High Pressure Bioscience and Biotechnology: Proceedings of the International Conference (Progress in Biotechnology)

HIGH PRESSURE BIOSCIENCE AND BIOTECHNOLOGY

Progress in Biotechnology Volume 1 New Approaches to Research on Cereal Carbohydrates (Hill and Munck, Editors) Volume 2 Biology of Anaerobic Bacteria (Dubourguier et al., Editors) Volume 3 Modifications and Applications of Industrial Polysaccharides (Yalpani, Editor) Volume 4 lnterbiotech '87. Enzyme Technologies (Blafej and Zemek, Editors) Volume 5 In Vitro Immunization in Hybridoma Technology (Borrebaeck, Editor) Volume 6 lnterbiotech '89. Mathematical Modelling in Biotechnology (Blafej and Ottova, Editors) Volume 7 Xylans and Xylanases (Visser et al., Editors) Volume 8 Biocatalysis in Non-Conventional Media (Tramper et al., Editors) Volume 9 ECB6: Proceedings of the 6th European Congress on Biotechnology (Alberghina et al., Editors) Volume 10 Carbohydrate Bioengineering (Petersen et al., Editors) Volume 11 Immobilized Cells: Basics and Applications (Wijffels et al., Editors) Volume 12 Enzymes for Carbohydrate Engineering (Kwan-Hwa Park et al., Editors) Volume 13 High Pressure Bioscience and Biotechnology (Hayashi and Balny, Editors)

The illustration on the cover is a classical script of a Chinese character (kanji) which means "pressure". Kanji is used in a wide area of Asia including Japan.

Progress in Biotechnology 13

HIGH PRESSURE BIOSCIENCE AND BIOTECHNOLOGY Proceedings of the International Conference on High Pressure Bioscience and Biotechnology, Kyoto, Japan November 5-9, 1995

Edited by R. Hayashi

Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kyoto, Japan

C. Balny

lnstitut National de la Sante et de la Recherche Medicale, INSERM U128, Montpellier, France

ELSEVIER Amsterdam Lausanne - New York - Oxford - Shannon Tokyo 1996

-

-

Published by: Elsevier Science B.V. P.O. Box 21 1 1000 AE Amsterdam The Netherlands

ISBN 0-444-82555-X 01996 Elsevier Science B.V. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher, Elsevier Science B.V., Permissions Department, P.O. Box 521,1000 AM Amsterdam, The Netherlands. No responsibility is assumed by the Publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, the Publisher recommends that independent verification of diagnoses and drug dosages should be made. Special regulations for readers in the USA - This publication has been registered with the Copyright Clearance Center Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01293, USA. Information can be obtained from the CCC about conditions under which photocopies of parts of this publication may be made in the USA. All other copyright questions, including photocopying outside the USA should be referred to the copyright owner, Elsevier Science B.V., unless otherwise specified. This book is printed on acid-free paper. Printed in the Netherlands

PREFACE In the past, many conferences devoted to differem aspects of high pressure and biological science have been separately organized. Domestic symposia in Japan organized by the High Pressure Research Group in the biologically related fields have been held every year since 1989. These symposia have helded to promote the sale of high pressure preserved foods. The idea of having joint Japanese and European meetings on High Pressure and Bioscience was elaborated four years ago by a small group of scientists ; it was formalized during the First European Seminar on High Pressure and Biotechnology, a joint meeting with the Fifth Symposium on High Pressure and Food Science of Japanese Group held in La Grande-Motte, France, September 1992, organized by C. Balny, R. Hayashi, K. Heremans and P. Masson. This last Conference, together with the publication of the proceedings (High Pressure and Biotechnology, edited by C. Balny, R. Hayashi, K. Heremans and P. Masson, INSERM / J. Libbey Eurotext), stimulated further research and contact between the industry and the academic world for all aspects of the application of the high pressure parameter to biological material. The second consequence of these scientific contacts was the organization by researchers in Japan and Europe of the first International Conference on High Pressure Bioscience and Biotechnology held in Kyoto, November 1995 (Chairman, R. Hayashi) followed by the publication of the present proceedings. One aim of the editors is the same as for the publication of the proceedings of the first joint meeting : to promote the possibility of applying pressure in specific biotechnological areas, not only for food processing but also for biotechnology in general. There has been progress in the use of high pressures which has led to the manufacture of high pressure-processed foods. There has also been the development of both processes and equipment. It must be remember that R & D in the use of high pressure has been based on the principles of traditional physical chemistry and chemical technology over the past few years. Integration of the knowledge gained in this way would permit us to find many new applications for processing biological materials in the fields of medicine and pharmacy as well as food. Few pharmaceutical or biomedical applications of this technology have been reported so far. In the future high pressure might be used in the preservation of pharmaceuticals, blood derivative and transplant organs. For many years, pressure was disregarded by biochemists. There was an absence of general idea of what pressure could add to the understanding of the behavior of biomolecules. The situation is now different. There is a growing interest on the part of researchers to introduce pressure as a variable acting on biosystems. We hope that in presenting the up - to - date state of the art view of high pressure research, these proceedings will contribute to future developments. The Editors

This Page Intentionally Left Blank

EDITORS EWumaru Hayashi Claude Balny

Kyoto University, Kyoto, Japan Institut National de la Sante et de la Recherche Medicale, INSERM U 128, Montpellier, France

CO-EDITORS Shgeru Kunugi Atsushi Suzuki Katsuhiro Yamarnoto Karel Heremans Patrick Masson

Kyoto Institute of Technology, Kyoto, Japan Niigata University, Niigata, Japan Rakuno Gakuen University, Hokkaido, Japan Katholieke University Leuven, Leuven, Belgium Centre de Recherches du Service de Sante des Armees, La Tronche, Grenoble, France

This Page Intentionally Left Blank

ORGANIZING COMMITTEE R. Hayashi (Chairman) C. Balny K. Heremans S. Kunugi P. Masson A. Suzuki K. Yamamoto

Kyoto Univ., Kyoto, Japan INSERM, Monpellier, France Katholieke Univ. Leuven, Leuven, Belgium Kyoto Inst.Technol., Kyoto, Japan CRSSA, La Tronche, Grenoble, France Niigata Univ., Niigata, Japan Rakuno Gakuen Univ., Hokkaido, Japan

SCIENTIFIC COMMITTEE J.- C. Cheftel G. Demazeau J. Frank K. Gekko G. Herve D. Knorr S. Kaneshina H. Ludwig M. Nakahara A. Noguchi M. Osumi R. Winter

Univ. Monpellier, France Univ. Bordeaux, France Univ. Delft, Delft, The Netherlands Hiroshima Univ., Hiroshima, Japan CNRS, Paris, France Univ. Technol. Berlin, Berlin, Germany Tokushima Univ., Tokushima, Japan Univ. Heidelberg, Heidelberg, Germany Kyoto Univ., Kyoto, Japan Natl. Food Res. Inst. of MAFF ; Tsukuba Univ., Japan Japan Women's Univ., Tokyo, Japan Univ. Dortmund, Germany

ADVISORY COMMITTEE M. Fujimaki

H. Horikoshi S. Kimura

N. Ogasawara (deceased) Y. Okami T. Ooi K. Suzuki T. Watanabe

Emeritus Prof. of Tokyo Univ.; Former President, Ochanomizu Univ., Japan Japan Marine Science & Technol. Center, Japan Japan School Baking, Japan; Former Director, Natl. Food Res. Inst. of MAFF Emeritus Prof., Niigata Univ., Japan Inst. of Microbial. Chem., Japan Kyoto Women's Univ.; Emeritus Prof., Kyoto Univ., Japan Emeritus Prof., Ritsumeikan Univ., Japan Tokyo Metropolitan Food Technol. Res. Center ; Former Director. Natl. Food Res. Inst. of MAFF

This Page Intentionally Left Blank

xi THE CONFERENCE HAS BEEN SUPPORTED BY : The Joint Japanese & European Research Group of High Pressure Bioscience & Food Science The Japanese Society for Bioscience, Biotechnology and Agrochemistry The Japanese Biochemical Society Institut National de la Sant6 et de la Recherche Mrdicale, France French Ministry of Foreign Office, French Embassy in Japan The Commemorative Association for the Japan World Exposition (1970)

ACKNOWLEDGEMENTS : We express our gratitude and special appreciation to Ms. Setsuko Yasui, Congress secretariat, and to Dr. Hiroshi Ueno, Dr. Shogo Ozawa and Mrs. Fukuko Suzuki, Biopolymer Laboratory, Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University.

The publication of this book was partly supported by Grant-in Aid No. 80012 for the publication of Scientific Research Results, from the Ministry of Education, Science, Sports and Culture of Japan

This Page Intentionally Left Blank

...

XI11

CONTENTS

V

PREFACE

xi

ACKNOWLEDGEMENTS

I - OVERVIEWS 1

Use of high pressure in bioscience and biotechnology R Hayashi

7

Future prospects in high pressure basic bioscience C. Balny

17

Deep-sea microbial research and its aspect to high pressure biotechnology C. Kato & K. Horikoshi

JI - BIOCHEMISTRY AND MOLECULAR BIOLOGY 21

High pressure effects on the structure and mesophase behaviour of supramolecular lipid aggregates and model membrane systems R Winter

29

High pressure sensing and adaptation in the deep-sea bacterium Photobacterium species strain SS9 D.H. Bartlett, E. Chi & T.J. Welch

37

Morphological effects of pressure stress on yeasts M. Osumi, M. Sato, H. Kobori, Z.H. Feng, S.A. Ishijima, K Hamada & S. Shimada

47

Biological analogy between hydrostatic pressure and temperature H. Iwahashi, K.Obuchi, S. Fujii, K. Fujita & Y. Komatsu

x iv

53

Vacuolar acidification under high hydrostatic pressure in Saccharomyces cerevisiae F. Abe & K. Horikoshi

59

Gene expression under high pressure C. Kato & K. Horikoshi

67

Effects of hydrostatic pressure on photosynthetic activities in thylakiods M. Yuasa

73

Effect of hydrostatic pressure on the proliferation and morphology of the mouse BALB/ c cells in culture T. Naganuma, T. Mizukoshi, K. Tsukamoto, R. Usami & K. Horikoshi

79

Influence of hydrostatic pressure on expression of heat shock protein 70 and matrix synthesis in chondrocytes K. Takahashi, T. Kubo, Y. Arai, Y. Hirasawa, J. Imanishi, K. Kobayashi & M. Takigawa

83

Changes of microfilaments and microtubules of yeasts induced by pressure stress H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada & M. Osumi

95

Direct induction of homozygous diploidization in the fission yeast Schizosaccharomyces pombe by pressure stress K. Hamada, Y. Nakatomi, M. Osumi & S. Shimada

101

Acquisition of stress tolerance by pressure shock treatment in yeast M. Miyashita, K. Tamura & H. Iwahashi

105

High pressure denatured metalloprotein is a new NO - trapper T. Oku, K. Umezawa, T. Nishio, H. Ogihara, Y. Ichikawa, N. Takamatsu, H. Ishikawa, H. Tsuyuki & N. Yano

109

Ultrastructural effects of pressure stress to Saccharomyces cerevisiae cell revealed by immunoelectron microscopy using frozen thin sectioning M. Sato, A. Tameike, H. Kobori, S. Shimada, Z.H. Feng, S.A. Ishijima & M. Osumi

xv 113

Biological stimulation of low-power He-Ne laser on yeast under high pressure S. Kishioka, K. Tamura & M. Miyashita

I11 - HIGH PRESSURE EFFECTS ON BIOLOGICAL STRUCTURES 1. Proteins 117

Pressure - induced molten globule states of proteins P. Masson & C. ClCry

127

Pressure versus temperature behaviour of proteins: FT-IR studies with the diamond anvil cell K. Heremans, P. Rubens, L. Smeller, G. Vermeulen & K. Goossens

135

Pressure induced protein structural changes as sensed by 4th derivative UV spectroscopy R. Lange, N Bec, J. Frank and C. Balny

.

141

High pressure N M R study of protein unfolding T. Yamaguchi, H. Yamada & K. Akasaka

147

Compressibility-structure relationships of protein : Compactness of denatured ribonuclease A K. Gekko

153

Structure of pressure-induced "denatured" state of proteins N.Tanaka & S. Kunugi

157

Finite element study of protein structure under high pressure T. Yamato

163

Pressure-induced dissociation of beef liver L-glutamate dehydrogenase G. Tang & K. Ruan

167

Mechanism of pressure denaturation of BPTI B. Wroblowski, J.F. Diaz, K , Heremans & Y. Engelborghs

xvi

171

Thermal inactivating behavior of Bacillus stearothermophilus under high pressure K. Kakugawa, T. Okazaki, S. Yamauchi, K. Morimoto, T. Yoneda & K. Suzuki

2. Others 175

Effect of pressure on the phase behaviour of ester - and ether - linked phospholipid bilayer membranes S. Kaneshina, S. Maruyama & H. Matsuki

181

Kinetics and mechanisms of lamellar and non-lamellar phase transitions in aqueous lipid dispersions J. Erbes, G. Rapp & R. Winter

185

Similar characteristics of bacterial death caused by high temperature and high pressure: Involvement of the membrane fluidity T. Tsuchido, K. Miyake, M. Hayashi & K. Tamura

189

Structure and function of nucleic acids under high pressure A. Knyzaniak, P. Salanski, R.W. Adamiak, J. Jurczak & J. Barciszewski

IV - ENZYMES 195

Stabilization of thermophile enzymes by pressure D. Clark, M. M. Sun, L. Giarto, P.C. Michels, A. Matschiner & F.T. Robb

203

Enzyme stability under high pressure and temperature S. De Cordt, L. Ludikhuyze, C. Weemaes, M. Hendrickx, K. Heremans & P.Tobback

209

Catalytic properities of proteinases under high pressure S. Kunugi , Y. Kanazawa, K.Mano, A. Koyasu & T. Inagaki

215

Pressure effects on the stabililty and reactivity of methanol dehydrogenase J. Frank, N. Bec, H.A.L. Corstjens, R Lange & C. Balny

22 1

Modulation of enzyme activity and stability by high pressure : a - chymotrypsin V.V. Mozhaev, E.V. Kudryashova, & N. Bec

xvii

227

Effects of hydrostatic pressure on catalytic activity and stability of two alcohol dehydrogenases S. Dallet & M.D. Legoy

23 1

Thermodynamics of transient enzyme kinetics C. Balny

V - MICROORGANISMS 237

High Pressure inactivation of microorganisms H. Ludwig, G. Van Almsick & B.Sojka

245

Saccharides protect yeast against pressure correlated to the mean number of equatorial OH group S. Fujii, K. Obuchi, H. Iwahashi, T. Fujii & Y. Komatsu

253

Inactivation of bacterial spores in phosphate buffer and in vegetable cream treated with high pressure S. Gola, C. Fornari, G. Carpi, A. Maggi, A.Cassara & P. Rovere

26 1

Behaviour of Escherichia coli under high pressure K. Tamura, Y. Muramoto, M. Miyashita & H. Kourai

267

High pressure inactivation in foods of animal origin M.F. Patterson, M. Quinn, R.K.Simpson & A. Gilmour

273

Inactivation of HIV in blood plasma by high hydrostatic pressure T. Shigehisa, T. Nakagami, H. Ohno, T. Otake, H. Mori, T. Kawahata, M. Morimoto & N. Ueba

VI - FOOD SCIENCE 1. Reviews

279

Advantages, opportunities and challenges of high hydrostatic pressure application to food systems D. Knorr

xviii

289

Understanding the pressure effects on postmortem muscle A. Suzuki, K. Kim & Y. Ikeuchi

299

Effects of high pressure on dairy proteins : a review J.C. Cheftel, E. Dumay

2. Meats 309

Changes in myosin molecule and its proteolytic subfragments induced by high hydrostatic pressure K. Yamamoto

315

Dynamic rheological behaviour and biochemical properties of pressurized actomyosin Y. Ikeuchi, H. Tanji, K. Kim, N. Takeda, T. Kakimoto & A. Suzuki

323

The effect of high pressure on skeletal muscle myofibrils and myosin A. J.McArthur & P. Wilding

327

Effect of high pressure treatment on proteolytic system in meat N. Homma, Y. Ikeuchi & A. Suzuki

3. Milk and eggs

33 1

High pressure effects on emulsified fats W. Buchheim, M. Schutt & E. Frede

337

High pressure treatment of whey protein / polysacchride systems P. B. Fernandes & A. Raemy

343

Time-resolved turbidimetric measurements during gelation process of egg white under high pressure H. Kanaya, K. Hara, A. Nakamura & N. Hiramatsu

347

High pressure effects on the colloidal calcium phosphate and the structural integrity of micellar casein in milk K. Schrader, C.V. Morr & W. Buchheim

xix

4. Fishes 351

High pressure effects on fish lipid degradation: Myoglobin change and water holding capacity S. W ada & Y. Ogawa

357

Gelation of surimi pastes treated by high isostatic pressure T.C. Lanier

363

Effect of water-soluble protein on pressure-induced gelation of Alaska pollack surimi E. Okazaki & Y. Fukuda

369

Application of high pressurization to fish meat: Changes in physical properties of carp skeletal muscle resulting from high pressure thawing K. Yoshioka, A. Yamada & T. Maki

375

Thermal and rheological properties of pressurized carp meat N. Iso, M. Horie, H. Mizuno, H. Ogawa, Y. Mochizuki & T. Mihori

5. Plant foods 379

Effect of pressure-shift freezing on texture, pectic composition and histological structure of carrots M. Fuchigami ,N. Katoh & A. Teramoto

3 87

Technique of quality control for Sudachi (Citrus Sudachi Hort. ex Shirai) juice by high pressure treatment A. Iuchi, K. Hayashi, K. Tamura, T. Kono, M. Miyashita & S.K. Chakraborty

391

Effect of hydrostatic pressure on the sterilization of tomato juice T. Sato, T. Inakuma & Y. Ishiguro

397

High pressure treatment for Nozawunazuke (salt vegetable) preseravation T. Kuribayashi, K. Ohsawa, S. Takanami & K. Kurokouchi

xx

401

Stabilization of black truffle of Perigord (Tuber melanosporum ) by high pressure treatment A.El Moueffak, C. Cruz, M. Montury, A. Deschamps, A. Largeteau & G. Demazeau

405

Preparation of salt-free miso and its high pressure treatment for reservation K. Hayakawa, Y. Ueno, S. Kawamura, Y. Miyano, S. Kikusima, S. Shou & R Hayashi

41 1

Texture and cryo-scanning electron micrographs of pressure-shift frozen tofu M. Fuchigami & A. Teramoto

6. Sterilization

415

Combined effects of temperature and pressure on inactivation of heat-resistant bacteria T. Okazaki, K. Kakugawa, S. Yamauchi, T. Yoneda & K. Suzuki

419

Sterilization of yeast by high pressure treatment Y. Aoyama, M. Asaka, R. Nakanishi & K. Murai

423

High pressure inactivation of yeast cells in saline and strawberry jam at low temperatures C. Hashizume, K. Kimura & R Hayashi

429

Application of high pressure for sterilization of low acid food K. Kimura, M. Ida, Y. Yosida, K. Ohki & M. Onomoto

7. Technical developments

433

Comparative study of thermal and high pressure treatment upon wheat starch suspensions J.P. Douzals, P.A. MarCchal, J.C. Coquille & P. Gervais

439

Modeling of high pressure thawing J.M. Chourot, R Lemaire, G. Cornier & A. Le Bail

xxi

445

HPP strawberry products : an example of processing line P. Rovere, G. Carpi, S. Gola, G. Dall'Aglio & A. Maggi

45 1

Measurement of the gel-point temperature under high pressure by a hot-wire method K. Shimada, Y. Sakai, K. Nagamatsu, T. Hori & R Hayashi

455

Continuous high pressure system for liquid food S. Itoh, Ka. Yoshioka, M. Terakawa & I. Nagano

463

Development of a pulsatile high pressure equipment S. Itoh, K. Yoshioka, M. Terakawa & I. Nagano

8. Miscellaneous

473

Behaviour of organic compounds in food under high pressure : Lipid peroxidation E. Kowalski, H. Ludwig &B. Tauscher

479

The effect of pressure on process modelling the Maillard reaction N.S. Isaacs & M. Coulson

485

The effects of high pressure on some mechanical and physical properties of wood M.Yashiro & K. Takahashi

MI - CONCLUDING REMARKS 491

Some reflections on a high pressure conference K. Heremans

493

LIST OF PARTICIPANTS

51 1

AUTHOR INDEX

5 15

SUBJECT INDEX

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

An overview of the use of high pressure in bioscience and biotechnology Rikimaru Hayashi Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku, Kyoto 606-01, Japan

Abstract

The successful application of pressure as a parameter in bioscience and biotechnology, the background, industrial establishment, and developmental activities of high pressure food in food processing in Japan, where it is widely recognized that the most notable progress has been made, is described. It is also emphasized that such progress is naturally extended to bioscience in general.

1. INTRODUCTION Observations of the effect of high pressure on biological materials and organisms can be traced back to the last century. High pressure treatment to kill bacteria was first described in 1895 by Royer. Hite and coworkers of the University of West Virginia reported the use of high pressure for the preservation of milk in 1899. Bridgman observed coagulation of egg white by high pressure treatment in 1914. Since these reports, research on the effect of high pressure on biological materials and living organisms have continued without interruption. However, it is surprising that attempts to apply high pressure to food science almost stopped for 70 years since the pioneering attempts of Hite and coworkers until recent break-throughs in Japan, where high pressure-processed foods have been successfully released on the food markets. This article describes development activities of high pressure food,

emphasizing that such progress can be naturally extended to bioscience in general.

2. DEMAND IN JAPANESE FOOD CONDITIONS

The most common process for food sterilization and processing today is thermal treatment. Modem food industries use increasinglyelevated temperatures over temperature range traditionally used in the home kitchen for such processes. It is generally appreciated that the severe conditions to which food materials are exposed may cause alterations on the natural taste and flavor of food and destruction of food nutrients such as vitamins or may even produce toxic compounds. When we started studies on the application of high pressure processes to food science and technology in 1986, 40 years had passed since the Second World War ended. The country was highly industrialized: the urban population increased to a majority, the rural population engaged in agricultural work decreased proportionally. This industrialization raised two problems for the food industries. Ironically, urban people favor traditional foods which are fixed deeply in Japanese culture taking long years though they take modem processed foods for convenience. Many such traditional foods are cooked scrupulously making the best use of the natural taste contained in the fresh food materials. The modem way of food processing in food industries does not necessarily fit to such elaborate foods. Another noticeable point with regard to food in Japan is the fact that the country can not attain self-sufficiency in food supply. Food industries have to continuously endeavor to improve technical developments in food transportation needed to import many foods from far countries whilst maintaining good quality and reasonable price. For example, freezing of fish for transportation is not sufficient for sashimi because of taste and texture deterioration brought about by the freezing and thawing processes. Food conditions in Japan clearly needed a principally new technique for food processing. As a concept, non-heating processes for sterilization and processing of food has been strongly desired by food manufactures. The proposition to introduce high pressure-processing technology to food

industries, thus, has been a matter of concern and interest in food industries, and high pressure techniques have been accepted smoothly as an inevitable technique in modem food industries.

3. DEVELOPMENT OF HIGH PRESSURE PROCESSING

In 1992, a major breakthrough came in Japan. Meidiya Food Company released high pressure-processed jams on the food market, followed by high pressure-processed fruit jellies and sauces. These products have strong but natural tastes and flavors and vivid color, which are regarded as the prominent merits of high pressure food processing. By the end of 1995, a total of seven food companies in Japan had released high pressure food products on the market. In addition to jams, juices, ice-cream, Japanese unrefined rice wine (Nigori-sake), and rice cakes containing herbs (yomogimochi) are on the market. Icenucleation bacteria sterilized by high pressure treatment are used for food processing. In order to meet the requirements of the food industry, high pressure equipment has to be constructed. Fortunately, the ceramic industry has utilized water compression to generate high pressure at large scales, called CIP. This machine has improved so as to attain fast pressurizing and depressurizing speeds, and to ensure the safety of the food products. Industrial equipment for high pressure processing of foods is operational in several food industries" a batchwise system of 10 to 50 litercapacity is used for the treatment of packed foods and a semi-continuous system of 1-4 ton per hour-capacity for the treatment of liquid foods. Small size test machines for high pressure treatment have been installed in more than 100 food companies and governmental institutions in Japan in recent years where they are used to perform research and development for new food products. In these machines, hydrostatic pressure of 400 MPa is directly applied to foods placed in the pressure vessel at high speed under the regulated temperature without any harmful contaminants. As the first step, high pressure has been used at room temperature without changing the pressurization temperature. Subsequently, it has

been learned that the combined use of high pressure (P) and temperature (T) can be effective in developing high quality foods. In other wards, independent use of P as the traditional use of high T or low T at ambient pressure has developed for pressurization at high or low temperature (P + T ) and pre-treatment by T followed by P treatments (T--~P) or vice versa (P-->T). Pressurization at high temperature has been found to be effective at killing the heat tolerant spores of bacteria. The use of high pressure at sub-zero temperatures is also of recent interest because treatment of biological materials including food materials at low temperature has many applications; it is particularly ideal for treating medically important organs.

4. FROM FOOD SCIENCE TO BIOSCIENCE OF HIGH PRESSURE

In principle, high pressure inactivates microorganisms, denatures proteins, and gelatinizes starches. These properties of high pressure are similar to the effects given by temperature. However, unlike temperature, high pressure keeps natural flavor, color and nutrients of natural foods, in other words, the original properties of the biological material. Therefore, high pressure treatment may be applied not only to food materials but also biological materials such as organs and tissues. It is natural that high pressure technology is extended to bioscience and biotechnology in general and concern and demand for this extension are increasing under the support of successful use of high pressure in food science and technology. Water compression is not realized on the earth except 100 MPa at the bottom of the deepest sea. To understand the effects of higher hydrostatic pressure on biological systems, basic research is indispensable for further development of high pressure food science and bioscience. More observations of high pressure effects on living organisms and living matters should be accumulated by scientists in the biology-related sciences such as biochemistry, molecular biology, microbiology, cell biology and so on, in addition to agriculture, medicine, and pharmacology (see chapter 2 contributed by Dr. C. Balky). Investigations to determine physical constants under high pressure

should be continuously made though the work is unpretentious and unattractive but pains-taking. For example, such data as solubility of biologically important compounds including amino acid, sugars, and lipids in addition to various salts should be summarized in the form of an international table. These data are indispensable for understanding and further development of high pressure bioscience. Experimental high pressure equipment useful in biological research are not as common as equipment for temperature control. Easily available and small high pressure vessels for various spectroscopic studies are strongly and increasingly required. World wide exchange of knowledge in high pressure bioscience seems to be made rather smoothly: five series of symposia have been organized on the uses of high pressure processing in food in Japan with academic and industrial researchers since 1989, and that is followed by The Joint Meeting of Japan and the European Community on High Pressure Biotechnology held at La Grande Motte, France in September of 1992 and The First International Congress on High Pressure Bioscience and Biotechnology held at Kyoto, Japan in November of 1995. For further details one may refer to the Proceedings of the Symposia (see REFERENCES).

5. CONCLUSION Mankind has two fundamental factors, T and P, which offer many chances in the field of bioscience and biotechnology for new challenges because they can act on the face which is made by T and P axes not simple changing of only T. In response to the fast growing applications, basic bioscience for artificially produced high pressure and its effect on biological materials increases its importance and needs further exploration by scientists of different disciplines including biochemistry, cell biology, engineering, food science, medicine, molecular biology, pharmacology and physical chemistry. Readers of the Proceeding surely realize that high pressure research is rapidly increasing in the fields of bioscience and biotechnology and that

it will grow to produce fruitful results for human welfare in twenty first century. Bioscience under artificially-produced high pressure should be distinguished from bioscience of extreme conditions which are recent concerns of bioscientists, because extreme conditions mean natural conditions existing on the Earth. One may say that high pressure bioscience described in this article is not natural science but artificial science. This situation is similar to space medicine under no gravity. Traveling in space is brought about by artificial achievement. Bioscience of artificial environment, which is out of the Earth environment, involves very interesting subjects as pure science without considering any value.

6. R E F E R E N C E S

1 R. Hayashi (ed.), Use of High Pressure in Food (in Japanese), San-Ei Publishing Co., Japan, 1989. 2 R. Hayashi ed.), Pressure Processed Food-Research and Development (in Japanese), San-Ei Publishing Co., Japan, 1990. 3 R. Hayashi (ed.), High Pressure Science for Food (in Japanese), San-Ei Publishing Co., Japan, 1991. 4 C. Balny, R.Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology, Colloques INSERM/John Libbey Eurotext Ltd., France, Vol. 224, 1992. 5 R. Hayashi, High Pressure Bioscience and Food Science (in Japanese), San-Ei Publishing Co., Japan, 1993. 6 R. Hayashi, S.Kunugi, S. Shimada and A. Suzuki, High Pressure Bioscience (in Japanese), San-Ei Publishing Co., Japan, 1994.

R. Hayashiand C. Balny(Editors), High Pressure Bioscienceand Biotechnology 9 1996Elsevier Science B.V. All rights reserved.

Future prospects in high pressure basic bioscience C. Balny INSERM, Unit~ 128, BP 5051, 34033 Montpellier, Cedex 1, France Abstract If applied research in the field of high pressure bioscience has, up to now, mainly been t u r n e d in the direction of food science, a clear knowledge of reactions involved needs support from basic research which is aimed at an u n d e r s t a n d i n g of pressure induced phenomena in biomolecules and living cells.

1. INTRODUCTION The philosophy of the Closing Remarks of the last International Conference on "High P r e s s u r e and Biotechnology" held in 1992 at La Grande Motte (France) is still pertinent : "It seems that the best strategy in fundamental research is the random approach in which one singular topic is studied by a wide variety of techniques" [1]. However, since 1992, significant progress has been made in high pressure technology such as the adaptation of biophysical methods under high pressure conditions (X-ray structure analysis and NMR may be the most s i g n i f i c a n t examples, allowing the collection of high resolution data from high pressure experiments with proteins), the interpretation of the observed results such as the introduction of the notion of a molten globule state during protein denaturation reactions. Concerning the structure-function and structure-stability relationship in proteins, the study of mutant proteins associated with high-pressure experiments will contribute to our understanding of protein structure and behavior. From a conceptual point of view, the real progress which has been made is that the pressure parameter is now not only considered as a physical tool to investigate elementary equilibria or chemical reactions, to provide information on reaction mechanisms themselves, but may also be exploited as a potential tool to create perturbations which can, for example, modify reaction pathways (or subtrate specificity and protein structure). However, to allow an understanding of these phenomena at the molecular level, substantial effort has still to be made in the application of fundamental thermodynamics to biological problems [2]. Several monographs discuss in detail the effects of pressure on a variety of biochemical and biophysical systems, covering both the experimental and theoretical aspects of recent high-pressure studies of proteins (for a recent review, see ref. 3 and the references list in this article). Therefore, in the present paper, we will limit ourselves and stress only some characteristic

points which m u s t be study in depth for a b e t t e r u n d e r s t a n d i n g of the pressure effects on b i o s y s t e m s and their possible applications. In this context, we will p r e s e n t also some techniques which have recently been developed for the high p r e s s u r e a d a p t a t i o n of some biophysical m e t h o d s g e n e r a t i n g a n d m a i n t a i n i n g pressures up to 700 - 1000 MPa.

2. I M P O R T A N C E O F T H E E N V I R O N M E N T 2.1. Role of the t e m p e r a t u r e p a r a m e t e r in s t u d y i n g p r e s s u r e effects P r e s s u r e effects on biomolecules are governed by two m a i n principles [3] : 1 - The f u n d a m e n t a l Le Chatelier's principle which s t a t e s t h a t at e q u i l i b r i u m a s y s t e m t e n d s to m i n i m i z e t h e effect of a n y e x t e r n a l f a c t o r by w h i c h it is perturbed; 2 - The p r i n c i p l e of microscopic o r d e r i n g which s t a t e s t h a t an i n c r e a s e in p r e s s u r e a t c o n s t a n t t e m p e r a t u r e l e a d s to a n o r d e r i n g of m o l e c u l e s or a decrease in the entropy of the system.

I

~ AV, ml/mo,

3

[

Dcnature.d, AG < 0

,

,.o d r~

1-

Native, AG > 0

............ ,;..................[;i".........................I...........................~ ......................... - 20

0

20

40

q~ I

.

60

Temperature, o C

F i g u r e 1. P r e s s u r e - t e m p e r a t u r e t r a n s i t i o n d i a g r a m of p r o t e i n d e n a t u r a t i o n (Figure a d a p t e d fi~om Ref. 5).

The co n s eq u ence is t h a t the effects of p r e s s u r e and t e m p e r a t u r e on biochemical reactions are antagonistic. This is clear if we consider some elementary reactions such as the ionisation of dissociable groups. For example, the pK of a Tris buffer is very sensitive to the t e m p e r a t u r e b u t a l m o s t independent of the pressure. This difference exists also if we consider reaction rates : by lowering the temperature, the velocity of a reaction decreases (positive enthalpy AH$) whereas, by increasing the pressure, the velocity of a reaction increases or decreases, depending of the sign of the activation volume AV$ [4]. These two p a r a m e t e r s m u s t , in all cases, be t a k e n into a c c o u n t w h e n considering protein denaturation, since the native conformation of a protein exists only over a rather limited range of both pressure and temperature. The region of stability of a native structure has a curved boundary when plotted on a temperature-pressure diagram, which can be used to select useful t reat m ent s for biotechnological applications, mainly in food biochemistry where controled denaturation of proteins is achieved (see Figure 1). As in the case of the effect of p r e s s u r e on p r o t e i n s , the effect of t e m p e r a t u r e m a y be r e v e r s i b l e or n o n r e v e r s i b l e , b u t the f u n d a m e n t a l difference b e t w e e n p r e s s u r e - and temperature-induced processes relates to the fact that no changes in covalent bonding have been observed to occur using the pressure effect. 2.2. Water The solvation of biological material is essential in most studies and one way to attain this is to use high pressure. Protein volume in solution is the sum of several components including a contribution due to the solvation of peptide bonds and amino acid side chains, which contributes negatively to the total volume. At high pressure, the solvation shell of proteins becomes more ordered and an increase in protein-water interactions may be a characteristic feature of pressure-induced denaturation. As an example we can mention the role of water in the inactivation of enolase by high hydrostatic pressure. In the transition state of the dissociation, the previously buried interfaces of pressure-dissociated subunits of this dimeric protein become hydrated, which is favored by pressure [6]. The other aspect concerns the physical properties of w at er u n d e r high pressure. According to the phase diagram of water, at high pressure (up to 200 MPa), a subzero t e m p e r a t u r e (down to - 20~ ) region exists where water remains liquid. Application of such low-temperature, high-pressure conditions allows rapid freezing of biological materials by a rapid decompression of the medium. Improved high-pressure biotechnological processing methods should result from the possibility of operating in the liquid water phase under such conditions at temperature below 0~ However, the thermodynamics of these promising processes are still not well known when biological materials are in the water phase.

2.3. Osmotic p r e s s u r e As mentioned by G. Hui Bon Hoa, the osmotic stress technique through the addition of osmolytes of different sizes is an interesting way of perturbing solvation of proteins and of probing the role of loosely-bound water in the free energy changes associated with protein-protein binding. A recent example is given in the case of the specificity of cleavage of restriction endonucleases,

l0 which is found to be d r a m a t i c a l l y reduced at elevated osmotic pressure. Application of hydrostatic pressure counteracts the effect of osmotic pressure a n d r e s t o r e s the n a t u r a l selectivity of the e n z y m e s for t h e i r canonical recognition sequences. These results indicate that the solvation by water plays an important role [7]. The use of both osmotic- and h y d r o s t a t i c - p r e s s u r e techniques has been neglected for many years, the combination of these two approaches permits the study of the role of water in many biochemical processes, such as substrate binding, p r o tein- pr ot e i n interactions, allosteric effects and conformational changes, catalysis, protein stability, and ion channel formation. (see Ref. 7 and the paper of G. Hui Bon Hoa in these Proceedings).

2.4. Pressure and enzyme reactions :viscosity problems The e x p e r i m e n t a l value which reflects the pressure dependency of the velocity of an enzyme reaction is the activation volume (AV$), the slope of the curve of In k v e r s u s pressure (k being the rate constant) multiplied by a factor [4,8]. This simplest formulation is derived by analogy with the t r e a t m e n t of chemical reactions, where the transition state theory of Eyring postulates that between two successive complexes, there is a labile complex (transition state). Here also, the thermodynamics of these process must be reanalyzed to give a better description of biological reactions. Some experiments carried out with model s y s tem show t h a t the t r a n s i t i o n state theory is an oversimplified i n t e r p r e t a t i o n . A t r e a t m e n t which may approach the real s i t u a t i o n more closely is provided by Kramers' theory, which includes the viscosity of the medium ; an important factor when applications are considered. In addition, according to this theory, the variation of viscosity with pressure must introduce curvature in I n k as a function of pressure. Preliminary results obtained from viscosity experiments are, therefore, a way of discovering the still unknown p a r a m e t e r s which affect the i n t e r c o n v e r s i o n of i n t e r m e d i a t e s reflecting intramolecular protein motions. 2.5. New experimental media Recent years have witnessed a development of the ideas and methods of micellar enzymology. The systems of reversed micelles appear to be very useful in f u n d a m e n t a l biochemistry because they help to mimic the behavior of enzymes in cell membranes. These micelles contain the biological material in a w a t e r phase solubilized in an apolar organic solvent (octane) using an amphiphilic s u r f a c t a n t (AOT : Aerosol OT) (see Figure 2). They also have potential uses in biotechnology such as, for example, protein extraction. Both f u n d a m e n t a l and applied biochemistry face the problem of m o d u l a t i n g the enzyme activity in the micelles, and one way is to use high pressure in these systems, with a low content of water [9]. The other point concerns thermostability. We have studied the case of achymotrypsin solubilized in reversed micelles of AOT, where the problem of the thermostability of this enzyme remains. Application of high pressure in the range 0.1 - 150 MPa stabilizes the enzymes against thermal inactivation at all d e g r e e s of h y d r a t i o n (this p a r a m e t e r is equal to the ratio b e t w e e n the concentrations of water and surfactant). One can assume t hat application of pressure increases the structural order of surfactant aggregates which would

11 decelerate enzyme inactivation. However, using different physical methods such as NMR or infrared spectroscopies adapted to the conditions of high pressure, studies at the molecular level are necessary [10].

Figure 2. Schematic p r e s e n t a t i o n of enzyme-containing reversed micelles formed by surfactant (Aerosol OT) in a non-polar solvent. 1 : non-polar solvent ; 2 : water ; 3 :Aerosol OT ; 4 : enzyme. 3. HIGH-PRESSURE, A WAY TO APPROACH PROTEIN STRUCTURE ANALYSIS P r e s s u r e acts on the secondary, t e r t i a r y and q u a t e r n a r y s t r u c t u r e of proteins and a classical image of local pressure-induced changes is obtained clearly from X-ray structure analysis. However other methods permit access to other local or global pressure-induced changes in protein structure : at the level of secondary structure by using vibrational spectroscopy, at the level of tertiary structure by using NMR spectroscopy, X-ray analysis or UV-vis and fluorescence spectroscopies and at the level of quaternary structure by using NMR and fluorescence spectroscopies or electrophoresis [3]. Among these methods, we must point out that recent development in Fourier transform i n f r a r e d spectroscopy can give detailed information on p r e s s u r e - i n d u c e d changes in the secondary structure of proteins, from characteristic shifts in the band frequencies in spectra [11]. However, major advances in determining structural changes in proteins a c c o m p a n y i n g p r e s s u r e - i n d u c e d d e n a t u r a t i o n h a v e b e e n o b t a i n e d by combining h i g h - r e s o l u t i o n NMR t e c h n i q u e s with high p r e s s u r e . In an

12 excellent recent review, J. Jonas et al. analysed both the potentialities of this approach and technical progress in this field. They discuss, in particular, several features of NMR probe design which are essential for biochemical applications of this technique : high resolution, high sensitivity, wide pressure and temperature ranges, large sample volume, reliable RF feedthroughs and suitability for superconducting magnets [12]. An example of the potential of this approach is given by the study of the dissociation of a dimeric Arc repressor protein using phase-sensitive two-dimentional correlated s p e c t r o s c o p y (COSY) and n u c l e a r O v e r h a u s s e r effect e n h a n c e m e n t spectroscopy (NOESY) [13]. A study of the unfolding of ribonuclease A using 1H NMR at 400 MHz in the temperature range 7.5 to 40~ is presented by one group at Kobe University in these Proceedings. For membranes, systematic high-pressure NMR studies have been made on model phospholipid membranes, in particular for studies of the gel-state which is highly ordered in contrast to the liquid-crystalline state [12]. Special attention must be given to circular dichroism spectroscopy which has been developed by a Japanese group (see the paper of S. Ozawa et al. in these Proceeding). This technique, which gives i m p o r t a n t information for protein conformation studies, is very difficult to adapt for high pressure experiments (depolarization of the surface of the windows problems under pressure). At present, data on model molecules seem reliable up to 200 MPa. 3. 1. Protein cristallization Protein crystallization can be achieved under pressure ; this was first observed with glucose isomerase. However, the role of high pressure is not yet clear since, for example, the crystallization of egg-white lysozyme is strongly inhibited by hydrostatic pressure. It seems that sudies up to now have not included any systematic t h e r m o d y n a m i c investigation. However, kinetic models have been proposed to understand how pressure may act on protein self-assembly (see Ref. 14). 3.2. The molten globule states This particular point will be discussed in detail in these Proceedings by P. M a s s o n . This p h e n o m e n o n is very i m p o r t a n t w h e n we c o n s i d e r mild d e n a t u r i n g of proteins under conditions where they undergo a transition toward partially unfolded states called molden glogule states. Pressure induced these states with particular emphasis on hydration changes that are involved in the formation of these folding/unfolding intermediates. An interesting example is given in the study of the denaturing effect of pressure on the structure of human butyrylcholinesterase under pressure. It has been found that the hydrodynamic volume of the enzyme swells when pressures around 150 MPa are applied and that the fluorescence intensity of a bound dye (ANS) is increased by pressure between 50 and 150 MPa. These observations indicate that pressure denaturation of the protein is a multi-step process and that the observed transient pressure-denatured states have the characteristics of "highly ordered" molten globule states [15]. These lines of evidence are of primary importance for a better understanding of the proteindenaturation process.

13 M o r e o v e r , p r e s s u r e d e s t a b i l i z e s h y d r o p h o b i c bonds, w h i c h i n d u c e s dissociation of oligomeric structures. This effect often accurs at pressures below 200 MPa where, after pressure release, the reverse transition may be slow, showing an hysteresis phenomenon. It is the "conformational drift" due to a long-living matastable intermediate state [16,17].

3.3. Compressibility A considerable body of e x p e r i m e n t a l work indicates t h a t proteins are flexible structures, and in particular that they are compressible. The pionner work of K. Gekko's group has led to the d e t e r m i n a t i o n of the a d i a b a t i c compressibility by m eans of sound velocity m e a s u r e m e n t s , giving complem e n t a r y i n f o r m a t i o n on the flexibility or rigidity of prot ei n molecules in solution and on f l e x i b i l i t y - s t r u c t u r e r e l a t i o n s h i p s . The c o m p r e s s i b i l i t i e s measured are in the range 30 - 200 ml.mo1-1 which correspond to about 0.3 % of the total protein volume. As an application of this technique, a method for e s t i m a t i n g hydration terms has been proposed. Recent results concern the compactness of thermally a n d c h e m i c a l l y d e n a t u r e d r i b o n u c l e a s e A, as r e v e a l e d by v o l u m e and compressibility. It has been found t hat the confor-mation of the d e n a t u r e d ribonuclease resulting from thermal denaturation is greatly different from that brought about by guanidine hydrochloride denaturation. As a conclusion, it is s u g g e s t e d t h a t t her e are some molten globule like i n t e r m e d i a t e s in the denaturation processes [18]. 4. NEW FIELDS 4.1. High hydrostatic pressure as an agent for increasing the activity and the stability of enzymes In this laboratory, V. V. Mozhaev et al. have shown that elevated hydrostatic pressure can be used to increase the catalytic activity and thermal stability of model proteins [19]. For ~-chymotrypsin, an increase in p r e s s u r e at 20~ results in an exponential acceleration of the hydrolysis rate, reaching a 6.5 fold increase in activity at 470 MPa. The acceleration due to high pressure becomes more p r o n o u n c e d at high t e m p e r a t u r e because of a s t r o n g t e m p e r a t u r e dependence of the activation volume of the reaction. At 50~ under a pressure of 360 MPa, the activity is more than 30 times greater t han the activity at normal conditions (20~ and atmospheric pressure). Elevated hydrostatic pressure has also been found effective in increasing the stability of ~-chymotrypsin agai ns t t h e r m a l d e n a t u r a t i o n . For example, at 55~ the enzyme is a l m o s t i n s t a n t a n e o u s l y i n a c t i v a t e d at a t m o s p h e r i c pressure whereas under a pressure of 180 MPa, the activity is retained during several minutes. Additional stabilization can be achieved in the presence of glycerol. This pressure modulation of reaction rates is extremely promising for b i o t e c h n o l o g i c a l a p p l i c a t i o n . (See the p a p e r of V.V. M o z h a e v in t h e s e Proceedings).

14 4.2. P r o t e i n purifications Among affinity separation techniques, immunoaffinity seems to be the most suitable for protein separation because it is easy to get specific antibodies against any given protein. The main problem concerns desorption which often requires drastic conditions at atmospheric pressure (low pH, chaotropic ions, high salt concentration, etc.). Studies using high-pressure to disrupt antigenantibody complexes are currently in progress. This could be a clean method since, during the process, no extra compounds have to be added. However, the antigen-antibody interactions are specific and strong. Only preliminary results have been obtained, but it seems that a complete study will be necessary to allow unambiguous interpretation of the results obtained where, in addition to the pressure effect, other factors must be explored such as the temperature. It is an interesting approach, for which a better understanding of pressure effects on chemical and biochemical bonds is necessary since the published data available are from model systems, sometimes far removed from the complexity of biochemical problems [20].

5. SPECIAL EQUIPMENT There can be no real progress in high p r e s s u r e basic science w i t h o u t special equipment. Depending on the biophysical method used, many systems have been developed. If UV-vis absorption or fluorescence spectroscopies working up to 500 MPa are now nearly "routine" methods, some others are as yet only at the development stage. Among them, we may mention : fast kinetic equipment, electrophoresis, NMR spectroscopy (which use a compressed liquid as a pressure transmitter), and the diamond anvil cell which uses a direct mechanical compression. For the first t h r e e m e t h o d s , the classical s y s t e m for h i g h p r e s s u r e d e t e r m i n a t i o n s is composed of generation, control and m e a s u r e m e n t parts. The real innovation is at the cell level where various mechanical designs have been proposed. However, the commercialisation of these systems is not yet possible because the of the reliability. One main problem concerns the nature of the alloys used to construct the cells, regarding the mechanical constraints both at high p r e s s ur e and at various t e m p e r a t u r e s . A collaboration with specialists in hard materials is required. 6. CONCLUSIONS : CURRENT PROGRESS AND FUTURE PROSPECTS Mainly using special equipment, real progress has been made in barobiochemical science, in the field of structure-function relationships. These systems have permitted the first direct in situ observation under pressure, together with a very good control of other parameters such as the temperature and the nature of the medium. This is real progress since, for many years, it was only possible to record pressure effects after decompression to atmospheric conditions. Second, it is the diversity of the biophysical methods which have p e r m i t t e d the collection of m a x i m u m data. It may be in the field of NMR specctroscopy that the most interesting results will be obtained.

15 However, there are at least two problems which remain to be solved. The first is technological : i t is not yet possibble to have a versatile circular dichroism apparatus for protein studies at high pressure, if we except the real first a t t e m p t p r e s e n t e d at this Conference by S. Ozawa and applied to ribonuclease conformation change. The second concerns the thermodynamic t r e a t m e n t of the pressure effects on biosystems. We must keep in mind that the basic thermodynamic analysis that we use comes from applications in chemistry, and sometimes from perfect gases. The absence of an adequate theory is a major difficulty in the treatment of the data, but we can hope that by collection as much information as possible, the situation will soon improve. 7. ACKNOWI~EDGMENTS

The author is grateful to DRET (grant N 94/5) for financial support and t h an k s Drs. V. V. Mozhaev, K. Heremans, J. Frank, P. Masson, R. Lange, K. Ruan and N. Klyachko for helpful discussion. Part of the work discussed in this paper was performed in the framework of COST project D6 and INTAS 9338 project. 8. REFERENCES

1 C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology, John Libbey Eurotext/INSERM, Montrouge, France, vol. 224, 1992. 2 V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Trends Biotechnol., 12 (1994) 493. 3 V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Proteins: Structure, Function, and Genetics, 24 (1996) 81. 4 C. Balny, P. Masson and F. Travers, High Pres. Res., 2 (1989) 1. 5 S.A. Hawley, Biochemistry, 10 (1971) 2436. 6 M . J . Kornblatt, J. A. Kornblatt and G. Hui Bon Hoa, Arch. Biochem. Biophys., 306 (1993) 495. 7 C.R. Robinson and S. G. Sligar, Proc. Natl. Acad. Sci. USA, 92 (1995} 3444. 8 C. Balny and P. Masson, Food Rev. Inter., 9 (1993) 611. 9 V.V. Mozhaev, N. Bec and C. Balny, Biochem. Mol. Biol. Inter., 34 (1994) 191. 10 R. V. Rariy, N. Bec, J-L. Saldana, S. N. Nametkin, V. V. Mozhaev, N. L. Klyachko, A. V. Levashov and C. Balny, FEBS Letters, 364 (1995) 98. 11 P. T. T. Wong and K. Heremans, Biochim. Biophys. Acta, 956 (1988) 1. 12 J. Jonas and A. Jonas, Ann. Rev. Biophys. Biolmol. Struct., 23 (1994) 318. 13 S. Samarasinghe, D. M. Campbell, A. Jonas and J. Jonas, Biochemistry, 31 (1992) 7773. 14 M. Gro[~ and R. Jaenicke, Eur. J. Biochem., 221 (1994) 617. 15 C. Clery, F. Renault and P. Masson, FEBS Letters, 370 (1995) 212. 16 G. Weber, Biochemistry, 25 (1986) 3626. 17 K. Ruan and G. Weber, Biochemistry, 27 (1988) 3295.

15 18 Y. Tamura and K. Gekko, Biochemistry, 34 (1995) 1878. 19 V. V. Mozhaev, R. Lange, E. V. Kudryashova and C. Balny, Biotech. Bioeng. (1996) (in press). 20 E. Gavalda, P. Degraeve and P. Lemay, Enz. Microbiol. Techno., (1996) (in press)

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

17

Deep-sea microbial research and its aspect to high pressure biotechnology Chiaki Kato and Koki Horikoshi The DEEPSTAR Group, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka, 237, Japan Abstract We have isolated several microorganisms that are adapted to living in the extremes of the deep-sea environment characterized as high hydrostatic pressure. They include barophilic bacteria, which are able to grow at high hydrostatic pressure, but that are unable to grow at atmospheric pressure, and barotolerant bacteria, which are able to grow almost same ability in both high pressure and atmospheric pressure conditions. A new application field, high pressure biotechnology, will be developing from the deep-sea microbial research in the future.

1. I N T R O D U C T I O N The deep-sea bed is a unique environment that experiences extremely high pressures and low temperatures. Microorganisms living there have developed particular characteristics that allow them to thrive at such extremes. In studies aimed at improving our understanding of microbial adaptation to the deep-sea environment, we have isolated and characterized a number of microorganisms from samples of deep-sea mud obtained by the manned submersible Shinkai 6500. This vehicle, which is operated by the Japanese Marine Science and Technology Center (JAMSTEC), has the ability to submerge to a depth of 6500 m [1 ]. The typical deep-sea adapted microorganisms, barophilic bacteria, which can grow only at high pressure, not at normal atmospheric pressure, and the another high pressure adapted microorganisms, barotolerant bacteria, which can grow in both high and atmospheric pressures, have been isolated from the samples [2]. Such microorganisms could prove to be useful for new biotechnology applications such as high-pressure bio-reactor.

18

2. DEEP-SEA BAROPHILIC AND BAROTOLERANT BACTERIA In 1957, ZoBell and Morita [3] were among the first researchers who attempted to isolate microorganisms that were specifically adapted to the high pressures associated with the deep-sea environment - they called them barophilic bacteria. However, it was only in 1979 that Yayanos et al. [4] were able to isolate barophilic bacteria, thanks to technical support and the development of procedures for investigating deep-sea environments. We are keen to isolate new deep-sea adapted microorganisms and to characterize them for their possible application to high-pressure biotechnology. Several barophilic and barotolerant bacteria have been isolated from samples of deep-sea mud that were collected using sterilized mud samplers on the submersible Shinkai 6500 [2,5]. The isolated bacteria (Table 1) were grown in pressure vessels under a range of hydrostatic pressures (0.1-80 MPa) and temperatures (4-15~ The optimal pressure for growth of barophilic strains was about 50 to 70 MPa at 10~ however that of barotolerant strains was 0.1 to 30 MPa. None of these strains was able to grow at temperatures above 20~ under any pressure conditions. The growth-rate profiles of these barophilic and barotolerant strains indicate that their response to pressure is greatest near their upper temperature limit (15~ for growth. The growthrate profiles of barophilic strains at 4~ were similar to the profiles of barotolerant strains [2,5]. Table 1. The list of deep-sea adapted microorganisms isolated in our laboratory. Bacterial strains

Properties

Barophilic bacteria DB5501 Optimalgrowth at 50MPa and 10~ DB6101 Optimalgrowth at 50MPa and 10~ DB6705 Optimalgrowth at 50MPa and 10~ No growth at atmospheric pressure. DB6906 Optimalgrowth at 50MPa and 10~ No growth at atmospheric pressure. DB 172F Optimalgrowth at 70MPa and 10~ No growth at atmospheric pressure. DB 172R Optimalgrowth at 60MPa and 10~ No growth at atmospheric pressure.

Source

Ref.

SurugaBay depth at 2485m Ryukyu Trench depth at 5110m Japan Trench depth at 6356m

2 2 2

JapanTrench depth at 6269m

2

Izu-BoninTrench depth at 6499m

5

Izu-BoninTrench depth at 6499m

5

Barotolerant bacteria DSK1 Optimalgrowth at 0.1MPa and 10~ Japan Trench depth at 6356m DSS 12 Optimalgrowth at 30MPa and 8~ RyukyuTrench depth at 5110m

2 2

We have also found that barotolerant bacteria display a similar response profile to the barophilic organisms [2]. Indeed, even Escherichia coli responds in a similar way to variations in temperature and pressure [6], perhaps

19 implying that the same response mechanisms are widely conserved. At present, there are not enough data to draw any general conclusions about bacterial growth under high pressure, but it is possible that bacterial growth rates may be stimulated by high pressure near their maximum temperature for growth. From a comparison of the DNA sequences encoding 16S ribosomes, it was shown that the barophilic and barotolerant strains we isolated belong to the P r o t e o b a c t e r i a , gamma subgroup. It is interesting to note that the 16S ribosomal DNA sequences of the barophilic strains DB6906, DB172F, DB 172R, and the psychrophilic barotolerant strain DSS12 [5] show the highest homology of all, indicating that these strains are very closely related. The relationship between the isolated strains and some strains of the gamma Proteobacteria are shown in Fig. 1 in the form of a phylogenetic tree that uses the neighbor-joining method [7]. The barophilic and barotolerant strains isolated from the deep-sea environment have been separated into one of the sub-branches in the gamma subgroup; the barophilic microorganisms reported by Liesack et al. [8] (strains WHB 46-1 and WHB 46-2) are also included in the sub-branch containing the strains isolated in our laboratory. These data suggest that the high-pressure-adapted bacteria may belong to a new bacterial genus in the gamma subgroup of the Proteobacteria. E. coli

S.

marcescens

WHB46-2

P. shigelloides WHB46-1

Pr. vulgaris DSSI2 DBI72F "~. DBI72R

I

DB6906

V. anguillarum DB6101

DB5501

A. hydrophila DB6705

S ~ alga

DSKI |

!

0.02 Knue

Fig. 1. Unrooted phylogenetic tree showing the relationships of isolated barophilic strains within the Proteobacteria gamma subgroup, as determinedby a 16S ribosomalDNA sequence comparison, using the neighbor-joiningmethod.

20 Molecular-genetic analysis of high-pressure-adaptation mechanisms of such microorganisms is been carried out. We have reviewed about the gene and protein expression influenced by high pressure [9]. We believe that the new discovery field of high-pressure biotechnology will develop from such basic studies. 3. FUTURE APPLICATIONS The deep-sea environment is a source of unique microorganisms with great potential for biotechnological exploitation. Very few studies concerning the isolation and characterization of deep-sea microorganisms have been carried out, and we think that investigations in this field may lead to many new discoveries. In this article, we have described the characterization of unique deep-sea adapted microorganisms that display barophily and barotolerance. These microorganisms may be very useful in new applications of biotechnology. For example, the genes and proteins from deep-sea barophilic bacteria are adapted to high-pressure conditions, so they could be used for the development of high-pressure bioreactors, for example. Based on these new discovers, further work aimed to developing commercial applications for these deep-sea microorganisms is in progress. 4. REFERENCES

1 S. Takagawa, K. Takahashi, T. Sano, Y. Mori, T. Nakanishi and M. Kyo, OCEANS, 3 (1989) 741. 2 C. Kato, T. Sato and K. Horikoshi, Biodiv. Conserv., 4 (1995) 1. 3 C.E. Zobel and R. Y. Morita, J. Bacteriol., 73 (1957) 563. 4 A.A. Yayanos, A. S. Dietz and R. Van Boxtel, Science, 205 (1979) 808. 5 C. Kato, N. Masui and K. Horikoshi, J. Mar. Biotechnol., in press. 6 R.E. Marquis, Adv. Microbiol. Physiol., 14 (1976) 159. 7 N. Saitou and M. Nei, Mol. Biol. Evol., 4 (1987) 406. 8 W. Liesack, H. Weyland and E. Stackebrandt, Microb. Ecol., 21 (1991) 191. 9 D.H. Bartlett, C. Kato and K. Horikoshi, Res. Microbiol., 146 (1995) 697.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

21

High pressure effects on the structure and mesophase behaviour of supramolecular lipid aggregates and model membrane systems Roland Winter University of Dortmund, Department of Physical Chemistry, Otto-Hahn-Strafie 6, D-44227 Dortmund, Germany Abstract

Lipids, which provide valuable model systems for membranes, display a variety of polymorphic phases, depending on their molecular structure and environmental conditions. By use of X-ray and neutron di~action, infrared and fluorescence depolarization spectroscopy, calorimetry and volumetric measurements, the temperature and pressure dependent structure and phase behaviour of several lipid systems, differing in chain configuration and headgroup structure have been studied. Hydrostatic pressure has been used as a physical parameter, because high pressure is an important feature of certain natural membrane environments (e.g., marine biotopes), and because the high pressure phase behaviour of biomolecules is also of considerable biotechnological interest [1]. An understanding of the energetics of these lipid assembfies and of the various lipid phase transitions should help in assessing the role of such molecules in natural membranes. 1. INTRODUCTION Lipid bilayers, which constitute the basic structural component of biological membranes, exhibit a rich lyotropic and thermotropic phase behaviour [2]. Due to the large hydrophobic effect, most phospholipid bilayers associate in water already at extremely low concentrations (<10 12 M). Saturated phospholipids often exhibit two thermotropic lamellar phase transitions, a gel to gel (L~,/P~,) pretransition and a gel to liquid-crystalline (Pg,/Lc~) main transition at a higher temperature Tm. In the fluid-like L a phase, the hydrocarbon ~hains of the lipid bilayers are conformationally disordered, whereas in the gel phases, the chains are more extended and ordered. In addition to these thermotropic phase transitions, also pressure-induced phase transformations have been observed (see, e.g., [3-7]). Lamellar liquid-crystalline phases represent the fundamental structural element of cell membranes. However, it is assumed that the non-lamellar lipid structures, such as the inverse hexagonal (Hn) and bicontinuous cubic lipid phases, are also of biological relevance. They probably play an important functional role in some transient cell processes [8-11]. The bicontinuous cubic phases consist of a single lipid bilayer which partitions three-dimensional space into two congruent aqueous sub-volumes. The structures are based on periodic minimal surfaces. A pre-requisite for the formation of the HtI or inverse cubic phases is that the opposing monolayers wish to bend towards the water region. This desire arises because of differential lateral pressures which are present through the monolayer film. It increases, for instance, if the lateral chain pressure increases due to extensive cisJtrans-isomerisations at high temperatures. - First, we present data on the temperature and pressure dependent phase behaviour of single-component phospholipid bilayers. Second, we show results on lipid systems exhibiting also non-lamellar phases. Third, we discuss the effect of incorporated cholesterol on the structure and phase behaviour of phospholipid bilayers. In this overview we will mainly focus on the discussion of experimental results. Details of the experimental techniques are discussed elsewhere [ 12-15].

22 2. RESULTS AND DISCUSSION

2.1 Lamellar phase transitions of single-component phospholipid bilayer dispersions Generally, the lamellar gel phases prevail at high pressure and low temperature. They give way to the lamellar liquid-crystalline L~ phase as pressure is lowered and temperature is raised. A common value for the La/gel transition slope of about 22 ~ has been observed for the saturated phosphatidylcholines DMPC, DPPC and DSPC [4-7,12-14,16] (see Fig. 1). The positive slope can be explained by the endothermic enthalpy change AHm and volume increase AVmat the gel to Lcx transition through the Clapeyron relation dTm/dp = TmA Vm/MJm. Similar transition slopes have been found for the mono-cis-unsaturated POPC, the phosphatidylserine DMPS, and for the phosphatidylethanolamine DPPE. Only those of cisunsaturated DOPC and DOPE have been found to be markedly smaller [4,17]. The transition slope does not significantly depend on the hydrocarbon chain length or the type of headgroup, they affect the transition temperature, mainly. The existence of cis double-bonds in the chain region drastically affects the transition slope, however. The introduction of cis double-bonds leads to the lowest transition temperatures and smallest transition slopes, presumably as the cis double-bonds impose a kink in the linearity of the acyl chains, thus creating si~ificant free volume in the bilayer, which reduces the ordering effect of high pressure. Further pressureinduced gel phases have been observed in single-component phospholipid dispersions, such as an interdigitated high pressure gel phase in DPPC and DSPC [4,12,16]. These studies clearly demonstrate that, by regulating the lipid composition of the cell membranes through changes in lipid chain length, degree of unsaturation and headgroup structure, biological organisms are already provided with a mechanism for efficiently modulating the physical state of their membranes in response to changes in the external environment, such as high hydrostatic pressure.

80L APPE/DPPc F/

/

6oF

DMPC

F / / ~ F 2 0 !/

/

80-

DEPC /

-

-

60 H~

.,DOPE

O

40

o t...d

0 -20~ 0

t- 20

PC ..... 1.......... n 1

p[kbar]

2

3

Figure 1. T, p-phase diagram for the main transition of different phospholipid bilayer systems. The Lcx phase is observed at the low-pressure high-temperature comer of the phase diagram.

ot

-200 - 4[)0" 860 "12'0018'002000 p [bar]

Figure 2. T, p-phase diagram of DOPE in excess water (abbreviations are explained below).

23 2.2 Stable and metastable non-lamellar lipid phases For a series of lipid molecules, also non-lameUar phases occur as thermodynamically stable states or they can often be induced as long-lived metastable states. Here we discuss three examples, taken from different groups of amphiphilic molecules. Contrary to DOPC, the corresponding cis-unsaturated phospholipid with ethanolamine as headgroup (DOPE), in addition to the lamellar LI3/La transition exhibits a lamellar La to inverted hexagonal (Ha) transition. As pressure forces a closer packing of the chains, which results in a reduction of the number of gauche bonds within the chains, both transition temperatures increase with increasing pressure. Figure 2 displays the corresponding T, p-phase diagram for the two endothermic transitions. The initial transition slope of the Hii/Lot transition (dTh/dP = 40 ~ is almost three times steeper as the slope of the lamellar chain-melting transition. A similar steep slope for the HiI/L~-transition has also been observed for egg-PE by turbidity and volumetric measurements [4,20]. The Hii/La-transition is the most pressure-sensitive lipid phase transition found to date. In DOPE also two cubic phases of space group Pn3m and lm3m can be induced by subjecting the sample to an extensive temperature or pressure cycling process at conditions close to the transition region of the L~ and HII phase [4,18,19,21]. Fig. 3a displays diffraction patterns of a pressure-cycled DOPE dispersion. The Bragg reflections (10), (11), and (20) of the Hn phase, the (001) and (002) reflections of the La phase, and the Bragg peaks of the cubic structures of spacegroup lm3m and Pn3m are seen. It is also possible to induce metastable cubic structures in naturally derived lipid systems. Dispersions of egg-PE in excess water spontaneously form a lamellar L~, Lc~ and a Hn structure with increasing temperature, no equilibrium cubic phase is found. However, after a series of pressure-jumps passing the HIi/L~-transition we observe the formation of additional metastable cubic phases of space groups Im3m, Pn3m, and Ia3d (Fig. 3b). It has been shown, that in certain situations, the topology of bicontinuous cubic phases can result in a similar or even lower free

T - 62~

b) egg PE

l--1 I/) l--

I = Im3m

H,,(10)

P = Pn3m

I--I I/) .,--,

T = 20~

p = 340 bar

Pn3m~/~~Htl

l--

_6 i,_

I(211)

xS~~~_.~0

P(III)

I__1

P(110) I I(110) 1(200)

C/) v t---4 >.

IL,(IO0)

Q)

D O P E

bar_

Pn3m[ Im3m I/All Hll

(/) 1-r I--

0

,

I

0.01

~

I

0.02

,

I

.

0.03 s[A -1]

~

I

0.04

,

0.05

0

i

I

,

0.01

,

L

0.02 s[A -~3

~

i

0.03

,

0.04

Figure 3. SAXS patterns a) of DOPE/water, which has been pressure-cycled between the L~ and Hn phase, and b) of egg-PE/water, which has been pressure-cycled between 30 and 450 bar at 62 ~ (s = (2/2)sinO, 2 wavelength of radiation, 20 scattering angle).

24 energy than either the lamellar Lc~ or Hu phase, as the cubic phases have low curvature energies and do not suffer the extreme chain packing stress of the HII phase [ 10,21,22]. As a second example, the monoacylglycerides monoolein (MO, C18:1c9) and monoelaidin (ME, C18: l t9) are chosen, because they have received considerable interest due to their importance as intermediates in lipid digestion and their applications in food industry. For both systems, a temperature-pressure phase diagram has been determined [23], and drastic differences in phase behaviour are found for the two systems (see Fig. 4). In MO-water dispersions, the cubic phase Pn3m extends over a large phase field in the T, p-plane. At temperatures above 95 ~ the H~I phase is found. In the lower temperature region, a crystalline lamellar phase is induced at higher pressures. The phases found in ME-water include a lamellar crystalline L c phase, the L~ gel phase, the La phase, and two cubic phases belonging to the crystallographic space groups Im3m and Pn3m~ Obviously, even small changes in lipid chain configuration can lead to drastic changes in phase behaviour. The stability of the lamellar phases of ME at lower temperatures over the cubic and inverted hexagonal phase, as compared to MO, can be qualitatively explained by simple molecular packing arguments [23]. Compared to ME, the MO molecule is more wedge-shaped, thus leading to an increased tendency of the molecules to aggregate into structures with negative curvatures. I00

80L) F--

..I-

i00

~', ~

80

60

Pn3m

0,U%

40

I--

l

00

60~,i-I

,

Im3m

L

40 P ~ 20~ --''x

20

monoelaidin

Pn3m

monoolein

L. LI3

t

500

p [bar]

I000

l(;

500 p [bar]

i000

Figure 4. T, p- phase diagram of monoolein (MO) and monoelaidin (ME) in excess water. According to the Gibbs phase rule, binary lipid mixtures may exhibit an even more complex phase behaviour with extensive phase coexistence regions. Here we focus on one class of system only: phospholipid/fatty acid mixtures. Fatty acids are known to affect important membrane properties, such as permeability and fusion. It is assumed that hydrogen bonded complexes are formed between the phospholipid and fatty acid molecules, which act as spacers, thus reducing the crowding of the relatively bulky phospholipid headgroups [24]. This change in the steric balance of the bilayer results in the non-bilayer phases being energetically favoured over the fluid lamellar phase, immediately that the chain-melting transition occurs. For the palmitic chain system DPPC/PA (1:2), the low temperature phase is a lamellar phase, but the high temperature fluid phase is an inverted hexagonal one. For the system DMPC/MA

25 (1:2), however, also an isotropic phase of cubic symmetry is observed at higher temperatures. From the combined results of high pressure DTA, X-ray and neutron diffraction experiments, a phase diagram has been constructed for these systems (Fig. 5). At the gel to fluid phase transition of DMPC/MA the change of monolayer curvature is probably that large that the Ha/cubic phases become more stable than the La-phase. The L~-phase is observed under nonequilibrium conditions, however. In the system DPPC/PA, with about 2.5 A longer chain length of the lipid molecules, the larger splay of the 'molten' hydrocarbon chains in the fluidlike state probably leads to such a large spontaneous (intrinsic) curvature that can only be adopted by the inverted hexagonal structure.

100 f 90

Hr[

DMPC/MA

/

80 70 c) o 60

100

/

50 4O

40

Lp

30201 0

I

500

~

Lp

30

MA - L~ ,

DPPC/PA

80 70 o o 60 I--50

l

HE

90

I

i000

p [bar]

~

,

t

1500

20

I

0

500

p [bar]

~

I

I000

Figure 5. T, p-phase diagrams of aqueous dispersions a) of DMPC/MA (1:2) - we encounter further metastable phases, such as a further cubic phase, upon cooling the sample, in particular at elevated pressures -, and b) ofDPPC/PA (1:2) in excess water. 2.3 The effect of cholesterol on the high pressure phase behaviour of phospholipids Not only the nature of pure phospholipid barotropic phase transitions, but also how they are affected by the incorporation of other species (ions, local anesthetics, steroids etc.) interacting with these membranes, has attracted considerable attention (see, e.g., [4] and references therein), recently. Here, we will focus on the effects of incorporating cholesterol into phospholipid bilayers, only. Cholesterol is an integral component of mammalian cell membranes with concentrations up to about 50 mol%. We investigated static and dynamic properties of unilameUar vesicles of the common phospholipid DPPC (Tin ~ 41.5 ~ containing different amounts of cholesterol. Incorporation of more than about 5 mol% cholesterol is sufficient to suppress the pretransition, and the main transition is abolished by 50 tool% of the sterol. We used the fluorescence depolarization technique for the study of the physical state of the membrane. It utilizes the fluorescence anisotropy elicited from the probe molecule TMA-DPH embedded in the lipid bilayers [15]. The steady-state fluorescence anisotropy rss has been analyzed in terms of a structural order parameter S = of the fluorophore, which reflects the average order parameter of the lipid bilayer at the position of the fluorophore (0 _ S _ 1). The rss data of TMA-DPH in DPPC/cholesterol mixtures as a function of temperature, pressure and sterol concentration are presented in Figs. 6. rss of

26 TMA-DPH in the La phase is significantly lower than that in the gel phase of DPPC, due to the greater static and/or dynamic molecular disorder present in the fluid-like phase of the bilayer; rss is about 0.30 in the gel phase and 0.17 in the fluid phase of pure DPPC, corresponding to a marked difference in the order parameter S of 0.83 and 0.45, respectively. Increase of pressure in the fluid phase leads to an about 20 % decrease of the population of gauche conformes per kbar [25]. The incorporation of cholesterol into the DPPC bilayer reduces the disorder in the liquid-crystalline state, as can be deduced from the observed larger steady-state anisotropy values. The rigid ring system of cholesterol significantly enforces the orientational ordering of the acyl chains in their fluid-like state. Contrary to the behaviour for T>Tm, the rss values slightly decrease for T
1

,.n 0.24 [._ 020L

~

I

-,-+\

9 ooo \+\ ++

~

"''" ++++

***

t3 t3.~

147 6 ~i ~ ~ 1 7 6 1,,7o6<>], "'''''~ i

tool

+

+

~

/

o

9 20molZ

:

30 mol~ " .'

o ,0mo,

:

?o 32 34 36 as 40 42 44 4~ 48 so 52 s4 s~ s8 6o o.o o.~ o.2 0.3 o.4 o.s o.6 o.7 o.8 o.9 ~.o

T [~

p [kbar]

Figure 6. T- and p-dependence of the steady-state fluorescence anisotropy rss of TMA-DPH in DPPC/cholesterol unilamellar vesicles at different sterol concentrations. We found a center value for the fluorescence distribution of lifetimes rF of TMA-DPH of 5.8 ns for pure DPPC at 35 ~ in the gel phase, and of 3.0 ns at 55 ~ in the liquid-crystalline phase. The addition of cholesterol results in an increase in v~ in both lipid phases. It has been shown, that the excited-state lifetime is a function of the dielectric permittivity of the solvent cage [26]. As the fluorophore resides in the interfacial region of the membrane, it experiences quenching by probe-water interactions. Information on the hydration level at the location of the fluorophore position in the bilayer can thus be obtained by measurements of rF. In the La state, rF is significantly shorter, because greater static and/or dynamic molecular disorder is present in the fluid phase of the bilayer, which increases the probability of water penetration

27 into the bilayer system Incorporation of the sterol reduces the probability of water penetration into the bilayer, thus leading to longer fluorescence lifetimes. Figure 7 presents some representative data for DPPC/cholesterol mixtures at T = 58 ~ as a function of pressure up to 1 kbar. Increasing pressure results in longer fluorescence lifetimes of TMA-DPH in DPPC vesicles in their fluid-like state, rv increases slightly from 2.5 ns at 1 bar to 3.5 ns at 700 bar. At the pressure-induced fluid to gel phase transition, which takes place around 750 bar at that temperature, VF increases up to about 5.7 ns. Further increase of pressure leads to a slight increase of rF only. Addition of for example 30 mol% cholesterol causes a 2.5-fold increase of VF at atmospheric pressure. Hydrostatic pressure increase has only a small effect on fluorescence lifetime in this mixture. Above about 400 bar, r~ reaches a plateau value around 7 ns, which is slightly higher than that in the gel phase of pure DPPC.

9~7'

I'

1'

I'

I'

I'

1'

I'

I'

I'

1

8 m ..... -0- ..... E3 ..... [] ...... El- ..... :~ ..... .~._ - - e.

. . . .

~.._._.l~e.....

~ c~,5

100m~ %

- I ..... _~ ............ 20 rnol% ....~ . . . . . . - ~

~f-" ,--7 6 1

~ ~

~ . . . . ~ .......

......... ~

........ ~

~ .../~.~

....

<> ....

J. ----r . . . . ...... [] ......

30

mol

%

40 tool% 50 tool %

b_ ~

4

3

2

..... ~---.- X L

o.

0

'

I'

0.~

X ------'X~

J,

0.2

l , ' ,

0.3

1

~

I,

i , , ,

0.4 o.s 06 p [kbar]

0.7

I,

o.s

!

0.9

,

1

1.0

Figure 7. Center value rF of the fluorescence lifetime distribution of TMA-DPH in DPPC/cholesterol unilamellar vesicles as a function of pressure (T-- 58 ~ These results clearly indicate that the incorporation of cholesterol into the DPPC bilayer leads to a significant increase in hydrophibicity of the membrane. An increase in pressure up to the 1 kbar range is much less effective in suppressing water permeability than cholesterol embedded in fluid DPPC bilayers at concentration levels higher than about 10 mol% sterol. Abbreviations MA: myristic acid, PAL: palmitic acid, MO: monoolein, ME: monoelaidin, DMPC: 1,2dimyristoyl-sn-glycero-3-phosphatidylcholine (di-C 14:0), DPPC: 1,2-dipalmitoyl-sn-glycero3-phosphatidylcholine (di-C16:0), DSPC: 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (diC18:0), DOPC: 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (di-C18:l,cis), DOPE: 1,2dioleoyl-sn-glycero-3-phosphatidylethanolamine (di-C 18:1,cis), POPC: 1-palmitoyl-2-oleoylsn-glycero-3-phosphatidylcholine, (C16:0, C18:1,cis), DEPC: 1,2-dielaidoyl-sn-glycero-3phosphatidylcholine (di-C18:1,trans); DPPE: 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine (di-C16:0), DMPS: 1,2-dimyristoyl-sn-glycero-3-phosphatidylserin (di-C14:0), egg-PE: egg-yolk phosphatidylethanolamine, TMA-DPH: 1-(4-trimethylammonium-phenyl)-6phenyl-l,3,5-hexatriene, SAXS small-angle X-ray scattering, DTA differential thermal

analysis.

28 Acknowledgements We thank the Laboratory of Fluorescence Dynamics at the University of Illinois at Urbana/Champaign (U.S.A.) for the opportunity to carry out the time-resolved fluorescence measurements. The Synchrotron-X-ray diffraction experiments have been carried out at the EMBL outstation at DESY in Hamburg. Financial support from the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen lndustrie is gratefully acknowledged.

6. REFERENCES 1 C. Balny, 1L Hayashi, K. Heremans, and P. Masson (eds.), High Pressure and Biotechnology, Colloque Inseram, Vol. 224, John Libbey Eurotext, 1992. 2 G. Cevc and D. Marsh, Phospholipid Bilayers, John Wiley and Sons, New York, 1987. 3 1L Winter and J. Jonas (eds.), High Pressure Chemistry, Biochemistry and Materials Science, Kluwer Academic Publishers, Dordrecht, Netherlands, 1993. 4 IL Winter, A. Landwehr, Th. Brauns, J. Erbes, C. Czeslik, and O. Reis, Proceedings 23rd Steenbock Symposium on High Pressure Effects in Molecular Biophysics and Enzymology, Madison, 1994. 5 P.-L. G. Chong and G. Weber, Biochemistry 22 (1983) 5544. 6 P.T.T. Wong, D.J. Siminovitch, and H.H. Mantsch, Biochim. Biophys. Acta 47 (1988) 139. 7 D.A. Driscoll, J. Jonas, and A. Jonas, Chem. Phys. Lipids 58 (1991) 97. 8 P. Mariani, V. Luzzati, and H. Delacroix, J. Mol. Biol. 204 (1988) 165. 9 G. Lindblom and L. Rilfors, Biochim. Biophys. Acta 988 (1989) 221. 10 J.M. Seddon, Biochim Biophys. Acta 1031 (1990) 1. 11 M.W. Tate, E.F. Eikenberry, D.C. Turner, E. Shyamsunder, and S.M. Gnmer, Chem~ Phys. Lipids 57 (1991) 147. 12 R. Winter and W.-C. Pilgrim, Ber. Bunsenges. Phys. Chem. 93 (1989) 708. 13 M. Bfttner, D. Cell, U. Jacobs, and R. Winter, Z. Phys. Chem. 184 (1994) 205. 14 A. Landwehr and R. Winter, Ber. Bunsenges. Phys. Chem 98 (1994) 214. 15 C. Bemsdorff, R. Winter, T.L. Hazlett, and E. Gratton, Bet. Btmsenges. Phys. Chenl 99 (1995) 1479. 16 L.F. Braganza and D.L. Worcester, Biochemistry 25 (1986) 2591. 17 IL Winter and P. Thiyagarajan, Progr. Colloid. Polym. Sci. 81 (1990) 216. 18 J. Erbes, C. Czeslik, W. Hahn, M. Rappolt, G. Rapp, and R. Winter, Ber. Btmsenges. Phys. Chem. 98 (1994) 1287. 19 P.T.C. So, S.M. Gnmer, and E.S. Shyamsunder, Phys. Rev. Lett. 70 (1993) 3455. 20 E.L. Chang and P. Yager, Mol. Cryst. Liq. Cryst. 98 (1983) 125. 21 E. Shyamsunder, S.M. Grtmer, M.W. Tate, D.C. Turner, P.T.C. So, and C.P.S. Tilcock, Biochemistry 27 (1988) 2332. 22 J.M. Seddon and 1LH. Templer, Phil. Trans. R. Soc. Lond. A 344 (1993) 377. 23 C. Czeslik, R. Winter, G. Rapp, and K. Bartels, Biophys. J. 68 (1995) 1423. 24 J.M. Seddon, J.L. Hogan, N.A. Warrender, and E. Pebay-Peyroula, Progr. Colloid Polym. Sci. 81 (1990) 189. 25 O. Reis, 1L Winter, and T.W. Zerda, Biochim. Biophys. Acta, in press. 26 E. Gratton and T. Parasassi, J. of Fluorescence 5 (1995) 51.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

29

High pressure sensing and adaptation in the deep-sea bacterium Photobacterium species strain SS9. D. H. Bartlett, E. Chi, and T. J. Welch Center for Marine Biotechnology and Biomedicine, Scripps Institution of Oceanography, University of California, San Diego, La Jolla, California, U. S. A. 92093-0202 Abstract Moderate hydrostatic pressures perturb membrane-associated processes in many 0.1 MPa-adapted bacteria. Genetic studies in the deep-sea bacterium Photobacterium species strain SS9 have uncovered two membrane-associated signal transduction systems, one of which is required for the inverse regulation of two genes encoding outer membrane proteins at low and high pressure, and the other which is critical for barophilic growth. Barophilic deep-sea bacteria represent useful subjects for molecular genetic inquiries into the evolution of high-pressure-adapted life.

1. INTRODUCTION Most of the studies in this volume describe the effects of pressures greater than 100 MPa on 0.1 MPa-adapted organisms or their constituent macromolecules [1 megapscal (MPa) = 9.9 atmospheres = 10 bar]. However, it is relevant to note that pressures far below 100 MPa can also have profound effects on biological processes. For example, brief exposure of human osteosarcoma cells to 4 MPa results in changes in the subcellular distribution of cytoskeletal elements and induction of heat shock protein 70 [ 1]. Furthermore, modulation of substrate and cofactor binding affinity in some enzymes can result from exposure to pressure increases of as little as 5 MPa [2]. Another pertinent fact is that not all life has evolved in a 0.1MPa environment. The largest portion of the known biosphere is the deep sea where pressures reach as high as 110 megapascals. Within this environment a great diversity of marine fauna exist [3] which must possess mechanisms for maintaining appropriate physiological function at the pressures characterizing their habitats. Much of what is known about the influence of pressure on the evolution and distribution of marine life has come from bacteriological investigations. Deep-sea bacteria have been isolated which are barophilic (also termed piezophilic), possessing more rapid growth rates at pressures greater than 0.1 MPa [4]. Since their initial isolation in 1978 [5], numerous laboratories around the world have isolated barophilic bacteria [6-9]. The most barophilic bacterium yet obtained is an isolate from the Mariana Trench whose pressure limit for growth is 130 MPa [10]. Studies of the effects of pressure changes on bacteria are consistent with one of the principal targets of either suboptimal or supraoptimal pressure being the structural integrity and function of the cell membrane. For example, bacteria exposed

30 to moderate pressure changes are impaired in assorted transport processes, cell division, and the initiation or termination of DNA replication [reviewed in 11 ], all of which are suggestive of, or consistent with, effects on the cell membrane. Decompression of an obligate barophile was found to result in the production of intracellular vesicles and membrane fragments [12]. Pressure-induced changes in the cell membrane could stem from changes in membrane fluidity or phase. High pressure compresses lipids, resulting in increased lateral packing of acyl chains and encouragement of membrane-lipid gelation [13]. Barophilic bacteria have apparently circumvented this potential problem at elevated pressures by producing high levels of unsaturated fatty acids or polyunsaturated fatty acids (PUFAs) in their membrane lipids [14-19]. Increasing the extent of fatty acid unsaturation is believed to maintain the membrane in a functional liquid crystalline state. However, such changes may render the membranes of some barophiles vulnerable to excessive lipid fluidity at low pressures. 2.

PRESSURE SENSING AND ADAPTATION IN THE DEEP-SEA BACTERIUM PHOTOBACTERIUM SPECIES STRAIN SS9

In addition to adaptation to elevated pressure, many barophiles may need to cope with a changing pressure environment as they are moved vertically through the water column. Clues to such adaptational processes have come from investigating pressure regulation of protein production and gene expression in marine microorganisms [reviewed in 20]. In this article we describe the results of such experiments which indicate important roles for two different membrane-localized signal transduction pathways in pressure sensing and pressure adaptation in the deep-sea bacterium Photobacterium species strain SS9. SS9 is a psychrotrophic moderate barophile which grows over a temperature range of 2-20~ with a temperature optimum of 15~ and a pressure range of 1-86 MPa with a pressure optimum of approximately 28 MPa. The original studies of SS9 were undertaken upon discovering that it inversely regulates the abundance of two major outer membrane proteins (OMPs) in response to growth pressure. The 38 kDa protein OmpH increases approximately 10-fold as pressure is increased from 0.1 MPa up to the pressure optimum for growth, while the 32 kDa protein OmpL is maximally produced at 0.1 MPa, and progressively decreases at higher pressures [21-22]. The ompH and ompL genes have been cloned and sequenced and various ompH mutants have been constructed [21-24, Welch and Bartlett; manuscript in preparation]. The deduced amino acid sequence of OmpL and OmpH suggest that they both form channels (porins) across the outer membrane for the diffusion of nutrients into the cell, although these two proteins do not display similarity to one another. Western blotting using antisera directed against OmpL or OmpH indicate that OmpL-like proteins are present in many bacteria of the family Vibrioniaceae, while no bacteria other than SS9 have yet been observed to produce an OmpH-like protein. However, no barophilic bacteria have yet been tested for proteins possessing antigenic similarity to OmpH. Studies with OmpH + and OmpH- cells indicate that OmpH probably functions as a relatively nonspecific porin protein, facilitating the uptake of substrates larger than 400 daltons [24]. Although OmpH abundance increases with increasing pressure, it is not required for the barophilic growth of SS9. It has been hypothesized that OmpH is one of multiple proteins possessing overlapping functions which facilitate growth at high pressure, that it is only required for high pressure growth under certain physiological conditions, or perhaps that the pressure regulation of OmpH

31 stems from a correlation between high pressure and some other condition which prevails in the deep sea, such as low nutrient levels. This latter possibility is supported by the observation that ompH mutants are impaired in the uptake of a 410 m.w. tripeptide. Indeed, OmpH is so important in the uptake of larger substrates that in the presence of ICR191, a bacteriocidal compound of molecular weight 451, there is a strong selection for mutants which produce little or no OmpH. The phenotypes of ompL mutants are currently under investigation. Pressure regulation of ompH and ompL transcript levels is comparable to that of the OmpH and OmpL proteins [21-22, Welch and Bartlett; manuscript in preparation]. The basis for this regulation appears to be the control of ompH and ompL promoter activity rather than that of the lifespan of their transcripts. When a promoterless gene encoding the E. coli 13-galactosidase enzyme was placed under the control of the ompH or ompL promoters and crossed into the chromosome of SS9, 13galactosidase activity reflected a pattern of pressure regulation corresponding to that of the gene from which the promoter was obtained. 3.

ROLE OF THE TOXRS OPERON IN PRESSURE-REGULATED GENE EXPRESSION

The locus responsible for pressure-regulated omp expression in SS9 is the toxRS operon [Welch and Bartlett; unpublished results], toxRS operon involvement in pressure sensing was uncovered after screening SS9 mutants generated using the transposable genetic element mini-Mu [25] for those impaired in OmpL abundance. A mini-Mu transposon insertion in one locus was discovered to prevent o mpL expression and constituitively produce OmpH at low and high pressure. This locus was found to be highly homologous to the toxRS operons of Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio fischeri [26-29]. V. cholerae ToxR and ToxS proteins are cytoplasmic membrane proteins [26-27], and ToxR has the unusual property of being a transmembrane DNA binding protein [26, 30-31 ]. Most of what is known about the toxRS operon has come from studies with V. cholerae. The V. cholerae ToxR and ToxS proteins function in association with one another as an environmental sensor which controls the expression of many virulence genes in response to changes in temperature, pH, and osmolarity, as well as changes in the concentration of specific amino acids [32-33]. As with SS9, the V. cholerae ToxR and ToxS proteins are required for the inverse regulation of two OMP proteins [32]. V. cholerae ToxR/S signaling modes have been proposed to depend on whether ToxR is present in the membrane as a dimer or a monomer [27, 34-35]. ToxS is believed to perform an important role facilitating ToxR dimerization. This mode of activation/inactivation of gene expression may be similar to the observed high pressure induction of the plac and ptac promoters in E. coli [36]. Elevated hydrostatic pressure is well known to promote the dissociation of many multimeric proteins, including the Lac, Arc, and Raf repressor proteins [37-38] An interesting distinction between the SS9 toxRS genetic studies and the Lac, Arc, and Raf biophysical analyses is that in the later work the pressure needed for protein dissociation was on the order of 100 -200 MPa, whereas pressure changes of as little as 7 MPa have been observed to elicit changes in ToxR/S-mediated omp expression in SS9. The profound pressure sensitivity of the SS9 ToxR/S system could reflect a very small concentrationof ToxR/S in vivo, a very large volumechange for ToxR/S association, or that the observed pressure effects are the result of more subtle changes in ToxR/S structure than complete protein subunit dissociation. It will be

32

low pressure

high pressure

Q

'

-- ! ! ! ~

Periplasm Inner membrane

-

Cytoplasm

W

~f

[ompL] CRP CRP cAM~AMP

Figure 1. Model of ToxR/S and CRP function in the regulation of omp gene expression in SS9. The associated ToxR/S protein complex functions as both a repressor and activator of gene expression. CRP binding to ompH operator DNA removes ToxR/S repression. interesting to learn whether dissociation of the SS9 ToxR and ToxS proteins underscores pressure-regulated omp gene expression, and whether gene regulation mediated by the ToxR and ToxS proteins from non-barophilic bacteria is also similarly pressure-dependent. Another category of SS9 mutants impaired in omp pressure regulation have provided insight into both barophilicity and pressure sensing. Ethylmethane sulfonate mutagenized derivatives of the the ompH::lacZ fusion strain EC10 have been obtained which are deficient in ompH promoter activity and produce the OmpL protein constituitively at both low and high pressure [22]. Thus, these mutants have a phenotype which appears to be opposite to that of the toxR transposon insertion mutant. One of these mutants, designated strain EC1002, which was characterized in greater detail was also found to display reduced growth, particularly at elevated pressure. Beyond 60 hours of high pressure incubation mutants bearing second-site suppressor mutations began to take over the EC1002 culture. These pseudorevertants possessed growth characteristics similar to that of the original parental strain EC10. Thus, the EC1002 class of mutants were interesting both in terms of pressure sensing and high pressure adaptation. The mutation responsible for these phenotpes in EC1002 has not yet been identified, but the characteristics of these mutants are consistent with increased activity of the ToxR or ToxS regulatory proteins, or of other regulatory components within the ToxR/S signaling pathway. Another important characteristic of these mutants is that they produce less of the PUFA species eicosapentaenoic acid. This suggests that ToxR/S could control both ompH/L gene expression as well as the expression of genes required for PUFA synthesis. An alternative explanation is that these strains possess a mutation in a gene required for PUFA synthesis, which thereby decreases the fluidity of the membrane, inhibits ToxR/S dissociation, and maintains the ToxR/S complex in a form that leads to ompH repression and ompL activation. Because PUFAs are likely to be critical to homeoviscous adaptation and proper membrane fluidity and phase at high pressure, reduced PUFA content may be responsible for the barosensitive nature of these mutants.

33 The inverse pressure regulation of ompL and ompH gene expression can be uncoupled. This is apparently because in addition to ToxR/S control, ompH gene expression is also controlled by catabolite repression [39]. In other gram negative bacteria catabolite repression of many genes involved in carbon and energy metabolism has been found to operate through the cAMP receptor protein (CRP). An interesting twist in the catabolite repression of ompH transcription is that it occurs at 0.1 MPa, but not at 28 MPa, despite the fact that catabolite repression is operational in SS9 at both pressures. One possibility is that CRP binding leads to conformational changes in the ompH operator which prevents the binding of the ToxR repressor. Since ToxR is postulated to only repress ompH expression at low pressure, release of ToxR repression by CRP is only operational at low pressure. A working model depicting ToxR/S and CRP control of omp transcription in SS9 at low and high pressure is shown in Fig. 1. 4. ROLE OF THE RPOE OPERON IN HIGH PRESSURE ADAPTATION

During the course of immunoscreening transposon mutants of SS9 for clones producing reduced levels of OmpH, a new class of mutants was obtained which is proving useful in the molecular dissection of both high pressure and low temperature adaptation [40, Chi and Bartlett; unpublished results]. These mutants are altered in the abundance of numerous OMPs in addition to OmpH, and grow poorly at elevated pressures or decreased temperatures. Cloning and sequence analysis of the chromosomal locus disrupted by the transposon insertions in these strains revealed that all of the mutants possess a transposon insertion in what appears to be the third gene of a four-gene operon bearing homology to the rpoE operon of Escherichia coli. The E. coli rpoE gene encodes an alternative RNA polymerase sigma factor (designated GE) which directs the transcription of multiple genes required for resistance to various types of stresses in the extracytoplasmic compartment of the cell [41-43]. These stresses include high temperatures and chemical agents which perturb the integrity of the outer membrane. Based upon work performed on the E. coli rpoE operon and on related operons of other bacteria [44-46], the products of the downstream genes of the rpoE operon control the activity of G E in response to stresses perceived in the outer or inner membrane or within the periplasmic space. Genetic studies of the SS9 rpoE operon indicate that the last gene in the operon is necessary for high-pressure/low-temperature adaptation, and all three downstream genes are necessary for a wild type OMP profile. Because the products of the downstream genes are believed to function through modulation of GE activity, these genes have been designated rse (for regulator of GE) A, B, and C. Based upon the phenotypes of the SS9 rpoE operon mutants and the predicted localization of the rpoE operon gene products, a working model describing GE regulation in SS9 has been developed (Fig. 2). According to this model direct control of GE is exerted through RseA which resides within the inner membrane. Since SS9 rseA insertion mutants are not as deficient in OMP abundance as rseB or rseC mutants [Chi and Bartlett; unpublished results], we hypothesize that RseA may both stimulate and inhibit GE activity, with stimulation depending on signals from the RseB or RseC proteins which reside in the periplasmic space and inner membrane, respectively. In

34

~seB~ " ~ G ~

Damagedproteins lRs I eC

Periplasm Innermembrane Cytoplasm

~

e/e

High pressure adaptation Figure 2. Model of rpoE operon function in the regulation of OMP abundance and growth at high pressure. the presence of damaged proteins in the extracytoplasmic space, RseB and RseC, either working together or separately stimulate RseA to activate o E. When o E activity is high it activates the expression of a gene or a set of genes whose product(s) leads to alteration of the OMPs. In cases where activity is very high, growth at low temperature and high pressure is also inhibited. In E. coli oE controls the expression of a gene encoding a periplasmic protease [42-43]. It is possible that in SS9 the activity of a similar ~E-regulated protease controls the half lives of numerous extracytoplasmic proteins, one or more of which is critical to cell growth at low temperature and high pressure.

lJE

5. CONCLUDING REMARKS The identification of genes important for pressure-sensing and high pressure adaptation which are homologous to genes present in nonbarophilic bacteria suggests that these processes have arisen through variation on existing biochemical themes. Furthermore, as both ToxR/S and o E both regulate and are regulated by the membrane environment, appropriate functioning of this cell compartment appears to be essential to life at moderately high pressures. Additional studies are needed to elucidate the molecular basis of ToxR/S pressure sensing, along with the identification and characterization of those ToxR/S or oE-regulated genes which influence baroadaptation. Then, the significance of these sensory transduction systems and the genes they control to pressure sensing and high pressure adaptation in other microbial inhabitants of the deep sea can be addressed.

35 6. ACKNOWLEDGMENT

This work was supported by a grant from the National Institute of General Medical Sciences to D.H.B. (GM49800-01A1). 7. REFERENCES

4 5 6 7 8 9 10 11 12 13 14 15 16. 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

C.L. Haskin, K.A. Athanasiou, R. Klebe, and I.L. Cameron, Biochem. Cell Biol. 71 (1993) 361. G.N. Somero, Amer. Zool. 30 (1990) 123. M.A. Rex, C.T. Stuart, R.R. Hessler, J.A. Allen, H.L. Sanders, and G.D.F. Wilson, Nature 365 (1993) 636. A.A. Yayanos, Annu. Rev. Microbiol. 49 (1995) 777. A.A. Yayanos, A.S. Dietz, and R. Van Boxtel, Science 205 (1979) 808. J.W. Deming, P.S. Tabor, and R.R. Colwell, Microb. Ecol. 7 (1981) 85. H.W. Jannasch, C.O. Wirsen, and C.D. Taylor, Science 216 (1982) 1315. W. Liesack, H. Weyland, and E. Stackebrandt, Microb. Ecol. 21 (1991) 191. C. Kato, T. Sato, and K. Horikoshi, Biodiversity and Conservation 4 (1995) 1. A.A. Yayanos, Proc. Natl. Acad. Sci. U.S.A. 83 (1986) 9542. D.H. Bartlett, Sci. Progress 76 (1992) 479. R.A. Chastain, and A.A. Yayanos, Appl. Environ. Microbiol. 57 (1991) 1489. L.F. Braganza, and D.L. Worcester, Biochemistry 25 (1986) 7484. E.F. DeLong, and A.A. Yayanos, Science 228 (1985) 1101. E.F. DeLong, and A.A. Yayanos, Appl. Environ. Microbiol. 51 (1986) 730. K. Kamimura, H. Fuse, O. Takimura, and Y.Yamaoka, Appl. Environ. Microbiol. 59 (1993) 924. C. O. Wirsen, H.W. Jannasch, S.G. Wakeham, and E.A. Canuel, Current Microbiol. 14 (1987) 319. K. Yazawa, K. Araki, N. Okazaki, K. Watanabe, C. Ishikawa, A. Inoue, N. Numao, and K. Kondo, J. Biochem. 103 (1988) 5. K. Yazawa, K. Araki, K. Watanabe, C. Ishikawa, A. Inoue, K. Kondo, S. Watabe, and K. Hashimoto, Nippon Suisan Gakkaishi. 54 (1988) 1835. D.H. Bartlett, C. Kato, and K. Horikoshi, Res. Microbiol. 146 (1995) 697. D.H. Bartlett, M. Wright, A. Yayanos, and M. Silverman. Nature 342 (1989) 572. E. Chi, and D.H. Bartlett, J. Bacteriol. 175 (1993) 7533. D.H. Bartlett, E. Chi, and M. E. Wright, Gene. 131 (1993) 125. D.H. Bartlett, and E. Chi, Arch. Microbiol. 162 (1994) 328. J. Graf, P.V. Dunlap, and E.G. Ruby, J. Bacteriol. 176 (1994) 6986. V.L. Miller, R.K. Taylor, and J.J. Mekalanos, Cell. 48 (1987) 271. V.J. DiRita, and J.J. Mekalanos, Cell. 64 (1991) 29 Z. Lin, K. Kumagai, K. Baba, J.J. Mekalanos, and M. Nishibuchi J. Bacteriol. 175 (1993) 3844. K.A. Reich, and G.K. Schoolnik, J. Bacteriol. 176 (1994) 3085. K.M. Otteman, V.J. DiRita, and J.J. Mekalanos, J. Bacteriol. 174 (1992) 6807. D.E. Higgins, and V.J. DiRita. Mol. Microbiol, 14 (1994) 17. V.L. Miller, and J. J. Mekalanos, J. Bacteriol. 170 (1988) 2575. C.L. Gardel, and J.J. Mekalanos, Methods in Enzymol. 235 (1994) 517. K.M. Otteman, and J.J. Mekalanos, Mol. Microbiol. 15 (1995) 719. M. Dziejman, and J.J. Mekalanos, Mol. Microbiol. 13 (1994) 485.

36 36 37 38 39 40 41 42 43 44 45 46

C. Kato, T. Sato, M. Smorawinska, and K. Horikoshi, FEMS Microbiol.Lett. 122 (1994) 91. R. Jaenicke, I. Muiznieks, C. Aslandidis, and R. Schmitt, FEBS lett. 260 (1990) 233. J.L. Silva, and G. Weber, Annu. Rev. Phys. Chem. 44 (1993) 89. D.H. Bartlett, and T.J. Welch, J. Bacteriol. 177 (1995) 1008. E. Chi, and D.H. Bartlett, Mol. Microbiol. 17 (1995) 713. K. Hiratsu, M. Amemura, H. Nashimoto, H. Shinegawa, and K. Makino, J. Bacteriol. 177 (1995) 2918. P.E. Rouvi~re, A. De Las Penas, J. Mecsas, C.Z. Lu, K.E. Rudd, and C. A. Gross, EMBO J. 14 (1995)1032. S. Raina, D. Missiakas, and C. Georgopoulos, EMBO J. 14 (1995) 1043. V. Deretic, M.J. Schurr, J.C. Boucher, and D.W. Martin, J. Bacteriol. 176 (1994) 2773. M. A. Lonetto, K.L. Brown, K.E. Rudd, and M.J. Buttner, Proc. Natl. Acad. U.S.A. 91 (1994) 7573. D.W. Martin, M.J. Schurr, H. Yu, and V. Deretic, J. Bacteriol. 176 (1994) 6688.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

37

Morphological effects of pressure stress on yeasts Masako Osumi a, Mamiko Sato b, Hiromi Kobori a, Zha Hai Feng a, Sanae A. Ishijima b, Kazuhiro Hamada ~ and Shoji Shimada d aDepartment of Chemical and Biological Sciences, Faculty of Science, and bLaboratory of Electron Microscopy, Japan Women's University, 2-8-1, Mejirodai, Bunkyo-ku, Tokyo 112, Japan CFermentation and Food Research Laboratories, Oriental Yeast Co., Ltd., 3-610, Azusawa, Itabashi-ku, Tokyo 174 dplanning and Research Division, Oriental Yeast Co., Ltd. 3-8-30, Nihonbashi Honcho, Chuo-ku, Tokyo 103

Abstract To investigate the induction of polyploidy by pressure stress, the ultrastructure and microtubules of Saccharomyces cerevisiae and Schizosaccharomyces pombe were studied by conventional and immunoelectron microscopy. The nuclear membrane was disrupted even at 100 MPa and with increasing pressure mitochondria had electron-dense areas, the cytoplasmic substances changed dramatically and the cellular organelles could hardly be detected. S. pombe cells were more sensitive to low pressure stress than were S. cerevisiae cells. Immunoelectron microscopy confirmed that the microtubules were damaged by pressure stress. The damage to spindle pole bodies, microtubules and the nuclear membrane was thought to be followed by breakdown of the nuclear division apparatus and inhibition of nuclear division.

1. INTRODUCTION Our previous investigations by conventional electron microscopy related to the response of the budding yeast Saccharomyces cerevisiae [1] and the dimorphic yeast Candida tropicalis to pressure [2, 3] revealed that the membrane systems, especially the nuclear membrane, were most susceptible

38 to pressure stress even at 100 MPa. At more than 400-600 MPa, there was an additional alterations: an electron-dense matrix appeared in the organelles and cytoplasm. Under fluorescence microscopy the cell cycle-specific organization of microfilaments and microtubules was found to be altered when S. cerevisiae and both yeast and hyphal form cells of C. tropicalis were treated at 100-150 MPa. Hyphal cells were found to be more sensitive to pressure t r e a t m e n t than yeast form cells and microtubules to be more sensitive than microfilaments [2-4]. It was also demonstrated that hydrostatic pressure at 200 to 250 MPa greatly inactivated S. cerevisiae cells while inducing polyploidy at the high frequency of 15% [5]. To confirm the induction of polyploidy induced by pressure stress, the effects of pressure stress on the nucleus, in particular the microtubules, of S. cerevisiae were investigated by immunoelectron microscopic ( i m m u n o EM) examination of ultrathin frozen sections [6]. We recently found that polyploid cells of the fission yeast Schizosaccharomyces pombe were induced under lower pressure stress than those of S. cerevisiae [7]. Since the effects of pressure stress on the ultrastructure and cytoskeletal elements of S. pombe have not been reported we used fluorescence microscopy and conventional and immuno EM to study this stress on S. pombe cells. S. cerevisiae strain O-102 [ 1 ], an industrial isolate from the Oriental Yeast Co., and S. pombe strain L972 h- were used. Cells suspended in fresh YPD liquid medium were trasferred to small polyethylene bottles and placed in a high pressure apparatus, NKK-ABB, where they were treated with hydrostatic pressure of 0.1 and 3 0 - 6 0 0 MPa for l0 min at room temperature. The system of increasing pressure, holding it and decompression was automatic

[1]. The pressurized cells were fixed with glutaraldehyde and potassium permanganate, then ultrathin-sectioned by the conventional method [2]. I m m u n o EM of the specimens was performed generally according to the m e t h o d described previously [6]. The specimens were immuno-stained, stained with 3% uranyl acetate, adsorption-stained with a 0.3% uranyl acetate-3% polyvinyl alcohol mixture, and examined with a JEM 1200 EXS transmission electron microscope at 120 kV. As we describe here, the effects of pressure stress on the growth, ultrastructure and microtubules of S. pombe cells were comparable to those in S. cerevisiae cells, but fission yeast was more sensitive than the budding yeast. The involvement of microtubules in induction of polyploidy in yeasts is also discussed.

39

2 . RESPONSE OF GROWTH OF YEAST CELLS TO PRESSURE STRESS Above 100 MPa the survival curve of S. pombe cells determined by their colony-forming ability displayed a drastic decrease in proliferation and at pressures over 200 MPa the cells were almost completely inactivated (Fig. 1, ~). In S. cerevisiae, however, this ability was sharply reduced with increasing pressure only when the pressure stress exceeded 150 MPa (Fig. 1, --~) and only above 250 MPa did the cells lose all ability to proliferate. Thus S. pombe cells were more sensitive to pressure stress than S. cerevisiae cells.

I() E

8

E ,~ '

4

"3

2

L

~). I

!

!

I O0

150

I

~

200

9, 250

300

! 400

Pre ssu re ( M l ' a )

Fig. 1. Effect of hydrostatic pressure stress on colony-forming ability of S. cerevisiae and S. pombe.

3. RESPONSE OF ULTRASTRUCTURE OF S. CEREVISIAE CELLS TO PRESSURE STRESS After exposure to pressure stress the ultrastructure, especially of the nuclear membrane, of the cell began to decompose. Even at 100 MPa there was fragmentation of the nuclear membrane (Fig. 2b, ~-) in comparison with the nontreated cell (Fig, 2a). With increasing pressure the damage to the nuclear membrane became more drastic (Fig. 2c, d) and above 400 MPa the inner structure of the cells was strikingly affected (Fig. 2e, f, ~-). The ultrastructural changes in microtubules in pressure-stressed cells were studied in more detail by immuno EM. In the cell without pressure treatment, a-tubulin was identified unambiguously with 10-nm colloidal gold particles

40 (~-- in Fig. 3a) conjugated with goat anti-rat IgG. Bundles of the fine filamentous structures of microtubules ( ~ ) crossed between the two spindle pole bodies (SPBs) in the nucleus. Most of the gold particles were located on these bundles (Fig. 3a). At 100 MPa bundles of microtubules together with the gold particles were visible in the nucleus; however the SPBs had disappeared. At 150 MPa gold particles, (~-) were seen in the nucleus, although the filamentous structure of the microtubules had disappeared (Fig. 3b). The nuclear membrane in several portions was also disrupted. At 200 MPa there were fewer gold particles and they were scattered throughout the nucleus; the electron-dense areas ( , ) became visible in the nuclear matrix (Fig. 3c). At 300 MPa most of the subcellular structure was disrupted and profuse electron dense areas had formed in the cytoplasm. These electrondense materials are assumed to be denatured proteins resulting from pressure stress, and were also observed in the pressurized cells of Candida tropicalis [2, 3]. To determine the involvement of the nuclear division machinery in the formation of polyploid cells, the recovery of the ultrastructure of the cells was examined by incubating the pressurized cells (0.1, 100, 150, 200, and 250 MPa, 10 min). When the cells pressureized at 200 MPa were transferred to fresh medium for 24 h, most of them did not completely recover. When the cells were pressurized at 150 MPa, all the microtubules disappeared and none of them were seen during the 8-h recovery period. However after 24 h, gold particles were present in the complete assembly of the microtubules and SPBs were also visible (Fig. 3d). Sometimes the profile of SPB was abnormal because it was depressed inside the nucleus, and the bundles of microtubules (-~) spread out in different directions from a single SPB (Fig. 3e). All cells pressurized at 100 MPa recovered normal profiles of the microtubules. Immuno EM observation of the frozen thin sections of cells confirmed that microtubules disappearing as a result of pressure stress can fully recover after the release of pressure and incubation in fresh medium for 24 h. Sometimes, abnormal location of SPB with abnormal arrangement of microtutules was observed in the matrix of the nucleus as shown in Fig. 3e. This abnormal location of an SPB might be brought about by breakdown of the nuclear membrane and spindle by pressure stress. These SPBs might induce poliploid cells. Fluorescence microscopic study of microtubules and microfilaments revealed that the cytoskeleton was one of the most susceptible elements to hydrostatic pressure in the subcellular structure of S. cerevisiae [4]. The changes in microtubules caused by pressure stress induced the inhibition of nuclear division in S. cerevisiae because the major components of the nuclear division

41 machinery such as spindle microtubules and SPB were severely damaged by pressure stress. It is well established that the nuclear membrane does not break down during the nuclear division in yeasts [8]; this membrane is therefore closely involved in the positioning of SPB and in the elongation of this spindle in this organism during mitosis. Damage to microtubules, SPB and the nuclear membrane would thus affect mitosis, causing the cells to be incapable of growth.

4 . RESPONSE OF ULTRASTRUCTURE OF S. POMBE PRESSURE STRESS

CELLS TO

The normal ultrastructure of organelles was seen in cells not exposed to pressure stress (Fig. 4a). After treatment at 100 MPa, however, the nuclear membrane was damaged and fragmented (Fig. 4b, ~-), and this was the most severely damaged of all the yeasts we observed [2, 3, 6]. At 150 MPa the matrix of the mitochondria had an electron-dense area (Fig. 4c, ~-). At above 250 MPa the cytoplasmic substance changed dramatically (Fig. 4d); the cellular organelles could hardly be detected and the fragmented nuclear membrane (~-) was barely visible. This damaged profile was similar to that of other yeast cells, but S. pombe cells were more affected at low pressure than were S. cerevisiae and C. tropicalis cells. It is worth noting that electron-dense areas similar to those in the mitochondrial matrixes of S. pombe cells (150 MPa) were detected when S. cerevisiae cells were exposed to pressure stress [2, 3], heat stress, ethanol, or hydrogen peroxide stress [9]. These studies indicate that a change induced by pressure stress and other types of stress results in a similar phenomenon at the ultrastructural level. In immuno EM most of the gold particles (~-) for anti a-tubulin were present in the nucleus in nonpressurized cells although the microtubules ( ~ ) w e r e barely discernible in the nucleus (Fig. 5a). In the cells without deposits of colloidal gold particles in the nucleus, cytoplasmic microtubules, were seen only in the cytoplasm (Fig. 5b). Ultrastructural characteristics of microtubules and deposits of colloidal gold particles were not affected when cells were exposed to less than 50 MPa (Figs. 5c, d). At 100 MPa the two types of microtubules were hardly visible. Only a small prcentage of the cells showed an abnormal a-tubulin localation (Fig. 5e, ,--) and most displayed no gold particles. Fluorescence microscopy revealed that both microtubules and microfilaments of S. pombe were more susceptible to pressure than those of S. cerevisiae [4]. Electron microscopic observation of ultrastructure and microtubules also indicated that S. pombe cells were damaged more severely than S.

42 cerevisiae. The colony-forming ability of S. pombe was lost at lower pressure than that of S. cerevisiae. Thus S. pombe cells were found to be more sensitive than S. cerevisiae cells to hydrostatic pressure. The damage to microtubules and the nuclear membrane caused by pressure stress induced inhibition of nuclear division in S. pombe because the major components of the nuclear division machinery such as spindle microtubules was severely damaged by this stress. This membrane is therefore closely involved in the elongation of the spindle during mitosis, making the cells incapable of growth. Damage to and disappearance of spindle microtubules induced by pressure stress in S. pombe would also lead to the induction of polyploidy, as in the S. cereviseae. We demonstrated in this study that induction of polyploidy in S. cerevisiae is accompanied by the breakdown of spindle microtubules and their reassembly. Therefore, the induction of polyploid cells by pressure stress apparently occurs widely in yeasts and eukaryotes [ 10, 11 ].

5 . REFERENCES 1

S. Shimada, M. Ando, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biothechnol., 40 (1993) 123. 2 M. Osumi, N. Yamada, M. Sato, H. Kobori, S. Shimada and R. Hayashi, In High Pressure and Biotechnolgy. (eds. C. Balny, R. Hayashi, K. Heremans and P. Masson) Colloque INSERM/224 John Libbey Eurotext, Ltd, 1993. 3 M. Sato, H. Kobori, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 131 (1995) 11. 4 H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, In High Pressure Bioscience and Biotechnology, (eds. R. Hayashi) Elsevier. Amsterdam, 1996. 5 K. Hamada, Y. Nakatomi, S. Shimada, Curr. Genet., 22 (1992) 371. 6 H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 132 (1995) 253. 7 K. Hamada Y. Nakatomi, M. Osumi and S. Shimada, FEMS Microbiol. Lett., 132 (1996). 8 B. Bayers and L. Goetsch, J. Bacteriol., 124 (1975) 511. 9 D.L. Webster and K. Watson, Yeast, 9 (1993) 1165. 10 P. Noviok, B. C. Osmond and D. Bostein, Genetics, 121 (1989) 659. 11 H. Onozato, Aquaculture, 43 (1984) 91. Key to abbreviations M, Mitochondrion; N, Nucleus; NM, Nuclear membrane; NP, Nuclear membrane pore; SPB, Spindle pole body; V, Vacuole.

43

Fig. 2. Transmission EM (TEM) images of conventional thin sections of S. cerevisiae cells untreated (a) and treated with hydrostatic pressure at 100 (b), 200 (c), 300 (d), 400 (e) and 600 (f) MPa.

44

Fig. 3. Immuno TEM images of frozen thin sections of S. cerevisiae cells untreated (a) and treated with 150 (b) and 200 (c) MPa of hydrostatic pressure and recovery of cell pressure stress at 150 (d, e) MPa after incubation for 24 h.

45

Fig. 4. TEM images of conventional thin sections of S. pombe cells untreated (a) and treated with hydrostatic pressure at 100 (b), 150 (c) and 250 (d) MPa.

46

Fig. 5. Immuno TEM images of frozen thin sections of S. pornbe cells untreated (a, b) and treated with hydrostatic pressure at 50 (c, d) and 100 (e) MPa.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 1996 Elsevier Science B.V.

47

Biological analogy b e t w e e n hydrostatic pressure and temperature. H. Iwahashi, K. Obuchi, S. Fujii, K. Fujita, and Y. Komatsu National Institute of Bioscience and Human Technology Higashi 1-1, Tsukuba, Ibaraki 305, Japan

Abstract The biological analogy between hydrostatic pressure and temperature was studied. The heat shock treatment conferred tolerance toward the damage caused by hydrostatic pressure (barotolerance) in addition to that by high temperature. However hydrostatic pressure shock response was not observed under the conditions of hydrostatic pressure (60-120MPa for lh) corresponding to heat shock temperature (43~ for lh). Thus we considered that hydrostatic pressure and temperature are not the same factors for Saccharomvces cere~4si~e, but the damages caused by these physical factors are very similar. To clarify this point, we next examined the barotolerance and thermotolerance of the mutant strains which lacked the ability to accumulate trehalose and hsp104. Both mutants showed lower barotolerance and thermotolerance than their control strains. Thus, trehalose and hspl04 are important factors for barotolerance and for thermotolerance

1. INTRODUCTION Hydrostatic pressure affects almost all physiological activities in living cells. Bett and Cappi (1) studied the viscosity of water as a function of pressure up to 10,000kg/cm. They found that relative and absolute viscosities decrease with an increase from zero to 2,000kg/cm in pressure at ambient temperature (1). Decreased viscosity due to high pressure results in destruction of hydrogen bonding, which has also been reported for the results based on increase in temperature (1). Thus the effects of high temperature and high hydrostatic pressure may be analogous for organisms. On the basis of this theory, new technology which uses hydrostatic pressure instead of high temperature has developed in the food industry (2). However, from the biological aspect, the basic research on the effect of hydrostatic pressure on living cells or on the analogy between hydrostatic pressure and high temperature has not been accumulated (2). On the other hand, more is known about the response and the damage to living cells by high temperature. When yeast cells are exposed to a temperature slightly more than that

48 optimum for growth or enter a stationary phase of growth, the synthesis of heat shock proteins (hsp) and trehalose is enhanced, and they acquire the ability to survive under conditions much higher than the optimum temperature (3, 4). Trehalose can also be a protectant when yeast cells are exposed to temperature extremes, and strong correlation between the trehalose content and thermotolerance is observed (5). Although thermotolerance is complicated and comprises many factors, so far hspl04 and trehalose are the factors that are genetically confirmed to contribute to thermotolerance in yeast (6,7). Using Saccharomyces cerevisiae as a model system, we have been studying the analogy between hydrostatic pressure and temperature. In this report we will show and disscus the biological anaology between hydrostatic pressure and high temperature.

2. MATERIALS AND METHODS 2.1. Strains The yeast Saccharomyces cercvisiae IFO-1()149 (MATa sle-VC9 adel canl his3 leu2 llpl ~u-a3) was an indicator strain and a parent strain for mutant isolation. ~104-LEU+ (AL4Ta canl ade2 his3 leu2 tlpl lu-',z3 JIO4--LEU2+) is a H S P I 0 4 disrupted strain kindly provided by S. Lindquest with its control strain, W3()3aLEU2+ ( M A T a canl ade2 his3 LEU2+ tlpl tua3) . 224A-12D ( M A T e his4 leu2 ur',z3 Trehalose-) is the mutant which has a decreased ability to accumulate trehalose at less than 10% of its parent strain, 144-3A

(MA T;~ his4 leu2 ina3), kindly provided by De Virgilio. 2.2. Growing condition and estimation of barotolerance and thermotolerance

The yeast cells were routinely grown in YPD medium (8) (2%(w/v) peptone, 1% (w/v) yeast extract, 2% (w/v) glucose). Barotolerancc and thermotolerance were estimated according to Iwahashi et al. (8).

3. RESULTS AND DISCUSSION 3.1. Barotolerance is induced by heat shock treatment. Physically, we can acccpt thc idca that hydrostatic prcssurc and tcmperature are analogues. From the biological aspect, this idea could also bc acceptable. If so, barotolerance could be induced by heat shock treatment. Table 1 shows the effect of heat shock treatment on barotolerance and thermotolerance. After incubation at 43~ for 3()min, yeast cells showed 400 times higher thermotolerance and 900 times higher barotolerance, and the induced tolerance was inhibited by the addition of a protein synthesis inhibitor, cyclohcximide (8.9). These results clearly show that barotolerance is induced by heat shock treatment. Thus, we may' accept the idea of analogy between hydrostatic pressure and temperature.

49 Table 1 Effect of heat shock treatment on the induction of barotolerance (150MPa, 6()min) and thermotolerance (50 ~C, 10 min). Condition 30 ~ C, 30 ~ 43 ~C, 43~

Ban)tolerance

30min 30min + cycloheximide (100/~ g/ml) 30rain 30min + cycloheximide (10()/z g/ml)

Thermotolerance

().()42" ().()36

().1() ().()36

37.2 1.75

39.1 ().12

a, Tolerance, %CFU = (CFU of stressed cells / CFU of unstressed cells) X 100

3.2. Pressure shock response

The induction of barotolerance by heat shock treatment suggests the possibility that temperature and hydrostatic pressure are not only analogues but also the same environmental factors for yeast. If so, a pressur shock treatment must induce

A

100

/

A

I.L.

010

0

i

0

>

in

(D

0 l

l

60 42

l 100 44

,

i (~

i

Pressure

Fig. 1

"

l)

0

l/I

if

l

10

-

0

1 4 0 MPa 0 46

B

O O

c~

0.1

| 100

|

0

0

l

I

60

100

o C 30

40

and

Temperature

45

1

-0.1

t

I MPa ~

Hydrostatic pressure respose of yeast.

(A) Effect of hydrostatic pressure and temperature to the survival of yeast cells. Survivals after the hydrostatic pressure treatment ( O ) and the heat shock treatment (Q)).(B) Hydrostaticpressure response and heat shock response of yeast cells. Thermotolerance by hydrostatic pressure response ( O ) and heat shock response (@',).

50 thermotolerance. As the first step, we tried to define the pressure shock conditions corresponding to heat shock conditions (43 ~ under the assumption that pressure and temperature are the same environmental factors. Fig. 1A shows the survival curves after the treatments under various pressure and various temperature conditions for lb. Under the assumption, we could consider that pressure and temperature cause the same degree of damage to yeast, thus by fixing survival curves (Fig. 1A) we determined that a temperature of 43~ corresponded to a hydrostatic pressure from 60 to 120MPa. Under the pressure conditions from 60 to 120MPa, yeast cells were incubated for lh in YPD medium and the induced thermotolerance was determined (Fig. 1B). Compared to induced thermotolerance by heat shock treatment, induced thermotolerance by pressure was very small (Fig. 1B). The induction of hspl04 was not observed on pressure shock treatment (10) either. This result clearly shows that pressure and temperature are not same environmental factors for yeast. However, this does not deny the pressure shock response under unknown conditions. Recently, the induction of hsp104 (11) and the acidification of vacuole (12) were reported under the pressure less than 100MPa. 3.3. Barotolerance and thermotolerance Hydrostatic pressure and temperature are not the same environmental factors but barotolerance is induced by heat shock treatment. This suggests that the damages caused by these two factors are similar. To confirm this possibility, we monitored barotolerance and thermotolerance during heat shock and recovery conditions (13) and during the growing conditions in batch culture. Under recovery conditions both tolerance was similaly decreased and under growing conditions both tolerance showed similar features (high tolerance in the stationary phase and low tolerance in the logarithmic phase) (13). Furthermore, we isolated barotolerant mutants and determined the barotolerance and thermotolerance of these mutants. As shown in Table 2, all the mutants showed higher barotolerance and thermotolerance than the parent strains. These results suggest that hydrostatic pressure is like high temperature stress in the damage it causes to yeast.

Table 2. Tolerance of barotolerant mutants. Tolerance of exponential phase yeast cells were monitored as described in the text. Parent Baro. Thermo.

0.008

0.049

CWG2 CWG3 CWG4 CWG5 CWG7 CWG8 CWG9 CWG10 ~'

2.8

0.53

0.78

1.5

0.21

0.13

0.91 0.50

1.4 0.47

2.9 6.4

0.38 0.17

a, Tolerance, %CFU = (CFU of stressed cells / CFU of unstressed cells) X 100

1.5 0.25

51 3.4. Barotolerance is dependent on both trehalose and hspl04. Because thermotolerance is dependent on trehalose and hspl04 (6,7), it is interesting to analyze the contribution of these factors to barotolerance. We determined the barotolerance and thermotolerance of the trehalose deficient mutant, the hspl04 disrupted mutant, and their control strains (Table 3)(14). The barotolerance and thermotolerance of these strains are shown in Table 2. The trehalose deficient mutant showed a lower barotolerance and lower thermotolerance with logarithmic phase cells, heat shocked cells, and stationary phase cells than its parent strain. The hspl04 disrupted mutant also showed lower barotolerance and lower thermotolerance in the three states than its control strain. Both mutants showed increased thermotolerance with heat shock treatment and in the stationary phase and these increased ratios were parallel to those of the control strains. However, in barotolerance, the trehalose deficient mutant showed a lower increase with heat shock treatment and in the stationary phase. Induced tolerance of the trehalose deficient mutant is mainly depend on hspl04 and that of hspl04 disrupted mutant is mainly dependent trehalose. Thus, it is possible that trehalose is more important for induced barotolerance than that for thermotolerance (14).

Table 3. Barotolerance and thermotolerance of the mutants Strain

144-3A

224A-12D

W3()3aLEU2+

~ I()4-LEU+

Barotolerance L.P.C. 5.6" H.S.C. 15 S.P.C. 27 Thermotolerance L.P.C. 9.2 H.S.C. 64 S.P.C. 69

1.6 2.0 3.2 0.31 1.5 2.1

1.5 11 12 5.1 12 54

0.17 1.7 8.8 0.12 0.84 5.5

a, Tolerance, %CFU = (CFU of stressed cells / CFU of unstressed cells) X 100

3.5 Conclusion We defined that hydrostatic pressure and temperature are not the same environmental factors but are analogues from the biological aspect. The analogy is in the damage caused by these environmental factors. However, it is true that there are some differences between the damages caused by these two factors. It seems that trehalose is more important for protection against pressure damages than hspl04 is. To study the reason why trehalose is more important would contibute to understanding of the analogy of hydrostatic pressure and temperature from the biological aspect.

52 4. ACKNOWLEDGEMENT Authers thank Dr. S. Lindquest and Dr. De Virgilio for },cast strains.

5. REFERENCES 1 2 3 4 5 6 7 8 9 10 11 12 13 14

K.E. Bett and J.B.Cappi, Nature 207 (1965) 6202. R. Hayashi, Use of High Pressure In Food (1989) 1. P.W. Piper, FEMS Microbiol. Rev. 11 (1993) 339. E.A. Craig, B.D. Gambill, and R.J. Nelson, Microbiol. Rev. 57 (1993) 402. T. Hottiger, T. Boller, and A. Wiemken, FEBS Lctt. 220 (1987) 113. Y.E. Sanchez, and S. Lindquest, Science 248 (1990) 1112. C. De Virgilio, T. Hottiger, J. Domingez, T. Bollcr, and A. Wiemken, Eur. J. Biochem. 219 (1994) 179. H. Iwahashi, S.C. Kaul, K. Obuchi, and Y. Komatsu, FEMS Microbiol. Lctt. 80 (1991) 325. Y. Komatsu, K. Obuchi, H. Iwahashi, S.C. Kaul, M. Ishimura, G.M.Fahy, and W.F. Rail, Biochem. Biophs. Res. Comm. 174 (1991) 1141. H. Iwahashi, K. Obuchi, S. Fujii, S.C. Kaul, and Y. Komatsu, High Pressur Bioscience (1994) 136. M. Miyashita, K. Tamura, and H. Iwahashi, Prog. Anest. Mech. 3 (1995) 422. F. Abe and K.Horikoshi, FEMS Microbiol. Lett. 130 (1995) 307. H. lwahashi, S. Fujii, K. Obuchi, S.C. Kaul, A. Sato, and Y. Komatsu, FEMS Micmbiol. Lett. 108 (1993) 53. H. Iwahashi, K. Obuchi, S. Fujii, and Y. Komatsu, Microbiol. (in press).

Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

R.

Vacuolar acidification under high pressure in Saccharomyces cerevisiae

53

hydrostatic

Fumiyoshi Abe and Koki Horikoshi The DEEPSTAR Group, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka 237, Japan

Abstract The yeast vacuole is an acidic organelle involved in cellular ion homeostasis and degradation of proteins. Hydrostatic pressure promoted the acidification of the yeast vacuoles. A pressure of 40 to 60 MPa reduced the vacuolar pH by 0.2 pH units, defined using 6-carboxyfluorescein (6-CF). Bafilomycin A1, a specific inhibitor of vacuolar H+-ATPase (V-H+-ATPase), caused a significant alkalization of the vacuoles. Meanwhile, vacuolar accumulation of the weak base quinacrine was increased by a pressure of 40 MPa, suggesting that uptake of the dye was induced by the increased pH gradient across the vacuolar membrane.

1.

INTRODUCTION

Hydrostatic pressure has a great influence on the biological functions and viability of living organisms [1, 2, 3]. In the yeast Saccharomyces cerevisiae, high hydrostatic pressure above 100 MPa induces cytoplasmic petite mutation [4], and tetraploid or homozygous diploid forms [5]. A short duration of heat shock induces barotolerance allowing the cells to survive at 150 MPa [6]. However, few data have been reported on the physiological or biochemical effects at moderate or nonlethal hydrostatic pressure below 100 MPa. The vacuolar compartment of yeast cells contains a large quantity of hydrolytic enzymes, and plays an important role in the degradation of cellular proteins and the storage of amino acids, carbohydrates, polyphosphates and ions [7, 8]. The vacuole is an acidic organelle, maintaining the low pH through the function of vacuolar H+-ATPase (V-H +ATPase) on its membrane. [9, 10]. Acidification of vacuoles is essential for the activity of vacuolar enzymes, protein transport, and cytosolic homeostasis [8, 11, 12]. In this study, we describe the effect of hydrostatic pressure on vacuolar acidification.

54 2. M A T E R I A L S AND METHODS

2.1. Yeast strains and culture conditions The yeast strains used in this study were Saccharomyces cerevisiae IFO 2347 (Sake yeast, kyokai No. 7), X 2180 and ATCC 60782 (Killar group K1). Cells were grown at 24 o c in YPD broth (2 % w/v Bactopeptone, 1 % w/v Yeast extract, 2 % w/v glucose) in 100 ml Erlenmeyer flasks on an orbital shaker at 150 rpm. 2.2. Application of hydrostatic pressure Cells from the logarithmic phase of growth (0.5 - 2.5 x 107 cells m1-1) were placed in plastic tubes. After sealing with parafilm, the tubes were put into titanium pressure vessels (Rigo-sha, Co., Tokyo) and were subjected to hydrostatic pressure. The required hydrostatic pressure was reached within 1 minute. 2.3. Vacuole labeling with fluorescent dyes 6-CFDA and quinacrine were used to label yeast vacuoles in YPD containing 50 mM citric acid (pH 3.0), and YPD containing 50 mM N a 2 H P O 4 (pH 7.6), respectively [13, 14]. The final concentration of 6-CFDA was 10 ~M, and that of quinacrine was 1 raM. Cells were incubated with each dye for 1 hour at atmospheric or high hydrostatic pressure. The labeled cells were immediately cooled on an ice, collected by centrifugation, and washed three times in MHG buffer (50 mM MES, 50 mM HEPES 50 mM KC1, 50 mM NaC1, 110 mM glucose, pH 6.0). 2.4. Fluorescence analysis The labeled cells were analyzed using a CAF-110 fluorometer (Jasco, Co., Tokyo). Vacuolar pH was determined as described by Preston et al. [13]. In the vacuolar pH assay, strain IFO 2347 was found to be the most useful strain, because of the high accumulation of 6-CF in its vacuoles. Fluorescence emissions of 540 nm were measured when cells were excited at 458nm and 488 nm. The fluorescence ratio (emission with 488 nm excitation / emission with 458 nm excitation) of the 6-CF-labeled cells was calculated and checked against calibration curves. In vitro calibration curves of 6-CF fluorescence were determined with 0.25 ~M 6-CF in MHI buffer (50 mM MES, 50 mM HEPES, 50 mM KC1, 50 mM NaC1, 0.2 M ammonium acetate, 10 mM NAN3, 10 mM 2-deoxyglucose, 50 pM carbonylcyanide mchlorophenyhydrazone) at specified pHs. In vivo calibration curves were determined by equilibrating vacuolar pH of labeled cells to that of external pH in MHI buffer at specified pHs [13]. Quinacrine-labeled cells (108 cells m1-1 in MHG buffer, pH 6.0) were excited at 450 nm, and the emitted fluorescence of 540 nm was measured (arbitrary units). In order to determine the increases in vacuolar accumulation of quinacrine by hydrostatic pressure, the fluorescence emission at atmospheric pressure was

55 subtracted from the emission at each pressure. Each experiment was done at least three times.

3. RESULTS AND DISCUSSION 3.1 Vacuolar acidification under high pressure Fig. 1 shows the 6-CF labeled cells observed under confocal laser microscope (MRC-1000, BIO-RAD). 6-CF was exactly localized in the vacuoles.

Fig. 1

Localization of 6-CF in the yeast vacuoles.

Vacuolar pH was determined by measuring the fluorescence ratio of 6-CF labeled cells [13]. At atmospheric pressure, the vacuolar pH of strains IFO 2347, X 2180 and ATCC 60782 were 6.05 (SD=0.05), 6.44 (SD=0.05) and 6.32, respectively. These values were similar to a previous report [13]. Application of hydrostatic pressure for 1 hour promoted vacuolar acidification in strain IFO 2347 (Fig. 2 A). The vacuolar pH of the cells incubated at 40 MPa and 60 MPa fell to 5.88 (SD=0.03) and 5.88 (SD=0.04), respectively. Similar changes were also demonstrated with strain X 2180 (Fig. 2 B) and ATCC 60782 (Fig. 2 C). It has been shown that the acidification of vacuoles is mediated by VH+-ATPase on the membrane [9, 10].

3.2. The effect of bafilomycin A1 on vacuolar acidification Bafilomycin A1 is a specific inhibitor of the V-H+-ATPase of isolated organelles and yeast vacuoles, eliminating the pH gradient across the vacuolar membrane. To test whether the decrease in vacuolar pH under

56 A 5.8 -r t..

.

t~ >

X2180

6.2-

6.2

5.9 6.3-

0 :D ro

6.1

6.1 "

IF02347

6.3

6.0 6-4 i

6.1

Fig. 2

0

9

i

-

i

.'

l"-

!

-

!

9

|

-

10 20 30 40 50 60 70

pressure(MPa)

6.5

. . . . . . . . .

0

'. . . .

'~

10 20 30 40 50 60 70

pressure(MPa)

6.4

0

10 20 30 40 50 60 70

pressure(MPa)

Vacuolar pH under hydrostatic pressure.

hydrostatic pressure was mediated by V-H+-ATPase, the strain X 2180 was incubated with or without bafilomycin A1. 1.0-20.0 laM of bafilomycin A1 caused a significant alkalization of vacuoles at both atmospheric pressure and a pressure of 40 MPa, however, the vacuolar pHs were different with each other (Fig. 3). The pH rose to 7.34 at atmospheric pressure, while it rose to 6.84 at 40 MPa, with maximal effect at 2.5-5.0 laM of bafilomycin A1. 6-CF was exactly localized in vacuoles of the strain X 2180 in the presence of bafilomycin A1 under both hydrostatic pressures (data not shown).

Fig. 3 Effects of bafilomycin A1 to vacuolar pH under hydrostatic pressure.

Fig. 4 Possible model for pressureinduced acidification of the yeast vacuole

57 Indeed, V-H+-ATPase dependent proton transport plays a principal role in vacuolar acidification under high hydrostatic pressure, there are other possibilities to elucidate the decrease in vacuolar pH; proton antiport mechanisms, such as amino acids/H + antiport [7] and Ca 2 +/H + antiport [15], could be slowed down, or the proton permeance characteristics of vacuolar membranes may be changed by hydrostatic pressure. It has been shown that chloride salts stimulated ATP-dependent acidification in isolated yeast vacuoles [16]. We preliminarily obtained a result that addition of 100 mM of chloride salts in YPD broth decreased the vacuolar pH by 0.1-0.2 units in the strain IFO 2347. It is likely that hydrostatic pressure inhibited an efflux of C1-from the cells, causing an increase in cytosolic C1-. This might stimulate V-H+-ATPase, resulting in a promoted uptake of cytosolic protons into the vacuoles. Meanwhile, hydrostatic pressure inhibited proton extrusion of plasma membrane in both strains IFO 2347 and X 2180, which might cause the cytosolic acidification (data not shown). In hepatocytes, V-H+-ATPase makes an important contribution to the regulation of the cytosolic pH [17]. To maintain the cytosolic pH, the yeast vacuole may serve as a proton sequestrant under high hydrostatic pressure (Fig. 4). 3.3. Quinacrine accumulation under high hydrostatic pressure The weak base quinacrine accumulates in acidic organelles, depending on the pH gradient across the membrane [14]. We analyzed the effect of high pressure on vacuolar uptake of quinacrine. At atmospheric pressure, fluorescence emissions of quinacrine-labeled cells (108 cells m1-1 in MHG buffer, pH 6.0) were 468.4 (arbitrary units, SD=114.3), 167.2 (arbitrary units, SD=14.2) and 104.1 (arbitrary units) in the strains IFO 2347, X 2180 and ATCC 60782, respectively. Fig. 5 shows the increases in vacuolar fluorescence of the cells under hydrostatic pressure. The accumulation of quinacrine was A

B

C 150

IF02347

400

X2180

ATCC60782

r

|L

200"

300

~

100

0

._~

200

100-

50

e.-

9

0

I

"

I

10 20

"

I

"

I

30 40

I

50

pressure(MPa)

I

60

70

OI 0

10 20

, . , . , . 30 40 50 60 70

pressure(MPa)

0-0

, 9, 10 20

9. . . . . . 30 40

50 60

'

70

pressure(MPa)

Fig. 5 Increase in vacuolar accumulation of quinacrine under hydrostatic pressure.

58 greatly increased by elevated hydrostatic pressure. No difference was observed in the localization of the dye at all pressures. The reason for low accumulation of the dye at 60 MPa in strains IFO 2347 and X 2180 is still unclear. It is likely that a fluidity of plasma membrane or vacuolar membrane was decreased under high pressure. Enhanced accumulation of the weak base strongly confirmed the pressure-induced acidification of the yeast vacuoles.

4. R E F E R E N C E S

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

A.M. Zimmerman and D. Marsland, (1964) Exp. Cell Res. 35, 293-302. J.V.Landau, (1970) In High Pressure Effects on Cellular Processes (ed. A.M. Zimmerman), pp.45-70. New York and London: Academic Press. H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, (1995) FEMS Microbiol. Lett. 132, 253-258. M.P. Rosin and A.M. Zimmerman, (1977) J. Cell Sci. 26, 373-385. K. Hamada, Y. Nakatomi and S. Shimada, (1992) Curr. Genet. 22, 371376. H. Iwahashi, S.C. Kaul, K. Obuchi and Y. Komatsu. (1991) FEMS Microbiol. Lett. 80, 325-328. T. Sato, Y. Ohsumi, Y. Anraku, (1984) J. Biol. Chem. 259, 1150511508. K. Kitamoto, K. Yoshizawa, Y. Ohsumi and Y. Anraku, (1988) J. Bacteriol. 170, 2687-2691. Y. Kakinuma, Y. Ohsumi and Y. Anraku, (1981) J. Biol. Chem. 256, 10859-10863. E. Uchida ,Y. Ohsumi, Y. Anraku, (1985) J. Biol. Chem. 260, 10901095. M. Latterich and M.D. Watson, (1991) Mol. Microbiol. 5, 2417-2426. D.J. Klionsky, H. Nelson and N. Nelson, (1992) J. Biol. Chem. 267, 3416-3422. R.A. Preston, R.F. Murphy and E.W.Jones, (1989) Proc. Natl. Acad. Sci. USA 86, 7027-7031. L.S. Weisman, R. Bacallao and W. Wickner, (1987) J. Cell Biol. 105, 1539-1547. Y. Ohsumi, and Y. Anraku, (1983) J. Biol. Chem. 258, 5614-5617. Y. Wada, Y. Ohsumi and Y. Anraku, (1992) Biochim. Biophys. Acta 1101, 296-302. S.J. Wadsworth and G.D.V. van Rossum, (1994) J. Mem. Biol. 142, 2134.

R. Hayashi and C. Balny (Editors), HighPressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

59

Gene expression under high pressure Chiaki Kato and Koki Horikoshi The DEEPSTAR Group, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka, 237, Japan Abstract High hydrostatic pressure affects gene expression in microorganisms and three types of responses have been recognized: 1) high pressure-inducible, 2) pressure tolerant (independent), and 3) high pressure-repressible. Our observations suggest that mainly types 1) and 2) occur in deep-sea bacteria adapted to high pressure conditions (barophilic and barotolerant bacteria), however, in addition, type 3) occurs in Escherichia coli adapted to atmospheric pressure conditions. Our results are consistent with the hypothesis that high pressure-inducible and pressure tolerant gene expression is an ancient evolutionary trait which is shared by many bacteria.

1. INTRODUCTION The deep-sea bottom is a special world subject to extremely high pressure and low temperature. Organisms living in the deep-sea have adapted to this extreme environment, in part through the development of high pressure dependent mechanisms for the control of gene expression. It has been suggested that life may have originated in the deep-sea about 3.5 to 4 billion years ago, away from the damaging effects of ultraviolet light. Thus, the study of deep-sea microorganisms may enhance our understanding of particular adaptations to abyssal and hadal ocean realms, but also may provide valuable insight into the origin and evolution of life. Few studies have been undertaken concerning the effect of high pressure on gene expression, and we have reviewed them recently [ 1]. To investigate the mechanisms of adaptation to high pressure in the deepsea, several high pressure adapted bacteria were isolated in our laboratory from deep-sea mud samples obtained by the Japanese deep-sea manned submersible, SHINKAI 6500 [2]. Some of the isolated bacteria grow better at high pressure than at atmospheric pressure, and accordingly these are defined as barophilic bacteria. Others were high pressure tolerant bacteria, defined as barotolerant bacteria. All of these barophilic and barotolerant bacteria belong to the Proteobacteria y-subgroup as indicated by 16S ribosomal DNA analysis

60 [3-5]. These results are not surprising since Deming et al. [6] have reported that the obligately barophilic bacterium Colwellia hadaliensis belongs to the Proteobacteria y-subgroup, and DeLong and Franks [7] have also documented the existence of barophilic and psychrophilic deep-sea bacteria that belong to this group, as indicated by 5S and 16S ribosomal DNA sequence data. Because of the relatively close taxonomic relationship between Escherichia coli and all of the identified deep-sea bacteria, and because E. coli is well known in terms of its genetics and molecular biology, high pressure experiments have been performed with E. coli as well deep-sea bacteria. In this article, we describe the effects of pressure on gene expression in deep-sea adapted barophilic and barotolerant bacteria, and atmospheric pressure adapted E. coli, observed in studies performed in our laboratory. We speculate that during the early evolution of life high pressure-inducible and pressure tolerant mechanisms of gene expression developed, which were followed by high pressure-repressible gene expression systems concomittant with the evolution of low pressure-adapted forms of life.

2. GENE EXPRESSION IN DEEP-SEA ADAPTED B A C T E R I A

A promoter, activated by growth at high pressure, was cloned from the barophilic bacterium strain DB6705 in E. coli [8]. Gene expression initiating from this promoter was induced at the level of transcription by high pressure in both the barophilic strain DB6705 and in the E. coli transformants harboring this promoter. Downstream from this promoter, two open reading frames were identified as one operon, designated as a pressure-regulated operon [9]. According to the analysis of transcription, the pressure-regulated operon was expressed under elevated high pressure, and at 70 MPa, the largest amount of transcript was observed. The structure of the promoter sequence was similar to that of the promoter of ompH from Photobacterium sp. strain SS9, which was the first reported pressure-regulated gene [10,11 ]. The highly conserved pressure-regulated operon from the barotolerant bacterium strain DSS12 was also cloned and sequenced [Kato et al., paper submitted]. Its sequence was almost identical to the operon from the barophilic strain DB6705, and similarly gene expression was controlled at the transcription level by elevated pressure. This pressure-regulated operon has been found in many deep-sea adapted bacteria [4,8], therefore it may have an important function in such bacteria allowing them to survive in the deep-sea environment. It has been noted that when barophilic bacteria are grown at low hydrostatic pressure septation is inhibited and the cells grow as long filaments, however low pressure can not change cell shape in barotolerant bacteria [12]. These

61 results could stem from the effects of pressure on the composition of the bacterial cell wall. Aspartate 13-D-semialdehyde dehydrogenase (ASD) is a key enzyme in the pathway for biosynthesis of lysine, threonine, methionine, diaminopimelic acid (DAP), and isoleucine. DAP is an essential component present in the peptidoglycan in all Gram-negative and some Gram-positive bacteria [13]. We thought that expression of the ASD gene in deep-sea barophilic and barotolerant bacteria could be influenced by hydrostatic pressure. To analyze asd gene expression under high pressure, asd genes from the barophilic bacterium strain DB6705, and barotolerant bacterium strain DSS 12 were cloned and sequenced [ 14]. DB6705

601'

CGTTTTATCTATGATCTTCGCGATGACGATGAATTATTTAGAAAAACCATCCTTGATGAT

DSSI2

601"

CGTTTTATCTACGACCTTCGTGATGGCGATGAATTATTTAGAGAAACAATCCTCGATGAT

661 ' TCATCAAAAAATCCCCAAGTTAATTCACTTAATAACAATGGGTTTGACCTTATGAGAAAA 661 " TCATCAAAAAATGACCAAGTTAATTGTGTTAATAACAATCgSATTTGATCTTATGAGAAAA -35 721 ' AATCATCTGCATAGACGTGAATTCAGTGCCTTAAGGCTAGTAAACACTGGGCATTCTGAT *****

*

*****9:*********

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

721 " AATCACCAGCATAGACGTGAATTTCGTGCCTTAAGGCTAGTAAACACTGGGCATTCTGAT -I0

#1//#2

~-> A S D

781 ' GTAAATTGGCTGACTAATTTAGGTTTTTCAGGAATCGGACAGTAATTATGTCGCAAGAAT 781"

GTAAATTGGTTGACCAATTTAGGTTTTTCAGGAGTCGGACAGTAATTATGTCTCAAGAAT #1//#2

Fig. 1. Homology of the asd promoter regions between the barophilic strain DB6705 and the barotolerant strain DSS12. /; transcription start points. The accession numbers of these asd sequences deposited in DDBJ, EMBL, and GenBank nucleotide sequence data bases are D49539 for asd of strain DB6705 and D49540 for asd of strain DSS 12. The asd sequences containing the promoter region are very similar between these strains, and the similarity of the deduced amino acid sequenced of the asd gene products is 96.2%. The 5' ends of the mRNA from both strains were localized at the same point by primer extension analysis, and two transcriptional starting points were detected which differed by just 1 base (Fig. 1). The 1st transcript (#1) is a minor transcript, and the 2nd transcript (#2) is a major transcript in the barophilic strain DB6705, however similar amounts of both of these transcripts were found in the barotolerant strain DSS 12. We observed that the 2nd transcript was clearly regulated by elevated hydrostatic pressure in both strains, however, the 1st transcript was constitutively produced, independent of pressure conditions, in strain DSS 12. These results suggest that the difference between the barophilic and barotolerant strains in relation to asd expression under high pressure conditions may result from

62 differences between their RNA polymerases. It is possible that asd gene expression in the barophile is primarily controlled by a single RNA polymerase whose activity on the secound promoter is enhanced at high pressure, whereas asd expression in the barotolerant strain is mediated by two different RNA polymerase species, only one of which directs increased asd transcription at high pressure. Consistent with this possibility at least two RNA polymerases which differ in optimal temperature for enzyme activity have been detected in the barotolerant strain DSS12 [Nakasone et al., unpublished results]. These RNA polymerases may be responsible for the pressure-dependent and pressure-independent gene expression observed in this strain. 3. G E N E EXPRESSION A D A P T E D E. COLI

IN

ATMOSPHERIC

PRESSURE

Because of the genetic similarity between E. coIi and deep-sea bacteria, we hypothesized that E. coli could share with many deep-sea bacteria common mechanisms for regulating gene expression at high pressure. To test this possibility, we used promoters from E. coli, encoded on plasmids to analyze the effect of pressure on expression of a reporter gene, the chloramphenicol acetyltransferase (CAT) gene [15]. The results are summarized in Table 1. Table 1. Comparison of CAT activity encoded by various plasmids in E. coli JM109 grown at 0.1 MPa, 30 MPa, and 50 MPa. Plasmid Vector

Gene

pTSI

pBR322

antitet-CAT

pTS2

pBR322

tet-CAT

pTS3

pBR322

pTS4 pTS5 pACYCI84

Enzyme activity(unit/mg) 0.1MPa 30MPa 50MPa 1481

2498

2.3

3.8

253

512

1294

2.0

5.1

amp-CAT

183

231

399

1.3

2.2

pUCI3

Iac-CAT

127

11944

471

94 . 0

3.7

pKK223-3

tac-CAT

121

587

10973

4.8

90.5

cat-CAT

12103

7303

13529

0.6

I.I

pACYCI84

645

Ratio* 30/0.1MPa 50/0.1MPa

*; The ratio of the specific enzyme activity (unit/mg of protein) at 30 MPa compared with 0.1 MPa (30/0.1 MPa), and at 50 MPa compared with 0.1 MPa (50/0.1 MPa). Gene expression initiated from the lac promoter region, on plasmid pUC13, and from the tac promoter region, on plasmid pKK223-3, was enhanced greatly by growth at 30 MPa and 50 MPa, respectively, in the absence of the inducer isopropyl-13-D-thiogalactopyranoside (IPTG) [Table 1; 16,17]. In

63 contrast, promoters on plasmid pBR322, and pACYC184 were unaffected at high pressure, although elevated pressure did increase plasmid copy number [16]. The lac and tac promoters are activated in the presence of IPTG, whereas the other promoters, which were unaffected by high pressure, function in the absence of interaction with a allosteric effector molecule. IPTG enhances expression of the lac and tac genes by binding to the repressor protein, LacI, and releasing it from the repressor binding site on the DNA just downstream of the transcription start point [18]. The transcription start point of lac and tac promoters induced by high pressure or IPTG are the same. Therefore, induction of gene expression by pressure must be related to induction by IPTG. High pressure may release the repressor protein bound to the DNA by causing a structural change in the DNA and/or the repressor protein itself. Royer [19] reported that a pressure of around 200 MPa induced the repressor protein, LacI, to change from a tetramer to a dimer in vitro. The LacI protein binds its operator DNA target with high affinity as a tetramer, but displays poor DNA binding characteristics when present in the dimer form. As shown in Table 1, gene expression regulated by the lac and tac promoters was maximum at 30 and 50 MPa, respectively, and these pressure levels were low compared with Royer's report. These differences could be explained by differences in the concentration of LacI protein. Two alternative interpretations also exist. One is that the observed effects relate entirely to a change in plasmid supercoiling that incidentally interferes with the LacI binding site. Another is that the lacI promoter may be inactive at these high pressure. Recently, we observed that detectable amounts of stable lacI transcript and LacI protein were present in E. coli cells grown under several pressure conditions [Sato et al., unpublished results]. Therefore, the first hypothesis may be correct. A more detailed study of pressure effects on plasmid supercoiling is now in progress. In other work, we have demonstrated that the formation of plaques by ~, phage in E. coli is prevented at 30 MPa hydrostatic pressure [20]. When phage infects E. coli, the phage binds to an outer membrane protein, LamB [21]. The ~, receptor, LamB, is expressed from the malB region which is composed of two operons, maIEFG and malKlamB, transcribed divergently from an inter-operon regulatory interval [22-24]. Both operons of the maIB region are positively controlled by the malT gene product through its interaction with an inducer, maltose [25]. Using promoter fragments derived from the malB region, we showed that gene expression initiated from both promoters (pmaIK-lamB and pmaIEFG) is repressed by elevated hydrostatic pressure (Table 2). High pressure repressed gene expression directed by the maIB regulatory interval even in the presence of inducer, thereby preventing the synthesis of the ~, receptor protein. Nakashima et al. [26] reported that, in E. coli, the amounts of outer membrane proteins, OmpF and OmpC are

64 reduced under high pressure, and that this is not the result of effects on the amounts of the regulatory proteins, EnvZ and OmpR. The extent of expression of another OM protein designated OmpX was also found to be reduced under high pressure culture conditions. Since the N-terminal amino acid sequence of OmpX is identical to that of the ~, phage receptor protein, LamB, it seems likely that OmpX is LamB. These observations lead us to conclude that prevention of plaque formation by phage ~, under high pressure conditions is due to a paucity of the k receptor protein, LamB. Our findings suggest that high pressure affects gene expression directed by the maIB regulatory interval, and this causes a decrease in the quantity of ~, receptor protein, LamB. In a previous study by Marquis and Keller [27], binding of the Lac repressor of E. coli to ]3-galactosides was pressure-sensitive in vivo. Thus, it is possible that binding of the positive regulatory protein, MalT, to maltose also may be pressure-sensitive. This might be one of the mechanisms by which high pressure acts to repress expression of the maIB region. Table 2. Effect of pressure on gene expression in both directions from the maIB operon in E. coli*. Promoter

Inducer**

0.1MPa

Enzyme activity(unit/mg) 10MPa 20MPa 30MPa

40MPa

pmalKlamB

+ -

173.9 20.5

64.8 14.8

26.7 15.9

10.9 25.1

10.8 9.3

pmalEFG

+ -

326.4 27.5

205.1 22.4

57.2 27.9

17.9 37.9

18.3 16.9

*; Data from Ref. 20. **" +, Inducer was present at 0.2% for maltose. -, no inducer. Finally, just as asd gene expression was examined in the deep-sea bacteria as a function of pressure, pressure regulation of asd gene expression was also followed in E. coli. In contrast to the deep-sea bacteria, E. coli forms long filaments when incubated at high pressure rather than low pressure [28,29]. Following the same reasoning and methodology described in section 2 above, we have investigated asd gene expression in E. coli under several pressure conditions. Three different sizes of transcripts were detected at pressures up to 30MPa, but at 50MPa, these were almost undetectable [14]. Thus, lack of the ASD enzyme may be one cause of filament formation and growth inhibition at high pressure in E. coli. 4. C O N C L U S I O N S In conclusion, as shown in Table 3, we have observed three kinds of responses to pressure in studies of gene expression in high pressure adapted barophilic and barotolerant bacteria, and in atmospheric pressure adapted E.

65 coli. Gene expression in barophilic bacteria was mainly subject to high pressure-inducible regulation, however in barotolerant bacteria both high pressure-inducible and pressure-independent regulatory mechanisms were evident. In E. coli, there are three types of responses; high pressureinducible, pressure-independent, and high pressure-repressible. Recently, several groups have proposed that life might have originated in the deep-sea hydrothermal vents [30,31 ], so it seems possible that the high pressure-adapted mechanisms of gene expression could represent a feature present during the early stages of life.

Table 3. Effect of high pressure on gene expression in deep-sea adapted bacteria and atmospheric pressure adapted Escherichia coli. Gene

Barophilic isolate (DB6705)

Pressure-regulated operon

Barotolerantisolate (DSS12)

E. coli

Ref.

+

+

+a

8, 9

+

+, -y-

-

14

lac (pUC13)

+

16, 17

tac (pKK223-3)

+

16, 17

-Y-

16

cat (pACYC184)

T-

16

ompF, ompC

-

26

envZ, ompR

-Y-

26

ma/B operon

-

20

asd

tet,antitet,amp (pBR322)

lacI

-Y-

unpublished

+; high pressure-inducible gene expression, -Y-;pressure-independent gene expression, -; high pressure-repressible gene expression, a; Recombinant E. coli harboring the pressure-regulated operon from DB6705. A c k n o w l e d g m e n t s : We appreciate Dr. D. H. Bartlett for critical reading of the manuscript and many useful discussions. We thank Dr. W. R. Bellamy for assistance in editing the manuscript. We also thank the S H I N K A I 6500 and S H I N K A I 2000 operation teams, and the crews of M.S. Y O K O S U K A and N A T U S H I M A for contributing the deep-sea samples for this research.

66

5. R E F E R E N C E S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

D.H. Bartlett, C. Kato and K. Horikoshi, Res. Microbiol., 146 (1995) 697. S. Takagawa, K. Takahashi, T. Sano, Y. Moil, T. Nakanishi and M. Kyo, OCEANS, 3 (1989) 741. C. Kato, T. Sato and K. Horikoshi, B iodiv. Conserv., 4 (1995) 1. C. Kato, N. Masui and K. Horikoshi, J. Mar. Biotechnol., in press. C. Kato, A. Inoue and K. Horikoshi, Trends in Biotechnol., 14 (1996) 6. J.W. Deming, L. K. Somers, W. L. Straube, D. G. Swartz and M. T. Macdonell, Syst. Appl. Microbiol., 10 (1988) 152. E.F. DeLong and D. G. Franks, Abstr. Am. Soc. Microbiol., (1992) 302. C. Kato, M. Smorawinska, T. Sato and K. Horkoshi, J. Mar. Biotechnol., 2 (1995) 125. C. Kato, M. Smorawinska, T. Sato and K. Horkoshi, Biosci. Biotech. Biochem., 60 (1996) 166. D. Bartlett, M. Wright, A. A. Yayanos and M. Silverman, Nature, 342 (1989) 572. D.H. Bartlett and T. J. Welch, J. Bacteriol., 177 (1995) 1008. C. Kato, T. Sato, M. Smorawinska, S. Ham and K. Horikoshi, JAMSTEC J. Deep Sea Res., 10 (1994) 453. K.H. Schleifer and O. Kandler, Bacteriol. Rev., 36 (1972) 407. C. Kato, M. Smorawinska and K. Horikoshi, Proceedings of AIRAPT & EHPRG International conference, published by World Scientific in the Conference Proceedings, in press. T.J. Close and R. L. Rodriguez, Gene, 20 (1982) 305. C. Kato, T. Sato, M. Smorawinska and K. Horikoshi, FEMS Microbiol. Lett., 122 (1994) 91. T. Sato, C. Kato and K. Horikoshi, J. Mar. Biotechnol., 3 (1995) 89. R. Ogata and W. Gilbert, J. Mol. Biol., 132 (1979) 709. C.A. Royer, Biochem., 29 (1990) 4959. T. Sato, Y. Nakamura, K. K. Nakashima, C. Kato and K. Horikoshi, FEMS Microbiol. Lett., 135 (1996) 111. S.D. Emr, J. Hedgpeth, J. M. Clement, T. J. Silhavy and M. Hofnung, Nature, 285 (1980) 82. M. Hofnung, Genetics, 76 (1974) 169. O. Raibaud, M. Roa, C. Braun-Breon and M. Schwartz, Mol. Gen. Genet., 174 (1979) 241. T.J. Shilhavy, E. Brickman, P. J. Jr. Bassford, M. J. Casadaban, H. A. Shuman, V. Schwartz, L. Guarente, M. Schwartz and J. Beckwith, Mol. Gen. Genet., 174 (1979) 249. M. Debarbouille, H. A. Shuman, T. J. Shilhavy and M. Schwartz, J. Mol. Biol., 124 (1978) 359. K. Nakashima, K. Horikoshi and T. Mizuno, Biosci. Biotech. Biochem., 59 (1995) 130. R.E. Marquis and D. M. Keller, J. Bacteriol., 122 (1975) 575. C.E. Zobell and A. B. Cobet, J. Bacteriol., 87 (1963) 710. K. Tamura, T. Shimizu and H. Kourai, FEMS Microbiol. Lett., 99 (1992) 321. O. Kandler, The archaebacteria: biochemistry and biotechnology, Portland press, London, (1992) 195. K.O. Stetter, Frontiers of life, Editors Frontiers, Gif sur Yvette France, (1993).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

67

Effects of hydrostatic pressure on photosynthetic activities of thylakoids Mitsuyoshi Yuasa a Photosynthesis Research Laboratory, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-01, Japan aAdvanced Research Laboratory, Hitachi Ltd., Hotoyama, Saitama 350-03, Japan

Abstract Effects of hydrostatic pressure on PS II isolated from spinach thylakoids were studied. Upon pressure treatment above 100 MPa, Mn-cluster of the oxygen-evolving enzyme was preferentially inactivated. This inactivation was effectively suppressed by inclusion of high concentration of sucrose in the medium. This enabled us to study the effects of ambient pressure on the electron transfer around PS II reaction center up to 200 MPa. Ambient high pressure retarded the electron transfer between QA and QB. It also retarded the charge recombination of S2QA- charge pair, but not that of Z§

- charge pair.

1. I N T R O D U C T I O N Light-driven electron transfer in photosynthetic membranes takes place in photosystems in which various electron donor and acceptor molecules are orderly arranged in a functional integrity consisting of more than twenty membrane proteins. As a means to understand the mechanism of electron transfer in such a semi-solid system, the pressure effect has been considered to be a method of certain interest. There have been several reports on the effects of pressure on photosynthetic electron transfer. Hydrostatic pressure affected the rates of charge separation and recombination in reaction centers of photosynthetic bacteria [ 1-4]. In intact cyanobacterial cells, pressure affected the transfer of excitation energy by inducing irreversible dissociation of protein components [5]. In view of the fact that photosystems have a supramolecular structure maintained by relatively weak intermolecular forces, the pressure effect is expected to appear in two types, reversible and irreversible. This has made it difficult to correctly examine the pressure dependence of electron transfer rates, unless both types of effects are successfully separated. In this communication, we report several features of pressure-induced irreversible damage on the oxygen-evolving enzyme of PS II, and some preliminary results on reversible effects of ambient pressure on the electron transfer in PS II reaction centers, which were enabled by use of a pressure protectant to suppress the irreversible damage.

68

2. MATERIALS AND METHODS Oxygen-evolving PS II membranes were prepared from spinach basically according to the method of Berthold et al. [6]. The PS II membranes were resuspended in 0.4 M sucrose, 40 mM MES-NaOH (pH 6.5) and 20 mM NaC1. Sucrose concentration was increased to 1.2 M if needed. Cross-linked PS II membranes were prepared with EDC (1-ethyl-3-(3dimethylaminopropyl)-carbodiimide) as described by Enami et al. [7]. NHzOH treatment of PS II membranes was done as described by Ono et al. [8]. A sample contained in an inner capsule was subjected to high-pressure treatment in a highpressure cell (Hikari High Pressure Co. Ltd., Hiroshima, Japan) having three sapphire optical windows. Two different types of inner capsules were used. One was a cylindrical cell made of polyethylene tubing used for pressure treatment of samples. The pressure was increased at a constant rate to an indicated level in 3 min, kept at this level for 5 min and then released in 3 min. The treated sample (1.0 mg Chl /ml) was recovered and subjected to activity measurements. The other inner capsule was a homemade one used for measurements of fluorescence kinetics under ambient high pressure. A small piece of filter paper soaked with an aliquot of sample (2.0 mg Chl/ml, supplemented with 1.2 M sucrose) was inserted into an envelope of transparent plastic film. After sealing the opening, the envelope was placed in the high-pressure cell in a close front of the optical window. Electron transfer around the PS II reaction center was induced by a short Xe flash (10 ~ts), and was monitored by fluorescence using a pulse-modulated fluorometer (PAM system, Walz, Effeltrich, Germany).

3. RESULTS AND DISCUSSION 3.1. Pressure-induced damage of the oxygen-evolving enzyme We have recently reported that the oxygen-evolving enzyme of PS II is preferentially and selectively damaged by high-pressure treatments, while other photochemical activities of both P S I and PS II are not much affected [9]. As Fig. 1 shows, both oxygen evolution and photoreduction of DCIP (2,6-dichlorophenol-indophenol) with water as electron donor became affected by pressure treatments above 100 MPa, and inactivated almost completely at 300 MPa (0 ~ or 200 MPa (23 ~ By contrast, DCIP photoreduction with DPC (1,5diphenylcarbazide) as electron donor was stimulated. These results indicate that the oxygenevolving enzyme is specifically inactivated by high-pressure treatments, while the electron transfer from Z (the secondary donor of PS II) to QB (the secondary acceptor quinone of PS II) is resistant. It is well known that tetranuclear Mn-cluster is the molecular entity of the catalyst for water oxidation in PS II [ 10]. Inactivation of oxygen evolution, therefore, is expected to involve destruction of the Mn-cluster. Table 1 shows the changes in relative intensity of the EPR signal arising from free Mn 2+ after pressure treatment of PS II membranes. Native PS II membranes exhibited no Mn signal after washing with any buffers, whereas a large part of Mn was released from pressure-treated membranes, exhibiting strong EPR signals after washing with a buffer containing EDTA. Notably, significant amount of free Mn could be released after washing with a buffer containing no EDTA. This implies that the pressure treatments not only damaged the function of the Mn-cluster but also destroyed its structure, but most of the resultant Mn atoms remained nonspecifically adsorbed on PS II proteins in an EPR silent state.

69

Fig. 1 Effects of pressure on oxygen evolution and DCIP photoreduction in normal and EDC-cross-linked PS II membranes. (A) Oxygen evolution by normal PS II after pressure treatment at 0 ~ ( 9 and 23 ~ ( I ) , and by cross-linked PS II after treatment at 0 ~ (A). (B) DCIP photoreduction by PS II membranes in the absence (solid symbols) of DPC after pressure treatment at 0 ~ ( 9 and 23 ~ (1), and in the presence (open symbols) of DPC after pressure treatment at 0 ~ ( o ) and 23 ~ (n). Open and solid triangles indicate the activity of EDC-cross-linked PS II membranes with and without DPC after pressure treatment at 0 ~ [Reprinted, with permission, from: Yuasa et al. (1995) Plant CellPhysiol.,36: 1081-1088, 9 The Japanese Society of Plant Physiologists]

~. 100 i v

8

so

c7

o 150

g 100~ '

o

~t -

50

e~ u a

O

0

100

300

400

Treatment pressure

200

( MPa )

500

Table I Release of Mn from pressure-treated PSII membranes upon washing with and without EDTA. Pressure treatments (0 ~ 5 min)

Release of Mn (%)a No wash

No treatment 300 MPa 500 MPa

0 23 33

Wash with buffer b 0 67 79

Wash with 1 mM EDTA c 0 81 90

Amount of Mn 2+ ions was estimated from the EPR signal of hyperfine lines characteristic of free Mn 2+ ions. b The buffer used was 0.4 M sucrose, 40 mM MES-NaOH (pH 6.5), 20 mM NaC1. c 1 mM EDTA was included in the sample buffer. a

A unit of PS II in oxygen-evolving membranes contains three extrinsic proteins in addition to more than twenty membrane protein components [ 10]. Of these three extrinsic proteins, the 33 kDa protein is known to stabilize the functional Mn-cluster [ 11 ]. We examined the effects of pressure treatments on the protein composition of PS II membranes by means of SDSPAGE [9]. It turned out that most of the 17 and 23 kDa extrinsic proteins were removed from the membrane after treatment at 200 MPa and above at 23 ~ for 5 min (Fig. 2). On the other hand, an appreciable amount of the 33 kDa protein was retained even after treatment at 500 MPa, although partial loss of the protein occurred above 200 MPa. These results suggest that the 33 kDa extrinsic protein no more functioned as a stabilizer of the Mn-cluster at high pressure. Presumably, high pressure caused dissociation of the 33 kDa protein from its native

70 binding site on PS II, leading thereby to destruction of the Mn-cluster, but the protein was reassociated with PS II upon releasing the pressure. Re-association of the 33 kDa protein is likely, since this protein has a high affinity for PS II [ 12]. If these considerations are true, chemical immobilization of the extrinsic proteins will protect the Mn-cluster against pressureinduced destruction. As shown in Fig. 1, EDC-cross-linked PS II in fact exhibited significant resistance to pressure treatments: higher pressures were needed for complete inactivation. Summarizing these results and considerations, we propose a scheme of pressure-induced inactivation of the oxygen-evolving enzyme as shown in Fig. 3. The initial effect of high pressure on PS II is assumed to be dissociation of the 33 kDa protein from PS II, which then facilitates the destruction of the Mn-cluster owing to the absence of the stabilizing machinery.

Fig. 2 Protein composition of PS II membranes after pressure treatment. [Reprinted, with permission, from: Yuasa et al. (1995) Plant Cell Physiol., 36:1081-1088, 9 The Japanese Society of Plant Physiologists]

Fig. 3 A scheme of pressure-induced inactivation of PS II.

71 3.2. Effects of ambient high pressure on PS II electron transfer We recently found that inclusion of high concentration of sucrose or other polyols in the medium effectively suppresses the pressure-induced inactivation of the oxygen-evolving enzyme [to be published elsewhere]. These pressure protectants enabled us to examine the effects of ambient pressure on the electron transfer in PS II by means of fluorescence. As is well established, the yield of chlorophyll fluorescence from PS II varies depending on the redox state of the primary acceptor quinone, QA [ 13], and its transient change (Fv) can be correctly monitored by use of pulse modulation fluorescence technique [ 14] with negligible or minimized photochemistry in the reaction center. Fig. 4 schematically shows the electron transfer chain around PS II reaction center. Excitation of the reaction center chlorophyll, P680, by a flash illumination results in prompt reduction of QA to QA-. The concentration of QA- decreases through three different paths. In the absence of a herbicide (DCMU), its concentration decreases owing to the forward electron transfer from QA to QB. In the presence of DCMU, its concentration decreases through recombination of S2QA- charge pair. (Note that S 2 is one equivalent oxidized state of the Mn-cluster.) In PS II depleted of the Mncluster, its concentration decreases through recombination of Z+QA- charge pair, when DCMU is present. Fig. 5 shows the effects of ambient pressure on the decay kinetics of F v after illumination with a strong single flash. The rapidly decaying component observed at 0.1 MPa (atmospheric pressure) disappeared gradually between 50 and 100 MPa, and was almost lost at 200 MPa. The low initial F v intensity immediately after flash illumination at 200 MPa may be attributed to the decrease in fluorescence yield due to the change in dielectric constant of surroundings at high pressure [ 15]. Upon releasing the pressure, these changes were largely PS II membranes photon

~

NH2OH treatment

Mn

(So~S

Z ~

,~

:

'

P68o ~

DCMU Phe ~

Z+ QA" recombination

QA

4-

J

QB Pa,~ )

$2QArecombi " nation O.1 MPa (202 MPa ~ ) 2 ms

Fig. 4 Electron transfer chain around PS II reaction center in the presence or absence of the Mn-cluster and an inhibitor, DCMU.

Fig. 5 Effects of ambient pressure on the electron transfer from QA- to QB, as monitored by fluorescence decay kinetics at 20 ~

72

PS II membranes + DCMU

A

(Sz QA- recombination) A~

1

~

p,

I...#

NHzOH-treated PS II membranes + DCMU (Z + QA- recombination)

01MPa .

0.1 MPa 100MPa 200MPa m

2s

200 m s

Fig. 6 Pressure effects on the recombination of S2Q A- (A) and Z+QA- (B) charge pairs as monitored by fluorescence decay kinetics at 20 ~ restored, indicating that the effect of ambient pressure on the electron transfer from QA- to QB is reversible. Fig. 6 shows the effects of ambient pressure on fluorescence kinetics due to S2Q A- charge recombination in DCMU-treated PS II (A), and that of Z+QA - charge recombination in NH2OH-treated PS II in the presence of DCMU (B). Obviously, S2Q Acharge recombination was reversibly retarded by ambient high pressure, whereas Z+QA recombination was immune. Based on the scheme shown in Fig. 4, these results are interpreted as indicating that the reverse electron transfer from Z to S 2 is sensitive to ambient high pressure owing probably to a pressure-induced structural modulation of the Mn-cluster.

REFERENCES 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

R.K. Clayton and D. DeVault, Photochem. Photobiol., 15 (1972) 165-175. C.W. Hoganson, M.W. Windsor, D.I. Farkas and W.W. Parson, Biochim. Biophys. Acta, 892 (1987) 275-283. M.W. Windsor and R. Menzel, Chem. Phys. Lett., 164 (1989) 143-150. N.L. Redline, M.W. Windsor and R. Menzel, Chem. Phys. Lett., 186 (1991) 204. D. Foguel, R.M. Chaloub, J.L. Silva, A.R. Crofts and G. Weber, Biophys. J., 63 (1992) 1613-1622. D.A. Berthold, G.T. Babcock and C.F. Yocum, FEBS Lett., 134 (1981) 231-234. I. Enami, T. Tomo, M. Kitamura and S. Katoh, Biochim. Biophys. Acta, 1185 (1994) 75-80. T. Ono and Y. Inoue, Biochemistry, 30 (1991) 6183-6188. M. Yuasa, T. Ono and Y. Inoue, Plant Cell Physiol., 36 (1995) 1081-1088. R.J. Debus, Biochim. Biophys. Acta, 1102 (1992) 269-352. T. Ono and Y. Inoue, Biochim. Biophys. Acta, 806 (1985) 331-340. I.Enami, M. Kitamura, T. Tomo, Y. Isokawa, H.Ohta and S. Katoh, Biochim. Biophys. Acta, 1186 (1994) 52-58. H. Dau, Photochem. Photobiol., 60 (1994) 1-23. U. Schreiber, C. Neubauer and U. Schliwa, Photosynthesis Research, 36 (1993) 65. A. Freiberg, in: Anoxygenic t-,lotosynthetic Bacteria, eds. R.E. Blankenship, M.T. Madigan and C.E. Bauer (Kluwer Academic Publishers, The Netherlands, 1995) p.385.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

73

Effect of hydrostatic pressure on the proliferation and morphology of the mouse BALB/c cells in culture T. Naganuma a,b, T. Mizukoshi c, K. Tsukamoto c, R. Usami c and K. Horikoshi b,c a Faculty of Applied Biological Science, Hiroshima University, 1-4-4 Kagamiyama, Higashi-hiroshima, 739, Japan b Deep Star Program, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka, 237, Japan c Faculty of Engineering, Toyo University, 2100 Kujirai-nakanodai, Kawagoe, 350, Japan Abstract

The mouse BALB/c cells were cultured under hydrostatic pressures of 0.1 to 60 MPa. Proliferation activity declined with the increase of hydrostatic pressure. Sharp decline was observed at the pressure increase from 20 to 30 MPa. Cell viability was lost between 40 and 50 MPa. Cell morphology was affected by hydrostatic pressure. Cells were shortened, collapsed, or coagulated by increased pressure. Cytoskeletal F-actin was also affected by pressure. F-actin lost organization at 50 MPa, and collapsed at 60 MPa. Close association in the pressure-induced loss of proliferation activity, morphology and cytoskeletal organization was confirmed. 1. I N T R O D U C T I O N Effects of hydrostatic pressure on cytological processes have been studied with cultured cells, oocytes, embryos and protozoans [1, 2]. The studies focused mainly on cell viability and proliferation, embryogenesis, polymerization-depolymerization of cytoskeletal filaments, cytoplasmic viscosity and sol-gel transformation, etc. However, the topics were studied independently with different biological sources. Among the cytological topics, cytoskeleton and related-motility seem to have been a primary interest [2]. Microtubule has been intensively studied, probably because of availability and easy determination of assemblydisassembly. Actin filament (F-actin) was mainly studied with invertebrate

74 and yeast cells [2, 3]. The studies with vertebrates are few [2, 4], and the mammalian cells used for the studies were of epithelium origin [2]. This study aims at the coordinative pressure-induced changes in cell proliferation, cell morphology and cytoskeletal F-actin organization. This communication reports the results from a mammalian cell line of fibroblast origin, the mouse BALB/c cells.

2. M A T E R I A L S AND METHODS 2.1. Cell culture under pressure The mouse BALB/c CL.7, which is a normal embryonic fibroblast cell line (ATCC TIB 80) [5] was purchased from ATCC and maintained at 35~ in RPMI 1640 medium (GIBCO BRL) added with 5% (v/v) fetal bovine serum (GIBCO BRL). After several subculturings, the cells were seeded in fresh RPMI 1640 medium (GIBCO BRL) at a density of 103 cells/cm 2 in test tube-like culture flasks (Leyton tubes; Coastar, Cambridge, Massachusetts). The Leyton tube is about 10 cm long and 1 cm wide, and has a flat side for horizontal placement. A plastic cover slip (9 x 55 mm) is placed inside a tube, which the cells attach to and grow on. Immediately after attachment to the slip, the mouse cells were incubated at the pressures (MPa) of 0.1 (atmospheric), 10, 20, 30, 40, 50 and 60 in pressurizing vessels for 24 hours at 35~ The tubes were filled with the medium so that no air space is left.

2.2. Cell proliferation measurement Cell proliferation activity was measured as the increase in cell abundance during the 24-hr incubation. Cell abundance was estimated based on mitochondrial dehydrogenase activity. The dehydrogenase activity was determined by colorimetry of the formazan yielded from the sodium salt of 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl-2H-tetrazolium-5-carboxyanilide, or XTT (Sigma) [6]. The XTT colorimetric incubation was done in RPMI 1640 without phenol red (GIBCOBRL) at 35~ at the atmospheric pressure. The results were expressed as percentage to the maximum activity (colorimetric value). 2.3. Cell m o r p h o l o g y observation Immediately after decompression, the cells were fixed for 30 min at room temperature in a fixation buffer containing 4% paraformaldehyde and 400 mM sucrose in 15 mM Na-HEPES (pH 7.6) [7]. The cell appearance was observed at this stage by phase-contrast microscopy. To increase the cell membrane permeability, the cells were further incubated in ethanol/glacial acetic acid (95:5) at -20~ for 5 min [8], rinsed in deionized distilled water, air-dried, and stored at-80~ Then the cytoskeletal F-actin was stained with 30 units/ml rhodamine phalloidin (Molecular Probes,

75 Inc., Eugene, Oregon) in PBS for 30 min at room temperature, and observed by epifluorescence microscopy.

3. RESULTS AND DISCUSSION

3.1. Cell proliferation activity There was a consistent decrease of growth activity with the increase of pressure (Figure, left column ). A sharp decrease was seen between the pressures of 20 and 30 MPa, where about 60% activity was lowered down to 18%. There was low but positive proliferation at 50 and 60 MPa. However, the proliferation could be false positive, because extracellular (leached) dehydrogenases might cause false positive XTT measurements. Thus the cell proliferation is thought to be positive only up to 40 MPa. This was confirmed by the fact that the 40 MPa-incubated cells recovered full proliferation activity after decompression, while the 50 MPa-incubated cells lost viability. Therefore, there were two breaks in cell proliferation activity. One was the sharp decline between 20 and 30 MPa; and the other was the loss of cell viability (recoverability of the growth) between 40 and 50 MPa. The loss of proliferation activity is, in other words, the blockage of cell division. Earlier observation of the blockage pressure ranged from 20 to 80 MPa, mostly from 30 to 40 MPa [1], with which our observation is in good agreement. 3.2. Cell m o r p h o l o g y The decrease of proliferation activity by pressure was associated with the change of the cell morphology (Figure, middle column ). Typically, the cultured mouse cells are elongated and >100 #m long at the atmospheric pressure. The cell morphology, as well as proliferation activity, was not visually affected at 10 MPa. The cells began to lose elongated morphology and shrink at 20 MPa. The cells became spherical ("rounding-up" [9,10]) at 30 MPa, and even smaller at 40 MPa. The "rounding-up" pressure was previously reported 2040 to 50 MPa for Amoeba cells [1, 10] and 50-70 MPa for human cells [9]. At 50 MPa, the cells were partially collapsed, and coagulated at 60 MPa. The coagulation may suggest the changes in the nature of the the cell membrane surface. The molecular structure of cell membrane is known to be affected by "physiological" pressure of 0.1-100 MPa [11].

3.3. Cytoskeletal F-aetin Cell morphology is largely based on the organization cytoskelton such as actinfilaments (F-actin). Changes in the formation and distribution of Factin under pressure was also observed by epifluorescence microscopy (Figure, right column ).

76 The types of F-actin organization that are generally observed are: stress fibers and the focal contacts; peripheral fibers; and cortical fibers. These organization was still intact at 10 MPa. Stress fiber F-actin was first affected at 20 MPa and retarded in supporting the elongated cell morphology. At 30 MPa, F-actin became accumulated in the peripheral region of the cells; stress fibers were visually disordered, and losing focal contacts. This was responsible for the "rounding-up" of the cells. Stress fibers were completely disordered at 40 MPa, as also shown with in the green monkey cells [2], while peripheral fibers were still organized. However, even the peripheral fibers began to be disturbed at 50 MPa, which might be associated with the loss of cell viability. Similar F-actin disorganization at 50 MPa was observed in yeast cells [3]. At 60 MPa, stress fibers, focal contacts and peripheral fibers were all collapsing. Even cortical fibers seemed to be disordered and F-actin collapsed at 60 MPa. Because the F-actin, as well as microtubules [2], is known to be the most dynamic bio-macromolecule that shows the "dynamic stability" through the balance between polymerization and depolymerization. Also, F-actin has essential functions in various cellular processes such as motility, muscle force generation, cell division and morphology suppot. The cells in culture are suitable for the observation of F-actin organization, and easy to maintain and manipulate. Therefore the cells in culture can serve as a model system to study the pressure effects on the kinetics and dynamism of cellular and biochemical processes.

Figures (next page)

(Left) Effect of hydrostatic pressure on the proliferation of the mouse BALB/c cells in culture.

(Middle column) Effect of hydrostatic pressure on the appearance of the mouse BALB/c cells in culture, observed by phase-contrast microscopy. Scale bar, 50 ktm.

(Right Column) Effect of hydrostatic pressure on the cytoskcletal F-actin (stained with rhodamine phalloidin) of the mouse BALB/c cells in culture, observed by epifluorescencc microscopy. Scale bar, 50 gin.

77

78 4. REFERENCES

1 F. H. Johnson, H. Eyring and M.J. Polissar, The Kinetic Basis of Molecular Biology, John Wiley & Sons, Inc., New York, 1954. 2 H.W. Jannasch, R.E. Marquis and A.M. Zimmerman (eds.), Current Perspectives in High Pressure Biology, Academic Press, London, 1987. 3 H. Kobori, M. Sato, Z.H. Feng, A. Tameike, K. Hamada, S. Shimada and M. Osumi, Program and Abstracts of International Conference on High Pressure Bioscience and Biotechnology, Kyoto (1995) 60. 4 R.R. Swezey and G.N. Somero, Biochemistry, 21 (1982) 4496. 5 P. Patek, J. Collins and M. Cohn, Nature 276 (1978) 510. 6 N.W. Roehm, G.H. Rodgers, S.M. Hatfield and A.L. Glasebrook, J. Immunol. Methods, 142 (1991) 257. 7 P. Forscher and S.J. Smith, J. Cell Biol., 197 (1988) 1505. 8 A. Sarzinski-Powitz (1992) In" Nonradioactive In Situ Hybridization Application Manual, Boehringer Mannheim, Indianapolis (1992) 44. 9 J.V. Landau, Exp. Cell Res., 23 (1961) 538. 10 J. V. Landau and L. Thibodeau, Exp. Cell Res., 27 (1962) 591.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

79

Influence of hydrostatic pressure on expression of heat shock protein 70 and matrix synthesis in chondrocytes K. TAKAHASHI, T. KUBO, Y. ARAI, Y. HIRASAWA, J. IMANISHI*, K. KOBAYASHI* and M. TAKIGAWA* * Departments of Orthopaedic Surgery and *Microbiology, Kyoto Prefectural University of Medicine, Kamigyo-ku, Kyoto 602, Japan. * *Department of Biochemistry and Molecular Dentistry, Okayama University Dental School, Shikada-cho, Okayama 700, Japan.

Abstract To investigate the influence of hydrostatic pressure (HP) on the expressions of heat shock protein 70 (HSP70), and to know the relationship between HSP70 expression and matrix synthesis, we subjected chondrocyte-like cells to HP. HSP70 were enhanced after exposure to 10 to 50 MPa of HP. 35S sulfate incorporation into the cultured cells increased after exposure to 5 MPa of HP and decreased after 50 MPa of HP.

1. I N T R O D U C T I O N Mechanical stress is known to have an important role in the control of matrix synthesis in cartilage. Certain levels of hydrostatic pressure (HP) can stimulate the synthesis of matrix by chondrocytes and can maintain matrix metabolism. However, some levels of HP can depress the turnover of matrix and may lead to cartilage degradation (1). On the other hand, heat shock protein (HSP) is produced by cells after the application of various stresses. It was reported that active synthesis of 70-kDa HSP (HSP70), correlated with the severity of osteoarthritis (OA) (2). In this study, we exposed chondrocyte-like cells to HP and examined the relationship between HSP70 expression and matrix synthesis. 2. M A T E R I A L S AND M E T H O D S

Cell culture HCS-2/8 cells (3) were seeded in plastic petri dishes in Dulbecco's modified Eagle's medium (DMEM) contains 10% fetal bovine serum The cells were maintained at 37~ in a humidified atmosphere of 5% CO2. Pressure application After reached confluence, HCS-2/8 cells were exposed to HP ranging from 1 MPa to 50 MPa. In all assays, duration of HP exposure was set to be 2 hours. The petri dishes were placed in a teflon pouch, which was filled with DMEM. The pouch was then placed in a

80 stainless steel pressurization vessel (inside size, ~65 m m X 9 0 mm), equipped with an oil pressure apparatus (Type KP5B, Hikari Koatsu, Hiroshima, Japan). Temperature was maintained at 37~

35s sulfate incorporation assay for proteoglycan synthesis Control cells and cells after HP exposure (5 and 50 MPa) were labeled for 2 hours by 3 5S sulfate. 35S sulfate incorporation was measured by using a scintillation counter, and was normalized by the total protein concentration. The statistical significance of results was evaluated by using the Student's t-test.

Northern blotting Total RNA was extracted from the control and HP (1, 5, 10, and 50 MPa) exposed cells between 30 minutes and 24 hours after HP exposure. Northern blotting was performed according to the method described previously (4). RNA loading was examined by probing for 15-actin mRNA.

Western blotting Control cells and cells exposed to 1, 5, 10, and 50 Mpa of HP. The cells were harvested at 4 and 8 hours after HP exposure and then sonicated. HSP70 was detected in Western blotting as previously described (4), and a monoclonal antibody (Amersham) was used as the primary antibody.

3. RESULTS

Effects of liP on proteoglycan synthesis in HCS-2/8 cells Exposure to 50 MPa of HP resulted significant (p<0.001) decreases of 35S sulfate incorporation, i.e., 63.5+1.77% (mean+SD, n=18) of the levels in control cells (under atmospheric pressure, 100+5.52%, n=17 ). However, 35S sulfate incorporation increased when the cells were exposed to 5 MPa of liP (109.6__+8.17%, n=17, p<0.001) (Fig.l).

Fig. 1. Effects of HP exposure on 3 5S sulfate incorporation. The figures are expressed in % to the levels of control cells. Results are mean___SD. C: control under atmospheric pressure.* " p<0.001.

81 HP-induced HSP70 in HCS-2/8 cells HSP70 mRNA were detected by Northern blotting in the cells grown under atmospheric pressure. After exposure to HP for 2 hours ranging from 1 MPa to 50 MPa, pressuredependent elevation in HSP70 mRNA was observed at 4 and 8 hours after the release of HP (Fig. 2). At 12 and 24 hours after the release of HP, HSP70 mRNA levels were close to that under atmospheric pressure. Western blotting demonstrated that HSP70 in cells exposed to 50 MPa of HP increased 4 and 8 hours after the release of HE compared with that in the control cells (Fig. 3).

Fig. 3.

Induction of HSP70 in HCS-2/8 cells after HP exposure. HSP70 in cells at 4 hours after HP exposure was detected by Western blotting. C: control under atmospheric pressure.

4. D I S C U S S I O N Maximum contact pressures in the human hips during a walk are reported to range from 3

82 WlPa to 10 MPa (5). and the oressure level can rise to almost 20 Mpa during some activities (6). HP is considered to rise at the same order. Our study showed that the rate of proteoglycan synthesis increased after giving 5 MPa of HP. and markedly decreased after giving 50 MPa of HP. These results indicate that HP at physiologic magnitudes can increase the proteoglycan synthesis rate in chondrocytes, while HP at unphysiologic magnitude decrease the proteoglycan synthesis rate in chondrocytes. We previously demonstrated that chondrocytes from OA tissue expressed HSP70, and the level elevated as severity of OA increased (2). HSP is produced by cells which received various stresses, such as heat shock, heavy metals, ethyl alcohol, sulfhydryl reagents, amino acid analogs, viral infections, and oxygen deprivation (7). Analysis of HSP expression will provide many indications of cell responses to mechanical stress. After exposure to HP at unphysiologic level (50MPa), HSP70 expression was markedly enhanced immediately after the HP exposure. Such a rapid elevation of HSP70 mRNA level was not observed in the cells receiving HP at lower magnitudes. These results indicate 50 MPa of HP is excessively strong for chondrocytes and such a high magnitude of HP affectes chondrocytes adversely. High HP also promotes dissociation, unfolding, and misassembly of oligomeric proteins (8). Major roles of HSP70 are to bind and refold partially denatured or misfolded proteins, and to dissociate abnormally aggregated proteins (7). It is possible that HSP70 is induced in cells immediately after HP exposure in order to bind denatured or misfolded proteins which are generated in the cells exposed to 50 MPa of HP as in the cells exposed to heat shock. In conclusion, This study demonstrates that HP at physiologic level increase proteoglycan synthesis, and excessively strong HP evokes enhancement of HSP70 expression along with the decrease in proteoglycan synthesis. These results indicate HP may be a important modulator of the metabolic activities of chondrocvtes and HSP70 could be a charasteristic indicator of an abnormal and harmful state of chondrocytes which receive excessively high HP in articular cartilage. 5. REFERENCES

1 A. C. Hall, J. E G. Urban, K. A. Gehl: J Orthop Res 9:1-10, 1991. 2 T. Kubo, C. A. Towle, H. J. Mankin, B. J. Treadwell: Arthritis Rheum 28:1140-1145, 1985. 3 M. Takigawa, K. Tajima, H-O. Pan, M. Emoto, A. Kinoshita, E Suzuki, Y. Takano, Y. Moil: Cancer Res 49:3996-4002, 1989. 4 K. Kobayashi, E. Ohgitani, Y. Tanaka, M. Kita, J. Imanishi: Microbiol Immunol 38:321325, 1994. 5 N.Y. E Afohe, P. D. Byers, W. C. Hutton: J Bone Joint Surg 69B:536-541, 1987. 6 W. A. Hodge, R. S. Fijan, K. L. Carlson, R. G. Burgess, W. H. Harris, R. W. Mann: Proc Nath Acad Sci USA 83:2879-2883, 1986. 7 R. I. Morimoto, A. Tissieres, C. Georgopoulos: Cold Spring Harbor Laboratory Press, 1450, 1990. 8 M. Gross, R. Jaenicke: Eur J Biochem 221:617-630, 1994.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

83

Changes in microfilaments and microtubules of yeasts induced by pressure stress H. Kobori a, M. Sato b, A. Tameike b, K. Hamada c, S. Shimada d and M. Osumi a aDepartment of Chemical and Biological Sciences, Faculty of Science, and bLaboratory of Electron Microscopy, Japan Women's University, 2-8-1, Mejirodai, Bunkyo-ku, Tokyo 112, Japan CFermentation and Food Research Laboratories, Oriental Yeast Co., Ltd., 3-6-I0, Azusawa, Itabashi, Tokyo 174 dplanning and Research Division, Oriental Yeast Co., Ltd. 3-8-3, Nihonbashi Honcho, Chuo-ku, Tokyo 103

Abstract Changes in cytoskeletal elements induced by pressure stress in a budding yeast Saccharomyces cerevisiae, a dimorphic yeast Candida tropicalis and a fission yeast Schizosaccharomyces pombe were investigated by fluorescence microscopy. The cell cycle-specific organization of microfilaments and microtubules in the three yeasts was altered by exposure to hydrostatic pressure of 50-150 MPa for 10 min and their complete disassembly was observed at 150-300 MPa. Similar morphological changes in the cytoskeleton were caused in the three yeasts by acceleration of pressure stress, although their sensitivity differed from that of yeasts; hyphal-form cells of C. tropicalis and S. pombe cells were sensitive to pressure stress.

1. INTRODUCTION The response of living cells of prokaryotes (bacteria) and higher eukaryotes to hydrostatic pressure stress is well characterized; however, the response of yeasts, lower eukaryotes, is less evident [ 1,2,3,4]. In this study we investigated the changes in organization of cytoskeletal elements due to hydrostatic pressure stress in three representative yeasts by fluorescence microscopy. We also examined the effect of pressure on viability of the yeasts and the process of reassembing cytoskeletal elements after the release of pressure. The possible involvement of cytoskeletal elements in the

84 formation of polyploid cells is discussed.

2 . MATERIALS AND METHODS The diploid industrial isolates of Saccharomyces cerevisiae O-102 [2] and Schizosaccharomyces pombe L972h- were grown in YPD medium. The yeastform cells (Y-cells) and hyphal-form cells (H-cells) of Candida tropicalis (ATCC 20336) were grown as described [5]. Each cell suspension (109 cells/ml) was treated with hydrostatic pressure (0.1 to 400 MPa) for 10 min at room temperature by a high pressure apparatus, NKK-ABB [2]. The procedure of increasing pressure, holding and decompressing was performed automatically. Viability of pressurized cells was determined by their colony-forming ability when the cell was plated on agar and incubated for 3 days at 3013. Viability of H-cells of C. tropicalis was determined by dye exclusion assay using methylene blue because their multi-cellular nature made it impossible to use the plating method. Microfilaments (MFs) were visualized by staining the F-actin of the cells with rhodamine-conjugated phalloidin as described [5]. MFs were also observed by an immunoelectron microscopic methods described previously [6], except that rabbit anti-chicken gizzard F-actin monoclonal antibody was used. Microtubules (MTs) were visualized by indirect immunofluorescence as described by kilmartin and Adams [7], except that the fixed cells were permeabilized sequentially with fl-mercaptoethanol, cell wall digestive enzymes and Triton X-100. Rat anti-yeast a-tubulin monoclonal antibody and FITC-conjugated goat anti-rat IgG were used as primary and secondary antibodies, respectively. The stained cells were viewed through a fluorescence microscope as described [8]. In order to examine recovery process of cytoskeleton, the pressurized cells of S. cerevisiae (220 MPa, 10 min) and those of Y-cells of C tropicalis (150 and 200 MPa, 10 min) were transferred to fresh medium and incubated at atmospheric pressure. In the case of S. cerevisiae this pressure condition was selected because it was the minimum condition inducing complete disappearance of MTs, and the highest formation of polyploid cells was obtained at 200-250 MPa [2]. At appropriate time intervals between 0 and 36 h, the cells were examined for changes in organization of MFs and MTs.

3 . RESULTS Effects of pressure on survival of yeasts These effects are shown in Fig. 1. The survival curve sharply decreased

85 with increasing pressure and no cells survived at 400 MPa in any of the three yeasts. Sensitivity to pressure stress differed with the strain and cell form. The order of the sensitivity was H-cells of C. tropicalis > S. pombe > S. cerevisiae > Y-cells of C. tropicalis.

1010 - o

~

- 100

10a ~

~

106 - 50

o

~

|

~

104

'~

lOa

~

Fig. 1. Effects of pressure on survival of yeasts. S. cerevisiae ( 9 Y-cells ( 9 ) and H-cells ( O ) of C. tropicalis and S.

pombe (1).

Z

0 0.1

I

I

100

200

~=--~t

, ~.

300

0

400

Pressure (~a)

Changes in microfilaments in yeast cells induced by hydrostatic pressure The effects of pressure on MFs of S. cerevisiae are shown in Fig. 2. The cell cycle-specific organization of MFs was visualized in the cells without pressure t r e a t m e n t (0.1 MPa) as reported by Kilmartin and Adams [7]. Actin dots clustered in rings about the bases of very small buds ( ~ - ( ~ ) , clustered in small and medium-sized buds (~--(~) and were evenly distributed in large buds (~(~)) as shown in Fig. 2a. Actin cables were oriented along the long axes of m o t h e r cells during the cell cycle. During cytokinesis actin dots clustered in the neck region between the separating cells. W h e n cells at various cell cycle stages were pressurized for 10 min, the actin cables in m o t h e r cells disappeared and the cell cycle-specific actin organization was lost at 100 MPa. Short and thick fragmented actin cables were seen in both buds and m o t h e r cells at 150 MPa; they became vague at 250 MPa and no fluorescence was visible due to the depolymerization of F-actin above 300 MPa. Figure 3 shows the effects of pressure on MFs of Y-cells of C. tropicalis. The cell cycle-specific organization of Y-cells of C. tropicalis was basically

85 the same as that of S. cerevisiae cells, except that actin cables were not observed in mother cells [5]. The cell cycle-specific actin organization observed in the non-pressurized cells was lost at 150 MPa. Only 3% of the cells showed fluorescence of F-actin at 200 MPa and no fluorescence was visible at 300 MPa. The effects of pressure on MFs of H-cells of C. tropicalis are shown in Fig. 4. In the 12-h cultured H-cells, the majority of actin dots were concentrated at the hyphal apex (Fig. 4a) [5]. When these cells were pressurized, unlocalized actin was observed in most of the cells at 100 MPa, and no fluorescence of actin was visible at 150 MPa. The effects of pressure on MFs of S. pombe are shown in Fig. 5. The three distinct patterns of organization of actin were observed during the cell cycle as described by Marks and Hyams [9]. At the beginning of the cell cycle all of the actin dots were clusterd at one end of the cell (~(~)) and then they were present at both ends in the bidirectional growth stage ( ~ (~)) as shown in Fig. 5a. Actin dots were located in the center of the cells at a post-mitoic stage (Fig. 5a, ~(~)), followed by septum formation and cytokinesis. When the cells were pressurized, cell cycle-specific actin organization was lost at 50 MPa, although the clusterd actin dots remained in the center of the cells (Fig. 5b, ~ ) . Thick actin cables appeared at 100 MPa (Fig. 5c) and complete disassembly of actin occurred at 150 MPa. Immunoelectron microscopic observation also revealed the existence of concentrated colloidal gold particles for anti-F actin (Fig. 5e, ~ ) , which corresponded to the thick actin cables observed in Fig. 5c.

Changes in microtubules in yeast cells induced by hydrostatic pressure Figure 6 shows typical double-staining images of tubulin and DNA of S. cerevisiae cells without and with pressure treatment. The organization of MTs shown in Fig. 6a was basically the same as those reported for S. uvarum [7], except that the number of cytoplasmic MTs ( ~ ) attached to spindle pole body (SPB) was different. Organization of the MTs changed drastically according to the degree of pressure. At 150 MPa organization of MTs was slightly altered and both cytoplasmic MTs (~-(~) and spindle MTs (~-(~) were partially disrupted as shwon in Fig. 6c. At 200 MPa both cytoplasmic MT and spindle MTs were fragmented and their cell cyclespecific organization was completely lost. No fluorescence of tubulin was observed at over 250 MPa, therefore only DNA was stained in Figs. 6e and 6f. In Y-cells of C. tropicalis, 12 different tubulin staining patterns were observed during the cell cycle-specific organization and their schematic diagram is shown in Fig. 7. The organization of MTs in Y-cells was basically the same as those reported for S. cerevisiae [ 10] and Candida albicans [ 11 ]; however, a unique characteristic of the Y-cells was a large granular MT at

87 the mother-bud neck at telophase in mitosis and the presence of many dots of tubulin in stages 1 and 12 in Fig. 7. Figure 8 shows the changes in MTs in the Y-cells without and with pressure. At 150 MPa cell cycle-specific organization of MTs was lost and complete disassembly of MTs was observed above 200 MPa. Organization of MTs during the hyphal growth of C. tropicalis is shown in Fig. 9. The basic organization of MTs in the H-cells was similar to that of the Y-cells; however, novel large granular MTs were seen at the mother-hypha neck during elongation of the short hypha (Figs. 9d and 9e, ~-) and the very tip of the cytoplasmic MTs extending into the growing hypha (Fig. 9h, ~ ) . Duplicated SPBs were observable (Figs. 9d, 9e and 9f, ~l ). When 12-h cultured H-cells were pressurized, filamentous tubulin turned into dots at 100 MPa and complete disassembly of tubulin was observed above 150 MPa (Fig. 10). Figure 11 shows the changes in MTs in S. pombe cells without and with pressure. Without pressure, several fine cytoplasmic Mts were oriented along the long axes of cells at interphase (Fig. l la, ~ ( ~ ) ) and these cytoplasmic MTs were replaced by spindle MTs when cells entered mitosis (Fig. l la, ~--~). When these cells were pressurized, both cytoplasmic MTs and spindle MTs disassembled in most of the cells at 100 MPa (Fig. l l d ) , although disrupted cytoplasmic MTs (~(~)) and spindle MTs (~(~)) were remained in a small percentage of the cells examined as shown in Fig. l lc.

Recovery of cytoskeletal elements after pressure stress Figure 12 shows the process of recovery of MFs in S. cerevisiae. Fragmented thick actin cables were seen when the cells were pressurized at 220 MPa (Fig. 12b). After an 8 h recovery period, large actin dots were more numerous in the cells. At 12 h fine actin cables were noticed (Fig. 12d, ~ ) , which had further developed in most of the cells by 24 h. Complete recovery of the actin organization had occurred by 36 h. Fig. 13 shows the MT recovery process of S. cerevisiae. All MTs disappeared as a result of pressure stress (Fig. 13b), and during the 8-h recovery period none were seen. It is worth noting that duplicate SPBs appeared in some cells of various stages of the cell cycle at 12 h (Fig. 13d, ~ ) . In non-stressed cells, duplication of SPB occurs only before bud emergence during the cell cycle. At 15 h cytoplasmic MTs were noted, although some of them were not normal and three SPBs were observed in some cells (Fig. 13e, ~-). At 24 h the organization of MTs had been completely restored. Figure 14 shows the MF recovery process in Y-cells of C. tropicalis. Actin dots remained in only 2% of the cells when the cells were pressurized at 150 MPa (Fig. 14a). Drastic reassembly of actin was noticed after a 4-h recovery period and complete organization of MFs was seen at 6 h. When the cells were pressurized at 200 MPa, none of the MFs were recovered even

88 after a 10 h period. Figure 15 shows the MT recovery process in Y-cells of C. tropicalis. None of the MTs were observed when the cells were pressurized at 150 MPa (Fig. 15a). After a 4 h recovery period, dots of tubulin appeared and filamentous tubulin was partially reassembled (Fig. 15c) and then complete organization of MTs was noted at 6 h (Fig. 15d).

4 . DISCUSSION Table 1 summarizes the changes in MFs and MTs in response to pressure stress in the three yeasts. The order of sensitivity of MFs to pressure was S. pombe ~ H-cells of C. tropicalis ~ S. cerevisiae ~ Y-cells of C. tropicalis. The order of sensitivity of MTs to pressure was S. pombe = H-cells of C. tropicalis ~ Y-cells of C. tropicalis ~ S. cerevisiae. It was shown that viability of S. pombe and H-cells of C. tropicalis was also sensitive to pressure stress compared to that of S. cerevisiae and Y-cells of C. tropicalis (Fig. 1). Since MTs, especially spindle MTs, play an important role in the nuclear division process, d a m a g e to and breakdown of MTs would result in the cells being incapable of growth. Therefore the correlated susceptibility of MTs and survival observed in the yeasts would be explained by their sensitivity to MTs.

Table 1. Effects of pressure stress on cytoskeleton of yeasts Cytoskeleton

Organism

Microfilaments

S. cerevisiae C. tropicalis C. tropicalis S. pombe S. cerevisiae C tropicalis C. tropicalis S. pombe

Microtubules

Form of cells

Y-cell H-cell

Y-cell H-cell

Minimum pressure (MPa) Abnormality

Disappearance

100 150 100 50 150 150 100 100

300 300 150 150 250 200 150 150

Similar distinctive morphological changes in MFs caused by the acceleration of pressure stress were observed in the three yeasts. It is interesting to note that the same successive changes in MFs were also observed in S. pombe when the cells were starved in distilled water [12]. At present it is not possible to explain the mechanism of these drastic changes. However, the interaction between actin and actin-binding proteins might affect the formation and maintenance of the structure of F-actin and its polymerization

89 as suggested by studies of osmotic stress [ 13] and of cycloheximide, an inhibitor of protein synthesis in S. cerevisiae [ 14]. We have reported the frequent formation of polyploidy after hydrostatic pressure in S. cerevisiae [2] and S. pombe [3]. Induction of polyploidy by treatment with hydrostatic pressure in many higher eukaryotes has been reported [ 15, 16]. It was found that the breakdown of the mitotic spindle after application of hydrostatic pressure resulted in the formation of polyploidy in salmonid eggs [ 16]. Therefore, the same phenomenon seen in higher eukaryotes probably results in induction of polyploidy in yeasts. We have shown that SPBs, spindle MTs, and cytoplasmic MTs that disappeared as a result of pressure stress were restored after the release of pressure in S. cerevisiae [6] and C. tropicalis in this study. Three or more SPBs were sometimes observed in a cell during the recovery process (Fig. 13e), and these might cause the induction of polyploid cells in yeasts. Therefore, recoverability of these cytoskeletal elements could contribute to the frequent formation of polyploidy in yeasts.

5 . REFERENCES 1

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

M. Osumi, N. Yamada, M. Sato, H. Kobori, S. Shimada and R. Hayashi, In High Pressure and Biotechnology. (eds. C. Balny, R. Hayashi, K. Heremans and P. Masson) vol. 224 pp 9. Colloque INSERM/John Libbey Eurotext Ltd., 1992. K. Hamada, Y. Nakatomi and S. Shimada, Curr. Genet., 22 (1992) 371. S. Shimada, M. Andou, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biotechnol., 40(1993) 123. M. Sato, H. Kobori, S. Shimada and M. Osumi. FEMS Lett., 131 (1995). 15. H. Kobori, M. Sato and M. Osumi, Protoplasm, 167 (1992) 193. H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, FEMS Lett., 132 (1995) 253. J . V . Kilmartin and A. E. M. Adams, J. Cell Biol., 98 (1984) 922. H. Kobori, N. Yamada and M. Osumi, J. Cell Sci., 94 (1989) 653. J. Marks and J.S. Hyams, Eur. J. Cell Biol., 39 (1985) 35. B. Byers and L. Goetsch, J. Bacteriol., 124 (1975) 511. R. Barton and K. Gull, J. Cell Sci., 91 (1988) 211. T. Kanbe, A. Tomohiro and K. Tanaka, J. Electron Micros., 43 (1994) 20. S. Chowdhury, K. W. Smith and M. Gustin, J. Cell Biol., 118 (1992) 561. P. Novick, B. C. Osmond and D. Bostein, Genetics, 121 (1989) 659. S. Dasgupta, J. Exp. Zool., 151 (1962) 105. H. Onozato, Aquaculture, 43 (1984) 91.

90

Fig. 2. Changes in organization of MFs of S. cerevisiae cells caused by hydrostatic pressure. Fluorescence staining of F-actin of untreated cells (a) and cells treated with hydrostatic pressure at 100 (b), 150 (c), 200 (d), 250 (e) and 300 (f) MPa. Fig. 3. Changes in organization of MFs in Y-cells of C. tropicalis. Fluorescence staining of F-actin of untreated cells (a) and cells treated with pressure at 150 (b) and 200 (c) MPa. Fig. 4. Changes in organization of MFs in H-cells of C. tropicalis caused by hydrostatic pressure. Fluorescence staining of F-actin of untreated cells (a) and cells treated with pressure at 100 (b) and 150 (c) MPa.

91

Fig. 5. Changes in organization of MFs of S. pombe caused by hydrostatic pressure. Fluorescence staining of F-actin of untreated cells (a) and cells treated with pressure at 50 (b), 100 (c) and 150 (d) MPa. Immunoelectron microscopic image reveals clusterd colloidal gold particles for anti-F actin in the cells treated at 100 MPa (e).

92

93

Fig. 6. Changes in organization of MTs in cells of S. cerevisiae caused by hydrostatic pressure. Fluorescence microscopic images of double-staining of a-tubulin (green) and DNA (orange) of untreated cells (a) and cells treated with pressure at 100 (b), 150 (c), 200 (d), 250 (e) and 300 (f) MPa. Fig. 7. Schematic diagram summarizing the organization of MTs during the cell cycle of Y-cells of C. tropicalis. The nucleus is shown as an open circle and the dots and lines represent the two types of tubulin staining. Bold lines represent spindle MTs and fine lines cytoplasmic MTs. Sequential numbers (1 to 12) show 12 different stages of tubulin staining.

94

Fig. 8. Changes in organization of MTs in Y-cells of C. tropicalis caused by hydrostatic pressure. Images of a-tubulin staining of untreated cells (a) and cells treated with pressure at 150 (b), 200 (c), and 300 (d) MPa. Fig. 9. Organization of MTs during the hyphal growth in C. tropicalis showing the double-staining images of tubulin and DNA. Cells were grown for the appropriate period (0 to 20 h) and the sequence of typical patterns of tubulin staining during hyphal growth is shown. Fig. 10. Changes in organization of MTs in H-cells of C. tropicalis caused by hydrostatic pressure. Images of a-tubulin staining of untreated cells (a) and cells treated with pressure at 100 (b), 150 (c), and 200 (d) MPa. Fig. 11. Changes in organization of MTs in cells of S. pombe caused by hydrostatic pressure. Images of a-tubulin staining of untreated cells (a) and cells treated with pressure at 50 (b), and 100 (c, d) MPa. Fig. 12. Process of recovery of MFs from pressurized cells in S. cerevisiae. Images of F-actin staining before (a) and just after (b) pressure treatment. Recovery of Factin of pressurized cells after incubation for 8 h (c), 12 h (d), 24 h (e), and 36 h (f). Fig. 13. Process of recovery of MTs from pressurized cells in S. cerevisiae. Images of a-tubulin staining before (a) and just after (b) pressure treatment. Recovery of a-tubulin of pressurized cells after incubation for 8 h (c), 12 h (d), 15 h (e), and 24 h (f). Fig. 14. Process of recovery of MFs from pressurized Y-cells in C. tropicalis. Images of F-actin staining just after pressure treatment (a). Recovery of F-actin after incubation for 2 h (b), 4 h (c), and 6 h (d). Fig. 15. Process of recovery of MTs from pressurized Y-cells in C. tropicalis. Fluorescence microscopic images of a-tubulin just after pressure treatment (a). Recovery of a-tubulin after incubation for 2 h (b), 4 h (c), and 6 h (d).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

95

Direct induction of h0m0zyg0us dipl0idizati0n in the fission yeast heosaccharomycespombe by pressure stress. Kazuhiro Hamadaa , Yasuo Nakatomia , Masako Osumf and Shoji Shimadac aFermentation & Food Research Laboratory, Oriental Yeast Co.,Ltd., 3 - 6 - 1 0 Azusawa, Itabashi- ku, Tokyo 174, Japan bDepartment of Chemical and Biological Science, Faculty of Science, Japan Women's University, 2 - 8 - 1 0 Mejirodai, Bunkyo-ku, Tokyo 112, Japan CPlanning & Research Division, Oriental Yeast Co., Ltd., Nihonbashi Tosho Bldg., 3 - 8 - 3 Nihonbashi Honcho, Chuo-ku, Tokyo 103, Japan

Abstract Hydrostatic pressure stress and a dye plate method were first applied to investigate the direct induction of homozygous diploids from the haploid yeast S. pombe. Above 100 MPa at 250C for 10min, pressure stress greatly inactivated the haploid strain JYl(L972h-). At the same time, pressure stressed cells of the former strain at more than 1 0 0 - 2 0 0 MPa were spread on a dye plate, some pressure-effected visible colonies were stained violet (variant colonies) ; the rest were stained pink, similar to colonies originating from haploid cells that were not pressure-stressed. Variant colonies from JY1 began to appear and increased in fi'equency up to 200 MPa. Around 200 MPa, the maximum measured % cell population of variant colonies presented was approximately 40. Based on the cell size, DNA content, crosses, and random spore analysis for the segregation of mating types or auxotrophic markers, these variant cells originating from color changed colonies after pressure stress were very stable and found to be a homozygous diploid with h-/ h-genotype at the mating-type locus.

1.

INTRODUCTION

The mechanism involved in damage by hydrostatic pressure in microorganisms has not yet been determined. There is little knowledge of the genetics and molecular biology of the p r e s s u r e - s t r e s s response, particularly in yeast cells although numerous physiological phenomena correlated to pressure stress have been described (1). In fact, pressure stress has been widely used to artificially duplicate the chromosome sets of fishes or to alter the genetic events and to examine the effects of ultrastructure in yeast cells ( 2 - 3 ) as well as other

96 sudden stresses such as heat, freezing, desiccation, U V - l i g h t , radiation, or chemical agents in their environments. We found that the direct induction of polyploidization by pressure stress of around 200 MPa occurred easily in Saccharomyces cerevisiae during the studies on various applications of the use of hydrostatic pressure in food science (4). In the fission yeast Schizosaccharomyces pombe, similar phenomenon of direct diploidization has been reported by Booher and Beach, Broek et al. (5), and Moreno and Nurse. For instance, Broek et al. (5) revealed re-replication of G2arrested temperature sensitive cdc2 mutants of S. pombe after heat treatment, which led to increase in ploidy. Certain chemical treatments also lead to DNA replication without mitosis, which induces a high level of diploidization. This study deals with the direct induction of diploidization by hydrostatic pressure stress in S. pombe cells, which is assumed to act on targets involving nuclear division apparatus and the detection of induced diploidizing cells using a dye plate. The effect of pressure stress on cell survival and cell morphology in S. pombe compared with the budding yeast S. cerevisiae is also discussed.

2.

MATERIALS AND

METHODS

2.1. S. pombe strains and culture conditions The fission yeast S. pombe strains JY1 (L972h-), JY334 (ade6-M216 leul h§ JY276(his2/his2 ade6-M216/ade6-M210 h-/ h-) were used and variants (JY1-V~, JY1-V2, JY1-V3) described in this work were derived from pressure-stress of JY1. The basic rich medium containing 1% yeast extract, 2% polypeptone, and 2% glucose (YPD) was used. YPD was supplemented with adenine-HC1 (100 mg/1) and leucine (100 mg/1) when needed. For pressure stress experiments, cells were grown to the stationary phase in YPD medium on a reciprocal shaker at 30~

2.2. Pressure treatment Cell suspension (approx. 109cells/ml) were put into a small collapisible polyethylene bottle and placed in the pressure vessel. Samples were compressed by a high pressure generation system (Model N K K - A B B , NKK Co., Tokyo, Japan) for 10min. at 2 5 ' C as described previously (3). 2.3. Induction and detection of variants The protocols for generating variant cells (diploid cells) by pressure stress treatment and detecting variant colonies were described by Hamada et al. (5).

2.4. Genetic analysis Standard S. pombe genetic procedures were sporulation and random spore analysis (6).

3.

RESULT AND

used

for genetic

crosses,

DISCUSSION

3.1. Occurrence of variants (large-sized

cells) on a dye plate after pressure

97

stress.

We first investigated whether a dye p l a t e - c o l o n y color assay system for detecting varied ploidy in the pressure stressed cells of S. pombe would be useful, as described in S. cerevisiae. Colony color of the strain JY1 was examined on the dye plates after pressure stress of 200 MPa for 10 min at 25~ The parental haploid strain with JY1 all formed pink colonies, on the contrary, after pressure stress (200 MPa), visible colonies of the same strain JY1 which were stained violet or dark violet (variants) were readily detected on the dye plate.

(A)Before pressure stress

Fig.1

(B)After 200 MPa for 10min.

Occurrence of variants on a dye plate after pressure stress.

Table 1. Effect of magnitude of pressure stress on the induction of variants from S.pombe JY1. Pressure stress (MPa) 100 150 200

No. of variants detected (V) 2 6 103

Total no. of colonies examined (T) 100 80 266

V/T(%)

2.0 7.5 38.7

Variants from JY1 colonies formed on a dye plate were almost all consisted of large-sized cells. We also examined the effect of the magnitude of pressure stress on the formation of variants. As shown in Table 1, the degree of viabili-

98 ty in the apprearance of variants varied in the pressure from 100 to 200 MPa. After pressure stress over 100 MPa, variant colonies from JY1 began to appear and increased in frequency up to 200 MPa. The maximum percent of cell population of variant colonies from JY1 after pressure stress at 200 MPa were 38.7. This value was double that obtained for the variant colonies from the pressurestressed haploid cells of S. c e r e v i s i a e under the same conditions. Further, these haploid strains showed only < 1% pre-existing spontaneous diploids on a dye plate (data not shown), so it is possible that the higher number of variant colonies is due to pressure stress rather than to the selection of spontaneous diploids.

3.2. Properties of variant cells induced by pressure stress. From the 103 variant colonies formed on a dye plate after pressure stress at 200 MPa, the JY1-V~ colony was randomly chosen to determine ploidy. Ploidy was evaluated by cell size (cell length) and DNA content. Table 2 shows the proper-

Table 2 Properties of the variant J Y 1 - V 1 stress at 200 MPa. strain

JY1

JY334 JY 1-V~ JY276

genotype

h-(L972, wild type) h +ade6-M2161eu l h-/h- (variant) 3) h-/h- his2/his2 ade64~216/ade6-M210

derived from S. p o m b e

Cell size 1) (/zm) 9.8+2.2 NT. 2~

15.0+3.4 14.2+3.2

DNA content (/.t g/109 cells) 21.3 23.6 44.8 50.3

JY1 after pressure

Colony color on dye plate Pink Pink Violet Violet

1)average cell length: measured directly on a light microscope/ image analyzer. 2)not tested. 3)assumed mating type.

ties of variant JY1-V1 from the haploid strain JY1. The single variant J Y 1 - V a cell isolated from JY1 more closely resembled both in cell length and DNA content of the parental diploid strain JY276. To learn whether the variant JY1V1 cell could be defined as a homozygous diploid, it and the standard haploid strain JY334 of mating type h § were crossed pairwise with each other. As expected, they were able to mate. Similarly, other variants J Y 1 - V 2 and J Y 1 - V 3 with large-sized cells (data not shown), which were isolated from JY1 under the same conditions, were able to cross with the opposite mating type of JY334. 3.3. Analysis of hybrids between J Y 1 - V , and JY334 and JY1-V2 and JY334 To further identify ploidy in the variant cells above, we carried out random spore analysis and examined mating types and ploidy. The variants J Y 1 - V 1 and

99 JY1-V2 were mated with the opposite mating type of strain JY334, sporulated on MEL plates, and subjected to this analysis (Table 3). In the hybrid H P I - 1 1 formed in crosses with JY1-V, and JY334, mating type showed 14 h - / h § 9 7 h § : 25 h-segregants in 46 spore clones tested. From the results of the X 2- test,

Table 3. Random spore analysis with hybrids formed in crosses between S. pombe JY1, JY1V1 and the haploid tester strain JY334 (h § Strain

Cross

Segregants

Segregation of mating type

Estimated gene constitution based on 2"2 analysis

h-: h +" h-/ h +

HPI-01 HPI-11

JY1 (h-)• JY334 (h § JY1-Va • JY334 (h§

40 46

23"17" 0 25" 7"14

h-/h § h -/h -/h +

( 2"2=1.00, 2~, P > 0.50)

the observed segregation ratio of mating types formed in the above hybrid, HPI11 was not significantly different from the theoretical ratio, which shows 3 h-/ h § : 1 h § : 2 h-segregation with genotype h-/ h-/ h+. This also suggests that the variant JY1-V1 is a homozygous diploid with an h-/ h - m a t i n g type. For the mechanism of polyploidization by pressure stress, we suggested previously that in the budding yeast S. cerevisiae, at low pressure magnitude of 1 0 0 - 1 5 0 MPa, cytoskeletal elements including microtubules and microfilaments, which are strongly related to nuclear division apparatus or cell polarity in the cells, were completely disrupted, which resulted in the promotion of polyploidation (tetraploid and diploid). Until now, the effect of pressure stress on the induction of diploidization in S. p o m b e has been unclear, but as suggested previously, it is possible that pressure stress may impose severe damage on cytoskeletal elements and make them unable to maintain normal nuclear division as in the budding yeast S. cerevisiae. This is currently under investigation.

4.

REFERENCES

1 D. G. Hoover, C. Metric, A. M. Papineau, D. F. Farkas and Knorr, Food Technol. 43, 99-407 (1989). 2 S. Shimada, M. Andou, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biotechnol. 40, 1 2 3 - 1 3 1 (1993). 3 M. Sato, H. Kobori, S. Shimada and M. Osumi, FEMS Microbiol. Lett. 131, 11-45 (1995). 4 K. Hamada, Y. Nakatomi and S. Shimada, Curr. Genet. 22, 371-376 (1992). 5 D. Broek, R. Bartlett, K. Crawford and P. Nurse, Nature 349, 388-393 (1991).

100 6 S. Moreno, A. Klar and P. Nurse, Meth Enzymol. 194, 795-823 (1991).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

101

9 1996 Elsevier Science B.V. All rights reserved.

Acquisition of stress tolerance by pressure shock treatment in yeast Mitsuo Miyashitaa, Katsuhiro Tamura *a, and Hitoshi lwahashi b aDepartment of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, 2-1 Minamijosanjima-cho, Tokushima 770, Japan bNational Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology, 1-1 Higashi, Tsukuba, Ibaraki 305, Japan Abstract

Pressure shock treatment induced heat shock protein (hspl04) and tolerance against various stresses such as high temperature, high pressure and high concentration of ethanol in yeast. The optimum pressures which induced maximal tolerance against these stresses were in the range of 50 - 75 MPa and depended on the type of stress. 1. INTRODUCTION When the cells from different organisms are exposed to mild heat shock, they acquire resistance to subsequent various stresses that would normally be lethal, a phenomenon called acquired stress tolerance [1-5]. Stress tolerance can be induced by various treatments, such as the heating of cells, and the treatment of cells with chemicals, for example, ethanol [4, 5]. These treatments can also induce a small set of proteins called heat shock protein (hsp).

Many hsps are also

formed constitutively and are essential at normal growth temperatures. However, the function of most other hsps is unknown. In Saccharomyces cerevisiae it has been shown that the induction of heat shock protein hsp 104, which is not expressed during growth at normal temperature, is required for acquired thermotolerance to prolonged heat treatments. Another factor potentially important for acquired thermotolerance in yeast is the trehalose. It has been reported that the thermotolerance of yeast is increased even in the absence of hsp 104 when trehalose is accumulated in yeast cells [6-8]. And trehalose induces thermal stability of proteins extracted from yeast cells [7]. It is well known that hydrostatic pressure acts as astress to some organisms and the effects of hydrostatic pressure are similar to those of temperature.

However, the acquisition of stress

tolerance in yeast as a result of pressure shock treatment and its mechanism has not been cleared. We report the effects of high pressure on the induction of heat shock proteins and tolerance to various stresses such as, high temperature, high pressure and high concentration of ethanol in yeast.

102 20 15 "~ 10 .. r~

5

01

0

I

I

25

50

I

75

I

100

]" 125

Pressure / MPa Figure 1. Stress tolerance of pressure-shocked yeast cells. Symbols:O" incubated for 10 min at 51 ~ (thermotolerance); 9 " incubated for 60 min at 150 MPa (barotolerance); IN 9incubated for 60 rain in medium containing 14%(w/w) ethanol (ethanol tolerance). 2. MATERIALS AND METHODS

Stress tolerance of pressure-shocked yeast The yeast Saccharomyces cerevisiae IFO 10149 was grown at 30~ in YPD medium containing (g/l) glucose, 20; polypeptone, 20; and yeast extract, 10. Cultures in the logarithmic phase of growth were used. Logarithmic phase cells were suspended in fresh YPD medium and incubated at 30 ~ for 30 min under various pressures and were subjected to high temperature (51~ for 10 min), high concentration of ethanol (14%(w/w) for 60 min), and high pressure (150 MPa for 60 min).

Survivals were determined by standard dilution plate counts on YM agar containing

(g/l) glucose, 10; agar, 20; polypeptone, 5; yeast extract, 3; and malt extract, 3. Colonies were counted after incubation for 3 days at 37~

All experiments were carried out at least three

times and mean values were calculated.

Measurement of trehalose. Trehalose levels in cells were measured by trehalase (a, ot-trehalose glucohydrolase, [EC 3.2.1.28], Sigma) treatment and following Somogi-Nelson method [9]. Yeast cells were harvested by centrifugation at 1000 x g for 5 minutes, washed twice with distilled water, suspended with the same volumes of distilled water, and incubated in a boiling water bath for one hour. The cell suspensions in part were assessed for protein content and the residual suspensions were centrifuged. The supernatants were added to the reaction mixture containing 3 ~ units of trehalase and 50 mM of sodium acetate buffer at pH 5.7. The reaction mixture was incubated at 37~ overnight. Glucose hydrolyzed from trehalose was measured as a reducing sugar using SomogiNelson method [9].

103

Figure 2. Induction of hsp 104 protein by pressure shock treatment. Lanes A (control,30~ 30 min), B (heat shock, 43~ 30 min) and C (pressure shock, 75MPa, 30 min) are normalized for the protein concentrations. Table 1 Induction of heat shock protein (hspl04)

Western blotting analysis of the heat shock proteins Proteins from yeast cells were incubated at 30~

,

,,

control heatshock pressureshock (30~ (43~ (75 MPa, 30~ Area 25 128 88 Percentage(%) 3.1 15.3 10.6

under 75 MPa for

30 min, were separated by SDS-PAGE electrophoresis using a SDS-10% polyacrylamide slab gel. After the electrophoresis, gels were stained with C o o m a s s i e brilliant blue G-250.

Table 2 Induction of trehalose control heatshock pressureshock (30~ (43~ (75 MPa, 30~ HLC method ND 53.8 ND Enzyme method ND 40 ND ~g / mg of proteins ND: not detected

Destained gels were blotted onto a nitrocellulose

membrane

by

electrotransfer. The membranes were reacted with anti-hsp 104 antiserum and were subsequently visualized using the immunoperoxidase method (Vectastain ABC kit).

The protein amounts

were then estimated using a densitometer. 3. RESULTS AND DISCUSSION

Stress tolerance of pressure-shocked yeast To study the effect of pressure shock on yeast, we evaluated the stress tolerance of cells after pressure shock treatment. Figure 1 shows the results of tolerance against three types of stresses: thermotolerance, barotolerance and ethanol tolerance of the yeast after incubation for 30 min under various pressures at 30~

In the thermotolerance (51~

10 min), only a few percent of

the yeast cells incubated at 0.1 MPa survived under such a severe condition. However, for the cells incubated under moderate pressures, the maximal tolerance against high temperature was induced in the cells incubated at 75 MPa. The survivals then gradually decreased with increasing

104 pressure. On the other hand, the optimum shock pressure was 60 MPa for ethanol tolerance and 50 MPa for barotolerance. These differences in the optimum shock pressures suggest that high pressure, high temperature and high concentration of ethanol affect pressure-shocked yeast cells in different manners. In the case of heat shock treatment, the tolerance against high temperature, high pressure and high ceoncentration of ethanol became maximum at 43~

Western blotting analysis of the heat shock proteins and the determination of trehalose To investigate whether heat shock protein analogs cause the induction of stress tolerance of pressure-shocked yeast, proteins separated from the pressure-shocked yeast cells were analyzed using SDS-10% polyacrylamide slab gel electrophoresis. The proteins obtained were blotted onto a nitrocellulose membrane and incubated with anti-hsp104 antiserum.

They were

subsequently visualized using immunoperoxidase method. Figure 2(I) shows that heat shock proteins were apparently induced by pressure shock treatment in the yeast cells. In Fig. 2(II), hsp 104 bands are separated and the results assayed using a densitometer are shown in Table 1. These results indicate that acquirement of resistance to subsequent stress that would normally be lethal is dependent on the heat shock proteins. As shown in Table 1, pressure shock treatment in yeast for 30 min at 75 MPa induced 3.4 times as much hsp 104 as that of the control and this amount of hsp 104 was nearly two-thirds compared with that induced by heat shock treatment for 30 min at 43~

Therefore, pressure shock treatment is sufficiently effective to induce heat

shock proteins in yeast, although it is not as powerful as heat shock treatment.

This finding

suggests that although the effects of high hydrostatic pressure and high temperature in yeast are tightly linked physiologically, the response of yeast to high temperature and high pressure are not necessarily the same. We also examined the amount of trehalose accumulation in pressureshocked yeast cells.

However, we did not find any trehalose in the pressure-shocked cells

(Table 2). Accordingly, the molecular mechanisms by which the yeast cells acquire the stress tolerance seem to be different in heat shock and pressure shock. REFERENCES

1 2 3 4 5 6 7 8 9

K. Watson and R. Cavicchioli, Biotechnol Lett, 5 (1983) 683. Y. Komatsu, S. C. Kaul, H. Iwahashi and K. Obuchi, FEMS Microbiol Lett., 72 (1990) 159. H. Iwahashi, S. C. Kaul, K. Obuchi and Y. Komatsu, FEMS Microbiol Lett., 80 (1991) 325. J. Plesset, C. Palm and C. S. McLaughlin, B iochem. B iophys. Res. Commun, 108 (1982) 1340. K. Tanji, T. Mizushima, S. Natori and K. Sekimizu, Biochim. Biophys. Acta, 1129 (1992). C. De Virgilio, P. Piper, T. Boller and A. Wiemken, FEBS Lett., 288 (1991) 86. C. De Virgilio, T. Hottiger, J. Dominguez, T. Boller and A. Wiemken, FEBS Lett., 219 (1994) 179. T. Hottiger, C. De Virgilio, M. N. Hall, T. Boiler and A. Wiemken, FEBS Lett., 219 (1994) 187. M. J. Somogyi, J. Biol. Chem., 195 (1952) 19.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

105

High pressure denatured metalloprotein is a new NO-trapper

T.Oku a, K.Umezawa b, T.Nishio a, H.Ogihara b, Y.Ichikawa a, N.Takamatsu a, H.Ishikawa b, H.Tsuyuki b and N.Yano b Department of Biological Chemistry a, and Food Science and Technology b, College of Bioresource Sciences, Nihon University, 3-34-1, Shimouma, Setagaya, Tokyo 154, Japan

Abstract The trapping of nitric oxide (NO) and nitrite (NO2) reduction were examined using cytochrome c, which had been denatured under pressure (0.1500MPa), in 10% isopropanol at 60~ A reducing agent and electron donor were used in the NO2- reduction system. ESR and UV-vis. studies have shown that denatured cytochrome c rapidly forms an iron-nitrosyl (Fe"-NO) complex. Cytochrome c was shown to have a high NO2- reducing activity and the rate of NO2-reduction to NH4+ was faster at low pH. The reduction mechanism is proposed to be NO2 ---~ NO--* NH4+. This reaction is a net 6-electron, 8-proton process. These results suggest that high pressure denatured cytochrome c can be used as an NO-trapper. 1. I N T R O D U C T I O N Nitrite is commonly used as a curing agent in meat processing and is converted into nitric oxide (NO) under acid and reducing conditions ~. Purplish-red myoglobin and hemoglobin forms red NO-(nitrosyl or nitroso) complexes with nitric oxide which subsequently form pinkish NO-hemochrome complexes '~ when heated. The conversion and removal of nitrite is, therefore, an area of interest in the meat processing process. It is also an area of interest in the environmental sciences since nitric oxide, which is derived mainly from nitrite ~ (NO2-) and nitrate ~' (NO3-) by reduction in nature, is a precursor of acid rain", a destroyer of ozone and a suspected carcinogen ~. In 1992 nitric oxide was selected as "The Molecule of the Year" by the journal Science 6~and for the past 5-6 years diverse lines of evidence have shown that NO mediates in immune system responses, a variety of cell functions such as vascular smooth muscle relaxation, inhibition of platelet aggregation and 9 " 7) neurotransm~sslon. Recently we described the conversion of NO2-into N H 4 + via NO using

106 gamma-irradiated and heat denatured metalloprotein "'. This report describes the properties of high pressure denatured cytochrome c and its potential as an NO-trapper and as a model for nitrite reductase.

2. MATERIALS AND METHODS Horse heart cytochrome c purification. Horse heart cytochrome c was obtained from the Sigma Chemical Company (St. Louis, Mo., U.S.A.) and further purified by passage through a Bio-gel P 10 column (2.5 • 50cm) in 1% NaC1. Cytochrome c containing fractions were pooled, dialyzed at 5~ for 4 days and lyophilized. Polyacrylamide gel electrophoresis and electrospray ionizingmass spectrometry (ESI-MS) of purified cytochrome c. SDS-PAGE was performed in 17% acrylamide/0.2% SDS gels using a discontinuous Trisglycine buffer system according to the method of Laemmli 9~and protein bands visualized by staining with Coomassie Brilliant Blue R-250. A JOEL JMX-SX 120A mass spectrometer equipped with an ion spray interface and a mass range of 500-1500amu/e was used to analyze 0.1% acetic acid solutions of cytochrome c (0.1mg/ml).

Denaturation of cytochrome c. High pressure denaturation of cytochrome c in an aqueous solution was performed at 0.1-500MPa in 10% isopropanol at 60~ The procedure was repeated three times. Reduction of nitrite by denatured cytochrome c. A reaction mixture consisting of 1.5ml of 0.2M buffer (0.75mmole, pH3-9), 2ml of 0.01M sodium nitrite (20/zmole), 2.5ml of 0.003M methyl viologen (7.5 /1 mole), 2.5ml of 50/z M cytochrome c, and 1.5ml of 0.96M sodium dithionite (0.36 lz mole) dissolved in an aqueous solution of 0.29M sodium bicarbonate, was incubated at 30~ At timed intervals lml aliquots of the reaction mixture were removed and vortexed vigorously until the methyl viologen was completely discolored. Determination of nitrite and ammoniumn ions. Determination of NO2-and NH4§ formed in the reaction mixture were performed using diazoreaction and HPLC. Spectrometric measurement of iron-nitrosyl complex. Optical and ESR spectra of iron-nitrosyl complexes were obtained using a Milton Roy 3000 spectrophotometer and a JOEL FE3A X-band spectrometer.

107 3. R E S U L T S AND D I S C U S S I O N P u r i f i c a t i o n , s p e c t r o p h o t o m e t r i c p r o p e r t i e s and m o l e c u l a r weight of c y t o c h r o m e c. Purified cytochrome c displayed a single band on SDSPAGE with an estimated molecular mass of 12.5kDa. The absorption maxima of purified cytochrome c were 409nm (~ band) and 529nm in the oxidized form and 415nm( y band), 520nm (/3 band) and 549nm ( a band) in the reduced form. These absorption characteristics are in accord with those of oxidized and reduced cytochrome c l~ The molecular mass of cytochrome c determined by ESI-MS was 12,356.6Da agreeing closely with that (12,360Da) calculated from the amino acid sequence ''). Nitrite reduction and ammonium ion f o r m a t i o n by high p r e s s u r e denatured cytochrome c. Fig.1 shows the results of the reduction of NO2 to NH4+ by high pressure denatured cytochrome c in the presence of reducing agent and an electron donor. The rate of NO2 reduction to NH4+ was higher using high pressure denatured cytochrome c compared with that of purified cytochrome c and purified cytochrome c in isopropanol. This suggests that denatured cytochrome c can be efficiently used as a substitute for nitrite reductase 4).

100~

E ao 0 +

"* 60

imlsggmmiDnsgmBDq

40 "~

20 ,o~

'~ Z

OI

0

30

60 Time (min.)

90

120

Fig.1 NO2" reduction and NH4+ formation using purified and high pressure denatured cytochrome c purified cytochrome c 9 --C]- NO2", ..n.. NH4+ purified cytochrome c in 10% isopropanol 9 ~ NO2", --O- NH4+ purified cytochrome c treated with high pressure in 10 % isopropanol" --~-- NO2", ..,A,. NH4+

108 Detection of iron-nitrosyl c o m p l e x . Optical absorption due to the formation of Fe"-NO complex was observed at around a wavelength of 570nm. A characteristic ESR of the Fe"-NO complex of high pressure denatured cytochrome c was observed near 3,300G. Reaction mechanism of nitrite r e d u c t i o n . From the above results the reaction mechanism of NO2- reduction by high pressure denatured cytochrome c in the presence of reducing agent and an electron donor is proposed as NO2---~NO--~NH4+. This reaction is a net 6 electron, 8 proton reduction process as in the case of nitrite reductase ~ and feredoxin nitrite reductase ~,'~) A ckno wledge m en ts

Our thanks are due to Dean S. Kadota of College of B ioresource Sciences and Nihon University for purchasing ESI-MS. The authors are indebted to Professor R. Hayashi of Kyoto University and Professor K. Gekko of Hiroshima University for their valuable advices with high pressure treatment. Thanks are given to Chief M. Sato of Institute Liaison Section of Nihon University for his smooth administration of ESI-MS and Assistant J. Kaneko of Nihon University for her skilled technical assistance in ESI-MS. We thank Mr. David C. Watson of the National Research Council of Canada for reading the manuscript. 4. R E F E R E N C E S

1 S.H.Lee and R.G.Gassens, J. Food Sci., 41 (1976) 969. 2 T.Kakutani, H.Watanabe, K.Arima and T.Beppu, J. Biol. Chem., 89 (1981) 453,463. 3 J.-P. Rosso, P. Forget and F. Pichinoty, Biochem. Biophys. Acta, 321 (1973) 443. 4 J.M.Jouany, Pollut. Atmos., 89 (1981) 35. 5 P.N.Magee, Adv. Cancer Res., 10 (1967) 163. 6 D.E.Koshland, Jr., Nature, 2 5 8 (1992) 1861. 7 E.Culotta. and D.E.Koshland, Jr., Nature, 258 (1992) 1862. 8 T. Oku, T. Nishio, M. Kondo, H. Sato, T. Ito, K. Nishizawa, H. Seki and M. Hoshino, (in Press) 9 U.K.Laemmli, Nature, 2 2 7 (1970) 680. 10 T. Nakashima, H. Higa, H. Matsubara, A. Benson, K. T. Yasunobu, J. Biol. Chem., 2 41 (1966) 1166. 11 M.Barber and B.N.Green, Rapid Commun. Mass Spectrom., 1 (1987) 80. 12 B.J.Cardenas, J.Rivas and C.G.Moreno, FEBS Letters, 23 (1972) 131. 13 W.G.Zumft, Biochem. Biophys. Acta, 276 (1972) 363.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

109

Ultrastructural effects of pressure stress to Saccharomyces cerevisiae cells revealed by immunoelectron microscopy using frozen thin sectioning M. Sato a, A. Tameike a, H. Kobori b, S. Shimada ~, Z. H. Feng b, S. A. Ishijima" and M. Osumi b aLaboratory of Electron Microscopy, and bDepartment of Chemical and Biological Sciences, Faculty of Science, Japan Women's University, 2-8-1, Mejirodai Bunkyo-ku, Tokyo 112, Japan cplanning and Research Division, Oriental Yeast Co., Ltd. 3-8-30, Nihonbashi Honcho, Chuo-ku, Tokyo 103

Abstract Effects of hydrostatic pressure on ultrastructure of Saccharomyces cerevisiae were studied by immunoelectron microscopy using frozen thin sections. At 100 MPa bundles of the microtubules (MTs) extended in the nucleus, but spindle pole bodies were not visible. At 150 MPa the deposition of gold particles for anti a-tubulin was recognized in the nucleus, although the filamentous structure of the MTs was not seen. At 200 MPa fewer gold particles were scattered in the nucleus. These results show that elements of the nuclear division apparatus are susceptible to pressure stress. These events were reversible at below 200 MPa. 1. INTRODUCTION Study of the effects of hydrostatic pressure on Saccharomyces cerevisiae O-102 cells have revealed the impact of ultrastructural changes [1]. Transmission electron microscopy showed that membrane systems (especially the nuclear membrane) were most susceptible to pressure, and were changed after pressure treatment at 100 MPa for 10 rain. It was also demonstrated that hydrostatic pressure of 200 to 250 MPa greatly inactivated the yeast cells, but at the same time induced polyploidy at high frequency [2]. This finding suggests that the structure of cytoskeletal elements, particularly microtubules (MTs) which are related to the nuclear division apparatus, might be severely damaged by pressure stress under the same conditions. In fact, in S. cerevisiae MTs have been shown to be involved in nuclear division during mitosis [3]. The breakdown of nuclear division apparatus by pressure stress thus confirms the induction of polyploidy in S. cerevisiae. Here, we report the effects of pressure stress on ultrastructure of S. cerevisiae cells using immunoelectron microscopy (immuno EM) [4]. The change in ultrastructure of MTs in the pressure-stressed cells and their assembly during

110 the recovery period after pressure stress was investigated.

2 . Response of S. cerevisiae cells to pressure stress The mid-exponential phase cultures of S. cerevisiae O-102 cells were subjected to various magnitudes of applied pressure from 0.1 to 300 MPa for 10 rain at room temperature. The methods of high pressure treatment, immuno EM and recovery experiment were as described [4]. An immuno EM image of frozen thin sections of the cell without pressure treatment is shown in Fig. l a. Alphatubulin was identified obviously with 10 nm colloidal gold particles (*--) conjugated with goat anti rat IgG. Bundles of MTs (~--) with fine filamentous structure crossed between the two spindle pole bodies (SPBs) in the nucleus. Most of the gold particles (~-) for anti a-tubulin were localized on these bundles within the dividing nuclei. At 100 MPa bundles of MTs (~-) together with the gold particles (~-) for anti a-tubulin were visible in the nucleus, however, SPBs had disappeared (Fig. l b). At 150 MPa gold particles (~-) were seen in the nucleus, although the filamentous structure of the MTs had disappeared (Fig. lc). At 200 MPa there were fewer gold particles and they were scattered throughout the nucleus; the electron dense materials became visible in the the nuclear matrix (Fig. l d, *-). At 300 MPa most of the subcellular structure was destroyed (Fig. le). Our previous observation showed that the viability of S. cerevisiae was lost at 300 MPa [4]. The ultrastructural changes observed in this experiment would explain why the cells lost their abililty to proliferate at 300 MPa. Many electron dense materials had formed in the nucleus (Fig. l e), and these materials are assumed to be denatured proteins caused by pressure stress which were also observed in the pressurized cells of Candida tropicalis [5].

3 . Recovery of microtubules after pressure stress When the cells pressurized at 200 MPa were incubated in fresh medium for 24 h, most of them did not completely recover; sometimes the gold particles (*-) appeared in the nucleus but SPBs were rarely observed (Fig. 2a). When the cells were pressurized at 150 MPa, all the MTs disappeared, and none was seen during the 8 h recovery period. However after 24 h, gold particles (~--) were arranged in the complete assembly of MTs ( ~ ) and SPBs were also visible (Fig. 2b). Sometimes the profile of SPB was abnormal because it was compressed inside the nucleus, causing the bundles of MTs (~-) to spread out in various directions from a single SPB (Fig. 2c). This abnormal location of SPB might be brought about by breakdown of the nucleus membrane and spindle by pressure stress. All cells pressurized at 100 MPa showed normal profiles in the MTs (Fig. 2d, ~ ) . These results show that MTs were reversible. The mitotic spindles of S. cerevisiae partially or completely disappeared at the same range of pressure (200 to 250 MPa) at which formation of polyploidy was observed at high frequency [2]. The same phenomenon observed in higher eukaryotes has demonstrated the induction of polyploidy by pressure stress [6], therefore the breakdown of the mitotic spindle of S. cerevisiae by pressure stress probably facilitates the induction of polyploidy in this yeast.

111 T h e a b n o r m a l SPBs (Fig. 2) and recoverability of the d a m a g e d mitotic spindles and nuclear m e m b r a n e s also m i g h t contribute to the f r e q u e n t f o r m a t i o n of polyploidy in this yeast.

Fig. 1. Immuno EM images of frozen thin sections of the yeast treated without (a) and with hydrostatic pressure at 100 (b), 150 (c), 200 (d) and 300 (e) MPa. N, Nucleus.

112

4 . REFERENCES 1 2 3 4 5 6

S. Shimada, M. Andou, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biotechnol., 40 (1993) 123. K. Hamada, Y. Nakatomi and S. Shimada, Curr. Genet., 22 (1992) 371. B. Byers, In Molecular Biology of the Yeast Saccharomyces, vol. 1 (eds. J. N. Strathern, E. W. Jones and J. R. Broach) pp. 59. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1981. H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 132 (1995) 253. M. Sato, H. Kobori, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 131 (1995) 11. H. Onozato, Aquaculture, 43 (1984) 91.

Fig. 2. Immuno EM images of frozen thin sections of 24 h-incubation cells after treated at 200 (a), 150 (b, c) and 100 (d) MPa by hydrostatic pressure.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

113

Biological stimulation of low-power He-Ne laser on yeast under high pressure Shinsuke Kishioka, Katsuhiro Tamura*, and Mitsuo Miyashita Department of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan Abstract The aim of this study was to find out the effect of Low-power He-Ne laser on the growth of yeast (Saccharomyces cerevisiae) cells under pressurized conditions. Laser was found to be able to retard the growth inhibitory effect of hydrostatic pressure thus stimulating the growth of yeast cells under moderate pressure of 50 MPa, a pressure that normally inhibits their growth. 1. I N T R O D U C T I O N Laser radiation has been widely and variedly used in medicine and biology. High-power radiation of laser can destroy normal and neoplastic tissues. On the other hand, low-power HeNe laser is widely used in the field of medicine for the treatment of postsurgical headaches, posttherapeutic neuralgia (PTN), failure of skin ulcers to heal, rheumatic arthritis, and bronchial asthma. It is known that the irradiation of low-power visible monochromatic red light such as He-Ne laser often stimulates metabolic systems in various cells and accelerates the growth [1 ]. Irradiation of laser caused stimulation of DNA synthesis in cell and enhanced cell division rate [2,3]. We studied the effect of low-power visible monochromatic red light, He-Ne laser, on the growth of yeast cells under high pressures up to 150 MPa. Hydrostatic pressure usually retards the growth of cells under moderate pressures up to 50 MPa. We used a low-power He-Ne laser to retard the effects of hydrostatic pressure on the growth of yeast. 2. M A T E R I A L S AND M E T H O D S

The yeast Saccharomyces cerevisiae IFO 10149 was grown at 30~ in YPD medium containing (g/l) glucose, 20; polypeptone, 20; and yeast extract 10. Cultures in the logarithmic phase of growth were used. Logarithmic phase cells were suspended in fresh YPD medium and incubated for 0 - 120 min under various pressures at 25~ (room temperature), and then irradiated with He-Ne laser (8.5 mW, wavelength 632.8 nm, Senko Medical Instrument Mfg.). A high pressure vessel (130x130x130 mm) with optical windows was used for the irradiation of laser under high pressures up to 150 MPa (Fig. l). Optical power of laser was measured by ADVANTEST Optical power multimeter Q8221 type. The viable cell numbers were determined by counting colonies on YM agar medium containing (g/l) glucose, 10; agar, 20; polypeptone, 5; yeast extract, 3; and malt extract, 3, after incubation for 3 days at 30~ and comparing with those of the non-irradiated controls.

114

Figure 1. High pressure system with He-Ne laser. 1. High pressure pump, 2. Bourdon gauge, 3. High pressure vessel, 4. Inner sample cell, 5. Sapphire window, 6. He-Ne laser system, 7. Optimical power meter.

Table 1

The time course of dose at the inlet surface of inner sample cell Time / min Dose / 104 J m -2

20

40

60

80

100

120

4.60

9.20

13.79

18.38

22.99

27.59

3. RESULTS It is known that maximum biomass in yeasts is accumulated at the wavelength of 632.8 nm of He-Ne laser [2]. The dose of the laser at the inlet surface of the inner sample cell which contains yeast suspension is shown in Table 1. Figure 2 shows the numbers of viable cells of irradiated and non-irradiated yeasts at various pressures of 0.1 to 120 MPa. At atmospheric pressure, yeast cells irradiated with He-Ne laser showed pronounced growth enhancement which was much higher than that of the non-irradiated controls. The difference in number of viable cells between irradiated and non-irradiated ones increased with increase in irradiation time from 20 up to 120 min. At 50 MPa, the growth of non-irradiated yeasts was found to be inhibited, however, the viable cell numbers of irradiated ones were increased. The rate of increase in number of viable cells corresponded to that of the non-irradiated ones at 0.1 MPa. At 100 MPa, the viable cell numbers became constant regardless of the period of irradiation, although they were higher than those of the non-irradiated yeasts. The effect of laser irradiation completely disappeared at pressures higher than 150 MPa. Figure 3 shows viable cell numbers of irradiated and non-irradiated yeasts after 120 minutes at various pressures (A) and the differences between them (B). The number of non-irradiated cells decreased monotonously along with increase in pressure, but irradiated ones drew a gentle slope. The

115

2.5

2.5 0.1 MPa

50 MPa

2.0 o

Z

2.0

1.5

Z

1.5

Z

Z 1.0

Ip _o

0.5 0.0

,

0

,IL lw

t

!

20

40

1.0 0.5 "

irradiated non-irradiated I 60

I 80

------(3---.--irradiated non-irradiated ,qw

I 100 120

I 20

0.0

I 80

I 100 120

2.5

2.5

150 MPa

1O0 MPa

2.0

-----0

1.5

2.0 . irradiated non-irradiated

Z

Z

Z 1.(~ lw,

-,

0.5 0.0

I 60

Time / rain

Time / min

Z

I 40

0

t 20

t 40

t 60

t 80

Time / min

t I 100 120

9

irradiated non-irradiated

1.5 1.0 0.5 o.o 0

20

~ 40

~

60

~

80

t

..

100 120

Time / min

Figure 2. The effects of low-power He-Ne laser irradiation on the growth of yeast cells under various pressures. The data at 150 MPa overlapped completely.

difference between the numbers of irradiated and non-irradiated cells was maximum at 50 MPa. These results suggest that a low-power He-Ne laser stimulates the growth of yeast cells most effectively at 50 MPa, a pressure under which yeast cells normally can grow no longer. The results of experiments performed to investigate the effect of laser irradiation on the growth of yeast cells at 50 MPa for various periods of times ranging from 20 to 120 min are depicted in Fig.4. Without irradiation, the growth of yeast cells was found to be ceased at 50 MPa. However, they did not loss their viability. The growth was also completely ceased when the irradiation was stopped after exposure for 20, 40 or 60 minutes and the number of viable cells became constant up to 120 minutes as shown by each dashed line. These results suggest that we can obtain desired number of viable cells by changing irradiation time at 50 MPa, a pressure that normally inhibits their growth. On the other hand, at 0.1 MPa (atmospheric pressure) the dashed lines of 20, 40 or 60 minutes' irradiation overlapped each other on the solid line of 120 minutes' irradiation (the figure is not shown). Therefore, irradiation of yeast cells for a period exceeding 20 minutes had virtually no effect on their growth at atmospheric pressure.

116

2.5

0

irradiated

1.0/

2.0 1.5

0.6

Z ~ 1.0 2:

~

0.5 0.0

/

~

o

120min

,,

o.4

0.2

0

50

~,

150

100

Pressure / MPa

0.0

0

50 1O0 Pressure / MPa

150

Figure 3.

The effects of low-power He-Ne laser irradiation ( 120 min) on the growth of yeast cells under various pressures.

2,5

"

50 MPa

2~I 1

J

0.5 0.0

0

I

20

I

40

I

60

I

Figure 4. The effects of low-power HeNe laser irradiation on the growth of yeast cells at 50 MPa. Irradiation time: O , 0 min (nonirradiated) ; A , 20 min ; V , 40 min ; ~ , 60 min ; Q), 120 min (full time) . :irradiated, :non-irradiated.

I

80 100 120

Time / min 4. R E F E R E N C E S 1 T.I. Karu, Photobiology of Low-power Laser Therapy, Harwood Academic Publishers, 1989. 2 T. I. Karu, IEEE J. Quantum Electronics, QE-23 ,(1987) 1703. 3 J. S. Kana, G. Hutschenreiter., D. Haina and W. Waidelich, Arch. Surg., 116 (1981) 293.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

117

Pressure-induced molten globule states of proteins P. Masson and C. Cl6ry Centre de Recherches du Service de Sant6 des Arm6es, Unit6 de Biochimie, 24, av. des Maquis du Gr6sivaudan, 38702 La Tronche c6dex, France

Abstract Under mild denaturing conditions proteins undergo transitions toward partially unfolded states called "molten globules". Moderate pressures can inactivate enzymes and cause protein denaturation without extensive conformational changes. Several lines of evidence indicate that pressure in the range 0.5 - 1.5 kbar can induce molten globule transitions. In this paper, the subject of pressure-induced molten globule states is reviewed. This is followed by practical considerations on gel electrophoresis under hydrostatic pressure. This technique is used to detect increase in hydrodynamic volume of proteins that accompanies molten-globule transitions. High pressure electrophoresis and measurements of ANS binding were applied to cholinesterases. Results indicate that pressure denaturation of these enzymes is a multistep process ; intermediates have characteristics of molten globules.

1. I N T R O D U C T I O N In the past few years, growing attention on protein folding/unfolding [1, 2, 3] and emerging applications of high pressure in biotechnology [reviewed in : 4, 5, 6, 7, 8] have renewed interest in high pressure effects on the structure and functions of proteins. The purpose of this overview is to discuss the effects of moderate pressures on proteins. In this respect we will present results dealing with the pressure dependence of hydrodynamic parameters of proteins with special reference to denaturation of cholinesterases (EC. 3.1.1.7 and 8) as model proteins.

2. M O L T E N GLOBULES INTERMEDIATES

AS

PROTEIN

FOLDING/UNFOLDING

The intrinsic stability of proteins is the result of a delicate balance between stabilizing and destabilizing interactions [9, 10, 11]. Thus, the native conformation of

118 proteins is marginally stable and protein unfolding occurs by changing the environmental conditions. Unfolding transitions can be either reversible or irreversible and even for small single-domain proteins, the existence of folding intermediates has been recognized [12]. Among the intermediates, the existence of a native-like folding state which does not have the typical amino acid tight packing of native state was predicted in the early 1970s by Ptitsyn and his co-workers [13]. These authors introduced the concept of "molten globule" (MG), but the term "molten globule", which specifies that this intermediate is compact but liquidlike and fluctuating, was proposed by Ohgushi and Wada [14]. Actually, the first MG state was discovered in 1981 by studying acid-induced denaturation states of model ct-lactalbumins [15]. It appears now that the MG state is an equilibrium denatured state for proteins submitted to mild denaturing conditions such as low temperatures, low concentrations of guanidinium chloride, or moderate pressures. Also it is now well accepted that the MG state is a major kinetic intermediate of protein folding. It is also becoming clear that there is a structural continuum of MG states from "highly ordered" MG states that are less ordered than the native state [16] to "pre-molten globule" states that are more ordered than the unfolded state [17]. However, the mechanisms responsible for the conformational stability of the MG states are still unclear. Indeed, the thermal unfolding of MG states indicates that there are two types of MG : the first one shows cooperative thermal unfolding that can be approximated by a two-state transition, whereas the second one shows gradual unfolding. Recent results suggest that a combined mechanism of the two-state and gradual transitions would provide a better description of unfolding transitions of MG states [18]. Molten globules have the following characteristics : they are compact denatured states that retain most of the secondary structure of folded states, but have a disordered tertiary structure with largely flexible side-chains, and high mobility of loops and ends of the polypeptide chain [19, 20, 21 ]. Their hydrodynamic radius is 10-20 % greater than that of native conformations. Proteins in the MG state have also an increased hydrophobic surface as evidenced by : a) increased binding of hydrophobic probes such as ANS (8-amino-l-naphtalene sulfonate)[22], bis-ANS or cis-parinaric acid ; b) increased quenching of tryptophan fluorescence by acrylamide ; c) tendency to aggregate. Enzymes in MG state are inactive. The compactness of MG can be estimated by determining adiabatic compressibility using ultrasonic velocimetry [23, 24]. The energetics of MG states can be directly determined by differential scanning calorimetry [25].

3. PRESSURE-INDUCED DENATURATION OF PROTEINS Hydrostatic pressure is a unique tool for obtaining thermodynamic and structural information on conformational and structural equilibria of macromolecules. Indeed, unlike other perturbants, pressure acts only on interatomic distances of molecular and macromolecular assemblies. Therefore, pressure affects the structure of folded polypeptide chains by altering inter and intramolecular weak interactions responsible for stability of native forms, but in the pressure range of most biochemical and biophysical studies (0.1 MPa to 1500 MPa, i.e., 1 bar to 15 kbar), pressure does not affect the primary structure of proteins. The extent and the reversibility of functional

119 and structural pressure-induced changes depend on both the pressure range, the rate of compression and the exposure time under pressure. Pressures of magnitude less than 3 kbar (300 MPa) can induce dissociation of oligomeric assemblies [26] and partial denaturation of proteins. Although moderate pressures do not affect significantly the tertiary structure of proteins, they may cause inactivation of enzymes. The fact that moderate pressures do not disrupt secondary structures is due to the absence of effect of pressure on hydrogen bonds that are the stabilizing interactions of secondary structure. On the other hand, desorganization of tertiary structure presumably results from pressure-induced disruption of hydrophobic interactions. Unfolding of polypeptide chains occurs in general at pressures higher than 3 kbar that can be over 10 kbar. Hawley showed by electrophoresis under pressure that pressure denaturation of small single-chain proteins obeys apparently the simple two-state model [27]. However, change in intrinsic fluorescence of proteins and of ANS binding with pressure demonstrated that pressure denaturation is not an all-or-none transition but a complex phenomenon involving several steps and leading to a plurality of pressure-denatured protein states [28]. Complex denaturation processes involving stable intermediates have been probed by electrophoresis under pressure [29, 30]. However, major advances in study of pressure-induced denaturation of proteins can be obtained by spectroscopic methods, among them high-pressure NMR is becoming one of the most informative tool [31, 32]. In a previous study, we investigated the pressure denaturation of human butyrylcholinesterase (BuChE, EC.3.1.1.8) tetramer by Fourier transform-infra red spectroscopy up to 11 kbar. We observed no significant change in secondary structure below 3 kbar [33]. Yet, the enzyme was irreversibly inactivated above 2 kbar [34] and fourth derivative UV spectra corresponding to absorption of aromatic amino acids provided evidence for pressure-induced change in the environment of aromatic residues [35], which in turn reflects slight conformational changes. Unfolding started above 3 kbar and was complete at 8 kbar. Upon releasing the pressure, there was no return to the native conformation and fluorescence measurements under pressure indicated formation of aggregates of irreversibly denatured BuChE. Moreover, although this enzyme is a tetramer, it is not dissociated by pressure. The molecular basis for this resistance to pressure is not completely elucidated. However, the four subunits appear to be held together by their C-terminus which contains an array of tryptophan residues on the apolar ridge of a helical segment. These residues may form a "tryptophan zipper" whose stability is strengthened by pressure [35]. So, numerous lines of evidence argue for complexity of pressure denaturation and multiplicity of pressure-denatured states of proteins.

4. TEMPERATURE, SOLVENT AND COSOLVENT EFFECTS The effects of pressure can be modulated by other environmental parameters : temperature, pH, solvent and chemical composition of the medium, in particular salts and low molecular weight additives acting as osmolytes. Temperature changes induce simultaneous changes in energy and volume, but as a general rule, the effects of temperature on weak interactions are opposite to those of pressure [36]. The combined effects of pressure and temperature on protein structure can be represented by pressure-temperature denaturation transition maps of constant free energy difference [37]. So, pressure, e.g., up to 2 kbar, may increase thermal

120 stability of mesophile enzymes [38] and macromolecular assemblies [39]. Enzymes from extreme thermophiles have been found to be pressure stabilized against thermal inactivation [40], but this cannot be generalized [41]. Although the importance of water in pressure-induced denaturation of proteins has long been recognized [42], the influence of solvent has not been intensively investigated. Yet, high-pressure studies can be performed in heavy water instead of water as buffer solvent. Indeed, heavy water has been found to shift the pressure denaturing threshold toward high pressures [43, 44]. The protective effect of heavy water presumably reflects the strengthening of hydrophobic interactions in the presence of heavy water. Regarding organic solvents, there is indication that pressure/thermal denaturation of proteins may be retarded in neat non polar solvents [45] and in reversed micelles [46].

5. M O L T E N PROTEINS

G L O B U L E S AS P R E S S U R E - D E N A T U R E D

STATES

OF

The nature of pressure-denatured states of proteins has long been badly characterized. There are now numerous evidence that denatured states of proteins induced by pressures lower than 3 - 4 kbar are more compact than denatured states induced by heat or chemical denaturants. These pressure-denatured states do not show a well organized tertiary structure, their secondary structure is essentially unaltered and they have the ability to bind hydrophobic probes. Thus, they display characteristics of molten globules [26]. However, few data on molecular dimensions of pressure-denatured states of proteins have been reported to date. Measurements of diffusion coefficients by light scattering under pressure showed that the hydrodynamic radius, RH, of bovine serum albumin passes through a shallow minimum and above 1 kbar increases monotonously with pressure [47]. A more complex pressure dependence of hydrodynamic radius has been found for lysozyme 9initially RH is independent of pressure, but between 1.2 kbar and 2.3 kbar it decreases by approximately 3%, then RH increases and eventually reaches a plateau beyond 4 kbar [48]. Such a behavior is not clear and would suggest that the initial response of proteins to pressure is a contraction. The following size expansion at higher pressures corresponds to penetration of water into the protein structure.

6. INVESTIGATION OF MOLECULAR SIZE OF PRESSURE-DENATURED PROTEINS Among hydrodynamic methods, size exclusion chromatography (FPLC) has proven to be a convenient tool to evaluate with accuracy molecular dimensions of proteins conformers, solvent-induced changes of protein Stokes radii and to provide evidence for MG state [49]. However, chromatographic techniques are difficult to adapt to high pressure. On the other hand, polyacrylamide gel electrophoresis which has long been used to estimate size of proteins [50] and to characterize their denatured states [51] has also been successfully adapted to high pressure [for a review, see 52]. So, gel electrophoresis under hydrostatic pressure is ideally suited to the study of

121 pressure-induced MG state, as it gives a measure of changes in the hydrodynamic volume of proteins. In our laboratory, monitoring the pressure-induced changes in hydrodynamic radius of proteins is achieved by electrophoresis under pressure in multiple capillary gel rods of different acrylamide concentrations [52]. The mobility (m) of proteins in polyacrylamide gels is related to the acrylamide concentration (% T) according to the empirical Ferguson relationship (1)

log m = log Yo- KRT

where Yo is the mobility at T - 0% and KR is the retardation coefficient. The ordinate intercept Yo depends on the charge, size and shape of the protein ; KR depends on the size [50]. Assuming sphericity of the protein, KR may be related to the protein molecular radius (R) according to the equation, KR1/2 = c (R + r) (2) where c is an experimental constant and r the radius of the polyacrylamide fiber. Since R>> r, it follows 9 KR ~ c 2 (3Vh/4Jt) 2/3

(3)

where Vh is the hydrodynamic volume. The values of KR have also been found to depend on protein conformation [53] and to vary with pressure [52]. So, any change in KR can be related to changes in conformation and hydrodynamic volume (AVh). K~ 2 AV h ~ c-37-,2-. . AK R 2n

or

KR,p

KR,O

....

Vh,p

)2/3 (4)

Vh,o

where subscripts P and 0 refer to values at pressure P and at atmospheric pressure, respectively. We used this electrophoretic technique to investigate the effect of moderate pressures, lower than 3 kbar, on the structure of different cholinesterases. Pressureinduced overall conformational changes of these enzymes have been detected by construction of Ferguson plots at different pressures and measuring KR changes as a function of pressure. As shown in Fig. l, replot of KR against pressure for human BuChE indicates that KR was almost constant at pressures up to 1.25 kbar. Above this pressure threshold, KRincreased up to about 1.5 - 1.75 kbar and then decreased. This transient increase in KR suggested to us that human BuChE had undergone a transition toward a conformational state whose hydrodynamic radius is about 20% greater than that of the native enzyme. As we pointed out, swelling of protein structure is one of the characteristics of the MG transition. To test the hypothesis of a pressure-induced MG transition and to examine the contribution of hydration changes to human BuChE volume change, electrophoreses were performed in the presence of osmolytes at high concentration (2 M sorbitol, 1 M sucrose, 0.5 M glycine in buffers). Under these conditions, KR did not significantly

122 change up to 3 kbar, suggesting that osmolytes counteracted the pressure-induced swelling of the enzyme [62]. In addition, the enzyme was still fully active at 3 kbar, whereas in the absence of osmolytes it was irreversibly inactivated beyond 2 kbar. The protective effect of cosolvents may be interpreted in terms of preferential hydration, i.e., preferential exclusion of polyols or osmolytes from the protein surface [54]. The presence of the osmolyte shell increases the tension of the enzyme surface and strips water molecules off the enzyme hydration layer, which in turn counteracts the denaturing effect of pressure. It should be mentioned that the stabilizing effect of osmolytes against pressure induced-dissociation of oligomeric proteins [55, 56, 57] and denaturation of single-chain proteins [58] is well documented. To rule out possible artifactual effects due to change in buffer viscosity and change in polyacrylamide gel sieving properties with pressure, we studied the pressure dependence of KR of different wild-type, mutant, and chemically-modified cholinesterases which exhibit stability differences [34]. In addition, we studied the pressure dependence of the fluorescence intensity of ANS in the presence of these cholinesterase species. As shown in Fig. 1, monomer and dimer recombinant wild-type human ac6tylcholinesterase (ACHE, EC.3.1.1.7) behave exactly like the tetramer of wild-type human BuChE. On the other hand, monomer and dimer of recombinant Drosophila AChE did not exhibit any pressure dependence of KR up to 2.5 kbar. This behavior was unexpected since Drosophila AChE shows sequence homology with vertebrate cholinesterases that suggests similar folding [59]. However, the active site gorge of Drosophila AChE displays some differences that explain specific catalytic properties and sensitivity to inhibitors. Thus, certain amino acid residues lining the active site gorge of cholinesterases could be involved in the pressure sensitivity of these enzymes.

0.5

0/

-

0.4

BuChE

0.3 m

ad

rHuACIaE

Abr-~--..~" 0.2 \

0.1

rDrosophila AChE .,

0

t

0.5

I

1

I

1.5

t

2

I

2.5

P R E S S U R E (kbar)

Figure 1. Variation of the retardation coefficient, KR, of different cholinesterases with pressure in 8.26 mM Tris/0.1 M glycine pH 8.3 at 10~ human serum BuChE tetramer ; m, recombinant human AChE dimer ; A, recombinant human AChE monomer ; X, recombinant Drosophila AChE dimer ; +, recombinant Drosophila AChE monomer.

123 To test this hypothesis, we investigated the effect of pressure on KR of cholinesterases that have been modified in their active site gorge : a) human BuChE whose active site serine (S198) was irreversibly phosphonylated by an organophosphate (soman), b) human AChE mutants carrying point mutations either at the rim (D74N) or at the bottom (E202Q) of the active site. The methyl phosphonyl BuChE did not exhibit transient KR increase around 1.5 kbar, suggesting that it was insensitive to pressure in this pressure range. It should be remembered that in previous studies we found this phosphonyl conjugate more resistant to urea and pressure than the native enzyme [60, 34]. Moreover Raman spectroscopy revealed significant differences in secondary structure between the two enzyme forms [61]. Similarly, KR of AChE mutants was found to be pressure invariant in the pressure range applied, thus confirming our hypothesis. These results were corroborated by ANS fluorescence data. Indeed, the relative intensity of fluorescence of ANS bound to cholinesterases was found to be pressure dependent in a complex way. Binding of ANS to wild-type human AChE increases transiently with pressure up to 1.25 kbar, then drops and increases again beyond 1.5 kbar. This pattern indicates that low pressures in the range of 1 kbar promoted solvent exposure of patches of hydrophobic residues, which is consistent with the hypothesis of MG intermediates. On the other hand, there was no enhancement of ANS binding to the E202Q mutant up to 2.5 kbar and only a small increase to the D74N mutant. The fluorescence increase of ANS observed beyond 1.5 kbar for wild-type AChE presumably corresponds to the beginning of the highly cooperative unfolding of the polypeptide chain. Interestingly, we should point out that the pressure corresponding to the first fluorescence peak (1.25 kbar) did not coincide with the pressure giving the maximum values of KR (~1.75 kbar). Such a shift has already been observed during the pressure denaturation of human BuChE [62], suggesting that pressure induces the sequential formation of at least two MG states. Moreover, spectra were recorded overnight after the release of pressure; they did not reveal any time evolution, indicating complete irreversibility of the transition native state -> MG state. ANS binding and electrophoresis data support the view that denaturation of cholinesterases by moderate pressures is a multistep process consisting of at least two MG intermediates. Moreover, the fact that a chemical modification or single mutations of amino acids located down the active site or close to the rim of the active site gorge increased the stability of modified / mutated enzymes indicates that these amino acids play a key role in the conformational stability of cholinesterases. This in turn suggests that the active site gorge of these enzymes is flexible and hence very sensitive to environmental conditions. Thus, it may be hypothesized that the MG transition of cholinesterases is initialized by conformational / hydration changes occuring in this region.

7. CONCLUSIONS AND PROSPECTS Results on model enzymes presented in this paper and recent studies reviewed by [31] show that pressure is a powerful tool which can provide unique insights into the mechanisms of protein denaturation [63]. In this respect, molten globules may now be regarded as transition states in protein folding/unfolding processes [64]. Thus, characterization and conditions of generation of sub-transition states of proteins, e.g.,

124 "highly ordered" molten globule states should be achieved by fine pressure tuning. Applications in the field of protein engineering could come out in a very near future. For example, high pressure-assisted refolding of proteins appears to be a promising method to get E. coli expressed functional recombinant enzymes [65]. Possible medical applications can also be considered. Indeed, pressure inactivate viruses [66] without loss of the immunogenicity [67]. Therefore, pressure may be used for the preparation of killed vaccines. Moreover, since pressure-induced partial unfolding of viral proteins may uncover buried antigenic sites, pressure inactivation procedures could be particularly suitable for poorly immunogenic viruses. Lastly, limited or complete proteolysis of proteins under pressure is another promising field of research [6, 68]. Potential applications are production of low antigenic proteins and protein hydrolysates without allerginicity and improved digestibility [69].

8. ACKNOWLEDGEMENTS This work was supported by a grant from la Direction des Recherches et de la Technologie (DRET 94/5). The authors are grateful to Dr. A. Shafferman for providing recombinant human ACHE, and Pr. D. Fournier for providing recombinant Drosophila ACHE.

9. R E F E R E N C E S

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

T.E. Creighton, Biochem. J., 270 (1990) 1. R. Jaenicke and J. Buchner, Chemtracts, Biochem. Mol. Biol., 4 (1993) 1. K.A. Dill, S. Bromberg, K. Yue, K.M. Fiebig, D.P. Yee, P.D. Thomas and H.S. Chan, Prot. Sci., 4 (1995) 561. R. Hayashi, in : Engineering and Food 2, Spiess, W.E.L. and Schubert, H., Eds, Elsevier appl. sci., Amsterdam, (1989) pp 815-826. C. Balny, R. Hayashi, K. Heremans and P. Masson High Pressure and Biotechnology , John Libbey Eurotext Ltd, Paris, London, XXXV+ 565 p. (1992) S. Kunugi, Prog. Polym. Sci., 18 (1993)805. V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, TIBTECH, 12 (1994) 493. B. Tauscher, Z. Lebensm. Unters. Forsch., 200 (1995) 200, 3. C.N. Pace, TIBS, 15 (1990) 14 and TIBTECH, 8 (1990) 93. R. Jaenicke, Eur. J. Biochem., 202 (1991) 715. C.O. FdgS.in, Biochim. Biophys. Acta, 1252 (1995) 1. P.S. Kim and R.L. Baldwin, Annu. Rev. Biochem., 59 (1990) 631. O. Ptitsyn, Cur. Opin. Struct. Biol., 5 (1995) 74. M. Ohgushi and A. Wada, FEBS, 164 (1983) 21. D.A. Dolgikh, R.I. Gilmanshin, E.V. Brazhnikov, V.E. Bychkova, G.V. Semisotnov, S. Venyaminov, S. Yu and O.B. Ptitsyn, FEBS Lett., 136 (1981) 311. C.M. Dobson, Curr. Biol., 4 (1994) 636.

125 17 O.B. Ptitsyn, V.E. Bychkova and V.N. Uversky, Phil. Trans. R. Soc. London Ser. B., 348 (1995) 35. 18 I. Nishii, M. Kataoka and Y. Goto, J. Mol. Biol., 250 (1995) 223. 19 H. Christensen and R.H. Pain, Eur. Biophys. J., 19 (1991) 221. 20 O. Ptitsyn, Adv. Prot. Chem., 47 (1995) 83. 21 O. Ptitsyn in" Protein Folding, Creighton, T.E. Ed., Freeman & Co, N.Y., (1992) pp 243. 22 G.V. Semisotnov, N.A. Rodionova, O.I. Razgulyaev, V.N. Uversky, A.F. Gripas and R.I. Gilmanskin, Biopolymers, 31 (1991) 119. 23 B. N61ting and S.G. Sligar, Biochemistry, 32 (1993) 12319. 24 T.V. Chalikian, V.S. Gindikin and K.J. Breslauer, J. Mol. Biol., 250 (1995) 291. 25 D. Xie, V. Bhakuni and E. Freire, E. Biochemistry, 30 (1991) 10673. 26 J.L. Silva and G. Weber, Annu. Rev. Phys. Chem., 44 (1993) 89. 27 S.A. Hawley and R.M. Mitchell, Biochemistry, 14 (1975) 3257. 28 T.N. Li, J.W. Hook, H.G. Drickamer and G. Weber, G., Biochemistry, 15 (1976) 5571. 29 P. Masson, D.M. Arciero, A.B. Hooper and C. Balny, Electrophoresis, 11 (1990) 128. 30 L. Erijman, A.A. Paladini, G.H. Lorimer and G. Weber, G. J. Biol. Chem., 268 (1993) 25914. 31 J. Jonas and A. Jonas, Annu. Rev. Biophys. Biomol. Struct., 23 (1994) 287. 32 J. Zhang, X. Peng, A. Jonas and J. Jonas, Biochemistry, 34 (1995) 8631. 33 C. Cl6ry, K. Goossens, G. Hui Bon Hoa, K. Heremans, C. Balny and P. Masson, in 9Stability and Stabilization of Enzymes, van den Tweel et al., Eds., Elsevier, Amsterdam, (1993) pp 255. 34 P. Masson, P. Gouet and C. Cl6ry, J. Mol. Biol., 238 (1994) 466. 35 P. Masson and C. Cl6ry, in Enzymes of the cholinesterase family, Balasubramanian, A.S., Doctor, B.P., Taylor, P. and Quinn, D.M., Eds., Plenum Press, N.Y. (1995) pp 113. 36 W. Kauzmann, Adv. Prot. Chem., 14 (1959) 1. 37 S.A. Hawley, Biochemistry, 10 (197 l) 2436. 38 S. Makimoto, H. Nishida and Y. Tanigushi, Biochim. Biophys. Acta, 996 (1989) 233. 39 A. Goldbeck, M.D. Leichner, J. Witz, E. Nordmeier and K. Ibel, Eur. Biophys. J., 20 (1991) 151. 40 D.J. Hei and D.S. Clark, Appl. Environ. Microbiol., 60 (1994) 932. 41 J. Konisky, P.C. Michels, D. Clark, Appl. Environ. Microbiol., 61 (1995) 2762. 42 H. Wu, Chinese J. Physiol., 5 (1931) 321 (reprinted in 9Adv. Prot. Chem., 46 (1995) 6. 43 K. MUller, H.D. Liidemann and R. Jaenicke, R. Biophys. Chem., 16 (1982) 1. 44 P. Masson and C. Balny, Biochim. Biophys. Acta, 1041 (1990) 223. 45 J. Kim and J.S. Dordick, Biotechnol. Bioengn., 42 (1993) 772. 46 R.V. Rariy, N. Bec, J.L. Saldana, S.N. Nametkin, V.V. Mozhaev, N.L. Klyachko, A.V. Levashov and C. Balny, FEBS Lett., 364 (1995) 98. 47 B. Nystr6m and J. Roots, J. Chem. Phys., 78 (1983) 2833. 48 B. Nystr6m and J. Roots, Makromol. Chem., 185 (1984) 1441. 49 V.N. Uversky, Biochemistry, 32 (1993) 13288. 50 D. Rodbard and A. Chrambach, Anal. Biochem., 40 (1971) 95. 51 T.E. Creighton and D. Shortle, J. Mol. Biol., 242 (1994) 670. 52 P. Masson in 9High Pressure Chemistry and Physics, a practical approach, Isaacs, N.S., Ed. Oxford univ. press, in press, 1995.

126 53 D.P. Goldenberg and T.E. Creighton, Anal. Biochem., 138 (1984) 1. 54 S.N. Timasheff, Annu. Rev. Biophys. Biomol. Struct., 22 (1993) 67. 55 C.F.S. Bonafe, M. Villas-Boas, M.C. Suarez and J.L. Silva, J.L.J. Biol. Chem., 266 (1991) 13210. 56 M.J. Kornblatt, J.A. Kornblatt and G. HuiBonHoa, Arch. Biochem. Biophys., 306 (1993) 495. 57 A. Oliviera, L.P. Gaspar, A.T. Da Poian and J.L. Silva, J. Mol. Biol., 240 (1994) 184. 58 P. Cioni and G.B. Strambini, J. Mol. Biol., 242 (1994) 291. 59 J. Massouli6, L. Pezzementi, S. Bon, E. Krejci and F.M.Vallette, Prog. Neurobiol., 41 (1993) 31. 60 P. Masson and J.L. Goasdou6, Biochim. Biophys. Acta, 869 (1986) 304. 61 D. Aslanian, P. Grof, F. Renault and P. Masson, Biochim. Biophys. Acta, 1249 (1995) 37. 62 C. Cl6ry, F. Renault and P. Masson, FEBS Lett., 370 (1995) 212. 63 Mozhaev, V.V., Heremans, K., Frank, J., Masson, P. and Balny, C. (1996) Prot. : Struct. funct. Genet., in press. 64 G.J.A. Vidugiris, J.L. Markley and C.A. Royer, Biochemistry, 34 (1995) 4909. 65 Q. Zong, P.A. Osmulski, L.P. Hager, Biochemistry, 34 (1995) 12420. 66 E. Jurkiewicz,M. Villas-Boas, J.L. Silva, G. Weber, G. Hunsmann and R.M. Clegg, Proc. Natl. Acad. Sci. USA, 92 (1995) 6935. 67 J.L. Silva, in : High Pressure Chemistry, Biochemistry and Materials science, NATO ASI Series, Winter, R. and Jonas, J. Eds, Kluwer, Dordrecht, The Netherlands (1993) pp. 561. 68 E. Dufour,G. Herv6, T. Haertl6, Biopolymers, 35 (1995)475. 69 T. Nakamura, H. Sado and Y. Syukunobe, Milchwissenschaft., 43 (1993) 141.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

127

Pressure versus Temperature Behaviour of Proteins" FT-IR studies with the Diamond Anvil Cell K. Heremansa, P. Rubens a, L. Smellerb, G. Vermeulena and K. Goossens ~ aDepartment of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200 D, B-3001 Leuven, Belgium blnstitute of Biophyscis, Semmelweis Medical University, H-1444 Budapest, P.O.Box 263, Hungary.

Abstract

Pressure effects on the transformation of macromolecular food components are studied, in-situ, in the diamond anvil cell with Fourier-Transform InfraRed (FT-IR) spectroscopy. Pressure and temperature-induced phenomena in proteins, polysaccharides, bacterial cells and spores can be studied, For proteins, the infrared spectra point to stronger inter-molecular interactions in the temperature-induced in contrast to the pressure-induced gels.

I. INTRODUCTION

At the beginning of this century it was shown that one can cook an egg by subjecting it to high pressure [1]. It is now clear that these observations are the consequence of the unique behaviour of proteins [2-4]. The phase diagram for the conditions under which the native and the denatured conformation occur reflects the importance of the role of the change in heat capacity and compressibility between the native and the denatured state. These quantifies reflect the change in energy and volume fluctuations respectively of the protein in the solvent [5]. A molecular interpretation of these phenomena is based on the fact that pressure affects mainly the volume of a system thus damping the molecular fluctuations. Temperature effects are known to affect both the kinetic energy and the volume of the system. In this paper we illustrate some of the consequences of phase diagram for the denaturation of proteins. We first discuss the difference between the temperature and pressure denaturation of proteins and search for the molecular basis of the correlation between the denaturation temperature and pressure for the homologous a-amylases. The gel formation of ovalbumin is studied as a function of both temperature and pressure and

128 we show the important role of the protein concentration in determining the pressureinduced melting of the heat-induced gels as reported by Doi and coworkers [6]. In the last section we report on the pressure and temperature effect of proteins in emulsions and in the adsorbed state. The emphasis in this paper is on the use of FT-IR spectroscopy. This allows the analysis of aspects which are different and complementary to those of other techniques such as fluorescence and NMR spectroscopy. In addition to frequency shifts which allow the determination of denaturation pressure and temperature, analysis of the amide r band allows an in-situ observation of the changes of the secondary structure of the proteins. This provides a global view of the protein which is equivalent with the results that are obtained with the circular dichroism technique. However, for technical reasons the latter technique is not easily accessible for high pressure studies.

2. MATERIALS AND METHODS 2.1. High Pressure Infrared Spectroscopy with the Diamond Anvil Cell Proteins are dissolved in D20 or buffer solution and mounted in a stainless steel gasket of a diamond anvil cell. The mini-cell from Diacell Products, Leicester, UK, which has a rated maximum of about 50 kbar is quite convenient. Pressure is obtained from the ruby fluorescence with a Spex Raman spectrometer. The ruby technique has the advantage that it allows easier inspection of the sample under the microscope. Infrared spectra were obtained with a Bruker IFS66 FT-IR spectrometer equipped with a liquid nitrogen cooled MCT detector. The infrared light was focussed on the sample by a NaC1 lens [7]. 350 interferograms were coadded after registration at a resolution of 2 cm-1. The time between the registration of a spectrum at each pressure is about 15 min. 2.2. Analysis of the amide I' band of the infrared spectra The determination of the secondary structure of a protein from the analysis of the amide I' bandshape of the infrared spectrum, may be done by several approaches. First one may compare the specvmn with a database of the amide bands of several proteins with known secondary structure from X-ray data. This approach, sometimes called factor analysis, was developed for Raman spectroscopy [8]. For the analysis of the pressureinduced changes one would need a data set of reference proteins as a function of pressure. This is an impossible task since it implies a knowledge of all possible physical effects on the protein. Another complication is the pressure-reduced H/D exchange. The second approach is curve fitting of the amide r band. Since the bands are rather featureless, Fourier self-deconvolufion is often used to obtain resolution enhancement. The advantage of this procedure is that shifts in the band frequencies are allowed which are independent of any assumptions about the assignments of the subcomponents. In many instances, the assignments are not unequivocal [9].

129 We have therefore developed a method to determine the secondary structure of proteins and peptides as a function of pressure [10]. Although the method of selfdeconvolution combined with band fitting has been applied before by Susi & Byler [11], we apply it for the first time to pressure- and temperature-induced effects in proteins and peptides. Our method does give new information from an analysis of the frequency shifts as well as the changes in the area of the subcomponents of the amide I band on the effect of pressure and temperature on proteins. Fourier self-deconvolution, a mathematical technique of bandnarrowing, was performed either with the Brt~er software or with our own developed software [12]. The deconvolution and noise reduction factor to be used, depend on the quality of the spectral data. A Blackman-Harris apodization function was usecL In general we determine the deconvolution factor which gives the smallest errors in the determination of the individual components of the amide I' band and that gives the smallest residuum for the overal fitting procedure. The fractional composition in secondary structure was calculated from a fit of the Gaussian curves of the deconvolved specmun with a program developed in our laboratory that fits all the parameters simultaneously in contrast to Susi & Byler [11 ] who perform the fitting of the parameters consecutively. The initial values for our fitting were obtained from the second derivative of the deconvolved specmun. We have often observed that there is a systematic difference in the result of the fitting between a protein under ambient conditions in the temperature cell and the diamond anvil cell. This may be attributed to the fact that, at the lowest pressure that is needed to contain the liquid in the metal gasket, a few hunderd bars, the very slow H/D exchange is considerably enhance4 This induces small changes in the amide F band which are easily detected by the fitting procedure. Although this may affect the determination of the secondary structure in solution, it does not have a strong effect on the determination of the pressure-induced changes in secondary structure. Despite these restrictions, our approach allows a detailed analysis and comparison on the molecular level of the temperature- and pressure-induced changes in the secondary structure.

3. RESULTS AND DISCUSSION

3.1. Temperature and pressure-induced denaturation in a-amylases ~-amylases are a class of enzymes that catalyze the hydrolysis of starch and related carbohydrates. The enzyme from Bacillus lichemformis is the most thermostable although the organism itself is mesophilic [13]. We have explored the correlation between the temperature and pressure stability in three a-amylases with the aim to explain this in terms of the secondary structure of the proteins. The effect of temperature and hydrostatic pressure on the stability of three a-amylases from Bacillus species is studied with FT-IR to detect temperature and pressure reduced changes in the amide I' ban4 The spectra of all enzymes show a transition between 80 and 86~ At high temperature, the amide band becomes broad and shapeless. The most significant effect,

130 however, is the occurrence of new bands at 1614 cm -a and 1685 cm -~ which are assigned to aggregates linked with intermolecular [3-sheets [14, 15]. The high temperature spectra of the enzymes from B. lichemformis and from B. amyloliquefaciens have a high intensity band at 1655 cm -1 suggesting that there is still a certain amount of a-helical structure in the conformation of the protein. In contrast, at high temperature the most intense band of the enzyme from B. subtilis is at 1641 cm-~. This may be correlated with the formation of unordered structure. Thus for the a-amylase of B. subtilis the intramolecular [3-sheet is transformed into unordered structure and intermolecular 13-sheet structure.

Table 1. Temperature and Pressure Stability of a-amylases from Bacillus species as determined from the changes in the frequencies of the tyrosine sidechains with FT-IR in D20. Enzyme

tl/2 (~

Pl/2 (kbar)

B. subtilis

80

7.5

B. amyloliquefaciens

82

6.5

B. licheniformis

86

11.2

The infrared spectra reveal no changes in the amide I' band profile up to 1.5 kbar. The band begins to broaden at 5 kbar. At higher pressures the amide I' band in the spectum of the B. subtillis enzyme shows a decrease of the 1635 cm -1 and the 1655 cm-1 bands while a shoulder developes at 1645 cm 1 due to the formation of unordered stucture. In the spectra of a-amylase of B. amyloliquefaciens and B. licheniformis the band at 1655 cm-~ decreases in intensity. A broad band at 1645 cm-1 developes due to formation of unordered structure. The frequency due to the tyrosine ring vibrations was also used to determine the transition pressure and temperature. The position of this band is influenced by the formation of the hydrogen bonding of the OH group and this can be used as a probe for the denaturation. The temperature and pressure stability of the three enzymes expressed as the midpoint of the transition, determined from the frequency of the tyrosine band, is shown in Table 1. Similar results are obtained from the analysis of the amide I' banct For the temperature the following sequence is observed: B. subtilis < B. amyloliquefaciens < B. lichemformis. The pressure stability, however, shows the sequence: B. amyloliquefaciens < B. subtilis < B. lichemformis. We assume that the switch in stablility for the B. subtilis enzyme is correlated with the difference in secondary structure of this enzyme.

131 3.2. Pressure effect on heat-induced gels of ovalbumin Doi and coworkers [6] observed that heat-induced gels of egg ovalbumin melt at high pressure. A heat-induced gel containing 7% ovalbumin in 10 mM phosphate buffer (pH 7.0) melted completely at 600 MPa when treated for 20 rain at 20~ After pressure release, the gel reformed, suggesting that the effect is reversible. In our experiments we compare two solutions of albumin from chicken egg at two different concentrations. In a first experiment we pressurized to 10 kbar a solution containing 70 mg/ml protein in a phosphate buffer with a composition similar to that used by Doi et al. [6]. Except for the broadening of the band, no visible changes occured in the amide I' band suggesting a small effect of pressure on the protein. While still under pressure, the solution was then heated at 80~ during 20 minutes. Again the specmun, recorded after heat treatment, showed no dramatic changes in the amide I' band. In a second series of experiments the solution was first heated during 20 minutes at 80~ followed by pressure treatment at 14 kbar. After the heating, the amide r band showed a broadening of the bands at 1655 cm -1 and 1635 cm-~ as shown in Figure 1. Neither low nor high frequency bands were observed as is usually the case for heat treated proteins [14, 15]. This suggests that no intermolecular hydrogen bonding takes place. The pressurization caused, besides the broadening of the amide r band, no further changes in the spectrum. These experiments were repeated at a protein concentration of 150 mg/ml in Bis-Tris buffer at pD 7.0. In the first experiment the solution was first pressunzed at 10 kbar. The two bands that were present in the amide I' band at ambient conditions disappeared and we observed the formation of a broad shapeless amide r band with a maximum around 1645 crn-1 due to the formation of unordered structure. In a second step the same solution, while still under pressure, was heated again for 1 hour at 95~ Except for the broadening of the amide r band, no visible changes occured. In another set of experiments, the solution was first heated at 95~ for 1 hour. As shown in Fugure 2, the specmun shows two new bands at 1614 cm -1 and 1685 cm -1 typical for the formation of intermolecular 13-sheet. Parallel with the occurrence of the intermolecular sidebands there was a broadening of the amide r band with a maximum around 1635 cm -1 which is assigned to intramolecular 13-sheet. When this solution is pressurized to 13 kbar, a decrease in the intensity of the intermolecular sidebands and the formation of a broad shapeless center of the amide r band with its maximum around 1635 crn-~ is observect The fact that we do not observe changes in the infrared spectrum in solutions of low protein concentration (70 mg/ml) explains why Doi et al. [6] observed a pressure-induced melting of the heat-induced ovalbumin gels. At this concentration the spectra do not show the formation of the bands typical for intermolecular hydrogen bonding observed in many heat-denatured proteins [14, 15]. These gels are not stabilized by intermolecular hydrogen bonding and they are sensitive to changes in external conditions. At higher concentration (150 mg/ml), the proces of gel formation goes parallel with the formation of intermolecular 13-sheet. These gels are stronger and will only melt partially under high

132 pressure as observed from changes in the amide I' band. The heat-induced gels (150 mg/ml) show intermolecular hydrogen bonding in the amide F band. We conclude that these gels melt only partially under pressure because of the partial disappearance of the bands typical for intermolecular hydrogen bonding, This is similar to the behaviour that we have observed in a number of other proteins. It should be pointed out that pressure used in our experiments is considerably higher than used by Doi et al. [6].

f~

f J ~

/

/

/

/

\

/

~~\

/ =~ ~

1600

1625

1650

1675

/ ,

\

f~" ~

/~/

\ ~-~

~

\

Ap \

~\

I.O 1/)

At

1700

Wavenumber (cm-1)

Figure 1. Effect of heating (At) followed by a 10 kbar treatment (Ap) on the amide I' band of ovalbumin at 70 mg/ml.

1600

1625

1650

1675

1700

Wavenumber (cm -1)

Figure 2. Effect of heating (At) followed by a 13 kbar treatment (Ap) on the amide I' band of ovalbumin at 150 mg/ml.

The conclusion of our experimems is that pressure-induced melting of heat-induced gels is only possible for gels with weak intermolecular interactions. At higher protein concentrations, when intermolecular hydrogen bonding is strongly stabilizing the gel network, no melting of the heat-induced gels can be observe& It would of considerable interest to make a systematic study of the gels of this protein with theological techniques and to correlate the gel strength with the formation of mtermolecular hydrogen bonds as observed from the infrared spectra of whey protein concentrate [16, 17].

3.3. Proteins in emulsions and the adsorbed state Relatively few pressure studies have been performed on mixed lipid-protein systems or on systems in which proteins are present at interfaces. Buchheim and Abou E1-Nour [18] observed the induction of milkfat crystallization in the emulsified state by high pressure. Karbstein et al. [19] observed that emulsions of soybean oil, with whey protein

133 as emulsifiers, are stable at pH 7 up to 6 kbar. Such type of emulsions are an opporttmity to follow simultaneously changes in the physical state of the lipids as well as the denaturation of the proteins. An oil~eavy water (D20) emulsion of 30% soybean oil with 5% whey protein concentrate as an emulgator shows dearly separated infrared bands for the lipid and the protein in the infrared specmnn. Increasing the temperature of the emulsion shows the appearance of the bands at 1614 and 1685 cm-~ typical for intermolecular hydrogen bonding. This suggests that the protein is forming intermolecular aggregates while being at the interface between oil and water. A further analysis is in progress to find out whether the protein has the same conformation as in solution. The effect of pressure shows transitions in the lipids as well as in the protein. Both transitions occur between 2 and 3 kbar. For the lipids this could coincide with a partial transformation to the gel phase of the saturated lipids since it is tmlikely that the majority of the unsaturated lipids in soybean oil would undergo such a transformation at such low pressures. For the protein it coincides with the pressure at which 13-1actoglobulin denatures. Here also further analysis will show whether the protein undergoes a different conformational change at the interface as compared to the free solution. The results presented in this, as well as in other papers, has shown that protein unfolding is in many cases followed by intermolecular interactions. This makes a detailed analysis of protein denaturation a difficult process to analyse. Infrared spectroscopy is an ideal tool for the study of these aggregation processes since new bands occur which can be assigned with confidence to intermolecular antiparallel 13-sheet formation. We have found that it is possible to reduce the intensity of this band when chymotrypsinogen is adsorbed on silica-gel beads that have 6 nm pores. Several tests were performed to ascertain the adsorption of the protein to the surface. Increasing the temperature shows that the bands that can be assigned to intermolecular hydrogen bonding are considerably reduced for the protein that is adsorbed compared to the protein that is free in solution. Further analysis will show whether the absorbed protein has the same conformation as that in solution. Although these experiments are preliminary in nature, this approach shows that it is possible to separate the folding from the aggregation.

4. CONCLUSIONS The results of experiments presented in this paper show that infrared spectroscopy is a powerful tool for the study of a number of aspects related to pressure- and temperatureinduced phenomena in proteins. It is possible to relate the correlation between pressure and temperature stability with the secondary structure of proteins. Pressure effects on heat-induced gel formation can easily be monitored from the presence of intermolecular hydrogen bonds. In oil/water emulsions it is possible to monitor pressure-induced changes in the lipids as well as in the protein on the same sample.

134 Acknowledgement. This research is supported by the Research Fund of the Leuven University, by the National Fund for Scientific Research (N.F.W.O.) and by the European Union (AIR1-CT92-0296) and from a COST D6 action.

5. REFERENCES

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

P.W. Bridgman, J. Biol. Chem., 19 (1914) 511. K. Suzuld, Rev. Phys. Chem. Japan., 29 (1960) 91. S.A. Hawley, Biochemistry, 10 (1971) 2436. A~ Zipp and W. Kauzmann, Biochemistry, 12 (1973) 4217. ~ Cooper, Proc. Nat. Aca~ Sci. USA, 73 (1976) 2740. E. Doi,/k Shimizu, H. Oe and N. Kitabatake, Food Hydrocolloids, 5 (1991) 409. P.T.T. Wong, Can. J. Chem., 69 (1991) 1699. 1LW.Williams, Methods in Enzymology, 130 (1986) 311. M, Jackson and H.H. Mantsch, Crit. Rev. Biochem. mol. Biol., 30 (1995) 95. L. Smeller, K. Goossens and K. Heremans, Vibrational Spectr., 8 (1995) 199. H. Susi and D.M~ Byler, Methods in Enzymology, 130 (1986) 290. L. Smeller, K. Goossens and K. Heremans, Applied Spectr., 49 (1995) 1538. C. Weemaes, S. De Cordt, K. Goossens, M Hendrickx, K. Heremans and P. Tobback, Biotechnology and Bioengineering. 50 (1996) in press. A~H. Clark, D.H.P. Saunderson and/k Suggett, Int. J. Peptide Protein Res., 17 (1981) 353. A~A Ismail, H.H. Mantsch and P.T.T. Wong, Biochim. Biophys. Acta, 1121 (1992) 183. J. Van Camp and A. Huyghebaert, Food Chemistry, 54 (1995) 357. K. Heremans, J. Van Camp and A~ Huyghebaert, in Food proteins and their applications, A~ Paaraf and S. Damodaran (eds.) in press. W. Buchheim and A~M~Abou E1-Nour, Fat-Science Technology, 94 (1992) 369. H. Karbstein, H. Schubert, W. Scigalla and H. Ludwig, in Balny, C., Hayashi, IL, Heremans, K. & Masson, P. (eds.) High Pressure and Biotechnology, INSERM/ Libbey, (1992) 345.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

135

Pressure induced protein structural changes as sensed by 4th derivative UV spectroscopy R. Lange ~, N. Bec ~, J. Frank b and C. Balny ~

alNSERM U 128, BP 5051, 34033 Montpellier, France bKluyver Laboratory for Biotechnology, University of Delft, 2628 BC Delft, The Netherlands

Abstract We have elaborated and optimised a fourth derivative UV spectroscopic method based on a variable spectral shift. The selective enhancement of this method permits to quantify the local dielectric constant in the vicinity of aromatic amino acids. The method was applied to the study of pressure reduced structural changes of two proteins which are characterised by the dominant spectral contribution of tyrosine (ribonuclease A) and tryptophan (methanol dehydrogenase). At high pressure (400 MPa), Ribonuclease is in a partially unfolded molten globule like state which is characterised by a local dielectric constant of ~ = 59. Methanol dehydrogenase proved to be extremely stable towards high pressure. The cohesion of the quaternary structure of this protein appears to be reinforced by high pressure.

1. INTRODUCTION In theory, one of the easiest ways to study the effect of pressure on the threedimensional structure of proteins in solution, is UV spectroscopy. Indeed, between 250 and 300 nm, protein spectra are dominated by the contributions of phenylalanine, tyrosine and tryptophan. Since the spectra of these chromophores depend on the polarity of their environment, a pressure reduced spectral change of the protein can potentially help to characterise conformational changes. In practice, this task is however rather difficult because of overlapping individual electronic transitions which are broadened by their vibronic structure [ 1]. The problem can be overcome by taking the second or fourth derivative of the spectra [2,3 ]. Especially the fourth derivative method ensures a selective enhancement of spectral bands with narrow bandwidth and allows thus to obtain more information about spectral details such as shoulders, whereas abstraction is made of the broader bands arising from other chromophores and of eventual baseline shifts [4 ].

136

i

n

:: !"~

288

tyr

286 L,,.,, -

:

;. ~ ~i

'"~

!

:

i:

!l.:i'.," "!i

""

,,<1~ 284

~

~

".': i

;

'..;

282

~

9

i

i

,

,

I

. . . .

I

. . . .

I

. . . .

I

, ,

ii j:i

4 ~ [-' ' " ' I . . . .

9 ,

, ....

, ....

,

I-

..:.

.-

g ~ . iim 2 ,el

.!

i

I

i

I

260 270 280 wavelengLh

,1

,

290 (nm)

Figure 1. Effect of ethanol (0 to 100 %) on the 4th derivative spectra of tyrosine and tryptophan (red shift)

I

0

20 40 60 dielectric constant,

80 e

r

Figure 2. Variation of the spectral parameters of tyrosine and tryptophan as a function of the dielectric constant

The basis of the method is the variable shift of a specmun for a given wavelength (derivation window) and its subsequent subtraction from the original specmun. The derivation window is a very critical parameter. Its flexible use enables to enhance selectively certain absorbance bands. Care must be taken, however, since its uncontrolled use can also be misleading. Here we show how this method can be optimised for the spectral study of the aromatic amino acids. The method is then applied to the analysis of the pressure induced spectral changes of ribonuclease A and methanol dehydrogenase [5].

2. M A T E R I A L S

AND METHODS

Phenylalanine, tyrosine and tryptophan were used as theft acetyl-O-ethylesters. All solvents were of UV-grade quality. Ribonuclease A was from Sigma, St. Louis, and methanol dehydrogenase (MDH) was isolated from Methylophaga marina [6]. Sample solutions were placed in a quartz cuvette which was closed by a flexible membrane.

137 This cuvette was then placed reside a thermostated high pressure cell (Pmax = 500 MPa) which was equipped with sapphire windows. The cell was placed in the light beam of a Cary 3 spectrophotometer.

3. RESULTS AND DISCUSSION 3.1 Tyrosine and tryptophan The advantage of analysing complex UV spectra in the derivative mode can be understood readily when the mathematics of the derivative procedure are considered. To simulate what happens with a real spectrum in the course of the procedure, let us take a simple Gaussian type model. Here the amplitudes A at )Maaaxwith the lmewidth w are A = -8A0 ln(2) / w 2 and A = 192Ao In(2) 2 / w 4 for the second and fourth derivative respectively. Clearly, the amplitude of the derivative is greatly dependent on the spectral linewidth, and the fourth derivative is particularly suitable to enhance selectively spectral bands with a small bandwidth. For the derivation window a compromise has to be found between spectral resolution and derivative amplitude. Furthermore, when the derivation window is chosen too large, the resulting derivatives can become 0.2

r

0.1

C

0.0

-0.1

275

l,

. I

280

, .

I.

285

,

t

290

,

295

wavelength, n m

Figure 3. Effect of pressure on the fourth derivative specmnn of Ribonuclease A at pH 2 and 25 ~

138 meaningless. By a comparison with the Savitzky-Golay method and the analytical solution of the mathematical derivative of model spectra we have thus optimised the derivation window for phe, tyr and trp as 1.3, 1.6 and 2.6 nm respectively. As shown in Fig. 1, the 4th derivative spectra of tyr and trp are red-shifted when the polarity of the solvent is decreased. A systematic investigation of the solvent effect - from water to cyclohexane - on the UV spectra reveals a dependency on the polarity of the solvent. As shown in Fig. 2, a linear relationship was found between the dielectric constant and 3~ma• of the tyrosine derivative. A similar relationship was found for phenylalanine (data not shown). On the other hand, for tryptophan it is the maximum amplitude of the 4th derivative spectrum which was found to vary linearly as a function of the dielectric constant. Furthermore, the fourth derivative spectra of the aromatic amino acids vary only very little as a function of pressure (at least up to 500 MPa). It appears therefore, that if the application of pressure leads to a protein structural change, fourth derivative UV-spectra should help to quantify changes of the dielectric constant in the vicinity of the aromatic amino acids. In the following, we show two examples where we apply this method to pressure induced structural changes of proteins. 3.2. Ribonuelease

A

As shown m Fig. 3, at pH 2 and room temperature, the fourth derivative spectrum of ribonuclease A is shifted to the blue under high pressure. The wavelength at the maximum amplitude is shifted from 285.7 to 283.5 nm. As shown also in Fig. 4, the transition is fully reversible. The presence of clear isosbestic points indicates an equilibrium between two conformational states. Under the assumption that these spectral 0.2 to o3 t~

I

Figure 4. Reversible pressure dependent unfolding of ribonuclease A. The 4th derivative amplitude at increasing pressure is given in open circles; the results for pressure release in closed circles. The solid line represents the fit for a two-state model.

0.1

t,rio

0.0

,r "O

-0.1 100 200 300 400 500

pressure,

MPa

139 changes reflect an increase of the polarity in the environment of the tyrosines (this protein does not contain tryptophan), as it happens usually when these residues become exposed to the aqueous solvent, we can apply our scaling tool which we had developed for the pure aromatic amino acids in different solvents. According to Fig. 2, the transition corresponds to an increase of the mean dielectric constant from 25 to 59. This indicates, that although the tyrosines are in a more polar environment in the high pressure state, the protein is still not completely unfolded. The two-state fit of this transition in Fig. 4 yielded the following thermodynamic parameters AGO - 10.3 kJ/mol and AV = -52 ml/mol. The latter value is surprisingly small for a protein denaturation. Together with the only partly exposure of the tyrosine residues, a molten globule like structure [7] of the ribonuclease at high pressure can be assumed. Interestingly, when ribonuclease A is denatured by increased temperature at atmospheric pressure, the transition cannot be described by a two-state process. At least three steps are required to fit adequately the temperature induced denaturation. These steps overlap however, and it is not possible to study each step separately. Another problem is that at higher temperatures the transition becomes partly irreversible. Hence, pressure appears to be a more suitable variable to study the mechanism of protein folding and unfolding.

0.8

o r~ o ~n

0.6

450 M P a

--

.."

a

_

0.4

0.2 k

I

I

I

I

!

I

I

!

I

I

!

I

0.05 ~o

0.00

-0.05 285

290

wavelength,

295

nm

!

!

Figure 5. Effect of high pressure on the UV spectrum of methanol dehydrogenase; (a) zero order, (b) 4th derivative spectra from 1 to 450 MPa. The effect of 6 M guanidinium chloride is indicated in open circle symbols.

140 3.3 Methanol dehydrogenase This tetrameric enzyme is characterised by a tryptophan dominated UV specmma. From Fig. 5a it is apparent that a zero order recording in the UV is uninformative. All what can be seen is a general increase of the absorbance. However, the application of our fourth derivative spectroscopic method permits to perceive clearly a red shift of the maximum amplitude of the derivative from 291.1 to 291.5 nm. This region corresponds to the spectral shoulder observed in the zero order absorbance spectrum. This transition is fully reversible, and MDH retains its activity up to 450 MPa. For this enzyme again, the study of the unfolding by raising the temperature is complicated due to the fact that high temperature leads to an irreversible protein aggregation. The observed red shift as a function of pressure suggests a decreased mean polarity in the vicinity of the ~ t o p h a n residues of this enzyme. In contrast, when the protein is unfolded by the action of 6 M guanidmium chloride, a significant spectral transition into the other direction (shorter wavelengths) is observed. In fact, we were surprised, not to detect a blue shift as a function of pressure. Indeed, oligomeric proteins are generally believed to dissociate under high pressure - because of a weakening of electrostatic and hydrophobic interactions under pressure [8,9]. However, in the case of MDH, high pressure appears to strengthen the coherence of the quaternary structure. This phenomenon may be explained in several ways. For instance, one may speculate that water molecules are squeezed out of the intersubunit crevice. On the other hand, the effect of pressure on hydrophobic interactions in macromolecules is not quite clear actually. In view of the great importance of subunit interactions in biology, the possibility to follow the degree of solvent exposition of the aromatic amino acids as offered by the 4th derivative method, might be applied to many other proteins, as a complementary tool to study protein structure in solution.

4. REFERENCES 1 R. Lange, J. Frank, J.L. Saldana and C. Balny, Eur. Biophys. J. (1996) submitted. 2 W.L. Butler, Methods Enzymol. 56 (1979) 501. 3 R. Ragone, G. Colonna, C. Balestrieri, L. Servillo and G. Irace, Biochemistry 23 (1984) 1871. 4 E. Padr6s, J. Dufiach, A. Morros, M. Sab6s and J. Mafiosa, TIBS (1984) 508. 5 R. Lange, N. Bec, V.V. Mozhaev and J. Frank, Eur. Biophys. J. (1996) submitted. 6 M. Janvier, J. Frank, M. Luttik and F. Gasser, J. Gen. Microbiol. 138 (1992) 2113. 7 0 . B . Ptitsyn in T.E. Creighton (ed.) Protein Folding, Freeman, New York (1992) 243. 8 G. Weber in R. Winter and J. Jonas (eds.) High pressure chemistry, biochemistry and materials science, Kluwer Academic Publishers, The Netherlands (1993) 471. 9. V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Proteins (1996) in press.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

141

H i g h P r e s s u r e N M R S t u d y of P r o t e i n U n f o l d i n g Tohru Yamaguchi, Hiroaki Yamada & Kazuyuki Akasaka Division of Material Science, The Graduate School of Science and Technology, Kobe University, Nada-ku, Kobe 657, Japan

The thermodynamic state of solvent water around the exposed hydrophobic groups shares a definitive position in governing the thermodynamic stability of a protein. However, there is still much unknown about the state of water molecules surrounding a protein. Pressure can cause a change in the interaction between a protein and its surrounding water molecules in a different way to temperature. Pressure can also act as an agent to lower the freezing point of aqueous solutions of proteins making use of the singular dependence on pressure of solid-liquid equilibrium of water, by which cold denaturation is expected to be more clearly observable for aqueous solutions of proteins. Therefore, pressure can open another important dimension in studies on structural stability of proteins. For studies of protein unfolding under high pressure, such spectroscopic methods as UV absorption and fluorescence have been used (Brandts et al., 1970; Hawley, 1971; Zipp & Kauzmann, 1973; Li et al., 1976). In the NMR spectrum, signals from solvent molecules and polypeptide chains are clearly resolved, and integrated signal intensities are linearly correlated to the relative populations of the molecular species from which the signals are originated. Therefore, NMR spectroscopy is adopted in thermodynamic studies of protein unfolding to use with high pressure techniques. The present work is intended to study the thermodynamics of protein unfolding under pressure with the methods of high pressure NMR, aiming at the investigation of the effects of pressure on the structural stability of proteins as a final goal. The protein sample mainly used in this study is bovine pancreatic ribonuclease A (RNase A), which is known to exhibit two state transition in thermal denaturation. The method of high pressure NMR used in this study utilizes a pressure-resisting glass cell to realize a pressurized state that can be measured without an

142 alteration to NMR probe (Yamada, 1974). Two types of glass cell were used in this series of experiments at high pressures (Yamada et al., 1994). One is an on-line type cell with a long, fine capillary stretching out from a neck of the main body of the cell and is directly attached to a hand pump, which makes it possible to conduct experiments under constant pressures. The other is an off-line type cell in which a pressurized state is realized by the thermal expansion of a liquid sealed in the cell. In Fig. 1, 1H NMR spectra of RNase A under constant pressure of 2000 atm at different temperatures obtained by the on-line high pressure apparatus are shown. At t e m p e r a t u r e s under 0 ~

a resonance at different position to thermally dena-

tured conformers was observed, which seems to be originated from cold-denatured conformers. Q u a n t i t a t i v e analysis of the data obtained by the on-line type high pressure NMR a p p a r a t u s are now in progress.

10 5/119

A

12

10 ~ .~v,,,,~..,,

~

~,.,~.~.:.

.

.

.

.

.

.

^.

.-,

.

.

.

.

.

.

p~.

O~

-5 ~

D'

-10 ~

-15 ~ 90

8~

PP

Fig. 1. T e m p e r a t u r e dependence of 1H NMR spectra of the His eH region of ribo -nuclease A under constant pressure at 2000 atm.

143 Fig. 2 shows 1H NMR spectra of RNase A obtained by off-line type high pressure cell. Thermodynamic functions of protein denaturation were obtained from these spectra as follows (Yamaguchi et al., 1995). First, from the combined integral intensities of the His e proton signals of the folded against the unfolded, equilibrium constant K(p,T) was determined between the folded (N) and unfolded (D) conformers at each temperature and pressure using a relation K(p,T) = [D] / [N], from which AG, the Gibbs energy of the denatured state minus the Gibbs energy of the native state was determined from an equation AG(p,T) = -RT In K(p,T).

(1)

D

impurity

37.5

~

2000

atm

prn

'

" 9:0 . . . . . . . . . 105/119~

8:5 . . . . .

'

'

s'.5

25 ~ 1840

atm

12.5

9:o

.

.

.

.

.

.

.

.

.

.

.

.

.

atm . 90

1610

.

~

1680

7.5

.

.

.

.

.

.

.

.

.

.

.

.

.

.

s:5

.

8.5

.

.

.

~ atm '

'

9'0

.

.

.

.

.

.

.

.

.

.

.

.

.

.

Fig. 2.1H NMR spectra of the His eH region of ribonuclease A under different pressures. The integrated peak areas were used to obtain equilibrium constants for a given pressure and temperature, and the free energy difference between the native and denatured states was calculated from equation (1). In the first-order approximation, AG is a linear function of pressure. It follows that, when AG values at each temperature obtained from a number of cells were plotted against pressure, a line drawn on the points by best-fitting, the slope of which represents the volume increase upon denaturation AV, can be used to know values of

144 AG at various pressures, which gave AG values for the temperature range of 7.5 to 40 ~ and for the pressure range of 1 to 2000 atm. Finally, the calibrated AG values at constant pressures at various t e m p e r a t u r e s were best-fitted to the following equation AG(T) = (1- T/T d) AH(T d) +(T- T d) ACp- TACp In (Tfrd) ,

(2)

where T d is a melting temperature, AH(T d) is a change in enthalpy upon denaturation at T d and ACp is a heat capacity change upon denaturation, respectively.

o

~

o

-

_

-20

o

o

o

-25

o

280

290

300

310

temperature/K

Fig. 3.

Temperature dependence of the volume change upon pressure denatur-

ation (AV) obtained from the slopes of the plots of AG against pressure at various temperatures.

The curves showing the temperature dependence of AG under constant pressures (Fig. 3) indicated that pressure moves these curves downward to decrease AG, that is, pressure facilitates thermal denaturation. As shown in Fig. 4, the value of AV, which is usually negative for proteins, became more negative as temperature was increased. Among three thermodynamic parameters obtained from best-fitting listed in Table 1, ACp was found to decrease with increasing pressure, which became clear for the first time by the present study (Yamaguchi et al., 1995).

145

2.0 9 II 9 o

II

9

1 atm 500 atm 1000 atm 1500 atm 2000 atm

9

0

I 280

300

320

temperature/K

Fig. 4.

T e m p e r a t u r e dependence of Gibbs free energy change upon h e a t dena-

t u r a t i o n (AG) calibrated for constant pressure (dots) The solid lines are the leastsquares fittings to equation (2). The obtained p a r a m e t e r s are s u m m a r i z e d in Table 1.

Table 1. T h e r m o d y n a m i c p a r a m e t e r s of ribonuclease A upon h e a t denaturation. pressure atm

Td

AH(T d)

AS(T d)

K

kcal/mol

cal/mol 9 K

ACp kcal/mol 9 K

Tma~ K

1

315.4

43.2

136.9

1.79

292.2

500

313.0

37.6

119.9

1.61

290.5

1000

310.1

32.2

103.8

1.43

288.4

1500

306.7

27.2

88.6

1.25

285.7

2000

302.7

22.8

75.3

1.08

281.9

Td" d e n a t u r a t i o n t e m p e r a t u r e , AH(T d) 9enthalpy increase upon unfolding, AS(T d) 9 entropy increase upon unfolding, ACp" heat capacity increase upon unfolding, Tmax 9t e m p e r a t u r e at m a x i m u m AG.

146 AV is a parameter in which pressure effects are most clearly reflected, and ACp, whose characteristic positive value is believed to be originated from the exposure of non-polar groups hidden in the interior of the protein molecule to solvent water, is a decisive parameter that characterize the thermodynamic profiles of protein unfolding. It is a prevailing notion that, when protein molecules denature in aqueous solution, some ordered structure is formed around the exposed hydrophobic groups. From this point, an explanation on the temperature dependence of AV and the pressure dependence of ACp can be made as follows. As t em perat ure is raised, the ordered structure would melt down, resulting in a more negative value of AV, and the pressure dependence of AC, can be considered as arising from the break down of the structure of water around hydrophobic residues, which is rationalized by the fact that ice melts as pressure is increased. Thus, the present study suggests that pressure effects on the stability of proteins are through the change in the state of hydrophobic interaction existing between a protein molecule and the surrounding water molecules.

REFERENCES 1 J. F. Brandts, R. J. Oliveira & C. Westort. Biochemistry, 9, 1038, 1970. 2 S.A. Hawley. Biochemistry, 10, 2436, 1971. 3 A. Zipp & W. Kauzmann Biochemistry, 12, 4217, 1973. 4 T. M. Li, J. M. Hook III, H. G. Drickamer & G. Weber Biochemistry, 15, 5571, 1976. 5 H. Yamada. Rev. Sci. Instrum. 45, 640, 1974. 6 H. Yamada, K. Kubo, I. Kakihara, & A. Sera. In High pressure Liquids

and solutions.Y. Taniguchi, M. Senoo. & K. Hara eds. Elsevier science B.V., 1994. 7 T. Yamaguchi, H. Yamada, and K. Akasaka. J. Mol. Biol. 250, 689, 1995.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

147

Compressibility-structure relationships of protein: Compactness of denatured ribonuclease A Kunihiko Gekko Department of Materials Science and Graduate Department of Gene Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739, Japan

Abstract The conformational changes of ribonuclease A due to thermal and guanidine hydrochloride denaturation were monitored by means of precise density and sound velocity measurements. The adiabatic compressibility and apparent partial molar volume decreased on guanidine hydrochloride denaturation, but thermal denaturation showed the increase in compressibility and the decrease in molar volume, as found for pressure denaturation. The compressibility change was not correlated to a loss of the secondary structure in the transition region. These results suggest that the conformation of protein partially denatured by guanidine hydrochloride, as well as by heat and pressure, remains as some molten-globule-like intermediates having the loose compactness and high flexibility.

1. INTRODUCTION The compressibility is a basic quantity for understanding the compactness or flexibility of protein molecules, denaturation mechanism, and structure-function relationships of proteins. During the past fifteen years, we have accumulated the adiabatic compressibility data of many globular proteins at native state [1-4]. The statistical analyses of them revealed some correlations between the compressibility and structural parameters such as the hydrophobicity, helix content, and amino acid composition [1,2]. Interestingly, we have recently found that the adiabatic compressibility is largely influenced by a single amino acid substitution [5]. These findings indicate that the compressibility reflects sensitively the characteristics of protein structure. Since the secondary structure and hydrophobic interaction of protein are broken on denaturation, compressibility should be a good measure of the compactness of denatured proteins or molten-globules which remains controversial. In this study, the apparent adiabatic compressibility and specific volume of ribonuclease A (RNase A) were measured as functions of temperature and guanidine hydrochloride (GuHC1) concentration [6]. The characteristic changes in the compactness of this protein due to both types of denaturation will be discussed in terms of the

148 modified internal cavity and surface hydration, compared with the results of pressure denaturation [7].

2. M E T H O D O L O G Y The sound velocity in protein solutions, u, was measured with an accuracy of 0.5 cm/s, by means of the "sing-around pulse method" at 5 MHz. The solution density, d, was measured in an accuracy of 1 • 10 .6 g/ml with a precision density meter DMA-02C (Anton Paar, Gratz). A given amount of RNase A solution (about 6 mg/ml) was introduced into the sample cells and the sound velocity and density were measured as a function of temperature or GuHC1 concentration. The same measurements were carried out with the respective solvents. Using the sound velocity and density data set of the sample solutions and solvents at a given temperature or GuHC1 concentration, the apparent adiabatic compressibility of protein in water, B~, was calculated with the Laplace equation, ~s =u2d The partial specific volume, v, which was calculated with a standard equation from the density data, can be expressed as a sum of the constitutive atomic volume (Vc), volume of internal cavity (Vc,v), and volume change due to hydration (AV~o0 which is usually negative value. v = Vc + Vc,v + AV~o~

(1)

Since the constitutive atoms may be regarded as incompressible (SVc/SP=0), the experimentally observed ~s would be mainly ascribed to the pressure effects on internal cavity (positive contribution) and surface hydration (negative contribution) as follows. [3s = - (1/v)(Sv/SP) = - (1/v)[(SVc~v/SP) + (SAV~offSP)]

(2)

Details of the experimental procedures and data analyses are described in the previous papers [2,6].

3. R E S U L T S AND D I S C U S S I O N 3.1. Guanidine hydrochloride d e n a t u r a t i o n Figure 1 shows the GuHC1 concentration dependence of the apparent specific volume, v, sound velocity increment per unit protein concentration, A u/c, and adiabatic compressibility, ~s, as a function of GuHC1 concentration at 15~ The dotted lines show the transition curves estimated from the ellipticity at 222 nm assuming a two-state transition. Evidently, these parameters are linearly dependent on the GuHC1 concentration in the pre- and post-transition regions. The results of the least-squares regression analyses for both regions are shown by the solid lines in Fig. 1. It is evident that the v and ~s values of the native protein are larger t h a n those of the denatured one at any GuHC1 concentration

149

examined. However, these values at a given GuHC1 concentration involve the contribution of GuHC1 binding to the protein, then the changes of molar volume (AVd) and compressibility (A~a) due to GuHC1 denaturation were estimated from the extrapolated values of the two linear lines in the pre- and post-transition regions to zero GuHC1 concentration. These results are shown in Table 1 with the free energy change of denaturation, AGd. and the GuHC1 concentration at the midpoint of the transition, Cm, which were calculated with the ellipticity data at 222 nm.

~

0.74 ...-.

>

0.55

~.. E E

E "~

0 . 6 5 ?

0

55O

....

, .... 1

, .... 2

, 3

. .

~

250

..-.

0

1

2

3

0

..-.

%

-20

..........................

-

20

30

40

50

~

0

....

- ~ " - - ~ " ~ " ~ - ~ , .... 10

, ..... ...., 20 30 40

50

10

20

50

10

E 0 X

~__..,o

-40

200 100

4

20

~

10

1

350-

150

0

400

b

450-

a

0.66 0.62

9 4

a

0.70

0

....

, .... , ......... 1 2 3 [ G u H C I ] (M)

4

Figure 1. GuHC1 concentration dependence of the apparent specific volume (a), sound velocity increment per unit protein concentration (b), and apparent adiabatic compressibility (c) of RNase A at pH 2.0 and 15~ The dotted lines show the two-state transition curves calculated from the eUipticity at 222 nm. (Taken from Tamura and Gekko [6])

"

-10

-

0

30

40

Temperature(~ Figure 2. Temperature dependence of apparent specific volume (a), sound velocity increment per unit protein concentration (b), and apparent adiabatic compressibility (c) of RNase A at pH 1.90. The dotted lines show the two-state transition curves calculated from the ellipticity at 222 nm. (Taken from Tamura and Gekko [6])

150 Table 1 Changes of partial molar volume (AVd) and compressibility (A~d) due to GuHC1, thermal, and pressure denaturation of RNase A (a) GuHC1 denaturation (15~ pH

2.0

C,. a (M) 1.86

AGd b (kcal/mol)

(ml/mol)

15.4

- 830

A~d • 1012 (cm2/dyn)

AWd

- 25.1

(b) Thermal denaturation (15~ pH

Tm c

(~ 1.60 1.90 2.08

AGd b (kcal/mol)

23.0 25.8 28.7

7.2 10.4 13.2

(ml/mol)

AJ3d• 1012 (cm2/dyn)

- 320 -490 -670

7.6 5.5 3.3

AVd

(c) Pressure denaturation (Brandts et al. [7]) pH

Temp. (~

2.0 2.0

23.7 27.5 ,

AVd (ml/mol) -46.5 --43.0 ,

ABd• 1012 (cm2/dyn) 1.5 2.0

,

a The GuHC1 concentration at the midpoint of the transition. b The free energy change of denaturation. c The thermal denaturation temperature. (Taken from Tamura & Gekko [6])

The volume change of unfolding in water at pH 2.0 is - 0 . 6 1 mug, which corresponds t o - 8 3 0 ml/mol. The negative compressibility of native protein ( 4.0 • 10-12 cm2/dyn) is due to a large hydration effect overcoming the cavity effect, since RNase A is one of the most rigid globular proteins [2]. The compressibility of denatured state, - 2 9 . 1 • 10-12 cm2/dyn, is comparable with those of amino acids in water. The large negative values of AVa and A~d support the general acceptance that the protein molecule is almost completely unfolded by GuHC1 although the expansion of polypeptide chain may be restricted by disulfide bonds. A noticeable point is that ~8 definitely deviates from the two-state transition curves estimated from the CD measurements (Fig.l). At the initial stage of

151 unfolding, the protein structure seems to remain compact despite the breaking of the secondary structure and the main exposure of amino acid residues would occur in the latter half of the transition over 2M GuHC1. Similar noncooperative disruption of the global structure and the secondary structure has been found on the urea and GuHC1 denaturation of some small globular proteins [8]. From the compressibility data, RNase A partially unfolded by GuHC1 seems to have some compact intermediate or molten-globule-like conformation having a compressibility comparable with that of the native structure. 3.2. Thermal denaturation Figure 2 shows the temperature dependence of the apparent specific volume, sound velocity increment per unit protein concentration, and adiabatic compressibility of RNase A at pH 1.90. The dotted lines show the transition curves estimated from the ellipticity at 222 nm assuming a two-state transition. Similar transition curves for v and ~s were observed at other pHs, 1.60 and 2.08. The v value increases with increasing temperature in the pre-transition region, followed by the gradual decrease due to thermal denaturation down to the level of post-transition region. The ~s value increases with temperature up to the denatured level, accompanying the complicated changes in the transition region. Deviations of the experimental values of v and ~ from the two-state transition curves (dotted lines in Fig. 2) means that the global structure or compactness may be disrupted in different manner from the secondary structure on thermal denaturation as found for GuHC1 denaturation. According to the small angle Xray scattering data of Sosnick and Trewhella [9], the radius of gyration slightly decreases at the beginning of denaturation and after passing the minimum it increases largely to the maximum value with temperature, then decreases to the denatured state level. The combination of these X-ray data and our compressibility data predicts that the partially denatured protein may have the more compact conformation than the native one and the nonpolar groups exposed by denaturation may cluster in the latter half or around the final stage of the transition. It is probable that the breaking of a small amount of helix contributes to increase the compactness of protein molecule since the helix elements, being rigid and bulky, would play a role of a dynamic domain in the protein structure [2]. The apparent molar volume and adiabatic compressibility changes due to thermal denaturation were estimated at 15~: by extrapolating the linear lines in the pre- and post-transition regions. The results at three pHs are listed in Table 1, in which the results of pressure denaturation [7] were also shown for comparison. The volume change (AVd) is - ( 3 2 0 - 6 7 0 ) ml/mol, the extent being larger at lower temperature and higher pH. The negative volume change can be explained if a protein is fully unfolded to increase hydration and decrease the amount of cavity. However, the change in cavity is not so easily rationalized for thermal denaturation although the amount of hydration should increase on breaking of the secondary structure. Many experimental data have demonstrated that thermally denatured RNase A remains in a compact conformation with some residual secondary structure. The ellipticity change at

152 222 nm due to thermal denaturation is about 65% of that due to GuHC1 denaturation. Similar level of difference was found in the free energy changes, AGd, of both types of denaturation (Table 1), which were calculated from the CD data assuming a two-state transition model. These results suggest that a considerable amount of cavity remains in the interior of the thermally denatured protein. An interesting point is that ~s increases on thermal denaturation (A~d > 0) while it largely decreases on GuHC1 denaturation. The negative volume change and positive compressibility change were also observed for pressure denaturation [7], the extent being smaller compared with thermal denaturation (Table 1). Judging from these volume and compressibility changes, the denatured structure may become more compact in the order of GuHC1 < heat < pressure denaturation. The finding that the compressibility increases despite the molar volume decreases cannot be explained by a simple hydrophobic model for denaturation, in which the compressibility change should be negative due to an increase in hydration and decrease in cavity. A possible explanation for this contradiction may be given if the local concentration of nonpolar groups is quite high in a protein molecule denatured by heat and pressure. The volume change for the rupture of hydrophobic bonds would be partly positive in protein systems as expected from the positive volume change of transfer of water into organic solvents [10]. Because the apparent compressibility of cavity is more than tenfold that of pure water [1], only a small amount of loosened cavity in nonpolar cluster would overcome the negative contribution of the increased hydration, leading to a larger compression of the denatured protein. As demonstrated in this study, the apparent molar volume and adiabatic compressibility sensitively reflect the conformational changes of RNase A on denaturation: the denatured structure of the protein becomes more compact in the order of GuHC1 < heat < pressure denaturation and the compactness is not necessarily correlated to a loss of the secondary structure in the transition region. Although these parameters involve the complicated contributions of hydration and internal cavity, the compressibility study could give new insights into the compactness and thermal fluctuation of denatured proteins which cannot be characterized by other spectroscopic techniques such as CD and fluorescence. 4. REFERENCES

1 2 3 4 5 6 7 8 9 10

K. Gekko and H. Noguchi, J. Phys. Chem. 83 (1979) 2706. K. Gekko and Y. Hasegawa, Biochemistry 25 (1986) 6563. K. Gekko and Y. Hasegawa, J. Phys. Chem. 93 (1989)426. K. Gekko and K. Yamagami, J. Agric. Food Chem. 39 (1991) 57. K. Gekko et al., Protein Science 5 (1996) in press. Y. Tamura and K. Gekko, Biochemistry 34 (1995) 1878. J.F. Brandts, R.J. Oliveira, and C. Westort, Biochemistry 9 (1970) 1038. K. Kuwajima, Proteins: Struc. Funct. Genet. 6 (1989) 87. T.R. Sosnick and J. Trewhella, Biochemistry 31 (1992) 8329. L. Boje and A. Hvidt, Biopolymers 11 (1972) 2357.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

153

Structure of pressure-induced "denatured" state of proteins Naoki Tanaka and Shigeru Kunugi Department of Polymer Science and Engineering, Kyoto Institute of Technology, Matsugasaki, Sakyo, Kyoto 606, J a p a n Abstract

Structure of pressure-induced denatured state of ~-lactoglobulin (LG) was investigated. The reactivity of the single SH group of LG, which is buried inside in its native state, was increased above 100 MPa, as a result of its exposure to the protein surface. When LG was incubated at 400 MPa (pH 6.8) for i hr, dimerization through intermolecular reaction of SH was observed. The generation of the covalently linked dimers were prevented by the presence of N-ethyl maleimide (NEM), an agent for SH-specific modification. Interand intra-molecular reactions of the SH group are suggested to be a main cause for the pressure induced irreversible denaturation of LG. 1.INTRODUCTION High Pressure can provide a useful method to perturb the environment of proteins, and it has been increasingly used in a variety of applications related to biochemical sysytems [1-5]. For example, proteolytic digestion under high pressure was used for the selective elimination of allergemc ~-lactoglobulin (LG) [1] in bovine milk whey. The marked difference in the protease-susceptibility under high pressure was observed for a-lactalbumin (LA), another component of milk whey. This can be explained as being due to LG losing its native structure under high pressure more easily than LA. In the recent studies, we have investigated the effect of pressure on the structure of LA and LG [6-8] to confirm this explanation. Dufour et al. investigated the effect of pressure on the structure of LG by fluorescence method, and found that pressure-induced denaturation of LG was irreversible at neutral pH though it was reversible at acidic pH [ 9 ] . Bovine LG has a single unpaired cysteine (Cysl21) and it is possible that pressureinduced irreversible denaturation of LG comes from the reaction of this residue. In this study, chemical reactions of the unpaired sulfhydryl group of ~lactoglobulin (LG) under high pressure and the role of this group in the irreversible denaturation were investigated.

154 2.EXPERIMENTAL ~-Lactoglobulin B was purchased from Sigma Co. (St.Louis, MO, U.S.A.). Water was purified by the Barnsted E-pure and used for preparation of sample solutions. N-ethylmaleimide (NEM) and 5,5'-dithiobis(2-nitro-benzoic acid) (DTNB) were obtained from Nacalai Tesque (Kyoto, Japan). Titration of buried SH groups by DTNB was performed under urea-denatured (8M) conditions as described by Ellman. For titration of SH of LG under high pressure, LG solutions with DTNB were incubated at an indicated pressure for an indicated period, and the absorbance of the released 2-nitro-5-thiobenzoic acid (TNB) was measured on a spectrophotometer (Shimadzu, 2200) after decompression. HEPES buffer (50 mM) was used for preparing solutions of neutral pH, and acetate buffer (50 mM) was used for acidic solutions. Incubations of LG under elevated pressure were performed by using a high pressure reaction vessel (Hyprex-7000-19-1, Yamamoto Hydraulic Pressure Ind., Toyonaka, Japan). The concentration of LG was 5-10 ~M. 3 . R E S U L T AND D I S C U S S I O N In the previous study, we investigated the effect of NEM on the fluorescence change of LG caused by high pressure, in both the intrinsic fluorescence of LG and the retinol fluorescence of the LG-retinol complex [8]. The control showed an irreversible change at neutral pH, but it became mostly reversible in the presence of NEM. Compatible results were obtained by CD spectroscopy: pressure treatment of LG induced irreversible change of the negative peak at near-UV region, but it was not observed in the presence of NEM. When LG was incubated at 400 MPa (pH 6.8)for 1 hr, dimerization through intermolecular reaction of SH was observed by SDS-PAGE in non-reduced condition. The generation of the covalently linked dimers were prevented by the presence of N-ethyl maleimide (NEM), an agent for SH-specific modification. The reactivity of the SH group of LG, which is buried inside in its native state, was increased by high pressure, as a result of its exposure to the protein surface accompanied by the pressure denaturation. In the previous study by NMR and FTIR, we have investigated the deuterium exchange reaction of the pressure-induced denatured state of LG [6]. H/D exchanges for LG at 100 MPa were detectable by NMR as a decrease in the amide proton signals, but they were detected less unambiguously by FTIR. This was explained by generation of an intermediary unfolding stage of protein was under moderately high pressure. The reactivity of SH group increased above 100 MPa because buried SH group is exposed at this pressure [8]. This result indicates that buried SH group of LG was exposed at intermediary unfolding stage. In the present study, reaction of SH group of LG was quantitatively analyzed.

155

Table I shows the DTNB titration of SH group of LG after the pressure treatment. 0.92 SH was t i t r a t e d for the intact bovine-lactoglobulin B. Incubation of LG at 400 M P a for l h r (pH 6.8) decreased the SH titer to 0.64. Under high pressure the single unpaired SH group reacted intermolecularly to form dimers or it was oxidized by the solubilized oxygen (its solubility being increased by increasing pressure). When LG was incubated with NEM for 1 hr under atmospheric pressure, 0.8 SH remained unreacted, which is consistent with the previous results that the rate of the reaction of SH group of native LG with NEM was slow. When LG was incubated at 400 M P a for 1 hr in the presence of 20-hold NEM, the SH titer became null and, under such high pressure, the SH group of LG reacted completely with NEM. This will be explained as follows: pressure induced the denaturation or deformation of LG and exposed the buried SH group to contact with NEM sufficiently.

Table I Effect of P r e s s u r e - t r e a t m e n t on the stoichiometry of SH of ~-Lactoglobulin Protein Sulihydrys founds 0.92 intact LG 0.64 Pressure-treated LG a 0.8 NEM-treated LG b Pressure-treated LG in the presence of NEM a,b a Pressure at 400MPa was applied for the p r e s s u r e - t r e a t m e n t for 1 hr. b Molar ratio for NEM to LG was 20:1.

Effect of pressure on the structure of LG has been investigated by CD m e a s u r e m e n t [8]. The negative peak of the native LG in the near-UV region completely disappeared after incubation at 400 M P a (pH 6.8) for 1 hr. This indicates t h a t tertiary structures of all LG molecules in the solution were affected by the pressure treatment. On the other hand, pressure t r e a t m e n t of LG decreased about 30% of SH group of intact LG. This indicates t h a t dimerization is not the only reason for the irreversible denaturation. Intramolecular reaction described in fig.1 occurred under high pressure and this also caused the irreversible denaturation.

156

ed)

~rmolecular exchange Intramolecular exchange ~ SH

S~ S

S Sf "~

121v~

] 121

~S

"-s Figure 1. Structure of pressure-mduced irreversibly denatured [~-lactoglobulin.

REFERENCES 1 Hayashi R., Kawamura Y. & Kunugi S. J. Food Sci. 52 (1987) 1107. 2 Hayashi. R. ed. "Use of High Pressure in Food" San-El press, Kyoto (1989). 3 Balny C. Hayashi R. Heremans K. and Masson P. ed. "High Pressure and Biotechnology" John Libbey Eurotext (1992) Montrouge, France. 4 Kunugi S.(1993) Prog.Polym.Sci.,18,805-838. 5 Kunugi S. ed. "High Pressure Bioscience" San-Ei press, Kyoto (1994). 6 Tanaka N. and Kunugi S. Int. J. Biol. Macromol. (1996) m press. 7 Tanaka N., Koyasu A., Kobayashi I. and Kunugi S. ibid. m press. 8 Tanaka N., Tsurui Y., Kobayashi I. and Kunugi S. ibid. in press. 9 Dufour E, Hui Bon Hoa G. and Haertle T. Biochim. Biophys.Acta, 1206 (1994) 166.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

157

Finite element study of protein structure under high pressure Takahisa Yamato Faculty of Technology, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184, Japan.

Abstract

Molecular dynamics simulations of the S-peptide of ribonuclease S in water at 1 atm and 1Ok atm were conducted. Conformational clusters were found in these dynamics trajectories. Pressure effects on peptide structures were investigated using a strain tensor analysis with Delaunay tessellation. A computer graphics technique was employed in the analysis. The whole structure of the S-peptide was divided into core parts in which atom packings were conserved and surrounding flexible parts.

1. INTRODUCTION Computer simulation techniques have the advantage of giving a detailed description of a biomolecular structure and movement of the atomic level. So far, pressure effects on the static and dynamic properties of proteins have been studied by the normal mode analysis [1] and molecular dynamics simulation technique [2]. The S-peptide of ribonuclease S is a short peptide consisting of 20 amino acid residues. It is known that the S-peptide forms a stable a-helix conformation at a low temperature around 5 ~ The temperature unfolding of an a-helical analog of the S-peptide was studied using molecular dynamics simulations [3]. Recently, the secondary structure of ribonuclease S at high pressures up to approximately 10k atm was studied using Fourier transform infrared spectroscopy [4]. This study showed that the protein is completely unfolded at high pressure. In the present work, molecular dynamics simulations of the S-peptide in water were performed at two different pressures (1 atm and 1Ok atm) for 50 ps. Conformational clusters were detected in each of the two molecular dynamics trajectories and these clusters were compared at the two pressures. A pair of clusters, one from the low-pressure trajectory and the other from the high-pressure one, was found for which intercluster RMS deviations were relatively small. The average structure was calculated for each of the pair of clusters. These average structures were compared by strain tensor analysis with finite elements. A computer graphics technique was employed to illustrate the tensor field of the pressure-strain imposed on the S-peptide.

158 2. M O L E C U L A R D Y N A M I C S S I M U L A T I O N S OF THE S-PEPTIDE Molecular dynamics simulations of the S-peptide were conducted using the IMPACT software [5]. Two NPT dynamics simulations were performed at 298 K for 50 ps. That is, the number of particles (N), pressure (P) and temperature (7) of the system were constant during the simulations. More precisely, fluctuations in the pressure and temperature were permitted around their target values. The values of target pressure were 1 atm in one and 1Ok atm in the other simulation. The conformational energy function with the AMBER parameters [6] was employed for the peptide, and the simple point charge (SPC) model [7] was used for water. The dielectric constant was fixed at 1.0. The equations of motion were integrated with a time step of 1 fs. The coordinates were saved every 50 fs. A list of nonbonded interactions, including the Lennard-Jones and electrostatic interactions, was updated every 5 steps (= 5 fs). These interactions were cut off at the distance of 8 ~, to accelerate the calculations. Periodic boundary conditions with the initial box size of 29.1 x 30.1 • 42.9 A3 were imposed. Thereby, the average distance between the van der Waals surface of the protein and one of the walls of the box became approximately 8 ~,. The size of the box was rescaled at each step to adjust the pressure. To control the temperature, the kinetic energy of the system was scaled every step. The initial conformation of the S-peptide of ribonuclease S (2RNS) was taken from the Brookhaven Protein Data Bank [8]. The atomic coordinates of the first 15 residues of the S-peptide were used. Because this structure was determined at pH 5.5, a histidine model protonated in the 6and e positions was used for His-12. Accordingly, the net charge of the S-peptide became le. To neutralize the system, a chloride ion was placed at a distance of 2.37 ,~, from a hydrogen atom of the NH3 + group in Lys-1. The total number of atoms in the peptide is 242 including all hydrogen atoms. The peptide was immersed in a box of water molecules equilibrated in advance. Water molecules colliding with the protein were removed. Thus, the number of water molecules in the box was 1142. The time dependence of the pressure, total potential energy, and density of the system is shown in Figs. 1A, 1B, and 1C, respectively. The pressure and density were reached at their equilibrium values within a few ps (Figs. 1A and 1C). The average density at 1Ok atm is approximately 1.25 times as much as that at 1 atm. The total potential energy quickly increased near t = 0 and relaxed to the equilibrium value within 5 ps (Fig. 1B). It seems that the system was sufficiently equilibrated in both of the simulations after 10 ps from the starting point. The RMS deviations from the crystal structure in the two simulations are shown in Fig. 2 as a function of time. In each simulation the RMS deviations quickly increased near t = 0 and then fluctuated around the average value. The average value of the RMS deviations in the low-pressure simulation is approximately twice that of the high-pressure simulation. In order to obtain a good picture of the conformational fluctuations of the S-peptide, the RMS deviations between all pairs of structures contained in the molecular dynamics trajectories (10 ps -'~ 40 ps) were calculated for both simulations. The average RMS deviations were ml - 0.81 and mlo k = 0.55 ~,, while the standard deviations of the RMS deviations were o l = 0.20 ~, and a 10 k = 0.18 A for P = 1 atm and P = 1Ok atm, respectively. Pairs of small deviations and large deviations are shown in the upper left triangles and the lower right triangles of Figs. 3A and 3B. There are several small black triangles along the diagonal lines of the two figures. This finding

159

!

10000 1 atm

5000

0

1 Ok atm

v,r,, v.

~ '~1,-.

" " ' w ~ ' " r " wW, " , ~

W,,'~ p" V .'*~

...................

, , ~ ,q,.,~ w ' , e - * , ~ , W . ~ l t

Pressure (atm)

Wl~

A i I

1 atm 10k atm

...........

-12000

Fig. 2. Time dependence of RMS deviations. The RMS (Root Mean Square) deviations from the crystal structure for the backbone atoms (N, C a, C, O) in the two simulations are shown.

-13000

Energy (kcal/mol)

40

Density (g/cm 3) 1.2

A

~"~

: ;Ill

.V

y,

_:

1 atm 10k

atm

,~, 30 &

..................

1.1 [-= 20

i

0

Time (ps)

10

C

10 10

20

Fig. 1. Time dependence of (A) pressure, (B) total potential energy, and (C) density of the system.

20 30 Time (ps)

40

20 30 Time (ps)

40

40

30 v ~D

Fig. 3. Map of RMS deviation, d, between pairs of 300 structures contained in the molecular dynamics trajectories (t = 10 ps "~ 40 ps) of the simulations at 1 atm (A) and at 1Ok atm (B). In the upper left of the figure, pairs with d less than m - o are shown by dots. In the lower right of the figure, pairs with d larger than m + o are shown.

E ~" 20

l0 10

160

Fig. 4. Schematic view of conformational fluctuations. The S-peptide is making several conformational clusters, while it fluctuates. It sometimes jumps from one cluster to another. The average size of these clusters is smaller at high pressure (1 Ok atm) than at low pressure (1 atm). These clusters are related to the black triangles appearing along the diagonal lines in Figs. 3 A, B.

Fig. 5. Schematic view of the energy landscape. The free energy shown in the figure is special in that the integration with respect to the protein coordinates are not done. Accordingly, this partly integrated free energy becomes a function of the protein coordinates.

'L

Fig. 6. Structure of the S-peptide. The average structure, , is denoted by thick solid line, while is shown as thin line.

Fig. 7. Strain tensor field in the S-peptide. The average backbone structure of is shown by the thick black line and that of is shown by the thick grey line. The principal axes of the strain tensors of the common Delaunay tetrahedra are shown in short segments. A strain tensor has three principal axes. Among them, only the axis with its eigenvalue's maximum absolute value is shown. The locations of the tetrahedra lost during the deformation from to are shown as dots.

161

indicates that there are some conformational clusters within which the RMS deviations between all pairs of structures are less than the threshold value of m - o. A schematic view of the fluctuations of the S-peptide in the conformational space is shown in Fig 4. Frauenfelder proposed that there are many mountains and valleys on the energy surface of a protein (Fig. 5) [9]. He indicated that the existence of substates of the protein structure and that these substates correspond to the valleys on such an energy landscape. These substates are called conformational substates. Pressure effects on the structure and dynamics of proteins may be twofold: (a) Pressure affects the structure of each substate. (b) Pressure affects the populations of conformational substates. It is important to investigate the pressure dependence of the free energy landscape for the understanding of the pressure effects on the structure and dynamics of proteins. Five conformational clusters found by inspection for each simulation are shown in Table I. Even though there is no direct evidence that these clusters correspond to the conformational substates, it is worthwhile making a structural comparison of these clusters between different pressures. For this purpose, the average RMS deviations were calculated between them (Table II). This table shows that the smallest value is between II1 and III10 k. It should be noted that the topographical metric introduced in an earlier study of protein fluctuation would be more suitable for this type of analysis [10]. The average structure of III10 k is superimposed on that of II1 and shown in Fig. 6. These structures are called and , respectively. If the II1 and III10 k clusters correspond to the same comformational substates, then the structural change from to should be classified as the pressure-induced deformation of type (a) mentioned above. In the next section, this structural change is studied using strain tensor analysis with Delaunay tessellation.

Table I. Conformational clusters. 1 atm I1

111 III1 IVI V1

130 160 210 280 380

ps ps ps ps ps

10k atm ~ ~ ~ ~ ~

150 180 230 300 400

ps ps ps ps ps

I10k II10 k III10k IV10k

Vlok

130 180 200 330 360

ps ps ps ps ps

~" ~ ~ ~ "~

150 200 220 350 380

ps ps ps ps ps

Table II. Average RMS deviations between conformational clusters.

11 111 III1 IV1 V1

IlO k

IIlo k

IIIlo k

IVlo k

V10 k

1.33 1.17 1.40 1.21 1.18

1.32 1.17 1.39 1.26 1.21

1.25 1.10 1.34 1.14 1.12

1.23 1.16 1.27 1.17 1.13

1.39 1.23 1.45 1.26 1.20

The RMS deviations (~,) between all pairs of structures (one from A1 and the other from B10 k, where A,B = I, II, III, IV, V) were calculated. The average values were then calculated for each combination of A and B.

162 3. STRAIN TENSOR ANALYSIS WITH FINITE ELEMENTS Strain tensor analysis was originally developed to study the pressure-induced deformation of myoglobin [ 1]. The method was combined with the Delaunay tessellation and computer graphics technique [ 11, 12]. In the present study, the structural change from to is described as the tensor field of the pressure-strain imposed on . All hydrogen atoms were neglected. Delaunay tetrahedra were constructed around buried atoms in each structure. To find the buried atoms, accessible surface areas (ASA) were calculated for all atoms. An atom was classified as buried when its ASA equaled zero. Delaunay tessellation was carried out using the method developed by Tanemura et al. [13]. The region, which underwent a continuous-body-like deformation, was defined by the common tetrahedra between and A tetrahedron was regarded as a common tetrahedron if the four atoms at its four vertices are conserved between and . Fig. 7 shows that the locations of the common tetrahedra are restricted around the backbone atoms which are not close to the N- and C-termini. On the other hand, lost tetrahedra surround them, reaching far from the backbone chain. The analysis shows that application of a pressure caused a packing rearrangement of the atoms in the region between the side chains. The RASMOL computer graphics program [ 14] was used for producing this figure.

4. ACKNOWLEDGEMENTS Computations were done at the Computer Center of the Institute for Molecular Science. This work was supported by grants-in-aid from the Ministry of Education, Science and Culture, Japan.

5. REFERENCES

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.

T. Yamato, J. Higo, Y. Seno, N. G6, Proteins 16 (1993) 327. D.B. Kitchen, L.H. Reed, R.M. Levy, Biochemistry 31 (1992) 10083. J. Tirado-Rives, W.L. Jorgensen, Biochemistry 30 (1991) 3864. N. Takeda, M. Kato, Y. Taniguchi, Biospectroscopy 1 (1995) 207. D.B. Kitchen, F. Hirata, J.D. Westbrook, R.M. Levy, M. Yarmush, J. Comput. Chem. 11 (1990) 1169. S.J. Weiner, P.A. Kollman, D.T., Nguyen, D. Case, J. Comput. Chem. 7 (1986) 145. H.J.C. Berendsen, J.P.M. Postma, W.F. van Gunsteren, J. Hermans, Intermolecular Forces, The Netherlands, Reidel, (1981) pp 331. E.E. Kim, R. Varadarajan, H.W. Wyckoff, F.M. Richards, Biochemistry 31 (1992) 12304. H. Frauenfelder, F. Parak, R.D. Young, Ann. Rev. Biophys. Chem. 17 (1988) 451. T. Yamato, M. Saito, J. Higo, Chem. Phys. Lett. 219 (1994) 155. T. Yamato, BUTSURI (In Japanese), 49 (1994) 305. T. Yamato, J. Mol. Graph., in press. M. Tanemura, T. Ogawa, N. Ogita, J. Comput. Phys. 51 (1983) 191. R. Sayle, RASMOL (Glaxo, U.K., 1994)

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

163

Pressure-induced dissociation of beef liver L-glutamate dehydrogenase Guo-Qing Tang and Kang-Cheng Ruan Shanghai Institute of Biochemistry, Academia Sinica, Shanghai 200031, China

Abstract Pressure-induced dissociation of beef liver L-glutamate dehydrogenase(GDH) was studied by fluorescence spectroscopy.The dissociation exhibited an anomalous concentration dependence which indicated the existence in the native protein of populations with different free energies o f the association o f monomers. The association was revealed to be driven by entropy increases. The observations obtained in the presence of bis-ANS suggested conformational changes upon subunit separation of GDH. Effects of substrate binding on the dissociation was also studied.

1. I N T R O D U C T I O N L-glutamate dehydrogenase from beef liver (E.C.1.4.1.3, GDH) is a homohexamer with Mr 3 32 kDalton. The form of hexamer is widely regarded as the smallest enzymically active unit[l]. Numerous studies were made based on observations of GDH polymerization above 0. lmg/ml regulated by various ligands [1]. However, few investigations were found upon its subunit interaction. Previous explorations employing the high pressure-induced dissociation of aggregates demonstrated that distinctly complex characters appeared in the equilibria, which had not been observed in the systems of small molecules, with the number of constitutive monomers from dimer to multimer even more complex self-assembling structure [2-6]. Two models, conformadonal drift that occurs following dissociation and appears to be the inevitable consequences of the displacement of subunit-subunit contacts by solvent-subunit contacts and heterogeneity in the free energies of association of ttie molecular population in higher oligomers, were proposed by Weber and co-worker [3-7]. In the present work, GDH was the first hexamer to be used to examine the generality of phenomena described above. In addition, its subunit interactions were also characterized thermodynamically.

2. MATERIALS AND METHODS Beef liver L-glutamate dehydrogenase (GDH) was purchased from Boehringer. The standard buffer(0.1 M Tris-Acetate, pH 8.0, 0.01M phosphate, 0.001M EDTA and DTY) was used. Unless stated otherwise, the protein concentration was 0. lmg/ml to avoid polymerization. 8,8'-Bis (phenylamino) -5,5'-bi [naphthalene]-l,l'-disulfonate (bis-ANS) was purchased from

164

I O0

E or)

GO

A

I B

" o.1 mg/ml

~

"

0,026 mg/ml

9 o.1 mg/ml 'Nk Compression X~ ~ Decompression

< 29700 " - ~ ' , . ~ ~E "~ ._1 (,~~J-N~~

Conditions 1" native GDH 2: at 2.1 kbar 9 from to 1bar

4-) r

c:) .mJ r ""

50

>

LU n 29500

GO ii

9

rr ILl I-Z iii 2 9 3 0 0 0 0

rr"

0 . 6OO

.

.

. . 1200

.

. 1800

PRESSURE (bar)

350 2400

W~ve 1engLh

41213

(nm)

Figure 1. A: Pressure dependence of the center of spectral mass of the intrinsic fluorescence of GDH at 10~ B: Fluorescence emission spectra of GDH in various conditions.

Molecular Probes ( Eugene, OR ). The pressure devices and the measurement of fluorescence under pressure were similar to those described elsewhere [4,5]. Data analysis was carried out as those described in related references[3-7]. In order to save spaces, they are not given here.

3. R E S U L T S A N D D I S C U S S I O N S

Fig. 1.A show plots of the pressure dependence of the center of spectral mass ( v p) of the intrinsic fluorescence o f 0.026mg/ml and 0. lmg/ml solutions of GDH at 10~ The curves upon compression reached high pressure plateaus near 1.95kbar and 2. lkbar, respectively, with similar total spectral shifts of ca. 350nm-1. Red shifts in spectra and decreases in fluorescence efficiency on dissociation indicated a considerable increase in polarity of the tryptophan environment accompanying dissociation. The volume changes upon subunit association derived from a logarithmic plot (AVp) (cf. eq 1' & 4' in ref. 7, X ~ for the two solutions were in a good agreement of 295ml/mol and 293ml/mol, repectively (fig 2. B). Concentration displacement caused a shift of the pressure P1/2 (required for half the spectral changes) for the two concentrations by a magnitude of 98bar. This value was nearly one-fifth of the theoretical shift of 560bar expected fi'om a strict concentration dependence of dissociation(cf, eq 6', ref. 7, XV). This phenomenon also observed in many examples like porcine LDH [3] and yeast GPADH [4] was explained by Ruan and Weber with that aggregate exists as a heterogeneous population of species with characteristic dissociation pressures which in turn depend upon their differential free energy and volume change upon association of each fraction[4]. As seen in fig 1.A & 2.A, the decompression curve shifted toward smaller pressures relative to the curve observed on elevating pressure, indicating reduced affinities among the monomers after dissociation.The loss o f free energy of subunit association was calculated to be 7.8kcal/mol. In addition, the d elayed regain of the enzyme activity with different time course from spectroscopic properties on return to atmospheric pressure was also observed (not shown). The

165

~100

A

Z

o

0

~ 8o

g

o 0

U3~

60

co

CO

a Ix. 40 o

-4

o 0.1 mg/ml

U.I

/

m rr 20

//

m

=0.1 mg/ml ~ Compression

-8

~' Decompression

U.I

121 00

600 1200 1800 PRESSURE (bar)

@

2400

-12

J/ J

o00

Compression

1200

PRESSURE (bar)

Figure 2. A: Pressure dependence of the degree of dissociation of GDH at 10~ In(Kp/66Cs) v s pressure.

~oo

[

>. _Y ._ [ c c | "-" 50 •

1800

B: Plot of

Conditions: 1. before pressurization 2. treated with 8M urea 3. decompression to 1 bar treated with 2.1 kbar

~

4-)

450

0-

500

Wave Iength

550

6O0

(nm)

Figure 3. Fluorescence spectra of 10 r M bis-ANS in the presence of GDH.

hysteresis suggested the conformational drift of monomers upon dissociation which was first described by King & Weber[3] and well discussed elsewhere[7]. Conformational drift of free monomers upon dissociation was also revealed partly by the observations that fluorescence properties of bis-ANS, a common hydrophobic probe which can bind to GDH [8], in the presence of GDH underwent changes of a blue shift of 10nm and a 3-fold increase in fluorescence yields under high pressure relative to those before compression. The opposed changes in the same system caused by concentrated urea 0ike 8M), which can dissociate and unfold GDH[1], were observed (Fig. 3). One explanation consistent with these results is that changes of fluorescence properties of bis-ANS exposed to pressure resulted from the more exposed hydrophobic surfaces o f monomers upon p ressure-induced dissociation and probably a conformational change of separated monomer. In addition, the observed properties of separated

166 Table 1 A. Temperature effect on the dissociation of GDH T(~ P1/2 (kbar) AGass, (kcal/mol) 10 1.22 -48.0 18 1.41 -50.0 27 1.50 -52.2

AVass.(ml/mol) 290 304 309

B. Substrate effect on the GDH dissociation at 10~ P1/2 (kbar) AGass~ (kcal/mol) A Vass. (ml/mol) none 1.23 -48.0 291 40mM Ala 1.48 -49.5 263 40mM Glu 1.56 -50.0 286 P1/2: pressureatthe midpoint of spectral changes; AGass. 9 standard free energy upon subunit association; A Vass. 9standard volume change upon subunit association

monomers suggested a probable folding intermediate upon pressure-induced dissociation. Raising temperature increased the half-dissociation pressure P1/2 (table 1, A), indicating an improved stability which displayed similarly in other systems studied [4,7]. The change in enthalpy of association ( ~ H ) and the entropic component (T~S) were derived from the relation between them and the dissociation constant (cf. eq 12 in ref. 4). The positive A H value of +22kcal/mol suggested a large enthalpy of dehydration of the subunit interfaces and thus adverse contribution to the association[7]. The increasing entropic contribution(T/\S=+74.2kcal/mol at 27~ should compensate the unfavorable effect of A H and thus be the driving force responsible for the stability of GDH as a hexamer under physiological conditions. Substrate effects upon protein stability against high pressure were also studied. The small variations in standard free energies,~(AG), and the volume changes upon the association of monomers occurred simultaneously upon the binding of saturating Glu or Ala to the protein and were combined to promote the stability of native hexamers (Table 1, B). 4. A C K N O W L E D G E M E N T S This work was supported by a grant of Chinese National Scientific Foundation to K.C.R. G.Q.T now is in Kyoto Inst. of Tech., Dept. of Polym. Sci. & Eng., Japan, and he thank Professor S. Kunugi for helpful suggestion and encouragement in writing this paper. 5. R E F E R E N C E S E. L. Smith, B. M.Ausen, K. M. Blumenthal and J. F. Nyc, in The Enzymes (3rd, P.D. Boyer, ed.), 11 (1975) 293, Academic Press, New York. A. A. Paladini and G. Weber, Biochem., 25 (1981) 3632. L. King and G. Weber, Biochem., 25 (1986) 3632. K. Ruan and G. Weber, Biochem., 28 (1989) 2144. J. L. Silva, E. W. Miles and G. Weber, Biochem., 25 (1986) 5781. L. Erijiman and G. Weber, Biochem., 30 (1991) 1595. G. Weber, Protein Interactions, Chapman and Hall, New York, 1992. G. K. Radda, in Fluorescence Techniques in Cell Biology (A. A. Thaer and M. Sernetz, eds.), 261, Springe-Verlag, Berlin, 1973.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

167

Mechanism of pressure denaturation of B PTI. B. Wroblowski, J. F. Diaz, K. Heremans and Y. Engelborghs. Laboratorium voor Chemische and Biologische Dynamica, Katholieke Universiteit Leuven, Celestijnenlaan 200D, B-3001 Leuven, Belgium.

Abstract We have performed a 800 ps molecular dynamics (MD) simulation of bovine pancreatic trypsin inhibitor (BPTI) in water coupled to a pressure bath at 1, 10000, 15000 and 20000 bar, which reproduces quite well the experimental behaviour [ 1]. The protein keeps its globular form, but adopts different conformations with only small reductions in volume. Some residues in the hydrophobic core become exposed and parts of the secondary structure is denatured between 10 and 15 kbar.

1. I N T R O D U C T I O N

Conformational changes are one of the major keys in the regulation of the function of proteins. These changes range from local transitions to global folding and unfolding. At 1 bar, the usual denaturing variables of a protein in solution are the temperature and/or changes in the solvent. The main disadvantage of using temperature as perturbing variable is that it simultaneous changes volume and thermal energy, which makes it difficult to separate the effects. Pressure as perturbing variable produces effects caused only by the change in volume. The most plausible interpretation [2] for the denaturation of proteins under high pressure is that at high pressure proteins are infiltrated by water and the hydrogen bonds of the protein become destabilized by the infiltrating water. That leads to a loss of protein secondary structure and finally to unfolding. MD simulations can be used to study the conformational freedom of proteins in solvent at atmospheric pressure [3] and the behaviour of proteins and water at high pressure [4, 5, 6]. A comparison of MD simulations at high and low pressure can give microscopic insight into the pressure induced denaturation, which is complementary to the results obtained by experimental methods. Because FT-IR experiments have shown that unfolding of BPTI starts at 8 kbar and continues up to 14 kbar [1], we have performed a MD simulation (all together 800 ps) of BPTI under different pressures (from 1 bar to 20 kbar). This work presents the first MD simulation that shows the events involved in the early stages of the unfolding of the protein under high pressure and the related changes in the solvent structure.

168

0.25 1 bar

10 kbar

15 kbar

20 kbar

A

0.20 0.15

0.10

0.05 200

I

I

I

400

600

800

Tim~s) 0.30 1 bar

il 0 k b a r

15 kbar

20 kbar

B

0.25 0.20 0.15 0.10 0.05 200

!

I

I

400

600

800

Time(ps)

Figure 1.-Fractions of a-helix (A) and ~-sheet (B) during the MD simulation as given by the DSSP algorithm [18].

2. MATERIAL AND METHODS The starting structure of BPTI (4PTI) was obtained from the PDB [7].Its energy was minimized in vacuum with the steepest descent method [8], and then placed in a truncated octahedral 55.58 A wide box of 2525 SPC water molecules [9] leading to 8149 atoms. Their energy was minimized (500 steps) and atom velocities assigned following a maxwell velocity distribution at 100 K. The system was warmed up to 300 K in five steps of 1 ps, while restraining the position of the protein atoms harmonically to their initial positions. Then 200 ps of free MD

169 simulation was performed using constant pressure (1 bar) and temperature (300 K). The pressure of the system was increased in eight steps of 1 ps (to 5, 10, 50, 200, 500 bar and 1, 5, and 10 kbar) to reach a pressure of 10 kbar, while restraining the position of the protein atoms to their final positions at 1 bar. Then a free molecular dynamics simulation was performed for 600 ps at a constant temperature of 300 K, increasing the pressure by 5 kbar every 200 ps to final 20 kbar. Compressibility factors of water at different pressure were taken and extrapolated from Hobbs [ 10]. The calculations were performed using 4D/210, Indy Silicon Graphics workstations and DEC Alpha 3000 workstations. The simulation was done using the GROMOS 87 package [11]. The data were analyzed using the programs WHATIF [12], DSSP[ 13] and SIMLYS [ 14].

3. R E S U L T S We observed a high pressure induced conformational transition that involves the exposition to water of some of the residues of the hydrophobic core. The unfolding starts at 10 kbar with loss of ~-structure and continues at 15 kbar with loss of helical structure (figure 1).

lO 10 kbar m

m

T

W

-2 -4 - 6

-8

--20

I

I

I

I

I

I

I

I

I

I

-lg

-16

-14

-12

-10

-8

-6

--4

-2

0

Distance ( A

)

Figure 2. Best plane projection of the r.m.s deviation between the structures of every 10th ps, (the solid circles indicate the points were the pressure is raised to the indicated value) during the MD simulation of BPTI.

170 The high pressure conformation fulfils known facts about the behaviour of proteins at high pressure [2]. BPTI retains its globular form, while changing to a high pressure conformation with a negligible change in volume. The hydrophobic core becomes infiltrated by water leading to a breakage of internal hydrogen bonds. Our explanation is, that the different compressibilities of water and protein disturb the balance of the hydrophobic~ydrophilic interactions in the protein. In the pressures range in which the conformational change takes place, the water density approaches that of the protein. The results is an increased hydrophilicity of the solvent since the same volume is occupied now by a larger amount of water molecules. That allows the solvent to interpenetrate the protein. The constant pressure segments of the simulation, except the one at 15 kbar, lead to a 'stable' end conformation (figure 2). The area covered by each of those conformations decreases with pressure. The conformational change induced in the protein by 15 kbar is not completed after 200 ps. The increase up to 20 kbar leads to a state with reduced conformational freedom of the protein. The change of the water structure is in agreement with experimental data and other MD simulations. The hydrogen bond network changes from one similar to ice Ih to one similar to Ice VI. The system does not freeze, probably due to the increased diffusion constant and mobility of the SPC model [9]. This is the first MD simulation of a protein under high pressure that reproduces at least qualitatively experimental data. That allows us to describe, at microscopical level, events involved in the high pressure induced conformational transitions. A full quantitative agreement could not be obtained due to the lack of long term equilibration in the MD simulation.

4. R E F E R E N C E S

1. K.Goossens, L.Smeller, J.Frank and K.Heremans, Eur. J. Biochemistry, in press. 2. J.L Silva and G.Weber, Annu. Rev. Phys. Chem. 44 (1993) 89. 3.W.F. van Gunsteren and H.J.C. Berendsen, J. Mol. Biol, 176 (1984) 559. 4. D.B. Kitchen, L.H. Reed, and R.M. Levy, Biochemistry 31 (1992) 10083. 5. R.M.Brunne and W.F. van Gunsteren, FEBS Lett 323 (1993) 215. 6. F. H. Stillinger and A. Rahman, J. Chem. Phys. 61 (1974) 4973. 7. J.J. Birktoft and D.M. Blow, J.Mol.Biol. 68 (1972) 187. 8. M. Levitt and S. Lifson, J. Mol. Biol. 46 (1969) 269. 9. H.J.C. Berendsen, J.P.M. Postma, W.F. Van Gunsteren and J. Hermans, Intramolecular forces. (Pullman, B. ed.) pp.331, Reidel, Dordrecht. 1981 10. Hobbs, P.V. Ice Physics, Clarendon Press Oxford (1974) 61. 11. W.F van Gunsteren and H.J.C. Berendsen. Program system GROMOS 87. Distributed by: Biomos biomolecular software b.v., University of Groningen. 12. G. Vriend, J. Mol. Graph. 8 (1990) 52. 13. W. Kabsch and C. Sander, Biopolymers 22 (1983) 2577. 14. P. Krtiger, M. Ltike, A. Szameit, Comput Phys. Commun. 62 (1991) 371.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

171

Thermal inactivating behavior of Bacillus stearothermophilus under high pressure Koji Kakugawa% T a k a s h i O k a z a k P , S h i n y a Y a m a u c h P , Kyozo Morimoto ~, Tatsuo Yoneda% and Kanichi Suzuki b aHiroshima Prefectural Food Technology Research Center, 12-70 H i j i y a m a h o n m a c h i , M i n a m i k u , H i r o s h i m a 732, J a p a n b D e p a r t m e n t of Applied Biological Sceience H i r o s h i m a University, 1-4-4 K a g a m i y a m a , H i g a s h i - H i r o s h i m a 739, J a p a n

ABSTRACT

T h e e f f e c t of h i g h p r e s s u r e on t h e r m a l i n a c t i v a t i o n of B a c i l l u s stearothermophilus spores was i n v e s t i g a t e d . The time for the spore decrease from 10 ~ to 102 spores/ml was w i t h i n 30min by h e a t i n g at l l 0 ~ and was within 10min at 100~ However, under the pressurized conditions (at 400MPa), the spores did not decrease to the value below 102 spores/ml even w h e n they were h e a t e d at 120~ for 50min. 1. I N T R O D U C T I O N

Spores of Bacillus genus produce high h e a t r e s i s t a n t spores, and those spores often spoil h e a t sterilized foods. Therefore, m a n y studies on t h e r m a l sterilization of foods as well as on p r e s s u r i z e d t r e a t m e n t of t h e r m a l r e s i s t a n t spores, h a v e conducted. However, very few studies have reported on the effects of t e m p e r a t u r e combined with pressure on sterilization behavior of h e a t r e s i s t a n t spores. For food s t e r i l i z a t i o n processes, it is d e s i r e d to r e d u c e t h e r m a l conditions, i.e. h e a t i n g t e m p e r a t u r e and time, from the s t a n d p o i n t of the quality of products. T h e o b j e c t i v e of t h i s s t u d y is to i n v e s t i g a t e t h e i n a c t i v a t i n g b e h a v i o r of B.stearothermophilus s p o r e s u n d e r c o m b i n e d c o n d i t i o n s of t e m p e r a t u r e a n d pressure. 2. M A T E R I A L S A N D M E T H O D

Spores of B.stearothermophilus IAM1035 were used as the t e s t specimen. The D121oc value and Z value were 2.3min and 7.4~ in 1/15M phosphate buffer(pH7.0), so they have efficient h e a t r e s i s t a n c e . D i a g r a m of the high p r e s s u r e a p p a r a t u s u s e d in this s t u d y is s h o w n in Fig.1. After t h e v e s s e l was p r e s s u r i z e d at the pressures r a n g i n g from 0.1MPa to 400MPa, it was h e a t e d in an oil b a t h for 5min to 60min at the t e m p e r a t u r e s ranging from 50~ to 120~ After heating, the vessel was cooled in a w a t e r b a t h at 25~ and the p r e s s u r e was released u n t i l n o r m a l

172

Fig.1

S c h e m a t i c d i a g r a m of e x p e r i m e n t a l a p p a r a t u s ( 1 " p r e s s u r e vessel ; 2"thermocouple ; 3:silicon rubber tube ; 4:sample ; 5:pressure gauge ; 6:pressure pump)

400

~" 100

f

o

75 ~

50

~

25

0.1 0

I

0

I

I

1

200 400 600 H e a t i n g T i m e (s)

I. 800

Fig.2 An e x a m p l e of t e m p e r a t u r e and p r e s s u r e c h a n g e of a s a m p l e d u r i n g h e a t i n g at 100~ for 10min u n d e r 400MPa one. T e m p e r a t u r e a n d p r e s s u r e h i s t o r i e s at 1 0 0 ~ for 10min, for example, is shown in Fig.2. Survival spore n u m b e r s in the treated suspensions were m e a s u r e d by counting the colony n u m b e r which grew on a s t a n d a r d agar plate.

3.

RESULTS

AND

DISCUSSION

Survival curves of the spores at 113~ u n d e r pressures ranging from 0.1MPa to 400MPa are shown in Fig.3. The survival curves did not obey the first order rate equation. Additionally, the spores considerably died under the pressurized condition more t h a n 150MPa. Though the death rate increased with the increase of pressure, the difference was not significant between 300MPa and 400MPa. Survival curves of the spores at t e m p e r a t u r e s r a n g i n g from 50~ to 100~ at 4 0 0 M P a are s h o w n in Fig.4. T h e s p o r e s c o n s i d e r a b l y d e c r e a s e d at t h e t e m p e r a t u r e m o r e t h a n 60~ w h e n the p r e s s u r e was applied. W h e n the t e m p e r a t u r e was 50~ significant decrease was not observed even at 400MPa.

173

10 7

107

10 6

0

>

I0

10 6

5

105

.,~

104

~

>

104 m

10 3

10 3

10 2

Fig.3

o~

.v.-q

10 2

Influence of p r e s s u r e on survival curves of B . s t e a r o t h e r m o p h i l u s spores d u r i n g h e a t i n g at 113~ ( 9 :O.1MPa A "IOOMPa V "150MPa n .200MPa @ "300MPa ~ : 4 0 0 M P a ) 107 G'--

lOJ

\

m 10 5 o

> 10 4

90oc E

m 10 3

100

102 lO 1

Fig.4

,

,

,

,

I

10

,

,

,

,

I

20

,

,

,

,

l

,

,

i

,

I

30 40 Time(min)

,

i

i

i~I~,

50

,

,

,

60

C o m b i n e d effect of t e m p e r a t u r e a n d p r e s s u r e on s u r v i v a l curves of B. stearothermophilus d u r i n g h e a t i n g u n d e r 4 0 0 M P a

It is k n o w n t h a t the spores of B.stearothermophilus do not die at the t e m p e r a t u r e below 100~ u n d e r n o r m a l pressure. 1) However the p h e n o m e n o n t h a t the spores died even at t e m p e r a t u r e r a n g i n g from 60~ to 100~ u n d e r 4 0 0 M P a shows t h a t p r e s s u r e c o n t r i b u t e d m a i n l y to the d e a t h . This r e s u l t was s i m i l a r to the case of B.subtilis spores t h a t died at t e m p e r a t u r e r a n g i n g from 35~ to 65~ u n d e r 400MPa, t h o u g h the spores was not i n a c t i v a t e d at 100~ u n d e r n o r m a l pressure. 2) The influence of p r e s s u r e on the survival curves of the spores at high t e m p e r a t u r e are s h o w n in Fig.5. Little decrease of viable spores was observed

174

107 106( ~_ 105 104 103 102 10 ~ 10 ~

0.1MPa ,

1

~

!

L

I

I

l

y

\

o--,

106 o

105 .~ 104 lo ~ OZ 102~ 101 ~10~ 106~ 105~ 104~ 103~, 102~ 101~ 10~ 0

A

I

,

I

I

400MPa

10

2O

3O

40

50

Time(min) Fig.5

Influence of pressure on survival curves of B.stearothermophilus spores during heating at t e m p e r a t u r e s r a n g i n g from 100~ to 120~ (C) "100~ A .ll0~ V .120~

d u r i n g h e a t i n g for 5 0 m i n at t e m p e r a t u r e s below 110~ at n o r m a l p r e s s u r e (0.1MPa). The time for the spore decrease from 106 to 102 spores/ml was within 30min by heating at l l 0 ~ and was within 10min at 100~ However, u n d e r the p r e s s u r i z e d conditions (at 400MPa), the spores did not decrease to the value below 102 spores/ml even when they were heated at 120~ for 50min. When the spores were kept at 120~ for a few minutes after h e a t i n g at 120~ for 10min, the alive spores were not detected (data not shown). T h i s r e s u l t i n d i c a t e s t h a t d e p r e s s u r i z a t i o n a f t e r a p p r o p r i a t e p r e s s u r i z e d h e a t t r e a t m e n t is effective for reducing the complete inactivation time of h e a t r e s i s t a n t spores. 4.REFERENCES

1 J a i r u s R.D.David and R.L.Merson, J. Food Sci., 55 (1990) 488. 2 Okazaki T. and Suzuki K., Nippon Shokuhin Kogyo Gakkaishi, 42 (1994) 536.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996Elsevier ScienceB.V. All rights reserved.

175

Effect of p r e s s u r e on t h e p h a s e b e h a v i o r of e s t e r - a n d e t h e r - l i n k e d phospholipid bilayer membranes Shoji Kaneshina, Shoji Maruyama and Hitoshi Matsuki Department of Biological Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima, Tokushima 770, Japan Abstract

The temperature-pressure phase diagrams for dipalmitoylphosphatidylcholine (DPPC) and dihexadecylphosphatidylcholine (DHPC) bilayer membranes were constructed in the pressure range up to 200 MPa. The DPPC and DHPC membranes exhibited similar phase behavior for the main transition. However, the most surprisingly difference between DPPC and DHPC lies in the pretransition. The pressure-induced, interdigitated gel ( L~I ) phase was found in the DPPC membrane at high pressures above 100 MPa. In contrast, the DHPC membrane exists in the L~I phase at low temperature below 33.6 ~ and ambient pressure. The ripple gel phase of DHPC membrane disappeared at high pressure above 130 MPa. 1. I N T R O D U C T I O N

Pressure studies of lipid bilayer membranes have been initiated at first in the interest of a more complete understanding of pressure-anesthetic antagonism [16]. The succeeding high-pressure studies have been performed with various physical techniques including volumetry [7], X-ray diffraction [8], Raman spectroscopy [9], neutron diffraction [10,11], light transmission [12,13], and 2H-NMR [14]. These measurements have revealed phase behaviors ofbilayer membranes of dipalmitoylphosphatidylcholine (DPPC), which is one of the most extensively studied diacylphospholipids. In addition to liquid crystal, ripple gel and lamellar gel phases, a new pressure-induced gel phase, in which the lipid hydrocarbon chains from opposing monolayers are fully interdigitated, has been observed [10-14]. Some disagreements are still remaining on the temperature-pressure phase diagram of DPPC bilayer membranes. In addition to the diacyl-phospholipids, dialkyl-phospholipids and alkyl-acylphospholipids have been widely found in mammalian cell and organella membranes [15]. In contrast to diacyl-phospholipids, relatively few studies of the properties of dialkyl-phospholipids have been reported [16-19]. NMR, X-ray diffraction and differential scanning calorimetry (DSC) studies revealed that in the gel phase of the ether-linked dihexadecylphosphatidylcholine (DHPC), the bilayers are fully chain interdigitated. However, the effect of pressure on the phase behavior of DHPC bilayer membranes is still unknown. The present study demonstrates the temperature-pressure phase diagrams of bilayer membranes for the ether-linked DHPC as well as the ester-linked DPPC.

176 2. EXPERIMENTAL

Synthetic DPPC, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, and DHPC, 1,2-

di-O-hexadecyl-sn-glycero-3-phosphocholine, were obtained from Sigma. These

molecules differ only in the ester-linkage and ether-linkage between polar head groups and hydrocarbon chains. Multilamellar vesicles of these phospholipids were prepared by suspending each lipid in water at 2.0 • 10 -3 mol kg -1, using a Branson model 185 Sonifier at a temperature several degrees above the main phase transition. The phase transitions of these lipid bilayer membranes under ambient pressure were observed by a MicroCal MCS differential scanning calorimeter. The heating rate was 0.75 K min -1. The phase transitions under various pressures were observed by an optical method. The general arrangement of the high pressure apparatus has been described in detail previously [20]. The sudden change in transmittance accompanying the phase transition was followed at 540 nm. The heating rate at a given pressure was 0.67 K min -1. 3. RESULTS AND DISCUSSION An example of the phase transition measurements is shown in Figures 1 and 2 for diacylphospholipid DPPC and dialkylphospholipid DHPC bilayer membranes, respectively. Two kinds of endothermic transitions were clearly observed on the DSC thermograms for both lipid bilayer membranes. The light transmittance also changed suddenly at two transition temperatures, that is, the pretransition t e m p e r a t u r e Tp and the main transition t e m p e r a t u r e Tm. Two transition temperatures by both methods were 34.1 and 41.2 ~ for DPPC, and 33.6 and 44.4 ~ for DHPC, respectively, which are in good agreement with previously published data [9-12, 16-19]. The main transition from the ripple gel. (P~') phase to the liquid crystal (La) phase for the DHPC bilayer membrane is similar to that for the DPPC bilayer membrane. The most significant difference between DPPC and DHPC membranes lies in the pretransition. known that the DHPC membrane . It . has been . . p , undergoes thermotropic pretranmtion between the mterdxgltated gel (L~I) and phases [18,19], while the DPPC membrane undergoes the pretransition between the lamellar gel (LB') and PB' phases [21]. As is seen from Figures 1 and 2, the ' pretransition in DHPC membrane from the L~I phase to the P~' phase is accompani e d with a decrease in transmittance, while in DPPC membrane the pretransition from the L ' phase to the P~' phase is accompanied with an increase in transmittance, although the DSC thermogram for the pretransition is endothermic for both lipid membranes. Phase transition temperatures for DPPC and DHPC bilayer membranes were determined by the optical method at various pressures. Both transition temperatures increased with an increase in pressure. The temperature (T) - pressure (P) phase diagram of DPPC and DHPC bilayer membranes are shown in Figures 3 and 4, respectively. With respect to the phase diagram of DPPC bilayer membrane (Figure 3), both temperatures of the main- and pre-transition increase with an increase in pressure, but the slope of phase boundary for the pretransition is smaller than that for the main transition. A pressure-induced phase, which can be assigned as the LBI phase, was observed beyond 100 MPa. A triple point among L~', P~' and L~I phases was found at 100 MPa and 45 ~ The slope of the phase boundary between L~' and L~I phases is negative. The phase diagram of DPPC bilayer membrane has

177

l l/I/l/l/l/~

(a)

t/t/t/Ht//

tit/t|

.~ttt~

L~'

PlY'

Lo,

(b)

,S 10

i

I

2o

3o

I I

rp

I1

,r~

4o

I

5o

60

Temperature / ~

Figure 1. Phase transitions of DPPC vesicles observed by (a) DSC method and (b) optical method. Tin: main-transition temperature, Tp: pre-transition temperature.

(a)

tttttt A ~~ LI31

PI~'

L~

(b)

f I

I

10

20

I

I

30 40 Temperature / ~

I

50

60

Figure 2. Phase transitions of DHPC vesicles observed by (a) DSC method and (b) optical method. Tin: main-transition temperature, Tp: pre-transition temperature.

178 80

70 -

oO

L~,

60

so

~-

40

30

20

0

,

50

i

1O0

i

150

.

200

Pressure / MPa

Figure 3. Phase diagram of DPPC bilayer membrane. The concentration of DPPC was 2.0 mmol kg-1. Phase transitions: (@) L~' or L~I -, P~', (iX) L~' -* L~I, (O) P~' -, La. 90

80

0o

7O

60 E ~-

50

40

30

0

I

I

I

50

1 O0

150

200

Pressure / MPa

Figure 4. Phase diagram of DHPC bilayer membrane. The concentration of DPPC was 2.0 mmol kg-1. Phase transitions" (iX) L~I -* P~', (O) P~' or L~l -* La.

179 been constructed by several authors. There are some disagreements between their results. The phase diagram measured by the methods of Raman spectroscopy [9], light transmittance [12] and 2H-NMR [14] has a positive slope of phase boundary between L B' and LBI phases, whereas the phase diagram by the neutron diffraction has a neg/ttive slope [10,11]. The slope of phase boundary is expressed by the Clapeyron-Clausius equation (dT/dP = AV/AS), using the volume (AV) and entropy (AS) changes of phase transition. It is well known that the L~I phase of DPPC bilayer membrane can be induced by the addition of ethanol, glycerol and several surface-active small molecules [22-27]. Ohki and co-workers [27] have measured the specific volume of DPPC vesicle dispersion in the absence and presence of ethanol as a function of temperature by the method of scanning density meter, and revealed that the volume change accompanied by the transition from the L ' phase to the L I phase is negative. Consequently, the slope of phase boundary between L~ and..~LI phases in the DPPC bilayer membrane should be negative, since the t r a n s m o n from the L ' phase to the L~I phase accompanies with the negative volume change [27] and thee endothermic change by the DSC measurement [26]. In contrast, the DHPC bilayer m e m b r a n e exists in the L~I phase at low temperature below T Dunder ambient pressure [16-19]. As shown in Figure 4, the temperature of pretra'nsition from the LBI phase to the PB' phase increases linearly with an increase in pressure. The slope 'of the phase boundary between L~I and P~' phases is larger than that for the main transition. The values of dT/dP for the pretransition and the main transition were 0.316 and 0.242 K MPa -1, respectively. Therefore, the P~' phase disappeared by the pressure above 130 MPa. A triple point among L~I, PB' and La phases was found at 130 MPa and 74.5 ~ At high pressures above 130 MPa, only a main transition from the L~I phase to the L a phase was observed. Let us compare two phase-diagrams for DPPC and DHPC bilayer membranes. With respect to the m a i n t r a n s i t i o n , both lipids exhibit almost the same thermodynamic characteristics. The main transition temperatures for DPPC and DHPC bilayer membranes were 41.2 and 44.4 ~ respectively, and the values of dT/dP were 0.244 and 0.242 K MPa -1, which were almost the same. In other words, the main transition is hardly affected by the difference between the ester and ether linkages ofphospholipids. However, the most surprisingly difference between DPPC and DHPC lies in the pretransition. The dT/dP value for the pretransition of DHPC bilayer membrane, 0.316 K MPa -1, is significantly large compared with that for DPPC membrane, 0.140 K MPa -1. As mentioned before, the L~I phase of DPPC bilayer can be induced by a variety of surface-active small molecules [22-27]. All of these molecules can displace water from the interfacial region and do not extend too deeply into the bilayer interior. These small molecules anchor to the interface by virtue of their polar moiety, with the non-polar part of the molecule intercalating between the lipid acyl chains. The DPPC bilayers respond to the addition of surfaceactive small molecules by forming the L~I phase, resulting in the decrease in the bilayer volume. The L~I phase can be also induced by pressure itself because the volume of a system can be reduced by pressure. The substitution of an ether linkage for an ester linkage of phospholipid brings about the appearance of the L I phase at ambient pressure. As you can see from Figures 3 and 4, the shape of the T~-Pdiagram of DHPC is corresponding to the phase diagram for the DPPC bilayer membrane in the regions of elevated pressures. Therefore, we may say that the substitution of an ether linkage for an ester linkage of DPPC is comparable to the compression of the DPPC bilayer membrane.

180 4. R E F E R E N C E S

1 2 3 4 5 6 7 8 9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

J . R . Trudell, D. G. Payan, J. H. Chin and E. N. Cohen~ Biochim. Biophys. Acta, 373 (1974) 436. A.G. MacDonald, Biochim. Biophys. Acta, 507 (1978) 26. D.B. Mountcastle, R. L. Biltonen and M. J. Halsey, Proc. Nat. Acad. Sci. USA, 75 (1978) 4906. H. Kamaya, I. Ueda, P. S. Moore and H. Eyring, Biochim. Biophys. Acta, 550 (1979) 131. W. MacNaughtan and A. G. MacDonald, Biochim. Biophys. Acta, 597 (1980) 193. S. Kaneshina, H. Kamaya and I. Ueda, J. Colloid Interface Sci., 93 (1983) 215. N.I. Liu and R. L. Kay, Biochemistry, 16 (1977) 3484. J. Stamatoff, D. Guillon, L. Powers and P. Cladis, Biochem. Biophys. Res. Commun., 85 (1978) 724. P. T. T. Wong and H. H. Mantsch, Biochemistry, 24 (1985) 4091. L. F. Braganza and D. L. Worcester, Biochemistry, 25 (1986) 2591. R. Winter and W. C. Pilgrim, Ber. Bunsenges. Phys. Chem., 93 (1989) 708. S. K. Prasad, R. Shashidhar, B. P. Gaber and S. C. Chandrasekhar, Chem. Phys. Lipids, 43 (1987) 227. S. Kaneshina, K. Tamura, H. Kawakami, and H. Matsuki, Chem. Lett., (1992) 1963. D. A. Driscoll, J. Jones and A. Jones, Chem. Phys. Lipids, 58 (1991) 97. H. K. Mangold and F. Paltauf (Eds.), Ether Lipids: Biochemical and Biomedical Aspects, Academic Press, New York, 1981. M . J . Ruocco, D. J. Siminovitch and R. G. Griffin, Biochemistry, 24 (1985) 2406. M.J. Ruocco, A. Makriyannis, D. J. Siminovitch and R. G. Griffin, Biochemistry, 24 (1985) 4844. P. Laggner, K. Lohner, G. Degovics, K. Muller and A. Schuster, Chem. Phys, Lipids, 44 (1987) 31. J. T. Kim, J. Mattai and G. G. Shipley, Biochemistry, 26 (1987) 6592. S. Kaneshina, K. Tamura, T. Isaka and H. Matsuki, in: Y. Taniguchi, M. Senoo and K. Hara (Eds.), High Pressure Liquids and Solutions, Elsevier Science B. V., Amsterdam, 1994, p. 95. M. J. Janiak, D. M. Small and G. G. Shipley, J. Biol. Chem., 254, (1979) 6068. R. V. McDaniel, T. J. McIntosh and S. A. Simon, Biochim. Biophys. Acta, 731 (1983) 97. T. J. McIntosh, R. V. McDaniel and S. A. Simon, Biochim. Biophys. Acta, 731 (1983) 109. S. A. Simon and T. J. McIntosh, Biochim. Biophys. Acta, 773 (1984) 169. P. Nambi, E. S. Rowe and T. J. McIntosh, Biochemistry, 27 (1988) 9175. E. S. Rowe and T. A. Cutrera, Biochemistry, 29 (1990) 10398. K. Ohki, K. Tamura and I. Hatta, Biochim. Biophys. Acta, 1028 (1990) 215.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

181

Kinetics and mechanisms of lamellar and non-lamellar phase transitions in aqueous lipid dispersions J. Erbes a, G. Rapp b and R. Winter a aUniversity of Dortmund, Institute of Physical Chemistry I, D-44221 Dortmund, Germany bEMBL Outstation at DESY, D-22603 Hamburg, Germany

Abstract

By using the pressure-jump relaxation technique in combination with time-resolved synchrotron X-ray diffraction, the kinetics of different lipid phase transformations at conditions close to and far from equilibrium were investigated. We studied the inter-lamellar LtJLa-transition of dielaidoylphosphatidylcholine (DEPC), the Hii/La-transition of eggphosphatidylethanolamine (egg-PE), and the La to cubic phase transformation of monoelaidin in excess water. The time constants for completion of the transitions vary from seconds to several minutes, dependent on the direction of the transition, the symmetry and topology of the structures involved, and also on the pressure-jump amplitude. In several cases, also intermediate structures can be detected under non-equilibrium conditions.

1. INTRODUCTION Aqueous dispersions of lipids, in particular the phosphatidylcholines, provide valuable models for the investigation of biophysical properties of membranes. They exhibit a rich lyotropic, barotropic and thermotropic phase behaviour. Although most lipids exist in lamellar bilayer phases, certain lipids, including monoacylglycerides, phospholipid/fatty acid mixtures and natural derived lipid mixtures, such as egg-phosphatidylethanolamine, can form non-bilayer hexagonal (HII) or cubic liquid-crystalline phases as well [1-3]. Most of the cubic liquid-crystalline phases are now known to consist of bicontinuous regions of water and hydrocarbon, which can be described by infinite periodic minimal surfaces. It is assumed that non-lamellar lipid structures are also of biological relevance. They probably play an important functional role in some cell processes as local and transient intermediates [2,4], such as in membrane fusion, pore formation, and fat digestion. Although the static structure and thermodynamic properties of these model membrane systems are rather well established, considerable lack of knowledge exists regarding the understanding of the kinetics and mechanisms of lipid phase transformations. We used the synchrotron X-ray diffraction technique to record the temporal evolution of the structural changes after induction of the phase transition by a pressure-jump across the phase boundary. Besides using pressure to trigger these phase transitions, pressure-dependent studies on the structure and phase behaviour of biomolecules are also of biological and biotechnological relevance.

182 2. EXPERIMENTAL The small- and wide-angle X-ray diffraction experiments were performed at beam line X13 of the EMBL outstation at DESY, which is described elsewhere [5,6]. For the investigation of the high pressure phase behaviour and structure of lipid systems, w C 0 / as well as the kinetics of lipid phase transitions using the pressure-jump technique, we built a high pressure X-ray cell. Fig. 1 illustrates the cross-sectional view of the essential parts. Pressure-jumps were obtained by computer controlled opening of an air operated valve x between the high pressure cell and a liquid reservoir container. With the pressure-jump ,, ,, \ \ \ \ \ ~ _ \ \ apparatus rapid ( < 5 ms) and variable amplitude pressure-jumps (up to 1 kbar) are possible. In relaxation kinetic measurements, the pressure-jump trigger has been shown to offer Figure 1. Cross-sectional view of the high pressure X-ray cell (bs: beryllium-window several advantages over the temperature jump and sample; o: O-Ring; c: high-pressure approach: 1) pressure propagates rapidly so connection; w: thermostating jacket; v: that sample homogeneity is less of a problem, high-pressure vessel; n: closure nut; x: X- 2) pressure-jumps can be performed bidirectional, i.e. in the pressurization and in the ray beam). depressurization direction, and 3) the amplitude of the pressure-jump can be easily and repeatedly varied to a level of high accuracy (here + 5 bar), thus also allowing to sum up sets of diffraction data to improve the counting statistics in the case of fully reversible phase transformations. /

/

3. EXPERIMENTAL RESULTS 3.1. Lameilar L# to lamellar L a phase transition First we present pressure-jump experiments carried out in dielaidoylphosphatidylcholine (DEPC)/water dispersions to study the L~/La-transition. Selected SAXS diffraction patterns collected after a pressure jump from 250 to 70 bar at 15 ~ are depicted in Fig. 2. The equilibrium transition pressure at that temperature is 160 bar. An intermediate structure is clearly observable. The first order Bragg reflection of the initial L~ phase vanishes in the course of the pressure-jump (5 ms). The first diffraction pattern collected (with an X-ray exposure time of 30 ms) after the pressure-jump exhibits a Bragg peak of a new lamellar phase L x with a 6 A smaller d-spacing, which decreases with time. This intermediate phase vanishes after 1.5 s. The phase transformation is complete after about 2 s. In equilibrium measurements, no such intermediate

i

0.01

--

0.02

sty,-1]

Figure 2. Selected diffraction patterns of DEPC in excess water after a pressure jump from 250 to 70 bar at 15 ~

183 lamellar structure is detectable. Interestingly, the pressure-jump amplitude has a significant influence on the lifetime and d-spacing of the intermediate structure. In the pressurization (La--, L~) direction, the lifetime of the intermediate L x phase is found to be significantly longer. Wide-angle diffraction data give evidence that the hydrocarbon chains in the L x phase are fluid. 3.2. Lamellar La to inverted hexagonal H n phase transition Dispersions of egg-phosphatidylethanolamine in excess water spontaneously form a lamellar L~, La and an inverted hexagonal H n phase with increasing temperature. We present data of a pressure-jump experiment across the HiffLa-transition of egg-PE. The d-spacings and the intensities of the (10) Bragg peak of the H n phase and the (001) peak of the La phase are presented in Fig. 3.

a)

b)

Hn =

~ o

"7.0.8

=i -..'0.6

63

~ ~9

z

. ,.,,,

62

~ ~49 ~

;'

i'

; t[sl

6

"

0.2 |

0

,

,

i

|

,

2

,

3

i

4

|

i

5

9

6

t[sl

Figure 3. a) d-spacings and b) intensities of the first order Bragg reflections of the La phase and the H a phase of egg-PE in excess water after a pressure-jump from 230 to 390 bar at 62~ After the pressure-jump, the d-spacing of the hexagonal structure (hexagonal lattice constant a = 2d/v~) shifts from 62.3 ,~ to 63.0 ,~ in approximately 1 s. This shift of 4.4 ,~/kbar is comparable with the pressure dependence of the d-spacing observed in equilibrium measurements. The d-spacing of the La phase, which is observed after a lag period of 250 ms, does not change in the course of the phase transformation, which takes about 4 s in total. The relative intensities of the Bragg peaks reveal a two-state process for this Hn/L atransition at the experimental time resolution. Depressurization experiments show that the transition is reversible and a similar rate for completing the LJHii-transition has been found. Interestingly, T-jump experiments on 1-stearoyl-2-oleoyl-phosphatidylethanolamine dispersions reveal an intermediate thin La phase in the course of the La/Hn-transition [7].

184 4. SUMMARY Generally, as found for laser temperature jump induced phase transitions [7], the results show that the relaxation behaviour and the kinetics of lipid phase transformations drastically depend on the topology and symmetry of the lipid phases, as well as on the applied jump amplitude. i) The symmetry-homologous lameUar chain melting LJLa-transition of DEPC/H20 appears to be highly cooperative with total transition time in the order of 2 s. A transient intermediate lamellar phase occurs. Its structure and lifetime drastically depends on the amplitude of the p-jump. The transition proceeds as two-state at low p-jump amplitudes. ii) The symmetry-heterologous Hrt/L a inverted hexagonal to lamellar transition of egg-PE appears to be two-state, with no evidence for intermediate structures or phases being observed, at least at the sensitivity and resolution of these experiments. The behaviour on pressurization and depressurization is fully reversible. A fast relaxation component causes an initial increase of the hexagonal lattice spacing, followed by a coexistence of both phases up to 4 s, where the Hrt phase disappears. The diffraction lines of the different phases remain sharp throughout the transition, indicating a high degree of long range order within the phase domains. iii) The lamellar L~ to cubic lm3m transition in monoelaidin dispersions (data not shown), which involves a major change in symmetry, occurs within 600 s. An intermediate cubic structure of space group Pn3m is formed. The occurence of metastable cubic phases is a rather often observed phenomenon [8,9]. In most cases the rate of the transition is probably limited by the transport and redistribution of water into and in the new phase, rather than being controlled by the required time for a rearrangement of the lipid molecules. The turtuosity factor of the different structures, especially in cases where the pore diameters are small, is likely to control the different kinetic components.

5. REFERENCES 1 G. Cevc and D. Marsh, "Phospholipid Bilayers" (John Wiley & Sons, New York, 1987). 2 J. M. Seddon, Biochim. Biophys. Acta 1031 (1990) 1. 3 R. Winter, A. Landwehr, T. Brauns, J. Erbes, C. Czeslik and O. Reis, in: Proceedings of the 23rd Steenbock Symposium on "High Pressure Effects in Molecular Biophysics and Enzymology" (Madison, U.S.A., 1994). 4 G. Lindblom and L. Rilfors, Biochim. Biophys. Acta 988 (1989) 221. 5 G. Rapp, A. Gabriel, M. Dosi~re, M.H.J. Koch, Nucl. Instr. & Meth. 357 (1995) 178. 6 J. Erbes, C. Czeslik, W. Hahn, R. Winter, M. Rappolt and G. Rapp, Ber. Bunsenges. Phys. Chem. 98 (1994) 1287. 7 P. Laggner, M. Kriechbaum, and G. Rapp, J. Appl. Cryst. 24 (1991) 836. 8 C. Czeslik, R. Winter, G. Rapp and K. Bartels, Biophys. J. 68 (1995) 1423. 9 M. Caffrey, Biochemistry 26 (1987) 6349.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

185

Similar characteristics of bacterial death caused by high temperature and high pressure: Involvement of membrane fluidity Tetsuaki Tsuchido ~, Kayoko Miyake b, Makoto Hayashi b, and Katsuhiro Tamura r ~Department of Biotechnology, Faculty of Engineering, Kansai University, Suita 564, Japan bPackaging Research Institute, Dai Nippon Printing Co., Ltd., Sayama 591-10, Japan CDepartment of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, Tokushima 770, Japan Abstract We confmned our previous finding that the thermal death of Escherichia coli was affected by the holding temperature prior to heat treatment as well as growth temperature. The cell death caused by hydrostatic pressure at 150 MPa was also found to depend upon the pressurization temperature as well as growth temperature. The light scattering study on extracted membrane lipids suggested that the gel-liquid crystalline phase transition is involved in the temperature-dependency of both cellular sensitivities, implying a role of the membrane fluidity.

1. INTRODUCTION The mechanisms of bacterial death by heat and pressurization remain to be resolved, although several studies have been reported [1-4 as reviews]. We have shown that the holding temperature prior to heat treatmentin combination with the growth temperature affects the heat resistance of E. coli cells (preincubation effect) [5], and suggested that the membrane fluidity is involved in the bacterial death process. In fact, the functions and structures of membranes have been shown to be damaged by heat [6-8]. High hydrostatic pressure also kills bacterial cells and the membranes of bacterial cells and yeast cells have been reported to be damaged by high pressure [9, 10]. The purpose of this study is to examine whether membrane fluidity is involved in the death mechanism in pressurized cells of E. coli, similar to heated cells.

186 2. MATERIALS AND METHODS

E. coli W3110 cells were cultivated at either 15 or 37~ to logarithmic growth phase in M9 minimal medium supplemented with glucose [5,6]. The cells were harvested and washed with 50 mM Tris-10 mM MgC12 buffer (pH 8.0) (TM buffer). Washed cells were incubated for 30 min at various temperatures in TM buffer. The preincubated cells were heated at 50~ for 15 min in TM buffer by a 10-fold dilution method, as described previously [5]. For pressurization, the washed cells were treated at various temperatures in a hydrostatic pressurization apparatus (Kobe Steel, Ltd.). To measure the phase transition temperature of membrane lipids, a high pressure vessel with optical windows described previously [11] was employed. Viability was assayed by colony counting as described previously [5]. The plate medium used was M9 supplemented with glucose plus 1% agar. The plates were incubated at 37~ for 2 d and the numbers of colonies were counted. The membrane lipids were extracted from cells by the method of B ligh and Dyer [12]. The lipids were dried up in nitrogen gas and then liposomes were prepared from the lipids by sonication. The phase transition temperatures of the lipids were measured at atmospheric pressure and 100MPa by raising the temperature [11].

3. RESULTS AND DISCUSSION 3.1. Thermal death

We confmned our previous finding [5] that the cells of E. coli W3110 strain incubated at ~37~ prior to heating had higher resistance, when evaluated by viability of cells after heated at 50~ for 15 min, than the cells preincubated at 0~ (the preincubation effect). However, this effect could not be seen at temperatures above 2022~ (Figure 1). On the other hand, the heat resistance of cells grown at 15~ was almost constant, irrespective of preincubation temperature. 10 100

O.--O . . . . . .

-O"

f

.•-0-

~-~

- - - O - - - -0- . . . .

0.1

I_

0 "

9

I0

,

!

20

"0-

"~" "-" 9

,

0.1

0.01

'!

30

l

' 40

l'reinculmlion temperature (*(3) Figure 1. Effect of preincubation temperature on the heat resistance of E. coll. Viability after heating at 50~ for 15 min is showri as percentage of the unheated count.O, 15oCgrown cells; O , 37~ cells. Adapted from Katsui et al.[5] by permission of Society for General Microbiology.

.

0 I0 20 30 40 Preincub:dion temperature (~ Figure 2. Effect of pressurization temperature on the pressure resistance of E. coli. Viability after treatment at 150MPa for 10 min is shown as percentage of the untreated count. See the legend to Figure 1 for symbols.

187 A similar situation has been observed with unsaturated fatty acid-requiring mutant of E. coli, K1060 (5). The viability obtained after heating oleic acid-grown K1060 cells at 50~ for 45 min was constant at above 15~ of preincubation temperature, while decreased gradually at temperatures lower than 15~ On the other hand, linolenic acid-grown cells had almost constant resistance at preincubation temperatures tested, except for 0 to 4~

3.2. Death by high pressure treatment The E. coli W3110 cells grown at 37~ died by pressurization at 150MPa at 0 and 37~ for 10 min similarly (Figure 2). More of the cells grown at 15~ died by pressurization at 0~ than by that at 37~ The temperature corresponding to the sensitization-starting point was about 20~ whereas no substantial change in the temperature dependence of pressure resistance was observed with cells grown at 37~

3.3. Fatty acid compositions The fatty acid composition of bacterial cells is known to change with the growth temperature [13]. We reported that the unsaturated fatty acid content increased with lowering of the growth temperature in W3110 strain [5]. The ratio of saturated to unsaturated fatty acids was 0.81 and 1.32 for 15~ cells and 37~ cells, respectively. In the K1060 strain, oleic acid and linolenic acid were incorporated into the cells. Such an increase in the unsaturated fatty acid content and an increase in the number of double bonds in unsaturated fatty acid incorporated should lower the phase transition temperature and therefore increase the inherent fluidity of the membrane lipids.

3.4. Phase transition temperature and the involvement of membrane fluidity Sinensky [14] indicated that the gel-liquid crystalline phase transition temperatures of the membranes of E. coli cells gi'own at 15 and 37~ were about 0 and 22~ respectively. Overath et al. [ 15] reported that those temperatures for K1060 cells grown with oleic acid and linolenic acid were about 4 and 15~ respectively. For the heat resistance of cells, these phase transition temperatures were found to correspond to the temperatures where the viability started to change, as shown in Figure 1 for W3110 strain. Since the-'phase separation of membrane lipids occurs below these transition temperatures, lowering of temperature below this level should result in an increase in gel-phase area in the membranes. This may be the reason why the heat sensitivity increased with decreasing preincubation temperature below the above points where the viability started to change. For the synthetic lipids, increasing hydrostatic pressure has been indicated to raise the phase transition temperature by approximately 20~ every 100MPa [16]. We measured the transition temperature of membrane lipids extracted from cells grown at 15~ and at 37~ at atmospheric pressure and 100MPa. As a consequence, at atmospheric pressure, the temperatures was below 15~ which was the lowest tested temperature, for the former cells and about 20~ for the latter, in accord with

188 Sinensky's data [14]. At 100MPa, the transition temperature was about 25~ for cells grown at 15~ but no transition was observed with cells grown at 37~ in the range of tested temperatures between 15 to 45~ This suggests that cells which have membranes rich in gel-phase are more sensitive than cells having membranes rich in liquid-crystalline phase. Although we can not compare here the temperature where the viability of pressurized cells started to change with the phase transition temperature, the findings obtained suggest that the membrane fluidity may be involved in the bacterial resistance to not only heat but also high hydrostatic pressure. Although whether the resultant membrane damages were a direct cause of cell death was unclear, both at a high temperature and high pressure, any event relating to the membrane structure may be involved in any process of the injury pathway toward cell death.

4. REFERENCES

1 T. Tsuchido, J. Antibacterial Antifungal Agents, Jpn., 18 (1990) 75. 2 T. Tsuchido, Jpn. J. Freezing Drying, 39 (1993) 61. 3 C.E. ZoBell, High Pressure Effects on Cellular Processes (A.M. Zimmerman, ed.), p. 85, Academic Press, New York, 1970. 4 D.G. Hoover, C. Metrick, A.M. Papineau, D.F, Farkas and D. Knorr, Food Technol., 43, [3] (1989) 99. 5 N. Katsui, T. Tsuchido, M. Takano and I. Shibasaki, J. Gen. Microbiol., 122 (1981) 357. 6 N. Katsui, T. Tsuchido, R. Hiramatsu, S. Fujikawa, M. Takano and I. Shibasaki, J. Bacteriol., 151 (1982) 1523. 7 T. Tsuchido, N. Katsui, A. Takeuchi, M. Takano and I. Shibasaki, Appl. Environ. Microbiol., 50 (1985) 298. 8 T. Tsuchido, I. Aoki and M. Takano, J. Gen. Microbiol., 135 (1989) 1941. 9 R.Y. Morita, Bacteriol. Rev., 39 (1975) 144. 10 M. Osumi, N. Yamada, M. Sato, S. Kobori, S. Shimada and R. Hayashi, High Pressure and Biotechnology (C. Balny, R. Hayashi, K. Heremans and P. Masson, eds.), p. 9, John Libbey Eurotext, Montrouge, 1992. 11 K. Tamura, Y. Kaminoh, H. Kamaya and I. Ueda, B iochim. B iophys. Acta, 1066 (1991) 219. 12 E.G. Bligh and W.J. Dyer, Can. J. Biochem. Physiol., 37 (1959) 911. 13 A.G. Marr and J.L. Ingraham, J. Bacteriol., 84 (1962) 1260. 14 M. Sinensky, Proc. Natl. Acad. Sci. U. S. A., 71 (1974) 522. 15 P. Overath, H.U. Schairer and W. Stoffel, Proc. Natl. Acad. Sci. U. S. A., 67 (1970) 606. 16 K. Heremans, Annu. Rev. Biophys. Bioeng., 11 (1982) 1.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

189

Structure and Function of Nucleic Acids Under High Pressure Andrzej Krzyzaniak l, Piotr Satafiski 2, Ryszard W. Adamiak l, Janusz Jurczak 2'3 and Jan Barciszewski 1 z Institute of Bioorganic Chemistry of the Polish Academy of Sciences, Noskowskiego 12, 61704 Poznafi, Poland, 2Institute of Organic Chemistry of the Polish Academy of Sciences, Kasprzaka 44, 01-224 Warszawa, Poland, 3Department of Chemistry, Warsaw University, Pasteura 1, 02-093 Warszawa, Poland.

Abstract

We have studied effects of high pressure on structure and function of synthetic and natural DNA and RNA. An analysis of circular dichroism (CD) spectra identified that at pressure of 6kbar, polyd(CG) changes its B conformation to Z-DNA form. Synthetic oligoribonucleotides (CG)6 and (AU)6 change their conformation from A to Z-RNA at 6 kbar and in the presence of high salt (5M NaC1) concentration, but not at high pressure only. Heterodimer of DNA-RNA responds to high pressure slightly changing its original A-like conformation. We suggested that high pressure effects the nucleic acids structure through their dehydration, of which the first step is a change of water structure itself. Detailed inspection of the CD spectra of tRNA before and after pressure treatment suggests some changes in its conformation. What is more interesting, high pressure catalyses charging specific amino acid to its cognate tRNA. Such obtained aminoacylated tRNA molecule, is fully active active in ribosomal poly(U) directed polyphenylalanine synthesis.

1. I N T R O D U C T I O N

Hydrostatic pressure is an emerging physical parameter in biological studies and biotechnology. It efficiently perturbates an equilibrium and rate processes. Recently high pressure is very useful technique in structural biology, aimed at establishing relationships between structure and function of biological macromolecules. It is known that pressure dependence of reaction velocity is due entirely to the activation volume of the reaction, assuming that the reacting molecule is not subject to denaturation by the increased pressure [ 1]. Up to now many studies have been concentrated on conformational changes of proteins at high pressure but only few dealed with nucleic acids. We were interested in studies of effects of high pressure on structure and function of nucleic acids. We analyzed conformation of poly d(CG), r(GC)6, r(AU)6, heteroduplexes of d(GC)3(AT)g*r((AU)3(GC)3) as well as native

190 transfer ribonucleic acid by means of circular dichroism (CD). It is well known that DNA occurs in three different conformations B, A and Z-DNA [20]. For all of them, the crystal structures are known and CD data on structure in solution have been accumulated. Those three crystal structures differ one from another significantly by a water content [2]. In the B conformation, 10 base pairs show up one complete turn of the helix and in the A conformation, 12 base pairs generates one helical turn. The left handed Z-DNA form has been found for oligodeoxynucleotides with alternating purines and pirymidines sequences [3]. In this conformation the purine nucleosides occur in syn conformation but the sugar-phosphate backbone forms a zig-zag what makes DNA helix left-handed [3]. On the other side, RNA occurs mainly in the A conformation as a consequence of the presence of 2'-OH group which has a capacity to form hydrogen bonds through water molecule with 02 or N3 atoms of the same nucleoside [4]. Although the crystal structure of the Z form of RNA is not known up to now, there are NMR and CD data available which characterize such structure in solution [5,6]. It is known that conformation of DNA and RNA with alternating purines and pirymidines can be effected by many different factors as high salt, organic solvents, temperature and chemical modification. In this paper we will summarize results on application of high pressure to studies of structure and function of nucleic acids obtained in our laboratory. 2. HIGH PRESSURE EFFECT ON THE STRUCTURE OF OLIGONUCLEOTIDES

One of the best methods presently available for analysis of conformational changes of nucleic acids in solution is circular dichroism (CD) spectroscopy [3]. B-DNA to Z-DNA conformational change can be traced with negative Cotton effect at 295 nm [21 ]. Poly d(CG) exposed to high pressure of 6 kbar for 19 hours switch the from B to Z form [7]. The conformation of polydeoxynucleotide induced with high pressure is identical to that one caused by salt or alcohol at high concentration [8,9]. The high pressure effect on DNA is completely reversible after 5 hours sample handling at an atmospheric pressure and room temperature. At 10 kbar, however, there is almost no B-Z DNA change. Most probably at these conditions water forms VI-like form of ice, which is considerably different from that one formed at atmospheric pressure [ 10] and it limits changes of conformation of DNA. RNA molecules occurs in the A conformation due to the presence of 2'-OH group [4]. ZRNA has been observed in solution of 2.85M MgC12 or 6M NaC10 4 and 42 C. In studies of pressure effects on RNA, we have used two synthetic oligoribonucleotides r(GC)6 and r(AU)6. After 18 hours pressurization at 6 kbar two changes have been noticed in their CD spectra: firstly, a maximum of the CD spectrum was shifted to higher wavelengths, and secondly, new CD peak appeared in the spectrum beyond 300 nm. A shift in the Cotton effect indicates changes of structure of nucleic acid and its interaction with solvent. The last one is probably due to light scattering and/or aggregation of the oligoribonucleotides. We have observed similar effects for r(AU)6 [11]. Interestingly, the CD spectra of both oligoribonucleotides measured after high pressure treatment resemble very much those of r(GC)3 obtained in the presence of 5M NaC1 [6] or poly r(GC) in 6M NaC10 4 [5]. From these data one can clearly see, that high pressure alone does not induce the Z RNA conformation of the oligoribonucleotide duplexes. Therefore we have checked influence of high pressure on RNA conformation in the high concentrated salt solution. Exposure of r(CG)6 to high pressure of 6 o

191 2.5

kbar in the presence of 5M NaC1 shows a positive Cotton effect at about 295 nm. No CD ,._, 1.5 band above 300 nm indicates that RNA aggregation is significantly reduced with high "~ 0.5 .. t . . ' ~ ' A t,,, o 0 salt. The effect of high pressure on CD spectra 43.5 of r(AU)6 observed at 295 nm is similar to that of (GC)6, although less pronounced [11 ]. One -1.5 240 260 280 300 320 220 should also notice that at lower wavelength wavelength [nm] (230 nm), a new peak appeared which is much higher then that one in spectra of the Z-RNA form [5,6]. Comparing the CD spectra with B those already known for oligoribonucleotides 2 we concluded that high pressure at high salt concentration induces the left handed Zconformation of RNA. To understand contribution of ribose residue to this process, we analyzed CD spectra of 2'-0<1 methylated analog of (CG)3 oligonucleotide. It -4 is known that this type of modification strenghten stability of the oligonucleotide in -6 solution [22]. We have found, that the methylated oligonucleotide neither at high 240 280 320 pressure nor at high pressure in high salt wavelength [nm] Fig. 1 solution (5M NaC1) did not change its a) Circular dichroism spectra of (CG)3OMe conformation significantly (Fig l a). Earlier we in atmospheric pressure (solid line) and 6 have also shown that poly d(GmSC) does not kbar (dashed line) recorded in buffer change its conformation under high pressure containing 5M NaC1 (Fig. lb) [7]. It seems that presence of methyl b) Circular dichroism spectra of poly group on the base moiety or on the sugar d(GmSC) after treatment with high pressure: residue of the nucleoside, restricts (solid line) atmospheric pressure; (dotted conformational flexibility of nucleotide. line) 6 kbar, 1 hour; (dashed line) 6 kbar, 19 To learn more about different effect of high hours; (dashed line with dots) 10 kbar, 19 pressure on RNA and DNA we studied also hours. their heteroduplexes. Synthetic RNA and DNA oligonucletides with altemating purinepirymidine sequences d(GCGCGCATATAT)*r(AUAUAUGCGCGC) have been challenged with high pressure. From their CD spectra it is evident that the heteroduplex does not occur in a Z-DNA like form. We did not see any similarity with CD spectrum of Z-RNA and can only conclude that heteroduplex has not aquired exactly neither A nor B form. When high pressure together with 5M sodium chloride is applied, small hyperchromic Cotton effect at ca. 265 nm is visible what resembles the A conformation. This observation is in good agreement with previous one, that at lower humidity heteroduplexes tend toward canonical A-RNA structure [ 13]. However RNA-DNA complex is unable to form zig-zag conformation. .v~

192 3. MECHANISM OF HIGH PRESSURE INDUCED CONFORMATIONAL CHANGES OF NUCLEIC ACIDS For long time it has been known that the main factor responsible for conformational switches of DNA is hydration [2]. The B form is the most hydrated form of DNA and the left handed Z form is the least hydrated one [2]. From crystal structure analysis of various oligodeoxynucleotides it follows that in the B form each phosphate in the sugar-phosphate backbone is hydrated separately, whereas in the A and Z forms the distances between phosphate oxygens are shorter and water molecules bridge two neighbouring phosphates. The 2'-OH group of the riboses together with water molecules are involved in formation of hydrogen bond network, which thus stabilizes the overall molecule structure of RNA. Detailed analysis of crystal and solution studies of B and Z-DNA forms, allowed us to conclude that the driven force of this change is dehydration, what nicely explains term "water economy". This observation is additionally supported by resistance of RNA molecules to change their conformation at high pressure. It means that water is more strongly bound to nucleic acid backbone and that this is due to presence of 2'-OH group. For conformational changes of nucleic acids the crucial is first water layer, located in the close contact with a solute [14]. High pressure not only can change a molar volume of nucleic acid, but also, a molar volume of water. Recently on the basis of theoretical calculations, a model of water structure has been proposed [ 15] in which water molecules occur predominantly in tetrameric and octameric forms. In cubic (octameric) form, 1 mol of water molecules occupy a volume 16.6 cm 3, but in tetrameric form the value is 17.9 cm 3 [ 15]. Volume difference between these two forms at atmospheric pressure is ca. 8% in contrast to 20% which has been observed for water pressed with 1 kbar at 25~ [14]. It has been suggested that high pressure changes water volume due to shortening of the H-bonds [16]. Therefore we assume, that high pressure induces lowering of molecular volume of water by change of a tetrameric to an octameric form which chain can interact with phosphate groups located in the groove of Z-DNA. This model was strongly supported by the recent finding that high pressure and high salt concentration have similar effect on water structure [23]. For example effect of 4M concentration of sodium chloride on the structure of water is similar to the one caused by 1.4 kbar pressure [23]. From various studies of nucleic acids in solution it is known that important factor responsible for conformational changes of oligonucleotide is a nucleotide sequence. The B to Z or A to Z conformational changes are possible only when altemating purine-pyrimidine sequence is present. In the DNA:RNA heteroduplex with such sequence, however there is no conformational change at high pressure even when correct (alternating purine-pirymidine) sequence is present. This can be explained by different hydration of the both DNA and RNA strands and therefore, water would not be able to stabilize a new conformation. 4. AMINOACYLATION OF tRNA AT HIGH PRESSURE Treatment of transfer ribonucleic acid (tRNA) with high pressure causes some conformational changes as seen from CD spectroscopy [12]. Small batochromic shift of the CD maximum identifies stronger interaction of chromophore with solvent at high pressure. To

193 learn more about mechanism of this interaction we decided to probe the tRNA structure by aminoacylation reaction with cognate and non cognate amino acid. It is known that in the cell as well as in vitro, tRNA is aminoacylated with specific amino acid in the enzymatic reaction. The enzyme, aminoacyl-tRNA synthetase, decrease an activation energy of the acylation reaction and catalyse acyl bond formation. From crystal structure of complexes tRNA and AARS it is known that conformation of tRNA in the complex is different from that in the free state [19]. Most changes occur in the acceptor stem. It means that tRNA is charged in conformation different from the native one. We found that phenylalanine is bound to E.coli tRNA Phe at high pressure in the absence of aminoacyl-tRNA synthetase and ATP [17]. Based on these findings we can assume that conformation adopted at high pressure and induced by the enzyme are very similar (Fig. 2). To prove an amino acid specific acylation site at high pressure, we chose tRNA Phe of E.coli which has at least two possible targets for this reaction: 3' hydroxyl group of terminal adenosine and amine group of nucleoside X (3 amino-3 carboxypropyl uridine) in position 47 of tRNA Phe molecule. The excellent proof for tRNA aminoacylation at the terminal adenosine, is a hydrolysis of ester bond in alkaline conditions. Kinetics of a spontaneous hydrolysis of [14C] Phe_tRNAPhe obtained enzymatically and at high pressure are almost ideniical [ 17]. If putative amide bond is formed it would be resistant to alkaline hydrolysis. This finding was further confirmed by HPLC analysis of high pressure obtained [14C]Phe-tRNAPhe hydrolyzed with ribonuclease A. The RNase A cleaves RNA at 3' end of pyrimidines. After enzymatic digestion a new peak appeared which was analysed on a TLC plate. This assay allowed us to conclude that phenylalanine is bound to terminal adenosine [ 18]. Specificity of tRNA aminoacylation at high pressure was also confirmed, tRNA Phe from E.coli was aminoacylated with [14C]_phenylalanine in the presence of increasing amount of cold serine. No inhibition of the aminoacylation level was observed [17].

Fig. 2. A scheme of the aminoacylation reaction carried out enzymatically (top) and at high pressure (bottom). Final product of these two reactions is the same. Putative intermediate conformation in the enzymatic coupling and the one generated by high pressure are similar or identical.

194 Furthermore we proved that the product of aminoacylation reaction at high pressure is biologically active. Phe-tRNA Phe was bound to poly U programmed ribosomes and was good substrate for synthesis of polyphenylalanine. Kinetics in both reactions for high pressure and enzymatically charged tRNAs is almost identical [ 18].

5. ACKNOWLEDGEMENTS This work was supported by the grant from the Polish Committee for Scientific Research (KBN).

6. REFERENCES 1. P. Douzou, (1992) in High Pressure and Biotechnology, eds. C.Balny, R.Hayashi, K.Heremans and P.Masson. Colloque INSERM/John Libbey Eurotext Ltd. vol. 224, 3 2. W. Saenger, W. N. Hunter and O. Kennard, (1986) Nature, 324, 385 3. A. Rich, A. Nordheim and A. H. -J. Wang, (1984) Annu.Rev.Biochem., 53, 791 4. E. Westhof(1988)Annu. Rev.Biophys. Biophys. Chem., 17, 125 5. K. Hall, P. Cruz, I. Tinoco Jr., T. M. Jovin and J. H. van de Sande (1984) Nature, 311,584 6. R. W. Adamiak, A. Ga|at and B. Skalski, (1985) Biochim. et Biophys. Acta, 825, 345 7. A. Krzy~aniak, P. Satafiski, J. Jurczak, and J. Barciszewski, (1991) FEBS Lett., 279, 1 8. F. M. Pohl and Y. M. Jovin (1972)J.Mol.Biol., 67, 375 9. M.J. Behe, G. Felsenfeld, S. C. Szu, and E. Charney (1985) Biopolymers, 24, 289 10.K. Heremans (1992) in High Pressure and Biotechnology, eds. C.Balny, R.Hayashi, K.Heremans and P.Masson. Colloque INSERM/John Libbey Eurotext Ltd. vol. 224 11.A. Krzyzaniak, J. P. F~irste, R. Bald, P. Satafiski, J. Jurczak, V. A. Erdmann and J. Barciszewski, (1994) Int.J.Biol.Macromol., 16, 159 12.A. Krzyzaniak, J. P. Ftkste, V. A. Erdmann, P. Satafiski, J. Jurczak and J. Barciszewski (submitted for publication) 13.S. -H. Chou, P. Flynn and B. Reid (1989) Biochemistry, 28, 2435 14.T.V. Chalikian, A. P. Sarvazyan, E. Plum and K. J. Breslauer (1994) Biochemistry, 33, 2394 15.S.W. Benson and E. D. Siebert (1992)J.Am.Chem.Soc., 114, 4269 16.D.B. Kitchen, L. H. Reed and R. M Levy,. (1992) Biochemistry, 31, 10083 17.A. Krzyzaniak, P. Satafiski, J. Jurczak and J. Barciszewski (1994) Int.J.Biol.Macromol., 16, 153 18.A. Krzyzaniak, P. Satafiski, J Jurczak and J. Barciszewski (submitted for publication) 19.M., Haruki, R. Matsumoto, M. Hara-Yokoyama, T. Miyazawa, and S. Yokoyama, (1990) FEBS Lett., 263, 361 20.W. Saenger, in Principles in Nucleic Acids Structure, 220-295 (Springer, New York, 1983) 21.F.M. Pohl, T.M. Jovin, W. Baehr, and J.J. Holbrook, (1972) Proc.Natl.Acad.Sci. USA 69, 3805 22.C.Escude, J.-S. Sun, M. Rougee, T. Garestier and C. Helene (1992) C.R.Acad.Sci.[III] 315, 521 23.R. Leberman and A.K. Soper (1995) Nature 378, 364-366.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

195

Stabilization of Thermophilic Enzymes by Pressure D. S. Clark a, M. M. Sun a, L. Giarto a, P.C. Michels a, A. Matschiner b, and F.T. Robb b aDepartment of Chemical Engineering, University of California, Berkeley, California, 94720 bCenter of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, Maryland, 21202

Abstract Many thermophilic enzymes exhibit increased thermal stability at high pressures. Improved stability under pressure appears to be closely related to enzyme thermostability; however, the underlying mechanism(s) of this relationship is not yet clear. We are investigating structure-function relationships associated with the pressure-stabilization of enzymes, particularly thermophilic enzymes from pressure-adapted sources (e.g., glutamate dehydrogenase (GDH) from the deep-sea hyperthermophile Pyrococcus endeavori). Surprisingly, recombinant GDH from Pyrococcus furiosus is stabilized ca. 800-fold at 103~ by 500 atm pressure, whereas the closely related wild-type enzyme from P. endeavori is unaffected by pressure. This behavior suggests that useful insights into enzyme structurestability relationships can be obtained by comparing the structures of the two proteins, and that subtle structural differences can have a major impact on thermostability and pressure stabilization.

High pressure is an important characteristic of many unusual habitats from which exciting microorganisms are now being isolated. These habitats include deep-sea hydrothermal vents, cold waters in the deep ocean, and subsurface environments in the Earth's crust. Microorganisms from these sources are of far-reaching interest for many reasons, including their novel physiological properties, their promise to provide new clues about the evolution of microorganisms and the origin of life itself, and their potential for exploitation in biotechnology. This latter comment applies to high pressure in general, and one can identify several proven as well as potential applications of high-pressure biotechnology. Many such applications are discussed throughout this monograph. For some time Clark and co-workers have been investigating pressure effects on the structure and function of proteins, as well as on the physiology of deep-sea thermophiles [ 1-4]. Figure 1 below illustrates the dramatic effects of pressure on the growth of two deep-sea thermophiles: Methanococcus jannaschii and Pyrococcus endeavori (formerly ES4). M. jannaschii is an extremely thermophilic methanogen isolated from the vicinity of a deep-sea hydrothermal vent at a depth of ca. 2500 meters [5]. P. endeavori was isolated from a flange fragment of a vent chimney on the Juan de Fuca Ridge Segment [6]. Both organisms

196 displayed barophilic growth under the conditions employed. At 86~ M. jannaschii grew nearly five times faster at 750 atm of hyperbaric pressure than at 7.8 atm; helium was used as the pressurizing gas. Likewise, at 95~ the growth rate of P. endeavori increased two-fold as the hydrostatic pressure was increased from 35 atm to 500 atm.

200

"6"

ii0

lso

' ....

' ....

"s ~oo

"~-

g

C_

....

i00

F~

90

iZ

80

' ....

' ....

\

C~

\

\\

6O

50

k[

50

0

\ .....

40 0 0

2OO

4OO

6OO

8OO

1000

1200

1400

'

95~

~ "

' ....

100

i

i ....

200 300 Hydrostatic

i ....

i ....

\ i

400 500 600 Pressure (atm)

700

Hyperbaric Pressure (atm)

Figure 1. Doubling times of M. jannaschii (based on methane production) (left) and P. endeavori (based on increasing cell number) (right) as a function of hyperbaric and hydrostatic pressure, respectively. The growth data for M. jannaschii are from Miller et al. [1]; the P. endeavori experiments are described in Nelson et al [2].

In addition to having a pronounced effect on the growth rate of M. jannaschii and P. endeavori, pressure has been shown to increase the thermostability of many thermophilic proteins. Shown in Figure 2 are data which typify this behavior. Figure 2 presents deactivation trajectories for citrate synthase from Thermoplasma acid@hilum, a moderately thermophilic acidophile with an optimal growth temperature of 55-60~ pH 1-3. Thermoinactivation was measured at 78~ and hyperbaric pressures of 1 atm and 500 atm. In this particular case, the enzyme was stabilized nearly 4-fold at the higher pressure, its half-life having been increased from ca. 15 min at 1 atm to just over an hour at 500 atm. Further examples of pressure stabilization are given in Table 1. Listed in Table 1 are half-life ratios, that is, the half-life measured at a pressure of 500 atm divided by the half-life measured at 10 atm, for various enzymes isolated from different sources exhibiting varying degrees of thermophilicity. For example, in the case of

197 hydrogenase, hydrogenase enzymes were isolated from four Methanococcus species, ranging from the mesophile M. maripaludis to the extreme thermophile M. jannaschii. The results indicate that the more thermophilic enzymes are stabilized by pressure at high temperatures, whereas the less thermostable enzymes are destabilized by pressure at lower temperatures. Moreover, the same pattern is observed for the other enzymes, including citrate synthase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

500 atm ~ ~

< "o o~ . ~

n-

Half-lives (min) 1 atm 15.7 + 2.5

.01

i~

500 atm 62 + 8 |

0

1 atm

|

50

1 O0

Time ( min )

Figure 2. Deactivation trajectories of citrate synthase from T. acidophilum measured at 1 atm and 500 atm, 78~ Further insights into pressure effects on protein stability can be gained by considering volume changes of key intra- and inter-molecular interactions associated with the reversible unfolding of proteins. These include hydrogen bond formation and electrostriction (defined here as the strong contraction of hydration volume due to alignment of dipolar water molecules in the electric field of exposed charge), which in an aqueous environment, are characterized by negative volume changes and hence are favored by pressure. On the other hand, recent evidence suggests that solvation of apolar side chains, particularly aliphatic side chains [7], is characterized by positive volume changes. Assuming that this is the case, high pressure should favor hydrophobic interactions within proteins. Moreover, it has been inferred from the structure of several thermophilic proteins that hydrophobicity confers thermostability; therefore, as a result of these two complementary influences, pressure is expected to increase hydrophobic thermostabilization, and the more hydrophobic the interior of a protein, the more likely it is to be stabilized by pressure. This model of pressure stabilization is supported by recent studies of pressure effects on the thermostability GAPDHs (Figure 3). Although hydrophobic solvation may play a major role in determining a protein's response to moderate pressures (where moderate is defined with respect to the denaturing pressure range for the enzyme), many other physicochemical factors are no doubt important.

198 The sensitivity of protein thermostability (and of pressure effects) to seemingly minor differences in protein structure is clearly illustrated by recent data obtained with the enzyme glutamate dehydrogenase.

30

o

Thermotoga maritima Thermusaquat~~

25

B.stearothermoph~

E o

~ 20 P~~Yeast Lobster 15 20

i

I

30

40

I

I

I

I

50

60

70

80

90

Growth T (~

1.6 E'-" O O tO v

(95~

1.2

9

(65oc) ~"

0.8 0.4

9 (55oc)

19

20

21

22

AGtr, 25~

23

24

25

26

27

(kcal/mole)

Figure 3. (Top) Relationship between transfer free energies (AGtr) for the hydrophobic amino acids of the s-loops of GAPDHs from several eubacterial and eukaryotic sources and the normal growth temperature of the source. A more positive transfer free energy indicates a

199 more hydrophobic s-loop (residues 178 to 201), the polypeptide segment through which each GAPDH subunit associates to form the core of the tetrameric protein. (Bottom) Inactivation ratios for GAPDHs versus transfer free energies of the s-loops. The sources of GAPDH and temperatures at which the inactivation experiments were performed are, from left to right, pig muscle (55~ B. stearothermophilus (65~ and T. maritima (95~ These results suggest that there is a relationship between pressure stabilization and the hydrophobicity of the s-loop region, which is critical in maintaining enzyme stability. For further details, see reference [3].

Table 1. Pressure effects on the half-lives of homologous enzymes exhibiting varying degrees of thermophily Inactivation temperature

to~2) (500 atm)

M. jannaschii

90~

4.8

M. igneus

90~

4.5

M. thermolithotrophicus

70~

0.3

M. maripaludis

70~

0.07

T. acidophilum

78~

3.9

Pig heart

35~

0.74

T. maritima

95~

1.6

B. stearothermophilus

65~

1.2

Pig muscle

55~

0.3

P. furiosus

110~

2.6

S. cerevisiae

45~

1.0

125~

2.7

Enzyme

t(1/2~(10 atm)

Hydrogenase 1

Citrate Synthase 2

GAPDH 1

o~-Glucosidase 1,3

Protease

M. jannaschii

1) Data from Hei and Clark [3]. 2) Enzymes provided by M. Danson, University of Bath. 3) P. furiosus enzyme provided by R. M. Kelly, North Carolina State University.

200 Glutamate dehydrogenase (GDH) catalyzes the oxidative deamination of glutamate, and along with aminotransferases, helps serve as a clearing house for a-amino groups within the cell. Furthermore, GDHs have been isolated and sequenced from a number of thermophiles, including P. endeavori, P. furiosus, and Thermococcus litoralis (Table 2). The Robb and Clark groups are currently using these three enzymes for comparative studies of structure-stability relationships as a function of temperature and pressure. A very interesting aspect of this research is that P. endeavori is a pressure-adapted organism isolated from a high-pressure environment, whereas its closely related cousin, P. furiosus, was isolated from a shallow marine source (although this does not preclude the possibility that P. furiosus also inhabits deep-sea environments). In addition, the genes for all three enzymes have been cloned and the proteins have been expressed in E. coli. Regarding the structure of GDH, biochemical studies on GDHs from a diverse range of mesophilic and thermophilic sources have shown that these enzymes are generally hexamers of identical subunits with masses around 50 kDa [8]. Table 2. Glutamate dehydrogenases from thermophilic sources

Organism P. endeavori P. furiosus T. litoralis

Source

Growth Range

Deep-Sea Vent Marine Solfataras Marine Thermal Springs

66-110~ 70-103~ 55-96~

Thermal stability experiments at low and high pressure were performed on two GDH enzymes: wild-type glutamate dehydrogenase from P. endeavori, and recombinant glutamate dehydrogenase from P. furiosus. Purified wild-type GDH from P. endeavori was a generous gift of Michael W. W. Adams (University of Georgia). The recombinant GDH was produced through expression of the gdhA gene (encoding the hexameric GDH from P. furiosus) in E. coli using the pET-11 d vector [9]. Thermal stability experiments were performed in a specially designed high-pressure, high-temperature bioreactor. The bioreactor was kept at a constant temperature of inside a forced-air oven. Inactivation was initiated by injecting 8-10 ml of a 50 ~g/ml enzyme solution containing 100 mM EPPS (pH 7.5 at inactivation temperature) and 10 mM dithiothreitol. For the high-pressure experiments, the bioreactor was rapidly pressurized with preheated helium from a gas reservoir inside the oven. Samples were withdrawn from the reactor at time intervals and assayed at 85~ and ambient pressure. Deactivation trajectories measured at high and low pressure are shown in Figure 4. As shown, the recombinant GDH enzyme was very unstable at 5 atm, losing 50% of its activity after 30 seconds of incubation. Substantial stabilization was observed at 500 atm, however, with the half-life increasing to 400 min. These results are in stark contrast to the data for wildtype GDH from P. endeavori. In this case, the enzyme's thermal stability was much higher at 5 atm and was not affected by pressure; the half-lives at 106~ were 280 and 290 min at 5 and 500 atm, respectively. The GDH results illustrate that two homologous enzymes can differ dramatically in their thermostabilities and response to pressure. The degree of pressure stabilization obtained for recombinant GDH, nearly 800-fold, is unprecedented. The magnitude of this effect is even

201 more remarkable when viewed in comparison to the results for wild-type GDH (no pressure stabilization). The disparate behavior of these enzymes suggests that useful insights into enzyme structure-stability relationships can be obtained by comparing the structures of the two proteins. However, sequencing studies reveal few differences between the two wild-type enzymes. The two GDHs are highly homologous and differ in composition by only 17 amino acids per 420-residue subunit.

1000 rE

E -1cl a <

500 atm tl/2 = 400 min

100

z

~

0

E

2

5 atm = 05 min

10

>,,

P. furiosus GDH

>

. _ = . _ _

< 1

Ill,ilitlJl 0

1000

50

ilillllfllj

Jiiliil,lJli

fill ji I

100 150 200 250 300 350 400

-

t.-

E "r" n

500 atm tl/2 = 290 min

100

z

5 atm tl/2 = 280 min

0

E

P. endeavori GDH < i l l i

l i l i

50

i

If

If

iI

if

ill

il

If

li

li

i

II

if

if

ii

li

I

100 150 200 250 300 350 400

Incubation Time (min) Figure 4. Deactivation at high and low pressure of recombinant P. furiosus GDH at 103~ (top) and of wild-type P. endeavori GDH at 106~ (bottom).

202 Another possibility is that the different thermostabilities of the two GDHs arise from the recombinant nature of the P. furiosus enzyme. Thus, a key question to consider is whether the properties of recombinant thermophilic enzymes can differ significantly from those of their wild-type counterparts. Factors that could explain the instability of the recombinant GDH include improper folding and/or assembly of the hexamer. The structural properties of the recombinant enzyme are currently under investigation in our laboratories. In any event, these results illustrate that high pressure, in addition to being an important component of the Earth's biosphere, is a very useful--and largely underutilized--parameter for fundamental studies of protein structure and function.

ACKNOWLEDGMENTS This work was supported by the National Science Foundation (BES-9421862).

REFERENCES 1 J.F. Miller, N.N. Shah, C.M. Nelson, J.M. Ludlow, and D.S. Clark, Appl. Environ. Microbiol., 54 (1988) 3039. 2 C.M. Nelson, M.R. Schuppenhauer, and D.S. Clark, Appl. Environ. Microbiol., 58 (1992) 1789. 3 D.J. Hei and D.S. Clark, Appl. Environ. Microbiol., 60 (1994) 932. 4 D. Hei, P.C. Michels, and D.S. Clark, Adv. Prot. Chem., in press (1996). 5 W. Jones, A. Leigh, F. Mayer, C. Woese, and R. Wolfe, Arch. Microbiol., 136 (1983) 254. 6 R.J. Pledger and J.A. Baross, J. Gen. Microbiol., 137 (1991) 203. 7 Y. Harpaz, M. Gerstein, and C. Chothia, Structure, 2 (1994) 641. 8 K.L. Britton, P.J. Baker, K.M.M. Borges, P.C. Engel, A. Pasquo, D.W. Rice, F.T. Robb, R. Scandurra, T.J. Stillman, and K.S.P. Yip, Eur. J. B iochem., 229 (1995) 688. 9 J. DiRuggiero and F.T. Robb, Appl. Environ. Microbiol., 61 (1995) 159.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

203

Enzyme stability under high pressure and temperature S. De Cordt a, L. Ludikhuyze a, C. Weemaes a, M. Hendrickx a, K. Heremans b and P. Tobback a a Laboratory of Food Technology, Dept. of Food & Microbial Technology, Katholieke Universiteit te Leuven, Kardinaal Mercierlaan 92, B-3001 Heverlee, BELGIUM

b Laboratory of Chemical & Biological Dynamics, Dept. of Chemistry, Celestijnenlaan 200D, B-3001 Heverlee, BELGIUM

Abstract This paper discusses the stability of two enzymes under high temperature (HT) and under combined high pressure and temperature (HP/T). One is Bacillus subtilis cz-amylase (BSA), an enzyme that was recently examined thoroughly as to its potential use as time-temperatureintegrator for quantitative assessment of thermal preservation processes [ 12]. The other one is polyphenol oxidase (PPO), an enzyme that should be inactivated by a preservation treatment because it causes brown colouration of fruit and vegetable products. 1. INTRODUCTION The stability of enzymes under HT and HP/T, and how this is affected by medium factors, is interesting merely theoretically, as well as with a view to applications. For instance, it has become clear that when high pressure (HP) will be applied for food preservation, the inactivation of quality related enzymes may be difficult. Because of this and other issues, it is believed that the most safe and economically feasible use of HP in food preservation will be in combined processes, especially with moderate temperature elevation [ 1,5,7,10]. The stabilities of systems (enzymes in a specified medium) can be compared on the basis of different parameters and in different terminologies. Kinetics offer a very thorough basis for making a balanced and thoughtful comparison. Furthermore, knowledge of kinetics will be required in the development and use of methods for quantitative assessment of HP/T preservation processes.

2. MATERIALS AND METHODS 2.1 Enzymes and media Bacillus subtilis a-amylase (BSA) was supplied by Fluka as a solid. It was dissolved in tris buffer (0.01 M). pH was 8.6, unless specified otherwise. Ca 2+ concentration was adjusted by adding CaC12. The concentration of ethanol, ethylene glycol and glycerol are expressed in volume percent; the concentration of mannitol and sorbitol in weight percent. Polyphenoloxidase (tyrosinase) (PPO) isolated from mushrooms was supplied by Sigma as a solid. It was dissolved in phosphate buffer (0.1 M). pH was 6.5, unless specified otherwise.

204

2.2 High temperature (HT) treatment In order to enable kinetic analysis of the results, the HT treatments were designed to be isothermal. They were performed in a water bath with thermostatic control. Samples were contained in capillary glass tubes ( g 1.5 mm), thus minimizing heating lag. At preset heating times, samples were transferred to and stored on ice water (to minimize cooling lag). 2.3 Combined high pressure and temperature (HP/T) treatment Combined HP/T treatments were performed in a warm isostatic press (SO. 5-7422-0, National Forge, Belgium). The pressure and sample temperatures were measured every 10 seconds and registered, so that (t,T,P) profiles could be filed. 2.4 Activity assays The m-amylase activity was measured spectrophotometrically according to procedure no. 577 of Sigma Diagnostics [12]. PPO activity was measured spectrophotometrically. The procedure is based on the enzymatic oxidation of catechol to o-quinones, which polymerize to brown complexes detectable at 411 nm. Temperature was 23~

2.5 Data interpretation A fast and simple way to compare the stabilities of different systems (enzyme in a specified medium) is to expose them to identical HT or HP/T conditions for identical times, and rank them according to their relative activity retention (A/A0). However, this method yields only a very superficial analysis. A real kinetic analysis provides a solid basis for a more profound comparison, which in some instances unavoidably turns out to be more complex too. If the compared systems have equal orders (n), activation energies (Ea) and activation volumes (AVe), one can simply rank according to the rate constants (k). If the Ea's and/or AV~'s differ, the ranking of rate constants should be specified with respect to T and/or P, because the variations of k as a function of T and/or P will intersect at an "isokinetic point" where the ranking reverses. If the orders differ, the comparison becomes even more complex. In this case, it is not appropriate to compare the rate constants. A graphical plot or simulation of the compared kinetics can help then. Kinetic experiments, where (A,t) datasets are collected by submitting samples to identical isothermal/isobaric HP/T treatments during various times, could not be performed with the above described HP equipment because it is a single vessel system and the reproducibility of the P- and T-profiles in subsequent runs is not sufficiently high. However, in a limited number of cases, a kinetic analysis was performed of the (non-isothermal) HP/T results. This required the simplifying assumption that the HP/T treatments were isobaric. Furthermore, an advanced non-linear regression programme is needed (SAS), and the full (T,t)-profile of the applied treatment (see 2.3) is necessary input. The models used for regression on isothermal data are log(A) = log(A0) - kt

(if n = 1)

(1)

205

1 A = [A~ -n + (n- 1)kt] 1-n

(if nr 1)

(2)

for estimation of k (and n if nr E a was estimated from regression with the Arrhenius equation. For regression on non-isothermal data, the Arrhenius equation was implemented in eq. 1 or 2, and a Simpson integration was incorporated in the regression procedure. 3. R E S U L T S AND DISCUSSION

3.1 Influence of medium composition on the stability of B. subtilis o~-amylase (Table 1) From a specified enzyme concentration [E] on, stability increased with rising [E]. Below this treshold value, the correlation between enzyme stability and [El was not pronounced. Both under HT and HT/P conditions, stability was highest in alkaline medium (pH >_ 8). A more profound kinetic analysis was performed with [E]=15 mg/ml at pH 8.6. At 55~ (Tref), the rate constant at 1 bar was lower than any of the rate constants at the elevated pressures. That is to say, at Tref, BSA was more stable at 1 bar than at the higher pressures. This ranking of HT- and HP/T- stability must be specified with respect to T, since the activation energies are different (see 2.5). According to the isokinetic temperatures calculated from the Arrhenius plots, this ranking would reverse at 78~ when the HT stability is compared to the HP/T stability at 750 bar, and at 89~ when the HT stability is compared to the HP/T stability at 5300 bar. E a decreased with increasing pressure. The HT- and HP/T- stabilities increased with rising Ca 2+ concentration, and this increase was most pronounced at the lower Ca ion concentrations. From 10% upwards, the enzyme stability increased with rising ethanol concentration. This is contrary to literature [3,4,6], where the currently adopted vision is that mono-alcohols and other more hydrophobic solvents destabilize proteins due to interaction with the protein hydrophobic moieties, which are more readily accessible in the denatured state. The protective effect of ethanol was more pronounced if the HT-contribution to the HP/T treatment was higher. Protein stability was increasing with rising ethylene glycol concentration. According to Gray [6], ethylene glycol appears to be in an intermediate position between the polyols of three carbons and longer, which generally stabilize proteins, and more hydrophobic "cosolvents", which generally destabilize. Like with ethanol, the protective effect was more pronounced if the HT-contribution to the HP/T treatment was higher. BSA stability was found to be proportional to the trehalose or polyalcohol concentration. This is in agreement with numerous other literature reports [e.g. 2,3,11]. Similarly to what was observed with ethanol and ethylene glycol, the protective effect was more pronounced if the HT-contribution to the HP/T treatment was higher. The here discussed dependence of HT-stability of BSA is in accordance with earlier observations for B.licheniformis m-amylase [2]. A more profound kinetic analysis was performed with BSA in the presence of 15% glycerol. At 55~ (Trcf), the rate constant at 1 bar was lower than any of the rate constants at the elevated pressures. That is to say, at Trc f, BSA with 15% glycerol was more stable at 1 bar than at the higher pressures. This ranking of HT- and HP/T- stability must be specified with respect to T, since the activation energies are different. E a decreased with increasing pressure.

206

Table

1. H T -

and

[E] 0.25 - 30 mg/ml

pH: 4 - 1 0 ([E]: 1 and 15 mg/ml)

HP/T-

stability

of BSA,

as influenced

HT-stability (1 bar) - at 0.25, 1 and 5 mg/ml: effect not pronounced - from 5 mg/ml on (5, 15, 30 mg/ml): stability 1' with 1' [E] - stability highest in alkaline conditions (pH > 8.5) - at pH 8,6 ([E] = 15 mg/ml): n= 1 assumed k55< (k55 = 2.9 10 -4 rain ~)

b

~' m e d i u m c o m p o s i t i o n HP/T-stability (0.75 - 5.3 kbar) [8] - at 0.25 and 1 mg/ml: effect not pronounced - from 1 mg/ml on (1, 5, 10, 15, 20, 30 mg/ml): stability 1' with 1' [E] - stability highest in alkaline conditions (pH _>8) - at pH 8;6 ([E] -- 15 mg/ml): n =l assumed k55 (k55, 750 bar = .001069 min l , and k 1' with

?P) )_t

Ca : 0 - 300 ppm ( [ E ] : 1 and 15 mg/ml) ethanol: 0-30% ([E]=I 5 mg/ml)

ethylene glycol: 0-45% ([E]=I 5 mg/ml) trehalose: 0 - 400 mg/ml ([E] 1 and 15 mg/ml) polyalcohols: glycerol: 0-45%, mannitol: 022.5%, sorbitol: 0-30% ([E]=I 5 mg/ml)

Ea > (E a 64 kcal/mol) - stability $ with 7" [Ca 2.] - stronger stability increase per [Ca 2+] increment at the lower [Ca 2+]

- stability 1" with 1" [trehalose]

Ea (Ea 750 bar= 5 1 kcal/mol,and Ea$ with ~P) - stability $ with 1" [Ca z*] - stronger stability increase per [Ca 2+] 9 2+ increment at the lower [Ca ] - from 10% upwards: stability $ with 1" [ethanol] - stabilisation more pronounced if contribution of HT 1' - stability $ with $ [ethylene glycol] - stabilisation more pronounced if contribution of HT - stability $ with $ [trehalose] - stabilisation more pronounced if contribution of HT 1" general trends: - stability 1" with 1' [polyalcohol] - stabilisation more pronounced if contribution of HT 1' - at 15% glycerol: n=l assumed** k55 (k55.750 bar-- 4.5 10 .5 min 1, and k 1" with

-

- at 15% glycerol: n--1 assumed*

k55 < (k55 = 1.8 10 .5 min 1)

l"e) Ea > Ea (Ea = 64 kcal/mol) (Ea 750 bar=60 kcal/mol,and Ea$ with ~P) " The kinetic H T experiments were conducted at constant temperature (see 2.2), so that isothermal' plots of log(A/A0) as a function of heating time could be made. These plots can give indications on the value of the reaction order n. If a linear plot was obtained, n was assumed to be 1. If a biphasic plot was obtained, n was estimated by regression with the general nth order model (eq.2). With the used HP equipment, no kinetic isothermal/isobaric experiments could be performed (see 2.5). For lack of experimental indications on the value of n, it was either assumed to be equal to 1 or estimated by regression with the general nth order model, by analogy with the experimentally supported values for the corresponding HT-inactivation.

207

3.2 Influence of medium composition on the stability of polyphenoloxidase (Table 2) The pH is a generally important factor, whereas EDTA, benzoic acid and glutathione are specifically relevant to PPO. EDTA is a PPO inhibitor because it chelates copper, which is an essential element of the PPO active center. Benzoic acid is a competitive inhibitor because it is structurally analogous to the PPO substrates and binds to the active center [9]. Glutathione is a reductive agent converting o-quinones (product of the PPO enzymatic reaction) back to (colorless) diphenols, thus preventing the formation of brown complexes [9]. Table 2. HT- and HP/T- stability of PPO, as influenced by medium composition HP/T-stability (5.5 kbar) HT-stability (1 bar) n=l assumed" pH: 5.5---~6.5---~7.5 n = 1 assumed' k55 > k55 (at resp. pH levels: .095---~.072--~.083 (at resp. pH levels" .031---~.027---~.034 min 1) min -l) E a > Ea (at resp. pH levels: 70---~76---~83 (at resp. pH levels: 38---~32--+39 kcal/mol) kcal/mol) n=l assumed" glutathione: .005 M n = 1 assumed' k55 (.352min -1) > k55 (.082 min -1) Ea ( 56 kcal/mol) > E a ( 27 kcal/mol) n r 1 assumed EDTA" .005 M n>l n (1.822) > n (0.488) k55 ( .529 min IAU l-n***) > k55 ( .019 min 1AU 1-n***) Ea(76 kcal/mol) > Ea ( 17 kcal/mol) n r 1 assumed benzoic acid: .005 M n > l n (2.227) > n (0.604) k55 ( .189 min 1 AU l-n***) > k55 ( .013 min -1 AU 1-n***) Ea ( 89 kcal/mol) > Ea ( 36 kcal/mol) "and "': refer to notes under Table 1 *** Since n~l, the dimension ofk is time -1 Activity units 1-". ,4.

The influence of pH on HT- and HP/T-stability was analogous. The pH affected only slightly the rate constants and the activation energies. At Tref (55~ PPO was more stable at 5.5 kbar than at atmospheric pressure. For pH 5.5, 6.5 and 7.5 respectively, the isokinetic temperatures were 48, 50 and 51 ~ This means that e.g. for pH 6.5, at T < 50~ PPO would be more stable (lower k) at atmospheric pressure than at 5.5 kbar. Both under HT and under HP/T, k55 was increased by glutathion. Hence, one can conclude that at 55~ glutathione considerably lowers PPO resistance to HT and HP/T. Again, this stability ranking is to be specified with respect to temperature because the Ea's in the absence and presence of glutathion are different. The calculated isokinetic temperatures were 72 and l l l ~ respectively for HT- and HP/T- inactivation. In the presence of glutathione and at 55~ PPO stability was higher at 5.5 kbar than at 1 bar. Based on the calculated isokinetic T, this order would however reverse below 45~ With EDTA, the order of thermal inactivation was higher than 1. The reaction had a biphasic progress, i.e. an initial fast phase is followed by a slower phase. In general, this feature can have several causes. One possibility is the existence of two subfractions with different stability. Since EDTA chelates copper, and the copper in the active

208 center might influence the PPO stability, it is possible that EDTA indeed generates two subpopulations with different stability. Biphasic behaviour can be described using biphasic models, consisting of two terms, but here the kinetic analysis was confined to the general nth order model (eq.2). Simulation of the reaction progresses (see 2.5) in the absence and presence of EDTA, respectively, suggested that at Tref (55~ the HT- stability was lowered by EDTA. Similarly, a simulation suggested that also the HP/T-stability was decreased by EDTA. With regard to the comparison between the HT- and HP/T-stability in the presence of EDTA, simulation strongly suggested that at Tref, the PPO stability was higher at 5.5 kbar than at 1 bar. With benzoic acid, the order of thermal inactivation was higher than 1. Since benzoic acid binds to the PPO active center, the biphasic behaviour might be due to the coexistence of two fractions with different stabilities. It is possible that the fraction with benzoic acid bound is more stable [11]. The kinetic analysis was confined to regression with the nth order model (eq.2), and a simulation indicated that at Tref(55~ the PPO stability towards HT would be increased by benzoic acid. However, the Ea's differ, and according to the Arrhenius plots the ranking of the rate constants should reverse around 40~ A simulation of the HP/T- induced inactivations in the presence and absence of benzoic acid, respectively, suggested that (at 55~ also the HP/T-stability of PPO was improved by benzoic acid. This trend is in accordance with the possible mechanism explained above. With regard to the comparison between the HT- and HP/T-stability of PPO in the presence of benzoic acid, simulation indicated that at Tref, the PPO stability was higher at 5.5 kbar than at 1 bar.

Acknowledgement This research has been supported by the Flemish Institute for the promotion of scientifictechnological research in industry (IWT), the Belgian National Fund for Scientific Research (NFWO), and the European Commission as part of the AIR1-CT92-0296 project. 4. REFERENCES 1. Cheftel, J.-C. IAA 108 (3), 141-153, 1991. 2. De Cordt, S., Hendrickx, M., Maesmans, G. and Tobback, P. Biotechnol. Bioeng. 43, 107114, 1994. 3. Gekko, K. and Koga, S. J. Biochem. 94, 199-205, 1983. 4. Gerlsma, S.Y.J. Biol. Chem. 243 (5), 957-961, 1968. 5. Gould, G.W. and Sale, A.J.H.J. Gen. Microbiol. 60, 335-346, 1970. 6. Gray, C.J. Biocatalysis 1, 187-196, 1988. 7. Knorr, D. Food Technol. 47 (6), 156-161, 1993. 8. Ludikhuyze, L., Weemaes, C., De Cordt, S., Hendrickx, M. and Tobback, P. Submitted for publication in Appl. Biochem. Biotechnol., 1996. 9. McEvily, A.J., Iyengar, R. and Otwell, W.S. Crit. Rev. Food Sci. Nutr. 32 (3), 253273, 1992. 10. Tauscher, B. Z. Lebensm. Unters. Forsch. 200, 3-13, 1995. 11. Timasheff, S.N. and Arakawa, T. 1989. "Protein structure: a practical approach", Creighton, T.E. (ed.), p.331-344, IRL Press at Oxford University Press, 1989. 12. Van Loey, A., Hendrickx, M., Ludikhuyze, L., Weemaes, C., Haentjens, T., De Cordt, S. and Tobback, P. J. Food Prot., in press, 1996.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

209

Catalytic properties of proteinases under high pressure S.Kunugi, Y.Kanazawa, K.Mano, A.Koyasu and T.Inagaki Department of Polymer Science and Engineering, Kyoto Institute of Technology, Matsugasaki, Sakyo, Kyoto, 606 Japan. Abstract Effect of much higher pressure on thermolysin was investigated with regard to the proteinase activity on protein substrates, the intrinsic Trp fluorescence during and after the pressure incubation, limited proteolysis by subtilisin, autolysis, and residual activity after prolonged incubations. Though thermolysin is known to perform a remarkable pressure-induced activation at 100 or 150 MPa, it was revealed to be not a balo-tolerant protein, more sensitive to much high pressure treatment than did subtilisin.

1.INTRODUCTION We have studied the pressure dependence of several enzymatic reactions (Kunugi, 1992, 1993; Kabata et al., 1994) and found that the pressure affected enzymes in characteristic manner depending on the type and the structure of enzyme proteins, or depending on the nature of the scissile bond of the substrate and the type of the substrate-enzyme interactions. Among them, thermolysin was activated drastically by pressure (Fukuda & Kunugi, 1984). Considering this result, the proteolysis by thermolysin at high pressure was examined and the facilitated proteolysis was observed for some proteins (Hayashi et al., 1987). At the later stage we have studied the effect of much higher pressure on the proteinase reaction of this enzyme and found that the proteolysis by thermolysin is not always facilitated by increasing pressure. It depended on the (tertiary) structure of substrate proteins and the optimum pressure was relatively low when compared with the result of another proteinase, subtilisin. Thus here we report the result of the study on the catalytic and structural properties of thermolysin in higher pressure range ( < 400 MPa).

210 2.EXPERIMENTAL Thermolysin and subtilisin (Carlsberg) were obtained from Daiwa Kasei (Osaka, Japan) and Sigma (St.Louis, Mo. USA), respectively. Fua-Gly-OLeuNH 2 was kindly donated from Prof.N.Nishino of Kyushu Inst. Tech. (Kitakyushu, Japan). Other substrates and reagents were commercially available. High-pressure incubation vessel was made by Yamamoto Suiatsu Kogyou (Toyonaka, Japan). High pressure fluorescence was measured by using a combination of high pressure optical cell from Hikari Koatsu (Hiroshima, Japan) and a spectrofluorometer of Shimadzu RF-5000 (Kyoto, Japan). Spectrophotometric assay under high pressure was done using an equipment made by Unisoku (Hirakata, Japan). Degree of digestion was measured by absorbance (280 nm) of TCA-supernatant of the reaction solution. The reaction time was 1 h for casein and 3 h for BSA. Densitogram of PAGE was taken Shimadzu flying spot scanner CS-9000.

Fig.1. Non-specific digestion of casein and BSA by thermolysin or subtilisin under various pressure conditions. [enzyme]/[protein] = 0.1 mg/10m (in 1 ml). pH 6.5, 30~

Fig.2. Effect of pressure on the modification of amino groups of BSA by TNBS. o, 0.1 MPa;, 200 MPa,, 400 MPa; ,0.1 MPa for 2h + 400 MPa. pH 9.0, 40~

211 3.RESULTS AND DISCUSSIONS Figure 1 contains the results of proteolytic digestion of BSA and casein by thermolysin and subtilisin at various pressures. The degree of proteolysis is presented in the relative values to those at atmospheric pressure. The degree of digestion was much higher for casein at this pressure value. Apparently, the proteolysis of BSA is much facilitated, for both thermolysin and subtilisin, at elevated pressure, but the maximum value was obtained at 100 MPa for thermolysin, much lower than the value of 300 MPa for subtilisin. The difference between BSA and casein will be explained by considering well defined tertiary structure of the former protein. The elevated pressure will deform or denature this protein, much accessible or preferable for the proteolytic enzyme. The deformation of BSA tertiary structure under high pressure was also known from the results of pressure effect on the modification of amino groups of this protein by trinitrobenzene sulfonic acid (TNBS) as shown in Fig.2. The effect of pressure on the caseinolysis is relatively small. The pressure dependence of hydrolytic catalysis by these two proteinases towards synthetic small peptide substrates have been studied and the activation volume for kcat and kcat/Km parameters were measured as -35 and -65 ml/mol (thermolysin)(Fukuda & Kunugi, 1984), respectively and -8 and +4 ml/mol (subtilisin)(Kunugi et al., unpublished results), respectively. These values can not reasonably explain the highly different results of the proteolysis under higher pressure. Therefore we have measured the effect of pressure and pressure treatment on the intrinsic (Trp) fluorescence of these two proteinases. The results are shown in Fig.3. Open symbols are the (relative) fluorescence intensity observed at the indicated pressure (not corrected for the volume contraction of the sample solutions) and closed circles are the values measured after the incubation at the indicated pressure for 20 min. TLN

STN

9: 1,0 ,...,

" e~ 9

0

1.0

.--1 L:J

>,

r--< ,_J 'LtJ

,_1

0

100

200

PRESSURE (MPa)

300

400

0

100

200

PRESSURE (M

300

400

Pa)

Fig.3. Fluorescence intensity of intrinsic Trp of thermolysin (left) and subtilisin (right) measured at the indicated pressure (o) and after incubation at the indicated pressure for 20 min (e).

212

Fig.4. Effect of pressure on the limited proteolysis of thermolysin by subtilisin at various pH. Residual activity (relative) was shown against reaction time and pH. a. residual peptidase activity measured against FuaGlyLeuNH 2. b, residual esterase activity measured against FuaGlyOLeuNH 2.

lO0~

lO0, i

0

.

0

80

0

0

8O

60

6O

40

4O

9

2O

9

9

i

o

.

1

.

.2

O0

9

.

. 3

Time(h)

9

4

9

9

o ....

2;

'

~ '

;o'

~o

Time(h)

Fig.5. Effect of pressure on the autolytic process of thermolysin and the residual activity after incubation at 0.1 MPa (a) and 300 MPa (b). o, Fraction of main thermolysin band at 34.4 KDa, o, Fraction of subtilisin-nicking band at 14.4 KDa. l Residual peptidase activity after incubation at indicated pressure.

213 Clearly subtilisin suffered from little irreversible change in fluorescence up to at least 300 MPa, and even at 400 MPa the residual change in the fluorescence is very small. In contrast to this, thermolysin showed considerable irreversible change in fluorescence at 300 MPa or higher and this started to some extent even at 200 MPa. Although thermolysin showed a remarkable pressure activation, it underwent irreversible change in structure at much lower pressure than did subtilisin. As for the combination of these two proteinases, Fontana's group reported very interesting results (Vita et al., 1985). When a small portion of subtilisin is incubated with thermolysin solution, relatively stable fragment (Ser5-Thr224) of the enzyme peptide was formed, which was named thermolysin-S. This thermolysinS showed fairly reduced but certain endo-peptidase activity. The hydrolytic process of thermolysin by subtilisin was found to be accelerated by performing the process under high pressure (Fig. 4), still in limited manner. This result will also be explained as that the deformation or relaxation of the higher order structure of thermolysin caused by pressure made it easier for subtilisin to access and to attack on the specific peptide bond. Poly(acrylamide) electrophoresis analysis indicated that both the specific nicking and the further less specific digestions of the enzyme were accelerated by increasing pressure and hence the apparent reduction of the activity was accelerated. Though thermolysin is an endoprotease and it does not hydrolyze a normal alkyl esters such as amino acid methyl ester, it can cleave ester bonds of depsipeptide type esters from acylamino acid and e.g., leucic acid amide. Thermolysin-S showed almost comparably reduced activity for this "ester"ase reaction, but the reduction of the activity under high pressure showed a slightly different features for these two types of hydrolytic reactions. Specific and non-specific digestion of thermolysin can be caused by autolytic reaction. The effect of pressure on the autolytic processes of thermolysin was then examined by SDS-PAGE method and the catalytic assay. Under "low" calcium ion conditions (containing EDTA), where thermolysin is know to perform autolytic reaction very well, the autolysis occurred very quickly and the most of the process was completed before incubating at high pressure (after column chromatography). Under "high" calcium ion conditions (0.01M), autolysis did not proceeded much further even under elevated pressure, as shown in Fig.5. as the integration values of the scanning of the PAGE results. Both at 0.1 MPa (a) and 300 MPa (b), the fraction of the main band of the intact thermolysin reached about 80% of the total bands after certain time periods and the process seemed to be somewhat accelerated by giving elevated pressure. The change in the apparent activity of thermolysin during the incubation was measured (m). The half life was around 60 h under atmospheric pressure and it became much less than 1 h at 300 MPa. However, this inactivation was not directly related with the amount of the autolytic degradation. Without reducing much of the molecular weight, thermolysin lost its activity and the disactivation is highly accelerated by giving high pressure. The extent of acceleration seemed much larger than that for the autolytic reaction.

214 Thus it is now clear that thermolysin is relatively balo-labile protein, though it showed remarkable pressure-activation of the catalysis at relatively lower pressure (100 or 150 MPa). There seems to be unconscious acceptance that thermostable proteins are generally balo-stable and that there is some parallelism between thermostability and balostability. Actually there have been some experimental results which indicated such a correlation (Dallet and Legoy, 1995). However, the present example of thermolysin indicated that this is not always true.

4.REFERENCES 1 S.Dallet, and M.D.Legoy, (1995) Abstract for Enzyme Engineering XIII, P#26 (to be published as Ann.New York Acad.Sci., also contained in this proceeding) 2 M.Fukuda, and S.Kunugi, (1984) Eur.J.Biochem., 142, 565-570. 3 R.Hayashi, Y.Kawamura, and S.Kunugi, (1987) J.Food Sci., 52, 1107-1108. 4 H.Kabata, A.Nomura, N.Shimamoto, and S.Kunugi, (1994) J.Mol.Recognition, 7, 25-30. 5 S.Kunugi, (1992) in High Pressure and Biotechnology, C.Balny,R.Hayashi, K.Heremans and P.Masson Ed. John Libbey Eurotext Ltd., pp129-137. 6 S.Kunugi, (1993) Progress in Polymer Science, 18, 805-838. 7 C.Vita, D.Dalzoppo, and A.Fontana, (1985) Biochemistry, 24, 1798-1806.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

215

Pressure effects on the stability and reactivity of methanol dehydrogenase J. F r a n k a, N. Bec b, H.A.L. Corstjens a, R. Lange b and C. Balny b. aDeli~ University of Technology, Kluyver Laboratory of Biotechnology, D e p a r t m e n t of Biochemical Engineering, J u l i a n a l a a n 67, NL-2628 BC Delft, The N e t h e r l a n d s bINSERM U128, Site CNRS, Route de Mende, F-34033 Montpellier, France

Abstract Methanol dehydrogenase (MDH) is a key enzyme in the degradation of m e t h a n e and methanol by methylotrophic bacteria. It is an oligomeric protein with an a2~ 2 s t r u c t u r e (66 and 10 kDa respectively) and pyrroloquinoline quinone (PQQ) as the redox cofactor, non covalently bound to the large (zsubunit. The n a t u r a l electron acceptor for methanol dehydrogenase is a special type of cytochrome c. The MDH / cytochrome c L couple is an interesting model system to study the interaction and stability of proteins. The interaction of the two proteins can be followed either by the kinetics of electron transfer between the two proteins or by changes in the circular dichroism spectrum. A method based on capillary electrophoresis is presented to determine binding constants of proteins, w h i c h is suitable to investigate complex formation between m u t a n t proteins which are no longer capable to transfer electrons. Both proteins are r e m a r k a b l y resistant against d e n a t u r a t i o n by p r e s s u r e . Cytochrome CL, a small monomeric protein (19 kDa), is stable up to 1200 M P a . MDH retains its native structure and activity up to 500 MPa, accompanied by a reversible red shift of the 4th derivative absorption spectrum. At p r e s s u r e s above 700 MPa a transition to a denatured state occurs, which is not seen in the presence of cytochrome %. Application of pressure in the presence of 6 M u r e a leads to an irreversible and stable change in the 4th derivative absorption spectrum and a concomitant loss of most of the enzymatic activity. No evidence supporting subunit dissociation was obtained.

1. I N T R O D U C T I O N Methanol dehydrogenase (MDH) is a key enzyme in the microbial metabolism of methanol and m e t h a n e by methylotrophic bacteria [1]. Most MDH's are tetrameric enzymes with subunits of 66 and 10 kDa a r r a n g e d in a n

216 a2~ 2 structure [2] with non-covalently bound PQQ (2,7,9-tricarboxy-lH-pyrrolo[2,3-f]quinoline-4,5-dione) as a redox cofactor [3]. Electrons derived from the oxidation of methanol are transferred to an acidic cytochrome c (cytochrome cL, 19 kDa) and then to other components of the electron transport chain [4,5]. The published X-ray structures of several MDH's [see 6 for a review] reveal t h a t the a-subunit is a superbarrel composed of eight four-stranded antiparallel ~-sheets which are stacked radially around a pseudo eight-fold s y m m e t r y axis running through the centre of the subunit. The two a-subunits have a spherical shape and interact via a large p l a n a r interface. The small ~-subunits are extended, mostly a-helical structures, lying, isolated from each other, across the a-subunits. The function of the ~-subunit is not clear at present, its p r e s u m e d role in the interaction with cytochrome c L having been ruled out by the finding t h a t cytochrome c L interacts specifically with the a - s u b u n i t [5]. In spite of the fact that our s t r u c t u r a l knowledge of MDH has m u c h improved in recent years m a n y questions concerning the precise n a t u r e of the interaction of MDH with cytochrome c L and the forces that held together the subunits of MDH r e m a i n unsolved. This paper presents some approaches that may be of value for a better understanding of the forces and the conformational dynamics that are involved in the stability of MDH and its interaction with cytochrome c L.

2. T H E STABILITY OF M E T H A N O L D E H Y D R O G E N A S E MDH is a stable protein that only slowly looses its enzymatic activity w h e n stored at 4 ~ This is most probably due to the chemical reactivity of the PQQ cofactor that is usually in the semiquinone form. All attempts to reversibly remove the cofactor or to reversibly dissociate the subunits have been unsuccesful so far. Release of PQQ or dissociation appears to be invariably accompanied by irreversible denaturation. Since m a n y oligomeric proteins are known to be dissociated by hydrostatic pressures in the range of 100-200 MPa [7] the effect of pressure on MDH was explored. A convenient way to follow pressure induced changes is by means of 4th derivative UV spectroscopy [8] and since the spectrum of MDH is largely dominated by that of tryptophan, optimal conditions for t h a t amino acid were applied. As shown in Figure 1, hydrostatic pressures up to 450 MPa induce a red shift of 0.9 nm in the spectrum of MDH indicating that the tryptophan residues are pushed into a more apolar environment. This may be explained by a s s u m i n g that w a t e r molecules are forced out of the interface between the two a-subunits. Another possible explanation for this phenomenon may be that the interaction of some of these residues with the so called tryptophan docking motif (this is a s t r u c t u r e located on each blade of the superbarrel structure of the a-subunit interacting with a tryptophan on an opposed blade) is enhanced. Dissociation of MDH is unlikely since this most probably results in an increased exposure of tryptophan to the polar solvent causing a blue shift of the spectrum. F u r t h e r evidence for the high stability of MDH against pressure was obtained from FTIR studies in the

217 diamond anvil cell showing that MDH is stable up to 700 MPa. I n t e r e s t i n g l y , this p r e s s u r e limit seems to be shifted to higher p r e s s u r e s in the presence of cytochrome c L.

0.06

0.04

t

0.04 ~

"o 0.02 1 ~-"0 0.00 -0.02 -0.04 t -0.06

0.02

"-o "~ ~" 0 0.00

t

/

-0.02 t

284

t

t

288 292 wavelength (nm)

Figure 1. Reversible changes in the 4th derivative absorption s p e c t r u m of MDH upon application of p r e s s u r e at 30 ~ Before and after application of pressure ( - - ) ; 450 M P a ( ..... )

t

284

'

'

t

288 292 wavelength (nm)

Figure 2. Irreversible changes in the 4th derivative absorption spectrum of MDH w h e n p r e s s u r e is applied in the presence of 6 M u r e a at 30 ~ Ambient p r e s s u r e (. . . . ); 450 M P a (. . . . ); after d e p r e s s u r i s a t i o n ( ..... )

Complete dissociation of MDH, with release of PQQ, occurs in 6 M urea, pH 7.0 at 60 ~ but not at 30 ~ Exposure of MDH, dissolved in 6 M u r e a pH 7.0, to 450 MPa results in a blue shift as depicted in Figure 2, leading to a lower a n d broader m a x i m u m after d e p r e s s u r i s a t i o n . Concomitantly, the a r o m a t i c CD s p e c t r u m and the enzymatic activity are lost. However, we did not obtain evidence that this change is due to a complete unfolding of the protein. Gel electrophoresis of the pressurised protein revealed t h a t its molecular m a s s h a d not changed and the fact that PQQ was still present [9] f u r t h e r supports the apparently intact state of the protein. Moreover, considerable s e c o n d a r y s t r u c t u r e was still observed in the far-UV CD s p e c t r u m s u g g e s t i n g that pressure in the presence of urea induces a "molten globule" like state.

3. INTERACTION OF M D H WITH CYTOCHROME C L 3.1 Interaction studied with kinetic m e t h o d s The interaction of MDH with cytochrome c L from Methylophaga marina as a function of t e m p e r a t u r e and p r e s s u r e has been studied by stopped flow kinetic methods [10]. F r o m the p r e s s u r e dependence of the observed reaction rate at

218 -5 ~ (measured up to 200 MPa under conditions where complex formation is the rate limiting step) a value of 145 ml.mol 1 for the activation volume AV* can be calculated. The activation volume decreases to 62 ml.mo1-1 at 17 ~ and remains essentially constant up to 32 ~ F u r t h e r m o r e , a break in the A r r h e n i u s plot for complex formation is observed at 15 ~ which suggests a change in conformation of one or both of the proteins. This is confirmed by differential CD-spectroscopy of the protein mixture and is further substantiated by the pressure dependence of the break of 4 K.GPa 1. Investigation of cytochrome c L and MDH with CD-, absorbance- and FTIR - spectroscopy h a s revealed that the break in the A r r h e n i u s plot is due to a change in conformation of MDH r a t h e r t h a n cytochrome c L. The change of AV* as a function of t e m p e r a t u r e might therefore reflect the change in conformation of MDH, although at present it is not possible to distinguish between the contributions of solvation and conformational changes. Therefore the interaction needs to be further investigated as a function of solvent conditions, t e m p e r a t u r e and pressure, in addition to studies with specific m u t a n t proteins prepared by site-directed mutagenesis. 32, P r o t e i n interactions studied w i t h ~ t y capillary electrophoresis Free zone capillary electrophoresis is a rapidly developing technique with a n interesting potential to study molecular interactions in free solution [11]. Basically, one of the reactants is dissolved in the background electrolyte and its influence on the migration behaviour of the other reactant is studied. A s s u m i n g that the two reactants have a different electrophoretic mobility a relation can be derived for the mobility of the injected reactant as a function of the concentration of the reactant in the background electrolyte. The equilibrium between the protein in the background electrolyte (B) and the injected protein (I) is characterised by the association constant Ka: [BI] Ka = [B][I]

(1)

The total concentration of I, [I]o, is the sum of the concentrations of free [I] a n d bound I, [BI] and the electrophoretic mobility g of I is the weighted sum of the mobilities of free, gi, and bound I, g~: [II [BII g = go [-~o + g ~ [I]---o-

(2)

The mobility of the complex BI is roughly equal to that of B when the m o l e c u l a r mass of B is much larger than that of I, gB. If we further a s s u m e that [B]>>[I], so that [B] can be considered to be constant, equation 3 is obtained after substitution of equation i in equation 2: g =

Ka [B]gB + gI 1+ K a [B]

(3)

219 The advantage of this approach resides in the flexibility to control the composition of the electrolyte. A major drawback is however the fact that m a n y proteins tend to adsorb to the negatively charged capillary wall which is generally made of fused silica. This necessitates a pH well above the isoelectric points of the proteins or a suitable coating of the capillary wall. Although the MDH/cytochrome c L system fulfils most of the requirements for this type of analysis, MDH has significant interaction with the capillary wall at pH values that are of physiological interest. To test the feasibility of affinity capillary electrophoresis a set of comparable, but acid proteins, methylamine dehydrogenase (160 kDa) and its natural electron acceptor amicyanine (10 kDa), isolated from Thiobacillus v e r s u t u s [12] was used. Figure 3 shows the effect of increasing concentrations of methylamine dehydrogenase on the mobility of amicyanine. Fitting of the mobility data with equation 3 gives an association constant of 2-105 M -1, a value that compares well with literature data [13]. 14 1 I~M

3 #M 8~ <7

~__

-

Illl -

13-

5 gM

v f:

12-

12 16 20 Migration time (min)

24

0

I

I

I

2 4 6 8 Osmotic pressure (MPa)

Figure 3. Effect of the concentration Figure 4. Increased interaction of of MADH on the electrophoretic MADH and amicyanin in the presence migration of amicyanin in 10 m M of glycerol in 10 mM phosphate, pH 7.0 phosphate, pH 7.0

In Figure 4 IZ~ is plotted as a function of the osmotic pressure generated by glycerol [14] and it is clear that glycerol strongly increases the affinity of the two proteins, suggesting that water may play an important role in the interaction of the two proteins. From the slope of the plot a AV of-633 ml.mo1-1 can be derived. Even though we do not know yet the AV obtained from experiments conducted under hydrostatic pressure it does not seem likely that it will be very close to this unusual high value. Clearly, the development of equipment that allows for affinity capillary electrophoresis under high hydrostatic pressure will certainly provide us with more comparative data and will contribute to a better

220 interpretation of equilibrium volumes using different approaches. Studies of the interaction of MDH with cytochrome c L in coated capillaries are currently in progress.

5. ACKNOWl~EDGEMENT

We thank Prof. K. Heremans and P. Rubens for m e a s u r i n g the pressure stability of methanol dehydrogenase and cytochrome c L in the diamond anvil cell and Prof. C. Anthony for providing us with the atomic coordinates of methanol dehydrogenase from Methylobacterium extorquens AM1. We are grateful to Mr. J-L. Saldana for his excellent technical assistance. This research has been carried out in the framework of the COST D6 action and h a s been supported by grants from NWO/INSERM and INTAS 93-38.

6. REFERENCES 1 C. Anthony and L.J. Zatman, Biochem. J., 92 (1964) 614 2 C. Anthony, M. Ghosh and C.C.F. Blake, Biochem. J., 304 (1994) 665 3 J.A. Duine, J. Frank and J.A. Jongejan in Advances in Enzymology, pp 169-212, John Wiley & Sons, New York 4 M. Dijkstra, J. Frank and J.A. Duine, Biochem. J., 257 (1988) 87 5 C. Anthony, FEMS Microbiol. Rev., 87 (1990) 209 6 C.C.F. Blake, M. Ghosh, K. Harlos, A. Avezoux and C. Anthony, Nature Struct. Biol., 1 (1994) 102-105 7 G. Weber, Protein Interactions, Chapman and Hall, New York, 1992, pp 235-271 8 R. Lange, N. Bec, J. Frank and C. Balny, these Poceedings 9 M.A. Paz, P.M. Gallop, B.M. Torelio and R. Fltickiger, Biochem. Biophys. Res. Commun., 154 (1988) 1330 10 I. Heiber-Langer, C. Clery, J. Frank, P. Masson and C. Balny, Eur. Biophys. J., 21 (1992) 241 11 S.G. Penn, E.T. BergstrSm, I. Knights, G. Liu, A. Ruddick and D.M. Goodall, J. Phys. Chem., 99 (1995) 3875 12 T. van Houwelingen, G.W. Canters, J.A. Duine, J. Frank. A. Tsugita and G. Stobbelaar, Eur. J. Biochem., 153 (1985) 75 13 V.L. Davidson, M.E. Graichen and L.H. Jones, Biochim. Biophys. Acta, 1144 (1993) 39 14 J.A. Kornblatt and G. Hui Bon Hoa, Biochemistry, 29 (1990) 9370

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

221

M o d u l a t i o n o f e n z y m e activity a n d stability b y h i g h p r e s s u r e : cx-chymotrypsin V. V. Mozhaeva, b, E. V. Kudryashova a and N. Bec b aChemistry Department, Moscow State University, 000958 Moscow, Russia bInstitut National de la Sante et de la Recherche Medicale, I N S E R M U 128, Route de M e n d e - B.P. 5051, 34033 Montpellier, Cedex 1, France

Abstract Examples of application of high hydrostatic pressure for modulating important properties of enzymes, namely catalytic activity, substrate specificity and thermal stability are presented in this paper. Enzymatic reactions characterised by negative values of activation volumes (AVr are accelerated at high pressures as is the case with hydrolysis of anilides by c,-chymotrypsin. Simultaneous action of elevated temperature and high pressure raises the rate of enzymatic hydrolysis by more than 50 times as compared to the reaction studied at 20 ~ and atmospheric pressure. Due to different signs in AV;~ for hydrolysis of anilides and esters, a 100-fold increase in anilide-hydrolysing over ester-hydrolysing activity of c,-chymotrypsin in the sysytem of reversed micelles was observed at 2000 atm, in comparison with the rates measured at 1 atm. Another positive effect of hydrostatic pressure is in its ability to significantly decelerate heat inactivation of a-chymotrypsin : a 5-10-fold decrease in the rate of thermal inactivation of the enzyme at 50 ~ was observed by applying pressure of 1.500-2.000 atm. This protection becomes even more important in the presence of glycerol. Possible explanations of activation and stabilisation effects of high hydrostatic pressure are discussed.

Recently a growing researchers' interest from both fundamental and applied domains has been documented towards protein behaviour under extreme conditions, [1] such as high and low temperatures, high pressures and presence of additives like organic solvents, salts and denaturants which make the medium very different in comparison to dilute aqueous solutions where proteins are usually studied. Two types of changes in protein structure may occur under these extreme conditions. At temperatures of 50-60 ~ pressures of 4-8.000 atm and in concentrated solutions of additives, spatial structure of many proteins is significantly altered and they are denatured with a loss in activity. On the other hand, at less damaging temperatures, pressures, and cosolvent concentrations,

222 protein structure is retained on the whole and only local changes occur. Sometimes these local changes lead to another active state of a protein which may possess an altered activity, specificity, and stability. In comparison to other extreme conditions, pressure effects on proteins are less studied and worse understood. In a general term, a possibility of applying pressure to biological systems is based on the classical Le Chatelier's principle which claims that an increase in pressure favours the processes accompanied by a decrease in volume. For an equilibrium at a constant temperature, the reaction volume, AV, which is equal to the difference between volumes of a system in the final and initial states, is linked to the equilibrium constant (K) by the following relation : AV = V B - V A = -RT.(01nK/0p) T Pressure effects on the reaction velocity (v) derive from a similar equation AVr = V ~: - V A = -RT.(0 lnv/Op) T

(1) :

(2)

where the activation volume, AV~e, is equal to the difference in the system volumes in the activated and initial states. Normally biological reactions has the reaction volumes and the activation volumes in the interval between -50 and +50 ml/mol. This fact implies that both reaction velocities and equilibria are sensitive to pressure increases in the interval from 1 atm up to at least hundred to thousand atm. Due to recent technical progress, major physico-chemical methods including N M R , different spectroscopies, X-ray structural analysis, and fast kinetic methods have been adapted to such pressures ; see Ref. 2 for a recent review. For understanding the potentiality of pressure application to enzymatic processes we studied two experimental systems, enzymes included into reversed micelles [3-5] and catalysis and stability of e~-chymotrypsin at high temperatures [6, 7]. Kinetic studies were done in a stopped-flow apparatus with spectral and fluorometric detection created by Mr. Saldana in the laboratory in Montpellier [8]. This instrument enables rapid mixing of enzyme and substrate solutions during 510 ms and functions at pressures up to 2.000 atm and temperatures between -40 ~ and +40 ~

Pressure effects on catalysis by et-chymotrypsin at high temperatures. The transition state theory predicts (Eq. 2) that high pressure accelerates the processes having negative activation volumes (with a more compact activation state than the initial state). Hydrolysis of anilides by c,-chymotrypsin shows the value of AV~ of -10 ml/mol at 20 ~ that corresponds to a 2-fold reaction acceleration at a pressure of 1.500 atm. At 4.500 atm where c,-chymotrypsin is still active, the acceleration effect is equal to 6.5 times. The activation effect of high pressure becomes more pronounced at higher temperatures. For example, at 50 ~ and 3.600 atm, the rate of a-chymotrypsincatalysed hydrolysis of anilide is by more than 30-fold higher in comparison to the reaction at 20 ~ and 1 atm. Such an acceleration corresponds to the value of AV

223 equal to -25 ml/mol which is by 2.5-fold more negative than the value found at 20 *C. However, a further increase in pressure up to 4-5.000 atm leads to a decrease in catalytic activity owing to pressure-induced denaturation of achymotrypsin I9].

Pressure effects on thermal stability of cx-chymotrypsin. Normally temperature dependencies of enzymatic reactions are characterised by existence of an optimal temperature at which the activity has a maximal value. At atmospheric pressure, the maximal activity of a-chymotrypsin is observed at 45~ and a decrease at higher temperatures is explained by rapid thermal inactivation. At high pressures, temperature dependencies of the reaction rate are described by similar curves with maxima. However, due to pressure-induced stabilisation of the enzyme, the values of optimal temperatures (Tin) are progressively increased with raising pressure : T m is equal to 47 ~ at 600 atm and to 52 ~ at 1800 atm. The value of activation enthalpy (AH *) which determines a sensitivity of the enzymatic reaction to temperature alteration, is nearly doubled when pressure is raised from 1 atm to 1800 atm. As a consequence of these two tendencies, i.e. an increase in AH * and T m induced by high pressure, catalytic activity of a-chymotrypsin at temperatures higher than 45~ is significantly greater at elevated pressures than the activity at atmospheric pressure. Another positive effect of high hydrostatic pressure is in its ability to markedly decelerate heat inactivation of cz-chymotrypsin. At 50oc, the enzyme rapidly loses its anilide-hydrolysing activity at atmospheric pressure with the inactivation halftime smaller than 5 min. The inactivation half-time increases to 15 rain at a pressure of 600 atm and to 30 rain at 1200 atm. Further increase in pressure does not additionally change the thermal stability. This protection against thermal inactivation by high pressure becomes even more important at higher temperatures. The described phenomenon of stabilisation under high pressure may have a general character and was also observed for other enzymes. Thermal inactivation of carboxypeptidase from archaebacterium Sulfolobus solfataricus is also pressure inhibited. This stabilisation effect depends on temperature and at 50-60 ~ thermal inactivation can be completely suppressed by applying pressures of several thousand atm. [10] Stabilisation effect of high pressure was also observed by Hei and Clark for thermal inactivation of hydrogenases from extreme thermophiles 1111.

Effect of glycerol on stabilisation of ~-chymotrypsin at high pressure. Another often used possibility for protein stabilisation is by addition of low-molecular-mass compounds. Among these additives, glycerol is known as one of the most effective stabilisers. [12] At atmospheric pressure and 50~ addition of glycerol strongly protects a-chymotrypsin : in 40 % (v/v) glycerol, half-time of enzyme inactivation is in excess of 40 min, whereas in aqueous buffer this value is smaller than 5 min. Elevation of glycerol concentration over 40 % (v/v) does not lead to additional

224 stabilisation ; this character of ~-chymotrypsin stabilisation by glycerol was also observed by other authors I13]. However, the maximal stabilisation level achieved in 40 % (v/v) glycerol can additionally be increased by applying high hydrostatic pressure. At 50 ~ and a pressure of 1.800 atm, less than 10 % of enzymatic activity is lost during 40 min in 40 % (v/v) glycerol whereas nearly half of the active enzyme is inactivated during the incubation at atmospheric pressure. In turn, the presence of 40 % (v/v) glycerol additionally stabilises ~chymotrypsin already protected from heat inactivation by applying high pressure. This stabilisation effect is especially pronounced with respect to the value of the enzymatic activity measured at high temperatures. At a pressure of 4.700 atm, the value of T m for a-chymotrypsin-catalysed hydrolysis of anilide is observed at 35 ~ in aqueous buffer. Addition of 40 % (v/v) glycerol increases T m up to 50 ~ Catalytic activity of a-chymotrypsin at this temperature is by more than 50 times higher than the activity at normal conditions (20 ~ and 1 atm). At 4.700 atm, in the whole temperature interval between 40 ~ and 60 ~ enzymatic activity of czchymotrypsin is several-fold higher in the presence of glycerol than in aqueous buffer.

Possible reasons of pressure effects on activity and stability of cz-chymotrypsin. We assume that a key point in understanding the action of pressure on activation and stabilisation of cx-chymotrypsin may be a well-known ability of high pressure to increase protein hydration. [14] This effect of high pressure is quite opposite to a tendency of loosening the contacts of water molecules with functional groups of proteins shown at high temperatures [15] that is important for thermal inactivation of proteins. It has been found that the rate of conformational changes in proteins during thermal inactivation essentially depends on the water content ; in turn, the inactivation is followed by changes in protein hydration. [16] High hydrostatic pressure may inhibit unfavourable dehydration of the protein molecule and, similarly to the effect of glycerol, fortify the hydration shell of a protein. Our data suggest that both hydrostatic pressures of several thousand atm and osmotic pressure created by addition of glycerol, [17] increase protein thermal stability due to increase in hydration. We found an additivity in the effect of high pressure and concentrated glycerol solutions on stability of cz-chymotrypsin. This fact may indicate that a number of water molecules non-covalently bound with achymotrypsin, are sensitive to the effect of glycerol but are insensitive to high pressures. In other words, at high temperature interaction of certain water molecules with cz-chymotrypsin is strengthened by "osmotic stress" but is not influenced by hydrostatic pressure. For explanation of the observed effects we cannot also exclude a possible stabilisation effect of high hydrostatic pressure on different intra-protein non-covalent interactions such as hydrophobic contacts and hydrogen bonds. [ 111 Modulation of substrate specificity of ~t-chymotrypsin under high pressure. An interesting possibility of exploiting hydrostatic pressure is for modulation of substrate specificity of enzymes. If the enzyme-catalysed transformation of two substrates is characterised by activation volumes of different signs, then high

225 pressure accelerates one reaction while decelerates the other.

This situation was

observed with c~-chymotrypsin [3, 4], for which hydrolysis of anilide (negative AV~ values) was activated at high pressure, while ester hydrolysis (positive AVr values) was pressure inhibited. Due to this difference in the activation volumes, at 2.000 atm we observed a 10-fold increase in anilide-hydrolysing activity over esterhydrolysing activity in aqueous buffer, in comparison to the reactions studied at 1 atm. In the system of reversed micelles, the magnitude of AVe for hydrolysis of anilide becomes more negative as compared to the value obtained in aqueous solutions, while AV* value for ester hydrolysis becomes more positive. As a result, in micelles we observed a ca. 100-fold increase in the rate of hydrolysis of anilides in comparison to esters. Potentially such a modulation may be useful for peptide synthesis where the task is to preserve peptide-synthesising activity and at the same time to inhibit ester-hydrolysing activity. To date, there have been only a few studies on enzyme catalysis in mainly organic media at high pressures [3-5, 18] ; however, it appears that there is a clear tendency towards significantly larger volume changes in organic media compared with reactions in aqueous solutions. In conclusion, unravelling the molecular aspects of the observed results will demand further studies. However, if these phenomena have a general character, the strategy of using high hydrostatic pressure for increasing enzyme activity and stability and changing enzyme specificity may find numerous biotechnological applications.

Acknowledgements The authors wish to thank Drs. C. Balny and R. Lange for fruitful discussions and Mr. J.-L. Saldana for excellent technical assistance. V.V.M. is grateful to INSERM for a long-term fellowship (Poste Vert). This work was supported in part by grant from INTAS 93-38 (staying and work of E.V.K. in Montpellier).

REFERENCES 1 R. Jaenicke, Eur. J. Biochem., 202 (1991) 715. 2 V.V. Mozhaev, K. Heremans, I. Frank, P. Masson and C. Balny, Proteins (1996) in press. 3 V.V. Mozhaev, N. Bec and C. Balny, Biochem. Molec. Biol. Internat., 34 (1994) 191. 4 V.V. Mozhaev, N. Bec and C. Balny, Annals N. Y. Acad. Sci. 750 (1995) 94. 5 C. Clery, N. Bec, C. Balny, V.V. Mozhaev and P. Masson, Biochim. Biophys. Acta 1253 (1995) 85. 6 R.V. Rariy, N. Bec, J.-L. Saldana, S.N. Nametkin, V.V. Mozhaev, N.L. Klyachko, A.V. Levashov and C. Balny, FEBS Lett., 364 (1995) 98. 7 V.V. Mozhaev, R. Lange, E.V. Kudryashova and C. Balny, Biotechnol. Bioengin. (1996), in press. 8 C. Balny, J.-L. Saldana and N. Dahan, Anal. Biochem. 163 (1987) 309.

226 9 10 11 12 13 14 15 16 17 18

Y. Taniguchi and K. Suzuki, J. Phys. Chem. 87 (1983) 5185. N. Bec, A. Villa, P. Tortora, V.V. Mozhaev, C. Balny and R.Lange, submitted. D.J. Hei and D.S. Clark, Appl. Environ. Microbiol., 600 (1994) 932. S.N. Timasheff, Annu. Rev. Biophys. Biomol. Struct., 22 (1993) 67. P. Lozano, D. Combes, J.L. Iborra, J. Biotechnol. 35 (1994) 9. V.V. Mozhaev, K. Heremans, I. Frank, P. Masson and C. Balny, Trends Biotechnol. 12 (1994) 493. K.W. Nickerson, J. Theor. Biol. 110 (1984) 487. M.J. Hageman, Drug Development Ind. Pharm. 14 (1986) 2047. C. De Primo, E. Deprez, G. Hui Bon Hoa and P. Douzou, Biophys. J. 68 (1995) 2056. J. Kim and J.S. Dordick, Biotechnol. Bioengin. 42 (1993) 772.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

Two alcohol dehydrogenases denaturating pressure

investigated

227

under

non

S. Dallet and M.-D. Legoy Universit~ de La Rochelle, Laboratoire de G~nie Prot~ique et Cellulaire, P61e Sciences et Technologies, Avenue Marillac, 17042 La Rochelle Cedex 1 (FRANCE)

Abstract The effects of hydrostatic pressure on Thermoanaerobium brockii alcohol dehydrogenase (TBADH : thermostable) and on baker's yeast alcohol dehydrogenase (YADH : mesostable) were studied with special interest in structural and enzyme kinetic modifications. Kinetics were continuously followed by an LW-VIS diode array spectrophotometer connected to a high pressure (up to 250MPa), high t e m p e r a t u r e (up to 150~ controlled reactor. 1. I N T R O D U C T I O N Depending on the biological source, alcohol dehydrogenases show different substrate specificities (short/long chain alcohols, aliphatic/aromatic alcohols and branched alcohols). YADH (150 KDa) catalyses the oxidation of primary alcohol with the coenzyme Nicotinamide Adenine Dinucleotide (NAD) as oxidizing agent. TBADH (160 KDa) has a broad substrate specificity but secondary alcohols are preferred and requires Nicotinamide Adenine Dinucleotide Phosphate as coenzyme (NADP). Several reasons lead to the investigation of YADH and TBADH in the present work. They are both tetrameric, of same molecular weight; kinetics are well known at ordinary pressure (0.1MPa) ; kinetics are easely monitored by spectrophotometry. The effects of high pressure upon protein have been reviewed by numerous authors [1-4]. Numerous works in the field tend to show t h a t pressure acts as a modulator of biochemical processes ranging from the inhibition of bacterial growth [5] or the inhibition of viral particles to activation-inactivation of enzymatic reactions [6]. In the case of oligomeric enzymes, the exposure to pressure below 200 MPa shifts the equilibrium between oligomers and monomers towards subunits dissociation [4].

228 2. E N Z Y M E S A S S A Y

The enzyme reactions were followed either directly under pressure in the high pressure high temperature bioreactor [7] or at atmospheric pressure by an I.W/VIS spectrophotometer (Perkin Elmer). The bioreactor is made of stainless steel by Top Industrie (FRANCE). The maximal pressure reached is 250 MPa. The working temperature varied from ambient t e m p e r a t u r e up to 150~ The cell is equipped with two sapphire windows and connected to a photodiode a r r a y spectrophotometer Otsuka MCPD 1000 (Braun Sciencetec) Kinetics are followed in situ. The sampling is possible through a high pressure valve without pressure release. 3. I N A C T I V A T I O N O F Y A D H B Y H I G H P R E S S U R E

Between 0.1 and 150 MPa, YADH losses 70 % of its activity (fig1). The catalytic efficiency decreased also in this range of pressure. Nevertheless, pressure induces little effect of on YDAH affinity for ethanol (no more t h a n 19 % variation between 0.1 to 150 MPa) (fig 1).

10.2

-2

-2.05

lO 9.8

9

"m'-'~'''-~'~'~-~'~'~'"~.~.,..,~__~6"'--

9.6

2.

-2.1

!

-2.151

9.4

-2.2

9.2

-2.25 M -2.3

~

= M

-2.35

8.8 8.6

-2.4 0

25

50

75

100

125

150

Pressure MPa Figure 1. Pressure dependence on kinetic parameters of YADH (as a function of ethanol); Lnkcat (--); LnKm-1 ( - - -)

It seems t h a t the decrease of the activity is due to the catalytic step because the absolute value of AVcat is the most important. In other words, pressure slows

229 down the complexe enzyme-products dissociation. This fact may be due to : a change of interaction between the substrates and the enzyme, a reorganisation of the surrounding water molecules. 4. A C T I V A T I O N OF T B A D H BY M O D E R A T E P R E S S U R E

The results show that pressure effects may be split into two parts: below and above 100 MPa. An increase of pressure up to 100 MPa increases the activity and the affinity for isopropanol (fig3) and reversely for pressure above 100 MPa. However, the activity and the affinity remain better up to 150 MPa t h a n the activity at 0.1 MPa. 8.85

. . . . . . . . . . . . . . . . . . . . . . .

8.75

0.5 0.3

[]

D

8.65

O.1

"7"

8.55

-0.1 ,.;,

8.45

-0.3 ~=

I ! I

.35

-0.5

8.2

-0.7 0

25

50

75

100

125

150

175 200

Pressure M P a Figure 3.Pressure dependence on kinetic parameters of TBADH (as a function of isopropanol); Lnkcat (--); LnKm-1 (- - -) 5. C O N F O R M A T I O N C H A N G E S I N D U C E D BY P R E S S U R E

HPLC chromatograms of YADH and TBADH solutions which were pressurized or not show t h a t the effects of pressure on activity and affinity were not correlated to subunit dissociation [7]. So pressure induces a molecular r e a r r a n g e m e n t which leads to a loss of activity in the case of YADH and a favorable conformational modification in the case of TBADH. Whereas hypothesis has been previously raised concerning the dissociation of oligomeric enzymes under moderate pressures (less t h a n 200 MPa) [8], we

230 evidenced that, in our case, moderate pressures dissociation but possibly conformational changes.

did not induce

subunit

6. C O N C L U S I O N YADH is continuously inhibited by pressure whereas TBADH activity is one of the few cases at the present time where an enzyme can be activated by pressure, in the range of 0.1 to 100 MPa. The comparisons of the two enzymes are in good agreement with Fukuda and Kunugi (1984) [9] : barostability is linked to thermostability. However, TBADH kinetics parameters display a complex behaviour under pressure : the pressure dependence of both affinity and catalytic constant are biphasic, with a shift at 100 MPa which is difficult to interprete. The monitoring of oligomer dissociation by HPLC tends to show that YADH and TBADH do not dissociate under pressure unless they reassociate very quickly at ambient pressure. 7. R E F E R E N C E S

Heremans K. Annu.Rev.Biophys.Bioeng., 11 (1982) 1. Weber G. and Drickamer H.G.Q.Rev.Biophys., 16 (1983) 89. Balny C., Masson P. Food Rev. Int., 9 (1993) 611. Gro[~ M.and Jaenicke R.. Eur.J.Biochem., 221 (1994) 617. Nelson C.M.,Schuppenhauer M. and Clark D.S. Appl. Environ. Microbiol., 58 (1992) 1789. Jaenicke R. Eur. J. Biochem., 202 (1991).715. Dallet S. and Legoy M.D.. Biochim. Biophys. Acta, in press. Gro~ M., Auerbach G. and Jaenicke R. FEBS Lett., 321 (1993). 256. F u k u d a M. and Kunugi S. Eur. J. Biochem., 142 (1984) 565.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

231

Thermodynamics of transient enzyme kinetics C. Balny INSERM, Unit6 128, BP 5051, 34033 Montpellier, Cedex 1, France Abstract Using the cryo-baro-enzymological approach and by carrying out experiments over a wide range of temperatures (- 40~ to + 40~ and pressures (up to several h u n d r e d MPa) in specially constructed equipment, one can derive the thermodynamic parameters associated with individual rate constants describing the interconversions of reaction intermediates 1. I N T R O D U C T I O N In carrying out their biological functions, enzymes go t h r o u g h a n u m b e r of subtle conformational changes t h a t are related to their dynamic s t r u c t u r a l flexibility. The way of obtaining dynamic information about enzyme systems is by kinetic studies. It is postulated that between each intermediate of a reaction p a t h w a y t h e r e is an a c t i v a t e d complex whose c h a r a c t e r i s t i c s govern rate constants, and thus the dynamics of the structural interconversion. By its very n a t u r e the activated state is not accessible to m e a s u r e m e n t and its properties can only be inferred from the thermodynamic p a r a m e t e r s associated with the constants studied. To gain access to these p a r a m e t e r s , cryo-baro-enzymology and t r a n s i e n t methods are used because these processes are usually very rapid and therefore difficult to study [1]. We have developed a stopped-flow apparatus a d a p t e d to high p r e s s u r e s and to low t e m p e r a t u r e s which p e r m i t s kinetic recording in the millisecond time scale. The t h e r m o d y n a m i c quantities :AG~, ASS, AH~ and AV-~. are t h u s d e t e r m i n e d and w h e n this is achieved u n d e r different solvent conditions (the solvent can be also used as antifreeze) one can, at least within the therories available, attempt an approach to the problems of p r o t e i n d y m a n i c s . E x a m p l e s will be given for v a r i o u s e n z y m e - c a t a l y z e d reactions and the r e s u l t s will be discussed in t e r m s of changes in protein c o n f o r m a t i o n or in solvation where the a p p l i c a t i o n of h i g h p r e s s u r e can magnify phenomena only slightly detectable at atmospheric pressure. 2. MATERIALS AND M E T H O D S

2.1. Stopped-flow apparatus a n d c o m p o u n d s The apparatus, which has been already published [2,3,4], is a modification of t h a t of Heremans. Proteins were isolated according to published procedures or purchased from Sigma. Other compounds are used without further purifi-

232 cations. The buffer used was Tris-HC1 which is almost p r e s s u r e - i n d e p e n d e n t .

2.2.Treatment of d a t a The s t u d y of the d e p e n d e n c e on p r e s s u r e of catalytic r a t e s in enzymic reactions was u n d e r t a k e n about 50 years ago by Laidler and has recently been reviewed [5,6,7]. An e l e m e n t a r y reaction between two species will be considered as 9 A

k+-,B "~

k-

The classical t r a n s i t i o n state theory of Eyring a s s u m e s t h a t between the two states A and B, there is a labile complex A S named the transition state 9 A

k+ "-~" .

.

.

.

AS,.

k-

.

B 7

The subscripts + and - refer to the forward and reverse reactions, respectively. A and AS or AS and B, respectively, are in equilibrium with the same deactivation rate constant (dashed arrows in the above scheme), equal to kT / h, w h e r e T is the t e m p e r a t u r e , k the B o l t z m a n n c o n s t a n t a n d h the P l a n k constant. The above equilibria can be treated as" AG-?+ - - RT in ( k+ 9h / k T )

and

AG$_-- RTln (k_" h / k T )

With T and P as variables, it is possible to i n t e g r a t e these relations by i n c l u d i n g d i f f e r e n t p a r a m e t e r s s u c h as v a r i a t i o n s in h e a t c a p a c i t y , compressibility or expansibility, repectively. The final equation, depending on the t e m p e r a t u r e and the p r e s s u r e r a n g e s , respectively, c a n n o t be a l i n e a r function of T or P. However, because of the narrow ranges of T and P covered in e x p e r i m e n t s on biochemical systems, simplifications are possible and for most systems, the following equations can be used : At constant pressure P, In ( k +

9h / k T ) - -

A H - + / R T + A S S + / R , and 98In k + / 8 ( 1 / T ) - ( A H $ + - RT)/R.

if AHS+ >> RT, k+ -- A exp (AHS+ /RT), which is the empirical A r r h e n i u s law. At constant t e m p e r a t u r e T, AG$+ - - RT In ( k+ 9h / RT ) - P- AVe+ + constant, and 9In k+ - - P. AV$+ / RT + ct. AV$++ is t e r m e d the activation volume, m e a s u r i n g the volume change for the transition A ~

A t , and AvS_ for the transition B

>

AS.

F o r an e n z y m e r e a c t i o n , the s i m p l e s t e n e r g e t i c p a t h w a y is s h o w n in F i g u r e 1 where E, S and P are the enzyme, the s u b s t r a t e and the product, respectively 9

233

i AG:]:

| [,,E +,,,S 1-+'

/i"i " /i IS

E+S

i

E-P

C o o r d i n a t e reaction Figure 1 : M i n i m u m scheme for the reaction p a t h w a y of an enzyme reaction with one s u b s t r a t e (S). The dashed line indicates t h a t at this level different i n t e r m e d i a t e s can exist. The slopes of the plots of In k (k is either k+ or k_, depending on the direction of the reaction pathway) as a function of 1/T at constant pressure or In k as a f u n c t i o n of p r e s s u r e at c o n s t a n t t e m p e r a t u r e are - AH$ / R a n d AV$ / R T , respectively. The equations of I n k as a function of 1/T or as a function of P are s i m i l a r , a n d the plots are l i n e a r from the above s i m p l i f i e d e x p r e s s i o n s . However, a l t h r o u g h the plots of In k as a function of 1/T g e n e r a l y show a negative slope p e r m i t t i n g the determination of AH$ (a positive term), the plots of In k as a function of P can show a negative or a positive slope permitting the d e t e r m i n a t i o n of AV$ which can thus also be positive or negative, depending on t h e t y p e of t h e b i o c h e m i c a l r e a c t i o n a n d / o r of t h e p h y s i c o - c h e m i c a l e x p e r i m e n t a l conditions. Moreover, in some cases, t h e s e plots m a y exhibit c u r v a t u r e when, for example, the viscosity m u s t be t a k e n in consideration. A t r e a t m e n t which more n e a r l y a p p r o a c h e s the real s i t u a t i o n is provided by K r a m e r s ' theory which takes into account the pre-exponential t e r m A in the A r r h e n i u s law, a t e r m which includes the viscosity of the m e d i u m [8] : k - A 9exp (- AG; / RT) where" A - Ao / rl' rl being the viscosity of the medium. However, even in their resting states, enzymes fluctuate between different conformational states which a p p e a r to be organized hierarchically in s u b s t a t e s [9]. An enzyme reaction may involve one or a combination of several of these f l u c t u a t i o n s , and it often d e p e n d s on the specific i n t e r a c t i o n with the surr o u n d i n g s o l v e n t . T h i s m e a n s t h a t the c l a s s i c a l t r a n s i t i o n s t a t e t h e o r y developed above is an oversimplification of reactions carried out by proteins. This theory is poorly defined, and as discussed by R. Lange et al. [10], we know

234 only the relative enthalpy and entropy of the transition state. Nevertheless, in the absence of a b e t t e r - a d a p t e d theoretical approach, the f o r m a l i s m of the transition state theory continues to be used. In spite of these difficulties of i n t e r p r e t a t i o n , the t h e r m o d y n a m i c t e r m s AG$, AH$, ASS and AV$ for a given biochemical reaction (in which there is no modification of the conformation of the protein or modification of the enzyme reaction p a t h w a y induced by pressure or t e m p e r a t u r e ) , are related according to the Maxwell relationships (as for a simple chemical reaction) : - (AV* / RT)p - (5AS + / 5P) T

and (SAH$ /T)p - AV$- T (SAV~ / 5 T)p

2.3. Interpretation of experimental results The m a g n i t u d e of the a c t i v a t i o n volume a n d its sign can r e s u l t from conformational changes of the protein and also reflects the interaction of the transition state (whether of the major or restricted regions of the protein) with t h e s o l v e n t molecules. T h i s o b s e r v a t i o n (in c o n t r a s t to s i m p l e c h e m i c a l reactions - in the gas phase - where the interpretation of experimental data is easier) shows t h a t it is very difficult to give a precise physical meaning to the e x p e r i m e n t a l l y m e a s u r e d AV$ which may be considered as the sum of several t e r m s : conformational and solvation t e r m s (with the s u r r o u n d i n g m e d i u m : water, organic solvents, ions, salts...) as mentioned above, but also a chemical t e r m (such as binding, reduction, oxidation, electron-tranfer reactions, etc...) and intra- and inter-molecular interaction terms, at short and long range. 3. R E S U L T S AND D I S C U S S I O N To illustrate the above approach, we summarize here some results obtained with the binding of CO to heme proteins and with the formation of enzymes u b s t r a t e complexes. According to the general induced-fit theory for enzyme kinetics, the binding of CO to the protein is a two-step process 9formation of a collision complex followed by an isomerization step" E + CO _~ K__I__:_~E-CO ~ k2 . ~ E*-CO k-2 T h e b i n d i n g k i n e t i c s w e r e s t u d i e d in e i t h e r a q u e o u s s o l u t i o n , 50% methanol or 40% ethylene glycol. The linearity of kob s as a function of CO concentration means t h a t we obtained only the second-order constant k+ = k 2 x K 1 (the slope in M -1 s-l), K 1 and k 2 r e m a i n i n g too high for the m a x i m u m CO c o n c e n t r a t i o n allowed (0.5 mM). V a l u e s for d i f f e r e n t h e m e p r o t e i n s are s u m m a r i z e d in Table 1. From these data, it is clear t h a t for a given reaction, depending on both the solvent and the t e m p e r a t u r e , the a c t i v a t i o n volume can be v e r y different, showing the role of solvation. Moreover, for these reactions, linearity of In k+ as a function of P is observed in the pressure range exploited (up to 120 MPa). This validates the reaction scheme proposed, with no change of the r a t e limiting step. F u r t h e r , the i n t e r p r e t a t i o n does not necessitate reference to K r a m e r s ' equation, the variation of viscosity remaining slight under our conditions.

235 Table 1 : A c t i v a t i o n v o l u m e for CO b i n d i n g to v a r i o u s h e m o p r o t e i n s (rate c o n s t a n t : k + ) u n d e r d i f f e r e n t e x p e r i m e n t a l conditions. HRP: h o r s e r a d i s h peroxidase ; EGOH: ethylene glycol; MeOH: methanol ; P-450 LM2: cytochrome P-450 from p h e n o b a r b i t a l i n d u c e d liver ; P-450scc: c y t o c h r o m e P-450 from b o v i n e a d r e n o c o r t i c a l m i t o c h o n d r i a ; CPO: c h o l o p e r o x i d a s e ; LP: lactoperoxidase ; P-460: cytochrome P-460 from hydroxylamine oxidoreductase. Protein

Medium

HRP

water 40% EGOH

Temperature (~ C)

20 4 20 1

50% MeOH P-450LM2 P-450scc CPO LP P-460

water water water water water 40% EGOH

AV~ Reference (ml.mo1-1)

- 24 - 27 -7 -10

- 10

- 15

20 4 -10 25 25 25 25 20 4 20 4

- 19 -5 -2 + 3 + 2 + 1 - 10 - 36 -32 - 23 -14

[11]

[ 10]

[12]

The situation can be more complex if it is not possible to record e l e m e n t a r y rate constants of simple reactions but only global values such as K M or Vma x. In collaboration with Dr P. Masson, e x p e r i m e n t s were carried out on some reactions of h u m a n butyrylcholinesterase. For example, the plots of In kob s of the c a r b a m y l a t i o n reaction as a function of p r e s s u r e show c u r v a t u r e , which h a s been i n t e r p r e t e d as a complex biphasic p r e s s u r e dependence, d e p e n d i n g also on s u b s t r a t e c o n c e n t r a t i o n [13]. F o r t h i s e n z y m e , a c o n f o r m a t i o n a l plasticity h a s been p o s t u l a t e d . Recent e x p e r i m e n t s combining the effects of high p r e s s u r e and reversed micelles have shown t h a t it is possible to modulate the catalytic behaviour of butyrylcholinesterase [14]. The purpose of this study was to determine w h e t h e r the conformational plasticity of the enzyme is altered by e n t r a p m e n t in r e v e r s e d m i c e l l e s ( r e v e r s e d m i c e l l e s a r e d e s c r i b e d as s p h e r i c a l a g g r e g a t e s of a m p h i p h l i c molecules - Aerosol O T - in an organic s o l v a n t - octane - t r a p p i n g a certain a m o u n t of encapsulated aqueous solution). The enzyme displays a non-Michaelian behaviour with its substrate (acethylthiocholine). This new approach appears to us to be of great interest. By c o m b i n i n g high p r e s s u r e a n d r e v e r s e d micelles both e n z y m e r e a c t i o n s a n d enzyme stability may be studied [15], in spite of the difficulties of interpretation of e n z y m e m e c h a n i s i s m u n d e r such physico-chemical conditions.

236 4. CONCLUSION Even though the thermodynamics of transient enzyme kinetics remain imperfect, it is by collecting as much data as possible and, in particular, by observing their dependence on the environment (solvent, temperature, etc.), that one might eventually be able to come to conclusions as to the general concepts concerning the dynamics of the processes under study. This is one of the few avenues for approaching the problem of protein dynamics in solution [7]. 5. ACKNOWI~DGMENTS The author is grateful to DRET (grant N ~ 94/5) for financial support and thanks Drs. P. Masson, A. B. Hooper, F. Travers, T. Barman, R. Lange, V.V. Mozhaev, K. Ruan, Mrs Bec and Mr J-L Saldana for help and discussion. 6. REFERENCES 1 C. Balny, F. Travers, T. Barman and P. Douzou, Proc. Natl. Acad. Sci. USA, 82 (1985) 7495. 2 C. Balny, J-L. Saldana and N. Dahan, Anal. Biochem., 139 (1984) 178. 3 C. Balny, J-L. Saldana and N. Dahan, Anal. Biochem., 163 (1987) 309. 4 G. Hui Bon Hoa, G. Hamel, A. Else, G. Weill and G. Herv~, Anal. Biochem., 187 (1990) 258. 5 E. Morild, Adv. Protein Chem., 34 (1981) 93. 6 C. Balny and P. Masson, Food Rev. Inter. 9 (1993) 611. 7 V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Proteins: Structure, Function, and Genetics, (1996) (in press). 8 H.A. Kramers, Physica, 7 (1940) 284. 9 H. Frauenfelder, S. G. Sligar and P. G. Wolynes, Science, 254 (1991) 1598. 10 R. Lange, I. Heiber-Langer, C. Bonfils, I. Fabre, M. Negishi and C. Balny, Biophys. J. 66 (1994) 89. 11 C. Balny and F. Travers, Biophys. Chem., 33 (1989) 237. 12 C. Balny and A. B. Hooper, Eur. Biochem. J., 176 (1988) 173. 13 P. Masson and C. Balny, Biochem. Biophys. Acta, 954 (1988) 208. 14 C. Clery, N. Bec, C. Balny, V.V. Mozhaev and P. Masson, Biochem. Biophys. Acta, 1253 (1995) 85. 15 R. V. Rariy, N. Bec, J-L. Saldana, S. N. Nametkin, V. V. Mozhaev, N. L. Klyachko, A. V. Levashov and C. Balny, FEBS Letters, 364 (1995) 98.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

237

High pressure inactivation of microorganisms H. Ludwig, G. van Almsick and B. Sojka Pharmazeutische Technologie und Biopharmazie, Gruppe Physikalische Chemie, Universit~it Heidelberg, INF 346, D-69120 Heidelberg, Germany

Abstract The kinetics of pressure induced inactivation was measured for vegetative bacteria, bacterial spores and spores of moulds. In case of bacterial spores, the complicated interplay of germination and inactivation was investigated. Results given for anaerobic Clostridium sticklandii could be interpreted in a similar way as it had been done for aerobic species in earlier studies. The conidiospores of the mould Eurotium repens were stabilized against pressure in concentrated salt and sugar solutions. The stabilization could be overcome by still higher pressures. The germination of Bacillus subtilis spores was fastest at 110 MPa and high temperatures. From these findings effective inactivation cycles were derived.

1. I N T R O D U C T I O N Pressure induced inactivation of microorganisms is an important aspect of high pressure food processing [1] and seems to be a promising method for sterilization of pharmaceutical preparations [2]. For both applications it is necessary to know how fast the microorganisms are inactivated in dependence on the pressure, temperature, and their surroundings. Only in a few cases is the inactivation a simple first order reaction. More frequently the inactivation rate decreases with time thus indicating that the population is composed of specimens with different resistance to pressure. Therefore, a lot of precise measurements are needed to find out the resulting complicated kinetics of inactivation.

2. MATERIALS AND M E T H O D S

2.1. Microorganisms The vegetative bacteria were freshly prepared for each experimental run. Usually bacteria of the early stationary phase were used because these are the most stable forms. In the high pressure experiments the bacteria were suspended in the appropriate nutrient broth. Clostridium sticklandii, ATCC 12662, were grown under strictly anaerobic conditions. Esct~erichia coli, ATCC 39403, were aerobically grown in M9 minimal medium.

238 Conidiospores of the mould Eurotium repens, DSM 62631, were harvested after having been formed within seven days on the tips of the hyphae. The spores were purified by washing and centrifugation steps in 0.9 % NaC1 solution. Pure bacterial spores of Bacillus subtilis were produced from the strain ATCC 9372 [3] and stored at 4 ~ in 0.9 % NaC1 solution for 2 months at most. All microorganisms were purchased from the Deutsche Sammlung yon

Mikroorganismen und Zellkulturen, Braunschweig, Germany. 2.2. Substances

Trimethoprim (DAB 10) was purchased from Synopharm, Barsbi~ttel/ Hamburg; nutrients from Difco, Detroit. Dipicolinic acid (DPA) was obtained from Sigma, Mi~nchen. Salts and all the other substances were of p.a. or DAB 10 quality.

2.3. Experimental procedures All high pressure experiments were done in a high pressure device consisting of ten small pressure vessels which could simultaneously be pressurized and thermostated [4,5]. The single vessels could be opened at different times thus allowing to measure the kinetics of inactivation. The inner dimensions of the vessels were 1.2 cm in diameter and 12 cm in length. The samples were enclosed in polyethylene tubes and were thus separated from the pressure transmitting medium which was water. The number of surviving organisms were counted as colony forming units on appropriate agar plates (cfu = number of living germs per ml). All experiments were reproduced at least two times.

3 R E S U L T S AND D I S C U S S I O N

3.1. Vegetative bacteria Figure 1 shows the inactivation of C. sticklandii by 300 MPa at different temperatures. The kinetics is biphasic, i.e. a fast reaction is followed by a second much slower one. Both are first order reactions, the inactivation curve is composed of two linear rays. It seems that the whole bacterial population consists of two fractions with different sensitivities to pressure, a large very sensitive fraction and a smaller more insensitive one in the ratio 106 : 1. This can be seen from Figure 1 where the number of bacteria is reduced by 6 orders of magnitude within 1 minute and the smaller fraction is indicated by a sharp bend of the inactivation curve. The bacteria are most resistant to pressure at room temperature. They are faster killed at 4 and 37 ~ This behaviour seems to be a common feature of most bacterial species as long as the applied pressure is not too high. The underlying reason is that the pressure-temperature stability diagrams of bacteria equal those of proteins [5]. It has already been shown by Suzuki that proteins may withstand pressure best at room temperature [6].

239

6

1.6

E o 1.2

5 g

s

tO

0.8

~ O

II

A

'

-- a ~

A

n 0

& -----

I

0

10

20

30

40

t/min

Figure 1. Inactivation of C. sticklandii at 300 MPa and different temperatures of 9 4, A 25, and m 37 ~ Open symbols: Controls. Dashed line: Limit of detection.

0.4

0.0

0

!

!

!

5

10

15

~

20

t

25

t/h

Figure 2. Optical density of a culture of C. sticklandii after an 8 rain treatment by 250 MPa and 37 ~ Open symbols: Controls.

When the inactivation is done by a smaller pressure of 200 MPa a lag time of 3 minutes is found (not shown in the Figures). This indicates that more than one damage is needed to kill a cell of C. sticklandii. In contrast, the majority of bacterial species we have investigated till now did not show such a lag time thus favouring a one hit mechanism of inactivation [5]. From these findings it may be concluded that the proteins which are the targets of pressure's action are located in very crucial positions, e.g. in membranes or in important complexes. In Figure 2 is demonstrated that pressure treated but still living Clostridia are damaged. They do not grow but, contrary, more than half of them die slowly within the following hours. In order to reveal the reason for biphasic inactivation curves we compared E. coli bacteria from the stationary phase with those from the exponential phase of the growing culture. As shown in Figure 3 the exponential phase bacteria are faster killed and contain a higher portion of sensitive specimens. We now stopped the growing culture in the exponential phase by adding the substance Trimethoprim (5-(3,4,5-Trimethoxybencyl)-2,4-diammopyrimidine) in different amounts (Figure 4). The bacteria were then harvested in the stationary phase, 9 hours after the culture had been started. Trimethoprim is a competitive inhibitor of the enzyme Dihydrofolate reductase. If this enzyme is inhibited tetrahydrofolic acid can not be built which is used by the cell in the form of activated formaldehyde and activated formic acid to synthesize purine and pyrimidine bases. In consequence the synthesis of nucleic acids is slowed down. Thus, the cells accumulate in that stage of their cell cycle where the synthesis of nucleic acids is competitively inhibited by Trimethoprim. The result can dearly be seen in the inactivation curves of Figure 5: The more of the inhibitor is added the more disappears the "pressure resistant" fraction of the bacteria. Therefore we

240 conclude that biphasic behaviour reflects two stages of the bacterial development in the cell cycle.

[] m

9

o

m

"

.,

" -0,8

I

~ '-1,3

o i n

0

15

. o o

0 o~

5

3

'

.~ -0,3

l

n

3o

45

I 0

t/min

3

6

9

t/h

Figure 3. Inactivation of E. coli at 300 MPa and 25 ~ 9 culture in the stationary phase, 9 culture in the exponential phase. Open symbols: Controls.

Figure 4. The growth of E. coli was stopped within the exponential phase by adding Trimethoprim in amounts of $ 0, 9 1, 9 2, and 4 9 mgfl. Arrow marks addition of Trimethoprim.

9,

7 5

~11

O

vm

0

& A

O &

A

O

'

I

I

I

I

10

20

30

40

50

t/min

Figure 5. Inactivation of E. coli at 300 MPa and 25 ~ in dependence on the concentration of added Trimethoprim; o 0 , A 2, m4, 9 8 mg/1.

A temperature induced transition in the kinetic curves was found for some bacterial species. At this temperature the bend disappears resulting in one straight line; the inactivation is then a simple first order reaction. This is the case for E. coli and Serratia marcescens at temperatures above 30 ~ and for Pseudomonas aeruginosa below 30 ~ [5,7]. Straight lines at low temperatures were also found for Corynebacterium re 9 (ATCC 10848) with a transition temperature near 20 ~ and for Kurthia zopfii (ATCC 33403) with the break near

241 45 ~ (yet unpublished). With respect to the explanation given above for biphasic inactivation curves, the transition to monophasic behaviour may be explained by a temperature induced change either of the mechanism of inactivation or of structural cell components like the membrane in such a way that the inactivation rate does not any longer depend on the variations of the two (or more) fractions.

3.2 Spores Spores are usually the most resistant forms of microorganisms. Figure 6 shows how conidiospores of the mould E u r o t i u m repens react to 300 MPa at 25 ~ The inactivation in 0.9 % NaC1 solution is not a first order reaction, a smoothly curved line is found in the semilogarithmic plot indicating a multi component mixture of specimens with various sensitivities to pressure. E. repens is an osmophilic mould. Therefore it is interesting to examine the resistance of the spores in concentrated media. This has been done in salt and sugar solutions and the results are shown in the Figures 7 and 8. The spores are better protected against pressure by sodium ions than by potassium ions, but in both cases 25 % of salt are sufficient to perfectly inhibit the action of 300 MPa. The spores are also stabilized by sugars, the disaccharide sucrose being better by a factor of 2 than the monosaccharide glucose. Here, in the case of sucrose the inactivation by 300 MPa is nearly stopped in 60 % sugar solutions. Figure 9 shows that this protection can be overcome by higher pressures of 500 MPa or more. 7

9

9'

,

9

.

,

8

q 5

o o

3

O 0

o

o

4

A &

9 & DA ~L

9 9

0

15

9

I

I

!

I

!

30

45

60

75

90

t/min

Figure 6. Inactivation of conidiospores of E. repens in isotonic NaC1 solution at 300 MPa and 25 ~ Open symbol: Control.

0

0

!

~

I

1

2

3

,

I

4

I

5

m ol/kg H20

Figure 7. Influence of salt concentration on the inactivation of E. repens (conidiospores) by 30 rain at 300 MPa and 25 ~ $ NaC1, A KC1..: Initial number of germs.

242

O &

o

o

4

4

m

A

00 A 0

0

A

'

'

I

I

1

2

3

4

moll kg H20

Figure 8. Influence of sugar concentration on the inactivation of E. repens (conidiospores) by 300 MPa and 25 ~ 9 Sucrose, A Glucose. o: Initial number of germs.

l

,

|

''I

I

.....

I I

....

I

300 350 400

450 500 550

p/MPa

Figure 9. m Pressure dependence of E. repens (conidiospores) inactivation in 60 % sucrose solution, 30 min at 25 ~ El: Initial number of germs.

Even more problems arise with bacterial spores, because they withstand very high pressures. It has been shown that only germinated spores can be killed by high pressures [3]. In case of B. subtilis spores moderate pressure induces the germination process by a yet unknown mechanism [7]. During germ~ation the spore releases Dipicolinic acid (DPA), a spore typical substance, and amino acids into the surrounding medium. The release of DPA starts at about 50 MPa and reaches a maximum at 110 MPa (Figure 10). It is much faster at higher temperatures (Figure 11), thus it seems that germination is favoured in the heat. The release of amino acids parallels that of DPA with a maximum near 100 MPa and an increasing rate with rising temperature (Figure 12). The rate of release is slowed down by 3mino acids added to the medium and the same level is reached with and without initially added amino acids (Figure 13). Therefrom, it can be concluded that the transport through the spore coverings is by diffusion. The collected results give some hints for an effective inactivation of B. subtilis spores: Pressure cycles between low and high pressures and temperatures as high as possible should be the best method. It has already been shown that pressure cycles give good results [3]. Here we report some new experiments using very short cycle ~mes. Figure 14 shows the effect of varying the pressure between 60 and 500 MPa every one minute at a temperature of 60 ~ A different initial concentration results in a parallel shifting of the inactivation curve. This is very important in practical applications. With a raised temperature of 70 ~ the short cycles yield sterile solutions from 10s spores/ml in only 20 minutes (Figure 15). Under these conditions is the inactivation a first order reaction and it's the same whether the pressure changes between 60 and 500 MPa or between 0.1 and 500 MPa. Using constant pressure of 500 MPa it takes many hours to

243 obtain sterility, but it is very remarkable that similar effects can be obtained at 70 ~ using only 60 MPa.

Figure 12. Release of amino acids from spores of B. subtilis after 60 min at 110 MPa and different temperatures.

Figure 13. Release of amino acids from spores of B. subtilis at 150 MPa and 50 ~ with (left) and without (right) initially added amino acids. C: Controls.

It should be mentioned that in the cycle experiment the temperature varies on account of adiabatic heating and cooling. Only the mean temperature is 70 ~ Within the cycle time of 2 minutes the temperature rises rapidly to 85 ~ relaxes

244 for 1 minute with a time constant of about half a minute, then falls rapidly to 55 ~ relaxes to higher values, and then the cycle starts again. The temperature alone does not harm the spores. Thus the inactivation is achieved by a complicated interplay of temperature and pressure effects on germination as well as inactivation processes. Much more experiments have to be done to understand the underlying mechanisms and to use them for an effective sterilization of spore suspensions. 8

4i

|'

,

|

|

9

i

i

A

4

6

I V

0

9

e

_a~

9

6

A

t

t

!

ql

,

9

sterile 0

i

sterile

q

I

I

1

I

I

5

10

15

20

25

3O

t/min

Figure 14. Influence of initial concentration on the inactivation kinetics of B. subtilis spores at 60 ~ and 60/500 MPa, alternatingly; duration of intervals: i rain. Open symbols: Controls.

.,.

g

I

I

I

l

1

5

10

15

20

25

i

30

t/min

Figure 15. Inactivation of spores of B. subtilis at 70 ~ and different pressures of 9 60 MPa, A 500 MPa, m 0.1/500 MPa, 9 60/500 MPa, alternatingly; duration of intervals: I rain. Open symbols: Controls.

4. R E F E R E N C E S

[1] [2]

[31 [41 [51 [6] [7]

R. Hayashi in Engineering and Food, W. Spiess and H. Schubert (eds.), Elsevier Appl. Sci., UK (1989) 815. W. Scigalla and H. Ludwig, High Pressure in Material Science and Geoscience, EHPRG Conf. Proc. 32, TU Brn5, Czech Rep. (1994) 195. B. Sojka and H. Ludwig, Pharm. Ind. 56 (1994) 660. P. Butz et al., Pharm. Ind. 52 (1990) 487. H. Ludwig et al., High Pressure Effects in Molecular Biophysics and Enzymology, chapt. 22, Oxford Univ. Pess, New York, N.Y. (1996). K. Suzuki, Rev. Phys. Chem. Japan 29 (1960) 91. H. Ludwig et al. in High Pressure and Biotechnology, C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.), Colloque INSERM, John Libbey, 224 (1992) 25.

This work was supported by the European Union (AIR1-CT92-0296) and the Max Buchner Forschungsstiftung.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

245

Saccharides protect yeast against pressure correlated to the mean number of equatorial OH groups Shinsuke Fujiil,2, Kaoru Obuchil , Hitoshi Iwahashil , Takaaki Fujii2, and Yasuhiko Komatsul 1National Institute of B ioscience and Human Technology, Agency of Industrial Science and Technology, 1-1 Higashi, Tsukuba, Ibaraki 305, Japan 2Department of B ioproduction Science, Chiba University, 648 Matsudo, Matsudo-shi 271, Japan

Abstract Several mono-, and disaccharides were found to be significantly effective in providing protection against hydrostatic pressure and high temperature damage in yeast, Saccharomyces cerevisiae. The extent of barotolerance and thermotolerance with seven different sugars showed a linear relation to their the mean number of equatorial OH groups. Same linear relationship was seen when sugars protect protein molecules against elevating temperatures in vitro. These results suggest that sugars may protect cells against hydrostatic pressure and high temperature in the similar manner probably by stabilizing macromolecule(s).

1. I N T R O D U C T I O N

The transient exposure of non-adapted organisms and cells to high temperature or hydrostatic pressure often results in physiological changes [1] that lead to death. Protein thermodenaturation is thought to be one of the main causes of death in living cells exposed to lethal high temperatures. It has also been known that protein is denatured with increasing hydrostatic pressure [2].When hydrostatic pressure increases, thermodynamic and kinetic changes occur in the properties of aqueous solutions, such as the relative and absolute viscosity [3], hydrogen bonding [4] and the overall free energy change in the

246 biochemical processes [2]. Furthermore, the absolute and relative viscosity of pure water decrease with increases in temperature or hydrostatic pressure until approximately 200 MPa at ambient temperature [3]. Sugars, especially trehalose, and polyols are known as protein and membrane stabilizers [5-8.] It is thought that trehalose is not only a reserve carbohydrate but also one of the agents that are important as macromolecular protectants against some stresses in yeast cells [9-10].Uedaira et al. have shown that several mono- and disaccharides have the ability to prevent thermal denaturation of proteins, which can be correlated to their mean number of equatorial OH groups in vitro. They postulated that the OH groups of additives, especially equatorial OH groups in sugar molecules, can array water molecules and improve the structurization of water [11-13].Based on this discussion, we have reported that the exposure of yeast cells to dimethylsulfoxide (known as a water structure improver [14]) and deuterium oxide (known to form stronger hydrogen bonds than H20 [ 15])confer protection against hydrostatic pressure stress [ 16]. These reports raise the possibility that the equatorial OH groups of sugars, as macromolecular stabilizers, would protect cells against elevated temperature and hydrostatic pressure conditions as lethal stresses, through arrayed water molecules and the improved structurization of water. However, there has been no evidence that the equatorial OH groups of sugars stabilize membranes or proteins in vivo. In this report, we demonstrate that the in vitro observation [11-13] could be applied to elevating temperature and hydrostatic pressure conditions in vivo.

2 . M A T E R I A L S AND M E T H O D S

2.1 Yeast strain and culture conditions S. cerevisiae, Hansen IFO-0224 was grown in YPD medium (glucose, 2 %; yeast extract, 1 % ; peptone, 2 %). Cells were grown at 30~ overnight (cell density, 8 x 107 cells/ml). The culture in the logarithmic phase of growth was sampled and divided into 2 tubes. Cells in one tube were collected at 3000 rpm for 30 sec, washed 2 times with distilled water and resuspended in distilled water containing altrose, fructose, mannose, galactose, glucose, sucrose, or trehalose. Cells in another tube were given the pre-heat shock treatment. Thus, cells were incubated at 43~ for 1 hr in new YPD medium. Cells were collected at 3000 rpm for 30 sec, washed 2 times with distilled water, and resuspended in distilled water. These were then immediately stressed by elevated pressure or temperature.

247 2.2 Procedures for pressure or heat stress treatment For pressure stress treatment, 0.4 ml cell suspensions with or without sugars were packed into a 1-ml sterilized syringe (Terumo, Japan) and pressurized [16]. Also, another cell suspension was pressurized after pre-heat shock treatment. Samples were pressurized under 150 MPa at 4~ for 1 hr in the absence of any air bubbles. The low temperature (4~ had been selected under the expectation that cells do not take up any sugars. The subsequent reduction of pressure to ambient levels took place over a 2-min period. After decompression, adequately diluted cell suspensions were plated out on YPD agar medium and incubated at 30~ for 48 hr until colony counting became possible. For heat stress treatment, 0.3 ml cell suspensions with or without sugars were packed into 1 ml sterilized Eppendorf tubes and heated. Also, another cell suspension was heated after pre-heat shock treatment. Samples were heated in a water bath at 51~ for 10 rain, followed by immediate cooling in ice water. After cooling, adequately diluted cell suspensions were plated out on YPD agar medium and incubated at 30~ for 48 hr until colony counting became possible. 2.3 Estimation of barotolerance and thermotolerance values Barotolerance or thermotolerance values were measured by comparing the colony forming units (cfu) of pressure or heat stressed samples. The toxic effect of the sugars themselves was measured by comparing the cfu of samples incubated with 0.5, 1, or 2 mol/1 of sugars for 1.5 hrs at 4~ versus samples incubated without sugars for 1.5 hrs at 4~

3. R E S U L T S

At first, we estimated the toxic effects of the sugar solutions on the cells. As shown in Table I, 0.5 or 1 mol / 1 sugar resulted in a slightly toxic effect to yeast cells, but some sugars showed a strong toxic effect (less than 50% viability) on cells at the concentration of 2 mol/1. Barotolerance values endowed by four sugars (fructose, galactose, glucose, or sucrose) are shown in Fig. 1. Cell survival after a pressure stress of 150 MPa at 4 ~ for 1 hr without sugars was 0.01%. Barotolerance values with sugars increased dosedependently. Sugars at the concentration of 1 and 2 mol/1 were significantly effective (over hundred times compared to that without sugars) in providing protection against pressure stress.

248 Table.I The mean number of equatorial OH groups and toxic effect of sugar solutions at 4 for 1.5 hrs. Sugars Percent viabjlit.y (S.D.) with .different The mean sugar solution concentrations number of Concentration (mol/l) Control D-Altrose D-Fructose o-Mannose D-Galactose D-Glucose Sucrose

0.5

1.0

2.0

equatorial OH groupsw

100

100 86 * 75 (1.7) 96 (5.3) 87 (5.4) 83 (6.6) 89 (4.6)

100 41 (2.7) 80 (2.3) 44 (4.6) 45 (3.8)

2.6 3.0 3.3 3.6 4.6 6.3

-

86 (4.4) 91 (6.0) 101 (1.4) 102 (2.6)

Trehalose 99 (4.8) *: Number of experiments for D-Altrose is 2 whereas for other sugars it is 3. wCited from [12-13].

7.2

The barotolerance values for 1 mol/1 of sugars were calibrated in terms of the mean n u m b e r of equatorial OH groups of the various sugars. The barotolerance values of each sugar were 0.12 %, altrose; 2.0 % + 0.8, fructose; 0.45 % + 0.06, mannose; 3.3 % + 1.8, galactose; 12.3 % + 3.3, glucose; 27 % + 9.0, sucrose and 35 % + 2.8, trehalose. A linear relationship could be traced when the barotolerance values were plotted versus the mean number of the equatorial OH groups of these sugars (Fig. 2, curve fitting; y=8.0x-23, R2=0.98.). The mean numbers of the equatorial OH groups are shown in Table I. Sugars have a few types of conformations in solution, so that the mean numbers of the equatorial OH groups are not whole numbers. Mannose is an epimere of altrose and glucose, and glucose is an epimere of galactose. In other words, these four o-aldoses have the same molecular weight and basic structure but have not the same mean numbers of equatorial OH groups. The same series of experiments were done to characterize thermotolerance. Cell survival after heat stress at 51 ~ for 10 min without sugars was 0.01%. The thermotolerance values of each sugar were 0.02 %, altrose; 0.12 % + 0.03, fructose; 0.07 % + 0.05, mannose; 0.20 % + 0.03, galactose; 0.25 % + 0.06, glucose; 0 . 5 1 % + 0.17, sucrose and 0.63 % + 0.03, trehalose. A linear relationship could be traced when the thermotolerance values were plotted

249

Figure 1. Concentration Effects of Sugars on Barotolerance Values. Cells were pressurized under 150 MPa at 4 ~ for 1 hr with 0.5, 1, or 2 mol/1 of each sugar. Bars; solid, fructose; open, ga lactose; stripes, glucose; dots, s ucrose. Error bars indicate standard de viation from three independent experiments.

0.8 ~D

0.6 6

>

7

0.4 ~D O o

Figure 2. The Barotolerance Values Versus the Mean Number of the Equatorial OH Groups of t heS ugars. Cel Is we re pressurized under 150 MPa at 4 ~ for 1 hr with 1 mol/1 of each sugar.Symbols 1, with altrose; 2, fructose; 3, m annose; 4, galactose; 5, glucose; 6, sucrose; 7, trehalose. Error bars indicates tandard deviation f r o m thr ee ( altrose w as tw o) independent experiments.

Figure 3. T he Thermotolerance Values Versus the Mean Number of the Equatorial OH Groups of the Sugars. Ce lls were heated at 51 ~ for 10 min with 1 mol/1 of each sugar. The numbe rs in t he figure denote the same number as in Fig. 2.

0.2

x: 0.0

-

i

i

i

i

3 4 5 6 7 8 Mean number of Equatorial OH Groups

versus the m e a n n u m b e r of the equatorial O H g r o u p s o f the sugars (Fig. 3, c u r v e fitting; y = 0 . 1 3 x - 0 . 3 1 , R 2 = 0 . 9 8 . ) similar to Fig. 2. A l t h o u g h a similar linear relationship were observed for barotolerance values and t h e r m o t o l e r a n c e values with sugars in the same c o n c e n t r a t i o n , b a r o t o l e r a n c e values were at m a x i m u m over 50 times h i g h e r than the t h e r m o t o l e r a n c e values with the same sugars.

250 On the other hand, pre-heat shocked cells showed 0.11% + 0.06 and 5.4 % + 0.41 as barotolerance and thermotolerance values, respectively.

4. DISCUSSION

We have succeeded in correlating our in vivo observations with that of the in vitro observations [11-13]; that is, sugars could protect not only proteins against thermodenaturation correlated to their mean number of equatorial OH groups but also protect cells against both hyperthermia and hydrostatic pressure stress as well. Hottiger et al. have reported that glucose, sucrose, and trehalose are protein stabilizers against elevated temperatures, and trehalose is superior to the other sugars, polyalcohols, and amino acids [17].Our results support this report and answer the question why trehalose shows the most potent effect of thermoprotectant by acting as a protein stabilizer. Trehalose has a higher mean number of equatorial OH groups among the well known sugars. Concerning the thermotolerance studies in yeast, trehalose is thought to play an important role as a thermoprotectant [18].We have previously reported that lethal hydrostatic pressure stress on yeast cells had an analogous effect on the viability after lethal heat stress [19-22]. These results suggest that the cells were injured by hyperthermia and hydrostatic pressure stress on a molecular basis, that is, the injury by hyperthermia and hydrostatic pressure stress can be protected by macromolecular stabilizers by improving water structurization. Furthermore, it raises the possibility that sugars may have the ability to prevent not only thermo-denaturation but also hyperbaric denaturation of proteins or disruption of other macromolecules correlated to their mean number of equatorial OH groups in vitro. Pre-heat shock treatment on yeast cells induces various stress tolerances that include thermotolerance [23] and barotolerance [16,24] The studies of yeast cells during hyperthermia, heat shock proteins (hsps) induced by pre-heat shock treatment are thought to protect cells by repairing or digesting denatured proteins [23,25-26] In this report, heat shock treatment elevated the barotolerance values only ten times, from 0.01% to 0.11%, but elevated the thermotolerance values over 500 times, from 0.01% to 5.4%. On the other hand, 1 mol/1 trehalose elevated the barotolerance values over 3000 times, but elevated the thermotolerance values only 60 times. Low temperature at pressurization would be one of the causes of these differences. These results suggest that this protection manner of sugars and heat shock treatment may be suited for pressure and heat resistance, respectively. Protection of the former may be done by trehalose and on the latter by hsps in

251 natural yeast cells. The studies of barotolerance and comparison with thermotolerance could help to reveal and understand the mechanism of multiple stress tolerance in yeast cells.

5. A C K N O W L E D G M E N T S

We special thank Drs. Uedaira and Dr. Sunil C. Kaul for their valuable comments and criticism.

6. REFERENCES

10 11 12 13 14 15 16

F. H. Johnson, H. Eyring, and M. J. Polissar, in "The kinetic basis of molecular biology" John Wiley & sons. Inc., NY, 1954. G. N. Somero, Ame. Zool., 30, 123-135 (1990). K. E. Bett and J. B. Cappi, Nature, 207, 620-621 (1965). E. M. Stanley and R. C. Batlen, J. Phys. Chem., 73, 1187-1192 (1969). J. F. Back, D. Oakenfell, and M. B. Smith, Biochemistry, 18, 5191-5200 (1979). J. H. Crowe, L. M. Crowe, and D. Chapman, Science, 223, 701-703 (1984). J. H. Crowe, L. M. Crowe, J.F. Carpenter, and C.A.Wistrom, Biochem. J., 242, 1-10 (1987). J. H. Crowe, L. M. Crowe, A. Rudolph, C. Womersley, and L. Appel, Archi. Biochem. Biophys., 242, 240-247 (1985). C. D. Virgilio, P. Piper, T. Boiler, and A. Wiemken, FEBS Lett., 288, 86-90 (1991). A. Wiemken, Leeuwenhoek, 58, 209-217(1990). H. Uedaira and H. Uedaira, Bull. Chem. Soc. Jpn, 53, 2451-2455 (1980). H. Uedaira and H. Uedaira, J. Sol. Chem., 14, 27-34 (1985). H. Uedaira, M. Ishimura, S. Tsuda, and H. Uedaira, Bull. Chem. Soc. Jpn., 63, 3376-3379 (1990). E. S. Baker and J. Jonas, J. Phys. Chem., 89, 1730-1735 (1985). D. Masland, in "High Pressure Effects on Cellular Processes" ed. by M. Zimmerman, Academic Press, NY, 1970, pp. 259-312. Y. Komatsu, K. Obuchi, H. Iwahashi, S. C. Kaul, M. Ishimura, G. M. Fahy, and W. F. Rall, Biochem. Biophys. Res. Comm., 174, 1141-1147

252

17 18 19 20 21 22 23 24

25 26 27

(1991). T. Hottiger, C.D. Virgilio, M.N. Hall, T. Boller, and A. Wiemken, Eur. J. Biochem., 219, 187-193 (1994). P.W. Piper, FEMS Microbiol. Rev., 11,336-356 (1993). Y. Komatsu, S. C. Kaul, H. Iwahashi, and K. Obuchi, FEMS Microbiol. Lett., 72, 159-162 (1990). H. Iwahashi, S. C. Kaul, K. Obuchi, and Y. Komatsu, FEMS Microbiol. Lett., 80, 325-328 (1991). H. Iwahashi, S. Fujii, K. Obuchi, S. C. Kaul, A. Sato, and Y. Komatsu, FEMS Microbiol. Lett., 108, 53-58 (1993). H. Iwahashi, K. Obuchi, S. Fujii, and Y. Komatsu, Cell. Mol. Biol., 41, 763-769, (1995). S. Lindquist, Annu. Rev. Biochem., 55, 1151-1191 (1986). K. Obuchi, H. Iwahashi, S. C. Kaul, H. Uedaira, M. Ishimura, and Y. Komatsu, Y., in "High Pressure and Biotechnology" eds. by C. Balny, R. Hayashi, K. Heremans, and P. Masson, Colloque INSERM/John Libbey Eurotext, France. 1992, 224, pp. 77-81. Y. Sanchez, J. Taulien, K. A. Borkovich, and S. Lindquist, EMBO J., 11, 2357-2364 (1992). E. A. Craig, B. D. Gambill, and R. J. Nelson, Microbiol. Rev., 57, 402414 (1993). S. Fujii, K. Obuchi, H. Iwahashi, T. Fujii, and Y. Komatsu, Biosci. Biotech. Biochem. 60, 476-478 (1996).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

253

Inactivation of bacterial spores in phosphate buffer and in vegetable cream treated with high pressures S. Goba C.Fomaria G. Carpia, A. Maggia A. CassarS,a and P. Rovereb aStazione Spefirrentale lndustria Conserve Athentari, V.Tanara 31/a,43100-thm-a,Italy bre,,WaPak Processing Systerrs I~g~on AB-Ruben Rausing gata,Lund,Sweden Abstract Spores of four types of Bacillus sp. in phosphate buffer (pH 7) were treated with high pressures. Bacillus cereus spores (4x105 / ml) were partially inactivated using a 9 kbar treatment for 10 min at 20 ~ C. Total spore inactivation was obtained at 20 ~ C after a double treatment (2 kbar for 1 n ~ followed by 9 kbar for 1 min). Total inactivation of Bacillus licheniformis and Bacillus stearothermophilus spores was reached after 8 kbar treatment for 3 rain at 60 and 70 ~ C, respectively. Bacillus coagulans spores were partially inactivated by a 9 kbar treatment for 5 min at 70 ~ C. Truffle cream (aw 0.98 ; p H 6.8 ) containing 8.4 x 10 2 spores / g of Clostridium sporogenes P. A. was preheated at 80~ and treated at 6, 7, 8 and 9 kbar for 5 and 10 rain at 80 ~ C. Treatments of 8 and 9 kbar for 10 rain completely reduced the number of inoculated spores of C. sporogenes and all Bacillus spores (4.2 xl 04/g) naturally present in the product. Eight out of ten samples treated at 8 and 9 kbar for 10 min and incubated at 30 ~ C for 30 days were microbially sterile while two were not. High pressure treatments were not sufficient to completely destroy C. sporogenes spores in truffle cream.

1. INFROI~CTION High pressure is currently applied rminly to acid products (jam, fruit dressings, fruit juices) to improve their sensory characteristics. Acid products can be contaminated by non spore-forming bacteria (lactic acid bacteria), moulds and yeasts ; t h e s e microorganisms are inactivated by high pressure at levels between 3 - 5 kbar [1 - 4]. q-he application of high pressure to low acid foods (meat, fish and vegetables) is more problematic because, in this case, also bacterial spores must be inactivated. Bacterial spores are very resistant to high pressure "combined pressure - heat treatments are needed to inactivate different types of spores. Spores have proven pressure resistance (Gould and Sale [5], Sale et al. [6], Tlmson and Short [7]). ] h e last two authors suggest that bacterial spores are lax)re resistant to pressure than vegetative cells because spore proteins are protected against solvation and excessive

254 ionization by dipicolinic acid. Gould [8] suggests the possibility of a highly viscous glassy state existing within the core of the spore and contributing to resistance and dormancy. Sapru and Labuza [9] use the polymer glass -transition theory to gain infomaation about the high heat resistance of bacterial spores. The objective of this paper was to study the pressure resistance of four strains of Bacillus spores in phosphate buffer and that of Clostridium sporogenes spores inoculated in truffle cream. 2. MATERIALS AND METHODS 2.L Microbial slrains 'Ihe following swainswere u~cl for the tests" -BacilluscereusS.S.L C.A. / DA 1isohted fromwheat nr_al; -Bacillus licheniformisS. S. I. C.A. / D A2 isohted fromsp~s; -BacilluscoagulansS.S .I.C.A. / 1881isohted fromtormto- ba.wa:ttuna sauce; -Bacillusstearothermophilus S. S. I. C. A. / T460 isohted fromcanned peas; -Clostridiumsporogenes,putaefactive anaerobe 3679 ATC C 7955. Sportdation was obtained by hdividually inoculating the aerobic strains nto T S A and anaerobic swainhto BeefExtract Infusion [10]and incubating the phtes at opt~mm growth t e ~ m r e ~ for 10 21 days, xeslx~tively. 'Ihe spoles were then colkxzted with stenqe disnqP,d water, centrifuged twr,e at 31300rpm for 15 rrin, suspended in phosphate bufferat pH 7 and p a s t ~ at 80~ C for 15 nin.

2.2. Culture media Tryptone Soy Agar (Biogenetics) (TSA) was used for Bacillus spore count, qhe plates were inoculated and incubated at growth temperatures optimum for the bacilli taken into consideration :30 ~ C for 3 days for the two mesophilic strains, 45 ~ C for 4 days for B.coagulans and 55 ~ C for 4 days for B. stearothermophilus. M 5 medium [11] was used for C. sporogenes spore count : the plates were inoculated and incubated in anaerobic jar at 30 ~ C for 4 days. 2.3. High Pressure treatments of Bacillus spores 105-106 Bacillus spores / ml suspended in 10 ml phosphate buffer at two pH values (7 and 5), packed under vacuum in polythene pouches which were subsequently heat- sealed, were subjected to different treatments with an ABB - QFP 6 pilot press [12]. qhe tests were carried out at 20,50,60,70 ~ C at pressures between 2 and 9 kbar for 1, 3, 5, 10 min. Moreover, a double treatment was perfom'ed :the first at 2 kbar (for 1,5 and 10 mm) and then at 3 , 4 or 5 kbar for 1 rr~, the second at 9 kbar for 1 rain. 2.4. Observation at Scanning Electron Microscope(S. E. M.) B. cereus spores treated at 3 and 5 kbar for 5 rain at 20 ~ C were photographed using S. E. M. Stereo Scan 200 (Cambrigde) after ethanol dehydration (levels of 75, 85,95 and 99.8 %), 12 hours for each level, treatment with Critical Point Dryer (mod. CPD 0.30, Balzers) and gold rretallizing with Coating Unit PS 3 mod. ST2 M. 2.5. Truffle cream samples. Frozen black truffle (Tuber aestivum) was thawed and washed. A cream was obtained by mixing the minced (3 mm t r a c e r - plate) truffle (70 %) with seed oil

255 (30%) under vacuum in a refrigerated cutter (10 ~ C). The cream (aw 0.98, pH 6.8) was inoculated with C. s p o r o g e n e s spores (840 cfu/g), splitted (20/g) and packed in plastic pouches (PE). q-he pouches, heat sealed under vacuum, were stored at 3 ~ C until use.

2.6. High pressure treatments of truffle cream. High pressure processing was carded out by pre - heating the samples to 80 ~ C in a themaostatic bath. qhe sarrples were then pressurized using a ABB-QFP 6 pilot press [12]. Truffle cream samples were HP-treated at 6, 7, 8 and 9 kbar for 5 and 10 mm. qhe press and the pressure media were each time conditioned to the same temperature (80 ~ C ) o f the incoming samples, qhe temperature of the truffle cream increased during pressurization. After the HPP treatments, the samples were quickly cooled using a 15 ~ C water bath; three samples were immediately analyzed and five for each treatment were incubated at 30 ~ C for sterility test. 2.7. Sterility test 5 sarrples of each HPP matrix point were incubated at 30 ~ C for 30 days ; at the end of storage, the sulphite-reducing clostridium spores were counted (M 5 medium) on each sample. 3. RESULTS ANDDEC~SSION

3.1. Bacillus spores in phosphate buffer. "Ihe behaviour of B. cereus spores during the different treatments (from 5 to 9 kbar for 1, 5 and 10 minutes at 20 ~ C) is reported in Figure 1 : significant reduction of spores (3 decimal reductions, D) was obtained only with treatments at 7 and 8 kbar for 10 n m or at 9 kbar for 5 min ; 1 n ~ at 9 kbar was not sufficient to decrease initial spore number.

Figure 1. Behaviour of B a c i l l u s cereus spores HP treated at 20 ~ C.

Subsequent treatments (2 kbar for 1 min and 9 kbar for 1 min) caused complete destruction o f 4 x l 0 5 spores/ml of B. c e r e u s , whereas treatments at 5 kbar for 1 min and subsequently at 9 kbar for 1 min were less effective. If the pressure level of the first treatn-ent is lower than 3 kbar, spore inactivation is higher. "Ibis behaviour was observed also by other research workers [6, 13].

256 Combined high pressure-terrperature treatments proved very effective causing spore reductions (2 - 3 D) also at 5 - 6 kbar and 50 - 60 ~ C. Complete destruction of 5.0x105 spores/g was obtained at "9 kbar x 5 min at 50 ~ C, 8 kbar x 3 n ~ at 60 ~ C or 7 kbar x 3 min at 70 ~ C. Pressure caused spore morphological changes: lengthening and flattening at 3 kbar and breaking at 5 kbar could be observed at the S. E. M. (Figures 2, 3).

Figure 2. S.E.M. image of Bacillus cereus

spores treated at 3 kbar for 5 n ~ at 20 ~ C in phosphate buffer, pH7.

Figure 3. S.E.M. image of Bacillus cereus

spores treated at 5 kbar for 5 ~ n at 20 ~ C in phosphate buffer, pH7.

257 qhe other three strains were inactivated only by combined high pressure-heat treatments. Since temperature increases by about 3 ~ C / 1,000 bar during pressurization, the r m x i m u m t e l ~ e r a t u r e reached during the most severe treatment (9 kbar for 5 n ~ at 70" C) was 95" C. qhis temperature applied for 5 min did not cause any spore inactivation because therrml resistance expressed as decimal reduction time at 95 ~ C was 9.5,6.8 and 1215 n ~ for B. licheniformis, B. coagulans and B.stearothermo-philus, respectively. Treatments at 9 kbar for 5 min at 50 ~ C or 8 kbar for 3 min at 60 ~ C or 7 kbar for 1 rnln at 70 ~ C remarkably reduced the number of B. licheniformis spores (Figure 4). "Ihe spores of the two mesophilic Bacillus were more sensitive to pressure than those of the two therrr~philic. B. stearothermophilus was more sensitive to pressure than B. coagulans, which is less heat resistant. In fact, B. stearothermophilus spores were completely destroyed (5 D) by 7 kbar for 5 rnm or by 8 kbar for 3 min at 70 ~ C (Figure 5), while B. coagulans spores were significantly inactivated (4 D) only by 9 kbar for 5 min at 70 ~ C.

3.2. C. sporogenes in truffle c r e a m On the basis of these results we studied the effects of combined high pressure heat treatments on C. sporogenes P. A. 3679 spores inoculated in truffle cream. This strain is normally used as a test organism to determine heat processing time for canned low acid foods. Treatments at 6 - 7 kbar for 5 and 10 min and at 8 - 9 kbar for 5 min at 80 ~ C were not sufficient to completely destroy the C. sporogenes spores. Treatments of 8 - 9 kbar for 10 n ~ at 80 ~ C caused complete destruction of 840 spores / g (Table 1).

258 Bacillus spp. spores (4.2 x 104/g) naturally present in the cream were already inactivated by 6 kbar for 5 min at 80" C. The results of the sterility test reported in Table 1 showed that the survivors generally do not grow in the cream in 30 days: probably these spores have lost their capacity to germinate and grow. Of ten samples treated at 8 and 9 kbar for 10 rnm at 80 ~ C eigth can be considered microbially sterile, the remaining two also commercially sterile but not safe because there is a real possibility of C. botulinum growth. For this mason, further investigations will be carded out using other HPtemperature combina-tions. These preliminary results allow the possibility of sterilizing low acid foods with HPheat treaments to be foreseen.

Table 1 Behaviour of HP treated Clostridium sporogenes P. A. inoculated in truffle cream samples non incubated and incubated at 30 ~ C for 30 days.

kbar x min

C. sporogenes P.A.

C. sporogenes P.A. (cfu / g)

(cfu / g)

after 30 days at 30 ~ C (5 samples)

ref.

8.4 x 102

spoiled

6x5

40

0- 27- 30- >106- 19

6 x 10

22

0- 60- 2- 15- 18

7x5

5

0-0-0-4-16

7x10

3

0-0-1--5-2

8x5

11

8x10

0

0-0-0-1-0

9x5

2

0-0-5-1-5

0

0-0-4-0-0

9x10 .

.

.

0-

11 - 1 0 - 4 -

25

.

4. REFERENCT~ 1 2 3 4 5 6 7

D. Knolr, A. Bottcher,I-[ Domerburg,M. Eshtiaghi,E Oxen,& Richwin and I. Seyderhelm ia" I-figh pressure and Biotechnobgy", C. Balny, R. Hayashi,K. Herermns and P. Masson (eds,) CoIloque INSERM/J.Llbbey Eurotext Ltd,vol. 224 (1992)211. HI Ogawa, K Fukuhisa and H. fiakurmto,h" I-fighpmsane and Biotechnology", C. Balny, R. Hayashi,K. Herermns and P. Masson. (eds.) Colloque INSERM/J. L~bey Eurotext Ltd, vol. 224 (1992)269. G.DalrAglio,S.Gohand G.Carpi,IndustriaConserve,67 (1992)23. S.Gola,L.Dahiefi,D.CacaceandG.Dall'Aglio,IndustriaConserve,67 (1992)41. G.W. GouldandA.J.I-tSale,J. G e n ~ b b l . , 6 0 (1970) 335. A. Sale,G. W. Gould and W.A. Hamqton,J.Gen_ML-mbbl.,60(1970) 323. A.J.R Tn-mn and AJ. Short,Bbtechnol. Bioeng,7 (1965) 139.

259 8 9 10 11 12 13

G.W.Gould, h "Metabofism and Dry O r g Y " , A. C. Leopold (ed.), Comstock Publishing ComellUniv~ ~ . thaca, 1986. V.Sapru and T.P. Labuza,J. Food Sci.,58 (1993)445. NationalFood Processors Association," Laboratory Manual for Food Canners and Processors" 31ded,voL1 (1968) 18, AviPublishingCo.,Westport,Connectizut (USA). A. Casohfi, h " ~ i n g s of 4th International Cong~,ss of Food Science and Technobgy" Spain,vot 3 (1974)86. S. Gola,L.Pahiefi, D. Cacace and G. DallAglio,IndustriaConserce,67 (1992)417. I. Hayakawa,T. Kanno,K. Yoshiyarmand Y. Fu~,J.Food Sci.,59(1994) 164.

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

261

Behaviour of Escherichia coli under high pressure Katsuhiro Tamura *a, Yoshihisa Muramoto a, Mitsuo Miyashita a and Hiroki Kourai b aDepartment of Chemical Science and Technology, bDepartment of Biological Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan

Abstract Escherichia coli was cultivated under hydrostatic pressures up to 40 MPa (400 bar), and the

elongation of E. coli cells and the partition of the cells between an aqueous phase (physiological saline) and oil phase (n-hexadecane) were observed.

The partition coefficients were used as

measures of hydrophobicity of the surface of the cells and correlated with the susceptibility to an antimicrobial agent (dodecylpyridinium iodide). This agent is lethal to the cells and the effect of pressure on its concentration for a lethal effect on E. coli was determined. A good correlation was found between the hydrophobicity of the cells and their death rate on treatment with this reagent.

1. I N T R O D U C T I O N The maximum pressure for growth of E. coli is about 50 MPa (500 bar). E. coli cells cultivated at pressures of 10- 30 MPa, which correspond to those at 1000 - 3000 m depth in the sea, show various interesting features, such as elongation of the cells [1].

In this paper we discuss the

elongation of E. coli cells and the effects of pressure on the hydrophobicity of the cell surface of E. coli.

Hydrophobicity has been shown to be correlated with drug susceptibility in many

bacteria at atmospheric pressure [2], so we investigated the effect of an antimicrobial agent (dodecylpyridinium iodide) on E. coli cells cultivated at high pressures.

To evaluate the

hydrophobicity of the cell surface of E. coli, we measured the partition coefficient of the cells between water and oil phases. In general, the drug susceptibilities of Gram-positive bacteria to dodecylpyridinium iodide are fairly high, whereas those of Gram-negative bacteria are very low [2].

Marshall et al.

262 reported that the adsorption of microorganisms to surfaces is important for their behavior in natural habitats [3,4]. The hydrophobicities of bacterial cell surfaces have been measured by use of a two-phase partition system [5], by hydrophobic interaction chromatography [6] and by a salt aggregation method [7].

2. EFFECTS OF ETHANOL ON THE G R O W T H AND ELONGATION OF E. COLI UNDER HIGH PRESSURE

The size and shape of E. coli incubated in the presence of ethanol or under high pressure were examined by optical microscopy (Fig. 1) [ 1]. In the absence of ethanol, high pressure induced E. coli cell elongation. At 40 MPa, the cell length became seven times as much as that of control cells. When the pressure was released at a rate of 20 MPa/min and the suspension was allowed to stand for a few hours at ambient pressure, the cell shape returned to normal. In the presence of 2%(w/w) ethanol, the elongation due to increased pressure was almost abolished

10

E

8

c-t-

O

6 4

0 1 0

I

I

10

20

I _

30

I

40

Pressure I MPa

Figure 1. Effects of pressure and ethanol on the cell length of E. coli. Ethanol concentration (%w/w)" O , 0" ~ , 2" 0,4; A,6. Figure 2. SEM photographs of E. coli cultivated for 18 h at 0.1 MPa (A) and 30 MPa (B). (7000 x).

263 above 30 MPa.

Ethanol also induced cell elongation, and 4%(w/w) ethanol induced further

increase in the length of cells in pressurized cultures. This effect of ethanol reached a peak at about 20 MPa, above which the plots crossed and the effect of ethanol disappeared.

At an

ethanol concentration of 6%(w/w), pressure had no effect on the cell length. Figure 2 shows SEM photographs of E. coli cells cultivated for 18 h at atmospheric pressure and 30 MPa [8]. When the cells were incubated under high pressure, cell division was retarded and the cell length became abnormally longer.

3. CHANGES IN H Y D R O P H O B I C I T Y OF THE CELL SURFACE OF B A C T E R I A INCUBATED UNDER HIGH PRESSURE

When bacterial cells are well shaken in a mixture of water and oil, the cells are partitioned into the two phases according to the hydrophobicity of the cell surface.

The higher the

hydrophobicity of the cell surface, the more bacterial cells shift into the oil phase. Figure 3(B) is an example of gram positive bacteria, Bacillus cereus.

In this case, more cells

are partitioned into the oil phase side. Accordingly, we can say that the hydrophobicity of the bacterial cell surface is relatively high. On the other hand, gram negative bacteria such as E. coli shown in Fig.3(A) are around oil-

water interface but do not shift into the oil phase. From these results, we can conclude that the hydrophobicity of the cell surface of E. coli is low. In order to quantitatively

evaluate

the

hydrophobicity of the cell surface, partition coefficients of bacterial cells between the water and oil phases were used. In the two-phase system, the amount of cells that moved from the aqueous phase to the oil phase depended on the cell concentration in the aqueous phase.

Figure 3. Microphotographs of bacteria at oil - water interface in the n-hexadecane - physiological saline systems. (A) E s c h e r i c h i a coli and (B) B a c i l l u s cereus.

264 Thus the hydrophobicity of the bacterial cell surface seems to be related to the partition of cells between n-hexadecane and physiological saline in a similar manner to the hydrophobicity of a chemical compound. The partition coefficient is given as K = (C I - CA) [ CAn

(1)

where C I and C A are the concentrations of E. coli cells in the aqueous phase before and after partition, (C I - CA) is the concentration of cells moved to the oil phase and n is the association number in the oil phase.

This partition coefficient is an index of the hydrophobicity of the

surface of E. coli cells. A higher value of the coefficient indicates a higher hydrophobicity. From equation (1) (2)

log (C I - CA) = log K + n log C A

where log K is a common logarithm of the partition coefficient.

There was a good linear

relationship between log (C I - C A) and log C A at various pressures and the slopes of the lines were about one (n= 1). This result suggests that bacterial cells in the oil phase do not associate, but behave individually. The log K values can be estimated from the plots of log (C i - C A) vs. log C A [8]. The values of log K in stationary phase cells are plotted against pressure in Fig.4. In general, the hydrophobicities of the cell surface are lower in the stationary phase than in the exponential phase [2]. Table shows the logarithm of the

1.0

partition coefficients at atmospheric pressure for twenty kinds of gram

0.5

negative and gram positive bacteria. We can use these values as an index of the hydrophobicity of the cell surface of these bacteria.

Since

large

high

values

mean

hydrophobicity, gram positive bacteria

have

a

higher

hydrophobicity than gram negative

v

o --

0.01 -0.5 -1.0 I 0

I 10

I 20

30

Pressure / MPa

bacteria. Also, the hydrophobicity of the exponential phase cells is higher than that of the stationary phase cells.

Figure 4. Partition coefficients (hydrophobicity) of bacterial cells cultivated at high pressures. I I , S. aureus; Q , B. cereus; (~ , E. coli; [-], K. pneumoniae; A , p. mirabilis.

265

T a b l e 1 Hydrophobicities of cell surface of bacteria (ref. 2) Hydrophobicity (log K) Bacteria

Stationary phase cells")

No

1 2 3 4 5 6 7 8 9 10 11

(Gram negative bacteria) Pseudomonas aeruginosa ATCC 27583 Pseudomonas aeruginosa ATCC 10145 Pseudomonas aeruginosa IFO 3080 KlebsieUa pneumoniae ATCC 4352 KlebsieUa pneumoniae ATCC 13883 Proteus rettgerl NIH 96 Proteus vulgaris OX 19 RIMD Proteus vulgaris ATCC 13315 Proteus mirabilis IFO 3849 Escherichia coli IFO 3301 Escherichia coli K 12 OUT 8401

12 13 14 15 16 17 18 19 20

(Gram positive bacteria) Bacillus subtilis IFO 3134 Bacillus subtilis ATCC 6633 Bacillus subtilis var. niger OUT 4380 Bacillus cereus IFO 3001 Bacillus megaterium IFO 3003 Staphylococcus aureus ATCC 25923 Staphylococcus aureus IFO 12732 Staphylococcus epidermidis ATCC 12228 Micrococcus lysodeikticus NCTC 2665

Exponential phase ceils b~

-

1.68

-

1.40

-

1.80

-

1.21

-

1.85

-

1.41

-

1.37

-

0.81

-

1.14

-

1.18 - 1.17 - 1.19

1.10

- 0.96 - 0.94

-0.81 -0.85 -0.80 - 0.61 - 0.68 - 0.79

-0.81 - 0.89 - 0.99 - 0.65 - 0.87 - 0.56 - 0.76 - 0.74 - 0.31

-0.72 - 0.77 - 0.97 - 0.85 - 0.69 - 0.37 - 0.24 - 0.30 - 0.67

-

-

1.55

a) Cells incubated in nutrient broth for 18 h at 37~ b) Cells incubated in nutrient broth for 2 - 3 h at 37~

4. D E A T H

RATE

OF

E. COLI

INCUBATED

UNDER

HIGH

PRESSURE

BY

ANTIMICROBIAL

R e s u l t s for the t i m e c o u r s e o f d e a t h o f E. coli cells on d r u g d a m a g e f o l l o w e d a first o r d e r reaction.

D e a t h b y h e a t i n g also f o l l o w e d this order, e x p r e s s e d as k = 2.303 (log N O - log N) / t

(3)

w h e r e N O is the initial v i a b l e cell n u m b e r , N is the v i a b l e cell n u m b e r a f t e r t r e a t m e n t , t is the t r e a t m e n t t i m e ( m i n ) , and k is the c o n s t a n t for the rate o f death. Fig.5.

T h e c o n s t a n t s are s h o w n in

P r e s s u r e a c c e l e r a t e d the d e a t h at l o w e r p r e s s u r e s : E. coli c u l t i v a t e d at 10 M P a w e r e

sterilized m o r e easily than those cultivated at a t m o s p h e r i c pressure.

H o w e v e r , at higher pressures

the effect o f p r e s s u r e on cell d e a t h d e c r e a s e d , b e c o m i n g a l m o s t the s a m e to that at a t m o s p h e r i c p r e s s u r e at a b o u t 30 M P a .

T h e pattern o f the c u r v e in Fig.5 is v e r y s i m i l a r to that o f E. coli in

266 Fig.4 and the correlation between log K (hydrophobicity of the cell surface) and k (death rate constant) can be s h o w n by the

0.06 '7, C

E

linear

relationship, log K = - 1.65 + 12.0 k (correlation coefficient: R = 0.96).

0.04

c-

o to

0.02

This similarity suggests that the drug ~- 0.00

susceptibility shown by the death rate

c-

of E. coli cells cultivated at high

a

pressures can be directly correlated with the hydrophobicity of their cell

-0.02

0

I

20

Pressure / MPa

surface. 5. A C K N O W L E D G E M E N T

I

10

Figure 5. First order death rate constants of E. coli cells cultivated for 18 h at various pressures at 37~

The work was supported in part by a Grant-in-Aid for Scientific Research (No. 04808045) from the Ministry of Education, Science and Culture of Japan. 6. REFERENCES

1 K. Tamura, T. Shimizu and H. Kourai, FEMS Microbiol. Lett., 99 (1992) 321. 2 H. Kourai, H. Takechi, K. Muramatsu and I. Shibasaki, J. Antibact. Antifung. Agents, 17 (1989) 119. 3 K. C. Marshall, R. Stout, and R. Mitchell, J. Gen. Microbiol., 68 (1971) 337. 4 K. C. Marshall, R. Stout, and R. Mitchell, J. Microbiol., 17 (1971) 1413. 5 K. E. Magnussen and G. Johansoon, FEMS Lett., 2 (1977) 225. 6 C. J. Smyth, P. Jonsson, E. Olsson, O. S6derlind, J. Rosengren, S. Hjert6n and T. WadstrOm, Infect. Immun., 22 (1978) 462. 7 M. Lindahl, A. Faris, T. Wadstrtim, and S. Hjert6n, Biochim. Biophys. Acta, 677 ( 1981 ) 471. 8 K. Tamura, Y. Muramoto and H. Kourai, Biotech. Lett., 15 (1993) 1189.

30

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

267

High pressure inactivation in foods of animal origin M. F. Pattersona, b, M. Quinna, R. Simpson a and A. Gilmoura, b aDepartment of Food Science (Food Microbiology), Queen's University of Belfast bFood Science Division (Food Microbiology), Department of Agriculture for Northern Ireland, Newforge Lane, Belfast BT9 5PX, UK. Abstract Various factors can affect the response of vegetative bacteria to pressure. In general, Gram negative bacteria such as Yersinia enterocolitica and Salmonella spp. were found to be more pressure sensitive than Gram positive bacteria such as Listeria monocytogenes and Staphylococcus aureus, when treated in phosphate buffered saline at 20 ~ C. Some strains of Escherichia coli 0157:H7 were found to be relatively resistant to pressure. Further studies on the effect of substrate on pressure resistance were carried out on St. aureus, S. enteritidis and one of the resistant E coli O157:H7 strains. There was greater survival of the E. coli and S. enteritidis in ultra hightemperature treated (UHT) milk compared to poultry meat, while there was greater recovery of St. aureus in poultry meat than in the milk. There was evidence, assessed by differential plating using trypticase soy agar with and without additional NaC1, that sublethally injured E. coli O157:H7 cells were present at pressures significantly lower than were required for death. The simultaneous application of pressure with mild heating (up to 60 ~ C) significantly increased the death of E. coli O157:H7 in poultry meat and UHT milk compared to either treatment alone. The variation in results obtained with different organisms, between strains of the same organism and in different substrates should be recognised when recommendations for the pressure processing of foods are being considered. 1. INTRODUCTION The number of reported cases of food poisoning continues to rise in most countries around the world. Many of theses cases are associated with foods of animal origin such as poultry meat and dairy products. If high pressure processing of such foods is to be accepted then further information is needed on the response of pathogens to high pressure treatment in the foods, so that the process can be optimised for microbiological safety and quality. The microbiological inactivation achieved by high pressure depends on a number of interacting factors including the microbial species, the strain variation within a species, the effect of substrate and the ability of the organism to survive sub-lethal injury caused by pressure. These aspects are discussed below. In addition the use of high pressure applied simultaneously with elevated temperature was investigated as a method of inactivating the more pressure resistant microorganisms.

268 2. RESULTS AND DISCUSSION

2.1. Variation in pressure sensitivity between microbial species In phosphate buffered saline (PBS), a pressure of 275 MPa for 15 rain at 20 ~ C resulted in more than a 105 reduction in numbers of Yersinia enterocolitica NCTC 11174 (Figure 1). However, treatments of 350 MPa, 450 MPa, 450 MPa, 700 MPa and 700 MPa for 15 rain were needed to achieve a similar reduction in Salmonella typhimurium NCTC 74, S. enteritidis PT4 (laboratory isolate from liquid egg), Listeria monocytogenes NCTC 11994, Escherichia coli O157:H7 NCTC 12079 and Staphylococcus aureus NCTC 10652. The unexpected pressure resistance of the E. coli O157:H7 was investigated further using different stains of this pathogen. II S. t~l~imunum 9$. enter~lis

O-

co/i 0157:H7 NCTC 12079

I ' E.

-1-

Figure 1. Inactivation of pathogens in phosphate uffered-saline (pH 7.0, 20~ after 15 min treatment at various pressures. No - initial number, N - number of survivors. Plating medium = TSAYE.

-2-

'• Z

-3-"

4-741

,

,

l

,

Pressure (MPa)

2.2. Variation in pressure sensitivity between different stains of the same species The pressure sensitivity of six strains of E. coli O157:H7 ( NCTC 12079, ATCC 43888, ATCC 43894 and three clinical isolates, H631 (obtained from a child with Haemolytic Uremic Syndrome), H2822 and H1071) was investigated. Table 1. Pressure inactivation of E. coli 0157:H7 strains after 15 rain in PBS (pH 7.0, 20~ No - initial number; N - number of survivors.

Strain

'log 500

NCTC 12079 ATCC 43888 ATCC 43894 H 1071 H 631 H 2822

-2.53 - 1.99 - 1.79 -4.20 -4.67 -3.56

MPa

(N/No)

MPa

600

-4.48 -5.1 7 -2.87 -7.04 -7.10 -6.32 ii

700

MPa

-5.63 -7.61 -5.07 > -8.00 > -8.00 -7.93 ,,

269 There was obvious variation in pressure sensitivity between the different strains (Table 1), with the clinical isolates tending to be more sensitive than isolates from the culture collections. Variation in pressure resistance between different stains has also been reported for L. monocytogenes [ 1]. 2.3. Effect of substrate on the sensitivity of microornanisms to pressure To date many investigations of the effect of pressure on microorganisms have been carried out in buffers such as PBS. This substrate is readily available, easy to inoculate and used in many investigations, so allowing for comparisons to be made between different published studies. However, it is known that PBS can undergo significant changes in pH during pressurisation [2]. This is likely to affect the survival of microorganisms as well as the pressure treatment. In addition, it is thought that low water activity, sucrose, sodium chloride, and possibly other food constituents, may have a 'protective' effect on microorganisms [3, 4]. For these reasons it is of more value to investigate microbial inactivation in the foods of interest rather than in model systems. Figures 2 and 3 show the response of E. coli O157:H7 (NCTC 12079), St. aureus and S. enteritidis to pressure treatment (700 MPa) in irradiation-sterilised poultry meat and ultra high-temperature treated (UHT) milk respectively. The substrate during the pressure treatment had a significant effect on the recovery of the pathogens. The UHT milk allowed greater survival of the E. coli and S. enteritidis, while there was greater recovery of St. aureus in poultry meat compared to UHT milk. In all cases, inactivation was greater in PBS than in either of the foodstuffs (data not shown). This variation in inactivation obtained in different substrates has been reported elsewhere. L. innocua was more pressure resistant in liquid UHT dairy cream than in minced beef [5, 6] S. typhimurium and L. monocytogenes were more pressure sensitive in buffer than in strained chicken or UHT milk respectively [7, 8].

~.

-3-

z

.4-

z

Figure 2. Pressure inactivation 700 MPa) of pathogens in poultry meat treated at 20~ No = initial number, N = number of survivors, Plating medium = TSAYE

-g'4-

4-7-8

0

10

1

T i m e (mln)

I

2O

25

30

270

~' Z

I E.coli O157:H7 NCTC 12079 9 S.oureus 9Sal.enteritidis

..3

0

I

5

9

I

10

i

i

15 20 Time (rain)

'

i

26

Figure 3. Pressure inactivation (700 MPa) of pathogens in UHT milk treated at 20~ No = initial number, N - number of survivors. Plating medium = TSAYE

I

30

2.4. Recovery and survival of pressure-injured bacteria As with all physical preservation techniques, high pressure may not kill cells outright but may injure a proportion of the population. The main site of damage in microorganisms is thought to be the cell membrane which becomes more permeable after pressure treatment. Shigehisa et al., [9] reported that treatment of E. coli and St a u r e u s at pressures up to 600 MPa for 10 min at 25 ~ C resulted in leakage of cytoplasmic RNA. Ultraviolet absorption spectra and acridine orange staining suggested that the E. coli cell membranes became permeable and leaked cytoplasmic RNA at lower pressures than those of St. aureus, agreeing with findings that E. coli was more pressure sensitive than St aureus. Evidence of damaged cells can also be obtained by comparing bacterial counts on non-selective agar with those obtained on selective agar. Compounds such as sodium chloride can act as selective agents and inhibit the growth of cells with membrane damage [10]. The use of differential plating, consisting of trypticase soy agar containing 0.6% yeast extract (TSAYE) and TSAYE + 3% NaCI was used to assess injury in E. coli O157:H7 after treatment in UHT milk at various pressures for 15 min. (Figure 4). There was no significant difference in counts below 300 MPa. At 400 MPa and above, counts were significantly lower on the salt medium, indicating the presence of injured cells. The fact that pressure can cause microbial injury has important implications for the storage of pressure treated foods. Carlez et al [11] reported that, although P s e u d o m o n a s spp. could not be detected immediately after minced meat was pressure treated (400 MPa, 20 rain.), the organisms were detected after 6 days storage at 3 ~ C. After this initial lag, the growth rate of the recovered organisms was similar to that of the controls. Metrick et al. [7] also reported that recovery of S a l m o n e l l a spp., assessed by ability to grow on a selective medium, was possible from strained-chicken baby food but not from phosphate buffer.

271

0

"

9TSAYE SAYE + 3% NaCI

Figure 4. Effect of plating medium on the recovery of E. coli O157:H7 NCTC 12079 after 15 min treatment in UHT milk at 20~ No - initial number, N - number of survivors.

4-7.8-

"

i

~

I

i

Pressure ( M P a )

0

m 9

,m

A

A

-1 ~"

-2-

\

\

\

\

-4-

\

\

\ N_

\

\

-~ \

~.

-~

10~

=2o0c

\

\

o4ooc

*so~

.~*c 60~

Figure 5. Effect of pressure and temperature, applied simultaneously, on the survival of E. coli O157:H7 NCTC 12079 after 15 min treatment in UHT milk. No = initial number, N - number of survivors. Plating medium = TSAYE.

-70

I

100

--

'P

200

I

300

9

400

"1"

600

I

S00

9

700

Pressure ( M P a )

2.5 C o m b i n e d effect of pressure and t e m p e r a t u r e on the inactivation of pathogens Previous work has shown that certain strains of E. coli O157:H7 were relatively resistant to pressure treatment at 20 ~ C. The application of pressure at different temperatures was therefore investigated as a method to increase the inactivation of this pathogen in UHT milk (Figure 5). The combination treatment acted synergistically and resulted in greater inactivation than either treatment alone. For example, pressure treatment of 400 MPa at 50 ~ C resulted in a 104 fold inactivation compared to < 10 fold inactivation achieved when the pressurisation was carried out at 20 ~ C.

272 3. REFERENCES

1. M.F. Patterson, M. Quinn, R. Simpson and A. Gilmour, A. J. Food Prot., 58, (1995) 524. 2. J.J. MacFarlane, J.J. in Meat Science 3, R. Lawrie, ed., Elsevier Applied Science Publishers, London. 3. D. Knorr, A. Bottcher, H. Dornenburg, M. Eshtiaghi, P. Oxen, A. Richwin, and I. Seyderhelm, in High Pressure and Biotechnology, C. Balny, R. Hayashi, K. Heremans and P. Masson, eds., Colloque INSERM/J. Libbey and Co. Ltd. London 224 (1992) 211. 4. A. Maggi, P. Rovere, S. Gola, and G. Dall'Agilo, Ind. Conserv., 68, (1994) 232. 5. A. Carlez, J-P. Rosec, N. Richard and J-C. Cheftel, Lebensm. Wiss. Technol., 26, (1993) 357. 6. J. Raffalli, J-P. Rosec, A. Carlez, E. Dumay, N. Richard, N. and J-C. Cheftel, Sci. Aliments, 14, (1994) 349. 7. C. Metrick, D.G. Hoover and D. F. Farkas, J. Food Sci., 54, (1989) 1547. 8. M.F. Styles, D.G. Hoover and D.F. Farkas, J. Food Sci., 56, (1991) 1404. 9. T. Shigehisa, T.,Ohmori, A. Saito, S. Taji, S. and R. Hayashi, Int. J. Food Microbiol., 12, (1991) 207. 10. J.L. Smith and D.L. Archer, J. Ind. Microbiol., 3, (1988) 105. 11. A. Carlez, J-P. Rosec, N. Richard and J-C. Cheftel, Lebensm. Wiss. Technol., 27, (1994) 48.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

273

Inactivation of HIV in blood plasma by high hydrostatic pressure T. Shigehisa a, T. Nakagami a, H. Ohno a, T. Otake b, H. Mori b, T. Kawahata b, M. Morimotob and N. Ueba b aResearch and Development Center, Nippon Meat Packers, Inc., Tsukuba, Ibaraki 300-26, Japan bOsaka Prefectual Institute of Public Health, Osaka, Osaka 537, Japan

Abstract The present paper describes (1) inactivation of bacteria, a parasite Trichinella spiralis and enveloped viruses of HCMV and HSV-1, and leakage of enzymes from lysosomes; these phenomena probably occur due to the membrane-conformational alteration induced by high hydrostatic pressure (HHP), and (2)inactivation of HIV to MT-4 cells by HHP; drastic inhibition at 350 MPa for 10 min at 25~ and more than 5-log reduction at 400 MPa. The longer the duration of HHP at 300 MPa, the lower the remaining infective titer of HIV-1. Even at 400 MPa, however, H H did not alter biological activities of plasma proteins except that of factor VIII.

1. O V E R V I E W OF T H E A U T H O R S ' P R E C E D I N G S T U D I E S

High hydrostatic pressure (HHP) treatment induces a number of irreversible changes in food ingredients and concomitants like heat, depending on the magnitude of the pressure; i.e. denaturation of proteins, inactivation of enzymes, physicochemical alteration of starch, textural improvement of meat, inactivation of microorganisms and so forth [1]. The authors examined the effects of HHP on meat-r elated areas as well as other biological phenomena. 1 . 1 . B a c t e r i c i d a l effects of H H P First, we examined whether the HHP treatment could destroy bacteria associated with meat and meat products [2]. Since various species of bacteria can be found on and in the meat, we inoculated each of various species of bacteria, including those which deteriorate meat and meat products as well as pathogens, into aseptically prepared pork slurries, pressurized them for 10 min at room temperature, and

274 enumerated the surviving cells after resuscitation treatments. All the test bacteria were killed by HHP. Based on the pressure sensitivities, the bacteria examined seemed to be divided into two groups" the bacteria which were inactivated at pressures higher than 300-400 MPa and those at higher than 500-600 MPa. "lhe former comprised all gram-negative bacteria including Campylobacter, Pseudomonas, Salmonella, Yersinia and E. coli. ]he latter comprised all gram-positive bacteria including Micrococcus, Staphylococcus and Enterococcus. To illustrate such differences in pressure sensitivities, E. coli and S. aureus were selected as representatives of pressure-labile gram-negative bacteria and pressure-stable gram-positive bacteria, respectively. After the HHP treatment, these bacteria were stained with acridine orange (AO), observed under a fluorescence microscope, and examined for UV absorption spectra of centrifugal supernatant fluid of the supporting media. E. coli cells without the HHP treatment were stained in orange fluorescence, but those pressurized in green. The ratio of the green cells increased as the pressure increased (Fig. 1). It was also noted that the pressurized E. coli leaked A260 substance and the higher the pressure, the more the leakage. With S. aureus, however, HHP induced neither appearance of the green fluorescent cells nor leakage of A260 substance. Since AO complex of double-helix 100 m

Q

50

(P om

0

1

2

3

4

5

6

x 100 MPa Pressure applied

Fig. 1. Effects of high hydrostatic pressure (HHP) on acridine orange (AO) staining of E. coli (circles) and S. aureus (triangles). After each cell suspension in PBS was subjected to the pressure for 10 min at 25~ the cells were fixed with methanol, stained with AO in acetate buffer, pH 4.0, and observed under a fluorescence microscope. Mean ratios of green fluorescent cells to all the cells observed are plotted against the pressure. Reprinted from: T. Shigehisa et al., Int. J. Food Microbiol. 12 (1991) 207.

275 nucleic acid emits green and that of single-stranded one orange and since E. coli leaked A260 substance, it is obvious that E. coli became permeable and leaked cytoplasmic RNA at lower pressure than S. aureus. Such difference in the pressure sensitivity may relate to different membrane constructions of these bacteria; namely, the cell-waU structure of gram-negative microorganisms is more complicated than that of gram-positive ones, and the former seems to be more susceptible to such environmental changes caused by the HHP treatment. There are several possible mechanisms by which bacteria are inactivated on exposure to the pressure; a primary site of injuries induced by HHP may be a membrane. In consequence of such a hypothesis, the authors examined the effects of HHP on other biomembranes, using lysosome [3, 4], Trichinella spiralis [5, 6] and viruses [7]. 1 . 2 . E f f e c t s o f H H P on o t h e r b i o m e b r a n e s of l y s o s o m e s , Trichinella

spiralis and v i r u s e s Meat is prepared by holding carcasses for a few days to weeks at chilling temperatures. Such a process is known as conditioning. Without the conditioning, the muscle cannot become meat, being tender and palatable, smelling good and enhancing our appetite. Although the mechanisms of the conditioning have not fully been explained yet, such lysosomal enzymes as cathepsins and calpain are believed to contribute toward the conditioning. Lysosomes were prepared from bovine fiver, suspended in an isotonic buffer, pressurized, and subfractioned by centrifugation, qhe enzyme activities of the supematant and the residue were determined. It was observed that HHP at 100 to 200 MPa induced destruction of lysosome membranes and leakage of the lysosomal enzymes [4], and that pressurized meat became tender and palatable in a shorter period than did normally conditioned meat [3]. T. spiralis causes trichinellosis, an important food-borne zoonosis. To prevent trichineUosis, treatment of meat by heating, freezing and drying have been widely used to date. The authors showed that the HHP treatment at higher than 200 MPa kills T. spiralis larvae and is a useful alternative to conventional treatments [5]. Histochemical and morphological studies [6] by using hematoxylin-eosin (HE), periodic acid-Schiff (PAS) and Azan staining showed the followings: (1) slight histochemical changes in HE and PAS staining of the larvae pressurized at lower than 200 MPa, (2) blue staining of all tissues of the larvae pressurized at 300 MPa, suggesting that acidophilic tissue degenerated and became basophilic, and (3) decrease and/or distortion of PAS-positive staining of the larvae pressurized at 300 MPa, suggesting that glycogen and/or glycoprotein may have been decomposed. Virologically, viruses are classified on the basis of nucleic acids, DNA or RNA, and of morphology of the viral particles. From the morphological viewpoint, viruses are divided into two categories" nonenveloped and enveloped ones. As the nonenveloped viruses known are polyovirus, hepatitis A virus (HAV), etc. and as

276 enveloped viruses, human cytomegalovirus (HCMV), HSV (human simplex virus), human immunodeficiency virus (HIV), human T cell leukemia virus (HTLV), hepatitis B virus (HBV), etc. The envelopes of the viruses are originated from the membrane of their host cells and requisite for the viruses to infect target cells. Two enveloped viruses (AD 169 strain of HCMV and Seibert strain of HSV-1) and a nonenveloped virus, polyovirus, were selected, pressurized, and then determined for plaque formation units [7]. HCMV and HSV-1 were inactivated by HHP at more than 300 MPa. At more than 400 MPa, the infective titers of HSV-1 and HCMV reduced by more than 7 and 4 logs, respectively (Fig. 2). However, the nonenveloped virus, polyovirus, was not inactivated even at 600 MPa.

|

A

9 ~)~

HSV-1

a 7

HCMV

6 5 4 3

3

2

2

e

1

~ID4-4D-tD 0

1

2

3

4

6

II

x 100 MPa Pressure applied

0

1

2

3

4

S

t

x 100 MPa Pressure applied

Fig. 2. Effects of high hydrostatic pressure ( H H ) on herpes simplex virus type 1 (HSV-1) and human cytomegalovirus (HCMV). qhe virus suspensions were subjected to HHP at 100 to 600 MPa for 10 min at 25~ The infectivities of HSV-1 and HCMV were evaluated by plaque assay. Reprinted from: T. Nakagami et al., J. Virol. Methods, 38 (1992) 255.

The HSV-1 particles were examined by negative-contrast electron microscopy [7]. The HSV-1 particles without the HHP treatment were scarcely disrupted, but those treated by HHP at 300 MPa were mostly disrupted. After allowing adsorption of the pressurized HSV-1 to Vero cells for an hour at 37~ the cells were examined by making ultrathin sections, qhe binding of most virions of untreated HSV-1 to the cell surface was observed, whereas no virion bound to the cell surface after HHP at 300 MPa. These results show that the HHP treatment may have caused configurational change in biomembranes, killing such microorganisms as bacteria [2] and T. spiralis [3, 4], leakage of endogenous enzymes from lysosomes [6] and reduced infectivities of

277 enveloped viruses, HCMV and HSV-1 [7]. The authors were prompted to examine the effect of HHP on infectivity of an enveloped-RNA-virus HIV [8].

2. E F F E C T S O F H H P ON I N F E C T I V I T Y O F HIV HIV causes acquired immunodeficiency syndrome (AIDS) [9], and transmitted from human to human by transfusion with infected but unsterilized blood, by sexual intercourse, etc. HIV infects CD4+-T leukocytes and macrophages, disturbs the immune system, and causes human death. Research on and development of vaccines, monoclonal antibodies, such chemicals as reverse-transcriptase inhibitors like AZT and DDI, protease inhibitors, antisense DNAs, ribozymes as well as gene therapies have intensively been carried out. However, no absolutely effective therapy has been established yet. HIV (a IIIB strain) suspended in 10% FCS was treated at room temperature at various pressures for 10 min or for various durations, qhe infective titers of HIV were assessed by a usual method. 6

m

.

mm

r

5

r~

4

n

.

A 200MPa 0

B

0

Z [.. 0

u

Z

3

~

-2

m

2

o~

>

o1111

~'q

-1

0

1

0

I

l

I

I

J

1O0

200

300

400

500

Pressure

(MPa)

I

I0

i

100

tOO0

Time (min)

Fig. 3. Effects of high hydrostatic pressure (HHP) on human immunodeficiency virus type 1 (HIV-1). Suspensions of the virus (a III B strain) containing 10% fetal calf serum were subjected to HHP at 100 to 500 MPa for 10 min (A) and for 10 to 1,000 min (B) at 25~ qhe infective titers of H1V-1, calculated as a tissue culture infectious dose (TCID), were assessed in MT-4 cells. *: Below the lowest detectable titer of the assay (log TCIDs0/mI<0.5). No: Infective titers of HIV-1 without the HHP treatment. N: Those after the HHP treatment at each

278 HHP at 350 MPa for 10 min drastically reduced the infectivity to the MT-4 cells, and that at greater than 400 MPa reduced its infective titer. HHP at 350 MPa for 10 min drastically reduced the infectivity to more than 5 logs. qhe infective titers of HIV decreased as the duration of HHP treatment increased (Fig. 3) [8].

3. E F F E C T S OF H H P ON B L O O D C O M P O N E N T S

The effects of HHP on blood components were also examined by using commercially available plasma preparations, qhe results showed that lower HHP caused hemolysis and deformation of platelets, but that relatively higher HHP did not inactivate plasma components such as gammaglobulin, thrombin, antithrombin or factor IX, with an exemption of factor VIII. In this connection, heat treatment for 10 h at 60~ of which condition is now being applied to prepare virus-flee plasma preparations, destroyed all the components tested. From these results, it is obvious that the HHP treatment is a promising method applicable to production of virus-free blood plasma and plasma-derived products. With regard to HW, interesting and elegant reports were published by two independent research groups in 1995 [10, 11]. According to their reports, HW in blood circulation decreased and CD4 + lymphocytes increased swiftly in two days after administration of a drug of a reverse-transcriptase inhibitor, NVP. Unfortunately, however, HIV increased and CD4 + lymphocytes decreased thereafter. Such a phenomenon coincided with increase in population of drug-resistant mutants of HIV. If ex-vivo application of the HHP treatment to HIV carriers and AIDS patients is realized and mutation of HW ks overcome, HHP wil be feas~le for treating AIDS, although many problems have remained unsolved.

4. R E F E R E N C E S

R. Hayashi (ed.), Use of High Pressure in Food. San-Ei Shuppan, Kyoto, 1989, (in Japanese). 2 T. Shigehisa et al., Int. J. Food Microbiol., 12 (1991) 207. 3 T. Ohmori et al., Agric. Biol. Chem., 55 (1991) 357. 4 T. Ohmori et al., Biosci. Biotech. Biochem., 56 (1992) 1285. 5 Y. Ohnishi et al., Jpn. J. Parasitol., 41 (1992) 373. 6 Y. Ohnishi et al., Int. J. Parasitol., 24 (1994) 425. 7 T. Nakagami et al., J. Viol. Methods, 38 (1992) 255. 8 T. Nakagami et al., Transfusion (in press). 9 M. A. Nowak and A. J. McMichael, Scientific American, August (1995) 42. 10 X. Wei et al., Nature, 373 (1995) 117. 11 D. D. Ho et al., Nature, 373 (1995) 123.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

279

Advantages, opportunities and challenges of high hydrostatic pressure application to food systems D. Knorr Department of Food Technology, Berlin University of Technology K6nigin-Luise-Str.22, D-14195 Berlin, Germany

Abstract From a food processing/engineering perspective key advantages of high pressure application to food systems are the independence of size and geometry of the samples during processing, possibilities for low temperature treatment and the availability of a waste free, environmentally friendly technology. Opportunities for effective and relevant utilization of the potential of high hydrostatic p r e s s u r e center around p r e s e r v a t i o n processes, product modifications, and processes based on phase transition or membrane permeabilization. Scientific challenges that still need to be overcome are the lack of kinetic data, little understanding of mechanisms involved in high pressure effects on food systems, limited knowledge regarding the role of food constituents and storage related changes of pressure treated products. Technical challenges of commercial application of high pressure technology exist regarding issues dealing with material handling, process optimization, sanitation, cleaning and disinfection as well as package design. Engineering aspects to be dealt with are heat transfer issues temperature distribution in pressure vessels and compressibility differences within complex food systems. 1. ADVANTAGES OF HIGH PRESSURE APPLICATION TO FOOD SYSTFAVIS In addition to advantages of the application of high pressure to foods or food constituents provided in the scientific literature [1-3] which include effects on reaction rates and reaction volumes, membrane permeabilization and influences on phase transitions, the instant transmittance of high pressure throughout food systems and the consequent independence of size and geometry of the sample represents a major advantage over conventional thermal processing where size and geometry can be process limiting factors. For example, size reduction required in conventional thermal processing to improve heat and mass transfer during processing is often accompanied by elevated losses of nutrients and subsequent environmental pollution (i.e. in hot water blanching processes). Such independence of size and geometry of the samples could not only reduce process severity and thus lead to higher product qualities, it could also increase process flexibilities and ultimately revolutionize food processing by making requirements for size reduction of foods (due to processing constraints) obsolete. However, it should be kept in mind that diffe-

280

281 rences in constituents in complex biological systems can result in differences in compressibilities as exemplified in the shift of electron densities within yeast cells upon pressure treatment (Figure 1). Another key advantage of high pressure application is the possibility to perform processing at ambient or even lower temperatures. Indications exist that processing at subzero temperatures can be more effective with regards to inactivation of microorganisms or enzymes [4,5]. Low temperature processing can help to retain nutritional quality and functionality of the raw materials treated and could allow maintenance of consistently low temperatures during postharvest treatment, processing, storage, transportation and distribution periods of the the life cycle of food systems. Finally the fact that high pressure processing is environmentally friendly and a basically waste free technology needs attention. For example, Eshtiaghi and Knorr [6] obtained significantly less leaching of cell constituents after high pressure blanching of potato cubes as compared to hot water blanching. In addition the pressure processing related potential for future omission of size reductions of foods prior to processing could substantially reduce food processing wastes (i.e. resulting from contents of ruptured plant or animal cells or tissues). 2. OPPORTUNITIES OF HIGH HYDROSTATIC PRESSURE FOR FOOD RELATED R & D 2.1. Preservation of foods and related substances A vast amount of empirical information is available regarding the effects of high hydrostatic pressure on a wide range of vegetative microbial cells [5,7,8]. Bottlenecks such as the baroresistance of microorganisms within environments of low water activity [9] could be overcome by combinations with mild heat or by pretreatment with ultrasound (Oxen-Bodenhausen, unpublished data). Work on pathogenic microorganisms is still scarce in the published literature [10] and needs continued attention. Increased pressure resistance of bacterial spores as compared to vegetative cells has been demonstrated repeatedly [7]. Temperature or pressure induced germination of spores and subsequent inactivation of g e r m i n a t i n g or germinated cells by treatment with high pressure or combination processes is one route that is currently being considered [5]. Methodologies have been developed [11] that allow to study germination processes via the release of dipicolinic acid or to monitor germination processes during pressure t r e a t m e n t via absorbance measurements of spores in a pressure cell with optical windows (Figures 2 and 3). Successfull preservation operations often depend on the effective reduction of enzyme activities during processing. Consequently, one of the requirements for high pressure processing should include the effective reduction of undesirable enzyme activities(especially oxidases) to ensure high quality, shelf stable products. A vast amount of information exists dealing with the effects of high pressure on food related enzymes [1,12,13] indicating that certain food enzymes can be reduced by high pressure to a tolerable levels, but also containing a wide range of sometimes conflicting information [14].

282 It seems clear t h a t food constituents are affecting baroresistance of enzymes [13,15,16] and it also seems evident, t h a t when e v a l u a t i n g p r e s s u r e effects on given e n z y m e s y s t e m s u n d e r given conditions, a case by case a p p r o a c h is necessary. i

sapphire window

fitting for photomet

opto.coupled~

totalvolume:20mL Figure 2. Prototype high pressure cell (700 MPa, 0 - 70 ~ C, 0.025 L) with saphire windows opto-coupled to a spectrophotometer.

i....... 20-0-~ CI l .....

[38.5~

J

l

1.05-

| o

-

=

o

~

o.9o

6o

4

\

~

|

oi191~'

f~,. o.96-

0.85

~OM~

O.SO-

- /t~ =

.

0.70 0

1000

2000

300O

Treatment time [s]

40OO

0

1000

2000

i~oo-M-Pa

L I ~J 3000

4000

Treatment time [s]

Figure 3. Relative absorbance of Bacillus subtilis spores (ATCC 9327) d u r i n g pressure t r e a t m e n t at 20 ~ C or 38.5 ~ C measured at 580 n m [11].

283 2.2 Modifications An extensive set of data exists on gelling behavior of proteins, polysaccharides and to some extent also on protein/polysaccharide combinations under high hydrostatic pressure conditions [17,18,19]. Because of the differences in functionality experienced between pressure and temperature induced gels [19], a wide field for product modifications via pressure or pressure/temperature treatments becomes available. Changes in composition and functionality of plant tissues have also been identified. For example hardening of vegetable tissues (Eshtiaghi, unpublished data, [20]) and the formation of solid gels during cold storage of kiwi or strawberry puree (Seyderhelm and Knorr, unpublished data, [21]) has been observed. The most likely explanation seems a pressure induced change of pectins, which could also be caused by residual activities of pressure tolerant enzymes such as pectin esterase. The effects of food constituents on pectin esterase activity are exemplified in Figure 4.

Figure 4. Effects of medium composition (Tris buffer single strenght, orange juice, 30% sucrose solution orange juice concentrate) on the relative activity of added pectin esterase after high pressure (600 MPa, 45~ 10 min) treatment [13]. Within this context it appears also highly interesting to indicate the effects of high pressure on plant cell cultures as model systems for plant foods [22]. Current investigations in our laboratory on the stress response of cultured plant cells to high pressure treatment indicate that treatment at 90 MPa and higher results in instant cell death without subsequent stress reactions of the cell. Lower pressures lead to a time delayed stress response, suggesting pectin degradation and an elicitor effect of such degradation products [23]. 2.3. Phase transition

Pressure induced phase transitions such as crystallization of lipids [24], or thawing, or freezing of high moisture systems [25] offer numerous opportunities for process or product development. However, some engineering challenges such as the rapid removal of the heat of fusion (Figure 5) because of i n s t a n t ice crystal formation during pressure shift freezing and the requirement for studies on the kinetics of ice nucleation, or crystal size, distribution and growth as well as on recrystallization still exist.

284

10

0.o. (D

-400

pressure 3OO

0 - - =~"~',~=~~.

-5

~[_temperatur~

L _

= -10

200 oo oo (D

L _

(D

,', -15 E (D -~ -20

L_

~~[

-100

PF

-25 -30

t~

12.

m

E

0

atmospl~,eric pressure 10 time [min]

I -[ 20

Figure 5. Pressure and temperature conditions during pressure shift freezing of potato cubes [26].

2.4. Membrane permeabilization The permeabilization of membranes of vegetative microbial cells as well as of plant m e m b r a n e s has been demonstrated [22,27,28]. This has led to the inactivation of microbial cells and has opened new opportunities for process development. For example, mass transfer during dehydration of plant tissues [29], during processing of french fries (Figure 6), during pasteurization of strawbwerries (Figure 7), or during high pressure blanching [6] could be affected. Work is under way in our laboratory to attempt to u n d e r t a n d the mechanisms involved in the phenomena observed.

Figure 6. Fat content of pressure blanched, frozen or water blanched (WB), frozen french fries (Esthiaghi and Knorr, unpublished data).

285

Figure 7. Total solids of pressure thawed, pasteurized vs. athmospheric pressure thawed, pasteurized strawberries (Esthiaghi and Knorr, unpublished data). 3. CHAI,I.ENGES FOR HIGH PRESSURE R & D IN FOOD SCIENCE AND TECHNOLOGY

3.1. Scientific challenges Key areas where additional information are required, include the need for kinetic data on the inactivation of microorganisms and enzymes as well as on the changes of food quality and functionality ; a better understanding of the mechanisms involved during high pressure treatment ; experiments clarifying the interactions between food constituents and high pressure effects on food systems ; the necessity to gain more knowledge regarding interactions between high pressure and nutrients, toxins or allergens ; and finally compilation of data during post pressure treatment storage periods of food materials. Attempts are under way to accumulate data on inactivation kinetic of microorganisms : Such information will be essential for regulatory purposes. Time-inactiva-tion curves of a statically pressurized test organism ( B a c i l l u s subtilis ATCC 9372) suspended in Ringer's solution at 20 ~ C typically showed a sigmoid, non-symetric shape when plotted on logaritmic scale (Figure 8). A mathematical description of experimental results was possible by fitting the accumulated Weibull-distribution as a flexible two-parametric function. The resulting, good agreement between predicted and experimental number of survivors makes this aspproach a usefull tool for comparison and development of high pressure processes.

286

250 . .. MPa

~..~ --

Z

i

f/)

-5

,

t

0

,

i 600

R t

!~ 1200

~0 J

l

I

1 1800

24OO

UHP treatment time [s] Figure 8. Typical time-inactivation curve of Bacillus subtilis after high pressure treatment at 250 MPa and 20 ~ C (after Heinz and Knorr [11]). 3.2. T e c h n i c a l / e n g i n e e r i n g

challenges

Technical challenges of commercial application of high pressure technology are, according to Mertens [30], material handling ; package design ; sanitation, cleaning and disinfection of high pressure equipment ; bulk or in-container processing; and "high pressure short time" processing or "low pressure long time" processing. In addition, heat transfer within pressure t r a n s f e r r i n g media ; t e m p e r a t u r e distribution within pressure vessels and pressure distribution within food materials - due to differences in compressibilities because of the complex composition of foods (and other biological systems such as microorganisms) - are engineering issue that require attention. 4. ACKNOWLEDGEMENTS Parts of this work have been funded by grants from the European community (EC-AIR CT92-0296), the German Research Foundation (DFG Kn 260/3-1,3-2,33) and the Research Foundation of the German Food Industry (AIF-FV 8774, AIF-FV 9918). 5. REFERENCES 1 J.C. Cheftel, in : C. Balny, R. Hayashi. K. Heremans and P. Masson (eds), High Pressure and Biotechnology, INSERM/John Libbey-Eurotext, Montrouge-London 224 (1992) 195. 2 R. Hayashi, S. Kunugi, S. Shimada and A. Suzuki (eds.), High Pressure Bioscience, San-Ei Suppan Co., Kyoto, 1994. 3 B. Tauscher, Z. Lebensm. Unters. Forsch., 200 (1995) 3. 4 R. Hayashi, Abstract for ISOPOW 6 Meeting, St. Rosa, CA, March 2-8, 1996. 5 D. Knorr, in : G.W. Gould (ed.), New Methods of Food Preservation, Blackie Academic & Professional, London, 1995, 159.

287 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

29 30

M.N. Eshtiaghi and D. Knorr, J. Food Sci., 58 (1993) 1371. G.W. Gould, in : D.A. Ledward.D.E. Johnston, R.G. Earnshaw and A.P.M. Hasting (eds.), High Pressure Processing of Foods, Nottingham University Press, Nottingham, 1995, 7. D.G. Hoover, Food Technol., 47 (1993) 150. P. Oxen and D. Knorr, Lebensm. Wiss. Technol., 26 (1993) 220. M.F. Patterson, M. Quinn, R. Simpson and A. Gilmour, in : D.A. Ledward, D.E. Johnston, R.G. Earnshaw and A.P.M. Hasting(eds.), High Pressure Processing of Foods, Nottingham University Press, Nottingham, 1995, 47. V. Heinz and D. Knorr, Annual Report, EC project High Pressure Processing of Foods (AIR-CT92 - 0296), 1995. A. Hara, G. Nagahama. A. Ohbayashi and R. Hayashi, Nippin Nogeikagaku Kaishi, 64 (1990) 1025. I. Seyderhelm, S. Boguslawski, G. Michaelis and D. Knorr, J. Food Sci. (in press). M. Anese, M.C. Nicoli, D. Dall'Aglio and C.R. Lerici, J. Food Biochem., 18 (1995) 285. M. Asaka and R. Hayashi, Agric. Biol. Chem., 55 (1991) 2440. H. Ogawa, K. Fukuhisa, J. Kubo and H. Fukumoto, Agric. Biol. Chem., 54 (1990) 1219. C. Balny and P. Masson, Food Rev. Inter., 9 (1993) 611. E. Dumay, M.T. Kalichevsky and J.C. Cheftel, J. Agric. Chem., 42 (1994) 1861. T. Oshima, H. Ushio and C. Koizumi, Trends Food Sci. Technol., 4 (1993) 370. M. Kasai, K. Hatae, A. Shimada and S. Iibuchi, Nippon Shokuhin Kagaku Kogaku Kaishi, 42 (1995) 594. P. Rovere, Tecnol. Aliment., 4 (1995) 1. D. Knorr, Trends Food Sci. Technol., 5 (1994) 328. H. DSrnenburg and D. Knorr, Enzyme Microb. Technol., 17 (1995) 674. W. Buchheim and A.M. Abou E1-Nour, Fat Sci. Technol. 94 (1992) 369. M.T. Kalichevsky, D. Knorr and P.J. Lillford, Trends Food Sci. Technol., 6 (1995) 253. H. Koch, I. Seyderhelm, P. Wille, M.T. Kalichevsky and D. Knorr, Nahrung-Food (submitted). H. DSrnenburg and D. Knorr, Food Biotechnol., 8 (1994) 57. M. Osumi, N. Yamada, M. Sato, H. Kobori, S. Shimada and R. Hayashi, in : C. Balny, R. Hayashi. K. Heremans and P. Masson (eds), High Pressure and Biotechnology, INSERM/John Libbey-Eurotext, Montrouge-London 224 (1992) 9. M.N. Eshtiaghi, R. Stute and D. Knorr, J. Food Sci., 59 (1994) 1168. B. Mertens, in : G.W. Gould (ed.), New Methods of Food Preservation, Blackie Academic & Professional, London, 1995.

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

289

9 1996Elsevier Science B.V. All rights reserved.

Understanding Atsushi Suzuki, Department Umversity

the pressure Ken Kim

of Applied of Niigata,

and

effects on postmortem

muscle

Yoshihide Ikeuchi

Biological Niigata-shi,

Chemistry, Niigata

Faculty 950-21,

of Agriculture,

Japan

Abstract Effects of high pressure treatment on the postmortem musde were investigated in an understanding the mechanism of the pressure-induced tenderization of meat or acceleration of meat conditioning. The modification of actin-myosin interaction as evidenced by changes in ATPase activity and the fragmentation of the myofibrils were observed in myofibrils prepared from the muscles exposed to high pressure. The increase of extractability of connectin and the conversion of a-connectin to ~ were also observed in the pressurized muscle, but the weakemng of the connective tissue as assessed by electron microscopy and thermal analysis was not observed.

1. I N T R O D U C T I O N When an ammal is slaughtered, within a few hours, rigor mortis developes with a contraction of muscle fiberes and an increasing toughness of meat. The meat immediately after death is soft but lacking in good flavor and taste, and the meat in rigor state is no good for cooking and processing because of the toughness and low water-holding capacity. If the meat is helled cool for a few days, the muscle becomes soft again and there is a progressive tenderization of meat over the next several weeks. Thus the most widely used process for tenderization of meat with improvement of flavor and taste is called " conditioning "or " ageing " of the carcass. It is well known that the postmortem tenderization of meat is due from following changes in the muscle during conditiomng ' 1 ) weakemng of actin-

290 myosin interaction line disintegration connectin

; 2) fragmentation ofmyofibrils into short segments due to Z;3)

degradation of the elastic filaments consisting of

; 4) weakening of connective tissue.

This paper describes pressure-effects on the postmortem muscle in an understanding the mechanism of the pressure-induced tenderization of meat or acceleration of meat conditioning. 2. E F F E C T ON TEXTURE Since Macfarlane's observation that a brief exposure ofpre-rigor muscle to high pressure (100 MPa) for a few minutes at ambient temperature (about 35 ~ produced a marked drop in shear value [1], a new tenderization method for meat by high pressure has been reported in a series of paper by Macfarlane [2,3] and others [4-6] . However, there are few papers describing tenderizing effect of high pressure treatment on post-rigor muscle. Bouton et al. [7] suggested that postrigor muscle proved less amenable to such improvement of shear value unless long exposure at high temperature was used. They said that 150 MPa at 60 ~ for 30 min was required for improvement for shear value. Locker and Wild [8] also reported that pressure-heat treatment tenderized post-rigor meat effectively only after considerable period at an elevated temperature. This pressure-heat treatment, however, is no good for meat due to the cooked color caused by pressure and heat. In our laboratory, the effects of high pressure treatment on hardness and elasticity of the post-rigor bovine muscle were investigated. The hardness of the pressurized muscle decreased to 60, 20, and 10 % of the contol (untreated) at 100, 150, and 300 MPa, respectively, whereas sigmficant difference in the elasticity was not observed. This result indicates that brief exposure of post-rigor muscle to high pressure induces the meat tenderization without heat-treatment. In order to clarify the mechanism for pressure-induced tenderization of meat or acceleration of meat conditioning, the following subjects were i n v e s t i g a t e d : l ) pressure effect on modification of actin-myosin interaction ; 2) pressure effect on fragmentation of myofibrils ; 3) pressure effect on conversion of ~-connectin to ~ ; 4) pressure effect on connective tissue.

291 3. E F F E C T ON M O D I F I C A T I O N OF A C T I N - M Y O S I N I N T E R A C T I O N It is well established that actin-myosin interaction and myofibrillar structure are modified during postmortem ageing as evidenced by changes in the ATPase activity of myofibrils. Ouali [9] reported that Mg2+-Ca2+-enhanced ATPase avtivity increased at low ionic strength, whereas it decreased at higher ones as the storage time increased. He concluded that the slope value which quantifies the sensitivity to ionic strength could be an accurate indicator of the degree of ageing of the myofibrillar structure and has been called the Biochemical Index of Myofibrillar Ageing (BIMA). The changes m the BIMA values of the myofibrils prepared from the conditioned and pressurized muscles are shown m Fig. 1. In the conditioned muscle, BIMA value 3.0 gradually increased with the increase of 20 ~ J 1.0

Time stored (day) 3.0

m 2.0

o

5'o

~o

1~0

2~o

storage time and reached about 2.5 times of that from the at-death muscle (Inserted in Fig. 1). The BIMA value of the myofibrils from the pressurized muscles increased with increasing pressure up to 200 MPa and reached to the same level with that of the myofibrils conditioned for 7 days. However, an application of more high pressure (300 MPa) caused remarkable

Pressure applied ( M P a )

Fig. 1. Pressure effect on BIMAvalue,

decrease of BIMA value. The pressure-induced structural changes of the thin filament may be main factor

affecting the BIMA. The application of high pressure to postmortem muscle probably causes the changes in ATPase activity and BIMA value of the myofibrils of the meat in a different manner from that of conditioning, because the drastic structural changes as observed in the myofibrils from the pressurized muscle are not observed in the myofibrils from the conditioned muscle as reported elswhere.

292 4. E F F E C T

ON

FRAGMENTATION

OF

MYOFIBRILS

It is well-known that the myofibrils prepared by homogemzing conditioned muscle were shorter and composed of fewer sarcomeres than those from at-death muscle and that breaks in myofibrils at Z-line were correlated with the increase in meat tenderness. Therefore myofibrillar fragmentation is considered to be useful for predicting meat tenderness. The pressure effects on the degree of fragmentation in myofibrils prepared from the pressurized muscles are shown in Fig. 2. The degree of fragmentation is expressed as % of the number of myofibrillar fragments composed of 1 to 4 sarcomeres to

i00-

f v 80-

the total number of myofibrils observed. The degree of fragmentation, which was less than 10%

in

the

untreated

muscle,

was

accelerated by pressurization and reached over 30, 70, 80, and 90% at 100, 150, 200, and 300 MPa, respectively. The degree of frgmentation, maximal myofibrils

level

6o

40

20

80 to 90 %, is over the of the

naturally

fragmentation occurring

in

of the

0

T

0

I

i

i

~

i

I oo 2o0 30o Pressure applied (MPa)

conditioned muscle. From the results of this Fig.2. Pressure effect on fragmentation fragmentation, a brief exposure of post-rigor of myofibrils.[10] muscle to high pressure seems to be useful for meat tenderization. According to our previous paper[ 10], changes in ultrastructure of the myofibrils prepared from the pressurized muscles were as follows. In the myofibrils prepared from the muscle pressurized at 100 M P a , a contraction of the sarcomeres was observed, and the difference in density between the A-band and I-band became indistinguishable as compared with the control (untreated). Marked rupture of the filamentous structure of the I-band and a loss of the M-line materials were observed in myofibrils from the muscle pressurized at 150 MPa. In the myofibrils from the muscle pressurized at 200 MPa, the structural continuity of the sarcomere was almost completely lost, with broken A- and I-filaments spread over the sarcomere. Complete loss of the M-line and thickening of the Z-fine, probably due to collapse of the I-filament, were also observed. Cleavage of the A-

293 band adding to the many changes already mentioned was observed in myofibrils from the muscle pressurized at 300 MPa. The length of the sarcomere initially contracted by pressurization at 100 MPa seemed to have gradually recovered with the increase of pressure, because of the increasing loss of structural continuity. As already mentioned, fragmentation of the myofibrils during conditioning is derived from breakage of the myofibrils at Z-line, whereas the Z-line in the fragmented myofibrils from the pressurized muscle apparently remained intact. From the ultrastructural observation and SDS-PAGE analysis of myofibrils (data not shown. See ref. 10), the mechanism for the disruption of structural continuity of myofibrils induced by pressurization may be different from that of conditioned muscle. 5. E F F E C T

ON

CONVERSION

OF a - C O N N E C T I N

TO

/~

Recent studies dearly indicate that the elasticity and mechanical stability of skeletal muscle are maintained by a string-like protein that has been designated as connectin (also called titin ). At death, the connectin in muscle exsists as c~connectin (about 3,000 kDa) together with a small amount of its subfragment, -connectin (about 2,000 kDa) [11,12] . ~ -Connectin has been shown to undergo degradation into fi-connectin and 1,200 kDa fragment during the postmortem storage of muscle [13-15]. An entire molecule of c~-connectin spans one half the width of a sarcomere and forms elastic connections between the end of the thick filament and the Z-line [16,17]. The cleavage site converting ~- to /3 -connectin is located in a region in the I-band [18], which indicates that the elastic connections linking the thick filament to the Z-line are cut off with increasing time postmortem. It is obvious that the splitting of connectin is closely associated with the postmortem tenderization of meat [ 19-21]. In a previous study [22], we revealed that a brief exposure of muscle to high pressure could induce the conversion of ~-connectin into /~ -connectin. Since the disruption of peptide bonds should not be induced by high pressure, it is of interest to establish the reason why the conversion of c~- to t3-connectin was caused by pressurization. The results of SDS-PAGE of the whole muscle proteins prepared from the control (untreated) and pressurized muscle samples are shown in Fig. 3. When muscles were exposed to high pressure of 100 to 400 MPa for 10 min, the conversion of ~-connectin into 13-connectin was markedly accelerated by

294 pressurization at 200 MPa, and an approximately 1,200 kDa peptide was observed, accompanied by conversion of ~-connectin to ~-connectin. The conversion of connectin from ~ to ~ was most pronouced at pressure of 300 MPa, however, connectin was relatively resistant to degradation under a pressure of 400 MPa. Nebulin disappeared upon pressurization at 300 MPa, whereas it remained partly intact at 400 MPa. The electrophoretic patterns of myofibrillar proteins prepared from the pressurized myofibrils are shown in Fig. 4A. The effect of high pressure on connectin in the isolated myofibrils was similar to that on connectin inmuscle. To inactivate contaminating calpain, two kinds of protease inhibitor, 1 mM leupeptin and 1 mM E64, were added to the isolated myofibrils. As shown in Fig. 4B, these protease inhibitors completely prevented the degradation of connectin at each stage of pressurization. This result demonstrated that the participation of some endogenous proteases, especially calpain, in the pressure-induced Fig.3. SDS-PAGE of pressurizedmuscles. conversion of c~-connectin to ~.

~: c~-connectin :~ -connectin 1200:1,200 kDa peptide N : nebtflin M :myosin heavy chain

Fig.4. SDS-PAGE of pressurized myofibrils.[23]

295 The direct action of calcium ion on

connectin was investigated in the presence

of both 1 mM leupeptin and 1 mM E64. The densitometric scans of the SDSPAGE gels (Fig. 5) confirmed that connectin in the pressurized myofibrils was almost same as that in the control myofibrils (initial and untreated), O. 2 0

even

though

1

the myofibrils were

pressurized in

the presence of 3

mM CaC12. The degradation of connectin by the direct action of calcium ion under high pressure in this experiment is thus improbable. The data shown in Fig. 3 indicates that the rate of the conversion of c~-

U

O. 1 5

-

O. I 0

--

that the susceptibility of connectin to calpain was markedly increased by the application of pressure, but

I

A

A

U I

C

Et .< o. 0 5 0

.4

9

connectm into/~ -connectin in muscle was not proportional to pressure. This can be interpreted by assuming

i

Mf

+

Inhibitor

Mf

+

Inhibitor

I . 1

ioo

P r e s s u r e

I 200

A p p l i e d

+

Ca

z"

I 300

(MPa)

Fig.5. Effects of Ca2+on a-connectm under high pressure.

the ability of calpain to hydrolyze connectin was gradually reduced with increase of the pressure (See ref. 23). It has been recognized that high pressure of 100 MPa or more denatures protein and increases its susceptibility to proteolysis. Since the calcium ion concentrations in the sarcoplasmic fluid is near optimum for activation of calpain during high pressure treatment, the degree of conversion of -connectin to /~ is thought to be mainly related to the pressure dependences of the structural change of c~-connectin and the inactivation of calpain. The mechamsm for the splitting of connectin under high pressure is probablly the same with that in the muscle during conditiomng (See ref. 24 ). The increase of the extractability of connectin (data not shown) may reflect the quality change of connectm structure in the muscle reduced by pressurization. 6. E F F E C T

ON

CONNECTIVE

TISSUE

Meat tenderness has been resolved at least into two different c o m p o n e n t s "actomyosin toughness "

and

" background toughness " .

Actomyosin

296 toughness is the toughness attributed to the myofibrillar protein, whilst the background toughness is the toughness due to the presence of the connective tissue. Generally it is accepted that changes in the connective tissue during conditioning of meat are only slightly in comparison with those in the myofibrillar protein. There are few papers describing the effects of pressurization on connective tissue as compared with those on myofibrillar proteins. Ratdiff et al. [25] showed that although pressure-heat treatment effectively eliminated the myofibrillar toughness (actomyosin toughness), the tenderness of the treated sample was limited by the connctive tissue toughness (background toughness). Macfarlane et al. [26] also revealed that a transition attributed to F-actin was absent, but that attributed to the connective tissue was not changed in the thermograms of the pressurized muscle. Beilken et al. [27] suggested in a paper describing the effect of pressure during heat treatment on Warner-Bratzler shear force value of beef muscle that pressure treatment at temperatures ranging from 40 to 80 ~ has little or no effect on the background toughness other than to raise the temperature at which heat treatment alone produce a decrease in this toughness. In our previous report [28], we reported that no significant differences in the ultrastructure, electroopboretic pattern, thermal solubility and thermogram of DSC analysis of the isolated intramuscular collagen were observed among the control (untreated) and pressurized muscles. Recentry Nishimura et al. [29] suggested that the weakemng of the intramuscular connective tissues, endomysium and perimysium, caused during extended conditiomng correlated with meat tenderization using scanning electron microscopy. We investigated whether the similar changes as observed in the conditioned muscle were reduced by pressure treatment or not. Scanning electron micrographs of the intramuscular connective tissues in the conditioned and pressurized muscles are shown in Fig. 6. During conditiomng the structural weakening of the endomysium and perimysium proceeded, and the disruption of honeycomb structure was obderved. In the pressurized muscle, deformation of honeycomb structure of endomysium was accelerated with increase of the pressure applied to the muscle, and expansion of the hole of endomysitun was observed in the muscle pressurized at 400 MPa. It is not certain that the pressure-induced structural changes in the intramuscular connective tissue as shown in Fig. 6 may cause some significant effects on meat tenderness or not.

297 (a) untreated (b) 7days conditioned (c) pressurized at 200 MPa (d) pressurized at 400 MPa Scale mark indicates 20.0 tt.

Fig. 6. Pressure effect on intramuscular connective tissure 7. C O N C L U S I O N From the results, it is suggested that an application of a high hydrostatic pressure to postmortem muscle causes tenderization of meat or acceleration of meat conditioning, but the mechanism is not necessarily the same with that of conditioning. 8. R E F E R E N C E S 1 J. J. Macfarlane, J. Food Sci., 38 (1973) 294. 2 J. J. Macfarlane, J. Food Sci., 39 (1974) 542. 3 R.A. Lawrie (ed.), Developments m Meat Science-3, Elsevier Applied Science Publishers, Essex, 1985. 4

W.H. Kennick, 4 (1980) 33.

E.A. Elgasim, Z. A. Holmes,

5 6 7

E./L Elgasim and W. H. Kennick, Food Microstruct., 1 (1982) 74. L.M. Riffero and Z. A. Holmes, J. Food Sci., 48 (1983) 346. P. E. Bouton, A.L. Ford, P.V. Harris, and J. J. Macfarlane, J. Food Sci., 42 (1977) 132. R. H. Locker and D. J. C. Wild,

and P. F. Meyer,

Meat Sci., 10 (1984) 207.

Meat

Sci.,

298 9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

A. Ouali, Meat Sci., 11 (1984) 79. A. Suzuki, M. Watanabe, K. Iwamura, Y. Ikeuchi, and M. Saito, Agric. Biol. Chem., 54 (1990) 3085. K. Wang, J. McClure, and /k Tu, Proc. Natl. Acad. Sci. USA, 76 (1979) 3698. K. Maruyama, S. Kimura, H. Yoshidomi, H.Sawda, and M. Kikuchi, J. Biochm., 95 (1984) 1423. M.L.Lusby, J.F. Ridpath, F.C. Parrish, Jr., and R.M. Robson, J. Food Serf., 48 (1983) 48. N. Seki and T. Watanabe, J. Biochem., 95 (1984) 1161. A. Suzuki, K. Hoshino, E.Sasaki, N. Sano, M. Nakane, Y. Ikeuchi, and M. Saito, Agric. Biol. Chem., 52 (1987) 1439. K. Maruyama, T. Yoshioka, H. Higuchi, K. Ohashi, S. Kimura, and R. Natori, J. Cell Biol., 101 (1985) 2167. D. O. Furst, M. Osborn, R. Nave, and K. Weber, J. Cell Biol., 106 (1988) 1563. S, Kimura, T. Matsumura, S. Ohtsuki, Y. Nakauchi, A. Matsuno, and K. Maruyama, J. Muscle Res. Cell Motfl., 13 (1992) 39. K. Takahashi and H. Saito, J. Biochem., 85 (1979) 1539. B. C. Patterson and F. C. Parrish ,Jr., J. Food Sci., 51 (1986) 876. T. J. Anderson and F. C. Parrish, Jr., J. Food Sci., 54 (1989) 748. K. Kim, Y. Ikeuchi, and A. Suzuki, Meat Sci., 32 (1992) 237. K. Kim, Y. Homma, Y. Ikeuchi, and A. Suzuki, J. Biochem., 114 (1993) 463. K. Kim, Y. Homma, Y. Ikeuchi, and A. Suzuki, Biosci. Biotech. Biochem., 59 (1995) 896. D. Ratcliff, P.E. Bouton, A.L. Ford, P.V. Harris, J.J.Macfarlane, and J. M. O'Shea, J. Food Sci., 42 (1977) 857. J. J. Macfarlane, J.J. Mckenzie, R.H. Turner, and P.N. Jones, Meat Sci., 5 (1981) 307. S. L. Beilken, J.J. Macfarlane, and P.N. Jones, J. Foos Sci., 55 (1990) 15. A. Suzuki, M. Watanabe, Y. Ikeuchi, M. Saito, and K. Takahashi, Meat Sci., 35 (1993) 17. T. Nishimura, A. Hattori, and K. Takahashi, Meat Sci., 39 (1995) 127.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

299

Effects of high pressure on dairy proteins" a review J.C. Cheftel and E. Dumay Unit6 de Biochimie et Technologie Alimentaires, GBSA, Universit6 de MontpeUier II, 34095 Montpellier Cedex 05, France Abstract

Milk processing at 150-400 MPa causes some irreversible fragmentation of casein micelles, together with calcium release, increased milk viscosity, decreased milk turbidity, and decreased non casein nitrogen. The exact changes in individual caseins and whey proteins are not known, but milk pressurization accelerates subsequent casein coagulation by rennet or glucono-6-1actone, and enhances the strength and water-holding capacity of acid-set gels. Processing solutions of B-lactoglobulin (B-Lg) in the same high pressure range causes partial structure denaturation. B-Lg unfolding is more extensive and irreversible at neutral than at acid pH. Above 1% protein, pressure also induces significant B-Lg aggregation into soluble oligomers and polymers linked both by hydrophobic interactions and disulfide bonds. The latter form mainly through SH/S-S interchange reactions. B-Lg proteolysis by thermolysin (pH 7), trypsin or chymotrypsin (pH 8) or pepsin (pH 4) is enhanced under pressure, apparently because of pressure-unfolding of B-Lg. Above 7% or 11% protein, processing at 300-400 MPa and 20-30~ induces the gelation of B-Lg isolate or whey protein concentrate, respectively. Pressure-induced gels (P-gels) are markedly weaker, less elastic and more exudative than corresponding thermal gels (T-gels) (80-90~ 30 rain). Both B-Lg aggregation and gelation are influenced by pressure level, pH, type of buffer used, time under pressure, and presence of additives. P-gels (from 10-14% protein solutions) display a coarsely aggregated spongious texture and a coral-like microstructure with large "pillars" and pores, in contrast to the smooth texture, small protein aggregates and fine branched strands of T-gels. The presence of 5-15% sucrose or 0.1-0.9% w/w polysaccharide (depending on whether pectin, alginate or xanthan is used) reduces or prevents exudation and cancels the spongious texture and porous structure of P-gels. Potential applications of high pressure to dairy products are discussed. 1. CHANGES IN THE STRUCTURE AND BEHAVIOR MICELLES DUE TO PRESSURE PROCESSING OF MILK

OF

CASEIN

Investigations on milk preservation by high pressure began with Hite [1], and several recent publications have dealt with pressure inactivation of microorganisms naturally present or introduced in milk. Milk constituents were found to partially protect vegetative pathogens against pressure inactivation [2, 4], but for example Listeria innocua introduced in dairy cream were still sensitive to pressure [5].

300 High pressure (100-10~ MPa) treatment of milk induces a partial and irreversible fragmentation of casein micelles, as seen after pressure release [6-7]. Fragmentation and related phenomena were mainly observed in a 150-400 MPa range. Chains or clusters of casein submicelles were formed, with a wide size distribution [7]. Milk viscosity increased and milk turbidity decreased (skim milk became translucent). Micellar fragmentation could be reversed by addition of Ca2+ [6] or by heating to 30~ [7]. Micellar fragmentation was accompanied by a release of non ionic calcium and phosphorus (colloidal calcium phosphate) into milk serum. The pH of skim milk also increased by 0.1 pH unit as a result of pressurization [9]. The concentration of free Ca 2§ remained unchanged or increased only slightly [7, 8]. Other investigators [10] obtained similar results upon pressure processing (20~ 22 min) of milk reconstituted from low-heat skim milk powder : the mean hydrodynamic diameter of casein particles, initially close to 200 nm, decreased to 120 nm from 230 to 430 MPa, then remained constant until 700 MPa. Milk turbidity and lightness decreased in parallel to the mean diameter, while dynamic viscosity increased from 1.6 to about 1.9 mPa.s. Non sedimentable calcium increased from 0.43 to 0.6 g/L at 200 MPa, but decreased back to 0.4 g/L at 400 MPa and above. Micellar fragmentation was greater at 5 or 10~ than at 20~ [9]. It is likely that this pressure-induced fragmentation results from the weakening of electrostatic interactions (calcium phosphate clusters) between submicelles, and perhaps also from the rupture of some hydrophobic interactions between casein constituents. Artificial micelles prepared from calcium caseinate were also strongly dissociated by pressure [11]. Increasing the soluble calcium (but not the sodium) concentration before pressurization enhanced the resistance to dissociation, in contrast to increasing the pressure (from 100 to 300 MPa) or the pH (from 6 to 7). Pressure processing of skim milk also increased the number of exposed hydrophobic groups, as measured by enhanced binding of the ANS fluorescent probe [12]. This effect persisted for 8 days at 5~ and could result from micellar casein fragmentation and/or from unfolding of individual protein chains. The content in free SH groups decreased with time at 400 MPa [13]. This appears to indicate that SH groups (present mainly in whey proteins) were oxidized into S-S bonds. Both serum nitrogen (non sedimentable at 70,000 g) and non casein nitrogen (primarily native whey proteins, non precipited at pH 4.6) were found to decrease after pressure processing of milk [12]. For treatment at 300 MPa and above, serum nitrogen became less than the non casein nitrogen content of the control sample. These results suggest that rather than extensive release of the individual caseins (which would be non sedimentable) larger fragments were formed and/or some reaggregation took place. Indeed whey proteins in skim milk were found to be denatured above 200 MPa (at 20~ and reaggregated to casein micelles or submicelles [9]. This is in agreement with g-lactoglobulin denaturation under pressure (next section). In another report [10], an initial increase in non sedimentable nitrogen from 1.5 (control sample) to 2.3 g/L at 200 MPa was followed by a decrease at higher pressure. The effects of high pressure onto individual caseins has not been extensively studied. The depolymerization of B-casein was observed for pressures up to 150 MPa, with a subsequent reassociation of solubilized monomers at higher pressure (300 MPa) [14]. Hydrophobic interactions involved in B-casein polymerization, were supposed to disrupt under moderate pressure up to 150 MPa. Other investigators [15, 16] subjected trypsin- or chymosin-treated B, (Xsl or I( casein to pressure. Protein

301 dissociation took place up to about 150 MPa, while reassociation was observed at 150-300 MPa. This may be due to the higher compressibility of free water as compared to that of protein hydration water. Around 150 MPa, the volume of free water becomes smaller than that of protein-bound water, thus enhancing protein association (accompanied by a conversion of protein-bound water into free water). Alkaline phosphatase in milk is pressure-sensitive above 400 MPa. When raw whole milk was processed for 20 min at 500 or 700 MPa, alkaline phosphatase inactivation reached about 45 or 95%, respectively [8]. 2. PRESSURE-INDUCED B-LACTOGLOBULIN

UNFOLDING

AND

AGGREGATION

OF

Native B-Lg contains 8 B-sheets (representing some 55% of the molecule in 1-7% protein solutions) forming a B-barrel with an affinity for hydrophobic ligands, and one a-helix. This secondary structure does not vary much over a 2 to 10 pH range [17]. The B-Lg monomer has 2 intramolecular S-S bonds and one SH group. Dumay et al. [18] subjected to 450 MPa at 25~ for 15 min a solution of B-Lg isolate containing 2.5 or 5% protein. A 50% reduction in the residual enthalpy (AH) of thermal denaturation was measured by differential scanning calorimetry after pressure release, clearly demonstrating partial unfolding of the secondary/tertiary structure by pressure processing. The AH reduction was partly reversible when the 2.5% protein solution (but not the 5% solution) was kept at 4~ for 24 h after pressure release. Some protection against unfolding was apparent when pressure processing was carded out in the presence of 1-5% sucrose. Dufour et al. [19] have carded out measurements under pressure (intrinsic fluorescence of the tryptophan residues of B-Lg ; fluorescence of added retinol in the B-Lg-retinol complex), using 0.22% solutions of B-Lg in a pH 7 Tris buffer or in a pH 3 acetate buffer. B-Lg was found to unfold in the 150-300 MPa range. Unfolding was extensive and irreversible at pH 7, but much smaller and reversible at pH 3 (B-Lg is also more resistant to heat and to proteolysis at acid than at neutral pH). Dissociation by pressure of the B-Lg-retinol complex was reversible at acid but not at neutral pH. It appears that when unfolding was induced at neutral pH in the presence of N-ethyl maleimide (a blocking agent for SH groups), reversibility was observed after pressure release [20]. It is likely that pressure unfolding at neutral pH enhances the reactivity of the SH group of B-Lg, and that resulting intermolecular disulfide bonds formed through SH/S-S interchange reactions (see below) prevents reversible unfolding. Contrary to that of B-Lg, the secondary structure of bovine serum albumin (= 70% a-helix) was found to be very stable even at 600 MPa, as measured by specific rotation, fluorescence and electrophoresis [21]. This resistance may be due to the 17 intramolecular disulfide bonds of the molecule. Solutions of an industrial B-Lg isolate (86% protein, of which 89% is native B-Lg, 2% ct-lactalbumin, and 7-9% glycomacropeptide) were prepared in water, at pH 7.0, and two protein concentrations (2.5 and 5%) [18]. B-Lg remained largely soluble after processing at 450 MPa (25~ 15 min). However, solubility in 2 M ammonium sulfate was decreased, evidencing pressure-induced aggregation. Some solubles aggregates (36-103 kDa) were observed by gel permeation chromatography. Solutions of the same B-Lg isolate in water, in phosphate buffer (20 or 50 mM), and in pressure-resistant buffers, at a protein concentration of 2.5% w/w and at pH 7.0,

302 were processed at 150, 250, 350 and 450 MPa and 25~ for 15 min, then stored at 4~ for -~ 24 h before analysis [22]. Bis-Tris (20 or 50 mM) and bis-Tris-propane (10, 20 or 50 mM) were selected as pressure-resistant buffers, while the pH of water or phosphate buffer is known to decrease reversibly by 0.2-0.3 pH unit per 100 MPa. Nitrogen solubility at pH 4.7 or 7.0, and aggregation patterns by electrophoresis (PAGE and SDS-PAGE) were determined. Both indicated that aggregation of B-Lg was most extensive in pressure-resistant buffers. Electrophoretic patterns also revealed the progressive formation of dimers to hexamers and of higher polymers of B-Lg as a function of the type and molafity of buffer and of the pressure level. All high molecular weight aggregates and most oligomers disappeared when pressurized solutions were treated with B-mercaptoethanol (MSH) before electrophoresis. Thus pressure induced the formation of intermolecular S-S bonds, especially when the pH was kept close to 7. The determination of free SH groups, plus experiments under N2 or in the presence of NEM, MSH, cysteine or glutathion, indicated that S-S bonds were formed mainly through SH/S-S interchange reactions. 3. PROTEOLYSIS OF ~LACTOGLOBULIN UNDER PRESSURE The effect of high pressure on the proteolysis of whey proteins has also been investigated. Large amounts of whey protein hydrolyzates are produced industrially as hypoallergenic dairy formulae for infants, and pressure may be useful in promoting faster or more complete proteolysis, especially of the main allergen, B-Lg. Using pressure-resistant proteases could also protect against bacterial growth. Hayashi and co-workers [23, 24] have shown that the hydrolysis of pure B-Lg (at 0.5% w/v) by thermolysin was enhanced under pressure, and that B-Lg was selectively hydrolyzed when whey protein concentrate (2, 5 or 10% w/v in water, pH 7) was subjected to thermolysin at 200 MPa and 30~ for 3 h. This, and the resistance of (x-lactalbumin under the same conditions may be due to B-Lg unfolding under pressure, tx-lactalbumin may be stabilized by its 4 S-S bonds. Investigators at the Snow Brand Milk Products Co. [25] found that pressure-processing of whey protein concentrate (10% w/v in water) resulted in selective denaturation of B-Lg (while heat-processing denatured both B-Lg and ct-lactalbumin). Subsequent proteolysis at atmospheric pressure with a mixture of proteases effectively reduced the antigenicity of hydrolyzates, preprocessing at 600 MPa and 28~ (without holding) being as effective as preheating at 60~ for 30 min. Dufour et al. [26] studied the hydrolysis of 0.05% solutions of B-Lg under pressure at 25~ using pepsin at pH 4 (acetate buffer) or thermolysin at pH 7 (Tris buffer). Both proteases are known to be activated under pressure. Hydrolysis was enhanced up to 200 MPa in the case of thermolysin (global AV of proteolysis = - 35 mL/mol), and up to 300 MPa in the case of pepsin (AV = - 45 mL/mol), protease inactivation taking place at higher pressure. Even though thermolysin and pepsin displayed similar cleavage specificity for hydrophobic aminoacid side chains, only thermolysin was able to digest B-Lg at atmospheric pressure (possibly because hydrophobic aminoacids are well buffed at pH 4). Most identified peptic peptides were produced by cleavages in B-turns or other non ordered regions. Increasing pressure increased the rate of hydrolysis by pepsin without changing cleavage specificity, probably because B-Lg did not unfold under pressure at pH 4. In contrast, higher pressure made the N-terminal, and to a smaller extent the C-terminal

303 of B-Lg and the flexible loop at position 56-68, more susceptible to initial proteolysis by thermolysin. This may be due to B-Lg unfolding under pressure at pH 7. B-Lg proteolysis by trypsin or chymotrypsin was also studied under pressure at pH 8 and 370C [27]. 2% w/v solutions of B-Lg variant A, B or AB were used. Tryptic hydrolysis of variant A increased (as measured by released a-amino groups) from 50 to 300 MPa, while chymotryptic hydrolysis of the same variant increased with pressure up to 250 MPa, then remained constant up to 350 MPa. At 300 MPa, no rate differences were observed between variants A and B for both proteases, while variant A was hydrolyzed faster than variant B by both proteases at atmospheric pressure. This may be explained by B-Lg unfolding under pressure for both variants, while the aspartic acid of variant A at position 64 may facilitate protease binding to the native molecule at atmospheric pressure. At relatively high protein contents compatible with industrial processing, pressure application often induces protein aggregation. This may hinder proteolysis, unless proteases are already present at the onset of pressurization (i.e. proteolysis is carried out under pressure, and is not subsequent to protein pressurization). Another point deserving further investigation is the possible increased baroresistance of various proteases in the presence of protein substrates. 4. INFLUENCE OF PRESSURE ON MILK COAGULATION AND GELATION The time necessary for rennet coagulation of milk at 30~ and pH 6.45 was found to be markedly reduced (by 20-40%) by prior pressure processing of whole milk or homogenized whole milk at 200-400 MPa [7, 8 10]. This may be due to micellar fragmentation and to the resulting higher total area of smaller casein particles. Processing at higher pressure increased rennet coagulation time again [8], or had no further effect [7, 10]. The composition and characteristics of these rennet coagulaJgels obtained from pressurized milk were not assessed. The rennet coagulation process was also investigated under pressure (up to 130 MPa) at 30~ starting from skim milk powder diluted to 20% w/v in a 20 mM CaCI2 solution [28]. Initial proteolysis by chymosin (primary phase) was hardly affected. Coagulation time (secondary phase) was doubled at 80 MPa and multiplied by 9 at 130 MPa (as compared to the value at atmospheric pressure), although the residual rennet activity measured after 60 min at 130 MPa was almost unchanged. Gel strength development was also correspondingly slower (except at 40 MPa). In a study of acid-set gels prepared from pressure-treated skim milk using gluconic acid-6-1actone as a progressive acidifying agent, Johnston et al. [29] found that the apparent elastic modulus of the gels, and the force required to break the gels increased up to 9 and 5 fold, respectively, as compared to non pressurized skim milk. It is reported that the gel network displayed more numerous strands and smaller pores than corresponding gels from non pressure-treated milk. The syneresis resistance of the gels was also improved, a property related to the water-holding capacity and protein hydration index of gels. The effects increased with both pressure (up to 600 MPa) and time under pressure (up to 2 h). In a similar manner, using pressurized milk increased 3.5 fold the viscosity of stirred acid-set gels [30]. These effects may be due to micellar casein fragmentation, to increased surface hydrophobicity of the casein constituents, and/or to whey protein aggregation. Desobry-Banon et al. [10] investigated the effects of pressurization of skim milk

304 upon subsequent acidification with glucono-tS-lactone at atmospheric pressure. From pH 5.8, the increase in turbidity was faster for pressurized than for control milk. Coagulation started at pH 5.3 for the former, and only at pH 5.0 for the latter. High pressure may induce the gelation of milk proteins at low temperature and neutral pH in the absence of any coagulating enzyme or gelling agent. Using raw or market milk freeze-concentrated to at least 25% dry solids w/w, Kumeno et al. [31] induced gelation by processing at 300-600 MPa for 5 min at 5~ The gel strength and viscoelasticity were found to increase by adding 10% sucrose to the concentrated milk before pressurization. The gel was characterized by a phase transition at 62-75~ and by high whiteness and brightness. Urea and EDTA inhibited gelation. Solutions at 25% dry solids made from commercial milk powder, or freeze-dried raw milk, did not gel under pressure unless 10% sucrose was added. The effects of high pressure on some types of cheeses have been patented [32], in view of enhancing the rate of ripening. However the complex interplay of pressure effects on microbial inactivation, enzymatic enhancement or inactivation (proteolysis, lipolysis), lipid crystallization, and protein aggregation or gelation requires further investigations before ripening, pasteurization, or stabilization of specific cheeses by pressure becomes a well controlled industrial reality. 5. PRESSURE-INDUCED GELATION OF B.LACTOGLOBULIN OR WHEY PROTEIN CONCENTRATES Aqueous solutions of g-Lg isolate [see 18] containing 10-15% w/w protein and 0-15% w/w sucrose were adjusted to pH 7.0, clarified and deaerated by centrifugation, introduced into polyvinylidene chloride tubings (20 mm in diameter) and processed at 450 MPa and 25~ for 15 min [33]. After storage at 4~ for 24-48 h, pressure-induced gels (P-gels) were fixed and their microstructure examined by scanning electron microscopy (SEM). A 3D "coral-type" network was observed at a magnification of 500, with thick "pillars" delimiting large liquid pores. The size of pillars and pores increased with increasing protein concentration, decreased with increasing sucrose concentration, appearing to be related to the extent of protein aggregation. At higher magnification (up to 20,000), the structure of pillars of some P-gels (>12% protein, no sucrose) was clearly heterogeneous, with "expanded beads" set in a dense matrix of closely packed 20-40 nm particles. Corresponding heat-set gels (T-gels) (87~ 45 min) displayed a regular network of 50-100 nm particles aggregated into fine branched strands. Similar pH 7.0 solutions of B-Lg isolate containing 12% w/w protein, with or without 10% w/w polyol (sucrose, glucose or sorbitol), were pressurized or heated as indicated above [33]. All solutions were almost fully gelled immediately after processing, but P-gels (in contrast to T-gels) underwent progressive syneresis and exudation during storage at 4~ The loss of liquid exudate (30% of total weight after 1 h, 45% after 24 h, in the absence of polyol) was reduced in the presence of polyol. 12 or 17% of the initial protein went to the exudate in soluble form, but the protein concentration of the remaining P-gel fraction increased from an initial 12% to 14 or 18% (with or without polyol, respectively). The rigidity (at 10% compression) of "residual" P-gels was about half that of T-gels (in the absence of polyol) or even lower (with polyol). The rigidity and elasticity index of these P-gels decreased in the following order: no polyol >_ sucrose > sorbitol > glucose. These two mechanical characteristics increased during storage at 4~ in parallel to exudation.

305 The protein solubility of the pressurized B-Lg isolate solutions (gel plus exudate) was determined in the following dissociating solutions 950 mM K phosphate buffer, pH 7.0, without (A) or with (B) 0.5% SDS (without (B) or with (C) 10 mM DTT). In the case of pressurization without polyol, protein solubility exceeded 90% in solution A after 0.6 h storage at 4~ and decreased to 38-60% in solution A or B after 23-144 h, indicating an extensive aggregation of B-Lg. The presence of 10% polyol (specially glucose) enhanced protein solubility. Protein solubility in solution C was high at all times, showing that pressure-induced aggregation and insolubilization of B-Lg were largely due to the formation of intermolecular S-S bonds [33]. When pressurization was carried out at 40~ instead of 25~ protein solubility in solutions A and B dropped to 10%, showing a synergistic effect of temperature and high pressure on the aggregation of B-Lg. Thus, pressurization of B-Lg isolate (12% protein solution) at 450 MPa and 25~ for 15 min, followed by pressure release, induces the immediate formation of a soft gel (with easily solubilized protein constituents). During subsequent chilled storage (20-24 h), intermolecular (hydrophobic ?) interactions and S-S bonds accumulate, and the solubility of protein constituents decreases. This leads to a more rigid and elastic gel network, and to gel syneresis and exudation phenomena. Both steps are partially inhibited by the presence of 10% polyol, glucose exerting a greater "baroprotective" effect than sorbitol or sucrose. When CaCI2 or EDTA was added to B-Lg isolate solutions (5-10 mmoles/kg) before pressurization, it was observed (after 20-24 h at 4~ that both chemicals reduced exudation and protein loss, increasing gel rigidity without changing significantly the elasticity index [33]. Microscopy confirmed that protein aggregation was greater, probably as a result of enhanced hydrophobic interactions at higher ionic strength. Calcium ions were clearly of limited importance in pressureinduced gelation of B-Lg (the initial B-Lg isolate containing only 0.4 g/kg calcium). Van Camp and Huyghebaert [34] prepared gels by pressure processing at 2030~ (usually at 400 MPa, 30 min), or heat processing (80~ 30 min), solutions of a whey protein concentrate in water or in various buffers. At initial protein concentrations of 9 to 18%, P-gels had weaker networks than T-gels, as measured by penetration. Liquid exudation was observed for P-gels, representing 10-20% of the total weight of the initial solution, depending on protein concentration. A minimum pressure of 200 or 400 MPa, combined to a minimum protein content of 16 or 11%, respectively, were necessary for gel formation. Increasing protein concentration, pressure or time generated stronger P-gels. In the pH 4 to 9 range, P-gels were formed at or above pH 6, with a similar gel strength and a coarse texture. Exudation was minimal at pH 8 or 9. Pressure-sensitive buffers (pH 6 or 7 phosphate) reduced the strength of P-gels as compared to Tris and bis-Tris), probably due to the lowering of pH (and the absence of SH/S-S exchange reactions ?) under pressure. At similar pressures and protein contents, P-gels were also obtained from an haemoglobin protein concentrate, but not from a blood plasma or an egg white concentrate. The same P-gels and T-gels of whey protein concentrate (at 11 to 18% protein in 50 mM phosphate buffer, pH 7.0) were compared using various rheological methods [35]. Exudation for P-gels was close to 18% w/w. Non destructive oscillatory rheology indicated that both the elastic storage modulus G' and the viscous loss modulus G" increased with protein concentration (as expected) and were higher for T-gels (80~ 30 min) than for P-gels (400 MPa, 30 min, 20-30~ The higher elasticity of T-gels must reflect a greater number and strength of protein-protein interactions. Creep methods (small sample deformation measured for 10 min after an

306 initial stress, results given as compliance - strain/stress ratio) confirmed the lesser elasticity of P-gels, reflecting a greater ability of polypeptide strands to rearrange between cross-links. Relaxation measurements after large deformation (17 to 33% compression) indicated a faster force decay for P-gels than for T-gels, due to an easier rupture and/or rearrangement of bonds. Stress-strain relationship up to 33% deformation was close to linear for all gels, revealing no fragmentation or excessive compaction during measurement. The "compression modulus" (stress/strain slope) was lower for P-gels than for T-gels, but increased more with protein concentration for P-gels. SEM at magnifications of 500 and 2000 revealed the greater porosity of P-gels, as compared to the compactness of T-gels, thus supporting rheological data. The mechanical properties and microstructure of T- or P-gels from B-lactoglobulin isolate or mixed B-Lg isolate/xanthan solutions were studied at pH 6.85-7.0, at 7 to 17% (w/w) protein, with or without 0.9% (w/w) xanthan [36]. With T-gels, xanthan markedly decreased gel rigidity above 10% protein, and reduced elasticity index and relaxation time (as measured after compression) below 12% protein, thus enhancing the viscous component of the gels. Mixed T-gels containing 14.7-16.4% protein displayed a spread-like creamy texture similar to that of protein-based fat substitutes. A minimum protein concentration of 7.5% was necessary for the formation of P-gels of B-Lg isolate (at 450 MPa). Pressure-induced gelation of B-Lg isolate alone resulted in the previously mentioned sponge-like texture prone to exudation, and to a protein content of gels (13-22%) higher than in the corresponding initial solutions (9-17% protein). These characteristics were prevented by xanthan. Xanthan also increased the elasticity index and the relaxation time of P-gels. SEM indicated that T-gels from B-Lg isolate alone contained protein aggregates linked together into fine strands below 10% protein, and into coarse strands around 15% protein. Xanthan increased the size of aggregates promoting their separation into distinct spherical particles (1-2 lxrn). The specific structure with thick "pillars" and large pores (up to 100 ~tm) observed in P-gels of B-Lg isolate alone was prevented by xanthan. Mixed P-gels and T-gels had similar characteristics, in contrast to P-gels and T-gels of B-Lg isolate alone. Mixed protein/polysaccharide gels prepared by pressure processing solutions containing 12% protein (from B-Lg isolate) and 0.l-l% polysaccharide (high methoxy pectin, low methoxy pectin or alginate) confirm that the presence of small amounts of given polysaccharides efficiently reduces the porosity and increases the water-holding capacity of P-gels of B-Lg [Dumay et al., in preparation]. CONCLUSIONS A basic challenge in the study of pressure effects on proteins at low or moderate temperature is to understand the mechanisms of pressure unfolding, dissociation/ aggregation, hydration and/or gelation under pressure or after pressure release. Little is precisely known concerning the influence of pressure on the various types of protein-protein and protein-water interactions. The reversible dissociation of electrostatic and ionic interactions due to the electrostriction (alignment and volume reduction) of neighboring water molecules is generally accepted. The reversible disruption of hydrophobic interactions (additional hydrophobic surfaces cause more water to assume a tightly packed structure) appears to depend both on the alkyl or aryl nature of the hydrophobic aminoacids involved, and on the pressure level. Hydrogen bonds are apparently reinforced (reversibly) under pressure, since gelatin or agarose gels, with a network stabilized primarily by hydrogen bonds, do not melt

307 under pressure unless the temperature is raised well above their melting point at atmospheric pressure. In addition to NMR or FFIR spectroscopy under pressure, the following approaches may be used for comparing the bonds and interactions involved in pressure or heat-induced aggregation and gelation phenomena: 1) determine the solubility of protein constituents of gels or aggregates in solutions known to disrupt different types of interactions ; 2) promote gel formation in the presence of bond-forming or -breaking agents (Ca 2§ SDS, etc) ; 3) investigate the temperature dependence of rheological properties for solutions or gels containing one or several different macromolecules. Results obtained with pressure-induced gels of l~-Lg are not so different from those resulting from mild heat processing or slow heating rates, and therefore do not fully support the claim of a specific gelation mechanism. This may be due to the fact that the energy required for sample compression to 500 MPa is much smaller than that necessary for heating to 80~ Another challenge that remains to be met concerns the practicality of applying cosily high pressure processing to protein-rich foods or to food proteins, especially in the dairy field. Some potential applications may be listed 9 low temperature "pasteurization" of raw milk, dairy creams [5], fresh curds, dairy spreads, cheese sauces or cheeses prepared from raw or heated milk ; low temperature enzyme inactivation and stabilization of fermented dairy products such as yoghurts [37] or cheeses [32] ; modification of the enzyme activities of lactic acid bacteria [38] ; enhancement of the functional properties of dairy proteins, e.g. water holding capacity, viscosity, emulsifying properties, hydrophobic ligand binding ; stabilization of emulsions by low temperature gelation [39] ; enhancement of fat crystallization for accelerated tempering of dairy cream, butter or ice cream mix [40, 41] ; freezing of dairy products (by fast pressure release) without destabilization of dairy constituents or structures ; improved rennet or acid coagulation of milk ; preparation of dairy gels and emulsions with novel textures and low microbial load (possibly through combined pressure/heat processing) ; high pressure enzyme reactors for preparing protein hydrolyzates (faster operation, lower allergenicity and microbial load, less bitter peptides, more biologically active peptides) ; enhancement of SH/S-S interchange reactions for the covalent binding of cysteine and peptides. REFERENCES

1 2 3 4 5 6 7 8

B.H. Hite. Bull. West Virginia University Agricultural Experiment Station, 58 (1899) 15. M.F. Styles, D.G. Hoover and D.F. Farkas. J. Food Sci., 56 (1991) 1404. M.F. Patterson, M. Quinn, R. Simpson and A. Gilmour. J. Food Protection, 58 (1995) 524. J.C. Cheftel. Food Science and Technology International, 1 (1996) 1. J. Raffalli, J.P. Rosec, A. Carlez, E. Dumay, N. Richard and J.C. Cheftel, Sciences des Aliments, 14 (1994) 349. D.G. Schmidt and W. Buchheim. Milchwissenschaft, 25 (1970) 596. Y. Shibauchi, H. Yamamoto and Y. Sagara. In "High Pressure and Biotechnology", C. Balny, R. Hayashi, K. Heremans and P. Masson (eds), INSERM/ John Libbey Eurotext, Montrouge, p 239 (1992). D.E. Johnston. In "High Pressure Processing of Foods", D.A. Ledward, D.E. Johnston, G.R. Earnshaw and A.P.M. Hasting (eds), Nottingham University Press, Nottingham, chapter 8, p 99 (1995).

308 9

K. Schrader, C.V. Morr and W. Buchheim. Paper presented at the "International Conference on High Pressure Bioscience and Biotechnology", Kyoto, November 5-9 (1995). 10 S. Desobry-Banon, F. Richard and J. Hardy. J. Dairy Sci., 77 (1994) 3267. 11 S.K. Lee, S.G. Anema, K. Schrader and W. Buchheim. Milchwissenschaft, 51 (1996) 17. 12 D.E. Johnston, B.A. Austin and R.J. Murphy. Milchwissenschaft, 47 (1992) 760. 13 D.E. Johnston and R.J. Murphy. In "Food Macromolecules and Colloids", E. Dickinson and D. Lorient (eds), Royal Soc. Chemistry, London, p 134 (1995). 14 T.A.J. Payens and K. Heremans. Biopolymers, 8 (1969) 335. 15 K. Ohmiya, T. Kajino, S. Shimizu and K. Gekko. J. Dairy Res. 56 (1989) 435. 16 K. Ohmiya, T. Kajino, S. Shimizu and K. Gekko. Agric. Biol. Chem. 53 (1989) 1. 17 J.E. Matsuura and M.C. Manning. J. Agric. Food Chem., 42 (1994) 1650. 18 E. Dumay, M. Kalichevsky and J.C. Cheftel. J. Agric. Food Chem., 42 (1994) 1861. 19 E. Dufour, G. Hui Bon Hoa and T. Haertlr. Biochem. Biophys. Acta, 1206 (1994) 166. 20 N. Tanaka and S. Kunugi. Poster presented at the "International Conference on High Pressure Bioscience and Biotechnology", Kyoto, November 5-9 (1995). 21 I. Hayakawa, J. Kajihara, K. Morikawa, M. Oda and Y. Fujio. J. Food Sci., (1992) 288. 22 S. Funtenberger, E. Dumay and J.C. Cheftel. Lebensm. Wiss. Technol., 28 (1995) 410. 23 R. Hayashi, Y. Kawamura and S. Kunugi. J. Food Sci., 52 (1987) 1107. 24 M. Okamoto, R. Hayashi, A. Enomoto, S. Kaminogawa and K. Yamauchi. Agric. Biol. Chem., 55 (1991) 1253. 25 T. Nakamum, H. Sado and Y. Syukunobe. Milchwissenschaft, 48 (1993) 141. 26 E. Dufour, G. Herv6 and T. Haertlr. Biopolymers, 35 (1995) 475. 27 R.W.G. Van Willige and R.J. Fitzgerald. Milchwissenschaft, 50 (1995) 183. 28 K. Ohmiya, K. Fukami, S. Shimizu and K. Gekko. J. Food Sci., 52 (1987) 84. 29 D.E. Johnston, B.A. Austin and R.J. Murphy. Milchwissenschaft, 48 (1993) 206. 30 D.E. Johnston, R.J. Murphy and A.W. Birks. High Pressure Res., 12 (1994) 215. 31 K. Kumeno, N. Nakahama, K. Honma, T. Makino and M. Watanabe. Biosci. Biotech. Biochem., 57 (1993) 750. 32 H. Yokoyama, N. Sawamura and N. Motobayashi. Method for ripening cheese under high pressure. US Patent N ~ 5180596 (1993). 33 J.C. Cheftel, E. Dumay, S. Funtenberger, M. Kalichevsky and D. Zasypkin. Presented at the Symposium "High Pressure Effects on Foods", IXth World Congress of Food Science and Technology, Budapest, August 2 (1995). 34 J. Van Camp and A. Huyghebaert. Lebensm. Wiss. Technol., 28 (1995) 111. 3 5 J. Van Camp and A. Huyghebaert. Food Chem., 54 (1995) 357. 3 6 D. Zasypkin, E. Dumay and J.C. Cheftel. Food Hydrocolloids. 10 (1996) in press. 37 T. Tanaka and K. Hatanaka. Nippon Shokuhin Kogyo Gakkaishi, 39 (1992) 173. 38 H. Miyakawa, K. Anjitsu, N. Ishibashi and S. Shimamura. Biosci. Biotech. Biochem., 58 (1994) 606. 39 E. Dumay, C. Lambert, S. Funtenberger and J.C. Cheftel. Lebensm. Wiss. Technol., 29 (1996) in press. 40 W. Buchheim and A.M.A. El Nour. Fat Science and Technology, 94 (1992) 369. 41 M. Schtitt, E. Frede and W. Buchheim. Kieler Milchwirtschaftliche Forschungsberichte, 47 (1995) 209.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

309

Changes in myosin molecule and its proteolytic subfragments induced by high hydrostatic pressure Katsuhiro Yamamoto Department of Food Science, Rakuno Gakuen University, Ebetsu, Hokkaido 069, Japan

Abstract Turbidities of myosin, heavy meromyosin (HMM), and $1 increased with pressure. Whereas, light meromyosin (LMM) and rod did not show turbidimetric change. Head to head association forming a cluster was observed in HMM as well as myosin. $1 aggregate was larger than that of myosin or HMM. There was no noticeable morphological change in pressurized LMM and rod. $1 was split from unpressurized myosin by chymotryptic digestion in the absence of Ca 2+. After pressurization of myosin, S 1 splitting was suppressed. Hydrophobicities of myosin, HMM, and $1 increased with pressure, while no hydrophobic changes were detected in LMM and rod.

1. I N T R O D U C T I O N

When myosin is pressurized, it forms a gel at low ionic strength [1] or forms an aggregate at high ionic strength [2, 3]. Myosin does not form a gel at high ionic strength upon pressurization at least up to 500 MPa, although heating induces gelation of myosin regardless of ionic strength. Myosin molecule consists of two distinct parts, namely, head and tail. Myosin head is a globular part and it contains actin binding site and ATPase site. The tail of myosin molecule has a fibrous structure and consists of almost 100% of helix [4], and self-association of tails at low ionic strength causes filament formation. Head to head interaction is thought to be involved in pressure-induced gelation [1] or aggregation [2,3], while pressure effect on tail portion of myosin is not well understood. In this study, we investigated biochemical and morphological changes in proteolytic subfragments of myosin in order to make clear pressure effect on myosin molecule. 2. M A T E R I A L S A N D M E T H O D S

Preparation of myosin and itsproteolytic subfragments ~ Myosin was prepared from rabbit back and white portion of hind leg muscles by the method of Offer et al [5]. HMM and LMM were prepared by chymotryptic digestion of myosin and purified according to the method of Weeds and Taylor [6] and Lowey et al [4]. $1 and rod were also prepared by the method of Weeds and Taylor [6].

310 Application of hydrostatic pressure ~ The protein solution dissolved in 0.5 M KC1 and 20 mM Tris-maleate (pH 6.0 or 7.0) at an appropriate concentration was put into a plastic tube, then the tube was firmly sealed with a plug without trapping an air bubble. The sample tube was placed in a pressure vessel filled with water. Application of pressure was done at room temperature. Transmission electron microscopy - - - T h e pressure-treated proteins were diluted to 20 t~g/ml in 0.4 M a m m o n i u m acetate and 50% glycerol (pH 7.2), then sprayed onto freshly cleaved mica and rotary shadowed with p l a t i n u m at an angle of about 6 degrees from a distance of 10 cm. The specimen was observed with a Hitachi H-800 electron microscope at 75 kV. Measurement ofhydrophobicity ~ Hydrophobicity of the protein was measured by the method according to Wicker and Knopp [7]. The pressure-treated protein was diluted to 0.5 mg/ml with 0.5 M KC1, and 8-anilino-l-naphthalenesulfonic acid was added. After 10 minutes of incubation at room temperature, fluorescence intensity was measured and expressed as hydrophobicity. The wavelengths of excitation and emission were 380 and 475 nm, respectively. S D S polyacrylamide gel electrophoresis (SDS-PA GE) ~ SDS-PAGE was carried out as previously described [8].

3. R E S U L T S A N D D I S C U S S I O N

Figure 1 shows the changes in turbidity of myosin and subfragments in 0.5 M KC1 after pressure treatment. For the pH 6 myosin, the turbidity after pressurization at 100 MPa remained at almost the same level as in the case of the unpressurized control. With increasing pressure from 200 to 500 MPa, turbidity increased, and the increase of turbidity is almost proportional to the applied pressure. Most of the turbidimetric change was completed within 2 min of pressurization, and the increase in turbidity from 5 to 30 min being little. The myosin at pH 7 did not show turbidimetric change up to 200 MPa, though the turbidity increased above 200 MPa. The turbidity of the pH 7 myosin was always lower than that of the pH 6 myosin with a specified pressure and duration. Pressure-induced change in turbidity of HMM was similar to that in myosin. At pH 6, the turbidity began to increase above 100 MPa. On the other hand, at pH 7, the turbidity remained at the same level up to 200 MPa, and the turbidity increased above 200 MPa. The increase of turbidity of HMM is more pronounced compared to myosin. In the case of S1, turbidity increase was remarkable. The turbidity of S1 after pressurization at 500 MPa was not measurable, because large aggregates were formed and they precipitated. In contrast to myosin, HMM, and S1 which contain head portion, LMM and rod did not show any noticeable turbidimetric change at least up to 500 MPa regardless of the pH. Pressure-induced morphological changes in HMM, S1, and rod are shown in Figure 2. HMM aggregated with application of pressure, like the case of myosin. With increasing pressure, the aggregates became large. S1 aggregates were quite bigger than those of myosin or HMM. A cluster of myosin aggregate is about 45 to 50 nm in diameter (Fig. 2b, bottom center), while S1 aggregate was about 200 to 350 nm. This is why S1 showed very high turbidity upon pressurization. In contrast to myosin, HMM, and S1, no notable morphological change in rod was observable after application of pressure. Pressurized rod still retained rod-like shape and dispersed separately each other in a microscopic field (Fig. 2c). LMM

311

0.4

"•

I

1

I

0.20

I

" •0.15

0.3

(c)

<_. 0.2

0.10

0.1

P" 0.05

.e [] ,

I

!

0 0.20

I

8

-

5

-

_Z2

~

I

I

I

!

I

200

300

400

0.15

i 'U

I

I

(d)

(b) ~

I

4

_~ O.lO .a

~-

2

0

100

200 Pressure

300 (MPs)

400

;00

0.05

100

Pressure

;00

(MPa)

Figure 1. Pressure-induced turbidimetric changes in (a) myosins (circle) and HMM (square), S1 (b), LMM (c), and rod (d). Proteins dissolved in 0.5 M KC1 at pH 6.0 and pH 7.0 with a protein concentration of 2 mg/ml were pressurized for 10 minutes. After release of pressure, turbidity was measured as absorbance at 350 nm with a 2 mm light path cuvette and converted to 10 mm light path. In (a) and (b), closed and open symbols represent pH 6.0 and pH 7.0, respectively. In (c) and (d), square and circle denote pH 6.0 and pH 7.0, respectively. also did not show any morphological changes with pressure application (data not shown). The appearance of heat-induced myosin aggregates [9,10] and pressure-induced aggregate is quite similar [2]. It is known that hydrophobic interaction is involved in heat-induced aggregation or gelation of myosin [11]. We measured hydrophobicity of pressurized myosin and its subfragments (Figure 3). Myosin and the subfragments containing head, i.e., H M M and S1 showed increase of hydrophobicity with pressure application; however, hydrophobicity reached its maximum value at about 300 MPa and it remained almost the same level from 300 to 500 MPa. On the contrary, LMM and rod did not show any hydrophobic changes at all (data not shown). Chymotryptic subfragment production from myosin depends on the presence and absence of divalent cations as well as salt concentration [12]. Figure 4a indicates degradation pattern of myosin at 0.1 M NaC1 after pressure treatment. The pressure application of myosin was done at 0.5 M NaC1, then the digestion was done at 0.1 M NaC1. At 0.1 M NaC1, splitting of Sl-rod junction occurs in the absence of Ca ~* [12]. Since myosin tails self-associate at low ionic strength, HMM-LMM junction is protected against proteolytic digestion, resulting in preferential splitting of Sl-rod junction. In the presence of Ca 2., Ca ~ binds to LC2, and the CaZ~-bound LC2 shows protective effect against proteolysis of Sl-rod junction. With pressure treatment, Sl-rod splitting was suppressed regardless of

312 the presence and absence of Ca 2+. This suggests that the structure in the vicinity of Sl-rod junction is modified to be resist against chymotryptic digestion.

Figure 2. Electron micrographs of rotary shadowed HMM (a), $1 (b), and rod (c). (a), HMM was pressurized in 0.5 M KC1 at pH 6.0 for 10 min. (b), S1 was pressurized at 300 MPa for 10 min. Bottom center is pressurized myosin at the same pressurizing condition and at pH 6.0, and the magnification is the same as in the S1 micrographs. (c) Rod was pressurized at pH 6.0 and 500 MPa for 10 minutes.

313

~oooLI(a) ~4~176176 I ~ 6000

[

,

,

,

,

l(c) ~176176176 J/ '~176176 r j

8000

,

iooor 0

I

i

I

~

i

0

100

200

300

400

,

i

500

1

0 I

0

100

200

300

Pressure

400

500

600

0

'

'

t

t

i

I

,

100

200

300

400

500

600

(MPa)

Figure 3. Hydrophobicity of myosin (a), HMM (b), and $1 (c) after application of pressure. Proteins were pressurized at the indicated pressure for 10 minutes. Hydrophobicity denotes fluorescence intensity. O, pH 6.0; A, pH 6.5; D, pH 7.0.

Figure 4. SDS-PAGE of chymotryptic digested myosin at 0.1 M NaC1 (a) and 0.5 M NaC1 (b) after pressure treatment. Myosin in 0.5 M NaC1 at pH 6.0 was pressurized at 210 MPa for 10 min. Chymotryptic digestion was done in 0.1 or 0.5 M NaC1 containing 5 mM CaC12 or EDTA. The ratio of chymotrypsin: myosin was 3:1000 (w/w). The reaction was stopped by addition PMSF. Chymotryptic digestion pattern of myosin at 0.5 M NaC1 is shown in Figure 4b. At this ionic strength, myosin tail does not self-associate. As a result, digestion will occur at S 1-rod junction as well as HMM-LMM junction in the

314 absence of CaZ*; therefore, the proteolytic products are $1, rod, HMM, and LMM. In the presence of Ca 2*, Sl-rodjunction is protected by Ca 2* binding to LC2, then HMM-LMM splitting preferentially takes place. When myosin was pressuretreated, S1 production was suppressed in the absence of Ca 2*. This result also indicates structural change in S 1-rod junction. Furthermore, the appearance of LMM bands, which migrated faster than S1, was suppressed in the pressurized myosin. These proteolytic digestion patterns suggest that some conformational changes in the hinge region of myosin molecule, i.e., S 1-rod and HMM-LMM junctions, take place with application of pressure. We reported that myosin ATPase activity decreased with pressure and almost complete loss of the activity occurred at about 200 MPa for pH 6.0 and 300 MPa for pH 7.0 [3]. S1 ATPase activity was also inactivated with pressure. Decrease of ATPase activity was nearly linear up to 150 MPa both at pH 6.0 and 7.0 and no activity was observed after application of pressure above 200 MPa (data not shown). The conclusion of the present study is as follows; (1) structural changes in myosin heads, which involve the increase of hydrophobicity of the surface and loss of ATPase activity, take place with pressure application, (2) pressure effect on the tail of myosin seemed to be little, although some structural changes occurred in the hinge region of the tail. Acknowledgment The author expresses his thanks to Messrs. S. Hayashi and I~ Kobayashi, and Miss Y. Yoshida for technical assistant and professor T. Yasui for critical discussion. 4. R E F E R E N C E S

1 K. Yamamoto, T. Miura, and T. Yasui, Food Structure, 9 (1990) 269. 2 K. Yamamoto, S. Hayashi, and T. Yasui, Biosci. Biotech. Biochem., 57 (1993) 383. 3 K. Yamamoto, Y. Yoshida, J. Morita, and T. Yasui, J. Biochem., 116 (1994) 215. 4 S. Lowey, H.S. Slayter, A.G. Weeds, and H. Baker, J. Mol. Biol., 42 (1969) 1. 5 G. Offer, C. Moos, and R. Starr, J. Mol. Biol., 74 (1973) 653. 6 A.G. Weeds and R.S. Taylor, Nature, 257 (1975) 54. 7 L. Wicker and J.A. Knopp, Arch. Biochem. Biophys., 266 (1988) 452. 8 K. Yamamoto and C. Moos, J. Biol. Chem., 258 (1983) 8395. 9 K. Yamamoto, J. Biochem., 108 (1990) 896. 10 A. Sharp and G. Offer, J. Sci. Food Agric., 58 (1992) 63. 11 L. Wicker, T.C. Lanier, J.A. Knopp, and D.D. Hamann, J. Agr. Food Chem., 37 (1989) 18. 12 A.G. Weeds and B. Pope, J. Mol. Biol., 111 (1977) 129.

R. Hayashiand C. Balny (Editors), High Pressure Bioscienceand Biotechnology

9 1996Elsevier ScienceB.V. All rights reserved.

Dynamic rheological behaviour pressurrized actomyosin

315

and biochemical

properties

of

Y. Ikeuchi, H. T a n j i , K. Kim, N. T a k e d a , T. K a k i m o t o a n d A. S u z u k i Department of Applied Biochemistry, Faculty of Agriculture, Niigata Umversity, Igarashi, Niigata 950-21, Japan Abstract

The nature of heat-induced gelation of actomyosin treated with high pressure was investigated. When actomyosin at 0.6 M KC1 and pH 6.0 was subjected to a pressure of 150 M Pa for 5 min, the dynamic rheological behavior during heat gelation showed a pattern similar to that of myosin. The storage modulus of pressurized actomyosin at 80 ~ was almost double that observed in unpressurized

actomyosin. Analysis

of DNAase I inhibition

capacity of

actomyosin demonstrated that most of the actin in actomyosin in 0.6 M KC1 was denatured by pressures of 150 M Pa. Mg2+-ATPase activity of actomyosin decreased with increasing pressure, whereas Ca2+-ATPase activity was not affected at pressures below 200 M Pa. Both SH content and surface hydrophobicity of actomyosin increased with an increase m pressure.

1. I N T R O D U C T I O N Heat-induced gelation of the salt soluble myofibrillar proteins leads to the formation of a three-dimensional network which exhibits both viscous and elastic properties [1]. Myosin plays a very important role in this gelation process. Actin is also important as a co-factor reinforcing the gel structure of myosin [2]. Needless to say, pressure affects the properties of these proteins, depending on the extend of applied pressure, pH, salt concentration and so on [3,4]. Our study was conducted to clarify the properties of heat-induced gel formation of actomyosin at pH 6.0 with regard to variations in pressure intensity and salt concentration.

316 2. M A T E R I A L S

AND METHODS

Myosin, actomyosin and actin were purified from rabbit skeletal muscle according to the conventional procedures. The sample solution which was vacuumsealed in flexible polyethylene bags was exposed to the pressure ranging from 100 to 300 M Pa for 5 min at low temeprature. We carried out dynamic viscoelasticity measurements of heat-induced gel of pressurized actomyosin or myosin with a cone and plate type viscoelastic meter. Ca2+-activated ATPase and Mg2+-ATPase activities of myosin and actomyosin and DNAase I inbibition capacity of actin after pressure treatment were measured to estimate the denaturation of myosin and actin [5]. Surface hydrophobicity and SH content of pressirized actomyosin was measured accoring to the usual method [6,7]. We also observed changes in the ultrasturucture of actomyosin and myosin after pressure treatment using an electron microscope. Detailed description concermng "Material and Methods" are given in our previous papers [8,9]. 3. R E S U L T S

AND DISCUSSION

Figure la shows changes in storage modulus, loss modulus and loss tangent as a function of temperature. This Figure is a typical dynamic rheological pattern of unpressurized actomyosin at 0.6 M KC1 and pH 6.0. In this case, the G', which represents the elastic component, increased after the first transition at 38 to 48' C, reached a peak, decreased on further rise in temperature to the third transition around 52' C to 60' C, and then increased again until 80' C. When actomyosin was subjected to a pressure of 100 M Pa for 5 min, the decrease in G' in the 52 to 60~ range became apparently smaller (Figure lb). The peak around 48~ almost disappeared under applied pressure of 150 M Pa (Figure lc). The pattern shown in this Figure was quite similar to that of unpressurized or pressurized myosin. This suggestes that the greater part of actin in actomyosin was denatured or depolymerized into G-actin which did not contribute to the heat-induced gel formation of myosin. Yasui et al. [2] showed that a small amount of actin increases the rigidity of myosin gels formed in buffers containing 0.6 M KC1. Therefore, the pressure-associated increase in G' may be due to a decrease m F-actin.

317

~3

0

__

3

0

A

30

40

50

60

70

"

80

30

3 ~2

40

50

60

70

80

0

3

0

-1

2

-2

1

-2

-3

0

-3

1

30

i

!

i

,L

40 50 60 70 Temperature(~

i

80

-4 -I

I

30

I

I

I

I

40 50 60 70 Temperature(~

!

i

O

,2

D

C

o

i

B

-4

80

Figure 1. Dynamicrheological behavior of actomyosin (15 mg/mL) and myosin ( 10 mg/mL) at 0.6 M KC1 and pH 6.0 (20mM sodium phosphate buffer)before and after pressure application. (A) unpressurized actomyosm, (B) actomyosm pressurized at 100 M Pa for 5 mm, (C) actomyosin pressurized at 150 MPa for5 mm, (D) myosm pressured at 150 M Pa for 5 min. (note: unpressurized myosm gave almost the same pattern as pressurized one). (O) storage modulus, G'; (0) loss modulus, G"; (Y) tangent-6. Figure 2 shows the theological p a r a m e t e r s , G', G" and tangent delta, which were observed at 80

~

versus pressure intensity.

The G' and G" values

of

actomyosin linearly increased with increasing pressure in the range of 100 to 200 M Pa, but t h a t further increase in pressure led to a decrease in the gel strength. A fall in the G' at 300 M Pa is probably related to the d e n a t u r a t i o n of both myosin and actin in actomyosin.

There were no significant differences in tangent

delta observed in the p r e s s u r e - t r e a t e d samples.

The G' of myosin alone ,which is

filled circle, scarcely changed over a wide pressure range from 0 to 300 M Pa.

318

G'(Pa) G " ~ . . ~ _ . _ _ _ ~

Tna-5

Figure 2. Dynamic rheological parameters at 80 ~ of actomyosm (open symbols) and myosin (filled symbols) at 0.6 M KC1 and pH 6.0 (20mM

200

-

20

- 0.20 150 100

50

15

(A) loss modulus, G"; (D) tangent-6.

The

0.15

protein concentrations of actomyosm and myosin

0.10

were 15 mg/mL and l0 mg/mL, respectively.

10

5

sodium phosphate buffer) as a function of pressure intensity. (C),Q)storage modulus, G';

0.05 I I 1__ 0.01 100 200 300 Pressure intensity (MPa)

As described above, the dynamic rheological measurements suggested the possibility that pressure-induced denaturation of actin in actomyosin was responsible for the increased storage modulus of pressurized actomyosin. Therefore, we next studied on why pressurized actomyosin shows greater storage modulus than unpressurized actomyosin. Figure 3 shows changes in the percentage of denaturation of actin in actomyosin and F-actin at 0.6 M KC1 and pH 6.0 as a function of pressure intensity, which was measured by

DNAase I inhibition assay. DNAase I inhibition assay

gives

information on how pressure affects the properties of actin in actomyosin [5]. As shown in this figure, a sigmoidal relationship was obtained between the percentage of denaturation of actin in actomyosin and the intensity of pressure applied. The degree of denaturation was accelerated by pressurization, and reached over 40, 75, 80, 90% at 100, 150, 200, 300 M Pa, respectively. In the case of F-actin without ATP, this change occurred more sharply between 100 and 150 M Pa.

Figure 4 shows changes in the remaining Ca 2§ activated and Mg 2§

activated ATPases of actomyosin and myosin at 0.6 M KC1 and pH 6.0 as a function of pressure intensity.

Ca2§

activity is an index of myosin

denaturation in actomyosin and Mg2+-ATPase activity reflects the properties of both actin and myosinin actomyosin. M Pa reduced the Ca2§

The increase in pressure from 100 to 200

activity of actomyosin slowly, and with a further

rise in pressure to 300 M Pa, the remaining activity rapidly diminished to about 25 %. The dependence of the ATPase activity upon pressure was quite similar to

319 t h a t of myosin alone ,which is shown by dotted line.

On the other hand,

the

r e m a i n i n g Mg2+-activated ATPase activity of actomyosin decreased linearly with increasing pressure intensity, indicating t h a t

the d e n a t u r a t i o n of actin in

actomyosin h a p p e n e d during pressure t r e a t m e n t . The results obtained from these biochemical m e a s u r e m e n t s indicate t h a t a c t i n i s more apt to be d e n a t u r e d by p r e s s u r e t h a n myosin as G-actin.

and

a large p a r t of the r e m a i m n g native actin exists

Accordingly, it should be expected t h a t pressure t r e a t m e n t at 100-

150 M Pa would effectively diminish the negative effect of excess a m o u n t of Factin in actomyosin on the gel s t r e n g t h of myosin by denaturing or depolymerizing actin. As a result, pressure t r e a t m e n t increases the heat-induced gel s t r e n g t h of actomyosin but not myosin.

100

I

75

o

75

50

~-

25

0

100

50

~+'

100 200 300 Pressure intensity (MPa)

Figure 3. Changes in the percentage of denaturation of actm in actomyosin and Factm at 0.6 M KC1 and pH 6.0 (20 mM MESNaOH buffer) as a function of pressure mtensity. (O) actm in actomyosm, (A) F.actm. The protein concentrations of actomyosm and F-actm were 15 mg/mL and 2 mg/mL, respectively.

25

-

i I

I

I

100 200 300 Pressure intensity (MPa)

Figure 4. Changes in the remammg Ca 2+activated and Mg2+- activated ATPases of actomyosm and myosin at0.6 MKC1 andpH 6.0 (20 mM MES-NaOH buffer) as a function of pressure intensity. ( O ) Ca2+-ATPase of actomyosin, (D) Ca2+-ATPase of myosin, (A) Mg~+-ATPase of actomyosm.

320 The structure of myosin or actomyosin in the solution, aggregated, filamentous, and solubilized forms, influences its heat-induced gelation.

Then, we observed

the s t a t e of actomyosin in 0.2 M or 0.6 M KC1 and myosin in 0.2 M KC1 i m m e d i a t e l y after pressurized at 150 M Pa for 5 m i n using t r a n s m i s s i o n electron microscope. In Figure 5a, the dispersed myosin f i l a m e n t s and no i n t e r f i l a m e n t o u s association were visible in the application. W i t h pressure

electron microscopic fields before pressure

application

and release, the myosin f i l a m e n t s

gathering into aggregates were observed (Figure 5b). in 0.2 M KC1, the aggregated form was t r a n s f o r m e d

In the case of actomyosin into a structure which was

quite s i m i l a r to t h a t of pressurized myosin (Figure 5c).

This suggested t h a t the

disintegration of actin f i l a m e n t s in actomyosin at 0.2 M KC1 took place under pressure. On the contrary, the structure of actomyosin at 0.6 M KC1 was t r a n s f o r m e d into the aggregated form by pressure t r e a t m e n t (Figures 5e and 5f).

Figure 5. Electron micrographs of myosin and actomyosin at 0.2 M or 0.6 M KC1 and pH 6.0 (20 mM sodium phosphate buffer) before and after pressure application at 150 M Pa for 5 min. All micrographs are of the same magnification (bar-=0.5 pm). (a) myosin at 0.2 M KC1; (b) pressurized myosin at 0.2 M KC1; (c) actomyosin at 0.2 M KC1; (d) pressurized actomyosin at 0.2 M KC1; (e) actomyosin at 0.6 M KC1; (f) pressurized actomyosin at 0.6 M KC1. It should be noted that the samples of myosin and actomyosin shown in (a)-(d) were obtained by directly diluting to final KC1 concentration of 0.2 M without dialysis.

321 Figure 6. Changes m the surface hydrophobicity of myosin, actomyosin and actin at 0.6 M KC1 300

and pH 6.0 (20 mM sodium phosphate buffer) as a function of pressure mtensity. (A) myosin,

-

(O) actomyosin, (m) F-actin. The ordmate

~r

o

mdicates the relative increment against the surface hydrophobicity of unpressurized sample.

200

o

The

.=

concentrations

of

myosin,

actomyosm and F-actin were l0 mg/mL, 15

O (D

protein

mg/mL and 2 mg/mL, respectively.

100

r

I

0 100

200

I

3O0

P r e s s u r e intensity (MPa) M a n y hydrophobic residues and SH amino group buried in the interior of native muscle proteins would be exposed at the molecular surface under pressure, altering the properties of heat-induced gels [ 6, 10l We also m e a s u r e d the surface hydrophobicity and SH content of myosin, actomyosin and actin before and after pressure t r e a t m e n t .

The hydrophobicities

increased with increasing pressure (Figure 6). profile.

of actomyosin and myosin were Actin alone showed an abnormal

That is, it attained maximum at 150 M Pa and decreased sharply with

other pressure intensities. The m a r k e d increase in SH content for myosin was not observed unlike in the case of hydrophobicity (data not shown). of actomyosin increased with increasing pressure intensity.

The SH content

On the other hand,

the SH content of F-actin pressurized at 150 M Pa was more than two fold higher t h a n t h a t of unpressurized F-actin and was maximum in analogy with the case of hydrophobicity.

The decreases in SH content and hydrophobicity over 200 M Pa

is seemed to be due to the aggregation of actin.

Also, the change in the SH

content of actomyosin seems to reflect, on the whole, the change in t h a t of actin in actomyosin because the change in myosin alone was small regardless of pressure intensity.

322 4. C O N C L U S I O N 1. Excellent heat-induced gels of actomyosin at low and high salt concentrations could be produced by pressure treatment. 2. Judging from the data of dynamic rheological measurements, biochemical measurements and electoron microscopic observation, the increased gel strength at high salt concentration (more than 0.6 M KC1) of pressurized actomyosin are probably attributable to pressure-induced denaturation of actin in actomyosin. This is because a large amount of F-actin exhibits negative effect on the heatinduced gelation of myosin at low and high KC1 concentrations according to the Yasui's theory [1]. 3. There is no doubt that increases of hydrophobicity and SH content in actomyosin by pressure are partially responsible for the increased gel strength of pressurized actomyosin [ 11 ]. 5. R E F E R E N C E S 1

A. Asghar, K. Samejima, T. Yasui, CRC Critical Reviews in Food Science and Nutrition, 22 (1985) Issue 1, 27-106. 2 T.Yasui, M. Ishioroshi, K.Samejima, J. Food Biochem., 4 (1980) 61-78. 3 T. Ikkai and T. Ooi, Biochemistry, 8 (1969) 2615-2622. 4 K. Yamamoto, T. Miura, T.Yasui, Food structure, 9 (1990) 269-277. 5 Y. Ikeuchi, T. Iwamura, A. Suzuki, Int. J. Biochem., 23 (1991) 985-989. 6 A. Kato and S. Nakai, Biochim. Biophys. Acta, 624 (1980) 13-20. 7 J. Janatova, J. K. Fuller, M.J. Hunter, J. Biol. Chem., 243 (1968) 3612-3622. 8 Y. Ikeuchi, H.Tanji, K. Kim, A. Suzuki, J. Agric. Food Chem., 40 (1992a) 1751-1755. 9 Y. Ikeuchi, H. Tanji, K. Kim, A. Suzuki, J. Agric. Food Chem., 40 (1992b) 1756-1761. 10 M. Ishioroshi, M. Samejima, Y. Arie, T.Yasui, Agric. Biol. Chem., 44 (1980) 2185-2194. 11 J.E. Kinsella and D.M.Whitehead, Adv. Food Nutr. Res., 33 (1989) 343-438.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

323

The effect of high pressure on skeletal muscle myofibrils and myosin A. J. McArthur and P.Wilding Unilever Research, Colworth Laboratory, Sharnbrook, Bedfordshire MK44 1LQ, UK 1. INTRODUCTION Since the initial work of Bridgman [1] the application of high hydrostatic pressure on biological systems has led to the manufacture of food by high pressure processes [2]. Muscle shows significant changes when subjected to high hydrostatic pressure. Application of pressure to pre-rigor muscle results in tenderisation [3-7], whilst on rigor muscle combined pressure and temperature t r e a t m e n t is necessary for tenderisation [8,9], although high t e m p e r a t u r e t r e a t m e n t may not be necessary [10]. Pressure caused the solubilisation of myofibrillar proteins from isolated myofibrils [11], and this solubilisation depended on the pressure applied [12]. Myosin in solution undergoes several distinct changes with increasing pressure resulting in the formation of aggregates apparently mediated through the globular head domains of the molecule [13]. 2. EXPERIMENTAL

The experimental procedures were as described elsewhere [6]. 3. RESULTS 3.1. Pressure induced solubilisation of myofibrUlar proteins Figure 1. Change in solubility of myofibrillar protein against applied pressure treatment. Reproduced from [16] by kind permission of Oxford University Press.

3O-

v

25-

8

"

~ 2.o-

8(-8

1.5

,

J

~ lOa_

///

ff

/

/"

/

o.5.

0

'

100

200

300

Applied Pressure OVIPa)

400

324 The effect of increasing pressure on the solubility of myofibrillar proteins in the extraction buffer is shown in Figure 1. At a pressure of 100 to 300 MPa an increase in protein solubility in the extraction buffer of about 2mg/ml was observed representing about 30% of the total protein. The solubilised proteins were identified by SDS-PAGE by estimation of molecular weights using the protein standards and data in the literature (Table 1). The number of bands increased with increased pressure and qualitatively followed the observed changes in the solubility. The samples were spiked with v a r y i n g concentrations of the identified proteins and re-analysed. An increase in intensity of a band with no additional appearance of any other bands was taken to confirm the assignment of that band. The soluble proteins are those associated with the structure of thin filament of the myofibril and the myosin light chain sub-units (represented in the table by MLC-1, MLC-2 and MLC-3). Table 1 Proteins identified in the supernatants of myofibril suspensions Control 500 MPa Estimated Assignment Literature Estimated Assignment Molecular Molecular Molecular Weight Weight Weight (kDaltons) (kDaltons) (kDaltons) 104 a-actinin 104 a-actinin 102 44 actin 44 actin 45 38 troponin-T 35 tropomyosin 36 tropomyosin 35 26 troponin-I 23 MLC-1 22 troponin-C 19 MLC-2 14 MLC-3

Literature Molecular Weight (kDaltons) 102 45 37 35 24 25 20 18 15

3.2. Effect of high hydrostatic pressure on the c o n f o r m a t i o n of myofibril proteins When samples of the control and 500 MPa treated myofibril suspensions in extraction buffer were analysed by DSC, the thermograms shown in Figure 2 were obtained. The untreated myofibril sample shows at least two cooperative endothermic transitions at Tmax 53 and 57~ probably due to the major myosin and actin constituents of the myofibril, while the 500 MPa treated sample shows a smaller single transition at Tmax 52~ plus a small broad transition at 55 to 60~ The enthalpy of denaturation was reduced from 8.5 J/g for the control sample to 2.7 J/g for the treated sample. 3.3. Effect of high hydrostatic pressure on the conformation of myosin Thermograms obtained when control and 500 MPa treated dispersions of myosin were analysed by DSC are shown in Figure 3. Two endothermic transitions with Tmax 49~ and 55~ were observed for the control sample. The sample treated at 500 MPa for 15 minutes showed only one endothermic transition at Tmax 51~ The enthalpy of denaturation reduced from 7.9J/g for the control to 4.0J/g for the 500 MPa treated sample.

325

m4~4

f 01-

/-,\

I

~,,~

,//

',.._

//

_ 02,

Temperature(C)

Temperakl'e(C)

Figure 2. Thermograms from control (left) and 500 MPa/15 minutes treated (right) myofibrils.

,:,4=_

~:-

/'~

I'\ ' E,',~,~,-,erm,<"

~:

// i

.... / 4O-

~o :.~

\-

.

.

.

. Temperature

-~,:5 (C)

.

.

.

.

.

.

.

Temperait~

(C)

Figure 3. Thermograms from control (left) and 500 MPa/15 minutes treated (right) myosin suspensions. 4. DISCUSSION The response of biological systems to pressure follows Le Chatelier's Principle and thus we expect pressure to destabilise electrostatic and hydrophobic interactions and have little or no effect on H-bonds. The complexity of the interactions stabilising the native conformation of proteins means that it is not possible to predict the effects of pressure without study of each separate protein in a system. The data presented shows that pressure solubilises significant levels of proteins, primarily from the thin myofilament and partly from the thick myofilament, into a low ionic strength buffer. High levels of salt (0.3-0.6 M) are normally required to achieve this. The pressure treatment therefore causes partial dissociation of the thick and thin myofilaments, suggesting that the proteins solubilised are associated with the filaments by hydrophobic interactions and are destabilised by high pressure. However, a pressure induced conformation change of these or associated molecules rather than weakening of protein-protein interactions may initiate the solubilisation but as the state of the proteins in solution was not investigated so this explanation cannot be substantiated either way. In a previous study [10] high pressure resulted in solubilisation of myosin heavy chain sub-units but there was no indication of this in this study. The DSC data shows that a significant proportion of the myofibrillar protein is altered conformationally by pressure

326 t r e a t m e n t at 500 MPa, but at least one protein or protein domain retains enough order to undergo a cooperative endothermic transition when heated. Previous work [14] has shown that myofibrils and myosin denature thermally by a series of independent processes associated with the major myofibrillar proteins or myosin domains respectively. Pressure induced gelation of myosin in solution is initiated by head to head association and succeeded by aggregation of the helical tail region of myosin [13]. This suggests that the helical tail retains its conformation following the 500 MPa treatment which is f u r t h e r s u b s t a n t i a t e d by the effect of pressure on dispersions of myosin presented here. The broad endothermic transition observed by DSC (Figure 4a) has been assigned to the denaturation of the globular head regions and the more cooperative transition to the helical rod [15]. The data shows that pressure t r e a t m e n t resulted in modification of the myosin head regions and that the transition observed in Figure 4b relates to the helical rod of the myosin molecule although the denaturation temperature was reduced by about 5~ compared to the control, perhaps due to conformational destabilisation. Again, previous work [14] has shown that whilst the domains of myosin thermally d e n a t u r e independently, they are stabilised by each other. The simplest explanation of the observations presented here is that the helical rod domain of myosin, stabilised mainly by hydrogen bonds, is unaffected by the 500MPa treatment, but its denaturation temperature is reduced due to the change in conformation of the head domains. 5. REFERENCES .

2.

.

.

5. .

7. 8. .

10. 11. 12. 13. 14. 15. 16.

P. W. Bridgman, J. Biol. Chem., 19 (1914) 511. C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.) (1992) High Pressure and Biotechnology, J. Libbey/Eurotext, INSERM, London Montrouge, 224, 1992. J.J. MacFarlane, in Developments in Meat Science, R. Lawrie (ed.), Elsevier Applied Science Publishers Ltd., London. 3 (1985) 135. J.J. MacFarlane and D.J. Morton, Meat Sci., 2 (1978) 281. W.H. Kennick, E.A. Elgasim, Z.A. Holmes and P.F. Meyer, Meat Sci., (1980) 33. L.M. Riffero and E.A. Holmes, J. Food Sci., 48 (1983) 346. E.A. Elgasim and W.H. Kennick, Food Microstruct., 1 (1982) 75. P.E. Bouton, A.L. Ford, P.V. Harris, J.J. MacFarlane and J.M. O'Shea, J. Food Sci., 42 (1977) 132. R.H. Locker and D.J.C. Wild D.J.C., Meat Sci., 10 (1984) 207. A. Suzuki, M. Watanabe, K. Iwamura, Y. Ikeuchi, M. Saito, Agric. Biol. Chem. 54 (1990) 3085. J.J. MacFarlane and I.J. McKenzie, J. Food Sci., 41 (1976) 1442. A. Suzuki, N. Suzuki, Y. Ikeuchi and M. Saito, Agric. Biol. Chem., 55 1991) 2467. K. Yamamoto, S. Hayashi, T. Yasui, Biosci. Biotech. Biochem., 57 (1993) 383. D.J. Wright, I.B. Leach and P. Wilding, J. Sci. Fd Agric.,28 (1977) 557. D.J. Wright and P. Wilding P. J. Sci. Fd. Agric., 35 (1984) 357. P. Wilding and A.J. McArthur, Proceedings of 8th International Conference on Gums and Stabilisers (1996), in press.

Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

R.

327

Effect of high pressure treatment on proteolytic system in meat Noriyuki Homma, Yoshihide Ikeuchi and Atsushi Suzuki Department of Applied Biological Chemistry, Faculty of Agriculture, University of Niigata, Niigata-shi, Niigata 950-21, Japan Abstract High hydrostatic pressurization increased the total activities of lysosomal cathepsins and calpains in the muscle. The pressure-induced increase in the amount of cathepsin activities was due to the release of enzymes from lysosomes. On the other hand, the increase of calpain activities was caused by the increase of Ca '+ release from sarcoplasmic reticulum, and inactivation of calpastatin. These increses of activities may result in tenderization of meat.

1. INTRODUCTION Generally, postmortem tendefization of meat during storage is caused by the proteolytic enzymes. Mainly, two enzymic systems(cathepsins and calpains) have been implicated. Catheptic enzymes are released from lysosomes, due to the rupture of lysosomal membranes and may promote ageing by proteolysis of myosin, actin, cractinin, troponin T and troponin I. [1, 2] Calpain removes the Z-disc from myofibrils in the presence of Ca '+ and causes many changes in myofibrillar structure which could be related to increased meat tenderness. [3, 4] High hydrostatic pressurization is one of the new technologies for tenderizing meat or accelerating meat conditioning. The changes in the ultrastructure of the pressurized muscle have been reported by many workers. [5-7] It seemed that the pressureinduced changes in the muscle structure were derived from not only the physical force but also the increase of the proteolytic activity of enzymes in the muscle. Therefore we measured the changes of activity of lysosomal enzymes and calpain system induced by the pressurization. 2. LYSOSOMAL ENZYMES Changes of lysosomal enzyme activity extracted from the pressurized muscle are shown in Fig.1. Activity of acid phosphatase increased with increasing pressure applied to the muscle up to 500 MPa. Activity of cathepsin B, D and L increased up to 400 MPa, then tended to decrease at 500 MPa. Aminopeptidase B decreased with the increasing pressure.

328

Measurements of enzymic activity in the pressurized crude extract, to investigate the pressure effect on the enzymes themselves, showed that all lysosomal enzymes lost their enzymic activity as applied pressure increased. (Fig.2) Acid

Phosphat

s

)

Acid P h o ~ p ~ a t a s e Cathepsi Cathepsin L

Cathepsin Cathepsin

B

50.

_l

L

Cathepsi;

Aminopep

Cathepsin Cathepsin (Aminopeptidas

Aminopeptidase

C ~

1~

2~

3~

4~

i

ase

B

Cathepsin ~ (Aminopepti ase

B

ConUol

5~

100

200

300

400

B)

500

Pressure ( MPa )

Press~e(MPa)

Fig.2.Changes of the enzymic ability in the pressurized crude extract.

Fig.l.Changes of enzyme activity extracted from pressurized muscle.

When the pressurized extracts were subjected to the gel-filtration chromatography (Fig. 3), a decrease in the activity of aminopeptidase B and an increase in the activities of cathepsin B and L and acid phosphatase were observed. It seems that the decrease in activity of the enzymes eluted early from the column (aminopeptidase B) is due to the decrease of the amount of the eluted protein,whereas the increase of activity of the enzymes eluted late (cathepsin B, L and acid phosphatase) is due to the increase of the amount of the protein eluted. Cathepsin 3o

eC o 03

Cathepsin

B

on

r

,o

@Control

L

Aminopeptidase 41

a

~

B

eControl

Acid 0.~

30OHPa

20

Phosphatase

eControl 03

a

v o~

i,o o

io

is

2o

2s

Frlclmn numOeq

30

io

Is Fractk~

2o

zs

3o

number

Io

is Fr

20

2S

numbl~

3O

1~

15

2O

2S

3O

Fr~llon number

Fig.3.Gel filtration chromatographs and enzymes activities of crude extract from control and pressurized muscle.

to

15

20

zs

30

Friction mm~e*

329 These restllts showed that the substances of large molecular weight tended to be degraded by the pressure treatment, and the amount of activity was influenced by amount of eluted protein solution in each fraction. Therefore, it was concluted that the pressure-induced increase in the amount of cathepsin activities was due to the release of enzymes from lysosomes. This increse might result in tenderization of meat.

3. CALPAIN SYSTEMS The changes of /.z-, m-calpain and calpastatin levels in the pressurized rabbit muscle are shown in Fig.4 and Table 1. Calpains and calpastatin (specific inhibitor) lost their activity with increasing pressure, but the degree of loss was different for each. Calpains resisted changes in pressurization at 200MPa and were inactivated over 200 MPa. Inactivation of calpastatin at 100MPa was faster than that of calpains. Cont 6.0

9 Inhibit

co

o r 7"

i

i

200MPa

"~

m t

,'"

/

I'

.

o.

.

.

60

.

70

;"~

~_

80

90

100

_~.

110

......

120

Inhibitor

6"O-'le

m

~

130

140

-o.1

,o

. o . 5 .~

"~

~

~o

o

150

o

" ol.

,

60

,

70

~

~

80

100

110

100MPa

300MPa -

~.

-0.2 -,.o ~

~

~

80

90

-5o

-o.1 -o.s~i

100

110

FRACTION NUMBER

120

130

140

1500

LO

-0

i

0.3 -I.5

[

120

130

140

100

0.2 -1.0 ~IE

.~

o.,

-

- o . 5 ~_

il~ o

-0 90

FRACTION NUMBER

.

/"

"

FRACTION NUMBER

,-"

70

,- I 0

//

/

60

"1.5

;T

"

~,

-0.3

150

"'"" ,.o

~

,-"" ~

o-L

, 60

, 70

a--80

~ 90

~ e ~ - - * - - " r 100 110 120 130

~-0.1

140

150

-o.5

-9

o '-o

FRACTION NUMBER

Fig.4.Elution profile of DEAE-Sephacel of the extract from muscle. Comparatively, Zz-calpain appeared to decrease more than m-calpain at 200MPa pressurization. It was considered as follows. At 200MPa, which had no effect on m-calpain,the level of /_z-calpain decreased rapidly, because in the pressurized muscle, Ca 2, concentration was probably increased so far as /_z-calpain was activated.

330 In short, at 200MPa, r activated by an increase in Ca ~§ may have decreased thep level of Zz-calpain by autolysis. Suzuki et al. [8] presented direct evidence for the pressure-induced Ca '.+ release from sarcoplasmic reticulum from electron micrographs of the pyroanthimonate-fixed fiber bundles prepared from pressurized muscles. Emori [9] reported that the primary structures of the /.z- and m-calpain large subunits were similar to one another. On the basis of these reports, it was difficult to accept that the two calpains had a different ability to withstand pressurization. From the results,it was concluded that calpain levels remained in muscle pressurized up to 200 MPa, whereas calpastatin level in the muscle was decreased and Ca ~+ concentration increased by the pressurization. Therefore,the total activities of calpains in the pressurized muscle were increased, and could result in tenderization of meat. P?essure Applied

=-Calpain

Control

100

m-Calpain 100

Calpastatin 100

IOOMPa

55.9

96.4

39.6

200MPa

5.4

99.5

14.5

300MPa

1.6

8.2

Values are calculated

the on

in the

vitro basis

activities of the

Table 1 Relative levels of calpain and calpastatin after pressurization

4.3 of each chromatographs.

peak,

4. CONCLUSION From the results, it was concluded that the pressure-induced increase in the amount of protease activity was due to the release of the enzymes from lysosomes. And total activities of calpains in the pressurized muscle were increased by the pressure treatment. These increase of activity may result in tenderization of meat. 5. REFERENCES

1 W. N. Schwartz and J. W. C. Bird, Biochem. J., 167 (1977) 811. 2 A. Okitani, U. Matsukura, H. Kato and M. Fujimaki, J. Biochem., 87 (1980) 1133. 3 D. E. Goll, M. H. Stromer, D. G. Olson, W. R. Dayton, A. Suzuld and R. M. Robson, Proc.of the Meat Industry Res. Conf., Am. Meat Inst. Found. Arlington, Virginia, 1974 4 A. Suzuld and D. E. Goll, Agric. Biol. Chem., 38 (1974) 2167. 5 J. J. Macfarlane, Developments in Meat Science-3(R. A. Lawrie, ed. ), Elsevier Applied Science Publishers, Barking, Essex, 1985 6 E. A. Elgasim and W. H. Kennick, Food Microstructure, 1 (1982) 75. 7 A. Suzuki, K. Kim, N. Homma, Y. Ikeuchi and M. Saito, High Pressure and Biotechnology. (C.Balny et al., eds.), Colloques INSERM/John Libbey Eurotext, Montrouge, 1992 8 Y. Emori, H. Kawasaki, S. Imajoh, S. Kawashima and K. Suzuki, J. Biol. Chem., 261 (1986) 9472. 9 A. Suzuki, A. Okamoto, Y. Ikeuchi and M. Saito, Biosci. Biotech. Biochem., 57 (1993) 862.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

331

High pressure effects on emulsified fats W. Buchheim, M. Schiitt and E. Frede Federal Dairy Research Centre, POB 6069, 24121 Kiel, Germany

Abstract

The crystallization behaviour of edible fats/oils which represent complex mixtures of triglycerides is not only dependent on chemical composition, temperature/ time treatment but also on factors like thermal history and on whether such a fat is finely dispersed (o/w emulsion) or present in a continous phase. By application of high pressure, crystallization of fats can be accelerated because solid/liquid transition temperatures are shifted to higher values. The effects of pressure, temperature, time, thermal pretreatment and degree of dispersion were studied with milkfat emulsions of constant fat composition using low resolution pulsed NMR for measuring the solid fat content (SFC) under isothermal conditions after the pressure treatment. An equivalence relationship was derived between pressure-induced and purely temperature-induced crystallization processes.

1. I N T R O D U C T I O N

Chemically pure triglycerides exhibit exact phase transition temperatures depending on the type of polymorphic crystal form, i. e. r ~' or ~. Natural fats/oils of animal or vegetable origin like milkfat or coconut oil, however, represent mixtures of numerous triglycerides which results in a complex crystallization and melting behaviour extending over a more or less broad temperature range [1, 2]. Although natural fats turn completely liquid at distinct temperatures, the so-called clearpoints, a characteristic proportion of the fat crystallizes only after sufficiently long tempering, commonly referred to as solid fat content (SFC). Such fats/oils crystallize in a different way depending on whether they are present in bulk or in a finely dispersed state, i. e. as an o/w-type emulsion. The crystallization in the small emulsion droplets depends on the presence of crystal nuclei. In general, emulsified fats/ oils require deeper cooling and/or longer tempering as compared to bulk fats in order to obtain a given SFC. Time consuming fat crystallization procedures are therefore often applied as, e. g., for the treatment of dairy cream or of ice cream emulsions. It is known that pressure affects the solid-liquid transitions of alkanes [3] and phospholipids [4] by increasing the melting temperature by about 0.25 K per MPa. For a natural fat, i. e. cocoa butter, which has a comparably narrow melting range

332 an increase of melting temperature by 0.14 K per MPa has been measured [5]. First studies on the pressure-induced crystallization of emulsified milkfat showed that at 23 ~ pressures around 300 MPa exhibited a m a x i m u m effect on fat crystallization [6].

2. M A T E R I A L S A N D M E T H O D S For most experiments a commercial ultra-high-temperature (U. H. T.) sterilized dairy whipping cream (200 g units) with 30 % fat and a fat droplet mean diameter (d43) of approx. 4 tLm was used. Such a sterile model emulsion system of defined fat composition and fat droplet size has a sufficiently long shelf life (up to 3 - 4 months) to be repeatedly used for crystallization measurements. For some comparative experiments also a U. H. T. sterilized dairy coffee cream (10 % fat) with a fat droplet mean diameter of approx. 0.5 tLm was used. Samples of 5 to 10 ml were sealed in polyethylen foils, heated above the clear-point of the fat to 37 ~ or to 60 ~ for 10 rain in order to ensure complete melting and then inserted into a temperature-controlled autoclave system with hydraulic oil as pressure-transfer medium. The pressure holding time was 15 min in most trials. SFC was determined by low resolution pulsed nuclear magnetic resonance (NMR) spectrometry (NMS - 20, Bruker, Karlsruhe, Germany) equipped with a temperature-controlled probehead [7]. 6 pulses were accumulated at a repetition time (relaxation delay) of 3 s. The SFC was calculated from the accumulated NMR signal according to the direct method [8] taking into account the fat content and the signal coming from the aqueous phase. All NMR measurements were made at ambient pressure, 5 to 65 min after decompression but keeping the temperature of the cream sample at constant value. The microstructure of the emulsion systems was studied by transmission electron microscopy (TEM) using the freeze-fracture technique [6].

3. R E S U L T S A N D D I S C U S S I O N The following figures reflect the courses of isothermal crystallization at different pressures (Fig. 1), temperatures (Fig. 2) and thermal pretreatments (Fig. 3). Fig. 1 shows 4 isotherms at 16 ~ for cream samples having been pressure-treated at 100, 200 and 400 MPa for 15 min as well as the control sample (0.1 MPa). All 4 SFC curves seem to follow an exponential expression indicating similar mechanisms of crystallization processes. Whereas the crystallization of the control sample started approx. 30 min after reaching the temperature of 16 ~ the pressure-treated creams showed considerable SFCs already after 20 min, i. e. 5 min after decompression. A 200 MPa treatment resulted in higher SFCs as compared to the 100 or 400 MPa treatment. This finding is in accordance with earlier studies done at 23 ~ [6]. The lower fat crystallization at higher pressures, i.e. beyond approx. 350 MPa, is probably due to a reduced crystal growth during the pressure period because of somewhat reduced molecular mobility at too high pressures.

333

Figure 3. Effect of different thermal pretreatment on the pressure-induced fat crystallization (400 MPa/15 min/20 ~

Figure 4. Effect of different degrees of fat dispersion (mean diam. 4 t~m (cream) or 0.5 t~m (homog. cream) on pressure-induced fat crystallization (100 MPa/15 rain/15 ~

Fig. 2 gives the courses of isothermal crystallization after a 200 MPa/15 min treatment performed at 3 different temperatures (10/16/24 ~ At 24 ~ and ambient pressure the emulsified fat, previously held at 60 ~ keeps liquid for longer periods up to several days although non-emulsified fat would start to crystallize under these conditions. The application of 200 MPa, however, induces fat crystallization at all 3 temperatures which further proceeds after decompression towards a temperature-specific equilibrium value. At 16 and 10 ~ crystallization takes also place at ambient pressure as is shown by the dotted curves in Fig. 2. The distance between the two 10 ~ is smaller as compared to the corresponding 16 ~ Analogously, at ambient pressure the SFC increases also more

334 strongly after cooling the fat by the same extent from 16 ~ than from 10 ~ Alltogether these measurements demonstrate that certain SFCs may be realized by less cooling and time expenditure than under ambient pressure. The effect of different thermal pretreatment (37 ~ versus 60 ~ on subsequent fat crystallization after the same pressure treatment (400 MPa/15 rain/20 ~ is demonstrated in Fig. 3. The significantly higher SFCs for the 37 ~ as compared to the 60 ~ are probably due to the persistance of some ordered domains in the melted state unless a fat is heated significantly, i.e. 20 - 30 K, above its clear-point [9, 10]. These ordered domains may become active crystal nuclei under high pressure in a similar way as under ambient pressure and a lower temperature. When comparing two milkfat emulsions of identical fat composition and the same fat content but distinctly different average fat droplet size (4 ttm versus 0.5 tLm) the strongly delayed fat crystallization in the finer emulsion both at ambient pressure and after high pressure treatment is obvious (Fig. 4). For possible practical applications of high pressure-induced fat crystallization a dramatic shortening of crystallization times as, e. g., during the so-called ageing of ice cream mixes may be an attractive aim.

Figure 5. Equivalence of a thermal treatment at ambient pressure (5, (6) or 7 ~ 15 min ~ 15 ~ and pressure treatment (100 MPa/15 min/15 ~ for obtaining similar SFC (NMR) values in dairy cream.

Finally, comparative experiments were performed to derive equivalent temperature/time treatments at ambient pressure and at high pressure in order to obtain similar SFCs for the same emulsion system. In one experiment a cream sample was held at 16 ~ under 100 MPa for 15 min whereas other cream samples were cooled down rapidly to 5, 6 and 7 ~ then held for 15 min before rewarming to 16 ~ As Fig. 5 shows, the SFCs measured for the 0.1 MPa/6 ~ min-treatment (although not drawn in this figure for the sake of clarity) would have corresponded rather exactly to the 100 MPa/16 ~ min-treatment. Thus an equivalence exists between pressure and purely thermal treatments, i. e. application of 100 MPa corresponds to 10 K cooling. This finding was largely confirmed by another experi-

335 ment, i.e. starting at 50 ~ and an inital pressure of 300 MPa, then cooling the autoclave system continuously down to 16 ~ within approx. 26 rain. When the applied pressure was gradually reduced at a rate of 100 MPa per 11 K of temperature reduction the final SFC was almost identical to that of a control sample kept at 16 ~ and ambient pressure for the same period of time. The TEM analysis of the various cream samples (Fig. 6) demonstrated clearly the pressure-induced crystallization processes within the emulsion droplets. However, no basic differences were detected in crystal morphology as compared to temperature-induced crystallization at ambient pressure. On the other hand, it could be seen that the application of pressures up to at least 400 MPa did not destabilize the emulsion systems studied.

Figure 6. TEM micrographs of dairy cream (30 % fat) (a) before and (b) after pressure treatment (400 MPa/24 ~ min).

4. C O N C L U S I O N S It has been demonstrated that the application of high pressure (100 - 400 MPa) to o/w-type emulsions of edible fats/oils results in an initiation or acceleration of fat crystallization which proceeds after decompression until the temperature-specific solid fat content (SFC) is reached. High pressure treatment is thus principally suited to overcome the phenomenon of supercooling in o/w-type emulsions. The pressure-induced fat crystallization depends strongly on temperature and on pressure but a reversed tendency is observed beyond a certain pressure value. Furthermore, the fat composition (melting behaviour), the degree of dispersion (mean droplet size) and also the thermal pretreatment, i.e. heating above the clear-point of the fat, are of decisive importance. For the milkfat emulsions under study there exists an equivalence between

336 pressure-induced and temperature-induced crystallization processes, i. e. application of 100 MPa pressure leads to similar quantitative crystallization as a cooling (at ambient pressure) by 10 - 11 K for the same period of time. This equivalence relationship may allow optimal pressure-temperature-time regimes to be designed for obtaining a defined fat crystallization in an emulsion of given fat composition and droplet size distribution. Because the liquid/solid transition temperature of water is decreasing under pressure it is thus possible to realize crystallization conditions by pressure application (e. g. 400 MPa at 10 ~ which would correspond to a purely thermal treatment at ambient pressure, i.e. cooling to -30 ~ which cannot be made without freezing of the aqueous phase and the risk of subsequent destabilization of the emulsion. The pressure-temperature equivalence relationship also facilitates the interpretation of the finding that pressures beyond a certain value, i.e. approx. 350 MPa for milkfat, result in less crystallization. Most probably the mobility of the various triglyceride species is reduced similar to shock-cooling to a temperature range were amorphous solidification of such systems increasingly takes place. Finally, it should be mentioned that the application of high pressure to O/W emulsion systems other than the dairy emulsions studied may affect interfacial phenomena like protein desorption in the presence of low molecular weight surfactants and, subsequently, desired or undesired destabilization processes, e.g. in ice cream emulsions [11, 12]. Also pressure-induced equilibrium changes within the aqueous phases of O/W emulsions have to be considered (see, e.g., the paper of K. Schrader et al. in this volume).

5. R E F E R E N C E S

1

P. Walstra, R. Jenness, Dairy Chemistry and Physics, John Wiley & Sons, New York (1984). 2 P.J. Moran, K. K. Rajah, eds., Fats in Food Products, Blackie Academic & Professional, London, 1994. 3 A. Wfirflinger, Ber. Bunsenges. Physik. Chem. 79 (1975) 1195. 4 N.I. Liu, R. L. Kay, Biochemistry 16 (1977) 3484. 5 A. Yasuda, K. Mochizuki, in: High Pressure and Biotechnology (C. Balny, R. Hayashi, K. Heremans, P. Masson, eds.) Colloque INSERM/John Libbey Eurotext, London, 224 (1992) 255. 6 W. Buchheim, A. Abou E1-Nour, Fat Sci. Technol. 94 (1992) 369. 7 M. Schiitt, E. Frede, W. Buchheim, Kieler Milchw. Forsch. Ber. 47 (1995) 209. 8 E. Frede, Kieler Milchw. Forsch. Ber. 42 (1990) 197. 9 K. Larsson, Fette. Seifen. Anstrichm. 74 (1972) 136. 10 L. Hernqvist, Fette. Seifen. Anstrichm. 86 (1984) 197. 11 K. Larsson, E. D. Friberg, eds., Food Emulsions, Marcel Dekker, New York, 1990. 12 N.M. Barfod, N. Krog, G. Larsen, W. Buchheim, Fat Sci. Technol. 93 (1991) 24.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

337

High Pressure Treatment of Whey Protein/Polysaccharide Systems P.B. Fernandes a and A. Raemy b apresent address: Friskies R&D Centre S.A., P.O. Box 47, F-80800 Aubigny, France bNestec Ltd, Nestl6 Research Centre, P.O. Box 44, Vers-chez-les-Blanc, CH-1000 Lausanne 26, Switzerland

Abstract

High hydrostatic pressure treatment can be used to change food structures, in particular to obtain weak or strong gels. In this study we have characterized the gelifying effect obtained by pressure treatments, at ambient and at 50~ on whey protein/polysaccharide mixed systems. The polysaccharides studied were kappa-carrageenan, xanthan gum and HM-pectin. The pressures applied were 400, 600 and 800 MPa. The main effects observed are that: - whey protein alone does not gelify at concentrations up to 12%; - at room temperature kappa-carrageenan is shown to be the most the efficient gelifying agent in whey proteirdpolysaccarides systems; - a higher pressure does not always lead to a stronger gel; - at 50~ xanthan gum and HM-pectin are as efficient as kappa-carrageenan. 1. INTRODUCTION Control of the functionality of food ingredients is fundamental for retaining the desired structure of foods. Synergistic protein-polysaccharide interactions are attractive and give rise to widespread technological applications (eg. desserts, dressing salads, pet food, etc.). Recently, the study of protein/polysaccharide interactions became of great interest [1-5]. Gelation of polysaccharides (eg. kappa-carrageenan, agar-agar, etc.) is usually achieved by lowering temperature [6-7], while in the case of globular proteins (eg. whey proteins, egg white, etc.) gels are obtained by heating above their denaturation temperature [8-9]. Therefore, if a gelling polysaccharide is used in a globular protein/polysaccharide mixture, gelation can be achieved either by increasing or by decreasing temperature. Very recently, it was described by several authors that HHPT induces conformational changes of globular proteins, increasing the solvent-accessible surface area (hydration) by unfolding [10-11]. Typically, proteinpolysaccharide gels were obtained by heating or cooling of a solution [12]. Recently, it was demonstrated that whey protein/polysaccharide solutions can also be transformed into weak gels by pressure treatments (Femandes & Raemy, unpublished results). The gelifying effect was shown to be particularly important with the negatively charged polysaccharide kappacarrageenan.

338 This communication describes the effect of high hydrostatic pressure treatment (up to 800 MPa) on whey protein/kappa-carrageenan, xanthan gum or HM-pectin mixed systems at the temperatures of 30~ and 50~

2. MATERIALS AND METHODS

a) The press used was the ABB mobile equipment (warm isostatic press, 900 MPa, 1.4 1). The samples were put in yoghurt pots sealed with aluminium foil. b) The products were from Whey Protein Isolate (supplier Le Seur Isolates, G.B.). The polysaccharides were kappa-carrageenan in the potassium form from Fluka (CH), xanthan gum from Xanthan Jungbunzlauer (A), and HM-pectin (extracted from citrus) from Fluka (CH). c) Preparation of solutions The whey protein was dissolved in distilled water at room temperature and pH was adjusted to 7.0 with 0.1M HC1 or 0.1M KOH. The polysaccharides kappa-carrageenan, xanthan gum and HM-pectin were first dispersed in water under moderate agitation for l h, at room temperature, then heated at 90~ for 30 min while stirring. The whey protein/polysaccharide mixed systems were then prepared by mixing, at room temperature, solutions of whey protein and polysaccharides at the desired ratio and total biopolymer concentration. The mixture was stirred for 30 min at room temperature. The pH of the mixtures was also controlled and if necessary adjusted to 7.0. d) Analytical instruments Rheological measurements were performed using a controlled stress rheometer Carri-Med CS-100, at 25~ The storage modulus, G', and the loss modulus, G", were obtained in the frequency range of 0.1-10 Hz. Parallel plate geometry: gap 2mm, plate diameter 6 cm. Cone and plate geometry: cone angle 4 ~ diameter 6 cm. The strain amplitude was fixed at 0.01.

3. RESULTS AND DISCUSSION Whey protein/kappa-carrageenan, xanthan gum or HM-pectin solutions were submitted to the pressures of 400, 600 and 800 MPa for 10 rain at 30~ and 50~ The textures of the final products were evaluated by measuring the viscoelastic moduli G' and G". Fig. 1 presents the evolution of the G' and G" moduli as a function of pressure for the three whey protein/polysaccharide mixed systems at 30~ as well as the results of whey protein alone presented for comparison. For whey protein/xanthan gum or HM-pectin mixtures, the values of G' and G" were higher than those of the whey protein alone, especially in the case of xanthan gum. However, this increase seems not to be very pronounced since these polysaccharides are non-gelling agents. In the case of the whey protein/kappa-carrageenan blend a significant increase of both G' and G" was observed. Clearly, these interactions can be attributed to synergistic effects occurring between globular proteins and the gelling polysaccharide kappa-carrageenan. The whey protein/kappa-carrageenan mixture after pressurisation displayed typical rheological properties of a weak gel [13]. The optimum pressure was 600 Mpa.

339

Figure 1. Storage modulus (G') and loss modulus (G") values after high pressure treatments on whey protein/polysaccharide mixed systems at the temperature of 30~ and frequency of 1Hz.

340

Figure 2. Storage modulus (G') and loss modulus (G") values after high pressure treatments on whey protein/polysaccharide mixed systems at the temperature of 50~ and frequency of 1Hz.

341 The effect of high pressure on globular proteins can be promoted by increasing temperature. In this context, HHPT on whey protein/kappa-carrageenan, xanthan gum or HMpectin mixtures was applied at 50~ for 10 min (Fig. 2). The presence of the polysaccharides promoted an increase in the whey protein gel rigidity. It should be noted that: - the optimum pressure value of 600 MPa observed at 30~ was no longer observed at 50~ a continuous increase of G' and G" moduli with pressure was seen; - the polysaccharide kappa-carrageenan no longer shows the strongest effect as observed at 30~ however, at 800 MPa it conforms to the same behaviour as that demonstrated at 30~ These data confirm that the relationship HHPT-temperature could be used to promote synergistic interactions between globular proteins and polysaccharides. It is important to note that none of the three polysaccharides used will gelify alone under the present experimental conditions. Kappa-carrageenan, xanthan gum and HM-pectin are negatively charged (anionic) polysaccharides. At neutral pH the whey proteins carry a negative charge. The synergistic interactions observed between whey proteins and polysaccharides should be explained by the following mechanism: during the application of high pressure the globular proteins are partially unfolded with a subsequent increase of their hydration; this may lead to volume exclusion effects originating from incompatibility between unlike biopolymers (whey proteins and polysaccharides). Therefore, an increase of the effective concentration of both proteins and polysaccharides is observed. This results in gel formation. Additionally, the stabilisation of this gel network is certainly due to the establishment of local links of the type protein.NH 3 +--R.polysaccharide.

4. CONCLUSION The main effects observed with the oscillatory shear experiments performed in this sudy are that: - whey protein alone does not gelify under pressure, up to a concentration of 12%, even if it is denaturated in some way; - the gels obtained are due to the co-presence of protein/polysaccharide in the mixtures; - the effect of pressure on the gel rigidity is less marked than the effect of temperature; - optimum values of pressure can be found in some cases (e.g., 600 MPa for kappacarrageenan and xanthan at 30~ - at 30~ kappa-carrageenan is shown to be the most efficient gelifying agent in whey protein/polysaccharide systems this is however no longer the case at 50~

5.

R E F E R E N C E S

1 V.M. Bernal, C.H. Smajda, J.L. Smith and D.W. Stanley, J. of Food Science, 52 (5), 1121-1125(1987). 2 A. Kato, T. Sato and K. Kobayashi, Agric. Biol. Chem., 53 (8), 2147-2152 (1989). 3 E. Dickinson and S.R. Euston, in: Food polymers, gels and colloids, E. Dickinson ed., Royal Society of Chemistry, Cambridge, pp. 132-146 (1991).

342 4 T.V. Burova, V.Y. Grinberg, A.L. Leontiev and V.B. Tolstoguzov, Carbohydr. Polym., (18), 101-108 (1992). 5 A. Syrbe, P.B. Femandes, F. Dannenberg, W. Bauer and H. Klostermeyer, in: Food macromolecules and colloids, E. Dickinson & D. Lorient eds., The Royal Society of Chemistry, Cambridge, pp. 328-339 (1995). 6 P.B. Femandes, M.P. Gongalves and J.L. Doublier, Effect of galactomannan addition on the thermal behaviour of kappa-carrageenan gels. Carbohydrate Polymers, (19), 261-269 (1992). 7 C. Rochas, F.R. Taravel and T. Turquois, Int. J. Biol. Macromol., (12), 353-358 (1991). 8 R.C. Bottomley, M.T.A. Evans and C.J. Parkinson, in: Food gels, P. Harris ed., Elsevier Science Publishers, pp. 435-466 (1990). 9 P.B. Femandes, Food Hydrocoll., 8 (3-4), 277-285 (1994). 10 R. Hayashi, in: Use of high pressure in food, R. Hayashi Ed., Sanei Publishing, Kyoto, pp. 1-30 (1989). 11 K. Gekko, in: High pressure and biotechnology, C. Balny, R. Hayashi, K. Heremans & P. Masson Eds, Colloque INSERM/John Libbey Eurotext Ltd, pp. 105-113 (1992). 12 P.B. Femandes, in: Gums and stabilisers for the food industry - 8, Phillips, G.O., Wedlock, D.J. & Williams, P.A. eds., IRL Press, Oxford, (in press). 13 A.H. Clark and S.B. Ross-Murphy, Adv. Polymer Sci., (83), 55-192 (1987).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

343

Time-resolved turbidimetric measurements during g e l a t i o n p r o c e s s o f e g g white under high pressure Haruichi Kanaya, Kazuhiro Hara a, Atsushi Nakamura b and Nobuyasu Hiramatsu b Department of Electrical and Electronic Engineering, Faculty of Engineering, Yamaguchi University, Ube, Yamaguchi 755, Japan aDepartment of Applied Science, Faculty of Engineering, Kyushu University, Higashiku, Fukuoka 812, Japan bDepartment of Applied Physics, Faculty of Science, Fukuoka University, Jonan-ku, Fukuoka 814-01, Japan

Abstract Dynamical properties of egg white during the gelation process in some pressure and temperature range (from 0.1 MPa to 250 MPa and from 25~ to 65~ respectively) were investigated by measuring the time-resolved transmitted light spectra. The transmitted light spectra changed drastically by applying pressure and/or temperature. It was found that application of pressure up to 180 MPa can suppress the heat-induced gelation. In a pressure-jump experiment, the transmitted light intensity increased rapidly on application of pressure, and then decreased gradually, which can be explained by a simple light-scattering mechanism. 1. I N T R O D U C T I O N Pressure-induced gelation process has recently attracted much attention in the field of food processing, for the merits to maintaifi freshness and prevent nutritional loss due to thermal decomposition. During the process, some materials turn opaque, which indicates that light-scattering properties change considerably. Egg white also turns into turbid gel by application of pressure or heat, in which ovalbumin plays a main role[l]. In the previous paper, we reported on the time dependence of the transmitted light spectra during the heat- and pressure-induced gelation processes of actomyosin (myosin B). In the pressure-jump experiment, transmitted intensities of the spectrum increased as soon as pressure was applied, and then, it showed gradual decrease. Such behaviors showed clear contrast to the monotonous decrease in the case of the temperature jump experiment. From these results, we concluded that actomyosin molecules dissociated into some clusters before gelation in the pressure-jump experiment[2]. In the present study, we investigate the dynamical properties of the gelation process of egg white in some pressure and temperature range utilizing a temperature-controlled high-pressure vessel and a time-resolved turbidity spectrum measurement system.

344 2. E X P E R I M E N T A L Collimated white light from a Xe lamp was led into a temperature-controlled highpressure vessel and the spectrum of the light transmitted through the vessel were analyzed by a s p e c t r o m e t e r with a linear p h o t o d i o d e array ( M C P D - 1 0 0 0 , Otsuka Electronics). The real-time data from the spectrometer were processed by a personal computer[3]. Firstly, in order to investigate the effect of pressure during the heating process, the transmitted light spectrum was measured with elevating temperature from 40~ to 65~ (heating rate is 0.5~ at several pressures. The pressure was measured before elevating temperature (at room temperature), which ranged from atmospheric pressure (0.1 MPa) to 250 MPa. Secondly, in order to observe the time dependence of the transmitted light spectrum during the pressure-induced gelation process, pressure-jump experiments were carried out at several t e m p e r a t u r e s . The e x p e r i m e n t a l p r o c e d u r e was as follows: in the beginning, the pressure was maintained at 0.1 MPa for 540 s, then elevated to 250 MPa in a moment of 60 s, and after then kept constant at 250 MPa for about 600 s. 3. R E S U L T S AND D I S C U S S I O N 3.1. Temperature

change

Figure 1 shows the transmitted light spectra at several temperature. The pressure was 150 MPa. As the temperature elevated, the intensity in the short-wavelength region decreased more drastically than in the long-wavelength region. Figure 2 shows the temperature dependence of the transmitted light intensities (Z.=400 nm) at several p r e s s u r e s . The t r a n s m i t t e d light i n t e n s i t y d e c r e a s e d r e m a r k a b l y a r o u n d some temperature which is different from each other and depends on the pressure. I

I

I

I

I

I

I

I

I

I

I

1 5 0 MP.a

at 150MPa -

44.5~

-

lOO

_

0.1 MPa_

-~ 9 80

r~

- o

"~ 60 d=

m

0~Ooo

-

... o 0% Ooo 1Oo

-

"~ 40 -

63.4oc !

400

450 500 550 Wavelength (nm)

250 MPa , o I*o i

20 -

l

600

Figure 1. Evolution of the transmitted light spectra.

[ '

; k = 400 nm 0 40

l

45

l

~1

~ o0 x 9x

-

......

,i'l,, 14,

oOoi L ", ,

~..

~ , ~

50 55 60 Temperature (*C)

--

65

Figure 2. Temperature dependence of transmitted light intensity at several pressures.

345

In order to examine the pressure effect on gelation more in detail, the temperatures at w h i c h the t r a n s m i t t e d light i n t e n s i t y becomes 50% are plotted against the applied pressure ila Fig.3, which shows a convexshaped dependence and indicates that the application of pressures below 180 MPa can suppress the gelation. These results are similar to those on the structural stability in chymotrypsinogen[4].

63 ~" ~ 61 ~ ~ ~ 59' ~ .r,.)~57 -

region)

QDenaturated re . o . .i ............. o~ ~176176

-

~~

~

4k .....

.......

-

",,

~

9

9149

roaion') ((Native reg,on) ~ ,

-

\ l,d

55

,

L = 400 nm "~ # Figure 4 shows the time dependence of 530 t I I I 50 100 150 200 250 the t r a n s m i t t e d light intensity at several Pressure (MPa) temperatures in t h e p r e s s u r e - j u m p experiment. In the cases of the temperature Figure 3. Plot of temperature versus at 45 and 50~ the intensity increased as applied pressure at which transmitted light soon as the pressure was jumped, and then, becames 50%. it decreased gradually with time. On the other hand, in the case of 60~ the intensity already decreased at a t m o s p h e r i c pressure and showed no change even by the application of pressure. At 55~ the intensity showed intermediated behavior between the two cases mentioned above. Generally speaking, the gelation process of protein can be considered as

3.2. Pressure-jump experiment

k12 k23 N N(t) "" N o(t) -" N G(t) , k21 k32

(1)

where Nu(t), ND(t ) and Nc(t) denote the n u m b e r s of native protein, d e n a t u r e d (dissociated) protein and polymers of the denatured proteins (gel), respectively, kij's are rate of the reactions. Assuming k21, ks2-- 0, the kinetics of these process becomes

dNs(t) dt =-k12NN(t) dND(t)-ka2NN(t ) - k 23 ND(t ) dt

(2)

The eqs. (2) can be solved analytically as

N N (t) = Ao exp (- k12 t) N ~ (t) = A ~ kz3k12 - k ]2 {exp(_k]2t)_exp(_kz3t) ) U G(t) = A o- Nu (t)- No(t )

(3)

where A o is the total number of all molecules. If we describe light scattering efficiencies per a protein molecule a s lscaar Iscat o and 1sea,c corresponding to Nu(t), ND(t) and NG(t) respectively, and assume Isca,G is much larger than other efficiencies, the transmitted

346 light intensity

Irr,,,s becomes

I~r~ =A o ls~ata - (NN (t) lsc~tN + No (t) IscatD + NG(t) lscatg)

(4)

In order to demonstrate evolutions of the transmitted light intensity, we calculated

Irra,s, as a first approximation, substituting Ao= 1, Isc,tN=200, Is,,a~= 1 and Iscatc=lO00 into eq. (4). Figure 5 shows the time dependence of transmitted light intensity in case of (a) k12/k23 = 10 (the gelation process is slower than dissociation process) and (b) ki2 / k23=0.1 (the gelation process is faster than the dissociation process), respectively. As shown in the figure, time dependence of the scattered light intensity in the pressurejump experiment corresponds to Fig. 5(a), and that in the temperature-jump experiment, to Fig. 5(b). These results indicate that the rate of dissociation is much larger than that of gelation in the pressure-induced gelation process contrarily to the case of the heat-induced one, and demonstrate the different feature of the gelation processes by the different treatments. r

100• ~) ~Ol-_. mtq -~ ~'%.

~ ~. Yji. ti., 45"C ~i~

;~ o~

r

~-. 1.0

~,

~

-

r

~= 20 0

i

~'*,

i

/ [

0

" '. '. 600C %.o

200

eo.eo

I

(a)

I

4

0.0 -_ 1.o

.*:* i "~ *.

,

I

k12 / k23 = 10

.

;

(b)

,-.1

s5~ ~'~ ~

"

I

-

~9 601"~ 50 ~ ~- ~ 4 . . ~ . . . . . . . . ~,. a= tr. * * ~ ."." % "-~" . "~ 40]-" =9 ]

I

k = 400 nm

o

9

I

4-,,4

'i k "*§ i .... i ,,,,

o,' - -

v

~,

400 600 800 1000 1200 Time (sec)

Figure 4. Time d e p e n d e n c e of the transmitted light intensity at several t e m p e r a t u r e s in the p r e s s u r e - j u m p experiments.

k12 / k23 = 0.1

[" 0.0

'

'

I

I

10 20 30 40 Time (arb. units)

I

50

60

Figure 5. Time d e p e n d e n c e of the transmitted light intensity ( I r.... ) during the reaction. (a) is k12/k23= 10 and (b) is k12/k23= 0.1, respectively.

Acknowledgements

This work was partly supported by the Grant-in-Aid for Encouragement of Young Scientists and Scientific Research (C) from the Ministry of Education, Science and Culture, and also by the Japanese Private School Promotion Foundation. P.W.Bridgman: J. Biol. Chem., 19 (1914) 511. H. Kanaya, K. Hara, H. Okabe, K. Matsushige, S. Nishimuta and M. Muguruma: J. Phys. Soc. Jpn. ,62 (1993) 362. H. Kanaya, K. Hara, A. Nakamura, N. Hiramatsu and K. Matsuchige: Jpn. J. Appl. Phys., 33 (1994) 2817. S. A. Hawley: Biochemistry, 10 (1971) 2436.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

347

High pressure effects on the colloidal calcium phosphate and the structural integrity of micellar casein in milk K. Schrader a, C.V. Morr b and W. Buchheim ~ a Federal Dairy Research Centre, POB 6069, 24121 Kiel, Germany b Ohio State University, Dept. Food Sci. and Technol.,Columbus, OH, U.S.A.

Abstract

Temperature and pressure affect the conformation of the (globular) whey proteins as well as the structure of the colloidal casein aggregates - casein micelles but also the equilibrium state of dissolved and colloidal (casein-bound) calcium phosphate in milk. The relations between temperature- and pressure-induced changes of calcium phoshate equilibria were evaluated in original and ultra-hightemperature treated milks, in corresponding ultrafiltration retentates and permeates and in synthetic milk salt solutions. By high pressure treatment the heatinduced changes of calcium phosphate can be largely reversed to their original values. These changes can be related to the pressure-induced structural changes of the micellar casein and to interactions of casein with temperature- or pressuredenaturated whey proteins.

1. I N T R O D U C T I O N

The major proteins of cow milk (about 35 g 1i ) are random coil-type caseins (about 80 %) and globular whey proteins (about 20 %). In fresh milk caseins are present as colloidal aggregates - casein micelles - which bind about 70 % of the total calcium and 50 % of the total phosphate. There is a sensitive dynamic equilibrium between this colloidal calcium phosphate and the dissolved calcium phosphate of the milk serum. This equilibrium is related to the structural integrity of the casein micelles. Furthermore, the whey proteins may associate with the micellar casein upon denaturation. Changes in calcium phosphate equilibrium, e.g., as induced by heating above 100~ result also in significant changes of pHvalue due to a release of H + ions when soluble Ca phosphate is converted to the insoluble form [1]. Since the early work of HITE [2] it is known that application of high pressure to milk affects its scattering of light which mainly results from a disintegration of the casein micelles [3-6]. The aim of this study was to relate pressure- and

348 temperature-induced structural changes of micellar casein to shifts in calcium phosphate equilibria and also to consider possible interactions due to whey protein denaturation.

2. M A T E R I A L S A N D M E T H O D S For the experiments concerning the shift in the salt equilibrium, fresh cow skim milk was used. After pasteurization at 74~ it was concentrated threefold by ultrafiltration (UF). The milk, the UF-retentate and the UF-permeate were heatand pressure-treated. In addition, a synthetic milk ultrafiltrate (SMUF) [7] containing or not containing calcium as well as a clear infranatant of ultracentrifuged pasteurized skim milk were treated in the same way. The heat treatment was a sterilization at 118~ for 15 minutes. The high pressure treatment was carried out about 20 hours after sterilization at 400 MPa for 5 minutes at 20~ After the treatment, the pH and the contents of dissolved calcium in the sample were measured. For the experiments concerning the kinetics of casein micelle disintegration original skim milk and ultra-high-temperature-treated (U.H.T.) skim milk were used. The pressure treatment was carried out at pressures of 100...500 MPa at temperatures of 5, 10, 20 and 40~ and at holding times of 1, 5 and 10 minutes. Immediately after pressure treatment the pH and the turbidity (440 nm, 1 mm quartz sample cell) as measure for the size of the micelles were determined. In some experiments also the content of undenatured whey protein was measured. Microstructural changes were followed by transmission electron microscopy (TEM) of freeze-fractured preparations.

3. R E S U L T S AND D I S C U S S I O N Fig. 1 shows that heat treatment causes a drop in pH and reduces dissolved Ca in all Ca-containing samples. High pressure treatment brings the pH and the content of dissolved Ca back to their initial values. The effects are considerably higher in samples which contain no or little protein because of the buffer action and binding capacity of the protein, which is the highest in the UF-retentate. The disintegration of the casein micelles and the increase of the pH are nearly completed after 10 minutes of pressure application (Fig. 2). The pH-shift in the heat-treated milk is higher than in original milk. At pressures of 100 and 200 MPa casein micelles in U.H.T. milk are less sensitive against pressure. In original milk the small difference in turbidity between 200 and 300 MPa is caused by pressureinduced whey protein denaturation (results not shown here).

349

7.5 v

100

-1-

f:l.

6.5

8O o ~5

6

0

('N d>4

60

>o

4o

5.5

...., (X <X

2o

#x

<x <X

5

untreated

sterilized

O< /-y

0

then pressurized

Dmilk

F] UF retentate

L~-7SMUF

~SMUF

untreated

sterilized

then pressurized

m UF permeate

without CaCI2R~]lnfranatant of past. milk

Figure 1: Effect of sterilization and high pressure treatment on pH and content of dissolved Ca in milk systems and synthetic milk ultrafiltrates

a

b 1.5

1.5 f

_t0.2

0.2 o . . . .

1- f"~ 0 . 5 -

,~:-----_--------~--IV-:-i:"":-:-..........................

o. 1

,? 0.5+ . .

-l-

Q_

0 "

.

0

.~

.E (_.

. . . . .

-0.5

.E (.-

y 0 " -

=====

.

.

.

.

=.:=====

. . . . . . . . .

.

.

.

.

.

.

0.1

.........

0

-1.c: ,m t-

-0.5

. . . .

-0.1

09 ]

-0.1

-1

0

1

2

3

4

5

6

7

holding time (rain)

8

9

10

-1.5w

~

t

J

~

~

~

~

i

~ .... -0.2

0 1 2 3 4 5 6 7 8 9 10 holding time (min)

-~-100 MPa <)-200 MPa --x--300 MPa -o-400 MPa -r turbidity pH

MPa

Figure 2- Time dependence of casein micelle disintegration (change in turbidity) in original skim milk (a) and U.H.T. skim milk (b) at 20~ Fig. 3 shows that with increasing pressure and with decreasing temperature the shifts in pH and turbidity increase. In original milk at temperatures of 20~ and above and at pressures between 200 and 350 MPa an increase in turbidity is observed which has to be ascribed to whey protein denaturation and subsequent

350 reaggregation of protein. This was demonstrated by TEM analysis. In U.H.T. milks this reaggregation is not detectable, which apparently is a result of the fact that the whey proteins are already present in a (thermally) denatured state.

a

1 .m .Q

._c (/)

0.5 0

.

t

i p .

.

.

.

.

~

,,' ....... - ....... --~:;,-:( '"" ........... "'"

J.[S[:::::: .......

t

1.5

_o.1

.......... -o -0.1

-1 0

1 O0

200

300

400

0.2

_>, c~

.c_

, ~-;; .

0.5

-1-

CO9

-0.5

-1.5

b

._c c(/)

-0.2 500

p r e s s u r e (MPa)

I ---5oc -o-10oc -x- 20oc ~ 40oc

.

.

,,'z,"

.

.

.

.

0.1

,-

7CL

o

0

.c_ CO9

-0.5

-0.1

-1 -1.5

0

t

t

t

I

1 O0

200

300

400

-0.2 500

p r e s s u r e (MPa)

t u r b i d i t y - - - pH I

Figure 3: Pressure induced changes in turbidity and pH-value in original skim milk (a) and U.H.T. skim milk (b) at different temperatures after 10 minutes of pressure treatment The studies have shown that application of high pressure to milk systems results in a variety of interrelated changes both for the protein and the mineral phase. This further depends on whether the original eqilibrium state has already been changed by high temperature treatments which are common in milk processing.

4. R E F E R E N C E S

1 P. Walstra, R. Jenness, Dairy Chemistry and Physics, John Wiley & Sons, New York, 1984 2 B.H. Hite, West Virginia Agricult. Exp. Station Bull No. 58 (1899) 15 3 D.G. Schmidt, W. Buchheim, Milchwissenschaft 25 (1970) 596 4 D.G. Schmidt, J. Koops, Neth.Milk Dairy J., 31 (1977) 342 5 Y. Shibauchi, H. Yamamoto, Y. Sagara, In: High Pressure and Biotechnology (C. Balny, R. Hayashi, K. Heremans, P. Masson eds.) Colloque INSERM/John Libbey Eurotext, London 224 (1992) 239 6 D.E. Johnston, B.A. Austin, R.J. Murphy, Milchwissenschaft 47 (1992) 760 and Milchwissenschaft 48 (1993) 206 7 R. Jenness, J. Koops, Neth.Milk Dairy J., 16 (1962) 153

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

High Pressure Effects on Fish Lipid Degradation: Myoglobin Water Holding Capacity

351

Change and

S. Wada and Y. Ogawa Department of Food Science and Technology, Tokyo University of Fisheries, Konan 4-5-7, Minato-ku, Tokyo 108 Japan

Abstract Changes in myoglobin (Mb) content and water holding capacity (WHC) related to lipid degradation of fish meat (red muscle) were measured during storage at 5 o C after high pressure treatment at 100MPa or 200MPa. The Mb contents of sardine and bonito decreased during storage after 200MPa to 70% and 25% residues, respectively. The production of free fatty acid (FFA) in the fish meat during storage was prohibited by the 200MPa treatment. These results suggest that lipid degradation of fish meat after high pressure treatment above 200MPa occurred on the basis of Mb degradation and loss of WHC increased the surface layer between oxygen and the fish meat.

1. I N T R O D U C T I O N To stop the lipid oxidation of fish meat is quite impo~tant for the utilization for food materials after high pressure treatment. After the treatment above 200MPa for 30 min., the lipid of the fish meat is easily oxidized during storage although no difference is observed when the extracted lipid from the fish meat is treated by high pressure [ 1] of around 100MPa to 800MPa. These phenomena are postulated to be due to the denaturation of the protein by high pressure treatment, and that the lipid is affected along with the denaturation of the protein. One reason why the lipid oxidation occun'ed with the cooperation of the denaturation of the protein is that the heme-ion in the myoglobin(Mb) of the meat is possibly activated as a catalyst and the water holding capacity (WHC) is structurally related to this reaction. Therefore, in this study, the effect of the Mb and WHC on the lipid oxidation was investigated, especially in the red meats of bonito and sardine. Furthermore, the natural antioxidant effects of rosemary and c~-tocopherol for preventing the lipid oxidation of fish meat with high pressure treatment was also investigated.

2. MATERIALS AND METHODS The very fresh samples that included the red meats of sardine (Sardinops melanostica) and bonito (Euthynnuspelamis) were obtained at Tokyo central fish market, Tukiji, in Tokyo. The fresh red meats were minced for the samples to be treated at the high pressures of 200MPa and 100MPa for 30min., respectively, using a Rikenseiki 200M-60 Pressure Instrument [2]. After the red meat was homogenized and treated by high pressure, the meat was stored in the dark at 5~ using peu'i dishes with a diameter of 8.5cm. For preventing water evaporation during

352 storage, the meat was wrapped using Saran-Wrap@, wrapping film. A portion of the 12g sample was removed from the dish for each additional analysis. Mb was measured by the absorbance method at a wavelength of 543nm [3]. The thiobarbituric acid (TBA) value of the sample for the degradation degree of the lipid was measured by the method of Sinnhuber [4]. After extraction of the sample lipid using the method of Bligh and Dyer [5], the lipid spotted on the TLC plate was developed with petroleum ether/diethyl ether / acetic acid (80:20:1 v/v) and a Shimadzu High Speed TLC scanner (CS9000) was used to determine the lipid class composition. Fatty acid composition was analyzed by GLC on a spelco wax 10 capillary column (30m x 0.25mm i.d.) with a flame ionization detector. WHC was measured by the method of pressing the sample using two plates of glass. A 0.3g portion was put between two filter papers.

3. RESULTS AND DISCUSSION 3.1. Change of Myoglobin Content Figure 1 shows the change in the content of Mb including the hemoglobin (Hb) of bonito red meat during storage at 5~ The changes in Mb at 100MPa and non-treated meats almost had the same degradation patterns during storage. However, the Mb content of the 200MPa treated meat significantly changed from 1300 mg to 950 mg during the first stage after high pressure treatment and then the content gradually decreased, similar to the curve for 100MPa alter 3 days storage.

--O--

'~'~=~ 1 2 0 0 ~ ~ " ~

Non-Pressure

--A-100MPa :2 + ,.Q

--0-200MPa

300 ('}/f

a.

.1

~

2

4 6 Storage Days

I

,

I

,

I

v

0

8

10

Figurel. Change in (Mb+Hb) Content of Bonito Red Meat during Storage at 5~C

From these results, it appeared that heme pigments in fish meat treated by high pressure above 200MPa rapidly denaturates, while the changes in the meats of non-treated and low pressure treated ones were almost the same during degradation. The Mb content of sardine red meat was 265 mg and decreased to 185 mg after 200MPa treatment. Therefore, after the 200MPa treatment, the remaining Mb content of sardine was 30%, i.e., 70% was destroyed after the treatment, and after 6 days storage, 20% remained, which means 80% was lost. The Mb content of bonito decreased 15% after the treatment, then for 3 to 6 days storage, it decreased 40%, which means 60% remained. The degree of Mb denaturation, of course, is based on the degree of denaturation of part of the globin in the pigment protein.

353 From this point of view, the decrease in Mb content by high pressure treatment was considered to depend on the degree of high pressure along with the denaturation of the globin protein.

3.2

Lipid degradation during storage

Figure 2 shows the lipid changes in free fatty acid (FFA)s and triglycefide (TG)s of the sardine and the bonito red meats. The degradation in TGs of the u'eated samples of sardine and bonito were significantly more protective than those of the non-treated ones, while the production of FFA in the treated sample was prohibited because of the lack of lipase activity. Concerning the 100MPa treatment, the production of FFA occurred almost in the same pattern as the treated and non-treated samples.

Ico

FFA

FFA <

r

6 4O

4

[---3 o

3

6

Storage Days Sardine

9

12

0

3

6 Storage Days

9

12

Bonito

lO0

60

TG

50

6O

2O I0

40 0

3

6

9

12

C

_

0

3

Storage Days Sardine

6

9

12

Storage Days Bonito

cl, Non-Pressure; [], 200MPa FFA, Free fatty acid; TG, Triglyceride Figure 2.

Changes in FFA and TG of Red Meats of Sardine arid Bonito during Storage at 5~ after 200MPa Treatment

It is considered that the loss in lipase activity and the denaturation of myoglobin by high pressure treatment above 200MPa are related to the hydrophobic bond between the lipid and protein molecules inside the inter molecules and/or inner molecules. Therefore, further investigation was performed on the fatty acid composition to clarify the relationships between the changes in Mb and lipid oxidation.

354

Figure 3 shows the degree of lipid oxidation using the ratio of eicosapentaenoic acid (EPA) plus docosahexaenoic acid (DHA) divided by palmitic acid (C16:0). The vertical axis is indicated by delta which means the value is defined as the ratio of treated sample minus the ratio of non-treated sample. The minus value means greater lipid oxidation occurred during storage. After 100MPa treatment, the oxidation of sardine and bonito meats had almost the same pattern until 3 days storage, but after the 200MPa treatment, the sardine was significantly more oxidized than that of bonito, which suggests that Mb might be involved in lipid oxidation. 3.3

WHC and TBA value

If the WHC is formed between the solute and water, the system including the water will have a lower volume. Based on this phenomenon, we need to investigate the WHC in the meat related to the lipid stability which will become morn stable against oxidation after the high pressure treatment. The WHC of sardine was 37.1% for the original non-treated sample, then after the treatment, it decreased to 33.5%. During storage the WHC content was significantly changed after 2 to 5 days. The change in WHC is correlated with lipid oxidation, which estimates that the waterholding molecules were destroyed in accordance with the lipid oxidation. Figure 4 clarifies that the treatment above 200MPa for fish red meat affects the protein denaturation such as Mb, and then there are big changes among the molecular structures, and the WHC is destroyed after 2days storage.

9

.rd

+~ 0.2 r.., 0.1 O.Of -0.1 -0.2 -0.3 " -0.4 "~ 9 -0.5 v 0
'

!

2

Storage F igur The and The

'

I

4 Days

e 3. difference non-treated ratio is

,

1

6

,

I

,

8 -O-Sardine

10 ZOO,,Pa

Bonito

200

MPa

Sardine

I00

MPa

--A- aonito ,oo ~a in the fish defined

ratio of treated red meat. as (EPA+DHA)/16:0

In accordance with the decrease in the WHC, the lipid oxidation was prolonged. As indicated in Figure 5, there is a big difference between the wrapped meat and the meat without wrapping. The TBA values of non-wrapped meat showed significant oxidation in both cases of the high pressure treatment and non-pressure treated samples.

355

5O b

.,..~ u

~

~.3

40

-

sure

30

20

,

I.

0

i

2

!

J

1

4

z

6

I

i

8

I

.,

10

12

Storage Days Figure4.

WHC (%) of Sardine Red Meat during Storage at 5~ after 200MPa Treatment

[

"-'~o 400[

--C)--

200MPa Reference

.~,\__.=~~5 300 <

20o r

(Non-Treated)

lOOMPa ----~--

//#

Packing Packing

200MPa

10 t r.-".,.

,

,,

1

.

.,

O

Storage Days F i g u r e 5. Thiobarbituric Acid value of Sardine-Red Meat by Open and Packing Conditions during Storage at 5~

The meat with water has allowed more oxidation than that of the open ones in both samples. If water surrounds the protein molecules in the meat, the lipid in the meat become more stable toward oxidation. By high pressure treatment, the conformation between protein and lipid are destroyed and the reaction of the meat with air will easily occur and the surface between the lipid and oxygen will increase thus allowing oxidation to occur. The change in WHC is one of the most important factors influencing the sardine red meat oxidation.

356 3.4

Prevention of oxidation

The effects after 12-days storage of natural antioxidants on the lipid oxidation were investigated. The mixture of oc-tocopherol and rosemary at a 1:1 ratio and the concentration was 0.07 weight percent in the sample based on a previous paper [6]. The oxidation was faster in the order of 200MPa, 100MPa, and the non-high pressure samples, in both cases of the antioxidant treated samples and non-treated samples. The effects of antioxidants were prolonged until 6 days and 9 days alter high pressure u'eatments of 200MPa and 100Mpa, respectively, while the non-high pressure treated sample has a slight antioxidant effect until 12 days though there was less of an effect during the initial stage of storage. It is suggested that high pressure treatment might affect the radical scavenger function of octocopherol and rosemary. From this point of view, the reason for lack of a significant effect by oc- tocopherol and rosemary above 200MPa high pressure treatment could be explained by the structure change around the molecules of the antioxidant and lipid surface. 4.

CONCLUSION

To obtain more detailed information, further investigation will be needed in this field. However, as a conclusion to this study, it is recognized that lipid oxidation of the meat by high pressure treatment is related to the degradation of Mb and the loss of WHC. 5.

REFERENCES

1 S. Wada and S. Ide, High Pressure Science lbr Food, R. Hayashi (ed.), San-Ei Publ. Co., 293-299, Kyoto, 1991. 2 T. Mihori, Res. Rep. of Tokyo University of Fisheries, 7-30 (1989). 3 X. Fang and S. Wada, Food Research International, 26 (1993) 405. 4 R.O. Sinnhuber and T.C. Yu, J.of Jpn Oil Chem. Soc. (Yukagaku), 26 (1997) 259. 5 E.G. Bligh and W.J. Dyer, Can. J. Biochem. Physiol., 37 (1959) 577. 6 S. Wada and X. Fang, J. of Jpn Oil Chem. Soc. (Yukagaku), 43 (1994) 109.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

357

Gelation ofsurimi pastes treated by high isostatic pressure T.C. Lanier Food Science Department, North Carolina State University Raleigh NC, USA 27695-7624

Abstract

Surimi, a myofibrillar concentrate of fish muscle, gels at 25~ (for Alaska pollock) due to crosslinking of proteins by endogenous transglutaminase, at 90~ by heat-induced protein denaturation, and at pressures near 300 Mpa due to pressure-induced denaturation. The latter two treatments doubtless induce extensive gel network formation via formation of intermolecular hydrophobic associations, and heat is known to induce disulfide bonding. We have shown that pressure-induced gels evidence disulfide bonding as well. Endogenous transglutaminase evidently survives the pressure treatment, and subsequent setting at 25~ with or without subsequent cooking at 90~ results in very strong gels as compared to those prepared without prior pressurization. I. INTRODUCTION Fish muscle proteins are typically heat-gelled in the manufacture of crab analog products. High temperatures (40-60~ depending on the protein source) are normally required to denature fish myosin, leading to intermolecular covalent and non-covalent interactions including disulfide bond formation and hydrophobic group interactions that result in gelation (1). Proteins are destabilized and may also be induced to gel at low temperature by pressure treatment ranging from 100-1000 MPa (2). Gels formed by pressure treatment generally possess increased glossiness and deformability, as well as a more natural flavor (3) as compared to heat-induced gels. Fish protein gels can be formed with pressure at ambient or lower temperatures at pressures ranging from 200 to 500 MPa (4). Heremans and Heremans (5) proposed that the process of pressure-induced protein denaturation could be thought of as a cascade effect. Initially, hydrophobic interactions which stabilize the native structure of the protein are disrupted under the influence of pressure. This causes an opening of the protein structure, allowing hydrophobic groups to be exposed to the aqueous environment. Changes result from pressure-induced destabilization of the protein and produce further volume decreasesdue to electrostriction around charged groups, water structuring around exposed apolar groups, and solvation of

358 polar groups through hydrogen bonding. It was considered that disulfide bond formation might occur at this time. Upon release of pressure, the hydrophobie groups interact once again to minimize exposure to the aqueous environment. Along with other protein-protein interactions such as possibly disulfide bonds formed under pressure and hydrogen bonds that form upon release of pressure, the intermoleeular hydrophobie interactions result in the formation of a gel structure when protein concentration is sufficient. Even at atmospheric pressure muscle pastes from most species of fish can gel at low temperatures (0-40~ but the time required for gelation is greater than by heat or pressure (6). Endogenous transglutaminase is thought to induce this low temperature gelation (termed "setting"), which also imparts added strength to the gel upon subsequent cooking at higher temperatures. Transglutaminase forms intermolecular covalent e-(T-glutamyl) lysine bonds between myosin heavy chains (MHC), the polymerization of which can be measured by SDS-PAGE (7). The endogenous transglutaminase requires Ca 2§ to be active, and thus can be inhibited with EDTA (8). Since pressure causes denaturation and gelation of proteins at low temperatures, it may also affect the activity of transglutaminase (9). 2. RECENT EXPERIMENTS We subjected pastes of Alaska pollock (Theragra chalcogramma) surimi (refined myofibrillar protein containing 4*/, sucrose, 4*/. sorbitol and 0.3% sodium tripolyphosphate), adjusted to 78% moisture content and 2% NaCI, to cooking (90~ for 30 min.), setting (25~ for 2 hr), pressure treatment (300 MPa isostatic pressure for 30 min at 5~ or a combination of these treatments, setting or cooking always being carried out at atmospheric (10) (Fig. 1). Stress (strength) and strain(deformability) of gels were determined at the tensile failure point, measured at 25~ It is apparent that the various methods of processing the paste into a gel had dramatic effects on tensile strength, but little effect on tensile deformability. The setting treatment strengthened the gel, particularly when preceded by a pressure treatment. This enhancement of the setting effect by a prior pressure treatment raises the question of whether the endogenous transglutaminase presumed to be responsible for gdation during setting is also active during the pressure treatment, and survives pressure-induced denaturation. Since the enzyme is known to be calcium activated, we can inhibit its action by addition of EDTA (Fig. 2, setting only treatment) (10). EDTA addition had no effect on the pressure-only treatment; thus it is logical to conclude that transglutaminase is not involved in pressure-induced gelation. The dramatic effect of EDTA on gel stress in the pressure+setting treatments indicates that the transglutaminasr survives a pressure treatment of this magnitude, despite assertions to the contrary by Shoji et al.. (11). The data of Fig. 1 and 2 were corroborated by SDS-polyacrylamide gel dectrophoresis of these gels, which indicated polymerization of myosin heavy chain as a result of inclusion of setting as part of the treatment. The test used was more qualitative than quantitative with

359 respect to polymerization; however, loss of myosin heavy chain monomer was approximately the same for setting with or without a prior pressure treatment. (10). Figure l. Effect of gelling treatment on tensile stress and strain at failure of surimi gels. Treatments: P = 300Mpa isostatic pressure, 30 min, 5~ S = 25~ 2 hr, atmospheric pressure; C = 90~ 30 min, atmospheric pressure.

1000

A

(U n

750

(/) (/) UJ hI'U)

5OO

1.5

Z

"--I

~r~

1

250 0.5

C

S

S/C

P

P/C

P/S

P/S/C

84

O-

i

i

C

S

I

S/C

P

PIe

PIS

PIS/C

Figure 2. Effect of EDTA and gelling treatment on tensile stress and strain at failure of surimi gels. Treatments are same as in Fig. 1.

~"

=1]

9 NOEDTA

~t

L"~ I:~I,.IEDTA

S

S/C

I II .'~t ~ I

~

P

P/S

i

I

P/S/C

9

S

No EDTA

S/C

P

P/S

PIS/C

360 The activity of the endogenous transglutaminase is dependent upon denaturation of the substrate myosin to expose available binding (7). Thus it is reasonable to believe that the greater strength of gels prepared by the pressure+setting+cook treatment as compared to those prepared by setting + cooking (Fig. 1) might be attributed to a more available substrate, which facilitates more active crosslinking of myosin, in the former treatment. However, we did not quantitate numbers of e-(g-glutamyl) lysine bonds directly to verify this hypothesis, and it should be noted that we have previously seen instances where the rate of bond formation, rather than total bonds formed, seemed to correlate better with ultimate gel strength (12). Of course the pressure treatment, having induced gelation of the fish proteins, is certainly introducing intermolecular bondings, most likely hydrophobic and possibly even covalent/disulfide (5). Solubility of the gels for which fracture data are presented in Fig. 1 were determined in the manner of Buttkus (13) in 2% SDS-SM urea-20 mM Tris-HCl (pH 8.0), with or without added 2% 13-mercaptoethanol (13-ME) (Table 1). These data indicate Table 1: Solubility results (% solubility) on samples prepared +/- EDTA (raw= starting paste, P=300 MPa/30 min, C=90~ min, S=25~ min w/o EDTA Gel Type

w/EDTA

wlo 13-Me

w/ ~Me

w/o w/ 13-Me 13-Me

Raw

90.9

100

90.9

100

P

42

100

41.6

100

P/C

38.8

100

35.7

100

C

86.3

100

88.5

100

P/S

17.7

93.6

39

100

S

70.8

93.2

89.6

100

P/SIC

15

93.2

36.1

100

SIC

63.7

93.2

85.3

100

that the treatments decreased solubility in SDS-urea in the absence of ~3-ME, but this loss was restored upon inclusion of 13-ME in the dissolving medium for all treatments except those which included a setting step. The remaining insoluble fraction in gels subjected to setting can be attributed to formation of non-disulfide of e-(T-glutamyl) lysine bonds by transglutaminase. Note that no such remaining insolubility occurred in samples subjected to

361 setting which contained added EDTA. Comparison of solubility data for samples prepared +/- EDTA also indicates that loss of solubility in gels subjected to only a setting treatment can largely be attributed to the action of transglutaminase, not disulfide bonding.

The remarkable loss of solubility in SDS-urea for pressure-treated gels indicates that substantial disulfide bonding likely occurred, in excess of that which resulted from cooking at 90~ Note that EDTA addition had little or no effect on solubility of these gels. Berg et al. (14) had noted a dramatic increase in the numbers of readily reacting SH-groups of myosin at pressures of 300 Mpa. 3. C O N C L U S I O N S

These experiments thus indicated that gelation of surimi pastes by high pressure does likely involve formation of intermolecular disulfide bonds, but doubtless is also greatly stabilized by intermolecular hydrophobic bondings facilitated by weakening of intramolecular hydrophobic associations under pressure. Transglutaminase-mediated covalent crosslinking proceeds unabated after a 300 Mpa/30 min treatment when warmed to 25~ and the effects of this subsequent setting treatment on gel strength are quite synergistic with the prior pressure treatment. Conformational changes in the proteins must occur that, after pressure release, increase the effectiveness of transglutaminase to catalyze covalent crosslinking of MHC. This opens the possibility of enhancing the gelling effects of added microbial transglutaminase in protein foods by a prior pressure treatment, a hypothesis we are presently investigating. 4. REFERENCES

1 2 3 4 5 6 7 8 9 10 ll

H. Lee and T.C. Lanier, J. Muscle Foods, 6 (1995) 125. T. Ohshima, H. Ushio and C. Koizumi, Trends in Food Sci. and Technol., 4 (1993) 370. M. Okamoto, Y. Kawamura and R. Hayashi, Agric. Biol. Chem., 54 (1990) 183. T. Shoji, H. Saeki, A. Wakameda, M. Nakamura and M. Nonaka, Nippon Suisan Gakkaishi, 56 (1990) 2069. L. Heremans and K. Heremans, Biochim. Biophys. Acta, 999 (1989) 192. G. Kamath, T.C. Lanier, E. Foegeding and D.D. Hamann, J. Food Biochem., 16 (1992) 151. D. Joseph, T.C. Lanier and D.D. Hamann, J. Food Sci., 59 (1994) 1019. Y. Kumazawa, T. Numazawa, M. Motoki and M. Takamura, Abstr., Annual Meeting, Institute of Food Technologists, Chicago, IL. (1993). P. Low and G. Somero, Comp. Biochem. Physiol., 52B (1975) 67. M.G. Gilleland and T.C. Lanier, J. Food Sci. (1996), in press. T. Shoji, H. Saeki, A. Wakameda and M. Nonaka, Nippon Suisan Gakkaishi, 60 (1994) 101.

362 12 13 14 15

H.G. Lee, T C. Lanier, D.D. Hamann and J.A. Knopp, J. Food Sci. (1996) in press. H. Buttkus, Can. J. Biochem., 49 (1971) 97. Y.N. Berg, N.A. Lebedeva, E.A. Markina and I.I. Ivanov, Biokhimiya, 30 (1965) 277. P.M. Nielsen, Food Biotechnol. 9 (1995) 119.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

363

Effect of water-soluble protein on pressure-induced gelation of Alaska pollack surimi Emiko OKAZAKI and Yutaka FUKUDA

National Research Institute of Fisheries Science, 2-12-4, Fukuura, Kanazawa-ku, Yokohama, 236, Japan Abstract SURIMI and WSP was mixed with various ratio and pressurized. The breaking strength of the pressure and heat-induced gel decreased in the WSP and Surimi mixture but remained high in the WSP only. This phenomenon indicated that there was little positive interaction between SURIMI and WSP in the both of pressureinduced gel and heat-induced gel. It was seemed that WSP lowered the strength of pressurized surimi gel because it delayed the polymerization of myofibrillar protein in SURIMI. On the other hand, the pressure-induced gel enhanced smoothness and flexibility, regardless of the amount of WSP contained. These result indicated the possibility that pressurization could be a suitable processing method to give a favorable texture to the surimi-based product containing high quantity of WSP.

1. INTRODUCTION Approximately 20-35% water soluble protein (WSP) is contained in fish meat protein which is believed to impede the gel formation in kamaboko. Generally, in surimi manufacturing, WSP is removed by water-washing process to obtain a higher gel-forming ability. Now, almost 400 million tons of surimi is produced worldwide, so about 50,000 tons of protein is available as surimi, while more than 20,000 tons of WSP are dumped away 1). To dump away this WSP without any use is problematic both from the economical point of view and utilization of marine resources. To utilize this WSP, many trials were done to develop methods to recover WSP and to utilize this as food materials in Japan. Several methods to recover WSP were established 2-4). But, very few methods succeeded practically. It is because the development in the utilization method of recovering WSP is not enough. So, it is necessary to create a WSP which will have functional properties as a food material, and to develop methods of utilizing WSP into food. The nutritive value of WSP is comparable to that of fish muscle protein itself 6). Recently, authors clarified that WSP is texturized to an elastic gel by high pressure, and that the characteristics of pressure-induced gel is different from that of heat-induced gel which is a fragile coagulum 7). Furthermore, denatured WSP, such as recovered protein from washing water in surimi processing can be texturized by pressure if the protein is not extremely denaturedS).

364

From the practical point of view, it is logical to utilize WSP in mixed state with surimi since both the proteins are contained in the original fish meat. Therefore, this study aimed to investigate the effect of water soluble protein on pressure-induced gelation of Alaska pollack surimi. 2. T H E P H Y S I C A L P R O P E R T I E S OF T H E P R E S S U R E - A N D H E A T I N D U C E D GELS OF A L A S K A P O L L A C K S U R I M I A N D W S P M I X E D WITH VARIOUS RATIO There are many reports concerning the effect of WSP on the heat-induced gelation of fish meat 9-11). It was said that sarcoplasmic protein have an inhibitory action on the gel strength of heat-induced gel. But, the mechanism of the inhibitory action is not clarified yet. Shimizu et al. reported that sarcoplasmic proteins aggregated with actomyosin during heat denaturation both at low and high ionic strength, t2) The inhibitory effect of WSP in the pressure-induced gel is not clarified yet either. So, attempts were made to know the effect of WSP on the pressureinduced gelation of SURIMI. WSP was added to SURIMI in different ratios and the property of pressure-induced gel was measured. The extraction procedure of WSP on Alaska pollack is shown in Figure 1. The pH of the concentrated WSP was adjusted to 7.0 and the moisture was adjusted to that of surimi's (Alaska pollack surimi, Maruha.Co.,Ltd, SA grade). The WSP extract was added to surimi in different ratios as given in Figure 2., and mixed under vacuum to remove the air. The air free mixture was filled into a polyvinylidene chloride tube, heated at 85~ for 20min, or pressurized at 300MPa for 10 min, cooled at 0~ for about 24 hours and the physical properties were measured by a puncture test using a rheometer.

~_L ,00.0 I?l 80: 20 60: 40 40. 60 20: 80 0:100

Alaska pollack

Mixing

**g*{,,***

1 ~ ~

~- 2,5% NaCI

Air removing

Fish meat

Extraction with0.05M KCI ~Centrifugation 5,000x g, 20rain

~

1 I

(

-~

Heating (85~

Pressurization 4 ~ t500MPa, 0~ ~ 10min

Residue ~ ]

'

I

Filling in polyvinylidene chrolide tube

1

WSP solution

Concentration with polyethylene glycol Concentrated WSP Moisture: 77%

Figure 1. Extraction method of WSP from Alaska pollack meat

9

1

Cooling (o~

I

1 24hr)

Physical Measurement (Puncture test)

Figure 2. Preparation of SURIMI + WSP gel by heating or pressurization

365 Figure 3. shows the breaking strength, breaking strain, and water-holding capacity of the pressure and heat-induced gel of WSP added surimi. The breaking strength and the breaking strain of heat-induced gel of W S P - s u r i m i mixture d e creased with an increase in WSP content. The gel containing more than 20% of WSP was very brittle, fragile gel. This result was almost the same as with the reports mentioned above 9-11). In the pressure-induced gel, the breaking strength of W S P surimi mixture decreased with the WSP content but remained high in the WSP only. Namely, the WSP itself formed an elastic gel by pressure, but WSP did not make the gel strength of the pressure-induced gel higher when it was mixed with surimi. On the other hand, the pressure-induced gel enhanced the breaking strain such as smoothness and flexibility, regardless of the amount of WSP. Even in the mixture containing more than 50% of WSP, the pressure-induced gel kept a high flexibility. This phenomenon was in contrast with the h e a t - i n d u c e d gel whose texture was lacking in flexibility.

.....

6O0-

~176

E

._~

12

Pressure-induced

L O3

.... o~ ,....

75,

~.

to.

==

C

Pressure-

'"'\ "'"e,

~ '

o

""e,

Heat-induced

II]

200.

Heat-induced SURIMI 16o e'o 6"0 40 2"0 6

WSP

6

~o go 6.o 8"o 16o Ratio(%)

5

t, "Q Heat9, J induced

SURIMI 160 8"0 6"0 4"0 2b 6 WSP 6 2"0 40 ~ 8"0 160 Ratio(%)

",.

60

SURIMI 160 e'o 6"o 4"0 2"o 6 WSP 6 20 go ~ 8"0 16o Ratio(%)

Figure 3. Physical measurement of pressure- and heat- induced gel from SURIMI + WSP mixture. Physical measurement was accomplished with a penetration test using spherical plunger (diameter: 5mm) by rheometer, the specimen was shaped cylindrical state (height, 25mm; diameter, 23mm). The speed of the stage on which the sample piece was placed was set at lmm/sec. The breaking strain is expressed as the distance of plunger movement from the top to the point where the maximum gel strength was obtained. Water holding capacity was measured as follows: The specimen was placed between a couple of two sheets of filter paper and pressed at 10kg/cm2 for 20 sec. The water content after pressing was measured. These results showed that there was slight positive interaction between surimi and WSP in both the pressure and h e a t - i n d u c e d gel from the viewpoint of gel strength, but WSP did not adversely affect the breaking strain and the total texture of the pressure-induced gel more than that in the heat-induced gel. Shoji et al. 13) reported that the breaking strength of pressure-induced gel of salted ground surimi increased remarkably during storage, and in the case of storage at 5~ the maximum gel strength was obtained after more than 120 hrs of storage periods. In this experiment, the physical properties were measured at only 24hrs after pressurization~ so if the storage was carried out much longer, a higher breaking

366

strength than the one shown in Figure 4. would have been obtained. So, nextly, the change in the physical properties of pressure-induced gel containing 25% WSP during storage for 120 hours was examined.

3. T H E C H A N G E IN P H Y S I C A L P R O P E R T I E S OF P R E S S U R E - I N D U C E D G E L OF SURIMI WITH OR W I T H O U T W S P Three kinds of surimi containing natural WSP or denatured WSP gel were prepared, the contents of myofibrillar protein were adjusted equally among the preparations. Each surimi preparation was mixed with 2.5% NaC1 and kneaded to a pasty state after which they were filled into polyvinylidene chloride tubes, pressurized, and stored at 5~ for a specified time (Figure 4.). The change in the physical property was measured by puncture test by rheometer. ' Surimi Protein I

'

Water

'Others

l/!

13.3

"~.3~:3~ 76 ', 1 " N a t u r a l W S P ~.33 76

13.3

,.,

j

l(il ,.~

i

B I I CI

Ill

L-Denatured WSP

,.o

I ++ 20~ Denaturedl-] Del-. S,P j'

,,,

i

Figure 4. Preparation of pressure-induced gel from SURIMI + 25% WSP. (A),(B),(C) was adjusted to have the same myofibrillar protein content. (B) included 25% of natural WSP against the amount of SURIMI protein. (C) included 25% of denatured WSP against the amount of SURIMI protein. Denatured WSP was obtained by heating at 90~ for 30 rain. The content of other components except moisture was adjusted to be the same among each sample.

+ Denatured e"

f / C

/+wsP

/I;

5O0

E

20-

NaCl

Filling in p o l y v i n y l i d e n e chloride tube

' r High p r e s s u r e t r e a t m e n t ~"

(300MPa,OoC,2Omin)

Preservation at 5~

(0,24,48,72,96,120hr)

~ (A) o.~

=

~'- ' "

-

(B) (C)

t

"=-

g

~

O IX3

t t

113

m

t I

..3-

~"

2,5%

_. I - - ' A - -

wsP 7 ~ ~ ~ ~c~ .~,% ~/

~

----lTc)

Mixing

Or

1000

I ce~

i

6

Before Pressurizahon

2;4 4"8 7'2 9"6 150 Storage hour alter pressurization

-<5

I

0

Before Pressunzahon

24 48 72 96 120 Storage hour after pressurization

Figure 5. Physical property change of pressure-induced gel of SURIMI + WSP during storage after pressurization.

367 Figure 5. shows the changes in the physical properties of pressure-induced gel during storage at low temperature after pressurization. The gel strength of (B) at the beginning of the storage was lower than (A) although the gel contained high amount of protein. This would be reflected the inhibitory effect of WSP on gelation. The gel strength of (C) was a little higher than (A), because of the lower water content. It was seemed that the denatured WSP had no inhibitory effect. However, after 120 hours of storing, the gel strength of (B) became very similar to (A) or (C). It can be said that WSP disturbed the pressure-induced gelation of surimi, but the effect was only a delaying one since the maximum gel strength was achieved after a period of storing. On the other hand, there was no difference in the breaking strain which reflects the flexibility between (A), (B) and (C).

Figure 6. The change in SDS-polyacrylamide gel electrophoretic pattarn of pressure-induced gel of SURIMI + WSP during storage after pressurization. To know the change of subunit compositions of myofibrillar protein, each specimen was solubilized in the SDS-Urea medium containing 2% SDS, 8M Urea, 2% Mercaproethanol, and applied to SDS-polyacrylamide gel electrophoresis. In each gel, Myosin heavy chain (HC) decreased corresponding with the increase of the gel strength. This suggested the formation of high molecular weight components of HC. In the gel of SURIMI only, the rate of decrease of HC was the same as that in SURIMI + denatured WSP, but in the gel containing natural WSP, the rate was lower than the former two. These changes were parallel to the change in gel strength. Addition of WSP seemed to delay the gelation of surimi by high pressure. This phenomenon was confirmed by SDS-Polyacrylamide gel electrophoresis, Figure 6. It is concluded that though WSP seemed to impede pressure-induced gelation of surimi, subjecting high pressure to the WSP and Surimi mixture gave a favorable texture in the surimi-based product.

368 4. REFERENCES

1 E. Okazaki and M. Sakamoto. An Inquiry as to the Actual Conditions of Wastewater Treatment at Plants for Processing Alaska Pollack Frozen-Surimi. Bull. Natl. Res. Fish. Sci., No 4, 57-68 (1992). 2 F. Nishioka and Y. Shimizu. Recovery of Proteins from Washings of Minced Fish Meat by pH-Shifting Method. Bulletin of the Japanese Society of Scientific Fisheries, 49 (5,) 795-800 (1983). 3 Y. Miyata. Concentration of Protein from the Wash Water of Red Meat Fish by Ultrafiltration Membrane. Bulletin of the Japanese Society of Scientific Fisheries, 50 (4), 659-663 (1984). 4 H. Niki, T. Kato, E. Deya, and S. Igarashi. Recovery of Protein from Effluent of Fish Meat in Producing Surimi and Utilization of Recovered Protein. Bulletin of Japanese Society of Scientific Fisheries, 51 (6), 959-964 (1985). 5 H. Hasegawa, H. Watanabe, and R. Takai. Methods of Recovery of Fish Muscle Water-soluble Protein by Electrocoagulation. Bulletin of Japanese Society of Scientific Fisheries, 48 (1), 65-68 (1982). 6 E. Okazaki. A Study on the Recovery and Utilization of Sarcoplasmic Protein of Fish Meat Discharged during the Leaching Process of Surimi Processing. Bull. Natl. Res. Inst. Fish. Sci., No.6, 79-160 (1994). 7 E. Okazaki and K. Nakamura. Factors Influencing Texturization of Sarcoplasmic Protein of Fish by High Pressure Treatment. Nippon Suisan Gakkaishi, 58, 2197-2206 (1992). 8 E. Okazaki. Pressure-induced texturization of water-soluble protein denatured by heating, pH-shifting and organic solvent treatments. High Pressure Bioscience, San-ei-shuppan, Kyoto, 296-303 (1994). 9 M. Okada. Effect of Washing on the Jelly Forming Ability of Fish Meat. Bulletin of the Japanese Society of Scientific Fisheries, 30 (3) 255-261 (1964). 10 A. Hashimoto, N. Katoh, H. Nozaki, and K. Arai. Inhibiting Effect of Various Factors in Muscle of Pacific Mackerel on Gel Forming Ability. Bulletin of the Japanese Society of Scientific Fisheries., 51 (3), 425-432 (1985). 11 T. Nakagawa, F. Nakayama, H. Ozaki, S. Watabe, and K. Hashimoto. Effect of Glycolytic Enzymes on the Gel-forming Ability of Fish Muscle. Nippon Suisan Gakkaishi, 55 (6) 1045-1050 (1989). 12 Y. Shimizu and F. Nishioka. Interactions between Horse Mackerel Actomyosin and Sarcoplasmic Proteins during Heat Coagulation. Nippon Suisan Gakkaishi, 40,231-234 (1974). 13 T. Shoji, H. Saeki, A. Wakameda, M. Nakamura, and M. Nonaka. Effect of Storage Temperature on Changes in Gel Strength and Myofibrillar Protein of Pressure-induced Gel of Walleye Pollack Surimi. Nippon Suisan Gakkaishi, 58, 329-336 (1992).

R. HayashiandC. Balny(Editors),HighPressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

369

Application of high pressurization to fish meat: Changes in the physical properties of carp skeletal muscle resulting from high pressure thawing

Keiko Yoshioka a, Ai Yamadaaand Tetsuyoshi Maki b a Department of Food and Nutrition, Faculty of Home Economics, Nakamura Gakuen University, Befu, Jonan-ku, Fukuoka 814-01, Japan b Department of Research and Development, Ichiban Foods Co., Ltd., Ikawa, Iizuka, Fukuoka 820, Japan

Abstract Carp were stored frozen at -25~ for 30 days, half of which were submitted to pressure thawing at 100--300 MPa for 10 min ,while the others were thawed beneath running water at 15N17~ Using fresh carp muscle as a control, the thawed samples were examined by the breaking strength test, creep test and a DSC analysis. In addition, they were also treated by heating. The pressure-thawed samples, which were similar to the fresh samples, showed more breaking stress and elasticity than the running water thawed samples. After heating, the muscle of the pressurethawed samples were almost as soft as the unfrozen sample. Pressure thawing was thus found to maintain a better quality of fish muscle than running water thawing.

1. INTRODUCTION

The freezing point of water is lowered under hydrostatic pressure and both physical properties and behavior are different from those observed under atmosphere pressure; for instance, the melting point of ice is about at -20~ at 200 MPa. As mentioned in the equilibrium diagram of the liquid and the solid of water1), the structure and properties of water under high pressure change markedly at the point of about 200 MPa. Based on this phenomenon some scientists have

370 recently begun to study freezing, thawing and preservation at subzero temperatures using high pressure3)4). When frozen fish muscles are thawed under high pressure, the thawing process is considered to proceed differently from that under atomosphere pressure, because the ice phase in frozen fish muscle changes instantaneously into the liquid phase. As the muscle structure of frozen fish is affected more greatly than that of animal meat by the method of thawing, it is necessary for the thawing method to be improved in order to maintain the quality of fish muscle. Previous studies on pressure-thawing have been reported such as frozen tuna thawed under various pressure conditions s) and a comparison of the quality of carp and chicken muscles under non-freezing presevation and frozen storage6). In this study, carp stored at -25~ for 30 days were submitted to high pressure thawing and running water thawing, and then were compared to unfrozen carp muscles in regard to their physical properties. Furthermore, these thawed muscles were also heated, and thus the changes in the physical properties using these different thawing methods were examined. Based on the above findings, the effects of high pressure thawing on the quality of fish muscle were discussed.

2. MATERIALS AND METHODS

Live carp (Cyprinus carpio) with an average body weight of about 600g were killed in our laboratory by a blow to the head. The carp samples were then divided into three groups, one group of which was used for the experiments immediately as unfrozen samples ( Fresh ), and the other two groups were stored respectively at 5~ for I day ( 5~ 1 day) and-25~ for 30 days. The frozen fish samples were thawed, respectively, by high pressure at 100, 200, 300 Mpa for 10 min ( H . P-Thawed) by a food pressurizing testing machine (MFP-7000) and by running water at 15~17 ~ for about 40 min (R . W-Thawed). In order to observe the effects of heating, each sample was filleted, packed in a polyethylene bag and heated in boiling water for 5~7 min until the central part reached 80 ~ Next, the breaking strength test and creep test of the pressurized and heated carp muscles were measured by a creepmeter (Yamaden RE-3305). The weight reduction ratios of the carp fillets were also calculated before and after the heating treatment and were shown as a percentage. The L, a and b color values of the carp muscles were measured by a color and color difference meter (Nippon denshoku Z1001DP) and thus color differences (AE) were calculated. In addition, the thermal properties were analyzed by differential scanning calorimetry (Seiko E.I. DSC-120).

371

3. RESULTS AND DISCUSSION Regarding the breaking strength properties, the breaking stress, deformation rate and breaking energy were analyzed and are shown in Table 1. For raw meat, the breaking stress of the thawed muscle decreased compared to the unfrozen muscle. However, pressure-thawed muscle showed more elasticity than running waterthawed muscle. These thawed samples were also treated by heating, and were thus compared on the basis of their physical properties in order to clarify the effects of thawing. Regarding hardness after heating, the running water-thawed muscle was 1.5 times harder than the unfrozen muscle, but the pressure-thawed muscle showed almost the same degree of hardness as the unfrozen muscle. Owing to drip loss, the weight reduction ratio of the unfrozen muscle was observed to be less than 10%, while that of the pressure-thawed muscle and running water-thawed muscle were 11.0% and 14.0%, respectively. Tabale 1. Properties of breaking strength of flesh and frozen-thawed carp muscle PX 104 h/H >(100 EX 103 Ratio of weight (N/m) (%) (J/ma) reduction (%) Raw Fresh 8.57_+0.22 33.03+ 1.15 8.95+ 2.02 0 meat 5~ I day 8.77_+0.15 27.12+5.90 9.63-+1.46 0 H. P-Thawd 7.12_+0.98 38.22_+2.32 6.94_+0.49 0 R. W-Thawed 5.28_+0.72 38.94+5.04 6.64_+0.62 0 Heated Fresh 2.01+0.67 31.34+14.07 3.32+2.28 9.60 meat 5~ 1 day 1.85 +0.15 26.99+ 5.08 2.52_+0.34 9.93 H. P-Thawd 2.14_+0.21 32.73_+ 4.60 3.49_+0.52 11.09 R. W-Thawed 3.06_+0.34 39.08_+ 6 . 1 8 6.16+_2.10 13.67 Measuring conditions: deformation rate, 85%; plunger, 16mm ~ ; sample size, 30X30X15mm; test speed, lmm/sec; 5~ I day, refrigerated at 5~ for 1 day; H 9P-Thawed, thawed by high pressure at 200 MPa; R. W-Thawed, thawed by running water; P, breaking stress; E, breaking energy. The results of the creep test are shown in Table 2. All samples were examined within a 7--10% loaded linearity range , and the creep compliance curves were analyzed by the Rheoner auto-analyzed system in four-element models of the viscoelastic modulus of the Voigt body ( EH, Ev, 77v , 77N )" In regard to the viscoelastic modulus in raw meat, running water-thawed muscle and pressure thawedmuscle showed decreases of 33% and 24%, respectively, compared to instantaneous elastic modulus (EH) of the muscles in unfrozen and in refrigerated at 5~ for 1 day. Similarly, for the visco-elastic modulus ( Ev, ~/v, ~?N ), running water -thawed muscle and pressure thawed-muscle showed one third and half as large as those in unfrozen and refrigerated muscles, respectively. For instantaneous elastic modulus of heated meat, the running water thawed and the pressure thawed muscles showed 2.3 times and 1.8 times higher than that in unfrozen muscle, respectively.

372 Table 2. Analysis of creep measurrnent on fresh and frozen-thawed carp muscles EHXllY EvX10~ "r X10 r/vX106 ~ N;KlfF (N/m3 (N/m 2) (sec) (Pa. s) (Pa. s) Raw Fresh 2.83 17.80 5.31 9.44 6.96 meat 5~ I day 2.70 13.10 5.39 7.03 5.77 H. P-Thawd 2.14 7.37 5.28 3.89 3.02 R. W-Thawed 1.89 4.70 4.92 2.32 2.09 Heated Fresh 1.58 5.77 4.88 2.81 3.07 meat 5~ 1 day 1.58 7.99 4.35 3.48 3.80 H. P-Thawd 2.98 8.24 5.09 4.20 3.70 R. W-Thawed 3.56 8.84 4.97 4.40 3.36 Measuing conditions: plunger, 40 mm ~ ; sample size, 20 X 20X 15mm; test speed, lmm/sec; 5~ I day, H 9P-Thawed, R 9W-Thawed, same the above abbreviations EH, elastic modulus of Hookean body; Ev, elastic modulus of Voigt body; v, relaxation time; ~ v, viscosity of Viogt body; ~/H,viscosity of Newtonian body The L, a, b values of flesh color in carp muscles thawed by high pressure and by running water were also determined and are shown in Figure 1. The carp muscles treated by high pressure lost their transparency, together with an increase of the L values and an increase of pressurization. Only slight color differences were detected in the carp muscles thawed at 100 MPa and by running water, while over 200 MPa was observed, which is a substantial difference, compared to unfrozen muscle. The thermal properties of carp muscles thawed by high pressure at 100, 200, 300 MPa and by running water were analyzed by DSC thermograms, and their typical curves are shown in Figure 2. Each carp muscle showed endothermic peaks corresponding to the changes of raw carp meat. H . P-Thawed 100 MPa and R . W-Thawed showed approximately the same behavior as Fresh carp. The endothermic peaks shifted to higher temperature regions with increases of pressure at 200 and 300 MPa. In addition, protein denaturation of carp muscle caused by pressurization was also recognized. Compared to the physical properties of unfrozen fish muscle, the following is concluded; in raw meat, high pressure thawed muscles showed a similar breaking stress to that of unfrozen carp muscle and elasticity was also maintained in the muscle. In heated carp muscles, little difference in the breaking stress was observed in high pressure thawing, while running water thawed muscles were harder and demonstrated more dripping than unfrozen muscle. It is thusconsidered that high pressure thawing preserves nearly the same taste quality as that of unfrozen muscle. Based on the above findings, regarding flesh color and DSC thermograms, high pressure thawing is thus suggested to be a better thawing method of fish muscle as long as the pressure required for thawing is adjusted properly.

373

50 u w~'

~

Fresh carp

6 I ""

. ~~5"C,

1 day

3

:

ms

9

!

~ ~ .

p .Thawed 100 MPa

Fresh lOOMPa200MP=300MPa R ' W

14. P - ] h a w e d

~

200 MPa

'H. 20

rt~ IOOMP200MP300MP R

W

'i

rms~,"1001~ 200l'~ 300l~ .R ' W

Fig. 1. Color and color difference of fresh and frozen-thawed carp muscles. Fresh, fresh carp muscle; 100 MPa, 200 Mpa, 300 Mpa, thawed by high pressure at 100 MPa, 200 MPa, 300 MPa, respectively; R. W, thawed by running water.

0

25

P-Thawed

~ 50

Temperature

75

300 MPa

Thawed

100

( "C )

Fig. 2. DSC tharmograms of carp muscles thawed by high pressure and by running water. Sample weight, 300mg; Heating rate, 2~ Reference, water.

The use of high pressure at low temperatures has also been studied. However, for the pressure-shift method, an appropriate apparatus is still being developed, although a study of frozen tofu has already been reported2). Non-freezing preservation under subzero temperatures enabled the long term storage without any degradation in food texture due to denaturation of protein and a large drip volume but it has also been pointed out that more enzymatic degradation occurred in non-freezing preservation under subzero temperatures than in frozen storage 6) . It has also been reported 5) that in high pressure thawed tuna muscle, the drip volume was limited and the color of the flesh only changed a little, but the tuna muscle had an elastic texture and tasted good. On the other hand, based on a study on the behavior of water and ice at low temperatures 7), as the pressure is transmitted equally and instantaneouly, it is possible to thaw for a short time if the melting latent heat necessary for thawing can be adequately supplied. Based on

374 these findings, it is therefore considered that the pressure thawing of frozen food under low temperatures will develop further in the future.

REFERENCE

1. D.H. Rasmussen, A.P. MacKenzie, C.A. Angell, and J.C. Tucker, Science, 181, (1973) 342. 2. Y. Kanda, and M. Aoki, In High Pressure Bioscience and Food Science, (ed.) R. Hayashi, Kyoto, San-Ei Shuppan Co., 1992. 27-33. 3. T. Deuchi and R. Hayashi, In Pressure Processed Food; Research and Development, (ed.) R. Hayashi, Kyoto, San-Ei Shuppan Co., 1990. 37-51. 4. T. Deuchi and R. Hayashi, High Preesure Biotechnology, (eds.) C. Balny, R. Hayashi, K. Heremans & P. Masson, Colloque INSERM /John Libbey Euretext Ltd. 224, 1992. 353-355. 5. T. Murakami, I. Kimura, T. Yamaishi, M. Yamashita, M. Sugimoto and M. Satake High Preesure Biotechnology, (eds.) C. Balny, R. Hayashi, K. Heremans & P. Masson, Colloque INSERM/John Libbey Euretext Ltd. 224 1992, 329-331. 6. A. Ooide, Y. Kameyama, N. Iwata, R. Uchio, S. Karino, N. Kanyama, High Pressure Bioscience, (eds.) R. Hayashi, S. Kumugi, S. Shimada and A. Suzuki, Kyoto, San-Sei Shuppan, 1994, 344-351. 7. S. Karino, H. Hane and T. Makita, High Pressure Bioscience, (eds). R. Hayashi, S. Kumugi, S. Shimada and A. Suzuki, Kyoto, San-Sei Shuppan, 1994, 2-9.

R. Hayashiand C. Balny(Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

375

T h e r m a l a n d r h e o l o g i c a l p r o p e r t i e s of p r e s s u r i z e d c a r p m e a t N. Iso, M. Horie, H. Mizuno, H. Ogawa, Y. Mochizuki and T. Mihori Department of Food Science and Technology, Tokyo University of Fisheries, Konan, Minato, Tokyo 108, Japan

Abstract In order to make clear the thermal and rheological changes in meat from high pressure treatment, we discussed volume changes, enthalpy changes from measurement of DSC, molecular weight changes from SDS-PAGE, and dynamic viscoelastic measurement on the pressurized samples. Carp meat was pressurized from 98MPa to 490MPa for 13h at I~ Although pressurized meat paste under 294MPa produced a gel by heating, meat paste pressurized at not less than 392MPa gave a brittle structure. A comparison of the results from other measurements suggested that there was a similar denaturation mechanism in both heating and pressurizing treatments.

1. INTRODUCTION Recently application of high pressure treatment to food processing has been investigated by many researchers from various points of view. Iso et al. reported that the meat was slightly denaturated by high pressurization at 196MPa and underwent partial further protein denaturation with additional heating. In order to reveal a difference in the denaturation mechanism between thermal and high pressure treatments, the physicochemical properties of carp meat pressurized at different high pressures are discussed in terms of rheological properties, molecular weight of myofibril, and thermal properties.

2. MATERIALS AND M E T H O D S

2.1. Materials and High pressure equipment The meat of carp Cyprinus carpio (mean weight ca. 1.5kg) was used in this

376 experiment. High pressure equipment ( KP-10-B, Hikari Kouatsu Co.) with two sapphire windows for observation was used for the experiments.

2.2. Measurement of dynamic viscoelasticity Dynamic viscoelasticity of carp meat paste was measured by free damped oscillation-type rheometer (Rhesca TPA-10), in which the added mass suspended in the paste was twisted by 1 ~ , and the samples were heated at the rate of 1K/min in a range from 20 to 90~

2.3. Measurement of differential scanning calorimetry (DSC) Thermal measurements were performed using a differential scanning calorimeter (SSC-560U, Seiko Instruments Inc. ) at a temperature elevating rate of 2K/min in a temperature range from 20 to 100~ 2.4. SDS-PAGE SDS-PAGE was carried out according to the Laemmli method using 7% conc. of polyacrylamide gel. 2.5. Measurements of volume change About 8 cm 3 of sample and lOml of water colored with dye were put into a 2 0 m l glass cylinder and pressurized at different high pressures. The sample volume was measured from the distance of surface movement between the water and kerosene by reading a scale marked on the outer surface of the glass cylinder through the sapphire windows.

3. RESULTS AND DISCUSSION 3.1. Rheological property Typical results of the temperature dependence of G' are shown in Fig. 1. When the samples were pressurized at less than 294MPa and pressurized at 392MPa for less than lh, as shown in sample (B), G' increased at the temperature above 40~ and the samples turned to gel. But G' in the samples pressurized for not less than 3h at 392MPa and all samples pressurized at 490MPa, as shown in sample (C), decreased further, and the samples did not gel in heating.

3.2. Thermal property The DSC thermograms are shown in Fig. 2. In the thermograms of

377

pressurized meat, the endothermic peaks were small compared with the untreated meat and a new peak appeared clearly at around 38~ This peak shifted to low temperature with further high pressure, and it seemed that the phenomenon was the result of decreased myosin thermal stability. The decrease in A H for all pressurized samples indicated that the (A)

(A)

100 .Q

10

9

j

I

T 6

(a)

-e 1O0

(B)'

• LU

c

(c)

10

~r 'o

X

J

]

_(D)

(c)

100

(~.)

10

50 Temperature(~

50

30

100

)

70

Temperature(~

Fig. 1. Effects of temperature of meat paste prepared after pressurizing on the theological parameter, dynamic modulus G', for pressurized meat paste. (A), control; (B), pressurized at 392MPa for lh; (C), pressurized at 392MPa for 3h.

Fig. 2. DSC thermogram of carp meat. (A), control; (B), pressurized at 196MPa for 0.5h; (C), pressurized at 196MPa forl3h; (D), pressurized at 490MPa for 0.5h; (E), pressurized at 490MPa for 13h.

0

fi

40

40 F v

20

7-10

9

0

20 Q.

=-10 0

f0:

0

~

i:~

0

9

I

200

40 F 320 <

90

o

a

150

<~

100

~176

~ I 50

o

.

0 0

9 J

0

i

a

5

' 6r

0

10

1S

Holding Time(h)

5

10

Holding Time(h)

Fig. 4. Time courses of enthalpy change, A tt o- A H, and contraction work, -p A V, of meat pressurized at 294MPa and

Fig. 3. Enthalpy change, All M and AII A, against holdings at various pressurization times. O, not pressurized; O, 98MPa; ~i,, 147Mpa; A, 196Mpa; II, 294MPa; E3,392MPa; 0,490MPa.

490MPa. A Ho- A tt ( 0 , 294MPa; 0,490MPa), and the works at high pressures -p A V (C), 294MPa; O, 490MPa) are plotted against pressurization holding times.

378 denaturation of protein in meat from pressurizing occured as a similar phenomenon to that of heat denaturation. AH M was culculated from the peak area of DSC thrmogram in a temperature range from 20 to 60~

A H A was

culculated from the peak area of DSC thrmogram in a temperature range from 60 to 100~ Myosin was found to be more readily denaturated than actin by pressurizing, as the decrease of A H M was larger than that of A H A. It seems that the decrease of A H A depends on the degree of pressurization.

3.3. Volume change Energy consumed by contraction work under high pressurization is considered to be (A H 0- A H ) . On the other hand, the pressurization work can be calculated from a well-known definition of-p A V, where p is the pressure. A comparison of (AH 0- A H) with -p A V is shown in Fig. 4. The two values could never coincide with each other. The difference between (AH 0- A H) a n d - p A V increases with an increase of degree of pressurization.

3.4. Molecular weight The band patterns of samples pressurized at less than 147MPa were almost the same as those of the untreated samples except for the appearance of a new band, since the molecular weight of the band substance was estimated to be larger than that of the myosin heavy chain (MHC) that located at the same point with a 205kDa marker. This suggested the formation of a cross-linked myosin heavy chain (CMHC) or coaguration of myosin. The effect of myosin polymerization or coaguration is immediately apparent by pressurizing at 196MPa. Pressurizing and heating denaturation show some similar phenomena; the reason seemingly that hydrophobic and hydrogen bonding occurred.

4. REFERENCES 1 Y. Ikeuchi, Nippon Shokuhin Kogyo Gakkaishi, 40 (1993) 299-307. (in Japanese) 2 S. Iso, H. Mizuno, H.Ogawa, Y. Mochizuki, T. Mihori and N. Iso, Fisheries Sci., 60 (1994) 89-91. 3 T. Saito, N. Iso, H . Mizuno, Y. Mochizuki, Repts. Prog. Polym. Phys. Jpn, 27 (1984) 745-746. 4 N. Seki, H. Kokyryo, Nippon Suisan Gakkaishi, 46 (1980) 493-498. (in Japanese)

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

379

Effect of pressure-shift freezing on texture, pectic composition and histological structure of carrots Michiko Fuchigami, Noriko Kato and Ai Teramoto Department of Nutritional Science, Faculty of Health and Welfare Science, Okayama Prefectural University, 111 Kuboki, Soja, Okayama 719-11, Japan Abstract Pressurizing enhanced de-esterification of pectin in carrots, but did not enhance pectic degradation by transelimination; therefore, pressurized carrots did not soften. When raw or blanched carrots were frozen (ca. -18~ at 100MPa (ice-I) or 700MPa (ice-VI), firmness decreased and strain increased, while changes in texture, release of pectin and histological damage in carrots frozen at 200MPa (liquid), 340MPa (ice-III), 400MPa (ice-V) were less than those frozen at 100 and 700MPa. It was also found that carrots stored in a freezer (-30~ after freezing at 200MPa and 340MPa, decreased in firmness and increased strain, but the histological structure was better than those frozen at -30~ (0.1MPa). 1. I N T R O D U C T I O N

Texture is a highly important quality of fruits and vegetables. Freezing may cause severe damage to tissues, and can cause excessive softening. When water is frozen at atmospheric pressure, ice-I is formed, and the volume of water increases during phase transition. Therefore, histological damage to tissues and excessive softening occur. Conversely, when water is frozen at high pressure, the volume of water decreases, and several kinds of heavy ice are formed. Our main objective was to determine the effect of high pressure on texture improvement and tissue damage of frozen carrots. While softening of vegetables by freezing is affected through physical change, in cooking it is brought about mainly by degradation of pectin [1] and is affected by the properties of pectin (low methoxyl pectins are difficult to break down in hot neutral solutions by transelimination [2-4] ). Yamamoto et al. reported that pressurizing decreased the degree of esterification of pectin in a recent study on Japanese radish [5]. Therefore, first the effects of pressurizing and heating on texture, pectic composition and histological structure of carrots were investigated. Second, the effects of pressurizing and heating on pectic degradation were compared using various pH level pectin solutions. 2. M A T E R I A L S & M E T H O D S

The cortex parenchyma of carrot roots (Daucus carota L.) was cut into disks (15 mm diameter and 5 mm thick). The six disks were either pressurized for 45 min at

380 100-700MPa using a Dr. Chef (Kobe Steel Ltd.), or cooked for 3 min or 30 min in boiling water. For freezing under high pressure, the raw or 3 min blanched carrot disks were sealed, put into a pressure vessel (6 cm diameter and 20 cm high) prechilled at -18~ - -20~ immediately pressurized at 100 - 700MPa for 45 min and then thawed at 20~ After treatment, the firmness and strain of carrots were measured using a creepmeter (Rheoner RE-33005, Yamaden Co. Ltd.). Pectic substances with different degrees of esterification were extracted successively using four reagents: 0.01N HC1, 0.1M acetate buffer, 2% sodium hexametaphosphate and 0.05N HC1 solutions [2-3]. Histological changes in the parenchyma of carrots were observed by light microscope and cryo-scanning electron microscope (Hitachi S-4200 or S-4500) [6]. To compare effects of pressurizing and heating on pectic degradation, 0.5% pectin solutions (pH 1 - 13) were pressurized at 700MPa for I hr or heated for 30 min. Pectic degradation was determined by tiobalbituric acid reaction, iodometric method and specific viscosity [7].

3: RESULTS & DISCUSSION 3.1. Effects of pressurizing and heating on texture, pectic composition and histological structure of carrots Typical force-distance curves of raw, cooked and pressurized carrots measured by a creepmeter were compared in Figure 1. Raw carrots, compressed to 20% of their thickness, became broken. About the same firmness was maintained at 90% of thickness. Therefore, raw carrots were crisp. After boiling for 3 min or 30 min, the firmness of carrots decreased respectively. However, pressurizing did not affect the softening. 50 40 . . . . . . . . . . .

m. r a w

A. pressurized at 700MPa for 45 min 0 " cooked for 3 min O" cooked for 30 min

•

20

_

_

.

~

O, 2O

.

.

.

.

.

~ 40 60 80 Strain (%)

100

Figure 1. Force-distance curves of raw, cooked and pressurized carrots by creepmeter. Firmness of pressurized carrots was the same as raw carrots, but pressurizing increased rupture strain above 200MPa (Figure 2). Pectic composition change during cooking or pressurizing is compared in Figure 2. While dipping tissues in a diluted HC1 solution of pH 2 at 35~ 40% of pectic substances were extracted from the tissues by removal of calcium and magnesium [2]. Low methoxyl pectin is usually precipitated with addition of acid. Therefore, it was difficult to extract these pectic substances at pH 2. HCl-soluble pectin was highly methyl-esterified (about 75%). Residues were extracted with acetate buffer

381 solution of pH 4. The acetate buffer-soluble pectin was the low methoxyl pectin (about 50% esterified). About 90% of pectin was extracted from carrots using these solutions. After 30 min cooking, the amount of galacturomc acid in carrots decreased; in particular, the high methoxyl pectin caused softening of carrots to decrease.

Figure 3. Cryo-scanning electron micrographs of the parenchyma of raw, cooked and pressurized carrots. (a) raw; (b) cooked 6 min; (c) cooked 30 min; (d) pressurized for i hr at 700MPa. Bar: (1) 25gm; (2) lgm. CW: cell wall; ML: middle lamella; PM: plasma membrane; PW: primary wall; S: separated region of the cell wall; V: vacuole.

382 Total pectin in pressurized carrots was the same as that in 3 min cooked carrots. However, with rising pressure, the amount of high methoxyl pectin in carrots decreased while low methoxyl pectin increased. Pressurizing reduced the degree of esterification of carrot pectin, suggesting that it decreased by pectin methylesterase during pressurizing. Histological changes of raw, 6-min-cooked, 30-min-cooked and pressurized carrots were observed using cryo-scanning electron microscope (Figure 3) [6]. The pectin-rich middle lamella were observed at the center of primary walls. High magnification micrographs of raw carrots showed reticular structures, with granular components in the middle lamella and primary cell walls. The granular components may be pectic substances. After cooking for 6 min, cell separation in the middle lamella due to pectic solubilization was observed. High magnification micrographs showed fibrous components in primary cell walls. However, while reticular structures and granular components, found in raw cell walls, were not observed, large differences between raw and cooked cell walls were observed. After 30 min of cooking, the degree of cell separation in middle lamella and the spaces among microfibrils increased [6]. The middle lamella of carrots pressurized at 700MPa for 45 min did not separate. 3.2. Effects of p r e s s u r i z i n g a n d h e a t i n g on p e c t i c d e g r a d a t i o n Effects of pressurizing and heating on pectic degradation were then compared. Pressurized 2.5 The amount of double bonds produced by Heated | ' transelimination of pectin was ~ 2 determined by the tiobalbituric acid test (Figure 4). The TBA value of heated ,~ 1.5 pectin increased above pH 5. Therefore, o heated pectin was broken down above ] pH 5 by transelimination. Pectic degradation increased with rising pH, but 0.5 \ ~ .,-A it decreased above pH 8 by alkaline saponification of pectin. However, 0 2 4 6 8 10 12 14 pressurized pectin did not degrade by pH transelimination. The amount of reducing sugar increased rapidly above Figure 4. Effects of heating and pH 5 and slightly below pH 3. Increase of pressurizing on the pectic degradation reducing sugar in pressurized pectin was measured by tiobalbituric acid extremely slight. Specific viscosity of reaction. pectin solutions reduced slightly by pressurizing. Changes in pectic substances of vegetables during cooking are shown (Figure 5). The results suggest that the enhanced softening at neutral and alkaline pH may be ascribed to the degradation of pectin by transelimination mechanism, but at low pH it is caused by hydrolytic cleavage of pectin and removal of divalent cation from the cell walls of vegetables [2]. The vegetables cooked at pH 4 are firmest because these reactions do not occur. Low methoxyl pectin is usually more difficult to degrade by transelimination than high methoxyl pectin through cooking [2-4, 8]. Pressurizing enhanced de-esterification of pectin, and hardly any degradation of the pectic main chain occurred. Therefore, pressurized carrots maintained firmness.

t=

. l.

.

,

.

.

.

.

.

I i

I I='I

I ' P|

i-I

383

O [Pressurized] [Preheated at 60~

Softening

r~OH H

De-esterification [Pectin methylesterase] Saponification [Alkaline pH]

O0

2H3 COH '3

I

I

H

I

OH

H

l Hydrolysis [Heated: < pH g] [Polygalacturonase] COOH

H

I

H

OH

COOH

OH ~

COOCH3

v H I

OH

COOCHz

OH

Transelimination [Heated: > pH 5]

H

H I

gH I

H OH COOCH3

Softenin g !

H OH COOCI-I~

o ~--

Hydrolysis [Heated'< pH 3]

/

H

HH I

H

I

OH

Softening

H I

H

I

OH

Figure 5. Changes in pectic substances of vegetables during cooking. 3.3. Effect of high p r e s s u r e on texture, pectic c o m p o s i t i o n and histological s t r u c t u r e of frozen carrots A phase diagram of the water indicated the freezing point is shown in Figure 6. Changes in texture and structure of 7 0 0 - - 1 ' " [ . . . . , . . . . ~ " r . . . . ~ ' ~ " ~ ' , ' , i, carrots were investigated during .....................V.!.................../" freezing at a pressure of 100MPa 600 Solid 9 .-/ Liquid (ice-I), 200MPa (liquid phase), V 9 "'500 "'"340MPa (ice-III), 400,500,600MPa (ice-V) or 700MPa (ice-VI) at about 400 -20~ When raw carrots were frozen II 2;.... I~." 300 , . III ,, at 100MPa, ice-I formed, firmness decreased, and strain increased 200 " 9 (Figure 7). However, texture of 100 I 9 ".. carrots, frozen at 200,340 and 0 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 400MPa was better than 100 and -5( -40 -30 -20 -10 0 10 20 30 700MPa. At 700MPa, the carrots Temperature (~ strain increased. During freezing under high Figure 6. Phase diagram of water and pressure, pectic composition of raw freezing point ( 9 carrots did not change greatly, and the total pectin decreased only ~t

r

'

"

Y'i

9

',

9, , .

,,

,,_

9

.

9"

.....

. . . .

o-

.,

"',,_

,|

;

;

.._

. ....

f

. . . .

i

. . . .

i

. . . .

i

.

~ = ~ . 1

. . . .

i

|

,

|

|

i

. . . .

r

384

Figure 7. Changes in pectic composition of raw carrots during freezing under high pressure. Symbols: See Figure 2.

slightly (Figure 7). When carrots were frozen at 200MPa and 340MPa, the tissues did not freeze completely. Therefore, after pressure-shift-freeing, they were stored in a freezer at -30~ (0.1MPa). Total pectin and firmness decreased during this storage. The texture of carrots, blanched for 3 min then frozen under high pressure, is shown in Figure 8. When frozen at 200 to 400MPa, the firmness and strain were the same as for non-frozenblanched carrots. However, when carrots were frozen at 100MPa or above 500MPa, firmness decreased while strain increased.

Figure 8. Firmness and strain of blanched carrots frozen under high pressure. R: raw; B: blanched for 3 min. Light micrographs of blanched carrots frozen under high pressure are shown in Figure 9. When carrots were frozen in the freezer at -30~ (at 0.1MPa), 100MPa, or above 500MPa, histological damage (shown by arrows) was observed; but, this was not obvious for those frozen at 200 to 400MPa. However, some correlation between histological changes and texture was noted. Cryo-scanning electron micrograph comparison between the former carrots (a) and this group of carrots (b) is shown in Figure 9. Histological damage in blanched carrots frozen at 100MPa was observed, but it was not above 200MPa. The results suggest that the tissues frozen at 200MPa (liquid phase), 340MPa (ice III) and 400MPa (ice V) were not damaged, while those frozen at 100MPa (ice I) were

385

Figure 9. Light and cryo-scanning electron micrographs of blanched carrots frozen under high pressure. (a) light micrographs; (b) cryo-scanning micrographs. (1) blanched for 3 min (nonfrozen); (2) 100MPa; (3) 200MPa; (4) 340MPa; (5) 400MPa; (6) 500MPa; (7) 600MPa; (8) 700MPa. Bar: 50pm. Arrows: damage.

386

Figure 10. Cryo-scanning electron micrographs of blanched carrots stored in freezer (-30~ (a) blanched then stored; (b) frozen at 200MPa then stored; (c) frozen at 340MPa then stored. Bar: 50pm. Arrows: damage. always damaged. However, above 500MPa, the freezing tolerance may affect histological damage. When blanched carrots were frozen at -30~ histological damage was observed (Fig. 10). However, it was not observed when frozen at 200MPa and 340MPa then stored in a freezer. We conclude from these results that freezing at 200, 340 and 400MPa was effective in improving both the texture and histological structure of frozen carrots. These results were very much in agreement with the results of tofu frozen under high pressure. 4. R E F E R E N C E S

1 J . J . Doesburg, Pectic Substances in Fresh and Preserved Fruits and Vegetables, I. B. V. T., Wageningen, The Netherlands, (1965). 2 M. Fuchigami and K. Okamato, Nippon Eiyo Shokuryo Gakkaishi, 37 (1984) 57. 3 M. Fuchigami, J. Food Sci., 52 (1987) 1317. 4 P. Albersheim, H. Neukom and H. Deuel, Arch. Biochem. Biophys., 90 (1960) 46. 5 A. Yamamoto, M. Kasai, K. Hatae and A. Shimada, Nippon Shokuhin Kogyo Gakkaishi, 39 (1992) 571. 6 M. Fuchigami, N. Hyakumoto and K. Miyazaki, J. Food Sci., 60 (1995) 137. 7 M. Fuchigami. Nippon Eiyo Shokuryo Gakkaishi. 36 (1983) 294. 8 M. Fuchigami, K. Miyazaki, and N. Hyakumoto, J. Food Sci., 60 (1995) 132.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

387

Technique of quality control for Sudachi (Citrus sudachi Hort. ex Shirai)juice by high pressure treatment Akira Iuchi a, Katsuo Hayashi a, Katsuhiro Tamura *b, Toshitaka Kono b, Mitsuo Miyashita b and Swapan K. Chakraborty b aTokushima Prefectural Industrial Technology Center, Saika-cho, Tokushima 770, Japan bDepartment of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan

Abstract

Sudachi (Citrus sudachi Hort. ex Shirai) juice was sterilized by pressurization at 400 MPa for 10 minutes at room temperature and subsequently preserved at -20~ for 120 days. Throughout the period of storage, d-limonene, the major aromatic component in Sudachi juice was determined and thus it was found that Sudachi juice could be sterilized by high pressure treatment and preserved for a long time retaining its natural flavor and quality intact.

1. INTRODUCTION Sudachi (Citrus sudachi Hort. ex Shirai) is a cultivated variety of sour orange which is grown in Tokushima Prefecture, Japan. The juice of this fruit is widely used as an acidulant instead of brewed vinegar for the seasoning or flavoring of various foods. The fresh flavor of Sudachi juice, the most important feature of this fruit, easily disappears during the process of pasteurization, and the adsorption of aromatic components by polymeric sealant films during storage is another cause of quality deterioration. Sudachi juice is usually on the market in small EVA bags, however, the film of EVA often adsorbs aromatic components in the juice. To solve these problems, sterilization of Sudachi juice at room temperature by high pressure treatment and proper selection of polymeric sealant films were studied.

388 2. MATERIALS AND METHODS

Sudachi juice was filled in EVA (ethylene-vinylacetate copolymer) and PET (polyethylene telephthalate) films (60 ml ), pressurized up to 400 MPa for 10 rain at room temperature and then experimentally stored at -20, 2 and 20~ for 120 days. The constituents of fresh (non pressurized) Sudachi juice (Table 1) was determined beforehand in order to observe any detectable change in quality of pressure-sterilized juice during storage. The major aromatic constituent in Sudachi juice, d-limonene, was determined at intervals by bromometry during the period of storage. The best combination of sealant film and temperature for the storage of Sudachi juice was then determined. The number of surviving yeasts and molds in juice was measured by counting colonies after incubation at 25~ for 5 days on the plate of YM agar medium. High pressure equipment used was R7K-6-20-15 type of Yamamoto Hydraulic Pressure Co. Ltd., which can generate high pressure up to 700 MPa. The inside volume of the high-pressure

Sudachi fruit [

[ Squ' ~'eze I

Filling in package (PET1, PET 2, PET 3, EVA)

Sterilization by High Pressure (400 MPa, 10 min)

Itorage

1 ~--

Supply for Analysis

Figure 1. The flowchart of the analysis of Sudachi juice.

.

e-s i.

rl._

. .

.

.

i

.

.

,.,., -~

i

.

,z, ,-,_1

i i .....

time (min)

, ,J

Figure 2. Gas chromatogram of Sudachi oil. Column: OV-1701, 0.53 mm x 30 m, Temp.: 40~ (3 min hold) - 210~ (5~ and 2 min hold), Dtector: FID.

389 vessel is 60 ~ x 200 mm. The time required

Table 1

to pressurize juice specimen to 700 MPa was

Analysis of Sudachi juice A) General items pH Brix (refractive index %) Pulp (%) Citric acid (%) Amino N (mg %) Vitamin C (rag %)

about 1 minute. Figure 1 displays the flowchart of experimental procedures of the analysis of Sudachi juice. chromatogram

An e x a m p l e of gas of S u d a c h i

juice

is

demonstrated in Fig.2 and the major aromatic

2.33 7.8 4.5 6.3 35.5 36.8

compounds in it are shown in Table 1(B). B) Major aromatic components d-Limonene ~(-Terpinen Myrcene ot-Pinene p-Cymene Linalool ]3-Pinene c~-Terpineol Yerpinen-4-ol

3. R E S U L T S The various properties of Sudachi juice are shown in Table 1(A). The elimination of yeast and molds in Sudachi juice depended on the level as well as period of pressurization. When pressurized

].t//juice 172.3 22.0 8.7 4.5 2.9 2.2 1.8 1.6 1.4

100 ml (%) (79.4) (10. l) (4.0) (2.1) (1.3) (1.0) (0.8) (0.7) (0.6)

at 500 MPa, only 1 - 2 min was required for sterilization while in cases of 400 and 300 MPa, the required times of pressurization were 2-5 min and 10 - 20 min respectively (Table 2). Among two kinds of polyester films (EVA and PET) tested for the storage of Sudachi juice, the latter was found to be more suitable than the former to retain better quality of Sudachi juice during storage. When stored in PET films at -20~

the quantity of d-limonene in Sudachi juice

after 120 days of storage was 30 - 40% higher than that of the juice stored in EVA films (Table 3). The quality of frozen juice (-20~

was better than that of the juice stored at 2~ or at room

temperature (20~ Table 2

Elimination of yeast and molds by pressurization Pressure (MPa)

Pressurization time (min) l

2

250

+

+

300

+

+

400

+

-

500

-

-

5

l0

20

390 Table 3

Absorption of volatile aromatic component of high pressure (400 MPa, 10 min) sterilized Sudachi juice by packaging films Storage

Package

conditions

type

1 day (%)

32 days(%)

60 days(%)

125 days (%)

Freezing (-20~

Glass EVA PET 1 PET 2 PET 3

0.165 (100) 0.093 (56) 0.1389(84) 0.160 (97) 0.146 (88)

0.149 (90) 0.092 (56) 0.144 (87) 0.155 (94) 0.158 (96)

0.158 (96) 0.098 (59) 0.150 (91) 0.145 (88) 0.147 (89)

0.157 0.090 0.140 0.150 0.148

(95) (55) (85) (91) (90)

Cold storage (2~

Glass EVA PET 1 PET 2 PET 3

0.160 0.109 0.137 0.142 0.128

0.123 0.075 0.125 0.138 0.141

0.106 0.070 0.122 0.137 0.139

0.110 0.064 0.118 0.136 0.143

(67) (39) (72) (82) (87)

Room temp. (20~

Glass EVA PET 1 PET2 PET 3

0.144 (87) 0.091 (55) 0.121 (73) 0.145(88) 0.130 (79)

Recovered oil (d-limonene m//100 ml juice)

(97) (66) (83) (86) (78)

(75) (45) (76) (84) (85)

0.122 (74) 0.054 (33) 0.085 (51) 0.130(79) 0.127 (77)

(64) (42) (74) (83) (84)

0.112 (67.9) 0.050 (30.3) 0.077 (46.7) 0.115(69.7) 0.114 (69.1)

0.066 (40.0) 0.048 (29.1) 0.069 (41.8) 0.114(69.1) 0.109 (66.1)

Glass data were used as reference for the storage at atmospheric pressure. PET 1, 2 and 3 are the products of different makers.

4. CONCLUSION The retention of natural flavor and better quality of any consumable product even after a long period of storage is of prime importance. From the results of this study, it could be concluded that the natural flavor and the highest possible quality of Sudachi juice could be retained during storage by sterilizing the juice at 400 MPa for 10 minutes at room temperature and preserving subsequently at-20~ in PET films.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

391

Effect of hydrostatic pressure on the sterilization in tomato juice Tetsu Sato, Takahiro Inakuma, and Yukio Ishiguro Research Institute, KAGOME CO., Ltd., 17 Nishitomiyama, Nishinasuno-machi, Nasu-gun, Tochigi-ken 329-27, Japan

1. INTRODUCTION Fresh and nutritious foods have been desired to maintain many people's health. Hydrostatic sterilization in the food processing field has been developed as the technology which doesn't cause product of off-flavor and destruction of nutrient[I-5]. However, experiential laws of thermal sterilization, such as D-value and Z-value, have never been established in hydrostatic sterilization yet. Therefore, for a purpose of establishment of the law in hydrostatic sterilization, the relationships between hydrostatic pressure treatment and effect of the sterilization were studied in tomato juice. Then, the effects of salt and various antimicrobial substances were investigated in tomato juice at 400 MPa.

2. M A T E R I A L S

AND

METHODS

2.1 TOMATO JUICE Tomato juice on the maz'ket was used. Tomato juice (non-added salt) was with an acidity 0.3%, salinity 0%, Brix 5.0% and pH 4.2. On the experiment concerned with salinity, a salt concenu'ation in tomato juice with non-added salt was prepared by adding salt.

2.2 PREPARATION OF TEST BACTERIA

Bacillus coagulans spores[6] which spoil tomato juice were used as the test bacteria. B.coagulans cells stored at-80 ~ were treated by heat (100 ~ l0 minutes)[7] for extinction of nuuitive cells, and were diluted fixed cell number with sterilized 0.9% NaC1.

2.3 ANTIMICROBIAL S U B S T A N C E S Lysozyme (egg white)[8,9] (San-Ei Gen F.EI., Inc. Japan; MW. av. 14,400), polylysine (50%)[8,10] (Chisso CO., Ltd. Japan; MW. av. 3,(I)0), and an extract of etiolated seedlings of adlay (tears) were the antimicrobial substances used. The extract was made from etiolated seedlings grown in the dark (25 ~

4 days), after seeds of adlay has sprouted. The etiolated

392 seedlings was reduced to fine powder in a mortar, alter freeze-dried, then extracted with ethanol, and evaporated[11]. Molecular weight of the central substance of this antimicrobial substance was about 200.

2.4 M E A S U R E M E N T OF MINIMUM INHIBITORY CONCENTRATION (MIC) IN ANTIMICROBIAL S U B S T A N C E S Medium containing 1.5% agar and each fixed concentration (0-8,000 ,u g/ml) of antimicrobial substances put on a plate (60X 15mm). Bacteria cultured in advance was drown a line on the plate with platinum wire. After the plate was incubated at 45 ~ for 3 days, the plate was checked whether bacteria had grown or not on the plate, and MIC in each antimicrobial substances was measured.

2.5 TREATMENT OF HYDROSTATIC P R E S S U R E The hydrostatic pressure ueatment was operated by a hydrostatic pressure apparatus (Type FP-70, San-Ai engineering CO. Japan). 4.5 ml of tomato juice and the culture adjusted each cell number was placed in a polyethylene pouch (45 X40mm). The antimicrobial substance was added in the pouch when the substance was used. Then, final volume in the pouch was 5 ml. These samples were heat-sealed after air was carefully removed from the pouch, and pressurized at 400 MPa and 30 ~ for 1-100 minutes.

2.6 M E A S U R E M E N T OF THE SURVIVAL OF BACTERIA The number of viable bacteria was measured by a colony count after incubation at 45 ~ for 3 days on the plate of proteose peptone acid agar acidified to pH 5 with 1% HCI[ 12].

3. R E S U L T S

AND

3.1 RELATIONSHIPS

DISCUSSION BETWEEN THE TIME OF PRESSURE

TREATMENT

AND THE BACTERICIDAL EFFECT Relationships between the time of pressure treatment and the number of viable bacteria on hydrostatic sterilization were a first order kinetics just like the~xnal sterilization have been reported[ 13]. However, we reported that the death rate of bacteria was not proportional to the time of pressure treatment but the logarithm of the time of pressure t~eatment on hydrostatic sterilization[ 14]. Fig. 1 shows this result. Either the time of pressure treatment in left side of Fig.1 or the logarithm of the time of pressure treatment in fight side of Fig.1 shows on X axis, and the logarithm of the bactericidal effect in both left and fight side show on Y axis. The number of viable bacteria on the hydrostatic sterilization of

B.coagulans spores stayed for a few minutes

and then decreased. When the time of pressure treatment was shown on X axis, the slopes of

393

death rate in the

case

l~ ,o'r

of

different initial cell

t~ '~

~

I I

0

1

t03At~-13.-~ "t. \ 1

I~

t

number I~

lb.

lo' . . . . . . . . .

'

0

were different respectively (Fig. 1 left). This

.'~

10 2

~

10l

result

E

10 o

indicated

1

|r -!

j 0

hydrostatic

accord

with

a

10

100

1000

Time (min)

Left side: X axis is linear, and Y axis is logarithmic. Right side: X and Y axes are logarithmic. Initial viable counts" 0 - - 0 , 1 • 105 CFU/ml; ~ , 1 • 104 CFU/ml; ~ , 1 x 103 CFU/ml.

thermal

sterilization. When

1

200

Fig. 1 Effect of the time of pressure treatment on the survivals of B.coagulans spores in tomato juice at 400 MPa.

first

order kinetics like

.

Time (min)

sterilization did not

l . 100

the

logarithm of the time of pressure treatment was shown on X axis, the number of viable bacteria stayed f o r 5

minutes, and the decrease was shown as a straight line, whose slope was

approximately definite regardless of the initial cell number. 3.2

EFFECT

ON

OF

SALT

10711

HYDROSTATIC

STERILIZATION

IN

~

to 6

~

to 5

Fig.2 shows the result

~

lo 4

tomato

added

.~

t03

spores

~

l02

TOMATO JUICE

that

lo s

juice

B.coagulans

(1 X 107 cfu/ml) and sah (0,

l0 t

1, 2 and 3%) was pressurized

l00

at 400

MPa.

When

salt

content in tomato juice was 1% or less, the result became

. x

,

,

,

.

. . . .

10

, 100

........ 1000

Time (min) Fig. 2 Effect of salt on the survivals of B.coagulans spore in tomato juice at 400 MPa.

the same result of tomato juice with non-added salt and the effect

of

s',flt on

the

Initial viable counts was 1 x 107 CFU/ml. o - - o , Non-added salt; ~ , added salt(1.0%); n , added salt(2.0%); ~ , added salt(3.0%).

394 hydrostatic sterilization did not appear. In the case of salt content of 2% or more, the thne before the initial number of viable bacteria began to decrease was delayed (7-8 minutes when 2%, 10 minutes when 3%) and the slope was slow compared with the case ofsalt content of 1% or less. This result indicated that the effect of hydrostatic sterilization in tomato juice on the market wasn't influenced b6cause salt content in tomato juice on the market was 0.5 % approximately. Taki et al.[15] and Takahashi et al.[16] reported that salt solution around bacteria protected the bacteria according to salt concentration. We consider that the effect of salt appeared in tomato juice in the case of salt content of 2 % or more. 3.3 M I C OF A N T I M I C R O B I A L S U B S T A N C E S

MIC of lysozyme from egg white, polylysine and the extract of etiolated seedling of adlay (tears)(antimicrobial substances) against B.coagulans spore was 20, 90 and 4,700 ,u g/ml respectively. MIC of the exu'act of etiolated seedlings of adlay indicated high value because of rough extract. From these results, we decided that from 0.01 to 10 times of MIC of antimicrobial substances were added to tomato juice. 3.4

E F F E C T OF H Y D R O S T A T I C S T E R I L I Z A T I O N

WITH ANTIMICROBIAL

SUBSTANCES Fig.3 shows the result that tomato juice added B.coagulans spores (SX 103 cfu/ml) and lysozyme (0.1,

1 and 10 times of MIC) was pressurized at 400 MPa. According as

concentration of lysozyme in tomato 10 4

juice became high, the time before the hfiti'al number of viable bacteria began to

~"

decrease seemed to be prolonged. The

~ l03

case of polylysine indicated the same result of lysozyme (Fig.4). Fig.5 shows

.~ ~.

the result that tomato juice added

" fa~

B.coagulans spores

(8 X 103 cfu/ml)

102

l0 ~ 10

and the exu'act of etiolated seedlings of

100

1000

Time (min)

adlay (0.01, 0.1 and 1 times of MIC) was

pressurized.

Regardless

of

concentration of the extract of etiolated seedlings of adlay in tomato juice, the time before the initial number of viable bacteria

began

to

decrease

was

shortened by 1-2 minutes less than

Fig. 3 Effect of lysozyme (egg white) on the survivals of B.coagulans spore in tomato juice at 400 MPa. Initial viable counts was 8 • 3 CFU/ml. o--o, control(non-added); O--D, 0.1 x MIC; m - - I , 1 • MIC; A---~,

10 •

395 control. From these results, the effect

10 4

of hydrostatic sterilization rose in the

tx

case of the extract of etiolated seedlings 103

of adlay was existent. But lysozyme

and polylysine seemed not to be ~

effective.

10 2

We estimate one hypothesis from these results.

It is

molecular weight substances.

........

101

the effect of

1

of antimicrobial

1000

Fig. 4 Effect of polylysine on the survivals of B.coagulans spore in tomato juice at 400 MPa.

of hyd~:ostatic sterilization doesn't the

transformation

Initial viable counts was 8 • 10 3 CFU/ml. , control(non-added); ~ , 0.1 x MIC; H , 1 x MIC; ~ , 10 • MIC.

of

structure and protection of bacteria for

the

l

100

In the case of high

substances, we consider that the effect by

........

Time (min)

of antimicrobial

molecular weight

appear

| 10

existence

of

antimicrobial 104

substances like the effect of salt or

sugar solution around bacteria [15,16].

~ lo3

Molecular weight of each antimicrobial substance is 14,400 in lysozyme,

~

10 2

3,000 in polylysine and about 200 in

.,N ~" ~

10

1

A

the extract of etiolated seedling of

I

adlay. Thus, lysozyme and polylysine

10 ~ 1

l0

maybe indicate the effect of sterilization by permeation of a pm't of lysozyme and polylysine in bacteria, but the effect of lysozyme and polylysine on the

I00

1000

Time (rain) Fig. 5 Effect of the extract of the etiolated seedlings of Adlay on the survivals of B.coagulans spore in tomato juice at 400 MPa.

hydrostatic sterilization did not appear by transformation of structure and the existence of lysozyme and polylysine. On the other hand, the extract of

Initial viable counts was 8 x 103 CFU/ml. o - - o , control(non-added); ~ , 0.01 • MIC; m - - a , 0.1 • MIC; ~ , 1 •

etiolated seedling of adlay permeate in bacteria because of low molecuhu" weight, and the effect of hydrostatic sterilization rose because of low molecular weight.

4. S U M M A R Y We summmize in this study as follows,

396 1. The effect of hydrostatic sterilization in tomato juice became weakly when salt content was 2 % or more. 2. When tomato juice added lysozyme (egg white) or polylysine was treated with pressure, the time before the number of bacteria decreased was prolonged, so these substances seemed not to be effective. 3. The effects of hydrostatic sterilization rose when the extract of etiolated seedlings of adlay was existent.

5. R E F E R E N C E S 1 R.Hayashi, Use of High Pressure in Food, San-Ei Pub. Co., Kyoto, 1989. 2 R.Hayashi, Pressure-Processed Food -Research and Development-, San-Ei Pub. Co., Kyoto, 1990. 3 R.Hayashi, High Pressure Science for Food, San-Ei Pub. Co., Kyoto, 1991. 4 R.Hayashi, High Pressure Bioscience and Food Science, San-Ei Pub. Co., Kyoto, 1993. 5 R. Hayashi, High Pressure Bioscience, San-Ei Pub. Co., Kyoto 1994. 6 M.L.Speck (ed.), "Compendium of Method for the Microbiological Examination of Foods", American Pub. Health Ass. Inc., Washington,D.C., 1979, pp.248. 7 Hersom and Hulland, "Canned Food -An Introduction to their Microbiology-", Kenpaku-sha, Tokyo, 1976, pp.155. 8 T.Onishi, Foods & Food Ingredients Journal, 155 (1993) 81. 9 Y.Osumi, Up-to-date Food processing, 23(8) (1988) 35. 10 T.Endo, Packaging of FoodstufL 24 (1992) 53. 11 Y.Ishiguro et al., Biosci. Biotech. Biochem., 57 (1993) 866. 12 R.Higashi, New Food Industry, 4 (1962) 61. 13 F.H.Johnson et d., "the Kinetic Basis of Moleculaz" Biology", John Wiley & Sons Inc., New York, 1954, pp.286. 14 M.Yasumoto et d., in "High Pressure Bioscience and Food Science", ed. by R.Hayashi, San-Ei Pub. Co., Kyoto, 1993, pp.220. 15 Y.Taki et d., in "Pressure-Processed Food -Research and Development-", ed. by R.Hayashi, San-Ei Pub. Co., Kyoto, 1990, pp.143. 16 K.Takahashi et d., in "High Pressure Bioscience and Food Science",ed. by R.Hayashi, San-Ei Pub. Co., Kyoto, 1993, pp.244.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

High pressure treatment vegetables) preservation

for

397

Nozawana-zuke

(salted

T. Kuribayashi, K. Ohsawa, S. Takanami and K. Kurokouchi Food Technology Research Institute of Nagano Prefecture, 1-205, Kurita, Nagano 380, Japan

Abstract

Nozawana-zuke, a traditional pickled vegetable, was pressurized up to 400 MPa.

Pressurization at 300 MPa for 10 min or longer or at 400 MPa for

0 min (no pressure-holding time) was effective to inactivate microorganisms and increased the preservation period of Nozawana-zuke without losing fresh flavor, texture, and green color which are usually damaged by conventional heat sterilization.

To elongate shelf life of Nozawana-zuke,

a practical

application of high pressure treatment is effective if economical use of high pressure is realized.

1. INTRODUCTION Recent consumers demand low salt contents in pickles for their health.

Nozawana-zuke is a pickle traditionally prepared from fresh leaves of Nozawana (Brassica campestris L. vat. rapifera) in Nagano Prefecture of Japan where it is surrounded by high mountains of Japan Alps and being very cold in winter time.

Nozawana-zuke used to be taken only in winter

time as a local food mainly in Nagano.

Recently, urbanite has developed a

taste and takes in all seasons throughout Japan.

As Nozawana-zuke contains

a relatively low salt of 2 -~, 3%, microorganisms can grow easily to shorten the shelf life.

Although Nozawana-zuke is distributed at low temperature to

inhibit the growth of microorganisms, the shelf life of Nozawana-zuke is only several days even kept at the low temperature.

Low temperature

398 preservation

and

decomposition

distribution

are

also

important

to

suppress

the

of chlorophyl which keeps green color and inhibits the

development of pheophorbide.

In order to develop effective methods to keep

high quality of Nozawana-zuke, i. e., fresh flavor, texture, and green color, which quality is damaged by the conventional heat sterilization 1), a pressure treatment of Nozawana-zuke has been tested in this study 2).

2. MATERIALS AND METHODS To prepare Nozawana-zuke, 11 kg of fresh leaves of Nozawana (Brassica

campestris L. var. rapifera) were placed in a plastic container, mixed with 10 liters of 7% salt solution, and kept for 1 or 2 days with 20 kg of weight as a load.

Nozawana-zuke thus obtained was washed in running water and the

salt solution was wrung out.

Four hundred gram of them was packed in a

plastic bag with 150 ml of salt solution and heat-sealed under vacuum to adjust concentration of salt to be 2.5%.

The bag of Nozawana-zuke was

pressurized at 300 or 400 MPa and room temperature by a high pressure test machine (Mitsubishi, MCT-150S), and stored at 10~

It took 7.5 min to

obtain 400 MPa and 1 min to release the pressure to 0.1 MPa.

No holding

time in this experiment means immediate release of pressure.

Viable cell

count of microorganisms was carried out on standard agar, lactic acid bacteria on plate count agar containing BCP (brom cresol purple), gram negative

bacteria

on

plate

count

agar

containing

CVT (crystal

violet

triphenyltetrazolium chloride), and fungi on potato dextrose agar in which the pH was adjusted to 3.5. Texture and flavor were tested by organoleptics.

3. RESULTS AND DISCUSSION Pressurization at 200 MPa was insufficient to inactivate viable cell count of

microorganisms

decreased

in Nozawana-zuke,

but

pressurization

at 300

numbers of viable cell count of microorganisms,

MPa

lactic acid

bacteria, gram negative bacteria, and fungi with increasing pressurization time (Fig. 1).

399

~9s

.._~ 9s A

r v

6 O

8

= 3 r

~

I 0

t 4 8 Storage period (day)

d~ ~0-

J 12

[

1

0

!

1

1

4 8 Storage period (day)

1

J

12

~9-

~9-

r

6

6 O

O

0o

= 3

3-

r

d~ ~0-

I'1

1

0

Fig.

t

1

I

1

4 8 Storage period (day)

l

J

-cr------o 1

1

0

12

l

1

I

4 8 Storage period (day)

1

I

12

1. Effect of pressurization time on viable cell count of microorganisms

(A), lactic acid bacteria (B), gram negative bacteria (C), and fungi (D) in N o z a w a n a - z u k e.

Pressurization was performed at 300 MPa for 0 (no pressure-holding time) ( O ) , 1 ( A ) , 5 ( & ) and 10 (1-1) min.

Open circles show no pressurization.

cfu means colony forming unit.

Gram

negative

bacteria

was

almost

completely

inactivated

by

pressurizaton at 300 MPa for 10 min.

Pressurization at 400 MPa needed no

pressure-holding

number

time

microorganisms (Fig. 2).

to

decrease

of

viable

cell

count

of

400

~6

A

r

r

4

4

o 0

o r

2

.--.,

~ 1

0

,

t

,

~t

,

l

2 4 6 Storage period (day)

,

2

0 1

0

,

!

,

l

,

l

4 Storage period (day)

9

J

8

Fig. 2. Effect of pressurization time on viable cell count of microorganisms in Nozawana-zuke at 200 MPa (A) or 400 MPa (B). Pressurization was performed for 0 (no pressure-holding time) (O), 1 (A), 5 (A), 10 (l---1) and 30 (11) min. Open circles show no pressurization, cfu means colony forming unit.

Pressurized Nozawana-zuke showed fresh flavor, texture, and green color by organoleptics. Nozawana-zuke pressurized at 300 MPa for 10 min or 400 MPa for 0 min (no pressure-holdig time) was stored at 10~ for 6 days without increasing number of viable cell count of microorganisms. To elongate shelf life of Nozawana-zuke, high pressure treatment is effective.

Acknowledgment. The authors are grateful to Professor R. Hayashi of Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University for his helpful advice.

4.

REFERENCES

1 T. Kuribayashi and T. Miyashita, High Pressure Bioscience, R. Hayashi, S. Kunugi, S. Shimada, and A. Suzuki (eds.), San-Ei Shuppan Co., Japan (1994) 314. 2 T. Matsumoto, High Pressure Bioscience and Food Science, R. Hayashi (eds.), San-Ei Shuppan Co., Japan (1993) 343.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

401

Stabilization of black truffle of Perigord (Tuber melanosporum) by high pressure treatment. A. E1 Moueffak a, C. Cruz a, M. Montury a, A. Deschamps b, A. Largeteau c and G. Demazeau c. aEURIA, Universit6 de Bordeaux I, 39 rue Paul Mazy, 24019 P6rigueux, France bI.S.T.A.B ,cI.H.P. Universit6 de Bordeaux I, Domaine Universitaire, 33405 Talence Cedex, France Abstract The effects of combined high pressure (550 MPa for 30 min) and low t e m p e r a t u r e (40~ 60~ and 80~ treatments on the microbial contamination and organoleptic qualities (aroma, taste and exudation) of black truffle samples were compared with those of classical thermal sterilization (100~ for 3 hours). All the high pressure t r e a t m e n t s at 40~ 60~ and 80~ caused a fungi flora inactivation and drastic reductions of the total mesophilic contamination which turns from 107 to 102 or to less than 10 CFU/g. The exudat ratio, as well as aroma, seems to p r e s e n t no significant change b e t w e e n p r e s s u r i z e d samples and sterilized ones. Described pressure t r e a t m e n t s at low t e m p e r a t u r e followed by storage at 4~ afford a method for microbial stabilization of black truffles. 1. I N T R O D U C T I O N Fresh black truffles have well recognized organoleptic qualities and can be processed through two ways : fresh (kept only few days) or sterilized (kept at room temperature). Truffles are highly fragile and t h e r m a l processing leads to a certain exudation d e t r i m e n t a l to the yield and to the organoleptic properties. Therefore, the thermal t r e a t m e n t should be limited to the minimal required for preservation. The high hydrostatic pressure preservation treatments (100 - 700 MPa) have been suggested as a soft processing technique, allowing the reduction of the t r e a t m e n t t e m p e r a t u r e s or d u r a t i o n , and also for s t a b i l i z a t i o n at low t e m p e r a t u r e [1-3]. High pressure processed foods are already commercialized in J a p a n , mainly fruit juices and m a r m e l a d e s [4]. Extension is now being u n d e r t a k e n to meat products [5], seafoods, and even "Foie Gras" [6].

402 Varied contaminations (Pseudomonas, Bacillus, fungi flora, sporas...) are present on black fresh truffles. The main objective of this preliminary study is to demonstrate the feasibility of combined high pressure/reduced temperature treatment, for the stabilization of vacuum packed, black truffle, in order to diversify its distribution and preserve its organoleptic properties. 2. MATERIALS AND METHODS Raw materials: The black fresh truffles were harvested in Dordogne (France). As usually, before t r a di t i ona l t r e a t m e n t , whole samples were washed, brushed, vacuum packaged (PE/PA/PE) or tin conditionned and refrigerated at 4~ until further experiments. Experimental design: temperatures of 40~ 60~ or 80~ were used during high pressure t r e a t m e n t s , at 550 MPa for 30 min. Three batches were performed using samples kept 2 days, 8 days and 22 days at 4~ after treatment. Samples obtained from high pressure t r e a t m e n t s were compared with samples t r a d i t i o n a l l y processed by t herm al sterilization and with untreated samples. T r ad itio n al t h e r m a l treatments" ten control samples were processed by traditional thermal treatment, similar to industrial or craft ones" introduced in tins with 2 mL water, truffles were sterilized in water at 100~ for 3 hours, then cooled and stored until +4~ High pressure treatment: High pressure treatments were performed at the Interface Hautes Pressions (E.N.S.C.P.B. - L.C.S. - C.N.R.S. Bordeaux France. For each temperature (40~ 60~ and 80~ three samples were pressurized at 550 MPa for 30 min, then cooled immediatly and stored at 4~ Microbiological analysis" The microbial analysis were performed in duplicate at the same dates" 2 days, 8 days and 22 days after t r e a t m e n t s in two laboratories (EURIA and ISTAB) using the same methodology. Counting of total mesophilic aerobic flora at 30~ fungi flora at room temperature, sulfito-reductive anareobic flora, aerobic and anaerobic spore forming bacteria inlg, were performed. Aroma analysis" The analysis were carried out on unt reat ed and treated truffles and on juice of exudation. 0,2g of truffle flesh or 2mL of exudation juice were analysed by a gas chromatographic device TEKMAR (Headspace desorption- concentration - GC introduction). After separation in a Varian gas chromatograph, aromatic compounds were detected and identified in a FININGAN ITS 40, Ion trap, mass spectrometer. Some fresh, t he r m a l sterilized and pressurised samples were equally provided to truffle professionals for sensory analysis at 20 and 120 days after treatment and storage at 4~ Exudation measure" On package opening, the exudation juice was collected and weighted. Exudation was expressed as the weight ratio of exudation juice and fresh whole truffle (w/w).

403 3. RESULTS AND DISCUSSION 3.1. M i c r o b i a l effect o f t r e a t m e n t s

Results concerning the effects of high pressure and thermal treatments on microbiological contamination are given in Table 1. Sulfito-reductive anaerobic flora, anaerobic sporulated and aerobic sporulated floras don't appear in this table, for their initial population was not significative. Table 1 Effect of high pressure t r e a t m e n t on the microbiological contamination of truffles samples (CFU/g) Treatments TMAF (CFU/g) Fungi Flora (CFU/g) Storage days at 4~ Untreated Heat sterilized(100~ 550 MPa/30min. 40~ 60~ 80~

h.)

2 107 <10

8

22

8

22

<10

2 103 <10

<10

<10

<10

102 102 <10

102 102 <10

<10 <10 <10

<10 <10 <10

<10 <10 <10

<10 <10 <10

Table 1 shows that the fungi flora was totaly inactivated whatever the treatment applied even at low temperature (40~ It is well known that the fungi flora seems to be highly sensitive to high pressure [2]. Total mesophilic aerobic flora was reduced by high pressure treatment at 40~ and 60~ from 107 to 102 CFU/g. The high pressure treatment at the strongest temperature (80~ allowed a reduction of contamination similar to those obtained through traditional t h e r m a l sterilization (100~ hours) and provided a good stabilization of the product. We observed after pressurization and storage at 4~ under vacuum for 8 and 22 days, a total absence of growth for the residual contamination. 3.2. Effects o f t r e a t m e n t s o n e x u d a t i o n

Our results about exudation after 22 days expressed as percentages of fresh truffle weights are similar (between 15% to 20%) whatever the conditions used but less than the released amount of juice (25%) reported by Talou et al. [7] after thermal processing. Considering the juice aspect, we observed that the thermal processing led to a darker exudation juice than the high pressure processing, indicating a higher thermal damage of juice components. 3.3. Effects o f t r e a t m e n t s o n a r o m a a n d taste

Aromatic composition of fresh truffle seems not to be modified by high pressure treatments. High pressure t r e a t m e n t preserved in truffle some aromatic volatile components which were extracted in exudation liquid by heat sterilized treatment, as reported by Talou et al. [7]. After 21 days of storage at 4~ the olfactory and taste qualities of high pressurized seemed to be similar to those of heat sterilized ones, but an attractive characteristic was also found by professionnals for pressurized samples, according to the temperature used during high pressure processing.

404 Indeed, the best olfactive as well as taste evaluation was presented by samples pressurized at 40~ After the same delay in the same conditions, an attractive aroma close to that of a sterilized truffles was characterised for two pressurized samples one of which had been opened 21 days after processing. 4. CONCLUSION Results show that truffle bacteriological contamination could be reduced by high pressure processing at lower temperature than traditional sterilization. High pressure treatment (550 MPa, 30 min) could afford two types of new products according to the choosen temperature: on one hand at 40~ tasty truffles with organoleptic properties close to those of fresh truffles storable few weeks and on the other hand, at 80~ stabilized truffles closed to sterilized products but with less modified organoleptic properties. But, further investigations may be made to reduce the exudation by optimization of processing parameters (temperature, high pressure intensity, duration). It is also necessary to investigate more about high pressure effects on aromatic compounds and sensory aspect. 5. ACKNOWI~DGEMENTS Authors would like to thank the F6d6ration D6partementale des Trufficulteurs for supporting this work. 6. REFERENCES 1 2 3 4 5

6 7

R. Hayashi, R. Spiess and H. Schubert (eds.), Engineering and food, London :Applied Science, 2 (1989) 815. J.C. Cheftel, I.A.A., 108 (1991) 141. J.C. Cheftel, in C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology. J. Libbey/Eurotext, INSERM, LondonMontrouge, 224 (1992) 195. H. Kinugasa, T. Takeo, K. Fukumoto, T. Shinno and M. Ishihara, (eds.), High Pressure Bioscience and Food Science. Kyoto : Ei Pub. Co. (1993) 237. A. Suzuki, K. Kim, N. Homma,Y. Ikeuchi and M. Saito, in C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology, J. Libbey/Eurotex, INSERM, London-Montrouge, 224 (1992) 219. A. E1 Moueffak, C. Cruz, M. Antoine, M. Montury, G. Demazeau, A. Largeteau and F. Zuber, Int. J. Food Sci. Tech., 30 (1995) 391. T. Talou, M. Delmas and A. Gaset, Vitt. Flavor Fragr. J., 4 (1989) 109.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

Preparation of salt-free for preservation

miso and its high pressure

405

treatment

Kiyoshi Hayakawa a, Yoshie Ueno a, Shinya Kawamura a, Youichi Miyano b Sunao Kikushima c, Sakiko Shou c and Rikimaru Hayashi d ~Kyoto Prefectural Comprehensive Center for Small and Medium Enterprises, 17 Chudoji Minami-machi, Shimogyo-ku, Kyoto 600. b Hondamisohonten Co., Ltd., Ichijyo-agaru, Muromachidori, Kamigyo-ku, Kyoto 602 c Hishiroku Co., Ltd.,Yamatooji-higashiiru, Matubaradori, Higashiyam-ku, Kyoto 605 dFaculty of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-01.

Abstract Pressurization completely inactivated yeast and enzymes in water but not in stu'romiso. The presence of NaC1 or glucose in stu'romiso had an adverse influence on the high pressure inactivation of yeast and enzymes, whereas ethanol had an effective influence. For effective use of high pressure in inactivating yeast and enzymes in a foodstuff, high pressure treatment was applied to salt-free miso which was newly produced as a test product. Thus, the miso containing low salt was proved to be sterilized at a lower pressure forpreservation. These results indicate that hydrostatic pressure was available to develope new types of food which contain low salt and sugar. 1. I N T R O D U C T I O N

Shiromiso (white miso) is a kind of miso which is made from soybean and rice and used traditionally as a soup in Japan. To make stu'mmiso, a mixture of rice koji and boiled soybean is saccharized for a day and fermented for several weeks. As stu'romiso is used high content of rice koji and fermented

406 for short time in comparison with the other type of miso, it shows white color and named shiromiso. As salt content is lower in shiromiso than in miso, the packed shiromiso is often burst by the yeast growth. However, heating causes undesirable phenomena such as browning, disappearance of a fresh flavor, destruction of nutrients and so forth. A new technical development for sterilization and preservation has been expected. To study the possibility of applying pressure treatment in sterilization and storage of sh/romiso, we investigated for inactivation effect of high pressure on yeast and enzymes contained in shiromiso and in salt-free miso which we produced as a test product. 2. M A T E R I A L S AND M E T H O D S

2.1. Application of hydrostatic pressure About 50 ml of test solutions or miso was packed in a plustic bag and pressurized at 25~ for 30 min. High pressure treatment was performed by a highpressure processor (Mitubishi Heavy Industries, LTD. Model;MFP-7000). 2.2. M e a s u r e m e n t of the yeast cells and the e n z y m e a c t i v i t i e s The number of yeast cells was measured by a colony count after incubation at 30~ for 3 days on the plate of malt extract agar (S. cerey/siae IAM 4274) or 5% NaC1 malt extract agar (Z. rouxii IAM 12880). The activity of neutral protease was measured according to the standard method of National Tax Administration Agency (1974).

2.3. A n a l y s i s of general components of s h i r o m i s o The amino acid concentration was measured by high pressure liquid chromatography (Shimadzu LC-9A). The ethanol concentration was measured by gas chromatography (Shimadzu GC-15A). Glucose was measured by glucose kit (Boehrmger MannheimCo. Ltd.). 2.4. Preparation of s a l t - f r e e m i s o Four types of salt-free miso (A)~(D) were prepared; (A), miso seeded by Zygosaccharomyces rouxii IAM 12880 after saccharization at 55~ for 24 h; (B), miso seeded by Saccharomyces cereyisiae IAM 4274 after saccharization at 55~ for 24 h; (C), miso seeded by Z. rouxii IAM 12880 just after mixing with boiled beans and rice koji; (D), miso seedeed by S. cereyisiae IAM 4274 just after mixing with boiled beans and rice koji. Every miso mash was fermented for four weeks.

407 3. R E S U L T S

AND DISCUSSION

3.1. H i g h p r e s s u r e t r e a t m e n t

for p r e s e r v a t i o n

Neutral protease

Z rouxii A

I0'

C~

~

> ,,. {,D

shiromiso

too

10 ~

"~ 0

of s h i r o m i s o

10'

0

i tom i so

10 ~

3_-.--0

~75 9~

50

I0 ~ 10 N O " r - ,~ 0

"$

200

.

-~ .

400

Pressure ( M P a )

600

0

200

400

600

Pressure ( M P a )

Figure 1. Effect of pressure on the reactivation of yeast and enzyme. Yeast (Z. rouxii [AM 12880) and neutral protease was suspended in shiromiso or in H 2 0.

The halophilic yeast Z. rouxii IAM 12880 in st~'romiso was inactivated by pressurization at 500 MPa for 30 min. at 25~ whereas the yeast in water suspension was inactivated effectively by pressurization at 200 MPa. Neutral protease in shiromiso was not inactivated by pressurization at 600 MPa for 30 min at 25~ whereas protease in the extract from rice koji was inactivated effectively by pressurization at 600 MPa. Thus, pressure to inactivate Z. rouxii and neutral protease was higher pressure in s/~'mmiso than in water

(Fig.l). 3.2. E f f e c t of s o l u b l e c o m p o n e n t s c o n t a i n e d in s h i r o m i s o on t h e h i g h p r e s s u r e i n a c t i v a t i o n of y e a s t a n d e n z y m e . Shiromiso involved soluble components, such as NaC1 (final conc. 4.6%), glucose (final conc. 23.1%) and ethanol (final conc. 2.5%). Fig.2 shows the effect of these soluble component on the high pressure inactivation of yeast and enzyme. When Z. rouxii and neutral protease suspended in buffer solution were pressurized, the presence of NaC1 or glucose had an adverse influence but ethanol had an effective influence for their high pressure inactivation. Neutral protease and Z. rouxii as well as acid protease, s - a m y l a s e , and S. cerev/siae contained in shiromiso also showed the similar results (1,2).

408

2 rouxii

Neutral protease

.,

B

!

|o* |o i

yeast eel is

|o*

etlauol

'~

-t

~o~

\\ ~\ ~\\'"

:l o\ \\

20(-

I0'

6o~

ethalml

~

~_

.

|u'

~ - * ~ - ~ 4 .i.

" total

lu~ ---

aJilm acid

io'

--

io I

o

c (/)

10'

,01

~:~'~------~L*

etl~ao,

|o 4

l

etl~nol |o = 0

Pressure

( MPa

2oo

Pressure

)

400

( MPa

o

60o

~

2

3

,i

o

Fermentation

)

Figure 2. Effect of NaCI, glucose and ethanol in the buffer suspension of yeast and enzyme. Z. rouxii and neutral protease were suspended in NaCl, glucose or ethanol solutions, and pressurized.

~

time

z

:l

,t

(week)

Figure 3. Time courses ot' glucose, ethanol and total amino acid content, and the growlh of yeast during fermentation of salt-free miso. Samples A, B, C and I) are explaine(I in the text.

3.3. P r e p a r a t i o n of s a l t - f r e e m i s o a n d i t s high p r e s s u r e t r e a t m e n t To increase the high pressure inactivation of yeast and enzyme in a food stuff, we produced salt-flee miso as an experiment. Four types of salt-flee miso was made according to the four methods described. Either Z. rouxii IAM 12880 or S. cerevisiae IAM 4274 which produces ethanol was seeded to every miso m a s h to prevent spoiling. Fig.3 showed the time courses of glucose, ethanol and total amino acid content, and growth of yeast during fermentation of salt-flee miso. Type A of salt-free miso, which was seeded by Z. mux/i after saccharized at 55~ 24 h, showed best taste and low level of infecting bacteria. Neutral protease

Z. rouxi i A

~aCI

~06

t"

I0 ~ 10 9

0 U

10 s

.~

IoZ

"~

i. "1 OO

5~,

,,. lO0

i$o

~laCl

10 ~ NO--t?

5C

T, 0

200

O~

400

Pressure ( M P a )

6;0

0

200

Pressure

,~00

600

( MPa )

Figure 4. h;ffect of NaC1 cont~;nt in miso on tile pressure inactivation of yeast an(lenzyme. Salt-free m i s o was mixed thoroughly with Z. rouxii and verious qua,ltity of NaC! and pressurized.

409 Fig.4 showed the effect of N aC1 on the pressure inactivation of yeast and enzyme mixed in the type A salt-free miso. Yeast was inactivated by pressurization at 300 MPa and 25~ for 30 min. The yeast in the miso containing 5 and 10% NaC1 was inactivated by pressurization at 400 and 500 MPa, respectively. Addition of NaC1 to the salt-free miso had an adverse influence on the pressure inactivation of Z. roaxii. On the other hand, no difference of protease inactivation between salt-free miso with and without NaC1, was observed by pressurization at 0-600 MPa. Thus, the present salt-free miso can be sterilized at a lower pressure for preservation.

4. R E F E R E N C E S 1 K. Hayakawa, Y. Ueno, S. Kawamura, Y. Miyano, S. Kikushima and S. Shou, High Pressure Bioscience, R. Hayashi et al (eds.), Kyoto, Japan, (1994) 320. 2 K. Hayakawa, Y. Ueno, S. Kawamura, Y. Miyano, S. Kikushima, S. Shou and R. Hayashi, Nippon Nogeikagaku Kaishi, 69, No.8, (1995) 1021.

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

411

Texture and cryo-scanning electron micrographs of pressureshift-frozen tofu Michiko F u c h i g a m i a n d Ai T e r a m o t o Department of Nutritional Science, Faculty of Health and Welfare Science, O k a y a m a Prefectural University, 111 Kuboki, Soja, Okayama 719-11, J a p a n Abstract The objective of this study was to research the effect of high pressure on improvement in texture of frozen tofu. While the firmness and strain of tofu frozen at 100MPa at ca. -18~ increased, t h a t of tofu frozen at 200MPa and 340MPa was almost the same as untreated tofu. As pressure rose, firmness and strain increased, texture became worse. The pore size in tofu frozen at 200MPa 400MPa was smaller than in tofu frozen at 100MPa and 700MPa. Freezing formed ice crystals in the gel network causing it to contract. Tofu with a tight network was firmer than tofu with a loose network by cryo-SEM observation. It appeared that the shrinkage affected the firmness, while the size of the ice crystals affected the strain of frozen tofu. 1. I N T R O D U C T I O N Texture is a highly important quality of tofu (soybean curd). However, tofu frozen at atmospheric pressure is undesirable because it is spongy. Kanda et al. reported t h a t structure of pressure-shift-frozen tofu at 200MPa was better than tofu frozen by air-blast method [1]. Thus, our objective was to determine in detail the effect of high pressure on the improvement in texture of frozen tofu. Changes in the texture and structure of tofu were investigated during freezing at a pressure of 100MPa (ice-I), 200MPa (liquid phase), 340MPa (ice-III), 4 0 0 , 5 0 0 , 6 0 0 M P a (ice-V) or 700MPa (ice-VI) a t - 18~ - -20~ This tofu was compared with untreated tofu, pressurized tofu (non-frozen) or tofu frozen in freezers (F: -20~ -30~ or -80~ at atmospheric pressure. 2. M A T E R I A L S & M E T H O D S Packed kinu-tofu coagulated with magnesium chloride and glucono-delta-lactone (Eishoku Co. Ltd.) was cut into i x 1 x i cm (S) and 3 x 3 x 1.5 cm (L) pieces. The 8 (S) or 3 (L) pieces of tofu were vacuum packed in heat-sealed polyethylene bags and put into a pressure vessel (6 cm in inside diameter and 20 cm high) previously kept at -18~ - -20~ They were immediately pressurized for 45 min (S) and 90 min (L) at 100 - 700MPa using a Dr. Chef (Kobe Steel Ltd.). After freezing under high pressure, they were stored for 2 days in a freezer (-30~ and then thawed at

412 20~ Firmness and strain of this tofu were measured by a creepmeter (Rheoner RE-33005, Y a m a d e n Co.). Structure of the central (S, L) and outer parts (L) of frozen tofu was observed by cryo-scanning electron microscope (Hitachi S-4500), while the pore size was analyzed by a mac-scope (Mitani Co.).

3. RESULTS & DISCUSSION 3.1. Texture of tofu frozen under high pressure The texture of pressurized (non-frozen) and frozen-thawed tofu (S) is shown in Figure 1. With rising pressure,the firmness and strain of pressurized tofu (nonfrozen) increased slightly. When tofu was frozen at atmospheric pressure (0.1MPa) or 100MPa, ice-I formed, and the firmness and strain were greatest to least: -20~ > 100MPa > -30~ > -80~ respectively. Sensory evaluation of tofu frozen in -20~ was worst among all treated tofu. However, firmness and s t r a i n of tofu frozen at 200MPa and 340MPa were almost the same as t h a t of u n t r e a t e d tofu, and sensory evaluation was good. As pressure rose from 400MPa to 700MPa, firmness and strain increased, and texture became worse. 12 r

~ 10 O

Frozen

Non-Frozen

8

x 6

v ~24 ~ ~ @ ~ ~ ~ ~ ~ ~ ~ ~ o lO0

x

80

::~.:

60

:::: --

N

9

UT100200340400500600700-20-30-80 UT 100 200 340 400 500 600 700

I

Ice'I

I L

I

MPa,-18~ Freezer ( ~ L III V V V VI I I I

[

I

Pressurized (MPa)

Figure 1. Texture of pressurized tofu and frozen-thawed tofu. UT 9untreated tofu (non-frozen).

3.2. Structure of tofu frozen under high pressure Cryo-scanning electron micrographs of untreated and pressurized tofu are shown in Figure 2. The network of protein gel in untreated tofu was observed to change slightly in tofu pressurized at 700MPa.

413 Change in structure of frozen tofu is shown in Figures 3 and 4. Pores of ice-I in tofu were long and large (-20~ > -30~ > 100MPa, -80~ However, ice pores in tofu frozen at 200MPa (liquid phase), 340MPa (ice-III), and 400 - 600MPa (iceV) were round. Histological damage in tofu frozen at 700MPa was greatest among tofu frozen under high pressure.

Figure 3. Cryo-scanning electron micrographs (low magnification) of tofu (S) frozen for 45 min under high pressure. (1) untreated; (2) 100MPa; (3) 200MPa; (4) 340MPa; (5) 400MPa; (6) 500MPa; (7) 600MPa; (8) 700MPa. Bar: 50~tm.

414

Figure 4. Cryo-scanning electron micrographs (high magnification) of tofu (S) frozen for 45 min under high pressure. (1) 100MPa; (2) 200MPa; (3) 340MPa; (4) 700MPa. Bar" 0.5pm. The pore size of frozen-thawed tofu (S and L) analyzed by a mac-scope is compared in Figure 5. Ice pores in small size tofu (S) were smaller than those in large size (L), and ice pores of the outer part (L) were smaller than those of central part (L). Also, the pore size in tofu frozen at 200MPa ~ 400MPa (L) or 600MPa (S) was smaller t h a n in tofu frozen at 100MPa, 700MPa, -30~ and -20~ 53

~ 25 S: lxlxlcm

L: 3x3x1.5cm,Outer Part

.

L: 3x3• Central Part

/.-/

~o 20 ~15 bl

N10 0

/.,v

/ / /

t l i 111

! t l i l l

~% j j j

100 200 340

Ice 'I

400 500 600 700 100 200 340 400 500 600 700 -20 -30 -80 100 200 340 400 500 600 700 -20 -30 -80

MPa,-18~ MPa,-18~ Freezer(~ MPa,-18~ Freezer(~ L III V V V VI I L IIIV V V VI I I I I L IIIV V V VI I I I

Figure 5. The pore size of frozen tofu analyzed by a mac-scope. Freezing formed ice crystals in the gel network causing it to contract. Tofu with a tight network was firmer than tofu with a loose network by cryo-SEM observation. It seemed that shrinkage of the gel, due to the growth of ice crystals, affected the firmness, while the size of the ice crystals affected the strain of frozen tofu. 4. R E F E R E N C E S

1 Y. Kanda, M. Aoki and T. Kosugi, Nippon Shokuhin Kogyo Gakkaishi, 39 (1992) 608.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

C o m b i n e d effects of t e m p e r a t u r e

415

a n d p r e s s u r e o n i n a c t i v a t i o n of h e a t -

resistant bacteria Takashi OKAZAKI a, Koji KAKUGAWA a, Shinya YAMAUCHI a, Tatsuo YONEDA ~ and Kanichi SUZUKI b aHiroshima Prefectural Food Technology Research Center 12-70 Hijiyamahonmachi, Minami-ku, Hiroshima 732, J a p a n bDepartment of Applied Biological Science, Hiroshima University 1-4-4 Kagamiyama, Higashihiroshima 739, J a p a n Abstract Survival behavior of heat resistant bacteria (Bacillus, Clostridium) were studied in the temperature range from 35~ to l l 0 ~ under the controlled pressures up to 400 MPa. The death rates of organisms at 100~ and l l 0 ~ under 400 MPa were 7.4 times and 13.6 times higher than those at normal pressure. 1. I N T R O D U C T I O N

In most of the food industries, food products have been sterilized by heating. However, the excessive t h e r m a l conditions for ensuring the safety of microbial spoilage degrade the quality of products. The recent studies on the effect of high pressure on food processing have shown that the high pressurized treatment has an advantage of sterilization and quality of foods ~). However, it has also been proved that the heat resistant organisms, such as the spores of Bacillus and Clostridium species, have some pressure resistance 2). Thus, we have investigated the thermal inactivation combined with pressure for effective sterilization of these organisms. 2. M A T E R I A L A N D M E T H O D

Organisms used in this study were Bacillus subtilis (Research Laboratory, J a p a n Canners Association No. 1403, D10~oc=13.9min), B. coagulans (ATCC7050, Di10oc=13.9 min) and Clostridium sporogenes (PA3679, D.10oc=10.8 min). A sample tube made of silicon rubber (I.D.=5mm, L= 150mm), containing spore suspension (ca. 107 spores/ml, pH7.0, 1/15M phosphate buffer) was inserted into a pressure vessel in Fig.l, followed by heating the vessel in a constant temperature bath under the controlled pressure. Temperature and pressure histories at 100~ + 400 MPa for 10 min, for example, is shown in Fig.2. The survival spore numbers of B. subtilis and B. coagulans in the treated suspension were measured by counting the colonies which grew on a standard agar plate. In the case of C.sporogenes, the spore numbers were done by using a

416 y e a s t extract starch agar.

Fig.1 Schematic d i a g r a m of experimental a p p a r a t u s 1" pressure vessel; 2" thermocuple; 3: silicon tube;4: sample; 5: pressure gauge; 6: pressure p u m p

400

100 o

~

75

v

~9

9 50 0.1

B ~

25 I

0

I

I

I

200 400 600 Heating Time (s)

I

800

Fig.2 An example of t e m p e r a t u r e and pressure histories of a sample during heating at 100~ for 10 min under 400MPa

3. R E S U L T S

AND

DISCUSSION

Survival curves for spores ofB. subtilis and B. coagulans at up to 110~ u n d e r 400MPa are shown in Fig.3. Even at moderate t e m p e r a t u r e s ranging from 35~ to 65~ B. subtilis was inactivated at 400 MPa, though the survival curves did not obey the first order rate equation. However, B. coagulans was not inactivated under

417

10 7 ~,-__.__~_o__

o> o,-.q

~

in

10e

i

25~

lO 5

50~ 70~

~

lO 4

> lO ~

or]

lO 2

101

65~

lO 0

i

0

10

4,, 110~ ,

i

,

i

20

,

i

30

,

40

i

,

i

50

v

,

60 0 , 10 Time (min) ,

,

20 '

'

3" 0

'

40 '

,

50 ,

,

60 ,

,

70

Fig.3 Survival curves for spores of Bacillus subtilis (left) and B. coagulans (right) at t e m p e r a t u r e s r a n g i n g from 25~ to 110~ u n d e r 400MPa

the s a m e conditions. It b eg an to die at the t e m p e r a t u r e s higher t h a n 100~ u n d e r 400 MPa and the survival curves obeyed the first order rate equation. Sale et al? ) reported t h a t B. coagulans spores decreased from 100% to 0.0037% at 3000 atm. (ca.300 MPa) at 70~ and B. subtilis spores were 1250 times more r e s i s t a n t t h a n B. coagulans spores at the s a m e conditions. While in this result, B. coagulans spores decreased in ca. 1/10 of initial spore n u m b e r even at 400 MPa + 70~ for 60 min and B. subtilis spores died considerably at 400 MPa + 65~ O ur result disagreed with their report. Survival curves for spores ofB. coagulans (110~ and C. sporogenes (110~ at the p r e s s u r e s r a n g i n g from 0.1 M P a to 400 M P a are s h o w n in Fig.4. P r e s s u r e influenced so m u c h the inactivation of these bacteria. T h o u g h the d e a t h ra te s of both o r g a n i sm s at 100 M P a were slightly s m a lle r t h a n those at n o r m a l pressure,

lO 7

lg o>

,,--4

~

IOOMPa

105

IOOMPa

104 I03

%

....200MPa

"~.

102

101

lO~o

400MPa~ i

10

,

aOOMPa I

20

,

400MP~a 300MPa

i

30

O.1MPa !

0

10

20

30

40

Time (min) Fig.4 Survival curves for spores of B. coagulans (left) and Clostridium sporogenes (right) at pressures ran g in g from 0.1MPa to 4 0 0 M P a at 110~

418 their rates remarkably increased at more t h a n 200 MPa. The survival curves obeyed the first order rate equation at all pressure ranges. It is indicated t h a t the survival curves ofB. subtilis spores obeyed the first order rate equation at more than 100~ under 100 MPa to 400 MPa. 4) On the other hand, K a k u g a w a et al. ~) showed t h a t the

Table 1 Rate constants of various bacterium spores under pressure Death rate constants Pressure (MPa) 0.1 200 400

B. subtilis 4) 105~

B. c o a g u l a n s 110~

C. sporogenes ll0~

3.4• .2 ( - ) 5.6• .2 ( - ) 1.0• * 1.4x 10-1(2.5) 2.5x 10-1(7.4) 4.8x 10-1(8.6)

5.5• .2 ( - ) 2.7x 10-1(4.8) 7.7•

* The ratio of the death rate constant u n d e r pressure / normal pressure survival curves ofB. stearothermophilus spores did not obey the first order equation even at the temperatures ranging from 100~ to 120~ under 100 MPa to 400 MPa. Thus, the types of the survival curves are dependent on species of organisms. The death rates ofB. coagulans and C. sporogenes at l l 0 ~ under 400 MPa were 8.5 times and 13.6 times higher t h a n those at normal pressure, respectively (Table 1). The d e a t h rate ofB. subtilis spores (105~ at 400 M P a was 7.4 times higher t h a n the value at n o r m a l p r e s s u r e 4). As the r e s u l t of the combined t r e a t m e n t of t e m p e r a t u r e and p r e s s u r e , it will be possible to reduce the conditions of t h e r m a l sterilization (heating time and the temperature). On the basis of the results of this study, we have developed a high pressure-temperature experimental apparatus. The pressure-chamber is 100 m m I.D. x 300 m m height. We have been investigating the inactivating behavior of spores in real size foods by using the apparatus.

4. R E F E R E N C E S 1 Y a s u m o t o M., H a y a m i z u M., I n a k u m a T., High P r e s s u r e Bioscience and Food Science( Sanei shuppan), (1993) 213. 2 K i n u g a s a H., Takeo T., F u k u m o t o K., I s h i h a r a M., Nippon Nogeikagaku Kaishi, 66(1992)707. 3 Sale, A.J.H., Gould, G.H., and Hamilton, W.A.,J. Gen. Microbiol., 60(1970) 323. 4 0 k a z a k i T. a n d Suzuki K., Nippon S h o k u h i n Gakkaishi, 41(1994) 536. 5 K a k u g a w a K., O k a z a k i T., Y a m a u c h i S., Morimoto K., Yoneda T. and Suzuki K., ( in submission )

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

419

Sterilization of yeast by high pressure treatment Y.Aoyama, M.Asaka, R.Nakanishi and K.Murai Laboratory of Biological Chemistry, Toyo Institute of Food Technology, 23-2-4, Minamihanayashiki, Kawanishi-shi, Hyogo 666, Japan Abstract Sterilization of yeast by high pressure treatment was studied in comparison with that by heat treatment. Saccharomyces cerevisiae, Candida tropicalis, Candida parapsilosis and the yeast isolated from digestive tract (Japanese traditional fermented food, ika-siokara) were tested. The pressure survival curves of these yeasts showed to be sigmoidal. Considering D-values obtained from the regression analysis of survival curves, pressure stability of yeasts had a good correlation with heat stability. Z-values of yeasts ranged from 80 to 100 MPa for high pressure treatment, 5 to 7~ for heat treatment. A larger z-value means a weaker pressure effect. 1. I N T R O D U C T I O N Many attempts have been made to apply high pressure treatment for food processing because of it's retaining food's nutrients and taste recently [1-3]. Although there are many works about high pressure sterilization, the sterilization effect is still not completely elucidated. Whether pressure death kinetics of microorganisms follows first order reaction has not been obvious yet [4,5]. It is important to evaluate the sterilization effect of high pressure treatment in comparison with that of heat treatment because heat treatment has been used mainly for commercial sterilization in the food industry. But there are few reports concerning with the relationship between pressure stability and heat stability of microorganism. In this study we examined sterilization of yeasts by high pressure treatment compared with that by heat treatment. The death kinetics of yeasts by pressure treatment was examined. D-values were calculated from the regression analysis of survival curves. The relationship between pressure stability and heat stability of yeasts was examined from the D-values obtained. The influence of culture conditions and growth temperature on the pressure stability of yeasts was examined. Using the z-value obtained from pressure-death-time curves, we calculated time at different pressure for the sterilization effect equivalent to 400 MPa-10min treatment.

420 2. M A T E R I A L S A N D M E T H O D S 2.1. M i c r o o r g a n i s m s

Saccharomyces cerevisiae (JCM 1499), Candida tropicalis (JCM 1541), Candida parapsilosis (JCM 1618) were obtained from the Institute of Physical and Chemical Research (Wako, Japan). The yeast isolated from ika-siokara (IS) was identified as Candida tropicalis. These were grown in potato dextrose agar and broth, YM agar and broth media (Difco, Detroit, USA) at 15, 25, 35~ They were stored in a refrigerator until use. The suspension of yeast was treated with ultrasonication for 5 rain using Bransonic cleaner (60W, 45kHz) to break clump of yeast. Ultrasonicated sample was checked with microscope and laser particle size distribution analyzer LA-500 (Horiba, Kyoto, Japan). 2.2. H i g h p r e s s u r e t r e a t m e n t and h e a t t r e a t m e n t Suspension of yeast was sealed in a plastic pouch and treated at 300, 350, 400, 450 and 500 MPa at 20% with high pressure test machine, MFP-7000 (Mitsubishi Heavy Industries, Hiroshima, Japan). The solution for suspension was 1/15 M phosphate buffer (pH 7.0) containing 5% sodium chloride. During pressurization, the t e m p e r a t u r e within high pressure vessel raised by 5 ~ because of adiabatic compression and when the pressure became constant, the temperature was kept at about 20~ Heat t r e a t m e n t was performed as follows: the suspension of yeast was injected into the same buffer as suspension of yeast in a t e s t - t u b e preheated at a given temperature. And sampling of an aliquot was carried out at a time interval. After treatment, the sample was incubated by plate-counting method for enumeration of survivor of yeasts. Potato dextrose agar medium was used, and the sample was cultured at 25~ for 3 or 4 days.

3. R E S U L T S AND D I S C U S S I O N 3.1. S u r v i v a l c u r v e s of y e a s t s Survival curves were shown to be sigmoidal at 300, 350 MPa (Fig 1). We obtained this results of experiment used the yeast isolated from ika-siokara. As to other yeasts similar results were obtained. The influence of clump of yeasts on type of survival curve was studied with ultrasonicated sample and untreated sample. The linearity was improved slightly but the curve was sigmoidal basically. The survivor curve tended to be more linear when the pressure was higher. Heat t r e a t m e n t also did not show linear curve (Fig. 2). Although the cause that these curves are sigmoidal is unclear, it seems to be due to other causes for example the heterogeneity of p r e s s u r e stability of yeast [6]. 3.2. I n f l u e n c e of c u l t u r e c o n d i t i o n s on p r e s s u r e s t a b i l i t y of y e a s t s The influence of growth t e m p e r a t u r e and culture media on pressure stability of yeasts was examined. The influence of growth t e m p e r a t u r e on the pressure stability of S. cerevisiae was shown in Fig 3. The pressure stability of the yeast cultured at 35~ was higher than that at 15 and 25~ The result obtained on heat stability test was similar. The cell size and composition of cell membrane may be concerned with the higher pressure stability of yeast grown at higher t e m p e r a t u r e [7].

421

-2 v

v -

t~

4

bO

0

0

-

0

i. . . . . .

5

I0

m3OOHPa #350t{Pa i

.

15

T i m e ( min )

H3OOHPa

-8

20

v350dPa

0

5

I0

T i m e ( min )

15

20

Figure 1. Survival curves for the yeast isolated from ika-siokara in 1/15 M phosphate buffer (pH 7.0) containing 5% sodium chloride at 300, 350 MPa. Left" untreated sample Right" ultrasonicated sample

o

2

mlS~ 92 5 ~

~i 2~z~o

9

c~b0oi

.,4

~

435~

0

nN).o~c 6

.

-

,,!

0

.52.5"C |

5

10

i

1,5

T i m e ( rain)

20

Figure 2. Survival curves for the yeast isolated from ika-siokara in 1/15M phosphate buffer (pH 7.0) containing 5% sodium chloride at 50, 52.5~

__ 1 1

j

300

350

Pressure

i

400

(HPa)

450

Figure 3. Pressure-death-time curves (z-values) for S.cerevisiae grown at different temperature.

422

Table 1 Pressure-time combination giving sterilization effect equivalent to 400 MPa-10min treatment at ambient temperature (z-value = 80 MPa)

r'0. 863 t~

m

,~ 400

t~

Pressure I

eL,

S.cerevisiae

(lilPs) '

& IS

.0 C.tropicalis 0 C.parapsilosis

200

50

55 Teupera

60

ture(~)

65

Figure 4. Scatter plot of the pressure and temperature corresponding D-value to lmin, respectively (relationship between pressure stability and heat stability of yeasts).

300 350 400 450 600

Duration time (uin) 178 42 I0 2.4 0. 66

3 . 3 . R e l a t i o n s h i p b e t w e e n p r e s s u r e s t a b i l i t y and h e a t s t a b i l i t y of y e a s t Considering that the pressure and temperature corresponding D-value to 1 minute represent pressure stability and thermal stability, respectively, the relationship between pressure stability and heat stability of yeasts was evaluated (Fig.4). The pressure stability of yeasts had high correlation with the thermal stability (correlation coefficient" 0.853). The z-values of yeasts ranged 80 to 100 MPa for high pressure treatment, 5 to 7~ for heat treatment. There is not a good correlation in z-values between pressure sterilization and heat sterilization. A larger z-value means a weaker pressure effect. In case of z-value equal to 80 MPa , the relation of pressure to time for sterilization effect equivalent to 400 MPa-10min treatment at ambient temperature were shown as Table 1. For application of high pressure treatment in food processing, operation condition at lower pressure is desirable from the viewpoint of equipment cost. However, a longer time treatment is required to sterilize yeasts at lower pressure. Also elevation of pressure by 80 MPa is more difficult than that of temperature by 5~ So, high pressure treatment at ambient temperature is more unfavorable than heat treatment. REFERENCES

1 C.Balny,R.Hayashi,K.Heremans and P.Masson (eds.) High Pressure and Biotechnology, John Libbey Eurotext Ltd., France, 1992. 2 D.G.Hoover, Food Tech., No.6 (1993) 150. 3 Y.Horie, K.Kimura, M.Ida, Y.Yoshida and K.Ohki, Nippon Nogeikagaku Kaishi, 66 (1992) 713. 4 C.Hashizume, K.Kimura and R.Hayashi, Biosci.Biotech.Biochem., 59, (1995), 1455. 5 Y.Ishiguro, T.Sato, T.Okamoto, H.Sakamoto, T.Inakuma and Y.Sonoda, Nippon Nogeikagaku Kaishi, 67 (1993) 1707. 6 0 . C e r f , J.Appl. Bacteriol.,42 (1977) 1. 7 R.Hayashi(eds.) High Pressure Science for Food,San-Ei Pub.Co.,Japan,1991.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

423

High pressure inactivation of yeast cells in saline and strawberry jam at low temperatures Chieko Hashizume b, Kunio Kimura b, and Rikimaru Hayashi' 'Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606, Japan ~leidi-Ya Food Factory Co., 3-1-13, Nishigawara, Ibaraki, Osaka 567, Japan Abstract

Combined treatment with high pressure and low temperature effectively inactivated Saccharomyces cerevisiae. When S. cerevisiae was suspended in 0.85% NaCI solution and treated with pressure of 120 - 300 MPa at -20 to 50~ the inactivation rates showed pseudo-first order kinetics. The regression analysis demonstrates that pressurization at sub-zero temperatures enhances the pressure effect similar to what observed at higher temperatures. The effects of additives, i.e. sugars and salts, on pressure inactivation of yeast were also examined. The presence of additives showed more effective pressure inactivation at sub-zero temperatures. The practical use of high pressure under sub-zero temperature was demonstrated on strawberry jam where complete sterilization of jam was achieved.

I. INTRODUCTION Highly efficient sterilization techniques have been sought in order to preserve flesh flavors and colors for pressure-treated foods. It was realized that S. cerevisiae (IFO 0234) was effectively inactivated when it was pressurized under sub-zero temperatures [ 1]. In this study, we have further examined the pressure-inactivation of S. cerevisiae at sub-zero temperatures by measuring the inactivation rates in 0.85% NaCI solution as well as in the presence of various additives, i.e. sucrose. Strawberry jam is an excellent sample for examining the changes in flavor and color during the food processing. We examined the pressure-inactivation of yeast under sub-zero temperature in the presence of strawberry jam in order to seek some industrial applications.

2. MATERIALS and METHODS

Preparation of yeast samples. Saline suspension of Saccharomyces cerevisiae (IFO 0234) obtained in its stationary phase was prepared as follows: the cell number was adjusted to 8.0 x 1 0 6 . 1 . 0 x 1 0 7 cells/ml with sterilized 0.85% NaCI or the solutions containing NaCI, sucrose, glycerol or sodium citrate. Jam inoculated by the yeast was prepared by adding the yeast into heat-processed

424 strawberry jam which contained 50% of strawberry fruit. The cell number was adjusted to 10 6 - 10 7 / g , and the brix of the jam was adjusted to 40 ~ The samples thus prepared were sealed in polyethylene bags and pressurized.

Pressure treatment. A hand-type pressure pump (Type KP5B, Hikari Koatsu Co., Japan), using kerosene as a pressure medium, was used. Before pressurization, the vessel (inside size ~ 25 x L 75 mm ) was placed in a temperature-controlled water bath filled with 70% ethanol and the bath temperature was taken as the pressurization temperature during the experiments. The pressure between 120 and 400 MPa was applied to the samples in the temperature range of -20 and 50~ The suspension of yeast cells with additives was pressurized for 20 min each. The inoculated jam was pressurized for 30 min each. The time to attain maximum pressure and to release the pressure was approximately 2 min and 30 s, respectively.

Colony counting. After pressurization, surviving cells were counted after the incubation of 10-fold serial dilutions on YM agar culture plates (Difco Lab., USA). Considering the delay of cell growth by pressure stress, the plates were incubated at 28~ for more than 7 days. The reproducibility of data was confirmed by duplicated or triplicated experiments.

A

B

_--,6 E ~5 t~

~4 o~ >

,-3

~2 0

0

10

20

30

40

0

10

20

30

40

P r e s s u r i z i n g Time (min)

Fig. 1. First order kinetics of inactivation ofSaccharomyces cerevisiae. A: Pressurization at constant temperature and various pressures, 210 MPa (C)), 240 MPa (Q), 250 MPa (A) and 270 MPa (&). B: Pressurization at constant pressure (180 MPa) and various temperatures,-20~ (C)),- 10~ (O), 0~ (A), 5~ (&), 25oC (I-l), and 40~ ( I ) . Lines were obtained by the least-squares method.

425

Regression analysis of inactivation rate. The inactivation rate (k), obtained by least-squares method, was expressed as the logarithmic decrease in the surviving cells per min. Regression analysis of the inactivation rate with a function of pressure and temperature was done by an equation of the second degree (see ref. 2 for details):

3. RESULTS and DISCUSSION

Regression analysis of the inactivation rate of yeast. Figure 1 shows the logarithmic decrease of the surviving cells vs. pressurization time. They followed pseudo first order kinetics. Regression curves in Fig. 2 were obtained based on the lines in Fig. 1. The correlation factor (R) was 0.927 with 43 of measured inactivation rates. A B

o

,

2 --Q~-2

3

[]

[]

-4 I

-20

I

I

I

I

0 20 Temperature (~

I

,I

40

I

0

i

100 200 Pressure (MPa)

I

300

Fig. 2. Temperature (A)- and Pressure (B)- dependent curves obtained by regression analysis for the inactivation of S. cerevisiae. A: curve 1 (O), 0.1 MPa; curve 2 (O), 120 MPa; curve 3 (A), 150 MPa; curve 4 (&), 180 MPa; curve 5 (I-1), 210 MPa; curve6 (11), 240 MPa; curve 7 (~), 270 MPa. B: curve 1 (O),-20~ curve 2 (V), 50~ curve 3 (1), 40~ curve 4 (O),-10~ curve 5 (A), 0~ curve 6 (&), 5~ curve7 (l-q), 25~ Symbols show experimentally measured data.

Figure 2 indicates that the inactivation rate depends on both pressure and temperature, including sub-zero temperatures. Figure 2A shows the temperature dependence of the yeast inactivation at given pressures, while Fig. 2B showing the pressure dependence at given temperatures. The profiles of the curves have exponential shapes, which means a slight shitt in temperature or pressure causing a significant change in the inactivation rate. In these experiments carried out at sub-zero temperatures, water is in the form of liquid or Type I ice [3]. However, the effects of freezing and thawing on the yeast inactivation were disregarded

426 since the number of surviving cells remained almost the same after cells had been frozen at -20~ for 180 min under ambient pressure and then thawed at room temperature. Furthermore, the effects of freezing and thawing on the inactivation rate may be eliminated because the temperature-dependent inactivation lines shown in Fig. 2A and Fig. 3 are continuous without any discrepancy between above and below the freezing point.

400 [

,

,

. . . . . . . . . . . . . . . . . . . . . . . .

~_ 200 a. 1 0 0

-20

0 20 Temperature (~

40

Fig. 3. Temperature-pressure diagram of the inactivation rate ofS. cerevisiae. Numbers in the figure show log k. See the text for the dotted lines.

Figure 3 summarizes the inactivation rate in the relation to temperature and pressure. The elliptical curves resemble the pressure denaturation of spherical proteins [4]. The similarity between the pressure-dependent denaturation curve of protein and the curve of the pressure inactivation rate of microorganisms may imply that the inactivation of microorganisms is due to interference with some critical life processes such as enzyme reactions. Figure 3 also indicates that only 190 MPa is required to obtain the inactivation rate of 1 per min at -20~ while 320 MPa is needed to reach the same rate of inactivation at 20~ as shown by the dotted lines. This means that the pressure sterilization is achieved under much lower pressure at the temperatures lower than the room temperature or above.

Effects of additional substances on the yeast inactivation. Figure 4 shows the effects of sodium chloride, sucrose, glycerol, or sodium citrate on the inactivation of yeast by pressurization at 25~ or-20~ No changes in surviving cell numbers were observed when 0.5 M or higher sodium chloride was added and pressurized at 25~ while a sharp decline was observed by pressurization at -20~ (Fig. 4A). An increase in surviving cells as observed when cells were pressurized with increasing concentrations of sucrose at 25~ while little change in survival of cells was observed when cells were pressurized at -20~ in the presence of sucrose (Fig. 4B). These results show that both sodium chloride and sucrose do not protect the yeast cells against pressure at sub-zero temperatures, but they protect from the inactivation at room temperature. Glycerol and

427 sodium citrate gave identical effects at both 25~ and-20~ yeast, showing a slight protective effect (Fig. 4C, 4D).

on the pressure inactivation of

!

>

0

"~

0

|

o

i

|

0.z

i

|

n

!

,.

0.4 0.6 NaCladded(M)

I

0.8

/

,"

J

Glycerol added (M)

I

0

02

0.4 0.6 0.8 Sucrose added (M)

o

o.i Sodium citrate added (M)

0.2

Fig. 4. Effect of sodium chloride (A), sucrose (B), glycerol (C) and sodium chloride (D) on the S. cerevisiae. Pressurization at 260 MPa for 20 min at 25~ (O) and at 150 MPa for 20 min at-20~ (0).

The diverse effects of added substances on the inactivation of various microorganisms by pressure treatment have been reported [5]. As shown in Fig. 4, the effects of pressure on the inactivation vary among added substances depending on the temperature. The effects of sodium chloride are of special interest since it enhances the inactivation of S. cerevisiae at low temperatures, particularly below 0~ At present, it is difficult to explain the reason why and how added substances can enhance or weaken the pressure inactivation of microorganisms. This is mainly due to the limited data [6] available for physical or chemical properties of added substances under high pressure, e.g., solubility, viscosity, freezing point, dielectric constants and so on, which should be all concerned in the high pressure inactivation of microorganisms. Further study is desired to clarify the detailed relationships between the strains of microorganisms and added substances for the effective pressure sterilization of food.

Effects of high pressure on jam inoculated by yeast. Figure 5 shows the logarithmic change of survival cell numbers of yeast cells per initial cell numbers after strawberry jams were pressurized for 30 min at deferent pressures in the temperature range from-20 to 25~ The effect of pressure was enhanced more at lower temperatures in the range of-10 to 25~ giving 104.9reduction at-10~ while 10 reduction at 25~ when pressurized at 300 MPa. Thus, the effect of pressure on yeast cells was enhanced at lower temperatures, but the greatest reductions were shown at -10~ Slight increase in survival number at-20~ is probably due to the protective effect of sucrose whose concentration is increased by the ice formation.

428

,i,•J

I

-

'

0 =

-2

.

Z .

Z ~-4 O .d

m

m

-6

,=

. ~ p -f~,

0

~,

,

_~

.

.

.

200 300 Pressure (MPa)

.

.

.

.

400

Fig. 5. Inactivation ofS. cerevisiae in strawberry jam. Pressurization for 30 min at-20~ (~), -IO~ (~r), Ooc (A), IOoC(11) and 25~ (0).

From these results, it is shown that the pressurization at low temperature is effective to yeast inactivation and practical food sterilization. We can expect that the pressure sterilization is achieved with much lower pressure at lower temperatures than at room temperature. Furthermore, the flesh flavors and colors, which are the most great advantage of high pressure treatment, could be maintained well by the treatment at low temperatures. To probe the possibilities of pressure treatment for various foods is an important theme for food industries. 4. REFERENCES 1 C. Hashizume, K. Kimura, and R. Hayashi, Biosci. Biotech. Biochem., 59, 1355-1458, 1995. 2 K. Sonoike, T. Setoyama, Y. Kuma, and S. Kobayashi, in "High Pressure and Biotechnology", Colloques INSERM, Vol. 224, ed. by C. Balny, R. Hayashi, K. Heremans and P. Masson, John Libbey Eurotext Ltd., France, 1992, pp. 297-301. 3 P.W. Bridgman, Proc. Amer. Acad Art andSci., 47, 441-558 (1912). 4 S.A. Hawley, Biochemistry, 10, 2436-2442 (1971). 5 K. Takahashi, H. Ishii, and H. Ishikawa, in "High Pressure Bioscience and Food Science" (in Japanese ), ed. by R. Hayashi, San-Ei Pub. Co., Japan, 1993, pp. 244-249. 6 N.S. Isaacs, in "Liquid Phase High Pressure Chemistry", by N. S. Isaacs, John Wiley & Sons Ltd., New York, 1981, pp. 63-135.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

429

Application of high pressure for sterilization of low acid food Kunio Kimura, Masao Ida, Yasuhiro Yosida, Kunihito Ohki and Mizuko Onomoto

Meidi- Ya Food Factory Co., 3 - 1 - 1 3 , Nishigawara, Ibaraki, Osaka 567, Japan Abstract The bactericidal effects of high pressure treatment combined with heat were examined using B. lichenifarmis spores and C/. sporogenes spores. After exposure to 500 MPa or more for 15 rain at ~ C , the number of B. lichenifarmis spores suspended in corn cream soup decreased drastically. The inactivation rate for the combined treatment exhibited 7 log cycles. However, exposure to the same pressure at room temperature did not cause significant change in spore numbers. After CI. sporogenes spores suspended in 1/15 M phosphate buffer solution was exposed to 7(I) MPa at ~)~ for 20 rain, the inactivation rate reached 7 log cycles. The inactivation rate for the: spores suspended in beef consomme fell slightly, to 6 log cycles, after the treatment of 700 MPa at ~)~ ~,)r30 rain.

1. I N T R O D U C T I O N To produce low acid food, there is necessary to sterilize the food by a method whereby spores of Cl. botulinum can be sufficiently eliminated. However, it is known that a high hydrostatic pressure treatment at room temperature can not kill bacterial spores. On account of this obstruction, the application of pressure processing method under the present condition is confined to acid foods such as jam, juice and so on in which there is not any fear of the multiplication of spore-forming bacteria. For those who want to produce low acid food using the pressure processing method, therefore, the most important problem is to establish a pressure treatment method whereby the bacterial spores which include Cl. botulinum spores can be eliminated. In order to solve this problem, we have examined the bactericidal effects of a high pressure combined with heat ( i . e . , pressurization under elevated temperatures) for two spore-forming bacteria.

2. M E T H O D S

2.1. Test specimens B. licheniformis ( Stock Culture No. 1203 of Japan Canners Association) sporulated by using a Shaeffer medium and Cl. sporogenes (IFO 142~?, 9ATCC 7 ~ 5 ) s p o r u l a t e d by using a modified GAM agar medium (Nissui) supplemented with yolk were used as the test specimens. The heat tolerances of these strains were determined. The results are as follows. B. licheniformis " D~0~ : 0.81 min (TRT,0s.c, .:~ = 7 . 2 9 min), Z = 7.21 ~ Ct. sporogenes " D,~0o~ = 1.04 min (TRT ,~,.c ,.=G = 6 . 2 4 min), Z = 9. 16 ~

430

2.2. Preparation of test samples A concentrated spore solution of B. licheniformis was suspended in a corn cream soup, while a concentrated spore solution of Ct. sporogenes was suspended in a 1/15 M phosphate buffer solution (pH 6.8) and a beef consomme as the testing solutions. Twenty gram portions of these solutions were packed in polyethylene bags (65 • 1133 mm) and heat sealed. Before testing, they were heated to ~cfC for 15 rain to kill the vegetative cells. The samples were stored below 5~ during the testing period except for the pressure treatment time. 2 . 3 . Test procedures Pressure treatment was performed by using a laboratory-scaled pressurization apparatus (Kobe Steel, Ltd., cylinder : 03 m m r • 180 ram) at a treating temperature o f ~ C or ~"fC under a treating pressure of from 400 to 700 MPa for up to 30 rain. At the initiation of the pressurization, an increase ( 5 to 6% ) in temperature was observed due to adiabatic compression. Thus, 5 to 6 min were required to return to the temperature setup. After the completion of the pressure treatment, the survivors in each sample were counted using the agar plate dilution method. As the culture media, an eugon agar medium(DIFCO) and a modifided GAM agar medium(Nissui) were used respectively for B. licheniformis and

Cl. sporogenes. 10 ~ ~

-

'

-

'

~

~

,--, 10-'

]0_2 Z

--" 10 a

N

10 s

~: 10 -~ O9

10-" ND

0

400 500 600 700 PRESSURE ( MPa )

Fig. 1. E f f e c t of Temperature and pressure on High Pressure S t e r i l i z a t i o n of ~ //c/7e/7/fo/,~/s Inoculated into Corn Cream Soup. B. //c/7e/7/forzws spo r es in co rn cream soup were pressurized to 400--(00 MPa for 15 min at room t e m p e r a t u r e ( O ) 60~ (jll~) and

80~ (1).

N : I n i t i a l count, 1.81 x 10 ~ ND: < 5.52 x 10 -8

3. RESULTS (1) The effect of combined high pressure / high temperature sterilization on B. licheniformis spores inoculated into corn cream soup is shown in Fig. 1. When the treating pressure was increased to 703 MPa at room temperature, the survivor count of B. licheniformis scarcely showed any change. In the case of the high pressure treatment combined with heat, on the other hand, the survivor rate was remarkably decreased with an increase in pressure. Treatment at 0ff'C was superior in the bactericidal effect to treatment at CffC. Namely, the survivor rate achieved by treatment at 9::ffC and 7C30 MPa for 15 rain was at the level of 10-s, while the one achieved by treatment at 03'0 and 5C0 MPa for 15 rain was less than 10-7. (2) The effect of combined high pressure / high temperature sterilization on Ct. sporogenes spores inoculated into 1/15 M phosphate buffer solution and consomme is shown in Fig. 2-A and Fig. 2-B respectively. The survivor rate of CI. sporogenes spores observed after the completion of the pressure treatment of 7D~) MPa was lower than the one

431 observed after the completion of the pressure treatment of 600 MPa. Also, the survivor rate was decreased as the treatment time was further increased. In the case of the 1/15 M phosphate buffer solution, a survivor rate less than 10 -7 was achieved by using the high pressure treatment combined with heat (8(YC, 7(/3 MPa) for 20 min or longer. In the case of consomme, on the other hand, the bactericidal effect was somewhat lower than that in case of the 1/15 M phosphate buffer solution. That is, a survivor rate of less than 10 -6 could be achieved by using the high pressure treatment combined with heat (80~ 700 MPa) for 30 rain. When treated at 80~ and 600 MPa, the survivor rate remained at a level of 10-4 to 10 -s even though the treatment was performed for 30 min. 10 ~

O

10" c

"-" 10-'

-~ 10-'

10-2

~. 10 - 2

z

',\

,,, 10-' <

a: 10-' cro

>

N

.

.

.

10-~ ~< 10 -~ o ~

>. tl

r

10-7 ND

.

z

10 -s

>

.

10-~ 10 -~

10-7 ND 0

5 10 15 20 25 30 PRESSURIZING TIME (MIN)

Fig. 2-A. E f f e c t of Pressure and Time on Pressure S t e r i l i z a t i o n of C/. sporogenes Inoculated into 1/15 M Phosphate Buffer Solution. C/. sporox,enes spo r es in 1/15 M phosphate b u f f e r s o l u t i o n were pressurized to 600 MPa ( O ) and 700 MPa(~k) for 0-30 rain at 80~ N : Initial count, 4.88 x 10" ND: < 2.05 x 10 -~

0

5 10 15 20 25 30 PRESSURIZING TIME (M IN)

Fig. 2-B. E f f e c t of Pressure and Time on Pressure S t e r i l i z a t i o n of C/. sporogenes Inoculated into Consomme. C/. sporogenes spores in consomme were pressurized to 600 MPa(O) and 700MPa ( A ) for 0-30 min at 80~ N : I n i t i a l count, 5.34 x 10' ND: < 1.87 x 10 -~.

4. DISCUSSION There have been described in some reports '1-8~ that pressure treatments at high temperatures of 60 to 80~ are effective for inactivation of bacterial spores. However, most of these reports relate to bacteria which are relatively poor in heat tolerance and there has been no reports relating to Ct. @orogenes so far. The strain Cl. sporogenes IFO 14292 (ATCC 7~)55) used in this study is an index bacterium of sterilization which has been authorized for

432 the public as a substitute for Cl. botulinum A (sterilized by heating to 120~ for 4 rain) in the heat sterilization of low acid food. Spores of this strain could be inactivated (a decrease of 6 to 7 log cycles in the survivor rate) by high pressure treatment combined with heat (80~C, 7(~ MPa, 30 rain). These test results suggest that Cl. botulinum A might be also sterilized by the high pressure treatment combined with heat. However, pressure sterilization differs from heat sterilization in the mechanism of the exertion of the bactericidal effect. Thus, it is necessary to confirm that Cl. botulinum A per se can be sterilized by the high pressure treatment combined with heat. After confirming this fact, it is expected that the high pressure treatment combined with heat can be applied to the production of low acid food ( i . e . , the production of high quality low acid food suffering from little degradation in quality due to excessive heat).

5. A C K N O W L E D G M E N T We are grateful to Kobe Steel, Ltd. for offering us convenience on using experimental high pressure apparatus.

6. REFERENCES 1

2

3

4

5

6

7

8

Y. Taki, T. Awano, N. Mitsuura, and Y. Takagaki, Sterilization of Bacillus sp. Spores by Hydrostatic Pressure. In Pressure-Processed Food : Reseach and Development (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1990), pp. 143-155. Y. Ifuku and Y. Takahashi, Pasteurization Effects of High Hydrostatic Pressure on Drinks. In Pressure-Processed Food : Reseach and Development (in Japanese), ed. by R. Hayashi, San-EiPub. Co., Kyoto, (1990), pp. 165-177. H. Fujiki and K. Mochizuki, Application of High Pressure to Processing and Preservation of The Water-Containing Cocoa Mass. In Pressure-Processed Food : Reseach and Development (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1990), pp.193-205. Y. Taki, T. Awano, S. Toba, and N. Mitsuura, Sterilization of Bacillus sp. Spores by Hydrostatic Pressure, Part 2. In High Pressure Science for Food (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1991), pp. 217-224. H. Kinugasa, T. Takeo, K. Fukumoto, T. Shinno, and M. Ishihara, Processingand preservation of tea extract by hydrostatic pressure : Sterilization and changes in components. In High Pressure Bioscience and Food Science (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1993), pp.237-243. T. Okazaki, T. Yoneda, and K. Suzuki, Combined treatment of pressurization and heating for food sterilization. In High Pressure Bioscience (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1994), pp. 242-247. A. Ymnazaki, A. Sasagawa, M. Kinefuchi, and A. Ymnada, The method of processing rice cakes with high pressure. In High Pressure Bioscience (in Japanese), ed. by R. Hayashi, San-Ei Pub. Co., Kyoto, (1994), pp. 328-335. I. Hayakawa, T. Kanno, K. Yoshiyalna, and Y. Fujio, Oscillatory Compared with Continuous High Pressure Sterilization on Bacillus stearothermophilus Spores. ]. Food Sci., Vol. 59, No.l, (1994), 164-167.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

433

C o m p a r a t i v e study of thermal and high pressure treatments upon wheat starch suspensions.

J.P. Douzals 1, P.A. Mar6chal 1, J.C. CoquiUe2 and P. Gervais 1.

1 Laboratoire de Gdnie des Procddds Alimentaires et Biotechnologiques, ENSBANA, 1, esplanade Erasme, 21000 Dijon, France. 2 Laboratoire de G6nie des Agro-6quipements et Proc6d6s, ENESAD, Site O. de Serres, 21800 Qu6tigny, France.

Abstract Wheat starch suspensions of 15 to 40 % dry matter were submitted to pressure (100 600 MPa) or temperature (60 - 80~ / 15 minutes). Compressibility study under pressure showed irreversible modifications of starch suspensions through a reduction of the total volume. This volume reduction remained visible after treatment by pressure as shown by specific gravity measurements. Fresh gels drying behaviour were compared with stored gels at 4 ~ C during 24 hours or 48 hours. The results gave informations to water - starch linkages and indirectly to starch gels stability toward retrogradation.

1. I N T R O D U C T I O N . Starch gelatinization corresponds to an endothermic phase transition with sufficient amount of water. It is commonly obtained by an increase in temperature up to 60 to 70 ~ for main starch. Studies on starch gelatinization under pressure are few and starch gelatinization under pressure was generally obtained with a previous or simultaneous heating treatment. X ray diffraction patterns showed an important decrease in crystalline peaks of corn starch after a 500 MPa treatment [I ]. Gelatinization under pressure enhanced starch enzymatic digestibility and prevented retrogradation as starch granules remained granular-like after pressurisation [2].

434 From a theoretically point of view, starch melting can be characterised by the Clausius Clapeyron's equation (1) which is valid for any phase transition at the equilibrium_ ~pp]

AG=O

=

T.AV AH

(1/

where AT, AP, AG, AV and AH are the temperature, pressure, Gibbs free energy, volume, enthalpy changes and T is the melting temperature. High pressure differential thermal analysis results predicted a decrease in starch volume above 200 MPa [3]. Microscopic observations using a visualisation cell under pressure showed an significant swelling and an iodine discoloration of wheat starch granules above 300 MPa [4]. This swelling attained to 80 % (initial volume basis) at the end of the release. The aim of this paper was to study starch modifications under pressure using macroscopic compressibility measurements. These primary results were completed with specific gravity measurements upon starch gels in order to appreciate any remaining effect of the pressure after treatment. Pressure effects upon wheat starch suspensions were compared to heating treatment. Finally, some prospective experiments were carded out in order to make appear specific properties of pressure treatment may be due to a specific gel network obtained under pressure.

2. M A T E R I A L S A N D M E T H O D . 2.1. Compressibility measurements. In order to measure the macroscopic compressibility of a water starch suspension, a manual screw piston pump was employed, in connection with a short high pressure circuit of about 7 ml including a pressure gauge. The precision in volume and compressibility measurements was about 0.02 ml and 0.5 Pa -1. Each step of measure was about 10 MPa from 0.1 MPa until 600 MPa. The macroscopic compressibility of a starch suspension were calculated from the macroscopic equation (2) where Bt, AP, AV and V corresponded to the isothermal compressibility, the pressure and volume variation and the initial volume respectively. AV V.~d:'

(2)

As far as starch suspensions were concemed, the convenient term of compressibility was fairly incorrect considering a solid - liquid mixing which became liquid -like during the process. 2.2. Specific gravity measurements. Wheat starch suspensions were prepared in supple rubber bags tight closed with a string. Samples of 10 to 15 g had initial starch content from 10 - 70 % dry matter basis. Specific gravity were calculated in reference to pure water using a water pycnometer and a precise balance (10 mg precision) for both suspensions and gels.

435 Samples bags were submitted to 600 MPa or 75 ~ during 15 minutes. Specific gravity of heated ~els was measured at room temperature. Precision in specific gravity was about 7 rng.cm"~ 2.3. Drying experiments. Heated and pressurised starch gels were dried in a dry air oven at 105 ~ during 24 hours. Fresh starch gels were compared with gels previously stored at 4 ~ during 24 or 48 hours in order to appreciate high pressure effects upon starch retrogradation. Samples were weighted every hour during 7 consecutive hours and finally at 24 hours. Initial starch contents were 25 % and 40 % dry matter basis.

3. R E S U L T S . 3.1. Compressibility of a wheat starch suspensions under pressure. The evolution of the macroscopic compressibility of pure water and starch suspension is presented on figure 1 as a function of pressure. Pure water compressibility ( 0 ) was according to theoritical equations. The compression and release curves were superimposed.

Figure 1. Macroscopic compressibility of pure water (13 H20) and wheat starch suspension (13 starch) of 33 % starch content (dmb) during a 600 MPa treatment.

436 Above 300 MPa on compresion, the compressibility of a wheat starch suspension (D) was higher than pure water at the same pressure. Moreover, the release curve was always situated upper the compression curve, showing a compressibility lag. This lag appeared to correspond to a reduction of the total volume while starch melted. Previous studies on microscopy and differential scanning calorimetry have shown wheat starch gelatinization above 300 MPa [4]. These results would confirm that gelatinization under pressure occured above 300 MPa with a simultaneous reduction of the volume. A second compression cycle upon the same suspension gave a reversible curve (not represented here). No further modifications occurred during the second treatment. 3.2 Specific gravity of wheat suspensions Previous results let us suppose some remaining effect of the pressure treatment upon wheat starch gels after return to atmospheric pressure. Specific gravity of initial suspesnions, heated and pressurised gels have been plotted for different kind of dry matter content ( 10 - 40 % w/w).

Figure 2. Evolution of the specific gravity of suspensions, thermal and pressurised wheat starch gels as function of the initial dry matter content.

437 The straight line (--O-) on figure 2 corresponds to the initial suspensions specific gravity as a linear function of dry matter. The upper points (A) corresponds to the pressurised gels and the lower curve (O) to heated gels. Starch gels treated under pressure remained compressed after the release, suggesting that water starch linkages created under pressure were strong. Pressure induced a high condensed gel. According to previous works using high pressure differential thermal analysis [3], starch gelatinization at atmospheric pressure involved an slight decrease in specific gravity. 3.3. Drying behaviour of heated and pressurised gels. In order to investigate functionnal properties of heated and pressurised gels, some propestive experiments on drying at 105 ~ were realised.

Figure 3. Drying diagrams of fresh and stored starch gels treated under pressure or heat.

As shown on figure 3, fresh starch gels obtained after thermal treatment dried more rapidly than pressure treated gels. It means that the pressure treated gels needed a higher level of energy to release the water molecules from the gel in comparison with a thermal treatment. Furthermore, at 24 and 48 hours storage at 4 ~ this phenomenon was more accentuated. A pressure treatment would involve a lower susceptibility to gels modifications dttring storage. That could involve interesting properties regarding to retrogradation.

438 4. C O N C L U S I O N . Starch compressibility measurements showed irreversible modificatiom of starch suspensions during the high pressure treatment. Starch gelatinization began above 300 MPa when the compressibility of the suspension was higher than pure water at the same pressure. It signifies that water molecules linked with starch occupied a smaller volume than in pure water at the same pressure. This volume reduction was particularly visible with the compressibility lag between the compression and the release curve. These results were consistent with theory and with Le Chatelier principle. Pressure treatment has a remaining effect as shown by a significant increase in the specific gravity of pressurised gels in comparison with a thermal treatment. Pressure induced irreversible modifications upon starch gels structure may be due to a specific gels network which were more condensed. Further works will concern the influence of pressure treatment regarding to retrogradation.

5. R E F E R E N C E S 1 Y. Hibi, T. Matsumoto, S. Hagiwara. Cereal Chem., 70 (1993), 6,671. 2 R. Hayashi and A. Hayashida, Agr. Biol. Chem., 53 (1989), 2543. 3 A. H. Muhr and J. M. V. Blanshard, Carbob_ polym., 2, (1982) 61. 4 J.P. Douzals, P.A. Marechal, J.C. CoquiUe and P. Gervais, in press, J. Agr. Food Chem.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

439

Modeling of high pressure thawing J.M. Chourot, R. Lemaire, G. Cornier and A. Le Bail ENITIAA- D6partement GPA- chemin de la g&audi&e 44072 Nantes cedex 03

Abstract Modeling of freezing and thawing of foodstuffs has been extensively studied. Our application looks at thawing of foodstuffs under high pressure (HP). The phase change temperature of water to ice decreases with increasing pressure below 220 MPa [1] and then allows to achieve higher thawing rate than at atmospheric pressure. Experimental thawing was realised in a HP vessel with pure water and with 4.3% NaCI aqueous solution as model foods. A numerical model (finite difference - crank nicholson) was used to modelize the process. The lack of data on convection under HP does not allowed to make accurate comparison between experimental and calculated results. Preliminary comparison showed encouraging results. 1. INTRODUCTION HP technology is being increasingly investigated. Potential food applications can be classified in the following groups as proposed by [2] : protein modification, pasteurization, reaction enhancement (i.e. enzymes) and phase change transition. Our application looks at the phase change of ice to water under HP. The freezing rate and the thawing rate are of great importance with regard to the final quality of food. The thawing rate is controled by two main parameters; the surface heat-transfer coefficient and the ambient temperature. The ambient temperature is supposed to be below 5 to 10 ~ during thawing to prevent flora development. Then the parameter which is irffluent on the thawing rate at atmospheric pressure is the heat transfer coefficient. Yet the small temperature difference between the initial freezing point and the ambient temperature does not allow to achieve high thawing rate. The phase change diagram of water and ice has been studied in detail by Bridgrnan [I] up to 2000 Mpa. HP depresses the melting point of ice with increasing pressure below 220 MPa and then allows to increase the temperature gap between the heat source and the phase change interface. Thus high heat flux rate can be obtained with a low level of the ambient temperature. The behaviour of food during HP thawing opens a new field of investigation with regard to food quality and thermal aspect of the process. Foods which mainly contains water will thawed much rapidly at HP than at atmospheric pressure. The phase change temperature increases with pressure above 220 MPa and thus is not of interest in thawing. Recent studies were published during the last five years. Takai [3] presented HP thawing of ice and of fish. Deuschi [4] presented thawing of ice blocks. Murakami [5] thawed tuna muscles. He observed a reduction of the thawing time and a reduction of the drip volume; the microbiological quality of food was not affected. Kalichevsky [6] did an overview of the potential food applications of liP effects on ice-water transitions. Our study focus on heat transfer during HP thawing.

440 Table 1 List of variables Letters

C"

H(F)" hkp. r"

Q.

R" t"

T"

p. a 9 i" W"

Specific heat at constant pressure [J/kg.K] Volumic heat source [J/m3] _ Heat transfer coefficient [W/m2.K] Themml conductivity [W/m.K] Pressure (MPa) Radius from center[m] Heat [J] External radius of the cylinder [m] Time Is] Temperature [~ Greek letters Thermal expansion coefficient at constant' pressure [K- i] Density [kg/m3] Subscripts Ambient temperature Initial value Wall conditions ,

I

2. MATERIAL AND METHOD Experiments were realised in a HP vessel (internal diam. 120 mm, internal high 300 mm) equipped with two thermocouples. The samples were of cylindrical geometry (42 mm diam.). ~, (

~

0m . ~

"

STOP VALVE

DFA2OMPRESSION VALVE

Figure 1. Overview of the experimental HP vessel with the sample They were made of a polyethylene bag in which a cylinder of a high porosity foam (0.98) was placed to prevent convection in the sample. The foam was filled with pure water or with 4.3% NaCI aqueous solution. The sample were frozen with solid CO 2 and were initialy placed at the centre of the HP vessel (fig. 1). One K type thermocouple (1.5 mm diameter) was placed at center of the cylinder to record the temperature during thawing and a second one was installed in the vessel. The vessel was then filled with water at a temperature of 20~ and the pressure was allowed to rise with a HP pump. The temperature of the vessel was maintained at 20 ~ with a regulated heating bath. An experimental plot of temperature versus time is presented in fig.2 for pure water. The pressure during the run was 55 MPa which corresponds to a phase change temperature of-4.4~ [ 1].

441

8

6~

/

6

30 J '

4 it. .

2 0

,

-2

600

.,

1200

o

o

1800

2400

-4

-6 -8

Pressure (xlO MPa) . . . . .

3000

/ 3600

J

T .t cna~re (%3

I

-3 -6 -9 -12 -15 -18 -21 -24 -27 -30

;

~oo

,

~

,

900

:

,,,

.oo

A

,,

..oo J ; o o

T

at centre

(~) . . . . . P (xlO MPa) TIME |1tl

TIME ~ }

Figure 2. Thawing of pure water P=55 MPa

,-

.~oo

Figure 3. Water + 4.3% NaCI P=55 MPa

Temperature was continuously increasing during thawing of water+4.3% NaC1 (fig.3) because of the evolution of the concentration. The thawing time was the time interval between -40~ and 0~ Relative thawing time are presented in table 2. Each value corresponds to the mean thawing time measured over three experiments. One can see that R1 and R2 ratios are increasing with the same magnitude with respect to pressure showing the correlation between the heat flux and the relative increase of the temperature gap between the melting point and the heat source. On the other hand, thawing was in the average 25% shorter with the solution than with pure water because of the smaller phase change temperature of the solution. Table 2 Relative temperature gap (R1) with respect to relative thawing; time P (MPa) 0.1 55 105 R1 1 1.2 1.5 R2 1 1.3 1.6 RI=(Ta - Tm(P))/(Ta - Tm(Patm)) R2=(thawing lime at Patm) / (thawinglime at P)

012) for water 155 205 1.7 2.1 2.1 2.5

3. MODELING The model concerns one-dimensional heat transfer with phase change in an infinite cylinder submitted to convective heat transfer at surface. We intend to realise a model which can work both with water which is a pure substance (constant phase change temperature) and with a food (spaned melting domain). Two approaches are presented in the literature to model the problem of a solid undergoing phase change : the first of them consists in solving the heat diffusion equation with symplifying assumptions. This approach leads to analytical or semianalytical solutions based on the model of Plank [7] and does not take into account the phase change span. The second comprise the finite difference and the finite elements methods. The finite elements methods are generally more complex and they do not present any advantage over the finite difference methods for simple geometry. The finite difference methods comprise the enthalpy methods or the apparent specific heat method. The former as presented by [8] or [9] needs an explicit procedure which requires small values of the fourier number or an implicit procedure with iterations. In the latter, the phase change is taken into account by an apparent specific heat function which is a combination of the latent heat and of the specific heat. The semi-implicit Crank Nicholson finite difference scheme and the fully implicit scheme are unconditionally convergent and therefore are much used [10]. The major problem lies in tbe

442 "jump" of the latent heat peak which might generate stable oscillations. This difficulty can be tided over in reducing the time step and the mesh size or in smothing the latent heat peak as proposed by [11], [12] and [13]. The Crank Nicholson finite difference method was used with an apparent specific heat formulation. 3.1 Finite difference scheme

The problem concerns an infinite cylinder of initial temperature T i. At initial time, a constant temperature Ta is applied with a convective heat transfer coefficient h : 1 0( _~3 ~(pc(T,P).T) + 0H(P) r ' ~ r. k(T) = & &

(1)

r=0

fff - k(T). ~ = 0

r=R

fir - k(T). - ~ =h.[T(r=R,t)- Ta] Vt

(3)

t=0

T(r,t=O) = Ti

(4)

Vt

Vr

(2)

Under non-adiabatic condition the heat dissipated during compression is given by (5): dQ = (c + ~ dP]dT- Io~VT+ ~~rFVT) dT]dP

(5)

Assuming quasi-static and adiabatic condition, dQ can be simplified in dQadiab.=-ctTVdP. This expression was used to calculate H(P) which represents the volumic heat dissipated during pressure variation. Indeed, between each time step of the finite difference model, the temperature was almost constant. Furthermore, the knowledge of an accurate value of H(P) was much needed at the end of thawing (when the temperature is almost constant). Indeed, the decompression should start at the fight moment and with an adapted rate in order to prevent partial refreezing of the sample. H(P) = cz(P)TdP (6) Density was considered as constant. The apparent specific heat function of water was modeled with a triangular peak centered on the phase change temperature proposed by Bridgman [1]. The temperature span ATm of the melting domain was adjusted at 1K. The surface of the triangular peak was equal to the latent heat and was expressed as a function of the pressure as proposed by [1]. Thermal conductivity of water and ice were assumed to be independent of pressure; a linear evolution was used on the melting domain (temperature span ATm). The apparent specific heat of the solution was measured at atmospheric pressure with a DSC (SETARAM 92). The thermal conductivity of water+4.3%NaCl proposed by [14] was used. These latter thermophysical properties were assumed to be independent of the pressure.

443 The time step and the mesh size were adjusted with the thermophysical properties of water. Indeed, the sharp function of the apparent specific heat represents severe conditions with respect to numerical considerations. Convergence and stability of the model were observed with more than 80 nodes and with a time step smaller than 15 s.

3.2 Comparison between experimental and calculated results As natural convection was occuring in the annular gap between the sample and the HP vessel, the heat transfer coefficient was a function of the temperature difference ATw (T at surface of the sample minus T vessel) and thus was a function of time. The lack of correlation on convection under HP did not allowed to make an accurate estimation of h. We used a mean value of h (h ~ 400) for the calculations which was estimated at atmospheric pressure with the correlation proposed by [15] and a mean value of ATw. Anyway, the model shows minor influence of h on the thawing time for h value above 400 W.m-2.K-1. The experimental thawing time at 155 MPa for pure water was 36 min. and the calculated thawing time was 41 min with h=400 or 39 min with h=1000. The difference between experimental and calculated thawing time was assumed to come from the uncertainty in the origin of time (time needed to close the vessel plus 2 minutes to reach 200MPa), the unknown temperature distribution in the sample (which was assumed to be homogenous) and the contribution of the thermophysical properties of the foam which were not taken into account. In despite of these experimental difficulties, the model showed good agreement with experimental thawing time. The ice to water ratio was estimated with expression (7). T)

ICE

~c(T)dT 9o

WATER ( t ) = 1 0 0 - 1 0 0 . T~c(T)dT

(%)

(7)

To

A quasi linear dependence of the thawing time with regard to pressure was observed. The decrease of the thawing time was greatly caused by the increase of the temperature difference between the heat source and the phase change boundary. The heat transfer coefficient does not appear to be a limitative parameter in our conditions. 4. CONCLUSION A Crank-Nicholson finite difference model with apparent scpecific heat formulation was tested for the modeling of HP thawing and exhibited results that concurred with the experimental results in despite of experimental unaccuracy in the time origin and in the initial temperature. The use of the model with an apparent specific heat function such as that of a food with a large temperature span during phase change should exhibit convenient robustness and accuracy. The assumption of a constant heat transfer coefficient was acceptable in our conditions because the thermal resistance due to convective heat transfer was small with respect to the thermal resistance of the thawed part of the sample. Thus, the unaccuracy introduced by this assumption was not so important. Further work should be done to measure the thermophysical properties of food under HP (HP calorimetry) and the heat tranfer coefficient in an annular gap at HP. This latter point will be of importance in optimizing the

444 thawing process for food industry (optimal occupation ratio and diameter of the vessel). High pressure thawing appears as a new interesting technic for food industry. It should allow to reduce the thawing time and to improve the final quality of foods. Acknowledgements : This research was supported by the "Contrat de Plan Etat-Region Pays de Loire 1994-1998". 5. REFERENCES

[ 1] [2]

[3]

[4]

[5]

[6]

[7] [8]

[9] [10] [ 11] [12] [13] [14] [15]

P.W. Bridgman, Water in the liquid and five solid forms under pressure, Pro. Am. Acad. Arts Sci., n~ 441-558 (1911) J.C. Chet'tel, Effects of high pressure on food constituents : an overview, High pressure and biotechnology, C.Balny, R.Hayashi, K.Heremans & P.Masson (eds) colloque INSERM John Libbey Eurotext Ltd. vol. 224 195-209 (1992) R. Takai, T. Kozhima and T. Suzuki, Low temperature thawing by using high Pressure, 17~mc congr~s international du froid, Montrfal (Qurbec), vol 4 1951-1955 (1991) T. Deuchi and R. Hayashi, High pressure treatements at subzero temperature : application to preservation, rapid freezing and rapid thawing of foods, High Pressure and biotechnology, C.Balny, R.Hayashi, K.Heremans and P.Masson (eds) Colloque INSERM John Libbey Eurotext Ltd, vol. 224 353-355 (1992) T. Murakami, I. Kimura, T. Yamagishi and M. Sujimoto, Thawing of frozen fish by hydrostatic pressure, High Pressure and biotechnology, C.Balny,R.Hayashi, K.Hereman and P.Masson (eds) Colloque INSERM John Libbey Eurotext Ltd, vol. 224 329-331 (1992) M.T.Kalichevsky, D.Knorr and P.J.Lillford, Potential applications of high-pressure effects on ice-water transitions, Trends in Food Science & Technology, vol. 6 253259 (1995) R. Plank, The freezing time of ice blocks, Zeitschritt for die gesamte Kalte-Industrie,H6, p 109 (1913) V.R. Voller and M. Cross, Use of enthalpy method in the solution of Stefan problems. In Numerical Methods in Heat Transfer, R.W. Lewis, K. Morgan and O.C. Zienkiewicz (eds), 177-200. WILEY, New York (1981) A.B. Crowley, Numerical solution of Stefan problems, Int. J. Heat Mass Transfer, vol. 21 215-219 (1978) A.C.Cleland and R.L. Earle, Assessment of freezing time prediction methods, Journal of Food Science, vol. 49 1034-1042 (1984) G. Comini and C. Bonacina, Application of computer codes to phase-change problems in food engineering, I.I.F.-I.I.R.-Commissions B 1,C 1,C2-Bressanone, 15-27, (1974) C. Bonacina and G. Comini, On a numerical method for the solution of the unsteady state heat conduction equation with temperature dependent parameters, Proc. of the XIIIth Int. Cong. of Refrigeration, vol.2, 329, (1971) A.C. Clealand and R.L. Earle, The third kind of boundary condition in numerical freezing calculations, Int. J. Heat Mass Transfer, vol.20, 1029-1034, (1977) F. L. Levy, The thermal conductivity of commercial brines and seawater in the freezing range, Int. Journal of Refrigeration, vol. 5, N~ May (1982) R. Giblin, Transmission de la chaleur par convection naturelle, Eyrolles (eds), Paris (1974)

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

445

HPP strawberry products 9an example of processing line P. Rovere a, G. Carpi b, S. Gola b, G.Dall'Aglio b and A. Maggi b aTetra Pak Processing & Packaging System AB, Ruben Rausing gata, Lund, Sweden. bStazione Sperimentale per l'Industria delle Conserve Alimentari, V.Tanara 31/a, Parma, Italy. Abstract qhe possibility of processing fresh or frozen strawberries by high pressure was investigated. The typical heat sensibility of this product limits its industrial use if no chemicals are added to preserve colour and flavour. "Iherefore, the possibility of a cold processing technology for this vegetable is very interesting. Experiments on strawberry nectar were carried out using an HP food processor (ABB) : technological, physico-chemical and microbiological parameters were optimised during the trials. Microbiological and chemical shelf life was investigated on the high pressure treated samples. Finally, a model for an industrial processing line was developed.

1. INTRODUCTION "Ihe use of high pressures as an alternative to conventional heat treatments for the stabilisation of acid food is an experimental fact which has now been completely acquired [ 1-5 ]. qhis technique offers numerous advantages : - the possibility of obtaining preservable products with characteristics very sin~ar to those present before treatment ; -the homogeneity of treatment due to the fact that pressure is always the same at each point of the product; -remarkable energy saving in comparison with thermal stabilisation techniques. qhe innovative aspects of research gives rise to products which are new from the physical, functional and nutritional viewpoints [6]. However, it should be said that in order to produce foods to be preserved by means of high pressure, the preparation techniques must be changed :that is, food products must be prearranged to be able to submit to the new preservation technique, which involves much higher investments than the conventional ones. When the product is pressure-treated without pre-heating, it sometimes undergoes taste, flavour and colour changes often attibutable to chemical and enzymic reactions which begin during the preparation stage and are then enhanced by treatment.

446 Certainly, cell disruption, which occurs during preparation and still more during the pressing stage, favours the corr~g out of endoenzymes which, if not hnn~diately inactivated, catalyse more quickly phenomena for which they are responsible, q-he efficiency of this new technique consists not only of the resulting microbial stability [7] but also of the possibility to reach better food quality levels. "Iherefore, besides considering the microbiological aspect, research should also investigate in the physico-chemical, enzymatic and nutritional properties of the product. Since the use of high pressure in the preparation of preserved foods certainly limits the range of products which can be obtained, a choice must be made in favour of either high added-value products or of products which are unsuitable for conventional treatment and which retain their integrity only with the use of pressures. The reason for the choice of strawberry fruits is their typical therrml sensitivity, which limits its use in conventional industrial processing : their particular aromatic composition and colour are inevitably and irrevocably damaged during heat treatment for preservation, qhe high pressure technique allows cold treatment and is therefore very interesting for this product. 2. M A T E R I A L S AND METHODS 2.1. Strawberry nectar flow sheet Strawberries intended for industrial processing are generally frozen just after picking;once thawed, they are used in the preparation of thermally stabilized juices, nectars and pieces. Therefore, in the preparation of strawberry nectar for high pressure processing, frozen strawberries were thawed for use as raw material. The strawberry nectar flow sheet is reported in the following Figure 1. 2.2. Microbial strains Strawberry samples were inoculated with the following microorganisms : two lactic bacteria: a strain of Lactobacillus casei sub casei (L12 SSICA 1098) isolated from fruit juice, and a gas fomaing strain of acid Lactobacillus sp. (L25 SSICA 9442) isolated from tomato juice ; two strains of spore moulds : Penicillium digitatum and Rhizopus oryzae isolated from fresh fruit; two strains of yeasts:Saccharomyces cerevisiae and Saccharomyces sp., both isolated fromfresh fruit.

2.3. Cultural media Rogosa agar (Oxoid) was used for lactic acid bacteria count ; the plates were inoculated and incubated at 30 ~ C for 4 days. Malt Extract agar (Oxoid) was used for the yeast and mould count ;the plates were inoculated and incubated at 30 ~ C for 4 days. 2.4. High pressure pilot plant An ABB autoclave Model QFP-6 research press, the main characteristics of which have been reported in a previous work [8], was used.

447

STRAWBERRIES (cir. Chander)

+ +

+

II

STRAWBERRY NECTAR (S S = 16%)

+

AIR BLAST QUICK FREEZING (-18~ in 20 min)

I

500 %juice 49 5 % sucrose syrup (24%) 0 2 % ascorblc ac,:l 0 3 % carx: ac~l

]

§

I

4,

HOMOGENIZING

+

STORAGE (-20"C)

VACUUM PACKAGING (PP/E'VOH/PP plastic cups of 100 g capacay

THAW1NG (16 h at 4"C)

§

REFINING (0.6 mm sieve)

+

and

PET/E-VOH-PEcoex seahng film)

I

]

+ SHELF-LIFE EVALUATION

l

+ +

]

STORAGE AT 3 AND 8"C

4,

SHELF-LIFE EVALUATION

] I

Figure 1. Flow sheet of strawberry nectar preparation 2.5. A n a l y t i c a l M e t h o d s

Sugars: glucose, fructose and sucrose were determined by HPLC with a refraction index detection system_ A waters trod 840 chromatograph was used, in accordance with "Official methods of analysis of vegetable preserved foods", DM 3/2/89 - GU 20H/89, No. 51. L. ascorbic acid was determined by HPLC with a UV detection system A waters mod 840 chromatograph was used in accordance with "Official methods of analysis of vegetable preserved foods",DM 3/2/89 - GU 20/7/89, No. 51. metals: sodium, potassium, calcium and magnesium were determined by means of flame absorption spectroscopy. colour was measured by means of a Gardner Colorgrad System5 BYK colorirreter - Gardner. For each analysis 10 results were obtained ; the instrument gives directly the average value of L, a, b ; "L" represents tightness (black-white), "a" the red corr~onent and "b" the yellow component. soluble solid content was determined in accordance with "Official methods of analysis ofvegetable preserved foods" ,DM 3/2/89 - GU 20H/89, No. 51 with a rr~d AUS. refracton~ter, Jena, Germany. total solid content was determined in accordance with "Official methods of analysis of vegetable preserved foods", DM 3/2/89 - GU 20H/89, No. 51. pH: in accordance with IFU Method No. 11 (1989) with a Metrohom 691 pHmeter.

Table 2 Physico-chemical and organoleptic shelf life of High Pressure processed strawberry nectar (nt= not treated. HPP= processed, V= very. G= good) storage (days) storage temperature ("C) Soluble solids. % Total solids. % Ash. % pH Total acidity. g/l 00g L-Ascorbic acid. ppnl Glucose. % Fructose. % Sucrose. % Forn~olnumber Na. ppm K. PPm Ca. ppm Mg. PPm

nt 0 7 --3 16.0

Hydrosol colour 420 nm abs 520 nm abs A 520-420 Gardner colour

L a b

ah Sensorial e~aluat

colour smell flavour

16.0

8

15 3 -

8

30 3 8

60 3

8 -

~

449 titrable acidity: in accordance with WU Method No.3 (1968) with a Radion'eter mod. ABV 80 automatic titrator Autoburette with pH meter mod Ion Analyzer Radiometer. forrr~l index: in accordance with WU Method No 30. ash: according to WU method No.9 (1989). water soluble colour was measured reading at 420 and 520 nm with a SHIMADZU spec tro ph o t o meter. 3. R E S U L T S AND DISCUSSION

3.1. Microbiological results To evaluate the efficacy of the treatment at different levels of contamination, 50 % of the prepared nectar samples was inoculated with some fruit spoilage microorganisms (yeast, mould and lactic acid bacteria), while the remaining half was not. Both inoculated and uninoculated samples were then subjected to different pressures (from 300 to 600 MPa) for 3 min. Table 1 shows the results of the previous test perforn~d on the nectar to f'md the correct pressure level to inactivate spoiling micro-organisms : 500 MPa for 3 min are enough for the microbial stabilization of uninoculated samples, while 600 MPa for 3 min are necessary to corr~lete inactivation of inoculated samples. Table 1 HP inactivation of micro-organisms spoiling strawberry nectar (cfu/g) HP-treatments (MPa x min) samples

inoculated

uninoculated

400 x 3

500 x 3

2.2x 105 < 10

10

50

yeasts

1.2x105

11

2

Lactic acid bacteria

4.6x 105 2.6x 102 11

0

moulds

8.5x102

6

8

0

0

yeasts

4.0x102

0

0

0

0

Lactic acid bacteria

35

0

0

0

0

micro-organisms

No

moulds

300 x 3

4.3x104

600 x 3

A final test was carried out to evaluate the importance of mycete c o n t a n ~ a t i o n level in raw material by choosing an inoculum of 104 c.f.u.]g, although this concentration is not normally found in products of good quality. Strawberry nectar was inoculated with yeasts (1,2x104 c.f.u./g) and rmulds (1,1xl04 c.f.u./g), then treated at 500 MPa for 3 min. The samples (10 x 100 g cups for each temperature) were then incubated at 3 and 8 ~ C for 180 days and at 30 ~ C for 30 days to perform a stability test At the end of the incubation periods the samples were not spoiled: besides,mycetes were absent in 1 g of both samples stored at 3 and 8 ~ C and in the

450 whole product stored at 30 ~ C. In accordance with the previous results, the reference untreated samples (data not shown) were spoiled after 15 days (stored at 8 ~ C) and after 30 days (stored at 3 ~ C) respectively during chemical shelf life evaluation. 3.2. Chemical shelf-life evaluation The data reported in Table 2 show noticeable changes in sugar values during storage. Sucrose hydrolysis occurs with the formation of glucose and fructose: this phenomenon is stronger in samples not subjected to high pressure (nt) than in those which are HP-treated, and is likely to be attributed to enzyrre invertase, which is only partially inhibited by HP treatments. L-ascorbic acid remains practically the same during HP processing but decreases during storage, reaching 75% after 60 days at 3 ~ C. The same trend was found for the water-soluble colour parameters; the decrease is significant for the 520 component only. During shelf life evaluation, chromatic modification of the samples was quite negligible from the sensorial view point, while the colorirreter detected some small differences between the different sarr~les. In any case the anthocyanin components of the strawberries were not affected by HPP (data not shown). qhis experience has shown that the best results can be obtained with cold storage after the treatment. The high pressure processing technique allows the preparation of foods with new characteristics of freshness; a correct set- up must be done on the preparation line to find the best processing conditions for optimal results. 4. REFERENCES

1 R. Hayashi, in "Engineering and Food",W.E.L. Spiess and H. Shubert (eds.), vol. 2 (1989) 81,Elsevier Applied Science, London. 2 A. DalrAglio, S. Gola and G. Carpi, Industria Conserve,67 (1992)23. 3 B. Mertens and D. Knorr, Food Technology, 46 (1992) 124. 4 J.C. Cheftel, IAA, 108 (1991) 141. 5 P. Rovere, G. Carpi, A. Maggi and G. Dall'Aglio, in
R. Hayashiand C. Balny (Editors), High Pressure Bioscienceand Biotechnology 1996 Elsevier Science B.V.

451

Measurement of the gel-point temperature under high pressure by a hot-wire method Keiko Shimadff', Yoshio Sakai ~, Kazuyuki Nagamatsu a, Tomoshige ttori b and Rikimaru Hayashi c ~Faculty of Science and Engineering, Science University of Tokyo in Yamaguchi, Onoda, Yamaguchi 756, Japan bTechnology and Research Institute, Kawagoe, Saitama 350-11, Japan

Snow Brand Milk Products Co.Ltd.,

CDepartment of Agricultural Chemistry, Faculty of Agriculture, University, Kitashirakawa, Sakyo-ku, Kyoto 606-01, Japan

Kyoto

Abstract The gel-setting and gel-melting temperatures of aqueous gelatin and agar solutions (0.5 wt% and 1 wt%) were measured by applying a steady state hot-wire method during pressurization up to 200 MPa. Pressurization induced the elevation of both the gel-setting and gel-melting temperatures in proportion to the pressure. The hot-wire method was found to be effective for assessing gelation under pressurized conditions.

1. INTRODUCTION The development of high-pressure food processing has been inferred in many cases to be lacking in a sound scientific basis: e.g., the mechanism for protein gelation and the sol-gel behavior of polysaccharides is far from being understood. ~) Under pressurized conditions up to 300 MPa, elevation of the gel-melting temperature has been induced with the gelation of an aqueous gelatin solution; 2) although the effect of high pressure on the gel-setting temperature has not been reported, the gel-setting temperature is well known to be lower than the gel-melting temperature under atmospheric conditions. The techniques for obtaining adequate data in experiments under high pressure are probably difficult. 2) Hori :~-5)has proposed the application of a steady state hotwire measuring technique as having great potential for use in food manufacturing processes that involve coagulation or gelation. We present

452 here the results of studies in which the gel-setting and gel-melting temperatures of aqueous gelatin and agar solutions were examined under high pressures of up to 200 MPa by the steady state hot-wire method, which was found to be as effective for assessing the coagulation or gelation of food materials such as gelatin and agar under pressurized conditions as it is under atmospheric conditions. 2. M A T E R I A I ~ AND METHODS Commercial gelatin (Sigma Chemical Co., No. 2500, bloom number approx. 300) and agar (Merck Co., Art. 1614) were used. The gelatin or agar was dissolved in deionized and sterilized water (0.5 wt% and 1.0 wt%) at 60~ for 10 rain or at 90~ for 30 min, respectively, after suspending each at 30~ for 30 rain while sth'ring. A high-pressure vessel was then filled up with about 14.5 ml of the sample solution, the vessel having a free piston at the bottom and a narrow well at the top. This vessel was placed in high-pressure experimental apparatus (Hikari High Pressure Co.) surrounded with a cooling or heating jacket. A hot wire probe (1.2 mm in diameter and 10 mm in length), which worked as both a heat source and a temperature detector, was tightly inserted vertically into the narrow well at the top of the vessel. Under working pressure conditions, each gelatin solution was cooled from 40~ to 4~ and heated from 4(C to 450(2 (each agar solution was cooled from 60~C to 250(2 and heated from 25~ to 85~C) at an interval of I~ and equilibrated at a defined temperature. The equilibrated temperatures of the probe, which were equal to those of the samples, were measured 100 times, and then a constant direct electric current was supplied to the probe with a DC power supply system (model 6634A from Hewlett Packard Co.) to give a constant power of 30 W/re. After 3 min of applying power, the temperature of the surrounding sample was measured 50 times, in addition to measuring the supply current. Temperature measurements at a regular interval of 0.6 s time and of electric current were carried out automatically with a data acquisition and control unit (model 3852A from Hewlett Packard Co.), which was connected directly to a desk-top computer (HP 9000 Series 300 from Hewlett Packard Co.). The equilibrium difference between the temperature of the probe and that of each surrounding sample (i.e., the difference in temperature during and before supplying power), J Tw, due to convection heat transfer (30 W/m) was evaluated as an index of the change in fluid viscosity for the transition from gel to sol or from sol to gel. :~-~) 3. RESULTS AND DISCUSSION Figure 1 shows the relationship between the index (AT~v) and the temperature of the surrounding sample for the 0.5% gelatin solution measured under atmospheric and pressurized conditions (0.1, 100 and 200 MPa), the data presenting the results fi'om cooling [Fig. 1 (a)] and heating [Fig. l (b)]. Each

453 3.3

(b) Tmelting

i i

3.0

|

20

25

30

35

2.9 0

10

20

T(~

30

40

50 0

10

20

T(~

30

40

50

Figure 1. Effect of pressure on T~,,tting and 71neltin~ for the 0.5% gelatin solution during cooling (a) and heating (b) under pressures of 0.1 MPa ((),O), 100 MPa ([]...) and 200 MPa (•

result obtained from the cooling and heating processes produced two curves, enabling the gel-setting or gel-melting temperature to be determined from the point at which A Tw rapidly changed and being designated as T~etting or Tmelting, respectively, (Fig. 1). In the case under atmospheric conditions (0.1 MPa), both temperatures, ~etting (12.3~ and Tmelt,ing (23.3~ were almost consistent with the temperatures measured with MSC-DSC apparatus (Microcal Co.) at 20~ (data are not shown). Pressurization at 100 or 200 MPa induced the elevation of both the setting and melting temperatures for 0.5% gelatin solution. T~etting(12.3~C) was incresed to about 14.7~ and to 17.5~ at 100 MPa and 200 MPa, respectively, and Tme,lting (23.3~ was increased to about 26.6~ and 29.8~ respectively, as shwon in Figs. 1 (a) and l(b). These results suggest that both Tse,mng and Tmelting increased proportionally with increasing pressure: elevation of the setting temperature was about 2.6~ and of the melting temperature was 3.2~ for each 100 MPa increase in pressure with the 0.5% gelatin solution. The value tbr the pressure-induced elevation of melting temperature, 3.2~ is close to the result reported by Gekko and Fukamizu 2) of 3.17_+0.22 • 10 .2 K/MPa. With the 1.0% gelatin solution, the relationship between A T w and the temperature of the surrounding sample resembled that with the 0.5% solution,

454 although the temperature elevation induced by pressurization was higher than that with the 0.5% solution; e.g., ~tting of 19.5~ at 0.1 MPa was raised to 23. I~ at 100 MPa, and I~nelting of 28. I~ at 0.1 MPa was raised to 32. I~C. These results for the gel-setting and gel-melting temperature of the aqueous gelatin solutions indicate that the more dilute solution under high pressure behaved like the more concentrated solution at atmospheric pressure: the value for Tmelting of the 1% gelatin solution under atmospheric conditions corresponds with that of the 0.5% solution under a pressure of about 140 MPa. In the case of the 0.5% agar solution, both I~tting and /'melting under pressurized conditions were not as clearly detectable as the case of the 0.5% gelatin solution, whereas Tmeltingunder atmospheric pressure (i.e. 0.1 MPa) was easily detectable as about 72~ as shown in Fig. 2. This might have been due 3.4

,,

..

%

"~ 3.0

~

Tmelting

2.9

~ 2.8 2.7 20

30

40

50

60

T( ~ O)

70

80

90

Figure 2. Effect of pressure on Tme|ting for the 0.5% agar solution during heating under pressures of 0.1 MPa (O) and 100 MPa (m).

to the change in the index of fluid viscosity ( A Tw) being little in the agar solution under the present conditions of heat flux (30 W/m), Tmelting under the p r e s s u r i ~ d conditions being elevated to avobe 85~)C. The present results confirm that the steady state hot-wire method is a particularly useful technique for measuring and assessing the coagulation or gelation of food materials under high pressure. 4. R E F E R E N C E S

K. tIeremans, in "High Pressure and Biotechnology", ed. by C. Bainy et M., John Libbey Eurotcxt, Monterougc (1992) 37. 2 K. Gekko and M. Fukamizu, Int. J. Biol. Macromol., 13 (1991) 295. 3 T. Hori, J. Food Sc]., 50 (1985) 911. 4 T. Hori, Nippon Shokuhin Kogyo GakkaLs'hi, 40 (1993) 461. 5 T. ttori and K. Itoh, Abstracts of Papers, 15th Japan Symposium on Thermophysical Properties, Toyama (1994) 215. 1

R. Hayashi and C. Balny (Editors), High Pressurz Bioscience and Biotechnology 0 1996 Elsevier Science B.V. A11 rights resewed.

C o n t i n u o u s h i g h p r e s s u r e s y s t e m for l i q u i d food S . I t o h , K . Yoshioka, M . T e r a k a w a & I . N a g a n o KATO B R O T H E R S H O N E Y CO., LTD. J a p a n 2-1-8 F u k u u r a , Kanazawa-ku, Yokohama-shi, Kanagawa

Abstract H i g h p r e s s u r e t r e a t m e n t s y s t e m for foods h a v e h a d some p r o b l e m s s u c h a s h e a v y - w e i g h t , expensive cost a n d u n - c o n t i n u o u s t r e a t i n g . S o we h a v e developed a c o n t i n u o u s h i g h p r e s s u r e s y s t e m for liquid foods w h i c h w a s a b l e t o solved a l m o s t a l l t h e p r o b l e m s . I n s t e a d of u s u a l h i g h p r e s s u r e vessel, t h e o u r s y s t e m h a s 5m s t a i n l e s s p i p e s t h a t a r e wound l i k e a coil. By o p e n i n g t h e valve a t t h e o u t l e t of t h e pipe g r a d u a l l y , t h e p r e s s u r i z e d s a m p l e i s r e l e a s e d f r o m t h e s y s t e m a n d t h u s t r e a t e d by c o n t i n u o u s p r e s s u r e . By u s i n g t h i s s y s t e m , we a r e s t u d i n g a d e v e l o p m e n t of s t e r i l i z a t i o n s y s t e m w i t h w a r m condition on s p o r e of Bacillus c e r e u s v a r mycoides (ATCC 11778). S p o r e c o u n t of B. c e r e u s w a s d e c r e a s e d t o l e s s t h a n 10 from 1 0 6 w i t h 4 t i m e s u n d e r 5 0 0 M P a a t 50°C f l o w r a t e 10m1/10min.

1. I N T R O D U C T I O N

T e n y e a r s h a v e b e e n p a s s e d since t h e u s e of p r e s s u r e w a s a d v o c a t e d for food processing. M a n y s t u d i e s h a v e b e e n p u b l i s h e d r e g a r d i n g t h e u s e f u l n e s s of p r e s s u r e for s t e r i l i z i n g m i c r o o r g a n i s m s , d e n a t u r i n g p r o t e i n , a n d a c t i v a t i n g or i n a c t i v a t i n g e n z y m e s . T h e food i n d u s t r y h a s focused on t h e f a c t t h a t p r e s s u r e c a n be u s e d t o s t e r i l i z e a n d process foods w i t h o u t spoiling t h e f r e s h t a s t e . T h i s i s t h e c u r r e n t situation. However, no s p e c i a l r e s u l t s w e r e publicized a f t e r t h e i n v e s t i g a t i o n r e p o r t s w e r e r e l e a s e d by t h e U l t r a h i g h P r e s s u r e T e c h n i c a l R e s e a r c h

456 A s s o c i a t i o n of t h e F o o d I n d u s t r y (11 t h e m e s , 20 c o m p a n i e s ) , w h i c h is one of t h e n a t i o n a l p r o j e c t s u n d e r t h e g u i d a n c e of t h e M i n i s t r y of A g r i c u l t u r e , F o r e s t r y a n d F i s h e r i e s . R e a s o n s for t h i s i n c l u d e : 1) t h e s t e r i l i z i n g e f f e c t a g a i n s t s p o r e s w a s l e s s e r t h a n h a d b e e n expected; 2) t h e s y s t e m w a s h e a v y , l a r g e a n d e x p e n s i v e to o p e r a t e ; a n d 3) t h e s y s t e m did n o t s u p p o r t c o n t i n u o u s p r o c e s s i n g . R e c e n t l y , we h a v e d e v e l o p e d a c o n t i n u o u s h i g h p r e s s u r e s y s t e m for l i q u i d foods t h a t is l i g h t - w e i g h t a n d s o l v e s a l m o s t all t h e p r o b l e m s m e n t i o n e d a b o v e . In t h e p r e s e n t s t u d y , we e x a m i n e d t h e f u n c t i o n s a n d s t e r i l i z i n g e f f e c t s of t h e n e w l y d e v e l o p e d s y s t e m a n d o b t a i n e d good r e s u l t s .

2. E X P E R I M E N T A L

METHOD

2.1. Test system I n s t e a d of t h e u s u a l h i g h p r e s s u r e v e s s e l , t h e new s y s t e m h a s 5m s t a i n l e s s p i p e s t h a t a r e w o u n d l i k e a coil w i t h a p r e s s u r e r e s i s t a n c e of 700 M P a , a n d a n a i r - d r i v e n h y d r a u l i c p u m p (a p l u n g e r p u m p d e l i v e r i n g 800 a t m ) t h r o u g h w h i c h t h e l i q u i d m a t e r i a l is i n t r o d u c e d i n t o t h e p i p e s . A f t e r t h e v a l v e at t h e o u t l e t of t h e p i p e is closed, t h e system applies pressure. T h e 5m s t a i n l e s s p i p e h a s a n i n t e r n a l c u b i c v o l u m e of 10ml. In t h e p r e s e n t s t u d y , we u s e d one or two c o i l - s h a p e d p i p e s , w h i c h w e r e c o n n e c t e d in s e r i e s to m a k e a p r e s s u r e v e s s e l w i t h a n i n t e r n a l v o l u m e of 1 0 m l or 20ml. T h e c o i l - s h a p e d p i p e s w e r e p l a c e d in a t h e r m o s t a t v e s s e l a n d t h e t e m p e r a t u r e c o n t r o l l e d b e t w e e n 5~ a n d 80~ By o p e n i n g t h e v a l v e g r a d u a l l y , t h e p r e s s u r i z e d l i q u i d m a t e r i a l is r e l e a s e d f r o m t h e s y s t e m a n d t h u s t r e a t e d by c o n t i n u o u s p r e s s u r e . T h e c o n c e p t of t h e s y s t e m is i l l u s t r a t e d in F i g u r e 1, a n d t h e s y s t e m s p e c i f i c a t i o n s a r e l i s t e d in T a b l e 1. 2.2. Measurement of t r e a t m e n t performance We m e a s u r e d t h e t i m e t a k e n to r e a c h e a c h p r e s s u r e w i t h t h e t e s t s y s t e m u s i n g p u r e w a t e r as t h e p r o c e s s l i q u i d , t h e m a r g i n a l p r e s s u r e t i m e in c a s e of c o n t i n u o u s t r e a t m e n t , a n d t h e f l u c t u a t i o n s in w o r k i n g p r e s s u r e . We also m e a s u r e d t h e t e m p e r a t u r e in t h e coil

w o r k i n g p r e s s u r e . We a l s o m e a s u r e d t h e t e m p e r a t u r e i n t h e coil d u r i n g t h e c o n t i n u o u s t r e a t m e n t . 'I'he e x p e r i m e n t w a s conducted u n d e r t h e c o n d i t i o n s of one coil c o r r e s p o n d i n g t o a p r e s s u r e vessel w i t h a cubic volume of 101111, a n d a c o n s t a n t t e m p e r a t u r e . After closing t h e valve, we m e a s u r e d t h e t i m e s t a k e n t o r e a c h p r e s s u r e s of 100, 300, 500 a n d 600 M P a . To m e a s u r e t h e c o n t i n u o u s t r e a t n l e u t p e r f o r m a n c e t i m e a n d f l u c t u a t i o n s of w o r k i n g p r e s s u r e , we f i r s t m e a s u r e d t h e p r e s s u r e , s i m i l a r t o t h e m e a s u r e n l e n t of t i m e t a k e n to r e a c h e a c h p r e s s u r e of 1 0 0 , 300, 5 0 0 a n d 6 0 0 M P a . We t h e n g r a d u a l l y o p e n e d t h e valve t o collect t h e t r e a t e d l i q u i d , a n d m e a s u r e d t h e t i m e t a k e n t o collect lOml of t h e l i q u i d . T h i s t i m e w a s r e g a r d e d a s t h e t r e a t m e n t t i m e , while t h e t i m e i n which t h e p r e s s u r e d e c r e a s e d by o p e n i n g t h e valve could n o t b e c o r r e c t e d t o t h e fixed p r e s s u r e by t h e h y d r a u l i c p u m p was regarded a s t h e marginal treatment time. T h e f l u c t u a t i o n s of working p r e s s u r e w e r e m e a s u r e d for a t r e a t m e n t t i m e of 2 m i n u t e s a n d p r e s s u r e s of 1 0 0 , 300, 500 a n d 6 0 0 M P a . T h e t e m p e r a t u r e of t h e t e s t m a t e r i a l s a n d t h e t e m p e r a t u r e i n t h e coil w e r e m e a s u r e d a t p r e s s u r e s of' 100. 300, 500 a n d 6 0 0 M P a for a t r e a t m e n t t i m e of 1 0 n i i n u t c s .

fluid tank

purge gas tank

:

:

rI - - - I,

:

r, - - - - I

pressure gauge

!

intensifier

lOml vessel ...spiral - . .- - - - - - - - - - -.

j

I

C 33-

-

-Y

air source C.---------..

.

, .......... I

...

regulating valve

.....-.-...- - - - ., water-bath

stop valve

temperature transducer

fluid pressed

4

F i g u r e 1. D i a g r a m of C o n t i n u o u s hie11 p r e s s u r e s y s t e m

458 Table 1 S p e c i f i c a t i o n s of C o n t i n u o u s h i g h p r e s s u r e s y s t e m Model number Press capacity L e n g t h of h i g h p r e s s u r e t u b e Maximum pressure Size of h i g h p r e s s u r e t u b e

QCL-10 10 ml 5052 m m 600 M P a 1/4 i n . ( o u t e r d i a m e t e r ) 1/6 i n . ( i n n e r d i a m e t e r ) Maximum press temperature 80~ Pressurizing unit air-operated intensifier M e a s u r e m e n t of f l u i d p r e s s e d t e m p e r a t u r e iron-constantan thermocouple

2.3. Test microorganisms B a c i l l u s c e r e u s v e r m y c o i d e s (ATCC 11778) w a s u s e d as t h e t e s t m i c r o o r g a n i s m f r o m w h i c h B. c e r e u s s p o r e s a l o n e w e r e c o l l e c t e d by u s i n g t h e m e t h o d of a d j u s t i n g t h e s p o r e s u s p e n s i o n , as s p e c i f i e d in t h e " T e s t m e t h o d of r e s i d u a l a n t i b i o t i c s in a n i m a l a n d m a r i n e p r o d u c t s " , a n d t h e n u m b e r of s p o r e s w a s a d j u s t e d to 106 for t h e t e s t liquid. 2.4. Pressure sterilization test The test liquid was treated under continuous pressure under the c o n d i t i o n s s h o w n in T a b l e s 2 a n d 3, a n d t h e n u m b e r of o r g a n i s m s in the treated liquid was measured. The system was rinsed with 0.05N of N a O H s o l u t i o n f o l l o w e d by w a s h i n g w i t h s t e r i l i z e d w a t e r . 2 0 0 m l of t h e t e s t l i q u i d w a s t r a n s f e r r e d to a s t e r i l i z e d b o t t l e in w h i c h a f e e d p i p e w a s i n s e r t e d , a n d t h e l i q u i d w a s m i x e d by a s t i r r e r f o l l o w e d by s i m u l t a n e o u s t r e a t m e n t u n d e r c o n t i n u o u s p r e s s u r e . T h e i n i t i a l p a r t of t h e t r e a t e d l i q u i d w a s d i s c a r d e d a n d t h e r e m a i n i n g p a r t of t h e p r e p a r a t i o n w a s u s e d as t h e t e s t m a t e r i a l for m e a s u r i n g the microorganisms. Before the measurement, the material was i n c u b a t e d w i t h M-10 m e d i u m u n d e r 30~ for 24 h o u r s .

459 Table 2 C o n d i t i o n of s t e r i l i z e d effect w i t h t r e a t i n g t i m e 2 pieces (20 ml) 2 . 4 - 24 min. 300, 400, 500, 600 MPa 50, 60 ~

Piece of coil (volume) Treating time Pressure Temperature

Table 3 C o n d i t i o n of s t e r i l i z e d effect w i t h r e p e a t i n g time 2 pieces (20 ml) 2.4min./20ml 400 MPa, 500 MPa 50, 60 ~ 1 - 4 cycles

Piece of coil (volume) T r e a t i n g time Pressure Temperature The n u m b e r of r e p e t i t i o n

3. R E S U L T S 3.1. Treatment

AND DISCUSSION performance

of t h e s y s t e m

Table 4 R e s u l t of m e a s u r e m e n t w i t h p r e s s u r e level, r e a c h t i m e a n d d i s p e r s i o n of p r e s s u r e P r e s s u r e level (MPa) R e a c h time (sec.) Possible to t r e a t i n g t i m e ( m i n . ) D i s p e r t i o n of Max (MPa) pressure Min (MPa)

100

300

500

600

<1 0.2-30 100 97

2.5 1-30 305 270

9 1-30 510 465

17 1-30 610 560

460 Table 5 R e s u l t of m e a s u r e m e n t

at t e m p e r a t u r e

T r e a t i n g p r e s s u r e (MPa) S e t up t e m p e r a t u r e (~ T e m p e r a t u r e b e f o r e t r e a t i n g (~ T r e a t i n g t i m e (min.) T e m p e r a t u r e of w a t e r - b a t h (~ T e m p e r a t u r e i n t o coil (~

i n t o coil 300 5 20 10 5.0 5.1

300 30 20 10 30.0 30.0

300 50 20 10 50.0 49.2

T a b l e s 4 a n d 5 s h o w t h e m e a s u r e d t i m e s t a k e n to r e a c h e a c h p r e s s u r e , m a r g i n a l p r e s s u r e t i m e in c a s e of c o n t i n u o u s t r e a t m e n t , f l u c t u a t i o n s of w o r k i n g p r e s s u r e , a n d c h a n g e s of t e m p e r a t u r e in t h e coils d u r i n g c o n t i n u o u s t r e a t m e n t . T h e t i m e s t a k e n to r e a c h e a c h p r e s s u r e w e r e : n e a r l y i n s t a n t a n e o u s to r e a c h 300 M P a , a p p r o x i m a t e l y 9 s e c o n d s to r e a c h 500 M P a , a n d a p p r o x i m a t e l y 17 s e c o n d s to r e a c h 600 M P a . All of t h e t i m e s w e r e s h o r t e r t h a n t h o s e presently considered possible. T h e r e s u l t s also i n d i c a t e d t h a t , r e g a r d i n g t h e m a r g i n a l p r e s s u r e t i m e , a h i g h - s p e e d t r e a t m e n t s u c h as for a b o u t 12 s e c o n d s w a s p o s s i b l e at 100 M P a , b u t at o t h e r p r e s s u r e s , t h e t i m e c o r r e s p o n d e d to a b o u t one m i n u t e . F l u c t u a t i o n s of w o r k i n g p r e s s u r e w i t h a p i p e s h o w e d a m a x i m u m f l u c t u a t i o n of 50 M P a , w h i l e t h e f l u c t u a t i o n s i n c r e a s e d as t h e cubic v o l u m e i n c r e a s e d by c o n n e c t i n g t h e p i p e s . S p e c i f i c a l l y , w h e n two p i p e s w e r e c o n n e c t e d , f l u c t u a t i o n in t h e w o r k i n g p r e s s u r e w a s 150 M P a u n d e r 500 M P a p r e s s u r e a n d one m i n u t e t r e a t m e n t . T h i s s u g g e s t s t h a t t h e t e s t s y s t e m is s u i t a b l e for p r e s s u r e t r e a t m e n t not o n l y to g e n e r a t e a c o n s t a n t p r e s s u r e , b u t a l s o to g e n e r a t e v a r i o u s p r e s s u r e s . The r e s u l t s a l s o s h o w e d t h a t t h e coils c a n be k e p t at v a r i o u s t e m p e r a t u r e s d u r i n g c o n t i n u o u s treatment.

461 spore counts (log) 6

. . . . . . . .

I

-

.

.

.

.

.

.

!

.

]

!

!

!

i ..................

5

!

.....................................

"'~': . . . . . . . . . . . . .

300MPa

! ........................

~". . . . . . . . . . . . . . . . . . . . . . . . . . . . .

L_Ij 4 0 0 M P a

~

"X2I >,,

3 ....................,,,...i.... ~ . . ' ~ . . . - . - . - . i - . - . . - -

-

-. ~< ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

500MPa

: ~ .... ~ . . _

\

2

l

.........................."....................................................................................

E

..................

i

"• - 6 0 0 M P a

,

/

i".

i

1

i

t

0

J

t

I

I

5

I

i

i

I

10

i

t

i

i

i

15

t

i

i

J

20

"

25 (min.)

S a m p l e = 10^6 ATCC 11778 spores Figure

2. S t e r i l i z a t i o n

e f f e c t s of d i f f e r e n t

the treatment

t i m e at 50~

on ATCC 11778 spore counts (log) .

.

.

.

.

.

.

.

I

.

.

.

.

.

.

.

.

I

"

'

'

'

1

. . . .

I

''~

.

.

.

.

.

.

................................ ]................................................. i...................i...........................................

i <

~ .................... i ...................... i.......~

i

!

!

.....T ....... i................ i ......................i....................... i....................

400MPa :

3

.............

J. . . . . . . . . . . . . . . .

i

\

.,

!

500MPa ? ?

1 1

2

3

4 (times)

I cycle = 2.4min continuous t r e a t m e n t S a m p l e = 10^6 ATCC 11778 spores

Figure

3. E f f e c t s o f t h e n u m b e r

of t r e a t m e n t

at 500C on A T C C 1 1 7 7 8

462 3.2. Pressure sterilization The r e s u l t s of p r e s s u r e s t e r i l i z a t i o n are i l l u s t r a t e d in F i g u r e s 2 a n d 3. It was found t h a t p r o l o n g e d t r e a t m e n t t i m e did not p r o d u c e r e m a r k a b l e s t e r i l i z a t i o n . B a s e d on the f i n d i n g t h a t the p r e s s u r e can be c h a n g e d by r e d u c i n g the t r e a t m e n t time, we chose 2.4 m i n u t e s for t h e t r e a t m e n t and, due to the s m a l l volume of the coils, r e p e a t e d t r e a t m e n t s by r e t u r n i n g the p r e v i o u s l y t r e a t e d m a t e r i a l s to the s y s t e m . Thus, four r e p e a t e d t r e a t m e n t s (total t r e a t m e n t time, 9.6 m i n u t e s ) s t e r i l i z e d a l m o s t the e n t i r e p o p u l a t i o n of m i c r o o r g a n i s m s .

4. R E F E R E N C E S 1 R. H a y a s h i , Use of h i g h p r e s s u r e in c o r p o r a t i o n (1989). 2 Y. Kokubo, K. Jinbo, S. K a n e k o a n d Spore-forming Bacteria Commercial Lab. P. H., 35 (1984). 3 The j a p a n e s e R & D A s s o c i a t i o n for industry, High pressure technology c u l t i v a t i o n , (1993).

food, S a n - e i p u b l i s h i n g M. M a s t u m o t o , P r e v a l e n c e of Honey, Ann. Rep. Tokyo Metr. high p r e s s u r e t e c h n o l o g y in and dense and mass

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

Development

of pulsatile

high

pressure

463

equipment

S. Itoh, K. Yoshioka, M. Terakawa & I. Nagano KATO BROTHERS HONEY CO., LTD. J a p a n 2-1-8 Fukuura, Kanazawa-ku, Yokohama-shi, Kanagawa

Abstract We h a v e d e v e l o p e d p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t for r e s e a r c h a n d d e v e l o p m e n t of p r e s s u r i z e d foods. The e q u i p m e n t can i n s t a n t a n e o u s l y i n c r e a s e or d e c r e a s e p r e s s u r e a n d p r o d u c e p r e s s u r e p u l s a t i o n by r e g u l a t i n g t h e p r e s s u r i z i n g v a l v e a n d t h r o t t l e valve on t h e f r o n t of t h e p r e s s u r e vessel . We h a v e s t u d i e d t h e k i l l i n g of s p o r e s of Bacillus c e r e u s v a r mycoides u s i n g t h i s e q u i p m e n t a n d o b t a i n e d good r e s u l t s . A l t h o u g h B . c e r e u s s p o r e s are v i a b l e u n d e r c o n d i t i o n s of 500 M P a at 50~ for 1 h o u r , t h e y can be k i l l e d by r a i s i n g t h e p r e s s u r e to 500 M P a for 5 m i n u t e s at 50~ a n d t h e n r e d u c i n g t h e p r e s s u r e to n o r m a l , r e p e a t e d 10 t i m e s .

1. I N T R O D U C T I O N U l t r a h i g h p r e s s u r e p r o c e s s i n g t e c h n i q u e s are a t t r a c t i n g a t t e n t i o n as a new m e t h o d of food p r o c e s s i n g . This t e c h n o l o g y w as b o r n in 1914 w h e n B r i d g m a n c a u s e d d e n a t u r a t i o n of p r o t e i n u n d e r h y d r o s t a t i c p r e s s u r e , a n d r e s e a r c h u s i n g h i g h p r e s s u r e in t h e fi el ds of food p r o c e s s i n g a n d s t e r i l i z a t i o n b e c a m e a c t i v e t h r o u g h o u t t h e world, i n c l u d i n g J a p a n , a b o u t 10 y e a r s ago. H i g h p r e s s u r e p r o c e s s i n g h a s a l m o s t no effect on a r o m a t i c i n g r e d i e n t or p i g m e n t s , a n d c a u s e s i r r e v e r s i b l e d e n a t u r a t i o n of p r o t e i n s a n d s t a r c h e s s i m i l a r to t h a t s e e n in h e a t p r o c e s s i n g . T h i s p r o c e s s i n g m a y also c a u s e d e s t r u c t i o n a n d d e a t h of some b a c t e r i a .

464 B a s e d on s u c h p r o p e r t i e s of h i g h p r e s s u r e , r e s e a r c h on t h e u t i l i z a t i o n of h i g h p r e s s u r e in foods is d e v o t e d i t s u s e in food p r o c e s s i n g a n d s t e r i l i z a t i o n in p l a c e of h e a t . H i g h p r e s s u r e s h o u l d be a n e f f e c t i v e m e t h o d for m i c r o b i o l o g i c a l c o n t r o l of foods w h i c h a r e s u b j e c t e d to a r e d u c t i o n in q u a l i t y d u e to t h e i n a c t i v a t i o n of v i t a m i n s a n d a c t i v e i n g r e d i e n t s as w e l l as t h e g e n e r a t i o n of b a d o d o r s by h e a t s t e r i l i z a t i o n . It s h o u l d also be p o s s i b l e to i m p r o v e t h e s t e r i l i z a t i o n e f f e c t s by u s i n g a c o m b i n a t i o n of h i g h p r e s s u r e a n d h e a t to s t e r i l i z e food r a t h e r t h a n h i g h p r e s s u r e a l o n e . H o w e v e r , r e s e a r c h on t h e a p p l i c a t i o n of h i g h p r e s s u r e to foods is s t i l l at t h e b a s i c s t a g e , a n d it is s t i l l not c l e a r e x a c t l y how m i c r o o r g a n i s m s a r e k i l l e d by h i g h p r e s s u r e or how it s h o u l d be a p p l i e d to a c h i e v e t h e o p t i m u m e f f e c t s . F o r e x a m p l e , in p r o c e s s i n g using both p r e s s u r e and heat, spores which are not killed even after p r o c e s s i n g at 500 M P a for 3 h o u r s a r e s o m e t i m e s k i l l e d in 30 m i n u t e s by r e p e a t e d l y r a i s i n g t h e p r e s s u r e to 500 M P a a n d t h e n l o w e r i n g it to n o r m a l at i n t e r v a l s of s e v e r a l m i n u t e s . It a p p e a r s t h a t m o r e e f f e c t i v e s t e r i l i z a t i o n is a t t a i n e d t h r o u g h t h e force ( s h e a r s t r e n g t h , etc.) g e n e r a t e d w h e n t h e p r e s s u r e is r a i s e d a n d l o w e r e d t h a n by c o n s t a n t a p p l i c a t i o n of h i g h p r e s s u r e . T h e r e f o r e , we d e v e l o p e d p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t w h i c h c a n i n s t a n t a n e o u s l y r a i s e a n d l o w e r t h e p r e s s u r e for use in r e s e a r c h a n d d e v e l o p m e n t of p r e s s u r i z e d foods. T h e p r e s s u r i z a t i o n m e t h o d u s e d in t h i s e q u i p m e n t is a s y s t e m w h i c h s u p p l i e s a p r e s s u r i z e d m e d i u m ( w a t e r ) to t h e p r e s s u r e v e s s e l by m e a n s of an a i r p u m p . T h i s s y s t e m m a k e s it p o s s i b l e to a c h i e v e p r e s s u r i z a t i o n by r e l e a s i n g the p r e s s u r i z e d w a t e r from a s e p a r a t e p r e s s u r e - r e d u c i n g valve a t t a c h e d to t h e p r e s s u r e v e s s e l , i.e., p r e s s u r i z a t i o n is a c h i e v e d by a fixed r e d u c t i o n w i t h i n p r e s s u r e from an optional level and t h e n r a i s i n g it b a c k to t h e o p t i o n a l level. In t h i s way, p r e s s u r e p u l s a t i o n ( v a r i a t i o n ) o c c u r s c o n s t a n t l y in t h e p r e s s u r e v e s s e l a n d we call t h i s " p u l s a t i l e h i g h p r e s s u r e p r o c e s s i n g " . S i n c e t h e p r e s s u r e c a n be r e d u c e d i n s t a n t a n e o u s l y w i t h t h i s e q u i p m e n t , it is also p o s s i b l e to s t u d y t h e e f f e c t s of t h e p r e s s u r e r e d u c t i o n s p e e d on foods a n d sterilization using this equipment. We a p p l i e d r e p e a t e d h i g h p r e s s u r e p r o c e s s i n g , c o m b i n i n g b o t h p r e s s u r e a n d h e a t , u s i n g t h i s p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t , to s p o r e - f o r m i n g b a c t e r i a w h i c h a r e c o n s i d e r e d d i f f i c u l t to k i l l by h i g h

465 p r e s s u r e , and s t u d i e d the p o s s i b i l i t y of s t e r i l i z a t i o n .

2. E X P E R I M E N T A L M E T H O D S 2.1. Equipment The p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t h a s a p r e s s u r e v e s s e l w h i c h is b a s i c a l l y the s a m e as t h a t in cold i s o s t a t i c p r e s s i n g (CIP) e q u i p m e n t u s e d c o n v e n t i o n a l l y for the m o l d i n g of c e r a m i c s , and p r e s s u r i z a t i o n is a c h i e v e d by i n j e c t i n g the p r e s s u r i z e d m e d i u m into t h e p r e s s u r e vessel. The f e a t u r e s of t h i s e q u i p m e n t i n c l u d e the use of an a i r - d r i v e n p r e s s u r e - i n c r e a s i n g device which can i n s t a n t a n e o u s l y i n c r e a s e or d e c r e a s e the p r e s s u r e and a p r e s s u r e r e d u c i n g valve a t t a c h e d to the front of the p r e s s u r e vessel which m a k e s possible r e l e a s e of the p r e s s u r i z e d m e d i u m (water) forced out by the p r e s s u r e i n c r e a s i n g device. By r e g u l a t i n g the p r e s s u r e r e d u c i n g valve, p r e s s u r i z a t i o n can be p e r f o r m e d while r e d u c i n g the p r e s s u r e , and p r e s s u r e p u l s a t i o n can be a p p l i e d in the p r e s s u r e vessel. T e m p e r a t u r e r e g u l a t i o n is a c h i e v e d by c i r c u l a t i o n of w a t e r from the t h e r m o s t a t t h r o u g h the j a c k e t s u r r o u n d i n g the p r e s s u r e vessel, p e r m i t t i n g high p r e s s u r e p r o c e s s i n g at a t e m p e r a t u r e r a n g e of 5 to 80~ Table 1 shows the m a i n s p e c i f i c a t i o n s and F i g u r e 1 shows a d i a g r a m of the p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t .

i

| -4-

i

V: P: J:

pressure vessel pressure pump jacket

F i g u r e 1. D i a g r a m of p u l s a t i l e h i g h p r e s u r e e q u i p m e n t

466 Table 1 S p e c i f i c a t i o n of p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t Application Pressure vessel Vessel volume Maximum pressure Pressure medium Temperature control C o m p r e s s form Pressurizing condision

L i q u i d a n d Solid foods Steinless steel 50 ml 600 M P a Water J a c k e t by t h e r m o s t a t Air c o m p r e s s e r ( O u t p u t v o l u m e is 5 m l / o n e s t r o k e ) v a r i a b l e p u l s e by r e g u l a t e t h e val ve

2.2. C u l t i v a t i o n a n d c o u n t i n g of s p o r e s B a c i l l u s c e r e u s var. m y c o i d e s (ATCC 11778) w a s g r o w n by i n c u b a t i o n for a b o u t 3 w e e k s at 30~ a n d t h e s p o r e s w ere c o l l e c t e d in s t e r i l i z e d w a t e r . A f t e r h e a t i n g at 65~ for 30 m i n u t e s , c e n t r i f u g a t i o n was p e r f o r m e d at 3,000 r p m a n d t h e s u p e r n a t a n t w as d i s c a r d e d . This p r o c e d u r e w a s r e p e a t e d twice at an i n t e r v a l of 24 h o u r s , a n d a s p o r e s u s p e n s i o n w a s p r e p a r e d w i t h t he n u m b e r of s p o r e s a d j u s t e d to

106/g. Th is s u s p e n s i o n w a s p l a c e d in a 20 m m x 80 m m s t e r i l i z e d n y l o n / p o l y e t h y l e n e bag a n d h e a t s e a l e d a f t e r d e a e r a t i o n . It p r o v i d e d s a m p l e s for t h e s t u d y . 2.3. High pressure processing experiment 1) M e a s u r e m e n t of t he p r e s s u r i z i n g t i m e The t i m e t a k e n to r e a c h e a c h p r e s s u r e level w as d e t e r m i n e d before t h e s t a r t of e a c h e x p e r i m e n t . 2) I n s t a n t a n e o u s h i g h p r e s s u r e e x p e r i m e n t The i n s t a n t a n e o u s h i g h p r e s s u r e e x p e r i m e n t w as p e r f o r m e d by i n s e r t i n g t h e s a m p l e d e s c r i b e d above i n t o t h e p r e s s u r e vessel, a n d i n s t a n t a n e o u s l y r e d u c i n g t h e p r e s s u r e to t he n o r m a l level one s e c o n d a f t e r an o p t i o n a l p r e s s u r e h a d be e n r e a c h e d . P u l s a t i l e h i g h p r e s s u r e p r o c e s s i n g w a s p e r f o r m e d by r e p e a t i n g t h i s c o m p l e t e p r o c e d u r e u n d e r 300, 400, 500 a n d 600 M P a at 25~ a n d u n d e r 500 M P a at 50~ from one to 10 or 20 t i m e s . The s por e c o u n t s were t h e n o b t a i n e d . In t h e e x p e r i m e n t u s i n g b o t h p r e s s u r e a n d h e a t , t h e hot w a t e r

467 c i r c u l a t i n g in t h e j a c k e t w a s r e g u l a t e d so t h a t t h e p r o c e s s i n g c o u l d be p e r f o r m e d w i t h t h e t e m p e r a t u r e b e f o r e a n d a f t e r s a m p l e p r o c e s s i n g m a i n t a i n e d w i t h i n t h e r a n g e of __ 1~ of t h e s e t temperature. Instantaneous high pressure processing experiments w e r e p e r f o r m e d at 30, 40, 50 a n d 60~ 3) P u l s a t i l e e x p e r i m e n t w i t h t h e h i g h p r e s s u r e m a i n t a i n e d D i f f e r e n c e s in s t e r i l i z a t i o n e f f e c t s b a s e d on t h e l e n g t h of t i m e at w h i c h h i g h p r e s s u r e w a s m a i n t a i n e d in p u l s a t i l e h i g h p r e s s u r e processing were studied. Processing was performed with the p r e s s u r e m a i n t a i n e d at 500 M P a or 600 M P a a n d t h e t e m p e r a t u r e m a i n t a i n e d at 40, 50 or 60~ for 1, 2, 3, 5, 10, 30 or 60 m i n u t e s w i t h one to 30 p u l s e s p e r e x p e r i m e n t , a n d t h e e f f e c t s on s t e r i l i z a t i o n w e r e s t u d i e d .

3. R E S U L T S

AND DISCUSSION

1) The r e s u l t s of d e t e r m i n a t i o n of t h e t i m e s t a k e n to r e a c h e a c h p r e s s u r e l e v e l s a r e s h o w n in T a b l e 2. 2) I n s t a n t a n e o u s h i g h p r e s s u r e e x p e r i m e n t F i g u r e 2 s h o w s t h e r e s u l t s of d e t e r m i n a t i o n of s p o r e c o u n t s a f t e r i n s t a n t a n e o u s h i g h p r e s s u r e p r o c e s s i n g . S o m e r e d u c t i o n in t h e c o u n t s w a s s e e n w h e n t h e n u m b e r of p r o c e s s i n g s w a s i n c r e a s e d a t n o r m a l t e m p e r a t u r e , b u t t h e r e w e r e a l m o s t no s t e r i l i z a t i o n effects, a n d t h e r e s i d u a l s p o r e c o u n t s did n o t c h a n g e e v e n w h e n t h e n u m b e r of p r o c e s s i n g s w a s i n c r e a s e d to 30 or 40 t i m e s . T h e s t e r i l i z a t i o n e f f e c t s a g a i n s t B. c e r e u s s p o r e s , w h i c h c a n n o t be k i l l e d at all w i t h h e a t a l o n e , w e r e i n c r e a s e d by u s i n g b o t h h e a t a n d p r e s s u r e . By i n s t a n t a n e o u s p u l s a t i l e p r o c e s s i n g 10 t i m e s u n d e r 500 M P a at 50 ~

t h e 106/g c o u n t w a s r e d u c e d to 104/g, a n d f u r t h e r to

102/g w h e n t h e p r o c e s s i n g w a s r e p e a t e d 20 t i m e s . And, r e s u l t s of d e t e r m i n a t i o n of r e s i d u a l s p o r e c o u n t s a f t e r p r e s s u r e t r e a t m e n t w i t h 500 M P a at d i f f e r e n t t e m p e r a t u r e on B. c e r e u s s p o r e s a r e s h o w n in f i g u r e 3.

468 Table 2 T h e t i m e s t a k e n to r e a c h v a r i o u s p r e s s u r e 100 M P a

1 second

200 300 400 500

2 seconds 8 seconds 9 seconds 10 s e c o n d s

MPa MPa MPa MPa

1 s t r o k e - 250 M P a

spore counts (log)

7.< I

I

" ".

~ f

43.

f

2~

I

O. i

..,

..............

.'.

f

:.:.:.:.:.: ........... I~~!..:i:i:i:i:i: .'.'. ".'."

I

~ 5

P

I0

frequency

15

~

300MPa-25"C

_ 400MPa'25~ 500MPa-25 ~ 600MPa-25 ~ 20 500MPa-50~

F i g u r e 2. T h e r e s u l t s of d e t e r m i n a t i o n of r e s i d u a l s p o r e c o u n t s a f t e r i n s t a n t a n e o u s h i g h p r e s s u r e p r o c e s s i n g at d i f f e r e n t p r e s s u r e on B. c e r e u s s p o r e s .

3) E x p e r i m e n t w i t h t h e h i g h p r e s s u r e m a i n t a i n e d T h e s t e r i l i z a t i o n e f f e c t s of d i f f e r e n c e s in h i g h p r e s s u r e h o l d i n g t i m e s on B. c e r e u s s p o r e s a r e s h o w n in F i g u r e 4.

469

spore

count

5I !

4 - . . ~

3.

!-

1

~]

0

l ?C.

.z.J.

v~,, ~.l

~-~

',-,

A A v J

10

Figure time

3. on

spore

The

B.

cereus

counts

6 5

effects

of

10 min.

differences

in

high

pressure

maintenance

spore

(log)

_ ...................... 9 .r., ..........~........................... ~............................ !........................... i'....................... ! , ,,\ i ~ i 20~ ! i , , ~ . i ! : 2- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

j

4

" ". i \

. . . . . . . . . . . . . . . . . . . . . . . . ... . . . . .......... ..

~ a

,

~

+

' ...........................

o ................

_

i

'T~............... ........

: -

...........................

'

,

. .............

~

60~

~

""

,,.

o'ci . . . . . . .

i :. . . . . . . . . . . . . . . .

-X

"

- ....................... :..-........................... ~.......................... + . . . . . . . . . . . . . . . . . . . . {. . . . . . . . . . . . . . . . . . . . +

0

treatment

40~

:

i ' .......

-

Figure

....

.............................................................' ................~ .......................... i............... ~ . . ~ ...................... -~ ........................

0

i

, ..~........................... \ \ ~ ~......... o u ~ .'....... :............................

9

2

~

4.

The with

30 min.

results 500MPa

X 1

of residual at

different

spore

30 min.

X 2

counts

after

temperature

pressure on

B.

cereus

spores

470

T h e c o u n t o f B. c e r e u s pressure

maintained

spores under

reached

0 after

longer

the maintenance

Based

on the total time the high pressure

found that required

time, the better

the shorter

10 p r o c e s s i n g s

with the

5 0 0 M P a a t 50 ~ f o r 5 m i n u t e s . the sterilization

the maintenance

The

effects.

was maintained,

it was

time, the less total time was

for sterilization.

s p o r e c o u n t s (log)

~

1

1

I

I

iii

6

I

I

I

I

1

I

1

!

I

1

I

- !

I

l

1

I

!

I

i

l"

!

I

1

'i

]'

i--r-[~

_

.......i ......:.......i................::................!................i...............i................~............ -

i

i !

! \ i,"-J.

i

i i

i

( J

60 ~ 60~

9 lOmin.

50~ 50~ -

~\ [ ~ ] ~

:

\:

[~J

:

\

i

i

"

.

i

i

-

i "-

i

:

50~ ~~ ~

!

" ~: - - - i _

- ............il................~............. ! ..............i....~ .......i....-'...:....i~.-..........:~ ...........--

L

l

J

J

J

|

I

J

J

!

1

I

J

10

Figure

J

J

J

20

for complete

As in figure minutes,

J

8 times

which

improved of pulsatile

J

I

I

40

J

J

J

I

50

J

J

I

60

JJ

(min.)

processing

o n B. c e r e u s

spores

could be reduced

a n d a t 50~

from

for 5

f o r 10 m i n u t e s ,

f o r 10 m i n u t e s

three

or five times

with

for 2 minutes. it was evident

that

the sterilization

a r e v e r y d i f f i c u l t to k i l l u s i n g h i g h p r e s s u r e ,

by pulsatile

time was

spores

10 t i m e s w i t h 5 0 0 M P a a n d a t 50~

with 500MPa

results,

J

of t o t a l h i g h p r e s s u r e

w i t h 5 0 0 M P a a n d a t 60~

From these

I

5, t h e c o u n t o f B. c e r e u s

5 8 0 M P a a n d a t 60~ spores,

l

sterilization

106/g to 0 by processing times

I

30

5. T h e d i f f e r e n c e s

required

J

high pressure

high pressure

low, and the sterilization

processing

processing.

However,

at normal

temperature

effects were remarkably

improved

effects on could be the effects were by t h e

471 u s e of b o t h p r e s s u r e a n d h e a t . S t e r i l i z a t i o n of B. c e r e u s s p o r e s at a c o m p a r a t i v e l y low t e m p e r a t u r e of 50~ in c o m b i n a t i o n w i t h p r e s s u r e is a n e f f e c t i v e p r o c e d u r e for food a n d is v e r y s i g n i f i c a n t , b u t a t o t a l p r e s s u r i z i n g t i m e of a b o u t 1 h o u r is c o n s i d e r e d too long. W h e n t h e t e m p e r a t u r e w a s r a i s e d to 60"C a n d p r o c e s s i n g w a s p e r f o r m e d a n d 500 M P a m a i n t a i n e d for 10 m i n u t e s at 60 ~ t h e t o t a l p r e s s u r i z i n g t i m e w a s 30 m i n u t e s . It w a s 10 m i n u t e s a n d 580 M P a m a i n t a i n e d for 2 m i n u t e s at 60~ By i n c r e a s i n g t h e t e m p e r a t u r e , t h e n u m b e r of p u l s a t i l e p r o c e s s i n g s a n d t h e t o t a l t i m e c o u l d be s h o r t e n e d . It is h i g h l y s i g n i f i c a n t t h a t k i l l i n g of B . c e r e u s s p o r e s is p o s s i b l e by h i g h p r e s s u r e p r o c e s s i n g at 50 or 60~ t e m p e r a t u r e s at w h i c h d e g e n e r a t i o n or r e a c t i o n s of s u b s t a n c e s a r e u n l i k e l y . The r e a s o n s for t h e s e r e s u l t s a r e c o n s i d e r e d to be t h e f a c t t h a t t h e r e c e n t l y d e v e l o p e d p u l s a t i l e h i g h p r e s s u r e e q u i p m e n t is able to i n c r e a s e t h e a i r p r e s s u r e by 800 fold by m e a n s of an a i r - d r i v e n p r e s s u r e i n c r e a s i n g device which has s h o r t e n e d the p r e s s u r i z i n g time, and a l a r g e s h o c k is a p p l i e d to t h e s a m p l e s since t h e p r e s s u r e c a n be r e d u c e d i n s t a n t a n e o u s l y by m e a n s of t h e p r e s s u r e r e d u c i n g v a l v e on t h e f r o n t of t h e p r e s s u r e v e s s e l . T h e r e a r e m a n y o t h e r a d v a n t a g e s , i n c l u d i n g (1) no n e e d for a n e l e c t r i c p o w e r d r i v e s o u r c e , (2) c o m p a c t e q u i p m e n t w i t h a s m a l l p r e s s u r e v e s s e l of o n l y 50 ml, a n d (3) p u l s a t i o n at a n y o p t i o n a l pressure.

4. R E F E R E N C E S 1 Rikimaru Hayashi, Use of high pressure in food, San-ei publishing corporation (1989). 2 Y. Kokubo, K. Jinbo, S. Kaneko and M. Matsumoto, Prevalence of Sporeforming Bacteria in Commercial Honey, Ann. Rep. Tokyo Metr. Lab. P. H., 35 (1984). 4 The japanese R & D Association for high pressure technology in food industry, High pressure technology and dense and mass cultivation, (1993). 5 K. Watando, ISO3, MPR conference (1986).

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

473

Behaviour of organic compounds in food under high pressure: Lipid peroxidation E. KowalskP, H. Ludwigb and B. Tauscher~'c alnstitute of Chemistry and Biology, Federal Research Center for Nutrition, Engesserstr. 20, D-76131 Karlsruhe, Germany blnstitute of Pharmaceutical Technology, University of Heidelberg, INF 346, D-69120 Heidelberg, Germany ~

to B. Tauscher

Abstract We investigated the autoxidation of alpha-linolenic acid under pressure of up to 600 MPa. Three groups of peaks were separated by HPLC and the kinetics of their formation described. Isomeric hydroperoxyepidioxides, hydroxides and hydroperoxides were determined by spectroscopy. Increasing pressure reduces the induction phase strongly and accelerates formation of primary oxidation products; after a maximum, it decreases relatively fast again. Shorter induction phases are explained by degradation of hydroperoxides in the original product. Propagation under elevated pressure follows the same reaction mechanism as under normal pressure. With increasing viscosity and radical concentration, reactions are stopped by recombination of radicals in a confined area, leading to decreasing yield with increasing pressure.

1. INTRODUCTION Pasteurization of food by ultrahigh hydrostatic pressure has attracted the attention of many disciplines. Chemical reactions of low-molecular and oligomeric compounds in food under high pressure have been little investigated. Generally any process and any reaction in food are of interest to which the principle of Le Chatelier applies, i.e. under equilibrium conditions, a process associated with a decrease in volume is favoured by pressure, and vice versa. Pressure influences rate and equilibrium of reactions even in food [1]. In synthetic chemistry pressure is frequently applied e.g. to hydrations, cyclizations, solvolyses, polymerizations or production of ionic compounds [2]; little attention,

474 however, has been paid to oxidation reactions, and autoxidations of unsaturated systems under pressure. The questions arises whether at pressures applied to sterilize food desirable or undesirable chemical reactions among food components must be expected. Alpha-linolenic acid is one of the polyunsaturated n-3-fatty acids (n-3-PUFAs). Alpha-linolenic acid and linolic acid (n-6-PUFA) are essential for humans as they are not synthetized by the organisms and have to be supplied by food (essential fatty acids). Linolic acid is present in many seeds, alpha-linolenic acid in green leafy vegetables and in some vegetable oils. Polyunsaturated fatty acids, as components of acyl lipids, autoxidize readily to hydroperoxides which enter into many subsequent reactions [3]. Under atmospheric pressure alpha-linolenic acid autoxidizes according to a radical chain mechanism to eight isomeric hydroperoxides [4, 5]. We investigated the autoxidation of alphalinolenic acid under pressures of 100 to 600 MPa at 40~ and explored the structures of the resulting compounds in order to shed light on the reaction mechanisms controlling autoxidation under pressure.

2. MATERIAL AND METHODS Alpha-linolenic acid was purchased from Fluka, Neu-Ulm and used without further purification. All solvents and other chemicals were from E. Merck, Darmstadt, Nmethyl-N-nitroso-p-toluenesulfonamide from Aldrich, Steinheim. 100/zl aliquots of linolenic acid were pipetted into small bags of LD-polyethylenealuminium laminate and heat sealed. 10 ml of oxygen were added to each bag using a syringe; then the bag was sealed again. The pressure apparatus used consisted of three separate autoclaves (12 ml volume each), thermostated by water. Pressure up to 700 MPa was generated by an hydraulic pump. 5/zl of linolenic acid were added to 5 ml of 80 % ethanol. Absoption at 234 nm (conjugated diene absorption) was measured by Bekmann DU-6 spectrophotometer. Before the oxidation products were separated by HPLC, free acids had been converted into the corresponding methylesters by diazomethane. Reversed-phase HPLC was carded out on a 125 x 4.6 mm HD-SIL-C8 column (Knaur, Bad Homburg). The products were eluted using a gradient of

475 acetonitrile/water = 50/50 (v:v) to 90/10 (v:v) within 20 min at a flow rate 1 ml/min. Column effluents were detected at 215 and 234 nm simultaneously. The hydroperoxides obtained after micro-preparation by RP-HPLC were reduced by sodium borhydride and separated into eight isomeric alcohols, according to eight isomeric hydroperoxides [6], by absorption HPLC. Absorption HPLC was performed on a 250 x 4 mm Lichrosolv Si60 column (E. Merck, Darmstadt) under isocratic conditions (hexane/ethanol = 100/0.7 (v:v), flow rate 1 ml/min, detection at 234 nm). Fractions separated by RP-HPLC were identified by HPLC-MS under different ionization conditions, whereas the pure isomeric alcohols obtained by adsorption HPLC were identified by GC-MS after etherification by BSTFA (conditions see [7]). To determine the total amount of alpha-linolenic acid methylester by GC oleic acid methylester was used as internal standard (GC conditions: Omegawax 320, 30 m,

2oooc).

3. RESULTS AND DISCUSSION The decrease of the content of alpha-linolenic acid determined as methylester as a function of pressure is shown in figure 1. Increasing pressure lowers the decrease of alpha-linolenic acid dramatically. The strongest decrease was recorded after three hours.

Linolenic acid methylester [%]

120 I 110 . . . . . . . . . . . . . . . . . . . . . . 100)

9

0.1 MPa ,-+-100 MPa

. . . . . . . . . . . . . . . . . . . .

~ 350 MPa 600 MPa

The p r i m a r y o x i d a t i o n products emerging from autoxidation show a conjugated d o u b l e b o n d w i t h a UV absorption maximum at 234 nm. Formation kinetics of the primary oxidation products as a function of pressure is shown in figure 2. D e c r e a s e of the alphalinolenic methylester correlated well with increased absorption

90 80 70 60 50

0

5

10

15

20

25

30

35

40

t [h]

Figure 1. Decrease of alpha-linolenic acid under different pressures at 40 ~

476 at 234 nm. Primary oxidation products with conjugated diene structure obviously form also u n d e r h i g h p r e s s u r e . An absorption maximum (fig. 2) is reason to assume that the primary oxidation products lose their conjugation and react further to form thermodynamically more stable p r o d u c t s . In c o n t r a s t to autoxidation under normal pressure, t h e r e is no continuous regeneration of primary oxidation products, as the concentration of alphalinolenic is nearly constant under pressure (fig. 1) while the concentration of conjugated dienes is decreasing (fig. 2).

~.6

Absorption [AU]

1.4

i

0.1 MPa ,--100 MPa

. . . . . . . . . . . . . . . . . . .

J" . y. .Y ;

-

.

"

~.2

0.8 0.6

0.4 02 0

2

4

6

8

10

12

16

14

18

20

t [h]

Figure 2. Absorption increase at 234 nm as a function of pressure at 40~ (formation of primary oxidation products with conjugated double bonds).

The primary oxidation products, after conversion into methyl esters, were separated into three groups of peaks (I, II, and III) (retention time I: 7.4-7.9 min, II: 8.4-9.4 min, III: 9 . 5 - 1 0 . 5 min). With increasing oxidation these three 0 . 7 5 ~ "/" peak groups have been found to be t h e p r i m a r y m a i n .~ 0'6 1 o x i d a t i o n p r o d u c t s . It is c 0.45noteworthy that small quantities of primary oxidation o products were present already ~ 03in the original alpha-linolenic acid used. Figure 3 shows the 0.~development of peak groups I, / ~ 3h II and III at normal pressure, I II III I , 12 figure 4 at 350 MPa. t (min)

J

|

I

'

At normal pressure, peak g r o u p III is c o n t r o l l i n g oxidation, at increased pressure it does so for a while only,

21h

Figure 3. RP-HPLC chromatograms of the oxidation products of alpha-linolenic acid at 0.1 MPa and 40~ detection at 234 nm.

477 then peak group II is taking its role. With increasing pressure, the maximum of the sum of peak areas (I+II+III) shifts towards shorter times and smaller area values. In other words" t h e r e is l e s s autoxidation totally under pressure.

t'--

.o_ O

The appearance of shoulders in the chromatogramm of the peak groups is reason to a s s u m e that each g r o u p consists of several isomeric compounds.

<

h 0.1

] 5

I

II

III

12

t (min)

Peak groups I, II and III Figure 4. RP-HPLC chromatograms of the were identified by HPLC-MS oxidation products of alpha-linolenic acid at 350 [8]. By different ionization MPa and 40~ detection at 234 nm. methods including particle beam chemical ionization with ammonia as reaction gas the following compounds were classified with peak groups I, II and III: Peak group I:

isomers of hydroperoxy-epidioxy-octadecadienoic acid methlyester

Peak group II:

isomers of hydroxy-octadecatrienoic acid methylester

Peak group III:

isomers of hydroperoxy-octadecatrienoic acid methylester

By reduction by sodium borhydride in aqueous ethanol the hydroperoxyoctadecatrienoic acid methylesters of peak group III can be converted into hydroxyoctadecatrienoic acid methylesters which correspond to the compounds of peak group II [9]. The reduction products were separated into eight isomeric alcohols by adsorption HPLC, the structure of which was explored by MS-, IR-, ~3C- und ~HNMR-spectroscopy [7]. These eight isomers are identical to those described in the literature [6].

478 A comparison, in terms of quantity, of isomer distributions of pressure oxidized samples to samples oxidized under normal pressure has shown that in four of the eight alcohols distribution was not identical; samples oxidized under normal pressure contained more than twice as much trans-isomers. Prerequisite for the formation of trans-trans isomers is the splitting off of oxygen from the peroxyradical. This homolytic bond splitting is associated with a volume increase and should hence not be favoured by pressure. The proportion of trans-trans isomers therefore is lower in the pressurized samples. The relative isomer distribution does not change also under higher pressures and with longer autoxidation times. Autoxidation under increased pressure can hence be assumed to follow the same mechanism as under atmospheric pressure. It is concluded that pressures above 600 MPa suppress autoxidation of linolenic acid and denaturate lipoxigenase irreversibly. High pressure treatment of food aiming at a retention of essential fatty acids is useful when pressure above 600 MPa is applied.

4. REFERENCES

1 B. Tauscher, Z Lebensm Unters Forsch, 200 (1995) 3. 2 N.S. Isaacs, Liquid phase high pressure chemistry, John Wiley & Sons, Chichester, 1980. 3 H.W.S. Chan (ed.), Autoxidation of Unsaturated Lipids, Academic Press, London, 1987. 4 H.W.S. Chan, J.A. Matthew and D.T. Coxon, J. Chem. Soc. Chem. Commun., 235 (1980). 5 J.P. Cosgrove, D.F. Church and W.A. Pryor, Lipids 22 (1987) 299. 6 H.W.S. Chan and G. Levett, Lipids 12 (1977) 837. 7 E. Kowalski, Thesis, Universit/it Heidelberg, 1995. 8 E. Kowalski, H. Ludwig and B. Tauscher, publication in preparation 9 E. Kaplan, J. Chromatogr. 350 (1985) 435.

R. Hayashiand C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

479

The effect of p r e s s u r e on processes modelling the Maillard reaction N. S. Isaacs and M. Coulson Department of Chemistry, University of Reading, POB 224 Reading RG6 2AD, U.K. 1. INTRODUCTION The Maillard reaction is a complex sequence of events beginning with reactions between proteins and carbohydrates at temperatures around 100 ~ and above, leading ultimately to a range of products, some volatile and others highly complex which impart flavour and colour to cooked foodstuffs [1, 2]. Despite its complexity, the Maillard reaction has been studied in some detail in the form of model reactions between simple carbohydrates and aminoacids and an overall scheme due to Hodge [3] is still regarded as the basis of the process. The mechanisms of the initial stages are also understood as occurring according to Scheme 1 [4]. Thus, tryptophan and glucose, for example, in water around 100 ~ condense initially to form an imine,1, which rapidly undergoes the Amadori rearrangement to the aminoketose, 2 existing in various tautomeric forms [5,6]. This in turn is degraded to a variety of small molecules which are i m p o r t a n t for flavour production. Among these, 5hydroxymethylfurfural, n o r h a r m a n and maltol have been recognized as prominent while some t r ypt opha n is recovered although the formation of pyrroles, pyrazines and other nitrogen heterocyclics account for loss of some of the aminoacid. The appearance of a brown colour also signals the formation of more complex, possibly polymeric products ('melanoidins') . It has been reported [6] t h a t the browning reaction is suppressed by pressure but, since there are numerous stages involved in the reaction before coloured products are formed, we have examined the effect of pressure on rates of several of the early stages in addition to this overall sequence using the model reaction between tryptophan and glucose.

480 SCHEME I

HO

H\ , l ~ ' ~ ' ~- ~ ' ~

%~"/~'"~OH HO / _

/C.,

~ 0 z x

H2N

__

Ind I, ~

Ind

I--v'=+6

....... H

....

I

.:>

H3N~ ' c 4~". H

COOH

~CO0-

Ind

I HO_ H o

OH

~ HO

HO

AV = +4

I

HN/C~

HO

HO

OH / C N~,. H

3

Ind I

.....H

H2N

~COOH

~

/\H HO 4

~ , .... H ~CO0

'~ 0

H

6

C ,,,...... H

HN /

0

....H H

HO OH

~COOH 0

0 S

etc

OH

481 2. RESULTS 2.1. R e a c t i o n b e t w e e n 3 - h y d r o x y b e n z a l d e h y d e (co = 0.1M) a n d I ~ t r y p t o p h a n (co -- 0.01M), 70 ~ i n w a t e r " p/bar 1 200 400 6O0 800

105k / min- 1 6.92 +/- 0.05 7.15 7.57 8.39 9.13

In kre 1 0 0.032 0.090 0.192 0.277

AV = -10 cm 3 mo1-1. 2.2. R e a c t i o n b e t w e e n 3 - h y d r o x y b e n z a l d e h y d e m e t h y l e s t e r (c o = 0.01 M) , w a t e r 20 ~

p/bar 1 400

104 k/min- 1 2.16 +/- 0.05 2.59 2.87 3.26

[c o - 0.1M] a n d t r y p t o p h a n

In krel 0 0.181 0.284 0.412

AV = -16 cm3 mol-1. 2.3. T h e r e a c t i o n b e t w e e n g l u c o s e [c o = 0.025 M] a n d t r y p t o p h a n [c o = 0.0025 M] w a t e r , 70 ~

p/bar 100 200 600

105k / min-1 4.53 +/- 0.07 4.79 5.12 6.43

In krel 0.056 0.122 0.350

AV = -17 cm3 mol-1. 2.4. T h e r m a l d e c o m p o s i t i o n of 1-(N-L-tryptophanyl)-l-deoxy-D-fructose ; w a t e r , 95 ~ p/bar 1 100 400 600

103k / rain-1 3.28 +/- 0.05 3.13 2.62 2.35

AV = +17 cm 3 mo1-1.

In krel 0 -0.05 -0.22 -0.33

482

/

1.400

1.200 E]

2.000 1.800

-

1.600 -

1.000 1.400

il

0.800

1

Degassed []

1.200

il

1.000

0.800

0.400

0.200

0.000

-

0.400

-

0.2OO

-

'

0

I

'

100

I

200 Time/min

(a)

'

-'300

0.000

I 0

100

'

I

200 Time/rain

(b)

Figure 1. a) Meloidin formation from tryptophan and xylose, 80 ~ m at 800 bar; r2 50 bar b) Melanoidin formation from tryptophan and xylose. 80 ~ 1 bar under oxygen, I1 and under argon Ll atmospheres

'

I 300

483

3. DISCUSSION The initial step in the Maillard reaction m u s t be the condensation of the a m i n o a c i d in its n e u t r a l form with the sugar, p r e s u m a b l y as the free aldehyde, to form an imine. The volume of activation for ring-opening of the pyranoside (1 -> 2) may be taken as t h a t estimated for mutarotation of glucose, AV = -11 cm 3 mo1-1. Condensation between an aldehyde and an amine is an associative reaction, and consequently would be expected to show a negative volume of activation such as has been observed for oxime formation for which a value AV = -14 cm 3 mo1-1 has been recorded [8]. For this stage the volume of activation was estimated using as a model system, the condensation between 3hydroxybenzaldehyde and t r y p t o p h a n methyl ester for which AV = -16 cm 3 mo1-1. This may be compared with the less negative volume of activation for the reaction of 3-hydroxybenzaldehyde with tryptophan, AV = -10 cm 3 mol "1, the difference, +6 cm3 mol-1 being attributable to the internal proton transfer of the zwitterionic form of the aminoacid, a value which accords with charge neutralisation. The formation of the Amadori product, 4, from tryptophan and glucose was directly observed and gave an a p p a r e n t AV = -16 cm 3 mo1-1. This is a m u c h slower reaction t h a n either ring-opening of glucose or proton transfer within the aminoacid and therefore these two steps may be treated as pre-equilibria and, hence the r e a r r a n g e m e n t step, the conversion of imine to aminoketose (3 -> 4) is characterised by a small positive activation volume, AV = +4 cm 3 mo1-1. It is reasonable t h a t the volume change should be very small for such a r e a r r a n g e m e n t . Overall , therefore, pressure favours the formation of the Amadori product. In contrast, the decomposition of the preformed aminoketose in water at 100 ~ was found to be retarded by pressure, AV = +17 cm 3 mo1-1. This m u s t r e p r e s e n t a m e a n value for several decomposition modes. However, w h e t h e r the decomposition of the Amadori compound leads to the formation of 5-hydroxymethylfurfural, maltole or n o r h a r m a n (4 -> 5,6 etc.) in addition to some t r y p t o p h a n , similar volume changes would be predicted since all are fragmentation reactions. A comparison might be made with the f r a g m e n t a t i o n of 2-methyl-3-bromobut-2-enoate [10], AV = +18 cm 3 mol-1 We have confirmed t h a t pressure r e t a r d s the development of the brown colour (melanoidins) in the reaction between t r y p t o p h a n and xylose. However, oxygen provides a complication. The development of brown colour is greatly accelerated by its presence. When carried out in carefully degassed solutions u n d e r a n a r g o n a t m o s p h e r e , b r o w n i n g is m u c h slower, F i g u r e 1. Nevertheless, further retardation is brought about by high pressure. Since the rate of reaction increases with time and leads eventually to precipitation of dark-coloured solids, no specific rate coefficient or volume of activation can be attatched to this process. The volume profile is as shown in Scheme 1. 4. A C K N O W L E D G E M E N T is made for the funding of this work to the Commissioners of the European Community under the AIR1-CT92 project and to Mr. M. Bristow and Mr. N. Thornton-Allen for studies of the effect of oxygen.

484 5. REFERENCES

1

C. Balny, R. Hayashi, K. Heremans and P. Masson (eds), High Pressure and Biotechnology, J. Libbey/Eurotext, INSERM, 224, 1992. 2 C. Eriksson (ed.), Maillard Reactions in Food, Pergamon Press, Oxford, 981 ; P.A. Finot, H.U. Aeschbacher, R.F. Hurrell and R. Liardon (eds.), The Maillard reaction in food processing; human nutrition and physiology, Birkh~iuser Verlag, Basel, 1990. 3 H. Nursten, Food Chemistry, 6 (1980) 263. 4 V. Yaylayan and N.G. Forage, J. Agric. Food Chem., 39 (1991) 364 ; J. Mauron, Prog. Food Nutr. Sci., 5 (1981) 5. 5 T. Tamaoka, N. Itoh and R. Hayashi, Agric. Biol. Chem., 55 (1991) 2071. 6 V.C. Sgarbieri, J. Amaya, M. Tanaka and C.O. Chichester, J. Nutr. 103 (1973) 657. 7 N.S. Isaacs, Liquid Phase High Pressure Chemistry, Chap., Wiley, Chichester, 1981. 8 W.H. Jones, E.W. Tristram and W.F. Benning, J. Amer. Chem. Soc., 81 (1984) 2151. 9 C.M. Lee, B. Sherr and Y-N. Koh, J. Agric. Food Chem. 32 (1984) 379. 10 W.J. Le Noble, R. Goitien and A. Shurpik, Tetrahedron Lett., (1969) 895.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

485

The effects of high pressure on some mechanical and physical properties of wood Makoto Yashiro a and Kaori Takahashia, b Department of Applied Biological Chemistry, Faculty of Agriculture, Niigata University, 8050 Igarashi-ninocho, Niigata City 950-21, J a p a n b Present affiliation: Cosmo-Clean Co. Kandouji Niigata City 950, Japan a

Abstract Small wood block of Hmoki (Chamaecyparis obtusa) and two its components (cellulose and lignm) were treated under the conditions of 30 and 60 MPa, at 25 and 50 C, for 10 and 30 min. Compressive strength of wood in longitudinal direction was slightly decreased. The strength in tangential direction of all the samples were increased. Decreases in the strength in radial direction were observed in all the treated samples. Tensile strengths in longitudinal direction were increased in most conditions. Degree of crystallmity of cellulose had a tendency to slightly increase. End-thermic peaks on DSC of wood were affected by the treatments.

Keywords Wood, High pressure, Compressive strength, Cellulose, Lignin, Degree of crystallinity, Endo-thermic peak, DSC

1. I N T R O D U C T I O N Wood is one of the most important natural resources which has long been widely used for various industrial products as raw material. The wood undergoes heat and pressure in number of the industrial process as raw material. However, the highest pressure that wood usually undergoes in these processes is well below 100 kgf/cm 2 at most. For example, wet wood block of Douglas-fir was treated at 800 psi and appreciable decreases in modulas of rapture and modulas of elasticity were observed[l]. However, the effect of pressure over several hundred MPa on wood has never adopted in industrial process and accordingly hardly been studied so far, even though it is hydrostatic one. In these backgrounds, the effect of high pressure of several hundreds MPa on some most fundamental mechanical properties of wood, compressive strength, tensile strength and a few physical properties including degree

486 of crysta!linity in cellulose and DSC thermogram of lignin in wood were studied.

2. E X P E R I M E N T A L 2.1. Samples The types of high pressure-treated samples were: block of wood, wood meal, cellulose and dioxane lignin isolated from wood. Three different types of wood block samples for compressive strength and one for tensile strength were prepared from wood of Hinoki (Chamaecyparis obtusa). The sizes of the samples for compressive strength were: (1) 20 mm (longitudinal direction) 10 mm (radial direction) mm (tangential direction), (2) 20 mm (radial direction) mm (longitudinal direction) mm (tangential direction) and (3) 20 mm (tangential direction) mm (longitudinal direction) mm (radial direction), in which 20 mm is the length of load direction. The size of sample for tensile strength were: 50 mm (longitudinal direction ; load direction) mm (radial direction) mm (tangential direction). Wood meal, isolated cellulose and dioxane lignin from non-treated wood were also treated at high pressure. Cellulose and dioxane lignm samples were prepared in two different ways: one by isolation from non-treated and the high pressure-treated block wood, and the other from treatments of non-treated and high pressure-treated wood samples. The isolation of the components were carried out according to Browning [2]. Wood meal and dioxane lignm were used for DSC measurements and cellulose for determination of degree of crystallinity.

2.2. High pressure treatment Block samples were evacuated thoroughly in a vacuum bottle containing water in it to fully saturate with water before the treatment. The block, wood meal, cellulose and lignin were saturated with distilled water, 0 . 1 % HC1 or 1 % HC1 and sealed with polyethylene bags. The samples were treated with Beaker Isostatic Processor 45120-70 (Product of Nikkiso Co.)under the conditions of 300 and 600 MPa, 10 and 30 ram., and room temperature and 50 C, in part of which 0.1% and 1% HC1 were used as medium instead of water.

2.3. Measurement of compressive and tensile strength Compressive strengths of block samples were measured with a material testing machine (Shimadzu AGS 1000B) Loading speed was 0.5 ram/rain For tangential and radial strength, proportional limits on stress-strain curves were considered as maximum strength since apparent maximum strength was hard to detect Tensile strengths were measured with the same machine at loading speed of 2 ram/rain From the stress-strain curves, maximum strength (modulus of rupture) and/or proportional hmit stress and elastic modulus for both compressive and tensile strength measurement were obtained

487

2.4. Differential scanning calorimetry Moisture contents of samples were adjusted to 20-25% for wood meal and 50-55% for lignin before sealing into aluminum sample pan. The conditions for calorimetry were: increasing rate of temperature; 3 C/rain, scanning range; 30- 320 C. DSC 120 and SSC5200TA by Seiko Instruments Inc. was used. 2.5. X-ray diffraction Isolated cellulose sample was powdered and screened. Small tablet with thickness of about I mm was made from the screened fraction of 80 mesh through and used for Xray diffraction. The conditions adopted were: anticathode; copper, lamp voltage; 40 kV, lamp ampere; 30 mA, scanning speed; 10 deg/min, range of diffraction; 3 - 70 deg. Relative degree of crystallinity was calculated with an area method[3]. Geigerflex by Riguku was used.

3. R E S U L T S

AND DISCUSSION

3.1. Compressive strength Changes in average compressive strength at air dry in longitudinal direction treated

488

at room temperature are shown in Fig.1. The strength had a tendency to be decreased slightly by the treatments with an average decrease of 2.8% of non-treated one. The average strength of 8 conditions including 40 samples dropped from 399 kgf/cm2 to 388 kgf/cm 2. Nearly parallel drop in Young's modulus to the strength was observed. On the contrary, compressive strength in the same direction measured at water-saturated condition showed an apparent increase ( Fig. 2). The strength was increased in all the 8 conditions by the treatments with an average increase of 7.3 kgf/cm 2 (4.8 %). Since water probably weakens intermolecular hydrogen bond among wood components, it can be understood t h a t strength was decreased by watersaturation from the state of air-dry condition. In addition, water plasticize cellulose in wood [4]. In fact, average strength of non-treated one in air-dry condition, 399 kgf/cm 2 was decreased to 232 kgf/cm 2 in water-saturated condition. The strength ratio of water-saturated ones to air-dry ones is 0.58 in average of non-treated ones, whereas it is 0.63 in average of all treated ones. This indicates that high pressure treatments reduce a decrease in compressive strength by water-saturation. Compressive strengths in radial direction in air-dry condition were decreased in all the conditions (Fig. 3). The average strength was decreased from 60 kgf/cm 2 to 40 kgf/cm 2 which was equivalent to an average decrease of 17%. Compressive strength in tangential direction in air-dry, however, was increased in all the conditions (Fig. 4). The average strength was increased from 31 kgf/cm 2 to 37 kgf/cm2,which was equivalent to an increase of 19 %. The reason why the strength was decreased in radial direction and increased in tangential direction is very interesting but is hard to analyze at the present.

3.2. Tensile strength Tensile strength in longitudinal direction was deceased in 3 conditions and increased in 5 conditions. The changes at room temperature treatments are shown in Fig. 5. Among the conditions, 600 MPa, 10 ram. at room temperature resulted in the highest increase m the strength of about 11%. This could have been brought about by some increase in crysta!linity of cellulose, which will be mentioned later. On the contrary, the highest decrease in the strength of 19 % was brought about by 300 MPa, 30 min. at room temperature. It m a y be caused by breakages of inter cellular bond at middle lamella. As a whole, the strength was only slightly increased from 566 kgf/cm 2 of nont r e a t m e n t to 569 kgf/cm 2 in average. However, the effect of high pressure on tensile strength of wood was not obvious.

3.3. Degree of crystallinity of cellulose Relative degrees of crystallinity of cellulose isolated from non-treated and treated wood block were in the range from 64.8 c~ of non-treated one to 68.3 % of treated one with 600 MPa, 30 rain. 50 C. Changes in degree of crystallinity by the treatments proved very small. The highest increase was 3.9 % in average from non-treated one. But a defmite conclusion cannot be drawn from the results whether these treatments increase degree of crystallmity of cellulose in wood or not. However, these results suggest a possibility that degree of crystallinity of cellulose in wood is slightly increased by the treatment of high pressure. Cellulose was also treated after isolation from wood. Degrees of crystallimty of the

489 treated cellulose are tabulated in Table 1. Although the effects of high pressure on cellulose are considered more direct when it is treated in isolated state than in wood as a component, changes in crystallinity by the treatments in water were not obvious. However, when it was high pressure-treated in 1 % HC1, the treatment increased degree of crystallinity by nearly 6 %, which is equivalent to about 10 % of the value of non-treated sample. The result shows a possibility that degree of crystallmity is Table 1 Relative degree of crystallmity of cellulose treated after isolation*

Medium

Control

Water

Water

Pressure (kgf/cm2)

_

300

600

600

600

Time (rain.)

_

30

30

30

30

62.4

66.6

Temperature Degree of (%) crystallinity

0.1%HC1

1%HC1

room temperature 60.9

58.4

60.2

Note: * Values are averages of 4 calculations from 2 measurements.

increased by the treatment. Although the reason for it is not clear, hydrolysis of cellulose may be caused by the treatments and this probably accelerate rearrangement or crystallization of cellulose molecules in amorphous region under a high pressure.

3.4. Changes in endo-thermic peaks of wood on DSC thermogram Peaks appeared on the thermograms of wood are shown in Table 2 There were 3 endo-thermic peaks on DSC thermogram of untreated wood : ca 185 C, ca 240 C and 247-251 C The peak at 185 A~ was the most prominent one among them and is considered to be attributed to lignin After the treatments in water this peak shifted gradually to higher region of 186-190 C However, the peak seems to have disappeared by the treatment of 600 MPa in HC1 On the other hand, the peak around 240 C is relatively stable: After treatment of various conditions, it almost remained The peak at 247-251 C seems to be stable too. Besides these peaks, various new peaks appeared by the treatments. They are shown by underlines in the table. Although it is difficult to interpret these changes in DSC thermogram, the results show that thermal properties of wood have significantly changed. Peaks shown in block letter with underline in Table 3 appeared also in the thermograms of treated or untreated dioxane lignin. Accordingly these peaks in wood can probably be attributed to lignin. Most of the softening temperatures of wood and its components, which have been measured are in a lower range than those observed

490 in this study[5]. Therefore most of the peaks are probably attributed to other

Table 2

Endo-thermic peaks of the treated wood on DSC thermogram

Medium Pressure M.C* (kgf/cm 2 ) ( % ) Control

Water

Water

-

23.9 23.6

184.9 184.7

239.9 241.8

247.4 251.4

300

25.9 22.2

185.6 188.3

244.1

247.6 247.6

25.5 22.2

190.5 219.7 243.0 189.7 242.2

21.3 22.9

239.5

600

0.1% HC1 600

1%HC1

Peak temp. (C)

600

23.7 226

223.6 244.1

262.0

252.4

257.7 266.3 263.2

252.3

260.3 256.9

269.5 274.2

280.0

258.3 264.8

265.6

270.3 275.5

* Adjusted moisture contents of samples. transitions than softening. Although it is obvious from these results that thermal properties of wood and lignin were suffered some changes by the high pressure treatments, it is still difficult to analyze the changes occurred and attribute these new peaks to defmite structures in lignm or resultant products from lignin.

4. R E F E R E N C E S 1 C.S. Walters and W.W.H. Huang, American Woo-Preserves' Association, 1971. 2 B.L. Browning, Methods of wood chemistry, Interscience Publishers at John Wiely & Sons, Vol. 2, 1967. 3 Japan Wood Research Society eds. Experimental Handbook for Wood Science,O~, Chemistry, Chuugai-sangyou-chousakai, 1985. 4 N.H. SalmOn and E. L. Back, Tappi, Vol. 60, No. 12, 1977. 5 G.M. Irvine, Tappi, Vol. 167, No. 5, 1984.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

491

Some Reflections on a High Pressure Conference K. Heremans Department of Chemistry, Katholieke Universiteit Leuven, B-3001 Leuven, Belgium The papers presented at this Conference are a good sample of the activities that are currently of interest to scientists working in the field of High Pressure Bioscience and Biotechnology. The topics discussed range from physical biochemistry, microbiology, molecular biology and food science to industrial applications. Whereas pressure effects on proteins get the most attention, lipids and lipid mixtures are also fairly represented in contrast to nucleic acids and more in particular polysaccharides. For polysaccharides this has no doubt to do with the absence of well def'med optical centers and structures as available for proteins. However, in view of the important role of carbohydrates in food science, this situation is certainly going to change in the future. Apart from the main physical parameter pressure, increasing attention is being paid to the effect of temperature, solvent conditions and time. In view of practical applications, the study of the kinetics of enzyme and microorganism inactivation, under a variety of physical and chemical conditions, is certainly going to be at the forefront in the future. The same will almost certainly apply to the formation of gels, not only for proteins but even more so for mixtures of proteins and polysaccharides. The latter compounds have, even at small concentrations, a remarkable effect on the gelling properties of proteins. The most complex systems, membrane bound enzymes and proteins, might well be the most interesting as they hold probably the key to our understanding of the inactivation of microorganisms. Part of the fascination of high pressure bioscience comes from the observation that certain microorganisms live under the extreme conditions of high pressure and low temperature in the deep-sea. The mechanisms of adaptation may be related to a large number of processes that are currently at the center of interest of molecular biology. If we want to understand the mechanism of high pressure inactivation for a safer application in the food science, then we will certainly need a better understanding of gene expression, the mechanism of membrane bound enzymes and a number of other related topics. A challenging and fascinating question is the inactivation of bacterial spores. We are far from an understanding of the pressure induced germination which takes place at low pressures in contrast to the absence of inactivation at very high pressures.

492 Although food, by its natural origin, is a very complex system, it is quite surprising to observe in many, but not all, cases a behaviour which is essentially that of one major component. This makes the physico-chemical studies of these systems so fascinating. Thus, new developments in this field will probably emerge from studies on model systems. Modelling of the behaviour of complex systems is indeed one of the primary steps towards industrial applications. This aspect has obtained a good deal of attention in Japan, the rest of the world apparantly waiting for the results of the Japanese experience. But surprises may be just around the comer for an example of a processing line for the production of strawberry products was presented at this conference by a European company. In many cases reflections about a conference result in reflections about the surprises that the future might have in store for us. But if history teaches us one lesson then it is that we should be prepared for surprises! In other words, there appears to be no simple recipe for success. A cursory reading of a few seminal papers in the field of high pressure bioscience makes it clear that hard work and good luck are the basic ingredients. The 1899 paper of Hite makes interesting reading about the attempts and failures in the struggling with a new technology. The 1914 paper of Bridgman is astonishly short and simple in his description of an observation that revolutionized our thinking. More recently, the 1960 paper of K. Suzuki on the kinetics of protein denaturation under high pressure, gives the foundations of our present day view of the landscape of protein stability under extreme conditions. Assuming that we know what kind of knowledge we want, what then can we hope for? We will certainly observe a tendency to perform more in-situ observations under high pressure. Here there are a number of technical difficulties which will be a challenge for talented experimentalists. On the theoretical side there is the need for good physical and chemical models that give a close representation of the more complex reality. In both cases, we should be aware that progress is often hampered by the entanglement of our own mental constructions while we tend to forget to keep an open eye on reality itself. Nature is much more creative than we ever could imagine. Since we are all part of Nature, we should also keep an open eye on the activities of our colleagues and even more so when they are working on a topic that seems to be far from our own interests. We congratulate our hosts, Prof. R. Hayashi, his Japanese colleagues and his staff for exactly doing this: To bring together scientists with a different cultural and scientific background in Kyoto city, a magnificent human and natural surrounding, to meet and discuss on a topic of common interest: The behaviour of Biomatter under High Pressure.

493 LIST OF PARTICIPANTS

Fumiyoshi Abe The DEEPSTAR group, Japan Marine Science and Technology Center, Yokosuka, Kanazawa 237, Japan. Phone: +81 468 67 5542, Fax: +81 468 66 6364 Takaki Abe c/o Dr. S. Wada, Dept. of Food Science and Tech., Tokyo Univ. of Fisheries, 4-5-7 Konan, Minatoku, Tokyo 108, Japan. Phone: +81 3 5463 0605, Fax: +81 3 5463 0626 Kazuyuki Akasaka Dept. of Chemistry, Fac. of Science, Kobe University, 1-1 Rokkodai-cho, Nada-ku, Kobe 657, Japan. Phone: +81 78 803 0602, Fax: +81 78 803 0839 Yoshio Aoyama Toyo Inst. of Technology, 4-chome, 23-2, Minamihanayashiki, Kawanishi, Hyogo 666, Japan. Phone: +81 727 59 4221, Fax: +81 727 58 6934 Masashi Asaka Toyo Inst. of Technology, 4-chome, 23-2, Minamihanayashiki, Kawanishi, Hyogo 666, Japan. Phone: +81 727 59 4221, Fax: +81 727 58 6934 Minao Asano Ajinomoto Co., Inc., 1-1 Suzuki- cho, Kawasaki-ku, Kawasaki 210, Japan. Phone: +81 44 244 7107, Fax: +81 44 244 7198 Tsuyoshi Baba Tetra Pak, Japan, 4-6-20 Higashikojiya, Ohta-ku, Tokyo 144, Japan. Phone: +81 3 3741 7433, Fax:+81 3 3741 3204 Claude Balny U128 INSERM, B.P.5051, Route de Mende, 34033 Montpellier Cedex 1, France. Phone: +33 67 61 33 60, Fax: +33 67 52 36 81 Jan Bareiszewski Inst. of Bioorganic Chemistry, Noskowkiego 12, 61704 Poznan, Poland. Phone: +48 61 52 8503, Fax: +48 61 52 0532

494

Douglas H. Bartlett SCRIPPS, Marine Biology Research,, Univ. of California, San Diego, La Jolla, California 92093-0202, USA. Phone: +1 679 534 5233, Fax: +1 619 534 7313 Jean-Matthieu Bonnei Nippon Surio Denshi K.K. (Framatome Corp.), Oak II Bldg., 1-15-6 Ebisu, Shibuya-ku, Tokyo 150, Japan. Phone: +81 3 5449 3271, Fax: +81 3 5449 3275 Wolfgang Buchheim Federal Dairy Research Center, P.O.Box 6069, D-24121 KIEL, Germany. Phone: +49 431 609270, Fax: +49 431 609222 Swapan K. Chakraborty Dept. of Chemical Science and Technology, The University of Tokushima, 2-1 Minami Josanjima-cho, Tokushima 770, Japan. Phone: +81 886 56 7416, Fax: +81 886 55 7025 Dereck Chatterton MD Foods Ingredients, Sonderupvej 26, Nr. Vium, DK-6920, Denmark. Phone: +45 99 94 44 44, Fax: +45 97 17 82 06 Jean-Claude Cheftel Unite de Biochimie et Technologie Alimentaires, Universite Montpellier 2, 34095 Montpellier Cedex 05, France. Phone: +33 67 14 33 51, Fax: +33 67 63 33 97 Douglas S. Clark Dept. of Chemical Engineering, Univ. of California at Berkeley, Berkeley, CA 94720, USA. Phone: + 1 510 642 2408, Fax: + 1 510 642 4778 C6cile Clery Unite de Biochimie, CRSSA, 24 Av. des Maquis du Gresivaudan, B.P.87 38702, La Tronch Cedex, France. Phone: +33 76 63 69 59, Fax: +33 76 63 69 01 Sandrine Dallet Labo. de Genie Proteique et cellluaire, Universite de La Rochelle, Av. Marillac, 17042 La Rochelle Cedex, France. Phone: +33 46 45 82 26, Fax: +33 46 45 82 47

495

Suzanne De Cordt Labo. of Food Technology, Kathokieke Univ. Leuven, Kardinaal Mercierlaan 92, 3001 Heverlee, Belgium. Phone: +32 16 321573, Fax: +32 16 321997 Gerard I)emazeau I.H.P., Universit6 de Bourdeaux I, Domaine Universitaire, 33405 Talence Cedex, France. Phone: +33 56 84 63 34, Fax: +33 56 84 66 34 J.P. l)ouzals Labo. de Genie des Procedes Alimentaires Biotechnology, ENSBANA, Esplanade Erasme, 21000 Dijon, France. Phone: +33 80 39 66 54, Fax: +33 80 39 66 11 Joerg Erbes Inst. of Physical Chemistry I, Univ. of Dortmund, Otto-Hahn-Str.6, D-44227 Dortmund, Germany. Phone: +49 231 755 3919, Fax: +49 231 755 3901 George P.A. Fortes Dept. of Biology 0116, Univ. of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0116, USA. Phone: +1 619 534 4693, Fax: +1 619 534 7108 Johannes Frank Dept. of Biochemical Engineering, Delft Univ. of Technology, Jilianalaan 67, NL-2628 BC Delft, The Netherlands. Phone: +31 15 78 23 32, Fax: +31 15 78 23 55 Michiko Fuchigami Dept. of Nutritional Science, Fac. of Health & Welfare Science, Okayama Prefectural University, 111 Kuboki, Soja, Okayama 719 11, Japan. Phone: +81 866 94 2153, Fax: +81 866 94 2153 Shinsuke Fujii National Inst. of Bioscience & Human-Tech., Agency of Industrial Science & Technology, 1-1 Higashi, Tukuba, Ibaraki 305, Japan. Phone: +81 298 54 6023, Fax: +81 298 54 6005 Keiko Fujii Fac. of Education, Yamagata University, 1-4-12 Kojirakawa-machi, Yamagata 990, Japan. Phone: +81 236 28 4353, Fax: +81 236 28 4313

496 Masao Fujimaki 5-21-15 Miyamae, Suginami-ku, Tokyo 168, Japan. Phone: +81 3 3332 4136 Kazuhiro Fujiwara Inovation Center, Nippon Lever B.V., 38 Hagadai, Haga-cho, Hagagun, Tochigi 321-33, Japan. Phone: +81 28 677 6350, Fax: +81 28 677 6355 Kunihiko Gekko Dept. of Materials Science, Fac. of Science, Higashi-Hiroshima 739, Japan. Phone: +81 824 24 7387, Fax: +81 824 24 7387 Arthur Gilmour Dept. of Food Science, The Queen's Univ. of Belfast, Newforge Lane, Belfast, BT9 5PX, Nothern Ireland, UK. Phone: +44 1232 255293, Fax: +44 1232 668376 Yuji Goto Dept. of Biology, Fac. of Science, Osaka University, Toyonaka, Osaka 560, Japan. Phone: +81 6 850 5435, Fax: +81 6 850 5288 Kazuhiro l-lamada Oriental Yeast Company Ltd., 3-6-10 Azusawa, Itabashi-ku, Tokyo 174, Japan. Phone: +81 3 3968 1117, Fax: +81 3 3968 9832 Chieko Hashizume Meiji-ya Food Factory Co., Ltd., 3-1-13 Nishigawara, Ibaraki, Osaka 567, Japan. Phone: +81 726 24 2325, Fax: +81 726 26 2253 Kiyoshi l-layakawa Kyoto Pref. Comprehensive Center, 17 Choudoji Minami-machi, Shimogyo-ku, Kyoto 600, Japan. Phone: +81 75 315 8635, Fax: +81 75 315 1551 Rikimaru Hayashi Dept. of Agr. Chemistry, Fac. of Agriculture, Kyoto Univ., Kitashirakawa, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 6110, Fax: +81 75 753 6128 Karei A.It. I-leremans Dept. of Chemistry, Katholieke Univ. Leuven, Celestijnenlaan 200D, B-3030 Leuven, Belgium. Phone: +32 16 32 71 59, Fax: +32 16 32 79 82

497 Kazuo Homma

R & D Division, Q.P. Corporation, 5-13-1 Sumiyoshi-cho, Fuchu, Tokyo 183, Japan. Phone: +81 423 61 4890, Fax: +81 423 61 6271 Noriyuki Homma

Dept. of Applied Biochemistry, Fac. of Agriculture, Univ. of Niigata, 208050 Igarashi, Niigata 950-21, Japan. Phone: +81 25 262 6694 Mitsuru Horie

Dept. of Food Science & Technology, Tokyo Univ. of Fisheries, 4-5-7 Konan Minato, Tokyo 108, Japan. Phone: +81 3 5467 0583, Fax: +81 3 5463 0495 Koki Horikoshi

Japan Marine Science & Technology Center, 6th floor, Sakura-shinbashi Bid., 2-6-1 Minatoku, Tokyo 105, Japan. Phone: +81 3 3591 5151, Fax: +81 3 3580 8621 Gaston Hui Bon ttoa

U310 INSERM, Inst. de Biologie Phisico-Chimique, 13 rue Pierre et Marie Curie, 75005 Paris, France. Phone: +33 (1) 43 25 26 09, Fax: +33 (1) 43 29 80 88 Taroh Ichikawa

Dept. of Molecular Engineering, Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5945, Fax: +81 75 751 7611 Yoshihide Ikeuchi

Dept. of Applied Biological Chemistry, Fac. of Agriculture, Univ. ofNiigata, Igarashi, Niigata 950-21, Japan. Phone: +81 252 262 6663, Fax: +81 25 263 1659 Takeshi Inagaki

c/o Prof. Kunugi, Kyoto Inst. of Technology, Goshokaido-cho, Matsugasaki, Sakyo, Kyoto 606, Japan. Phone: +81 75 724 7861, Fax: +81 75 724 7710 Neii S. Isaacs

Dept. of Chemistry, University of Reading, P.O.Box 224, Reading, RG6 2AD, UK. Phone: +44 1734 875123 (ext. 7421), Fax: +44 1734 311610

498 Koichiro lshimori Dept. of Molecular Engineering, Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5941, Fax: +81 75 751 7611 Naomichi Iso Dept. of Food Science & Technology, Tokyo Univ. of Fisheries, Konan, Minato, Tokyo 108, Japan. Phone: +81 3 5463 0581, Fax: +81 3 5463 0495 Shinji ltoh Kato Brothers Honey Co., Ltd., 2-1-8, Fukuura, Kanazawa-ku, Yokohama 236, Japan. Phone: +81 45 784 8281, Fax: +81 45 784 8280 Hitoshi lwahashi National Inst. ofBioscience & Human-Technology, Higashi 1-1, Tsukuba, Ibaraki 305, Japan. Phone: +81 298 54 6023, Fax: +81 298 54 6005 Tatsuo Jin Dept. of Food Science, Rakuno Gakuen University, Ebetsu, Hokkaido 069, Japan. Phone: +81 11 386 1111, Fax: +81 11 387 5848 Koj i Kakugawa Hiroshima Pref. Food Technology, 12-70 Hijiyamahonmachi, Minami-ku, Hiroshima 732, Japan. Phone: +81 82 251 7431, Fax: +81.82 251 6087 Haruichi Kanaya Dept. of Electrical & Electronic Engi., Fac. of Engineering, Yamaguchi Univ. Tokiwadai, Ube, Yamaguchi 755, Japan. Phone: +81 836 31 5100 (ext.4123), Fax: +81 836 35 9449 Shoji Kaneshina Dept. of Biological Science & Tech., Fac. of Engineering, Univ. of Tokushima, Minami josanjima-cho, Tokushima 770, Japan. Phone: +81 886 56 7513, Fax: +81 886 55 3162 Pensuwan Kanlaya National Inst. of Bioscience & Human-Tech., Agency of Industrial Science & Technology, 1-1 Higashi, Tukuba, Ibaraki 305, Japan. Phone: +81 298 54 6059, Fax: +81 298 54 6005

499 Choemon Kanno

Fac. of Agriculture, Utsunomiya University, 350 Mine-cho, Utsunomiya 321, Japan. Phone: +81 286 49 5461, Fax: +81 286 49 5401 Midori Kasai

School of Human Life & Environmental Science, Ochanomizu Univ., 2-1-10tsuka, Bunkyo-ku, Tokyo 112, Japan. Phone: +81 3 5978 5765, Fax: +81 3 5978 5760 l:lirotaka Kataoka Dept. of Molecular Engineering, Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5945, Fax: +81 75 751 7611 Chiaki Kato

The Deepstar group, Japan Marine Science & Technology Center, 2-15 Natsushima-cho, Yokosuka 237, Japan. Phone: +81 468 67 5555, Fax: +81 468 66 6364 Shoji Kawai

Teramecs, 4-5-3 Takeda Okenoicho, Fushimi, Kyoto, Japan Phone: +81 75 622 3551, Fax: +81 75 622 7699 Ikuo Kimura

Central Research Labo., Nippon Suisan Kaisha Ltd., 559-6 Kitanomachi, Hachioji, Tokyo 192, Japan. Phone: +81 426 56 5197, Fax: +81 426 56 5189 Susumu Kimura

Japan School Baking, 19-6, 6 - chome, Nishi Kasai, Edogawa-ku, Tokyo 134, Japan. Phone: +81 3 689 7571, Fax: +81 3 689 7574 Kunio Kimura

Meidi-ya Food Factory Co., LTD., 3-1-13 Nishigawara, Ibaraki, Osaka 567, Japan. Phone: +81 726 24 2325, Fax: +81 726 26 2253 Lan King

Dept. of Biochemistry, Chang Gung Medical College, 259 Wen-Hwa First Road, Kwei-San, Tao-Yuan, Taiwan 33332, ROC. Phone: +886 33328 3016, Fax: +886 3328 3031

500 Shinsuke Kishioka Dept. of Chemical Science & Tech., The Univ. of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan. Phone: +81 886 56 7416, Fax: +81 886 55 7025 Keiko Kitagishi Otsuka Electronics Co., Ltd., 3-26-3 Shodai-tajika, Hirakata, Osaka 573, Japan. Phone: +81 720 55 8550, Fax: +81 720 55 8557 Dietrich Knorr Food Biotechnology Division, Univ. of Technology, KOnigin-Luise StraBe 22, D-W-1000 Berlin, Germany. Phone: +49 30 314 71250, Fax: +49 30 832 7663 Wen-Ching Ko Dept. of Food Science, National Chung Hsing Univ., 250 Kuokuang Road, Taichung, Taiwan, ROC. Phone: +886 4 2871690, Fax: +886 4 2871690 Yosuke Kobayashi Dept. of Food Science, Rakuno Gakuen University, Ebetsu, Hokkaido 069, Japan. Phone: +81 11 386 1111, Fax: +81 11 387 5848 Itiromi Kobori Dept. of Chemical & Biological Sciences, Fac. of Science, Japan Women's Univ., 2-8-1, Mejirodai, Bunkyo-ku, Tokyo 112, Japan. Phone: +81 3 3943 3131 (ex.7266), Fax: +81 3 3942 6188 Yasuhiko Komatsu National Inst. of Bioscience & Human-Tech., Agency of Industrial Science & Technology, 1-1 Higashi, Tukuba, Ibaraki 305, Japan. Phone: +81 298 54 6059, Fax: +81 298 54 6066 Yoshihiro Komatsu Toyo Inst. of Food Technology, 23-2, 4 chome, Minami-hanayashiki, Kawanishi, Hyogo 666, Japan. Phone: +81 727 59 4221, Fax: +81 727 58 6934 Shigeru Kunugi Dept. of Polymer Science & Engineering, Kyoto Inst. of Tech. Matsugasaki, Sakyo, Kyoto 606, Japan. Phone: +81 75 724 7836, Fax: +81 75 724 7710

501 Takeshi Kuribayashi

Food Technology Research Inst. ofNagano Pref., 1-205 Kurita, Nagano 380, Japan. Phone: +81 262 27 3131, Fax: +81 262 27 3130 Reinhard Lange

U128 INSERM, B.P.5051, Route de Mende, 34033 Montpellier Cedex 1, France. Phone: +33 67 61 33 70, Fax: +33 67 52 36 81 Tyre C. Lanier

Food Science Dept., North Carolina State Univ., Raleigh, NC 27695-7624, USA. Phone: +l 919 515 2964, Fax: +1 919 515 7124 Alain M. Le Bail Dept. GPA, ENITIAA, Chemin de la geraudiere, 44072 Nantes Cedex 03, France. Phone: +33 51 78 54 73, Fax: +33 51 78 54 67 Horst Ludwig

Inst. of for Pharmazeutische Tech., Univ. Heidelberg, Im Neuenheimer Feld 346, D-69120 Heidelberg, Germany. Phone: +49 6221 565234, Fax: +49 6221 565475 Patrick Masson Unite de Biochimie, CRSSA, B.P.87, 38702 La Tronche Cedex, France. Phone: +33 76 63 69 59, Fax: +33 76 63 69 01 Takato Matsuo Research Division, Nihon Pharmacential Co. Ltd., 3-1 Shin-izumi, Narita, Chiba, Japan.

Phone: +81 476 36 1218, Fax: +81 476 36 0863 Hiroaki Matsumoto Nestle Japan Ltd., Yebisu Garden Place Tower, 20-3 Ebisu, 4 cho-me, Shibuya-ku, Tokyo

150, Japan. Phone: +81 3 5423 8256, Fax: +81 3 5423 8792 Andrew J. Mc Arthur

Unilever Research, Colworth Labo., Sharnbrook, Bedford, MK44 1LQ, UK. Phone: + 44 1 234 781781, Fax: +44 1 234 222000

502 Mitsuo Miyashita

Dept. of Chemical Science & Tech., The Univ. of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan. Phone: +81 886 56 7416, Fax: +81 886 55 7025 Shunichi Miyazaki

Hokkaido Pref. Tech. Research Center, 379 Kikyo-cho, Hakodate, Hokkkaido 041, Japan. Phone: +81 138 47 3615 Hassan A.R. Mohammed

c/o Dr. S. Wada, Tokyo Univ. of Fisheries, 4-5-7 Konan, Minato-ku, Tokyo 108, Japan. Phone: +81 3 5463 0605, Fax: +81 3 5463 0626 Michel Montury EURIA, University of Bordeaux I, 39 rue Paul Mazy, 24019 Perigueux Cedex, France. Phone: +33 53 09 47 74, Fax: +33 53 02 58 80 Shigeru Mori

Central Research Labo., UCC Ueshima Coffee Co. Ltd., 3-1-4 Zushi, Takatsuki, Osaka 569, Japan. Phone: +81 726 74 0109, Fax: +81 726 74 4576 Isao Morishima

Dept. of Molecular Engineering, Fac. of Tech., Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5921, Fax: +81 75 751 7611 Takami Morita Food Processing & Preservation, Natl. Research Inst. of Fisheries, Kanazawa-ku, Yokohama 236, Japan. Phone: +81 45 788 7654, Fax: +81 45 788 5001 Vadim V. Mozhaev

Chemistry Dept., Moscow State University, 000958 Moscow, Russia. Phone: +7 095 939 3434, Fax: +7 095 939 0997 Jonas Nackmanson TPPS Division, Tetra Pak, Ruben Rausing gata, S-22186, Lund, Sweden.

Phone: +46 46 36 36 44, Fax: +46 46 36 31 91

503

Kazuyuki Nagamatsu Science Univ. of Tokyo- Yamaguchi College, 1-1-1 Daigakudori, Onoda, Yamaguchi 756, Japan. Phone: +81 836 88 4832, Fax: +81 836 88 3844

Shingo Nagano Dept. of Molecular Engineering, Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5941, Fax: +81 75 751 7611

Takeshi Naganuma Fac. of Applied Biological Science, Hiroshima University, 1-4-4 Kagamiyama, HigashiHiroshima 739, Japan. Phone: +81 824 24 7986, Fax: +81 824 22 7059

Yoshiharu Nakabayashi Central Research Labo., UCC Ueshima Coffee Co. Ltd., 3-1-4 Zushi, Takatsuki, Osaka 569, Japan. Phone: +81 726 74 0109, Fax: +81 726 74 4576

Tatsuyoshi Nakagami R & D Center, Nippon Meat Packers, Inc., 3-3 Midorigahara, Tsukuba, Ibaraki 300-26, Japan. Phone: +81 298 47 7817, Fax: +81 298 47 7824

Masaru Nakahara Inst. of Chemical Research, Kyoto University, Uji, Kyoto 611, Japan. Phone: +81 774 32 0854, Fax: +81 774 33 1247

Jin Nakatani Dept. of Molecular Engineering, Kyoto University, Sakyo, Kyoto 606, Japan. Phone: +81 75 753 5941, Fax: +81 75 753 7611

Akinori Noguchi Food Engineering Labo., National Food Research Inst., 2-1-2 Kannondai, Tsukuba, Ibaraki 305, Japan. Phone: +81 298 38 8029, Fax: +81 298 38 8122

Nagahiro Ogasawara (deceased) 2-7-27 Masago, Niigata 950-21, Japan. Phone: +81 25 231 2430, Fax: +81 25 231 2430

504 ttiroo Ogawa

Tokyo Univ. of Fisheries, 4-5-7 Konan, Minatoku, Tokyo 108, Japan. Phone: +81 3 5463 0583, Fax: +81 3 5463 0495 Hirokazu Ogiwara

Nihon University, 34-1 Shimouma, 3-chome, Setagaya-ku, Tokyo 154, Japan. Phone: +81 3 3421 8121 Toshio Ohta

Furo Japan Co. Ltd., 2-6-12 Ginza, Chuo-ku, Tokyo, Japan Yosiro Okami

Inst. of Microbiol. Chemistry, 4-23, 3 - chome, Kami Osaki, Shinagawa-ku, Tokyo 141, Japan. Phone: +81 3 3441 4173, Fax: +81 3 3441 7589 Emiko Okazaki

Food Processing & Preservation, Natl. Research Inst. of Fisheries, Kanazawa-ku, Yokohama 236, Japan. Phone: +81 45 788 7655, Fax: +81 45 788 5001 Takashi Okazaki

Hiroshima Pref. Food Technology Research Center, 12-70 Hijiyamahon-machi, Minami-ku, Hiroshima 732, Japan. Phone: +81 82 251 7431, Fax: +81 82 251 6087 Tadatake Oku

Coil ege of Agriculture & Veterinary, Nihon University, 34-1 Shimouma, 3-chome, Setagayaku, Tokyo 154, Japan. Phone: +81 3 3421 8121 ( ext.345 ), Fax: +81 3 3424 2262 Tatsuo Ooi

Kyoto Women's Univ., 35 Kitahiyoshi-cho, Imakumano, Higashiyama-ku, Kyoto 611, Japan. Phone: +81 75 531 7153, Fax: +81 75 531 7216 Naoki Osawa

Central Research Labo., Pokka Corpo., Shikatus-cho, Nishikasuga-gun, Aichi 481, Japan. Phone: +81 568 21 1126, Fax: +81 568 21 4331 Masako Osumi

Dept. of Chemical & Biological Sciences, Fac. of Science, Japan Women's Univ., 2-8-1 Mejirodai, Bunkyo-ku, Tokyo 112, Japan.

505 Phone: +81 3 3943 3131 (ex7266), Fax: +81 3 3942 6188 Toru Otake Osaka Pref. Inst. of Public Health, 3-69 Nakamichi 1 cho-me, Higashinari-ku, Osaka 539, Japan. Phone: +81 6 972 1321, Fax: +81 6 972 2393 Shogo Ozawa Dept. of Agricultural Chemistry, Fac. of Agriculture, Kyoto University, Sakyo, Kyoto 606, Japan. +81 75 753 6125, Fax: +81 75 753 6128 Alois R. Raemy Nestec S. A., Nestle Research Centre, P.O. Box 44, CH-1000 Lausanne 26, Switzerland. Phone: +41 21 785 87 46, Fax: +41 21 785 85 54 Pierpaolo Rovere ABB Industria SpA (& Tetra Pak Processing & Packaging), c/o S.S.I.C.A. Parma, v.le. F. Tanara 3 l/a, 33100 Parma, Italy. Phone: +39 2 26232,670, Fax: +39 2 26232, 899 Yoshio Sakai Science Univ. of Tokyo-Yamaguchi, 1-1-1 Daigakudori Onoda, Yamaguchi 756, Japan. Phone: +81 836 88 4551, Fax: +81 836 88 3844 Mamiko Sato Labo. of Electron Microscopy, Japan Women'd Univ., 2-8-1 Mejirodai, Bunkyo-ku, Tokyo 112, Japan. Phone: +81 3 3943 3131 (7760), Fax: +81 3 3942 6188 Tetsu Sato Researh Inst., Kagome Co., Ltd., 17 Nishitomiyama, Nishinasuno-machi, Nasugun, Tochigi 329-27, Japan. Phone: +81 287 36 2935, Fax: +81 287 39 1038 Hideharu Seki Sales Division, NKK Plant Engineering Co., Ltd., 61-10no-cho, Tsurumi-ku, Yokohama

230, Japan. Phone: +81 45 506 7948, Fax: +81 45 506 7948 Hiroyuki Serizawa Tetra Pak, Japan, 4-6-20 Higashi Kojiya, Ohta-ku, Tokyo 144, Japan. Phone: +81 3 3741 7433, Fax: +81 3 3741 3204

506

Tamotsu Shigehisa R & D Center, Nippon Meat Packers, Inc., 3 Midorigahara, Tsukuba, Ibaraki 300-26, Japan. Phone: +81 298 47 4716, Fax: +81 298 47 4005 Keiko Shimada Fac. of Science & Engineering, Science University of Tokyo in Yamaguchi, Daigakudori, Onoda, Yamaguchi 756, Japan. Phone: +81 836 88 4528, Fax: +81 836 88 3400 Shoji Shimada R & D Division, Oriental Yeast Co., Ltd., 3-8-3 Nihonbashi Honcho, Chuo-ku, Tokyo 103, Japan. Phone: +81 3 3663 4955, Fax: +81 3 3663 8226 Jonathan B. Snape Inovation Center, Nippon Lever B.V., 38 Hagadai, Haga-cho, Hagagun, Tochigi 321-33, Japan. Phone: +81 28 677 6350, Fax: +81 28 677 6355 Kyung ttyun Sohn Foods R & D Center, Cheil Foods Chemicals Inc., 636 Guro-dong, Guro-ku, Seoul, Korea. Phone: +82 2 636 2470, Fax: +82 2 636 8023 Shigeru Sugino Sugino Machine Ltd., 2410 Hongo, Uozu, Toyama 937, Japan. Phone: +81 765 24 5118, Fax: +81 765 24 5119 Yoichi Sugiyama Dept. of Molecular Engineering, Kyoto University, Sakyo-ku, Kyoto 606, Japan. Phone: +81 75 753 5945, Fax: +81 75 751 7611 l-lidenobu Sumitani Toyo Inst. of Food Technology, 4-chome, 23-2, Minamihanayashiki, Kawanishi, Hyogo 666, Japan. Phone: +81 727 59 4221, Fax: +81 727 58 6934 Atsushi Suzuki Dept. of Applied Biological Chemistry, Fac. of Agriculture, Niigata University, Niigata 95021, Japan. Phone: +81 25 262 6693, Fax: +81 25 263 1659

507 Kanichi Suzuki

Fac. of Applied biological Science, Hiroshima University, 1-4-1 Kagamiya, HigashiHiroshima 724, Japan. Phone: +81 824 24 7939, Fax: +81 824 24 7937 Keizo Suzuki

79-4 Kitazono-cho, Shimogamo, Sakyo, Kyoto 606, Japan. Phone:+81 75 791 9072 Kotaro Tada

Toyama Food Research Institute, 360 Yoshioka, Toyama 939, Japan. Phone: +81 764 29 5400, Fax: +81 764 29 4908 Kenji Takahashi

Dept. of Orthopaedic Surgery, Kyoto Pref. University of Medicine, Kamigyo-ku, Kyoto 602, Japan. Phone: +81 75 251 5549, Fax: +81 75 251 5841 Yasuo Takahashi

R & D Division, Wakayama Agr. Processing Research Corporation, 398 Tsukatsuki, Momoyama-cho, Naga-gun, Wakayama 649-6 l, Japan Phone:+81 736 66 2285, Fax: +81 736 66 2212 Katsuhiro Tamura

Dept. of Chemical Science & Technology, Fac. of Engineering, The Univ. of Tokushima, 2-1 Minamijosanjima-cho, Tokushima 770, Japan. Phone: +81 886 56 7416, Fax: +81 886 55 7025 Naoki Tanaka

Dept. of Polymer & Engineering, Kyoto Inst. of Technology, Matsugasaki, Sakyo, Kyoto 606, Japan. Phone: +81 75 724 7861, +81 75 724 7710 Guo-Qing Tang

Graduate School, Dept. of Polymer & Engineering, Kyoto Inst. of Technology, Matsugasaki, Sakyo, Kyoto 606, Japan. Phone: +81 75 724 7867, +81 75 724 7710 Bernhard Tauscher

Inst. for Chemistry & Biology, Federal Research Centre for Nutrition, EngesserstraBe 20, 76131Karlsruhe, Germany. Phone: +49 721 6625 116, Fax: +49 721 6625 167

508 Ai Teramoto Dept. of Nutritional Science, Fac. of Health & Welfare Science, Okayama Pref. University, 111 Kuboki, Soja, Okayama 719-11, Japan. Phone: +81 866 94 2146, Fax: +81 866 94 2146 Tetsuaki Tsuchido Dept. ofBiotechnology, Fac. of Engineering, Kansai University, Yamate-cho, Suita 564, Japan. Phone: +81 6 368 0880, Fax: +81 6 388 8609 Takeshi Uchida Dept. of Molecular Engineering, Kyoto University, Sakyo-ku, Kyoto 606, Japan. Phone: +81 75 753 5945, Fax: +81 75 751 7611 Yoshiaki Uchiyama General Machinery Division, IHI, 6-2, 1-chome, Marunouchi, Chiyoda-ku, Tokyo 100, Japan. Phone: +81 3 3286 2426, Fax: +81 3 3286 2430 Shun Wada Dept. of Food Science & Technology, Tokyo Univ. of Fisheries, 4-5-7 Konan, Minatoku, Tokyo 108, Japan. Phone: +81 3 5463 0605, Fax: +81 3 5463 0626 Tokuji Watanabe 5-9-2, Chuou, Ohta-ku, Tokyo 143, Japan. Roland Winter Inst. of Physical Chemistry I, Univ. Dortumund, Otto-Hahn Str. 6, Germany. Phone: +49 231 755 3900, Fax: +49 231 755 3901

D-44227 Dortmund,

Toshiaki Yamagishi General Machinery Division, IHI, 2-16 Toyosu 3 cho-me, Koto-ku, Tokyo 135, Japan. Phone: +81 3 3534 2418, Fax: +81 3 3534 2333 Shinkoh Yamagishi R & D Division, Sugino Machine Ltd., 2410 Hongo, Uozu, Toyama 937, Japan. Phone: +81 765 24 5118, Fax: +81 765 24 5119 Takeo Yamaguchi Dept. of Chemistry, Fac. of Science, Fukuoka University, Jonan-ku, Fukuoka 814-80, Japan. Phone: +81 92 871 6631 (ext.6242), Fax: +81 92 865 6030

509

Tohru Yamaguchi

Division of Material Science, Kobe Unversity, 1-1 Rokkodai-cho, Nada-ku, Kobe 657, Japan. Phone: +81 78 803 0145, Fax: +81 78 803 0839 Katsuhiro Yamamoto

Dept. of Food Science, Rakuno Gakuen Unversity, Ebetsu, Hokkaido 069, Japan. Phone: +81 l13861111, Fax:+81 113875848 Yoshihisa Yamamoto

Tetra Pak, Japan, 4-6-20 Higashi Kojiya, Ohta-ku, Tokyo 144, Japan. Phone: +81 3 3741 7433, Fax: +81 3 3741 3204 Masatada Yamashita

IHI (Ishikawajima-Harima Heavy Industries), 1 Shin-nakahara-cho, Isogo-ku, Yokohama 235, Japan. Phone: +81 45 759 2167, Fax: +81 45 759 2149 Takahisa Yamato

Fac. of Technology, Tokyo Univ. of Agriculture & Technology, Koganei, Tokyo 184, Japan. Phone: +81 423 64 3311 (ex.7602), Fax: +81 423 81 7979 Kunio Yamazaki

Hokkaido Food Processing Research Center, 589-4 Bunkyodai-midorimachi, Hokkaido 069, Japan. +81 11 387 4126, Fax: +81 11 387 4664 Nobuhiro Yano

Dept. of Food Technology, Nippon University, 3-34-1 Shimouma, Setagaya, Tokyo 154, Japan. Phone: +81 3 3421 8121, Fax: +81 3 3424 2262 Makoto Yashiro

Dept. of Applied Biological Chemistry, Fac. of Agr., Niigata Univ., 8050 Igarashi ninocho, Niigata 950-21, Japan. Phone: +81 25 262 6634, Fax: +81 25 263 1659 Gow-Chin Yen Dept. of Food Science, National Chung Hsing University, 250 Kuokuang Road, Taichung, Taiwan, ROC.

510

Zen-ichi Yokoyama Lab. of Biochemistry, Kobe Yamate College, 3-1 Suwayama-cho, Chuo-ku, Kobe 650, Japan. Phone: +81 78 362 4587, Fax: +81 78 362 4584 Kaoru Yoshioka Kato Brothers Honey Co., Ltd., 2-1-8 Fukuura, Kanazawa-ku, Yokohama 236, Japan. Phone: +81 45 784 8281, Fax: +81 45 784 8280 Keiko Yoshioka Dept. of Food and Nutrition, Fac. of Home Economics, Nakamura Gakuen Univ., 5-7-1 Befu, Jonan-ku, Fukuoka 814-01, Japan. Phone: +81 92 851 2531 (ex. 208), Fax: +81 92 841 7762 Mitsuyoshi Yuasa Advanced Research Lab., Hitachi Ltd., Hatoyama, Hiki-gun, Saitama 350-03, Japan. Phone: +81 492 96 6111, Fax: +81 492 96 6006

A U T H O R INDEX

512

AUTHOR INDEX Abe, F. Adamiak, R.W. Akasaka, K. Aoyama, Y. Arai, Y. Asaka, M. Balny, C. Barciszewski, J. Bartlett, D.H. Bec, N. Buchheim, W. Carpi, G. Cassara, A. Chakraborty, S.K. Cheftel, J.C. Chi, E. Chourot, J.M. Clark, D. Clery, C. Coquille, J.C. Cornier, G. Corstj ens, H.A.L. Coulson, M. Cruz, C. Dallet, S. Dall' Aglio, G. De Cordt, S. Demazeau, G. Deschamps, A. Diaz, J.F. Dumay, E. Douzals, J.P. E1 Moueffak, A. Engelborghs, Y. Erbes, J. Feng, Z.H. Fernandes, P.B.

53 189 141 419 79 419 7,135,215,231 189 29 135,215,221 331,347 253,445 253 387 299 29 439 195 117 433 439 215 479 401 227 445 203 401 401 167 299 433 401 167 181 37,109 337

Fornari, C. Frank, J. Frede, E. Fuchigami, M. Fujii, S. Fujii, T. Fujita, K. Fukuda, Y. Gekko, K. Gervais, P. Giatro, L. Gilmour, A. Gola, S. Goossens, K. Hamada, K. Hara, K. Hashizume, C. Hayakawa, K. Hayashi, K. Hayashi, M. Hayashi, R. Hendrickx, M. Heremans, K. Hiramatsu, N. Hirasawa, Y. Homma, N. Hori, T. Horie, M. Hofikoshi, K. Ichikawa, Y. Ida, M. Ikeuchi, Y. Imanishi, J. Inagaki, T. Inakuma, T. Isaccs, N.S. Ishiguro, Y. Ishijima, S.A. Ishikawa, H. Iso, N.

253 135,215 331 379,411 47,245 245 47 363 147 433 195 267 253,445 127 37, 83, 95 343 423 405 387 185 1,405,423,451 203 127,167,203,491 343 79 327 451 375 17,53,59,73 105 431 289,315,327 79 209 391 479 391 37,109 105 375

513

Ito, S. Iuchi, A. Iwahashi, H.

Jurczak, J. Kakimoto, T. Kakugawa, K. Kanaya, H. Kanazawa, Y. Kaneshina, S. Kato, C. Katoh, N. Kawahata, T. Kawamura, S. Kikushima, S. Kim, K. Kimura, K. Kishioka, S. Knorr, D. Kobayashi, K. Kobori, H. Komatsu, Y. Kono, T. Kourai, H. Kowalski, E. Koyasu, A. Krzyzaniak, A. Kubo, T. Kudryashova, E.V. Kunugi, S. Kuribayashi, T. Kurokouchi, K. Lange, R. Lanier, T.C. Largeteau, A. Le Bail, A. Legoy, M.D. Lemaire, R. Ludikhuyze, L. Ludwig, H. Maggi, A.

455,463 387 47,101,245 189 315 191,415 343 209 175 17,59 379 273 405 405 289,315 423,429 113 279 79 37,83,109 47,245 387 261 473 209 189 79 221 153,209 397 397 135,215 357 401 439 227 439 203 237,473 253,445

Maki, T. Mano, K. Marechal, P.A. Mamyama, S. Masson, P. Matschiner, A. Matsuki, H. McArthur, A. Michels, P.C. Mihori, T. Miyake, K. Miyano, Y. Miyashita, M. Mizukoshi, T. Mizuno, H. Mochizuki, Y. Montury, M. Mori, H. Morimoto, K. Morimoto, M. Morr, C.V. Mozhaev, V.V. Murai, K. Muramoto, Y. Nagano, I. Nagamatsu, K. Naganuma, T. Nakagami, T. Nakamura, A. Nakanishi, R. Nakatomi, Y. Nishio, T. Obuchi, K. Ogawa, H. Ogawa, Y. Ogihara, H. Ohki, K. Ohno, H. Ohsawa, K. Otake, T.

369 209 433 175 117 195 175 323 195 375 185 405 101,113,261,387 73 375 375 401 273 171 273 347 221 419 261 455,463 451 73 273 343 419 95 105 47,245 375 351 105 429 273 397 273

514 Okazaki, E. Okazaki, T. Oku, T. Onomoto, M. Osumi, M. Patterson, M.F. Quinn, M. Raemy, A. Rapp. G. Robb, F.T. Rovere, P. Ruan, K. Rubens, P. Sakai, Y. Salanski, P. Sato, M. Sato, T. Schrader, K. Scht~tt, M. Shigehisa, T. Shimada, K. Shimada, S. Shou, S. Simpson, R. Smeller, L. Sojka, B. Sun, M.M.. Suzuki, A. Suzuki, K Takahashi, K. Takahashi, K. Takamatsu, N. Takanami, S. Takeda, N. Takigawa, M. Tameike, A. Tamura, K. Tanaka, N. Tang, G.

363 171,415 105 429 37, 83, 95, 109 267 267 337 181 195 253,445 163 127 451 189 37, 83, 109 391 347 331 273 451 37, 83, 95, 109 405 267 127 237 195 289, 315,327 171,415 485 79 105 397 315 79 83, 109 101,113, 185, 261,387 153 163

Tanji, H. Tauscher, B. Terakawa, M. Teramoto, A. Tobback, P. Tsuchido, T. Tsukamoto, K. Tsuyuki, H. Ueba, N. Ueno, Y. Umezawa, K. Usami, R. Van Almsick, G. Vermeulen, G. Wada, S. Weemaes, C. Welch, T.J. Wilding, P. Winter, R. Wroblowski, B. Yamada, A. Yamada, H. Yamaguchi, T. Yamamoto, K. Yamato, T. Yamauchi, S. Yano, N. Yashiro, M. Yoneda, T. Yosida, Y. Yoshioka, K. Yoshi oka, K. Yuasa, M.

315 473 455,463 379,411 203 185 73 105 273 405 105 73 237 127 351 203 29 323 21,181 167 369 141 141 309 157 171,415 105 485 171,415 429 455,463 369 67

SUBJECT INDEX

516 SUBJECT

AMBER parameter, 158 Accessible surface area, 162 Acid protease, 328 Acquired immunodeficiency syndrome (AIDS), 277 Acridine-orange staining, 274 Actin, 75,315 - filaments, 320 - myosin interaction, 291 Activation - energy, 204 - enthalpy, 223 - volume, 139, 204, 211,221, 302, 483 Actomyosin, 295, 315 Adaptation, 17, 20, 59 Adlay, 395 Aggregation, 301, 310, 320 Air-blast method, 411 Alaska pollack 358, 363 Alkaline phosphatase, 301 Amadori rearrangement, 479 Amino acids, 231 Aminopeptidase B, 328 Amylase, 129 Antagonism, 175 Antimicrobial substance, 394 Artificial environment, 5 Aromatic component, 389 Aspartate [3-D-semialdehyde Atom packing, 157 ATPase activity, 56, 318 Autolysis, 212 Autoxidation, 474 BSA, 210 Bacillus - cereus ver mycoides, - coagulans, - fichniformis,

429

- stearothermophilus, - subtilis,

458, 468

391, 415 171

415

Background toughness,

295

INDEX

Bacterial spores, 127, 281,429 Bactericidal effects, 429 Bafilomycin A1, 56 Barostability, 214 Barophilic bacteria, 18, 59 Barotolerance, 47, 103,245 Barotolerant bacteria, 18, 59 [3-1actoglobulin, 153 Bilayer membrane, 175 Biological stimulation, 113 Bioreactor, 17, 200 Biotechnology, 20 Bis-ANS, 163 Bonito, 351 Bragg peak, 23, 183 Breaking strain, 365 Breaking strength, 363 Butyrylcholinesterase, 139 Calcium, 380 Calpain, 329 Calpastatin, 329 Campylobacter, 274 Candida spp.,

420

6-Carboxyfluorescein, 55 Carp meat, 375 Carrot, 379 Casein, 210, 347 Casein micelles, 300, 347 Cathepsin, 327 Cavity, 148 Cell culture, 73 Cell size, 97 Cell wall, 381 Cellulose, X-ray diffraction, 485, 487 Center of spectral mass, 164 Charge recombination, 71 Chemical immobilization, 70 Chloroperoxidase, 139 Cholesterol, 25 Cholinesterase, 122 Chroramphenicol acetyltransferase, 62 Chymotryptic digestion, 311

517 Circular dichroism (CD), 189 Clapeyron-Clausius equation, 179 Clostridium sporogenes, 415,429 CO binding, 138 Coagulation of milk, 302 Combined effects of temperature and pressure, 1,171,415,429 Compactness ofribonuclease A, 147 Compressibility, 13 water, 301 protein, 147 Compressibity factor, 169 Conditioning, 275, 289 Conformational - change, 170 157,161 driP, 163 Connectin (titin), 293 Connective tissue, 295 Cooking, 379 Cosolvent, 205, 221 Cotton effect, 190 Creep methods, 305 Creepmeter, 380, 412 Cristallization, 12 Cryo-baro-enzymology, 135 -scanning electron micrograph, 381, 411 Crystallization of fat, 331 Cultivation spores, 466 Cytochrome c, 105 Cytochrome P450, 139 Cytoskeleton, 75 Cytoskeletal element, 97 Cytosolic pH, 57 Death rate ofE. colli, 265 Decompression curve, 164 Deep-sea adaptation, 20, 29, 59, 60 Dehydrogenase, 61 Delaunay tessellation, 157 Denaturation, 245, 316 Depolymerizing actin, 319 Deuterium, 246 Diamond anvil cell, 127 Differential scanning calorimeter (DSC), -

-

- c l u s t e r ,

-

175, 301,324, 376 Differential thermal analysis, 25 Dihexadecylphosphatidylcholine, 175 Dimerization, 155 Dimethylsulfoxide, 246 Dipalmitoylphosphatidylcholine, 175 Dipicolinic acid, 242, 254 Disulfide bond, 301,305 Divalent cation, 382 DNA, 189 DNAase I inhibition, 315 Docosahexaenoic acid (DHA), 354 D-value, 422 Dye plate method, 95 Dynamic -rheological behaviour, 315 - viscoelasticity, 376 viscoelasticity measurements, 316 Electron densities, 300 - micrograph, 312 transfer, 71 Electrophoresis, 301 Electrostatic interaction, 300, 325 Elongation of cells, 262 Emulsion, 132, 334 Endoplasmic reticulum, 69 Endothermictransition, 324, 326 Entrococcus, 274 Entropic contribution, 166 Entropy change, 179 Equatorial OH, 245 Escherichia coli, 18, 59, 185,261,274 Ester-linked phospholipid, 175 Esterification, 379 Ethanol tolerance, 103 1-Ethyl- 3-(3- dimet hylaminopropyl)carbodiimide, 68 F-actin, 75 Fat, 331 Fatty acid, 353 Ferguson plot, 121 Finite element, 157 Firmness, 379, 411 -

-

-

518 Fish meat, 351 - protein, 363 storage, 353 Flexibility, 363 Fluorescence, 154, 163, 211 anisotropy, 25 - dye, 54 kinetics, 71 - microscope, 274 - spectroscopy, 163 - yield, 71 tryptophan, 301 Food, 423 related enzymes, 281 Fourth derivative spectroscopy, Freezer, 379, 411 Freezing, 379, 386, 411 FT-IR, 127 Galacturonic acid, 381 GC-MS, 475 Gel formation, 315 - forming ability, 363 melting temperature, 453 - property, 364, 411 setting temperature, 453 strength, 319 Gel electrophoresis, 117, 376 Gelation, 315, 451 - 13-1actoglobulin, 304 milk, 303 - myosin, 326 357 - whey protein, ,304341 Gene expression, 59 Germination, 242 Glucono-6-1actone, 411 Glutamate dehydrogenase, 163 Gram negative bacteria, 267 Gram positive bacteria, 267 Gutamate deydrogenase, 163 HPLC-MS, 475 Halophilic yeast, 407 He-Ne laser, 113

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

s

u

r

i

m

i

Heat, 379 capacity, 143 inactivation, 221 - shock, 246 shock protein, 101 shock response, 47 stability, 422 resistant bacteria, 171, 415 Heavy meromyosin, 309 Heme protein, 138 Heterogeneity, 163 High pressure, 141, 176, 273,281,323,327, 338, 379, 391, 411 adaptation, 17, 20, 59 - application to food system, 279 - Campylobacter, 274 combined use, 4 - Enterococcus, 274 - equipment, 96, 182, 375, 452, 445, 456 -inactivation, 274, 407, 423 independent use, 4 instantaneous treatment, 466 meat tenderization, 289 - NMR, 141 - processed food, 1 sterilization, 419, 459 -X-ray, 182 High temperature, 186 Histological damage, 379, 413 Homozygous diploid, 95 Horseradish peroxidase, 139 Hot-wire method, 451 Hydration, 148 Hydrodynamic diameter, 300 Hydrogen bond, 246, 325 Hydrolytic cleavage, 382 Hydrophobic - interactions, 300, 305, 325 -probe, 165 Hydrophobicity, 197, 205, 224, 310 - of cell surface, 263 Hydroxylamine oxidoreductase, 139 Hysteresis, 164 -

231

-

-

-

-

-

519

Ice, 379,411 Icosapentaenoic acid, 4, 354 Inactivation, 237, 244, 253,267, 274, 398, 407, 423 - enzymes, 280 - microorganisms, 280, 285,299 Increase in cubic vessel, 460 Induction, 59 Interdigitated gel phase, 175 Intermolecular exchange, 155 Iodometric method, 380 Ion homeostasis, 53 Ionic strength, 305 Iron - nitrosyl complex, 106 Irreversible denaturation, 153 Isopropyl-[3-D-thiogalactopyranoside, 62 Isothermal stability, 203,205, 206, 207 Isotropic phase, 25 Kamaboko, 363 Killing effect, 186 Kramers' theory, 138 Lac promoter, 62 b-Lactoglobulin, 301 Lactoperoxidase, 139 Lamellar gel phase 1, 2 Lamellar phase, 22, 181 Le Chatelier principle, 8, 325 Light meromyosin, 309 Lignin, 485 Limited proteolysis, 209 Lipid bilayer, 21 degradation, 353 - oxidation, 353 peroxidation, 473 stability, 354 crystal phase, 176 -phase, 383,411 Low - acid food, 429 - temperature, 423 temperature processing, 281 Lysosome, 275,327 Lysozyme, 394 -

-

-

-

-

-

MT-4 cell, 277 Mac-scope, 412 Macromolecules, 245 Magnesium, 380, 411 Maillard reaction, 479 Maxwell relationships, 138 Meat conditioning, 289 Membrane, 30, 181,187, 270, 284 Metalloprotein, 105 Methanol dehydrogenase, 236 Micellar - enzymology, 10 - fragmentation, 300 Microbial spoilage bacteria, 171, 415 Micrococcus, 274 Microfibril, 382 Microfilament, 97 Microscopic ordering principle, 8 Microtuble, 97 Middle lamella, 381 Miso, 408 Milk, 267, 300 Minimum inhibitory concentration, 394 Mn-cluster, 68 Modeling of thawing 441 Molten globule, 12, 117 Morphology, 73,310 Mould, 241 Mouse cells, 73 mRNA, 61 Multilamellar vesicle, 176 Myofibrillar protein, 315, 63 Myofibrils, 292, 323 Myoglobin, 352 Myosin, 309, 315, 324, 358 aggregate, 310 - filaments, 320 - heavy chain, 367 NMR, 141,332, 477 NPT dynamics simulation, 158 Neutral protease, 407 Nozawana-zuke, 397 Nitric oxide, 105 Nuclear division, 97 -

520

Nucleic acids, 189 Organelle, 53 Osmotic pressure, 9 Ovalbumin, 131 Oxidation, 366 Oxygen evolution, 68 PET films, 390 Parenchyma 379 Parasite, 275 Partition of cells, 264 Pathogen, 258, 271 Pectin, 379 esterase, 283 methylesterase, 382 Phalloidin, 74 )~ Phage, 63 Phase - boundary, 176 - diagram, 175,283,331,379, 383 Phenylalanine, 232 Phospholipid, 22, 175, 331 Photobacterium, 29 Photosynthesis, 67 Photosystem, 68 Pickle, 397 Plasma membrane, 381 Plasmid, 62 Ploidy, 97 Polarity, 231 Polygalacturonase, 383 Polylysine, 395 Polyploidization, 95 Polysaccharide, 127, 337 Poultry meat, 267 Press capacity, 458 Pressure, 175,245 - activation, 209 adaptation, 30, 60, 195,200 anesthetic antagonism, 175 denaturation, 118, 197 induced acidification, 56 induced dissociation, 164 - induced gel phase, 175 - induced gelation, 363 -

-

-

-

-

-

-

- induced inactivation, 70 - induced structural modulation, 72 - jump relaxation, 181 - medium, 465 - protectant, 71 - pump, 465 - reducung valve, 464 - resistance bacteria, 171,415 - sensing, 30 - sensitivity, 268 - shift freezing, 379, 411 - shock treatment, 103 - stability, 195, 199, 422 - thermostability, 195,200 - tolerant, 59 Pressurizing unit, 458 Pretransition, 175 Primary wall, 381 Proliferation, 73 Promoter, 60 Protective effect, 205 Protein, 127, 245, 412 - denaturation, 143, 148 - modification, 210 - polysaccharide interaction, 337 - pressure denaturation, 150 - protein interaction, 305, 325 - purification, 14 - structure, 11 - thermal denaturarion, 151 - unfolding, 141 Proteinase, 209 Proteobacteria, 19, 59 Proteolysis, 302 Proton sequestrant, 57 Pseudomonas, 274 Psychrophilic, 60 Pulsatile high pressure - equipment, 464 Puncture test, 364 Quinacrine, 57 Quinone, 71 RNA, 189 RNA polymerase, 62 Randam spore analysis, 96

521 Reaction pathway, 137 Reaction volume, 300 Recombinant, 195,200 Red fish meat, 355 Red muscle, 351 Redox state, 71 Reducing sugar, 382 Repeated treatment Repression, 59 Reversed micelles, 10 Rheological measurements, 338 Ribonuclease A, 141, 193,234 Ribosomal DNA, 60 Ripple gel phase, 175 Rosemary, 356 RpoE operon, 33 S-peptide, 157 Saccharides, 245 Saccharomyces cerevisiae, 47, 53, 101, 113,245,420, 423 Salmonella, 274 Saponification, 382 Sarcoplasmic protein, 364 Sardine, 351 Scanning electron microscopy, 304, 381, 411 Sensory evaluation, 412 Serum albumin, 210, 301 SH content, 321 SH/S-S interchange reactions, 301 Shelf life of pickeles, 397 Shinkai 6500, 17, 59 Shiromiso (white miso), 405 Signal transduction, 30 Size exclusion chromatography, 120 Skim milk 348 Small-angle x-ray scattering, 23 Softening, 379 Solid fat content, 331 Solvation, 9, 253 Solvent-accessible surface area, 337 Soybean curd, 411 Specific rotation, 301 Specific volume, 148

Spectral shift, 231 Spore, 241,253,256 Stabilization, 223,237

Staphylococcus aureus, 274 Starch, wheat 433 Sterility test, 255 Sterilization, 171, 187, 389, 391,406, 415 Stokes radii, 120 Stopped-flow apparatus, 135 Storage. 270, 353,366, 406 Storage modulus, 316 Strain, 379, 411 Strain tensor analysis, 157 Strawberry, 445 Strawberry jam, 423 Stress, 95,246 Stress tolerance, 101 Sub-zero temperatures, 423 Subtilisin, 209 Subunit association, 163 Sudachi juice, 387 Sugars, 245 Sulfhydryl groups, 153,300 Surface hydrophobicity, 321 Surimi, 357, 363 Survival curve, 420 Tac promoter, 62 Tangent delta, 317 Temperature controll, 456, 465 Temperature- pressure phase diagram, 24, 175 Termotropic phase transition, 21 Tenderdization, 289 Test microorganism, 458 Texture, 290, 363,379, 411 Thawing 439 Thermal -inactivation, 171, 186, 221, 415 -stability, 13,221 Thermodynamics, 136, 141 Thermolysin, 209 Thermophilic enzyme, 195,202 Thermotolerance, 47, 103,245 Thiobarbituric acid, 355, 380

522 Time-resolued synchrotron X-ray diffraction, 181 Tocopherol, 356 Tofu, 386, 411 Tomato juice, 391 ToxRS operon, 31 Transglutaminase 358 Transcription, 60 Transelimination, 379 Transfer free energy, 198 Transition state, 136 Transmission electron microscopy, 348 Trehalose, 47, 104 Trichnella spiraBs, 275 Trichinellosis, 275 Triglyceride, 353 tRNA, 189 Truffle 401 Truffle cream, 253 Tryptophan, 232 Tuber melanosporum, 401 Turbidity, 310 Typsin inhibitor, 167 Tyrosine, 232 U.H.T. milk 348 UV-Vis diode array spectrophotometer, 227 Unfolding, 234, 301,337, 341 Vacuole, 53, 381 Vacuolar pH, 53 Variant cell, 95 Vegetable, 379 Vegetative bacteria, 238, 267 Vesicle, 175 Viable cell of fungi, 398 of gram negative bacteria, 398 of lactic acid bacteria, 398 of microorganisms, 398 Virus - Enveloped virus, 276 -Human cytomegalo virus, 276 Human immunodeficiency virus, 277 Human simplex virus, 276 -

-

-

-

-

-

- Polyo virus, 276 Viscosity, 10, 137, 245, 380 Volume change, 143, 164, 179, 376 Water, 9, 379 - soluble protein, 363 holding capacity, 352 phase diagram, 9 Weibull-distribution, 285 WHC and TB A value changes 354 Whey protein, 304, 337, 347 Wood Hinoki (Chamecyparis obutsa), 485 Wood physical properties, 485 XTT, 74 Yeast, 53,101, 113,245, 419, 423 Z-value, 422 Zig-zag conformation, 190 -

-