a variety of methods has been used, with varying degrees of success, to determine localized elemental concentrations. These range from delicate techniques using ion-selective microelectrode probes to cell disassembly and selective centrifugation as a means of isolating particular cell organelles. Most of these techniques, however, are fraught with problems. Microelectrodesare selective for only one element per electrode, and the diameter of the region probed is in excess of several micrometers, and the microelectrode technique is thus limited in spatial localization. The limit of sensitivity is in general greater than desirable because of the small size of the region probed. One of the most important relationships in biology is that between the distribution and migration of ions in living systems and subsequent cell function. The technique of cell fractionation, however, yields sufficient quantities of individual components and allows rather precise quantitative chemical analysis, but does not permit analysis of the cell in any form resembling the living state. Cell fractionation also has the serious technical problem of not consistently providing clean preparations of individual organelles within the cell and requires larger numbers of cells for analysis than may be convenient to acquire. The requirement of large numbers of cells also implies that variations in elemental concentration among cells cannot be determined; rather, an average concentration is obtained. As a result, biologists have relied upon rather standard techniques of either chemistry or electrochemistry to make concentration analyses. These techniques, while having excellent limits of detectability for a variety of elements, are highly limited in attainable spatial discrimination and cannot be used to make in vivo analyses without disrupting the system. The physical sciences, on the other hand, have long made use of more sophisticated instrumental techniques for determining elemental concentrations. Among the methods developed is electron-induced x-ray emission with subsequent wavelength or energy determination. Until recently, this method was used mainly by metallurgists and geologists in studying inorganic materials. Lately, however, investigators have come to appreciate the effectiveness of the technique as applied to biological systems. The increasing interest in this application is closely coupled with significant advances in electron optical instrumentation. In particular, scanning electron microscopes have reached a new lower limit of spatial resolution. This is of great significance, since the region of electron microprobe analysis depends, to the first order in thin sections, on the diameter of the electron probe beam. Currently, the smallest electron probe used in conventional scanning transmission electron microscopy is about 2.0 nm, and the smallest probe used in sophisticated field emission electron microscopy is less

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

117

than 0.5 nm. This lower limit of spatial resolution, coupled with the modification by instrument manufacturers of general-purpose instruments to make them useful in this type of examination, makes possible the investigation of subcellular regions of cells and tissue through electron microprobe analysis.

11. Physical Background of Elemental Analysis by Characteristic X-ray Determination The physics of x-ray microanalysis is relatively simple, although the instrumentation required to produce quantitative determinations of elemental concentrations by this technique is quite complex. Electrons striking a specimen give rise to several forms of radiation. Backscattered electrons are emitted as a result of elastic interactions of the incident electrons with the atoms of the specimen and have energies which are virtually unchanged from the incident electron energy. Secondary electrons, which have energies much less than that of the incident electron beam-typically 50 eV or less-are also emitted. These electrons are relatively large in number and are used in scanning electron microscopy (SEM)for image formation. Transmitted electrons are available from thin specimens and s 1 ~ eused for imaging in the transmission mode of operation. Several other types of radiation are emitted which are particularly useful in microanalysis. Incident electrons passing through the specimen may ionize atoms by the removal of electrons. When this ionization occurs, the energy levels of the atoms which have been depopulated are available to higher-energy-level electrons which then occupy these vacancies and therefore experience a reduction in energy. The transition of electrons from higher to lower energy states can result in photon production (probability = o, the fluorescence yield). Since these energy levels are quantum mechanically sharp with respect to energy, a transition between levels gives rise to photons of unique energies characteristic of the energy level arrangement in the target atom. The energy and wavelength of the photons are related by Einstein’s relationship: E = hclk

where E is the energy of the photon, h is Planck’s constant, A is the wavelength, and c is the speed of light. Determination of either the energy or the wavelength of the radiation from a particular characteristic transition allows identification of the element from which the radiation was emitted. Low-energy, long-wavelength radiation gives rise to photons in the visible part of the wavelength spectrum. Analysis of the elemental composition in this case is reduced to the determination, using optical instrumentation, of the emitted wavelength known as the electron-induced photoluminescence. A more widely used technique is detection

118

THOMAS E. HUTCHINSON

FIG. 1 . The energy level configuration of electrons around the nucleus of an atom. Incident electron interaction causes vacancies to occur at lower energy (smaller radius) levels which are filled by higherenergy electrons from outer shells. The difference in energy is compensated for by the production of an x ray characteristic of the transition.

and characterizationof the high-energy, short-wavelength photons classified as x rays. Figure 1 , which considers only the nucleus and surrounding electron shells of an atom of the specimen, illustrates the manner in which characteristic x rays are emitted. When an electron is removed from the K shell by incident electron

Energy of X-ray

FIG.2a.

Phofons In ksV

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

119

interaction, an electron of the L-shell can reduce its energy by dropping to the K level, giving rise to what is termed K, radiation. Alternatively, M-shell electrons can drop to the K-shell, giving rise to K, radiation. The likelihood of L-shell to K-shell transitions is higher than that of N-shell to K-shell transitions. While K, and KBradiations are seen simultaneously during electron bombardment of large numbers of atoms, the intensity of the K, radiation is higher by roughly a factor of 5 for elements of biological interest irradiated with 20 to 100-keV electrons. In

\

\

\

\ \

NUMBER OF PHOTONS \

PI

\ \

X

\

PHOTON NUMBER RECORDED BY X-RAY DETECTOR

BREMSSTRAHLUNG

10

2.0

3.0

4.0

5.0

60

Energy of X- roy Photons in keV

10

2.0 30 40 Energy of X- roy Phclons in keV

50

60

FIG. 2. Spectral components from x-ray energy analysis showing characteristic peaks (a), the bremsstrahlung component, (b) and the combined contributions (c).

120

THOMAS E. HUTCHINSON

addition, since K, photons arise from L-K transitions which are lower in energy than M-K transitions, K, radiation is lower in energy than K, radiation. L, radiation occurs when transitions between the M and L shells take place, that is, when an L-shell electron is ejected from the atom. The difference in energy between the M and L shells is less than that between either the L and K shells or the M and K shells, thus L, radiation is lower in energy than K radiation. A spectral diagram is shown in Fig. 2a. The two characteristic peaks seen in this figure arise when the specimen consists entirely of Na and C1 as in a stoichiometric composition of NaCl. The characteristic K, x ray emissions for Na take place at an energy of 1.07 keV and for C1 at 2.6 keV. The gaussian spread in energy indicated in this diagram is due to instrumental noise rather than energy uncertainty in the characteristic radiation. The area under each of the curves is proportional to the number of atoms excited by the electron beam and thus serves as a basis for quantitative elemental microanalysis using x radiation. The characteristic radiation emitted from the specimen has very sharp characteristic energies. In addition, a continuous radiation, or bremsstrahlung, is emitted as a result of the slowing down of electrons within the specimen. The energy dependence of the bremsstrahlung is shown in Fig. 2b. Since this radiation is not a result of electron transitions within the atoms involved, but is due to a deceleration of the incident electrons themselves, it is continuous in energy. The number of such x-ray photons of all energies is proportional to the incident electron flux and the number of interactions which take place within the specimen. Clearly then, a thin specimen, with which fewer incident electrons interact, yields a lower bremsstrahlung photon number than a thicker specimen and the proportionality between thickness and bremsstrahlung yield can, as suggested by Hall (1968), be used to estimate the thickness of the specimen, which is difficult to measure directly in these studies. The total energy spectrum of x radiation emitted from the specimen is a combination of these two contributions, as shown in Fig. 2c. The sum of the characteristic radiation and the bremsstrahlung comprises the total spectrum of x-ray photons emitted from the specimen.

111, Instrumentation Used in Elemental Analysis by Characteristic X-ray Energy Determination

The instrumentation for ultrahigh resolution elemental microanalysis can be divided into three categories: x-ray wavelength-dispersive spectroscopy, x-ray energy-dispersive spectrometry, and electron energy loss spectroscopy.

DETERMMATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

12 1

A . WAVELENGTH-DISPERSIVE ANALYSIS As noted in the preceding section, the number of x rays having a characteristic energy or wavelength which arise from a specimen is dependent upon both the number of atoms present with the characteristic transitions giving rise to these x-rays and the number of electron-atom interactions which occur. Possibly the oldest form of microanalysis is that which employs high-current, large-diameter electron probes coupled with a wavelength-dispersivespectrometer. A schematic diagram of the wavelength-dispersive system is given in Fig. 3. X rays arising from electron beam interaction with the specimen impinge upon a diffracting crystal. Most of these x-rays are scattered by the diffracting crystal without reinforcement in any particular direction; however, certain x rays which satisfy Bragg’s law:

n h = 2d sin 8 are diffracted with high intensity to the x-ray counter. In Bragg’s equation, A is the wavelength of the characteristic x ray, 8 is the angle between the planes of the diffracting crystal and the incident x ray, and d is the distance between crystal planes in the diffracting crystal. It can thus be seen that, when the angle between the incident x ray and the diffracting crystal, and between the diffracting crystal and the x-ray counter, is set, constructive interference leads to satisfaction of Bragg’s law for selected values of the wavelength. By determining the number of counts entering the x-ray counter as a function of the angle 8 for a known value

r-

m

GAS FLOW X-RAY COUNTER

\

L

ELECTRON BEAM

~

~

DIFFRACTING CRYSTAL

FIG.3. Schematic drawing of a typical wavelengthdispersive x-ray analysis system. X rays having the appropriate wavelength and correct angular acceptance by the diffracting crystal are directed with high intensity to the gas flow x-ray counter which records the presence of the incident x rays. The angle between the x ray incident upon the crystal and the diffracted x ray must be mechanically adjusted to record x rays of differing wavelength.

~

122

THOMAS E. HUTCHINSON

of d, Bragg’s law can be used to generate a counts-versus-wavelength spectrum. The spectrum thus generated is similar to that shown in Fig. 2c. In addition to this spectrum, a continuous x-ray counter is also included in this system, which allows normalization of the generated data as a function of fluctuating electron beam current and other changing parameters. The advantage of the wavelength-dispersive x-ray system lies primarily in the high resolution which can be obtained in separating closely adjacent spectral peaks. Most peaks of biological interest in closely separated wavelength positions in the spectrum can be resolved by this technique, which is not always the case with the energydispersive system, as will be seen in Section III,B. The second advantage of this technique is that the very low-energy x rays from C, N, and 0 can be detected using special high-sensitivity, windowless systems. This is certainly an advantage in certain biological systems but is not necessarily essential to all studies. There are two disadvantages to this technique. First, a very low efficiency for collection of x rays is inherent in the system. This is due to mechanical difficulties in placing the diffracting crystal in such a position that the solid angle, as seen from the specimen, is large. This drawback is apparently unavoidable, and it seems that little can be done to improve the low collection efficiency. The second disadvantage is related to the fact that the system is basically mechanical and is therefore dependent upon setting a particular angle between the diffracting crystal and the specimen; collection of the spectrum is in essence a sequential process. Because of this, the specimen must be exposed to the electron beam for an excessive length of time in order to collect a complete spectrum for several elements. The large losses of elemental constituents which may occur in biological materials under these conditions further complicate the quantitative analysis of subcellular elements using this technique.

B. ENERGY-DISPERSIVE X-RAYSPECTROSCOPY The second technique is energy-dispersive x-ray analysis. This technique depends upon instrumentation which is basically a product of semiconductor technology. X rays of a variety of energies are generated by the specimen and impinge upon a silicon crystal as shown schematically in Fig. 4. This silicon crystal is coated on each side with a thin layer of gold and is isolated from the vacuum of the electron microscope by a thin beryllium window. Upon striking the silicon crystal, the x ray releases its energy in a series of collision events, each of which gives rise to one electron and one positively charged unit known as a hole. A bias voltage of 1000 V exists between the gold layers at the surface of the silicon crystal. As a result, the electrons and holes are attracted to opposite sides of the crystal and collect at the interface, causing a pulse of current to occur. The number of electron-hole pairs generated is directly proportional to the

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

123

DATA STOR&€ -ELECTRON

SOURCE

CMJDENWR LENS1 ELECTRON E A M CONDENSOR LENSH MINCOMPUTER MTA PROCESSOR

I

s,

x - ~ p y I-&ECX)R

LV)

OBJECTIVE LENS SPECIMEN

IMAGING LENSES

DATA INTERRUPTS

FIG.4. Schematic drawing of a modem elemental microanalysis electron microscope. Both the Si-Li energy-dispersive x-ray detector unit and the electron energy loss analysis spectrometer are interfaced with a high-resolution scanning transmission electron microscope to form a complete elemental microanalysis system.

energy of the x ray entering the crystal. Thus the current pulse arising as a result of x-ray absorption within the crystal is proportional to the x-ray energy. The entire crystal is cooled to near liquid N temperature in order to prevent undesirable thermal electron events from occurring which would enter the spectrum as background current. The current pulse is amplified by a field effect transistor, and the resulting signal further amplified by a low-noise solid-state amplifier in an adjacent console. The pulse is converted from a current pulse to a voltage pulse, the height of which is proportional to the energy of the incident x ray. The height of this voltage pulse is then measured by a pulse height analyzer and stored in a preselected memory location of a minicomputer. The particular location selected is determined by the height of the pulse and thus the x-ray energy. The information accumulated in the computer after a significant period of time is a spectrum which has as its ordinate the x-ray energy, and as its abscissa the

124

THOMAS E. HUTCHINSON

number of pulses proportional to the number of x rays which entered the silicon crystal of this particular energy. The total spectrum is displayed on a television screen, a diagram of which is shown in Fig. 2c. In general, several data manipulations are performed using the software routines of the minicomputer. Software routines are available which, to a greater or lesser extent, remove the bremsstrahlung background from the characteristic x-ray data. This is a rather extensive and difficult procedure, and a satisfactory routine for full removal of the bremsstrahlung has not yet been perfected. A second manipulation which can be performed is Gaussian peak extraction. In this routine a selected peak in the spectrum can be removed in order to reveal adjacent spectral peaks hidden by shoulders of the primary peak. This is extremely valuable in providing full quantitation with the procedure. In addition, a spectral smoothingroutine can be implemented, which uses averaging techniques in order to make small peaks more obvious. This routine is not considered particularly desirable, since repeated smoothings can actually cause pseudopeaks to occur which arise from noise inherent in the background. In order to obtain fully quantitative data from this technique it is necessary to make a significant number of spectral analyses. The technique of spectral analysis has been discussed extensively by Shuman et al. (19761, and the reader is referred to their article for further details. In summary, however, the method consists of obtaining the Gaussian peak area of the characteristic x-ray emissions by a digitizing routine provided with modem systems. The peak area P is the total area of the peak and contains a certain background component, as seen in Fig. 2c. An estimate is made, either by an automatic computer routine or by visual inspection, of the background component of this peak. The background b is then subtracted from P, the peak area, yielding a total Gaussian peak area proportional to the number of atoms giving rise to the peak. The constant of proportionality is based on &heexcitation efficiency of the particular element, the particular electron shell by which the peak was generated, and the efficiency of the detector in recording x-rays of this energy. Each of these factors enters into the equation determining the concentration. In addition, it is obvious that the total peak area is proportional to the electron dose striking the volume of the specimen. Thus the peak area is proportional to the number of electrons per unit area per unit time which strike the specimen, the time of irradiation, and the total volume of material irradiated. A simple way to normalize these data was suggested by Hall (1971), which makes the use of the bremsstrahlung or white radiation arising from noncharacteristic emission of x rays as outlined in Section I. The bremsstrahlung or white radiation, denoted by W ,is proportional to the total electron dose and the thickness of the specimen. Thus the net concentration of any characteristic element C, is

c, - (P - b)/W

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

125

This equation is valid in the limit of small thicknesses of the specimen (roughly 200 nm) and is known as the thin-film or thin-section approximation. The logic behind this limit is that for thicker specimens x rays arising from emission from higher-atomic number (2)elements can be absorbed by lower-Z elements and give rise to secondary x-ray emissions prior to exit from the specimen. This phenomenon, known as absorption and reemission, yields an anomalously lower than accurate elemental composition for higher-Z elements and correspondingly greater than correct apparent concentrations for lower-Z elements. This effect can be compensated for through the use of a sophisticated theory of x-ray cross section requiring computer analysis (Hall, 1971). With the use of the procedures outlined in this section, it is possible to obtain quantitative concentration data from an energy-dispersive x-ray spectrum through the use of a set of standards. Elemental standards suitable for the quantification of energydispersive x-ray analysis have been fabricated by Chandler (1976) and Spurr (1975), using ionic salts in a polymer matrix. The salt-matrix composite is sectioned into thicknesses within the limit of application of the thin-film approximation. Further studies have been done by Hutchinson and Borek (1977) in which frozen thin-film ionic aqueous solutions were examined in order to calibrate the x-ray spectrum. Each of these standards has particular advantages. The composite method allows examination at room temperature, whereas the method of Hutchinson and Borek requires the use of a cold transfer stage for the examination of standards. The Hutchinson and Borek method more closely approximates frozen hydrated tissue, however. An advantage of the energy-dispersive system over the wavelength-dispersive system is that higher detection efficiencies are possible, since the Si crystal can be moved to within a short distance of the sample, typically on the order of 1 cm. Solid angles of %nhave been attained. A second clear advantage is that the spectrum is obtained simultaneously for elements having atomic numbers greater than that of Na. This much reduces the radiation damage which occurs during the long exposures needed for complete spectra to be obtained from wavelengthdispersive detectors. A major disadvantage is the inability of the system to resolve closely adjacent peaks, however, this has been mitigated to some degree by data manipulation in the computer as outlined above. C. ELECTRON ENERGY Loss SPECTROMETRY

There are two alternative methods for performing elemental analysis of light elements in thin specimens. One is the analysis of Auger electrons emitted from the specimen as a process complementary to x-ray emission. The yield of Auger electrons is just 1 - o per ionization (w = fluorescence yield), so that for low-2 elements there is higher probability of producing an Auger electron than an x ray.

THOMAS E. HUTCHINSON

126

However, because of the small escape depth of Auger electrons, the technique is limited to analysis near the surface, and quantitation is sometimes difficult. Moreover, the small escape depth poses a further experimental difficulty, since thin layers of contamination formed in medium vacuum systems can completely obliterate the Auger electron signal. The technique is therefore limited to use in high-vacuum systems (pressures less than 10-8 torr). The second alternative method of performing elemental analysis of thin specimens of the type used in transmission electron microscopy is to detect electrons which have lost characteristic amounts of energy in producing inner shell ionizations. This is done by placing a spectrometer beneath the specimen to analyze the energy of the electrons transmitted through the specimen. A typical electron energy loss spectrum for a thin film of biological material is shown in Fig. 5 . This experimentally obtained spectrum shows a large, relatively noncharacteristic energy loss peak due to valence shell excitations of about a 20eV energy loss and also characteristic peaks due to the excitation of N and K levels of C in the molecules present (guanine). Detection of the characteristic energy loss of transmitted electrons holds particular advantage for low-Z materials for two reasons. First, for each inner shell ionization, there exists an electron which has been transmitted through the specimen and lost a characteristic amount of energy in producing this ionization, regardless of the fluorescence yield o.That is, the yield of energy loss electrons to inner shell excitations and ionizations is unity. Second, electrons which have lost energy in the event are scattered through relatively small angles, particularly for l o w 2 elements (and correspondingly low-energy inner shell levels). For

/

NITROGEN K I

I

0

25

50

400

300 ENERGY

LOSS lev)

FIG.5 . A typical electron energy loss spectrum from a biological substance. The spectrum was obtained from a thin (--4M) A), sublimed film of guanine with an incident energy of 25 keV. The spectrum shows characteristic energy loss due to excitation of N and K energy levels, of C, as well as the relative intensity of these peaks compared to the -2O-eV energy loss peak due to valence shell excitations. Specturm courtesy of Dr. D. E. Johnson.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

127

instance, half of all electrons in the 10-100 keV energy range which have been inelastically scattered, and have lost an amount of energy E in the process, are scattered into angles smaller than about 2EIEo, where Eo is the incident electron energy. Therefore an electron spectrometer with a limited acceptance angle can still collect an appreciable fraction of the transmitted energy loss electrons. As compared to the situation in x-ray techniques, the net increase in collection efficiency due to the above two factors can be translated directly into an increase in elemental sensitivity or, for detection of a given concentration, into an increase in spatial resolution. The improvement in spatial resolution is possible because, with improved collection efficiency, less incident current (and thus smaller probe sizes) can produce the same count rate. A detailed analysis and experimental verification by Isaacson and Johnson (1975) indicates that, for example, over a range of atomic numbers from Z = 6 to Z = 20 the energy loss technique should be able to detect concentrations from 40 to 10 times smaller than the energy-dispersive x-ray technique for a given spatial resolution. And, for example, in the case of a hot-filament electron source where the beam current is a (beam this increase in sensitivity could also be used to increase the spatial resolution by a factor of from 5 to 15 for a fixed concentration. This assumes that the minimum concentration detectable is a (beam current)-1’2 (Isaacson and Johnson, 1975). It should also be pointed out that without special techniques (e.g., windowless detectors) the energy-dispersive technique cannot detect elements below Z = 11 (Na). The energy loss technique, however, becomes more sensitive with lower Z values, and F1, for example, can be detected easily using energy loss electrons. Since Fl is used as a biological marker, its quantitative detection can be useful. In fact, fluorinated serotonin has recently been localized in human platelets by energy loss spectrometry. An example of the use of energy loss electrons to determine the location of S-labeled serotonin in platelets is shown in Fig. 6. An additional and potentially useful aspect of electron energy loss spectroscopy for microanalysis is that very highenergy resolution can be maintained in the energy loss spectrum. One immediate application of such high-energy resolution is the observation of fine structure at the leading edge of inner shell energy loss events. Isaacson and Johnson (1975), with an energy resolution of 0.2-0.5 eV, observed such fine structure in the transmitted energy loss electron spectra at the energy loss peak due to the excitation of K-shell electrons in the C atoms of six nucleic acid bases. The spectra have been correlated by Isaacson and Johnson (1975) with the amount of charge on each C atom and interpreted as transitions from the different bounding states of C in these molecules to single-bond excited states. With the use of this fine structure it may be possible to use the energy loss technique not only to measure elemental concentrations in small volumes but also to identify the bounding states of the elements present.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

129

IV. Critical Reading of the Literature Critical reading of the literature is of great importance to investigators in any field of endeavor and is a skill which is naturally developed in a particular field. This critical reading skill may not, however, extend to related and useful fields such as elemental microanalysis. Consequently it is appropriate to point out areas of possible misinterpretation and confusion which may arise in the minds of investigators in related fields when reading elemental microanalysis literature. In addition, since the technique of elemental microanalysis now offers great potential benefits to such a wide range of disciplines, it may be used by investigators unfamiliar with its limitations and possible sources of error. Although many of these points are implicit in the preceding and following sections, a more explicit enumeration of these factors is appropriate. Several critical components are required for successful qualitative and quantitative elemental microanalysis of biological tissue. In general terms these can be stated as retention of elemental spatial position prior to and during elemental analysis, attainment of adequate visualization of the micromophology to identify regions in which elemental localization is required, and analysis of the data produced in such a way that maximum information is gained while extraneous and unrelated information is discarded. These three features of successful analysis are not easily separated with respect to experimental procedure, and no effort has been made in this section to attempt this; however, each of these requirements is treated in an explicit form consistent with its appearance in the experimental procedure.

A. STATEOF TISSUE PRIORTO SPECIMEN PREPARATION Regardless of the method of specimen preparation selected, the state of the tissue prior to this step is critical in retaining elements in the in vivo positions. The condition of the tissue immediately prior to preparation should be as close as possible to that in vivo. A description should be given by the authors of the steps taken to ensure that in vivo conditions exist prior to preparation for electron microscopy. Clearly preparatory steps which induce cell trauma or high ion motion in the cell counteract efforts to localize elements totally in their in vivo state. This includes such techniques as extraction of the cell mass from tissue or host organisms, whether they involve extraction of muscle in such a way as to FIG.6. Electron energy loss elemental mapping of air-dried blood platelets incubated with a S analog of serotonin. The micrograph was taken using 100-kV electrons in a JEOL lOOb electron microscope. The zero-loss image shows the vacuoles and dense bodies. The image was obtained using S,hence the serotonin as being localized in the dense bodies. Micrograph courtesy of Dr. D. C. Joy, Bell Laboratories and Dr. J. L. Costa, National Institutes of Health.

I30

THOMAS E. HUTCHINSON

change the state of the tissue in an uncontrolled way or extraction of microorganisms into an extracellular medium which may induce osmotic transport. The authors should clearly describe steps taken to ensure that such elemental translocation is unlikely.

B. SPECIMEN PREPARATION Three methods previously outlined for the preparation of cells and tissue for electron microscope examination are (1) conventional fixation and dehydration for electron microscope examination, (2) rapid freezing followed by maintenance of hydration during transfer to the electron microscope and examination, and (3) rapid freezing of cells and tissues followed by freeze-sectioning and drying, followed by examination in the electron microscope at low temperatures. 1. Conventional Preparation Techniques for Electron Microscopy

Numerous examples have been described both in this article and in the literature of techniques which employ conventional preparations for electron microscopy. The central feature of these techniques is fixation with gluteraldehyde or other protein-fixing solutions followed by graded dehydration and subsequent staining of protein elements to provide adequate contrast for electron microscopy. In most cases this procedure is the least desirable of the three methods presented, since it involves the use of solutions for volatile constituents, which may change the ionic distribution within the cells unless they are strongly bound either by natural or artificial means to existing proteins. Thus quantification of elemental concentrations using specimen preparation techniques of the conventional variety is subject to question unless strong binding agents for the element of interest is introduced early in the preparation scheme and it is shown by the authors that there is minimal loss of the element during preparation by this technique. Even then possible redistribution during preparation is difficult to disprove. 2 . Frozen Hydrated Thin-Section Preparaiions Numerous questions may arise concerning the validity of the preparation of frozen hydrated thin sections for elemental microanalysis study. Perhaps the most significant among these concerns the degree to which the rapid-freezing technique translocates ions and elements from in vivo positions to the periphery of ice crystals grown during freezing. Evidence should be given by the authors of the degree of crystallinity (i.e., microcrystal size or amorphous structure) accompaning the freezing step, which may be supplied largely by electron diffraction patterns from which the average size of ice crystals can be inferred. The

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

13 1

second concern is the degree of hydration, which can be rather easily discerned from an examination of the diffraction pattern and the existence of regions of low scattering and absorption in the bright-field image obtained by either transmission microscopy or scanning transmission microscopy.

3 . Frozen Dried Tissue Many investigators use frozen dried tissue for the examination of elemental distributions within biological material mainly for two reasons: first, ease of preparation, since this method does not require transfer to or maintenance of frozen hydrated material in the electron microscope and, second, the fact that the loss of water and other volatile constituents from the tissue decreases the signalto-noise ratio compared to that for frozen hydrated tissue and allows the detection of wet weight concentrations of elements much smaller than can be realized in frozen hydrated tissue. In addition, greater contrast is frequently attained through the loss of water, making identification of micromorphological features easier. This can be understood by recognizing that about 80% of average biological tissue is aqueous. Care must be taken when reading articles in which frozen dried tissue is used for elemental distribution analysis, since the freeze-drying method is extremely important in determining the degree of translocation prior to analysis. The authors should state the conditions under which freeze-drying was accomplished, which optimally should be as near the critical temperature of water as possible. c . CONDITIONS OF ANALYSIS Although the tissue is brought to the electron microscope in a state in which translocation of elements within it is precluded and the micromorphology of the tissue is revealed, the conditions of analysis can greatly change either or both of these states. The experimental conditions which should be carefully examined in a critical reading of the literature are outlined here. 1, Electron Beam-Induced Loss of Elements during Analysis

The loss of elements during electron microscope examination and analysis has been documented by Hall and Gupta (1974) and Delgado and Hutchinson (1978). The loss of elements from biological tissue during electron beam-induced x-ray examination has been shown to be great during the time required to collect statistically significant information needed for quantitative analysis of biological tissue. These data of course are normalized with respect to electron dose within a particular area of the specimen. The electron beam dose, considered to be the number of electrons striking a particular area of the specimen, should be stated

132

THOMAS E. HUTCHINSON

by the author and compared to the dose determined by independent studies. To be compensatable for in quantitative analysis, negligible mass loss must occur during this dose period, or the extent of mass loss must be known. These parameters are related to the specimen temperature and the presence or absence of a protective coating on the surface of the specimen, as described by Griffin and Hutchinson (1978). 2. Elemental and Spectral Contamination Two types of contamination can result in nonquantitative results from elemental microanalysis. The appearance of spurious peaks in the spectra may be due to several factors. The first of these is electron-induced x-ray emission from microscope components and specimen constituents, namely, the supporting electron microscope grid, specimen state and carrier, and the imaging lenses of the electron microscope. These may contribute elemental peaks which appear in the resultant spectrum but are not related to the specimen. Authors should state the degree to which these "tramp" peaks are present within the spectrum and the degree to which they have been eliminated from consideration as either constituents of the specimen or contributors to the bremsstrahlung background of the specimen. Each of these conditions can lead to extraneous contributions to the spectrum, which may be wrongly interpreted. A prime example of such an error is the interpretation given by many of the M line of copper interpreted as a concentration of Na, since the region of the spectrum in which they occur is nearly identical. A second type of problem is caused by spurious peaks and contributions to the bremsstrahlung resulting from contamination of the specimen. This contamination may take the form of a buildup of either C or Si at the surfaces of the specimen under investigation, resulting in extraneous Si peaks and more importantly in an inappropriate reading of the bremsstrahlung or white count. An example of the buildup of contaminants is given in Fig. 7. It is clear from this figure that, although the entire contaminant may be C and not appear in the spectrum because of the lower-limit cutoff of the analyzer, its thickness is much greater than the thickness of the specimen and thus it increases the bremsstrahlung radiation, resulting in a white count which makes quantification totally impossible. Authors should state the degree to which contamination occurs and describe experiments which reveal the elemental constituents of the contaminants should they occur. ~

~

~~

~

~

~

~~

FIG.7. Transmission (a) and secondary electron (b) micrographs of contamination formed from residual vapors in the vacuum of an electron microscope. The conical deposit was formed during a lengthy high-intensity exposure of the thin C support film in the microspot mode of operation of the instrument. The diameter of the cone at the base is -100 nm. The transmission micrograph (a) was taken at a 0" tilt, and the secondary electron micrograph (b) at an angle of 42".

134

THOMAS E. HUTCHINSON

D. DATAANALYSIS Several methods have been used for the analysis of spectral data of x-ray microanalysis once generated. Perhaps the most popular of these and the most useful for high-resolution analysis is the thin-film computer routine devised and employed by T. A. Hall (personal communication, 1977). This routine assumes that the tissue under consideration is thin with respect to secondary scattering events of electrons in the tissue. The authors of articles on microanalysis should state the method used for analysis and the logic for their choice. If the tissue used in analysis is thicker than that which would presuppose secondary electronscattering events, the thin-film routine is not applicable. In any case, a full description of the method of data analysis, with particular emphasis on computer routines used, should be given. Failure to do so should raise the level of skepticism concerning the entire experimental procedure.

V. Application of Microprobe Analysis to Specific Biological Systems The following review of literature reporting applications of electron microprobe analysis to specific biological systems is mainly concerned with its application to mammalian tissue on a subcellular scale. This section also treats, to a lesser degree, application to microorganisms. Further, two elements, Ca and Fe, are deemed to be of sufficient significanceto warrant separate sections. Although this review of the literature is not meant to be exhaustive, examples of application of the microprobe technique are treated for a full range of topics important to physiology and cell biology. A. SKELETAL AND CARDIAC MUSCLE

Skeletal and cardiac muscle are two tissues on which much research using other techniques of elemental localization has been focused. In particular, studies using pyroantimonate, involving efforts to localize Ca and other elements by autoradiography, are extensive. It is therefore quite natural that, when the value of the microprobe technique was recognized, one of the first tissues to receive attention was striated muscle. Of the several methods of specimen preparation used with the microprobe technique, by far the easiest to implement is epoxy embedding followed by thin-sectioning and observation in the microscope. However, the possibility of translocation of elements during the fixation and embedding process has stimulated several studies in order to determine the extent of such translocation. Of particular note is the work of Yarom et al. (1974a,b) on the effect of embedding and other methods of specimen preparation on the

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

135

location of intracellular myocardial Ca. These studies indicate that significant changes occur during fixation with glutaraldehyde, osmium, and pyroantimonate. The pyroantimonate fixation technique produced the highest Ca concentration and the majority of statistically significant concentrations; it has been used successfully by Atsumi and Sugi (1976) and by Myklebust et al. (1975). A combination of osmium tetroxide and potassium pyroantimonate was used by Atsumi and Sugi (1976) to fix skeletal muscle during various states of contraction, while potassium pyroantimonate was used to localize the Ca. Electron probe microanalysis of precipitates showed the presence of Ca in an unambiguous way. In resting muscle, the electron-opaque precipitates were observed on the inner surface of the plasma membrane, the vesicles, and the mitochondria. In muscle fixed at the peak of mechanical response to Ca removal, the precipitates were found to be diffused throughout the myoplasm in the form of a large number of small particles. At the completion of spontaneous relaxation, the precipitate was again seen on the inner surface of the plasma membrane. In experiments to determine the distribution in the catch state, the precipitate was found to reaccumulate in the peripheral structures, with a corresponding decrease in the precipitate in the myoplasm. These workers conclude that the study not only provides evidence for the involvement of Ca-accumulating structures in the contraction-relaxation cycle but also indicates that the transition from active to catch contraction is related to the decrease in myoplasmic free Ca concentration. In a more sophisticated study, Myklebust er al. (1975) reacted potassium pyroantimonate with atrial myocardial tissue and found a pattern of evenly spaced cross-striations of antimonate precipitates along the myofilaments. The spacing was reported to have a periodicity of about 400 A. These investigators suggest that the localization of troponin-bound Ca is demonstrated by the periodicity of the pattern along the thin filaments during contraction. Although the technique of plastic embedding and sectioning with subsequent staining has great advantages in revealing the morphological features of muscle and the use of pyroantimonate can localize Ca redistribution, several investigators have selected the technique of frozen dried, or frozen hydrated thinsection elemental microanalysis in order to minimize the possibility of redistribution during subsequent preparation steps prior to observation. The first of these observations was made by Bacaner er al. (1973), with further details of the work given by Hutchinson et al. (1974). The rudiments of the technique are outlined in the previous section on specimen preparation. In later work, Somlyo et al. (1977), using frozen dried thin sections of skeletal muscle, demonstrated that the electron microprobe technique used for elemental analysis of Na, Mg, P, C1, and K yielded concentrations well within the limits of variability for fibers. They concluded that the electron microprobe analysis of 50-nm- to 2-pm-diameter areas of frozen dried ultrathin sections yielded quantitative results which were in agreement with chemical analysis of whole muscle, and further that, in hypotonically

136

THOMAS E. HUTCHINSON

treated muscle, the excess Ca was compartmentalized in a manner consistent with ionic communication with the extracellular space. In several excellent studies, Ashraf and Bloor (1976) investigated the mitochondria1 deposits in ischemic myocardium, and the microanalysis results suggest the formation of calcium, magnesium, and phosphate in the mitochondria during ischemia. Further work on ischemia was done by Somlyo et al. (1975). Granules similar to those of Ashraf and Bloor (1976) were observed. It was found that the amounts of Ca in mitochondria containing numerous granules were clearly pathological and represented abnormal accumulations caused by ventricular fibrillation andor ischemia. The Somlyo technique differed from that of Ashraf in that the cells were unfixed and were prepared by cryomicrotomy with freeze-drying and subsequent osmium vapor staining. An extensive investigation of the techniques used to prepare skeletal muscle for transmission electron analytical microscopy of diffusible elements was made by Sjostrom and Thomell (1975). They concluded that brief fixation in glutaraldehyde resulted in gross ionic changes, as did sectioning of frozen material employing liquid trough techniques. Sections cut from unfixed frozen muscle without contact with cryogenic liquids showed numerous spectral peaks indicating the presence of Mg, P, S, Ca, and K. In the various parts of the fibers of frozen dried sections, reproducibIe spectra of these elements were found within different structures. They concluded that the best method for obtaining data on diffusible ions involved rapid freezing of unfixed tissue, followed by dry cutting in the frozen state and freeze-drying. There are, however, questions relating to the alteration of elements during the drying process. These questions have not been treated in sufficient detail in any study as yet, due mainly to the difficulty of obtaining analysis of fully hydrated frozen tissue and the problems associated with determination of full hydration as opposed to partial dehydration in the electron microscope.

B. SMOOTH MUSCLE The field of microanalysis, as well as the determination of elemental distributions by other means within smooth muscle, has been dominated by the work of Andrew and Avril Somlyo. One of the pioneering efforts performed in the Somlyo laboratory involved specimen preparation in which Sr was substituted for Ca prior to induced contraction of smooth muscle. It is suggested by Somlyo and Somlyo (1971) that the translocation of Ca accumulates divalent cations from the sarcoplasmic reticulum in close contact with the surface membranes and is responsible for the action potential triggering contraction in rabbit and guinea pig mesenteric veins. This was pioneering work with respect to localization of electron-dense deposits but did not employ elemental microanalysis to identify these deposits. Later work from the Somlyo laboratory (Somlyo er al., 1974)

DETERMUVATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

137

showed that tissues incubated with Sr contained electron-opaque mitochondrial granules and deposits in the sarcoplasmic reticulum. X-ray microanalysis of the mitochondria indicated that the granules contained mainly Sr and Ca. It was further noted that mitochondria, subject to Ba-induced swelling, contained granules which showed characteristic Ba signals. The presence of Ba was in good correlation with that of P. The general conclusion was that the energy-dependent uptake of divalent cations was associated with K and suggested mitochondrial regulation of intercellular divalent cations in smooth muscle. The previously mentioned work involved mainly conventionally fixed preparations of smooth muscle tissue. Somlyo and Somlyo have also used freezing with subsequent freeze-drying in conjunction with an oxalate precipitation method as a Ca ion marker to show by a direct method the significant Ca accumulation inside the sarcoplasmic reticulum of smooth muscle, as had been shown previously in skeletal muscle. In addition, it was shown by Somlyo et al. (1977) that cryosectioned smooth muscle exhibited high Ca concentrations in the mitochondria, frequently associated with high levels of Na and K. Higher than normal net Ca concentrations were seen with C1 of roughly 200 mmoledkg, while K was in the range of 330 mmoleskg. It was concluded from the anomalous non-Donnan distribution in cellular organelles that mitochondria in situ excluded C1 but probably not K from the matrix space. In a study by Garfield and Somlyo (1976), unfixed ultrathin frozen dried sections of cultured smooth muscle cells were subjected to elemental microanalysis. Mitochondria containing electron-opaque granules were identified. In these regions, Ca and P were the dominant elements. In regions outside the mitochondria, the presence of Na, K, S, C1, and Ca was observed. The Ca concentrations in regions other than the mitochondrial granules were deemed to be quite low, but still greatly in excess of that expected in normal cytoplasm. In all these studies, Somlyo and Somlyo went to great lengths to make the best use of the statistical analyses which could be employed with these systems and to obtain the greatest quantification possible with the instrumentation used. C. LUNG Because of the recent increase in interest in the contribution of particles in the lung to cancer initiation, microprobe analysis has been applied rather widely in the study of lung tissue. The literature is extensive, and only two examples of these studies are mentioned here. Ferin et af. (1976) used this technique for the identification of titanium dioxide particles in lung tissue and cells. Conventional fixation techniques were used in these studies, and the particles were identified by electron opacity. Characterization of the particles was aided by their tendency to clump, so that accretions of particles could be Seen in the transmission electron

138

THOMAS E. HUTCHINSON

microscope and identified by electron probe analysis. The particles were found in the alveolar macrophages and tended to be adjacent to the nucleus. The resolution, however, was not sufficiently high to determine whether the cell organelles or the cytoplasmic membrane was involved in particle encapsulation. Pintar er al. (1976) used the technique to characterize pulmonary silicosis. This study, made on three foundry workers, using lung biopsy specimens, identified a significant amount of Si in fibrous tissues of the septa and pleura and around blood vessels. The amount of Si was sufficient to permit a diagnosis of silicosis in all three patients. All three had severe functional impairment, but it was not clear at the time what factors were responsible for the diffused distribution of Si in their lung tissue.

D. NERVE One example of the application of microprobe analysis to the study of nerve is cited in Section V,M,l. Several other articles are worthy of note, in particular one reporting a study by Oschman et al. (1974) demonstrating the use of microprobe analysis in investigating the squid giant axon. The technique of fixation was similar to that employed with numerous other Ca-containing cells; chloride (5 mM) was added to all solutions used in tissue processing. These workers observed electron-dense deposits along the axonomal plasma membrane, in the mitochondria, and along the basal plasma membranes of the Schwann cells. It was found that these deposits contained mainly Ca and P. They also noted that these elements were not detected in the axoplasm. The findings of this study were supported by the further work of Hillman and Llinas (1974), who examined tissues which were unstained and unosmicated. The findings with respect to Ca and P were identical to those of Oschman et al. (1974). Gambetti et al. (1975) applied electron microprobe analysis to vertebrate glial cells. Again, osrniophilic particles were found in the visceral and cisternal structures. These particles were shown to contain primarily Ca and P. It was further noted that the osmiophilic particles also occurred in astrocytes, and it was suggested that these organelles were the storage sites of Ca. An excellent study was made by Rick ef al. (1976) to determine the distribution of Na, P, C1, and K in different structures of myelinated nerve of Raw escutentur. It was found that the axon showed a typical intracellular distribution pattern of Na, C1, and K, while the interstitial space and the myelin sheath showed a typical extracellular pattern. It was noted that these measurements demonstrated that Na was present in the myelin sheath near the node of Ranvier. Duckett er al. (1977) showed that the localization of Ca and P by scanning electron microprobe analysis provided a morphological outline of normal nerve, which could be used to compare abnormal and normal nerves qualitatively and

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

1 39

quantitatively. The normal saphenous nerves of eight cadavers and the abnormal saphenous nerves of two cases of diabetic neuropathy were analyzed, and the results were compared. Results were obtained for Ca and P concentrations in the normal and abnormal nerves. In the normal nerve both Ca and P were excluded from the node of Ranvier, while in the abnormal nerve Ca was uniform within the tissue but P was totally excluded from the area of the node of Ranvier to a greater extent than in the normal nerve. These results should be of interest to neurologists, since this method provides an efficient way of detecting abnormalities in peripheral nerves. These investigators are further pursuing studies to refine the technique using air-dried, unfixed nerves, which eliminates the artifactual presence of osmium and lead as stains in these tissues. E. EPITHELIUM The study of epithelial tissue over the past several years by x-ray microprobe analysis has gained increasing importance. Even though epithelial tissue does not lend itself well to studies using frozen hydrated or frozen dried preparations, valuable information concerning elemental distributions in these cells obtained by microanalysis cannot be gained by other techniques. In an early study by Gehring et al. (1972), frozen dried cross sections of frog skin were examined. These studies used freeze-sectioning with subsequent drying in a cryotome for the preparation of tissue. Tissues were examined at room temperature in a scanning electron microscope equipped for x-ray microanalysis. The cytoplasm and the nucleus were regions of particular interest, and the elements Na and K were studied extensively. In the cytoplasm the Na level was 30 meq/kg wet weight, and in the nucleus the Na concentration was identical. The K level was 115 meqkg wet weight in the cytoplasm, and in the nucleus it was 110 meq/kg wet weight. An additional feature of their article is that it outlines a relatively sophisticated quantification technique, although the roughly 5% accuracy of the K concentration determination is not fully justified. Tapp (1975) studied the epithelium of the midgut of the fruit fly. It was known well before microanalysis was used on these tissues that Cu accumulated in the midgut epithelium. This study showed that the Cu was associated with high concentrations of S and that no other elements with an atomic number greater than 9 were present in appreciable concentrations. The Cu was located in granules bound to membranes and morphologically similar to secondary lysosomes. Jessen et al. (1976) studied the amount of S in keratohyalin granules in the interpapillary and papillary lingual epithelium and in the esophageal epithelium of the rat. A quantitative assay of the S concentration of the keratohyalin granules was performed using a suitable S standard. It was demonstrated that the different types of keratohyalin granules had unique compo-

I40

THOMAS

E. HUTCHINSON

sitions. Single granules, present in both nuclei and cytoplasm of the epithelial cells, were rich in S, having a content of roughly 3.6 at 96. Another type, composite granules, contained S-rich components and S-poor components. The S-poor, components contained roughly 0.8-1.4 at 8 S. These investigators suggested that the S-rich keratohyalin granules were involved in deposition of the peripheral envelope protein of cornified cells. Hodson and Marshall (1970) used the electron microprobe technique to study S and K ions in corneal stroma. Frozen sections were cut from the corneal stroma, freeze-dried, and subsequently subjected to x-ray microanalysis. Quantitative analysis determined Na and K concentrations to be on the order of 172 and 22 mM, respectively. Although the limit of resolution of the technique used by Hodson and Marshall was well below the cell size (i.e., 1.O to 0.1 p n ) , the K in the sections appeared to be uniform and not localized in the keratocytes. This strongly indicates that the sections may have rehydrated during transfer, in which case the K may have diffused throughout the tissue. In a paper by Gupta et al. (1976) of the Cambridge University group, extensive studies on the distribution of ions in fluid-transporting epithelium using frozen hydrated sections from the fluid-secreting upper portion of the Malpighian tubule of the insect Rhodnius prolixus were reported. The data presented showed that NayK, and C1 were not uniformly distributed within the cells, that the basal lamina was not entirely a passive layer open to small ions, and that in the particular epithelium studied the stimulation of secretion greatly increased the intracellular Na concentration. These workers stated that their results did not support the standing gradient theory of fluid secretion. The reader is referred to the article for details of the study. One observation of particular significance is that high concentrations of K have been found in other insect tissues as well and cannot be attributed to the limited spatial resolution which only tends to obscure the existing sharp peaks in concentration which do in fact exist. One implication for fluid transport is that the basal lamina, although apparently permeable to quite a large number of neutral molecules, may nevertheless preferentially mtrict the movement of some ions. In a study by Appleton and Newel1 (1977), frozen dried ultrathin sections of regulating epithelium of the snail otala were examined by a x-ray microanalysis technique. This is an especially important cell because of its ability to regulate water and ion flow across the epithelium. Standard techniques of sectioning and freeze-drying were used. The primary results showed that the x-ray microanalysis of frozen dried ultrathin sections was sufficiently sensitive to detect physiologically significant changes in the concentrations of elements at the subcellular level. In addition, the changes in the concentration of Fe and Zn in regulating and control epithelium indicated that translocation of these elements was related to fundamental physiological processes within cells. It was stated by these workers that the increase in the Zn concentration may be related to its role

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

14 1

as an enzymic cofactor associated with carbonic anhydrase, which is known to be present in mantle epithelium tissue.

F. KIDNEY Kidney studies have been made primarily at one laboratory, that of Claude Lechene of Harvard Medical School, and collaborators. This is the result of the extensive facilities and interest in kidney studies at Harvard and the presence there of a Biotechnology Resource for Microprobe Analysis. The primary technique used in these studies is the examination of picoliter samples of fluids extracted by micropuncture techniques from kidney tubules. The studies take advantage of the highly sophisticated automated analysis techniques developed by Lechene and co-workers. The reader is referred to the bibliography for particular results and details of the experimental procedure.

G. CALCIFIABLE TISSUE

X-ray microanalysis of calcifiable tissues is an area of investigation which in itself could be the subject of a review article. For this reason only a few articles illustrative of the use of this technique for calcifiable tissue have been selected for discussion. The reason for this extensive literature is that calcifiable tissue presents relatively easily solved problems in specimen preparation and thus has been the subject of extensive study. Perhaps the most extensively studied material using electron probe microanalysis is dental. An example of such a study is that reported by Selvig et af. (1977). Ground sections of human tooth showing early stages of root surface caries were subject to analysis by electron microprobe techniques, and Ca, P, F, S, Mg, Na, Fe, Cu, Zn, Sn, and Ag were observed. The progress of caries in the cementum was followed by sequential analysis, and the pattern of dissolution and precipitation of mineral components seemed to be the same as that seen in dentine caries studied by other methods. A surface layer containing relatively high F content resulted in the development of a distinct zone of recalcification at the surface. Boyde and Reith (1977) examined early stages of the cementum caries of rapidly growing rat incisors which were freeze-fractured, freeze-dried, and subsequently subjected to energy-dispersive x-ray microanalysis. Ca levels were found to be elevated in the distal cell body of odontoblasts where Ca was uniformly low over all parts of the cell body secretory ameloblasts. Results suggested a fundamental difference in the mechanism by which these two types of cells process Ca and that Ca possibly diffused through the secretory ameloblast layer on its way to the enamel.

142

THOMAS E. HUTCHINSON

In a study by Berkovitz and Heap (1976), the effect of F on Fey Cay and P distribution in rat incisors was studied. It was found that rats subjected to treatment of 25-100 ppm grew incisors with a typical banding pattern of routhly 60 pm. These pigmented bands were found to contain more Fe, Ca, and P than bands exhibiting reduced pigmentation. Diffusion of Sr from desensitizing agents into human dentine was studied by Stazen and Foreman (1977). In this study Sr-containing densensitizing agents were applied to two surfaces and burnished onto another set of diametric surfaces. The variation in concentration of Sr in dentine with depth beneath the surface was determined by x-ray microanalysis. It was noted that burnishing produced deeper Sr penetration which followed Fick 's second law of diffusion. The mineralization of cartilage has been the subject of several investigations. In early research by Hall (1971), calcification was studied in ultrathin sections of costochondraljunctions of 1-month-old guinea pigs. Electron-dense bodies having diameters of 50-200 nm were found. It was concluded from this study that the concentration of Ca in the particles in the early stages of mineralization was not greater than in the surrounding matrix. Observed levels of Caythat is, 1 or 2 ppt, were similar to those in equivalent tissue, although they were much higher than in most soft tissue, suggesting an accumulation of Ca, presumably in an early stage in the process of mineralization. Second, the observed C d P ratio was often much higher than that expected in the phosphate compounds. This suggested that the first step toward nucleation of these globules was the binding of Ca to some moiety other than phosphate. These were regarded as the first sites of apatite nucleation. In a recent study on calcification of elastin, Urry et al. (1976) concluded that the ability of elastin coacervates to initiate calcification was a bulk property of the coacervate and not limited to the serum-coacervate interface, and that calcium phosphate deposits acted to bind the protein units together and slow dissolution and spreading of the coacervate as it floated at the air-water interface. In addition they found there was no inferable involvement of S. Initiation and deposition, it was concluded, were due to neutral sites on the protein which were tightly bound to the phosphate deposits. H. BLOOD Formed elements of the blood such as erythrocytes, lymphocytes, and platelets have become subjects of intense study by x-ray microanalysis, mainly because single cells can be studied by this technique whereas other methods do not offer this advantage. An extensive study of single human red blood cells was carried out by Lechene et al. (1976) at the Biotechnology Resource for Microprobe Analysis at Harvard Medical School. Their report outlines both the techniques of

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

I43

specimen preparation and the results of microprobe analysis. The method of preparation found to be most reliable was spraying cells onto polished pyrolytic graphite by atomization. It is notable that the mean values of x-ray intensities from the elements studied were linearly related to the content of ions, as determined by optical spectroscopy. The calibration curves were obtained by loading the cells with known amounts of Na and K. The Na and K contents of the cell were measured by flame photometry and the results compared to results from electron microprobe analysis. Calibration curves were thus constructed which allowed quantitative data to be obtained from individual cells. In a study by Yarom et al. (19761,comparative investigations of elemental concentrations in normal and leukemic cells were undertaken with a few subjects using electron microscope x-ray microanalysis. In addition to the normal physiological elements detected, Cu and Zn were found to be above accepted levels in normal cells. The abnormal concentration of these elements appeared to be disease-related. In leukemic lymphocytes, nuclear Zn was significantly lower than that observed in normal lymphocytes, while P was only slightly decreased. This suggested faulty Zn uptake for binding in the leukemic cells. The possible consequences of intracellular Zn deficiency were discussed also by Yarom et ai. (1976). In a study of Ca and P in human platelets, large amounts of these elements were found by electron microprobe analysis of dense bddies of frozen dried human platelets. The Ca and P occurred in a fixed ratio similar to that of dicalcium ATP. Except for C1, no elements other than these were detected. Both dense bodies and membrane-bound particles were absent when platelets were fixed in a Ca-free solution. In a further study by Skaer (1975)and Skaer et al. (1974),mineral elements present in dense bodies of human platelets were detected by the quantitative microprobe analysis technique. Sections of frozendried platelets and also whole mounts of air-dried platelets were used. The only elements detected by the study in the dense bodies were Ca and P. The ratio of Ca to P corresponded approximately to the atomic ratio-just over three P atoms to one Ca atom. When the dried platelets were extracted with liquid solvents, the P/Ca ratio became essentially 1:l. These workers calculated that the amount of Ca within the dense bodies was equal to the total Ca content of the entire platelet as obtained by gross chemical analysis. Microprobe analysis of the platelet cytoplasm substantiated the results of this calculation. It was further noted that the dense bodies dissolved from the platelets in the absence of Ca in the cytoplasm and thus the stability of the dense bodies was dependent upon the presence of Ca. In a further study, Hutchinson (1978) applied ultramicroprobe analysis to frozen hydrated and frozen dried normal and irreversibly sickled erythrocyte ghosts. The presence of membrane-bound particles was evident from the highresolution electron micrographs. Regions of the erythrocyte membrane were found to be devoid of membrane-bound particles, while in other regions they

144

THOMAS E. HUTCHINSON

were in a closely packed state. The results of analysis of the concentrations of elements within the membrane-bound particles indicated that they contained largely P and S, although C1, K, Ca, and Fe were also found to be present. With the use of an identical technique irreversibly sickled erythrocytes were examined, and it was found that the major change was an increase in the K/Ca ratio. The technique was also applied to the examination of erythrocytes by Barber (1975). The procedure consisted primarily of tagging the antigen sites with osmium, followed by normal fixation for SEM. The osmium M line was used in the analysis. In this study it was noted that antigen sites were evenly distributed over the surface of the cells.

I. GAMETES AND DEVELOPMENTAL BIOLOGY Very little work has been done on cilia with electron probe microanalysis apart from gametes, although they represent a highly important system much studied by other techniques. Several studies are worthy of note. In the first of these, Tsuchiya (1976) investigated the Ca-binding sites in the cilia of Paramecium. This study revealed the distribution of Ca and other elements within the various components of the cilia using a preparation technique consisting of fixation with glutaraldehyde containing 5 mM calcium chloride, subsequent embedding, and thin-sectioning. Ca and P were present in electron-dense deposits found on the inner side of the ciliary membrane just above the ciliary necklace and less frequently on the outer and central doublet microtubules. This observation suggests that Ca ions may be released from inner ciliary binding sites during excitation of the ciliary membrane and influence ciliary movement. In a supportive study, Fisher ef al. (1976), also investigated Paramecium aurelia and identified granules containing large amounts of Ca, particularly on the cytoplasmic side of the surface membranes in the basal regions of the cilia, in preparations fixed with a high (5 mM) concentration of Ca in the solutions. Certain deposits were also observed on the smooth cytomembranes and within the axonema of the cilia and on the basal bodies. Certain divalent cations, in particular Mg, Mn, Sr, Ni, Ba, and Zn, could be substituted for Ca in the procedure with similar results. Some deposits were larger at the ciliary transverse plates and at the termination plates of the basal body when 5 mM Sr, Ba, or Mn solutions were used in the preparation. Microanalysis showed that Ca and C1 were concentrated within these deposits. It is notable that these deposits were seen only when the ciliates were actively swimming at the time of fixation. These workers also discussed the possibility that the action sites of Ca and other divalent cations were those identified in their study. Stamejohn and Hutchinson (1977) investigated the distribution of ions within bovine spermatozoa using scanning transmissiun electron microscopy and determined the distribution of ions (Na, P, C1, K, s, and Zn) in specimens prepared by

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

145

ultrarapid freezing and direct observation of the whole-cell preparation in the frozen hydrated state. Large variations were seen in the relative abundance of each of these elements in the various compartments of the cell. In particular, the acrosome, head, midpiece, and tail were studied. The variation in elemental concentration with cell aging for each of these units was determined in semen. Many investigations on mammalian sperm have been carried out in the laboratory of John Chandler at the Tenovus Institute, Cardiff, Wales. He performed x-ray microanalyses on both air-dried and ultrathin frozen dried sections of human sperm and found large variations in elemental distribution and composition among cells in any single ejaculate and an even larger variation among ejaculate samples. The NdK ratios in these preparations were found to be roughly constant. It was concluded by Chandler and Battersby (1976) that airdrying was a valid method of preparation for sperm cells to be subjected to elemental microanalysis. In a study on the effect of Cu on the distribution of elements in human spermatozoa, Maynard et al. (1975) found that incubation with a Cu wire in semen or cervical mucus significantly reduced the levels of both Na and K in the spermatozoa but did not affect the ratio between these two elements. Cu also displaced Zn from the head region, possibly replacing it. They further noted that this may account for the decreased motility of spermatozoa in contact with Cu ions and that the observed toxicity of Cu for human sperm cells lent support to the theory that part of the mode of action of the Cu IUD may be due to alteration of the sperm-fertilizingpotential. Chandler and Battersby (1976) also investigated the use of pyroantimonate in the localization of Ca. Although Na, K, and C1 were all removed during the fixation process, Ca and Zn were found to be present intracellularly in association and independent of the antimonate precipitate. They concluded that there appeared to be a varying degree of binding of these elements subcellularly, precipitation occurring where binding was reduced. In a rather extensive investigation Rosado et af. (1977) studied the elemental composition of subcellular structures of human spermatozoa by the x-ray microanalysis technique. This study determined the elemental composition in the acrosome, head, midpiece, and tail of spermatozoa fixed in the usual manner for electron microscopy. Of particular interest was the finding that Ca, S, and Zn were present in extremely high concentrations in the membrane of the spermatozoa and that sperm heads were richer than tails in Na, Cu, and Zn, while tails had higher concentrations of Ca. This certainly supports the Ca-mediated motility theory of flagellar action. Battersby and Chandler (1977) attempted to correlate the elemental composition with the motility of human spermatozoa. These workers found that x-ray microanalysis data obtained from human sperm cells in donor semen having a range of motility from 0 to 85% indicated that the elemental composition was not strongly correlated with spermatozoa motility. Only the Cu in the midpiece was positively correlated with motility when high- and low-fertility groups were compared. It was noted that aging of cells in semen caused large changes in the

146

THOMAS E. HUTCHINSON

subcellular elemental concentrations as motility decreased. It was especially clear in the case of uptake of Zn that these changes were not reflected in the range of motilities of clinical samples. In this case the electrolyte balance was measured by NdK ratios which also appeared not to be correlated with motility. It was found that subcellular elemental distributions were not a major factor in determining cell motility in normal human sperm. J . CHROMATIN IN MITOSIS AND AGING A particularly interesting study was made by Cameron et al. (1977), in which the concentration of elements in mitotic chromatin was measured by x-ray microanalysis. These workers used unfixed frozen dried tissue sections of mouse duodenum. The analysis was carried out on carbon planchets and analyzed in scanning electron microscope fitted with energy-dispersive x-ray analysis equipment. The peakkontinuum ratios for S , C1, K, and Ca were measured in mitotic chromatin. It was found that the concentrations of these elements were significantly higher in the chromatin than at other cell sites. These investigators suggested that the redistribution of Ca in mitosis may help explain both chromatin condensation and assembly in the mitotic spindle apparatus. An extremely active group in the area of aging is jointly associated with the Center of Cytology at the Gerontological Research Department in Ancola, Italy, and the Biomedical Institute, Medical University of Hungary. In a report from this group (Pieri et al., 1977) it is noted that they have examined the nucleus and cytoplasm of large brain cortical and liver cells of young and old adults by microanalysis using the preparative method of freeze-drying bulk specimens. It was found that the K and C1 contents per unit dry mass in the nuclei of both tissues were significantly increased between the age of 1 and 24 months, while the Ca content of the hepatocyte nucleus decreased. At the same time some cytoplasm ion concentrations were increased, while others decreased or remained unchanged. It was noted, however, that there was an age-dependent intracellular water loss, the extent of which was not known for the tissues studied, however, in human organs it averages about 10-14% between the ages of 20 and 99 years. The values obtained for the old cell nucleus reached ranges of ionic strength when nonhistonic regulatory proteins were separated from the chromatin in vitro. These results have had a significant impact on recent biochemical observations.

K. MICROORGANISMS Several studies have been made of the distribution of elements in a variety of microorganisms. Coleman et al. (1973) made a quantitative electron microprobe

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

147

analysis of the refractile granules of Tetrahymena pyriformis both individually and in situ. The ratios of several elements were determined in these granules. When Sr was substituted for Ca in the growth medium, all the granules incorporated this element, seemingly at the expense of Ca. The (Ca Mg Sr)/P ratios in the granules were comparable to the (Ca + Mg + Sr)/P ratios in granules from Sr-free media, indicating that the mix of divalent ions in granules may vary but the proportion of divalent ions to P tended to be constant. In a particularly interesting study Murphy et al. (1976) applied electron microanalysis to dormant and germinating Diplodia maydis spores. It was found that the spore population contained large amounts of Si, P, C1, and K, and smaller amounts of S and Ca, with trace amounts of Mg and Al. Analysis of single spores revealed high K and C1 and low P and Mg at one end of the cell, with concomitant low K and C1 and high P and Mg in the central portion and at the other end of the cell. They found that high K and C1 occurred at one end of nongerminating spore cells, whereas germinating cells contained high P and Mg and low K and C1 at the same location. Hutchinson et al. (1977) demonstrated the presence of Ca, K, and P in relative amounts of 1:1:4, respectively, in the viruslike gamma particles found in zoospores of the aquatic fungus Blastocladiella emersonii. Some gamma particles, however, lacked detectable amounts of K. These workers discussed the possible significance of these observations in understanding the triggering of encystment and initiation of wall synthesis mechanisms.

+

+

L. MEDICAL DIAGNOSIS Recently, energy-dispersive x-ray analysis has been applied to medical diagnosis. Two studies may be given as examples of such studies. Paetau and Haltia (1976) examined the sciatic nerve of a patient who died of uremia complicating juvenile diabetes. It was revealed that selective calcification had occurred in the perineurial sheath of the sciatic nerve. Calcium phosphate deposits were found to be limited to outer layers of the perineurium. The end-stage diabetic nephropathy was associated with an extremely high Ca-P ion product known to favor metastatic calcification. The mechanism of selected localization of the P deposit to the outer layer of the perineurium sheath was discussed with reference to the structure and suggested a barrier function of the perineurium in regard to phosphate ions. In a second study, Murphy and Piscopa (1976) investigated subcellular Fe distribution in plasmic anemic human bone marrow. Cells presumed to be proerythroblasts were quantitatively abnormal in their utilization of Fe. It was further suggested that this may provide an index for hematological disorders of this type. These observations revealed the existence of a new class of cells not previously identified by light or electron microscope techniques and identified only by their accumulation of Fe within the cytoplasm and along the plasma

148

THOMAS E. HUTCHINSON

membrane. This research provides yet another example of the power of the ultramicroprobe technique in cellular investigation. M. ELEMENTS OF PARTICULAR INTEREST

1. Calcium Binding and Transport Much attention has been focused on electron probe studies of Ca transport in mammalian cells. The basic question involved is to what extent electron microprobe analysis can be relied upon to describe the Ca distribution within cells on a scale which is very small in comparison to the cell size. The fundamental biological question is: How is Ca transported through cells which are highly sensitive to Ca levels without the transient Ca interfering with the basic cell function? Coleman and co-workers at the University of Rochester have addressed this question using both glutaraldehyde-fixed and oxalate-stabilized cells followed by routine embedding and sectioning, and by the technique of freeze substitution and freeze-drying. Primarily they investigated Ca movement through cells organized in epithelia, particularly in the two organs of the embryonic chick chorioallantoic membrane and the small intestine of the young rat and chick. Using these techniques coupled with electron microprobe analysis, Coleman and Terepka (1972) identified Ca pools within the cells on a scale of roughly 25 nm. It was clearly established that the Ca in transit through the cells was restricted in location and did not diffuse through the cytoplasm, which was a highly important finding. It was further determined that, of all methods examined, freeze-drying offered the greatest possibility for full quantitation of elemental distributions within cells using the electron microprobe technique. This was established by comparing elemental distribution maps to the values determined by bulk analysis. The close correspondence between the two values for Na and K established for rat small intestine by Nellans and Schultz (1976) strengthened the confidence of the investigators in the electron microprobe technique. Another excellent example of microprobe measurements of Ca binding is found in a study by Routledge et al. (1975), in which the contractile spasmoneme of a vorticellid was examined. The Ca content of isolated contractile organelles from the ciliate zoothamnium was compared in both extended and contracted conditions. Contracted organelles contained a higher Ca content than those in the extended state by about 1.7 g d k g dry mass. It was further noted that this Ca was very strongly bound. These workers concluded from this study that the quantity of Ca bound in this way was in agreement with the theory that the energy of contraction was derived from the chemical potential of Ca ions. They further suggested that stochiometry considerations supported the idea that between 1.4 and 2.1 Ca ions combine per molecule of the sparmanelmaCa-binding protein.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

149

In a pioneering study, Parducz and Joo’ (1976) demonstrated a method for visualizing stimulated nerve endings by preferential Ca accumulation in mitochondria using the electron microprobe technique. Stimulated and unstimulated nerve endings from cat superior cervical ganglion were used for the study. Standard methods of fixation, embedding, and sectioning were employed. A comparison of x-ray spectrometer signals obtained from mitochondria in different processes within a given section clearly demonstrated that mitochondria with electron-dense granules were significantly higher in Ca than others located in different areas. A nerve stimulated for longer periods resulted in larger areas being occupied by the electron-dense granules in the presynaptic mitochondria. The technique described in this article offers a simple means of identifying stimulated translocation of Ca in relation to the regulation of neurotransmitter release. In addition to the studies described in this section an excellent review of the applicability of microprobe analysis to Ca studies has been compiled by Hall (1975). In this review Hall describes studies ranging from Ca localization in blood to characterization of deposits in squid giant axon. 2. Iron After Ca, Fe is likely the most studied element using the technique of microprobe analysis. Shuman and Somlyo (1976) reported on a remarkable study by electron probe x-ray analysis of single femtin molecules. In this study single molecules and groups of three femtin molecules were subjected to x-ray microprobe analysis. Adequate Fe spectral peaks were recorded during a 100-second x-ray energydispersive analysis, when single fenitin molecules were excited with the electron probe. It was found that there was a linear relationship between the number of femtin molecules analyzed and the count rates. These workers contrasted their experimental results with the theoretically calculated x-ray Fe yields and with the results of Isaacson and Johnson (1975). They concluded that the current state-of-the-art electron probe x-ray analysis could realize the theoretically predicted sensitivity of the method, which is roughly 1 X lo-’’’gm of Fe as a minimal dectable mass. Sprey er al. (1976) studied chloroplasts of young Nicoriana leaves containing electron-dense stroma inclusions. These inclusions may represent a convertible form of the Fe-containing phytofemtin. Considerable amounts of Fe and P were present in the electron-dense inclusions. The mean atomic Fe/P ratio detected by x-ray microanalysis was 2.5. These investigators discuss the gross arrangement of the phytoferritin in the plastic stroma in relation to the different states of chloroplast development. In addition to the direct study of Fe in its naturally occumng form, numerous studies have been made using the fenitin-protein complex in conjunction with concanavalin A (Con A) as an indicator of the binding sites of the latter on cell surfaces. One such example has been given in

150

THOMAS E. HUTCHINSON

Section V,I. In addition, Amakawa and Barka (1975) studied the distribution of Con A binding sites on the surface of dissociated rat submandibular gland acinar cells. Femtin was also identified in insect vectors of the maize streak disease agent by Kimura et al. (1975). Certainly the use of ferritin in conjunction with Con A as an indicator of sites of binding to cell surface will increase as studies require this technique. Electron microprobe analysis will be used extensively to identify the fenitin positions in these studies.

VI. Methods and Reviews Two very important compilations of articles published in the literature do not lend themselves to comment in the bulk of the text. These are methods and procedures, and reviews by other authors. For this reason, the bibliography will serve as a guide to investigators in selecting articles on the reviews and methods most closely aligned with their research interests. A few comments, however, on methods and procedures are given as a guide to the literature. An excellent set of articles has been published in book form by Academic Press entitled, “Micro probe Analysis as Applied to Cells and Tissues,” edited by T. Hall, P. Echlin,and R. Kaufmann (1974). The book is comprised of the papers given by major contributors to the field of microprobe analysis at a conference sponsored by the Battelle Seattle Research Center in April 1973. The book contains articles which, taken together, can be used as a very substantial introduction to the area of electron microprobe analysis. In addition, Mizuhira (1976) has given a review of the instrumentation techniques used primarily in his laboratory and in addition has referenced the techniques of other investigators. Saubermann and Echlin (1975) have reviewed the particular technique of preparation and examination of frozen hydrated tissue, while the examination of thin sections by scanning transmission electron microscopy has been reviewed by Hutchinson (1977). Bonventre and Lechene (1974). and Roinel (1975) have carefully outlined the methods and procedures for examining picoliter samples of organic compounds. Lechene ’s laboratory has an extremely sophisticated, automated analysis procedure with which routine analysis of picoliter samples can be performed. In addition, there is an excellent general review.of ultramicroanalysis by Lechene and Warner (1977). An article by Marshal (1977) is worthy of note, in that it provides some insight into the procedures and formulas employed in his laboratory for the preparation of frozen hydrated biological specimens used in x-ray microanalysis. This article describes a technique for preparing frozen hydrated bulk specimens for electron probe x-ray microanalysis. This investigator states that the method allows reproducible quantitative analysis of frozen hydrated specimens to be made. The

DETERMlNATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

151

article is invaluable in delineating the significant problems in x-ray microanalysis by the electron beam excitation technique, however, many of the problems addressed are presently in a further state of examination. Particularly they concern the effect of coating biological specimens to reduce charging during examination, full qualification of the microanalysis technique, the effect of electron beam heating, and perhaps most importantly the effect on quantification of mass loss during examination.

VII. Conclusions Ultrahigh resolution elemental microanalysis of biological tissue is in a state of infancy as regards full quantification of concentrations within cells and tissues. Further, few studies have been performed which yield highly significant data concerning elemental concentration distributions and gradients within tissue. It is clear, however, that studies which have been performed by careful investigators using advanced techniques and equipment demonstrate the tremendous power ultramicroanalysis brings to the solution of many vital questions relating to physiology, cell biology, and medicine. In summing up the potential of the technique Lechene (1977) states, “In the future, electron probe microanalysis can bring to physiology what electron microscopy brought to anatomy. The discipline of electron probe can help to advance physiology from the realm of the black box approach to describing cellular function.” This is not an overstatement. Clearly a number of very fundamental questions relating to application of the technique to the quantification of elements with ultrahigh spatial resolution on the order of cell membrane thickness have not as yet found satisfactory answers. These questions are, however, being addressed by major laboratories, and there is no basically physical limitation to the analysis required to obtain a solution to all the major problems in ultramicroanalysis. The questions addressed thus far have been mainly in the area of proving the technique a useful biological tool and in application of the technique to biological problems which require only semiquantification results. The intense work presently going on at the several major laboratories attacking various facets of the problem should allow full quantification of the technique within a short time. The areas of investigation which will lead to full quantification are: 1. Complete computer analysis of energy-dispersive x-ray spectra with peak stripping, least-squares analysis, and so on. 2. Quantification of elemental loss during analysis and identification of techniques to minimize this loss.

152

THOMAS E. HUTCHINSON

3. Fabrication of primary elemental standards having characteristics closely akin to biological tissue. 4. Extension of the technique to include electron energy loss analysis which allows concentration determinations of the light elements, those with an atomic number less than that of Na, not possible with x-ray energy analysis. 5 . Extension of the instrumentation to allow ultrahigh resolution analysis (- 1-10 nm) and full computer analyses of the electron image and control of the electron beam to remove the inefficient unit (i.e., the electron microscope operator) from the analysis scheme.

In addition to the above areas of investigation which are required for full quantification of ultramicroanalysis in the determination of elemental concentrations on the subcellular scale for biological tissues, the entire area of specimen preparation needs serious attention. The two alternative routes in “native state” preparation, frozen-hydrated and frozen-dried, in addition to the conventional embedding process, need careful examination and determination of the degree of loss and transmigration of elements during the preparation technique as well as during analysis. It is likely that the technique of freeze-sectioningand subsequent drying of the tissue prior to examination will be the most widely used method of specimen preparation. Application of this technique, however, requires that full determination be made of the translocation of elements and ions during the drying process. Further, the use of frozen hydrated tissue in analysis is required in every case in which lumen must be examined in addition to the normal cellular concentration. In certain cases compounds which bind selected elements such as pryoantimonate can be used in conventionally prepared electron microscope sections. Care should, however, be taken to ensure that checks of the full binding of these compounds be ensured prior to acceptance of data from the technique. This again requires the use of frozen hydrated tissues. The entire question of morphological destruction during freezing, whether the sample will be subsequently analyzed following freeze-drying or by examination of the frozen hydrated tissue, needs careful treatment. Examination of each of the aforementioned questions is expensive, both in research time and research funds, but it is fully required before meaningful information of a quantitative nature can be obtained from this potentially extremely powerful technique. Prior to the time when these data are available extreme care should be taken that the data obtained by the technique are carefully scrutinized both from their biological implications and their physical significance. The endeavor of subcellular quantitative analysis of biological tissue by ultramicroanalysis requires close collaboration of the biological and physical sciences to a degree seldom required before. This collaboration is occurring and will lead soon to reduction to a relatively simple practice of the extremely powerful technique of ultramicroprobe analysis.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

153

ACKNOWLEDGMENTS The author gratefully acknowledges the contributions of Drs. Johnson and MacKenzie in the preparation of the manuscript for this article through numerous discussions and extensive editing. I am also particularly grateful to Marie Cantino for assembling much of the reference list and for her critical reading of the manuscript. 1 am also indebted to Keith Monson for his many suggestions and gratefully acknowledge the typing and editing talents of Linda Richter, Judy Bragg, and RenCe Freeman.

REFERENCES Amakawa, T., and Barka, T. (1975). J . Hisrochem. Cyrochem.23, 607. Appleton, T. C., and Newell, P. F. (1977). Nature (London) 266, 854. Ashraf, M., and Bloor, C. M. (1976). J . Mol. Cell..Cardiol. 8, 489. Atsumi. S., and Sugi. H. (1976). J . Physiol. (London) 257, 549. Bacaner, M.. Broadhurst, J., Hutchinson, T., and Lilley, J. (1973). Proc. Narl. Acad. Sci. U.S.A. 70, 3423. Barber, T. A., and Burkholder, P. M. (1975). 34th Annu. EMSA Meet. p. 666. Battersby, S., and Chandler, J. A. (1977). Ferril. Sreril. 28, 557. Berkovitz, B. K. B., and Heap, P. F. (1976). Caries. Res. 10, 337. Bonventre, J. V., and Lechene, C. P. (1974). Proc. 9rh Annu. Conj. Microbeam Anal. Soc., p. 8A. Boyde, A,, and Reith, E. J. (1977). Hisrochemisfry 50, 347. Cameron, 1. L., Sparks, R. L., Horn, K. L., and Smith, N. R. (1977). J . Cell B i d . 73, 193. Chandler, J. A. (1976). J . Microsc. (Oxford) 106, 291. Chandler. J. A., and Battersby, S . (1976a). J . Hisrochem. Cyrochem. 24, 740. Chandler, J. A., and Battersby, S. (1976b). J . Micros. (Oxford) 107, 55. Coleman, J. R., and Terepka, A. R. (1972). 1. Hisrochem. Cyrochem. 20, 401. Coleman, J. R., Nilsson. J. R., Warner, R. R., and Batt, P. (1973). Exp. Cell Res. 80, 1. Delgado, L. A., and Hutchinson, T. E. (1977). J . Microsc. (Oxford) (in press). Duckett, S., Balle, P., and Said, G. (1977). Acra Neuroparhol. 37, 271. Ferin. J., Coleman, J . R., Davis, S . , and Morehouse, B. (1976). Arch. Environ. Healrh. 31, 113. Fisher, G., Kaneshiro. E. S.. and Peters, P. D. (1976). J . Cell B i d . 69, 429. Gambetti, P., Erulkar, S. E., Somlyo. A . P.. and Gonatas, N. K. (1975). J . Cell Biol. 64, 322. Garfield, R. E., and Somlyo, A. P. (1975). 33rd Annu. EMSA Meet., p. 558. Gehring, L.,Dorge, A., Nagll, W., Schaky. B. V., Hausmann, R., and Thurau, L. (1972). I n “Thin Section Microana” (J. Russ and B. Panessa, eds.), p. 141. EDAX Lab. Griffin, G., and Hutchinson, T. E. (1978). In preparation. Gupta, B. L.. Hall, T. A., Maddrell. S. H. P., and Moreton, R. B. (1976). Nature (London) 264, 284.

Hall, T. A. (1971). “The Micmpmbe Assay of Chemical Elements.” Phys. Tech. B i d . Res., 2nd Ed. l A , 157. Hall, T. A. (1975). In “Calcium Transport in Contraction and Secretion” (E. Carafoli er al., eds.). p. 9 . North-Holland Publ., Amsterdam. Hall, T. A. (1977). Private Communication. Hall, T. A., and Gupta, B. L. (1974). J . Microsc. (Oxford) 100, 177. Hillman, D. E., and Llinas, R. (1974). J . Cell Biol. 61, 146. Hodson, S., and Marshall, J. (1970). Experienfia 26, 1283. Hutchinson, T. (1977). I n “Analytical and Quantitative Biology” (G. Meek, ed.), p. 213. Cambridge Univ. Press, London and New York.

154

THOMAS E. HUTCHINSON

Hutchinson, T. E. (1978). In preparation. Hutchinson, T. E., Bacaner, M., Broadhurst, J., and Lilley, J. (1974). Rev. Sci. Instrum. 45, 252. Hutchinson, T. E., and Borek, J. R. (1977). Ultramicroscopy 4, 2. Hutchinson, T. E., Cantino, M. E., and Cantino, E. C. (1977). Biochem. Biophys. Res. Commun. 74, 336. Isaacson, M., and Johnson, D. (1975). Ultramicroscopy 1, 33. Jessen, H., Peters, P. D., and Hall, T. A. (1976). J. CellSci. 22, 161. Kimura, M., Seveus, L., and Maramorosch, L. (1975). J . Ultrastruc. Res. 53, 366. Lechene, C. (1977). Am. J . Physiol. 232, F391. Lechene, C. P., and Warner, R. R. (1977). Annu. Rev. Biophys. Bioeng. 6, 57. Lechene, C. P., Bronner, C., and Kirk, R. G. (1976). J. Cell. Physiol. 90, 117. Marshall, A. T. (1977). Microsc. Acta 79, 254. Maynard, P. V . , Elstein, L., and Chandler, J. A. (1975). J. Reprod. Fertil. 43, 41. Mizuhira, V . (1976). Acta Hisrochem. Cyrochem. 9, 69. Murphy, J. A., Thompson, M. R., and Pappelis, A. J. (1976). J . Bacteriol. 127, 1465. Murphy, M. J., Jr., and Piscopa, 1. C. (1976). J . Submicrosc. Cyrol. 8, 269. Myklebust, R., Berg Justesen, N. P., and Saetersdal, T. S. (1975). Cell Tissue Res. 162, 323. Nellans, H. N., and Schultz. S. G. (1976). J . Gen. Physiol. 68, 441. Oschman, J. L., Hall, T. A., Peters, P. D., and Wall, B. J. (1974). J. Cell Biol. 61, 156. Paetau, A,, and Haltia, M. (1976). Acta Neuropathol. 36, 185. Parducz, A.. and Joo', P. (1976). J . Cell Biol. 69, 513. Pieri, C., As-Nagy, 1.. 2s-Nagy, V., Giuli, C., and Bertoni-Freddari, C. (1977). J. Ultrastruct. Res. 59, 320. Pintar, K., Funahashi, A., and Siegesmund, K. A. (1976). Arch. fathol. Lab. Med. 100, 535. Rick, R., Dorge, A., and Tippe, A. (1976). Experientia 32, 1018. Roinel, N. (1975). J. Micros. Biol. Cell. 22, 261. Rosado, A., Huacuja, L., Delgado, N. M., Merchant, H.,and Pancardo, R. M.(1977). Life Sci. 20, 647. Routledge, L. M., Amos, W. B., Gupta, B. L., Hall, T. A., and Weise-Fogh, T. (1975). J. CellSci. 19, 195. Saubermann, A. J., and Echlin, P. (1975). J. Microsc. (Oxford) 105, 155. Selvig, H.,Selvig, E., and Selvig, K. A. (1977). Caries. Res. 11, 62. Shuman, H., and Somlyo, A. P. (1976). Proc. Natl. Acad. Sci. U.S.A. 73, 1193. Shuman, H., Somlyo, A. V., and Somlyo, A. P. (1976). Ultramicroscopy 1, 317. Sjostriim, M., and Thornell, L. E. (1975). 1. Microsc. 103, 101. Skaer, R. J. (1975). Ciba Found. Symp. 35, 239. Skaer, R. J.. Peters, P. D., and Emmines, 1. P. (1974). J. Cell Sci. 15, 679. Somlyo, A. P., Somlyo, A. V., Devine, C. E., Peters, P. D., and Hall, T. A. (1974). J. Cell Biol. 61, 723. Somlyo, A. V., Silcox, J., and Somlyo, A. P. (1975). 33rd Annu. EMSA Meet., p. 532. Somlyo, A. V., and Somlyo, A. P. (1971). Science 174, 955. Somlyo, A. V., Shuman, H., and Somlyo, A. P. (1977). Nature (London) 268, 556. Sprey, G., Gliem, G., and Janossy, A. G. S. (1976). 2.Pflanzenphysiol. 79, 165. Spun, A. R. (1975). J. Microsc. Biol. Cell. 22, 287. Stamerjohn, D. M., and Hutchinson, T. E. (1977). 1. Micros. (Oxford) (in press). Stazen, P. J., and Foreman, D. W. (1977). J . Dent. Res. 56, 28. Tapp, R. L. (1975). J. CeNSci. 17, 449. Tsuchiya, T. (1976). Sep. Exp. 32, 1176, Urry, D. W., Hendrix, C. F., and Long, M. M. (1976). Calcif. Tissue Res. 21, 57. Yarom, R.,Peters, P. D., and Hall, T. A. (1974A). J. Ultrastruct. Res. 49, 405.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

155

Yarom, R., Peters, P. D., Scripps, M., and Rogel, S. (1974B). Hisrochemistry 38, 143. Yarom, R., Hall, T. A., and Polliack, A. (1976). Proc. Narl. Acad. Sci. U.S.A. 73, 3690.

B~BLIOGRAPHY Skeletal and Cardiac Muscle Ashraf, M., and Bloor, C. M. (1976). J. Mol. and Cell. Cardiol. 8, 489. Ashraf, M., and Bloor, C. M. (1976). Virchows Arch. B. 22, 287. Ashraf, M., Sybers, H. D., and Bloor, C. M. (1976). Exp. Mol. Parhol. 24, 435. Atsumi, S., and Sugi, H. (1976). J. Physiol. (London) 257, 549. Bacaner, M., Broadhurst, J., Hutchinson, T., and Lilley, J. (1973). Proc. Natl. Acad. Sci. U.S.A. 70, 3423. Buja, L. M., Dees, 1. H., Harling, D. F . , and Willerson, J. T. (1976). J. Hisrochem. Cyrochem. 24, 508. Myklebust. R., Justesen, N. P., and Saetersdal, T. S. (1975). Cell Tissue Res. 162, 323. Oberc, M. A., and Engel, W. K. (1977). Lab. Invest. 36, 566. Peters, P. D., Yarom, R., Dormann, A., and Hall, T. (1976). J. Ultrastrucr. Res. 57, 121. Saetersdal, R. S., Myklebust, R., Berg lustesen, N. P., and Engedal, H. (1977). Cell. Tissue Res. 182, 17. Sjostrom, M. (1975). J . Microsc. (Oxford) 105, 67. Sjostriim, M., and Thomell, L. E. (1975). 1. Microsc. (Oxford) 103, 101. Somlyo, A. V., Silcox, J., and Somlyo, A. P. (1975). 33rd Annu. EMSA Meer.. p. 532. hmlyo, A. V., Shuman, H.,and Somlyo, A. P. (1976). J . Cell Biol. 70, 336a. Somlyo, A. V., Shuman, H.. and Somlyo, A. P. (1977). Narure (London) 268, p. 556. Somlyo, A. V., Shuman, H., and Somlyo, A. P. (1977). J . Cell Biol. 74, 828. Yarom, R. (1977). Isr. J. Med. Sci. 13, 121. Yarom,R., and Chandler, 1. A. (1974). J . Hisrochem. Cyrochem. 22, 147. Yarom, R., Peters, P. D., and Hall, T. A. (1974). J . Ultrastruc. Res. 49, 405. Yarom,R., Peters, P. D., Scripps, M., and Rogel, S . (1974). Histochemistry 38, 143. Yarom, R., Wisenberg, E., Peters, P. D., and Hall, T. A. (1977). Virchows Arch. E . 23, 65. Smoorh Muscle

Ashton, F. T., Somlyo, A. V.. and Somlyo, A. P. (1975). J. Mol. Biol. 98, 17. Garfield, R. E., and Somlyo, A. P. (1975). 33rd Annu. EMSA Meer.. p. 558. Huddard. H., Hunt, S., and Oates, K. (1977). J . Exp. Eiol. 68, 45. Popescu, L. M., and Diculescu, I. (1975). J. Cefl Biol. 67, 91 1. Somlyo. A. P., Somlyo, A. V., Devine, C. E., and Peters, P. D. (1974). J. Cell Biol. 61, 723. Somlyo, A. P., Somlyo, A. V., Shuman, H., Sloane, B., and Scarpa, A. (1978). Ann. N.Y. Acud. Sci. (in press). Somlyo, A. P., Somlyo, A. V., and Shuman, H. (1977). Inf. Conf. X-Ray Opr. Microanaly. (1977) (in press). Somlyo, A. V., and Somlyo, A. P. (1971). Science 174, 955. Sornlyo, A. V., Shuman, H., and Somlyo, A. P. (1977). J. Cell Biol. 74, 828. Sugi, H., and Daimon, T. (1977). Narure (London) 269, 436. Vallieres, J., Scarpa, A., and Somlyo, A. P. (1975). Arch. Biochem. Biophys. 170, 659.

156

THOMAS E. HUTCHINSON

Lung

Ferin. J., Coleman, J. R., Davis, S., and Morehouse, B. (1976). Arch. Environ. Health 31, 113. Pintar, K., Funahashi, A., and Siegesmund, K. A. (1976). Arch. Parhol. Lab. Med. 100, 535.

Nerve

Duckett, S., Galle, P., and Said, G. (1977). Acra Neuroparhol. 37, 271. Gambetti, P., E ~ l k a r ,S. E., Somlyo, A. P., and Gonatas, N. K. (1975). J. Cell B i d . 64, 322. Hillman, D. E., and Llinas, R. (1974). J . Cell Biol. 61, 146. Lever, J. D., Santer, R. M., Lu, K. S., and Presley, R. (1977). J . Hisrochem. 25, 275. Nakagawa, S., Yoshida, S., Suematsu, C., Shimizu, E.,Hirohata, T., Kumamota, T., Yase, Y., Kawai, K., and Iwata, S. (1977). Speciafia I S , 1225. Oschman, J. L., Hall, T. A., Peters, P. D., and Wall, B. J. (1974). J . CellBiol. 61, 156. Parducz, A., and Joo’ F. (1976). J . Cell Biol. 69, 513. Paul, D. H., and Robens, B. L. (1976). Phys. Soc. 263, 10. Rice, R. W., and Moran, D. J. (1977). J . Exp. Zool. 201, 471. Rick, R., Dorge, A,, and Tippe, A. (1976). Experienria 32, 1018.

Epithelium

Amakawa, T., and Barka. T. (1975). J . Hisrochem. Cyrochem. 23, 607. Appleton, T. C., and Newell, P. F. (1977). Narure (London) 266, 854. Berridge, M. F., Gupta, B. L., Hall, T. A., Maddrell, S. H. P., Moreton. R. B., and Wall, B. J. (1976). Proc. Physiol. SOC. 26, 35. Gehring, L., Dorge, A., Nagll, W.,Schacky, B. V., Hausmann, G., and Thurau. K. (1972). In “Thin Section Microana” (J. Russ and B. Panessa, eds.), p. 141. EDAX Lab. Gupta, B. L., Hall, T. A.. Maddrell, S. H. P., and Moreton, R. B. (1976). Narure (London) 264, 284.

Hodson, S., and Marshall, J. (1970). Experientia 26, 1283. Jessen, H.,Peters, P. D., and Hall, T. A. (1976). J . Cell Sci. 22, 161. Landay, M. A., and Schroeder, H. E. (1977). Cell Tissue Res. 177, 383. Nellans, H.N., and Schultz, S. G. (1976). J . Gen. Physiol. 68, 441. Sohal, R. S., Peters, P. D., and Hall, T. A. (1977). Tissue & Cell 9, 87.

Kidney Calcifiable Tissue Berkovitz, B. K. B., and Heap, P. F. (1976). Caries Res. 10, 337. Boyde, A., and Reith, E. 1. (1977). Hisrochemistry 50, 347. Coleman, 1. R., and Terepka, A. R. (1972). J . Hisrochem. Cyrochem. 20, 401. Hall. T. A. (1975). In “Calcium Transport in Contraction and Secretion” ( E . Carafoli et al., eds.), p. 9. North-Holland Pub]., Amsterdam. Paetau, A.. and Haltia, M. (1976). Acra Neuropathol. 36, 185. Routledge, L. M., Amos, W. B., Gupta, B. L., Hall, T. A., and Weise-Fogh, T. (1975). J. CellSci. 19, 195. Selvig, H . , Selvig, E., and Selvig, K. A. (1977). Caries Res. 11, 62.

DETERMINATION OF SUBCELLULAR ELEMENTAL CONCENTRATION

157

Stazen, P. J., and Foreman, D. W . (1977). J . Dent. Res. 56, 28. Tsuchiya, T. (1976). Sep. Exp. 32, 1176. Urry, D. W.,Hendrix, C. F., and Long, M. M. (1976). Calcif. Tissue Res. 21, 57.

Blood Gwynn, A. ap., Evans, P. M., Jones, B. M. and Chandler, J. A. (1976). Cyrobios 16, 97. Kimzey, S. L.,and Bums, L. C. (1974). Cell Physiol. 84, 486. Kirk, R. G.. Crenshaw, M. A., and Tosteson, D. C. (1974). J . Cell. Physiol. 84, 29. k h e n e , C., Bronner, C., and Kirk, R. G. (1974). Proc. 9th Annu. Conf. Microbeam Anal. SOC., p. 9A.

Lechene, C. P., Bronner, C., and Kirk, R. G. (1976). J . Cell. Physiol. 90, 117. MacKenzie, A. P., and Luyet, B. J. (1%3). Biodynamica 9, 181. Murphy, M. J., Jr., and Piscopa, 1. C. (1976). J . Submicrosc. Cyrol. 8 , 269. &hi, 0. (1977). Cell Strucr. Funcr. 2, 51. Rick, R., Barth, F. G., and Pawel, A. V. (1976). J . Comp. Physiol. A. 110, 89. Roinel, N., and Passow, H. (1974). FEBS k r r . 41, 81. Skaer, R. J. (1975). Ciba Found. Symp. 35, 239. Skaer, R. J., Peters, P. D., and Emmines, J. P. (1974). J. Cell Sci. I S , 679. Skaer, R. J., Peters, P. D., and Emmines, J. P. (1976). J. Cell Sci. 20, 441. Stump, 1. G., Camithers. J., D’Auria, J. M., Applegarth, D. A., and Davidson, A. G. F. (1977). Clin. Biochem. 10, 127. Yarom, R., Hall, T. A., and Polliack, A. (1976). Proc. Natl. Acad. Sci. U.S.A. 10. 3690.

Gametes and Developmental Biology Battersby, S.,and Chandler, J. A. (1977). Fenil. Sreril. 28, 557. Chandler, J. A., and Battersby, S. (1976). J. Microsc. (Oxford) 107, 55. Chandler, J. A., and Battersby, S. (1976). J. Hisrochem. Cyrochem. 24, 740. Maynard, P. V.,Elstein, M., and Chandler, J. A. (1975). J . Reprod. Fenil. 43, 41. Rosado, A., Huacuja, L.,Delgado, N.M., Merchant, H., and Pancardo, R. M. (1977). Life Sci. 20, 647.

Microorganisms

Nolan, R. A., and Freake, G. W . (1974). J . fnverreb. Pathol. 23, 121. Osbom, D., and Hamilton, T. C. (1976). J. Cell. Physiol. 91, 409. Sicko-Goad, L.,Crang, R. E., and Jensen, T. E . (1975). Cyrobiologie 11, 430. Thibaut, M., and Ansel, M. (1976). Parassitologia (Rome) 17, 49.

Calcium Fisher, G., Kaneshiro, E. S., and Peters, P. D. (1976). J. Cell Biol. 69, 429. Hutchinson, T. E., Cantino, M. E., and Cantino, E. C. (1977). Biochem. Biophys. Res. Commun. 74, 336.

THOMAS E. HUTCHINSON Iron

Kimura, M.,Seveus, L., and Maramorosch, K. (1975). J. Lrlrrasrruct. Res. 53, 366. Shuman, H., and Somlyo, A. P. (1976). Proc. Nurl. Acud. Sci. U.S.A. 73, 1193. Spmy, €IGIiem, ., G., and Janossy, A. G. S. (1976). 2. P’anzenphysiol. 79, 165.

Reviews

Borland, R. M., Biggers, J . D., and Lechene, C. P. (1976). Dev. Biol. 50, 201. Hall, T. A., and Hohling, J. F. (1968). Proc. In?. Cong. on X-Ray Optics Microanal. 5rh, 1968, p. 582.

Hall, T. A.. Anderson. H. C., and Appleton, T. (1973). J . Microsc. (Oxford) 99, 177. Hutchinson, T. E. (1977). I n “Analytical and Quantitative Biology” (G. Meek, ed.), p. 213. Cambridge Univ. Press, London and New York. Lechene, C. (1975). Proc. IOth Annu. Conf. Microbeam Anal. Soc., p. MA. Lechene, C. (1977). Am. J . Physiol. (preprint for an editorial). Lechene, C. P., and Warner, R. R. (1977). Annu. Rev. Eiophys. Eioeng. 6, 57. Maugh, T. H., 11 (1977). Electron Probe Microanal. 197, 356. Mizuhira, V. (1976). 34th Annu. EMSA Meer., p. 410. Saubermann, A. J., and Echlin, P. (1975). J. Microsc. (Oxjord) 105, 155. Shuman, H., Somlyo, A. V., and Somlyo, A. P. (1977). Scanning Elecrron Microsc. 1, 317. Weaver, B. A. (1973). J. Hisrochem. 5, 173.

INTERNATIONAL REVIEW OF CYTOLOGY. VOL . 58

The Chromaffh Granule and Possible Mechanisms of Exocytosis HARVEY B . POLLARD. CHRISTOPHER J . PAZOLES. CARLE . CREUTZ.A N D ORENZINDER

.

Clinical Hematology Branch National Institute of Arthritis. Metabolism and Digestive Diseases. National Institutes of Health. Bethesda Maryland and Department of Clinical Biochemistry. Rambam Medical Center. Haif0 Israel

.

.

1. Introduction . . . . . . . . . . . . . . . . . . . . I1. A Statement of the Problems and a Prologue . . . . . . . . III . Chromaffin Granule Assembly . . . . . . . . . . . . . A . Cell Biology of Granule Assembly . . . . . . . . . . B . Protein Condensation . . . . . . . . . . . . . . . C . Packaging of Small Molecules . . . . . . . . . . . . D . Transport of Calcium and ATP . . . . . . . . . . . . E . The Structure of the Granule Core and the State of ATP . . F . Catecholamine Transport into Chromaffin Granules . . . . G . Intragranular Synthesis of Catecholamines . . . . . . . . IV . Approaches to the Problem of Calcium Action in Exocytosis . . A . Types of Theories . . . . . . . . . . . . . . . . B . The Actomyosin Hypothesis . . . . . . . . . . . . . C . The Direct Calcium Action Hypothesis . . . . . . . . . D . Synexin: A New Protein That Mediates Calcium-Dependent Membrane Fusion . . . . . . . . . . . . . . . . V . Biochemistry of the Secretory Event (Fission) . . . . . . . A . Approaches to the Problem . . . . . . . . . . . . . B . ATPandChromaffimGranuleOsmotic Lysis . . . . . . C . Anion Transport Sites in Granule Membranes . . . . . . D . Tests of the Hypothesis for Exocytosis by Anion Transport and Local Osmotic Lysis . . . . . . . . . . . . . . VI . Recovery of Granule Membranes after Exocytosis . . . . . . A . Coated Vesicle Hypothesis . . . . . . . . . . . . . B . Evidence for Direct Recovery . . . . . . . . . . . . VII . Adenylate Cyclase in Chromaffin Granule Membranes . . . . A . Pharmacological Properties . . . . . . . . . . . . . B . Cyclase in Other Granule Preparations . . . . . . . . . C . Role of Adenylate Cyclase in the Adrenal Medulla . . . . VIII . Conclusions . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

160 160

161 161 162 162 163 164 165

169 170 170 170 171 172 174 174 175 178 181 187 187 188

189 190

191 191 192 193

159 ISBN 0-12-364356-9

160

HARVEY B. POLLARD ET AL.

I. Introduction Chromaffin granules and chromaffin cells have been subjects of biological and chemical investigation for over a quarter of a century, and fundamental, seminal information has been obtained about the general process of secretion from cells. For example, these studies led to discovery of the vesicular storage of transmitter or hormone (Blaschko and Welch, 1953; Hillarp, 1953), secretion of vesicle contents but not whole vesicles (DeRobertis and Vaz Ferreira, 1957; Kirshner et al., 1966; Schneider et al., 1967; 0. H. Viveros et al., 1969), and the general requirement for free calcium in the secretory process (Douglas, 1968, 1974; Rubin, 1974). These earlier studies have been exhaustively reviewed in recent years (Smith, 1968; Smith and Winkler, 1972; Stjame, 1972; Viveros, 1974; Kirshner, 1974; Helle and Serck-Hanssen, 1975; Winkler and Smith, 1975; Winkler, 1977). In this article we turn our attention primarily to experiments performed in the last several years that have yielded new information about possible biochemical mechanisms involved in chromaffin granule assembly, calcium action, and exocytosis. 11. A Statement of the Problems and a Prologue

Chromaffin granules play several roles in adrenal medullary cells, some of which may be amenable to biochemical analysis. A possible representation of chromaffin granule activity in cells during secretion is shown in Fig. 1. in which the various possible stages of granule function are described using Palade’s nomenclature (1975). This view presumes that chromaffm granules are assembled in the Golgi apparatus, by analogy to studies on other cells such as those of the pancreas (Palade, 1975), though in fact studies on the ultrastructural biochemistry of chromaffin granule assembly are in a relatively primitive state (Holtzman, 1977; Winkler, 1977). However, an increasing amount of knowledge is becoming available about possible mechanisms for loading mature granules with their small-molecule constituents (catecholamines, CaZ+,ATP), and it is possible that these mechanisms are also involved in de now assembly. Once assembled, the granules are ready to perform their apparently primary function: exocytosis. This complex process appears to require an increased intracellular calcium concentration and may lead to the fusion or juxtaposition of granules and plasma membranes. This initial fusion occurs between the plasma membrane inner leaflet and the granule outer leaflet and has been described as a pentalaminar complex in several cell types. This is described in more detail in Section IV. Finally, after further ultrastructural changes, the barrier between the vesicle interior and the extracellular medium breaks (undergoes fission) and secretion

CHROMAFFIN GRANULE AND EXOCYTOSIS

1"

\

-.

161

6 INTEGRATION

(ContentrJ

FIG. 1. Representation of the sequence of events that may illustrate the life cycle of a chromaffin granule. Granules may be assembled in the Golgi apparatus ( I ) and become cytoplasmic granules (2). Upon an increase in cytoplasmic calcium, the granule fuses to the plasma membrane (3). A pentalaminar complex is often observed. The fission event (4) then follows, resulting in a complete loss of granule contents. Recovery of the vesicle membrane then ensues. The membrane may be recovered by immediate segregation (5) or may become integrated (6) in a transient fashion into the plasma membrane for eventual recovery. Segregation as in ( 5 ) can occur, or the vesicle membrane may be recovered as coated vesicles (7) in a more leisurely fashion. The recovered vesicle membranes may be reassembled into intact granules by the original or another mechanism, or the vesicle membranes may be simply scavenged by lysosomes.

ensues. These processes of fusion and fission have hitherto been quite mysterious. However, on the basis of recent studies on both chromaffin granules and cells, to be described in this article, it is possible that both fusion and fission are related to specific protein factors, and that the fission step itself may actually be a localized osmotic lysis event. After exocytosis, the granule membrane may be recovered in some manner into the cell. However, various possible mechanisms of membrane recovery are depicted in Fig. 1, because evidence in favor of any specific model is not complete. This article is explicitly divided into descriptions of each of these problem areas.

III. Chromaffin Granule Assembly A. CELLBIOLOGY OF GRANULE ASSEMBLY

The protein components of chromaffin granules, such as dopamine-8hydroxylase (DBH, EC 1.14.17.1) and chromogranin A, are probably synthe-

162

HARVEY B. POLLARD ET AL.

sized on ribosomes in the rough endoplasmic reticulum (RER)and may finally fold into their native conformations upon entry into the luminal aspect of the smooth endoplasmic reticulum (SER).This statement is based on analogy to the better understood pancreatic zymogen granule system (Palade, 1975; Holtzman, 1977; Winkler, 1977). At this point additional modifications can occur, including carbohydrate addition (Winkler, 1977), proteolysis, disulfide bond formation, and hydroxylation of proline (Steiner el al., 1974; Uy and Wold, 1977). Finally, the proteins to be packaged may enter the Golgi apparatus and become concentrated or condensed within membranous vesicles. The origins of vesicle membrane proteins and nonmembrane proteins within vesicles are not presently evident, though it is clear that the two types of protein compartments turn over at different rates in the adrenal medulla and other tissues (Melodolesi, 1974; Wallach et al., 1975; Winkler ef al., 1974). Finally, small molecules such as ATP, divalent cations, and catecholamines must be added at some point, though where and when are not known.

B. PROTEIN CONDENSATION The protein condensation step in chromaffin granule assembly is not well understood. It may involve calcium or other ions, by analogy to proposals by Palade (1975) or Steiner e? al. (1974) for other systems. Indeed, the apparent Ca2+and Mgz+concentrations within chromaffin granules are relatively high (30 and 6 mM, respectively; Phillips et al., 1977), and the protein concentration may be as high as 210 mg/ml (Phillips et al., 1977). Proteolytic events could also potentiate protein condensation, as is apparently the case for insulin packaging (Novikoff et al., 1975; Steiner et al., 1974). Indirect evidence suggests that proteolytic events occur in the chromaffin system, since Hortnagl et a1.'(1974) showed that antibodies to purified chromogranin A interacted with smaller granule lysate peptides but not DBH.

C. PACKAGING OF SMALL MOLECULES

In addition to the high protein and divalent cation content, the chromaffin granule must also accommodate high concentrations of catecholamines (possibly 0.71 M ) and ATP (possibly 0.16 M ) (summarized in Pollard et al., 1976b; Phillips et al., 1977). It is possible that granule membrane enzymes mediate specific uptake of these smaller components during assembly. For example, in the otherwise mature granule, new uptake systems have been recently defined for both calcium (Kostron et al., 1977a) and ATP (Kostron et al., 1977b), in

CHROMAFFIN GRANULE AND EXOCYTOSIS

163

addition to the well-known catecholamine uptake system (Kirshner, 1962; Carlsson et al., 1963). The purpose of the high concentration of ATP in chromaffin granules is not known, though it is a feature also found in other neurosecretory esicles (Dowdall er al., 1976) and secretory granules (Wallach and Schramm, 971; Clemente and Meldolesi, 1975; Pletscher et al., 1974). D. TRANSFORT OF CALCIUM

AND

ATP

Calcium uptze by isolated chromaffb granules has been studied by Kostron et al. (1977a) who found it to be independentof MgZ+-ATPconcentration and to be unaffected by proton ionophores and inhibitors such as azide. In this sense, granule uptake of Ca2+was different from Ca2+uptake by mitochondria. Uptake of Ca2+ by granules, however, was temperature-sensitive, saturable with respect to [Ca2+],and inhibited by S P but not Mg2+.In addition, it was found that apparently newly formed granules did not take up Ca2+preferentially, a result different from that of Wallach and Schramm (1971) obtained in studies on salivary glands. ATP and ADP have also been found to be transported into granules by a specific, carrier-mediated uptake system (Kostron et al., 1977b). The saturable, temperature-dependentprocess was activated by Mg2+,but inhibited by N-ethylmaleimide (NEM), by the proton ionophore carbonyl cyanide N-chlorophenylhydne (CCCP), and by atractyloside,a compound that also inhibits nucleotide transport in mitochondria. However, ATP or ADP uptake by chromaffin granules was distinct from nucleotide exchange by mitochondria in that NEM and CCCP did not affect the mitochondrialprocess. It was also suggested that there was a close relationship between the catecholamine and nucleotide uptake systems and the generation of pH gradients across the granule membrane, since CCCP inhibited all three processes. However, the atractyloside sensitivity of ATP transport in granules might lead one also to consider AV as the force inducing ATP (or ADP) to enter the granule, since atractyloside inhibits potential sensitive nucleotide exchange in mitochondria. In the case of mitochondria, the ATPIADP ratio is higher outside the organelle than inside and may be equilibrated with AV (Klingenberg and Rottenberg, 1977). In the case of chromaffin granules exposed to external ATP, AV is reversed in sign from that for mitochondria (80 mV at 37°C; Pazoles and Pollard, 1978), and the ATP concentration within granules is accordingly much greater than that outside granules. For example, if ATP is distributed as a singly charged species (meaning AV = -58 log A T P JATP,), then an external ATP concentration of 5 mM would correspond to an internal ATP concentration of 117mM. However, at pH 7.5, the charge on ATP is -4, while that on Mg2+-ATP is -2, and a Nernstian distribution with n = 1 would not be expected unless transport of other charged species were involved, as in mitochondria. Kostron et al. (1977b) also concluded, in agreement with Pletscher etal. (1974), that the granule

164

HARVEY B. POLLARD ET AL.

ATP uptake system might be part of a process to create ATP-catecholamine storage complexes within granules.

E. THESTRUCTURE OF THE GRANULE CORE AND THE STATE OF ATP One of the oldest and most durable ideas about the organization of the granule core has been that ATP might function as an anionic counterion for cationic catecholamine stores (Falck et al., 1966; Uvnas and Aborg, 1977). The ATPI catecholamine molar ratio is 1:4 (150 mmoles/600 mmoles; e.g .,Phillips et af., 1977), and this appears to correlate with the four negative charges that ATP would carry at the presumed intragranularpH of 7.4 (two on the y phosphate and one each on the a and fi phosphates). Complexes between catecholamines and ATP with approximately the correct molar ratios were even prepared in solutions containing high concentrations of both compounds (e.g., Berneis et al., 1974). However, recent studies of intragranuiar pH using the methylamine-’*C distribution method have shown the intragranular pH to be relatively acidic (Pollard et uf., 1976a; Johnson and Scarpa, 1976a,b; Casey et al.. 1977; Pazoles and Pollard, 1978), implying that fewer anionic sites on ATP might be available than previously anticipated. Attempts to detect or define ATP-catecholamine complexes within intact granules, primarily by NMR (e.g., Weiner and Jardetsky, 1964; Daniels et al., 1974; Sharp and Richards, 1977a,b)or fluorescence (e.g., Steffen et al., 1974), have not met with conspicuous success. In addition, many workers have attempted to reconstitute granule contents in stoichiometricproportions in order to reproduce presumed conditions in the granule core (e.g., Muro ez al., 1971; Tuck and Baker, 1973; Rajan el al., 1976; Casey et al., 1977; Njus et al., 1978), and in some cases have defined specific conditions where both ATP and catecholaminesinteract. However, Sharp and Richards (1977a.b) concluded, on the basis of and ‘HN M R that ATP and epinephrine were in free solution within the granule and that neither constituent interacted appreciably with the other. One assumption, common to many of these structural studies, was that simple, in v i m solutions of granule contents were good models for the granule core. However, recent studies by Pollard et af. (1979s) using slP NMR have questioned this assumption. The NMR chemical shift of the terminal (7) phosphate of ATP is particularly sensitive to pH changes near neutrality, thereby making ATP within granules an excellent indicator of environmental pH. Casey et al. (1977) were the first to apply this concept to the problem of determiningthe intragranular pH. However, one fundamental but well recognized problem with the method was the lack of an internal calibration method that would relate an observed chemical shift to a spcific interval pH value. Pollard et al. (1979) solved this problem by adding sufficient amounts of weak acid (acetate), weak

-

CHROMAFFIN GRANULE AND EXOCYTOSIS

165

base (ammonia), or nigericin-K+ to collapse the ApH, and under these conditions varied the external pH between 3 and 8. The result was that the interna€pH was also varied in an exactly known fashion, and the 31PNMR signals Rorn ATP could be measured as a function of internal pH. The resulting titration curve (Fig. 2) was quite different from the simple curves of either Na,-, Ca2+-,or Mg2+-ATP in solution or of ATP in a physiologicallystoichiometric mixtureof granule lysate proteins, epinephrine,calcium, and magnesium, and the internal pH was found to be 5.7 f 0.1. This value was similar to that deduced by Casey et af . ( 1977)from a combination of “C-methylamine distribution and 31PNMR studies. Pollard et af. (1979a)also found that the titration curve for intragranular ATP was consistent with a folded structure for the nucleotide in which the terminal ( y ) phosphorus atom came to lie approximatelycoplanar with the purine ring(s). The plausibility of this structure was underlined by the fact that such a folded ATP structure was in fact found in crystalline Na,-ATP by Kennard et af. (1971). However, x-ray diffraction data from granule suspensions(Pollard et af., 1973)provided no evidence for a crystalline core, and it thus appears that the structure of ATP within the granule only has some crystallike characteristics. INTO CHROMAFHN GRANULES F. CATECHOLAMINE TRANSPORT

The catecholamine transport system, which requires Mg2+-ATP and is reserpine-sensitive, has several evident functions, some of which are very likely

4’ 2

1

3

4

5

.

6 PH

7

t

1

I

E

9

10

FIG. 2. NMR titration o f intragranular ATP as a function o f intragranular pH at 25°C. The data are a composite of titrations of the y-phosphate chemical shift in 0. I M potassium acetate (pH < 6.0 only), 0.1 M ammonium sulfate (whole range of pH). and 4 pM nigericin-K+ (pH > 5 . 5 only). The total osmotic strength of the system was 950 mOsM, of which 200 mOsM was potassium isethionate (acetate and nigericin-K+ curves) or potassium chloride (ammonium sulfate curve). The remaining osmotic strength was made up with 50 m M MES buffer and sucrose. (From Pollard e r a / . , 1979a.)

166

HARVEY B. POLLARD ET AL.

to be involved in granule assembly. One important function of the transport system is to bring dopamine into the granule where it can be converted to norepinephrine by intragranular DBH (Kirshner, 1962). DBH in adrenal medullary cells, as in sympathetic nerves (Lagercrantz, 1976), is exclusively localized to granules, being in both soluble and membrane-bound forms, and each granule has only a few copies of this enzyme, perhaps as few as 20 (Zinder et al., 1977). Yet another role of the catecholamine transport system is to replace 1-norepinephrine with epinephrine when local glucocorticoid levels rise (as at parturition in many mammals) and induce phenyl N-methyltransferase (PNMT, EC 2.1.1.28), a soluble cytoplasmic enzyme (cf. Wurtman and Axelrod, 1966; Ciaranello et al., 1973). By an as yet poorly understood process, the endogenous 1-norepinephrine leaves the granule and enters the cytoplasm, becomes methylated to form epinephrine, and reenters the granule. A third role for the transport system may simply be a vegetative one of maintaining the granule catecholamine content at a certain steady-state concentration. Granule catecholamines appear to exit the granule spontaneously, only to be replaced by the active transport system. The mechanism of Mg2+-ATP-inducedcatecholamine transport is only now becoming understood. Taugner (1971, 1972) showed that catecholamine uptake by granules was related to ATP hydrolysis and was somewhat stereospecific for the 1 form. She proposed a carrierlike mechanism (though in different words) for the transport process. Slotkin (1973) also concluded that transport was mediated by a mobile carrier mechanism. Very similar conclusions were reached by Phillips (1974a,b), who developed methods for studying transport with granule “ghosts. ” Direct evidence relating ATP hydrolysis to transport in intact granules came from studies on nonhydrolyzable ATP analogs such as AppNHp (Hoffman et al., 1975b) and AppCHzp (Phillips, 1974a; Hoffman et al., 1976b) showing that they did not support transport. Important discoveries were reported by Bashford et al. (1975a,b, 1976), and reviewed recently by Njus and Radda (1 978), that entirely changed the complexion of catecholamine transport studies on granules. Catecholamine transport into intact granules was found to be inhibited by proton ionophores such as carbonylcyanide p-trifluromethoxyphenylhydrazone (FCCP) and granule membrane ATPase was also found to be activated by these same agents. Von Euler and Lishajko (1969) had earlier observed the inhibition of norepinephrine uptake and release in splenic nerve vesicle preparations by similar agents. However, Bashford et al. (1975a) also found that Mg2+-ATP,at 37”C, caused granules to bind the fluorescent probe 8-anilino-1-naphelene sulfonic acid and, by analogy to results from mitochondrial studies, suggested that the ATPase pumped protons into the granule, thus making the granule transmembrane electrical potential positive inside. Finally, they suggested that the proton potential (ApH) induced

CHROMAWIN GRANULE AND EXOCYTOSIS

167

by the Mg*+-ATPaseactivity was the mechanism responsible for coupling the ATP requirement to catecholamine uptake. Pollard et al. (1976a) showed directly with 3JSCN- as a tracer that the granule interior indeed became positive when exposed to Mgz+-ATP. However, they did not ascribe it to an inward proton current or ATPase activity at the time. Casey et al. (1977) later presented evidence from 31P NMR and methylamine studies that exposure of granules to Mge+-ATP at 25°C acidified the granule interior only if the medium also contained permeant anions such as C1-. The latter experiments were corroborated by Pollard et al. (1979) who quantitated the changes in ApH in absolute terms using 31P-NMR. It is relevant to the concept of granule ATPase as a proton-pumping enzyme that recent attempts by Apps and Glover (1978) to isolate the ATPase with dichloromethane have been successful. Dichloromethane had been used to prepare mitochondrial F, ATPase previously, and these investigators also interpreted their sodium dodecyl sulfate (SDS) gels of purified granule ATPase as indicating a structural analogy between subunits of granule ATPase and F, ATPase. Several specific models for coupling the ATPase to catecholamine transport have been proposed. Bashford et al. (1976) proposed models in which specific carriers for catecholamines moved substrates into the granule interior where the substrates were protonated by protons derived from the ATPase and thus trapped within. Alternatively, Johnson and Scarpa (1976a,b) and Johnson et al. (1978) proposed that catecholamines might simply permeate the granule membrane as neutral species and equilibrate with the pH gradient across the granule membrane. This concept was originally demonstrated experimentally by Nichols and Deamer (1976) in studies on liposomes. Here again, however, the substrates would be trapped as protonated species on the granule interior. The available data, however, appear to favor transport by a carrier model rather than by diffusion. For example, granule uptake is stereospecific, is competitively blocked by compounds such as reserpine, and requires added Mg2+-ATP. The diffusion-equilibration model does not account for these requirements. In addition, at the optimal pH for transport ( 7 . 3 , the internal pH is already low (5.7), and ATP ought not be further needed. However, in the absence of ATP specific catecholamine transport is indeed extremely low. The general properties of transport by chromaffin granules have also been shown to be properties of granule ghosts in recent studies by Phillips and Allison (1978a) and Phillips (1978b). These authors superimposed artificial pH gradients across granule membranes and activated transport. The exact mechanism for coupling ATP hydrolysis, proton transport, membrane potential, and catecholamine transport thus remains unknown. According to the chemiosmotic hypothesis, vectorial translocation of protons across a mem-

168

HARVEY B. POLLARD ET AL.

brane can lead to the generation of a transmembrane electrochemical proton gradient, or proton-motive force, Ap (Boyer et al.. 1977). Ap is composed of a chemical component based on ApH, and an electrical component A*, Ap is the difference between these forces, AT - 2.3RT/F ApH. The question is whether transport is coupled to Ap, or to either of its specific components A'$ and ApH. In the resting chromaffin granule the chemiosmotic hypothesis may not be useful for describing the energetic state, though a consideration of the resting granule can be an instructive caveat concerning the system. For example, the internal pH is set at 5.7 -+ 0.1 (Pollard et al., 1979a) in a manner relatively independent of the external pH, and by simply changing the external pH various values of ApH can be generated. If no permanent anion is in the medium, a direct relationship between ApH and AY can be observed using methylamine-"(2 and 35SCN-(Pollard et al., 1976a). However, this relationship is misleading because when, for example, C1- is added to the medium, the direct relationship between ApH and AY is lost (Fig. 3). Addition of Cl- makes the internal potential more negative, presumably via the anion transport site recently detected in granule membranes by Pazoles and Pollard (1978). However, while AY changes, no change in internal pH is concomitantly detectable. Upon addition of MgZ+-ATP, the chromaffi granule is activated and the transmembrane potential becomes relatively positive inside (Pollard et al., 1976a). Yet the intragranular pH is not reduced unless significant amounts of permeant anions are available in the medium (Casey et al., 1977; Pollard et al.,

FIG. 3. Influence of external C1- and pH on the transmembrane potential of isolated chromafin granules. The study was performed at 2°C. and AY was measured from the distribution of S'YN, as described by Pollard ef al. (19768).

CHROMAFFIN GRANULE AND EXOCYTOSIS

169

1979a) and the temperature is approximately 20°C or more. The reason is that the inward proton current generated by the ATPase (Bashford er al., 1976) is sufficient to create a positive A* that in the absence of permeant anion electrically limits further proton entry. The intragranular buffering capacity may also limit the detection of ApH changes under these conditions (Casey er al., 1977). More protons are allowed into the granule only if permeant anions are available in the medium for electroneutral cotransport of H+ and C1-, and only under these conditions does ApH change. These observations might lend insight to catecholamine transport by granules. Yet catecholamine transport is no better under high [Cl-] conditions than it is in plain sucrose (see Hoffman et al., 1976a). Thus the change in ApH induced by the exposure of granules in C1- media to Mg2+-ATPmay not be mechanistically related to transport. These observations should serve only to emphasize our need for more information about the basis of resting potential in granules and the coupling of ATP hydrolysis to catecholarnine transport. G . INTRAGRANULARSYNTHESIS OF CATECHOLAMINES

As mentioned earlier, dopamine must enter the granule before it can be converted to norepinephrine by DBH. If this were the only mechanism for the synthesis of norepinephrine in chromaffh tissue, as it appears to be, the in v i m cofactors necessary for DBH action ought to be found within the granule. These include ascorbate, catalase, dicarboxylic acids such as fumarate, and an optimal pH of approximately 5.5 (e.g., Nagatsu and Udenfriend, 1972). The internal pH is indeed 5.7, and Terland and Flatmark (1977) have recently found 30 mM ascorbic acid within granules. Catalase has also been detected in particulate fractions of adrenal medulla (C. J. Pazoles, E. Weinbach, and H. B. Pollard, unpublished observations). Thus the chromaffin granule has many of the components necessary for I-norepinephrine synthesis that have been discovered by independent in virro studies. We conclude from our analysis of granule assembly that granule membranes contain much of the enzymic machinery that would be necessary in principle for adding small molecules (Caz+,ATP, catecholamines) to an otherwise preformed chromaffm granule. Whether or not they are actually involved in granule assembly, rather than in just maintenance of mature granules, remains to be seen. One could anticipate more dramatic progress in this area in the near future when these problems are examined with the newly developed techniques for culturing bovine adrenal medullary cells (i.e., Hochman and Perfman, 1976; Schneider et al., 1977; Brooks, 1977; Fenwick et al., 1978) and rat pheochromocytoma (PC 12) cell lines (Green and Tishler, 1976; Schubert and Klier, 1977). Utilization of new gradient materials such as Metrizamide (Moms and Schovanka, 1977) will

170

HARVEY B. POLLARD ET AL.

also allow purification of small amounts of chromaffin granules with very high yields and should prove useful in the future.

IV. Approaches to the Problem of Calcium Action in Exocytosis A. TYPESOF THEORIES The calcium requirement in secretion has been appreciated at least since the pioneering studies of Locke (1 894)on the frog neuromuscular junction. In later years it became apparent that an increase in intracellular free Ca2+ was the key requirement, and many theories have been introduced to explain calcium action. However, one assumption common to most theories was that the rate-limiting step in exocytosis was a calcium-dependent fusion or juxtaposition of secretory vesicles and plasma membranes. Dodge and Rahamimoff (1967), in a study based on the calcium dependence of neurotransmission in the frog neuromuscular junction, proposed that there might be reactive sites on the cell membrane (“x sites”) which permitted secretory vesicle adhesion in the presence of free Ca2+. Other workers have hypothetically viewed calcium action in terms of a change in the surface charge on a vesicle (Bass and Moore, 1966), a site of cyclic nucleotide action (Rasmussen, 1970), a site for localization of specific phospholipids (Papahadjopoulos et af., 1973), a site of action for phospholipases (Keough and Thompson, 1972), a charge-screening event in which calcium might neutralize negative charges on both vesicle and membrane (Mathews, 1970; Cooke et al., 1973), an anionic site on both vesicle and plasma membrane that could be bridged by CaZ+(Hubbard et al., 1968; Dean, 1975), or a site promoting the interaction of vesicle myosin and plasma membrane actin (Berl et al., 1973). Izumi et al. (1977) proposed that a microsomal factor from adrenal medulla mediated calcium activation of ATP, Cl--dependent release from isolated chromaffin granules. Diliberto et al. (1978) have suggested that protein carboxymethylase might potentiate calcium action by lowering the net negative charge on a granule. Some of these hypothesis have been partially tested in the adrenal medulla and other tissues, and it is important to note that none of these ideas are mutually exclusive.

B. THEACTOMYOSIN HYPOTHESIS It is reasonable to suppose that calcium action might be mediated by a specific protein, and the actomyosin hypothesis has been the subject of intense investigation in the last several years. However, the status of actomyosin, as specifically

CHROMAFFIN GRANULE AND EXOCYTOSIS

17 1

related to membrane fusion, is presently in serious doubt. The verbal analogy between Ca2+-dependent stimulus-secretion coupling (Douglas and Rubin, 1963) and Ca2+-sensitivestimulation-contraction coupling in muscle was interpreted literally by investigators who considered actomyosin a possible mediator of exocytosis. Actomyosin had been observed in nonmuscle cells, including brain (see T. D. Pollard and Weiling, 1974, for a review), and it was proposed by Berl et al. (1973) that exocytosis in synaptosomes might proceed by an interaction between actin on the inner aspect of the plasma membrane and myosin on the vesicle membrane. Evidence was obtained that actomyosin was present in the adrenal medulla (Poisner, 1970; Trifaro and Ulpian, 1975; Bumdge and Bray, 1975), and Burridge and Phillips (1975) discovered conditions under which polymerizing actin could be caused to associate with chromaffin granule membranes. Thus the appropriate protein components appeared to be properly situated for involvement in exocytosis. However, the isolated chromaffin granule membranes contained no intrinsic myosin (Bumdge and Phillips, 1975). In addition, granules prepared in sucrose were also devoid of actin, though actin (and tubulin) were present in plasma membrane fractions from adrenal medulla (Zinder et af., 1978). Earlier Blitz and Fine (1974) had also questioned the specificity of actin and myosin distribution in synaptosomes and had concluded that myosin was not specifically localized to synaptic vesicle membranes. In a more recent study on this problem, Creutz (1977) prepared rhodamine-tagged antibody to purified adrenal medulla myosin and demonstrated that up to 90% of the immunoreactive myosin in bovine adrenal medulla slices was in fact associated with connective tissue. Only a small amount was localized to chromaffin cells. Similar distributions of myosin were also found for the brain and other bovine secretory tissues. Thus it seems less likely that actomyosin in the adrenal medulla is directly involved in Cazfdependent membrane fusion, though it still may be important as a mechanism for intracellular movement of vesicles and other organelles. Jockusch et al. (1977) have proposed recently that actin binding to chromaffin granules might instead be via a-actinin. a-Actinin was detected on granules prepared in high salt, but not in sucrose. Is it possible that sucrose may labilize the association of granules with cytoskeletal elements? ACTIONHYFQTHESIS C. THEDIRECTCALCIUM Edwards et al. (1974) and later Green et al. (1978) found that high concentrations of Ca2+or Mg2+(2-10 mM) aggregated chromaffin granules, and Moms and Schober (1977) detected divalent and trivalent cation-binding sites on granule membranes. Ultrastructural analysis subsequently demonstrated that the external membrane leaflets of aggregated granules fused to form pentalaminar

172

HARVEY B. POLLARD ET AL.

complexes, and submembrane particles were redistributed around the zones of fusion (Schober et al., 1977). In these experiments, fission did not occur, and it was concluded that this process was a biochemical model for the fusion event. This conclusion, however, must be considered in terms of the possibly nonphysiologicalconcentrationsof CaZ+needed to observe effects, the lack of cation specificity (Mg2+versus Ca2+),and the fact that even endoplasmic reticulum from liver can be quantitatively precipitated at high divalent cation concentrations (Schenkman and Cinti, 1972). Recent ultrastructural studies by Dahl and Gratzl(l976) on beta granules from islets of Langerhans, and by Gratzl et al. (1977) on neurosecEtory granules from bovine neurohypophysis, have demonstrated that secretory granules from both tissues can apparently be induced to undergo fusion with one another and fission into one another in the presence of micromolarconcentrations of calcium (but not magnesium). In the neurohypophysis system, fusion and fission of secretory granules was also observed with membrane sheets presumptively identified as plasma membranes. Submembrane particles in granules were observed to cluster in patches, and in aggregated granules the regions where membranes were juxtaposed were relatively enriched with these submembrane particIe patches. One basic problem with these studies, recognized by these workers, was that only 5-6% of the total granule profiles were ever affected by the addition of calcium, compared to a baseline, at low Ca2+,of 1% of the total profiles. They concluded in each case that most of the granules might be in a denatured state with regard to calcium sensitivity. D. SYNEXIN: A NEWPROTEIN THATMEDIATES CALCIUM-DEPENDENT MEMBRANE FUSION

There are many examples of secretion in which the secretory vesicles fuse not only with the plasma membrane but also with one another to form channels to the cell exterior (Lagunoff, 1973; Rohlich et al., 1971;Ichikawa, 1965; Amsterdam et al., 1969). This has been termed compound exocytosis, and it is plausible that the process of vesicle aggregation, as described in the preceding sections, can present a valid model for the initial interactions between vesicles and plasma membranes during exocytosis. Creutz et al. (1978) recently reported the discovery of a new protein from the adrenal medulla that promoted calcium-dependent fusion of chromaffin granule membranes. The minimum concentration of calcium needed for fusion was 6 pM, and neither Ba2+,S P , or Mg2+had activity. The regions of contact between granules in the aggregates formed by this protein were morphologicallysimilar to the pentalaminar contacts formed between vesicles and between vesicles and plasma membranes in secreting cells. In addition, the protein caused nearly all the granules to interact, and on this basis the protein

CHROMAFFIN GRANULE AND EXOCYTOSIS

173

was named synexin, from the Greek word synexis, meaning “meeting. *’ Exarnples of fused granules are shown in Fig. 4. Synexin has several interesting biological and chemical properties that distinguish it from other calcium-binding proteins in the adrenal medulla and other tissues (for a useful review of these calcium-binding proteins, see Kretsinger, 1976). The isolation procedure involved precipitation in ammonium sulfate, gel filtration, and final purification on hydroxylapatite. Aggregating activity was assayed on the basis of increased turbidity of purified chromaffin granule suspensions, and the kinetics of aggregation could be easily followed over a 15-minute period. The purified protein had a molecular weight of -47,000 on SDS gels. The calcium concentration for half-maximal turbidity increase was 200 p M , but electron microscope analysis revealed that most of the granules were fused with at least one other granule when the calcium concentration was 2 6 pM. Hill analysis of the turbidity of an aggregated granule suspension as a function of [Ca2+]revealed apparent positive cooperativity (nH = 4), which was in principle very reminiscent of the results of Dodge and Rahamimoff (1967) on the calcium dependence of neurotransmission at the frog neuromuscular junction. However, the Hill coefficient for the formation of “activated” synexin by Ca2+ was 2.3. Synexin activity was destroyed by heating at 60°C for 5 minutes, and aggregation decreased strongly below 25°C. Aggregation was stimulated two- to threefold by salts of monovalent ions, up to 30 mM, and could be prevented by prior fixation of granules with glutaraldehyde. These properties, as well as the insensitivity of the reaction to various sugars, distinguished synexin activity from the wheat germ agglutinin-induced granule aggregation reaction reported by Meyer and Burger (1976). Finally, when activated, the protein apparently bound to granules and could be centrifuged out of solution in this form. In later studies, Creutz et al. (1979) found that calcium could act directly on

FIG. 4. High-magnification electron micrographsof chromaffin granules incubated with synexin at *a*+ = 4.0 (A) and 5.2 (B-D) showing fusion of outer membrane leaflets to form typical pentalaminar complexes. Arrowheads point to pentalaminar contact regions. (From Creutz et of., 1978 .)

174

HARVEY B. POLLARD ET AL.

purified synexin to form paracrystalline arrays. By electron microscopy synexin rapidly self-associated into 150 A by 50 8, rods which then formed the larger arrays by extensive side-to-side and end-to-end interaction. The self-association reaction exhibited precisely the same calcium titration curve and specificity for calcium that was seen in the synexin-induced chromaffin granule aggregation reaction. This suggested that calcium-induced self-association of synexin might be a prerequisite for, or a necessary concomitant with, membrane fusion. We have also detected synexin activity in both bovine brain and human platelets (C. E. Creutz, H. B. Pollard, and C. J. Pazoles, unpublished). On the basis of these data it is thus possible that synexin is the intracellular receptor for calcium in the process of exocytosis from the adrenal medulla and perhaps other cells.

V. Biochemistry of the Secretory Event (Fission) A. APPROACHES TO THE PROBLEM Exocytosis has been visualized by ultrastructural analysis in secretory systems such as the exocrine (Jamieson and Palade, 1974; Palade, 1975) and endocrine (Orci et al., 1973) pancreas, frog neuromuscular junction (Heuser and Reese, 1973), mast cells (Chi ef af ., 1976; Lawson et al., 1977), and adrenal medulla (Diner, 1967; Grynszpan-Winograd, 1971; Smith et af., 1973), and in many other tissues. An event sequence for exocytosis, such as that given in Fig. I, has been suggested in some of these studies, though the exact ulfrastructural details have varied. In general, after the fusion of secretory vesicles and plasma membranes, the barrier separating the vesicle interior and the extracellular medium eventually undergoes fission, or breakage. Until recently, the biochemical details of this process were particularly obscure. One productive approach to this problem has been to study ATP-induced release of epinephrine from isolated chromaffin granules (Oka et al., 1965; Poisner and Trifaro, 1967; Lishajko, 1969; Hoffman et af., 1976b). The assumption implicit in many of these studies was that the chemistry of granule release might apply to the fission step in exocytosis. The reasoning was based on the premise that granule components were involved in both processes and that both appeared to be associated with a break in the secretory granule membrane. The validity of this assumption has been questioned by some workers (Casey ef al., 1976), and only recently has it been demonstrated that the chemistry of the granule release reaction may indeed define the chemical principles of exocytosis at least in some cells.

175

CHROMAITIN GRANULE AND EXOCYTOSIS

B. ATP A N D CHROMAFFIN GRANULE OSMOTIC LYSIS It has been known for many years that isolated chromaffin granules, under isotonic conditions at 3TC, could release their contents (catecholamines, proteins, ATP, Ca2+)when exposed to Mg2+-ATPand large amounts of C1- or other permeant anions (for an example, see Fig. 5 ) . However, only recently have the detailed biochemical reactions involved in this process come to light and, as discussed in Section V,D, these studies have led to new and perhaps fundamental insights into the more general process of exocytosis. It is now apparent that the granule release reaction is actually due to osmotic lysis and release of the entire granule contents. Earlier workers (summarized in Viveros, 1974) had come to this conclusion, and recently more detailed studies by Pollard et af. (1976a) and others (Casey et af., 1976) showed that release could be suppressed by raising the osmotic strength of the medium with either salt or sucrose. A semilogarithmicplot of percent epinephrine released as a function of external osmotic strength (Fig. 6) was linear and allowed one to calculate that, under optimal release conditions ([Mg2+-ATP]= 1 mM; [KCI] = 90 mM), an increase in the external osmotic pressure of -660 mOsM (the difference between 300 and 960 mOsM) could suppress release totally. The simplest interpretation of these results was that the osmotic content of releasing granules must at most increase by this amount, thereby provoking lysis under otherwise isotonic conditions in the medium. I

.,

I

I

I

I

I

0.2

0.4

0.6

0.8

1.0

1

[ATP], rnM

FIG. 5 . Requirement of a permeant anion for ATP-induced release of epinephrine. Both C1- and SCN- are permeable to the granule membrane, while isethionate is relatively irnpermeant. (From Pollard er a/., 1977a.)

HARVEY B. POLLARD ET AL.

176

FIG.6 . Suppression of chromaffin granule release by increasing the osmotic strength of the medium (calculated from data presented in arithmetic form in a paper by Pollard et af., 1976a).

H+

tl*O

FIG.7. Representation of a chemiosmotic mechanism of granule lysis in the presence of Mg*+ -ATP and C1-. +, ATPase; E, epinephrine. C1- enters the granule as a counterion for H+,and water subsequently enters to equilibrate the new osmotic gradient. The flexible but inelastic granule membrane (Momsand Schober, 1977) then bursts.

CHROMAFFIN GRANULE AND EXOCYTOSIS

177

Addition of ATP to granules was found to cause entry of both 35SCN- (Pollard et af., 1976a) and 3sCl- (Pollard et al., 1977a; Pazoles and Pollard, 1978), and Casey et al. (1976) suggested that membrane ATPase catalyzed the inward

movement of protons as permeant counterions to C1-. Thus the osmotic content of the granule could be raised by the entry of H+ and C1- and lysis would ensue (see Fig. 7). Only a few problems persist in our understanding of this ATPase-controlled mechanism of ATP-evoked granule lysis. One of them is that ATP analogs that are resistent to hydrolysis at the y linkage, such as AppNHp, both support release at 37°C (Fig. 8) (Hoffman et af., 1976a) and cause changes in the transmembrane potential of isolated granules (Pollard et af., 1976a). In addition, ADP was found to be about half as active as ATP in inducing changes in the transmembrane electric potential at pH 7 (Pollard et al., 1976a). and ADP was also shown to be approximately 50% as effective as ATP in inducing release over a 5-minute period at pH 7.4 (Izumi et af., 1977). Granule preparations contain myokinase activity, and this might be the basis for activity by ADP. However, Pollard et af. (1976a) found they could measure ADP- or ATP-dependent changes in the transmembrane electric potential of intact granules at 4"C, a

"

1

2

3

4

5

[AppNHp]. mM

FIG. 8. Activation of granule release by AppNHp. The experiment was performed at pH 7.0, and the VmaXfor release by the analog was approximately half that for ATP under the same conditions. The apparent K, for AppNHp was nearly five times that for ATP. As with ATP, the reaction was inhibited by high Mg*+. The- inset shows Eadie plots of the data. (From Hoffman et al., 1976a.)

178

HARVEY B. POLLARD ET AL.

temperature at which ATP hydrolysis by granule membrane ATPase was too low to measure. In addition, ADP was not found to cause changes in intragranularpH by 31PN M R analysis (Pollard et al., 1979a). This suggests that some granule functions, perhaps like some skeletal muscle function (Lymn, 1975), may be sensitive to the binding of ATP rather than hydrolysis. Alternatively, only very small amounts of hydrolysis may be necessary to generate changes in A*. More work is clearly needed on this problem. C. ANIONTRANSPORT SITESIN GRANULE MEMBRANES More recently our attention has been directed toward the mechanism of ATPinduced anion permeation in intact granules. The main reason for interest in this problem was the fact that permeant anion gradients (e.g., C1-, OH-, HC03-) exist across most cell membranes, and that such gradients would be expected to occur across the membrane barrier separating the granule interior from the extracellular medium in the fusion state (Fig. 9). Thus the secreting cell could theoretically reconstitute the exact geometric and chemical conditions required to generate release of epinephrine from chromaffin granules in vitro (Pollard et al., 1977a; cf. Fig. 6). It seemed a reasonable expectation that granules should have a specific system for regulating anion transport, and that this system might play a central role in controlling exocytosis. It has been known for many years that some anions supported Mg2+-ATPinduced granule lysis better than others. For example, C1- is better than phosphate or isethionate (HO-C2 H4-S03), while SCN-, I-, and Br- are better than CI- (see Hoffman et al., 1976a; Casey e t a l . , 1976). This activity series was also

= pH7.4 r Z

:

M pH i =P 5.7

PLASMA MEMBRANE

GRANULE MEMBRANE

FIG.9. Representation o f possible anion gradients across a fusion complex between granule and plasma membranes. The pH inside the granule is 5.7, while the CI- concentration is at most 30 m M (Hoffman er at., 1976a). A physiological mammalian extracellular medium is 120 mM sodium chloride and pH 7.4.

CHROMAFFIN GRANULE AND EXOCYTOSIS

179

‘/[Cl]2,6s x 106 (mM-1) FIG. 10. Lineweaver-Burk plot showing competitive nahm of isethionate inhibition as a function of CI- concentration. It was necessary to raise the C1- concentration to the power of the Hill coefficient for this plot, because release was a positively cooperative function of Cl- concentration. (From Pazoles and Pollard, 1978.)

applied both to valinomycin-induced granule lysis in potassium salts of the various anions (Dolais-Kitabgi and Perlman, 1975) and to anion permeation of resealed granule membrane ghosts (Phillips, 1977). Therefore it seemed clear that the entry of anions was controlled by a selective mechanism at the membrane level. Further evidence for a selective mechanism came from observations that the rate of Mg2+-ATP-inducedgranule lysis was a saturable function of C1concentration and that isethionate, an impermeant anion, behaved as a competitive inhibitor of lysis with respect to C1- (Pazoles and Pollard, 1978) (Fig. 10). In pursuit of this concept, attention was focused on other known anion transport systems such as the anion “channel” in the erythrocyte membrane. In this system, transport in the form of anion exchange is mediated by a specific membrane protein identified as a 100,000-molecular-weight species on SDS gels (the so-called band III). It was of particular interest to us that this transport system was competitively inhibited by several specific drugs such as 4-acetamido-4‘-isothiocyanostilbene-2,2’disulforin acid (SITS), probenecid, pyridoxal phosphate, and others (Cabantchik and Rothstein, 1978). These drugs are relatively impermeant, aromatic anions, and structures are shown in Fig. 1 I . We subsequently discovered that these same compounds also blocked C1-, Mg2+-ATPinduced granule lysis (Pollard et al., 1978a; Pazoles and Pollard,

-

HARVEY B. WLLARD ET AL.

180

Bl

FIG. 11. Structures of some drugs that block anion transport in the red blood cell. (A) SITS;(B) probenecid, a drug also known to block organic acid transport in the kidney; and (C) pyridoxal phosphate.

1978). The inhibition by SITS,probenecid, and pyridoxal phosphate was found to be competitive with respect to [Cl-1, analogous to the competitive effect of isethionate on Cl--supported release. An example for SITS inhibition using Dixon analysis (Dixon, 1953) is shown in Fig. 12. By this analysis, the K ivalues for SITS, probenecid, and pyridoxal phosphate, with respect to C1-, were found to be 35 pM, 100 p M , and 1 mM, respectively. In contrast, the K ifor isethionate (Fig. 10) was 35 mM. These values compared well with those found in the erythrocyte system. SITS was also found to block Mg2+-ATP-induceduptake of %l- or S’QCN- into granules at 4 and 37°C. Pazoles and Pollard (1978) concluded that the mechanism for Cl-,Mg2+-ATP lysis of granules probably included anion entry through a site pharmacologically analogous to band III in red cells. K a a et al. (1978) have recently shown that the granule membrane enzyme DBH has ionophoric activity in black lipid membranes, but DBH does not appear to be the site of chloride transport during granule lysis. Later studies by Pazoles et al. (1979) showed that anion transport sites were also of importance in low-pH-activated osmotic lysis. In this case, an artificial inwardly directed proton gradient was created by lowering the external pH to 4.5, and osmotic lysis was stimdated in the presence of permeant anions. Impmeant

CHROMAFFIN GRANULE AND EXOCYTOSIS

181

anions and anion transport blocking drugs inhibited this ATP-independent release. Studies on the internal pH of granules under these conditions using 31P NMR (H. B. Pollard, H. Shindo, C. J. Pazoles, C. E. Creutz, and J. S. Cohen, unpublished observations) showed that granules incubated in a low pH medium became acidified inside only if a permeant anion like chloride were also present. SITS was also found to suppress internal acidification. This showed that granules were intrinsically permeable to H+ when accompanied by chloride, and that the effects of anions or anion transport inhibitors did not depend on the hydrolysis of ATP. This was of particular importance since SITS had also been found to inhibit ATP hydrolysis in granules (Pazoles et al., 1979) and other systems (e.g., Ehrenspeck and Brodsky, 1976).

D. TESTSOF

THE

HYPOTHESIS FOR EXOCYTOSIS BY ANIONTRANSPORT AND LOCALOSMOTICLYSIS

We and others had anticipated that chromaffin granule lysis might be a general model for the fission step in exocytosis. If this hypothesis were true, one might expect exocytosis to be blocked (1) by anion transport-blocking drugs, (2) by omission of specific permeant anions, (3) by hypertonic media, and (4) perhaps by proton ionophores. Indeed, we found these predictions to be born out generally in studies on serotonin secretion from human platelets (Pollard er al., 1977b) and parathyroid hormone (PTH) secretion from dissociated bovine parathyroid cells (Brown et al., 1978). However, while these systems adhered closely to the

2

0

4

0

~

o

m

i

m

HMSITS

FIG. 12. Dixon plot of SITS inhibition of epinephrine release from chromaffii granules at various concentrations of CI-. (From Pazoles and Pollard, 1978.)

HARVEY B. POLLARD ET AL.

182

principles underlying the chromaffin granule release reaction, neither of the cell types behaved exactly like the chromaffin granule model. PTH is stored in dense-cored secretory granules, and secretion can be stimulated by exposure of the dissociated parathyroid cell to low calcium (0.5 mM), isoproterenol, dopamine, and other agonists (Brown et al., 1976). Robenecid and SITS were found to have similar inhibitory potencies and inhibited secretion almost completely, while replacement of sodium chloride by either sucrose or sodium isethionate caused a 70% reduction in PTH secretion (Fig. 13). A remarkable similarity was detected between the sucrose-C1- titration curve for PTH release and the analogous curve for chromaffin granules (cf. Pazoles and Pollard, 1978). Various cation replacements for sodium were without influence on release, and kinetic analysis of both SITS and probenecid inhibition showed a strong competitive character with respect to C1-, each with K,= 4-6 X M. FCCP (4 p M ) completely inhibited stimulated PTH secretion, as did raising the osmotic strength of the medium from 300 mOsm to lo00 mOsm. We were initially puzzled by the observation that, while anion transport inhibitors blocked PTH release essentially completely, the omission of C1- or replacement of C1- by isethionate left 30% of the total release unaffected. One

Y

0

(Na ISETHIONATE], mM 60 100

(0)

160

I

160

I

I

I

1w

M

0

(NaCI], mM

FIG. 13. Influence of anions on the secretion of FTH by dissociated parathyroid cells. The stimulus was low calcium and 1 pM isoproterenol. (From Brown et al.. 1978.)

CHROMAFFIN GRANULE AND EXOCYTOSIS

183

interpretation was that the medium might contain an alternative anion to C1-. We considered both HC03- and OH-, since both were known to be transported by the erythrocyte anion channel (see Tosteson et al., 1973, for details). We found that simply lowering the pH from 7.5 to 7.0 resulted in a substantial reduction in PTH secretion and that the reduction was not reversed by raising the [HCO-.J. Probenecid was also found to be a competitive inhibitor with respect to [OH-], and we concluded that OH- might also be a permeant anion for this system. An alternative explanation was that a membrane component was being protonated and therefore inhibited PTH release. This would have meant, however, that probenecid acted in a very similar manner on both a Cl--interacting site and on a H+-interacting site, both of which were involved in PTH release. At present we do not consider this a very likely possibility. Secretion of serotonin from human platelets was also found to exhibit many similarities to the chrornaffin granule lysis reaction (Pollard et al., 1977b). For example, anion transport-blocking drugs were again found to inhibit secretion, regardless of whether release was stimulated by A23 187, a calcium ionophore, or thrombin, a physiological agonist. However, replacement of sodium chloride by either sucrose or sodium isethionate did not inhibit secretion. Instead, a reduction in pH was found to inhibit both thrombin- and A23187-induced release, and the blocking drugs were found to be apparent competitive inhibitors with respect to OH- concentration. Suramin was found to be the most effective agent with a K, of 0.9 p M ,while the K ivalues for SITS,probenecid, and pyridoxal phosphate in the platelet system were 22, 56, and 350 pM, respectively, with respect to [OH-]. In contrast, suramin was not a good inhibitor of PTH secretion by parathyroid cells or indeed of C1,Mg2+-ATP-inducedchromaffin granule lysis. FCCP, a proton ionophore, was also found to inhibit platelet secretion completely at a concentration of 4 pM. Hypertonic media also inhibited platelet secretion as shown in Fig. 13. The semilogarithmic plot of these data in Fig. 14 showed an interesting similarity to the homologous curve for osmotic suppression previously shown for chromaffin granule epinephrine release (cf. Fig. 6). We concluded that the platelet system also closely resembled the chromaffin granule in terms of the osmotic basis of release, apparently differing in terms of the specific anions involved in secretion. The chemiosmotic model for exocytosis has also been shown to apply to isolated chromaffin cells obtained by collagenase digestion of bovine adrenal medulla tissue (Pollard et al., 1979b). Chromaffin cells could be stimulated to release epinephrine by exposure to veratridine, acetylcholine, or A23 187, the calcium ionophore, by a process which required chloride in the medium and could be inhibited by sodium isethionate. Probeneoid and pyridoxal phosphate were also good release inhibitors at 500 p M concentrations, and FCCP (4 pM) inhibited veratridine and acetylcholine-induced release completely. The osmotic suppression curves for chromaffin cells were also found to be nearly identical to

HARVEY B. POLLARD ET AL.

184

1

I

1

I

1

I-loo

pH = 7.32

o A

w

m e

-lo

!I !! Y

Itt

- 1.0 vJ

.4Le

2

,nm

CI

0

5&

ebo

ti0 ill OSMOTIC STRENGTH, mown

s;D

1.-

FIG. 14. Inhibition of platelet release as a function of increasing osmotic strength of the medium. (A) An arithmetic dependence of serotonin release on osmotic strength; (B)logarithmic transform of (A). (From Pollard e t a / . . 1977.)

CHROMAFFIN GRANULE AND EXOCYTOSIS

185

those for chromaffin granules alone, and to the curve for suppression of serotonin release from platelets (cf. Fig. 14). Consideration of an electroneutral osmotic mechanism for either granule lysis or fission in exocytosis implies net movement of anions and cations into the granule interior as a motive force. In the case of the isolated chromaffin granule it has become clear that the ions are C1- and H+, respectively. However, as far as whole-cell studies are concerned, one can only interpret the data tentatively by analogy to the chromaffin granule system. The chromaffin cell appears to mirror the chromaffin granule in most respects in terms of a chemiosmotic mechanism for release. The C1- dependence and isethionate sensitivity of the PTH cell also closely resembles the chromaffin granule system. However, the additional role of OH- in PTH cells, as well as the possibly exclusive role of the latter ion in platelets, must remain hypothetical until direct studies of PTH or serotonin granules are performed. At present OH- and HC03- cannot be clearly distinguished experimentally. The observations that proton ionophores such as FCCP inhibit not only chromaffin granule lysis but also epinephrine, serotonin and PTH secretion from cells is necessary but not sufficient evidence that the systems all depend on permeation of the granule by protons. Uncouplers also interfere with ATP synthesis by mitochondria, and, based on the available data, it cannot be excluded that the uncouplers act on A W synthesis in cells and only secondarily affect secretion. However, the uncouplers act on secreting cells, such as the platelet, in substantially less than 10 seconds, a time during which very little happens to the metabolically active ATP in platelets and most other tissues. An additional caveat is the recent observation by Motais et af. (1978) that mitochondria1 uncouplers were also potent blockers of anion transport in red blood cells. One obvious problem with OH- as the permeant anion in cellular systems is that, if H+ were the permeant cation, the result would be transport of water, a permeant species. It is of course possible that the H+ would be buffered by granule contents, as proposed for the chromaffin granule by Casey et af. (1977), and the OH- would be left free. However, the role of H+remains quite hypothetical in cell systems. Extracellular sodium and potassium do not appear to be important in either platelet or PTH cell secretion. However, here again we know nothing about the possible role of cytoplasmic cations (or anions) in these systems. Thus definitive information on cations must also await studies on isolated serotonin and PTH granules. We conclude by pointing out the possibility of a chemiosmotic model for the fission step in exocytosis in some cells analogous to the events controlling chromaffin granule lysis. The three cells we studied intensively, chromaffin cells, platelets, and PTH cells, appear to behave in a fashion analogous to chromaffin granules with respect to osmotic sensitivity, anion dependence, and inhibition by both anion transport inhibitors and uncouplers. A chemiosmotic

186

HARVEY B. POLLARD ET AL.

model for exocytosis based on strict analogy to the chromaffin granule system is shown in Fig. 15 and simply puts more details into Fig. 1. According to this model. one could suppose that PTH and serotonergic granules might have anion transport sit@) in their membranes analogous to those in chromaffin granules. Fusion, induced by Ca2+and synexin, could result in the anion transport site(s) being closely juxtaposed to the plasma membrane. Of course, in the absence of any specific cell data one might also suppose that the anion transport site@)could reside in the plasma membrane and be juxtaposed to the granule membrane when fusion occurred. In any event, the pentalaminar complex would have to reorganize into a structure that allowed the anion transport site@)access to both the granule interior and the extracellular medium. We have drawn the model to indicate formation of a simple bilayer, for which evidence in the pancreas has been presented by Palade (1979, though other processes are conceivable. By analogy to the anion transport protein (band 111) of the red blood cell membrane, the anion transport site in the model is shown spanning the cell membrane. The result is to align the anion transport site relative to the existing OUT//

IN

U

FISSION

(Osmotic Lvrir)

FIG. 15. Chemiosmotic model for exocytosis. The numbers suggest a temporal sequence. (1) The cytoplasmic granule with an anion transport site in the membrane; more sites are of course possible. (2) The granule in the fusion state, the formation of which may be aided by the protein synexin and calcium. (3) A state in which the anion transpoxt site becomes exposed to the external medium. The osmotic strength inside the granule increases, and lysis or fission (4) occurs. The specific geometric relationship between synexin and cell constituents is conjectural, as is the specific location of anion transport sites on granules other than chromaffin granules.

CHROMAFFJN GRANULE AND EXOCYTOSIS

187

anion concentration gradient with the same geometry found for in vitro release from granules. However, this time the granule is still within the cell. A cation is shown entering the fused granule from the cytoplasmic side. One might anticipate that cations could enter from the medium, though in the case of the platelets and parathyroid cells, replacement of sodium in the medium had no effect. In the same vein, in some cells anions might conceivably also enter from the cytoplasmic side, but in such a hypothetical case one might not expect the impermeant anion transport-blocking agents to be effective inhibitors of release. Regardless of its exact origin, the consequence of net salt uptake into granules would be an increase in internal osmotic content. It is important to point out at this juncture that there is only circumstantial evidence in support of this model as it applies to intact cells, and changes are anticipated as we learn more about the biochemistry of exocytosis in the specific cellular systems.

VI. Recovery of Granule Membranes after Exocytosis After exocytosis, the membrane of the expended secretory vesicle is further processed, but what exactly happens is far from understood ( W i d e r , 1977). Is the granule membrane recovered, or does it remain associated with plasma membranes? If it is eventually recovered, is it then sent to lysosomes for complete decomposition or is it refilled with catecholamine and/or protein for reuse as a secretory vesicle (Herzog and Farquhar, 1977)? Can macromolecular components of granule membranes be reutilized by the Golgi apparatus for granule assembly without having to be synthesized from amino acids or acetate? An examination of the literature shows that in different cells all these various alternatives and many others may be valid (see Holtzman, 1977, for a review). However, in the case of the adrenal medulla, where vesicle membranes have specific biochemical markers and can be distinguished from plasma membranes (Zinder et al., 1978), one might expect less confusion. Unfortunately, this is not the case. A. COATEDVESICLEHYFOTHESIS One interesting idea about vesicle membrane retrieval has been analyzed by Heuser and Reese (1973) in their studies on vesicle membrane recycling at the frog neuromuscular junction. The critical interpretation in these studies is that recovery of vesicle membranes may occur through the formation of coated endocytotic pits and eventual full recovery of the membrane in the form of coated vesicles. The vesicle membrane is then thought to be recycled into acetylcholine-filled synaptic vesicles after fusion with a tubular membranous

188

HARVEY B. POLLARD ET AL.

system in the nerve terminal. This membrane retrieval concept was considered earlier for granule membrane recovery in the neurohypophysis (Nagasawa et al., 1971) and adrenal medulla (Douglas et al., 1971) and was based on observations that coated vesicles could be seen to form in close association with exocytotic omega structures (see Fig. 1 for a schematic illustration). Coated pits were found to be five times more prevalent in regions of chromaffin granule exocytosis than in surrounding regions of plasma membrane. B. EVIDENCE FOR DIRECT RECOVERY Coated pits and vesicles were initially described by Roth and Porter (1964) and later by Kaneseki and Kadota (1969). Douglas (1974) considered the coat (now termed clathrin, a 180,000-molecular-weightprotein; Pearse, 1976) to be a contractile element whose role was to provide curvature to otherwise flat membrane regions, thus allowing the membrane to be detached and internalized. However, several experimental problems have arisen which make direct acceptance of this hypothesis difficult. In the case of the adrenal medulla, Abrahams and Holtzman (1973) found that chromaffin cells of insulin-shocked rats, whose medullary catecholamine levels had been si nificantly lowered by massive neurogenic exocytosis, were filled with 2000-1-diameter empty vesicles. This is the size of chromaffin granule ghosts. Similar findings were previously reported by Nahas et al. (1967) in studies of acidotic dog adrenals. Furthermore, it is known that membrane-bound DBH can be detected in medullary homogenates prepared from insulin-shocked rabbits (0.H.Viveros et al., 1969) in a density region similar to that for lysed granule membranes (Poisner et al., 1967). Thus recovery of secretory vesicle membranes by small, coated vesicles in the adrenal medulla is in direct contrast to the biochemical and anatomic data indicating direct recovery of the intact vesicle. However, it is possible that both processes occur, but at different rates in different metabolic situations. More recently, preparations of coated vesicles have been prepared from several sources, including brain, and the vesicle membrane has been shown to be structurally and functionally identical to sarcoplasmic reticulum (SR)(Blitz et al., 1977). Of course, since many tissues including brain are closely invested with muscle cells in the vasculature (see Creutz, 1977, for examples), it is possible that the coated vesicle preparations are heavily contaminated by exogenous SR. Nonetheless, if coated vesicles are composed of clathrin and SR, it is evident that they cannot be easily made, simultaneously, of secretory vesicle membranes. Similar caveats have been mentioned by Winkler (1977). More work on purified coated vesicles is clearly warranted, and the main lesson to be learned from the analysis of studies on membrane recovery in the adrenal

CHROMAFFXN GRANULE AND EXOCYTOSIS

189

medulla is that our knowledge of the molecular biology of this process is still in a primitive state.

VII. Adenylate Cyclase in Chromaffin Granule Membranes Cyclic nucleotide metabolism may be important in the physiology of chromaffin cells. For example, rat adrenal medullary CAMP shows a 20-fold increase when carbachol, a cholinergic secretagogue, is administered (Guidotti and Costa, 1974). There is no evidence for coupling of the plasma membrane cyclase of bovine adrenal medulla to cholinergic receptors (Hurko et al., 1974; SerckHanssen et al., 1972; Zinder et al., 1976b), and so the relationship between cholinergic stimulation and adenylate cyclase has not been obvious. As men-

1:

"

'

'

""'"''1

12

l.l

1.o

+

0.9

g

o.6

i

q O5 0.4

0.3 0.2

ji

1 8

0.1 0

FIG. 16. Sucrose gradient showing the distribution of adenylate cyciase, DBH, cytuchrome ba2, and protein in purified chromaffin granule membranes. The adenylate cyclase/DBH and adenylate cyclase/cytochrome bJs2 specific activity ratios were constant from fractions 4 to 18. (FromZinder et al., 1977.)

HARVEY B. POLLARD ET AL.

190

tioned earlier, chromaffin granules can be induced to release by the ATP analog AppNHp. This analog is also a substrate for adenylate cyclase, and we therefore looked for and found adenylate cyclase in chromaffin granule membranes (Zinder et al., 1976a,b, 1977, 1978; Hoffman et al., 1976b; Zinder el af., 1977, 1978). A continuous gradient showing adenylate cyclase, as well as the conventional granule membrane markers DBH and cytochrome bSe2,is shown in Fig. 16, demonstrating copurification of cyclase with these markers. Adenylate cyclase is also in plasma membrane fractions of adrenal medullary tissue (Zinder e? al., 1978; Wilson and Kirshner, 1976). A. PHARMACOLOGICAL PROPERTIES Granule membrane cyclase also proved to have several interesting pharmacological properties. F- and GTP or GppNHp activated the enzyme, and various p-adrenergic agonists inhibited it in the order: isoproterenol > epinephrine > norepinephrine; dopamine was inactive. Consistent with these findings, low doses of 1-propranolol, a P-adrenergic antagonist, reversed the inhibtion. Nerve growth factor (NGF)also inhibited granule cyclase, and this action was reversed by I-propranolol (0. Nikodijevic et al., 1976). This ability of I-propranolol to reverse NGF action was also found in studies with adenylate cyclase activation in rat superior cervical ganglia (B. Nikodijevik et al., 1976).

-

4.0

I

.5

I

1

1

I

I

I

1

1

1

'

E

X

'i

3.0

0

1

1

1

20

40

60

1

Ti

100 120 140 160

Release (nmoles epinephrinelrng protein x min)

FIG.17. Dependence of adenylate cyclase on the release rate for epinephrine under limiting conditions of ATP and CI-. CAMP synthesis was measured by the production of CAMP-"P from a-ATP-"P by the method of Salamon et al. (1976).The CI-concentrations, from the lowest value of percent released, were 5, 10, 25, and 90 mM, while the Mgx+-ATPvalues were 0.05, 0.10, 0.15, 0.20, and 0.05 mM.

CHROMAFFIN GRANULE AND EXOCYTOSIS

191

Granule cyclase was also found to synthesize cAMP from ATP during ATPevoked release of epinephrine from intact chromaffin granules. A proportionality was observed between these events whether the release rate was regulated by a variation in C1-, the required permeant anion, or Mg2+-ATP(for an example, see Fig. 17). An obligatory role for cAMP in ATP-evoked granule lysis seemed excluded, however, by observations that a low concentration of CAMP or dibutyryl CAMP, or the inclusion of phosphodiesterase inhibitors such as methyl isobutyl xanthine (0.1 mM) or theophylline (1 mM), did not cause or potentiate epinephrine release (Zinder et al., 1976a). Even the requirement for cAMP synthesis in release seemed excluded by the fact that release could be activated by GTP nearly as well as by ATP. Thus the basis for the activation of cyclase by release conditions appeared to be related to the availability of substrate (Mg2+ATP) and lysis. Lysis results in a lower than normal local concentration of epinephrine at the granule membrane, and this alone may be the basis for activation of adenylate cyclase.

B. CYCLASE IN OTHERGRANULE PREPARATIONS Since the above-mentioned findings were published, adenylate cyclase has been found to be localized to other secretory granule membrane preparations. Bonne et af. (1977) observed adenylate cyclase in neurosecretory granule membranes from bovine neurohypophysis. Sussman and Leitner (1977a) also showed that adenylate cyclase was associated with membranes from insulin (beta) granules of rat pancreas. The latter workers also reported that beta granule membranes contained CAMP-activated protein kinase activity (Sussman and Leitner, 1977b). We also found that purified chromaffin granule membranes had CAMP-activated protein kinase, the best substrate being protamine (H. Pollard and 0.Zinder, unpublished observations). Endogenous acceptor activity however was quite low. We conclude that the occurrence of adenylate cyclase on secretory granule membranes may prove somewhat general and in addition is probably not related to contamination of the granule preparations by plasma membranes, at least in the case of the chromaffin granule (Zinder et al., 1978).

c.

ROLEOF ADENYLATE CYCLASE IN

THE

ADRENAL MEDULLA

The roles of the cyclase and the CAMP-activated protein kinase remain open for investigation. It is possible that this system may mediate the interaction of granules with other proteins or membranes in the chrornaffin cell. Alternatively, cAMP synthesis may also prove to be a postsecretion intracellular signal for

192

HARVEY B. FQLLARD ET AL.

replenishing granule contents or activating a recovery mechanism. cAMP has been implicated in the regulation of tyrosine hydroxylase activity (see Lovenbexg et al., 1975; Morganroth et al., 1975). The actual amounts of cAMP being synthesizedby otherwise intact granules during Mg2+-ATPevoked lysis is actually relatively small (2-5 pmoles/mg protein per minute), and this is consistent with the concept that only small amounts of cAMP in the adrenal gland can be involved in tyrosine hydroxylase regulation (Thoenen, 1975). Studies on the compartalization of cAMP in the adrenal medulla might be relevant.

VIII. Conclusions The main goal of our article was to describe recent information on the biochemical basis of exocytosis as viewed from the vantage point of the chromaffin granule. We have taken a rather general view of exocytosis and included granule assembly, the mechanism of calcium action, the release event, and recovery of the granule membrane after secretion. From our discussion it should be clear that we are still in a quandry regarding specific events involved in granule assembly in the Golgi apparatus, and in membrane recovery. However, some progress in determining the mechanisms of catecholamine uptake, calcium action, and catecholamine release have clearly been made. Calcium action in exocytosis may be dependent on the function of a new protein, synexin, that mediates membrane fusion in the presence of calcium. The release event in exocytosis from some cells may be based on an osmotic lysis event, analogous to the chemiosmotic mechanism of C1--ATP-induced chromaffin granule lysis. In this case as well, a specific granule membrane factor, the anion transport site, has been identified. However, the possible general importance of synexin, anion transport sites, adenylate cyclase, and other factors will be determined in future studies of other secretory systems. We anticipate that the chromaffh granule will be increasingly recognized in coming years as a kind of Rosetta Stone for biochemical analysis of many events in secretion by exocytosis. Undoubtedly there will be exocytotic secretory systems that do not follow the chromaffin model. The frog neuromuscular junction appears to be one of these, since FCCP, the proton ionophore, and elevated osmotic pressure greatly activate miniature end plate potential frequencies, and anion transport inhibitors appear to be without effect (R. Ornberg and H. B. Pollard, unpublished observations). This potential is believed to represent a synaptic vesicle release event. We therefore anticipate significant insights into the process of intercellular communication through critical, comparative analysis of these and other different systems.

CHROMAFF" GRANULE AND EXOCYTOSIS

193

ACKNOWLEDGMENT The authors thank Ms. Carol Brower for her expert skill in preparing this article for publication.

REFERENCES Abrahams, S. J., and Holtzman, E. (1973). J. Cell Biol. 56, 540-558. Amsterdam, A., Ohad. I., and Schramm, M. M. (1969). J. Cell Biol. 44, 753-773. Apps, D. K., and Glover, L. A. (1978). FEBS Lett. 85, 254-258. Bashford, C. L., Radda, G . K., and Ritchie, G. A. (1975a). FEBS Lett. 50, 21-24. Bashford, C. L., Casey, R. P., Radda, G. K.,and Ritchie, G. A. (1975b). Biochem. J. 148, 153- 155.

Bashford, C. L., Casey, R. P . , Radda. G. K., and Ritchie, G. A. (1976). Neuroscience 1, 399-412. Bass, L., and Moore. W.J. (1966). Proc. Natl. Acad. Sci. U.S.A. 55, 1214-1217. Berl, S., Puszkin, S., and Nicklas, W.J . (1973). Science 179, 441-446. Bemeis, K. H., DaPrada, M. and Pletcher, A. (1969). Science 165, 913-914. Blaschko, H.. and Welch, A. D. (1953). Naunyn-Schmiedebergs Arch. Exp. Parhol. Pharmakol. 219, 17-22.

Blitz, A. L., and Fine, R. E. (1974). Proc. Nurl. Acad. Sci. U.S.A. 71, 4472-4476. Blitz, A. L., Fine. R. E., and Toselli, P.A. (1977). J . Cell Bio/. 75, 135-147. Bonne, D., Nicolas, P., Lauber, M., Camier, M., Tixier-Vidal, A., and Cohen, P. (1977). Eur. J. Biochem, 78, 337-342. Boyer, P. D., Chance, B., Emster, L., Mitchell, P., Racker, E., and Slater, E. C. (1977). Annu. Rev. Biochem. 46, 955-1026. Brooks, J. C. (1977). Endocrinology 101, 1369-1378. Brown, E. M., Hunvitz, S., and Aurbach, G. D. (1976). Endocrinology 99, 1582-1588. Brown, E. M., Pazoles, C . J., Creutz, C . E., Aurbach, G. D., and Pollard, H. B. (1978). Proc. Natl. Acad. Sci. U.S.A. 75, 876-880. Bumdge, K., and Bray, D. (1975). J. Mol. Biol. 99, 1-14. Bumdge, K., and Phillips, J. H. (1975). Nature (London) 254, 526-529. Carlsson. A., Hillarp, N. A., and Waldeck, B. (1963). Acta Pkysiol. Scand. 59, Suppl. 215, 1-38. Casey, R. P., Njus, D., Radda, G. K., and Sehr, P. A. (1976). Biochem. J . 158, 583-588. Casey, R. P., Njus, D., Radda, G. K., and Sehr, P. A. (1977). Biochemistry 16, 972-977. Chi, E. Y . , Lagunoff, D., and Koehler, J . K. (1976). Proc. Natl. Acad. Sci. U . S . A . 73,2823-2827. Ciaranello, R. D., Jacobowitz, D., and Axelrod, J. (1973). J. Neurochem. 20, 799-805. Clernente, F., and Meldolesi, 1. (1975). J . Cell Biol. 65, 88-102. Cooke, J. D., Okamoto, K., and Quastel, D. M. J . (1973). J. Physiol. (London) 228, 459-497. Creutz, C. E. (1977). Cell Tissue Res. 178, 17-38. Creutz, C. E., Pazoles, C. J., and Pollard, H. B. (1978). J. Biol. Chem. 253, 2858-2866. Creutz, C. E., Pazoles, C . J., and Pollard, H. B. (1979). J . Biol. Chem. 254, 553-558. Dahl. G., and Gratzl. M. (1976). Cyrobiologie 12, 334-355. Daniels, A.. Korda. A., Tanswell, P.. Williams, A., and Williams, R. J . P. (1974). Proc. R . Soc. London, Ser. B 187, 353-361. Dean, P. M. (1975). J. Theor. Biol. 54, 289-308. DeRobertis, E., and Vaz Ferreira, A . (1957). Exp. Cell Res. 12, 568-574. Diliberto, E. J . , Viveros, 0 . H., and Axelrod. J. (1976). Proc. Natl. Acad. Sci. U.S.A. 73, 4050-4054.

Diner, 0. (1967). C . R . Acad. Sci., Ser. D 265, 616-618.

1 94

HARVEY 6.POLLARD ET AL.

Dixon, M. (1953). Biochem. J . 55, 170-171. Dodge, F. A., and Rahamimoff, R. (1967). J. Physiol. (London) 193, 419-432. Dolais-Kitagbi, J., and Perlman, R. L. (1975). Mol. Pharmacol. 11, 745-750. Douglas, W. W. (1968). Br. J. Pharmacol. 34, 451-474. Douglas, W . W . (1974). Biochem. SOC. Symp. 39, 1-28. Douglas, W . W., and Rubin, R. P. (1963). J. Physiol. (London) 167, 288-310. Douglas, W . W., Nagasawa, J., and Schultz, R. A. (1971). Nature (London) 232, 340-341. Dowdall, M. J., Fox, G., Wachtler, K., Whittaker, V. P., and Zimmerman, H. (1976). ColdSpring Harbor Symp. Quanr. Biol. 40, 65-81. Edwards, W., Phillips, J. H., and Moms, S. 1. (1974). Biochim. Biophys. Acra 356, 164-173. Ehrenspeck, G.,and Brodsky, W. A. (1976). Biochim. Biophys. Acra. 419, 555-558. Fenwick, E. M., Fajdiga, P. B.,Howe, N. B. S., and Livett, B. G. (1978). J. Cell Biol. 76, 12-30. Gratzl, M.,Dahl, G., Russell, I . T., and Thorn, N. A. (1977). Biochim. Biophys. Acra 470,45-57. Green, D. J., Westhead, E. W., Langley, K. H., and Sattelle, D. B. (1978). Biochim. Biophys. Acra. 539, 364-371. Green, L. A., and Tishler, A. G. (1976). Proc. Narl. Acad. Sci. U.S.A. 73, 2424-2428. Guidotti, A., and Costa, E. (1974). J. Pharmacol. Exp. Ther. 189, 665-675. Grynszpan-Winograd, 0. (1971). Philos. Trans. R . SOC. London, Ser. B 261, 291-292. Hillarp, N. A. (1960). Acra. Physiol. Scand. 50, 8-22. Helle, K. B., and Serck-Hanssen, G. (1975). Mol. Cell. Biochem. 6, 127-146. Herzog, V.. and Farquhar, M. G. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 5073-5078. Heuser, J. E., and Reese, T. S. (1973). J. Cell B i d . 57, 315-344. H i l l q , N. A., Lagerstedt, S., and Nilson, B. (1953). Acra Physiol. Scand. 29, 251-263. Hochman, I . , and Perlman, R. L. (1976). Biochim. Biophys. Acra 421, 168-175. Hoffman, P. G., Zinder, 0..Bonner, W. M., and Pollard, H. B. (1976a). Arch. Biochem. Biophys. 176, 375-388. Hoffman, P. G., Zinder, 0..Nikodijevik, O., and Pollard, H. B. (1976b). J. Supramol. Srrucr. 4, 15 1- 184. Holtzman, E. (1977). Neuroscience 2, 327-355. Hortnagl, H., Lochs, H., and Winkler, H. (1974). J. Neurochem. 22, 197-199. Hubbard, J . I . , Jones, S. F., and Landau, E. M. (1968). J. Physiol. (London) 194, 355. Hurko, 0.. Elster, P., and Wurtman, R. J. (1974). Endocrin. 94, 591-593. Ichikawa, A. (1965). J. Cell Biol. 24, 369-385. Izumi, F., Kashimoto, T., Miyashita, T., and Wada, A. (1977). FEBS Lerr. 78, 177-180. Jamieson, J., and Palade, G. (1974). J. Cell Biol. 50, 135-158. Jockusch, B. M., Burger, M. M., DaPrada, M., Richards, J. G., Chaponnier, C., and Gabbiani, G. (1977). Nature (London) 270, 628-629. Johnson, R. G., and Scarpa, A. (1976a). J. Biol. Chem. 241, 2189-2191. Johnson, R. G., and Scarpa, A. (1976b). J. Gen. Physiol. 68, 601-631. Johnson, R. G., Carlson. N. J., and Scarpa, A. (1978). J. Biol. Chem. 253, 1512-1521. Kafka, M. S., Blumenthal, R., Walker, G. A., and Pollard, H. B. (1978). Membr. Biochem. I, 279-295. Kaneseki, T., and Kadota, K. (1969). J. Cell Biof. 42, 202-220. Kennard, O., Isaacs, N. W., Motherwell, W. D. S., Coppola. J. C., Wampler, D. L., Larson, A. C., and Watson, D. G. (1971). Proc. R . SOC. London, Ser. A 325, 401-436. Keough, K. M. W., and Thompson. W. (1972). Biochim. Biophys. Acra 270, 324-336. Kirshner, N. (1962). J. B i d . Chem. 237, 2311-2317. Kirshner, N. (1974). Adv. Cytopharmacol. 2, 265-271. Kirshner, N . , Sage, H. J., Smith, W. J., and Kirshner, A. G. (1966). Science 154, 529-531. Klingenberg, M., and Rottenberg, H. (1977). Eur. J . Biochem. 73, 125-130.

CHROMAFFIN GRANULE AND EXOCYTOSIS

195

Kostron, H., Winkler, H., Geissler, D., and Konig, P. (1977a). J. Neurochem. 28, 487-493. Kostron, H., Winkler, H., Peev, L. J., and Konig, P. (1977b). Neuroscience 2, 159-166. Kmtsinger, R. H. (1976). Annu. Rev. Biochem. 45, 239-266. Lagercrantz, H. (1976). Neuroscience 1, 81-92. Lagunoff, D. (1973). J. Cell Biol. 57, 252-259. Lawson, D., Raff, M. C., Gornperts, B., Fewtrell, C., and Gilula, N. B. (1977). J. Cell Biol. 72, 242-259. Lishajko, F. (1969). Acta Physiol. Scand. 75, 255-256. Lishajko, F. (1970). Acta Physiol. Scand. 79, 64-75. h k e , F. S . (1894). Zentralbl. Physiol. 8, 166-167. Lovenberg, W.,Bruckwick, E. A., and Hanbauer, 1. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 2955-2958. Lymn, R. W. (1975). J. Mot. Biol. 99, 567-582. Mathews, E. K. (1970). In “Calcium and Cell Function” (A. W. Cuthbert, ed.),pp. 163-182. St. Martins, New York. Meldolesi, J. (1974). Adv. Cytophannacol. 2, 71-85. Meyer, D. J., and Burger, M. M. (1976). Biochim. Biophys. Acra. 443, 428-436. Morganroth, V. H., Hegstrand, E. R., Roth, R. H., and Greengard, P. (1975). J. Biol. Chem. 250, 196-1953. Moms, S. J., and Schober, R. (1977). Biochem. J. 34, 33-48. Moms, S. J., and Schovanka, I. (1977). Biochim. Biophys. Acra 464, 53-64. Motais, R., Sola, F., and Cousin, J. L. (1979). Biochim. Biophys. Acra (in press). Muro, I., Morishirna, I., and Yonezawa, T. (1971). Chem.-Biol. Interact. 3, 213-224. Nagasawa, J., Douglas, W. W., and Schultz, R. A. (1971). Narure (London) 232, 341-342. Nagatsu, T., and Udenfriend, S . (1972). Clin. Chem. 18, 980-987. Nahas, G. G., Zagury, D., Milhand, A., Manger, W. M., and Pappas, G. (1967). Am. J . Physiol. 213, 1186-1192. Nichols, J. W., and Deamer, D. W. (1976). Biochim. Biophys. Acta 455, 269-271. Yu, M.-Y. W ., Pollard, H. B., and Guroff, G. (1976). Proc. Narl. Nikodijevic, B., Nikodijevic, 0.. Acad. Sci. U.S.A. 72, 4769-4771. Nikodijevic, O., Nikodijevik, B., Zinder, O., Yu, M.-Y.W., and Pollard, H. B. (1976). Proc. Natl. Acad. Sci. U.S.A. 73, 771-774. Njus, D., and Radda, G. K. (1978). Biochim. Biophys. Acta 463, 219-244. Njus. D., Sehr, P. A., Radda, G. K., Richie, G. A., and Seeley, P. J. (1978). Biochemisrry 17, 4337-4343. Novikoff, A. B., Yom, A., and Novikoff, P. M. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 4501-4505. Oka, M., Ohuchi, T.. Yoshida, H., and Imaizumi, R. (1965). Biochim. Biophys. Acta 97, 170-171. Orci, L., Amherdt, M., Malaisse-Lagae, F., Rouiller, C., and Renold, A. E. (1973). Science 179, 82-84. Palade, G. E. (1975). Science 189, 347-357. Papahadjopoulos, D., Poste, G., and Schaeffer, B. E. (1973). Biochim. Biophys. Acta 323, 23-42. Pazoles, C. J., and Pollard, H. B. (1978). J. Biol. Chem. 253, 3962-3969. Pazoles, C. J., Cnutz, C. E., and Pollard, H.B. (1979). In “Catecholamines: Basic and Clinical Frontiers” (I. Kopin and E. Usdin, eds.). Permagon Ress, Oxford, in press. Pearse, B. M. F. (1976). Proc. Natl. Acnd. Sci. U.S.A. 73, 1255-1260. Phillips, J. H.(1974a). Biochem. J. 144, 311-318. Phillips, J. H . (1974b). Biochem. J . 144, 319-325. Phillips, J. H., Allison, Y. P., and Moms, S . J. (1977). Neuroscience 2, 147-152. Phillips, J. H. (1977). B k h e m . J . 168, 289-297.

196

HARVEY B. POLLARD ET AL.

Phillips, J. H., and Allison, Y. P. (1978). Biochem. J . 170, 661-672. Phillips, J. H. (1978) Biochem. J . 170, 673-679. Pletscher, A., DaPrada, M., Berneis, K. K., Steffen, H., Lufold, B., and Weber, H. G. (1974). A h . Cyropharmacol. 2, 257-264. Poisner, A. M.(1970). Fed. Proc., Fed. Am. SOC. Exp. Biol. 29, 545. Poisner, A. M., and Trifaro, J. M. (1967). Mol. Pharmacol. 3, 561-571. Poisner, A. M.,Trifam, J. M., andhuglas, W. W. (1967). Biuchem. Pharmacol. 16,2101-2108. Pollard, H. B., Miller, A., and Cox, G. (1973). J. Supramol. Srrucr. 3, 295-306. Pollard, H. B., Zinder, O., Hoffman, P. G., and Nkodijevk, 0. (1976a). J . Biol. Chem. 251, 4544-4550. Pollard, H. B., Zinder, 0.. and Hoffman, P. G. (1976b). In “Data Book on Cell Biology” (P. L. Altman and D. D. Katz, eds.), pp. 359-362. Fed. Am. Soc. Exp. Biol., Washington, D.C. Pollard, H. B., Pazoles, C. J., Hoffman, P. G., Zinder, 0..and Nikcdijevik, 0. (1977a). In “Cellular Neurobiology: Progress in Clinical and Biological Research” (Z. Hall, R. Kelley, and C. F. Fox, eds.), pp. 269-276. Alan R. Liss, New York. Pollard, H. B., Tack-Goldman, K. M., Pazoles, C. J., Creutz, C. E.,and Shulman, N. R. (1977b). Proc. Narl. Acad. Sci. U.S.A. 74, 5295-5299. Pollard, H. B., Hanna, R. B., and Pappas, G. D. (1977~).Biol. Bull. (Woods Hole, Mass.)153, 443. Pollard, H. B., Pazoles, C. J., Creutz, C. E., Ramu, A., Strott, C. A., Ray, P., Brown, E. M., Aurbach, G. D., Tack-Goldman, K. M., and Shulman, N. R. (1978). J . Supramol. Srrucr. 7, 277-285. Pollard, H. B., Shindo, H., Creutz, C. E., Pazoles, C. J., and Cohen, J. S. (1979a). J . Biol. Chem. 254, 1170-1177. Pollard, H. B., Pazoles, C. J., and Creutz, C. E. (1979b). In “Catecholamines: Basic and Clinical Frontiers” (I. Kopin and E. Usdin, eds.). Permagon Press, Oxford, in press. Pollard, T. D.. and Weiling, R. R. (1974). Crir. Rev. Biochem. 2, 1-65. Rajan, K. S.,Skripkus, A., Marks, G. E., and Davis, J. M. (1976). Bioinorg. Chem. 6 , 93-117. Rasmussen, H. (1970). Science 170, 404-412. Rohlich, P., Anderson, P., and Uvnas, B. (1971). J. Cell Biol. 51, 465-483. Roth, T. F., and Porter, K. R. (1964). J . Cell Biol. 20, 313-332. Rubin, R. P. (1974). “Calcium and the Secretory Process.” Plenum, New York. Salamon, Y.,Londos, C., and Rodbell, M. (1976). Anal. Biochem. 58, 541-548. Schenkman, 1. B., and Cinti. D. L. (1972). Life Sci. 11, 247-257. Schneider, A. S., Hen, R., and Rosenheck, K. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 50365040. Schneider, F. H., Smith, A . D., and Winkler, H. (1967). Br. J . Pharmacol. Chemorher. 31, 99-104.

Schober, R., Nitsch, C., Rinne, U., and Moms, S. J. (1977). Science 195, 495-497. Schubert, L.. and Klier, F. G. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 5184-5188. Serck-Hanssen, G., Christoffersen, T., Morland, J., and Osnes, J. B. (1972). Eur. J . Pharmacol. 19, 297-300. Sharp, R. R., and Richards. E. P. (1977a). Biochim. Biophys. Acra 497, 14-28. Sharp, R. R., and Richards, E. P. (1977b). Biochim. Biophys. Acra 497, 260-271. Slotkin, T. A. (1973). LifeSci. 13, 675-683. Smith, A. D. (1968). In “The Interaction of Drugs and Subcellular Components on Animal Cells” (P. N. Campbell, ed.), pp. 239-292. Churchill, London. Smith, A. D., and Winkler, H. (1972). Handb. Exp. Phannakol. 33,538-605. Smith, U., Smith, D. S., Winkler, H., and Ryan, J. W. (1973). Science 179, 79-82. Steffen, H., DaPrada, M.,and Pletscher, A. (1974). Biochirn. Biophys. Acra 338, 561-571.

CHROMAFFIN GRANULE AND EXOCYTOSIS

197

Steiner, D. F., Kemmler, W., Tager, H. S., and Rubenstein, A. H. (1974).Adv. Cyfopharmacol. 2, 195-205. Stjarne, L. (1972).Handb. Exp. Pharmakol. 33, 230-269. Sussman, K. E., and Leitner, J. W. (1977a).Biochem. Biophys. Res. Commun. 79, 429-437. Sussman, K.E.,and Leitner. 1. W. (1977b).Endocrinology 101, 694-701. Taugner, G.(1971).Nauyn-Schmiedebergs Arch. Pharmakol. 270, 392-406. Taugner, G . (1972). Biochem. J . 130, 969-973. Terland, 0.. and Flatmark, T. (1975).FEBS Lett. 59, 52-56. Theonen, H. (1975). Adv. Neurol. 9, 67-74. Tosteson. D.C., GUM,R. B., and Wieth, I. 0. (1973).In “The Organization of Energy Transducing Membranes” (M. Nakao and L. Packer, eds.), pp. 345-354. Univ. Park Press, Baltimore, Maryland. Trifam, J . M., and Ulpian, C . (1975). FEBS Left. 57, 198-202. Tuck, L. D.,and Baker, J. K. (1973).Chem.-Biol. Inrerucr. 7, 355-366. Uvnas, 8 . (1974).Life Sci. 14, 2355-2366. Uvnas, B., and Aborg, C.-H. (1977).Acta Physiol. Scand. 99,476-483. Uy. R.,and Wold, F. (1977).Science 198, 890-896. Viveros, 0.H., Arqueros, L., Connett, R. J., and Kirshner, N. (1969).Mol. Phnnnucol. 5,69-82. Viveros, 0 . H. (1974).Handb. Physiol., Sect. 7: Endocrinol. 6, 389-426. Viveros, 0.H., Arqueros, L.,and Kirshner, N. (1969).Science 165, 911-913. von Euler, U. S., and Lishajko, F. (1969).Acfa Physiol. Scand. 77, 298-307. Wallach, D.,and Schramm, M. (1971).Eur. J . Biochem. 21, 433-437. Wallach, D.,Kirshner. N., and Schramm, M. (1975).Biochim. Biophys. Acra 375, 87-105. Weiner, N., and Jardetsky, 0. (1964).Nauyn-Schmiedebergs Arch. Phnrmakol. Exp. Pathol. 255, 266-286. Wilson, S. P., and Kirshner, N. (1976).Molec. Pharm. 13, 382-385. Wilson, S. P., and Kirshner. N. (1976). J. Neurochem. 27, 1289-1298. Winker, H. (1977). Neuroscience 2, 657-683. Winkler, H., and Smith, A. D. (1975). In “The Adrenal Gland: Handbook of Physiology” (H. Blaschko, G. Sayers, and A. D. Smith, eds.), pp. 321-339. Am. Physiol. Soc., Bethesda, Maryland. Winkler, H.. Schneider, F. H., Rufener, C., Nakane, P. K., and Hortnagl, H. (1974). Adv. Cyfophurmucol. 2, 127-140. Wurtman, R. J., and Axelrod, J. (1966).J. Biol. Chem. 241, 2301-2305. Zinder, 0..Hoffman, P. G., Nikodijevik, O., and Pollard, H. B. (1976a). In ”Cellular and Molecular Bases of Neuroendwrine Processes” (E. E n d m z i , ed.), pp. 359-363. Akadkmiai Kiadb, Budapest. Zinder, O., Nikodijevik, O., Hoffman, P. G., and Pollard, H. B. (1976b).J . Biol. Chem. 251, 2179-2181. Zinder, O.,Menard, R., Lovenberg, W., and Pollard, H. B. (1977). Biochem. Biophys. Res. Commun. 79, 707-711. Zinder, O.,Hoffman, P. G., Bonner, W. M., and Pollard, H. B. (1978). Cell Tissue Res. 188, 153-170. Zinder, O.,and Pollard, H. B. (1979).In “Catecholamines: Basic and Clinical Frontiers” (I. Kopin and E. Usdin, eds.). Permagon Press, Oxford, in press.

This Page Intentionally Left Blank

I"ATI0NAL

REVIEW OF CYMLOOY. VOL. 58

The Golgi Apparatus, the Plasma Membrane, and Functional Integration W. G. WHALEYAND MARIANNE DAUWALDER The Cell Research Institute. The University of Texas at Auslin, Austin, Texas 1. Introduction . . . . . . . . . . . 11. Components of the Golgi Apparatus . A, Nomenclature . . . . . . . .

. . . . . . . . .

. . . . . . . . . . . . . . . . . . .

B. Sources of Membrane Components . . . . . . . . . C. Formation and Change . . . . . . . . . . . . . . 111. Models for the Golgi Apparatus and Its Function . . . . . A. General . . . . . . . . . . . . . . . . . . . . B. Transfer to the Golgi Apparatus . . . . . . . . . . C. Activities in the Golgi Stack . . . . . . . . . . . D. Transport and Recognition . . . . . . . . . . . . E. Lysosomes and GERL . . . . . . . . . . . . . . F. Differentiation of the Golgi Cistemae . . . . . . . . IV. Movement of Vesicles out of and into Cells . . . . . . . A. Exocytosis . . . . . . . . . . . . . . . . . . B. Endocytosis . . . . . . . . . . . . . . . . . . V. Discussion and Concluding Remarks . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

. .

.

. . . . . . . . .

199

202 202 203 205 209 209 213 218 222 228 229 232 232 234 236 238

I. Introduction Through the years many different suggestions have been made concerning the activities of the Golgi apparatus. The information available was largely morphological and often led to conflicting interpretations. Although the role of the Golgi apparatus in secretion has been well supported, there is as yet no generally accepted explanation for its presence in some form in all eukaryotic cells. Even with respect to the secretory process, much more is known about the assembly, condensation, or modification of the products than is known about the basic functioning of this organelle. Its more recently recognized part in the development or activation of the lysosomal system has also been subject to various interpretations, Much of the information up to the most recent investigations has been reviewed previously (Beams and Kessel, 1968; Northcote, 1971, 1974; Cook, 1973; Whaley, 1975) and is not treated here in detail. This article 199

Copyright @ 1979 by Academic Press, Inc. All rights of rrpmduclion in any form reserved. ISBN 0-12-361358-9

200

W. G. WHALEY AND MARIANNE DAUWALDER

deals primarily with some of the more recent evidence bearing on the functional differentiationof the Golgi apparatus, describes problems that require resolution, and attempts to provide a more modem interpretation of the organelle as an important site in the exchange of information between the nucleus and the cell surface. A possible pattern for its activities as a general aspect of cellular metabolism, development, and dysfunction is suggested. Several years ago, we assembled evidence from a wide variety of investigations to support the idea that the Golgi apparatus contributes “informational” characteristicsto the plasma membrane of the cell and thus can be interpreted as a center at which genetically controlled developments affecting various cellular interactions take place (Whaley er al., 1972). The basic concept implies that molecules with particular configurations are assembled in the membrane on the inside of the Golgi apparatus cistemae (or in derived vesicles) and are translocated to and included in the plasma membrane at the time of “secretory” vesicle-plasma membrane fusion. The concept includes the possibility that factors developed on the outside of the vesicle membranes can lead to “recognition” and selective fusions between the Golgi apparatus-derivedvesicles and the plasma membrane or plasma membrane derivatives such as elements of the lysosomal system. An extension of this concept allows a whole series of cellular functions to be related in a rational pattern. These include steps in the synthesis and assembly of materials, in their modification or breakdown, and in the recycling of some of them. It also points to the critical role of membrane differentiation in mediating these processes. The differentiation of membranes is a well-recognized phenomenon supported by work using widely differing techniques and materials (see Franke and Kartenbeck, 1976). The structure and apparent functions of the portions of the Golgi apparatus that can be investigated by current techniques may provide a unique model system in which to try to assess aspects of membrane change and specificity. In the most generally recognized form, the organelle is an assemblage of individual membrane-bounded units working in concert yet lacking a limiting outer boundary membrane. One difference that sets it apart from some of the other “stacked” membrane forms (chloroplast grana, outer segments of retinal cells) appears to be the high degree to which the individual elements (or groups of elements) are specialized. At least with respect to the lamellar or stacked form of the apparatus, differences from one face of the organelle to the other can be demonstrated morphologically, enzymically, in the synthesis and attachment of polysaccharides, and in the accumulation and separation of so-called secretory products. Some of this evidence has been reviewed recently (Whaley et al., 1975) with the suggestion that many aspects of the functional differentiation of the membranes must be closely modulated by some level of genomic regulation. In a sense the Golgi region can be tentatively identified as a site at which much secondary information is expressed. The term “secondary” is used here to

THE GOLGI APPARATUS

20 1

indicate the aspects of genetic control subsequent to the steps clearly traceable to a linear gene sequence. It is now well accepted that variously differentiated cells of an organism have the same basic genetic material and that primary changes in genetic expression occur through differences in the activity of genes. Nonetheless, many factors can affect the eventual production of cellular constituents. These factors may act at the posttranscriptional level, as has been suggested in early development (Davidson, 1977), or at the posttranslational level, as seems to be the case in some aspects of glycoprotein synthesis (Beeley, 1974; R. G. Spiro et al., 1974; Schachter, 1974). Part of this secondary control must reside in proteins acting as agents of genes. Here particular attention is directed toward the activity and specificity of enzymes in the Golgi apparatus which act in the structuring of carbohydrate moieties. On the cell surface such carbohydratecontaining components, in association with other compounds, appear to be important in determining diverse aspects of cellular interaction and function. Classically, since Bowen’s (1929) interpretation, the GoIgi apparatus has been looked upon as functioning primarily in secretion, and it has frequently been referred to as acting in the “packaging” and “concentration” of secretory products (Beams and Kessel, 1968). Such interpretations usually stress the secretory products as being of first importance and view the membrane as a sort of “wrapping” which separates materials from the cytoplasmic matrix and facilitates their selective discharge from the cell. In the last decade increasing evidence has lent firm support to the role of the Golgi apparatus in packaging materials, but it has also suggested a much more complex function for this organelle, much of which must be related to particular characteristics of its membranes. In highly differentiated glandular cells, the classic secretory products are often clearly separable from the membranes and function at a distance from the cell that produces them. In many instances, however, components of the secretory products are intimately associated with the membrane, and their formation appears to be a general cellular function. Although the idea was not new (see De Robertis, 1964), Palade (1975) was one of the first to emphasize the generality of secretion. He also recognized that, even though his own investigations dealt with a classic secretory product, various phenomena might have to be considered in interpreting secretion as a basic cellular process. Once again, interpretations may differ in part, depending on whether the products or the membranes are stressed. Emphasis on the latter leads to the suggestion that the fundamental or “primitive” function of the Golgi apparatus is the formation of membrane segments destined for the renewal and differentiation of the plasma membrane. For secretion, this basic theme could be used and/or modified to include the movement of masses of materials to and through the surface of the cell. The greatest emphasis in biological science and biochemistry in the last several decades has been on the formation of proteins and their activities, because of the obvious specificity characteristics and the genetic encoding processes. Many

202

W. G. WHALEY AND MARIANNE DAUWALDER

investigations of the Golgi apparatus have also dealt with proteinaceous materials, with concentration on their movement and possible modification prior to secretion. The secretion of carbohydrates by the Golgi apparatus has long been evident, particularly in plant and animal matrix materials and in mucous secretions. There is now sound evidence that the apparatus actually functions in the synthesis as well as the assembly and modification of complex carbohydratecontaining macromolecules. The tremendous range of structural configurations possible in carbohydrate materials has directed attention to their potential informational qualities. Clamp (see Roseman, 1975) calculated that the theoretical number of permutations for a single oligosaccharide is on the order of 102‘ and, although of lesser magnitude, the structural differences in polysaccharides found in nature are still quite large. It thus seems likely that the potential diversity of molecules is substantially increased by activities in the Golgi apparatus. Materials with structurally distinctive carbohydrate moieties may have significantly different functions either as parts of secretory products or as components at the surface of cells. It follows that the Golgi apparatus could be a site where many specificity factors of the plasma membrane and cell surface are developed. Reactions at the plasma membrane are highly complex and depend not only on the composition of the functional groups but also on their molecular asymmetry, their particular spatial distribution, and their mobility in the plane of the membrane (Singer and Nicolson, 1972; Oseroff et al., 1973; Weissmann and Claibome, 1975; Marchesi, 1975a; Bretscher and Raff, 1975; Rothman and Lenard, 1977). Although principal focus here is on certain aspects of membrane differentiation in the Golgi apparatus as they may relate to characteristics of the plasma membrane, we do not mean to suggest that all aspects of plasma membrane function are predicated on the activity of this organelle. 11. Components of the Golgi Apparatus

A. NOMENCLATURE

In the past years it has proved difficult to arrive at designations for the opposite faces of the Golgi stack which were acceptable to the different groups investigating the apparatus. Our group adopted the terms “proximal” and “distal” to avoid using more functionally explicit terms or other morphological indicators such as “convex” and “concave” (which led to confusion in several cell types), even though we realized that these terms had their own set of problems. Despite increased information, many of the differences observed between the two faces are not subject to clear functional interpretations. However, readers outside the groups of “Golgiites” must be confused by the plethora of terms, and another

THE GOLGI APPARATUS

203

effort at compromise seems indicated. Here “mature” is used instead of “distal” to indicate that the membranes (and the contents) have reached the stage of assembly in which the forces operative in vesicle formation come into play. This is not meant to negate further changes in the evolved vesicles. The naming of the opposite face is even more difficult, for so little is actually known about it. Here the term “forming” is used instead of “proximal.” It should, however, be carefully noted that it is not known with certainty that in all cases cisternae are formed at this face (and subsequently displaced) or that, in some cases, vesicles may not also evolve from this face. Nonetheless, this terminology can provide an aid in teaching and a general base for discussing the organelle and its functions. In addition, the term “secretion” is broadly interpreted and used to reflect what appears to be general processes for the assembly and condensation of products and for the movement of membrane components and varying masses of enclosed materials to the plasma membrane.

B. SOURCES OF MEMBRANE COMFQNENTS A discussion of membrane assembly, extension, and differentiation in the Golgi apparatus must begin with the question of where the membrane components come from. Siekevitz (1975) presented a model for membrane replacement, growth, and differentiation by molecular turnover. Although the evidence supporting this model is drawn principally from studies of the endoplasmic reticulum and mitochondria, it provides a common basis for considering numerous aspects of membrane biogenesis and change. Most evidence indicates that synthesis of membrane components occurs at sites removed from the Golgi apparatus membranes. Many membrane lipids which form the skeleton of the membrane and account for certain of its permeability characteristics (Danielli, 1975) are thought to be formed in the endoplasmic reticulum (McMurray, 1973; although see Benes et al., 1973) and must be transported by some process to the Golgi apparatus. Transfer of some of these lipids may be via membrane-bounded vesicles (or possibly transient membrane continuities). Others may move from the endoplasmic reticulum into cytoplasmic pools before participating in membrane maintenance or growth by molecular turnover. Differences between membrane systems can arise from the preferential incorporation or rejection of particular membrane lipids during vesicle fusion or from differential insertion or turnover of molecules (Siekevitz, 1972, 1975). Whatever the mechanism, some sort of “keying” process seems necessary to explain the differences in lipid makeup. Such a process could influence the composition of individual cisternae in the Golgi stack (at least theoretically) and, as discussed by Chapman (1975), regional differences in membrane lipids could also influence the incorporation of proteins into the membranes. In certain types of cells, activities related to secre-

204

W.G. WHALEY AND MARIANNE DAUWALDER

tion bring about the rapid extension of membranes. Hence whatever the site of lipid origin, the process of transfer must be an efficient one. Although there is a tendency to discuss secretory proteins separately from membrane proteins, this distinction is sometimes blurred. The source of the proteins is of course the ribosome, but the question arises in the case of membrane proteins: Which class of ribosomes? Probably the most generally accepted idea is that membrane proteins are synthesized by the polysomes of the rough endoplasmic reticulum (Siekevitz, 1972, 1975); however, Bretscher (1973, 1974) discussed evidence supporting the concept that they should be considered special secreted proteins which are probably translated at free cytoplasmic polysomes. The two possibilities are not mutually exclusive, and it seems likely that either or both occur, depending perhaps on the type of protein and its orientation with respect to the membrane. For example, bound ribosomes may be the source of proteins that move into or through the membrane, whereas free ribosomes may synthesize some of the proteins that become associated with the cytoplasmic membrane surfaces (Blobel and Dobberstein, 1975; Lodish and Small, 1975; Sabatini and Kreibich, 1976). Additionally, there could be proportionately different contributions from bound or free ribosomes, depending on the functional activities or specialization of the cell. Once again transfer can be via cytoplasmic pools (which could contain proteins from both sources) or via membrane segments, or both, with some sort of selectivity factors involved in determining which proteins are actually incorporated into the Golgi apparatus membranes. At least some of both the protein and lipid components of the membranes are glycosylated. With respect to a number of secretory glycoproteins, the steps in glycosylation have been well worked out. There is a sequential addition of sugars with the initial sugars added to the polypeptide chain in association with the rough endoplasmic reticulum and the more terminal sugars added in the Golgi apparatus (Cook, 1973; Cook and Stoddart, 1973; Schachter and Rod& 1973; Schachter, 1974; Molnar, 1976). In the endoplasmic reticulum the sugars may first be assembled into oligosaccharides and transferred to the polypeptide chain via lipid intermediates (M.J. Spiro et al., 1976; Tabas et al., 1978) but there is no comparable evidence for en bloc addition in the Golgi apparatus. A similar sequence of steps has been suggested for the synthesis of membrane glycoproteins (Cook and Stoddart, 1973; Hughes, 1973; Leblond and Bennett, 1974; Schachter, 1974; Haddad et al., 1977; Bennett and Leblond, 1977). This sequence is supported by various data including the staining patterns of membrane fractions using different lectins (Singer, 1973). Cook and Stoddart (1973), however, suggest that such staining patterns may be due in part to secretory proteins associated with the membrane, and they discuss the possibility that some membrane protein glycosylation may be initiated in the Golgi apparatus. If glycosylation is initiated in the endoplasmic reticulum, these membrane components may be transferred from the endoplasmic mticulum to the Golgi apparatus by some

THE GOLGI APPARATUS

205

type of membrane-mediated process which retains the directional asymmetry of these molecules. Such a mechanism would also provide for the association of other factors which might be important in subsequent synthetic reactions. Bretscher (1973). for example, suggested that glycosylation of membrane proteins could serve to “lock” them into the membrane-which implies that subsequent transfer is in the form of membrane segments. There is, however, some evidence for turnover of membrane glycoproteins (Autuori et al., 1975a,b; Elhammer et al., 1975). Membrane lipids ate apparently largely glycosylated by activities in the Golgi apparatus (Fishman, 1974), and in some tissues the sulfation of some of these glycolipids also occurs here (see Fleischer et al.. 1974; Tennekoon et al., 1977). Perhaps not too surprisingly, the general pattern for biogenesis of membranes in the endoplasmic reticulum and Golgi apparatus appears to parallel that of the secretory materials processed within them. Possible areas where these two pathways diverge are discussed later.

C. FORMATION AND CHANGE The manner in which the cisternal envelopes are assembled at the forming face of the Golgi apparatus has not yet been ascertained with any finality. Many investigators believe that the process involves the fusion of vesicles or short membrane-bounded segments which come from the endoplasmic reticulum or nuclear envelope. Kessel (1971) investigated in detail an instance in which the Golgi apparatus in embryonic cells of the grasshopper seemed to originate in stages by a process involving the fusion of vesicles from the nuclear envelope (see also C h ~ t i e n ,1972). He also called attention to the possibility that the nuclear envelope is a major site of membrane production (Kessel, 1973). For cisternal formation, vesicles or segments of membrane would have to fuse with each other rather than with existing cisternae. Although micrographs frequently show blebs coming from the endoplasmic reticulum or nuclear envelope in the vicinity of the Golgi apparatus, in many cell types the site of their fusion is subject to debate. A different interpretation (seeClaude, 1970) is that there are at least transient continuities between smooth segments of the endoplasmic reticulum in the Golgi region that result in the formation of cistemae. But in many cases, there is no evidence for either of these mechanisms-a fact which prompts a plea for further study. Some alternative concepts may be required to explain the evidence from high-voltage electron microscope studies of osmium-impregnated samples that the cisternae on the forming face have a tubular structure and may form an interconnected network in the cell (Rambourg et al., 1973). It is certain, however, that cisternal envelopes can be formed on this face. In some cases, their formation compensates for the transformation of mature face cisternae into vesicles (Neutra and Leblond, 1966, 1969; Brown, 1969). A capacity for cisternal

206

W. G. WHALEY AND MARIANNE DAUWALDER

formation is also implied by the increase in number of cisternae which can occur in development and cell differentiation or in response to experimental treatment (Whaley et al., 1964; Hall and Witkus, 1964; Flickinger, 1971). Although fusion of membrane-bounded units is an attractive model for cisternal formation and appears to be a likely mechanism in some cell types, it is not at all clear that the same mechanism pertains in all instances. This uncertainty reflects the lack of knowledge about the relation of the Golgi apparatus to other endomembrane systems. A better understanding of membrane interactions will also provide insight regarding the pattern of development of the organelle, the extent of its differentiation, and its replication (Whaley, 1975). Whatever the mode of cisternal envelope formation and extension, some selectivity must be involved. Biochemical studies have shown that the composition of the Golgi apparatus membrane differs from that of other cytoplasmic organelles with respect to lipids and proteins including enzymes (see Meldolesi et al., 1971a,b; Fleischer and Fleischer, 1971; Cook, 1973; Cook and Stoddart, 1973; Bergeron et al., 1973a; Schachter, 1974; Fleischer et al., 1974; Farquhar et al., 1974; Palade, 1975), although some investigators have emphasized the commonality in membrane composition (for a discussion, see Franke and Kartenbeck, 1976). Further differentiation occurs in the membranes within the stack, and various cytological methods can be used to distinguish cisternae at the forming face, in the midregion, and at the mature face, as well as to indicate differences in the central and peripheral regions of the cisternae (see Dauwalder et al., 1972; Whaley et al., 1975; for previous review and references, see Whaley, 1975). Although the extent to which the observed patterns directly reflect membrane changes is not yet clear, it seems highly unlikely that such differences arise without prior or concurrent changes in membrane-associated activities. There is probably also variation in the composition or interaction of membrane constituents between the functionally different regions of the organelle-such as the sites at which secretory products are assembled and those at which secretory vesicles are pinched off or otherwise separated. For example, Staehelin and Kiermayer (1970). using freeze-fracture techniques, noted differences between these sites in the distribution of intramembranous particles, which could reflect domains of particular composition, structure, or fluidity. Production of the secretory product is generally, though not always, associated with the mature face of the apparatus-sometimes involving several cisternae in which the accumulation appears to be progressive toward the mature face or sometimes involving membranous elements associated with the mature face such as GERL (Golgi apparatus-Endoplasmic Reticulum-Lysosomes) (Novikoff, 1976). In some cell types, however, different secretory granules may originate from opposite faces of the Golgi apparatus (Bainton and Farquhar, 1966). Still the most generally recognized pattern of activity seems to involve membrane differentiation from the forming to the mature face. This pattern has led to the

THE GOLGI APPARATUS

207

concept that cisternae are formed at one face and removed at the opposite face with the evolution of secretory vesicles, and that individual cisternae migrate (flow) from one face of the stack to the other concurrently with the progressive assembly of secretory products. For example, in the development of algal scales (see Brown, 1969), it is difficult to consider the maturation of these large, highly structured, rigid bodies by a mechanism other than displacement of the cisternae containing them. Leblond and his associates (Neutra and Leblond, 1966) made a similar interpretation regarding the formation of mucigen granules in colonic goblet cells. Yet the highly selective staining of single or a few cisternae, with no staining of adjacent cisternae, that is seen with osmium and osmium-zinc iodide impregnations (see Friend, 1969; Dauwalder h d Whaley, 1973; Rambourg et al., 1973; Martin and Spicer, 1973; Lane and Swales, 1976) and with certain enzyme localization techniques (for example, Novikoff et al., 1971) seems inconsistent with a displacement process. How, for example, could cisternal migration occur and complete osmium staining only of the single forming face cisterna still be maintained. It is also difficult to explain how intercisternal elements found toward the mature face of the apparatus in certain cell types fit into the cisternal flow model. Such problems of interpretation have long plagued investigators of the Golgi apparatus (see Whaley, 1966), and they remain factors in attempting to resolve fundamental questions concerning the functioning of this organelle. Membrane differentiation seems to be a necessary forerunner of the influx of substrates and the activity of enzymes concerned in protein remodeling, specific glycosylation steps, and sulfation, all indicated to be Golgi apparatus activities. However, lack of critical knowledge about membranes in general compounds the difficulties in attempting to discuss how membrane differentiation occurs within the Golgi stack. Mechanisms for membrane change include self-directed assembly processes (for example, Holtzman, 1975; Bouck and Brown, 1976), molecular turnover (for example, Siekevitz, 1972, 1975), and patterned cycles of membrane fission and fusion (for example, Poste and Allison, 1973; Lucy, 1975). These phenomena could explain the insertion of particular proteins into the membranes of the Golgi apparatus and provide a basis for continuing modificationduring differentiation or interaction with other membrane systems. However, there is little direct evidence concerning the exact processes involved. Indeed, the turnover and transfer of membrane components make it very difficult to define clearly a membrane in biochemical terms or to trace membrane constituents from one site to another. Membranes may undergo considerable change biochemically in time (or during phases of cell function) without easily detectable alteration of their morphology or location in the cell (see Schor et al., 1970; Siekevitz, 1976). In the Golgi apparatus the problem is also complicated by the possibility that membrane turnover or transfer may differ in cisternae from one region of the stack to another.

208

W . G. WHALEY AND MARIANNE DAUWALDER

With either transfer of membrane segments or molecular turnover, it seems that there must be specificity factors governing the actual incorporation of various components into the Golgi apparatus membranes. With respect to membrane proteins, there is increasing evidence suggesting such factors. Some examples come from the cytoplasmic synthesis of various proteins and their subsequent location in the mitochondria1 and chloroplast membranes. Other data pertain primarily to the endoplasmic reticulum and in part involve mutual interactions of the membranes and ribosomes (for example, Hendler, 1974a,b). A hypothesis recently proposed by Blobel and Dobberstein (1975) to account primarily for the insertion of protein through membranes in the processing of immunoglobulin for secretion might serve as a general model. They suggested a mutual interaction of “signal peptides” on the polypeptide being synthesized and “receptor sites” within the membrane. Various aspects of this model have been discussed in detail by Sabatini and Kreibich (1976). They emphasized the evidence supporting the role of membrane-bound ribosomes in the biogenesis of membrane proteins and considered how this concept might be related to possible interactions of the membrane systems involved in the secretory process. They indicated that membrane specificities in the binding of ribosomes may be important in the synthesis of proteins which are inserted into or through membranes. It has also been proposed that membrane binding sites might in general account for the selective association of particular proteins with the cytoplasmic surfaces of membranes (Lodish and Small, 1975). The above interpretations reflect the increasing attention given to possible membrane-mediated intracellular recognition phenomena and to the varied functional activities of membrane proteins. Such recognition factors could account for some of the events leading to the preferential fusion of vesicles from the nuclear envelope or endoplasmic reticulum with the membranes of the Golgi apparatus; however, evidence for the lack of intermixing of membrane components implies that such fusions do not lead to complete incorporation of membrane segments in the apparatus. One suggestion is that during vesicle fusion (with either the Golgi apparatus or the plasma membrane) some membrane components move by lateral displacement into the recipient membrane system with subsequent bulk removal of excess membrane (Bergeron et al., 1973b; Sabatini and Kreibich, 1976; Haddad et al., 1977). This is an attractive concept, since it allows some membrane components to be transported from one membrane compartment to another in a manner that would retain any directional asymmetry, and yet it provides a way for different membrane systems to conserve their biochemical differences. The mechanisms by which partial incorporation of membrane components is regulated are not known, but the clustering of intramembranous particles during fusion, which has recently been demonstrated by freeze-fracturetechniques (Lawson et al., 1977; Pinto da Silva and Nogueira, 1977), might reflect such processes.

THE GOLGI APPARATUS

209

Such concepts provide a rationale, correct or not, for the consideration of factors which could be important in the assembly and differentiation of Golgi apparatus membranes. This could be of particular significance if, as suggested above, some of the genetically influenced synthetic events are carried out in this organelle by membrane proteins-ne step removed from the direct coding sequence traceable to DNA.

111. Models for the Golgi Apparatus and Its Function A. GENERAL The Golgi apparatus is an organelle which is notorious for variability in form. The common stacked form is characteristic of most eukaryotic cells; however, in some organisms (among them the ciliates; see, for review, Dutta, 1974) it appears quite primitive and is often difficult to distinguish from specialized regions of endoplasmic reticulum. This fact and the possible origin of the Golgi apparatus from the endoplasmic reticulum and/or the nuclear envelope raise numerous questions concerning both evolutionary interrelationships and functional specialization of the various endomembrane systems. It thus becomes necessary to qualify many experimental models of Golgi apparatus function with the observation that in a particular cell type some of the activities involved could take place elsewhere. The size, shape, and number of cisternae, the degree of interconnection among the stacks, the characteristics of vesicle production, and so on, may all differ widely (Figs. 1-3). Despite this diversity of form, cytochemical staining patterns are commonly, but not always, localized at particular sites within the stack: nucleoside diphosphatase (NDPase) and thiamine pyrophosphatase (TPPase) in a few cistemae at the mature face, acid phosphatase at the mature face or in association with GERL, osmium impregnation in one or a few cisterna(e) at the forming face, and osmium-zinc iodide impregnation at either or both faces with unstained cisternae in between (Figs. 4-6). Although the particular details vary, some of these staining patterns have been reported in both plant and animal cells, in cells involved in the production of quite different secretory materials, and in cells without a classic secretory function. Such features have made it particularly difficult to correlate the morphological, cytochemical, and biochemical characteristics of the organelle and arrive at a general interpretation of its form and function. Even the widely accepted role of the apparatus in the assembly of secretory products has been questioned in certain cell types (Novikoff, 1976). The problem becomes how, if at all, the currently available evidence can be

210

W. G.WHALEY AND MARIANNE DAUWALDER

FIG.1. An example of a large, localized Golgi apparatus in a morphologically polarized secretory cell. The cisternae are elongated and highly interconnected. Accumulations of electron-dense secretory material can be seen in the mature cisternae and in the complex secretory granules which contain both protein and plysaccharide products. The Golgi regions shown are approximately 25 by 17 p n in size. Multifid gland cell of the snail Helix aspersu during the reproductive season. Glutaraldehyde and osmium. ~2300.

related to characteristics of the stacked membranes within the organelle and to their differentiation. As pointed out by several authors in Weissmann and Claiborne (1975), recent advances in membrane research have as usual raised more questions than they have answered. With respect to the Golgi apparatus, the questions are many. Attempts to formulate a plausible model of Golgi apparatus function for discussion and experimental guidance may end in frustration (or heated argument). Figure 7 was designed to set up a basis on which to consider some of the features that might hypothetically be involved in the differentiation of Golgi apparatus membranes (necessarily neglecting many of the problems such as the function of the forming face, the possibility of cistemal displacement, the precise location of various processes within the stack, structural pleomorphism, participation of the organelle in lysosomal activity, and so on). Only part of the

THE GOLGI APPARATUS

21 1

available information has been included. Unfortunately, the basis for the impregnation staining patterns is not known, and their inclusion here would also require localization within the stack, as would that of the cytochemically demonstrable phosphatases. In addition, the relationship of NDPase and TPPase activities to the membrane is not clear and, although there have been some suggestions linking them to carbohydrate synthesis, their functional significance is not well defined. Localizations of other enzymes, such as those for lysosomal components, some of which are glycoproteins, probably indicate the assembly of many different products in the apparatus (and perhaps the synthesis of some). Although Fig. 7 shows a pattern of numbered areas, this is for convenience in illustration only and in no sense is intended to indicate topographical relationships. It roughIy indicates membrane features which may be involved in moving materials into the stack, those occurring within the stack, and those involved in separating materials from the stack. The term “Golgi region” lacks general acceptance because

FIG.2. Part of a large Golgi complex showing one pattern of product accumulation. The cisternae toward the mature face become progressively distended with material, and large vesicles form. The membrane relationships at the forming face are quite intricate, with short membrane-bounded segments and possibly some vesicles in this region. This morphology is often interpreted as indicating cisternal formation at the forming face and subsequent cisternal displacement. Mucus cell from the body wall of the slug L i m a sp. Glutaraldehyde and osmium. ~30,000.

FIG.3. An example of the complexity of membrane interactions in the Golgi region. In addition to Golgi stacks and profiles of endoplasmic reticulum, there are membrane-bounded segments and strands and different-sized vesicles, both smooth and coated, in the region. In three dimensions some of these elements are probably interconnected. The Golgi stacks are loosely associated, and the morphology of the cisternae and the character of their contents differ across the stack. Indications of the patterns of cistemal fenestration can be seen in both sectional views-in general, this pattern becomes more tubular toward the mature face. The mature face appears to be active in vesicle formation, but the function of the apparatus in this cell type is not known. Primary spermatocyte from H.aspersa. Glutaraldehyde-tannic acid and osmium. X44.700.

THE GOLGI APPARATUS

213

FIG.4. Staining pattern typical of the osmium impregnation technique. One to three cistemae on the forming face are heavily stained with osmium. The adjacent cisterna and all remaining cisternae toward the mature face are unstained. Active multifid gland cell of H. aspersa. Compare with the unstained morphology in Fig. 1 . Osmium impregnation of unfixed sample. x 16,500.

it is not clearly definable, but there is much evidence for organization and activities within the vicinity of the organelle that are not attributable directly to components of the membrane or lumen. Recent investigations using high-voltage electron microscopy have revealed a complex dynamic substructure in the cytoplasmic ground substance bearing some relation to membranes, microtubules, and microfilaments (see Wolosewick and Porter, 1976). Such a system or other factors not yet clearly definable in terms of their molecular organization may influence the features indicated in Fig. 7.

B. TRANSFER TO THE GOLGIAPPARATUS In Fig. 7, area I (top) illustrates the transfer (and possible inclusion) of membranes and materials which move to the Golgi stack in the form of membranebounded vesicles. Such a transfer may be involved in the formation of cisternae

214

W. G. WHALEY AND MARIANNE DAUWALDER

FIG.5. Osmium-zinc iodide staining in a plant cell. One to three. cisternae at the forming face are stained, whereas staining at the mature face is limited to a single cisterna and associated vesicles. Vesicles separated from the stack are not stained. On the basis of autoradiographic experiments, this cell type is not particularly active in secretion in the classic sense. There is some staining of internal plastid membranes. Cortical cell from the root tip of Zea mays. Osmium-zinc iodide impregnation of unfixed sample. x40,OOO. FIG.6. Osmium-zinc iodide staining in an animal cell. Again, cisternae at both faces of the stack are stained, with unstained cisternae between. Often the staining at the forming face is more extensive than that at the mature face. The function of the apparatus in this cell type is unknown. Late spermatid from H. aspersa. Osmium-zinc iodide impregnation of unfixed sample. X24,500.

or in the extension of existing cistemae. Much of the information on transfer pertains not to the membranes themselves but to the masses of secretory materials contained in vesicles pinched off from segments of the endoplasmic reticulum (or in some cells the nuclear envelope) and moved to a site in the Golgi region. Leblond and his associates (Neutra and Leblond, 1966, 1969) envision such a transfer of membranes and presumptive secretory materials to the forming face of the organelle-with the secretory material being subiequently modified during the differentiation of cisternae across the stack (e.g., Fig. 2). There is recent biochemical evidence consistent with this scheme from studies on the formation of serum proteins in the liver (Bergeron et al., 1978). Palade and his coworkers

THE GOLGI APPARATUS

215

(Palade, 1975; Jamieson, 1975) suggested that such vesicles were transferred to the more mature cisternae in some types of glandular cells or to the condensing vacuoles in the exocrine pancreas (e.g., Fig. 8). Immunocytochemical evidence (Kraehenbuhl et al., 1977), however, demonstrates the passage of bovine pancreatic zymogens through the cisternae of the Golgi apparatus. Whatever the site of incorporation of materials into the Golgi region, transport in membranebounded packets necessitates membrane fusion. There is little direct information concerning such fusions; however, it seems highly likely that this is a nonrandom selective process (for discussion, see Meldolesi, 1974a) which could involve a mutual signal system between the membranes. As noted, although some membrane components may be transferred during fusion, the evidence is not consistent with the stable incorporation of entire vesicle membranes into the Golgi apparatus. One possibility is that the vesicles (with selective cycles of membrane fission and fusion) "shuttle" between the endoplasmic reticulum and the Golgi region in the transport of secretory materials (Meldolesi, 1974a; Palade, 1975). This represents one site at which there is a possible difference in the translocation of secretory materials and of certain membrane components which may be reutilized or recycled. As noted in Section IV,A, this may also occur following the fusion of secretory vesicles with the plasma membrane. The possibility of recycling and the general compositional similarity of the membrane and the secretory components have complicated the analysis of membrane transfer.

\t\

I

v

nn

FIG.7. A hypothetical representation of some of the characteristics and activities of the Golgi apparatus, which also indicates possible associations with other cytoplasmic components. For a detailed explanation, see the text.

216

W.G.WHALEY AND MARIANNE DAUWALDER

FIG.8. Part of a large Golgi complex showing the transport of materials by means of small vesicles. Blebs coming from the rough endoplasmic reticulum give rise to many of the vesicles, but some of the vesicles could be moving back to the endoplasmic reticulum as part of a “shuttle” system. Indications of possible vesicle fusion can be seen in some regions of the Golgi stack; however, evidence of either vesicle fission or fusion can also be seen in the forming secretory vesicles (vacuoles). The cistemae at the forming face are highly distended. The precise manner of secretory vesicle formation is not completely clear. Nuchal cell from a late embryo of H.aspersa near the time of hatching. Glutaraldehyde and osmium. ~42,000.

The secretory products transported include proteins, incomplete glycoproteins, and various lipid-containing materials. For simplicity the latter have been omitted from Fig. 7. For a recent view of the assembly and secretion of liver lipoproteins see Alexander et al. (1976). As noted, the synthesis of glycoproteins and glycolipids in many cases appears to involve sequential addition of sugars in the endoplasmic reticulum and Golgi apparatus. Roseman (1970, 1974, 1975) proposed that the glycosyltransferases involved were associated to form multiglycosylnansferase systems. Although such enzyme complexes may be formed by the “interlocking” of components after their sequential insertion into the appropriate membrane system (Siekevitz, 1975), it is tempting to envision transfer of multiglycosyltransferases via vesicle membranes concurrent with that of incompletely glycosylated secretory products. Synthesis could then be completed by the different transferases, possibly after activation steps such as the addition of substrates or cofactors, various unmasking mechanisms, or spatial or configura-

THE GOLGl APPARATUS

217

tional changes in the macromolecular structure. Some changes in the activity of enzymes might be mediated by membrane-associated processes, perhaps as a feature of differentiation toward the mature face of the apparatus. In Fig. 7, area I (bottom) illustrates sites for membrane modification by selective molecular turnover. Such a process appears to involve some mediation or specification by sites within the membrane. Turnover could lead to particular changes in the lipid and protein composition, or bring about various other alterations such as differences in fluidity or modulation of enzyme activity. The sites for turnover might differ with location in the stack or be subject to change in terms of flow within the membrane or interaction with other membrane components. For instance, the incorporation of some membrane components during vesicle fusion could sufficiently change the character of the membrane so as to affect turnover processes. Unfortunately, there is no direct evidence for factors which might govern the selectivity of membrane change either during vesicle fusion or by turnover mechanisms. Some combination of such factors, however, seems currently the most readily comprehensible explanation for the compositional differences observed.

FIG.9. An electron microscope autoradiograph showing the pattern of galactose incorporation. Labeling in the cytoplasm is limited to the Golgi stacks with forming secretory vesicles and to vesicles in transit to the cell membrane. The labeled material is being preferrntially secreted along the cell surface toward the left. Outer rootcap cell of Z. mays. Galactose-H3 for 30 minutes. Glutaraldehyde and osmium. X 11,600.

218

W. G. WHALEY AND MARIANNE DAUWALDER

C. ACTIVITIESIN

THE

GOLGISTACK

In Fig. 7, area 11, once again not to be considered topographically fixed, illustrates various facets of Golgi apparatus activity. The specific features of these activities differ with species, tissue, and cell type. Localized regions of the cistemae can be highly specialized both morphologically and functionally. A striking example (Fig. 7, lower left) is seen in the production of the complex, highly structured scales of certain algae (Manton, 1966a,b, 1967a,b; Manton and Leedale, 1969; Brown, 1969; Brown et al., 1973). Their assembly involves both cistemal membranes and may exhibit differences in structuring at the opposite lumenal surfaces. The cistemal morphology appears to determine the shape of the scale, and several distinctive scale types may be assembled in the Golgi apparatus simultaneously (Moestrup and Thomsen, 1974). This process provides an excellent example of regional polarization in the cistemae, and the general polarity of the organelle (arrows in Fig. 7) is a basic feature of its morphology. The nature of the forces involved in the induction and maintenance of polarity are unknown, but membrane features seem likely to be among the factors involved. These could include interactions of materials located between the cistemae (e.g., intercisternal elements or “cementing” substances) with the cytoplasmic surfaces of the cisternae; but how such interaction might be directional is unclear. Little is known about the specializations of the cytoplasmic membrane surfaces, and many of those indicated in Fig. 7 are included by implication. There is, however, evidence for anionic binding sites which might affect cisternal cohesion (Abe et al., 1976), and for some enzymes on these surfaces. The cytochemically demonstrable products for acyltransferase (Fig. 7, upper left; Benes et al., 1973); adenylate cyclase (Cheng and Farquhar, 1976a,b) and, in some portions of the apparatus, 5’-nucleotidase(Farquhar et al., 1974; Little and Widnell, 1975) are localized here. The acyltransferase activity appears to be associated with phospholipid synthesis and thus might be important in conferring particular characteristics on membranes during Golgi apparatus differentiation or membrane biogenesis. The others may be transported to and included in the plasma membrane. The evidence for 5’-nucleotidase is particularly intriguing in that in secretory vesicles produced by the apparatus the activity is localized on the lumenal membrane surfaces, perhaps as a result of enzyme translocation (Little and Widnell, 1975). The most extensively studied synthetic activity of the Golgi apparatus is the formation of various carbohydrate moieties (the synthesis of polysaccharides and the glycosylation of proteins and lipids) and the sulfation of some of these. The evidence comes from many cell types and includes specific staining reactions, autoradiographic studies, and the presence of glycosyltransferases, particularly galactosyltransferases, and some of the sulfation enzymes in Golgi apparatusenriched fractions (Rambourg, 1971; Cook, 1973; Hughes, 1973; Young, 1973;

THE GOLGI APPARATUS

219

Schachter and Rodkn, 1973; Fleischer and Zambrano, 1973; Knapp et al., 1973; Schachter, 1974; Fishman, 1974; Fleischer et al., 1974; Bennett et al., 1974; Dauwalder and Whaley, 1974; Molnar, 1976; Haddad et al., 1977; see Fig. 9). The precise relationship of these enzymes to the membrane bilayer is not known, but at least with respect to some of the glycosyltransferases there is fairly good agreement that they are located within the cistemae and are often f m l y associated with or are integral components of the membrane (see Roddn and Schwartz, 1975; Jentoft et al., 1976). There is, however, some variability in binding of the transferases to the membrane (for example, Schwartz et af., 1975), and free transferases occur in some body fluids (serum, milk). There are also glycosyltransferases in the plasma membrane where it has been suggested that they act in cellular recognition or regulatory phenomena (Roseman, 1970, 1975; Roth, 1973; Roth et al., 1974, 1975; Weiser, 1976; Cebula and Roth, 1976). This location is consistent with the idea that enzymes which are tightly bound membrane components can be transported via Golgi apparatus-derived vesicles for inclusion in the plasma membrane. Substrates are necessary for synthetic action, and it seems likely that the Golgi apparatus membranes (particularly toward the mature face) are responsible for providing sufficient concentrations of sugars, sulfate, and perhaps other materials. Using the globulin-type glycoprotein as an example, the sugars would include galactose, fucose, and sialic acid; however, with other products (e.g., plant cell wall materials) other sugars and the appropriate transferases would be involved. The selective binding and transport of sugars (and other lowmolecular-weight substances) has been extensively studied in bacteria (Roseman, 1972; Oxender, 1974), and there is growing evidence that in the plasma membrane specific membrane components are instrumental in these processes (Singer, 1975). The mechanism by which sugars activated outside the Golgi cistemae gain access to the inside of the cistemae where they are utilized is not known. Roseman (1970) suggested that Golgi apparatus glycosyltransferases might penetrate the membrane and act as their own substrate transport system. Molnar (1976) discussed other possible mechanisms for sugar transport in the endoplasmic reticulum which provides substrates for the initial steps in glycosylation. In this case the evidence suggests the involvement of lipid-bound intermediates, but these intermediates did not react well with galactose, fucose, or sialic acid, as would be expected if they operated in Golgi apparatus membranes. The synthesis of carbohydrates in the Golgi apparatus seems to requite the extensive movement of selected sugars (and in some cell types, sulfate) through the membranes-hence the inclusion of these transport systems as a differentiated feature of the Golgi apparatus membranes. For efficient substrate utilization such systems may be in close proximity to or associated with the transferase enzymes. The Golgi apparatus is the site of glycosylation not only of secretory products

220

W. G. WHALEY AND MARIANNE DAUWALDER

but of membrane glycolipids and glycoproteins as well (Rambourg, 1971; Cook, 1973; Cook and Stoddart, 1973; Hughes, 1973; Singer, 1973; Leblond and Bennett, 1974; Bennett et al., 1974; Fishman, 1974; Schachter, 1974; Fleischer et al., 1974; Fishman and Brady, 1976; Haddad et al., 1977; Bennett and Leblond, 1977; Bok er al., 1977). One example is provided by studies of immunoglobulin (Ig) secretion. Ig’s have regions of highly variable polypeptide chains which are responsible for immunological specificity, and regions of more constant polypeptide composition containing carbohydrate moieties which may be involved in membrane association. The evidence is good that Ig molecules are terminally glycosylated and assembled in the Golgi apparatus and then transferred to the cell surface (Vitetta and Uhr, 1975; Uhr, 1975). At the time of exocytosis, some Ig remains attached to the plasma membrane, while some is secreted. The predominance of binding or release appears to be under regulatory control; and it may vary with the type of Ig, the type of cell, and the state of cellular development or stimulation. The molecules involved are structurally similar, but it is not known if they are identical, and some differences in carbohydrate moieties have been reported (Melchers and Andersson, 1974). Vitetta and Uhr (1975) suggested that modification of Ig molecules in the Golgi apparatus could cause the release of some of these molecules from the membrane, and a similar possibility has been noted for certain serum glycoproteins secreted by the liver (Redman and Cherian, 1972). Dissociation of some of the glycosyltransferase enzymes from the membranes might lead to their secretion and explain their appearance in body fluids. The alterations involved in the release of membrane constituents could include proteolysis of an hydrophobic portion of the polypeptide chain holding the molecule to the membrane, or the shedding of small membrane segments as has been suggested by Uhr (1975) in the release of Ig from the plasma membrane. The question remains of whether Ig’s terminally assembled in the Golgi apparatus should be considered secretory products or portions of first the Golgi apparatus membrane and then the cell surface membrane. Thus, avoiding a sharp distinction between these two assembly processes seems desirable. As one or the other, Ig imparts specific characteristics to the cell membrane or the blood plasma or both (perhaps depending on the particular character of the molecules). A somewhat similar situation exists with respect to some of the substances with blood group activity in which the specific functional determinants have been shown to be in the carbohydrate moieties. For example, in the ABO, H, and Lewis blood group systems, the specifying factors occur in the body fluids as components of glycolipids, and comparable sequences of carbohydrates occur on the surface of erythrocytes as portions of glycoprotein molecules associated with the plasma membrane (see Spiro, 1973). Another example of membrane glycosylation which points to the specificity of the terminal carbohydrate moieties is found in recent studies of the insulin receptor. Cuatrecasas (1974, 1975) reviewed the nature and distribution of specific

THE GOLGI APPARATUS

22 1

insulin receptors on various types of cells. These surface groups appear to be glycoproteins containing galactose and having sialic acid as a terminal group, a typical configuration for products which undergo the final steps of glycosylation in the Golgi apparatus. Additionally, there is direct evidence suggesting biogenesis of the insulin receptor in the Golgi apparatus (Bergeron et al., 1973b; Bergeron and Posner, 1975). This provides an instance of the processing of both membrane receptor components and their interacting substance in the Golgi apparatus, for insulin is terminally assembled in the Golgi apparatus of the beta cells of the endocrine pancreas (Orci et al., 1971, 1973b; Steiner ef al., 1975b; see, however, Novikoff et al., 1975). The diverse biological actions of insulin and the variety of cell types involved seem to necessitate well-controlled mechanisms for the formation and secretion of insulin and for the proper biogenesis of the receptor and its transport to the plasma membrane to ensure normal function. Although the exact nature of the receptor site is not yet known, Cuatrecasas (1975) states that galactose forms “a pretty essential part” of this site. The biological importance of the sugar-containingportions of macromolecules has been recognized for some time (see Spiro, 1973), and particular functional activities have been suggested for those at the cell surface-as sites for recognition and aggregation, as antigens, and as receptors for viruses, hormones, or other substances (Winder, 1970; Rarnbourg, 1971; Cook and Stoddart, 1973; Spiro, 1973; Hughes, 1975, 1976; Talmadge and Burger, 1975; Luft, 1976). What remains to be determined is the extent to which the actual structuring of the carbohydrates is essential to many of these functions. The specificity characteristics of surface sugars, including galactose and fucose, have been most carefully worked out with respect to the blood group substances (Watkins, 1974). The particular (or peculiar) role of galactose in “cell sociology” was pointed out a number of years ago by Kalckar (1965) who predicted its importance in such phenomena as cell adhesion and development (see also Roth et al., 1971; Chipowsky et af., 1973; Vicker, 1976), neural function (see also Radin, 1970; Fishman, 1974; Brady and Fishman, 1976), and abnormalities of genetic and viral origin. As noted, galactose has also been implicated in hormone reception, and it is a key sugar in the uptake of circulating glycoproteins by the liver (Ashwell and Morell, 1971, 1974). Much attention has recently been focused on the importance of alterations in galactose moieties in the cell membrane in relation to cell transformation or other dysfunctions (for example, Gahmberg and Hakomori, 1973; Hakomori ef al., 1974; Brady and Fishman, 1975, 1976; Gahmberg et al., 1976; Fishman and Brady, 1976). In some of these cases, changes in galactosarninyl- or galactosyltransferasees were found. Changes in fucose-containing glycoproteins have also been reported in relation to cellular transformation (see Warren and Buck, 1976), and fucose appears to be involved in receptor reactions mediating macrophage mobility (Fox et al., 1974). As

222

W.G. WHALEY AND MARIANNE DAUWALDER

noted by Schachter (1974), radioactive “fucose is an especially useful label for plasma membrane(s),” and it has been increasingly used as a marker for plasma membranes in biochemical investigations. Considerable attention has been directed toward cell surface sialic acid. Most commonly the evidence has pointed either to a general involvement in charge characteristics of the surface materials or to the effects of removal of sialic acid, which allows interactions with other components of the glycoproteins (for example, Winzler, 1970; Ashwell and Morell, 1971; Neri et al., 1976). The particular distribution of surface changes may, however, be important in cell function (Brummett and Dumont, 1976; Skutelsky and Farquhar, 1976), and sialic acid appears to have a more specific role in certain membrane receptors. In the liver, sialic acid is a necessary receptor component for the binding and subsequent removal of serum asialoglycoproteins (Ashwell and Morell, 1974), and such receptors may also be involved in patterns of lymphocyte homing (see Hughes, 1975). Sialic acid may be a component of the thyrotropin receptor (Tate et al., 1975; see Kahn, 1976). The presence of sialyltransferase has been reported in Golgi apparatus fractions (see Schachter and Roden, 1973; Schacter, 1974), and enzymes involved in the modification of sialic acids may also occur here (Schauer et al., 1974). Recently Bennett and Leblond (1977) showed by autoradiography that N-acetylmannosamine, a relatively specific precursor of sialic acid, was rapidly incorporated by the Golgi apparatus and that the labeled materials were subsequently moved to the plasma membrane and the lysosomes. These investigators suggested that the synthesis of all glycoproteins for the cell surface and lysosomal system is completed in the Golgi apparatus. The exact nature of the interactions of surface carbohydrate groups and other groups is yet to be determined, as is the question of whether they are indeed causally related to subsequent cellular phenomena. Still, the general evidence seems sufficient to support a hypothesis that glycosylation of membrane components is completed in the Golgi apparatus, and that these components are then transported via derived vesicles to the plasma membrane where they may have a profound influence on cellular behavior. This hypothesis does not rule out the possibility of further glycosylation at the surface or the involvement of surface glycosylating enzymes in cellular recognition or interaction (Roseman, 1970, 1975; Roth, 1973; Cebula and Roth, 1976).

D. TRANSP~RT AND RECOGNITION In Fig. 7, area 111indicates some of the features which might be involved in the evolution and transport of vesicles. Vesicles with distinctive sizes and shapes or membrane modifications are in many cases formed from the highly fenestrated (or possibly tubular) periphery of more mature cisternae (although there are many

THE GOLGI APPARATUS

223

examples suggesting that their contents may be at least partially developed at other sites within the cisternae and subsequently moved to the periphery; for reference, see Whaley, 1975). The morphological changes in cisternal structure during vesicle evolution may be accompanied by various changes in the membrane (possibly including alterations in composition, fluidity, topographical rearrangements, and so on, and modifications actually occurring during the fission process). Lack of the particles demonstrable by freeze-fracture in fenestrated regions (Staehelin and Kiermayer, 1970) could relate to some of these processes. The total mechanism would have to include steps ensuring sequestering of the membrane components and lumenal materials destined for transport into the presumptive vesicles. The factors governing the size or shape of the vesicles are not known. In some cases it has been suggested that different types of vesicles evolve from different regions of the stack (Friend and Farquhar, 1967; Coulomb and Coulon, 1971; Dobberstein and Kiermayer, 1972; Singal and Sanders, 1974). If so, this would again point to a high degree of cisternal membrane differentiation within the organelle. Some of the enclosed secretory materials exhibit varying degrees of structuring either in the cisternae or in the vesicles. Membrane activities may be involved, as has been suggested for algal scales, but often visible changes in structure occur at a distance from the inner membrane surface. Changes in structure could result from assembly processes dependent on the molecular configurations of the products themselves or could be influenced by materials added in the Golgi apparatus. Charged polysaccharides have an enormous potential for binding (Rees, 1975), and it has been suggested repeatedly that polysaccharide materials have various effects on the structural integrity or functional activity of other components in the intercellular matrix (see Trelstad, 1973; Hay, 1973; Slavkin and Greulich, 1975). It is likely that the synthesis of such materials by the Golgi apparatus could similarly affect components within the cisternal or vesicle lumen. In the odontoblast, structural rearrangements of potential matrix components occur within regions of the Golgi apparatus prior to secretion. Weinstock and Leblond (1974) showed carbohydrate staining, probably indicative of synthesis, at the sites where procollagen molecules were oriented in parallel bundles. It is tempting to suggest an interrelation between these two processes, but more definitive evidence is needed. The presence of carbohydrates in secretory materials might also result in alterations in the pH (Palade, 1975) or modulations of enzyme activity. Hardin and Spicer (1971) suggested that mucosubstances stabilized potential lysosomal enzymes during the storage of leukocyte granules in the cytoplasm. Additional interactions of polysaccharides which occur either intra- or extracellularly have been discussed recently by Lindahl and HMk (1978). Catabolic activities are also important in the assembly and possibly the structuring of secretory materials. Limited proteolysis has now been suggested to occur in the intracellular assembly of a variety of secretory products (for exam-

224

W. G. WHALEY AND MARIANNE DAUWALDER

ple, Pasquini et al., 1974; Urban et al., 1974; Quinn et al., 1975; Schechter et al., 1975). Some of this may take place in the endoplasmic reticulum (see Sabatini and Kreibich, 1976); however, there is direct evidence for involvement of the Golgi apparatus in the proteolytic processing of certain peptide hormones. The assembly of insulin provides a good example (Steiner, 1969; Tager and Steiner, 1974; Steiner et al., 1975a,b). Proinsulin is synthesized in the rough endoplasmic reticulum and moved to the Golgi apparatus. Cleavage of proinsulin to insulin begins in the apparatus and continues in the derived secretory granules during the maturation process which is finally completed with the formation of a dense crystalline inclusion. Proteolysis might be involved in modifying the binding of materials to membranes, as noted previously, or in the activation of enzymes, as suggested for tyrosinase in melanin synthesis (Barisas and McGuire, 1974). Glycosidases in the Golgi apparatus could also play an important role in the final structuringof glycoprotein secretory materials or lysosomal components (Touster, 1973; Dewald and Touster, 1973; Goldstone and Koenig, 1974; Marsh et al., 1974). Recent evidence on the synthesis of lysosomal enzymes indicates that there are differences in both the protein and carbohydrate moieties between materials isolated from microsomal and lysosomal fractions, a suggestion that considerable remodeling may occur during the assembly of glycoprotein molecules (Tulsiani et al., 1978). Some of the materials assembled in the Golgi apparatus become components of the cell coat. Cook and Stoddart (1973) discussed some of the inappropriate aspects of this terminology; however, the analogy can be profitably used (Luft, 1976), and the term is retained here in a descriptive sense. Much of the cell coat is probably made up of glycosylated components of the plasma membrane discussed previously, but some materials closely associated with the membrane and not actually part of its structure could also be involved. In a sense (see Ito, 1974), even intercellular matrix materials can be considered highly developed cell coats. The cell coat is a generally occurring surface element, characteristic of all cells and largely carbohydrate in nature. Thus its assembly might represent a fundamental Golgi apparatus function. Its synthesis and transport parallel that of other carbohydratecontaining materials (Leblond and Bennett, 1974; Bennett et al., 1974; Haddad et al., 1977; Bennett and Leblond, 1977), which is consistent with the concept that membrane components are glycosylated in the apparatus (Fig. 7, lower right). Here also, other presumptive coat constituents might be synthesized and/or selectively bound to the membranes (Fig. 7, “coat hangers,” upper right). Recent evidence has suggested a relationship between transmembrane glycoproteins and the intramembranous particles demonstrated by freeze-fracture techniques. The most direct support comes from studies of erythrocytes (see Marchesi, 1975a,b); however, in a rare homozygous condition in human beings where the major erythrocyte sialoglycoprotein is completely lacking, Bachi et

THE GOLGI APPARATUS

225

al., (1977) showed that there was no decrease in the number of intramembranous particles. Although various interpretations were possible, they concluded that this glycoprotein was not essential for maintenance of the structural integrity of the particles in human red blood cells. The coat on most other eukaryotic cells is much more complex than that of the erythrocyte, and some of the components vary in distribution and apparent mobility independently of the freeze-fracture particles (Pinto da Silva et al., 1975; Martinez-Palomo et al., 1976). Synthesis and transport of surface materials have been shown to occur in many cell types not classically considered secretory (Bennett et al., 1974; Haddad et a / . , 1977). Even in such cells, regions of the plasma membrane may be highly specialized and show clear differences in the extensiveness of cell coat development. Differences in patterns of labeling of cell surfaces have also been noted in autoradiographic studies of sugar incorporation and translocation (Leblond and Bennett, 1974). “Turnover” of the plasma membrane appears to be a general phenomenon (although it has been most studied in animal cells), which evokes questions concerning how patterns of surface coat specialization are maintained and how they are changed in an ordered sequence. In a few cases different classes of vesicles have been implicated in this process (for example, Mignot et al., 1972). Some secretory surfaces are more conspicuously associated with compensatory retrieval mechanisms, and it seems probable that in such instances (e.g., in cells of the exocrine pancreas) the membrane transport to or retrieval from the secretory lumenal surface of the cell differs from that involving the lateral or basal regions of the plasma membrane. There is little precise information about the extensiveness of activities within the vesicles separated from the Golgi region. In many cases visible structuring is absent, but staining reactions often indicate continuous changes in the contents. New metabolic activities could be involved, but these changes may simply reflect the progress of reactions already initiated. Small molecules such as water or certain amines (Ericson, 1972; Gershon and Nunez, 1973; Palade, 1975) and ions such as Ca2+(Baumrucker and Keenan, 1975; Warner and Coleman, 1975; Ravazzola et al.,1976), are moved into or out of the vesicles, but the extent to which the vesicle membrane is actively involved in such transport is unclear. The observations of Franke and his co-workers (1976; Franke and Kartenbeck, 1976) suggest that there are selective changes or modifications in membrane constituents during the flow of secretory vesicles, possibly through molecular turnover. In some cell types, however, the vesicles are stored in the cytoplasm or transported to distant sites prior to exocytosis-suggesting that the vesicle membranes retain their differentiated character or are relatively resistant to change. Modifications resulting in increasing stability of membranes could be an important facet of membrane characterization occurring in the Golgi apparatus. Palade (1975) noted also that changes toward decreased membrane permeability may provide resistance to external conditions with exocytosis.

226

W. G. WHALEY AND MARIANNE DAUWALDER

The previously described phenomena are related primarily to the development of factors within or associated with the inner surface of the cisternal and vesicle membranes. Characteristics of the outer (or cytoplasmic) membrane surfaces are less clearly understood. Some of the vesicles coming from the Golgi region have been categorized, perhaps miscellaneously, as “coated, ” ”bristle-coated, ” or “fuzzy” vesicles. Such structuring appears to typify a form of morphologically distinctive differentiation of the outer vesicle membrane surface. There are probably several different types of vesicles which can be categorized as coated. Such vesicles have been implicated in diverse functions and appear to have various fates (Franke and Kartenbeck, 1976; Franke et af., 1976). Coated vesicles are often relatively numerous in the region of the Golgi apparatus. It has been suggested that some of the Golgi apparatus-derived coated vesicles represent membrane specially assembled for transport to the plasma membrane or that they are involved in the recycling of portions of this membrane (Franke and Herth, 1974; Franke et al., 1976; Rees et al., 1976; Steinman et al., 1976; Silverstein et af., 1977). Sites on the outer membrane surfaces might also play a role in the movement of Golgi apparatus-derived vesicles to particular sites on the plasma membrane, as part of a patterned or directional transport process. The intracellular transport of materials depends on a complex of cellular phenomena. Palade and his associates (see Palade, 1975) discuss the movement of secretory proteins in two phases: one concerned with transport from the endoplasmic reticulum to the Golgi apparatus and another involved in the events leading to discharge. Based partly on the requirement for continued ATP synthesis, they suggest the existence of a lock or lock-gate in transport from the endoplasmic reticulum to the Golgi apparatus at the level of the transitional elements of the endoplasmic reticulum. Attempts to localize components of such a system have led to the development of a technique that gives selective staining of small structures limited to regions of the endoplasmic reticulum where blebs are being formed (Locke and Huie, 1975, 1976). Currently, this staining reaction is observed only in certain classes of animals, and a clear interpretation of the staining patterns is not possible. The state of assembly of the materials in the endoplasmic reticulum can also affect transport processes (Uitto et af., 1975)-perhaps indicating that another sort of “lock” operates in this region. It is not clear whether or not there are similar barriers in the formation of vesicles from the Golgi stack. It does seem that a substantial number of factors must be involved in the accumulation of secretory materials and the appropriate membrane components into presumptive vesicles and in the subsequent fission events. Once separated, the vesicles must be translocated and, as shown in Fig. 7, sites on the outer surface of the vesicle membrane may provide for an association with microtubules and microfdaments-which seem to function in the guidance and movement of the vesicles. Microtubules are often found in the

THE GOLGI APPARATUS

227

Gold region in animal cells, and a relationship between Golgi vesicles and microtubules was suggested by several groups working with plant cells soon after the discovery of microtubules themselves. There are now numerous studies, some using inhibitors, which indicate the involvement of microtubules andor microfilaments in maintenance of the normal integrity and intracellular location of the Golgi apparatus (Bhisey and Freed, 1971; Kelley e t a f . , 1973; De Brabander et al., 1975; Moskalewski et al., 1976) and in the transport and/or exocytosis of the derived vesicles (Ehrlich et al., 1974; Allison and Davies, 1974; Redman et af., 1975; Bauduin et af., 1975; Smith et al., 1975; Malaisse et af., 1975; Poisner and Cooke, 1975; Patzelt et af., 1977). The use of inhibitors thought to disrupt primarily the activities of microtubules or microfilaments often leads to abnormal transport and accumulation of material in Golgi apparatus vesicles; however, the mechanisms responsible for these changes are still subject to question (for discussion, see Redman et al., 1975; Patzelt et al., 1977). Movement may result from the general motility of the cytoplasm, with microtubules providing directional orientation, but in some cases both the speed and the directional precision of translocation seem to require a more selective mechanism. Vesicles often appear in clusters in association with microtubular structures (Whaley et af., 1966), and cross-bridging occurs between microtubules and vesicles in some cells-for example, in axonal transport (D. S. Smith, 1971; Smith et af., 1975). Recently, studies of isolated pituitary secretory granules have shown the in v i m binding of both microtubules and actin filaments to the granule membrane (Sherline et al., 1977; Ostlund et af., 1977). Although much more evidence is needed, various interactions between membrane components and microtubules or microfilaments could mediate preferential vesicle transport. The tails of the transmembrane glycoproteins are possible sites for interaction, and Edelman (1976) explored the implications of such a relationship in the modulation of groups in the plasma membrane. Attempts to explain the selective patterns of fusion among different membrane systems (see, for example, Poste and Allison, 1973; Meldolesi, 1974a; Lucy, 1975; Palade, 1975) have, as already noted, led to the suggestion that a membrane recognition system exists. The fact that exocytosis occurs primarily at the secretory lumen of polarized glandular cells provides a general example. More direct evidence for the specificity of fusion comes from studies on heterophilic polymorphonuclear leukocytes which contain more than one kind of granule. The two major granule types are assembled in the Golgi apparatus and remain in the cytoplasm for various time periods-suggesting that the derived membranes are fairly stable. The two granules differ in membrane composition (see Holtzman, 1976) and in the normal patterns of fusion with membranes arising with phagocytosis (Bainton, 1973; Bainton et al.. 1976). Various exogenous materials can stimulate fusion of one granule type with the plasma membrane without similarly affecting the other-the implication being that there are different sig-

228

W.G . WHALEY AND MARIANNE DAUWALDER

nals for granule discharge (Goldstein et al., 1975; Hoffstein et al., 1976). There are lectin-binding sites indicative of sugar residues on the outside of both granule types, and it has been suggested that these could be related to granule recognition (Feigenson et al., 1975). Several factors can affect the differences in granule fusion observed in vivo (relative number of granules, movement of granules to the site for fusion, and so on); however, results from in vitro studies of phagolysosome fusion in amebas are consistent with the specificity of fusion being dependent on factors in the membranes (Oates and Touter, 1976). Such factors could be of extreme importance in controlling the normal secretion of lysosomal enzymes or in the aberrant release of these enzymes in various dysfunctional conditions (Holtzman, 1976; Davies and Allison, 1976; Henson, 1976; Werb and Dingle, 1976). It is clear that materials within the vesicles contribute to the outer surface of the cell after fusion; however, it seems likely that various characteristics of the outer surface of Golgi apparatus-derived vesicles provide features functionally important to the inner surface of the plasma membrane as well. Cheng and Farquhar (1976b) noted a possible biogenetic relationship between the adenylate cyclase found on cytoplasmic membrane surfaces in the Golgi apparatus and that in the plasma membrane. Rees et al. (1976) suggested that the coatings of Golgi apparatus vesicles contribute to the postsynaptic density in synapse development. Combined with the recent evidence that the glycoprotein receptor for acetylcholine is also processed through the Golgi apparatus (Fambrough and Devreotes, 1978), the implication is that the organelle is involved in the formation of a morphologically discrete, highly specialized region of the plasma membrane with distinctive characteristics on both membrane surfaces. The sum of the evidence seems sufficient to support the postulate that membrane organization in the Golgi apparatus directly affects the transport and fusion of the derived vesicles and subsequent characterization of the membranes with which they fuse.

E. LYSOSOMES AND GERL

As noted earlier, there are problems in clearly understanding the interrelationships of the endoplasmic reticulum and the Golgi apparatus with respect to the transfer both of membrane components and secretory products. It is also difficult to make a clear interpretation of the relationship of the Golgi apparatus to regions of the endoplasmic reticulum called GERL and of the interaction of these structures in the formation of primary lysosomes. Some of the lysosomal enzymes are glycopmteins, and their sequence of synthesis parallels that of other glycoproteins (Goldstone and Koenig, 1972; Bennett and Leblond, 1971, 1977), with

THE GOLGI APPARATUS

229

glycosylation in the Golgi region. In diverse cell types the final assembly of lysosomal enzymes appears to take place in GERL, rather than in the Golgi stack, and vesicles containing the enzymes are formed at this site for transport to other elements of the lysosomal system (see, for review and discussion, Novikoff, 1976; Holtzman, 1976). Novikoff (1976) reexamined both the evidence for this concept and the more recent evidence that some secretory vesicles (including the so-called condensing vacuoles of the pancreatic exocrine cell) also arise from GERL instead of the Golgi stack. The close morphological proximity of GERL to the mature face of the Golgi apparatus is consistent with a functional interrelation, but it also poses problems for studying the nature of the interactions occurring by techniques other than those for the electron microscope localization of enzyme activities. Novikoff’s interpretation of these data is that in some cases the Golgi apparatus appears “to be bypassed. There is, however, the possibility that in some way the apparatus is involved in the formation or differentiation of GERL. In a study of the lacrimal gland, Hand and Oliver (1975, 1977a,b), using the cytochemical localization of several enzymes, showed the progressive involvement of the Golgi apparatus and GERL in the processing of secretory materials. They suggested that the mature Golgi cisterna may be converted to GERL. In the absence of further data pertaining to the precise relationships of these endocellular membranes, it seems in order to consider them interrelated membrane systems both of which, in different circumstances, are capable of the assembly and transport of membrane-bounded materials. ”

F. DIFFERENTIATION OF THE GOLGICISTERNAE At this stage, our knowledge of the Golgi apparatus is too restricted to permit proposal of a model for cisternal membrane differentiation in terms much more definitive than those considered above. The membranes are stacked, but the significance of this stacking is not clear. The cisternal membranes may “flow,” but it is difficult to reconcile this concept with the evidence for highly specialized individual cisternae. There are complex interrelations with the endoplasmic reticulum which differ at the two faces of the stack, but the nature of the membrane interactions is subject to various interpretations. We have chosen to present a generalized model using the glycosylation of membrane components as a basic feature of cisternal change (Fig. 10). Only some of the membrane components involved have been considered, and the glycoprotein constituent has been diagrammatically patterned after the model for glycophorin (see Marchesi, 1975a,b) which is the term for the major integral glycoprotein of the erythrocyte membrane. This particular molecular model represents the culmination of a long period of extensive investigation including studies of the antigenicity and recep-

230

W. G.WHALEY AND MARIANNE DAUWALDER

FIG. 10. A diagrammatic interpretation of the manner in which changes in certain components of Golgi apparatus cisternal membranes may occur from the forming face (A) to the mature face (C). Regional differences in the composition of the lipid bilayer are not indicated, nor are possible differences other than glycosylation in the inner and outer elements of the bilayer. For simplicity, various possible arrangements of the protein moieties of the glycoproteins with respect to the. bilayer have also been omitted. For detailed explanation, see the text (also discussed in Whaley, in press).

tor capacity of the carbohydrate portions of the molecule and its asymmetric location with respect to the membrane (Morawiecki, 1964; Winzler, 1970; Bretscher, 1973; Steck, 1974; Singer, 1974). For this model it is assumed that, when membranes are assembled, perhaps at the forming face of the apparatus, they contain relatively fewer glycopruteins, and that the carbohydrate chains of both the glycoproteins and glycolipids are incomplete (Fig. 10A). Differentiation across the stack includes the insertion, by whatever mechanism, of new proteins or glycoproteins and possibly lipids or glycolipids. The activities within the cistemae lead to further glycosylation of these components until the membrane bears many such groups with extensive carbohydrate chains (Fig. 1OC). The model pruposes that important facets of Golgi apparatus function include the continuous assembly of carbohydratecontaining informational macromolecules and the transport of these molecules to the cell membrane. There Seems to be sufficient support available for this model to propose it as a basis for further exploration. The evidence suggests further that the specificity characteristics of surface groups are in some cases clearly related to their carbohydrate moieties and that the specificity, maintenance, and change of these groups are genomically directed cell functions.

THE GOLGI APPARATUS

23 1

Various investigators have recognized that there is clearly a modulation of genetic control between the genome and the cell surface (Schmitt, 1971; Boyse, 1973; Kent, 1973; Burger, 1973, 1974; Watkins, 1974; Moscona, 1974a; Edelman, 1976), and we have discussed previously some of the evidence suggesting that genetic influence is mediated by activities in the Golgi apparatus (Whaley et al., 1972, 1975; Dauwalder et af., 1972; Whaley, 1975). A relationship between the nucleus and the Golgi apparatus is in general supported by studies on the induction of polyploidy in which there is an accompanying increase in the number of Golgi stacks (Walne, 1967), and by studies using enucleation in which there is disorganization of the apparatus (Flickinger, 1968, 1969; Driessche et al., 1973). More direct examples include changes in the amount and composition of intercellular matrix carbohydrates resulting from mutation, or the introduction of agents which modify genetic expression or polysaccharide synthesis (Seegmiller et al., 1972a,b; Overman et af., 1972; Seegmiller and Runner, 1974; Levitt et al., 1974; Orkin er af., 1976). These changes are sometimes paralleled by modifications in the morphology of the Golgi apparatus-perhaps related to differences in the membranes or in membrane-associated activities. In a few cases mutations appear to affect stages subsequent to product assemblypossibly at the secretory level (Boquist et al., 1974). Genomic modifications brought about by viral infection often show attendant alterations in cell surface carbohydrates including changes in components containing galactose, fucose, and sialic acid (see Hakomori, 1971; Brady and Fishman, 1975, 1976; Fishman and Brady, 1976; Warren and Buck, 1976). With some viruses there is an accumulation of virus particles in vesicles closely associated with the Golgi apparatus (Sat0 et al., 1971; Whaley et al., 1976; Leffmgwell and Whaley, 1976). The apparatus may be a site of viral assembly or, as the site at which the terminal sugars are added to glycolipids and glycoproteins destined for the plasma membrane, it could influence viral maturation or other aspects of cellular transformation at the cell surface. With respect to many glycosylated compounds the apparatus thus appears to be a locus where various secondary molecular characteristics are developed, which have their eventual genetic expression at or exterior to the cell surface. This interpretation does not rule out the likelihood of additional changes in molecular configurations at the surface itself. The nature of the links between the genome and genetic expression at the cell surface is only now becoming a major subject for investigation. In the glycosylation activities occurring in the Golgi apparatus the steps in carbohydrate chain elongation are thought to be controlled primarily by specificities of the individual glycosyltransferases. Both the composition and the morphological state of the membrane to which an enzyme is bound can have profound effects on its specificity, kinetic behavior, and other parameters of normal function (Zakim and Vessey, 1976; Nordlie and Jorgenson, 1976). Control of glycosylation could involve a dependence not only on the genetic

232

W. G. WHALEY AND MARIANNE DAUWALDER

availability of glycosyltransferases, as suggested by Kent and Mora (1973), but also on their selective insertion into the appropriate membrane system. Various factors, such as the heterogeneity of carbohydrate moieties (Beeley, 1974; Spiro, R. G., et al., 1974; Schachter, 1974; Watkins, 1974), indicate that the level of control is less strict than that between nucleic acid and protein; however, as noted by Spiro, R. G. er al. (1974), postribosomal processes, which are not directly coded, could be important as sites where physiological controls are operative or where pathological factors may act. As mentioned, it is difficult to bridge the gap in interpretation between the direct DNA coding of proteins and the final expression of the genome in the form, function, and behavior of cells and organisms. The controlled synthesis and arrangement of carbohydrate groups destined for the cell surface where they act as an important signal system for the interaction of the cell with its environment (including other cells) may be a key process in this phenomenon.

IV. Movement of Vesicles out of and into Cells A. EXOCYTOSIS A detailed consideration of exocytosis will not be undertaken here. It must be assumed, however, that in accordance with Palade’s generalization of secretion as a cellular function, exocytosis at some level is a regular cellular phenomenon. The highly selective fusion of secretory vesicle membrane and plasma membrane (or related endocytically derived membrane) must, as indicated, involve preliminary recognition factors. The process of fusion is energy-dependent, involves a series of morphological changes (Satir, 1974; Palade, 1975; Lucy, 1975; Tandler and Poulsen, 1976), and is generally dependent on calcium ions (A. D. Smith, 1971; Rubin, 1974; Douglas, 1974a). The molecular events involved are not yet known, but recent studies reveal the formation of membrane regions depleted of intramembrane particles and other proteins in areas of interaction between the vesicle membrane and the plasma membrane prior to their actual fusion (see Pinto da Silva and Nogueira, 1977; Lawson er al., 1977). Fusion provides a means for release of secretory products and movement of assembled membrane components into the plasma membrane in the proper configuration (Fig. 11, left). This can result in the insertion of highly specialized membrane segments into particular regions of the plasma membrane (Hicks, 1966) or the limited incorporation of certain membrane components into the plasma membrane by lateral movement during fusion (Bergeron et al., 1973b). The added membrane constituents may serve to maintain normal cellular function or may bring about extensive changes in cellular activities and development (as, for example, in

THE GOLGI APPARATUS

233

cortical granule fusion in fertilization, Epel and Johnson, 1976). As noted, characteristics on both sides of the membrane are probably involved, but only those toward the exterior of the plasma membrane are indicated here. Fusion extends the membrane for varying periods of time. The fate of the incorporated membrane depends on phases of growth or secretion cycles and on regional specializationsof the cell membrane. Much of the membrane can be retained, as in rapidly growing cells, or much of it can be selectively removed, as at the secretory lumen of gland cells (Palade, 1975; De Camilli et al., 1976). In nongrowing cells without a conspicuous differentiation for secretion there is a continuous renewal and turnover of plasma membrane (see Haddad et al., 1977). Most of the components added to the plasma membrane bear variously sized carbohydrate moieties. The carbohydrate-containing regions of the molecules may protrude different distances from the surface, like trees in a forest, or may be flattened, “like seaweed lying limply over a rock at low tide” (Marchesi,

FIG.11. A diagrammatic interpretation suggesting exocytosis involving the fusion of Golgi apparatus-derived secretory vesicle membranes concurrently with the exteriorization of membrane components and secretory products (left) and compensation to some degree by endocytosis after modification (right). The details of the vesicle membranes have been omitted, as have some of the details of the plasma membrane. The question marks indicate areas of perturbation in the membrane associated with fusion or fission. For further explanation, see the text.

234

W. G. WHALEY AND MARIANNE DAUWALDER

1975a). After their incorporation into the plasma membrane, some of these groups exhibit varying degrees of lateral mobility in the plane of the membrane, normally or in response to certain stimuli (Singer and Nicolson, 1972; Burger and Noonan, 1972; Edidin, 1974; Edidin and Weiss, 1974; Nicolson, 1974a,b; Bretscher and Raff, 1975; Edelman, 1976). Both the character and the topographic distribution of these groups in the plasma membrane influence or determine a multitude of cellular characteristics. These include various factors involved in hormone binding, cell recognition, adhesion, development, and dysfunctions. For recent reviews of these phenomena, see Hughes (1975) and Talmadge and Burger (1975). Resolution of the precise nature of the interactions involved is one of the most challenging problems for research in the years ahead (see, particularly, Moscona, 1974b, 1975). B. ENWCYTOSIS The term “endocytosis” is intended here to cover a range of activities of the plasma membrane extending from phagocytosis to micropinocytosis. The endocytic process is a means by which various external materials are brought into the cell-including regions of the plasma membrane and surface-associated materials which are taken back into the cytoplasm during the formation of vesicles. Much of the material entering the cytoplasm in vesicle form goes to elements of the lysosomal system (see Holtzman, 1976). The general process is represented in Fig. 11 (right) as a sort of reversal of exocytosis. There are several morphological similarities in exo- and endocytosis, and in some cell types both can be experimentally inhibited or stimulated by similar compounds. In part, somewhat comparable membrane changes could be involved in both processes (Poste and Allison, 1973; Lucy, 1975). In general, these two processes represent mechanisms by which a balance can be maintained between the addition and removal of surface membrane, and they also provide a means for turnover of the cell surface and its associated structures. Exocytosis and endocytosis can occur during different phases of cell activity; however, in several systems the two processes appear to be closely linked (Dingle, 1969; Douglas et al., 1971; Masur et al., 1972; Abrahams and Holtzman, 1973; Orci er al., 1973a;Douglas, 1974b; Reynolds and Werb, 1975). Endocytosis serves to remove excess membrane following cycles of secretion, and it may serve to retrieve “outdated” or “exhausted” membrane components that need replacement. There is also evidence that membranes or membrane components are reutilized or recycled in the movement of membrane to and from the plasma membrane (Heuser and Reese, 1973; Ceccarelli et al., 1973; Pelletier, 1973; Meldolesi, 1974b; Farquhar et al., 1975; Steinman et al., 1976), and there have

THE GOLGI APPARATUS

235

been speculations that the Golgi apparatus is involved (see Steinman et al., 1976; Silverstein el al., 1977). The pattern of endocytosis is often nonrandom (Gordon, 1973), again suggesting specificity factors in the membranes. Selectivity of endocytosis can affect the topography and composition of the plasma membrane, as well as the nature of materials taken into the cell. For example, endocytosis occurs at the secretory lumen more or less immediately following exocytosis in many gland cells (Palade, 1975; De Camilli et al., 1976), and in response to external stimuli particular groups can be moved to sites of endocytosis for removal from the plasma membrane (see Allison and Davies, 1974; Jacques, 1975; Kom, 1975). An example of a high degree of specificity in the selection of materials taken into the cell is provided by the uptake of corrective factors by fibroblasts cultured from individuals with certain mucopolysaccharidoses (diseases characterized by deficiencies in lysosomal enzymes). In culture the fibroblasts can be “cured” by providing the particular enzyme in the culture medium. Uptake of the enzyme requires both an appropriate receptor on the fibroblast cell surface and a recognition marker (possibly a specific polysaccharide side chain) on the enzyme (see Neufeld, 1974; Neufeld et al., 1975). The mechanisms by which surface interactions are coordinated with cytoplasmic activities and lead to the actual formation and transport of an endocytic vesicle are not clear, but it is likely that some of the factors involved are similar to those discussed for exocytosis (specializations of the cytoplasmic surface of the membranes, microfilaments, and/or microtubules; see Korn, 1975; Albertini and Anderson, 1977; Hoffstein et al., 1977). The materials brought into the cell include the products of exocytosissubstances released from the same or other cells and the surface membrane. This might represent a feedback mechanism in which cell products modified by interactions with the environment and returned to the cytoplasm in some way influence subsequent cellular behavior. Materials in the intercellular matrix apparently affect cellular behavior and developmental processes (see Slavkin and Greulich, 1975), and their uptake by cells might also be involved. In the case of the membrane, the process is important in retrieval, renewal, and change. However, surface structures such as receptors or substances associated with binding sites brought into the cell could directly affect cellular metabolism (as in the case of the corrective factors, noted above). By this interpretation, cycles of exocytosis-endocytosis which vary according to the developmental stage, metabolic and functional activities, or environmental factors may be instrumental in the secondary expression of genetic information. The Golgi apparatus is involved in secretion, in the assembly of lysosomal enzymes, and possibly in membrane recycling. Thus it is a site where exocytosis and endocytosis are interrelated. As such it could provide a locus where factors regulating these phenomena might act (Dauwalder et af., 1972; Werb and Dingle, 1976).

236

W. G . WHALEY AND MARIANNE DAUWALDER

V. Discussion and Concluding Remarks Although principal attention has been directed to membrane interactions, some aspects of the role of the Golgi apparatus in secretion as defined in the more limited sense should be considered briefly. A broad spectrum of functionally important materials is involved, and these may act at varying distances from the site of their production (Fig. 12). Some vesicle membrane components and associated materials remain at or close to the surface of the producing cell. Here these products may trigger reactions involved in cellular associations (recognition, adhesion, and so on) or in activation of the cellular signal system which induces responses of the cell to various stimuli. Other products move varying

FIG.12. A diagrammatic representation of the manner in which the Golgi apparatus-assembled membrane components and secretory products may function at varying distances fmm the point of exteriorization. Some products may function between cells that are not part of the same organism, for example, milk substances and acrosomal constituents.

THE GOLGI APPARATUS

237

distances from the producing cell and provide components essential to the maintenance of structural, functional, and associative activities inherent in multicellular organisms. Cellular function and sociological behavior are to a great extent affected by elements outside the cell-associations with other cells, characteristics of surrounding matrix materials, and numerous circulating or environmental factors. Many of the constituents to which the cell is subjected are products of secretion, which are assembled and released via Golgi apparatus-related activities. Cellular response to external factors appears to be dependent on interactions of various specifying groups on or near the cell surface. Much of the exposed surface material is carbohydrate in nature, and the variety and stereospecificityof carbohydrates makes them likely candidates as carriers of information necessary in modulating many of the normal interactions of the cell with its environment. The structuring of these carbohydrate moieties and their movement to the cell surface could be a critical part of Golgi apparatus function. Interference with the normal development and transport of cell surface materials at any stage in their assembly may bring about dysfunctions of varying severity or a breakdown of normal cellular sociological or functional relationships (Trump and Arstila, 1975). The interrelated activities of the Golgi apparatus in the production of secretions and in the formation of surface constituents suggests that the evolution of this organelle has been of key significance in the development of versatility, intercellular relationships, and adaptability of eukaryotic organisms. It will be important to determine the control mechanisms which lead to the progressive and sometimes highly specialized spatial differentiation of the membranes of the Golgi apparatus. This organelle appears to be the near-terminal point in a membrane assembly line along which genomic information can be expressed at the cell surface. In association with development of membranes in the apparatus, compounds with informational characteristics can be collected, synthesized, assembled, and subsequently transferred to the plasma membrane. The return of some of the components to the cytoplasm may result in ongoing modulations in the development and functioning of cells within particular organ systems, among various organ systems, systemically, and in associations not involving highly structured systems. Although there are many specific facts still to be gathered, there now seems to be sufficient supporting evidence from many different fields and types of investigation to justify the assumption that the Golgi apparatus is a site of critical importance in determining the genetic expression of the cell.

ACKNOWLEDGMENTS Support of the work in this laboratory on which this article is based was acknowledged in each of the individual papers cited. Additional contributions and development of the interpretations have

238

W. G.W

E Y AND MARIANNE D A W A L D E R

been supported by the Faith Foundation. This material was presented in Boston at the First International Congress on Cell Biology in September, 1976 (Whaley and Dauwalder, 1976). Figures 7, 10, 11, and 12 were prepared by Mrs. Pauline West. We thank Gary Bennett, Geoffrey Cook, and Saul Roseman for their helpful comments on an earlier version of this article. Editorial assistance was provided by Audrey N. Slate and typing by Rita Cornea.

REFERENCES Abe, H., Moscarello, M. A., and Sturgess, J. M.(1976). J. Cell Biol. 71, 973. Abrahams, S. J., and Holtzman, E. (1973). J . Cell Biol. 56, 540. Albertini, D. F., and Anderson, E. (1977). 1. Cell Biol. 7 3 , 111. Alexander, C. A.. Hamilton, R. L., and Havel, R. J. (1976). J. Cell Biol. 69, 241. Allison, A. C., and Davies, P. (1974). Symp. SOC. Exp. Biol. 28, 419. Ashwell, G., and Morell, A. G. (1971). In “Glycoproteins of Blood Cells and Plasma” (G. A. Jamieson and T. J. Greenwalt, eds.), p. 173. Lippincott, Philadelphia. Pennsylvania. Ashwell, G., and Morell, A. G. (1974). Biochem. SOC.Symp. 40, 117. Autuori, F., Svensson, H., and Dallner, G. (1975a). J. Cell Biol. 67, 687. Autuori, F., Svensson. H.,and Dallner, G. (1975b). J . Cell Biol. 67, 700. Bachi, T., Whiting, K., Tanner, M. 1. A., Metaxas, M.N., and Anstee, D. J. (1977). Biochim. Biophys. Acta 464, 635. Bainton, D. F. (1973). J . Cell Biol. 58, 249. Bainton, D. F., and Farquhar, M. G. (1966). J . Cell Biol. 28, 277. Bainton, D. F., Nichols, B. A., and Farquhar, M.G. (1976). Lysosomes Biol. Parhol. 5 , 3. Barisas, B. G., and McGuire, J. S. (1974). J . Biol. Chem. 249, 3151. Bauduin, H., Stock, C., Vincent, D., and Grenier, I . F. (1975). J. Cell Biol. 66, 165. Baumrucker, C. R., and Keenan, T. W. (1975). Exp. Cell Res. 90, 253. Beams, H. W., and Kessel, R. G. (1968). In). Rev. Cyrol. 23, 209. Beeley, J. G.(1974). Biochern. SOC.Symp. 40, 27. Benes, F., Higgins, J. A., and Barmen, R. J. (1973). J. Cell Biol. 57, 613. Bennett, G., and Leblond, C. P. (1971). J . Cell Biol. 51, 875. Bennett, G., and Leblond, C. P. (1977). Hisrochem. J . 9, 393. Bennett, G.,Leblond, C. P., and Haddad, A. (1974). J. Cell Biol. 60, 258. Bergeron, J. J. M.,and Posner, B. 1. (1975). J . Cell Biol. 67, 30a. Bergemn, J. J. M.,Ehrenreich, H. J., Siekevitz, P., and Palade, G. E.(1973a). J . Cell Biol. 59,73. Bergeron, J. J. M..Evans, W. H.,and Geschwind, 1. I. (1973b). J . Cell Biol. 59, 771. Bergeron, J. J. M., Borts, D.. and CNZ, 1. (1978). J . Cell Biol. 7 6 , 87. Bhisey, A. N., and Freed, J. J. (1971). Exp. Cell Res. 64, 419. Blobel, G., and Dobberstein, B. (1975). J . Cell Biol. 67, 835. Bok, D., Hall, M.O., and O’Brien, P. (1977). In “International Cell Biology: 1976-1977” (B. R. Brinkley and K. R. Potter, eds.), p. 608. Rockefeller University Press, New York. Boquist, L., Hellman, B., Lemmark, A., and TmUjedal, I.-B. (1974). J . CeN Biol. 62, 77. Bouck, G. B., and Brown, D. L. (1976). Annu. Rev. Plant Physiol. 27, 71. Bowen, R. H. (1929). Q. Rev. Biol. 4, 299 and 484. Boyse, E. A. (1973). Curr. Res. Oncol., 1972 p. 57. Brady, R. 0.. and Fishman, P. H. (1975). Biochem.. Ser. One 2,61. Brady, R. O., and Fishman, P. H. (1976). Enzymes Biol. Membr. 2 , 421. Bretscher, M. S. (1973). Science 181, 622.

THE GOLGI APPARATUS

239

Bretscher, M. S. (1974). In “The Cell Surface in Development” (A. A. Moscona, ed.), p. 17. Wiley, New York. Bretscher, M. S., and Raff, M. C . (1975). Nature (London) 258, 43. Brown, R. M., Jr. (1969). J. Cell Biol. 41, 109. Brown, R. M., Jr., Herth, W.. Franke, W. W., and Romanovicz, D. (1973). In “Biogenesisof Plant Cell Wall Polysaccharides” (F. Loewus, ed.), p. 207. Academic Press, New York. Brummett, A. R., and Dumont, J. N. (1976). J . Ulrrasrrucr. Res. 55, 4. Burger, M. M. (1973). Fed. Proc., Fed. Am. SOC. Exp. Bioi. 32, 91. Burger, M. M. (1974). In “Macromolecules Regulating Growth and Development” (E. D. Hay, T. J. King, and J. Papaconstantinou, eds.), p. 3. Academic Press, New York. Burger, M. M., and Noonan, K. D. (1972). In “Protein-Protein Interactions” (R. Jaenicke and E. Helmreich, eds.), p. 445. Springer-Verlag, Berlin and New York. Cebula, T. A., and Roth, S. (1976). In “Biogenesis and Turnover of Membrane Macromolecules” (J. S. Cook, ed.), p. 235. Raven, New York. Ceccarelli, B., Hurlbut, W. P., and Mauro, A. (1973). J. Cell Biol. 57, 499. Chapman, D. (1975). In “Cell Membranes: Biochemistry, Cell Biology & Pathology” (G. Weissmann and R. Claibome. eds.), p. 13. H. P. Publishing Co., New York. Cheng, H., and Farquhar, M. G. (1976a). J. Cell Biol. 70, 660. Cheng, H., and Farquhar, M.G. (1976b). J. Cell Biol. 70, 671. Chipowsky, S., Lee, Y. C., and Roseman, S. (1973). Proc. Natl. Acad. Sci. U.S.A. 70, 2309. Chdtien, M. (1972). J. Microsc. (Paris) 14, 55. Claude, A. (1970). J. Cell Biol. 47, 745. Cook, G. M. W. (1973). Lysosomes Biol. Pathol. 3, 237. Cook, G. M. W., and Stoddart, R. W .(1973). “Surface Carbohydrates of the Eukaryotic Cell.” Academic Press, New York. Coulomb, P., and Coulon, J. (1971). J . Microsc. (Paris) 10, 203. Cuatrecasas, P. (1974). Annu. Rev. Biochem. 43, 169. Cuatrecasas, P. (1975). In “Cell Membranes: Biochemistry. Cell Biology & Pathology” (G. Weissmann and R. Claiborne, eds.). p. 177. H. P. Publishing Co., New York. Danielli, J. F. (1975). In “Cell Membranes: Biochemistry, Cell Biology & Pathology” ( G . Weissmann and R. Claiborne, eds.), p. 3. H. P. Publishing Co., New York. Dauwalder, M., and Whaley, W .G. (1973). J. Ulfrasfrucr.Res. 45, 279. Dauwalder, M., and Whaley, W. G. (1974). J. Cell Sci. 14, 11. Dauwalder, M., Whaley, W. G.,and Kephart, J. E. (1972). Sub-Cell. Biochem. 1, 225. Davidson, E. H. (1977). “Gene Activity in Early Development,” 2nd ed. Academic Press, New York. Davies, P., and Allison, A. C . (1976). Lysosomes Biol. Parhol. 5, 61. De Brabander, M., Aerts, F., Van de Veire, R., and Borgers, M. (1975). Nature (London) 253, 119. De Camilli, P., Peluchetti, D., and Meldolesi, J. (1976). J. Cell Biol. 70, 59. De Robertis, E. (1964). “Histophysiology of Synapses and Neurosecretion. ” Pergamon, Oxford. Dewald, B., and Touster, 0. (1973). J . Biol. Chem. 248, 7223. Dingle, J. T. (1969). Lysosomes Biol. Parhol. 2, 421. Dobberstein, B., and Kiermayer, 0. (1972). Protoplasma 75, 185. Douglas, W. W. (1974a). Biochem. SOC. Symp. 39, 1. Douglas, W. W. (1974b). Handb. Physiol., Sect. 7: Endocrinol. 4, 191. Douglas, W. W., Nagasawa, J., and Schulz, R. (1971). Mem. SOC. Endocrinol. 19, 353. Driessche, T. V., Hars, R., Hellin, J., and Boloukhere, M. (1973). J. Ultrasfrucr. Res. 42, 479. Dutta, G. P. (1974). Int. Rev. Cyrol. 39, 285. Edelman, G. M. (1976). Science 192, 218.

240

W. G . WHALEY AND MARIANNE DAUWALDER

Edidin, M. (1974). In “Developmental Aspects of Cminogenesis and Immunity’’ (T. J. King, ed.), p. 91. Academic Press, New York. Edidin, M., and Weiss, A. (1974). In “Control of Proliferation in Animal Cells” (B. Clarkson and R. Baserga, eds.), p. 213. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Ehrlich, H. P., Ross, R., and Bornstein, P. (1974). 1. Cell B i d . 62, 390. Elhammer, A., Svensson, H., Autuori, F., and Dallner, 0 . (1975). J. Cell B i d . 67, 715. Epel, D., and Johnson, J. D. (1976). In “Biogenesis and Turnover of Membrane Macromolecules” (J. S. Cook, ed.), p. 105. Raven, New York. Ericson, L. E. (1972). J. Vlrrasrruct. Res. 41, 467. Fambrough, D. M., and De-vreotes, P. N. (1978). J. Cell B i d . 76, 237. Farquhar, M. G., Bergeron, J. J. M., and Palade, G. E . (1974). J . Cell B i d . 60, 8. Farquhar, M. G., Skutelsky. E., and Hopkins, C. R. (1975). In “The Anterior Pituitary” (A. Tixier-Vidal and M. G. Farquhar, eds.), p. 83. Academic Press, New York. Feigenson, M. E., Schnebli, H. P., and Baggiolini, M. (1975). J. Cell Biol. 66, 183. Fishman, P. H. (1974). Chern. fhys. Lipids 13, 305. Fishman, P. H., and Brady, R. 0. (1976). Science 194, 906. Fleischer, B., and Fleischer, S. (1971). Biomembranes 2, 75. Fleischer, B., and Zambrano, F. (1973). Biochem. Biophys. Res. Commun. 52, 951. Fleischer, B., Zambrano, F., and Fleischer, S. (1974). J . Supramol. Strucr. 2, 737. Flickinger, C. 1. (1968). J. Cell B i d . 37, 300. Flickinger, C. J. (1969). J . Cell B i d . 43, 250. Flickinger. C. J. (1971). Exp. Cell Res. 68, 381. Fox, R. A., Gregory, D. A., and Feldman, J.S. (1974). J. Immunol. 112, 1867. Franke, W . W., and Herth, W. (1974). Exp. Cell Res. 89, 447. Franke, W. W., and Kattenbeck, J. (1976). In “Progress in Differentiation Research” (N. MiillerBCrat, ed.), p. 213. North-Holland Pub]., Amsterdam. Franke, W. W ., Liider, M. R., Kartenbeck, J., Zerban, H., and Keenan, T. W. (1976). J. Cell Biol. 69, 173. Friend, D. S. (1969). J . Cell Biol. 41, 269. Friend, D. S.,and Farquhar, M. G . (1967). 1. Cell B i d . 35, 357. Gahmberg, C. G., and Hakomori, S. (1973). J. B i d . Chem. 248, 431 I . Gahmberg, C. G., Hayry, P.. and Anderson, L. C. (1976). J . Cell B i d . 68, 642. tiershon, M.D., and Nunez, E. A. (1973). J. Cell B i d . 56, 676. Goldstein, I. M.,Hoffstein, S. T., and Weissmann, G. (1975). J . Cell B i d . 66, 647. Goldstone, A., and Koenig, H. (1972). Life Sci. 11, 5 i l . Goldstone, A., and Koenig, H. (1974). Eiochem. J. 41, 527. Gordon, A. H. (1973). Lysosomes B i d . Parhol. 3, 89. Haddad, A,, Bennett, G., and Leblond, C. P. (1977). Am. 1. Anat. 148, 241. Hakomori, S . (1971). In “The Dynamic Structure of Cell Membranes” (D. F. H.Wallach and H. Fischer. eds.), p. 65. Springer-Verlag, Berlin and New York. Hakomori, S.,Gahmberg, C. G., Laine, R., and Kijimoto, S. (1974). In “Controlof Proliferationin Animal Cells” (B. Clarkson and R. Baserga, eds.), p. 461. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Hall, W. T., and Witkus, E. R. (1964). Exp. Cell Res. 36, 494. Hand, A. R., and Oliver, C. (1975). 1. CeNBiol. 67, 154a. Hand, A. R., and Oliver, C . (1977a). Hisrochem. J . 9, 375. Hand, A. R., and Oliver, C . (1977b). J . Cell B i d . 74, 399. Hardin, J . H., and Spicer, S. S. (1971). J . Cell Biol. 48, 368. Hay, E. D. (1973). Am. Zool. 13, 1085. Hendler, R. W. (1974a). Biomembranes 5, 147.

THE GOLGI APPARATUS

24 1

Hendler, R. W. (1974b). Biomembranes 5, 25 1. Henson, P. M. (1976). Lysosomes Biol. Pathol. 5 , 99. Heuser, J., and Reese, T. S. (1973). J. Cell Biol. 57, 315. Hicks, R. M. (1966). J. Cell B i d . 30, 623. Hoffstein, S., Sobeman, R., Goldstein, I. M., and Weissmann, G. (1976). J. Cell Biol. 68, 781. Hoffstein, S., Goldstein, I. M., and Weissmann, G. (1977). J . Cell Biol. 73, 242. Holtzman, E. (1975). I n “Cell Membranes: Biochemistry, Cell Biology & Pathology” (G. Weissmann and R. Claibome, eds.), p. 153. H. P. Publishing Co., New York. Holtzman, E. (1976). “Lysosomes: A Survey,” Cell Biol. Monogr., Vol. 3. Springer-Verlag, Vienna and New York. Hughes, R. C. (1973). Prog. Biophys. Mol. Biol. 26, 191. Hughes, R. C. (1975). Essays Biochem. 11, I . Hughes, R. C. (1976). “Membrane Glycopmteins: A Review of Structure and Function.” Butterworth, London. Ito, S. (1974). Philos. Trans. R . SOC. London, Ser. B 268, 55. Jacques, P. J. (1975). Parhobiol. Cell Membr. 1, 255. Jarnieson, J. D. (1975). I n “Cell Membranes: Biochemistry, Cell Biology & Pathology” (G. Weissmann and R. Claibome, eds.), p. 143. H. P. Publishing Co., New York. Jentoft, N., Cheng, P. W., and Carlson, D. M. (1976). Enzymes Biol. Membr. 2, 343. Kahn, C. R. (1976). J. Cell Biol. 70, 261. Kalckar, H. M. (1965). Science 150, 305. Kelley. R. 0.. Baker, T. I., Crissman, H. A,, and Henderson, C. A. (1973). Anat. Rec. 175, 657. Kent, P. W., ed. (1973). “Membrane Mediated Information,” Vols. 1 and 2. Am. Elsevier, New

York. Kent, P. W., and Mora, P. T. (1973). In “Membrane Mediated Information” (P. W. Kent, ed.), Vol. 1, p. 129. Am. Elsevier, New York. Kessel, R. G. (1971). J . Ulfrastrucr. Res. 34, 260. Kessel, R. G. (1973). Prog. Su$. Membr. Sci. 6, 243. Knapp, A., Komblatt, M. H., Schachter, H., and Murray, R. K. (1973). Biochem. Biophys. Res. Commun. 55, 179. Korn, E. D. (1975). Biochem., Ser. One 2, 1. Kraehenbuhl, 1. P., Racine, L., and Jamieson. J . D. (1977). 1. Cell Biol. 72, 406. Lane, N. J., and Swales, L. S. (1976). J . CellSci. 22, 435. Lawson, D., Raff, M. C., Gomperts, B., Fewtrell, C., and Gilula, N. B. (1977). J. Cell Biol. 72, 242. Leblond, C. P., and Bennett, G. (1974). In “The Cell Surface in Development” (A. A. Moscona, ed.), p. 29. Wiley, New York. Leffingwell, T. P., and Whaley, W. G. (1976). J . Cell Biol. 70, 85a. Lvitt, D., Ho, P.-L., and Dorfman, A. (1974). In “The Cell Surface in Development” (A. A. Moscona, ed.), p. 101. Wiley, New York. Lindahl, L., and Hook, M. (1978). Annu. Rev. Biochem. 47, 385. Little, J. S., and Widnell, C. C. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 4013. Locke, M., and Huie, P. (1975). Science 188, 1219. h k e , M.,and Huie, P. (1976). J. Cell Biol. 70, 384. Lodish, H. F., and Small, B. (1975). J. CeN Biol. 65, 51. Lucy, J. A. (1975). In “Cell Membranes: Biochemistry, Cell Biology Bi Pathology” (G. Weissmann and R. Claibome, eds.), p. 75. H. P. Publishing Co., New York. Luft, J. H. (1976). Int. Rev. Cytol. 45, 291. McMurray, W. C. (1973). In “Form and Function of Phospholipids” ( G . B. Ansell, J. N. Hawthorne, and R. M. C. Dawson, eds.), p. 205. Elsevier, Amsterdam.

242

W. G. WHALEY AND MARIANNE DAUWALDER

Malaisse, W. J., Malaisse-Lagae, F., Van Obberghen, E., Somers, G., Devis, G., Ravazzola, M., andorci, L. (1975). Ann. N. Y. Acad. Sci. 253, 630. Manton, 1. (1966a). J. CeNSci. 1, 375. Manton, I. (1966b). 1. Cell Sci. 1, 429. Manton, 1. (1967a). J. Cell Sci. 2, 265. Manton, I. (1967b). J. Cell Sci. 2, 411. Manton, I., and Leedale, G. F. (1969). J. Mar. Biol. Assoc. U . K . 49, 1. Marchesi, V. T. (1975a). In “Cell Membranes: Biochemistry, Cell Biology & Pathology” (G. Weissmann and R. Claiborne, eds.), p. 45. H. P. Publishing Co., New York. Marchesi, V. T. (1975b). Biochern.. Ser. One 2, 123. Marsh, C. A., Lin, C.-W., and Fishman, W. H. (1974). Biochem. J. 142, 491. Martin, B. J., and Spicer, S. S. (1973). Anat. Rec. 175, 15. Martinez-Palomo, A., de Souza, W., and Gonzalez-Robles, A. (1976). J. Cell Biol. 69, 507. Masur, S. K., Holtzman, E., and Walter, R. (1972). J. Cell Biol. 52, 211. Melchers, F., and Andersson, J. (1974). Biochem. SOC. Symp. 40, 73. Meldolesi, J. (1974a). Philos. Trans. R . SOC. London. Ser. B 268, 39. Meldolesi, J. (1974b). J. Cell Biol. 61, 1. Meldolesi, J., Jamieson, J. D., and Palade, G. E. (1971a). J. Cell Biol. 49, 130. Meldolesi, J., Jamieson, J. D., and Palade, G. E. (1971b). J. Cell Biol. 49, 150. Mignot, J., Brugerolle, G., and Metenier, G. (1972). J. Microsc. (Paris) 14, 327. Moestrup, 0..and Thomsen, H. A. (1974). Protoplasma 81, 247. Molnar, J. (1976). Enzymes Biol. Membr. 2, 385. Morawiecki, A. (1964). Biochim. Biophys. Acta 83, 339. Moscona, A. A,, ed. (1974a). “The Cell Surface in Development.” Wiley, New York. Moscona, A. A. (1974b). I n “The Cell Surface in Development” (A. A. Moscona, ed.), p. 67. Wiley, New York. Moscona, A. A. (1975). I n ”Extracellular Matrix Influences on Gene Expression” (H. C. Slavkin and R. C. Greulich, eds.), p. 57. Academic Press, New York. Moskalewski, S . , Thyberg, J., and Friberg, U. (1976). J. Ultrasrrucr. Res. 54, 304. Neri, G., Giuliano, M. C., Hixson, D. C., and Walborg, E. F., Jr. (1976). I n “Membranes and Disease” (L. Bolis, J.F. Hoffman, and A. Leaf, eds.), p. 163. Raven, New York. Neufeld, E. F. (1974). I n “Cell Communication” (R. P. Cox, ed.), p. 217. Wiley, New York. Neufeld, E. F., Lim, T. W., and Shapiro, L. J. (1975). Annu. Rev. Biochem. 44, 357. Neutra, M., and Leblond, C. P. (1966). J. Cell Biol. 30, 119. Neutra, M., and Leblond. C. P. (1969). Sci. Am. 220, (#2) 100. Nicolson, G. L. (1974a). In “Control of Proliferation in Animal Cells” (B. Clarkson and R. Baserga, eds.), p. 251. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Nicolson, G. L. (1974b). Inr. Rev. Cyrol. 39, 89. Nordlie, R. C., and Jorgenson, R. A. (1976). Enzymes Biol. Membr. 2, 465. Northcote. D. H. (1971). Endeavour 30, 26. Northcote, D. H. (1974). Philos. Trans. R . SOC. London, Ser. B 268, 119. Novikoff, A. B. (1976). Proc. Nail. Acad. Sci. U.S.A. 73, 2781. Novikoff, A. B., Yam, A., and Novikoff, P. M. (1975). Proc. Narl. Acad. Sci. U.S.A. 72,4501. Novikoff, P. M., Novikoff, A. B., Quintana, N., and Hauw, J.-J. (1971). J. Cell Biol. 50, 859. Oates, P. J., and Touster, 0. (1976). J. Cell Biol. 68, 319. Orci, L., Lambert, A. E.,Kanazawa, Y ., Amherdt, M., Rouiller, C., and Renold, A. E. (1971). J. Cell Biol. 50, 565. Orci, L.,Malaisse-Lagae, F., Ravazolla, M., and Amherdt, M. (1973a). Science 181, 561. Orci, L., Like, A. A., Amherdt, M., Blondel, B., Kanazawa, Y.,Marliss, E. B., Lambert, A. E., Wollheim, C. B., and Renold, A. E. (1973b). J. Ulrrasrrucr. Res. 43, 270.

THE GOLGI APPARATUS

243

Orkin, R. W., Pratt, R. M., and Martin, G. R. (1976). Dev.Biol. 50, 82. Oseroff, A. R., Robbins, P. W., and Burger, M. M. (1973). Annu. Rev. Biochem. 42, 647. Ostlund, R. E., Leung, J. T., and Kipnis, D. M. (1977). J . Cell Biol. 73, 78. Overman, D. O., Seegmiller, R., and Runner, M. N. (1972). Dev. B i d . 28, 573. Oxender, D. L. (1974). Biomembranes 5, 25. Palade, G. E. (1975). Science 189, 347. Pasquini, F . , Petis, A., Sbaraglia, S.. Scopelliti, R., Cenci, G.. and Frati, L. (1974), Exp. CeNRes. 86, 233. Patzelt, C., Brown, D., and Jeanrenaud, B. (1977). J. Cell Biol. 73, 578. Pelletier, G. (1973). J . Ulrrasrrucr. Res. 43, 445. Pinto da Silva, P., and Nogueira, M. L. (1977). J . Cell Biol. 73, 161. Pinto da Silva, P., Martinez-Palomo, A., and Gonzalez-Robles, A. (1975). J. Cell Biol. 64, 538. Poisner, A. M., and Cooke, P. (1975). Ann. N. Y. Acad. Sci. 253, 653. Poste, G., and Allison, A. C. (1973). Biochirn. Biophys. Acra 300, 421. Quinn, P. S., Gamble, M., and Judah, J. D. (1975). Biochem. J . 146, 389. Radin, N. S. (1970). Chem. Phys. Lipids 5, 178. Rambourg, A. (1971). Inf. Rev. Cyrol. 31, 57. Rambourg, A., Marraud, A., and Chdtien, M. (1973). J. Microsc. (Oxford) 97, 49. Ravazzola, M., Malaisse-Lagae, F., Amherdt, M., Pettelet, A., Malaisse, W. J., and Orci, L. (1976). J . Cell Sci. 21, 107. Redman, C. M., and Cherian, M. G. (1972). J. Cell Biol. 52, 231. Redman, C. M., Banerjee, D., Howell, K.,and Palade, G. E. (1975). J . Cell Biol. 66, 42. Rees, D. A. (1975). Biochem., Ser. One 5 , 1. Rees, R. P., Bunge, M. B., and Bunge, R. P. (1976). 1. Cell Biol. 68, 240. Reynolds, J. J., and Werb, Z. (1975). In “Extracellular Matrix Influences on Gene Expression” (H. C. Slavkin and R. C. Greulich, eds.), p. 225. Academic Press, New York. RodCn, L.. and Schwartz, N. 8. (1975). Biochem., Ser. One 5 , 95. Roseman, S. (1970). Chem. Phys. Lipids 5, 270. Roseman, S. (1972). In “Current Topics in Biochemistry” (C. B. Anfinsen, R. F. Goldberger, and A. N. Schechter, eds.), p. 219. Academic Press, New York. Roseman, S. (1974). In “The Cell Surface in Development” (A. A. Moscona, ed.), p. 255. Wiley, New York. Roseman, S. (1975). In “Cell Membranes: Biochemistry, Cell Biology & Pathology” (G. Weissmann and R. Claiborne, eds.), p. 55. H. P. Publishing Co., New York. Roth, S. (1973). Q . Rev. B i d . 48, 541. Roth, S., McGuire, E. J., and Roseman, S. (1971). J . Cell Biol. 51, 536. Roth, S., Patterson, A., and White, D. (1974). J . Supramol. Sfrucr. 2, 1. Roth, S., Barbera, A. J., Shur, B. D., and Marchase, R. B. (1975). In “Extracellular Matrix Influences on Gene Expression” (H. C. Slavkin and R. C. Greulich, eds.), p. 473. Academic Press, New York. Rothman, J. E., and Lenard, J. (1977). Science 195, 743. Rubin, R. P. (1974). “Calcium and the Secretory Process.” Plenum, New York. Sabatini, D. D., and Kreibich, G. (1976). Enzymes Biol. Mernbr. 2, 531. Satir, B. (1974). J. Supramol. Srrucr. 2, 529. Sato, T., Friend, C., and de Harven, E. (1971). Cancer Res. 31, 1402. Schachter, H. (1974). Biochem. SOC. Symp. 40,57. Schachter, H., and RodCn, L. (1973). In “Metabolic Conjugation and Metabolic Hydrolysis” (W. H. Fishman, ed.), Vol. 3. p. 1. Academic Press, New York. Schauer, R., Buscher, H.-P., and Casals-Stenzel. J. (1974). Biochern. SOC. Symp. 40, 87. Schechter, I., McKean, D. J., Guyer, R., and Terry, W. (1975). Science 188, 160.

244

W. G. WHALEY AND MARIANNE DAUWALDER

Schmitt, F. 0. (1971). In “The Dynamic Structure of Cell Membranes” (D. F. H. Wallach and H. Fischer, eds.), p. 5. Springer-Verlag. Berlin and New York. Schor, S., Siekevitz, P., and Palade, G. E. (1970). Proc. Narl. Acad. Sci. U.S.A. 66, 174. Schwartz, N. B., Dorfman, A,, and Roddn, L. (1975). In “Extracellular Matrix Influences on Gene Expression” (H. C. Slavkin and R. C. Greulich, eds.), p. 197. Academic Ress, New York. Seegmiller. R., and Runner, M. N. (1974). J . Embryol. Exp. Morphol. 31, 305. Seegmiller, R., Ferguson, C. C., and Sheldon, H. (1972a). J. Ultrastruct, Res. 38, 288. SeegmiUer, R..Overman, D. 0.. and Runner, M. N. (1972b). Dew. Biol. 28, 555. Sherline, P., Lee, Y.-C., and Jacobs, L. S. (1977). J. Cell Biol. 72, 380. Siekevitz, P. (1972). Annu. Rev. Physiol. 34, 117. Siekevitz, P. (1975). In “Cell Membranes: Biochemistry, Cell Biology and Pathology” (G. Weissmann and R. Claiborne, eds.), p. 115. H. P. Publishing Co., New York. Siekevitz, P. (1976). In “Membranes and Disease” (L. Bolis, J. F. Hoffman, and A. Leaf, eds.), p. 145. Raven, New York. Silverstein, S. C., Steinman, R. M., and Cohn, Z . A. (1977). Annu. Rev. Biochem. 46, 669. Singal, P. K., and Sanders, E. J. (1974). J . Ultrastruct. Res. 47, 433. Singer, S. 1. (1973). In “Membrane Mediated Information” (P. W. Kent, ed.), Vol. 2, p. 27. Am. Elsevier, New York. Singer, S . J. (1974). Annu. Rev. Biochem. 43, 805. Singer, S. I. (1975). In “Cell Membranes: Biochemistry, Cell Biology and Pathology” (G. Weissmann and R. Claiborne, eds.), p. 35. H. P. Publishing Co., New York. Singer, S. J., and Nicolson, G. L. (1 972). Science 175, 720. Skutelsky, E., and Farquhar, M. G. (1976). J. Cell Biol. 71, 218. Slavkin, H. C.,and Greulich, R. C., eds. (1975). “Extracellular Matrix Influenceson Gene Expression.” Academic Press, New York. Smith, A. D. (1971). Philos. Trans. R. SOC. London, Ser. B 261, 363. Smith, D. S . (1971). Philos. Trans. R. SOC. London, Ser. B 261, 395. Smith, D. S., Jarlfors, U.,and Cameron, B. F. (1975). Ann. N. Y . Acad. Sci. 253, 472. Spim, M. J., Spim, R. G., and Bhoym, V. D. (1976). J . Biol. Chem. 251, 6400. Spim, R. G. (1973). Adv. Protein Chem. 27, 349. Spiro, R. G., Spim, M. I . , and Adamany, A. M. (1974). Biochem. SOC. Symp. 40,37. Staehelin, L. A., and Kiermayer, 0. (1970). J . Cell Sci. 7, 787. Steck, T. L. (1974). J . Cell Biol. 62, 1. Steiner, D. F. (1969). N. Engl. J. Med. 280, 1106. Steiner, D. F., Kemmler, W., Tager, H. S., and Peterson, J. D. (1975a). Fed. Proc.. Fed. Am. Soc. Exp. Biol. 33, 2105. Steiner, D. F.. Kemmler, W.,Tager, H. S., Rubenstein, A. H.. Lernmark, A., and Ziihlke. H. (1975b). In “Roteases and Biological Control” (E. Reich, D. B. Rifkin, and E. Shaw, eds.), p. 531. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Steinman. R. M., Bmdie, S. E., and Cohn, 2. A. (1976). 1. Cell Biol. 68, 665. Tabas, I., Schlesinger, S., and Kornfeld, S. (1978). J . Biol. Chem. 253, 716. Tager, H. S., and Steiner, D. F. (1974). Annu. Rev. Biochem. 43, 509. Talmadge, K. W., and Burger, M. M. (1975). Biochem., Ser. One 5, 43. Tandler, B., and Poulsen, I. H. (1976). J . Cell Biol. 68, 775. Tare, R. L.,Holmes, J. M.,Kohn, L. D., and Winand, R. (1975). J. Biol. Chem. 250, 6527. Tennekoon, G . I., Cohen, S.R., Price, D. L., and McKhann, G. M. (1977). J. Cell Biol. 72,604. Touster, 0 . (1973). Mol. Cell. Biochem. 2, 169. Trelstad, R. L. (1973). J . Hisrochem. Cyrochem. 21, 521. Trump, B. F., and Arstila, A. U. (1975). Pathobiol. Cell Membr. 1, 1. Tulsiani, D. R. P., Six, H.. and Twister, 0. (1978). Proc. Nurl. Acad. Sci. U.S.A. 75, 3080.

THE GOLGI APPARATUS

245

Uhr, J. W. (1975). I n “Cell Membranes: Biochemistry, Cell Biology & Pathology” ( G . Weissmann and R. Claibome, eds.), p. 223. H. P. Publishing Co., New York. Uitto, J., Hoffmann, H.-P., and Prockop, D. J. (1975). Science 190, 1202. Urban, J., Inglis, A. S., Edwards, K., and Schreiber, G. (1974). Biochem. Biophys. Res. Commun. 61,444. Vicker, M. G. (1976). J . CellSci. 21, 161. Vitetta, E. S., and Uhr, J. W. (1975). Biochim. Biophys. Acru 415, 253. Walne, P. L. (1967). Am. J . Bor. 54, 564. Wamer, R. R., and Coleman, J.R. (1975). J . Cell Biol. 64, 54. Warren, L., and Buck, C. A. (1976). I n “Membranes and Disease” (L. Bolis, 1. F. Hoffman, and A. Leaf, eds.), p. 173. Raven, New York. Watkins, W, M. (1974). Biochem. Soc. Symp. 40, 125. Weinstock, M.,and Leblond, C. P. (1974). J. Cell B i d . 60, 92. Weiser, M. M. (1976). I n “Membranes and Disease’’ (L.Bolis, J. F. Hoffman, and A. Leaf, eds.), p. 281. Raven, New York. Weissmann, G., and Claibome, R., eds. (1975). “Cell Membranes: Biochemistry, Cell Biology & Pathology.” H. P. Publishing Co., New York. Werb, Z., and Dingle, J. T. (1976). Lysosomes Biol. futhol. 5, 127. Whaley, W. G. (1966). I n “Organisation der ZeUe. In. Problem der biologischen Reduplikation” (P. Sitte, ed.), p. 340. Springer-Verlag. Berlin, Heidelberg and New York. Whaley, W. G . (1975). “The Golgi Apparatus.” Cell Biol. Monogr.. Vol. 2. Springer-Verlag, Vienna and New York. Whaley, W. G. (1979). “CRC Handbook Series in Nutrition and Food.” CRC Press, Cleveland, Ohio (in press). Whaley, W. G., and Dauwalder, M. (1976). J . Cell Biol. 70, 84a. Whaley, W. G., Kephart, J. E.,and Mollenhauer, H. H. (1964). I n “Cell Membranes in Development” (M.Locke, ed.), p. 135. Academic Press, New York. Whaley, W. G., Dauwalder, M., and Kephart, J. E. (1966). 1. Ulrrusrrucr. Res. 15, 169. Whaley, W. G., Dauwalder, M., and Kephart, J. E. (1972). Science 175, 596. Whaley, W. G., Dauwalder, M.,and Leffingwell, T. P. (1975). Curr. Top. Devl. Biol. 10, 161. Whaley, W. G., Leffingwell, T., and Dauwalder, M. (1976). froc. Inr. Congr. Histochem. Cyrochem.. 5th. 1976 Abstract, p. 370. Winzler, J. (1970). Inr. Rev. Cyrol. 29, 77. Wolosewick, J. J., and Porter, K. R. (1976). Am. J . Anur. 147, 303. Young, R. W. (1973). J. Cell Biol. 57, 175. Zakim, D., and Vessey, D. A. (1976). Enzymes Biol. Membr. 2, 443.

This Page Intentionally Left Blank

INTERNATIONAL REVIEW OF CYTOLOGY. VOL.58

Genetic Control of Meiosis’ I. N. GOLUBOVSKAYA lnstiture of Cytology and Genetics, Academy of Sciences of the USSR,Siberian Division, Novosibirsk, USSR 1. Introduction . . . . . . . . . . . . . . . . . . . . 11. The Characterization of Meiotic Mutations . . . . . . . . . A. Mutations Affecting Patterns of Meiosis . . . . . . . . B. Mutations Affecting Synapsis . . . . . . . . . . . . C. Genes Affecting Desynapsis of Chromosomes . . . . . . 0. Genes Affecting Crossover Frequency . . . . . . . . . E. Mutations Affecting Chromosome Disjunction . . . . . . F. Mutations Interfering with the Behavior of Single Chromosomes G. Genes Causing Loss or Impairment of the Second Division of Meiosis . . . . . . . . . . . . . . . . . . . . H. Other Cases of Meiotic Gene Control of Chromosome Behavior 111. Conclusions . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

247 249 249 252 260 268 27 1 275 277 278 280 286

I. Introduction Meiosis presents a seemingly paradoxical situation in which universality and uniqueness are harmoniously combined. All organisms, irrespective of their evolved complexity, meiotically reduce the chromosome number on beginning sexual reproduction. On the one hand, meiosis is a compensatory mechanism of fertilization maintaining the diploid chromosome set from generation to generation; on the other hand, it is a cytological device ensuring fulfillment of Mendel’s laws of heredity in organisms with chromosomal organization of the genome. Genetic recombination and the associated cytological phenomena-chromosome pairing and formation of the synaptonemal complex (sc) and chiasmata-all occur in meiotically dividing cells. An understanding of the genetic mechanisms underlying these complex processes would provide deeper insight into meiosis itself. Meiosis is a thought-provoking problem requiring a multidisciplinary approach. It indeed “lies at a crossroads where processes of many kinds meet. They converge on it and diverge from it and to understand what the whole ‘Dedicated to the memory of V. V. Khvostova 247

Copyright @ 1979 by Academic Press. Inc. All rights of reproduction in any form rewrved. ISBN 0-12-364358-9

248

1. N. GOLUBOVSKAYA

encounter means we need to bring methods and also ideas of many together” (Darlington, 1977, p. 185). Visualization as a series of sequential events is one way of unraveling the genetic mechanisms of meiosis. This may be done with the help of certain meiotic mutations, reducing meiosis to elementary units and revealing some of the features of the genetic programs controlling each developing cell and the meiotic devices that trigger passage from mitosis to meiosis. Based on collections of meiotic mutants, meiotic types that spontaneously arise under natural conditions might be modeled. The fact that meiosis is genetically determined was realized from the studies of Darlington (1929, 1932), and Sapegin (1932), and Sokolov (1934). It was then that the concept of reduction division genes was developed. The first descriptions of meiotic mutants involved the asynaptic mutants in maize (Beadle, 1930) and the c3G mutant in which crossing-over is arrested in Drosophila melanogasfet (Gowen and Gowen, 1922; Gowen, 1928, 1933). But it was especially during the 1960s that systematic analysis of meiotic mutants took place. Collections of meiotic mutants, induced by X rays or chemical mutagens, were established. These now include meiotic mutants of D.melanogaster (Sandler ef al., 1968; Baker and Carpenter, 1972; Boyd et al., 1976a; Smith, 1976), Pisum sativum (Gottschalk and Jahn, 1964; Gottschalk and Klein, 1976), Vicia faba (Sjodin, 1970), and Zea mays (Golubovskaya and Mashnenkov, 1975, 1976, 1977). The unwaning interest in meiosis and meiotic mutants is indicated by the large number of review articles (Sandler and Lindsley, 1974; Golubovskaya, 1975; Baker and Hall, 1976; Baker et al., 1976b) and discussions (see monograph, Cytology and Genetics of Meiosis, 1975, and the PhilosophicaI Transactions of the Royal Society, 1977). Meiotic mutants provide meaningful clues to theregulation of meiotic cells; they also help determine the role of cytological entities, their relationships (those between the sc and chiasmata), and the significance of the cytogenetic events of meiosis. Furthermore, they reveal similarities and differences in the mechanisms of meiotic recombination, DNA repair, and mutability in eukaryotes. And, finally, they permit one to retrace the pathways along which meiosis was arrested in apomictic plants and parthenogenetic animal species. The biochemistry of the meiotic cell reveals novel aspects of the problem. The metabolic features of DNA and protein in meiotic cells have been thoroughly described in a series of articles by Stem and his group, working with the microsporocytes of Lilium (Ito et al., 1967; Hotta and Stem, 1971a,b; It0 and Hotta, 1973; Stem and Hotta, 1973, 1974, 1977). In this article, efforts to solve the problem of meiosis with the use of meiotic mutants are surveyed. Only mutants identified in species with a typical, cytologically observable course of meiosis are dealt with. The illustrations show typical meiotic mutants and those unique in one respect or another. Direct visualization of cytologically identified mutants is a step from the how of meiosis to its why; it

GENETIC CONTROL OF MEIOSIS

249

would be helpful in establishing mutations of the same type in different organisms, a task still complicated by terminological ambiguities. Comparisons of the genetic and cytological effects of the genes affecting meiosis in versatile material should culminate in the establishment of a generality-a definite type of meiotic mutation. 11. The Characterization of Meiotic Mutations

The following classification is based on the effects exerted by genes affecting meiosis on the major cytogenetic events: chromosome pairing, recombination, segregation, and chiasma formation. Figure 1 is a schematic representation of this classification, which incorporates all the mutations considered here. Recent biochemical and ultrastructural data (Gillies et al., 1974; Gillies, 1975; Bogdanov, 1975; Stem and Hotta, 1977) are given at the top of the figure. The arrows indicate the meiotic stage when the effect of a certain gene is first observed cytologically. With these preliminaries it is now possible to proceed to a direct characterization of meiotic mutations.

A. MUTATIONS AFFECTING PATTERNS OF MEIOSIS 1. Mutations Blocking Entry into Meiosis An ameiotic mutant has been identified by Rhoades (1956) in maize, and the cytological observations have been described by Palmer (1971a,b). The locus

pan-ASU

0s

on

c X

op-WZ3

md diy-A344

p4(5,+) me-081

S. = S md-5332)

no-9 nnJZBZ

md-38

me351 me-41

abo

0verSOde.ynwle p l u s mdlllarant @.Ot -1s.

T*U. ni

du mad

no-4 ma-5

pc

mn-S.W20

md 4 ma,-C8? pal

on ms(2R)

dy

d

11"

ms-me

in-218

me-251 ma-352 010-99

md-IfU

FIG. 1. A general scheme of the subsequent stages of meiosis, associated biochemical and cytogenetic events, and controlling genes. The description of these genes is given in the text.

250

I. N. GOLUBOVSKAYA

responsible has been designated am and is located on the short arm of the fifth chromosome. Plants homozygous for the am gene show complete male sterility and incomplete female sterility. Phenotypically, the meitotic mutant becomes distinguishable at the time of tassel emergence. Prior to emergence, however, mutants do not differ from normal plants. The am gene does not seem to affect vegetative growth and development. In amlam mutants, the last premeiotic division proceeds normally; subsequently, cells do not enter into meiosis; after two to three synchronous mitoses, microsporocytes degenerate. While not attempting to elucidate the mechanism of the action of the gene concerned, Palmer (1971a,b) has indicated that it does not in any way interfere with growth and development. A closer examination of the am mutant might provide a clue to the triggering mechanisms of meiosis. It may be suggested that the developmental program of sporogenous cells switches from mitosis to meiosis at the last premeiotic mitosis and that perhaps the am gene is responsible for this. How this occurs must be determined by further experimental studies. However, more recent data give grounds for assuming that DNA synthesis is not changed from the mitotic to the delayed meiotic type in this mutant. 2 . Mutations Producing Substitution of Mitosisfor the First Division of Meiosis This mutation is controlled by a recessive gene called afd-W23 (absence of the fist division). It has been induced by treatment of dry maize seeds (the Wisconsin 23 line) with a 0.012% solution of N-nitroso-N-methylurea for 24 hours (Golubovskaya and Mashnenkov, 1975). Replacement of the first division of meiosis by mitosis is the salient feature of this mutation. The typical prophase I of meiosis is absent. Leptotene, zygotene, pachytene, diplotene, and diakinesis are omitted. As seen in Fig. 2, in this mutant prophase I of meiosis is dissimilar to normal prophase I. The homologous chromosomes fail to pair; at diakinesis, all 20 chromosomes are univalents outwardly resembling C-mitotic chromosomes. At metaphase I, all the univalents appear in orderly distribution on the plane of the spindle and regularly pass to the opposite poles at anaphase I of meiosis. This abnormal behavior is due to precocious disjunction of the centromeres of the sister chromatids of the first division of meiosis. Because the centromeres divided during the first division of meiosis, random passage of the chromatids to the poles is characteristic of the second division (Fig. 2). The tetrads are abnormal. Complete male and female sterility is observed in mutant afd/afd plants. This mutation has not been described in the literature. It reveals an interesting possibility, namely, the reversion of highly differentiated cells, meiocytes, already undergoing meiosis, to mitosis as a result of one or two mutational events. Possibly, evolving apomictic plant species used this mutational mechanism for reversion from meiosis to mitosis.

GENETIC CONTROL OF MEIOSIS

25 1

FIG.2. The meiotic cytological behavior of chromosomes in maize (2.rnuys) microsporocytes homozygous for the recessive ufd-M3 mutation. (a-e) Prophase I of meiosis. (a) Leptotene. (b-d) The typical zygotene, pachytene, and diplotene are absent and the chromosomes fail to pair. (e) Diakinesis; 20 chromosomes are scattered in the cell. (f) Metaphase I; 20 chromosomes (dyads) regularly coorientate themselves at the spindle plate; this coorientation is achieved by disjunction of the sister chromatid centromeres. (9) Anaphase I; 20 chromatids (monads) pass to each pole; some chromatids appear to be sticky. (h) Prometaphase 11, the chromosomes are represented by monads. (i) Anaphase 11-telophase 11, abnormal disjunctional separation of chromatids during the second division. (j)Tetrads with micronuclei are apparent. Prophase I-MI, X 6 6 0 ; prophase 11-TII, X330; tetrads, X 120; microsporads, X 120 or 330.

252

I. N. GOLUBOVSKAYA

B. MUTATIONS AFFECTING SYNAPSIS The discovery of the sc in prophase I of meiosis (Moses, 1956, 1968) was followed by the development of concepts concerning the role of this complex in the crossing-over of homologous chromosomes (Westergaard and von Wettstein, 1972; Gillies, 1975). A normally developed sc is essential for the regular pairing of homologs. By blocking, completely or partly, formation of the sc, meiotic mutations cause either total asynapsis or incomplete pairing of homologous chromosomes. A meiotic mutation perturbing regular chromosome pairing had been observed before the discovery of the sc. Two phenomena have been distinguished: asynapsis (the absence of bivalents at metaphase I of meiosis) and desynapsis (the Occurrence of both univalents and bivalents). These phenomena have been dealt with by Smith (1936), Li et al. (1945), and Prakken (1943). Smith (1936) has cautioned against using the term “asynapsis” when virtually nothing is known about chromosome behavior during the early prophase of meiosis. Distinguishing between the two phenomena is rarely feasible, because there are few subjects appropriate for studies on the early stages of meiosis. Terminological ambiguities remain. To avoid confusion, “asynaptic ” will henceforth designate only genes that prevent chromosome pairing during the early stages of the prophase of meiosis; “desynaptic” will designate those concerned with regular chromosome pairing during early prophase (pachytene); the term “desynaptic” will be applied to cases in which the cytologically observed abnormalities become apparent at diplonema-diakinesis as impaired chiasma terminalization due to an early slip of chiasmata along the bivalents making the homologs lie close together although not connected by chiasmata. In the light of recent data, asynapsis may be regarded as the result of arrested development of the sc. Each case of desynaptic mutation should be thoroughly examined. 1. Asynaptic Genes or Genes Blocking Formation of the Synaptonemal Complex

Only some of the plant mutants described in the literature are asynaptic in the full sense of the term. Two such mutants have been identified in tetraploid wheat, Triticum durum (Martiniand Bozzini, 1966), and two, ass and as,, have been detected in Brassica campestris (Stringham, 1970); a line has been described in a hybrid population of tobacco, Nicotiana tabacum X N . rustica (Swaminathan and Murty, 1959). Asynaptic mutants do not differ morphologically from the normal original forms. Their development is not disturbed until the flowering stage. They are phenotypically distinguishable only by sterile flowers and anthers. The anthers in the flowers are usually shriveled; they do not dehisce and produce pollen. The pollen grains are sterile, of various sizes and shapes, and anucleate. In plants

GENETIC CONTROL OF MEIOSIS

253

with pronounced asynapsis, the percentage of fertile pollen grains ranges from 0 to 30%. Asynaptic mutations cause both male and female sterility. Analysis of fertility in reciprocal hybrids between the asynaptic and original forms has demonstrated that not more than 10% of the eggs of asynaptic plants can be fertilized. Cytogenetic analyses of the pachytene stage of meiosis have shown that the homologous chromosomes do not associate and, as a result, chromosomes are univalent at diplotene, diakenesis, and first meiotic division. No chiasmata are formed. Chromosome disjunction is aberrant in character, even though the spindle apparatus is normal. The second division is essentially regular, and the abnormalities observed at this stage are consequences of some abnormality occurring during the first division. A salient feature of these mutants is the appearance of polyad (not tetrad) microspores after the completion of meiosis. The number of cells in polyads is not constant, two to eight, and each cell may have microcuclei. As a result, pollen is formed with a chromosome number considerably deviating from the haploid. With rare exceptions, the pollen is sterile. Electron microscope studies at prophase of meiosis have been conducted with two asynaptic mutants of tetraploid wheat ( T . durum). Although axial elements of the sc are formed at leptotene, in these mutants a normal sc does not make its appearance at zygotene or at pachytene (La Cour and Wells, 1970). A gene similar to the asynaptic gene in its effect has been amply described in D . melanagaster by Gowen and Gowen (1922) and Gowen (1928, 1933). This gene has been mapped at 57.4 map units on the third chromosome. It is 4 map units to the right of the crossveinless gene, c (cv = c). On maps developed from salivary gland studies, Lewis (see Lindsley and Grell, 1968) demonstrated that the c3G gene was located in the region of the deletion D f ( 3 R ) ~ b d which ’~~ involves bands 88F9 to 89A1 and 89D4 to 89D5. Two alleles have been identified at this locus, c3G” and c ~ (Hall, G ~1972). ~ Because their effects on meiotic events are the same, these alleles are considered together. The c3G gene affects the major steps of meiosi-rossing-over and the disjunction of homologous chromosomes. The percentage of crossovers at any of the chromosome sites studied does not exceed 0.1% (Gowen, 1933). No reciprocal crossovers were encountered. This gene not only completely suppresses crossing-over in females, but also promotes chromosomal nondisjunction. The nondisjunction rate of the X and fourth chromosomes exceeds by 400-fold the normal rate. This effect is manifest in females only; the gene concerned is inactive in males. This has been confirmed by analysis of offspring from reciprocal crosses; females having the c3G gene in a homozygous condition produced offspring consisting of 721 normal flies and 236 abnormal flies (aneuploids for the X and fourth chromosomes, triploids, and sex intergrades). In males homozygous for the c3G gene, nondisjunction of chromosomes did not occur, and offspring consisting of 1725 individuals included 899 XX females and 826 males (Gowen, 1933).

254

I. N. GOLUBOVSKAYA

Females homozygous for the c3G gene produce offspring mainly aneuploid for the X and fourth chromosomes. The absence of aneuploidy for the second and third chromosomes has been attributed to the death of zygotes aneuploid for the large autosomes. According to electron microscope observations, the sc does not appear in c3G D . melanogasrer females during prophase I of meiosis (Meyer, 1961; Smith and King, 1968; King, 1970; Rasmussen, 1975). With respect to the effect on meiosis, the c3G gene of D . melanogasrer resembles asynaptic genes of plants. The distinctive features of these mutants are: (1) failure of chromosome pairing during prophase of meiosis; (2) absence of the sc; (3) blocked crossing-over; (4) absence of chiasma formation; ( 5 ) formation of aneuploid gametes; and (6) incomplete fertility. Since the initial experiments of Moses (1956), it has become increasingly apparent that cmssing-over is directly related to the presence of the sc. Corroborative evidence for this has been provided by Meyer (1961, 1965) who demonstrated that the sc was not formed during prophase I of meiosis in D . melanogaster females with a c3Glc3G genotype and in males in which cmssing-over did not occur. Smith and King (1968) and King (1970) have attempted to bring out more facts about the role of the sc in chromosome pairing and disjunction. For this purpose, they analyzed the duration of prophase I and the presence (or absence) of the sc in D, melanogaster, with particular reference to the genetic data of Hinton (1966). All the pertinent data are summarized in Table I. The presence of the sc in +/+, c3Gl+ females and a prophase I of normal duration are correlated with regular crossing-over and disjunction of homologous chromosomes. The absence of the sc in c3Glc3G. c3GIDf(3)sbd105females, precocious termination of sc developfemales, and a reduced prophase stage are associated with ment in Df(3)~bd'~~/+ impaired crossing-over. Thus there is good evidence for the sc ensuring regular recombination. The same conclusion follows from studies on maize. Rhoades and Dempsey (1966a) have indicated that the abnormal tenth chromosome (KlO), which has a large heterochmmatin knob at the end of its long arm,increases crossing-over in the region of paracentric inversion in plants heterozygous for it. As judged by light microscope observations, heterozygotes for the 3/3b inversion paired more intimately in the presence of the K10, which corresponded to less frequent asynapsis in the inverted region when the K10 was present. Based on electron microscope studies, Gillies et al. (1974) reconstructed the sc of pachytene bivalents. These reconstructions showed that it was formed more frequently in the presence of the K10 than in its absence in the region of the inverted loop in heterozygotes for this inversion. The observations made were explained by the effect of the K10 chromosome on crossing-over.

GENETIC CONTROL OF MEIOSIS

255

TABLE I THE DURATION OF MEIOTIC PROPHASE I, CROSSOVER FREQUENCY, PATTERN OF HOMOLOGOUS AND PRESENCE OR ABSENCE OF THE Sc IN D . melamgaster CHROMOSOME DISJUNCTION, FEMALES OF DIFFERENT GENOTYPE* ~

~

Genotype of females

+I+

Scb

+

c3GI + + ~3GIDf(3)sbd’~~ -

Duration of prophase I

Crossing-over‘

Short

Normal (19.9%) Normal (21.1%) None

Normal Normal

+IDf(3)sbdlo5

f

Two times shorter than normal

0.5 of normal value (10.7%)

c3Glc3G

-

Short

None

~______

~

Disjunction of homologous chromosomes Normal Normal Nondisjunction 400 times more frequent than normal Nondisjunction 40 times more frequent than normal Nondisjunction 400 times more frequent than normal

‘Based on the data of Smith and King (1968); King (1970). * Present; -, absent. cThe total crossing-over frequency in the y-w-spl-sps region of the X chromosome is given in parentheses (Hinton, 1966).

+.

Data along these lines have been obtained in experiments with Drosophila ananassae. In males of this species, which carry a dominant enhancer of crossing-over on the right arm of the third chromosome, recombination frequency between the pe (peach eye color) and shy (straw body color) genes is one-sixth of that in females (Hinton, 1970). The failure of Grell et al. (1972) to discern a sc in the prophase cells of D . ananassae has prompted the idea that meiotic exchange can occur without a sc. The finding of a partly developed sc at zygotene in the homologous chromosomes of D. ananassae males gave Moriwaki and Tsujita (1974) a good reason for believing that crossing-over took place because of the presence of incompletely paired chromosomes. However, the presence of a sc is a necessary condition for crossing-over to occur, not a sufficient one. Nor does the sc deserve the “hallowed status as the embodiment of all that is essential to the achievement of recombination and disjunction” (Stem and Hotta, 1977, p. 375). 2. Genes Determining Synaptonemal Complex Abnormalities In 1974, a meiotic mutant, controlled by the recessive dsy-A344 gene (the

desynaptic gene), was identified in maize (Golubovskaya and Mashnenkov, 1976). In this mutant, the meiotic pattern of chromosome behavior is the same as that in desynaptic mutants. Throughout prophase I plants homozygous for the

256

I. N. GOLUBOVSKAYA

dsy-A344 gene pass from leptotene to diakinesis (Fig. 3). The first cytologically visible abnormalities appear at pachytene as asynaptic regions of homologous chromosomes (Fig. 3). At diakinesis, the chromosomes appear either as univalents or, rarely, as rod-shaped bivalents. The average number of bivalents per cell is 0.6 at metaphase I, and that of univalents is 18.9 at metaphase I. The disjunction pattern of homologs is random at anaphase I, so that only 12% of cells show regular separation of homologs toward the opposite poles. The second division, in the dyads (or polyads) of each cell, occurring after the first division irrespective of the number of chromosomes involved, proceeds synchronously. The centromeres of the sister chromatids disjoin normally at anaphase I1 (Fig. 3). This aberrant type of meiosis leads to the formation of tetrads with micronuclei and polyads. The dsy plants have completely sterile pollen and almost completely sterile ovules. From preliminary observations, the impression was gained that the sc, although present at pachytene, was abnormal; that is, it consisted of interrupted strands and distinct regions of chromosomes lacking a central element. It seems that the product of the dsy gene is a requisite for regular formation of the sc. The semidominant autosomal ord (orientation disrupter) mutation, induced by ethyl methanesulfonate (EMS) in the Canton S stock of D. melanogaster is mapped on the second chromosome (103.5 map units) in the region 59B-D on the cytology map of salivary gland chromosomes (Mason, 1976). The ord mutation has been investigated genetically and cytologically. Among the known meiotic mutations in D . melanogaster, the ord mutation is unique in that it sharply decreases the crossover rate (to 7% of the control values) in homozygous females and increases nondisjunction in chromosomes during the first and second divisions in individuals of both sexes. Cytological analyses of meiosis in males have demonstrated a normal course for the first division, although univalents and lagging chromatids may be encountered. The major abnormalities are the precociously dividing centromeres during meiosis in males. The cytological mechanism of the action of the ord gene is perhaps identical to that described for the dsy-A344 gene. The ord gene causes abnormalities of the sc (see review of Baker et al., 1976b; Lindsley and Sandler, 1977). It also causes precocious disjunction of the centromeres of sister chromatids similar to the that described for the asynaptic a3 gene in B. campestris, for the desynaptic a gene in T. monococcum (Smith, 1936), and for the desynaptic 2982 mutation in P. sativum (Klein, 1969a,b). Since the mei-W68 gene produces an abnormal sc and sharply decreases the crossover rate (Baker et al., 1976a), while the mei-S332a gene produces disjunction of the centromeres of the sister chromatids (Davis, 1971), a double meiW68lmei-322a homozygote would be a good model of the effect of the ord gene.

GENETIC CONTROL OF MEIOSIS

257

FIG.3. The meiotic cytological behavior of chromosomes in maize (2.mays) microsporocytes homozygous for the recessive dsy4344 mutation. (a) Leptotene. (b-c) Pachytene; the mynaptic regions are seen in distinct chromosome regions. (d) Diakinesis; instead of 10 bivalents, univalents and rod-shaped bivalents are observed; (e) Metaphase I; 20 univalents are scattered in the cell. (f) Metaphase I-anaphase I, irregular disjunction of univalents to the opposite poles (9 and 11). (g) Anaphase I; 7 chromosomes are at one pole and 13 are at the other. (h) Metaphase II. (i) Anaphase 11; the chromatids separate during the second division. (j)Telophase 11. (k)Tetrads with micronuclei and , 11-TII, X330; tetrads, X 120; microsporads, x 120 or 330. polyads. Prophase I-MI, ~ 6 6 0prophase

258

I. N. GOLUBOVSKAYA

3. Genes Affecting Chromosome Pairing during Meiosis in Common Wheat

In discussing meiosis, special attention should be given to findings on the cytological diploid behavior of polyploid wheat, in view of its relevance to the genetic control of pairing between homologous chromosomes and to the prevention of pairing between homoeologous chromosomes. Common wheat is a complex natural allopolyploid species having three genomes, A, B, and D, derived from different diploid ancestors that have retained genetic equivalence of corresponding homoeologous chromosomes. During meiosis, chromosomes behave normally like those of the diploid type, as evidenced by the presence of bivalents in all the microsporocytesand the absence of multivalents. The latter observation was explained only after establishment of the role of single chromosomes in the control of meiosis. The following chromosomes are involved in the regulation of meiotic chromosome behavior in hexaploid wheat: (1) chromosomes 2A, 3A, 3B, and 3D determine normal synaptic events; (2) chromosome 5B prevents synapsis between homoeologous chromosomes; (3) chromosome 5D provides normal synapsis at low temperatures (Riley et at., 1966; Sears, 1976). Chromosome 5B exerts a diploidizing effect on meiosis. This has been independently revealed by Okamoto (1957) and Riley and Chapman (1958). The absence of chromosome 5B increases the frequency of chromosomal pairing; moreover, the strength of attraction causing bivalent formation is so strong that subsequently multivalents arise. Okamoto (1957) has assumed that chromosome 5B*bears asynaptic genes and that its presence in hybrids between rheat and othkr species of the subtribe Triticinae leads to the occurrence of a large n2mber of univalents. It was initially proposed by Riley and Chapman (1963) that homoeologous chromosomes from different genomes of common wheat participated in the formation of multivalents in the absence of chromosome 5B (Riley and Chapman, 1963). This hypothesis has been confirmed by elegant cytogenetic experiments using lines with telocentric chromosomes represented by a chromosome arm. Lines simultaneously possessing two telocentrics from similar and dissimilar homoeologous chromosome groups were developed. Homoeologous chromosomes indeed participate in the formation of multivalents in the absence of chromosome 5B. Unequivocal proof of this was the observation of bivalents and trivalents containing both marked telocentric homoeologous chromosomes. The presence of telocentrics from homoeologous groups in the original lines excluded the formation of bivalents and trivalents with the involvement of telocentrics at metaphase I (Riley and Kempanna, 1963; Riley and Chapman, 1964). Thus chromosome 5B has a specific influence on chromosome pairing during meiosis in common wheat; its presence prevents the association of homoeologous chromosomes and ensures pairing of strictly homologous chromosomes.

GENETIC CONTROL OF MEIOSIS

259

At first, it was shown that a single dosage of chromosome 5B was sufficient for chromosome pairing to be normally bivalent. The locus responsible for the specific pairing of homologs was located on the long arm of this chromosome (5BL). From monosomic analyses it has been tentatively concluded that this property of chromosome 5B is under the control of a single gene (Riley, 1960; Kimber, 1966). Closer investigation of the properties of the long arm of chromosome 5B was made difficult by the absence of alleles of this gene. This difficulty was overcome by artificial induction of allelic variations. Seeds of a line of Chinese Spring common wheat ditelocentric for 5BLwere treated with EMS.Plants from the treated seeds were crossed with rye, Secale cereale, for the identification of mutants in which nonhomologous chromosome pair. One of these mutants, 10/13, was analyzed in detail (Riley ef al., 1966). These studies were designated to prove that the 10/13 mutation was located on chromosome 5B.The mutant line 10/13, ditelocentric for chromosome 5B, was crossed with rye, S. cereale. In hybrids between Triticum aestivum and S . cereale, chromosome behavior was analyzed during meiosis; analyses of the segregation of chromosome pairing in the families obtained (in the presence or absence of pairing of nonhomologous chromosomes) and segregation for condition of chromosome 5B (with normal chromosome complements or telocentric) were made independently. More sophisticated approaches were needed to locate the mutation locus on chromosome 5B. These have been developed in further studies (Wall et al., 1971a,b). It is now clear that the 10/13 mutation is on chromosome 5B, although its location relative to the centromere remains unclear (the frequency of crossingover between the mutation locus and the centromere is 50.6%). A more precise localization may be achieved by intermediate markers. The locus responsible for the normal pairing of homologs in hexaploid wheat has been designated Ph (pairing homoeologs). Its recessive allele ph permits pairing of homoeologous chromosomes. The occurrence of this mutation lends support to the idea that the activity of chromosome 5B might have been induced by a monogenic mutation arising in polyploid wheats. Knowledge of the specificity of the effect of chromosome 5B on meiotic pairing would provide meaningful clues to understanding polyploid diploidization. Analogous systems controlling pairing have been established in naturally occurring allopolyploids, hexaploid tobacco and cotton (Kimber, 1961), tetraploid and hexaploid oats (Jauhar, 1977; Rajhathy and Thomas, 1972), and hexaploid tall fescue (Festucu arundicafa) (Jauhar, 1975, 1977). However, the mechanisms whereby chromosome 5B exerts its regulatory action are not clear. Some intriguing possibilities have been envisaged. Having analyzed the effect of the dosage of chromosome 5B on the relative positions of homologous partners at metaphase of mitosis, Feldman (1966, 1968) and Feldman et al. (1966) concluded, albeit in a still disputable formulation, that homologs lay closer to each

260

I. N. GOLUBOVSKAYA

other in the nucleus than nonhomologs. Their hypothesis implies genetic factors interfering with the relatively contacting segments between nonhomologous chromosomes. Riley (1968) has viewed chromosome pairing as a two-step process, with partners attracted in the first step and passing through the elaborate synaptic process in the second. The effect of chromosome 5B is to time the attraction phase of homologous chromosomes which comes to an end irrespective of the commenced phase of site-to-site synapsis (Riley, 1968; Sears, 1976). The following situations are quite plausible: (1) prolongation of the attraction phase, hence the promotion of homolog-nonhomolog associations under the influence of chromosome 5B; (2) a progressive increase in the attraction phase with increasing dosage of chromosome 5B; the association only between homologs possible at two dosages of 5BL;increasing dosages of 5BLparalleled by shortening the attraction phases and decreasing associations, even between homologs; (3) shortening of the attraction phase caused by chromosome 5B and its prolongation under the influence of chromosomes 5D,5A, and the short arms of 5B, 5BS (Riley, 1968; Sears, 1976). Riley and Feldman, have tackled the same meiotic events from different viewpoints. What is significant is that the results of electron microscope investigations on Drosophila and on remote hybrids of common wheat (Riley, 1968) fit perfectly into the concept that regards homologous chromosome pairing as consisting of two independent steps. Further support of this concept stems from biochemical data (Hotta and Stem, 1961) and models simulating the various steps of meiosis (Comings and Okada, 1970). 4. Absence of Chromosome Pairing in the Spermatocytes of D . melanogaster Sandler e f a f . (1968) identified the mei-081 mutation which causes failure of homolog pairing during the first meiotic division in the primary spermatocytes of D . melanogaster. This recessive mutation has been located on the thud chromosome. Other pertinent data are lacking. The mei-081 mutation is all the more interesting when one recalls that homolog pairing patterns are basically different in the two sexes. The absence of an sc (Meyer, 1965), true chiasmata (Slizynsky, 1964), and crossing-over are characteristic of meiosis in D . melanogaster males. These mutations, which affect prophase I in males, are not associated with any changes in females. The fact that these mutations operate in one sex only has evolutionary implications that are dealt with in Section 111.

c. GENESAFFECTINGDESYNAFWS OF CHROMOSOMES Table I1 lists the genetically studied mutations that produce desynapsis in various plant species. As demonstrated in this table, this abnormality is a fre-

GENETIC CONTROL OF MEIOSIS

26 1

quent occurrence in the plant world. Desynaptic mutants spontaneously arising in populations of various plant species, as well as desynaptic remote hybrids, have been omitted. The omitted data have been summarized by Gaul (1954) and Sjodin (1970), and partly reviewed by Baker er al. (1976b). 1. A Cytological Characterization of Desynaptic Mutants In the majority of desynaptic mutants, meiosis has been studied from diakinesis of metaphase I. There is no evidence concerning meiosis at early prophase I. After prophase I, meiotic aberrations in desynaptic mutants resemble those described for the dsy-A344 mutant in 2. mays. The separation of the centromeres of the sister chromatids during the second meiotic division is a feature common to desynaptic mutants, as well as to the dsy-A344 mutant. Exceptions to this rule are several mutants showing not only desynapsis homologs but also division of the centromeres of sister chromatids at anaphase I instead of anaphase 11. These are the a mutation in T. monococcum and the 2982 mutation in P. sarivum (Smith, 1936; Klein, 1969b). The number of bivalents at metaphase I, and the chiasma frequency per cell and per bivalent serve as indexes of the various degrees of desynapsis. Prakken (1943), a proponent of the term “asynapsis, ’* has founded his classification of desynaptic genes on estimates of the bivalent number at metaphase I. According to his classification, mutants are weakly desynaptic, completely desynaptic, or intermediate with respect to this character. Weak desynapsis means the appearance of several univalents at metaphase I; medium desynapsis signifies the presence of many univalents along with bivalents; desynapsis is said to be complete when exclusively univalents are seen at metaphase I and scarcely any bivalents. Data on chromosome behavior at pachytene and electron microscope data on early prophase, which characterize the sc, would possibly permit the assignment of these forms either to asynaptic mutations or to mutations causing abnormalities in the sc. It should be noted that mutants displaying various degrees of desynapsis occur in many forms of plants. Thus V.faba mutants exhibit all the transitions from weak to strong desynapsis. Four years of experimental work with V. fuba have yielded results indicating that each line retains its own degree of specificity. The same is true for the desynaptic mutant in maize (Miller, 1963). 2. Desynapsis and Chiasma Frequency Chiama number is invariably decreased in desynaptic plants, as compared with that in normal plants. This decrease is due to the appearance of univalents and to the lower number of chiasmata in the retained bivalents. Vlmus glubra is an exception to this rule in that the chiasma number remains unchanged in the retained bivalents (Ehrenberg, 1949). Desynaptic mutants, in which not only bivalent number but also chiasma frequency per bivalent is reduced at metaphase I, were analyzed to determine chiasma crossover relationships (Soost, 1951).

I. N. GOLUBOVSKAYA

262

TABLE I1 GENESCAUSING DESYNAPUS IN PLANTS

Plant species

Gene symbol

Segregation ratio of nonnal to mutant plants in Fz

Gene effect

Reference

3:1

Strong

3: 1

Medium

Avena sativa

3: 1

Medium

Brassica campestris Collinsia iinctoria Corchorus cliiorius Datura siramonium Gossypium hirsutum x G . barbadense Gossypium hirsuium Glycine m u

3: 1

Medium

3: 1 3:l 3:l

Medium

3: 1

Strong

15:l

Medium

15:l

Medium

Weaver (1971)

3: 1 3; 1

Medium Strong

Hordeum vulgare

3:l

Medium

Lolium perrene Lycopersicum esculentum Nicotiana rusiica X N. tabacum Oenoihera dicipiens Oriza saiiva Pisum sativum (23 mutants induced by x-ray treatment)

3: 1 3:1

Medium Medium

Hardley and Stames (1964) Palmer (1974) Enns and LMer (1960) Ahloovalia (1969) Soost (1951)

3: I

Medium

3: 1

Medium

3: 1 3: 1

Medium Medium

Avena abissinica A . barbata Avena sirigosa

X

Medium

Thomas and Rajhathy (1966) Dyck and Rajhathy (1965) Thomas and Rajhathy (1966) Stringham (1970) Mehra and Rai (1970, 1972) Mitra and Singh (1971) Bergner ei al. (1934) Beasley and Brown (1942)

Swaminathan and Murty (1959) Catcheside (1939) Chao and Hu, 1960 Gottschalk and Jahn (1964); Gottqchalk and

VillalobosPieaini (1965); Gottschak (1968); Klein (1969); Gottschak and Baquar (1971)

263

GENETIC CONTROL OF MEIOSIS TABLE I1 (continued)

Plant species Pisum sativum

Gene symbol

Segregation ratio of normal to mutant plants in F2

Two alleles

3:1

Medium

Ezhova et al.

3: 1 3: 1

Medium Medium

Prakken (1943) Krishnaswamy and Meehakshi

3: 1

Medium

Ross et a / . (1960)

15:I

Medium

Smith (1936)

Li er a / . (1945) Sjiidin (1970)

Gene effect

Reference

(1977)

Secale cereale Sorghum durra x S . subglabrescens Sorghum (of hybrid origin) Triricum monococcum X T . aegilopoides Triticum aestivum Vicia faba

(1957)

Zea mays

3: 1

Medium Strong, medium, weak Medium

Zea mays

3: 1

Medium

3: 1 3: 1

Beadle (1930); Miller (1963) Nelson and Clary, 1952, cited by Maguire (1978)

"Gene located on chromosome 21 or 22. bGene located on chromosome 1 between the genes P and br.

Significant decreases in crossover frequencies, as compared with those derived from genetic map estimates, were expected. Whether the experimental data agreed with the expected proved to be a controversial problem. 4. Desynapsis and Crossover Frequency Beadle (1930) was the first to analyze crossover frequency in desynaptics. He

studied crossing-over between the sh and wx genes on the ninth chromosome in maize. The reciprocal crosses were: (1) ? (as sh wx)l(as -t +) x S (sh wx)l(sh wx) and (2) 0 (sh wx)l(sh w x ) x S (as sh wx)l(as sh wx)l(as

+ +).

In the first experimental cross the crossover percentage between the two genes was 24%; it was 13% in the second cross. When the results of the second cross were reev.aluated, the percentage was found to be 11-20%. that is, within the range not differing significantly from that for these two genes in desynaptics (Beadle, 1930). The aim of Rhoade's (1947) experiments was to study crossing-

264

I. N. GOLUBOVSKAYA

over in the diploid gametes of mutants in which all the chromosomes migrated toward one pole. Crossover percentage, estimated in the sh-wx region, was not lower than normal and, in some cases even surpassed it. Subsequently, higher crossover frequencies have been established for chromosome regions of both diploid and haploid eggs (Rhoades and Dempsey, 1949; Dempsey, 1959, cited in Miller, 1963). The experiments of Miller (1963) have provided a sounder basis for consensus on the problem of crossing over in desynaptics. He tested possible crossovers using large heterochromatic knobs on chromosomes as cytological markers. Miller’s (1963) conclusions were based on observations of partial asynapsis in pachytene cells, parallels between these asynaptic data, and recombination data on crossing-over of marker genes, as well as comparisons of the frequency and locations of chiasmata in different chromosome regions. Miller (1963) has succintly explained the increased crossover frequency in the chromosome regions in egg cells observed in the earlier studies of Rhoades and Dempsey (1949) as follows. The feature distinguishing desynaptics from normal plants is the predominant location of chiasmata in the distal segments of the short arm or in segments near the centromere; in the three chromosomes, chiasmata in rod bivalents are formed three times more frequently in the short arm than in the long one. The genetic regions used for determining crossover frequency were located mainly in the distal segment of the short arm or in the segment proximal to the centromere. Thus increased crossing-over in the chromosomes of the haploid egg may be related to an actual increase in chiasma frequency in the distal segments of chromosomes (Miller, 1963). In the tomato, the effects of the as, and as4 genes on crossing-over between the W Y and d, genes, responsible for light-green color and dwarfness, have been examined (Soost, 1951). It was observed that crossover frequency between this pair of genes in the mutant ranged from 30 to 40%, while the frequency in the normal control varied from 32 to 37%. Moens (1969) has made similar comparative studies by examining three tomato desynaptic mutants for the fine-structure details of chromosome pairing at prophase I. Crossing-over was studied using three genes as genetic markers. Of these, two, d , and wv,were the same as those utilized by Soost (1951); the third marker was the aw gene governing anthocyanin absence (green stem). They were located on the second linkage group (the nucleolus chromosome). The sc was normally formed in all three mutants. Genetic data indicate that these genes alter crossover frequency irregularly along the length of the chromosome. The as, gene does not affect crossover frequency in the distal region, while the asq and asb genes somewhat increase its frequency in this region. Neither the asg or asg gene interferes with the recombination frequency in the proximal region. All three genes increase somewhat the probability of double crossovers.

GENETIC CONTROL OF MEIOSIS

265

Crossover frequency between the li and v genes, which determine liguless and six-rowed varieties in barley, is much reduced (14-16%) as compared with that of normal plants (Enns and Larter, 1962). From these genetic data it appears that these genes do not seem to interfere directly with the subtle mechanism of recombination, being concerned rather with processes preceding recombination. The mode of action of these genes is considered in detail in Section II,D. 4. Allelic Tests of Desynuptic Genes

Genetic analyses of desynaptic mutants in diploid species have demonstrated that the changes observed during meiosis are most frequently due to a recessive mutation in a single gene (see Table 11). Triticum monococcum in an exception in that its desynapsis is produced by two recessive genes. A large number of genes controls desynapsis in allopolyploids. In cotton, two recessive genes are responsible for the occurrence of desynapsis. Data have been obtained indicating that modifier genes control the varying degrees of desynapsis in common wheat (Li et ul., 1945). As Table I1 shows, different numbers of desynaptic mutants have been identified in plants which have a good cytology of meiosis: more than 20 in P. sutivum, 5 in tomato, and 11 in V.fubu L. Allelism tests did not establish any allelic relationships between these genes. Allelism has been shown only in two desynaptic mutants. One example of allelism has been provided by Ezhova et ul. (1977) who induced desynaptic mutants in P. sufivum with chemical agents. The genes concerned proved to be allelic. The other example of allelism in Collinsiu tinctoriu is interesting, because two meiotic mutations with different phenotypic expressions are allelic (Mehra and Rai, 1972). In this species, a desynaptic mutant, controlled by the recessive gene c d s ,and a meiotic mutant, distinguished by chromosome stickiness, have been identified. Genetic analysis has demonstrated that the two mutations are allelic, with the F, gene (chromosomal stickiness) dominantt over the desynapsis gene. Chromosomal stickiness was observed in all the Fl hybrids, and segregation of three sticky mutants to one desynaptic occurred in F2 hybrids. Mehra and Rai (1972) have proposed the symbol C~ for the gene controlling chromosomal stickiness.

5 . Genes Responsible f o r Chromosomal Stickiness Adhesions between two or more chromosomes resulting from certain gene mutations have been identified in maize (Beadle, 1937), Alopecurus myosuroides Hud. S . (sI and s2) (Johnson, 1944), C. tinctoriu (c") (Mehra and Rai, 1970), and rye (Sosnikhina, 1973). In maize, as in C. fincforiaand rye, this meiotic abnormality results from a monogenic recessive mutation; in A. myosuroides, it is due to two mutations. Cytogenetically, the sticky chromosomes of all show the same type of behavior. Chromosomes start to aggregate at

266

I. N. GOLUBOVSKAYA

prophase I. They frequently form associations, but single stray chromosomes may be encountered which are, however, more condensed than normal chromosomes. Plants and cells exhibit significant variations in the expression of stickiness. Chiasma formation is impaired, and associated chromosomes do not orient themselves at the equatorial plate. A cytological feature of mutant plants homozygous for the stickiness gene is chromosome fragmentation apparent from prophase I of meiosis. This fragmentation is particularly pronounced at anaphase I, and chromatin threads are seen extending from the fragments to the pole. These chromosomal abnormalities cause female (and even female and male) sterility in plants. There are no data concerning the effect of stickiness genes on the fquency of crossing-over and chiasma formation, chromosomal disjunction, and other events important in understanding meiosis better. So far, analysis of the composition of histone fractions has failed to reveal any differences between normal plants and st mutants in maize (Stout and Phillips, 1973). The mutation producing chromosomal stickiness has been induced with nitromethylurea in maize (Golubovskaya, 1977). It differs from all the mutations described in that sticky chromosomes predominantly appear at metaphase I and no meiotic abnormalities are noted before this stage (Fig. 4). The disjunction pattern of chromosomes in this mutant is quite unusual. Chromosomes lose their identity, and the nucleus elongates to form “dumbbells” which are divided by a cell membrane formed by the end of the first meiotic division. Tetrads with micronuclei or polyads arise instead of regular tetrads. Sterility appears in both males and females. When comparing the cytological characteristics of the meiotic mutants identified in the ascomycete Podospora anserina (Simonet and Zickler, 1972), one finds evidence strongly suggesting that mutations giving rise to chromosomal stickiness also occurred in the ascomycete. An example is the mei-1 mutation which blocks chromosome pairing so that chromosomes coalesce at early prophase I of meiosis. Four alleles have been identified at this locus. mei-2 and mei-1 mutants have common cytological features. The three alleles of this mutant are mei-2-1, mei-2-2, and mei-2-3. In these mutants, meiosis is blocked until pachytene, completely in mei-2-1 and mei-2-3, and partially in mei-2-2. This incomplete arrest in mei-2-2 was taken advantage of to analyze the effect of this mutation on crossing-over. Interallelic complementation in offspring from mei-2 x mei-2-1 and mei-2-2 X mei-2-3 crosses made genotype analysis possible. It was found that the allele mei-2-2 increased crossover in regions located near the centromere and decreased it in other regions. This effect was established for three linkage groups. Besides affecting intergenic recombination, this gene increases the frequency of spontaneous mutations. It is worthwhile noting again that the meiotic abnormalitiesof these P. anserinu mutants (Simonet, 1973) are strongly reminiscent of sticky chromosome patterns.

GENETIC CONTROL OF MEIOSIS

267

FIG.4. The meiotic cytological behavior of chromosomes in maize (Z.mays) homozygous for the mei 025 mutation causing chromosome stickiness. (a) Diakinesis; 10 normal pairing bivalents a p pear at meiosis; all stages, including diakinesis, do not differ from normal. (b) Metaphase I; chromosomes form sticky adhesions. (c) Irregular chromosome disjunction; the chromosomes are in the process of separating into three groups. (d) Telophase I; the cell wall “cuts” the chromatin thread. (e) PMCs have divided into two daughter cells, but the nucleus forms a “dumb-bell” configuration. ( f ) Prophase II; decondemed chromatin is apparent. (h) Metaphase 11; the chromosomes reassume their sticky appearance. (i) Anaphase 11; irregular separation of the chromosomes to the opposite poles. (j) Tetrad stage, the PMCs are distinguished. Telophase 11; tetrads and polyads are evident. (k-1) Binuclear and mononucleax microsporads arise as a result of abnormal meiosis. Prophase I-MI, ~ 6 6 0prophase ; 11-TII, x330; tetrads, x 120; microsporads, x 120 or 330.

The mei-3 mutation causes stickiness at early diplotene. Chromosome behavior is normal before diplotene. Three alleles have been detected at this locus (Simonet and Zickler, 1972). From comparisons of this type of mutation in fungi and higher plants, it may be tentatively concluded that stickiness mutations in higher plants presumably exert an effect on genetic events at prophase I of meiosis, similar to the effect described for the mei-2 mutation. The finding of allelic relationships between the ca gene, conferring chromosomal stickiness, and the cdsgene, controlling de-

268

I. N. GOLUBOVSKAYA

synapsis in C. tinctoria, is encouraging. These relationships can serve as guidelines for aligning all the mutations affecting prophase I meiosis in a sequence each member of which blocks the sequential steps of prophase I in the meiotic cell.

D. GENESAFFECTING CROSSOVER FREQUENCY 1. A Description of Meiotic Mutations

Three mutations belonging to this class have spontaneously arisen in natural populations of D . melanogaster (Sandler et al., 1968). 1 . mei-S-51 mutation in Salaria 51. This mutant has two recessive genes located near the centromere region of the second and third chromosomes. The mutation is the cumulative effect of both recessive genes. In the homozygous condition, these mutations reduce crossing-over in the X and second chromosomes to half that in the controls, and in addition cause nondisjunction during the first meiotic division (Sandler et al., 1968; Robbins, 1971). 2. mei-$282 mutation in Salaria 282. This is a recessive mutation on the third chromosome (5 map units). The crossover frequency (in the X and the second chromosomes) is also halved by this mutation. This chromosome is capable of reducing crossover frequency in the distal regions of the chromosome (Sandler et al., 1968; Parry, 1973). 3. mei-S-332b mutation in Salaria 332. This is a dominant enhancer of cmssing-over, located on the third chromosome. The effect of this gene is to increase to the same extent crossing-over along the entire chromosome length (confirmatory data were obtained by X-chromosome tests) and to increase the disjunction frequency of homologous chromosomes as compared with that in controls (Sandler et al., 1968). Eleven meiotic mutations affecting crossing-over were located on the X chromosome after EMS treatment (Baker and Carpenter, 1972). Of these, those at abo, mei-9, mei-9b, and mei-218 have been studied in some detail (Carpenter and Sandler, 1974). mei-9 and mei-9b are located on the X chromosome (5 map units). These alleles of a single gene exert a similar effect on recombination and disjunction, which is somewhat stronger in the case of mei-9. The effect of this gene is specific in that it causes a uniform recombination decrease along the chromosome. mei-218 has been assigned to 57 map units on the X chromosome. abo has been located on the X chromosome at a position of 3 map units proximal to J which has been mapped at 41 map units. mei-41 and mei-95 are allelic mutations; mei-251, mei-352, mei-99, and mei-160 have all been located on the X

GENETIC CONTROL OF MEIOSIS

269

chromosome. Decreased recombination frequency and increased nondisjunction frequency are characteristic of all these genes. Unlike the mei-9 gene, they decrease recombination in a nonuniform manner along the total length of a chromosome arm, more conspicuously in distal regions than in proximal ones. mei-38 is also located on the X chromosome. This gene enhances recombination nonuniformly along chromosome length and has only a weak effect on meiosis. Clear-cut analysis of the effect of different genes, expressed as the total map length of a chromosome arm in mutants divided by the same parameter in controls, has led to the establishment of a minimum of two steps in the recombination process of D . melanogasrer. Interestingly, of the 14 genes examined, only mei-9 affects the intimate mechanisms of exchange; the rest seem to interfere with a step preceding exchange (Baker and Carpenter, 1972; Carpenter and Sandler, 1974; Baker er al., 1976a). Furthermore, Valentin and Stahl (1975) investigated the combined effects of meiotic mutations ( a h , mei-Z, mei-218, and S282), subjected to x-ray treatment and containing inversions, on recornbination frequency. As a result, they have assigned meiotic mutations affecting events preceding exchange to two groups and thereby distinguished two stages in the preparation of D . melanogasrer females for recombination. The general impression was that inversion, x-ray treatment, and mei-Z influenced one preparatory stage and mei-218 the other. Electron microscopy has demonstrated that the sc in the three meiotic mutants of this group (mei-9, mei-218, and mei-4Z) is normal (Baker et al., 1976b). Mutations affecting crossing-over have been described in D . ananassue. Crossing-over involves regions severalfold smaller in males than in females. It has been repeatedly indicated that crossover variability in this Drosophila species is under genetic control (Kikkawa, 1938; and Moriwaki, 1940, cited by Hinton, 1970). Having analyzed male crossing-over in D . ananassue, Hinton (1970) concluded that it was dependent on a dominant gene with an enhancing effect, E n , located on the right arm of the third chromosome, and on the recessive allele of a dominant suppressor, S, presumably located on the left arm of the second chromosome. In males having this crossover-enhancing gene, the total frequency of the marked chromosome was 0.31, whereas in females it was 0.34. However, individuals of opposite sexes differed in crossover distribution in the marked regions. Individuals of this Drosophila species seem to possess crossover modifiers (Hinton, 1970). From a survey of pertinent data in the literature, Hinton (1970) has inferred that the crossover enhancer E n , on the third chromosome, and the gene E, which Kikkawa has also located on the third chromosome, are identical. The other gene controlling crossing-over (Moriwaki, 1940, cited by Hinton, 1970) and located on the second chromosome is regarded as a crossover modifier. Data of more detailed cytogenetic analyses are still lacking. In some mutants, recombination values are altered as a consequence of absence of the sc or some impairment of its structure (c3G and ord); in others

270

I. N. GOLUBOVSKAYA

recombination frequency is drastically diminished in spite of the presence of a sc (mei-9, mei-41, mei-218, a s , , a s 4 , and as*). Both genetic and biochemical data have shown that the mei-9 mutation directly interferes with recombination (Carpenter and Sandler, 1974; Boyd et al., 1976b), whereas the other Drosophila genes and the desynaptic genes in the tomato (asl, as4, and asb) affect only the steps preceding exchange. These genes affecting meiosis in Drosophila possibly affect chiasma distribution frequency along the chromosome in a manner demonstrated for the desynaptic genes in plants. 2. Meiotic Mutants, Recombination, DNA Replication, and Mutability Relationships in Higher Organisms Boyce and Howard-Flanders (1964) were the first to point out the remarkable similarity between the dark repair mechanisms of DNA and genetic recombination. Since certain enzymes may be simultaneouslyinvolved, ultraviolet sensitivity and deficient recombination capacities were thought to be correlated. This proposal received confirmation and was made more concrete by studies on the genetic phage systems and bacteria. The reader is referred to Kushev's book (1972, 1975) and to Zakharov's paper (1970) for a comprehensive treatment of the subject. Discussions of the implications of dark repair of DNA in higher organisms were particularly illuminating with reference to recombinationdeficient meiotic mutants. Watson (1969, 1972) showed that the meiotic mutant of D . melanogasfer was more sensitive to x rays as compared with the wild type. X rays produced high frequencies of recessive sex-linked lethals and translocations, whereas treatment of egg cells with alkylating chemicals (EMSor diepoxybutane) increased the frequency of only lethal mutations. The recovered recombination-deficient mutants provided a larger basis for experiments. The mutants were divided into two gmups. One group was characterized by a meiotic mutation deficiency, while the other consisted of chemical mutagen-sensitive mutants. Smith (1976) has identified 28 sex-linked mutations, symbolized mus (mutagen-sensitive). Boyd et al. (1976a) isolated 13 mutations of this kind. Seventeen mus mutations of those recovered by Smith (1976), mei-41 A-1 through mei-41 A-17, and 4 of those recovered by Boyd et al. (1976a), mei-41 D-2 through mei-41 Ih5, proved to be alleles of the previously induced mutation (Baker and Carpenter, 1972), mei-41, which affects recombination and disjunction. Allelic relationships between these two classes of mutations suggest that DNA metabolism during meiosis and mitosis are under a common genetic control in higher organisms (Baker et al., 1976a). The more thoroughly studied mutants in which recombination is affected (mei-41, mei-9, mei-9b, and mei-218) have been tested for their sensitivity to mutagenic agents. It was found that individuals homozygous for mei-41 were hypersensitive to the killing effect of x rays and ultraviolet adiation, EMS, methyl methanesulfonate (MMS), 2-acetylamino-

GENETIC CONTROL OF MEIOSIS

27 1

fluorene (AAF), and nitrogen mustard (NH,). The mutants hypersensitive to x rays, MMS, AAF, and NH2 were mei-9 and mei-9b. The mei-218 mutant was not sensitive to these agents. The capacity for photorepair has also been tested in these mutants (Boyd et al., 1976b). The rate of the removal of the endonuclease-sensitive sites from DNA was estimated in cultures of the embryonic mei-9 mutant. It was found to be 10 to 20 times slower than in the controls. The removal rates of the endonuclease-sensitive sites were the same in mei-218 mutants and in the controls. These results have indicated that the product of the mei-9 gene is necessary for DNA repair in somatic cells and possibly is crucial for normal meiotic recombination (Boyd et al., 1976b). The genetic systems of meiotic mutants of D . melangaster have contributed and should continue contributing to our understanding of the intimate mechanism of DNA repair and recombination.

E. MUTATIONS AFFECTING CHROMOSOME DISJUNCTION While not interfering with pairing and crossing-over, some mutations affect the disjunction of homologous chromosomes. The effects of these mutations vary in degree. Some meiotic mutations directly cause abnormalities of the spindle apparatus, and others impair disjunction mechanisms in one way or another. All this is considered in this section. 1. Mutations Causing Failures of the Spindle Apparatus

Mutations causing failures of the spindle apparatus are ms(l)RD7, ms(l)516, ms(l)RDIS, RA40, 202, 244, and ms(l)RD294. These mutations have been identified among mutations producing complete male sterility in D . melanogaster. They are located on the X chromosome. ms(1)516 has been precisely located at 5 map units to the right of vermilion. The mutations had no effect on mitosis, but consistently induced spindle apparatus deficiencies (Lifschytz and Meyer, 1977). The basic features of the organization of the spindle apparatus in mutants have been compared with those in the normal living cell. Using the terminology of Mazia (1961), Lifschytz and Meyer (1977) have described several kinds of spindle deficiencies: monopolar, bipolar, and monoastral, instead of biastral and multipolar with three to four poles. These deficiencies produced a “cascade of errors”: irregular orientation of chromosomes and incorrect disjunction, precocious division of centromeres, and inability to attach to the membrane. ms(l)RD15, RA40, 202, and 244 induce multiple abnormalities in the spindle apparatus in the first division of meiosis. Chromosome division ceases at the stage from prometaphase I to anaphase I, and the second division of meiosis is omitted.

272

I. N. GOLUBOVSKAYA

The ms(l)RD7 mutation gives rise to deficient spindles both in the first and second division of meiosis. Abnormal chromosome behavior reminds the abnormal disjunction of chromosomes induced by colchicine. The rns(1)526 mutation affects spindle organization in the second division. All these mutations produce sterility only in male. In maize the dv (divergent) gene was discovered by Clark (1940). It is responsible for spindle abnormalities and is inherited as a monogenically recessive character. In plants homozygous for this gene meiosis is normal until the spindle is formed during the first meiotic division. Although the bivalents regularly coorient themselves at the equator, their separation is impaired; they separate irregularly into several groups at anaphase 1 and do not gather into nuclei at telophase I. The spindles have a aberrant divergent shape, not a convergent one. At the end of the first meiotic division, two cells are formed from a microsprocyte, and several nuclei of different size are seen in each. The second meiotic division is synchronous in all the nuclei of both daughter cells. After the second division, polyads with micro- and macronuclei arise instead of tetrads of microspores. Spermatogenesisproceeds normally in the various microsporocytes; however, pollen grains with different numbers of chromosomes may be encountered; dvldv plants are characterized by partial male and female sterility. In 1975, a ms-43 mutation similar to the dv mutation described by Clark (1940), was induced by N-nitroso-N-methylurea (Golubovskaya, 1977). Genetic analysis has demonstrated that it is controlled by a single recessive gene. Plants homozygous for this gene have fertile ears and completely sterile pollen. A meiotic pattern typical of this mutant is depicted in Fig. 5 . As in the dv mutant, meiosis is normal until metaphase I of meiosis; there is also no failure in pairing. It is only at anaphase I that meiotic irregularities appear; all 20 chromosomes remain in the center of the cell, having freed themselves of chiasmata, or they separate into groups of 10 to the opposite poles without assembling into nuclei; they may also be randomly scattered in the cell. These abnormalities seem to be directly related to structural and functional impairment of the spindle. Screening for meiotic mutants induced by ultraviolet radiation in a wild-type strain of P. anserina has resulted in the identification of 40 mutants with disturbed meiosis and 2 with abnormal karyogamy (Simonet and Zickler, 1972). The aberrant patterns of 18 of these mutants have been examined with light and elechdn microscopes. It has been found that the mei-4 and mei-5 genes (795) according to the designation of Simonet and Zickler (1972) cause abnormalities in the spindle apparatus. The rnei-4 gene has been located on the fourth linkage group. Under the influence of this gene, the centrosomal plaque to which the spindle threads are attached is seven to eight times longer than that in the wild type. The recombination frequency of all the genes located in the sixth linkage group is also increased under the influence of this gene. The mei-4 gene has two alleles.

GENETIC CONTROL OF MEIOSIS

213

FIG.5 . The meiotic cytological behavior of chromosomes in maize (Z. mays) homozygous for the ms-43 recessive mutation causing functional disturbance of the spindle apparatus. (a-b) Meiosis proceeds normally until diakinesis-metaphase I; 10 regularly pairing bivalents appear at diakinesis and metaphase I. (c) Anaphase I; impaired chromosome separation. (d) All 20 chromosomes lie randomly in the cell. (e) Twenty chromosomes remain immobile in the center of the cell. (0 Ten chromosomes have passed to each pole, but nuclei are not formed. (g) Chromosomes (single or in groups) condense into nuclei of different sizes. (h) The cell wall is distinct, although the chromosomes remain at anaphase I. (i-j) Prometaphase I1 and MII; some chromosomes are not oriented at the spindle plate. (k) General appearance at late meiotic stages; some of the PMCs have formed tetrads, while others am delayed at metaphase I or anaphase I. (1) a m i c r o s p a d with three nuclei of different size resulting from abnormal meiosis. Prophase I-MI, x660; prophase 11-TII, x330; tetrads, X 120; microsporads, x 120 or 330.

The mei-5 gene produces abnormal centrosomal plaques (thicker than normal, contiguous with respect to the nuclear envelope, and not perpendicular) to which the spindle threads are attached, and also an abnormal ultrastructural appearance of spindle microtubules. Both mei-4 and mei-5 mutations produce sterility. Abnormal chromosome behavior caused by the claret mutation in Drosophilu

274

I. N. GOLUBOVSKAYA

simulans was described by Sturtevant (1929). The claret gene is located on the third chromosome. The claret mutation of D . simulans has several specific features. Females homozygous for this gene are semisterile, and their offspring contain a large number of aneuploid flies and mosaics for chromosome number. Sturtevant (1929) and Wald (1936) have given a complete account of their analyses of the effects of the claret gene. In 1962, a similar mutation was induced by x-ray treatment in D . melanogaster (Lewis and Gencarella, 1952). It was located on the third chromosome and was allelic to the earlier established claret mutation which affects eye color. This allele has been designated cand (claret nondisjunction) because it causes nondisjunction of the X and the fourth chromosomes. It is interesting to note that the ca mutants of both Drosophila species, along with aneuploids, contain a large number of mosaics. Cells differing with respect to chromosome set number were observed within the same tissue of an individual. Having analyzed these flies, Sturtevant determined that either one-half or onequarter of the fly’s body was mosaic. Simultaneous nondisjunction of the X and fourth chromosomes was also noted. This was manifest in aneuploid individuals and in individuals mosaic for chromosome set number (Sturtevant, 1929; Davis, 1969). In both Drosophila species, chromosome nondisjunction in the first meiotic division gave rise to aneuploid individuals, while that occurring at the early stages of cleavage produced mosaics. That the issue of chromosomal nondisjunction depends on the time when it occurs during nuclear division has been established for D . simulans (Sturtevant, 1929); using the same genetic technique, Davis (1969) demonstrated that this was also true for D. melanogaster. Chromosome nondisjunction and subsequent elimination have been attributed to spindle disturbances in D. simulans fenales homozygous for the ca gene (Wald, 1936). The sc is present at prophase I in females homozygous for the cand gene (Rae and Green, 1976). It should be emphasized that crossing-over is normal both in cand D. melanogaster and ca D . simulans females.

2 . Precocious Meiotic Centromere Division A meiotic mutation with precociously disjoining centromeres was described in a population of Lycopersicon esculentum by Rick and subsequently studied by Clayberg (1959). This abnormality is under the control of a single recessive gene, symbolized pc. The mutants do not differ from normal unit metaphase I of meiosis. The first abnormalities appear at anaphase I; cells with one or several separated chromatids at the poles occur very seldom. The centromeres of the sister chromatids seem to divide at interkinesis, judging by the fact that only chromatids are seen in both nuclei at prophase I. However, it is interesting that chromatids orientate themselves in pairs at the spindle plate. In spire of their regular orientation at anaphase 11, the chromatids pass randomly to one pole and to the other.

GENETIC CONTROL OF MEIOSIS

275

Sporads containing two to six cells are formed instead of regular tetrads. Plants homozygous for pclpc contain only 0 to 10% fertile pollen grains and eggs. mei-S332a is a mutation similar to the pc mutation. It is semidominant and located on the second chromosome at 36 map units in D . melanogaster (Sandler et al., 1968). It produces chromosome nondisjunction in the second division of meiosis. The gene concerned has been studied in detail and located by Davis (1971). Its major effect is the precocious division of centromeres. This results in irregular disjunction in the second division and chromosome loss in both sexes. Each chromosome pair acts alone, almost independently of the influence of other pairs. Gametes devoid of chromosomes were estimated to occur in the following approximate ratios: 0.20 nullogametes, 0.12 diplogametes, and 0.68 regular gametes. The mei4332 mutation results in progeny containing mosaics. This gene has no effect on crossing-over. 3 . Other Mutations Affecting Chromosomal Nondisjunction nod is a recessive mutation located on the X at a position of 36 map units. Manifest only in D . melanogaster females, it causes a high frequency of chromosomal nondisjunction in the first meiotic division. The gene was found to have no effect on crossover frequency. Nondisjunction has been observed only in chromosomes that have not undergone exchange in the first division of meiosis (Baker and Carpenter, 1972; Carpenter, 1973). The nod mutation acts in a specific manner, so that only distributive chromosome pairing, postulated by Grell (1962a,b), is affected in D . melanogaster females. In Drosophila, the mei-GI7 mutation is located on the second chromosome, in the distal part of the 2R arm.It produces nondisjunction of all the chromosomes in the second division. Its effect is confined to males (Gethmann, 1974). Viewed broadly, it may be concluded that genes of this group do not seem to affect pairing and crossing-over. These genes somehow act through impaired chromosome disjunction, each affecting meiosis in its own way. Thus the spindle apparatus is disturbed by a mutation of claret type in two Drosophila species, and by the seven mutations detected by Lifschytz and Meyer (1977) in D . melanogaster males, as well as by mei-4 and mei-5 mutations in P . anserina. The abnormalities produced by the mei-S-332a mutation in D . melanogaster and the pc mutation in L . esculentum result in failure of the centmmeres of the sister chromatids to disjoin precociously at anaphase I-prophase I1 of meiosis, while those caused by the nod mutation affect specific features of the meiotic cell.

F. MUTATIONS INTERFERING WITH THE BEHAVIOR OF SINGLE CHROMOSOMES Besides genes exercising a general control over chromosome behavior in meiosis, there exist genes governing the behavior of single chromosomes during meiosis. Several mutations in such genes have been established.

276

I. N. GOLUBOVSKAYA

A desynaptic ds mutation has been described in a wild population of Hypochoeris radicara L. (Compositae). It results in the desynapsis of 90% of pollen mother cells of a single chromosome pair, the fourth. This indeed remarkable pattern of univalence is controlled by a single recessive gene, ds, with presumably a chromosome specific effect, not one acting on the whole chromosome set (Parker, 1975). The eq (equational producer) gene is located at one of the ends of the X chromosome in D . melunogaster. It causes the nondisjunction of the X chromosomes at the second division of meiosis in females (Sandler et al., 1968). The recessive mei-G-87 gene is localized to the second chromosome in D . melanogasfer. It causes nondisjunction of this chromosome at anaphase I1 in both sexes (Gethmann, 1974). Disclosure of the mechanisms of the eq and mei-GB7 genes would clarify the specific behavior of the supernumerary B chromosomes in mitotic spermatogonial cells, as well as their behavior in postmeiotic plant cells. The behavior of the centromeres of B chromosomes in heterozygous translocations between A and B chromosomes in maize should provide needed clues too. In the course of sperm formation, nondisjunction of the centromeres of B chromosomes during the second mitotic division gives rise to two genetically nonidentical sperms in the pollen grains, one carrying both B centromeres and the other none (Bumham, 1962). The pal mutation, induced by EMS in D . melanogaster, deserves special consideration. It is located on the second chromosome at 35.7 map units. The effect of this gene is unique in that pal homozygous males are devoid of the paternally derived chromosomes in meiosis, most frequently the X and the fourth. The mutation also results in somatic elimination of chromosomes. Like the cand gene, the pal gene is operative at meiosis and mitosis of cleavage (Baker, 1975). Evgen’ev’s (1977) experiments with interspecific Drosophilu virilis x D. littoralis hybrids offer some suggestions concerning chromosome elimination. Having described, in general outlines, the genetic system of the genome of D . virilis, which controls elimination of the sixth chromosome in D . littoralis during cleavage, Evgen’ev and co-workers established a causal relationship between changes in the duration of replication of the D . littoralis sixth chromosome and its elimination from the cytoplasm of D . virilis during cleavage. The factor altering the replication pattern of the D . virilis sixth chromosome resides in the nonhomologous D . virilis chromosome (Evgen’ev and Sidorova, 1976; Evgen’ev and Gubenko, 1977). Baker and Carpenter (1972) described 20 mutations located on the X chromosome. They cause nondisjunction of the X and fourth chromosomes, but their mode of action is unclear. What is certain is that they operate in females only. The recessive mei-1 gene has been located on the third chromosome. It is concerned with recombination of only the X chromosome and decreases total recombination frequency by half. According to measurements made of the entire X chromosome, the mei gene sharply decreases recombination frequency in the

GENETIC CONTROL OF MEIOSIS

277

target region surrounding the ct gene and, to a less extent, either decreases or increases it in the centromere region. The presence of the mei-2 gene produces a threefold increase in nondisjunction of the X chromosome in females, as compared with the control values. X-ray and EMS treatment reduces recombination frequency in the same region of the X chromosome (Valentin, 1973). OF MEIOSIS G. GENESCAUSING LOSS OR IMPAIRMENT OF THE SECONDDIVISION

Mutations of this kind have been established in plants. The dy mutation was initially observed in 1931. In Duturu strumonium plants, homozygous for the dy gene, the first division of meiosis does not differ in any respect from the normal. Twelve bivalents are formed at metaphase I; these regularly pass to the c o m sponding poles, and the nuclei are separated by a cellular membrane at telophase I. The second meiotic division does not take place in the mutant plants. Instead of tetrads, dyads arise, hence chromosome sets are doubled in the MPC’s (2n = 24). Ploidy increases with each subsequent generation (Satina and Blakeslee, 1935). The effect of the recessive el gene is similar to that of the dy gene (Rhoades and Dempsey, 1966b). In ears of mutant maize, homozygous for the el gene, well-filled kernels are encountered among rows of shriveled kernels. The plump kernels give rise to diploid plants. Although a significant portion of the shriveled kernels fail to germinate, chromosome counts, still feasible in some root tips, have established that 82% are triploids with 2n = 30, and that 18% have chromosome numbers ranging from 24 to 33. Since all the eggs of mutant plants possess a nonreduced chromosome number, only the haploid pollen is capable of functioning. According to Rhoades and Dempsey (1966b), the most likely cause of the appearance of nonreduced gametes is a disturbance in the second division of meiosis. However, in mutant maize, the second division of meiosis is not arrested, as in D. strumonium, homozygous for the dy gene, as indicated by the normal anaphase II and telophase I1 in ellel plants. If may be that cytokinesis is perturbed after telophase 11. Another possibility considered by Rhoades and Dempsey (1966b) is additional DNA replication during the interphase between the first and second divisions. The el gene has no effect on chromosome pairing or recombination. Evidence supporting this latter possibility was obtained by analyzing the frequencies of recombination between genes belonging to different linkage groups: sh and wx on the ninth chromosome, lgz and uz on the third chromosome, and ws2, Igl, and g12 on the second chromosome. In all the cases examined, the recombination values were within the normal range. Besides causing nonreduction in eggs, this mutation affects coilmg at the fmst and second divisions. Uncoiled chromosomes appear longer than normal and, for this reason, the gene concerned has been termed elongate (et).

278

I. N. GOLUBOVSKAYA

The el mutation has been used extensively for wide-scale production of polyploids in maize (Alexander, 1957). Mutations with comparable effects have been found in rye (Sosnikhina, 1973).

H. OTHER CASES OF MEIOTICGENE CONTROL OF CHROMOSOME BEHAVIOR The va gene determines the absence of cytokinesis in meiosis. It has been identified by Emerson and investigated by Beadle (1932). There is a large variation in the number of sterile pollen grains (27-100%) in plants homozygous for the VQ gene. In spite of another scmity, pollination is still feasible. Female fertility is very low. The character is transmitted as a monogenic recessive. The gene concerned is located on the seventh chromosome in the following sequence: va (ll%)-gl (6-7%)-v5 (Beadle, 1932; Jones, 1959). The prophase of the fust division and pachytene do not deviate from the normal, and 10 bivalents are seen at diakmesis, metaphase I and anaphase I are normal too. The deviations make their appearance at telophase I. Cell membranes dividing the nuclei, the normal concomitants of this stage, fail to appear in va homozygotes. The formation of these membranes may be disturbed either in the first or in the second division. A new type of meiotic mutation has been induced by N-nitroso-N-methylurea in maize. It drastically modifies the normal pattern of chromosome behavior. The recessive pam-A344 gene is responsible for these changes (Golubovskaya and Mashnenkov, 1977) (Fig. 6). The coordination of meiosis is lost in Pam mutants: (1) a large number of plasmodia1 cells with 2 to 14 nuclei (about 20%) enter meiosis together with uninuclear mother pollen cells; (2) having begun simultaneously in all cells, meiosis becomes asynchronous after prophase I; (3) from prophase I and onward, the chromatin of the pollen mother cells undergoes degradation, judging either by nuclear pycnosis (8.1%of the total number of pollen mother cells) or by chromatin lysis (1.1% of their total number); (4) each cell of an anther completes its own meiotic program. Cytokinesis does not occur in 9.5%of the pollen mother cells during the first and second divisions, and in 9.0%of the cells meiosis is replaced by mitosis. Desynaptic cells and spindle apparatus abnormalities are also observed. This meiotic mutation causes complete sterility in males and almost complete sterility in females. The ms(2R) gene has been identified in an EMS-treated Canton S stock of D. melanogaster where it causes loss of cytokinesis, a normal meiotic event, in primary spermatocytes; the sperm, immobilized by the effects of the ms(2R) gene, is unable to penetrate into the egg (Romrell et a f . , 1972). The three maize mutants of P. sativum have been characterized by desynapsis associated with decreased chiasma number per bivalent in the nonpaired chromosomes at metaphase I, as well as by chromosome fragmentation at anaphase of

GENETIC CONTROL OF MEIOSIS

279

FIG.6. The meiotic cytological behavior of chromosomes in Z. mays microsporocytes homozygous for the. recessive pam-A3444 mutation. (a-d) Polynuclear cells (cenocytes) entering meiosis. (a) Pachytene. (b) Diakinesis. (c) Metaphase I. (d) Telophase I; each nucleus behaves independently at all these stages. (e-f) Lysis of chromosomes in polynuclear cells. (g-h) Pycnotic degradation of the nuclei. 6)Chromosomes adhere tightly to the cell wall; they do not assemble into a daughter nucleus. (k) Chromosome disjunction is disturbed and cytokinesis is lost. (m) A cell in which first meiotic division has been omitted. (n) Microsporads differing in size and nucleus number. Prophase I-MI, x 6 6 0 ; prophase II-TII, ~ 3 3 0tetrads, ; X 120; microsporads, X I 2 0 or 330.

280

1. N. GOLUBOVSKAYA

the first division, as a consequence of chromosome breakage and reunion at prophase 1of meiosis. The three mutations are controlled by nonallelic recessive genes (Klein and Baquar, 1972). The mu (multiploid) gene has been discussed in barley Hordeum vulgare (Smith, 1942). Its presence causes the appearance of polyploid microspomytes at meiosis. At diakinesis anthers exhibit single cells with 7 bivalents and plasmodium-like masses of various sizes in which chromosome groups of 7 bivalents are either scattered or coalesce to form sets of 14, 21, 28, 35, or even more bivalents. The number of bivalents in such groups is a multiple of 7. The function of the spindle apparatus is disturbed. In such mutant plants, the pollen grains are of various sizes and devoid of stmh. It is noteworthy that mitotic division is normal in the cells of the roots and the tapetum. Smith (1942) has tentatively ascribed this abnormality to the delayed formation of cellular enwith comparable effects velopes during premeiotic mitoses. A mutation (ms-mu) has been found in barley by Sharma and Reinbergs (1972). 111. Conclusions

Any generalizations will be made after the salient features of meiotic mutations diagrammed in Fig. 1 and those listed in Table I11 are commented upon. What is the extent and magnitude of the action of meiotic mutations? There are genes which block the first and second divisions (am), genes allowing meiosis but replacing the first meiotic division with mitosis (afd)while not affecting the second division, and other genes which arrest the second division (dy). The majority of genes do not turn the meiotic process entirely off, they rather interfere with its distinct steps. This may be an indication that the fust and second divisions of meiosis are under autonomous genetic control and also strongly suggests that genetic mechanisms switch division programs from mitotic to meiotic in eukaryotes. The am gene may function in this way, its product possibly being required at the early meiotic stage for DNA metabolism to follow a meiotic course. There are no exact estimates of the time needed for this to occur. However, cytogenetic analyses of meiotic mutations, affecting premeiotic mitoses and meiosis @amA334), indicate that a preliminary preparation for meiosis quite likely takes place during the last two to three premeiotic mitoses. These differ from the normal mitoses of somatic cell cycles in that they are prolonged from 25 hours to 35-55 hours (Bennett, 1977; Dover and Riley, 1977). From comparisons of the meiotic mutations listed in Table III it follows that these genes act in a steplike manner. The am gene turns meiosis off; the us and c3G genes suppress the development of sc, pairing, crossing-over, and disjunction; the ord gene disrupts the structure of the sc, drastically decreases crossing-

TABLE I11 A COMPARIWN OF MEIOTICABNORMALITIES IN MEIOTIC MUTANTS Cytogenetic eventsn

Gene symbol

Entrance into meiosis

sc formation

Chromosome pairing

Crossing-over

Chromosome disjunction

Species

Reference

-

significantly abnormal

Z . muys D . melanogaster, T . durum

Significantly abnormal Abnormal

Z . mays

Palmer (1971b) Gowen (1928. 1933); Htnton (1966) Martini and Bozzini (1966); La Cow and Wells (1970) Mason (1976); Baker e f al. (1976b); Lindsley and Sander (1977) Golubovskaya and Mashnenkov (1976) Baker and Carpenter (1972); Carpenter and Baker (1974); Baker er al. (1976) Baker and Carpenter (1972); Carpenter and Baker (1974); Baker et al. (1976) Baker and Carpenter (1972); Carpenter and Baker (1974); Baker et al. ( 1976) soost (1951); Moens (1969)

-

-

am c3G

Chiasma formation

US

ord

Abnormal

?

7% of normal value

?

dv-A344

Abnormal

Abnormal

?

Abnormal

mei-9

Normal

?

Decreased

?

Abnormal

D . melanogasfer

mei-rll

Normal

?

Decreased

?

Abnormal

D . melanogasfer

mei-281

Normal

?

Decreased

?

Abnormal

D . melanogasfer

Desynaptic

Normal

Normal

Normal or decreased

Abnormal

Abnormal

ClPd

Normal

Normal

Normal

?

Abnormal

Lycopersion esculentun; and see Table U D . melanogaster

(I

-. Arrested; +, not arrested;

?, no data.

D . melanogusfer

Davis (1969); Rae and G m n (1970)

282

1. N. GOLUBOVSKAYA

over, and impairs disjunction. The genes which exert an effect on recombination are indifferent to the development of the sc and chromosome pairing, but alter crossing-over and disjunction (mei-9a, mei-96, mei-41, mei-218, meLS282). Other genes do not interfere with meiosis until the homologous chromosomes start to disjoin (dv, candlnod, mei-S332u, p c ) . These comparisons of meiotic mutants make it possible to distinguish between primary and secondary abnormalities caused by mutations in different genes. Clearly, in asynaptic mutant plants and Drosophila females homozygous for the c3G gene, failures of pairing and crossing-over are secondary events related to the absence of the sc. In desynaptic mutants, the primary cause of nondisjunction of homologs is an earlier event than normal chiasma terminalization. Chromosome nondisjunction in an array of mutants is directly caused by abnormal shifts of chromosomes in the cell, by impaired function of the spindle apparatus [mei(1)516 through mei-RD1.5, cund, d v ] , or by abnormal behavior of centromeres and other specific cytogenetic factors @c, mei-S322u, nod). Finally, comparisons of meiotic mutations reduce meiosis to elementary units each of which is under specific genetic control. The blocking of steps of meiosis precludes its subsequent completion. How this occurs will remain conjectural until a large variety of meitotic mutations has been described. The other intriguing question is: What would the meiotic pathway be like in a double homozygote? Three pathways may be envisaged: (1) meiosis in a double homozygote conforms to that of one of the meiotic mutants; (2) it conforms to that of the other meiotic mutant; (3) it follows a new pathway resulting from the interaction of the two genes. A double homozygote was developed to test these possibilities (Golubovskaya, 1977). The mutations involved were ufd, which totally replaces the first division of meiosis by mitosis, and dsy-A344, which produces an abnormality in the sc, disturbing chromosome pairing. Meiosis in this double homozygote proved to be of the ufd type, because the F2 self-pollination of (+/dsy +/afd) plants segregated in a ratio of 9/16 plants with normal meiosis to 4/16 plants with meiosis of the ufd type to 3/16 plants with the dsy type. It is conceivable that the afd gene is switched on earlier than the dsy gene during meiosis. To ensure normal meiosis from the ufd+ gene-controlled step to that under the control of dsy+, a product of the gene ufd' is needed. In this vein, it may be assumed that it makes meiosis follow a deviant course cytologically expressed as replacement of the first meiotic division by mitosis. Other meiotic mutants can serve as points plotted on a genetic flowchart depicting the sequential switching on of meiotic genes. Chromosome behavior appears to be controlled at two levels. There seems to exist a group of genes controlling the behavior of all the chromosomes in the nucleus and another group that controls the behavior of single chromosomes. Although several genes specifically affect the behavior of single chromosomes, they are concerned with various events. The mei-l gene affects recombination in D. melanogaster (Valentin, 1973), and

GENETIC CONTROL OF MEIOSIS

283

the ds gene interferes with chiasma formation in H . radicata (Parker, 1975). Disjunction abnormalities are caused by genes such as the meiG87 gene which governs the behavior of the second chromosome (Gethmann, 1974) and the eq gene governing that of the X chromosome in D . melanogaster (Schult, 1934, cited by Sandler et al., 1968). These may be just instances when “the chromosomes do not obey the laws of genetics: they make them” (Darlington, 1977, p. 187). Genes exerting a general control over chromosomes during meiosis must have access to the “active centers” of the chromosomes that respond to commands. Chromosomes with deficient active sites may be likened to “draft dodgers” evading the command to enlist. The genes mentioned may be responsible for active site deficiencies. The X chromosome is the one that most frequently frees itself from control of the nucleus. There are vivid examples of this sort of liberation. Lemmings of the species Myopus schisticolor regularly occur as XX and XY females, indistinguishable phenotypically but differing with respect to karyotype. A confounding observation is that the somatic sex chromosome constitution is XY in XY females, while it is XX in the meiotic cells at diakinesis. Fregda e l al. (1976) have postulated that the X chromosomes fail to disjoin and that the Y chromosome is eliminated during meiosis. An essentially similar pattern has been described for another species of D . rorquarus (Gileva, 1978). The genetic system regulating the bizzare behavior of sex chromosomes in the lemming operates during premeiotic mitosis. This has prompted the suggestion that similar mechanisms underlie elimination of the Y and nondisjunction of the sixth chromosome of hybrids between D . virilis and D . littoralis (Evgen’ev and Sidorova, 1976; Evgen’ev, 1977; Evgen’ev and Gubenko, 1977). By pursuing investigations along evolutionary lines, it will be possible to broaden our understanding of meiotic mutations. What mechanisms have arrested meiosis in the plant and animal kingdoms? The list of organisms with achiasmate meiosis is impressive (John and Lewis, 1965; White, 1965, 1973). Among Lepidoptera females, achiasmate meiosis occurs in the genera Cidaria and Galleria, and among Diptera it is encountered in males of the families Phryneidae, Bibionidae, Chironomidae, and Tupulidae. The only plant species groups in which achiasmate meiosis has been established is Fritillaria (Noda, 1975). This group comprises six species, F . koidzumiana (2n = 24), F . shikokiana (2n = 24), F . kaiensis (2n = 24), F . muraiana (2n = 24), F . japonica (2n = 22), and F . amabilis (2n = 22), which are endemic to the central and western regions of Japan. The flowers of all these species are hermaphrodites. Achiasmate meiosis is characteristic of only the developing microsporocytes of the anthers. Egg formation in the embryo sacs is associated with regular meiosis and chiasma formation. Viewing achiasmate meiosis in evolutionary retrospect, Noda (1975) has treated it as an event appearing later than chiasmate meiosis with meiotic cryptic refinements evolving between the two chiasmate and achiasmate extremes. The achiasmate system is common to the animal and

284

I. N. GOLUBOVSKAYA

plant worlds. Organisms with achiasmate meiosis must have been endowed with a specific faculty to keep the homologs together. Based on achiasmate meiosis, all species may be divided into two groups. The first group has a normally developed sc at prophase I of meiosis. It includes the male of the scorpion fly, Panorpa nuptilans (Gassner, 1967), the male of a mantid species, Boble nigra (Gassner, 1969), and females Bombyx mori and Cidaria (Lepidoptera)(Rasmussen, 1977a,b; Sorsa and Suomalainen, 1975). The fate of the sc during achiasmate meiosis in B. mori has been closely followed by Rasmussen (1977a,b). The sc does not disappear after pachytene, but still exists in the guise of an ultrastructurally modified organization in the bivalents until metaphase I. It is only after metaphase 1 that the bivalents lose the sc, which is observed in the cytoplasm as eliminated chromatin. These observations gave rise to the belief that the absence of crossing-over and chiasmata, required for chromosome disjunction to occur normally, is compensated by the sc,modified as it is after prophase I, that keeps the homologs together until anaphase I. It may be further assumed that, in cases of this kind, amst of crossing-over is caused by mutations affecting recombination but not the sc (mei-41, mei-9, and mei-218); in these organisms, mutations arresting development of the sc (as and c3G) should have the same effect in homogametic and heterogametic sexes. Yet another group of species with achiasmate meiosis is characterized by the absence of the sc at prophase I of meiosis. This group comprises males of the D . melanogaster, Tipulia caesia, and Phryne fenestralis (Meyer, 1965), as well as males of Eusimulium aureum (Simuliidae) (Rothfels and Mason, 1975). The known meiotic mutations do not produce anything reminiscent of this type of achiasmate meiosis. The achiasmate meiosis characteristic of D.melanogaster is an imitation of normal meiosis, lacking the sc, crossing-over and chiasmata and retaining merely the division of centromeres at anaphase 11. With the sc missing, how can every chromosomes associate faultlessly at prophase I of meiosis and disjoin at anaphase I? It may be conceded that a mechanism has evolved similar to that in holocentric chromosomes. A good example is the plant Luzula campestris. Meiosis in this species is exceptional in that, after normal chromosome pairing, crossing-over, and chiasma formation at prophase I, the centromeres of the nonsister chromatids of each homolog pass poleward at anaphase I; to provide regular disjunction during the second division of meiosis, these chromatids reunite for a short time at prophase I1 (Nordenskiold, 1961; Kiknadze and Vysotskaya, 1975). It may be thought that the genetic pmgram of achiasmate meiosis without a sc is basically different from that underlying regular meiosis. It is known that the c3G gene manifests itself in females but not in homozygous males; the mei-81 gene interferes with the pairing of spermatocytes of the fust order and is inconsequential in females. Meiotic genes, which interfere with the structure and function of the spindle apparatus during the fust and second meiotic divisions in D . melanogaster males, do not affect meiosis in the

GENETIC CONTROL OF MEIOSIS

285

females of the species (Lifschytz and Meyer, 1977). Only the centromeres of both chiasmate meiosis of females and a chiasmate meiosis of males are under common genetic control; an example is the mei-S332a gene, which causes precocious disjunction of the centromeres of sister chromatids and affects meiosis in both sexes. The only gene which interferes with the first division in females and males in D. melanogaster is the ord gene; it seems to accomplish this effect through a precocious division of centromeres. Would further identification of meiotic mutations unshroud the mystery of achiasmate meiosis? Because retention of reproductive characters shaped by natural selection is advantageous for apomictic plants and parthenogenetic animals, they manage well without meiosis. The absence of chromosome number reduction, hence the absence of recombination of chromosomes is inherent in apomictics. This is the consequence of arrested first division of meiosis, a feature of genera with semiheterotypic division [Ixeris dentata, Taraxacum, Chondriella, and Balunophora japonica (Gustafsson, 1946; Petrov, 1964; Solntdva, 1969)l. Meiotic behavior of chromosomes (irregular pairing, chiasma formation, and homologs passing to the poles) is aberrant during semiheterotypic division, and more so during pseudohomotypic division [Erigeron, Taraxacum, Euhiearium, Antennaris, and Potentilla verna (Gustafsson, 1946; Petrov, 1964; Solntzeva, 1969)], in which the first division is almost completely reduced. And finally, in apomictically reproducing plants, meiosis is entirely replaced by mitosis in Eupatorium glandulosum, Arnica, Poa alpina, and Calamagrostis, for example (Gustafsson, 1946; Petrov, 1964; Solntzeva, 1969). The meiotic features of parthenogenetic vertebrates and invertebrates have been well described in the literature (Astaurov, 1966, 1967; Uzzel, 1970; Cimino, 1972). In most species reduction is abolished as a consequence of cytokinesis arrest during premeiotic mitoses, which causes cells with a doubled chromosome number to enter meiosis [Amblistoma platineum and A . tremblui (3n = 72) and several triploid parthenogenetic fish species, Poeciliopsis monacha 2 lucida]. However, there are parthenogenetic animal species in which the first division is either entirely (Curussius auratus gibelio and Daphnia pulex) or partly blocked, crossing-over and disjunction of homologous chromosomes (Poeciliopsis C,) (Uzzel, 1970). Astaurov and co-workers have developed experimental techniques for blocking meiosis in females of the mulberry silkworm. These females produce ameiotic parthenogenetic offspring.Experimental studies with B . mori have theoretical as well as practical implications because they help to regulate sex ratios in this species (Astaurov, 1966, 1969, 1974; Terskaya and Strunnikov, 1975; Strunnikov, 1978). The examples mentioned indicate that evolving organisms at various organization levels have used the arrest of certain meiotic steps to replenish the reservoir of genetic variation.

286

I. N. GOLUBOVSKAYA

Some questions remain. What are the distinguishing features of the two types of meiosis in apomictic plants? What are the meiotic patterns of parthenogenetic animals? Comparative ultrastructural investigations of meiotic mutants and apomictics will hopefully provide meaningful answers. The next question involves mitosis occurring in the sporogenic tissues of apomictics. conceivably, only two monogenic mutations are sufficient for a change from meiosis to mitosis. This can occur under the influence of mutations of the ufd type, substituting mitosis for the first meiotic division, and of the dy type, completely arresting the second division. No matter how tempting models may appear, they never provide “a picturesque denouement” of all the uncertainties. This particularly concerns meiosis, a problem yet to be solved with the aid of meiotic mutations.

ACKNOWLEDGMENTS The author expresses sincere thanks to Professor I. 1. Kiknadzc for critically reading the manuscript, and to A. Fadeeva for translating it from Russian into English.

REFERENCES Ahloovalia, B. C. (1967). Mufar. Res. 7, 205. Alexander, D. E. (1957). Agron. J . 49, 40. Astaurov, B. L. (1966). In “Actual Questions of Modem Genetics,” p. 65. “MGU,” Moscow (in Russian). Astaurov, B. L. (1969). Annu. Rev. Gener. 3, 99. Astaumv, B. L. (1974). In “Heredity and Development” (P. F. Rockitsky, ed.). “Nauka,” Moscow (in Russian). Baker, B. S. (1975). Genetics 80, 267. Baker, B. S., and Carpenter, A. T. C. (1972). Genetics 71, 255. Baker, B. S.. and Hall, J. C. (1976). In “The Genetics and Biology of Dmsophila” (M.Ashbumer and E. Novitski, eds.), Vol. 1A. Academic Press, New York. Baker, B. S . , Boyd, J. B., Carpenter, A. T. C., Green, M. M.. Nguyen, T. D., Ripoll, P., and Smith, P. D. (1976a). Proc. Narl. Acad. Sci. U.S.A. 73, 4140. Baker, B. S., Carpenter, A. T. C., Esposito, M. S., Esposito, R. E., and Sandler, L. (1976b). Annu. Rev. Genet. 10, 53. Beadle, G. W. (1930). N.Y. Agric. Exp. S m . , Irhaca. Mem. 129, 1. Beadle, G. W . (1932). Cyiologia 3, 142. Beadle, G. W. (1937). Cytologia (Fujii Jubilee Vol.) p. 43. Beasley, J. 0..and Brown, M. S. (1942). J . Agric. Res. 65, 421. Bennett, M. D. (1977). Philos. Trans. R. SOC. London, Ser. B 277, 201. Bergner, A. D., Cartledge, J . L., and Blakeslee, A. F. (1934). Cytology 6, 19. Bogdanov, Yu.F. (1975). In “Cytology and Genetics of Meiosis” (V. V. Khvostova and Y. F. Bogdanov, eds.), p. 58. “Nauka,” Moscow (in Russian).

GENETIC CONTROL OF MEIOSIS

287

Boyce, R. P., and Howard-Flanders, P. (1964). Proc. Natl. Acad. Sci. U.S.A. 51, 293. Boyd, J. B., Golino, M. D., Nguyen, T. D., and Green, M. M. (1976a). Genetics 84, 485. Boyd, J. B., Golino, M. D., and Setlow, R. P. (1976b). Genetics 84, 527. Burnham, C. R. (1962). “Discussion in Cytogenetics.” Burgess, Minneapolis, Minnesota. Carpenter, A. T. C . (1973). Genetics 73, 393. Carpenter, A. T. C., and Sandier, L. (1974). Genetics 76, 453. Catcheside, D. G. (1939). New Phytol. 38, 323. Chao, C. Y., and Hu,W. L. (1960). Bot. Bull. Acad. Sin. 1, 29. Cimino, M. C. (1972). Evolution 26, 294. Clark, E. J. (1940). Am. J . Bot. 27, 547. Clayberg, C . D. (1959). Genetics 44, 1335. Comings, D. E., and Okada, T. A. (1970). Nature (London) 227, 451. Darlington, C. D. (1929). J. Genet. 21, 207. Darlington, C. D. (1932). Am. Nar. 66, 25. Darlington, C. D. (1977). Philos. Trans. R . Soc. London. Ser. E 277, 185. Davis, B. K. (1971). Moi. Gen. Genet. 113, 251. Davis, D. G. (1969). Genetics 61, 577. Dover, G. A., and Riley, R. (1977). Philos. Trans. R. SOC. London. Ser. B 277, 313. Dyck, R. L., and Rajhathy, T. (1965). Can. J. Genet. Cyrol. 7, 418. Ehrenberg, C. E. (1949). Hereditas 35, 1 . Enns, H., and Larter, E. N. (1960). Can. J. Plant Sci. 40, 570. Enns, H., and Larter, E. N. (1962). Can. J. Genet. Cytol. 4, 263. Evgen’ev, M. B. (1977). Ph.D. Thesis, Novosibirsk (in Russian). Evgen’ev, M. B., and Gubenko, I. S . (1977). Chromosoma 63, 89. Evgen’ev, M. B., and Sidorova, N. V. (1976). Theor. Appl. Genet. 48, 5 5 . Ezhova, T. A., Balakireva, M. D., and Gostirnsky, S. A. (1977). Genetika 13, 424. Feldman, M. (1966). Proc. Natl. Acad. Sci. U.S.A. 55, 1447. Feldman, M. (1968). Proc. Int. Wheat Genet. Symp., 3rd, 1978, p. 169. Feldrnan, M., Mello-Sampaya. F.. and Sears, E. F. (1966). Proc. Narl. Acad. Sci. U.S.A. 56, 1192. Fredga, K., Gropp, A., Winking, H., and Frank, F. (1976). Nature (London)261, 225. Gassner, G. (1967). J. Cell Eiol. 35, 166A. Gassner, G. (1969). Chromosoma 26, 22. Gaul, H. (1954). Z. Indukt. Abstamm.- Vererbungsl. 86, 69. Gethmann, R. C. (1974). Genetics 78, 1127. Gileva, P. A. (1978). Proc. Int. Congr. Genet., 14th. 1978 (in press). Gillies, C. B. (1975). Annu. Rev. Genet. 9, 91. Gillies, C. B., Rasmussen, S. W., and von Wettstein, D. (1974). Coldspring HarborSymp. Quant. B i d . 38, 117. Golubovskaya, I. N. (1975). I n “Cytology and Genetics of Meiosis” (V. V. Khvostova and Yu.F. Bogdanov, eds.), p. 312. “Nauka,” Moscow (in Russian). Golubovskaya, 1. N. (1977). I n “All Union Society Geneticists and Breeders,” p. 112. “Nauka,” Leningrad (in Russian). Golubovskaya, I. N., and Mashnenkov, A. S. (1975). Generika 11, 7. Golubovskaya, I. N., and Mashnenkov, A. S. (1976). Genetika 12, 7. Golubovskaya, I. N., and Mashnenkov, A. S. (1977). Generika 13, 1910. Gottschalk, W. (1968). Nucleus (Caicutta) 11, 343. Gottschalk, W., and Baquar, S. R. (1971). Can. J. Genet. Cytol. 13, 138. Gottschalk. W., and Jahn, A. (1964). 2. Indukr. Abstamm.- Vererbungsl. 95, 150. Gottschalk, W., and Klein, H. D. (1976). Theor. Appl. Genet. 48, 23. Gottschalk, W., and Villalobos-Pietrini, R. V. (1965). Cytologia 30,88.

288

I. N. GOLUBOVSKAYA

Gowen, J. W.(1928). Science 68, 211. Gowen, 1. W. (1933). J. Exp. 2001.65, 83. Gowen, M. S., and Gowen, J. W. (1922). Am. Nat. 56, 286. Grell. R. F. (1962a). Proc. Natl. Acad. Sci. U.S.A. 48, 165. Grell, R. F. (1962b). Generics 47, 1737. Grell, R. F.,Bank, H., and Gassner, G. (1972). Nature (London), New Biol. 240, 155. Gustafsson, A. (1946). Lunds Univ.Arsskr. 1, 1. Hall, J. C. (1972). Generics 71, 367. Hardley, H. H., and Starnes, W.J. (1964). Crop Sci. 4, 421. Hinton, C. W. (1966). Generics 53, 157. Hinton, C. W. (1970). Genetics 66, 663. Hotta, Y., and Stem, H. (1971a). 1.Mol. Biol. 55, 337. Hotta, Y., and Stem, H. (1971b). Dev. Eiol. 26, 86. Hotta, Y., and Stem, H. (1976). Chromosoma 55, 171. Ito, M., and Hotta, Y. (1973). Chromosoma 43, 391. Ito, M., Hotta, Y., and Stem, H. (1967). Dev. Bioi. 16, 54. Jauhar, P. P. (1975). Nature (London) 254, 595. Jauhar, P. P. (1977). Theor. Appl. Genet. 49, 286. John, B., and Lewis, K. R. (1965). Proroplasmarologia 6. Johnsson, H. (1944). Hereditas 30, 464. Jones, L. M. (1959). “The Ten Chromosomesof Maize.” De Kalb Agric. Assoc.. De Kalb, Illinois. Kiknadze, 1. I., and Vysotskaya, L. (1975). In “Cytology and Genetics of Meiosis” (V. V. Khvostova and Yu.F. Bogdanov, eds.), p. 15. “Nauka,” Moscow (in Russian). Kimber, G. (1961). Nature (London) 191, 98. Kimber, G.(1966). Nature (London) 212, 317. King, R. (1970). fnt. Rev. Cytol. 28, 125. Klein, H. D. (1969a). Mufaf. Res. 8, 1 277. Klein, H. D. (1969b). Genetica 40, 566. Klein, H. D., and Baquar, S. R. (1972). Chromosoma 37, 223. Krishnaswamy, N., and Meehakshi, K. (1957). Cyrologia 22, 250. Kushev, V. V. (1972). I n “Mechanisms in Genetics Recombination” ( S . E. Bressler, ed.), p. 1. “Nauka,” Leningrad (in Russian). Kushev, V. V. (1975). “Mechanisms in Genetics Recombination.” Plenum, New York. La Cour, L. F., and Wells, B. (1970). Chromosoma 29, 419. Lewis, E. R., and Gencerella, W. (1952). Generics 37, 600. Li, H.W., Pao, W. K., and Li, C. H. (1945). Am. 1.Bor. 32, 92. Lifschytz, E., and Meyer, G. F. (1977). Chromosoma 64, 371. Lindsley, D. L., and Grell, E. H. (1968). Carnegie fnst. Washington Publ. 627. Lindsley, D. L., and Sandler, L. (1977). Philus. Trans. R. SOC. London, Ser. B 277, 295. Maguire, M. P. (1978). Chromosoma 65, 173. Martini, G., and Bozzini, A. (1966). Chromosoma 20, 251. Mason, 1. M. (1976). Genetics 84, 545. Mazia, D. (1961). I n “Mitosis and Physiology of Cell Division“ (1. Brachet and A. Mirsky, eds.), Vol. 3. Academic Press, New York. Mehra, R. C., and Rai, K. S. (1970). Can. J . Genet. Cytol. 12, 560. Mehra, R. C., and Rai, K. S. (1972). Can. 1. Gener. Cyrol. 14, 637. Meyer, G. F. (1961). Proc. Eur. Reg. Conf. Electron Microsc., 2nd, 1960, Vol. 2, p. 951. Meyer, G. F. (1965). Elecrron Microsc., Proc. Eur. Reg. Conf. 3rd. 1964, p. 461. Miller, 0. L. (1963). Genetics 48, 1445. Mitra, G. C.. and Singh, D. P. (1971). Gener. fber. 23, 43.

.

GENETIC CONTROL OF MEIOSIS

289

Moens, P. B. (1969). Can. J. Gener. Cyrol. 11, 875. Moriwaki, D., and Tsujita, M. (1974). Cyrologia 39, 829. Moses, M. J. (1956). J. Biophys. Biochem. Cyrol. 2, 215. Moses. M. J. (1968). Annu. Rev. Gener. 2, 363. Noda, S. (1975). Heredity 34, 373. Nordenskiold. H. (1961). Hereditas 47, 203. Okamoto, M. (1957). Wheat Inf. Serv. 5, 6. Palmer, R. G. (1971a). Zea Crop Sci. News/. 45, 63. Palmer, R. G. (1971b). Chromosomc 35, 233. Palmer, R. G. (1974). 1.Hered. 65, 280. Parker, J. S. (1975). Chromosoma 49, 391. Parry, D. M. (1973). Generics 73, 465. Petrov, D. F. (1964). "Genetically Regulating Apomixis." Siber. Dep. Acad. Sci. USSR, Novosibirsk (in Russian). Prakken, R. (1943). Hereditas 29, 475. Rae, P., and Green, M.M. (1970). Drosophila lnf. Serv. 45, 106. Rajhathy, T., and Thomas, H.(1972). Nature (London) New Biol. 239, 217. Rasmussen, S. W . (1975). C. R. Trav. Lab. Carlsberg 40, 163. Rasmussen, S. W. (1977a). Philos. Trans. R. SOC. London. Ser. B 277, 343. Rasmussen, S. W. (1977b). Chromosoma 60, 205. Rhoades, M. M. (1946). Rec. Gener. Soc. Am. 15, 64. Rhoades, M. M. (1947). Generics 32, 101. Rhoades, M. M. (1956). Maize Genet. Crop News/. 30, 38. Rhoades, M. M., and Dempsey, E. (1966a). Generics 53, 989. Rhoades, M. M., and Dempsey, E. (1966b). Generics 54, 505. Riley, R. (1960). Heredity 15, 407. Riley, R. (1968). Proc. Inr. Wheat Symp., 3rd. 1968 p. 185. Riley, R., and Chapman, V. (1958). Nature (London) 182, 713. Riley, R., and Chapman, V. (1963). Heredity 18, 473. Riley, R., and Chapman, V. (1964). Nature (London) 203, 156. Riley, R., and Kempanna, C. (1963). Heredity 18, 287. Riley, R., Chapman, V., Young, R. M., and Belfield. A. M. (1966). Nature (London) 212, 1475. Robbins, L. (1971). Mol. Gen. Genet. 110, 144. Romrell, L. J., Stanley, H. P., and Bowman, J. T. (1972). J . Ulrrasrrucr. Res. 38, 563. Ross, J. G., Sanders, M. E., and Franzke, C. J. (1960). Heredifas 46, 570. Rothfels, K. H.,and Mason, G. F. (1975). Chromosoma 51, 11 1. Sadasivaiah, R. S., and Magoon, M. L. (1965). Genetica 36, 307. Sandler, L., and Lindsley, D. L. (1974). Generics 78, 289. Sandler. L., Lindsley, D. L., Nicoletti, B., and Trippa, C. (1968). Generics 60, 525. Sapegin, L. A. (1932). Genet. Sb. Ser. 2 4, 5 . Satina, S.,and Blakeslee, A. L. (1935). Bor Gaz. (Chicago) 96, 521. Sears, E. R. (1976). Annu. Rev. Gener. 10, 31. Sharma, R. K., and Reinbergs, E. (1972). fndian J . Gener. 32, 408. Simonet, J. M. (1973). Mol. Gen. Gener. 123, 263. Simonet, J. M.,and Zickler, D. (1972). Chromosoma 37, 327. Sjodin, J. (1970). Heredifas 66, 215. Slizynski, B. M. (1964). Gener. Res. 5, 80. Smith, L. (1936). Univ. Ma.,Agric. Exp. Srn.. Res. Bull. 248, 1. Smith, L. (1942). Am. 1.Bor. 29, 451. Smith, P. (1973). Mufat. Res. 20, 215.

290

I. N. GOLUBOVSKAYA

Smith, P., and King, R. (1968). Generics 60, 335. Smith, P. D. (1976). Mol. Cen. Gener. 149, 73. Sokolov, N. N. (1934). Eiol. Zh. 3, 703. Solntzeva, M. P. (1969). Genetika 5 , 20. Soost, R. K. (1951). Genetics 36, 410. Sorsa, M., and Suomalainrn, E. (1975). Hereditas 80, 35. Sosnikhina, S . P. (1973). Generika 9, 21. Stern, H., and Hotta, Y. (1973). Annu. Rev. Genet. 7 , 37. Stern, H., and Hotta, Y. (1974). Generics 78, 227. Stern, H., and Hotta, Y. (1977). Philos. Trans. R. SOC. London, Ser. B 271, N955, 277. Stout, J. T., and Phillips, R. L. (1973). Proc. Narl. Acad. Sci. U.S.A. 70, 3043. Stringham, G. R. (1970). Can. J . Gene?. Cytol. 12, 743. Strunnikov, V. A. (1978). Ontogenez 9, 3. Sturtevant, A. H. (1929). Z. Wiss. 2001. 135, 323. Swamhathan, M. S.,and Murty, B. R. (1959). Generics 44, 1271. Terskaya, E. R., and Strunnikov, V. A. (1975). Genetika 11, 54. Thomas, H., and Rajhathy, T. (1966). Can. J . Genet. Cyrol. 8, 506. Uzzell, T. (1970). Am. Nut. 104, 433. Valentin, J . (1973). Hereditas 75, 22. Valentin, J., and Stahl, G. (1975). Generics 81, 325. Wald, H. (1936). Generics 21, 264. Wall, A. M.,Riley, R., and Gale, M. D. (1971a). Gener. Res. 18, 31 1. Wall, A. M., Riley, R., and Gale, M. D. (1971b). Gener. Res. 18, 329. Watson, W. A. F. (1969). Mural. Res. 8, 91. Watson, W. A. F. (1972). Mutat. Res. 14, 299. Weaver, J. B. (1971). Crop Sci. 11, 927. Westergaard, M., and von Wettstein, D. (1972). Annu. Rev. Gener. 6 , 71. White, M. I. D. (1965). Chromosoma 16, 521. White, M. J. D. (1973). “Animal Cytology and Evolution,” 3rd ed. Cambridge Univ. Press, London and New York. Zakharov, 1. A. (1970). Tsitol. Genet. 4, 123.

INIERNATIONAL REVIEW OF C y M L o a Y . VOL. 58

Hypothalamic Neurons in Cell Culture A. TIXIER-VIDAL AND F. DE VITRY Groupe de Neuroendocrinologie Cellulaire, Laboratoire de Physiologie Cellulaire, College de France, Paris, France

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Morphological Features of Primary Cultures . . . . . . . B. Cytochemical and Biochemical Features . . . . . . . . C. Conclusion . . . . . . . . . . . . . . . . . . . Continuous Cell Lines . . . . . . . . . . . . . . . . A. Tumor-Derived Cell Lines . . . . . . . . . . . . .

I. Introduction

11. Primary Cultures

111.

B. SV40-Transformed Hypothalamic Cell Lines IV. General Conclusions . . . . . . . . . . References . . . . . . . . . . . . . .

. . . . . . . . . . . . . .

. . . . . .

29 1 293 294 31 1 313 314 314 316 327 328

I. Introduction A cell culture approach to the study of hypothalamic neurons is fully justified by the complexity of the anatomy, cell architecture, and function of the hypothalamus as established over the past 50 years. The hypothalamus forms the ventral and lateral walls of the third ventricle and has an uncommon neurovascular relationship with an endocrine gland, the pituitary. It is composed of a heterogeneous population of neurons and glial cells. In addition, it represents the site of the brain where secretory neurons were first described (Scharrer, 1928) and where they display their most characteristic features. Indeed, hypothalamic cell architecture follows a rigid schema; most of the secretory neurons project their axons toward two areas, the median eminence and the postpituitary. Here they release their secretory products into the bloodstream by way of specific synapselike contacts. From a functional point of view, the hypothalamus secretes many chemical messengers in response to external as well as internal stimuli. Such a neuronal function implies the synthesis, migration, storage, and release of peptide hormones, as well as the existence of specific receptors. During the last decade, significant progress has been made in studying the biochemistry of hypothalamic peptides (see reviews by Guillemin, 1978; Vale et al., 1977). This has been accompanied by the development of many new, highly sensitive tools, 29 1

Copyright 0 1979 by Acadcmic Rrss. Irr. All rights of reproduction in any form reserved. ISBN 0-12-364358-9

292

A. TIXIER-VIDAL AND F. DE VITRY

or markers, for analysis of the cellular and molecular mechanisms which control the differentiation and activity of hypothalamicneurons. In spite of this progress, most of these mechanisms are still poorly understood. Indeed, their analysis at a singlecell level is hampered by the complexity of the structural organization of the hypothalamus itself, as well as of its relations with afferent brain mas. Therefore there is a need for cell systems that permit experimentation under simplified conditions. The culture of dissociated hypothalamic cells offers a unique means of obtaining simplified models. It differs fundamentally from organ culture in which the predetermined in viva pattern of tissue organization is maintained. The potentialities of organ cultures of the hypothalamuswere pointed out in the pioneering work of Hild (1954)and Borghese (1954).They were later developed by several investigators who used in fact two types of organ culture depending on the size of explants and culture conditions. Large pieces of adult guinea pig hypothalamus (Sachs et al., 1971)or even the entire hypothalamo-hypophysealcomplex of the guinea pig, the rat (McKelvy, 1974, 1975;Pearson er al.. 1975), or the toad (Eggena and Polson, 1974) were mostly used for studies on hormone biosynthesis or release (vasopressin, vasotocin, thyrolikrin, neurophysins). In such cultures the morphological integrity of at least some of the secretory neurons is maintained, although a widespread cell degeneration also occurs (see review Pearson, 1977). The situation is different in explant cultures where the hypothalamus generally taken from rodent fetuses or neonates is minced in small pieces and allowed to grow on coverslips (Masurowsky et al., 1971;Sobkovicz et al., 1974;Toran-Allerand, 1976, 1978a; Gglhwiler er al., 1978). In that case the survival of neurons is improved and a rich network of neurites is reestablished in culture. From a developmental point of view such cultures offer a good model for an analysis of the regulatory mechanism which controls the neuronal maturation (see review Toran-Allerand, 1978b). This permits a partial simplification of the system, but still at the tissue level. In contrast, the culture of dispersed hypothalamic cells permits work at a singlecell level, provided that the cells completely retain their features of differentiation under such conditions. Since it was long believed that in general the culture in vitro of dissociated cells induced their dedifferentiation, it appears that the first step in the study of hypothalamic cells in culture is to defrne their differentiated features. This is not a simple task because of the necessity for initiating the culture with cells taken from young animals and even from fetuses where development is not complete. Therefore we have compared, when possible, the early development of the hypothalamus in viva with that of dispersed hypothalamiccells in vitro. In this article, it is shown that cultures of dissociated hypothalamic cells express several hypothalamic functions. Furthermore, it is believed that this approach will permit an analysis of cell reassembly and cell interaction at the hypothalamic level.

HYPOTHALAMIC NEURONS IN CELL CULTURE

293

The purpose of the cell culture approach is to isolate homogeneous populations of fully differentiated cells. Such homogeneous populations generally correspond to neoplastic continuous or permanent cell lines, as opposed to primary cultures. Both types of cultures have been used for several years with nerve cells of other origins, central as well as peripheral, and have provided information on normal neuronal as well as glial cell behavior (see reviews in Sato, 1973; Varon, 1975; Heiffer et al., 1978; Patrick et al., 1978). Such cultures have been more recently applied to hypothalamic cells and are discussed and compared in this article. 11. Primary Cultures

Primary cultures of dissociated hypothalamic cells have been established for various purposes and, at least to our knowledge, in only two species, the rat and the mouse. The presently available reports are listed in Table I which shows that most of these cultures were initiated with cells taken from fetuses, newborns, or neonates. The only attempts to culture adult rat hypothalamic cells did not result in good survival of neurons according to the phase-contrast observations of Wilkinson et al. (1974). The same situation occurred in the culture of other areas of the brain (see review by Varon, 1975). The initial cell dissociation involved in most cases enzymic treatment, as brief as possible, of small tissue pieces followed by mechanical dissociation through pipets. In the case of the hypoTABLE 1

REVIEWOF REPORTSON PRIMARY CULTURES OF DISSOCIATED HYPOTHALAMIC CELLSFROM RODENTS

Species

Source of cells and age at initiation of culture

Mouse

13-, 14-,15-, 16-,and

Dissociation process

Duration of cultures

Reference

Mechanical

From 4 days up to 2 months

Tixier-Vidal er al.. 1973 Benda er al., 1975

20day fetus

Rat

Newborn (1-5days); adult (4-5weeks)

Enzymic (trypsin)

1-2 weeks

Wilkinson er al., 1974

Rat

18-day fetus

Enzymic (papain plus DNase) plus pipetting

Up to 90 days

Vaccaro et al.. 1976a.b Canick er 01.. 1977

Rat

Neonate (10-12days)

Enzymic (trypsin) plus EDTA plus pipetting

Up to 2 months

Knigge e?al., 1977

294

A. TWER-VIDAL AND F. DE VITRY

thalamus of a young mouse fetus, mechanical dissociation alone was sufficient to obtain a suspension of single cells accompanied by a few clusters of 5 to 10cells. In the case of perinatal or adult tissue enzymic treatment was necessary. In view of the great variety of neuronal functions in the hypothalamus, as well as its very specialized structural organization, numerous specific features of differentiation are available to characterize cells in culture and to compare them with their in vivo counterparts. Exploration of the capabilities of hypothalamus primary cultures has just begun, but morphological and ultrastructural features, as well as a few biochemical markers of differentiation, nevertheless have already been identified. FEATURES OF PRIMARY CULTURES A. MORPHOLOGICAL 1. Phase-Contrast Observations The changes in the cells during the hours following plating vary according to the age of the donor fetus, the cell density, the nature of the substrate, and the origin of the serum added to the culture medium (horse serum or fetal calf serum). The precise roles of each of these factors are not clear at present. After the plating of hypothalamic cells taken from 14 to 16-day mouse fetuses, in a medium containing 15% horse or fetal calf serum, most of them reaggregated in masses of various sizes. The number and size of the masses increased with the density of seeding. These masses attached to the dish and within the following 2-3 days displayed two patterns of outgrowth (Fig. la): straight processes either isolated or associated in bundles, or an irregular outgrowth of flat cells sometimes surrounded by small, brilliant cells and cell processes. The straight processes sometimes formed bridges between adjacent aggregates, and small, oval cells were often seen lying along them. The relative frequency of these two patterns of outgrowth greatly varied from dish to dish and even within the same dish. At the end of the first week in vitro, the small aggregates flattened, and finally a monolayer of flat, pale cells spread over the dish and more or less rapidly formed a continuous background layer made up of polyhedric, epithelioid cells (Benda et al., 1975) (Fig. l b and c). The addition of cytosine arabinoside at the time of plating of 18-day fetal rat hypothalamic cells limited the confluence of this layer (Vaccaro et al., 1976a). Over this basal monolayer various types of brilliant cells grouped in discontinuous areas could be distinguished (Fig. l b and c): (1) a few clusters of very densely packed small cells (5-6 pm) which persisted for several days in culture but did not grow and finally disappeared after 2-3 weeks; (2) oval cells of medium size, which exhibited one or two polar expansions and formed rather loose groups in the vicinity of the clusters of small cells; and (3) large cells (20 p m in diameter) which had the typical appearance of neurons with multiple

HYPOTHALAMIC NEURONS IN CELL CULTURE

295

FIG.1. Light microscope features of primary cultures of 14-day fetal hypothalamic cells observed at various stages of development in v i m . (a) After 4 days small aggregates are linked by straight bundles of fibers (arrow); in addition, an irregular outgrowth of flat cells is also observed (double arrows). (band c) After 9 days in culture the final pattern is achieved; over a basal monolayer of flat and polyhedric cells clusters of densely packed small cells are seen (b) and bipolar cells of larger size. (c) Culture embedded in Epon. X 140.

expansions. They became predominant over bipolar cells after an increasing time in culture (up to 6 weeks) and formed a dense network of long processes. In addition, in some cultures, ependymal cells could be easily recognized by their rhythmic ciliary movements which were not seen before 10 days in culture. They were grouped either in clusters made of a few cells or associated within a large circular area (Benda et al., 1975). A similar development of the culture during the first hours and days after seeding was reported for cells of the fetal chick brain (Varon and Raibom, 1969;

296

A. TUUER-VIDAL

AND F. DE VITRY

Sensenbrenner and Mandel, 1974), the fetal rat cerebral cortex (Yavin and Menkes, 1973), and more recently the postnatal mouse cerebellum grown in microwells (Trentkner and Sidman, 1977). This initial reaggregation step seems in fact critical for continued development of the culture. Nevertheless, it was not observed for hypothalamic cells taken from 10 to 12-day-old rats (Knigge et al., 1977). In this case, the dispersed cells attached within 6-8 hours, and their morphological development proceeded slowly. After 10- 14 days connective tissue cells, together with neuroglia, formed “a moderate syncytium over the floor of the dish.” Neurons tentatively identified by their refractility were first seen at about 10-14 days; they were bipolar and had short pmcesses. By the fourth week in culture they had greatly extended their processes over a thin carpet of connective tissue. This final pattern is the same as that which succeeds the initial reaggregation step reported for younger cells. In all cases a three-dimensional organization of the cells characterizes the evolution of central brain cells in culture. In order to understand the significance of such a pattern of organization more precise identification of the cell types, of the fibers, and of their spatial relationships was needed. This was obtained for the hypothalamus before any other brain area (Benda et al., 1975; Tixier-Vidal et al., 1973, 1978). 2. Ultrastructural Features of Hypothalamic Cells in Culture Our study was mainly performed on a culture of hypothalamic cells taken from 14-day mouse fetuses and grown for varying periods of time from 4 days up to 2 months. Using an original technique (Picart and Tixier-Vidal, 1974), we selected small areas of the culture for thin-sectioning in a direction either parallel or perpendicular to the monolayer. This allowed a correlation between the phasecontrast view of the selected area and the ultrastructural features of the corresponding cells. a. Aggregates and Fiber Outgrowth after 4-6 Days in Vitro (A. Tixier-Vidal, unpublished observations). Vertical sections through a medium-sized aggregate revealed a loose arrangement of small cells of various shapes lying over a sheet of flat cells or cell processes (150-200 nm in thickness) (Fig. 2). The smallest cells (5-8 p m in diameter) were rounded and had a high nucleus/ cytoplasm ratio. Their morphology was similar to that of primitive neuroepithelial cells. Their nucleus was often invaginated and contained a dense karyoplasm with chromatin distributed in a thin marginal layer and many small clusters. Their cytoplasm was electron-dense and, except for ribosomes and mitochondria, contained very few cytoplasmic organelles. Such cells were often observed in pairs, suggesting that they might result from cell division, which was consistent with the occasional presence of a mitotic cell in their vicinity. The largest cells (8-14 p m in diameter) could be divided into two categories: dark and clear cells. The clear cells displayed features of maturing neurons. Their cytoplasm contained many conspicuous rosettes of ribosomes against a clear background, and a

HYPOTHALAMIC NEURONS IN CELL CULTURE

297

FIG.2. Electron micrograph of a vertical section through a cell aggregate in a 4-day culture of 14-day fetal hypothalamic cells. The surface of the culture dish is seen in the lower left-hand comer (arrow). Two cells at the surface of the aggregate display a polarity toward the center of the aggregate as Seen from the position of the welldeveloped Golgi zone (G).Inside the aggregate one can see dark primitive cells and a mitotic cell (m). The cells are loosely associated, and intermingled cell processes are seen between them. Fixed in 4% glutaraldehyde in Millonig’s buffer at pH 7.4. Epon embedding in siru. x6OOO.

298

A. TIXIER-VIDAL AND F. DE VITRY

large Golgi zone which sometimes contained one or two small, dense-cored vesicles. They often possessed one large extension which emerged from the Golgi area and contained, in addition to rosettes of ribosomes, microtubules which ran parallel to their long axis. Some of them were bipolar. The cells limiting the aggregates and facing the medium were rounded on their outer face and had a few large villi. They displayed a polarity toward the core of the aggregate, as seen from the position of the Golgi zone (Fig. 2 ) and the orientation of one polar extension. The flat cells which supported the aggregate at the point of contact with the plastic dish remained difficult to identify. They were often observed extending from one aggregate to another, and in this area they were often surrounded by neuroepithelial cells, as well as by transverse profiles of axons or cell processes. The space between the various cells was either empty or more often occupied by an intermingled network of processes and growth cones. Growth cones appeared either as large, rounded expansions of the cytoplasm or as dilatations at the tips of narrow cytoplasmic extensions, axonal or not. They were filled with empty vesicles of various sizes (up to 150 nm) upon a translucent background. Many of the processes were straight and displayed features of elementary axons (about 300 nm in diameter), with a very clear cytoplasm devoid of ribosomes and with four to six microtubules. The emergence of fibers from aggregates followed several morphological patterns. The insertion of groups of growth cones between peripheral cells was the initial step in fiber outgrowth. This was followed by the formation of an unorganized network of straight axonal processes which extended from the aggregate a short distance. Some of these emerging axons associated into bundles and formed a straight cable which seemed to advance over the surface of the dish without making contact with it, as clearly seen in vertical sections (Fig. 3). This cablelike structure often joined another aggregate. The number of axons within a bundle varied from 4 to 30 or more. Asymmetric bipolar cells were often associated with the axons to which they were closely apposed without the formation of specialized contacts (Fig. 4). Such cells displayed features typical of bipolar neurons. Growth cones were numerous in these cablelike structures. Another pattern of outgrowth consisted of very large heterogeneous expansions of aggregates, which were apposed to the surface of the dish and consisted of parallel bundles of axons associated with nonaxonal cytoplasmic extensions and numerous elongated cells. Some, although not all, of these outgrowing cells displayed features of maturing neurons. No specialized contacts, that is, synaptic contacts, were seen either inside or outside the aggregates. One can infer from these morphological observations that the aggregates are sites of cell division, cytoplasmic growth, axonal emergence, and cell migration.

HYPOTHALAMIC NEURONS IN CELL CULTURE

299

FIG.3. Same material as in Fig. 2. A transverse section through a cablelike structure emerging from an aggregate without making contact with the surface of the dish. It consists of many transverse profiles of axons associated with dark cells and their processes. Same technique as in Fig. 2. x 10,Ooo.

300

A. TWER-VIDAL AND F. DE VITRY

FIG.4. Same material as in Fig. 2. A horizontal section within a cablelie stmcture emerging from an aggregate.. It is made up of a parallel bundle of longitudinal profiles of axons. An asymmetric bipolar cell (N)which displays neuronal featum is apposed to the axon bundle. Same technique as in Fig. 2. X7500.

HYPOTHALAMIC NEURONS IN CELL CULTURE

30 1

These events induce progressive flattening of the aggregates and result in the formation of a continuous culture that covers the entire dish. b. Final Pattern of Cell Organization (Benda et al., 1975). Vertical sections through various areas of the culture, made after establishment of the final pattern, confirmed as presumed from phase-contrast observations that clusters of various cell types were superimposed on a basal carpet. In addition, they revealed unexpected findings. First, the basal carpet was in fact made of several layers of flat cells which were best identified in “old” cultures (Fig. 5 ) . The cells, which lay directly over the dish, formed zones of local contact with the plastic dish as seen by local membrane thickenings. The cells in the upper layer of the carpet sent microvilli toward the medium. When ependymal cells were present, they were always inserted in the basal carpet where they were localized either to the upper layer of the carpet, facing the medium, or around a rounded cavity inside the carpet. In these cases, they sent cilia and microvilli toward the cavity or the medium. Another original feature of the basal carpet was the presence of transverse as well as longitudinal axonal profiles which were inserted between the cells of the basal carpet. The overlying cells, isolated as well as associated in clusters, were apposed to the basal carpet. Depending on the plane of the section, they were either rounded, were apparently free, or made discontinuous contacts with the upper cells of the basal carpet with one or two “feet” (Fig. 5 ) . Short local membrane thickenings of variable length (80-200 nm) were occasionaIly seen at these levels. Neuronal processes running along the surface of the basal carpet were relatively few in vertical sections. c. Cell Types of the Basal Carpet. In the youngest cultures (9 days) of 1Cday hypothalamic cells, the basal carpet was made up of a heterogeneous population of loosely associated cells larger than those of the aggregate (10-15 pm). They could be divided into two main categories according to the electron density of their cytoplasm and nucleus. The dark cells displayed an irregular shape and irregular processes. In the nucleus, the distribution of chromatin was characterized by a thick marginal layer and many conspicuous clusters. The cytoplasm contained over a dense background many free ribosomes, a small Golgi zone, and several dense bodies. Very few filaments were observed in the karyoplasm, whereas they were more numerous in the cell processes. Such cells most probably represented astrocytes undergoing progressive maturation. The clear cells were in strong contrast, with their electron-lucent karyoplasm and cytoplasm. Their outline was oval or irregular but always smoother than that of the dark cells. They also extended villi as well as large processes. Their cytoplasm contained numerous small polysomes homogeneously distributed, a very few flexuous, flat, rough cisternae, and a very small Golgi zone. Such cells were seen undergoing mitosis. They shared many features with the ventricular cells of

302

A. TIXIER-VIDAL AND F. DE VITRY

HYPOTHALAMIC NEURONS IN CELL CULTURE

303

the third ventricle of the hypothalamus of a young mouse fetus (12-13 days). Last, a third type, less frequent than the others, consisted of giant electron-lucent cells with numerous narrow, elongated mitochondria and a very large electronlucent nucleus. These cells had no in vivo counterpart in the fetal hypothalamus. In older cultures (21, 27, 37, and 60 days) of 14-day fetal cells, as well as in 10-day cultures of 16 to 18-day fetal cells, the cells of the basal carpet were tightly associated and displayed many features of astrocytes as revealed by the presence of conspicuous bundles of cytoplasmic filaments which were irregularly distributed in the karyoplasm and streamed in bundles in the long, irregular cytoplasmic processes (Fig. 6). Their cytoplasm was darker than that of astrocytes in vivo. The nucleus displayed the same features as the nucleus of dark cells observed in young cultures. In a vertical section of a 37-day culture, the astrocytes and their processes formed up to six superimposed sheets. They were most probably responsible for the epithelioid appearance of the basal carpet as seen in the phase-contrast microscope. Ependymal cells, when present, were of two types: dark cells with cytoplasmic filaments and several cilia, and clear cells with large protrusions and many endocytotic vacuoles. d. Overlying Cell Types. Based on their ultrastructural features, the overlying cells were classified into several types which correlated with their appearance under the phase-contrast microscope. Primitive neuroepitheliul cells were the major components of clusters of densely packed small cells. They displayed exactly the same features as the smallest cells (5-8 p m in diameter), described in Section A,2,a in the aggregates. In addition, they were often associated in small chains and exhibited a tendency to send out a single narrow cytoplasmic extension. Such clusters might derive from the cores of flattened aggregates. Maturing and mature neurons corresponded to bipolar and multipolar cells at the phase-contrast microscope level. Maturing neurons possessed exactly the same features as the cells described above in the outgrowth of aggregates. They were often bipolar and emitted typical elementary axons. They were the most frequent in cultures of medium age (14 days plus 9, 10, or 21 days or 16 days plus 10 days). Mature neurons were larger (20 p m in diameter) and with time (up to 2 months) became more frequent. They displayed classic features of fully differentiated neurons. The nucleus was large and rounded, with a very clear karyoplasm and a very thin discontinuous layer of chromatin lining the nuclear membrane. The cytoplasm was electron-lucent. It contained, besides rosettes of FIG.5 . A transverse section through a 37-day culture of 14-day fetal hypothalamic cells. The surface of the culture dish is seen at the bottom (arrow). The basal carpet is made up of several layers of dark cell processes which contain bundles of filaments (F). An overlying cell is apposed to the basal carpet. Its cytoplasm is clearer than that of the basal carpet. The inset shows detail of a local contact with membrane thickening (double arrows). X 12,000. Inset: X60,OOO.

304

A. TIXIER-VIDAL AND F. DE VITRY

HYPOTHALAMIC NEURONS IN CELL CULTURE

305

ribosomes, a Nissl body and a prominent Golgi zone. Microtubules were found either isolated and scattered in the perikaryon or grouped in parallel bundles and streaming into axons emerging from the Golgi zone. These mature neumns were often seen closely associated with satellite cells of a glial nature. They were either oval and bipolar, or highly multipolar. The largest multipolar neurons (20 p m in diameter) exhibited signs of intense secretory activity, as revealed by the considerable extension of the Golgi zone which contained several stacks of saccules and numerous dense bodies (Fig. 7). Such cells were already present in 9- to 10-day cultures of 14-day fetal cells and were still found in great numbers in older cultures. Some of the overlying cells could not be considered neurons. This was particularly true for cultures initiated with 18- to 19-day fetal hypothalamic cells. Such cells were rounded, and the perinuclear cisternae were often dilatated. The cytoplasmic background was slightly electron-dense, the polysomes were less conspicuous than those of neurons, and there was no Nissl body. The Golgi zone was well developed and often contained secretory material. They might be tentatively identified as oligodendroglial cells. e. Neuronal Processes and Synaptogenesis. Neuronal processes formed a very dense network. On vertical sections they ran along the surface of the basal layer a short distance, before entering the basal layer. They consisted mainly of axons. In young cultures, these axons were narrow (200 nm) and often formed parallel bundles of two to six. In older cultures, they were larger (up to 1 pm) and sometimes contained narrow strips or droplets of membrane-bound dense material which often displayed acid phosphatase activity. Dendritic processes were identified by their irregular outlines and the presence, in addition to microtubules, of many ribosomes. They were more numerous and displayed more spines in old cultures. Growth cones were found at the tips of axons in young cultures (6 days) of 14-day fetal cells. These growth cones contained a few small, dense-cored vesicles (60-80 nm) and an irregular smooth reticulum. A few days later (9-10 days in culture) the axon terminal dilatations, or perhaps the axon swellings, differed from growth cones by their large size and extension of the smooth reticulum (35 nm in diameter). Mature terminal boutons, as identified by the presence of synaptic vesicles (40-50 nm), appeared after 4 weeks in cultures of 14-day fetal cells (Fig. 8). Synaptic membrane thickening was seen at the same time, either on the postsynaptic side or on both sides. These mature axon terminals contained in addition dense-cored vesicles of various diameters and shapes (up to 100 nm).

FIG.6 . A cytoplasmic astrocyte in a horizontal section through a 15-day culture of 19-day hypothalamic cells. It displays a small Golgi zone ( G ) and many bundles of filaments (arrows). x20,Ooo.

306

A. TIXIER-VIDAL AND F. DE VITRY

HYPOTHALAMIC NEURONS IN CELL CULTURE

307

In contrast, when cultures were initiated from 16- to 18-day fetuses, axon terminals and synapses had formed by the tenth day in culture. When synaptic contacts were observed, they occurred between boutons and either cell bodies or dendritelike processes. In vertical sections, the latter were always found inside the basal layer. Synapselike contacts between a mature axon terminal and a glial process were never found in our cultures, although they are known to occur frequently in vivo in the median eminence as well as in the neurohypophysis. 3 . Comparison with in Vivo Development of the Mouse Hypothalamus In order to interpret the morphogenetic events which occurred in culture, we summarize present knowledge concerning the in vivo development of the mouse hypothalamus. According to the light microscope study of Niimi et al. (1962), the mouse hypothalamus can be distinguished on the tenth day of gestation and shows further development by the twelfth day. From the thirteenth to the fifteenth day, the primitive cell layer of the neural tube differentiates into three layers, germinal, mantle, and marginal, and gradually increases in size. On the sixteenth day of gestation, the majority of the hypothalamic nuclei are already in place. In addition, the anlage of the neural lobe is already formed in the 12-day fetus and is in close contact with the Rathke pouch. At the electron microscope level, the first signs of neuronal maturation were detectable in the 12-day mouse fetus by the presence of bundles of elementary axons which had already formed a neuropil in the lateral and ventral walls of the anterior area of the third ventricle, dorsal to the optic chiasma. Terminal growth cones were found in this neuropil. At this time, most cells of the hypothalamus were “primitive,” that is, small, electron-dense, rounded, and loosely associated. In contrast, the ventricular cells, which were connected by desmosomes and tight junctions and often seen dividing, displayed striking specific morphological features in two areas: anterior, dorsal to the optic chiasma, and posterior, at the level of the recessus infundibularis. Such cells were larger, with an electron-lucent cytoplasm. They formed large protrusions and numerous villi which faced the ventricle lumen and displayed signs of intense endocytotic activity. In the 14-day fetus, signs of neuronal maturation clearly appeared in the presumptive tuber cinereum based on both the neuronal features of the perikaryon and the presence of elementary axons with dense-cored vesicles (60-80 nm). At these stages the presumptive median eminence, as well as the neural lobe, was completely devoid of axon terminals (Tixier-Vidal et a l . , 1978). In 15- to 16-day ~~

~

FIG.7.

~

~~~

~

~~

~

A secretory neuron in a horizontal section through a 37day culture of 14-day fetal

hypothalamic cells. Note the development of the RER in (a) and in (b), the considerable extension of the Golgi zone with membrane-bound secretory granules (arrows), and dense bodies (db). (a) X6OOO. (b) X30,OOO.

308

A . TWER-VIDALAND F. DE VITRY

HYPOTHALAMIC NEURONS IN CELL CULTURE

309

fetuses single axons and small bundles of fibers were f i t seen in the neural lobe of the mouse (Eurenius and Jarskar, 1974) and of the rat (Fink and Smith, 1971), and 1-2 days later in the rat median eminence (Daikoku et al., 1971; Halasz et al., 1972; Paull, 1977). The axonal invasion was followed by the formation of axon terminals containing dense-cored vesicles, the diameter and number of which increased with age. Synapselike contacts first appeared at birth and increased in number after birth. The maturation of glial cells occurred mainly after birth, when tanycytes, protoplasmic astrocytes, and oligodendrocytes achieved complete development (Schiebler, 1977). At the same time, the complexity of the neuronal network increased in hypothalamic nuclei with the development of synapses and dendntic spines (Raisman and Field, 1973). This brief review shows that the ultrastructural maturation of the mouse hypothalamus proceeds slowly, beginning in early fetal life with the formation of axons on the thirteenth day of gestation, followed by axonal invasion and the formation of axon terminals in the neurohemal regions during the last days of gestation. Synapselike contacts appear at birth in the neurohemal regions, and the hypothalamus reaches its final complexity of organization after birth. Before making a comparison of the ultrastructural features of hypothalamic cells in vivo and in vitro,it must be kept in mind that the degree of differentiation of the cells at the initiation of the culture varies greatly depending on the age of the donor fetus. Hypothalamic cells dissociated from 14-day fetuses consist of a heterogeneous population of primitive nerve cells (the most numerous), of ventricular cells, and of maturing neurons with elementary axons. Astrocytes, tanycytes, mature axon terminals, and synapses are totally lacking. In contrast, cells taken from postnatal stages have almost completely achieved their final differentiation. If these facts are taken into account, the morphological changes in cells in culture may be discussed from two p i n t s of view: (1) maturation of individual cells, and (2) cell interaction and cell sorting out. a. Cell Maturation. A comparison of the ultrastructural features of 14-day hypothalamic cells at the beginning of culture with those of older cultures clearly demonstrates that de novo differentiation occurs in culture. This is obvious in the formation of axon terminals and synapses, as well as in the differentiation of astrocytes and tanycytes. As for the neurons, although they undergo evident FIG. 8. Fully differentiated axon terminals and synapses in a horizontal section through a 27day culture of 14-day fetal hypothalamic cells. (a) An axon terminal (1) which displays densecored vesicles and forms a synaptic contact with a dendrite is apposed to an astrocyte process (A). Another synaptic contact is seen at (2). x 30,000.(b) Detail of a fully differentiated synaptic contact between a bouton and perhaps an axon (synapse en passant). Note the presence of dense-cored vesicles and numerous synaptic vesicles on the presynaptic side, the postsynaptic thickening, and the presence of dense material within the synaptic cleft x60,OOO.

310

A. TIXIER-VIDAL AND F. DE VITRY

complete maturation in culture, it is difficult to determine whether or not they appear de novo in culture, since the first steps of neuronal differentiation have already been expressed in vivo at the time of initiation of the culture. A priori three possibilities may be equally considered. Neurons which mature in culture may derive either from postmitotic cells which began their neuronal maturation in vim, or from neuroblasts which might divide and differentiate in culture, or from both. The fact that mature axon terminals and synapses occur mote rapidly in cultures initiated from 16-day fetuses than in cultures initiated from 14-day fetuses is very much in favor of the first possibility. Alternatively, the evidence for mitosis of neuroepithelial cells in the aggregates and the persistence of small, maturing neurons after 10 days in culture is consistent with the second possibility. Experiments involving cell labeling are necessary in order to resolve this matter. The progression of nerve cell maturation in culture follows the same steps as that of the hypothalamus in vivo; in both cases, the first signs of neuronal differentiation occur several days earlier than the differentiation of astrocytes and tanycytes and the appearance of synapses. The timing of neuronal maturation is slower in culture than in vivo. Synapses are not found before 20 days in virro in cultures initiated with 14-day cells, whereas they occur in vivo 6 days later. This delay is reduced to 10 days when cultures are initiated with 16-day cells. This difference suggests that certain factors necessary for the achievement of neuronal differentiation are lacking in culture when cells are isolated from their normal environment at an early stage. Hypothalamic cells in culture undergo synaptogenesis, as do other cells derived from the fetal mouse brain (Bornstein and Model, 1972; Yavin and Yavin, 1977). They also have the same ability to form synapses in culture as explant cultures of hypothalamus taken from 15-day fetuses or newborn mice (Masurovsky ef a f . , 1971). The initial dissociation step therefore does not reduce cell potentialities. Nevertheless the establishment in culture of a well-defined pattern of histiotypic organization seems to be required for the Occurrence of synaptogenesis. This underlines the importance of cell interactions for this process. b. Cell Interacfionand Cell Sorting Our. Although primary cultures do not attain the cytoarchitectonicorganization of the hypothalamus in vivo, they form a new three-dimensional histiotypic pattern which at least at the phase-contrast microscope level is similar to that described earlier for fetal chick brain cultures. The crucial event in the development of the culture is the formation of aggregates, since they are sites not only of cell division, but also of fiber outgrowth and cell migration. Cell migration starting from the aggregates is accompanied by a cell sorting out which determines the final pattern of the culture. This pattern includes a basal carpet of glial cells and loose groups of maturing and mature neurons. Two mechanisms play a fundamental role in this process: (1) the associ-

HYPOTHALAMIC NEURONS IN CELL CULTURE

31 1

ation of elementary axons into bundles which seem to be used as a guide for neuronal migration, and (2) the direct apposition of nonneuronal cells on the substrate where they are used as a guide for the migration of neurons and their axons. Both mechanisms are indeed observed in vivo during maturation of the hypothalamus. The neuropil of the anterior hypothalamus of the 12-day fetus does not differ in organization from the outgrowth of fibers and cells from the aggregate. In the migration of axons, followed by the concentration of axon terminals in the median eminence and the neural lobe, which occurs in vivo at the end of gestation, the affinity of the axon endings for the astrocytes is the same as that observed in the basal carpet of the culture. The dissociated hypothalamic cells therefore express in culture the same capacities for cell recognition and cell association as those which seem to direct the topographic organization of the hypothalamus in vivo. Therefore they offer a wide field for experimental analysis of the cellular mechanisms involved in the differentiation of the hypothalamus, such as the transition from dividing to nondividing cells, membrane properties, the reciprocal role of glia and axons in their respective terminal differentiation, and the effect of hormones or other unknown factors from the extrahypothalmic environment. Such an experimental analysis has not yet been reported for hypothalamic cultures and has just begun for other brain cells.

B. CYTOCHEMICAL A N D BIOCHEMICAL FEATURES Ultrastructural evidence for the development in culture of neurosecretory neurons, including their typical axon swellings and terminal boutons, strongly suggests but does not demonstrate the differentiation in culture of hypothalamic specific functions. Biochemical studies, qualitative and if possible quantitative, are needed for such a purpose. Again, they should be correlated with the in vivo development of hypothalamic functions. In fact, studies of this type, in vivo as well as in vitro, are still very few and deal exclusively with neuronal functions. As for the development in vivo of hypothalamic specific functions, two lines of results have been reported, most of them involving cytochemical methods. The Falck-Hillarp method for histofluorescence of biogenic amines has allowed the developmental pattern of these transmitters to be described in the rat (Olson and Seiger, 1972; Cadilhac and Pons, 1976) and mouse brain (Golden, 1973) where both catecholamine and serotonin fluorescent cells appear in the brain stem on gestational day 13 and catecholamine-containing cells and axon terminals in the hypothalamus on day 19. Immunocytochemicalmethods have allowed localization in the rodent hypothalamus of several hypothalamic peptides such as luteinizing hormone-releasing hormone (LHRH), somatostatin, and neurophysin which were generally first observed in the rat median eminence at the end of

312

A. TIXIER-VIDAL AND F. DE VITRY

gestation (Dubois, 1978). In the rat postpituitary, neurophysin was first detected in the l&day fetus (Leclerc and Pelletier, 1977). However, in the fetal guinea pig, LHRH-containing neurons and axon terminals (Barry and Dubois, 1974), as well as neurophysin- and vasopressin-containing structures (Silberman, 1973, were first observed at earlier stages of gestation (days 40-45). The same observation was made for LHRH and somatostatin in the human fetus (Bugnon et al., 1977a,b). With the use of radioimmunoassay LHRH is detected 1 day after birth in the rat hypothalamus (Araki et al., 1975) (sensitivity of the assay is 25 pg with 4 to 11 animals per assay). The tripeptide thyrotropin-releasinghormone (TRH) is detectable by radioimmunoassay (sensitivity, 4 pg), as well as radioreceptor assay, in trace amounts in both the hypothalamus and the extrahypothalamic brain of 12-day mouse fetuses. Its level then increases in both areas up until birth when it represents one-fifth of the values observed in adults (100 pg/hypothalamus instead of 500 pg) (Faivre-Bauman er al., 1978). Very few data on the expression in culture of hypothalamic specific functions have been reported. In primary cultures of enzymically dispersed cells from basal hypothalami taken from 10- to 12-day-old rats, a small percentage of the overlying multipolar cells were found to contain catecholamine as revealed by microspectrofluorometricanalysis, and in 45- to 60-day cultures a significant number of the overlying bipolar cells (2000 out of 10,000 per dish) was immunochemically stained with a rabbit anti-LHRH (Knigge et al., 1977). These findings demonstrated that neurons which had most probably already differentiated in vivo were able to survive in vitro after enzymic dissociation and retain their initial differentiation. Toran-Allerand (1978a), using long-term explant cultures of newborn mouse hypothalamus preoptic area, have recently reported the presence of LHRH neurons immunocytochemically identified in the outgrowth and which may have differentiated in culture from migrating neuroblasts. Preliminary reports on cultures of enzymically dispersed cells taken from 18-day rat fetuses have shown that they synthesize neurotransmitters (Vaccaro et al., 1976a), and intracellular recordings of presumptive neurons reveal action potentials and spontaneous synaptic input (Vaccaro et al., 1976b). Moreover, after 8 days in vitro the cultures display a hypothalamic function: the ability to aromatize androgens. The level of activity is estimated to be comparable to that found in cell-free homogenates of fetal rat hypothalamus. In addition, when cultures are grown in the presence of cytosine arabinoside, which limits the proliferation of nonneuronal cells and enhances neuronal morphology, the aromatase activity is six times higher as reported by Canick et al. (1977). According to these investigators, this allows one to localize this function to neurons. Another interpretation might be that, by limiting the division of nonneuronal (possibly glial) cells, one favors their functional differentiation. The tripeptide TRH is detectable by radioimmunoassay in l0-day cultures of hypothalamic cells taken from two different stages of mouse gestation: from the

HYPOTHALAMIC NEURONS IN CELL CULTURE

313

early 13-day fetus, at a time when TRH becomes detectable in trace amounts, and from the early 16-day fetus, at a time where TRH content is steeply increasing. Comparison with the hypothalamic content in vivo at the time of initiation of culture reveals that the initial content is maintained but does not increase in culture. The situation is different for cultures of brain hemispheres initiated and treated under the same conditions. In this case, there was a 10-fold increase when cultures were initiated at 12 days, but no increase when they were initiated at 15 days. This suggests that the TRH-synthesizing cells of the brain hemisphere undergo a more autonomous differentiation than those of the hypothalamus (Tixier-Vidal et al., 1978; Faivre-Bauman et al., submitted). In addition to this quantitative study, an immunocytochemical study was performed in order to determine the cellular origin of TRH. Specific staining was found exclusively in small, overlying bipolar cells (8-14 pm) of neuronal a p pearance. The cells of the basal layer were always negative. The positive cells were numerous in 10-day cultures of 15-day fetal hypothalamic cells, but there were very few in cultures of 12-day hypothalamic cells, which is consistent with the quantitative data. An electron microscope study of cultures previously treated immunochemically confirmed the neuronal nature of the positive cells. The reaction deposit was localized to both the perikaryon and the cytoplasmic extension which ran over and extended into the basal carpet (see preliminary results in Tixier-Vidal ef al., 1978; Faivre-Bauman et al., submitted). These preliminary results show that TRH can be used as a potent marker to follow neuronal differentiation in culture. The fact that TRH hypothalamic content did not increase in culture might indicate either a numerical deficit of TRH neurons in the culture or a low level of TRH synthesis per cell. In both cases, this suggests the absence in the culture of certain factors such as hormones or connections with other cells. This deserves further experimental study.

C. CONCLUSION As a whole, the biochemical studies on hypothalamic cell cultures, although still very few, are promising. They will add chemical specificity and quantitative parameters to the information provided by ultrastructural analysis. Both methodological approaches provide evidence for the expression in culture of hypothalamic specific functions. In addition, they open the field for the experimental study of factors involved in the development and control of these functions using primary cultures as a valuable model system. A possible limitation of this model is its heterogeneity, since it includes both glial and neuronal cells. Nevertheless it may be possible to further simplify this system by the selection of neurons and glial cells. Such an approach has already been successful with neurons of the rat sympathetic ganglia (Mains and Patterson, 1973), as well as with cells of the

314

A. TIXIER-VIDAL AND F. DE VITRY

embryonic chick brain (McCarthy and Parlow, 1976). It has not yet been used with hypothalamic cell cultures.

111. Continuous Cell Lines Continuous clonal cell lines offer another possibility for obtaining homogeneous populations of hypothalamic cells. The existence of continuous cell lines implies cell “transformation. ” Although the meaning of this word is not agreed upon by all workers, it is agreed that it implies a modification of the cell machinery which results at least in restoration of the cell’s ability to divide. In the particular case of neurons, which are strictly postmitotic elements, this raises the question of whether or not they retain their complete features of differentiation. In fact, several nerve cell lines which retain at least some neuronal features of differentiation have been established starting from spontaneous tumors such as the C 1300 mouse neuroblastoma (Augusti-Tocco and Sato, 1969; Schubert et al., 1969) and the rat adrenal pheochromocytoma (Greene and Tischler, 1976), or from chemically induced tumors (Greene et al., 1973; Schubert et al., 1974). In the case of neuronal hypothalamic functions, two types of cell lines have recently been established which differ in anatomical origin: (1) those not derived from hypothalamic tissue but either from chemically induced brain tumors or even from a nonneural spontaneous tumor (lung carcinoma), and (2) those derived from the hypothalamus by way of viral transformation (SV40)of primary cultures of fetal hypothalamic cells. A. TUMOR-DERIVED CELLLINES 1. TRH-SynthesizingCell Lines (Grirnm-Jorgensen et al., 1976) Several clonal cell lines “of both glial and neuronal origin” isolated from an ethylnitrosourea-induced central nervous system tumor in a CDF rat were found to contain TRH-like irnmunoreactive material after methanolic extraction. The highest amount of imrnunoreactive material was found in two of them, BN 1010-1 and BN 1010-3, during their logarithmic phase (21.7-208.6 pg/mg alkali-soluble proteins). TRH was also detectable in a comparable amount in solid clonal tumors in CDF rats. These cell lines synthesized labeled TRH after incorporation of proline-gH (280-1200 cpm/108 cells after a 16-hour incubation in the presence of 33 pCi/ml L-proline). It is not yet known if these cells can release TRH into the medium. Preliminary electron microscope examinations of BN 1010-1 cells (TixierVidal and F‘feiffer, in preparation) showed that they did not look like normal secretory neurons. Their cytoplasm contained a great many free polysomes and a

HYPOTHALAMIC NEURONS IN CELL CULTURE

315

few linear rough cisternae. The Golgi zone was rather small compared to the rest of the cytoplasm in these large cells (15-20 pm). It contained irregular smooth cisternae and many smooth vesicles, coated and uncoated. In some cases, the smooth reticulum extended for a short distance into the cytoplasmic processes. Small, dense-cored vesicles (50 nm) were rarely seen. A few dense bodies were associated with the Golgi zone, but in some cells groups of closely associated lipid droplets were found in the perinuclear area. A suiking feature of these cells was the enhanced development of the cytoskeleton as revealed by the presence of numerous filaments (5-8 nm) concentrated at the periphery of the cell where they ran parallel to the plasma membrane. Numerous pinocytotic vacuoles were associated with the lateral and polar bundles of cytofiiaments. None of the cytoplasmic extensions, even the narrowest, displayed axonal features. They always contained ribosomes and filaments, but very few microtubules and rarely smooth reticulum. They did not form either axon terminals or synaptic contacts with cells of the same population, at least under routine culture conditions. Furthermore, some of these cells gave a positive reaction when immunochemically stained with anti-TRH IgG (A. Faivre-Bauman, unpublished observation). At the electron microscope level the reaction product was located in the cytop lasm, possibly on polysomes and ribosomes. As compared to normal neurosecretory neurons in vivo as well as in vitro, BN 1010-1 cells in primary cultures differ in several ways: the organization of the Golgi zone and its small size, the absence of axons, and the considerable development of cytofilaments. This contrasts with the fact that they contain and synthesize TRH, a peptide which appears to be exclusively a neuronal marker in primary cultures (see Section II,B and Tixier-Vidal et al., 1978). In addition, this cell line displays another neuronal feature: verauidine-scorpion venom stimulation of Na+ uptake (S.E. Heiffer, personal communication).

2. ~usopressin-ProducingCell Line (Pettengill et al., 1977) A human cell line has been established from a bone marrow metastasis of a small-cell anaplastic carcinoma of the lung. This cell line was designated DMS 44. It formed colonies of epithelioid cells which grew slowly and had a low plating efficiency. It was heteroploid (modal number 64 with a wide disuibution). The presence of vasopressin in the cells was visualized by irnmunocytochemical staining (light microscopy) using an antiserum to arginine vasopressin (AVP). Antisera to oxytocin, to human estrogen-stimulated neurophysin (ESN), and to human nicotine-stimulated neurophysin (NSN) failed to stain the cells. Vasopressin was also detected by radioimmunoassay in the DMS-44cell culture medium without purification or extraction. The values were clearly above those measured in the control medium, and the curve obtained with increasing dilution

3 16

A. TIXIER-VIDALAND F. DE VITRY

of the medium paralleled the vasopressin standard curve. Oxytocin, as well as ESN and NSN,was also sought by radioimmunoassay in the DMS-44 cell culture medium, but the values remained at the levels in the control medium. It was concluded that these cells only secreted vasopressin. Electron microscope study of these cells revealed interesting epithelioglandular features. They formed rather unusual cellular aggregations correlated with the presence of cellular contacts of both desmosomal and tight-junctional types. They had a high nucleus/cytoplasm ratio. The cytoplasm contained a minimal but variable amount of rough endoplasmic reticulum (RER), and a large number of free ribosomes and rosettes of polysomes. Membrane-bound granules (90-1 10 nm in diameter) were present in some of the cells and tended to be located in the short cellular processes rather than in the cell body. Light microscope examination of cells immunochemically stained with antisera to AVP revealed that many, although not all, of the cells were positive. Many of the cellular morphological characteristics of DMS-44 cells are very similar to those described for tumors obtained from a patient with small anaplastic carcinomas of the lung, which displayed a capacity for de novo synthesis of vasopressin in virro (George et a!., 1972). It was proposed (Levine and Metz, 1974) that such tumors, as well as the argentaffin-type cells of the normal bronchial tree, originate in and migrate from the neural crest during ontogeny. They would therefore belong to the APUD cell series as defined by Pearse (1969) which might also include hypothalamic peptidergic neurons (Pearse and Takor, 1976). As compared to normal hypothalamic vasopressin-containing neurons, DMS-44 cells differ on one important point: the absence of neurophysin. There is indeed much evidence that vasopressin and neurophysin II synthesis occurs simultaneously in vivo (see reviews of Zimmerman et al., 1975; Dierickx et af., 1978; Defendini and Zimmerman, 1978), and even in vitro, in organ cultures (Sachs et al., 1971) as well as in some SV40-transformed hypothalamic cell lines (see Section 111,B).The hypothesis that they have a common precursor molecule, put forward by Sachs et al. (1969), is still under study in several laboratories. The existence of a cell line which produces vasopressin only indicates that a mechanism might exist whereby vasopressin can be synthesized without neurophysin.

B. SV40-TRANSFORMED HYPOTHALAMIC CELLLINES In vitro infection with a virus offers another approach to isolating continuous cell lines. It permits better knowledge of the starting material, just before transformation, than in the case of tumor-derived cell lines. This technique was fvst used by Shein (1968) who obtained hamster astrocyte lines after transformation by SV40 and polyoma virus of a primary culture of brain cells.

HYPOTHALAMIC NEURONS IN CELL CULTURE

317

Such a method was successfully applied to primary cultures of fetal mouse hypothalamic cells. It allowed the isolation of several clonal cell lines characterized by various methods in order to compare their degree of differentiation with that of their in vivo counterparts as well as with that at their in vitro starting points (De Vitry et al., 1974; De Vitry, 1977, 1978; Tixier-Vidal and De Vitry, 1976). 1. Isolation and Characterization of Neurophysin-Vasopressin-Synthesizing Clonal Cell Lines One month after the addition of SV40 to 6-day cultures of hypothalamic cells taken from a 14-day mouse fetus, foci of highly dividing cells appeared and developed. These cells were collected, serially transferred, and called HT9. After the third passage, 10 clones were isolated from the HT9 strain. Six of them were selected because of their neuronelike features in the phase-contrast microscope: clones C7,E2, G3,B4,B8, and H6 (Fig. 9). Among them, clone C7 has been extensively characterized. Its doubling time is 24 hours. It is heteroploid (106 ? 5 ) and displays the SV40 T antigen as revealed in the nucleus by immunofluorescence staining.

FIG. 9. Phase-contrast microscope featuresof the four main types of SV40-transformedclones or subclones. D7 and B2 are neurosecretory subclones of the C7 neurosecretory clone. F7 is a primitive subclone of the C7 neurosecretory clone, and D12 is an intermediate subclone of the C7 neurosecretory clone. ~ 2 8 0 .

318

A . TIXIER-VIDAL AND F. DE VITRY

a. Biochemical Properties of Clone C7 (De Vitry et al., 1974, 1975). After a 48-hour incubation of cells with ~ y s t e i n e - ~a ~35S-labeled S protein material with a molecular weight of 10,000, soluble in 0.1 M hydrochloric acid, was isolated from cell extracts after purification on Sephadex G-75. The apparent molecular weight and isoelectric focusing behavior of this protein component were characteristic of neurophysins. In addition, this protein component was recognized by a bovine neurophysin I1 antiserum both by radioimmunoassay and with immunochemical staining. Besides neurophysin-like proteins, C7 cells also synthesized an %-labeled peptidic material of molecular weight close to 1000, which was radioimmunologically undistinguishable from AVP. The same conclusions were drawn from immunoperoxidase staining. However, negative results were obtained with an antioxytocin serum in both radioimmunoassay and immunocytochemical staining. b. Ultrastructural Features (De Vitry et al., 1975; Tixier-Vidal and De Vitry , 1976). These cells possessed ultrastructural features characteristic of intense secretory activity (Fig. 10). Their very large Golgi zone contained abundant microvesicles and numerous stacks of four to six saccules, as well as membrane-bound secretory-like material localized within rounded granules (100-nm in diameter) or small, elongated strips. Many free ribosomes and rosettes of ribosomes were seen within the cytoplasm, but linear RER cisternae were less frequent. In addition, some cells contained numerous large, dense bodies of irregular size and shape. These cells formed long cytoplasmic processes which contained ribosomes, mitochondria, and sometimes elongated smooth cisternae, narrow strips of dense material, and a few microtubules. These processes did not display axonal feature at any distance from the perikarya, and they did not form either axon terminals or synaptic contacts with other cells of the same population. Irnrnunuchernical staining using an antiserum to bovine neurophysin I1 allowed the localization of neurophysin at the ultrastructural level (Tixier-Vidal et al., 1975). A positive reaction was obtained within a large proportion, although not all, of the cell population. When the specific neurophysin I1 was previously absorbed with crude neurophysins, the imqunocytochemical staining was greatly decreased, although a few cells still displayed a partial, slight positive reaction. The inhibition was therefore not total, which may be related to the fact that a heterologous system was involved. A positive reaction was found in FIG. 10. An electron migrograph of a cell of a SV40-transformed neurosecretory clone (C7). Note the extension of the Golgi zone (G)which contains numerous stacks of saccules and membtane-bound dense materials (arrows). The long, polar cytoplasmic extension does not contain micratubules. Numerous dense bodies (db) are seen in the cytoplasm as well as in the cytoplasmic extension, x6OOO. Inset: x12,OOO.

HYPOTHALAMIC NEURONS IN CELL CULTURE

3 19

320

A . TIXIER-VIDAL AND F. DE VITRY

the cytoplasm either in the perikaryon or in cell processes. The reaction product displayed a “particulate” distribution, which seemed to repeat and to amplify the ribosomal distribution as revealed after conventional ultrastructural study. In addition, a few positive, small secretory granules were found. The large, dense bodies were either unstained or displayed nonspecific staining. At the level of the Golgi zone, there was no modification in density and distribution of the reaction product in the cytoplasm, but the smooth membranes of the flat cisternae and Golgi vesicles were completely unstained. Similarly, no reaction product was found within the cisternae of the smooth endoplasmic reticulum (SER)or the RER . In view of the abundance of dense material or dense bodies within the Golgi zone, as well as of the importance of lysosomes in the secretory cycle of neurosecretory cells in vivo (Boudier and Picart, 1976), acid phosphatases were localized in another neurosecretory clone, B4 (DeVitry, 1978) (Fig. 11). At the electron microscope level the specific reaction product was located in most of the dilatated smooth cisternae of the large Golgi zone. In addition, the reaction product was also localized in narrow strips within some long cytoplasmic extensions. Such structures displayed only a very low electron density when the reaction was performed in the presence of sodium fluoride as inhibitor. It appears therefore that the majority of the membrane-bound material located in the Golgi zone represents lysosomes rather than secretory material. This correlates well with the fact that these structures were found to be negative after immunocytochemical staining. This suggests an intense and rapid degradation of the neurosecretory material in the vicinity of its sites of synthesis and segregation. c . Possible Physiological Correlations with the Morphological Features. The absence of axons and axon terminals in C7 cells might be correlated with their apparent inability to release vasopressin and with their electrophysiologicalprop erties. 1. In attempts to release vasopressin from neurosecretory cells, various pharmacological and biological compounds known to be active in vivo were tested for their effects on vasopressin release from cultured cells of either clone C7 or its M ) , nicotine M ) , a high potassium subclone D7: carbamylcholine concentration (56 mM), and cooling. All were unable to induce vasopressin release from 2 x loe cells in 3 ml of medium, using a radioimmunoassay with a sensitivity of 5 pglml (collaboration with P. Czernichow, Paris). FIG.11. A light micrograph of cells of a SV40-transformed neurosecretory clone (B4) treated by Gomori’s procedure to localize acid phosphate activity. (a) The positive reaction is intense and localized in both the perikarya and the long cytoplasmic extensions. (b) The enzyme activity was inhibited by sodium fluoride. Fixed in 1% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, on a 8-glycerol phosphate substrate; incubation at 37°C for 90 minutes. x 350.

HYPOTHALAMIC NEURONS IN CELL CULTURE

32 1

322

A. TIXIER-VIDAL AND

F. DE VITRY

2. Electrophysiological and pharmacological studies (Bioulac et al., 1977) have been performed on a C7 subclone, D7. These cells possess a low resting membrane potential (1 1.3 ? 2.8 mV over 234 neurons) and a weak membrane resistance (0.72 .t 0.67 M i l over 82 neurons). They do not exhibit spontaneous activity. After individual electrical stimulation, as well as after general stimulation with the help of special grids on which cells are grown, very few cells develop an action potential of 10-20 mV. Microiontophoretic application of a neurotransmitter such as glutamate or acetylcholine, does not induce an action potential. Nevertheless, dopamine and y-aminobutyric acid, known to have an inhibitory effect in vivo, appear to exert a slight hyperpolarizing effect on the resting membrane potential of the D7 cells. Norepinephrine has not yet been used. Radioimmunoassays with a sensitivity of 5 pg/ml carried out on the culture medium after electrical stimulation did not reveal any measurable amount of vasopressin. These neurosecretory lines therefore do not appear to possess the electrophysiological characteristics of fully differentiated magnocellular neurons in vivo, as well as in vitro, at least in explant cultures (Geller, 1975; Gahwiler et al., 1978). d. Presence of PAdrenergic Receptors (collaboration with J . Bockaert , Paris, see De Vitry, 1978). Electrophysiological studies in vivo have shown that adrenergic drugs inhibit neurosecretory cells of the supraoptic and paraventricular nuclei (Barker et al., 1971; Moss et al., 1972). Autoradiographic evidence indicates that noradrenergic terminals make synapses with neurosecretory neurons in this area (Alonso, 1973). Thus the presence of P-adrenergic receptors has been sought in the B4 cell line. These cells contained an adenylate cyclase which was stimulated by (-)-isoproterenol (about 13-fold) and (-)norepinephrine. Dopamine at very high concentrations had a small stimulatory effect. Stimulation by these three agonists was blocked by (-)-alprenolo1 (a specific P-adrenergic antagonist), but not by phentolamine (a specific a-adrenergic antagonist) or fluphenazine (a dopaminergic antagonist), indicating the presence of a /3-adrenergic receptor coupled with adenylate cyclase in this cell line and the absence of a dopaminergic receptor. The apparent activation constants were 4.5 X lo-' M and lop5 M for (-)-isoproterenol and (-)norepinephrine, respectively. The P-adrenergic receptor was also detected by (-)-dihydr~alprenolol-~Hbinding (K, = 13 nM). The presence of P-adrenergic receptors on cells indicates that they could respond to adrenergic drugs by inhibiting vasopressin release. Unfortunately, the undetectable basal level of the hormone in the medium of control cells does not permit such a study. In addition, it must be noted that, based on present knowledge, the presence of P-adrenergic receptors is not restricted to neurons. e. Absence of Acetylcholine Receptors (collaboration with J. Merlie, Paris,

HYPOTHALAMIC NEURONS IN CELL CULTURE

323

see De Vitry, 1978). In vivo microiontophoresis of acetylcholine on hypothalamic neurosecretory cells accelerates their spontaneous discharge rate (Barker et al., 1971 ;Moss et al., 1972). We have sought acetylcholine receptors on the neurosecretory clone D7, using a-bungarotoxin (3Hor 12gI-labeled) known to bind irreversibly to nicotinic receptors. Whether the binding assay was performed on intact cells or on solubilized receptors, it gave negative results. Cells pretreated with d-tubocurarine (lop5 M ) were used as controls. These results are in agreement with the observation that these neurosecretory cells were unable to give an electrophysiologicalresponse to a microiontophoretic application of acetylcholine (see above). f. Attempts to Induce Axon Terminals. Since mature axon terminals differentiated de novo in primary cultures of 14-day-old hypothalamic cells but were not yet present at the time of introduction of the virus (6 days), we hypothesized that their absence in SV40-transformed cell lines might result from a lack of interaction with glial cells which also differentiated in primary cultures. Since in vivo most of the axon terminals of the neurophysin-synthesizing neurons are concentrated in the postpituitary, we used the following approach. Organ cultures of postpituitaries taken from 16-day mouse fetuses were initiated in plastic petri dishes. The small explants rapidly attached, and cell outgrowth began within 2 days. At this stage, D7 cells were seeded at a low density in the same dish, and their behavior was examined during the following days. In some cases, the cultures were treated with cytosine arabinoside in order to inhibit cell division and favor cell differentiation. The D7 cells attached to the dish only, not to the explant. They were concentrated around the explant, where they formed a sort of crown and sent cytoplasmic extensions toward the explant as well as in other directions. An electron microscope analysis of the contact zone is still in progress. Thus far we have not found induction of axon terminals and synaptoid contacts between pituicytes and D7 cell processes. As a whole, this extensive analysis of the properties of SV40-transformed neurosecretory cell lines allows the following interpretation of their degree of differentiation. They synthesize immunoreactive material, either neurophysin and vasopressin or an eventual common precursor, which is almost totally located in the cytoplasm. Whether this cytoplasmic compartment corresponds to “soluble” material or to a polysome-linked material cannot be determined from electron microscope immunocytochemical study only. These secretory materials would be rapidly degraded by lysosomal enzymes. The considerable development of lysosomes might represent either the primary cause or a consequence of the cell’s inability to release its secretory product. If only the second eventuality were true, this would mean that the cells lack some membrane differentiation which in their normal counterparts is responsive in the completion of the neurosecretory process, including packaging in membrane-bound granules, migration within axon terminals, and release by exocytosis. This lack of membrane

324

A. TIXIER-VIDAL AND F. DE VITRY

differentiation might result from an effect of the SV40 transformation or from an absence of target cells, or from both. 2. Characterization of Other Clones and Subclones of the SV40-Transformed HT9 Strain (Tixier-Vidal and De Vitry, 1976) Morphological characterization of eight clones of the original strain HT 9 and six subclones of the C7 neurosecretory clone has been made using the following criteria: Gomori’s paraldehyde fuchsin as a stain for neurosecretory cells, P-glucuronidase cytochemical detection (a lysosomal enzyme known to play a role in the metabolism of gangliosides during brain development), immunochemical staining using several antisera (antisera to bovine neurophysin LI, bovine neurophysin I, AVP, oxytocin, TRH, and LHRH), and electron microscope examination. Based on this study, these clones were arranged in three groups (Fig. 12): 1 . Neurosecretory clones displayed the same ultrastructural features and the same P-glucuronidase-positive reaction as the C7 clone. In addition, they all

C7

G3

€2

W

W

Be

8 clom

€12 FS

NI+ VP-

1’

C6

82

N+,VP+ .

‘

D12

NI+ VP-

€7

F7

I

ruklom

71

FIG.12. A schema summarizing the immunocytochemical properties of eight clones of the initial HT9 strain and six subclones of the C7 neurosecretory clone.

HYPOTHALAMIC NEURONS IN CELL CULTURE

325

gave a positive reaction with antisera to bovine neurophysin 11, bovine neurophysin I, and AVP. All were negative for the other antisera. In other words, they all of belong to the magnocellular neuronal type. Such properties were found in four clones of the original HT 9 strain (C7, B4, E2, and G3), as well as in three subclones of the C7 clone (D7, B2, and C6). 2. Primitive clones were negative for all the tests which gave a positive response with neurosecretory clones. At the electron microscope level they did not display secretory features, and in contrast to the neurosecretory clones they contained fibrils (5-6 nm) which formed bundles beneath the plasma membrane. Some of them looked like the clear cells of the basal layer described above for young cultures of 14-day cells and tentatively identified as spongiocytes. Such features were encountered in clones of the original strain, as well as in a subclone, F7,of the C7 clone. In addition the F7 subclone was also found to contain a specific /3-adrenergic receptor as identified by the activation of adenylate cyclase. The apparent activation constant was higher in F7 cells than in B4 cells, although the level of stimulation was lower in the former than in the latter (collaboration with J. Bockaert, see De Vitry, 1978). 3. Intermediate clones displayed features intermediate between those of the two previous groups. They reacted positively with an antiserum to bovine neurophysin I but not to antisera to bovine neurophysin 11, AVP, and oxytocin. Such properties were found in a clone of the original HT9 strain, as well as in a subclone of the C7 clone. The fact that separated clones reacted only with antiserum to bovine neurophysin I does not allow us to conclude to the existence of separate clones for the synthesis of mouse neurophysin I and neurophysin 11, since a heterologous system is involved. Progress in obtaining knowledge of the immunochemical properties of mouse neurophysins would be needed for this purpose. The existence of clones intermediate between primitive clones and neurosecretory clones suggests the existence of a precursor relationship between them. This affdiation might follow progressive steps, as discussed in the next section.

3 . Maturation of Primitive Nerve Cells into Neurosecretory Cells The fact that the C7 neurosecretory clone underwent phenotypic changes after several transfers and that primitive clones were found among its subclones (clone F7) suggests the existence of a reversible affiliation between primitive nerve cells and neurosecretory cells. An experimental demonstration that primitive cells are precursors of neurosecretory cells has been obtained in vivo (De Vitry, 1977), although not yet in vitro. The primitive clone F7, when injected subcutaneously into syngeneic mice, gave rise to tumors which, after subculture, contained not only primitive

326

A. TJXIER-VIDAL AND

F. DE VITRY

cells but also neurosecretory cell types having the same diversity seen in C7 subclones: 1. Cells which had the same phase-contrast microscope features as the neurosecretory clone C7 but could not be dissected out from the cultured cells. 2. Cells which were immunoreactive with bovine neurophysin I antisera but not with neurophysin I1 or vasopressin antisera. These cells are positive for the two other tests we used to characterize neurosecretory cells: Gomori 's aldehyde fuchsin and P-glucuronidase histochemical staining. These observations support the view that the cells of neurosecretory lines undergo modifications of their differentiated properties under in v i m conditions but retain the ability to express again some of their specific functions under favorable conditions such as in vivo passage. Similar morphological and cell function alterations have been reported in the case of endocrine tumor cell lines; hormonal activity was restored by animal passage in tumor cells which no longer synthesized their specific hormones in virro (Buonassisi et af., 1962; Sat0 and Buonassisi, 1964; Niesor, 1977).

4. Conclusion SV40 transformation of primary cultures is a useful tool for obtaining clonal cell lines which can be compared to the cell types present in primary cultures at the time of introduction of the virus (Section 11). Neurosecretory cell lines possess the neurophysin-vasopressin synthesis capacities of hypothalamic magnocellular neurons, without possessing complete terminal differentiation. They may provide a simplified system for studying mechanisms involved in the synthesis of a peptide hormone or of its precursor. They seem to undergo a developmental stage found in vivo in the early fetus. Indeed, some hypothalamic peptides, such as TRH (see Section II,B and Faivre-Bauman er al., 1978a) and vasopressin (P. Czernichow, unpublished observation), are detectable in 14-day mouse fetuses several days before the differentiation of axon terminals. The formation of cellular contact between neurosecretory axons and their normal target cells, pituicytes, might be a necessary step in completion of their morphofunctional differentiation. In this respect, it must be remembered that axon terminals were not yet differentiated when the virus was inoculated into the culture. (Section 11,A). From another point of view, the observation that neurosecretory clones all expressed the same peptidergic function is difficult to explain. This might suggest that SV40 integration occurred in a single cell already committed to neurophysin-vasopressin function, a hypothesis which also agrees with the existence of an affiliation or cell lineage between primitive and neurosecretory clones.

HYPOTHALAMIC NEURONS IN CELL CULTURE

327

The existence of primitive clones which do not display glial features, at least in their ultrastructure, is consistent with the observation that an ultrastructural pattern of glial differentiation was not yet apparent in a 6-day primary culture at the time of introduction of the virus. This means that, when SV40 integration occurred in a neuroglial percursor cell, the glial morphological differentiated pattern ceased to progress. Such a process was reported for another marker of glial differentiation after passage through athymic nude mice of other SV40transformed hypothalamic cell lines (Benda et al., 1977). In this case, an oligodendrogliaf biochemical marker was expressed: glycerol phosphate dehydrogenase and its inducibility by hydrocortisone (DeVellis and Inglish, 1973). Last, SV40 transformation in vitro may also offer an approach to experimental study of the ontogenesis of hypothalamic cells. Autoradiographic analysis and morphological observations performed in vivo on the developing brain have led to the conclusion that neurons and neuroglial cells derive from the ventricular cells of the neural tube by progressive divisions. It is not yet clear whether neurons and neuroglial cells arise from a common precursor (see reviews in Peters et al., 1976; Bondar, 1978; Fedoroff, 1978). In the case of the walls of the third ventricle two peptides have been detected in the mammalian fetus. Vasotocin, an embryonic form of vasopressin, was found in primitive ependymal cells of the pineal and of the subcommissuralorgan (Pave1 et al., 1977), and somatostatin in tanycytelike cells of the median eminence (Dubois, 1976). This favors the proposition that fetal ependymal cells represent the most primitive secretory cells of the brain (Olsson, 1963). The exact relationship between these cells and adult neurosecretory neurons is nevertheless unknown. The existence of primitive and intermediate clones within SV40-transformed cell lines might permit a study of such a relationship.

IV. General Conclusions As compared to primary cultures, none of the presently available hypothalamic cell lines resume the complete pattern of neuronal differentiation in culture. They rather seem to represent a stable interruption of a program which is continuously evolving in vivo. From this viewpoint, they offer homogeneous cell populations for the study of steps in the biochemical differentiation of hypothalamic neurons, mainly as concerns the synthesis of peptide hormones or of their precursors. There is reason to believe that it is possible to obtain other cell lines synthesizing other peptides. For this purpose, SV40 transformation of primary cultures established at various stages of development, as well as tumors of neural crest origin, offers a promising approach. However, it remains hypothetical that hypothalamic cell lines can complete their neuronal pattern of development in vitro. Untrans-

328

A. TIXIER-VIDAL AND F. DE VITRY

formed primary cultures may be better tools for studying synaptogenesis in vitro than continuous cell lines. In fact, morphologically differentiated synapses have not yet been obtained in any neuronal clonal line, although chemical and electrophysiological transmission was recently demonstrated between clonal nerve cell lines and muscle cells (Nelson et af.,1976; Schubert et al., 1977). Another limitation in the use of continuous cell lines is that they are transformed and heteroploid. They may express functions which would have been repressed during execution of the normal program of differentiation. For example, the extensive development of filaments in the BN 1010-1 clone which synthesizes TRH is a glial rather than a neuronal feature. The simultaneous expression of glial and neuronal features has been reported for other neural cell lines (Schubert etal., 1974, 1975; see reviews by Pfeiffer et af., 1978; Patrick et af., 1978). This must be kept in mind if one wishes to use them for an analysis of neuronal and glial ontogeny. In this respect, primary cultures and, within certain limits, their SV40-transformed derivatives, offer models closer to the normal situation than tumor-derived cell lines. At present, the experimental analysis of hypothalamic differentiation is still in its infancy. However, current data allow an optimistic view of the future. Both primary cultures and continuous cell lines hold the promise of being good models provided constant comparisons are made with their in vivo counterparts. This is an absolute prerequisite for asking the right questions when investigating mechanisms involved in neurogenesis at the hypothalamic level.

ACKNOWLEDGMENTS We acknowledge the excellent technical assistance of Mrs. R. Picart and Mr. Claude Pennarun. This work was supported by grants from the Centre National de la Recherche Scientifique (E.R. 89 and ATP 1256 and 2110). We are grateful to Dr. Angie Rizzino (Department of Biology, University of California, San Diego) for his help and advice in the preparation of the English text.

REFERENCES Alonso, G. (1973). C.R. Hebd. Seances Acad. Sci., Ser. D 277, 2769. Araki, S., Toran-Allerand, C. D., Ferin, M.,and Vande Wiele, R . L. (1975). Endocrinology 97, 693. Augusti-Tocco, G.. and Sato. G. (1969). Proc. Nail. Arad. Sci. U.S.A. 64, 31 1. Barker, J., Crayton, J., and Nicoll, R. (1971). Science 171, 208. Barry, J., and Dubois, M. P. (1974). Brain Res. 67, 103. Benda, P., De Vitry, F., Picart, R., and Tixier-Vidal, A. (1975). Exp. Brain Res. 23,29. Benda, P., Illinger, D., Poindron, P.,Fiszman, M., and Salomon, J. C. (1977). Brain Res. 122, 191.

HYPOTHALAMIC NEURONS IN CELL CULTURE

3 29

Bioulac, B., Dufy, B., De Vitry, F.. Fleury, H., Tixier-Vidal, A,, and Vincent, J. D. (1977). Neurosci. Lett. 4, 257. Bondar, R. L. (1978). “Dynamic Properties of Glial Cells” (E. Schoffeniels, G. Frank, D. B. Towers, and L. Hertz, ed.), p. 3. Pergamon Press, Oxford. Borghese, E. (1954). Tex. Rep. Biol. Med. 12, 215. Bomstein, M. B . , and Model, P. G. (1972). Bruin Res. 37, 287. Boudier, J. A., and Picard, D. (1976). Cell Tissue Res. 172, 39. Bugnon, C., Bloch, B., and Fellmann, D. (1977a). Brain Res. 128,249. Bugnon, C., Fellmann, D., and Bloch, B. (1977b). Cell Tissue Res. 183, 319. Buonassisi, U . , Sato, G., and Cohen, A. (1962). Proc. Natl. Acad. Sci. U.S.A. 48, 1184. Cadilhac, J., and Pons, F. (1976). C.R. Seances Sor. Biol. Ses. Fil. 170, 25. Canick, J. A., Vaccaro, D. E.. Ryan, K. J . , and Leeman. S . E. (1977). Endocrinology 100,250. Daikoku, S . , Kotsu. T..and Hashimoto, M. (1971). 2. Anur. Enrwicklungsgesch. 134, 31 1. Defendini, R., and Zimmennan, E. A. (1978). In “The Hypothalamus” ( S . Reichlin, R. J. Baldessarini, and J. M. Martin, eds.), p. 137. Raven, New York. De Vellis, J., and Inglish, D. (1973). Prog. Neurobiol. 40, 321. De Vitry, F. (1977). Nature (London) 267, 48. De Vitry, F. (1978). In “Cell Biology of Hypothalamic Neurosecretion” (J. D. Vincent and C. Korton, ed.), p. 803. CNRS, Paris. De Vitry, F., Camier, M., Czernichow, P., Benda, P., Cohen, P., and Tixier-Vidal, A. (1974). Proc. Natl. Acad. Sci. V.S.A. 71, 3575. De Vitry, F . , Camier, M . , Czernichow, P.. Benda, P., Cohen, P., and Tixier-Vidal, A. (1975). Ann. N.Y. Acad. Sci. 248, 64. Dierickx, K., Vandesande, F., and Goossens, N. (1978). In “Cell Biology of Hypothalamic Neurosecretion” (J. D. Vincent and C. Kordon. ed.), p. 391. CNRS, Paris. Dubois, M. P. (1976). INSERM Colloq. Synrh. Ser. Action Thematique. Rapp. 7, 179. Dubois, M. P. (1978). In ”Cell Biology of Hypothalamic Neurosecretion” (I. D. Vincent and C. Kordon, ed.). CNRS, Paris, 701. Eggena, P., and Polson, A. X. (1974). Endocrinology 91, 35. Eurenjus. L., and Jarskar, R. ( 1974). Cell Tissue Res. 149, 333. Faivre-Bauman, A,, Grouselle, D., Nemeskeri, A,, and Tixier-Vidal, A. (1978). Brain Res. 154, 382. Faivre-Bauman, A., Nemeskeri, A., Tougard, C., and Tixier-Vidal, A., submitted. Fedoroff, S . (1978). ”Dynamic Properties of Glial Cells” (E. Schoffeniels, G.Frank, D. B. Towers, and L. Hertz, eds.), p. 83. Pergamon Press, Oxford. Fink, G., and Smith, G. C. (1971). 2. Zelvorsch. Mikrosk. Anar. 119, 208. Gahwiler, B. H., Sandoz, P.. and Dreifuss. J. J. (1978). Brain Res. 151, 245. Geller, H. M. (1975). Brain Res. 93, 511. George, J. M., Capen, C. C., and Phillips, A. S. (1972). J . Clin. Invest. 51, 141. Golden, G. S. (1973). Dev. Biol. 33, 300. Greene, L., and Tischler, A. (1976). Proc. Natl. Acad. Sci. V . S . A . 73, 2424. Greene, L., Sytkowski, A,, Vogel, Z., and Nirenberg, M. (1973). Nature (London) 243, 163. Grimm-Jorgensen, Y . , Pfeiffer, S . , and McKelvy, J. (1976). Biochem. Biophys. Res. Cornmun. 70, 167. Guillemin, R. (1978). In “The Hypothalamus” ( S . Reichlin, R. J. Baldessarini, and J. B. Martin, eds.), p. 155. Raven, New York. Halasz, B., Kosaras, B., and Lengrari, I. (1972). In “Brain Endocrine Interaction, Median Eminence: Structure and Function” (R. M. Knigge, D. E. Scott, and A. Weindl, eds.), p. 27. Karger, Basel. Hild, W. (1954). 2.Zellforsch. Mikrosk. Anar. 40, 257.

330

A. TIXIER-VIDAL AND F. DE VITRY

Knigge, K. M., Hoffman, G., Scott, D. E., and Sladek, J. D., Jr. (1977). Brain Res. 120, 393. Leclerc, R., and Pelletier, G. (1977). Brain Res. 129, 275. Levine, R. J., and Metz, S. A. (1974). Ann. N.Y. Acad. Sci. 230, 533. McCarthy, K. D., and Partlow, L. M. (1976). Brain Res. 114, 391. McKelvy, J. F. (1974). Brain Res. 65, 489. McKelvy, J. F. (1975). Enhcrinology 97, 908. Mains, R. E.,and Patterson, P. H. (1973). J. Cell Biol. 59, 329. Masurovsky, E., Benitez, H., and Murray, M. (1971). J. Comp. Neurol. 143,263. Moss, R., Urban, I., and Cross, B. (1972). Am. J. Physiol. 223, 310. Nelson, P., Christian, C.. and Nirenberg, M. (1976). Proc. Natl. Acad. Sci. U.S.A. 73, 123. Niesor, E. (1977). Abstract, Eur. Assoc. Study Diabetes, 13th Annu. Meet. Niimi, K., Harada, I., Kusaka, Y.,and Kishi, S. (1962). J . Exp. Med. 8, 203. Olson, L., and Seiger, A. (1972). Z. Anal. Entwicklungsgesch. 137, 301. Olsson, R. (1963). Proc. inr. Congr. Zool., Ibth, 1963 Vol. 3, p. 38. Patrick, J., Heineman, S., and Schubert, D. (1978). Ann. Rev. Neurosc. 1,417. Paull, W. R. (1977). “Brain Endocrine Interaction 111. Neural Hormones and Reproduction” (D. E. Scott, G.P. Kozlowski, and A. Weindl, eds.), p. 16. Karger, Basel. Pavel, S., Goldstein, R., Ghinea, E., and Calb, M. (1977). Endocrinology 100, 205. P e w , A. G. E. (1969). J. Hisrochem. Cytochem. 17, 303. P e a , A. G. E., and Takor, T. (1976). Clin. Endocrinol. 5, Suppl., 2295. Pearson, D. (1977). “Cell Tissue and Organ Culture in Neurobiology” (S.Federoff and L. Hertz, eds.), p. 573. Academic Press, New York. Pearson, D., Shainberg, A., Osinchak, J., and Sachs, H. (1975). Endocrinology 96, 982. Peters, A., Palay, S. L., and de Webster, H. (1976). “The Fine Structure of the Nervous System,” Saunders, Philadelphia, Pennsylvania. Pettengill, O., Faulkner, C.. Wurster-Hill, D., Maurer, L.. Sorenson, G., Robinson, A,, and Zimmerman, E. (1977). J . Narl. Cancer Insr. 58, 51 1 . Pfeiffer, S. E., Betschart, B., Cook, J., Mancini, P., and Moms, R. (1978). In “Cell Tissue and Organ Cultures in Neurobiology” (S. Federoff and L. Hertz, eds.), p. 287. Academic Press, New

York. Picart, R., and Tixier-Vidal, A. (1974). J . Microsc. (Paris) 20, 80. Raisman, G., and Field, P. M. (1973). Brain Res. 54, 1 . Sachs, H., Fawcett, P., and Takabatake, Y. (1969). Recent f r o g . Horm. Res. 25, 447. Sachs, H., Goodman, J., Osinchak, J., and McKelvy, J. (1971). Proc. Narl. Acad. Sci. U.S.A. 68, 2782. Sato, G. (1973). ‘Tissue Culture of the Nervous System.” Plenum, New York. Sato, G., and Buonassisi, V. (1W). Narl. Cancer Inst., Monogr. 13, 81. Scharrer, E. (1928). Z . Vergl. Physiol. 7, I . Schiebler, T. H. (1977). “Brain-Endocrine Interaction 111. Neural Hormones and Reproduction” (D. E. Scott, G. P. Kozlowski, and A. Wiendl, eds.), p. 46. Kacger, Basel. Schubert, D., Humphreys, S., Baroni, C., and Cohn, M. (1969). Proc. Narl. Acad. Sci. U.S.A. 64, 316. Schubert, D., Heinemanns, S., Carlisle, W., Tarikas. H., Kimes, B., Patrick, J., Steibach, J. H., Culp, W., and Brandt, B. L. (1974). Nature (London) 249, 224. Schubert, D., Kidokoro, Y.,and Heineman, S. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 2579. Sensenbrenner, M., and Mandel, P. (1974). Exp. Cell Res. 87, 159. Shein, H. M. (1968). Science 159, 1476. Silberman, A. J. (1975). Am. J . Anat. 144,445. Sobkovicz, H., Bleier, R., and Monzain, R. (1974). J . Comp. Neurol. 155, 355. Tixier-Vidal, A., and De Vitry, F. (1976). Cell Tissue Res. 171, 39.

HYPOTHALAMIC NEURONS IN CELL CULTURE

33 1

Tixier-Vidal, A., and Pfeiffer, S. E. (1978). In preparation. Tixier-Vidal, A., Benda, P., De Vitry, F., and Picart, R. (1973). Commun., Colloq. Neuroendocrinol.. 5th. 1973. Tixier-Vidal, A., Tougard, C., and Picart. R. (1975). In “Immunoenzymatic Techniques” ( G . Feldmann et al.. eds.), p. 307. North-Holland Publ., Amsterdam. Tixier-Vidal, A., Nemeskeri, A., and Faivre-Bauman, A. (1978). I n “Cell Biology of Hypothalamic Neurosecretion” (J. D. Vincent, and C. Kordon, ed.), 777. CNRS, Paris. Toran-Allerand, C. D. (1976). Brain Res. 106, 407. Toran-Allerand, C. D. (1978a). Brain Res. 149, 254. Toran-Allerand, C. D. (1978b). I n “Cell Biology of Hypothalamic Neurosecretion,” p. 759. (J. D. Vincent and C. Kordon, eds.). CNRS, Paris. Trentkner, E., and Sidman, R. L. (1977). J . Cell B i d . 75, 915. Vaccaro, D. E., Messer, A,, Lam, D. M. K., and k m a n , S. E. (1976a). Fed. Proc., Fed. Am. Sor. Exp. Biol. 35, 1648. Vaccaro, D. E.,Messer, A., and Leeman, S . E. (1976b). 6th Annu. Meet. Soc. Neurosci., Neurosci. Abstr. p. 1492. Vale, W., Rivier, C., and Brown, M. (1977). Ann. Rev. Physiol. 39, 473. Varon, A,, and Raibom, C. (1%9). Brain Res. 12, 180. Varon, S.(1975). Exp. Neurol. 48, 93. Wilkinson, M., Gibson, C. I., Bressler, P. H., and Inman, D. R. (1974). Brain Res. 82, 129. Yavin, E., and Menkes, J. H.(1973). J. Cell B i d . 57, 232. Yavin, Z., and Yavin, E. (1977). Exp. Brain Res. 29, 137. Zimmerman, E. A,, Defendini, D.,Sokol, H. W.,and Robinson, A. G. (1975). Ann. N.Y. Acad. Sci. 248.92.

This Page Intentionally Left Blank

INTERNATlONAL REVIEW OF CYTOLOGY,VOL. 58

The Subfornical Organ H. DIETER DELLMANN Depament of Veterinary Anatomy, Pharmacology. and Physiology, Iowa State University. Ames. Iowa

JOHN B. SIMPSON Department of Psychology, University of Washington, Seattle, Washington

. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . .. Normal General Morphology of the Subfornical Organ . . . A. Neurons . . . . . . . . . . . . . . . . . . . B. GlialCells . . . . . . . . . . . . . . . . . . C. Other Cells . . . . . . . . . . . . . . . . . . D. Vascularity . . . . . . . . . . . . . . . . . . E. Histochemistry and Irnrnunocytochemistry . . . . . . . Functions of the Subfornical Organ . . . . . . . . . .

. . . . . . . . .

333 335 336 336 360 375 380 383 384

Studies . . . . . . . . . . . . . . . . . . . . B. Physiological Studies of the Subfornical Organ . . . . . . V. Conclusions . . . . . . . . . . . . . . . . . . . VI. Table of Investigated Species . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

385 391 399 402

1. Introduction 11. Development

111.

IV.

A. Experimentally Induced StNCtUral Changes; Correlational

.

416

I. Introduction The subfomical organ (SFO) is a small, almost hemispherical or ovoid tubercle which protrudes into the lumen of the third ventricle at the level of the interventricular foramina. This topographic relationship is consistent in all vertebrates, regardless of whether the fornix is present or absent, as in lower vertebrates, and it is thus more appropriate to refer to the organ as the interventricular organ (Watermann, 1965b). The history of the discovery of the SFO is quite remarkable, It began in 1896 when Wilder first mentioned the existence of a crista fornicis, followed by Smith (1898) who observed that the choroid plexus terminated upon a small nodule, 333

Copyright 0 1979 by Academic Press. Inc. All rights of rcpmduction in any form PSXNUI.

ISBN 0-12-364358-9

334

H. DIETER DELLMA" AND JOHN B. SIMPSON

Tandler and Kantor (1907) who designated it vorderes Hockemhen, and Johnston (1913) who labeled it nucleus marginalis. Spiegel(l918) was the first to give a detailed account of the morphology of the SFO, which he named ganglion psalterii, in a variety of mammalian species. Its existence in various mammals was also reported by Putnam (1922) and Pines (1926), both apparently unaware of the previous descriptions, and Pines and Scheftel (1929) described the SFO for the first time in a reptile, an amphibian, a bird, and a fish. A detailed study of the SFO in all domestic mammals was published by Cohrs and von Knobloch (1936). and an excellent developmental investigationby von Knobloch (1937). In 1942, Legait expanded the investigation of the SFO to a large number of lower and higher vertebrates and further explored it in the late 1950s (E. Legait and Legait, 1957; H. Legait and Legait, 1957a,b; Legait et al., 1957). In 1959 Hofer introduced a unifying concept by combining a variety of organs or organlike formations (organartige Bildungen) whose structure was distinctly different from the typical morphology of the central nervous system (CNS)under one common heading, the circumventricular organs. He included in this classification the choroid plexus, the paraphysis, the suprapineal recess, the subcommissural organ (SCO), the neurohypophysis, the organum vasculosum laminae terminalis (OVLT), the area postrema, and the SFO. The most important common characteristics of these organs are their direct contact with the cerebrospinal fluid (CSF), their high vascularity, and the absence of a blood-brain barrier (for further details, see Hofer, 1958). The first ultrastructural description of the canine SFO by Andres (1965a,b) was significant in that it clearly established the neuronal nature of the parenchymal cells; in quick succession other transmission electron microscopic (TEM) studies confirmed and extended Andres* findings (Rohr, 1966a,b; Rudert et al., 1966, 1968; Pfenninger et al., 1967; Akert et al., 1967a,b; Dempsey, 1968; Pfenninger, 1969; Schinko et al., 1972). Morphometric studies by Palkovits (1966, 1969) and Palkovits and Wetzig (1969) showed a definite relationship between the SFO and various changes in the h;ydromineral equilibrium of the organism; Dellmann (1 970) confirmed and extended these findings at the ultrastructural level. Exploration of the ventricular surface of the SFO with scanning electron microscopy (SEM) (Leonhardt and Lindemann, 1973; Phillips et al., 1974) introduced a new dimension into SFO research and gave further insights into its fine structure. Other landmarks in the investigation of the SFO were the report by Simpson and Routtenberg (1973) presenting the first experimental evidence that it functioned in angiotensininduced drinking and the publications of Felix and Akert (1974), Felix (1976), and Phillips and Felix (1976), who demonstrated the presence of specific cholinoceptive and angiotensin-receptive neurons in the SFO. During the past decade and even more so during the past 5 years, our knowledge of both the morphology and function of the SFO has increased considerably. The precise ultrastructural identification of most of the neuronal, glial, and

THE SUBFORNICAL ORGAN

335

vascular components of this organ answered many of the questions left open by light microscopy, and earlier speculations on its structure were replaced by facts. Spectacular advances have been made in our knowledge of the functions of the SFO: whereas 10 years ago only hypotheses existed, today several functions in which the SFO is involved have been identified. A survey both of the published literature and of our own, in part unpublished, observations has clearly shown that the structural organization of the SFO is, in general, identical in all investigated vertebrates. It is presently possible to describe a certain number of structural features common to all or most investigated species, even though qualitative and quantitative species-specific differences undoubtedly exist. The primary aims of this article are to provide an account of these well-established common morphological characteristics of the SFO, to provide an overview of the controversial issues regarding its structure and function, and to point out the structural features whose identity is still unclear. It is beyond the scope of this article to give details on known species differences unless they are of particular interest for one reason or another. The reader who desires to obtain detailed information on a particular species is referred to Section

VI . 11. Development

The SFO derives from the ependymal wall of the telencephalon, from the dorsal portion of the commissural plate (in turn derived from the lamina terminalis) at the point of origin of the telencephalic choroid plexus (von Knobloch, 1937; Dannheimer, 1939; Scevola, 1941; Legait, 1942; Grignon and Grignon, 1957; Watermann, 1965a,b). The proliferation of ependymal cells and their migration into the depth of the organ are followed by its vascularization (von Knobloch, 1937; Scevola, 1941; Legait, 1942; Grignon and Grignon, 1957) and eventual overgrowth by the fomix (Grignon and Grignon, 1957; Watermann, 1965a,b), and finally by the formation of anastomoses with the blood vessels of the choroid plexus (Grignon and Grignon, 1957). The structure of the fetal SFO approaches that of the adult SFO (Dannheimer, 1939). There is, however, continued development after birth; for example, in the pig, it is only at about 4 months after birth that the definitive adult structure is established (von Knobloch, 1937). Legait et al. (1976) calculated the allometry coefficient of the SFO of rats during this species’ growth period and concluded that the SFO grew little during this period and that it follwoed a pattern different from that of the adenohypophysis and that of the neurohypophysis. These workers did not draw any further conclusions. Developmental studies have also clearly demonstrated that the SFO is not homologous with the paraphysis (Scevola, 1941; Ariens Kappers, 1955).

336

H. DIETER DELLMANN AND JOHN B. SIMPSON

111. Normal General Morphology of the Subfornical Organ The morphological components of the SFO are: neuronal perikarya and their dendrites and axons, dendrites and axons of unknown origin and destination, macroglial cells and microglial cells, ependymal cells and tanycytes, supraependymal neurons, glial cells, macrophages, and a rich vascular supply. These elements are discussed in turn. A. NEURONS In his first histological description of the SFO Spiegel (1918) identified some neurons among the nonglial cell population. Subsequently other investigators confirmed this finding but, since it was not always possible to establish with certainty the neuronal nature of these cells, some of them described these cells as “resembling nerve cells” (Putnam, 1922; Pines and Maiman, 1928; Pines and Scheftel, 1929; Spiegel, 1937; Scevola, 1939, 1941; Brizzee, 1954; Yamada and Hasunuma, 1955; Hasunuma, 1956; Stephan and Janssen, 1956; Legait et al., 1957; H. Legait and Legait, 1957b,c; Sprankel, 1957; Hofer, 1959; Creswell et al., 1964; Rabl, 1966; Weindl, 1965; Adhami, 1967; Watermann, 1969; Cramer, 1970). However, because some of these cells are modified to a point where their neuronal characteristics are virtually undetectable at the light microscope (LM) level, it is not surprising that many investigators remained uncertain about their nature and preferred the noncommittal name “parenchymal cell” (Pines and Maiman, 1928; Pines and Scheftel, 1929; Cohrs and von Knobloch, 1936; Legait, 1942; Asida, 1943; Leduc and Wislocki, 1952; Wislocki and Leduc, 1952; Legait and Legait, 1957; H. Legait and Legait, 1957b; Legait etal., 1957; Hofer, 1958; Pachomov, 1963; Rudert, 1965; Rudert et al., 1965; Watermann, 1965b; Adhami, 1967; Dellmann and Fahmy, 1967a,b; Sarrat, 1968; Cramer, 1970; Dretzki, 1971). In his ultrastructural analysis of the SFO, Andres (1965a) solved the problem of the identity of the parenchymal cells by clearly demonstrating their neuronal nature. At this point it has been established that the mammalian SFO contains only cell types which are classifiable either as neuronal or glial in nature, and the term “parenchymal cell” therefore is archaic and only of historical interest. With TEM, in most mammalian species at least four types of neuronal perikarya can be identified.

1. Neuronal Perikarya a. Type I Neuronal Perikarya. Type I perikarya were described under various names by Andres (1965a), Pfenninger et al. (1967), Dempsey (1968). Rudert et al. (1968), Schinko et al. (1972), and Dellmann and Simpson (1975a). They are characterized by a relatively large amount of light cytoplasm which

THE SUBFORNICAL ORGAN

337

makes them readily identifiable with the LM. The light nucleus is spherical or ovoid and often indented by one or more deep, narrow invaginations. Heterochromatin occurs in small amounts scattered throughout the nucleus and sparsely concentrated in the periphery (Fig. 1); a single spherical nucleolus is present. Short profiles of rough endoplasmic reticulum (RER),often dilated (Andres, 1965a), are usually scattered throughout the cytoplasm and form occasional small aggregates (Fig. 1). These are intermingled with other organelles, including free ribosomes and polysomes, small slender mitochondria, multivesicular bodies, dense bodies, occasional small lysosomes, numerous microtubules, and nucleolus-like bodies (NLBs) (Schinko el al., 1972; Hindelang-Gertner et al., 1974). The Golgi apparatus is prominent and multilocular in these neurons and gives origin to nongranulated and granulated vesicles (Fig. 2, inset) (70-185 nm, majority 120 nm, Dellmann and Simpson, 1975a; 150 run, Pfenniger et al., 1967). b. Type ZZ Neuronal Perikarya. This type of perikaryon was identified by Andres (1965a), Dempsey (1968), and Dellmann and Simpson (1975a). The nucleus is similar to that of type I neurons, but the cytoplasm is darker, primarily

FIG.1. Type I neuronal perikaryon separated from the ventricular lumen by a thin ependymal cell process. Note the aggregate of small profiles of RER on the right-hand side and the light cytoplasm. Rat. Bar, 5 pm. ~ 4 2 0 0 .

338

H. DIETER DELLMA" AND JOHN B. SIMPSON

FIG.2. Type I1 neuronal perikaryon with parallel long profiles of RER and dark cytoplasm Inset: resulting from the presence of ribosomes and many polyribosomes. Rat. Bar, 2 pm. ~6480. Granulated vesicles which occur in both type I and type I1 neumnal perikarya. Rat. Bar, 0.5 pm. x 30,190.

because of abundant free ribosomes and polysomes (Fig. 2). The RER profiles occur predominantly in parallel aggregates (Fig. 2). In addition, numerous dense, slender, elongated mitochondria with often widened cisternae (Andres, 1965a), multivesicularbodies, lysosornes, dense lamellar bodies, lipofuscin, and NLBs are present. The multilocular Golgi apparatus is prominent, and vesicles and granulated vesicles of the same size range as in type I perikarya are found in its vicinity (Dellmann and Simpson, 1975a). Because of these similarities and the Occurrence of perikarya with characteristics of both type I and type II neurons, as well as similar reactions of both cell types to a variety of experimental interventions, the validity of the classification of these perikarya into two separate types of neurons is questionable (Dellmann and Simpson, 1975a). Both type I and type I1 perikarya also occur in a supraependymal location (see Section III,A,l,f). c . Type IZZ Neuronal Perikarya. These perikarya were referred to as type-2 neurosecretory cells and are usually scarce (Pfenninger et al., 1967), except in

THE SUBFORNICAL ORGAN

339

the water buffalo (Dellmann and Simpson, 1975a). The nucleus of these cells has numerous shallow indentations, the nucleolus and chromatin are dense, and the heterochromatin is located predominantly in the periphery (Fig. 3). The cytoplasm is dense and contains tightly packed free ribosomes as well as polysomes which occupy most of the cytoplasmic strands between the variably dilatated cistemae of the RER (Fig. 3). These cisternae either appear empty or are filled with a dispersed, slightly granular, electron-dense material (Fig. 4) which Pfenninger et al. (1967) considered to be the origin of the “neurosecretory” substance which may cause vacuolated dilatations of axons and may be released into the CSF. The remainder of the cytoplasm is occupied by mitochondria with a light matrix, lysosomes, lipofuscin and dense bodies, and a multilocular prominent Golgi apparatus which gives off numerous vesicles that are either empty or filled with moderately electron-dense, fine granular material or dense, uniformly sized, granulated vesicles (120 nm). d. Type IV Neuronal Perikarya. Type IV perikarya are particularly prominent in the rabbit (Weindl, 1965; Rudert et al., 1968; Watermann, 1969;

FIG.3. Type 111 neuronal perikaryon with its characteristic dark cytoplasm and dilatated profiles of RER. Rat. Bar, 1 p m . X7000.

340

H. DIETER DELLMA" AND JOHN B. SIMPSON

FIG.4. Portion of a type I11 neuronal perilcaryon containing greatly dilatated profiles of RER filled with dispersed and occasionally clumped electron-dense material. Dromedary. Bar, 0.5 pm. x22.000.

Leonhardt and Lindemann, 1973) but have been reported under various designations to occur in other animals as well (Legait, 1942; E. Legait and Legait, 1957; H. Legait and Legait, 1957b; Legait et al., 1957; Hofer, 1959, 1965; Watermann, 1956, 1969; Rohr, 1966b; Dellmann and Fahmy, 1967b; Akert, 1967, 1969b; Pfenninger et al., 1967; Akert and Steiner, 1970; Schinko et al.. 1972;Dellmann and Simpson, 1975a;Takei, 1977; Dellmann and Linner, 1979). Type IV perikarya and many of their processes (see Section 111,A,2) characteristically contain a variable number of vacuoles. The vacuolization process apparently begins with small dilatations of the endoplasmic reticulum (ER) (Rudert et al., 1968; Schinko et al., 1972) and/or Golgi cistemae of neurons (Rudert et al., 1968; Schinko et al., 1972; type I and 11, Dellmann and Simpson, 1975a) or of pamnchymal cells (Weindl, 1965). Subsequently the vacuoles increase in number and especially in size, and the cytoplasm is reduced between the vacuoles to thin strands andor a slightly thicker layer in the cell periphery. In more advanced phases of vacuolization, only the limiting membranes separate! the vacuoles. In extreme cases the vacuoles merge, and the entire perikaryon, now several times its original size (up to 300 Fm in diameter, Watermann, 1969), becomes one large vacuole surrounded by a narrow rim of cytoplasm (Fig. 5 ) . The cells a~ then also referred to as giant vacuolated nerve cells and do not possess a nucleus (H. Legait and Legait, 1957b; Schinko et al., 1972; H.-D. Dellmann, unpublished observations). Most vacuoles are empty. However,

THE SUBFORNICAL ORGAN

34 1

especially at the beginning of vacuolization, they may contain fiie granular material (H. Legait and Legait, 1957b; Weindl, 1965), dense bodies, dense lamellar bodies, and mitochondria. Large vacuoles may contain smaller ones (Weindl, 1965). Other type IV perikarya equally contain a varying number of vacuoles but are characterized by a homogeneous dispersion of their cytoplasm; mitochondria, ribosomes, dense bodies, and occasional microtubules are the only remaining organelles (Rudert et al., 1968; Schinko et al., 1972; H.-D. Dellmann, unpublished observations). The functional significance and fate of these neurons are unknown. The fact that they occur frequently at the ventricular surface (Hofer, 1957; Weindl, 1965) and are often separated from the CSF by only a very thin ependymal cell strongly suggests their possible discharge into the third ventricle (Watermann, 1965a; Rohr, 1966b; Weindl, 1965; Akert, 1967, 1969b; Pfenninger et al., 1967; Akert and Steiner, 1970; Dellmann and Simpson, 1975a). However, so far the only evidence in support of this hypothesis consists of large vacuolated protrusions as well as collapsed and

FIG.5 . Giant vacuolated nerve cell (type IV neuronal perikaryon) causing the overlying flat ciliated ependymal cell to bulge into the ventricular lumen. Rat. Bar, 2 pm. ~3500.

FIG.6. Light CSF-contactingneurons are located among dark empendymal cells and project into the ventricular lumen. Frog. Bar, 1 pin. ~ 8 6 7 0 .

FIG.7. Ventricular process of a CSF-contacting neuron containing mitochondria, E large, dense lamellar body, many micmtubules, and profiles of SER. Frog. Bar,0.5 pm. x17,oOO. FIG.8. Ventricular process of a CSFcontacting neuron with abundant profiles of SER and a cilium. Frog. Bar, 0.5 pm. x26,oOO. (Figs. 6-8 from Dellmann, 1978.)

THE SUBFORNICAL ORGAN

343

almost empty hulls containing a few remnants of vacuolated cytoplasm on the ventricular surface of the rabbit SFO (Leonhardt and Lindemann, 1973). e. Cerebrospinal Fluid-Contacting Neurons. In the SFO, typical CSFcontacting neurons (Fig. 6) (see Vigh and Vigh-Teichmann, 1973) have only been described in the grass frog (Dellmann, 1978). Their perikarya are located either within the ependymal cell layer or in a hypendymal position. Ultrastructurally these resemble type I neurons. A dendrite in the form of a bulbous enlargement projects into the third ventricle, and the axon penetrates into the SFO. Lysosomes, lipofuscin inclusions, and clear and granulated vesicles, as well as a single cilium, are commonly found in this dendritic terminal bulb (Figs. 7 and 8).

FIG. 9. Supraependymal neuron with three slender processes. Note the dilatation of one process and the network of numerous beaded supraependymal processes. Rat. Bar, 2 k m . x4950. (From Dellmann and Simpson, 1976.)

344

H.DIETER DELLMA" AND JOHN B. SIMPSON

f. Supraependymal Neurons. Supraependymal neurons are a common feature of all SFOs that have been investigated for their presence (Dellmann and Simpson, 1975a,b, 1976). With SEM these are easily identified by their usually elongated or pyramidal shape and their numerous and frequently beaded processes (Fig. 9). Some of these processes terminate with a slight dilatation on an ependymal cell surface. Other processes penetrate between adjacent ependymal cells into the SFO. The site of their termination is unknown. Still other processes terminate in extra-SFO locations which remain to be identified. With TEM the supraependymal neuronal perikarya usually have the same ultrastructural characteristics as type 11 neurons, although they occasionally resemble type I neuronal perikarya (Dellmann and Simpson, 1976) (Figs. 10 and 11). Sometimes type IV perikarya are observed in supraependymal locations (Figs. 10 and 11). The processes of these cells are often arranged in several layers (Figs. 12 and 13) and are particularly numerous in the rostra1 zone of the SFO (rat, Phillips et al., 1974; Dellmann and Linner, 1977). In the same region of the SFO Bouchaud el al. (1971) reported the presence of serotoninergic fibers. Synaptoid contacts between axons and ependymal cells (Fig. 14) correspond to the ventricular terminals observed in the SEM. Occasionally intraventricular axodendritic synapses resembling crest synapses are observed (Fig. 15). In addition to axons which originate from supraependymal neurons located on the SFO surface, numerous long axons are present, the origins of which are often difficult to determine. Some of them seem to originate within the SFO; most of them,

FIG. 10. Scanning electron micrograph of the two cells shown in Fig. 11. The arrow indicates the incidence of sectioning. Rat. Bar, 5 pm. ~ 2 2 2 0 . FIG. 11. Transmission electron micrograph of the cells shown in Fig. 10. The cell on the left is a type IV and the one on the right a type I neutonal perikaryon. Rat. Bar, 2 pm. ~ 4 8 0 0 .

THE SUBFORNICAL ORGAN

345

FIG. 12. Eight superimposed layers of crossing supraependymal neuronal processes. The small blebs (arrow) correspond to the evagination shown in Fig. 29 and are believed to be artifactual in nature. Rat. Bar, 1 p m . X7200.

however, apparently join the organ from extra-SFO locations. Several supraependymal processes regularly converge upon or cross at the level of single ciliated ependymal cells in the rostra1 region (Fig. 16).

2. Neuronal Processes Specific LM methods have revealed a dense nerve fiber plexus in the SFO (Cohrs and von Knobloch, 1936;Scevola, 1939,1941;E. Legait, 1942;Yamada and Hasunuma, 1955;Stephan and Janssen, 1956;H. Legait, 1956;Hofer, 1958, 1965;Pachomov, 1963;Shute and Lewis, 1963, 1966;Rudert, 1965;Adhami, 1967;Lewis and Shute, 1967;Akert, 1967;Akert et al., 1967a,b;Dellmann and Fahmy, 1967b; Lichtensteiger, 1967; Nakajima et al., 1968; Bouchaud and Berrou, 1970; Jacobowitz and Palkovits, 1974). Within this plexus Gomoripositive and/or paraldehyde-fuchsin-positive beaded nerve fibers were present (Legait, 1956; Hofer, 1959, 1965; Pachomov, 1963; Creswell et al., 1964; Rudert, 1965;Dierickx, 1963;Dellmann and Fahmy, 1967b,c;Dellmann, 1978).

FIG. 13. Numerous axons of varying caliber containing microtubules, mitochondria, profiles of axoplasmic reticulum, and empty and granulated vesicles are identified in an arra similar to the one shown in Fig. 12. Rat. Bar, 1 p m . ~11,200.

FIG. 14. Supraependymal axon containing empty vesicles in synaptoid contact with an ependymal cell. Note a smooth and a coated vesicle in communication with the ventricular lumen. Rat. Bar, 0.5 h m . x24,Doo.

THE SUBFORNICAL ORGAN

347

FIG. 15. Intraventricular synapse. Rat. Bar, 0.5 prn. ~35,000.

These findings have been considerably extended at the eIectron microscope (EM) level (Andres, 1965a; Rohr, 1966b; Rudert et al., 1965, 1968; Akert et al., 1967a,b; Dempsey, 1968; Leonhardt and Backhus-Roth, 1969; Akert and Steiner, 1970; Bouchaud, 1974b, 1975a; Hindelang-Genner et al., 1974; Dellmann and Simpson, 1975a; van Buren et al., 1977; Dellmann, 1978; Mikami and Asari, 1978; Tsuneki et al., 1978; Dellmann and Linner, 1979), and ultrastructural analyses of dendrites and especially of a variety of axons and synapses, sometimes in combination with experimental interventions, have contributed substantially to a better understanding of the organization of the SFO. a. Dendrites. No exact description of the dendritic pattern within the SFO of any of the investigated species is available. All investigators thus far have reported that all dendrites within the SFO apparently originate and terminate there, with one exception. Dierickx (1963) observed in the frog that dendrites originating from the preoptic nucleus were found within the SFO. Dellmann (1978) could not confirm this finding with TEM but rather identified these neurosecretory fibers as typical axons. The dendrites are broad and short (Andres, 1965a; Pfenninger et al., 1967) and particularly abundant immediately underneath the ependyma (Dempsey, 1968; Dellmann and Simpson, 1975a). Frequently only a thin layer of ependymal cytoplasm separates them from the CSF (Dempsey, 1968). a fact which suggests a possible receptor function, as proposed by Andres (1965a) for the dendrites of type I neurons. In the frog, the dendrites of the CSFcontacting neurons project into the third ventricular lumen (Dellmann, 1978) (Fig. 6). Some dendrites extend into the pericapillary spaces

348

H. DIETER DELLMA" AND JOHN B. SIMPSON

FIG.16. Neuronal processes converging upon and crossing on a ciliated ependymal cell. Rat. Bar, 5 wm. X3200.

(Andres, 1965a; Dellmann and Simpson, 1975a). It is not unusual to find specialized attachments such as tight junctions between neuronal perikarya and dendrites, and zonulae adherentes (desmosomes, Pfenninger et al., 1967) and puncta adherentia (Dellmann and Simpson, 1975a; Dellmann and Linner, 1979) between dendrites and ependymal cells. b. Axons. Our knowledge of the afferent and efferent connections of the SFO is still rather rudimentary. The SFO contains large amounts of acetylcholinesterase (AChE), particularly in its periphery, which may arise from ACE-containing cells in the dorsal fomix above the hippocampal commissure and in the midline raphe in the upper part of the septum. These reach the SFO by passing through and on either side of the hippocampal commissure (Shute and Lewis, 1963, 1966; Lewis and Shute, 1967; Akert, 1967). Shute and Lewis (1963) hypothesized that the SFO is an effector organ receiving cholinergic innervation and may be part of the cholinergic limbic system (1966). AChE-

THE SUBFORNICAL ORGAN

349

positive terminals were also identified by Akert (1967, 1969a), Jacobowitz and Palkovits (1974), and Akert and Steiner (1970; also nonspecific cholinesterase) who also demonstrated a subependymal zinc iodide-positive plexus with presynaptic terminals containing vesicles with a homogeneously black content. Under conditions which favor the accumulation of 5-hydroxytryptamine (5-HT), Lichtensteiger (1967) observed its presence in nerve endings throughout the organ, as well as that of ~-3,4-dihydroxyphenylalanine,5-hydroxytryptophan, and rarely norepinephrine. Cholinergic and adrenergic fibers were observed by Nakajima et af. (1968). Mitro ef at. (1976) reported a significant decrease in norepinephrine content of the SFO following immobilization of the animals for 60 minutes, which was interpreted to indicate participation of the SFO in stress. Afferent connections to the dorsal part of the SFO (in the rat, cat, and mouse) derive from the triangular nucleus of the septum, and to the ventral and rostral parts of the SFO fronthe median preoptic nucleus (Hernesniemi et al., 1972); the latter connection, however, may not include terminals but just be composed of fibers passing through the SFO. Recently, Broadwell and Brightman (1976) proposed that the SFO received afferents from the vertical limb of the nucleus of the diagonal band of Broca. Myelinated andlor nonmyelinated nerve fibers penetrate the SFO through the fornix. The former lose their myelin sheath soon after having penetrated the organ and terminate at various levels within the SFO (Cohrs and von Knobloch, 1936; Yamada and Hasunuma, 1955; Hofer, 1958; Adhami, 1967; Akert et al., 1967a,b; Dellmann and Fahmy, 1967a,b). Efferent connections of the SFO were reported by Stephan and Janssen (1956). They found a tract which coursed caudally and then subdivided into two fascicles and surrounded the splenium of the corpus callosum dorsally and which was probably continuous with the longitudinal striae. In an autoradiographic study Miselis ef af. (1977a,b) described efferent projections to the nucleus medianus of the medial preoptic area, the OVLT, and the supraoptic nucleus. Through horseradish peroxidase (HRP) injection into the supraoptic nucleus, the cells of origin could be localized along the dorsal and lateral borders of the SFO and in the rostral region (Miselis, 1978; Shapiro and Miselis, 1978). The projections from the SFO suggest involvement of the nucleus medianus and the OVLT in neural thirst mechanisms and a modulatory role of the SFO in the control of antidiuretic hormone secretion. At the EM level, several types of axons or axon terminals have been identified. Presynaptic terminals containing numerous spherical, ovoid, or flat clear vesicles (20-80 nm, Akert ef al., 1967b; 40-60nm, Dellmann and Simpson, 1975a) and occasional granulated vesicles (100-150 nm, Akert ef al., 1967b; 90-120 nm, Dellmann and Simpson, 1975a; 80-120 nm, Andres, 1965a; 105-135 nm, Rudert et al., 1968) are considered to be cholinergic. Other preterminal and terminal axon dilatations contain clear vesicles (40nm, Bouchaud, 1974b; 35-85 nm, Dellmann and Simpson, 1975a; 40-80 nm, Leonhardt and BackhusaRoth, 1969) and granulated vesicles (80-100 nm,

FIG.17. Perivascular axon terminals. The one on the right is in the regressive phase of a regression-restitution cycle. Rat. Bar, 0.5 p m . ~ 2 9 , 3 7 0 .

FIGS.18-21. Serontoninergic axon terminals in various phases of a regression-restitution cycle. FIG. 18. Vacuoles, dense lamellar bodies, and dense bodies. Rat. Bar, 1 p m . ~ 1 5 , 0 9 0 . FIG. 19. Evidence of crinophagic activity, numerous vacuoles, dense lamellar bodies, and mitochondria. Rat. Bar, 0.5 pm. X20,400. 350

FIG.20. Extensive axoplamic reticulum. Rat. Bar, 0.5 p n . X18,080. FIG.21. Densely packed mitochondria. Rat. Bar, 0.5 pm. x 17,950.

FIGS.22-23. Two examples of axon profiles whose identity is difficult to establish. FIG.22. This enlarged axon contains numerous granulated vesicles, mitochondria and debris, and a fine network of filaments. Rat. Bar, 1 pi.X 15,080.

35 1

352

H. DIETER DELLMANN AND JOHN 9. SIMPSON

FIG.23. In addition to fine granular material this profile contains a few vesicles and unidentifiable debris. Rat. Bar, 0.5 pm. x19,OOO.

Bouchaud, 1974b; 70-120 nm, Dellmann and Simpson, 1975a; 100-200 MI, Rohr, 1966b; 70-90 nm, Rudert er al., 1968; 65-100 nm, Leonhardt and Backhus-Roth, 1969). Based upon mitochondria1characteristics, Andres (1965a) and Rudert ef al. (1968) think that some of these synapses derive from intrinsic neurons of the SFO while others originate outside the SFO. Many axon dilatations are neither axosomatic nor axodendritic and are found to be in contact with the perivascular basal lamina (Dempsey, 1968; Bouchaud, 1974b) or even with the perivascular connective tissue (Rohr, 1966b; Dellmann and Simpson, 1975a) (Fig. 17). Bouchaud (1975a) has clearly established the serotoninergic nature of these axon terminals which may undergo profound morphological changes described as regression-restitution cycles by Dellmann and Simpson (1975a) and as degeneration and involution by Bouchaud (1974b; 1975a). These changes (Fig. 18) are characterized by an increase in the number of clear vesicles and mitochondria and the appearance of large, empty vesicles, dense bodies, and

THE SUBFORNICAL ORGAN

353

dense lamellar bodies. They are accompanied by an increase in the size of the axon which may reach 12 p m (Rudert ef al., 1968) to 15 p m (Bouchaud, 1974b) in diameter. In advanced phases of regression the dilatated axon is filled with dense bodies and lipofuscin inclusions together with a few mitochondria (Fig. 19). These regressive changes seem to be reversible (Dellmann and Rodriguez, 1970; Baumgarten et al., 1972), leading Dellmann and Simpson (1975a) to postulate a restitution phase during which axon dilatations contain a decreased number of dense bodies and dense lamellar bodies, many profiles of axoplasmic reticulum, microtubules, and individual granulated vesicles andor many mitochondria (Figs. 20 and 21). Enlarged axon profiles, like the ones shown in Figs. 22 and 23, very likely represent other, as yet unclassified, stages in the regression-restitution cycle. The occasional observation of a regressive axon engulfed by a microglial cell (Fig. 24) suggests that some of the changes may

FIG.24. Degenerating (?) axon completely surrounded by a microglial cell. Rat. Bar, 0.5 pm. ~21,620.

354

H. DIETER DELLMANN AND JOHN B. SIMPSON

actually lead to degeneration and loss of part of the axon (Pachomov, 1963; Rudert et al., 1968). Preterminal and terminal axon dilatations with ultrastructural characteristics identical to those found in type IV perikarya have been identified in a variety of species (Rohr, 1966b; Pfenninger et al., 1967; Rudert et al., 1968; Dellmann and Simpson, 1975a) (Figs. 25 and 26). It is, however, difficult or even impossible at times to differentiate between axons in advanced phases of vacuolization with homogenization of their contents and serotoninergic axons in restitution cycles. According to Akert et al. (1967a) 83% of the synapses in the cat are axodendritic, and 17% are axosomatic. The most frequent type of synapse (in this species) is the Gray type I synapse, although in addition Gray type I1 synapses were observed (Akert et al., 1967b). Furthermore, the SFO contains axodendritic and axosomatic crest synapses with subjunctional bodies. These consist of two synaptic junctions occurring on either side of a central dendritic crest about 1.4 p m in length, up to 1 pm in height, and about 150 nm in width; the crest contains postsynaptic subjunctional spherical bodies 20-30 nm in diameter, which are in hexagonal or trigonal arrays (Akert er al., 1967a,b) (Fig. 27). Leonhardt and Backhus-Roth (1969) described synaptic contacts between axon

FIG.2 5 . Three axon dilatations containing many vacuoles of varying sizes (left), dilatated profiles of the axoplasmic reticulum (center), and homogeneous axoplasm without organelles (right); identical characteristics are found in type IV neuronal perikarya. Rat. Bar, 2 pm. ~6230.

THE SUBFORNICAL ORGAN

355

FIG.26. In this vacuolated axon dilatation only a few remnants of axoplasm remain between the vacuoles. Rat. Bar, 2 pm. ~ 5 5 0 0 .

terminals and ependymal cells, characterized by presynaptic dense bodies and membrane thickening, subjunctional bodies, and the presence of parallel intersynaptic filaments; they also reported desmosomelike junctions. With SEM occasional club-shaped ventricular protrusions have been observed

FIG. 27. Typical crest synapse. Rat. Bar,0.5 pm. ~ 3 1 , 0 0 0 .

356

X

FIG.28. 16,800.

H. DIETER DELLMANN AND JOHN B. SIMPSON

A bundle of twisting supraependyrnalaxons and a club-shaped ending. Rat. Bar, 1 p n .

(Leonhardt and Lindemann, 1973) (Fig. 28). They were clearly identified as axonal projections, often involved in regression-restitution cycles (Dellmann and Simpson, 1976a) (Fig. 29). NLBs with occasional granules in the periphery, thought to be RNA transported into the axon for delayed utilization, are present within type I and I1 prikarya and also within their axons (Hindelang-Gertner et al., 1974) (Fig. 63). Gomori-positive or paraldehyde-fuchsin-positive and often beaded fibers and/or imgular masses similar to neurohypophysial Herring bodies have been reported in the SFO of a variety of birds and mammals (H. Legait, 1956, 1959; H. Legait and Legait, 1956, 1957b,c; E. Legait and Legait, 1967; Hofer, 1958, 1965; Pachomov, 1963; Dierickx, 1963; Creswell et al., 1964; Ruden, 1965; Dellmann and Fahmy, 1967a,b; Bouchaud and Berrou, 1970; Dellmann, 1978). Usually these observations were interpreted as indicative of the existence of a

THE SUBFORNICAL ORGAN

357

connection between the magnocellular hypothalamic nuclei and the SFO. Under normal conditions these fibers are so scarce and small that they readily escape detection, especially with TEM (Dellmann and Simpson, 1975a). However, under conditions which stimulate the peptidergic hypothalamohypophysial system they become more obvious (Legait, 1956, 1959; Hofer, 1958, 1965; Pachomov, 1963; Dierickx, 1963; Rudert, 1965; Bouchaud and Berrou, 1970; Dellmann, 1978). Recently, paraldehyde-fuchsin-positivefibers and large masses were identified electron microscopically as axons and axon dilatations containing peptidergic neurosecretory granulated vesicles (Dellmann, 1978). M. s. Brownfield and G.P. Kozlowski (personal communication) demonstrated immunocytochemically the presence of neurophysin-positive fibers in the SFO of the kangaroo rat. These findings, as well as those of Summy-Long et al. (1978), who detected an about twofold higher vasopressin concentration in 2-day waterdeprived rats as compared to normally hydrated controls, clearly suggest the existence of a link between the hypothalamus and the SFO, although the significance of such a link remains to be determined. A positive paraldehyde-fuchsin reaction, however, must be cautiously evaluated. For example, serotoninergic fibers in advanced phases of regression give a positive reaction because of the presence of lysosomes (Bouchaud, 1974b). The same is true for melanin granules (H.-D. Dellmann, unpublished observation). It is very likely that the neurosecretory perikarya Rudert (1965) observed with the LM in the frog SFO could be

FIG. 29. This supraependymal terminal axon dilatationderives from a subependymalaxon and is in the regressive phase of a regression-restitution cycle. The small evagination corresponds to the blebs shown in Fig. 12. Rat. Bar, 0.5 pm. X26,400.

358

H. DIETER DELLMA” AND JOHN 8 . SIMPSON

identified with the TEM as either melanin-containing cells (Section III,D,4) or Herring bodies where a central light mne often simulates the presence of a nucleus. In the vicinity of the blood vessels in the center of the frog SFO, enlarged dendrites and axons regularly occur (Dellmann, 1978), which correspond to the vacuolar extracellular spaces described by Dierickx (1963) and Rudert (1965). The ultrastructural morphology of these processes covers a wide range from a few vacuoles in a normal process to vacuolated processes in which the plasma membrane is the only visible cellular constituent left. Occasionally synapses or granulated and/or empty vesicles permit unequivocal identification of the more modified profiles which otherwise are difficult or even impossible to identify.

3. Discussion and Conclusions At first it seems rather difficult to reconcile the different points of view regarding classification of the various types of neuronal perikarya and their processes, and one may be inclined to invoke species differences as an explanation for the apparent diversity. Upon close examination, however, it seems that the obstacle is more apparent than real. Type I neuronal perikarya correspond to Andres’ (1965a) type I cells, Dempsey’s (1968) neurons, the parenchymal cells of Rudert et af. (1968) and Schinko et al. (1 972), and the ganglionic cells of Pfenninger et al. (1967). Type II neuronal perikarya correspond to the type I1 cells described by Andres (1965a). The question arises, however, whether the observed differences are pronounced enough to warrant their classification as a separate type. The structural differences between type I and type I1 neurons are primarily quantitative. There are cells which possess the characteristics of both cell types, have granulated vesicles of identical size, and react similarly to a variety of experimental interventions. All these factors favor the concept that the observed differences are merely the morphological expression of varying functional stages of one cell type. Pfenninger et al. (1967) and Akert (1969b) describe the type 111 neuronal perikarya discussed above as type-2 neurosecretory cells and believe that they synthesize the type-2 neurosecretory material first described by Rohr (1966b) in dilatated neuronal processes. Yet, there is a striking discrepancy between the scarcity of these cells in most SFOs and the fact that Rohr (1966b) observed type-2 neurosecretory material frequently; we have neither been able to observe the continuity of processes containing Rohr’s type-2 secretory material with type III perikarya, nor have we found any further documentation of this cell type in the literature. We therefore consider type 111 neurons unrelated to Rohr’s type-2 neurosecretory material which we believe to be related to type 1V cells (see below). Even though the cisternae of the ER may dilatate and may be filled with slightly granular electron-dense material, the process of vacuolization has never been observed to reach the advanced stages that it does in type 1V neurons, and

THE SUBFORNICAL ORGAN

359

the cytoplasm between the vacuoles is always clearly identified as belonging to type 111cells. The available morphological evidence supports the concept that type IV neurons are another morphological expression of a different functional stage of type I and type II neurons. It is indeed easy to observe all stages from the onset of vacuolization, that is, the presence of one or several small vacuoles, until the eventual formation of several large vacuoles or a single large vacuole, the “giant vacuolated nerve cell. ” This process is puzzling and raises several questions, in particular whether the perikaryon may undergo total vacuolization with disappearence of the nucleus and ensuing cell death. As yet there is no certain answer. Although type IV neurons in advanced stages of vacuolization have been observed not to possess a nucleus (H. Legait and Legait, 1957b; Rudert et al., 1968;Schinko et al., 1972;H.-D. Dellmann, unpublished), there is no conclusive evidence that these giant vacuoles are indeed of perikaryal origin. But even if one assumes that they are, it is difficult to conceive of the actual death of a relatively large population of neurons, as this would eventually lead tc substantial depletion of SFO type I and type I1 neurons; only a quantitative study of age-related changes in the number of neurons would resolve this problem. The fact, however, that no investigator has reported the pycnotic nuclei which would be expected to occur if the cells degenerated, together with the absence of phagocytic glial cells around the giant vacuoles, is a good indication that such neurons do not die, or at least do not die in situ. It is true, however, that release into the third ventricle of vacuolized perikarya in toto cannot be excluded. Leonhardt and Lindemann (19731,for example, have convincingly demonstrated that at least the content of the giant vacuoles can be released into the CSF. However, in this case, one wonders not only about the functional significance of the process but also about the fate of the giant vacuoles consistently found in the deep portions of the organ. Are they in the process of migrating toward the ventricular surface or into a penvascular space? Some clues may be provided by the frog SFO (Dellmann, 1978). Here vacuolated dendrites and axons consistently occur around a central capillary tuft, and vacuolated perikarya are extremely rare. There is a close topographical relationship between vacuolated processes and glial cells containing many lysosomes and lipofuscin inclusions, which is suggestive of a phagocytic activity of these cells disposing of degenerated axons or dendrites. Thus part of the neuron may be disconnected from the perikaryon without obvious major consequences for the perikaryon, although the location of the perikarya to which these processes belong is unknown. The question remains, however, whether the same process occurs in the mammalian SFO, that is, whether most of the giant vacuoles are axons and dendrites rather than prikarya. If some dendrites and axons degenerate, what is the significance of this event? It is reasonable to assume, because of the regular occurrence of these vacuoles in higher and lower vertebrate SFOs, that vacuolization is a physiological

360

H.DIETER DELLMA“ AND JOHN B. SIMPSON

process. Whether it is a “neurosecretory ” process, as assumed by Rohr (1966b)or perhaps the expression of stages of regression-restitution cycles (Dellmann, 1978), remains to be determined. Rohr’s (1966b) type-1 neurosecretory axons have been shown to be serotoninergic in nature (Bouchaud, 1975a). The corresponding type- 1 neurosecretory perikarya were identified with the LM by Pfenninger et al. (1967), although not been confirmed with TEM. Perikarya, similar to the ones reported by Pfenninger et al. (1967), were observed in our material; the successive examination of semithin and thin sections showed that what appeared to be perikarya were actually dilatated serotoninergic axons in various phases of regressionrestitution cycles, in which a dark zone may mimic the presence of a nucleus. Further studies will hopefully be able to combine physiological (stimulation and recording) and morphological techniques (receptor detection and injection of tracer substances such as HRP) in order to confirm or disconfirm the existence of several types of neurons within the SFO and to assess their functional significance. The discovery of acetylcholine (ACh)-responsive neurons (Akert, 1969a; Akert and Steiner, 1970) and of specific angiotensin 11-sensitive neurons (Felix and Akert, 1974; Felix, 1976; Phillips and Felix, 1976; Buranarugsa and Hubbard, 1976) and other neurons which are sensitive to both angiotensin II and Ache (Felix, 1976; Phillips and Felix, 1976) are first steps in this direction. B. GLIALCELLS 1. Ependymal Cells Ependymal cells, more than any other cell type within the SFO, have been found by virtually all investigators to vary greatly in shape and structure as well as in location. The following description is based upon the EM observations by Andres (1965a,b), Rudert et al. (1968), Dempsey (1968), Pfenninger (1969), Schinko et al. (1972), Sirjean (1973), Phillips et al. (1974), Dellmann and Simpson (1975a,b, 1976), and Dellmann and Linner (1977). The ependyma is simple squamous, cuboidal, or columnar epithelium. Both cuboidal and columnar ependymal cells often have short, slender lateral and basal filopodia which extend between the subependymal and intraependymal dendrites and axons. Thin, elongated, flat processes which interdigitate extensively with similar processes from adjacent cells are observed at the ventricular surface of these and squamous ependymal cells; these processes are attached by numerous desmosomes (Fig. 30). Short lateral processes invaginate neighboring cells. They are characterized by a light, slightly granular cytoplasm without organelles and a gap junction at the level of the entire invagination (Fig. 31). Gap junctions occur, however, at other surfaces as well (Fig. 32). Sometimes the basal processes are broad and long, contain numerous filaments, profiles of endoplasmic reticulum

THE SUBFORNICAL ORGAN

36 1

FIG.30. Extensively interdigitating ependymal cell processes. Rat. Bar, 1 pm. X 15,000. FIG.31. Gap junction between two ependymal cells at the level of an invaginated process. Rat. Bar, 0.25 pm. ~ 3 7 , 4 6 0 . FIG.32. Gap junction near the ventricular surface of two ependymal cells. Rat. Bar, 0.25 pm. X44.ooO.

362

H. DIETER DELLMA" AND JOHN B. SIMPSON

FIG.33. The basal process of this ependymal tanycyte gives off small branches which surround dendrites and axons and terminates upon the basal lamina of a penvascular space; as it approaches its termination, the cytoplasm becomes lighter because of a considerablydecreased number of filaments. Rat. Bar, 1 pm. ~7200.

often with an electron-dense content and mitochondria, and terminate deep in the SFO either in contact with a neumnal perikaryon or with the penvascular connective tissue space (Fig. 33); these cells are referred to as ependymal tanycytes. At the ventricular surface all types of ependymal cells are linked by zonulae adherentes, and the lateral and ventral surfaces may be invaginated by dendrites or axons.

THE SUBFORNICAL ORGAN

363

The ventricular surface morphology is variable and is distinctly different from the adjacent ciliated lining of the third ventricle (Figs. 34 and 35). It ranges from a flat, even surface to a hemispherical one that bulges into the lumen of the third ventricle (Figs. 35-38). Short, broad, slender, and long, slender microvilli occupy the entire surface or part of it and are often particularly concentrated in the cell periphery (Fig. 36). Cilia occur singly or in tufts (Fig. 37). Bulbous ventricular protrusions are common (Fig. 38). Varying amounts of cytoplasm, sometimes even containing the nucleus, may protrude above the level of adjacent cells (Fig. 39); in exmme cases this may lead to complete extrusion of a cell into the ventricular lumen. The cell shown in Fig. 40 is likely in the process of becoming detached from the underlaying ependyma to which it is still attached by demowmes and a gap junction. Other bulgings are caused by subependymal neuronal perikarya or giant vacuolated nerve cells or their processes or, very rarely, by intracellular vacuoles. In the frog SFO, many ependymal cells contain

FIG. 34. Rat SFO lying above the two diverging branches of the choroid plexus. Note the virtual absence of cilia. Bar, 5 pm. X340.

FIG.35. Following removal of the choroid plexus the bulging ependymal cells of the central region become visible. In contrast to the SFO in Fig. 34 there are many supraependymal processes in the rostral region of this SFO. Rat. Bar, pm. ~ 3 9 0 .

FIG.36. Flat, hexagonal ependymal cells from the rostral region of the rat SFO an either studded with microvilli or almost devoid of them; but they always occur in the cell periphery. Rat. Bar, 5 pm. ~2470.

THE SUBFORNICAL ORGAN

365

FIG.37. In the center of the micrograph a junction occurs between the central region of the rat SFO and the caudal region which is covered by typical cells of the choroid plexus. Rat. Bar, 5 prn. x 1080.

FIG.38. The ependymal cells of the central region of the rat SFO have bulging surfaces with many slender microvilli, occasional single cilia or tufts of cilia, and blebs. Rat Bar, 5 pm. x 3 W .

variably sized vacuoles, especially in their apical cytoplasm, which frequently form large protrusions into the ventricle (Fig. 41) (Rudert, 1965; Dellmann, 1978). The cytoplasm is rich in ribosomes, especially polyribosomes, which may be particularly abundant in the ventricularprotrusions (Fig. 39). Furthermore it may contain sparse profiles of RER and smooth ER (SER), an usually prominent Golgi complex often elaborating many small, usually empty, occasionally

FIG.39. Transmission electron micrograph of the same area as that shown in the center of Fig. 37. The cell to the left possesses the typical dense microvillous border of a choroid plexus epithelial cell. On the right side are smaller, slender microvilli of the central region. Rat. Bar, 3 Fm. ~4330.

FIG.40. This cell is attached to the underlying ependyma through a few desmosomes and a gap junction and is probably in the process of losing its connection and becoming a free supraependymal cell. Rat. Bar, 1 pm. X13,OOO. 366

FIG.41. Vacuolated protrusions of ependymal cells. Above the large vacuole a macrophage process is visible. Frog. Bar, 1 p m . X9000.

FIG.42. Dark ependymal cell protruding into the ventricular lumen. Rat. Bar, 1 prn. ~ 9 5 0 0 . 367

368

H. DIETER DELLMANN AND JOHN B. SIMPSON

granulated vesicles, mitochondria, multivesicular bodies, dense bodies, lysosomes, lipid inclusions, vacuoles of varying size, microfilaments and microtubules, glycogen, and coated vesicles. Occasional single ependymal cells, most often in the center of the SFO, were first described by Pfenninger (1969) as “dark” ependymal cells. They are distinguished from other ependymal cells by having more dense cytoplasm, more ribosomes, a vast Golgi complex, vacuoles, vesicles, and lysosomes (Fig. 42). These cells give a particularly strong reaction following intraventricular injection of HRP (Pfenninger, 1969). Ependymal channels were commonly observed in the cat (Pfenninger, 1969). and especially in the periphery of the dog SFO (Andres, 1965a,b; Watermann, 1965b); occasionally they are also seen in other mammalian SFOs as well (Dellmann and Simpson, 1975a). These channels are up to 100 pm long, and their lumen measures 2-5 p m in diameter. The lining cells from which microvilli and cilia project into the lumen are cuboidal or squamous in shape and are linked by demosomes. Andres (1965a,b) noted the frequent communication of these channels with the neuropil of the SFO, suggesting that the CSF may come into direct contact with the neurons which could possibly monitor its chemical composition. In the vicinity of the ependymal cells, and only occasionally in the depth of the SFO, the external basal lamina of the perivascular space can often be seen to expand considerably and to extend into deep invaginations into the adjacent cells (Figs. 43 and 44).Subplasmalemmal condensations reminiscent of hemidesmosomes are commonly found in these locations (Fig. 44).

FIG.43. Expansion of the perivascular basal lamina in the vicinity of the ependymal lining. Rat.

Bar, 0.5 pm. ~20,400.

THE SUBFORNICAL ORGAN

369

FIG.44. In a tangential section the external penvascular basal lamina is seen to indent deeply adjacent ependymal cells, even within the immediate vicinity of the nucleus. Rat. Bar, 0.5 Fm. X 27.74.

2. Other Glial Cells The first investigators of the SFO recognized the presence of neuroglial cells which were not further identified or described as macro and microglial cells, astmcyks, and oligodendroglial cells (Putnam, 1922; Pines and Maiman, 1928; Pines and Schefkl, 1929; Cohrs and von Knobloch, 1936; von Knobloch, 1937; Dannheimer, 1939; Scevola, 1939, 1941; Reichhold, 1942). Subsequently their findings were confirmed and expanded (Brizzee, 1954; Yamada and Hasunuma, 1955; Hasunuma, 1956; E. Legait and Legait, 1957; H. Legait and Legait, 1957b; Legait et al., 1957; Hofer, 1957, 1965; Sprankel, 1957; Pachomov, 1963; Creswell et al., 1964; Weindl, 1965; Rabl, 1966; Dellmann and Fahmy, 1967a,b; Nakajima et al., 1968), and the final identity of these cells and their fine-structural characteristics were established with the E M . Typical protoplasmic and fibrous astmytes are present in all investigated species (Andres, 1965a; Rudert et al., 1965, 1968; Schinko et al., 1972; Spoerri

370

H.DIETER DELLMA” AND JOHN B. SIMPSON

and Alexy, 1974; Dellmann and Simpson, 1975a, 1976), although Pfenninger et al. (1967) consider them to be absent from the cat SFO. In most species protoplasmic astrocytes, which are more abundant than fibrous astrocytes, are found within the entire organ and are often located in the immediate vicinity of blood vessels (Weindl, 1965; Adhami, 1967; Dellmann and Fahmy, 1967a,b), adjacent to the perivascular basal lamina (Schinko et al., 1972). Their often slender, filamentous processes permeate the entire organ and are especially concentrated underneath the ependyma, parallel to the ventricular surface (Cohrs and von Knobloch, 1936; Scevola, 1939; Sprankel, 1957; Hofer, 1965; Adhami, 1967; Rudert el al., 1968) where they intermingle with neuronal processes (Rudert et a!., 1968) and may be found invaginated into ependymal cells. Fibrous astrocytes are more abundant in the base of the SFO (Hofer, 1957; Andres, 1965a; Weindl, 1965) and in the vicinity of the large blood vessels (Schinko et al., 1972) upon whose perivascular spaces they terminate with broad processes. In the buffalo, dromedary, cattle, cat, and spiny mouse fibrous astrocytes are particularly abundant and occur throughout the entire SFO (Dellmann and Simpson, 1975a; H.-D. Dellmann, unpublished observations). In the caudal region of the

FIG.45. Protoplasmic astmyte in contact with the pial connective tissue of the choroid plexus. Rat. Bar, 1 pm. ~9860. FIG.46. Numerous lysosomes within an astrocyte perikaryon. Rat. Bar, 1 pm. x 15,500.

THE SUBFORNICAL ORGAN

37 1

FIG.47. Two satellite cells in the vicinity of a type IV neuronal perikaryon in an early stage of vacuolization. Rat. Bar, 3 wm. X3170. FIG.48. Microglial cell. Rat. Bar, 1 pm. X10,540.

rat SFO, the surface of which is in contact with the pial connective tissue of the choroid plexus, the zone of contact consists of either numerous thin, interdigitating astrocyte processes or of astrocyte perikarya or their large processes which contain numerous mitochondria toward the pia (Dellmann and Simpson, 1976) (Fig. 45). Oligodendrocytes are rare (von Knobloch, 1937; Scevola, 1941; H. Legait and Legait, 1957b; Nakajima et al., 1968; Andres, 1965a; Rudert et al., 1968), while microglial cells are regularly and more frequently observed (Fig. 48) (Pines and Maiman, 1928; Pines and Scheftl, 1929; Reichold, 1942; Stephan and Janssen, 1956; H. Legait and Legait, 1957b; Rudert, 1965; Weindl, 1965; Rudert et al., 1965; Dellmann and Fahmy, 1967a.b; Dempsey, 1968). The neurons of the SFO are intimately associated with satellite cells (Hofer, 1957, 1965; Andres, 1965a; Pfenninger et al., 1967; Rudert et al., 1968; Schinko et al., 1972; Dellmann and Simpson, 1975a). The shape of these cells is adapted to the nerve cell perikarya which they surround, and their dark, often bean- or half-moon-shaped nuclei facilitate their identification (Fig. 47). Their cytoplasm contains polyribosomes, sometimes in groups, little RER, a Golgi apparatus, lysosomes, dense bodies, mitochondria, and microtubules (Andres, 1965a; Pfenninger et al., 1967; Rudert ef al., 1968; Schinko et al., 1972).

372

H. DIETER DELLMA“ AND JOHN B. SIMPSON

Pfenninger et al. (1967) described the regular occurrence of several nuclear bodies and occasional filaments and observed the formation of thin sheaths (premyelin) around neuronal perikarya and/or their processes and even of true myelin sheaths. The thin glial sheaths may be attached to the neuron through zonulae adherentes (Pfenninger et al., 1967). Even though some of the satellite cells have undoubtedly the morphological characteristics of either oligodendrocytes or astrocytes, we agree with Rudert et al. (1968) that their special relationship with SFO neurons as well as their structure warrants their classification as a separate glial cell type. The presence of granules and/or Gomori-positive granules in microglial cells, oligodendrocytes, and astrocytes has been observed by Yamada and Hasunuma (1955), E. Legait and Legait (1957), H. Legait and Legait (1957b), H. Legait et al. (1957), Pachomov (1963), Creswell et al. (1964), and Weindl (1965). In view of the strong acid phosphatase activity demonstrated in some oligodendrocytes and astrocytes (Nakajima et al., 1968) and the presence of dense bodies, dense lamellar bodies, and lysosomes (Fig. 46), we consider these granules lysosomal in nature. In addition to these typical glial cells Rudert et al. (1968) described two additional types of glial cells in the rabbit SFO, designated “small” and “dense” glial cells; while the former is considered a subgroup of oligodendrocytes, the latter cannot be placed in any classic group. The same is true for a peculiar type of glial cell in the chicken SFO that is characterized by stacks of parallel profiles or spherical to ovoid concentric conglomerates of rough ER (Dellmann and Linner, 1979). Furthermore, Andres (1965a) observed glioblastlike cells which lacked the typical nuclear and cytoplasmic characteristics of mature glial cells and contained abundant glycogen and ER in their processes. Glial cells with a large vacuole, into whose lumen project cilia and/or microvilli, commonly occur in all investigated species (H.-D. Dellmann, unpublished observations) (Fig. 49). 3. Supraependyrnal Glial Cells With TEM supraependymal glial cells are very rarely found. These are spherical or ovoid cells which lack processes and which possess a microvillous surface. Their cytoplasm contains numerous polyribosomes, a few short profiles of RER, mitochondria, a prominent Golgi complex with numerous vesicles in its vicinity, multivesicular bodies, lysosomes, multilamellated bodies, and a few microfilaments (Fig. 50). Since forms intermediate between dark ependymal cells in the FIG.49. This glial cell with a central lumen into which project cilia and microvilli and in which debris occurs was found in the depth of the SFO. Rat. Bar, 1 pm. ~ 7 5 0 0 . FIG.50. Supraependymal glial cell. Cat. Bar, 1 pm. ~ 6 4 8 0 (From . Dellmann and Simpson, 1975a.)

374

H. DIETER DELLMA" AND JOHN B. SIMPSON

FIG. 51. hcephalochmmaffii cell projecting into the. ventricular lumen. Note the presence of many granulated vesicles and especially of clusters of filaments (arrows).Frog. Bar, 5 pm. X2380. (From Dellmann, 1978.)

THE SUBFORNICAL ORGAN

375

ependymal layer and these supraependymal cells can be observed, we think that they are of ependymal origin and fulfill an as yet to be determined (very likely phagocytic) function within the ventricular lumen.

C. OTHER CELLS

1. Encephalochromufin Cells The term “encephalochromaffin cell” was first proposed by McKenna and Rosenbluth (1971)for subependymal cells bordering the preoptic recess of the toad. Structurally identical cells are present in the SFO of Ram pipiens (Dellmann, 1978). The perikaryon of these cells (Fig. 51) is located either at the same level as ependymal cell perikarya or underneath them. They project and terminate with a variably shaped enlargement into the third ventricle. Perikarya and ventricular processes contain granulated vesicles (220-600 nm in diameter) which are usually more numerous in the latter (Fig. 51). Frequently the granules are smaller than the surrounding vesicles, and it is not unusual to find more than one granule within one vesicle (Fig. 52). Besides profiles of RER, polyribosomes, a prominent Golgi complex, mitochondria, and a few microtubules, encephalochromaffin cells contain filaments which are particularly densely

FIG.52. Detail of the ventricular process of the encephalochromaffin cell shown in Fig. 51. The granules are often eccentrically located within the vesicles, and two granules may occur within one membrane. Frog. Bar. 2.25 p m . ~47,600.(From Dellmann, 1978.)

376

H.DIETER DELLMA" AND JOHN B. SIMPSON

FIG.53. Detail of part of the perikaryon of the cell shown in Fig. 51, with filaments, microtubules, and granulated vesicles. Frog. Bar, 0.25 pm. ~47,600.(From Dellmann, 1978.)

packed in the vicinity of the nucleus (Figs. 51 and 53). The significance of these cells remains to be determined. 2. Supraependymal Macrophages With the SEM cells are observed on the SFO surface, characterized by one or several flat, elongated processes and their ruffled surface (Fig. 54) which often conveys the impression of the presence of several superimposed flat cytoplasmic processes. Their large nucleus is spherical or ovoid and heterochromatic. Their cytoplasm contains many polyribosomes and cisternae of RER, large vacuoles, and variably sized lysosomes and phagolysomes;the Golgi complex is prominent (Fig. 5 5 ) . They thus possess the structural characteristics of macrophages whose function is presumably the removal of debris from the CSF. 3. Other Supraependymal Cells In addition to supraependymal neurons and macrophages other supraependymal cells occur which are not readily classifiable. In one cell type numerous flat processes and microvillous projections interdigitate extensively and intricately (Fig. 57); in addition to nuclear and cytoplasmic characteristics similar to those observed in supraependymal macrophages, large, abundant bundles of microfilaments are observed. The second cell type is a spherical to ovoid cell with an irregular surface. It contains a light nucleus conforming to the shape of the cell, light cytoplasm with

THE SUBFORNICAL ORGAN

377

FIG.54. Supraependymal macrophage with flat, elongated processes and a ruffled surface. Frog. Bar, 3 pm. X3080. (From Dellmann, 1978.)

abundant polyribosomes, a few profiles of RER, a prominent Golgi complex with numerous vesicles in its vicinity, and large vesicles filled with granular material (Fig. 56). Microfilaments occur in bundles in such cells. The third cell type (Fig. 58) has been observed thus far only in the rat. These cells always occur in groups of several cells. The spherical or ovoid nucleus is

FIG.55. Supraependymal macrophage containing many lysosomes, dense lamellar bodies, lipid inclusions, and vacuoles. Rat. Bar, 1 pm. x9OoO.

FIG.56. This unidentified supraependymal cell has a prominent Golgi complex with numerous vesicles of varying size in its vicinity and is abundantly provided with microfilaments (arrow). Rat. Bar, 1 p m . x16,OOO.

FIG. 57. Abundant long, slender microvilli and overlapping processes, as well as evidence of phagocytic activity and bundles of microfilaments, characterize this supraependymal cell. Rat. Bar, 1 pm. ~ 1 2 , 8 0 0 .

THE SUBFORNICAL ORGAN

379

FIG.58, Group of supraependymat cells with many interdigitating processes containing numerous microfilaments. Rat. Bar, 1 pm. ~ 4 8 0 0 .

predominantly euchromatic and surrounded by a thin layer of cytoplasm. The cell body contains a light cytoplasm with a few plyribosomes and profiles of RER and a Golgi complex, as well as a few vacuoles. The outstanding characteristic of these cells are the numerous thin, elongated processes which interdigitate in a compact mass and in most of which densely packed microfilaments prevaiI. The morphology of the first cell type is suggestive of phagocytosis, but there is little morphological evidence for phagocytic activity in the second type and no evidence for it in the third cell type. The origin of these cells is unknown. All three types are abundantly provided with microfilaments which also are present both in ependymal cells and in fibrous astrocytes. At this point it can only be speculated that the supraependymal cells may derive from these cell types, since conclusive evidence is not available. 4. Melanin-Containing Cells In the frog SFO occasional melanin-containing cells are observed. These are usually located within the ependymal layer but may also occur deeper within the SFO. The cells have a very light cytoplasm containing sparse organelles and single melanosomes and melanosome complexes (Fig. 59).

380

H. DIETER DELLMANN AND JOHN B. SIMPSON

FIG.59. Melanosomes in a cell within the ependymal layer of the frog SFO.Bar:pm. x 11,430.

D. VASCULARITY A striking characteristic that distinguishes the SFO from adjacent brain regions, and that it shares with the other circumventricular organs, is its dense blood supply. Arteries enter the SM) from both rostra1 and caudal directions. Coming from the prechiasmatic region (preoptic artery, Duvemoy and Koritkk, 1965) the rostal

THE SUBFORNICAL ORGAN

38 1

artery enters the rostral pole of the SFO with several branches and anastomoses with branches derived from the posterior chorioid artery which penetrates the SFO from a caudal direction (Cohrs and von Knobloch, 1936; Spoerri, 1963; Duvernoy and Koritke, 1964, 1965; Watermann, 1965b; Weindl, 1965; Rabl, 1966; Adhami, 1967). In addition, a branch of the anterior cerebral artery, the subfornical artery (Spoem, 1963), enters the subfornical organ caudally after having passed around the splenium of the corpus callosum (Dannheimer, 1939; Adhami, 1967). The branches of these three arteries form a dense capillary network (Putnam, 1922; Pines and Maiman, 1928; Finley, 1939; Wislocki, 1940; Legait, 1942; Brizzee, 1954; Hasunuma, 1956; Duvernoy and Koritkk, 1964, 1065; Akert, 1967; Cramer, 1970; Dellmann and Simpson, 1976) with frequent sinusoid dilatations (Legait, 1942; Spoerri, 1963; Andres, 1965a; Rudert et al., 1966; Schinko er al., 1972) from which subependymal loops originate (Duvernoy and Koritke, 1964; Andres, 1965a). In the rostral region of the SFO, the network of fenestrated and nonfenestrated capillaries is less dense than in the central region, where it reaches its greatest density (Duvernoy and Koritke, 1964, 1965; Dellmann and Simpson, 1976). Here most capillaries are fenestrated, surrounded by wide connective tissue spaces (Cramer, 1970; Dellmann and Simpson, 1976), and often arranged in groups of two (Duvernoy and Koritkd, 1965) or even more (Stephan and Janssen, 1956; Dellmann and Simpson, 1976). In the caudal region, which is in contact with the connective tissue of the choroid plexus (Sprankel, 1960; Dellmann and Simpson, 1976), the capillary density decreases again to that of the rostral region. The continuity of this capillary plexus with the choroid plexus has been noted by several investigators in a variety of species (Dannheimer, 1939; Scevola, 1941; Legait, 1942; E. Legait and Legait, 1957; H. Legait et al., 1957; Rabl, 1966; Dellmann and Fahmy, 1967a,b; Akert, 1969b; Akert and Steiner, 1970; Dellmann and Simpson, 1976). Mergner (1961) and Spoerri (1963) have suggested a vascular connection between the SFO and the OVLT, although Duvernoy et al. (1969) failed to confirm its existence. The capillary network drains either directly or through arteriovenous (AV) anastomoses (Yamada and Hasunuma, 1955; Hasunuma, 1956; Duvemoy and Koritkk, 1965; Akert, 1967; Cramer, 1970) into venules which are collected into two laterally located wide veins (Spoerri, 1963; Duvernoy and Koritkk, 1964, 1965; Weindl, 1965; Dellmann and Simpson, 1976) which eventually join with the veins of the choroid plexus (Duvernoy and Koritkk, 1965) and drain via the septa1veins (Spoerri, 1963; Rabl, 1966) into the vena magna Galeni (Spoerri, 1963; Weindl, 1965; Rabl, 1966). The arterioles are characterized by one to two layers of smooth muscle cells and by endothelial cells with folds bulging into the narrow vascular lumen (Rohr et al., 1965; Rohr, 1966a; Schinko et al., 1972). The capillaries in the SFO of the cat, mouse, rat, camel, buffalo, frog, and chicken are fenestrated (Rohr, 1965a; Schinko et al., 1972; Bouchaud, 1975a,b; Dellmann and Simpson,

382

H. DIETER DELLMA" AND JOHN B. SIMPSON

1975a; 1976; H.-D.Dellmann, unpublished observations) and nonfenestrated (Dellmann and Simpson, 1975a, 1976). In the dog and rabbit they are apparently exclusively nonfenestrated (Andres, 1965a,b; Rudert et al., 1966). In most investigated species, the capillaries are surrounded by perivascular connective tissue spaces; sometimes these are greatly enlarged (Pines and Maiman, 1928; Legait, 1942; Dempsey and Wislocki, 1955; Hofer, 1958; Weindl, 1965; Andres, 1965a; Rabl, 1966; Rohr, 1966a; Adhami, 1967; Nakajima et al., 1968; Akert, 1969b; Akert and Steiner, 1970; Cramer, 1970; Bouchaud, 1975a,b; Dellmann and Simpson, 1976). These spaces are particularly wide in the vicinity of the SFO surface, while they decrease in width and may even be absent in the base of the organ, adjacent to the fornix (Dempsey and Wislocki, 1955; Andres, 1965a). In the rabbit and mouse, perivascular spaces are either very narrow or absent altogether (Rudert et al., 1966; Schinko et al., 1972), but in these species, as well as in the cat (Rohr, 1966a) and rat (Dempsey, 1968; Bouchaud, 1974a), the basal lamina forms extensive labyrinths by extending into the surrounding nervous tissue, thus leading to a considerably increased neurovascular contact zone (Fig. 60). Weindl's (1964, 1976) investigations in the rabbit show that the virtual absence of a perivascular connective tissue space is very likely

FIG.60. Fenestrated capillary surrounded by a labyrinthine perivascular space contacted by nervous and glial elements. Rat. Bar, I pm. x6980.

THE SUBFORNICAL ORGAN

383

responsible for the impermeability of the capillaries to blood-borne trypan blue and HRP. In the rat, blood-borne trypan blue (Behnsen, 1927; Wislocki and Leduc, 1952; Adhami, 1967) silver nitrate (Wislocki and Leduc, 1952; Dempsey and Wislocki, 1955; Dempsey, 1968; Bouchaud, 1974a), myofer (Dretzki, 1971), and HRP (Bouchaud, 1975b) were shown to be deposited within the endothelial basal lamina, the pericapillary space, the labyrinthine basal lamina, intercellular spaces, neuronal perikarya, and even ependymal cells (Wislocki and Leduc, 1952). The highest accumulation occurs in the central region of the SFO (Dempsey and Wiskocki, 1955; Dempsey, 1968; Dretzki, 1971; Bouchaud, 1974a, 1975b), where the capillary network is densest and the perivascular spaces are widest (Dellmann and Simpson, 1976).

E. HISTOCHEMISTRY A N D IMMUNOCYTOCHEMISTRY Histochemical studies of the SFO have revealed the presence of alkaline and acid phosphatase in neuronal perikarya and neuropil (Leduc and Wislocki, 1952; Weindl, 1965; Nakajima et at., 1968), and especially in the perivascular connective tissue sheaths (Leduc and Wislocki, 1952). In view of the fact that nonspecific esterases in SFO tanycytes behave in a manner almost identical to those of the infundibular tanycytes, a moderate intracytoplasmic reaction for nonspecific esterase (Leduc and Wislocki, 1952; Weindl, 1965) is interpreted by Goslar and Bock (1971) as a possible indication of a transport function of SFO tanycytes. A diffuse reaction is present for succinic dehydrogenase (Leduc and Wislocki, 1952; Watermann, 1965a; Shimizu and Morikawa, 1957; Shimizu et al., 1957). Furthermore, the neuronal perikarya have a moderate to relatively strong reaction for cytochrome oxidase (Shimizu and Morikawa, 1957; Shimizu et al., 1957; Nakajima, 1966) and total lactate dehydrogenase (Nakajima, 1966), a strong reaction for glucose-6-phosphatase and 6-phosphogluconate dehydrogenases (Nakajima, 1966) and amylophosphorylase (Nakajima, 1964), and mild to moderate Ca2+activated ATPase activity (Nakajima et al., 1968). Shimizu and Okada (1957) detected moderate to marked staining for phosphorylase immediately at or 1 day after birth, and a subsequent steady decrease with only slight coloration being present in the adult SFO. Ependymal cells were found to react similarly to neurons for glucose-6-phosphatasee,6-phosphogluconate dehydrogenases, total lactate dehydrogenase, and cytochrome oxidase (Nakajima, 1966). A few ependymal cells as well as astrocytes, oligodendrocytes, and endothelial cells also had amylophosphorylase activity (Nakajima, 1964). Moderate acid phosphatase activity was shown to be present in blood vessel endothelium, and it was moderate to strong in the outermost layer of the perivascular space; both the endothelium and the perivascular sheath reacted strongly to Ca2+-and Mg2+-activatedATPase (Nakajima et al., 1968).

384

H. DIETER DELLMA" AND JOHN B. SIMPSON

The SFO contains significant quantities of luteotropic-hormone-releasing hormone (LHRH) (Kizer et al., 1974; Pelletier, 1976; Pelletier et al., 1976), thyrotropin-releasing hormone (TRH) (Kizer et al., 1974), and somatostatin (Pelletier et al., 1976; Palkovits et al., 1976) in most ependymal and subependymal cells. In addition, substantial amounts of norepinephrine, dopamine, 5-HT and histamine (Saavedra et al., 1976) are present. Brownstein (1977) hypothesizes that these substances are scavenged from the CSF and that they may reach the general circulation through the SFO and other circumventricular organs, where they are either destroyed or distributed for some peripheral action. Williams et al. (1975) describe the presence of monoamine oxidase (C-MAO) in the SFO and other circumventricular organs and hypothesize that it may have a specific role in neuroendocrine control mechanisms, possibly through action on specific CSF monoamines. Following intravenous injection of 3H-labeled melanocyte-stimulatinghormone release inhibiting factor (MIF) Pelletier et al. (1975) reported accumulation of this substance in the SFO which was also diffusely labeled after intraventricular injection.

IV. Functions of the Subfornical Organ Statements regarding the physiological role@)of the SFO were few until the last decade. Earlier suggestions of investigators such as Dierickx (1963), Palkovits (1966), and Dellmann (1970) that the SFO was some type of receptor involved in central nervous regulation of fluid balance has received recent experimental confirmation. Certain anatomical characteristics of the SFO are consistent with the possibility that it may monitor various characteristics of the body fluids andlor endocrine factors and then integrate this information into physiological and/or behavioral reflexes aimed at maintaining homeostasis. This section briefly reviews information describing proposed functions of the SFO and points out some of the possible anatomical characteristics of the structure which are consistent with its proposed functions. It is important at this juncture to reemphasize several salient anatomical characteristics of the SFO,which are consistent with various proposed functional roles for the structure. The first of these is the presence of fenestrated capillaries, a characteristic the SFO shares with other circumventricular organs of the brain, including the OVLT. This characteristic indicates that various circulating molecules, such as peptide hormones, may equilibrate rapidly between blood and the interstitial fluid of the SFO. Many of these same molecules would be excluded from most of the CNS. Further, the presence within the structure of dense vascularity is suggestive of some sort of interrelationship between circulating substances and the SFO. Second, the anatomical interrelationships between

THE SUBFORNICAL ORGAN

385

the SFO and the CSF indicate that neurons there may function in the regulation of CSF production or composition. The presence of tanycytes as well as ependymal channels on the ependymal surface of the SFO, and the documented vascular interconnections between the SFO and the choroid plexus, are consistent with such proposed functions. A parameter of CSF composition or production which might be monitored or influenced by elements within the SFO has not at present been identified. A third salient characteristic of the SFO with clear functional implications is the anatomical interrelationship between neurons of the SFO and those of other brain regions thought to function in neuroendocrine phenomena. In particular, the recent demonstrations of Miselis et al. (1977a,b) that SFO efferent projections terminate within the preoptic regions, within the OVLT, and most significantly within the supraoptic nuclei indicate that the anatomical substrate required for a role of the SFO in the modulation or control of neurohypophyseal phenomena has been provided. It appears, then, that certain characteristics of the SFO may provide a basis for functions of the structure in various homeostatic and/or endocrine mechanisms. Experimental analyses of the role of the SFO in physiological phenomena have been of two principal types. First, numerous studies of a correlational nature have consistently demonstrated alterations in structure of various cellular components of the SFO in response to manipulations of the endocrine system and/or body fluid balance. The second type of study on SFO function has involved experiments describing physiological manipulations of the entire organ, without clear identificationof the elements of the SFO which are involved in the observed results. This type of study has again indicated that one likely function of the SFO is in the control of body hydromineral homeostasis, and that the structure is implicated in physiological, endocrine, and behavioral reflexes directed at maintaining body fluid balance. A. EXPERIMENTALLY INDUCED STRUCTURAL CHANGES; CORRELATIONAL

STUDIES 1. Dehydration Structural changes following experimental dehydration within the SFO have been observed in various LM investigations. Dehydration through water deprivation or the ingestion of 3% saline caused an increase in basophilia (Pachomov, 1963) and an increase in the size of neuronal nuclei (Legait, 1962; 15.7%; Palkovits, 1969; Sirjean and Legait, 1972) and perikarya (Legait, 1962; Sarrat, 1968; Dellmann, 1970; Sirjean, 1972, 1977b; Dellmann and Simpson, 1975a). Similarly, during dehydration an increase in the activity of glucose-6-phosphate dehydrogenase has been noted (Sarrat, 1968), as well as increased incorporation

386

H. DIETER DELLMA" AND JOHN B. SIMPSON

of ~ytidine-~H into RNA (George, 1974) and of leu~ine-~H (Sijean, 1977a). Schiitte (1971), however, found no changes in the activity of various enzymes in the SFO of the dehydrated rat. Ultrastructural changes in the SFO following dehydration have also been described. Such changes involved activation of the organelles of protein synthesis in type I and type I1 and, to a lesser extent, in type 111 nerve cells (Dellmann, 1970; Dellmann and Simpson, 1975a). In the early phases of dehydration, the Golgi complex became multilocular, with widened cisternae and numerous pmximal vesicles (Fig. 62). During more prolonged deprivation, the cisternae of the RER enlarged and contained slightly granular material (Fig. 61). During the period of 9-21 days after the onset of dehydration, further changes included a further increase in the size of Golgi complexes, an increased abundance of polyribosomes and of small, empty vesicles, associations of NLBs with granules and mitochondria (Fig. 63), and an increase in dense bodies and dense lamellar bodies; ultimately SER became dilatated and filled with slightly granular material (Fig. 64).With dehydration Pachomov (1963) also noted an increase in the number of Gomori-positive beaded axons, and Sirjean (1973) observed droplet formation at the ventricular surface of ependymal cells in the dehydrated rat. During dehydration there is a significant increase in the size of neuronal perikarya in Meriones lybicus, although this particular effect is not significant in the rat (Sirjean, 1972; Sirjean and Legait, 1972). Nevertheless, the rat SFO increases approximately four times in volume, as a result of dilatation of the capillary network (Sirjean, 1972; Sirjean and Legait, 1972). Such increases in the volume of the entire SFO have also been reported for the garden dormouse

X

FIG.61. 12,450.

Dilatated RER cisternae in a type I1 neuron of a 10-day water-deprived rat. Bar, 1 pm.

FIG.62. Activated Golgi complex in a type I neuron from a rat after 5 days of hypertonic saline consumption. Bar, 0.5 pm. X 15,950.

THE SUBFORNICAL ORGAN

387

FIG.63. NLB in a type I neuron from a rat after 14 days of hypertonic saline consumption. Bar, 0.5 pm. x 15,950. FIG.64. Portion of a type I neuron from a rat after 21 days of hypertonic saline consumption. Bar, 1.5 prn. ~ 1 3 , 8 5 0 (Figs. . 61-64 from Dellmann and Simpson, 1975a.)

and for Meriones crassus (Legait, 1962). However, Pakovits has reported (1966) a considerable shrinkage of the rat SFO following the somewhat different treatments of 21 days of 1.5% sodium chloride (37%) or desoxycorticosterone acetate (DOCA) administration (41%) or 20 minutes after oral administration of 2.5% saline (29%). In comparison to European rodents African rodents have a relatively large SFO, a fact which may be related to their water metabolism (Legait et al.. 1973). The lack of water and food could likewise be responsible for the observation that the SFO of the dormouse is largest at the end of hibernation and smallest in August (Legait et al., 1973, 1974). Little variation was found in the volume of the SFO of Muscardinus avellanarius during the annual cycle (Legait et al., 1974).

2. Cellular Dehydration It is possible experimentally to evaluate the effects of dehydration of the cellular or of the extracellular body fluid compartment independently of one another. Following water deprivation, fluid is lost from both major body fluid compartments. The responses, in terms of physiological and endocrine reflexes, to each of these stimuli differ somewhat, and it thus becomes of interest to evaluate the effects of dehydration of the cellular versus extracellular body water, such as was not permitted in the experiments described above. Various investigators have described structural changes in the cells of the SFO following cellular dehydration. Palkovits found shrinkage of the entire rat SFO following oral administration of 2.5% sodium chloride. Thornsbomugh et al. (1973) described certain brain lesions which disrupted the natriuretic effect of

388

H. DIETER DELLMA" AND JOHN B. SIMPSON

intracarotid hypertonic sodium chloride infusion in anesthetized cats. Such lesions likely included the SFO. Passo er al. (1973) further found that intracarotid hypertonic sodium chloride caused increased unitary discharge rates in neurons of the SFO and speculated that this structure may be involved in neural control of natriuresis. Palkovits (1966) noted that oral administration of hypotonic sodium chloride or of distilled water caused an increase in size of neuronal perikaryal nuclei of 25 and 318, respectively. However, Simpson and Routtenberg (1974) failed to find increased water intake following direct intracranial injection of hypertonic sodium chloride (930 mOsm, 0.5 pl) in awake rats. Clearly, much work remains to be done on the role of the SFO in mediation of the antidiuretic, natriuretic, and dipsogenic effects of cellular dehydration. 3. Extracellular Dehydration

Most recent work regarding the role of the SFO in body fluid homeostasis has centered on selective dehydration of the extracellular body fluid compartment. It is now apparent that the SFO plays a pivotal role in mediation of certain neural responses to loss of water from this body fluid compartment and that it is a site of action of the hormone angiotensin I1 (hereafter, angiotensin). As noted above, Palkovits (1966) reported increases in cell nuclei volume following acute hypovolemia. Further, isosmotic hypovolemia caused by the withdrawal of 2 ml of blood in the rat caused an 18% increase in nuclear volume of neuronal perikarya of the SFO after 10 minutes, a 30% increase after 29 minutes, and a 47% increase after 30 minutes (Palkovits, 1966). Alternatively, using the same techniques of measurement of SFO neuronal nuclei, Palkovits also reported that acute isosmotic hypervolemia caused a 7% decrease in nuclear volume after 10 minutes, a 23% decrease after 20 minutes, and a 25% decrease after 30 minutes. An even greater decrease was subsequently reported for acutely hypervolemic animals (Palkovits, 1969). Dellmann and Simpson (1975a) described several ultrastructural changes in SFO neuronal perikarya following various hypovolemic treatments. Within 24 hours after ligation of the caudal vena cava, the Golgi complex of type I and type II neurons increased in size and the RER in extent. Subependymal invaginations of penvascular spaces became more numerous (Fig. 65). Many ependymal cells had extensive SER with an electron-dense content, and a prominent Golgi complex with many vesicles was found in its vicinity (Fig. 66). At 48 hours, the Golgi complexes were extremely vesiculated, and the cisternae of the RER had numerous empty dilatations (Figs. 67 and 68). The functional correlate of these changes was not specified. Alternatively, these workers did not find any changes associated with another, different, form of hypovolemia, produced by hyperoncotic colloid dialysis, within the first 24 hours following onset of dehydration.

THE SUBFORNICAL ORGAN

389

FIG.65. In rats with acute hypovolemia the normally present subependymal spaces become more numerous. Bar, 1 pm. ~ 5 9 0 0 . FIG.66. Portion of an ependymal cell from a 24-hour caval-ligated rat. Bar,0.5 pm. X 13,200.

4. Other Experimental Interventions

Adrenalectomy and a sodium-deficient diet had identical effects in that they caused a 25-30% increase in the size of neuronal nuclei (Palkovits, 1966, 1969; Palkovits and Wetzig, 1969) and swelling and vacuolization of the cytoplasm. This increase was absent in adrenalectomized DOCA-mated animals (Palkovits and Wetzig, 1969). At the ultrastructural level the changes in adrenalectomized animals are similar to but less pronounced than those observed in dehydration.

FIG. 67. Activated Golgi complex in a type I neuron from a 2-day caval-ligated rat. Bar,0.5 pm. 13,200. FIG. 68. Dilatated cisternae of the RER in a type I1 neuron from a 2day caval-ligated rat. Bar, 2.5 p m . x 13.200. (Figs. 67-70, from Dellmann and Simpson, 1975a.) X

390

H. DIETER DELLMA" AND JOHN B. SIMPSON

They involve a progressive increase in the size of the Golgi complex, vesicle formation by it, and an increase in the number of lysosomes and dilatated cisternae of RER filled with granular material (Figs. 69 and 70). Many ependymal cells m also activated, as evidenced by the size increase of the Golgi complex and the presence of many vesicles and multivesicular bodies (Dellmann and Simpson, 1975a). In the SFO of laying or thyroid-stimulating hormone (TSH)-treated birds, Legait (1956) observed the presence of Gomori-positive terminals which were normally only visible in the vicinity of the SFO. Estrogen administration or the intraperitoneal injection of 12% alcohol caused an increase in the number of Gomori-positive granules within perivascular and subependymal glial cells in the rat SFO (Pachomov, 1963). In germ-free rats the SFO is slightly but significantly smaller than in normal animals (Legait el al., 1975b). No changes were observed in the nuclear volume of neuronal perikarya of rats treated with estradiol, methylthiouracil, diiodotyrosine, p-hydroxypropriophenone, or alloxan, or after thyroidectomy (Palkovits and Wetzig, 1969)). In the rabbit the intraventricular injection of bacteria or quartz particles caused disappearance of the giant vacuoles, as did partial coagulation of the SFO. However, interruption of the caudal blood supply caused an increase in their number (Watermann, 1969), which was also noted after injection of lycopodium spores into the subarachnoid space (Watermann, 1956). Following intraperitoneal injection of phenylalanine-gH a pronounced uptake into neurons and glial nuclei was observed in the cat and guinea pig (Cramer, 1970).

FIG. 69. Portion of a type I neuron from a 12-day adrenalectomized rat. Bar,0.5 prn. x 13,850. FIG.70. Portion of type I1 neuron from a #-day adrenalectomized mouse. Bar, 0.5 pm. x 13,850. (Figs. 65 and 66, from Dellmann and Simpson, 1975a. Same as Fig. 68.)

THE SUBFORNICAL ORGAN

39 1

Subcutaneously injected estradioL3His taken up selectively by the neurons of the SFO (Stumpf, 1970). The SFO responds to ovariectomy with an increased incorporation of uridine3H into RNA (George and Penrose, 1975). Perfusion of the cat cerebral ventricle with fluorescent dye (3,6-diaminoacridine trihydrochloride) caused deep penetration of the dye into the SFO (Fleischhauer, 1964). Intraventricularly injected HRP is not only taken up by ependymal cells but is also found to diffuse through the ependymal layer and to infiltrate the subependymal fibrous network between axons, dendrites, and ependymal cell processes (Pfenninger, 1969). Following destruction of the SFO, the following effects were observed. The choroid plexus of the third and lateral ventricles was aplastic and covered with flat epithelial cells with a darkly stained cytoplasm; the choroid plexus of the fourth ventricle was hyperactive; the SCO had a higher than normal epithelium, with vacuoles in the cell apexes and secretory granules; the paraventricular organ had more folds and also secretory granules; neurosecretory material was more abundant in the supraoptic and paraventricular nuclei (Sirjean and Legait, 1974).

B. PHYSIOLOGICAL STUDIES OF THE SUBFORNICAL ORGAN The morphological studies described above suggest that dehydration of the cellular or the extracellular body fluid compartment is correlated with alterations in neuronal structure in the SFO. In particular, these changes suggest that neurons in the SFO respond to dehydration with increased metabolism. One prominent physiological consequence of dehydration of the extracellular fluid compartment is increased secretion of the renal principle renin, and subsequent generation in the circulation of the octapeptide hormone, angiotensin. Several actions of angiotensin are central nervous and synergistic in defense of the extracellular fluid volume. In particular, angiotensin causes a blood pressor effect, increased secretion of vasopressin, and a dipsogenic, or thirst-eliciting, effect. Considerable evidence now indicates that the SFO is a central target organ for angiotensin. Because of the lack of a blood-brain barrier circulating peptides, such as angiotensin, could gain access to the SFO’s extracellular fluid and affect local neuronal functioning. Over the last several years, studies of the SFO in rodents have indicated an important role for this organ in the initiation of water ingestion. This behavioral event of course is appropriate in situations in which the organism is dehydrated. There is evidence that the dense cholinergic synaptic plexus within the SFO functions, at least in part, to initiate drinking and to control blood pressure. The same function appears to be ascribable to action of angiotensin at the SFO.

392

H.DIETER DELLMA" AND JOHN B. SIMPSON

However, it is clearly not the case that the structure is the unique central locus from which control of water ingestion and blood pressure emanate. For example, rats maintain a normal daily water intake despite total ablation of the SFO (Simpson and Routtenberg, 1972). Rather, the SFO is one locus at which neuroendocrine andor neurophysiological events may initiate such responses to dehydration. The significant experimental observations regarding the role of the SFO in body fluid homeostasis are now summarized. 1. Drinking Behavior It is now recognized that circulating angiotensin stimulates thirst, increased blood pressure, and secretion of vasopressin, adrenocorticotrophichormone, and aldosterone. Several of these effects are mediated by the action of angiotensin on the brain, A question of interest regarding the central actions of angiotensin, then, is, Where in the brain does this principle act? As a fist logical step in solving this puzzle, it is necessary to point out that the hormone does not cross the blood-brain barrier and does not enter the CSF (Ramsay and Reid, 1975; Shrager er al., 1975). It is thus the case that angiotensin actions on brain must be mediated by extra blood-brain barrier structures, such as the circumventricular organs. This constraint on possible candidate loci of action of angiotensin led Simpson and Routtenberg (1973) to explore the possibility that the SFO might mediate the dipsogenic action of the hormone. It was initially demonstrated by these workers that direct, topical applications of angiotensin to the SFO of awake, unrestrained rats elicited water ingestion. Injections of equivalent quantities of hormone at other loci, such as the cerebral ventricles, fornix, or hypothalamus were less effective than SFO injections in causing water ingestion. It was also shown that drinking elicited by hypothalamic injections of angiotensin was reduced or eliminated by selective destruction of the SFO (Simpson and Routtenberg, 1973). This latter effect, however, is controversial (Buggy et al., 1975; Simpson and Routtenberg, 1978). Simpson (1973), Abelaal ef al. (1974), and Simpson and Routtenberg (1975) all reported that SFO ablation reduced drinking in response to aphysiological quantities of intravenous angiotensin. Felix and Akert (1 974) demonstrated that iontophoretically injected angiotensin increased the unitary discharge rates of SFO neurons. This action was specific (Phillips and Felix, 1976). These earlier studies, then, indicated that the SFO may play a role in the central actions of angiotensin. A recent series of experiments (Simpson et at., 1978) tested rigorously the hypothesis that the SFO is a central dipsogenic site of action of circulating (Simpson and Routtenberg, 1973) angiotensin. These studies employed several diverse techniques, and the agreement of results concerning angiotensin and the SFO indicates that the structure is significantly involved in central effects of the hormone.

393

THE SUBFORNICAL ORGAN

The first experiment of this series (Simpson et al., 1978) explored the doseresponse relationship between injected angiotensin and elicited water intake at several brain loci reported in the literature to be effective sites of application of the hormone. The results of this dose-response analysis of angiotensin-induceddrinking are shown in Fig. 71. Two results are noteworthy. First, it is apparent that the dose-response curve for the SFO is more sensitive than that for adjacent ventricular or tissue sites of application. It is thus unlikely that the applied angiotensin diffused via CSF or extracellular fluid to alternative loci from the SFO injections. Second, the threshold dose of angiotensin at the SFO is within the range of concentrations of angiotensin achieved in blood during maximal renin release (Mann el al., 1977). It is important to note that such sensitivity to injected hormone was obtained if and only if the cannula terminated within the SFO and not in an adjacent ventricular space or neuropil. The SFO, then, was clearly the most sensitive site of application of angiotensin in this study.

i

5.

4.

I

lo-16

10-15

10.1'

10-13

lo-12

lntracranial He5 - A 11, moles FIG.71. Water intake elicited by various doses of angiotensin applied to the SFO, dorsal third ventricle, or lateral ventricle. At each data point the numerator indicates the number of animals ingesting water, and the denominator indicates the number of animals injected. (From Simpson et al., 1978.)

H. DIETER DELLMANN AND JOHN B. SIMPSON

394

A second experiment (Simpson et al., 1978) evaluated the necessity of the SFO for drinking elicited by the intravenous infusion of low doses of angiotensin, in analogy with classic endocrine extirpation experiment. It is known that such infusions mimic the concentrations of hormone achieved during maximal renal renin secretion (Hsiao et al., 1977; J. B. Simpson and 1. A. Reid, unpublished), and vascular delivery is the mode of access of circulating angiotensin to the brain. The experimental manipulations consisted of selective lesions of the SFO or the adjacent ventral fornical commissure, or of surgical controls. In a large group of animals with virtual ablation of the central mne of the SFO, drinking was not elicited by infusion of hormone (Fig. 72). In contrast, the same doses of hormone infused into neurologically intact controls or into animals with large lesions proximal to but not including the SFO do indeed provoke drinking in rats. Selective and local destruction of the SFO, then, eliminates drinking in response to intravenous angiotensin. Further findings in animals bearing this lesion of the SFO have revealed that (1) the effect on intravenous angiotensin-induced drinking is chronic in that, 3

5te1n;

I

I

I I

f

4-

E

3-

L

2-

0)

I

I

L

P

I-

’(4171 0-

SFO (n=lEl 1014)

12/1(1l

(4/1W

12/15]

THE SUBFORNICAL ORGAN

0

0.2

2

lntrocronial Sorolosin,

20

395

200

ng/0.2 yl/min

FIG.73. Water intake during a simultaneous intravenous infusion of angiotensin and intracranial infusion of variable doses of saralasin into the SFO (SFO),ventral fornical commissure (VFC),or lateral or third ventricle (111-V& LV). (From Simpson et al., 1978.)

months after ablation of the SFO, animals still fail to drink in response to intravenous infusion of angiotensin at these doses (Simpson et al., 1978); (2) this effect appears to be specific to angiotensin-induceddrinking in that such animals drink normally in response to other thirst stimuli, such as cellular dehydration produced by systemic injection of hypertonic sodium chloride (Simpson et al., 1978); (3) such animals drink less than controls in response to the extracellular thirst stimuli of hyperoncotic colloid dialysis or to beta-adrenergic agonists systemically injected (Simpson ef al., 1978); and (4) such lesions, while producing animals which are refractory to drinking induced by exogenous circulating angiotensin, do not prevent animals from regulating water intake over the long term, as indicated by normal daily water intakes commencing within 3 days following such lesion surgery (Simpson and Routtenberg, 1972). A third experiment of this series (Simpson et af., 1978) found that topical antagonism of angiotensin at the SFO reduced or prevented drinking in response to intravenously infused angiotensin. 1-Sar-8-ala-angiotensin11, or saralasin acetate, antagonizes all known effects of the hormone at central as well as peripheral sites of action. Simultaneous intravenous infusion of an agonist and intracranial infusion of an antagonist of various loci showed (Fig. 73) that sufficiently high doses of ari-’

396

H. DIETER DELLMA" AND JOHN B . SIMPSON

tagonist at all tested brain depots prevented drinking in response to intravenous angiotensin. However, maximal sensitivity, by several orders of magnitude, was only found when the antagonist was applied directly to the SFO and not to adjacent ventricles or parenchyma. This observation extends reports that pretreatment with saralasin prevents an angiotensin-induced increase in unitary discharge rates of SFO neurons (Phillips and Felix, 1976) and that pretreatment at the SFO with this antagonist likewise prevents angiotensin-induced drinking at the SFO (Simpson and Mangiapane, 1977). The regular dose-response relationship for antagonism of intravenous drinking at the SFO further suggests that the antagonism was indeed specific and competitive. The additional finding that SFO applications of saralasin do not affect cellular dehydration drinking indicates a specificity of antagonism in this experiment. This experiment obviated certain difficulties inherent in the previous lesion experiment, because the functional and spkcific antagonism of angiotensin action at the SFO was readily reversible. These experiments, then, indicate that the SFO is one locus in the brain at which angiotensin exerts an action. However, these studies do not demonstrate unequivocally that the SFO is the exclusive central site of (dipsogenic) action of angio,tensin.Rather, the SFO must be considered the only structure at present for which such convincing proof exists that it is indeed a central site of action of the hormone. Other studies have suggested that additional loci, including perhaps the OVLT (Buggy ef al., 1975; Phillips and Hoffman, 1977; Johnson and Buggy, 1977) and the preoptic regions (Mogenson et al., 1977), may likewise be significant in the central actions of angiotensin. Critical discussion of experiments indicating alternative loci of angiotensin action are beyond the scope of this article. Several recent studies have suggested potential modes of action of angiotensin at the SFO. Specific competitive antagonists of angiotensin prevent both the drinking response to injected angiotensin (Simpson and Mangiapane, 1977) and the increased unitary discharge rate in response to iontophoretically applied hormone (Phillips and Felix, 1976). These findings indicate a specific action of angiotensin on neurons of the SFO. One proposal recently advanced by Nicolaides and Fitzsimons (1976) suggests that the hormone acts to cause drinking at the SFO by decreasing blood flow through the structure; that is, angiotensin may act as a potent local central pressor substance, in analogy with its potent peripheral myotrophic effect, and the resulting local vascular deformation is the stimulus for the elicited behavior. In this scheme, then, the SFO functions as a vascular mechanoreceptor within the brain. In support of this proposition, it was reported that large doses of drugs which are vasidilators in peripheral circulatory beds, such as nitroprusside, papaverine, and sodium nitrite, reduced or prevented drinking in response to angiotensin, although not to carbachol. Kenney et al. (1977) have also reported that SFO application of prostaglandin El prevented lateral ventricular angiotensin drinking. These observations are seemingly com-

THE SUBFORNICAL ORGAN

397

plementary to those of Sirjean (1972) and Sijean and Legait (1972) that the volume of the entire SFO changes as a function of changes in the diameter of the capillaries. However, the demonstration of a direct unitary discharge rate increases in cat SFO following iontophoretic application of angiotensin indicates that direct action of angiotensin on SFO neurons may be a more likely mode of action. Either or both mechanisms may be means of action of angiotensin at the SFO, and further experimentation is indicated. It has been found that other agents which affect hydromineral homeostasis and/or are putative endogenous transmitter substances within the SFO may also affect water metabolism following applications to the SFO. One early study (Simpson, 1973) demonstrated that, in rats which responded to angiotensin, topical applications to the SFO of a variety of other compounds, for the most part, did not elicit drinking. Applications of epinephrine, dopamine, or norepinephrine did not provoke water intake. While catecholamines apparently do not affect water intake at the SFO, it was noted in this study that the indoleamine 5-HT caused moderate drinking following application there. SFO applications of the hormone aldosterone or vasopressin did not affect water intake. However, several experiments have shown that cholinomimetics reliably produced vigorous drinking following topical application to the SFO. The longlasting parasympatheticomimetic, carbachol, produced short-latency drinking in water-replete rats following intracranial injection at the SFO (Routtenberg and Simpson, 1971; Simpson and Routtenberg, 1973). Additionally, application of acetylcholine directly to the SFO also elicited drinking, an observation which has not been reported with this agent following application elsewhere (Simpson and Routtenberg, 1974). All these forms of cholinergic thirst within the SFO are antagonized by atropine (Simpson, 1973). It was also found that drinking elicited by carbachol application to the third ventricle was eliminated by selective destruction of the SFO (Simpson and Routtenberg, 1972). Other investigators, however, did not find this same effect (Buggy and Fisher, 1976). It may be that intracranial carbachol-induced drinking in the rat is in part dependent upon the SFO, and this may occur following delivery of injectate to the organ via CSF diffusion (Routtenberg, 1967). Cholinergic innervation of the SFO, then, functions in the control of water balance in the rat. It has been recently demonstrated that the effects of cholinergic and peptidergic thirst at the SFO are independent (Simpson and Mangiapane, 1977). Pretreatment at the SFO with atropine but not with several nicotinic antagonists completely prevented carbachol-induced drinking at the SFO. Likewise, pretreatment with the angiotensin-competitive antagonist saralasin abolished angiotensin-induced drinking at the SFO. However, pretreatment with atropine did not affect angiotensin-induced drinking, and pretreatment with saralasin did not affect carbachol-induced drinking. Thus, within the SFO, the two thirst

398

H. DIETER DELLMA" AND JOHN B. SIMPSON

stimuli are not dependent upon one another and must therefore represent separate populations of receptors on the same or on different neurons of the SFO. These observations are interesting because both dipsogens also cause potent central pressor effects at the SFO. 2. Blood Pressure Recent experiments have examined the role of the SFO in central actions of angiotensin other than drinking elicitation, and a powerful interrelationship between the central pressor and dipsogenic effects of angiotensin and of cholinomimetics has been found (Mangiapane and Simpson, 1977; J. B. Simpson and M. L. Mangiapane, unpublished observations). Injection of angiotensin produced drinking at the SFO,the dorsal and ventral third ventricle, the lateral ventricle, and the fomical commissure. However, the magnitude of this effect was clearly maximal at the SFO, as reported previously (Simpson et al., 1978). In addition, injections of the hormone also produced a pressor effect, which, like the dipsogenic effect, was clearly maximal at the SFO. The interrelationship between drinking and pressor effects at the SFO, as shown in Fig. 74, was striking in that the onset of the increase in blood pressure (GI0 seconds) always preceded the onset of drinking behavior (G45 seconds).

40 0

I 30 0 In 0

20

2

-g ?! ul

10

a 0

-0

m Angiotensin 11, moles

FIG.74. Simultaneous dipsogenic and pressor effect as a function of variable doses of angiotensin applied to the SFO.Correlation between effects was r = .80. At each data point the numerator indicates the number of animals responding, and the denominator the number of animals injected. (From Mangiapane and Simpson, 1977.)

+

THE SUBFORNICAL ORGAN

399

The magnitude of the pressor and drinking effects were highly correlated (r = +.go). Further, at low doses of angiotensin (1.0 pg), it was possible in some animals to elicit a pressor effect in the absence of a dipsogenic effect. Injections of hormone into sleeping animals produced increased blood pressure prior to any behavioral arousal, and a pressor effect of smaller magnitude was elicited with similar latencies in rats under barbiturate anesthesia. Thus the increased blood pressure was not a consequence of the elicited behavior. These data indicate that both behavioral and reflexive physiological effects apparently emanated from angiotensin action on neurons of the SFO, although statements regarding whether both effects are mediated via the same or different neurons in the SFO are not at present possible. The two effects of angiotensin on the SFO occur in synergy to maintain the extracellular fluid volume. Injection at the SFO of the cholinomimetic carbachol likewise elicited both drinking and pressor effects (Mangiapane and Simpson, 1977; J. B. Simpson and M. L. Mangiapane, unpublished observations). Doses of carbachol of 1.O ng or more cause increased mean arterial pressure and water intake. As with angiotensin, the pressor effect always preceded the dipsogenic effect, and the former effect occurred in anesthetized rats. Thus it has now been shown that two agents which elicit drinking following SFO application also elicit a potent and prior pressor effect. In summary, evidence of both correlational and causative types has indicated that the SFO functions in the regulation of hydromineral homeostasis. Actions of angiotensin and of cholinomimetics at the SFO both act to produce increased water intake and increased arterial pressure. The mechanism of action of each substance on SFO neurons remains unclear, and alterations in SFO vasculature and/or actions on neuronal receptors may underlie either or both of these phenomena. In view of reports that the pressor effect of intraventdcular angiotensin is due at least partially to neurohypophyseal secretion of vasopressin (Phillips and Hoffman, 1977; Hutchinson et al., 1976), it will be of interest to determine if SFO application of angiotensin causes secretion of this principle. Miselis et al. (1977a,b) showed that SFO neural efferents contacted the magnocellular neurosecretory cells of the supraoptic nucleus. Thus a substrate for SFO modulation of vasopressin secretion has been provided on anatomical and inferential grounds. This possibility remains to be evaluated experimentally.

V. Conclusions Over the past few years our knowledge of the structure of the SFO has increased spectacularly, and much detailed information is currently available on all components of this organ. There are, however, many problems which remain to

400

H . DIETER DELLMANN AND JOHN B. SIMPSON

be solved and many questions which still are unanswered.

The SFO is a central site at which angiotensin and cholinergic agents cause drinking behavior and increased blood pressure. We are able at present to distinguish several functional types of neurons on the basis of iontophoretic data: neurons which are specifically activated by angiotensin, by acetylcholine, by both compounds, or by neither compound (Felix and Akert, 1974; Phillips and Felix, 1976). This functional classification remains without morphological correlation. In order to obtain further insight into and a better understanding of the histophysiology of the SFO, it is imperative to establish, through correlative stimulation and recording and HRP injection techniques, the identity, topography, and connectivity of these neurons. Such an investigation might also yield an answer to the question of whether type I and type I1 neurons are two distinctly different neurons, or whether they are a morphological expression of different functional stages of one neuron; it may also elucidate the significance of type I11 and type IV neurons. A developmental study of the SFO would be expected to shed some light on the identity of type IV neurons; such a study could clearly establish whether our hypothesis that they derive from type I and type I1 neurons is correct or whether they represent indeed a distinctly different neuronal type. It would be interesting to know at what developmental stage they are first observed and whether there is any relation between their first occurrence and any particular function. Can their release into the CSF be demonstrated conclusively? What is the significance of the vacuolization process of these neurons? Does it lead to giant vacuolated perikarya, or are the observed structures vacuolated axons andor dendrites, as it seems to be in the frog? Quantitative studies on the incidence of vacuolated neurons in aging animals as we11 as on the total neuronal population should provide information on the relationship between vacuolization, degeneration, and decreased SFO cell population. Supraependymal cells at the SFO include neurons, glial cells, macrophages, and cells whose identity could not be established. These constitute a cell population whose relationship to other cells of the SFO is enigmatic. Since supraependymal neurons are not unique to the SFO but are found in other locations within the ventricular system, it is legitimate to assume that they may not necessarily be specifically associated with functions of the SFO. Our findings in the rat support this concept (H.-D. Dellmann and J. G. Linner, unpublished observations); no relationship was detected between the occurrence, distribution, and number of supraependymal neurons and any of the parameters investigated, such as age, sex, season, breed, hypophysectomy, adrenalectomy, castration, and body fluid equilibrium. While neuronal perikarya were not observed in all specimens, we never failed to detect neuronal processes in supraependymal locations. What is the origin, nature, and significance of these processes? It is known that some of

THE SUBFORNICAL ORGAN

401

the supraependymal axons are serotonergic (Bouchaud et al., 1971), and it is unclear if all those associated with the SFO are also of this classification. If so, do they originate within the raphe nuclei as do many serotonergic supraependymal axons in other portions of the ventricular system (Chan-Palay, 1976)? The observed sequences of SFO ependymal cells migrating into the ventricular lumen have shown that the SFO contributes to this cell population, but they do not necessarily indicate a specific local function of these cells nor do they preclude migration to and from other areas. A systematic exploration of large ventricular regions or the entire ventricular system is necessary in order to solve this problem. In addition, more comparative ultrastructural data are needed to establish the exact identity of the supraependymalcells of the SFO, which were mentioned in Section III,C,3. The clear and complete delineation of the afferent and efferent connectivity of the SFO is of primary importance to our understanding of the role the SFO plays in body fluid homeostasis. The investigations by Hemesniemi et al. (1972) and Miselis et al. (1977a,b) have provided interesting data on this question, but our knowledge at present is incomplete, and this type of study must be pursued. Autoradiography as well as the tracing of HRP directly injected into the SFO should provide the desired information. The frog may prove to be a useful tool in the further exploration of morphological and functional connections between the peptidergic neurosecretory hypothalamic nuclei and the SFO. Because the organ is accessible directly through the roof of the third ventricle in this species, and because no nervous structures are destroyed during experiments, it is ideally located for direct orthodromic and antidromic stimulation and recording experiments. The ependymal lining of the SFO merits further investigation. Phillips et al. (1974) and Dellmann and Simpson (1976) showed very distinct regional differences in the surface morphology of the ependymal cells of the rat SFO. What is the significance of these differences? Is the high number of long microvilli caudally a morphological expression of a higher absorptive activity of these cells, and if so what role does this activity play in the function of the SFO? Further comparative data need to be obtained. Furthermore, since various experimental interventions not only cause changes within the neuronal population of the SFO but within ependymal cells as well (Dellmann and Simpson, 1975a), it is imperative that more correlative data be obtained. These brief concluding remarks have only touched on some of the most obvious problems to which future morphophysiological research must be addressed. The key role the SFO appears to play in extracellular fluid regulation will undoubtedly stimulate further research and possibly solve within the near future the questions posed here.

402

H. DIETER DELLMANN AND JOHN B. SIMPSON

VI. Table of Investigated Species In order to help investigators who would like specific information on the morphology of the SFO of a given species, we have listed the investigated species and the corresponding publication and, whenever possible and relevant, a summarizing statement of the findings. Species Mammals Marsupialia Didelphidae Didelphis virginiana Insectivora Erinacedae Erinaceus europaeus Talpidae Scalopus aquaricus Chiroptera Pteropodidae Pteropus edulis Rhinolophidae Rhinolophus ferrum equinum Rhinolophus hipposideros Vespertilionidae Myotis myoris Epresicus f. fuscus

Pipistrellus pipistrellus Mollossidae Tadarida mexicana

Primates Tupaiidae Tupaia glis Lemuridae Lemur Lorisidae. Galago crassicaudatus

Reference

Summary

Spiegel (1918) Akett et al. (1961)

H. Legait and Legait (1957b) Johnston (1913) Akert et al. (1961)

Spiegel (1918)

H. Legaint and Legait (1957b) H. Legait and Legait (1957b)

Johnston (1913) H. Legait and Legait (1957b) Akert et al. (1961)

Nucleus marginalis Same topography as in mammals but not overgrown by corpus callosum

H. Legait and Legait (1957b) Humphrey (1936)

Sprankel (1957) Hofer (1958, 1965) Hofer (1965) Sprankel (1957) Hofer (1957, 1958, 1965)

Supracommissuralportion of the bed nucleus of the hippocampal commissure

403

THE SUBFORNICAL ORGAN

Species Nycticebus cougang

Cebidae Aotes trivirgatus Alouatta Cebus Saimiri sciureus

Reference Sprankel (1957) Hofer (1958, 1965) Sprankel (1957, 1960) Hofer (1965) Hofer (1965) Akert er at. (1961) Cresswell e f a [ . (1964)

Hofer (1965) Nakajima et al. (1968)

Cercopithecoidae Maraca mulatta

McLardy (1 955) Hofer (1957, 1965) Hofer (1958) Sprankel (1957) Mergner (1961)

Maraca cynomolga Cercopithecus aethiops Macacus rhesus

Maraca irus Pongidae Hylobafes Callitrieidae Saguinus oedipus

Hominidae Homo sapiens

Summary

Vacuoles Caudal contact with the external CSF system

Topography; body, dorsal and ventral stalks Gomori-positive granules in glial cells, also adjacent to blood vessels Hemng bodies Presence of the enzymes of the Embden-Meyerhof pathway, pentose cycle, and tricarboxylic acid cycle

Large subependymal vacuoles Large perivascular connective tissues spaces; Herring bodies Vascular connection between OVLT and SFO

Sprankel (1957) Hofer (1958, 1965) Hofer (1958, 1965) Putnam (1922) Scoti and Krobisch-Dudley (1975) SEM Hofer (1965) Spiegel (1918) Mergner (1961)

Spiegel (1918) Putnam (1922) Pines and Maiman (1928) Pines and Scheftel (1929) Heidrich (1931) Dannheimer (1939)

Vascular connection between OVLT and SFO

Ependymal channels Development; caudal portion of SFO covered by pial connective tissue (continued)

404

H. DIETER DELLMA" AND JOHN B. SIMPSON Species

Reference

Summary

Scevola (1939, 1941) Legait (1942) Reichhold (1942) Ariens-Kappers (1955) Hasunuma (1956) H. Legait and Legait (1957b) Clara (1959) Rabl (1966)

Development Development; vacuolated cells

Finley (1939) Hasunuma (1956)

Vascularity AV anastomoses

Development AV anastomoses

No specific species mentioned Monkey Japanese monkey mentat a Dasypodidae Dasypus septemcinctus Lagomorpha Leporidae Orycrolagus cuniculusa

Spiegel (1918)

Spiegel (1918) Pines and Maiman (1928) Pines and Schefiel (1929) Cohrs and von Knobloch (1936) Legait (1942)

Vascularity

Axon terminals at endothelium of blood vessels of the base of the SFO receptors?

H. Legait and Lgait (1957b) Rudert el ai. (1965) Weindl (1965) Rudert er al. (1966) Weindl (1967)

Rudert et al. (1968) Duvemoy and Koritkk (1965) Watermann (1968)

Watermann (1969)

Leonhardt and Backhus-Roth ( 1969)

TEM Vacuoles; histochemistry TEM;vasculature No dye after intravenous injection of trypan blue; no perivascular connective tissue spaces TEM; detailed cytology Detailed description of vasculature Uptake and phagocytosis of erythrocytes and bacteria from CSF Giant vacuoles disappear after intraventricular injection of bacteria or quartz particles, and increase after interruption of dorsal blood supply Supraependymal axon terminals; contact with ependymal cells

405

THE SUBFORNICAL ORGAN

Species

Reference Leonhardt and Lindemann (1973) Legait er al. (1975a) Weindl (1976)

Summary

SEM and TEM; release of giant vacuoles into CSF HRP does not cross capillary walls

Rodentia Legait et al. (1973) Legait et al. (1975a) Sciuridae Cirellus citellus" Marmotta marmottan Sciurus vulgaris' Citellus ter Xerus Cricetidae H. Legait and Legait (1957b) Sigmodon hispidusavb Cricerus cricerusa,b Mesocricetus auratusa.b Wislocki and Leduc (1952) E. Legait and Legait (1957) Watermann (1969) Microtus orcadensisasb E. Legait and Legait (1967) Microtus senegalensis a Ondatra zibethicaa Pachyuromys Gerbillidae Gerbillus hinipes" Tatera valida" Meriones crassusa.b

Meriones lybicus' Meriones shawia*b

Legait (1962)

Sirjean and Legait (1972) Sijean (1972, 1973) Sijean and Legait (1972) Sirjean and Legait (1972) Duvernoy and Koritkt (1965)

SFO larger in African rodents than in European rodents Increase in SFO volume with higher body weights

Giant vacuoles; presence of Gomori-positive nerve fiben from paraventricular nucleus

During dehydration progressive increase in size of cells and nuclei Increase in nuclear volume during dehydration Vasculature

Meriones persicus " Muridae Acomys caharinus" Criceromys gambianusa,b Dasymys incorntusUab Hybomys univittatus"" Hylomyscus srella",b ~~

(continued)

H.DIETER DELLMA” AND JOHN B. SIMPSON

406 Species

Reference

summary

Behnsen (1927) Dempsey and Wislocki (1955) Shimizu and Morikawa (1957) Shimizu and Okada (1957) Lichtensteiger (1967)

Accumulation of vitahdyes Same findings as in rat Succinic dehydrogenase Same findings as in rat 5-HT and other substances; no monoaminecontaining cells in normal animals; no true catecholamine-containing cell

Leggada induta Lemniscomys siriatusa*b Lophuromys sikapusi‘Mmtomys (38 chromo-

somes)Qab Mus musculusasb

Watermann (1969) Hernesniemi et al. (1972)

Afferent connections from nucleus preopticus medialis into ventral and rostra1 parts of SFO, and from nucleus triangularis septi into dorsal

SFO Schinko et al. (1972) Spoemi and Alexy (1974)

TEM Hypoplastic and dysplastic SFO in hydrocephalic mice; absence of astrucytes and almost complete absence of tanycytes; disappearance of nerve cells Dellmann and Simpson (1975a) TEM Broadwell and Brightman Afferents from vertical limb of the nucleus of the diagonal (1976) band of Broca Carithers (1978) TEM changes during dehydration and subsequent rehydration

Praomys a*b Praomys jacksoni a Praomys morioa Praomys tullbergP Pelomys campanaea,b Ranus norvegicusaSb Rams albinos

H. Legait and Legait (1957b) Johnston (1913) Nucleus marginalis Cohrs and von Knobloch (1936) Reichhold (1942)

407

THE SUBFORNICAL ORGAN

Species

Reference Leduc and Wislocki (1952)

Wislocki and Leduc (1952)

Dempsey and Wislocki (1955)

Grignon and Grignon (1957) Shimizu and Okada (1957)

Legait (1962)

Pachomov (1963)

Shute and Lewis (1963) Lewis and Shute (1966) Spoerri (1963)

Nakajima (1964) Nakajima (1966) Watermann (1965a) Palkovits (1966, 1969)

Lewis and Shute (1967) Lichtensteiger (1967) Dernpsey (1968)

Nakajima er al. (1968)

Summary Alkaline and acid phosphatases; nonspecific esterases; succinic dehydrogenase Uptake of silver nitrate (intercellular spaces and neurons) and trypan blue Silver deposit in perivascular connective tissue spaces and in fibroblasts and glial cells Development Phosphorylase decline after birth; slight coloration in adult Increased diameter of nuclei and neuronal cytoplasm during dehydration Gomori-positive glial cells and fibers; increase after NaCl and estrogen as well as intraperitoneal injection of alcohol; increase in basophilic neurons after dehydration AChE from AChEcontaining cells in the midline of septum and dorsal fornix Detailed description of vasculature; possible connection with OVLT Am ylophosphory lase Phosphatase Changes in neuronal nuclear volume after adrenalectomy, thirst, hypovolemia, hypervolemia, hypertoncity Large amounts of A C E Same findings as in mice (see above) Ultrastructure; silver uptake especially in fibroblasts in the perivascular connective tissue spaces Acid phosphatase; Ca2+activated ATPase (continued)

H. DIETER DELLMANN AND JOHN B. SIMPSON

408 Species

Reference Sarrat (1968)

Akert (1969a) Palkovits and Wetzig (1969)

Watermann (1969) Akert and Steiner (1970)

Summary Neuronal size increase after dehydration; increased glucose-6-phosphate dehydrogenase activity AChE and ChE in neuropil Increase in nuclear volume after adrenalectomy; compensated by DOCA

ACh concentration per gram SFO = 0.17 x gm Autofluorescent granules Bouchaud and Berrou (1970) especially in rats with several litters Three types of neurons; EM Dellmann (1970) changes during dehydration EstradioVH uptake by neurons Stumpf (1970) Serotoningeric supraependymal Bouchaud el al. (1971) nerve fibers Myofer uptake Dretzki (1971) Unspecific esterases Goslar and Bock (1971) No changes in various enzymes Schiitte (1971) in dehydrated rat Same as for mice (see above) Hernesniemi eta!. (1972) Increase in volume of SFO Sirjean (1972, 1973) during dehydration Increase in diameter of nuclei; Sirjean and Legait (1972) increased capillary diameter; SFO four times larger during dehydration Droplet formation on Sijean (1973) ependymal cells during dehydration Silver uptake; large grains in Bouchaud (1974a) perivascular labyrinth around fenestrated capillaries; small grains around continuous capillaries Degenerative and involutive Bouchaud (1974b. 1975a) changes in axon dilatations; 5-HT uptake in same terminals Increased cytidine-’H incorGeorge (1974) poration into RNA during dehydration Hindelang-Gertner et a!. (1974) Larger and lighter NLBs in stimulated animals

409

THE SUBFORNICAL ORGAN Species

Reference Jacobowitz and Palkovits (1974) K i m et al. (1974) Phillips er a/. (1974)

Sirjean and Legait (1974)

Bouchaud (1975a,b) Dellmann and Simpson (1975a)

George and Penrose (1975)

Dellmann and Simpson (1975b, 1976)

Legait et al. (1975b) Pelletier et a/. (1975)

Williams et a / . (1975) Buranarugsa and Hubbard (1976) Legait

et al.

Palkovits

et

(1976) al. (1976)

Pelletier (1976) Pelletier et a/. (1976) Saavedra et al. (1976) Brownstein (1977)

Dellmann and Linner (1977)

Summary

AChE terminals LHRH; TRH Subdivision of SFO into three zones; varying surface characteristics Variable effects of destruction of SFO on choroid plexus, SCO, and neurosecretory nuclei Vasculature; HRP injections Neuronal ultrastructure following dehydration, adrenalectomy, hypovolemia, hypertonicity Increased uridine-SH incorporation into RNA in ovariectomized rats Subdivision of SFO into three zones; varying composition within SFO; structural differences in ependymal cells and supraependymal cells SFO smaller in germ-free rats MIF-SH present after intravenous or intraventricular injection Presence of C-MA0 Action potentials in response to angiotensin I1 SFO-body weight relationship during growth SFO had lowest somatostatin content of all circumventricular organs LHRH (localization by peroxidase-antiperoxidase) Somatostatin and LHRH Dopamine; histamine; 5-HT; norepinephrine LHRH; TRH; somatostatin; norepinephrine; dopamine; 5-HT; histamine TEM and SEM; supraependymal cells (continued)

H.DIETER DELLMANN AND JOHN B. SIMPSON

410 ~

Species

Reference

Summary

Efferent SFO connections Increase in leucine-sH incorporation in dehydrated rats Nuclear diameter changes Sijean (1977b) during dehydration and subsequent rehydration Projections to the supraoptic Shapiro and Miselis (1978) nucleus Thamnomys rutilansa*b Deshmukh and Phillips (1978a) SEM Deshmukh and Phillips (197%) Junctional complexes Stochomys Efferent SFO connections Miselis et al. (1978) longicaudatusa.b Myoxidae Little variation in SFO volume Legait ei al. (1974) Eliomys quercinusasb during annual cycle No change in nuclear volume Sijean (1972, 1973) during dehydration Largest SFO volume at end of Legait er al. (1973, 1974) GIis glisonb hibernation Presence of gomori-positive Legait and Legait (1967) Mucsardinus nerve fibers avellanariusa*b Little variation in SFO volume Legait er al. (1974) during annual cycle Graphiurus graphiurusaab Caviidae Cavia apereaaSb Cohrs and von Knobloch (1936) Cavia cobaya Reichhold (1942) Shimizu and Morikawa (1957) Succinic dehydrogenase as in rat Shimizu and Okada (1957) H. Legait and Legait (1957b) Watermann (1965b, 1968, Uptake and phagocytosis in 1969) erythrocytes and bacteria from CSF; vasculature Adhamy (1967) Structure; vasculature; trypan blue uptake in perivascular spaces; Phen~lalanine-~ H incorporated Cramer (1970) into nerve and glial cells; AV anstomoSes Capromyidae Myocastor coypus as Cetacea Delphinidae Phocoena Spiegel (1918) Debhinus Spiegel (1918) Miselis ei al. (1977a,b) Sijean (1977a)

41 1

THE SUBFORNICAL ORGAN

Species Camivora Canidae Canis familiaris

Mustelidae Meles meles Mustella putorius fur0 Mustella erminea

Felidae Felis domestica

Reference

summary

Spiegel (1918) Vasculature Pines and Maiman (1928) CohrsandvonKnobloch(1936) Vacuoles containing lipofuscin Yamada and Hasunuma (1955) AV anastomoses H. Legait and Legait (1957b) Gomori-positive granules in glial cells Detailed "EM;ependymal Andres (1965a,b) channels Duvemoy and Koritkt (1965) Detailed description of vasculature Watemann (1965b. 1969) Ependymal channels Duvemoy and Koritkt (1965) H. Legait and Legait (1957b) Legait (1962)

Spiegel (1918) Pines and Maiman (1928) CohrsandvonKnobloch(1936) Brizzee (1954) Hasunuma (1956) Fleischhauer (1964) Duvemoy and Koritkk (1964, 1965) Rohr ef al. (1965) Watemann (1965a) Rohr (1966a,b) Akert (1967) Akert et al. (1967a,b) Pfenninger er al. (1967) Akert (1969a) Akert and Steiner (1970) Akert (1969b) Pfenninger (1969)

Vasculature Continuous illumination causes increase in nuclear diameter and cytoplasm

Vasculature Vasculature Vasculature; AV anastomses Fluorescent dyes penetrate SFO from CSF Detailed description of vasculature TEM Succinic dehydrogenase Detailed "EM of vasculature and cytology High ChE content TEM of synapses; crest synapses TEM AchE and ChE in neuropil; ACh-responsive neurons Structure; vasculature HRP uptake from ventricle especially in dark ependymal cells but not in ependymal channels ( continued)

H. DIETER DELLMA" AND JOHN B. SIMPSON

412 Species

Reference Watennann (1969) Cramer (1970) Hemesniemi et al. (1972) Dellmann and Simpson (1975a) Felix (1976)

Van Buren et al. (1977)

Proboscidea Elephantidae Loxodonta africana Perissodactyla Equidac Equus caballus Artiodactyla Suidae Sus scrofa

Camelidae Carnelus drornedarius

Bovidae Bos taurus

Bos bubalis

Capra Ovis aries

Mammals (no specific species mentioned)

Stephan and Janssen (1956)

summary Phenylalanine-sH uptake in nerve and glial cells Same as in mice Neurons that respond to both ACh and angiotensin and to angiotensin only TEM neuritic growth cone and ependymal gap junctions during early development

Vasculature; projections

Cohrs and von Knobloch (1936)

Spiegel (1918) Cohrs and von Knobloch (1936) von Knobloch (1937) Duvemoy and Koritkk (1965)

Dellmann and Fahmy (1967b) Dellmann et a!. (1965) Dellmann and Simpson (1975a)

Myelinated nerve fibers Development Detailed description of vasculatum Neurosecretory axons TEM

Absence of myelinated nerve fibers Dellmann and Simpson (1975a) TEM Dellmann and Fahmy (1967a) Many vncuolized nerve cells; neurosecretory axons Dellmann and Simpson (1975a) TEM Spiegel (1918) Spiegel (1918) Cohrs and von Knobloch (1936) Many vacuoles surrounded by glial fibers Increase in number of giant Watermann (1969) vacuoles 1 hour after coitus in the ram Cohrs and von Knobloch (1936)

Wilder (1896) Spiegel (1937) Battro (1962) Watennann (1965a,b)

Crista fomicis Summarizing review Development; vasculature

413

THE SUBFORNICAL ORGAN

Species

Reference Hofer ( 1969) Weindl (1973) Scott et al. (1974)

Buds Fringillidae Cocorhraustes cocothraustes Fringilla coelebs

Ploceidae Passer domesticus

Columbidae Columbia livia

Legait (1956) E. Legait and Legait (1957) Reichhold (1942) 1

I

Reichhold (1942) Legait (1956) E. Legait and Legait (1957)

summary Review, including other circumventricular organs Short review; alsoothercircumventricular organs SEM

Same as in Columbia Spherical, lobulated SFOcaudal to rostra1commissure;macroglial cells; parenchymal cells; occasional stratified ependyma

Gomori-positive granules in glial cells

Legait (1942) Legait (1956)

Gomori-positive fibers after TSH and in laying females; blood “lake” in center of

E. Legait and Legait (1957)

Gomori-positive granules in glial cells

SFO

Anatidae Anas Laridae h r u s canus Phasianidae Gallus domesticus

Coturnix coturnix japonica Accipitridae Buteo buteo Paridae Parus coeruleus No species listed

Legait (1956) E. Legait and Legait (1957)

Same as in Columbia

Wetzig and Palkovits (1968)

Development

Legait et al. (1957)

Development; vacuoles; capillaries in connection with choroid plexus Same as in Columbia

E. Legait and Legait (1975) Watermann and Abdel-Messeih (1957) Watermann (1969) Dellmann and Linner (1979) Takei (1977) Mikami and Asari (1978) Takei ef al. (1978) Tsuneki et al. (1978) E. Legait and Legait (1957)

TEM EM SEM TEM Same as in Columbia

Pines and Schefte.l(i929) Huber and Crosby (1929) (continued)

414

H. DIETER D E L L M A " AND JOHN B. SIMPSON ~

Species

Refenmce

summary

Fish Cyprinidae Tinca tinca

Abramis brama Alburnus alburnus Barbus barbus Cyprinus carpi0 Gobio gobio Leuciscus cephalus Scardinius erythrophthalmus Salrnonidae Salmo salvelinus Salmo irideus ( =Salmo gairdneri)

Legait (1942)

H. Legait and Legait (1957b)

Legait (1942)

H. Legait and Legait (1957b) Esocidae Esox lucius Ictaluridae Ameirus ( =Ictalurus) ne bulosus

Pines and Scheftel (1929b)

H. Legait and Legait (1957b) Gasterosteidae Gasterosteus aculeatus Percidae Acerina (=Gymnocephalus) cernva Perca fluviatilis Anguidae Anguis fragilis Varanidae Varanus Lacertidae Lacerta viridens Lacerta agilis Colubridae Natrix natrix Natrix viperina Columber gemonensis

H. Legait and Legait (1957b)

H. k g a i t and Legait (1957b) H. LEgait and Legait (1957b) Reptiles L e g i t (1942) Watennann and Abdel-Messeih (1957) Legait and Legait (1956) Pines and Scheftel (1929) Kiihlenbeck (1931) Legait and Legait (1956) Legait and Legait (1956) Legait and Legait (1956)

No isolated SFO in the ventricular cavity; suprasepta1 formation with modified ependyrna and subepemdyrna

THE SUBFORNICAL ORGAN Species Testudinidae Tesrudo mauretanica Geconidae Platydactylus maureranicus Salamanders Salamandridae Trirurus cristarus Trirurus alpestris Pleurodeles walrii Frogs Ranidae Rana esculenra

Rana temporaria

Reference Legait and Legait (1956)

Bufonidae Bufo vulgaris L. Discoglossidae Bombinator igneus Discoglossus pictus Pipidae Xenopus laevis

a

Legait er al. (1973).

* Legait er at. (1975a).

summary

SFO missing

Tandler and Kantor (1907)

Legait and Legait (1956)

Pines and Scheftel (1929) Legait (1942) H. Legait and Legait (1956, 1957a) Rudert (1965) Rudert (1965)

Legait (1942) Dierickx (1963)

Rana pipiens

415

Watermann (196513, 1969) Dellmann (1978)

Legait (1942) Legait (1942) H. Legait and Legait (1956, 1957a) H. Legait and Legait (1956. 1957a)

Capillary loops in center of SFO sunounded by vacuoles; also ependymal cells with vacuoles in apical cytoplasm; Gomori-positive cells; beaded fibers; Herring bodies Vacuoles Vacuoles; neurosecretory nerve fibers; after hypophysial stalk transection maximum accumulation in dendrites SEM andTEM; vacuolateddendrites and axons; CSFcontaining neurons; encephalochromaffin cells; neurosecretory axons

416

H. DIETER DELLMANN AND JOHN B. SIMPSON ACKNOWLEDGMENTS

Original research cited in article was supported by NIH Grants NB 07492 to H.D. Dellmann, HL-21799 and HL-21800 to J. B. Simpson, and MH 26151 to J. B. Simpson and A. N. Epstein. The invaluable help of J. G.Linner and the secretarial assistance of Debbie Harrison and Portia McGuire are greatfully acknowledged.

REFERENCES Abdelaal, A. E., Assaf, S. Y., Kucharczyk, J.. and Morgenson, G. J. (1974). Can. J. Physiol. Pharmacol. 52, 362. Adhami, H. (1967). Acra Anat. 67, 239. Aken, K . (1967). Schweiz. Arch. Neurol., Neurochir. Psychiatr. 100, 217. Aken, K. (1969a). In “Zirkumventrikulare Organe und Liquor” (G. Sterba, ed.), pp. 89-93. Fischer, Jena. Akert, K. (1969b). J. Neuro-Visc. Relat. Suppl. 9, 78. Aken. K., and Steiner, F. A. (1970). Top. Probl. Psych. Neurol. 10, 1. Akert, K., Potter, H. D., and Anderson, J. W.(1961). J. Comp. Neurol. 116, 1. Akert, K., Pfenninger, K., and Sandri, C. (1967a). Brain Res. 5, 118. Akert, K.,Pfenninger, K., and Sandri, C. (1967b). Z . Zellforsch. Mikrosk. Anar. 81, 537. Andres, K. H. (1965a). Z . Zellforsch. Mikrosk. Anar. 68, 445. Andres, K. H. (196%). Narunvissenschaften 52, 443. Ari6ns Kapprs, J. (1955). J . Comp. Neurol. 102, 425. Asida, K. (1943). Keijo J. Med. 12, 45 (cited after Nakajima er al., 1968). Battm, A. M . (1962). Acra Neurol. Latinoam. 8, 15. Baumgatten, H.G., Bjorklund, A., Holstein, A. F., and Nobin, A. (1972). 2.Zellforsch. Mikrosk. Anar. 126, 483. Behnsen, G . (1927). 2.Zellforsch. Mikrosk. Anat. 4, 515. Bouchaud, C. (1974a). Bull. Assoc. Anar. 58, 491. Bouchaud, C. (1974b). J. Microsc. (Paris) 20, 215. Bouchaud, C . (1975a). J. Physiol. (Paris) 70, 73. Bouchaud, C. (1975b). J . Microsc. (Paris) 24, 45. Bouchaud, C., and Bemu, A. M. (1970). C.R. Hebd. Seances Acad. Sci. 271, 770. Bouchaud, C., Arluison, M., Bosler, 0.. and Calas, A. (1971). J. Physiol. (Paris) 71, 4B. Brizzee, K. R. (1954). J. Comp. Neurol. 100, 699. Bmadwell, R. D., and Brightman, M. W.(1976). J. Comp. Neurol. 166, 257. Bmwnstein, M. (1977). Fed. Proc., Fed. Am. SOC.Exp. Neurol. 36, 1960. Buggy, J., and Fisher, A. E. (1976). Pharmacol. Biochem. Behau. 4, 651. Buggy, J., Fisher, A. E., Hoffman, W.E., Johnson, A. K., and Phillips, M. I. (1975). Science 190, 72. Buranamgsa. P., and Hubbard, I. I. (1976). Proc. Univ. Orago Med. Sch. 54, 3. Carithers, J. (1978). Anar. Rec. 190, 356. Chan-Palay, V . (1976). Brain Res. 102, 103. Clara, M. (1959). In “Das Nervensystem des Menschen,” pp. 672-674. B a h , Leipzig. Cohrs, P., and von Knobloch, D. (1936). 2.Anar. Enrwichlungsgesch. 105,491. Cramer, H. (1970). Exp. Brain Res. 11, 343. Creswell, G. F., Reis, D. J., and Maclean, P. (1964). Am. J . Anar. 115, 543. Dannheimer, W.(1939). Anat. Anz. 88, 351. Dellmann, H.-D. (1970). Anar. Rec. 166, 298.

THE! SUBFORNICAL ORGAN

417

Dellmann, H.-D. (1978). Cell Tissue Res. 186, 361. Dellmann, H.-D., and Fahmy, M. F. A. (1967a). J. Hirnforsch. 9, 471. Dellmann, H.-D., and Fahmy, M. F. A. (1967b). Acra Neuroveg. 29, 501. Dellmann, H.-D., and Linner, J. G . (1977). Anar. Rec. 187, 565. Dellmann, H.-D., and Linner, J. G . (1979). Cell Tissue Res. (in press). Dellmann, H.-D., and Rodriguez, E. M. (1970). Z. Zelyorsch. Mikrosk. Anut. 111, 293. Dellmann, H.-D., and Simpson, 1. B. (1975a). Brain-Endocrinefnteracr..fnr. Symp.. 2nd 1975, p. 166. The Ventricular System in Neuroendocrine Mechanisms. Dellmann, H.-D., and Simpson, 1. B. (1975b). Anar. Rec. 181, 343. Dellmann, H.-D., and Simpson, J. B. (1976). Brain Res. 166, 389. McClure, R. C.. and Fahmy, M. F. A. (1965). Proc. fnr. Congr. Anar., Brh. Dellmann, H.-D., 1965, p. 29. Dempsey, E. W. (1968). Exp. Neurol. 22, 568. Dempsey, E. W., and Wislocki, G. B. (1955). J. Biophys. Biochem. Cyrol. 1, 245. Deshmukh, P., and Phillips, M. I. (1978a). Scan. Electron Microsc. 111, 349. Deshmukh, P., and Phillips, M. 1. (1978b). Anar. Rec. 190, 381. Dierickx, K . (1963). Natunvissenschaffen 15, 163. Dretzki, J. (1971). 2.Anat. Entwicklungsgesch. 134, 278. Duvernoy, H., and Koritke, J . 4 . (1964). Arch. Biol. 75, 693. (1965). J. Med. Besanqon 1, 115. Duvernoy, H., and Koritke, J .-G. Duvernoy, H., Koritke, J.-G., and Monnier, G.(1969). Z . Zellforsch. Mikrosk. Anar. 102, 49. Felix, D. (1976). Naunyn Schmiedeberg‘s Arch. Pharmacol. 292, 15. Felix, D., and Akert, K. (1974). Brain Res. 76, 350. Finley, K. H.(1939). J. Comp. Neurol. 71, 1. Fleixhhauer, K. (1964). Z. Zellforsch. Mikrosk. Anar. 62, 639. George, J. M. (1974). Brain Res. 73, 184. George, J. M., and Penrose, M. (1975). Brain Res. 97, 167. Goslar, H. G.,and Bock, R. (1971). Hisrochemie 28, 170. Grignon, G.,and Grignon, M. (1957). C. R. Assoc. Anal. 44, 341. Hasunuma, S . (1956). Bull. Tokyo Med. Denr. Llniv. 3, 159. Heidrich, L. (1931). Brun’s Beirr. Klin. Chir. 151, 607. brnesniemi. J., Kawana, E.. Bruppacher, H., and Sandri, C . (1972). Acra Anat. 81, 321. Hindelang-Gertner, C., Stoeckel, M. E., Porte, A,, Dellmann, H.-D., and Madarasz, B. (1974). Cell Tissue Res. 155, 21 1. Hofer, H. (1957). Z . Anar. Enwicklungs gesch. 120, 1. Hofer, H. (1959). Zool. Ant. Suppl. 22, 202. Hofer, H. (1965). I n “Primatologia” (H.Hofer, A. H. Schultz, and D. Starck, eds.), Vol. 11, pp. 1-104. Karger, Basel. Hofer, H. (1969). In “Zirkumventrikulare Organe und Liquor” (G. Sterba, ed.), pp. 77-88. Fischer, Jena. Hsiao, S.,Epstein, A. N.,and Camardo, J. S., Jr. (1977). Horm. Behav. 8, 129. Huber, G. C . , and Crosby, E. C. (1929). J . Comp. Neurol. 48, 1. Humphrey, T. (1936). J. Comp. Neurol. 65, 603. Hutchinson. J. S., Schelling, P., Mohring, J., and Ganten, D. (1976). Endocrinology 99, 819. Jacobowitz, D. M., and Palkovits, M. (1974). J. Comp. Neurol. 157, 13. Johnson, A. K., and Buggy, J. (1977). I n “Central Actions of Angiotensin and Related Hormones” (J. P. Buckley and C. M. Ferrario, eds.), p. 357. Pergamon, Oxford. Johnston, J. 9. (1913). J. Comp. Neurol. 23, 371. Kenney, N. J., Fluharty, S. J., and Epstein, A. N. (1977). Personalcommunication. Kizer, J. Z., Palkovits, M., and Brownstein, M. J . (1974). Endocrinology 98, 311. Kuhlenbeck, H. (1931). Morphol. Juhrb. 66, 244.

418

H.DIETER DELLMANN AND JOHN B. SIMPSON

Leduc, E. H., and Wislocki, G.B. (1952).J . Comp. Neurol. 97, 241. Legait, E. (1942).“Les organes kpendyrnains du t r o s i h e ventricule: L’organe souscornmissural, I’organe subfornical, I’organe paraventriculaire. ” Georges Thomas, Nancy. Legait, E. (1962).C.R. Seances SOC.Biol. Ses Fil. 156, 1662. Legait, E., and Legait, H. (1957). Bull. Assoc. Anat. 95, 502. Legait, E.,and Legait, H. (1967).Bull. Assoc. Anar. 52, 1254. Legait, H. (1956).C. R . Seances SOC. Biol. Ses Fil. 150,996. Legait, H.(1959).“Contribution t~I’6tude morphologique et exphimentale du systeme hypothalamo neumhypphysaire de la Poule Rhode-Island. ” Nancy. Legait, H., and Legait, E. (1956).C.R. Seances SOC.Biol. Ses Fil. 150, 1982. Legait, H.,and Legait, E. (1957a). C . R. Seances SOC. Biol. Ses Fil. 151, 365. Legait, H.,and Legait, E. (1957b).C . R . Assoc. Anar. 44,427. Legait, H.,Legait, E., and Grignon, G.(1957). Bull. Assoc. Anat. 95, 509. Legait, H.,Roux, M., Sirjean, D., Contet-Audonneau, J.-L., and Burlet, C. (1973).C.R . Seances SOC.Biol. Ses Fil. 167, 1436. Legait, H.,Legait, E., and Contet-Audonneau, J. L. (1974).C.R. Seances SOC.Biol. Ses Fii. 168, 834. Legait, H.,Legait, E., Contet-Audonneau, J.-L., Mur, J.-M., Roux, M., Richoux, J.-P., Sijean, D., and Dussart, G. (1975a). Bull. Assoc. Anar. 59, 185. Legait, H.,Roux, M., and Reichard, E. (1975b). C. R. Seances SOC.Biol. Ses Fil. 169, 1418. Legait, H., Legait, E., Roux, M., and Sijean, D. (1976).Bull. Assoc. Anar. 60, 168. Legait, H.,Contet-Audonneau, J.-L., and Sirjean, D. (1974).Bull. Assoc. Anat. 5.3, 381. Leonhardt, H., and Backhus-Roth, A. (1969).Z.Zellforsch. Mikrosk., Anar. 97, 369. Leonhardt. H., and Lindernann, B. (1973).2. Zellforsch. Mikrosk. Anat. 146, 243. Lewis, P. R., and Shute, C. C. D. (1967).Brain 90, 521. Lichtensteiger, W.(1967).Brain Res. 4,52. McKenna, 0. A., and Rosenbluth, J. (1971).J . Cell Biol. 48, 650. McLardy, T.(1955).J . Comp. Neurol. 103, 327. Mangiapane. M. L., and Simpson, 1. 8. (1977). Neurosci. Abstr. (Soc. Neurosci.) 3, 351. Mann, J. F.E.,Johnson, A. K., Schelling, P., and Ganten, D. (1977).Proc. Vllnr. Congr. Physiol. Food Fluid Inrake. Paris. Mergner, H. (1961).Z.Wiss. Zool. 165, 140. Mikami, S., and Asari, M. (1978).Cell Tiss. Res. 188, 19. Miselis, R. R. (1978).Personal communication. Miselis, R. R., Hand, P. J., and Berger, R. (1977a). Neurosci. Abstr. (Soc. Neurosci.) 3, 483. Miselis, R. R., Hand, P. J., and Berger, R. (1977b).Proc. V l l n r . Cong. Physiol. FoodFIuidIntake,

Paris.

Miselis, R. R., Shapiro, R. E., and Hand, P. J. (1978).SOC. Neurosciences Absrracrs 4, 179. Mitm, A., Palkovits, M. and Kvetnanski, R. (1976).In “Catecholamines and Stress” (E.Usdin, R. Kvetnansky, and I. I. Kopin, eds.), p. 89. Pergamon, Oxford. Mogenson, G. J., Kucharczyk, J., and Assaf, S. (1977).In “Central Actions of Angiotensin and Related Hormones” (J. P. Buckley and C. M. Ferrario, eds.), p. 493. Pergamon, Oxford. Nakajima, Y. (1964).Bull. Tokyo Med. Dent. Univ. 11, 391. Nakajima, Y. (1966).Bull. Tokyo Med. Dent. Vniv. 13, 125. Nakajima, Y.,Shanta, T. R., and Bourne, G. H. (1968).Histochemie 13, 331. Nicolaides, S., and Fitzsimons, J. T. (1975).C . R . Acad. Sci. (0)(Paris), 281D, 1417. Pachomov, N. (1963).Drsch. Z. Nervenheilkd. 185, 13. Palkovits, M. (1966). Naturwissenschafen 53, 336. Palkovits, M.(1969).In “Zirkumventrikulare Organe und Liquor” (G. Sterba, ed.), p. 94. Fischer, Jena.

THE SUBFORNICAL ORGAN

419

Palkovits, M., and Wetzig, H. (1969). Endocrinol. Exp. 3, 215. Palkovits, M., Brownstein, M. J., Arimura, A., Sato, H., Schally, A. V., and Kizer, J. S,(1976). Brain Res. 109, 430. Passo, S. S., Ferris, C. F., andThornbrough, J. R. (1967). Fed. Proc. 36, 460. Pelletier, G. (1976). In “Hypothalamus and Endocrine Function” (F.Labrie. J. Meites, and G. Pelletier, eds.), p. 443. Plenum, New York. Pelletier, G., Labrie, F., Kastin, A. J. Coy, D., and Schally, A. V . (1975). Phannacof. Biochem. Eehav. 3, 675. Pelletier, G . , Leclerc, R.. and Duke, D. (1976). J . Hisrochem. Cyrochem. 24, 864. Pfenninger, K. (1969). In “Zirkumventrikulk Organe und Liquor” (G.Sterba, ed.), p. 103. Fischer, Jena. Pfenninger, K., Akert, K., Sandri, C., and Buppacher,’ H. (1967). Schweiz. Arch. Neurol., Neurochir. Psychiarr. 100, 232. Phillips, M. I., and Felix, D. (1976). Brain Res. 109, 531. Phillips, M. I., and Hoffman, W. E. (1977). In “Central Actions of Angiotensin and Related Hormones” (J. P. Buckley and C. M.Ferrario, eds.), p. 325. Pergamon, Oxford. Phillips, M. I., Balhom, I., Leavitt, M.,and Hoffman, W. (1974). Brain Res. 80, 95. Pines, J. L. (1926). 1. Psychol. Neurol. 34, 186. Pines, J. L., and Maiman, R. (1928). Anar. Anz. 64, 424. Pines, J. L., and S c h e k l , M. (1929). Anar. Am. 67, 203. Putnam, 1. J. (1922). Bull. Johns Hopkins Hosp. 38, 181. Rabl, R. (1966). J. Hirnforsch. 8, 529. Ramsay, D. J., and Reid, I. A. (1975). J. Physiol. (London) 253, 517. Reichhold, S. (1942). 2. Mikrosk., Anar. Forsch. 52, 445. Rohr, V. U. (1966a). Z . Zellforsch. Mikrosk. Anar. 73, 246. Rohr, V. U. (1966b). Z.Zellforsch. Mikrosk. Anar. 75, 1 1 . Rohr, V. U.. Sandri, C., and Akert, K. (1965). Proc. Inr. Anar. Congr., 8rh. p. 103. Routtenberg, A. (1967). Science 157, 838. Routtenberg, A., and Simpson, J. B. (1971). Life Sci. 10, 481. Rudert, R. (1965). Z. Zellforsch. Mikrosk. Anar. 65, 790. Rudert, R., Schwink, A., and Wetzstein, R. (1965). Proc. Inr. Anm. Congr.. 8rh, p. 103. Rudert, H.,Schwink. A., and Wetistein, R. (1966). Z . Zellforsch. Mikrosk. Anat. 74,252. Rudert, H., Schwink, A,, and Wetzstein, R. (1968). Z . Zellforsch. Mikrosk. Anar. 88, 145. Saavedra, J. M., Brownstein. M. J., Kizer, J. S.,and Palkovits, M. (1976). Brain Res. 107, 412. Sarrat, B. (1968). Experienria 24, 1239. Scevola, D. (1939). Monit. 2 0 1 . lral., Suppt. 49, 146. Scevola, D. (1941). Arch. Iral. Anar. 45, 195. Schinko, I., Rohrschneider, I., and Wetzstein, R. (1972). Z. Zellforsch. Mikrosk. Anal. 123, 277. Schiitte, B. (1971). Acra Hisrochem. 41, 210. Scott, D. E., and Kmbisch-Dudley, G. (1975). Anat. Rec. 181, 473. Scott, D. E., Kozlowski, G. P., and Sheridan, M. N. (1974). Inr. Rev. Cyrol. 37, 349. Shapiro, R. E.,and Miselis, R. R. (1978). Anar. Rec. 190, 538. Shimizu, N., and Morikawa. N . (1957). J . Hisrochem. Cyrochem. 5 , 334. Shimizu, N., and Okada, M. (1957). J. Hisrochem. Cyrochem. 5 , 459. Shirnizu, N., Morikawa, N., and Ishi, Y. (1957). J . Comp. Neurol. 108, 1. Shrager, E. E., Osborne, M. J., Johnson, A. K., and Epstein. A. N. (1975). In “Central Action of Drugs in Blood Pressure Regulation” (D. S. Davies and J. L. Reid, eds.). Univ. Park Press, Baltimore, Maryland. Shute, C. C. D., andLewis, P. R. (1%3). 1. Anar. W, 301. Shute, C. C. D., and Lewis. P. R. (1966). Brit. Med. Bull. 22, 221.

420

H. DIETER DELLMANN AND JOHN B. SIMPSON

Simpson, J. B. (1973). Unpublished Doctoral Dissertation, Northwestem University, Chicago, Illinois. Simpson, J. B., and Mangiapane, M. L. (1977). Neurosci. Absrr. (Soc. Neurosci.) 3, 166. Simpson, J. B., and Routtenberg. A. (1972). Brain Res. 45, 135. Sipson, J. B., and Routtenberg, A. (1973). Science 181, 1172. Simpson, J. B., and Routtenberg, A. (1974). Brain Res. 79, 179. Simpson. J. B., and Routtenberg, A. (1975). Brain Res. 88, 154. Sipson, J. B., and Routtenberg, A. (1978). Science 201, 379. Simpson, J. B.,Epstein, A. N., andcamardo, J. S., Jr. (1978). J. Comp. Physiol. Psychol. 92,581. Sirjean, D. (1972). C . R. Seances SOC.Biol. Ses Fil. 166, 1118. Syean, D. (1973). Thesis, Nancy. Sirjean, D. (1977a). Arch. Anar. Microsc. Morphol. Exp. 66, 17. Sijean, D. (1977b). Arch. Biol. 88, 25. Syean, D., and Legait, E. (1972). Bull. Assoc. Anar. 152, 721. Sirjean, D., and Legait, E. (1974). Arch. Anar. Microsc. Morphol. Exp. 63, 109. Smith, G. E. (1898). J. Anat. Physiol. Norm. Parhol. Homme Anim. 32, 231. Spiegel, E . A. (1918). Anat. Anz. 51, 454. Spiegel. E . A. (1937). Z. Anar. Entwicklungs gesch. 107, 154. Spoem, 0. (1963). Acra Anar. 54, 333. Sp&m, O., and Alexy, H. J. (1974). Dev. Med. Child Neurol. 6, Suppl. 32, 91. Sprankel, H.(1957). Verh. Dtsch. Zool. Ges. 50-52, 444. Sprankel, H. (1960). Narurwissenschafen 47, 383. Stephan, H.. and Janssen, P. (1956). Acra Neurol. Psychiatr. Belg. 56, 789. Stumpf, W. E. (1970). Am. J. Anat. 129, 207. Summy-Long, Y.,Keil, L. C., and Severs, W. B. (1978). Brain Res. 140, 241. Takei, Y. (1977). Cell Tissue Res. 185, 175. Takei, Y.,Tsuneki, K., and Kobayashi, H. (1978). Cell Tissue Res. 191, 389. Tandler, J., and Kantor, H. (1907). Anar. Hefre., Abr. 2 33, 554. Thomsborough, J. R.. Passo, S. S., and Rothballer, A. B. (1973). Brain Res. 58, 355. Tsuneki, K., Takei, Y.,and Kobayashi, H. (1978). Cell Tissue Res. 191, 405. Van B u m , J. M., Akert, K., Sandri, C., and Moor, H. (1977). Cell Tissue Res. 181, 27. Vigh, B., and Vigh-Teichmann, 1. (1973). In#. Rev. Cyrol. 35, 189. von Knobloch, D. (1937). 2. Anar. Entwicklungs gesch. 106, 379. Watermann. R . (1956). Drsch. Z . Nervenheilkd. 174, 593. Watermann. R. (1965a). Arzneim.-Forsch. 29, 345. Watermann, R. (1965b). Anar. Anz. 117, 261. Watermann. R. (1968). Verh. Drsch. Anar. Ges., 62nd Versamml. (1967). Anat. Ang. Erg. Heft 12, 577. Watermann. R. (1969). J. Neuro.-Visc. Relat. 31, 195. Watermann. R., and Abdel Messeih, 0.(1957). 2. Morph. dkol. Tiere 45, 603. Weindl, A. (1965). Z . Zellforsch. Mikrosk. Anar. 67, 740. Weindl, A. (1967). Naturwissenschafen 54, 342. Weindl, A. (1976). Neurology 20, 397. Weindl, A. (1973). In “Frontiers in Neuroendocrinology” (W. F. Ganong and L. Martini, eds.), p. 3. Oxford Univ. Pms, London and New York. Wetzig, H.. and Palkovits, M. (1968). 2. Mikrosk.-Anar. Forsch. 79, 283.

THE SUBFORNICAL ORGAN Wilder, B. G. (1896). J . Comp. Neurol. 6 , 216. Williams, D., Gascoigne, J . E.. and Williams, D. E. (1975). Brain Res. 100, 231. Wislocki, G. B. (1940). Anat. Rec. 78, 119. Wislocki, G. B., and Leduc, E. (1952). J . Comp. Neurol. 96, 371. Yamada, H., and Hasunuma, S. (1955). Bull. Tokyo.Med. Dent. Univ. 2, 67.

42 1

This Page Intentionally Left Blank

Subject Index A Actomyosin, exocytosis and, 170-171 Ademsine triphosphate chmmaffim granule release and osmotic lysis and, 175-178 state in chromaffin granule, 164-165 transport, chromaffin granule and, 163-164 Adenyl cyclase, chromaffin granule membrane and, 189-190 other granule preptions, 191 pharmacological properties, 190-191 role in adrenal medulla, 191-192 Anions, transport sites in chromaffin granule membrane, 178-181

structure. of granule core and state of ATP, 164-165 transport of calcium and ATP, 163-164 mechanisms of exocytosis, statement of problem and prologue, 160-161 membrane, anion transport sites in, 178-181 Chromatin, in mitosis and aging, microprobe analysis of, 146 Chromosome(s) behavior, control of, 278-280 desynapsis, meiotic mutations and, 260-268 disjunction, meiotic mutations and, 271-275 single. interference with behavior of, 275-277 Crossover, frequency, meiotic mutations and, 268-271

B

D

Blood, microprobe analysis of, 142-144

C Calcifiable tissue, microprobe analysis of, 141-142 Calcium problem of action in exocytosis, 170 actomyosin hypothesis, 170-171 direct calcium action hypothesis, 171- 172 synexin and, 172-174 transport, chromaffin granule and, 163-164 Cardiac muscle, microprobe analysis of, 134- 136 Catecholaminea, chromaffin granule and intragranular synthesis, 169-170 tranSportinto, 165-169 Chromaffin granule adenyl cyclase in membranes, 189-190 other granule preparations, 191 pharmacological properties, 190- 191 role in adrenal medulla, 191-192 assembly catecholamine transport into, 165-169 cell biology of, 161-162 intragranular synthesis of catecholamines, 169- 170 packaging of small molecules, 162-163 protein condensation, 162 423

Deoxyribonucleic acid satellite addendum, 104-108 credo and coda, 101-104 interspecies comparisons, 23-40 introduction, 1-12 library hypothesis and, 93-97 limits of tolerance, 75-82 manipulation of, 40-54 mechanisms of change, 82-86 soma-gem line differentials, 68-74 structural relationships to heterochromatin, 12-23 unresolved aspects of, 97-101 Developmental biology, microprobe analysis and, 144-146

E Electron energy loss spectromehy, elemental analysis and, 125-127 Element@),of particular interest, microprobe analysis and, 148-150 Elemental analysis by characteristic x-ray determination,physical backmound, 117-120 critical reading of literature. conditions of analysis, 131-132 data analysis, 134

SUBJECT INDEX

424

specimen preparation, 130-1 31 state of tissue prior to preparation, 129-130 instnunentation used in characteristic x-ray energy determination electron energy loss spectrometry, 125-127 energy-dispersive x-ray spectmscopy, 122-125 wavelength-dispersive analysis, 121-122 methods and reviews, 150-151 Endocytosis, Golgi apparatus and, 234-235 Energy-dispersivex-ray spectroscopy,elemental analysis and, 122-125 Epithelium, microprobe analysis of, 139-141 Exocytosis by anion transport and local osmotic lysis, 181- 187 Golgi apparatus and, 232-234 problem of calcium action in actomyosin hypothesis, 170-171 direct calcium action hypothesis, 17 1- 172 synexin and, 172-174 types of theories, 170 recovery of granule membranes and coated vesical hypothesis, 187-188 evidence for direct recovery, 188-189

c

interspecies comparisons, 23-40 introduction, 1-12 library hypothesis and, 93-97 limits of tolerance. 75-82 manipulation of, 40-54 mechanisms of change, 86-93 polymorphisms, 54-68 soma-gem line differentials, 68-74 structural relationships to satellite DNA, 12-23 Histochemistry. of subfomical organ, 383-384 Hypothalamic neurons continuous cell lines SV 4&transformed, 316-327 tumor-derived lines, 314-316 primary cultures, 293-294, 313-314 cytochemical and biochemical features, 311-313 morphological features, 294-31 1

I Immunocytochemistry, of subfomical organ, 383-384

K Kidney, microprobe analysis of, 141

Gametes, microprobe analysis of, 144-146 Glial cells, subfomical organ, morphology, 360-375 Golgi apparatus components of formation and change, 205-209 nomenclature, 202-203 sources of membrane components, 203-205 models and function activities in Golgi stack, 218-222 differentiation of cisternae, 229-232 general, 209-213 lysosomes and GERL,228-229 transfer to,213-217 transport and recognition, 222-228

H Hetemhromatin addendum, 104-108 credo and coda, 101-104

L Lung, microprobe analysis of, 137-138 Lysosomes, Golgi apparatus and, 228-229

M Medical diagnosis, microprobe analysis and, 147-148 Meiotic mutations characterization affecting chromosome disjunction, 271-275 affecting patterns of meiosis, 249-250 affecting synapsis, 252-260 genes affecting crossover frequency, 268-271 genes affecting &synapsis of chromosomes, 260-268 genes causing loss or impairment of second division of meiosis, 277-278

425

SUBJECT INDEX interference with single chromosome behavior, 275-277 other cases of control of chromosome behavior, 278-280 Microorganisms, microprobe analysis of, 146-147 Microprobe analysis application to specific biological systems blood, 142-144 calcifiable tissue, 141-142 chromatin in mitosis and aging, 146 elements of particular interest, 148-150 epithelium, 139-144 gametes and developmental biology, 144-146 kidney, 141 lung, 137-138 medical diagnosis, 147-148 microorganisms, 146- 147 nerve, 138-139 skeletal and cardiac muscle, 134-136 smooth muscle, 136-137

N Nerve, microprobe analysis of, 138-139 Neurons, of subfomical organ, 336-360

P Protein, condensation, c h r o d n granule assembly and, 162

S Secretory event, biochemistry of anion transport sites in granule membranes, 178-1 81 approaches to the problem, 174 ATP and chromaffin granule release by osmotic lysis, 175-178 hypothesis for exocytosis by anion transport, 181-187 Simian virus 40,transformed hypothalamic neuron cultures, 316-327

Skeletal muscle, microprobe analysis of, 134-136 Smooth muscle, microprobe analysis of, 136-137 Subfornical organ development, 335 normal general morphology glial cells, 360-375 histochemistry and immunocytochemistry, 383-384 neurons, 336-360 other cells, 375-380 Vascularity, 380-383 functions, 384-385 experimentally induced structural changes, 385-391 physiological studies, 391-399 table of investigated species, 402-415 Synapsis, meiotic mutations and, 252-260 Synexin, exocytosis and, 172-174

T Tissue, state prior to preparation for analysis, 129- 130 Tumors, hypothalamic neuron cultures from, 314-316

V Vascularity, of subfornical organ, 380-383 Vesicles, movement out of and into cells endocytosis, 234-235 exocytosis, 232-234

W Wavelength-dispersive analysis, elemental analysis and, 121-122

X X-ray determination, elemental analysis by, physical background, 117-120

This Page Intentionally Left Blank

Contents of Previous Volumes Volume 1 Some Historical Features in Cell BiologyARTHURHUGHES Nuclear Reproduction<. LEONARD HUSKINS Enzymic Capacities and Their Relation to Cell Nutrition in Animals-GEORGE W. KIDDER The Application of Freezing and Drying Techniques in Cytology-L. G. E. BELL Enzymatic Processes in Cell Membrane Penetration-TH. ROSENBERG A N D w . WILBRANDT Bacterial Cytology-K. A. BISSET Protoplast Surface Enzymes and Absorption of Sugar-R. BROWN Reproduction of Bacteriophage-A. D. HERSHEY

The Folding and Unfolding of Protein Molecules as a Basis of Osmotic Work-R. J. GOLDACRE

Nucleo-Cytoplasmic Relations in Amphibian Development-G. FRANK-HAUSER Structural Agents in Mitosis-M. M. SWANN Factors Which Control the Staining of Tissue Sections with Acid and Basic Dyes-MARCUS SINGER The Behavior of Spermatozoa in the Neighborhood Of Egg+LORD ROTHSCHILD The Cytology of Mammalian Epidermis and Sebaceous Glands-WILLIAM MONTAGNA The Electron-Microscopic Investigation of Tissue Sections-L. H. BRETSCHNEIDER The Histochemistry of Esterases-G. GOMORI

Quantitative Histochemistry of PhosphatasesWILLIAML. DOYLE Alkaline Phosphatase of the Nucleus-M. A N D H. FIRKET CHPVREMONT Gustatory and Olfactory Epithelia-A. F. AND 0. H. BOURNE BARADI Growth and Differentiation of Explanted Tissues-P. J. GAILLARD Electron Microscopy of Tissue Sections-A. J. DALTON A Redox Pump for the Biological Performance of Osmotic Work, and Its Relation to the Kinetics of Free Ion Diffusion across Membranes-E. J. CONWAY A Critical Survey of Current Approaches in Quantitative Histo- and CytochemistryDAVIDGLICK Nucleo-cytoplasmic Relationships in the Development of Acetabularia-J. HAMMERLING Report of Conference of Tissue Culture Workers J. Held at Cooperstown, New York-D. HETHERINGTON AUTHOR INDEX-SUBJECT

INDEX

Volume 3

The Nutrition of Animal Cells-CHARJTY WAYMOUTH Caryometric Studies of Tissue C u l t u r e s - O n o BUCHER The Properties of Urethan Considered in Relation to Its Action on Mitosis-IvoR CORNMAN AUTHOR INDEX-SUBJECT INDEX Composition and Structure of Giant Chromosomes-MAX ALFERT How Many Chromosomes in Mammalian SoVolume 2 matic Cells?-R. A. BEATTY Quantitative Aspects of Nuclear NucleoproThe Significance of Enzyme Studies on Isolated Cell Nuclei-ALEXANDER L. h U N C E teins-HEWSON SWIFT The Use of Differential Centrifugation in the Ascorbic Acid and Its lntracellular Localization, Study of Tissue Enzymes4HR. DE DUVE with Special Reference to Plants-J. CHAYEN A N D J. BERTHET Aspects of Bacteria as Cells and as OrganD. DE Enzymatic Aspects of Embryonic DifferentiaiSm*sTUART MUDDA N D EDWARD tion-TRYGGVE GUSTAFSON LAMATER Azo Dye Methods in Enzyme HistochemistryIon Secretion in Plants-J. F. SUTCUFFE A. G. EVERSONPEARSE Multienzyme Sequences in Soluble ExtractsHENRYR. MAHLER Microscopic Studies in Living Mammals with The Nature and Specificity of the Feulgen Transparent Chamber Methods-Roy G. WILNucleal Reaction-M. A. LESSLER LIAMS 421

428 AUTHOR INDEX-SUBJECT

CONTENTS OF PREVIOUS VOLUMES INDEX

CUMULATIVE SUBJECT INDEX (VOLUMES

1-5)

Volume 7 Some Biological Aspects of Experimental Radiology: A Historical Review-F. G. SPEAR The Effect of Carcinogens, Hormones, and Vitamins on Organ Cultures-ILSE LASNITZKI Recent Advances in the Study of the Kinetochore-A. LIMA-DE-FARIA Autoradiographic Studies with Sa6-Sulfate-D. D. DZIEWATKOWSKI The Structure of the Mammalian Spermatozoon-DON W. FAWCETT The Lymphocyte-0. A. TROWELL ?he Structure and Innervation of Lamellibranch Muscle-I. BOWDEN Hypothalamo-neumhypophysialNeurosecretionI. C. SLOPER Cell COntaCt-PAUL WEIS The Ergastoplasm: Its History, Ultrastructure, and BiochemistyFruNFoISE HAGUENAU Anatomy of Kidney Tubules-JOHANNES RHODIN

Structure and Innervation of the Inner Ear Sensory Epithelia-HANS ENGSTR6M A N D JAN WEMALL The Isolation of Living Cells from Animal Tissues-L. M. RINALDINI AUTHOR INDEX-SUBJECT

INDEX

Volume 8

A Survey of Metabolic Studies on Isolated Mammalian Nuclei-D. B. ROODYN Trace Elements in Cellular Function-BERT L. VALLEEAND FREDERIC L. HOCH Osmotic Properties of Living Cells-D. A. T. DICK Sodium and Potassium Movements in Nerve, Muscle, and Red Cells-I. M. GLYNN Pinocytosis-H. HOLTER AUTHOR INDEX-SUBJECT

INDEX

Volume 9 The Influence of Cultural Conditions on Bacterial Cyt~logy-I. F. WILKINSON AND 1. P. DUGUlD

Organizational Patterns within ChromosomesBERWNDP. KAUFMANN, HELENGAY,AND MARGARET R. MCDONALD Enzymic Processes in Celk-JAY BOYDBEST The Adhesion of Ceh-LEONARD WEISS Physiological and Pathological Changes in Mitochondrial Morghology-CH. ROUILLER The Study of Drug Effects at the Cytological Leve1-G. B. WILSON Histochemistry of Lipids in OOgeneSiS-VlSHWA NATH Cyto-Embryology of Echinoderms and Amphibia-KUTSUMA DAN The Cytochemistry of Nonenzyme PmteinsRONALDR. COWDEN AUTHOR INDEX-SUBJECT

INDEX

The StNCtUR Of CytOplaSm--CHARLESOBERLING

Wall Organization in Plant Cells-R.

D. PRES-

TON

Submicroscopic Morphology of the SynapseEDUARWDE ROBERTIS The Cell Surface of Pururneciurn-C. F. EHRET AND E. L. POWERS The Mammalian Reticulocyte-LEAH MIRIAM LOWENSTEIN The Physiology of Chromatophores-MILTON FINGERMAN The Fibrous Components of Connective Tissue with Special Reference to the Elastic FiberDAVIDA. HALL Experimental Heterotopic Ossification-I. B. BRIDGES

Volume 10 The Chemistry of Shiff's Reagent-FREDERICK H. KASTEN Spontaneous and Chemically Induced Chromosome Breaks-ARUN KUMARSHARMA AND ARCHANA SHARMA The Ultrastructure of the Nucleus and Nucleocytoplasmic Relations-SAUL WIXHNITZER The Mechanics and Mechanism of CleavageLEWISWOLPERT The Growth of the Liver with Special Reference to Mammals-F. DOLJANSKI Cytology Studies on the Affinity of the Carcinogenic Azo Dyes for Cytoplasmic Components-YosHIMa NAGATANI

429

CONTENTS OF PREVIOUS VOLUMES The Mast Ce1l-G. ASBOE-HANSEN Elastic Tissue-EDWARDS w. DEMPSEYAND ALBERTI. LANSING The Composition of the Nerve Cell Studied with New Methods-SVEN-OLOE BRATTGARD AND HOLGERHYDEN AUTHOR INDEX-SUBJECT

INDEX

Volume 4

on Cytokinesis and Amoeboid Movement-

DOUGLAS MARSLAND Intracellular pH-PETER C. CALDWELL The Activity of Enzymes in Metabolism and Transport in the Red Cell-T. A. 1. PRANKERD Uptake and Transfer of Macromolecules by Cells with Special Reference to Growth and Development-A. M. SCHECHTMAN Cell Secretion: A Study of Pancreas and Salivary Glands-L. C. J. JUNQUEIRAAND G. C. HIR~CH The Acrosome Reaction-JEAN c. DAN Cytology of Spermatogenesis-VlsHWA NATH The Ultrastructure of Cells, as Revealed by the Electron Microscope-FRITIOF S. SJ~STRAND

Cytochemical Micrurgy-M. J. KOPAC Amoebocytes-L. E. WAGGE Problems of Fixation in Cytology, Histology, and Histochemistry-M. WOLMAN Bacterial Cytology-ALFRED MARSHAK AUTHOR INDEX-SUBJECT Histochemistry of Bacteria-R. VENDRELY Recent Studies on Plant Mitochondria-DAVID P. HACKET-T The Structure of Chloroplasts-K. MOHLE- Volume 6

INDEX

THALER

Histochemistry of Nucleic Acids-N.

B. KUR-

NICK

S. Structure and Chemistry of Nucleoli-W. VINCENT On Goblet Cells, Especially of the Intestine of Some Mammalian Species-HAruLD MOE Localization of Cholinesterases at Neuromuscular Junctions-R. COUTEAUX Evidence for a Redox Pump in the Active Transport of Cations-E. J. CONWAY AUTHOR INDEX-SUBJECT

INDEX

Volume 5 Histochemistry with Labeled Antibody-ALBERT H. COONS The Chemical Composition of the Bacterial Cell Wall<. S. CUMMINS Theories of Enzyme Adaptation in Microorganisms-J. MANDELSTAM The Cytochondria of Cardiac and Skeletal Muscle-JOHN w.HARMON The Mitochondria of the NeUrOn-WARREN ANDREW The Results of Cytophotometry in the Study of the Deoxyribonucleic Acid (DNA) Content of the Nucleus-R. VENDRELY AND c . VENDRELY

Protoplasmic Contractility in Relation to Gel Structure: Temperature-Pressure Experiments

The Antigen System ofParamccium a u r e l i a 4 . H. BEALE The Chromosome Cytology of the Ascites Tumors of Rats, with Special Reference to the Concept of the Stemline Cell-SAmo MAKIN0

The Structure of the Golgi Apparatus-ARTHUR AND PRISCHIAF. POLLISTER W. POLLISTER An Analysis of the Process of Fertilization and Activation of the Egg-A. MONROY The Role of the Electron Microscope in Virus Research-ROBLEY C. WILLIAMS The Histochemistry of Polysaccharides-ARTHUR J. HALE The Dynamic Cytology of the Thyroid Gland-J.

GROSS Recent Histochemical Results of Studies on Embryos of Some Birds and Mammals-ELI0 BORGHESE Carbohydrate Metabolism and Embryonic Determination-R. J. O'CONNOR Enzymatic and Metabolic Studies on Isolated Nuclei-4. SIEBERTAND R. M. S. SMELLIE Recent Approaches of the Cytochemical Study of Mammalian TiSSUeS-ciEORGE H. HOGEBOOM, EDWARD L. KUFF, A N D WALTERC. SCHNEIDER The Kinetics of the Penetration of Nonelectrolytes into the Mammalian ErythmyteFREDABOWYER

430

CONTENTS O F PREVIOUS VOLUMES

Epidermal Cells in Culture-A.

GEDEONMA-

TOLTSY AUTHOR INDEX-SUBJECT INDEX CUMULATIVE SUBJECT INDEX (VOLUMES

sequential Gene Action, Protein Synthesis, and Cellular Differentiation-REED A. FLICKINGER

1-9)

Volume 11 Electron Microscopic Analysis of the Secretion Mechanism-K. KUROSUMI The Fine Structure of Insect Sense OrgansELEANOR H. SLIFER Cytology of the Developing Eye-ALFRED J. COULOMBRB The Photoreceptor Structures-J. J. WOLKEN Use of Inhibiting Agents in Studies on Fertilization Mechanisms-CHARLEs B. METZ The Growth-Duplication Cycle of the Cell-D. M. PRESCOTT Histochemistry of Ossification-RoMuLo L. CABRINI Cinematography, Indispensable Tool for Cytol0 g y - C . M. POMERAT

The Composition of the Mitochondrial Membrane in Relation to Its Structure and Function- ERIC G . BALLAND CLIFFED. JOEL Pathways of Metabolism in Nucleate and Anucleate Erythrocytes-H. A. SCHWEICER Some Recent Developments in the Field of Alkali Cation Transport-W. WILBRANDT Chromosome Aberrations Induced by Ionizing Radiations-H. J. EVANS Cytochemistry of Protozoa, with Particular Reference to the Golgi Apparatus and the Mitochondria-VISHWA NATHAND G . P. DUTTA Cell Renewal-FELIX BERTALANFFY AND CHOSEN LAU AUTHOR INDEX-SUBJECT

INDEX

Volume 14

Inhibition of Cell Division: A Critical and Experimental Analysis-SEYMOUR GELFANT Electron Microscopy of Plant Protoplasm-R. BUVAT Volume 12 Cytophysiology and Cytochemistry of the Organ Sex Chromatin and Human Chromosomesof Corti: A Cytochemical Theory of Hearing-J. A. VINNIKOV AND L. K. TITOVA JOHNL. HAMERTON Chromosomal Evolution in Cell Populations-T. Connective Tissue and Serum Proteins-R. E. C. Hsu MANCINl Chromosome Structure with Special Reference to The Biology and Chemistry of the Cell Walls of H. the Role of Metal Ions-DALE M. STEFFEN- Higher Plants, Algae, and Fungi-D. NORTHCOTE SEN Development of Drug Resistance by StaphyloElectron Microscopy of Human White Blood Cells and Their Stem Cells-MARCEL BESSIS cocci in Vitro and in Vivo-MARY BARBER AND JEAN-PAUL THIERY Cytological and Cytochemical Effects of Agents I n Vivo Implantation as a Technique in Skeletal Implicated in Various Pathological CondiBiology-WILLIAM J. L. FELTS tions: The Effect of Viruses and of Cigarette The Nature and Stability of Nerve Myelin-J. B. Smoke on the Cell and Its Nucleic AcidCECILIE LEUCHTENBERGER FINEAN AND RUDOLF LEUCHTENBERGER Fertilization of Mammalian Eggsin Virro-C. R. AUSTIN The Tissue Mast Wall-DOUGLAS E. SMITH Physiology of Fertilization in Fish Eggs--ToKI-o AUTHOR INDEX-SUBJECT INDEX YAMAMOTO AUTHOR INDEX-SUBJECT

INDEX

AUTHOR INDEX-SUBJECT

INDEX

Volume 13 The Coding Hypothesis-MARTYNAs YEAS Chromosome Reproduction-J. HERBERTTAYLOR

Volume 15 The Nature of Lampbrush Chromosomes-H. G. CALLAN The Intracellular Transfer of Genetic Information-J. L. SIRLIN Mechanisms of Gametic Approach in Plants-

CONTENTS OF PREVIOUS VOLUMES

43 1

LEONARD MACHLIS A N D ERIKARAWITSCHER- The Cells of the Adenohypophysis and Their Functional Significance-MARC HERLANT KUNKEL AUTHOR INDEX-SUBJECT INDEX The Cellular Basis of Morphogenesis and Sea A N D L. Urchin Development-T. GUSTAFSON WOLPERT Volume 18 Plant Tissue Culture in Relation to Development CytOlOgy
432

CONTENTS OF PREVIOUS VOLUMES

The Dynamism of Cell Division during Early Cleavage Stages of the Egg-N. FAUTREZThe Chemical Organization of the Plasma MemAND J. FAUTREZ FIRLEFYN brane of Animal Cells-A. H. MADDY Lymphopoiesis in the Thymus and Other Tissues: Subunits of Chloroplast Structure and Quantum AND Functional Implications-N. B. EVERETT Conversion in Photosynthesis-RoDERlc B. RUTHW. TYLER(CAFFREY) PARK Structure and Organization of the Myoneural Control of Chloroplast Structure by Light-LESJunction-C. CotiRS TER PACKERAND PAUL-AND& SIEGEN- The Ecdysial Glands of Arthropods-WILLIAM THALER S. HERMAN The Role of Potassium and Sodium Ions as Cytokinins in Plants-B. I. SAHAISRIVASTAVA Studied in Mammalian Brain-H. HILLMAN AUTHOR INDEX-SUBJECT INDEX Triggering of Ovulation by Coitus in the RatCUMULATIVE SUBJECT INDEX (VOLUMES 1-21) CLAUDE ARON,GITTAASCH,AND JAQUELINE

Volume 20

Roos Cytology and Cytophysiology of Non-MelanoVolume 23 phore Pigment Cells-JOSEPH T. BAGNARA Transformationlike Phenomena in Somatic The Fine Structure and Histochemistry of ProstaCells-J. M. OLENOV tic Glands in Relation to Sex HormonesRecent Developments in the Theory of Control DAVIDBRANDES and Regulation of Cellular Processes-ROBCerebellar Enzymology-LuclE ARVY ERT ROSEN AUTHOR INDEX-SUBJECT INDEX Contractile Properties of Protein Threads from Sea Urchin Eggs in Relation to Cell DivisionVolume 21 HIKOICHISAKAI Electron Microscopic Morphology of OogeneHistochemistry of Lysosomes-P. B. GAHAN sis-ARNE NBRREVANG Physiological Clocks-R. L. BRAHMACHARY Dynamic Aspects of Phospholipids during ProCiliary Movement and Coordination in Ciliatestein Secretion-LOWELL E. HOKIN BELAPAROUCA The Golgi Apparatus: Structure and FunctionElectromyography: Its Structural and Neural H. W. BEAMSAND R. G . KESSEL Basis-JOHN V. BASMAJIAN The Chromosomal Basis of Sex DeterminationCytochemical Studies with Acridine Orange and KENNETHR. LEWISAND BERNARD JOHN the Influence of Dye Contaminants in the AUTHOR INDEX-SUBJECT INDEX Staining of Nucleic Acids-FREDERICK H. KASTEN Experimental Cytology of the Shoot Apical Cells Volume 24 during Vegetative Growth and Flowering-A. Synchronous Cell Differentiation-GEORGE M. NOUGAR~DE PADILLA AND IVAN L. CAMERON Nature and Origin of Perisynaptic Cells of the Mast Cells in the Nervous System-YNGVE Motor End Plate-T. R. SHANTHAVEERAPPA OLSSON AND G. H. BOURNE Development Phases in Intermitosis and the AUTHOR INDEX-SUBJECT INDEX Preparation for Mitosis of Mammalian Cellsin Vitro-BLAGOJE A. NESKOVIC Volume 22 Antimitotic Substances-Guu DEYSSON The Form and Function of the Sieve Tube: A Current Techniques in Biomedical Electron MiProblem in Reconciliation-P. E. WEATHERCrOSCOpy-SAUL WISCHNITZER LEY AND R. P. C. JOHNSON The Cellular Morphology of Tissue Repair-R. Analysis of Antibody Staining Patterns Obtained M. H. MCMINN with Striated Myofibrils in Fluorescence MiStructural Organization and Embryonic Differencroscopy and Electron Microscopy-FRANK tiatiOnGAJANAN v . SHERBET A N D M. s. A. PEPE LAKSHMI

433

CONTENTS OF PREVIOUS VOLUMES Cytology of Intestinal Epithelial Celb-PETER G. TONER Liquid Junction Potentials and Their Effects on Potential Measurements in Biology Systems-P. C. CALDWELL AUTHOR INDEX-SUBJECT

INDEX

Volume 25 Cytoplasmic Control over the Nuclear Events of Cell Reproduction-NOEL DE TERRA Coordination of the Rhythm of Beat in Some Ciliary Systems-M. A. SLEIGH The Significance of the Structural and Functional Similarities of Bacteria and MitochondriaNASS SYLVAN The Effects of Steroid Hormones on Macrophage Activity-B. VERNON-ROBERTS The Fine Structure of Malaria Parasites-MARIA A. RUDZINSKA The Growth of Liver Parenchymal Nuclei and Its Endocrine Regulation-RITA CARRIERE Strandedness of Chromosomes-SHELDON WOLFF Isozymes: Classification, Frequency, and Significance4HARLES R. SHAW The Enzymes of the Embryonic NephronLUCIEARVY Protein Metabolism in Nerve Cells-B. DROZ Freeze-Etching-HANS MWR AUTHOR INDEX-SUBJECT

INDEX

Volume 26 A New Model for the Living Cell: A Summary of the Theory and Recent Experimental Evidence LBERT in Its S U ~ ~ O ~ ~ ~N.I LING The Cell PenpheIy-LEONARD WEISS Mitochondrial DNA: Physicochemical Properties, Replication, and Genetic Function-P. BORST AND A. M. KROON Metabolism and Enucleated Ceh-KONIuD KECK Stereological Principles for Morphometry in Electron Microscopic CytolOgy-EWALD R. WEIBEL Some Possible Roles for Isozymic Substitutions during Cold Hardening in Plants-D. W. A. ROBERTS AUTHOR INDEX-SUBJECT

INDEX

Volume 27 Wound-Healing in Higher PlantS-JACQUES LIPETZ Chloroplasts as Symbiotic OrganekS-DENNlS L. TAYLOR The Annulate Lamellae-SAUL WISCHNITZER Gametogenesis and Egg Fertilization in Planaria n s 4 . BENAZZILENTATI Ultrastructure of the Mammalian Adrenal CorteX-sIMON IDELMAN The Fine Structure of the Mammalian Lymphoreticular System-IAN CARR Irnmunoenzyme Technique: Enzymes as Markers for the Localization of Antigens and Antibodies-STRATIS AVRAMEAS AUTHOR INDEX-SUBJECT

INDEX

Volume 28 The Cortical and Subcortical Cytoplasm of Lymnaea EggXHRISTIAAN P. RAVEN The Environment and Function of Invertebrate A N D R. B. Nerve Cells-J. E. TREHERNE MORETON virus Uptake, Cell Wall Regeneration, and Virus Multiplication in Isolated Plant ProtoplastsE. C. COCKING The Meiotic Behavior of the Drosophila 00cyte-ROBERT c. KING The Nucleus: Action of Chemical and Physical Agents-RENd SIMARD The Origin of Bone Cek-MAUREEN OWEN Regeneration and Differentiation of Sieve Tube Elements-WILLIAM P. JACOBS Cells, Solutes, and Growth: Salt Accumulation in A N D R. Plants Reexamined-F. C. STEWARD L. MOTT AUTHOR INDEX-SUBJECT

INDEX

Volume 29 Gram Staining and Its Molecular MechanismB. B. BISWAS,P. s. BASU, ANDM. K. PAL The Surface Coats of Animal Cells-A. MARTfNEZ-PALOMO Carbohydrates in Cell Surfaces--hcHAm J. WINZLER Differential Gene Activation in Isolated Chromosomes-MARKUS LEZZI lntraribosomal Environment of the Nascent Peptide Chain-HIDEKo KAJI

434

CONTENTS OF PREVIOUS VOLUMES

Location and Measurement of Enzymes in Single Cells by Isotopic Methods Pact I-E. A. BAR-

Volume 32

Highly Repetitive Sequences of DNA in Chromosomes-W. G.FLAMM Location and Measurement of Enzymes in Single The Origin of the Wide Species Variation in Cells by Isotopic Methods Part II-G. C. Nuclear DNA Content-H. REes AND R. N. BUDD JONES Neuronal and Glial Perikarya Preparations: An Polarized Intracellular Particle Transport: SaltaAppraisal of Present Methods-PATRICIA v. tory Movements and Cytoplasmic StreamJOHNSTON AND BETTYI. ROOTS ing- LIONELI. REBHUN Functional Electron Microscopy of the HypothaThe Kinetoplast of the Hemoflagellates-LARRY lamic Median Eminence-HIDEsHI KOBASIMPSON YASHI, TOKUZOMATSUI,A N D SUSUMI ISHI1 Transport across the Intestinal Mucosal Cell: Early Development in Callus Cultures- MIHierarchies of Function-D. S. PARSONS AND CHAEL M. YEOMAN C. A. R. BOYD AUTHOR INDEX-SUBJECT INDEX Wound Healing and Regeneration in the Crab Paratelphusa hydrodromous-RlTA G. ADIYODI Volume 30 The Use of Fenitin-Conjugated Antibodies in High-pressure Studies in Cell Biology-ARTHLIR Electron MiCrOSCOpy-COUNClLMAN MORM. ZIMMERMAN GAN Micmrgicd Studies with Large Free-Living Metabolic DNA in Ciliated Protozoa, Salivary Amebas-K. W. JEONAND J. F. DANIELLI Gland Chromosomes, and Mammalian The Practice and Application of Electron MicroCells-S. R. PELC scope Autoradiography-J. JACOB AUTHOR INDEX-SUBJECT INDEX Applications of Scanning Electron Microscopy in Biology-K. E. CARR Acid Mucopolysaccharides in Calcified TisSUCS-SHINJIRO KOBAYASHI NARD

AUTHOR INDEX-SUBJECT

INDEX

CUMULATIVE SUBJECT INDEX (VOLUMES

1-29)

Volume 33

Visualization of RNA Synthesis on Chromosomes-0. L. MILLER,JR. AND BARBARAA. HAMK ALO Cell Disjunction ("Mitosis") in Somatic Cell Studies on Freeze-Etching of Cell MembranesReproduction-ELAINE G. DIACUMAKOS, KURTMBHLETHALER SCOTTHOLLAND, AND PAULINEPECORA Recent Developments in Light and Electron Neuronal Microtubules, Neurofilaments, and Microscope Radioautography-G. C. BUDD Microfilaments-RAYMOND B. WUERKER Morphological and Histochemical Aspects of AND JOELB. KIRKPATRICK Glycoproteins at the Surface of Animal Lymphocyte Interactions in Antibody ReCells- A. RAMBOURG sponses-J. F. A. P. MILLER DNA Biosynthesis-H. S. JANSZ,D. VAN DER Laser Microbeams for Partial Cell IrradiationMEI, AND G. M. ZANDVLIET MICHAELW. BERNSAND CHRISTIANSALET Cytokinesis in Animal Cells-R. RAPPAPORT Mechanisms of Vims-Induced Cell FusionThe Control of Cell Division in Ocular L e n d . GEORGE POSTE V. HARDING,J. R. REDDAN.N. I. UNAKAR, Freeze-Etching of Bacteria
Volume 31

AUTHOR INDEX-SUBJECT

INDEX

AUTHOR INDEX-SUBJECT

INDEX

435

CONTENTS OF PREVIOUS VOLUMES

Volume 34 The Submicroscopic Morphology of the Interphase Nucleus-SAUL WISCHNITZER The Energy State and Structure of Isolated Chloroplasts: The Oxidative Reactions Involving the Water-Splitting Step of Photosynthesis- ROBERTL. HEATH Transport in N e U r O S p O r o A E N E A. SCARBOROUGH

Mechanisms of Ion Transport through Plant Cell Membranes-EMANUEL ERSTEIN Cell Motility: Mechanisms in Protoplasmic Streaming and Ameboid Movement-H. KOMNICK, W. STOCKEM,A N D K. E. WOHLEFARTH-BOTTERMANN The Gliointerstitial System of MoIIuscs- GHISLAIN NICAISE Colchicine-Sensitive Microtubules-LYNN MARGULIS AUTHOR INDEX-SUBJECT

INDEX

tigophora and Opalinata (Protozoa)-G. P. DUTTA Chloroplasts and Algae as Symbionts in MolAND RICHARD IUSCS-LEONARD MUSCATINE W. GREENE The Macrophage-hMoN GORDONAND ZANVIL A. COHN Degeneration and Regeneration of Neurosecretory SYStemS-HORST-DIETER DELLMANN AUTHOR INDEX-SUBJECT

INDEX

Volume 37 Units of DNA Replication in Chromosomes of Eukaroytes-J. HERBERT TAYLOR Viruses and Evolution-D. C. REANNEY Electron Microscope Studies on Spermiogenesis in Various Animal SpeCieS~ONPACHIRO YASUZUMI Morphology, Histochemistry, and Biochemistry of Human Oogenesis and Ovulation-hRDuL

s. GURAYA

Volume 35 The Structure of Mammalian ChromosomesELTONSTUBBLEFIELD Synthetic Activity of Polytene ChromosomesHANSD. BERENDES Mechanisms of Chromosome Synapsis at Meiotic Prophase-PETER B. MOENS Structural Aspects of Ribosomes-N. NANNINGA

Functional Morphology of the Distal LungKAYEH. KILBURN Comparative Studies of the Juxtaglomerular Apparatus-HIROFUMI SOKABE AND MIZUHO OGAWA The Ultrastructure of the Local Cellular Reaction to Neoplasia-IAN CARRA N D J. C. E. UNDERWOOD

Scanning Electron Microscopy in the UhStNCtural Analysis of the Mammalian Cerebral Ventricular System-D. E. Scorn, G. P. KOZLOWSKI, A N D M. N. SHERIDAN

Comparative Ultrastructure of the Cerebrospinal Fluid-Contacting Neurons-B. VlGH AND I. VIGH-TEICHMANN AUTHOR INDEX-SUBJECT INDEX Maturation-Inducing Substance in StdishesHARUOKANATANI The Limoniurn Salt Gland: A Biophysical and Structural Study-A. E. HILLAND B. s. HILL Volume 38 Toxic Oxygen Effects-HAROLD M. SWARTZ Genetic Engineering and Life Synthesis: An AUTHOR INDEX-SUBJECT INDEX Introduction to the Review by R. Widdus and C. AUIt-JAMES F. DANIELLI Progress in Research Related to Genetic EngiVolume 36 neering and Life Synthesis-Roy WIDDUS AND CHARLES R. AULT Molecular Hybridization of DNA and RNA in The Genetics of C-Type RNA Tumor VirusesSI‘iU-WOLFGANG HENNIG J. A. WYKE The Relationship between the Plasmalemma and Three-Dimensional Reconstruction from ProjecPlant Cell W~~I-JEAN-CLAUDE ROLAND tions: A Review of Algorithm+hcHARD Recent Advances in the Cytochemistry and UltraGORDONAND GABORT. HERMAN sbucture of Cytoplasmic Inclusions in Mas-

436

CONTENTS OF PREVIOUS VOLUMES

The Cytophysiology of Thyroid Cells-VuaMlR R. PANTIC The Mechanisms of Neural Tube FonnationPERRY KAWUNKEL The Behavior of the XY Pair in MammalsALBERTOJ. SOLAN Fine-Structural Aspects of Morphogenesis in Acetabularia-G. WE= Cell Separation by Gradient Centrifugation-R. HARWOOD

Volume 41

Fine Structure of the Thyroid Gland-HrsAo FUJITA Postnatal Gliogenesis in the Mammalian BrainA. PRIVAT Three-Dimensional Reconstruction from Serial SectiontRANDLE w . WARE A N 0 VINCENT LOPRESTI

SUBJECT INDEX

The Attachment of the Bacterial Chromosome to the Cell Membrane-PAUL J. LEIBOWITZAND MOSELIOSCHAECHTER Regulation of the Lactose Operon in Escherichia cofi by cAMP-4. CARPENTERAND B. H.

SELLS

Regulation of Microtubules in TewahymenaNORMANE. WILLIAMS Cellular Receptors and Mechanisms of Action of SUBJECT INDEX Steroid Hormones-SHUTSUNG LIAO A Cell Culture Approach to the Study of Anterior Volume 39 Pituitary Cells-A. TIXIER-VIDAL, D. GOURDJI,AND C. TOUGARD Androgen Receptors in the Nonhistone Protein Immunohistochemical Demonstration of NeuFractions of Prostatic Chromatin-TUNG YUE rophysin in the HypothalamoneurohypoWANGAND LEROYM. NYBERG physial System-W. B. WATKINS Nucleocytoplasmic Interactions in Development The Visual System of the Horseshoe Crab Limuof Amphibian Hybrids-STEPHEN SUBTELNY lus polyphemus-WOLF H. FAHRENBACH The Interactions of Lectins with Animal Cell SUBJECT INDEX SUIfaCeSaARTH L. NICOLSON Structure and Function of Intercellular Junctions-'. ANDREWSTAEHELIN Volume 42 Recent Advances in Cytochemistry and UltraRegulators of Cell Division: Endogenous Mitotic structure of Cytoplasmic Inclusions in CilioInhibitors of Mammalian CellS-BISMARCK B. phora (Protozoa)-G. P. DUTTA LOZZIO, CARMEN B. Lozzio, ELENAG.BAMStructure and Development of the Renal GlomBERGER, AND STEPHEN V. LAIR erulus as Revealed by Scanning Electron MiUltrastructure of Mammalian Chromosome croscopy-FuNco SPINELLI Aberrations-B. R. BRINKLEY AND WALTER Recent Progress with Laser Microbeams- MiN. HITTELMAN CHAEL w. BERNS The Problem of Germ Cell Determinants-H. W. Computer Processing of Electron Micrographs: A Nonmathematical Account-P. W. HAWKES BEAMSA N D R. G. KESSEL Cyclic Changes in the Fine Structure of the SUBJECT INDEX Epithelial Cells of Human EndometriumMILDRED GORDON Volume 40 The Ultrastructure of the Organ of CortiROBERTS. K~MURA B-Chromosome Systems in Flowering Plants and Endocrine Cells of the Gastric Mucosa-ENRIco Animal Species-R. N. JONES SOLCIA,CARLOCAPELLA,GABRIELEVASThe Intracellular Neutral SH-Dependent Protease SALLO, AND ROBERTO BUFFA Associated with Inflammatory ReactionsMembrane Transport of Purine and Pyrimidine HIDEOHAYASHI Bases and Nucleosides in Animal CellsThe Specificity of Pituitary Cells and Regulation RICHARDD. BERLINAND JANETM. OLIVER of Their Activities-VLAOIMlR R. PANTIC

SUBJECT INDEX

Volume 43 The Evolutionary Origin of the Mitochondrion: A Nonsymbiotic Model-HENRY R. MAHLER AND RUDOLFA. RAFF Biochemical Studies of Mitochondrial Transcrip-

CONTENTS OF PREVIOUS VOLUMES tion and Translation-C. SACCONEA N D E. Qu AGLIARIELLO The Evolution of the Mitotic Spindle-DONNA F. KUBN Germ Plasma and the Differentiation of the Germ Cell Line-E. M. EDDY Gene Expression in Cultured Mammalian Cells-RoDY P. COX AND JAMESc. KING Morphology and Cytology of the Accessory Sex AND Glands in Invertebrates-K. G. ADIYODI R. G. ADIYODI SUBJECT INDEX

437

Small Lymphocyte and Transitional Cell Populations of the Bone Marrow; Their Role in the Mediation of Immune and Hemopoietic Progenitor Cell FUnctions~oRNELIUSROSE The Structure and Properties of the Cell Surface Coat-J. H. LUFT Uptake and Transport Activity of the Median Eminence of the Hypothalamus-K. M. KNIGGE, S. A. JOSEPH, J. R. SLADEK, M. F. NOTTER,M. MORRIS,D. K. SUNDBERG, M. A. HOLZWARTH,G. E. HOFFMAN,AND L. O’BRIEN SUBJECT INDEX

Volume 44

Volume 46 The Nucleolar StNCtllre-sIBDAS GHOSH Neurosecretion by Exocytosis-Tohi CHRISTIAN The Function of the Nucleolus in the Expression NORMA” of Genetic Information: Studies with Hybrid Genetic and Morphogenetic Factors in HemoSIDEBOTTOM A N D I. 1. Animal Cells-E. globin Synthesis during Higher Vertebrate DeDEhK velopment: An Approach to Cell DifferentiaPhylogenetic Diversity of the Proteins Regulating tion Mechanisms-VICTOR N i t ” AND JACMuscular Contraction-WILLIAM LEHMAN QUELINE GODET Cell Size and Nuclear DNA Content in VerteCytophysiology of Corpuscles of Stannius-V. brates-HENRYK SZARSKI C. KIUSHNAMURTHY Ultrastructural Localization of DNA in Ultrathin Ultrastructure of Human Bone Marrow Cell Tissue Sections-ALAIN GAUTIER Maturation-]. BRETON-GORIUSAND F. Cytological Basis for Permanent Vaginal REYES Changes in Mice Treated Neonatally with Evolution and Function of Calcium-Binding ProSteroid Hormones-NoeoRu TAKASUGI teins-R. H. KRETSINGER On the Morphogenesis of the Cell Wall of StaphykxCi-PETER GIESBRECHT,J ~ R G SUBJECT INDEX REINICKE WECKE,A N D BERNHARD Volume 47 Cyclic AMP and Cell Behavior in Cultured Responses of Mammary Cells to Hormones-M. Cells-MARK c . WILLINGHAM R. BANERJEE Recent Advances in the Morphology, HistoRecent Advances in the Morphology, Histochemistry, and Biochemistry of Steroid-Synchemistry, and Biochemistry of Steroid-Synthesizing Cellular Sites in the Nonmammalian thesizing Cellular Sites in the Testes of NonVertebrate OVUY-SARDULS. GURAYA mammalian Vertebrates-SARDUL S. GURAYA SUBJECT INDEX Epithelial-Stromal Interactions in Development of the Urogenital TraCtdERALD R. CUNHA Volume 45 Chemical Nature and Systematization of SubApproaches to the Analysis of Fidelity of DNA stances Regulating Animal Tissue GrowthVICTORA. KONYSHEV Repair in Mammalian Cells-MICHAEL W. AN LIEBERM Structure and Function of the Choroid Plexus and The Variable Condition of Euchromatin and Other Sites of Cerebrospinal Fluid FormaHeterochromatin-FRIEDRICH BACK H. MILHORAT tion- THOMAS Effects of 5-Bromodeoxyuridine on TumoriThe Control of Gene Expression in Somatic Cell Hybrids-H. P. BERNHARD genicity, Immunogenicity, Virus Production, Precursor Cells Of Mechanocytes-ALEXANDER Plasminogen Activator, and Melanogenesis of Mouse Melanoma Celk-sELMA S~LAGI J. FRIEDENSTEIN Mitosis in Fungi-MELVIN S. FULLER SUBJECT INDEX

438

CONTENTS OF PREVIOUS VOLUMES

Volume 48 Mechanisms of Chromatin Activation and ReAND VAUGHAN pression-NORMAN MACLEAN A. HILDER Origin and Ultrastructure of Cells in Virro-L. D. WILSON M. FRANKSAND PATRICIA Electrophysiology of the Neurosecretory CellKIN11 YAGI AND SHlZUKO IWASAKI Reparative Processes in Mammalian Wound Healing: The Role of Contractile Phenomena- G i u u o GABBIANI AND DENYSMON-

New Aspects of the Ultrastructure of Frog Rod Outer SegmentS-JbRGEN ROSENKIUNZ Mechanisms of Morphogenesis in Cell Cultures-J. M. VASILIEVAND I. M. GELFAND Cell Polyploidy: Its Relation to Tissue Growth AND I. v. and Functions-W. YA. BRODSKY

URYVAEVA Action of Testosterone on the Differentiation and Secretory Activity of a Target Organ: The Submaxillary Gland of the Mouse-MoNlQUE CH&TIEN SUBJECT INDEX

TANDON

Smooth Endoplasmic Reticulum in Rat Hepatocytes during Glycogen Deposition and Depletion-ROBERT R. CARDELL. JR. Potential and Limitations of Enzyme Cytochernistry: Studies of the Intracellular Digestive Apparatus of Cells in Tissue Culture-M. HONDGEN

Uptake of Foreign Genetic Material by Plant Protoplasts-E. C. COCKING The Bursa of Fabricius and Immunoglobulin Synthesis-BRUCE CLICK SUBJECT INDEX

Volume 49 Cyclic Nucleotides, Calcium, and Cell Division-LIONEL I. REBHUN Spontaneous and Induced Sister Chromatid Exchanges as Revealed by the BUdR-Labeling Method-HATAo KATO Structural, Electrophysiological, Biochemical, and Pharmacological Properties of Neuroblastoma-Glioma Cell Hybrids in Cell Culture-B. HAMPRECHT Cellular Dynamics in Invertebrate Neurosecretory Systems-ALLAN BERLIND Cytophysiology of the Avian Adrenal MedullaASOKGHOSH Chloride Cells and Chloride Epithelia of Aquatic Insects-H. KOMNICK Cytosomes (Yellow Pigment Granules) of Molluscs as Cell Organelles of Anoxic Energy ProdUCtiOn-hmE ZS.-NAGY SUBJECT INDEX

Volume 50

Volume 51 Circulating Nucleic Acids in Higher Organisms-MAURICE STROUN, PHILIPPEANKER, PIERREMAURICE,AND PETERB. GAHAN Recent Advances in the Morphology, Histochemistry, and Biochemistry of the Developing Mammalian 0 v a r y - s ~ S. ~ GURAYA ~ ~ ~ Morphological Modulations in Helical Muscles (Aschelminthes and Annelida)--GluLto LANZAVECCHIA Interrelations of the Proliferation and Differentiation Processes during Cardiac Myogenesis and Regeneration-PAVEL P. RUMYANTSEV The Kurloff Cell-PETER A. REVELL Circadian Rhythms in Unicellular Organisms: An Endeavor to Explain the Molecular Mechanism- HANS-GEORGSCHWEIGERAND MANFRED SCHWEIGER SUBIECT INDEX

Volume 52 Cytophysiology of Thyroid Parafollicular Cells-ELAD10 A. NUNEZAND MICHAELD. GERSHON Cytophysiology of the Amphibian Thyroid Gland through Larval Development and Metamorphosis-ELIANE REGARD The Macrophage as a Secretory Cell-ROY C. PAGE,PHILIP DAVtES, AND A. c. ALLISON Biogenesis of the Photochemical ApparatusTIMOTHY TREFFRY Extrusive Organelles in Protists-KLAus HAUSMANN

Lectins-JAY c. BROWN AND RICHARD c. HUNT Cell Surface Enzymes: Effects on Mitotic Activity and Cell Adhesion-H. BRUCEBOSMANN SUBJECT INDEX

CONTENTS OF PREVIOUS VOLUMES Volume 53 Regular Arrays of Macromolecules on Bacterial Cell Walls: Structure, Chemistry, Assembly, and Function-UwE B. SLEYTR Cellular Adhesiveness and Extracellular SubStrata-FREDERICK GRINNELL Chemosensory Responses of Swimming Algae A N D D. C. and Protozoa-M. LEVANDOWSKY R. HAUSER Morphology, Biochemistry, and Genetics of Plastid Development in Euglena gracilis-V. NIG~N AND P. HEIZMANN Plant Embryological Investigations and Fluorescence Microscopy: An Assessment of Integration-R. N. KAPIL AND s. C. TIWARI The Cytochemical Approach to Hormone Assay-J. CHAYEN SUBJECT INDEX

Volume 54

439

The Isolated Mitotic Apparatus and Chromosome Motion-H. SAKAI Contact Inhibition of Locomotion: A Reap PraiSd-JOAN E. M. HEAYSMAN Morphological Correlatesof Electrical and Other Interactions through Low-Resistance Pathways between Neurons of the Vertebrate Central Nervous System-C. SOTELOAND H. KORN Biological and Biochemical Effects of Phenylalanine Analogs-D. N. WHEATLEY Recent Advances in the Morphology, Histochernistry, Biochemistry, and Physiology of Interstitial Gland Cells of Mammalian S. GURAYA O V ~ ~ A R D U L Correlation of Morphometry and Stereology with Biochemical Analysis of Cell FractionsR. P. BOLENDER Cytophysiology of the Adrenal Zona FasGIUSEP CiCUlataxASTONE G . NUSSDORFER, mA MAZZOCCHI, AND VIRGILIO MENEGHELLI SUBJECT INDEX

Microtubule Assembly and Nucleation-MARC W.KIRXHNER Volume 56 The Mammalian Sperm Surface: Studies with Specific Labeling Techniques-JAMES K. Synapses Of CephdopOdS~OLLETTEDUCROS KOEHLER Scanning Electron Microscope Studies on the The Glutathione status Of Celk-NECHAMA s. Development of the Nervous System in Vivo KOSOWERAND EDWARD M. KOSOWER and in Vitro-K. MELLER cells and Senescence-ROBERT ROSEN Cytoplasmic Structure and Contractility in Immunocytology of Pituitary Cells from Teleost Amoeboid Cells-D. LANSING TAYLORAND Fishes-E. FOLL~NIUS. J. DOERR-SCHOTT, JOHN S. CONDEELIS A N D M. P. DUBOIS Methods of Measuring Intracellular CalciumFollicular Atresia in the Ovaries of NonmammaANTHONY H. CASWELL lian vertebrates-SRtNlVAs K. SAIDAPUR Electron Microscope Autoradiography of CalHypothalamic Neuroanatomy: Steroid Hormone cified TiSSUeS-ROBERTM. FRANK Binding and Patterns of Axonal Pro- Some Aspects of Double-StrandedHairpin StrucA N D LILYC. A. jcctions-DoNALD w. PFAFF tures in Heterogeneous Nuclear RNA-HIROTO CONRAD NAORA Ancient Locomotion: hkaryotic Motility Sys- Microchemistryof MicrodissectedHypothalamic kms-LELENG P. TO A N D LYNNMARGULIS Nuclear Areas-M. PALKOVITS An Enzyme Profile of the Nuclear EnvelopeSUBJECT INDEX I. B. ZBARSKY SUBJECT INDEX Volume 57 Volume 55 Chromatin Structure and Gene Transcription: Nucleosomes Permit a New SynthesisTHORUPEDERSON

The Corpora Allata of hSeCtS-PIERRE CASSIER Kinetic Analysis of Cellular Populations by Means of the Quantitative Radioautography-J.-C. BISCONTE

440

CONTENTS OF PREVIOUS VOLUMES

UES Autonomic Nervous S Y S ~ ~ ~ - J A C QTAXI Cellular Mechanisms of Insect PhotoreceptionThe Synapses of the Nervous System-A. A. F. G . GRIBAKIN MANINA Oocyte Maturation-YosHlo MASUIAND HUGH J. CLARKE SUBJECT INDEX The Cbrnaffin and ChromaKin-likeCells in the