Pathogenic Escherichia coli in Latin America

Pathogenic Escherichia coli in Latin America Editor ALFREDO G. TORRES eBooks End User License Agreement Please rea...

Author: Alfredo G. Torres

65 downloads 2253 Views 11MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

Pathogenic Escherichia coli in Latin America

Editor ALFREDO G. TORRES

eBooks End User License Agreement Please read this license agreement carefully before using this eBook. Your use of this eBook/chapter constitutes your agreement to the terms and conditions set forth in this License Agreement. Bentham Science Publishers agrees to grant the user of this eBook/chapter, a non-exclusive, nontransferable license to download and use this eBook/chapter under the following terms and conditions: 1. This eBook/chapter may be downloaded and used by one user on one computer. The user may make one back-up copy of this publication to avoid losing it. The user may not give copies of this publication to others, or make it available for others to copy or download. For a multi-user license contact [email protected] 2. All rights reserved: All content in this publication is copyrighted and Bentham Science Publishers own the copyright. You may not copy, reproduce, modify, remove, delete, augment, add to, publish, transmit, sell, resell, create derivative works from, or in any way exploit any of this publication’s content, in any form by any means, in whole or in part, without the prior written permission from Bentham Science Publishers. 3. The user may print one or more copies/pages of this eBook/chapter for their personal use. The user may not print pages from this eBook/chapter or the entire printed eBook/chapter for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained from the publisher for such requirements. Requests must be sent to the permissions department at E-mail: [email protected] 4. The unauthorized use or distribution of copyrighted or other proprietary content is illegal and could subject the purchaser to substantial money damages. The purchaser will be liable for any damage resulting from misuse of this publication or any violation of this License Agreement, including any infringement of copyrights or proprietary rights. Warranty Disclaimer: The publisher does not guarantee that the information in this publication is error-free, or warrants that it will meet the users’ requirements or that the operation of the publication will be uninterrupted or error-free. This publication is provided "as is" without warranty of any kind, either express or implied or statutory, including, without limitation, implied warranties of merchantability and fitness for a particular purpose. The entire risk as to the results and performance of this publication is assumed by the user. In no event will the publisher be liable for any damages, including, without limitation, incidental and consequential damages and damages for lost data or profits arising out of the use or inability to use the publication. The entire liability of the publisher shall be limited to the amount actually paid by the user for the eBook or eBook license agreement. Limitation of Liability: Under no circumstances shall Bentham Science Publishers, its staff, editors and authors, be liable for any special or consequential damages that result from the use of, or the inability to use, the materials in this site. eBook Product Disclaimer: No responsibility is assumed by Bentham Science Publishers, its staff or members of the editorial board for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products instruction, advertisements or ideas contained in the publication purchased or read by the user(s). Any dispute will be governed exclusively by the laws of the U.A.E. and will be settled exclusively by the competent Court at the city of Dubai, U.A.E. You (the user) acknowledge that you have read this Agreement, and agree to be bound by its terms and conditions. Permission for Use of Material and Reproduction Photocopying Information for Users Outside the USA: Bentham Science Publishers Ltd. grants authorization for individuals to photocopy copyright material for private research use, on the sole basis that requests for such use are referred directly to the requestor's local Reproduction Rights Organization (RRO). The copyright fee is US $25.00 per copy per article exclusive of any charge or fee levied. In order to contact your local RRO, please contact the International Federation of Reproduction Rights Organisations (IFRRO), Rue du Prince Royal 87, B-I050 Brussels, Belgium; Tel: +32 2 551 08 99; Fax: +32 2 551 08 95; E-mail: [email protected]; url: www.ifrro.org This authorization does not extend to any other kind of copying by any means, in any form, and for any purpose other than private research use. Photocopying Information for Users in the USA: Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, is granted by Bentham Science Publishers Ltd. for libraries and other users registered with the Copyright Clearance Center (CCC) Transactional Reporting Services, provided that the appropriate fee of US $25.00 per copy per chapter is paid directly to Copyright Clearance Center, 222 Rosewood Drive, Danvers MA 01923, USA. Refer also to www.copyright.com

CONTENTS Foreword

i

Preface

ii

Contributors

iv

CHAPTERS 1. Overview of Escherichia coli A.G. Torres, M. Arenas-Hernandez and Y. Martinez-Laguna

1

2. Evolution and Epidemiology of Diarrheagenic Escherichia coli N. Williams, A.G. Torres and S. Lloyd

8

3. Enteropathogenic Escherichia coli (EPEC) T.A.T. Gomes and B. Gonzalez-Pedrajo

25

4. Enteroaggregative Escherichia coli F. Navarro-Garcia, W.P. Elias, J. Flores and P.C. Okhuysen

48

5. Shiga Toxin Producing Escherichia coli B. Guth, Valeria Prado and M. Rivas

65

6. Enterotoxigenic Escherichia coli J. Flores and P.C. Okhuysen

84

7. Detection and Subtyping Methods of Diarrheagenic Escherichia coli Strains R.M.F. Piazza, C.M. Abe, D.S.P.Q. Horton, E. Miliwebsky, I. Chinen, T.M.I. Vaz and K. Irino

95

8. Clinical Management of Escherichia Coli Cases (The Latin America Experience) H.A. Repetto

116

9. Host Responses to Pathogenic Escherichia coli C. Ibarra and M. Palermo

122

10. Diarrheagenic Escherichia coli in Argentina M. Rivas, N.L. Padola, P.M.A. Lucchesi and M. Masana

142

11. Escherichia coli Situation in Brazil B.E.C. Guth, C.F. Picheth and T.A.T. Gomes

162

12. Shiga Toxin Producing Escherichia coli in Chile R.M. Vidal, A. Oñate, JC. Salazar and V. Prado

179

13. Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico, Past and Present A. Navarro and T. Estrada-Garcia

191

14. Diarrheagenic Escherichia coli in Children from Uruguay, Colombia and Peru G. Varela, O. Gomez-Duarte and T. Ochoa

209

15. Escherichia coli Animal Reservoirs, Transmission Route and Animal Disease A.F. Pestana DE Castro, A. Bentancor, E.C. Mercado, A. Cataldi and A.E. Parma

223

16. Host-Pathogen Communication M.P. Sircili, C.G. Moreira and V. Sperandio

249

17. Future of Escherichia coli Research in Latin America T.A.T. Gomes, C. Ibarra, F. Navarro-Garcia, M. Palermo, V. Prado, M. Rivas and A.G. Torres

256

Index

262

i

FOREWORD In November 1946, Gerardo Varela, the most prominent Mexican bacteriologist of his time, published a paper in the bulletin of the Children’s Hospital in Mexico City [1] describing the identification of a “new” type of Escherichia coli isolated from a child who had died from a severe diarrhea in the same hospital. His collaborators were Alejandro Aguirre, a young pediatrician, and Julio Carrillo, who had personally performed the microbiological studies during the autopsy and who had isolated the bacteria and kept it for further studies. A few months earlier, Bray had published similar results from a group of children in the Great Britain who were dying from diarrhea in a town in England [2]. Considering that the Second World War had just ended, there was no communication between these two groups at the time. However, once published, a heated discussion began on both sides of the Atlantic with most people reluctant to accept that a bacterium like E. coli, which until then had been considered as an organism that was not associated with disease, could be the cause of these children’s deaths. Although, both Bray and Varela were able to show that the serum obtained from the children infected with these putative pathogens were able to agglutinate the bacteria in vitro, Varela’s approach went a step further. One of his main interests was to study the cross reactions between different enteric organisms when tested against an antiserum raised in rabbits. For these particular assays, he primarily used antisera prepared against somatic and flagellar antigens of different types of Salmonella, which was the dominant pathogen of interest at the time. As reported in his publication [1], an antiserum prepared against the somatic antigen of Salmonella adelaide was able to agglutinate the E. coli isolated from the feces of the child who had died. A similar reaction was found with another E. coli isolated from a different child who had also died from severe diarrhea, and from a cook working in the kitchen of the hospital who had been sampled during a study to determine sources for such infections. The cross reaction tests allowed Varela and his colleagues to demonstrate that these E. coli, usually considered as a part of the normal intestinal flora, were somehow different from other E. coli found in feces from humans without diarrhea. These two seminal studies in the mid-40’s led to major discussions about the role of E. coli as a pathogen, while remaining the most modest inhabitant of the intestine of humans and animals. The discussions prompted a deluge of new research in laboratories around the world that in one form or another had found similar results. Over the next few years, groups in Britain, the United States, Brazil and Mexico sent strains of E. coli isolated from children with severe diarrhea to Copenhagen, where Fritz Kauffmann had set up a serological system in his laboratory to identify the somatic and flagellar antigens of these organisms. The most interesting finding that comes out of Kauffmann’s serological studies was that E. coli isolated in different parts of the world was restricted to a few somatic and flagellar antigen combinations, called serotypes. All of these initial studies provided the catalyst for a whole new field of research that over the past 60 years has allowed us to understand how bacteria interact with intestinal cells, and how they are able to cause diarrhea. Researchers, either born or working in Latin America, have contributed extensively and consistently to this field over the years. Under the dynamic leadership of Alfredo Torres, who has been able to convince and cajole his friends working all over Latin America to put into writing their most recent work, this unique and interesting volume follows the tradition started by Varela and others in the 1940’s and shows the developments made since those early days in the scientific and clinical study of E. coli. I am sure that this book will help us involving in teaching microbiology and infectious diseases, and I hope it will encourage new questions and better answers in a field that, in spite of improved knowledge and increased understanding, is still looking for the necessary tools to prevent young children from dying from diarrhea around the world.

Alejandro Cravioto, M.D. International Centre for Diarrhoeal Disease Research Dhaka, Bangladesh

ii

REFERENCES [1] [2]

Varela G, Aguirre A, Carrillo J. Escherichia coli-Gomez, nueva especie aislada de un caso mortal de diarrhea. Bol Med Hosp Inf Mex 1946; 54: 623-6. Bray J. Isolation of antigenically homogenous strains of Bact. coli neapolitanum from summer diarrhea of infants. J Pathol Bacteriol 1945; 57: 239-47.

iii

PREFACE In 2009, during a session at the 7th International symposium on Shiga Toxin (Verocytotoxin) – Producing Escherichia coli Infections in Buenos Aires, Argentina, I was sitting at the back of the auditorium and realized that a large proportion of the attendees were young Latin American students, postdoctoral fellows and investigators, and many of them were participating for the first time in an international meeting where the world experts in pathogenic E. coli research discussed the “state of the art” in the field. I also observed that many of them were current and former trainees of Latin American laboratories and institutions with a long tradition in E. coli research, and those laboratories have not only contributed to the understanding of Shiga toxin-producing E. coli infections, but played a pivotal role in the identification and characterization of other categories of pathogenic E. coli. At that moment, I realized that it was the to organize a group that helps promoting the research of the scientist in this region and as a first task to write a comprehensive text on pathogenic E. coli summarizing and reviewing the accumulated knowledge generated by these Latin American investigators, which had make a significant impact on our understanding of these important human pathogens. In the first 10 years of the 21st century, the different categories of pathogenic E. coli have been reviewed extensively in review articles and some books, representing the vast body of literature on this bacterium, making pathogenic E. coli the best reviewed organism in the field of bacterial pathogenesis and infectious diseases. Even though, thousands of investigators around the world have been studying different aspects of the pathogenic attributes of E. coli for more than 60 years, pathogenic E. coli remains an important cause of diarrhea and death in infants in developing countries. Intestinal infections caused by E. coli remain as an important health problem in all Latin American countries and there was a need to publish an overall review of all the studies conducted in this region that have shown, the appearance of serotypes not previously associated with disease and the evolution of some categories of E. coli, which have become the predominant pathogenic E. coli in some of these countries. This body of knowledge produces by these investigators needed a critical review that was comprehensive and integrate all the different countries and all the researchers. Why this book is different from other books which are already published on pathogenic E. coli? Most prior volumes concentrated on the basic and clinical research progress performed by laboratories in North America, Europe, Australia or Japan, and none of them covered the situation in Latin America. The book “Pathogenic Escherichia coli in Latin America” is a unique, comprehensive analysis of the most common categories of E. coli associated with diarrheal illness in Latin America. The aim of the book is to allow leading investigators in this region to discuss molecular mechanisms of E. coli pathogenesis followed by chapters on diagnosis, clinical management, host immune responses, animal reservoirs and epidemiology. In addition, the authors discuss the current situation of E. coli in representative countries, including Argentina, Brazil, Chile, Colombia, Mexico, Peru and Uruguay. This ebook presents timely and vital information to understand the current work on pathogenic E. coli in Latin America and presents future research in this region. The book is divided into 17 parts. The first 2 parts introduce the foundations of E. coli and the evolution and epidemiology associated with this pathogen. Parts 3-6 review the 4 most important categories of intestinal pathogenic E. coli in Latin America. Parts 7-9 are an overview of the current knowledge regarding diagnosis, clinical management and host responses to E. coli. Part 10-14 present the current situation of E. coli infections in 7 Latin American countries. Part 15 discuss the animal reservoirs, transmission and animal disease. Part 16 introduce a relative new area of investigation regarding communication mechanisms between host and pathogen. Finally, part 17 is an assay by top investigators in the region discussing future directions of E. coli research in Latin America. I hope this book becomes a useful textbook for current and future generations of investigators and serves as a reference for the E. coli community to understand the past and present of research in Latin America.

Alfredo G. Torres, PhD Galveston, Texas

iv

CONTRIBUTORS Cecilia M. Abe

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, Brazil

Margarita M.P. Arenas-Hernandez

Centro de Investigaciones en Ciencias Microbiológicas. B. Universidad Autónoma de Puebla, Puebla, México

Adriana Bentancor

Universidad de Buenos Aires, Argentina

Angel Cataldi

INTA-CONICET, Argentina

Isabel Chinen

Servicio Fisiopatogenia, Departamento de Bacteriología, Instituto Nacional de Enfermedades Infecciosas “Carlos G. Malbrán”, Buenos Aires, Argentina

Alejandro Cravioto

ICDDR,B, Dhaka, Bangladesh

Waldir P. Elias

Laboratory of Bacteriology, Instituto Butantan, São Paulo, SP, Brazil

Teresa Estrada-Garcia

Department of Molecular Biomedicine, CINVESTAV-IPN, Mexico City, Mexico

Jose Flores

Division of Infectious Diseases, The University of Texas at Houston Medical School, Houston, Texas, USA

Tania A.T. Gomes

Departmento de Microbiologia, Imunologia, e Universidade Federal de São Paulo, São Paulo, Brazil

Oscar G. Gómez-Duarte

International Enteric Vaccines Research Program, Division of Infectious Diseases, Department of Pediatrics, University of Iowa Children’s Hospital, USA

Bertha Gonzalez-Pedrajo

Departamento de Genética Molecular, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, México, D.F., Mexico

Beatriz E.C. Guth

Department of Microbiology, Immunology, and Universidade Federal de São Paulo, São Paulo, Brazil

Denise S.P.Q. Horton

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, Brazil

Cristina Ibarra

Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires, Argentina

Kinue Irino

Seção de Bacteriologia, Instituto Adolfo Lutz, São Paulo, SP, Brazil

Sonja J. Lloyd

Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas, U.S.A.

Paula M.A. Lucchesi

Laboratorio de Inmunoquímica y Biotecnología, Facultad de Ciencias Veterinarias, Universidad Nacional del Centro, 7000 Tandil, Prov. de Buenos Aires, Argentina.

Ygnacio Martinez-Laguna

Centro de Investigaciones en Ciencias Microbiológicas. B. Universidad Autónoma de Puebla, Puebla, México

Parasitologia,

Parasitology,

v

Marcelo Masana

Instituto Tecnología de Alimentos. Centro de Investigación de Agroindustria, Instituto Nacional de Tecnología Agropecuaria, INTA. B1708WAB Morón, Prov. de Buenos Aires, Argentina.

Elsa C. Mercado

Instituto Nacional de Tecnología Agropecuaria (INTA), Argentina

Elizabeth Miliwebsky

Servicio Fisiopatogenia, Departamento de Bacteriología, Instituto Nacional de Enfermedades Infecciosas “Carlos G. Malbrán”, Buenos Aires, Argentina

Cristiano G. Moreira

University of Texas Southwestern Medical Center, Department of Microbiology, Dallas, USA

Armando Navarro

Departamento de Salud Pública. Facultad de Medicina, Universidad Nacional Autónoma de Mexico. Mexico City, Mexico

Fernando Navarro-Garcia

Department of Cell Biology, Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV-IPN), México DF, Mexico

Theresa Ochoa

Instituto de Medicina Tropical “Alexander von Universidad Peruana Cayetano Heredia, Lima, Perú

Pablo C. Okhuysen

Division of Infectious Diseases, The University of Texas at Houston Medical School, Houston, Texas, USA

Angel Oñate

Department of Microbiology, Faculty of Biological Sciences. Universidad de Concepción. Chile

Nora Lía Padola

Laboratorio de Inmunoquímica y Biotecnología, Facultad de Ciencias Veterinarias, Universidad Nacional del Centro, Prov. de Buenos Aires, Argentina.

Marina Palermo

Departamento de Inmunología, Academia Nacional de Medicina and ILEX-CONICET, Buenos Aires, Argentina

Alberto E. Parma

Universidad Nacional del Centro-CICPBA, Argentina

Antonio F. Pestana de Castro

University of São Paulo, Brazil

Roxane M.F. Piazza

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, Brazil

Cyntia F. Picheth

Department of Medical Pathology, Federal University of Paraná, Curitiba, Brazil

Valeria Prado

Microbiology Program, Institute of Biomedical Sciences, Faculty of Medicine, Universidad de Chile, Santiago, Chile

Horacio A. Repetto

Department of Pediatrics, Faculty of Medicine, and Hospital Nacional Prof. A Posadas, University of Buenos Aires, Buenos Aires, Argentina

Marta Rivas

Branch of Physiopathogenesis, Department of Bacteriology, Instituto Nacional de Enfermedades Infecciosas-ANLIS "Dr. Carlos G. Malbrán", Buenos Aires, Argentina

Humboldt”,

vi

Juan C. Salazar

Institute of Biomedical Sciences, Faculty of Medicine Universidad de Chile

Marcelo P. Sircili

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, 05503900, Brazil

Vanessa Sperandio

University of Texas Southwestern Medical Center, Department of Microbiology, Dallas, TX 75390-9048, USA

Alfredo G. Torres

Department of Microbiology and Immunology, Department of Pathology and the Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas, U.S.A.

Gustavo Varela

Departamento de Bacteriología y Virología. Instituto de Higiene “Arnoldo Berta”. Facultad de Medicina. Universidad de la República. Montevideo, Uruguay

Tânia M.I. Vaz

Seção de Bacteriologia, Instituto Adolfo Lutz, São Paulo, SP, Brazil

Roberto M. Vidal

Institute of Biomedical Sciences, Faculty of Medicine Universidad de Chile

Nina D. Williams

Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas, U.S.A.

Pathogenic Escherichia coli in Latin America, 2010, 1-7

1

CHAPTER 1 Overview of Escherichia coli Alfredo G Torres1,*, Margarita MP Arenas-Hernández2 and Ygnacio Martínez-Laguna2 1

Department of Microbiology and Immunology, Department of Pathology and the Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555-1070 and 2Centro de Investigaciones en Ciencias Microbiológicas. B. Universidad Autónoma de Puebla, Puebla, Puebla 72570 México. Abstract: Escherichia coli are Gram-negative bacteria found as normal commensal flora in the gastrointestinal tract. As a pathogen, E. coli are the most frequent causes of bacterial infections, including urinary tract infections, diarrheal disease, and other clinical infections such as neonatal meningitis, pneumonia and bacteremia. At least six different categories of pathogenic E. coli causing enteric infections have been identified and further characterized. In Latin America, as well as many other developing countries, diarrheal infections caused by E. coli remain an important cause de infant morbidity - mortality. Due to the appearance of the highly virulent strain of E. coli of serotype O157:H7 in the US and Canada in the 1980’s, and subsequently in other Latin American countries, there is an increase need for accurate testing for this and other pathogenic E. coli strains, substantially enhancing detection of virulent strains and, therefore, facilitating identification of sporadic E. coli infections and outbreaks.

ESCHERICHIA COLI: THE ORGANISM The genus Escherichia is named after the German pediatrician Theodor Escherich, who isolated the type species of the genus in 1885 [1]. E. coli are facultative anaerobic bacteria with a type of metabolism that is both fermentative and respiratory. They are either non-motile or motile by peritrichous flagella. E. coli strains are a major facultative inhabitant of the large intestine, widely distributed in the intestine of humans and warm-blooded animals and it is the predominant facultative anaerobe in the intestine and part of the essential microbiota that maintains the physiology of the healthy host [2]. E. coli is a member of the family Enterobacteriaceae [3], and although most strains of E. coli are not regarded as pathogens, they can be opportunistic pathogens that cause infections in immunocompromised hosts. Physiologically, E. coli is versatile and well-adapted to its characteristic habitats. It can grow in media with glucose as the sole organic constituent. Wild-type E. coli has no growth factor requirements, and metabolically it can transform glucose into all of the macromolecular components that make up the cell [4]. The bacterium can grow in the presence or absence of O2. Under anaerobic conditions it will grow by means of fermentation, producing mixed acids and gas as end products. However, it can also grow by means of anaerobic respiration, since it is able to utilize NO3, NO2 or fumarate as final electron acceptors for respiratory electron transport processes. In part, this versatility is what gives E. coli its ability to adapt to its intestinal (anaerobic) and its extraintestinal (aerobic or anaerobic) habitats [4]. E. coli is used as an indicator of fecal contamination because the organism is abundant in human and animal feces and not usually found in other niches. Furthermore, since E. coli could be easily detected by its ability to ferment glucose (later changed to lactose), it is easier to isolate from contaminated food or water than contain other known gastrointestinal pathogens. Due to the presence of other enteric bacteria like Citrobacter, Klebsiella and Enterobacter, which can also ferment lactose, the term "coliform" was coined. These enteric organisms are similar to E. coli in phenotypic characteristics and are not easily distinguished. Therefore, a broad definition indicates that the coliforms are a group of Gram-negative, facultative anaerobic rod-shaped bacteria that ferments lactose to produce acid and gas within 48 h at 35°C, and which are an indicator of contamination [5]. Further, the coliforms are well adapted to mammalian intestines, e.g. different strains of E. coli grows best in vivo or at the higher temperatures characteristic of such environment, rather than the cooler temperatures found in soil and other environments. Within the coliform group, the fecal coliforms consists mostly of E. coli (the indicator species), but some other enterics, such as Klebsiella, is also important indicator because they can also ferment lactose at temperatures between 44.5-45.5°C. *Address correspondence to: Alfredo G. Torres, Department of Microbiology and Immunology, University of Texas Medical Branch, 301 University Blvd, Galveston, Texas 77555-1070; Tel (409) 747-0189. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

2 Pathogenic Escherichia coli in Latin America

Torres et al.

Detection and enumeration of coliforms is used as an indicator of sanitary quality of water or as a general indicator of sanitary condition in the food-processing environment [6]. Almost all the methods used to detect E. coli, total coliforms or fecal coliforms are enumeration methods that are based on lactose fermentation [7]. Colony-forming units and Most Probable Number (MPN) are two methods commonly used to assess the threat of pathogen contamination. For example, the MPN method is a statistical, multi-step assay consisting of presumptive, confirmed and completed phases. In the assay, serial dilutions of a sample are inoculated into broth media and the number of gas positive (fermentation of lactose) tubes is scored, from which the other 2 phases of the assay are performed using the combinations of positive results to consult statistical tables to estimate the number of organisms present. Typically only the first 2 phases are performed in coliform analysis, while all 3 phases are done for E. coli [8]. As a result of this type of analysis, fecal coliforms remain the standard indicator of choice for shellfish and shellfish harvest waters; and E. coli is used to indicate recent fecal contamination or unsanitary processing [5, 9]. One useful property of coliforms is that they are very easily differentiated from others by growing them in lactose– peptone–nutrient medium (e.g., Mac–Conkey broth) at 37°C for 24-48 h and then checking if they produced acid and gas. For further differentiation of fecal coliforms, the samples can be grown in lactose–peptone–eosin–methyl blue (EMB) agar medium. After incubating the medium at 37°C for 24-48 h, E. coli develops into blue black colonies with light reflecting metallic shine, whereas Enterobacter forms reddish slimy colonies. For E. coli O157:H7, the stool specimen are normally tested on sorbitol–MacConkey (SMAC) agar. To perform the complete differentiation of fecal contaminant (e.g., E. coli) and the non–fecal contaminant (e.g., Enterobacter), a series of traditional biochemical tests are still in use, which are collectively known as IMViC test [10]. In these tests, indol production from tryptophan (indol test), production of strong acid causing red color in methyl red indicator (methyl red test), production of acetoine (Voges–Proskauer test), and use of citrate as the only carbon source (citrate test) are conducted. E. coli shows positive reactions for the first two tests whereas Enterobacter aerogenes for the last two tests. Significance in Determining E. coli as a Contaminant of Food Products and Water As described above, coliforms are found in the soil, in water, in muck and all over the natural environment. However, E. coli strains are specifically adapted to live in the guts of warm blooded animals. E. coli is used for detection because it makes up about 10 percent of intestinal microorganisms of human and animals; consequently, there are a lot more coliforms in human feces than there are pathogens. Therefore, E. coli is considered a contaminant risk not only in water, but in food products as well, and in recent years there have been an increasing number of food recalls because of E. coli contamination [11, 12]. As a water contaminant, E. coli was chosen several years ago as an "indicator" of the amount of human fecal matter level in the water [13]. Comparing the number of coliform/E. coli with the standardized coliform index, the water quality can be graded and recommended for certain use or none. However, caution is recommended as it can be misleading to use E. coli alone as an indicator of human fecal contamination, because there are other environments in which E. coli grows well. Monitoring the levels of E. coli contamination is important because differences between non-pathogenic and pathogenic E. coli strains are often detectable only on the molecular level; however, many of these differences cause changes in the physiology or life cycle of the bacterium, leading for example to the different pathogenic lifestyles. New strains of E. coli arise all the time from the natural biological process of genetic variability (i.e. mutation, horizontal transfer genes), and some of those strains develop characteristics that can be harmful to their host animal. Although in most healthy adult individuals, such a strain would probably cause no more than a diarrheal episode or might produce no symptoms at all; in young children, people who are or have been recently immunocompromised, or in people taking certain medications, such virulent strain can cause serious illness and even death. A recent example of the evolution of a virulent strain is represented by E. coli O157:H7, which possess the stx-phages, which carry the genes encoding Shiga toxin (Stx). Shiga toxins have driven and are driving the emergence of Stx-producing pathogens and since the emergence of E. coli O157:H7 as a cause of significant human disease, more than 500 different serogroups of E. coli have been reported to produce Shiga toxin, as well as a few other organisms [14, 15]. ESCHERICHIA COLI AS A COMMENSAL Commensal intestinal microbiota (normal microbiota, indigenous microbiota) consists of those micro-organisms, which interact with epithelial cells and are exposed to the external environment [16]. The adult gastrointestinal tract

Overview of Escherichia coli

Pathogenic Escherichia coli in Latin America 3

acquires at least 17 families of bacteria yielding 400 to 500 different microbial species with regional variation of bacterial composition within the gastrointestinal tract. In general, there is a qualitative and quantitative increase in complexity from the stomach to the colon with the colon as the primary site for commensal bacterial colonization in humans and animals. Commensal bacteria co-evolved with their hosts, however, under specific conditions they are able to overcome protective host responses and exert pathologic effects [17]. E. coli is part of the commensal flora and a normal inhabitant of the human gut, but is also the Gram-negative bacillus most frequently isolated in cases of human infection [18]. It has been postulated that commensal enteric E. coli may be the natural reservoir of pathogenic strains, because this normally harmless commensal needs only to acquire a combination of mobile genetic elements to become a highly adapted pathogen capable of causing a range of diseases, from gastroenteritis to extraintestinal infections of the urinary tract, bloodstream and central nervous system [19]. Indeed, intestinal or extraintestinal E. coli infections are caused by strains harboring numerous virulence factors located on plasmids, bacteriophages, transposons and pathogenicity islands [20]. The ubiquitous commensal population constitutes an enormous reservoir from which pathogenic strains continually emerge. The ability to E. coli to exist as a humanadapted commensal compounded with its natural tendency for frequent genetic exchange, its ubiquitous presence, and the enormous, diverse, and largely uncharacterized reservoir of genetic variation found within the species genomes, contribute to the emergence of new pathogenic strains and potentially resistant to antimicrobial drugs. Several studies have shown that pathogenic E. coli strains may be derived from commensal strains by the acquisition of chromosomal or extra-chromosomal virulence loci [21], “pathoadaptive mutations” which are genomic deletions that enhance pathogenicity [22]; or random point mutations that increase adaptation for pathogenic environments [23]. These strategies of genome plasticity for a commensal strain to become virulent has led to the hypothesis indicating that the fecal E. coli population may influence the occurrence and etiology of extraintestinal and intestinal infections because E. coli populations have a clonal structure [24]. Phylogenetic analyses have shown that E. coli strains fall into four main phylogenetic groups (A, B1, B2, and D [25], and these classification are utilized to perform rapid and simple classification of pathogenic E. coli [26]. The assignment of E. coli clones to one of these four groups is the basis of phylogenetic studies of the species [27]. For example, it has been found that Shigella clones are derived from E. coli outside the phylogenetic groups B2 and A [28], while Shiga toxin-producing E. coli O157:H7 clones belong to phylogenetic group D [26]. In contrast, the clones responsible for human extraintestinal infections frequently belong to the anciently diverged B2 phylogenetic group [29]. Recent evidence indicates that commensal and pathogenic bacteria can also participate in the pathogenesis of the inflammatory bowel diseases [17]. Although there is no evidence that a single pathogen causes Crohn's disease or ulcerative colitis, it has been observed that increased numbers of mucosa-associated E. coli are observed in both major inflammatory bowel diseases. As a result, a new pathovar of E. coli, designated Adherent-Invasive E. coli (AIEC) has been found associated with ileal Crohn's disease. AIEC strains colonize the intestinal mucosa by adhering to intestinal epithelial cells, displaying the ability to invade them via a macropinocytosis-like process, and to survive and replicate intracellularly. Within macrophages, AIEC strains survive and replicate extensively without inducing host cell death and induce the release of high amounts of TNF [30]. All these virulence properties designate AIEC as a possible pathogen potentially able to induce persistent intestinal inflammation, further supporting the idea that commensal E. coli are a natural reservoir of pathogenic strains. ESCHERICHIA COLI AS AN ANTIBIOTIC RESISTANCE RESERVOIR IN THE MICROBIOME The human microbiome substantially impacts human health and plays beneficial roles in dietary processing and prevention of pathogen intrusion [31-33]. The widespread use of antibiotics in human medicine and agriculture has likely induced substantial responsive changes in this community. Many commensal bacterial species, which were once considered relatively harmless residents of the human microbiome, have recently emerged as multidrugresistant disease-causing organisms [34]. E. coli, as indicator bacteria, it is useful because this microorganism acquires antimicrobial resistance faster than other conventional bacteria. Thus, changes in the resistance of this species may serve as a good indicator of resistance in potentially pathogenic bacteria [35, 36]. Plasmids are genetic elements, not virulence factors per se, that can be transmitted between bacteria. Plasmids encode genes for a variety of factors that contribute to pathogenesis, including antibiotic resistance, fimbriae, toxins, secretion systems, and invasion factors. Transmission of plasmids plays a large role in the growing problem of antibiotic resistance [37]. An overview of the major

4 Pathogenic Escherichia coli in Latin America

Torres et al.

plasmid families that are currently emerging in multidrug-resistant Enterobacteriaceae strains isolated worldwide among those conferring resistance to clinically relevant antibiotics, such as extended-spectrum cephalosporins, fluoroquinolones, and aminoglycosides has been recently published [38]. Acquisition of antibiotic resistance genes by non-pathogenic bacteria is detrimental for two reasons. First, these bacteria will constitute a reservoir of antibiotic resistance genes (and antibiotic resistance vectors) that may be transferred to virulent bacteria. Second, antibiotic-resistant bacteria can protect the susceptible ones (eventually pathogenic) from the action of antibiotics [39]. Conversely, acquisition and further spread of antibiotic resistance genes among pathogenic bacteria is a phenomenon that has occurred just in the last 50 years as a consequence of extensive antibiotic use for human therapy and animal farming. At first glance, pathogenicity and resistance should be unlinked phenomena. However, several examples indicate that this is not the situation for several bacterial pathogens. Antibiotic resistance and virulence genes can be linked (and then co-selected) in the same replicon, or eventually a single determinant can be involved in both virulence and resistance [39]. For example, the EHEC virulence plasmid pO26-CRL contains a complex antibiotic-resistance gene locus located between virulence determinants, such as the enterohemolysin operon (ehxCABD) and the STEC-specific extracellular serine protease (espP) [40]. This region encompasses a 22,609 bp Tn21 derivative encoding resistance to trimethoprim, streptomycin, sulfathiozole, kanamycin, neomycin, -lactams, and mercuric chloride. Plasmid pO26-CRL is nonconjugative but is mobilizable and raises the concern that antibiotic use could be co-selected with the virulence determinants, leading to increase disease potential in both commensal and pathogenic E. coli populations [40]. The widespread use of antimicrobial agents that are regarded as critically or highly important for use in humans creates a reservoir of resistant bacteria and antibiotic resistance genes, which adds to the burden of antimicrobial resistance in human medicine and may shorten the time that these valuable antimicrobial agents will be available for effective treatment of human infections. Humans may obtain antimicrobial-resistant E. coli or antibiotic resistance genes of animal origin directly, via contact with animals, food of animal origin, or the environment. These bacteria may subsequently colonize humans or may transfer resistance genes to other bacteria during passage through the intestinal tract. Although the carriage of antimicrobial-resistant E. coli in the intestine is not a human health hazard itself, it might give rise to bacterial infections with limited therapeutic options and an increased risk of treatment failure. The contribution of the animal reservoir to the burden of antimicrobial resistance in humans has not been quantified; however, the use of antimicrobial agents considered as a critical or highly important for humans use should be avoided or minimized in food animals, to preserve the efficiency of these antimicrobial agents for treatment of infection in humans [41]. Evidence is accumulating to support the hypothesis that intestinal bacteria not only exchange resistance genes among themselves but might also interact with bacteria that are passing through the colon, causing these bacteria to acquire and transmit antibiotic resistance genes. By significantly expanding comparative genomics to a population scale, we will peer into the E. coli population, with previously unattainable resolution, and identify the genetic pathways leading to the emergence of human-adapted, pathogenic strains. ESCHERICHIA COLI AS AN ENTERIC PATHOGEN In the United States, for example, E. coli is the leading cause of both community-acquired and nosocomial Urinary Tract Infections (UTI). E. coli also causes 12-50% of nosocomial infections and 4% of cases of diarrheal disease. In tropical countries, in contrast, E. coli infections are one of leading causes of diarrhea, responsible in some situations for up to 40% of cases of infant or traveler's diarrhea. These infections are traditionally acquired after the consumption of contaminated meat obtained from a variety of animal species, other food products and water. Historically, serotyping was important in distinguishing the small number of strains that actually cause diarrheal disease. Some serotypes of these enteric organisms have been related to emergent zoonotic infections in developed and developing countries. Currently, with over 700 antigenic types (serotypes) of E. coli (which are recognized based on O, H, and K antigens) and with increasing number of serotypes associated with disease, the pathogenic E. coli are now also classified based on their unique virulence factors and adherence properties. Analysis for pathogenic E. coli usually requires that the isolate first be identified as E. coli by testing for metabolic characteristics and virulence markers before the serotype is determined. When an outbreak is suspected, it is necessary to differentiate the pathogenic E. coli isolates from commensal E. coli, because they are indistinguishable at the

Overview of Escherichia coli

Pathogenic Escherichia coli in Latin America 5

biochemical level and, therefore, additional tests to those traditionally performed in the clinical laboratory are required to identify the specific isolate [42, 43]. For the diagnostic of pathogenic E. coli, some of the following methodologies are required: a) serotypification; b) adherent assays on HEp-2 cells; c) FAS test (Fluorescent Actin Staining); d) different molecular biology techniques to amplify genes encoding specific virulence factors [42-44]. One of the phenotypic diagnostic test is the adherence assay on HEp-2, which allows the identification of distinct pattern of bacterial adherence on the cells, namely, Localized, Localized Adherence-Like, Diffuse and Aggregative adherence [45, 46]. The second phenotypic assay is the FAS test, which is an alternative technique utilized in epidemiological studies and basic research [47]. In this assay, the accumulation of host cell cytoskeleton actin underneath the adherent bacteria is observed, and this accumulation is due in response to bacterial secreted factors. The FAS test can be utilized in: a) direct way on intestinal biopsies in patients with diarrhea and where is suspicion of a E. coli infection; b) with tissue cultured cells (HEp-2, HeLa, or Caco-2) infected with an E. coli strain isolated from infected feces [42, 47, 48]. The adherence assay and the FAS test are sufficient to identify some of the categories of E. coli listed in the subsequent chapters, however, additional molecular test to identify specific virulence factors are required to have a complete idea about the pathogenic capabilities of the strains. As a cause of enteric infections, different pathogenic mechanisms of 6 different categories of E. coli have been reported [14, 42]. Enterotoxigenic E. coli (ETEC) is a major cause of travelers’ diarrhea in adults from industrialized countries and children in developing countries worldwide. Enteropathogenic E. coli (EPEC) is a cause of infant diarrhea in developing countries. Enterohemorrhagic E. coli (EHEC), a food-borne pathogen of worldwide importance, can cause a non-bloody diarrhea but the most serious manifestation of disease is bloody diarrhea that can progress to a fatal illness due to acute kidney failure (hemolytic uremic syndrome [HUS]), particularly in children. Enteroaggregative E. coli (EAEC) were originally recognized as predominant etiologic agents of persistent diarrhea in developing countries and still remain an important cause of acute as well as protracted diarrhea in several parts of the world, including industrialized countries. Enteroinvasive E coli (EIEC) cause a watery diarrhea and dysentery in humans and, interestingly since EIEC are closely related to Shigella spp, the knowledge regarding EIEC virulence has been mainly extrapolated from the studies in Shigella. Finally, diffusely adhering E. coli (DAEC) strains are characterized by their diffuse adherence pattern on cultured epithelial cells, however, as compared with the other categories; little is known about the mechanism of DAEC pathogenesis. In the human intestine, ETEC, EPEC, EAEC colonize the small intestine, while EIEC and EHEC preferentially colonize the large bowel prior to causing diarrhea. Because of a large number of DAEC serotypes are associated with this category; the exact location for intestinal colonization of this pathogen has not been defined. ESCHERICHIA COLI: THE INTEND OF THIS BOOK In Latin America, acute gastroenteritis remains to be an important cause of morbidity in adults and a major cause of morbidity and mortality in children. A child under 5 years of age belonging to a low income segment of the Latin American population will develop 5 to 10 episodes of diarrhea every year [49]. Even with the impressive progress done to understand pathogenic mechanisms of enteric bacterial pathogens, at least one-third of all diarrheal cases in this region are still associated with the different categories of pathogenic E. coli. The rapid expansion of this field has been fueled by the continual emergence and re-emergence of new E. coli strains as a global public health problem; indeed, few infectious diseases have generated more sustained attention from the scientific and, notably, the lay media because the ability of some of the strains (e.g. E. coli O157:H7) to cause important outbreaks. The authors of this chapter believe that the field of pathogenic E. coli in Latin America was in great need of, the comprehensive review that this book represents. Although other books have been written about pathogenic E. coli, their focus generally has been the research progress in other parts of the world; this is the first volume, to our knowledge, with a nearly complete coverage of the pathogenesis, epidemiology, diagnostic, therapeutics, animal reservoirs, mechanism of action, host-pathogen interactions, and other aspects associated with E. coli intestinal infections, with special emphasis to the situation in Latin America. This book combines and illuminates several years of tenacious study of pathogenic E. coli by multiple research groups in Latin America. The goal was to integrate the diverse aspects of the E. coli research performed in the majority of the countries in this region toward a unified view of how these E. coli infections continue been such a serious threats to humans.

6 Pathogenic Escherichia coli in Latin America

Torres et al.

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33]

Escherich T. Die darmbakterien des neugeborenen und sauglings. Fortshr Med 1885;3:5-15-522,47-54. Conway PL. Microbial ecology of the human large intestine. In: Gibson GR, Macfarlane GT, editors. Human colonic bacteria: role in nutrition, physiology and pathology. Boca Raton, FL.: CRC Press; 1995. p. 1-24. Ewing WH. Identification of Enterobacteriaceae. 4th ed ed. Edwards, Ewing, editors. New York: Elsevier; 1986. Shiloach J, Reshamwala S, Noronha SB, et al. Analyzing metabolic variations in different bacterial strains, historical perspectives and current trends - example E. coli. Curr Opin Biotechnol. 2010;Jan 28 [Epub ahead of print]. Leclerc H, Mossel DA, Edberg SC, et al. Advances in the bacteriology of the coliform group: their suitability as markers of microbial water safety. Annu Rev Microbiol. 2001;55:201-34. Simpson JM, Santo Domingo JW, Reasoner DJ. Microbial source tracking: state of the science. Environ Sci Technol. 2002;36:5279-88. APHA. Compendium of Methods for the Microbiological Examination of Foods. 3rd ed ed. Washington, DC: American Public Health Association; 1992. APHA. Standard Methods for the Examination of Water and Wastewater. 20th ed ed. Washington, DC: American Public Health Association; 1998. Wohlsen T, Bates J, Vesey G, et al. Evaluation of the methods for enumerating coliform bacteria from water samples using precise reference standards. Lett Appl Microbiol. 2006;42:350-6. Huang SW, Chang CH, Tai TF, et al. Comparison of the beta-glucuronidase assay and the conventional method for identification of Escherichia coli on eosin-methylene blue agar. J Food Prot. 1997;60:6-9. CDC. Diagnosis and management of foodborne illnesses: a primer for physicians and other health care professionals. MMWR. 2004;53:352-6. Erickson MC, Doyle MP. Food as a vehicle for transmission of Shiga toxin-producing Escherichia coli. J Food Prot. 2007;70:2426-49. Pearson H. The dark side of E. coli. Nature. 2007;445:8-9. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123-40. Zhou Z, Li X, Liu B, et al. Derivation of Escherichia coli O157:H7 from its O55:H7 precursor. PLoS One. 2010;5:e8700. Yan F, Polk DB. Commensal bacteria in the gut: learning who our friends are. Curr Opin Gastroenterol. 2004;20:565-71. Packey CD, Sartor RB. Commensal bacteria, traditional and opportunistic pathogens, dysbiosis and bacterial killing in inflammatory bowel diseases. Curr Opin Infect Dis. 2009;22:292-301. Duriez P, Clermont O, Bonacorsi S, et al. Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiology. 2001;147:1671-6. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol. 2010;8:26-38. Mühldorfer I, Hacker J. Genetic aspects of Escherichia coli virulence. Microb Pathog. 1994;16:171-81. Finlay BB, Falkow S. Common themes in microbial pathogenicity revisited. Microb Mol Biol Rev 1997;61:136-69. Torres AG. The cad locus of Enterobacteriaceae: more than just lysine decarboxylation. Anaerobe. 2009;15:1-6. Sokurenko EV, Hasty DL, Dykhuizen DE. Pathoadaptive mutations: gene loss and variation in bacterial pathogens. Trends Microbiol. 1999;7:191-5. Selander RK, Levin BR. Genetic diversity and structure in Escherichia coli populations. Science. 1980;210:545-7. Herzer PJ, Inouye S, Inouye M, et al. Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates of Escherichia coli. J Bacteriol. 1990;172:6175-81. Clermont O, Bonacorsi S, Bingen E. Rapid and Simple Determination of the Escherichia coli Phylogenetic Group. Appl Environ Microbiol. 2000;66:4555–8. Pupo GM, Karaolis R, Lan R, et al. Evolutionary relationship among pathogenic and non pathogenic Escherichia coli strains inferred from multilocus enzyme electrophoresis and mdh sequence studies. Infect Immun 1997;65:2685-92. Pupo GM, Lan R, Reeves PR. Multiple independent origins of Shigella clones of Escherichia coli and convergent evolution of many of their characteristics. Proc Natl Acad Sci USA. 2000;97:10567-72. Picard B, Sevali-Garcia J, Gouriou S, et al. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999;67:546-53. Rolhion N, Darfeuille-Michaud A. Adherent-invasive Escherichia coli in inflammatory bowel disease. Inflamm Bowel Dis. 2007;13:1277-83. Gill SR, Pop M, Deboy RT, et al. Metagenomic analysis of the human distal gut microbiome. Science. 2006;312:1355-9. Turnbaugh PJ, Hamady M, Yatsunenko T, et al. A core gut microbiome in obese and lean twins. Nature. 2009;457:480-4. Jia W, Li H, Zhao L, et al. Gut microbiota: a potential new territory for drug targeting. Nat Rev Drug Discov. 2008;7:123-9.

Overview of Escherichia coli

[34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49]

Pathogenic Escherichia coli in Latin America 7

Marshall BM, Ochieng DJ, Levy SB. Commensals: Underappreciated Reservoir of Antibiotic Resistance. Microbe. 2009;4:231. Kijima-Tanaka M, Ishihara K, Morioka A, et al. A national surveillance of antimicrobial resistance in Escherichia coli isolated from food-producing animals in Japan. J Antimicrob Chemother. 2003;51:447–51. Von Baum H, Marre R. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int J Med Microbiol. 2005;295:503–11. Prats G, Mirelis B, Miro E, et al. Cephalosporin-resistant Escherichia coli among summer camp attendees with salmonellosis. Emerg Infect Dis. 2003;9:1273-80. Carattoli A. Resistance Plasmid Families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53:2227–38. Martínez JL, Baquero F. Interactions among Strategies Associated with Bacterial Infection: Pathogenicity, Epidemicity, and Antibiotic Resistance. Clin Microbiol Rev. 2002;15:647–79. Venturini C, Beatson SA, Djordjevic SP, et al. Multiple antibiotic resistance gene recruitment onto the enterohemorrhagic Escherichia coli virulence plasmid. FASEB J. 2010;24:1160-6. Hammerum AM, Heuer OE. Human Health Hazards from Antimicrobial-Resistant Escherichia coli of Animal Origin. Clin Infect Dis. 2009;48:916–21. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. Rodríguez-Ángeles G. Principal characteristics and diagnosis of the pathogenic groups of Escherichia coli. Salud Publica Mex. 2002;44:464-75. Cravioto A, Vasquez V. Escherichia coli: pathogenic mechanisms and enterohemorrhagic strains. Bol Med Hosp Infant Mex. 1988;45:196-7. Cravioto A, Gross RJ, Scotland SM, et al. An adhesive factor found in Escherichia coli belonging to the traditional infantile enteropathogenic serogroups. Microbiology. 1979;6:3427-37. Torres AG, Zhou X, Kaper JB. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun. 2005;73:18-29. Knutton S, Baldwin T, Williams PH, et al. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 1989;57:1290-8. Knutton S, Lloyd DR, McNeish AS. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect Immun. 1987;55:69-77. Prado V, O'Ryan ML. Acute gastroenteritis in Latin America. Infect Dis Clin North Am. 1994;8:77-106.

8

Pathogenic Escherichia coli in Latin America, 2010, 8-24

CHAPTER 2 Evolution and Epidemiology of Diarrheagenic Escherichia coli Nina D Williams1, Alfredo G Torres1,2 and Sonja J Lloyd1,* 1

Department of Microbiology and Immunology and 2Department of Pathology and the Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555-1070. Abstract: The emergence and evolution of pathogenic Escherichia coli strains associated with diarrheal diseases have become a topic of active investigation in recent years due to the emergence of more virulent strains and the association of new serotypes with disease. Outbreak studies indicate that most patients with an intestinal E. coli infection develop mild, uncomplicated diarrhea. However, a significant risk exists that infections caused by highly virulent E. coli isolates, such as the enterohemorrhagic E. coli O157:H7, develop into serious and potentially life-threatening complications, such as hemolytic uremic syndrome. The relative contribution of recombination events in the generation of new categories of pathogenic E. coli varies among the E. coli population, and it is represented by the wide variety of mobile elements found in different diarrheal strains (e.g. pathogenicity islands, phages, transposons, pathoadaptive mutations, etc). Understanding the population structure of pathogenic E. coli is important, since it impacts the effectiveness of molecular epidemiological studies. Such studies are needed to understand the increasingly recognized diversity of enterotoxigenic E. coli, a leading cause of pediatric and travelers’ diarrhea. In addition, factors underlying the emergence of enteroaggregative and atypical enteropathogenic E. coli strains associated with persistent diarrhea are unknown. Horizontal transfer of genetic elements that affect virulence of diarrheagenic E. coli strains and changes in global agricultural processes, as well as movement of humans and animals, may contribute to the complex natural history of diarrheagenic E. coli.

INTRODUCTION TO E. COLI EVOLUTION Biologists have long considered the mechanisms behind genetic variation and how it arises and persists. Organisms must have a balance between robustness and evolution capability, between an individual’s physiological responses to change and the changes by which a population of genomes continuously updates information about past experiences and how future generations should respond to those influences [1]. Adaptation has been historically viewed as a gradual process. Early studies led to two generalizations concerning the emergence and persistence of this variation. First, competition for the same limiting resources selects for the one fittest variant. Second, variation arising from mutations is subject to “periodic selection,” which leads to a succession of clones each more fit than its predecessor [2]. Now, experimental evidence demonstrates how one clone of Escherichia coli adapts to a particular environmental factor and suggests that multiple genotypes can arise from a single ancestral clone and can co-exist over time – that in other words, out of one comes many [2]. Empirical evidence has been found for alternating periods of stasis and rapid evolution[3]. Environmental changes are an insidious part of an organism’s life, and the mechanisms that allow adjustment to environmental conditions will compensate for the effects of the mutations required to produce that phenotype. Selection may favor mutants better adapted to particular regions or those that are better able to colonize niches at the boundaries of these regions. Selection may also favor clones that can better scavenge limited resources or more efficiently use those resources for essential processes. The outcome is dependent upon the founding ancestral clone, the pathways which lead to the different adaptive strategies, the influence of differential gene regulation on the evolutionary process, and the likelihood that key steps along these pathways will actually occur (i.e. mutations). Variation in the adaptation rate may be as a result of environmental changes, the invasion of new habitats, and other circumstances which either promote or inhibit gene flow[3]. Evolution at the molecular level is now known to have arisen from many directions: single base changes; loss, duplication, or rearrangement of genes; and, importantly, the horizontal transfer of genes [4]. Current ideas concerning bacterial evolution center on the idea that pathogenic diversity is the result of the acquisition of pathogenic genes, or virulence determinants, through horizontal gene transfer. E. coli is a good model *Address correspondence to: Sonja J. Lloyd, Department of Microbiology and Immunology, University of Texas Medical Branch, 301 University Blvd, Galveston, Texas 77555-1070; Tel (409) 747-2424. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 9

for addressing this question as it is the best known member of the normal microbiota of the human intestine and is the most intensively studied and best understood of all bacteria. The reference strain K-12 and its derivatives have been vital in the advancement of the fields of genetics, molecular biology, and physiology. Investigations of E. coli virulence have revealed a wealth of information regarding the emergence and evolution of these pathogens. Comparison of the genomic sequences of the non-pathogenic laboratory strain K-12 with that of E. coli O157:H7 has shown that these strains share a common DNA backbone, with numerous islands of DNA that were apparently acquired over an extended period of time through horizontal gene transfer [5]. The ongoing and stepwise evolution of E. coli allows it to adapt to constantly changing conditions and environments and ensures the emergence of new pathogenic clones. In a study to better understand the genetic relationships of commensal and pathogenic E. coli strains, multilocus enzyme electrophoresis (MLEE) was used at 10 enzyme loci to determine the genetic diversity of E. coli and the relationship of pathogenic clones to commensal clones. Results showed that pathogenic E. coli strains do not have a single evolutionary origin but have actually arisen several times [6], likely due to the lateral transfer of specific virulence factors which are subject to strong natural selection. E. coli is a diverse species with both commensal and pathogenic strains. E. coli strains may not have always been pathogenic; the one common ancestor evolved into pathogenic strains due to the acquisition of mobile genetic elements such as plasmids and pathogenicity islands (PAIs), as well as due to integration of bacteriophages and transposons. Changes in microbial populations can lead to the evolution of entirely new pathogens, development of new virulent strains in old pathogens, adaptation to new niches, the development of antibiotic resistance, or to changes in the ability to survive in adverse environmental conditions. The virulence determinants encoded on these mobile genetic elements are supposed to be highly interchangeable among bacterial species, and though initially mobile may become ‘locked’ into the genome [7]. Each pathotype of E. coli has unique virulence mechanisms, with the exception of enterohemorrhagic E. coli (EHEC), which is a clonal group derived from enteropathogenic E. coli (EPEC) [8]. Physiologically, E. coli is versatile and well adapted to its characteristic habitats, and can respond to environmental signals such as pH, temperature, osmolarity, as well as a multitude of other stimulants. There are several highly adapted clones that have acquired specific virulence elements which confer an increased ability to adapt to new niches. Diseases caused or effects of infection depend on the distribution and expression of the specific array of pathogenic (virulence) determinants possessed by the organism, including adhesins, secretion systems, and toxins, and the ability to withstand host defenses. The very diversity of E. coli and its pathogenic clones is due to the continued arrival of different virulence determinants into the population, from other E. coli species or other enteric pathogens such as Salmonella, Shigella, and Yersinia. This again emphasizes the idea that pathogenic E. coli do not originate from a single ancestor, but instead have arisen several times from several ancestors [9]. Virulence Determinants, How They Are Acquired How do bacteria adapt to the life-style of a pathogen? Ecological niches that non-pathogenic bacteria might inhabit, such as soil, are very different from the niches encountered upon infecting a vertebrate host [5]. These hosts have defenses that have evolved through co-evolution with microbes – physical barriers, such as the skin and the mucuscovered epithelia, up to the more elaborate antimicrobial peptides and immune responses enacted by the host. The factors and mechanisms that pathogens have evolved to circumvent these defenses are termed virulence factors. Several highly adapted E. coli clones have acquired specific virulence attributes, which has conferred upon them the ability to adapt to new niches and thus cause a spectrum of diseases [10]. The virulence determinants of each E. coli pathotype are distinct, but can generally be categorized as either colonization factors or secreted proteins. The colonization factors, such as adhesins, enable the bacteria to bind closely to the intestinal mucosa and resist clearance. Most frequently, these adhesins form distinct structures on the bacterial cell surface termed fimbriae or pili, though they also include outer-membrane proteins such as intimin in EPEC and EHEC, and other non-fimbrial proteins. Secreted proteins, including toxins and other effector proteins, interfere with the normal physiological processes of host cells such as protein synthesis and the regulation of intracellular messengers such as cAMP and cGMP. By one means or another, pathogenic strains of E. coli have perfect mechanisms to acclimate to new environmental pressures and to survive in novel niches which they previously did not inhabit, consequently causing damage to host tissues and leading to disease. Genes can be taken up as naked DNA or transferred in the form of

10 Pathogenic Escherichia coli in Latin America

Williams et al.

plasmids, conjugative transposons, or bacteriophages, and the transferred DNA can range in size from less than 1 to more than 100 kb, and encode entire metabolic pathways [5]. Virulence is often conferred to bacteria by pathogenicity islands, which refer to clusters of virulence-associated genes that are found on the chromosomes of pathogenic bacteria but are absent from non-pathogenic strains. These islands often show evidence of having been acquired from other bacteria [11], including a nucleotide base composition different from the native chromosome in general and possibly the presence of mobile genetic elements at the termini. These fragments of genetic material can lead to increased virulence or even change a non-pathogenic organism to a pathogen. Bacteriophages, the viruses that infect bacteria, are important vehicles for horizontal gene exchange between different bacterial species and account for a good share of the strain-to-strain differences within bacterial species, such as E. coli. Studies have indicated that some pro-phages carry additional genes (termed lysogenic conversion genes) that are not required for the phage life cycle. Instead, many lysogenic conversion genes from prophages in pathogenic bacteria encode proven or suspected virulence factors. They are postulated to change the phenotype or fitness of the lysogen [5]. Phages have thus emerged as prime suspects in the adaptation of pathogens to new hosts and the emergence of new pathogens or epidemic clones. Phages can also serve as anchor points for genome rearrangements, and protect a bacterium from lytic phage infection, and, most importantly, have the ability to introduce new virulence factors. Transposable elements are discrete DNA segments that have the ability to move from site to site in a genome, independent of extensive DNA sequence homology [12]. These transposable elements often cause spontaneous mutations, regulate the expression of genes near their insertion sites, and induce cycles of chromosome breakage and rearrangement. They play a special role in bacterial evolution because of their ability to move between the chromosome and the various plasmid and phage DNAs resident in a bacterial cell and, when piggybacked on these molecules, to move between unrelated bacteria in a population. Virtually, any gene can become associated with a transposable element, and elements called transposons containing genes whose functions are unrelated to movement are now common. It has been suggested that, especially during periods of drastic environmental change, transposable elements make great contributions to the adaptability and evolution of bacterial populations [12]. Besides pathogenicity islands, bacteriophages, and transposons, plasmids play an important role in the transfer of genetic information between clones. Bacterial plasmids are self-replicating, extrachromosomal replicons and are key agents of change in microbial populations. Naturally occurring plasmids are able to promote the dissemination of a variety of traits, from antibiotic resistance to the ability to metabolize certain substances, and recombinant plasmids based off these wild type plasmids have been essential to the field of molecular biology. E. coli strains have been found to possess a wide variety of plasmid types, including those associated with virulence. Some of these are essential for virulence in the various pathotypes of E. coli, and it has been shown that the majority of these E. coli virulence plasmids have evolved from a single plasmid backbone type through the acquisition of traits that are essential for and specific to the particular pathotypes [13]. E. coli Pathotypes Though E. coli are historically classified based on the serology of the O (lipopolysaccharide, LPS) and H (Hauch, flagellar) antigens, more recently the terms virotype and/or pathotype have been used, to refer to a group of strains of a single species that cause a common disease using a common set of virulence factors. Only the most successful combination of virulence factors have persisted to become specific pathotypes, and each pathotype represents a family of E. coli clones that share virulence determinants, which were acquired by horizontal gene transfer between E. coli and other bacterial species [10-11]. Individual strains of each pathotype possess a distinct set of virulenceassociated characteristics that determine the pathological and clinical features of the diseases they cause; only the most successful combinations of virulence factors persist to become specific pathotypes. There are more than 180 O serogroups of E. coli, each of which is further subdivided into more than 60 H serotypes, to give more than 10,000 possible combinations [11]. The clonal nature of these pathogenic bacteria is seen in the fact that they generally belong to distinctive O serogroups and O:H serotypes and has recently been inferred by sequencing studies and multilocus enzyme electrophoresis (MLEE) of different E. coli clones [6].

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 11

Eight distinct pathotypic categories (also known as pathovars) of E. coli have been described, which are broadly classified into diarrheagenic E. coli (DEC) or extraintestinal E. coli (ExPEC). Two pathovars are extraintestinal, the uropathogenic E. coli (UPEC), and the neonatal meningitis E. coli (NMEC). Six pathovars are diarrheagenic: enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), and diffusely-adhering E. coli (DAEC) (Fig. 1) [10]. Several evolutionary events have permitted the differentiation of the different pathovars. For example, EPEC produce a characteristic intestinal histopathology known as the attaching and effacing (A/E) lesion, and the ability to form this lesion is conferred by the chromosomally-located Locus of Enterocyte Effacement (LEE) Pathogenicity Island. The LEE is in fact present in a family of pathogens, including EHEC, all able to confer the attaching and effacing lesion [10, 14]. EPEC also produce a type IV pilus, known as the bundle-forming pilus (BFP), expressed from 14 genes on a virulence-associated plasmid (pEAF) carried by certain EPEC strains [15-16]. Bundle-forming pili are thought to mediate both initial binding to host cells and interbacterial interactions leading to the formation of three-dimensional microcolonies of attached bacteria [17]. In the case of EHEC, this pathovar is distinguished from other strains on the ability to produce Shiga toxins (Stx), the key virulence determinant for these strains, which is transmitted among Shigella and E. coli strains by toxinencoding bacteriophages [18]. For EPEC and EHEC, the majority of virulence determinants are encoded on ‘O’ islands or plasmids and so these were the focus for comparison. Analysis of the originally described 177 ‘Ospecific’ islands provides insights into the evolution of the two strains[19]. Homologous sequences can be demonstrated for nearly all the ‘O157’ islands in EPEC E2348/69, with only 14 showing little nucleotide homology (below 55%). Sixty-nine of the islands have 49% nucleotide homology [17]. This divergence offers considerable range for differences in the carriage and expression of virulence determinants. Therefore, variation in these Oislands impacts host adaptation, tissue tropism and virulence and this assumption is a simplification that belies the evolution adapting the strains to different hosts and the complex interactions on the host mucosa that lead to an asymptomatic or pathogenic outcome. In addition, not all strains of Stx-producing E. coli are able to cause the more serious clinical syndromes associated with EHEC infection. Those that can usually carry other virulence determinants in addition to Stx, such as the LEE pathogenicity island or a distinctive hemolysin known as enterohemolysin or EHEC hemolysin [10-11]. In fact, the only E. coli pathotypes that share virulence determinants are EPEC and EHEC, likely because EHEC strains have evolved from EPEC ancestors [20-22]. This demonstrates the compound effect that multiple virulence determinants can have on a pathogen. For ETEC strains to cause disease, they must attach to the epithelia of the small intestine, colonize, secrete either of both of two varieties of enterotoxin, the heat-labile enterotoxin (LT) and heat-stable enterotoxin (ST), and evade host defenses while causing damage to the host. ETEC adhesins, known as colonization factors (CFs), allow binding to the small intestinal mucosa – a region where E. coli normally does not display tropism. Human ETEC CFs can be either plasmid or chromosomally encoded; however the majority are plasmid-encoded and appear to have been horizontally-acquired due to the presence of flanking insertion sequences and transposons [13]. The colonization factors themselves have undergone extensive evolution, resulting in at least 22 human ETEC CF genetic variants. For example, the pCOO plasmid was the first ETEC CF-encoding plasmid to be sequenced. Isolated from strain C921b-1, this plasmid encodes the CS1 and CS3 variants of CFs [13]. Genome sequencing of ETEC strain E24377A showed this strain has six plasmids, ranging in size from 5 to 80Kb. The CS1 antigen of this strain is encoded on the pETEC_73 plasmid, which is similar to the pCOO plasmid in its possession of CS1 and in the RepI1 backbone of the plasmid. This indicates that the CS1 operon was introduced into an ancestral plasmid and maintained by certain strains, prior to the integration of RepFIIA components into the pCOO plasmid [13] and its maintenance in other ETEC strains. Indeed, the presence of other CF-encoding plasmids with the same Rep backbones, such as the CFA/I on the pH10407_95 plasmid from strain H10407, further suggests that the ETEC CF operons have been acquired on multiple occasions on multiple plasmid backbones. EAEC is another pathovar which is a very heterogeneous pathogen and a complicating factor is that some EAEC strains are pathogenic while others are not. These strains are often recovered from apparently healthy individuals and there was a failure of some studies to show a correlation between EAEC and disease [23]. Although three major EAEC phylogenetic groups, EAEC1, EAEC2, and AA/DA (aggregative adherence/diffuse adherence) have been

12 Pathogenic Escherichia coli in Latin America

Williams et al.

identified on the basis of multilocus enzyme electrophoretic (MLEE) patterns, EAEC phylogeny overlaps with the also heterogeneous DAEC group [24]. However, members of each of the three clusters show conserved plasmid and chromosomal loci, suggesting the most EAEC, like other pathotypes of diarrheagenic E. coli, show a conserved linkage of virulence genes [23]. The primary virulence factor of EAEC is the aggregative adherence phenotype, which is associated with aggregative adherent fimbriae (AAF) and localized to a 55-65MDa plasmid, the pAA plasmid [13]. Similar to the ETEC colonization factors (CFs), EAEC adhesins are multiple and diverse and allelic variants of AAF have been identified. A study by Jenkins et al. differentiated two groups of EAEC on the basis of the presence or absence of genes on the pAA plasmid, and thus designates “typical” and “atypical” EAEC with typical strains possessing pAA-associated genes, including aggR, as well as certain chromosomal islands that are apparently co-inherited[25]. Another EAEC virulence factor identified as a putative cause of diarrhea was the enteroaggregative heat-stable toxin EAST-1[26]. This toxin activates guanylate cyclase and causes ion secretion; however, no association has been identified between EAST-1 and diarrheal illness, and EAST1 has been detected in other diarrheagenic E. coli pathotypes. Three plasmids from EAEC strains have been completely sequenced: pO42, which belongs to the AAF/II+ strain O42; 55989p, which belongs to AAF/III+ strain 55989; and pO86A1, which has a novel AAF-like operon [13]. Finally, there are no known pathogenicity islands in EAEC; however, islands associated with other members of the family Enterobacteriaceae have been found in EAEC. Examples include a hemolysin-pyleonephritis-associated pili island associated with ExPEC and the high pathogenicity island originally described in Yersinia, which has genes for the synthesis of the siderophore yersiniabactin and its uptake protein [23]. Commensal E. coli LEE PAI (Intimin) Lpf fimbriae

CF As PAI

Atypical EPEC

LT/ST Enterotoxins

EHEC plasmid

EAF plasmid (Bfp)

Shi PAI

pAA plasmid

Inv plasmid

Afa/Dr fimbriae

Enterotoxins

Stx genes CFA

EIEC ETEC Bfp Lpf

Typical EPEC

EHEC STEC

Afa/Dr

EAEC

DAEC

Figure 1: Escherichia coli encompass a continuously evolving group that includes both commensal and pathogenic strains. The pathogenic diversity of E. coli is a result of deletion or acquisition of genes, which confer virulence properties to different bacterial isolates. Only the most successful combinations of virulence factors, commonly encoded on mobile genetic elements, have persisted to become part of specific E. coli pathotypes. Virulence determinants encoded by these elements include the EPEC adherence factor (EAF), EHEC virulence, and EIEC invasion plasmids; the Locus of Enterocyte Effacement pathogenicity island (LEE PAI) of EHEC and EPEC; the plasmid-encoded heat stable and heat labile enterotoxins of ETEC, and the bacteriophageencoded Shiga toxin (Stx) of EHEC. Other categories of pathogenic E. coli, such as EAEC, EIEC and DAEC possess unique combinations of virulence determinants. Abbreviations: EPEC, enteropathogenic E. coli; EHEC, enterohemorrhagic E. coli; STEC, Shiga toxin-producing E. coli; ETEC, enterotoxigenic E. coli; EAEC, enteroaggregative E. coli; EIEC, enteroinvasive E. coli; DAEC, diffusely adherent E. coli.

EPIDEMIOLOGY OF INTESTINAL Escherichia coli PATHOTYPES Intestinal E. coli pathotypes (or diarrheagenic E. coli, DEC) cause significant morbidity and mortality worldwide in children under 5 years of age, especially in the developing world. ETEC strains alone are responsible for millions of diarrheal episodes and an estimated 380,000 deaths each year [27-28]. The majority of diarrhea cases due to DEC are caused by ETEC; however other DEC pathotypes also cause significant disease, such as EPEC and, increasingly, EAEC. Shiga toxin-producing E. coli (STEC) infections are relatively rare in both developed and developing countries; however, STEC, especially EHEC of the serotype O157:H7, are considered important pathogens due to

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 13

the potential for life-threatening sequelae, such as hemorrhagic colitis and hemolytic uremic syndrome. Widespread use of oral rehydration therapy since the 1980’s has reduced the severity of disease and mortalities due to acute diarrheal episodes. Since the reduction of serious disease due to acute diarrhea, the incidence of persistent diarrhea (defined as diarrhea lasting >14 days) has increased, and approximately 50% of those who die as a result of diarrheal disease have persistent diarrhea [29]. In conjunction, detection of EPEC and EAEC strains that are associated with persistent diarrhea has increased. All intestinal E. coli pathotypes are transmitted via the fecal-oral route and most infections occur as a result of contaminated food or water. Humans are the major reservoir of EPEC, EAEC and ETEC, while cattle are the main reservoir for STEC. EPEC, EAEC and ETEC have all been isolated from various animals, but the role of these animals in transmission is unclear. Epidemiology of EPEC EPEC is a major cause of persistent diarrhea in children less than 2 years of age throughout the developing world where it is endemic [30]. It is estimated that 5-10% of all diarrheal cases in children are caused by EPEC when identification is based on molecular methods, or 10 - 20% when based on serotyping or adherence to cultured human epithelial cells [30]. All EPEC carry the eae gene, encoding the receptor intimin, which is contained within the LEE pathogenicity island. EPEC strains are classified as either typical or atypical EPEC based on the presence (typical) or absence (atypical) of bundle-forming pili (BFP) [31]. Although detection of BFP is considered the best criteria for accurate classification of EPEC, many investigators distinguish EPEC strains by the presence or absence of the gene encoding the BFP (bfpA) or of EPEC adherence factor plasmid (pEAF) which carries bfpA [32]. Typical EPEC have been a leading cause of persistent watery diarrhea in children of developing countries, but have been supplanted over the last decade by emerging atypical EPEC strains in both developed and developing countries [30]. EAEC, followed by typical EPEC, were the predominant diarrheagenic E. coli isolated from children under 5 years of age that were hospitalized for acute or persistent diarrhea in Dar es Salaam, Tanzania [33]. Results of a study in Brazil showed a similar trend, although EAEC and, in this case, atypical EPEC, were the predominant diarrheagenic E. coli pathogens in children less than 5 years of age presenting with diarrhea to hospitals or clinics in two large urban centers in Sao Paulo State, Brazil [34]. Typical EPEC was also recovered in this study, but mostly from a population at high risk of typical EPEC infection in the past. This observation supports the hypothesis that the shift in prevalence from typical to atypical EPEC in Brazil and other parts of South America may be due to improved sanitation and/or other living conditions or factors that allowed for the emergence of atypical EPEC strains [32, 35]. Other studies conducted in Mexico, Peru and Uruguay also found atypical EPEC (typical EPEC was also detected in diarrhea cases but at a lower prevalence) as one of the most frequently isolated diarrheagenic E. coli pathotypes in young children with acute or persistent diarrhea [36-43]. Gomes et al. (2004) reported atypical EPEC in children, adults and AIDS patients with diarrhea, in three urban centers in Brazil, indicating that atypical EPEC is an important cause of diarrhea in adults and the immunocompromised as well as in children. EPEC outbreaks involving adults have occurred [44-45] and presumably a high dose is ingested because in volunteer studies diarrhea can be induced with doses of 108 – 1010 CFU/ml and after neutralization of gastric acid with sodium bicarbonate [46]. Atypical EPEC is also an important cause of sporadic and epidemic diarrhea in developed countries. Sporadic cases are mainly detected in children, while epidemics affect both children and adults. Atypical EPEC made up 71% (30/42) of diarrheagenic E. coli isolated from children less than 14 years old with persistent diarrhea in Australia [47]. Similarly, a study in Norway found EPEC more frequently than any other enteric pathogen in the stools of children less than 2 years of age. All but one of the 44 EPEC isolates were atypical EPEC, and one-third of the patients from whom atypical EPEC was recovered had persistent diarrhea [48]. A subsequent study by Afset et al. (2004) was unable to show a significant association between atypical EPEC and diarrhea in children less than 5 years old in Norway; however, an association was detected between atypical EPEC and persistent diarrhea [49]. While typical EPEC are very rarely isolated in developed countries, outbreaks of diarrhea due to atypical EPEC have occurred in the United States, Finland and Japan [44-45, 50]. An outbreak in Minnesota affected >100 patrons and workers of a restaurant. Foodborne transmission of EPEC was suspected, but no single vehicle was implicated, and contamination of various foods by an infected restaurant worker could not be ruled out [44]. No source of infection was identified in a diarrheal outbreak in Finland that affected both children and adults [45]. A waterborne

14 Pathogenic Escherichia coli in Latin America

Williams et al.

diarrheal outbreak occurred in Japan that affected children from 12-15 years old [50], while another Japanese outbreak involved infants in a daycare facility [51]. Humans are considered to be the major reservoir of typical EPEC, although there are increasing reports of isolation from dogs, cats, monkeys and deer [52-56]. EPEC that carried eae, bfpA and/or the EAF plasmid, but belonged to the non-classical EPEC serotype O157:H45 were isolated from cattle in Switzerland [57]. EPEC strains of this serotype have been isolated from humans, and one such strain caused an outbreak in Japan [58-59]. Atypical EPEC are shed by domesticated animals (cats, dogs, cattle, sheep, pigs, rabbits, chickens, duck, geese, and pigeons) and wildlife (monkeys, deer) [53-55, 60-62]. These animals may serve as reservoirs of atypical EPEC infection in humans, as several studies have identified aEPEC from animals that carried virulence genes or displayed phenotypes associated with human infection. These findings led to the suggestion that colonization by these isolates is not restricted to a particular species [53, 55, 62]. Despite isolation of typical and atypical EPEC from multiple animal sources and animal products, currently there is no evidence of zoonotic transmission. Typical EPEC generally belong to the serogroups O26, O55, O86, O111,O114, O119, O125, O126, O127, O128, O142, O158 [35] which are referred to as classic EPEC serotypes. Eighty-one percent of atypical EPEC do not belong to these classic EPEC serogroups and 26.6% are untypeable. The most frequent serogroups of atypical EPEC are O26, O51, O55, O111, O119, and O145, some of which are also classic EPEC serotypes. Initially, typical and atypical EPEC were classified based on serotype, however, new methods to distinguish between atypical and typical EPEC became necessary due to shared serotypes between these groups. These methods include detection of virulence genes such as eae and bfpA and virulence traits such as formation of attaching and effacing lesions and pattern of adherence on epithelial cells. Typical EPEC exhibit a localized adherence (LA) pattern, whereas atypical EPEC can exhibit localized-like (LAL), diffuse (DA), or aggregative adherence (AA) patterns. Epidemiology of EAEC EAEC is an important cause of diarrhea in children and adults in both developing and developed countries. EAEC strains can cause acute and persistent (>14 days) diarrhea along with inflammation. EAEC was first described in 1987 in a child from Chile with persistent diarrhea [63]. Several studies have since shown an association between EAEC and persistent diarrhea in children throughout the developing world [64-67]. More recently, a meta-analysis of 41 case-control studies involving populations from developing and industrialized countries demonstrated more frequent isolation of EAEC from children with acute diarrheal illness compared to controls [68]. A significant association was also detected between EAEC and acute diarrhea in children of industrialized countries, HIV-infected adults from developing countries, adults from developing countries, and adult travelers to developing regions [68]. EAEC is second only to ETEC as a cause of diarrhea in travelers to developing countries, being responsible for 24.1% and 16% of cases in Latin America and South Asia, respectively [69]. There is also evidence that EAEC causes sporadic diarrhea in adults of industrialized countries [70-71]. In studies conducted at sites in Brazil and Peru, EAEC was one of the most frequently isolated pathotype of diarrheagenic E. coli recovered from children with diarrhea [38, 72]. Most EAEC cases are sporadic, but several food and waterborne outbreaks of diarrhea affecting both children and adults in Europe, the UK, the US and Japan have been described [73-74]. In 1993, 40.6% of 2,697 Japanese children who ate school lunches developed diarrhea, which was persistent in 10% of cases [73]. Two outbreaks of diarrhea due to EAEC occurred within 10 days of each other at a holiday farm restaurant in Italy [74]. The infection sources in both the Japanese and Italian outbreaks were identified epidemiologically; EAEC was not recovered from the implicated food items. EAEC has been recovered from both asymptomatic individuals and those with diarrhea, which suggests that humans are likely the reservoir of EAEC infection. Fecally-contaminated food and water may serve as source of infection, and vehicles include produce, unpasteurized dairy products, sauces and baby bottles [75]. Other risk factors include travel to developing countries, poor hygiene, host susceptibility and possibly immunosuppression due to HIV infection [68, 75-76].

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 15

EAEC has been recovered from animals such as calves, piglets and horses, which may indicate that these animals are potential reservoirs for human EAEC infection [77-78]. However, Uber et al. (2006) found that clinical isolates of EAEC from calves, piglets and horses with diarrhea were not typical EAEC, in that they lacked the plasmidencoded aggR gene. These atypical EAEC animal isolates were also found to carry few or none of the other EAEC virulence markers which leads to the suggestion that animals may not be a reservoir for human pathogenic EAEC. Another study that examined clinical samples from horses included isolates from both diarrheal feces and extraintestinal sites [77]. One isolate was found to carry several putative virulence genes, including aggR, that are associated with EAEC diarrhea in humans. The risk of infection from animals appears low; therefore, humans remain the most likely reservoir of EAEC infection. Common EAEC serotypes include O44:H18 and O111:H12 as well as the serogroups O125 and O126, although much serotype diversity has been reported [75]. The aggregative nature of the bacterium results in many strains being untypeable for the O antigen. Further evidence of heterogeneity is found in volunteer studies that demonstrate virulent and avirulent strains of EAEC (some strains elicit diarrhea in volunteers, while others do not) [79]. These observations may explain the high frequency of EAEC recovery from asymptomatic individuals. Efforts to identify markers associated with EAEC pathogenicity are ongoing. The CVD432 probe can be useful in identifying EAEC strains, although sensitivity can range from 15–90%, depending on the geographic region [75]. The presence of this probe was associated with persistent diarrhea in children compared to healthy controls or to children with acute diarrhea in a case-control study conducted in Brazil [80]. Diarrhea was positively associated with heat stable enterotoxin (EAST1)-positive and EAST1/CVD432-positive EAEC strains in this study [80], although few studies have found an association between the virulence of EAEC strains and any one or group of these markers. The heterogeneity of EAEC strains, as well as host factors, likely contribute to the role of EAEC in both acute and persistent diarrhea with a range of accompanying symptoms, including intestinal inflammation, abdominal pain, nausea, vomiting, low-grade fever and blood or mucus in stools. Epidemiology of STEC Shiga-toxigenic E. coli (STEC) strains are not a major cause of diarrhea, although STEC infection can lead to severe and life-threatening disease. Many STEC are able to form attaching and effacing lesions in the intestine through the expression of the proteins encoded on the LEE, but it is the production of Shiga toxins (Stx) that defines this E. coli pathotype. Toxin production is also thought to be responsible for the damage leading to serious sequelae such as hemolytic uremic syndrome (HUS). Some strains of STEC that cause bloody diarrhea, a risk factor for HUS, are also known as enterohemorrhagic E. coli (EHEC), which is a subset of STEC. Unlike other DEC pathotypes, cattle are the main animal reservoir of STEC and are the major source of direct and indirect transmission. Since the emergence of E. coli O157:H7, other STEC serotypes have also been recognized as causes of serious disease [81]. Both O157 and non-O157 STEC infections are reported mainly in developed countries such as the United States, Canada, UK, Japan, Australia, Europe and Argentina. Outbreaks are common and receive much attention in the press but most STEC cases are sporadic. Only 25.7% of STEC infections in the US in 2008 were outbreak-associated [82]. As, with other DEC pathotypes, children are most at risk of infection and are also more likely to develop severe disease, although HUS can occur at all ages. The elderly are also vulnerable to developing severe manifestations of STEC infection and they are most likely to succumb to STEC-associated disease even in the absence of severe complications [83]. STEC infections are rare in developing countries and few outbreaks are reported. In a meta-analysis of 19 studies which examined the pathogens isolated from cases of persistent diarrhea in children under 6 years of age residing in low to middle income countries, there were only two studies which tested for EHEC, and neither detected it in cases or controls [84]. Several studies in Brazil have identified STEC in human clinical isolates, including the first report in that country of O111:NM infection [85] and possibly the first outbreak in Brazil caused by E. coli O157:H7 [8687]. A study in the Amazon found 0.63% of cases carried STEC. STEC infection was found to be significantly associated with EPEC diarrhea cases, although only 3 cases were positive for STEC [41]. E. coli O157:H7 or nonmotile strains of the serogroup O157 (O157:H- or O157:NM) have been detected in a collection of food, animal and human clinical isolates from South America [88]. These O157 isolates carried several virulence markers associated

16 Pathogenic Escherichia coli in Latin America

Williams et al.

with human disease. In children over 2 but less than 12 years-old in Mexico City, 8.6% of diarrheal pathogens were STEC [42]. Most of the STEC isolates carried the stx2 gene which is associated with development of HUS. Converse to the trend of low prevalence of STEC-associated disease in Mexico and many South American countries, Argentina has the highest rates of HUS in the world at 12.2 cases per 100,000 inhabitants in 2002. Elsewhere, most HUS cases are associated with the O157 serogroup although, in Argentina, STEC of non-O157 serogroups were isolated from 40% of cases with diarrhea or HUS [89]. Chile and Uruguay also have high rates of HUS [90-91]. STEC was detected in a small number of controls in several case-control studies conducted throughout the developing world. Often, these isolates carried virulence genes or were of serotypes associated with human disease [36, 42, 72]. A study in Nigeria showed STEC were frequently isolated from children with and without diarrhea [92]. Humans may serve as an important reservoir of STEC infection in areas where asymptomatic STEC carriage is coupled with inadequate sanitation. One of the largest outbreaks in a developing country occurred in South Africa and Swaziland where contaminated water sickened thousands of people; fatalities and cases of renal failure were also reported. E. coli O157:H7 was isolated from 22.5% of 89 stools from patients [93]. Many developed countries report multiple STEC outbreaks each year; however, these are usually small, affecting tens of people or less. Large outbreaks, sickening hundreds of people, are less frequent. In 2000, an estimated 2,300 people were infected with E. coli O157:H7 due to a contaminated municipal water supply in the town of Walkerton, Ontario, Canada. Twenty-seven cases developed HUS and 7 died of STEC infection [94]. In the same year as the Walkerton outbreak, Canada reported 45 other outbreaks of E. coli O157:H7 infection. In 2006, E. coli O157:H7contaminated spinach caused 205 cases in 26 US states and in Canada, and 3 deaths [95]. In the 20-year period from 1982 to 2002, 350 outbreaks were reported in the US [96]. Although higher incidence occurs in the northern states, outbreaks were reported in 49 states affecting 8,598 people [96]. Since the 2006 spinach outbreak, several other outbreaks have been reported. A cluster of E. coli O157:H7 cases was linked to a Taco Bell fast-food outlet in the northeastern US in 2006. This outbreak had an 11% HUS rate and lettuce, cheddar cheese and beef were linked to cases [97]. Other outbreaks in the US from 2007 to 2010 have been linked to frozen beef patties, ground beef, bladetenderized steaks, pepperoni on frozen pizzas and raw cookie dough [98]. Most STEC infections in industrialized countries are sporadic. Analysis of data from FoodNet shows that outbreaks accounted for only 25.7% of E. coli O157 cases in 2008[82]. Overall, 513 E. coli O157 infections were reported resulting in an incidence of 2.12 cases per 100,000 people. Non-O157 STEC infections in 2008 totaled 205 with an incidence of 0.45 cases per 100,000 people. In children (< 18 years old), 77 cases of HUS were reported (incidence of 0.73 cases per 100,000 children). There was no significant change in the incidence of E. coli O157 infections or HUS compared to the previous three years; however, E. coli O157 infections have decreased 25% (95% confidence interval: 8%-39%) compared to the first three years of surveillance (1996-1998)[82]. The decrease in incidence since the mid-late 1990’s plateaued by the mid-2000’s, and incidence has not yet reached the target of 1.0 E. coli O157 infections per 100,000 people proposed in the CDC Healthy People by 2010 Program suggesting unresolved and/or unrecognized issues in food safety still exist[82]. Transmission of STEC is via the fecal-oral route. The infectious dose of E. coli O157:H7 is estimated to be approximately 100 organisms and is presumed to be low for non-O157 STEC [99]. This low dose and the ability of E. coli to survive a variety of conditions may contribute to the diversity of vehicles and transmission routes reported. Transmission of STEC has been reported via contaminated water, food items, person-to-person contact and animal contact. Airborne particles contaminated with E. coli O157 were implicated in one outbreak [100] and airborne transmission of E. coli O157 was demonstrated between pigs in a controlled setting [101]. Among food items implicated in STEC infections, meat, produce, milk and milk products have been reported [96, 102-103]. Produce items including sprouts, lettuce and spinach have been linked to outbreaks [96, 102-103]. Although there are many potential sources of STEC infection, cattle remain the most important reservoir. At the beef and dairy herd level, O157 is ubiquitous [104]. Small ruminants such as sheep and goats are also carriers of STEC and indirect transmission from sheep to humans was demonstrated following a Norway sausage outbreak [105-106]. Pigs were thought to only serve as a mechanical vector, but recent studies have demonstrated that pigs are competent biological reservoirs of STEC [95]. The 2006 spinach-associated outbreak of E. coli O157:H7 was likely the result of feral pigs shedding the outbreak strain onto spinach fields. The outbreak strain was also identified in cattle about

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 17

one mile away from the implicated fields [95]. Interestingly, STEC have a wide distribution in both food items and production animals in countries that have low STEC prevalence in humans, such as India and Brazil [87-88, 107110]. Some of the STEC from food and animals carried several genes and/or serotypes associated with human disease; however, many isolates lacked important virulence genes such as the eae gene [87, 108]. Runoff water from fecally-contaminated fields is likely responsible for contamination of drinking and recreational water [103]. Little is known about the behavior of STEC in soil and/or water but this will likely prove important to the ecology of STEC and STEC-related disease. Risk factors for sporadic STEC infection vary geographically, but in general, eating outside the home and eating undercooked beef are the most common exposures. Risk may differ for exposures depending on age. For example, Werber et al. (2007) found that transmission through food items was less of a risk in children less than 3 years of age, whereas in children over 10 years of age, only food items, such as lamb meat and raw spreadable sausage were found to be significant risk factors [111]. In general, risk factors are similar for E. coli O157 and non-O157 STEC infection; however, a study in Australia found that O157 was associated with eating hamburgers, eating out of the home and living on or visiting a farm while non-O157 infections were associated with eating chicken deli meat and working with animals [112]. A study of sporadic STEC infection in New Mexico found that those infected with nonO157 were more likely to be nonwhite, < 5 years old and urban residents compared to those infected with O157 [113]. Seasonality has been observed in both STEC infection and prevalence in cattle, both of which increase during summer months [103, 114]. E. coli O157:H7 is a highly virulent serotype and the most recognized and characterized of the STEC; however, there are 250 recognized serogroups of non-O157 STEC and over 100 of these serogroups have been associated with disease in humans, and along with flagellar antigen types, the variety of STEC serotypes is vast [115]. As the use of methods to identify non-O157 STEC becomes more widespread, non-O157 STEC serotypes are increasingly detected and approximately 19-100% of STEC-associated disease is due to non-O157 serotypes [115]. The nonO157 serotypes most associated with severe disease in humans are motile and non-motile (NM) strains of O26:H11/NM, O103:H2, O111:H8/NM, O145:H28/NM. Other emerging serotypes include O118:H16/NM, O121:H19/NM [102]. STEC that produce Stx2 are associated with severe human disease, while strains producing only Stx1 are not, although these strains are isolated from some cases of HUS and bloody diarrhea [116]. While the Stx1 gene is quite conserved, several variants of Stx2 have been identified that are associated with differences in disease severity. Stx2 and Stx2c are variants that are more frequently isolated from HUS patients, whereas patients with STEC producing Stx2d are more likely to have uncomplicated diarrhea [103]. Some Stx2 variants are mainly detected in animal strains such as Stx2e, which contributes to the pathogenesis of edema disease in pigs [117-118] and Stx2f which is found in STEC of avian origin [103]. Variants of intimin have also been identified in attaching and effacing E. coli. Although 17 intimin types have been described, the main intimin types are α, β, γ, ε [103, 119]. In general, EPEC carry α-intimin, while γ-intimin is found in STEC serogroups O157, O55 and O145. Other important STEC serogroups, O103 and O121 have the ε-intimin type, and STEC O26:H11 carry β-intimin [103]. LEE-negative (intimin-negative) serotypes, such as O113:H21, have been associated with severe disease and produce an alternate adhesin and cytotoxin [115, 120]. Epidemiology of ETEC ETEC is the most commonly isolated pathotype of DECs. It is a major cause of pediatric diarrhea which causes an estimated 1.4 million deaths per year [28, 121]. ETEC can cause cholera-like diarrhea in groups of all ages, including travelers to the developing world where ETEC is endemic. Asymptomatic carriage of ETEC in individuals of all ages is common, which provides a reservoir for cycles of infection and re-infection [28]. ETEC infection is a major cause of diarrhea in children under 2 years of age in the developing world [122]. A survey by Wenneras et al. (2004) of studies conducted between 1970 and 1999 showed high incidence of ETEC in children less than one year old (69 million diarrheal episodes per year) with 210 million episodes per year for children 1-4 years old (average 52 million episodes). Diarrhea due to ETEC infection in children less than 2 years of

18 Pathogenic Escherichia coli in Latin America

Williams et al.

age may exacerbate or result in malnourishment, potentially leading to reduced physical and/or cognitive development. ETEC is associated with diarrhea in children under 5 years, although it is estimated almost 50 million children in this age group are asymptomatic carriers [28]. Compared to younger children, 5-15 year-olds have reduced incidence (114 million cases per year for the entire age group, average of approximately 10 million cases per year) and ETEC is no longer associated with diarrhea in this older age group [28]. Although ETEC-associated diarrhea is mainly considered to affect young children, approximately 25% of ETEC cases are in adults who can experience severe dehydration compared to children [122]. ETEC is endemic in almost all developing countries with peak incidence occurring during warm and wet seasons [122]. Outbreaks of ETEC can also occur in developing countries, although clusters of ETEC-associated diarrhea have been mistaken for cholera outbreaks. Two unrelated ETEC outbreaks in the Brazilian Amazon Rainforest were originally thought to be cholera [123]. Travelers to countries where ETEC is endemic are susceptible to diarrhea due to ETEC infection. ETEC is a major cause of traveler’s diarrhea (TD) and may be responsible for 20-40% of cases [122, 124]. In a meta-analysis, Shah et al. (2009) reported that 30.4% of global TD cases are due to ETEC. The prevalence of ETEC-associated TD in different regions were similar to this global prevalence: 33.6% in Latin America, 31.2% in Africa, 30.6% in South Asia, but only 7.2% in Southeast Asia [69]. ETEC-associated diarrhea also impacts soldiers deployed to countries where ETEC is endemic; 70% of US troops experienced at least one bout of diarrhea during deployment to Iraq and ETEC was the most commonly isolated enteropathogen from these cases at a prevalence of 32% [125]. Sporadic endemic cases of ETEC diarrhea are rare in developed countries, except in communities lacking adequate water quality and sanitation; however, several food and waterborne outbreaks have been reported in the US, Japan and Europe [122]. ETEC was identified as the etiologic agent of a large food borne outbreak at a sushi restaurant in Nevada in 2004. Poor food-handling practices and infected food handlers likely contributed to this outbreak since the butterfly shrimp implicated in these outbreaks was distributed to other restaurants that were not involved in the outbreak [126]. Another ETEC outbreak in 2004 occurred at a corporate lunch in Illinois [127]. Cucumber salad and Asian crispy noodle salad were associated with diarrhea through epidemiological methods, although no food was available for testing. In general, the ETEC strain responsible for this outbreak resulted in diarrhea of longer duration (median of 7 days) compared to other reported ETEC outbreaks (median of 4 days) [127]. As with other DEC pathotypes, transmission of ETEC occurs via the fecal-oral route. Contaminated food and water are the most common sources of infection. Humans are the major reservoir of ETEC, so improved personal hygiene and sanitation capabilities (clean water and latrines) should reduce incidence of ETEC infection. Infants in low socio-economic households in the developing world are most susceptible to ETEC-associated diarrhea [122]. Breastfeeding is thought to be protective since exposure to ETEC through contaminated food and water is reduced. However, protection is limited since children are often weaned or started on solid foods at a very young age, and contaminated weaning food has been suggested as a likely source of ETEC infection in infants [122]. Risk of ETEC diarrhea in children in Brazil was associated with preparation of food (beans, rice and soup) in the morning that was fed to children in the afternoon [128]. This association suggests that improper food storage is a risk factor for ETEC diarrhea. ETEC is also a cause of serious diarrheal disease in young animals, particularly swine, cattle and rabbits, but these strains carry different toxin and colonization factors than human ETEC strains and, therefore, do not appear to have zoonotic potential [122]. ETEC strains isolated from humans are highly variable. There are 78 different serotypes and many isolates are untypeable. The most common ETEC serotypes detected in a collection of isolates representing the global diversity of ETEC were O6, O78, O8, O128 and O153 [129]. Only 34 flagellar H-antigen types were identified in this collection, five of which accounted for half the ETEC isolates [129]. A subsequent study in Egypt showed that the serotypes O43 and O159 were most prevalent and five H types also accounted for half of the Egyptian isolates, but these serotypes differed from the previous study [130]. Analysis of ETEC outbreaks occurring in the US between 1996 and 2003 found that ETEC of the serotype O169:H41 were isolated in 10/16 outbreaks and were the sole

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 19

serotype identified in 6 of the outbreaks [131]. Prior to 1996 only 1/21 outbreaks were due to O169:H41 ETEC. These serotypes appear to be emerging in both Japan and the US [132]. The finding of multiple lineages within a serotype goes against other studies which demonstrated that each serotype belonged to its own lineage despite some intra-serotype variation [133-134]. ETEC strains produce colonization factor antigens (CFAs) that mediate binding to the small bowel. Over 22 CFA types have been recognized and more are thought to exist. The most common types are CFA/I, coli surface antigen (CS) 1, CS2, CS3, CS4,CS5, CS6, CS7, CS14, CS17 and CS21 [10, 122]. Approximately 75% of ETEC express CFA/I, CFA/II or CFA/IV, although 30-50% of ETEC express no typeable CFA [10, 122]. This may be due to the absence of CFA or our inability to detect all types of CFA. Colonization factors, such as K88 and K99, that are expressed by ETEC of animal-origin are very different from those of ETEC isolates from humans and likely contribute to species-specificity [10, 122]. ETEC can produce each or both of the plasmid-encoded toxins, heat-labile toxin (LT) and heat-stable toxin (ST). ETEC strains producing LT only are thought to be less pathogenic than strains producing ST only or LT and ST, since LT-producing ETEC are often isolated from asymptomatic individuals [122]. Indeed, Qadri et al. (2005) reported a possible increasing trend in LT-producing ETEC strains in Bangladesh and Latin America. There are two variants of LT, LT1 and LT2. LT2 is associated with animals, while LT1 are mainly isolated from human ETEC cases. Genotyping techniques found 16 different LT1 types among 51 ETEC strains isolated from children with and without diarrhea in Brazil [135]. Considering that 16 LT types were identified in only 51 samples from one country, it is likely that significant diversity of ETEC LT1 exists. Functional differences in these LT types may account for the variations in incidence and disease severity observed among LT-producing ETEC strains. Similar to LT, ST has two major variants, STa (or STI), which is mainly associated with human disease, and STb (or STII) which is predominant in animals. STa can be further split into two subtypes, STh (or STIb) and STp (or STIa). STh were thought to mainly be found in humans, while STp were considered of porcine origin, although both STh and STp have been isolated from humans. Bölin et al. (2006) found that the distribution of the two STa subtypes varies by geographic region with equal prevalence of STh and STp among pediatric diarrhea cases in Egypt and Guatemala, but few STp-producing ETEC detected in Bangladesh. CONCLUSION Diarrhea is the second leading cause of death in children under 5 years old in the developing world. DEC strains are responsible for millions of episodes of diarrhea each year that affect children and adults worldwide. ETEC is endemic in developing countries and is the most frequently isolated bacterial pathogen from children with diarrhea, as well as from adult travelers to endemic areas. Increasing outbreaks of food and waterborne ETEC infection have been reported in the United States, many of them associated with the emerging serotype O69:H41. EPEC strains are also widespread, particularly in the developing regions. Atypical EPEC strains, lacking the bundleforming pilus, are emerging in both developing and industrialized countries and are associated with persistent diarrhea. Unlike typical EPEC, atypical EPEC strains have been isolated from a variety of animal species. The role of animals in atypical EPEC transmission is unknown, as are the factors underlying the emergence of atypical EPEC. EAEC strains have emerged as the second leading cause of travelers’ diarrhea following ETEC, and as one of the most frequently isolated DEC pathotypes in children with diarrhea. Persistent diarrhea in children has been associated with EAEC, in both developing and industrialized countries, and outbreaks affecting children and adults have been reported. EAEC are identified phenotypically by a “stacked brick” adherence pattern on cultured epithelial cells; however, EAEC strains are very diverse and a limited factor for epidemiological studies is that no genetic markers have been detected that identify all EAEC. STEC continue to be an important cause of sporadic and epidemic diarrhea and the more serious HUS in industrialized countries. STEC are present in cattle and other animal species worldwide, but are detected at low levels, if at all, in children with or without diarrhea in developing countries. The threat posed to human health by the

20 Pathogenic Escherichia coli in Latin America

Williams et al.

great diversity of E. coli strains carrying stx genes is unknown. In addition, the growing number and variety of transmission routes warrants continued surveillance of STEC in humans, animals and the environment. DEC natural history is complex and the underlying factors responsible for shifts in DEC pathotypes or strains, including loss and acquisition of mobile elements as well as anthropogenic changes, must be understood to inform effective interventions that reduce exposure to DEC and decrease the burden of disease. REFERENCES [1] [2] [3] [4] [5] [6]

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24]

Lenski RE, Barrick, J.E., Ofria, C. Balancing robustness and evolvability. PLoS Biology. 2006;4:e428. Kinnersley MA, Holben, W.E., Rosenzweig, F. E unibus plurum: Genomic analysis of an experimentally evolved polymorphism in Escherichia coli. PLos Genetics. 2009;5:e1000713. Barrick JE, Yu DS, Yoon SH, et al. Genome evolution and adaptation in a long-term experiment with Escherichia coli. Nature. 2009;461:1243-7. Serres MH, Kerr, A.R.W., McCormack, T.J., et al. Evolution by leaps: gene duplication in bacteria. Biolog Direct. 2009;4:46. Brussow H, Canchaya C, Hardt WD. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev. 2004;68:560-602. Pupo G.M. K, D.K.R., Lan, R., Reeves, P.R. Evolutionary relationships among pathogenic and nonpathogenic Eschericia coli strains inferred from Multilocus Enzyme Electrophoresis and mdh sequence studies. Infection and Immunity. 1997;65:2685-92. Escobar-Paramo P, Clermont, O., Blanc-Potart, A-B., et al. A specific genetic background is required for acquisition and expression of virulence factors in Escherichia coli. Molecular Biology and Evolution. 2004;21:1085-94. Donnenberg MS, Whittam, T.S. Pathogenesis and evolution of virulence in enteropathogenic and enterohemorrhagic Escherichia coli. Journal of Clinical Investigation. 2001;107:539-48. Clarke SC. Diarrhoeagenic Escherichia coli - an emerging problem? Diagnostic Microbiology and Infectious Disease. 2001;41:93-8. Kaper JB, Nataro, J.P., Mobley, H.L.T. Pathogenic Escherichia coli. Nature Rev Micro. 2004;2:123-40. Robins-Browne RM, Hartland, E.L. Advances in pediatric gastroenterology and hepatology Journal of gastroenterology and hepatology. 2002;17:467-75. Berg DE, Berg CM, Sasakawa C. Bacterial transposon Tn5: evolutionary inferences. Mol Biol Evol. 1984;1:411-22. Johnson TJ, Nolan, L.K. Pathogenomics of the virulence plasmids of Escherichia coli. Micro and Molecular Biology Rev. 2009;73:750-74. Torres AG, Zhou, X., Kaper, J.B. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infection and Immunity. 2005;73:18-29. Giron JA, Ho, A.S., Schoolnik, G.K. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science. 1991;254:710-3. Giron JA, Ho, A.S., Schoolnik, G.K. Characterization of fimbriae produced by enteropathogenic Escherichia coli. J Bacteriology. 1993;175:7391-403. Spears KJ, Roe, A.J., Gally, D.L. A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis. FEMS Microbiol Lett. 2006;255:187-202. Schmidt H. Shiga-toxin-converting bacteriophages. Res Microbiol. 2001;152:687-95. Perna NT, Plunkett G, Burland V, et al. Genome sequence of enterohaemorrhagic Eshcherichia coli O157:H7. Nature. 2001;409:529-33. Zhou Z, Li, X., Liu, B., et al. Derivation of Escherichia coli O157:H7 from its O55:H7 precursor. PLoS ONE. 2010;5:e8700. Wick LM, Qi, W., Lacher, D.W., Whittam, T.S. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J Bacteriology. 2005;187:1783-91. Feng P, Lampel, K.A., Karch, H., Whittam, T.S. Genotypic and Phenotypic Changes in the Emergence of Escherichia coli O157:H7. J Infec Dis. 1998;1771:1750-3. Okeke IN, Nataro, J.P. Enteroaggregative Escherichia coli. Lancet Infectious Diseases. 2001;1:304-13. Okeke IN, Scaletsky, I.C.A., Soars, E.H., et al. Molecular epidemiology of the iron utilization genes of enteroaggregative Escherichia coli. J Clin Micro. 2004;42:36-44.

Evolution and Epidemiology of Diarrheagenic Escherichia coli

[25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37]

[38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50]

Pathogenic Escherichia coli in Latin America 21

Jenkins C, van Ijperen C, Dudley EG, et al. Use of a microarray to assess the distribution of plasmid and chromosomal virulence genes in strains of enteroaggregative Escherichia coli. FEMS Microbiol Lett. 2005;253:119-24. Vial PA, Robins-Browne R, Lior H, et al. Characterization of enteroadherent-aggregative Escherichia coli, a putative agent of diarrheal disease. J Infec Dis. 1988;158:70-9. Sanchez J, Holmgren J. Virulence factors, pathogenesis and vaccine protection in cholera and ETEC diarrhea. Curr Opin Immunol. 2005;17:388-98. Wenneras C, Erling V. Prevalence of enterotoxigenic Escherichia coli-associated diarrhoea and carrier state in the developing world. J Health Popul Nutr. 2004;22:370-82. Mathers CD, Bernard C, Moesgaard IK, et al. Global burden of disease in 2002: data sources, methods and results. Geneva: World Health Organization 2003. Ochoa TJ, Barletta F, Contreras C, Mercado E. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans R Soc Trop Med Hyg. 2008;102:852-6. Cleary J, Lai LC, Shaw RK, et al. Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal epithelial cells: role of bundle-forming pili (BFP), EspA filaments and intimin. Microbiology. 2004;150:527-38. Trabulsi LR, Keller R, Tardelli Gomes TA. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:508-13. Moyo SJ, Maselle SY, Matee MI, et al. Identification of diarrheagenic Escherichia coli isolated from infants and children in Dar es Salaam, Tanzania. BMC Infect Dis. 2007;7:92. Araujo JM, Tabarelli GF, Aranda KR, et al. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007;45:3396-9. Hernandes RT, Elias WP, Vieira MA, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2009;297:137-49. Bueris V, Sircili MP, Taddei CR, et al. Detection of diarrheagenic Escherichia coli from children with and without diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2007;102:839-44. Estrada-Garcia T, Lopez-Saucedo C, Thompson-Bonilla R, et al. Association of diarrheagenic Escherichia coli Pathotypes with infection and diarrhea among Mexican children and association of atypical Enteropathogenic E. coli with acute diarrhea. J Clin Microbiol. 2009;47:93-8. Franzolin MR, Alves RC, Keller R, et al. Prevalence of diarrheagenic Escherichia coli in children with diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2005;100:359-63. Gomes TA, Irino K, Girao DM, et al. Emerging enteropathogenic Escherichia coli strains? Emerg Infect Dis. 2004;10:1851-5. Moreno AC, Filho AF, Gomes Tdo A, et al. Etiology of childhood diarrhea in the northeast of Brazil: significant emergent diarrheal pathogens. Diagn Microbiol Infect Dis. 2010;66:50-7. Orlandi PP, Magalhaes GF, Matos NB, et al. Etiology of diarrheal infections in children of Porto Velho (Rondonia, Western Amazon region, Brazil). Braz J Med Biol Res. 2006;39:507-17. Paniagua GL, Monroy E, Garcia-Gonzalez O, et al. Two or more enteropathogens are associated with diarrhoea in Mexican children. Ann Clin Microbiol Antimicrob. 2007;6:17. Torres ME, Pirez MC, Schelotto F, et al. Etiology of children's diarrhea in Montevideo, Uruguay: associated pathogens and unusual isolates. J Clin Microbiol. 2001;39:2134-9. Hedberg CW, Savarino SJ, Besser JM, et al. An outbreak of foodborne illness caused by Escherichia coli O39:NM, an agent not fitting into the existing scheme for classifying diarrheogenic E. coli. J Infect Dis. 1997;176:1625-8. Viljanen MK, Peltola T, Junnila SY, et al. Outbreak of diarrhoea due to Escherichia coli O111:B4 in schoolchildren and adults: association of Vi antigen-like reactivity. Lancet. 1990;336:831-4. Levine MM, Bergquist EJ, Nalin DR, et al. Escherichia coli strains that cause diarrhoeea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet. 1978 1978;1:1119-22. Nguyen RN, Taylor LS, Tauschek M, et al. Atypical enteropathogenic Escherichia coli infection and prolonged diarrhea in children. Emerg Infect Dis. 2006;12:597-603. Afset JE, Bergh K, Bevanger L. High prevalence of atypical enteropathogenic Escherichia coli (EPEC) in Norwegian children with diarrhoea. J Med Microbiol. 2003;52:1015-9. Afset JE, Bevanger L, Romundstad P, et al. Association of atypical enteropathogenic Escherichia coli (EPEC) with prolonged diarrhoea. J Med Microbiol. 2004;53:1137-44. Yatsuyanagi J, Saito S, Miyajima Y, et al. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:2033-9.

22 Pathogenic Escherichia coli in Latin America

[51] [52]

[53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77]

Williams et al.

Yatsuyanagi J, Saito S, Sato H, et al. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40:294-7. Carvalho VM, Gyles CL, Ziebell K, et al. Characterization of monkey enteropathogenic Escherichia coli (EPEC) and human typical and atypical EPEC serotype isolates from neotropical nonhuman primates. J Clin Microbiol. 2003;41:122534. Ishii S, Meyer KP, Sadowsky MJ. Relationship between phylogenetic groups, genotypic clusters, and virulence gene profiles of Escherichia coli strains from diverse human and animal sources. Appl Environ Microbiol. 2007;73:5703-10. Krause G, Zimmermann S, Beutin L. Investigation of domestic animals and pets as a reservoir for intimin- (eae) gene positive Escherichia coli types. Vet Microbiol. 2005;106:87-95. Moura RA, Sircili MP, Leomil L, et al. Clonal relationship among atypical enteropathogenic Escherichia coli strains isolated from different animal species and humans. Appl Environ Microbiol. 2009;75:7399-408. Nakazato G, Gyles C, Ziebell K, et al. Attaching and effacing Escherichia coli isolated from dogs in Brazil: characteristics and serotypic relationship to human enteropathogenic E. coli (EPEC). Vet Microbiol. 2004;101:269-77. Stephan R, Borel N, Zweifel C, et al. First isolation and further characterization of enteropathogenic Escherichia coli (EPEC) O157:H45 strains from cattle. BMC Microbiol. 2004;4:10. Makino S, Asakura H, Shirahata T, et al. Molecular epidemiological study of a mass outbreak caused by enteropathogenic Escherichia coli O157:H45. Microbiol Immunol. 1999;43:381-4. Oswald E, Schmidt H, Morabito S, et al. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect Immun. 2000;68:64-71. Farooq S, Hussain I, Mir MA, et al. Isolation of atypical enteropathogenic Escherichia coli and Shiga toxin 1 and 2fproducing Escherichia coli from avian species in India. Lett Appl Microbiol. 2009;48:692-7. Frohlicher E, Krause G, Zweifel C, et al. Characterization of attaching and effacing Escherichia coli (AEEC) isolated from pigs and sheep. BMC Microbiol. 2008;8:144. Morato EP, Leomil L, Beutin L, et al. Domestic cats constitute a natural reservoir of human enteropathogenic Escherichia coli types. Zoonoses Public Health. 2009;56:229-37. Nataro JP. Enteroaggregative Escherichia coli pathogenesis. Curr Opin Gastroenterol. 2005;21:4-8. Bhan MK, Khoshoo V, Sommerfelt H, et al. Enteroaggregative Escherichia coli and Salmonella associated with nondysenteric persistent diarrhea. Pediatr Infect Dis J. 1989;8:499-502. Fang GD, Lima AA, Martins CV, et al. Etiology and epidemiology of persistent diarrhea in northeastern Brazil: a hospitalbased, prospective, case-control study. J Pediatr Gastroenterol Nutr. 1995;21:137-44. Lima AA, Guerrant RL. Persistent diarrhea in children: epidemiology, risk factors, pathophysiology, nutritional impact, and management. Epidemiol Rev. 1992;14:222-42. Wanke CA, Schorling JB, Barrett LJ, et al. Potential role of adherence traits of Escherichia coli in persistent diarrhea in an urban Brazilian slum. Pediatr Infect Dis J. 1991;10:746-51. Huang DB, Mohanty A, DuPont HL, et al. A review of an emerging enteric pathogen: enteroaggregative Escherichia coli. J Med Microbiol. 2006;55:1303-11. Shah N, DuPont HL, Ramsey DJ. Global etiology of travelers' diarrhea: systematic review from 1973 to the present. Am J Trop Med Hyg. 2009;80:609-14. Nataro JP, Mai V, Johnson J, et al. Diarrheagenic Escherichia coli infection in Baltimore, Maryland, and New Haven, Connecticut. Clin Infect Dis. 2006;43:402-7. Svenungsson B, Lagergren A, Ekwall E, et al. Enteropathogens in adult patients with diarrhea and healthy control subjects: a 1-year prospective study in a Swedish clinic for infectious diseases. Clin Infect Dis. 2000;30:770-8. Ochoa TJ, Ecker L, Barletta F, et al. Age-related susceptibility to infection with diarrheagenic Escherichia coli among infants from Periurban areas in Lima, Peru. Clin Infect Dis. 2009;49:1694-702. Itoh Y, Nagano I, Kunishima M, et al. Laboratory investigation of enteroaggregative Escherichia coli O untypeable:H10 associated with a massive outbreak of gastrointestinal illness. J Clin Microbiol. 1997;35:2546-50. Scavia G, Staffolani M, Fisichella S, et al. Enteroaggregative Escherichia coli associated with a foodborne outbreak of gastroenteritis. J Med Microbiol. 2008;57:1141-6. Okeke IN, Nataro JP. Enteroaggregative Escherichia coli. Lancet Infect Dis. 2001;1:304-13. Weintraub A. Enteroaggregative Escherichia coli: epidemiology, virulence and detection. J Med Microbiol. 2007;56:4-8. Liberatore AMA, Tomita SK, Vieira MAM, et al. Expression of aggregative adherence to hela cells by Escherichia coli strains isolated from sick horses. Brazilian Journal of Microbiology. 2007;38:9-13.

Evolution and Epidemiology of Diarrheagenic Escherichia coli

[78] [79] [80] [81] [82] [83] [84] [85] [86] [87]

[88]

[89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99]

[100] [101] [102] [103]

Pathogenic Escherichia coli in Latin America 23

Uber AP, Trabulsi LR, Irino K, et al. Enteroaggregative Escherichia coli from humans and animals differ in major phenotypical traits and virulence genes. FEMS Microbiol Lett. 2006;256:251-7. Nataro JP, Deng Y, Cookson S, et al. Heterogeneity of enteroaggregative Escherichia coli virulence demonstrated in volunteers. J Infect Dis. 1995;171:465-8. Pereira AL, Ferraz LR, Silva RS, et al. Enteroaggregative Escherichia coli virulence markers: positive association with distinct clinical characteristics and segregation into 3 enteropathogenic E. coli serogroups. J Infect Dis. 2007;195:366-74. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308:681-5. Preliminary FoodNet Data on the incidence of infection with pathogens transmitted commonly through food--10 States, 2008. MMWR Morb Mortal Wkly Rep. 2009;58:333-7. Gould LH, Demma L, Jones TF, et al. Hemolytic uremic syndrome and death in persons with Escherichia coli O157:H7 infection, foodborne diseases active surveillance network sites, 2000-2006. Clin Infect Dis. 2009;49:1480-5. Abba K, Sinfield R, Hart CA, et al. Pathogens associated with persistent diarrhoea in children in low and middle income countries: systematic review. BMC Infect Dis. 2009;9:88. Guth BE, Lopes de Souza R, Vaz TM, et al. First Shiga toxin-producing Escherichia coli isolate from a patient with hemolytic uremic syndrome, Brazil. Emerg Infect Dis. 2002;8:535-6. Irino K, Vaz TM, Kato MA, et al. O157:H7 Shiga toxin-producing Escherichia coli strains associated with sporadic cases of diarrhea in Sao Paulo, Brazil. Emerg Infect Dis. 2002;8:446-7. Vaz TM, Irino K, Nishimura LS, et al. Genetic heterogeneity of Shiga toxin-producing Escherichia coli strains isolated in Sao Paulo, Brazil, from 1976 through 2003, as revealed by pulsed-field gel electrophoresis. J Clin Microbiol. 2006;44:798-804. Bastos FC, Vaz TM, Irino K, et al. Phenotypic characteristics, virulence profile and genetic relatedness of O157 Shiga toxin-producing Escherichia coli isolated in Brazil and other Latin American countries. FEMS Microbiol Lett. 2006;265:89-97. Rivas M, Sosa-Estani S, Rangel J, et al. Risk factors for sporadic Shiga toxin-producing Escherichia coli infections in children, Argentina. Emerg Infect Dis. 2008;14:763-71. Cordovez A, Prado V, Maggi L, et al. Enterohemorrhagic Escherichia coli associated with hemolytic-uremic syndrome in Chilean children. J Clin Microbiol. 1992;30:2153-7. Schelotto F, Varela G, Amorin MB, et al. E. coli verotoxico en el Uruguay. Relaciones Huesped - Parasito. In: Mera I, editor. I Simposio de Infectologia Pediatrica del Cono Sur; Montevideo, Uruguay 1996. p. 60-1. Okeke IN, Lamikanra A, Steinruck H, et al. Characterization of Escherichia coli strains from cases of childhood diarrhea in provincial southwestern Nigeria. J Clin Microbiol. 2000;38:7-12. Isaacson M, Canter PH, Effler P, et al. Haemorrhagic colitis epidemic in Africa. Lancet. 1993;341:961. Woodward DL, Clark CG, Caldeira RA, et al. Verotoxigenic Escherichia coli (VTEC): A major public health threat in Canada. Can J Infect Dis. 2002;13:321-30. Jay MT, Cooley M, Carychao D, et al. Escherichia coli O157:H7 in feral swine near spinach fields and cattle, central California coast. Emerg Infect Dis. 2007;13:1908-11. Rangel JM, Sparling PH, Crowe C, et al. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg Infect Dis. 2005;11:603-9. Multistate Outbreak of E. coli O157 Infections, November-December 2006. 2006 [updated December 14, 2006; cited 2010 March 28, 2010]; Available from: http://www.cdc.gov/ecoli/2006/december/121406.htm. E. coli outbreak investigations. 2010 [updated March 16, 2010; cited 2010 March 28, 2010]; Available from: http://www.cdc.gov/ecoli/outbreaks.html. Paton AW, Ratcliff RM, Doyle RM, et al. Molecular microbiological investigation of an outbreak of hemolytic-uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxin-producing Escherichia coli. J Clin Microbiol. 1996;34:1622-7. Varma JK, Greene KD, Reller ME, et al. An outbreak of Escherichia coli O157 infection following exposure to a contaminated building. JAMA. 2003;290:2709-12. Cornick NA, Vukhac H. Indirect transmission of Escherichia coli O157:H7 occurs readily among swine but not among sheep. Appl Environ Microbiol. 2008;74:2488-91. Beutin L. Emerging enterohaemorrhagic Escherichia coli, causes and effects of the rise of a human pathogen. J Vet Med B Infect Dis Vet Public Health. 2006;53:299-305. Caprioli A, Morabito S, Brugere H, et al. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289-311.

24 Pathogenic Escherichia coli in Latin America

Williams et al.

[104] Renter DG, Sargeant JM. Enterohemorrhagic Escherichia coli O157: epidemiology and ecology in bovine production environments. Anim Health Res Rev. 2002;3:83-94. [105] Schimmer B, Nygard K, Eriksen HM, et al. Outbreak of haemolytic uraemic syndrome in Norway caused by stx2-positive Escherichia coli O103:H25 traced to cured mutton sausages. BMC Infect Dis. 2008;8:41. [106] Sekse C, O'Sullivan K, Granum PE, et al. An outbreak of Escherichia coli O103:H25 - bacteriological investigations and genotyping of isolates from food. Int J Food Microbiol. 2009;133:259-64. [107] dos Santos LF, Goncalves EM, Vaz TM, et al. Distinct pathotypes of O113 Escherichia coli strains isolated from humans and animals in Brazil. J Clin Microbiol. 2007;45:2028-30. [108] Oliveira MG, Brito JR, Carvalho RR, et al. Water buffaloes (Bubalus bubalis) identified as an important reservoir of Shiga toxin-producing Escherichia coli in Brazil. Appl Environ Microbiol. 2007;73:5945-8. [109] Oliveira MG, Brito JR, Gomes TA, et al. Diversity of virulence profiles of Shiga toxin-producing Escherichia coli serotypes in food-producing animals in Brazil. Int J Food Microbiol. 2008;127:139-46. [110] Sehgal R, Kumar Y, Kumar S. Prevalence and geographical distribution of Escherichia coli O157 in India: a 10-year survey. Trans R Soc Trop Med Hyg. 2008;102:380-3. [111] Werber D, Behnke SC, Fruth A, et al. Shiga toxin-producing Escherichia coli infection in Germany: different risk factors for different age groups. Am J Epidemiol. 2007;165:425-34. [112] McPherson M, Lalor K, Combs B, et al. Serogroup-specific risk factors for Shiga toxin-producing Escherichia coli infection in Australia. Clin Infect Dis. 2009;49:249-56. [113] Lathrop S, Edge K, Bareta J. Shiga toxin-producing Escherichia coli, New Mexico, USA, 2004-2007. Emerg Infect Dis. 2009;15:1289-91. [114] Brooks JT, Sowers EG, Wells JG, et al. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983-2002. J Infect Dis. 2005;192:1422-9. [115] Johnson KE, Thorpe CM, Sears CL. The emerging clinical importance of non-O157 Shiga toxin-producing Escherichia coli. Clin Infect Dis. 2006;43:1587-95. [116] Ostroff SM, Tarr PI, Neill MA, et al. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J Infect Dis. 1989;160:994-8. [117] MacLeod DL, Gyles CL, Valdivieso-Garcia A, et al. Physicochemical and biological properties of purified Escherichia coli Shiga-like toxin II variant. Infect Immun. 1991;59:1300-6. [118] Makino S, Watarai M, Tabuchi H, et al. Genetically modified Shiga toxin 2e (Stx2e) producing Escherichia coli is a vaccine candidate for porcine edema disease. Microb Pathog. 2001;31:1-8. [119] Blanco M, Schumacher S, Tasara T, et al. Serotypes, intimin variants and other virulence factors of eae positive Escherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-eta2). BMC Microbiol. 2005;5:23. [120] Bettelheim KA. The non-O157 shiga-toxigenic (verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol. 2007;33:67-87. [121] Bryce J, Boschi-Pinto C, Shibuya K, et al. WHO estimates of the causes of death in children. Lancet. 2005;365:1147-52. [122] Qadri F, Svennerholm AM, Faruque AS, et al. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev. 2005;18:465-83. [123] Vicente AC, Teixeira LF, Iniguez-Rojas L, et al. Outbreaks of cholera-like diarrhoea caused by enterotoxigenic Escherichia coli in the Brazilian Amazon Rainforest. Trans R Soc Trop Med Hyg. 2005;99:669-74. [124] Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. [125] Monteville MR, Riddle MS, Baht U, et al. Incidence, etiology, and impact of diarrhea among deployed US military personnel in support of Operation Iraqi Freedom and Operation Enduring Freedom. Am J Trop Med Hyg. 2006;75:762-7. [126] Jain S, Chen L, Dechet A, et al. An outbreak of enterotoxigenic Escherichia coli associated with sushi restaurants in Nevada, 2004. Clin Infect Dis. 2008;47:1-7. [127] Yoder JS, Cesario S, Plotkin V, et al. Outbreak of enterotoxigenic Escherichia coli infection with an unusually long duration of illness. Clin Infect Dis. 2006;42:1513-7. [128] Sobel J, Gomes TA, Ramos RT, et al. Pathogen-specific risk factors and protective factors for acute diarrheal illness in children aged 12-59 months in Sao Paulo, Brazil. Clin Infect Dis. 2004;38:1545-51. [129] Wolf MK. Occurrence, distribution, and associations of O and H serogroups, colonization factor antigens, and toxins of enterotoxigenic Escherichia coli. Clin Microbiol Rev. 1997;10:569-84. [130] Peruski LF, Jr., Kay BA, El-Yazeed RA, et al. Phenotypic diversity of enterotoxigenic Escherichia coli strains from a community-based study of pediatric diarrhea in periurban Egypt. J Clin Microbiol. 1999;37:2974-8.

Evolution and Epidemiology of Diarrheagenic Escherichia coli

Pathogenic Escherichia coli in Latin America 25

[131] Beatty ME, Bopp CA, Wells JG, et al. Enterotoxin-producing Escherichia coli O169:H41, United States. Emerg Infect Dis. 2004;10:518-21. [132] Nishikawa Y, Helander A, Ogasawara J, et al. Epidemiology and properties of heat-stable enterotoxin-producing Escherichia coli serotype O169:H41. Epidemiol Infect. 1998;121:31-42. [133] Pacheco AB, Guth BE, Soares KC, et al. Random amplification of polymorphic DNA reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli strains isolated from humans. J Clin Microbiol. 1997;35:1521-5. [134] Pacheco AB, Soares KC, de Almeida DF, et al. Clonal nature of enterotoxigenic Escherichia coli serotype O6:H16 revealed by randomly amplified polymorphic DNA analysis. J Clin Microbiol. 1998;36:2099-102. [135] Lasaro MA, Rodrigues JF, Mathias-Santos C, et al. Genetic diversity of heat-labile toxin expressed by enterotoxigenic Escherichia coli strains isolated from humans. J Bacteriol. 2008;190:2400-10.

Pathogenic Escherichia coli in Latin America, 2010, 25-47

25

CHAPTER 3 Enteropathogenic Escherichia coli (EPEC) Tânia AT Gomes1* and Bertha González-Pedrajo2 1

Departmento de Microbiologia, Imunologia, e Parasitologia, Universidade Federal de São Paulo, São Paulo, Brazil; 2Departamento de Genética Molecular, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, México, D.F., Mexico Abstract: Enteropathogenic Escherichia coli (EPEC) comprise two groups of distinct organisms classified as typical EPEC (tEPEC) and atypical EPEC (aEPEC). tEPEC were leading infantile diarrheal agents in developing countries, whereas aEPEC prevailed in developed countries. Nowadays, tEPEC are less frequent while aEPEC are emerging enteropathogens of children and adults (including HIV-infected patients) in developing countries. EPEC infections can lead to severe secretory acute and persistent diarrheal diseases. Both EPEC groups contain the locus of enterocyte effacement (LEE), which encodes a Type Three Secretion System and various effector proteins that alter several signaling mechanisms of intestinal cells, leading to the development of attaching and effacing (A/E) lesions. The distinction between tEPEC and aEPEC strains is based on the expression of the bundle-forming pilus (BFP) adhesive-structure, which is restricted to tEPEC. Both EPEC groups lack the Shiga toxin genes of another A/E lesion-producing pathogen, enterohemorrhagic E. coli. aEPEC are much more heterogeneous than tEPEC in terms of phenotypic characteristics and virulence determinants. Humans are the only reservoir of tEPEC, whereas aEPEC strains may be found in humans and diverse animal species. Diagnosis is currently performed in research laboratories that use molecular methods to detect specific virulence properties that distinguish tEPEC from aEPEC strains. Antibiotics are indicated to treat more severe or persistent diarrheal cases, but resistance has been detected worldwide. Prophylactic measures are common to other diarrheal infections and vaccines based on surface or secreted proteins that were shown to induce antibodies (IgG and SIgA) responses in endemic areas are under development.

INTRODUCTION The first epidemiological studies suggesting that certain Escherichia coli strains were agents of severe childhood diarrhea were published at the end of the 19th century [reviewed in [1]]. In subsequent years, various studies suggested the involvement of certain E. coli strains of specific serogroups as agents of infantile diarrhea in Europe and the United States [reviewed in [2] and [1]]. Notwithstanding these various studies, general recognition of E. coli as agent of human diarrhea was attained by John Bray [3], who described the association of antigenically homogeneous E. coli strains with outbreaks of infantile diarrhea (“summer diarrhea”) in England. At the same period, Varela et al. [4] described the involvement of an E. coli strain (E. coli-gomez) that caused fatal diarrhea in an infant in Mexico. Subsequently, various experimental infections were published that corroborated the potential etiologic role of certain E. coli strains in diarrheal diseases [reviewed in [5]]. In 1955, Neter [6] created the term enteropathogenic E. coli (EPEC) to designate those E. coli strains epidemiologically associated with childhood diarrhea and to differentiate these strains from E. coli strains of the normal flora. However, although EPEC was the first diarrheagenic E. coli pathotype identified, their pathogenic potential was only confirmed and widely accepted when their ingestion by volunteers promoted evident symptoms of diarrhea [7]. Due to the epidemiological association of E. coli strains of certain serogroups and serotypes with diarrhea, until the 1970s, detection of specific serogroups (classical O groups) and serotypes was the only method available for EPEC identification and to distinguish pathogenic from non-pathogenic E. coli strains [5]. The development of molecular *Address correspondence to: Dr. Tânia A. Tardelli Gomes, Departmento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Rua Botucatu, 862, 3º. Andar, Vila Clementino, São Paulo, S. Paulo, 04023-062, Brazil. Tel: 55-11-5083.2980; E-mail: [email protected]. Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

26 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

and cellular biology techniques and of tissue culture assays has contributed a great deal of information about the virulence factors of EPEC thus allowing the use of such techniques to identify EPEC and to study their virulence mechanisms [8]. Currently, the EPEC pathotype is subdivided into typical EPEC (tEPEC) and atypical EPEC (aEPEC). This classification is based on the occurrence of the virulence-associated EAF (EPEC adherence factor) plasmid (pEAF) in tEPEC and its absence in aEPEC [9]. Both EPEC groups produce a characteristic lesion in the intestinal cells known as attaching and effacing (A/E) lesions, which result from the cooperative action of proteins encoded in a pathogenicity island named locus of enterocyte effacement (LEE). In addition, tEPEC and aEPEC strains lack the genes encoding Shiga toxins (Stx), heat-labile and heat-stable toxins, and are non-invasive [9]. Although tEPEC strains were major causative agents of acute diarrhea in very young children in developing countries (including Latin American countries) until the 1990s, there is currently a clear decrease in their frequency in many of these countries [10, 11]. In contrast, aEPEC strains, which are important agents of diarrhea in developed countries since the 1960s, are emerging agents of acute and persistent diarrhea affecting children and adults worldwide [8, 11, 12]. The main characteristics of tEPEC and aEPEC are summarized in Table 1. Table 1: Main features of typical and atypical EPEC Features

Typical EPEC

Atypical EPEC

Most common serotypes

O55:H6, O55:NM, O86:H34, O111ab:H2, O111ab:NM, O119:H6, O127:H6, O127:H40, O142:H6, O142:H34

O26:H11, O55:H7, O55:H34, O86:H8, O111ac:H9, O111:H25, O119:H2, O125ac:H6, O128ab:H2

Attaching-effacing lesion

Yes

Yes

Present

Absent

EAF plasmid (BFP expression) Stx genes

No

No

Adherence patterns a

LA

LA-like, AA, DA, LAc

LEE Region

Present

Present

Regulation

per, ler, quorum sensing

ler, quorum sensing

Reservoir

Humans

Humans, animals

a

Adherence pattern in HeLa/HEp-2 cell: LA, localized adherence; LAL, localized adherence-like; DA, diffuse adherence; AA, aggregative adherence.

b

NM, non-motile.

c

The LA phenotype in aEPEC strains is independent of BFP expression and usually is detected in prolonged assays (6 h).

SEROTYPES In 1987, the World Health Organization [13] defined EPEC as E. coli strains belonging to 12 different O groups also known as classic serogroups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158. It is currently known that some serotypes within these serogroups may comprise both typical and atypical EPEC strains, as well as other diarrheagenic pathotypes [14, 15]. The most frequent serotypes among tEPEC strains of the classic serogroups are O55:H6, O55:NM (non-motile), O86:H34, O111ab:H2, O111ab:NM, O119:H6, O127:H6, O127:H40, O142:H6, and O142:H34. Most of these serotypes correspond to genetically related clones, when studied by Multilocus Enzyme Electrophoresis (MLEE) and other molecular methods [11, 14]. However, the frequency of these serotypes has changed over the years and some tEPEC serotypes belonging to non-classical EPEC serogroups have now been identified, e.g. O88:H25, and O145:H45 [16]. Regarding aEPEC strains, various epidemiological studies conducted in different geographic areas have reported a large antigenic diversity with at least 109 different serogroups (mostly non-EPEC serogroups) and more than 200 different H types [reviewed in [12]]. The most frequent aEPEC serogroups are O26, O51, O55, O111, O145, and O119, whereas the most frequent serotypes are O26:H11, O55:H7, O55:H34, O86:H8, O111ac:H9, O111:H25, O119:H2, O125ac:H6, and O128ab:H2 [12, 17]. A considerable number of aEPEC strains are O and/or H nontypable and many are non-motile.

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 27

PATHOGENESIS After passing through the gastric barrier, EPEC adhere to the mucosa of the small and large intestines, determining complex alterations that lead to diarrhea. The colonization process is proposed to occur in three phases [8]. The first phase is superficial and non-intimate and the factors that mediate initial adherence have not been definitively characterized, but some studies report the possible involvement of a type IV fimbriae named bundle forming pilus (BFP), other less characterized fimbrial and afimbrial structures, as well as the flagella, thus indicating that this phenomenon is multifactorial [18, 19]. After initial adherence, a type III secretion system (T3SS) is mounted and various effector proteins are injected, whose signaling effects promote diverse alterations in the host epithelium. Finally, there is an intimate adherence that culminates with the A/E lesion. Morphologically, the A/E lesion includes the effacing of the intestinal microvilli and the formation of actin-rich pedestal-like structures on which EPEC bacteria rest (Fig.1). In severe infections, there is complete destruction of the intestinal absorptive epithelium, with marked villous atrophy and thinning of the mucosal layer. This lesion could explain the diarrhea presented by infants due to the extensive destruction of intestinal microvilli, but there are currently many evidences that other factors participate in the process of diarrhea like alterations in the transport of ions and water, opening of the tight junctions and mucosal inflammation [19].

mv PY

Figure 1: Attaching-effacing lesions in rabbit ileum infected with atypical enteropathogenic E. coli showing effacement of microvilli (mv) and pedestals (arrows) (Bar 26 μm).

MECHANISMS AND VIRULENCE FACTORS INVOLVED IN THE INTERACTION OF EPEC WITH HOST CELLS Adherence The tEPEC strains produce the so called localized adherence (LA) pattern to HeLa/HEp-2 cell surfaces after 3 h of contact [20], which reflects the formation of compact microcolonies on cell surfaces mediated by BFP [21]. These fimbriae also promote and stabilize bacterial interconnection within the microcolonies (Fig. 2A) [21]. Microcolony formation is also observed in natural infected children, and in ex vivo human biopsies [22], reviewed in [23]]. In contrast, the majority of aEPEC strains produce a modified LA pattern termed LA-like (LAL) [24] or poor LA [25], in which loosen clusters of bacteria are observed in fewer cells. Usually, the establishment of LAL is slower requiring prolonged incubation periods (6 h assays) (Fig. 2B). While the LAL pattern is characteristic of the strains of most aEPEC serotypes [26-32], some aEPEC strains express alternative adherence patterns in vitro, such as diffuse adherence (DA) (Fig. 2C) or aggregative adherence (AA) (Fig. 2D) [26, 27, 32-34]. Some tEPEC strains were shown to produce biofilms on a flow through continuous culture system, and a model of EPEC biofilm formation has been proposed [35]. Using several EPEC isogenic mutants to form biofilms, it was shown that adhesins such as BFP and the EspA filament of the T3SS were involved in bacterial aggregation during biofilm formation on abiotic surfaces. Whether biofilms are involved in the virulence of EPEC remains to be established.

28 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

A

C

B

D

Figure 2: Patterns of adherence to HeLa cells of typical and atypical enteropathogenic E. coli. A. Localized adherence, B. Localized adherence-like; C. Aggregative adherence; D. Diffuse adherence. Microscopic magnitude: 1,000 x.

Adhesins BFP

BFP, the first virulence factor to be identified in pEAF [21], is encoded by the bfp operon which comprises 14 genes (mostly related to its biogenesis), of which the first, bfpA, encodes the pilin protein named bundlin [[36, 37] reviewed in [17]]. The rope-like filaments of BFP interconnect EPEC bacteria into microcolonies to promote non-intimate bacterial adhesion of EPEC to enterocytes in the small bowel and are also involved in dispersion of the bacteria through the intestinal mucosa [38-41]. BFP probably mediates the initial attachment by binding to N-acetyl-lactosamine-containing or to similar receptors on host cell surfaces [42]. The contribution of BFP to the virulence of EPEC has been established by studies in volunteers who ingested EPEC strains carrying mutations in genes of the bfp operon and had much less severe diarrhea than the individuals that received the wild type strain [43]. Intimin Intimin is required for intimate bacterial adhesion to epithelial cells and cytoskeletal reshuffling [[44], reviewed in [17]]. It is an outer membrane protein of 94 kDa with a high variability in amino acid composition at its C-terminal domain (280-amino acid C-terminal sequence Int280). The highly conserved intimin N-terminal domain is inserted in the bacterial outer membrane, whereas the extracellular C-terminal adhesive domain is exposed to the environment [45]. Based on subtle differences at the nucleotide sequence of the C-terminal portion of the molecule, more than 27 intimin subtypes have been described [46-51]. These subtypes were named with Greek letters, being the alpha and beta types more common among tEPEC, whereas intimin subtypes alpha, beta, gamma, zeta, delta, and epsilon appear to be the most frequent among aEPEC strains of different serotypes worldwide [28, 48, 52]. Usually most tEPEC strains of a certain serotype carry the same intimin subtype, [11] whereas not all aEPEC serotypes have the same intimin subtype. For instance, while aEPEC strains of serotype O51:H40 isolated in Brazil and in Spain possess intimin subtype theta [48, 53], certain aEPEC serotypes carry different intimin sub-types, e.g., O80:H26 carrying either intimin subtype beta or epsilon [48, 52]. The exposed variable portion of the intimin molecule connects to its receptor protein Tir (translocated intimin receptor), which is translocated into the cytosol of the targeted eukaryotic cell through a T3SS. After its translocation, Tir is inserted in the plasma membrane exposing its middle portion at the cell surface as a loop. Intimin interacts with this loop region, inducing clustering of adjacent Tir molecules whereas the amino- and carboxy- portions of Tir are exposed to the cytosol [54].

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 29

The Tir C-terminal domain is phosphorylated on its Y474 residue and triggers actin polymerization in tEPEC strains while Tir of enterohemorrhagic E. coli (EHEC) strains are non-phosphorylated and employ other effector proteins for the same function. In addition, it has been demonstrated that aEPEC strains may carry either phosphorylated or non-phosphorylated Tir molecules [reviewed in [55]]. Although the host tissue distribution of EPEC strains is probably multifactorial, some in vitro studies suggest that different intimin subtypes can determine tropism for different intestinal sites (sites of preferential adhesion) [56]. Thus, intimin subtyping may yield important information concerning tissue tropism [reviewed in [17]]. EFA/LIF Lymphocyte inhibitory factor (LifA) is a very large surface protein described in tEPEC strains, which inhibits proliferation of mitogen-activated lymphocytes and the synthesis of pro-inflammatory cytokines [57]. Efa1 (EHEC factor adhesin 1) was first described as a potential adhesin in some EHEC strains [58]. The lifA and efa1 genes are almost identical [58] and are located in a pathogenicity island named O island 122 (OI-122). Besides efa1/lifA, PAI O122 comprises other putative virulence genes: sen, pagC, nleB and nleE [59]. Efa1/LifA seems to contribute to EPEC adherence to epithelial cells in the absence of BFP, and is critical for intestinal colonization by Citrobacter rodentium, an A/E lesion-producing bacterial murine pathogen [60]. There is evidence indicating that efa1/lifA encodes a critical protein product that regulates bacterial colonization, crypt cell proliferation, and epithelial cell regeneration during in vivo colonization [60]. Although Efa1/LifA has been implicated in the attachment of aEPEC strains to host cells [61], its association with diarrheal diseases is controversial [33, 62]. In a recent study in Brazil, the efa1/lifA gene was found to be more frequent among tEPEC (62%) than among aEPEC (30%) strains [63]. However, although tEPEC and aEPEC strains may harbor complete and incomplete PAI O122, a strong association between the presence of a complete PAI O122 (with simultaneous occurrence of efa1/lifA, sen, pagC, nleB and nleE) and diarrhea was observed only in aEPEC. This observation led the authors to suggest that the detection of complete PAI O122 could help to identify potential more pathogenic aEPEC strains [63]. Other Adhesins The complete genomic sequence of tEPEC prototype strain E2348/69, which has been recently published, revealed the presence of eight intact and five incomplete fimbrial operons as well as ten regions encoding putative nonfimbrial adhesins [64]. However, among the intact operon products identified, thus far only BFP were confirmed to play a role in microcolony formation in vitro [21] and diarrhea in human volunteers [43]. Other fimbriae encoded by tEPEC strain E2348/69 include the type 1 fimbriae, but mutants in these fimbriae showed no interference with in vitro adherence [reviewed in [17]]. In addition, EPEC E2348/69 also has conserved fimbrial genes encoding homologs of the long polar fimbriae (LPF) [65]. LPF were originally identified in Salmonella enterica serovar Typhimurium and were shown to direct the attachment of this organism to murine Peyer's patches in vivo [66]. These fimbriae also mediate microcolony formation contributing to the colonization by EHEC O157:H7 in some animal models [67]. In tEPEC, the lpf region (lpfABCDE) encodes predicted proteins with about 60% homology to the Salmonella LPF, but initial studies have indicated that LPF is apparently not necessary for adherence and A/E lesion formation on human biopsies as these functions were unaltered in an EPEC strain E2348/69 lacking the lpf gene cluster [65]. In fact, mutations in one or both of the known lpf loci (lpfA1 and lpfA2) in EHEC O157:H7 were shown to diminish colonization in animal models and to display an altered human intestinal tissue tropism [68, 69]. A number of polymorphisms within the lpfA genes have been recently identified and were used to classify distinct variants based on these major fimbrial subunit genes of EPEC and Shiga toxin producing E. coli strains (STEC) [70]. Both tEPEC and aEPEC strains were found to carry different lpfA variants. Among the tEPEC strains, the majority possessed only one of the two lpfA genes whereas most of the aEPEC strains possessed the lpfA1-2 and lpfA2-1 genes in combination with specific intimin alleles [71]. Recently, it was demonstrated that the E. coli common pilus (ECP), which is present in most E. coli isolates, may act in concert with BFP to stabilize interactions between EPEC and host cells [72]. However, the prevalence and significance of ECP to aEPEC pathogenesis has yet to be determined. In addition, the EspA filament of T3SS has

30 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

been proposed to be the adhesin mediating initial adherence by EPEC strains that lack BFP [38] but the initial adherence of aEPEC strains may probably be multifactorial. As mentioned previously, some aEPEC strains may express the diffuse adherence (DA) or aggregative adherence (AA) patterns in vitro. In some aEPEC strains DA is a consequence of the expression of daa and afa operons, which encode adhesins of the Dr family [73, 74]. A non-fimbrial structure conferring the DA phenotype to tissue culture cells in some aEPEC strains belonging to serotype O26:H11 has been described, despite the fact that this strain exhibited a LA pattern similar to the BFP-mediated LA. This structure is encoded by the chromosomal region designated Locus for Diffuse Adherence (LDA) [75], and its expression is induced by bile salts [76]. The minor structural subunit gene of this adhesin, ldaH, was found in few aEPEC strains of serogroups O5, O26, O111 and O145 [75], but its role in virulence of these aEPEC strains remains to be evaluated. In addition, aEPEC strains of serotype O125ac:H6 express AA in HEp-2 cells but lack EAEC-virulence-associated adhesins; the AA shown by aEPEC strains of this serotype was shown to be mediated by an outer membrane protein [15, 77]. Flagella Flagella contribute to the virulence of various pathogenic bacteria through motility, chemotaxis, and stimulation of IL-8 production in eukaryotic cells. Furthermore, in some species flagella were shown to promote adhesion to and invasion of host surfaces [78]. Some flagellar antigen types, such as H2 and H6 have been consistently identified among EPEC strains isolated in various epidemiological studies worldwide. However, conflicting data exist in the literature regarding the involvement of flagella in EPEC virulence, especially as an adhesin. Girón et al. [79] demonstrated that H2 and H6 flagella purified from tEPEC but not H7 flagella purified from EHEC O157:H7 bound to HeLa cells. In addition, flagella mutants of tEPEC strains were shown to be impaired in adherence and microcolony formation thus corroborating that flagella may mediate adhesion on cultured enterocytes in vitro [79]. However, another study could not confirm a role of flagella in adherence [38]. Studying a selected aEPEC strain (1711-4) of serotype O51:H40, the most prevalent aEPEC serotype in Brazil, Sampaio et al. [80] demonstrated that flagella was involved in aEPEC 1711-4 adhesion to and invasion of polarized intestinal cells (Caco-2 and T84 cells) in vitro as an isogenic aEPEC mutant unable to produce flagellin (the protein subunit of the flagellar filament) had a marked decrease in the ability to adhere and invade those cell lineages. Signaling Events Type Three Secretion System As mentioned previously, EPEC virulence and A/E lesion development are conferred by the chromosomal LEE pathogenicity island, which encodes a T3SS [81, 82]. T3SSs are used by many Gram-negative pathogenic bacteria to deliver effector proteins straight into eukaryotic cells, subverting different host cellular processes [83, 84]. The virulence-associated T3SS also known as the ‘injectisome’, assembles into a complex macromolecular structure of more than 20 different proteins that traverses the bacterial cell envelope [84-86]. It is composed of a multi-ring base that spans both membranes, and extends a needle-like projection that protrudes out of the cell from the bacterial surface [87-89]. In addition, a hydrophilic protein forms a tip complex at the distal end of the needle, and serves as an assembly platform for two hydrophobic pore-forming translocator proteins that form a pore in the host cell membrane [90, 91]. Effectors are thought to be transported through the hollow needle directly into the cytoplasm of the target cell through the translocation pore [89, 90]. The injectisome is closely related to the bacterial flagellar export apparatus [83, 92]. The needle complex shares structural resemblance with the flagella basal body and a high degree of sequence similarity exists among eight proteins of their secretion apparatus [84, 93]. Moreover, phylogenetic studies indicate that both structures derived from a common evolutionary ancestor [94]. The T3SS in EPEC is composed of a cylindrical basal structure with two sets of membrane ring complexes joined by a periplasmic central rod (Fig. 3) [95]. The outer membrane ring is composed of the EscC protein, a member of the secretin family, which forms a channel for the delivery of large molecules through the outer membrane [96, 97]. Recently, the crystal structure of the periplasmic domain of EscC was solved and a homomultimeric ring-model of

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 31

12 subunits was constructed [98]. The inner membrane ring predicted to be associated to the outer leaflet of the inner membrane, is formed by the lipoprotein EscJ that oligomerizes into a 24-subunit ring structure [99]. The EscD protein is also predicted to form a ring-like structure in the inner membrane and EscI is believed to form the inner rod [100]. In addition, several integral and associated inner membrane proteins form the export apparatus essential for protein secretion. Among these, five polytopic membrane proteins EscR, EscS, EscT, EscU and EscV, extensively conserved among different T3SSs and with the flagellar export apparatus, are proposed to be localized within a membrane patch in the center of the inner membrane ring [101, 102]. However, the precise function and localization of these proteins within the secretion apparatus is still unknown. Structural data is available for the Cterminal cytoplasmic domain of EscU, a member of the SpaS/YscU/FlhB family of proteins that undergo autocleavage and form part of a molecular switch that regulates a substrate secretion hierarchy [103]. HM EspD/B

EspA

EscC

EscF OM

Escl

EscJ

EscQ

EscD EscL

PG IM

EscU,R,S,T,V EscN

Chaperone-effector complex

Figure 3: Schematic representation of the injectisome from EPEC. Proteins are represented according to what is known for the EPEC T3SS (see the text), and for their orthologues in other virulence as well as the flagellar T3SSs [92, 98, 102, 104, 105]. As shown, the inner membrane component EscR interacts with EscU and EscS; EscD interacts with EscC (interaction not depicted in the figure) [106]. We have shown interactions between EscN-EscL and EscN-EscQ (González-Pedrajo B., et al. unpublished results). HM, host membrane; OM, outer membrane; PG, peptidoglycan; IM, inner membrane.

A fundamental component of all T3SSs is a highly conserved ATPase EscN/InvC/YscN/FliI that shares sequence similarity with the catalytic β subunit of the F0F1-ATPases and serves to energize the secretion process [107, 108]. It provides a docking interface for chaperone-effector complexes and induces chaperone release and unfolding of the secreted protein in an ATP-dependent manner [109-111]. EscN is the ATPase associated with the T3SS in EPEC and it is essential for the virulence of this bacterial pathogen [97, 112]. High resolution structural data were obtained for the catalytic domain of EscN and a hexameric ring model was built using the F1-ATPase coordinates [113]. The extracellular portion of the injectisome is formed by a needle-like extension which is a helical homopolymer of EscF subunits [87]. Furthermore, EPEC and other A/E pathogens possess a unique T3SS that has a filamentous extension, called the EspA filament, which extends from the needle and is thought to facilitate attachment to the host cells through the thick mucus layer [87, 114, 115]. A central channel within this structure appears to function as a conduit for the translocation of effector proteins into enterocyte cells [116, 117]. Finally, EspB and EspD are secreted by the T3SS in EPEC and form the translocation pore in the intestinal cell [118]. The assembly of the T3SS is a highly regulated process. It has been shown that protein secretion is induced in response to conditions similar to the ones found in the gastrointestinal tract [119]. The T3S proteins SepD and SepL constitute a molecular switch that controls the ordered secretion of translocators (EspA, EspB and EspD) and effector molecules, possibly in response to environmental cues such as low calcium concentrations [120]. This regulatory mechanism is used by A/E pathogens to ensure that translocators are secreted prior to effectors [120-122].

32 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

LEE and Non-LEE Encoded Effectors Genome sequence analysis of the prototype typical strain E2348/69 revealed the existence of 21 T3SS effector genes carried on lambda-like prophages and integrative elements [64]. Seven of the effectors translocated through the T3SS are encoded within the LEE PAI (Tir, Map, EspB, EspF, EspH, EspZ and EspG), while the others are scattered throughout the chromosome and are referred to as non-LEE-encoded effectors (Nle) [[122] reviewed in [123]]. Translocated LEE effectors subvert normal host cell functions and are responsible for the formation of the A/E lesion (effacement of absorptive microvilli and induction of pedestals); and with the exception of EspZ [124], all have proven deleterious effects on the host cell [123]. The first LEE effector to be characterized was Tir; with Tirintimin interaction being essential for pedestal formation [54]. In addition to promoting intimate attachment, actin polimerization and cytoskeletal rearrangements, the Tir-intimin interaction also triggers phosphorylation of a host phospholipase [125], facilitates invasion of non-phagocytic cells [126] and downregulates the EPEC-mediated filopodia formation [127]. Tir is also involved in tight junction (TJ) disruption [123]. The contribution of the LEE effectors in the disease process has been studied in animal infection models using EHEC and Citrobacter, indicating that Tir is essential while the other effectors have a smaller contribution to virulence [123]. Many of the EPEC translocated effectors have multiple functions and the ability to cooperate with one another (reviewed by [128, 129]. Map (Mithochondrial-associated protein) is targeted to the mitochondria affecting its structure and function [130], it induces transient filopodia formation [127], and is essential for disruption of intestinal barrier function and alteration of TJ structure [131]. More recently, Map was shown to act as a guaninenucleotide exchange factor regulating actin dynamics [132]. EspF, another multifunctional effector is also targeted to the host mitochondria initiating the mitochondrial death pathway [133]. It has a role in disrupting the intestinal barrier function [134], remodeling of the brush border microvilli [135], and redistribution of TJ proteins [136]. Additionally, EspF has been implicated in cell death via apoptosis [137] and in inhibition of phagocytosis [138]. EspG and its Nle homolog EspG2 have been shown to trigger actin stress fiber formation and the destruction of the microtubule networks beneath adherent bacteria [70, 139, 140]. More recently, it was demonstrated that both EspG and EspG2, play a role in the inhibition of intestinal membrane chloride transport [141], and that they activate the host cysteine protease calpain during EPEC infection, leading to host cell loss and necrosis [142]. The effector EspH localizes to the host cell membrane and is a modulator of the host actin cytoskeleton structure [143]. EspH, Tir, and Map collaborate to organize the assembly and disassembly of actin filopodia and pedestals [127]. Recently, it has been shown that EspH counteracts macrophage phagocytosis by binding to RhoGEFs, inactivating the host Rho GTPase signalling pathway [144]. EspZ (previously SepZ) is the translocated effector most recently identified that can be detected beneath the site of bacterial attachment [124]. A function has recently been identified for this effector, it was demonstrated that it interacts with the host protein CD98, enhancing phosphorylation of focal adhesion kinase (FAK), and promoting host cell survival mechanisms during infection [145]. EspB, which is also a translocator protein essential for the delivery of effectors, acts as an effector modulating the host cell cytoskeleton [146]. It also participates in microvilli effacement and in preventing phagocytosis [147]. Non-LEE effectors also have roles in EPEC virulence, although relatively little is known about their cellular function [148]. Since the major EPEC virulence properties have been attributed to the LEE effectors, the non-LEE effectors are proposed to function as accessory factors for an efficient infection [reviewed in [123]]. In contrast to the LEE-encoded effectors that are conserved among all the A/E pathogens, there is a considerable variation in the repertoire of non-LEE effector proteins between strains [64]. To state some of their functions, NleA is reported to inhibit protein trafficking [149] and to disrupt TJs [150]. NleB has been associated with diarrheal disease due to aEPEC [62]. NleE participates in the induction of the signaling pathways required for polymorphonuclear leukocytes transepithelial migration, and it has been demonstrated that it is capable of inhibiting NF-kappaB activation [151, 152]. NleH has anti apoptotic activity during EPEC infection [153]. As previously mentioned, EspG2 has functional redundancy with EspG, indicating that LEE and non-LEE effectors can function together to alter specific cellular processes [140, 154]. EspJ is involved in inhibition of receptor-mediated phagocytosis [155], and the cyclomodulin Cif induces apoptosis [156]. Several other Nle proteins have been identified but their function is still unknown. Most effectors require chaperone proteins for efficient translocation into host cells [157]. T3S chaperones typically form homodimers that interact with their cognate effector through a chaperone-binding domain located within the

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 33

first 100 amino acids of the effector protein. It has been proposed that chaperones promote translocation by stabilizing the effectors in the cytoplasm, maintaining them in a secretion-competent conformation, masking their cellular localization or ‘toxic’ domains, regulating their synthesis, and by targeting them to the secretion apparatus [84, 157]. In EPEC two effector chaperones have been identified. CesF, which binds to EspF [158], and CesT, which was initially shown to bind and stabilize Tir and Map [159-161]; however, additional studies have demonstrated interactions with multiple LEE and non-LEE effectors [162, 163]. The participation of these chaperones in establishing a hierarchal translocation of effectors has also been demonstrated [162, 164]. Autotransporters EPEC also encodes virulence-associated proteins that are secreted via a type V secretion mechanism [reviewed in [165]]. EspC is the most studied autotransporter protein in this bacterial pathogen. It has a conserved serine protease motif similar to the IgA protease and has been shown to have enterotoxic activity [166, 167]. In addition, it has been demonstrated that EspC produces epithelial damage on HEp-2 cells [168] and that it proteolyses hemoglobin [169]. Recently, it was shown that EspC internalization into host cells is also dependent on the T3SS, suggesting cooperation between two secretion systems [170]. Two other putative autotransporter proteins have been identified in the genome sequence of the prototype strain E2348/69, but their function is still unknown [64]. Regulation The LEE contains 41 genes organized in five major polycistronic operons (LEE1 to LEE5) and several smaller transcriptional units, which are positively regulated by Ler, a key transcriptional regulator of EPEC virulence encoded by the first gene of the LEE1 operon [reviewed in [171]]. Ler regulates LEE gene expression by counteracting the repression imposed by the global regulator H-NS [172]. In addition, two other LEE-encoded transcriptional regulators have been identified, GrlA and GrlR, that have positive and negative roles in ler expression, respectively [122, 173, 174]. Moreover, in tEPEC strains, the EAF plasmid-encoded regulator PerC also plays a role in ler positive regulation, linking the expression of BFP with the expression of the LEE [172, 175, 176]. Additionally, in EPEC and EHEC, Ler also regulates non-LEE encoded virulence factors e.g., espC, nleA and lpf, so it is considered a global regulator of EPEC virulence [68, 177-179]. Invasion Some in vivo studies have shown the presence of EPEC cells inside human enterocytes [22, 180, 181] and different cell lines in vitro [182-185]. However, despite these evidences, invasiveness has not been considered a pathogenic characteristic of tEPEC strains in vivo and strains in this pathotype have been considered extracellular pathogens [8]. Studies conducted to evaluate the invasive ability of aEPEC strains are somewhat controversial. Former studies with some collections of aEPEC strains have shown that these strains invade HEp-2 cells less efficiently than tEPEC prototype E2348/69 [30] or rarely invade these cells [33]. In contrast other studies have shown that some aEPEC strains invade epithelial cells efficiently [50, 80, 186, 187]. Scaletsky et al. [188] reported a case of persistent diarrhea caused by an aEPEC (O18ab) strain that invaded HeLa and rabbit intestinal cells as observed by transmission electron microscopy. In addition, Rosa et al. [186] and Yamamoto et al. [50] have shown that a subset of aEPEC strains are able to invade undifferentiated intestinal Caco2 cells more efficiently than differentiated cells of the same lineage suggesting that undifferentiated cells express basolateral receptors necessary for aEPEC invasion. Hernandes et al. [187] showed that an aEPEC strain of serotype ONT:NM invaded HeLa cells as a result of intimin-Tir interaction with the subsequent cytoskeleton reorganization, as an eae mutant of this strain remained adherent but was no longer invasive. Furthermore, Bulgin et al. [189] showed that EspT, a T3SS-dependent effector protein belonging to the WXXXE family of effector proteins, promoted invasion of non-phagocytic cells by the trigger mechanism. The pathogenic role of the invasive ability of some aEPEC strains is presently unknown. As invasive organisms may be protected from destruction by the immune system and some antibiotics that do not penetrate eukaryotic cells, invasion could contribute to the permanence of certain aEPEC strains in the intestine, resulting in the persistent diarrhea reported in recent studies [190, 191].

34 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

Induction of Mucus hypersecretion A putative new virulence phenomenon has been recently described with two aEPEC strains isolated from diarrheic children in Brazil, which consisted of induction of mucus hypersecretion in rabbit ligated ileal loops and in cultured human mucin-secreting intestinal HT29-MTX cells [192]. The same phenomenon could not be observed with tEPEC strain E2348/69 tested in the same conditions. Mucus hypersecretion was associated with increased production of secreted MUC2 and MUC5AC mucins and membrane-bound MUC3 and MUC4 mucins after infection of HT29MTX cells by an unidentified non-secreted effector molecule. Interestingly, adhering aEPEC cells grew in the presence of membrane-bound mucins, thus exploiting the mucins increased production for its own growth benefit. It is currently not known whether mucus hypersecretion is a virulence mechanism used by aEPEC strains to infect the human host. Furthermore, it remains to be investigated how frequent this property can be found among aEPEC strains. DIVERSITY OF VIRULENCE PROPERTIES The tEPEC strains are generally more homogeneous in their virulence characteristics, expressing the LEE- and the EAF plasmid-virulence genes [11]. Conversely, besides the genes on the LEE, many aEPEC strains carry genes encoding virulence factors of other E. coli pathotypes (even from extra-intestinal pathogenic E. coli) in different combinations [11, 26, 28, 32, 77], reflecting the heterogeneity of the group. However the role of these genes or different genes combinations in aEPEC pathogenesis is unknown. It is also recognized that some tEPEC and EHEC strains may loose pEAF or the stx-encoding phages during infection, respectively, thus generating E. coli isolates devoid of these genes, which would be diagnosed as an aEPEC isolate [193, 194]. Using DNA microarray analyses to search for genes associated with diarrhea, Afset et al. [62] found that the genes present in PAI O122 (efa1/lifA, set/ent, nleB and nleE) and certain genes located outside this PAI (lpfA, paa, ehxA and ureD) were associated with diarrhea but these associations may vary among different serotypes and in distinct geographic areas. It is apparent that aEPEC is more likely than tEPEC to receive virulence genes by horizontal transmission (i.e., from transmissible plasmids, PAIs, transposons or bacteriophages) in the intestine and/or environment. Lacher et al. [195] showed that EPEC strains are spread in four main clusters: EPEC 1 containing only tEPEC strains with H6 flagellar antigen, EPEC 2 containing tEPEC and aEPEC carrying H2 antigen, EPEC 3 including tEPEC and aEPEC with H34 antigen and EPEC 4 comprising tEPEC and aEPEC with H6 antigen. Bando et al. [196] have combined data generated by MLST and presence of pathogenic E. coli virulence factor-encoding genes to make a phylogenetic analysis of a collection of EPEC strains with other diarrheagenic E. coli pathotypes. With this approach, they showed that tEPEC and aEPEC of the classical EPEC serogroups were distributed on clusters that closely correlated with these clonal groups. However, they have also shown that aEPEC strains are distributed in all E. coli phylogenetic groups (A, B1, B2 and D) with at least two main distinct genomic backgrounds (named Clusters I and III). According to these authors, the acquisition and expression of virulence factors derived from non-EPEC pathotypes by various aEPEC clonal groups could be due to their particular genomic background, with Clusters I and III being associated with severe and mild diarrhea, respectively. EPIDEMIOLOGY AND IMPACT IN LATIN AMERICA For many decades, studies conducted worldwide have shown that tEPEC serotypes were strongly associated with diarrhea in children <1 year of age, mainly in poor children of urban centers in the first six months of life [reviewed in [8]]. In this age group, these serotypes were considered the main cause of endemic diarrhea in developing countries, including Latin America [197-200]. The frequency of tEPEC serotypes in children older than one year of age were reported to diminish with increasing age and adults rarely contracted EPEC infections, except under exceptional conditions [8]. The increased resistance in older children and adults was credited to the development of immunity or the loss of receptors for some specific adhesin [8]. In developed countries, there was a significant decrease in the frequency of tEPEC since the 1960s, and after that period, these bacteria were rarely detected in these countries, whereas aEPEC are frequently found in diarrheic patients [191, 201] reviewed in [1, 8]. In some developing countries, such decrease in the frequency of tEPEC strains has also been detected in recent years [11, 202-207]. The reasons for such decrease probably comprise better control of hospital infections, improvements in therapy, sanitation measures and in nutrition of infants [11].

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 35

The epidemiology of aEPEC strains worldwide has been recently reviewed [12, 203]. It is noticeable that this pathotype has shown a more significant role in diarrhea in developing countries [205, 206, 208]. In many of these studies the frequency of aEPEC strains in both diarrheic and non-diarrheic individuals are similar, thus strong association of aEPEC serotypes with endemic diarrhea has yet to be demonstrated. Even so, aEPEC strains have been found in diarrheic patients of various ages and in adult patients with HIV-AIDS [28]. Moreover, some serotypes have been incriminated as agents of diarrheal outbreaks, but thus far no outbreaks due to aEPEC have been reported in Latin America. A large outbreak caused by serotype O111:H9 was described in Finland involving more than 600 people [209] while in the U.S.A. an outbreak due to an aEPEC of serotype O39:NM involved more than 100 adults [210]. Another outbreak associated with aEPEC was described in infants at a daycare center in Japan, in which four aEPEC isolates of serotype O55:NM with identical Pulsed Field Gel Electrophoresis patterns were detected in four patients [211]. In addition, a waterborne diarrheal outbreak affected students between 12 and 15 years old in Japan [211]; seven of 41 diarrheic individuals carried aEPEC isolates of serotype ONT:H45. RESERVOIRS AND TRANSMISSION Thus far, studies have shown that tEPEC are rarely found in animals and their reservoirs comprise only humans [11]. Many children acquire infection in public hospitals, usually by contact with other patients hospitalized with diarrhea. Although not completely characterized, it is apparent that tEPEC may be transmitted by ingestion of contaminated food and water [212]. The substitution of bottle feeding for breast-feeding enhances the risk of contracting diarrhea [212].

In contrast, various reports have described the isolation of aEPEC strains from various healthy and diarrheic animal species, such as cattle, sheep, goat, pig and poultry, as well as in domestic animals, deers and marmosets [reviewed in [12]]. Although there is no evidence of direct transmission from animals to humans, some aEPEC strains isolated from animals belong to serogroups implicated in human diseases, for example, O26, O103, O119, O128 and O142 [reviewed in [12]], suggesting that these animals may represent important reservoirs of aEPEC, which can be transmitted to humans. CLINICAL ASPECTS Diarrhea due to EPEC varies from a fatal to a subclinical infection, probably depending on host factors [8]. Various studies have shown that tEPEC strains can induce abundant secretory diarrhea with mucus (but without blood) with important losses of fluid and electrolyte in feces. Vomiting and low-grade fever are also observed in EPEC-infected patients. Furthermore, EPEC infection may lead to severe malabsorption of nutrients, and even evolve to food intolerance, resulting in nutritional aggravation and persistence of diarrhea [213]. The infective dose of EPEC necessary to cause disease in infants has not been established. Studies in volunteers indicate that a high infective dose is necessary to induce diarrhea (109 and 1010 bacteria), but in children it is presumed to be much lower [8]. Although adult volunteers ingesting large numbers (109 to 1010) of EPEC cells presented short incubation periods (12 to 24 h) to develop diarrhea [7, 193, 214, 215], the incubation periods in infants is unknown [216, 217]. The examination of intestinal biopsies of infected infants have shown that EPEC adhere to the mucosa of the small and large intestines, and intimate attachment to the small bowel mucosa has been demonstrated in many (but not all) cases of diarrhea by EPEC [218-221]. The presence of the A/E lesion appears to be related to fluid secretion, and disarrangement of the digestive-absorptive enzyme system, which leads to malabsorption of nutrients. Edema, neutrophil infiltrate, and reduced enzymatic activity in the intestinal mucosa have been found following EPEC infection [181, 218, 222]. IMMUNE RESPONSE Antibody response to the O antigen of certain O serogroups has been demonstrated in volunteers convalescing from experimental EPEC infection [193, 223] and in children older than 1 year of age [6]. In addition, most EPEC virulence factors, such as the major adhesins (intimin, and BFP) and cell-signaling proteins (EspA, EspB and Tir)

36 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

were shown to induce an immune response in serum (IgG and IgM), and milk, colostrum and saliva (sIgA) of healthy and sick human hosts and in colostrum and milk of bovines [224-236]. In breast milk, IgA and other factors (i.e., oligosaccharide fractions) were shown to contribute to immunity by blocking bacterial adherence [232]. A strong antibody response in serum and saliva of children reactive to EPEC virulence factors was shown to develop early, since children around 12 months of age presented an antibody repertoire equivalent to that of an adult at the same geographical area [234]. Taken together, these findings suggest that the reduction in the frequency of tEPEC in children older than 2 years of age may be at least in part due to the development of a repertoire of anti-EPEC antibodies. It has been demonstrated that purified flagellin induces IL-8 production by Toll-like receptor 5 (TLR5) activation in enterocyte monolayers infected with tEPEC [79]. Zhou et al. [237] demonstrated that flagellins H6 and H34 of tEPEC stimulated IL-8 production in T84 monolayers. Using a flagellin deficient mutant, Sampaio et al. [80] have recently shown that the flagella of aEPEC strain 1711-4 (serotype O51:H40) induced IL-8 production in Caco-2 cells at an early stage of infection (3 hours). As a fliC derivative mutant of this strain still induced IL-8 levels at least 2 times higher than that of uninfected monolayers at 24 h post-infection, it was hypothesized that at a later stage of infection the wild-type aEPEC 1711-4 could stimulate IL-8 production in a flagellin-independent pathway (24 h) [80]. The significance of these findings in vivo remains to be confirmed. DIAGNOSIS Currently, molecular assays are more appropriate methods for EPEC identification. These methods include PCR and multiplex PCR, as well as genetic probes, to detect pEAF (EAF probe) [238], bfpA (encoding the major pilin subunit of BFP), eae genes (or other conserved LEE-genes) and the stx genes (encoding Shiga toxins) [18, 44, 239-241]. EPEC strains have been identified by the presence of the LEE region and absence of the stx genes; lack of stx distinguishes EPEC from enterohemorrhagic E. coli (EHEC). tEPEC and aEPEC strains are differentiated mainly by the presence of the EAF sequence and/or the bfpA gene in the former group. Although all tEPEC strains carry bfpA, some aEPEC strains contain a defective bfp operon, thus resulting in positive reactions to this gene. For this reason and to differentiate atypical from typical EPEC, search for BFP expression by immunological methods is recommended [11, 26, 242]. As aEPEC strains are very heterogeneous and may often be isolated from non-diarrheic children, it should be important to demonstrate the potential ability of E. coli strains diagnosed as aEPEC to promote A/E lesions on epithelial cells. This could be achieved in vitro by the Fluorescent Actin Staining Method described by Knutton et al. [243]. Nonetheless, the use of methods to identify BFP expression and ability to promote A/E lesions is so far restricted to research laboratories. TREATMENT AND PROPHYLAXIS Oral rehydration therapy noticeably reduces early mortality and is the most effective therapy against mild EPEC infections. However, it has been shown that children with EPEC may not respond to this therapeutic measure, and some children may present intolerance to cow’s milk, require hospitalization and develop persistent diarrhea [213]. This is probably due to the damage caused in the intestinal mucosa, which may require time to fully recover its functions (digestion, absorption, and defense) [8]. Antibiotic therapy is only recommended for more severe cases or cases of persistent diarrhea associated with aEPEC [203, 244]. However, the antimicrobial susceptibility patterns of tEPEC and aEPEC vary among the different geographic areas studied and antibiotic resistance are common in many areas of the world [26, 198, 216, 244-247]. Consequently, susceptibility testing must be performed before the establishment of therapy. A conserved conjugative plasmid carrying antibiotic resistance was identified among tEPEC strains of serotypes O111:H2 (and non-motile), and aEPEC strains of serotype O119:H2 of different geographical areas [248]. More recently, this plasmid was identified in tEPEC strains of other serotypes (O55:H6, O127:H6, and O119:H6) and in aEPEC strains of serogroups O55 and O119 [245]. As already mentioned, breast milk may contain antibodies against EPEC O antigens and outer membrane proteins, which inhibit EPEC adherence to tissue culture cells [232]. Breast-feeding has a protective effect [212, 224, 225,

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 37

249, 250] probably due to the cooperative protective effect of IgA antibodies to EPEC components and the presence of oligosaccharides that inhibit adhesion [232], or a direct inhibitory effect of lactoferrin on EPEC [251]. Besides breast feeding, protection offered by appropriate sanitary conditions and corrected hygiene and alimentation practices could prevent the infection of poor children in developing countries [252]. An EPEC vaccine would benefit poor children as these conditions are difficult to be implemented in these countries. However, there is currently no licensed vaccine available against EPEC infections of humans [reviewed in [253]]. A plant based vaccine was constructed using BfpA (the structural subunit A of the bundle-forming pilus) as antigens to induce high levels of phytosecreted BfpA in BALB/c mice by the induction and detection of fecal anti-BfpA antibodies [254]. Since natural infections in rabbits with a REPEC (Rabbit EPEC) strain induce A/E lesions in a manner similar to human EPEC [255, 256], the development of vaccines against human EPEC could benefit from the elaboration of a vaccine against REPEC or other A/E lesion producing pathogen. Some laboratories are trying to develop vaccines by inactivating some virulence genes to generate attenuated vaccines lacking genes encoding important virulence factors, such as intimin or the Ler-encoding gene [223, 255]. A deletion mutation in the ler gene in a wild-type REPEC strain was constructed resulting in diminished T3SS-secreted effector proteins by the mutant strain and in preventing REPEC from adhering intimately to the rabbit intestinal mucosa in vivo with vaccinated animals, demonstrating no clinical evidence of disease. It remains to be determined whether this vaccine could protect against A/E producing E. coli strains in different hosts [257, 258]. Other groups have cloned specific EPEC or EHEC virulence genes to induce protective responses in the host, mainly the gene encoding intimin. In a recent study, two distinct fragments of intimin β (one of the most frequent EPEC intimin subtype) were expressed in Lactobacillus casei strains for nasal immunization of mice. This procedure induced specific antibodies in the sera (IgG) and nasal washes (sIgA), which were active against the intimin immunodominant region and inhibited EPEC adhesion to epithelial cells in vitro [259]. In another recent study, an attenuated Vibrio cholerae strain (CVD 103-HgR) expressing the C-terminal portion of intimin in fusion with ClyA (a secreted protein from Salmonella enterica serovar Typhi) has been reported [260]. This construction showed moderate protection efficacy in rabbits challenged with a virulent REPEC strain. In addition, EspA was lately expressed in Lactococcus lactis NZ9000 and used to immunize mice; antisera from immunized animals were shown to interrupt the interaction of E. coli O157:H7 with the host cell [261]. Despite the assays were designed to produce an EspA-oral vaccine against E. coli O157:H7 infections, they could also be an alternative candidate to prevent EPEC infections. ACKNOWLEDGEMENT Work in the laboratory of T.A.T.G. is supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). Work in the laboratory of B.G.P. is supported by grants 81847 from CONACyT and IN224708 from DGAPA, UNAM. We thank Dr. Waldir P. Elias and B.G.P. lab students and academic technician Norma Espinosa Sánchez for useful discussion and contributions to this work. REFERENCES [1] [2] [3] [4] [5] [6]

Robins-Browne RM. Traditional enteropathogenic Escherichia coli of infantile diarrhea. Rev Infect Dis. 1987;9(1):28-53. Levine MM, Kaper JB, Black RE, et al. New knowledge on pathogenesis of bacterial enteric infections as applied to vaccine development. Microbiol Rev. 1983;47(4):510-50. Bray J. Isolation of antigenically homogeneous strains of Bacterium coli neopolitanum from summer diarrhoea of infants. J Pathol Bacteriol. 1945;57:239-47. Varela G, Aguirre A, Carrillo J. Escherichia coli-gomez nueva especie aislada de un caso mortal de diarrea. Bol Med Hosp Infant Mex. 1946;3(3). Levine MM. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis. 1987;155(3):377-89. Neter E, Westphal O, Luderitz O, et al. Demonstration of antibodies against enteropathogenic Escherichia coli in sera of children of various ages. Pediatrics. 1955;16(6):801-8.

38 Pathogenic Escherichia coli in Latin America

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27]

[28] [29] [30] [31]

[32]

[33] [34]

Gomes and González-Pedrajo

Levine MM, Bergquist EJ, Nalin DR, et al. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet. 1978;1(8074):1119-22. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11(1):142-201. Kaper JB. Defining EPEC. Rev Microbiol. 1996;27(130-3). Chen HD, Frankel G. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol Rev. 2005;29(1):8398. Trabulsi LR, Keller R, Tardelli Gomes TA. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8(5):508-13. Hernandes RT, Elias WP, Vieira MA, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2009;297(2):137-49. Tikhomirov E. WHO programme for the control of hospital infections. Chemioterapia. 1987;6(3):148-51. Campos LC, Franzolin MR, Trabulsi LR. Diarrheagenic Escherichia coli categories among the traditional enteropathogenic E. coli O serogroups--a review. Mem Inst Oswaldo Cruz. 2004;99(6):545-52. Elias WP, Barros SF, Moreira CG, et al. Enteroaggregative Escherichia coli strains among classical enteropathogenic Escherichia coli O serogroups. J Clin Microbiol. 2002;40(9):3540-1. Gomes TA, Vieira MA, Wachsmuth IK, et al. Serotype-specific prevalence of Escherichia coli strains with EPEC adherence factor genes in infants with and without diarrhea in Sao Paulo, Brazil. J Infect Dis. 1989;160(1):131-5. Torres AG, Zhou X, Kaper JB. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun. 2005;73(1):18-29. Giron JA, Donnenberg MS, Martin WC, et al. Distribution of the bundle-forming pilus structural gene (bfpA) among enteropathogenic Escherichia coli. J Infect Dis. 1993;168(4):1037-41. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. Scaletsky IC, Silva ML, Trabulsi LR. Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect Immun. 1984;45(2):534-6. Giron JA, Ho AS, Schoolnik GK. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science. 1991;254(5032):710-3. Polotsky YE, Dragunskaya EM, Seliverstova VG, et al. Pathogenic effect of enterotoxigenic Escherichia coli and Escherichia coli causing infantile diarrhoea. Acta Microbiol Acad Sci Hung. 1977;24(3):221-36. Nougayrede JP, Fernandes PJ, Donnenberg MS. Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol. 2003;5(6):359-72. Rodrigues J, Scaletsky IC, Campos LC, et al. Clonal structure and virulence factors in strains of Escherichia coli of the classic serogroup O55. Infect Immun. 1996;64(7):2680-6. Knutton S, Phillips AD, Smith HR, et al. Screening for enteropathogenic Escherichia coli in infants with diarrhea by the fluorescent-actin staining test. Infect Immun. 1991;59(1):365-71. Abe CM, Trabulsi LR, Blanco J, et al. Virulence features of atypical enteropathogenic Escherichia coli identified by the eae(+) EAF-negative stx(-) genetic profile. Diagn Microbiol Infect Dis. 2009;64(4):357-65. Dulguer MV, Fabbricotti SH, Bando SY, et al. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003;188(11):1685-94. Gomes TA, Irino K, Girao DM, et al. Emerging enteropathogenic Escherichia coli strains? Emerg Infect Dis. 2004;10(10):1851-5. Rosa AC, Mariano AT, Pereira AM, et al. Enteropathogenicity markers in Escherichia coli isolated from infants with acute diarrhoea and healthy controls in Rio de Janeiro, Brazil. J Med Microbiol. 1998;47(9):781-90. Pelayo JS, Scaletsky IC, Pedroso MZ, et al. Virulence properties of atypical EPEC strains. J Med Microbiol. 1999;48(1):41-9. Scaletsky IC, Pedroso MZ, Oliva CA, et al. A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea. Infect Immun. 1999;67(7):3410-5. Vieira MA, Andrade JR, Trabulsi LR, et al. Phenotypic and genotypic characteristics of Escherichia coli strains of nonenteropathogenic E. coli (EPEC) serogroups that carry eae and lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J Infect Dis. 2001;183(5):762-72. Robins-Browne RM, Bordun AM, Tauschek M, et al. Escherichia coli and community-acquired gastroenteritis, Melbourne, Australia. Emerg Infect Dis. 2004;10(10):1797-805. Nunes EB, Saridakis HO, Irino K, et al. Genotypic and phenotypic characterization of attaching and effacing Escherichia coli (AEEC) isolated from children with and without diarrhoea in Londrina, Brazil. J Med Microbiol. 2003;52(Pt 6):499-504.

Enteropathogenic Escherichia coli (EPEC)

[35] [36] [37] [38] [39] [40]

[41] [42] [43] [44] [45]

[46] [47] [48] [49] [50] [51] [52]

[53] [54] [55] [56] [57] [58] [59]

Pathogenic Escherichia coli in Latin America 39

Moreira CG, Palmer K, Whiteley M, et al. Bundle-forming pili and EspA are involved in biofilm formation by enteropathogenic Escherichia coli. J Bacteriol. 2006;188(11):3952-61. Stone KD, Zhang HZ, Carlson LK, et al. A cluster of fourteen genes from enteropathogenic Escherichia coli is sufficient for the biogenesis of a type IV pilus. Mol Microbiol. 1996;20(2):325-37. Sohel I, Puente JL, Ramer SW, et al. Enteropathogenic Escherichia coli: identification of a gene cluster coding for bundleforming pilus morphogenesis. J Bacteriol. 1996;178(9):2613-28. Cleary J, Lai LC, Shaw RK, et al. Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal epithelial cells: role of bundle-forming pili (BFP), EspA filaments and intimin. Microbiology. 2004;150(Pt 3):527-38. Hicks S, Frankel G, Kaper JB, et al. Role of intimin and bundle-forming pili in enteropathogenic Escherichia coli adhesion to pediatric intestinal tissue in vitro. Infect Immun. 1998;66(4):1570-8. Knutton S, Shaw RK, Anantha RP, et al. The type IV bundle-forming pilus of enteropathogenic Escherichia coli undergoes dramatic alterations in structure associated with bacterial adherence, aggregation and dispersal. Mol Microbiol. 1999;33(3):499-509. Tobe T, Sasakawa C. Role of bundle-forming pilus of enteropathogenic Escherichia coli in host cell adherence and in microcolony development. Cell Microbiol. 2001;3(9):579-85. Hyland RM, Sun J, Griener TP, et al. The bundlin pilin protein of enteropathogenic Escherichia coli is an Nacetyllactosamine-specific lectin. Cell Microbiol. 2008;10(1):177-87. Bieber D, Ramer SW, Wu CY, et al. Type IV pili, transient bacterial aggregates, and virulence of enteropathogenic Escherichia coli. Science. 1998;280(5372):2114-8. Jerse AE, Yu J, Tall BD, et al. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci U S A. 1990;87(20):7839-43. Frankel G, Candy DC, Everest P, et al. Characterization of the C-terminal domains of intimin-like proteins of enteropathogenic and enterohemorrhagic Escherichia coli, Citrobacter freundii, and Hafnia alvei. Infect Immun. 1994;62(5):1835-42. Jores J, Rumer L, Kiessling S, et al. A novel locus of enterocyte effacement (LEE) pathogenicity island inserted at pheV in bovine Shiga toxin-producing Escherichia coli strain O103:H2. FEMS Microbiol Lett. 2001;204(1):75-9. Adu-Bobie J, Frankel G, Bain C, et al. Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol. 1998;36(3):662-8. Blanco M, Blanco JE, Dahbi G, et al. Identification of two new intimin types in atypical enteropathogenic Escherichia coli. Int Microbiol. 2006;9(2):103-10. Tarr CL, Whittam TS. Molecular evolution of the intimin gene in O111 clones of pathogenic Escherichia coli. J Bacteriol. 2002;184(2):479-87. Yamamoto D, Hernandes RT, Blanco M, et al. Invasiveness as a putative additional virulence mechanism of some atypical Enteropathogenic Escherichia coli strains with different uncommon intimin types. BMC Microbiol. 2009;9:146. Zhang WL, Kohler B, Oswald E, et al. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol. 2002;40(12):4486-92. Jenkins C, Smith HR, Lawson AJ, et al. Serotypes, intimin subtypes, and antimicrobial resistance patterns of atypical enteropathogenic Escherichia coli isolated in England from 1993 to 1996. Eur J Clin Microbiol Infect Dis. 2006;25(1):1924. Moreira FC, Vieira MA, Ferreira AJ, et al. Escherichia coli strains of serotype O51:H40 comprise typical and atypical enteropathogenic E. coli strains and are potentially diarrheagenic. J Clin Microbiol. 2008;46(4):1462-5. Kenny B, DeVinney R, Stein M, et al. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell. 1997;91(4):511-20. Frankel G, Phillips AD. Attaching effacing Escherichia coli and paradigms of Tir-triggered actin polymerization: getting off the pedestal. Cell Microbiol. 2008;10(3):549-56. Phillips AD, Frankel G. Intimin-mediated tissue specificity in enteropathogenic Escherichia coli interaction with human intestinal organ cultures. J Infect Dis. 2000;181(4):1496-500. Klapproth JM, Scaletsky IC, McNamara BP, et al. A large toxin from pathogenic Escherichia coli strains that inhibits lymphocyte activation. Infect Immun. 2000;68(4):2148-55. Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol. 2000;35(2):275-88. Karmali MA, Mascarenhas M, Shen S, et al. Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol. 2003;41(11):4930-40.

40 Pathogenic Escherichia coli in Latin America

[60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80]

[81]

[82] [83] [84] [85] [86]

Gomes and González-Pedrajo

Klapproth JM, Sasaki M, Sherman M, et al. Citrobacter rodentium lifA/efa1 is essential for colonic colonization and crypt cell hyperplasia in vivo. Infect Immun. 2005;73(3):1441-51. Badea L, Doughty S, Nicholls L, et al. Contribution of Efa1/LifA to the adherence of enteropathogenic Escherichia coli to epithelial cells. Microb Pathog. 2003;34(5):205-15. Afset JE, Bruant G, Brousseau R, et al. Identification of virulence genes linked with diarrhea due to atypical enteropathogenic Escherichia coli by DNA microarray analysis and PCR. J Clin Microbiol. 2006;44(10):3703-11. Vieira MA, Salvador FA, Silva RM, et al. Prevalence and characteristics of the O122 pathogenicity island in typical and atypical enteropathogenic Escherichia coli strains. J Clin Microbiol. 2010;48(4):1452-5. Iguchi A, Thomson NR, Ogura Y, et al. Complete genome sequence and comparative genome analysis of enteropathogenic Escherichia coli O127:H6 strain E2348/69. J Bacteriol. 2009;191(1):347-54. Tatsuno I, Mundy R, Frankel G, et al. The lpf gene cluster for long polar fimbriae is not involved in adherence of enteropathogenic Escherichia coli or virulence of Citrobacter rodentium. Infect Immun. 2006;74(1):265-72. Baumler AJ, Tsolis RM, Heffron F. Contribution of fimbrial operons to attachment to and invasion of epithelial cell lines by Salmonella typhimurium. Infect Immun. 1996;64(5):1862-5. Jordan DM, Cornick N, Torres AG, et al. Long polar fimbriae contribute to colonization by Escherichia coli O157:H7 in vivo. Infect Immun. 2004;72(10):6168-71. Torres AG, Lopez-Sanchez GN, Milflores-Flores L, et al. Ler and H-NS, regulators controlling expression of the long polar fimbriae of Escherichia coli O157:H7. J Bacteriol. 2007;189(16):5916-28. Torres AG, Milflores-Flores L, Garcia-Gallegos JG, et al. Environmental regulation and colonization attributes of the long polar fimbriae (LPF) of Escherichia coli O157:H7. Int J Med Microbiol. 2007;297(3):177-85. Tomson FL, Viswanathan VK, Kanack KJ, et al. Enteropathogenic Escherichia coli EspG disrupts microtubules and in conjunction with Orf3 enhances perturbation of the tight junction barrier. Mol Microbiol. 2005;56(2):447-64. Torres AG, Blanco M, Valenzuela P, et al. Genes related to long polar fimbriae of pathogenic Escherichia coli strains as reliable markers to identify virulent isolates. J Clin Microbiol. 2009;47(8):2442-51. Rendon MA, Saldana Z, Erdem AL, et al. Commensal and pathogenic Escherichia coli use a common pilus adherence factor for epithelial cell colonization. Proc Natl Acad Sci U S A. 2007;104(25):10637-42. Beinke C, Laarmann S, Wachter C, et al. Diffusely adhering Escherichia coli strains induce attaching and effacing phenotypes and secrete homologs of Esp proteins. Infect Immun. 1998;66(2):528-39. Keller R, Ordonez JG, de Oliveira RR, et al. Afa, a diffuse adherence fibrillar adhesin associated with enteropathogenic Escherichia coli. Infect Immun. 2002;70(5):2681-9. Scaletsky IC, Michalski J, Torres AG, et al. Identification and characterization of the locus for diffuse adherence, which encodes a novel afimbrial adhesin found in atypical enteropathogenic Escherichia coli. Infect Immun. 2005;73(8):4753-65. Torres AG, Tutt CB, Duval L, et al. Bile salts induce expression of the afimbrial LDA adhesin of atypical enteropathogenic Escherichia coli. Cell Microbiol. 2007;9(4):1039-49. Barros SF, Abe CM, Rocha SP, et al. Escherichia coli O125ac:H6 encompasses atypical enteropathogenic E. coli strains that display the aggregative adherence pattern. J Clin Microbiol. 2008;46(12):4052-5. Ramos HC, Rumbo M, Sirard JC. Bacterial flagellins: mediators of pathogenicity and host immune responses in mucosa. Trends Microbiol. 2004;12(11):509-17. Giron JA, Torres AG, Freer E, et al. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol. 2002;44(2):361-79. Sampaio SC, Gomes TA, Pichon C, et al. The flagella of an atypical enteropathogenic Escherichia coli strain are required for efficient interaction with and stimulation of interleukin-8 production by enterocytes in vitro. Infect Immun. 2009;77(10):4406-13. Jarvis KG, Giron JA, Jerse AE, et al. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci USA. 1995;92(17):7996-8000. Elliott SJ, Wainwright LA, McDaniel TK, et al. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol Microbiol. 1998;28(1):1-4. Hueck CJ. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev. 1998;62(2):379-433. Cornelis GR. The type III secretion injectisome. Nat Rev Microbiol. 2006;4(11):811-25. Marlovits TC, Stebbins CE. Type III secretion systems shape up as they ship out. Curr Opin Microbiol. 2009;13(1):47-52. Galan JE, Wolf-Watz H. Protein delivery into eukaryotic cells by type III secretion machines. Nature. 2006;444(7119):567-73.

Enteropathogenic Escherichia coli (EPEC)

[87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107]

[108] [109] [110] [111] [112] [113] [114]

Pathogenic Escherichia coli in Latin America 41

Sekiya K, Ohishi M, Ogino T, et al. Supermolecular structure of the enteropathogenic Escherichia coli type III secretion system and its direct interaction with the EspA-sheath-like structure. Proc Natl Acad Sci USA. 2001;98(20):11638-43. Kubori T, Matsushima Y, Nakamura D, et al. Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science. 1998;280(5363):602-5. Blocker A, Jouihri N, Larquet E, et al. Structure and composition of the Shigella flexneri "needle complex", a part of its type III secreton. Mol Microbiol. 2001;39(3):652-63. Mueller CA, Broz P, Cornelis GR. The type III secretion system tip complex and translocon. Mol Microbiol. 2008;68(5):1085-95. Mueller CA, Broz P, Muller SA, et al. The V-antigen of Yersinia forms a distinct structure at the tip of injectisome needles. Science. 2005;310(5748):674-6. Macnab RM. Type III flagellar protein export and flagellar assembly. Biochim Biophys Acta. 2004;1694(1-3):207-17. Blocker A, Komoriya K, Aizawa S. Type III secretion systems and bacterial flagella: insights into their function from structural similarities. Proc Natl Acad Sci USA. 2003;100(6):3027-30. Gophna U, Ron EZ, Graur D. Bacterial type III secretion systems are ancient and evolved by multiple horizontal-transfer events. Gene. 2003;312:151-63. Ogino T, Ohno R, Sekiya K, et al. Assembly of the type III secretion apparatus of enteropathogenic Escherichia coli. J Bacteriol. 2006;188(8):2801-11. Genin S, Boucher CA. A superfamily of proteins involved in different secretion pathways in gram-negative bacteria: modular structure and specificity of the N-terminal domain. Mol Gen Genet. 1994;243(1):112-8. Gauthier A, Puente JL, Finlay BB. Secretin of the enteropathogenic Escherichia coli type III secretion system requires components of the type III apparatus for assembly and localization. Infect Immun. 2003;71(6):3310-9. Spreter T, Yip CK, Sanowar S, et al. A conserved structural motif mediates formation of the periplasmic rings in the type III secretion system. Nat Struct Mol Biol. 2009;16(5):468-76. Yip CK, Kimbrough TG, Felise HB, et al. Structural characterization of the molecular platform for type III secretion system assembly. Nature. 2005;435(7042):702-7. Pallen MJ, Beatson SA, Bailey CM. Bioinformatics analysis of the locus for enterocyte effacement provides novel insights into type-III secretion. BMC Microbiol. 2005;5(1):9. Minamino T, Imada K, Namba K. Mechanisms of type III protein export for bacterial flagellar assembly. Mol Biosyst. 2008;4(11):1105-15. Trevor FM, Spreter T, Strynadka NC. Piecing together the Type III injectisome of bacterial pathogens. Current Opinion in Structural Biology. 2007;18:1-9. Zarivach R, Deng W, Vuckovic M, et al. Structural analysis of the essential self-cleaving type III secretion proteins EscU and SpaS. Nature. 2008;453(7191):124-7. Schraidt O, Lefebre MD, Brunner MJ, et al. Topology and organization of the Salmonella typhimurium type III secretion needle complex components. PLoS Pathog. 2010;6(4):e1000824. Zhu K, Gonzalez-Pedrajo B, Macnab RM. Interactions among membrane and soluble components of the flagellar export apparatus of Salmonella. Biochemistry. 2002;41(30):9516-24. Creasey EA, Delahay RM, Daniell SJ, et al. Yeast two-hybrid system survey of interactions between LEE-encoded proteins of enteropathogenic Escherichia coli. Microbiology. 2003;149(Pt 8):2093-106. Dreyfus G, Williams AW, Kawagishi I, et al. Genetic and biochemical analysis of Salmonella typhimurium FliI, a flagellar protein related to the catalytic subunit of the F0F1 ATPase and to virulence proteins of mammalian and plant pathogens. J Bacteriol. 1993;175(10):3131-8. Eichelberg K, Ginocchio CC, Galan JE. Molecular and functional characterization of the Salmonella typhimurium invasion genes invB and invC: homology of InvC to the F0F1 ATPase family of proteins. J Bacteriol. 1994;176(15):4501-10. Akeda Y, Galan JE. Chaperone release and unfolding of substrates in type III secretion. Nature. 2005;437(7060):911-5. Gauthier A, Finlay BB. Translocated intimin receptor and its chaperone interact with ATPase of the type III secretion apparatus of enteropathogenic Escherichia coli. J Bacteriol. 2003;185(23):6747-55. Thomas J, Stafford GP, Hughes C. Docking of cytosolic chaperone-substrate complexes at the membrane ATPase during flagellar type III protein export. Proc Natl Acad Sci U S A. 2004;101(11):3945-50. Andrade A, Pardo JP, Espinosa N, et al. Enzymatic characterization of the enteropathogenic Escherichia coli type III secretion ATPase EscN. Arch Biochem Biophys. 2007;468(1):121-7. Zarivach R, Vuckovic M, Deng W, et al. Structural analysis of a prototypical ATPase from the type III secretion system. Nat Struct Mol Biol. 2007;14(2):131-7. Knutton S, Rosenshine I, Pallen MJ, et al. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. Embo J. 1998;17(8):2166-76.

42 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

[115] Daniell SJ, Takahashi N, Wilson R, et al. The filamentous type III secretion translocon of enteropathogenic Escherichia coli. Cell Microbiol. 2001;3(12):865-71. [116] Shaw RK, Daniell S, Ebel F, et al. EspA filament-mediated protein translocation into red blood cells. Cell Microbiol. 2001;3(4):213-22. [117] Crepin VF, Shaw R, Abe CM, et al. Polarity of enteropathogenic Escherichia coli EspA filament assembly and protein secretion. J Bacteriol. 2005;187(8):2881-9. [118] Ide T, Laarmann S, Greune L, et al. Characterization of translocation pores inserted into plasma membranes by type IIIsecreted Esp proteins of enteropathogenic Escherichia coli. Cell Microbiol. 2001;3(10):669-79. [119] Kenny B, Abe A, Stein M, et al. Enteropathogenic Escherichia coli protein secretion is induced in response to conditions similar to those in the gastrointestinal tract. Infect Immun. 1997;65(7):2606-12. [120] Deng W, Li Y, Hardwidge PR, et al. Regulation of type III secretion hierarchy of translocators and effectors in attaching and effacing bacterial pathogens. Infect Immun. 2005;73(4):2135-46. [121] Wang D, Roe AJ, McAteer S, et al. Hierarchal type III secretion of translocators and effectors from Escherichia coli O157:H7 requires the carboxy terminus of SepL that binds to Tir. Mol Microbiol. 2008;69(6):1499-512. [122] Deng W, Puente JL, Gruenheid S, et al. Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc Natl Acad Sci U S A. 2004;101(10):3597-602. [123] Dean P, Kenny B. The effector repertoire of enteropathogenic E. coli: ganging up on the host cell. Curr Opin Microbiol. 2009;12(1):101-9. [124] Kanack KJ, Crawford JA, Tatsuno I, et al. SepZ/EspZ is secreted and translocated into HeLa cells by the enteropathogenic Escherichia coli type III secretion system. Infect Immun. 2005;73(7):4327-37. [125] Kenny B. Enteropathogenic Escherichia coli (EPEC)-- a crafty subversive little bug. Microbiology. 2002;148(Pt 7):1967-78. [126] Jepson MA, Pellegrin S, Peto L, et al. Synergistic roles for the Map and Tir effector molecules in mediating uptake of enteropathogenic Escherichia coli (EPEC) into non-phagocytic cells. Cell Microbiol. 2003;5(11):773-83. [127] Kenny B, Ellis S, Leard AD, et al. Co-ordinate regulation of distinct host cell signalling pathways by multifunctional enteropathogenic Escherichia coli effector molecules. Mol Microbiol. 2002;44(4):1095-107. [128] Garmendia J, Frankel G, Crepin VF. Enteropathogenic and enterohemorrhagic Escherichia coli infections: translocation, translocation, translocation. Infect Immun. 2005;73(5):2573-85. [129] Dean P, Maresca M, Kenny B. EPEC's weapons of mass subversion. Curr Opin Microbiol. 2005;8(1):28-34. [130] Kenny B, Jepson M. Targeting of an enteropathogenic Escherichia coli (EPEC) effector protein to host mitochondria. Cell Microbiol. 2000;2(6):579-90. [131] Dean P, Kenny B. Intestinal barrier dysfunction by enteropathogenic Escherichia coli is mediated by two effector molecules and a bacterial surface protein. Mol Microbiol. 2004;54(3):665-75. [132] Bulgin R, Raymond B, Garnett JA, et al. Bacterial guanine nucleotide exchange factors SopE-like and WxxxE effectors. Infect Immun. 2010;78(4):1417-25. [133] Nougayrede JP, Donnenberg MS. Enteropathogenic Escherichia coli EspF is targeted to mitochondria and is required to initiate the mitochondrial death pathway. Cell Microbiol. 2004;6(11):1097-111. [134] McNamara BP, Koutsouris A, O'Connell CB, et al. Translocated EspF protein from enteropathogenic Escherichia coli disrupts host intestinal barrier function. J Clin Invest. 2001;107(5):621-9. [135] Shaw RK, Cleary J, Murphy MS, et al. Interaction of enteropathogenic Escherichia coli with human intestinal mucosa: role of effector proteins in brush border remodeling and formation of attaching and effacing lesions. Infect Immun. 2005;73(2):1243-51. [136] Peralta-Ramirez J, Hernandez JM, Manning-Cela R, et al. EspF Interacts with nucleation-promoting factors to recruit junctional proteins into pedestals for pedestal maturation and disruption of paracellular permeability. Infect Immun. 2008;76(9):3854-68. [137] Crane JK, McNamara BP, Donnenberg MS. Role of EspF in host cell death induced by enteropathogenic Escherichia coli. Cell Microbiol. 2001;3(4):197-211. [138] Quitard S, Dean P, Maresca M, et al. The enteropathogenic Escherichia coli EspF effector molecule inhibits PI-3 kinasemediated uptake independently of mitochondrial targeting. Cell Microbiol. 2006;8(6):972-81. [139] Shaw RK, Smollett K, Cleary J, et al. Enteropathogenic Escherichia coli type III effectors EspG and EspG2 disrupt the microtubule network of intestinal epithelial cells. Infect Immun. 2005;73(7):4385-90. [140] Matsuzawa T, Kuwae A, Yoshida S, et al. Enteropathogenic Escherichia coli activates the RhoA signaling pathway via the stimulation of GEF-H1. Embo J. 2004;23(17):3570-82. [141] Gill RK, Borthakur A, Hodges K, et al. Mechanism underlying inhibition of intestinal apical Cl/OH exchange following infection with enteropathogenic E. coli. J Clin Invest. 2007;117(2):428-37.

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 43

[142] Dean P, Muhlen S, Quitard S, et al. The bacterial effectors EspG and EspG2 induce a destructive calpain activity that is kept in check by the co-delivered Tir effector. Cell Microbiol. 2010 Mar 25. [143] Tu X, Nisan I, Yona C, et al. EspH, a new cytoskeleton-modulating effector of enterohaemorrhagic and enteropathogenic Escherichia coli. Mol Microbiol. 2003;47(3):595-606. [144] Dong N, Liu L, Shao F. A bacterial effector targets host DH-PH domain RhoGEFs and antagonizes macrophage phagocytosis. EMBO J. 2010;29(8):1363-76. [145] Shames SR, Deng W, Guttman JA, et al. The pathogenic E. coli type III effector EspZ interacts with host CD98 and facilitates host cell prosurvival signaling. Cell Microbiol. 2010 Mar 31. [146] Taylor KA, O'Connell CB, Luther PW, et al. The EspB protein of enteropathogenic Escherichia coli is targeted to the cytoplasm of infected HeLa cells. Infect Immun. 1998;66(11):5501-7. [147] Iizumi Y, Sagara H, Kabe Y, et al. The enteropathogenic E. coli effector EspB facilitates microvillus effacing and antiphagocytosis by inhibiting myosin function. Cell Host Microbe. 2007;2(6):383-92. [148] Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol. 2010;8(1):26-38. [149] Kim J, Thanabalasuriar A, Chaworth-Musters T, et al. The bacterial virulence factor NleA inhibits cellular protein secretion by disrupting mammalian COPII function. Cell Host Microbe. 2007;2(3):160-71. [150] Thanabalasuriar A, Koutsouris A, Weflen A, et al. The bacterial virulence factor NleA is required for the disruption of intestinal tight junctions by enteropathogenic Escherichia coli. Cell Microbiol. 2009;12(1):31-41. [151] Nadler C, Baruch K, Kobi S, et al. The type III secretion effector NleE inhibits NF-kappaB activation. PLoS Pathog. 2010;6(1):e1000743. [152] Zurawski DV, Mumy KL, Badea L, et al. The NleE/OspZ family of effector proteins is required for polymorphonuclear transepithelial migration, a characteristic shared by enteropathogenic Escherichia coli and Shigella flexneri infections. Infect Immun. 2008;76(1):369-79. [153] Hemrajani C, Berger CN, Robinson KS, et al. NleH effectors interact with Bax inhibitor-1 to block apoptosis during enteropathogenic Escherichia coli infection. Proc Natl Acad Sci U S A. 2010;107(7):3129-34. [154] Matsuzawa T, Kuwae A, Abe A. Enteropathogenic Escherichia coli type III effectors EspG and EspG2 alter epithelial paracellular permeability. Infect Immun. 2005;73(10):6283-9. [155] Marches O, Covarelli V, Dahan S, et al. EspJ of enteropathogenic and enterohaemorrhagic Escherichia coli inhibits opsono-phagocytosis. Cell Microbiol. 2008;10(5):1104-15. [156] Samba-Louaka A, Nougayrede JP, Watrin C, et al. The enteropathogenic Escherichia coli effector Cif induces delayed apoptosis in epithelial cells. Infect Immun. 2009;77(12):5471-7. [157] Ghosh P. Process of protein transport by the type III secretion system. Microbiol Mol Biol Rev. 2004;68(4):771-95. [158] Elliott SJ, O'Connell CB, Koutsouris A, et al. A gene from the locus of enterocyte effacement that is required for enteropathogenic Escherichia coli to increase tight-junction permeability encodes a chaperone for EspF. Infect Immun. 2002;70(5):2271-7. [159] Elliott SJ, Hutcheson SW, Dubois MS, et al. Identification of CesT, a chaperone for the type III secretion of Tir in enteropathogenic Escherichia coli. Mol Microbiol. 1999;33(6):1176-89. [160] Creasey EA, Delahay RM, Bishop AA, et al. CesT is a bivalent enteropathogenic Escherichia coli chaperone required for translocation of both Tir and Map. Mol Microbiol. 2003;47(1):209-21. [161] Abe A, de Grado M, Pfuetzner RA, et al. Enteropathogenic Escherichia coli translocated intimin receptor, Tir, requires a specific chaperone for stable secretion. Mol Microbiol. 1999;33(6):1162-75. [162] Thomas NA, Deng W, Baker N, et al. Hierarchical delivery of an essential host colonization factor in enteropathogenic Escherichia coli. J Biol Chem. 2007;282(40):29634-45. [163] Thomas NA, Deng W, Puente JL, et al. CesT is a multi-effector chaperone and recruitment factor required for the efficient type III secretion of both LEE- and non-LEE-encoded effectors of enteropathogenic Escherichia coli. Mol Microbiol. 2005;57(6):1762-79. [164] Mills E, Baruch K, Charpentier X, et al. Real-time analysis of effector translocation by the type III secretion system of enteropathogenic Escherichia coli. Cell Host Microbe. 2008;3(2):104-13. [165] Yen YT, Kostakioti M, Henderson IR, et al. Common themes and variations in serine protease autotransporters. Trends Microbiol. 2008;16(8):370-9. [166] Mellies JL, Navarro-Garcia F, Okeke I, et al. espC pathogenicity island of enteropathogenic Escherichia coli encodes an enterotoxin. Infect Immun. 2001;69(1):315-24. [167] Stein M, Kenny B, Stein MA, et al. Characterization of EspC, a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous to members of the immunoglobulin A protease-like family of secreted proteins. J Bacteriol. 1996;178(22):6546-54.

44 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

[168] Navarro-Garcia F, Canizalez-Roman A, Sui BQ, et al. The serine protease motif of EspC from enteropathogenic Escherichia coli produces epithelial damage by a mechanism different from that of Pet toxin from enteroaggregative E. coli. Infect Immun. 2004;72(6):3609-21. [169] Drago-Serrano ME, Parra SG, Manjarrez-Hernandez HA. EspC, an autotransporter protein secreted by enteropathogenic Escherichia coli (EPEC), displays protease activity on human hemoglobin. FEMS Microbiol Lett. 2006;265(1):35-40. [170] Vidal JE, Navarro-Garcia F. EspC translocation into epithelial cells by enteropathogenic Escherichia coli requires a concerted participation of type V and III secretion systems. Cell Microbiol. 2008;10(10):1975-86. [171] Mellies JL, Barron AM, Carmona AM. Enteropathogenic and enterohemorrhagic Escherichia coli virulence gene regulation. Infect Immun. 2007;75(9):4199-210. [172] Bustamante VH, Santana FJ, Calva E, et al. Transcriptional regulation of type III secretion genes in enteropathogenic Escherichia coli: Ler antagonizes H-NS-dependent repression. Mol Microbiol. 2001;39(3):664-78. [173] Lio JC, Syu WJ. Identification of a negative regulator for the pathogenicity island of enterohemorrhagic Escherichia coli O157:H7. J Biomed Sci. 2004;11(6):855-63. [174] Barba J, Bustamante VH, Flores-Valdez MA, et al. A positive regulatory loop controls expression of the locus of enterocyte effacement-encoded regulators Ler and GrlA. J Bacteriol. 2005;187(23):7918-30. [175] Porter ME, Mitchell P, Roe AJ, et al. Direct and indirect transcriptional activation of virulence genes by an AraC-like protein, PerA from enteropathogenic Escherichia coli. Mol Microbiol. 2004;54(4):1117-33. [176] Gomez-Duarte OG, Kaper JB. A plasmid-encoded regulatory region activates chromosomal eaeA expression in enteropathogenic Escherichia coli. Infect Immun. 1995;63(5):1767-76. [177] Elliott SJ, Sperandio V, Giron JA, et al. The locus of enterocyte effacement (LEE)-encoded regulator controls expression of both LEE- and non-LEE-encoded virulence factors in enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 2000;68(11):6115-26. [178] Li M, Rosenshine I, Tung SL, et al. Comparative proteomic analysis of extracellular proteins of enterohemorrhagic and enteropathogenic Escherichia coli strains and their ihf and ler mutants. Appl Environ Microbiol. 2004;70(9):5274-82. [179] Roe AJ, Tysall L, Dransfield T, et al. Analysis of the expression, regulation and export of NleA-E in Escherichia coli O157: H7. Microbiology. 2007;153(Pt 5):1350-60. [180] Pedroso MZ, Freymuller E, Trabulsi LR, et al. Attaching-effacing lesions and intracellular penetration in HeLa cells and human duodenal mucosa by two Escherichia coli strains not belonging to the classical enteropathogenic E. coli serogroups. Infect Immun. 1993;61(3):1152-6. [181] Ulshen MH, Rollo JL. Pathogenesis of Escherichia coli gastroenteritis in man--another mechanism. N Engl J Med. 1980;302(2):99-101. [182] Miliotis MD, Koornhof HJ, Phillips JI. Invasive potential of noncytotoxic enteropathogenic Escherichia coli in an in vitro Henle 407 cell model. Infect Immun. 1989;57(7):1928-35. [183] Francis CL, Jerse AE, Kaper JB, et al. Characterization of interactions of enteropathogenic Escherichia coli O127:H6 with mammalian cells in vitro. J Infect Dis. 1991;164(4):693-703. [184] Donnenberg MS, Donohue-Rolfe A, Keusch GT. Epithelial cell invasion: an overlooked property of enteropathogenic Escherichia coli (EPEC) associated with the EPEC adherence factor. J Infect Dis. 1989;160(3):452-9. [185] Andrade JR, Da Veiga VF, De Santa Rosa MR, et al. An endocytic process in HEp-2 cells induced by enteropathogenic Escherichia coli. J Med Microbiol. 1989;28(1):49-57. [186] Rosa AC, Vieira MA, Tibana A, et al. Interactions of Escherichia coli strains of non-EPEC serogroups that carry eae and lack the EAF and stx gene sequences with undifferentiated and differentiated intestinal human Caco-2 cells. FEMS Microbiol Lett. 2001;200(1):117-22. [187] Hernandes RT, Silva RM, Carneiro SM, et al. The localized adherence pattern of an atypical enteropathogenic Escherichia coli is mediated by intimin omicron and unexpectedly promotes HeLa cell invasion. Cell Microbiol. 2008;10(2):415-25. [188] Scaletsky IC, Pedroso MZ, Fagundes-Neto U. Attaching and effacing enteropathogenic Escherichia coli O18ab invades epithelial cells and causes persistent diarrhea. Infect Immun. 1996;64(11):4876-81. [189] Bulgin RR, Arbeloa A, Chung JC, et al. EspT triggers formation of lamellipodia and membrane ruffles through activation of Rac-1 and Cdc42. Cell Microbiol. 2009;11(2):217-29. [190] Nguyen RN, Taylor LS, Tauschek M, et al. Atypical enteropathogenic Escherichia coli infection and prolonged diarrhea in children. Emerg Infect Dis. 2006;12(4):597-603. [191] Afset JE, Bevanger L, Romundstad P, et al. Association of atypical enteropathogenic Escherichia coli (EPEC) with prolonged diarrhoea. J Med Microbiol. 2004;53(Pt 11):1137-44. [192] Vieira MA, Gomes TA, Ferreira AJ, et al. Two atypical enteropathogenic Escherichia coli strains induce the production of secreted and membrane-bound mucins to benefit their own growth at the apical surface of human mucin-secreting intestinal HT29-MTX cells. Infect Immun. 2010;78(3):927-38.

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 45

[193] Levine MM, Nataro JP, Karch H, et al. The diarrheal response of humans to some classic serotypes of enteropathogenic Escherichia coli is dependent on a plasmid encoding an enteroadhesiveness factor. J Infect Dis. 1985;152(3):550-9. [194] Bielaszewska M, Middendorf B, Kock R, et al. Shiga toxin-negative attaching and effacing Escherichia coli: distinct clinical associations with bacterial phylogeny and virulence traits and inferred in-host pathogen evolution. Clin Infect Dis. 2008;47(2):208-17. [195] Lacher DW, Steinsland H, Blank TE, et al. Molecular evolution of typical enteropathogenic Escherichia coli: clonal analysis by multilocus sequence typing and virulence gene allelic profiling. J Bacteriol. 2007;189(2):342-50. [196] Bando SY, Andrade FB, Guth BE, et al. Atypical enteropathogenic Escherichia coli genomic background allows the acquisition of non-EPEC virulence factors. FEMS Microbiol Lett. 2009;299(1):22–30. [197] Toledo MR, Alvariza Mdo C, Murahovschi J, et al. Enteropathogenic Escherichia coli serotypes and endemic diarrhea in infants. Infect Immun. 1983;39(2):586-9. [198] Gomes TA, Rassi V, MacDonald KL, et al. Enteropathogens associated with acute diarrheal disease in urban infants in Sao Paulo, Brazil. J Infect Dis. 1991;164(2):331-7. [199] Cravioto A, Reyes RE, Trujillo F, et al. Risk of diarrhea during the first year of life associated with initial and subsequent colonization by specific enteropathogens. Am J Epidemiol. 1990;131(5):886-904. [200] Cravioto A, Reyes RE, Ortega R, et al. Prospective study of diarrhoeal disease in a cohort of rural Mexican children: incidence and isolated pathogens during the first two years of life. Epidemiol Infect. 1988;101(1):123-34. [201] Cohen MB, Nataro JP, Bernstein DI, et al. Prevalence of diarrheagenic Escherichia coli in acute childhood enteritis: a prospective controlled study. J Pediatr. 2005;146(1):54-61. [202] Regua-Mangia AH, Gomes TA, Vieira MA, et al. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Infect. 2004;48(2):161-7. [203] Ochoa TJ, Barletta F, Contreras C, et al. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans R Soc Trop Med Hyg. 2008;102(9):852-6. [204] Moreno AC, Filho AF, Gomes Tdo A, et al. Etiology of childhood diarrhea in the northeast of Brazil: significant emergent diarrheal pathogens. Diagn Microbiol Infect Dis. 2010;66(1):50-7. [205] Franzolin MR, Alves RC, Keller R, et al. Prevalence of diarrheagenic Escherichia coli in children with diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2005;100(4):359-63. [206] Bueris V, Sircili MP, Taddei CR, et al. Detection of diarrheagenic Escherichia coli from children with and without diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2007;102(7):839-44. [207] Araujo JM, Tabarelli GF, Aranda KR, et al. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007;45(10):3396-9. [208] Estrada-Garcia T, Cerna JF, Paheco-Gil L, et al. Drug-resistant diarrheogenic Escherichia coli, Mexico. Emerg Infect Dis. 2005;11(8):1306-8. [209] Viljanen MK, Peltola T, Junnila SY, et al. Outbreak of diarrhoea due to Escherichia coli O111:B4 in schoolchildren and adults: association of Vi antigen-like reactivity. Lancet. 1990;336(8719):831-4. [210] Hedberg CW, Savarino SJ, Besser JM, et al. An outbreak of foodborne illness caused by Escherichia coli O39:NM, an agent not fitting into the existing scheme for classifying diarrheogenic E. coli. J Infect Dis. 1997;176(6):1625-8. [211] Yatsuyanagi J, Saito S, Miyajima Y, et al. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41(5):2033-9. [212] Blake PA, Ramos S, MacDonald KL, et al. Pathogen-specific risk factors and protective factors for acute diarrheal disease in urban Brazilian infants. J Infect Dis. 1993;167(3):627-32. [213] Fagundes-Neto U, Scaletsky IC. The gut at war: the consequences of enteropathogenic Escherichia coli infection as a factor of diarrhea and malnutrition. Sao Paulo Med J. 2000;118(1):21-9. [214] Ferguson WW, June RC. Experiments on feeding adult volunteers with Escherichia coli 111, B4, a coliform organism associated with infant diarrhea. Am J Hyg. 1952;55(2):155-69. [215] June RC, Ferguson WW, Worfel MT. Experiments in feeding adult volunteers with Escherichia coli 55, B5, a coliform organism associated with infant diarrhea. Am J Hyg. 1953;57(2):222-36. [216] Thoren A. The role of enteropathogenic E. coli in infantile diarrhoea. Aspects on bacteriology, epidemiology and therapy. Scand J Infect Dis Suppl. 1983;37:1-51. [217] Levine MM, Edelman R. Enteropathogenic Escherichia coli of classic serotypes associated with infant diarrhea: epidemiology and pathogenesis. Epidemiol Rev. 1984;6:31-51. [218] Taylor CJ, Hart A, Batt RM, et al. Ultrastructural and biochemical changes in human jejunal mucosa associated with enteropathogenic Escherichia coli (0111) infection. J Pediatr Gastroenterol Nutr. 1986;5(1):70-3. [219] Sherman P, Drumm B, Karmali M, et al. Adherence of bacteria to the intestine in sporadic cases of enteropathogenic Escherichia coli-associated diarrhea in infants and young children: a prospective study. Gastroenterology. 1989;96(1):86-94.

46 Pathogenic Escherichia coli in Latin America

Gomes and González-Pedrajo

[220] Rothbaum RJ, Partin JC, Saalfield K, et al. An ultrastructural study of enteropathogenic Escherichia coli infection in human infants. Ultrastruct Pathol. 1983;4(4):291-304. [221] Clausen CR, Christie DL. Chronic diarrhea in infants caused by adherent enteropathogenic Escherichia coli. J Pediatr. 1982;100(3):358-61. [222] Boedeker E. Enteroadherent (enteropathogenic) Escherichia coli. London: Chapman and Hall; 1988. [223] Donnenberg MS, Tacket CO, James SP, et al. Role of the eaeA gene in experimental enteropathogenic Escherichia coli infection. J Clin Invest. 1993;92(3):1412-7. [224] Silva ML, Giampaglia CM. Colostrum and human milk inhibit localized adherence of enteropathogenic Escherichia coli to HeLa cells. Acta Paediatr. 1992;81(3):266-7. [225] Sanches MI, Keller R, Hartland EL, et al. Human colostrum and serum contain antibodies reactive to the intimin-binding region of the enteropathogenic Escherichia coli translocated intimin receptor. J Pediatr Gastroenterol Nutr. 2000;30(1):73-7. [226] Parissi-Crivelli A, Parissi-Crivelli JM, Giron JA. Recognition of enteropathogenic Escherichia coli virulence determinants by human colostrum and serum antibodies. J Clin Microbiol. 2000;38(7):2696-700. [227] Palmeira P, Carbonare SB, Silva ML, et al. Inhibition of enteropathogenic Escherichia coli (EPEC) adherence to HEp-2 cells by bovine colostrum and milk. Allergol Immunopathol (Madr). 2001;29(6):229-37. [228] Nagao AT, Friedlander-Del Nero D, Arslanian C, et al. Elevated levels and different repertoire profile of colostral antiLPS antibodies may have a significant role in compensating newborn immunity. Scand J Immunol. 2001;53(6):602-9. [229] Martinez MB, Taddei CR, Ruiz-Tagle A, et al. Antibody response of children with enteropathogenic Escherichia coli infection to the bundle-forming pilus and locus of enterocyte effacement-encoded virulence determinants. J Infect Dis. 1999;179(1):269-74. [230] Loureiro I, Frankel G, Adu-Bobie J, et al. Human colostrum contains IgA antibodies reactive to enteropathogenic Escherichia coli virulence-associated proteins: intimin, BfpA, EspA, and EspB. J Pediatr Gastroenterol Nutr. 1998;27(2):166-71. [231] Donnenberg MS, Tacket CO, Losonsky G, et al. Effect of prior experimental human enteropathogenic Escherichia coli infection on illness following homologous and heterologous rechallenge. Infect Immun. 1998;66(1):52-8. [232] Cravioto A, Tello A, Villafan H, et al. Inhibition of localized adhesion of enteropathogenic Escherichia coli to HEp-2 cells by immunoglobulin and oligosaccharide fractions of human colostrum and breast milk. J Infect Dis. 1991;163(6):1247-55. [233] Costa-Carvalho BT, Bertipaglia A, Sole D, et al. Detection of immunoglobulin (IgG and IgA) anti-outer-membrane proteins of enteropathogenic Escherichia coli (EPEC) in saliva, colostrum, breast milk, serum, cord blood and amniotic fluid. Study of inhibition of localized adherence of EPEC to HeLa cells. Acta Paediatr. 1994;83(8):870-3. [234] Carbonare CB, Carbonare SB, Carneiro-Sampaio MM. Early acquisition of serum and saliva antibodies reactive to enteropathogenic Escherichia coli virulence-associated proteins by infants living in an endemic area. Pediatr Allergy Immunol. 2003;14(3):222-8. [235] Camara LM, Carbonare SB, Silva ML, et al. Inhibition of enteropathogenic Escherichia coli (EPEC) adhesion to HeLa cells by human colostrum: detection of specific sIgA related to EPEC outer-membrane proteins. Int Arch Allergy Immunol. 1994;103(3):307-10. [236] Palmeira P, Costa-Carvalho BT, Arslanian C, et al. Transfer of antibodies across the placenta and in breast milk from mothers on intravenous immunoglobulin. Pediatr Allergy Immunol. 2009;20(6):528-35. [237] Zhou X, Giron JA, Torres AG, et al. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun. 2003;71(4):2120-9. [238] Nataro JP, Baldini MM, Kaper JB, et al. Detection of an adherence factor of enteropathogenic Escherichia coli with a DNA probe. J Infect Dis. 1985;152(3):560-5. [239] Muller D, Greune L, Heusipp G, et al. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl Environ Microbiol. 2007;73(10):3380-90. [240] Baldini MM, Kaper JB, Levine MM, et al. Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J Pediatr Gastroenterol Nutr. 1983;2(3):534-8. [241] Aranda KR, Fabbricotti SH, Fagundes-Neto U, et al. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol Lett. 2007;267(2):145-50. [242] Nara JM, Cianciarullo AM, Culler HF, et al. Differentiation of typical and atypical enteropathogenic Escherichia coli using colony immunoblot for detection of bundle-forming pilus expression. J Appl Microbiol. 2010;109(1):35–43. [243] Knutton S, Baldwin T, Williams PH, et al. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 1989;57(4):1290-8.

Enteropathogenic Escherichia coli (EPEC)

Pathogenic Escherichia coli in Latin America 47

[244] Senerwa D, Mutanda LN, Gathuma JM, et al. Antimicrobial resistance of enteropathogenic Escherichia coli strains from a nosocomial outbreak in Kenya. Apmis. 1991;99(8):728-34. [245] Scaletsky IC, Souza TB, Aranda KR, et al. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol. 2010;10:25. [246] Moyenuddin M, Wachsmuth IK, Moseley SL, et al. Serotype, antimicrobial resistance, and adherence properties of Escherichia coli strains associated with outbreaks of diarrheal illness in children in the United States. J Clin Microbiol. 1989;27(10):2234-9. [247] Gross RJ, Rowe B, Threlfall EJ. Escherichia coli 0142.H6; a drug-resistant enteropathogenic clone? J Hyg (Lond). 1985;94(2):181-91. [248] Nwaneshiudu AI, Mucci T, Pickard DJ, et al. A second large plasmid encodes conjugative transfer and antimicrobial resistance in O119:H2 and some typical O111 enteropathogenic Escherichia coli strains. J Bacteriol. 2007;189(16):6074-9. [249] Giles C, Sangster G, Smith J. Epidemic gastro-enteritis of infants in Aberdeen during 1947. Arch Dis Child. 1949;24(117):45-53. [250] Robins-Browne RM, Still CS, Miliotis MD, et al. Summer diarrhoea in African infants and children. Arch Dis Child. 1980;55(12):923-8. [251] Boesman-Finkelstein MF, Finkelstein RA. Antimicrobial effects of human milk: inhibitory effect on enteric pathogens. FEMS Microbiol Lett. 1985;27:167-74. [252] Sobel J, Gomes TA, Ramos RT, et al. Pathogen-specific risk factors and protective factors for acute diarrheal illness in children aged 12-59 months in Sao Paulo, Brazil. Clin Infect Dis. 2004;38(11):1545-51. [253] Horne C, Vallance BA, Deng W, et al. Current progress in enteropathogenic and enterohemorrhagic Escherichia coli vaccines. Expert Rev Vaccines. 2002;1(4):483-93. [254] Silva J, Garcia A, Flores V, et al. Phytosecretion of enteropathogenic Escherichia coli to HeLa cells. Acta Paediatr Scand. 2002;81:266-7. [255] Agin TS, Zhu C, Johnson LA, et al. Protection against hemorrhagic colitis in an animal model by oral immunization with isogeneic rabbit enteropathogenic Escherichia coli attenuated by truncating intimin. Infect Immun. 2005;73(10):6608-19. [256] Cantey JR, Blake RK. Diarrhea due to Escherichia coli in the rabbit: a novel mechanism. J Infect Dis. 1977;135(3):45462. [257] Zhu C, Feng S, Thate TE, et al. Towards a vaccine for attaching/effacing Escherichia coli: a LEE encoded regulator (ler) mutant of rabbit enteropathogenic Escherichia coli is attenuated, immunogenic, and protects rabbits from lethal challenge with the wild-type virulent strain. Vaccine. 2006;24(18):3845-55. [258] Zhu C, Feng S, Yang Z, et al. LEE-encoded regulator (Ler) mutants elicit serotype-specific protection, but not cross protection, against attaching and effacing E. coli strains. Vaccine. 2007;25(10):1884-92. [259] Ferreira PC, Campos IB, Abe CM, et al. Immunization of mice with Lactobacillus casei expressing intimin fragments produces antibodies able to inhibit the adhesion of enteropathogenic Escherichia coli to cultivated epithelial cells. FEMS Immunol Med Microbiol. 2008;54(2):245-54. [260] Keller R, Hilton TD, Rios H, et al. Development of a live oral attaching and effacing Escherichia coli vaccine candidate using Vibrio cholerae CVD 103-HgR as antigen vector. Microb Pathog. 2010;48(1):1-8. [261] Luan J, Zhuang Z, Liu Y, et al. Expression of EspA in Lactococcus lactis NZ9000 and the detection of its immune effect in vivo and vitro. Immunopharmacol Immunotoxicol. 2010;32(1):133-40.

48

Pathogenic Escherichia coli in Latin America, 2010, 48-64

CHAPTER 4 Enteroaggregative Escherichia coli Fernando Navarro-Garcia1*, Waldir P Elias2, Jose Flores3 and Pablo C Okhuysen3 1

Department of Cell Biology, Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV-IPN), México DF, Mexico; 2Laboratory of Bacteriology, Instituto Butantan, São Paulo, SP, Brazil; 3Division of Infectious Diseases, The University of Texas at Houston Medical School, Houston, Texas, USA Abstract: Enteroaggregative Escherichia coli (EAEC) have been identified in children and adults living in developed and developing countries as well as in travelers returning from developing countries and in patients infected with HIV. In addition to the acute complications of diarrhea, such as dehydration and death, EAEC can also cause persisting diarrhea that can lead in turn to malnutrition and impaired growth and development in children. EAEC strains are defined by the ability to produce a “stacked brick” appearance when placed on HEp-2 epithelial cells in culture, and contaminated food appears to be the main source of EAEC infection. EAEC are genetically heterogeneous. EAEC strain 042 is the prototypical strain for the study of virulence factors and pathogenicity; however, emergence of atypical EAEC has been described. Three major features of EAEC pathogenesis have been defined; abundant adherence to the intestinal mucosa, elaboration of enterotoxins and cytotoxins, and induction of mucosal inflammation. Infection with strains that possess specific virulence factors correlate with elevated levels of fecal cytokines and inflammatory markers. Unfortunately, the diagnosis of EAEC infection remains limited to research laboratories and therefore, are of little use in guiding antibiotic therapy. EAEC induce short-term immunity in healthy individuals which suggests that immunoprophylaxis is a potential option for control of EAEC.

INTRODUCTION The pathogenesis and protective immunity to enteroaggregative Escherichia coli (EAEC) and diffusely adhering E. coli (DAEC) are the poorest understood compared to the other four diarrheagenic categories: enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shiga toxin-producing E. coli (STEC) and enteroinvasive E. coli (EIEC) [1]. Considerable advances have been made on the understanding of pathogenesis and prevention of these last four categories, even though diarrheagenic E. coli is still loosely classified into these six major categories based on clinical associations, serotyping, phenotypic assays and identification of virulence characteristics.

Figure 1: The adherence pattern of enteroaggregative E. coli (EAEC) to HEp-2 cells. EAEC adheres to HEp-2 cells in a pattern known as auto-aggregative, in which bacteria adhere to each other in a 'stacked-brick' configuration.

A common feature that defines EAEC strains is the ability to produce a “stacked brick” appearance (Fig. 1) when placed on HEp-2 epithelial cells in culture [1]. This phenotype is derived from the ability of EAEC to attach to other EAEC, to the epithelial cells, and to the surface of tissue culture plates. At the molecular level (described later in this *Address correspondence to: Dr. Fernando Navarro-Garcia. Department of Cell Biology, CINVESTAV-IPN, Ap. Postal 14-740, 07000 México DF, Mexico. Tel: (52-55) 5747-3990. Fax: (52-55) 5747-3393. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 49

chapter in detail) the aggregative phenotype determinants (also referred to as the AA phenotype) of EAEC are contained in a large plasmid (pAA) that carries a number of virulence genes that are under the control of the master aggR regulator. Shortly after the initial description of EAEC in 1987 by Nataro et al. [2] an empirically derived probe originally denominated CVD432 or AA was developed in the early 1990’s by Baudry et al. [3] and served as the basis for a PCR based assay a few years later [4]. This AA probe was later shown to hybridize with a region of in the pAA coding for an ABC transporter apparatus that is needed to translocate the antiaggregative protein dispersin across the bacterial cell membrane [5] The study of EAEC experienced a breakthrough in 1994, when the ability of this pathotype to cause diarrhea was left in no doubt when a volunteer study demonstrated that the prototypic EAEC strain 042, originally identified in a child with diarrhea in Peru, elicited diarrhea in the majority of volunteers challenged with 109 c.f.u. in a study at the Center for Vaccine Development, University of Maryland [6]. However, volunteers exposed to other EAEC strains in this challenge study did not develop diarrhea. This provided initial insights into the variable and complex pathogenesis of EAEC. EAEC strain 042 (serotype O44:H18), which caused diarrhea in the healthy volunteer challenge, became then the prototypical EAEC strain for the study of virulence factors and EAEC pathogenicity [6] and was the subject of a recent EAEC genome characterization [7]. Thus, the majority of the virulence factors described in EAEC have been characterized in the EAEC prototype strain 042. Epidemiologic studies showed that the majority of isolates hybridizing with the AA probe also contained the master aggR regulator and that EAEC isolates that hybridized with the AA probe were found to be associated with persisting diarrhea in case-controlled studies. However, it was also noted that not all EAEC strains causing diarrhea hybridized with primers specific for aggR. This led to the suggestion that EAEC be classified into “typical” EAEC when aggR is present and “atypical” EAEC when aggR is absent [8]. The literature thus, contains studies on EAEC that rely solely on the aggregative phenotypic HEp-2 assay, solely on the use of molecular probes and yet others that use a combination of these two approaches to identify EAEC. The heterogeneity among strains from geographically diverse regions not conforming to these characteristics further complicates the classification of EAEC into discrete groups [9] and will likely require of a reclassification in the near future. EPIDEMIOLOGY AND IMPACT IN LATIN AMERICA EAEC has been identified in all regions of the world where it has been studied. Children and adults living in developing countries [10-14], as well as travelers returning from developing countries are susceptible to infection with EAEC [15, 16]. EAEC can also result in persisting asymptomatic infection in adults and children [17, 18]. In the US, a recent study showed that gene probe positive EAEC but not EAEC defined by HEp-2 adherence, was more commonly identified in children under the age of five with acute diarrhea than in age matched healthy controls [19-21]. Although atypical EAEC has been identified in calves, piglets and horses [22], animals have not been implicated as a source or reservoir for human infection. Contaminated food appears to be the main source of EAEC infection and has been implicated in several food borne outbreaks of diarrhea [23, 24] in several parts of the world. In Mexico, EAEC is commonly found in food, including desserts and salsa [25, 26] and may explain the high rates of travelers’ diarrhea seen in US visitors to that country. Also, in Brazil EAEC was detected in the lacteal contents of feeding bottles of low socio-economic class infants brought to the outpatient clinic of a public hospital, demonstrating the possible transmission of EAEC by contaminated food [27]. In Latin America, EAEC is among the most common bacterial isolates recovered from children with diarrhea and has been identified in Colombia [28], Mexico [29, 30], Guatemala [31], Brazil [10, 11, 32-42], Chile [43], Peru [44], Argentina [45], Ecuador [46] and Jamaica [16]. In some areas of Brazil, EAEC surpasses ETEC as the predominant pathogen identified [47].

50 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

In addition to the acute complications of diarrhea such as dehydration and death, EAEC can also cause persisting diarrhea [48] that can lead in turn to malnutrition and impaired growth and development. Steiner and colleagues demonstrated that in Brazilian slums, infections with EAEC were associated with intestinal inflammation as evidenced by elevated levels of fecal cytokines including IL-8 and that even in the absence of diarrhea, infection with EAEC led to impaired growth and development [49]. EAEC has also been associated with chronic diarrhea in patients infected with HIV [17, 50-55]. Although studies in Africa linked EAEC to persistent and bloody diarrhea in HIV associated infection [52], there is a paucity of data on the prevalence or complications associated with HIV-related EAEC infection in Latin America. In developed countries, diarrhea due to opportunistic pathogens in patients with HIV has decreased dramatically in response to the introduction of highly active antiretroviral therapy and this may also be the case in Latin America. EAEC can be identified in 19% to 33% of traveler’s diarrhea cases depending on the region of the world visited [16, 56-58]. In Latin America, the proportion of EAEC associated cases of travelers' diarrhea is seen in 25% of travelers, which is significantly higher to the rates observed in travelers visiting Africa, where the proportion is less than 2%, and south Asia (15%) [59]. Unlike ETEC, which causes diarrhea within the first two weeks of travel and is not associated with asymptomatic carriage in US visitors to Mexico, EAEC infection can persist for longer periods of time [60]. EAEC PATHOGENESIS Once ingested, the localization of infection in the gastrointestinal tract has not been well defined. EAEC infection has been associated with increased nitric oxide production and alterations in lactulose permeability in aboriginal children in Australia [61]. Studies done on endoscopic intestinal specimens demonstrate that EAEC can bind to jejunal, ileal, and colonic epithelium [62]. Studies in volunteers have demonstrated that EAEC 042 can be recovered from duodenal aspirates [6]. In a separate study, organ cultures of small and large intestinal mucosa from children were used to examine the interactions of EAEC with human intestine. In this study, five EAEC strains were evaluated for their ability to bind to jejunal, ileal, and colonic mucosa. The affinity for segments of the intestinal tract was heterogeneous among the EAEC isolates studied [63]. Although a great diversity of adhesins, toxins and proteins involved in EAEC pathogenesis have been described, the prevalence of these virulence factors-encoding genes is highly variable and none of these have been found in all EAEC strains [33, 40, 64-68]. In addition to the expression of adhesins and toxins, several other potential virulence factors have been described in EAEC which are encoded in plasmids or in the chromosome [69]. Nevertheless, pathogenesis studies have suggested three major features of EAEC pathogenesis: (i) abundant adherence to the intestinal mucosa, (ii) elaboration of enterotoxins and cytotoxins, and (iii) induction of mucosal inflammation (Fig. 2). Virulence Factors HyE EAST1 Pet Pic

Flagellin

ShET1 Dispersin Adhesins

EAEC

EA

EC AAFs

B

Vesicular traffic

Epithelial cell

A

B

IL-8 Inflammation

Targets Guanylyl Cyclase Adenylyl Cyclase Fodrin Membrane

A

Mucus

Figure 2: Schematic representation of enteroagregative E. coli virulence factors and their targets in the mucosal epithelium. Some of the targets of virulence factors are extrapolated from their known function in other pathogens o similarity to other factors (HylE, ShET1 and EAST1).

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 51

Abundant Adherence to the Intestinal Mucosa Several authors demonstrated that the AA pattern is associated with the presence of fimbrial and afimbrial adhesins in EAEC strains. However, the genes encoding these adhesins are found in low prevalence, indicating a high diversity of adhesive structures responsible for the AA pattern [55, 70-76]. Afimbrial Adhesins Afimbrial adhesins, or outer membrane proteins (OMP) associated with the AA, have been observed in several EAEC strains of different serotypes [72, 74, 76, 77]. Debroy et al. [72] and Wai et al. [76], demonstrated that OMPs of 30 and 38 kDa, respectively, were responsible for the AA in some EAEC. A 18 kDa OMP present in EAEC strains belonging to serotypes O44:H18 and O126:H27, was associated with AA in HEp-2 cells and scum formation on broth cultures [77]. Spencer et al. [78] showed that the expression of that OMP also occurred in other serotypes that hybridized with the DAEC genetic probe described by Bilge et al. [79]. The mannose-resistant hemagglutination of human erythrocytes expressed by the prototype strain 042 in low temperature was associated with a 16 kDa OMP named cryohemagglutinin [80]. Monteiro-Neto et al. [74] described a 58 kDa OMP, named aggregative protein 58 (Ap58) responsible for the AA pattern of EAEC strains of the serotype O111:H12. The Ap58 adhesin is encoded by the ap58 gene located in the chromosome of the prototype strain 236. However, the distribution of Ap58 seems to be restricted to the O111:H12 serotype [74]. Recently, Bhargava et al. [81] reported the presence of an OMP adhesin (Hra1) in EAEC 042 that is an accessory factors involved in autoaggregation, biofilm formation and aggregative adherence, demonstrating the multifaceted adhesion and aggregation factors seen in this phenotype. Fimbrial Adhesins The presence of different fimbriae has been demonstrated in several EAEC strains employing electron microscopy studies [82-84]. Old et al. [85] described a fibrillar adhesin present in two strains of serogroup O78 able to mediate agglutination in rat and mice erythrocytes in the presence of mannose. Only a few of EAEC fimbriae have been genetically characterized, and certainly, the best studied are the Aggregative Adherence Fimbriae (AAFs) I, II and III [55, 71, 75]. AAF/I, II and III are encoded in high-molecular weight plasmids and are necessary for the expression of AA, in the prototype strains 17-2, 042 and 55989, respectively [55, 75, 86]. AAF/I is a flexible, bundle-forming fimbriae (2- to 3- nm diameter) responsible for the AA on HEp-2 cells and mannose-resistant hemagglutination of human erythrocytes [75]. In the prototype strain 17-2, the genes responsible for AAF/I biogenesis are located in two regions of the pAA1 plasmid, designated region 1 (containing the aggABCD operon that encodes the pilin, chaperonin and usher proteins) and region 2 (containing the AggR regulator-encoding gene) [75, 87, 88]. AAF/II was described in the prototype strain 042 as the adhesin responsible for the AA to HEp-2 cells and human colonic mucosa in tissue explants, as well as for biofilm formation in tissue cultures and polystyrene [71]. This fimbrial structure was observed as semi-rigid bundles of filaments (5-nm diameter) and detected by its ability to produce mannose-resistant hemagglutination of human erythrocyte [6]. The genes responsible for AAF/II biogenesis are also located in a high-molecular weight plasmid (pAA2) in two regions. However, these two regions show a unique fimbrial genetic organization, where the pilin-, chaperonin- and the regulator-encoding genes (aafA, aafD and aggR) are located in region 1, and the usher-encoding gene (aafC) takes place in region 2 [86]. These two regions are separated by a ~12-kb sequence harboring toxin-encoding genes [86]. The third AAF was identified in strain 55989 by Bernier et al. [55]. AAF/III is also involved in bacterial aggregation and AA to cultivated epithelial cells. Distinctly of AAF/I and II, AAF/III is long and individual flexible filaments. The genes responsible for AAF/III fimbria (agg-3ABCD and aggR) are organized in two regions similar to AAF/I genetic organization. Another fimbrial structure has been described in the atypical EAEC strain C1096. In this strain, the aggregative adherence to cultivated epithelial cells and to abiotic surfaces is mediated by a type IV pili, encoded by genes (operon pilLMNOPQRSTUV), located in a plasmid of the IncI1 incompatibility group. The gene pilS encodes the

52 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

major pili subunit [73, 89]. Recently, a new adhesin responsible for the AA in EAEC strains isolated in Denmark named Had has been described by Boisen et al. [70]. Had is responsible for the AA in EAEC strains lacking the AAFs. The ultrastructure of this adhesin has not been showed, however, the had gene has been previously described as encoding a pilin related to the Dr family of adhesins. A large number of EAEC strains lack the genes encoding these fimbriae, indicating that they express uncharacterized adhesins mediating the AA pattern [22, 33, 40, 65, 73, 90]. The EAEC heterogeneity in terms of fimbrial repertoire is similar to the observed among ETEC colonization factor antigens (CFA) [1]. Dispersin, Shf and Irp-2 Czeczulin et al. [65] identified several putative virulence genes in the pAA2 plasmid (strain 042) in addition to aafABCD-aggR (AAF/II-encoding genes), pet (Pet) and astA (EAST1). Among them are aspU or aap and shf. Dispersin is a 10.2 kDa immunogenic secreted protein encoded by the aap (anti-aggregation protein) gene, formerly known as aspU [65, 91]. This protein is secreted to the extra cellular milieu being covalently attached to the bacterial surface, neutralizing the negative charge of the bacterial surface and allowing the AAF/II projection [5, 91]. A 042 mutant in aap shows that dispersin acts decreasing bacterial autoaggregation allowing dispersion along the intestinal mucosa [91]. Dispersin secretion across the bacteria outer membrane is dependent of an ABC protein transporter system [92]. The shf gene shows homology with two genes described in Shigella flexneri 2a (shf1 e shf2), and encodes a predicted protein similar to IcaB of Staphylococcus epidermidis, related to biofilm formation [65, 93]. Besides pic and setAB (see below), the irp-2 gene was also localized in the 042 chromosome [65]. This gene encodes the iron-repressible high-molecular weight protein 2 (Irp-2) and is involved in the biosynthesis of a yersiniabactin responsible for iron acquisition in Yersinia [94]. Some authors showed a high prevalence of this gene among EAEC strains [22, 94], although, the role of Irp-2 in EAEC pathogenesis is unclear. Biofilm Formation Another characteristic of EAEC is the ability to form biofilm on biotic and abiotic surfaces in vitro, as result of bacterial aggregation [62, 63, 95, 96]. Biofilm of EAEC is a multifactorial phenotype distinct of the non-pathogenic E. coli biofilms [97]. It has been shown the involvement of AAF/II, type I fimbriae, Fis and YafK in the formation of biofilm by the prototype strain 042 [96, 98]. Fis is a DNA-binding protein involved in growth phase-dependent regulation and YafK is a secreted protein required for transcription of the genes involved in AAF/II biogenesis [96]. EAEC adherence to intestinal tissues is characterized as a biofilm composed by aggregates of bacteria in association with a thick mucus layer [62, 63, 95]. This characteristic biofilm formed by EAEC in vivo has been associated with the persistence of some cases of EAEC diarrhea [96, 99]. Invasion EAEC is considered a non-invasive pathogen, although some authors have demonstrated the invasive phenotype of some strains [90, 100, 101] using cells in culture. Benjamin et al. [101], showed that EAEC strains were internalized by HeLa cells, which was mediated by the cellular cytoskeleton components. Abe et al. [100] demonstrated the invasive phenotype to T84 cells and human colonic biopsies by the EAEC strain 236 (serotype O111:H12). These observations, in addition to the fact that children with EAEC diarrhea in Mexico can present bloody stools [29], suggest that the invasion ability of EAEC may be a virulence trait of at least some strains. Elaboration of Enterotoxins and Cytotoxins EAEC produces cytotoxic effects such as microvillus vesiculation, enlarged crypt openings, and increased epithelial cell extrusion [8]. Numerous putative virulence factors such as the plasmid-encoded Pet and EAST-1 toxins [102, 103]; the chromosomally encoded ShET1 toxin [104, 105], HlyE [106], Pic, a mucinase widely associated with pathogenic E. coli and Shigella spp [105], and a novel type VI secretion system [107] have been associated to these cytotoxic effects in EAEC. In an effort to identify cytotoxins and enterotoxins, Navarro-Garcia et al. [108] analyzed culture supernatants from strains that caused outbreaks of EAEC diarrhea in Mexican hospitals. Two major proteins of 108 and 116 kDa (now

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 53

known as Pet and Pic, respectively) were secreted. Interestingly, Pet and Pic are secreted by EAEC using the type V secretion system or also called autotransporter mechanism, and belong to the serine protease autotransporter of Enterobacteriaceae family. Thus, both proteins undergo two cleavage steps before a functional protein is released into the extracellular space. The passenger domains contain the protease motif (GDSGSP) characteristic of all proteins of the SPATE group [109]. Plasmid-encoded Toxin (Pet) It has been shown that a 104 kDa protein, termed Pet (plasmid-encoded toxin), is required for EAEC-induced damage to human intestinal mucosa [108]. Pet is a member of the autotransporter class of secreted proteins and together with Tsh, EspP, EspC, Pic, SigA, Hbp, Sat and SepA proteins comprises the serine protease autotransporter of Enterobacteriaceae (SPATE) subfamily. The defining feature of autotransporters is their self-contained secretion system [102]. Pet causes raises in Isc (short-circuit current) and decreases in electrical resistance of rat jejunum mounted in the Ussing chamber, an enterotoxic effect that is accompanied by mucosal damage, increased mucus release, exfoliation of cells and development of crypt abscesses [108]. Pet appears to be a cytoskeleton-altering toxin, since it induces contraction of the cytoskeleton, loss of actin stress fibers, and release of focal contacts in HEp-2 and HT29/C1 cell monolayers, followed by complete cell rounding and detachment. Interestingly, Pet cytotoxicity and enterotoxicity depend on Pet serine protease activity, since both effects are inhibited by phenylmethylsulfonyl fluoride (PMSF) and are not induced by Pet S260I, which is mutated in the catalytic serine and thereby lacks in vitro protease activity [110]. It has been shown that Pet enters the eukaryotic cell and that trafficking through the vesicular system appears to be required for the induction of cytopathic effects. Moreover, the Pet serine protease motif is the main requisite for the cytopathic effects, because the internalization assays have demonstrated that Pet and mutant S260I are found inside epithelial cells, but that only native Pet produces the cytopathic effects [111]. All these data suggest an intracellular target for Pet. Indeed, Pet produces degradation of erythroid spectrin [112]. Pet internalization by clathrin-coated vesicles was found to be the essential mechanism because two reagents for blocking this pathway totally inhibited Pet internalization (monodansylcadaverine and sucrose). Whereas drugs for blocking endocytosis (filipin and methyl--ciclodextrin), through caveolae mechanism, was unable to inhibit Pet effects on the cytoskeleton. Moreover, small interfering RNA (siRNA), designed to knock down clathrin gene expression in HEp-2 cells, prevented Pet internalization, and thereby the Pet-induced cytotoxic effect. However, the use of siRNA to knock down caveolin expression had no effect on Pet internalization, and the cytotoxic effect was clearly observed [113]. Pet endocytosis is a rapid event in HEp-2 cells, since it is possible to find Pet in early endosomes, as short as 8 min after the initial interaction. This rapid Pet endocytic process has also been observed in various bacterial toxins, in which, after endocytosis through clathrin-dependent or -independent mechanisms, toxins are delivered to early endosomes and a small fraction is subsequently delivered to lysosomes for its degradation. In the endocytic transport of Pet, it is possible to observe that a small fraction reached the lysosomes for its possible degradation. However, most of Pet followed a transport to other organelles [114]. Furthermore, brefeldin A (BFA) is able to inhibit the cytoskeletal effects caused by Pet. BFA disrupts the Golgi apparatus and causes multiple alterations in the vesicular transport. Inhibition of cell intoxication by BFA is classically associated with toxins, which undergo retrograde transport from the Golgi apparatus to the endoplasmic reticulum (ER), such as Cholera toxin, Shiga toxin and ricin [111]. These findings were confirmed by localizing Pet in the Golgi apparatus at sequential times and then in the ER. ER is an attractive compartment for translocation, since it contains factors that facilitate entry to the cytosol by reducing or displaying proteins before their departure from the ER membrane. Additionally, the ER contains a protein of machinery for translocation, named Sec61p, which is involved in the reverse translocation of misfolded proteins from the ER lumen to the cytosol. The Sec61p translocon complex appears to be responsible in this essential pathway for the intoxication by diverse toxins, since they have the ability to associate with the Sec61p complex, such as the A subunit of ricin, Pseudomonas exotoxin A, and Cholera toxin. Thus, Pet is able to colocalize with Sec61α, the major protein in the Sec61p complex, and this colocalization occurred immediately after Pet localization in the ER. Additionally, antibodies against Sec61α were able to precipitate Pet and antibodies against Pet immunoprecipite Sec61. Furthermore, Pet is unable to intoxicate

54 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

mutant CHO cells (cholera toxin resistant), which have translocation defects [114]. Finally, Pet colocalizes with one of its intracellular targets, fodrin. An intracellular target, -fodrin (II spectrin), has been found for Pet. Pet binds and cleaves epithelial fodrin (between M1198 and V1199) in vitro and in vivo, causing fodrin redistribution within the cells, to form intracellular aggregates as membrane blebs. Interestingly, both enterotoxic and cytotoxic effects depended upon the serine protease motif, the active site used for α-fodrin degradation. Furthermore, Pet internalization is needed to produce the cytotoxic and cytoskeletal damage, since α-fodrin is an intracellular protein. Thus, this mechanism appears to be a new system of cellular damage identified in bacterial toxin, which includes the internalization of the protease to allow finally specific α-fodrin degradation to destroy the cell [115]. So far, it is clear that purified Pet follows a sequence of events in order to damage the epithelial cells. However, all these events have been deduced from research performed in in vitro systems using purified Pet toxin (37 µg/ml) and have not yet been shown to occur during the infection of epithelial cells by EAEC. Recently, it was reported that the secretion of Pet by EAEC during the infection is regulated at the transcriptional level, since secretion is inhibited in eukaryotic cell culture medium, although Pet is efficiently secreted in the same medium supplemented with tryptone. Efficient Pet secretion in DMEM/tryptone increases cell detachment in HEp-2 cell adherence assay. Pet toxin is efficiently delivered by EAEC as it occurs when 37 µg/ml of purified Pet protein are used. Thus, there is a correlation between Pet secretion by EAEC, the internalization of Pet into epithelial cells, cell detachment and cell death in EAEC-infected cells. All these data indicate that Pet is an important virulence factor in the pathogenesis of EAEC infection [116]. Protein Involved in Colonization (Pic) Pic was identified as a second SPATE member in EAEC. This protein was recognized by the sera from the same children who were infected during an outbreak of diarrhea in a pediatric ward of a Mexican hospital and which were used to identify Pet [108]. In contrast to Pet, Pic is localized in the EAEC chromosome [65, 105] and it was found that Pic was identical to a protein termed Shmu (Shigella mucinase), which is encoded on the Shigella she pathogenicity island (PAI) [117]. Interestingly, the pic gene has a unique characteristic among the autotransporter proteins since there are two oppositely oriented genes in tandem within the pic (she) gene, set1B and set1A [105, 117], which encode the 7- and 20-kDa subunits of the 55-kDa ShET1 toxin [104]. The sequences flanking pic are different in EAEC and S. flexneri, and in the case of S. flexneri the she PAI contains another SPATE, SigA, which is similar to Pet. Pic catalyzes gelatin degradation which can be abolished by disruption of the predicted proteolytic active site. Through functional analysis of Pic, this proteolytic site is involved in Pic’s mucinase activity, serum resistance, and hemagglutination. Phenotypes identified for Pic suggest that it is involved in the early stages of pathogenesis and most probably promotes intestinal colonization [105, 117]. Recently, it has been shown that Pic did not damage epithelial cells, cleave fodrin, or degrade host defense proteins embedded in the mucus layer (sIgA, lactoferrin and lysozyme). However, by using a solid-phase assay to evaluate the mucinolytic activity of EAEC Pic, it has been documented a specific, dose-dependent mucinolytic activity. A serine protease inhibitor and an enzymatically inactive variant of Pic were used to show that the Pic serine protease motif is required for mucinolytic activity. Additionally, Pic binds mucin, and this binding was blocked in competition assays using monosaccharide constituents of the oligosaccharide side chains of mucin. Moreover, Pic mucinolytic activity decreased when sialic acid was removed from mucin. Thus, Pic is a mucinase with lectin-like activity that can be related to its reported hemagglutinin activity [118]. A homologue protein in uropathogenic E. coli, PicU (96% identity at the amino acid level), has been characterized and shared similar functions [119]. Subsequent investigations by Heimer et al. (2004) revealed that picU was expressed during experimental infection in the mouse model of urinary tract infection. However, co-challenge of wild-type organisms and the picU mutant in the mouse model suggested that PicU encoding strains had no competitive advantage in colonization [120]. Nevertheless, since PicU is a secreted protease, it is possible that

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 55

protein secreted by the wild-type strains may complement the picU deficiency of the mutant strains. Indeed, challenge of mice separately with wild-type and picU mutant strains revealed that the wild type strain colonized the bladder to a greater extent and displayed higher levels of neutrophil infiltration into the lumen, epithelium, and submucosa. Unfortunately, while these data showed a trend, they were not statistically significant [120]. In addition, it should not be discounted that loss of PicU function may be complemented by the homologous Vat and Sat serine protease autotransporters. Thus, the role of PicU in uropathogenic E. coli infection remains enigmatic. Shigella Enterotoxin 1 (ShET1) Culture filtrates of S. flexneri 2a strain M4243 cause significant fluid accumulation in rabbit ileal loops, when the bacteria is grown in iron-depleted medium. Also, when tested in Ussing chambers, a greater rise in potential difference and short circuit current was seen with such filtrates compared with the medium control. Ultrafiltration and gel exclusion size fractionation of M4243 filtrate revealed that the activity was approximately 60 kDa. Genes encoding this enterotoxin, named ShET1 (Shigella enterotoxin 1), were cloned. Thus, ShET1 is elaborated in vivo, where it elicits an immune response, may be important in the pathogenesis of diarrheal illness due to S. flexneri [104]. ShET1 toxin is a subunit toxin encoded by setA and setB, which are thought to form an oligomeric toxin consisting of a single 20-kDa SetA protein associated with a pentamer of five 7-kDa B subunits (SetB) [121]. ShET1 appears to induce intestinal secretion via cAMP and cGMP, however the precise mechanism of action and detailed biochemistry remains elusive. As mention above, unusually, the setAB genes are encoded within the pic gene but on the complementary strand and thus have the same prevalence characteristics and disease associations as pic [105]. A study of the genetic regulation of these overlapping genes suggests that pic and the setBA loci are transcribed as complementary 4-kb mRNA species. The major pic promoter is maximally activated at 37°C in exponential growth phase. It was also suggested that the setB gene is transcribed from a promoter which lies more than 1.5 kb upstream of the setB structural gene; setA may be transcribed via read-through of the setB transcript and possibly by its own promoter [122]. Hemolysins Hemolysin E (HlyE) of Escherichia coli is a pore-forming hemolytic protein encoded by the hlyE (clyA, sheA) gene that was first identified in E. coli K-12. A study done to determine if hlyE was present in other E. coli pathotypes demonstrated that 19 of 23 (83%) of STEC, 7 of 7 (100%) of EIEC, 6 of 8 (80%) EAEC strains, and 4 of 7 (58%) ETEC strains tested possess a complete hlyE. The remaining STEC, EAEC, and ETEC strains and 9 of the 17 tested EPEC strains were shown to harbor mutant hylE derivatives, containing 1-bp frameshift mutations that cause premature termination of the coding sequence [123]. However, the role of HlyE in EAEC has not been determined. HlyE is a 34-kDa, predominantly α-helical protein, which oligomerizes into higher order structures to form a poreforming toxin mediating cytolytic and cytopathic effects on cultured human cells [106]. Several lines of evidence, including a complex regulatory circuit and recognition by convalescent antisera, indicate a role in disease [124, 125]. However, the occurrence of hlyE amongst non-pathogenic bacteria [123, 126] suggests that if HlyE plays a role in mediating disease then it is a minimal role. A 120-kDa heat-labile toxin that cross-reacts with antibodies against part of the tandem repeat region of E. coli alpha-hemolysin, and is capable to increase intracellular calcium levels and to stimulate protein phosphorylation via calcium-dependent kinases in HEp-2 cells, was identified in EAEC strains by Baldwin et al. [127]. These authors suggested that this toxin could play an important role in the development of EAEC-caused diarrhea, promoting cellular changes that lead to death of intestinal epithelial cells. The production of alpha-hemolysin was detected in 13% of EAEC strains and strongly associated with HeLa cells detachment of the glass coverslip during the adherence assay [128]. Fernandez-Prada et al. [129] demonstrated that the infection of human and murine macrophages with alpha-hemolysin-producing EAEC cause macrophage cell death accompanied by release of lactate dehydrogenase activity and interleukin 1. Such macrophage destruction accompanied by proinflammatory cytokines release may contribute to the clinical manifestation of EAEC-caused diarrhea. The production of plasmidmediated and thermoregulated contact hemolysin, detected by close contact between bacteria and erythrocytes

56 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

achieved by centrifugation, was observed in EAEC strains isolated from cases of infantile diarrhea [130]. The role of  and contact hemolysins in the pathogenesis of EAEC-caused diarrhea has not been fully determined. Enteroaggregative Heat-stable Toxin 1 (EAST1) EAST-1, encoded by the astA gene adjacent to pet, is present in a wide variety of strains and different pathovars [65]. EAST1 is a 38 amino acids peptide (4.1 kDa). The sequence of EAST1 contains four cysteines that are involved in the formation of two disulfide bridges in a C1–C2 and C3–C4 conformation [131]. Using a synthetic peptide spanning residues 8–29, Savarino et al. [103] observed enterotoxic activity in an Ussing chamber assay using freshly isolated rabbit ileum. However, the presence of EAST-1 in EAEC 17-2, a strain which did not cause diarrhea in volunteers, suggests that EAST-1 is not the sole mediator of diarrhea. This observation is confirmed by studies which demonstrated EAST-1 from EAEC 17-2 had identical activities to EAST-1 derived from EAEC 042 during in vitro models of toxicity [6, 131]. Furthermore, the astA gene is detected in commensal and diarrheagenic E. coli strains [99]. EAST1 is often compared to E. coli STa (heat-Stable Toxin a) enterotoxin [103]. Like EAST1, STa toxin is known to cause secretory diarrhea [132]. The interaction of STa toxin with guanylyl cyclase C (GC-C), its enteric receptor, induces an increase of the concentration of intracellular cGMP (cyclic Guanosine MonoPhosphate) in the intestinal cells, leading to anion secretion and diarrhea. Structural similarities to STa have led to speculation that EAST1 is a ligand for GC-C [121]. However, EAST1 and STa are immunologically different since no cross-neutralization of EAST1 was observed using polyclonal anti-STa antibodies [103]. Induction of Mucosal Inflammation by EAEC The initial host inflammatory response to EAEC infection is dependent on the host innate immune system and the type of EAEC strain causing infection. The role of putative virulence genes and clinical outcomes is not well understood; however, the presence of several EAEC virulence factors correlate with finding elevated levels of fecal cytokines and inflammatory markers in stools of adults and children with diarrhea, including interleukin (IL)-1ra, IL-1β, IL-8, interferon (INF)-γ, lactoferrin, fecal leukocytes, and occult blood [58, 133]. In a quest to identify factors that may be responsible for the inflammatory presentation of EAEC-infected patients, it was reported that the flagellin of EAEC strains induced IL-8 secretion from Caco-2 cells in culture [134]. IL-8 release was subsequently linked to binding to the Toll-like receptor 5 (TLR-5) on the target epithelium [135]. TLR5 signals through P38 mitogen-activating protein kinase (MAPK) and nuclear factor kappa B (NF-κB) to induce transcription of pro-inflammatory cytokines from epithelial and monocytic cells [136]. MAPK is a member of a family of stress-related kinases that influences a diverse range of cellular functions, including host inflammatory responses to microbial products [136]. It has also suggested a role for plasmid-encoded factors in IL-8 induction [49, 58]. IL-8 is an important pro-inflammatory chemokine involved in EAEC pathogenesis. IL-8 is responsible for recruiting neutrophils to the epithelial mucosa without mucosal injury, and facilitates intestinal fluid secretion [137139]. Travelers to Mexico who developed symptomatic illness due to EAEC infection excreted high concentrations of fecal IL-8, compared to travelers who did not develop diarrhea due to EAEC infection [140]. Interestingly, IL-8 levels are higher in feces of patients infected with aggR- or aafA-harboring strains compared with those infected with strains negative for these factors. Recently, it was also shown that EAEC strains containing aggR, aggA and aap were more likely to cause increased IL-8 induction from non-polarized HCT-8 IECs than EAEC negative for those genes [133]. In a search to identify additional factors that could account for the IL-8 release from epithelial cells infected with EAEC strain 042, it was found that polarized T84 intestinal cells release IL-8, even when infected with 042 mutated in the major flagellar subunit FliC. IL-8 release from polarized T84 cells was found to require the AggR activator and the AAF fimbriae, and IL-8 release was significantly less when cells were infected with mutants in AafB, a cryptic protein encoded in the region 2 of the AAF/II fimbriae biogenesis gene cluster [141]. In addition to IL-8, intestinal epithelial cells infected with EAEC 042, have been shown to upregulate the following genes: IL-6, tumor necrosis factor (TNF)-α, growth-related gene product (GRO)-α, GRO-, intercellular adhesion molecule (ICAM)-1,

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 57

granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-1α. These cellular responses are primarily mediated by flagellin (fliC) of EAEC [141]. It is clear that multiple factors contribute to EAEC-induced inflammation, and further characterization of the nature of EAEC pro-inflammatory factors will greatly advance the understanding of this emerging pathogen. HOST GENETIC SUSCEPTIBILITY TO EAEC IL-8 is a potent chemokine that is released into the human respiratory and intestinal mucosa by epithelial cells, macrophages and polymorphonuclear cells in response to infection. In the case of EAEC, IL-8 is produced in vitro and in vivo in response to flagellin, the monomeric component of EAEC flagella via contact with the Toll-like receptor 5 in the intestinal mucosa. Single Nucleotide Polymorphisms (SNP) in the IL-8 gene promoter region are associated with severe pulmonary infections and increased levels of secreted IL-8 [142]. Based on this observation, Jiang et al. conducted a study of 69 Caucasian healthy adult students from North America visiting Mexico for at least 3 weeks who were at risk for travelers’ diarrhea due to EAEC to investigate if host IL-8 gene SNPs were associated with diarrheal disease. This study demonstrated that a SNP that resulted in a transition from C to T in the –251 position of the IL-8 gene promoter was associated with increased levels of IL-8 and symptomatic EAEC infection. Interestingly, in this study EAEC was identified by HEp-2 adherence, and the association of symptomatic EAEC diarrhea with the high IL-8 producing alleles was similar in individuals infected with typical and atypical EAEC [140]. Additional studies in different geographical locations are needed to validate this observation. Similarly, studies in Latin American children and adults repeatedly exposed to EAEC are needed to dissect differences in susceptibility to infection in individuals with sporadic and endemic EAEC infection. TREATMENT AND PROPHYLAXIS The diagnosis of EAEC infection remains limited to research laboratories and results are available in most cases a long time after infection has resolved and therefore are of little use in guiding antibiotic therapy. As with all other enteropathogens causing acute pediatric diarrhea, the mainstay for the treatment of EAEC infection is rehydration, preferably with oral rehydration therapy followed by the reintroduction of food as tolerated. As with other self-limiting infections, the decision to use antibiotic therapy should be done on an individual basis. The selection of the antibiotic to be used should take into account the age of the person, region of the world where infection was acquired and the local antimicrobial susceptibility patterns. In general, travelers from developed countries visiting Latin America should be reminded of basic principles of hygiene, advised to avoid tap water, to drink bottle water instead and to stick to the saying “cook it, peel it, boil it or forget it”. It should be kept in mind that even cooked food, served in restaurants may become contaminated due to unhygienic conditions. In studies of travelers’ diarrhea, infection with EAEC responds to antibiotic therapy [15]. Most strains are susceptible to fluoroquinolones, azithromycin and rifaximin. However, the prevalence of antibiotic resistance in EAEC isolated from children of developing nations is high [143], including reports of emerging resistance to fluoroquinolones [100]. In addition, fluoroquinolones can rarely cause tendon rupture. Nevertheless, for most parts of the world, fluoroquinolones remain a choice for the treatment of travelers’ diarrhea due to EAEC [13, 144] and have been recommended by the Infectious Diseases Society of America for the treatment of EAEC infection [144]. Antibiotics with and without antimotility agents have been shown to be safe and effective therapy for EAEC in US adult travelers [145, 146]. Although antibiotics are highly effective in preventing travelers’ diarrhea, their cost, potential side effects and the contribution to the development of resistance [147] limits routine use. Rifaximin, a non absorbable antibiotic with low side effect profile [148] is effective in preventing travelers’ diarrhea but not US Food Drug Administration approved for this indication. Studies of cost benefit are needed to compare chemoprophylaxis and early initiation of therapy of travelers' diarrhea. The cost of generic ciprofloxacin for 1- to 3-day treatment is certainly less than the cost of 14 days of rifaximin used

58 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

for chemoprophylaxis [148]. In patients with HIV and EAEC infection antimicrobial efficacy data is scarce. In a small, randomized, double-blind, placebo-controlled, cross-over study done with 24 cases of EAEC treated with ciprofloxacin 500 mg orally twice daily for 7 days or a placebo demonstrated that ciprofloxacin decreased the number of unformed stools by 50% and improved gastrointestinal symptoms and was associated with the eradication EAEC [53]. Of interest, nitazoxanide a broad spectrum anti-infective agent currently approved for the treatment of cryptosporidiosis and frequently used in HIV infection associated diarrhea was shown in vitro to decrease the formation of EAEC biofilm, block hemagglutination and prevent AAF/II filament formation[149]. THE PROSPECTS OF AN EAEC VACCINE Although EAEC infection responds to antibiotic therapy, the widespread geographic distribution of this infection and increasing rates of antibiotic resistance limit pharmacological approaches for control. Several lines of evidence suggest that immune based control of EAEC infection is possible. Antibodies raised against membrane components can effectively block EAEC infection in vitro [72] and this has also been demonstrated using secretory immunoglobulin A (IgA) derived from human colostrums [150]. Studies of natural history of EAEC suggest that short-term immunity develops in healthy individuals and protects against symptomatic disease [60]. Thus, immunoprophylaxis is a potential option for control of EAEC. Initial studies in volunteer challenge studies suggested that individuals with serum antibodies to dispersin would be less likely to develop symptomatic infection after exposure to EAEC [75]. This raised the possibility that dispersin, being a protein unique to EAEC [91] could represent a valuable vaccine target. Recently, however, dispersin has been identified in commensal E. coli and DAEC strains [151] and the fact that seroconversion to dispersin is seen in travelers without evidence of EAEC infection [152]. The development of an effective EAEC vaccine will require identifying pathogen-specific antigens across an enormously heterogeneous group of strains. In addition to identification of host immune responses that correlate with protection in the context of host-immunogenetic factors. ACKNOWLEDGEMENT We thank Paul S. Ugalde for the artistic work in the Fig. 2. F.N-G. was supported by Conacyt grants (60714-M and 128490) and W.P.E. was supported by FAPESP and CNPq grants. P.C.O. was supported by National Institutes of Health grant R01 AI54948, grant UL1RR024148 to the Center for Clinical and Translational Sciences of the University of Texas Medical School at Houston, and grant DK56338 to fund the Texas Gulf Coast Digestive Diseases Center. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8]

Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. Nataro JP, Kaper JB, Robins-Browne R, et al. Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis J. 1987;6:829-31. Baudry B, Savarino SJ, Vial P, et al. A sensitive and specific DNA probe to identify enteroaggregative Escherichia coli, a recently discovered diarrheal pathogen. J Infect Dis. 1990;161:1249-51. Schmidt H, Knop C, Franke S, et al. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:701-5. Velarde JJ, Varney KM, Inman KG, et al. Solution structure of the novel dispersin protein of enteroaggregative Escherichia coli. Mol Microbiol. 2007;66:1123-35. Nataro JP, Deng Y, Cookson S, et al. Heterogeneity of enteroaggregative Escherichia coli virulence demonstrated in volunteers. J Infect Dis. 1995;171:465-8. Chaudhuri RR, Sebaihia M, Hobman JL, et al. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One;5:e8801. Harrington SM, Dudley EG, Nataro JP. Pathogenesis of enteroaggregative Escherichia coli infection. FEMS Microbiol Lett. 2006;254:12-8.

Enteroaggregative Escherichia coli

[9] [10] [11] [12] [13] [14] [15] [16] [17]

[18]

[19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33]

[34]

Pathogenic Escherichia coli in Latin America 59

Okeke IN, Nataro JP. Enteroaggregative Escherichia coli. Lancet Infect Dis. 2001;1:304-13. Scaletsky IC, Fabbricotti SH, Silva SO, et al. HEp-2-adherent Escherichia coli strains associated with acute infantile diarrhea, Sao Paulo, Brazil. Emerg Infect Dis. 2002;8:855-8. Wanke CA, Schorling JB, Barrett LJ, et al. Potential role of adherence traits of Escherichia coli in persistent diarrhea in an urban Brazilian slum. Pediatr Infect Dis J. 1991;10:746-51. Pitman C, Amali R, Kanyerere H, et al. Bloody diarrhoea of adults in Malawi: clinical features, infectious agents, and antimicrobial sensitivities. Trans R Soc Trop Med Hyg. 1996;90:284-7. Okeke IN, Ojo O, Lamikanra A, et al. Etiology of acute diarrhea in adults in southwestern Nigeria. J Clin Microbiol. 2003;41:4525-30. Mathewson JJ, Oberhelman RA, Dupont HL, et al. Enteroadherent Escherichia coli as a cause of diarrhea among children in Mexico. J Clin Microbiol. 1987;25:1917-9. Glandt M, Adachi JA, Mathewson JJ, et al. Enteroaggregative Escherichia coli as a cause of traveler's diarrhea: clinical response to ciprofloxacin. Clin Infect Dis. 1999;29:335-8. Adachi JA, Jiang ZD, Mathewson JJ, et al. Enteroaggregative Escherichia coli as a major etiologic agent in traveler's diarrhea in 3 regions of the world. Clin Infect Dis. 2001;32:1706-9. Samie A, Obi CL, Dillingham R, et al. Enteroaggregative Escherichia coli in Venda, South Africa: distribution of virulence-related genes by multiplex polymerase chain reaction in stool samples of human immunodeficiency virus (HIV)positive and HIV-negative individuals and primary school children. Am J Trop Med Hyg. 2007;77:142-50. Samie A, Obi CL, Franasiak J, et al. PCR detection of Clostridium difficile triose phosphate isomerase (tpi), toxin A (tcdA), toxin B (tcdB), binary toxin (cdtA, cdtB), and tcdC genes in Vhembe District, South Africa. Am J Trop Med Hyg. 2008;78:577-85. Oberhelman RA, Laborde D, Mera R, et al. Colonization with enteroadherent, enterotoxigenic and enterohemorrhagic Escherichia coli among day-care center attendees in New Orleans, Louisiana. Pediatr Infect Dis J. 1998;17:1159-62. Kang G, Sheela S, Mathan MM, et al. Prevalence of enteroaggregative and other HEp-2 cell adherent Escherichia coli in asymptomatic rural south Indians by longitudinal sampling. Microbios. 1999;100:57-66. Cohen MB, Nataro JP, Bernstein DI, et al. Prevalence of diarrheagenic Escherichia coli in acute childhood enteritis: a prospective controlled study. J Pediatr. 2005;146:54-61. Uber AP, Trabulsi LR, Irino K, et al. Enteroaggregative Escherichia coli from humans and animals differ in major phenotypical traits and virulence genes. FEMS Microbiol Lett. 2006;256:251-7. Smith HR, Cheasty T, Rowe B. Enteroaggregative Escherichia coli and outbreaks of gastroenteritis in UK. Lancet. 1997;350:814-5. Itoh Y, Nagano I, Kunishima M, et al. Laboratory investigation of enteroaggregative Escherichia coli O untypeable:H10 associated with a massive outbreak of gastrointestinal illness. J Clin Microbiol. 1997;35:2546-50. Koo HL, Jiang ZD, Brown E, et al. Coliform contamination of vegetables obtained from popular restaurants in Guadalajara, Mexico, and Houston, Texas. Clin Infect Dis. 2008;47:218-21. Vigil KJ, Jiang ZD, Chen JJ, et al. Coliform and Escherichia coli contamination of desserts served in public restaurants from Guadalajara, Mexico, and Houston, Texas. Am J Trop Med Hyg. 2009;80:606-8. Morais TB, Gomes TA, Sigulem DM. Enteroaggregative Escherichia coli in infant feeding bottles. Lancet.1997;349:14489. Gomez-Duarte OG, Arzuza O, Urbina D, et al. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities. Foodborne Pathog Dis. 7:199-206. Cravioto A, Tello A, Navarro A, et al. Association of Escherichia coli HEp-2 adherence patterns with type and duration of diarrhoea. Lancet. 1991;337:262-4. Mathewson JJ, Cravioto A. HEp-2 cell adherence as an assay for virulence among diarrheagenic Escherichia coli. J Infect Dis. 1989;159:1057-60. Lima AA, Guerrant RL. Persistent diarrhea in children: epidemiology, risk factors, pathophysiology, nutritional impact, and management. Epidemiol Rev. 1992;14:222-42. Fang GD, Lima AA, Martins CV, et al. Etiology and epidemiology of persistent diarrhea in northeastern Brazil: a hospitalbased, prospective, case-control study. J Pediatr Gastroenterol Nutr. 1995;21:137-44. Gioppo NM, Elias WP, Jr, Vidotto MC, et al. Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E. coli and chain-like adherent E. coli isolated from children with and without diarrhoea, in Londrina, Brazil. FEMS Microbiol Lett. 2000;190:293-8. Orlandi PP, Magalhaes GF, Matos NB, et al. Etiology of diarrheal infections in children of Porto Velho (Rondonia, Western Amazon region, Brazil). Braz J Med Biol Res. 2006;39:507-17.

60 Pathogenic Escherichia coli in Latin America

[35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55]

[56] [57] [58] [59] [60] [61]

Navarro-Garcia et al.

Pereira AL, Ferraz LR, Silva RS, et al. Enteroaggregative Escherichia coli virulence markers: positive association with distinct clinical characteristics and segregation into 3 enteropathogenic E. coli serogroups. J Infect Dis. 2007;195:366-74. Piva IC, Pereira AL, Ferraz LR, et al. Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasilia, Brazil. J Clin Microbiol. 2003;41:1827-32. Regua-Mangia AH, Gomes TA, Vieira MA, et al. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Infect. 2004;48:161-7. Rodrigues J, Acosta VC, Candeias JM, et al. Prevalence of diarrheogenic Escherichia coli and rotavirus among children from Botucatu, Sao Paulo State, Brazil. Braz J Med Biol Res. 2002;35:1311-8. Walser BL, Newman RD, Lima AA, et al. Pathogen and host differences in bacterial adherence to human buccal epithelial cells in a northeast Brazilian community. Infect Immun. 1992;60:4793-800. Zamboni A, Fabbricotti SH, Fagundes-Neto U, et al. Enteroaggregative Escherichia coli virulence factors are found to be associated with infantile diarrhea in Brazil. J Clin Microbiol. 2004;42:1058-63. Gomes TA, Blake PA, Trabulsi LR. Prevalence of Escherichia coli strains with localized, diffuse, and aggregative adherence to HeLa cells in infants with diarrhea and matched controls. J Clin Microbiol. 1989;27:266-9. Gomes TA, Vieira MA, Abe CM, et al. Adherence patterns and adherence-related DNA sequences in Escherichia coli isolates from children with and without diarrhea in Sao Paulo city, Brazil. J Clin Microbiol. 1998;36:3609-13. Levine MM, Ferreccio C, Prado V, et al. Epidemiologic studies of Escherichia coli diarrheal infections in a low socioeconomic level peri-urban community in Santiago, Chile. Am J Epidemiol. 1993;138:849-69. Ochoa TJ, Ecker L, Barletta F, et al. Age-related susceptibility to infection with diarrheagenic Escherichia coli among infants from Periurban areas in Lima, Peru. Clin Infect Dis. 2009;49:1694-702. Ruttler ME, Renna NF, Balbi L, et al. Characterization of enteroaggregative Escherichia coli strains isolated from children with acute diarrhea, in Mendoza, Argentina. Rev Argent Microbiol. 2002;34:167-70. Bourgeois AL, Gardiner CH, Thornton SA, et al. Etiology of acute diarrhea among United States military personnel deployed to South America and west Africa. Am J Trop Med Hyg. 1993;48:243-8. Huang DB, Nataro JP, DuPont HL, et al. Enteroaggregative Escherichia coli is a cause of acute diarrheal illness: a metaanalysis. Clin Infect Dis. 2006;43:556-63. Bhan MK, Khoshoo V, Sommerfelt H, et al. Enteroaggregative Escherichia coli and Salmonella associated with nondysenteric persistent diarrhea. Pediatr Infect Dis J. 1989;8:499-502. Steiner TS, Lima AA, Nataro JP, et al. Enteroaggregative Escherichia coli produce intestinal inflammation and growth impairment and cause interleukin-8 release from intestinal epithelial cells. J Infect Dis. 1998;177:88-96. Mathewson JJ, Jiang ZD, Zumla A, et al. HEp-2 cell-adherent Escherichia coli in patients with human immunodeficiency virus-associated diarrhea. J Infect Dis. 1995;171:1636-9. Mayer HB, Wanke CA. Enteroaggregative Escherichia coli as a possible cause of diarrhea in an HIV-infected patient. N Engl J Med. 1995;332:273-4. Germani Y, Minssart P, Vohito M, et al. Etiologies of acute, persistent, and dysenteric diarrheas in adults in Bangui, Central African Republic, in relation to human immunodeficiency virus serostatus. Am J Trop Med Hyg. 1998;59:1008-14. Wanke CA, Mayer H, Weber R, et al. Enteroaggregative Escherichia coli as a potential cause of diarrheal disease in adults infected with human immunodeficiency virus. J Infect Dis. 1998;178:185-90. Durrer P, Zbinden R, Fleisch F, et al. Intestinal infection due to enteroaggregative Escherichia coli among human immunodeficiency virus-infected persons. J Infect Dis. 2000;182:1540-4. Bernier C, Gounon P, Le Bouguenec C. Identification of an aggregative adhesion fimbria (AAF) type III-encoding operon in enteroaggregative Escherichia coli as a sensitive probe for detecting the AAF-encoding operon family. Infect Immun. 2002;70:4302-11. Mathewson JJ, Johnson PC, DuPont HL, et al. A newly recognized cause of travelers' diarrhea: enteroadherent Escherichia coli. J Infect Dis. 1985;151:471-5. Jiang ZD, Lowe B, Verenkar MP, et al. Prevalence of enteric pathogens among international travelers with diarrhea acquired in Kenya (Mombasa), India (Goa), or Jamaica (Montego Bay). J Infect Dis. 2002;185:497-502. Jiang ZD, Greenberg D, Nataro JP, et al. Rate of occurrence and pathogenic effect of enteroaggregative Escherichia coli virulence factors in international travelers. J Clin Microbiol. 2002;40:4185-90. Shah N, DuPont HL, Ramsey DJ. Global etiology of travelers' diarrhea: systematic review from 1973 to the present. Am J Trop Med Hyg. 2009;80:609-14. Adachi JA, Ericsson CD, Jiang ZD, et al. Natural history of enteroaggregative and enterotoxigenic Escherichia coli infection among US travelers to Guadalajara, Mexico. J Infect Dis. 2002;185:1681-3. Kukuruzovic R, Robins-Browne RM, Anstey NM, et al. Enteric pathogens, intestinal permeability and nitric oxide production in acute gastroenteritis. Pediatr Infect Dis J. 2002;21:730-9.

Enteroaggregative Escherichia coli

[62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84]

[85] [86] [87] [88]

Pathogenic Escherichia coli in Latin America 61

Nataro JP, Hicks S, Phillips AD, et al. T84 cells in culture as a model for enteroaggregative Escherichia coli pathogenesis. Infect Immun. 1996;64:4761-8. Hicks S, Candy DC, Phillips AD. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 1996;64:4751-60. Bouzari S, Jafari A, Zarepour M. Distribution of virulence related genes among enteroaggregative Escherichia coli isolates: using multiplex PCR and hybridization. Infect Genet Evol. 2005;5:79-83. Czeczulin JR, Whittam TS, Henderson IR, et al. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli. Infect Immun. 1999;67:2692-9. Elias WP, Uber AP, Tomita SK, et al. Combinations of putative virulence markers in typical and variant enteroaggregative Escherichia coli strains from children with and without diarrhoea. Epidemiol Infect. 2002;129:49-55. Jenkins C, Chart H, Willshaw GA, et al. Genotyping of enteroaggregative Escherichia coli and identification of target genes for the detection of both typical and atypical strains. Diagn Microbiol Infect Dis. 2006;55:13-9. Okeke IN, Lamikanra A, Czeczulin J, et al. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in Southwest Nigeria. J Infect Dis. 2000;181:252-60. Weintraub A. Enteroaggregative Escherichia coli: epidemiology, virulence and detection. J Med Microbiol. 2007;56:4-8. Boisen N, Struve C, Scheutz F, et al. New adhesin of enteroaggregative Escherichia coli related to the Afa/Dr/AAF family. Infect Immun. 2008;76:3281-92. Czeczulin JR, Balepur S, Hicks S, et al. Aggregative adherence fimbria II, a second fimbrial antigen mediating aggregative adherence in enteroaggregative Escherichia coli. Infect Immun. 1997;65:4135-45. Debroy C, Yealy J, Wilson RA, et al. Antibodies raised against the outer membrane protein interrupt adherence of enteroaggregative Escherichia coli. Infect Immun. 1995;63:2873-9. Dudley EG, Abe C, Ghigo JM, et al. An IncI1 plasmid contributes to the adherence of the atypical enteroaggregative Escherichia coli strain C1096 to cultured cells and abiotic surfaces. Infect Immun. 2006;74:2102-14. Monteiro-Neto V, Bando SY, Moreira-Filho CA, et al. Characterization of an outer membrane protein associated with haemagglutination and adhesive properties of enteroaggregative Escherichia coli O111:H12. Cell Microbiol. 2003;5:533-47. Nataro JP, Deng Y, Maneval DR, et al. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect Immun. 1992;60:2297-304. Wai SN, Takade A, Amako K. The hydrophobic surface protein layer of enteroaggregative Escherichia coli strains. FEMS Microbiol Lett. 1996;135:17-22. Chart H, Smith HR, Rowe B. Enteroaggregative strains of Escherichia coli belonging to serotypes O126:H27 and O44:H18 express antigenically similar 18 kDa outer membrane-associated proteins. FEMS Microbiol Lett. 1995;132:17-22. Spencer J, Chart H, Smith HR, et al. Expression of membrane-associated proteins by strains of enteroaggregative Escherichia coli. FEMS Microbiol Lett. 1998;161:325-30. Bilge SS, Clausen CR, Lau W, et al. Molecular characterization of a fimbrial adhesin, F1845, mediating diffuse adherence of diarrhea-associated Escherichia coli to HEp-2 cells. J Bacteriol. 1989;171:4281-9. Yamamoto T, Wakisaka N, Nakae T. A novel cryohemagglutinin associated with adherence of enteroaggregative Escherichia coli. Infect Immun. 1997;65:3478-84. Bhargava S, Johnson BB, Hwang J, et al. Heat-resistant agglutinin 1 is an accessory enteroaggregative Escherichia coli colonization factor. J Bacteriol. 2009;191:4934-42. Vial PA, Robins-Browne R, Lior H, et al. Characterization of enteroadherent-aggregative Escherichia coli, a putative agent of diarrheal disease. J Infect Dis. 1988;158:70-9. Knutton S, Shaw RK, Bhan MK, et al. Ability of enteroaggregative Escherichia coli strains to adhere in vitro to human intestinal mucosa. Infect Immun. 1992;60:2083-91. Suzart S, Guth BE, Pedroso MZ, et al. Diversity of surface structures and virulence genetic markers among enteroaggregative Escherichia coli (EAEC) strains with and without the EAEC DNA probe sequence. FEMS Microbiol Lett. 2001;201:163-8. Old DC, Tavendale A, Yakubu DE. Some strains of Escherichia coli of putative enteroadherent-aggregative serotypes produce an unusual fibrillar haemagglutinin. FEMS Microbiol Lett. 1989;50:87-91. Elias WP, Jr, Czeczulin JR, Henderson IR, et al. Organization of biogenesis genes for aggregative adherence fimbria II defines a virulence gene cluster in enteroaggregative Escherichia coli. J Bacteriol. 1999;181:1779-85. Nataro JP, Yikang D, Yingkang D, et al. AggR, a transcriptional activator of aggregative adherence fimbria I expression in enteroaggregative Escherichia coli. J Bacteriol. 1994;176:4691-9. Savarino SJ, Fox P, Deng Y, et al. Identification and characterization of a gene cluster mediating enteroaggregative Escherichia coli aggregative adherence fimbria I biogenesis. J Bacteriol. 1994;176:4949-57.

62 Pathogenic Escherichia coli in Latin America

[89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116]

Navarro-Garcia et al.

Cobeljic M, Miljkovic-Selimovic B, Paunovic-Todosijevic D, et al. Enteroaggregative Escherichia coli associated with an outbreak of diarrhoea in a neonatal nursery ward. Epidemiol Infect. 1996;117:11-6. Pereira AC, Britto-Filho JD, de Carvalho J, et al. Enteroaggregative Escherichia coli (EAEC) strains enter and survive within cultured intestinal epithelial cells. Microb Pathog. 2008;45:310-4. Sheikh J, Czeczulin JR, Harrington S, et al. A novel dispersin protein in enteroaggregative Escherichia coli. J Clin Invest. 2002;110:1329-37. Nishi J, Sheikh J, Mizuguchi K, et al. The export of coat protein from enteroaggregative Escherichia coli by a specific ATP-binding cassette transporter system. J Biol Chem. 2003;278:45680-9. Heilmann C, Schweitzer O, Gerke C, et al. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol Microbiol. 1996;20:1083-91. Schubert S, Rakin A, Karch H, et al. Prevalence of the "high-pathogenicity island" of Yersinia species among Escherichia coli strains that are pathogenic to humans. Infect Immun. 1998;66:480-5. Tzipori S, Montanaro J, Robins-Browne RM, et al. Studies with enteroaggregative Escherichia coli in the gnotobiotic piglet gastroenteritis model. Infect Immun. 1992;60:5302-6. Sheikh J, Hicks S, Dall'Agnol M, et al. Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol Microbiol. 2001;41:983-97. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol;8:26-38. Moreira CG, Carneiro SM, Nataro JP, et al. Role of type I fimbriae in the aggregative adhesion pattern of enteroaggregative Escherichia coli. FEMS Microbiol Lett. 2003;226:79-85. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123-40. Abe CM, Knutton S, Pedroso MZ, et al. An enteroaggregative Escherichia coli strain of serotype O111:H12 damages and invades cultured T84 cells and human colonic mucosa. FEMS Microbiol Lett. 2001;203:199-205. Benjamin P, Federman M, Wanke CA. Characterization of an invasive phenotype associated with enteroaggregative Escherichia coli. Infect Immun. 1995;63:3417-21. Eslava C, Navarro-Garcia F, Czeczulin JR, et al. Pet, an autotransporter enterotoxin from enteroaggregative Escherichia coli. Infect Immun. 1998;66:3155-63. Savarino SJ, Fasano A, Watson J, et al. Enteroaggregative Escherichia coli heat-stable enterotoxin 1 represents another subfamily of E. coli heat-stable toxin. Proc Natl Acad Sci USA. 1993;90:3093-7. Fasano A, Noriega FR, Maneval DR, Jr, et al. Shigella enterotoxin 1: an enterotoxin of Shigella flexneri 2a active in rabbit small intestine in vivo and in vitro. J Clin Invest. 1995;95:2853-61. Henderson IR, Czeczulin J, Eslava C, et al. Characterization of Pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infect Immun. 1999;67:5587-96. Mueller M, Grauschopf U, Maier T, et al. The structure of a cytolytic alpha-helical toxin pore reveals its assembly mechanism. Nature. 2009;459:726-30. Dudley EG, Thomson NR, Parkhill J, et al. Proteomic and microarray characterization of the AggR regulon identifies a pheU pathogenicity island in enteroaggregative Escherichia coli. Mol Microbiol. 2006;61:1267-82. Navarro-Garcia F, Eslava C, Villaseca JM, et al. In vitro effects of a high-molecular-weight heat-labile enterotoxin from enteroaggregative Escherichia coli. Infect Immun. 1998;66:3149-54. Henderson IR, Navarro-Garcia F, Nataro JP. The great escape: structure and function of the autotransporter proteins. Trends Microbiol. 1998;6:370-8. Navarro-Garcia F, Sears C, Eslava C, et al. Cytoskeletal effects induced by pet, the serine protease enterotoxin of enteroaggregative Escherichia coli. Infect Immun. 1999;67:2184-92. Navarro-Garcia F, Canizalez-Roman A, Luna J, et al. Plasmid-encoded toxin of enteroaggregative Escherichia coli is internalized by epithelial cells. Infect Immun. 2001;69:1053-60. Villaseca JM, Navarro-Garcia F, Mendoza-Hernandez G, et al. Pet toxin from enteroaggregative Escherichia coli produces cellular damage associated with fodrin disruption. Infect Immun. 2000;68:5920-7. Navarro-Garcia F, Canizalez-Roman A, Vidal JE, et al. Intoxication of epithelial cells by plasmid-encoded toxin requires clathrin-mediated endocytosis. Microbiology. 2007;153:2828-38. Navarro-Garcia F, Canizalez-Roman A, Burlingame KE, et al. Pet, a Non-AB Toxin, Is Transported and Translocated into Epithelial Cells by a Retrograde Trafficking Pathway. Infect Immun. 2007;75:2101-9. Canizalez-Roman A, Navarro-Garcia F. Fodrin CaM-binding domain cleavage by Pet from enteroaggregative Escherichia coli leads to actin cytoskeletal disruption. Mol Microbiol. 2003;48:947-58. Betancourt-Sanchez M, Navarro-Garcia F. Pet secretion, internalization and induction of cell death during infection of epithelial cells by enteroaggregative Escherichia coli. Microbiology. 2009;155:2895-906.

Enteroaggregative Escherichia coli

Pathogenic Escherichia coli in Latin America 63

[117] Rajakumar K, Sasakawa C, Adler B. Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins. Infect Immun. 1997;65:4606-14. [118] Gutierrez-Jimenez J, Arciniega I, Navarro-Garcia F. The serine protease motif of Pic mediates a dose-dependent mucolytic activity after binding to sugar constituents of the mucin substrate. Microb Pathog. 2008;45:115-23. [119] Parham NJ, Srinivasan U, Desvaux M, et al. PicU, a second serine protease autotransporter of uropathogenic Escherichia coli. FEMS Microbiol Lett. 2004;230:73-83. [120] Heimer SR, Rasko DA, Lockatell CV, et al. Autotransporter genes pic and tsh are associated with Escherichia coli strains that cause acute pyelonephritis and are expressed during urinary tract infection. Infect Immun. 2004;72:593-7. [121] Fasano A, Noriega FR, Liao FM, et al. Effect of shigella enterotoxin 1 (ShET1) on rabbit intestine in vitro and in vivo. Gut. 1997;40:505-11. [122] Behrens M, Sheikh J, Nataro JP. Regulation of the overlapping pic/set locus in Shigella flexneri and enteroaggregative Escherichia coli. Infect Immun. 2002;70:2915-25. [123] Ludwig A, von Rhein C, Bauer S, et al. Molecular analysis of cytolysin A (ClyA) in pathogenic Escherichia coli strains. J Bacteriol 2004;186:5311-20. [124] Lithgow JK, Haider F, Roberts IS, et al. Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12. Mol Microbiol. 2007;66:685-98. [125] von Rhein C, Hunfeld KP, Ludwig A. Serologic evidence for effective production of cytolysin A in Salmonella enterica serovars typhi and paratyphi A during human infection. Infect Immun. 2006;74:6505-8. [126] von Rhein C, Bauer S, Simon V, et al. Occurrence and characteristics of the cytolysin A gene in Shigella strains and other members of the family Enterobacteriaceae. FEMS Microbiol Lett. 2008;287:143-8. [127] Baldwin TJ, Knutton S, Sellers L, et al. Enteroaggregative Escherichia coli strains secrete a heat-labile toxin antigenically related to E. coli hemolysin. Infect Immun. 1992;60:2092-5. [128] Gomes TA, Abe CM, Marques LR. Detection of HeLa cell-detaching activity and alpha-hemolysin production in enteroaggregative Escherichia coli strains isolated from feces of Brazilian children. J Clin Microbiol. 1995;33:3364. [129] Fernandez-Prada C, Tall BD, Elliott SE, et al. Hemolysin-positive enteroaggregative and cell-detaching Escherichia coli strains cause oncosis of human monocyte-derived macrophages and apoptosis of murine J774 cells. Infect Immun. 1998;66:3918-24. [130] Haque MA, Ohki K, Kikuchi M, et al. Contact hemolysin production by strains of enteroaggregative Escherichia coli isolated from children with diarrhea. J Clin Microbiol. 1994;32:1109-11. [131] Menard LP, Lussier JG, Lepine F, et al. Expression, purification, and biochemical characterization of enteroaggregative Escherichia coli heat-stable enterotoxin 1. Protein Expr Purif. 2004;33:223-31. [132] Greenberg RN, Hill M, Crytzer J, et al. Comparison of effects of uroguanylin, guanylin, and Escherichia coli heat-stable enterotoxin STa in mouse intestine and kidney: evidence that uroguanylin is an intestinal natriuretic hormone. J Investig Med. 1997;45:276-82. [133] Huang DB, DuPont HL, Jiang ZD, et al. Interleukin-8 response in an intestinal HCT-8 cell line infected with enteroaggregative and enterotoxigenic Escherichia coli. Clin Diagn Lab Immunol. 2004;11:548-51. [134] Steiner TS, Nataro JP, Poteet-Smith CE, et al. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest. 2000;105:1769-77. [135] Hayashi F, Smith KD, Ozinsky A, et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature. 2001;410:1099-103. [136] Khan MA, Kang J, Steiner TS. Enteroaggregative Escherichia coli flagellin-induced interleukin-8 secretion requires Tolllike receptor 5-dependent p38 MAP kinase activation. Immunology. 2004;112:651-60. [137] Kucharzik T, Hudson JT, 3rd, Lugering A, et al. Acute induction of human IL-8 production by intestinal epithelium triggers neutrophil infiltration without mucosal injury. Gut. 2005;54:1565-72. [138] Sansonetti PJ, Arondel J, Huerre M, et al. Interleukin-8 controls bacterial transepithelial translocation at the cost of epithelial destruction in experimental shigellosis. Infect Immun. 1999;67:1471-80. [139] Madara JL, Patapoff TW, Gillece-Castro B, et al. 5'-adenosine monophosphate is the neutrophil-derived paracrine factor that elicits chloride secretion from T84 intestinal epithelial cell monolayers. J Clin Invest. 1993;91:2320-5. [140] Jiang ZD, Okhuysen PC, Guo DC, et al. Genetic susceptibility to enteroaggregative Escherichia coli diarrhea: polymorphism in the interleukin-8 promotor region. J Infect Dis. 2003;188:506-11. [141] Harrington SM, Strauman MC, Abe CM, et al. Aggregative adherence fimbriae contribute to the inflammatory response of epithelial cells infected with enteroaggregative Escherichia coli. Cell Microbiol. 2005;7:1565-78. [142] Hull J, Ackerman H, Isles K, et al. Unusual haplotypic structure of IL8, a susceptibility locus for a common respiratory virus. Am J Hum Gene.t 2001;69:413-9.

64 Pathogenic Escherichia coli in Latin America

Navarro-Garcia et al.

[143] Haider K, Faruque SM, Shahid NS, et al. Enteroaggregative Escherichia coli infections in Bangladeshi children: clinical and microbiological features. J Diarrhoeal Dis Res. 1991;9:318-22. [144] Guerrant RL, Van Gilder T, Steiner TS, et al. Practice guidelines for the management of infectious diarrhea. Clin Infect Dis. 2001;32:331-51. [145] Geyid A, Olsvik O, Ljungh A. Virulence properties of Escherichia coli isolated from Ethiopian patients with acute or persistent diarrhoea. Ethiop Med J. 1998;36:123-39. [146] Kawano K, Yamada T, Yagi T, et al. [Detection of enteroaggregative Escherichia coli from sporadic diarrhea patients]. Kansenshogaku Zasshi. 1998;72:1275-82. [147] Wagner A, Wiedermann U. Travellers' diarrhoea - pros and cons of different prophylactic measures. Wien Klin Wochenschr. 2009;121Suppl3:13-8. [148] DuPont HL. Systematic review: the epidemiology and clinical features of travellers' diarrhoea. Aliment Pharmacol Ther. 2009;30:187-96. [149] Shamir ER, Warthan M, Brown SP, et al. Nitazoxanide Inhibits Biofilm Production and Hemagglutination by Enteroaggregative Escherichia coli Strains by Blocking Assembly of AafA Fimbriae. Antimicrob Agents Chemother. [150] Fernandes RM, Carbonare SB, Carneiro-Sampaio MM, et al. Inhibition of enteroaggregative Escherichia coli adhesion to HEp-2 cells by secretory immunoglobulin A from human colostrum. Pediatr Infect Dis J. 2001;20:672-8. [151] Monteiro BT, Campos LC, Sircili MP, et al. The dispersin-encoding gene (aap) is not restricted to enteroaggregative Escherichia coli. Diagn Microbiol Infect Dis. 2009;65:81-4. [152] Huang DB, Brown EL, DuPont HL, et al. Seroprevalence of the enteroaggregative Escherichia coli virulence factor dispersin among USA travellers to Cuernavaca, Mexico: a pilot study. J Med Microbiol. 2008;57:476-9.

Pathogenic Escherichia coli in Latin America, 2010, 65-83

65

CHAPTER 5 Shiga Toxin-Producing Escherichia coli Beatriz EC Guth1*, Valeria Prado2 and Marta Rivas3 1

Department of Microbiology, Immunology, and Parasitology, Universidade Federal de São Paulo, São Paulo, Brazil; 2Microbiology Program, Institute of Biomedical Sciences, Faculty of Medicine, Universidad de Chile, Santiago, Chile; 3Branch of Physiopathogenesis, Department of Bacteriology, Instituto Nacional de Enfermedades Infecciosas-ANLIS "Dr. Carlos G. Malbrán", Buenos Aires, Argentina. Abstract: Shiga toxin-producing Escherichia coli (STEC) can produce a wide spectrum of human diseases, being an important cause of both outbreaks and sporadic cases of bloody and non-bloody diarrhea, hemorrhagic colitis, the diarrhea-associated form of hemolytic uremic syndrome (HUS) worldwide. HUS is a major cause of acute renal failure in children. Albeit O157:H7 is by far the most important serotype in human infections, several different O:H serotypes of E. coli can harbor Shiga toxin (stx) genes, and actually some non-O157 strains cause illnesses that are comparable in severity to O157-induced diseases, posing a substantial concern to public health. Infections due to STEC have a proven zoonotic character as these bacteria are largely distributed among both domestic and wildlife animal species. STEC infections are transmitted to humans through contaminated food, water, and contact with infected animals or people. The cascade leading from gastrointestinal infection to renal impairment is complex, being the production of Stx the major pathogenicity determinant of STEC. However, a mosaic of different virulence traits comprising several adhesins and other toxins that may play a role in pathogenesis has also been described. There is no specific treatment to reduce the progression of HUS. Research is still necessary to improve our knowledge on the mechanisms of Stx infections and the pathophysiology of cell injury in HUS to lead to better therapeutic strategies to prevent the acute mortality and the long-term morbidity of HUS.

INTRODUCTION Shiga toxin-producing E. coli (STEC) is characterized by its ability to produce at least one member of a class of potent cytotoxins that have the ability to inhibit protein synthesis in eukaryotic cells. These toxins were named verotoxin (VT) for their activity in cultured Vero cells [1], as well as Shiga toxin (Stx) due to similarities to the toxin produced by Shigella dysenteriae 1 [2]. Thus, the names VTEC (Verotoxigenic E. coli) and STEC (Shiga toxin-producing E. coli) are equivalent and define all E. coli strains that produce one or more toxins of the Stx (VT) family [3]. Although association between certain E. coli strains isolated from children with diarrhea and production of cytotoxins have been reported since the 70’s [1], the importance of STEC as human pathogens gained notoriety only in the 80’s. In 1982, two outbreaks of severe bloody diarrhea, called hemorrhagic colitis (HC), related to a previously rare serotype of E. coli, the O157:H7 were reported in the United States [4]. Subsequent studies demonstrated that the O157 isolates that had caused these outbreaks produced Stx [5], and that this toxin was identical to the verotoxin produced by an O157:H7 strain isolated from HC in Canada [6]. The important events in the linkage of HUS and STEC were the reports by Karmali et al. [7, 8] describing the association of HUS with Stxproducing E. coli strains. Studies in several other countries subsequently confirmed the linkage between STEC infection and the development of HUS, and also with another post-diarrheal syndrome, thrombotic thrombocytopenic purpura (TPP), more commonly found in adults. The term enterohemorrhagic E. coli (EHEC) was originally used to classify a subset of STEC strains, being E. coli O157:H7 the prototype, considered to be highly pathogenic and responsible to cause severe human diseases, including HC and HUS, which besides expressing Stx, present other virulence attributes as the eae gene for bacterial intimate adherence and a plasmid of approximately 60 MDa known as “EHEC plasmid” [9]. However, as it was shown later the absence of virulence markers such as eae does not necessarily indicate that an isolate is less virulent for humans [10], thereby leading to the use of more general term STEC to refer to all types of Stx-producing E. coli isolates. In contrast to infections caused by other pathogenic E. coli, those associated with STEC have a proven zoonotic *Address correspondence to: Dr. Beatriz E C Guth, Department of Microbiology, Immunology, and Parasitology, Universidade Federal de São Paulo, São Paulo, 04023-062, Brazil; Tel:55-11-50832980; e-mail:[email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

66 Pathogenic Escherichia coli in Latin America

Guth et al.

character. Although most of the animals are asymptomatic carriers of STEC, diarrheal disease have been reported in calves, dogs and cats [11, 12,]. The piglet edema disease, a serious STEC-related illness is caused by particular STEC strains [14]. Ruminant animals, especially cattle, have long been recognized as the main natural reservoir of STEC strains [15], however several different surveys have demonstrated that STEC strains occurred in the gastrointestinal tracts of many other domestic animals such as sheep, goats, water buffalos, pigs, dogs, and cats [16, 17, 18, 19]. STEC can also be found in wildlife animals and birds, and the possible role of these animals as reservoirs for domestic animals sharing the same environment has been suggested [17, 20]. As a consequence, direct and indirect animal contact was identified as important transmission route for STEC in the environment followed by person to person spread of STEC as second most important way of transmission [21, 22]. E. coli O157:H7 has become one of the most significant food-borne pathogens, exhibiting some characteristic features such as its low infectious dose and acid tolerance that certainly favors its transmission to humans by the food chain. Since the first reported O157:H7 outbreak, many others have been linked to the consumption of raw or undercooked foods of bovine origin, which is one of the most common sources of human STEC infection, but raw or inadequately pasteurized dairy products, fermented or dried meat, unpasteurized apple cider, and several types of produce had also been sources of infection [23]. The spectrum of vehicles implicated in transmission of STEC is expanding far beyond the initial meat-related outbreaks, and the environmental contamination of farmland and irrigation water with STEC explains their finding in vegetables, fruits and sprouts [17]. Over the years, it has been recognized that more than 400 different O:H serotypes of E. coli can harbor stx genes, and a considerable proportion of them have already been recovered from human hosts (http://www.lugo.usc.es/ecoli/SEROTIPOSHUM.htm). Apart from O157:H7, the serogroups and serotypes of STEC implicated in human diseases vary from country to country, however certain serotypes such as motile and non-motile strains of O26:[H11], O103:H2, O111:[H8] and O145:[H28] tend to be found frequently associated with HC and HUS in most countries [24]. Indeed, in some geographic regions the frequency of non-O157 STEC illness overlaps that of O157 [25, 26, 27, 28, 29]. However, the role of non-O157 STEC is certainly underestimated in several countries because, in contrast to O157:H7, most laboratories do not routinely screen for them. Therefore, considerable concern regarding the awareness of the clinical importance of non-O157 STEC and the need of rapid, cost-effective diagnostic methods to detect them has been recently discussed [31, 30]. Within Latin-American countries, STEC infections seem to be more common in the South, reports of sporadic cases of diarrhea and HUS come from Argentina, Chile, Uruguay, Paraguay and Brazil, and it is probable that the problem exists but it is underestimated in other countries. Large outbreaks have not been notified in Latin America, perhaps due to lacking of surveillance programs. STEC INFECTIONS In Latin America, STEC infections are endemic and contribute to the burden of acute diarrheal syndrome in children less than 5 years of age being responsible for 2% of total cases of acute diarrhea, and in a few studies correspond to 20-30% of bloody diarrhea [32, 33]. More recent surveys have shown that in Argentina STEC accounted for approximately 2% of diarrheal diseases. In a study carried out in 2007 in Neuquén City, the rate of STEC detection in fecal samples of adults and pediatric patients with bloody and non-bloody diarrhea was low in comparison with the high number of HUS cases reported in the same period. These results suggest that the strains of this region may have a higher pathogenic potential, which allows a rapid evolution to HUS [34]. The clinical spectrum of STEC infections is broad and varies from asymptomatic cases, watery diarrhea, bloody diarrhea (or HC) and severe systemic complications as HUS. HUS is characterized by acute renal failure, microangiopathic hemolytic anemia, and thrombocytopenia [35], and is the most common indication for renal transplant in children [36]. Although the kidneys are the main targets, other organs, including the central nervous system, lungs, pancreas, and heart, may be affected. Five to 10% of children with STEC infection develop HUS, and the mortality rate among these children in the acute phase is 5% [37, 38].Infection and disease occurs after ingestion of a low dose of bacteria (as low as 50 colony forming units [CFU] and the incubation period is about 3-4 days. After that period, a high proportion of patients present watery diarrhea, and about 30% (80% in Argentina) of them evolve on day 5-6 to bloody diarrhea, presenting stools with mucus and spots of blood and a minority present HC. Mild or no fever is observed. Abdominal pain and scramps are frequent and more relevant in older children, but

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 67

vomiting and irritability are also observed. In some patients, the symptoms of HUS appear on day 6-8 from the onset of diarrhea and include: microangiopathic hemolytic anemia (hematocrit <30%, schistocytes), thrombocytopenia (<150,000 platelets/mm3) and acute renal failure (creatinine >1mg/dl). In some STEC infected patients a silent period between diarrhea and HUS is observed, in other HUS patients appears during the diarrhea episode, and in a low proportion of HUS cases, there is no prodromic diarrhea [39]. In some cases, the first symptoms of HUS are neurologic manifestations such as seizures and coma. During the course of HUS is common that patients present hypertension as a consequence of overload of intravascular volume and activation of renine-angiotensin-aldosterone system due to renal ischemia [39, 40, 41]. But congestive cardiac failure, pulmonar edema, coagulopathies, electrolytic disorders, like hyperkalemia, and neurologic involvement are also registered [42]. Appearance of HUS as a complication of STEC infection is the consequence of complex interactions between the bacteria and the host factors. The STEC serotype seems to be an important associated factor, and the risk for HUS has been reported to be 10-15% for O157:H7 STEC. On the other hand, the risk for HUS development is lower, around 2%, when the strain belongs to a non-O157 serotype. It is important to consider that a proportion of children (about 10%) can present an incomplete HUS with two out of three classical features [43, 32]. The severity of initial disease is also important, being bloody diarrhea a risk factor present in 60% of Chilean children with HUS [40, 44]. The most affected age group are children less than 5 years of age, but the mean age of children with HUS varies in different countries, and range between 16 months in Chile, 29 months in Argentina, 31 months in Canada, and 3.8 years in Minessota [33, 44, 45, 46]. These differences may be associated with differences in mechanisms of transmission. Sequelae Arterial hypertension, central nervous system dysfunction, (seizures, occasionally coma), chronic renal failure and involvement of other organs are the most serious complications in HUS patients. Mortality ranges from 2-10% and up to 30% of patients will develop sequelae due to severe hypertension, and/or increased proteinuria and decreased glomerular filtration [47]. Among the complications described are: myocardial ischemia, colonic necrosis, rectal stenosis and/or prolapsed. Almost 20% of patients have evidence of pancreatic involvement with increase of serum amylase and lipase, and diabetes mellitus is seen in a low proportion of cases [48]. Neurologic sequelae as hemiparesis, learning disorders and epilepsy have also been described. STEC PATHOGENESIS As with other enteric E. coli infections, the disease process is considered to involve colonization of the intestine and damage due to toxins. The production of Stx is essential for many of the pathological features and sequelae of STEC infection. However, pathogenesis is a multistep process, involving a complex interaction between a range of bacterial and host factors. During colonization, STEC overcome host defense mechanisms to establish them in the intestine. Gastric acidity is an important host defense mechanism in the gastrointestinal tract, and acid resistance is a general feature of STEC O157 and other serotypes, which facilitate their survival through the low pH of the stomach [49]. The bacteria pass through the small intestine, and virulence genes are turned on by environmental signals in the colon [50]. Adherence to intestinal epithelial cells is an early event on STEC infection, and markedly different between strains that contain the LEE pathogenicity island and those strains that are LEE-negative. In LEE-positive strains, adherence to enterocytes of the colon is produced by a characteristic mechanism called attaching and effacing (A/E) lesion, which involves ultraestructural changes, localized destruction of enterocyte microvilli, and intimate attachment of the bacterium to the apical cell surface. Beneath the adherent bacteria, there is a rearrangement of the cytoskeletal actin components and the formation of actin-rich pedestals. The bacterial genes required for A/E lesion formation are located on the LEE and are conserved in EPEC and STEC strains capable of inducing A/E lesions, but absent in other E. coli pathotypes and non-pathogenic E. coli [51]. On the other hand, the adherence mechanisms of LEEnegative STEC strains are less understood, and several proteins were proposed to be novel adhesive factors [reviewed in 52]. As mentioned before, production of Stx is the hallmark factor in STEC diseases. If sufficient Stx is produced, local damage in blood vessels in the colon results in bloody diarrhea. If sufficient Stx is absorbed into circulation, vascular endothelial sites rich in the toxin receptor are damaged, leading to impaired function. Following binding of

68 Pathogenic Escherichia coli in Latin America

Guth et al.

toxin to its globotriaosylceramide (Gb3) receptor, Stx appears to induce its transport to clathrin-coated pits, from which the toxin molecule is taken up into the cell by receptor-mediated endocytosis [53, 54]. In this process, a fragment of cell membrane pinches off to produce a coated vesicle with toxin molecules on the internal surface of the membrane. The vesicles may fuse with lysosomal vesicles, resulting in destruction of the protein toxin, leading to protection of the cell. In cells that are susceptible, however, Stx in the vesicle is transported using the retrograde pathway to the Golgi apparatus and the endoplasmic reticulum, after which the A1 fragment enters the cytosol, where interaction of the A1 subunit with the 28S rRNA results in inhibition of protein synthesis [55]. The fatty acid content of the Gb3 receptor may influence the interaction of Stx with the cell [56]. Binding of Stx induced signaling that resulted in an increase in Stx entry into the cell. Expression of the Stx receptor is a primary determinant of susceptibility to tissue injury. Both quantity and type of Gb3 present on epithelial or endothelial cells may therefore influence susceptibility to Stx. The pro-inflammatory cytokines IL-1β and tumor necrosis factor-α may also up regulate expression of Gb3 on endothelial cells [57]. Shiga toxin has been shown to induce production of IL-8 by human colonic epithelial cells and the inflammation that develops likely impairs the intestinal epithelial barrier function, thereby facilitating passage of Stx from the lumen into the submucosal area [58, 59, 60]. Most aspects of bloody diarrhea and HUS appear to be attributable to the action of Stx on vascular endothelial cells and thrombotic microangiopathy is a central feature of the disease [61]. Bloody diarrhea is associated with lesions in small blood vessels in the colon. Gianantonio et al. [62] described the pathologic renal findings in the acute stage of HUS and showed that most of the lesions are expressions of intravascular clotting. The HUS is associated with renal glomerular lesions that are due to damage to endothelial cells, which become swollen and detach from the basement membrane. Fibrin thrombi develop, and there is narrowing or occlusion of the capillary lumen [63]. The compromise in the blood supply to the glomeruli is the major contributor to loss of kidney function, but damage to glomerular epithelial and proximal tubular epithelium may also contribute to kidney damage. It has been demonstrated that Stx directly affect renal tubular cells [64, 65], and it seems plausible that injured tubular cells trigger the activation of the coagulation and inflammatory systems, which in turn, sensitize endothelial glomerular cells to Stx toxic effects. Independent of which cell type is the first target of Stx, the extent of glomerular injury will be determinant in long-term outcome, as tubular damage can be repair, whereas affected glomeruli will become fibrotic reducing the number of functional nephrons. In addition to Stx, several other factors from the bacteria and from the host that may have importance on the inflammatory and thrombotic responses in the development of HUS have been described and will be presented below. STEC VIRULENCE FACTORS Stx is the major virulence determinant of STEC, but a repertoire of different virulence factors comprising several adhesins and other toxins that may play a role in STEC pathogenesis has also been documented. Shiga Toxin The members of the Stx family share a conserved AB5 subunit structure, consisting of a single catalytic A subunit of approximately 32 kDa and a pentameric B subunit (7,7 kDa monomers) that is responsible for the binding of the toxin to specific glycolipid receptors on the surface of target cells [66]. The existence of two major Stx groups, Stx1 and Stx2, were described based on sequence analysis of stx genes and neutralization assays. Each group contains the major Stx type and an increasing number of variants. The Stx1 group presently consists of Stx1, which is nearly identical to Stx of S. dysenteriae type 1, and two variants Stx1c [67, 68] and Stx1d [69]. Stx2, which shares less than 60% amino acid sequence with Stx1, comprise a more heterogeneous group of toxins and an expanding number of variants that include Stx2c [70], Stx2d [71, 72], Stx2e [73], Stx2f [74, 75], and Stx2g [76], which has not yet found in humans. Stx2dactivatable differs from the other Stx types as its biological activity can be activated by elastase, a constituent of the intestinal mucus [77]. The genetic information for the production of Stx1, Stx2 and certain Stx variants are located in the genome of temperate lambdoid bacteriophages integrated in the STEC chromosome [reviewed in 78]. A single STEC strain can possess one or more different stx genes, and although most of the Stx variants have been isolated from patients, not all of them are associated with severe disease. In this respect, it has been reported that STEC producing only Stx2 are more pathogenic than those producing Stx1 alone and those producing both Stx1 and Stx2. Moreover, STEC strains producing Stx2, Stx2c and Stx2dactivatable have been more

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 69

frequently associated with HC and HUS when compared to the other members of Stx1 and Stx2 groups that were most commonly isolated from uncomplicated diarrhea and asymptomatic infections [79]. Therefore, information about the stx2 allele has considerable predictive value to assess the risk of HUS development in a patient that presents STEC infection [80]. A/E Lesion Certain STEC strains colonize the intestinal mucosa, inducing a characteristic histophatological lesion defined as “attaching and effacing” (A/E), which is genetically governed by a large pathogenicity island named the Locus of Enterocyte Effacement (LEE). The LEE pathogenicity island is organized into 5 major polycistronic operons called LEE1 to LEE5. The products of LEE are a type III secretion apparatus (LEE1 to LEE3), a protein translocation system (LEE4), and an adherence system consisting of an outer membrane protein called intimin and its translocated intimin receptor (Tir), both encoded by LEE5, and other effector proteins that are translocated by the secretion system. The secretion apparatus is a molecular syringe structure that begins inside the bacterial cytoplasm extends through the inner and outer membranes and passes through the host cell membrane. Secreted proteins are transferred from the bacterial cytoplasm to the host cell through this structure. The Tir protein becomes inserted into the host cell membrane and acts as the receptor for intimin on the bacterial surface. Tir and other secreted proteins (EspA, EspP, EspI, StcE) activate a number of signaling cascades that result in rearrangement of the intestinal epithelial cell architecture and in changes in the cell physiology, causing diarrhea and intestinal inflammation [81, 82]. Interestingly, EspJ, a non LEE-encoded secreted protein, has been identified as an anti-virulence factor. The intimin-coding genes eae present considerable heterogeneity in their 3’ end that encodes the C-terminal 280 amino acids involved in binding to the enterocytes and Tir [83, 84], and the corresponding changes in the amino acid sequence also represent antigenic variations. Based on the sequence and antigenic differences in this C-terminal cell binding domain, at least 17 distinct intimin types have been identified and classified with a nomenclature system based on the Greek alphabet (α1, α2, β1, β2,γ1, γ2/θ, δ/κ, ε, ζ, η, η2, ι, λ, , ν, ξ, o) [85, 86, 87]. These intimin variants are distributed among STEC and EPEC of human and animal origins. The γ1 intimin is associated with highly pathogenic STEC serotypes such as O157:H7 and O145:H− [88, 89]. It has been hypothesized that the wide variability in the polypeptide cell binding domain of intimin could play a role in the tissue tropism of the different intimin producing E. coli. EPEC, which produce β intimin, can colonise almost all regions of the small bowel, while binding of γ intimin-positive STEC strains is restricted to the follicle-associated epithelium of the Peyer’s patches [90]. Although the A/E lesion is not essential for bloody diarrhea and HUS in humans, most of the strains implicated in these syndromes are LEE-positive and the eae gene has been identified as a risk factor for HUS [91]. HC and HUS patients develop antibody responses to several LEE-encoded proteins. Furthermore, immunization with LEEencoded proteins can partially protect reservoir hosts against STEC infection [92, 93, 94]. It is important to point out that several LEE-positive STEC strains are not associated with HUS, and that the type III secretion system also secretes many other effector molecules encoded outside the LEE, that are referred to as non-LEE-encoded effectors (nle) [95]. At least three of these nle have been linked to non-O157 STEC that cause HUS [96]. Other Adhesion Mechanisms and Putative Adhesins Apart from the pivotal role of intimin in the adherence of LEE-positive STEC to human intestine, considerable research has been undertaken to discover other fimbrial and non-fimbrial adherence factors that may be involved in binding of these organisms to eukaryotic cells [reviewed in 97]. The involvement of a 60 MDa STEC plasmid referred to as pO157, in the adherence of STEC O157:H7 was initially suggested by Karch et al. [98]. These investigators found that the presence of the plasmid correlated with expression of fimbriae and adherence to Henle 407 but not HEp-2 cells. However, subsequent studies have produced conflicting results and there is no consistent in vitro evidence for a role for pO157 in STEC adherence [99, 100, 101]. Experimental infection studies indicate that pO157 is not required for EHEC O157:H7 virulence in gnotobiotic piglets [102], but it was more recently reported that pO157 influences colonization of the bovine terminal rectum [103]. In addition, it has been described that the plasmid-encoded serine protease EspP from O157:H7 STEC, which belongs to the family of serine protease autotransporters of Enterobacteriaceae (SPATES), contributes to adherence to bovine primary rectal cells and colonization of the bovine intestines [104]. However, the mechanism by which EspP affects intestinal colonization and adherence to cultured cells is unknown.

70 Pathogenic Escherichia coli in Latin America

Guth et al.

A chromosomal genetic locus named efa-1 (EHEC factor for adherence) was characterized in a clinical O111:NM STEC strain, and this locus was shown to mediates adherence to cultured Chinese hamster ovary (CHO) cells [105]. Mutations on the efa-1 gene dramatically reduced the number of bacteria associated with the bovine intestinal epithelium, although the mutants still retain their ability to form both microcolonies and A/E lesions [106]. A truncated version of efa-1 was identified in the chromosomes of the two fully sequenced O157:H7 prototype EDL933 and Sakai strains [107, 108]. It was suggested that this gene influences bacterial adhesion and intestinal colonization [109]. Another gene significantly homologous to efa-1 and also located in pO157 known as toxB was described [110]. Although strains lacking toxB presented reduced adherence to cultured epithelial cells [109], studies using single and double O157:H7 toxB and efa1’ deletion mutants indicate that neither ToxB, nor the truncated version of Efa1, are required for efficient intestinal colonization of calves [106]. On the other hand, it has been suggested that these genes may indirectly influences adherence by modulating the production and secretion of LEE-encoded effector proteins that are required for the formation of A/E lesions [106]. The distribution of efa-1 and toxB has been described in different STEC serotypes and the close association on the presence of these genes with eae has been confirmed [111, 112, 113, 114]. Some other proteins have been implicated as mediators of adherence in O157 STEC including Iha (Vibrio cholerae IrgA homologue adhesin), and Cah (calcium-binding antigen 43 homologue), but with no obvious role in pathogenesis. Iha, a 67 kDa outer membrane protein, was associated with adherence to HeLa cells only when it is expressed in a non-fimbriated E. coli stain [115]. The iha gene, which is located adjacent to an O-island encoding urease and tellurite resistance in O157:H7 strain, is commonly distributed in many STEC serotypes isolated from humans and cattle, independently of the presence of eae [112, 113, 116]. Cah is a surface-expressed and heat-extractable protein that causes autoaggregation and changes in bacterial shape when it is expressed as a recombinant protein and also participates in the formation of biofilms [117]. Two chromosomal gene clusters closely related to the long polar fimbrial (lpf) operon of Salmonella enterica serovar Typhimurium were identified in O157:H7 STEC [118, 119]. Expression of E. coli O157:H7 lpf operon 1 (lpf1) in E. coli K-12 was shown to increase adherence to HeLa cells, and is associated with the appearance of long fimbriae [118]. The lpf2 operon has also been linked to adherence to epithelial cells [119]. In addition, E. coli O157:H7 mutants in one or both of the lpf loci showed diminished colonization abilities in animal models [120], and the role of Lpf as a colonization factor associated with persistence in the intestine was elucidated using a lamb model of infection [121]. The adhesion mechanisms of non-O157 LEE-negative serotypes have been the subject of intense research, since some of these bacteria have been associated with sporadic cases and small outbreaks of HC and HUS [10]. The occurrence of fimbrial and non-fimbrial proteins with adhesive functions, beyond some of those already known among LEE-positive strains, has been reported. Investigations on the attachment of O113:H21 STEC to HEp-2 cultured cells and to rabbit intestine in vivo showed that there were areas of microvillus effacement beneath the organism, but that the cytoskeletal rearrangement characteristic of the AE lesion did not develop [122]. An autoagglutinating adhesin named Saa (STEC autoagglutinating adhesin) was initially characterized in an O113:H21 STEC strain isolated during an outbreak of HUS in Australia [123]. Saa is a plasmid encoded outer membrane protein of approximately 56 kDa, with little homology to other known bacterial adhesins. Saa was associated with both an increase in adherence to Hep-2 cells when it was expressed as a recombinant protein in E. coli and with a reduction in adherence when its gene was mutagenized in the wild-type strain [123]. Because saa was detected in several HUS associated LEE-negative STEC isolates but in any of the LEE-positive strains, it was suggested that saa may be a marker for a subset of LEE-negative STEC strains capable of causing severe gastrointestinal and systemic illness in humans [123]. However, subsequent surveys showed that saa is also widely found in bovine STEC isolates [112, 113, 114, 124, 125], sometimes at greater frequencies than in human STEC strains, suggesting that Saa may have a more important role in attachment to the bovine gut than the human intestine [124]. The participation of Saa in the adherence process of an O125 STEC strain isolated from HC was also described [126]. Moreover, a Saa-independent mechanism of adherence has also been reported by Toma et al. [127]. Homologs of lpf genes have also been detected in non-O157 STEC strains. A similar region to the O157 lpf2 operon, also involved in adherence to epithelial cells, was characterized in a LEE-negative O113:H21 STEC strain [128]. Subsequent studies showed that the lpfA gene from STEC O113 (lpfAO113) is highly frequent among LEE-negative E. coli strains isolated from humans and animals [112, 113, 125, 129, 130], and thus may represent an important

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 71

adherence factor in this group of pathogens. Recently, Galli et al. [131] using a collection of Argentinean LEEnegative STEC strains, determined that the different lpfA types were present in a wide variety of serotypes and no apparent association was observed between the types of lpfA1 or lpfA2 genes and the severity of human disease. The lpfA2-1 was the most prevalent variant identified, which was present in 95.8% of the isolates, and the lpfA1-3 and lpfA2-2, proposed as specific biomarkers of E. coli O157:H7, were not found in any of the serotypes studied. Other Toxins The plasmid-encoded hemolysin (Ehly) is a pore-forming cytolysin [132] belonging to the repeats-in-toxin (RTX) family [133] and responsible for the so called enterohemolytic phenotype observed among O157 and non-O157 STEC strains [134]. Production of Ehly has been identified at varied frequencies both in eae-positive and eaenegative STEC strains. Humoral immune response to this protein, detected in sera of patients recovering from HUS, demonstrates its expression during infection, and was the first evidence of an association of Ehly with the virulence of STEC [133]. It has been suggested that hemolysin could contribute to disease through lysis of erythrocytes and release of hemoglobin as a potential source of iron for the bacteria. A direct effect of Ehly on endothelial cells has not been investigated, but E. coli expressing the cloned enterohemolysin operon induced IL-1β [ 57], one of the cytokines that upregulates Stx receptor Gb3. Therefore, enterohemolysin might augment the effects of Stx on endothelial cells. Although this is an attractive hypothesis, there is no available data to support a role of enterohemolysin in the hemolytic anemia of HUS patients. A new member of the cytolethal distending toxin (CDT) family was identified in O157 and some particular nonO157 STEC serotypes associated with HUS, and designated CDT-V [135, 136]. Investigations on the biological effects of recombinant CDT-V from an O157 strain on human endothelial cells showed that CDT-V damages eukaryotic DNA, leading to G2/M cell cycle arrest and cell death [137]. These data demonstrate that CDT-V directly injures endothelial cells resulting in their dead, and may thus contribute in the pathogenesis of HUS. Subtilase cytotoxin, a novel member of the AB5 family of toxins, was identified for the first time in an O113:H21 STEC strain associated with an outbreak of HUS in Australia [138]. The presence of subAB genes was further identified in STEC strains belonging to different serotypes and isolated in other countries [113, 125, 139, 140, 141, 142]. This new toxin is composed of an enzymatically active A subunit, which is a subtilase-like serine protease, and a binding B subunit, which is related to a putative exported protein from Yersinia pestis. Intraperitoneal injection of purified SubAB into mice causes extensive microvascular tromboses, and necrosis in the kidneys, brain and liver [138], resembling the lesions observed in patients with HUS, and thus suggesting a contribution of this toxin to the pathogenesis of STEC disease. The simultaneous presence of cdt-V and subAB genes was recently reported in several LEE-negative STEC serotypes, some of which related to severe human diseases [113, 125, 142]. Additional Factors from the Bacteria and From the Host Several authors have reported the importance of the inflammatory and thrombotic responses in the development of HUS. In the STEC O157 infection, H7 flagellin appears to be a major contributor to colonic inflammation. Berin et al. [143] proposed that H7 flagellin played a major part in the activation of proinflammatory signals in human colon epithelial cells. Miyamoto et al. [144] reported that upregulation of proinflammatory cytokines and attraction of subepithelial neutrophils was observed following addition of H7 flagellin, which binds to toll-like receptor 5 leading to activation of NF-B and secretion of IL-8. Besides its putative role in STEC adherence, the plasmid-encoded serine protease EspP was shown to cleave coagulation factor V in human plasma [145], and this effect has been proposed to contribute to the mucosal hemorrhages observed in patients with HC. Moreover, the presence of proteolytically active EspP in other serogroups most frequently associated with HC and HUS suggests its role as a significant STEC virulence factor [146]. Other proteases (EspA, EspJ, EspI, StcE) are also produced by STEC and their role in the pathogenicity has been discussed elsewhere [15, 81]. The lipopolysaccharide (LPS) is a major product of the Gram-negative bacteria that induce the clinical syndrome of septic shock and renal cortical necrosis. Both Stx and LPS may be absorbed from the inflamed gastrointestinal tract and induce synergistic effects in Stx-induced HUS. Louise et al. [147] suggested that Stx may enhance the pro-coagulant

72 Pathogenic Escherichia coli in Latin America

Guth et al.

effect of LPS. In vivo studies have demonstrated that toxicity of Stx is potentiated by LPS, and renal thrombotic microangiopathic lesions, mimicking those seen in human HUS, can be reproduced by infusion of Stx together with LPS [148, 149, 150]. Many substances, including prostaglandins, cytokines, vasoactive and procoagulant factors, are stimulated by LPS [151]. Stx-induced endothelial injury is the primary pathogenic event but LPS, chemokines and cytokines released by inflammatory cells [58] or injured cells [152] may contribute with this process. Stahl et al. [153] suggested that absorption of LPS in the early stages of STEC O157 infection may lead to direct activation of platelets or to binding to endothelium followed by binding to platelets, resulting in platelet consumption. The authors suggested that other factors, such as activation of platelets by Stx and/or other compounds [154 ], or endothelial cell injury, may also contribute to the thrombocytopenia and the thrombotic state observed in HUS. Since acute inflammatory infiltration of the gut and the presence of leukocytes in feces are seen in many STECinfected patients, several studies were conducted to analyze the role of PMN in the intestine. According with Wagner et al. [155], PMN recruitment in the intestine may also increase the risk of HUS by inducing the Stx2 prophage in vivo and augmenting Stx2 production, mainly through the production of H2O2. Either Stx directly or the combined effects of LPS and cytokines will activate the coagulation system, causing a prothrombotic state with platelet and PMN activation that will amplify endothelial injury. Patients show markers of endothelial injury, activation of the coagulation cascade and inhibition of fibrinolysis [156]. It has been suggested that the degree of the prothrombotic activation early in infection could be decisive in the course of the disease [157]. The activation of PMN is evidenced by a high peripheral blood PMN count at presentation, which has been correlated with a poor prognosis, and increased levels of serum elastase and IL-8. EPIDEMIOLOGY OF STEC IN LATIN AMERICA STEC O157:H7 has been responsible for numerous outbreaks and sporadic cases of infections in different parts of the world [14, 43, 158, 159, 160]. The relative ease of isolation of this serotype on the basis of its inability to ferment sorbitol may be contributing to an overestimation of its prevalence with respect to other STEC serotypes. At present, there is growing concern over the emergence of highly virulent non-O157 STEC serotypes that become globally distributed and associated with outbreaks and/or severe human illness [96]. These serotypes differ in their frequency of association with human disease and the severity of disease, suggesting differences in virulence characteristics [161] Important differences exist in the incidence of STEC infections and HUS in South America. A Regional Network for surveillance purposes is still inexistent and data are only restricted to few countries. The National Reference Laboratories participate in PulseNet Latin America and Caribbean, a regional network that performs pulsed-field gel electrophoresis (PFGE) on STEC strains. National Databases have been created in some countries. HUS is endemic in some countries of the Southern cone region and reporting is only mandatory in Argentina, Chile and Paraguay. If we compare the HUS situation, the annual incidence in Argentina is five times higher than in Chile, but the magnitude of the problem is still unknown in other countries. In Brazil, STEC infections are important public health issues at least in some regions. Infections due to non-O157 STEC have been reported since the early 70’s, mainly in cases of uncomplicated diarrhea in young children [28, 162]. In later years, O157 and non-O157 STEC strains have been recovered from severe human diseases such as bloody diarrhea, hemolytic anemia and HUS cases, and also from food and animals. The STEC prevalence among children with acute diarrhea varies depending on the studied region, but in general the incidence is relatively low [reviewed in Chapter: E. coli situation in Brazil]. From 1976 to 1999, STEC strains were isolated from patients with diarrhea in São Paulo City. Serogroups O26 and O111 accounted for most of the cases [28]. At present, different non-O157 serotypes, including important zoonotic serotypes, have been reported associated with diarrhea and HUS [29, 163, 164, 166, 165, 167]. Since the first description in the 1990’s, O157 STEC strains associated with bloody diarrhea and HUS have been identified in the southeastern region [28, 29, 168, 169]. In the last five years, STEC strains were isolated in São Paulo from 2.9% HIV adult patients and from 1.5% children with non-bloody diarrhea. Different serotypes and genotypes were identified among the isolates. The HIV patient with O157 infection was the only one with bloody diarrhea [168]. Although a nationwide surveillance system for HUS has been recently established, data are still inexistent or scarce. In a prospective study carried out in São Paulo City from 2001 to

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 73

2005, thirteen children with clinical and laboratory diagnosis of HUS were enrolled in the survey, and O26, O157 and O165 STEC strains were isolated from three patients [164, 167, 169]. In addition, high levels of O111 and O157 LPS antibodies were detected in sera of two and seven HUS patients, respectively. Both microbiologic and serologic techniques provided evidences of STEC infection in more than 90% of the patients, and association with O157 infections accounted for almost 62% of the HUS cases. Ten patients were followed up from 2 to 5 years, one patient developed chronic renal disease [170]. Isolation of STEC strains from healthy dairy and beef cattle, water buffaloes, calves and goats at farm level, and also from hides and carcasses at abattoir level has been described in different Brazilian regions [reviewed in Chapter: E. coli situation in Brazil]. Non-O157 STEC strains prevailed in the animal reservoir, mainly stx2 producers, although E. coli O157 has also been isolated in some of them. The STEC frequency in cattle was higher in southern estates. In Chile, a National Surveillance System was established in 1999 and all clinical laboratories must report and send isolates to the Reference Laboratory. In the last two years, 96 strains were characterized and O157:H7 was the predominant serotype with more than 60% of the isolates and the stx2 genotype prevailed. A National E. coli O157 Database has been created and three restriction patterns are prevalent [171, 172]. Regarding the animal reservoirs, STEC strains were detected in 13.5% of bovine feces at slaughter level. Non-O157 serotypes and stx2-genotype were predominant. In pigs, the isolation rate was 6.2%, a value significantly lower than those reported several years before of 69%. The Stx2e variant was prevalent [173]. In Uruguay, reports of HUS are not mandatory and only a few cases are recognized each year. In 2002, the first HUS case associated with STEC O157 infection was recognized [174]. Moreover, Varela et al. [175] performed the comparison of STEC strains isolated from human diseases and food using typing techniques. Grazing cattle and sheep were recognized as main reservoirs of STEC, and non-O157 STEC strains were recovered from 42% of the sampled animals. Stx2 was the predominant genotype detected [176]. In Paraguay, reporting of HUS has been mandatory since 2005. In the last two years, fifteen HUS cases were reported by the laboratory-based surveillance system. The annual incidence was 0.6 cases per 100,000 children under 5 years old. In Asunción City, three sentinel sites have been established. National Databases have been created for molecular surveillance purposes but only few O157 and non-O157 strains have been isolated from HUS and diarrhea cases. In Argentina, data on human STEC infections are gathered through different strategies: 1) the National Health Surveillance System collects data of HUS cases and since the year 2000, the report is mandatory, and must be immediate and individualized; 2) the Sentinel Surveillance System through 25 HUS Sentinel Units; 3) the Laboratory-based Surveillance System through the National Diarrheal and Foodborne Pathogens Network; and 4) the Molecular Surveillance through the PulseNet of Latin America and Caribbean. Post-diarrheal HUS is endemic. Over the last 10 years, approximately 500 HUS cases were reported annually. The incidence has ranged between 7.8 and 17 cases per 100,000 children less than 5 year of age and the lethality was between 2 and 5% [46, Ministry of Health, Argentina, 2008, unpublished data). This rate is 10-fold higher than in other industrialized countries. In some studies, evidence of STEC infection was found in around 60% of Argentinean HUS cases, and E. coli O157 was the predominant serogroup isolated [46, 89, 177, 178]. Each year, the National Reference Laboratory receives samples from approximately 60% of the HUS cases reported. As part of the PulseNet Latin America and Caribbean, Argentinean databases for O157 and non-O157 STEC strains were created by the National Reference Laboratory. In the period 1988-2009, a total of 710 XbaI-PFGE patterns corresponding to 1775 STEC O157 strains were included. Two XbaI-PFGE patterns are prevalent, AREXHX01.0011 (n=176) and AREXHX01.0022 (n=100), representing 9.9% and 5.6% of the database, respectively. Among the non-O157 STEC strains, 891 XbaI-PFGE patterns, corresponding to 1190 isolates were established. Up to date, the patterns are classified and codified according to the following O-groups: O8, O22, O26, O91, O103, O111, O113, O121, O130, O145, O174 and O178. Different studies have demonstrated the role of ruminants, mainly cattle, as STEC reservoir [179, 180, 181, 182, 183], and foods as vehicle of transmission [184, 185, 186, 187, 188, 189]. In conclusion, STEC strains are

74 Pathogenic Escherichia coli in Latin America

Guth et al.

widespread in South America, infect humans and animals, and contaminate food products, but the magnitude of the problem is different in each country. Different serotypes and genotypes were detected and the severity of clinical symptoms caused by STEC has been associated with the stx variants produced. In each country, a National Surveillance System and enhanced laboratory-based surveillance are needed to assess the real burden of diseases due to STEC. A regional network should be created to monitor the incidence of STEC in humans, animals, food and environment. STEC epidemiology is the interest in South America from a human health perspective and an economic perspective being these countries major exporters of primary products, particularly meat. TREATMENT AND CONTROL Currently, there is no specific treatment for STEC infections and HUS. For that reason these diseases can be considered within the category of “orphan diseases” and thus the main focus must be in prevention. Use of antibiotics in the initial period of diarrhea is not recommended. Some evidences have indicated that antimicrobials of different families could be a risk factor for developing HUS, by enhancing phage induction and subsequent stx gene expression, and by increasing Stx release after bacterial lysis induction [190]. Taking this into account, a rapid identification of patients infected by STEC using adequate diagnostic tools is very important to avoid the use of antimicrobials; diagnostic efforts must be concentrated in bloody diarrhea patients [190, 191]. At hospital level, ideally in intensive care units, it is recommended to observe patients with diagnosis of bloody diarrhea caused by STEC to measure variations in parameters as: weight, water and electrolytes balance and diuresis, hematocrit, appearance of signs of hemolysis like schistocytes and serum creatinine. Medical efforts must be oriented to correct anemia and renal damage. If HUS is suspected or confirmed it is important to have an adequate vein access for the eventually administration of parenteral solutions or transfusions. Ake et al. [41] recommended parenteral rehydration with isotonic crystalloids to protect the kidney and to diminish the need for dialysis. If the patient present edema, oligoanuria, cardiac overload or hypertension, a diuretic like furosemide it is initially recommended, but if no response occurred in few hours, peritoneal dialysis must be indicated. There is a consensus that the opportunity of dialysis is critical and influences the patient’s outcome (prognosis). Transfusions with blood red cells (filtered and irradiated) must be administrated when hemoglobin is under 7gr/l or with upper levels if there is cardio-respiratory compromise. Platelets transfusion should be avoided unless the level of platelets is less than 20.000 /mm3 with high bleeding risk. The diet recommended for these patients is hyper caloric and low in proteins, sodium and calcium [192]. Some new strategies to prevent systemic and renal damage in STEC infections have been investigated, and are focused on the neutralization of the Shiga toxin deleterious activity. The following strategies can be pointed out: a) Synthetic molecules analogues of Gb3 receptor, like Synsorb-Pk, have been evaluated in clinical trials. A multicenter controlled trial enrolled 150 children with HUS and Synsorb was administered orally, but no efficacy in diminishing mortality, need or duration of dialysis, or indication for transfusions was observed. Conclusions of this study indicated that this kind of strategy would be more efficient in the early period of STEC infection, but with no benefits when HUS is already present [193]; b) Other molecules with greater affinity for Gb3 than Synsorb have been developed, and evaluated in preclinical studies. In rats, these molecules showed to be protective against a lethal dose of STEC O157, nevertheless evaluation in humans is still pending. [194]; c) A group of investigators have explored genetic recombinant techniques in bacterial strains to create non-pathogenic E. coli expressing Gb3 sugars in the LPS. Studies in animal models have shown good results with these molecules for binding Stx1 and Stx2 and protecting rats from a lethal dose of O157 STEC [195]; d) Other interesting therapeutic strategy proposed to reduce binding and uptake of Stx was based on short-term inhibition of host Gb3 synthesis with C-9, a specific inhibitor of glucosylceramide synthase. In vitro studies have shown that pre-treatment of human renal tubular epithelial cells for 48 h with C9 produced a significant reduction in cellular Gb3 levels [196]. This molecule if administered in the early course of STEC infection could be useful to prevent Stx damages; e) A recent therapeutic strategy was based in the use of intravenous chimeric human monoclonal antibodies against Stx1 and Stx2. The ability of antibodies to specifically neutralize Stx was well established. In vitro studies and pharmacological evaluations in mice revealed that antibodies protected animals from lethal dose of Stxs [197]. Safety and pharmacological properties of these monoclonal antibodies were then evaluated in phase I studies in healthy volunteers, and the results suggested that they are safe and well tolerated [198]. Future clinical studies in infected children are necessary.

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 75

Prevention with Vaccines Considering that STEC infections are zoonotic, one strategy has been the development of vaccines to prevent or diminish shedding of the bacteria in the animal reservoir. Cattle are the main reservoir and vaccines based on antigens involved in intestinal colonization have been tested in this host with promising results. One vaccine using as antigens Type III secreted proteins was administered to cattle and a decrease in shedding from 23 to 9% was observed [94]. Another vaccine based on a combination of antigens involved in STEC adherence, such as EspA, intimin, and Tir significantly reduced shedding of EHEC O157 from experimentally infected cattle and the protection correlated with immune response [199]. A new technology based on iron requirement of pathogenic bacteria has also been explored. An anti-E.coli O157 vaccine based on siderophore receptor and porin proteins was evaluated in cattle naturally shedding the pathogen, and a significant reduction in prevalence and duration of shedding was observed [200]. Other vaccine candidates are based on attenuated strains with deletions on ler and stx genes, and immunized mice with this vaccine were protected against infection with wild-type O157:H7 STEC [201]. A DNA vaccine has been developed with a non-toxic Stx2 [202]. This vaccine was tested in mice and was able to elicit systemic Stx-specific antibody response for native Stx2 and conferred partial protection to Stx2 challenge in vivo. On the other hand, there is scarce experience related to vaccines against STEC for humans. One evaluated vaccine is based on the concept that IgG antibodies against the O-specific polysaccharide of E. coli O157:H7 may confer immunity by lysing the inoculum in the intestine. A phase 1 trial was conducted in adult volunteers with a parenteral vaccine containing O157 polysaccharide conjugated to a recombinant exotoxin A of Pseudomonas aeruginosa (O157-rPA) showing that the vaccine was safe and immunogenic [203]. Afterwards, the same vaccine was evaluated in a phase 2 trial in children, and safety was confirmed, no significant adverse reactions were seen and high specific antibodies response were observed [204]. Albeit promising, it is clear that this vaccine does not represent a solution in preventing human STEC infections as it has considered only O157 serogroup. Currently, new approaches including common antigens for STEC serogroups and serotypes are needed to protect humans. REFERENCES [1] [2] [3]

[4] [5] [6] [7] [8] [9] [10] [11] [12] [13]

Konowalchuk J, Speirs JI, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun. 1977;18:775–779. O’Brien AD, LaVeck GD, Thompson MR, et al. Production of Shigella dysenteriae type 1-like cytotoxin by Escherichia coli. J Infect Dis. 1982;146:763–769. Melton-Celsa A, O’Brien AD. Structure, biology, and relative toxicity of Shiga toxin family members for cells and animals. In: Kaper JB, O’Brien AD (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press. Washington, DC. 1998;pp121-128. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308:681–685. O’Brien AD, Lively TA, Chen ME, et al. Escherichia coli O157:H7 strains associated with haemorrhagic colitis in the United States produce a Shigella dysenteriae 1 (Shiga) like cytotoxin. Lancet. 1983;i:702. Johnson WM, Lior H, Bezanson. Cytotoxic Escherichia coli O157:H7 associated with haemorrhagic colitis in Canada. Lancet. 1983;i:76. Levine MM, Xu J, Kaper JB, et al. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J Infect Dis. 1987;156:175–182. Karmali MA, Petric M, Lim C, Fleming et al. The association between hemolytic uremic syndrome and infection by Verotoxin-producing Escherichia coli. J Infect Dis. 1985;151:775–782. Karmali MA, Steele BT, Petric M, et al. Sporadic cases of hemolytic uremic syndrome associated with fecal cytotoxin and cytotoxin producing Escherichia coli. Lancet. 1983;i:619–620. Paton AW, Woodrow MC, Doyle RM, et al. Molecular characterization of a Shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic-uremic syndrome. J Clin Microbiol. 1999;37:3357–3361. Abaas S, Franklin A, Kuhn I, et al. Cytotoxin activity on Vero cells among Escherichia coli strains associated with diarrhea in cats. Am J Vet Res. 1989;50:1294–1296. Hammermueller J, Kruth S, Prescott J, et al. Detection of toxin genes in Escherichia coli isolated from normal dogs and dogs with diarrhea. Can J Vet Res. 1995;59:265–270. Gyles CL. Escherichia coli cytotoxins and enterotoxins. Can J Microbiol. 1992;38:734–746.

76 Pathogenic Escherichia coli in Latin America

[14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26]

[27] [28] [29] [30] [31] [32] [33] [34]

[35] [36] [37] [38] [39] [40] [41] [42]

Guth et al.

Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev 1998; 11: 450-479. Gyles CL. Shiga toxin-producing Escherichia coli: An overview. J Anim Sci. 2007;85:E45-E62. Beutin L, Geier D, Steinruck H, et al. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol. 1993;31:2483–2488. Caprioli A, Morabito S, Brugère H, et al. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289–311. Bentancor A, Rumi MV, Gentilini MV, et al. Shiga toxin-producing and attaching effacing Escherichia coli in cats and dogs in a high hemolytic uremic syndrome incidence region in Argentina. FEMS Microbiol Lett. 2007;267:251-256. Oliveira MG, Brito JRF, Carvalho RR, et al. Water buffaloes (Bubalus bubalis) identified as an important reservoir of Shiga toxin-producing Escherichia coli in Brazil. Appl Environ Microbiol. 2007;73:5945–5948. Jay MT, Cooley M, Carychao D, et al. Escherichia coli O157:H7 in feral swine near spinach fields and cattle, central California coast. Emerg Infect Dis. 2007;13:1908-1911. Mead PS, Slutsker L, Dietz V, et al. Food-related illness and death in the United States. Emerg Infec Dis. 1999;5:607–625. O'Brien SJ, Adak GK, Gilham C. Contact with farming environment as a major risk factor for Shiga toxin (Verocytotoxin)-producing Escherichia coli O157 infection in humans. Emerg Infect Dis. 2001;7:1049-51. Erickson MC, Doyle MP. Food as vehicle for transmission of Shiga toxin-producing Escherichia coli. J Food Prot. 2007;70:2426-2449. Karch H, Tarr PI, Bielaszewska M. Enterohaemorrhagic Escherichia coli in human medicine. Int J Med Microbiol. 2005;295:405–418. Beutin L, Krause G, Zimmermann S, et al. Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J Clin Microbiol. 2004;42:1099–1108. Gerber A, Karch H, Allerberger F, et al. Clinical course and the role of Shiga toxin-producing Escherichia coli infection in the hemolytic-uremic syndrome in pediatric patients,1997–2000, in Germany and Austria: a prospective study. J Infect Dis. 2002;186:493–500. Elliott EJ, Robins-Browne RM, O’Loughlin EV, et al. Nationwide study of haemolytic uraemic syndrome: clinical, microbiological,and epidemiological features. Arch Dis Child. 2001;85:125–131. Vaz TMI, Irino K, Kato MAMF, et al. Virulence properties and characteristics of Shiga toxin-producing Escherichia coli in São Paulo, Brazil, from 1976 through 1999. J Clin Microbiol. 2004;42:902-905. Irino K, Vaz TMI, Medeiros MIC, et al. Serotype diversity as a drawback in the surveillance of Shiga toxin-producing Escherichia coli infections in Brazil. J Med Microbiol. 2007;56:565-567. Bettelheim KA. The non-O157 Shiga-toxigenic (Verocytotoxigenic) Escherichia coli; under-rated pathogens. Critic Rev Microbiol. 2007;33:67–87. Johnson KE, Thorpe CM, Sears CL. The emerging clinical importance of non-O157 Shiga toxin–producing Escherichia coli. Clin Infec Dis. 2006;43:1587–95. López EL, Prado V, O´Ryan M, et al. Shigella and Shiga toxin-producing Escherichia coli causing bloody diarrhea in Latin America. Inf Dis Clin of North Am. 2000;14:41-65. Prado V, Martínez J, Arellano C, et al. Variación temporal de genotipos y serogrupos de E. coli enterohemorrágicos aislados en niños chilenos con infecciones intestinales o síndrome hemolítico-urémico. Rev Med Chile. 1997;125:291-297. González G, Pianciola L, Di Russo V, et al. Screening of Shiga toxin-producing Escherichia coli by PCR in patients with diarrhea in Neuquén City, Argentina. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires: Argentina. 2009;May 10-13,p60. Gianantonio C, Vitacco M, Mendilaharzu F, et al. The hemolytic uremic syndrome. J Pediatr. 1964;64:478-91. Exeni R. Síndrome Urémico Hemolítico. Archivos Latinoamericanos de Nefrología Pediátrica. 2001;1:35-56. Boyce TG, Swerdlow DL, Griffin PM. Escherichia coli O157:H7 and the hemolytic uremic syndrome. N Engl J Med. 1995;333:364-8. Spizzirri FD, Rahman RC, Bibiloni N, et al. Childhood hemolytic uremic syndrome in Argentina: long term follow-up and prognostic features. Pediatr Nephrol. 1997;11:156-60. Tarr P, Gordon C, Chandler W. Shiga-toxin producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 2005;365:1073-86. Cavagnaro F, Gana J, Lagomarsino E, et al. Síndrome hemolítico urémico. Experiencia de un centro pediátrico. Rev Med Chil. 2005;133:781-87 Ake J, Jelacic S, Ciol M, et al. Relative nephroprotection during Escherichia coli O157:H7 infections: association with intravenous volume expansion. Pediatrics. 2005;115:673-680. Cordovéz A, Prado V, Maggi L, et al. Enterohemorrhagic Escherichia coli associated with hemolytic uremic syndrome in Chilean children. J Clin. Microbiol 1992;30:2153.

Shiga Toxin-Producing Escherichia Coli

[43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56]

[57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70]

[71]

[72]

Pathogenic Escherichia coli in Latin America 77

Michino H, Araki K, Minami S, et al. Massive outbreak of Escherichia coli O157:H7 infection in school chidren in Sakai city, Japan, associated with consumption of white radish sprouts. Am J Epidemiol. 1999;150:787-96. Prado V, Cavagnaro F, et al. Síndrome hemolítico urémico asociado a infección intestinal por Escherichia coli productora de shiga toxina (STEC) en pacientes chilenos: aspectos clínicos y epidemiológicos. Rev Chil Infect. 2008;75:435-444 Rowe P, Orrbine E, Wells G, et al. Epidemiology of hemolytic-uremic syndrome in Canadian children from 1986 to 1988. J Pediatrics. 1991;119:218-24. Rivas E, Miliwebsky E, Chinen I, et al. Epidemiología del síndrome hemolítico urémico en Argentina. Diagnóstico del agente etiológico, reservorios y vías de transmisión. Medicina. 2006;66:27-32. Siegler R, Pavia A, Christofferson R, et al. A 20-year population-based study of postdiarrheal hemolytic uremic syndrome in Utah. Pediatrics. 1994;94:35-40. Ostroff SM, Neill MA, Lewis JH, et al. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O 157:H7 infections. J Infect Dis. 1989;160:994. Large TM, Walk ST, Whittam TS. Variation in acid resistance among Shiga toxin-producing clones of pathogenic Escherichia coli. Appl. Environ Microbiol. 2005;71:2493-500. Spears KJ, Roe AJ, Gally DL. A comparison of enteropathogenic and enterohemorrhagic Escherichia coli pathogenesis. FEMS Microbiol Lett. 2006;255:187-202. McDaniel TK, Jarvis KG, Donnenberg MS, et al. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci USA. 1995;92:1664-8. Torres AG, Zhou X, Kaper JB. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun. 2005;73:18-29. Sandvig K, Spilsberg B, Lauvrak SU. Pathways followed by protein toxins into cells. Int J Med Microbiol. 2004;293:483-90. Sandvig K, van Deurs B. Membrane traffic exploited by protein toxins. Annu Rev Cell Dev Biol. 2002;18:1-24. Paton JC, Paton AW. Shiga toxin 'goes retro' in human primary kidney cells. Kidney Int. 2006;70:2049-51. Kiarash A, Boyd B, Lingwood CA. Glycosphingolipid receptor function is modified by fatty acid content. Verotoxin 1 and verotoxin 2c preferentially recognize different globotriaosylceramide fatty acid homologues. J Biol Chem. 1994;269:11138-46. Taneike I, Zhang HM, Wakisaka-Saito N, et al. Enterohemolysin operon of Shiga toxin-producing Escherichia coli: Avirulence function of inflammatory cytokine production from human monocytes. FEBS Lett. 2002;524:219-24. Thorpe CM, Hurley BP, Lincicome LL, et al. Shiga toxins stimulate secretion of interleukin-8 from intestinal epithelial cells. Infect Immun. 1999;67:5985-93. Yamasaki C, Natori Y, Zeng XT, et al. Induction of cytokines in a human colon epithelial cell line by Shiga toxin 1 (Stx1) and Stx2 but not by non-toxic mutant Stx1 which lacks N-glycosidase activity. FEBS Lett. 1999;442:231-4. Hurley BP, Thorpe CM, Acheson DW. Shiga toxin translocation across intestinal epithelial cells is enhanced by neutrophil transmigration. Infect Immun. 2001;69:6148-55. Ray PE, Liu XH. Pathogenesis of Shiga toxin-induced hemolytic uremic syndrome. Pediatr Nephrol. 2001;16:823-39. Gianantonio CA, Vitacco M, Mendilaharzu F, et al. The hemolytic-uremic syndrome. Nephron. 1973;11:174-92. Remuzzi G, Ruggenenti P. The hemolytic uremic syndrome. Kidney Int. 1995;48:2-19. Creydt VP, Silberstein C, Zotta E, et al. Cytotoxic effect of Shiga toxin-2 holotoxin and its B subunit on human renal tubular epithelial cells. Microbes Infect. 2006;8:410-9. Nestoridi E, Kushak RI, Duguerre D, et al. Upregulation of tissue factor activity on human proximal tubular epithelial cells in response to Shiga toxin. Kidney Int. 2005;67:2254-2266. O’Brien AD, Holmes RK. Shiga and Shiga-like toxins. Microbiol Rev. 1987;51:206–220. Zhang W, Bielaszewska M, Kuczius T, et al. Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx1c) in Escherichia coli strains isolated from humans. J Clin Microbiol. 2002;40:1441–1446. Friedrich AW, Borell J, Bielaszewska M, et al. Shiga toxin 1c-producing Escherichia coli strains: phenotypic and genetic characterization and association with human disease. J Clin Microbiol. 2003;41:2448–2453. Kuczius T, Bielaszewska M, Friedrich A, et al. A rapid method for the discrimination of genes encoding classical Shiga toxin (Stx) 1 and its variants, Stx1c and Stx1d, in Escherichia coli. Mol Nutr Food Res. 2004;48:515–521. Schmitt CK, McKee ML, O’Brien AD. Two copies of Shiga-like toxin II-related genes common in enterohemorrhagic Escherichia coli strains are responsible for the antigenic heterogeneity of the O157:H- strain E32511. Infect Immun. 1991;59:1065–1073. Melton-Celsa AR, Darnell SC, O’Brien AD. Activation of Shiga-like toxins by mouse and human intestinal mucus correlates with virulence of enterohemorrhagic Escherichia coli O91:H21 isolates in orally infected, streptomycin-treated mice. Infect Immun. 1996;64:1569–1576. Pierard D, Muyldermans G, Moriau L, et al. Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J Clin Microbiol. 1998;36:3317–3322.

78 Pathogenic Escherichia coli in Latin America

[73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85]

[86]

[87] [88]

[89]

[90] [91] [92] [93] [94] [95] [96] [97] [98]

Guth et al.

Weinstein DL, Jackson MP, Samuel JE, et al. Cloning and sequencing of a Shigalike toxin type II variant from Escherichia coli strain responsible for edema disease of swine. J Bacteriol. 1988;170:4223–4230. Schmidt H, Scheef J, Morabito S, et al. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol. 2000;66:1205–1208. Morabito S, Dell’Omo G, Agrimi U, et al. Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol. 2001;82:275–283. Leung PHM, Peiris JSM, Ng WWS, et al. A newly discovered verotoxin variant, VT2g, produced by bovine verocytotoxigenic Escherichia coli. Appl Environ Microbiol. 2003;69:7549–7553. Kokai-Kun JF, Melton-Celsa AR, O’Brien AD. Elastase in intestinal mucus enhances the cytotoxicity of Shiga toxin type 2d. J Biol Chem. 2000;275:3713–3721. Herold S, Karch H, Schmidt H. Shiga toxin encoding bacteriophages – genomes in motion. Int J Med Microbiol. 2004;294:115–121. Schering J, Andreoli SP, Zimmerhackl LB. Treatment and outcome of Shiga toxin-associated hemolytic uremic syndrome (HUS). Pediatr Nephrol. 2008;23:1749:1760. Friedrich AW, Bielaszewska M, Zhang W, et al. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis. 2002;185:74–84. Grys TE, Siegel MB, Lathem WW, et al. The StcE protease contributes to intimate adherence of enterohemorrhagic Escherichia coli O157:H7 to host cells. Infect Immun. 2005;73:1295-303. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat. Rev Microbiol. 2004;2:123-40. Frankel G, Phillips AD, Rosenshine I, et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements, Mol Microbiol. 1998;30:911–921. Hartland EL, Batchelor M, Delahay RM, et al. Binding of intimin from enteropathogenic Escherichia coli to Tir and to host cells. Mol Microbiol. 1999;32:151–158. Garrido P, Blanco M, Moreno-Paz M, et al. STEC-EPEC oligonucleotide microarray: A new tool for typing genetic variants of the LEE pathogenicity island of human and animal Shiga toxinproducing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) strains. J Clin Chem. 2006;52:192–201. Blanco M, Blanco JE, Mora A, et al. Serotypes,virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-xi). J Clin Microbiol. 2004;42:645–651. Krause G, Zimmermann S, Beutin L. Investigation of domestic animals and pets as a reservoir for intimin-(eae) gene positive Escherichia coli types. Vet Microbiol. 2005;106:87–95. Blanco M, Schumache S, Tasara T, et al. Serotypes, intimin variants and other virulence factors of eae positive Escherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-eta2). BMC Microbiol. 2005;5:23. Rivas M, Miliwebsky E, Chinen I, et al. Characterization and epidemiologic subtyping of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog Dis. 2006;3:88–96. Fitzhenry RJ, Pickard DJ, Hartland EL, et al. Intimin type influences the site of human intestinal mucosal colonisation by enterohaemorrhagic Escherichia coli O157:H7. Gut. 2002;50:180–185. Ethelberg S, Olsen KE, Scheutz F, et al. Virulence factors for hemolytic uremic syndrome, Denmark. Emerg Infect Dis. 2004;10:845-7. Dean-Nystrom EA, Gansheroff LJ, Mills M, et al. Vaccination of pregnant dams with intimin (O157) protects suckling piglets from Escherichia coli O157:H7 infection. Infect Immun. 2002;70:2414-8 Judge NA, Mason HS, O'Brien AD. Plant cell-based intimin vaccine given orally to mice primed with intimin reduces time of Escherichia coli O157:H7 shedding in feces. Infect Immun. 2004;72:168-75. Potter AA, Klashinsky S, Li Y, et al. Decreased shedding of Escherichia coli O157:H7 by cattle following vaccination with type III secreted proteins. Vaccine. 2004;22:362-9. Karmali MA. Host and pathogen determinants of verocytotoxin-producing Escherichia coli-associated hemolytic uremic syndrome. Kidney Int Suppl. 2009;112:S4-7. Coombes BK, Wickham ME, Mascarenhas M, et al. Molecular analysis as an aid to assess the public health risk of nonO157 Shiga toxin-producing Escherichia coli strains. Appl Environ Microbiol. 2008;74:2153-60. Stevens MP, Timothy TS. Adhesins of Enterohemorrhagic Escherichia coli In: Kaper JB (ed) Escherichia coli and Salmonella: Cellular and Molecular Biology. ASM Press, Washington DC, 2005; Module 8.3.2.3 Karch H, Heesemann J, Laufs R, et al. A plasmid of enterohemorrhagic Escherichia coli O157:H7 is required for expression of a new fimbrial antigen and for adhesion to epithelial cells. Infect Immun. 1987;55:455–61

Shiga Toxin-Producing Escherichia Coli

[99] [100] [101] [102] [103] [104]

[105] [106]

[107] [108] [109] [110] [111] [112] [113]

[114] [115] [116] [117] [118] [119] [120] [121] [122] [123]

[124]

Pathogenic Escherichia coli in Latin America 79

Fratamico PM, Bhaduri S, Buchanan RL. Studies on Escherichia coli serotype O157:H7 strains containing a 60-MDa plasmid and on 60-MDa plasmid-cured derivatives. J Med Microbiol. 1993;9:371-81. Junkins AD, Doyle MP. Comparison of adherence properties of Escherichia coli O157:H7 and a 60-megadalton plasmidcured derivative. Curr Microbiol. 1989;19:21-7. Toth I, Cohen ML, Rumschlag HS, et al. Influence of the 60-megadalton plasmid on adherence of Escherichia coli O157:H7 and genetic derivatives. Infect Immun. 1990;58:1223-31. Tzipori S, Karch H, Wachsmuth IK, et al. Role of a 60-megadalton plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect. Immun. 1987;55:3117-25. Sheng H, Lim JY, Knecht HJ, et al. Role of Escherichia coli O157:H7 virulence factors in colonization at the bovine terminal rectal mucosa. Infect Immun. 2006;74:4685–4693. Dziva F, Mahajan A, Cameron P, et al. EspP, a typeV-secreted serine protease of enterohaemorrhagic Escherichia coli O157:H7, influences intestinal colonization of calves and adherence to bovine primary intestinal epithelial cells. FEMS Microbiol Lett. 2007;271:258–264. Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol. 2000;35:275–288. Stevens MP, Roe AJ, Vlisidou I, et al. Mutation of toxB and a truncated version of the efa1 gene in Escherichia coli O157:H7 influences the expression and secretion of locus of enterocyte effacement-encoded proteins but not intestinal colonization in calves or sheep. Infect Immun. 2004;72:5402-5411. Hayashi T, Makino K, Ohnishi M, et al. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 2001;8:11–22. Perna NT, Plunkett G, Burland V, et al. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001;409:529–532. Tatsuno I, Kimura H, Okutani A, et al. Isolation and characterization of mini-Tn5Km2 insertion mutants of enterohemorrhagic Escherichia coli O157:H7 deficient in adherence to Caco-2 cells. Infect Immun. 2000;68:5943–5952. Tatsuno I, Horie M, Abe H, et al. toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660–6669. Tatarczak M, Wieczorek K, Posse B, et al. Identification of putative adhesin genes in Shiga toxigenic Escherichia coli isolated from different sources. Vet Microbiol. 2005;110:77–85. Toma C, Martínez Espinosa E, Song T, et al. Distribution of putative adhesins in different seropathotypes of Shiga toxinproducing Escherichia coli. J Clin Microbiol. 2004;42:4937-4946. Cergole-Novella MC, Nishimura LS, Santos LF, et al. Distribution of virulence profiles related to new toxin and putative adhesins in Shiga toxin-producing Escherichia coli isolated from diverse sources in Brazil. FEMS Microbiol Lett. 2007;274:329–334. Vidal M, Escobar P, Prado V, et al. Distribution of putative adhesins in Shiga toxin-producing Escherichia coli (STEC) strains isolated from different sources in Chile. Epidemiol Infect. 2007;135:688–694. Tarr PI, Bilge SS, Vary JC, et al. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect Immun. 2000;68:1400-1407. Szalo IM, Goffaux F, Pirson V, et al. Presence in bovine enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli of genes encoding for putative adhesins of human EHEC strains. Res Microbiol. 2002;153:653-658. Torres AG, Perna NT, Burland V, et al. Characterization of Cah, a calcium-binding and heat extractable autotransporter protein of enterohaemorrhagic Escherichia coli. Mol Microbiol. 2002;45:951–966. Torres AG, Giron JA, Perna NT, et al. Identification and characterization of lpfABCCDE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect Immun. 2002;70:5416–5427. Torres AG, Kanack KJ, Tutt CB, et al. Characterization of the second long polar (LP) fimbriae of Escherichia coli O157:H7 and distribution of LP fimbriae in other pathogenic E. coli strains. FEMS Microbiol Lett. 2004;238:333–344. Jordan DM, Cornick N, Torres AG, et al. Long polar fimbriae contribute to colonization by Escherichia coli O157:H7 in vivo. Infect Immun. 2004;72:6168–6171. Torres AG, Milflores-Flores L, Garcia-Gallegos JG, et al. Environmental regulation and colonization attributes of the long polar fimbriae of Escherichia coli O157:H7. Int J Med Microbiol. 2007;297:177–185. Dytoc MT, Ismaili A, Philpott DJ, et al. Distinct binding properties of eaeA-negative verocytotoxin-producing Escherichia coli of serotype O113:H21.Infect Immun. 1994;62:3494–3505. Paton AW, Srimanote P, Woodrow MC, et al. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69:6999-7009. Jenkins C, Perry NT, Cheasty T, et al. Distribution of the saa gene in strains of Shiga toxin-producing Escherichia coli of human and bovine origins. J Clin Microbiol. 2003;41:1775-1778.

80 Pathogenic Escherichia coli in Latin America

Guth et al.

[125] Galli L, Miliwebsky E, Irino K, et al. Virulence profile comparison between LEE-negative Shiga toxin-producing Escherichia coli (STEC) strains isolated from cattle and humans. Vet Microbiol. 2010; (in press) [126] Vidal M, Prado V, Whitlock GC, et al. Subtractive hybridization and identification of putative adhesins in a Shiga toxinproducing eae-negative Escherichia coli. Microbiol. 2008;154:3639-3648. [127] Toma C, Nakasone N, Miliwebsky E, et al. Differential adherence of Shiga toxin-producing Escherichia coli harboring saa to epithelial cells. Int J Med Microbiol. 2008; doi: 10-1016/j.ijmm 2007.13003. [128] Doughty S, Sloan J, Bennett-Wood V, et al. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect Immun 2002; 70: 67616769. [129] Osek J, Weiner M, Hartland EL. Prevalence of the lpfO113 gene cluster among Escherichia coli O157 isolates from different sources. Vet Microbiol. 2003;96:259-266. [130] Dos Santos LF, Irino K, Vaz TMI, et al. Set of virulence genes and genetic relatedness of O113:H21 Escherichia coli strains isolated from the animal reservoir and human infections in Brazil. J Med Microbiol. 2010;59: [131] Galli L, Torres AG, Rivas M. Identification of the Long Polar Fimbriae gene variants in Locus of Enterocyte Effacementnegative Shiga toxin-producing Escherichia coli strains isolated from humans and cattle in Argentina. FEMS Microbiol Lett. 2010b;(accepted) [132] Schmidt H, Maier E, Karch H, et al. Pore-forming properties of the plasmid-encoded hemolysin of enterohemorrhagic Escherichia coli O15:H7. Eur J Biochem. 1996;241:594-601. [133] Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995;63:1055–1061. [134] Beutin L, Montenegro MA, Orskov I, et al. Close association of Verotoxin (Shiga-Like Toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol. 1989;27:2559-2564. [135] Janka A, Bielaszewska M, Dobrindt U, et al. Cytolethal distending toxin gene cluster in enterohemorrhagic Escherichia coli O157:H- and O157:H7: characterization and evolutionary considerations. Infect Immun. 2003;71:3634–3638. [136] Bielaszewska M, Fell M, Greune L, et al. Characterization of cytolethal distending toxin genes and expression in Shiga toxin-producing Escherichia coli strains of non-O157 serogroups. Infect Immun. 2004;72:1812-6. [137] Bielaszewska M, Sinha B, Kuczius T, et al. Cytolethal distending toxin from Shiga toxin-producing Escherichia coli O157 causes irreversible G2/M arrest, inhibition of proliferation and death of human endothelial cells. Infect Immun. 2005;73:552–562. [138] Paton AW, Srimanote P, Talbot UM, et al. A new family of potent AB(5) cytotoxins produced by Shiga toxigenic Escherichia coli. J Exp Med. 2004;200:35-46. [139] Osek, J. Identification of the subtilase cytotoxin gene among Shiga toxigenic Escherichia coli isolated from different sources. Bull Vet Inst Pulawy. 2006;50:29–33. [140] Khaitan A, Jandhyala DM, Thorpe CM, et al. The operon encoding SubAB, a novel cytotoxin, is present in Shiga toxinproducing Escherichia coli isolates from the United States. J Clin Microbiol. 2007;45:1374–1375. [141] Wolfson JJ, Jandhyala DM, Gorczyca LA, et al. Prevalence of the operon encoding subtilase cytotoxin in non-O157 Shiga toxin-producing Escherichia coli isolated from humans in the United States. J Clin Microbiol. 2009;47:3058–3059. [142] Irino K, Vieira MA, Gomes TAT, et al. Subtilase cytotoxin-encoding subAB operon found exclusively among Shiga toxinproducing Escherichia coli strains. J Clin Microbiol. 2010;48:988-990. [143] Berin MC, Darfeuille-Michaud A, Egan LJ, et al. Role of EHEC O157:H7 virulence factors in the activation of intestinal epithelial cell NF-kappaB and MAP kinase pathways and the upregulated expression of interleukin 8. Cel. Microbiol. 2002;4:635-48. [144] Miyamoto Y, Iimura M, Kaper JB, et al. Role of Shiga toxin versus H7 flagellin in enterohaemorrhagic Escherichia coli signalling of human colon epithelium in vivo. Cell Microbiol. 2006;8:869-79. [145] Brunder W, Schmidt H, Karch H. EspP, a novel extracellular serine protease of enterohemorrhagic Escherichia coli O157:H7 cleaves human coagulation factor V. Mol. Microbiol. 1997;24:767–778. [146] Brockmeyer J, Bielaszewska M, Fruth A, et al. Subtypes of the plasmid-encoded serine protease EspP in Shiga toxinproducing Escherichia coli: distribution, secretion, and proteolytic activity. Appl Environ Microbiol. 2007;73:6351–6359. [147] Louise CB, Obrig TG. Shiga toxin-associated hemolytic uremic syndrome: combined cytotoxic effects of shiga toxin and lipopolysaccharide (endotoxin) on human vascular endothelial cells in vitro. Infect Immun. 1992;60:1536-43. [148] Keepers TR, Psotka MA, Gross LK, et al. A murine model of HUS: Shiga toxin with lipopolysaccharide mimics the renal damage and physiologic response of human disease. J Am Soc Nephrol. 2006;17:3404-14. [149] Palermo M, Alves-Rosa F, Rubel C, et al. Pretreatment of mice with lipopolysaccharide (LPS) or IL-1beta exerts dosedependent opposite effects on Shiga toxin-2 lethality. Clin Exp Immunol. 2000;119:77-83.

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 81

[150] Sauter KA, Melton-Celsa AR, Larkin K, et al. Mouse model of hemolytic-uremic syndrome caused by endotoxin-free Shiga toxin 2 (Stx2) and protection from lethal outcome by anti-Stx2 antibody. Infect Immun. 2008;76:4469-78. [151] Shultz PJ, Raij L. Endogenously synthesized nitric oxide prevents endotoxin induced glomerular thrombosis. J Clin Invest. 1992;90:1718-25. [152] Ray P, Acheson D, Chitrakar R, et al. Basic fibroblast growth factor among children with diarrhea-associated hemolytic uremic syndrome. J Am Soc Nephrol. 2002;13:699-707. [153] Stahl AL, Svensson M, Morgelin M, et al. Lipopolysaccharide from enterohemorrhagic Escherichia coli binds to platelets through TLR4 and CD62 and is detected on circulating latelets in patients with hemolytic uremic syndrome. Blood. 2006;108:167-76. [154] Karpman D, Papadopoulou D, Nilsson K, et al. Platelet activation by Shiga toxin and circulatory factors as a pathogenetic mechanism in the hemolytic uremic syndrome. Blood. 2001;97: 3100-8. [155] Wagner PL, Acheson DW, Waldor MK. Human neutrophils and their products induce Shiga toxin production by enterohemorrhagic Escherichia coli. Infect Immun. 2001;69:1934-7. [156] Bielaszewska M, Karch H. Consequences of enterohaemorrhagic Escherichia coli infection for the vascular endothelium. Thromb Haemost 2005; 94: 312-8. [157] Chandler WL, Jelacic S, Boster DR, et al. Prothrombotic coagulation abnormalities preceding the hemolytic-uremic syndrome. N Engl J Med. 2002;346:23-32. [158] Rangel JM, Sparling PH, Crowe C, et al. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg Infect Dis. 2004;11:603-9. [159] Sartz L, De Jong B, Hjertqvist M, et al. An outbreak of Escherichia coli O157:H7 infection in southern Sweden associated with consumption of fermented sausage; aspects of sausage production that increase the risk of contamination. Epidemiol Infect. 2008;136:370-80. [160] Greenland K, de Jager C, Heuvelink A, et al. Nationwide outbreak of STEC O157 infection in the Netherlands, December 2008-January 2009: continuous risk of consuming raw beef products. Euro Surveill. 2008;14:19129. [161] Karmali MA, Mascarenhas M, Shen S, et al. Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol. 2003;41:4930-40. [162] Giraldi R, Guth BEC, Trabulsi LR. Production of Shiga-like toxin among Escherichia.coli strains and other bacteria isolated from diarrhea in São Paulo, Brazil. J Clin Microbiol. 1990;28:1460-1462. [163] Cantarelli V, Nagayama K, Takahashi A, et al. Isolation of Shiga toxin-producing Escherichia coli (STEC) serotype O91:H21 from a child with diarrhea in Porto Alegre city, RS, Brazil. Braz J Microbiol. 2000;31:266-70. [164] Guth BEC, Souza RL, Vaz TMI, et al. First Shiga Toxin-producing Escherichia coli isolate from a patient with hemolytic uremic syndrome, Brazil. Emerg Infect Dis. 2002;8:535-536. [165] Guth BEC, Vaz TMI, Gomes TAT, et al. Re-emergence of O103:H2 Shiga toxin-producing Escherichia coli infections in São Paulo, Brazil. J Med Microbiol. 2005;54:805-806. [166] De Toni F, Souza EM, Pedrosa FO, et al. A prospective study on Shiga toxin-producing Escherichia coli in children with diarrhoea in Paraná State, Brazil. Lett Appl Microbiol. 2009;48:645-647. [167] Souza RL, Nishimura LS, Guth BEC. Uncommon Shiga toxin-producing Escherichia coli serotype O165:HNM as cause of hemolytic uremic syndrome in São Paulo, Brazil. Diag Microbiol Infect Dis. 2007;59:223-225. [168] Irino K, Vaz TMI, Kato MAMF, et al. O157:H7 Shiga toxin-producing Escherichia coli strains associated with sporadic cases of diarrhea in São Paulo, Brazil. Emerg Infect Dis. 2002;8:446-447. [169] Bastos FC, Vaz TMI, Irino K, et al. Phenotypic characteristics, virulence profile and genetic relatedness of O157 Shiga toxin-producing Escherichia coli isolated in Brazil and other Latin American countries. FEMS Microbiol Lett. 2006;265:89-97. [170] Guth BEC, Souza RL, Andrade MC, et al. Hemolytic Uremic Syndrome in pediatrics care units in São Paulo, Brazil, from 2001 to 2005. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires: Argentina. 2009;May 10-13,p54-55. [171] Olivares B, Araya P, Ibáñez D, et al. Genetic characterization of Chilean isolates of O157:H7 Shiga toxin producer Escherichia coli. 2003-2008. Public Health Institute of Chile. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires: Argentina. 2009;May 10-13,p61. [172] Olivares B, Araya P, Prat S, et al. Laboratory surveillance system for STEC, Public Health Institute, ISP-Chile, 2007September 2008. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires: Argentina. 2009;May 10-13,p61. [173] Vidal RM, Valenzuela P, Corvalán L, et al. Serotype and virulence genes identification in Shiga toxin - producing Escherichia coli (STEC) isolated from pig and bovine at slaughter in Chile. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires: Argentina. 2009;May 10-13,p76.

82 Pathogenic Escherichia coli in Latin America

Guth et al.

[174] Gadea MDP, Varela G, Bernadá M, et al. Primer aislamiento en Uruguay de Escherichia coli productora de toxina Shiga del serotipo O157:H7 en una niña con síndrome urémico hemolítico. Rev Med Uruguay. 2004;20:79-81. [175] Varela G, Chinen I, Gadea P, et al. Detección y caracterización de Escherichia coli productor de toxina Shiga a partir de casos clínicos y de alimentos en Uruguay. Rev Arg Microbiol. 2008;40:93-100. [176] Gadea MDP, Balseiro V, González S, et al. Phenotypic and genotypic characterization of Shiga toxin - producing Escherichia coli strains isolated from animal in Uruguay. 7th International Symposium on Shiga Toxin (Verocytotoxin) Producing Escherichia coli Infections. Buenos Aires: Argentina 2009; May 10-13,p.79. [177] Rivas M, Balbi L, Miliwebsky E, et al. Síndrome Urémico Hemolítico en niños de Mendoza, Argentina: su asociación con la infección por Escherichia coli productor de toxina Shiga. Medicina (Buenos Aires). 58:1-7,1998 [178] Miliwebsky E, Balbi L, Gómez D, et al. Síndrome Urémico Hemolítico en niños de Argentina. Asociación con la infección por Escherichia coli productor de toxina Shiga. Bioquímica y Patología Clínica. 63:113-121,1999. [179] Gioffre A, Meichtri L, Miliwebsky E, et al. Detection of Shiga toxin-producing Escherichia coli in cattle in Argentina. Evaluation of two procedures. Vet Microbiol. 2002;87:301-3. [180] Meichtri L, Miliwebsky E, Gioffré A, et al. Shiga toxin-producing Escherichia coli in healthy young beef steers from Argentina: prevalence and virulence properties. I J Food Microbiol. 2004;96:189-198. [181] Leotta GA, Deza N, Origlia J, et al. Detection and characterization of Shiga toxin-producing Escherichia coli in captive wild mammals. Vet Microbiol. 2006;118:151-7. [182] Masana MO, Leotta GA, Del Castillo LL, et al. Prevalence, characterization, and genotypic analysis of Escherichia coli O157:H7/NM from selected beef exporting abattoirs of Argentina. J Food Protect. 2010;73:649-56. [183] Tanaro JD, Leotta GA, Lound LH, et al. Escherichia coli O157 in bovine feces and surface water streams in a beef cattle farm of Argentina.. Foodborne Path Dis. 2010;7:475-7. [184] Chinen I, Tanaro JD, Miliwebsky E, et al. Isolation and characterization of Escherichia coli O157:H7 from retails meats in Argentina. J Food Protect. 2001;64:1346-51. [185] Gómez D, Miliwebsky E, Fernández Pascua C, et al. Aislamiento y caracterización de Escherichia coli productor de toxina Shiga en hamburguesas supercongeladas y quesos de pasta blanda. Rev Arg Microbiol. 2002;34:66-71. [186] Rivas M, Caletti MG, Chinen I, et al. Home-prepared hamburger as the source for a sporadic case of hemolytic uremic syndrome, Argentina. Emerg Infect Dis. 2003;9:1184-6. [187] Oteiza JM, Chinen I, Miliwebsky E, et al. Isolation and characterization of Shiga toxin-producing Escherichia coli from precooked sausages (Morcillas). Food Microbiol. 2006;23:283-8. [188] Chinen I, Epsztein S, Melamed CL, et al. Shiga toxin-producing Escherichia coli O157 in beef and chicken burgers, and chicken carcasses in Buenos Aires, Argentina. I J Food Microbiol. 2009;132:167-71. [189] Almada G, Estrella P, Ottavianoni L, et al. Relación clonal de Escherichia coli O157:H7 aislada en un caso de SUH, un portador asintomático y muestras de alimentos. La Pampa, Argentina, 2008. Ind Cárn Latinoam. 2009;158:8-11. [190] Wong CS, Jelacic S, Habeeb RL, et al. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N Engl J Med. 2000;342:1930-6. [191] Saldar N, Adnan S, Gangnon RE, et al. Risk of hemolytic uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 enteritis. JAMA. 2002;288:996-1001. [192] Oakes R, Siegler R, McReynolds M, et al. Predictors of fatality in postdiarrheal hemolytic uremic syndrome. Pediatrics. 2006;117:1656-62. [193] Trachtman H, Cnaan A, Christen E, et al. Effect of an oral Shiga toxin-binding agent on diarrhea-associated haemolytic uraemic syndrome in children. JAMA. 2003;290:1337-44. [194] Watanabe M, Matsuoka K, Kita E, et al. Oral therapeutic agents with highly clustered globotriose for treatment of Shiga toxigenic Escherichia coli infections. J Infect Dis. 2004;189:360-8. [195] Pinyon RA, Paton JC, Paton AW, et al. Refinement of a therapeutic Shiga toxin-binding probiotic for human trials. J Infect Dis. 2004;189:1547-55. [196] Silberstein C, Copeland DP, Chiang W-L, et al. A glucosylceramide synthase inhibitor prevents the cytotoxic effects of Shiga toxin-2 on human renal tubular epithelial cells. J Epith Biol Pharmacol. 2008;1:71-75. [197] Mukherjee J, Chios K, Fishwild D, et al. Human Stx2-specfic monoclonal antibodies prevent systemic complications of Escherichia coli O157:H7 infection. Infect Immun. 2002;70:612-9. [198] Dowling TC, Chavaillaz PA, Young DG, et al. Phase I safety and pharmacological study of chimeric murine-human monoclonal antibody alpha Stx2 administered intravenously to healthy adult volunteers. Ant Agents and Chem. 2005;49:1808–1812. [199] McNelly TN, Mitchell MC, Roser T, et al. Immunization of cattle with a combination of purified intimin-531, EspA and Tir significantly reduces shedding of Escherichia coli O157:H7 following oral challenge.Vaccine. 2010;3:1422-1428.

Shiga Toxin-Producing Escherichia Coli

Pathogenic Escherichia coli in Latin America 83

[200] Fox JT, Thomson DU, Drouillard JS, et al. Efficacy of Escherichia coli O157:H7 siderophore receptor/porin proteinsbased vaccine in feedlot cattle naturally shedding E. coli O157. Foodborne Pathog Dis. 2009;6:893-899. [201] Liu J, Sun Y, Zhu L, et al. Towards an attenuated enterohemorhagic Escherichia coli O157:H7 vaccine characterized by a deleted ler gene and containing apathogenic Shiga toxins. Vaccine. 2009;27:5929-5935. [202] Bentancor LV, Bilen M, Brando RJ, et al. A DNA vaccine encoding the enterohemorrhagic Escherichia coli Shiga-like toxin 2 A2 and B subunits confers protective immunity to Shiga toxin challenge in the murine model. Clin Vaccine Immunol. 2009;16:712-718. [203] Konadu EY, Parke JC, Jr, Trant TH, et al. Investigational vaccine for Escherichia coli O157: phase 1 study of O157 Ospecific polysaccharide-Pseudomonas aerugionsa recombinant exoprotein A conjugates in adults. J Infect Dis.1998;177:383-387. [204] Ahmed A, Li J, Shiloach Y, et al. Safety and immunogenicity of Escherichia coli O157 O-specific polysaccharide conjugate vaccine in 2-5 year-old children. J Infect Dis. 2006;193:512-21.

84

Pathogenic Escherichia coli in Latin America, 2010, 84-94

CHAPTER 6 Enterotoxigenic Escherichia coli Jose Flores and Pablo C. Okhuysen* Division of Infectious Diseases, The University of Texas Health Science Center, 6431 Fannin Street, MSB 2.112, Houston, Texas, USA, 77030.. Abstract: Enterotoxigenic Escherichia coli (ETEC) have been identified as a major bacterial pathogen responsible for infantile diarrhea in developing nations. ETEC are also the most common bacterial pathogen responsible of acute infectious diarrhea in adults traveling from industrialized nations to less developed countries. After ingestion, ETEC first attaches to epithelial cells lining the small intestine mucosa through an interaction mediated by adhesins known as colonization factor antigens (CFA), ETEC then produce either one or both of the well identified heat-labile (LT) and heat-stable (ST) enterotoxins. The LT of ETEC is structurally and immunologically related to the pentameric V. cholerae enterotoxin while ST is a small, non immunogenic peptide. Polymorphisms in host blood group antigens and the IL-10 gene promoter have been associated with diarrheal disease due to ETEC. The diagnosis of ETEC depends on the identification of the LT and ST toxin by molecular probes or immune based assays. Clinically, diarrhea due to ETEC cannot be differentiated from diarrhea due to other enteropathogens. The correction and maintenance of hydration is essential to prevent dehydration due to ETEC. . Several antimicrobials have demonstrated efficacy to treat ETEC associated travelers’ diarrhea, including Rifaximin, various fluoroquinolones and Azithromycin. Strategies for ETEC vaccines have focused on targeting CFAs of ETEC (CFA/I, CFA/II, and CFA/IV), the immunogenic LT or the use of whole cell killed organisms expressing CFAs.

INTRODUCTION Escherichia coli, initially named Bacterium coli, was initially incriminated as the cause of infantile diarrhea outbreaks during the 1940's and 1950's and was first referred to as enteropathogenic E. coli [1-5]. Further studies done on ligated rabbit ileal loops demonstrated that these E. coli strains elicited the accumulation of fluid in a manner that was similar to what was observed with Vibrio cholerae animal models [6, 7]. Enterotoxigenic E. coli (ETEC) are now defined by their ability to produce at least one of two well characterized enterotoxins known as LT (heat labile) and ST (heat stable) toxins. ETEC were first implicated in adult diarrhea in 1971 [8]. Subsequent human challenge studies determined that a dose of 1x108 to 1x1010 colony forming units was necessary to cause diarrhea [9]. ETEC ASSOCIATED PEDIATRIC DIARRHEA In developing countries, ETEC are the most common bacterial pathogen identified in children with acute diarrhea less than 5 years of age. It is estimated that annually, ETEC are responsible for 200 million cases of diarrhea worldwide resulting in approximately 150,000 deaths [10]. ETEC can cause repeated infections in children, particularly those under the age of 24 months. A study in the Nile Delta in Egypt showed that children experience 48 bouts of diarrhea annually, with more than half of the recurring attacks of diarrhea being due to ETEC [11]. Older children and adults are less susceptible but can also experience dehydrating diarrhea due to ETEC. Worldwide, it is estimated that 66% of all ETEC identified produce LT either alone or in combination with ST (LT/ST) and therefore, LT producing strains are responsible for most of the ETEC related disease burden. PEDIATRIC ETEC INFECTIONS IN MEXICO AND LATIN AMERICA In the 1970’s, ETEC LT was identified in 23% of Mexican children presenting with acute diarrhea [12]. A community based prospective study done a decade later, in 1986-87, in children living in Guadalajara, Mexico, investigated the relationship between infant feeding patterns and ETEC LT diarrheal disease. In this study, a cohort *Address correspondence to: Dr Pablo C. Okhuysen, Division of Infectious Diseases, The University of Texas Health Science Center, 6431 Fannin Street, MSB 2.112, Houston, Texas, USA, 77030; Phone: +1-713-500-6736, email: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Enterotoxigenic Escherichia Coli

Pathogenic Escherichia coli in Latin America 85

of 98 Mexican women-infant pairs was followed for up to 50 weeks. Strictly formula-fed children had an incidence of diarrhea over three times that of strictly breast-fed infants and twice that of breast-fed and supplementally fed children. This hazard was inversely impacted by the overall amount of LT-ETEC-specific, immunoglobulin A antibodies the infant received via the mother's breast milk [13]. A more recent study published in 2006 done in central Mexico to assess the impact of vitamin A on infant diarrhea, showed that during a 15 month period of observation 41 of 92 (42%) participants in the placebo arm experienced ETEC infection with 23% of these infections being associated with diarrhea [14]. This suggests that in peri-urban areas, ETEC associated diarrhea remains a significant problem in central Mexico. In contrast, a prospective study conducted in the peri-urban areas of Lima, Peru showed that although diarrheagenic E. coli were the most common enteropathogen identified, only 3% of diarrheal episodes were due to ETEC with a majority of the cases being due to enteroaggregative, enteropathogenic and diffusely adherent E. coli [15]. ETEC AS A CAUSE OF TRAVELERS’ DIARRHEA ETEC also affects adults from developed nations traveling to developing countries and this E. coli pathotype remains the leading bacterial cause of travelers’ diarrhea in Mexico [16]. ETEC is more commonly identified among travelers to Latin America and the Caribbean compared to travelers visiting Africa or Asia; ETEC is identified in about 30.4% of travelers’ diarrhea cases overall, with rates in Latin America/Caribbean of 33.6%, Africa 31.2%, south Asia 30.6%, and Southeast Asia of only 7.2% [17]. ETEC is also the leading cause of bacterial diarrhea among military personnel conducting operations in developing nations [18]. After short stays in Mexico, US visitors develop ETEC diarrhea and seroconversion to LT [19]. With extended stays, the colonization and ETEC associated diarrhea rates decrease in travelers and the frequency in visitors resemble the rates of ETEC associated colonization and infection seen in inhabitants of endemic areas. However, immunity in visitors to developing countries is short lived in the absence of repeated exposure. ETEC VIRULENCE FACTORS ETEC Colonization Factor Antigens To cause diarrheal disease, ETEC must first attach to epithelial cells lining the small intestine mucosa through an interaction mediated by proteinaceous surface adhesins, also known as Colonization Factor Antigens (CFA), which can be non-fimbrial, fimbrial, helical or fibrillar. More than 25 distinct colonization factors (CF) have been identified; many of them are fimbriae or pili (Table 1). The types of CF are subdivided by type, antigenicity, molecular weight, N-terminal amino acid sequence of the major subunit, and also according to structural morphology. Human ETEC CFs are designated as coli surface antigens (CS) followed by a number that corresponds to the chronological order of identification, with the exception of CFA/I (Table1). ETEC can also infect animals and are distinguished by CFs that are distinct from those seen in human derived isolates. CFs in animal derived ETEC are referred to as K, F, or P. The most common animal ETEC LT CFs are F4, F5 and F6, also referred to as K88, K99 and 987P fimbriae. Table 1: Nomenclature of some human ETEC colonization factors. CF designation CFA/I CFA/II CFA/II CFA/II CFA/IV CFA/IV CFA/IV CS7 CFA/III 2230 PCF0148

CS number PCF0159 PCF09 PCF0166 8786 CS17 PCF020 CS19 CS20 Longus CS22

CFA/I CS1 CS2 CS3 CS4 CS5 CS6 CS7 CS8 CS10 CS11

CS12 CS13 CS14 CS15 CS17 CS18 CS19 CS20 CS21 CS22

86 Pathogenic Escherichia coli in Latin America

Flores and Okhuysen

The predominant CFAs expressed by ETEC strains affecting humans include CFA/I, and the CFA families CFA/II and CFA/IV family [20]. However, the distribution of particular CFs among ETEC strains varies geographically and changes over time. As an example, while CFA/I is the most commonly identified CF phenotype in Chile [21], CFA/II and CFA/IV are the most commonly identified CF phenotypes in Egypt [22]. Importantly, it is estimated that 50% of all ETEC strains have no identifiable CF. CFA/I represent the prototype of class 5 fimbriae, the largest class of human-specific ETEC CFs. The CFA/I fimbriae is a polymer typically consisting of more than 1,000 copies of the major pilin subunit CfaB, and 1 or a few copies of the tip-residing adhesive minor subunit CfaE. The CfaB structure has a 7-stranded β-sandwich fold and displays an Ig-like fold adopted by all known class 1 pilins, Caf1 subunits, and the Dr adhesins [23]. CfaB binds to host cell membrane glycosphingolipids, including the Lewis blood group antigens. This is of interest since it was recently shown that individuals with the Le(a+b–) blood type are significantly at higher risk of acquiring diarrhea caused by CFA/I group ETEC than Le(a–b+) individuals [24]. The CFA/II strains express CS antigen 3, either alone or in conjunction with CS1 or CS2. CFA/IV strains express CS6, either alone or in conjunction with CS4 or CS5. The CFA/IV CS6 has a non-fimbrial short oligomeric assembly, has two non-covalent associated subunits (CssA and CssB) and is recognized for its ability to bind different extracellular matrix proteins, including fibronectin [25]. The majority of the CFs except for longus (also known as CS21) and CFA/III are synthesized and transported via a chaperone-usher-dependent pathway. In general, CFs are encoded in a four-gene operon consisting of a periplasmic chaperone, a major fimbrial subunit, an outer membrane usher protein and a minor subunit. The minor subunit is located at the tip of the fimbriae, with the N-terminal half of the protein responsible for binding to the host cell receptor [26]. Longus and CFA/III are both synthesized as Type IV pili in a process analogous to the Type II secretion pathway [27]. Both CFs and flagella anchor ETEC for initial long-range attachment to host cells, however for some strains including the prototypic strain H10407 a closer and more intimate attachment is facilitated by the outer-membrane proteins Tia and TiaA [20]. ETEC Heat Labile Toxin (LT) The heat labile (LT) enterotoxin of ETEC not only induces secretory diarrhea and neutralizing antibodies but is also an important immune adjuvant. LT is closely related to cholera toxin and shares 82% amino acid homology. The toxin is a pentameric holotoxin composed of 5 B subunits that mediate attachment to the intestinal epithelial cell and an A unit that is responsible for activating cellular adenyl cyclase by virtue of its ADP ribosylating activity. The 86 kDa LT binds preferentially to the gangliosides GM1 and GD1b present on the surface of the intestinal epithelium. In addition to the GM1 Ganglioside, the LTB subunits can also bind to polylactosaminoglycan-containing receptors [28], brush borders galactoproteins [29] and two other glycoproteins present in the human intestine [30]. The LT toxin can be further classified into 2 major families known as LT I and LTII (Fig. 1). The LT I and LT II toxins differ in host affinity and also in genetic sequences. ETEC LT containing LTI are more common in humans and can be sub classified into LTh (derived from humans) and LTp (derived from pigs). It has recently been recognized that LT I strains are genetically diverse with over 16 distinct types reported to date [31]. A retrospective study done in a collection of 54 ETEC strains in Brazil demonstrated that toxin types from asymptomatic individuals were more diverse genetically than those associated with diarrheal disease. The prototypic ETEC strain H10407 (Bangladesh) produces LT1. Recently an LT2 producing strain has been identified. At the molecular level, LT2 has 5 polymorphic sites. Although LT1 and LT2 are similar functionally in vitro, they differ in their adjuvant activity resulting in the generation of higher neutralizing titers in animal models [32]. LT is encoded on a 60 kb virulence plasmid termed Ent, which contains three distinct major regions: (i) a pathogenicity island containing enterotoxin genes, (ii) a region involved in plasmid replication and maintenance, and (iii) a region including tra genes that cause the self-transmissibility [33]. The eltA and eltB genes encoding the A and B subunits form a single transcriptional unit. A histone-like nucleoid structuring (H-NS) repressor protein appears to

Enterotoxigenic Escherichia Coli

Pathogenic Escherichia coli in Latin America 87

be the main gene expression modulator. The plasmid encoded eltAB operon is silenced by H-NS, which blocks the binding of RNA polymerase to the gene promoter [34]. LT secretion by ETEC is dependent on the chromosomally located gene leoA. It has recently been shown that up to 95% of the LT secretion is vesicle-bound [35].

Figure 1: Structure of the heat-labile toxin. (Protein Data Bank entry 1LTS)

Subsequently to the LTB binding to the target cell, LT is endocytosed by the cell either through caveolin-coated vesicles, clathrin-coated vesicles, or the Arf6 endocytic pathway [36, 37]. After endocytosis, LT travels to the endoplasmic reticulum (ER) via a retrograde transport pathway where as is the case with V. cholera CT; LTA undergoes post-translational processing to generate A1 and A2 peptides. The LTA1 is then translocated to the cytosol by the ER-associated degradation pathway, or degradasome [38]. LTA1 catalyzes the ADP ribosylation of the GTPbinding regulatory component of adenylate cyclase in the presence of NAD, resulting in elevation of intracellular cyclic AMP levels [39]. Gene sequences encoding LT have been rarely identified in other Enterobacteriaceae such as Citrobacter and Enterobacter. However, the clinical relevance of these non-E. coli isolates containing LT is unknown. As mentioned above, in addition to being an enterotoxin, LT is a potent mucosal immune adjuvant. After internalization of the toxin A unit, the B subunit has been shown to bind to Toll-like receptors (TLR) 1 and 2 [40] in dendritic cells and this may in part explain the immune-modulatory and adjuvant properties of LT. Heat Stable Toxin (ST) The second major toxin, ST, is only 18 amino acids long and binds to guanylate cyclase (GC-C), a member of receptor cyclases that includes the atrial natruretic peptide. ST increases intracellular levels of cGMP. As the case with LT, there are several ST toxin types (Figs. 2 and 3). ST are classified into 2 major types by virtue of distinct phenotypes: The STa (ST I; estA encoded) is identified mostly in human stools while Stb (ST II) is identified mostly in animal stools. In addition, there are two distinct forms of STa, namely STh (or ST Ib) and Stp (or ST Ia). There are several allelic forms of the estA gene [41]. Various other enteric bacteria have been shown to elaborate identical or highly homologous ST's. Some of these bacteria include Yersinia enterocolitica, Citrobacter freundii, and Klebsiella pneumoniae [42]. However, the clinical significance of ST in other Enterobacteriaceae remains unknown.

Figure 2: Structure of heat-stable enterotoxin B. (Protein Data Bank entry 1ETL)

88 Pathogenic Escherichia coli in Latin America

Flores and Okhuysen

Figure 3: Structure of heat-stable enterotoxin B. (Protein Data Bank entry 1 EHS)

STs are synthesized as precursor proteins and are then converted to the active forms with intramolecular disulfide bonds after being released into the bacterial periplasm. The active STs are finally translocated across the outer membrane through a tunnel made by TolC [43]. Once released into the small intestine lumen, ST binds reversibly to the extracellular domain of GC-C on the villous and crypt epithelial cells. This interaction activates the intracellular catalytic domain of GC-C leading to intracellular accumulation of cGMP [44-46]. The activation of the cGMPdependent protein kinase II leads to phosphorylation of the cystic fibrosis transmembrane regulator (CFTR), driving Cl- secretion and inhibition of NaCl absorption [47]. It has been proposed that humans with cystic fibrosis do not respond to ST as well as carriers of wild type CFTR [48]. Activation of GC-C is regulated by the intestinal and kidney-enriched PDZ protein (IKEPP), which inhibits ST activation of GC-C [49]. Although GC-C is the primary receptor mediating STa-stimulated intestinal secretion, there are alternate receptors not associated with GC-C activity [50, 51], some of them can stimulate duodenal HCO3- secretion independent from the CFTR pathway [52]. The Serine Protease Autotransporter EatA In addition to the enterotoxins LT and ST, several other putative toxins have been described, including EatA, which is a serine protease autotransporter of ETEC. EatA is homologous to the wider group of Enterobacteriaceae serine protease autotransporters, which act as extracellular proteases. EatA possesses specificity for p-nitroanilideconjugated oligopeptides; these cleaved oligopeptides are substrates for cathepsin G, which in turn modulates or cleaves a diverse array of other extracellular products, including proteoglycans and cell surface protease-activated receptors, damaging the epithelial cell surface [53]. HOST GENETIC FACTORS PREDISPOSING ETEC INFECTION Several factors in the host impact the occurrence, duration, severity and resolution of ETEC associated diarrhea in a particular individual. An association between the anti-inflammatory IL-10, also known as human cytokine synthesis inhibitory factor, and susceptibility to ETEC LT associated diarrhea has been identified. Children living in ETEC endemic Latin America countries, such as Mexico, with intermediate and high levels of IL-10 cytokines in their stool, clear symptomatic and asymptomatic ETEC infections less efficiently compared to other children with low or no detectable levels of IL-10 in their stools [54]. Adult travelers harboring high production associated IL-10 single nucleotide polymorphisms (SNP) have a increased risk for developing diarrhea when naturally exposed to ETEC compared to individuals with normal or low IL-10 associated SNPs [55]. There is evidence that several enteropathogens use human blood group antigens as their receptors. Children with the Le (a+b-) blood group have increased susceptibility to diarrhea caused by ETEC (24). The H antigen (O group) lacks the terminal sugar residue, the toxin is unable to use it as a receptor [56]. It is also plausible that individuals with blood group O are less likely to become infected by ETEC, as individuals possessing the blood group O are 50% less likely to become infected with V. cholerae than non-blood group O individuals [57].

Enterotoxigenic Escherichia Coli

Pathogenic Escherichia coli in Latin America 89

DIAGNOSIS ETEC were initially identified by their ability to cause fluid accumulation in ligated animal ileal loops. With the characterization of the LT and ST genes, molecular probes specific for these toxins were developed. Most laboratories use colony hybridization or polymerase chain reaction assays with probes based on the LT and ST sequences applied to E. coli isolated from stool cultures. GM1 binding ELISA can measure the production of LT. Until recently, ETEC testing could only be done in a few research laboratories; commercial laboratories have now begun offering ETEC specific diagnostic testing. Probe hybridization on stool culture plates or the use of PCR done directly with DNA purified from feces increases the sensitivity for the detection of ETEC [58]. However, the specificity of these methods of testing remains unclear since PCR or whole plate probe hybridization can detect a low number of colonies. Inexpensive, field ready diagnostic tests are needed for an accurate assessment of ETEC epidemiology in the Americas. TREATMENT Pediatric ETEC Infection ETEC associated diarrhea cannot be differentiated from diarrhea due to other pathogens based on clinical features. The treatment of diarrheal disease due to ETEC is the same as that for other acute secretory diarrheal diseases, including cholera. The correction and maintenance of hydration is always most important intervention. When unable to tolerate oral rehydration, rapid rehydration using intravenous fluids may be required initially for patients with severe dehydration. After restoration of blood pressure and major signs of dehydration, patients can be placed on oral rehydration solutions for the remainder of therapy. For all other patients with lesser degrees of dehydration, therapy with oral rehydration solutions alone can be used until the diarrhea ceases. Antimicrobial therapy for ETEC in children is not routinely recommended. Treatment of Adults with Travelers’ Diarrhea There are several antimicrobial agents available for the treatment of travelers’ diarrhea. The antimicrobial choice depends on the epidemiology of the visited region, the microbial resistance patterns, the antimicrobial safety profile and the possible expected interactions. Several antimicrobials have demonstrated efficacy in the treatment of ETEC associated diarrhea, including Rifaximin, fluoroquinolones and Azithromycin. The current recommendations for the treatment of travelers' diarrhea occurring in an ETEC endemic region include: a) azithromycin, 1gr [59] or 500mg as a single dose [60], either with or without loperamide, b) rifaximin for three days either 400mg twice a day [61] or 200mg three times a day [62], also either with or without loperamide [63], or c) a fluoroquinolone antibiotic, such as 500mg levofloxacin as a single dose [64], 750mg ciprofloxacin as a single dose [65] or 500mg twice daily for 3 days [66]. Rifaximin is a rifamycin derivative antimicrobial recently approved by the FDA for the use in travelers diarrhea. The mechanism of action involves inhibition of bacterial RNA synthesis by binding to the beta-subunit of the bacterial DNA-dependent RNA polymerase. Less than 0.4% of rifaximin is absorbed after oral administration [67] which limits the potential for drug interactions and side effects. Although in vitro studies have demonstrated that rifaximin is capable of inducing the cytochrome P450 3A4 isoenzyme, clinical drug-drug interaction studies using midazolam and ethinyl estradiol have not demostrated such an interaction [68]. Antimicrobial Prophylaxis In general, travelers should be reminded of basic principles of hygiene, advised to avoid drinking tap water, to drink bottled water instead and to adhere to the saying “cook it, peel it, boil it or forget it”. It should be keep in mind that even cooked food, served in restaurants may be contaminated due to unhygienic conditions. Although not routinely recommended, antibiotic prophylaxis is highly effective in preventing ETEC associated diarrhea [69] and should be limited to travelers at greatest risk of disease or its complications. A drawback for the routine use of chemoprophylaxis is the emergence of antibiotic resistance [70]. Studies of cost benefit are needed to

90 Pathogenic Escherichia coli in Latin America

Flores and Okhuysen

compare chemoprophylaxis with early initiation of therapy of TD. The cost of generic ciprofloxacin for 1- to 3-day treatment is certainly less than the cost of 14 days of rifaximin used for chemoprophylaxis [69]. ETEC VACCINE DEVELOPMENT Natural history studies of ETEC infections in children in developing countries suggest that recurrent infections induce protective immunity, as reflected by declining rates of ETEC diarrhea with age, lower ratios of symptomatic to asymptomatic ETEC infections with increasing age, and the protective relationships between initial ETEC infections and subsequent infections that have similar toxin and/or colonization factor phenotypes [71]. These data suggest that immunization against ETEC may be an effective preventive strategy not only against ETEC but possibly diarrhea due to other enteropathogens. Strategies for ETEC vaccines have focused on targeting the three major CFAs of ETEC (CFA/I, CFA/II, and CFA/IV), the immunogenic LT or the use of whole cell killed organisms expressing CFAs. However, the heterogeneity in CF antigens poses a problem due to the regional differences and changes over time. LT Based ETEC Vaccines Since ETEC LT is immunogenic, confers protective immunity and is a potent mucosal adjuvant, several LT vaccines have been developed with and without CF components. Vaccines in development include whole cell killed vaccines, live attenuated Shigella/LT vaccines, live attenuated ETEC and plant and bacterial based systems that express either LT or other ETEC antigens. Interestingly, there is evidence that two LT based vaccines not only confer protection against ETEC LT but also other enteric pathogens. The oral killed whole cell/recombinant B subunit (WC/rBS) cholera vaccine (Dukoral TM) is currently the only vaccine available in the market (but not in the US) that has shown to prevent ETEC associated diarrhea in travelers. WC/rBS cholera vaccine has been shown to prevent up to 40% of all travelers' diarrhea episodes [72]. Furthermore, vaccinated travelers develop less severe forms of diarrhea compared to their unvaccinated counterparts [73]. The oral killed vaccine approach is being pursued by several investigators. E. coli K12 over-expressing CFA/I have recently been engineered and could be useful as an oral killed CF-ETEC vaccine [72]. A vaccine trial in Morocco done in Finnish travelers with done with the WC/rBS prevented 23% of all diarrhea episodes, 52% of ETEC related diarrhea and 82% of ETEC and Salmonella diarrhea [74]. A more recent study done in US travelers to developing countries with a transdermal LT patch based vaccine showed a 75% protective efficacy against moderate to severe diarrhea, less duration of diarrhea (0.5 vs 2.1 days; p=0.0006) and fewer loose stools (3.7 vs. 10.5) in diarrhea due to all causes [75]. The mechanisms responsible for this favorable effect against diarrhea due to other pathogens in unknown, it is plausible that antitoxin antibodies in the intestinal lumen block other enteropathogens in a non-specific manner or that by preventing ETEC LT and therefore the damage induced by subclinical infections of ETEC LT, the mucosa remains less susceptible to other organisms [76, 77]. It is also plausible that ETEC LT based vaccines induce tolerance in the GI tract to enteric pathogens. Live Attenuated Vaccines Several live attenuated oral vaccines have been tested, some of them have shown good immunogenicity in human volunteers, including the attenuated CFA/II expressing PTL003 ETEC strain [78] and the CFA/I expressing ACAM2010 ETEC strain [79]. Live attenuated Shigella [80]) and Salmonella [81] vectors for expression of ETEC fimbrial and LT antigens are also in development. Future Vaccines Vaccines consisting of transgenic plant-delivered antigens offer a new strategy for development of safe and inexpensive vaccines. Vaccine antigens can be eaten with the edible part of the plant or purified from plant material. Recently, transgenic corn expressing ETEC LT has shown to stimulate a specific antibody response in adults when fed with about 2g of plant material [82].

Enterotoxigenic Escherichia Coli

Pathogenic Escherichia coli in Latin America 91

Unlike fimbriae or LT, STa has a very poor immunogenicity. However, STa can become immunogenic after being coupled with a strongly immunogenic carrier protein, such as LT, An animal model of infection that used ST/LT immunized piglets demonstrated that this approach protected piglets when challenged with a STa-positive ETEC strain [83]. The geographical and temporal heterogeneity in colonization factors found on the surface of ETEC and the subtypes of LT and ST produced pose significant challenges for the development of a single component vaccine for ETEC. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]

[22]

Bray J. Isolation of antigenically homogeneous strains of Bacterium coli metropolitanum from summer diarrhoea of infants. J Pathol Bacteriol. 1945;57:239-47. Neter E, Webb CR, Shumway CN, et al. Study on etiology, epidemiology, and antibiotic therapy of infantile diarrhea, with particular reference to certain serotypes of Escherichia coli. Am J Public Health Nations Health. 1951;41:1490-5. Ogawa J, Ogawa T. Bacterium coli in the causation of infantile diarrhoea. Lancet. 1953;265:1266. Rogers KB, Koegler SJ. Inter-hospital cross-infection of epidemic infantile gastro-enteritis associated with type strains of Bacterium coli. J Hyg. 1951;49:152-61. Smith J. The association of serological types of Bacterium coli with infantile gastro-enteritis. J Pathol Bacteriol. 1953;66:503-11. De SN, Bhattacharya K, Sarkar JK. A study of the pathogenicity of strains of Bacterium coli from acute and chronic enteritis. J Pathol Bacteriol. 1956;71:201-9. Taylor J, Maltby MP, Payne JM. Factors influencing the response of ligated rabbit-gut segments to injected Escherichia coli. J Pathol Bacteriol. 1958;76:491-9. Sack RB, Gorbach SL, Banwell JG, et al. Enterotoxigenic Escherichia coli isolated from patients with severe cholera-like disease. J Infect Dis. 1971;123:378-85. Tacket CO, Reid RH, Boedeker EC, et al. Enteral immunization and challenge of volunteers given enterotoxigenic E. coli CFA/II encapsulated in biodegradable microspheres. Vaccine. 1994;12:1270-4. Wenneras C, Erling V. Prevalence of enterotoxigenic Escherichia coli-associated diarrhoea and carrier state in the developing world. J Health Popul Nutr. 2004;22:370-82. Rao MR, Abu-Elyazeed R, Savarino SJ, et al. High disease burden of diarrhea due to enterotoxigenic Escherichia coli among rural Egyptian infants and young children. J Clin Microbiol. 2003;41:4862-4. Evans DG, Olarte J, DuPont HL, et al. Enteropathogens associated with pediatric diarrhea in Mexico City. J Pediatr. 1977;91:65-8. Long K, Vasquez-Garibay E, Mathewson J, et al. The impact of infant feeding patterns on infection and diarrheal disease due to enterotoxigenic Escherichia coli. Salud Publica Mex. 1999;41:263-70. Long KZ, Santos JI, Rosado JL, et al. Impact of vitamin A on selected gastrointestinal pathogen infections and associated diarrheal episodes among children in Mexico City, Mexico. J Infect Dis. 2006;194:1217-25. Ochoa TJ, Ecker L, Barletta F, et al. Age-related susceptibility to infection with diarrheagenic Escherichia coli among infants from Periurban areas in Lima, Peru. Clin Infect Dis. 2009;49:1694-702. Mohamed JA, DuPont HL, Jiang ZD, et al. A novel single-nucleotide polymorphism in the lactoferrin gene is associated with susceptibility to diarrhea in North American travelers to Mexico. Clin Infect Dis. 2007;44:945-52. Shah N, DuPont HL, Ramsey DJ. Global etiology of travelers' diarrhea: systematic review from 1973 to the present. Am J Trop Med Hyg. 2009;80:609-14. Hyams KC, Bourgeois AL, Merrell BR, et al. Diarrheal disease during Operation Desert Shield. N Engl J Med. 1991;325:1423-8. Flores J, DuPont HL, Jiang ZD, et al. Enterotoxigenic Escherichia coli heat-labile toxin seroconversion in US travelers to Mexico. J Travel Med. 2008;15:156-61. Turner SM, Scott-Tucker A, Cooper LM, et al. Weapons of mass destruction: virulence factors of the global killer enterotoxigenic Escherichia coli. FEMS Microbiol Lett. 2006,263:10-20. Vidal RM, Valenzuela P, Baker K, et al. Characterization of the most prevalent colonization factor antigens present in Chilean clinical enterotoxigenic Escherichia coli strains using a new multiplex polymerase chain reaction. Diagn Microbiol Infect Dis. 2009;65:217-23. Rockabrand DM, Shaheen HI, Khalil SB, et al. Enterotoxigenic Escherichia coli colonization factor types collected from 1997 to 2001 in US military personnel during operation Bright Star in northern Egypt. Diagn Microbiol Infect Dis.

92 Pathogenic Escherichia coli in Latin America

[23] [24]

[25] [26] [27] [28] [29] [30] [31] [32]

[33] [34]

[35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48]

Flores and Okhuysen

2006;55:9-12. Li YF, Poole S, Nishio K, et al. Structure of CFA/I fimbriae from enterotoxigenic Escherichia coli. Proc Natl Acad Sci. USA. 2009;106:10793-8. Ahmed T, Lundgren A, Arifuzzaman M, et al. Children with the Le(a+b-) blood group have increased susceptibility to diarrhea caused by enterotoxigenic Escherichia coli expressing colonization factor I group fimbriae. Infect Immun. 2009;77:2059-64. Ghosal A, Bhowmick R, Banerjee R, et al. Characterization and studies of the cellular interaction of native colonization factor CS6 purified from a clinical isolate of enterotoxigenic Escherichia coli. Infect Immun. 2009;77:2125-35. Anantha RP, McVeigh AL, Lee LH, et al. Evolutionary and functional relationships of colonization factor antigen I and other class 5 adhesive fimbriae of enterotoxigenic Escherichia coli. Infect Immun. 2004;72:7190-201. Peabody CR, Chung YJ, Yen MR, et al. Type II protein secretion and its relationship to bacterial type IV pili and archaeal flagella. Microbiology. 2003;149:3051-72. Orlandi PA, Critchley DR, Fishman PH. The heat-labile enterotoxin of Escherichia coli binds to polylactosaminoglycancontaining receptors in CaCo-2 human intestinal epithelial cells. Biochemistry. 1994;33:12886-95. Griffiths SL, Critchley DR. Characterisation of the binding sites for Escherichia coli heat-labile toxin type I in intestinal brush borders. Biochim Biophys Acta. 1991;1075:154-81. Holmgren J, Lindbald M, Fredman P, et al. Comparison of receptors for cholera and Escherichia coli enterotoxins in human intestine. Gastroenterology. 1985;89:27-35. Lasaro MA, Rodrigues JF, Mathias-Santos C, et al. Genetic diversity of heat-labile toxin expressed by enterotoxigenic Escherichia coli strains isolated from humans. J Bacteriol. 2008;190:2400-10. Lasaro MA, Mathias-Santos C, Rodrigues JF, et al. Functional and immunological characterization of a natural polymorphic variant of a heat-labile toxin (LT-I) produced by enterotoxigenic Escherichia coli (ETEC). FEMS Immunol Med Microbiol. 2009;55:93-9. Ochi S, Shimizu T, Ohtani K, et al. Nucleotide sequence analysis of the enterotoxigenic Escherichia coli Ent plasmid. DNA Res. 2009;16:299-309. Yang J, Tauschek M, Strugnell R, et al. The H-NS protein represses transcription of the eltAB operon, which encodes heatlabile enterotoxin in enterotoxigenic Escherichia coli, by binding to regions downstream of the promoter. Microbiology. 2005;151:1199-208. Horstman AL, Kuehn MJ. Bacterial surface association of heat-labile enterotoxin through lipopolysaccharide after secretion via the general secretory pathway. J Biol Chem. 2002;277:32538–32545. Hansen GH, Dalskov SM, Rasmussen CR, et al. Cholera toxin entry into pig enterocytes occurs via a lipid raft- and clathrin-dependent mechanism. Biochemistry. 2005;44:873-82. Massol RH, Larsen JE, Fujinaga Y, et al. Cholera toxin toxicity does not require functional Arf6- and dynamin-dependent endocytic pathways. Mol Biol Cell. 2004;15:3631-41. Hazes B, Read RJ. Accumulating evidence suggests that several AB-toxins subvert the endoplasmic reticulum-associated protein degradation pathway to enter target cells. Biochemistry. 1997;36:11051-4. Gill DM, Richardson SH. Adenosine diphosphate-ribosylation of adenylate cyclase catalyzed by heat-labile enterotoxin of Escherichia coli: comparison with cholera toxin. J Infect Dis. 1980;141:64-70. Liang S, Hosur KB, Lu S, et al. Mapping of a microbial protein domain involved in binding and activation of the TLR2/TLR1 heterodimer. J Immunol. 2009;182:2978-85. Moseley SL, Hardy JW, Hug MI, et al. Isolation and nucleotide sequence determination of a gene encoding a heat-stable enterotoxin of Escherichia coli. Infect Immun. 1983;39:1167-74. Giannella RA. E. coli heat-stable enterotoxins; guanylins, and their receptors: what are they and what do they do? J Lab Clin Med. 1995;125:173-181. Yamanaka H, Nomura T, Fujii Y, et al. Need for TolC, an Escherichia coli outer membrane protein, in the secretion of heat-stable enterotoxin I across the outer membrane. Microb Pathog. 1998;25:111-20. Guandalini S, Rao MC, Smith PL, et al. cGMP modulation of ileal ion transport: in vitro effects of Escherichia coli heatstable enterotoxin. Am J Physiol. 1982;243:G36-41. Hughes JM, Murad F, Chang B, et al. Role of cyclic GMP in the action of heat-stable enterotoxin of Escherichia coli. Nature. 1978;271:755-6. Schulz S, Green C, Yuen P, et al. Guanylyl cyclase is a heat stable toxin receptor. Cell. 1990;63:941-948. Chao AC, de Sauvage FJ, Dong YJ, et al. Activation of intestinal CFTR Cl- channel by heat-stable enterotoxin and guanylin via cAMP-dependent protein kinase. EMBO J. 1994;13:1065-72. Tien XY, Brasitus TA, Kaetzel MA, et al. Activation of the CFTR by cGMP in the human colonic cancer cell line, CaCo2.

Enterotoxigenic Escherichia Coli

[49] [50]

[51] [52] [53] [54] [55]

[56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74]

Pathogenic Escherichia coli in Latin America 93

J Biol Chem. 1994;269:51-54. Scott RO, Thelin WR, Milgram SL. A novel PDZ protein regulates the activity of guanylyl cyclase C, the heat-stable enterotoxin receptor. J Biol Chem. 2002;277:22934-22941. Hakki S, Robertson DC, Waldman SA. A 56 kDa binding protein for Escherichia coli heat-stable enterotoxin isolated from the cytoskeleton of rat intestinal membrane does not possess guanylate cyclase activity. Biochim Biophys Acta. 1993;1152:1-8. Hugues M, Crane M, Hakki S, et al. Identification and characterization of a new family of high-affinity receptors for Escherichia coli heat-stable enterotoxin in rat intestinal membranes. Biochemistry. 1991;30:10738-45. Sellers ZM, Mann E, Smith A, et al. Heat-stable enterotoxin of Escherichia coli (STa) can stimulate duodenal HCO3(-) secretion via a novel GC-C- and CFTR-independent pathway. FASEB. J 2008;22:1306-16. Patel SK, Dotson J, Allen KP, et al. Identification and molecular characterization of EatA, an autotransporter protein of enterotoxigenic Escherichia coli. Infect Immun. 2004;72:1786-94. Long KZ, Rosado JL, Santos JI, et al. Associations between mucosal innate and adaptive immune responses and resolution of diarrheal pathogen infections. Infect Immun. 2010;78:1221-8. Flores J, DuPont HL, Lee SA, et al. Influence of host interleukin-10 polymorphisms on development of travelers’ diarrhea due to heat-labile enterotoxin-producing Escherichia coli in travelers from the United States who are visiting Mexico. Clin Vaccine Immunol. 2008;15:1194-8. Holmner A, Askarieh G, Okvist M, et al. Blood group antigen recognition by Escherichia coli heat-labile enterotoxin. J Mol Biol. 2007;371:754-64. Harris JB, LaRocque RC, Chowdhury F, et al. Susceptibility to Vibrio cholerae infection in a cohort of household contacts of patients with cholera in Bangladesh. PLoS Negl Trop Dis. 2008;2:e221. Meraz IM, Jiang ZD, Ericsson CD, et al. Enterotoxigenic Escherichia coli and diffusely adherent E. coli as likely causes of a proportion of pathogen-negative travelers' diarrhea - a PCR-based study. J Travel Med. 2008;15:412-8. Sanders JW, Frenck RW, Putnam SD, et al. Azithromycin and loperamide are comparable to levofloxacin and loperamide for the treatment of travelers’ diarrhea in United States military personnel in Turkey. Clin Infect Dis. 2007;45:294-301. Ericsson CD, DuPont HL, Okhuysen PC, et al. Loperamide plus azithromycin more effectively treats travelers' diarrhea in Mexico than azithromycin alone. J Travel Med. 2007;14:312-9. DuPont HL, Jiang ZD, Ericsson CD, et al. Rifaximin versus ciprofloxacin for the treatment of travelers’ diarrhea: a randomized, double-blind clinical trial. Clin Infect Dis. 2001;33:1807-15. Taylor DN, Bourgeois AL, Ericsson CD, et al. A randomized, double-blind, multicenter study of rifaximin compared with placebo and with ciprofloxacin in the treatment of travelers' diarrhea. Am J Trop Med Hyg. 2006;74:1060-6. Dupont HL, Jiang ZD, Belkind-Gerson J, et al. Treatment of travelers' diarrhea: randomized trial comparing rifaximin, rifaximin plus loperamide, and loperamide alone. Clin Gastroenterol Hepatol. 2007;5:451-6. Sanders JW, Frenck RW, Putnam SD, et al. Azithromycin and loperamide are comparable to levofloxacin and loperamide for the treatment of traveler's diarrhea in United States military personnel in Turkey. Clin Infect Dis. 2007;45:294-301. Petruccelli BP, Murphy GS, Sanchez JL, et al. Treatment of travelers’ diarrhea with ciprofloxacin and loperamide. J Infect Dis. 1992;165:557-60. Taylor DN, Sanchez JL, Candler W, et al. Treatment of travelers' diarrhea: ciprofloxacin plus loperamide compared with ciprofloxacin alone. A placebo-controlled, randomized trial. Ann Intern Med. 1991;114:731-4. Descombe JJ, Dubourg D, Picard M, et al. Pharmacokinetic study of rifaximin after oral administration in healthy volunteers. Int J Clin Pharmacol Res. 1994;14:51-6. Koo HL, Dupont HL, Huang DB. The role of rifaximin in the treatment and chemoprophylaxis of travelers' diarrhea. Ther Clin Risk Manag. 2009;5:841-8. DuPont HL, Ericsson CD, Farthing MJ, et al. Expert review of the evidence base for prevention of travelers' diarrhea. J Travel Med. 2009;16:149-60. Wagner A, Wiedermann U. Travellers' diarrhoea - pros and cons of different prophylactic measures. Wien Klin Wochenschr. 2009;121Suppl3:13-8. Steinsland H, Valentiner-Branth P, Gjessing HK, et al. Protection from natural infections with enterotoxigenic Escherichia coli: longitudinal study. Lancet. 2003;362:286-91. Tobias J, Lebens M, Bölin I, et al. Construction of non-toxic Escherichia coli and Vibrio cholerae strains expressing high and immunogenic levels of enterotoxigenic E. coli colonization factor I fimbriae. Vaccine. 2008;26:743-52. López-Gigosos R, García-Fortea P, Reina-Doña E, et al. Effectiveness in prevention of travellers' diarrhoea by an oral cholera vaccine WC/rBS. Travel Med Infect Dis. 5:380-4. Peltola H, Siitonen A, Kyronseppa H, et al. Prevention of travellers' diarrhoea by oral B-subunit/whole-cell cholera

94 Pathogenic Escherichia coli in Latin America

[75] [76] [77]

[78] [79]

[80] [81]

[82] [83]

Flores and Okhuysen

vaccine. Lancet. 1991;338:1285-9. Frech SA, Dupont HL, Bourgeois AL, et al. Use of a patch containing heat-labile toxin from Escherichia coli against travellers' diarrhoea: a phase II, randomised, double-blind, placebo-controlled field trial. Lancet. 2008;371:2019-25. Allen KP, Randolph MM, Fleckenstein JM. Importance of heat-labile enterotoxin in colonization of the adult mouse small intestine by human enterotoxigenic Escherichia coli strains. Infect Immun. 2006;74:869-75. Berberov EM, Zhou Y, Francis DH, et al. Relative importance of heat-labile enterotoxin in the causation of severe diarrheal disease in the gnotobiotic piglet model by a strain of enterotoxigenic Escherichia coli that produces multiple enterotoxins. Infect Immun. 2004;72:3914-24. McKenzie R, Bourgeois AL, Engstrom F, et al. Comparative safety and immunogenicity of two attenuated enterotoxigenic Escherichia coli vaccine strains in healthy adults. Infect Immun. 2006;74:994-1000. Turner AK, Beavis JC, Stephens JC, et al. Construction and phase I clinical evaluation of the safety and immunogenicity of a candidate enterotoxigenic Escherichia coli vaccine strain expressing colonization factor antigen CFA/I. Infect Immun. 2006;74:1062-71. Barry EM, Altboum Z, Losonsky G, et al. Immune responses elicited against multiple enterotoxigenic Escherichia coli fimbriae and mutant LT expressed in attenuated Shigella vaccine strains. Vaccine. 2003;21:333-40. Khan S, Chatfield S, Stratford R, et al. Ability of SPI2 mutant of S. typhi to effectively induce antibody responses to the mucosal antigen enterotoxigenic E. coli heat labile toxin B subunit after oral delivery to humans. Vaccine. 2007;25:417582. Tacket CO, Pasetti MF, Edelman R, et al. Immunogenicity of recombinant LT-B delivered orally to humans in transgenic corn. Vaccine. 2004;22:4385-9. Zhang W, Zhang C, Francis DH, et al. Genetic fusions of LTAB and STa toxoids of porcine enterotoxigenic Escherichia coli (ETEC) elicited neutralizing anti-LT and anti-STa antibodies. Infect Immun. 2010;78:316-25.

Pathogenic Escherichia coli in Latin America, 2010, 95-115

95

CHAPTER 7 Detection and Subtyping Methods of Diarrheagenic Escherichia coli Strains Roxane MF Piazza1*, Cecilia M Abe1, Denise SPQ Horton1, Elizabeth Miliwebsky2, Isabel Chinen2, Tânia MI Vaz3 and Kinue Irino3 1

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, Brazil; 2Servicio Fisiopatogenia, Departamento de Bacteriología, Instituto Nacional de Enfermedades Infecciosas “Carlos G. Malbrán”, Buenos Aires, Argentina; 3 Seção de Bacteriologia, Instituto Adolfo Lutz, São Paulo, SP, Brazil. Abstract: At least 6 categories of pathogenic E. coli are undoubtedly recognized as being associated with enteric diseases. The importance of diarrheagenic E. coli is probably underestimated due to limited applications of available diagnostic methods in routine laboratories, especially in developing countries. Several strategies have been described for detection and characterization of diarrheagenic E. coli strains, mainly after the development of more advanced techniques. Thus, this chapter presents culture- and DNA-based methods, as well as immunological and biological assays to detect and characterize different diarrheagenic E. coli categories. Additional methods for confirmation and subtyping are also presented. The method of choice will depend very much on the facility of each laboratory, taking into account the sensitivity, specificity, reproducibility, reliability, cost, infrastructural resources and technical skills required by each method. Apart from diagnostic methods we also included some methods, which are more directed to research and epidemiological purposes, but may eventually be useful for a more specific characterization of the E. coli strains.

INTRODUCTION The currently known E. coli categories associated with intestinal diseases are Enterotoxigenic E. coli (ETEC), Enteropathogenic E. coli (EPEC), Shiga toxin-producing E. coli (STEC), Enteroinvasive E. coli (EIEC), Enteroaggregative E. coli (EAEC) and Diffusely adherent E. coli (DAEC) [1]. Strains belonging to each pathotype possess distinct virulence profiles that determine the clinical, pathological and epidemiological features of the diseases they cause. Several strategies were described by different authors for detection and characterization of diarrheagenic E. coli strains, mainly based on the detection of virulence-associated characteristics [2]. Therefore, different methods and complementary assays can be used for detection, presumptive identification, and confirmation of strains belonging to different categories. Diagnosis of enteric infections due to the distinct categories can be performed by culture and nucleic acid-based methods, immunologic tests or biologic assays. The method of choice will depend very much on the facility of each laboratory, taking into account the advantages of each method, the characteristics of diarrhea and the

clinical symptoms of the patients.

DETECTION AND PRESUMPTIVE IDENTIFICATION Stool Specimens Collection Successful isolation of the pathogen largely depends on the collection and a proper transport of the specimens. The collection should be conducted preferably at onset of illness and the stools should be cultured as soon as possible in the laboratory. Fecal specimens collected in transport medium and not processed soon after the collection, should be stored and transported accordingly [3]. Isolation and Presumptive Identification of E. coli Differential media of low selectivity (e.g. MacConkey Agar - MC; Eosin Methylene-Blue - EMB) can be used in a screening for E. coli. After an overnight incubation at 37oC, around 5-10 suspect E. coli colonies (lactose fermenting *Address correspondence to: Roxane M. F. Piazza. Laboratório de Bacteriologia, Instituto Butantan, Avenida Vital Brazil 1500, 05503-900 São Paulo, SP, Brazil. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

96 Pathogenic Escherichia coli in Latin America

Piazza et al.

/ non-fermenting) should be selected and inoculated into presumptive identification media (e.g. Triple Sugar Iron Agar; Kliger´s Iron Agar) and incubated in the same conditions [4, 5]. The main biochemical characteristics can be seen in Table 1. In a screening for STEC, stools samples can be plated, directly and after enrichment at 37ºC for 4 h in Trypticase Soy Broth (TSB), onto Sorbitol MacConkey Agar (SMAC) plates. Since the majority of E. coli O157 STEC strains, in contrast to non-O157 STEC strains, do not ferment sorbitol after overnight incubation, SMAC is an effective medium to screen for O157. Before plating onto SMAC, enrichment for O157:H7 can be done in TSB supplemented with potassium tellurite (25 mg/ml) since O157 strains are less susceptible to tellurite than other enterobacteria; inhibition of other sorbitol negative bacteria, such as Proteus spp, can be done adding cefixime (50 ng/ml) to this enrichment broth. After an overnight incubation period, 5 to 10 sorbitol negative and sorbitol positive colonies are selected and inoculated into the presumptive medium. The colourless colonies in SMAC agar (sorbitol negative) which in presumptive medium present common phenotypic characteristics of E. coli strains are O157 suspicious colonies. Neverthless, the sorbitol fermenting colonies should be also screened for O157, as sorbitol fermenting O157 STEC strains had been reported in Europe [5]. Stool samples containing low number of O157 STEC strains, due to the delay between collection and processing steps, or samples collected several days after the onset of illness, such as from HUS patients, should be subjected to an enrichment step to increase the recovery of O157. In the selective enrichment of O157 by inmunomagnetic separation (IMS) technique, samples from any enrichment broths (e.g. Gram negative broth) are added to magnetic beads coated with antibody against O157, subjected to magnetic separation, washing and centrifugation steps, and streaked on SMAC plates. In routine diagnostic laboratories, when a more sensitive method than direct plating is required for O157 isolation, the use of IMS is strongly recommended [6]. All lactose positive/negative and sorbitol positive/negative colonies presumptively identified as E. coli should be screened for all diarrheagenic categories using any of the available methods according to the facility of each laboratory. Table 1: Main biochemical properties of Escherichia species and Shigella (a, b)

Test

E. coli inactive strains

E. coli

E. blattae

E. hermannii

E. fergusonii

E. albertii

E. vulneris

Shigella spp

Acetate utilization

[+]

d

-

+

[+]

d

+w

-

Citrate, Christensen

+

+

-

d

d

-

nd

-

Citrate, Simmons

-

-

d

[-]

-

-

-

-

D-glucose, gas

+

-

+

+

+

+

-

[-]

Indole

+

[+]

-

+

+

-

-

d

LDC

+

d

+

+

-

[+]

+

-

Malonate utilization

-

-

+

d

-

[+]

-

-

Motility

+

-

-

+

+

+

-

-

ODC

d

[-]

+

+

+

-

+

d

Yellow pigment

-

-

-

-

+

d

-

-

Acid production from: Cellobiose

-

-

-

+

+

+

-

-

D-adonitol

-

-

-

+

-

-

-

-

D-manitol

+

+

-

+

+

+

+

d

D-sorbitol

+

d

-

-

-

-

-

d

Dulcitol

d

d

-

d

[-]

-

-

d

Lactose

+

[-]

-

-

d

[-]

-

d

Mucate

+

d

d

-

+

[+]

-

-

a

Data from Ewing [4], Abbott et al. [7], Huys et al. [8], and Scheutz and Strockbine [9].

b

Legend: +, 90 -100% positive; [+], 76-89% positive; d, 26-75% positive; [-], 11-25% positive; -, 0-10 % positive; +w, weakly positive; nd, not determined

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 97

Slide Agglutination Test for EPEC, EIEC and STEC Screening In routine microbiology laboratories, all E. coli colonies obtained from primary isolation plates can be screened using the classical EPEC serogroups antisera O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158 [10]. E. coli colonies detected as sorbitol negative on SMAC plates can be tested against O157 antiserum and all other sorbitol fermenting and non-fermenting E. coli colonies can be screened for O26, O1O3, O111, and O145, some of the most common STEC serogroups associated with human infections worldwide [9]. In addition, all non-motile, and lysine decarboxylase and lactose negative E. coli colonies can be screened for the classical EIEC serogroups O28ac, O29, O112, O124, O136, O143, O144, O152, O159, O164, O169, and O173 [1, 4, 11], since most of the EIEC strains generally presents these characteristics. Besides being a practical and an easy test to perform, the main advantage of the slide agglutination test is the commercially availability of the sera. However, the disadvantage of this method is the heterogeneity of EPEC serogroups which can comprise categories other than EPEC; the inability to distinguish typical (tEPEC) from atypical EPEC (aEPEC) within these serogroups, and the occurrence of EPEC strains belonging to serogroups other than the classical EPEC serogroups. Misdiagnosis can also occur due to some atypical EIEC strains (gas+ or LDC+ or motile) and descriptions of newly recognized EIEC serogroups different from those mentioned above [12, 13, 14]. All E. coli isolates screened by this method as belonging to EPEC, EIEC or STEC should be confirmed by biochemical reactions and tested for virulence factors and those screened by slide agglutination test as negative are tested for all categories using other methods such as DNA-based assays. PCR Assays Nucleic acid-based detection methods relies on the detection of genes encoding for potential virulence or virulenceassociated factors (toxins, intimin, enterohemolysin, etc), and the most sensitive, specific, faster and practical method for detection is the PCR approach. A variety of PCR protocols based on simple or multiplex reactions to detect different categories in a single reaction or to further characterize specific diarrheagenic E. coli strains have been developed [15, 16, 17, 18, 19, 20, 21, 22, 23]. PCR methods using single primers sets as well as multiplex reactions have been reported to be sensitive and specific for the most common pathotypes of E. coli, and very practical reducing the number of tests required for diagnosis of diarrheagenic E. coli infections. Specific primers used to screen samples belonging to different diarrheagenic categories and their respective cycling conditions are presented in Table 2. DNA samples for PCR can be prepared using the confluent growth from primary isolation plates or pools of presumptively identified E. coli colonies. When DNA samples are prepared using mixed bacterial growth harvested from primary isolation plates, all positive PCR samples should be individually plated and re-tested. When pools of presumptively identified as E. coli colonies are used, amplification should also be repeated with individual colonies. Amplification of target genes direct from the stool samples is difficult due to the presence of inhibitors in stools, unless the samples are washed and diluted before boiling [5]. ETEC A sensitive and specific PCR assay with primers targeting the genes lt and st respectively encoding for heat-labile (LT) and heat-stable (ST) enterotoxins of ETEC was reported by Stacy-Phipps et al. [20]. Several multiplex PCR assays were also developed including these two genes [21, 22, 23]. EPEC EPEC detection by PCR assays can be performed using primers targeting the eae gene [16, 24]. All eae positive and stx negative strains are further tested by PCR for the presence of the gene bfp and EAF plasmid to differentiate tEPEC from aEPEC [18, 25].

98 Pathogenic Escherichia coli in Latin America

Piazza et al.

STEC Multiplex PCR including stx gene and other virulence genes could be useful in screening for STEC using bacterial confluent growth zones or suspicious sorbitol fermenting and non-fermenting colonies taken from SMAC [26]. Specific primers can also be used in screening for some STEC serogroups such as O111 and O157 [27]. EIEC The ipaH gene, present in multiple copies both on the invasion plasmid and in the chromosome has been used as a target for PCR assay to detect EIEC and Shigella spp [17]. EAEC After sequencing the EcoRI-PstI fragment of pCVD432 (EAEC probe) Schmidt et al. [19] designed a primer pair complementary to this probe for PCR amplification of a 630-bp region. This PCR assay revealed to be a rapid, simple, and highly sensitive method, being considered for this reason useful for screening stool specimens for the presence of EAEC strains. Rapid and practical multiplex PCR assays targeting for more genes (aggR, aap and aatA, respectively encoding for a transcriptional activator, an antiaggregation protein and an outer membrane protein or aggR, pic and astA, respectively encoding for a transcriptional activator, a protein involved in colonization and an enteroaggregative heat-stable toxin) have also been employed to detect EAEC strains [28, 29, 30]. More recently, using PCR to evaluate aggR, aatA and aap in a collection of E. coli strains, Monteiro et al. [31] found that aggR and aatA were more specific to EAEC than aap suggesting that the detection of aggR, aatA associated with aaiA (a protein involved in the expression of yersinibactin) might be an improvement in the PCR detection of EAEC. DAEC Multiplex PCR assays have been designed for detection of DAEC strains [32], while some recent assays did not screened for DAEC strains at all [23, 30]. Table 2: Diarrheagenic E. coli target genes, oligonucleotide sequences, cycling conditions, and expected DNA fragment sizes. Designation

Primers

Cycling conditions o

Amplicon size (bp)

Ref.

o

ETEC

lt

TW20: 5’-GGC GAC AGA TTA TAC CGT GC3’ JW11: 5’-CGG TCT CTA TAT TCC CTG TT3’

50 C (2 min); 95 C (5 min); 40 cycles: 95oC (45 s); 50oC (45 s); and final extention at 72 oC (10 min).

450

[20]

ETEC

st

JW14: 5’-ATT TTT CTT TCT GTA TTG TCT T3’ JW7: 5’-CAC CCG GTA CAA GCA GGA TT3’

50oC (2 min); 95oC (5 min); 40 cycles: 95oC (45 s); 50oC (45 s); and final extention at 72 oC (10 min).

190

[20]

EPEC

eae

AE9: 5’-ACG TTG CAG CAT GGG TAA CTC3’ AE10: 5’-GAT CGG CAA CAG TTT CAC CTG3’

94oC (5 min); 35 cycles: 94oC (1 min); 56oC (1 min); 72oC (2 min); and final extension at 72 oC (5 min).

800

[16]

EPEC

eae

SK1: CCCGAATTCGGCACAAGCATAAGC SK2: CCGGATCCGTCTCGCCAGTATTCG

94oC (5 min); 30 cycles: 94oC (30 s); 54oC (1 min); 72oC (2 min); and final extension at 72oC (2 min).

864

[24]

EPEC

bfp

EP1: 5’-AAT GGT GCT TGC GCT TGC TGC3’ EP2: 5’-GCC GCT TTA TCC AAC CTG GTA3’

29 cycles: 94oC (1 min); 56oC (1 min); 72oC (2 min).

326

[18]

o

o

STX1a: 5’-GAA GAG TCC GTG GGA TTA CG3’ STX1b: 5’-AGC GAT GCA GCT ATT AAT AA3’

94 C (5 min); 30 cycles: 94 C (30 s); 55oC (30 s); 72oC (30 s); and final extension at 72oC (3 min).

130

[15]

stx2

STX2a: 5’-TTA ACC ACA CCC CAC CGG GCA GT 3’ STX2b: 5’-GCT CTG GAT GCA TCT CTG GT3’

94oC (5 min); 30 cycles: 94oC (30 s); 55oC (30 s); 72oC (30 s); and final extension at 72oC (3 min).

346

[15]

ipaH

IpaH 1: 5’-GTT CCT TGA CCG CCT TTC CGA TAC3’ IpaH 2: 5’-GCC GGT CAG CCA CCC TCT GAG3’

94oC (5 min); 35 cycles: 94oC (1 min); 55oC (1 min); 72oC (1 min); and final extension at 72oC (3 min).

600

[17]

aggR

Pcvd432/start: 5’-CTG GCG AAA GAC TGT ATC AT3’ Pcvd432/stop: 5’-CAA TGT ATA GAA ATC CGC TGT T3’

94oC (5 min); 30 cycles: 94oC (30 s); 55oC (1 min); 72oC (50 s); and final extension at 72ºC (5 min).

630

[19]

STEC

stx1

STEC

EIEC

EAEC

Locus

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 99

The advantages of the use of PCR assays are the rapid detection of positive samples at the screening step, and the reduction of the number of stool specimens requiring further processing to isolate the E. coli strains since all PCRnegative stools samples can be screened out. More recently, real time PCR (RT-PCR) assays heve been developed to detect all the diarrheagenic categories of E. coli. The main advantages of this technique are the low cost, high sensitivity/specificity, simplicity, being faster, less laborious, and its availability for both, routine and research use [33]. Colony Hybridization Assays [34] Colony blots can be prepared from fecal plating of mixed bacterial growth, spread plates containing hundreds of colonies or plates containing individual colonies subcultured from the primary isolation plates. After overnight incubation at 37oC, the bacterial growth is transferred to Whatman or nitrocellulose filter papers, lysed, denaturated, and the DNA fixed on the filters. Specific DNA probes targeting the main virulence encoding genes can be used to screen for different diarrheagenic categories. Radiolabelled or non-radioactively (chemically or enzymatically) labeled polynucleotide (DNA fragment probes) or oligonucleotide probes can be used for hybridization assays. Probes used for different diarrheagenic E. coli categories have been reported [35, 36, 37, 38, 39, 40, 41, 42, 43, 44]. Colony hybridization assay is very suitable for the screening of a very large number of E. coli strains at one time. Although it is a very efficient method for the detection and characterization of different pathotypes, this technique can be performed only in some laboratories due to the technical difficulties. In Brazil, this methodology has been used in several epidemiological studies [45, 46, 47, 48]. CHARACTERIZATION OF DIARRHEAGENIC E. coli CATEGORIES Phenotypical Characterization of E. coli Strains All E. coli isolates screened as belonging to any of the known categories should be confirmed by biochemical tests according to Scheutz & Strockbine [9], since in presumptive media different species of Escherichia can present the same phenotype. Biochemical identification of E. albertii is very difficult as most of the phenotypic characteristics overlap with E. coli. Molecular methods are necessary to accurately differentiate E. coli isolates from E. albertii [7, 8]. Because E. hermannii and O157 STEC strains present the same phenotypic characteristics on SMAC and both agglutinate with O157 antiserum, all strains screened by slide test agglutination test using O157 antiserum should be confirmed by biochemical tests. Fermentation of cellobiose and production of yellow pigment are characteristic of E. hermannii [9]. Some biochemical characteristics can help to direct towards a specific diarrheagenic category; e.g., anaerogenic, non-motile, lactose negative and lysine decarboxylsae negative E. coli strains can suggest that the isolates are EIEC, as they present some characteristic features of this pathotype [4]. On the other hand, the absence of decarboxylation of lysine in O111 serogroup can be suggestive for STEC, while the ability to metabolize phenylpropionic acid is associated with EPEC strains in serogroups O111 and O128 [49, 50]. Most of STEC strains produce enterohemolysin, a characteristic that might be useful to identify this pathotype. The enterohemolytic phenotype is characterized as a thin zone of hemolysis around the colony after 18 h of incubation in contrast with E. coli -hemolysis which presents as a clear zone of hemolysis detectable after 4-6 h of incubation. Detection of enterohemolysin produced by E. coli isolates on agar plates prepared with washed sheep blood supplemented with CaCl2 may indicate that the isolates belong to the STEC category [51]. PCR Assays All diarrheagenic E. coli isolates screened by any methods other than the DNA-based assays, should be confirmed by PCR using specific primers of each category as previously described [15, 16, 17, 18, 20, 21, 22, 23, 52].

100 Pathogenic Escherichia coli in Latin America

Piazza et al.

Additionally, PCR assays can be used for detecting other virulence-associated genes, such as the DNA sequences related to a new member of the cytolethal distending toxin (CDT) family [53], the recently described highly potent and lethal subtilase toxin (SubAB) unrelated to other AB5 toxins [54]; the putative adhesins encoded outside the LEE: Efa1, the enterohemorrhagic E. coli factor for adherence [55]; Iha, an adherence conferring protein similar to the Vibrio cholerae IrgA [56], Saa, an autoagglutinating adhesin identified in a LEE negative STEC strain of serotype O113:H21 [57]; ToxB, a protein required for the full expression of adherence in the O157:H7 Sakai strain [58], LpfO113, a long polar fimbriae (Lpf) closely related to Lpf of Salmonella enterica serovar Typhimurium [59], EhxA, a plasmid-encoded enterohemolysin [51] East I, heat-stable enterotoxin I [60], and CFAs, colonization factor antigens [61]. Serotyping Serotyping has played an important role in the study of E. coli and even today, O:H serotyping remains the “gold standard” for taxonomy and epidemiological investigation of E. coli outbreaks [62]. Serotyping is based on the identification of the somatic (O), flagelar (H), and capsular (K) antigens. In the present scheme of E. coli serotyping, 179 groups designated from O1 to O187 are included (O31, O47, O67, O72, O94, and O122 were removed). Concerning the flagellar antigens, a total of 53 H antigens (H13, H22, and H50 were withdrawn) named H1 to H56 have been described [4, 11, 62, 63]. Despite of the great number of the distinct antigens (O, H and K) in E. coli strains, and the possibility of their occurrence in nature in several different combinations, only a limited number of them (serotypes) are known to cause human or animal diseases [11]. For many years, identification of these pathotypes relied on the slide agglutination test for identification of O serogroups. However, O:H serotyping was recommended since only some of them within a given EPEC O serogroup were associated with diarrheal diseases. Distinct O:H serotypes within a given O serogroup can be members of different pathotypes, and a close association can be found between serotypes with specific categories [1, 11]. The newly recognized O groups outside the classical O groups as typical EPEC (tEPEC) and atypical EPEC (aEPEC) (O88, O103, O145 and O157, among others), the more recently described EIEC groups (O121 and O135), and the steadily increasing list of serotypes in other diarrheagenic categories, mainly among STEC, point the important role of serotyping for epidemiological purposes [9, 12, 13, 14]. Molecular typing targeting the O antigen gene cluster (rfb) [64] can be used for typing O rough strains and those which are non-typeable by conventional serotyping using the currently available O antisera [65]. For some specific O groups, PCR-based assays targeting genes found within the O antigens gene cluster, such as the O antigen flippase (gene wzx) and polymerase (gene wzy), have been also developed [66]. Molecular genotyping can also be performed for non-motile E. coli strains [67, 68]. Serotyping of E. coli strains requires a complete set of O and H antisera; an assay performed only in few reference laboratories. Therefore, E. coli strains isolated in routine microbiology laboratories and characterized as associated with human/animal diseases should be forwarded to a reference laboratory. ADDITIONAL METHODS FOR CONFIRMATION OF DIARRHEAGENIC E. coli CATEGORIES Animal Model Assays A number of assays using animal models have been replaced by molecular techniques for routine diagnosis due to ethic concern; however, some of them are being used for research purposes, as they are considered the best way to characterize some virulence factors in vivo. Rabbit Ligated Ileal Loop Assay ST produced by ETEC was initially detected in a rabbit ligated ileal loop assay adapted by Evans et al. [69]. In this assay, the response of young adult rabbit small intestine after challenges with ST or LT is accessed by the presence

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 101

of fluid accumulation in the intestine. Apart from the animal use, the requirement of a delicate surgical procedure makes this method impracticable in most of the laboratories. Suckling Mouse Assay (Dean’s test) Due to several difficulties to perform the rabbit ileal loop assay in a routine basis, this assay has been later replaced by the suckling mouse assay or Dean’s test [70]. This test, which has been used as a standard biological assay for the presence of ST, is also based on the measurement of intestinal fluid accumulation, but using infant mice after percutaneous injection or oral administration of culture supernatants. After the infection period, the fluid accumulation is measured by weighting their intestines and calculating the gut-to-body weight ratio. Serény Test This test was originally proposed to verify the virulence of bacterial cultures [71]. Subsequently, this assay showed to be useful to evaluate the invasiveness of Shigella and EIEC. In this assay, a bacterial suspension is dropped into the conjunctivae of a guinea pig, and the animal’s eye is checked up for five days. The invasiveness of the bacteria is determined by its ability to produce keratoconjuntivitis. Alternatively, the invasive potential of EIEC can be assayed by an in vitro cell culture assay [72]. Cell Culture Assays Although cell culture assays are very sensitive, these methods are not routinely used in most clinical microbiological laboratories as they are cumbersome and requires familiarity with tissue culture techniques. Toxin Detection Cell culture assays have also been employed to access the ability of E. coli strains to produce toxins. Supernatants prepared by individual E. coli colonies taken from primary isolation plates can also be tested for LT production using Y1 adrenal cell or the Chinese hamster ovary (CHO) cell cultures. Presence of LT in supernatants is indicated by rounding of Y1 cells or elongation of CHO cells after 24 h of incubation [73, 74]. Vero (African green monkey kidney) cells are very sensitive to Shiga toxins (Stx) due to the high concentrations of globotriaosylceramides (Gb3 and Gb4), receptors for Stx in eukaryotic cells. HeLa cells also present Gb3 and can be used for Stx detection; however, some Stx variants cannot be detected with this cell line [75]. Sterile fecal filtrates prepared from fresh stool specimens or broth enrichments of selected colonies are inoculated onto cells and observed for typical cytopathic effect. Confirmation that the cytopathic effect is caused by Stx is performed by neutralizing the toxin using anti-Stx1 and anti-Stx2 antibodies. The result of this assay can typically be observed after 48 to 72 h. Cytotoxicity assay on Vero cells remains a standard confirmation test of Stx-producing E. coli isolates [75]. Invasion Ability Detection The invasive ability of bacteria can also be quantitatively evaluated by an assay (invasion assay) performed in a cell model usually using HeLa or HEp-2 cell lines [72]. In this assay, two sets of epithelial cells cultivated in vitro are infected with the bacterial samples for 3-6 h. After this period, one set of infected cells is washed with PBS, lysed with Triton X-100, and the bacteria suspension quantified by plating serial dilutions in MacConkey agar plates to obtain the total number of cell-associated bacteria. The second set is washed with PBS and further incubated in fresh media added by gentamicin before being washed again with PBS, lysed with Triton X-100, resuspended in PBS and quantified in MacConkey agar plates to obtain the number of intracellular bacteria. The invasion index is given in percentage by the intracellular bacteria / total cell-associated bacteria ratio. Adherence Patterns Detection The adherence assay is widely used to phenotypically classify E. coli strains in different E. coli categories according to their adherence pattern [76, 77, 78, 79]. It is a useful and reliable method to identify strains belonging to EAEC and DAEC categories. In this assay, monolayers of HEp-2 (or HeLa) cells presenting 50-70% confluence are prepared by standard cell culture techniques, usually in 24-wells cell culture dishes containing coverslips. Cells are

102 Pathogenic Escherichia coli in Latin America

Piazza et al.

inoculated tipically with 1:50 dilution of bacterial cultures and incubated for 3 or 6 h at 37oC. After this period, preparations are washed, fixed and stained for light microscopy observation (Fig. 1).

AA

DA

LA

LAL

Figure 1: Adherence patterns observed in HEp-2 adherence assays after 6 hours incubation: (AA) Aggregative adherence, characteristic of enteroaggregative E. coli (EAEC); (DA) Diffuse adherence characteristic of diffusely adherent E. coli (DAEC); (LA) Localized adherence, characteristic of enteropathogenic E. coli (EPEC); and, (LAL) Localized adherence-like, characteristic of atypical EPEC (aEPEC), x1000.

Immunological Assays for Virulence Markers Search Gene detection does not assure expression of the corresponding virulence factor. Therefore, the antibody-based assays comprise the largest group of rapid methods being used for detection of virulence factor expression. In some cases, they can be considered as first alternative, as it can replace biological assays. ETEC This pathotype can be characterized by the enterotoxins it produces, and diagnosis depends upon identifying either LT and/or ST. One or both toxins may be expressed by ETEC strains. A number of immunoassays have been developed for ST detection, including radioimmunoassay and enzyme-linked immunosorbent assay (ELISA). Both tests correlate well with results obtained with the suckling-mouse assay and require substantially less expertise [80, 81]. An anti-ST IgG1 monoclonal antibody [82] was evaluated by immuno-dot and colony immunoblot assays showing that the specificity in both techniques was 91%, and that the sensitivity was 77% and 67%, respectively. A better expression of ST was observed when the culture was performed in Colonization Factor Agar (CFA) and minimum medium rather than in Luria-Bertani (LB) or TSB. For colony immunoblot, CFA medium was more efficient than blood agar or MacConkey agar (Piazza, R.M.F. and L. Beutin, unpublished data). Immunological assays for LT detection includes the traditional Biken test, latex agglutination, and reliable and easy to perform commercially available tests, such as the reversed passive latex agglutination and the staphylococcal coagglutination test [1, 83]. Several immunological assays where LT is captured by ganglioside GM1 (its receptor in the host cell) have been described [1, 83]. Menezes et al. [84] reported high sensitivity (100%) and specificity (99%) with the capture immunoassay when CYE medium supplemented with polymyxin is used, instead of LB broth medium. The use of an IgG enriched fraction of a rabbit polyclonal as a capture antibody, and a mouse monoclonal IgG2b anti-LT as a second antibody is an excellent alternative approach for LT detection capture assay [85]. EPEC Given that EPEC strains are defined on the basis of their virulence properties, a set of proteins, including intimin, the bundle-forming pilus (BFP) and the secreted proteins belonging to the type III secretion system, can be considered for the diagnosis. Detection of intimin and secreted proteins can be used either for EPEC or EHEC, while the presence or absence of BFP distinguishes tEPEC from aEPEC [86, 87, 88]. Immunoblotting, immunofluorescence, immunogold or slot-blot immunoassay, using polyclonal rabbit antiserum raised against the conserved region of intimin (Int388-667) [89] can be used to detect tEPEC isolates expressing , , ,  and  intimin [90, 91]. Recently, Menezes et al. [92] reported an application of immunoblotting with 100% specificity and 97%

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 103

sensitivity in the detection of eae positive E. coli strains. Detection of a wider range of intimin subtypes was achieved using rabbit anti-intimin IgG-enriched fraction instead of rat antibody, which despite having presented low levels of nonspecific cross reactivity, detected much narrow range of intimin types. Menezes et al. [92], employing several EPEC and EHEC strains presenting different intimin types, clearly demonstrated that polyclonal rabbit antisera is suitable for immunoblotting as a diagnostic tool, and showed that protein denaturation and linearization is a critical step for anti-intimin antibody accessibility. Regarding secreted proteins; Lu et al. [93] developed a new practical method to identify EPEC by detecting the E. coli secreted protein B (EspB) in the culture supernatant by reversed passive latex agglutination (RPLA), after the strains have been cultivated in Dulbecco’s Modification of Eagle’s Medium (DMEM). In addition, Nakasone et al. [94] established a rapid immunochromatographic (IC) test to identify the presence of EspB in EPEC and EHEC isolates. The detection limit of the test has been reported as 4 ng/mL, and the results showed 96.9% of sensitivity and 100% of specificity. The IC test for the detection of EspB may be a practical method to define EPEC or EHEC both in clinical laboratories and the field trials [94]. The expression of BFP has been considered a truly phenotypic marker of tEPEC [86, 87, 88]. Among the phenotypical methods, immunological assays using monoclonal or polyclonal antibodies, such as the immunofluorescence and immunoblotting tests for BFP expression have been employed [95, 96]. Gismero-Ordoñez et al. [96] using immunoblotting analysis to detect the production of bundlin on different media, reported that 91% of the 36 tEPEC strains tested produced BFP in DMEM, 89% in MacConkey, and 83% in EMB agars. These results were particularly interesting since MacConkey and EMB agars are routinely used for the identification of lactosepositive E. coli isolated from diarrheal stools. Recently, a colony immunoblot assay for tEPEC detection based on BFP expression was standardized using a rabbit tEPEC anti-BFP polyclonal antiserum which was prepared as described by Girón et al. [44] and Nara et al. [88]. Standardization was done after growing the bacterial isolates on DMEM agar containing fetal bovine serum or tryptic soy agar containing 5% of washed sheep blood (TSAB). This test showed a positivity of 92% and 83%, and specificity of 96% and 97%, respectively, when the culture was done in DMEM and TSAB. This method combines the simplicity of an immunoserological assay with the high efficiency of testing a large number of EPEC colonies [88]. STEC Numerous assays for the diagnosis of STEC have been developed based on the detection of Stx1 and/or Stx2 toxins, which represents the major virulence factors of this E. coli category [reviewed in 97]. A variety of immunological test kits such as Premier EHEC, Immunocard STAT! EHEC (Meridian Diagnostics, Cincinnati, Ohio), ProSpecT Shiga Toxin E. coli Microplate Assay (Remel, Lenexa, Kansas); Ridascreen-EIA® (R-Biopharm AG, Darmstadt, Germany); Duopath Verotoxins Gold Labeled Immunosorbent Assay (Merck, Germany); VTEC Screen "Seiken"/Denka Seiken RPLA (Denka Seiken, Japan) are commercially available. The time required for these assays ranges from 20 minutes to 4 hours, depending on the test format used. Specific instructions and actual requirements for each test can be obtained by consulting the manufacturers’ instructions. Sensitivities and specificities vary according to the test format and the manufacturer [98, 99, 100, 101, 102, 103, 104, 105]. Reliable and low cost STEC detection assays are not currently available in developing countries. To outline this situation, Mendes-Ledesma et al. [106] standardized a reproducible, fast, easy to perform, and reliable immuno-dot and ELISA methods employing a mixture of rabbit anti-Stx1 and Stx2 sera for the detection of STEC. Regardless of of the better performance of the ELISA for STEC detection, this assay has not yet been evaluated in terms of industrial quality control and commercial availability. The estimated cost of the assay is around US$70 per 96 detections, which is realistically affordable for developing countries. EIEC An ELISA to identify EIEC and Shigella using an absorbed rabbit antiserum, recognizing invasion plasmid antigen (Ipa) proteins, was described by Pál et al. [107]. The method was feasible although dependent on sera preparation and standardization procedures. Later, this assay was modified by introducing a monoclonal antibody specific for IpaC, evaluated with a panel of selected invasive and non-invasive strains [108], and employed for clinical investigation among colonies from fecal samples from children in Kuwait [109]. The sensitivity of this method is

104 Pathogenic Escherichia coli in Latin America

Piazza et al.

restricted by the number of colonies chosen from individual specimens for the assay. Colony immunoblot, an adequate assay for testing a high number of colonies, was used to detect EIEC and Shigella in fecal specimens by Szakál et al. [110]. The authors reported the development and optimization of an IpaC-specific colony immunoblot assay for its application in a field trial and concluded that it is a simple screening method to detect EIEC in stool samples, applicable for laboratories not equipped with molecular techniques. Sethabutr et al. [111] studied an application of ELISA test to detect ipaH genes sequences by PCR from EIEC and Shigella in diarrheal stools and compared the PCR-agarose gel electrophoresis results with ipaH DNA probes and/or culture methods. PCR-ELISA method increased the detection of these pathogens in comparison to the culture method. This assay also offered the advantage of screening large number of samples, an automated test result database, and the possibility to avoid the use of mutagenic reagents EAEC The pathogenicity of this E. coli category is not as well understood as other categories of pathogenic E. coli, but several protein components (Protein involved in colonization, Pic; Shigella enterotoxins, ShET1; Enteroaggregative heat-stable toxin-1, EAST1; and Plasmid enconded toxin, Pet) have been involved in the virulence of this pathotype. The presence of Pet in EAEC isolates was initially detected by immunoblotting assays after a preliminary step of culture supernatant concentration [112]. Vilhena-Costa et al. [113] developed a slot blot immunoassay that avoids the concentration step, allowing detection of Pet directly from EAEC supernatant, after growing the EAEC bacterial isolate in TSB at 37ºC during 4 h. In this method, it was possible to evaluate Pet expression with specificity and reproducibility, using a rabbit polyclonal anti-Pet sera, which presented no cross reaction with supernatants of nonexpressing Pet isolates and commensal E. coli. DAEC This pathotype represents a heterogeneous group of strains [114, 115] which pathogenic mechanisms are not well understood. Phenotypic and genotypic assays have been used for DAEC detection; however, no immunological tests have been developed. Despite the current progress in the development of reliable and low cost immunoassays, diarrheagenic E. coli detection assays are currently unavailable in most of the countries in Latin America. Except for STEC, the other diarrheagenic E. coli categories are frequently disregarded as an important cause of either infantile diarrhea or diarrheal disease in all age groups. Colorimetric Method A simple and rapid stool test based on apyrase (ATP-diphosphohydrolase) activity has been recently reported for EIEC detection [116]. This is an essential periplasmic enzyme required for unipolar localization of IcsA, which is involved in the pathogen’s intracellular and intercellular spread, and is only expressed by EIEC and Shigella [117]. The use of an initial filtration step avoids interferences and allows adequate bacterial growth for the enzyme expression in 6 to 7 h at 37ºC. The enzyme activity is measured by a colorimetric reaction. The method is robust, requires widely available equipments and affordable reagents, and can be applied for routine use in laboratories with limited resources [116]. COMPLEMENTARY METHODS FOR DIARRHEAGENIC E. coli STRAINS CHARACTERIZATION Apart from the methods for the E. coli characterization already described in this chapter, other useful methods for a more specific identification and characterization of E. coli strains are described next. Most of the methods presented here are restricted to research laboratories because the high cost and the need of specific facilities, and due to the fact that they are too laborious to be available for routine use. However, these methods are very useful for specific research purposes. Variations of the Adherence Assay The adherence assay is useful to access the inhibition of adhesive properties mediated by certain structures or components of the cell or bacteria. In this case, before performing the adherence assay itself, the test bacterial strains

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 105

are pre-incubated with a specific anti-serum against a specific structure [118] or substance [52] of interest, before being transferred into the tissue cultured cells plates, and then the assay carried out as previously described. As a control, the standard adherence assay must be performed in parallel. In this case, the assay is referred as adherence inhibition assay. Intestinal mucosal biopsies can also be used for adherence assays using the in vitro organ culture (IVOC) method. In this method, endoscopically and histologically normal mucosal fragments, obtained (with ethical approval) from patients undergoing endoscopical investigation, are maintained and assayed in NCTC109 medium supplemented with 5% newborn calf serum. Bacterial strains are added to the culture medium, and the preparations incubated for 8 h at 37oC in an atmosphere of 95% O2-5% CO2. At the end of the incubation period, the preparations are washed, fixed and processed to be analyzed under light, scanning (SEM) or transmission electron microscopy (TEM) methods [119, 120]. Other variations of the adherence assay initially described by Cravioto et al. [76] have been reported using different cell cultures and conditions [121, 122, 123]. FAS Test and Other Immunofluorescence Assays This test proposed by Knutton et al. [124] is based on the principle that in the attaching-effacing (AE) lesion caused by EPEC, EHEC and other AE-producing bacterial strains, a dense concentration of actin microfilaments accumulates in the apical cytoplasm beneath attached bacteria. This actin can be detected by using a fluorescentlabeled phalloidin and a fluorescence microscope, providing a highly sensitive test for the AE lesion and thus for EPEC and EHEC detection. In this technique, fixed and washed cells are permeabilized with 0.1% Triton-X 100, washed in PBS, and treated with a solution of phalloidin conjugated with fluorescein isothiocyanate. The samples placed on coverslips are then washed, mounted in glycerol-PBS and examined by fluorescence (Fig. 2) or confocal microscope.

Figure 2: FAS test. Aspects of FAS negative (A) and FAS positive (B) test. Actin accumulation can be observed under bacteria on the cell surface in B, x1000.

Other tests, using direct and/or indirect immunofluorescence methods can be performed to identify and localize specific antigens. FAS test is an example of direct method using phalloidin to detect a specific antigen (actin). In the same way, specific antibodies conjugated with a fluorescent component (for example, FITC or TRITC) can be used to localize specific antigens. The indirect immunofluorescent labeling involves the use of a specific primary unlabeled antibody against the antigen of interest, followed by a secondary antibody conjugated with a fluorescent component directed against the primary antibody. Preparations are then washed, mounted in glycerol-PBS and examined under fluorescence or confocal microscope [125]. The advantages of the indirect labeling include a significant amplification of the primary signal, and the possibility of detecting different primary antibodies with the same labeled secondary antibody. Electron Microscopical Methods SEM and TEM of thin sections have been also used in the study of bacteria-cell interactions. Both methods have also been used associated with immunological methods. SEM is useful to examine the surface of a bacteria-cell interaction. Preparations obtained from adherence assays with epithelial cells cultivated in vitro or mucosal surfaces from natural or experimental infections can be quantitatively or qualitatively analyzed using this method. Specimens

106 Pathogenic Escherichia coli in Latin America

Piazza et al.

are fixed in 3% buffered glutaraldehyde, post-fixed in 1% osmium tetroxide, dehydrated through a series of graded ethanol solutions (50, 70, 90, and 100%) and critical point dried. Specimens are then mounted onto SEM stubs, coated with gold and examined under SEM (Fig. 3). TEM of sectioned material can basically provide high-resolution information about the bacteria-cell interaction. Specimens are fixed with 3% glutaraldehyde in 0.1 M sodium cacodylate buffer, post-fixed in 1% osmium tetroxide, dehydrated through a series of graded ethanol (70, 90, and 100%) and propylene oxide solutions and embedded in Araldite. Semi-thin sections are stained with 1% toluidine blue for light microscope examination and ultra-thin sections are stained with uranyl acetate and lead citrate and examined under TEM (Fig. 3). More details and some important considerations about these techniques can be found in Knutton [126]. Negative Staining Negative staining is a very useful technique to characterize fimbrial structures. It consists in surrounding the specimen in a thin film of heavy metal stain. As a result the specimen appears in a lighter tone against a dark background. In this method, a concentrated bacterial suspension is mixed with the negative stain (usually, ammonium molibdate, or aqueous uranyl acetate), and bacitracin in the same proportion. This mixture is applied onto a carbon-coated copper grid, and after 2 min the excess of liquid in the preparation is carefully removed with a filter paper. This material is analyzed under TEM (Fig. 3). More details about this technique, as well as some important considerations regarding this method can also be found in Knutton [126]. Immunogold Labeling This method is nothing else but an indirect immunolabeling method performed with the use of antibodies conjugated with coloidal gold particles, which is available in different sizes. It can be used combined with the negative staining, TEM or SEM methods to localize specific antigens [126] (Fig. 3).

B

A

C

D

Figure 3: Images obtained by SEM (A) and TEM (B-E). (A) and (B) show aspects of results obtained in adherence assays respectively performed using IVOC (colonic biopsy fragment) and in vitro cell culture (T84 intestinal epithelial cell line) methods. (C) shows the aspect of an E. coli observed under TEM after negative staining with 2% aqueous uranyl acetate. Arrows indicate fimbrial ( ) and flagellar ( ) structures. (D) Immunogold labeling combined with negative staining. Coloidal gold particles (black dots) are specifically attached to the EspA filament of an EPEC strain. Bars: (A) 10 m; (B-D) 0.2 m.

Biofilm forMation The study of biofilm formation can be also important to characterize some E. coli strains belonging to EAEC and EPEC categories as well as to understand their role during bacterial colonization; therefore, several methods to study and detect biofilm formation have been developed. Albert et al. [127] reported that EAEC strains were associated with clump formation when the samples were cultured in Mueller-Hinton broth under agitation, suggesting that this simple, fast and inexpensive test could be routinely used for EAEC identification.

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 107

The biofilm formation can be also assessed in 24-well culture dishes with or without glass coverslips in which overnight bacterial cultures grown in static conditions are inoculated into fresh medium. After incubation for different periods of time at 37°C in a CO2 atmosphere, the biofilm is fixed with methanol, stained with Giemsa or 0.5% crystal violet stain, and examined under light microscope [128, 129]. If the biofilm is fixed with formalin and stained with immunofluorescence methods, the preparations can also be analyzed by confocal microscopy. Biofilm formation can also be quantified by spectrophotometry or by calculating the CFU of the test strain on L agar plates. For spectrophotometrical quantification, ethanol is added to the biofilm formation stained with crystal violet. After solubilization, the suspension is transferred to a microtitre plate and the absorbance determined at 570 nm [128]. For the quantification by CFU counts, the biofilm in 24-well culture plates are washed with PBS, lysed with 1% Triton X-100 in PBS, and plated in serial dilutions onto LB agar plates [129]. In flow cell chamber biofilm assays, biofilms are grown in flow chambers with a defined minimal medium as substrate and the strains are tagged with the green fluorescent protein. Bacterial sample is injected in the system, which is immediately closed upstream to allow the initial attachment. After the initial attachment, the flow is reestablished in a constant speed, and the biofilm formation photographed every 12-24 h using epifluorescence or confocal laser microscope. The images are analyzed by specific softwares, which give the possibility to generate simulated three-dimensional images or calculate the mean thickness of the biofilm [129, 130]. SUBTYPING METHODS Several basic criteria such as typeability, reproducibility, discriminatory power, as well as other important characteristics, such as availability, cost, technical requirements (e.g., type of equipment, personnel and difficulty of interpreting results) and speed to get results, should be taken into account to choose the typing method [131]. The emergence of EHEC as a recognized pathogen and the rapid increase in numbers of reports involving human EHEC infections in the last decades have become a public health problem, leading to a consequent standardization of the molecular epidemiology techniques used worldwide. As part of these surveillance strategies, PulseNet standardized the PFGE and MLVA protocols [132, 133]. Although diarrheagenic E. coli subtyping techniques were mainly described for EHEC strains, they have been also applied to investigate outbreaks and sporadic cases of ETEC, EPEC and EAEC infections [134, 135, 136, 137]. Pulsed Field Gel Electrophoresis (PFGE) For Subtyping O157 and Non-O157 STEC Strains This technique is based on the use of macrorestriction enzymes that recognize few sites along the chromosome, generating large DNA fragments (10-800 kb) that can not be separated by conventional electrophoresis. The use of periodically changed (pulsed) orientation of the electric field across the gel allows DNA fragments on the order of megabase pairs in size, to be effectively separated. Different protocols have been described for E. coli O157 [132, 138, 139]. Currently, PFGE is performed following protocols standardized for PulseNet International for E. coli O157 subtyping, using XbaI enzyme and BlnI as second enzyme [132]. Equipments and software should be used accordingly. Dice coefficient is used to calculate the similarity matrix for distance methods and a dendogram can be produced from the distance matrix by unweighted pair groups using mathematical averages (UPGMA) with 1.5% tolerance values for the standardized analysis. The analysis of these patterns is visually confirmed. PFGE allows rapid comparison of isolates from different locations and determine the common source of infection to prevent further spread of the infection. Multilocus Variable Number of Tandem Repeat Analysis (MLVA). All bacterial genomes contain multiple loci of repetitive DNA, including genes or intergenic regions, which may be variable among strains with respect to the number of repeat units present or their individual primary structures. These so-called “variable number of tandem repeat regions” (VNTR) have been identified in essentially all prokaryotic and eukaryotic species and have been successfully used for identification purposes. The experimental assessment of this variability for a number of different loci has been called “multilocus variable number of tandem repeat analysis” (MLVA). This technique is a modern, timely and versatile bacterial typing methodology. [140]. For

108 Pathogenic Escherichia coli in Latin America

Piazza et al.

E. coli, the repeat mutation mechanisms have been studied [141], and a standardized MLVA for E. coli O157 protocol has been validated to be used as a subtyping method [133]. Multilocus Sequence Typing (MLST) Multilocus Sequence Typing (MLST), developed by Maiden et al. [142], is a very recent technique that is gaining popularity among researchers, due to its reproducibility, standardization, satisfactory discriminatory power and easiness of interpretation for both evolutionary and epidemiological studies [143, 144, 145]. The drawback of MLST is, of course, its high cost, and the requirement for specific equipments essential for its execution. Electronic databases containing the allelic profiles of countless strain types can be readily consulted on the internet, unifying and standardising global epidemiology data. In fact, such a database already exists and is accessible at the URL http//www.mlst.net. This site also provides on-line softwares for sequence analysis. EcMLST, a multilocus sequence typing database system for pathogenic E. coli (http://www.shigatox.net) is also available on the internet. stx Genotyping The Stxs have been subdivided into two main families (Stx1 and Stx2), based on differences in cytotoxic neutralization assays with specific antiserum, and hybridization with molecular probes. Within the two groups, the subtypes Stx1 (stx1), Stx1c (stx1c), Stx1d (stx1d), Stx2 (stx2), Stx2c [stx2c (vh-a), stx2c (vh-b)], Stx2-O118 (stx2-O118), Stx2OX3a (stx2-Ox3a), Stx2d [stx2d, stx2d1(vh-a), stx2d2 (vh-b)], Stx2e (stx2e), Stx2f (stx2f) y Stx2g (stx2g) are identified, regarding to differences in antigenic variations, toxicity, capacity to be activated, the receptor binding and amino acid sequences. In the literature, different designation has been used for the same genes, causing confusion. However, Scheutz et al. [9] recently compiled data on the designation of the stx genes. There are different PCR protocols and PCR-restriction fragment length polymorphism (RFLP) protocols for detection of stx genes [146, 147]. Shiga toxin genotyping, used to identify the stx variants genes of Stx1 and Stx2, usually has limited value by itself, but can add useful information when combined with other tests for epidemiological and clinical purposes. eae Genotyping The eae gene has been cloned and sequenced from C. rodentium and from different E. coli strains, including EPEC or EHEC isolates from human, calf, dog, pig, and rabbit sources. The overall pattern for these sequences shows a highly conserved N-terminal region, and variability in the last C-terminal 280 amino acids of the intimin, where the binding to the enterocytes and Tir occurs [24]. Seventeen variants of the eae gene, classified as 1, 2, , , θ, , , , , , , (1), (2), (1), (2), (1) and (2), have been described. [89, 148, 149, 150, 151, 152]. Although, some variants (,  and ) were equally called by Ramachandran et al. [151] and Blanco et al. [152], the sequences described for each one of them are different. Different specific PCR assays with oligonucleotide primers complementary to the 3´end of the specific intimin genes that encode the intimin types have been used [151, 152]. A better characterization of the variable 3´end C-terminal of eae in a large collection of STEC and EPEC strains of different origins may provide PCR tools for predicting the ability of E. coli of ruminant source to cause severe disease in humans. Phage Typing Phage typing is one of the first methods applied to bacteria subtyping before the development of molecular techniques. Standardized protocols by Ahmed et al. [153] and extended by Kahkhria et al. [154] can be used for phage typing of O157:H7 strains. For E. coli O157:H7, a panel of 16 lytic phages is used and according to the lytic pattern, 87 different phagetypes have been described so far. This method has been applied to epidemiological investigations of infections caused by E. coli O157:H7 in order to trace the source of the infection, the mode of transmission of the disease, and to differentiate a sporadic case from others involved in an outbreak. It is relatively simple and less expensive than the PFGE and it can be applied to a large number of isolates. Phage typing can be used with other more discriminatory typing methods such as PFGE. However, their use is limited to reference laboratories due to difficulties with the preparation and maintenance of the phage panel.

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 109

SERODIAGNOSIS OF STEC INFECTIONS Several methods with different specificity, sensitivity and complexity were described for serology: assays in cell cultures that are used to measure neutralizing anti-Stx antibodies [155], ELISA for detecting antibodies directed against the LPS [156], immunoblotting to detect antibodies against LPS, Stx [157, 158, 159], enterohemolysin [160], outer membrane proteins [161] and passive hemagglutination assays [162] for the detection of antibodies anti-LPS. The development of serological techniques made possible the detection of STEC infection in patients with severe disease or HUS, especially when the pathogen can not be detected. In epidemiological studies, this method has been useful for identification of human STEC infection susceptibilily, for establishing prevention and infection control strategies, and for the selection of immunogenic proteins to be used in vaccine formulations. REFERENCES [1] [2] [3] [4] [5]

[6]

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17]

[18] [19] [20] [21]

Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-01. Kaper JB, Nataro JP, Mobley HLT. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123-40. CDC. Recommendations for collection of laboratory specimens associated with outbreaks of gastroenteritis. MMWR. 1990;39:2-3. Ewing WH. The Genus Escherichia. In: Edwards PR, Ewing WH, Eds. Edwards and Ewing’s Identification of Enterobacteriaceae. New York: Elsevier Science Publishing Co. Inc. 1986;p93–22. Bopp CA, Brenner FW, Fields PI, Wells JG, Strockbine NA. Escherichia, Shigella, and Salmonella. In: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH, Eds. Manual of Clinical Microbiology - 8th edition. Washington, DC, ASM Press 2003. Chapman PA, Siddons CA. A comparison of immunomagnetic separation and direct culture for the isolation of Verocytotoxin-producing Escherichia coli 0157 from cases of bloody diarrhoea, non-bloody diarrhoea and asymptomatic contacts. J Med Microbiol. 1996;44:267-71. Abbott SL, Connor JO, Robin T, Zimmer BL, Janda JM. Biochemical properties of a newly described Escherichia species, Escherichia albertii. J Clin Microbiol. 2003;41:4852-4. Huys G, Cnockaert G, Janda JM, Swings J. Escherichia albertii sp. nov., a diarrhoeagenic species isolated from stool specimens of Bangladeshi children. Int J Syst Evol Microbiol. 2003;53:807-10. Scheutz F, Strockbine NA. Escherichia. In: Garrity GM., Ed. Bergey´s Manual of Systematic Bacteriology. New York: Springer. 2005;p607-24. World Health Organization. Programme for control of diarrhoeal diseases (CDD/83.3 Rev.1). In: Manual for laboratory investigation of acute enteric infections. Geneva: World Health Organization. 1987;p27. Ørskov F, Ørskov I. Escherichia coli serotyping and disease in man and animals. Can J Microbiol. 1992;38:699-04. Beutin L, Gleier K, Kontny I, Echeverria P, Scheutz F. Origin and characteristics of enteroinvasive strains of Escherichia coli (EIEC) isolated in Germany. Epidemiol Infect. 1997;118:199–05. Ørskov I, Wachsmuth IK, Taylor DN, et al. Two new Escherichia coli O groups: O172 from ‘‘Shiga-like’’ toxin IIproducing strains (EHEC) and O173 from enteroinvasive E. coli (EIEC). APMIS. 1991;99:30-2. Matsushita S, Yamada S, Kai A, Kudoh Y. Invasive strains of Escherichia coli belonging to serotype O121:NM. J Clin Microbiol. 1993;31:3034-5. Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee Kr. Rapid and specific detection of verotoxin genes in Escherichia coli by the polymerase chain reaction. J Clin Microbiol. 1990;28:540-5. Gannon VP, Rashed M, King RK, Thomas EJ. Detection and characterization of the eae gene of Shiga-like toxinproducing Escherichia coli using polymerase chain reaction. J Clin Microbiol. 1993;31:1268-74. Sethabutr O, Venkatesan M, Murphy GS, Eampokalp B, Hoge CW, Echeverria P. Detection of Shigella and enteroinvasive E. coli by amplification of the invasion plasmid antigen H DNA sequence in patients with dysentery. J Infect Dis. 1993;167:458-61. Gunzburg TS, Tornieporth GN, Riley WL. Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundle-forming pilus gene. J Clin Microbiol. 1995;33:1375-7. Schmidt H, Kmnop C, Franke S, Aleksic S, Heesemann J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:701-5. Stacy-Phipps S, Mecca JJ, Weiss JB. Multiplex PCR assay and simple preparation method for stool specimes detect enterotoxigenic Escherichia coli DNA during course of infection. J Clin Microbiol. 1995;33:1054-9. Toma C, Lu Y, Higa N, et al. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol. 2003;41:2669-71.

110 Pathogenic Escherichia coli in Latin America

[22] [23]

[24] [25]

[26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38]

[39] [40] [41] [42] [43] [44] [45] [46] [47]

Piazza et al.

Vidal R, Vidal M, Lagos R, Levine M, Prado V. Multiplex PCR for diagnosis of enteric infetions associated with diarrheagenic Escherichia coli. J Clin Microbiol. 2004;42:1787-9. Aranda KR, Fabbricott SH, Fagundes-Neto U, Scaletsky IC. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive, and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol Lett. 2007;267:145-50. Karch H, Böhm H, Schmidt H, Gunzer F, Aleksic S, Heesemann J. Clonal structure and pathogenicity of Shiga-like toxinproducing, sorbitol-fermenting Escherichia coli O157:H-. J Clin Microbiol. 1993;31:1200-5. Franke, J, Franke S, Schimidt H, et al. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994;32:2460-3. Leotta GA, Chinen I, Epszteyn S, et al. Validation of a multiplex PCR for detection of Shiga toxin-producing Escherichia coli. Rev Argent Microbiol. 2005;37:1-10. Paton AW, Paton JC. Detection and characterization of Shiga toxingenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA enterohemorrhagic E.coli hlyA, rfbO111, and rfb O157. J Clin Microbiol. 1998;36:598-02. Cerna JF, Nataro JP, Estrada-Garcia T. Multiplex PCR for detection of three plasmid-borne genes of enteroaggregative Escherichia coli strains. J Clin Microbiol. 2003;41:2138-40. Cordeiro F, Pereira DG, Rocha MR, et al. Evaluation of a multiplex PCR for identification of enteroaggregative Escherichia coli. J Clin Microbiol. 2008;46:828-9. Antikainen J, Tarkka E, Haukka K, et al. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. Eur J Clin Microbiol. 2009;28:899-08. Monteiro BT, Campos LC, Sirci MP, et al. The dispersin-enconding gene (aap) is not restricted to enteroaggregative Escherichia coli. Diag Microbiol Infect Dis. 2009;65:81-4. Vidal M, Kruger E, Durán C, et al. Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol. 2005;43:5362-5. Guion CE, Ochoa TJ, Walker CM, et al. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and Real-Time multiplex PCR. J Clin Microbio 2008;46:1752-7. Sambrook JEF, Russel DW. Molecular cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press 2001. Moseley SL, Huq I, Alim ARMA, et al. Detection of enterotoxigenic E. coli by DNA colony hybridization. J Infect Dis. 1980;142:892-8. Nataro JP, Baldini MM, Kaper JB, et al. Detection of an adherence factor of enteropathogenic E. coli with a DNA probe. J Infect Dis. 1985;152:560-5. Pickett CL, Twiddy EM, Belisle WB, et al. Cloning of genes that encode a new heat-labile enterotoxin of Escherichia coli. J Bacteriol. 1986;165:348-53. Small PLC, Falkow S. Development of a DNA probe for the virulence plasmid of Shigella spp and enteroinvasive E. coli. In: Leive L, Bonventre PF, Morello JA, Silver SD, Wu WC, Eds. Microbiology. Washington, DC: American Society for Microbiology. 1986;p121-4. Levine MM, Xu J, Kaper JB, et al. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J Infect Dis. 1987;156:175-82. Newland JM, Neil RJ. DNA probes for Shiga-like toxins I and II and for toxin- converting bacteriophages. J Clin Microbiol. 1988;26:1292-7. Bilge SS, Clausen CR, Lau W, et al. Molecular characterization of a fimbrial protein, F1845, mediating diffuse adherence of diarrhea associated E. coli to HEp-2 cells. J Bacteriol. 1989;171:4281-9. Baudry B, Savarino SJ, Vial P, et al. A sensitive and specific DNA probe to identify enteroaggregative E. coli, a recently discovered diarrheal pathogen. J Infect Dis. 1990;161:1249-51. Jerse AE, Yu J, Tall BD, et al. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesion on tissue culture cells. Proc Natl Ac Sci. USA. 1990;87:7839-43. Girón JA, Ho ASY, Schoolnik GK. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science. 1991;254:710–3. Gomes TA, Vieira MA, Wachsmuth IK, et al. Serotype-specific prevalence of Escherichia coli strains with EPEC adherence factor genes in infants with and without diarrhea in São Paulo, Brazil. J Infect Dis. 1989;160:131-5. Gomes TA, Rassi V, MacDonald KL, et al. Enteropathogens associated with acute diarrheal disease in urban infants in São Paulo, Brazil. J Infect Dis. 1991;164:331-7. Gomes TAT, Vieira MAM, Abe CM, et al. Adherence patterns and adherence-related DNA sequences in Escherichia coli isolates from children with and without diarrhea in São Paulo City, Brazil. J Clin Microbiol. 1998;36:3609-13.

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

[48] [49] [50] [51] [52] [53] [54] [55] [56] [57]

[58] [59] [60] [61] [62]

[63]

[64] [65] [66] [67]

[68] [69] [70] [71] [72] [73]

Pathogenic Escherichia coli in Latin America 111

Scaletsky ICA, Fabbricotti SH, Carvalho RL, et al. Diffusely adherent Escherichia coli as a cause of acute diarrhea in young children in Northeast Brazil: a case-control study. J Clin Microbiol. 2002;40:645–8. Irino K, Dias AMG, Kano E, et al. Metabolism of phenylpropionic acid in enteropathogenic Escherichia coli belonging to serogroup O111 and its application for diagnosis. FEMS Microbiol Lett. 2001;204:105-10. Guth BEC, Gomes TAT, Vaz TMI, et al. Inability to decarboxylate lysine as a presumptive marker to identify Shiga toxinproducing Escherichia coli strains of serogroup O111. J Clin Microbiol. 2003;41:3450. Beutin L, Montenegro MA, Orskov I, et al. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol. 1989;27:2559-64. Smith CJ, Kaper JB, Mack DR. Intestinal mucin inhibits adhesion of human enteropathogenic Escherichia coli to HEp-2 cells. J Pediatr Gastroenterol Nutr. 1995;21:269-76. Bielaszewska M, Fell M, Greune L, et al. Characterization of cytolethal distending toxin genes and expression in Shiga toxin-producing Escherichia coli strains of non-O157 serogroups. Infect Immun. 2004;72:1812-6. Paton AW, Srimanote P, Talbot UM, et al. A new family of potent AB5 cytotoxins produced by Shiga toxigenic Escherichia coli. J Exp Med. 2004;200:35-46. Nicholls L, Travis HG, Robins-Browne RM. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol. 2000;35:275–88. Tarr PI, Bilge SS, Vary JC, et al. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect Immun. 2000;68:1400–7. Paton AW, Srimanote P, Woodrow MC, et al. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga toxingenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69:6999-09. Tatsuno I, Horie M, Abe H, et al. toxB Gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660–9. Doughty S, Sloan J, Bennet-Wood V, et al. Identification of a novel fimbrial gene related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect Immun. 2002;70:6761-9. Savarino SJ, Fasano A, Watson J, et al. Enteroaggregative Escherichia coli heat-stable enterotoxin I represents another subfamily of E. coli heat-stable toxin. Proc Natl Acad Sci. USA. 1993;90:3093-7. Wolf MK. Occurrence, distribution, and associations of O and H serogroups, colonization factor antigens, and toxins of enterotoxigenic Escherichia coli. Clin Microbiol Rev. 1997;40:569–84. Scheutz F, Cheasty T, Woodward D, et al. Designation of O174 and O175 to temporary O groups OX3 and OX7, and six new E. coli groups that include verocytotoxin producing E. coli (VTEC): O176, O177, O178, O179, O180 and O181. APMIS. 2004;112:569-84. Scheutz F, Fruth A, Caprioli A, et al. Five new E. coli O groups that include verocttotoxin-producing E. coli (VTEC). 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli Infections; 2009: Buenos Aires, Buenos Aires: Asociación Argentina de Microbiología. 2009;p109. Reeves PR, Hobbs M, Valvano MA, et al. Bacterial polysaccharide synthesis and gene nomenclature. Trends Microbiol. 1996;4:495-03. Coimbra RS, Grimont F, Lenormand P, et al. Identification of Escherichia coli O-serogroups by restriction of the amplified O-antigen gene cluster (rfb-RFLP). Res Microbiol. 2000;151:639–54. DebRoy C, Fratamaico PM, Roberts E, et al. Development of PCR assays targeting genes in O-antigen gene clusters for detection and identification of Escherichia coli O45 and O55 serogroups. Appl Environ Microbiol. 2005;71:4919-24. Fields PI, Blom KH, Hughes JH, et al. Molecular characterisation of the gene encoding H antigen in Escherichia coli and development of PCR-restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. J Clin Microbiol. 1997;35:1066–70. Machado J, Grimont F, Grimont PAD. Identification of Escherichia coli flagellar types by restriction of amplified fliC gene. Res Microbiol. 2000;151:535–46. Evans DG, Evans Jr, DJ, Pierce NF. Differences in the response of rabbit small intestine to heat-labile and heat-stable enterotoxins of Escherichia coli. Infect Immun. 1973;7:873-80. Dean AG, Ching YC, Williams RG, et al. Test for Escherichia coli enterotoxin using infant mice: application in a study of diarrhea in children in Honolulu. J Infect Dis. 1972;125:407-11. Serény B. Experimental Shigella keratoconjuntivitis. Acta Microbiol Acad Sci. 1955;2:293-6. Robins-Browne RM, Bennett-Wood V. Quantitative assessment of the ability of Escherichia coli to invade cultured animal cells. Microb Pathog. 1992;12:159–64. Donta ST, Moon HW, Whipp SC. Detection of heat-labile Escherichia coli enterotoxin with the use of adrenal cells in tissue culture. Science. 1974;183:334–6.

112 Pathogenic Escherichia coli in Latin America

[74]

[75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88]

[89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99]

Piazza et al.

Guerrant RL, Brunton LL, Schnaitman TC, et al. Cyclic adenosine monophosphate and alteration of Chinese hamster ovary cell morphology: a rapid, sensitive in vitro assay for the enterotoxins of Vibrio cholerae and Escherichia coli. Infect Immun. 1974;10:320–7. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11:450-79. Cravioto A, Gross RJ, Scotland SM, et al. An adhesive factor found in strains of Escherichia coli belonging to the traditional infantile enteropathogenic serotypes. Curr Microbiol. 1979;3:95-9. Scaletsky ICA, Silva ML, Trabulsi LR. Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect Immun. 1984;45:534–36. Nataro JP, Kaper JB, Robins-Browne R, et al. Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis J. 1987;6:829-31. Rodrigues J, Scaletsky ICA, Campos LC, et al. Clonal structure and virulence factors in strains of Escherichia coli of the classic serogroup O55. Infect Immun. 1996;64:2680-6. Giannella RA, Drake KW, Luttrell M. Development of a radioimmunoassay for Escherichia coli heat-stable enterotoxin. Infect Immun. 1981;33:186–92. Cryan B. Comparison of three assay systems for detection of enterotoxigenic Escherichia coli heat-stable enterotoxin. J Clin Microbiol. 1990;28:792–4. Menezes CA. Detection of Escherichia coli producing ST-I and LT-I by monoclonal antibodies. Master Thesis. Biomedical Science Institute, University of São Paulo; 2002:p76. Qadri F, Svennerholm AM, Faruque ASG, et al. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev. 2005;18:465-83. Menezes CA, Imamura SY, Trabulsi LR, et al. Production, characterization, and application of antibodies against heatlabile type-I toxin for detection of enterotoxigenic Escherichia coli. Mem Inst Oswaldo Cruz. 2006;101:875-80. Menezes CA, Gonçalves DS, Amianti J, et al. Capture immunoassay for LT detection produced by enterotoxigenic Escherichia coli in bacterial isolates. Braz J Microbiol. 2003;34:11-3. Abe CM, Trabulsi LR, Blanco J, et al. Virulence features of atypical enteropathogenic Escherichia coli identified by the eae+ EAF-negative stx-genetic profile. Diagn Microbiol Infect Dis. 2009;64:357–65. Hernandes RT, Elias WP, Vieira AM, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2009;297:137–49. Nara JM, Cianciarullo AM, Culler HF, et al. Differentiation of typical and atypical enteropathogenic Escherichia coli using colony immunoblot for detection of bundle-forming pilus expression. J Appl Microbiol. 2009 Nov 14. Available from: http://www3.interscience.wiley.com/journal/122684576/abstract. Adu-Bobie J, Frankel G, Bain C, et al. Detection of intimins α, β, γ, and δ, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol. 1998;36:662-8. Batchelor M, Knutton S, Caprioli A, et al. Development of a universal intimin antiserum and PCR primers. J Clin Microbiol. 1999;37:3822–7. Koga PCM, Menezes CA, Lima FA, et al. Polyclonal anti-intimin antibody: immunological characterization and its use in EPEC diagnosis. Braz J Microbiol. 2003;34:5–7. Menezes MA, Rocha LB, Koga PCM, et al. Identification of enteropathogenic and enterohaemorrhagic Escherichia coli strains by immunoserological detection of intimin. J Appl Microbiol. 2010;108:878-87. Lu Y, Toma C, Honma Y, et al. Detection of EspB using reversed passive latec agglutination: application to determination of enteropathogenic Escherichia coli. Diagn Microbiol Infect Dis. 2002;43:7-12. Nakasone N, Toma C, Lu Y, et al. Development of a rapid immunochromatographic test to identify enteropathogenic and enterohemorrhagic Escherichia coli by detecting EspB. Diagn Microbiol Infec Dis. 2007;57:21-5. Girón JA, Qadri F, Azim T, et al. Monoclonal antibodies specific for the bundle-forming pilus of enteropathogenic Escherichia coli. Infect Immun. 1995;63:4949–52. Gismero-Ordoñez J, Dall’agnol M, Trabulsi LR, et al. Expression of the bundle-forming pilus by enteropathogenic Escherichia coli strains of heterologous serotypes. J Clin Microbiol. 2002;40:2291–6. Bettelheim KA, Beutin L. Rapid laboratory identification and characterization of verocytotoxigenic (Shiga toxin producing) Escherichia coli (VTEC/STEC). J Appl Microbiol. 2003;95:205–20. Donohue-Rolfe A, Kelley MA, Bennish M, et al. Enzyme-linked immunosorbent assay for Shigella toxin. J Clin Microbiol. 1986;24:65–8. Kongmuang U, Honda T, Miwatani T. Enzyme-linked immunosorbent assay to detect Shiga toxin of Shigella dysenteriae and related toxins. J Clin Microbiol. 1987;25:115–8.

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 113

[100] Beutin L, Zimmermann S, Gleier K. Rapid detection and isolation of Shiga-like toxin (verocytotoxin)-producing Escherichia coli by direct testing of individual enterohemolytic colonies from washed sheep blood agar plates in the VTEC-RPLA assay. Clin Microbiol. 1996;34:2812-4. [101] Mackenzie AMR, Lebel P, Orrbine E, et al. Sensitivities and specificities of premier E. coli O157 and premier EHEC enzyme immunoassays for diagnosis of infection with verotoxin (Shiga-like toxin) producing Escherichia coli. J Clin Microbiol. 1998;36:1608–11. [102] Novick TJ, Daly JA, Mottice SL, et al. Comparison of sorbitol MacConkey agar and a two-step method which utilizes enzyme-linked immunosorbent assay toxin testing and a chromogenic agar to detect and isolate enterohemorrhagic Escherichia coli. J Clin Microbiol. 2000;38:547–51. [103] Beutin L, Zimmermann S, Gleier K. Evaluation of the VTEC-Screen "Seiken" test for detection of different types of Shiga toxin (verotoxin)-producing Escherichia coli (STEC) in human stool samples. Diagn Microbiol Infect Dis. 2002;42:1-8. [104] Beutin L, Steinrück H, Krause G, et al. Comparative evaluation of the Ridascreen® Verotoxin enzyme immunoassay for detection of Shiga-toxin producing strains of Escherichia coli (STEC) from food and other sources. J Appl Microbiol. 2007;102:630–9. [105] Gould LH, Bopp C, Strockbine N, et al. Recommendations for diagnosis of Shiga toxin-producing Escherichia coli infections by clinical laboratories. MMWR Recomm Rep. 2009;58:1-14. [106] Mendes-Ledesma MR, Rocha LB, Bueris V, et al. Production and characterization of rabbit polyclonal sera against Shiga toxins Stx1 and Stx2 for detection of Shiga toxin-producing Escherichia coli. Microbiol Immunol. 2008;52:484–91. [107] Pal T, Pacsa AS, Emody L, et al. Modified enzyme-linked immunosorbent assay for detecting enteroinvasive Escherichia coli and virulent Shigella strains. J Clin Microbiol. 1985;21:415-8. [108] Floderus E, Pal T, Karlson K, et al. Identification of Shigella and enteroinvasive Escherichia coli strains by a virulencespecific, monoclonal antibody-based enzyme immunoassay. Eur J Clin Microbiol Infec Dis. 1995;14:111-7. [109] Pal T, Al-Sweih AN, Herpay M, et al. Identification of enteroinvasive Escherichia coli and Shigella strains in pediatric patients by IpaC-specific enzyme-linked immunosorbent assay. J Clin Microbiol. 1997;35:1757-60. [110] Szakál D, Schneider G, Pal T. A colony blot immune assay to identify enteroinvasive Escherichia coli and Shigella in stool samples. Diagn Microbiol Infect Dis. 2003;45:165-71. [111] Sethabutr O, Venkatesan M, Yam S, et al. Detection of PCR products of the ipaH gene from Shigella and enteroinvasive Escherichia coli by enzyme linked immunosorbent assay. Diagn Microbiol Infect Dis. 2000;37:11-6. [112] Navarro-Garcia F, Eslava C, Villaseca JM, et al. In vitro effects of a high–molecular-weight heat-labile enterotoxin from enteroaggregative Escherichia coli. Infect Immun. 1998;66:3149–54. [113] Vilhena-Costa AB, Piazza RMF, Nara JM, et al. Slot blot immunoassay as a tool for plasmid-encoded toxin detection in enteroaggregative Escherichia coli culture supernatants. Diagn Microbiol Infect Dis. 2006;55:101-6. [114] Nataro JP, Scaletsky IC, Kaper JB, et al. Plasmid-mediated factors conferring diffuse and localized adherence of enteropathogenic Escherichia coli. Infect Immun. 1985;48:378-83. [115] Czeczulin JR, Whittam TS, Henderson IR, et al. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichai coli. Infect Immun. 1999;67:2692-9. [116] Sankaran K, Banerjee S, Pavankumar AR, et al. Apyrase-based colorimetric test for detection of Shigella and enteroinvasive Escherichia coli in stool. Diagn Microbiol Infect Dis. 2009;63:243-50. [117] Bhargava T, Datta S, Ramachandran R, et al. Virulent Shigella codes for a soluble apyrase: identification, characterization and cloning of the gene. Current Science. 1995;68:293-00. [118] Moreira CG, Carneiro SM, Nataro JP, et al. Role of type I fimbriae in the aggregative adhesion pattern of enteroaggregative Escherichia coli. FEMS Microbiol Lett. 2003;226:79-85. [119] Knutton S, Lloyd DR, McNeish AS. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect Immun. 1987;55:69–77. [120] Knutton S, Shaw RK, Bhan MK, et al. Ability of enteroaggregative Escherichia coli strains to adhere in vitro to human intestinal mucosa. Infect Immun. 1992;60:2083–91. [121] Labigne-Roussel AF, Lark D, Schoolnick G, et al. Cloning and expression of an afrimbrial adhesion (Afa-I) responsible for P blood group-independent, mannose-resistant hemagglutination from a pyelonephritic Escherichia coli strain. Infect Immun. 1984;46:251-9. [122] Labigne-Roussel AF, Falkow S. Distribution and degree of heterogeneity of the afimbrial-adhesin-enconding operon (afa) among uropathogenic Escherichia coli isolates. Infect Immun. 1988;56:640-8. [123] Goluszko P, Selvarangan R, Nowicki S, et al. Rapid receptor-clustering assay to detect uropathogenic and diarrheal Escherichia coli isolates bearing adhesins of the DR family. J Clin Microbiol. 2001;39:2317-20. [124] Knutton S, Baldwin T, Williams PH, et al. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 1989;57:1290-8.

114 Pathogenic Escherichia coli in Latin America

Piazza et al.

[125] Knutton S, Rosenshine I, Pallen MJ, et al. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 1998;17:2166-76. [126] Knutton S. Electron microscopical methods in adhesion. Meth Enzymol. 1995;253:145-58. [127] Albert MJ, Qadri F, Haque A, et al. Bacterial clump formation at the surface of liquid culture as a rapid test for identification of enteroaggregative Escherichia coli. J Clin Microbiol. 1993;31:1397–9. [128] Sheikh J, Hicks S, Dall’Agnol M, et al. Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol Microbiol. 2001;41:983–97. [129] Moreira CG, Palmer K, Whiteley M, et al. Bundle-forming pili and EspA are involved in biofilm formation by enteropathogenic Escherichia coli. J Bacteriol. 2006;188:3952–61. [130] Heydorn A, Ersbøll BK, Hentzer M, et al. Experimental reproducibility in flow-chamber biofilms. Microbiol. 2000;146:2409–15. [131] Maslow J, Mulligan ME. Epidemiologic typing systems. Infect Control Hosp Epidemiol. 1996;17:595-04. [132] Gerner-Smidt P, Scheutz F. Standardized pulsed-field gel electrophoresis of Shiga toxin-producing Escherichia coli: the PulseNet Europe feasibility study. Foodborne Pathog Dis. 2006;3:74-80. [133] Hyytia-Trees E, Lafon P, Vauterin P, et al. Multilaboratory validation study of standardized multiple-locus variablenumber tandem repeat analysis protocol for Shiga toxin–producing Escherichia coli O157: a novel approach to normalize fragment size data between capillary electrophoresis platforms. Foodborne Pathog Dis. 2010;7:1-8. [134] Afset JE, Bergh K, Bevanger L. High prevalence of atypical enteropathogenic Escherichia coli (EPEC) in Norwegian children with diarrhoea. J Med Microbiol. 2003;52:1015-9. [135] Regua-Mangia AH, Guth BC, da Costa Andrade JR, et al. Genotypic and phenotypic characterization of enterotoxigenic Escherichia coli (ETEC) strains isolated in Rio de Janeiro city, Brazil. FEMS Immunol Med Microbiol. 2004;40:155-62. [136] Blanco M, Blanco JE, Dahbi G, et al. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (muB and xiR/beta2B). J Med Microbiol. 2006;55:1165-74. [137] Oundo JO, Kariuki SM, Boga HI, et al. High incidence of enteroaggregative Escherichia coli among food handlers in three areas of Kenya: a possible transmission route of travelers' diarrhea. J Travel Med. 2008;15:31-8. [138] Barret TJ, Lior H, Green JH, et al. Laboratory investigation of a multistate food-borne outbreak of Escherichia coli O157:H7 by using pulsed-field gel electrophoresis and phage typing. J Clin Microbiol. 1994;32:3013-7. [139] Izumiya H, Terajima J, Wada A, et al. Molecular typing of enterohemorrhagic Escherichia coli O157:H7 isolates in Japan by using pulsed-field gel electrophoresis. J Clin Microbiol. 1997;35:1675-80. [140] van Belkum A. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol Med Microbiol. 2007;49:22-7. [141] Vogler AJ, Keys C, Nemoto Y, et al. Effect of repeat copy number on variable number tandem repeat mutations in Escherichia coli O157:H7. J Bacteriol. 2006;188:4253-63. [142] Maiden MC, Bygraves JA, Feil E, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci. USA. 1998;95:3140-5. [143] Reid SD, Herbelin CJ, Bumbaugh AC, et al. Parallel evolution of virulence in pathogenic Escherichia coli. Nature. 2000;406:64-7. [144] Noller AC, McEllistrem MC, Stine OC, et al. Multilocus sequence typing reveals a lack of diversity among Escherichia coli O157:H7 isolates that are distinct by pulsed-field gel electrophoresis. J Clin Microbiol. 2003;41:675-9. [145] Pitondo-Silva A, Minarini LA, Camargo IL, et al. Clonal relationships determined by multilocus sequence typing among enteropathogenic Escherichia coli isolated in Brazil. Can J Microbiol. 2009;55:672-9. [146] Bastian SN, Carle I, Grimont F. Comparison of 14 PCR systems for the detection and subtyping of stx genes in Shigatoxin-producing Escherichia coli. Res Microbiol. 1998;149:457-72. [147] Ziebell KA, Read SC, Johnson RP, et al. Evaluation of PCR and PCR-RFLP protocols for identifying Shiga toxins. Res Microbiol. 2002;153:289-00. [148] Oswald E, Schmidt H, Morabito S, et al. Typing of intimin genes in human and animal enterohemorrhagic and enteroropathogenic Escherichia coli: characterization of a new intimin variant. Infect Immun. 2000;68:64-71. [149] Zhang WL, Köeller B, Oswald E, et al. Genetic diversity of intimin genes of attatting and effacing Escherichia coli strains. J Clin Microbiol. 2002;40:4486-92. [150] Jores J, Zehmke K, Eichberg J, et al. Description of a novel intimin variant (type ζ) in the bovine O84:NM verotoxinproducing Escherichia coli strain 537/89 and the diagnostic value of intimin typing. Exp Biol Med. 2003;228:370-6. [151] Ramachandran V, Brett K, Hornitzky MA, et al. Distribution of intimin subtypes among Escherichia coli isolates from ruminant and human sources. J Clin Microbiol. 2003;41:5022-32.

Detection and Subtyping Methods of Diarrheagenic Escherichia Coli Strains

Pathogenic Escherichia coli in Latin America 115

[152] Blanco M, Schumacher S, Tasara T, et al. Serotypes, intimin variants and other virulence factors of eae positive Esherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-η2). BMC Microbiol. 2005;5:23. [153] Ahmed R, Bopp C, Borczyk A, et al. Phage-typing scheme for Escherichia coli O157:H7. J Infect Dis. 1987;155:808-9. [154] Khakhria R, Duck D, Lior H. Extended phage-typing scheme for Escherichia coli O157:H7. Epidemiol Infect. 1990;105:511-20. [155] Karmali MA, Petric M, Lim C, et al. The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis. 1985;151:775-82. [156] Caprioli A, Luzzi I, Rosmini F, et al. Hemolytic uremic syndrome and verocytotoxin-producing Escherichia coli infection in Italy. J Infect Dis. 1992;166:154-8. [157] Reymond D, Karmali MA, Clarke I, et al. Comparison of the western blot assay with the neutralizing-antibody and enzyme-linked immunosorbent assays for measuring antibody to verototoxin1. J Clin Microbiol. 1997;35:609-13. [158] Ludwing K, Karmali MA, Sarkim V, et al. Antibody response to Shiga toxins Stx2 and Stx1 in children with enteropathic hemolytic–uremic syndrome. J Clin Microbiol. 2001;39:2272-9. [159] Karmali MA, Mascarenhas M, Petric M, et al. Age-specific frequencies of antibodies to Escherichia coli verocytotoxins (Shiga toxins) 1 and 2 among urban and rural populations in Southern Ontario. J Infect Dis. 2003;188:1724-9. [160] Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995;63:1055-61. [161] Carbonare SB, Silva MLM, Palmeira P, et al. Human colostrums IgG antibodies reacting to enteropathogenic Escherichia coli (EPEC) antigens and their persistence in the faeces of breast-fed infant. J Diarrhoeal Dis Res. 1997;15:53-8. [162] Bitzan M, Karch H. Indirect hemagglutination assay for diagnosis of Escherichia coli O157 infection in patients with hemolytic-uremic syndrome. J Clin Microbiol. 1992;30:1174–8.

116

Pathogenic Escherichia coli in Latin America, 2010, 116-121

CHAPTER 8 Clinical Management of Escherichia coli Cases (The Latin America Experience) Horacio A Repetto* Department of Pediatrics, Faculty of Medicine, and Hospital Nacional Prof. A Posadas, University of Buenos Aires, Buenos Aires, Argentina Abstract: Shiga toxin--producing Escherichia coli (STEC) are a leading cause of bacterial enteric infections in the United States and have become a significant problem in several countries in Latin America. Prompt, accurate diagnosis of STEC infection is important because appropriate treatment early in the course of infection might decrease the risk for serious complications such as renal damage and improve overall patient outcome. This chapter provides a short review of the clinical experiences of a physician dealing with STEC and Hemolytic Uremic Syndrome patients in Argentina.

INTRODUCTION Enterohemorrhagic Escherichia coli (EHEC) is the vector which introduces the shiga toxin (ST) in the host organism. This toxin meets its receptor, globotriosilceramide (GB3) in the membrane of different cells and is internalized generating an endothelial lesion which results in systemic thrombosis of the microcirculation, thrombotic microangiopathy (TMA) (Figs. 1 and 2), developing a group of clinical and laboratory symptoms and signs called the hemolytic uremic syndrome (HUS). Gasser et al. in 1955 reported 5 patients who presented with microangiopathic anemia - acute hemolysis, finding of fragmented erythrocytes (schystocytes, helmet cells), thrombocytopenia and acute renal injury, proteinuria, hematuria and/or increased serum creatinine [1]. However, the first report of a group of children who presented with diarrhea and developed HUS and acute renal failure was published by Gianantonio and his team [2] as part of a cohort of infants with acute renal failure treated by peritoneal dialysis. Two years later they reported a group of more than 50 children with HUS associated with a prodromal gastroenteritis [3] At that time, it became evident that this clinical entity was prevalent in Argentina and since 1996 its incidence has been systematically registered (see chapter Diarrheagenic Escherichia coli in Argentina, in this e-book), ranging between 450 and 500 new cases per year. More than 95 % of patients presented with the diarrheal (D+) form [4]; and when Karmali described its association with the infectious agent shiga toxin E. coli (VTEC or STEC) [5], its presence was documented in many cases [6-8].

Figure 1: Thrombotic microangiopathy (TMA), kidney (Phosphotungstic HE). TMA in a glomerulus from a girl with severe STEC HUS. A thrombus is seen in the arteriolocapillary region (ray) and clear deposits in the subendothelium. (arrow). Necropsy. (Courtesy of M. Mills, MD. Dept Pathology. Hosp Nac Prof A Posadas). *Address correspondence to: Horacio A Repetto, Hospital Nacional Prof. A Posadas, University of Buenos Aires, Buenos Aires, Argentina. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Clinical Management of Escherichia coli Cases

Pathogenic Escherichia coli in Latin America 117

Figure 2: Thrombotic microangiopathy, colon (Phosphotungstic H). Microthrombi in bowel. Idem as Fig 1. (Courtesy of M. Mills. MD, Dept Pathology. Hosp Nac Prof A Posadas).

NOSOLOGICAL CLASSIFICATION (Modified from [4]) HUS can be produced by many pathogenic mechanisms which lead to a Thrombotic microangiopathy. Table 1: Disease entities which can present with HUS. Etiopathogenic classification. ST (EHEC – Shigella) Neuraminidase (S. pneumoniae)

INFECTIOUS

D+ “Classic” Epidemic

C related: factor H (inh. act. AP) factor I (idem) MCP (cleaves C3b) CFB (hiper act) C3 (hiper act) vW multimers: ADAMTS 13

Recurrent & Tx Recurrent & Tx Recurrent Recurrent

FAMILIAL

Unknown. Probably genetic

AD - AR

IMMUNOL.

vW factor: ADAMTS 13 Ab C: Factor H Ab

Adult TTP

TOXIC

CyA – Tacrolimus - Sirolimus Mitomycin

SYSTEMIC DIS. & others

Cancer. Pregnancy. GNs. Tx rejection. Malignant HP

GENETIC

C: complement. MCP: membrane constitutive protein. vW: von Willebrandt. ADAMTS 13: vW protease. Tx: recurrent in renal transplant. TTP: thrombotic thrombocytopenic purpura. CyA: cyclosporin. GN: glomerulonephritides

Since the management, acute and chronic course and prognosis of the different entities is not similar, it has become very important to try to obtain an etiological diagnosis as soon as possible. Table 2. Initial LaboratoryTests.

Establishing Etiology Looking for Enterohemorragic E. coli (EHEC) [O157 H7 most common] Free Shiga toxin in stools Strain (lipopolysaccharide) y risk genes (eae, ehxA, stx) Serum antibodies anti-Stx and anti-lipopolysaccharide Look for other infectious agents (Shigella dysenteriae and S. pneumoniae) Serum Complement (C3, C4) FH (concentration and activity), FI, FB, MCP FvW activity, ADAMTS 13 activity, anti-protease (ADAMTS 13) Ab. Antiphospholipids Ab, LES

118 Pathogenic Escherichia coli in Latin America

Horacio A Repetto

STEC HUS D+ I will refer to the clinical management of this disease, based mostly in our experience in the Hospital Nacional Prof. A Posadas since 1973. Clinical Picture Patients have diarrhea, which may be bloody in 75% of the cases, and may have vomiting and fever for a few days, preceding the sudden onset of pallor and severe malaise. At this point, the parents may notice a decrease in urine output. Some infants may have depression of the Central Nervous System (CNS) and even convulsions. Laboratory studies disclose 2 main items: 1. acute microangiopathic anemia: low Hemoglobin, fragmented erythrocytes (“Schistocytes”) and thrombocytopenia; 2. If a urine sample can be obtained there are signs of glomerular involvement, hematuria with erythrocyte casts and proteinuria; and/or increased levels of serum creatinine and blood urea, showing the decrease in glomerular filtration rate [9]. Serum complement levels are generally normal and direct Coombs test negative. (These tests are useful to differentiate early from atypical complement alternative pathway deficiencies and pneumococcal HUS, which require a different management). During the acute course approximately 1/3 of patients may have involvement of the CNS, presenting a range of symptoms, going from change in sensorium (excitement or somnolence), focal signs, convulsions, and severe coma. Intestinal (generally colonic) necrosis is infrequent but can be as severe as to require surgical interventions. Hyperglycemia due to pancreatic insufficiency, cardiac involvement and hepatic failure are rare. [10] (Fig. 3). n=274 58%

Edema

Hipertension

52%

Anuria

52%

CNS S&S

34%

Purpura

33%

Convulsions

31% 7%

Cardiac failure

0%

20%

40%

60%

80%

Prevalence of symptoms & signs in the acute stage

Figure 3: Prevalence of signs and symptoms in the acute stage in 274 patients admitted for HUS.

Hypertension is detected in about half of the children. It follows two patterns: 1. short term course, associated to volume expansion and improving with salt restriction or with dialysis when indicated; 2. persistent, generally associated with renal isquemia in the presence of more severe lesions In Argentina HUS is the most frequent cause of acute renal failure (ARF) in children. HUS was diagnosed in 65% of 237 children admitted for ARF to our service [4]. Since patients suffer a hypercatabolic status they present 4 risks which may require aggressive dialytic treatment: 1. hypervolemia leading to hypertension, cardiac failure, pulmonary edema and encephalopathy; 2. hyperkalemia producing cardiac arrhythmias; 3. severe metabolic acidosis; and 4. hyponatremia (10% may present with hypernatremia) which may be associated with volume contraction due to the preceding diarrhea or may be dilutional due to the oligoanuria. Phil Tarr’s group presented evidence that the initial correction of the volume contraction is associatrd to a better course of the ARF [11]. In our experience, less than 1% of STEC HUS can have a very severe acute multisystemic form with high mortality, which requires aggressive treatment, including plasmapheresis [12]. This form has been reported with a higher

Clinical Management of Escherichia coli Cases

Pathogenic Escherichia coli in Latin America 119

frequency in different geografic areas, and its association with different strains and toxins is being studied. In Table 3, the management and control of STEC HUS in the acute stage is depicted.

Table 3 . Management of STEC+ HUS Public: control in reservoir & distribution of cattle products • PREVENTION Private: education through media, pediatricians & PC Phys • AVOID oral antibiotics & antimotility agents in bloody diarrhea • TREATMENT OF COMPLICATIONS: ARF, Fluid & Electrolyte, Acid – Base, Hypertension, Anemia, CNS

DIFFERENTIAL DIAGNOSIS The best differential sign is the documentation of microangiopathic anemia with the finding of schystocytes in the smear. Renal ultrasonography showing symmetrical enlargement of kidneys points against renal vein thrombosis, which is generally unilateral. Other signs are: Sepsis secondary to acute gastroenteritis (ARF and thrombocytopenia), Intussusception. (It can be an unusual complication of HUS), Reye’s syndrome (neurological symptoms and hyperazoemia), Acute renal vein thrombosis (ARF and thrombocytopenia). PROGNOSIS AND SEQUELAE [13] In STEC HUS, more than 95% of patients recover from the acute phase of the illness. Children usually die due to intercurrent infection or severe neurological, intestinal or myocardial complications associated with the more severe patterns of the systemic acute disease. In Argentina, after the introduction of early PD and a better care of nutrition and intercurrent infections mortality in acute stage has been maintained below 5 % since the 80’s. (Fig. 4).

16

1.5

14 12 10 8

%

5

6

3.5

4

4.7

4.3

2001

2004

3.2

1.8

2 0 1965

1973

1980

1990

2007

Figure 4: D+ HUD. Mortality in acute stage. A sharp decrease has been registered with the institution of early PD.

With modern methods of management of the fluid and electrolyte disorders and hypertension no patient should die due to these problems. Chronic lesions in other organs depend on the magnitude of the acute insult, since typically the disease mechanism is not persistent and it does not recur. CNS sequelae are infrequent, and chronic lesions in colon, pancreas and liver are reported occasionally. On the other hand, among the more than 95% of children recovering from the acute phase, approximately 38% have residual kidney involvement.

120 Pathogenic Escherichia coli in Latin America

Horacio A Repetto

The long term renal course depends on the intensity of the acute injury and the initial destruction of the nephron mass. STEC HUS, constitute a typical clinical model of an initial reduction of nephrons followed by hyperfunction of the residual renal mass [14]. During the acute phase, the presence and length of the anuria, the need for and duration of dialysis, the presence of persistent hypertension, and the magnitude of the extrarenal involvement (CNS, intestine), are signs associated with an increased risk of residual kidney lesion and progression to chronic renal insufficiency. Children should be followed with close control of growth and blood pressure, and laboratory determinations for glomerular filtration rate. They may have residual proteinuria after all these signs normalize. Persistence of proteinuria for more than 6 months after the acute stage is a risk sign for hyperfiltration due to the reduced renal mass, leading to progressive kidney fibrosis. In children recovering from the acute stage who normalized the Ccr, the presence of proteinuria after 1 year has been reported as the best predictor of long-term sequelae. Large groups of patients followed for more than 3 years after recovery of the acute period have shown that about 65% may have normal function, normal blood pressure and absence of proteinuria. Another 15% may have persistent proteinuria with or without hypertension but normal creatinine clearance. The remaining 20% will show chronic renal failure of different degrees [13, 15] (Fig. 5). 1. Normal SCr, no proteinuria

100

2. Normal SCr, proteinuria

n: 128 n: 118

n: 208

1

1

1 3

50

3 2 2

3

2

1 year 3 years > 10 years

Figure 5: Renal status at 1, 3 and > 10 years. Follow-up in children with diarrhea associated HUS. Group 1: normal Serum Creatinine (SCr), absence of proteinuria. Group 2: normal SCr, persistent proteinuria. Group 3: increased SCr, proteinuria [13, 15].

In the chronic stage treatment should point to decrease of proteinuria (with the inhibition of the angiotensin activity) and strict control of blood pressure [13] The treatment of choice for end-stage renal failure should be transplantation, since no recurrence occurs in the ST HUS and the long term course of the graft is similar to that of other non-immunological diseases [13, 16]. REFERENCES [1] [2] [3] [4] [5] [6]

Gasser VC, Gautier E, Steck A, et al. M Hämolytische-uramische syndrome: bilaterale nierenindennekrosen bei akuten erworbenen hamolytischen Anemia. Schweiz Med Wochensch. 1955;85:905-909. Gianantonio CA, Vitacco M, Mendilaharzu J, et al. Acute renal failure in infancy and childhood. Clinical course and treatment of forty-one patients. J Pediatr. 1962;611:660-678. Gianantonio C, Vitacco M, Mendiaharzu J, et al. The hemolytic-uremic syndrome. J Pediatr. 1964;64:478-49. Repetto HA. Epidemic hemolytic-uremic syndrome in children. Kidney Int. 1997;52:1708–1719 Karmali MA, Steele BT, Petric M, et al. Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing E. coli in stools. Lancet. 1983;1:619-620 De Cristofano MG, Fayad A, Ferraris J, et al. Sindrome urémico hemolItico de la infancia. Su relación con Ia presencia de verotoxina libre fecal. Arch Arg Pediatr. 1986;84:339-342

Clinical Management of Escherichia coli Cases

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16]

Pathogenic Escherichia coli in Latin America 121

Novillo A, Voyer L, Cravioto R, et al. Haemolytic uremic syndrome associated with faecal cytotoxin and verotoxin neutralizing antibodies. Pediatr Nephrol. 1988;2:288-290 Lopez EL, Diaz M, Grinstein S, et al. Hemolytic uremic syndrome and diarrhea in argentine children: the role of shiga like toxins. J Infect Dis. 1989;160:469-475 Centers for disease control and prevention. Case definitions for infectious conditions under national public health surveillance. MMWR. 1997;46(R-10):17. Gallo GE, Gianantonio CA. Extrarenal involvement in diarrhea associated haemolytic-uraemic syndrome. Pediatr Nephrol. 1995;9:117—119 Ake JA, Jelacic S, Ciol MA, et al. Relative nephroprotection during Escherichia coli O157:H7 infections: association with intravenous volume expansion. Pediatrics. 2005;115:e673–e680. Valles PG, Pesle S, Piovano L, et al. Postdiarrheal Shiga toxin-mediated hemolytic uremic syndrome similar to septic shock. Medicina (Bs Aires). 2005;65(5):395-401 Repetto HA. Long-term course and mechanisms of progression of renal disease in hemolytic uremic syndrome. Kidney International. 2005;68(Suppl 97):S102–S106 Tufro A, Arrizurieta E, Repetto HA. Renal functional reserve in children with a previous episode of hemolytic uremic syndrome. Pediatr Nephrol. 1991;5:184–188 Spizzirri FD, Rahman RC, Bibiloni N, et al. Childhood hemolytic uremic syndrome in Argentina: long-term follow-up and prognostic features. Pediatr Nephrol. 1997;11:156–160 Ferraris JR, Ramirez JA, Ruiz S, et al. Shiga toxin associated hemolytic uremic syndrome: Absence of recurrence after renal transplantation. Pediatr Nephrol 2002;17:809–814

122

Pathogenic Escherichia coli in Latin America, 2010, 122-141

CHAPTER 9 Host Responses to Pathogenic Escherichia coli Cristina Ibarra1 and Marina Palermo2* 1

Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires and 2Departamento de Inmunología, Academia Nacional de Medicina and ILEX-CONICET, Buenos Aires, Argentina Abstract: Pathogenic strains of Escherichia coli, including enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), and enterotoxigenic E. coli (ETEC), are responsible for a broad spectrum of diseases, which include local (intestinal) and systemic syndromes. In particular, infection with EHEC strains is also the leading cause of Hemolytic Uremic Syndrome (HUS), a systemic complication that affects to 5-10 % of EHEC infected children. These extracellular bacteria have the ability to intimately attach to the intestinal epithelium, flatten absorptive microvilli (effacement), and cause intestinal damage characterized by cellular necrosis, disruption of the epithelium, diarrhea and occasionally bleeding. The induction of these lesions depends on a type III secretion system (T3SS) encoded within the loci of enterocyte effacement (LEE). In case of EHEC strains, the expression of Shiga toxins (Stx) is one of the major pathogenic factors, which can modulate the severity of the intestinal damage, but also is responsible for HUS development. In thischapter we present and discuss new data helping to understand the role of Stx and the other bacterial pathogenic factors, as well as the involvement of host responses, in the evolution from gastrointestinal disease to systemic HUS complication.

EHEC/EPEC AND ETEC INTERACTION WITH HOST INTESTINE Pathogenic strains of Escherichia coli, including enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), and enterotoxigenic E. coli (ETEC) pose a significant public health risk, because these strains contaminate food and water supplies. The clinical spectrum of disease caused by these pathogens is remarkably broad. EPEC causes infantile diarrhea, which leads to dehydration, contributing to as many as 1 million infant deaths per year [13]. ETEC is an important pathogen responsible for secretory diarrhoea especially in children and adults living in developing countries and also the most common cause of traveler's diarrhea [4-5]. ETEC produces a heat labile enterotoxin (LT) and heat stable enterotoxin (ST), which are responsible for the clinical symptoms of ETEC infection, which can range from mild diarrhea to a severe cholera-like syndrome. Since the characteristics of ETECvirulence factors have been previously and thoroughly described [6-8], this chapter focuses on recent insights into the pathogenesis of EHEC and host response against them. Gastrointestinal infection with EHEC strains causes diarrhea and hemorrhagic colitis, and in addition is the leading cause of Hemolytic Uremic Syndrome (HUS), a systemic complication that is attributed to expression of Shiga toxins (Stx) [96,10], and characterized by a triad of hemolytic anemia, thrombocytopenia, and acute renal failure, that occurs predominantly in infants and young children [11]. Adherence, Invasion, and Colonization Although, Shiga toxin-producing E. coli (STEC), including EHEC strains, produce Stx as the major pathogenic factor to develop HUS, they also have putative virulence factors including adhesins, other toxins and proteases [12,13]. Because to cause infection STEC/EHEC must colonize the intestine, much work has focused on genes involved in bacterial attachment. In this regard, EPEC, EHEC and ETEC, and the murine pathogen Citrobacter rodentium, the well-established model of EPEC/EHEC infections [14], are classified as attaching and effacing (A/E) pathogens, based on the ability of these extracellular bacteria to intimately attach to the intestinal epithelium and flatten absorptive microvilli (effacement). Another hallmark feature of A/E pathogens is their ability to induce actin rearrangements that form membranous protrusions, called “pedestals,” beneath the attached bacteria. Pedestal formation is associated with the development of A/E lesions, breach of the epithelial barrier, and disease [15]. The induction of these lesions depends on a type III secretion system (T3SS) encoded within the loci of enterocyte *Address correspondence to: Marina Palermo, Lab Inmunologia, Instituto de Investigaciones Hematológicas, Academia Nacional de Medicina P. de Melo 3081 (C1425AUM), Ciudad de Buenos Aires, Argentina. [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 123

effacement (LEE) and the interplay of many T3SS effectors. To attach to the enterocytes, EPEC and EHEC utilize their T3SS to inject the translocated intimin receptor (Tir) into the host cell [16], where it inserts into the host cell membrane and binds to the bacterial outer membrane protein intimin. Binding of intimin to Tir induces Tir clustering, initiating a cascade of signaling events that leads to actin polymerization and pedestal formation [17]. This multifaceted approach allows A/E pathogens to coordinate the formation of A/E lesions and actin pedestals, providing them with a unique niche in the intestine of the infected host. Upon infection, A/E pathogens displace the commensal flora and cause an intestinal pathology that includes damage characterized by cellular necrosis, disruption of the epithelium, and occasionally bleeding [14,18]. Damage induces a localized repair response characterized by hyperplasia, which reflects an increased division of stem cells at the base of crypts to replace damaged enterocytes [18]. As hyperplasia develops, goblet cells become less evident because they are not replenished as readily as enterocytes. Thus, the apparent loss of goblet cells may be further evidence of repair. Infection with A/E pathogens also induces the recruitment of immune cells and causes edema within the lamina propria. The T3SS-dependent adhesion, survival, and persistence of pathogens within the host are invariably associated with damage to host tissues. T3SS-associated damage takes a number of forms, including direct cytotoxicity through the induction of apoptosis or necrosis, or tissue damage associated with the disruption of tissue barriers [16]. These mechanisms promote pathological outcomes, such as diarrhea or inflammation [19]. Although T3SSs do not act in isolation, the impact of their absence on disease pathogenesis is dramatic. Mice infected with T3SS-deficient C. rodentium, do not manifest any pathological symptoms caused by wild-type C. rodentium infection, and deletions of various T3SS effectors of A/E pathogens have been demonstrated to diminish distinct aspects of disease, such as formation of the A/E lesion and disruption of the epithelial barrier [20]. The intestine absorbs nutrients while simultaneously forms a barrier to noxious substances and bacteria. Along its 7meters in length, the human intestine displays distinct cell types in different areas according to the function and a gradient distribution of normal bacterial flora with maximal numbers in the colon. The colon receives a daily volume load of some 2 liters from the ileum, whereas the fecal excretion is only 50 ml/day. It is generally accepted that the water absorption is associated with the transepithelial absorption of sodium, potassium, chloride and bicarbonate across both the luminal and basolateral membranes of intestinal epithelial cells. To date, all proposed models suggest that fluid absorption in the intestine is due to a complicated interaction among volume fluxes dependent on salt transport and osmotic and hydrostatic gradients. Diarrhea results from an imbalance of absorption and secretion of ions and solute across the intestinal epithelium, followed by the movement of water in an attempt to restore the appropriated ion concentrations. Often, the absorption and secretion imbalance is caused by the presence of bacteria that secrete toxins disturbing the ions and water transport. Diarrhea benefits enteric pathogens by facilitating their rapid dissemination into the environment and, consequently, the infection of new hosts [21]. The disruption of tight junctions (TJs) responsible of transport through the paracellular pathway [22] is a common mechanism that promotes the spread of the pathogen to new hosts. T3SS-facilitated disruption of TJs was shown to be an important factor contributing to diarrhea initiation during C. rodentium infection of mice, with the T3SS effector E. coli secreted protein F (EspF) being central to this process [23]. EHEC, although closely related to EPEC, does not induce epithelial barrier disruption as quickly or severely as that induced by EPEC. This difference is possibly due to the fact that EHEC-induced TJ disruption is mainly regulated by a homologue of EspF, the UEspF, instead of EspF itself [24]. Map and EspG, together with EspG2, are two additional EPEC T3SS effectors implicated in the disruption of the intestinal epithelial barrier [25, 26]. An additional mechanism employed by C. rodentium to induce diarrhea in infected mice is mislocalization of the water channels aquaporins (AQPs) [27]. AQPs are expressed in the intestinal epithelial cells, contribute to stool dehydration [28] and could be implicated in diarrheas [29]. During C. rodentium infection AQPs move from their normal location along the apical cell membrane to the cytoplasm, an effect that is partially dependent on EspF and EspG T3SS effectors. Restoration of AQPs localization to the cell membrane is observed following recovery from infection and cessation of diarrhea. Secretion of Shiga Toxins. Role in the Intestinal Disease Although accumulating evidence have greatly advanced in the knowledge of the complex and dynamic colonization of human colon caused by STEC/EHEC the precise mechanisms by which Stx contribute to the intestinal pathology

124 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

are not well understood. Because STEC are non-invasive, it is generally accepted that Stx must be absorbed from the intestine to cause disease. How this occurs during STEC infection is unknown. While most of the data regarding the trafficking of Stx and cytotoxicity are based on studies in cells carrying the specific Stx-receptor, the globotriaosyl ceramide (Gb3), the finding of retrograde transport of Stx in the T84 human intestinal cell line that lacks receptor Gb3 is of particular interest [30]. In these cells, Stx1 was detected in endosomes, Golgi complex, endoplasmic reticulum (ER) and nuclear membrane [30]. Although the cleavage of the StxA subunit occurs after 6 hours of incubation, no cytotoxicity was observed even in periods of 24 hours. On the contrary, in Caco-2 cells, a human intestinal cell line expressing Gb3 receptors, Stx1 and Stx2 are transported to the ER, and both StxA subunits are activated by furin-dependent cleavage and produce ribotoxicity with the consequent protein synthesis inhibition and induction of cellular apoptosis [31]. It was also described a movement of the toxin through the intestinal barrier without apparent cellular damage probably via an active transcellular route [32]. Taken together, these evidences suggest that cytotoxicity by Stx is associated with the presence of Gb3 receptor. However, its expression in the apical membrane of epithelial cells of the human colonic mucosa is discussed. The existence [33, 34] and the absence of Gb3 [31] have been shown by different groups using different experimental conditions. Independently of this fact, structural and functional alterations in human intestinal epithelium by action of Stx have been broadly described. Studies in intestinal models suggest that Stx can modulate disease severity, including the production of diarrhea and hemorrhagic colitis. Intra-intestinal inoculation of rabbits with Stx or STEC has been used as models of both hemorrhagic colitis and HUS [35]. Inoculation of purified Stx1 in adult rabbit’s ileum loops induced fluid accumulation in association with the presence of apoptotic intestinal villous epithelial cells [36]. Crude and purified Stx2 holotoxin also induced a significant inhibition of water transport across human colon in vitro [37] and evoked a hemorrhagic fluid accumulation in rat colon loop ex vivo in association with damage in the colonic epithelial cells [38]. Instead, Stx2B subunits inhibited the water absorption and caused a non-hemorrhagic fluid accumulation maintaining tissue integrity [38]. Although the contribution of StxA subunit to the induction of these events in vivo has been demonstrated using the entire holotoxin, it is not clear if StxB subunit may be able to exert any effect on enterocyte function by itself. Local Host Immune Response In addition to physical barriers such as the intestinal epithelium, an important biological barrier to disease-causing microbial infection is the defense of the host. Upon arrival in the host environment, bacteria encounter an array of extracellular and intracellular pattern recognition receptors (PRRs) that have evolved to sense pathogenic motifs (called pathogen-associated molecular patterns) and to trigger host defenses. These PRRs include extracellular receptors of the Toll-like receptor (TLR) family and the intracellular leucine-rich repeat-containing proteins of the NOD-like receptor family. These important host innate immune receptors signal the presence of bacterial motifs in privileged host environments, and trigger their respective downstream signaling cascades. TLRs recognize and respond to conserved structural motifs associated with microbes, which include proteins (e.g., flagellin), nucleic acids (e.g., unmethylated CpG DNA), and lipids (e.g., lipid A of lipopolysaccharide [LPS]) [39]. LPS is abundant on the surface of pathogenic E. coli and is a known ligand for the TLR4 receptor complex. When LPS binds to its receptor, nuclear factor of kappa B (NF-κB) becomes de-repressed, and as a consequence, proinflammatory cytokines are expressed [40]. Notably, infection of TLR4−/− mice with C. rodentium results in a slower, less severe inflammatory response and reduced mortality [41], suggesting that TLR4 signaling exacerbates disease. In contrast, TLR2 signaling appears to be required for protective responses to C. rodentium. Thus, following infection TLR2−/− mice suffer from colonic mucosal ulcerations, bleeding, increased apoptosis, and increased mortality [42]. Together, these studies suggest that the activation of TLRs by C. rodentium can cause both protective and deleterious responses. A variety of innate immune receptors, including TLRs, the type I interleukin-1 receptor (IL-1R), and the IL-18 receptor, utilize the signaling adaptor myeloid differentiation factor 88 (MyD88) to activate NF-κB and produce an array of cytokines and chemokines [39]. Following detection of C. rodentium, MyD88 signaling in epithelial and hematopoietic cells initiates recruitment of innate immune cells, limits bacterial load, and controls the amount of intestinal damage and facilitates epithelial repair responses [43].

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 125

Similarly, it has been proposed that MyD88 signaling provides protection from EHEC by inducing the timely recruitment of neutrophils and thus stemming the growth of bacteria in the colon [44]. The role of TLR4 and the intracellular adaptor proteins MyD88 and Toll/interleukin (IL)-1 receptor domain-containing adaptor-protein inducing interferon beta (TRIF), were recently investigated in a mouse model of intestinal E. coli O157 infection [44]. The authors showed that the highest fecal bacterial counts as well as the most severe clinical signs; hematological derangements and histopathology were noted in MyD88-deficient mice, while moderate and milder clinical signs were observed in TLR4- deficient mice and in the TrifLps2/Lps2-mutated or wild type (WT) mice, respectively. These results suggest that MyD88, which is common to all TLR receptors, is involved in the response to E. coli O157:H7 and that, in its absence, bacterial clearance is defective, allowing systemic spread of Stx leading to hemolysis, thrombocytopenia, and renal pathology resembling human HUS. However, because MyD88 signaling contributes to several aspects of the innate immune response, it is difficult to discern whether particular phenotypes result from direct or indirect consequences of TLR signaling or from other receptors that utilize MyD88. Such designations are important to understand how TLRs or other receptors mediate a balanced response to a pathogen that is sufficient for containment and clearance but limits damage due to inflammation. For example, it has been recently demonstrated that IL-1R signaling provides protection from increased mortality and pathology upon infection with C. rodentium, whereas IL-18 signaling does not appear to participate [18]. Thus, the increased pathology evident in the absence of IL-1R signaling appears to result from an increased susceptibility to tissue damage by C. rodentium and not from deregulated immune or repair responses. A consequence of triggering host inflammatory signaling is the recruitment and activation of a variety of host immune cells. Resident phagocytes (neutrophils, macrophages), circulating inflammatory cells, antigen-presenting cells, and lymphocytes have the combined function of identifying, sequestering, and neutralizing invading pathogens. In addition, an effective innate immune response allows the proper recruitment and activation of specific immune cells necessary for a robust antibody response both to promote the clearance of A/E pathogens [45] and to reduce the severity of pathology upon reinfection [46]. However, in addition to providing protection, innate immune cells such as neutrophils, may contribute to colitis and epithelial damage, including the formation of crypt abscesses [47,48]. Interactions between EHEC and Cells of the Mucosal Immune System EHEC adheres to the apical membrane of colon epithelial cells, but is not invasive for those cells. Nonetheless, infection is characterized by acute inflammation of the colonic mucosa [49]. EHEC is thought to signal colon epithelial cells to produce proinflammatory chemokines that can chemoattract and activate leukocytes, resulting in acute mucosal inflammation [50,51]. EHEC produce several proteins that are candidates for signaling the upregulated production of epithelial chemokines. These include the surface protein intimin [52], but also Stx [50,51,53] and H7 flagellin [54], as in the case for EPECs [55]. The role of Stx as cytokine/chemokine-inducer factor in intestinal epithelium is still a controversal topic. Some reports have shown Stx-dependent induction of cytokine and chemokine mRNAs (TNF-, MCP-1 and IL-8) in intestinal epithelial cell lines. However, these results have been recently questioned [56] because Stx2 may be a strong inducer of proinflammatory cytokines, like IL-1α or TNFα, acting via NF-kB activation, but it is a weak inducer of CXCL8 even in colon cancer cell lines expressing the receptor for Stx [54,57,58]. In contrast to some of the human colon cancer cell lines, human colon epithelium in vivo seems not to express Gb3. Consistent with this, Stx did not bind to the epithelium in normal or inflamed human colon in vivo [59]. However, Stx, which gains access to endothelial cells in the subepithelial region of the colon mucosa, could trigger the release of inflammatory mediators by endothelial cells and acting either directly or indirectly on the epithelium, alters epithelial cell function. In sharp contrast, other authors have shown that PI3K/Akt/NF-kB pathway potentially induced by EHEC is inhibited by Stx in Gb3-negative epithelial cells. Thus, Stx could be an unrecognized modulator of the innate immune response of human enterocytes [60]. On the other hand, it has been shown that EHEC activates an epithelial cell proinflammatory response that depends to a significant extent on H7 flagellin [54]. Exposure of human intestinal epithelial cells to EHEC flagellin instilled into the lumen of human colon xenografts resulted in the upregulation of CXCL8 and CCL20 production, and a

126 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

marked influx of neutrophils into the subepithelial region of the xenograft mucosa [56]. Studies in this model further showed that EHEC flagellin, through a TLR5 mediated pathway, was both necessary and sufficient for upregulating CXCL8, in the context of EHEC infection [56]. Flagellin signaling through TLR5 activates NF-κB and MAP kinases in colon cancer cell lines [54]. Similarly, stimulation of human colon cancer cell lines with bacterial flagellin from different pathogenic bacteria has been reported to upregulate the expression of CXCL8 and/or CCL20 [61-63]. Since acute inflammatory infiltration of the gut and the presence of leukocytes in feces are seen in many STECinfected patients [64], several studies were conducted to analyze the role of PMN in the intestine. It has been demonstrated that STEC interaction with a cellular line of intestinal epithelium (T84) induces the basolateral-toapical transmigration of PMN, which in turn, significantly increased the movement of Stx1 and Stx2 across polarized T84 cells in the opposite direction [65]. The amount of Stx crossing the T84 barrier was proportional to the degree of PMN transmigration, and the increase in Stx translocation appears to be due to increases in paracellular permeability caused by migrating PMN. Additionally, PMN recruitment in the intestine may also increase the risk of HUS, because they were found to induce the Stx2 prophage in vivo and increase the Stx2 production, mainly through the production of H2O2 [66]. SYSTEMIC HOST RESPONSE DURING HUS (POST ENTERIC EHEC INFECTION) In 1983, investigators made a main contribution to the understanding of the etiology, pathogenesis and epidemiology of typical HUS, by describing the association between HUS, E. coli, and Stx (also referred as verotoxin) [67]. After this original description, interest was directed to several topics related with Stx role in the pathogenesis of HUS. The HUS is multifactorial in etiology involving complex interactions between bacterial and host factors. In 90% of HUS cases, an STEC infection is detected, but not all STEC infections result in HUS. Infection may be asymptomatic and result in no disease, or may develop watery diarrhea, followed by bloody diarrhea, or HUS, and only 5 to 10% of infected children develop HUS [68]. Certainly, a close relationship between bacterial and host factors may determine the clinical evolutions that define the fate/outcome of EHEC intestinal infection: to limit the infection to gastrointestinal signs or to evolve to a more complex systemic disease. The initial bacterial inoculum, the amount and type of Stx produced by the bacteria ingested, additional bacterial virulence factors, and the qualitative and quantitative characteristics of the thrombotic and inflammatory responses of the host are some of the factors that may determine the outcome of a EHEC infection. Spread of Shiga Toxins Through the Host: Its Responsibility in the Development of HUS The principal virulence factors associated with post-enteric HUS are Stx. Stx family consists of a number of structurally and functionally related protein toxins that are designed by a number or number⁄letter combination following the name Stx. Stx1 is almost identical to Stx from S dysenteriae type 1, differing by a single amino acid. Stx2 has only 56% of identity with Stx1 at the protein level and is immunologically distinct [69]. Nowadays, epidemiological and experimental studies have shown that the stx genotype is associated with the severity of the disease [70,71]. There are a number of variants of Stx2 that may be more virulent to humans, such as Stx2c, and certain forms of Stx2dact with can be activated by an elastase present in human mucus [72]. STEC serogroup O157 expressing both Stx1 and Stx2 are the microorganisms isolated from children with HUS, although strains that express only Stx2 are highly prevalent in Argentina [73]. Stx is an AB5 toxin consisting of an enzymatically active StxA subunits that interrupt essential cell functions, and pentameric StxB subunit that mediates binding and uptake into the target cell. For all Stx types associated with human disease, the 7.7 kDa StxB subunits recognizes and binds to a eukaryotic cell glycolipids bearing a terminal galactose-1, 4-galactose moiety namely Gb3 receptor. Several studies revealed that Stx were cytotoxic to some cells but no to others and linked this susceptibility to appropriate Gb3 receptor expression on the surface of target cells. Structural analysis of the interaction between Stx1B and a trisaccharide derivative, which served as a receptorlike compound, indicates that each Stx1B polypeptide possesses three putative receptor binding sites generating a total of at most 15 sites per toxin molecule [74]. Site-directed mutagenesis studies revealed that impairment of any of the binding sites affected the affinity between Stx1 and the receptor suggesting that multivalent binding between a StxB subunit and Gb3 molecules cooperatively stabilizes the holotoxin-receptor complex [75]. Although the correlation between the degree of Stx sensitivity and Gb3 content in the cell surface is generally recognized [76], the

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 127

length of Gb3 fatty acid chains and the Gb3 association to the lipid rafts are also implicated in the cell sensitivity to Stx [33,77]. In humans, Gb3 is found in highest concentrations in renal tubular epithelial cells and in microvasculature endothelial cells, particularly in the kidney, intestine, and brain. An appreciation of the exquisite sensitivity of some microvascular endothelial cells to cytotoxic effects of Stx resulted in the hypothesis that Stx directly initiated the classic HUS lesions: swelling of the glomerular endothelial cell, with detachment from the basement membrane, and the subsequent deposition of fibrin-platelet thrombi in the kidney microvasculature. After binding, Stx is internalized via clathrin-coated vesicles [78] and also via endocytic routes that do not involve clathrin-coated pits [79,80]. The Stx-Gb3 receptor complex then undergoes retrograde transport from early endosomes through the trans-Golgi network and Golgi to the ER and even to the nuclear membrane [81,82]. Once Stx has reached the ER, the 32 kDa StxA subunit is cleaved by the membrane anchored protease furin into the catalytically active 27.5 kDa A1 and a 4.5 kDa A2 fragment. Cleavage and activation of the A subunit in furinnegative cells occurs at a much lower rate and has been attributed to calpain in the cytoplasm or cathepsins in lysosomes [83,84]. This cleavage processing is required for retro-translocation into de cytosol, where the A1 subunit cleaves a specific adenine on the 28S ribosomal RNA, irreversibly inhibiting protein synthesis resulting in cell death [85,86]. In addition to inhibiting protein synthesis, Stx triggers intracellular signaling events that induce apoptosis in many cell types by different mechanisms [87-89]. This is important because for unknown reasons a variety of cells succumb to apoptotic cell death rather than necrosis through inhibition of cytoplasmic protein synthesis. While the inhibition of protein synthesis by the active A subunit is considered responsible for Stx cytotoxicity, other biological effects given by the B subunit appear to contribute to the mechanism by which Stx damages or kills target cells. The StxB subunits possess signal properties in its own right that can cause apoptosis of cells expressing the Gb3 receptor. In 1993, it was discovered that the B pentamer of Stx1 triggers apoptosis in Burkitt's lymphoma B cells, albeit at a much higher concentration than did the holotoxin [90,91]; whereas Stx2 B subunits trigger apoptosis in the Ramos but not in the Daudi Burkitt's lymphoma B-cell line [92] or Vero cells [93]. Human renal tubular epithelial cells showed to be sensitive to apoptotic action of Stx2B subunit [94]. Other reports showed that Stx1B subunit is non-toxic when applied to HeLa [95] or to monocytic THP-1 cells [95]. Shiga Toxin in Kidney The human kidney expresses relatively high levels of Gb3 as compared to other organs, which may account, at least in part, for renal targeting in HUS [96]. Renal histology reveals thickening of the capillary wall and swelling and detachment from the basement membrane of endothelial cells within the glomerulus with reduction of glomerular capillaries [97]. Mesangial expansion and mesangiolysis have also been observed [98]. Nowadays, it is well known that the microvascular endothelial damage is a central pathogenic process underlying the development of HUS. However, human glomerular endothelial cells in vitro are not very susceptible to Stx toxic effects unless pretreated with inflammatory mediators [99]. In addition, recent accumulated evidence suggests that renal tubular injury observed in HUS [100] is not only secondary to glomerular and arteriolar injury induced by Stx but also to the direct action of Stx on tubular epithelial cells [101]. It has been shown that the tubular epithelial cells are also highly susceptible to Stx in culture [94,102,103]. Proximal tubular damage is evident in renal tissue during the early stages of HUS [94, 104] raising the possibility that the proximal tubule may be an important early target of Stx action. The marked increase in N-acetyl glucosaminidase and β2-microglobulin, both of which are specific markers of tubular function, has provided evidence of renal tubular damage in the acute stage [105]. Studies in HUS animal models have shown that the most severely affected segment of the nephron is the proximal tubule [106,107]. It seems plausible that injured tubular cells trigger the activation of the coagulation and inflammatory systems [102], which in turn, sensitize endothelial glomerular cells to Stx toxic effects. Interestingly, urinary excretion of TNF-, IL-6 and IL-8 is high during the acute phase of HUS and gradually decreases until recovery correlating well with the degree of renal injury [108,109]. It is known that 120 liters of fluid are reabsorbed across the human proximal renal tubules each day and it is generally accepted that coupling between ion and water fluxes takes place in the lateral space of the epithelium [110]. The apical Na+/H+ exchanger-NHE3 together with the basolateral Na+/K+ ATPase pump are the principal

128 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

mechanisms committed to accumulate NaCl in the intercellular space which becomes hypertonic. The standing osmotic gradient resulting would be the driving force to reabsorb water through the transcellular and/or paracellular pathways [111], although the majority of water reabsorption occurs via a transcellular pathway [112]. The apical and basolateral plasma membranes of proximal tubules have high osmotic water permeability [113] given by the expression of water channel AQP1 [114]. We have recently demonstrated that Stx2 holotoxin and also Stx2B subunit inhibit the water absorption across human renal tubular epithelial cells monolayers [115]. These cells could be considered a model system reflecting the functional properties of the human proximal tubule epithelium, useful to improve the understanding of the mechanisms involved in the Stx-mediated cell damage. Shiga Toxin in Brain Argentina has a mortality rate of around 2-4% of cases of HUS associated with STEC infection being most of these cases due to injury of central nervous system (CNS) by the action of Stx. Common signs of severe CNS include seizures, alteration of consciousness, hemiparesis, visual disturbances and brainstem symptoms [116,117]. Studies from brain autopsies of children who died of HUS have shown thrombi in the microvasculature, endothelial and myocardial edema suggesting that the initial event of encephalopathy was associated with endothelial injury [100]. Studies of brain damage produced by Stx were usually performed in animal models of STEC colonic invasion or Stx systemic administrations [118-120]. Some reports have shown that neurological damage is associated with the destruction of the microvasculature and glial cells of the cerebral cortex causing inflammatory responses in the brain parenchyma [119,120]. In addition, in vitro studies showed that TNF- amplifies Stx effects on LPS-sensitized astrocytes contributing to brain inflammation and leading to endothelial and neuronal injury [121]. Others showed a selective damage of neurons in the lower layers of the cerebellar and cerebral cortex, midbrain and spinal cord, and in a later phase involved pathological changes of blood vessels [122,123]. Studies of magnetic resonance imaging (MRI) detected brain lesions in the hypothalamus, hippocampus, brainstem, spinal cord and cerebellum of rabbits injected with Stx2 [118,119], although the MRI technique is reliable to show brain damage is inefficient to identify areas affected at cellular level. A detailed ultrastructural study of the action of Stx2 when the toxin was intracerebroventicular microinfused in the rat brain was recently published [124]. Using transmission electron microscopy, apoptotic neurons were observed in association with Stx2 immunolabeling, together with pathological ultrastructural alterations of astrocytes and oligodendrocytes in affected brain areas. Furthermore, Stx2 caused cytoplasmic demyelinated oligodendrocytes and gliosis in the striatum. Confocal microscopy studies showed reactive astrocytes and increase of glial fibrillary acidic protein in astrocytes that contacted hypertrophied neurons containing Stx2. The lesions observed in the brain were associated with changes in the expression and activity of neuronal nitric oxide synthase (nNOS) [125]. In the cerebral cortex and the striatum showed a significant decrease in the number of NOS positive neurons and nNOS activity, whereas in the paraventricular nucleus of the hypothalamus was found the opposite effect. Taken together, these results are consistent with those found in HUS patients who developed encephalopathy and suggest that Stx causes a direct damage to parenchymal cells of the CNS. Additional Pathogenic Factors from the Bacteria Besides Stx, putative virulence factors of STEC include adhesins, other toxins and proteases [126]. Much work focused on genes involved in bacterial attachment because it has been suggested that the degree of intestinal adhesion is correlated with the ability to cause disease [1,7]. Since the vast majority of STEC strains implicated in HUS are intimin-positive, the intimin gene eae has been identified as a risk factor for HUS [70]. However, during last years LEE negative strains have been received an increasing attention since several HUS-cases were associated to these pathogenic bacteria [12,13,127]. Recently, it has been shown that highly pathogenic strains producing Stx2dactivavble are intimin negative [128]. In these strains putative adhesins and other effector molecules may induce adhesion, invasion and/or colonization [69,129]. Some of these alternative pathogenic factors are now being identified. Among them, the plasmid-encoded toxin hemolysin (Ehly) is a pore-forming cytolysin, produced by both LEE-positive and LEE-negative STEC, although the frequency is higher among eae-positive STEC [69,130]. Ehly could contribute to disease through lysis of erythrocytes and release of hemoglobin as a potential source of iron for the bacteria. It could also contribute by its membrane damaging effect on a wide variety of cell types, its ability to induce production of pro-inflammatory cytokines, or both [130]. Several proteases (EspP, EspI, StcE) are produced by STEC, and their activities suggest a putative role in the pathogenesis of the disease [126,127,131]. Interestingly,

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 129

EspJ, a non LEE-encoded secreted protein, has been identified as an “antivirulence” factor. Its deletion results in reduced colonic clearance in mice and lambs, and has been suggested to promote pathogen transmission [13]. Among other pathogenic factors with systemic effects that may contribute to HUS development subtilase cytotoxin (SubAB) is a recently discovered toxin with an A1:B5 structure detected in a high percentage of STEC strains [133]. It has been shown to be lethal and induced renal damage compatible with HUS in mice [134]. Its name has been chosen because the A subunit shares sequence homology with a subtilase like serine protease of Bacillus anthracis [133]. The studies using SubAB have shown in vitro cytotoxic effects on Vero cells [134,135]. SubAB is formed by an enzymatically active A subunit with a molecular weight of 35 kDa, that disrupt essential cell functions, and pentameric B subunit (each monomer 13 kDa) that mediates binding and uptake into the target cell. The B subunits have a high degree of binding specificity for glycans terming with 2–3-linked residues of non human sialic acid Nglycolylneuraminic acid (Neu5Gc) which are incorporated to host cells from food [136]. After binding to these receptors SubAB are internalized via clathrin-coated vesicles [78,137]. SubAB also inhibits the protein synthesis as described for Stx, but occurred by a different mechanism. SubAB is trafficked from the cell surface to the ER via a retrograde pathway converging at the Golgi similar to that of Stx. However, unlike Stx, whose catalytic A subunits must exit the ER to access their cytosolic targets, SubAB remains associated with the major chaperone in the ER GRP78/BiP, and causes the specific single site cleavage and inactivation of this intracellular substrate [138]. Disruption of BIP function has inevitably fatal consequences for the survival of eukaryotic cells [139]. The pentameric B subunits of SubAB alone can also caused alterations in host cells. Vacuolation dependent on V-type ATPase was reported by the B subunit of SubAB in Vero cells resulting in cell damage; however, a larger amount of SubAB was required compared to that required for protein synthesis inhibition [140]. A recent study described another novel toxin from STEC, the cytolethal distending toxin (CDT-V), that directly injures endothelial cells resulting in their dead, and may thus contribute to the pathogenesis of HUS [141]. CDT is a tripartite AB toxin in which CdtB is a nuclease that damages host cell DNA inducing cell cycle arrest and CdtA and CdtC is required for the delivery of CdtB into the target cell. The lipopolysaccharide (LPS) is a major product of the Gram-negative bacteria and represents a central trigger of inflammation during a Gram-negative infection. Although endotoxemia has never been demonstrated in HUS patients, traces of LPS absorbed from the inflamed gastrointestinal tract or simply the LPS mucosal stimulation could be enough to induce a systemic response, particularly the pro-inflammatory and prothombotic responses. In vivo studies have demonstrated that toxicity of Stx is enhanced by LPS, and renal thrombotic microangiopathic lesions, mimicking those seen in human HUS, are reproduced by infusion of Stx together with LPS [142-144]. Conversely, it was suggested that Stx might enhance the pro-coagulant effect of LPS [145]. Many substances, including prostaglandins, cytokines, vasoactive and pro-coagulant factors are stimulated by LPS. Among them, TNF- and IL-6 strongly upregulate the expression of Stx receptors and sensitize microvascular endothelial cells (glomerular and others) to Stx-induced injury [99,146], activate the coagulation system, causing a prothrombotic state with platelet activation, and activate the innate immune response that will amplify endothelial injury. In summary, although Stx-induced tissue injury is the main pathogenic event, multiple bacterial components may contribute to the whole pathogenic mechanism (Table 1). Table 1: Toxins isolated from enterohemorrhagic E. coli that are involved in the development of Hemolytic Uremic Syndrome Toxin

Structure

A1: B5 Stx1, Stx2, Stx2c, A: 32 kDa Stx2dact B: 7.7 kDa A1: B5 SubAB A: 35 kDa

Cellular receptors

Trafficking pathways

Gb3

Clathrin- dependent and independent internalization Retrograde transport to the ER Translocation of active A1 subunit into the cytosol

Non-human Neu5Gc

Clathrin-dependent internalization Retrograde transport to the ER

Toxin action A subunit inhibits protein synthesis B subunits link to Gb3 receptor A and B subunits inhibit water epithelial absorption and produce apoptosis. A and B subunits inhibit protein synthesis and produce apoptosis and vacuolation

Cellular targets Microvascular Endothelial cells Epithelial cells Monocytes Neurons Microvascular Endothelial cells Epithelial cells

130 Pathogenic Escherichia coli in Latin America

B: 13 kDa A1: B2 A: CdtB B: Cdt A, CDT-V CdtC Each unit: 25-35 kDa. Ehly

RTX

Specific single-site cleavage of dependent on V-type ATPase. ER chaperone GRP78/BiP B subunits link toNeu5Gc receptor CdtB subunit is a nuclease that damages host cell DNA inducing cell cycle arrest. N/D N/D CdtA and CdtC facilitate the entry of CdtB into the target cells LFA-1 in Pore-forming cytolysin that cells of causes damage of the N/A hematopoietic plasmatic membrane of target origin cells

Ibarra and Palermo

Microvascular Endothelial cells Epithelial cells Macrophages Microvascular Endothelial cells Leukocytes Erythrocytes

Stx: Shiga toxin, SubAB: Subtilase toxin, CDT: cytolethal distending toxin, Ehly: hemolysin, Gb3: globoytriaosyl ceramide, Neu5Gc: N-glycolyneuraminic acid, RTX: (repeats-in-toxin) family, LFA-1: lymphocyte-function-associated antigen-1, ER: Endoplasmic reticulum, N/D: not determined, N/A: not applicable

Additional Factors from the Host Although several bacterial pathogenic factors are necessary for HUS development, many research groups have reported the contribution of the host inflammatory response in the development of HUS. This statement is supported by in vitro and in vivo experimental studies and clinical observations in infected children: patients evidence a marked inflammatory response as demonstrated by systemically (blood) and locally (urine) increased levels of various inflammatory mediators, including interleukins, chemokines, soluble adhesion molecules, growth factors, and acute phase response proteins [110,147-150]. Additionally, they also show markers of endothelial injury, activation of the coagulation cascade and inhibition of fibrinolysis [151,152]. In this regard, it has been demonstrated in vitro and in vivo animal models that Stxs induce secretion of ultra large von Willebrand multimers (ULvWF) by endothelial cells, the delay in the ADAM-13-cleavage activity, as well as the increase in tissue factor release [151,153]. Moreover, it has been suggested that the degree of the prothrombotic activation early in infection could be decisive in the course of the disease [154]. The contribution of inflammation to HUS development has also been shown in several animal models, as mice, baboons, rats and rabbits, in which the injection of Stx plus LPS caused thrombocytopenia, hemolytic anemia, and renal failure similar to the triad of events described in human HUS [106,107,142, 143,155,156]. Involvement of Cellular Components of Inflammatory Response during HUS PMN are essential for host defense against microbial infections but can also be associated with pathologic side effects of tissue destruction, and especially with endothelial cell damage [157,158]. Indirect evidence supporting the hypothesis that activated PMN may be involved in the pathogenesis of HUS are that: 1) a high peripheral blood PMN count at presentation is a positive predictor of a poor outcome [159,160] and 2) PMN influx into the renal cortex of HUS patients is related to more severe cases and fatal cases [161]. In addition, activation and degranulation of PMN have been indirectly demonstrated by the presence of high levels of elastase and IL-8 in the serum of patients. Elastase is the major lysosomal proteinase liberated by activated PMN [162,163]. On the other hand, IL-8 is a cytokine produced by activated PMN that promotes their adhesion and migration in vivo, and delays PMN apoptosis [164]. Moreover, PMN from HUS patients have increased adhesive capacity in vitro and show reduction in their granule content as demonstrated by ultrastructural studies [165,166]. Studies on circulating PMN from HUS patients in the acute period have found phenotype and functional alterations. They have a reduced expression of membrane molecules (CD16 and CD11b) involved in adherence and inflammatory responses, and a reduced intracellular content of molecules and enzymes found in specific (CD66b) and azurophil (myeloperoxidase and β-glucuronidase) granules [167,168]. PMN also show impaired degranulation capacity upon cytokine stimulation, and decreased cytotoxic responses, such as ADCC and ROS production after direct PKC stimulation. Because the entire population of PMN in HUS patients shows an increased survival rate compared to healthy control children and patients who presented more deactivated PMN, are those that showed the lowest percentages of apoptosis [169], it has been concluded that deactivated PMN are not dying cells.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 131

These data suggest that PMN are partially deactivated, probably due to a post-activation exhaustion process [167,168], similar to that is found for platelets, which circulate in a degranulated form as consequence of a strong thrombotic stimulus prior to the moment of hospitalization [170-171]. Moreover, the importance of PMN in the course of HUS is also supported by the finding that the functional state of PMN in the acute period of HUS patients is inversely correlated with the severity of renal damage [169]. Therefore, PMN from patients with the highest degree of renal insufficiency showed the lowest levels of CD11b, CD66b, intracellular myeloperoxidase and ROS production [169]. On the other hand, previous reports indicate that Stx is able to bind to a Gb3-variant receptor expressed on the membrane of monocytes and instead of inhibiting protein synthesis, this interaction leads to cellular activation and secretion of cytokines such as TNF-, IL-1, and IL-8 and several chemokines that increase endothelial susceptibility to Stx [146,172,173]. Studies in the sera of HUS patients have found increased monocyte-produced cytokines, specifically, IL-6, IL-8, and TNF-, indicating that monocytes/macrophages are activated during the disease process [109,110,149,151,174]. Additionally, detection of IL-6, IL-8, and TNF- in the urine of HUS patients in higher amounts than in the serum indicates that these cytokines are produced locally in the kidney [110]. Detection of elevated levels of monocyte chemoattractant protein 1 (MCP-1), in the urine of HUS patients is an indirect evidence of monocyte infiltration into the kidney during HUS [149,151]. In addition, biopsy specimens clearly showed the increased presence of macrophages in HUS patient’s kidneys [175]. These data point to the monocyte/macrophage as an important inflammatory mediator in the progression of HUS. Further evidence that monocytes are also early activated during HUS has been established by the analysis of monocytes isolated from HUS patients during the acute period. An increased percentage of the subset of CD16+ monocytes have been reported in peripheral blood [176]. This CD16+ monocytes are considered to represent an activated, more mature subset with characteristics that resemble macrophages and dendritic cells [176,177]. Fractalkine, (FKN; CX3CL1) is a transmembrane chemokine present on endothelial and epithelial cells and is upregulated upon inflammation. The FKN receptor (CX3CR1) is expressed on monocytes, among other cells and, under conditions of physiologic flow, FKN mediates adhesion of monocytes. A disappearance of circulating CX3CR1+ monocytes has been reported in HUS patients, and this correlated with the severity of renal failure [175]. The fact that CX3CR1+ leukocytes were observed in renal biopsies from patients with HUS suggest that the interaction of CX3CR1+ cells with FKN present on activated endothelial cells may contribute to renal injury in HUS. Evidences of Inflammatory Response Contribution from the Mouse Model The lack of an animal model that reflects all features of human HUS is a true limitation, and it is possibly related, at least in part, to interspecies differences in the expression of the Stx specific receptor, Gb3. Despite the fact that the Gb3 receptor is absent in the glomeruli of mice, the mouse model of HUS by systemic injection of Stx2 reproduces the acute renal lesions, mainly by inducing tubular necrosis. Glomerular alterations are also observed, although they are due probably to systemic alterations such as the widespread thrombosis and the decreased renal flow secondary to hemodynamic imbalance [178,179]. Moreover, the mouse model reproduces other systemic alterations characteristic of HUS patients, such as platelet activation, thrombocytopenia and neutrophilia [179,180]. The mechanisms underlying Stx2-induced neutrophilia include an increase in the proliferation of myeloid progenitors, an acceleration of leukocyte appearance into the peripheral circulation and a reduced migration into tissues [181]. Further, it was demonstrated a positive correlation between neutrophil percentage and renal damage [180], mice depleted of PMN presented a reduced sensitivity to Stx2-dependent renal toxicity and lethal effects [181]. Then, it can be concluded that neutrophilia is not an epiphenomenon, but participates directly in the pathogenic mechanism of Stx2. Ex vivo analysis of peripheral PMN from Stx2-treated mice showed increased membrane expression of the adhesion molecules, as well as an increase PMN in vivo and in vitro adhesion to extracellular matrix proteins, enhanced cytotoxic capacity and a higher apoptotic rate when compared to controls [180,182]. Although adherent or infiltrated PMN were not observed within the kidney of Stx2-treated mice [181], the potential damaging role of reactive oxygen species or proteases released upon PMN activation could not be discarded.

132 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

In the similar mouse model of HUS by systemic administration of Stx2 and LPS, it was demonstrated recruitment of macrophages into the kidneys of mice in a time-dependent manner and that this recruitment occurs via the release of the chemokines MCP-1 (CCL2), RANTES (CCL5), and macrophage inflammatory protein 1-alpha (MIP-1) (CCL3) by tubular epithelial cells of the kidney [183]. It is noteworthy that while administration of Stx2 alone did not greatly alter renal mRNA levels of any chemokine, it did cause significantly increased protein expression. It is likely that posttranslational control or storage of the chemokines in renal cells allows to rapid secretion of these chemokines upon exposure to Stx2 without up-regulation of gene transcription [184]. Moreover, neutralization of these chemokines caused decreased renal fibrin deposition, indicating that macrophages, their chemokines, or both are involved in HUS-associated kidney damage. In support of this conclusion, we have found that depleting mice of splenic and liver macrophages reduced Stx2 plus LPS-induced mortality [185]. On the other hand, Stx2 injection also generates an anti-inflammatory reaction, secondary to the early inflammatory response, mainly characterized by endogenous glucocorticoid (GC) secretion [186]. It has been demonstrated that endogenous or exogenous GC can attenuate Stx2 toxicity and HUS severity in mice [182,186]. Although several mechanisms may be involved in GC protection against Stx toxicity, it has been demonstrated that GC-protection is mediated, at least in part, by restraining PMN activation [186]. In summary, and in spite of its limitations, the murine model of HUS, by intravenous injection of purified Stx2, is a useful tool that allows the investigation of early events in the course of HUS. These events are very difficult to study in patients because most of them have probably already occurred in children before they are diagnosed. Mechanism of PMN Activation during HUS The discussion about whether PMN activation during HUS, both in humans and animal models, is a consequence of the direct effect of Stx-binding, or is mediated indirectly through the endothelial activation secondary to Stx-direct damage, has been clarified by recent work. Some authors [187,188] have described Stx bound to PMN from HUS patients, several days after it was no longer detectable in stools. In addition, they and others also reported that Stx was able to bind to PMN in vitro, even when they lack of Gb3 or other known specific Stx receptor [189]. However, Geelen et al. [190] have recently reported the lack of specificity in the binding of Stx to PMN, both in vitro or in HUS patients, and attributed this non-specific binding to possible changes in PMN membrane due to activation. Further, the hypothesis that Stx has direct effects on PMN viability and function has been examined in vitro by measuring apoptosis, necrosis, phagocytosis, and ROS-production upon Stx incubation. Although some authors reported that Stx can influence the respiratory burst or the apoptotic rate of PMN in vitro [191,192], there is growing evidence demonstrating that neither Stx1 nor Stx2 have effects on the PMN priming or PMN degranulation, even at high concentrations or after preincubation with activating stimuli [168,189,193,194]. All the data presented above suggest that activation of PMN in HUS is mediated indirectly by injured or activated endothelial cells and other inflammatory cells rather than by direct interaction with Stx. In contrast, Stx is able to bind to and trigger cellular responses in endothelial cells (amplified in the presence of inflammatory factors) [99], renal epithelial cell [102,103], and monocytes [195]. The injury or disruption of the endothelial lining of blood vessels leads to profound alterations in the haemostatic state and inflammation. In fact, the exposure of the subendothelium, which contains von Willebrand factor, collagen and fibrinogen, induces platelet aggregation and activation [196]. Activated platelets interact with leukocytes, both neutrophils and monocytes [197], and release certain chemokines, present in platelet granules, that also potentiate the inflammatory process [198]. These include platelet factor 4 (PF-4), macrophage inflammatory protein-α (MIP-α), RANTES, β-thromboglobulin, monocyte chemoattractant protein-3 (MCP-3), and IL-8. On the other hand, leukocytes tether to and roll on altered endothelium, producing a link between inflammatory and thrombotic processes [199]. This complex interplay among inflammatory and thrombotic cascades initiated by Stx direct binding to monocytes and endothelial cells, may be enough to explain neutrophil (as well as platelet) activation (Fig. 1). ACKNOWLEDGEMENTS The authors would like to thank all the collaborators (researchers and fellows) for their excellent work as well as the National Agency for Scientific and Technological Promotion (Argentina) for its financial support, which allowed performing the investigations referred to in this chapter.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 133

Inflammatory cascade

Thrombotic cascade

(e) Monocyte

PMN Activation Maturation

(a)

Gb3

Resting EC

Activation Degranulation

+ IL-8 TNF- IL-1

Platelets

(c)

(f)

(b)

P and E-selectin  ICAM-1 and FKN, Gb3

Adhesion

Activated EC

(c) Aggregation Degranulation

(f)

(e) Stx

PF-4, MIP-, MCP-3, IL-8

+

(d)

Stx

Thrombin ULvWF TF

(a) Gb 3

(d)

EC damage

Protein synthesis inhibition

Figure 1: Scheme depicting the sequence of events leading to endothelial damage in HUS. (a) Stx binds to monocytes and endothelial cells (EC) promoting their activation, maturation and secretion of cytokines and chemokines. (b) Cytokines released cause up-regulation of adhesion molecules and of the Gb3 receptor in EC. (c) Activation of EC leads to secretion of thrombotic factors that induce platelets aggregation and degranulation. (d) Stx internalization in activated EC induces inhibition of protein synthesis. (e) Factors released by activated endothelium, monocytes and platelets collaborate in PMN activation. (f) Activated PMN release their granule content, produce reactive oxygen species, adhere to EC and, together with platelets and monocytes, potentiate Stx-induced EC damage. ULvWF: ultra large von Willebrand factor, TF: tissue factor, TNF-α: tumor necrosis factorα, IL-1β: interleukin-1 β, PF-4: platelet factor 4, MIP- α macrophage inflammatory protein- α, MCP-3: monocyte chemoattractant protein-3, IL-8: interleukin-8, ICAM-1: intercellular adhesion molecule-1, FKN: fractalkine.

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13]

Frankel G, Phillips AD, Rosenshine I, et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol. 1998;30:911-21. Review. Notario R, Borda N, Gambande T, et al. Species and serovars of enteropathogenic agents associated with acute diarrheal disease in Rosario, Argentina. Rev Inst Med Trop Sao Paulo. 1996;38:5-7. Cravioto A, Trujillo F, León LA, et al. Infections caused by enteropathogenic Escherichia coli. Gac Med Mex. 1996;132:611-5. Gascon J. Epidemiology, Etiology and pathophysiology of traveler's diarrhea. Digestion. 2006;73:102-8. Qadri F, Svennerholm AM, Faruque AS, et al. Enterotoxigenic Escherichia coli in developing countries: Epidemiology, Microbiology, Clinical features, treatment, and prevention. Clin Microbiol Rev. 2005;18:465-83. Eckmann L. Small bowel infections. Curr Opin Gastroenterol. 2002;18:197-02. Turner SM, Scott-Tucker A, Cooper LM, et al. Weapons of mass destruction: virulence factors of the global killer Enterotoxigenic Escherichia coli. FEMS Microbiol Lett. 2006;263:10-20. Minireview. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol. 2010;8:26-38. Review. Karmali MA, Steele BT, Petric M, et al. Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet. 1983;1:619-20. Kaper JB. Enterohemorrhagic Escherichia coli. Curr Opin Microbiol. 1998;1:103-08. Gianantonio CA, Vitacco M, Mendilaharzu F, et al. The hemolytic-uremic syndrome. Nephron. 1973;11:174-92. Rivas M, Miliwebsky E, Chinen I, et al. Case-Control Study Group. Characterization and epidemiologic subtyping of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog Dis. 2006;3:88-96. Roldgaard BB, Scheutz F, Boel J, et al. VTEC O157 subtypes associated with the most severe clinical symptoms in humans constitute a minor part of VTEC O157 isolates from Danish cattle. Int J Med Microbiol. 2004;294:255-59.

134 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

[14] Luperchio S, Schauer DB. Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect. 2001;3:333-340. [15] McDaniel TK, Kaper JB. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol Microbiol. 1997;23:399-07. [16] Coburn B, Sekirov I, Finlay BB. Type III Secretion Systems and Disease. Clinic Microbiol Rev. 2007,20:535-49. [17] Campellone K, Rankin S, Pawson T, et al. Clustering of Nck by a 12-residue Tir phosphopeptide is sufficient to trigger localized actin assembly. J Cell Biol. 2004;164:407-15. [18] Lebeis SL, Powell KR, Merlin D, et al. Interleukin-1 receptor signaling protects mice from lethal intestinal damage caused by the attaching and effacing pathogen Citrobacter rodentium. Infect Immun. 2009;77:604-14. [19] Pistone Creydt V, Venzano A, Vilte D, et al. Cytotoxic effect in human colon of enterohemorrhagic Escherichia coli isolated from calves with bloody diarrhea. Rev Arg Microbiol. 2005;37:117-21 [20] Caron E, Crepin VF, Simpson N, et al. Subversion of actin dynamics by EPEC and EHEC. Curr Opin Microbiol. 2006;9:40-45. [21] Viswanathan VK, Hodges K, Hecht G. Enteric infection meets intestinal function: how bacterial pathogens cause diarrhoea. Nat Rev Microbiol. 2009;7:110-19. [22] Tsukita S, Furuse M, Itoh M. Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2001;2:285-93. [23] Guttman JA, Li Y, Wickham M, et al. Attaching and effacing pathogen-induced tight junction disruption in vivo. Cell Microbiol. 2006;8:634-45. [24] Viswanathan V, Koutsouris A, Lukic S, et al. Comparative analysis of EspF from enteropathogenic and enterohemorrhagic Escherichia coli in alteration of epithelial barrier function. Infect Immun. 2004;72:3218-27. [25] Tomson F, Viswanathan V, Kanack K, et al. Enteropathogenic Escherichia coli EspG disrupts microtubules and in conjunction with Orf3 enhances perturbation of the tight junction barrier. Mol Microbiol. 2005;56:447-64. [26] Ma C, Wickham ME, Guttman JA, et al. Citrobacter rodentium infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption in vivo: role of mitochondrial associated protein (Map). Cell Microbiol. 2006;8:1669-86. [27] Guttman JA, Samji FN, Li Y, et al. Aquaporins contribute to diarrhoea caused by attaching and effacing bacterial pathogens. Cell Microbiol. 2007;9:131-41. [28] Silberstein C, Kierbel A, Amodeo G, et al., Zotta E, Bigi F, Berkowski D, Ibarra C. Functional characterization and localization of AQP3 in the human colon Brazilian J Med Biol Res. 1999;32:1303-13. [29] Tsujikawa T, Itoh A, Fukunaga T, et al. Alteration of aquaporin mRNA expression after small bowel resection in the rat residual ileum and colon. J Gastroenterol Hepatol. 2003;18:803-08. [30] Philpott DJ, Ackerley CA, Kiliaan AJ, et al. Traslocation of verotoxin-1 across T84 monolayers: mechanism of bacterial toxin penetration of epithelium. Am J Physiol. 1997;273:G1349-G1358. [31] Schüller S, Frankel G, Phillips AD. Interaction of Shiga toxin from Escherichia coli with human intestinal epithelial cell lines and explants: Stx2 induces epithelial damages in organ culture. Cell Microbiol. 2004;6:289-301. [32] Acheson D, Moore R, De Breucker S, et al. Translocation of Shiga toxin across polarized intestinal cells in tissue culture. Infect Immun. 1996;64:3294-4000. [33] Müthing J, Schweppe CH, Karch H, et al. Shiga toxins, glycosphingolipid diversity, and endothelial cell injury. Thromb Haemost. 2009;101:252-64. [34] Imai Y, Fukui T, Kurohane K, et al. Restricted expression of Shiga toxin binding sites on mucosal epithelium of mouse distal colon. Infect Immun. 2003;71:985-90. [35] Rodney A, Moxley L, Francis DH. Overview of animal models. In Kaper JB & O´Brien AD Eds. Escherichia coli O157:H7 and other Shiga toxin-producing E coli strains. Am Soc Microbiol. Washington DC. 1998;p249260. [36] Keenan KP, Sharpnack DD, Collins H, et al. Morphologic evaluation of the effects of Shiga toxin and E coli Shiga-like toxin on the rabbit intestine. Am J Pathol. 1986;125:69-80. [37] Fiorito P, Burgos JM, Fernandez Miyakawa M, et al. Effect of Shiga toxin 2 on water and ion transport in human colon in vitro. Dig Dis Sci. 2000;45:480-86. [38] Pistone Creydt V, Martín F, Fernández Miyakawa M, et al. Shiga toxin 2B subunit inhibits net fluid absorption in human colon and elicits fluid accumulation in rat colon loops. Braz J Med Biol Res. 2004;37:799-08. [39] Kaisho T, Akira S. Pleiotropic function of Toll-like receptors. Microbes Infect. 2004;6:1388-94. [40] Fitzgerald KA, Rowe DC, Golenbock DT. Endotoxin recognition and signal transduction by the TLR4/MD2complex. Microbes Infect. 2004;6:1361-7.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 135

[41] Khan MA, Ma C, Knodler LA, et al. Toll-like receptor 4 contributes to colitis development but not to host defense during Citrobacter rodentium infection in mice. Infect Immun. 2006;74:2522-36. [42] Gibson DL, Ma C, Rosenberger CM, et al. Toll-like receptor 2 plays a critical role in maintaining mucosal integrity during Citrobacter rodentium-induced colitis. Cell Microbiol. 2008;10:388-03. [43] Pull SL, Doherty JM, Mills JC, et al. Activated macrophages are an adaptive element of the colonic epithelial progenitor niche necessary for regenerative responses to injury. Proc Natl Acad Sci. USA. 2005;102:99-04. [44] Calderon Toledo C, Rogers TJ, et al. Shiga Toxin-mediated disease in MyD88-deficient mice infected with Escherichia coli O157:H7. Am J Pathol. 2008,173:1428-39. [45] Maaser C, Housley MP, Iimura M, et al. Clearance of Citrobacter rodentium requires B cells but not secretory immunoglobulin A (IgA) or IgM antibodies. Infect Immun. 2004;72:3315-24. [46] Donnenberg MS, Tacket CO, Losonsky G, et al. Effect of prior experimental human enteropathogenic Escherichia coli infection on illness following homologous and heterologous rechallenge. Infect Immun. 1998;66:52-58. [47] Mumy KL, McCormick BA. The role of neutrophils in the event of intestinal inflammation. Curr Opin Pharmacol. 2009;9:697-01. [48] Kelsall BL. Innate and adaptive mechanisms to control [corrected] pathological intestinal inflammation. J Pathol. 2008;214:242-59. [49] Besser RE, Griffin PM, Slutsker L. Escherichia coli O157:H7 gastroenteritis and the hemolytic uremic syndrome: an emerging infectious disease. Ann Rev Med. 1999;50:355-67. [50] Thorpe CM, Hurley BP, Lincicome LL, et al. Shiga toxins stimulate secretion of interleukin-8 from intestinal epithelial cells. Infect Immun. 1999;67:5985-93. [51] Thorpe CM, Smith WE, Hurley BP, et al. Shiga toxins induce, superinduce, and stabilize a variety of C-X-C chemokine mRNAs in intestinal epithelial cells, resulting in increased chemokine expression. Infect Immun. 2001;69:6140-47. [52] Yu J, Kaper JB. Cloning and characterization of the eae gene of enterohaemorrhagic Escherichia coli O157:H7. Mol Microbiol. 1992;6:411-17. [53] Yamasaki C, Natori Y, Zeng XT, et al. Induction of cytokines in a human colon epithelial cell line by Shiga toxin 1 (Stx1) and Stx2 but not by non-toxic mutant Stx1 which lacks N-glycosidase activity. FEBS Lett. 1999;442:231-34. [54] Berin MC, Darfeuille-Michaud A, Egan LJ, et al. Role of EHEC O157:H7 virulence factors in the activation of intestinal epithelial cell NF-κB and MAP kinase pathways and the upregulated expression of interleukin 8. Cell Microbiol. 2002;4:635-48. [55] Zhou X, Giron JA, Torres AG, et al. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun. 2003;71:2120-29. [56] Miyamoto Y, Iimura M, Kaper JB, et al. Role of Shiga toxin versus H7 flagellin in enterohaemorrhagic Escherichia coli signaling of human colon epithelium in vivo. Cell Microbiol. 2006;8:869-79. [57] Eckmann L, Jung HC, Schurer-Maly C, et al. Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8. Gastroenterology. 1993;105:1689-97. [58] Eckmann L, Kagnoff MF, Fierer J. Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry. Infect Immun. 1993;61:4569-74. [59] Schüller S, Heuschkel R, Torrente F, et al. Shiga toxin binding in normal and inflamed human intestinal mucosa. Microbes Infect. 2007;9:35-9. [60] Gobert AP, Vareille M, Glasser AL, et al. Shiga toxin produced by enterohemorrhagic Escherichia coli inhibits PI3K/NF-kappaB signaling pathway in globotriaosylceramide-3-negative human intestinal epithelial cells. J Immunol. 2007;178:8168-74. [61] Tallant T, Deb A, Kar N, et al. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-κB and proinflammatory gene program activation in intestinal epithelial cells. BMC Microbiol. 2004;4:33. [62] Khan MA, Kang J, Steiner TS. Enteroaggregative Escherichia coli flagellin-induced interleukin-8 secretion requires Toll-like receptor 5-dependent p38 MAP kinase activation. Immunology. 2004;112:651-60. [63] Hayashi F, Smith KD, Ozinsky A, et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature. 2001;410:1099-03 [64] Kelly J, Oryshak A, Wenetsek M, et al. The colonic pathology of Escherichia coli O157:H7 infection. Am J Surg Pathol. 1990;14:87-92

136 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

[65] Hurley BP, Thorpe CM, Acheson DW. Shiga toxin translocation across intestinal epithelial cells is enhanced by neutrophil transmigration. Infect Immun. 2001;69:6148-55. [66] Wagner PL, Acheson DW, Waldor MK. Human neutrophils and their products induce Shiga toxin production by enterohemorrhagic Escherichia coli. Infect Immun. 2001;69,1934-37. [67] Karmali MA, Steele BT, Petric M, et al. Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet. 1983;1:619-20. [68] Gallo EG, Gianantonio CA. Extrarenal involvement in diarrhoea-associated haemolytic-uraemic syndrome. Pediatr Nephrol. 1995;9:117-9. [69] Jacewicz MS, Acheson DW, Mobassaleh M, et al. Maturational regulation of globotriaosylceramide, the Shiga-like toxin 1 receptor, in cultured human gut epithelial cells. J Clin Invest. 1995;96:1328-35. [70] Eklund M, Leino K, Siitonen A. Clinical Escherichia coli strains carrying stx genes: stx variants and stxpositive virulence profiles. J Clin Microbiol. 2002;40:4585-93. [71] Ethelberg S, Olsen KE, Scheutz F, et al. Virulence factors for hemolytic uremic syndrome, Denmark. Emerg Infect Dis. 2004;10:842-47. [72] Melton-Celsa AR, Kokai-Kun JF, O’Brien AD. Activation of Shiga toxin type 2d (Stx2d) by elastase involves cleavage of the C-terminal two amino acids of the A2 peptide in the context of the appropriate B pentamer. Mol Microbiol. 2002;43:207-15. [73] Rivas M, Miliwebsky E, Chinen I, et al. The epidemiology of hemolytic uremic syndrome in Argentina. Diagnosis of the etiologic agent, reservoirs and routes of transmission. Medicina (B Aires). 2006;66:27-32. [74] Ling H, Boodhoo A, Hazes B, et al. Structure of the Shiga-like toxin I B-pentamer complexed with an analogue of its receptor Gb3. Biochemistry. 1998;37:1777-88. [75] Soltyk AM, MacKenzie CR, Wolski VM, et al. A mutational analysis of the globotriaosylceramide-binding sites of verotoxin VT1. J Biol Chem. 2002;277:5351-59. [76] O'Loughlin EV, Robins-Browne RM. Effect of Shiga toxin and Shiga-like toxins on eukaryotic cells. Microbes Infect. 2001;3:493-07. [77] Hanashima T, Miyake M, Yahiro K, et al. Effect of Gb3 in lipid rafts in resistance to Shiga-like toxin of mutant Vero cells. Microb Pathog. 2008;45:124-33. [78] Iversen TG, Skretting G, Llorente A, et al. Endosome to Golgi transport of ricin is independent of clathrin and of the Rab9- and Rab11-GTPases. Mol Biol Cell. 2001;12:2099-07. [79] Sandvig K, Grimmer S, Lauvrak SU, et al. Pathways followed by ricin and Shiga toxin into cells. Histochem Cell Biol. 2002;117:131-41. [80] Römer W, Berland L, Chambon V, et al. Shiga toxin induces tubular membrane invaginations for its uptake into cells. Nature. 2007;450:670-75. [81] Sandvig K, Garred O, Prydz K, et al. Retrograde transport of endocytosed Shiga toxin to the endoplasmic reticulum. Nature. 1992;358:510-12. [82] Sandvig K, van Deurs B. Transport of protein toxins into cells: pathways used by ricin, cholera toxin and Shiga toxin. FEBS Lett. 2002;529:49-53. [83] Garred O, Van Deurs B, Sandvig K. Furin-induced cleavage and activation of Shiga toxin. J Biol Chem. 1995;270:10817-21. [84] Lea N, Lord JM, Roberts LM. Proteolityc cleavage of the A subunit is essentials for maximal cytotoxicity of Escherichia coli O157:H7 Shiga-like toxin-1. J Microbiol. 1999;145:999-04. [85] O'Brien AD, Tesh VL, Donohue-Rolfe A, et al. Shiga toxin: biochemistry, genetics, mode of action and role in pathogenesis. Curr Top Microbiol Immunol. 1992;180:65-94. [86] Sandvig K, Van Deurs. B. Endocytosis, intracellular transport, and cytotoxic action of Shiga toxin and ricin. Physiol Rev. 1996;76:949-66. [87] Brigotti M, Alfieri R, Sestili P, et al. Damage to nuclear DNA induced by Shiga toxin 1 and ricin in human endothelial cells. FASEB J. 2002;16:365-72. [88] Obrig TG. Shiga toxin mode of action in E. coli O157:H7 disease. Front Biosci. 1997;2:d635-d642. [89] Cherla RP, Sang-Yun L, Tesh VL. Shiga toxins and apoptosis. FEMS Microbiol Lett. 2003;228:159-66. [90] Taga S, Carlier K, Mishal Z, et al. Intracellular signaling events in CD77-mediated apoptosis of Burkitt's lymphoma cells. Blood. 1997;90:2757-67. [91] Mangeney MCA, Lingwood S, Taga B, et al. Apoptosis induced in Burkitt's lymphoma cells via Gb3/CD77, a glycolipid antigen. Cancer Res. 1993;53:5314-19. [92] Kojio S, Zhang H, Ohmura M, et al. Caspase-3 activation and apoptosis induction coupled with the retrograde transport of shiga toxin: inhibition by brefeldin A. FEMS Immunol Med Microbiol. 2000;29:275-81.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 137

[93] Williams JM, Lea N, Lord JM, et al. Comparison of ribosome-inactivating proteins in the induction of apoptosis. Toxicol Lett. 1997;91:121-27. [94] Pistone Creydt V, Silberstein C, Zotta E, et al. Cytotoxic effect of Shiga toxin-2 holotoxin and its B subunit on human renal tubular epithelial cells. Microbe Infec. 2006;8:410-19. [95] Marcato P, Mulvey G, Read RJ, et al. Immunoprophylactic potential of cloned Shiga toxin 2B subunit. J Infect Dis. 2001;183:435-43. [96] Lingwood CA. Verotoxin-binding in human renal sections. Nephron 1994; 66: 21-28. [97] Remuzzi G, Ruggenenti P. The hemolytic uremic syndrome. Kidney Int. 1995;48:2-19. [98] Ray PE, Liu XH. Pathogenesis of Shiga toxin-induced hemolytic uremic syndrome. Pediatr Nephrol. 2001;16:823-39. [99] van Setten PA, van Hinsbergh VW, van der Velden TJ, et al. Effects of TNF alpha on verocytotoxin cytotoxicity in purified human glomerular microvascular endothelial cells. Kidney Int. 1997;51:1245-56. [100] Richardson SE, Karmali MA, Becker LE, et al. The histopathology of the hemolytic uremic syndrome associated with verocytotoxin-producing E coli. Hum Pathol. 1988;19:1102-08. [101] Kaplan BS. Shiga toxin-induced tubular injury in hemolytic uremic syndrome. Kidney Int. 1998;54:648-49. [102] Hughes AK, Stricklett PK, Kohan DE. Cytotoxic effect of Shiga toxin-1 on human proximal tubules cells. Kidney Int. 1998;54:426-37. [103] Karpman D, Hakansson A, Perez MT, et al. Apoptosis of renal cortical cells in the hemolitic-uremic syndrome: in vivo and in vitro studies. Infect Immun. 1998;66:636-44. [104] Nestoridi E, Kushak RI, Duguerre D, et al. Up-regulation of tissue factor activity on human proximal tubular epithelial cells in response to Shiga toxin. Kidney Int. 2005;67:2254-66. [105] Takeda T, Dohi S, Igarashi T, et al. Impairment by verotoxin of tubular function contributes to the renal damage seen in haemolytic uraemic syndrome. J Infect. 1993;27:339-341. [106] Taylor FB Jr, Tesh VL, DeBault L, et al.Characterization of the baboon responses to Shiga-like toxin: descriptive study of a new primate model of toxic responses to Stx-1. Am J Pathol. 1999;154:1285-99. [107] Zotta E, Lago N, Ochoa F, et al. Development of an experimental hemolytic uremic syndrome in rats. Pediatr Nephrol. 2008:23:559-67. [108] Karpman D, Andreasson A, Thysell H, et al. Cytokines in childhood hemolytic uremic syndrome and thrombotic thrombocytopenic purpura, Pediatr Nephrol. 1995:9:694-99. [109] van Setten PA, van Hinsbergh VW, van den Heuvel LP, et al. Monocyte chemoattractant protein-1 and interleukin-8 levels in urine and serum of patients with hemolytic uremic syndrome. Pediatr Res. 1998;43:759-67. [110] Diamond JM, Bossert WH. Standing gradient osmotic flow. A mechanism for coupling of water and solute transport in epithelia. J Gen Physiol. 1967;50:2062-83. [111] Larsen EH, Mobjerg N, Sorensen JN. Fluid transport and ion fluxes in mammalian kidney proximal tubule: a model analysis of isotonic transport. Acta Physiol (Oxf). 2006;187:177-89. [112] Schnermann J, Chou CL, Ma T, et al. Defective proximal tubule reabsorptive capacity in transgenic aquaporin-1 null mice. Proc Natl Acad Sci. USA. 1998:95:.9660-64. [113] Carpi-Medina P, Whittembury G. Comparison of transcellular and transepithelial water osmotic permeabilities (Posm) in the isolated proximal straight tubule (PST) of the rabbit kidney. Pflugers Arch. 1988;412:66-74. [114] Nielsen S, Agre P. The aquaporin family of water channels in kidney. Kidney Int. 1995;48:1057-68. [115] Silberstein C, Pistone Creydt V, Gerhardt E, et al. Inhibition of water absorption in human proximal tubular epithelial cells in response to Shiga toxin-2. Pediatr Nephrol. 2008;23:1981-90. [116] Siegler RL Spectrum of extrarenal involvement in postdiarrheal hemolytic–uremic syndrome. J Pediatr. 1994;125:511-18. [117] Gallo EG, Gianantonio CA. Extrarenal involvement in diarrhoea-associated haemolytic-uraemic syndrome. Pediatr Nephrol. 1995;9:117-19. [118] Fujii J, Kita T, Yoshida S, et al. Direct evidence of neuron impairment by oral infection with verotoxinproducing Escherichia coli O157: H– in mitomycin-treated mice. Infect Immun. 1994;62:447-53. [119] Fujii J, Kinoshita Y, Kita T, et al. Magnetic resonance imaging and histopathological study of brain lesions in rabbits given intravenous verotoxin 2. Infect Immun. 1996;64:5053-60. [120] Mizuguchi M, Sugatani J, Maeda T, et al. Cerebrovascular damage in young rabbits after intravenous administration of Shiga toxin 2. Acta Neuropathol. 2001;102:306-12. [121] Landoni VI, Campos-Nebel M, Schierloh P, et al. Shiga toxin 1-induced inflammatory response in LPSsensitized astrocytes is mediated by endogenous TNF-(alpha). Infect Immun. 2010:78:1193-201.

138 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

[122] Mizuguchi M, Tanaka S, Fujii I, et al. Neuronal and vascular pathology produced by verocytotoxin in the rabbit central nervous system. Acta Neuropathol. 1996;91:254-62. [123] Takahashi K, Funata N, Ikuta F, et al. Neuronal apoptosis and inflammatory responses in the central nervous system of a rabbit treated with Shiga toxin-2. J Neuroinflammation. 2008;5:11. [124] Goldstein J, Loidl CF, Pistone Creydt V, et al. Intracerebroventricular administration of Shiga toxin type 2 induces striatal neuronal death and glial alterations: an ultrastructural study. Brain Res. 2007;1161:106-15. [125] Boccoli J, Loidl CF, Lopez-Costa JJ, et al. Intracerebroventricular administration of Shiga toxin type 2 altered the expression levels of neuronal nitric oxide synthase and glial fibrillary acidic protein in rat brains. Brain Res. 2008;1230:320-33. [126] Gyles CL. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci. 2007;85:13Suppl:E45-E62. [127] Coombes BK, Wickham ME, Mascarenhas M, et al. Molecular analysis as an aid to assess the public health risk of non-O157 Shiga toxin-producing Escherichia coli strains. Appl Environ Microbiol. 2008;74:2153-60. [128] Bielaszewska M, Friedrich AW, Aldick T, et al. Shiga toxin activatable by intestinal mucus in Escherichia coli isolated from humans: predictor for a severe clinical outcome. Clin Infect Dis. 2006;43:1160-67. [129] Karmali MA. Host and pathogen determinants of verocytotoxin-producing Escherichia coli-associated hemolytic uremic syndrome. Kidney Int Suppl. 2009;112:S4-7. [130] Taneike I, Zhang HM, Wakisaka-Saito N, et al. Enterohemolysin operon of Shiga toxin-producing Escherichia coli: a virulence function of inflammatory cytokine production from human monocytes. FEBS Lett. 2002;524:219-24. [131] Grys TE, Siegel MB, Lathem WW, et al. The StcE protease contributes to intimate adherence of enterohemorrhagic Escherichia coli O157:H7 to host cells. Infect Immun. 2005;73:1295-03. [132] Dahan S, Wiles S, La Ragione RM, et al. EspJ is a prophage-carried type III effector protein of attaching and effacing pathogens that modulates infection dynamics. Infect Immun. 2005;73:679-86. [133] Paton AW, Srimanote P, Talbot UM, et al. A new family of potent AB cytotoxins produced by Shiga toxigenic Escherichia coli. J Exp Med. 2004;200:35-46. [134] Wang H, Paton JC, Paton AW. Pathologic changes in mice induced by subtilase cytotoxin, a potent new Escherichia coli AB5 toxin that targets the endoplasmic reticulum. J Inf Dis. 2007;196:1093-01. [135] Matsuura G, Morinaga N, Yahiro K, et al. Novel subtilase cytotoxin produced by Shiga-toxigenic Escherichia coli induces apoptosis in Vero cells via mitochondrial membrane damage. Infect Immun. 2009;77:2919-24. [136] Byres E, Paton AW, Paton JC, et al. Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin. Nature. 2008;456:648-52. [137] Wolfson JJ, May KL, Thorpe CM, et al. Subtilase cytotoxin activates PERK, IRE1 and ATF6 endoplasmic reticulum stress-signalling pathways. Cell Microbiol. 2008;10:1775-86. [138] Paton AW, Beddoe T, Thorpe CM, et al. AB5 subtilase cytotoxin inactivates the endoplasmic reticulum chaperone BiP. Nature. 2006;443:548-52. [139] Kim PS, Arvan P. Endocrinopathies in the family of endoplasmic reticulum (ER) storage diseases: disorders of protein trafficking and the role of ER molecular chaperones. Endocr Rev. 1998;19:173-02. [140] Morinaga N, Yahiro K, Matsuura G, et al. Two distinct cytotoxic activities of subtilase cytotoxin produced by Shiga-toxigenic Escherichia coli. Infect Immun. 2007;78:488-96. [141] Bielaszewska M, Fell M, Greune L, et al. Characterization of cytolethal distending toxin genes and expression in shiga toxin-producing Escherichia coli strains of non-O157 serogroups. Infect Immun. 2004;72:1812-1816. [142] Palermo M, Alves-Rosa F, Rubel C, et al. Pretreatment of mice with lipopolysaccharide (LPS) or IL-1beta exerts dose-dependent opposite effects on Shiga toxin-2 lethality. Clin Exp Immunol. 2000;119:77-83. [143] Keepers TR, Psotka MA, Gross LK, et al. A murine model of HUS: Shiga toxin with lipopolysaccharide mimics the renal damage and physiologic response of human disease. J Am Soc Nephrol. 2006;17:3404-14. [144] Sauter KA, Melton-Celsa AR, Larkin K, et al. Mouse model of hemolytic-uremic syndrome caused by endotoxin-free Shiga toxin 2 (Stx2) and protection fro m lethal outcome by anti-Stx2 antibody. Infect Immun. 2008;76:4469-78. [145] Louise CB, Obrig TG. Shiga toxin-associated hemolytic uremic syndrome: combined cytotoxic effects of Shiga toxin and lipopolysaccharide (endotoxin) on human vascular endothelial cells in vitro. Infect Immun. 1992;60:1536-43. [146] Tesh VL, Ramegowda B, Samuel JE. Purified Shiga-like toxins induce expression of proinflammatory cytokines from murine peritoneal macrophages. Infect Immun. 1994;62:5085-94. [147] Proulx F, Litalien C, Turgeon JP, et al. Circulating levels of transforming growth factor-beta1 and lymphokines among children with hemolytic uremic syndrome. Am J Kidney Dis. 2000;35:29-34.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 139

[148] Ray P, Acheson D, Chitrakar R, et al. Basic fibroblast growth factor among children with diarrhea-associated hemolytic uremic syndrome. J Am Soc Nephrol. 2002;13:699-07. [149] Proulx F, Toledano B, Phan V, et al. Circulating granulocyte colony-stimulating factor, C-X-C, and C-C chemokines in children with Escherichia coli O157:H7 associated hemolytic uremic syndrome. Pediatr Res. 2002;52:928-34. [150] Yamamoto T, Nagayama K, Satomura K, et al. Increased serum IL-10 and endothelin levels in hemolytic uremic syndrome caused by Escherichia coli O157. Nephron. 2000;84:326-32. [151] Karpman D, Manea M, Vaziri-Sani F, et al. Platelet activation in hemolytic uremic syndrome. Semin Thromb Hemost. 2006;32:128-45. [152] Nevard CH, Jurd KM, Lane DA, et al. Activation of coagulation and fibrinolysis in childhood diarrhoeaassociated haemolytic uraemic syndrome. Thromb Haemost. 1997;78:1450-55. [153] Nolasco LH, Turner NA, Bernardo A, et al. Hemolytic uremic syndrome–associated Shiga toxins promote endothelial-cell secretion and impair ADAMTS13 cleavage of unusually large von Willebrand factor multimers. Blood. 2005;106:4199-09. [154] Chandler WL, Jelacic S, Boster DR, et al. Prothrombotic coagulation abnormalities preceding the hemolyticuremic syndrome. N Engl J Med. 2002:346:23-32. [155] Barrett TJ, Potter ME, Wachsmuth IK. Bacterial endotoxin both enhances and inhibits the toxicity of Shigalike toxin II in rabbits and mice. Infect Immun. 1989;57:3434-37. [156] Harel Y, Silva M, Giroir B, et al. A reporter transgene indicates renal-specific induction of tumor necrosis factor (TNF) by shiga-like toxin. Possible involvement of TNF in hemolytic uremic syndrome. J Clin Invest. 1993;92:2110-16. [157] Weiss SJ. Tissue destruction by neutrophils. N Engl J Med. 1989;320:365-76. [158] Lentsch AB, Ward PA. Regulation of inflammatory vascular damage. J Pathol. 2000;190:343-48. [159] Walters MD, Matthei IU, Kay R, et al. The polymorphonuclear leucocyte count in childhood haemolytic uraemic syndrome. Pediatr Nephrol. 1989;3:130-34. [160] Buteau C, Proulx F, Chaibou M, et al. Leukocytosis in children with Escherichia coli O157:H7 enteritis developing the hemolytic-uremic syndrome. Pediatr Infect Dis J. 2000;19:642-7. [161] Inward CD, Howie AJ, Fitzpatrick MM, et al. Renal histopathology in fatal cases of diarrhoea-associated haemolytic uraemic syndrome. Pediatr Nephrol. 1997;11:556-59. [162] Milford DV, Staten J, MacGreggor I, et al. Prognostic markers in diarrhoea-associated haemolytic-uraemic syndrome: initial neutrophil count, human neutrophil elastase and von Willebrand factor antigen. Nephrol Dial Transplant. 1991;6:232-37. [163] Ishikawa N, Kamitsuji H, Murakami T, et al. Plasma levels of granulocyte elastase-alpha1-proteinase inhibitor complex in children with hemolytic uremic syndrome caused by verotoxin producing Escherichia coli. Pediatr Int. 2000;42:637-41. [164] Huber AR, Kunkel SL, Todd RF 3rd, et al. Regulation of transendothelial neutrophil migration by endogenous interleukin-8. Science. 1991;254:99-02. [165] Milford D, Taylor CM, Rafaat F, et al. Neutrophil elastases and haemolytic uraemic syndrome. Lancet. 1989;2:1153. [166] Fitzpatrick MM, Shah V, Trompeter RS, et al. Interleukin-8 and polymorphoneutrophil leucocyte activation in hemolytic uremic syndrome of childhood. Kidney Int. 1992;42:951-56. [167] Fernandez GC, Rubel C, Barrionuevo P, et al. Phenotype markers and function of neutrophils in children with hemolytic uremic syndrome. Pediatr Nephrol. 2002;17:337-44. [168] Fernandez GC, Gomez SA, Rubel CJ, et al. Impaired neutrophils in children with the typical form of hemolytic uremic syndrome. Pediatr Nephrol. 2005;20:1306-14. [169] Fernandez GC, Gomez SA, Ramos MV, et al. The functional state of neutrophils correlates with the severity of renal dysfunction in children with Hemolytic Uremic Syndrome. Pediatr Res. 2007;61:123-28. [170] Walters MD, Levin M, Smith C, et al. Intravascular platelet activation in the hemolytic uremic syndrome. Kidney Int. 1988;33:107-15. [171] Tarr PI, Gordon CA, Chandler WL. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 2005;365:1073-86. [172] Foster GH, Tesh VL. Shiga toxin 1-induced activation of c-Jun NH(2)-terminal kinase and p38 in the human monocytic cell line THP-1: possible involvement in the production of TNF-alpha. J Leukoc Biol. 2002;71:107-14.

140 Pathogenic Escherichia coli in Latin America

Ibarra and Palermo

[173] Geelen JM, van der Velden TJ, van den Heuvel LP, et al. Interactions of Shiga-like toxin with human peripheral blood monocytes. Pediatr Nephrol. 2007;22:1181-7 [174] Westerholt S, Pieper AK, Griebel M, et al. Characterization of the cytokine immune response in children who have experienced an episode of typical hemolytic-uremic syndrome. Clin Diagn Lab Immunol. 2003;10:109095. [175] Ramos MV, Fernández GC, Patey N, et al. Involvement of the fractalkine pathway in the pathogenesis of childhood hemolytic uremic syndrome. Blood. 2007;109:2438-45. [176] Fernandez GC, Ramos MV, Gomez SA, et al. Differential expression of function-related antigens on blood monocytes in children with hemolytic uremic syndrome. J Leukoc Biol. 2005;78:853-61. [177] Ancuta P, Weiss L, Haeffner-Cavaillon N. CD14+CD16++ cells derived in vitro from peripheral blood monocytes exhibit phenotypic and functional dendritic cell-like characteristics. Eur J Immunol. 2000;30:187283. [178] Karpman D, Hakansson A, Perez MT, et al. Apoptosis of renal cortical cells in the hemolytic-uremic syndrome: in vivo and in vitro studies. Infect Immun. 1998;66:636-44. [179] Dran GI, Fernandez GC, Rubel CJ, et al. Protective role of nitric oxide in mice with Shiga toxin-induced hemolytic uremic syndrome. Kidney Int. 2002;62:1338-48. [180] Fernandez, GC, Rubel C, Dran G, et al. Shiga toxin-2 induces neutrophilia and neutrophil activation in a murine model of hemolytic uremic syndrome. Clin Immunol. 2000;95:227-34. [181] Fernandez GC, Lopez MF, Gomez SA, et al. Relevance of neutrophils in the murine model of haemolytic uraemic syndrome: mechanisms involved in Shiga toxin type 2-induced neutrophilia. Clin Exp Immunol. 2006;146:76-84. [182] Gomez SA, Fernandez GC, Camerano G, et al. Endogenous glucocorticoids modulate neutrophil function in a murine model of haemolytic uraemic syndrome. Clin Exp Immunol. 2005;139:65-73. [183] Keepers TR, Gross LK, Obrig TG. Monocyte chemoattractant protein 1, macrophage inflammatory protein 1 alpha, and RANTES recruit macrophages to the kidney in a mouse model of hemolytic-uremic syndrome. Infect Immun. 2007;75:1229-36. [184] Comerford I, Nibbs RJ. Post-translational control of chemokines: a role for decoy receptors? Immunol Lett. 2005;96:163-74. [185] Palermo MS, Alves Rosa MF, Van Rooijen N, et al. Depletion of liver and splenic macrophages reduces the lethality of Shiga toxin-2 in a mouse model. Clin Exp Immunol. 1999;116:462-67. [186] Gomez SA, Fernandez GC, Vanzulli S, et al. Endogenous glucocorticoids attenuate Shiga toxin-2-induced toxicity in a mouse model of haemolytic uraemic syndrome. Clin Exp Immunol. 2003;131:217-24. [187] te Loo DM, Monnens LA, van Der Velden TJ, et al. Binding and transfer of verocytotoxin by polymorphonuclear leukocytes in hemolytic uremic syndrome. Blood. 2000;95:3396-02. [188] Brigotti M, Caprioli A, Tozzi AE, et al. Shiga toxins present in the gut and in the polymorphonuclear leukocytes circulating in the blood of children with hemolytic-uremic syndrome. J Clin Microbiol. 2006;44:313-17. [189] Fukuda MN, Dell A, Oates JE, et al. Structures of glycosphingolipids isolated from human granulocytes. The presence of a series of linear poly-N-acetyllactosaminylceramide and its significance in glycolipids of whole blood cells. J Biol Chem. 1985;260:1067-82. [190] Geelen JM, van der Velden TJ, Te Loo DM, et al. Lack of specific binding of Shiga-like toxin (verocytotoxin) and non-specific interaction of Shiga-like toxin 2 antibody with human polymorphonuclear leukocytes. Nephrol Dial Transplant. 2007;22:749-55. [191] King AJ, Sundaram S, Cendoroglo M, et al. Shiga toxin induces superoxide production in polymorphonuclear cells with subsequent impairment of phagocytosis and responsiveness to phorbol esters. J Infect Dis. 1999;179:503-07. [192] Liu J, Akahoshi T, Sasahana T, et al. Inhibition of neutrophil apoptosis by verotoxin 2 derived from Escherichia coli O157:H7. Infect Immun. 1999;67:6203-05. [193] Flagler MJ, Strasser JE, Chalk CL, et al. Comparative analysis of the abilities of Shiga toxins 1 and 2 to bind to and influence neutrophil apoptosis. Infect Immun. 2007;75:760-65. [194] Palermo MS, Exeni RA, Fernández GC. Hemolytic uremic syndrome: pathogenesis and update of interventions. Expert Rev Anti Infect Ther. 2009;7:697-07. Review. [195] van Setten PA, Monnens LA, Verstraten RG, et al. Effects of verocytotoxin-1 on nonadherent human monocytes: binding characteristics, protein synthesis, and induction of cytokine release. Blood. 1996;88:17483.

Host Responses to Pathogenic Escherichia coli

Pathogenic Escherichia coli in Latin America 141

[196] Savage B, Saldivar E, Ruggeri ZM. Initiation of platelet adhesion by arrest onto fibrinogen or translocation on von Willebrand factor. Cell. 1996;84:289-97. [197] Cummings RD, Bainton, DF, McEver, RP. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. J Cell Biol. 1995;128:661-671. [198] Michelson AD, Barnard MR, Krueger LA, et al. Circulating monocyteplatelet aggregates are a more sensitive marker of in vivo platelet activation than platelet surface P-selectin: studies in baboons, human coronary intervention, and human acute myocardial infarction. Circulation. 2001;104:1533-37. [199] Gear AR, Camerini D. Platelet chemokines and chemokine receptors: linking hemostasis, inflammation, and host defense. Microcirculation. 2003;10:335-50.

142

Pathogenic Escherichia coli in Latin America, 2010, 142-161

CHAPTER 10 Diarrheagenic Escherichia coli in Argentina Marta Rivas1*, Nora Lía Padola2,3, Paula MA Lucchesi2,4 and Marcelo Masana5 1

Servicio Fisiopatogenia, Instituto Nacional de Enfermedades Infecciosas – ANLIS “Dr. C. G. Malbrán”, Av. Vélez Sarsfield 563, 1281 Buenos Aires, Argentina. 2Laboratorio de Inmunoquímica y Biotecnología, Facultad de Ciencias Veterinarias, Universidad Nacional del Centro, 7000 Tandil, Prov. de Buenos Aires, Argentina. 3CIC-PBA. 4 Consejo Nacional de Investigaciones Científicas y Técnicas. 5Instituto Tecnología de Alimentos. Centro de Investigación de Agroindustria, Instituto Nacional de Tecnología Agropecuaria, INTA. B1708WAB Morón, Prov. de Buenos Aires, Argentina. Abstract: In Argentina, a total of 1,117,718 diarrheal diseases cases were notified in 2008 with an incidence rate of 28.12/100,000 inhabitants, being Diarrheagenic Escherichia coli (DEC) strains the most important etiological agents associated to them. Several community-based studies have assessed the relative frequency of DEC pathotypes, accounting for 6 to 28.8% (EPEC), 9.7 to 24.4% (ETEC), 0.3 to 17.1% (EIEC), 1.2 to 17.1% (STEC), 20 to 31.4% (EAEC), and 27.1 to 29% (DAEC). In the last 10 years, approximately 500 HUS cases were reported annually, with an incidence that ranged between 7.8 and 17/100,000 children less than 5 years of age. STEC O157:H7 was the major serotype isolated (60%), with prevalent genotype stx2/stx2c(vh-a)/eae/ehxA (81.4%), mainly of the phage type 4 (40%). Two XbaI-PFGE patterns are prevalent, AREXHX01.0011 and AREXHX01.0022, representing respectively 9.9% and 5.6% of the E. coli O157 Argentinean isolates in the database. Among the non-O157 STEC strains, genetic profiles were more diverse, but stx2/eae/ehxA (66.2%) was prevalent. STEC strains, mainly Stx2-producers, have been recovered from animals and food, being cattle an important reservoir, with increased risk of illness linked to beef-related dietary habits, and animal exposure. The implementation of integral preventive measures is necessary to decrease the incidence of diarrheal disease in Argentina and the associated human and economic costs.

INTRODUCTION Diarrheal diseases are a serious public health problem in infants and young children who have high rates of morbidity and mortality, especially in developing countries. Under the conditions of poverty, poor environmental sanitation and hygiene, inadequate water supplies, and limited education, diarrheal diseases occur more frequently with lethal consequences [1]. Diarrhea contributes to the death of 4 to 6 million children annually in Asia, Africa, and America. In poor countries, it has been estimated that each child suffers up to 15 to 19 episodes of diarrhea per year. Beginning in the 1980s, substantial global efforts were directed at reduction of diarrheal disease mortality [2]. These efforts were based on the recognition that acute dehydrating played an important role in the fatal outcome of the illnesses. It was demonstrated that dehydration could be treated with oral fluids and electrolytes replacement, along with a continued feeding, rather than by intravenous fluids [3]. These treatments provided a much more effective and widely available therapy that resulted in the initiation of national diarrheal control programs in nearly all developing countries. In Argentina, the notification of cases of acute diarrhea to the National Health Surveillance System is mandatory. A total of 1,117,718 cases were notified in 2008 with an incidence rate of 28.12 cases per 100,000 inhabitants and 374 deaths registered. The incidence was different by regions with higher values in the northwestern provinces, with 312,611 cases notified and an incidence rate of 67.47 per 100,000 inhabitants (Fig. 1). Children less than 5 years of age were more vulnerable with 505,703 cases notified and an incidence rate of 149.64 per 100,000 [4]. The frequency of cases and incidence rates by age groups are shown in Fig. 2. *Address correspondence to: Dr. Marta Rivas, Servicio Fisiopatogenia, INEI – ANLIS “Dr. Carlos G. Malbrán”, Av. Vélez Sarsfield 563, 1281 Buenos Aires, Argentina; Tel/Fax: 0054-11-43031801; E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 143

Figure 1: Incidence rates of diarrhea cases per 100,000 inhabitants by Provinces, Argentina 2008. National Health Surveillance System, Ministry of Health.

Figure 2: Number of diarrhea cases (columns) and incidence rates per 100,000 inhabitants (line and dots), Argentina 2008.National Health Surveillance System, Ministry of Health.

More than one century ago, a bacterium that could be found in the feces of healthy individuals, named at that time as Bacterium coli commune, was first described [5]. This facultative anaerobic microorganism, known today as Escherichia coli is a normal inhabitant of the large intestine of mammals. Most E. coli are usually harmless, however some strains have virulence attributes that cause a spectrum of diseases such us septicemia, meningitis, urinary tract infection, and diarrheal disease. It is surprising that it was not until 1945 that Bray could unequivocally prove that E. coli could be diarrheagenic in humans [6]. On the basis of specific virulence determinants, the diarrheagenic E. coli (DEC) are classified into at least five pathotypes (or virotypes): enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli

144 Pathogenic Escherichia coli in Latin America

Rivas et al.

(EIEC), Shiga toxin-producing E. coli (STEC), including enterohemorrhagic E. coli (EHEC), and enteroaggregative E. coli (EAEC). A sixth pathotype, named diffuse-adhering E. coli (DAEC), has been proposed as a putative cause of diarrhea, although its pathogenic capability and epidemiologic significance are at present controversial. Virulence determinants give each pathotype the capacity to cause a clinical syndrome with distinctive epidemiologic and pathologic characteristics. [7]. DIARRHEAGENIC Escherichia coli IN HUMAN DISEASE As part of a multicenter collaborative study performed in two hospitals of Rosario, Argentina, between August 1985 and December 1988, Notario et al. [8] reported the frequency of enteropathogens in 495 hospitalized and outpatient children less than 5 years of age with acute diarrhea. The most prevalent agents were EPEC (26.1%), ETEC (9.7%), Shigella spp. (8.5%), Rotavirus (5.1%), Giardia (3.6%), Campylobacter spp. (3.2%), and Salmonella spp. (2.4%). EPEC was isolated more frequently in hospitalized children in comparison with outpatients (p < 0.001), mainly among children less than 5 months of age. The predominant O-groups were O111 (50%), O55 (16.7%), O119 (14.1%), and O26 (6.4%). Regarding ETEC, ST-producing ETEC was isolated in 4.8% of the cases, LT-producing ETEC in 4.0% and LT/ST-producing ETEC in 0.8%. The most frequent O-groups were O128 (44%), O153 (16 %), O78 (12 %), and O20 (8%). Among the 164 E. coli strains recovered, 83.5% were resistant to ampicillin and 80.5% to sulfamethoxazole- trimethoprim. A prospective study was conducted in two communities with different socio-economic levels, Zaiman and Las Dolores, Misiones, to evaluate the occurrence of enteropathogens in children less than 5 years of age [9]. A total of 152 children were followed-up during two years by means of quarterly visits, in which fecal samples were collected. During the study, one or more enteropathogens were identified in 73.9% of samples in children from Zaiman and in 58.3% samples from Las Dolores, as being associated to diarrhea in 70.5% of the cases. The number of diarrheic episodes was higher in Zaiman (15.4%) than in Las Dolores (12.3%). ETEC was isolated from 65 (15.6%) of 415 samples in Zaiman and from 31 (12.3%) of 252 in Las Dolores. EPEC was isolated in 6% and 3.9%, and EIEC in 0.3% and 0.8%, in Zaiman and Las Dolores, respectively. E. coli strains isolated from 140 children less than 24 months of age, attended in Mendoza with acute (120), persistent (16) and chronic (4) diarrhea were studied by HEp-2 cell-adherence assay. Forty strains recovered from children without diarrhea were included as controls. Three patterns of adherence were recognized in strains isolated from diarrheic patients; localized adherence (LA) (15 strains, 11%), diffuse adherence (DA) (41, 29%), and aggregative adherence (AA) (28, 20%). Strains showing LA pattern were isolated from children with acute diarrhea, mainly less than 12 months of age (p = 0.0001). AA pattern was recognized only in strains isolated from diarrhea cases and strains showing DA pattern were isolated with similar frequency from cases and controls [10]. The antimicrobial susceptibility of enteropathogens isolated from 4,364 children less than 5 years of age with acute diarrhea, between August 1985 and December 1991 in seven cities of Argentina was analyzed. [11]. A total of 2,180 bacteria were isolated corresponding 1109 (50.9%) to EPEC, 507 (23.2%) to ETEC, 345 (15.8%) to Shigella spp., 200 (9.2%) to Salmonella spp., and 19 (0.9%) to Aeromonas spp. DEC strains showed resistance to ampicillin (74.5%), and to sulfamethoxazole-trimethoprim (64.2%). Quiroga et al. [12] studied the time of appearance of the first asymptomatic infection caused by the different categories of DEC, in 44 children since their birth until the first 20 months of their lives. In all children, at least one DEC strain was detected throughout the 20 months of the study. Although 97 diarrheal episodes (2.2 episodes/child/20 months) were recorded, the study reported only asymptomatic DEC infections. A total of 510 (33.5%) DEC strains were isolated from 1,524 fecal samples, with the following frequency; EAEC (31.4%), EPEC (28.8%), DAEC (27.1%), and ETEC (12.7%). Neither STEC nor EIEC were recovered. ETEC was detected more frequently in children of the 6-11 months age group, meanwhile the frequency of asymptomatic infections by EAEC, EPEC and DAEC tended to decrease with age. The median age for DEC colonization was 7.5 months. The mean weaning period was 12.8 months and the mean age for introduction of mixed feeding (breast fed supplemented) was 3.8 months. A significantly lower incidence of diarrheal disease and asymptomatic infections was recorded among the exclusively breast-fed rather than in the supplemented and non breast-fed children (p < 0.05).

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 145

From October 9th through November 12th, 1996, an outbreak of bloody diarrhea occurred in a neonatal nursery ward in a hospital of Neuquén city, in the southwestern region of Argentina. E. coli O18ac:H31 strains were isolated from seven patients of the intermediate care unit. All of the symptomatic patients were premature, except one child with necrotizing enterocolitis who died three days after birth. The strains were negative for a number of virulence factors typically found in DEC strains, but all isolates possessed the enterohemolysin ehxA gene, were resistant to the antibiotics ampicillin and chloramphenicol, and showed a low adherence property in HeLa cells without any recognizable pattern. On November 13th, a prevalence study to evaluate the outbreak dissemination in the neonatology ward was conducted. E. coli strains with identical phenotypic and genotypic characteristics were isolated from 11 of 16 inpatients and 4 of 33 staff members. By random amplification of polymorphic DNApolymerase chain reaction (RAPD-PCR) and pulsed-field gel electrophoresis (PFGE), the strains showed indistinguishable patterns. Cross-infection prevention protocols were improved and rigorously enforced and postoutbreak prevalence studies were performed weekly thereafter without detecting new cases [13]. Medina et al. [14] reported the results of one study carried out in Corrientes, in which feces from 120 children aged 1 month to 14 years with acute diarrhea, attending health centers in poor neighborhoods of the city, were cultured and analyzed by a multiplex PCR [15] to detect the presence of DEC. All children had urban housing with drinking water supply and toilet. In 41 (37%) samples, DEC strains were detected. The frequency was the following: 10 (24.4%) ETEC, 10 (24.4%) EAEC, 7 (17.1%) EPEC, 7 (17.1%) STEC, and 7 (17.1%) EIEC. There were not significant differences in the frequency of DEC pathotypes by sex or age group of the patients. SHIGA TOXIN-PRODUCING Escherichia coli (STEC) STEC in Humans Shiga toxin-producing E. coli (STEC) is an important foodborne pathogen which can cause non-bloody diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS) [16]. HUS, a life-threatening complication that occurs in 5-10% of patients, is characterized by microangiopathic hemolytic anemia, thrombocytopenia, and renal failure [17]. The dominant STEC serotype is O157:H7, which was identified as a human pathogen in 1982 [18]. However, there have been increasing reports of non-O157 strains associated with gastrointestinal infections [19]. The production of Shiga toxin 1, Shiga toxin 2, and/or their variants (Stx1c, Stx2c, Stx2-O118, Stx2-OX3a, Stx2dactivatable, and Stx2f) is the primary virulence trait responsible for human disease. Another virulence-associated factor is a 94-kDa outer membrane protein, called intimin, which is encoded by the eae gene on a chromosomal pathogenicity island termed the Locus of Enterocyte Effacement (LEE). However, a wide number of LEE-negative STEC strains are capable of causing human disease [19]. The products of several genes have been suggested to play a role in virulence, including adhesins, toxins, proteases, iron acquisition systems, LPS, and flagellin. In addition, most STEC strains produce an enterohemolysin (EHEC-Hly), encoded by a large plasmid-borne (60-MDa) gene known as ehxA, that has been associated with severe clinical disease in humans [20]. Cattle and other ruminants have been implicated as the main reservoir of O157:H7 and non-O157 strains [21]. STEC infections are transmitted to humans through contaminated food, water, and direct contact with infected persons or animals [22]. In Argentina, data on human STEC infections are gathered through different strategies: 1) the National Health Surveillance System collects data of HUS cases, and since 2000, the immediate and individualized report is mandatory; 2) the Sentinel Surveillance System through 25 HUS Sentinel Units; 3) the Laboratory-based Surveillance System through the National Diarrheal and Foodborne Pathogens Network; and 4) the Molecular Surveillance through the PulseNet of Latin America and Caribbean. Over the last 10 years, approximately 500 HUS cases were reported annually. The incidence has ranged between 7.8 and 17 cases per 100,000 children less than 5 years of age and the lethality was between 2 and 5% (Fig. 3). Each year, the National Reference Laboratory (NRL) receives samples from approximately 60% of the HUS cases reported.

146 Pathogenic Escherichia coli in Latin America

Rivas et al.

Figure 3: Number of hemolytic uremic syndrome cases (columns), incidence rates per 100,000 children less than 5 years of age and percentages of lethality (line and dots), 1999-2008.

Since 2003, the molecular surveillance of STEC using the PFGE methodology has been implemented through the PulseNet Latin America and Caribbean. Argentinean Databases for O157 and non-O157 STEC strains were created by the NRL. In the period 1988-2009, a total of 710 XbaI-PFGE patterns corresponding to 1775 STEC O157 strains, isolated from human infections (1398), food (154), animals (190) and environmental samples (33), were included. Two XbaI-PFGE patterns are prevalent, AREXHX01.0011 (n=176) and AREXHX01.0022 (n=100), representing 9.9% and 5.6% of the Database, respectively. Among the non-O157 STEC strains, 891 XbaI-PFGE patterns, corresponding to 1190 isolates, from human infections (465), food (161), animals (561) and environmental samples (3), were established. In Argentina, the E. coli O157 strains showed a high degree of diversity, however, strains with similar patterns have been isolated in different regions throughout the years and were grouped in clusters when they were linked by time or place. The identity of the strains, grouped in clusters or outbreaks by XbaI-PFGE, was further confirmed by PFGE using BlnI as a second enzyme. As part of the International PulseNet, the NRL receives consultations from CDC. As an example, the PFGE pattern (EXHX01.0124) established during the spinach outbreak in the US has been previously recognized in Argentina (AREXHX01.0057). At the NRL, three diagnostic criteria are used to establish the STEC infection: 1) isolation and characterization of STEC strains; 2) detection of free fecal Stx (StxMF); and 3) serological tests to detect Stx-antibodies. Novillo et al. [23] showed an evidence of STEC infection in 49 patients with HUS. StxMF was detected in 31% of the patients and Stx-neutralizing antibodies in 61%. López et al. [24] found a cumulative evidence of STEC infection in 85% of HUS cases with a low incidence of E. coli O157:H7 (2%). However, Miliwebsky et al. [25] found evidence of STEC infection in 59% of Argentinean HUS cases, and E. coli O157 was the predominant serogroup. During a prospective study to determine the frequency of STEC infection in 95 household contacts of 34 children with HUS and 34 children with acute gastroenteritis who did not develop HUS, Rivas et al. [26] found cumulative evidence in 38.2% of HUS patients, 31.6% of family members and 29.4% of control children, that Stx2 was prevalent in STEC strains and StxMF. These results showed the wide STEC dissemination in the Argentinean population and that person-to-person transmission may play an important role in the high incidence of HUS in our country. The phenotypic and genotypic features of 103 STEC strains isolated from 99 children with HUS, bloody and nonbloody diarrhea, and the clonal relatedness of E. coli O157:H7 strains using typing techniques were established [27]. The strains belonged to 18 different serotypes, 59% of which were of serotype O157:H7. The stx2 gene was

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 147

prevalent (90.3%). Among the 61 E. coli O157 strains, 93.4% harbored the stx2 and stx2c(vh-a) genes; PT4 (39.3%) and PT2 (29.5%) were the predominant phage types. By XbaI-PFGE, a total of 41 different patterns with 80% similarity were identified and seven clusters with identical profiles were established. Leotta et al. [28] performed a study to compare the phenotypic and genotypic characteristics of STEC O157 strains isolated between 1993 and 1996 from humans in Argentina, Australia and New Zealand, and to establish their clonal relatedness. A total of 73 strains isolated from HUS (n=36), bloody diarrhea (n=20), non-bloody diarrhea (n=10) and unspecified conditions (n=7) were included. The most frequent stx genotypes were stx2 and stx2c(vh-a) (91%) in Argentina, stx2 (89%) in New Zealand, and stx1 and stx2 (30%) in Australia. All strains harbored the eae gene and 72 strains produced enterohemolysin (EHEC-Hly). The most frequent PT identified in Argentinean, Australian, and New Zealand strains were PT49 (n=12), PT14 (n=9), and PT2 (n=15), respectively. Forty-six different patterns were obtained by XbaI-PFGE; 37 strains were grouped in 10 clusters and 36 strains showed unique patterns. No common XbaI-PFGE pattern was found among the strains isolated in the three countries. This study revealed differences in the stx-genotype, phage type and PFGE profiles of clinically-significant STEC O157 isolated from humans in these countries, and could explain the differences observed in the frequency of STEC O157-associated infections in those places. In 2007, during a study carried out in Neuquén City [29], 908 fecal samples of adults and pediatric patients with bloody and non-bloody diarrhea were screened by multiplex PCR. A total of 11 (1.2%) STEC-positive samples were found. The rate of STEC detection in diarrhea was low in comparison with the high number of HUS cases reported in the province of Neuquén at the same period. These results suggest that the strains of this region may have a higher pathogenic potential, which allows a rapid evolution to HUS, hampering STEC detection at the first stage of diarrhea. In the period 2004-2008, a total of 846 STEC infections were confirmed, mainly associated with STEC O157. However, non-O157 infections were also detected. A total of 848 STEC strains were isolated and confirmed at the NRL from 426 HUS, 223 bloody and 102 non-bloody diarrhea cases, and 97 to other pathologies. In two cases, a coinfection with two different STEC serotypes was detected. The most prevalent serotypes identified were O157:H7 (74.9%) and O145:NM (13.3%). Other O-groups, such us O121 (19, 2.2%), O26 (15, 1.8%), O174 (9, 1.1%), O111 (5, 0.6%), and O8 (4, 0.5%), among others, were also detected. In the case of STEC O157:H7 strains, the genetic profile stx2 and stx2c(vh-a), eae, ehxA (517, 81.4%) prevailed, followed by stx2, eae, ehxA (89, 14%). PT4 (40%), PT49 (25%) and PT2 (20%) were the most frequently phage types found. The strains showed a high antimicrobial susceptibility (97.6%). Among the non-O157 STEC strains, genetic profiles were more diverse, but stx2, eae, ehxA (66.2%) and stx1, eae, ehxA (11.3%) were the prevalent. The antimicrobial susceptibility was 81.2%. The intimin subtypes were specifically associated to some O:H serotypes. Similar to other studies, the intimin gamma (Int-γ) was associated with serotypes O157:H7/NM and O145:NM; the Int-β to O26:H11/NM and O145:H25; while Int-ε to O103:H2 and O121:H19; and Int-θ to O111:NM. In Argentina, outbreaks are identified through the surveillance system of HUS and STEC-associated diseases. The definition of an outbreak used for this analysis is two or more symptomatic and/or asymptomatic linked cases. PFGE and phage typing are used to establish the clonal relatedness of the isolates. In the period 2002-2009, a total of 12 outbreaks of bloody diarrhea and HUS cases associated with O157 and non-O157 STEC strains occurred at kindergartens, families and the community (Table 1). Table 1: Outbreaks associated with O157 and non-O157 STEC strains. No. of Patients BD/HUS

No. of Asympto matics

Buenos Aires

1/0

1

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0226

unknown

Kindergarten

Mar del Plata

13/1

0

O26:H11 O103:H2

stx1, eae, ehxA stx1, eae, ehxA

AREVCX01.0037 AREXWX01.0016

person-to-person

Kindergarten

Entre Ríos

3/1

2

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0243

swimming pool

Year

Outbreak Site

2002

Kindergarten

2003 2004

Place

Serotype

Genetic Profile

XbaI-PFGE pattern

Source

Rivas et al.

148 Pathogenic Escherichia coli in Latin America 2005

Kindergarten

Rosario

27/4

1

O145:NM ONT:HNT

stx2, eae, ehxA stx2d2 (vh-b)

ARENMX01.0006

swimming pool

2006

Kindergarten

Buenos Aires

1/0

5

O174:H21

stx2d2 (vh-b)

AREZDX01.0015

unknown

2006

Family

Neuquén

0/1

4

O145:NM

stx2, eae, ehxA

ARENMX01.0027

person-to-person

2007

Community

Neuquén

3/1

0

O157:H7

stx2, eae, ehxA

AREXHX01.0200

unknown

2008

Kindergarten

Buenos Aires

1/2

0

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0489

unknown

2008

Family

La Pampa

0/1

1

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0153 AREXHX01.0344

bovine meat, fresh sausage

2008

Family

Neuquén

0/1

3

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0331

person-to-person

2008

Kindergarten

Río Negro

0/1

1

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0011

unknown

2009

Kindergarten

Córdoba

0/2

6

O157:H7

stx2 and stx2c (vh-a), eae, ehxA

AREXHX01.0427

unknown

Legend: BD = bloody diarrhea, HUS = hemolytic uremic syndrome

In 2008, the Sentinel Unit of La Pampa Province [30], working together with the Epidemiology Branch and the Food Laboratory, was able to establish a clonal relatedness among STEC O157 strains isolated from an HUS case, an asymptomatic household contact and foods. The isolated strains presented the same genetic profile, belonged to PT49, and PFGE patterns (XbaI-PFGE AREXHX01.0344 and XbaI-PFGE AREXHX01.0153) with a high degree of similarity were established, with only one band difference, and they were considered part of the same cluster (08LPEXH-10). Miliwebsky et al. [31] described the detection and duration of fecal shedding of O157 and non-O157 STEC strains in symptomatic and asymptomatic cases during outbreaks in daycare centers. In different events, it was observed that STEC O157:H7 strains were shed by approximately 30 days, while O26 and O145 STEC strains were shed during 37 and 19 days, respectively. This study contributed to define control strategies to reduce the risk of STEC infection, by which to educate professional health workers, teachers and parents. In the period of 2001-2002, the first prospective case-control study was conducted to evaluate risk factors for sporadic STEC infection among Argentinean children in Mendoza and Buenos Aires cities and their surroundings [32]. A total of 150 cases and 299 controls were enrolled. Serotype O157:H7 was the most commonly isolated STEC (60%). Analysis of single variable associations identified dietary habits and animal exposures linked to illness. Eating beef outside the home and eating undercooked beef in diverse locations was associated with illness. Living in or visiting a place with farm animals, contact with farm animals, and contact with cattle manure were associated with illness. Risky exposures suggesting person-to-person transmission from young children included contact with a child less than 5 years of age, attending daycare or kindergarten, and contact with a child less than 5 years old with diarrhea. Wearing diapers was also linked to illness. The protective factors identified were eating more than the median number of fruits and vegetables, being a male, and those that always washed their hands after handling raw beef. On multivariable logistic regression analysis, significant risk factors for STEC infection were eating undercooked beef outside their home (p = 0.02), living in or visiting a place with farm animals (p = 0.01), contact with a child less than 5 years old suffering from diarrhea (p = 0.04), and having non-parental household income (p = 0.01). With this model, the fixed adjustment factors had significant estimated protective associations as follows: eating more than the median number of fruits and vegetables (p = 0.0007), be a male (p = 0.001), having a nonparent respondent (p = 0.001), and the respondent always washing hands after handling raw beef (p = 0.001). As part of the case-control study, in 2002 the first relationship between a sporadic HUS case and the consumption of home-prepared hamburger 48 h before diarrhea onset was established [33]. The isolates recovered from the child and from the food were characterized as STEC O157:H7 stx2 and stx2c(vh-a), eae, ehxA of PT4 with identical restriction patterns (XbaI-PFGE AREXHX01.0011 and BlnI-AREXHA26.0040). In a study performed by Rivero et al. [34], 437 children up to 6 years old with different types of diarrhea were studied. STEC were detected in both bloody and non-bloody stools from children with acute diarrhea, with or

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 149

without HUS. STEC was found in 10% of all stool specimens analyzed, and in 46% of stool cultures of patients with HUS. It is interesting that in 30% of STEC-positive samples, and in 20% of STEC-positive HUS cases, stools were non-bloody. All STEC isolates produced a cytopathic effect on Vero cells, confirming the ability for Stx expression. STEC strains, belonging to different serotypes (O157:H7, O145:NM, O26:H11, O121:H19, O111:H8, O118:H2, O128:NM) and with different virulence profiles were isolated. O157:H7 was the serotype most frequently found in stool samples of pediatric patients with HUS and in 38% of the stool samples from patients without HUS. Positive associations were found between the O157:H7 serotype and development of HUS, as well as with higher hospitalization rates and abdominal pain. With the exception of one strain, all isolates harbored the eae and ehxA genes, and they were in general associated with severe disease. None of the five stx1-positive isolates was associated with HUS development. While most of the isolates were susceptible to all antimicrobials tested, one strain was multi-resistant and corresponded to an E. coli O157:H7 isolated from a HUS patient who did not receive antimicrobial therapy. It is important to note that a positive association between HUS development and antibiotic therapy was established for the patients that had evidence of STEC infection. Rivero (PhD Thesis) found that the occurrence of HUS, the isolation of O157:H7 and the stx-type showed a seasonal variation. In the same study, the consumption of frozen food and a history of recent travel seemed to independently increase the risk for STEC infection, whereas vegetable consumption could be considered a protective factor. STEC in the Bovine Reservoir and in Other Animals In Argentina, cattle rearing are characterized by extensive grazing, nevertheless, intensive feeding practices have been increasing in the last 15 years, and nowadays 10% of beef cattle come from feedlots. Several studies have confirmed that cattle are a reservoir of STEC [35-41]. However, it is necessary to take caution when comparing prevalence data between studies, due to differences in season, number of animals and herds sampled, type and age of animals, methodology of sampling and analysis [42, 43]. Sanz et al. [35] found that the prevalence of STEC in grazing-fed cattle and cattle at slaughter was 33% and 44%, respectively. In different feedlots, the prevalence of STEC ranged from 1% to 50%, but when 11 consecutive samplings were conducted in a feedlot, the prevalence increased to 63%. E. coli O157:H7 was detected in 28% of the sampled farms, in 6.7% of the animals serially sampled, and in 0.2% of the animals sampled once. These results confirm the intermittent shedding of STEC to the environment, which increases transmission between animals, and allows reinfection [38]. All E. coli O157:H7 strains were characterized as stx2, eae, ehxA-positive, and 75% of them belonged to PT4. In this study, one STEC O120:H19 strain was isolated from cattle, a serotype previously detected only in human disease in other countries. Padola et al. [44] reported the isolation of a STEC O145:NM strain in feedlot cattle. This finding is relevant, as O145:NM is the second STEC serotype more frequently associated with human disease in Argentina. In dairy cattle, the prevalence of STEC was determined as 37% in milking cows and 43% in calves. STEC O157 was detected in 0.2% of the cows and 0.8 % of the calves [45]. Meichtri et al. [39], in another prevalence study conducted over 200 young steers, isolated 86 STEC strains from 39% STEC-positive animals. The most prevalent serotype was O8:H19 (12.8%), while 51.2% of the isolates belonged to serotypes previously associated with hemorrhagic colitis or HUS worldwide, including Argentina. In this study STEC O157:H7 was isolated in one animal (0.5%), though no specific detection methodology was employed. The virulence profile of the STEC strains revealed that stx2 genotype was prevalent (79.1%) followed by stx1 and stx2 (14%), and stx1 (7%). Four (4.7%) strains of serotypes, O2:NM, O112:H2, O145:NM, O157:H7 carried the stx2, eae, and ehxA genes associated with a higher virulence. Regarding the prevalence of the O157 serotype in cattle, a value of 3.8% was reported over 288 fecal samples in a beef cattle farm of Gualeguaychú, Argentina [46]. The prevalent stx-genotype identified was stx1 and stx2c(vh-a) in 11 isolates (64%) from cattle. In the same study, E. coli O157 strains from surface water troughs were also recovered (5.1%), but no genetic correlation between bovine and water strains was found. Prevalence of STEC O157 in cattle has also been established in an extensive investigation on O157 and non-O157 STEC conducted in nine selected beef exporting abattoirs of Argentina. A prevalence of 4.1% (CI 95% 2.9-5.6) for

150 Pathogenic Escherichia coli in Latin America

Rivas et al.

STEC O157 was found in the fecal content of 811 bovines at slaughter [41]. This study also established the contamination of STEC O157 in the carcasses as 2.6% (CI 95% 1.6-3.9). Among 54 STEC O157:H7 strains isolated, the predominant stx-genotype was stx2 and stx2c(vh-a) (56%), which also is the prevalent stx-genotype (>80%) in STEC O157 post-enteric HUS cases in Argentina. In these same abattoirs, the prevalence of non-O157 STEC in fecal and carcass samples was estimated as 22% and 9%, respectively [47]. Six serotypes (O8:H19, O179:H19, ONT:H2, O130:H11, O113:H21 y ONT:H7), accounted for half of all 307 non-O157 STEC isolates, whereas 4.2% of strains belonged to O-groups with the highest pathogenic potential (O103 y O145). Interestingly, in the same study, strains of O-group O174 (serotype O174:H21), which is the predominant non-O157 O-group isolated from foods (M. Rivas, personal communication), was recovered from 11 samples (7 feces and 4 carcasses), representing the 3.6% of all non-O157 serotypes. In feral pigeons, Parma et al. [48] studied the presence of stx, in particular stx2f, and intimin (eae) genes in 111 samples from fresh droppings of pigeons and 29 samples from cloacal swabs of racing pigeons. The screening was made by PCR, detecting eae, stx1 and stx2 genes in 34%, 1% and 15% of the samples, respectively. Among eaepositive samples, 69% were stx-negative. In this study, the variant stx2f was reported for the first time in Argentina. It was detected in 9% of the samples, which were predominantly eae-positive. STEC was isolated from 58% of pigs, 64% of the strains produced both Stx1 and Stx2 and corresponded to serogroups O111 and O157 [49]. In piglets without diarrhea but showing delayed growth, Parma et al. [50] isolated 2% of strains carrying stx1, 10% stx2, and 6% Stx2e. In dogs, Bentancor et al. [51] found that 4%, 4% and 7% of samples were positive for stx2, stx1 and rfbO157, respectively, but Fernández et al. [52] found dogs to be negative for STEC. In cats, 4% of the samples were positive for stx2, 2% for stx1 and 3% for rfbO157 [51]. In another study of STEC in asymptomatic humans and their pets, Gallego et al. [53] reported a 3.4% and 3.6% prevalence in dogs, and cats, respectively. E. coli O157:H7 strains (2/6, 33.3%) harboring the stx2 and stx2c(vh-a), eae, ehxA genotype, and belonging to PT2 were identified. The PFGE patterns established had been previously included in the E. coli O157 Database associated with HUS and bloody diarrhea cases. These findings add evidence that pets can be carriers of infection for the susceptible population. STEC was recovered from wild animals kept in captivity in Argentina [54]. In this study, 50.8% of samples collected by rectal swabs at the Zoo and Botanical Garden of La Plata City were STEC positive. Ten species of the order Cetartiodactyla, including, Alpaca, Patagonian Cavy, Red Deer, Antelope, among others, and one species of the Rodentia order, were recognized as new carriers of STEC. Among the seven serotypes identified, the most frequently detected was O146:H28 (24%), previously associated with human infections. Interestingly, toxin type stx1c was first identified in Argentina often in combination with stx2-O118 o stx2-OX3a genes. STEC in Foods Among beef products, STEC was detected in 29% of hamburger samples, and in 25% to 43% of ground beef samples [36, 55]. Serotypes O20:H19, O91:H21, O113:H21, O116:H21, O117:H7, O171:H2, O174:H21 were shared with cattle in the same area [36]. In another study, Gómez et al. [56] described the detection of non-O157 STEC in 8.4% of frozen hamburgers and in 0.9% of soft cheese. The serotypes identified were O8:H19 (in hamburger and cheese) and O8:H16, O113:H21 and O39:H4 in hamburgers. At retail outlets, E. coli O157:H7 was detected in 3.9% of 279 meat products [57] corresponding to 3.8% in ground beef samples, 4.8% in fresh sausages, and 3.3% in dry sausages. All 11 isolates harbored both eae and ehxA genes and were genotyped as stx2 and stx2c(vh-a) (n=4), stx1 and stx2c(vh-a) (n=5), stx1 (n=1) and stx2c(vh-a) (n=1). Oteiza et al. [58] established a 3% prevalence of STEC in “morcilla”, a typical Argentinean sausage, sampled at local retail markets. Two (2%) strains were characterized as STEC O157:H7 harboring the stx2 and stx2c(vh-a), eae, ehxA genes, and one (1%) strain, as STEC O26:H11 carrying the stx1, eae, ehxA genes. Roldán et al. [59] sampled 250 ground beef and hamburger at retail outlets, and 150 samples of bulk tank milk from dairy barns for STEC O157:H7 by selective enrichment and immunomagnetic separation. STEC O157:H7 stx2, eae, ehxA-positive strains were isolated from 1.2% of the beef samples, while milk samples were STEC-negative.

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 151

Alonso et al. [60] collected 300 samples from chicken hamburger, 300 giblet samples, and 40 chicken carcass swabs (external and visceral cavity surfaces) from different retail stores in Tandil, Argentina. Shiga toxin-encoding genes, with a predominance of stx2, were detected in 17% and 3% of hamburger and giblet samples, respectively. In carcass swabs, 2 samples were stx2-positive, and 3 were stx1-positive. The eae-γ1, characteristic of STEC O157, was not detected in this study. The proportion of stx-positive hamburger samples was greater at butcheries than at poultry shops, whereas the opposite trend was observed for eae gene. The results of this study suggested a possible STEC cross-contamination of chicken hamburgers elaborated at butcheries. Chinen et al. [61] described the isolation and characterization of STEC O157:H7 from cooked and uncooked beef and chicken burgers and from chicken carcasses. Samples were collected during sampling procedures triggered by episodes of infection reported in 2001 and 2002 in Buenos Aires City. Twenty STEC O157:H7 strains were isolated from 19 (6.8%) out of 279 samples of beef and chicken burgers, and 4 strains from 4 (10.3%) out of 39 chicken carcasses. The prevalent stx-genotype was stx2 and stx2c(vh-a) (14 strains, 58%). All strains were characterized as eae and ehxA-positive. By XbaI-PFGE, the strains yielded 10 different patterns. Eighteen out of 24 strains were grouped in four clusters: #1 (4 strains, AREXHX01-0043), #2 (4 strains, AREXHX01-0022), #3 (8 strains, AREXHX010139), and #4 (2 strains, AREXHX01-0200). Identical strains by phage typing, stx-genotyping and PFGE were detected in uncooked and cooked beef and chicken burgers in different restaurants, which had been collected on the same or different sampling dates. These findings underline the importance of STEC O157 detection in meat products, to improve active surveillance, and to define control strategies in order to prevent new cases of STEC infection. In a comparative study of STEC strains isolated from animals and foods in Argentina (n=44) and Brazil (n=22), relevant differences were found in the prevalent stx-genotype in each country [62]. One half of STEC O157 strains of Argentina carried stx2 and stx2c(vh-a) genes, while most strains from Brazil harbored only the stx2c(vh-a) gene. From 13 different O:H non-O157 STEC serotypes, O113:H21 was identified in both countries. In non-O157 STEC strains from Argentina, stx2 was more prevalent than in Brazil (p < 0.01), whereas stx1 alone or in combination was prevalent in Brazil (68.8%). Genetic Diversity of STEC Strains Most studies performed in Argentina on STEC strains isolated from cattle revealed that stx2 isolates are more frequent than stx1 strains [35, 37-39, 62-64]. The same trend is observed among strains from bovine meat [36, 55, 61]. Nevertheless, Balagué et al. [65] found that isolates from ready-to-eat food were stx1 and stx2-positive, and Rüttler et al. [66] found a similar frequency of stx1 and stx2 isolates from cattle and carcasses in a slaughterhouse. Krüger et al. [67] characterized the stx variants in 186 STEC strains from cattle and bovine meat isolated in previous studies [35, 36, 38, 55]. The stx2 genotype, alone or in combination with stx1 or other stx2 variants was the most frequent stx-genotype (ca. 50%), followed by stx2c(vh-b), and stx2c(vh-a). Both, stx2d and stx2g variants were found in less than 5% of the isolates, being stx2d present in strains carrying another stx2-variant. The stx2g variant was detected among isolates from cattle in feedlot belonging to O2:H25, O15:H21 and O175:H8 serotypes, not associated with other variants. All stx2 variants, except for stx2g were present in isolates from both bovine and meat sources. All O157:H7 strains carried stx2 in association with stx2c(vh-a), in agreement with the data reported by Chinen et al. [37, 57] and Guth et al. [62] in isolates from meat and cattle. Twenty-two percent of the STEC strains possessed more than one stx variant, from which the most frequent combination was stx1 and stx2. In stx1-positive strains, stx1 genotype was predominant (98%), and only one isolate presented a RFLP pattern characteristic of stx1d variant, but none strains carried stx1c. Basal and induced cytotoxic activity seemed to be associated with the stx-type or variant, more than with the serotype, or the origin of the isolate [67]. The presence of more than one stx variant was not reflected in a higher cytotoxicity titer. Among isolates with a single stx2 variant, those carrying stx2 had high titers under both noninduced and induced conditions. Under mitomycin C treatment, the highest increase in cytotoxicity was detected among strains carrying stx2c(vh-a) or stx2c(vh-b) variants. On the other hand, the isolates carrying stx1 had a lower response to mitomycin C treatment than most of the stx2 strains. Interestingly, all stx2g strains showed a low response to mitomycin C induction. The eae gene was detected in 24% of the 186 STEC isolates, with a lower frequency in strains isolated from food than from cattle. In relation to stx genes, eae was detected more frequently in stx1-positive than stx2-positive STEC

152 Pathogenic Escherichia coli in Latin America

Rivas et al.

strains, and both eae and stx1 were more frequent in calves than adult cattle. Subtypes  and  were the predominant eae variants, while  was present at a lower rate and  was absent. As expected, isolates belonging to the same serotype presented the same eae variant [64, Krüger A, PhD Thesis]. The saa gene, that encodes an autoagglutinating adhesin, was present in the same proportion as eae (24%), but always in eae-negative isolates. A higher percentage of saa-positive strains were found in food isolates, in accordance with the lower eae-frequency [Krüger A, PhD Thesis]. Lucchesi et al. [68] designed a PCR assay to detect variants of saa that differ in a region containing tandem repeats and detected five variants of the gene, revealing the existence of 2 novel saa variants which have a higher number of repeat units than those previously studied. Toma et al. [69] found for the first time another saa variant, with the presence of only one repeat. These authors could not attribute the differences in adherence capability among the isolates to the number of tandem repeats and suggested that multiple adherence mechanisms are present in saaharboring STEC, implying a high degree of diversity in this group. The study of Lucchesi et al. (68) showed that in some serotypes, all isolates were always saa-positive, whereas in O20:H19, O113:H21 and O174:H21, both saapositive and saa-negative isolates were detected. Furthermore, some saa-positive strains of the same serotype that shared their virulence genes could be differentiated by the saa variant. These results show that the study of the saa gene can be useful for characterizing eae-negative strains, as isolates belonging to the same serotype may not only differ in the presence or absence of this gene, but could also possess a different variant of saa. Almost all saapositive strains were also ehxA-positive, as expected, since both genes are encoded in the megaplasmid. Considering isolates belonging to serotypes O20:H19, O113:H21 and O174:H21, it was observed that ehxA-positive strains were also saa-positive, and all ehxA-negative strains were also saa-negative [68]. In the STEC collection analyzed by Krüger [PhD thesis], ehxA was detected almost in half of the isolates, and was prevalent in both eae-positive strains and saa-positive strains. Among these isolates, only 4 strains were saa-positive but ehxA-negative, which could suggest a different localization of the gene or, more likely, could be due to the proposed variability of the megaplasmid of STEC strains [68]. This genetic variability was also highlighted by Lucchesi et al. [70] with another megaplasmid gene, that codes for subtilase cytotoxin. Ninety five STEC strains isolated from cattle and meat were selected to allow assessment of potential associations among subAB, other virulence factors and serotypes. In general, subtilase-positive strains were also saa-positive and ehxA-positive, but neither all saa-positive nor ehxA-positive strains were subAB-positive. Strains positive for subAB belonged to serotypes O2:H5, O20:H19, O39:H49, O79:H19, O88:H21, O113:H21, O141:H8, O178:H19, ONT:H7, ONT:H8 and ONT:H19. For comparison purposes, Galli et al. [71] studied by PCR the prevalence of 8 virulence markers in 153 cattle and 47 human LEE-negative STEC strains isolated in Argentina. Also, their correlation with severe disease was established. The virulence markers studied comprises 5 fimbrial and nonfimbrial adhesin-encoding genes (fimA, iha, efa1, lpfAO113, and saa) and 3 toxin genes (cdt-V, subAB and astA) in addition to the Shiga toxins. The most prevalent virulence marker found was that encoded by the lpfAO113 gene (199/200, 99%). Comparatively, the lpfAO113, fimA, iha, saa, subAB, cdt-V and astA genes were detected in 100%, 2.8%, 85%, 52.9%, 36%, 11.8% and 9.8% of the cattle strains and in 97.9%, 5.7%, 89.4%, 40.4%, 32%, 17% and 10.6% of the human strains, respectively. All STEC strains were efa1 negative. The most prevalent profile observed among cattle and human STEC strains was lpfAO113 iha fimA. These results showed that bovine LEE-negative STEC strains possessed genes encoding virulence factors present in human LEE-negative STEC strains that are associated with disease. Despite a great diversity of virulence profiles observed, further studies comparing wild type strains and their allelic mutants are needed to evaluate the role of each factor in the pathogenesis of LEE-negative STEC strains during human infections. Krüger et al., [72] studied by RAPD the intra-serotype genetic diversity of O20:H19, O113:H21, O117:H7, O157:H7, O171:H2 and O174:H21 serotypes isolated from cattle and meat. Some profiles were shared among strains belonging to a same serotype that had been isolated from different sources (feedlot cattle, grazing cattle, cattle at abattoir, hamburger meat). Some isolates, previously regarded as identical according to their virulence profile, showed different RAPD profiles. Two multiple locus VNTR (variable number tandem repeats) analysis protocols to genotype STEC were adapted to be performed at laboratories that do not possess an automatic sequencer. The allele nomenclature adopted is suitable for the comparison of results among laboratories.

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 153

One of the protocols, specific for O157:H7 serotype, was adapted by Bustamante et al. [73], from those developed by Lindstedt et al. [74], Noller et al. [75] and Keys et al. [76]. A selection of fifteen O157:H7 isolates was genotyped by this MLVA protocol showing diversity values from 0.49 to 0.73 for the VNTRs, and the presence of 14 new alleles [73]. Nine MLVA profiles were observed and were grouped in two main clusters, one of which grouped all bovine isolates from the same farm. In concordance with the origin of the samples, the differences found among non-related isolates were greater than those presented by isolates from the same farm. This protocol gave a higher discrimination than RAPD and can be considered a useful alternative for the molecular characterization of a large number of STEC O157:H7 isolates. The second MLVA protocol enables the characterization of both O157:H7 and non-O157 STEC isolates [77]. Bustamante et al. [78] typed 64 STEC strains from cattle, foods, and patients with diarrhea, belonging to 8 different serotypes. Strains were selected to reflect a diversity of time-geographically related and unrelated isolates. All strains were typed by this method, and 41 different MLVA genotypes were established. The dendrogram showed two main clusters, one of which corresponded to O157:H7 and the other to non-O157 strains (Fig. 4). Loci diversity indexes notably differed among serotypes, being O157:H7 the most variable serotype, which presented 11 profiles and showed variability in six loci. One of the 7 VNTR loci could only be amplified in isolates belonging either to that serotype or to O145:NM. The selected O145:NM isolates from cattle of a same feedlot, were the least variable group, followed by isolates of serotypes O91:H21, O113:H21 and O117:H7, which presented variability in only one loci. The results confirmed the suitability of this MLVA method for future epidemiological studies of STEC strains, of both O157 as well as non-O157 O-groups. It also encourages the search of additional VNTR loci that could allow a higher discrimination among non-O157 STEC. Prospect for STEC Control in the Bovine Reservoir Considering the high prevalence of STEC in cattle and the potential contamination of carcasses during processing at slaughterhouse, two approaches have been undertaken in Argentina to reduce incidence of human infections with this pathogen. One of them, based on competitive exclusion strategies, is the administration of probiotic bacteria to cattle. Etcheverría et al. [79, Etcheverría AI, PhD thesis] isolated E. coli strains from bovine colon which exhibit inhibitory activity against STEC O157:H7 and non-O157, in vitro and in vivo, by the production of bacteriocins, and can be useful in the control of this pathogen in reservoirs. The other approach is the vaccination of cattle against STEC O157:H7. Vaccine formulations based on two recombinant proteins from EHEC, a carboxyl-terminal fragment of intimin and EspB (Escherichia coli secreted protein B), were first evaluated in BALB/c mice. After intranasal vaccination, strong humoral and cellular immune responses were observed against intimin and EspB [80]. The same recombinant proteins were assayed in calves through intramuscular route. In the vaccinated animals, the excretion of STEC O157:H7 was reduced and high serum IgG titers were observed [81]. ENTEROTOXIGENIC Escherichia coli (ETEC) ETEC in Humans ETEC is a common cause of acute diarrhea in developing countries and in travelers to those countries. The manifestations of ETEC infection run the spectrum from asymptomatic infection to severe dehydrating diarrheal illness. The virulence of ETEC is attributed to its ability to colonize intestinal epithelium via fimbrial adhesive factors and express secretogenic enterotoxins of a heat-labile (LT) and/or heat-stable (ST) variety [7]. ST may be classified in two major genotypes, i.e., STa and STb; typically ETEC strains isolated from human stools produce STa (STI) encoded by the estA gene, whereas STb (STII) is produced by animal ETEC strains. Two different subtypes of STa exist, i.e. STh (STIb) and STp (STIa). At present, more than 22 different colonization factors (CFs) have been described for human ETEC; CFA/I, CS1-CS8, CS10-CS15, and CS17-CS22. Several serogroups have been most frequently associated with ETEC isolates, including O6, O8, O20, O78, O127, O153, O159, and others. In Argentina, ETEC constitutes one of the main causes of infantile diarrhea, accounting for 10 to 15% of the bacterial intestinal infections [8, 82].

Rivas et al.

154 Pathogenic Escherichia coli in Latin America

665p O157:H7 (7,8,4,13,10,9,8) 652p O157:H7 (7,8,4,13,10,9,8) 643p O157:H7 (7,8,4,13,10,9,8) 174p O157:H7 (7,8,4,13,10,9,8) 166p O157:H7 (7,8,4,13,10,9,8) 187p O157:H7 (7,8,4,13,30,9,8) mat167/6 O157:H7 (7,8,5,30,9,9,8) gal26 O157:H7 (7,5,4,10,9,6,8) EDL933 O157:H7 (7,9,4,10,8,5,8) fb81 O157:H7 (7,7,3,13,30,10,8) fb22 O157:H7 (7,7,3,13,10,10,8) fb80 O157:H7 (7,7,3,10,8,11,8) fb3 O157:H7 (7,7,3,10,9,11,8) fcO157 O157:H7 (7,9,5,10,10,8,10) ht2-15 O157:H7 (7,8,5,10,9,8,10) fc103 O113:H21 (7,1,30,12,6,7,5) fo135 O91:H21 (7,1,30,12,6,7,5) fo130 O91H21 (7,1,30,12,6,7,5) am170-3 O174:H21 (7,1,30,12,6,7,5) ht7-14 O113:H21 (7,1,30,12,6,10,5) ap97-3 O113:21 (7,1,30,12,6,10,5) ht1-14 O117:H7 (7,1,30,12,6,10,5) be2-3 O113:H21 (7,1,30,12,6,9,5) am214-1 O117:H7 (7,1,30,12,6,6,5) hab14 O91:H21 (7,1,30,12,6,6,5) ft156O117:H7 (7,1,30,12,6,11,5) fb31 O174:H21 (7,1,30,12,6,11,5) ap16-1 O91:H21 (7,1,30,12,6,5,5) ap28-1 O20:19 (9,1,30,12,6,7,5) t22-2 O20:H19 (9,1,30,12,6,7,5) t22-1 O20:H19 (9,1,30,12,6,7,5) am114-1 O20:H19 (9,1,30,12,6,16,5) am178-2 O174:H21 (6,1,30,12,6,16,5) t186-3 O174:H21 (6,1,30,12,6,9,5) fb8 O171:H2 (8,1,30,12,6,10,5) cm20-7 O171:H2 (8,1,30,12,6,6,5) fo140 O171:H2 (8,1,30,12,6,2,5) am217-1 O171:H2 (8,1,30,12,6,11,5) am203-3 O171:H2 (8,1,30,12,6,9,5) am200-2 O171:H2 (8,1,30,12,6,9,5) fb58 O171:H2 (8,1,30,12,6,9,5) fb49 O171:H2 (8,1,30,12,6,9,5) fb38 O171:H2 (8,1,30,12,6,9,5) fb27 O171:H2 (8,1,30,12,6,9,5) fb10 O174:H21 (8,1,30,12,6,5,5) fb33 O174:H21 (8,1,30,12,6,5,5) cm25-12 O174:H21 (8,1,30,12,6,12,5) fo122 O174:H21 (8,1,30,12,6,16,5) fc101 O174:H21 (8,1,30,12,6,15,5) fb5 O145:H- (8,1,2,12,6,3,5) fb13 O145:H- (8,1,2,12,6,3,5) fb97 O145:H- (8,1,2,12,6,3,5) fb73 O145H- (8,1,2,12,6,3,5) fo112 O20:H19 (9,30,30,12,6,16,5) fo114 O20:H19 (9,30,30,12,6,16,5) ht 1-6 O20:H19 (9,30,30,12,6,11,5) am174-1 O171:H2 (1,1,30,30,6,8,5) ap32-1 O117:H7 (7,1,30,12,30,30,5) ht2-2 O117:H7 (7,1,30,12,30,10,5) fg163 O117:H7 (7,1,30,12,30,6,5) ft161 O117:H7 (7,1,30,30,30,8,5) fc149 O117:H7 (7,1,30,12,6,8,5) fc146 O117:H7 (7,1,30,12,6,8,5) am174-2 O174:H21 (7,1,30,12,30,8,5) ht6-2 O20:H19 (7,1,30,10,6,30,5)

1

.9

.8

.7

.6 .5 Linkage Distance

.4

.3

.2

.1

0

Figure 4: Dendrogram based on MLVA profiles of E. coli O157:H7 and non-O157 STEC strains isolated in Argentina, and EDL933 reference strain. The scale shown represents linkage distance.

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 155

The incidence of ETEC was studied in 85 children less than 4 years old with acute diarrhea attended in one pediatric hospital of Buenos Aires, and in 38 healthy children [83]. ETEC was recovered from 10.6% children with diarrhea with the following frequency: ST-producing ETEC (6 cases); LT/ST-producing ETEC (2), and LT-producing ETEC (1). LT-producing ETEC was recovered in only one (2.6%) control child. Five (55.5%) out of 9 ETEC strains isolated from diarrhea cases expressed CFA/I (4) and CFA/II (1). A broad diversity of serotypes was found in ETEC-associated diarrhea cases (O9:H10, O20:H34; O51:H10; O78:HNT; O125ac:NM; O153:H45), some of them rarely observed in other countries. Resistance to four or more antibiotics was found in 82.4% of the ETEC strains. The genetic relatedness among 29 ETEC strains of serotype O6:H16 was investigated by RAPD analysis [84]. The strains were isolated in Brazil (n=6), México (n=5), Honduras (n=1), The Philippines (n=4), Bangladesh (n=4), and Argentina (n=9), displayed CS1-CS3 or CS2-CS3, and expressed LT and ST (a single strain expressed only LT). Ten RAPD types were established which showed significant similarity with an average of 82% of the amplified bands in common. These observations supported the notion that ETEC strains sharing many phenotypic traits, such as serotype, CFs, and toxin profile could be clonal groups from a common ancestor. A prospective cohort study of ETEC infections in children from two communities located in Misiones, northeastern Argentina, was conducted during 2 years. Of 730 fecal specimens collected, 137 (19%) corresponded to diarrheal episodes. ETEC was isolated from a significantly higher proportion of symptomatic (18.3%) than asymptomatic (13.3%) children (p = 0.04541). Individuals of up to 24 months of age were found to have a higher risk of developing ETEC diarrhea than older children (p = 0.00021). ST-producing ETEC was directly associated with diarrhea (p = 0.00035). Colonization factors (CFs), CFA/I, CFA/II, CFA/III, and CFA/IV, coli surface antigens CS7 and CS17; and putative CFs PCFO159, PCFO166, and PCFO20 were identified in ETEC strains isolated from symptomatic and asymptomatic children. When each CF was considered separately, CS17 was the only factor independently associated with illness (p = 0.0151) [85]. During a prospective study carried out in different regions of Argentina to evaluate the presence of CFs, 109 ETEC strains were isolated from 1,211 children with diarrhea [86]. CFs were found in 52% of the ETEC strains; 23% CFA/I, 17% CFA/IV, and 12% CFA/II. All CFA/I strains produced ST, and several of them were of the prevalent serotypes O153:H45 (48%) and O78:H12 (36%). Among the 19 strains expressing CFA/IV, 16 (84%) expressed CS5 and CS6 and produced ST and most was of serotype O128:H21 (75%), the remaining 3 strains produced CS6 only. None ETEC strain expressed CS4. Most CFA/II-carrying ETEC strains (85%) expressed CS1 and CS3, 10 of them produced LT and ST and belonged to O6:K15:H16 serotype. Epidemiological studies carried out in Argentina revealed that there is a high proportion (35 to 40%) of ETEC strains isolated form children with diarrhea that do not express any defined CFs. Among this group, those of the serogroup O20 are the most frequently isolated. Pichel et al. [87] identified in one ETEC O20:H- strain very thin fibrilla-like structures on bacterial surface which mediated the adherence on Caco-2 cells. The N-terminal amino acid sequence of the structural subunit showed 95% homology to that of CS15 of ETEC (former antigen 8786) and 65% homology with fimbria SEF14 of Salmonella enterica serovar Enteritidis. In this non-fimbrial adhesin, named CS22, the subunit protein differed in 30 residues from that of CS15. A total 19 ETEC strains of serogroup O20, isolated from children with diarrhea, and from healthy controls in different regions of Argentina were studied by means of a combination of DNA typing approaches and adhesion to Caco-2 cells [88]. Most of the strains produced ST and were non-motile. By RAPD and PFGE, three sets of closely related strains were established with different binding properties. The strains of the most prevalent group expressed the adhesin CS22. As the occurrence of the various ETEC adhesins varies significantly within the different geographical areas, it is important to identify the more prevalent CFs in regions where ETEC vaccines need to be implemented. The ETEC O153:H45 CFA/I ST phenotype seems to be one of the most frequently found phenotypes in Latin America and Spain, where it represents a leading cause of infantile diarrhea. Pacheco et al. [89] studied the genetic relationship among 29 ETEC O153:H45 CFA/I ST isolates collected from diarrheic children in Argentina, Brazil, Mexico and Spain using DNA-based typing methods. The results showed that ETEC O153:H45 CFA/I ST isolates belong to a single cluster and whose isolates share on average, 84% of the RAPD bands and 77% of the PFGE

156 Pathogenic Escherichia coli in Latin America

Rivas et al.

restriction fragments. However, the presence of different clonal lineages was established. Some genetic variants were isolated from defined geographic areas, while places like São Paulo City in Brazil and the middle-eastern region of Argentina were populated by several genetic variants of related but not identical ETEC strains. Pichel et al. [90] assessed the prevalence of the type IV longus pilus among 217 ETEC strains isolated from diarrhea during different epidemiological studies conducted from 1988 to 1993, in nine different areas of Argentina. The structural lngA gene was present in 20.7% of the isolates and was highly associated with ST-producing ETEC strains. Oviedo et al. [91] showed that the hydrophobicity on the ETEC cell surface, the hemaglutination properties, and the LT production were considerably reduced after treatment with subinhibitory concentrations (0.0075 µg/ml) of ciprofloxacin, these results suggested that a subinhibitory concentration could interfere with the process of hostparasite interactions, such as adherence and toxin production. Rivas et al. [92] studied the serum antibody responses against LT and CFA/I and CFA/II of ETEC in 84 children less than 5 years of age living in two communities of Misiones, Argentina. Children of both communities developed significantly increased antibody titers against LT and CFA/II but not against CFA/I during 3 months of follow-up. There were 13 episodes of ETEC-associated diarrhea. Antibody titers rose to maximum levels during the second year of age and reached relatively constant levels in children aged 2-5 years, probably due to repeated exposure to ETEC strains. Antibody titers of 30 children were followed for 2 years, increases in anti-LT and anti-CFA titers varied in the different age groups. During the follow-up, 6 of 30 children had symptomatic and asymptomatic reinfections and 4 had only symptomatic infection due primarily to LT-producing ETEC. ETEC in Animals Parma et al. [50] performed a study in 28 piggeries of the central and northeast region of Argentina and found a predominance of ETEC strains in the group of animals with diarrhea (dams and piglets). The STIa gene was detected in 21% of E. coli isolated from piglets with diarrhea, in comparison with 3% for LTI. ETEC strains were not isolated from healthy piglets and dams without diarrhea. In piglets without diarrhea but showing delayed growth, STIa-positive strains were isolated from 2% of the animals, and LTI-positive strains from 6%. The prevalent Ogroup was O64. EPEC IN ANIMALS AND FOODS In retail stores of chicken products, Alonso et al. [60] detected eae gene in almost 50% out of 300 giblet samples. A lower proportion of eae-positive samples were observed among chicken hamburgers and carcasses (21 and 7%, respectively). The proportion of eae-positive hamburger samples was greater at poultry shops than at butcheries, but no differences were evident for samples from giblets. All samples from carcasses were taken from poultry shops, and positive samples corresponded to 1 external and 2 visceral cavity surfaces from different carcasses. Parma et al. [48], analyzing 140 samples from fresh droppings of pigeons and from cloacal swabs of racing pigeons, reported that 34% were eae–positive and stx-negative, suggesting the presence of EPEC strains. ENTEROINVASIVE Escherichia coli (EIEC) Although infections with EIEC strains can result in a dysentaric syndrome, most often this strains cause watery diarrhea. The ability of theses strains to invade cells is due to virulence genes harbored on a 140 MDa plasmid (pInv). Chinen et al. [93] described the characterization of 16 EIEC strains isolated from diarrheic patients using an enzyme-linked immunosorbent assay and the keratoconjunctivitis test (Sereny Test). The following serotypes were found; O28ac:NM (7 strains), O84:H30 (1), O112ac:NM (2), O121:NM (2), O124:NM (2), ONT:NM (2). A total of 37.5% of the strains were resistant to at least four or more antibiotics and the most frequent resistance pattern was ampicillin, cephalotin, mezlocillin, and piperacillin. ENTEROAGGREGATIVE Escherichia coli (EAEC) EAEC represent a major cause of protracted diarrhea in children in developing countries, where they are linked to diarrheal illness of travelers. In industrialized countries EAEC are considered emerging pathogens and cases

Diarrheagenic Escherichia coli in Argentina

Pathogenic Escherichia coli in Latin America 157

associated to EAEC infection are reported to be sporadic, but some outbreaks have been described. The sources of infection have rarely been identified in these episodes. This E. coli pathotype is defined by aggregative adherence (AA) to HEp-2 cells in a characteristic “stacked brick” pattern. The AA phenotype is associated the presence of 65 MDa plasmid (pAA) and the expression of one of two distinct aggregative adherence fimbria (AAFI and AAFII), and in some cases the enterotoxin EAST1 and the cytotoxin Pet. Rüttler et al. [94] described the characterization of 87 E. coli strains isolated from patients less 2 years old with acute diarrhea in Mendoza, Argentina, using the reference HEp-2 assay and AAF/I- and EAST1-PCR assays. Based on the adhesion to HEp-2 cells, 22 (25%) strains showed the localized (LA), 18 (21%) the aggregative (AA) pattern and 10 (11%) diffuse (DA) pattern. Twenty-five strains were positive by EAST1-PCR, but only 13 of them expressed the AA pattern on HEp-2 cell-adherence assay, and 13 strains were positive by AAF/I-PCR but only 8 showed the AA pattern. CONCLUSIONS Diarrheagenic E. coli strains are one of the most serious health problems in Argentina, especially in disadvantaged areas of the country, where sanitary conditions are less than adequate. Taking into account the number of diarrhea cases reported and their prevalence in asymptomatic infections, strains of the ETEC and EPEC pathotypes are the main pathogenic agents of diarrheal disease associated with DEC. However, STEC are of particular concern in Argentina, because of the high incidence of HUS, leading to death, or severe sequelae that impose a high toll to the health system. Several research groups have demonstrated that animals, especially bovines, play an important role in the infection cycle of STEC in Argentina. The in-depth characterization of the strains, by established, and advanced genetic techniques, have also contributed to the better knowledge of the relationships between human, animal and environmental strains circulating in the country. In order to improve the control and prevention of DEC infections in Argentina, it is required a continuing effort to increase the capabilities of the National Health Surveillance System, of the reference and research laboratories, and to strength data sharing-networks, such as, PulseNet of Latin America and Caribbean. ACKNOWLEDGEMENTS The data reported here is a summary of the efforts of many individuals and working groups who have collaborated to develop a clearer picture of DEC infections in Argentina. REFERENCES [1]

Black RE, Lanata CF. Epidemiology of diarrheal disease in developing countries. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, Eds. Infections of the gastrointestinal tract. Raven Press Ltd., New York, 1995.p13-35. [2] Claeson M, Merson MH. Global progress in the control of diarrheal diseases. Pediatr Infect Dis J. 1990;9:345-55. [3] World Health Organization. Reducing risks, promoting healthy life. The World Health Report. 2002. Available from: http://www.who.int/whr/en/. [4] Sistema Nacional de Vigilancia de la Salud. Ministerio de Salud. República Argentina. 2008. Available from http://www.msal.gov.ar/htm/site/sala de situación/paneles/boletines. [5] Escherich T. Die darmbakteriem des neugeborerem und säuglings. Fortsch Med. 1885;3:515-22, 547-54. [6] Bray J. Isolation of antigenically homogeneus strains of Bact. coli Neapolitanum from summer diarrhea of infants. J Pathol. 1945;57:239-47. [7] Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. [8] Notario R, Morales E, Carmelengo E, et al. Microorganismos enteropatógenos en niños con diarrea aguda en dos hospitales de Rosario, Argentina. Medicina (Buenos Aires), 1993;53:289-99. [9] Vergara M, Quiroga M, Grenon S, et al. Prospective study of enteropathogens in two communities of Misiones, Argentina. Rev Inst Med Trop S Paulo, 1996;38:337-347. [10] Ortiz A, Rüttler ME, García B, et al. Acumulación de actina y adherencia a células HEp-2 de cepas de Escherichia coli aisladas de niños con diarrea en Mendoza, Argentina. Rev Arg Microbiol. 1998;30:3-9. [11] Binsztein N, Picandet AM, Notario R, et al. Resistencia a los antimicrobianos de especies de Salmonella, Shigella, Escherichia y Aeromonas aisladas de niños diarreicos en siete centros de Argentina. Rev Latinoam Microbiol. 1999;41:121-6.

158 Pathogenic Escherichia coli in Latin America

[12] [13] [14] [15] [16]

[17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27]

[28]

[29]

[30]

[31] [32] [33] [34] [35] [36]

Rivas et al.

Quiroga M, Oviedo P, Chinen I, et al. Asymptomatic infections by diarrheagenic Escherichia coli in children from Misiones, Argentina, during the first twenty months of their lives. Rev Inst Med Trop S Paulo, 2000;42:9-15. Chinen I, Rivas M, Soriano V, et al. Escherichia coli ehl1gene-positive serotype O18ac:H31 associated with an outbreak of diarrhea in a neonatal nursery in Neuquén City, Argentina. J Clin Microbiol. 2002;40:1225-30. Medina GM, Esquivel P, Lifschift V, et al. Detección de Escherichia coli diarreogénicos en niños de barrios humildes de Corrientes, Argentina. Rev Cubana Med Trop. 2010;62:56-65. Toma C, Lu Y, Higa N, et al. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol. 2003;4:2669-71. Griffin PM, Mead P, Sivapalasingam S. Escherichia coli O157:H7 and other enterohemorrhagic Escherichia coli, In: Blaser MJ, Smith PD, Ravdin JI, Grenberg HB, Guerrant RL Eds. Infections of the gastrointestinal tract, 2nd edition. Lippincott Williams and Wilkins, Philadelphia, 2002;p627-42. Gianantonio C, Vitacco M, Mendilaharzu F, et al. The hemolytic uremic syndrome. J Pediatr. 1964;64:478-91. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308:681-5. Bettelheim KA. The non-O157 Shiga-toxigenic (Verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol. 2007;33:67-87. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598-602. Caprioli A, Morabito S, Brugreb H, et al. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289-311. World Health Organization. Prevention and control of enterohaemorrhagic (EHEC) infections. Report of a WHO Consultation. World Health Organization, Geneva, Switzerland, 1997. Novillo A, Voyer L, Cravioto R, et al. Haemolytic uraemic syndrome associated with faecal cytotoxin and verotoxin neutralizing antibodies. Pediatr Nephrol. 1988;2:288-90. López EL, Diaz M, Grinstein S, et al. Hemolytic uremic syndrome and diarrhea in Argentine children: the role of Shigalike toxins. J Infect Dis. 1989;160:469-75. Miliwebsky E, Balbi L, Gómez D, et al. Síndrome urémico hemolítico en niños de Argentina: su asociación con la infección por Escherichia coli productor de toxina Shiga. Bioq Patol Clín. 1999;63:113-21. Rivas M, Voyer LE, Tous M, et al. Verocytotoxin-producing Escherichia coli infection in family members of children with hemolytic uremic syndrome. Medicina (Buenos Aires). 1996;56:119-25. Rivas M, Miliwebsky E, Chinen I, et al. Characterization and epidemiologic subtyping of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog Dis. 2006;3:88-96. Leotta GA, Miliwebsky ES, Chinen I, et al. Characterisation of Shiga toxin-Producing Escherichia coli O157 strains isolated from humans in Argentina, Australia and New Zealand. BMC Microbiol. 2008;8:46-53 doi: 10.1186/1471-21808-46. González G, Pianciola L, Di Russo, et al. Escherichia coli O157:H7 outbreaks, San Martín de los Andes, Neuquén, Argentina. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires, Argentina. 2009,p60. Almada G, Estrella P, Ottavianoni L, et al. Relación clonal de Escherichia coli O157:H7 aislada en un caso de SUH, un portador asintomático y muestras de alimentos. La Pampa, Argentina, 2008. La Industria Cárnica Latinoam. 2009;158:811. Miliwebsky E, Deza N, Chinen I, et al. Prolonged fecal shedding of Shiga toxin-producing Escherichia coli among children attending day-care centers in Argentina. Rev Arg Microbiol. 2007;39:90-2. Rivas M, Sosa-Estani S, Rangel J, et al. Risk factors for sporadic Shiga toxin-producing Escherichia coli infections in Argentine children. Emerg Infect Dis. 2008;14:763-71. Rivas M, Caletti MG, Chinen I, et al. Home-prepared hamburger as the source for a sporadic case of hemolytic uremic syndrome, Argentina. Emerg Infect Dis. 2003;9:1184-6. Rivero MA, Passucci JA, Rodríguez, EM, et al. Role and clinical course of verotoxigenic Escherichia coli infections in childhood acute diarrhoea, Argentina. J Med Microbiol. 2010;59:345-52. Sanz ME, Viñas MR, Parma AE. Prevalence of bovine verotoxin-producing Escherichia coli in Argentina. Eur J Epidemiol. 1998;14:399-403. Parma AE, Sanz ME, Blanco JE, et al. Virulence genotypes and serotypes of verotoxigenic Escherichia coli isolated from cattle and foods in Argentina. Importance in public health. Eur J Epidemiol. 2000; 16:757-62.

Diarrheagenic Escherichia coli in Argentina

[37] [38] [39] [40] [41] [42] [43]

[44] [45] [46] [47]

[48]

[49] [50] [51] [52] [53]

[54] [55] [56] [57] [58] [59] [60]

[61]

Pathogenic Escherichia coli in Latin America 159

Chinen I, Otero JL, Miliwebsky ES, et al. Isolation and characterisation of Shiga toxin-producing Escherichia coli O157:H7 from calves in Argentina. Res Vet Sc. 2003;74:283–86. Padola NL, Sanz ME, Blanco JE, et al. Serotypes and virulence genes of shigatoxigenic Escherichia coli (STEC) isolated from a feedlot in Argentina. Vet Microbiol. 2004;100:3-9. Meichtri L, Miliwebsky E, Gioffré A, et al. Shiga toxin-producing Escherichia coli in healthy young beef steers from Argentina: prevalence and virulence properties. Int J Food Microbiol. 2004;96:189-98. Mercado EC, Gioffré A, Rodríguez SM, et al. Non-O157 Shiga Toxin-producing Escherichia coli Isolated from Diarrhoeic Calves in Argentina. J Vet Med. 2004;51:82-8. Masana MO, Leotta GA, Del Castillo LL, et al. Prevalence, Characterization, and Genotypic Analysis of Escherichia coli O157:H7/NM from Selected Beef Exporting Abattoirs of Argentina. J Food Prot. 2010;73:649-56. Faiht NG, Shere AJ, Brosch R, et al. Prevalence and clonal nature of Escherichia coli O157:H7 on dairy farms in Wisconsin. Appl Environ Microbiol. 1996;62:1519-25. Johnson RP, Wilson JB, Michel P, et al. Human infection with verocytotoxigenic Escherichia coli associated with exposure to farms and rural environments. In: Stewart CS and Flint HJ (Eds), Escherichia coli in farms animals. CABI publishing, 1999;p147-68. Padola NL, Sanz ME, Lucchesi PM, et al. First isolation of the enterohaemorrhagic Escherichia coli O145:H- from cattle in feedlot in Argentina. BMC Microbiol. 2002;2:6-9. Fernández D, Rodriguez EM, Arroyo GH, et al. Seasonal variation of Shiga toxin-encoding genes (stx) and detection of E. coli O157 in dairy cattle from Argentina. J App Microbiol. 2009;106:1260-67. Tanaro JD, Leotta GA, Lound LH, et al. Escherichia coli O157 in bovine feces and surface water streams in a beef cattle farm of Argentina. Foodborne Pathog Dis. 2010;7:475-7. Masana MO, Leotta GA, Palladino PM, et al. 2009. Origen de la contaminación con distintos serotipos de STEC no-O157 en plantas frigoríficas de Argentina. Proceedings of the XII Congreso Argentino de Ciencia y Tecnología de Alimentos. 2009. Concordia, Entre Ríos. Argentina. Parma Y, Krüger A, Lucchesi PMA, et al. Presence of virulence genes associated with verocytotoxigenic Escherichia coli (VTEC) and enteropathogenic Escherichia coli (EPEC) in pigeons from argentina. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires,. Argentina. 2009,p99. Notario R, Fain JC, Prado V, et al. Prevalence of enterohemorrhagic Escherichia coli in a cattle area of Argentina. Genotypic characterization of the strains of animal origin. Rev Med Chil. 2000;128:1335-41. Parma AE, Sanz ME, Viñas MR, et al. Toxigenic Escherichia coli isolated from pigs in Argentina. Vet Microbiol. 2000;72:269-76. Bentancor A, Rumi MV, Gentilini MV, et al. Shiga toxin-producing and attaching and effacing Escherichia coli in cats and dogs in a high hemolytic uremic syndrome incidence region in Argentina. FEMS Microbiol Lett. 2007;267:251-56. Fernández D, Etcheverría A, Padola NL, et al. Estudio en caninos de zonas urbanas de Tandil como posibles portadores de Escherichia coli verocitotoxigénica. Revista In Vet. 2006;1:111-17. Gallego V, Deza N, Carbonari C, et al. Detection of Shiga toxin-producing Escherichia coli strains in asymptomatic adults and their home pets. 6th Internacional Symposium on Shiga Toxin (Verocytotoxin) – Producing Escherichia coli Infection 2006 November 29-October 1; Melbourne, Australia. 2006;p128. Leotta GA, Deza N, Origlia, J, et al. Detection and characterization of Shiga toxin-producing Escherichia coli in captive non-domestic mammals. Vet Microbiol. 2006;118:151-57. Sanz ME, Villalobo C, Elichiribehety E, et al. Prevalencia de Escherichia coli verocitotoxigénico en productos cárnicos de la ciudad de Tandil. La Industria Cárnica Latinoam. 2007;146:56-8. Gómez D, Miliwebsky E, Fernández Pascua C, et al. Aislamiento y caracterización de Escherichia coli productor de toxina Shiga en hamburguesas supercongeladas y quesos de pasta blanda. Rev Arg Microbiol. 2002;34:66-71. Chinen I, Tanaro JD, Miliwebsky E, et al. Isolation and characterization of Escherichia coli O157:H7 from retail meats in Argentina. J Food Prot. 2001;64:1346-51. Oteiza JM, Chinen I, Miliwebsky E, et al. Isolation and characterization of Shiga toxin-producing Escherichia coli from precooked sausages (Morcillas). Food Microbiol. 2006;23:283-8. Roldán ML, Chinen I, Otero JL, et al. Aislamiento, caracterización y subtipificaión de cepas de Escherichia coli O157:H7 a partir de productos cárnicos y leche. Rev Arg Microbiol. 2007;39:113-9. Alonso MZ, Padola NL, Lucchesi PMA, et al. Detection of verocytotoxigenic Escherichia coli (VTEC) and enteropathogenic Escherichia coli (EPEC) virulence genes in chicken products. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires. Argentina. 2009,p68. Chinen I, Epszteyn S,. Melamed CL, et al. Shiga toxin-producing Escherichia coli O157 in beef and chicken burgers, and chicken carcasses in Buenos Aires, Argentina. Int J Food Microbiol. 2009;132:167–71.

160 Pathogenic Escherichia coli in Latin America

[62] [63] [64] [65] [66]

[67] [68] [69] [70]

[71] [72] [73] [74] [75] [76] [77]

[78]

[79] [80] [81]

[82] [83] [84] [85]

Rivas et al.

Guth BEC, Chinen I, Miliwebsky E, et al. Serotypes and Shiga toxin genotypes among Escherichia coli isolated from animals and food in Argentina and Brazil. Vet Microbiol. 2003;92:335-49. Gioffré A, Meichtri L, Miliwebsky E, et al. Detection of Shiga toxin-producing Escherichia coli by PCR in cattle in Argentina. Vet. Microbiol. 2002;87:301-13. Blanco M, Padola NL, Krüger A, et al. Virulence genes and intimin types of Shiga-toxin-producing Escherichia coli isolated from cattle and beef products in Argentina. Int Microbiol. 2004;7:269-76. Balagué C, Khan AA, Fernandez L, et al. Occurrence of non-O157 shiga toxin-producing Escherichia coli in ready-to-eat food from supermarkets in Argentina. Food Microbiol. 2006;23:307-13. Rüttler ME, Pizarro MA, Orozco JHA, et al. Virulence gene, serotyping, antibiotic resistance and molecular profile of Shiga toxin Escherichia coli strains isolated from a slaughter house in Mendoza, Argentina. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires. Argentina. 2009,p69. Krüger A, Lucchesi PMA, Parma AE. Verotoxins in bovine and meat VTEC isolates: type, number of vtx variants and their relation with cytotoxicity. Int J Med Microbiol. submitted. Lucchesi PMA, Krüger A, Parma AE. Distribution of saa gene variants in verocytotoxigenic Escherichia coli isolated from cattle and food. Res Microbiol. 2006;157:263-6. Toma C, Nakasone N, Miliwebsky E, et al. Differential adherence of Shiga toxin-producing Escherichia coli harboring saa to epithelial cells. Int J Med Microbiol. 2008;298:571-8. Lucchesi PMA, Granobles CV, Suárez L, et al. Detection of subtilase cytotoxin gene in strains of verocytotoxigenic Escherichia coli from Argentina. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires. Argentina. 2009,p96. Galli L, Miliwebsky E, Irino K, et al. Virulence profile comparison between LEE-negative Shiga toxin-producing Escherichia coli strains isolated from cattle and humans. Vet Microbiol. 2010; doi: 10.1016/j.vetmic.2009.11.028. Krüger A, Padola NL, Parma AE, et al. Intraserotype diversity among Argentinian verocytotoxigenic Escherichia coli detected by random amplified polymorphic DNA analysis. J Med Microbiol. 2006;55:545-9. Bustamante AV, Lucchesi PMA, et al. Molecular characterization of Verocytotoxigenic Escherichia coli O157:H7 isolates from Argentina by Multiple-Loci VNTR Analysis (MLVA). Braz J Microbiol. 2009;40:927-32. Lindstedt BA, Heir E, Gjernes E, et al. DNA fingerprinting of Shiga-toxin producing Escherichia coli O157 based on Multiple-Locus Variable-Number Tandem-Repeats Analysis (MLVA). Ann Clin Microbiol Antimicrob. 2003;2:12. Noller AC, McEllistrem MC, Pacheco AG, et al. Multilocus Variable-Number Tandem Repeat analysis distinguishes outbreak and sporadic Escherichia coli O157:H7 isolates. J Clin Microbiol. 2003;41:5389-97. Keys C, Kemper S, Keim P. Highly diverse variable number tandem repeat loci in the E. coli O157:H7 and O55:7 genomes for high-resolution molecular typing. J Appl Microbiol. 2005;98:928-40. Lindstedt BA, Thorstensen Brandal L, Aas L, et al. Study of polymorphic variable-number of tandem repeats loci in the ECOR collection and in a set of pathogenic Escherichia coli and Shigella isolates for use in a genotyping assay. J Microbiol Methods. 2007;69:197-205. Bustamante AV, Sanso AM, Lucchesi PMA, et al. Genetic diversity of O157:H7 and non-O157 verocytotoxigenic Escherichia coli from Argentina inferred by Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA). Int J Med Microbiol. 2010;300:212-7. Etcheverría AI, Arroyo GH, Perdigón G, et al. Escherichia coli with anti-O157:H7 activity isolated from bovine colon. J Appl Microbiol. 2006;100:384–9. Cataldi A, Yevsa T, Vilte DA, et al. Efficient immune responses against Intimin and EspB of enterohaemorragic Escherichia coli after intranasal vaccination using the TLR2/6 agonist MALP-2 as adjuvant. Vaccine. 2008; 26:5662-7. Vilte DA, Larzábal M, Garbaccio S, et al. Reduced excretion of Escherichia coli O157:H7 in cattle after systemic vaccination with gamma-intimin and EspB proteins. 7th International Symposium of Shiga toxin (Verocytotoxin)producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires. Argentina; 2009,p26. Vergara M, Quiroga M, Grenon S, et al. Identification of enteropathogens in infantile diarrhea in a study performed in the city of Posadas, Misiones, República Argentina. Rev Latinoam Microbiol. 1992;32:71-5. Binsztein N, Rivas M, López Moral L, et al. Relationship between enterotoxigenic Escherichia coli and diarrhea among children in Buenos Aires, Argentina. Medicina (Buenos Aires). 1992;52:103-8. Pacheco ABF, Soares KC, De Almeida DF, et al. Clonal nature of enterotoxigenic Escherichia coli serotype O6:H16 revealed by randomly amplified polymorphic DNA analysis. J Clin Microbiol. 1998;36:2099-102. Viboud GI, Jouve MJ, Binsztein N, et al. Prospective cohort study of enterotoxigenic Escherichia coli infections in Argentinean children. J Clin Microbiol. 1999;37:2829-33.

Diarrheagenic Escherichia coli in Argentina

[86] [87] [88] [89] [90] [91] [92] [93] [94]

Pathogenic Escherichia coli in Latin America 161

Binsztein N, Jouve M, Viboud G, et al. Colonization factors of enterotoxigenic Escherichia coli isolated from children with diarrhea in Argentina. J Clin Microbiol. 1991;29:1893-8. Pichel M, Binsztein N, Viboud G. CS22, a novel human enterotoxigenic Escherichia coli adhesion, is related to CS15. Infect Immun. 2000;68:3280-5. Pichel M, Binsztein N, Gutkind G, et al. Identification of a cluster of strains bearing a new adhesion among genetically diverse enterotoxigenic Escherichia coli isolates of serogroup O20. J Clin Microbiol. 2001;39:782-6. Pacheco ABF, Ferreira LCS, Pichel MG, et al. Beyond serotypes and virulence-associated factors: detection of genetic diversity among O153:H45 CFA/I heat-stable enterotoxigenic Escherichia coli strains. J Clin Microbiol. 2001;39:4500-5. Pichel M, Binsztein N, Qadri F, Girón JA. Type IV longus pilus of enterotoxigenic Escherichia coli: occurrence and association with toxin types and colonization factors among strains isolated in Argentina. J Clin Microbiol. 2002;40:694-7. Oviedo P, Quiroga M, Pegels E, et al. Effects of subinhibitors concentration of ciprofloxacin on enterotoxigenic Escherichia coli virulence factors. J Chem. 2000;12:487-90. Rivas M, Binsztein N, Basanta G, et al. Antibody responses against Escherichia coli heat - labile toxin and colonization factors antigens I and II in Argentinian children. J Infect Dis. 1995;171:1045-9. Chinen I, Rivas M, Caffer MI, et al. Diagnóstico de Escherichia coli enteroinvasiva asociada a diarrea. Rev Arg Microbiol. 1993;25:27-35. Rüttler ME, Renna NF, Balbi L, et al. Characterization of enteroaggregative Escherichia coli strains isolated from children with acute diarrhea in Mendoza, Argentina. Rev Arg Microbiol. 2002;34:167-70.

162

Pathogenic Escherichia coli in Latin America, 2010, 162-178

CHAPTER 11 Escherichia coli Situation in Brazil Beatriz EC Guth1*, Cyntia F Picheth2 and Tânia AT Gomes1 1 2

Department of Microbiology, Immunology, and Parasitology, Universidade Federal de São Paulo, São Paulo; Department of Medical Pathology, Federal University of Paraná, Curitiba, Brazil Abstract: Data from the health information system of Brazil showed that more than 17 million cases of acute diarrheal diseases (ADD) were notified from 2000 to 2007 (http://portal.saude.gov.br/portal/saude/profissional/area.cfm?id_area=1549). The number of hospitalizations due to ADD is still high in children less than 5 years of age, and varies depending on the region, with several numbers of deaths, representing a serious prejudice to the population health. Among the several bacterial agents, responsible for gastrointestinal infections in Brazil, diarrheagenic E. coli (DEC) accounts for an expressive number of cases. In this chapter we will present an overview on the E. coli situation in Brazil, regarding the most significant DEC pathotypes associated with intestinal infections.

ENTEROAGGREGATIVE E. coli (EAEC) EAEC may represent a significant role as cause of diarrhea in Brazil. EAEC are defined by their characteristic aggregative adherence (AA) pattern to HEp-2 or HeLa cells. Studies conducted in Brazil have shown that some EAEC strains may present variations in this pattern consisting of AA predominantly to coverslip [1, 2], predominantly to HEp-2 cells, and also a chain-like (CLA) pattern of adherence [1]. Only some of EAEC strains were found to hybridize with the EAEC probe which detects the presence of the aggregative adherence plasmid (pAA) [1-5], indicating the fundamental role of adherence assays for EAEC detection. However, the EAEC plasmid marker was found among some E. coli strains (5-9.8%) which promoted detachment of HEp-2 cells monolayers [3, 5-7] and 2-3% of non adherent strains [8-10]. And it was also shown that the AA pattern can also be expressed by some atypical EPEC belonging to O125ac:H6 serotype [11]. Besides the cell adherence and hybridization assays with the EAEC probe, PCR based assays including single PCR protocols targeting for pAA [5, 12], multiplex PCR for detection of diarrheagenic E. coli (DEC) including EAEC targets such as pAA or aggR [13-16], and also a multiplex PCR specific for detection of EAEC markers [17] have been used for detection of EAEC in Brazil. The last assay uses aggR, aap and aat as targets; when it was tested with 158 strains with AA pattern the positive results were 62% for aatA, 59.5% for aggR and 68.4% for aap. Therefore the best method to identify EAEC is controversial.Symptoms associated with diarrhea caused by EAEC include fever (30-70% of the affected), vomiting (32-82.5%), blood in stools (0-25%) [4, 18-20], and mucus in stools (55.2 75%) [21, 22]. The most frequent aspect of stools was liquid (75.8%) or unformed (34.5%), and duration of diarrhea varied from 1-3 days (34.5%); 4-8 (48.3%), 9-15 (6.9%) or 61-90 (10.3%) days [19]. Several studies have demonstrated that EAEC strains are frequently detected in stools of children with diarrhea, with prevalence varying from 4 to 36.6% [1, 13, 18, 20, 23-25] and Table 1]. In some studies EAEC was found to be the most prevalent diarrheagenic E. coli (DEC) [1, 4, 12, 15, 19, 26, 27], or the second most frequent [2, 5, 16, 26, 28] in the population analyzed. However, a high frequency (19%) of EAEC was found among asymptomatic children living in a slum in Osasco (SP), while in the control group, consisting of children from upper-middle class, the frequency was 2.8%. This suggests that EAEC may be widespread in low socio-economic housing conditions [29]. In contrast, no significant difference was found in EAEC prevalence between children with diarrhea belonging to families of low- or highsocioeconomic levels [26]. In adults with diarrhea a frequency of 11.7% of EAEC was found, and it was not different from prevalence found in children [7]. Studies including children with acute or persistent diarrhea and *Address correspondence to: Dr. Beatriz E. C. Guth, Department of Microbiology, Immunology, and Parasitology, Universidade Federal de São Paulo, São Paulo, 04023-062, Brazil; Tel:55-11-50832980;e-mail:[email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 163

controls without diarrhea (Table 1), have shown a prevalence of EAEC varying from 0 to 43.6% in the control group. In some studies, a significant association of EAEC with diarrhea was found [4, 26, 27], while in others no significant difference was found between patients and controls (Table 1). Prevalence of EAEC higher in the control group than in patient group was also found [25], indicating that in some regions there is a high level of asymptomatic carriers. Table 1: Frequency of EAEC in children with diarrhea and controls from different localities of Brazil and the methods used for detection. Patient group (% positive/N examined)

Control group (% positive/N examined)

10/100

8/100

Method

Locality

Period

AA

SP

1985-1986

•

Reference [24]

21.5/200

19/200

AA

SP

1989-90

[2]

4/40

0/40

AA#

SP

1995-96

[20]

33.6/125

34.7/98

AA•

Londrina

1995-96 1998-99

[1]

16.9/237

16.4/231

AA•

NA, SL

1997-99

[28]

AA•

SP

1999

[27]

1997-99

[5]

a

20/100

3/100*

26.3/338

18.3/322

AA•

SP,J,NA, SL

19.6/143

10.8/37

CH

BR

NI

[7]

14.6/199

11.1/54

CH

RJ

1994-95

[19]

36.6/123

43.6/39

AA

B

1997-00

[25]

5.5/470

4.2/407

M-PCR

PV

2000-02

[16]

5.1/79

1.7/60

M-PCR#

SP

2005

[14]

8.9/774

1.4/139*a

CH

SP, RP

2002-03

[26]

11.1/1020

8.6/187

M-PCR

S

2003-04

[15]

25.5/290

8.2/290*b

CH

JP

2000-01

[4]

N – number of children in sample analyzed; AA – Adherence assay in Hep-2 or HeLa cells; CH – colony hybridization with EAEC probe to detect pAA (aggregative adherence plasmid); M-PCR – multiplex PCR for diarreagenic E. coli using pAA or aggR as target for EAEC identification; NI- not informed. # - also tested by CH with agreement between AA and CH results. • - also tested by CH with disagreement between AA and CH results. * - significantly different (a p< 0.001; b p<0.01) B-Botucatu, BR-Brasília, J-Joinvile, JP-João Pessoa, L-Londrina, NA-Natal, PV-Porto Velho, RJ-Rio de Janeiro, RP-Ribeirão Preto, S-Salvador, SL-São Luiz, SPSão Paulo.

Serotyping is not a useful tool for EAEC diagnosis, since these bacteria belonged to a wide range of different serotypes [4, 7, 12, 18, 28, 30-33] and some strains belong to traditional EPEC serogroups [9, 34-36]. Most of strains isolated from human and animal (calves, piglets, horses) belonged to distinct serogroups and/or serotypes. This suggests that these animals may not represent a major source of contamination for humans [32]. In contrast, EAEC serotype O113:H21 was found in human with diarrhea and also in cattle and buffalo [31]. However, more studies are needed to clarify this matter. A great diversity in the distribution of virulence markers was found in EAEC strains isolated in Brazil [3, 4, 30, 32, 33, 37], indicating the heterogeneity among these bacteria. Typical or atypical EAEC (regarding the presence or absence of aggR, respectively) have been isolated from cases of diarrhea and controls [3, 30, 33]. Several different combinations of virulence markers were found among typical EAEC while the atypical EAEC presented none or only a few virulence markers [3, 32, 37]. Some virulence markers were found to be significantly associated with diarrhea in some studies [4, 7, 30, 33] while in others no significant statistical difference in the prevalence of any marker between cases and controls was found [3, 4, 37]. It was also suggested that EAEC strains isolated from children and adults with diarrhea differ regarding the virulence markers [7]. EAEC isolated from human and animal (calves, piglets, horses) differ regarding the

164 Pathogenic Escherichia coli in Latin America

Guth et al.

presence of virulence markers suggesting that these animals are not an important reservoir of human pathogenic typical EAEC [32, 38]. Molecular assays such as ribotyping, RAPD-PCR and PFGE analysis, and also a phenotypic assay, multilocus enzyme electrophoresis (MLEE), have revealed a great genetic diversity among EAEC strains. Several distinct subtypes of EAEC were found in each of the assays, and no association was found between the subtypes and combinations of virulence markers or serotypes of the strains [30, 32]. ENTEROPATHOGENIC E. coli (EPEC) For many years, the identification of specific serogroups (classical O groups) and serotypes epidemiologically linked to infantile diarrhea [WHO 1987, Chapters 3 and 7] was essentially the only method to identify EPEC strains. After the introduction of tissue culture assays and genotypic methods based on the presence or absence of certain virulence genes for EPEC identification [39, Chapter 7], it was possible to recognize that some E. coli strains of certain serotypes within the classical EPEC serogroups were in fact associated with other DEC pathotypes [9, 40]. Moreover, the employment of these latter techniques has led to the sub-grouping of EPEC in tEPEC and aEPEC [40, 41]. Therefore, the use of different methods for EPEC identification has made it difficult to compare the prevalence of EPEC among different geographic areas and periods of time in Brazil (and worldwide). Moreover, variations in the characteristics of the populations studied and the more recent distinction between tEPEC and aEPEC have also hampered such comparisons. Although in Brazil EPEC have been investigated since the 1950s, until the end of the 1980s data on the frequency of this group of organisms were mostly obtained in São Paulo (the largest city in the country) where these organisms were the most frequent pathogen in the first year of life with isolation frequencies of 25% to 35% [24, 42-53]. The fewer epidemiological studies conducted in other large urban centers in Brazil such as Recife [54], Brasília [55], Belo Horizonte [56], Rio de Janeiro [57, 58] and Porto Alegre [10] also revealed high EPEC frequencies in young children (11% to 45%) at that time. In some of these studies, the frequency of EPEC overcame the joint isolation frequency of Salmonella and Shigella [45-47, 49, 50]. Most of these studies were based on the identification of EPEC by serogrouping/ serotyping and focused in endemic acute diarrhea of children of low socio-economic level that attended outpatient clinics and hospitals in the country. In one study involving 558 children with acute diarrhea in São Paulo, EPEC was responsible for 35% of cases in children less than 6 months and in 16% of those between 6 and 11 months [53]. Likewise, and as reported in most studies conducted worldwide in developing countries, such high prevalence of EPEC in the first 6 months of life was found in many other studies in large urban centers in Brazil [43, 48, 50, 51, 54, 57-60] but not in smaller cities or rural areas in the country [53, 61-64]. In many of the studies mentioned above, the frequency of EPEC serotypes in children older than 1 year of age was lower and similar to the frequency in non-diarrheic controls (2%-4%). As discussed elsewhere, the increased resistance to EPEC infections in older children and adults may be associated with the development of immunity or the loss of receptors for some specific adhesin [39]. In regards of persistent diarrhea (lasting 14 or more days), a few studies with young children (≤ two years) have incriminated EPEC as the most frequent pathogen (18.5%-42%) [55, 59, 65-68]. In one of these studies, among the patients with EPEC, 25.7% died and O111 was the most frequent EPEC serogroup found [65]. Furthermore, a strong correlation between presence of EPEC O111 and food intolerance (mainly intolerance to lacteal formulas) was observed. A general observation in all the studies discussed so far was that serogroups O111ab (mainly non-motile strains or with H2 antigen) and O119 (mostly with H6 antigen) represented the most frequent of all EPEC isolates [42, 49, 50, 53, 54, 57, 60]. Most studies conducted in Brazil in the late 1980s and 1990s used molecular tools (colony hybridization, and PCR) for EPEC identification. At that time EPEC continued to be important agents of diarrhea. The fact that these later studies used the EAF (and/or bfpA) probe allowed to begin discriminating tEPEC and aEPEC by identification of probe positive and probe negative strains, respectively. In children younger than 1 year of age of low socioeconomic

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 165

families of large urban centers, tEPEC serotypes remained strongly associated with diarrhea [2, 12, 43, 60, 61, 64, 69, 70], being recovered in up to 30% of the cases. At that period of time the most prevalent tEPEC serotypes remained the same (O111:non-motile and H2, and O119:H6), and these serotypes could then be classified as tEPEC as they carried the EAF sequence and/or bfpA. The molecular methods used allowed the identification of other potential tEPEC serotypes in non-EPEC serogroups in our environment such as O88:H25, O145:H45 and O153:H7, with the former serotype showing a statistical correlation with diarrhea [60]. Also, a number of O non-typable strains have been found in association with tEPEC [43, 60, 71]. It became then evident that serotyping alone would no longer allow a complete identification and discrimination of EPEC in our settings [40, 42, 60, 72]. A detailed study on the pathogen-specific risk factors and protective factors for acute diarrheal disease in urban Brazilian children in the first year of life showed that EPEC infections were associated with prior hospitalization in the month before onset of disease. Moreover, breast feeding infants less than 6 months was protective against these infections [21]. Interestingly, E. coli O111 and O119 were isolated even from the environment in several hospital nurseries [73]. In the past, these epidemic serotypes were frequently identified in industrialized countries as causes of outbreaks and sporadic cases of diarrhea, but since the 1960s they are very rare in those countries [38]. Moreover, EPEC strains of these serotypes have frequently shown simultaneous resistance to up to 9 antimicrobial drugs [43, 52, 74, 75]. The fact that some serogroups were found both in nursery environments and in community patients, and the wide drug resistance patterns presented by the strains isolated from those patients, indicated that EPEC diarrhea in São Paulo probably comprised nosocomial infections. Indeed, by analyzing the plasmid profile of 123 tEPEC strains of the most prevalent EPEC serotypes (O111ab:H, O111ab:H2 and O119:H6) causing infant diarrhea in the city of São Paulo, Fernandes et al. [76] observed that about 53% of the O111 (non-motile and H2) strains studied had been isolated from recently hospitalized children and that those strains comprised only a few EPEC clones, which clustered in time of the isolation and by hospital where the infant had been [21]. As discussed previously, the evidences of hospital being reservoirs of EPEC could probably explain the high rates of EPEC infections in infants in large urban centers in Brazil [52]. An alternative method to identify tEPEC is the search for expression of localized adherence (LA) to HeLa/HEp-2 cells after 3 h of infection as this pattern is shown almost exclusively by tEPEC. LA-positive E. coli had been detected much more frequently in infants with diarrhea than in their matched controls, with frequencies in patients of 17%-23% in São Paulo [24, 27] 19.6% in Rio de Janeiro [69], 44% in Londrina [77], and 37.8% in Recife [78]. In these studies, non-diarrheic control patients carried LA-positive strains much less frequently. In addition to these findings, using cultured cells to identify enteroadherent strains among E. coli isolated in Rio de Janeiro, Girão et al. [79] found 12 strains, which co-expressed LA and AA (AL/AA) forming an intense biofilm in both biotic and abiotic surfaces. As these strains had virulence genes of the tEPEC pathotype (eae, EAF, bfp, per) and lacked virulence genes of the EAEC pathotype they were classified as tEPEC. As bacterial biofilms favor long lasting colonization, patients who are affected by the E. coli strains co-expressing LA/AA could remain as carrier in their intestinal tract (asymptomatic carrier) and serve as reservoir of such strains. It is noteworthy to stress that E. coli strains with such characteristic have also been detected in São Paulo in late years (Gomes, unpublished). Recently, studies in different geographic areas in Brazil have reported lower tEPEC frequencies in diarrheic children as in Salvador [13, 18], João Pessoa [4], Botucatu [25], Rio de Janeiro [19, Girão & Gomes, unpublished data) and São Paulo [26]. It is probable that such decline is associated to earlier treatment of patients, and more appropriate improvements in therapy, sanitary conditions, and better measures to control nosocomial infections. These findings are in accordance with a decrease in the number of cases of diarrhea in several regions in Brazil [80]. Conversely, it is apparent that aEPEC has assumed a more significant role in diarrhea in recent years, but such raise in frequency may also be due to the better definition of the aEPEC group [40, 81]. For instance, certain E. coli serotypes previously classified as EPEC (e.g., O26:H11, O55:H7, O119:H2, and O128:H2) are now clearly classified as aEPEC due to their virulence characteristics, and these aEPEC serotypes are commonly detected in epidemiological studies in Brazil [9, 40, 81]. Moreover, a large diversity of aEPEC serotypes, particularly within non-classical EPEC serogroups, and many non-typable serotypes have been reported by several authors in recent studies in Brazil as well as other areas in the world [69]. Most of these studies include strains isolated from young children both with and without diarrhea, where aEPEC occurs in 5-10% of the cases [4, 15, 16, 18, 26, 42, 82], but only a few studies have shown an epidemiological association with acute diarrheal cases [15, 18, 26].

166 Pathogenic Escherichia coli in Latin America

Guth et al.

Some aEPEC serotypes (e.g., O26:H11, O119:H2, O128ab:H2) belong to the classical EPEC serogroups and have been detected in children in Brazil since the 1950s. This fact suggests that at least certain aEPEC strains have been involved as agents of diarrhea in our community since that time. Despite the diversity of the aEPEC serotypes of non-EPEC serogroups in Brazil, the most frequent is O51:H40, which has been found in children in different cities in the Southeast of the country (São Paulo, Rio de Janeiro, and Ribeirão Preto) [82, 83] as well as in the Northeast (Salvador, Bahia State) of the country [15]. Interestingly, in Rio de Janeiro, aEPEC strains of serotype O51:H40 have been found in dogs with diarrhea (A. Cerqueira, personal communication). Of note, a single human O51:H40 strain isolated in 1985 had characteristics of tEPEC (carrying bfpA and expressing the LA pattern) while all other strains isolated much later were aEPEC. A detailed study of these strains in vitro and in the rabbit ileal loop has shown that serotype O51:H40 encompasses mostly potential enteropathogenic aEPEC strains, whose genetic background is closer to enterohemorrhagic E. coli than to tEPEC strains [84]. Due to the significant proportions of aEPEC strains in non-diarrheic patients, case-control studies concerning aEPEC virulence in Brazil have aimed at identifying diarrhea-associated virulence genes or phenotypic characteristics. However, as shown in many other geographic areas in the world, Brazilian aEPEC strains are highly diverse and may carry various combinations of virulence genes [82-84]. Scaletsky et al. [20] showed that aEPEC expressing LAL, which comprises the most frequent adherence pattern among aEPEC strains [27, 40, 82, 83], is significantly associated with diarrhea. In another study, Dulguer et al. [85] demonstrated a strong association between the enteroaggregative E. coli heat-stable encoding-gene (astA) and diarrhea in aEPEC strains isolated in different regions of Brazil. However, in a more recent study, such association was not confirmed by these authors [87]. Vieira et al. [88] have recently shown that the simultaneous presence of PAI O122 genes efa1/lifA, senA, pagC, nleB and nleE in aEPEC strains was statistically associated with diarrhea, thus suggesting that detection of a complete PAI O122 could identify aEPEC strains with higher virulence potential. Despite the controversial data on the epidemiological association of aEPEC strains with diarrhea in Brazil, aEPEC strains have been found in diarrheic patients of various ages and in adult patients with AIDS [83] thus suggesting that there may be certain genetic combinations that render some aEPEC strains truly enteropathogenic. So far, no outbreaks have been attributed to tEPEC or aEPEC in Brazil. Although aEPEC strains have been shown to be associated with persistent diarrhea [81], studies of patients with persistent diarrhea are scarce in our country and such association has not been confirmed. However, it has been shown that Brazilian children with EPEC are more prone to fail to respond to oral rehydration therapy, have food (mainly cow's milk) intolerance, require hospitalization and develop persistent diarrhea [89]. In these studies the EPEC strains probably correspond to tEPEC, as evidenced by the reported serotypes. [89]. Sick and asymptomatic humans are probably the most important reservoirs for tEPEC serotypes in Brazil, as in other countries, since these organisms have been rarely found in animals or foods. A study by Rodrigues et al. [25] has reported the simultaneous isolation of a closely related tEPEC strain of serotype O111:H- from a diarrheic dog and a child in the same house in Botucatu (São Paulo state). Moreover, a few tEPEC strains were identified in monkeys [90] and dogs [94]. In foods, one study reported the detection of the EAF sequence in two E. coli colonies isolated from two raw chicken meat samples [91]. Although much more epidemiological information is needed it is apparent that foods and pets are rare potential transmission routes for tEPEC in Brazil. In contrast, a range of aEPEC serotypes has been isolated from different animal species in Brazil and aEPEC strains have been recovered from pasteurized milk [22]. Of note, a recent study involving mostly Brazilian aEPEC isolates has shown by Multilocus Sequence Typing (MLST) and Pulsed Field Gel Electrophoresis (PFGE) a close clonal relationship among certain strains from humans and animals; the analysis suggested that potentially aEPEC strains may be transmitted between humans and animals in Brazil. By combining data on MLST and pathogenic E. coli virulence factor-encoding genes, Bando et al. [93] made a phylogenetic analysis to evaluate the genetic relationship of aEPEC (mostly Brazilian strains) with other diarrheagenic E. coli pathotypes. They showed that aEPEC strains are distributed in all E. coli phylogenetic groups (B1, A, B2 and D) and have at least two distinct genomic backgrounds (clusters I and III) Moreover, they concluded that the acquisition and expression of virulence factors derived from non-EPEC pathotypes by various aEPEC clonal groups may be due to their particular genomic background.

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 167

ENTEROTOXIGENIC E. coli (ETEC) The epidemiological importance of enterotoxigenic E. coli (ETEC) strains in human diarrheal disease has been highlighted in several studies conducted from the Northern to the Southern regions of Brazil. The first study reporting the role of this Diarrheagenic E. coli (DEC) category dates from 1975, and showed that 21 of the 38 children with diarrhea were carriers of ETEC [94]. Studies on the etiology of childhood diarrhea in the 80’s subsequently described the significant occurrence of ETEC, with variations in the range of isolation depending on the region and population studied. ETEC was the most frequent enteropathogen isolated in a peri-urban community in Manaus, north region [95]. In Northeastern Brazil, ETEC strains were identified in frequencies that varied from 12% to 27% in children with diarrhea in Recife and Fortaleza cities [54, 63, 96]. In southeastern part of Brazil, high frequencies (15 to 21%) of ETEC were also detected among children with acute diarrhea in Belo Horizonte [56] and in Campinas [97]. In studies conducted in São Paulo between 1977 and 1982, ETEC were found in 8% of the children under 1 year of age, in 4% of those between 1 and 2, and in 23% of the children above 2 years [52]. Although, similar frequencies of ETEC were identified in children with endemic diarrhea and in controls (children without gastrointestinal symptoms) between 1978 and 1979 in São Paulo [98]; considering the age group of these children, it was interesting to observe that in the control group only children with or over 12 months of age were carriers of ETEC [53]. Moreover, ETEC was significantly associated with diarrhea in infants less than 12 months of age in another case-control study carried out in São Paulo [43]. During the 90’s and in more recent years, variations in the frequency of ETEC, in children under 3 or 5 years of age with acute diarrhea, continued to be observed, and it can still be considered high (7% to 21%) in some studies [4, 18, 57, 99, 100] compared to others where ETEC was isolated from less than 4% of diarrheic patients [14-16, 19, 26, 69, 70, 101]. In addition, it should be mentioned that in some of these studies ETEC had also been isolated at higher or similar frequencies from children in the control groups compared to those with intestinal infection [15, 16, 19, 69, 70]. Besides the demonstrated role of ETEC in children acute diarrhea in our settings, it is noteworthy that ETEC was also identified as agent of sporadic summer diarrhea among adults [102], of persistent diarrhea in early childhood [103], and responsible for outbreaks of cholera-like diarrhea in children and adults in the Amazon rainforest [104]. The enterotoxins produced by ETEC belong to two major families of heat-labile (LT) and heat-stable (ST) toxins, and within each family of toxins distinct classes of LTs (LT-I and LT-II) and STs (ST-I and ST-II) were described. In several epidemiological studies carried out in Brazil the toxigenic phenotypes of ETEC strains were only characterized in general basis as LT, ST or LT-ST, but in most of them they usually referred to the type I classes of toxins. Therefore, in order to avoid misunderstandings, the classes or genetic variants of LT and ST toxins will be cited when appropriate. Studies on the etiology of childhood diarrhea showed that in general the ST-producing strains and/or LT-ST producers generally occur at a higher frequency than LT-only strains [43, 53, 69, 96, 98, 100, 102]. Moreover, in some studies in which no significant differences in ETEC frequency were observed among diarrheic and control groups, most of the isolates were LT-only producers [15, 19, 69, 98]. On the other hand, the predominance of LT-producing strains among diarrheal cases were also demonstrated in other studies [18, 26, 97, 99, 101]. LT-II enterotoxin was detected in some E. coli strains isolated from human diarrhea in São Paulo [105], it was not identified in other studies that searched for it [18]. Similar results were found regarding ST-II toxin that was rarely found among human ETEC isolates (Gomes T.A.T., personal communication). Distinct types of colonization factor antigens (CFAs) have been described in human ETEC strains. However, it should be mentioned that among the more than 20 different CFAs described so far in the literature, only a number of them have been commonly searched for in most of the studies conducted in Brazil. The frequency and types of CFAs varied depending on the studied region, but CFA/I, CFA/II (CS1CS3), CFA/IV (CS5CS6 and CS6), and CS21 have been the most frequently found [98, 104, 106-108]. It should also been mentioned that in general CFAs have been identified more frequently among ETEC strains isolated from diarrheal disease than from controls. Although CFAs occurred mainly among ST-I or LT-I/ST-I-producing strains, the presence of these factors have also been identified in some studies among LT-I producing strains [98, 99, 104, 106-110]. Moreover, a close association between the presence of a specific CFA, certain serotypes, and enterotoxin phenotypes of ETEC strains were also identified in the studies carried out in Brazil, as reported in several other countries.

168 Pathogenic Escherichia coli in Latin America

Guth et al.

ETEC strains isolated from humans in Brazil belong to a wide range of serotypes, and this is particularly true for LT-I-producing strains, while a more limited number of serotypes, such as O6:H16, O25:H42, O27:H7, O29:H21, O63:H-, O78:H12, O128ac:H7, O128ac:H12, O128ac:H27, O153:H45, O167:H5, have been found among strains belonging to ST-I and LT-I/ST-I toxigenic phenotypes [53, 98, 104, 106, 108, 111, 112]. Variations on the occurrence of serotypes presented by ST-I-producing strains isolated in same location overtime were also described [106]. The role of ETEC as agents of diarrheal disease in animals was also described in our settings. ST-I-producing strains were identified as agents of diarrheal disease in calves and newborn piglets [113-115], but isolation of LT-II strains in association with diarrhea in calves [114-116] and in ostriches [117] have also been described. Foods and water are important vehicles on the transmission of ETEC to humans. Several surveys conducted in Brazil reported the occurrence of these pathogens in a variety of raw and cooked foods, of animal and vegetable origin, and water samples [92, 105, 118-127]. The predominance of LT-I producing strains had been observed in some studies [120-122, 125, 126], whereas ST-I producers prevailed in other [118]. ETEC strains producing only LT-II enterotoxin were also isolated from different types of foods, such as raw and cooked meat, sausage, mayonnaise and milk samples [92, 105, 119]. In general, the serotypes identified among ETEC isolates from foods do not correspond to those more frequently associated with human diarrhea, and the reason for this may be explained by the fact that strains isolated from foods were mainly LT only producers, which usually belong to a great variety of serotypes [53, 98, 108, 110, 124, 125]. An observed homogeneity on the electrophoretic profiles of outer membrane proteins (OMP) and lipopolysaccharides (LPS) of ETEC strains belonging to the same serotypes, isolated in a particular location at different periods of time, lead to the suggestion of dissemination of only a few ETEC clones [128]. Application of random amplification of polymorphic DNA (RAPD) to those ETEC isolates, confirmed the presence of major clonal clusters, each one with at least 80% identical bands. The clonal clusters corresponded to strains having the same serotype which, in most cases, also had the same virulence factors (colonization factors and toxin types) and OMP and LPS profiles. These results suggested a correlation between phenotypic properties and genetic relatedness of ETEC isolates of human origin and indicated that a reduced number of clonally related strains are found in endemic areas of ETEC in Brazil. Moreover, the RAPD technique revealed intraserotype-specific variations, undetectable by the combination of several phenotypic typing methods, among the ETEC strains analyzed [129, 130]. Further studies also demonstrated the usefulness of RAPD and other molecular typing systems on the analysis of genetic diversity among ETEC isolates, helping to establish the relatedness among virulent lineages circulating in a given community [104, 108]. In addition, a recent study based on restriction fragment polymorphism (RFLP) analysis and DNA sequencing of the operons encoding LT-Is expressed by ETEC strains, mostly isolated from children living in three major cities in Brazil, revealed significant genetic diversity, particularly among strains producing LT-I only [131]. The finding of rather large natural diversity among LTs produced by ETEC strains than previously assumed may impact on studies of both ETEC pathogenesis and the epidemiology of the disease. SHIGA TOXIN-PRODUCING E. coli (STEC) Human infections associated with STEC in Brazil are mainly represented by sporadic cases of diarrhea, bloody diarrhea, hemolytic anemia, and hemolytic uremic syndrome (HUS). The great majority of infections occurred in children less than five years of age, and diarrhea is the most common clinical manifestation observed. From the northern to the southern region of Brazil, the range of isolation of STEC from human diarrhea varies depending on the studied region, but in general the incidence is relatively low. In western Amazon, north region, the occurrence of STEC corresponded to 0.6% of the enteropathogens [16]. In the northeastern region, STEC was isolated from 1.6% and 0.6% of children with diarrhea in Salvador city [15, 18], while in Fortaleza city, STEC was not identified in children with acute or persistent diarrhea [103]. In Brasilia State, central region, STEC occurred in 3% of diarrheic patients [99]. Studies conducted in southeastern part of Brazil showed that prevalence of STEC

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 169

ranged from 0 to 0.9% in Rio de Janeiro State [19, 69]; from 0.2% to 2.9% in São Paulo State [42, 132-134], and STEC was identified in almost 2% of children with diarrhea in Paraná State [135]. Efforts have been made to establish a national surveillance system for HUS in Brazil, but there are still little or no data available. A number of cases of HUS are annually reported in several Brazilian States according to the Health Ministry. Combined use of microbiologic and serologic techniques provided evidence of STEC infection in 92.3% of HUS cases studied in São Paulo from 2001 to 2005 [136]. An association with O157 infection accounted for 61.5% of the HUS cases, and non-O157 STEC were also identified. STEC was isolated from three out of seven HUS patients whose stool cultures yielded bacterial growth, and serotypes O26:H11 [137], O157:H7 [138], and O165:HNM [139] were identified. Moreover, high levels of O111 (16%) or O157 (42%) LPS antibodies (IgM and IgG) were detected in sera of HUS patients by enzyme-linked immunosorbent (ELISA) assays. These levels of antibodies were much higher than the cutoff values observed in the group of children with no diarrhea, even when higher serum dilutions were analyzed. Besides demonstrating the significance of E. coli O157 in HUS in our community, these results also confirmed the importance of looking for LPS antibodies in sera of HUS patients as a tool for identification of severe STEC infections [136]. Data from several surveys conducted especially in southeastern region showed the occurrence of O157:H7 and some other particular STEC serotypes, which prevalence seems to change overtime. Whereas O26 and O111 STEC strains prevailed between 1976 and 1999, O157 related cases arose since its first isolation in the late 90’s [133, 134, 138, 140, 141], and several non-O157 STEC serogroups, including some important zoonotic serotypes as O91:H21, O118:H16, O178:H19, and others serotypes that have been identified more recently [133, 135, 139, 142, 143]. It was interesting to observe that serotype O103:H2 was detected for the first time in São Paulo in 1986, and reemerged in more recent years in association with hemolytic anemia as well as from uncomplicated cases of diarrhea [133, 143]. Although the majority of sporadic cases of diarrheal diseases were associated with non-O157 STEC serotypes, isolation of O157:H7 has been reported in some Brazilian States and were in general related to more severe cases as bloody diarrhea and HUS. Besides the O157:H7 cases identified in São Paulo, two other O157:H7 STEC strains isolated at Minas Gerais and Espirito Santo States, in 2007, were submitted for confirmation at the National Reference Laboratory for E. coli, at Instituto Adolfo Lutz, São Paulo [Irino K, personal communication]. Therefore, the results obtained in the different surveys carried out so far besides stressing the importance of O157 STEC in our settings, also pointed out to the occurrence of non-O157 serotypes as agents of severe human diseases, which certainly have significant implications for diagnostic procedures employed in clinical laboratories in Brazil. In the animal reservoir, isolation of STEC from food-producing animals has been gathered through several surveys conducted in different Brazilian regions [114, 116, 144-155]. A much wider diversity of non-O157 serotypes was seen in the animal reservoir compared to human infections, and a great number of non-typeable and rough strains have been isolated. Rates of STEC isolation varied from 0 to 80% depending on the animal, region or farm, but in general O157 STEC occurred at a low frequency (0 to 2.4%) and was only detected among cattle. Some distinct serotypes were sheared by different animal species, but host specificity was seen for several serotypes suggesting that STEC serotypes are preferably more adapted to a specific species of ruminant than others [151]. All animal species except sheep were colonized by O113:H21, that in conjunction with O22:H8, O79:H14, O178:H19, and O116:H21 represent the five most common serotypes identified among cattle [145-147, 151-153]. Serotypes O77:H18 and O74:H25 prevailed among buffaloes [149], whereas O5:H-, O43:H2, O75:H-, O87:H16, O146:H21, and O178:H8 were significantly found among goats and sheep STEC isolates [151, 156]. Most of the STEC serotypes identified in animals were not isolated from human infections in Brazil except for some as O77:H18, O111:H8, O111:NM, O118:H16, O157:H7, and O178:H19. It is interesting to mention that O113:H21, a recognized STEC serotype causing intestinal and extra intestinal infections in many countries, accounts for one of the most frequent serotypes recovered from cattle in our settings [120, 147, 151, 157]. Nonetheless, cases of human infections involving STEC O113:H21 have not been registered so far in Brazil, and E. coli strains of serogroup O113 have been mainly related to EAEC in our settings [31, 32].

170 Pathogenic Escherichia coli in Latin America

Guth et al.

In common with other foodborne pathogens, several difficulties have been faced for detection and isolation of STEC from foods, as they are often present in low numbers and in the presence of high numbers of competitor organisms. The available data show a broad range of isolation of STEC (0 to 19%) in foods of animal origin, but O157 STEC has not been isolated to date [8, 22, 92, 120, 123, 155, 158-161]. A high incidence of O157:H7 STEC in hides of cattle presented for slaughter have recently been observed, which may be probably associated with differences in sampling, methodologies used for detection, among other factors [162]. Certainly, this result serves as an alert as these strains can reach consumers if good hygiene practices are not observed in cattle handling and during the dehiding process. Knowledge related to the virulence profiles of STEC has been gained through the studies conducted so far, and a great diversity of profiles has been identified. Presence of the eae gene that occurs in more than 98% of human strains, is rarely found among STEC isolates from animals, being mainly associated with particular serotypes such as O111:H8 and O157:H7 [144, 147, 148, 151]. On the other hand, the ehxA gene has been identified at high frequencies both in human and animal isolates. In respect to stx, most of the human isolates carried only stx1, except for the O157:H7 and some of those related to more severe infections that harbored stx2 or stx2 stx2c [163]. Although the prevalence of stx1 among human strains may partially explain the mild outcome of STEC infections identified in our country, strains harboring stx1 had already been isolated from patients with HUS and hemolytic anemia [137, 143]. Among the animal reservoir stx2 or stx1 plus stx2 genotypes prevailed [145-147, 150, 153], and differences related to stx subtypes were observed according to the animal species. STEC isolates carrying the sequence encoding for subtype stx2d were rarely found in cattle, but stx2d is predominant among caprine and sheep strains. Approximately 20% of STEC strains from beef cattle harbored the sequence encoding for the stx2d-activatable subtype, which was very common among cattle O113:H21 isolates [151, 164]. Concerning the stx1 subtype, all strains from goats and sheeps belonged to subtype stx1c, regardless of whether the strains harbored stx1 alone or associated with stx2; and the most common stx subtype observed was stx1cstx2d-O118 [151, 156]. When the presence of additional virulence markers related to other toxins and adhesins is studied more genetic diversities can be observed [163, 151]. Distinct virulence profiles were found, and differences were observed according to the presence or not of eae. The most prevalent profile observed among eae-positive STEC strains mainly isolated from humans was eae efa1 iha lpfAO113, whereas iha lpfAO113 saa ehxA subAB prevailed among eae-negative STEC strains, mostly isolated from cattle and foods [163]. Albeit the diversity of virulence profiles observed amongst the STEC strains isolated in Brazil, characteristic associations between virulence profiles, serotypes and origin of strains could be identified. Moreover, it is clear from all these studies that some STEC strains from the animal reservoir present a full set of virulence genes, and therefore the potential risk they pose for humans should be carefully monitored [151, 152, 163165]. In general, the majority of STEC strains were susceptible to almost all antimicrobials, but resistance when it occurs, was mostly associated with tetracycline, streptomycin, nalidixic acid, ampicillin, tobramycin and cefoxitin [138, 150, 152, 160, 166]. In addition, multiple resistant STEC strains have been detected in O111:H8, O111:H- and O118:H16 serotypes [166, 167]. Analysis of the genetic diversity by Pulsed Field Gel Electrophoresis (PFGE) of some STEC strains isolated from different sources and belonging to the same serotypes has been carried out, and it was possible to observe the establishment of some distinct clones of STEC O157:H7 and non-O157 over time in our settings [138, 168]. STEC strains belonging to the serogroup O111 of human origin and isolated during the period 1976-2003 were distributed into five related subgroups (70 to 78% of similarity) and formed a distant cluster from non-STEC O111 strains. A higher degree of similarity was observed among O26 STEC strains, and a cluster of two subgroups composed of O157:H7 STEC strains and unrelated to non-STEC O157 strains were also identified [168]. Further study on the analysis of the genetic relatedness among O157:H7 strains from different sources and isolated in Latin American countries, suggested that a particular clone of O157:H7 is more related to human diseases in Brazil, and some strains from distinct sources and countries have a common origin [138]. DIFFUSELY ADHERENT E. coli (DAEC) DAEC is defined by a diffuse adherence (DA) pattern to cultured epithelial cells, characterized by the scattered attachment of bacteria over the whole cell surface. Hybridization assays using daaC or AIDA-I (two factors

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 171

associated with DA phenotype), also have been used for DAEC detection [2, 5, 20, 26, 27, 28, 64, 101], however the results did not correlate well with cell culture assays. The sensitivity of daaC probe was around 64% [2, 5], while the AIDA-I probe detected only 0-3% of the DAEC strains [5, 20, 27, 64]. Also, only 40% of strains that hybridized with daaC probe were found to be positive for daaE by PCR [5]. Therefore, the best method to identify these organisms remains the cell adherence assay. In children with diarrhea, frequency of DAEC, determined by the cell adherence assay, ranged from 10% to 23.4% [1, 2, 5, 20, 27, 28, 64], and in some studies it was the most frequent diarrheagenic E. coli (DEC) isolated [2, 5, 26, 28, 64, 101]. However the role of DAEC as a cause of diarrhea is controversial since a high prevalence of these bacteria was found among asymptomatic children, being most prevalent among those of low socio-economic level [29]. Besides, in most of the studies it was not significantly associated with diarrhea [1,2,5, 20, 26-28]. Nevertheless DAEC may play significant role as agent of diarrhea in some regions of Brazil. Studies realized with children of 0-2 years of age, from cities of Natal, São Luiz (northeast) and Vitória (southeast), showed that DAEC was detected in all age groups [64, 101]. In children from Vitoria, DAEC was isolated significantly more often from patients with diarrhea than from controls without diarrhea (p<0.05), and a higher prevalence was observed in children over 12 months (p=0.01) [101]. However, in children from cities of northeast a significant correlation between DAEC infection and diarrhea was observed only for children older than 12 months of age (p=0.01) [64]. These studies indicated that DAEC should be considered a cause of diarrhea in those regions, and showed an association of DAEC with age-dependent diarrhea [64, 101]. When 112 DAEC strains, isolated from patients with diarrhea and controls, were tested for several potential E. coli virulence markers, a variety of different combinations was observed among isolates from both patients and controls [169]. Among those strains, forty-five different serotypes were found, being O86:H18 (7%), O21:HNT (3.6%), O99:H33 and O153:H2 (2.7% each) the most common. The results suggested that DAEC isolated from patients and controls present different profiles when virulence markers and serotypes are considered [169]. Most (70%) of strains presented multiple antibiotic resistance, and in some of the strains genes coding for antibiotic resistance and diffuse adherence were located on the same conjugative plasmid as showed by conjugation experiments [169]. In conclusion, DAEC comprises a heterogeneous group of strains what may be responsible for their controversial association with diarrhea. REFERENCES [1]

[2] [3] [4] [5] [6] [7] [8] [9] [10] [11]

Gioppo NMR, Elias Jr WP, Vidotto MC, et al. Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E. coli and chain-like adherent E. coli isolated from children with and without diarrhea, in Londrina, Brazil. FEMS Microbiol Lett. 2000;190:293-298. Gomes TAT, Vieira MAM, Abe CM, et al. Adherence patterns and adherence-related DNA sequence in Escherichia coli isolates from children with and without diarrhea in São Paulo city, Brazil. J Clin Microbiol. 1998;36:3609-3613. Elias WP, Uber AP, Tomita SK, et al. Combinations of putative virulence markers in typical and variant enteroaggregative Escherichia coli strains from children with and without diarrhoea. Epidemiol Infect. 2002;129:49-55. Moreno ACR, Fernandes Filho A, Gomes TAT, et al. Etiology of childhood diarrhea in the northeast of Brazil: significant emergent diarrheal pathogens. Diagn Microbiol Infect Dis. 2010;66:50-57. Scaletsky ICA, Fabbricotti SH, Aranda KR, et al. Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherent Escherichia coli. J Clin Microbiol. 2002;40:1254-1258. Gomes TAT, Abe CM, Marques LRM. Detection of HeLa cell-detaching activity and alpha-hemolysin production in enteroaggregative Escherichia coli strains isolated from feces of Brazilian children J Clin Microbiol. 1995;33:3364. Piva, IC, Pereira AL, Ferraz LR, et al. Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasília, Brazil. J Clin Microbiol. 2003;41:1827-1832. Bergamini AMM, Simões M, Irino K, et al. Prevalence and characteristics of Shiga toxin-producing Escherichia coli (STEC) strains in ground beef in São Paulo, Brazil. Braz J Microbiol. 2007;38:553-556. Campos LC, Franzolin MR, Trabulsi LR. Diarrheagenic Escherichia coli categories among the tradicional enteropathogenic E. coli seogroups – a review. Mem Inst Oswaldo Cruz. 2004;99:545-552. Coiro JR, Heuser MC, Vasconcellos VL, et al. Pathogens associated with acute enteritis in Brazilian children. J Diarrhoeal Dis Res. 1987;5:110-111. Barros SF, Abe CM, Rocha SPD, et al. Escherichia coli O125ac:H6 encompasses atypical enteropathogenic E. coli strains that display the aggregative adherence pattern. J Clin Microbiol. 2008;46:4052-4055.

172 Pathogenic Escherichia coli in Latin America

[12] [13] [14]

[15] [16] [17] [18] [19] [20]

[21] [22] [23] [24] [25] [26]

[27] [28] [29] [30]

[31] [32] [33] [34] [35] [36]

Guth et al.

Rodrigues J, Acosta VC, Candeias JMG, et al. Prevalence of diarrheogenic Escherichia coli and rotavirus among children from Botucatu, São Paulo State, Brazil. Braz J Med Bio Res. 2002;35:1311-1318. Aranda KRS, Fagundes-Neto U, Scaletsky ICA. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42:5849-5853. Aranda KRS, Fabbricotti SH, Fagundes-Neto U, et al. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol Lett. 2007;267:145-150. Bueris V, Sircili MP, Taddei CR, et al. Detection of diarrheagenic Escherichia coli from children with and without diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2007;102:839-844. Orlandi PP, Magalhães GF, Matos NB, et al. Etiology of diarrheal infections in children of Porto Velho (Rondonia, Western Amazon region, Brazil). Braz J Med Biol Res. 2006;39:507-517. Cordeiro F, Pereira DSG, Rocha M, et al. Evaluation of a multiplex PCR for identification of Enteroaggregative Escherichia coli. J Clin Microbiol. 2008;46:828-829. Franzolin MR, Alves RCB, Keller R, et al. Prevalence of diarrheagenic Escherichia coli in children with diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz. 2005;100:359-363. Regua-Mangia AH, Gomes TAT, Vieira MAM, et al. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Infection. 2004;48:161-167. Scaletsky ICA, Pedroso MZ, Oliva CAG, et al. A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea. Infect Immun. 1999;67:3410-3415. Blake PA, Ramos S, MacDonald KL, et al. Pathogen-specific risk factors and protective factors for acute diarrheal disease in urban Brazilian infants. J Infect Dis. 1993;167:627-632. Carneiro LAM, Lins MC, Garcia FRA, et al. Phenotypic and genotypic characterisation of Escherichia coli strains serogrouped as enteropathogenic E. coli (EPEC) isolated from pasteurised milk. Int J Food Microbiol. 2006;15:108:15-21. Barreto ML, Milroy CA, Strina A, et al. Community-based monitoring of diarrhea in urban Brazilian children: incidence and associated pathogens. Trans Royal Soc Trop Med Hyg. 2006;100:234-242. Gomes TAT, Blake PA, Trabulsi LR. Prevalence of Escherichia coli strains with localized, diffuse, and aggregative adherence to HeLa cells in infants with diarrhea and matched controls. J Clin Microbiol. 1989;27:266-269. Rodrigues J, Thomazini CM, Morelli A, et al. Reduced etiological role for enteropathogenic Escherichia coli in cases of diarrhea in Brazilian infants. J Clin Microbiol. 2004;42:398-400. Araújo JM, Tabarelli GF, Aranda KRS, et al. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007;45:3396-3399. Scaletsky ICA, Fabbricotti SH, Silva SOC, et al. HEp-2- adherent Escherichia coli strains associated with acute infantile diarrhea, São Paulo, Brazil. Emerg Infect Dis. 2002;8:855-858. Scaletsky ICA, Fabbricotti SH, Carvalho RLB, et al. Diffuse and enteroaggregative patterns of adherence of Escherichia coli isolated from stools of children in northeastern Brazil. Braz J Microbiol. 2001;32:313-319. Souza TB, Morais MB, Tahan S, et al. High prevalence of antimicrobial drug-resistant diarrheagenic Escherichia coli in asymptomatic children living in an urban slum. J Infect. 2009;59:247-251. Regua-Mangia AH, Gomes TAT, Vieira MAM, et al. Molecular typing and virulence of enteroaggregative Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro city, Brazil. J Med Microbiol. 2009;58:414-422. Dos Santos LF, Gonçalves EM, Vaz TMI, et al. Distinct pathotypes of O113 Escherichia coli strains isolated from humans and animals in Brazil. J Clin Microbiol. 2007;45:2028-2030. Uber AP, Trabulsi LR, Irino K, et al. Enteroaggregative Escherichia coli from humans and animals differ in major phenotypical traits and virulence genes. FEMS Microbiol Lett. 2006;256:251-257. Zamboni A, Fabbricotti SH, Fagundes-Neto U, et al. Enteroaggregative Escherichia coli virulence factors are found to be associated with infantile diarrhea in Brazil. J Clin Microbiol. 2004;42:1058-1063. Dias AMG, Irino K, Kano E, et al. Virulence-associated genes diversity in Escherichia coli O128 strains isolated in São Paulo, Brazil. Rev Inst Adolfo Lutz. 2008;67:156-162. Elias WP, Barros SF, Moreira CG, et al. Enteroaggregative Escherichia coli strains among classical enteropathogenic Escherichia coli O serogroups. J Clin Microbiol. 2002;40:3540-3541. Valle GRF, Gomes TAT, Irino K, et al. The traditional enteropathogenic Escherichia coli (EPEC) serogroup O125 comprises serotypes which are mainly associated with the category of enteroaggregative E. coli. FEMS Microbiol Lett. 1997;152:95-100.

Escherichia coli Situation in Brazil

[37]

[38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51]

[52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65]

Pathogenic Escherichia coli in Latin America 173

Suzart S, Guth BEC, Pedroso MZ, et al. Diversity of surface structures and virulence genetic markers among enteroaggregative Escherichia coli (EAEC) strains with and without the EAEC DNA probe sequence. FEMS Microbiol Lett. 2001;201:163-168. Liberatore AMA, Tomita SK, Vieira MAM, et al. Expression of aggregative adherence to HELA cells by Escherichia coli strains isolated from sick horses Braz J Microbiol. 2007;38:9-13. Nataro JP, Kaper JB. Diarrheogenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. Trabulsi LR, Keller R, Gomes TAT. Typical and atypical enteropathogenic Escherichia coli (EPEC). Emerg Infect Dis. 2002;8:508–513. Kaper JP. Defining EPEC. Rev Microbiol. 1996;27:130–133. Gomes TAT, Griffin PM, Ivey C, et al. EPEC Infections in São Paulo. Rev Microbiol. 1996;27:25-33. Gomes TAT, Rassi V, MacDonald KL, et al. Enteropathogens associated with acute diarrheal disease in urban infants in São Paulo, Brazil. J Infect Dis. 1991;164:331-337. Manissadjian A, Barbieri D, Penna HA, et al. Incidence of pathogenic aerobic Enterobacteriaceae in open newborn nursery. Rev Paul Med. 1965;66:63-67. Murahovschi J, Ciochetti D. Estudo sobre a etiologia das diarréias agudas do lactente. J Pediatr. 1963;28:1-50. Murahovschi J, Ciochetti D, Stein ML, et al. Treatment of acute diarrheas of early infancy with a combination of thiophenicol and neomycin. Pediatr Prat. 1965;36:3-16. Murahovschi J, Trabulsi LR. Síndrome diarréica aguda no lactente. Pediatr Prat. 1976;47:13-31. Stewien KE, Mós EN, Yanaguita RM, et al. Viral, bacterial and parasitic pathogens associated with severe diarrhoea in the city of São Paulo, Brazil. J Diarrhoeal Dis Res. 1993;1:148-52. Taunay AE, Martins H, Toporowski J, et al. Laboratory investigations of infantile gastroenteritis caused by E. coli G.E.I. Rev Inst Adolfo Lutz. 1958;18:45-81. Toledo MRF, Alvariza MCB, Murahovschi J, et al. Enteropathogenic Escherichia coli serotypes and endemic diarrhea in infants. Infect Immun. 1983;39:586–9. Trabulsi LR, Manissadjan A, Penna HA, et al. Infantile diarrhea caused by enteropathogenic colibacilli. Preliminary studies on the occurrence of certain groups and serological types in Sao Paulo. Rev Inst Med Trop Sao Paulo. 1961;3:267270. Trabulsi LR, Toledo MRF, Ceballos SO, et al. Epidemiology of diarrhoeal diseases in South America. In; Infectious diarrhoea in the young. S. Tzipori et al., eds Elsevier Sc Publ. 1985;121-125. Trabulsi LR, Toledo MRF, Murahovschi J, et al. Epidemiology of infantile bacterial diarrheal disease in Brazil. In: Bacterial Diarrheal Diseases, eds., Y. Takeda, T. Miwatani. 1985;25-36. Magalhães M, Andrade M, Carvalho AE. Pathogenic Escherichia coli associated with infantile diarrhea. Rev Microbiol. 1981;12:38-41. Fagundes-Neto U, Schmitz LG, Scaletsky ICA. Acute diarrhea due to enteropathogenic Escherichia coli: epidemiological and clinical features in Brasília, Brazil. Int J Infect Dis. 1996;1:65-69. Queiroz DM, Mendes EN, Penna FJ, et al. Research on enteropathogenic bacteria from children with acute diarrhea, in Belo Horizonte, MG. Arq Gastroenterol. 1987;24:46-50. Mangia AH, Duarte AN, Duarte R, et al. Aetiology of acute diarrhoea in hospitalized children in rio de janeiro city, Brazil. J Trop Pediatr. 1993;39:365-367. Regua AH, Bravo VL, Leal MC, et al. Epidemiological survey of the enteropathogenic Escherichia coli isolated from children with diarrhoea. J Trop Pediatr. 1990;36:176-179. Fagundes Neto U, Ferreira VC, Patricio FR, et al. Protracted diarrhea: the importance of the enteropathogenic E. coli (EPEC) strains and Salmonella in its genesis. J Pediatr Gastroenterol Nutr. 1989;8:207-211. Gomes TAT, Vieira MA, Wachsmuth IK, et al. Serotype-specific prevalence of Escherichia coli strains with EPEC adherence factor genes in infants with and without diarrhea in São Paulo, Brazil. J Infect Dis. 1989;160:131–135. Almeida MTG, Silva RM, Donaire LM, et al. Enteropatógenos associados com diarréia aguda em crianças. J Pediatr. 1998;74:291-298. Montelli AC, Trabulsi LR. Diarrhea caused by "Shigella", "Salmonella" and enteropathogenic "E. coli" in Botucatu, State of São Paulo. AMB Rev Assoc Med Bras. 1970;16:23-26. Guerrant RL, Kirchhoff LV, Shields DS, et al. Prospective study of diarrheal illnesses in Northeastern Brazil: patterns of disease, nutritional impact, etiologies, and risk factors. J Infect Dis. 1983;148:986-997. Scaletsky ICA, Fabbricotti SH, Carvalho RLB, et al. Diffusely adherent Escherichia coli as a cause of acute diarrhea in young children in northeast Brazil: a case-control study. J Clin Microbiol. 2002;40:645-648. Andrade JA, Gomes TAT, Fagundes-Neto U. Mortality in breast-fed infants with persistent diarrhea: risk factors associated with death. Arq Gastroenterol. 1998;35:62-68.

174 Pathogenic Escherichia coli in Latin America

[66] [67] [68] [69] [70] [71] [72] [73] [74]

[75] [76] [77] [78] [79] [80] [81] [82]

[83] [84] [85] [86]

[87] [88] [89] [90]

[91]

Guth et al.

Fagundes Neto U, Trabulsi LR, Patrício FRS. Diarréia protraída: agentes enteropatogênicos na sua gênese e fisiopatologia. J Pediatr. 1988;64:237-41. Fagundes Neto U, Cordano A, Lifshitz F, et al. Protracted diarrhea: The importance of the enteropathogenic Escherichia coli strains and Salmonella in its genesis. Academic Press. 1990;37:367-72. Scaletsky ICA, Pedroso MZ, Morais MB, et al. Association of patterns of Escherichia coli adherence to HEp-2 cells with acute and persistent diarrhea. Arq Gastroenterol. 1999;36:54-60. Rosa ACP, Mariano AT, Pereira AMS, et al. Enteropathogenicity markers in Escherichia coli isolated from infants with acute diarrhoea and healthy controls in Rio de Janeiro, Brazil. J Med Microbiol. 1998;47:781-790. Souza EC, Martinez MB, Taddei CR, et al. Etiologic profile of acute diarrhea in children in São Paulo. J Pediatr. 2002;78:31-38. Vidotto MC, Kobayashi RK, Dias AM. Unidentified serogroups of enteropathogenic Escherichia coli (EPEC) associated with diarrhoea in infants in Londrina, Parana, Brazil. J Med Microbiol. 2000; 49:823-826. Trabulsi LR, Campos LC, Whittam TS, et al. Traditional and non-traditional enteropathogenic Escherichia coli serogroups. Rev Microbiol. 1996;27:1-6. Pessoa GVA, Suguimori RT, Irino K, et al. Isolamento de enterobactérias patogênicas em berçários do município de São Paulo. Rev Inst Adolfo Lutz. 1980;40:107-127. Pessoa GVA, Calzada CT, Peixoto ES, et al. Ocorrência de enterobactérias enteropatogênicas em São Paulo no septênio 1970-76. III-Sorotipos de Shigella e de Escherichia coli da gastrenterite infantil. 1978. Rev Inst Adolfo Lutz. 1980;38:129-139. Zuliani ME, Trabulsi LR. Estudos sobre a E. coli O111:B4. III- sensibilidade “in vitro” à sulfadiazina e a 6 antibióticos. Rev Inst Med Trop São Paulo. 1969;11:323-334. Fernandes RM, Ramos SR, Rassi V, et al. Use of plasmid profiles to differentiate strains within specific serotypes of classical enteropathogenic Escherichia coli. Braz J Med Biol Res. 1992;25:667-72. Nunes EB, Saridakis HO, Irino K, et al. Genotypic and phenotypic characterization of attaching and effacing Escherichia coli (AEEC) isolated from children with and without diarrhoea in Londrina, Brazil. J Med Microbiol. 2003;52:499-504. Magalhães M, Amorim RJ, Takeda Y, et al. Localized, diffuse, and aggregative-adhering Escherichia coli from infants with acute diarrhea and matched-controls. Mem Inst Oswaldo Cruz. 1992;87:93-97. Girão DM, Girão VB, Irino K, et al. Classifying Escherichia coli. Emerg Infect Dis. 2006;12:1297-1299. Barreto ML, Genser B, Strina A, et al. Effect of city-wide sanitation programme on reduction in rate of childhood diarrhoea in northeast Brazil: assessment by two cohort studies. Lancet. 2007;370:1622-1628. Hernandes RT, Elias WP, Vieira MAM, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett. 2009;297:137-149. Vieira MA, Andrade J, Trabulsi LR, et al. Phenotypic and genotypic characteristics of Escherichia coli strains of nonenteropathogenic E. coli (EPEC) serogroups that carry eae and lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J Infect Dis. 2001;183:762–72. Gomes TAT, Irino K, Girão DM, et al. Emerging enteropathogenic Escherichia coli strains? Emerg Infect Dis. 2004;10:1851-1855. Moreira FC, Vieira MAM, Ferreira AJ, et al. Escherichia coli strains of serotype O51:H40 comprise typical and atypical enteropathogenic E. coli strains and are potentially diarrheagenic. J Clin Microbiol. 2008;46:1462-1465. Abe CM, Trabulsi LR, Blanco J, et al. Virulence features of atypical enteropathogenic Escherichia coli identified by the eae(+) EAF-negative stx(-) genetic profile. Diagn Microbiol Infect Dis. 2009;64:357-365. Dulguer MV, Fabbricotti SH, Bando SY, et al. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003;188:1685-1694. Scaletsky IC, Aranda KR, Souza TB, et al. Evidence of pathogenic subgroups among atypical enteropathogenic Escherichia coli strains. J Clin Microbiol. 2009;47:3756-3759. Vieira MA, Salvador FA, Silva RM, et al. Prevalence and characteristics of the Pathogenicity Island (PAI) O122 in typical and atypical enteropathogenic Escherichia coli. J Clin Microbiol. 2010; Feb 24. [Epub ahead of print]. Oliva CA, Scaletsky I, de Morais MB, et al. Severe acute diarrhea associated to classic enteropathogenic Escherichia coli (EPEC): clinical features and fecal losses in hospitalized infants Rev Assoc Med Bras. 1997;43:283-289. Carvalho VM, Gyles CL, Ziebell K, et al. Characterization of monkey enteropathogenic Escherichia coli (EPEC) and human typical and atypical EPEC serotype isolates from neotropical nonhuman primates. J Clin Microbiol. 2003;41:12251234. Nakazato G, Gyles C, Ziebell K, et al. Attaching and effacing Escherichia coli isolated from dogs in Brazil: characteristics and serotypic relationship to human enteropathogenic E. coli (EPEC). Vet Microbiol. 2004;101:269-277.

Escherichia coli Situation in Brazil

[92] [93] [94] [95] [96] [97]

[98] [99] [100] [101] [102] [103]

[104] [105] [106] [107] [108] [109] [110] [111]

[112] [113] [114] [115] [116]

Pathogenic Escherichia coli in Latin America 175

Franco BDGM, Gomes TAT, Jacabi M, et al. Use of probes to detect virulence factor DNA sequences in Escherichia coli strains isolated from foods. Int J Food Microbiol. 1991;12:333-338. Bando SY, Andrade FB, Guth BE, et al. Atypical enteropathogenic Escherichia coli genomic background allows the acquisition of non-EPEC virulence factors. FEMS Microbiol Lett. 2009;299:22-30. Guerrant RL, Moore RA, Kirschenfeld PM, et al. Role of toxigenic and invasive bacteria in acute diarrhea of childhood. N Engl J Med. 1975;293:567-573. Giugliano LG, Bernardi MG, Vasconcelos JC, et al. Longitudinal study of diarrhoeal disease in a peri-urban community in Manaus (Amazon-Brazil). Ann Trop Med Parasitol. 1986;80:443-450. McLean M, Brennan R, Hughes JM, et al. Etiology of childhood diarrhea and oral rehydration therapy in northeastern Brazil. Bull Pan Am Health Organ. 1981;15:318-325. Gatti MS, Ricci LC, Serafim MB, et al. The incidence of enterotoxigenic Escherichia coli, rotavirus and Clostridium perfringens from cases of diarrhea in children, in the region of Campinas, SP, Brazil. Rev Inst Med Trop São Paulo. 1989;31:392-398. Reis MHL, Guth BEC, Gomes TAT, et al. Frequency of Escherichia coli strains producing heat-labile toxin or heat-stable toxin or both in children with and without diarrhea in São Paulo. J Clin Microbiol. 1982;15:1062-1064. Giugliano LG, Araújo AN, Piva IC, et al. Virulence factors of Escherichia coli strains isolated from diarrheic children: influence of storage conditions. Rev Microbiol (São Paulo). 1995;26:267-273. Tornieporth NG, John J, Salgado K, et al. Differentiation of pathogenic Escherichia coli strains in Brazilian children by PCR. J Clin Microbiol. 1995;33:1371-1374. Spano LC, Sadovsky ADI, Segui PN, et al. Age-specific prevalence of diffusely adherent Escherichia coli in Brazilian children with acute diarrhoea. J Med Microbiol. 2008;57:359-363. Korzeniowski OM, Dantas W, Trabulsi LR, et al. A controlled study of endemic sporadic diarrhea among adult residents of southern Brazil. Trans R Soc Trop Med Hyg. 1984;78:363-369. Lima AAM, Moore SR, Brabosa Jr, MS, et al. Persistent diarrhea signals a critical period of increased diarrhea burdens and nutritional shortfalls: A prospective cohort study among children in northeastern Brazil. J Infect Dis. 2000;181:16431651. Vicente ACP, Teixeira LFM, Iniguez-Rojas L, et al. Outbreaks of cholera-like diarrhoea caused by enterotoxigenic Escherichia coli in the Brazilian Amazon Rainforest. Trans R Soc Trop Med Hyg. 2005;99:669-674. Guth BEC, Pickett CL, Twiddy EM, et al. Production of type II heat-labile enterotoxin (LT-II) by Escherichia coli strains isolated from food and human feces. Infect Immun. 1986;54:587-589. Guth BEC, Aguiar EG, Griffin PM, et al. Prevalence of colonization factor antigens (CFAs) and adherence to HeLa cells in enterotoxigenic Escherichia coli isolated from feces of children in São Paulo. Microbiol Immunol. 1994;38:695-701. Nishimura L, Giron J, Nunes SL, et al. Prevalence of enterotoxigenic Escherichia coli strains harboring the longus pilus gene in Brazil. J Clin Microbiol. 2002;40:2606-2608. Regua-Mangia AH, Guth BEC, Andrade JRC, et al. Genotypic and phenotypic characterization of enterotoxigenic Escherichia coli (ETEC) strains isolated in rio de Janeiro city, Brazil. FEMS Immunol Med Microbiol. 2004;40:155-162. Giraldi R, Guth BEC. Presence of colonization factor antingen IV (CS5CS6) in 029:H21 enterotoxigenic Escherichia coli isolated from children with diarrhea in Brazil. Braz. J Med Biol Res. 1993;26:1251-1259. Guth BEC, Trabulsi, LR. Evaluation of antisera used for detecting enterotoxigenic Escherichia coli in São Paulo. J Clin Microbiol. 1985;22:626-628. Guth BEC, Silva MHL, Scaletsky ICA, et al. Enterotoxin production, presence of colonization factor antigen I, and adherence to HeLa cells by Escherichia coli 0128 strains belonging to different 0 subgroups. Infect Immun. 1985;47:338340. Guth BEC, Silva RM, Toledo MRF, et al. Virulence factors and biochemical characteristics of serotypes of Escherichia coli serogroup 029. J Clin Microbiol. 1989;27:2161-2164. Martins MF, Martinez-Rossi NM, Ferreira A, et al. Pathogenic characteristics of Escherichia coli strains isolated from newborn piglets with diarrhea in Brazil. Vet Microbiol. 2000;76:51-59. Rigobelo EC, Stella AE, Ávila FA, et al. Characterization of Escherichia coli isolated from carcasses of beef cattle during their processing at an abattoir in Brazil. Int J Food Microbiol. 2006;110:194-198. Salvadori MR, Valadares GF, Leite DS, et al. Virulence factors of Escherichia coli isolated from calves with diarrhea in Brazil. Braz J Microbiol. 2003;34:230-235. Ugrinovich LA, Avila FA, Oliveira MN, et al. Identificação dos genes que codificam para a enterotoxina termolábil LT-II em amostras de Escherichia coli isoladas de bezerros com diarréia na região de Jaboticabal, SP. Brasil. Ciência Rural. 2002;32:289-291

176 Pathogenic Escherichia coli in Latin America

Guth et al.

[117] Nardi ARM, Salvadori MR, Coswig LT, et al. Type 2 heat-labile enterotoxin (LT-II)-producing Escherichia coli isolated from ostriches with diarrhea. Vet Microbiol. 2005;105:245-249. [118] Aleixo JA, Aver GP. Prevalence of enteropathogenic and enterotoxigenic Escherichia coli in foods of animal origin in Southern Brazil. Cien Rur. 1996;26:247-250. [119] Cerqueira AMF, Tibana A, Gomes TAT, et al. Search for LT-II and STb DNA sequences among Escherichia coli isolated from bovine meat products by colony hibridization. J Food Protect. 1994;57:734-736. [120] Cerqueira AMF, Tibana A, Guth BEC. High occurrence of Shiga-like-toxin-producing strains among diarrheagenic Escherichia coli isolated from raw beef products in Rio de Janeiro City, Brazil. J Food Protect. 1997;60:1-5. [121] Franco BDGM, Guth BEC, Trabulsi LR. Isolamento e características de cepas de Escherichia coli enteropatogênica isoladas de alimentos. Rev Microbiol (São Paulo). 1985;16:49-55. [122] Franco BDGM, Guth BEC, Trabulsi LR. Enterotoxigenic Escherichia coli isolated from foods in São Paulo, Brazil. J Food Prot. 1987;50:832-834. [123] Paneto BR, Schocken-Iturrino RP, Macedo C, et al. Occurrence of toxigenic Escherichia coli in raw milk cheese in Brazil. Arq Bras Med Vet Zootec. 2007;59:508-512. [124] Reis MHL, Vasconcelos JC, Trabulsi LR. Prevalence of enterotoxigenic Escherichia coli in some processed raw food from animal origin. Appl Env Microbiol. 1980;39:270-271. [125] Reis MHL, Matos DP, de Castro AFP, et al. Relationship among enterotoxigenic phenotypes, serotypes, and sources of strains in enterotoxigenic Escherichia coli. Infect Immun. 1980;28:24-27. [126] Sato MIP, Sanches OS, Martins MT, et al. Isolation of enterotoxigenic Escherichia coli in water and sewage in São Paulo, Brazil. Rev Microbiol (São Paulo). 1983;14:276-281. [127] Theophilo GN, dos Fernandes Vieira RH, dos Prazeres Rodrigues D, et al. Escherichia coli isolated from seafood: toxicity and plasmid profiles. Int Microbiol. 2002;5:11-4. [128] Nishimura LS, Ferreira LCS, Pacheco ABF, et al. Relationship between outer membrane protein and lipopolysaccharide profiles and serotypes of enterotoxigenic Escherichia coli isolated in Brazil. FEMS Microbiol Lett. 1996;143:253. [129] Pacheco ABF, Guth BEC, de Almeida DF, et al. Characterization of enterotoxigenic Escherichia coli by random amplification of polymorphic DNA. Res Microbiol. 1996;147:175-189. [130] Pacheco ABF, Guth BEC, Soares KCC, et al. Random amplification of polymorphic DNA reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli (ETEC) isolated from humans. J Clin Microbiol. 1997;35:1521-1525. [131] Lasaro MAS, Rodrigues JF, Mathias-Santos C, et al. Genetic diversity of heat-labile toxin expressed by enterotoxigenic Escherichia coli strains isolated from humans. J Bacteriol. 2008;190:2400-2410. [132] Giraldi R, Guth BEC, Trabulsi LR. Production of Shiga-like toxin among Escherichia.coli strains and other bacteria isolated from diarrhea in São Paulo, Brazil. J Clin Microbiol. 1990;28:1460-1462. [133] Irino K, Vaz TMI, Medeiros MIC, et al. Serotype diversity as a drawback in the surveillance of Shiga toxin-producing Escherichia coli infections in Brazil. J Med Microbiol. 2007;56:565-567. [134] Vaz TMI, Irino K, Kato MAMF, et al. Virulence properties and characteristics of Shiga toxin-producing Escherichia coli in São Paulo, Brazil, from 1976 through 1999. J Clin Microbiol. 2004;42:902-905. [135] De Toni F, Souza EM, Pedrosa FO, et al. A prospective study on Shiga toxin-producing Escherichia coli in children with diarrhoea in Paraná State, Brazil. Lett Appl Microbiol. 2009;48:645-647. [136] Guth BEC, Souza RL, Andrade MC, et al. Hemolytic Uremic Syndrome in pediatric care units in São Paulo, Brazil, from 2001 to 2005. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires,: Argentina. 2009;May 10-13,p54-55. [137] Guth BEC, Souza RL, Vaz TMI, et al. First Shiga Toxin-producing Escherichia coli isolate from a patient with hemolytic uremic syndrome, Brazil. Emerg Infect Dis. 2002;8:535-536. [138] Bastos FC, Vaz TMI, Irino K, et al. Phenotypic characteristics, virulence profile and genetic relatedness of O157 Shiga toxin-producing Escherichia coli isolated in Brazil and other Latin American countries. FEMS Microbiol Lett. 2006;265:89-97. [139] Souza RL, Nishimura LS, Guth BEC. Uncommon Shiga toxin-producing Escherichia coli serotype O165 :HNM as cause of hemolytic uremic syndrome in São Paulo, Brazil. Diag Microbiol Infect Dis. 2007;59:223-225. [140] Guth BEC, Ramos SRTS, Cerqueira AMF, et al. Phenotypic and genotypic characteristics of Shiga toxin-producing Escherichia coli isolated from children in São Paulo, Brazil. Mem Inst Oswaldo Cruz. 2002;97:1085-1089. [141] Irino K, Vaz TMI, Kato MAMF, et al. O157:H7 Shiga toxin-producing Escherichia coli strains associated with sporadic cases of diarrhea in São Paulo, Brazil. Emerg Infect Dis. 2002;8:446-447. [142] Cantarelli V, Nagayama K, Takahashi A, et al. Isolation of Shiga toxin-producing Escherichia coli (STEC) serotype O91:H21 from a child with diarrhea in Porto Alegre city, RS, Brazil. Braz J Microbiol. 2000;31:266-70.

Escherichia coli Situation in Brazil

Pathogenic Escherichia coli in Latin America 177

[143] Guth BEC, Vaz TMI, Gomes TAT, et al. Re-emergence of O103:H2 Shiga toxin-producing Escherichia coli infections in São Paulo, Brazil. J Med Microbiol. 2005;54:805-806. [144] Aidar-Ugrinovich L, Blanco J, Blanco M, et al. Serotypes, virulence genes, and intimin types of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E.coli (EPEC) isolated from calves in São Paulo, Brazil. Int J Food Microbiol. 2007;115:297-306. [145] Cerqueira AMF, Guth BEC, Joaquim RM, et al. High occurrence of Shiga toxin-producing Escherichia coli (STEC) in healthy cattle in Rio de Janeiro State, Brazil. Vet Microbiol. 1999;70:111-121. [146] Farah SMSS, de Souza EM, Pedrosa FO, et al. Phenotypic and genotypic traits of Shiga toxin-producing Escherichia coli strains isolated from beef cattle from Paraná State, southern Brazil. Lett Appl Microbiol. 2007;44:606-612. [147] Irino K, Kato MAMF, Vaz TMI, et al. Serotypes and virulence markers of Shiga toxin-producing Escherichia coli (STEC) isolated from dairy cattle in São Paulo State, Brazil. Vet Microbiol. 2005;105:29-36. [148] Leomil L, Aidar-Ugrinovich L, Guth BEC, et al. Frequency of Shiga toxin-producing Escherichia coli (STEC) isolates among diarrheic and non-diarrheic calves in Brazil. Vet Microbiol. 2003;97:103-109. [149] Moreira CN, Pereira MA, Brod CS, et al. Shiga toxin-producing Escherichia coli (STEC) isolated from healthy dairy cattle in southern Brazil. Vet Microbiol. 2003;93:179-183. [150] Oliveira MG, Brito JRF, Carvalho RR, et al. Water buffaloes (Bubalus bubalis) identified as an important reservoir of Shiga toxin-producing Escherichia coli in Brazil. Appl Environ Microbiol. 2007;73:5945-5948. [151] Oliveira MG, Brito JRF, Gomes TAT, et al. Virulence profile diversity of Shiga toxin-producing Escherichia coli from food-producing animals, Brazil. Int J Food Microbiol. 2008;127:139-146. [152] Pigatto CP, Schocken-Iturrino RP, Souza EM, et al. Virulence properties and antimicrobial susceptibility of Shiga toxinproducing Escherichia coli strains isolated from healthy cattle from Parana State, Brazil. Can J Microbiol. 2008;54:588593. [153] Timm CD, Irino K, Gomes TAT, et al. Virulence markers and serotypes of Shiga toxin-producing Escherichia coli isolated from cattle in Rio Grande do Sul, Brazil. Lett Appl Microbiol. 2007;44:419-425. [154] Vettorato MP, Leomil L, Guth BEC, et al. Properties of Shiga toxin-producing Escherichia coli (STEC) isolates from sheep in the State of São Paulo, Brazil. Vet Microbiol. 2003;95:103-109. [155] Vicente HIG, Amaral LA, Cerqueira AMF. Shigatoxigenic Escherichia coli serogroups O157, O111 and O113 in feces, water and milk samples from dairy farms. Braz J Microbiol. 2005;36:217-222. [156] Vettorato MP, de Castro AFP, Cergole-Novella MC, et al. Shiga toxin-producing Escherichia coli and atypical enteropathogenic Escherichia coli strains isolated from healthy sheep of different populations in São Paulo, Brazil. Lett Appl Microbiol. 2009;49:53–59. [157] Guth BEC, Chinen I, Miliwebsky E, et al. Serotypes and Shiga toxin-producing genotypes among Escherichia coli isolated from animals and food in Argentina and Brazil. Vet Microbiol. 2003;92:335-349. [158] Lira WM, Macedo C, Marin JM. The incidence of Shiga toxin-producing Escherichia coli in cattle with mastitis in Brazil. J Appl Microbiol. 2004;97:861-866. [159] Rigobelo EC, Gamez HJ, Marin JM, et al. Virulence factors of Escherichia coli isolated from diarrhoeic calves. Arq Bras Med Vet Zootec. 2006;58:305-310. [160] Rodolpho D, Marin JM. Isolation of Shiga toxingenic Escherichia coli from butcheries in Taquaritinga City, State of São Paulo, Brazil. Braz J Microbiol. 2007;38:599-602. [161] Silveira NFA, Silva N, Contreras C, et al. Occurrence of Escherichia coli O157:H7 in hamburgers produced in Brazil. J Food Prot. 1999;62:1333-1335. [162] Lascowski KMS, Fogo VS, Siqueira GA, et al. Occurrence of O157 and non-O157 Shiga toxin - producing Escherichia coli in beef cattle presented from slaughter in São Paulo, Brazil. 7th International Symposium on Shiga Toxin (Verocytotoxin) - Producing Escherichia coli Infections. Buenos Aires, Argentina. 2009;May 10-13,p77 [163] Cergole-Novella MC, Nishimura LS, Dos Santos LF, et al. Distribution of virulence profiles related to new toxins and putative adhesions in Shiga toxin-producing Escherichia coli isolated from diverse sources. FEMS Microbiol Lett. 2007;274:329-334. [164] Dos Santos LF, Irino K, Vaz TMI, et al. Set of virulence genes and genetic relatedness of O113:H21 Escherichia coli strains isolated from the animal reservoir and human infections in Brazil. J Med Microbiol. 2010;59(Epub ahead of print). [165] Tristão CS, Gonzalez AGM, Coutinho CAS, et al. Virulence markers and genetic relationships of Shiga toxin-producing Escherichia coli serogroup O111 isolated from cattle. Vet Microbiol. 2007;119:358-365. [166] Cergole-Novella MC, Nishimura LS, Irino K, et al. Stx genotypes and antimicrobial resistance profiles of Shiga toxinproducing Escherichia coli strains isolated from human infections, cattle and foods in Brazil. FEMS Microbiol Lett. 2006;259:234-239.

178 Pathogenic Escherichia coli in Latin America

Guth et al.

[167] Pestana de Castro AF, Guerra B, Leomil L, et al. Multidrug-resistant Shiga toxin-producing Escherichia coli O118:H16 in Latin America. Emerg Infect Dis. 2003;9:1027-1028. [168] Vaz TMI, Irino K, Nishimura LS, et al. Genetic heterogeneity of Shiga toxin-producing Escherichia coli strains isolated in São Paulo, Brazil, from 1976 through 2003, as revealed by pulsed-field gel electrophoresis. J Clin Microbiol. 2006;44:798-804. [169] Lopes LM, Fabbricotti SH, Ferreira AJP, et al. Heterogeneity among strains of diffusely adherent Escherichia coli isolated in Brazil. J Clin Microbiol. 2005;43:1968-1972.

Pathogenic Escherichia coli in Latin America, 2010, 179-190

179

CHAPTER 12 Shiga Toxin Producing Escherichia coli in Chile Roberto M. Vidal1*, Angel Oñate2, Juan C. Salazar1 and Valeria Prado1 1

Institute of Biomedical Sciences, Faculty of Medicine Universidad de Chile; 2Department of Microbiology, Faculty of Biological Sciences. Universidad de Concepción. Chile. Abstract: Shiga toxin-producing Escherichia coli (STEC) are emerging pathogens worldwide. Infections associated with STEC have a broad clinical spectrum from asymptomatic infections, acute diarrhea, dysenteric diarrhea and Hemolytic Uremic Syndrome. Some serotypes of STEC are highly virulent for humans due to the presence of two cytotoxins (Stx1, Stx2) and a pathogenicity island called Locus of Enterocyte Effacement (LEE), which is responsible for the adherence to intestinal epithelium, mainly through the intimin protein encoded by eae gene. Other factors have been implicated in virulence, e.g., the products of the efa1, iha, hylA, lpf and saa genes, which are encoded in the genomes of O157 and non-O157. In Chile, STEC Non-O157 serogroups are the most important cause of STEC infections. It has been found that the presence of these specific genes is more relevant than is that of the serogroup. In Chile, a high rate of STEC isolations in swine and bovines as asymptomatic carriers has been reported. Therefore the Chilean Ministry of Health has incorporated STEC as an agent under surveillance. Recently, samples from swine and bovines at slaughter were analyzed and, interestingly, only the bovine carrying STEC exhibited the virulence genes found in human isolates. Several strategies have been proposed to prevent STEC colonization in the animal host, where findings following vaccination with proteins from the LEE locus are encouraging. Thus,, DNA vaccines have been used as a novel strategy, and the immunized animals have shown a strong lymphocyte proliferation against bacterial antigens.

EPIDEMIOLOGY OF ENTERIC INFECTIONS IN CHILE Enteric infections are an important cause of morbidity around the world, with 2 to 4 billon acute diarrhea episodes, of which 123.6 million will require medical treatment and 9 million hospitalizations. Approximately 2 to 2.5 million children will die due to this cause [1, 2]. Although acute diarrhea lethality in Chile has decreased to 2/100,000 inhabitants, it continues as an important cause of morbidity. The projections made by a Chilean study and the acute gastroenteritis surveillance implemented by the Ministry of Health (MINSAL) suggest that in children under 3 years of age, non-dysenteric acute diarrhea causes ca. 114,000 emergency medical consultations and 12,500 hospitalizations every year, in addition to nearly 150,000 consultations for acute diarrhea in children under 5 years of age [3]. However, added to this is the significant impact of food- or water-transmitted acute diarrhea outbreaks affecting both children and adults. The Sub-Department of Epidemiology of the Department of Public Health and Sanitary Planning, through a food-transmitted diseases (FTD) monitoring program, has reported a gradual increase of notifications, from 81 outbreak notices between January and March 2003, to 265 reported for the same period in 2008. Microorganisms causing intestinal infection are multiple. Due to this multi-causality, it is relevant to point out that previous studies point to an etiologic cause, dependent on several factors, such as the patient’s age, clinical characteristics, and if the episodes are of endemic characteristic or an outbreak, among others. The most frequently detected agents in children under 5 years of age with non-dysenteric endemic acute diarrhea are: enteric viruses (rotavirus, astrovirus, human calicivirus (HuCV) and enteric adenovirus), enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli (ETEC), Shigella spp. and Salmonella enterica serovar Enteritidis; and in children under 5 years of age with dysenteric endemic acute diarrhea: Shiga toxin-producing E. coli/enterohemorrhagic E. coli (STEC/EHEC), Shigella spp, Salmonella Enteritidis, Campylobacter jejuni; and in acute diarrhea outbreaks: Salmonella Enteritidis, Calicivirus, Shigella sp., STEC/EHEC, ETEC and EPEC [4]. *Address correspondence to: Roberto M Vidal Alvarez1, Microbiology and Mycology Program, Institute of Biomedical Sciences, Faculty of Medicine. Universidad de Chile. Santiago, Chile E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Vidal et al.

180 Pathogenic Escherichia coli in Latin America

EPIDEMIOLOGY OF SHIGA TOXIN-PRODUCING E. coli (STEC) IN CHILE STEC is a group of emergent pathogens that are distributed worldwide and posses important virulence factors that allow increased infection of humans. They have been associated with food-transmitted diseases (FTD), and they also are the etiologic agent of acute diarrhea, bloody diarrhea and hemolytic uremic syndrome (HUS) in children. HUS affects mainly children, and its incidence in infants under 5 years of age in the Metropolitan Region of Chile has been reported at 3.2 cases in 100,000 inhabitants [5]. Further, HUS is one of the main causes of acute renal deficiency in infants and preschoolers, with a lethality ranging from 2 to 6% [5, 6, 7, 8, 9, 10, 11, 12]. Among the described STEC serotypes, O157:H7 is the most prevalent in countries such as United States, England, Canada and Japan, in which large food intoxication outbreaks caused by this serotype have been reported. In Latin America countries, some parts of Europe, and Australia, non-O157 serogroups are the most important. Prado et al. (1997) demonstrated that strains of non-O157 (i.e., O26, O111) serogroups were the most important cause of STEC infections in Chile (64%) [13]. The main virulence factor, characterizing STEC strains, is the production of two Shiga toxins (Stx1 and Stx2), responsible for the damage observed in HUS patients. In STEC as well as EHEC, there is another important virulence factor in these pathogenic strains named intimin (encoded by the eae gene), which has been described in other diarrheagenic E. coli (i.e. EPEC), as well as in other bacterial species (Citrobacter rodentium, E. albertii). Intimin allows bacteria to initiate the colonization of intestinal epithelium by means of the translocated intimin receptor (Tir) and to generate a series of changes in the cell cytoskeleton, producing a characteristic lesion called Attachment and Effacement (A/E), which is a structural modification resembling a pedestal (Fig. 1). This protein and its receptor are codify within the pathogenicity genomic island known as the Locus of Enterocyte Effacement (LEE) [11, 14]. 9 EHEC

PEDESTAL

x

mm

10000 1

mm

=924653 EHEC UCH-BIO MED.M.E

Figure 1: The characteristic A/E lesion is shown by scanning electron microscope (SEM). Note the intimate attachment of EHEC EDL933 to Hep-2 cultured cells and the appearance of a bacterium sitting on a “pedestal” on the cell membrane are common characteristics.

In Chile, very few clinical laboratories have included a diagnostic method for STEC, and those that have done so use culture in selective media (McConkey sorbitol agar), providing only a presumptive diagnosis [15]. In this context, molecular methods based on the Polymerase Chain Reaction (PCR) have been developed in Chile, allowing diagnosis of those clinical isolates corresponding to diarrheagenic E. coli. By using these diagnostic tools, two studies were conducted in Santiago, Chile, in which stool samples of children with acute diarrhea were analyzed, yielding a STEC isolation frequency between 0.6% and 1.6% in the first study performed from November 2002 until April 2003 [16] and the second from April 2004 until January 2005 [17]. Furthermore, a recent study was carried out which included 90 clinical isolates of STEC collected between 1997 and 2005, and allowed the determination that 46.6 % of the isolated were associated with mild acute diarrhea (AD); 23.3%, dysenteric syndrome (DS) and 30%,HUS. The STEC serotype most frequently isolated from the three clinical syndromes under study was O157:H7, and was found in particular in HUS patients, where it reached 100%

Shiga Toxin Producing Escherichia coli in Chile

Pathogenic Escherichia coli in Latin America 181

as compared with findings in AD patients (52.3%) and DS patients (62%). Non-O157 STEC serogroups were not isolated from HUS patients, but O26:H- and O26:H11 were present in patients with AD (43%) and DS (28.5%), making it the second most important serotype after O157:H7. From the total STEC strains studied, 66.3% were stx2/eae while 24.4% were stx1/eae. The rest of the eae+ STEC strains showed both Shiga toxins variants (stx1- stx2). In bloody diarrhea syndrome, 68.8% of the STEC strains were positive for stx2/eae and, in strains isolated from HUS patients, 100% were positive for the stx2/eae genotype. The O157:H7 serotype strains were mainly of the intimin gamma variant, and it is noteworthy that 4 of them did not amplify any of the variants studied (α, β, γ, δ, ε). The STEC strains serogroup O26 were intimin positive, and 2 strains were non-typable (NT), but showed intimin β variants. Regarding the intimin variants versus clinical symptoms, it was found that the  variant is directly related to the severity of the clinical syndromes, with the most severe cases being associated with the presence of the stx2/eae genotype (Tables 1 and 2). Table 1: Number of Shiga toxin-producing Escherichia coli strains isolates from humans, according to clinical syndrome and serogroup Clinical Syndrome

Strains (n)

Serogroup

Hemolytic Uremic Síndrome (HUS)

27 1 4 13 1 2 21 1 2 16 2 90

O157:H7 O103 O26:H11 O157:H7 O157 O26:HO157:H7 O157 O26:HO26:H11 Non Typable

Dysenteric Syndrome (DS)

Acute Diarrhea (DA)

TOTAL

Table 2: Virulence gene detected by using PCR in STEC strains isolated from humans according to clinical syndrome and location inside or outside of the LEE locus.

Gene

Genes inside of LEE locus Genes inside of LEE locus only in STEC non-O157

Genes outside of LEE locus

AD(n=42)

DS(n=21)

HUS(n=27)

eae

42 (100%)

21 (100%)

27 (100%)

tir

42 (100%)

21 (100%)

26 (96%)

ent

42 (100%)

17 (81%)

26 (96%)

efa1

18 (43%)

3 (14%)*

0*

efa1O157

40 (95%)

20 (95%)

26 (96%)

lpf

30 (71%)*

14 (66%)*

25 (93%)*

saa

0

0

0

hlyA

41 (98%)

21 (100%)

26 (96%)

stx1

20 (48%)*

7 (33%)*

0*

stx2

23 (55%)*

14 (66%)*

27 (100%)*

iha

39 (93%)

18 (86%)

22 (81%)

AD: Acute Diarrhea; DS: Dysenteric Syndrome; HUS: Hemolytic Uremic Syndrome * p<0.01 in relation to HUS.

Clinical Syndrome

182 Pathogenic Escherichia coli in Latin America

Vidal et al.

Additionally, in studies performed in parallel, it was possible to isolate clinical STEC strains that were intimin negative, showing variations in their toxigenic profile, containing stx2, or strains with both Shiga toxins (stx1- stx2). This is certainly exciting and opens investigations in these strains for new adhesion factors, responsible for the bacteria-intestinal cell interaction [18]. CHARACTERIZATION OF VIRULENCE FACTORS ENCODED WITHIN OR OUTSIDE OF THE LEE PATHOGENICITY ISLAND IN STEC STRAINS ISOLATED IN CHILE Presently, the presence of other virulence factors and adhesins, beside the intimin (eae) protein, is unknown in several isolates. They can be found as part of the LEE pathogenicity island or are also present in other chromosomal regions or extra-chromosomal elements. As part of the genetic mosaic comprised in the LEE pathogenicity island in non-O157 STEC strains, the efa1 (EHEC factor for adherence) gene can be found and identified in a chromosomal genetic locus [19]. Moreover, this gene would also be related to adhesion, but does not produce A/E type lesions in the cell [20] and the ent gene, a putative homologue of the Shigella ShET2 enterotoxin [21]. Furthermore, other genes (outside of the LEE island), whose products have been associated with adhesion and colonization mechanisms in the intestine, have been characterized. They include the hlyA gene, a hemolysin encoded in a plasmid present in eae-positive and eae-negative strains [22], the saa (STEC autoagglutinating adhesin) gene, present in LEE negative serotype strains (O113:H21, O91:H2 among others), as well as some strains isolated from HUS patients and the efa1 gene, mainly associated with STEC strains isolated from animal reservoir [23]. Also present are the lpfA (Long polar fimbriae) genes, representing the major fimbrial subunits located in two regions of the chromosome (O157-islands: OI-141 y OI-154) in STEC strains of serotype O157:H7 and highly related to Salmonella enterica serovar Typhimurium lpf genes [24]. Finally, also present is the iha (Iron-regulated gene A homologue) gene in the OI-43 and OI-48 islands that encodes for an outer membrane protein with adhesion properties and sharing homology to Vibrio cholerae IrgA, which is widely distributed among STEC [25]. Recently, the presence and distribution of these different virulence genes was analyzed in 90 STEC strains isolated from patients with infections of different levels of severity, including watery diarrhea, bloody diarrhea and HUS. As part of the plasmid- encoded genes, it was found that hlyA (hemolysin) was present in 96% in STEC strains isolated from AD, DS and HUS, with non-statistical differences among the three clinical syndromes. The saa (STEC autoagglutinating adhesin) gene was not detected in the studied STEC strains (Table 2). Nevertheless, other studies carried out in Chile have described Saa as the adhesin most frequently detected in STEC strains isolated from food products [26]. These results suggest that hlyA has an important role in STEC strains producing infection in humans. As part of the chromosomally encoded virulence factors not associated with the LEE island, it was observed that the iha amplification pattern does not show significant differences among the three groups of clinical STEC strains studied (values >80%); however the importance of this gene in STEC virulence is not clear. It was also observed that 90% of the STEC strains isolated from patients possessed the efa1 gene [26]. This result supports the possibility of identifying conserved genes encoding immunogenic proteins different from intimin, but which are associated with adhesion and might be appropriate targets for vaccine development. Interestingly, when analyzing the truncated version of the O157:H7 STEC strains efa1 gene (efa1O157 ≈1300 bp) in non-O157 STEC strains, it was observed that more than 95% of the strains were positive by PCR for efa1, and yielded similar results among the three clinical groups of strains under study. Therefore, efa1 is an ideal candidate for the development of vaccines directed against STEC strains harboring the LEE island (Table 2) independently of the bacterial serotype. On the other hand, the analysis of the lpf gene in the three groups of strains under study produced statistically significant differences (Table 2), with the larger presence in the most severe infections. The lpf gene was positive by PCR, in 54.3% of acute diarrhea up to 92.6% in HUS. Noteworthy, when comparing the results of the lpf amplification by PCR in food strains, it was positive only in 3.1% of the strains (data not shown). A Principal Components Analysis (PCA) allowed correlating the presence of genetic markers (virulence genes studied, Table 2) and the development of a clinical syndrome, particularly HUS. According to the Biplot graph

Shiga Toxin Producing Escherichia coli in Chile

Pathogenic Escherichia coli in Latin America 183

generated with the statistical data of the results (Table 2), (i) there was a greater proximity between the lpf y stx2 genes, (ii) the Biplot analysis (Fig. 2) also showed that HUS pathology does not correlate with the other pathologies, and (iii) in accordance with the mean analysis for the proportions test, it was demonstrated, with a 95% probability, that lpf y stx2 genes have a larger presence in HUS pathology. Therefore, "lpf and stx2 genes are certainly virulence genes associated with the HUS patients." This observation was supported by a recent publication by Torres et al. [27].

Biplot

1,2

SHU

0,4

lpf

stx2

saa

ent

0

efa1/lifA

efa10157

Component 2

0,8

cesT eae tir

hlya

-0,4

DS

iha stx1

DA

-0,8 -3,5

-1,5

0,5 Component 1

2,5

4,5

Figure 2: Biplot graphic showing that lpf and stx2 are certainly virulence genes associated with Hemolytic Uremic Syndrome (HUS) patients. HUS strains have a great impact in Component 2. Despite previous results, new virulence factors are described in E. coli strains every year. Some of these new proteins are associated with adhesion, such as the E. coli common pilus (ECP) factor present both in commensal and pathogenic E. coli [28]; the multipurpose type 4 pili with pathogenicity attributes called hemorrhagic coli pili (HCP), present in E. coli O157:H7 [29]; and a fimbria encoded in the ycbQRST operon, called E. coli YcbQ laminin-binding fimbriae (ELF) [30].

The adherence to the intestinal epithelium cells in infection produced by several STEC isolates is thus far, a not completely elucidated phenomenon. The only factor established as important in this process is the intimin protein, found in O157 strains and other STEC serogroups. The identification of new adhesion factors in clinical STEC strains participating in this first stage of the infection, recognition and comprehension of the humoral immune response generated by them, should provide a better understanding of STEC pathogenesis in humans, primarily in Chile, and allow us to detect new therapeutic targets for the development of vaccines. STEC, AN EMERGING ZOONOTIC PATHOGEN, AND ITS ASSOCIATION WITH FOOD TRANSMITTED DISEASES (FTD) STEC has been isolated from the intestinal content of several animals, such as bovines, ovines, caprines, pigs, dogs, cats and chicken [7, 31, 32]; however, the main STEC reservoirs are bovines and swine. Isolation frequencies have been described in the order of 8 to 21% for bovines and up to 7.5% in swine [31, 33, 34, 35]. STEC-colonized animals are difficult to identify, and O157:H7 infections in weaned calves and adult bovines and ovine are usually asymptomatic [36, 37]. Furthermore, O157:H7 STEC transmission among animals is efficient and occurs at very low doses [38], and the number of animals eliminating the pathogen in their stools is usually higher during summer months [39], correlating with an incidence increase of the disease in humans [40]. Studies performed in Chile by Borie et al. [41] revealed a high percentage of bovines (34%) and swine (69%) which were asymptomatic STEC carriers in their depositions. It must be emphasized that bovine carriers of STEC showed the same virulence genes found in strains isolated from humans, similar to that described in other international studies [42, 43, 44]. The presence of STEC serotypes pathogenic for humans in bovine and swine, specially those isolates with higher frequency in Chile (O157, O26 y O111), allows the conclusion that both animal species are a public health risk in the country, a finding that has encouraged the Ministry of Health of Chile to incorporate STEC as an Surveillance Agent (serogroup O157 and others) since the year 2000 (Ordinance N 712). Other national researchers show a high prevalence of STEC in swine, with a close clonal relationship with strains isolated from humans. Paradoxically, there are few studies associating swine STEC with HUS or identifying swinederived foods as important sources of infection [42].

Vidal et al.

184 Pathogenic Escherichia coli in Latin America

It is important to mention that this is an endemic problem in Latin America, with Argentina, Uruguay and Chile the countries most affected. In Argentina, colonization rates of 44% in bovines and 52% in swine are observed, with 300 to 400 HUS cases appearing per year in children under 5 years of age, reaching rates of up to 23 for every 100,000 children in Buenos Aires [45, 46]. In Uruguay, 5 cases for every 100,000 children under 5 years of age are registered [45, 46]. In Brazil, infections are, in general, restricted to sporadic cases in small children, without reaching bloody diarrhea. The serotypes most frequently associated with these infections have been O26:H11, O111:NM and O111:H8, although sporadically O157:H7 has been isolated. Despite these findings, the occurrence of infections in humans is low if we consider the high STEC prevalence in animals and foods. The first time that a STEC O157:H7 was described as a human pathogen was during two hemorrhagic diarrhea outbreaks during 1982 in the USA, when it was linked to the consumption of hamburgers in fast food restaurants [47]. Since then, STEC strains have been considered an agent transmitted by food, with meat and its byproducts as the most important in its dissemination, and, in lesser proportion, foods such as ham, turkey, homemade cider, salami, pepperoni, raw milk, yogurt, contaminated water, and most recently vegetables, such as spinach [48, 35, 49, 50]. In Chile, the first documented STEC outbreak took place in children from a nursery school fed noodles with ground beef [51]. In an attempt to correlate this information, researchers sought to establish the importance of Chilean and imported meat foods sold in Santiago and other regions of the country, in the dissemination of the diarrheal disease associated with STEC strains. For this purpose, 213 meat samples (157 from Chile and 56 imported) were analyzed, and from them 4.2% (5 bovine meat samples, 2 Chilean hamburgers and 2 hamburgers from Paraguay) were positive for Shiga toxins. These results indicate that the circulation of products that become contaminated is a reality [52]. stx2

STX2 X07865 EDL933 HH8

83

STX2 Z37725 O48 STX2C DQ235774 O157C

stx2c

61100

STX2C AB015057 O157 F vtx2dA DQ235775 O8

93

stx2d

stx2dA AF500191 ONT H11 STX2D3 X61283 O157

84

STX2D DQ059012 O73 STX2C L11078 O111

stx2b

84

stxA2d AJ567997 ONT H8

99 100

stx2g 61 67

“new variant stx2h”

STX2C AF043627 O118

STX2G AB048227

51 64

FV9422/9423 FV9408 FV9429 FV9425 FV9413/9419

96 66

FV9417/9420 STX2E AJ567998 ONT

stx2e

97 53 66

FV9412/9415 FV9393/9394/9397/9400/9402/9405/9411/9427 Stx2e M36727 STXE X81417 O101

stx2f

STX2F M29153

0.05

Figure 3: Phylogenetic tree of stx2 gene sequences based on the alignment of 957 nucleotides covering the subunit A. Phyolgenetic distances were compared using Kimura 2-parameters, and the tree was obtained by the Neighbor-Joining method

Shiga Toxin Producing Escherichia coli in Chile

Pathogenic Escherichia coli in Latin America 185

using MEGA 2.1 software. Bootstrap values based on 1,000 generated trees are displayed at the nodes. Highlighted in the red rectangle is a group of swine STEC strains that harbor a new variant of the stx2 gene, named by us stx2h. Reference strains designated according to their GenBank accession number were: stx2 (Y10775; AJ011566; X83722; X84263); stx2 O48 (Z37725); stx2vh-a(AF479828); stx2vh-b (AF479829); stx2 OX3b (L11079); stx2d O111 (L11078); stx2d OX3a (X65949); stx2 NV206 (AF329817); stx2c (M59432); stx2d Ount (AF043627); stx2e (M21534), respectively).

Recent studies allowed the isolation of STEC strains from animal reservoirs (swine and bovine) at levels similar to those described internationally, i.e. 6% in swine and 13% for bovines, differing from 68% and 29%, as previously described by Borie et al. [41]. After characterization of the STEC strains isolated from the animal reservoirs by serology and the presence of virulence factors, 45 STEC strains were isolated from a total of 759 samples obtained from intestinal content of swine slaughtered in different regions of the country. When analyzed in relation to their toxigenic profile, 100% of them showed only the stx2 variant. The analysis of the stx2 gene sequences, in accordance with the scheme published by Persson et al. [53], allowed the description of a new stx2 variant which was named stx2h (Fig. 3) associated mainly with serogroup O159 STEC strains. All STEC strains isolated from swine were nonO157, with a predominance of O141:H19, O5:H-, O139:H-, ONT:H- and O159:H- serotypes. On the other hand, the study of 52 STEC strains isolated from 385 intestinal content samples of bovines slaughtered in different regions of the country, showed that these strains are completely different and correlation was only observed in the presence of O171 and O139, also characterized in strains isolated from swine. This can indicate that bacterial populations colonizing both animals are completely different or that they have not had the possibility of interchanges in crowded places. Serotypes frequently isolated from bovines were O20:H19, O113:H21, O130:H11, O171:H2. It is important to point out that in bovines, an O157:H7 STEC strain was isolated, the only serotype responsible for 100% of the HUS cases in Chile. Strains isolated from bovines are heterogeneous with respect to the distribution of virulence genes characterized, with stx2 the most common genotype (69%). But, different from observations in swine, bovine STEC strains also showed stx1 and stx1/stx2 genotypes. The eae gene was identified in 5 of the 52 strains (9.6%) and, different from swine isolated strains, in the bovine STEC strains, it was possible to detect virulence genes with a great diversity of patterns, including the presence of iha (90%), hlyA (67%) and saa (60%). Further, efa1, lpf and ent were previously described in STEC pathogenic strains isolated from humans, which might represent a risk for the health of the human populations (Tables 3 y 4) (manuscript in preparation). Table 3: Toxigenic profile of STEC strains isolated from swine and bovines at slaughter

STEC Strains isolates from animal reservoir Toxigenic profile and intimin

Swine

Bovine

stx1 stx2 stx1-stx2 Intimin (eae)

0% (0/45) 100% (45/45) 0% (0/45) 0% (0/45)

9,6% (5/52) 69,2%(36/52) 21,1%(11/52) 7,7% (4/52) *

* Each isolate harboured a different variant of intimin (β, γ, ε and ζ)

Table 4: Virulence genes detected by PCR in STEC strains isolates from swine and bovines at slaughter

STEC Strains isolates from animal reservoir Virulence genes

Swine

Bovine

ent efa1 hlyA lpf saa iha efa1 (O157)

0% (0/45) 0% (0/45) 0% (0/45) 0% (0/45) 0% (0/45) 0% (0/45) 0% (0/45)

3,8% (2/52) 3,8% (2/52) 67,3% (35/52) 1,9% (1/52) 59,6% (31/52) 96,1% (50/52) 1,9% (1/52)

186 Pathogenic Escherichia coli in Latin America

Vidal et al.

STRATEGIES FOR STEC CONTROL There is some agreement that the use of antimicrobial agents is not recommended in the initial diarrhea phase nor in HUS, because clear benefits have not been observed and there is some evidence indicating that antimicrobials could be a risk factor for HUS development [54, 55]. On the other hand, a factor involved in zoonotic bacterial resistance development is the use of antimicrobials as cattle growth promoters [56]. This practice inevitably produces a selection of resistant strains within the commensal bacteria of the intestinal tract of livestock animals [57], and it can have an unsuspected relevance in public health because of the possibility that this resistant microbiota might colonize the human population by means of the food chain or by occupational exposure [56]. A study done by Prado et al. [58] demonstrated the existence of STEC strains resistant to ampicillin (21%), co-trimoxazole (20%), chloramphenicol (4%) and tetracycline (3%). In this context, a series of strategies have been proposed to control and prevent STEC infections in humans, for example the neutralization of Shiga toxins in the intestine, either during the diarrhea phase or once HUS has been developed [59], as well as the use of molecular bait, with great affinity for the toxin, with a structure similar to the globotriaosylceramide (Gb3) receptor [60]. Studies should be done relative to the development of attenuated live Salmonella vaccines expressing STEC antigens assayed in animals and attenuated EHEC strains encoding intimin with a diminished adhesion capacity [61]. A different approach has been the development of humanized monoclonal antibodies against Stxs, which have successfully passed toxicity tests in rats [62, 63]. Nevertheless, it has been shown that once initiated, it is impossible to reverse HUS [60]. A different and interesting strategy has been the attempt to use probiotics to control STEC prevalence in the animal reservoir and, therefore, to diminish the incidence in humans, [64, 65]. Following this same line of thought, if we consider that STEC-associated HUS is a low frequency disease; massive vaccination of the human population might not be an economically sound strategy. However, immunization of the animal reservoir, to decrease STEC colonization, is an attractive idea that may help to reduce the possible entry of STEC in the food chain [59]. In this sense, some studies have suggested that intimin is a good antigenic candidate to be included in an anti-STEC vaccine, showing good results in assays performed in production animals [66]. However, it is important to consider that vaccines directed against intimin peptides are subtype specific, because this protein shows at least 10 different variants, making the design highly complex [67]. Several investigations have suggested that proteins of the Type Three Secretion System (TTSS) are an attractive target for the development of vaccines [68], as well as the Efa1 protein, recently described as another important adherence factor present in several EHEC serotypes [69, 70, 71, 72], and SepD, described as a protein involved in translocation of effectors within the target cell [73, 74]. Preliminary assays have allowed evaluation of the protecting immune response generated by immunization with DNA vaccines in a murine model, using as targets, genes codifying proteins identified in highly conserved reading frames of the LEE island in both O157 and No-O157 strains. Three constructs cloned into the pVAX1 plasmid [Invitrogen, Inc] allowing expression in eukaryotic cells of the efa1A, escR and sepD genes, encoding proteins in the STEC LEE Locus, were intranasally administered with the AbISCO cationic liposome in C57BL/6 mice in order to generate humoral and cellular immune responses. It is known that nucleic acid vaccines, administered jointly with cationic lipids by the intranasal route, are efficient in inducing protective secretory type immunity [75, 76]. Animals inoculated with the efa1A and escR genes showed a strong lymphocyte proliferation against the bacterial antigens, diminishing intestinal colonization by the pathogen in all animals immunized with the recombinant plasmid after challenge with EHEC EDL933 strain. Animals receiving the pVAX-efa1A vector showed significant protecting activity (Fig. 4). These results lead to the suggestions that genes encoded in the LEE island for the formulation of DNA vaccines are potential vaccine candidates that could induce immunity in the animal model (manuscript in preparation). If we consider that clinical and subclinical STEC infections in ruminants are restricted to the intestinal epithelium and lumen, it is necessary that a vaccine can induce high titers of secretory IgA in the superficial mucosa and/or IgG in the colostrum in order to generate an efficient protecting response.

Shiga Toxin Producing Escherichia coli in Chile

Pathogenic Escherichia coli in Latin America 187

Figure 4: Lymphocyte proliferation assay. The T-cell proliferative response was measured 2 weeks after the last inoculation. Splenocytes were cultured in c-RPMI for 3 days and pulsed for 8 h with 0.25μCi of thymidine per well. Splenocytes (4x105 cells per well) from five mice of each group were pooled and stimulated in vitro with Heat-Killing E. coli EDL933 (2μg/ml) and crude protein (10μg/ml). Each bar indicates the average number of counts per minute for triplicate cultures of cells; the error bars indicate standard deviations. Groups with one asterisk (*) are significantly different from the corresponding PBS inoculated groups (P<0.05). Groups with two asterisks (**) are significantly different from the corresponding PBS- and pVAX- inoculated groups (P<0.05). Groups with three asterisks (***) are significantly different from the corresponding PBS- and pVAX-inoculated groups (P<0.01).

In the past, several authors have studied the antigenicity of various STEC proteins (intimin, EspA, EspB, Stxs, Efa1, etc.), but following mainly systemic administration [68, 77]. Nevertheless, a prerequisite to optimize the design of vaccines is the establishment of a strong mucosal immune response [61, 78]. The stimulation of an efficient local response against STEC can block the infection and the colonization process at an early stage, reducing the risk of transmission to other susceptible hosts. PERSPECTIVES RELATED TO STEC Despite the low incidence of STEC infections in humans, the severity of the symptoms and the frequency of renal and neurological sequels are cause of permanent concern for the Chilean Ministry of Health. In this context, adding STEC (O157 and other serogroups) as bacterial agents under surveillance to the Obligatory Notification Diseases Regulations list since April 2000 has been a strong public health measure. It has established the obligation to notify the organization about all outbreaks of food-transmitted diseases associated with this pathogen [79], thus reflecting the national concern about STEC-caused infections. The epidemiological measures have been promulgated and the search for successful therapeutical measures is now the responsibility of scientists. REFERENCES [1] [2] [3] [4] [5] [6] [7]

Parashar UD, Hummelman EG, Bresee JS, et al. Global illness and deaths caused by rotavirus disease in children. Emerg Infect Dis. 2003;9:565-572. Kosek M, Bern C, Guerrant RL. The global burden of diarrhoeal disease, as estimated from studies published between 1992 and 2000. Bull World Health Organ. 2003;81:197-204. O'Ryan M, Pérez-Schael I, Mamani N, et al. Rotavirus-associated medical visits and hospitalizations in South America: A prospective study at three large sentinel hospitals. Pediatr Infect Dis J. 2001;20:685-693. O'Ryan M, Prado V, Pickering LK. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis. 2005;16:125-136. Vizcaya MC, Sandoval C, Salin MP, et al. Impacto del síndrome hemolítico urémico en las distintas áreas de salud de la región metropolitana. Rev Chil Infect. 1996;13:223-230. Hering E, Marambio E, Prado V. Análisis de un Brote de diarrea por E. coli O142 en Recién Nacidos. Rev Chil Pediatr. 1984;55:175-184. Griffin PM, Tauxe RV. The epidemiology of infections caused by Escherichia coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 1991;13:60-98.

188 Pathogenic Escherichia coli in Latin America

[8]

Vidal et al.

López EL, Devoto S, Fayad A, et al. Association between severity of gastrointestinal prodrome and long term prognosis in classic hemolytic uremic syndrome. J Pediatr. 1992;120:210-215. [9] Pickering L, Obrig T, Stapleton B. Hemolyticuremic syndrome and Enterohemorrhagic Escherichia coli. J Pediat Infect Dis. 1994;13:459-476. [10] Siegler RL. The hemolytic uremic syndrome. Ped Nephrol. 1995;42:1505-1529. [11] Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. [12] López E, Prado V, O’Ryan M, et al. Shigella and Shiga toxin producing Escherichia coli causing bloody diarrhea in Latin America. Inf Dis Clin of North Am. 2000;14:41-65. [13] Prado V, Martínez J, Arellano C, et al. Variación temporal de genotipos y serogrupos de E. coli enterohemorrágicas aislados en niños chilenos con infecciones intestinales o sindrome hemolítico–urémico. Rev Med Chile. 1997;125:291297. [14] Nataro, JP. Diarrheagenic Escherichia coli. In M. Sussman editor. Molecular medical microbiology, San Diego, California: Academic Press; 2002;1463-1504. [15] Vidal M, Carreño M, Vidal R, et al. Evaluación de técnicas moleculares e inmunoenzimáticas para la detección de E. coli enterohemorrágico en brotes de toxi-infecciones alimentarias. Rev. Med. Chile. 2002;130:603-609. [16] Vidal R, Vidal M, Lagos R, et al. Multiplex PCR for diagnosis of enteric infections associated to diarrheagenic Escherichia coli. J. Clin. Microbiol. 2004;42:1787-1789. [17] Vidal R, Solari V, Mamani N, et al. Human Caliciviruses are a major cause of foodborne gastroenteritis outbreaks in Santiago, Chile. Emerg Infect Dis. 2005;11:1134-1137. [18] Vidal M, Prado V, Whitlock G, et al. Subtractive hybridization and identification of putative adhesins in a Shiga toxinproducing eae-negative Escherichia coli. Microbiology. 2008;154:3639-3648. [19] Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol Microbiol 2000;35:275-288. [20] Jores J, Rumer L, Wieler LH. Impact of the locus of enterocyte effacement pathogenicity island on the evolution of pathogenic Escherichia coli. Int J Med Microbiol. 2004;294:103-113. [21] Jores J, Wagner S, Rumer L, et al. Description of a 111-kb pathogenicity island (PAI) encoding various virulence features in the enterohemorrhagic E. coli (EHEC) strain RW1374 (O103:H2) and detection of a similar PAI in other EHEC strains of serotype 0103:H2. Int J Med Microbiol. 2005;294:417-425. [22] Bauer ME, Welch RA. Association of RTX toxins with erythrocytes. Infect Immun. 1996;64:4665-4672. [23] Paton AW, Srimanote P, Woodrow MC, et al. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69:6999-7009. [24] Torres AG, Giron JA, Perna NT, et al. Identification and characterization of lpfABCC'DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect Immun. 2002;70:5416-5427. [25] Tarr PI, Bilge SS, Vary JC Jr, et al. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect Immun. 2000;68:1400-1407. [26] Vidal M, Escobar P, Prado V, et al. Distribution of putative adhesins in Shiga toxin-producing Escherichia coli (STEC) strains isolated from different sources in Chile. Epidemiol Infect. 2007;135:688-694. [27] Torres AG, Blanco M, Valenzuela P, et al. Genes related to long polar fimbriae of pathogenic Escherichia coli strains as reliable markers to identify virulent isolates. J Clin Microbiol. 2009;47:2442-2451. [28] Rendon MA, Saldana Z, Erdem AL, et al. Commensal and pathogenic Escherichia coli use a common pilus adherence factor for epithelial cell colonization. Proc Natl Acad Sci USA. 2007;104:10637-10642. [29] Xicohtencatl-Cortes J, Monteiro-Neto V, Saldana Z, et al. The type 4 pili of enterohemorrhagic Escherichia coli O157:H7 are multipurpose structures with pathogenic attributes. J Bacteriol. 2009;191:411-421. [30] Samadder P, Xicohtencatl-Cortes J, Saldana Z, et al. Escherichia coli ycbQRST operon encodes fimbriae with lamininbinding and epithelial cell adherence properties in Shiga-toxigenic E. coli O157:H7. Environ Microbiol. 2009;11:18151826. [31] Beutin L, Geier D, Steinruck H, et al. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol. 1993;31:2483-2488. [32] Chapman PA, Siddons CA, Wright DJ, et al. Cattle as a possible source of verocytotoxin-producing Escherichia coli O157 infections in man. Epidemiol Infect. 1993;111:439-447. [33] Montenegro MA, Bulte M, Trumpf T, et al. Detection and characterization of fecal verotoxin-producing Escherichia coli from healthy cattle. J Clin Microbiol. 1990;28:1417-1421. [34] Wells JG, Shipman LD, Greene KD, et al. Isolation of Escherichia coli serotype O157:H7 and other Shiga-like-toxinproducing E. coli from dairy cattle. J Clin Microbiol. 1991;29:985-989.

Shiga Toxin Producing Escherichia coli in Chile

[35] [36] [37] [38] [39] [40] [41] [42]

[43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62]

Pathogenic Escherichia coli in Latin America 189

Caprioli A, Morabito S, Brugere H, et al. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289-311. Cornick NA, Booher SL, Casey TA, et al. Persistent colonization of sheep by Escherichia coli O157:H7 and other E. coli pathotypes. Appl Environ Microbiol. 2000;66:4926-4934. Wray C, McLaren IM, Randall LP, et al. Natural and experimental infection of normal cattle with Escherichia coli O157. Vet Rec. 2000;147:65-68. Besser TE, Richards BL, Rice DH, et al. Escherichia coli O157:H7 infection of calves: infectious dose and direct contact transmission. Epidemiol Infect. 2001;127:555-560. Van Donkersgoed J, Graham T, Gannon V. The prevalence of verotoxins, Escherichia coli O157:H7, and Salmonella in the feces and rumen of cattle at processing. Can Vet J. 1999;40:332-338. Prado V, Braun S, Bosch P, et al. Analysis of classical enteropathogenic Escherichia coli as an endemic cause of acute diarrhea in Chilean children. Rev Chil Pediatr.1984;55:171-175. Borie C, Sánchez ML, Monreal Z, et al. Prevalencia y caracterización de E. coli enterohemorrágica en bovinos y cerdos sanos faenados en Santiago, Chile. Arch Med Vet. 1997;29:205-212. Rios M, Prado V, Trucksis M, et al. Clonal diversity of Chilean isolates of enterohemorrhagic Escherichia coli from patients with hemolytic-uremic syndrome, asymptomatic subjects, animal reservoirs, and food products. J Clin Microbiol. 1999;37:778-781. Kobayashi H, Shimada J, Nakazawa M, et al. Prevalence and characteristics of shiga toxin-producing Escherichia coli from healthy cattle in Japan. Appl Environ Microbiol. 2001;67:484-489. Jenkins C, Chart H, Cheasty T, et al. Verocytotoxin-producing Escherichia coli (VTEC) other than serogroup O157 from Scottish cattle. Vet Rec. 2002;151:58-60. López EL, Prado-Jimenez V, O'Ryan-Gallardo M, et al. Shigella and Shiga toxin-producing Escherichia coli causing bloody diarrhea in Latin America. Infect Dis Clin North Am. 2000;14:41-65. Padola NL, Sanz ME, Blanco JE, et al. Serotypes and virulence genes of bovine Shigatoxigenic Escherichia coli (STEC) isolated from a feedlot in Argentina. Vet Microbiol. 2004;100:3-9. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308:681-685. Dorn CR, Angrick EJ. Serotype O157:H7 Escherichia coli from bovine and meat sources. J Clin Microbiol. 1991;29(6):1225-1231. Gyles CL. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci. 2007;85:E45-62. Grant J, Wendelboe AM, Wendel A, et al. Spinach-associated Escherichia coli O157:H7 outbreak, Utah and New Mexico, 2006. Emerg Infect Dis. 2008;14:1633-1636. Prado V, Solari V, Alvarez IM, et al. Epidemiological situation of foodborne diseases in Santiago, Chile in 1999-2000. Rev Med Chile. 2002;130:495-501. Alexandre M, Piñones CG, Martínez C, et al. Detección de citotoxinas de Escherichia coli enterohemorrágica en productos cárnicos chilenos e importados. Rev Chil Infectol. 1999; 16:277-282. Persson S, Olsen KE, Ethelberg S, et al. Subtyping method for Escherichia coli shiga toxin (verocytotoxin) 2 variants and correlations to clinical manifestations. J Clin Microbiol. 2007;45:2020-2024. Wong CS, Jelacic S, Habeeb RL, et al. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N Engl J Med. 2000;342:1930-1936. Safdar N, Said A, Gangnon RE, et al. Risk of hemolytic uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 enteritis: a meta-analysis. Jama. 2002;288:996-1001. Schroeder CM, Zhao C, DebRoy C, et al. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. Appl Environ Microbiol. 2002;68:576-581. van den Bogaard AE, Stobberingh EE. Antibiotic usage in animals: impact on bacterial resistance and public health. Drugs. 1999;58:589-607. Prado V, Basualdo W, Arellano C, et al. In vitro susceptibility of enterohemorrhagic Escherichia coli to 11 antimicrobials. Relationship between antibiotic resistance and toxigenic genotype. Rev Med Chil. 1995;123:1085-1090. Thorpe CM. Shiga toxin-producing Escherichia coli infection. Clin Infect Dis. 2004;38:1298-1303. Trachtman H, Cnaan A, Christen E, et al. Effect of an oral Shiga toxin-binding agent on diarrhea-associated hemolytic uremic syndrome in children: a randomized controlled trial. Jama. 2003;290:1337-1344. Agin TS, Zhu C, Johnson LA, et al. Protection against hemorrhagic colitis in an animal model by oral immunization with isogeneic rabbit enteropathogenic Escherichia coli attenuated by truncating intimin. Infect Immun. 2005;73:6608-6619. Mukherjee J, Chios K, Fishwild D, et al. Production and characterization of protective human antibodies against Shiga toxin 1. Infect Immun. 2002;70:5896-5899.

190 Pathogenic Escherichia coli in Latin America

[63] [64] [65]

[66] [67] [68] [69] [70] [71] [72] [73]

[74] [75] [76]

[77]

[78] [79]

Vidal et al.

Mukherjee J, Chios K, Fishwild D, et al. Human Stx2-specific monoclonal antibodies prevent systemic complications of Escherichia coli O157:H7 infection. Infect Immun. 2002;70:612-619. Asahara T, Shimizu K, Nomoto K, et al. Probiotic bifidobacteria protect mice from lethal infection with Shiga toxinproducing Escherichia coli O157:H7. Infect Immun. 2004;72:2240-2247. Sherman PM, Johnson-Henry KC, Yeung HP, et al. Probiotics reduce enterohemorrhagic Escherichia coli O157:H7- and enteropathogenic E. coli O127:H6-induced changes in polarized T84 epithelial cell monolayers by reducing bacterial adhesion and cytoskeletal rearrangements. Infect Immun. 2005;73:5183-5188. Dean-Nystrom EA, Gansheroff LJ, Mills M, et al. Vaccination of pregnant dams with intimin(O157) protects suckling piglets from Escherichia coli O157:H7 infection. Infect Immun. 2002;70:2414-2418. Stevens MP, van Diemen PM, Dziva F, et al. Options for the control of enterohaemorrhagic Escherichia coli in ruminants. Microbiology. 2002;148:3767-3778. Potter AA, Klashinsky S, Li Y, et al. Decreased shedding of Escherichia coli O157:H7 by cattle following vaccination with type III secreted proteins. Vaccine. 2004;22:362-369. Janka A, Bielaszewska M, Dobrindt U, et al. Identification and distribution of the enterohemorrhagic Escherichia coli factor for adherence (efa1) gene in sorbitol-fermenting Escherichia coli O157: H. Int J Med Microbiol. 2002;292:207-214. Badea L, Doughty S, Nicholls L, et al. Contribution of Efa1/LifA to the adherence of enteropathogenic Escherichia coli to epithelial cells. Microb Pathog. 2003;34:205-215. Tatarczak M, Wieczorek K, Posse B, et al. Identification of putative adhesin genes in shigatoxigenic Escherichia coli isolated from different sources. Vet Microbiol. 2005;110:77-85. Bielaszewska M, Sonntag AK, Schmidt MA, et al. Presence of virulence and fitness gene modules of enterohemorrhagic Escherichia coli in atypical enteropathogenic Escherichia coli O26. Microbes Infect. 2007;9:891-897. Jarvis KG, Giron JA, Jerse AE, et al. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci USA. 1995;92:7996-8000. O'Connell CB, Creasey EA, Knutton S, et al. SepL, a protein required for enteropathogenic Escherichia coli type III translocation, interacts with secretion component SepD. Mol Microbiol. 2004;52:1613-1625. Felgner JH, Kumar R, Sridhar CN, et al. Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem. 1994;269:2550-2561. Okada E, Sasaki S, Ishii N, et al. Intranasal immunization of a DNA vaccine with IL-12- and granulocyte-macrophage colony-stimulating factor (GM-CSF)-expressing plasmids in liposomes induces strong mucosal and cell-mediated immune responses against HIV-1 antigens. J Immunol. 1997;159:3638-3647. van Diemen PM, Dziva F, Abu-Median A, et al. Subunit vaccines based on intimin and Efa-1 polypeptides induce humoral immunity in cattle but do not protect against intestinal colonisation by enterohaemorrhagic Escherichia coli O157:H7 or O26:H. Vet Immunol Immunopathol. 2007;116:47-58. Cataldi A, Yevsa T, Vilte DA, et al. Efficient immune responses against Intimin and EspB of enterohaemorragic Escherichia coli after intranasal vaccination using the TLR2/6 agonist MALP-2 as adjuvant. Vaccine. 2008;26:5662-5667. Sotomayor V, Olivares B, Prat MS. Síndrome Hemolítico Urémico y Escherichia coli, como agente emergente. El Vigia. Boletín de Vigilancia en Salud Pública de Chile. 2000;3:7-10.

Pathogenic Escherichia coli in Latin America, 2010, 191-208

191

CHAPTER 13 Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico, Past and Present Armando Navarro1 and Teresa Estrada-Garcia2* 1

Departamento de Salud Pública. Facultad de Medicina, Universidad Nacional Autónoma de Mexico. Mexico City, Mexico, 2Department of Molecular Biomedicine, CINVESTAV-IPN, Mexico City, Mexico Abstract: In Mexico, diarrhea diseases are the second leading cause of death in children ≤ 5 years old. Studies regarding enteropathogens associated with severe acute diarrhea, requiring hospitalization, have revealed diarrheagenic Escherichia coli pathotypes (DEC) as the second most prevalent group, only after rotavirus, in children of this age. DEC epidemiology has changed throughout the years, until the mid ‘90s enterotoxigenic E. coli and typical enteropathogenic E. coli (tEPEC) strains were more often isolated from children aged ≤ 5 years, nowadays is enteroaggregative E. coli (EAEC) followed by atypical EPEC. Other DEC identified these days include, ETEC, non-O157:H7 Shiga-toxin producing E. coli (STEC), tEPEC and enteroinvasive E. coli (EIEC). DEC strains have been isolated from local food samples in enough quantities to cause disease. Non-O157:H7 STEC strains have been identified from stool samples from asymptomatic subjects, diarrhea cases and a variety of food items, but O157:H7 serotype prevalence is extremely low. Mexican children and adult serum have shown, cross reactivity against O157:H7, other E. coli serogroups (O7, O116), enteric bacteria and O157:H7 bactericidal activity. Most DECs strains isolated from diarrhea patients and food samples were resistant to TMP-SMX and ampicillin; almost all strains were ciprofloxacin and cefotaxime sensitive. A new E. coli serogroup (64474) sharing only a common O antigen with S. boydii 16, has been identified. Further, substantial reductions in diarrhea related deaths, complications and morbidity due to acute diarrhea episodes, will require sanitation improvement, identification of enteropathogens and development of both new drugs to treat pediatric diarrhea and vaccines against DEC.

INTRODUCTION, DIARRHEA DISEASES Diarrhea remains the second leading infectious cause of childhood death worldwide, accounting for approximately 1.8 million annual deaths in children less than 5 years of age [1]. Among these children rotavirus is the single most important cause of severe childhood diarrhea globally and annually causes more than half a million deaths [2], followed by bacterial infections, Vibrio cholerae, Shigella spp., Salmonella spp., enterotoxigenic (ETEC), enteropathogenic (EPEC) and enteroaggregative E. coli (EAEC) [3, 4]. In Mexico, diarrheal diseases continue to be a public health problem; it is also the second leading cause of childhood death and morbidity in children under 5 years of age. Substantial reductions in diarrhea related deaths and complications occurred from 1990 to 2002 as a result of improved sanitation and safe water, the promotion of breast-feeding and oral rehydration, and supplementation with a mega dose of vitamin A [5, 6]. Mortality rates have been further diminished considerable, since the introduction of a monovalent rotavirus vaccine in the national immunization program by December 2007 [7]. Revealing the great success of the first massive vaccination campaign against an enteropathogen, thus development of vaccines against other enteropathogens associated with severe diarrhea and death may have the same effect. Nevertheless, diarrhea morbidity rates in children less than 5 years of age have not changed in the last few years in Mexico. A slightly decrease was observed for 2009 with 15,835 cases per 100,000 children ≤ 5 years old, compared with 2008 (17,378 per 100,000 children), but it seems not significant, because the number of children in this age group has also decreased in the same proportion from 2008 to 2009 (morbidity rates were obtained base on data from http://www.dgepi.salud.gpb.mx/sinave/index.htm). Therefore, in Mexico, reduction of both, mortality rates due to diarrhea diseases and diarrhea morbidity in children; remains a challenge. *Address correspondence to: Teresa Estrada-Garcia. Department of Molecular Biomedicine, CINVESTAV-IPN, Av. IPN No. 2508, Col. Zacatenco, CP07360, Mexico City, Mexico. Phone: (5255) 5747 3327. Fax: (5255) 5747 3938. E-mail:testrada@cinvestav,mx Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

192 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

DIARRHEAGENIC E. coli PATHOTYPES Diarrheagenic E. coli pathotypes (DEC) affecting humans include several emerging pathogens. Nowadays, DEC are identified and classified on basis of their virulence traits and several comprehensive reviews have been written [8, 9, 10, 11, 12]. DEC encompasses typical (tEPEC) and atypical (aEPEC) enteropathogenic E. coli, enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), Shiga-toxin–producing E. coli (STEC), also called verocytotoxinproducing, enteroaggregative E. coli (EAEC), and diffusely adherent E. coli (DAEC). Functional definitions of each DEC have been enlisted and general defining characteristics and target loci for its identification are given in Table 1. Table 1: Phenotypic and genotypic characteristics of DECs DEC

Defining characteristic(s)

ETEC

Presence of heat stable or/and heat labile toxins

tEPEC

Presence of both intimin (as a marker of the LEE) and the BFP contained in the EAF plasmid

EIEC

Presence of the invasion-associated locus of the invasion plasmid

STEC

Serotypes (O:H antigens)

Target(s) loci lt, st

O6:H16, O8:H9, O11:H27, O15:H11, O20:NM, O25:H42 or NM, O27:H7, O78:H11,H12; O128:H7, O148: H28, O149:H10, O173:NM

eaeA, bfpA

O55:H6, O86:H34, O111:H2, O114:H2, O119:H6, O127:H6, O142:H6, O142:H34

ial

O28ac:NM, O29:NM, O112ac:NM, O124:H30 or NM, O136:NM, O143:HNM, O144:HNM, O152:H2 or NM, O164:NM, O167:H4 or H5, or NM

Presence of Shiga toxin 1 and/or Shiga toxin 2; in addition, some strains also have intimin (as marker of LEE)

stx1, stx2, eaeA

O26:H11 or O26:HNM, O91:H21 or O91:HNM, O103:H2, O111:HNM, O113:H21, O117:H7, O118:H16, O121: H19, O128:H2 or O128:HNM, O145:H28 or O145:HNM, O146:H21

aEPEC

Presence of intimin (as a marker of LEE); absence of the EAF plasmid and Shiga toxins 1 and 2

eaeA

O26:H11, O55:H7, O55:H34, O86:H8, O111ac:H8, O111:H9, O111:H25, O119:H2, O125ac:H6; O128:H2

EAEC

Presence of the transcriptional activator AggR (as marker of regulon

aggR

O3:H2, O15:H18, O44:H18, O86:NM, O77:H18, O111:H21, O127:H2, O?:H10

DAEC

Presence of Afa/Dr adhesins

daaC,D

O126:H27

LEE: locus of enterocyte effacement; BFP: bundle-forming pilus; EAF: EPEC adherent factor; st: heat stable toxin; lt: heat labile toxin; eaeA: E. coli attaching an effacing, gene encoding intimin; bfpA: bundle-forming pilus; ial: invasiveness associated locus; stx1: Shiga toxin 1; stx2: Shiga toxin 2; AggR: transcriptional activator; daa: diffuse adherence adhesion. NM: Non-Motile.

DIARRHEAGENIC E. coli PATHOTYPES IN MEXICO History Mexico has had a large tradition of excellence in clinical microbiological studies, thus the study of E. coli pathotypes has not been the exception. Back in the 40’s, the identification and characterization of diarrheagenic E. coli pathotypes began by several British groups [13, 14, 15] and also in Mexico. In 1946, Varela, isolated diverse E. coli strains from children who had died in an outbreak of diarrhea at the Hospital Infantil de Mexico “Federico Gomez” in Mexico City [16]. One of these strains isolated from a fatal case of diarrhea, a two year old girl, agglutinated with a serum against Salmonella adelaide (O35), that was designated as Escherichia coli-Gomez (in honor to Dr. Federico Gomez, founder of this Hospital). Some years later, Olarte established that these E. coli isolates belonged to O111:B4 serogroup of Kauffmann serologic Scheme, and also that serum from patients reacted with the isolates, supporting the idea that E. coli O111:B4 strains have been responsible for the diarrhea outbreak [17]. These and other studies worldwide revealed that diarrhea outbreaks were caused by a small number of E. coli serogroups [18, 19, 20] that were named enteropathogenic E. coli (EPEC). In 1961, a diarrhea outbreak was reported at the newborn premature nursery of the Hospital Infantil of Mexico [21]. The E. coli strains isolated from feces of infants and nursery room staff belonged to E. coli O7 serogroup and patient’s sera samples had higher titers against E. coli O7 antigen. Another diarrhea outbreak of premature infants occurred at the same hospital in 1963, which was caused by EPEC serotypes O86:B9 and O111:B4 [22].

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 193

In 1962, Kunin [23] proposed that the expression of what was known as the enterobacterial common antigen (ECA) differed depending of the period (diarrhea or convalescent) from which the bacteria were isolated. Carrillo [24] reported that ECA titers decreased during the diarrhea episode and significantly increased during convalescent stage. This became evident after analyzing ECAs expression on E. coli isolates from 10 premature infants, of Hospital Infantil de Mexico nursery, before, during, and after the diarrhea episode. In eight of ten children, the same E. coli serogroup was isolated during and after diarrhea episodes. Similar results were observed when isolates from 16 more patients and 31 nursery control children without diarrhea were analyzed for ECA expression. Strains obtained from convalescent and control children had significantly higher ECA titers that strains isolated from diarrhea episodes and also E. coli isolates obtained during and after diarrhea episodes belonged to the same serogroup. In line with these results, E. coli strains isolated during and after diarrhea episodes from 34 Mexican newborns in a longitudinal study followed until they were infants, had significantly ECA lower titers if obtained during diarrhea episodes than those strains from convalescent or healthy newborns and infants [25]. Overall these results suggested that host-parasite relationship had an important role, given that the same E. coli serotype could be found sometimes as a component of normal microbiota or as a pathogen [26]. In 1971 DuPont [27], described for the first time that ETEC and EIEC were able to cause diarrhea in adult volunteers and very early the association of ETEC strains with diarrhea disease in Mexican children was established [28, 29]. In a study conducted during July to October 1974 at the Hospital Infantil de Mexico, ETEC strains were isolated from eight (16%) of 50 children admitted with diarrhea and from one of 50 children hospitalized for nonenteric disorders, and all ETEC strains elaborated a heat-labile (LT) enterotoxin [28]. A second study of enteropathogens prevalence was conducted in the same hospital during the summer of 1975; among the 62 cases of diarrhea in 47 (76%) enteropathogens were identified, rotavirus particles were detected in 16 (26%) cases and ETEC was isolated in 29 (47%); 11 were positive for LT enterotoxin and 18 were positive for heat-stable (ST) [29]. The ability of E. coli strains to adhere intimately to eukaryotic cells in vitro, was tested using E coli strains collection [30], and revealed that 80% of the strains formed microcolonies on HEp-2 cells cultures and this particularly binding pattern was not shared with other groups of E. coli, with or without the ability of causing diarrhea. Subsequent studies, have shown that there are at least three binding patterns to HEp-2 cells, localized adherence (LA), which is characterized by the formation of bacterial microcolonies on the cell surface, diffuse adherence (DA) in which bacteria cover the cell uniformly, and bacteria aggregates as “stacked-brick” are observed on both the cell surface and the glass which has been named aggregative type (AA) or "stacked-brick" [31]. Based on these observations several studies using HEp-2 binding assay help to identify EPEC and EAEC strains in children with diarrhea in Mexico during the 80s and 90s [32, 33, 34, 35]. Serotyping As described before, since 1952 [17], E. coli isolates from diarrhea cases were typified in Mexico. Larger studies were reported later: 373 (59%) out of 636 fecal samples, obtained during the first 2 years of life of 72 Mexican children, yielded adherent E. coli on the HEp-2 assay. Strains with LA phenotype (EPEC) were significantly associated with acute non-bloody diarrhea, whereas strains with aggregative adherence were significantly associated with persistent diarrhea [34]. All LA strains were positive for the fluorescent actin-staining (FAS) assay, irrespective of serotype, and EPEC serotypes identified were O55:H6, O111:H2, O111:H12, O114:H2, O119:H6, O126:H2 and O142:H6. Furthermore, from 1992 to 2005, systematic serotyping analysis of E. coli strains isolated from human, animal and environmental samples has been carried out at the Public Health Laboratory, Faculty of Medicine, National University of Mexico (UNAM). During this period, a total of 10,073 E. coli strains have been serologically characterized by the method previously described by Ørskov [36] using rabbit serum (SERUNAM) against 181 somatic (O) and 53 flagellar (H) E. coli antigens. Among the 10,073 E. coli strains, 1352 different serotypes were identified of which 371 (27%) belonged to serogroups and 91 (7%) to serotypes of previously described E. coli pathotypes, and the remaining 890 (66%) to normal microbiota serotypes. A total of 2071 (21%) E. coli strains belonged to 91 serotypes previously characterized as E. coli pathotypes, of these strains, 69 (3%) were environmental isolates, 147 (7%) from animals, and 1855 (90%) from humans (most of them were isolates from children under five years of age with diarrhea). Serotyping analysis of E. coli pathotypes revealed that: 433 (23%)

194 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

strains belong to EPEC serotypes, 455 (25%) to ETEC, 324 (18%) to EAEC, 149 (8%) to STEC, 114 (6%) to EIEC, 169 (9%) to uropathogenic E. coli (UPEC) serotypes and 211 (11%) to other extraintestinal E. coli serotypes. In conclusion the most prevalent serotypes of diarrheagenic pathotypes were ETEC (25%) and EPEC (23%), although of the latter it was not specified if they were tEPEC or aEPEC serotypes. Identification of New E. coli Serotypes E. coli strains of a new serotype O88:H25 have been identified in Mexico. Strains belonging to this serotype were isolated from feces of children under five years of age, with acute diarrhea and bloody diarrhea, [33] as well as from Pozol, a fermented corn drink, [37]. These isolates were characterized as tEPEC, given that all displayed a localized adherence pattern when tested by the HEp-2 binding assay, and also harbor the eae gene. In accordance, E. coli O88:H25 strains isolated in Brazil produced A/E lesion and carried the EAF plasmid, and also displayed intracellular penetration [38]. Also, in Mexico ETEC strains belonging to O153:H45 serotype have been isolated from children up to two years of age, with diarrhea, and strains from this serotype are considered a specific geographic clone, from areas such as Brazil, Argentina and Spain; since rarely they have been identified elsewhere worldwide [39]. Identification of a New E. coli Serogroup Genetically and Antigenically Related to Shigella During the systematic serotyping of E. coli strains isolated from several epidemiological studies, at the Public Health Laboratory, UNAM, it was observed that 23 E. coli isolates from children with diarrhea, from three different geographical areas (Mexico, Egypt and Bangladesh), when tested with both 186 O E. coli and 45 O Shigella antigen anti sera, they only agglutinated with the O179 E. coli and S. boydii 16 sera [40]. The 23 strains had the characteristic biochemical profile of E. coli but not of Shigella. These strains were then characterized by polyclonal rabbit anti-sera against E. coli O179, S. boydii 16 and one of the new isolates (E. coli 64474). Assays, using unabsorbed anti-S. boydii 16 serum resulted in high agglutination titres (1:6400) against the homologous antigen compared to E. coli O179 (1:800) and E. coli 64474 (1:3200) titres. However, S. boydii 16 serum absorbed with E. coli O179 antigen abolished the reactivity against O179 antigen, but it was preserved for S. boydii 16 and E. coli 64474 antigens. Analysis of unabsorbed E. coli O179 serum showed agglutination titres of 1:3200 with the homologous antigen, and of 1:1600 both with S. boydii 16 and E. coli 64474 antigens. Furthermore, assays with antiE. coli O179 serum absorbed with S. boydii 16 or E. coli 64474 antigens revealed that titres diminished only in half (1:1600) with the homologous antigen (O179) and agglutination was not observed with the two heterologous antigens. In contrast, when unabsorbed E. coli 64474 serum was tested, the highest agglutination titres were observed against S. boydii 16 (1:3200) compared with those titres for the homologous, (1:1600) and E. coli O179, (1:800) antigens. On the other hand absorbed E. coli 64474 serum with E. coli O179 antigen, abolished the response against the O179 antigen and agglutination titters against E. coli 64474 and S. boydii 16 decreased. Overall, these results suggested that E. coli 64474 surface antigens are very similar to those expressed by S. boydii 16. The 23 E. coli strains were further characterized for the presence of wzx (flippase) and wzy (polymerase), both loci related to Shigella O antigen biosynthesis, by PCR, and 21 (91%) and 22 (96%) of the strains harbored these loci, respectively. RFLP analysis of these E. coli and S. boydii strains for the rfb gene revealed that they were identical between them and with S. boydi; supporting the idea that they are clonal. Shigella and E. coli virulence loci analyzed by PCR identified enterotoxigenic E. coli genes ltA1 in 12 of the 23 strains (52%), st1a in 4 (17%), cfa1 in 6 (26%), cs1 in 1 (4%), cs3 in 3 (13%), cs13 in 9 (39%), and cs14 in 5 (22%). From the epidemiological point of view, these E. coli strains were isolated from cases of diarrhea and from a variety of geographical locations, revealing the importance of systematic serotyping studies. Overall, these results suggest that 64474 is a new E. coli serogroup, with a defined virulence capacity, which share a common O antigen with S. boydii 16. EPIDEMIOLOGY OF DEC Overview EPEC, as described before, was the first diarrheagenic E. coli pathotype to be recognized. Cravioto in 1979 [30] described that typical EPEC strains adhered to HEp-2 cells in localize adherent (LA) phenotype, forming microcolonies on the cell surface, of which the type IV BFP, encoded in the EAF plasmid, is responsible for microcolony formation, promoting bacterium-bacterium interactions [41], characteristic of typical EPEC strains. EPEC then, adheres intimately to epithelial cells and induce host cell transmembrane signaling resulting in the

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 195

attaching and effacing lesion (A/E). AEPEC strains produce the A/E lesion, but do not possess the EAF plasmid and are Stx-negative, these days have increasingly been associated with diarrhea cases and outbreaks worldwide [12, 42, 43]. DuPont [27] demonstrated that both ETEC and EIEC strains were able to cause diarrhea in adult volunteers. ETEC produce LT or/and ST enterotoxins, which are responsible for their characteristics secretory diarrhea. EIEC is the only E. coli pathotype associated with cell invasion, are biochemically, genetically and pathogenically closely related to Shigella spp., are generally lysine decarboxilase negative, non-motile and lactose negative. EAEC strains are characterized by "stacked-brick" binding pattern to HEp-2 cells, nevertheless EAEC strains have shown a heterogeneous pathogenicity in humans which has been confirmed in volunteer studies and outbreak investigations [8, 10]. Recently a meta-analysis, that included 354 EAEC studies from August 1985 to January 2006, as well as a search of conference proceedings, references of articles, and contacts with investigators, helped to establish that the EAEC pathotype is a cause of acute diarrheal illness [44]. Since the recognition in the early eighties of E. coli O157:H7, the most well known STEC, associated with hemorrhagic colitis and hemolytic uremic syndrome, these strains have been sought from clinical and food samples in Mexico. STEC strains are a diverse group of organisms capable of causing severe gastrointestinal disease in humans. Within the STEC family, certain strains appear to have greater virulence for humans. STEC strains carrying eae and belonging to serogroup O157 or O111, known as EHEC, have been responsible for the vast majority of outbreaks of STEC disease reported to date [10]. However, STEC strains lacking eae, only producing Shiga-toxin have not only been associated with cases of diarrhea but also of HUS [45, 46]. DEC Epidemiology from the 80’s Until Now Mexico is a large country that encompasses 31 states and 1 Federal District (DF). Mexico City not only includes the DF but also part of the surrounding state of Mexico. Studies regarding DEC epidemiology have included Mexico City and several states, like Morelos, Queretaro and Puebla, at the center of the country, in the North West Jalisco mainly in Guadalajara city, the second largest city in Mexico, east Veracruz state; and in the South East states, like Tabasco, Yucatan and Quintana Roo. Weather conditions are extremely variable between and within these sates as well as the socioeconomic conditions, all of which make very valuable each epidemiological study. Children The first comprehensive studies seeking DEC during the eighties, was a prospective study of diarrheal disease that included 56 rural infants, of “The Village of the Stone Houses”, Morelos [32]. Infants born between March 15, 1982 and March 14, 1983, were enrolled and a longitudinal study was followed for 2 years and the frequency of isolation of pathogens during episodes of diarrhea was compared with that of matched controls from the same cohort. Incidence of diarrhea during the first year of life was 98%, diminishing to 93% during the second year. Isolation of tEPEC, ST- and ST/LT-producing ETEC and rotavirus was significantly higher in infants with diarrhea during the first 2 years of life. While LT-producing ETEC strains frequency was similarly throughout the first 2 years of life in both cases and controls. tEPEC strains were only found in children under 18 months of age and always more frequently in those with diarrhea. Of the 372 total cases of diarrhea during the 2 years of the study, 26% were associated with tEPEC and ST- and ST/LT-ETEC strains. In Guadalajara, Jalisco, during the summer of 1985, stool specimens from 154 children with acute diarrhea and 137 age-matched controls were studied for the presence of several enteropathogens, including enteroadherent E. coli and tEPEC by HEp-2 binding assays [35]. Children between the ages of 3 months to 7 years old were evaluated at public health clinics or the pediatric outpatient clinic of the Hospital General de Occidente. tEPEC strains, (showing localized adherence), were isolated from 13% of the patients and 0.7% of the controls (p<0.0001). Of the localized adherence E. coli isolated from children with diarrhea, 20% belonged to recognized tEPEC serogroups, whereas only 3.1% of enteroadherent E. coli strains belonged to recognized EPEC serogroups, suggesting that these strains were not tEPEC. In 1991, it was reported for the first time that E. coli strains with aggregative adherence pattern (EAEC) were significantly associated with persistent diarrhea, and one-third of children colonized by EAEC had bloody diarrhea. On the other hand, strains with localized adherence (tEPEC) were significantly associated with acute non-bloody diarrhea [34]. These results were obtained after analysis by HEp-2 binding assay, E. coli isolates from 636 fecal

196 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

specimens of diarrhea episodes, obtained during the first 2 years of life of 72 children from the rural village “Lugar Sobre la Tierra Blanca”, Morelos. From these isolates, 373 (59 %) yielded adherent E. coli. Serotype characterization revealed that half of the strains with localized adherence were not tEPEC serotypes and did not hybridized with the EAF DNA probe. All strains with localized adherence gave a positive fluorescent actin staining (FAS) assay, irrespective of serotype. Isolation of strains with diffuse adherence (DAEC) was not related to type or duration of diarrhea but was generally associated with isolation of another pathogenic organism. Also intestinal colonization by specific enteropathogens was followed with fecal cultures taken every fortnight and every time a child had diarrhea [26]. Diarrhea was detected in 82% of the children with initial isolation of STEC and 64% of the children with tEPEC or Shigella spp. The risk of diarrhea associated with the initial isolation of other pathogens was lower, at 41% for rotavirus and approximately 25% for ETEC, Salmonella spp., and Campylobacter jejuni. Furthermore, the etiology of bloody diarrhea was investigated in these children, 71 (11%) of the total episodes of diarrhea, showed presence of blood. STEC, ETEC and EIEC strains, were identified by DNA probes for; stx1, lt and st and ial, respectively. Among the 71 children, in 59 (83%), a single associated pathogen was isolated and 35% yielded EAEC strains, one-third of children colonized with EAEC had bloody diarrhea; 11% STEC, 7% ETEC and 4% yielded EPEC and EIEC strains [47]. A study that particularly focused on the identification and comparison of STEC strains in subjects took place in Mexico City and Cadereyta, Queretaro [48]. A total of 351 subjects were enrolled, 118 from the rural community (49 asymptomatic, and 69 patients, 48 with watery and 21 with bloody diarrhea), and 233 from the urban community (46 asymptomatic and 187 patients, 165 with watery and 22 with bloody diarrhea). All 256 patients with diarrhea were included regardless of sex and age and were recruited in outpatient clinics from the Mexican Institute of Social Security (IMSS). E. coli strains obtained from all subjects were analyzed by a cytotoxin assay on HeLa cells and some were further characterized by a Stx1 and Stx2 neutralization assays. Among the 351 subjects, from the rural and urban communities, 10 (20%) and 6 (13%) from the asymptomatic group yielded STEC strains, 22 (45%) and 13 (7.8%) from patients with watery diarrhea, 16 (76%) and 1 (4.5%) from patients with bloody diarrhea, respectively. Overall, STEC was significantly more frequently isolated (p<0.05) from patients with diarrhea than asymptomatic, in both communities and the relative risk for STEC watery and bloody diarrhea patients were 3 and 12, respectively. Asymptomatic subjects and patients with diarrhea from the rural community were more frequently colonized with STEC strains than urban subjects, and also STEC was highly associated with bloody diarrhea in this setting. Microbiological and clinical characteristics of 119 children <5 years of age, with bloody diarrhea, recruited during June 1990 to October 1991, from primary heath care units in Mexico City, was determined [49]. Patients were divided in two categories, <1 year old (68 infants) and 1-5 years old (59 children). STEC strains were identified by citotoxicity and anti-serum against Stx1 in neutralization assays and were also further characterized for O157:H7 by antiserum. Shigella (35%) and STEC (20%) were more frequently identified, 10% and 13%, respectively, in children than in infants, whereas Campylobacter (29%) and Salmonella (22%) were more common in infants than in children, 12% and 8% respectively. None of the STEC strains agglutinated with O157:H7 antiserum. No cases of amebiasis were identified. Fever was the most sensitive indicator of infection for Shigella (70%) as compared to Salmonella (50%), Campylobacter (42%) and EHEC (36%); with an overall specificity of 50% for all pathogens. In contrast, the lack of fever was 80%, predictive for the absence of these pathogens. However, in children with dysentery, the specific etiological agent cannot be predicted in the absence of culture. Between January and October 1991, 148 fecal samples were collected from the same number of children with acute diarrhea, ages between 0-2 years, admitted to Hospital O'Horan of the Secretary of Health, in Merida, Yucatan. In 41 (27.7%) samples, macroscopic or microscopic blood was found and in 22 (54%) samples, a bacterial pathogen was identified: Shigella was found in 9 samples (7 S. flexneri, 1 S. boydii, 1 S. sonnei); Campylobacter jejuni in 6 samples, Salmonella enterica serovar Enteritidis in 5, and EIEC in 2. Among 22 children, a single invasive bacterial pathogen was isolated in 13 (59%), and in 9 mixed culture; 5 had a mix of invasive pathogens and 4 had a mix of invasive and none invasive pathogens [50]. The remaining 105 children had watery diarrhea and in 49 (47%), at least one enteric pathogen was detected, 37 had single pathogen and 12 had mixed infections. The most frequent pathogen isolated was ETEC in 18 children (mainly ST-producing strains), followed by rotavirus in 15. Other isolated bacterial pathogens included: Shigella spp in 9 children, Salmonella spp in 6, Campylobacter jejuni in 4, and EIEC in 3 [51].

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 197

A large epidemiological study to establish the etiology and clinic characteristic of 815 children hospitalized due to acute diarrhea was carried out in Mexico City. Children were recruited during March 1998 through February 2001 at 3 main hospitals of the IMSS. Stool diagnostic evaluations were done for several enteropatogens; bacteria like Salmonella spp., Shigella spp., Vibrio cholerae, and Campylobacter spp.; parasites such as Entamoeba histolytica, Cryptosporidium parvum, Cyclospora cayetanensis, Isospora spp., and Giardia lamblia; and virus like rotavirus, adenovirus and astrovirus [52]. Furthermore, 5 E. coli colonies were selected and evaluated by 2 multiplex PCR, for the presence of several pathogenic loci, characteristic of 5 diarrheagenic E. coli pathotypes, with exception of DAEC [53, 54]. STEC strains were further characterized by the expression of the O157 lipopolysaccharide antigen and the EHEC enterohemolysin gene (hlyA) by a latex particle agglutination kit and a specific PCR assay, respectively. From the 815 children with acute diarrhea, 127 (16%) were positive for at least one diarrheagenic E. coli pathotype that was the second most frequent pathogen identified during the study, only after rotavirus. Among the 127 DEC positive patients, 48 yielded EAEC, 25 ETEC, 18 aEPEC, 17 STEC (none was positive for O157 serogroup), 6 tEPEC, 6 EIEC and 7 DEC mix infections In most cases DECs were isolated from mix infections, mainly with rotavirus, and most single DEC infections were recovered from samples collected during the summer-fall season [55, 56, 57]. A similar epidemiological investigation was performed in Villahermosa, Tabasco, 620 children hospitalized due to acute diarrhea, were recruited during February 2004 to February 2007 at “El Hospital del Niño” [56, 58]. In the stool samples, the same enteropathogens (bacteria, parasite and virus) described in the above paragraph, including DEC, were sought. Among the 620 children in 140 (22.5%), at least one DEC was identified, and most of them were associated with single infections. DECs were also the most frequent pathogen identified during the study, only after rotavirus. From the 140 DEC positive patients, 73 (52%) harbored EAEC, 25 (18%) aEPEC, 24 (17%) ETEC, 9 (6%) STEC, and 8 (6%) tEPEC. Although, EIEC was only identified in 1 patient, it was a life-threatening severe dysentery case, in a malnourished 4-month-old male, co-infected with rotavirus [59]. The unusual severity of this EIEC infection suggests that rotavirus co-infection might contribute to the disease manifestations and the severity of invasive enteropathogens, especially in malnourished infants from developing countries. A diarrhea outbreak due to ETEC was identified following an overflow of sewage water that took place on May 31, 2000, in “Valle de Chalco” a peri-urban community of Mexico City. After the disaster a total of 1521 rectal swab samples were taken from subjects, of Chalco Valley, with diarrhea and vomiting and 1,188 E. coli strains were isolated. DECs were identified by colony target loci for ETEC (lt, st), EIEC (ial), EPEC (bfp) and EHEC (hlyA). Most E. coli isolates hybridized with ETEC (62.2%), compared with 0.84% with both EIEC and EPEC, and 0.08% with STEC O157:H7. The remaining 36% of E. coli strains did not hybridize with any probe. Other isolated microorganisms were Salmonella spp. (0.45%) and Shigella spp (0.06%). ETEC was significantly associated with diarrhea cases (p<0.0001). ETEC strains had a variety of toxin profiles, among the 739 ETEC isolates, 44.6% were lt positive, 11.2% st and 44.1% were positive for both lt and st; suggesting that this was not clonal outbreak and that ETEC is the most prevalent enterobacteria in sewage water, at least during this time of the year in Mexico City [60]. In a case control study of diarrhea, 380 children aged > 2 to < 12 years old were analyzed. A total of 300 children with diarrhea from different hospitals of Mexico City and 80 children matched for age as controls (attending schools in the surrounding that did not had diarrhea in the previous 45 days), were included in the study. All subjects’ stool samples were collected from September 2004 through December 2006. Three multiplex PCR were used for detection and characterization of E. coli, Salmonella spp., and Shigella spp. The E. coli identified loci were for ETEC (eltB, estA) STEC (eaeA, stx1, stx2), EPEC (eaeA, bfpA) EIEC (ial), for E. coli O157:H7 (fliC H7, and O157); EAEC was not investigated in this study. Parasites Entamoeba histolytica/Entamoeba dispar and Giardia intestinalis were also sought. All stool samples from patients with diarrhea and 72.5% from controls were positive for one or more enteropathogens. In both groups, E. histolytica/E. dispar parasites were the most prevalent enteropathogens in 211/300 (70.3%) cases and in 35/80 (43.7%) controls; G. intestinalis was identified in 99 (33%) cases and in 16 (20%) controls. Salmonella was the most frequently identified bacteria in patients with diarrhea 166 /300 (55.3%) compared with only 3/80 (3.75%) in controls, followed by DEC in 97 patients (32.3%) and in 4 (5%) controls. The most prevalent DEC was ETEC (13.3 %), followed by EPEC (9.3%), STEC (8.6%), and EIEC (1%). None of the STEC strains isolated from patients belonged to the O157:H7 serotype, the only O157:H7 strain was isolated from the only positive STEC control subject [61].

198 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

Recently, an investigation of bacterial etiology in children hospitalized due to acute diarrhea, aged 0-6 years, admitted to Hospital O'Horan of the Secretary of Health in Merida, Yucatan was conducted. From October 2007 to January 2009, 396 children with acute diarrhea were recruited and stools samples collected from the same number of children were analyzed for the presence of enteric bacteria, including 6 DECs by 2 specific PCR assays [53, 54]. A total of 58 (15%) children yielded at least one DEC, the most frequent identified bacterial group, followed by Salmonella spp. in 53 (13%) patients. Among the 58 DEC positive patients, 26 harbored EAEC strains, 19 aEPEC, 4 ETEC, 5 tEPEC, 1 STEC, 1EIEC, and 2 DEC mix infections [62]. The importance of aEPEC strains and other DECs as pathogens associated with community cases of acute diarrhea episodes was established in a cohort of 76 children <2 years old, from La Magdalena Atlicpac, a peri-urban community of Mexico City. Children were enrolled between January 1st and December 31st, 1998, and prospectively followed for 1 year. Then, the asymptomatic infection and acute diarrhea associated with 5 DECs was determined using a pathogen-specific multiplex PCR [54]. DECs were sought in 795 stool samples, of which 125 (16%) were positive for DECs. From those, 4 represented shedding episodes and 4 parasite co-infections. Most single-DEC infections (85/117) were asymptomatic (p<0.001), and of the 32 DEC-associated diarrhea episodes, 41% were associated with aEPEC, 37.5% with ETEC, 9% with tEPEC, 9% with EIEC, and 3% with STEC strains (all O157 serogroup negative). Among the 76 children, 54 (71%) had at least one stool positive for DEC, of which 23 experienced a DEC-associated diarrhea episode. In the last group of children, DEC infection was significantly associated with a diarrhea episode (RR=2.5; 95%; p<0.001), and ETEC and aEPEC were the most frequently pathotypes associated with diarrhea. The aEPEC-associated diarrhea episodes were more frequently in the <12month age group (p=0.04), infections were distributed all year round, but associated diarrheal episodes were identified from April to October, with a May-June peak (rainy season). Most ETEC infections and diarrhea episodes characteristically occurred during the summer (rainy season), with a diarrhea peak in August. Of all DECs, only aEPEC was associated with acute diarrhea episodes lasting 7 to 12 days (p=0.019) [43]. The increasing prevalence of aEPEC over tEPEC in recent years was also documented after investigating 208 cases of children with acute diarrhea at the Hospital Infantil de México. tEPEC strains were identified in only 7% of patients with diarrhea compared with 12% of aEPEC [63]. Adults Most epidemiological studies regarding diarrheagenic E. coli pathotypes in Mexico, as well as in most developing countries, had and are focused on children. There are few studies regarding diarrhea of adults and most studies on this age group have been related to travelersy’ diarrhea [64, 65, 66, 67, 68] including genetic susceptibility for DEC infections [69]. A study comparing the enteric pathogens isolated and clinical illness between two adult populations, local and travelers, experiencing acute diarrhea acquired in Guadalajara, Mexico, was reported [70]. A total of 584 Mexican residents and US adults were enrolled in this study, 274 Mexicans during the summer of 1995, and 183 Mexicans and 127 US adult subjects throughout the summer of 1997. A similar proportion of one or 2 enteropathogens were detected in the 3 groups, for the Mexican groups combined, the distribution was 23% (107) and 2% (8), respectively, and for the 37 US adults 29% (37) and 2% (2), respectively. ETEC was the most common pathogen identified in both groups (11% in Mexicans, 19% in US adults), although it was more common in the US travelers’ group (p=0.0017). Shigella spp. and Cryptosporidium spp. were less common among Mexicans (<1% for both pathogens) than in US travelers (6% and 3%, respectively), whereas Entamoeba histolytica was only found in the Mexican residents (4%). In addition, the duration of untreated diarrhea due to ETEC was significantly shorter (p=0.0004) among Mexicans (49 hours) than in US adults (94 hours), as was the average number of unformed stools passed over 4 days (p=0.0009), in Mexicans was 8.8 versus travelers 17.9. Therefore, ETEC, as has been reported for travelers [66], is also the most common pathogen associated with diarrhea in the adult Mexican population. DEC INFECTIONS AND TRAVELER'S DIARRHEA IN MEXICO Traveler’s diarrhea studies in Mexico have been documented since the 70’s. Although, a review of on this subject is beyond our scope, some studies will be mentioned, not only due to the importance of DEC as the main etiological agents isolated from travelers to Mexico, but also because antibiotics susceptibility profiles against Mexican DECs isolates have been well characterized [71, 72].

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 199

In an early study, Gorbach [19] reported that in a group of 133 United States students, followed for 18 days after arriving in Mexico, diarrhea developed in 38 (29%). Diarrhea rarely began before the fourth day, and the mean onset was 13 days after arrival. Symptoms lasted an average 3.4 days but persisted in 21% of sick students. LT-producing ETEC was found in the stools of 72% of sick and 15% of healthy students, and none of their stools harbor LTproducing ETEC when they entered Mexico. The incubation period was short, generally 24 to 48 hours, and the carrier state was five days or less in 82% of students surveyed. The only other enteropathogen yielded was E. histolytica in 6% of cases of diarrhea. In a prospective study of travelers' diarrhea on 73 physicians and 48 family members attending a medical congress in Mexico City, in October of 1974, it was documented that ETEC was the main pathogen isolated from diarrhea patients [73]. Fecal and blood specimens were collected before, during and after their visit and examined for enteric bacterial pathogens, viruses and parasites. In 59 (49%) participants, travelers' diarrhea developed, with a median duration of illness of five days and an onset occurring with a median of six days after arrival. An etiologic agent was found in 63% of ill participants. ETEC from non-"enteropathogenic" serotypes were the most common cause. Consumption of salads containing raw vegetables was significantly associated (p=0.014) with ETEC infection. Since then, several studies have documented that ETEC is the main pathogen isolated from travelers’ diarrhea patients, not only visiting Mexico [65, 66, 67] but other regions worldwide, estimating that it is responsible of approximately 25-70% of all cases [74]. Furthermore, another DEC category, EAEC, has been established as a major etiologic agent in traveler's diarrhea, only second to ETEC, in visitors to Mexico and to other regions of the world [64]. Recently, DAEC strains have also been implicated in traveler's diarrhea; particularly in those subjects initially diagnosed as pathogen negative [75]. DEC IN FOOD, ENVIRONMENT, AND ANIMALS The most common vehicles of transmission of diarrheagenic E. coli pathotypes are contaminated food and water and transmission person-person has also been documented for some DECs such as STEC O157:H7 [10]. Consumption of food has been associated with DECs infections in Mexico. In a prospective study of travelers' diarrhea on 73 physicians and 48 family members attending a medical congress in Mexico City, it was documented that consumption of salads containing raw vegetables was significantly associated (p=0.014) with ETEC infection [73]. In another study, the influence of food consumption on the development and etiology of travelers’ diarrhea was investigated in US students in Guadalajara, Jalisco [76]. Reporting that there was a significant increase in diarrhea infections (p<0.005), particularly with Shigella (p<0.05) and ETEC (p<0.025), in newly-arrived students from the US, who ate half or more of their meals in the school cafeteria and public restaurants, compared with those eating a comparable number of meals in private homes. In this study, Shigella was the only bacteria isolated from food items. There was also an association of diarrhea and students eating from street vendors (p<0.05). However, in full-time US students who had lived in Mexico at least one year, as well as in Latin American students, a relationship between location of meals and occurrence of enteric disease was not apparent. In another study on food consumption patterns of US students living temporarily in Guadalajara, it was observed that food prepared in Mexican homes was associated with an increased risk of diarrhea acquisition [77]. Then, foods from private homes in Guadalajara and commercial sources were examined for contamination with coliforms, fecal coliforms, and bacterial enteropathogens. Foods from homes and commercial sources commonly contained E. coli, but ETEC strains were only isolated from two food samples, shrimp and potato salad which were purchased in a supermarket. The most frequent enteropathogens isolated were Salmonella followed by Shigella, but were found only in the foods obtained from homes. Contamination of food with DEC has been further documented in Guadalalara, Jalisco. During the summer of 1998, 71 tabletop sauces were collected from restaurants in Guadalajara and it was found that 47 were contaminated with E. coli, (median 1X103 CFU/gram), 4 samples with ETEC and 14 with EAEC [78]. More recently, DEC strains have been isolated from dessert samples collected in Guadalajara [79]. Among 49 dessert samples collected from 35 restaurants, between June and September 2007, coliforms were found in 47 (95.9%) of them (median 7X103 CFU/gram). E. coli was found in 6/49 (12%) samples, ETEC in 4, and EAEC in 1. Among the various types of desserts studied, including cream-filled, those topped with frosting, and desserts with ice cream, items with ice cream were found to be most frequently contaminated with E. coli compared to the desserts without ice cream (p=0.007).

200 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

Due to the importance of street-vend food in Mexico, general trading condition and microbiological contamination of these food items has been investigated. Street-vended food industry belongs to what it is known as the “informal economy” sector, which employed 32.5% of the labor force and generated 13.3% of the national gross product during 2009, compared with 12.4% for the period 1998-2003, (data collected from CEESP, Centro de Estudios Económicos del Sector Privado, Mexico, Nov 1st, 2009). This industry not only provides employment but also cheap ready-to-eat meals to a large proportion of the population in Mexico, as in other developing countries. Chili sauce consumption in Mexico has ancient precolumbian roots and it is a traditional dressing of most typical street-vended meals. Therefore, two observational studies were performed in Mexico City, where street vended chili sauces and taco dressings were examined for contamination of E. coli and other enterobacteria. The first study was conducted in “La Villa”, which has a high concentration of street-food vendors and consumers, with an average of 6,000,000 visitors estimated per year; because of its importance as a national and international place of pilgrims. During summer-autumn of 1999, 43 samples of street-vended chili sauces (30 green and 13 red sauces) were collected. From the 43 samples, 17 (40%) were contaminated with E. coli, 12 were green sauces (mean 17.7X103 CFU/g) and 5 were red sauces (mean 7.4X103 CFU/g). ETEC strains were identified by a specific multiplex PCR for lt and st enterotoxin genes. Among the 12 green sauces, 2 harbored ETEC strains (mean 7.6X103 and 13X103 CFU/g respectively) in sufficient quantity to cause disease. Considering that consumers add 4-8 ml of chili sauce per taco, ingest 2-5 tacos per meal on average, and than 50 consumers frequent a stall per day, it was estimated that the consumption of only one of these chili sauces could result in ETEC disease in at least 21,000 consumers per year [80]. The second study was conducted during the winter of 1999-2000 and spring-summer of 2000 [81, 82]. Five open street markets (known as “Tianguis”) were visited and 48 vendors in 48 stalls interviewed in Mexico City. General hygienic conditions of the stalls were poor; food-vendors kept water in buckets (reusing it all day), lacked toilet facilities, and prepared taco dressings the day before which remained at the Tianguis without protection for about 7.8 h on average. A total of 178 street-vended taco dressings, 49 green, 62 red, and 18 “Pico de Gallo” chili sauces, 8 Guacamole, 9 coriander-onion, 14 coriander, 13 onion, and 5 lettuce samples were collected, and sampled for E. coli and Salmonella spp. Among the 178 samples, 120 (67%) were contaminated with E. coli, and 8 (7%) of them were positive for DEC by PCR [54], of which 6 (75%) belonged to the STEC pathotype (4 red chili sauces and 2 coriander-onion samples), but they were negative for O157 serotype, and the other 2, 1 “Pico de Gallo” and 1 lettuce, harbored aEPEC and ETEC strains, respectively [82]. Two samples yielded Salmonella: 2 S. Enteritidis phage type 8, 1 S. Agona and 2 Salmonella B group O. Thus consumption of street-vended food by local and tourist populations poses a health risk [81]. In addition to chili sauces, the presence E. coli and DEC have been investigated in other acid food items such as Pozol [37]. Pozol is an acid-fermented maize beverage consumed in South-eastern Mexico. A total of 73 E. coli strains, were isolated at early and late times (6 and 48 h) during the Pozol fermentation process, when dough’s pH values were 6.7-4.7 (6 h) and 4.7-3.7 (48 h). Serotypes that belong to DECs, such as O18, O88, O8, O11, O20 and O173, were identified. Furthermore, HEp-2 cell adherence in vitro assays showed localized, diffuse and aggregative adherence patterns among some of these strains. A DNA colony hybridization analysis with different probes revealed the presence of virulence genes related to diarrheal pathogenesis (st1, eaeA, agg1, agg2, bfp, ltA, cdt). DECs, particularly STEC strains, have been sought from sheep dairy products. A total of 83 'Castellano' cheese, made from ewe's milk raw hard or semi-hard samples, with different ripening times (2.5, 6 and 12 months), were taken at 30 cheese factories. Samples were examined for the presence of STEC, (by the official method of the Association of Official Analytical Chemists), and then isolates were tested for stx1, stx2, eaeA, and ehxA virulence loci by PCR methods. Among the 83 cheese samples in two samples (2.4%), 3 STEC strains were isolated and the 3 were positive to stx1 by PCR. Two of the 3 isolates were identified as E. coli O14 and the third presented an Ospecific polysaccharide serologically not-groupable, These STEC strains were isolated from two cheese samples with different ripening periods, 2.5 and 12 months, revealing the potential of STEC strains to survive in longripened-hard cheeses [83]. In another study by the same group, a total of 13 STEC strains (eight O157 and five nonO157) isolated from sheep dairy products were further characterized biochemically for traits, motility, hemolytic activity, resistance to tellurite-cefixime, maximum growth, temperature and antibiotic resistance. STEC strains were grouped into nine biochemical and physiological biotypes (five for the O157 and four for the non-O157 strains). All STEC strains showed resistance to bacitracin, cloxacilin, penicillin and tylosin [84]. These studies supports the idea that consumption of sheep dairy products are a potential risks for STEC diarrhea in Mexico.

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 201

STEC strains including O157:H7 are pathogenic bacteria than can reside and not been detected in the gastrointestinal tract of cattle and other mammalians, and can contaminate meat, carcasses and slaughterhouse environment. The presence of Shiga-toxin producing O157:H7 and non-O157 on beef carcasses, from a slaughter plant in Guadalajara, Jalisco, was investigated [85]. A total of 258 beef carcasses were sampled during a 12-month period and analyzed for STEC by selective enrichment in modified tryptone soy broth supplemented with cefixime, cefsulodin and vancomycin, followed by plating on Sorbitol MacConkey Agar supplemented with cefixime and tellurite (CT-SMAC). Simultaneously, all samples were assayed by immunomagnetic separation and plated on CTSMAC and CHROM agar, and E. coli isolates were tested by PCR for the presence of the stx1, stx2, eaeA and hly933. From the 258 beef carcasses, in 53 non-O157 E. coli were isolated, in 13 O157:NM and in 7 O157:H7. In total from the 73 carcasses, 146 E. coli strains were isolated and among them 119 were non-O157, 16 O157:NM and 11 O157:H7. From the 146 strains only 2 harbored virulence genes one of these corresponded to O157:H7 serotype harboring stx2, eaeA and hly933 genes and the other isolate corresponded to a non-O157 STEC harboring stx1 gene. The presence of O157:H7 and non-O157 STEC on beef carcasses in this slaughter plant emphasizes the importance of implementing the Hazard Analysis and Critical Control Point system, the importance of detecting STEC virulence traits and the low prevalence of pathogenic O157 serogroup and O157:H7 serotype in beef carcasses. Fecal pollution of settled dust samples from indoor and outdoor urban environments in Mexico City was investigated by measuring and characterizing the presence of fecal coliforms, and by identification of E. coli virulence genes, adherence and antibiotic resistance traits as markers [86]. There were more fecal coliforms in indoors than in outdoors (mean values 1089 and 435 MPN/g). Among the indoor samples, there were more fecal coliforms in houses with carpets and/or pets. It was established that there was not a significant difference between isolates from indoors and outdoors, 60% and 72% positive to at least one tested gene, respectively, when E. coli isolates were tested randomly by a PCR-based assay for six virulence traits of EAEC, STEC and EPEC. Also, it was observed that there was a high prevalence of strains carrying genes associated to EAEC or STEC pathotypes. These randomly selected E. coli isolates belonged to a high diversity of E. coli serotypes (89 serotypes), that were commonly associated with pathogenic strains, such as O86 and O28 that were found in the indoor isolates; whereas O4, O66 and O9 were found amongst outdoor isolates. These results indicate that outdoor fecal bacteria were more likely isolated from human sources, and those found indoors were related to pets which remained in the carpets. This study illustrates the risk posed by fecal bacteria from human sources, usually bearing virulence and resistance traits. In another study in Puebla, a total of 74 environmental E. coli strains, 18 obtained from food, 28 from water and 28 from air, were characterized for the presence of lt and st by PCR. From the 56 E. coli strains from water and air and the 18 from food samples, 16 (29%) and 7 (39%) were ETEC positive, respectively [87]. To establish the specific prevalence of O157 in animals in Mexico, and due to the lack of positive samples in humans, a study was undertaken to determine the prevalence of E. coli O157 in cattle and swine in Central Mexico with the technique of immunomagnetic bead separation. Sixty fecal samples per farm were taken from four cattle (Xalpa, Veracruz; Texcoco, Mexico; Bernal, Quintana Roo; Mexico, D.F) and four swine (Xalpa, Veracruz; Axapusco, Mexico; San Miguel de Allende, Guanajuato; Mexico, D. F) farms in October 2001. A total of 240 cattle fecal samples and 240 swine samples were analyzed for E. coli O157 prevalence and in only 1.25% of cattle samples and 2.1 % of swine samples, this serotype was identified [88]. E. coli O157:H7 IN MEXICO Due the epidemiological importance of E. coli O157:H7 serotype in the US as the most frequent isolated pathogen from stool specimens with visible blood, and the bacteria most commonly associated with HUS, a similar scenario was anticipated in Mexico. However, most epidemiological studies in children, food and animals, even using more advanced and sensitive detection techniques, have revealed the extremely low prevalence of both O157 serogroup and O157:H7 serotype, and some, when identified, they do not harbour virulence markers. In Mexican residents so far, there have not been reports of HUS or HC in association with E. coli O157:H7 infections and the only E. coli O157:H7 human documented infection was not even associated with diarrhea disease; it was reported from a control subject [61]. Overall, this suggests that E. coli O157:H7 virulence phenotypes are not well fit as ecological competitors in environments with such large amount of circulating enterobacteria, including commensal and pathogenic E. coli strains, and that seem to be so well adapted to humans and animals intestinal microbiota. Similarly, it has also been document the low prevalence of E. coli O157:H7 serotype associated with diarrhea

202 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

disease in other developing countries with high prevalence of gastrointestinal infections due to other DEC pathotypes, such as Brazil [89] and Laos [90]. One possible explanation is the well documented cross-reactivity between the LPS of E. coli O157 and O antigens of Yersinia enterocolitica O9, Citrobacter freundii, E. hermannii, and even Brucella abortus [91, 92, 93]. It has also been documented that serum of patients with HUS, associated with E. coli O157, cross-reacted with strains of Vibrio cholerae O1 Inaba and sera from individuals vaccinated against V. cholerae O1 which strongly reacted against O157 LPS [94]. Furthermore, cross-reactivity between the E. coli O157 serogroup and the E. coli O7 and O116 serogroups have been described [95]. Similarly, it has also been shown that a proportion of serum samples from Mexicans, without clinical symptoms of disease, cross-reacted with O157, O7, and O116 LPS [96]. This was revealed when 605 serum samples (562 from adolescents and adults and from 43 infants less than 1 year of age), were tested against O157 LPS by ELISA, 20% of both groups reacted with the O157 LPS (cutoff points between 0.4 and 0.699). Western blotting analysis of selected serum samples, that had an intermediate response against the O157 LPS by ELISA, revealed that 61 of 88 (69%) reacted with the same LPS and a similar result was observed for maternal milk samples. Therefore, it is possible that the identification of antibodies in these subjects against O157 LPS, in Mexico and in other places, it is actually a cross reaction not only to other E. coli LPS, but also to common LPS antigens determinants from a variety of enteric bacteria. Furthermore, in this study three human serum samples had bactericidal activity against E. coli O157:H7, with serum dilutions of 1:16 and 1:64 (p<0.05). However, remains to be determined if similar antibodies against O157 LPS are present in the intestinal track of subjects with serum antibodies against O157:H7 and if such antibodies have any effect on intestinal colonization or/and bactericidal effect on this strain. Recently, Belongia [97] evaluated the presence of anti-O157 antibodies in children, farm and non-farm residents, with diarrhea, in Wisconsin, US. Reported that 14% of 363 children had anti-O157 antibodies, the incidence of clinically recognized diarrhea was similar among children with and without anti-O157 antibodies, and the clinical visit rate due to diarrhea was 46% lower among children which were farm residents. Overall these observations suggest that the reduced occurrence of clinical illness could be associated with repeated antigenic stimulation in a contaminated environment. A similar explanation may account for the low prevalence in Mexico of E. coli O157:H7 in animals. A study designed to determine the immune response against E. coli O157:H7 and other antigenically related bacteria, was conducted using bovine serum samples [98]. A total of 310 bovine serum samples obtained from two adult cattle herds, 100 samples were from cattle for veterinary purposes in Mexico City, and 210 samples from cattle for milk and meat production, in the State of Mexico. Serum samples were first analyzed by microagglutination assays against different enterobacterial antigens, including E. coli O157, and confirmed using a specific ELISA with purified LPS. In the ELISA test, 55% were positive for E. coli O7, 76% for O116 and 36% for O157, 15% were positive for E. hermannii, 14% and 40% for Salmonella enterica serovar Urbana and Salmonella enterica subsp. Arizonae, respectively. A bactericidal assay against E. coli O157: H7 using 31 bovine serum samples was performed, and 22 (71%) of these serum samples produce positive results. The data demonstrated that bovine serum displayed a response against different enterobacteria, including E. coli O157, and that this response could be due to the presence of shared epitopes in the LPS of these organisms. DEC TREATMENT AND ANTIBIOTIC RESISTANCE Most episodes of diarrhea are acute, self limiting, and most common bacterial infections causing diarrhea do not require antibiotics. Since some diarrheagenic E. coli pathotypes infections appear indistinguishable from viral gastroenteritis, isolation and identification of DEC strains could allow care takers to provide appropriate treatment for pathogen-specific illness. Furthermore, DEC cause high rates of persistent diarrhea [34, 42, 99], which has been associated with malnutrition, growth impairment, and death, in developing countries [4, 99, 100]. Antimicrobial therapy may be indicated in undernourished children with acute DEC diarrhea that is promptly identified and in children with DEC persistent diarrhea. In developing countries, including Mexico, trimethoprim-sulfamethoxazole (TMP-SMX) and ampicillin are the most commonly drugs used to treat pediatric diarrhea [101]. Quinolones, have been proven to be the antibiotic for adult travelers’ diarrhea, however, quinolones are not approved for children because of the risk of damage to immature joints [102].

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

Pathogenic Escherichia coli in Latin America 203

Antimicrobial resistance patterns for the strains isolated from Mexican patients with DEC have been described. In a large study with 430 children, from Villahermosa and Mexico City, presenting with acute diarrhea and requiring hospitalization, were analyzed for the presence of DEC [56]. A total of 170 DEC strains were isolated and tested for antibiotic resistance patterns, 105 (62%) were multidrug resistant; 145 (85%) were resistant to tetracycline, 124 (73%) to ampicillin, 127 (75%) to TMP-SMX, 29 (17%) to chloramphenicol, 4 (2%) to gentamicin, and none to ciprofloxacin and cefotaxime. Most isolated strains per patient showed similar susceptibility. Comparison of resistance patterns to ampicillin and TMP- SMX, and between patients belonging to different DECs showed that aEPEC (38% for both antibiotics) was significantly less resistant (p<0.05) than ETEC 88%, 71%, EAEC 81%, 88% and STEC 72%, 63%, respectively for each antibiotic, suggesting that aEPEC is an emerging pathotype. Similar results were observed when DEC strains isolated from children with acute diarrhea and requiring hospitalization in Merida were tested for antibiotic resistance patterns [62]. This resistance pattern is an emerging problem for DEC strains isolated from children in other developing countries [103]. Practically, all strains were sensitive to ciprofloxacin and cefotaxime in both studies; ciprofloxacin and other quinolones, as mentioned before, are not approved for children and unfortunately most parenteral third-generation cephalosporins (e.g., cefotaxime) are administered only in the hospital setting. Strains isolated from food have also been shown to be resistant to antibiotics. Among 73 E. coli strains isolated from Pozol, 33% were tetracycline-resistant [37]. Four of the non-O157 STEC strains isolated from taco dressings were resistant to ampicillin, and 1 was also resistant to chloramphenicol and all strains were susceptible to TMP-SMX, ciprofloxacin, and cefotaxime [82], revealing the risk of consumption of these food items if associated with disease. In an antimicrobial susceptibility of environmental strains study, indicated that a total of 14% of E. coli strains were multi-resistant to antimicrobials, mainly to trimethoprim and tetracycline, and most of the strains possessed multiresistant patterns, i.e. those isolated from settled dust in indoor environments. It was also observed, that among the strains positive for virulence factors, there were significantly more outdoors isolates (73%) resistant to at least one antibiotic than from indoors (45%), and outdoor isolates were more commonly multi-resistant. However, there was no relationship between the presence of virulence loci and resistance traits [86]. CONCLUDING REMARKS In Mexico, DECs are important etiological agents of acute severe diarrhea, identified as the second highest proportion only after that of rotavirus in children ≤5 years old, and above both Shigella spp. and Salmonella spp. Until the 90’s, ETEC strains followed by tEPEC strains, were the most frequent DECs associated with acute diarrhea cases at public health clinics, community acquired, or requiring hospitalization [28, 29, 32, 35, 51]. However, nowadays EAEC strains are the most frequent pathotype associated with both cases of acute diarrhea, either requiring hospitalization [55, 58, 62] or community acquired [43]. Furthermore, EAEC strains have been associated with persistent diarrhea [34] and bloody diarrhea [47], since the late 80’s in Mexico. EIEC identification from stool samples of patients with acute bloody diarrhea remains low, as in early studies, but continues to be associated with severe cases [47, 50, 59]. In addition, recent epidemiological studies have revealed the low prevalence of tEPEC strains and the emergence of aEPEC strains as important DECs associated with cases of acute diarrhea requiring hospitalization in children ≤5 years of age, [55, 58, 62, 63] and in older children [61]. Moreover, aEPEC has also been associated with community acute diarrhea in children ≤5 years of age and aEPEC was the only DEC associated with protracted acute diarrhea, lasting more than 6 and less than 14 days [43]. The emergence of non-O157:H7 STEC strains, associated with diarrhea cases and from food samples, have also been documented in Mexico; these studies have revealed the extremely low frequency of both O157 serogroup and the O157:H7 serotype [33, 47, 55, 61, 84, 85, 88], and particularly of those with a virulence phenotype [85]. Until now, the identification of DEC strains from patients with acute diarrhea has focused in children less than 5 years old, but it seems that its epidemiology varies depending of the age. There is one study that investigated the association of enteropathogens with acute diarrhea in children between 2-12 years of age [61], revealing that among DECs, EAEC was not sought, ETEC had the highest prevalence identified in 13.3% of cases, followed by non-O157 STEC in 8.6%, compared with studies of children ≤5 years old where ETEC prevalence in average is 3% and 2% for non-O157 STEC [55, 58]

204 Pathogenic Escherichia coli in Latin America

Navarro and Estrada-Garcia

Although the importance of DECs as agents of acute severe diarrhea, there are few studies investigating its presence in food samples in Mexico. In spite of that, some pathotypes have been isolated from a variety of food items, in enough quantities to cause disease [78, 79, 80, 82]. Unfortunately, due to the epidemiological importance of STEC O157:H7 in the US, most food studies have mainly focused on STEC [83, 85], or just this serotype [88] and not on other DECs of public health relevance in Mexico. In addition, only 2 studies regarding DECs in air or/and water have taken place revealing how limited is our knowledge of DECs in the environment [86, 87]. Seroprevalence studies have documented antibodies responses to O157 LPS in healthy children and adults and also in children with diarrhea; maybe due to cross reactivity with LPS from other E. coli (O7, O116) and enteric bacteria (E. hermannii, S. Urbana and subsp. Arizonae) [96]. Furthermore, at least 3 of these human serum samples have bactericidal effect against E. coli O157:H7, similar results have been observed when using bovine serum samples, from non E. coli O157:H7 infected animals [98]. Therefore, it is possible that this cross reactivity may explain the low incidence of this serotype in Mexico. These days, most DEC strains isolated from patients and food samples are resistant to common antimicrobial drugs for diarrhea treatment, trimethoprim/sulfamethoxazole and ampicillin, some are multidrug resistant and until recently most strains were ciprofloxacin and cefotaxime susceptible [56, 62, 82]. Unfortunately, these antibiotics are not approved for children, thus effective and safe oral agents are needed to treat children with bacterial diarrhea. Therefore, if further substantial reductions in diarrhea related deaths, complications, morbidity due to acute diarrhea episodes in children ≤ 5 years of age is desirable to achieved in Mexico and Lain America, it is necessary to systematically establish which diarrhea pathogens are responsible for the remaining deaths, complication and severe diarrhea cases, most common vehicles associated with infections and to continue to improve sanitation and safe water in all regions. Also, similar studies of acute diarrhea including older children and elder subjects should be performed given that related deaths, morbidity and associated enteropathogens in these age groups, in most Latin American countries, are yet unknown. The importance of the precise identification of diarrhea enteropathogens related to deaths, morbidity has recently been documented, after the effect of rotavirus vaccination on death from childhood diarrhea in Mexico and other countries was revealed [7]. Rotavirus vaccine is the first vaccine against diarrheal associated enteric pathogens introduced to routine childhood immunization programs in the world. Its effect on reducing diarrhea related deaths, morbidity, supports the concept that vaccine development against other enteric enteropathogens associated with sever acute diarrhea as diarrheagenic E. coli pathotypes will help to further reduce the related complications associated with this disease. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13]

Bryce J, Boschi-Pinto C, Shibuya K, et al. WHO estimates of the causes of death in children. Lancet. 2005;365:1147-52. Parashar UD, Gibson CJ, Bresse JS, et al. Rotavirus and severe childhood diarrhea. Emerg Infect Dis. 2006;12:304-6. Petri WA Jr, Miller M, Binder HJ, et al. Enteric infections, diarrhea, and their impact on function and development. J Clin Invest. 2008;118:1277-90. Todd EC. Epidemiology of foodborne diseases: a worldwide review. World Health Stat Q. 1997;50:30-50. González-Cossio T, Moreno-Mácias H, Rivera JA, et al. Breast-feeding practices in Mexico: results from the Second National Nutrition Survey 1999. Salud Pública Mex. 2003;45:s477-489. Velázquez FR, Garcia-Lozano H, Rodriguez E, et al. Diarrhea morbidity and mortality in Mexican children: impact of rotavirus disease. Pediatr Infect Dis. J 2004;23:s149-55. Richardson V, Hernandez-Pichardo J, Quintanar-Solares M, et al. Effect of rotavirus vaccination on death from childhood diarrhea in Mexico. N Engl J Med. 2010;362:299-305. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123-140. Le Bouguénec C, Servin AL. Diffusely adherent Escherichia coli strains expressing Afa/Dr adhesins (Afa/Dr DAEC): hitherto unrecognized pathogens. FEMS Microbiol Lett. 2006;256:185-194. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. Servin AL. Pathogenesis of Afa/Dr diffusely adhering Escherichia coli. Clin Microbiol Rev. 2005;18:264-292. Trabulsi LR, Keller R, Tardelli Gomes TA. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:508-603. Bray J. Isolation of antigenically homogeneous strain of Bacterium coli Neapolitanum from summer diarrhoea of infant. J Pathol Bacteriol. 1945;57:239-47.

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

[14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38]

[39] [40]

Pathogenic Escherichia coli in Latin America 205

Giles C, Sangster G. An Outbreak of infantile gastro-enteritis in Aberdeen; The association of a special type of Bact. coli with the infection. J Hyg. 1948;46:1-9. Taylor J, Powell BW, Wright J. Infantile diarrhoea and vomiting; a clinical and bacteriological investigation. Br Med J. 1949;2:117-125. Varela G, Aguirre A, Carrillo J. Escherichia coli Gómez nueva especie aislada de un caso mortal de diarrea. Bol Méd Hosp Infant Méx. 1946;3:623-627. Olarte J, Varela G. A complete somatic antigen common to Salmonella adelaide, Escherichia coli-gomez, and Escherichia coli O111:B4. J Lab Clin Med. 1952;40:252-4. Ewing WH, Tanner HE, Tatum HW. A new serotype of Escherichia coli associated with infantile diarrhea. Public Health Rep. 1955;70:107-114. Gorbach SL, Kean BH, Evans DG, et al. Travelers' diarrhea and toxigenic Escherichia coli. N Engl J Med. 1975;292:933936. Neter E, Westphal O, Lüderitz O, et al. Demonstration of antibodies against enteropathogenic Escherichia coli in sera of children of various ages. Pediatrics. 1955;16:801-8. Carrillo J, Heredia A, Benavides L. Asociación de Escherichia coli O7 con un brote epidémico de diarrea en niños prematuros. Bol Méd Hosp Infant Méx. 1961;18:611-19. Moreno Ruiz E, Alvarez de los Cobos J, Jurado-García E, et al. Clinical evolution of an epidemic of diarrhea in premature infants caused by E. coli O86:B9 and E. coli O111:B4 during the year 1963. Bol Med Hosp Infant Mex. 1965;22:627-46. Kunin CM, Beard MV, Tialmagyi NE. Evidence for a common hapten associated with endotoxin fractions of E. coli and other Enterobacteriaceae. Proc Soc Exp Biol Med. 1962;111:160-166. Carrillo J, Hashimoto B, Kumate J. Content of hetrogenetic antigen in Escherichia coli and its relationship to diarrea in newborn infant. J Infect Dis. 1966;116:285-296. Kumate J, Cravioto J, Hashimoto B, et al. Content of common antigen of Escherichia coli and diarrhea of newborns and infants in a Mexican preindustrial community. Ann N Y Acad Sci. 1971;176:350-359. Carrillo J. Cruce antigénico entre la mucosa intestinal de neonatos y algunos serotipos de Escherichia coli. Bol Méd Hosp Infant Méx. 1982;39:11-17. DuPont HL, Formal SB, Hornick RB, et al. Pathogenesis of Escherichia coli diarrhea. N Engl J Med. 1971;285:1-9. Donta ST, Wallace RB, Whipp SC, et al. Enterotoxigenic Escherichia coli and diarrheal disease in Mexican children. J Infect Dis. 1977;135:482-5. Evans DG, Olarte J, DuPont HL, et al. Enteropathogens associated with pediatric diarrhea in Mexico City. J Pediatr. 1977;91:65-68. Cravioto A, Gross RJ, Scotland SM, et al. An adhesive factor found in strains of Escherichia coli belonging to the traditional infantile enteropathogenic serotype. Curr Microbiol. 1979;3:95-99. Nataro JP, Kaper JB, Robins-Browne R, et al. Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis. J 1987;6:829-31. Cravioto A, Reyes RE, Ortega R, et al. Prospective study of diarrhoeal disease in a cohort of rural Mexican children: incidence and isolated pathogens during the first two years of life. Epidemiol Infect. 1988;101:123-34. Cravioto A, Reyes R, Trujillo F, et al. Risk of diarrhea during the first year of life associated with initial and subsequent colonization by specific enteropathogens. Am J Epidemiol. 1990;131:886-904. Cravioto A, Tello A, Navarro A, et al. Association of Escherichia coli HEp-2 adherence patterns with type and duration of diarrhoea. Lancet. 1991;337:262-4. Mathewson JJ, Oberhelman RA, Dupont HL, et al. Enteroadherent Escherichia coli as a cause of diarrhea among children in Mexico. J Clin Microbiol, 1987;25:1917-9. Ørskov F, Ørskov I. Serotyping of Escherichia coli. In T. Bergan, editor. Methods in Microbiology. Academic Press Ltd, London; 1984. 14;p. 43-112. Sainz T, Wacher C, Espinosa J, et al. Survival and characterization of Escherichia coli strains in a typical Mexican acidfermented food. Int J Food Microbiol. 2001;71:169-176. Pedroso MZ, Freymüller E, Trabulsi LR, et al. Attaching-effacing lesions and intracellular penetration in HeLa cells and human duodenal mucosa by two Escherichia coli strains not belonging to the classical enteropathogenic E. coli serogroups. Infect Immun. 1993;61:1152-56. Pacheco ABF, Ferreira LCS, Pichel MG, et al. Beyond serotypes and virulence-associated factors: detection of genetic diversity among O153:H45 CFA/I heat-stable enterotoxigenic Escherichia coli strains. J Clin Microbiol. 2001;39:4500-5. Navarro A, Eslava C, Perea LM, et al. A new enterovirulent Escherichia coli serogroup 64474 showing antigenic and genotypic relationships to Shigella boydii 16. J Med Microbiol. 2010;59:453-461.

206 Pathogenic Escherichia coli in Latin America

[41] [42] [43]

[44] [45] [46] [47] [48] [49] [50] [51] [52]

[53] [54] [55]

[56] [57] [58] [59] [60] [61] [62]

[63] [64] [65]

Navarro and Estrada-Garcia

Girón JA, Ho AS, Schoolnik GK. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science. 1991;254:710-713. Afset JE, Bevanger L, Romundstand P, et al. Association of atypical enteropathogenic Escherichia coli (EPEC) with prolonged diarrhea. J Med Microbiol. 2004;53:1137-44. Estrada-Garcia T, Lopez-Saucedo C, Thompson-Bonilla R, et al. Association of diarrheagenic Escherichia coli Pathotypes with infection and diarrhea among Mexican children and association of atypical Enteropathogenic E. coli with acute diarrhea. J Clin Microbiol. 2009;47:93-98. Huang DB, Nataro JP, DuPont HL, et al. Enteroaggregative Escherichia coli is a cause of acute diarrheal illness: a metaanalysis. Clin Infect Dis, 2006;43:556-563. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11:450-79. Paton AW, Woodrow MC, Doyle RM, et al. Molecular characterization of a Shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic-uremic syndrome. J Clin Microbiol. 1999;37:3357-61. Benítez O, Uribe F, Navarro A, et al. Etiología de diarrea con sangre en niños de una comunidad rural. Bol Méd Hosp Infant Méx. 1991;48:65-70. Parra-Maldonado NR, Torres-López J, Camorlinga-Ponce M, et al. Frequency of identification of cytotoxigenic strains of Escherichia coli in cases of diarrhea from rural and urban communities. Arch Invest Med. 1991;22:217-2. Torres J, González-Arroyo S, Pérez R, et al. Inappropriate treatment in children with bloody diarrhea: clinical and microbiological studies. Arch Med Res. 1995;26:23-29 Suárez-Hoil GJ, Flores-Abuxapqui JJ, Heredia-Navarrete MR, et al. Prevalence of enteropathogenic bacteria in children with acute bloody diarrhea. Bol Med Hosp Infant Mex. 1993;50:151-156. Flores-Abuxapqui JJ, Suárez-Hoil GJ, Puc-Franco MA, et al. Prevalencia de enteropatógenos en niños con diarrea líquida. Rev Latinoam Microbiol. 1993;35:351-356. Velázquez Castillo FR. Importancia de los agentes virales como causa de diarrea grave en niños menores de cinco años de edad que requieren hospitalización, y factores de riesgo asociados. In: García Peña MC, Reyes Morales H, Viniegra Velázquez L, editors Las Múltiples Facetas de la Investigación en Salud. Instituto Mexicano del Seguro Social, Mexico. ISB 968-7729-14-7; 2001. 7;p.133-152. Cerna JF, Nataro JP, Estrada-Garcia T. Multiplex PCR for detection of three plasmid-borne genes of enteroaggregative Escherichia coli strains. J Clin Microbiol. 2003;41:2138-40. Lopez-Saucedo C, Cerna JF, Villegas-Sepúlveda N, et al. Single multiplex polymerase chain reaction to detect diverse loci associated with diarrheagenic Escherichia coli. Emer Infect Dis. 2003;9:127-131. Cerna-Cortes JF. PhD thesis: Prevalencia y Caracterización Molecular de los Principales Grupos de Escherichia coli Diarreogénicos, en Niños Menores de Cinco Años Hospitalizados por Diarrea Aguda, en la Cd. de México. Departamento de Biomedicina Molecular, CINVESTAV-IPN; 2003. Estrada-García T, Cerna JF, Pacheco-Gil L, et al. Drug-resistant diarrheogenic Escherichia coli, México. Emerg Infect Dis 2005; 11:1306-08. Luna-Mendez O. Bachelor in Science thesis. Prevalencia de los principales grupos diarreogénicos de Escherichia coli en niños menores de cinco años hospitalizados por diarrea aguda en la ciudad de México. FES Iztacala-UNAM; 2003. Pacheco-Gil L. PhD Thesis: Etiología de las Diarreas Agudas en Niños Menores de 5 años en Tabasco. Escuela Superior de Medicina, IPN; 2007. Pacheco-Gil L, Ochoa TJ, Flores-Romo L, et al. Enteroinvasive Escherichia coli severe dysentery complicated by rotavirus gastroenteritis. J Infect. 2006;53:e211-213. Cortés-Ortiz IA, Rodríguez-Angeles G, Moreno-Escobar EA, et al. Brote causado por Escherichia coli en Chalco, México. Salud Pública Méx. 2002;44:297-302. Paniagua GL, Monroy E, García-González O, et al. Two or more enteropathogens are associated with diarrhoea in Mexican children. Ann Clin Microbiol Antimicrob. 2007;6:17-24. Patzi-Vargas SV. MSc Thesis: Incidencia y caracterización molecular de los principales patotipos diarreogénicos de Escherichia coli en niños menores de 5 años en Yucatán. Departamento de Biomedicina Molecular, CINVESTAV-IPN; 2009. Vidal JE, Canizález-Román A, Gutiérrez-Jiménez J, et al. Molecular pathogenesis, epidemiology and diagnosis of enteropathogenic Escherichia coli. Salud Pública Mex. 2007;49:376-86. Adachi JA, Jiang ZD, Mathewson JJ, et al. Enteroaggregative Escherichia coli as a major etiologic agent in traveler's diarrhea in 3 regions of the world. Clin Infect Dis. 2001;32:1706-9. Black RE. Epidemiology of travelers’ diarrhea and relative importance of various pathogens. Rev Infect Dis, 1990;12 (suppl 1):s73-79.

Epidemiology of Diarrheagenic Escherichia coli Pathotypes in Mexico

[66] [67] [68] [69]

[70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81]

[82] [83] [84] [85]

[86] [87] [88] [89] [90] [91]

Pathogenic Escherichia coli in Latin America 207

Caeiro JP, Estrada-Garcia MT, Jiang ZD, et al. Improved detection of enterotoxigenic Escherichia coli among patients with travelers' diarrhea, by use of the polymerase chain reaction technique. J Infect Dis. 1999;180:2053-5. Ericsson CD, DuPont HL. Travelers’ diarrhea: approaches to prevention and treatment. Clin Infect Dis. 1993;16:616-626. Jiang ZD, Greenberg D, Nataro JP, et al. Rate of occurrence and pathogenic effect of enteroaggregative Escherichia coli virulence factors in international travelers. J Clin Microbiol. 2002;40:4185-90. Flores J, DuPont HL, Lee SA, et al. Influence of host interleukin-10 polymorphisms on development of traveler's diarrhea due to heat-labile enterotoxin-producing Escherichia coli in travelers from the United States who are visiting Mexico. Clin Vaccine Immunol. 2008;15:1194-198. Bouckenooghe AR, Jiang ZD, De La Cabada FJ, et al. Enterotoxigenic Escherichia coli as cause of diarrhea among Mexican adults and US travelers in Mexico. J Travel Med. 2002;9:137-140. Gomi H, Jiang ZD, Adachi JA, et al. In vitro antimicrobial susceptibility testing of bacterial enteropathogens causing traveler's diarrhea in four geographic regions. Antimicrob Agents Chemother. 2001;45:212-216. Jiang ZD, Mathewson JJ, Ericsson CD, et al. Characterization of enterotoxigenic Escherichia coli strains in patients with travelers' diarrhea acquired in Guadalajara, Mexico, 1992-1997. J Infect Dis 2000; 181:779-82. Merson MH, Morris GK, Sack DA, et al. Travelers' diarrhea in Mexico. A prospective study of physicians and family members attending a congress. N Engl J Med. 1976;294:1299-05. Jiang ZD, Lowe B, Verenkar MP, et al. Prevalence of enteric pathogens among international travelers with diarrhea acquired in Kenya (Mombasa), India (Goa), or Jamaica (Montego Bay). J Infect Dis. 2002;185:497-502. Meraz IM, Jiang ZD, Ericsson CD, et al. Enterotoxigenic Escherichia coli and diffusely adherent E. coli as likely causes of a proportion of pathogen-negative travelers' diarrhea a PCR-based study. J Travel Med. 2008;15:412-8. Tjoa WS, DuPont HL, Sullivan P, et al. Location of food consumption and travelers' diarrhea. Am J Epidemiol. 1977;106:61-66. Wood LV, Ferguson LE, Hogan P, et al. Incidence of bacterial enteropathogens in foods from Mexico. Appl Environ Microbiol. 1983;46:328-332. Adachi JA, Mathewson JJ, Jiang ZD, et al. Enteric pathogens in Mexican sauces of popular restaurants in Guadalajara, Mexico, and Houston, Texas. Ann Intern Med. 2002;136:884-887. Vigil KJ, Jiang ZD, Chen JJ, et al. Coliform and Escherichia coli contamination of desserts served in public restaurants from Guadalajara, Mexico, and Houston, Texas. Am J Trop Med Hyg. 2009;80: 606-608. Estrada-Garcia T, Cerna JF, Thompson MR, et al. Faecal contamination and enterotoxigenic Escherichia coli in streetvended chili sauces in Mexico and its public health relevance. Epidemiol Infect. 2002;129:223-226. Estrada-Garcia T, Lopez-Saucedo C, Zamarripa-Ayala B, et al. Prevalence of Escherichia coli and Salmonella spp. in street-vended food of open markets (tianguis) and general hygienic and trading practices in Mexico City. Epidemiol Infect, 2004;132:1181-4. Lopez-Saucedo C, Cerna JF, Estrada-Garcia T. Non-O157 Shiga toxin-producing Escherichia coli is the most prevalent Diarrheagenic E. coli pathotype in street-vended taco dressings in Mexico City. Clin Infect Dis. 2010;50:450-1. Caro I, García-Armesto MR. Occurrence of Shiga toxin-producing Escherichia coli in a Spanish raw ewe's milk cheese. Int J Food Microbiol. 2007;116:410-413. Caro I, Mateo J, García-Armesto MR. Phenotypical characteristics of Shiga-like toxin Escherichia coli isolated from sheep dairy products. Lett Appl Microbiol. 2007;45:295-300. Varela-Hernández JJ, Cabrera-Diaz E, Cardona-López MA, et al. Isolation and characterization of Shiga toxin-producing Escherichia coli O157:H7 and non-O157 from beef carcasses at a slaughter plant in Mexico. Int J Food Microbiol. 2007;113:237-241. Rosas I, Salinas E, Yela A, et al. Escherichia coli in settled-dust and air samples collected in residential environments in Mexico City. Appl Environ Microbiol. 1997;63:4093-5. Chávez-Bravo E, Martínez Gómez LE, Cedillo Ramírez ML, et al. Identificación de cepas de Escherichia coli enterotoxigénicas en diferentes ambientes. Enf Inf Microbiol. 2007;27:70-74. Callaway TR, Anderson RC, Tellez G, et al. Prevalence of Escherichia coli O157 in cattle and swine in central Mexico. J Food Prot. 2004;67:2274-6. Guth BE, Ramos SR, Cerqueira AM, et al. Phenotypic and genotypic characteristics of Shiga toxin-producing Escherichia coli strains isolated from children in São Paulo, Brazil. Mem Inst Oswaldo Cruz. 2002;97:1085-89. Phantouamath B, Sithivong N, Insisiengmay S, et al. The incidence of Escherichia coli having pathogenic genes for diarrhea: a study in the People’s Democratic Republic of Lao. Jpn J Infect Dis. 2003;56:103-106. Chart H, Okubadejo OA, Rowe B. The serological relationship between Escherichia coli O157 and Yersinia enterocolitica O9 using sera from patients with brucellosis. Epidemiol Infect. 1992;108:77–85.

208 Pathogenic Escherichia coli in Latin America

[92] [93] [94] [95] [96] [97] [98]

[99] [100] [101] [102] [103]

Navarro and Estrada-Garcia

Rice EW, Sowers EG, Johnson CH, et al. Serological cross-reactions between Escherichia coli O157 and other species of the genus Escherichia. J Clin Microbiol. 1992;30:1315-6. Stuart FA, Corbel MJ. Identification of a serological crossreaction between Brucella abortus and Escherichia coli O157. Vet Rec. 1982; 110:202-203. Chart H, Rowe B. Antibody cross-reactions with lipopolysaccharide from E. coli O157 after cholera vaccination. Lancet, 1993;341:1282. Ewing WH. Identification of the Enterobacteriaceae. 4th ed. Edwards, Erwing editors. New York: Elsevier Science Publishers; 1986. Navarro A, Eslava C, Hernadez U, et al. Antibody response to Escherichia coli O157 and other lipopolysaccharides in healthy children and adults. Clin Diag Lab Immunol. 2003;10:797-01. Belongia EA, Chyou P-H, Greenlee RT, et al. Diarrhea incidence and farm-related risk factor for Escherichia coli O157:H7 and Campylobacter jejuni antibodies among rural children. J Infect Dis. 2003;187:1460-8. Navarro A, Eslava C, García de la Torre G, et al. Common epitopes in lipopolysaccharides of different Enterobacteriaceae are associated with an immune response against Escherichia coli O157 in bovine serum samples. J Med Microbiol. 2007;56:1447-54. Fegundes-Neto U, Scaletsky IC. The gut at war: the consequences of enteropathogenic Escherichia coli infection as a factor of diarrhea and malnutrition. Sao Paulo Med J. 2000;118:21-9. Steiner TS, Lima AA, Nataro JP, et al. Enteroaggregative Escherichia coli produce intestinal inflammation and growth impairment and cause interleukin-8 release from intestinal epithelial cells. J Infect Dis. 1998;177:88-6. Oberhelman RA, Javier de la Cabada F, Vasquez Garibay E, et al. Efficacy of trimethoprim-sulfamethoxazole in treatment of acute diarrhea in a Mexican pediatric population. J Pediatr. 1987;110:960-5. Bhattacharya SK, Sur D. An evaluation of current shigellosis treatment. Expert Opin Pharmacother. 2003;4:1315-20. Putnam SD, Riddle MS, Wierzba TF, et al. Antimicrobial susceptibility trends among Escherichia coli and Shigella spp. isolated from rural Egyptian paediatric populations with diarrhoea between 1995 and 2000. Clin Microbiol Infect. 2004;10:804-810.

Pathogenic Escherichia coli in Latin America, 2010, 209-222

209

CHAPTER 14 Diarrheagenic Escherichia coli in Children from Uruguay, Colombia and Peru Gustavo Varela1, Oscar G Gómez-Duarte2 and Theresa Ochoa3* 1

Departamento de Bacteriología y Virología. Instituto de Higiene “Arnoldo Berta”. Facultad de Medicina. Universidad de la República. Montevideo, Uruguay; 2International Enteric Vaccines Research Program, Division of Infectious Diseases, Department of Pediatrics, University of Iowa Children’s Hospital, USA; 3Instituto de Medicina Tropical “Alexander von Humboldt”, Universidad Peruana Cayetano Heredia, Lima, Perú. Abstract: The diarrheagenic E. coli (DEC) are important agents of acute and persistent diarrhea in children from Uruguay, Colombia and Peru. The relative importance of each pathotype (and its variants) is variable, and may be attributed to different factors, such as age of children and socioeconomic level, type of study, and laboratory methodology used in each country. However, within the DEC group the most common agents are enterotoxigenic E. coli, enteropathogenic E. coli and enteroaggregative E. coli. Further studies are needed, mainly in food and animal reservoirs, in order to better define the transmission and the local and regional epidemiology of these important diarrheal agents.

INTRODUCTION Diarrheal disease continues to be a health problem worldwide, especially in developing countries. It is responsible for 1.87 (95% confidence interval: 1.56-2.19) million of deaths per year in children under five-year-old living in these regions [1]. Acute diarrhea also contributes to morbidity and increases health care costs in children from industrialized countries [1, 2]. In poor countries, it has been estimated that each child suffers an average of 3 to 4 episodes of diarrhea per year [2]. This high morbidity in children living in poor areas is translated into a significant mortality rate despite its low lethality [1, 3, 4]. Within the group of bacteria associated with infantile diarrheal disease there are different pathotypes of Diarrheagenic Escherichia coli (DEC). These strains may colonize the gastrointestinal tract of humans; they are transmitted directly from person to person, animal to person or indirectly through water and contaminated food. According to pathogenesis and epidemiological features, this set of strains is divided into 6 pathotypes: enteropathogenic Escherichia coli (EPEC), Shiga toxin-producing E. coli (STEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC) and diffuse adherent E. coli (DAEC) [5]. The DEC as a group is responsible for 30% to 40% of acute diarrhea episodes in children from developing countries [3]. In a recent review by the World Health Organization, EPEC and ETEC were listed as the highest priority for vaccine development after rotavirus because of their high morbidity and mortality rates [4]. Therefore it is relevant to know the local and regional distribution of these pathogens. SITUATION IN URUGUAY Diarrheal illness is an important cause of infectious morbidity in Uruguayan children, exceeded only by respiratory tract infections [6, 7]. DEC strains are the most frequently bacteria agents associated with this former condition in infants from low-income families. Until recently, Uruguayan clinicians were looking only for the presence of Salmonella spp. and Shigella spp. in stools of children with diarrhea, through the analysis of suspect colonies, and adding, in some cases, the investigation of EPEC by slide-agglutination. With this methodology, the etiologic diagnosis did not exceed 20 to 25% of the cases [8]. Over the years, other diagnostic procedures have been incorporated and the search for other bacterial and viral agents also included. This has allowed increasing over 70% *Address correspondence to: Theresa Ochoa. Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Av. Honorio Delgado 430, San Martin de Porras, Lima 33, Perú. Phone 51-1-482-3903; Fax 51-1-482-3404; E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

210 Pathogenic Escherichia coli in Latin America

Varela et al.

the recovery rate of potential enteropathogens [7]. Nowadays, the search for different types of DEC is performed by conventional PCR, using specific primers to amplify segments of genes that encode distinctive virulence attributes, eae for EPEC and STEC; stx1 and stx2 for STEC; ipaH for EIEC; eltB and estA for ETEC and pCVD432 for EAEC [7, 9]. However, most clinical laboratories today do not follow this methodology and no effort or resources are devoted to the study of these agents. As a consequence, valuable information about different pathotypes of DEC is lost. EPEC is the most frequently isolated pathotype in Uruguayan children with diarrhea from low-income households, followed by ETEC and EAEC strains [7, 9]. According to preliminary data, atypical EPEC strains would also be associated with episodes of acute diarrhea in children from households with high socioeconomic level. STEC strains are recovered less frequently in both groups of children, but the disease that they cause is more severe than the one originated by EPEC and ETEC strains [10]. All the information shown in this section of the chapter about DEC strains in Uruguay has been generated in the Instituto de Higiene “Arnoldo Berta”, Universidad de la República, working in collaboration with pediatric clinics, especially from the Hospital “Pereira Rossell” and also with the participation of other laboratories, such as Laboratorio de Enfermedades Infecciosas-ANLIS “Dr. Carlos G. Malbrán”, Buenos Aires, Argentina, “Laboratorio de Referencia de E. coli” (LREC) Lugo, Spain and the Pathogénie Bactérienne Intestinale (CBRV) Centre, Faculté de Pharmacie, Université d’Auvergne, Clermont-Ferrand, France. Classical Enteropathogenic E. coli (EPEC) In Uruguay, serogroups O26, O55, O111 and O119 constitute 90% of typical EPEC isolates recovered from children under five-year-old with acute or persistent diarrhea [7, 11]. In 2006, the first atypical EPEC isolates from children with diarrhea from low-income households was reported. These strains corresponded to a wide variety of serogroups, many of which had not been described before in Uruguay [9]. Tables 1 and 2 show the main characteristics of EPEC strains recovered from children with diarrhea in Uruguay. Table 1: Characteristics of typical EPEC strains isolated from children with acute diarrhea, assisted in the Hospital “Pereira Rossell”, Uruguay (1999-2001). Serogroup

Intimin type

bfp type

stx1/stx2 genes

O55

μ

β

negative

Number of strains 2

O55:H-

μ

not determined

negative

3

O55

γ1

β

negative

1

O111

β1

α

negative

1

O119

β2

β

negative

4

O142

α1

β

negative

2

O127

θ

not determined

negative

1

Total

14

Table 2: Characteristics of atypical EPEC strains isolated from children with acute diarrhea, assisted in the Hospital

“Pereira Rossell”, Uruguay (1999-2001). Serogroup

Intimin type

stx1/stx2 genes

Number of strains

O26 O33 O49 O101 O34 O51 O55 O55 O128 O111

β1 β2 δ λ θ θ μ θ β1 ε

negative negative negative negative negative negative negative negative negative negative Total

2 1 1 1 1 1 1 1 1 1 11

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 211

In the past, typical EPEC strains were also responsible for nosocomial outbreaks of infantile diarrhea. This situation has been changing over time and the last documented outbreak in the Pediatric Hospital "Pereira Rossell" occurred between December 1991 and February 1992. The strains recovered during this outbreak, which affected children hospitalized in different wards, belonged to serotype O119:H6. All strains were resistant to oxyiminocephalosporins, carried the genes blaPER-2 and blaTEM-116 and all of them showed identical band patterns in PFGE after DNA digestion with XbaI [12]. Thus, apart from causing disease, EPEC contributed to build an enteric reservoir of unnoticed transmissible factors of antibiotic resistance that can be acquired by other bacterial enteropathogens. Therefore, the importance of studying these microorganisms from an epidemiological standpoint should be stressed. Information about antibiotic resistance in EPEC strains is not readily available, because local laboratories usually do not devote resources to the identification of EPEC. Shiga Toxin-producing E. coli (STEC) STEC of Human Origin Until 2002, no STEC strains were detected in children with Hemolytic Uremic Syndrome (HUS) or diarrhea in Uruguay. However, a study conducted between 1994 and 1996, showed that 47% out of 18 children with HUS admitted to intensive care units in Montevideo, provided evidence of STEC infection. The diagnostic methods used were the investigation of free fecal verotoxin by cytotoxicity assay in Vero cells and slide agglutination for the O157 antigen on suspect colonies grown on Sorbitol MacConkey Agar (SMAC) plates. Unfortunately, STEC O157 could not be recovered and the methodology used at that time did not allow the recovery of non-O157 STEC [13]. In 2001, the diagnostic approach for diarrhea and HUS was incorporated as well as the use of CT-TSB broth, CT-SMAC plates, and as a screening test, the multiplex PCR for stx1 and stx2 genes [14]. Using this methodology during a period from 2002 through 2008, 60 children with clinical and laboratory diagnosis of HUS were studied. Most of them had been previously treated withbroad-spectrum antibiotics and more than 10 days had elapsed from the first episode of diarrhea. In only one HUS case, O157 STEC was recovered. The other STEC strains were isolated from 3 children with bloody diarrhea, and 2 of them evolved to HUS. With these figures, it is plausible to affirm that the recovery of STEC strains from HUS cases is very low despite the use of more sensitive methodology. Table 3 shows the main features of the STEC strains of human origin recovered so far in Uruguay. Table 3: Characteristics of STEC strains recovered from children in Uruguay (2001-2008). Strain identification

Serotype

BD19

O111:NM

B

Lysine decarboxylase negative

BD49 b

O26:H11

B

O145:HNT

Seropathotype

Biochemical profile

Stx variants

Intimin type

ehxA

Antibiotype

stx1-stx2

γ2

+

Sa

Rhamnose negative

stx1

β1

+

S

B

--

stx2

β1

+

S

stx1

β1

+

S

stx2- stx2c (stx2vh-a)

γ1

+

S

BD49

b

BD60

b

O26:H11

B

Rhamnose negative

HUS56

O157:H7

A

Sorbitol negative

BD, Bloody diarrhea HUS, Hemolityc Uremic Syndrome a S: indicates susceptibility to ampicillin, cefoxitin, cefuroxime, ceftazidime, ceftriaxone, nalidixic acid, ciprofloxacin, trimethoprim-sulfamethoxazole, tetracycline, chloramphenicol and imipenem b Children who developed HUS

STEC of Animal Origin Currently, Uruguay has 10.5 million sheep, 12.0 million heads of cattle and 206,000 pigs, and as previously mentioned, these animals constitute the potential reservoir for STEC strains that affect humans. Between September 2003 and December 2005, 412 rectal swabs obtained from grazing cattle and sheep were studied. The animals were from different farms located in different departments of the country (see Fig. 1). In red circles: departments where O26 and O111 STEC strains were isolated from animals; in green circles: departments where O157:H7 or O26 or O145 were isolated from HUS or bloody diarrhea (BD) cases; in yellow circles: departments where O157:H7 STEC

212 Pathogenic Escherichia coli in Latin America

Varela et al.

strains were isolated from ground beef; in brown circles: departments where STEC strains were isolated without define serology from animals and in white circles: departments not tested for animal STEC strains. In 173 (42%) out of 412 animals, 230 STEC strains were recovered. Non-O157:H7 STEC isolates were detected and only 8 out of 230 STEC strains corresponded to serogroups associated with BD or HUS in Uruguay. Of these 8 strains, 7 corresponded to serogroup O26 and were isolated from healthy cattle; 5 out of 7 showed an identical pattern by XbaI-PFGE and were recovered from 5 different animals on the same farm. The other two O26 strains were recovered from different farms. The remaining STEC strain corresponded to serogroup O111 and was recovered from a cow from another farm. All O26 and O111 STEC strains carried eae and ehxA genes, but a clonal relationship with those isolates of the same serogroup recovered from children with BD by means of PFGE were not established (see Fig. 1 and Table 4). Most of the STEC isolates were resistant to tetracycline and streptomycin. Although most of the STEC strains recovered (96%) in Uruguay did not correspond to the serogroups linked to severe human diseases, some of them carry virulence factors associated with hemorrhagic colitis (HC) and HUS.

Artigas

Salto

Rivera

Paysandu

Tacuarembo Cerro Largo

Rio Negro Treinta y Tres

Durazno Soriano

Flores Florida

Colonia

Lavalleja

Rocha

San Jose Canelones

Ma.donado

Montevideo

Figure 1: Map of Uruguay that shows the department distribution of STEC strains isolated from humans, animals and food between 2002 and 2009. Table 4: Some characteristics of the O26 and O111 STEC strains isolated from humans and animals in Uruguay. Strain

Serogroup

Stx genes

Intimin type

B125

O26

1

β1

B265 B269

O26 O26

1 1

β1 β1

B270 B271 B292 B206 DS49(1) B261 DS19(2)

O26 O26 O26 O26 O26

1 1 1 2 1

β1 β1 β1 β1 β1

O111 O111

1/2 1/2

γ2 θ

XbaI-PFGE Profilea

Origin

Department/ Farm

+

Cattle

Florida / A

UYEXSX01.0006

Rham(-), dul(-), motility+

+ +

Cattle Cattle

Flores / B Flores / B

UYEXSX01.0005 UYEXSX01.0005

Rham(-), dul(-), motility+ Rham(-), dul(-), motility+

+ + + + +

Cattle Cattle Cattle Cattle Human

Flores / B Flores / B Flores / B Flores / C Soriano

UYEXSX01.0005a UYEXSX01.0005 UYEXSX01.0005 UYEXSX01.0007 UYEXSX01.0011

Rham(-), dul(-), motility+ Rham(-), dul(-), motility+ Rham(-), dul(-), motility+ Rham(-), dul(-), motility+ Rham(-), dul(-), motility+

+ +

Cattle Human

Flores/ B Montevideo

UYEXSX01.0008 UYEXSX01.0001

Lys(-), motility(-) Lys(-), motility (-)

ehxA

Biotyping

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 213

STEC of Food Origin Between 2002 and 2005, 220 samples of ground beef obtained from butcher shops of Montevideo, Maldonado, and Soriano were analyzed (see Fig. 1). The ground beef was ready for retail and a sample was obtained for each establishment. STEC was found in 1.8 % of the analyzed samples and all strains corresponded to serotype O157: H7 [10]. However, in contrast with other areas, non-O157 STEC from these samples was recovered. This result can be attributed to not using the recommended methodology for the detection non-O157 STEC, especially in reference to the enrichment sample stage. STEC was also found in products derived from pork sausages and meat samples. All the recovered strains corresponded to serotype O157:H7 and possess virulence genes associated with strains causing severe disease in humans. Despite the presence of O157:H7 in frequently consumed foods, there are no reported local outbreaks of disease caused by this agent. Enterotoxigenic E. coli (ETEC) In Uruguay, ETEC was initially investigated in cases of childhood diarrhea in 1990, using a GM1 receptor enzymelinked immuno-assay (GM1-ELISA) for the detection of LT and a commercial competitive STEIA (Oxoid) for the detection of ST. Using that methodology, ETEC strains were recovered in 9 out of 224 children with diarrhea. Four strains produced only LT, 4 were ST+ and one strain was ST+ and LT+. Another LT+ strain was recovered from a child without diarrhea, and the serotypes of these strains were not established [18]. In another study, involving 98 children with diarrhea and using PCR for eltB and estA genes, 8 ETEC strains were recovered from 8 of these children, 4 were LT+ and 4 were ST+. These strains corresponded to serogroups O6, O8, O39, O114 and O159 (one of each) and 3 were non-typeable. In this study, ETEC strains ranked second after EPEC [7]. Further, these results showed that with a careful diagnostic surveillance, ETEC can be recognized locally in association with cases of diarrhea, albeit less frequently than the EPEC pathotype. Enteroinvasive E. coli (EIEC) EIEC was initially investigated in cases of childhood diarrhea in 1990 and the study was conducted from 1990 through 1994 and included 224 children with diarrhea. The methodology used included 5 or 10 lactose-positive or negative, lysine-negative colonies per child as potential EIEC isolates. The EIEC “O” antigens were identified with monovalent rabbit antisera (O28ac, O29, O112ac, O121, O124, O135, O136, O143, O144, O152, O159, O164, O167 and O173) produced in the Instituto de Higiene “Arnoldo Berta”. Invasiveness was confirmed in guinea pigs' conjunctiva through the Serény test [11]. Using this methodology, only 2 EIEC strains were recovered and belonging to serogroups O29 and O124. In a later study that included 98 children with acute diarrhea and adopting a more sensitive methodology (PCR for ipaH), no EIEC strains were detected. The same occurred when looking for EIEC strains in children with BD. This data suggest that, similarly to other regions, this pathotype is not common in Uruguay [15]. Enteroaggregative E. coli (EAEC) In Uruguay, the first data for the presence of EAEC strains in children with diarrhea were reported in 2007 [7]. This study included 98 children with acute diarrhea from households of low socioeconomic levels. In this group of children, EAEC ranked third in frequency after EPEC and ETEC. The serogroups of the recovered strains were not established and the role of this pathotype as an agent associated with diarrhea in children living in homes with higher socioeconomic level remains unknown. Clinical Manifestations in Children Infected with DEC Strains It is noteworthy that many of these children have co-infections with different agents (bacteria, viruses, parasites or even with DEC strains of different pathotypes). In the study conducted between 1991 and 1994, it was found that 58 out of 224 children with diarrhea yielded more than one enteropathogen. A similar figure was observed in another study conducted between 1999 and 2001 [7, 11]. It is therefore difficult to analyze the clinical manifestations depending on the agent involved. Regardless, the most important manifestations occur at the gastrointestinal tract and include diarrhea, watery or bloody, vomiting and on some occasions, cramping and abdominal pain. These symptoms may be accompanied by fever, malaise, skin rashes, seizures and more or less serious complications such as dehydration of varying degrees, and in some cases HUS associated with STEC infections [16].

214 Pathogenic Escherichia coli in Latin America

Varela et al.

Clinical Manifestations Associated With EPEC Infections In the study carried out between 1999 and 2001 that included 98 children with acute diarrhea, 80% of those children infected with typical or atypical EPEC were sought for medical attention within 48 hours of the onset of disease, and over 70% of those children presented watery diarrhea. Twenty per cent of the children infected with EPEC showed visible blood in stools and the proportion that developed fever was similar to that found in children infected with Rotavirus and Shigella spp. No children infected with EPEC developed HUS [7]. Most children infected with EPEC strains develop a self-limited disease. However, EPEC strains have been recovered with equal frequency in children with acute or persistent diarrhea from low-income households. Clinical Manifestations Associated With STEC Infections HUS is a relatively common disease in Uruguay, with an estimated annual incidence of 4-5 cases per 100,000 children under 5 years of age. The cases usually occur in the warmer months (spring, summer and autumn), in wellnourished children, from low and acceptable socioeconomic level, sometimes living in small towns. They are usually preceded by BD without the obvious inflammatory component in stools. So far, only sporadic HUS cases have been studied and in none of them it could definitely establish the implicated food source. As a peculiar detail in a HUS case that occurred in a girl from Cerro Largo (see Fig. 1), the parents claimed to have fed her with undercooked “armadillo”(Dasypus novemcinctus) meat, 15 days previous to the onset of HUS [16]. These children are usually sent to the pediatric intensive care centers in Montevideo and most of them (90%) having previously received broad-spectrum antibiotics, which hampers the isolation of STEC strains and other bacterial enteropathogens from the stool samples analyzed. STEC strains can cause BD like in the case of Shigella spp., Salmonella spp., and Campylobacter spp. strains. Within the framework of an institutional program aimed at the regional surveillance of STEC infections, 249 children with BD were analyzed, which required medical attention at health care centers in Montevideo and other cities in Uruguay. The analysis period was from June 2001 to January 2008 and STEC strains were recovered only from 3 children. Two out of these 3 children evolved to HUS and none of the others developed this complication. One of the children that evolved to HUS was co-infected with 2 different STEC strains (O26 and O145 serogroup, see Table 3). As it can be seen, in Uruguay STEC infection represents a small proportion of all acute BD cases (1.2%). However, serious associated complications seem to justify the local importance of searching for this agent. SITUATION IN COLOMBIA Colombia, located at the North-western corner of South America, has 45.6 million inhabitants and 29% of them are less than 15 years of age. Potable water is available to only 77% of the rural population and 96% to the urban population. The diarrheal disease morbidity rate in Colombia is 110 cases per 100,000 inhabitants according to data collected between 1990 and 1998 [17]. Information on the molecular characterization of diarrheagenic E. coli strains associated to pediatric gastrointestinal infections in Colombia is limited. Similarly, information of E. coli contaminants in food products and water is also limited to the identification of plain E. coli strains as a safe indicator. Few studies have recognized the role of pathogenic E. coli in childhood diarrhea. In one study, the definition of pathogenic E. coli was based on detection of serotypes associated to EPEC and STEC [18]. No other E. coli pathotypes were evaluated. Limited information on E. coli pathogens associated to diarrhea in Colombia is explained by the lack of testing methods available at reference laboratories. Most epidemiological data on diarrheal pathogens from developing countries is scattered and generally does not include E. coli as a causative agent. The only method available in most developing nations for detection of bacterial diarrheal pathogens is conventional bacterial culture from stool. This method requires a minimum of 48 h for identification of E. coli and non-E. coli species, and it is unable to discriminate between non-pathogenic and pathogenic E. coli strains. Detection of pathogenic E. coli using PCR is based on amplification of gene targets specific for each pathogenic E. coli. A recent PCR method that uses DNA plasmids as target gene controls, rather than prototype strains, has facilitated systematic detection of these strains in laboratories with limited resources. This method can identify the six pathotypes of E. coli and the five most common non-E. coli enteropathogens [19].

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 215

Studies on E. coli as an Intestinal Pathogen in Children with Diarrhea A two-sample multiplex PCR assay was used to evaluate the prevalence of E. coli intestinal pathogens in Colombia from children with diarrhea [20]. Two Northern Caribbean Colombian cities were selected for the study. Cartagena is a tourist destination and an important industrial city, which has a highly dynamic population. In contrast, Sincelejo is an agricultural city with minimal population movement. In this study, stools specimens were collected from children less than 5 years of age with diarrheal episodes and living in Sincelejo and Cartagena after informed consent was obtained from the parents. All children evaluated at health clinics fulfilled the World Health Organization criteria for acute diarrheal disease. Specimens were identified by age, date, and location. A total of 267 stool samples were collected and processed during a 1-year period from January to November, 2007. Lactosefermenting Gram negative coccobacilli were tested with conventional biochemical assay for identification of E. coli. Among all samples collected, 139 E. coli isolates were recovered, 28 from Cartagena and 111 from Sincelejo. E. coli clinical isolates were processed by a multiplex PCR reaction for identification E. coli pathotypes, namely, EPEC, STEC, EAEC, ETEC, DAEC, and EIEC. Detection of E. coli pathotypes by the two-sample multiplex PCR was carried out [19] and twenty (14.4%) E. coli strains out of 139 clinical isolates were positive for any of the six known E. coli pathotypes associated with diarrhea [20]. This indicates that 14.4% of all E. coli isolates were E. coli intestinal pathotypes, and that 7.5% of all stool samples collected contained an E. coli intestinal pathotypes. The most frequent pathotype was ETEC with 5% of the total number of E. coli isolates studied. Other E. coli pathotypes identified included STEC, EPEC, EAEC, and DAEC (Table 5). Table 5: Distribution of E. coli clinical isolates according to pathotypes host’s age and city of origin in Colombia. Pathotypes

Children’s age < 2 years

STEC EPEC EAEC ETEC DAEC Mix Negative Total

City of origin

> 2 year

Cartagena

Sincelejo

#

%

#

%

#

%

#

%

3 1 2 6 1 3 70 86

3.5 1.2 2.3 6.9 1.2 3.5 81.4 100

2 0 0 1 0 1 49 53

3.8 0 0 1.9 0 1.9 92.5 100

1 1 0 2 0 0 24 28

3.6 3.6 0 7.1 0 0 85.7 100

4 0 2 5 1 4 95 111

3.6 0 1.8 4.5 0.9 3.6 85.6 100

Low numbers of STEC, EPEC, EAEC, and DAEC were identified, and these accounted for less than 7% of the isolates. Furthermore, EPEC and STEC isolates were all atypical as EPEC isolates were only positive for eae and negative for bfpA, and all STEC isolates were positive for stx and negative for eae. STEC strains were positive for either stx1 or stx2, or both. None of the STEC strains identified were positive for serotype O157:H7 according to agglutination testing with anti-O157 or anti-H7 antisera. This data indicates that E. coli pathotypes are circulating in the pediatric population of two Northern Colombian cities and that these isolates may be associated to children with diarrhea [20]. While ETEC was the predominant pathotype, this difference was not statistically significant with respect to children age, city of origin or with respect to the remaining isolates. In both cities the proportion of positive pathotypes was close to 14%. Studies on Food Product Contamination with E. coli Intestinal Pathogens Due to the importance of E. coli pathotypes as etiologic diarrheal agents affecting mainly children less than five years of age and the possible link between diarrhea and contaminated food, a study was carried out to implement molecular and traditional techniques to identify E. coli pathotypes from food products and stools from children with acute diarrhea in Colombia [21]. Between October 2006 and February 2007, 108 stool samples from children with diarrhea attending six hospitals in Colombia were obtained from clinical laboratories. Most samples were obtained from Bogotá (86%) and the remaining from three non-coastal Colombian cities (24%). Among 76 food samples

216 Pathogenic Escherichia coli in Latin America

Varela et al.

collected, 38 corresponded to meat samples from two supermarkets and 38 were vegetable samples (lettuce, spinach) from eight retail markets, in Bogotá. The identification of E. coli strains from clinical and food samples were done by conventional microbiologic techniques. Lactose-fermenting Gram negative coccobacilli were then tested with conventional biochemical assays for identification of E. coli. In this study, a total of 95 samples positive for E. coli from a total of 184 samples were analyzed. Sixty-seven samples positive for E. coli strains were isolated from stools of children with diarrhea, 16 from meat samples and 12 from vegetable samples (Table 6). Table 6: Pathotypic and non-phathotypic E. coli strains among clinical and food products samples in Colombia.

Samples

Children’s stool Vegetable Food Meat product Total Total

Negative for E. coli

Positive for E. coli Positive Pathotype

Negative Pathotype

Total E. coli

Total Samples

No.

%

No.

%

No.

%

No.

%

No.

%

41 26 22 48 89

38.0 68.4 57.9 63.2 48.4

12 3 3 6 18

11.1 7.9 42.1 7.9 9.8

55 9 13 22 77

50.9 23.7 7.9 28.9 41.8

67 12 16 28 95

62.0 31.6 57.1 36.8 51.6

108 38 38 76 184

100 100 100 100 100

A two-sample Multiplex PCR assay was used for identification of E. coli pathotypes among all 184 clinical and food product samples. A total of 18 (9.8%) samples were positive for any of the E. coli pathotypes or positive for any of the virulence factors analyzed, 12 (11.1%) among all clinical isolates and 6 (7.9%) among food product samples. While EPEC was the most common pathotype among all E. coli positive clinical (9.0%) and total samples 6.3%), STEC was more common among E. coli positive food product samples (7.1%). All EPEC strains were positive for eae and negative for bfpA, indicating that they are part of the atypical EPEC category. STEC, ETEC, EAEC and EPEC pathotypes were detected from clinical samples. Only STEC and EAEC were detected from food product samples. These four E. coli pathotypes were also detected in children with diarrhea in the Colombian Caribbean region [20]. They were also reported in the US and other Latin American countries, including Brazil, and Mexico. No DAEC or EIEC pathotypes were detected in this study. This is in contrast with studies done in Mexico, Brazil and countries in Southeast Asia, where these pathotypes are prevalent. DAEC strains were, however, recognized in the Colombian Caribbean region [20], and therefore, more studies will be necessary to determine if other geographic regions in Colombia may be prevalent for DAEC and/or EIEC. The STEC strains detected by the two-sample multiplex PCR were stx positive and eae negative. All STEC detected were stx2 positive and stx1 negative. All STEC strains were negative for O157:H7 according with the BAX- system, indicating that non-O157:H7 STEC serotypes were present in Colombia during the period tested. This is in contrast with the Colombian report published in 1998 indicating that the prevalence of STEC O157:H7 was up to 7.7% in children with diarrhea and that prevalence of cattle positive for STEC O157:H7 was 6.5% [22]. It is plausible to speculate that during the last 10 years, the prevalence of STEC serotypes may have changed and that non-0157:H7 STEC strains may now predominate in Colombia. Two recent and independent studies show that non-O157:H7 STEC, rather than O157:H7 strains, are prevalent in Colombia (17, 20). In Latin America, Argentina is one of the countries that reports high incidence of HUS associated with STEC O157:H7 strains. In this country, O157:H7 has been identified in beef and milk products for human consumption, surface water streams, and bovine feces. While infection may occur by consumption of contaminated food, person to person transmission may also contribute to infection, perhaps through fecal shedding of STEC from children attending day-care centers. While STEC and EAEC strains were isolated from clinical and food products, ETEC and EPEC were only detected in clinical isolates, which suggests that meat and vegetables in retails stores in Colombia may be the source of STEC and EAEC infections in the community. In contrast, ETEC and EPEC infection transmission may be the result of consumption of contaminated water or other food products, not tested in this study, or as a result of person to person transmission. In summary, E. coli diarrheal pathogens are believed to play an important role in the causation of childhood diarrhea in Colombia. Infections may be transmitted by contaminated food products, contaminated water and by person to

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 217

person transmission. More studies using rapid molecular-based detection assays are necessary to evaluate the magnitude of E. coli-associated diarrhea in Colombia. Coordinated efforts on epidemiological surveillance and public health interventions may significantly decrease the morbidity and mortality of childhood diarrhea in Colombia. SITUATION IN PERU Diarrheagenic E. coli pathotypes have been evaluated in studies involving both pediatric and adult populations in Peru using a variety of diagnostic methods (serotyping, tissue culture, ELISA, etc). However, a systematic search for all six currently-recognized diarrheagenic E. coli groups was not done in Peru until the last decade, when new molecular methods made such studies practical. Earlier reports from Peru (without using molecular methods) found, i.e., EPEC prevalence in children to vary from 1 to 28% (Table 7). This variation reflected differences in study populations, age groups, diagnostic criteria, and methods used for diagnosis. Based on molecular methods (intimin gene identification), EPEC is currently responsible for 5−10% of pediatric diarrheal episodes in the developing world. Previously, when diagnosis was made based on the HEp-2 adherence pattern or serotyping, the estimated prevalence rates of EPEC were higher, on average 10−20%, with large variability among studies [23]. Table 7: EPEC prevalence (diagnosis based on non molecular methods) in Peruvian children with diarrhea. Reference

Patient population / Study description

179 children hospitalized with acute diarrhea (3 to 36 months of age). Lactobacillus trial. 135 children hospitalized with acute diarrhea (3 to 35 months of age). Salazar-Lindo, 2000 Racecadotril trial. - 36 children hospitalized with persistent diarrhea (mean age 18 months) Salazar-Lindo, 1998 - 64 children hospitalized with acute diarrhea (mean age 14 months) Acute and persistent diarrhea study. 80 children hospitalized with watery diarrhea (3 to 24 months of age). Castro-Rodriguez, 1997 Osmotic vs secretory diarrhea study. - 107 patients hospitalized with persistent diarrhea (< 1 year of age) Lopez, 1996 - 1325 patients hospitalized with acute diarrhea (< 1 year of age). Acute and persistent diarrhea study. Figueroa-Quintanilla, 275 children hospitalized with acute watery diarrhea (3 to 59 months of age). 1993 Bismuth subsalicylate trial. - 327 samples from children with acute diarrhea - 304 samples from children with persistent diarrhea Lanata, 1992 Longitudinal study of acute and persistent diarrhea in children <3 years of age in peri-urban Lima Salazar-Lindo, 1993 72 children with diarrhea (mean age 10 months). Retinol and diarrhea study. 77 children with acute diarrhea (< 5 years of age). Measles-associated diarrhea Greenberg, 1991 study (controls). 391 children hospitalized with acute diarrhea (< 18 months of age). Pazzaglia, 1991 Aeromonas coinfection study (baseline data). Salazar-Lindo, 2004

EPEC prevalence (%) 15.4 19.3 8.3 1.5 27.8 10.5 10.1 26.9 3.4 4.9 4.2 22.1 11.0

Recently, a multiplex real time PCR (mRT-PCR) was developed for the detection of all 6 diarrheagenic E. coli groups: EPEC, ETEC, EIEC, EAEC, DAEC, and STEC [24].This mRT-PCR is utilized in the Enteric Disease and Nutrition Laboratory at the Tropical Medicine Institute at Universidad Peruana Cayetano Heredia in Lima. The multiplex PCR utilizes fluorescence to determine the melting temperature of each amplicon based on SYBER Green dissociation. The primers were designed to simultaneously detect nine different genes in a single reaction: aggR (EAEC), st1, st2, lt (ETEC), eae (EPEC), eae, stx1, stx2 (STEC), ipaH (EIEC), and daaD (DAEC) [24]. In this assay, five individual lactose positive colonies are randomly selected from MacConkey plates for analysis. To make this assay less expensive for use in developing countries, a method using a pool of 5 colonies rather than individual colonies was developed and validated. The pool analysis has a sensitivity of 98% and a specificity of 100%, at a fifth cost of the individual colony analysis [25].

218 Pathogenic Escherichia coli in Latin America

Varela et al.

The mRT-PCR has been used since 2005 in more than 5000 samples, from children and from several clinical and epidemiological studies, to determine the prevalence of diarrheagenic E. coli in Peru (Table 8). In some cases, E. coli colonies saved on peptone stabs from previous studies were used (Table 8, studies number 1-3) and in other cases there were ongoing studies and, therefore, the diarrheagenic E. coli on fresh MacConkey plates are searched (Table 8, studies 4-8). The prevalence of each pathogen varies depending on the age of the population and the type of study (active vs. passive surveillance and hospital vs. community settings) (Table 9). In children with dehydrating diarrhea (Table 9, study number 3) the most common pathogen was ETEC, responsible for 20.8% of all episodes. In contrast, in children in the community setting with mild and moderate diarrhea, the most common pathogens were EAEC, EPEC and DAEC, although the frequency of each pathogen varied, depending on the age of the population (Fig. 2). In children with bloody diarrhea (Table 9, study number 6), the relative frequency of STEC and EIEC is much higher than studies including both watery and bloody diarrhea. In HIV infected children (Table 9, study number 7), the most common pathogens were EAEC and EPEC [26]. Table 8: Clinical and epidemiological studies in Peruvian children in which diarrheagenic E. coli where diagnosed by molecular methods N

Principal Investigators

Location

Year

Age range

N of children

Study description Cohort study. Active diarrhea surveillance in the community Cohort study. Active diarrhea surveillance in the community (clinical trial) Children hospitalized with dehydration due to acute diarrhea (clinical trial).

1

Lanata CF

Huaraz, Ancash (Andes)

1987

0 – 36m

485

2

Zavaleta N

Villa el Salvador, Lima (Southern Districts)

2004

6m – 18m

313

3

Zavaleta N

Instituto Nacional de Salud del Niño, Lima

2005

4m – 36m

120

20062007

2m – 12m

1034

2008

13m – 20m

529

20072008

0 – 5y

135

20072009

1m – 18y

113

HIV children at the Emergency Room or outpatient clinic

20082009

12m – 24m

350

Cohort study. Active diarrhea surveillance in the community (clinical trial)

4

5 6

7

8

Chrorrillos, Villa el Salvador, Villa Marìa del Ochoa TJ and Triunfo, San Juan de Lanata CF Miraflores, Lima (Southern Districts) Ochoa TJ, Lanata Chorrillos, Lima CF and Huicho L (Southern District) Llanos A, Lee J Hospital Nacional and Lopez F Cayetano Heredia, Lima Instituto Nacional de Medina A, Salud del Niño, Hosp. Rivera P and Nacional Cayetano Romero L. Heredia and Hosp. Nacional Hipolito Unanue Cleary TG, Chea E and Ochoa TJ.

Independencia, Lima (Northern Districts)

Cohort study. Passive diarrhea surveillance in the community Cohort study. Passive diarrhea surveillance in the community Children at the Emergency Room with bloody diarrhea

Table 9: Diarrheagenic E. coli isolated from diarrheal samples in Peruvian children N 1 2 3 4 5 6 7 8

Study (Principal investigators, N° of diarrheal year) samples Lanata, 1987 598 Zavaleta, 2004 556 Zavaleta, 2005 120 Ochoa and Lanata, 2006-7 936 Ochoa, Lanata and Huicho, 2008 193 Llanos, Lee and Lopez, 2007-8 135 Medina, Rivera and Romero, 2007-8. 70 Cleary, Chea and Ochoa, 2008-9 703

DAEC

EAEC

EPEC

ETEC

EIEC

STEC

2.7 8.6 15.0 4.6 2.6 7.4 1.4 2.8

6.2 13.5 5.0 15.1 8.3 5.2 5.7 6.7

2.7 11.0 6.6 7.6 15.6 10.4 5.7 11.1

7.2 7.7 20.8 3.2 14.6 7.4 4.2 8.0

0.2 0.4 0 0 0 9.6 0 0.6

0.5 0.9 0 0.5 0.5 8.9 1.4 0.3

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 219

20

Percentage

15

10

5

0 DAEC

EAEC <6m

EPEC 6m-12m

ETEC

EIEC

13m-20m

Figure 2: Age distribution of diarrheagenig E. coli isolated from Peruvian children* * <6m (n=406), 6m-12m (n=530), 13m-20m (n=193) (samples from studies number 4 and 5, Table 2)

Among samples from healthy children without diarrhea or other gastrointestinal symptoms, the isolation of diarrheagenic E. coli is less frequent than from diarrheal samples. The most common pathogens isolated from such control samples were EAEC (8%-18%) and EPEC (10%-17%), followed by ETEC (1%-9%) and DAEC (2%-3%). The interpretation of pathogen frequency in diarrheal and control samples is complex. Colonization rather than illness results from the complex interaction of several factors including pathogen virulence, the host and the environment. Pathogens within a given pathotype are sometimes heterogeneous in presence and expression of virulence genes, but they share the specific virulence genes used for categorizing them in the group; accessory genes make them more or less virulent. Host susceptibility to infection is determined by the child’s age, presence of protective maternal factors (in young infants breastfeeding and trans-placental antibodies may play a role in protection), nutritional and immunological status, prior exposure and acquired immunity, and genetic susceptibility. Environmental factors, such as poor hygiene and high fecal contamination, result in early and frequent exposure with development of acquired immunity. We hypothesize that the high frequency of pathogens in samples from asymptomatic young children is a reflection of these factors. Several epidemiological studies have compared the isolation rate of diarrheagenic E. coli among diarrhea and control samples, with variable results. The factors mentioned above should be taken into consideration when interpreting and comparing studies. The role of virulence heterogeneity can be demonstrated with EPEC and ETEC. One hundred twenty EPEC strains were evaluated for the eae, bfpA and perA allele types by PCR-restriction fragment length polymorphism (RFLP) (Table 8, study number 4). Atypical EPEC strains (eae+, bfp-) were the most common pathotype in diarrhea (54/74, 73%) and control samples (40/46, 87%). There were 13 eae alleles; the most common were beta (34/120, 28%), theta (24/120, 20%), kappa (14/120, 12%) and mu (8/120, 7%). There were 5 bfpA alleles; the most common were beta1/7 (10/26), alpha3 (7/26) and beta5 (3/26). There were 3 perA alleles: beta (8/16), alpha (7/16) and gamma (1/16). The strains belonged to 36 distinct serogroups, and O55 was the most frequent. The gamma-intimin allele was more frequently found in diarrhea episodes of longer (>7 days) than shorter duration (3/26, 12% vs. 0/48, 0%, p<0.05). The kappa-intimin allele had the highest clinical severity score in comparison to other alleles (p<0.05) [27]. Ninety three ETEC strains were studied for their genotypic and phenotypic characteristics (Table 8, studies numbers 4 and 5). Among diarrhea samples ETEC-LT was the most common type (31/60, 52%), followed by ETEC-ST (15/60, 25%) and ETEC-ST/LT (14/60, 23%). The most common colonization factors (CFs) among diarrhea (58 strains) and control ETEC strains (27 strains), were CS6 (14% and 7%), CS12 (12% and 4%) and CS1 (9% and 4%); CFs were undetected in 47% and 67% of strains, respectively [28]. For those episodes due to a single pathogen (excluding co-infections), DAEC tended to cause longer illness (data from study number 4, Table 8). One fifth of DAEC episodes had blood in the stools and half had fever. The episodes with the maximum number of loose stools per day were with EPEC, ETEC, Campylobacter and rotavirus. Half of the children with ETEC received oral rehydration solutions (ORS), similar to rotavirus cases; however, only the later required intravenous fluids. Episodes due to rotavirus had the highest severity scores, followed by episodes due to mixed infections and EPEC [29].

220 Pathogenic Escherichia coli in Latin America

Varela et al.

STEC were isolated infrequently from children with diarrhea in the community setting (0.5-1%), however, among children with bloody diarrhea at the Emergency Room, STEC was responsible for 9% of all episodes. Most STEC strains isolated from all studies in Peru were stx1 and eae positive. The most common serotype was O26:H11 (7/20, 35%) and other serotypes found were O1:H7, O6:HNT, and O111:HNT. The O157:H7 serotype was found and the phylogenetic group D was the most common among STEC strains (8/18, 44%) [30]. Among diarrheagenic E. coli positive samples, co-infections with other pathogens are more common in diarrhea than in controls (40.1% vs. 15.6%, p<0.001) (data from study number 4, table 8). Mixed infections represent a poorly defined problem in diarrhea epidemiology. With better diagnostics tools, there are more mixed infections being found. This makes it complicated to determine which pathogen is responsible for the disease, or if there is an additive effect of each pathogen present in a co-infection. In this study, mixed infections were common, especially in diarrheal samples that included a diarrheagenic E. coli. Paradoxically, these episodes tended to have a slightly shorter duration but more dehydration occurred, in comparison with episodes due to a single DEC infection. They resembled the clinical course of rotavirus infection in this respect, but for other features (i.e. blood in stools) they were unlike rotavirus [29]. DEC as a group, exhibited high levels of antimicrobial resistance in diarrheal cases to ampicillin-85%, cotrimoxazole-79%, tetracycline-65% and nalidixic acid-28% (data from study number 4, Table 8). Among the individual E. coli groups, DAEC and EAEC exhibited significantly higher frequency of resistance to ampicillin, cotrimoxazole, tetracycline and nalidixic acid, than EPEC and ETEC. Resistance to ampicillin and cotrimoxazole was more frequent in E. coli isolated from diarrheal samples than controls, reflecting the greater antibiotic exposure in patients with gastroenteritis [31]. In summary, DEC as a group is responsible in average for 34% of all diarrhea cases in Peruvian children in Lima. The isolation rate and relative frequency of each pathogen varies depending on the age of the study population and the type and location of the study. The diarrheagenic E. coli isolated form Peruvian children are highly heterogeneous (multiple serotypes, variable virulence genes and polymorphisms). The microbiological laboratories in Peru, as in many countries, only test for some EPEC and ETEC serotypes to detect diarrheagenic E. coli. The development of widely available tests for these pathogens, including molecular diagnostic methods, will be needed for proper diagnosis. Furthermore, national research studies of the epidemiology of diarrheagenic E. coli in Peru must include not just the peri-urban areas of Lima, but also other urban and rural areas inside the country, where the hygiene is not as good and social levels are not as high as in the main city. CONCLUSIONS In these 3 countries, DEC strains are confirmed as common agents associated with infantile diarrhea; both in acute and persistent cases and in community or hospital setting. The relative importance of each pathotype (and its variants) is variable, and may be attributed to different factors such as age of children and socioeconomic level; type of study and laboratory methodology used in each country. However, within DEC group, the ETEC, EPEC (typical and atypical) and EAEC are highlighted by their frequency, while STEC are more associated with more serious processes. There is great variability in the serogroups found, and an important diversity in the genes encoding virulence attributes that define the different diarrheagenic pathotypes. It is evident that more detailed studies of DEC strains are required, mainly those that involved isolates which have animal reservoirs, with the goal to expand local and regional epidemiology. The DEC strains are also a reservoir for transferable antimicrobial resistance genes, therefore it is important the surveillance on this bacterial groups. ACKNOWLEDGEMENTS In Uruguay: María del Pilar Gadea1, María Inés Mota1, Victoria Balseiro1, Sabina González1, Gladys González1, Gabriela Algorta1, Milton Cattáneo2, Alfredo Sirok1, Felipe Schelotto1 (1Departamento de Bacteriología y Virología. Instituto de Higiene “Arnoldo Berta”. Facultad de Medicina. Universidad de la República. Montevideo, Uruguay. 2 Departamento de Ciencias Microbiológicas. Área Bacteriología. Instituto de Patobiología Veterinaria. Facultad de Veterinaria. Universidad de la República. Montevideo, Uruguay).

Diarrheagenic Escherichia coli in Children from Uruguay

Pathogenic Escherichia coli in Latin America 221

In Colombia: Yesenia Romero-Herazo 1,2, Octavio Arzuza2, Maria Consuelo Vanegas-Lopez3, Delfina Urbina4 (1International Enteric Vaccines Research Program, Division of Infectious Diseases, Department of Pediatrics, University of Iowa Children’s Hospital, USA; 2Facultad de Ciencias Exactas y Naturales, Universidad de Cartagena, Colombia; 3Laboratorio de Ecologia de Alimentos, Departamento de Ciencias Biologicas, Universidad de los Andes, Colombia; 4Corporación Para la Investigación Social Educativa, Tecnológica y Contemporánea, Colombia) In Peru: Francesca Barletta1, Carmen Contreras1, Eric Mercado1, Paul Rivera1, Lucie Ecker2, Ana I. Gil2, Nelly Zavaleta2, Eric R. Hall3, Ryan Maves3, Thomas G. Cleary4, Claudio F. Lanata2,5 (1Laboratorio de Enfermedades Entéricas y Nutrición, Instituto de Medicina Tropical, Universidad Peruana Cayetano Heredia, Lima, Perú. 2Instituto de Investigación Nutricional, Lima, Perú. 3Naval Medical Research Center Detachment (NMRCD), Lima, Perú. 4 University of Texas School of Public Health, Houston, USA. 5Universidad Peruana de Ciencias Aplicadas, Lima, Perú). REFERENCES [1] [2] [3] [4] [5] [6] [7]

[8] [9]

[10] [11] [12] [13] [14]

[15] [16] [17] [18] [19]

Boschi-Pinto C, Velebit L, Shibuya K. Estimating child mortality due to diarrhoea in developing countries. Bull World Health Organ. 2008;86:710-7. Kosek M, Bern C, Guerrant RL. The global burden of diarrhoeal disease, as estimated from studies published between 1992 and 2000. Bull WHO. 2003; 81:197-204. O'Ryan M, Prado V, Pickering LK. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis. 2005;16:125-36. Lanata CF, Mendoza W, Black RE. Improving diarrhoea estimates. WHO. 2002. http://www.who.int/child_adolescent_health/documents/pdfs/improving_diarrhoea_estimates.pdf. Accessed 21 April 2009. Nataro JP, Kaper JB. Diarrhoegenic Escherichia coli. Clin. Microbiol. Rev 1998;11:142-201. Ministry of Public Health. http://www.msp.gub.uy/homepidemiologia_198_1.html Varela G, Jasinski C, Gadea P, et al. Escherichia coli enteropatógeno clásico (EPEC) asociado a casos de diarrea en niños usuarios de los servicios de Salud Pública. Aspectos clínicos y características de las cepas involucradas. Rev Med. Urug. 2007;23:153-63. Hortal M, Montano A. Etiología de la diarrea aguda infantil en el Uruguay Rev Med. Uruguay. 1988;4:201-04 Blanco M, Blanco JE, Dahbi G, et al. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (muB and xiR/beta2B). J Med Microbiol. 2006;55:1165–74 Varela G, Chinen I, Gadea P, et al. Detection and characterization of Shiga toxin-producing Escherichia coli from clinical cases and food in Uruguay. Rev Argent Microbiol. 2008;40:93-100. Torres ME, Pírez MC, Schelotto F, et al. Etiology of children's diarrhea in Montevideo, Uruguay: associated pathogens and unusual isolates. J. Clin. Microbiol. 2001;39:2134-39. Vignoli R, Varela G, Mota MI, et al. Enteropathogenic Escherichia coli strains carrying PER-2 and TEM-116 extendedspectrum ß-lactamases isolated from children with diarrhea in Uruguay. J. Clin. Microbiol. 2005;43:2940-43. Schelotto F, Amorin B, Varela G, et al. Síndrome urémico hemolítico en Uruguay y su relación con E. coli VTEC. Montevideo, Uruguay. 1996,123. Blanco JE, Blanco M, Alonso M, et al. Serotypes, virulence genes, and intimin types of Shiga toxin (Verotoxin)-producing Escherichia coli isolates from human patients: Prevalence in Lugo, Spain, from 1992 through 1999. J Clin Microbiol. 2004;42:311-19. Townes JM, Quick R, Gonzáles OY, et al. Etiology of Bloody Diarrhea in Bolivian Children: Implications for Empiric Therapy. J Infect Dis. 1997;175:1527–30. Gadea MP, Varela G, Bernadá M, et al. Primer aislamiento en Uruguay de Escherichia coli productora de toxina Shiga del serotipo O157:H7 en una niña con síndrome urémico hemolítico. Rev Med Uruguay. 2004;20:79-81. Manrique-Abril FG, Tigne y Diane B, Bello SE, et al. Diarrhoea-causing agents in children aged less than five in Tunja, Colombia. Rev Sal Pub. 2006;8:88-97. Urbina D, Arzuza O, Young G, et al. Rotavirus type A and other enteric pathogens in stool samples from children with acute diarrhea on the Colombian northern coast. Int Microbiol. 2003;6:27-32. Gomez-Duarte OG, Bai J, Newell E. Detection of Escherichia coli, Salmonella spp., Shigella spp., Yersinia enterocolitica, Vibrio cholerae, and Campylobacter spp. enteropathogens by 3-reaction multiplex polymerase chain reaction. Diag Microbiol Infect Dis. 2009;63:1-9.

222 Pathogenic Escherichia coli in Latin America

[20]

Varela et al.

Gomez-Duarte OG, Arzuza O, Urbina D, et al. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two caribbean-colombian cities. Food Path Dis. 2010;7:199-206. [21] Rúgeles LC, Bai J, Martínez AJ, et al. Molecular characterization of diarrheagenic Escherichia coli strains from stools samples and food products in Colombia. Int J Food Microbiol. 2010;138:282-86. [22] Mattar S, Vasquez E. Escherichia coli O157:H7 infection in Colombia. Emerg Infect Dis. 1998;4:126-127. [23] Ochoa TJ, Barletta F, Contreras C, et al. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans R Soc Trop Med Hyg. 2008;102:852-6. [24] Guion CE, Ochoa TJ, Walker CM, et al. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR. J Clin Microbiol. 2008;46:1752-7. [25] Barletta F, Ochoa TJ, Ecker L, et al. Validation of five-colony pool analysis using multiplex real-time PCR for detection of diarrheagenic Escherichia coli. J Clin Microbiol. 2009;47:1915-7. [26] Medina A, Rivera FP, Romero LM, et al. Diarrheagenic Escherichia coli in HIV pediatric patients in Lima, Perú. Am J Trop Med Hyg. 2010. In press. [27] Contreras C, Ochoa TJ, Lacher DW, et al. Allelic variability of critical virulence genes (eae, bfpA, and perA) in typical and atypical EPEC in Peruvian children. J Med Microbiol. 2010;59:25-31. [28] Rivera FP, Ochoa TJ, Maves RC, et al. Genotypic and phenotypic characterization of enterotoxigenic Escherichia coli (ETEC) strains isolated from Peruvian children. Submitted to J Clin Micro. [29] Ochoa TJ, Ecker L, Barletta F, et al. Age related susceptibility to infection with diarrheagenic Escherichia coli among infants from periurban areas in Lima, Peru. Clin Infect Dis. 2009;49:1694-702. [30] Contreras CA, Ochoa TJ, Lacher DW, et al. Serotypes, virulence genes, MLST and PFGE patterns of Shiga toxinproducing Escherichia coli (STEC) isolated from Peruvian children. Manuscript in preparation. [31] Ochoa TJ, Ruiz J, Molina M, et al. High frequency of antimicrobial drug resistance of diarrheagenic Escherichia coli in infants in Peru. Am J Trop Med Hyg. 2009;81:296-301.

Pathogenic Escherichia coli in Latin America, 2010, 223-248

223

CHAPTER 15 Escherichia coli Animal Reservoirs, Transmission Route and Animal Disease Antonio F Pestana de Castro1, Adriana Bentancor2, Elsa C Mercado3, Angel Cataldi4 and Alberto E Parma5,* 1

University of São Paulo, Brazil; 2Universidad de Buenos Aires, Argentina; 3Instituto Nacional de Tecnología Agropecuaria (INTA), Argentina; 4INTA-CONICET, Argentina and 5Universidad Nacional del Centro-CICPBA, Argentina Abstract: Pathogenic Escherichia coli comprise several pathotypes which are able to carry out different manifestations in animals and humans. Some strains cause zoonotic diseases, affecting both animals and humans, while others use the animal as a carrier only, becoming pathogenic for it only circumstantially. A greater understanding of the role of reservoirs, virulence characteristics of the E. coli strains they carry, and transmission routes is necessary for developing methods of epidemiology, control and prevent infectious diseases caused by E. coli.

THE CONCEPT OF RESERVOIRS Several, often contradictory definitions of reservoirs can be found in the bibliography. Some imply that a reservoir comprises only one species; others suggest that a reservoir may constitute an ecologic system. That infections in reservoir hosts must always be nonpathogenic is nowadays commonly accepted, but, depending on the microorganism, this concept must be interpreted with care. First it all, we propose that reservoirs can only be understood with reference to defined target populations. Based on this point of view, we define a reservoir as one or more epidemiologically connected populations or environments in which the pathogen can be permanently maintained and replicated, and from which infection is transmitted to the target population. Disappearance of the pathogen in the target population after ring-fencing provides categorical evidence of the existence of a reservoir and its possible identity. Populations in a reservoir may be the same or of a different species than that of the target and may include vector species or transmission routes. Newly emerging diseases usually originate from infection reservoirs in other host species or by changing transmission routes. When a reservoir constitutes a maintenance community and all populations within the maintenance community are directly or indirectly connected to each other, the size of the reservoir has no upper limit. The best first step in identifying a reservoir is often through collecting epidemiological evidence. Antigenic and genetic variation (polymorphism) in pathogens isolated from the target population within the range observed in the reservoir is consistent with reservoir-target transmission. This pattern can be demonstrated by molecular biology or serologic methods. For infection to be controlled and eliminated, disease-control measures must be directed at the reservoir. Thus, an understanding of reservoir infection dynamics is essential [1]. INTRODUCTION TO SHIGA TOXIN-PRODUCING Escherichia coli Shiga toxin-producing Escherichia coli (STEC) produce two potent phage-encoded cytotoxins called Shiga toxins (Stx1 and Stx2). In addition to toxin production, another virulence-associated factor is a protein called intimin which is responsible for intimate attachment of STEC to the intestinal epithelial cells, causing attaching and effacing (A/E) lesions in the intestinal mucosa. Intimin is encoded by the chromosomal gene eae, which is part of a pathogenicity island termed the Locus for Enterocyte Effacement (LEE). A factor that may also affect the virulence of STEC is the *Address correspondence to: Dr Alberto E. Parma, Immunochemistry and Biotechnology Lab., Department of Animal Health and Preventive Medicine, Faculty of Veterinary, University of the Centre of Buenos Aires Province, Pinto 399 (7000) Tandil, Argentina; E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

224 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

enterohemolysin (Ehly), also called enterohemorrhagic E. coli hemolysin (EHEC-HlyA), which is encoded by an ehxA gene in the 60MDa megaplasmid [2, 3]. A new virulence gene, designated saa, is carried on the large plasmid of certain LEE-negative, but not LEE-positive, STEC strains. This gene encodes a novel outer membrane protein which appears to function as an autoagglutinating adhesin [4, 5]. Recently, a subtilase cytotoxin gene [4] was found in Argentine STEC isolates belonging to several serotypes, and this finding confirms once again the great genetic variability of these plasmids [6]. Shiga toxin-producing Escherichia coli (STEC) are responsible for numerous foodand water-borne outbreaks, causing a range of illnesses from non-bloody diarrhea to hemorrhagic colitis (HC) or hemolytic-uremic syndrome (HUS) in humans [7, 8, 9, 10, 11, 12, 13]. In Argentina, the HUS is endemic and constitutes the first cause of acute kidney insufficiency in children, as well as the second cause of chronic kidney insufficiency, and is responsible for 20% of all kidney transplants in children and adolescents [12, 14, 15]. This country holds the highest record of HUS all over the world (400-500 cases/year) [16]. The enterohemorrhagic Escherichia coli (EHEC) O157:H7 serotype has been frequently isolated from HC and HUS cases, by procedures provided by USDA-FSIS based upon the use of selective culture media and anti-O157:H7 antibody-coated magnetic beads [17]. However, it eventually became apparent that isolating E. coli O157:H7 was not possible in many human stool samples in Argentina [Giannantonio, personal communication] [9]. Accordingly, two hypotheses were suggested: i) the bacteria had already been expelled from the digestive tract of those patients at the moment of collecting the stool samples, or ii) patients were targets for another Shiga toxin-producing etiologic agent. To establish a method that would be applicable to all of the stool samples examined, the paradigm was changed and selective pressure was avoided in microbiological isolation. Accordingly, in the course of selectively looking for E. coli O157:H7, samples were screened by polymerase chain reaction (PCR) to detect the presence of any Shiga toxin-gene bearing bacterium, beyond its serotype. Surprisingly, many non-O157:H7 Shiga toxinproducing E. coli were characterized from those stool samples, after samples were found to be negative for O157:H7 following the use of the USDA-FSIS selective procedure [18, 19, 20, 21, 22, 23, 24, 25, 26]. Cattle as Reservoir of STEC Taking into account that Argentinian HUS patients are consumers of bovine derivatives, such as meat and milk, cattle were extensively investigated by PCR as potential reservoirs of STEC starting in the early 90´s. Although HUS was already known in Argentina before, cattle were not studied as a possible carrier of EHEC because, only on rare occasions, were these bacteria shown to be pathogenic for young calves [27]. Actually, the O157:H7 serotype was first isolatedby Villar (INTA, Argentina) in 1977 from a calf with colibacillosis, although this finding was unpublished until 1987 [28], after this serotype was isolated in 1982 from patients with hemorrhagic colitis [29]. This publication was a milestone because it led U.S. researchers to develop methods selectively designed to detect only the O157:H7 serotype, which were quickly adopted by many countries. When changing the procedure toward the screening of stx genes by PCR, many non-O157:H7 serotypes could be identified from the bovine gastrointestinal tract and derivative foods [20, 22, 30]. In Argentina, for example, the serotype O145:H- was firstly isolated from grain-fed cattle by Padola et al. [31]. Later, O145:H- was intensively investigated in stool samples from humans with HC and HUS [15, 32]. The status of the bovine as a reservoir of STEC in Argentina was demonstrated, with a prevalence of 33% for grazing cattle and adults at the slaughterhouse and 62% for grain-fed cattle. The last cattle were sampled every two weeks over a 6-month period. Shedding was found to be intermittent. The serotype, virulence genotype and origin of these isolates are given in Table 1. Many serotypes isolated from grain-fed cattle (O2:H25, O15:H21, O25:H19, O145:H-, O146:H21, O175:H8) also differed from those isolated from grazing animals [30]. Serotypes O15:H21, O25:H19 and O175:H8, harbouring stx2, had not been identified before as belonging to STEC, and the EHEC O120:H19 (stx2) was isolated from cattle for the first time in the world [33]. In 2002, Gioffré et al. [34] evaluated different methodologies to detect STEC in cattle, and they found the method having the highest sensitivity to be one involving plating on selective media after enrichment of the fecal sample, followed by heat-lysis DNA extraction from the confluent growth zone and Stx gene-PCR. In an initial genotyping analysis, the intestinal track of 422 calves was examined for STEC O157:H7 by using conventional plating techniques. One strain isolated from a calf was found to be closely related to 18 strains of

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 225

clinical origin following its comparison by pulsed-field gel electrophoresis, phage typing and PCR-RFLP of stx2 genes with 96 Argentine strains of different origin [35]. Table 1: Serotypes and virulence profile of STEC isolated from cattle and meat in Argentina. Serotype

Origin

stx1

stx2

eae

ehxA

saa

Serotype

Origin

stx1

stx2

eae

ehxA

saa

O2:H5

g

-

+

-

-

-

O111:H-

g

+

-

+

+

-

O2:H25

f

-

+

-

-

-

O113:H21

f, m

-

+

-

-

-

O5:H-

g

+

-

+

+

-

O113:H21

g, m

-

+

-

+

+

O5:H27

g

+

-

-

-

-

O116:H21

g, m

-

+

-

+

+

O8:H16

f, m

+

-

-

-

+

O117:H7

g, f, m

-

+

-

-

-

O8:H19

m

-

+

-

+

-

O118:H16

g

+

-

+

+

-

O15:H21 *

f

-

+

-

-

-

O120:H19

f

-

+

-

+

+

O20:H7

g

+

+

-

-

-

O130:H11

g

+

+

-

+

+

O20:H19

g, f, m

+

+

-

+

+

O139:H2 *

g

-

+

-

-

-

O20:H19

g

+

+

-

-

-

O141:H7

g

+

+

-

+

+

O20:H19

g

-

+

-

+

+

O141:H8

g

-

+

-

+

+

O20:H19

m

-

+

-

-

-

O141:H19 *

g

+

-

-

-

-

O20:H?

g

+

-

-

-

-

O145:H-

f

+

-

+

+

-

O22:H8

m

+

+

-

+

+

O145:H-

f

-

+

+

+

-

O22:H8

m

-

+

-

-

-

O157:H7

f

-

+

+

+

-

O22:H27 *

g

-

+

-

+

+

O157:H7

g

-

+

+

+

-

O25:H19 *

f

-

+

-

-

-

O157:H7

m

-

+

+

+

O26:H11

g

+

-

+

+

-

O162:H7

m

+

-

-

-

-

O26:H11

g

-

+

+

+

-

O165:H-

g

-

+

+

+

-

O38:H39

g

+

-

+

+

-

O165:H42 *

g

+

+

+

+

-

O39:H49

g

+

+

-

+

+

O168:H8

g

-

+

-

-

-

O39:H49

g

-

+

-

+

+

O171:H-

f

-

+

-

-

-

O74:H28

g

-

+

-

+

+

O171:H2

g, f, m

-

+

-

-

-

O79:H19

g

-

+

-

+

+

O174:H21

g

+

+

-

+

+ -

O84:H41 *

g

-

+

-

+

-

O174:H21

f

+

-

-

-

O88:H21

m

+

+

-

+

+

O174:H21

g, f, m

-

+

-

-

-

O91:H21

g, f, m

-

+

-

+

+

O175:H8 *

f

-

+

-

-

-

O103:H-

g

+

+

+

+

-

O177:H-

g

-

+

+

+

-

O103:H-

g

-

+

+

+

-

O178:H19

f

-

+

-

-

-

O103:H2

f

+

+

+

+

-

O178:H19

m

-

+

-

+

+

(*) New STEC serotypes; g: grazing cattle; f: cattle in feedlot; m: minced meat or hamburger.

The prevalence of STEC was established in 200 Argentine healthy young beef steers grown under local production systems, and the STEC strains isolated were examined in regard to their phenotypic and genotypic characteristics. Stool samples and rectal swabs were taken at the slaughterhouse and, by using PCR, stx gene sequences were detected in 69% of the samples. Eighty-six STEC strains were isolated from 39% of the animals, and the main serogroups identified were O8 (16 strains), O113 (14), O103 (5), O91 (4), O171 (3), and O174 (3), and E. coli O157:H7 was found in one animal [36]. Other work demonstrated that STEC strains were associated with diarrhea in calves. Most of these strains carried the stx1 and eae genes [37] (Table 2). Further work indicated that E. coli O157:H7 producing Stx2 and Stx2c, and harboring eae and ehxA genes, is the most common serotype causing HUS in Buenos Aires and Mendoza provinces. Human risk factors to HUS were also assessed in this work [16]. In one of the earliest studies of the genetic characterization of STEC from cattle in Latin America, Borie et al. [38] found in Chile that 34.5% of animals carried STEC and that 18 out of 48 isolates belonged to serogroups O157, O26 and O111. The stx1 gene was identified in 60.4% of animals. In Mexico, Callaway et al. [39] determined the prevalence of E. coli O157 in cattle and swine by immunomagnetic separation (IMS). The prevalence of E. coli O157 was found to be only 1.25% on cattle farms and 2.1% on swine farms. The authors concluded that the

226 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

prevalence in cattle in this study is lower than that reported in the United States, and could be related to the lower prevalence of E. coli O157 reported in humans in Mexico. In Guadalajara, Mexico, beef carcasses were assayed for STEC by selective enrichment culture and IMS-PCR. Five percent of the carcasses were positive for non-motile E. coli O157 and 2.7% for E. coli O157:H7 [40]. Table 2: Phenotypic and genotypic characteristics of STEC isolated from 100 diarrheic calves in Argentina, 2003. Farm

Location

A

Balcarce

B C D

Navarro Navarro Olavarría

Animal 1 2 3 4 5 6 7 8 9

E F

30 de Agosto Trenque Lauquen

10 11 12

Straina 97/12A 97/22A 97/23A 98/228-3 98/299-2 98/345-7 98/345-9 98/345-11 98/345-12 98/345-18 98/345-19 98/345-23 98/363-30 99/178-18 97/16 A

stx stx2 stx1-stx2 stx2 stx1-stx2 stx1 stx1 stx1 stx2 stx1 stx1 stx1 stx1 stx1 stx1-stx2 stx1

eae

ehxA

+ + + + + + + + + + + + -

+ + + + + + + + + + + + + + -

Serotype O26:H11 O5:HO26:H11 O5:HO111:HO5:HO111:HO26:H11 O159:H? O26:HO26:H11 O153:H? O5:HO123:H38 ONTb:H-

Urease

HEp-2 Adherence

+ + + + + +

LAc LA LA NAd DAe LA LA LA NA LA LA NA LA LA NA

a

All strains were bfpA negative. Not typeable. c Localized adherence. d Non-adherent. b

A cross-sectional study determined the prevalence of STEC on 25 dairy farms in Trinidad, where researchers detected STEC strains by using a Vero cell cytotoxicity assay in 16.6% of cows, 14.6% of calves, and 3.6% of bulk milk samples [41]. In Brazil, cattle are also known to be typical carriers of STEC/EHEC pathotypes. Calves are usually severely affected by enterotoxigenic E. coli (ETEC), but the disease is self-limited and rarely found in calves more than one month old. Older bovine are usually STEC carriers [42, 43]. Although there are some discrepancies in the literature, these animals did not show symptoms of diarrhea. Interestingly, examination of their stools revealed that they could be carriers of more than one serotype, and the diversity among the isolates was large. Further, several STEC and EHEC of serotype O111:H8 were detected by PCR with primers directed to rfbO111 [43]. However, in spite of the use of rfbO157 for PCR reactions, no strain of this serotype could be detected. To determine the occurrence, serotypes and virulence markers of STEC strains, 546 fecal samples from 264 diarrheic calves and 282 healthy calves in beef farms in São Paulo, Brazil, were screened by PCR. STEC were isolated in 10% of the 546 animals. Although the IMS test was used, the STEC serotype O157:H7 was not detected. The most frequent serotypes among STEC strains were O7:H10, O22:H16, O111:H-, O119:H- and O174:H21. In this study, serotypes not previously reported were found among STEC strains: O7:H7, O7:H10, O48:H7, O111:H19, O123:H2, O132:H51, O173:H-, and O175:H49. The eae gene was detected in 25% of the STEC strains, and the intimin type θ/γ2 was the most frequently found. The enterohemolysin (ehxA) gene was detected in 51% of the STEC strains, while STEC autoagglutinating adhesin (saa) gene was detected only in those STEC strains negative for the eae gene. These findings showed that cattle in Brazil are not only a reservoir of STEC, but also a potential source of human infection, because the researchers isolated from cattle’s stools important STEC serotypes, previously described and associated with severe diseases in humans, such as O111:H-, O113:H21, O118:H16, and O174:H21 [43]. Recently, another study was carried out in Argentine dairy farms. The prevalence of STEC O157 in dairy cows and calves was 0.2% and 0.8%, respectively, and all isolates harbored a stx2, eae, ehxA virulence pattern. However,

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 227

37.5% of milking cows and 43% of calves were shedding STEC, which indicated the high prevalence of non-O157 serogroups, particularly EHEC O130:H11 and O178:H19 in dairy cattle [44, 45]. The percentage of positive cows in each season was: 22% in autumn, 28% in winter, 44% in spring, and 56% in summer, with a decrease again the following winter. These values were higher than those found in some countries, such as The Netherlands (8.8% to 22.4%) [46], Australia (16.7%) [47] and USA (8%) [48]. However, there are countries with a higher prevalence, such as Switzerland (44.3%) [49], Canada (64.1%) [50], Brazil (52%-82%) [51, 52, 53] and in France, where the prevalence was similar to that in the preceding countries [54]. Recently, Fernández et al. [55] isolated from grazing dairy cattle five new STEC serotypes: O22:H27 (stx2, ehxA, saa), O84:H41 (stx2, ehxA), O139:H2 (stx2), O141:H19 (stx1), and O165:H42 (stx1, stx2, eae, ehxA). Calves from dairy farms are colonized by STEC as early as a week after birth. Interestingly, the number of dairy cows carrying stx2+ STEC showed a seasonal variation, increasing noticeably during the warm seasons [56]. The specific reasons for these fluctuations were not identified. However, seasonal differences in diet and handling of animals could have an impact on the selection of strains with varying abilities to cause human disease. In addition, sequences of these genes are located in mobile genetic elements and may have different patterns of mobility [57]. Many isolates from minced meat and hamburgers and carrying an EHEC virulence genotype shared their serotypes with STEC isolated from grazing cattle, grain-fed cattle and cattle at slaughter houses in Argentina (Table 1) [30, 31, 33, 58]. The prevalence of STEC in hamburgers and minced meat reached values of around 33% and is indicative of one of the main routes of transmission to man. The STEC O8:H19 serotype (stx2, ehxA) was isolated from soft cheese [59] after this food had passed microbiological quality controls for coliform counts. In 2000, 279 meat samples were collected from 136 retail stores in Gualeguaychú, Argentina. Samples were assayed for E. coli O157:H7 by selective enrichment and immunomagnetic separation (IMS). E. coli O157:H7 isolates were detected in 3.8% of ground beef samples, in 4.8% fresh sausages, and in 3.3% dry sausages. All isolates harbored both eae and ehxA genes. Pulse-field gel electrophoresis (PFGE) revealed that some of the isolates from different stores presented a high clonal relatedness and harbored virulence factors associated with human illness [60]. Oteiza et al. [61] analyzed morcillas (a typical Argentine sausage) and found STEC in 3% of the samples. Two strains were characterized as E. coli O157:H7 stx2+stx2vh-a/eae/ehxA. Beef samples from retail outlets and milk samples from bulk tanks were analyzed by selective enrichment and immunomagnetic separation. E. coli O157:H7 stx2, eae and ehxA-positive strains were isolated from 1.2% beef samples. However, milk samples were negative for STEC O157 [62]. In Uruguay, STEC was detected in ground meat [63] and inspected meat samples exported from Uruguay to the USA [64]. Non-O157 STEC was isolated from food in Chile [65]. In 1999, Rios et al. [66] performed genotyping of STEC strains from humans, food and animals and concluded that several different EHEC clones circulate in Chile and that pigs are an important animal reservoir for human infections by EHEC. In Peru, E. coli O157 was tested for in various food samples [67], and the researchers found E. coli O157in 23 of 102 ground beef samples; 15 of 102 beef samples; eight of 102 soft cheeses and four of 101 fresh vegetables. Moreover, 82% of these isolates carried the stx2 gene. Martínez et al. [68] in Colombia tested several food samples for STEC and found these isolates in only 6% of minced beef samples. In addition, E. coli O157:H7 was isolated from chicken giblets and raw milk in Costa Rica [69]. The same group analyzed the persistance of E. coli O157 in different foods [70] and how it is affected by storage temperature [71]. Finally, Alvarado-Casillas et al. [72] searched in Mexico for better sanitizing procedures to control E. coli O157. Several promising attempts are being carried out to control STEC in reservoirs, including one based on the use of probiotic E. coli, which have been demonstrated to compete successfully with O157:H7 and several non-O157 strains for colonizing the bovine digestive track, thus limiting the contamination of carcasses at slaughter and, subsequently, the contamination of foods and the transfer of this pathogen to man [73]. This study was also carried out ex vivo, with the aim to study whether probiotic E. coli inhibits the adhesion of E. coli O157:H7 in bovine colon explants. Explants were inoculated with 2x107 CFU of E. coli O157:H7-NalR and probiotic E. coli-NalR alone and in a mixture of both. Bacteria cultures were applied to the mucosal surface and incubated for 6 h. After incubation, explants were studied by culturing the bacteria and performing an immunohistochemical assay with anti-E. coli O157 serum. The explants inoculated only with pathogenic bacteria showed E. coli O157-positive adherent bacteria

228 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

on the surface epithelium. In the explants inoculated with both kinds of bacteria, it was not possible to detect adherent bacteria to the epithelium [74]. Ovine as Reservoirs of STEC There is mounting evidence that STEC serotypes that commonly inhabit the gastrointestinal tract of sheep are rarely isolated from other hosts [75, 76, 77, 78, 79, 80, 81, 82]. For example, STEC strains of serotype O5:H- are predominantly isolated from sheep and rarely from cattle, showing different genetic profiles among the species, and suggesting the existence of different clonal populations of O5:H-. Previous studies conducted in Brazil have demonstrated the occurrence in sheep of distinct strains from different farms [83]. These data suggest that sheep are the reservoirs of STEC strains belonging to a limited collection of serotypes, a subset of which might be capable of causing serious human disease. The results of the present research reinforce the fact that STEC occurring in single populations of sheep are epidemiologically related despite their virulence diversity. Pigs as Reservoirs of STEC The presence of STEC was also studied in 28 piggeries from the central and northeast region of Argentina [84]. Samples were taken by rectal swabs from healthy piglets and those with diarrhea and their dams. No many animals harbored pure STEC strains; the majority of them corresponded to the STEC-ETEC pathotype, with those carrying the stx2e, stIa, stb, ltI genes predominating. The stx2e variant is related to diseases causing edema and delayed growth in piglets. The serogroups corresponding to this genotype were O8, O138, O139. One isolate corresponding to the O64 serogroup showed the virulence profile stx1 stx2. Autochthonous and Exotic Wild Animals as Reservoirs of STEC In Argentina, STEC strains (stx1, stx2, st1/stx2) were isolated from autochthonous animals: guanaco, llama, red deer, vicuña and from exotic species in the Mendoza Zoo: arrui, Somali sheep, Nilghai antelopes, water antelopes, and camels. STEC were isolated in guanacos on the cordillera of the Andes at heights of 4000 meters [85] and in the Pampa plains [86]. Also, Leotta et al. [87] established the frequency of STEC in non-domestic mammals in the Zoo Garden of La Plata, Argentina. stx gene sequences were detected by PCR in 50.8% of fecal samples, and 25 STEC strains were isolated from 38.5% of the animals. Additionally, 11 species were recognized as new STEC carriers. STEC strains belonged to 7 different serotypes, including some new serotypes, and the most frequent Shiga toxins identified were type 1c and type 2c. Adesiyun [88] tested free-ranging and captive mammalian and avian wildlife in Trinidad and Tobago and found no evidences of the presence of E. coli O157. The fact that wild life species can be a reservoir of STEC presents an additional risk for public health authorities, since it contributes to the spread of STEC to the soil, streams and the environment in general. Pets as Reservoirs of STEC E. coli is an important constituent of the intestinal microbiota of dogs and cats, and it involves, among others, STEC strains [89]. STEC or EHEC strains isolated from dogs and cats have been poorly documented. Sporadic research concerning these species has been done to understand their role in the epidemiological chain. There are many references to the prevalence in pets from different places with different methods of diagnosis [90]. Sample size, sample type (feces or rectal swab) and population under study are all important factors for understanding research results. Sampling by rectal swab is related to bacterial colonization, as sampling in feces is related to recently eaten food which has been contaminated [91]. The occasional isolation of STEC from feces in healthy dogs was reported in different countries, with a prevalence of 3.2%, 4%, 4.8% and 12.3%. However, in diarrheic dogs, the same authors didn’t find differences and others showed a scaling up in the number of STEC carriers [92]. Studies in Germany have reported a prevalence of around 4% and 14% in healthy and symptomatic pets, respectively [75]. The isolation in a dog of STEC O157:H7 [93] and a clinical case in a dog associated with HUS symptoms [94] have also been reported, although in the latter it is not clear whether the strain isolated was actually STEC.

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 229

Sancak [95] showed differences in the level of isolation from dogs with acute diarrhea (24.6%) or chronic diarrhea (28%) compared with household dogs in which STEC prevalence is 6% or kennel dogs in which STEC was not found. In healthy cats from Germany, the prevalence was defined as 13.8% [75]. In another study, isolated STEC strains were found in only 0.5% of cats with gastroenteritis [96]. On the other hand, data from Ontario showed no significant differences between cats with or without diarrhea. The eventual role of dogs and cats as reservoirs of STEC is currently under investigation and has not been totally elucidated. Many authors have demonstrated the presence of STEC in the feces of domestic pets [75, 89, 93, 94, 95, 97-100], but little information regarding virulence properties of these strains is available. The relationship between humans and domestic animals in the city of Buenos Aires, Argentina, has been studied by means of surveys. These have established that about 34% of the households own some kind of domestic animal. From these, 95% have one or more dogs and 14% have one or more cats. It has also been determined that 28% of these households are homes with children under 12 years of age [101]. STEC isolated from pets in Buenos Aires city, all of them harboring the stx2 sequence, were recovered from 1.1% (5/450) of the dogs. The main serotype of these isolates was O178:H19, followed by serotypes O91:H16, O91:H21, O157:H- and ONT:H19. Except for one isolate belonging to O178:H19, the remaining STEC isolates were devoid of the eae sequence. In dogs, the risk-factor analysis of transmission of this pathogen was investigated [102]. Out of the 450 dogs screened, 373 were healthy, 4 of them (1.1%) were stx+, while 1 of 29 (3.4%) dogs with diarrhea was infected. No significant difference related to diarrhea (P>0.05) was seen in the animals carrying E. coli isolates harboring stx2 (STEC) sequences. Statistical analysis of 12 parameters revealed several risk-factors for the presence of STEC: increases in carriers were observed in puppies up to two years old and increases were found in association with springtime. Males showed more positive results than females. With respect to habitat, a high proportion of household dogs living outdoors were infected, and dogs that cohabited with other pets increased the STEC carrier risk. In cats, the prevalence of the STEC strains carrying the stx2 sequence was (4/149); all of them were eae− belonging to serotypes O22:H8 (H-), ONT:H8 and ONT:H19. The risk-factor analysis of transmission of this pathogen in this species was also investigated. In the same survey, out of 149 sampled, 113 were healthy cats, and 4 of them (2.7%) were stx+. Carriers were detected only in the Spring. Kittens of up to one year of age exhibited significant differences with high STEC carrier results, and the female was the most prevalent sex. Similar to household dogs, the household cats living outdoors had a high risk of infection, and cohabitation with other pets increased the number of STEC carriers [102]. According to the Fisher test, no significant differences were seen in the prevalence of STEC in dogs and cats. Using a previously published PCR multiplex assay [103] for screening for stx genes, and using bacterial growth from the confluence zone as a template, as few as 20 CFU were detected in rectal swabs of dogs. The efficiency of the isolation of strains from samples with a presumptive positive diagnosis was about one-third. Although the number of CFUs evaluated was up to 300 CFUs in positive samples, a diagnosis of certainty by isolation was not reached in two-thirds of the samples [98]. Thus, the efficiency of the isolation was smaller in this study than in the other groups observed in cattle [31, 34, 104]. When performing the screening on asymptomatic animals or healthy animals, the relative load can be reduced. In this case, the possibility of recovering positive colonies decreases. On the other hand, the microbiota of monogastrics is different than that in ruminants; probably monogastric microbiota is more competitive in relation to STEC. Both dogs and cats are domestic animals that have lived together with humans in a close relationship for thousands of years and, consequently, there is a high probability of transmission of microorganisms among these hosts [96]. The feeding of these pets in Argentina includes (always or sporadically) raw meat, and there are no nutritional

230 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

restrictions that could determine a feeding change. The presence or absence of intimin in strains from the same swab sample means that the ecological niche is shared by different types of E. coli. The findings tended to demonstrate that STEC strains circulated among pets with a low load. Interestingly, the prevalence in pets did not present higher values than those registered for European regions, where the incidence of HUS was much lower. There were household pets related to sporadic cases of HUS in Buenos Aires. Preliminary research of rectal swab samples from 36 dogs and 20 cats associated with 15 sporadic cases of HUS reported in Buenos Aires during the period 2005-2008, showed a deviation in relation with the prevalence estimated in the same geographical area. Screening for stx1/stx2 and rfb0157 was done by multiplex PCR. STEC isolates were further characterized by biochemical tests and serotyped by standard methods. Screening for STEC was positive in three dogs (8.3%) and two cats (10%). The two STEC strains isolated from dogs belonged to the serotype O178:H19, one of them exhibited the genetic profile stx2c (vh-a) and the other stx2c (vh-b), and both were eae− and ehxA−. One STEC strain recovered from a cat belonged to the serotype O145:H- with the profile stx2 (vh2) ehxA+ and eae+. The isolation of a STEC strain of the serotype O145:H- from a household cat, exhibiting the same serological and virulence profile of regional strains associated with HUS, showed the important role pets could play in the epidemiology of HUS [105, 106]. The existence of these strains of common circulation to humans and animals suggests the need for actions in the field of sanitation guidelines, to encourage pet owners to adopt hygienic measures that could contribute to the control of the disease. In Brazil, a total of 92 E. coli strains were isolated from the 25 diarrheic dogs, and all of them were investigated for the presence of Stx genes (stx 1 and stx2) by PCR. Twelve (13.0%) of the strains carried the stx gene; seven (7.6%) carried only the stx1 gene, five (5.4%) the stx2 gene, and none carried both genes. All isolated STEC strains were tested by using the O157 latex agglutination test kit; non-O157 was detected in the isolated strains [107]. The occurrence of stx genes (40.0%) among E. coli samples from diarrheic animals in this study are in accordance with the results on the same subject reported by Hammermuler et al. [108] (44.4%, with the presence of stx1 or stx2 genes alone, among STEC strains). However, it is noteworthy that Nakazato et al. [109], in Brazil, did not find STEC strains carrying stx 1 or stx 2 genes among 146 diarrheic and 36 healthy dogs examined. Paula and Marin [107] also could find among 12 STEC isolates, seven (58%) presenting a multi-drug resistant (MDR) phenotype to four or more antimicrobial drugs. The carrying of MDR E. coli by dogs represents a potential hazard for Brazilian people having contact with such animals, running the risk of spreading resistance genes. INTRODUCTION TO ENTEROTOXIGENIC ESCHERICHIA COLI Enterotoxigenic Escherichia coli (ETEC) are a group of pathogenic E. coli strains that produce watery diarrhea in humans and in some domestic animals. ETEC is a major agent of human diarrhea in children and in travelers to developing countries. In some regions of the world, i.e. Egypt and Bangladesh, ETEC strains are the first cause of diarrhea in young children. ETEC strains are also routinely isolated from cases of diarrheal disease occurring in neonatal and post-weaning pigs and neonatal calves. ETEC in Humans, Cattle, Pigs and Sea Foods Diarrheal diseases account for significant losses to producers worldwide. ETEC, first described by Sack in 1971 [110], is characterized by possessing genes encoding for one or both defined groups of enterotoxins: heat stable (ST) and heat labile (LT). There are two major types of non-related STs, STa (18- or 19-amino acid peptide) and STb (48-amino acid peptide) [111]. In addition, two variants of STa, designated STp (ST porcine or STIa) and STh (ST human or STIb), were initially identified in strains isolated from pigs or humans, respectively. Both variants can be found in human ETEC strains. STb is associated primarily with ETEC strains isolated from pigs. ETEC strains may also express any of the two major serogroups of LT toxins, LT-I or LT-II. LTs are oligomeric toxins highly related to cholera toxin [111], but are non-immunologically related. Only variants of LT-I have been associated with human or animal disease. ETEC strains comprise various types of O serogroups, and the preferred host is dictated by the presence of specific colonization factors. Both, the enterotoxins and the colonization factors, are plasmid-encoded. In spite of the existence of several O serogroups in the ETEC group, an association of colonization factors and serogroups has been

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 231

observed. F4 (K88), F5 (K99), F6 (987P) and F18 adhesins bind specifically to intestinal cells of different animal species. This host tissue specific adhesion makes it difficult for the animal ETEC strains to cause infection in humans. In consequence, ETEC is not considered a zoonotic pathogen. Initial studies in Argentina failed to identify in diarrheic calves E. coli strains with F5, ST and LT virulence factors [112]. A later study in 1990 [113] did not report finding ETEC in any of the fecal samples from 452 diarrheic calves. In another survey published in 1992, ETEC was [114] found in 1.5% of calf fecal samples. The presence of ETEC in pigs was evaluated from 1992 to 1997 in another study [84], and the STIa gene was detected in E. coli strains isolated from 21% piglets with diarrhea and LTI in 3.1% of the pigs. No toxin gene was amplified from E. coli strains isolated from either healthy piglets or their dams. Serogroup O64 appears to be a prevalent ETEC for pigs in Argentina [84], while it is an uncommon serogroup associated with non-toxigenic E. coli in Spain [115]. Mercado et al. [116] also failed to detect ETEC strains in specimens from 100 diarrheic or septicemic calves and 27 older cattle from outbreaks or individual cases submitted for laboratory diagnosis in Buenos Aires province, Argentina. In Brazil, ETEC investigations started as early as 1987, when different tests were compared to detect LT [117]. An adhesion factor from porcine ETEC, F42 was identified and biochemically characterized by Leite et al. [118]. In another study, 300 pigs with diarrhea, housed in farms located in the State of Sao Paulo, were investigated for the colonization of pathogenic E. coli strains, and 24 E. coli strains were found to produce enterotoxin STb, 5, LT, and 3, STa [119]. That work also showed the possible existence of a new E. coli colonization factor other than F4, F5 and F6, participating in colibacillosis provoked by E. coli in pigs. Silva et al. [120] found that 7.1% of all diarrheagenic strains isolated from urban pigeons belonged to the ETEC pathotype. A Bolivian-Japanese [121] consortium identified ETEC strains among other enteropathogenic bacteria in the water of La Paz River, Bolivia. Surprisingly, this is the only publication about contaminated fresh water in the region, in contrast to the Asiatic region, where many surveys focused on this problem [122, 123]. Peruvian researchers, analyzing Brazilian sea food samples, found a very low incidence of ETEC strains [124]. In another work, 32 E. coli strains were isolated from sea food. A total of 14 strains produced exotoxins, of which seven were LT and the other seven ST [125]. Ingestion of parsley was associated with an ETEC outbreak in Baja California, Mexico [126]. In Chile, a group [127] demonstrated in 1995 that the oral inoculation of calves with ETEC carrying a K99 pilus generated specific antibodies, but these antibodies did not neutralize the binding of the pilus to the bovine intestinal mucosa. An experimental vaccine combining ETEC and STEC bacteria was prepared in Corrientes, Argentina in 1999 [128]. A protection rate of 85% was obtained in vaccinated animals in mouse protection assays; unfortunately, this work did not have a continuation. INTRODUCTION TO EXTRAINTESTINAL PATHOGENIC ESCHERICHIA COLI Extraintestinal pathogenic E. coli (ExPEC) is a category of E. coli strains capable of causing disease outside of the intestine. In addition to human illness, ExPEC strains also cause extraintestinal infections in domestic animals and pets. It has been shown that ExPEC strains isolated from humans and animals share virulence traits and phylogenetic similarities. According to the definition of Johnson et al. [129], ExPEC strains contain at least two of the following virulence factors: P and S/F1 fimbriae, Afa-family adhesins, aerobactin siderophore and group 2 capsular polysaccharide antigens, besides numerous other putative virulence traits [130]. The ExPEC category also includes previously recognized groups of human and animal pathogenic E. coli strains, such as necrotoxigenic E. coli (NTEC), newborn meningitis-associated E. coli (NMEC), septicemic E. coli, avian pathogenic E. coli (APEC) and uropathogenic E. coli (UPEC). ExPEC in Human and Animal Species APEC is associated mainly with extraintestinal infections, principally of the respiratory tract, and systemic infections, both of which are principal causes of morbidity and mortality in chickens and turkeys, and are responsible for high economic losses in the world´s poultry industry. Swollen head syndrome (SHS) is a disease of

232 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

domestic poultry caused by a combination of a pneumovirus and adventitious bacteria, usually E. coli. Clinically, the disease occurs in broiler breeders causing swelling of the periorbital and infraorbital sinuses and submandibular edema. Young birds also showed signs of severe respiratory disease. Several studies were conducted in Brazil to determine the presence of E. coli virulence factors recovered from SHS in chickens. Parreira et al. [131], studying 50 SHS E. coli strains found that none of them agglutinated with antisera to adhesins K88, K99, F42, 987P and 2134P, and only 14% of strains agglutinated with antiserum to F41. Colicin V was produced by 78% of the E. coli strains and 80% produced aerobactin. In the serum resistance test, 36 (72%) of the strains showed resistance to normal chicken serum. Only seven (14%) strains expressed K1 capsular antigen, while motility was found in 62% of the strains. Efforts to define the SHS E. coli pathotype have shown that most SHS E. coli isolates have cytotoxic and lethal activities. Parreira and Yano [132] described for the first time a novel verocytotoxin named VT2y (Stx2y), which belongs to the STx family, and is produced by E. coli isolated from domestic poultry with SHS. The cytotoxic effect was neutralized by antiserum against Stx2, but not by antiserum against Stx1. The Stx2y toxin induced apoptosis in Vero, HeLa, CHO, CEF (primary chicken embryo fibroblast) and PCK (primary chicken kidney) cell lines, but was not lethal to mice [133]. Salvadori et al. [134] also investigated whether E. coli isolated from chickens with SHS produces a factor that is lethal to mice. They detected a lethal toxin similar to Bacillus cereus lethal toxin in the culture supernatants of E. coli strains, which killed mice within 10 min, and were not cytotoxic to Vero cells. In turn, Parreira and Gyles [135] demonstrated that SHS isolates were positive for the stx1 gene but had low titers for cytotoxicity in the Vero cell assay. The stx1 gene from one SHS E. coli isolate was cloned and sequenced and shown to be identical to that of the stx gene of S. dysenteriae. Cytotoxicity was also observed with supernatants, from the 30 avian pathogenic E. coli strains isolated from cellulitis lesions in chickens, avian septicemia and SHS, on two primary chicken cell lines (CEF and PCK) [136]. The cytotoxic effect, which was observed as early as 2 h after exposure of the cells, was maximal at 6 h and was evident as vacuolation, morphologically indistinguishable from that previously reported for culture supernatants of Helicobacter pylori. Supernatants of two vacuolating cytotoxinpositive cultures of H. pylori failed to induce vacuolation of the CEF and PCK cells, but caused the characteristic vacuolation in HeLa and Vero cells. The observations suggest that avian pathogenic E. coli produce a cytotoxin that is similar to the cytotoxin of H. pylori but may be specific for avian cells. An APEC strain designated SHS4, isolated from a chicken with clinical signs of SHS, adhered to but did not invade HEp-2 and tracheal epithelial cells. The strain harbored a 60MDa plasmid encoding adhesion genes, which may be responsible for the initial colonization of the upper respiratory tract of chickens [137]. In other work, Dias da Silveira et al. [138] found that colicin was characteristically produced by SHS E. coli strains, but failed to demonstrate a correlation between serotype, adhesion and invasion of in vitro cultured cells and hemagglutination patterns. Early work with avian septicemic E. coli isolates characterized a reduced number of strains with respect to their pathogenic phenotype [139]. They concluded that the adherence to and the invasiveness of HeLa cells were not related to the pathogenicity of these strains for chickens. Toxin production was correlated with the highest levels of pathogenicity. Some of the strains had mannose-resistant fimbriae. On the contrary, Vidotto et al. [140] examined a total of 45 E. coli isolates from chickens with colisepticemia and concluded that the characteristics exhibited by virulent strains were invasion for HeLa and chicken fibroblast cells, serum resistance, colicin V, and aerobactin production. None of the isolates were toxigenic or positive in hemagglutination tests. In order to detect phenotypic characteristics associated with pathogenicity, 25 E. coli strains isolated from clinical cases of colisepticemia in broiler chickens were studied by Ramirez Santoyo et al. [141]. Colicinogenicity occurred in 72% of the strains, 56% of all strains produced colicin V, 84% were positive for type 1 fimbriae, and 80% were positive for motility. None of the strains had hemolytic activity; however, all of them expressed at least one of the other characteristics studied. Sixty-three E. coli strains isolated from broilers with respiratory problems were examined for virulence factors by da Rocha et al. [142]. Interestingly, colicin production was observed in 55 (87.3%) of the strains, and 41.8% presented colicin V production, and 88.9% presented serum resistance, where as the operon pap was detected in 84.5% of the samples. The diversity of phenotypes detected in these studies partially explains the multifactorial nature of avian colisepticemia. A study of virulence-associated genes in 200 E. coli isolates from poultry with colibacillosis [143] examined the presence of 16 putative virulence genes by PCR. The seven virulence genes iutA, iss, cvaC, tsh, papC, papG and

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 233

felA were detected significantly more often among colibacillosis isolates than in fecal isolates from healthy birds, thereby confirming their worldwide occurrence and possible pathogenic role in colibacillosis. However, several of those genes were not detected in many colibacillosis isolates, and none were detected in 27.5% of those isolates, which points up the need for a search for variants of those genes, as well as yet undetected virulence factors. By colony hybridization, Vidotto et al. [144] demonstrated that sfaDE and facA are present in 40% and 30% of those isolates, respectively. Delicato et al. [145] also demonstrated the high frequency of the gene encoding the hemagglutinin Tsh among 305 avian pathogenic E. coli isolates in Brazil. Many of these results were in accordance with a recent study of Johnson et al. [146]. A large collection of avian E. coli isolates of known pathogenicity and serogroup were subjected to virulence genotyping and phylogenetic typing. Five genes carried by plasmids were identified as being the most significantly associated with highly pathogenic APEC strains: iutA, hlyF, iss, iroN, and ompT, underscoring the close association between avian E. coli virulence and the possession of ColV plasmids. APEC must resist the attack of incoming macrophages in order to cause disease. Rodrigues et al. [147] showed that resident murine peritoneal macrophages infected in vitro with an avian strain of E. coli underwent apoptosis 4 h after infection. Bastiani et al. [148] suggested that APEC may escape destruction by triggering macrophage apoptotic death through induced caspase 3/7 activation, the central caspases in apoptosis. The adherence pilus of avian pathogenic E. coli strains was examined by Vidotto et al. in 1997 [149], and they concluded that mannose-sensitive adherence to chicken tracheal cells correlated with the expression of type 1 fimbriae and that mannose-resistant adherence to chicken tracheal cells cannot always be attributed to P pili. A plasmid of 88 MDa encoding afimbrial adhesin genes has been also associated with adhesion properties to HEp-2 and tracheal epithelial cells in an avian septicemic E. coli strain by Stehling et al. [150]. As avian colisepticemia frequently occurs after respiratory tract damage, the primary site for infection allows bacteria to encounter an exposed basement membrane, where laminin and fibronectin are important components. Ramírez et al. [151] described two potential bacterial adhesins, which reacted with the basement membrane proteins laminin and fibronectin in a dot-blot analysis. Amabile de Campos et al. attempted to explore adhesion to tracheal epithelial cells, fimbrial expression and hemagglutination capacity of APEC strains isolated from chickens suffering from septicemia, SHS and omphalitis in different regions of Brazil [152]. They showed that adhesion, whether D-mannose resistant or D-mannose sensitive, is a characteristic observed in both pathogenic and commensal strains. Several strains with positive adherence had no genetic sequences related to the studied adhesin genes, which indicated that APEC strains probably possess a genome with adhesin genes besides those described elsewhere, as well as some not yet described. In studies of yolk sac infections, Rosario et al. [153] identified the ipaH gene, typical of enteroinvasive E. coli (EIEC) strains with biochemical properties that do not correspond to those described to the EIEC group. Invasion of HEp-2 cells with the formation of intercellular bridges or filipoidal-like protrusions were seen in some isolates, whereas serotypes and the presence of ColV plasmids agreed with the classification as extraintestinal E. coli strains. The results suggested the existence of specific clone complexes derived from EIEC strains adapted to the avian host. In other work, Rosario et al. [154] determined the serotypes and the presence of some virulence genes of E. coli strains isolated from different samples in a vertically integrated poultry operation in Mexico. The serogroup of 85% of the strains was determined, and the most commonly found included O19 (12%), 084 (9%), 08 (6%), and 078 (5%). In addition, 41 percent of the strains hybridized with one or more of the probes used (st, eae, agg1, agg2, bfp, lt, cdt, slt, and ipaH). Of these, ipaH (72%), eae (30%), and cdt (27%) were the most common. Results show that some avian E. coli strains isolated in Mexico are included as avian pathogenic E. coli serotypes not previously reported, which may suggest they could be specific for this geographic area. The wide distribution of the ipaH gene among non-motile strains may indicate that this invasiveness trait could be important in yolk sac infection pathogenesis, and some other genes could contribute to E. coli virulence. E. coli strains isolated from cellulitis presented phenotypic and genotypic characteristics of greater virulence than did fecal isolates [155]. The iss locus, associated with serum resistance, the iutA gene responsible for the aerobactin receptor, and the pathogenicity for 1-day-old chickens, were only associated with the cellulitis isolates. Salpingitis is another extraintestinal infection that affects broiler breeders. Based on the serogroups involved, pathogenicity for 1day-old chicks and virulence indicators, the E. coli salpingitis isolates were similar to those from cases of chronic respiratory disease [156].

234 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

Genetic relationships between avian E. coli strains isolated from extraintestinal sources have been evaluated by different typing methods. Forty-nine avian E. coli isolates from different outbreak cases of septicemia, SHS and omphalitis, and 30 commensal isolates from poultry with no signs of illness were characterized by the enterobacterial repetitive intergenic consensus (ERIC)-PCR technique and their serotypes were determined [157]. The ERIC-PCR profile allowed the grouping of the isolates into four main clusters (A-D), with the omphalitis isolates being grouped with the commensals and separated from the septicemia and SHS strains. This reinforces previous observations that omphalitis isolates are just opportunistic agents and are consistent with many reports that specific genotypes are responsible for causing specific diseases. When these strains were typed by isoenzyme profile and ribotyping analysis by restriction fragment length polymorphism (RFLP), isoenzyme analysis discriminated better among strains than did ribotyping analysis [158]. The enzyme profiles of the E. coli isolates allowed the identification of 33 clones that were organized into six main clusters. Most of the pathogenic strains were grouped together in a cluster, while commensal strains were assigned to the other clusters. Taken as a whole, these results demonstrate that pathogenic clones are more similar to one another, when compared with commensal strains, and may suggest that there is a correlation between the genetic background and the pathogenic characteristics of APEC strains. However, Carvalho de Moura et al. [159] could not distinguish among E. coli strains with different degrees of pathogenicity when testing the capability of ERIC and repetitive extragenic palindromic (REP) PCR to detect genetic diversity among E. coli strains isolated from chickens with colibacillosis and compared the genotypes so obtained with the O:H serotypes and virulence of those strains. The ERIC and REP-PCR methods had good discriminating power, and the dendrograms based on the different patterns revealed extensive genetic diversity among the avian strains. Those strains were allocated into four major clonal clusters, and those clusters corresponded to strains with different degrees of pathogenicity. The 32 serotypes detected were distributed in all clusters; however, strains with the same serotypes tended to form clusters with similar coefficients greater than 80%. Common virulence factors have been demonstrated in APEC and UPEC, and these findings may suggest that APEC strains represent a potential food-borne source of human UPEC infections. Both subcategories of ExPEC strains share virulence-associated traits and have overlapping O serogroups and phylogenetic types. The putative link between human and animal disease caused by E. coli deserves further attention. A reduced number of studies provided information about the isolation of ExPEC strains from other food-producing animals or pets in Latin American countries. E. coli strains isolated from pigs with urinary tract infection were investigated for the presence of virulence factors and a plasmid DNA profile [160]. The most frequent virulence factors presented by these strains were mannose-resistant fimbriae, including P fimbriae (54.8%) and aerobactin production (45.2%). The pap operon, detected by PCR, was found in 54.8% of the strains, which is similar to its frequency in human ExPEC strains. Other characteristics, such as the presence of mannose-sensitive hemagglutinin (16.1%), indicative of type 1 pili, and production of hemolysin (25.8%), colicin (38.7%) and toxins (22.6% for LT and for VT) were less frequent. No strains were positive for STa production. Plasmid profiles were variable among isolates from either the same or different farms. In a recent study, Siqueira et al. [161] compared the prevalence of virulence genes in E. coli strains isolated from 51 clinical cases of urinary tract infections, 52 of pyometra and from 55 fecal samples from healthy dogs by PCR. ExPEC-associated virulence factor genes encoding haemolysin (hlyA), uropathogenic specific protein (usp) and aerobactin iron transport system (iucD) were significantly associatedwith E. coli strains isolated from UTIs and pyometra. These genes are frequently identified in human UPEC strains. Eight E. coli strains obtained in Brazil from ostriches with respiratory disease also showed a virulence profile characteristic of ExPEC [162]. Serogrouping demonstrated that four isolates belonged to serogroup O2, two to serogroup O78, one to serogroup O9, and one to serogroup O21. The virulence genes encoding type 1 fimbria (fim) was found in all eight isolates, curli (csgA) in seven, aerobactin system (aer) in six, and P fimbria (pap), crl regulator protein (crl) and temperature-sensitive hemagglutinin (tsh) in one isolate each. All isolates analyzed were positive for mannose-resistant hemagglutination, adhered in vitro to ciliated tracheal epithelium, grew on irondeficient medium, and showed serum resistance. Five isolates exhibited high-t- intermediate pathogenicity when they were tested on one-day-old chickens. These results demonstrated strong similarities between E. coli strains isolated from respiratory disease in ostriches and septicemic E. coli strains isolated from poultry.

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 235

E. coli is also one of the bacteria that have been associated with otitis externa, produced primarily by rhabditiform nematodes and mites of the genus Raillietia in cattle from tropical and subtropical regions [163]. However, studies about the virulence traits of these E. coli isolates are lacking. In a study characterizing the E. coli strains isolated from 100 calves with diarrhea or septicemia and 21 older cattle with different pathologies, Mercado et al. [116] found that 21% of calves expressed the CS31A adhesin, and three of them produced the F17c fimbriae. All of the CS31A-producing strains exhibited at least one property of septicemic strains (resistance to serum, production of aerobactin or colicins) but none of them demonstrated heat-stable enterotoxigenic activity or expressed F5, F41, F17a or F17b fimbriae. CS31A+ E. coli isolates belonged to 10 serogroups, more commonly O8, O7, O17 and O21. These results suggested the worldwide distribution of plasmids containing CS31A or CS31A/F17c-associated sequences with additional extraintestinal virulence factor genes in cattle. Mercado et al. [164] also characterized 24 cytotoxic necrotizing factor (CNF)-producing E. coli strains isolated from cattle with diarrhea or extraintestinal infections. They found that the cnf2 allele was present in most of the isolates, while the cnf1 allele was present in only a reduced number of strains. Additionally, the virulence factor genes encoding hemolysin (hlyA), aerobactin iron transport system (iucD) and the outer membrane protein TraT (traT) were detected in more than 75% of the isolates. Cytolethal distending toxin genes cdtB-III and cdtB-IV were significantly associated with the cnf2 and cnf1 genes, respectively. Adhesin-encoding genes f17A, papC, sfa/foc y afaE-VIII and K1 capsular antigen were also detected among the CNF-producing strains. Interestingly, a cluster of strains belonging to serogroup O2 and B2 phylogenetic group was identified by RAPD-PCR. Finally, there is a need to know the role of ExPEC strains as etiological agents of disease in domestic and wild animals in Latin American countries. The human health hazard of ExPEC strains of animal origin in a region with intensive farming is of especially great concern. INTRODUCTION TO ENTEROPATHOGENIC Escherichia coli Evolution The term enteropathogenic E. coli (EPEC) was coined to describe strains associated with infantile diarrhea [165]. Independent of the track to be followed in this description, there was a gap in knowledge, because the major virulence factors were not known. Accordingly, Trabulsi et al. [166] described several serogroups for which there was a very strong prevalence in cases of infantile diarrhea. Experimental tests carried out in the rabbit ileal loop assay demonstrated that in most cases only serogroups associated with infantile diarrhea showed an increase of fluid in the intraluminal region of the loops. Accordingly, it was proposed that some active substances were released in vivo and that these were probably responsible for this effect. The increase in fluid, for example, could mimic the conditions in the gut of children infected with these particular strains; however there was no scientific basis to explain the etiology of these EPEC infections. The term enteropathogenic was established to refer to certain E. coli O serogroups or serotypes (O:H types) associated with infantile diarrhea that usually do not produce heat-labile and heat-stable enterotoxins and are not invasive. Since the discovery of enteropathogenic E. coli in the late 1940s, these serogroups were accepted worldwide as important agents of epidemic and non-epidemic infantile diarrhea in the first months of life [167]. Further studies [168, 169] demonstrated an adhesive characteristic, which differed between E. coli strains associated with diarrhea, that could provide a clue as to why strains that display a localized adherence (LA) to HeLa cells could explain the high virulence of some EPEC serotypes. Further studies showed a diffuse adherence to HeLa cells that had low pathogenicity or none for children. Several studies followed these data until it was established that the LA was not a true parameter to distinguish pathogenic EPEC from other low pathogenic E. coli, in infected children from 6 -12 months of age. The above phenotype was, in fact, due to a cascade of genotypic and respective phenotypic phenomena, which were exhaustively studied to reveal that the LA adherence was mediated by a bundle-forming pilus encoded in the Enteropathogenic Adherence Factor (EAF The pilus exhibited a cluster of 14 contiguous genes, and this was deemed the bfpA responsible for the synthesis of the bundling. The EAF plasmid (pEAF) was considered for many years as essential to determine what was called typical EPEC [169, 170, 171].

236 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

The strains encoding BFP and intimin are classified as typical EPEC (tEPEC). The strains harboring only the eae gene, without the presence of bfpA and expression of BFP, were designated as atypical EPEC (aEPEC). The tEPEC was the predominant pathotype associated with diarrhea in children over 1 year of age. The main serotypes were O55:[H6], O86:H34, O111:[H2], O114:H2, O119:[H6], O127:H6, O142:H6 and O142:H34. [172]. Recently, infections with tEPEC are decreasing dramatically as the cause of diarrhea in Brazil and other countries. Conversely, the infections caused by aEPEC are increasing exponentially in many cities in Brazil. The most common serotypes of aEPEC are O26:[H11], O55:[H7], O55:H34, O86:H8, O111ac:[H8], O111:[H9], O111:H25, O119:H2, O125ac:H6 and O128:H2 [172]. Furthermore, some aEPEC serotypes that do not belong to these classic serotypes are increasing in the community and in other countries, and similar epidemiologic data have been reported by other authors [173]. These strains seem to be involved in cases of diarrhea in both children and adults. Initially, when there was much attention placed on tEPEC, because it was found much more frequently in patients than was aEPEC, it had been assumed that humans were its only carriers. By extension of this assumption, the fecaloral route was considered virtually the exclusive route of infection, and, thus, only humans would be carriers and therefore reservoirs of tEPEC. If this premise was correct, there were further facts to be considered, including how long an infected person recovered from the disease or whether an imperceptibly infected patient continued to shed E. coli. However, at the time these questions remained unanswered due to a dearth of information, but in recent years this concept was somewhat disproved. Conversely, the findings that increased human infections were caused by aEPEC changed several factors. Among the most important was the report that adults, and not only children over 5-10 years of age, could be infected by aEPEC. Actually, findings in studies carried out by several groups [172, 174, 175, 176, 177] demonstrated that many isolates belonged to serotypes commonly found among domestic and companion animals [83, 109, 178, 179, 180]. As described below, many of the animal strains isolated were shown to be capable of transmission to humans and vice-versa. Since the kinetics of aEPEC infections either in humans or animals has not been widely studied, it was not easy to conclude whether rabbits, dogs, marmosets, bovine, ovine, cats or other animals were carriers and possible reservoirs of aEPEC, but this transmission route cannot be overlooked. The following sections will describe which isolates of aEPEC, as well as some tEPEC, have been reported mainly in Brazil and their incidence in the abovecited animals. Cattle as Reservoir of EPEC Calves are usually severely affected by enterotoxigenic E. coli (ETEC), but the disease is self-limited and rarely found in calves above one month of age. Older bovines are known as typical carriers of STEC/EHEC pathotypes [42, 43]. Although there are some discrepancies in the literature, these animals do not show diarrhea symptoms. To determine the occurrence, serotypes and virulence markers of EPEC strains in São Paulo, Brazil, 546 fecal samples from 264 diarrheic calves and 282 healthy calves from beef farms were screened by PCR. EPEC were isolated in 2.7% of the 546 animals. Although the IMS test was used, the STEC serotype O157:H7 was not detected. The most frequent EPEC serotypes were O26:H11, O123:H11 and O177:H11. The eae gene was detected in 100% of the EPEC strains. The intimin type 1 was the most frequently found. To our knowledge, this is the first report of the occurrence of the new intimin μB in one strain of animal origin. This new intimin was detected in one aEPEC strain of serotype O123:H?, isolated from diarrheic cattle. The enterohemolysin (ehxA) gene was detected in 80% of the EPEC strains. All 15 bovine EPEC strains isolated in this study were negative for both EAF and the bfpA gene. Overall, this study showed that cattle are reservoirs of atypical EPEC in Brazil. Among the EPEC isolated from diarrheic cattle, five EPEC strains (two of serotype O26:H11, two of O123:H11, and one of O177:H11) harbored intimin type 1, one other strain possessed intimin type θ/γ2 (O18:H7), and yet another, the new intimin μB (serotype O123:H?). Fluorescent actin staining (FAS) test confirmed four eae+ strains, but the three eae+ strains were FAS-negative, and one of those found to be FAS-negative was also intimin-negative

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 237

by Western blot. Three (43%) strains showed a NC pattern and one (14%), a LAL pattern, while three (43%) were negative in the HEp-2 cells adherence test. Among seven strains isolated from diarrheic animals, 86% possessed the enterohemolysin gene and expressed enterohemolytic activity. Six EPEC strains (4 of serotype O177:H11, one of O123:H11, and one of O123:H-), isolated from healthy cattle, harbored intimin type 1, while another strain possessed intimin θ/γ2 (O127:H40), and another, the intimin γ1 (serotype O145:H-). All 15 bovine EPEC strains were negative for both EAF and the bfpA gene, and, therefore, could be classified as aEPEC strains. It is not easy to explain the significance of these 15 aEPEC isolates. With the exception of serotype O127:H40, which was already reported in humans, the remaining isolates have not been isolated from cases of diarrheal disease in humans. Thus, based on these studies, cattle cannot be considered a reservoir of aEPEC for humans. Ovine as Reservoir of EPEC Previous studies have demonstrated the occurrence of distinct strains in sheep from different farms [83]. Depending on the number of strains studied, the absolute number of isolates of EPEC increases. However with some differences, the percentage of isolation of EPEC strains from ovines is not high. For example, among 86 ovine isolates, only five (5.81%) were eae+ and stx− and could be classified as aEPEC. Two isolates belonged to serotype O128:H2/β intimin; and the remainder were classified as O145:H2/γ, O153:H7/β and O178:H7ε. Based upon these findings, it is difficult to assume that ovines could be a reservoir of EPEC for humans. Pigs as Reservoir of EPEC There are a few reports of pigs as reservoirs of ETEC, and some EPEC-like isolates have been isolated from swine, mainly in other countries [181]. The study examined fecal samples from 198 pigs and 279 sheep at slaughter. The proportion of eae+ samples was 89% for pigs and 55% for sheep. By colony dot-blot hybridization, AE-producing E. coli (AEEC) were isolated from 50 and 53 randomly selected porcine and ovine samples, respectively. Strains of the serotypes O2:H40, O3:H8 and O26:H11 were found in both pigs and sheep. In pigs, O2:H40, O2:H49, O108:H9, O145:H28, and in sheep, O2:H40, O26:H11, O70:H40, O146:H21 were the most prevalent serotypes among typeable strains. Eleven different intimin types were detected, whereas γ2/θ was the most frequent, followed by β1, ε and γ1. All but two ovine strains tested negative for the Stx genes. All strains tested negative for the bfpA gene and the EAF plasmid. EAST1 (astA) was present in 18 of the isolated strains. Studies showed that pigs and sheep are a source of serologically and genetically diverse, intimin-harboring E. coli strains. Most of the strains show characteristics of aEPEC. Nevertheless, there are stx-negative AEEC strains belonging to serotypes and intimin types associated with classical EHEC strains (O26:H11, β1; O145:H28, γ1) [173]. The results of studies in which several pathotypes were sought in pig stool samples, did not point to any isolate that could be classified as aEPEC and tEPEC. This result leads to the possibility that pigs are not important carriers and reservoirs of this pathotype (unpublished data). Autochthonous and Exotic Wild Animals as Reservoirs of EPEC: Marmosets Monkey EPEC (MEPEC) or EPEC-like strains were the only groups of diarrheagenic E. coli isolated from fecal samples in research carried out in Brazil [179]. All of the isolates adhered to HeLa cells, and these results are shown in Table 3. The 21 eae+ E. coli strains belonged to 11 serogroups and 13 serotypes. Among these, O167:H9, O127, and O49:H46 were the most prevalent, identified in three animals each (23%), followed by serotypes O142:H6 and O132:H31 (each identified in two animals, 15%). Further, serotypes O139:H4, O128: H2, O26:H7, O167:H6, O33:NM, OR:H34, and O8:H10, were identified in one animal each. It is worth mention that some isolates from marmosets, i.e., serotype O132:H31, have all the characteristics of tEPEC, including presence of the eae and bfpA genes, BFP expression, and production of intimin type β and FAS+. Conversely this serotype of tEPEC was not found among humans, which may suggest that some animals could have their own tEPEC isolates. Symbols d or d/h means diarrhea (d) or healthy (h); Greek letters, types of intimin; LA, LAL, NC, DA and EA mean localized adherence or localized adherence-like; NC: Non-characteristic adhesion; DA: Diffuse adherence; EA: Enteroaggregative adherence.

238 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

Table 3: Characteristics of the E. coli eae+ isolates recovered from monkeys (Marmosets) healthy or with diarrhea. São Paulo, Brazil, 2003. Nº of Isolates

bfpA gene

BFP Expression

Intimin Subtype

Adherence

FAS

Serotype

2d 2d 2 d/h 1h 2 d/h 1d 1d 1d 1d 1d

+ +

+ +

β Ι γ2/θ λ β1 β1 β2 ε α1 α1

NC LAL, EA DA NC LA LAL,EA NC NC LAL LA

+ + + + + + + + + +

O128:H2 O49:H6 O127:H40 O33:NM O132:H31 O167:H9 O139:H14 O26:H7 O142:H6 O142:H6

Rabbits as Reservoir of EPEC Diarrhea in these animals is usually a serious problem because management procedures may include closed contact of the suckling and/or weanling rabbits. Thus most animals are infected earlier, usually either while suckling or just after weaning. In the case of REPEC (rabbit EPEC), the determination, even before determining the serotypes, of the biotype, as defined in reference [182], is important to allow assessment of the virulence of the isolates.. An important phenotype is the non-fermentation of rhamnose as indicative of higher pathogenicity. The virulence factors for REPEC are usually the production of fimbriae, which can be of two types: AF/R1 and AF/R2 (Table 4). Interestingly, AF/R1 is not the most common fimbrial antigen among REPEC. One study [177] showed that the AF/R1 was not detected in 178 strains. Among these isolates, 90 had the eae gene. Seventy-four were from diarrheic animals and all of them but one encoded the β intimin, which is unique compared to E. coli isolated from other animals. The virulence factor allowed the strains to be classified as aEPEC. The most prevalent serotype was O132:H2, present in 63 isolates (70%) of the 90 eae+ isolates. The AF/R2 fimbriae was found in 75 (83.3%) of the 90 eae+ isolates. Table 4: Summary of the study of 178 E. coli strains isolated from rabbits in Brazil. Number of Positive/total Number Isolated

Number of positive (percentage of isolates)

Strains not serotyped ( NT)

62/178

62 (34.83%)

Strains O132:H2

63/178

63 (35.39%)

Strains O128:H2

6/178

6 (3.37%)

Discrimination

Strains O153:H7

6/178

6 (3.37%)

Strains O103:H19

10/178

10 (5.62%)

Strains belonging to further serotypes

31/178

31 (17.42%)

Strains eae+ and serotype O132:H2

63/90

63 (70.00%)

Strains eae+ serotype O128:H2

6/90

6 (6.67%)

Strains eae+ serorype O153:H7

6/90

6 (6.67%)

Strains eae+ serotype O103:H19

0/90

0 (0.00%)

Strains of the serobiotype O132:H2:B28 among the eae+

49/90

42 (46.67%)

Strains of the serobiotype O132:H2:B30 among the eae+

9/90

9 (10.00%)

Strains of the serobiotype O128:H2:B28 among the eae+

6/90

6 (6.67%)

Strains eae+ of the serobiotype O153:H7:B28

6/90

6 (6.67%)

Strains AF/R2+ (only the eae+ were tested)

75/90

75 (83.33%)

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 239

Dogs as Reservoirs of EPEC The EAF plasmid and the bfpA gene have not been detected in EPEC from pigs, cattle, and rabbits, but some isolates of dog EPEC (DEPEC) and most typical EPEC of human origin harbor both EAF and bfpA [171, 183, 184]. Among the E. coli recovered from 182 fecal specimens collected from 146 dogs with diarrhea and 36 dogs without diarrhea, there were 23 (12.6%) that had the eae gene identified by PCR. These isolates were referred to as DEPEC. Twenty (13.7%) of the 146 isolates from diarrheic dogs, and three (8.3%) of the 36 isolates from non-diarrheic dogs were DEPEC [109]. The EAF plasmid was not detected in any of the DEPEC isolates, but the bfpA gene was detected in the isolates from two diarrheic dogs (S6 and C27, Table 4). The FAS test was carried out only with those DEPEC that showed adherence to HEp-2 cells. All isolates tested were FAS+, regardless of the pattern of adherence. There was a wide variety of serotypes among the DEPEC and serotypes O119:H2 (isolates SPA14 and BIO12) and O142:H6 (isolate S6) are noteworthy, as they have been identified as atypical and typical human EPEC serotypes, respectively. The DEPEC isolates in this study belonged to a wide variety of serotypes (Table 4). The serotype is often not determined for DEPEC, and only the serogroups of a limited number of isolates have been reported [96, 174, 178, 185, 186, 187]. It is significant that two isolates were serotyped as O111:H25 and two as O119:H2, because they are human atypical EPEC serotypes [172]. An outstanding finding is that one isolate belonged to serotype O142:H6, a typical human EPEC serotype. This isolate (S6) harbored the gene bfpA, expressed BFP, and adhered to HEp-2 cells in a LA pattern (Table 5). In a study characterizing non-STEC O157 strains isolated from dogs in Argentina, Bentancor and co-workers identified typical EPEC serotype O157:H45 and atypical EPEC serotype O157:H16 (188). These findings suggest that dogs, with or without diarrhea, may be a source of infection of typical and atypical EPEC infection for humans [172]. This has been described for EPEC of serotype O111:H- [189] in a study which demonstrated cross-infection between a dog and a child in the same house of a city of the state of São Paulo, Brazil. Table 5: Characterization of the eae+ E. coli isolates from diarrheic and non-diarrheic dogs in São Paulo, Brazil, 2004. Isolate 008 HE4 HE8 HE9 HE10 HE13 SPS14 SPA16 B1 B2N B4 B41-7 B17 S1 S6 BIO2 BIO4 BIO12 C27-colony 1 C27-colony2 C32 QSF4 SB2

bfpA + + -

Subtyping of Intimin β β γ γ γ β β NT γ NT NT NT γ NT α ε ε β γ β β κ β

Adhesion (HEp-2) LAL NC NC LAL NC LAL LAL LAL LAL LA NC NC LAL LAL LAL -

Serotype O98:H28 O11:H16 O111:H25 O111:H25 ONT:H40 O15:HO119:H2 ONT:HO88:H19 ONT:HO156:HO174:HO142:H6 O157:H16 O142:H6 O157:H16 O157:H16 O119:H2 O25:H8 O167:H6 O4:H6 O88:HO15:H-

(-) Negative; LAL: Localized Adherence Like; LA: Localized adherence; NC: Non characteristic adherence; Not Typeable: No reaction with primers (only α,β, γ and δ were available at the time of the research was carried out).

240 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

Cats as Reservoirs of EPEC Additional diarrheagenic bacteria have been studied in pets, as well as their potential role as sources of enteric pathogens for human infection. In this study, cats were investigated as carriers and excretors of EPEC, EHEC/STEC, and ETEC as possible causes of intestinal infections in humans [3, 172]. We examined fecal samples from 300 cats for diarrheagenic E. coli types. None of these were positive for genes encoding Shiga-toxins and enterotoxins, indicating that STEC and ETEC were not excreted by the animals. Fifteen eae+ E. coli strains (CEPEC; cat EPEC) were isolated from 14 cats (4.7%; 13 non-diarrheic and one diarrheic). Although further research was not performed with the CEPEC, these results may imply that cats can be an important reservoir for aEPEC and able to cause diarrheal disease in humans. Fig. 1 summarizes the interactions and relationships between animals and humans, based upon the reports in this section. The figure depicts, at left, humans as the only reservoir of typical EPEC. In text, it was emphasized that although tEPEC is disappearing as a major cause of diarrhea among children, a few serotypes, mainly O142:H6 and O127:H40, have been found in some animals that live in close contact with humans, and this observation cannot be overlooked. Therefore it is plausible to question whether the reservoir of these serotypes was human, canine s and/or simian (marmosets). Thus Fig. 1 also depicts some domestic and companion animal carriers of aEPEC. Because the diarrheal diseases by aEPEC is increasing, the role of these animals in the cycle of infection cannot be overlooked, and it is possible that nowadays the target of research on EPEC will focus more on these animals as putative reservoir of aEPEC for humans.

Figure 1: The past concept showing the putative reservoir for tEPEC and aEPEC for humans. The importance of humans as carries of tEPEC had its relevance strongly reduced. Among the animals (right part of the picture), some of them can be reservoirs of aEPEC, except marmoset and dogs that also showed to be carriers of tEPEC (particularly serotype O142:H6).

Conclusions about EPEC As a result of exploring several possibilities about animals as reservoirs, it can be stated, that to some extent they are reservoirs of aEPEC and tEPEC for humans. Further verification of this concept has been attempted by Rodrigo de Assunção Moura (University of São Paulo, Brazil to provide some additional findings, when strains of the same serotype, isolated from humans and different animal species, were matched and compared by using Multilocus Sequencing Typing (MLST) and Pulsed Field Gel Electrophoresis (PFGE) [190]. The phylogeny of 49 typical and atypical EPEC strains was inferred by Bayesian analysis. The strains were rooted with EHEC strain EDL933 and EPEC strain E2348/69; Salmonella enterica strain Ty2 was included as outgroup standard (data not shown). The relationships among the strains studied, constitute an original contribution to the epidemiology of EPEC, and describe the role of the sources of infection as possible reservoirs, in cases of cross- infection (animals and humans). ACKNOWLEDGEMENTS The co-authors thank those who participated in these studies and the institutions that gave financial support: USP, UBA, UNCPBA, CONICET, ANPCYT, INTA, CNPq, FAPESP, CIC-PBA, Min. Salud Nación Argentina and PPUA-SPU.

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 241

REFERENCES [1] [2] [3] [4]

[5] [6]

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]

[22] [23]

[24]

[25]

Haydon DT, Cleaveland S, Taylor LH, et al. Identifying reservoirs of infection: a conceptual and practical challenge. Emerg Infect Dis. 2002;8:1468-73. Knuton S, Baldwin T, Williams PH, et al. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohaemorrhagic Escherichia coli. Infect Immun. 1989;57:1290-8. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. Paton AW, Srimanote P, Woodrow MC, et al. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga toxigenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69:6999-7009. Lucchesi PMA, Krüger A, Parma AE. Distribution of saa gene variants in verocytotoxigenic Escherichia coli isolated from cattle and food. Research Microbiol. 2006;157:263-6. Lucchesi PMA, Granobles CV, Suárez L, et al. Detection of subtilase cytotoxin gene in strains of Verocytotoxigenic Escherichia coli from Argentina. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009;96. Giannantonio CA, Vitacco M, Mendilaharzu FM, et al. The hemolytic-uremic syndrome. Renal status of 76 patients at the long-term follow up. J Pediatr. 1968;72:757. Karmali MA. Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev. 1989;2:15–38. López EL, Diaz M, Grinstein S, et al. Hemolytic uremic syndrome and diarrhea in Argentine children: the role of Shiga like toxins. J Infect Dis. 1989;160:469-75. Voyer LE. Síndrome urémico hemolítico. Buenos Aires: López Ed. 1996. Paton JC, Paton AW. Pathogenesis and Diagnosis of Shiga Toxin-Producing Escherichia coli Infections. Clin Microbiol Rev. 1998;11:450-79. Exeni RA. Hemolytic uremic syndrome. Medicina (Buenos Aires). 1996;56:197–8. Repetto HA. Long-term course and mechanisms of progression of renal disease in hemolytic uremic syndrome. Kidney Internat. 2005;68:102-6. Lombardo H. Boletín Epidemiológico Nacional, Ministerio de Salud, Dirección de epidemiología. Annual Report, Argentina. 1999. Rivero MA, Padola NL, Etcheverrría AI, et al. Escherichia coli verocitotoxigénica en materia fecal de niños con diarrea. Implicancia clínica. In: IV Congreso Argentino de Zoonosis, Buenos Aires, Argentina. April 14-16, 2004. Rivas M, Miliwebsky E, Chinen I, et al. The epidemiology of hemolytic uremic syndrome in Argentina. Diagnosis of the etiologic agent, reservoirs and routes of transmission. Medicina (B. Aires). 2006;66 Suppl 3:27-32. Wright DJ, Chapman PA, Siddons CA. Immuno-magnetic separation as a sensitive method for isolating Escherichia coli O157 from food samples. Epidemiol Infect. 1994;113:31-9. Parma AE, Vinas M, Sanz ME. Improvement of the polymerase chain reaction to detect Escherichia coli Shiga-like toxin II gene from clinical isolates. J Microbiol Meth. 1996;26:81-5. Blanco M, Blanco JE, Blanco J, et al. Distribution and characterization of faecal verotoxin-producing Escherichia coli (VTEC) isolated from healthy cattle. Vet Microbiol. 1997;54:309-19. López E, Contrini M, Sanz ME, et al. Perspectives on Shiga-like toxin infections in Argentina. J Food Protect. 1997;60:1458-62. López EL, Contrini MM, De Rosa MF. Epidemiology of Shiga toxin-producing Escherichia coli in South America. In: Kaper JB, O´Brien AD (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC. ASM Press. 1998;30-37. Sanz ME, Viñas MR, Parma AE. Prevalence of bovine verotoxin-producing Escherichia coli in Argentina. Eur J Epidemiol. 1998;14:399-03. Caprioli A, Tozzi AE. Epidemiology of Shiga toxin-producing Escherichia coli infections in continental Europe. In: Kaper JB, O´Brien AD (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC. ASM Press. 1998;38-48. Spika JS, Khakhria R, Michel P, et al. Epidemiology of Shiga toxin-producing Escherichia coli infections in continental Europe. In: Kaper JB, O´Brien AD (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC. ASM Press. 1998;23-29. Robins-Browne RM, Elliott E, Desmarchelier P. Shiga toxin-producing Escherichia coli in Australia. In: Kaper JB, O´Brien AD (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC. ASM Press. 1998;66-72.

242 Pathogenic Escherichia coli in Latin America

[26]

[27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40]

[41] [42]

[43]

[44]

[45]

[46] [47] [48] [49] [50]

Pestana de Castro et al.

Griffin PM. Epidemiology of Shiga toxin-producing Escherichia coli infections in humans in the United States. In: Kapar J.B. and O´Brien A.D. (eds), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC. ASM Press. 1998;15-22. Montenegro MA, Bülte M, Trumpf T, et al. Detection and characterization of fecal verotoxin-producing Escherichia coli from healthy cattle. J Clin Microbiol. 1990;28:1417-21. Orskov F, Orskov I, Villar J. Cattle as reservoir of verotoxin-producing Escherichia coli O157:H7. Lancet 1987;2:276. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308:681-5. Parma AE, Sanz ME, Blanco JE, et al. Virulence genotypes and serotypes of verotoxigenic Escherichia coli isolated from cattle and foods in Argentina. Importance in public health. Eur J Epidemiol. 2000;16:757-62. Padola NL, Sanz ME, Lucchesi PL, et al. First isolation of the enterohaemorrhagic Escherichia coli O145:H- from cattle in feedlot in Argentina. BMC Microbiol. 2002; 2:6 [On-Line]. Available: www.biomedcentral.com/1471-2180/2/6. Rivas M. Symposium: Shiga toxin-producing Escherichia coli (STEC): epidemiology and prevention. In: IV Congreso Argentino de Infectología, Mar del Plata, Argentina. May 7-9, 2004. Padola NL, Sanz ME, Blanco ME, et al. Serotypes and virulence genes of bovine shigatoxigenic Escherichia coli (STEC) isolated from a feedlot in Argentina. Vet Microbiol. 2004;100:3-9. Gioffré A, Meichtri L, Miliwebsky E, et al. Detection of Shiga toxin-producing Escherichia coli by PCR in cattle in Argentina. Evaluation of two procedures. Vet Microbiol. 2002;87:301-13. Chinen I, Otero JL, Miliwebsky ES, et al. Isolation and characterisation of Shiga toxin-producing Escherichia coli O157:H7 from calves in Argentina. Res Vet Sci. 2003;74:283-6. Meichtri L, Miliwebsky E, Gioffré A, et al. Shiga toxin-producing Escherichia coli in healthy young beef steers from Argentina: prevalence and virulence properties. Int J Food Microbiol. 2004;96:189-98. Mercado EC, Gioffré A, Rodríguez SM, et al. Non-O157 Shiga toxin-producing Escherichia coli isolated from diarrhoeic calves in Argentina. J Vet Med B Infect Dis Vet Public Health. 2004;51:82-8. Borie CF, Monreal Z, Martinez J, et al. Detection and characterization of enterohaemorrhagic Escherichia coli in slaughtered cattle. Zentralbl Veterinarmed B. 1997;44:273-9. Callaway TR, Anderson RC, Tellez G, et al. Prevalence of Escherichia coli O157 in cattle and swine in central Mexico. J Food Prot. 2004;67:2274-6. Varela-Hernández JJ, Cabrera-Diaz E, Cardona-López MA, et al. Isolation and characterization of Shiga toxin-producing Escherichia coli O157:H7 and non-O157 from beef carcasses at a slaughter plant in Mexico. Int J Food Microbiol. 2007;113:237-41. Roopnarine RR, Ammons D, Rampersad J, et al. Occurrence and characterization of verocytotoxigenic Escherichia coli (VTEC) strains from dairy farms in Trinidad. Zoonoses Public Health. 2007;54:78-85. Leomil L, Pestana de Castro AF, Krause G, et al. Characterization of two major groups of diarrheagenic Escherichia coli O26 strains which are globally spread in human patients and domestic animals of different species FEMS Microbiol Lett. 2005;15:335-42. Aidar-Ugrinovich L, Blanco J, Blanco M, et al. Serotypes, virulence genes and intimin types of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) isolated from calves in São Paulo, Brazil. Int. J. Food Microbiol. 2007;115:297-306. Fernández D, Krüger A, Sanz ME, et al. Characterization of verocytotoxin-producing Escherichia coli O178:H19, the serotype prevalently isolated from dairy farms in Argentina. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009; 73. Bustamante AV, Sanso AM, Fernández D, et al. Genetic diversity of verocytotoxigenic Escherichia coli O178:H19 isolated from dairy farms in Argentina. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009; 72. Heuvelink AE, Van Den Biggelaar FLAM, Zwartkruis-Nahuis JTM, et al. Ocurrence of Verocytotoxin-Producing Escherichia coli O157 on Dutch Dairy Farms. J Clin Microbiol. 1998;36:3480-7. Cobbold R, Desmarchelier PA. Longitudinal study of Shiga-toxigenic Escherichia coli (STEC) prevalence in three Australian dairy herds. Vet Microbiol. 2000;71:125-37. Wells JG, Shipman LD, Greene KD, et al. Isolation of Escherichia coli O157:H7 and other Shiga-like-toxin-producing E. coli from dairy cattle. J Clin Microbiol. 1991;29:985-9. Busato A, Hofer D, Lentze T, et al. Prevalence and infection risks of zoonotic enteropathogenic bacterium in Swiss cowcalf farms. Vet Microbiol. 1999;69:251-63. Jackson SG, Goodbrand RB, Johnson RP, et al. Escherichia coli O157:H7 diarrhea associated with well water and infected cattle on an Ontario farm. Epidemiol Infect. 1998;120:17-20.

Escherichia coli Animal Reservoirs

[51] [52] [53] [54] [55]

[56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66]

[67] [68] [69] [70] [71] [72] [73] [74]

[75] [76]

Pathogenic Escherichia coli in Latin America 243

Leomil L, Aider-Ugrinovich L, Guth BEC, et al. Frequency of Shiga toxin-producing Escherichia coli (STEC) isolated among diarrheic and non-diarrheic calves in Brazil. Vet Microbiol. 2003;97:103-9. Moreira CN, Pereira A, Brod CS, et al. Shiga toxin-producing Escherichia coli (STEC) isolated from healthy dairy cattle in southern Brazil. Vet Microbiol. 2003;93:171-83. Vicente HIG, Amaral LA, Cerqueira AMF. Shigatoxigenic Escherichia coli serodrups O157, O111 and O113 in feces, water and milk samples from dairy farms. Braz J Microbiol. 2005;36:217-22. Fremaux B, Raynaud S, Beutin L, et al. Dissemination and persistence of Shiga toxin-producing Escherichia coli (STEC) strains on French dairy farms. Vet Microbiol. 2006;117:180-91. Fernández D, Sanz ME, Padola NL, et al. Virulence genes and serotypes of verocytotoxin producing Escherichia coli isolated from dairy cows in Argentina. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009; 72. Fernández D, Rodríguez E, Arroyo GH, et al. Seasonal variation of Shiga toxin-encoding genes (stx) and detection of E. coli O157 in dairy cattle from Argentina. J Appl Microbiol. 2009;106:1260-7. Vold L, Klungseth Johansen B, Kruse H, et al. Occurrence of Shigatoxigenic Escherichia coli O157 in Norwegian cattle herds. Epidemiol Infect. 1998;120:21-8. Blanco M, Padola NL, Krüger A, et al. Virulence genes and intimin types of Shiga-toxin-producing Escherichia coli isolated from cattle and beef products in Argentina. Internat Microbiol. 2004 7:269-76. Gómez D, Miliwebsky E, Fernández Pascua C, et al. Aislamiento y caracterización de Escherichia coli productor de toxina Shiga en hamburguesas supercongeladas y quesos de pasta blanda. Rev Arg Microbiol. 2002;34:66-71. Tanaro JD, Lound LH, Miliwebsky E, et al. Detección de Escherichia coli O157:H7 en agues abiertas de las proximidades de casco urbano. In: Resúmenes de las Primeras Jornadas de Microbiología del Noreste. Tucumán. December 2001. Oteiza JM, Chinen I, Miliwebsky E, et al. Isolation and characterization of Shiga toxin-producing Escherichia coli from precooked sausages (morcillas). Food Microbiol. 2006;23:283-8. Roldán ML, Chinen I, Otero JL, et al. Isolation, characterization and typing of Escherichia coli 0157:H7 strains from beef products and milk. Rev Argent Microbiol. 2007;39:113-9. Varela G, Chinen I, Gadea P, et al. Detección y caracterización de Escherichia coli productor de toxina Shiga a partir de casos clínicos y de alimentos en Uruguay. Rev Argent Microbiol. 2008;40:93-100. Bosilevac JM, Guerini MN, Brichta-Harhay DM, et al. Microbiological characterization of imported and domestic boneless beef trim used for ground beef. J Food Prot. 2007;70:440-9. Vidal M, Escobar P, Prado V, et al. Distribution of putative adhesins in Shiga toxin-producing Escherichia coli (STEC) strains isolated from different sources in Chile. Epidemiol Infect. 2007;135:688-94. Rios M, Prado V, Trucksis M, et al. Clonal diversity of Chilean isolates of enterohemorrhagic Escherichia coli from patients with hemolytic-uremic syndrome, asymptomatic subjects, animal reservoirs, and food products. J Clin Microbiol. 1999;37:778-81. Mora A, León SL, Blanco M, et al. Phage types, virulence genes and PFGE profiles of Shiga toxin-producing Escherichia coli O157:H7 isolated from raw beef, soft cheese and vegetables in Lima (Peru). Int J Food Microbiol. 2007;114:204-310. Martínez AJ, Bossio CP, Durango AC, et al. Characterization of Shiga toxigenic Escherichia coli isolated from foods. J Food Prot. 2007;70:2843-6. Reuben A, Treminio H, Arias ML, et al. Presence of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella spp. in food from animal origin in Costa Rica Arch Latinoam Nutr. 2003;53:389-92. Arias ML, Monge-Rojas R, Antillón F, et al. Growth and survival of Escherichia coli O157: H7 in meat, poultry and vegetables mixed with different concentrations of mayonnaise. Rev Biol Trop. 2001;49:1207-12. Arias ML, Monge-Rojas R, Chaves C, et al. Effect of storage temperatures on growth and survival of Escherichia coli O157:H7 inoculated in foods from a neotropical environment. Rev Biol Trop. 2001;49:517-23. Alvarado-Casillas S, Ibarra-Sánchez S, Rodríguez-García O, et al. Comparison of rinsing and sanitizing procedures for reducing bacterial pathogens on fresh cantaloupes and bell peppers. J Food Prot. 2007;70:655-60. Etcheverría AI, Arroyo GH, Perdigón G, et al. Escherichia coli with anti-O157 activity isolated from bovine colon. J Appl Microbiol. 2006;100:384-9. Etcheverría AI, Arroyo GH, Parma AE. Probiotic Escherichia coli inhibit adherence of Escherichia coli O157:H7 to colon explants from bovine. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009;106. Beutin L, Geier D, Steinbrück H, et al. Prevalence and some properties of verotoxin (Shiga-like Toxin) - producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol. 1993:31:2483-8. Beutin L, Geier D, Zimmermann S, et al. Virulence markers of Shiga-like Toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J Clin Microbiol. 1995;33:631-5.

244 Pathogenic Escherichia coli in Latin America

[77]

[78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105]

Pestana de Castro et al.

Beutin L, Geier D, Zimmermann S, et al. Epidemiological relatedness and clonal types of natural populations of Escherichia coli strains producing Shiga toxins in separate populations of cattle and sheep. Appl Environm Microbiol. 1997;63:2175-80. Djordjevic SP, Hornitzky MA, Barley G, et al. Virulence properties and serotypes of Shiga Toxin-producing Escherichia coli from healthy Australian slaughter-age sheep. J Clin Microbiol. 2001;39:2017-21. Djordjevic SP, Ramachandran V, Bettelheim KA, et al. Serotypes and virulence gene profiles of Shiga toxin-producing Escherichia coli strains isolated from feces of pasture-fed and lot-fed sheep. Appl Environm Microbiol. 2004;70:3910-7. Blanco M, Blanco JE, Mora A, et al. Serotypes, virulence genes, and intimin types of Shiga Toxin (Verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J Clin Microbiol. 2003;41:1351-6. Brett KN, Ramachandran V, Hornitzky MA, et al. stx1c is the most common Shiga toxin 1 subtype among Shiga toxinproducing Escherichia coli isolates from sheep but not among isolates from cattle. J Clin Microbiol. 2003;41:926-36. Urdahl AM, Beutin L, Skjerve E, et al. Animal host associated differences in Shiga toxin-producing Escherichia coli isolated from sheep and cattle on the same farm. J Appl Microbiol. 2003;95:92-101. Vettorato MP, Leomil L, Guth BEC, et al. Properties of Shiga toxin-producing Escherichia coli (STEC) isolates from sheep in the state of São Paulo, Brazil. Vet Microbiol. 2003;95:103-9. Parma AE, Sanz ME, Viñas MR, et al. Toxigenic Escherichia coli isolated from pigs in Argentina. Vet Microbiol. 2000;72:269-76. Parma AE. Conference: Reservoirs. Symposium: Shiga toxin-producing Escherichia coli (STEC): epidemiology and prevention. In: IV Congreso Argentino de Infectología, Mar del Plata, Argentina. May 7-9, 2004. Mercado EC, Rodríguez SM, Elizondo AM, et al. Isolation of Shiga toxin-producing Escherichia coli from a South American camelid (Lama guanicoe) with diarrhea. J Clin Microbiol. 2004;42;4809-11. Leotta GA, Deza N, Origlia J, et al. Detection and characterization of Shiga toxin-producing Escherichia coli in captive non-domestic mammals. Vet Microbiol. 2006;118:151-7. Adesiyun AA. Absence of Escherichia coli O157 in a survey of wildlife from Trinidad and Tobago. J Wild Dis. 1999;35:115-20. Broes A. Les Escherichia coli pathogènes du chien et du chat. Ann Méd Vét. 1993;137:377-84. Beutin L. Emerging enterohaemorrhagic Escherichia coli, causes and effects of the rise of a human pathogen. J Vet Med B Infect Dis Vet Public Health. 2006;53:299-305. Greenquist MA, Drouillard JS, Sargeant JM, et al. Comparison of rectoanal mucosal swab cultures and fecal cultures for determining prevalence of Escherichia coli O157:H7 in feedlot cattle. Appl Environ Microbiol. 2005;71:6431-3. Gallien P, Klie H, Lehmann S, et al. Detection of verotoxin-producing E. coli in field isolates from domestic and agricultural animals in Sachsen-Anhalt. Berl Munch Tierarztl Wochenschr. 1994;107:331-4. Khakhria R, Duck D, Lior H. Extended phage-typing for E. coli O157:H7. Epidem. Infect. 1990;105:511–20. Dell'Orco M, Bertazzolo W, Pagliaro L, et al. Hemolytic-uremic syndrome in a dog. Vet Clin Pathol. 2005;34:264–9. Sancak AA, Rutgers HC, Hart CA, et al. Prevalence of enteropathic Escherichia coli in dogs with acute and chronic diarrhoea. Vet Rec. 2004;154:101–6. Beutin L. Escherichia coli as a pathogen in dogs and cats. Vet Res 1999; 30: 285-98. Abaas S, Franklin A, Kühn I, et al. Cytotoxin activity on Vero cells among Escherichia coli strains associated with diarrhea in cats. Am J Vet Res. 1989;50:1294–6. Bentancor A, Rumi MV, Gentilini MV, et al. Shiga toxin-producing and attaching and effacing Escherichia coli in cats and dogs in a high hemolytic uremic syndrome incidence region in Argentina. FEMS Microbiol Lett. 2007;267:37-41. Johnson JR, Stell AL, Delavari P. Canine feces as a reservoir of extraintestinal pathogenic Escherichia coli. Infect Immun. 2001;69:1306-14. Staats JJ, Chengappa MM, DeBey MC, et al. Detection of Escherichia coli Shiga toxin (stx) and enterotoxin (estA and elt) genes in fecal samples from non-diarrheic and diarrheic greyhounds. Vet Microbiol. 2003;94:303-12. Sommerfelt I, Franco A. Relaciones entre el hombre y los animales de compañía. Rev Med Vet. 2001;83:181–4. Bentancor A, Agostini A, Rumi MV, et al. Factores de riesgo de infección con cepas de Escherichia coli Shigatoxigénicas en perros y gatos. InVet 2008;10:1-13. Leotta GA, Chinen I, Epszteyn S, et al. Validación de una técnica de PCR múltiple para la detección de Escherichia coli productor de toxina Shiga. Rev Arg Microbiol. 2005;37:1-11. Belanger SD, Boissinot M, Menard C, et al. Rapid detection of shiga toxin-producing bacteria in feces by multiplex PCR with molecular beacons on the smart cycler. J Clin Microbiol. 2002;40:1436-40. Bentancor A, Calviño M, Manfredi F, et al. Isolation of Shiga toxin-producing Escherichia coli from household pets and Rattus rattus related to sporadic hemolytic uremic syndrome cases. In: 7th International Symposium on Shiga toxin (Verocytotoxin)-producing Escherichia coli infections. Buenos Aires. May 10-13, 2009;74.

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 245

[106] Rumi MV, Irino K, Huguet M, et al. Primer aislamiento de STEC 0145:H- en gato doméstico en un estudio de brote de síndrome urémico hemolítico.III Congreso Latinoamericano de Zoonosis. Buenos Aires. June 18-20, 2008;57-58. [107] Paula CJS, Marin JM. Multidrug-resistant Shiga toxin-producing Escherichia coli in dogs with diarrhea. Arq Bras Med Vet Zootec. 2009;61:511-4. [108] Hammermueller J, Kruth S, Prescot J, et al. Detection of toxin genes in Escherichia coli isolated from normal dogs and dogs with diarrhea. Can J Vet Res. 1995;59:265-70. [109] Nakazato G, Gyles CL, Ziebell K, et al. Attaching and effacing Escherichia coli isolated from dogs in Brazil: characteristics and serotypic relationship to human E. coli (EPEC). Vet Microbiol. 2004;101:269-77. [110] Sack RB, Gorbach SL, Banwell JG, et al. Enterotoxigenic Escherichia coli isolated from patients with severe cholera-like disease. J Infect Dis. 1971;123:378-85. [111] Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123-40. [112] Campero C, Odeon A, Binsztein N, et al. Characterization of strains of Escherichia coli isolated from calves with neonatal diarrhea. Rev Argent Microbiol. 1985;17:203-8. [113] Bellinzoni RC, Blackhall J, Terzolo HR, et al. Microbiology of diarrhoea in young beef and dairy calves in Argentina. Rev Argent Microbiol. 1990;22:130-6. [114] Cornaglia EM, Fernández FM, Gottschalk M, et al. Reduction in morbidity due to diarrhea in nursing beef calves by use of an inactivated oil-adjuvanted rotavirus-Escherichia coli vaccine in the dam. Vet Microbiol. 1992;30:191-202. [115] Garabal JI, González EA, Vázquez F, et al. Serogroups of Escherichia coli isolated from piglets in Spain. Vet. Microbiol. 1996;48:113-23. [116] Mercado EC, Rodríguez SM, D'Antuono AL, et al. Occurrence and characteristics of CS31A antigen-producing Escherichia coli in calves with diarrhoea and septicaemia in Argentina. J Vet Med B Infect Dis Vet Public Health. 2003;50:8-13. [117] Said AC, Serafim MB, Pestana de Castro AF. Evaluation of the Biken test to detect heat-labile (LT) enterotoxin produced by porcine and human Escherichia coli strains. Ann Inst Pasteur Microbiol. 1987;138:657-66. [118] Leite DS, Yano T, Pestana de Castro AF. Production, purification and partial characterization of a new adhesive factor (F42) produced by enterotoxigenic Escherichia coli isolated from pigs. Ann Inst Pasteur Microbiol. 1988;139:295-06. [119] Carvalho AC, Avila FA, Schocken-Iturrino RP, et al. Virulence factors in Escherichia coli strains isolated from pigs in the Ribeirao Preto region, State of Sao Paulo, Brazil. Rev Elev Med Vet Pays Trop. 1991;44:49-52. [120] Silva VL, Nicoli JR, Nascimento TC, et al. Diarrheagenic Escherichia coli strains recovered from urban pigeons (Columba livia) in Brazil and their antimicrobial susceptibility patterns. Curr Microbiol. 2009;59:302-8. [121] Ohno A, Marui A, Castro ES, et al. Enteropathogenic bacteria in the La Paz River of Bolivia. Am J Trop Med Hyg. 1997;57:438-44. [122] Alam M, Nur-A-Hasan, Ahsan S, et al. Phenotypic and molecular characteristics of Escherichia coli isolated from aquatic environment of Bangladesh. Microbiol Immunol. 2006;50:359-70. [123] Khalil K, Lindblom GB, Mazhar K, et al. Flies and water as reservoirs for bacterial enteropathogens in urban and rural areas in and around Lahore, Pakistan. Epidemiol Infect. 1994;113:435-44. [124] Ayulo AM, Machado RA, Scussel VM. Enterotoxigenic Escherichia coli and Staphylococcus aureus in fish and seafood from the southern region of Brazil. Int J Food Microbiol. 1994;24:171-8. [125] Teophilo GN, dos Fernandes Vieira RH, dos Prazeres Rodrigues D, et al. Escherichia coli isolated from seafood: toxicity and plasmid profiles. Int Microbiol. 2002;5:11-4. [126] Naimi TS, Wicklund JH, Olsen SJ, et al. Concurrent outbreaks of Shigella sonnei and enterotoxigenic Escherichia coli infections associated with parsley: implications for surveillance and control of foodborne illness. J Food Prot. 2003;66:535-41. [127] Bustos C, Zurita L, Smith P, et al. Humoral immune response anti K99 pilus from enterotoxigenic Escherichia coli in experimentally inoculated calves. Biol Res. 1995;28:277-82. [128] Cicuta ME, Miranda AO, Roibón WR, et al. Colibacillosis in swine: proof of vaccine efficacy. Rev Latinoam Microbiol. 1999;41:263-5. [129] Johnson JR, Murray AC, Gajewski A, et al. Isolation and molecular characterization of nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from retail chicken products. Antimicrob Agents Chemother. 2003;47:2161–8. [130] Johnson JR, Russo TA. Molecular epidemiology of extraintestinal pathogenic (uropathogenic) Escherichia coli. Int J Med Microbiol. 2005;295:383-04. [131] Parreira VR, Arns CW, Yano T. Virulence factors of avian Escherichia coli associated with swollen head syndrome. Avian Pathol. 1998;27:148-54. [132] Parreira VR, Yano T. Cytotoxin produced by Escherichia coli isolated from chickens with swollen head syndrome (SHS). Vet Microbiol. 1998;62:111-9.

246 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

[133] Salvadori MR, Yamada AT, Yano T. Morphological and intracellular alterations induced by cytotoxin VT2y produced by Escherichia coli isolated from chickens with swollen head syndrome. FEMS Microbiol Lett. 2001;197:79-84. [134] Salvadori MR, Chudzinski-Tavassi AM, Baccaro MR, Ferreira CS, et al. Lethal factor to mice produced by Escherichia coli isolated from chickens with swollen head syndrome. Microbiol Immunol. 2002;46:773-5. [135] Parreira VR, Gyles CL. Shiga toxin genes in avian Escherichia coli. Vet Microbiol. 2002;87:341-52. [136] Salvadori MR, Yano T, Carvalho HE, et al. Vacuolating cytotoxin produced by avian pathogenic Escherichia coli. Avian Dis. 2001;45:43-51. [137] Stehling EG, Yano T, Brocchi M, et al. Characterization of a plasmid-encoded adhesin of an avian pathogenic Escherichia coli (APEC) strain isolated from a case of swollen head syndrome (SHS). Vet Microbiol. 2003;95:111-20. [138] Dias da Silveira W, Ferreira A, Brocchi M, et al. Biological characteristics and pathogenicity of avian Escherichia coli strains. Vet Microbiol. 2002;85:47-53. [139] Fantinatti F, Silveira WD, Pestana de Castro AF. Characteristics associated with pathogenicity of avian septicaemic Escherichia coli strains. Vet Microbiol. 1994;41:75-86. [140] Vidotto MC, Müller EE, de Freitas JC, et al. Virulence factors of avian Escherichia coli. Avian Dis. 1990;34:531-8. [141] Ramirez Santoyo RM, Moreno Sala A, Almanza Marquez Y. Avian Escherichia coli virulence factors associated with coli septicemia in broiler chickens. Rev Argent Microbiol. 2001;33:52-7. [142] da Rocha AC, da Silva AB, de Brito AB, et al. Virulence factors of avian pathogenic Escherichia coli isolated from broilers from the south of Brazil. Avian Dis. 2002;46:749-53. [143] Delicato ER, de Brito BG, Gaziri LC, et al. Virulence-associated genes in Escherichia coli isolates from poultry with colibacillosis. Vet Microbiol. 2003;94:97-03. [144] Vidotto MC, Gaziri LC, Delicato ER. Virulence-associated genes in Escherichia coli isolates from poultry with colibacillosis: correction. Vet Microbiol. 2004;102:95-6. [145] Delicato ER, de Brito BG, Konopatzki AP, et al. Occurrence of the temperature-sensitive hemagglutinin among avian Escherichia coli. Avian Dis. 2002;46:713-6. [146] Johnson TJ, Wannemuehler Y, Doetkott C, et al. Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. J Clin Microbiol. 2008;46:3987-96. [147] Rodrigues VS, Vidotto MC, Felipe I, et al. Apoptosis of murine peritoneal macrophages induced by an avian pathogenic strain of Escherichia coli. FEMS Microbiol Lett.1999;179:73-8. [148] Bastiani M, Vidotto MC, Horn F. An avian pathogenic Escherichia coli isolate induces caspase 3/7 activation in J774 macrophages. FEMS Microbiol Lett. 2005;253:133-40. [149] Vidotto MC, Navarro HR, Gaziri LC. Adherence pili of pathogenic strains of avian Escherichia coli. Vet Microbiol. 1997;59:79-87. [150] Stehling EG, Campos TA, Brocchi M, et al. The expression of plasmid mediated afimbrial adhesin genes in an avian septicemic Escherichia coli strain. J Vet Sci. 2008;9:75-83. [151] Ramírez RM, Almanza Y, González R, et al. Avian pathogenic Escherichia coli bind fibronectin and laminin. Vet Res Commun. 2009;33:379-86. [152] Amabile de Campos T, Stehling EG, Ferreira A, et al. Adhesion properties, fimbrial expression and PCR detection of adhesin-related genes of avian Escherichia coli strains. Vet Microbiol. 2005;106:275-85. [153] Rosario CC, Puente JL, Verdugo-Rodríguez A, et al. Phenotypic characterization of ipaH+ Escherichia coli strains associated with yolk sac infection. Avian Dis. 2005;49:409-17. [154] Rosario CC, López AC, Téllez IG, et al. Serotyping and virulence genes detection in Escherichia coli isolated from fertile and infertile eggs, dead-in-shell embryos, and chickens with yolk sac infection. Avian Dis. 2004; 48: 791-02. [155] de Brito BG, Gaziri LC, Vidotto MC. Virulence factors and clonal relationships among Escherichia coli strains isolated from broiler chickens with cellulitis. Infect Immun. 2003;71:4175-7. [156] Monroy MA, Knöbl T, Bottino JA, et al. Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comp Immunol Microbiol Infect Dis. 2005;28:1-15. [157] da Silveira WD, Ferreira A, Lancellotti M, et al. Clonal relationships among avian Escherichia coli isolates determined by enterobacterial repetitive intergenic consensus (ERIC)-PCR. Vet Microbiol. 2002;89:323-8. [158] da Silveira WD, Lancellotti M, Ferreira A, Solferini VN, et al. Determination of the clonal structure of avian Escherichia coli strains by isoenzyme and ribotyping analysis. J Vet Med B Infect Dis Vet Public Health. 2003;50:63-9. [159] Carvalho de Moura AC, Irino K, Vidotto MC. Genetic variability of avian Escherichia coli strains evaluated by enterobacterial repetitive intergenic consensus and repetitive extragenic palindromic polymerase chain reaction. Avian Dis. 2001;45:173-81. [160] Guimarães de Brito B, Leite DdaS, Linhares EC, et al. Virulence-associated factors of uropathogenic Escherichia coli strains isolated from pigs. Vet Microbiol. 1999;65:123-32.

Escherichia coli Animal Reservoirs

Pathogenic Escherichia coli in Latin America 247

[161] Siqueira AK, Ribeiro MG, Leite DdaS, et al. Virulence factors in Escherichia coli strains isolated from urinary tract Infection and pyometra cases and from feces of healthy dogs Res Vet Sci. 2009;86:206-10. [162] Knöbl T, Baccaro MR, Moreno AM, et al. Virulence properties of Escherichia coli isolated from ostriches with respiratory disease. Vet Microbiol. 2001;83:71-80. [163] Duarte ER, Hamdan JS. Otitis in cattle, an etiological review. J Vet Med B Infect Dis Vet Public Health. 2004;51:1-7. [164] Mercado EC, Rodríguez SM, Elizondo AM, et al. Characterization of cytotoxic necrotizing factor-producing Escherichia coli isolated from cattle in Argentina, In: Congreso Panamericano de Veterinaria. Buenos Aires, October 24-28, 2004. [165] Neter E, Westphal O, Lüderitz O, et al. Demonstration of antibodies against enteropathogenic Escherichia coli in sera of children of various ages. Pediatrics. 1955;16:801-8. [166] Trabulsi LR, Manissadjan A, Penna HAO, et al. Diarréias infantis por colibacilos enteropatogênicos. Rev Inst Med Trop São Paulo. 1961;3:267-70. [167] Hodes HL. The etiology of infantile diarrhea. In: S.Z. Levine (ed), Advances in pediatrics. New York; The Year Book Publishers, 1956; vol. VIII,13-52. [168] Nataro J, Scaletsky IAC, Kaper JB, et al. Plasmid-mediated factors conferring diffuse and localized adherence of enteropathogenic Escherichia coli. Infect Immun. 1985;48:378-83. [169] Scaletsky IAC, Silva MLM, Toledo MRF, et al. Correlation between adherence to HeLa cells and serogroups, serotypes and bioserotypes of Escherichia coli. Infect Immun. 1985;49:528-32. [170] Donnenberger MS, Girón JA, Nataro JP, et al. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence Mol Microbiol. 1992;6:3427-37. [171] Stone KD, Zhang HZ, Carlson LK, et al. A cluster of fourteen genes from Enteropathogenic Escherichia coli to HEp-2 cells for biogenesis of type IV pilus Mol Microbiol. 1996:20:325-37. [172] Trabulsi LR, Keller R, Gomes TAT. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:508-13. [173] Hernandes RT, Elias WP, Vieira MAM, et al. An overview of atypical enteropathogenic Escherichia coli FEMS Microbiol Lett. 2009;297:137-49. [174] Drolet R, Fairbrother, JM, Harel J, et al. Attaching and effacing and enterotoxigenic Escherichia coli associated with enteric colibacillosis in the dog. Can J Vet Res. 1994;58:87-92. [175] Robins-Browne RM, Tokhi AM, Adams LM, et al. Adherence characteristics of attaching and effacing strains of Escherichia coli from rabbits. Infect Immun. 1994;62:1584-92. [176] Carvalho V, Irino K, Onuma DL, et al. Random amplification of polymorphic DNA reveals clonal relationships among enteropathogenic Escherichia coli isolated from non-human primates and humans Braz J Med Bio Res. 2007;40:237-41. [177] Penteado AS, Ugrinovich LA, Blanco J, et al. Serobiotypes and virulence genes of Escherichia coli strains isolated from diarrheic and healthy rabbits in Brazil. Vet Microbiol. 2002;89:41-51. [178] Goffaux F, China B, Janssen, L. et al. Genotypic characterization of enteropathogenic Escherichia coli (EPEC) isolated in Belgium from dogs and cats. Res Microbiol. 2000;151:865-71. [179] Carvalho VM, Gyles CL, Ziebell K, et al. Characterization of monkey enteropathogenic Escherichia coli (EPEC) and human typical EPEC serotype isolates from neotropical nonhuman primates. J Clin Microbiol. 2003:41:1225-34. [180] Morato EP, Leomil L, Beutin L, et al. Domestic cats constitute a natural reservoir of human enteropathogenic Escherichia coli types. Zoonoses Pub Health 2009;56:229-37. [181] Fröhlicher E, Krause G, Zweifel C, et al. Characterization of attaching and effacing Escherichia coli (AEEC) isolated from pigs. BMC Microbiol. 2008; 8:144. [182] Camguilhem R, Milon A. Biotypes and O serogroups of Escherichia coli involved in intestinal infections of weaned rabbits; clues to diagnosis of pathogenic strains. J Clin Microbiol. 1989;27:743-7. [183] Beaudry M, Zhu C, Fairbrother JM, et al. Genotypic and phenotypic characterization of Escherichia coli isolates from dogs manifesting attaching and effacing lesions. J Clin Microbiol. 1996;34:144-5. [184] Scaletsky IC, Pedroso MZ, Fagundes-Neto U. Attaching and effacing enteropathogenic Escherichia coli O18ab invades epithelial cells causes persistent diarrhea. Infect Immun.1996; 64:4876-81. [185] Janke BH, Francis DH, Collins JE, et al. Attaching and effacing Escherichia coli infections in calves, pigs, lambs and dogs. J Vet Invest. 1989;1:6-11. [186] Turk J, Maddox C, Fales W, et al. Examination for heat-stable and Shiga-like toxins and for eaeA gene in Escherichia coli isolates obtained from dogs dying with diarrhea: 122 cases. J Am Vet Med Assoc. 1998;212:1735-6. [187] Holland RE, Walker RD, Sriranganathan N, et al. Characterization of Escherichia coli isolated from healthy dogs. Vet Microbiol. 1999;70:261-8. [188] Bentancor A, Vilte DA, Rumi MV, et al. Characterization of non-Shiga toxin- producing Escherichia coli O157 strains isolated from dogs. Rev Argent Microbiol. 2010;42:46-48.

248 Pathogenic Escherichia coli in Latin America

Pestana de Castro et al.

[189] Rodrigues J, Thomazini CM, Lopes CAM, et al. Concurrent infection in a dog and colonization in a child with human enteropathogenic Escherichia coli clone. J Clin Microbiol. 2004;42:1338-9. [190] Moura RA, Sircilli MP, Leomil L, et al. Clonal relationship among atypical enteropathogenic Escherichia coli strains isolated from different animal species and human. Appl Environ Microbiol. 2009;75:7399-7408.

Pathogenic Escherichia coli in Latin America, 2010, 249-255

249

CHAPTER 16 Host-pathogen Communication Marcelo P Sircili1*, Cristiano G Moreira2 and Vanessa Sperandio2 1

Laboratório de Bacteriologia, Instituto Butantan, São Paulo, SP, 05503-900, Brazil, 2University of Texas Southwestern Medical Center, Department of Microbiology, Dallas, TX 75390-9048, USA Abstract: Chemical communication between pathogens and host mucosal cells corresponds to a dynamic array of molecular interactions. The signature molecules unique to microbial pathogens allow the mammalian immune system to recognize them as a foreign element. This recognition is usually mediated by receptor proteins, which can be classified as toll-like receptors, and recently described as nod-like receptors. These interactions result in innate immune responses targeted against the invading organism. Pathogens also elaborate a variety of proteins that actively engage host signaling pathways and subvert them to facilitate their growth and dispersal. The host function alterations are mediated by microbial pathogens including inflammatory responses, secretory responses, alteration of host cytoskeleton, disruption of epithelial tight junctions and apoptosis. Important interactions between pathogens and host cell involves chemical signaling, that depends on cell density and signaling molecules identified as autoinducers that function as hormone-like molecules in a phenomenon also known as quorum sensing. Pathogens can use these systems to colonize and cause disease in the host, and we will further discuss these mechanisms in this chapter. Chemical signaling involved in these interactions are potential targets for therapeutic strategies against infectious microbes.

BACTERIAL INTERCELLULAR COMMUNICATION Before 1970 bacterial ability to recognize molecules produced by another bacteria as well as act in a multicellular behavior communicating with another cell was a dogma. This premise started to change after observations made at the early seventies involving the bioluminescence phenomena in Vibrio fisheri strains [1]. They noticed that V. fisheri bioluminescence was only expressed after a particular cell density had been achieved during the culture growth. This phenomenon was attributed to the production of signaling molecules that allowed cells within a population to communicate with each other, later named as Quorum sensing [2]. Quorum sensing is a cell-to-cell signaling mechanism that refers to the ability of bacteria to respond to chemical hormone-like molecules called autoinducers. When an autoinducer reaches a critical threshold, the bacteria detect and respond to this signal by altering their gene expression [3]. BACTERIAL COMMUNICATION AND HOST INTERACTIONS It is estimated that in humans, the total microbial population within the gastrointestinal (GI) tract (1014) exceeds the total number of mammalian cells (1013) by at least an order of magnitude [4]. The GI tract is the site with the largest and most complex environment in the mammalian host. The density of bacteria along the GI tract can vary greatly, with the majority of the flora residing in the colon (1011 to 1012 bacterial cells/ml). Given the enormous number and diversity of bacteria comprising the GI environment, it should not be surprising that the members of this community somehow communicate among themselves and with the host itself to coordinate various processes [5]. INTER-KINGDOM COMMUNICATION Recent studies on bacterial signaling have revealed an ongoing communication between microorganisms and their hosts. Several host-derived signals are sensed by bacteria. Some of these compounds include tumor necrosis factor alpha [6], interleukin 1 [7], adenosine [8], epinephrine [9], and antimicrobial peptides [10]. These reports have suggested that bacteria can sense the metabolic stress of the host to take advantage of a weakened immune state. *Address correspondence to: Marcelo P. Sircili. Laboratório de Bacteriologia, Instituto Butantan. Av. Vital Brazil 1500 São Paulo, SP, Brazil CEP 05503900. Phone/fax: 55 11 3726 7222 ext 2075. e-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

250 Pathogenic Escherichia coli in Latin America

Sircili et al.

On the other side of the cell-to-cell communication process, the ability of host cells to sense bacterial signaling molecules, such as acyl-homoserine lactones, has also been well shown [11]. The effects of these molecules are diverse and often deleterious for the host, leading to increased bacterial pathogenesis. The first host receptor for these molecules, the nuclear receptors PPRgamma and PPRbeta/delta were recently identified [12]. The activity of these molecules has been shown to modulate host immune responses, promote apoptosis and elicit pro-inflammatory responses. Research on chemical signaling between prokaryotes and eukaryotes has made significant progress in the recent past. Chemical signaling has an obvious mechanistically importance and implication for bacteria-host interactions during the infectious process. SIGNALING SYSTEMS Several signaling systems have been well studied between host-cell pathogens interactions, among them there are at least four involved in chemical signaling described in the literature: 1) AI-1 System, 2) AI-2 System, 3) AI-3/ epinephrine system, and 4) indole. The signaling systems described in E. coli are summarized in Fig. 1. AI-1 system

HSL

SdiA

-Interspecies communication -Biof ilm Formation

AI-2 system

AI-3 Epenephrine/norepinephrine system

AI-2

Lsr

-Lsr operon -Metabolic pathways

AI-3

QseC

QseBHSL

-Motility -HUS

QseF

QseE

- Via ler and espfu -AE lesion and Actin polymerization respectively

Figure 1: Schematic representation of signaling systems in E. coli

AI-1 System and Indole AI-1 system was first described in V. fisheri as responsible for lux operon activation, which culminates in bioluminescence control. The luxR/luxI family and their genes homologues are responsible for the production this respective autoinducer [2]. E. coli does not harbour one luxI homologue and does not produce the autoinducer, although harbours one luxR homologue which is called sdiA. SdiA is responsible for sensing the environmental AI-1 signals produced by other microorganisms [13]. Studies with SdiA mutants have shown that this regulator may be involved in biofilm formation in E. coli. SdiA has been proposed to interact with indole [14], one of the extracellular signals produced by E. coli [15], in addition to acylhomoserine lactones (AHLs) from other bacteria and interacts with them. However, conclusive data demonstrating that SdiA senses indole is lacking. In E. coli, SdiA, named after its ability

Host-pathogen Communication

Pathogenic Escherichia coli in Latin America 251

to suppress cell division inhibitors, is a 240-amino-acid protein that belongs to the LuxR family of transcriptional regulators. Over-expression of SdiA induces the expression of the ftsQAZ locus involved in cell division. Salmonella enterica and E. coli’s SdiA detects quorum sensing signal AHLs produced by other bacteria, although they do not synthesize AHLs [16]. AHLs control social behavior like biofilm formation and virulence. Furthermore, SdiA decreases early E. coli biofilm formation in approximately 50-fold, enhances acid resistance, and it is required to reduce E. coli biofilm formation in the presence of AHLs as well as in the presence of the stationary-phase signal indole [14]. Indole is an E. coli quorum-sensing signal that works primarily at temperatures found outside the human host and reduces biofilm formation [17]. Therefore, SdiA, via interaction with AHLs, is a key protein for intraspecies and interspecies cell communication as well as for biofilm formation [18]. AI-2/luxS System AI-2 was first described in V. harveyi strains and is involved in the control of bioluminescence, in a convergent pathway with AI-1, since these strains possess both signals. It was first described as a universal signal, responsible for interspecies communication [19]. The molecule was described as a furanosyl-borate-diester [20] and the gene responsible for its production was called luxS [21]. The receptor for this system in V. harveyi is called LuxP. The LuxP system is restricted to Vibrio species, moreover there are differences among AI-2 molecules produced by different strains [22]. The AI-2 receptor in E. coli and Salmonella is the LsrB periplasmic protein [23]. Cocrystallization of LsrB with AI-2 demonstrated that its ligand was not a furanosyl-borate-diester, but a furanone [2R, 4S-2-methyl-2,3,3,4-tetrahydrofuran (R-THMF)] [22]. LuxS functions in the pathway for metabolism of S-adenosyl methionine (SAM), the major cellular methyl donor. Transfer of the methyl moiety to various substrates produces the toxic byproduct S-adenosylhomocysteine (SAH). In non-LuxS containing bacteria and eukaryotes, the enzyme SAH hydrolase metabolizes SAH to adenosine and homocysteine. However, in bacteria containing LuxS, two enzymes, Pfs and LuxS, act sequentially to convert SAH to adenine, homocysteine, and the signaling molecule Dihidroxipentanedione (DPD) [24]. DPD is a highly reactive product that can rearrange and undergo additional reactions, which suggests that distinct but related molecules derived from DPD may be the signals that different bacterial species recognize as AI-2. AI-3/ Epinephrine/Norepinephrine System AI-3/epinephrine/norepinephrine system was first described in enterohemorrhagic E. coli O157:H7 (EHEC) strains [9]. It was initially thought that the gene responsible for production of the molecule was luxS, since luxS mutant has diminished AI-3 production. Later, it was shown that luxS mutants have metabolic deficiencies and that the luxS gene is not responsible for AI-3 production [25]. AI-3 is an aromatic molecule that can only be eluted from C18 columns with organic solvents. The host hormones epinephrine and norepinephrine can rescue AI-3-dependent phenotypes in EHEC. Based on that, it has been proposed that this system is involved in host cell-bacteria communication, and inter-kingdom signaling. The AI-3 receptor, QseC sensor kinase [26] has been extensively described in EHEC as well as enteropathogenic E. coli (EPEC) [27] and other species. Subsequently studies showed that AI-3/ epinephrine/norepinephrine system is not restricted to E. coli strains [28]. AI-3 Signaling in EHEC In EHEC, the mammalian hormones epinephrine and norepinephrine, which are released by the host during stress, are sensed by the QseC receptor to regulate bacterial virulence genes [26, 28]. The qseC mutant is attenuated for virulence, which underscores the importance of this inter-kingdom communication to the development of disease [26]. EHEC is part of a group of pathogens that includes EPEC, Citrobacter rodentium, and Hafnia alvei, all of which are able to cause a lesion on the intestinal epithelial cells named the attaching and effacing (AE) lesion. The AE lesion is characterized by the destruction of the microvilli and rearrangement of the cytoskeleton to form a pedestal-like structure, which cups the bacteria individually [29]. The genes involved in the formation of the AE lesion are encoded within a chromosomal pathogenicity island named the Locus of Enterocyte Effacement (LEE) [30]. The LEE region contains five major operons: LEE1, LEE2, LEE3, tir (LEE5), and LEE4 [31, 32], which encode a type III secretion system (TTSS) [33], an adhesin (intimin) [34], and the intimin adhesin receptor (Tir) [35], which is translocated to the epithelial cell through the bacterial TTSS. The EHEC luxS mutant, who presents diminished AI-3 production and does not express the LEE-encoded TTTS system at normal levels, nonetheless still forms AE lesions on epithelial cells that were indistinguishable from those seen with wild type. The luxS mutant was

252 Pathogenic Escherichia coli in Latin America

Sircili et al.

still responding to eukaryotic cell signals to activate expression of the LEE genes. These signals were identified as the hormones epinephrine and norepinephrine. Epinephrine and norepinephrine can substitute for AI-3 to activate transcription of the LEE genes, type III secretion, and AE lesions on epithelial cells. Norepinephrine has been previously reported to induce bacterial growth, and there are reports in the literature that imply that norepinephrine might function as a siderophore [36]. Norepinephrine has been implicated as inducing expression of enterobactin and iron uptake in E. coli, suggesting that this is the mechanism involved in growth induction [37]. However, the role of norepinephrine in bacterial pathogenesis seems to be more complex, since several reports suggested that this signal also activates virulence gene expression in E. coli, such as the EHEC Stx toxin, by an unknown mechanism of induction [38]. Both epinephrine and norepinephrine are present in the GI tract. Norepinephrine is synthesized within the adrenergic neurons present in the enteric nervous system (ENS) [39]. EHEC QS SIGNALING CASCADE Concerning the EHEC AI-3/epinephrine/norepinephrine signaling cascade, a transcriptional regulator from the LysR family, designated as QS E. coli regulator (QseA) [40] has been recently identified. QseA is transcriptionally activated through QS and, in turn, binds to and directly activates transcription of the LEE-encoded regulator (Ler). The qseA mutant in EHEC has a striking reduction in type III secretion, but has no defect in motility, suggesting that QseA only regulates the LEE genes and plays no role in the flagella regulation. Additionally, the QseBC twocomponent system is responsible for the transcriptional activation of the flagella regulon in response to QS. It is well known that many two-component systems act to positively regulate their own transcription. QseBC is no exception to this rule and has also been shown to autoactivate its own transcription [41]. Early studies indicated that an isogenic mutant in the qseC sensor kinase was unable to respond to AI-3 or epinephrine given exogenously [26]. Interestingly, the motility of a luxS mutant can be restored either by the addition of AI-3 or epinephrine, and the transcription of flhDC genes is also activated by both signals. Motility and flhDC transcription in the qseC mutant however is unable to respond to the presence of either AI-3 or epinephrine, indicating that QseC may be sensing the presence of these cross-signaling compounds. QseBC regulates both its own transcription and flhDC expression, and participates in the regulation of other QS phenotypes, such as the LEE genes and Stx production [28, 42]. Three other genes in this signaling cascade have also been identified recently: qseD (encoding another regulator of the LysR family) and qseE and qseF (encoding a second two-component system), which are involved in regulating AE [43]. Additionally, QseE has also been shown to sense epinephrine, sulphate and phosphate, but not AI-3 [44]. The interaction of epinephrine with more than one sensor kinase would also impart a “timing” mechanism to this system, which is a desirable feature given that it would be inefficient for EHEC to produce both the LEE TTSS and flagella simultaneously. The AI-3-dependent QS signaling cascade is present in all Enterobacteriaceae (E. coli, Salmonella spp., Shigella spp., and Yersinia spp.). The most striking feature is that the genes encoding the transcriptional factors of this cascade are always in the exact same context in the chromosome of all these strains and share high levels of identity among these different species, suggesting that this signaling cascade is functionally conserved in Enterobacteriaceae. DRUG DEVELOPMENT Treatment of EHEC infections with conventional antimicrobials is highly ineffective, as it is well documented that antimicrobials activate the Stx phage to enter the lytic cycle, thereby producing and releasing Stx [45, 46]. To circumvent this matter, the development of drugs acting in the pathogens chemical signaling systems without eradicating them and without a selective pressure could be useful against these infections. Based in the fact that EHEC senses AI-3 through QseC, one possible way to prevent the disease would be a drug to block QseC and consequently the downstream signaling cascade. These antimicrobials will not only be useful against diarrheagenic E. coli, as EHEC and EPEC, but also against other pathogens such as Salmonella enterica, Shigella, and Yersinia pestis, all of which harbor this signaling cascade. One recent study was performed and was carried out a high-throughput screening, which employed a library with 150,000 small organic compounds to identify a lead structure the N-phenyl-4-[[(phenylamino)thioxomethyl]amino]benzenesulfonamide or LED209, which selectively blocked the signals binding (AI-3/epinephrine/NE) to QseC, preventing QseC’s autophosphorylation, and consequently inhibiting QseC-mediated activation of virulence gene

Host-pathogen Communication

Pathogenic Escherichia coli in Latin America 253

expression. LED209 inhibited EHEC pathogenesis but did not affect EHEC growth in vitro, i.e. without eliminating EHEC cells. This compound was not toxic to host cells, but inhibited expression of key virulence traits of EHEC pathogenesis (AE lesions and Stx production). LED209 was also able to inhibit Salmonella enterica serovar Typhimurium and Francisella tularensis virulence in vitro and in vivo [28]. Furthermore, the QseC-dependent interkingdom signaling system does not directly affect bacterial growth, i.e. the inhibition of this signaling pathway does not exert a selective pressure towards development of drug resistance. CONCLUDING REMARKS Chemical signaling between cells underlies the basis of multicellularity. Although bacteria are unicellular, bacterial populations also utilize chemical signaling, through hormone-like compounds named autoinducers, to achieve cellcell communication and coordination of behavior. Chemical signaling is also essential for an organism to survive, successfully adapt to ever changing environments and protect themselves from insults, which can be collectively considered stress. Successful stress responses require energy input, and the coordination of many complex signaling pathways within the cell. Co-evolution of prokaryotic species and their respective eukaryotic host have exposed bacteria to hormones and eukaryotic cells to autoinducers. Research on signaling between prokaryotes and eukaryotes has made significant progress in the recent past and it is now obvious that such phenomenon has important implications for bacteria-host interactions. Future studies will not only reveal novel layers of interactions between bacteria and eukaryotes but also help further understand the molecular mechanisms involved in bacteria-host communication. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]

Nealson KH, Platt T, Hastings JW. Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol. 1970;104:313-22. Fuqua WC, Winans SC, Greenberg EP. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J Bacteriol. 1994;176:269-75. Xavier KB, Bassler BL. LuxS quorum sensing: more than just a numbers game. Curr Opin Microbiol. 2003;6:191-7. Berg RD. The indigenous gastrointestinal microflora. Trends Microbiol. 1996;4:430-5. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science. 2001;292:1115-8. Luo G, Niesel DW, Shaban RA, et al. Tumor necrosis factor alpha binding to bacteria: evidence for a high-affinity receptor and alteration of bacterial virulence properties. Infect Immun. 1993;61:830-5. Porat R, Clark BD, Wolff SM, et al. Enhancement of growth of virulent strains of Escherichia coli by interleukin-1. Science. 1991;254:430-2. Kohler JE, Zaborina O, Wu L, et al. Components of intestinal epithelial hypoxia activate the virulence circuitry of Pseudomonas. Am J Physiol Gastrointest Liver Physiol. 2005;288:G1048-54. Sperandio V, Torres AG, Jarvis B, et al. Bacteria-host communication: the language of hormones. Proc Natl Acad Sci. USA. 2003;100:8951-6. Bader MW, Sanowar S, Daley ME, et al. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell. 2005;122:461-72. Kravchenko VV, Kaufmann GF, Mathison JC, et al. Modulation of gene expression via disruption of NF-kB signaling by a bacterial small molecule. Science. 2008;321:259-63. Jahoor A, Patel R, Bryan A, et al. Peroxisome proliferator-activated receptors mediate host cell proinflammatory responses to Pseudomonas aeruginosa autoinducer. J Bacteriol. 2008;190:4408-15. Michael B, Smith JN, Swift S, et al. SdiA of Salmonella enterica is a LuxR homolog that detects mixed microbial communities. J Bacteriol. 2001;183:5733-42. Lee J, Jayaraman A, Wood TK. Indole is an inter-species biofilm signal mediated by SdiA. BMC Microbiol. 2007;7:42. Wang D, Ding X, Rather PN. Indole can act as an extracellular signal in Escherichia coli. J Bacteriol. 2001;183:4210-6. Lindsay A, Ahmer BM. Effect of sdiA on biosensors of N-acylhomoserine lactones. J Bacteriol. 2005;187:5054-8. Lee J, Zhang XS, Hegde M, et al. Indole cell signaling occurs primarily at low temperatures in Escherichia coli. ISME J. 2008;2:1007-23. Lee J, Maeda T, Hong SH, et al. Reconfiguring the Quorum-Sensing Regulator SdiA of Escherichia coli To Control Biofilm Formation via Indole and N-Acylhomoserine Lactones. Appl Env Microbiol. 2009;75:1703-16.

254 Pathogenic Escherichia coli in Latin America

[19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32]

[33]

[34] [35] [36] [37] [38] [39] [40]

[41] [42] [43]

Sircili et al.

Surette MG, Bassler BL. Quorum sensing in Escherichia coli and Salmonella typhimurium.. Proc Natl Acad Sci. USA. 1998;95:7046-50. Chen X, Schauder S, Potier N, et al. Structural identification of a bacterial quorum-sensing signal containing boron. Nature. 2002;415:545-9. Surette M, Miller M, Bassler BL. Quorum sensing in Escherichia coli, Salmonella typhimurium,and Vibrio harveyi: A new family of genes responsible for autoinducer production. Proc Natl Acad Sci. USA. 1999;96:1639-44. Miller S, Xavier K, Campagna S, et al. Salmonella typhimurium Recognizes a Chemically Distinct Form of the Bacterial Quorum-Sensing Signal AI-2. Molecular Cell. 2004;15:677-87. Taga ME, Semmelhack JL, Bassler BL. The LuxS-dependent autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in Salmonella typhimurium. Mol Microbiol. 2001;42:777-93. Schauder S, Shokat K, Surette MG, et al. The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum sensing signal molecule. Mol Microbiol. 2001;41:463-76. Walters M, Sircili MP, Sperandio V. AI-3 synthesis is not dependent on luxS in Escherichia coli. J Bacteriol. 2006;188:5668-81. Clarke MB, Hughes DT, Zhu C, et al. The QseC sensor kinase: a bacterial adrenergic receptor. Proc Natl Acad Sci. USA. 2006;103:10420-5. Sircili MP, Walters M, Trabulsi LR, et al. Modulation of enteropathogenic Escherichia coli virulence by quorum sensing. Infect Immun. 2004;72:2329-37. Rasko DA, Moreira CG, Li dR, et al. Targeting QseC signaling and virulence for antibiotic development. Science. 2008;321:1078-80. Moon HW, Whipp SC, Argenzio RA, et al. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect Immun. 1983;41:1340-51. McDaniel TK, Jarvis KG, Donnenberg MS, et al. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci. USA. 1995;92:1664-8. Elliott SJ, Hutcheson SW, Dubois MS, et al. Identification of CesT, a chaperone for the type III secretion of Tir in enteropathogenic Escherichia coli. Mol Microbiol. 1999;33:1176-89. Mellies JL, Elliott SJ, Sperandio V, et al. The Per regulon of enteropathogenic Escherichia coli: identification of a regulatory cascade and a novel transcriptional activator, the locus of enterocyte effacement (LEE)-encoded regulator (Ler). Mol Microbiol. 1999;33:296-306. Jarvis KG, Giron JA, Jerse AE, et al. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci. USA. 1995;92:7996-8000. Jerse AE, Yu J, Tall BD, et al. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci. USA. 1990;87:7839-43. Kenny B, DeVinney R, Stein M, et al. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell. 1997;91:511-20. Freestone PP, Lyte M, Neal CP, et al. The mammalian neuroendocrine hormone norepinephrine supplies iron for bacterial growth in the presence of transferrin or lactoferrin. J Bacteriol. 2000;182:6091-8. Burton CL, Chhabra SR, Swift S, et al. The growth response of Escherichia coli to neurotransmitters and related catecholamine drugs requires a functional enterobactin biosynthesis and uptake system. Infect Immun. 2002;70:5913-23. Lyte M, Arulanandam BP, Frank CD. Production of Shiga-like toxins by Escherichia coli O157:H7 can be influenced by the neuroendocrine hormone norepinephrine. J Lab Clin Med. 1996;128:392–8. Furness JB. Types of neurons in the enteric nervous system. J Auton Nerv Syst. 2000;81:87–96. Sperandio V, Li CC, Kaper JB. Quorum-sensing Escherichia coli regulator A: a regulator of the LysR family involved in the regulation of the locus of enterocyte effacement pathogenicity island in enterohemorrhagic E. coli. Infect Immun. 2002;70:3085-93. Clarke MB, Sperandio V. Transcriptional autoregulation by quorum sensing Escherichia coli regulators B and C (QseBC) in enterohaemorrhagic E. coli (EHEC). Mol Microbiol. 2005;58:441-55. Hughes DT, Clarke MB, Yamamoto K, et al. The QseC adrenergic signaling cascade in Enterohemorrhagic E. coli (EHEC). PLoS Pathog. 2009;5:e1000553. Reading NC, Torres AG, Kendall MM, et al. A novel two-component signaling system that activates transcription of an enterohemorrhagic Escherichia coli effector involved in remodeling of host actin. J Bacteriol. 2007;189:2468-76.

Host-pathogen Communication

[44] [45] [46]

Pathogenic Escherichia coli in Latin America 255

Reading NC, Rasko DA, Torres AG, et al. The two-component system QseEF and the membrane protein QseG link adrenergic and stress sensing to bacterial pathogenesis. Proc Natl Acad Sci. USA. 2009;106:5889-94. Kimmitt PT, Harwood CR, Barer MR. Induction of type 2 Shiga toxin synthesis in Escherichia coli O157 by 4-quinolones. Lancet. 1999;353:1588-9. Kimmitt PT, Harwood CR, Barer MR. Toxin gene expression by shiga toxin-producing Escherichia coli: the role of antibiotics and the bacterial SOS response. Emerg Infect Dis. 2000;6:458-65.

256

Pathogenic Escherichia coli in Latin America, 2010, 256-261

CHAPTER 17 Future of Escherichia coli Research in Latin America Tânia AT Gomes1, Cristina Ibarra2, Fernando Navarro-Garcia3, Marina Palermo4, Valeria Prado5, Marta Rivas6 and Alfredo G Torres7* 1

Departmento de Microbiologia, Imunologia, e Parasitologia, Universidade Federal de São Paulo, São Paulo, Brazil; 2Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires; 3Department of Cell Biology, Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV-IPN), México DF, Mexico; 4 Departamento de Inmunología, Academia Nacional de Medicina and ILEX-CONICET, Buenos Aires, Argentina; 5 Programa de Microbiología, ICBM, Facultad de Medicina, Universidad de Chile, Santiago, Chile; 6Servicio Fisiopatogenia, Instituto Nacional de Enfermedades Infecciosas – ANLIS “Dr. C. G. Malbrán”, Buenos Aires, Argentina; 7Department of Microbiology and Immunology, Department of Pathology and the Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas, U.S.A. Abstract: In the 21st century, diarrhea is still a leading cause of illness and death especially in children in Latin American countries. ETEC, EHEC, EPEC, and EAEC remain as the major categories of pathogenic E. coli associated with diarrheal disease; however, it is evident that a shift in the serotypes responsible for human disease is occurring in this region. Recent reports implicated atypical EPEC as an important emerging category of E. coli and the association of EHEC O157:H7 as a cause of hemolytic uremic syndrome in Latin America is becoming evident. Significant improvements are required in the area of early diagnosis to increase the likelihood of an effective treatment. In this region, very few studies have addressed the emergence of antimicrobial resistance and high asymptomatic carriage rates for diarrheagenic E. coli (DEC), as well as non-human reservoirs and vehicles of transmission, are largely unknown. It is evident that broadening the epidemiological surveys to include emerging and re-emerging categories of DECs while increasing the capabilities of detection and novel treatment is a priority for the future of the E. coli research in Latin America.

INTRODUCTION Diarrheal episodes due to DEC infections remain as an important public health issue in Latin America because their association with morbidity and mortality of children under 5 years of age. During the past 5 years, the prevalence of specific serotypes of E. coli have been replaced by new categories of pathogenic E. coli, making this a new challenge because no much is known about the virulence of these new serotypes [1]. Thus, it is imperative that effective diagnostic and epidemiological strategies be implemented in hospitals, clinics, etc., to identify, categorize, and evaluate the new pathogenic E. coli isolates. Further, new and effective preventive and treatment measures need to be implemented to control E. coli infections. It is plausible that vaccination may offer a safe and effective means of preventing infections with the main categories of E. coli; therefore, more efforts need to be placed in this area of research. HOW CAN WE IMPLEMENT RELIABLE DIAGNOSTIC TEST TO IDENTIFY DIARRHEAGENIC E. coli? The majority of all known categories of DECs have been detected in Latin America. However, the epidemiology of DECs in this region is poorly understood, and very unevenly studied, regardless of the significant contribution that these pathogens make to the burden of illness in Latin America. Despite published epidemiological studies, these are restricted to 4 major countries: Argentina, Brazil, Chile and Mexico. Epidemiological studies in different countries could contribute to identify risk factors associated with country-specific habits, thus leading to recommendations of simple, rapid, and effective risk-reduction procedures to decrease morbidity and mortality. The lack of or very limited information available from the other countries could be related to the inability of the investigators to publish studies in peer-reviewed journals due to high cost, language barrier, or lack of interest by them or the official *Address correspondence to: Alfredo G. Torres, Department of Microbiology and Immunology, University of Texas Medical Branch, 301 University Blvd, Galveston, Texas 77555-1070; Tel (409) 747-0189. E-mail: [email protected] Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Future of Escherichia coli Research in Latin America

Pathogenic Escherichia coli in Latin America 257

authorities. Other reason could be the lack of capacity to detect and further differentiate the different categories of diarrheagenic E. coli, either for research or clinical purposes, ignoring the fact that these organisms are among the most common causes of disease in these countries. The majority of the studies performed in Latin America are country-specific and sometimes city-specific, and multinational studies have been rarely performed. In many countries performing epidemiological studies, biochemical characterization of the isolates is often performed in the local clinical laboratories while serotyping and further classification of the E. coli pathotypes is performed in references labs in other countries in the continent or Europe. While this approach has result effective for some countries to produce reliable information, it is real barrier for other countries than would benefit from having local detection methods that will accelerate the identification and report of outbreaks, which currently are detected several months or years after they occurred. An example of an effective method in the US for surveillance, tracking trends, guiding prevention strategies, and detecting outbreaks is PulseNet [2]. This network for DNA "fingerprinting" of bacteria that cause foodborne illness, links state public health laboratories, the Center for Disease Control and Prevention (CDC) and the food regulatory agencies together so that multistate outbreaks can be rapidly detected, investigated, and control measures implemented. PulseNet Latin America and the Caribbean has been in operation since 2004 and this network if expanded to all the countries in Latin America should go a long way towards producing further epidemiological knowledge regarding distribution and endemic areas of E. coli O157:H7/NM and non-O157 STEC strains. Whenever possible, future studies need to use tests that are sensitive and specific to detect multiple E. coli pathotypes, without bias towards subtypes that have epidemiological relevance in other parts of the world, for example E. coli O157:H7 or typical enteropathogenic E. coli strains. As such methods necessarily require molecular biology and/or tissue culture, there is need to increase capacity for both on the different Latin American countries. Alternatively, the development and implementation of an appropriate diagnostic methodology in the different countries is required, although it is clear that the big differences in infrastructure remain as a limiting factor for some countries. Because stool culture is expensive, laborious and time consuming, and any evaluation that includes diarrheagenic E. coli increase the costs much more, perhaps the development of a simplified molecular method that will provide information directly from the stool sample, for example, it may be beneficial to screen DNA isolated from stool by multiplex PCR, and in case of positive results, the samples can be further investigated for diarrheagenic E. coli at reference laboratories within the same country. Considering that diarrhea incidence is higher in the areas with fewer resources, it is important to have rapid techniques of screening that can be easily performed, ideally, at the bedside, where the sample can be applied directly, either using chromatographic or immunoassay techniques. IDENTIFICATION OF NOVEL PATHOGENIC E. coli ISOLATES WITH CLINICAL RELEVANCE TO LATIN AMERICA Asymptomatic carriage of enteric pathogens in general and diarrheagenic E. coli in particular has been reported in many Latin American studies and the incidence seems to be high in some regions. Carriage rates are often higher for EAEC, pointing to strain variability and the likelihood that some strains are not pathogens, or at least less virulent than others. Therefore, in order to understand better the epidemiology of these pathogens, an in-depth characterization of isolates from large case-control studies needs to be planned and several countries involved to clarify the pathogenicity index of each category of DEC. Larger studies are more likely to uncover different types of associations with disease when these exist and to identify micro-outbreaks. Even better, population-based studies need to be performed as a way to link isolation rates to disease burden. It is also evident that mixed infections are present in parts of Latin America, including co-infections with pathogenic E. coli and other pathogens, i.e., Shigella, Campylobacter, or co-infection with other categories of pathogenic E. coli. Interactions between different pathogens have not been commonly studied in Latin America and this area of investigation could produce information regarding the effects on the human host. Regarding reservoirs and transmission: certain food products and animals have been directly associated with E. coli infection in humans. Contaminated water and person-to-person transfer of these organisms are probably

258 Pathogenic Escherichia coli in Latin America

Gomes et al.

predominant routes for spread. Water supplies, sanitation, frequency of hand-washing with soap have been instrumental to the reduction of diarrheal episodes in many Latin American countries and they have proven to prevent the acquisition and spread of diarrheagenic E. coli and other pathogens. Likewise, stimulation of breastfeeding has been very effective in reducing the incidence of infantile diarrhea. However, the animal reservoir and/or the way how several categories of pathogenic E. coli survive in the environment are still unknown. It is well documented that cattle and swine serve as reservoirs for EHEC, and contaminated water must make the largest contribution to diarrheal prevalence, but other reservoirs for diarrheagenic E. coli are not well known. Close contact with other species of animals and evidence of zoonotic transmission of enteric organisms means that pathotypes with an animal reservoir will have a high chance of being transmitted to humans. E. coli PATHOGENESIS It is clear that the biology of the different E. coli pathotypes is complex, since each pathotype has a distinct subset of genes involved in the subversion of host responses and hijacking of host cell machinery. In many pathotypes, the same host machinery or process is targeted but the mechanism and outcome is different. Bacterial pathogenesis is a quickly evolving and expanding field. Genetics, genomics and proteomics efforts continue to identify more potential virulence factors, but our understanding of the interactions between virulence factors (i.e., effectors and toxins) and host components, remain incomplete. It is a considerable challenge to integrate the numerous host-cell targets and to translate this knowledge into an accurate understanding of the mechanisms by which effector proteins cause disease [3]. Other interesting field of the bacterial pathogenesis is related with protein secretion. Protein secretion plays a central role in modulating the interactions of bacteria with their host organisms. In pathogenic E. coli, secretion requires translocation across the outer as well as the inner membrane and a diversity of molecular machines have been elaborated for this purpose; at least the known six secretion systems are present in E. coli. A number of secreted proteins are destined to enter the host cell (effectors and toxins), and thus several secretion systems include apparatus to translocate proteins across the plasma membrane of the host also [4]. Expanding the knowledge about how the secreted proteins or effectors are secreted will allow us to direct the quest of their action mechanisms as an addressed initial approach. Pathogenic microbes subvert normal host-cell processes to create a specialized niche, which enhances their survival. A common and recurring target of pathogens is the host cell’s cytoskeleton, which is utilized by these microbes for purposes that include attachment, entry into cells, movement within and between cells, vacuole formation and remodeling, and avoidance of phagocytosis. Our increased understanding of these processes in recent years as well as in the next years will continue contributing to a greater comprehension of the molecular causes of infectious diseases but also to increase our knowledge of cell biology [5]. Regarding to how to understand better the interaction between the different E. coli pathotypes with their cell targets imply new approaches, including the study of clinical isolates of the different pathotypes (as a second step after studies in prototype strains, recognizing the E. coli diversity) and the use of relevant animal diseases models. Switching cultured cells to relevant animal disease models is crucial for understanding disease, yet such studies are often neglected, because cell-culture-based systems are easier to manipulate. However, currently it is possible to genetically engineer animal host to be susceptible to infection [6], as well as the re-engineering o the bacterial effector to extend the host range of this bacterium to include the ideal host (i.e. mice) [7]. These two approaches present an opportunity to probe the host–pathogen interface during disease [8]. On the other hand, new studies have showed that the host microbiota has a crucial role in mediating the outcome of disease, which adds another layer of complexity [9]. Thus, the knowledge in these different issues must be translated into a true understanding of disease. This remains the crucial challenge to all who are involved in this field. PREVENTION AND TREATMENT Additional clinical trials with antibiotics are needed to determine the efficacy of newly developed drugs in preventing or treating diarrheal episodes caused by antibiotic resistant strains of pathogenic E. coli. Scant knowledge of the clinical relevance of more recently described categories of pathogenic E. coli means that, in the cases where

Future of Escherichia coli Research in Latin America

Pathogenic Escherichia coli in Latin America 259

antimicrobials are required, treatment protocols may not be optimal. For example, the use of antimicrobials for bloody diarrhea cases is contra-indicated when is associated with Shiga-toxin-producing E. coli infections because some evidence suggests that antibiotics increase the risk for HUS [10, 11]. In the majority of diarrhea episodes for which antimicrobials are not indicated, they are often prescribed because of the difficulty in distinguishing self-resolving infections from drug-indicated ones. Physicians and self-medicators would use less antimicrobial agents in this way if we have access to an early diagnosis and can determine which infections might be life-threatening. When antimicrobials are required, studies have shown that common E. coli pathotypes such as EPEC, ETEC, and EAEC are frequently resistant to almost all drugs available and affordable to patients in this part of the world so patients have no access to optimal treatment [12]. In the case of travelers diarrhea caused by ETEC and due to increase resistance, quinolones have replaced doxycycline and trimethoprim-sulphamethoxazole as drugs of choice, but quinolone resistance has since emerged and is increasing [13, 14]. The only promising alternative is rifamixin, a non-absorbable antimicrobial that can be used to treat infections by non-invasive E. coli pathotypes [15]. Availability and costs mean that rifamixin is presently limited to adjusting recommendations for travelers from affluent countries to compensate for the emergence of resistance, a niche occupied until now by ciprofloxacin. However, in the case of Shigella (similar to EIEC infections), which cause invasive dysentery, prevention of these invasive organisms from causing enteric infection, is relatively easier challenge for a non-absorbed antibiotic, like rifamixin, to be effective early during infection than treating enteric disease once the organisms have penetrated the mucosa and caused an inflammatory host response [16]. Other interesting alternative is the use of azithromycin, which has been demonstrated to be effective in the clinic for the treatment of shigellosis and it has a good in vitro activity against DECs; however, additional controlled clinical studies are needed to evaluate their use [17]. Continued study of the occurrence of functional diarrhea and other chronic gastrointestinal diseases is needed with an emphasis on the beneficial effects of prophylactic drugs on reducing these complications. An interesting novel therapeutic strategy is based on short-term inhibition of host Gb3 synthesis to reduce binding and uptake of Stx by host cells. Silberstein et al. [18] have recently shown that pre-treatment of human renal tubular epithelial cells for 48 h with C9 (Genzyme Corp.), a specific inhibitor of glucosylceramide synthase (the rate limiting first step in glycosphingolipid biosynthesis), caused a marked reduction in cellular Gb3 levels, as well as conferring a significant degree of resistance to Stx2-mediated cytotoxicity. The protective efficacy of C-9 was also demonstrated in an experimental model of Hemolytic Uremic Syndrome (HUS) in rats [19]. Glycosphingolipid inhibitors such as C-9 have been developed for treatment of glycosphingolipidoses such as Fabry and Tay-Sachs disease, but the findings of this study indicate that they may have utility to limit the progression of disease and development of HUS. Another new alternative therapeutic treatment is the use of intravenous humanized monoclonal antibodies anti-Shiga toxins 1 and 2 [20, 21]. The early administration during the initial phase of diarrhea by Shiga toxin-producing E. coli could neutralize the toxin in circulation and to prevent the HUS. Phase 2 clinical studies will star in the near future in Latin America to evaluate their efficacy. It is important to emphasize that their use required of an early diagnosis, identifying the subtypes of EHEC which constitute the major risk factor for development of HUS. Nutritional supplementation, in particular Zinc, has been proposed as a means for promoting small-bowel repair after infection, leading to shorter episodes of persistent diarrhea and resistance to reinfection. Some of these strategies could reduce the burden of disease from diarrheagenic E. coli. Preventing diarrheal episodes in the first place must be a primary goal [22]. VACCINATION Although significant advances have been made for vaccine research and development in some pathogenic E. coli categories, there still remain several important issues and challenges that need special attention. For example, the immunogenicity and efficacy of licensed vaccines, such as whole cell/recombinant B subunit (WC/rBS) oral ETEC vaccine, remain to be elucidated in infants, and they have yet to be fully implemented in areas where the disease is endemic, including Latin America [23, 24]. Vaccine candidates against enterotoxigenic E. coli and other

260 Pathogenic Escherichia coli in Latin America

Gomes et al.

diarrheagenic E. coli strains also face serious challenges. For those candidate vaccines already in clinical trials, there are initial indications that the immunogenicity might be lower in infants in less developed countries than in those from industrialized countries, and, therefore, the clinical efficacy of these vaccines needs to be evaluated in infant populations in developing countries [24, 25]. Further, the diarrheagenic E. coli candidate vaccines also have to cope with the multiplicity of protective antigens which need to be included in the vaccine and with the geographical diversity of circulating serotypes of the bacteria. One additional problem is that the immune correlates of protection are not clearly understood for any of these intestinal pathogenic E. coli vaccines. The current problem in developing effective vaccines is complex, because it is necessary to create a multivalent vaccine of universal utility to those endemic regions where DECs are prevalent. It is necessary to understand the epidemiological reality of different geographic areas, to define which DEC pathotypes of mayor importance are, i.e., those associated with severe diarrhea and death. Then, the conserved immunologic epitopes need to be determined and included in a vaccine that ideally, it is administered by the oral route. Although many of these challenges remain to be overcome, the involvement of the public health sector and the high priority given to vaccine research and development in this field bode well for the future. Such a combined public health effort coupled with the extensive and active investigations being conducted by the academic and research community should finally bring hope for the control of diarrheal diseases in infants and young children around the globe. HEALTH PROMOTION AND EDUCATION Although several Latin American countries, through their Ministries of Health, have performed successful campaigns to educate people regarding the actions that have to be taken to reduce diarrheal cases caused by enteric organisms, several countries are not investing enough money or resources. For example, the recent earthquake in Haiti exposes some of the discrepancies in health and education that still persist in the American continent in the 21st century. The Caribbean Island Hispaniola, where the Dominican Republic and Haiti are located, has the lowest investment in public education in Latin America and the Caribbean [26]. As a result of unhygienic and cramped living conditions, the lack of access to health services, and risk-taking behavior, rural populations suffer high rates of persistent health problems including diarrhea, respiratory problems, and other infectious diseases. Limited access to education and generally poor educational quality has further exacerbated the marginalization of poor Latin American individuals. The Ministries of Health in each country need to initiate or continue promoting campaigns in critical areas like nutrition, preventive healthcare, water and sanitation, and education. In the area of preventive health, it is necessary to educate the population about health risks and providing them with the necessary tools to avoid these risks, including training on prevention of diarrheal diseases and the promotion of closer relations between community and health care providers. Further, it is important to emphasize improvement of family nutrition, with a particular focus on child health. As the gap between rich and poor in Latin America and the Caribbean countries continues to grow wider, bringing the benefits of education to the most disadvantaged children becomes progressively more difficult. Education cannot be effective if children in the region do not have access to adequate health care, good nutrition and live in a stable home environment. Therefore, a priority in the different countries needs to be the promotion of health, nutrition and early childhood development schemes within their education projects. REFERENCES [1] [2] [3] [4] [5] [6]

Ochoa TJ, Barletta F, Contreras C, et al. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans R Soc Trop Med Hyg. 2008;102:852-6. Jones TF, Scallan E, Angulo FJ. FoodNet: overview of a decade of achievement. Foodborne Pathog Dis. 2007;4:60-6. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol. 2010;8:26-38. Tseng TT, Tyler BM, Setubal JC. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 2009;9:S2. Gruenheid S, Finlay BB. Microbial pathogenesis and cytoskeletal function. Nature. 2003;422:775-81. Lecuit M, Vandormael-Pournin S, Lefort J, et al. A transgenic model for listeriosis: role of internalin in crossing the intestinal barrier. Science. 2001;292:1722–5.

Future of Escherichia coli Research in Latin America

[7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19]

[20] [21] [22] [23] [24]

[25] [26]

Pathogenic Escherichia coli in Latin America 261

Wollert T, Pasche B, Rochon M, et al. Extending the host range of Listeria monocytogenes by rational protein design. Cell. 2007;129:891-902. Bhavsar AP, Guttman JA, Finlay BB. Manipulation of host-cell pathways by bacterial pathogens. Nature. 2007;449:82734. Lupp C, Robertson ML, Wickham ME, et al. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe. 2007;2:119–29. Saldar N, Adnan S, Gangnon RE, et al. Risk of Hemolytic Uremic Syndrome After Antibiotic Treatment of Escherichia coli O157:H7 Enteritis. JAMA. 2002;288:996-1001. Wong CS, Jelacic S, Habeeb RL, et al. The Risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N Engl J Med. 2000;342:1930-6. Erb A, Stürmer T, Marre R, et al. Prevalence of antibiotic resistance in Escherichia coli: overview of geographical, temporal, and methodological variations. Eur J Clin Microbiol Infect Dis. 2007;26:83-90. Minarini LA, Poirel L, Cattoir V, D et al. Plasmid-mediated quinolone resistance determinants among enterobacterial isolates from outpatients in Brazil. J Antimicrob Chemother. 2008;62:474-8. Rocha-Gracia R, Ruiz E, Romero-Romero S, et al. Detection of the plasmid-borne quinolone resistance determinant qepA1 in a CTX-M-15-producing Escherichia coli strain from Mexico. J Antimicrob Chemother. 2010;65:169-71. Koo HL, DuPont HL. Rifaximin: a unique gastrointestinal-selective antibiotic for enteric diseases. Curr Opin Gastroenterol. 2010;26:17-25. DuPont HL. Travellers' diarrhoea: contemporary approaches to therapy and prevention. Drugs. 2006;66:303-14. Cabada MM, White ACJ. Travelers' diarrhea: an update on susceptibility, prevention, and treatment. Curr Gastroenterol Rep. 2008;10:473-9. Silberstein C, Copeland DP, Chiang W-L, et al. A glucosylceramide synthase inhibitor prevents the cytotoxic effects of Shiga toxin-2 on human renal tubular epithelial cells. J Epith Biol Pharmacol. 2008;1:71-5. Silberstein C, Lucero MS, Zottz E, et al. Effects of a glucosylceramide synthase inhibitor on an experimental model of Hemolytic Uremic Syndrome in rats.. 7th International Symposium of Shiga toxin (Verocytotoxin)-producing Escherichia coli infections 2009 10-13 May 2009; Buenos Aires. Argentina; 2009. Mukherjee J, Chios K, Fishwild D, et al. Production of and characterization of protective human antibodies against shiga toxin 1. Infect Immun. 2002;70:5896-9. Mukherjee J, Chios K, Fishwild D, et al. Human Stx2-specfic monoclonal antibodies prevent systemic complications of Escherichia coli O157:H7 infection. Infect Immun. 2002;70:612-9. Walker RI. Considerations for development of whole cell bacterial vaccines to prevent diarrheal diseases in children in developing countries. Vaccine. 2005;23:3369-85. Girard MP, Steele D, Chaignat CL, et al. A review of vaccine research and development: human enteric infections. Vaccine. 2006;24:2732-50. Svennerholm A-M, Savarino SJ. Oral inactivated whole cell B subunit combination vaccine against enterotoxigenic Escherichia coli. In: Levine MM, Kaper JB, Rappuoli R, Liu MA, Good MF, editors. New Generation Vaccines. 3rd edn ed. New York: Marcel Dekker; 2004. DuPont HL. What's new in enteric infectious diseases at home and abroad. Curr Opin Infect Dis. 2005;18:407-12. Unknown. Programa de Promoción de la Reforma Educativa de América Latina y el Caribe (PREAL). 2006.

262

Pathogenic Escherichia Coli in Latin America, 2010, 262-264

INDEX A Adherence EPEC 27-30 Antibiotic resistance reservoir 3-4 Autotransporters EPEC 33 B Bacterial intercellular communication 249 Bacterial communication and host interactions 249 C Characterization of diarrheagenic E. coli categories 99-100 Clinical aspects EPEC 35 Clinical management of E. coli: Introduction 116 Coliforms 2 Commensals 2-3 Concept of reservoirs 223 Complementary methods for diarrheagenic E. coli characterization 104-107 D DEC in Colombia 214-217 DEC in food, environment and animals, Mexico 199-201 DEC in human disease, Argentina 144-145 DEC in Mexico, conclusions 203-204 DEC in Peru 217-220 DEC in Uruguay 209-214 DEC pathotypes, Mexico 192-194 DEC treatment and antibiotic resistance, Mexico 202-203 Detection and presumptive identification 95-99 Detection and subtyping methods: Introduction 95 Diagnosis EPEC 36 Diagnosis ETEC 89 Diffusely adherent E. coli, Brazil 170-171 Diarrheagenic E. coli (DEC), Argentina: Introduction 142-144 Diarrheal diseases, Mexico: Introduction 191 Differential diagnosis 119 Diversity of virulence factors EPEC 34 Drug development 252-253 E EAEC, Argentina 156-157 EAEC, Brazil 162-164 E. coli O157:H7, Mexico 201-202 EHEC QS signaling cascade 252 Enteric pathogen 4-5 Alfredo G. Torres (Ed) All rights reserved - © 2010 Bentham Science Publishers Ltd.

Index

Enteroaggregative E. coli (EAEC): Introduction 48-49 Enteroinvasive E. coli (EIEC), Argentina 156 Enteropathogenic E. coli (EPEC): Introduction 25-26 Enterotoxigenic E. coli (ETEC): Introduction 84 EPEC, Brazil 164-166 EPEC in animals and food 156 EPEC reservoirs 235-240 Epidemiology 12-19 Epidemiology, Chile 179 Epidemiology, Mexico 194-198 Epidemiology EAEC 49-50 Epidemiology EPEC 34-35 Epidemiology STEC 72-74 Epidemiology STEC, Chile 180-182 Escherichia coli: the organism 1-2 ETEC, Argentina 153-156 ETEC, Brazil 167-168 ETEC reservoirs 230-231 Extraintestinal pathogenic E. coli reservoirs 231-235 Evolution 8-9 F Future in health promotion and education 260 Future in identification of novel pathogenic E. coli isolates 257-258 Future in prevention and treatment 258-259 Future in vaccination 259-260 Future of E. coli pathogenesis 258 Future of E. coli research: Introduction 256 H Host genetic factors ETEC 88 Host genetic susceptibility EAEC 57 I Immune responses EPEC 35-36 Implementing diagnostic test 256-257 Interaction with host intestine EHEC/EPEC and ETEC 122-126 Inter-kingdom communication 249-250 Invasion EPEC 33 M Methods for confirmation of diarrheagenic E. coli 99-104 Mucus hypersecretion 34 N Nosological classification 117 P Pathogenesis EAEC 50-57

Pathogenic Escherichia Coli in Latin America 263

264 Pathogenic Escherichia Coli in Latin America

Pathogenesis EPEC 27 Pathogenesis STEC 67-68 Pathotypes 10-12 Pediatric diarrhea ETEC 84 Pediatric infections ETEC 84-85 Perspectives related to STEC, Chile 187 Prognosis and sequelae 119-120 R Regulation EPEC 33 Reservoirs and transmission EPEC 35 S Serodiagnosis of STEC infections 109 Serotypes EPEC 26 Shiga toxin-producing E. coli (STEC): Introduction 65-66 Signaling systems 250-252 STEC, Argentina 145-153 STEC, Brazil 168-170 STEC food transmitted disease, Chile 183-185 STEC, reservoirs 223-230 STEC HUS D+ 118-119 STEC infections 66-67 Strategies for STEC control, Chile 186-187 Subtyping methods 107-108 Systemic host response during HUS 126-133 T Travellers’ diarrhea ETEC 85 Travellers’ diarrhea, Mexico 198-199 Treatment and control STEC 74-75 Treatment and prophylaxis EAEC 57-58 Treatment and prophylaxis EPEC 36-37 Treatment ETEC 89-90 Type III secretion system EPEC 30-33 V Vaccine EAEC 58 Vaccine ETEC 90-91 Virulence determinants acquisition 9-10 Virulence factors STEC, Chile 182-183 Virulence factors STEC 68-72 Virulence factors ETEC 85-88

Alfredo G. Torres