Batten Disease: Diagnosis, Treatment, Research (Advances in Genetics, Volume 45)

Batten Disease: Diagnosis, Treatment, and Research Batten Disease: Diagnosis, Treatment, and Research Serial Editors ...

171 downloads 752 Views 10MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

Batten Disease: Diagnosis, Treatment, and Research

Batten Disease: Diagnosis, Treatment, and Research Serial Editors Jeffery C. Hall Waltham, Massachusetts Jay C. Dunlap Hanover, New Hampshire Theodore Friedmann La Jolla, California Francesco Giannelli London, United Kingdom

Batten Disease: Diagnosis, Treatment, and Research Edited by

Krystyna E. Wisniewski Nanbert Zhong George A. Jervis Diagnostic and Research Center Staten Island, New York

San Diego San Francisco New York Boston London Sydney Tokyo

∞ This book is printed on acid-free paper.

C 2001 by ACADEMIC PRESS Copyright

All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the Publisher. The appearance of the code at the bottom of the ﬁrst page of a chapter in this book indicates the Publisher’s consent that copies of the chapter may be made for personal or internal use of speciﬁc clients. This consent is given on the condition, however, that the copier pay the stated per copy fee through the Copyright Clearance Center, Inc. (222 Rosewood Drive, Danvers, Massachusetts 01923), for copying beyond that permitted by Sections 107 or 108 of the U.S. Copyright Law. This consent does not extend to other kinds of copying, such as copying for general distribution, for advertising or promotional purposes, for creating new collective works, or for resale. Copy fees for pre-2001 chapters are as shown on the title pages. If no fee code appears on the title page, the copy fee is the same as for current chapters. 0065-2660/01 $35.00 Explicit permission from Academic Press is not required to reproduce a maximum of two ﬁgures or tables from an Academic Press chapter in another scientiﬁc or research publication provided that the material has not been credited to another source and that full credit to the Academic Press chapter is given.

Academic Press A Harcourt Science and Technology Company 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http://www.academicpress.com

Academic Press Harcourt Place, 32 Jamestown Road, London NW1 7BY, UK http://www.academicpress.com International Standard Book Number: 0-12-017645-9 PRINTED IN THE UNITED STATES OF AMERICA 01 02 03 04 05 06 EB 9 8 7 6 5

4

3

2

1

Contents Contributors xi Preface xiii

1 Neuronal Ceroid Lipofuscinoses: Classiﬁcation and Diagnosis

1

Krystyna E. Wisniewski, Elizabeth Kida, Adam A. Golabek, Wojciech Kaczmarski, Fred Connell, and Nan Zhong I. Introduction 3 II. Current Classiﬁcation of NCLs 10 III. CLN1. Diagnostic Criteria and Phenotype–Genotype Correlation 12 IV. CLN2. Classic Late-Infantile NCL 16 V. CLN3. Juvenile NCL 19 VI. CLN4. Adult NCL 24 VII. CLN5. Finnish Late-Infantile Variant 24 VIII. CLN6. Variant Late-Infantile Gypsy/Indian 25 IX. CLN7. Turkish Variant Late-Infantile NCL 25 X. CLN8. Northern Epilepsy 29 XI. Summary 29 References 30

2 Cellular Pathology and Pathogenic Aspects of Neuronal Ceroid Lipofuscinoses

35

Elizabeth Kida, Adam A. Golabek, and Krystyna E. Wisniewski I. Introduction 36 II. CLN1. Infantile Form of NCL: Deﬁciency of Palmitoyl-Protein Thioesterase 1 37 III. CLN2. The Classic Late-Infantile NCL: Deﬁciency of Tripeptidyl-Peptidase I 42 IV. CLN3. Juvenile Form of NCL: Genetic Defect of Lysosomal Membrane Protein 49

v

vi

Contents

V. Other NCL Forms with Known Genetic Defect VI. NCL Forms without Identiﬁed Genetic Defects References 59

3 Positional Candidate Gene Cloning of CLN1

54 56

69

Sandra L. Hofmann, Amit K. Das, Jui-Yun Lu, and Abigail A. Soyombo I. Introduction 70 II. Linkage Disequilibrium Mapping of the CLN1 Locus in the Finnish Population 71 III. Palmitoyl-Protein Thioesterase Deﬁnes a New Pathway in Lysosomal Catabolism 72 IV. Enzymology of PPT 73 V. Posttranslational Processing and Lysosomal Targeting of PPT 75 VI. The Physiological Role of PPT 77 VII. Palmitoyl-Protein Thioesterase-2 (PPT2) 79 VIII. The PPT cDNA and Gene 79 IX. The Molecular Genetics of CLN1/PPT Deﬁciency 81 X. Laboratory Diagnosis of PPT Deﬁciency 86 XI. Prospects for Cause-Speciﬁc Treatment of PPT Deﬁciency 86 References 88

4 Biochemistry of Neuronal Ceroid Lipofuscinoses Mohammed A. Junaid and Raju K. Pullarkat I. II. III. IV.

Introduction 94 Genetic Defects 95 NCL are Lysosomal Storage Diseases 99 Remaining Issues and Future Directions 101 References 103

5 Positional Cloning of the JNCL Gene, CLN3 Terry J. Lerner I. II. III. IV.

Introduction 107 CLN3 Maps to Chromosome 16 A Subunit 9 Gene Is Not CLN3 Reﬁned Localization of CLN3

108 109 109

107

93

vii

Contents

V. Physical Mapping of the CLN3 Candidate Region 111 VI. Exon Trapping Yields a Candidate cDNA 113 VII. The Common Mutation in JNCL is a 1-kb Genomic Deletion 113 VIII. Mutational Analysis of the CLN3 Gene 115 IX. Tissue Expression of CLN3 116 X. CLN3 Encodes a Novel Protein 116 XI. Animal Models of JNCL 117 References 118

6 Studies of Homogenous Populations: CLN5 and CLN8

123

Susanna Ranta, Minna Savukoski, Pirkko Santavuori, and Matti Haltia I. II. III. IV. V. VI. VII. VIII. IX.

Introduction 125 Clinical Data 125 Neurophysiology 127 Neuroradiology 128 Morphology, Cytochemistry, and Biochemistry Molecular Genetics and Cell Biology 132 Diagnosis 135 Treatment 137 Mouse Homolog for CLN8 137 References 138

128

7 Molecular Genetic Testing for Neuronal Ceroid Lipofuscinoses

141

Nanbert Zhong I. II. III. IV. V.

Introduction 142 Specimens Required for Genetic Testing 143 Molecular Genetic Testing for JNCL 144 Molecular Genetic Testing for LINCL and INCL Molecular Screening of Carrier Status in NCL Families 151 VI. Prenatal Diagnostic Testing for NCL 152 VII. Important Issues in the Molecular Genetic Testing 154 References 156

149

viii

Contents

8 Genetic Counseling in the Neuronal Ceroid Lipofuscinoses

159

Susan Sklower Brooks I. II. III. IV. V. VI. VII. VIII.

Introduction 159 Inheritance 160 Genetics 160 Diagnostic Conﬁrmation 161 Genetic Counseling 161 Carrier Screening 162 Reproductive Options 164 Conclusion 165 References 166

9 Neurotrophic Factors as Potential Therapeutic Agents in Neuronal Ceroid Lipofuscinosis

169

Jonathan D. Cooper and William C. Mobley I. Introduction 170 II. Mouse Models of NCLs 170 III. Characterization of the CNS of Mouse Models of NCLs 171 IV. Neurotrophic Factors as Potential Therapeutic Agents in Neurodegenerative Disorders?—The Neurotrophic Factor Hypothesis 173 V. NTF Expression and Actions beyond the “Neurotrophic Factor Hypothesis” 176 VI. Failure of NTF Signaling—A Cause of Neuronal Dysfunction and Degeneration? 177 VII. Treatment with IGF-1—Implications for the Treatment of NCLs 178 VIII. Toward Clinical Trials of NTFs 179 References 179

10 Animal Models for the Ceroid Lipofuscinoses

183

Martin L. Katz, Hisashi Shibuya, and Gary S. Johnson I. The Need for Animal Models 184 II. The Human Disorders 184 III. Naturally Occurring Ceroid Lipofuscinosis in Animals as Models for the Human Disorders 186

ix

Contents

IV. Animal Models Created through Molecular Genetic Manipulation 195 V. Future Directions 198 References 199

11 Experimental Models of NCL: The Yeast Model

205

David A. Pearce I. II. III. IV. V.

Introduction 205 Yeast as a Model for JNCL 206 What Does Btn1p Do? 210 Yeast as a Therapeutic Model for JNCL A Yeast Model for INCL 214 References 215

12 Outlook for Future Treatment

213

217

Nanbert Zhong and Krystyna E. Wisniewski I. Molecular Cloning for CLN4 , CLN6 , and CLN7 218 II. Characterization of Native Substrates for CLN-Encoded Lysosomal Enzymes 218 III. Proteomic Studies of CLN-Encoded Proteins 219 IV. Uncovering the Pathogenesis of the NCLs 219 V. Potential Drugs in Experimental Models May Eventually Lead to Clinical Trials in NCL-Affected Patients 220 VI. Gene Therapy 221 References 222

Appendix: Batten Support Groups United States of America Canadian Chapter 230 European Support Groups Elsewhere 235

Index

237

225 225 230

This Page Intentionally Left Blank

Contributors Numbers in parentheses indicate the pages on which the authors’ contributions begin.

Susan Sklower Brooks (159) Department of Human Genetics, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Fred Connell (1) Department of Pathological Neurobiology, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Jonathan D. Cooper (169) Department of Neurology and Neurological Sciences, and the Program in Neuroscience, Stanford University School of Medicine, Stanford, California 94305 Amit K. Das (69) Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, Texas 75390 Adam A. Golabek (1, 35) Department of Pathological Neurobiology, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Matti Haltia (123) Department of Pathology, University of Helsinki and Helsinki University Central Hospital, 00014 Helsinki, Finland Sandra L. Hofmann (69) Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, Texas 75390 Gary S. Johnson (183) Department of Veterinary Pathobiology, University of Missouri College of Veterinary Medicine, Columbia, Missouri 65211 Mohammed A. Junaid (93) Department of Developmental Biochemistry, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Wojciech Kaczmarski (1) Department of Pathological Neurobiology, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Martin L. Katz (183) University of Missouri School of Medicine, Mason Eye Institute, Columbia, Missouri 65212 Elizabeth Kida (1, 35) Department of Pathological Neurobiology, New York State

xi

xii

Contributors

Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Terry J. Lerner (107) Molecular Neurogenetics Unit, Massachusetts General Hospital, Charlestown, Massachusetts 02129, and Department of Neurology, Harvard Medical School, Boston, Massachusetts 02114 Jui-Yun Lu (69) Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, Texas 75390 William C. Mobley (169) Department of Neurology and Neurological Sciences, and the Program in Neuroscience, Stanford University School of Medicine, Stanford, California 94305 David A. Pearce (205) Center for Aging and Developmental Biology, Department of Biochemistry and Biophysics, University of Rochester School of Medicine and Dentistry, Rochester, New York 14642 Raju K. Pullarkat (93) Department of Developmental Biochemistry, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 Susanna Ranta (123) Department of Molecular Genetics, The Folkh¨alsan Institute of Genetics, 00280 Helsinki, Finland, and Department of Medical Genetics, University of Helsinki, 00014 Helsinki, Finland Pirkko Santavuori (123) Department of Neurology, Hospital for Children and Adolescents, Helsinki University Central Hospital, 00029 Helsinki, Finland Minna Savukoski (123) Department of Human Molecular Genetics, National Public Health Institute, 00300 Helsinki, Finland, and Department of Medical Genetics, University of Helsinki, 00014 Helsinki, Finland Hisashi Shibuya (183) Department of Veterinary Medicine, Nihon University, Fujisawa, Japan 252-8510 Abigail A. Soyombo (69) Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, Texas 75390 Krystyna E. Wisniewski (1, 35, 217) Department of Pathological Neurobiology, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314, and Department of Pediatric Neurology, State University of New York/Health Science Center, Brooklyn, New York 11203 Nanbert Zhong (1, 141, 217) Department of Human Genetics, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314, and Department of Pediatric Neurobiology, State University of New York/Health Science Center, Brooklyn, New York 11203

Preface The highest goal of science, as it is applied to medicine, is to alleviate human suffering. Current research on genes and the human brain focuses on diseases and disorders of the central nervous system, with a broader perspective of obtaining an understanding of how the brain works and how it can be helped to work better if there is a problem. The neuronal ceroid lipofuscinoses (NCLs) are a group of inherited disorders that cause progressive neurological dysfunction. The clinical characteristics may vary from individual to individual and include retinal degeneration, which can lead to progressive blindness, cognitive and/or motor dysfunction, and epilepsy. These disorders mainly affect infants and children; rarely adults. In the past, the NCLs were diagnosed and categorized into four forms on the basis of age-at-onset and ultrastructural ﬁndings. Recent progress in biochemical and molecular genetics inclined us to reevaluate some atypical NCL cases. Eight forms have now been characterized, with numerous common and uncommon mutations, and more are to be identiﬁed. Prevention through early diagnosis, carrier detection, and genetic counseling is now available. Neuroscience, like other disciplines, set out to identify the cellular and molecular building blocks, as well as organizational principles and processes of the central nervous system. As multidisciplinary approaches address the causes of NCL, the underlying defect is still unknown. Hopefully, within the next decade, we will gain a better understanding of the defect. To date, no effective therapy for NCL is available; therefore, more research is vital. These twelve chapters describe the current status of NCL diagnosis, treatment, and research. Krystyna E. Wisniewski Nanbert Zhong

xiii

This Page Intentionally Left Blank

1

Neuronal Ceroid Lipofuscinoses: Classiﬁcation and Diagnosis Krystyna E. Wisniewski* Department of Pathological Neurobiology New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314 and Department of Pediatric Neurology State University of New York/Health Science Center Brooklyn, New York 11203

Elizabeth Kida, Adam A. Golabek, Wojciech Kaczmarski, and Fred Connell Department of Pathological Neurobiology New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314

Nanbert Zhong Department of Human Genetics New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314 and Department of Pediatric Neurobiology State University of New York/Health Science Center Brooklyn, New York 11203

I. Introduction II. Current Classiﬁcation of NCLs III. CLN1. Diagnostic Criteria and Phenotype–Genotype Correlation A. Classic Infantile Onset with GROD * Address for correspondence: New York State Institute for Basic Research in Developmental Disabilities, 1050 Forest Hill Road, Staten Island, New York 10314. E-mail: [email protected] Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

1

2

K. E. Wisniewski et al.

IV. V. VI. VII. VIII. IX. X. XI.

B. Variant Late-Infantile Onset with GROD C. Variant Juvenile Onset with GROD CLN2. Classic Late-Infantile NCL CLN3. Juvenile NCL CLN4. Adult NCL CLN5. Finnish Late-Infantile Variant CLN6. Variant Late-Infantile Gypsy/Indian CLN7. Turkish Variant Late-Infantile NCL CLN8. Northern Epilepsy Summary References

ABSTRACT The neuronal ceroid lipofuscinoses (NCLs) are neurodegenerative disorders characterized by accumulation of ceroid lipopigment in lysosomes in various tissues and organs. The childhood forms of the NCLs represent the most common neurogenetic disorders of childhood and are inherited in an autosomal-recessive mode. The adult form of NCL is rare and shows either an autosomal-recessive or autosomal dominant mode of inheritance. Currently, ﬁve genes associated with various childhood forms of NCLs, designated CLN1, CLN2, CLN3, CLN5, and CLN8, have been isolated and characterized. Two of these genes, CLN1 and CLN2, encode lysosomal enzymes: palmitoyl protein thioesterase 1 (PPT1) and tripetidyl peptidase 1 (TPP1), respectively. CLN3, CLN5, and CLN8 encode proteins of predicted transmembrane topology, whose function has not been characterized yet. Two other genes, CLN6 and CLN7, have been assigned recently to small chromosomal regions. Gene(s) associated with the adult form of NCLs (CLN4) are at present unknown. This study summarizes the current classiﬁcation and new diagnostic criteria of NCLs based on clinicopathological, biochemical, and molecular genetic data. Material includes 159 probands with NCL (37 CLNI, 72 classical CLN2, 10 variant LINCL, and 40 CLN3) collected at the New York State Institute for Basic Research in Developmental Disabilities (IBR) as well as a comprehensive review of the literature. The results of our study indicate that although only biochemical and molecular genetic studies allow for deﬁnitive diagnosis, ultrastructural studies of the biopsy material are still very useful. Thus, although treatments for NCLs are not available at present, the diagnosis has become better deﬁned.

1. NCL: Classiﬁcation and Diagnosis

3

I. INTRODUCTION The neuronal ceroid lipofuscinoses (NCLs, Batten disease), are common, progressive neurological disorders in infancy and childhood, with an incidence ranging in various countries from 0.1 to 7 per 100,000 live births (Santavuori, 1988; Uvebrant and Hagberg, 1997). Childhood forms of NCLs are inherited in an autosomalrecessive mode. A rare adult form of NCL shows both autosomal-recessive and dominant modes of inheritance. Accumulation of autoﬂuorescent ceroid lipopigment in lysosomes of various tissues and organs is a characteristic feature of NCLs. The term neuronal ceroid lipofuscinosis was introduced by Zeman and Dyken (1969) to clearly differentiate this group of disorders from the gangliosidoses. However, as far back as the Middle Ages, or perhaps even earlier, people were suffering from occulo-cerebral dysfunction manifested by progressive blindness, epilepsy, and dementia, although the nature of these disorders remained unknown. The ﬁrst description of this disease, which we could classify currently as a juvenile variant of NCL, comes from Stengel, who in 1826 presented four siblings demonstrating progressive blindness, epilepsy, cognitive decline, and motor dysfunction. Other NCL cases with juvenile onset were described by Batten (1903), Spielmeyer (1923), and Hallervorden (1938). Jansk´y (1908) and Bielschowsky (1923) documented NCL subjects with late-infantile onset, and Kufs (1925) described the adult variant of the disease. Haltia et al. ﬁrst described the infantile form of NCL (1973). Further electron microscopical (EM) studies of various biopsy and autopsy tissues revealed that lysosomal storage of NCL subjects may contain four types of inclusion bodies: granular osmiophilic deposits (GROD), curvilinear proﬁles (CV), ﬁngerprint proﬁles (FP), and rectilinear complexes (RL) (Santavuori, 1988; Wisniewski et al., 1988, 1992, 1998a, 1998b, 1999, 2000; Goebel et al., 1999; and Elleder et al., 1999). Thus, on the basis of age at onset, clinical course, and pathological ﬁndings, NCLs were traditionally divided into four major forms. The infantile form (INCL, Santavuori-Haltia disease) had onset of symptoms between 6 months and 2 years and was characterized by progressive dementia (intellectual decline), motor dysfunction, blindness, and seizures, and the presence of GROD evidenced by EM (Figure 1.1). The late-infantile form (LINCL, Jansk´y-Bielschowsky disease) had onset of symptoms between 2 and 4 years of age, with progressive dementia, blindness, motor dysfunction, and seizures, and CV proﬁles evident with EM (Figure 1.2). The juvenile form (JNCL, Batten-Spielmeyer-Vogt disease) had onset of symptoms between 4 and 10 years of age, with progressive blindness, cognitive and motor dysfunction, and seizures, and FP and vacuolated lymphocytes evident with EM (Figures 1.3 and 1.4).

4

K. E. Wisniewski et al.

Figure 1.1. (A) CLN1 infantile neuronal ceroid lipofuscinosis (NCL). Two densely packed lipopigments of granular osmiophilic deposits (GROD) in lysosomes, localized in the cytoplasm of lymphocyte (buffy coat), × 42,500. (B) Higher magniﬁcation of (A), × 241,000. (C) Numerous densely and loosely packed GROD localized in the lysosomal storage material in ﬁbroblast from a skin-punch biopsy, × 39,000. (D) Higher magniﬁcation of (C), × 98,500.

1. NCL: Classiﬁcation and Diagnosis

5

Figure 1.2. (A) CLN2 late-infantile NCL. The secretory exocrine sweat glands with numerous lysosomes storing material composed of curvilinear proﬁles, × 53,000. (B) Fibroblast with numerous lysosomes that are storing ﬁngerprint proﬁles, × 79,000. (C) In a pericyte of vessel wall, lysosomal storage with curvilinear proﬁles, × 23,500. (D) Subcutaneous nerve bundles showing, in the cytoplasm of Schwann cells, lysosomes that are storing curvilinear proﬁles, × 31,000.

6

K. E. Wisniewski et al.

Figure 1.3. (A) CLN3, juvenile NCL, homozygous. In the cytoplasm of a lymphocyte (buffy coat), ﬁngerprint proﬁles within membrane-bound lysosomal vacuoles, × 64,000. (B) Higher magniﬁcation of (A), × 73,500. (C) Lymphocytes with ﬁngerprint proﬁles within membranebound lysosomal vacuoles, similar to (A) and (B), × 27,000. (D) Higher magniﬁcation of (C), × 225,000.

1. NCL: Classiﬁcation and Diagnosis

7

Figure 1.4. (A) CLN3, juvenile NCL, compound heterozygous. In the cytoplast of lymphocytes (buffy coat) are large lysosomes that are storing mixed (curvilinear and ﬁngerprint) proﬁles, × 30,180. (B) Higher magniﬁcation of (A), × 69,800.

8

K. E. Wisniewski et al.

Table 1.1. NCL—Batten Disease Registry at IBR Age of death (yr) Form

No.

%

INCL LINCL JNCL Kufs

107 381 402 19

11.8 41.9 44.2 2.1

Totals

909

100

Within USA 83 305 359 19 766

% 10.8 39.8 46.9 2.5 100

Outside USA 24 76 43 0 143

%

Range

Mean

16.8 53.1 30.1 0

1.42–26 4.25–43.25 7.92–51.17 32.08–64

9.37 9.84 20.81 36.77

100

The adult form (ANCL, Kufs disease) had onset after 15 years of age, either with myoclonic seizures or progressive behavioral, cognitive, and motor dysfunction, and mixed lysosomal inclusions (CV, FP, GROD) by EM (Figure 1.5) The distribution of major NCL forms collected through the Batten Disease Registry at the New York State Institute for Basic Research in Developmental Disabilities (IBR) is presented in Table 1.1. The juvenile form is the most common form in the United States. The second most common is the late-infantile form. With the advent of molecular testing for INCL, the number of infantile forms is dramatically increasing. This form is not exclusive to the Finnish population, as originally thought, but may exist in all populations. However, in the 1970s and 1980s, clinicopathological correlations showed that around 20% of NCL cases did not ﬁt into these four classical forms (Wisniewski et al., 1988, 1992; Dyken and Wisniewski 1995; Wisniewski et al., 1999). Further, rapid progress in molecular genetic studies of NCLs was possible as a result of the formation of the International Batten Disease Consortium. The combined efforts of clinicians, pathologists, and molecular geneticists has allowed identiﬁcation of new forms of NCL, isolation and characterization of ﬁve genes associated with the NCL disease process, and mapping of two other genes. In this chapter, a new classiﬁcation of NCLs that has emerged from these studies as well as new diagnostic criteria based on clinicopathological, biochemical, and molecular genetic data will be summarized and discussed. This study is based on analysis of 159 probands with NCL collected at the George Jervis Clinic at IBR, including data obtained from the Batten Disease Registry at IBR. The ultrastructural studies were performed similarly to those discussed previously (Wisniewski et al., 1988, 1992, 1998a, 1998b). The biochemical and molecular genetic studies were carried out as described elsewhere (Das et al., 1998; Wisniewski et al., 1998a, 1999; Zhong et al., 1998a, 1998b, 2000; Sleat et al., 1999; Hartikainen et al., 1999; Junaid et al., 1999; Mole et al., 1999; Hofmann et al., 1999; see also Chapters 3–5). A comprehensive summary of data obtained by other researchers also will be included.

1. NCL: Classiﬁcation and Diagnosis

9

Figure 1.5. (A) CLN 4, adult NCL. In the vessel wall of skin punch biopsy, ﬁngerprint proﬁles without membrane-bound lysosomal vacuoles, × 32,500. (B) Higher magniﬁcation of (A), × 82,300. (C) Unmyelinated nerve ﬁbers with ﬁngerprint proﬁles, × 21,000. (D) Numerous ﬁngerprint and trilamellar structures in the lysosomal storage material, × 220,000.

10

K. E. Wisniewski et al.

II. CURRENT CLASSIFICATION OF NCLs The diagnosis of NCL is based at present on a careful analysis of data provided by clinicopathological, biochemical, and genetic studies. Currently, eight forms of NCLs can be distinguished, designated CLN1–CLN8. Five genes associated with the NCL disease process have been isolated and characterized: CLN1, CLN2, CLN3, CLN5, and CLN8 (Vesa et al., 1995; IBDC 1995; Sleat et al., 1997; Savukoski et al., 1998; Ranta et al., 1999). Two genes, CLN6 and CLN7, have been mapped to a small chromosome region (Sharp et al., 1997; Williams et al., 1999). Isolation of gene(s) associated with the adult variant of NCLs (CLN4) is still in progress. The functions of two products of NCL-associated genes, CLN1 and CLN2, are known. CLN1 gene encodes palmitoyl protein thioesterase (PPT1), a lysosomal enzyme involved in depalmitoylation of proteins (Camp and Hofmann 1993; Camp et al., 1994). The CLN2 gene encodes a tripeptidyl peptidase 1 (TPP 1), a lysosomal enzyme acting as an aminopeptidase that removes tripeptides from the free N-termini of proteins (Rawlings and Barrett, 1999; Vines and Warburton, 1999). The functions of three other proteins encoded by CLN3, CLN5, and CLN8 genes are unknown at present; however, their predicted amino acid sequences suggest that these proteins have transmembrane topology (Janes et al., 1996; Savukoski et al., 1998; Ranta et al., 1999; see also Chapter 6) To date, over 80 different mutations and polymorphisms have been identiﬁed in NCL-associated genes, and more mutations are expected to be found (Munroe et al., 1997; Hofmann et al., 1999; Sleat et al., 1999; Mole et al., 1999; Wisniewski et al., 2000; see also Chapter 3): about 30 each of CLN1 and CLN2, 25 CLN3 and 5 of CLN5 (Figures 1.6–1.8). These mutations can be divided into two groups: (1) common or major mutations that predominate in a given form of NCL and are associated with the classical course of the disease, and (2) rare, private mutations that occur sporadically and may be associated with a different phenotype than the classical one. As was revealed by phenotype–genotype correlation, the age at onset of the disease process can no longer represent a criterion for the assignment of a case as a particular NCL form. It became evident that mutations in the CLN1 gene can be associated with infantile, late-infantile, and juvenile onset of the disease process. Mutations in the CLN2 gene may give rise not only to late-infantile onset of the disease, but also to juvenile onset. Late-infantile onset of the disease may be associated with mutations in one of any ﬁve genes: CLN1, CLN2, CLN5, CLN6, or CLN7. Furthermore, the results of ultrastructural studies of biopsy material also may be misleading, considering that mixed types of lysosomal inclusion bodies may be found (Wisniewski et al., 1988, 1992). All these ﬁndings indicate that only a

11

1. NCL: Classiﬁcation and Diagnosis

CLN1 Mutations (Total=34) D79G Δ Phe84 Y109D G118D

R122W Δ398T

G42E K55X Δ 174-175G T75P 169-170insA

M1I L10X H39Q

V181M V181L E184K

R151X R164X C152X Q177E

L219Q Δ644A Y247H G250V

Null Allele

Q291X W296X 3`UTR 1

IVS1(-2A>G)

2

3

4

5

c.132-133insTGT c.162-163insA

6

7

8

9

IVS7(-2,T)

IVS6(-1,T)

c.774-775insA

Figure 1.6. CLN1 mutations.

CLN2 Mutations Glu343Lys Δ 4207-4385 Δ 4288-4295

Ile287Asn Arg206Cys

(Total: 32) Val385Asp Gly389Glu Gln422His

Cys365Arg Cys365Tyr

Arg208stop

Glu423Asp Arg447His Ala454Glu Ser475Leu

Ser135Pro

Gln509stop

Δ 6082-6092 6069insA Δ 6151-6152delTC

Δ 3081-3091 Arg127stop Gln66stop 1946A>G Gly77Arg

3`UTR 1 2

3

1946A>G

4

5

6

3556G>C 3556G>A

7

8

9

4188A>G

10 11

4396T>G 4635A>G

Figure 1.7. CLN2 mutations.

12 13

6025G>C

12

K. E. Wisniewski et al.

CLN3 Mutations (total 24) Ser161stop Ser162stop

Δ c.791-1056

Δ c.461-677

Δ 558AG 586-587insG 622-623insT Glu211stop

Gln327stop Val330Phe Arg334Cys Gln352stop

Δ c.461-1413

IVS14-1G>T Mutations caused classical phenotypes Δ 1272G

374-375insCC Δ 424G

1

IVS7+1G>C

IVS6-13G>C

2 3

Leu101Pro

4

5

6

7

8

Leu170Pro

9

944-945insA

10 11 12 13 14 15 Glu295Lys

Arg334His

Figure 1.8. CLN3 mutations.

careful evaluation of all data provided by clinicopathological, biochemical, and genetic studies can guarantee an accurate diagnosis. The proper classiﬁcation of a particular form of NCL is no longer a purely nosological problem because, ﬁrst, therapeutic approaches of NCL have already been initiated (Lake et al., 1997; Vanhanen et al., 1998; see also Chapters 7 and 12). The criteria used currently for diagnosis of particular forms of NCL are summarized in Table 1.2.

III. CLN1. DIAGNOSTIC CRITERIA AND PHENOTYPE–GENOTYPE CORRELATION Mutations in the PPT 1 gene can give rise to three major phenotypes: ones with the classic infantile onset, the variant late-infantile onset, and the variant juvenile onset. Of 37 cases evaluated at IBR and assigned to CLN1, the classic infantile-onset form was found in 18, the variant late infantile onset with GROD in 7, and the variant juvenile onset with GROD in 12. Thus, only around 50% of cases demonstrated infantile onset of the disease process, which in the past was considered typical for this form of NCL (Santavuori et al., 1973, 1989; Santavuori 1988). However, the classic infantile form is the only form of CLN1 encountered

Table1.2. Classification of Neuronal Ceroid Lipofuscinoses on the Basis of Clinicopathological, Biochemical, and Genetic Testing

Form

Genetic symbol

Infantile NCL

CLN1a

Classic late infantile NCL

CLN2b

Juvenile NCL

CLN3

Adult NCL

CLN4

Finnish LINCL

CLN5

Gypsy/Indian LINCL

CLN6

Turkish LINCL

CLN7

EPMRd

CLN8

a

Onset (age range) yr

yr

yr

yr

yr

18

yr

yr

yr

Presenting symptoms

EM resultsc

Mutated protein

Gene location

Common mutation/location

Total # of mutations

Visual loss Motor dysfunction Intellectual decline

GRODc

PPT1d

1p32

Arg122Trp Exon 4 Arg151STOP Exon 5 Thr75Pro Exon 2

>30

Seizures Motor dysfunction Intellectual decline

CV/mixed

TPP 1

11p15

IVS5-1G C Intron 5 Arg208STOP Exon 6

>30

Visual loss Intellectual, motor decline, seizures

FP, or mixed, vacuolated lymphocytes

Battenin Transmembrane

16p12

1.02-kb deletion Intron 6-8

>20

A: myoclonus epilepsy with dementia B: behavior and dementia

Mixed

Unknown

Unknown

Unknown

Unknown

Motor dysfunction Visual loss Intellectual decline

FP, CV, RL

Transmembrane

13q22

Tyr392STOP Exon 4

3 mutations 1 polymorphism

Motor dysfunction Intellectual decline Seizures Visual loss

CV, FP, RL

Unknown

15q21-q23

Unknown

Unknown

Seizures Motor dysfunction Visual loss

FP or mixed

Unknown

Unknown

Unknown

Unknown

Seizures Intellectual decline

CV- or GROD-like structures

Transmembrane

8p23

Arg24Gly Exon 2

1

Onset: infantile, 6 yr; late infantile, yr; juvenile, yr; adult, (>10 yr) in all forms of NCL. Onset: late infantile, yr; juvenile, yr. c EM, electron microscopy; CV, curvilinear profiles; F, fingerprint profiles; GROD, granular osmiophilic deposits; RL; rectilinear complex. Mixed: CV, FP, RL, GROD. PPT1, palmitoyl-protein thioesterase 1; TPP 1, tripeptidyl peptidase. d EPMR: progressive epilepsy with mental retardation. b

14

K. E. Wisniewski et al.

in Finland. Finland also has the highest incidence of mutated CLN1 gene—1 per 20,000 live births—and the highest carrier frequency: 1 in 70.

A. Classic infantile onset with GROD In the majority of subjects with the classic infantile form of NCL (INCL), the ﬁrst clinical signs and symptoms appear at the age of 6–18 months. Early symptoms and signs include retarded growth of the head, muscular hypotonia, excitability, and lack of motor-skill development. Progressive loss of vision (starting around 15–22 months), intellectual decline (starting around 10–18 months), ataxia (starting around 12–24 months), myoclonus (starting around 16–36 months), involuntary movements (starting around 7–20 months), and epileptic seizures (starting around 15 months–3.6 years), mostly of simple or complex partial type, complete the clinical picture. Brownish discoloration of the macula, retinal degeneration, and optic atrophy are present after 2 years of age, but pigment aggregation, typical for CLN2 and CLN3 subjects, is usually absent. In the ﬁnal stage of the disease, the affected children are blind and demonstrate spasticity and myoclonia; however, some emotional contact can be maintained with them even until death. Children die usually at the age of 8–13 years (Santavuori et al., 1999). Electrophysiological studies may be helpful to establish the ﬁnal diagnosis. Electroretinograms (ERG) are abnormal at around the age of 2.5 years. Visual evoked potentials (VEP) are abolished around the age of 2–5 years. Abnormalities of electroencephalograms (EEG) appear around the age of 2 years, and EEG often becomes ﬂat around the age of 3 years. Magnetic resonance images (MRI) show abnormalities early, around the age of 7–10 months. T-weighted images disclose hypointensity of the thalami to the white matter and basal ganglia, and later on, high signal intensity of the white matter and severe progressive cerebral and cerebellar atrophy. EM studies of diagnostic biopsy specimens (e.g., conjunctiva, skin, and/or rectal biopsies, and/or lymphocytes [buffy coat]) are recommended. GROD have been found very early during the disease process (eighth week of pregnancy); analysis of chorionic villi from “at risk” pregnancies has been used successfully in the past for prenatal diagnosis (Rapola et al., 1990) and postnatally (Das et al., 1998; Hofmann et al., 1999). However, deﬁnitive diagnosis of INCL is based currently on biochemical and molecular genetic studies. All children with the classic infantile form have either undetected or marginal PPT1 activity (Vesa et al., 1995; Das et al., 1998; Wisniewski et al., 1998b; Waliany et al., 1999; Hofmann et al., 1999; Mole et al., 1999; see also Chapter 3). Recently, a new, sensitive and simple biochemical assay was developed, which allows measurement of PPT1 activity in various biological specimens such as ﬁbroblasts, leukocytes, amniotic ﬂuid cells, chorionic villi, plasma, and cerebrospinal ﬂuid (van Diggelen et al., 1999). Molecular genetic

1. NCL: Classiﬁcation and Diagnosis

15

studies identiﬁed 24 mutations associated with this particular form of NCLs. In Finland, only one missense mutation (Arg122Trp) was found in all affected children (Vesa et al., 1995; Santavuori et al., 1999). In our material, however, 14 different mutations were associated with classic infantile phenotype, and Arg122Trp was found only in 3/73 CLN1 alleles examined (Das et al., 1998; Waliany et al., 1999). A nonsense point mutation, Arg151Stop, was the most common in the CLN1 probands with classic infantile onset, accounting for 50% of alleles examined in this group. Mutations of CLN1 cases were also identiﬁed in Italy (Santorelli et al., 1998).

B. Variant late-infantile onset with GROD Only seven probands, all from IBR’s collection, were assigned to the variant lateinfantile onset with GROD (Das et al., 1998; Wisniewski et al., 1998b; Waliany et al., 1999; Hofmann et al., 1999). Clinical signs and symptoms start at around 18 months–3.5 years. Initial symptoms include seizures and intellectual decline; however, in one proband, visual loss also was observed early. Gradually, visual loss and motor and cognitive dysfunction proceed, leading to a vegetative state. Progression of the disease process is slightly slower than in the classic infantile form. Some affected children are still alive at the age of 10–13 years. Biopsy material analyzed by electron microscopy reveals GROD, but in one proband, an admixture of CV also was disclosed. Electrophysiological studies may be helpful for the ﬁnal diagnosis; however, deﬁnitive diagnosis is based on ﬁndings of deﬁcient PPT 1 activity and mutations in the PPT1 gene. Various mutations in the PPT1 gene have been found in the probands analyzed to date, even those that also were described in the classic infantile form (Arg151Stop, Val181Met, Arg164Stop, Y109D). However, three mutations were identiﬁed only in children with the late-infantile-onset form: Q177E, V181L, W296X (Das et al., 1998; Wisniewski et al., 1998b; Waliany et al., 1999; see also Chapter 3).

C. Variant juvenile onset with GROD Numerous NCL subjects with clinical presentation resembling the juvenile NCL form, but demonstrating GROD and no FP in biopsy and autopsy tissues, have been documented (Zeman and Dyken 1969; Carpenter et al., 1973; Manca et al., 1990; Wisniewski et al., 1992; Taratuto et al., 1995; Philippart et al., 1995; Hofman and Taschner 1995; Lake et al., 1996; Crow et al., 1997; Wisniewski et al., 1998b). The nosological status of this group of patients was uncertain. Only recently, molecular genetic and biochemical studies revealed that these patients have mutations in the PPT1 gene and deﬁcient PPT1 activity in various diagnostic specimens, thus representing an allelic variant of CLN1 (Das et al., 1998; Mitchison et al., 1998).

16

K. E. Wisniewski et al.

Probands with this variant of CLN1 were reported in various countries, but this variant of NCL occurs at a high frequency in the central region of Scotland (Crow et al., 1997; Stephenson et al., 1999). This disorder starts at the age of 6–10 years, usually with visual loss. Rarely, intellectual decline or seizures are the initial signs. Hyperactive behavior as the initial sign also was noted (Hofman and Taschner, 1995). Afterwards, motor dysfunction (10–13 years), cognitive dysfunction (11–13 years), and epilepsy with tonic clonic seizures or absences (12–19 years) develop. Subjects usually die after the age of 14 years, but patients still alive after the age of 26 years also have been reported. The ERG is usually extinguished at the time of diagnosis of retinopathy. The VEP are reduced in amplitude and then become ﬂat. Retinal pigmentary degeneration and macular atrophy are typical; however, lack of ophthalmological changes also was reported (Hofmann and Taschner, 1995). MRI may be normal for a long time. Electron microscopy of the biopsy specimens (conjunctiva, skin, lymphocytes, rectum) shows GROD. In contrast to the juvenile form of NCL (CLN3), in variant juvenile NCL with GROD, lymphocytes show no vacuoles. Deﬁnitive diagnosis is based on detection of PPT1 deﬁciency and mutations in the PPT1 gene. Of interest, in some probands, residual activity of PPT1 was disclosed, which could at least partially explain the more benign phenotype in these subjects than in children with the classic infantile NCL form (Das et al., 1998). Although numerous mutations were found in this variant of CLN1, most probands are compound heterozygotes for “null”-type mutation and a missense mutation (Das et al., 1998; Mitchison et al., 1998; Mole et al., 1999; see also Chapter 3). The most common mutations are missense point mutations: Thr75Pro, present either in homozygous or heterozygous form; and Arg151Stop, occurring in heterozygous form. Thus, phenotype/genotype comparison shows that mutations in the CLN1 gene can cause three different phenotypes: INCL, LINCL, and JNCL and adult onset (personal communication, Van Diggelen). EM ﬁndings do not differ in these various phenotypes; all have GROD (see Figure 1.9). Table 1.3 summarizes the clinicopathological data for CLN1.

IV. CLN2. CLASSIC LATE-INFANTILE NCL The incidence of classic late-infantile NCL is around 0.36–0.46 per 100,000 live births (Cardona and Rosati, 1995; Claussen et al., 1992). Among the NCL probands evaluated at IBR, 72 subjects were assigned to CLN2. The ﬁrst symptoms appear at the age of 2–4 years, usually starting with epilepsy, which may be manifested by generalized tonic-clonic seizures, as well as absence, or partial, or secondarily generalized seizures. Regression of developmental milestones is soon

1. NCL: Classiﬁcation and Diagnosis

17

Figure 1.9. (A) CLN1 juvenile (age at onset >4 years). Numerous densely packed GROD in cytoplasm of lymphocyte (buffy coat), × 33,000. (B) Higher magniﬁcation of (A), × 130,500. (C) GROD, densely and loosely packed, located in the pericyte of the vessel wall, × 24,000. (D) Higher magniﬁcation of (C), × 95,000.

18

K. E. Wisniewski et al.

Table 1.3. CLN1 with Infantile, Late-Infantile, and Juvenile Onset Onset

Clinical signs/findings

Infantile, 6 mo–2 yr

Hypotonia, cognitive dysfunction, seizures, microcephaly, visual failure, ataxia, myoclonic jerks. EEG: disappearance of eye opening/closing reaction, and sleep spindles, low-voltage activity. MRI: severe progressive atrophy

Late infantile, 2–4 yr

Generalized seizures, myoclonic jerks, (may be provoked by ﬂash stimuli during EEG recording), cognitive dysfunction, ataxia, myoclonous, visual failure, motor regression. EEG: occipital photosensitive response using ﬂash rates at 1–2 Hz with eyes open. ERG is diminished. VER enhanced reaching amplitude of 355–375 ␮V. MRI: progressive brain atrophy

Juvenile, 5–8 yr

Progressive visual failure, cognitive/motor dysfunction (Parkinson-like syndrome), seizures. ERG abolished and VEP abnormal; the later could remain normal for several years. EEG abnormal, frequent paroxysmal activity. MRI: progressive brain atrophy

All CLN1 have GROD at EM level, are PPT1 deﬁcient, and have different types of mutations (see Chapter 3). Onset >6 m and/or >10 yr may also exist in the CLN1 form. Age of death: range 1.42–26 yr.

evident, followed by ataxia and myoclonus. Visual loss leading to blindness appears at the age of 4–6 years. Children are usually bedridden before the age of 6 years. EEG shows spikes in the occipital region in response to photic stimulation at 1–2 Hz. ERG is usually abnormal at presentation and soon afterwards extinguishes. VEP is enhanced for a long period and diminishes in the ﬁnal stage of the disease. MRI is helpful for differential diagnosis and shows progressive cerebral and cerebellar atrophy, with normal basal ganglia and thalami. Elevated level of subunit c in urine samples is a constant feature (Wisniewski et al., 1994, 1995). Finding of CV proﬁles in biopsy material (lymphocytes, skin, conjunctiva, and rectum) facilitates the diagnosis; however, in some cases, mixed lysosomal inclusions (FP, CV, RL, and/or GROD) are observed (Wisniewski et al., 1988, 1992). Ultrastructural studies of amniotic ﬂuid cells, choroid vili and fetal skin biopsy were used for prenatal diagnosis (Chow et al., 1993). Currently, biochemical assays based on analysis of TPP 1 activity are available to conﬁrm the diagnosis (Sohar et al., 1999; Junaid et al., 1999; Sleat et al., 1999). All CLN2 patients studied to date showed either undetectable levels or severely reduced PPT1 activity in diagnostic specimens (ﬁbroblasts, lymphocytes, brain samples). Molecular genetic studies disclosed 26 mutations and 14 polymorphisms in TPP 1 gene (Sleat et al., 1997; Zhong et al., 1998a; Sleat et al., 1999; Hartikainen et al., 1999; review: Mole et al., 1999). Two major mutations, the nonsense mutation Arg208Stop and the mutation affecting

1. NCL: Classiﬁcation and Diagnosis

19

→C, account for approximately 60% of CLN2 chromosomes splicing, IVS5-1G→ (Sleat et al., 1999; Zhong et al., 1998a); 10 cases of variant LINCL were evaluated at IBR. Of interest, four probands with TPP 1 gene mutations demonstrated juvenile onset (4–7 years) of the disease and atypical clinical presentation. Ten NCL probands with late-infantile onset did not show mutations in the CLN2/TPP 1 gene, had normal TPP 1 levels, and showed mixed proﬁles at the EM level (FP, CV, RL, and GROD). These probands also were excluded from CLN2, CLN5, and CLN8. Studies are in progress to identify genetic defect(s) in this group of cases. Short summaries of the clinicopathological data for probands assigned to CLN2, but presenting with juvenile onset of the disease process, are given below. Family 1: A family with three affected children. The onset of symptoms occurred between six and eight years of age, with behavioral abnormalities associated with dementia, coordination problems, and extrapyramidal signs. Seizures started at 9 years of age in case 1, 20 years in case 2, and 13 years in case 3. Visual impairment was not observed in case 1, who died at 24 years of age, or in case 2, who died at 30 years of age. However, visual impairment developed in case 3 at 12 years of age, leading to blindness at 20 years of age. Presently, case 3 is 28 years old and conﬁned to a wheelchair. Buffy coat and skin-punch biopsies from cases 2 and 3 showed mainly CV proﬁles. Increased level of subunit c of mitochondrial ATP synthase in the urine was present in cases 2 and 3. At postmortem examination, cases 1 and 2 revealed a predominance of mixed proﬁles (CV and FP, GROD) in lysosomal storage material (Figure 1.10). Studies for CLN3 mutations were negative. The activity of tripeptidylpeptidase I (TPP1) was decreased in case 3, and molecular genetic studies showed that this proband had a common mutation leading to aberrant splicing, →C, in one allele, and a missense mutation, Arg447His, in the other IVS5-1G→ allele. The pedigree for this family is presented in Figure 1.11. Proband 2: A Caucasian male had onset of symptoms at 8 years of age, with progressive blindness, seizures, cognitive and motor dysfunction, similar to family 1, case 3. He died at 43 years of age, and EM showed mixed (CV and FP) proﬁles in the buffy coat and in the brain. Molecular genetic studies showed the Arg208Stop nonsense mutation in one allele and a missense mutation, Arg447His, in the other allele.

V. CLN3. JUVENILE NCL The incidence of the juvenile form of NCL varies in different countries; e.g., in Iceland it is 7.0 per 100,000 live births (Uvebrant and Hagberg, 1997), whereas

20

K. E. Wisniewski et al.

Figure 1.10. (A) Brain of CLN2 case. Mixed proﬁles (ﬁngerprint and curvilinear) in the cytoplasm of a neuron, × 21,580. (B) Higher magniﬁcation of (A), × 83,000. (C) Lysosomal storage composed of mixed proﬁles (densely packed curvilinear and GROD), × 46,300. (D) A neuron with lysosomal storage composed of mixed proﬁles (rectilinear, curvilinear, and ﬁngerprint), × 41,000.

1. NCL: Classiﬁcation and Diagnosis

21

Figure 1.11. Pedigree of a family with three siblings affected with CLN2.

in West Germany it is 0.71 per 100,000 live births (Claussen et al., 1992). Forty cases evaluated at IBR were assigned to CLN3. The course of the disease can be divided into two categories: classical/typical, and delayed classical/atypical. In all CLN3 subjects, clinical signs and symptoms appear after the age of 4 years. Rapidly progressing visual loss represents the ﬁrst, and for 2–4 years, the only clinical sign of the disease. Affected children become blind usually within 2–4 years. Ophthalmological studies show pigmentary degeneration and optic nerve atrophy. Speech disturbances (frequent echolalia) and a gradual decline of cognitive functions follow after the age of 8–9 years. Epilepsy with generalized tonic-clonic seizures, myoclonic seizures, or complex partial seizures appears at the age of 5–18 years. Psychiatric signs, sleep disturbances, and extrapyramidal signs fulﬁll the clinical picture in the second decade of life. EEG is abnormal, showing spike-and-slow-wave complexes. ERG and VEP are changed early. However, cranial computer tomography (CT) and MRI reveal cerebral and, to a lesser degree, also cerebellar atrophy only in the later stages of the disease. FP are typically observed on biopsy (lymphocytes, skin, conjunctiva, rectum) and autopsy material. Vacuolated lymphocytes are a characteristic morphological feature for this form of NCL and can be found on a regular blood smear as well as in buffy coat by electron microscopy. Biochemical assays are

22

K. E. Wisniewski et al.

currently unavailable. Some CLN3 subjects show increased levels of subunit c in urine samples (Wisniewski et al., 1994, 1995). Molecular genetic studies disclosed 25 different mutations and two polymorphisms in the CLN3 gene (IDBC 1995; Munroe et al., 1997; Wisniewski et al., 1998a; Zhong et al., 1998; review: Mole et al., 1999; Lauronen et al., 1999; see also Chapter 5). The major mutation is a 1.02-kb deletion, which removes exons 7 and 8. This mutation was found in 96% of JNCL patients in at least one chromosome (on around 85% of all disease chromosomes examined). The majority of homozygotes for the common deletion show a classical clinicopathological presentation with some small differences in disease progression (J¨arvel¨a et al., 1997; Lauronen et al., 1999). However, marked clinicopathological heterogeneity may be observed in compound heterozygotes. Of the group of 40 CLN3 probands analyzed at IBR, 28 were homozygous and 12 were heterozygous for the 1.02-kb deletion. The classical clinicopathological presentation was observed in 34 probands (28/40 homozygotes and 12/40 heterozygotes). A delayed or atypical clinicopathological picture was found in six probands, all heterozygous for the 1.02-kb deletion. The age at onset for the homozygotes was 4–10 years (mean value 5.2), and for the 12 heterozygotes, 3.5–9 years (mean value 5.8). The present age of homozygotes with the 1.02-kb deletion (28/40) is 9–32 years (mean value 16.2) and for heterozygotes (12/40), 10–42 years (mean value 22.9). The age at death for homozygotes (8/28) is 18–38 years (mean value 23.5), and for heterozygotes (6/12), 24–56 years (mean value 30.6). In two heterozygotes with the 1.02-kb deletion, we found a point mutation, the Gly295Lys (Wisniewski et al., 1998a). These cases had a protracted clinical course, with progressive visual loss that started around the age of 5 years and led to blindness after the age of 12 years. However, neurological alterations other than blindness (cognitive/motor, epilepsy) appeared in one of these cases only after the age of 40 years. The other sibling is still free of other symptoms, except for blindness at the age of 40 years. Of interest, a patient reported by Lauronen and colleagues (1999), heterozygous for the 1.02-kb deletion and the Gly295Lys mutation, also had visual loss from the age of 6 years, but afterwards developed epilepsy (since the age of 19 years) and polyneuropathy (at the age of 20 years). The cause of these phenotypic differences is unclear. It cannot be excluded that they can be attributed at least partially to environmental factors. However, in this patient, no intellectual decline or speech abnormalities could be detected (Lauronen et al., 1999). Other patients with the protracted course of the disease (Goebel et al., 1976) and with a rare pigment variant of NCL (review: Goebel et al., 1995) still have to be determined. The different diagnoses of NCL with juvenile onset are summarized in Table 1.4.

Table 1.4. NCL with Juvenile Onset > Gene code CLN1

Years of Age

Symptoms Similar to CLN3

EM GROD

a

CLN2

Similar to CLN3

CLN3 homozygous

Blindness Dementia Seizures

Compound heterozygous

Rigidity Schuffling gait Sleep disturbances Spasticity Vegetative stage

Protracted

Blindness only, yr, after other neurological abnormalities

Juvenile onset of CLN1 age of death a CLN2 onset variant longer survival ,

ERG/VEP

EEG

Similar to CLN3

MRI/CT

Similar to CLN3

Similar to CLN3

Reference/mutation Chapter 3, this volume

CV or mixed

Similar to CLN3

Similar to CLN3

Similar to CLN3

Wisniewski et al., 1999, 2000

FP, mixed with membrane-bound vacuoles

ERG: decreased b-wave VEP: marked reduced amplitude

Large amplitude, spikes, and slow-wave complexes

Progressive atrophy, abnormal periventricular white matter, thalamus, caudate, putamen on T2 weighted images

1.02-kb deletion Intron 6-8

IBDC, 1995 Chapter 5, this volume

Same as above

Goebel et al., 1993 Wisniewski et al., 1998a

Same as above

yr. yr; CLN3 age of death range

yr.

24

K. E. Wisniewski et al.

VI. CLN4. ADULT NCL The adult form of NCL (CLN4, Kufs disease) can be inherited in either autosomalrecessive or dominant mode. However, because the genotype of this form is still unknown, diagnosis is based on clinicopathological data only (Berkovic et al., 1988; Goebel and Braak 1989; Constantinidis et al., 1992; Martin and Ceuterick 1997). Initial signs and symptoms appear usually around the age of 30 years; however, they may appear as early as the age of 11 years. There are two major clinical phenotypes. Type A is characterized by progressive myoclonic epilepsy with dementia, ataxia, and late-occurring pyramidal extrapyramidal signs. Affected individuals usually have no visual problems. Seizures often are uncontrollable. Type B is characterized by behavior abnormalities and dementia, which may be associated with motor dysfunction and disturbances from the cerebellum (ataxia) and basal ganglia (extrapyramidal signs). Dysarthria and suprabulbar signs are also features of this disorder (Berkovic et al., 1988). In the presenile form, onset after 50 years of age, dementia, cognitive decline, motor dysfunction, seizures, and suprabulbar signs (brain stem) are present (Constantinidis et al., 1992). Some probands may have A and B phenotype (Martin et al., 1987). Literature on the adult form of NCL is reviewed by Berkovic et al. (1988) and by Constantinidis et al. (1992). Electrophysiological and neuroradiological studies may be helpful for obtaining the ﬁnal diagnosis, but their ﬁndings are not speciﬁc. Ophthalmological studies are normal, in contrast to studies in childhood forms of NCLs. Thus, demonstration of lysosomal inclusion bodies that are usually mixed (FP, GROD, RL, or CV) proﬁles in biopsy material (skin, conjunctive, muscle, rectal), and if necessary, in brain biopsy, is mandatory for deﬁnitive diagnosis (Martin et al., 1987; Martin and Ceuterick, 1997).

VII. CLN5. FINNISH LATE-INFANTILE VARIANT The Finnish late-infantile variant is highly enriched in that country, where it accounts for 80% of late-infantile NCL cases reported (Santavouri et al., 1982; Uvebrant and Hagberg 1997). The CLN5 gene was assigned to chromosome 13q22 (Savukoski et al., 1994) and subsequently isolated and characterized. Details are described by Ranta et al. (see Chapter 6). The major features differentiating CLN5 subjects from subjects with classical CLN2 are later onset of the disease (usually 4.5–7 years) and the presence of FP and RL proﬁles apart from CV proﬁles at the EM level. Lymphocytes are not vacuolated. Accumulation of subunit c of mitochondrial ATP synthase and small amounts of saposin A and D are present (Tyynel¨a et al., 1997). Thus, these

1. NCL: Classiﬁcation and Diagnosis

25

cases resemble classical late-infantile NCL in their clinical features, but the onset of symptoms is at a later age, and the EM ﬁndings are different than in classical CLN2. Presently, three mutations of CLN5 and one polymorphism are known. All probands are of Finnish origin, except one Dutch and Swedish (Savukoski et al., 1998). The gene product of CLN5 is a transmembrane protein of unknown function that is similar to CLN3 protein (Savukoski et al., 1998). Biochemical diagnostic assays are not available.

VIII. CLN6. VARIANT LATE-INFANTILE GYPSY/INDIAN The incidence of the late-infantile/early-juvenile variant has not yet been determined. The CLN6 variant appears to be especially common in some European countries and Canada (Lake and Cavanaugh, 1978; Andermann et al., 1988; Elleder et al., 1997, 1999). CLN6 has been mapped to chromosome 15q21-23 (Sharp et al., 1997), but has not yet been isolated or characterized. Of the families tested for linkage to CLN6, because of similarities in clinical features and ultrastructural appearances (FP, rarely CV or RL, proﬁles without vacuoles), only approximately 75% showed evidence of linkage, conﬁrming that locus genetic heterogeneity exists (Williams et al., 1999a). A series of 27 Czech cases from 23 families has been described, of which 25 cases were diagnosed while living (Elleder et al., 1997, 1999). The age at onset ranged from 18 months to 8 years. Genetic analysis has allowed another 31 families to be assigned to CLN6 given current linkage data (Williams et al., 1999a). In less than 50% of variant LINCL (CLN6) cases, clinical presentation is similar to that in classical LINCL (CLN2), but mostly RL and FP proﬁles are found ultrastructurally, although CV proﬁles also may occur (Figures 1.12 and 1.13). Visual loss and seizures may represent the initial clinical signs and symptoms. However, in some children with later onset of the disease process (after the age of 4 years), the disease may start with epilepsy, ataxia, and myoclonus (Williams et al., 1999a). EEG, ERG, VEP, and MRI are helpful in establishing diagnosis. Electron microscopy studies of skin, rectum, or lymphocytes are necessary. However, deﬁnitive diagnosis should be based on molecular genetic and biochemical studies, which are not yet available.

IX. CLN7. TURKISH VARIANT LATE-INFANTILE NCL CLN7 is a Turkish variant of late-infantile NCL. Between 1993 and 1997, seven of eight cases in Ankara, Turkey, have been diagnosed, with onset at 1–6 years of age; most families of these cases were consanguineous. Presently, 14 cases of Turkish origin have been identiﬁed. They have a similar phenotype to CLN2 but

26

K. E. Wisniewski et al.

Figure 1.12. (A) CLN6 variant LINCL. In the secretory exocrine sweat glands, epithelial cell from a skin punch biopsy; lysosomal storage material composed of mixed proﬁles (ﬁngerprint, trilamellar structures), × 18,400. (B) Higher magniﬁcation of (A), × 55,000. (C) Fibroblasts with rectilinear complex (ﬁngerprints, trilamellar, and angulated) ﬁbers, × 175,000. (D) Fibroblast with island of ﬁngerprints and honeycomb-like structures in lysosomal storage material, without membrane-bound vacuoles, × 190,000.

1. NCL: Classiﬁcation and Diagnosis

27

Figure 1.13. Brain of CLN6 case. (A) Membranous proﬁles (rectilinear complexes) with slightly wavy course at various lengths and bending patterns; some superﬁcially resembling curvilinear proﬁles typical of earlier juvenile CLN6 (Czech late-infantile variant of NCL), × 52,000. (B) Lower magniﬁcation of (A), × 44,500.

Table 1.5. Late-Infantile Forms of NCL Form

Gene code

Onset (yr)

EM

First symptom

Enzyme level

References

LINCL

CLN1

Motor dysfunction

GROD

PPT1 deficiency

Chapter 3, this volume

Classical LINCL

CLN2

Seizures

CV, mixed

TPP1 deficiency

Sleat et al., 1999 Goebel et al., 1999

Finnish LINCL

CLN5

Motor dysfunction

FP or mixed a

TPP1 normal

Chapter 6, this volume

LINCL early juvenile,,

,,

CLN6

Seizure

Mixeda

TPP1 normal

Lake and Cavanagh, 1978

Turkish LINCL

CLN7

Seizures

CV, GROD-like structures, mixed

TPP1 normal

Williams et al., 1999a, 1996b

a

Without membrane-bound vacuoles. Age of death of CLN1, CLN2, CLN5

yr.

1. NCL: Classiﬁcation and Diagnosis

29

have earlier or later age at onset, and at the EM level, showed FP and/or mixed proﬁles (FP, CV, RL). To date, CLN7 has been excluded from the known NCL gene loci. These exclusion data eliminate the possibility that CLN7 is an allelic variant of one of the other NCLs (Williams et al., 1999b). The different diagnoses of all NCLs with late-infantile onset are summarized in Table 1.5.

X. CLN8. NORTHERN EPILEPSY Detailed clinicopathologic and molecular genetic data about the northern epilepsy variant of NCL are presented by Ranta et al. (see Chapter 6). Clinical onset occurs at 5–10 years. Diagnosis is based on a characteristic clinical picture (epilepsy with tonic-clonic or complex partial seizures, mental deterioration, motor dysfunction) and EM studies showing storage material that resembles CV proﬁles and GROD. Deﬁnitive diagnosis is based on molecular genetic studies. The CLN8 gene was isolated and characterized recently (Ranta et al., 1999). All 22 patients examined were homozygous to a missense mutation, Arg24Gly. Carrier frequency for the CLN8 gene is 1:135.

XI. SUMMARY Previously, before the era of genetic studies, diagnosis of NCL was based on clinicopathological ﬁndings alone, and four forms of NCL were known. No explanation was given for atypical NCL cases (Wisniewski et al., 1988, 1992; Dyken and Wisniewski, 1995) that showed different clinicopathological presentation from the four typical forms. Presently, NCLs are classiﬁed into a total of eight forms on the basis of clinicopathological and genetic ﬁndings. The data presented above show that although only biochemical and molecular genetic studies allow for deﬁnitive diagnosis, ultrastructural studies of the biopsy material are still very useful. Furthermore, the identiﬁcation of numerous mutations in each of the major NCL groups in children presented difﬁculties in assigning new cases to a particular NCL form. Thus, to facilitate clinical diagnosis, biochemical assays based on measurements of activity of PPT (Verkruyse et al., 1997; Cho and Dawson 1998) and PPT1 (Junaid et al., 1999; Sohar et al., 1999) have been developed recently. Further studies aimed at characterizing the structural and functional properties of the NCL genes’ products are under way. Studies also are in progress to elucidate the inﬂuence of mutations on the properties of NCL-associated gene products to better understand the pathogenesis and phenotypic heterogeneity of these disorders. Further research should better deﬁne the pathogenesis of the NCLs to determine the genetic defect in the variant late-infantile (CLN6–7) and the adult (CLN4)

30

K. E. Wisniewski et al.

forms, to determine the enzyme defect in all forms, and to develop treatment by enzyme or gene replacement and possible pharmaceutical agents (see Chapter 12). [Continue role of genetic counseling, (see chapter 8) by S. Sklower Brooks.]

Acknowledgments We wish to thank the families and their referring physicians who have participated in these studies; the Batten Disease Support and Research Association (B.D.S.R.A.), Lance Johnston, Executive Director, and Larry Killen, President; and Edith Dockter, coordinator of the Batten Disease Registry at IBR. Supported in part by a grant from the National Institutes of Health, National Institute of Neurological Disorders and Stroke, NS/HD38988, and the New York State Ofﬁce of Mental Retardation and Developmental Disabilities (OMRDD).

References Andermann, E., Jacob, J. C., Andermann, F., Carpenter, S., Wolfe, L., and Berkovic, S. F. (1988). The Newfoundland aggregate of neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. Suppl. 5, 111–116. Batten, F. E. (1903). Cerebral degeneration with symmetrical changes in the maculae in two members of the family. Trans. Ophthalmol. Soc. UK 23, 386–390. Berkovic, S. F., Carpenter, S., Andermann, F., Andermann, E., and Wolfe, L. S. (1988). Kufs’ disease: A critical reappraisal. Brain 11, 27–62. ¨ Bielschowsky, M. (1923). Uber sp¨ate-infantile famili¨are amaurotische Idiotie mit Kleinhimsymptomen. Dtsch. Z. Nervenheilk. 50, 7–29. Camp, L. A., and Hofmann, S. L. (1993). Puriﬁcation and properties of a palmitoyl-protein thioesterase that cleaves palmitat from H-Ras. J. Biol. Chem. 268, 22566–22574. Camp, L. A., Verkruyse, L. A., Afendit, C. A., Slaughter, C. A., and Hofmann, S. L. (1994). Molecular cloning and expression of palmitoyl-protein thioesterase. J. Biol. Chem. 269, 23212–23219. Cardona, F., and Rosati, E. (1995). Neuronal ceroid-lipofuscinoses in Italy: An epidemiological study. Am. J. Med. Genet. 57, 142–143. Carpenter, S., Karpati, G., Wolfe, L. S., and Andermann, F. (1973). A type of juvenile cerebromacular degeneration characterized by granular osmiophilic deposits. J. Neurol. Sci. 18, 67–87. Cho, S., and Dawson, G. (1998). Enzymatic and molecular biological analysis of palmitoyl protein thioesterase deﬁciency in infantile neuronal ceroid lipofuscinosis. J. Neurochem. 71, 323–329. Claussen, M., Heim, P., Knispel, J., Goebel, H. H., and Kohlsch¨utter, A. (1992). Incidence of neuronal ceroid-lipofuscinoses in West Germany: Variation of a method for studying autosomal recessive disorders. Am. J. Med. Genet. 42, 536–538. Constantinidis, J., Wisniewski, K. E., and Wisniewski, T. M. (1992). The adult and a new late forms of neuronal ceroid lipofuscinosis, Acta Neuropathol. (Berl.) 83, 461–468. Chow, C. W., Borg, J., Billson, V. R., and Lake, B. D. (1993). Fetal tissue involvement in the late infantile type of neuronal ceroid lipofuscinosis. Prenat. Diagn. 13, 833–841. Crow, Y. J., Tolmie, J. L., Howatson, A. G., Patrick, W. J., and Stephenson, J. B. (1997). Batten disease in the West of Scotland 1974–1995 including ﬁve cases of the juvenile form with granular osmiophilic deposits. Neuropediatrics 28, 140–144. Das, A. K., Becerra, C. H. R., Yi, W., Lu, J-Y., Siakotos, A. N., Wisniewski, K. E., and Hofmann, S. L. (1998). Molecular genetics of palmitoyl-protein thioesterase deﬁciency in the US. J. Clin. Invest. 101, 361–370. Dyken, P., and Wisniewski, K. (1995). Classiﬁcation of the neuronal ceroid-lipofuscinoses: Expansion of the atypical forms. Am. J. Med. Genet. 57, 150–154.

1. NCL: Classiﬁcation and Diagnosis

31

Elleder, M., Franc, J., Kraus, J., Nevsimalova, S., Sixtova, K., and Zeman, J (1997). Neuronal ceroid lipofuscinosis in the Czech Republic: Analysis of 57 cases. Report of the ‘Prague NCL group’. Eur. J. Pediatr. Neurol. 4, 109–114. Elleder, M., Kraus, J., Nevsimalov´a, S., Sixtov´a, K., and Zeman, J. (1999). NCL in different European countries: Czech Republic. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), p. 129. IOS Press, Amsterdam, The Netherlands. Goebel, H. H., and Braak, H. (1989). Adult neuronal ceroid lipofuscinosis. Clin. Neuropathol. 8, 109–119. Goebel, H. H., Pilz, H., and Gullotta, F. (1976). The protracted form of juvenile neuronal ceroid lipofuscinosis. Acta Neuropathol. (Berl.) 36, 393–396. Goebel, H. H., Gullotta, F., Bajanowski, T., Hansen, F. J., and Braak, H. (1995). Pigment variant of neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. 57, 155–159. Goebel, H. H., Mole, S. E., and Lake, B. D. (1999). Introduction. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 1–4. IOS Press, Amsterdam, The Netherlands. Hallervorden, J. (1938). Sp¨atform der amaurotischen Idiotie unter Bilde der Paralysis agitans. Mschr. Psychiat. Neurol. 99, 74–80. Haltia, M., Rapola, J., and Santavouri, P. (1973). Infantile type of so-called neuronal ceroid lipofuscinosis. Histological and electron microscopic studies Acta Neuropathol. (Berl.) 26, 157–170. Hartikainen, J. M., Ju, W., Wisniewski, K. E., Moroziewicz, D. N., Kaczmarski, A. L., McLendon, L., Zhong, D., Suarez, C. T., Brown, W. T., and Zhong, N. (1999). Late infantile neuronal ceroid lipofuscinosis is due to splicing mutations in the CLN2 gene. Mol. Genet. Metab. 67, 162–168. Hofman, I. L., and Taschner, E. M. (1995). Late onset juvenile neuronal ceroid-lipofuscinosis with granular osmiophilic deposits (GROD). Am. J. Med. Genet. 57, 165–167. Hofmann, S. L., Das, A. K., Yi, W., Lu, J-Y., and Wisniewski, K. E. (1999). Genotype-phenotype correlations in neuronal ceroid lipofuscinosis due to palmitoyl-protein thioesterase deﬁciency. Mol. Genet. Metab. 66, 234–239. International Batten Disease Consortium (IBDC) (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949–957. Janes, R. W., Munroe, P. B., Mitchison, H. M., Gardiner, R. M., Mole, S. E., and Wallace, B. A. (1996). A model for Batten disease protein CLN3: Functional implications from homology and mutations. FEBS Lett. 399, 75–77. Jansk´y, J. (1908). Dosud nepopsan`y pˇripad famili´arni aurotick´e-idiotie kompliklovan´e s hypoplasii mozeˇckovou. Sborn. L´ek. 13, 165–196. J¨arvel¨a, I., Autti, T., Lamminranta, S., Aberg, L., Raininko, R., and Santavuori, P. (1997). Clinical and magnetic resonance imaging ﬁndings in Batten disease: Analysis of the major mutation (1.02-kb deletion). Ann. Neurol. 42, 799–802. Junaid, M. A., Sklower Brooks, S., Wisniewski, K. E., and Pullarkat, R. K. (1999). A novel assay for lysosomal pepstatin-insensitive protease and its application for the diagnosis of late-infantile neuronal ceroid lipofuscinosis. Clin. Chim. Acta 281, 169–176. ¨ Kufs, H. (1925). Uber eine Sp¨atform der amaurotischen Idiotie und ihre heredofamiliaren Grundlagen. Z. Ges. Neurol. Psychiat. 95, 169–188. Lake, B. D., and Cavanaugh, N. P. (1978). Early-juvenile Batten’s disease—A recognizable sub-group distinct from other forms of Batten’s disease. Analysis of 5 patients. J. Neurol. Sci. 36, 265– 271. Lake, B. D., Brett, E. M., and Boyd, S. G. (1996). A form of juvenile Batten disease with granular osmiophilic deposits. Neuropediatrics 27, 265–269. Lake, B. D., Steward, C. G., Oakhill, A., Wilson, J., and Perham, T. G. M. (1997). Bone marrow transplantation in late infantile Batten disease and juvenile Batten disease. Neuropediatrics 28, 80–81.

32

K. E. Wisniewski et al.

Lauronen, L., Munroe, P. B., Jarvela, I., Autti, T., Mitchison, H. M., O’Rawe, A. M., Gardiner, R. M., Mole, S. E., Puranen, J., Hakkinen, A. M., Kirveskari, E., and Santavuori, P. (1999). Delayed classic and protracted phenotypes of compound heterozygous juvenile neuronal ceroid lipofuscinosis. Neurology 52, 360–365. Manca, V., Kanitakis, J., Zambruno, G., Thivolet, J., and Gonnaud, P. M. (1990). Ultrastructural study of the skin in a case of juvenile ceroid-lipofuscinosis. Am. J. Dermatopathol. 12, 412–416. Martin, J. J., and Ceuterick, C. (1997). Adult neuronal ceroid-lipofuscinosis: Personal observations. Acta Neurol. Belg. 97, 85–92. Martin, J. J., Libert, J., and Ceuterick, C. (1987). Ultrastructure of brain and retina in Kufs’disease (adult type-ceroid-lipofuscinosis). Clin. Neuropathol. 6, 231–235. Mitchison, H. M., Hofmann, S. L., Becerra, C. H., Munroe, P. B., Lake, B. D., Crow, Y. J., Stephenson, J. B., Williams, R. E., Hofman, I. L., Taschner, P. E. M., Martin, J. J., Philippart, M., Andermann, E., Andermann, F., Mole, S. E., Gardiner, R. M., and O’Rawe, A. M. (1998). Mutations in the palmitoyl-protein thioesterase gene (PPT: CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits. Hum. Mol. Genet. 7, 291– 297. Mole, S. E., Mitchison, H. M., and Munroe, P. B. (1999). Molecular basis of the neuronal ceroid lipofuscinoses: Mutations in CLN1, CLN2, CLN3, and CLN5. Hum. Mutat. 14, 199–215. Munroe, P. B., Mitchison, H. M., O’Rawe, A. M., Anderson, J. W., Boustany, R-M., Lerner, T. J., and Taschner, P. E. M. (1997). Spectrum of mutations in the Batten disease gene, CLN3. Am. J. Hum. Genet. 61, 310–316. Philippart, M., Chugani, H. T., and Bronwyn Bateman, J. (1995). New Spielmeyer-Vogt variant with granular inclusions and early brain atrophy. Am. J. Med. Genet. 57, 160–164. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., de Fatima Bonaldo, M., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A-E. (1999). The neuronal ceroid lipofusinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Rapola, J., Salonen, R., Ammala, P., and Santavuori, P. (1990). Prenatal diagnosis of the infantile type of neuronal ceroid lipofuscinosis by electron microscopic investigation of human chorionic villi. Prenat. Diagn. 10, 553–559. Rawlings, N. D., and Barrett, A. J. (1999). Tripeptidyl-peptidase I is apparently the CLN2 protein absent in classical late-infantile neuronal ceroid lipofuscinosis. Biochem. Biophys. Acta 1429, 496– 500. Santavuori, P. (1988). Neuronal ceroid-lipofuscinoses in childhood. Brain Dev. 10, 80–83. Santavuori, P., Haltia, M., Rapola, J., and Raitta, C. (1973). Infantile type of so-called neuronal ceroid-lipofuscinosis Part 1. A clinical study of 15 patients. J. Neurol. Sci. 18, 257–267. Santavuori, P., Rapola, J., Sainio, K., and Raitta, C. (1982). A variant of Jansky-Bielchowsky disease. Neuropediatrics 13, 135–141. Santavuori, P., Heiskala, H., Autti, T., Johansson, E., and Westermarck, T. (1989). Comparison of the clinical courses in patients with juvenile neuronal ceroid lipofuscinosis receiving antioxidant treatment and those without antioxidant treatment. In: “Lipofuscin and Ceroid Pigments” (E. A. Porta, ed.), pp. 273–282. Plenum Press, New York. Santavuori, P., Gottlob, I., Haltia, M., Rapola, J., Lake, B. D., Tyynel¨a, J., and Peltonen, L. (1999). CLN1 Infantile and other types of NCL with GROD. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 16–36. IOS Press, Amsterdam, The Netherlands. Santorelli, F. M., Bertini, E., Petruzzella, V., Di Capua, M., Calvieri, S., Gasparini, P., and Zeviani, M. (1998). A novel insertion mutation (A169I) in the CLN1 gene is associated with infantile neuronal ceroid lipofuscinosis in an Italian patient. Biochem. Biophys. Res. Commun. 245, 519–522. Savukoski, M., Kestil¨a, M., Williams, R., J¨arvel¨a, I., Sharp, J., Harris, J., Santavuori, P., Gardiner, M., and Peltonen, L. (1994). Deﬁned chromosomal assignment of CLN5 demonstrates that at least

1. NCL: Classiﬁcation and Diagnosis

33

four genetic loci are involved in the pathogenesis of human ceroid lipofuscinosis. Am. J. Hum. Genet. 55, 695–701. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukowski, M., J¨arvel¨a, I. E., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late infantile neuronal ceroid lipofuscinosis map to chromosomes 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591– 595. Sleat, D. E., Donnelly, R. J., Lackland, H., Liu, C. G., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science. 277, 1802–1805. Sleat, D. E., Gin, R. M., Sohar, I., Wisniewski, K., Sklower-Brooks, S., Pullarkat, R. K., Palmer, D. N., Lerner, T. J., Boustany, R-M., Uldall, P., Siakotos, A. N., Donnelly, R. J., and Lobel, P. (1999). Mutational analysis of the defective protease in classical late-infantile neuronal ceroid lipofuscinosis, a neurodegenerative lysosomal storage disorder. Am. J. Hum. Genet. 64, 1511– 1523. Sohar, I., Sleat, D. E., Jadot, M., and Lobel, P. (1999). Biochemical characterization of a lysosomal protease deﬁcient in classical late infantile neuronal ceroid lipofuscinosis (LINCL) and development of an enzyme-based assay for diagnosis and exclusion of LINCL in human specimens and animal models. J. Neurochem. 73, 700–711. Spielmeyer, W. (1923). Familiare amaurotische idotie. Zentralbl. Gesamte. Ophthal. 10, 161–208. Stengel, C. (1826). Account of a singular illness among four siblings in the vicinity of Røraas. In: “Ceroid-Lipofuscinosis (Batten’s Disease)” (D. Armstrong et al., eds.), pp. 17–19 Elsevier Biomedical Press, Amsterdam, The Netherlands, 1982. Translated from: Beretning om et maerkeligt Sygdomstilfoelde hos ﬁre Sødskende I Naeheden af Røraas, Eyr et medicinsk Tidskrift. 1, 347– 352. Stephenson, J. B. P., Greene, N. D. E., Leung, K. Y., Munroe, P. B., Mole, S. E., Gardiner, R. M., Taschner, P. E. M., O’Regan, M., Naismith, K., Crow, Y. J., and Mitchison, H. M. (1999). The molecular basis of GROD-storing neuronal ceroid lipofuscinoses in Scotland. Mol. Genet. Metab. 66, 245–247. Taratuto, A. L., Saccoliti, M., Sevlever, G., Ruggieri, V., Arroyo, H., Herrero, M., Massaro, M., and Fejerman, N. (1995). Childhood neuronal ceroid-lipofuscinoses in Argentina. Am. J. Med. Genet. 57, 144–149. Tyynel¨a, J., Suopanki, J., Santavuori, P., Baumann, M., and Haltia, M. (1997). Variant late infantile neuronal ceroid-lipofuscinosis: Pathology and biochemistry. J. Neuropath. Exp. Neurol. 56, 369– 375. Uvebrant, P., and Hagberg, B. (1997). Neuronal ceroid lipofuscinosis in Scandinavia. Epidemiological and clinical pictures. Neuropediatrics 28, 6–8. Van Diggelen, O. P, Keulemans, J. L. M., Winchester, B., Hofman, I. L., Vanhanen, S. L., Santavuori, P., and Voznyi, Y. V. (1999). A rapid ﬂuorogenic palmitoyl-protein thioesterase assay: Pre-and postnatal diagnosis of INCL. Mol. Genet. Metab. 66, 240–244. Verkruyse, L. A., Natowicz, M. R., and Hofmann, S. L. (1997). Palmitoyl-protein thioesterase deﬁciency in ﬁbroblasts of individuals with infantile neuronal ceroid lipofuscinosis and I-cell disease. Biochem. Biophys. Acta 1361, 1–5. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl-protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature. 376, 584–587. Vines, D., and Warburton, N. J. (1999). Classical late infantile neuronal ceroid lipofuscinosis ﬁbroblasts are deﬁcient in lysosomal tripeptidyl peptidase I. FEBS Lett. 443, 131–135.

34

K. E. Wisniewski et al.

Waliany, S. A. K., Das, A. K., Gaben, A., Wisniewski, K. E., and Hofmann, S. L. (1999). Identiﬁcation of three novel mutations of the palmitoyl-protein thioesterase (PPT) gene in children with neuronal ceroid-lipofuscinosis. Hum. Mutat., Mutation in Brief #290. Williams, R. E., Lake, B. D., Elleder, M., and Sharp, J. D. (1999a). CLN6 Variant Late Infantile/Early Juvenile NCL. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 102–116 IOS Press, Amsterdam, The Netherlands. Williams, R. E., Topc¸u, M., Lake, B. D., Mitchell, W., and Mole, S. E. (1999b). CLN7 Turkish Variant Late Infantile NCL. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 114–116 IOS Press, Amsterdam, The Netherlands. Wisniewski, K. E., Rapin, I., and Heaney-Kieras, J. (1988). Clinico-pathological variability in the childhood neuronal ceroid lipofuscinoses and new observations on glycoprotein abnormalities. Am. J. Med. Genet. Suppl. 5, 27–46. Wisniewski, K. E., Kida, E., Patxot, O. F., and Connell, F. (1992). Variability in the clinical and pathological ﬁndings in the neuronal ceroid lipofuscinoses: Review of data and observations. Am. J. Med. Genet. 42, 525–532. Wisniewski, K. E., Golabek, A. A., and Kida, E. (1994). Increased urine levels of subunit c of mitochondrial ATP synthase in neuronal ceroid lipofuscinosis patients. J. Inher. Metab. Dis. 17, 205–210. Wisniewski, K. E., Kaczmarski, W., Golabek, A. A., and Kida, E. (1995). Rapid detection of subunit c of mitochondrial ATP synthase in urine as a diagnostic screening method for neuronal ceroidlipofuscinoses. Am. J. Med. Genet. 57, 246–249. Wisniewski, K. E., Zhong, N., Kaczmarski, W., Kaczmarski, A., Kida, E., Brown, W. T., Schwarz, K. O., Lazzarini, A. M., Rubin, A. J., Stenroos, E. S., Johnson, W. G., and Wisniewski, T. M. (1998a). Compound heterozygous genotype is associated with protracted juvenile neuronal ceroid lipofuscinosis. Ann. Neurol. 43, 106–110. Wisniewski, K. E., Zhong, N., Kaczmarski, W., Kaczmarski, A., Sklower-Brooks, S., and Brown, W. T. (1998b). Studies of atypical JNCL suggest overlapping with other NCL forms. Ped. Neurol. 18, 36–40. Wisniewski, K. E., Kida, E., Connell, F., Kaczmarski, W., Kaczmarski, A., Michalewski, M. P., and Zhong, N. (1999). Reevaluation of neuronal ceroid lipofuscinosis: Atypical juvenile onset may be the result of CLN2 mutations. Mol. Genet. Metab. 66, 248–252. Wisniewski, K. E., Kida, E., Connell, Zhong, N. (2000). Neuronal ceroid lipofuscinoses: research update. Neurol. Sci. Suppl (3) 21, S49–S56. Zeman, W. (1976). The neuronal ceroid lipofuscinoses In: “Progress in Neuropathology” (H. M. Zimmerman, ed.), Vol. III, pp. 203–223. Grune & Stratton, New York. Zeman, W., and Dyken, P. (1969). Neuronal ceroid-lipofuscinosis (Batten’s disease). Relationship to amaurotic family idiocy? Pediatrits 44, 570–583. Zhong, N., Wisniewski, K. E., Hartikainen, J., Ju, W., Moroziewicz, D. N., McLendon, L., Sklower Brooks, S., and Brown, W. T. (1998a). Two common mutations in the CLN2 gene underlie late infantile neuronal ceroid lipofuscinosis. Clin. Genet. 54, 234–238. Zhong, N., Wisniewski, K. E., Kaczmarski, A. L., Ju, W., Xu, W., Xu, W. W., McLendon, L., Liu, B., Kaczmarski, W., Sklower Brooks, S., and Brown, W. T. (1998b). Molecular screening of Batten disease: Identiﬁcation of a missense mutation (E295K) in the CLN3 gene. Hum. Genet. 102, 57–62.

2

Cellular Pathology and Pathogenic Aspects of Neuronal Ceroid Lipofuscinoses Elizabeth Kida, Adam A. Golabek,∗ and Krystyna E. Wisniewski Department of Pathological Neurobiology New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314

I. Introduction II. CLN1. Infantile Form of NCL: Deﬁciency of Palmitoyl-Protein Thioesterase 1 III. CLN2. The Classic Late-Infantile NCL: Deﬁciency of Tripeptidyl-Peptidase I IV. CLN3. Juvenile Form of NCL: Genetic Defect of Lysosomal Membrane Protein V. Other NCL Forms with Known Genetic Defect VI. NCL Forms without Identiﬁed Genetic Defects References

ABSTRACT Lysosomal accumulation of autoﬂuorescent, ceroid lipopigment material in various tissues and organs is a common feature of the neuronal ceroid lipofuscinoses (NCLs). However, recent clinicopathologic and genetic studies have evidenced that NCLs encompass a group of highly heterogeneous disorders. In ﬁve of the eight NCL variants distinguished at present, genes associated with the disease process have been isolated and characterized (CLN1, CLN2, CLN3, CLN5, CLN8). Only products of two of these genes, CLN1 and CLN2, have structural and functional properties of lysosomal enzymes. Nevertheless, according to the nature of * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

35

36

E. Kida et al.

the material accumulated in the lysosomes, NCLs in humans as well as natural animal models of these disorders can be divided into two major groups: those characterized by the prominent storage of saposins A and D, and those showing the predominance of subunit c of mitochondrial ATP synthase accumulation. Thus, taking into account the chemical character of the major component of the storage material, NCLs can be classiﬁed currently as proteinoses. Of importance, although lysosomal storage material accumulates in NCL subjects in various organs, only brain tissue shows severe dysfunction and cell death, another common feature of the NCL disease process. However, the relation between the genetic defects associated with the NCL forms, the accumulation of storage material, and tissue damage is still unknown. This chapter introduces the reader to the complex pathogenesis of NCLs and summarizes our current knowledge of the potential consequences of the genetic defects of NCL-associated proteins on the biology of the cell.

I. INTRODUCTION The lysosomal storage diseases encompass at present more than 40 different genetically determined disorders, with a combined birth prevalence in the range of 14 per 100,000 live births (Poorthuis et al., 1999). Most of these disorders are caused by abnormal hydrolysis of an adequate substrate, either by mutated lysosomal hydrolase or by mutated activator or protector protein. Deﬁcient activity of lysosomal hydrolase leads to the accumulation of undigested product in the lysosomal lumen and dysfunction of vulnerable tissue. However, in mucolipidosis II and mucolipidosis III, lysosomal storage is caused by altered targeting of lysosomal hydrolases as a result of deﬁcient activity of GlcNAc-phosphotransferase (Reitman and Kornfeld, 1981). In nephropathic cystinosis or sialic acid storage disorders, lysosomal storage is caused by a genetic defect of lysosomal transporter proteins, cystinosin (Town et al., 1998) and sialin (Verheijen et al., 1999), respectively, both with the predicted multitransmembrane topology. Thus, pathogenic events leading to lysosomal storage may vary and include dysfunctions of both enzymes and transporter proteins. Zeman and Dyken (1969) introduced the term neuronal ceroid lipofuscinoses (NCLs) to separate this group of disorders from the gangliosidoses, to which they were traditionally assigned. At present, NCLs encompass a group of diseases that are highly heterogeneous from both the clinicopathological and genetic points of view. A common feature of all forms of neuronal ceroid lipofuscinoses is accumulation of autoﬂuorescent, ceroid lipopigment material in lysosomal compartments. However, data collected to the present suggest that the pathomechanisms responsible for lysosomal storage within the group of NCLs may vary. Five of eight NCL-associated genes have been cloned so far: CLN1, CLN2, CLN3, CLN5, and CLN8 (Vesa et al., 1995; Sleat et al., 1997; The International Batten

2. Cellular Pathology and Pathogenic Aspects of NCLs

37

Disease Consortium, 1995; Savukoski et al., 1998; Ranta et al., 1999). Of interest, only products of two of these genes, CLN1 and CLN2, have structural and functional properties of lysosomal enzymes. The predicted amino acid composition of three other NCL-associated proteins, CLN3p, CLN5p, and CLN8p, suggests that these proteins have multiple transmembrane domains, which implies that they might not act as soluble lysosomal enzymes. In spite of the well-documented clinicopathologic and genetic heterogeneity of NCLs, according to the nature of the material acccumulated in lysosomes, NCLs in humans as well as animal forms of these disorders can be divided into two major groups: those characterized by the prominent storage of saposins (SAPs) A and D, and those showing the predominance of subunit c of mitochondrial ATP synthase accumulation (Palmer et al., 1997a). In addition to proteins, storage material in NCLs contains other components such as lipids, metals, dolichyl pyrophosphoryl oligosaccharides, and lipid thioesters (Wolfe et al., 1977; Goebel et al., 1979; Ng Ying Kin et al., 1983; Banerjee et al., 1992; Palmer et al., 1992; Lu et al., 1996; Dawson et al., 1997). The relation between genetic defects associated with the major NCL forms, the accumulation of storage material, and tissue dysfunction and/or damage is still unknown. Furthermore, subjects with all NCL forms manifest lysosomal storage in many tissues and organs, but severe degeneration and cell loss involve mostly neuronal cells. Thus, it appears that NCL proteins may be critical only for the metabolism of neurons. It is uncertain whether this phenomenon is caused by the speciﬁc metabolic requirements of a neuron as a postmitotic cell or results from the properties of NCL proteins per se. This chapter will introduce the reader to the complex pathogenesis of NCLs and will discuss the potential consequences of genetic defects of NCL-associated proteins on the biology of the cell.

II. CLN1. INFANTILE FORM OF NCL: DEFICIENCY OF PALMITOYL-PROTEIN THIOESTERASE 1 The ﬁrst clinicopathologic descriptions of the infantile form of NCL by Haltia and colleagues (1973) indicated that this particular variant of NCL is the most severe and has the earliest onset of symptoms, the fastest course, and the most prominent destruction of brain tissue among all NCL forms. In fact, postmortem studies demonstrated severe brain atrophy with almost total loss of neurons in the cortical mantle with prominent astrogliosis (Figures 2.1a and 2.1b), and loss of myelin in the white matter. Only some neurons in the hippocampal CA1 and CA4 sectors and basal ganglia as well as numerous neurons in the brainstem are preserved. The retina undergoes severe atrophy. Virtually all the structural elements of the central nervous system show accumulation of the PAS- (Figure 2.1c) and Sudan black B-positive material (Figure 2.1d) revealing autoﬂuorescence when examined under ultraviolet light. Lysosomal storage is visible in other tissues and

38

E. Kida et al.

Figure 2.1. Infantile NCL (CLN1). Severe atrophy of the cerebral cortex with total loss of neurons (a) and proliferating glial cells (b) loaded with PAS-positive storage material (c). Preserved neurons of the hypoglossal nucleus accumulating Sudan black-B-positive storage material (d). (a) Cresyl violet, × 100. (b) Polyclonal antibody to glial ﬁbrillary acidic protein (GFAP), × 100. (c) PAS, × 100. (d) Sudan black B, × 400.

2. Cellular Pathology and Pathogenic Aspects of NCLs

39

organs; however, it is not accompanied by any signiﬁcant cell loss. The storage material corresponds ultrastructurally to granular osmiophilic deposits (GROD) (Wisniewski et al., 1992; see also Chapter 1) and constitutes approximately 35% lipid and 45% proteins, the latter containing mostly SAPs A and D (Tyynel¨a et al., 1993). The CLN1 disease process is associated with mutations of the gene on chromosome 1 that encodes palmitoyl-protein thioesterase 1 (PPT1) (Vesa et al., 1995). To date, 24 different mutations and two polymorphisms in the PPT1 gene have been found. Most PPT1 mutations are predicted to be functionally “null.” However, phenotype/genotype correlations showed that some CLN1 subjects have a later onset of clinical signs and symptoms and a more protracted course resembling the late-infantile or juvenile rather than typical infantile form (Das et al., 1998; Mitchison et al., 1998; Wisniewski et al., 1998a; Waliany et al., 2000; for a recent review, see Mole et al., 1999). Because some PPT1 mutants disclose residual enzyme activity (Verkruyse and Hofmann, 1996; Das et al., 1998), it appears that this clinical variability can be explained by the fact that some mutations affect PPT1 function in a more prominent manner than the other mutations. However, the translation of these genetic data into the pathogenesis of CLN1 still remains elusive. PPT1 is a thioesterase that removes fatty acyl chains, preferentially those that have 14–18 carbons, such as palmitate, myristate, stearate, and oleate, from select cysteine residues in proteins in vitro and is localized to lysosomes (Figure 2.2, see color insert) (Camp and Hofmann, 1993; Camp et al., 1994; Hellsten et al., 1996; Verkruyse and Hofmann 1996; Sleat et al., 1996; see also Chapter 3). PPT1 expression in rat brain is developmentally regulated and stronger in neurons than in glial cells (Suopanki et al., 1999). In mouse brain, neurons, astrocytes, oligodendrocytes and myelin are immunoreactive (Isosomppi et al., 1999). The pattern of PPT1 immunostaining in the normal human infant brain is similar to that in mouse brain, but the immunoreactivity is weaker in the cerebral cortex (Isosomppi et al., 1999). Studies in cell culture conditions showed that the Arg122Trp mutation in PPT1 that is present in all Finnish CLN1 subjects leads to production of a nonfunctional protein that is degraded in the endoplasmic reticulum (ER) (Hellsten et al., 1996). The cellular fate and biological consequences of other PPT1 mutants remain to be determined. Furthermore, the question of why PPT1 deﬁciency leads to dramatic brain tissue damage cannot yet be answered. Palmitoylation is a posttranslational modiﬁcation of proteins leading to the attachment of fatty acids to the side chain of cysteine residues via thioester linkage. Palmitoylation plays a role in the association of polypeptides with membrane or cytoskeleton, prevention of dimerization of proteins, restriction of the lateral mobility of proteins, or receptor recycling. Palmitoylation/depalmitoylation is a reversible and dynamic process, which may regulate the function of numerous proteins of the central

40

E. Kida et al.

nervous system that are implicated in important biological processes such as neuronal transmission, signaling pathways, or protein transport (for recent reviews, see Bizzozero, 1997; Dunphy and Linder, 1998). Thus, potential impairment of these processes by nonfunctional PPT1 could indeed induce a deleterious effect on the functioning of the central nervous system and cause prominent neuronal death. Both transmembrane and soluble proteins can be palmitoylated. However, palmitoylated transmembrane proteins including G-protein-coupled receptors are usually modiﬁed either in a juxtamembranous region, near the last transmembrane segment, or at the inner surface of the plasma membrane of cells, whereas PPT1 is localized to lysosomes. Thus, it is reasonable to expect that PPT1 could be implicated in the processes delineated above only if it also is active in other cellular sites than lysosomes. Such a possibility was indeed proposed recently by Isosomppi et al. (1999), based on analysis of PPT1 expression in the mouse brain. However, more direct evidence is needed to validate this intriguing proposal. Precise pathomechanisms leading to lysosomal storage in CLN1 subjects also are still unclear. Two models explaining the origin of lysosomal storage have been proposed recently. A hypothesis formulated by Bizzozero (1997) is based on previous observations indicating that palmitoylation protects some proteins against lysosomal proteolytic attack. Thus, lack of PPT1 activity and preservation of palmitate groups on proteins could render these particular proteins resistant to lysosomal degradation leading to lysosomal storage. Because physiological substrates for PPT1 are still unknown, veriﬁcation of this hypothesis is at present difﬁcult. A model proposed by Hofmann and colleagues is based on their ﬁnding showing that small lipid thioesters derived from acylated proteins accumulate in lysosomes from CLN1 lymphoblasts as a result of PPT deﬁciency and defective autophagocytic proteolysis. Thus, it was proposed that accumulation of these compounds could compromise activity of those lysosomal proteases that are sensitive to thiol compounds, leading to more global lysosomal defect than that caused by pure dysfunction of mutated PPT 1 (Lu et al., 1996; Hofmann et al., 1997). However, as was revealed by Tyynel¨a et al. (1993), lysosomal storage in CLN1 subjects contains mostly SAPs A and D. This ﬁnding raises the question of whether there are any direct or indirect interactions between SAPs and PPT1, or whether their metabolic pathways converge. Accumulation of SAPs represents a very early event of CLN1 pathogenesis because it was evidenced already in diagnostic brain biopsy specimens (Tyynel¨a et al., 1995). SAPs also were found in amounts varying between 2% and 10% of the molar amount of stored subunit c in other NCL forms (Tyynel¨a et al., 1995, 1997a), in the storage material in the miniature Schnauzer dog (Palmer et al., 1997b), and congenital ovine NCL (Tyynel¨a et al., 1997a). Accumulation of SAPs is not restricted to the NCLs. Increased levels of SAPs were found in liver and/or brain tissue from patients with type 1 GM1 gangliosidosis, type A Niemann-Pick disease, Tay-Sachs disease,

2. Cellular Pathology and Pathogenic Aspects of NCLs

41

Sandhoff disease, type 2 GM1 gangliosidosis, metachromatic leukodystrophy, and Krabbe disease (Inui and Wenger, 1983). The highest levels of SAPs were found in storage disorders in which the stored lipid(s) bound to SAPs. Furthermore, SAPs are increased in plasma of patients with numerous different lysosomal storage disorders (Chang et al., 2000). Of interest, although in the majority of these disorders all saposins were increased in the plasma, in some of them, including MPS II, only one form of SAPs was elevated. SAPs A, B, C, and D are small, 8- to 13-kDa glycoproteins that are derived by the proteolytic processing of a 73-kDa precursor protein, prosaposin. Prosaposin is a multifunctional protein encoded in humans by a gene on chromosome 10 (Inui et al., 1985). Proteolytic cleavage of prosaposin to mature saposins through various intermediates occurs in late endosomes and lysosomes and shows cell type-speciﬁc differences (Leonova et al., 1996). In vitro studies suggested that cathepsin D may be involved in the maturation of saposins (Hiraiwa et al., 1997). SAPs are lysosomal proteins that activate several lysosomal hydrolases that are engaged in degradation of glycophospholipids. Mutations in SAPs B and C, by themselves, can lead to lysosomal storage disorders. SAP B enhances the cleavage of sulfatide by arylsulfatase A, and its genetic defect leads to a variant of metachromatic leukodystrophy (Holtschmidt et al., 1991). SAP C is a physiological activator of acid ␤-glucosidase, enabling optimal cleavage of glucosylceramidase, and its deﬁciency causes a variant form of Gaucher disease (Christomanou et al., 1989). The mechanisms of action of SAPs are not fully understood (for reviews, see Sandhoff et al., 1995; Vaccaro et al., 1999). It was postulated that SAP B solubilizes and partially extracts speciﬁc glycosphingolipids from membranes, making them accessible to the active site of arylsulfatase A, or that SAP C stimulates glucosylceramide degradation by interacting with phospholipid membranes and favoring the glucosylceramidase localization on lipid surfaces. Furthermore, some SAPs show high afﬁnity for phospholipids and are involved in binding and intervesicular transport of glycosphingolipids. Thus, although lysosomal accumulation of SAPs may represent an epiphenomenon of no or minor signiﬁcance, the role of potential dysregulation of SAP metabolism in the pathogenesis of CLN1 cannot be excluded. Of interest, prosaposin also is secreted and then taken up by the cells via mannose 6-phosphate-dependent; mannose-dependent, and low-density lipoprotein receptor-related protein-dependent routes (Hiesberger et al., 1998). However, secreted prosaposin also may bind to a speciﬁc cell surface receptor and function as a signaling molecule with neurotrophic and antiapoptotic activity (O’Brien et al., 1994; Hiraiwa et al., 1997; Tsuboi et al., 1998). The neurotrophic activity encompasses a region spanning residues 22–31 in the N-terminal part of the saposin C domain (Qi et al., 1999). Prosaposin stimulates neurite outgrowth and prevents death of a variety of neuronal cells. In addition, it prolongs survival of Schwann cells and oligodendrocytes, acting as myelinotrophic factors (Hiraiwa

42

E. Kida et al.

et al., 1997). Thus, diminished neurotrophic and antiapoptotic action of prosaposin could potentially contribute signiﬁcantly to the massive neuronal death observed in CLN1 subjects. It cannot be excluded at present that saposins interact in some way with PPT1. All SAPs have a similar location of six cysteins, and their disulﬁde arrangement has been found to be essential for their action (O’Brien and Kishimoto, 1991; Vaccaro et al., 1995). SAPs could potentially represent natural substrates for PPT1. Therefore, lack of putative depalmitoylation of SAPs caused by PPT1 deﬁciency could affect proper function of these activator proteins. PPT1 deﬁciency also could be involved indirectly in the metabolism of SAPs, i.e., by changing the lipid content of the lysosomal milieu. These complex aspects of the CLN1 disease process require further experimental studies.

III. CLN2. THE CLASSIC LATE-INFANTILE NCL: DEFICIENCY OF TRIPEPTIDYL-PEPTIDASE I Severe brain atrophy with massive neuronal loss in the cerebral and cerebellar cortices represent a feature of classical late-infantile NCL brain (Figures 2.3a– 2.3d). Less severe neuronal loss is found in subcortical gray matter areas, and the least in brainstem nuclei. Diffuse proliferation of macrophages most probably of microglial origin (Br¨uck and Goebel, 1998) and astrogliosis, both most prominent in the cerebral cortex, represent a constant structural abnormality. Retinae show atrophy. Autoﬂuorescent, PAS- and Sudan black B-positive lysosomal storage material that is present in all tissues and organs is visualized ultrastructurally as curvilinear proﬁles (Wisniewski et al., 1992, see also Chapter 1). However, the intensity of neuronal damage varies, and neurons with relatively well preserved structure (Figure 2.4a), as well as neurons severely damaged and overloaded with lysosomal storage coexist in the same brain areas (Figure 2.4b). A main component of the lysosomal storage material in CLN2 subjects is subunit c of mitochondrial ATP synthase (Figures 2.5a and 2.5b), which constitutes around 85% of the protein content of stored cytosomes (Palmer et al., 1989, 1992; Fearnley et al., 1990; Kominami et al., 1992). Subunit c of mitochondrial ATP synthase also accumulates in other NCL forms, except for the CLN1 variant (Hall et al., 1991a; Elleder et al., 1997; Tyynel¨a et al., 1997b; Haltia et al., 1999); in some canine, bovine, and ovine forms of NCLs (for review, see Palmer et al., 1997a); and in mnd/mnd (for motor neuron degeneration) mice (Pardo et al., 1994; Faust et al., 1994). In addition, accumulation of subunit c was detected in lysosomal storage diseases other than NCLs (Kida et al., 1993; Elleder et al., 1997). However, even if accumulation of subunit c was conspicuous and widespread in the neuronal population in some of these conditions, such as in mucopolysaccharidoses I, II, IIIA, subunit c staining was generally absent in non-neuronal

2. Cellular Pathology and Pathogenic Aspects of NCLs

43

Figure 2.3. Classic late-infantile NCL (CLN2). Neuronal loss, gliosis and widespread deposition of PAS-positive material in neurons, glial cells and blood vessel walls in the neocortex (a). Numerous macrophages in the cerebral cortex (b). Neuronal loss in the granular and pyramidal layers of the cerebellar cortex (c) with gliosis (d). (a) PAS, × 100. (b) Anti-ferritin immunostaining, × 200. (c) PAS, × 100. (d) Anti-GFAP immunostaining, × 200.

Figure 2.4. Classic late-infantile NCL (CLN2). Substantia nigra neuron with relatively well preserved structure (a), and severely damaged neuron in the same brain area (b). Arrows point to the nuclei. CV indicates lysosomal storage material. Electron microscopy. Postmortem tissue. Orig. magn. × 5000.

Figure 2.5. Classic late-infantile NCL (CLN2). (a) Accumulation of subunit c of mitochondrial ATP synthase in neurons and glia in the cerebral cortex. Arrows indicate the severely distended proximal part of the axon (meganeurites). (b) Immunoelectron microscopically, subunit c of mitochondrial ATP synthase is associated with curvilinear proﬁles. Immunogold method with 10 nm gold particles. (a) × 200; (b) × 40,000.

2. Cellular Pathology and Pathogenic Aspects of NCLs

45

Figure 2.6. Classic late-infantile NCL (CLN2). Neuronal inclusion bodies (arrowheads) easily identiﬁable in Kl¨uver-Barrera staining (a) are not immunoreactive to subunit c of mitochondrial ATP synthase (b). (a), (b), × 400.

cells of the brain and visceral organs (Elleder et al., 1997). This is in sharp contrast to CLN2, where deposition of subunit c-immunopositive material is observed in many tissues and organs. Furthermore, in CLN2 and some CLN3 subjects, subunit c deposition in kidney is so prominent that it can be detected in urine samples, representing an easy screening test for these disorders (Wisniewski et al., 1994, 1995). Neurons in some brain regions of CLN2 subjects, such as the nucleus dentatus, nucleus subthalamicus, or substantia nigra, contain spheroidal inclusions that are immunoreactive neither to subunit c nor to selected lectins, even though the storage material surrounding them shows the staining (Figure 2.6) (Kida et al., 1995). These inclusions can be especially numerous in some CLN2 cases (Wisniewski et al., 1993) and most probably correspond to the so-called myoclonus bodies described originally by Seitelberger and colleagues (1967). Elleder and Tyynel¨a (1998) reported recently the presence of SAPs-negative storage bodies in CLN1, CLN2, and CLN6 subjects and subunit c-negative deposits also in CLN6 subjects. The origin of these inclusions is at present unclear. It was proposed that the lysosomal storage material undergoes gradual modiﬁcations, which may lead to loss of immunodetectable epitopes of both subunit c and SAPs. It is also conceivable that these inclusions may contain other components of the storage material than subunit c or SAPs, such as lipid thioesters or small polypeptides (see below). Subunit c is an intrinsic membrane component of the ATP synthase complex located in the inner mitochondrial membrane, where it is involved

46

E. Kida et al.

in rotary motion of the ATP synthase complex and proton transport through the membrane (Fillingame, 1997). The 75-amino acid sequence and 42-dalton modiﬁcation of subunit c isolated from the storage material do not differ from normal subunit c (Fearnley et al., 1990; Palmer et al., 1992; Buzy et al., 1996). None of the three nuclear genes, P1, P2, and P3, coding for subunit c located on chromosomes 17, 12, and 2, respectively (Dyer and Walker, 1993; Yan et al., 1994), could be associated with the NCL disease process (Medd et al., 1993; Ezaki et al., 1995). Thus, it was proposed that accumulation of subunit c of mitochondrial ATP synthase is caused by decreased degradation of this highly hydrophobic proteolipid (Palmer et al., 1989, 1992; Kominami et al., 1992; Ezaki et al., 1995). Most of the experimental studies aimed at characterizing the role of subunit c accumulation for CLN2 pathogenesis were done by using primary ﬁbroblast cultures. However, accumulation of subunit c in vitro in these particular types of cells was controversial. Both our (Kida et al., 1993) and others studies (Lake and Rowan, 1997) disclosed neither signiﬁcant subunit c storage nor the presence of curvilinear proﬁles in cultured ﬁbroblasts from CLN2 subjects. However, accumulation of subunit c in cultured ﬁbroblasts was reported by others (Tanner and Dice, 1995; Tanner et al., 1997; Kominami et al., 1992; Ezaki et al., 1995, 1997, 1999). In a series of publications, Ezaki and colleagues (Kominami et al., 1992, Ezaki et al., 1995, 1996, 1997) presented data showing that although the majority of subunit c from control ﬁbroblasts was found in fractionated mitochondria, around 50–70% of subunit c from patients’ cells was recovered in lysosomal fractions. There also was delayed intramitochondrial and lysosomal degradation of labeled subunit c in ﬁbroblasts from CLN2 patients. Furthermore, only isolated lysosomal fractions from control but not CLN2 ﬁbroblasts were able to degrade subunit c either from control or CLN2 cells. Nevertheless, pulse chase experiments presented by these researchers disclosed unequivocally that ﬁbroblasts from CLN2 patients did in fact degrade subunit c, but less efﬁciently than control cells. This suggests that the activity of the enzyme involved in subunit c degradation is impaired but not abolished totally in the cells studied. It cannot be excluded that more than one protease is involved in subunit c degradation in vivo as well, assuming that CLN2 protein is implicated directly in subunit c proteolysis. In 1997, by using a proteomic approach, Sleat and colleagues identiﬁed the protein defective in CLN2 subjects (Sleat et al., 1997). The signiﬁcant similarity of this protein to a speciﬁc group of bacterial proteases suggested that this protein is pepstatin-insensitive carboxyl endopeptidase. However, Rawlings and Barrett (1999) disclosed that CLN2-deﬁcient protein corresponds in fact to lysosomal tripeptidyl-peptidase I (TPP I), an enzyme puriﬁed recently to homogeneity from the rat spleen by Vines and Warburton (1998). TPP I is an aminopeptidase that releases different tripeptides from a free N-terminus, with preference to hydrophobic amino acids in the P1-position (Page et al., 1993), and also shows

2. Cellular Pathology and Pathogenic Aspects of NCLs

47

endopeptidase activity in vitro (Ezaki et al., 2000). With the use of immunocytochemistry, TPP I was localized in the brain to both neurons and glia (Oka et al., 1998). An acidic pH optimum together with the presence of mannose 6-phosphate modiﬁcation suggested that CLN2p acts within lysosomal compartments (Sleat et al., 1997, 1999; Sohar et al., 1999). The lysosomal localization of TPP I was indeed documented afterwards by immunoﬂuorescence and subcellular fractionation (Ezaki et al., 1999). Efﬁcient protein degradation in lysosomes depends on concerted action of endopeptidases and exopeptidases, which provide dipeptides and free amino acids exported to the cytoplasm and further used according to the metabolic needs of the cell. Thus, TPP I could provide tripeptides for subsequent action of dipeptidyl peptidases and dipeptidases, and its dysfunction could lead to the accumulation of undigested polypeptides in the lysosomal lumen. Of interest, accumulation of low-molecular-weight compounds was observed previously in the storage material (Palmer et al., 1993), but approaches to provide their closer biochemical characterization were unsuccessful. It appears that most of 26 mutations identiﬁed until present in the TPP I gene cause loss of TPP I activity (Sleat et al., 1999; Sohar et al., 1999; Junaid et al., 1999; Vines and Warburton, 1999; for a recent review, see Mole et al., 1999). The cellular fate of mutated TPP I has not yet been determined. However, TPP I is undetectable in ﬁbroblasts and brain and liver tissue from CLN2 subjects (Oka et al., 1998; Ezaki et al., 1999) (Figure 2.7), which suggests that mutated TPP I may be degraded soon after its synthesis. Although TPP I cleaves in vitro peptide hormones, such as growth hormone (Doebber et al., 1978), angiotensin II, and glucagon (Vines and Warburton, 1999), or substance P (Junaid et al., 2000), the natural substrates for TPP I have to be determined. Of interest, Junaid and colleagues (2000) demonstrated recently that TPP I also is involved in hydrolysis of synthetic amyloid-␤ peptides 1-42 and 1-28. Accumulation of amyloid-␤ peptide in the brain tissue of CLN2 subjects was suggested by our previous studies (Kitaguchi et al., 1990; Wisniewski et al., 1990a, 1990b). Elleder and colleagues (1995) showed that various cell types tested under cell culture conditions were not able to degrade subunit c isolated from the storage material from affected animals. However, Ezaki and colleagues (1999) showed that immunodepletion of TTP I from a lysosomal fraction prepared from control cells led to diminished degradation of mitochondrial subunit c from control cells. In agreement with this observation, Junaid and colleagues (2000) found that TPP I isolated from the bovine brain was able to cleave off a tripeptide from a synthetic amino-terminal hexapeptide or carboxy-terminal pentapeptide from the subunit c sequence. Both these observations suggested strongly that subunit c of mitochondrial ATP synthase represents a substrate for TPP I. However, subunit c isolated from the storage material from CLN2 subjects was not degraded in vitro

48

E. Kida et al.

Figure 2.7. Lack of tripeptidyl-peptidase I immunoreactivity in the cerebral cortex of CLN2 subject homozygous to Arg208STOP nonsense mutation (a) and strong immunostaining in the cerebral cortex of CLN3 subject (b). Monoclonal antibody 8C4, × 200.

by puriﬁed bovine TPP I (Junaid et al., 2000). Thus, it appears that further studies are needed to ascertain that subunit c accumulation in CLN2 subjects is caused directly by TPP I deﬁciency. Whether and how subunit c accumulation is associated with progressive neuronal degeneration and death remains unknown. Recently, it was reported that subunit c also is present in the plasma membrane, where it acts as a cation pore (McGeoch and Guidotti, 1997). Thus, it was proposed that increased subunit c content in the neurons could render these cells more susceptible to depolarization and increased excitability, leading to their death (McGeoch and Palmer, 1999). Of interest, in some NCL forms and in the mnd/mnd mice, also small amounts of subunit c of vacuolar ATPase have been identiﬁed (Faust et al., 1994; Palmer et al., 1997a). Subunits c of vacuolar ATPase reveal a homology to subunit c of mitochondrial ATPase and are derived by gene duplication and fusion from the mitochondrial ATPase c subunit (for review, see Forgac, 1998). Vacuolar ATPase is associated with membranes of intracellular acidic vesicular compartments, where it maintains pH gradient across the membrane. However, vacuolar ATPase also is expressed at the plasma membrane of some types of cells. Thus, it cannot be excluded at present that subunit c of mitochondrial ATP synthase and subunit c of vacuolar ATPase deposited in the storage material originate at least partially from the plasma membrane. If this scenario is true, both endocytosis and macroautophagy could be involved in lysosomal transport of subunits c.

2. Cellular Pathology and Pathogenic Aspects of NCLs

49

It is also conceivable that the cell damage observed in CLN2 subjects may result from defective degradation and lysosomal storage of small peptides as a direct consequence of TPP I dysfunction (Vines and Warburton, 1999). Another interesting pathogenic hypothesis was presented recently by Das and colleagues (1999). These researchers disclosed deﬁciency of mitochondrial ATP synthase in various NCL forms as well as in the sheep model of NCL. Thus, they proposed that deﬁcient ATP supply might represent a common denominator of neuronal degeneration in NCLs affecting especially those neurons that have high-energy requirements. Also, this hypothesis needs more experimental data to be conﬁrmed.

IV. CLN3. JUVENILE FORM OF NCL: GENETIC DEFECT OF LYSOSOMAL MEMBRANE PROTEIN Similar to CLN1 and CLN2, the CLN3 disease process affects most severely the brain tissue. However, brain atrophy and neuronal loss (Figures 2.8a and 2.8b) are distinctly less prominent in subjects with the juvenile variant of NCLs than in CLN1 and CLN2 individuals. In the cerebral cortex, neuronal loss predominates in layer V (Braak and Goebel, 1979). The cerebellar cortex shows widespread, moderate loss of granule cells, whereas the pyramidal layer is less affected. Neuronal loss is rather mild in subcortical nuclei and brainstem. Gliosis, manifested mostly by proliferation of astrocytes and, to a lesser degree, of microglia,

Figure 2.8. Juvenile NCL (CLN3). Moderate neuronal loss in the cerebral (a) and cerebellar cortices (b). (a) Sudan black B, × 100. (b) PAS, × 100.

50

E. Kida et al.

is distinctly less severe than in CLN1 and CLN2 subjects. Retinae show severe atrophy with gliosis. Autoﬂuorescent, Sudan black B- and PAS-positive storage material is widespread in the brain tissue, often being especially abundant in pyramidal neurons of hippocampal sectors CA2–CA4. Lysosomal storage is not conﬁned to the brain but also is present in various tissues and organs. Ultrastructurally, the storage material is composed of ﬁngerprint proﬁles. Vacuolated lymphocytes are typical for this form of NCLs (Wisniewski et al., 1992, see also Chapter 1). Subunit c of mitochondrial ATP synthase constitutes around 20% of the protein content of the storage material (Palmer et al., 1992). Other identiﬁed constituents of the lysosomal storage material include lipids, phosphorylated dolichols (for review, see Hall et al., 1991b), small amounts of SAPs (Tyynel¨a et al., 1995), and amyloid-␤ peptide (Wisniewski et al., 1990a, 1990b). Of interest, the level of numerous mannose 6-phosphate-modiﬁed lysosomal enzymes is increased signiﬁcantly—even up to sevenfold—in brain tissue of JNCL subjects (Sleat et al., 1998). Although the CLN3 gene was identiﬁed in 1995 (International Batten Disease Consortium, 1995), our knowledge of the role of the CLN3 protein (CLN3p) in the cell biology is very limited. The major problem encountered by researchers working on unraveling the function of CLN3p was posed by difﬁculties in raising antibodies recognizing endogenous CLN3p, which was caused most probably by speciﬁc structural and functional properties of CLN3p. As a consequence, most of the studies were carried out using mammalian expression systems. Structural modeling of CLN3p has led to the suggestion that CLN3p might be a mitochondrial protein (Janes et al., 1996). Indeed, Katz and colleagues (1997) reported the mitochondrial localization of CLN3p in M¨uller cells and some inner neurons of mouse retina by using polyclonal antibodies to CLN3 protein. On Western blot, this antibody recognized a 50-kDa band. However, the speciﬁcity of this antibody was not conﬁrmed by using recombinant CLN3p and could not be veriﬁed by Western blot analysis of disease and normal human material, because it did not react with human tissue. The immunoﬂuorescence method used in another recent study by J¨arvel¨a and colleagues (1998) showed that CLN3p expressed in HeLa cells and detected by a polyclonal antibody raised in rabbit colocalizes with a lysosomal-associated membrane protein, lamp-1, and thus is targeted to lysosomal compartments. Our studies performed by using a different methodology conﬁrmed that CLN3p either expressed in fusion with the green ﬂuorescent protein or tagged with FLAG epitope is a lysosomal membrane protein (Kida et al., 1999; Golabek et al., 1999, 2000) (Figures 2.9a–2.9c). Lysosomal localization of yeast homologue of CLN3p, BTN1, also was disclosed (Croopnick et al., 1998; Pearce et al., 1999a). However, it also was suggested that a substantial portion of overexpressed CLN3p is associated with the Golgi apparatus (Kremmidiotis et al., 1999).

2. Cellular Pathology and Pathogenic Aspects of NCLs

51

Figure 2.9. Predicted structure of CLN3p. The schematic structure of CLN3p including the predicted N-glycosylation (N) and phosphorylation (P) sites was drawn on the basis of TMpred, SOSUI, and MotifFinder algorithms. For the clarity of the picture, the predicted posttranslational lipid modiﬁcations were omitted, except for farnesylation motif (F) at the C-terminus.

Analysis of the predicted amino acid sequence of CLN3p suggested that CLN3p belongs to type-IIIb membrane proteins (von Heijne and Gavel, 1988) and that, according to hydropathy calculation, it may contain six putative transmembrane domains (Janes et al., 1996). Nevertheless, modeling with several other hydrophobicity algorithms suggests that CLN3p may span up to nine transmembrane regions (Figure 2.10, see color insert). The speciﬁc amino acid composition dictates that CLN3p is highly hydrophobic. In addition, its molecule contains numerous structural motifs that can be engaged in extensive co- and posttranslational modiﬁcations. According to the analysis performed by The International Batten Disease Consortium (1995), CLN3p has four potential N-linked glycosylation sites at residues 49, 71, 85, and 310; two putative O-glycosylation sites at residues 80 and 256; two potential glycosaminoglycan sites at residues 162 and 186; six protein kinase C phosphorylation sites; two cAMP- and cGMP-dependent protein kinase phosphorylation sites; eight casein kinase II phosphorylation sites; and 12 N-myristoylation sites and palmitoylation sites. Our studies showed that CLN3p, like other lysosomal membrane proteins (Hunziker and Geuze, 1996) is glycosylated extensively and that the pattern of glycosylation of CLN3p shows cell-type-speciﬁc differences (Golabek et al., 1999). According to our data, CLN3p also is phosphorylated (Michalewski et al., 1998), most probably processed proteolytically (Golabek et al., 2000), and farnesylated (Kaczmarski et al., 1999). The biological signiﬁcance of these co- and posttranslational modiﬁcations is at present unclear. However, characterization of co- and posttranslational modiﬁcations of CLN3p is important to understand the function of CLN3p, given that posttranslational modiﬁcations may signiﬁcantly determine the properties and/or regulate the activity of proteins.

52

E. Kida et al.

The most common mutation in the CLN3 gene is a 1.02-kb deletion found in 85% of the Batten disease chromosomes examined (Munroe et al., 1997). This deletion, affecting either one or both alleles, produces a frameshift and generates a predicted translation product of 181 amino acids (153 residues of the protein, followed by 28 novel amino acids before the stop codon), which is retained and most probably degraded in the endoplasmic reticulum (J¨arvel¨a et al., 1999). Apart from this common deletion, 24 other mutations, including deletions, insertions, and point mutations, have been discovered (Munroe et al., 1997; Wisniewski et al., 1998b; Zhong et al., 1998; Lauronen et al., 1999; for a recent review, see Mole et al., 1999). It was suggested that these mutations either result in severely truncated CLN3p or affect its structure/conformation. Phenotype/genotype correlation suggests that there are structural domains in CLN3p that are critical for CLN3 protein function, and that, even if affected by point mutations, induce a severe deleterious effect in vulnerable tissue. It is still unknown which particular properties of CLN3p are changed by point mutations. Mutations present in transmembrane domains can change the normal targeting of lysosomal membrane proteins by altering their membrane incorporation, as was documented for lysosomal membrane protein, lamp-1 (Roher et al., 1996; Wimer Mackin and Granger, 1996). Mutated proteins also can be misfolded and degraded rapidly in the endoplasmic reticulum (Klausner and Sitia, 1990), which might explain why some mutated proteins may be virtually undetectable in the tissues of affected subjects. Our unpublished data suggest that both CLN3-101 mutant (Leu101Pro) and CLN3-334 mutant (Arg334Cys) are targeted to lysosomal compartments (Figures 2.11d–2.11f, see color insert), thus, similar to wild-type CLN3p (Figures 2.11a–2.11c, see color insert). Lysosomal-associated membrane proteins such as lamp-1, lamp-2, limp-I, or limp-II are targeted to lysosomes either through late endosomes or through a secretory pathway and endocytosis from the plasma membrane. These proteins utilize two different structural lysosomal sorting motifs located in their C-terminal tails: either tyrosine-based or di-leucine-based signals (Fukuda, 1994; Sandoval et al., 1994; Marks et al., 1996). However, our data suggest that a di-leucine motif present in the C-terminal fragment of CLN3p is not involved in its lysosomal targeting in vitro (Kida et al., 1999). In this respect, CLN3p recalls sialin and other transporters of the ACS family, which do not possess a known targeting signal (Verheijen et al., 2000). There is no signiﬁcant sequence homology between CLN3p and any other protein known in mammals. However, the yeast homolog in Saccharomyces cerevisiae, btn1, encodes a nonessential protein that shows 39% identity and 59% similarity to CLN3. Btn1-deletion yeast strains show pH-dependent resistance to D-(−)-threo-2-amino-1-[p-nitrophenyl]-1,2-propanediol (ANP), a phenotype that can be complemented by expression of human CLN3 (Pearce and Sherman,

2. Cellular Pathology and Pathogenic Aspects of NCLs

53

1998). Furthermore, btn1- yeast strains have an abnormally acidic vacuolar pH in the early phases of growth, which can be reversed by the presence of chloroquine in the growing medium (Pearce and Sherman, 1998; Pearce et al., 1999a, 1999b). These data indicate that BTN1 is involved in the control of vacuolar pH in yeast (for details, see Chapter 11). To study the function of CLN3p, we used human embryonal kidney cells (HEK-293) stably expressing wild-type and mutant CLN3p as well as cells stably transfected with antisense-oriented CLN3 cDNA under the control of the ecdysone-inducible promoter (Golabek et al., 2000). Our data indicate that wildtype CLN3p increases lysosomal pH in HEK-293 cells, whereas inhibition of CLN3p synthesis by the antisense approach acidiﬁes lysosomal compartments. In addition, we found that this biological activity of wild-type CLN3p affects intracellular processing of amyloid-␤ protein precursor and cathepsin D, proteins whose metabolism is inﬂuenced by pH of intracellular acid compartments. We also found that mutant CLN3p (Arg334Cys), which is associated with the classical juvenile NCL phenotype in compound heterozygotes, is devoid of the biological activity of wild-type CLN3p. Of interest, our previous studies suggested accumulation of amyloid-␤ protein in the brain tissue of CLN3 subjects (Kitaguchi et al., 1990; Wisniewski et al., 1990a, 1990b). Thus, both our data and observations of Pearce and colleagues suggest that the pathogenesis of juvenile NCL is associated with altered acidiﬁcation of lysosomal compartments. The acidic pH of lysosomes is generated as a result of the activity of vacuolar H+-ATPase (V-ATPase), a major electrogenic proton pump in eukaryotic cells (for review, see Forgac et al., 1998). The V-ATPase pumps protons from the cytosol to the vacuoles by using the energy released by ATP hydrolysis. Acidiﬁcation of vacuolar compartments plays an important role in various cellular processes such as membrane trafﬁcking, formation of endosomal carrier vesicles, storage of metabolites, or dissociation of mannose 6-phosphate receptors from their ligands. Maintaining the acidic pH of the lysosomal milieu may be critical for the activity of numerous lysosomal enzymes, taking into account that most lysosomal enzymes have acidic pH optima. Derangement of the proper pH of the lysosomal lumen may affect predominantly the activity of those lysosomal enzymes that are especially sensitive to pH changes. Maintenance of the transmembrane pH gradient by a vacuolar H+-ATPase also may determine the normal posttranslational proteolysis of some proteins (Beers, 1996). In addition, a rise in lysosomal pH induced by lysosomotropic amines, H(+)-ionophores, or inhibition of vacuolar type H(+)-ATPase, may increase lysosomal secretion (Braulke et al., 1987). However, some lysosomal enzymes such as cysteine endopeptidases are active over a broad range of pH 4–8 (for review, see Mason, 1995). Furthermore, other enzymes such as sialic acid-speciﬁc O-acetylesterase (Butor et al., 1995) or PPT1, associated with infantile NCL (Verkruyse and Hofman, 1996), have

54

E. Kida et al.

neutral pH optima. Thus, it was suggested that intralysosomal pH can ﬂuctuate, facilitating efﬁcient hydrolytic activity of enzymes with a wide range of pH optima (Butor et al., 1995). We propose that alteration of this process by CLN3 protein deﬁciency and increased acidiﬁcation of lysosomes could impair the activity of enzymes with pH optima closer to neutral, leading to lysosomal storage. Further studies are needed to verify this hypothesis. The cause of neuronal death in CLN3 subjects is not known. Boustany and colleagues presented data suggesting that neurons and photoreceptors die in the mechanism of apoptosis in late-infantile and juvenile forms of NCL as well as in canine and ovine models of NCL (Lane et al., 1996). Further studies of these researchers implied that CLN3p exerts a neurotrophic and anti-apoptotic effect in vitro; thus, lack of functional CLN3p in subjects with the juvenile form of NCL could trigger apoptotic signaling pathways (Puranam et al., 1999). Increased rate of apoptosis also was observed in peripheral blood mononuclear cells from NCL patients (Kieseier et al., 1997). Recently developed CLN3 knockout mice (Katz et al., 1999; Mitchison et al., 1999) will be helpful in further elaborating this issue and gaining better insight into the complex pathogenesis of CLN3 disease process.

V. OTHER NCL FORMS WITH KNOWN GENETIC DEFECT Our knowledge of the pathogenesis of the forms of NCL other than CLN1, CLN2, and CLN3 is even more limited. Two of these NCL variants, CLN5 and CLN8, are encountered almost exclusively in the Finnish population and were assigned previously to chromosomes 13 and 8, respectively (Savukoski et al., 1994; Tahvanainen et al., 1994). Only recently, genes encoding proteins associated with the Finnish variant of late-infantile NCL (CLN5) (Savukoski et al., 1998) and Northern epilepsy (CLN8) (Ranta et al., 1999) have been isolated and characterized. The subcellular localization of the proteins encoded by these genes as well as their function are unknown at present. However, analysis of the predicted amino acid sequences of both these proteins suggest that they have transmembrane topology (Figure 2.12) and may undergo signiﬁcant co- and posttranslational modiﬁcations—thus, similar to CLN3p. The clinical course, pathology, and biochemistry of the CLN5 disease process recalls that observed in classical late-infantile NCL. Major differences include a later onset of the clinical signs, slower progression, less severe brain atrophy, and variable ultrastructure of lysosomal inclusions visualized as ﬁngerprint and curvilinear proﬁles as well as rectilinear complexes (for a recent review, see Santavuori et al., 1999; see also Chapter 6). Similarly to CLN2, the storage material contains mostly subunit c of mitochondrial ATP synthase and small amounts of SAPs A and D (Figures 2.13a and 2.13b) (Tyynel¨a et al., 1997b).

2. Cellular Pathology and Pathogenic Aspects of NCLs

55

Figure 2.12. Predicted structures of CLN5p (A) and CLN8p (B). The schematic structures of CLN5p and CLN8p, including the predicted N-glycosylation (N) and phosphorylation (P) sites, were drawn on the basis of TMpred, SOSUI, and MotifFinder algorithms. For the clarity of the picture, the predicted posttranslational lipid modiﬁcations were omitted.

Northern epilepsy (progressive epilepsy with mental retardation), although known in the Finnish population for many years, has only recently been added to the group of NCLs and its gene assigned as CLN8. Clinical course, symptomatology, and pattern of brain tissue damage in CLN8 subjects differ from those in all other forms of NCL. However, the storage material, similar to other NCL forms, shows immunoreactivity to subunit c of mitochondrial ATP synthase and SAPs, as well as to amyloid-␤ peptide (for a recent review, see Haltia et al., 1999; see also Chapter 6).

56

E. Kida et al.

Figure 2.13. Immunoreactivity to subunit c of mitochondrial ATP synthase (a) and to saposin A and D (b) in the frontal cortex of CLN5 subject. From the collection of Dr. J. Tyynel¨a. (a), (b) × 450.

Of interest, the gene lesion in the mnd/mnd mice that exhibit some clinicopathological signs of NCL including accumulation of subunit c of mitochondrial ATP synthase, subunit c of vacuolar ATPase, and dolichol-derived oligosaccharides (Pardo et al., 1994, Faust et al., 1994) is syntenic to CLN8 in humans (Ranta et al., 1999). The availability of a mouse model may be helpful to understand the pathogenesis of CLN8.

VI. NCL FORMS WITHOUT IDENTIFIED GENETIC DEFECTS Variant late-infantile/early-juvenile NCL, assigned to CLN6 and mapped to chromosome 15 (Sharp et al., 1999), recalls both the classical late-infantile and juvenile NCL forms. The clinical course and the pattern of brain damage are similar to the late-infantile NCL. However, the severity of neuronal loss in the cerebral cortex is less prominent. The ultrastructure of the storage material

2. Cellular Pathology and Pathogenic Aspects of NCLs

57

Figure 2.14. Accumulation of subunit c of mitochondrial ATP synthase in neurons and glia of the frontal cortex of CLN6 subject. × 200.

includes mostly ﬁngerprint proﬁles and rectilinear complexes. In contrast to CLN3, lymphocytes are not vacuolated (for a recent review, see Williams et al., 1999a). The storage material is immunopositive to subunit c of mitochondrial ATP synthase (Figure 2.14) (Elleder et al., 1997). Recently, Palmer and colleagues developed a cell culture model of fetal neurons from sheep affected with ceroid lipofuscinosis (Hughes et al., 1999; Kay et al., 1999). These cells accumulate signiﬁcant amounts of subunit c of mitochondrial ATP synthase in vitro. The genetic lesion in these animals is syntenic to the human CLN6 form (Broom et al., 1998). Thus, application of this new model to evaluate molecular mechanisms underlying subunit c storage and its potential inﬂuence on cell viability could provide new light on the pathogenesis of this form of NCL. Only very scanty data are available on the Turkish variant late-infantile NCL, assigned to CLN7. From the clinicopathological point of view, the

58

E. Kida et al.

CLN7 disease process recalls both the late-infantile and early-juvenile cases. Fingerprint proﬁles, curvilinear proﬁles, and rectilinear complexes were reported in the lysosomal storage (for a recent review, see Williams et al., 1999b). The adult form, CLN4 (Kufs’ disease), is a very rare form of NCL and differs in several aspects from the childhood forms (Berkovic et al., 1988). The CLN4 disease process may be manifested by two major phenotypes: type A, with predominance of dementia and behavioral problems; and type B, with progressive myoclonus epilepsy with dementia. In contrast to the childhood forms of NCL, subjects with Kufs’ disease have intact vision. Pigmentary retinal degeneration is absent. Inheritance, in contrast to other NCL forms, may be either autosomal recessive (more common) or autosomal dominant (rare). Storage material predominates in the brain tissue. Ultrastructurally, granular, ﬁngerprint, and curvilinear proﬁles were reported (for details, see Berkovic et al., 1988; Goebel and Braak, 1989; Martin et al., 1999). In the storage material, subunit c of mitochondrial ATPase (Hall et al., 1991a), SAPs A and D (Tyynel¨a et al., 1997), and amyloid-␤ peptide (Figure 2.15) (Wisniewski et al., 1990a) were found.

Figure 2.15. Immunoreactivity to the amyloid-␤ peptide in the frontal cortex of CLN4 subject. Immunostaining with monoclonal antibody 4G8 recognizing amino acids 17–24 of amyloid-␤ peptide. × 200.

2. Cellular Pathology and Pathogenic Aspects of NCLs

59

Brain atrophy is usually prominent in the frontoparietal areas and cerebellum. Neuronal loss is the most pronounced in layers II and III of the cerebral cortex and the pyramidal layer of the cerebellum. Of interest, similar to juvenile NCL, among the hippocampal sectors, CA1sector is less affected. The morphology of cells accumulating lipopigment is similar to that observed in childhood forms and includes severe distention of the cell somata and the proximal segment of axons, forming meganeurites. Of interest, in spite of preservation of vision and lack of evident damage to the retina, storage material also was reported in the retinal ganglion cells (Martin et al., 1987). The gene locus of CLN4 has not yet been identiﬁed. By using mannose 6-phosphate overlay blotting with iodinated cation-independent mannose-6 phosphate receptor, Sleat and colleagues (1998) could not identify a protein specifically associated with the CLN4 disease process. However, two proteins were highly elevated (11.9-fold and 15.0-fold) compared with controls, which might suggest that their increased levels could represent a compensatory mechanism mobilized by the cell in response to the CLN4 disease process. Isolation of the gene associated with CLN4 and characterization of the structure and function of its product is a condition necessary to understand the pathogenic events underlying this rare form of NCL.

Acknowledgments The authors wish to thank Dr. J. Tyynel¨a for kindly providing material for documentation, and Drs. S. Hofmann and E. Kominami for their gift of antibodies to PPT1 and subunit c of mitochondrial ATP synthase. The editorial assistance of Mrs. Maureen Stoddard Marlow is appreciated. This work was supported in part by National Institutes of Health grant NS38988, the Batten’s Disease Support and Research Association, and the New York State Ofﬁce for Mental Retardation and Developmental Disabilities.

References Banerjee, P., Dasgupta, A., Siakotos, A. N., and Dawson, G. (1992). Evidence for lipase abnormality: High levels of free and triacylglycerol forms of unsaturated fatty acids in neuronal ceroidlipofuscinosis tissue. Am. J. Med. Genet. 42, 549–554. Beers, M. F. (1996). Inhibition of cellular processing of surfactant protein C by drugs affecting intracellular pH gradients. J. Biol. Chem. 71, 14361–14370. Berkovic, S. F., Carpenter, S., Andermann, F., Andermann, E., and Wolfe, L. S. (1988). Kufs’ disease: A critical reappraisal. Brain 111, 27–62. Bizzozero, O. A. (1997). The mechanism and functional roles of protein palmitoylation in the nervous system. Neuropediatrics 28, 23–26. Braak, H., and Goebel, H. H. (1979). Pigmentoarchitectonic pathology of the isocortex in juvenile neuronal ceroid lipofuscinosis: Axonal enlargement in layer IIIab and cell loss in layer V. Acta Neuropathol. (Berl.) 46, 79–83. Braulke, T., Geuze, H. J., Slot, J. W., Hasilik, A., and von Figura, K. (1987). On the effects of weak bases and monensin on sorting and processing of lysosomal enzymes in human cells. Eur. J. Cell. Biol. 43, 316–321.

60

E. Kida et al.

Broom, M. F., Zhou, C., Broom, J. E., Barwell, K. J., Jolly, R. D., and Hill, D. F. (1998). The locus for ovine ceroid lipofuscinosis is syntenic to the human Batten disease variant CLN6. J. Med. Genet. 35, 717–721. Br¨uck, W., and Goebel, H. H. (1998). Microglia activation in neuronal ceroid-lipofuscinosis. Clin. Neuropathol. 5, 276. Butor, C., Grifﬁths, G., Aronson, N. N., and Varki, A. (1995). Colocalization of hydrolytic enzymes with widely disparate pH optima: Implications for the regulation of lysosomal pH. J. Cell Sci. 108, 2213–2219. Buzy, A., Ryan, E. M., Jennings, K. R., Palmer, D. N., and Grifﬁths, D. E. (1996). Use of electrospray ionization mass spectrometry and tandem mass spectrometry to study binding of F0 inhibitors to ceroid lipofuscinosis protein, a model system for subunit c of mitochondrial ATP synthase. Rapid Commun. Mass Spectrom. 10, 790–796. Camp, L. A., and Hofmann, S. L. (1993). Puriﬁcation and properties of a palmitoyl-protein thioesterase that cleaves palmitate from H-ras. J. Biol. Chem. 268, 22566–22574. Camp, L. A., Verkruyse, L. A., Afendis, S. J., Slaughter, C. A., and Hofmann, S. L. (1994). Molecular cloning and expression of palmitoyl-protein thioesterase. J. Biol. Chem. 269, 23212–23219. Chang, M. H., Bindloss, C. A., Grabowski, G. A., Qi, X., Winchester, B., Hopwood, J. J., and Meikle, P. J. (2000). Saposins A, B, C, and D in plasma of patients with lysosomal storage disorders. Clin. Chem. 46, 167–174. Christomanou, H., Chabas, A., Pampols, T., and Guardiola, A. (1989). Activator protein deﬁcient Gaucher’s disease. Klin. Wochenschr. 67, 999–1003. Croopnick, J. B., Choi, H. C., and Muller, D. M. (1998). The subcellular location of the yeast Saccharomyces cerevisiae homologue of the protein defective in juvenile form of Batten disease. Biochem. Biophys. Res. Commun. 250, 335–341. Das, A. S., Becerra, C. H. R., Yi, W., Lu, J-Y., Siakotos, A. N., Wisniewski, K. E., and Hofman, S. L. (1998). Molecular genetics of palmitoyl-protein thioesterase deﬁciency in the U.S. J. Clin. Invest. 102, 361–370. Das, A. M., Jolly, R. D., and Kohlsch¨uter, A. (1999). Anomalies of mitochondrial ATP synthase regulation in four different types of neuronal ceroid lipofuscinosis. Mol. Genet. Metab. 66, 349– 355. Dawson, G., Cho, S., Siakotos, A. N., and Kilkus, J. (1997). Low molecular weight storage material in infantile ceroid lipofuscinosis (CLN1). Neuropediatrics 28, 31–32. Doebber, T. W., Divor, A. R., and Ellis, S. (1978). Identiﬁcation of a tripeptidyl aminopeptidase in the anterior pituitary gland: Effect on the chemical and biological properties of rat and bovine growth hormones. Endocrinology 103, 1794–1804. Dunphy, J. T., and Linder, M. E. (1998). Signalling functions of protein palmitoylation. Biochim. Biophys. Acta. 1436, 245–261. Dyer, M. R., and Walker, J. E. (1993). Sequences of members of the human gene family for the c subunit of mitochondrial ATP synthase. Biochem. J. 293, 51–64. Elleder, M., and Tyynel¨a, J. (1998). Incidence of neuronal perikaryal spheroids in neuronal ceroid lipofuscinoses (Batten disease). Clin. Neuropathol. 17, 184–189. Elleder, M., Drahota, Z., Lisa, V., Mares, V., Mandys, V., Muller, J., and Palmer, D. N. (1995). Tissue culture loading test with storage granules from animal models of neuronal ceroid-lipofuscinosis (Batten disease): Testing their lysosomal degradability by normal and Batten disease. Am. J. Med. Genet. 57, 213–221. Elleder, M., Sokolova, J., and Hrebicek, M. (1997). Follow-up study of subunit c of mitochondrial ATP synthase (SCMAS) in Batten disease and in unrelated lysosomal disorders. Acta Neuropathol. 93, 379–390. Ezaki, J., Wolfe, L. S., Higuti, T., Ishidoh, K., and Kominami, E. (1995). Speciﬁc delay of degradation of mitochondrial ATP synthase subunit c in late infantile neuronal ceroid lipofuscinosis (Batten disease). J. Neurochem. 64, 733–741.

2. Cellular Pathology and Pathogenic Aspects of NCLs

61

Ezaki, J., Wolfe, L. S., and Kominami, E. (1996). Speciﬁc delay in the degradation of mitochondrial ATP synthase subunit c in the late infantile neuronal ceroid lipofuscinosis is derived from cellular proteolysis dysfunction rather than structural alterations of subunit c. J. Neurochem. 67, 1677–1687. Ezaki, J., Wolfe, L. S., and Kominami, E. (1997). Decreased lysosomal subunit c-degrading activity in ﬁbroblasts from patients with late infantile neuronal ceroid lipofuscinosis. Neuropediatrics 28, 53–55. Ezaki, J., Tanida, I., Kanehagi, N., and Kominami, E. (1999). A lysosomal proteinase, the late infantile neuronal ceroid lipofuscinosis gene (CLN2) product, is essential for degradation of a hydrophobic protein, the subunit c of ATP synthase. J. Neurochem. 72, 2573–2582. Ezaki, J., Takeda-Ezaki, M., Oda, K., and Kominami, E. (2000). Characterization of endopeptidase activity of tripeptidyl peptidase-I/CLN2 protein which is deﬁcient in classical late infantile neuronal ceroid lipofuscinosis. Biochem. Biophys. Res. Commun. 268, 904–908. Faust, J., Rodman, J., Daniels, P., Dice, J., and Bronson, R. (1994). Two related proteolipids and dolichol-linked oligosaccharides accumulate in motor neuron degeneration mice (mnd/mnd), a model for neuronal ceroid-lipofuscinosis. J. Biol. Chem. 269, 10150–10155. Fearnley, I. M., Walker, J. E., Martinus, R. D., Jolly, R. D., Kirkland, K. B., Shaw, G. J., and Palmer, D. N. (1990). The sequence of the major protein stored in ovine ceroid lipofuscinosis is identical with that of the dicyclohexylcarbodiimide-reactive proteolipid of mitochondrial ATP synthase. Biochem. J. 268, 751–758. Fillingame, R. H. (1997). Coupling H+ transport and ATP synthesis in F1F0-ATP synthases: Glimpses of interacting parts in a dynamic molecular machine. J. Exp. Biol. 200, 217–224. Forgac, M. (1998). Structure, function and regulation of the vacuolar (H+)-ATPases. FEBS Lett. 440, 258–263. Fukuda, M. (1994). Biogenesis of the lysosomal membrane. Subcell. Biochem. 22, 199–230. Goebel, H. H., and Braak, H. (1989). Adult neuronal ceroid-lipofuscinosis. Clinical Neuropathol. 8, 109–119. Goebel, H. H., Zeman, W., Patel, V. K., Pullarkat, R. K., and Lenard, H. (1979). On the ultrastructural diversity and essence of residual bodies in neuronal ceroid-lipofuscinosis. Mech. Ageing Dev. 10, 73–70. Golabek, A. A., Kaczmarski, W., Kida, E., Kaczmarski, A., Michalewski, M., and Wisniewski, K. E. (1999). Expression studies of CLN3 protein associated with a juvenile form of neuronal ceroid lipofuscinosis in mammalian cells. Mol. Genet. Metab. 66, 277–282. Golabek, A. A., Kida, E., Walus, M., Kaczmarski, W., Michalewski, M., and Wisniewski, K. E. (2000). CLN3 protein regulates lysosomal pH and alters intracellular processing of Alzheimer’s amyloid-␤ protein precursor and cathepsin D in human cells. Mol. Genet. Metab. 70, 203–213. Haltia, M. J., Rapola, P., and Santavuori, P. J. (1973). Infantile type of so-called neuronal ceroidlipofuscinosis. Histological and electron microscopic studies. Acta Neuropathol. (Berl.) 26, 157– 170. Haltia, M., Tyynel¨a, J., Hirvasniemi, A., Herva, R., Ranta, U. S., and Lehesjoki, A.-E. (1999). CLN8. Northern epilepsy. In “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 117–124. IOS Press, Amsterdam, The Netherlands. Hall, N. A., Lake, B. D., Dewji, N. N., and Patrick, A. D. (1991a). Lysosomal storage of subunit c of mitochondrial ATP synthase in Batten’s disease (ceroid-lipofuscinosis). Biochem. J. 275, 269–272. Hall, N. A., Lake, B. D., and Patrick, A. D. (1991b). Recent biochemical and genetic advances in our understanding of Batten’s disease (ceroid-lipofuscinosis). Dev. Neurosci. 13, 339–344. Hellsten, E., Vesa, J., Olkkonen, V. W., Jalanko, A., and Peltonen, L. (1996). Human palmitoyl protein thioesterase: Evidence for lysosomal targeting of the enzyme and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. EMBO J. 15, 5240–5245. Hiesberger, T., Huttler, S., Rohlmann, A., Schneider, W., Sandhoff, K., and Herz, J. (1998). Cellular uptake of saposin (SAP) precursor and lysosomal delivery by the low density lipoprotein receptorrelated protein (LRP). EMBO J. 17, 4617–4625.

62

E. Kida et al.

Hiraiwa, M., Martin, B. M., Kishimoto, Y., Conner, G., Tsuji, S., and O’Brien, J. S. (1997). Lysosomal proteolysis of prosaposin, the precursor of saposins (sphingolipid activator proteins): Its mechanism and inhibition by ganglioside. Arch. Biochem. Biophys. 341, 17–24. Hofmann, S. L., Lee, L. A., Lu, J-Y., and Verkruyse, L. A. (1997). Palmitoyl-protein thioesterase and the molecular pathogenesis of the infantile neuronal ceroid lipofuscinosis. Neuropediatrics 28, 27–30. Holtschmidt, H., Sandhoff, K., Kwon, H. Y., Harzer, K., Nakano, T., and Suzuki, K. (1991). Sulfatide activator protein: Alternative splicing generates three messages RNAs and a newly found mutation responsible for a clinical disease. J. Biol. Chem. 266, 7556–7560. Hughes, S. M., Kay, G. W., Jordan, T. W., Rickards, G. K., and Palmer, D. N. (1999). Disease-speciﬁc pathology in neurons cultured from sheep affected with ceroid lipofuscinosis. Mol. Genet. Metab. 66, 381–386. Hunziker, W., and Geuze, H. J. (1996). Intracellular trafﬁcking of lysosomal membrane protein. BioEssays 18, 379–389. Inui, K., and Wenger, D. A. (1983). Concentration of activator protein for sphingolipid hydrolysis in liver and brain samples from patients with lysosomal storage disorders. J. Clin. Invest. 72, 1622– 1628. Inui, K., Kao, F. T., Fujibayashi, S., Jones, C., Morse, H. G., Law, M. L., and Wenger, D. A. (1985). The gene coding for sphingolipid activator protein, SAP-1, is on human chromosome 10. Hum. Genet. 69, 197–200. The International Batten Disease Consortium. (1995) Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949–957. Isosomppi, J., Heinonen, O., Hiltunene, J. O., Greene, N. D. E., Vesa, J., Uusitalo, A., Mitchison, H. M., Saarma, M., Jalanko, A., and Peltonen, L. (1999). Developmental expression of palmitoyl protein thioesterase in normal mice. Dev. Brain Res. 118, 1–11. Janes, R. W., Munroe, P. B., Mitchison, H. M., Gardiner, R. M., Mole, S. E., and Wallace, B. A. (1996). A model for Batten disease protein CLN3: Functional implications from homology and mutations. FEBS Lett. 399, 75–77. J¨arvel¨a, I., Sainio, M., Rantamaki, T., Olkkonen, V. M., Carpen, O., Peltonen, L., and Jalanko, A. (1998). Biosynthesis and intracellular targeting of the CLN3 protein defective in Batten disease. Hum. Mol. Genet. 7, 85–90. J¨arvel¨a, I., Lehtovirta, M., Tikkanen, R., Kytt¨al¨a, A., and Jalanko, A. (1999). Defective intracellular transport of CLN3 is the molecular basis of Batten disease (JNCL). Hum. Mol. Genet. 8, 1091– 1098. Junaid, M. A., Sklower Brooks, S., Wisniewski, K. E., and Pullarkat, R. K. (1999). A novel assay for lysosomal pepstatin-insensitive proteinase and its application for the diagnosis of late-infantile neuronal ceroid lipofuscinosis. Clin. Chim. Acta 281, 169–176. Junaid, M. A., Wu, G., and Pullarkat, R. K. (2000). Puriﬁcation and characterization of bovine brain lysosomal pepstatin-insensitive proteinase, the gene product deﬁcient in the human late-infantile neuronal ceroid lipofuscinosis. J. Neurochem. 74, 287–294. Kaczmarski, W., Wisniewski, K. E., Golabek, A. A., Kaczmarski, A., Kida, E., and Michalewski, M. (1999). Studies of membrane association of CLN3 protein. Mol. Genet. Metab. 66, 261–264. Katz, M. L., Gao, C-L., Prabhakaram, M., Shibuya, H., Liu, P-C., and Johnson, G. S. (1997). Immunochemical localization of the Batten disease (CLN3) protein in retina. Invest. Ophthalmol. Vis. Sci. 38, 2375–2386. Katz, M. L., Shibuya, H., Liu, P. C., Kaur, S., Gao, C. L., and Johnson, G. S. (1999). A mouse gene knockout model for juvenile ceroid-lipofuscinosis (Batten disease). J. Neurosci. Res. 57, 551– 556. Kay, G. W., Hughes, S. M., and Palmer, D. N. (1999). In vitro culture of neurons from sheep with Batten disease. Mol. Genet. Metab. 67, 83–88.

2. Cellular Pathology and Pathogenic Aspects of NCLs

63

Kida, E., Wisniewski, K. E., and Golabek, A. A. (1993). Increased expression of subunit c of mitochondrial ATP synthase in brain tissue from neuronal ceroid lipofuscinoses and mucopolysaccharidosis cases but not in long-term ﬁbroblast culture. Neurosci. Lett. 164, 121–124. Kida, E., Wisniewski, K. E., and Connell, F. (1995). Topographic variabilities of immunoreactivity to subunit c of mitochondrial ATP synthase and lectin binding in late infantile neuronal ceroid lipofuscinosis. Am. J. Med. Genet. 57, 182–186. Kida, E., Kaczmarski, W., Golabek, A. A., Kaczmarski, A., Michalewski, M., and Wisniewski, K. E. (1999). Analysis of intracellular distribution and trafﬁcking of the CLN3 protein in fusion with the green ﬂuorescent protein. in vitro Mol. Genet. Metab. 66, 265–271. Kieseier, B. C., Wisniewski, K. E., Park, E., Schuller-Levis, G., Mehta, P. D., and Goebel, H. H. (1997). Leukocytes in neuronal ceroid-lipofuscinosis: Function and apoptosis. Brain & Develop. 19, 317–322. Kitaguchi, T., Wisniewski, K. E., Maslinski, S., Maslinska, D., Wisniewski, T. M., and Kim, K. S. (1990). ␤-Protein immunoreactivity in brains of patients with neuronal ceroid lipofuscinosis: Ultrastructural and biochemical demonstration. Neurosci Lett. 112, 155–160. Klausner, R. D., and Sitia, R. (1990). Protein degradation in the endoplasmic reticulum. Cell 62, 611–614. Kominami, E., Ezaki, J., Muno, D., Ishido, K., Ueno, T., and Wolfe, L. S. (1992). Speciﬁc storage of subunit c of mitochondrial ATP synthase in lysosomes of neuronal ceroid lipofuscinosis (Batten’s disease). Biochem. J. 111, 278–282. Kremmidiotis, G., Lensink, I. L., Bilton, R. L., Woollatt, E., Chataway, T. K., Sutherland, G. R., and Callen, D. F. (1999). The Batten disease gene product (CLN3p) is a Golgi integral membrane protein. Hum. Mol. Genet. 8, 523–531. Lake, B. D., and Rowan, S. A. (1997). Light and electron microscopic studies on subunit c in cultured ﬁbroblasts in late infantile and juvenile Batten disease. Neuropediatrics 28, 56–59. Lane, S. C., Jolly, R. D., Schmechel, D. E., Alroy, J., and Boustany, R. M. (1996). Apoptosis as the mechanism of neurodegeneration in Batten’s disease. J. Neurochem. 67, 677–683. Lauronen, L., Munroe, P. B., J¨arvel¨a, I., Autti, T., Mitchison, H. M., O’Rawe, A. M., Gardiner, R. M., Mole, S. E., Puranen, J., Hakkinen, A. M., and Santavuori, P. (1999). Delayed classic and protracted phenotypes of compound heterozygous juvenile neuronal ceroid lipofuscinosis. Neurology 52, 360– 365. Leonova, T., Qi, X., Bencosme, A., Ponce, E., Sun, Y., and Grabowski, G. A. (1996). Proteolytic processing of prosaposin in insect and mammalian cells. J. Biol. Chem. 271, 17312–17320. Lu, J-Y., Verkruyse, L. A., and Hofmann, S. L. (1996). Lipid thioesters derived from acylated proteins accumulate in infantile neuronal ceroid lipofuscinosis: Correction of the defect in lymphoblasts by recombinant palmitoyl-protein thioesterase. Proc. Natl. Acad. Sci. (USA) 93, 10046–10050. Marks, M. S., Woodruff, L., Ohno, H., and Bonifacino, J. S. (1996). Protein targeting by tyrosine- and di-leucine-based signals: Evidence for distinct saturable components. J. Cell Biol. 135, 341–354. Martin, J.-J., Libert, J., and Ceuterick, C. (1987). Ultrastructure of brain and retina in Kufs’ disease (Adult type of ceroid-lipofuscinosis). Clin. Neuropathol. 6, 381–394. Martin, J.-J., Gottlob, I., Goebel, H. H., and Mole, S. E. (1999). CLN4. Adult NCL. In “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 77–90. IOS Press, Amsterdam, The Netherlands. Mason, R. W. (1996). In “Subcellular Biochemistry” (Biology of the Liposome) (Lloyd and Mason, eds.), vol. 27, pp. 159–190. Plenum Press, New York. McGeoch, J. E., and Guidotti, G. (1997). A 0. 7-700 Hz current through a voltage-clamped pore: Candidate protein for initiator of neural oscillations. Brain Res. 766, 188–194. McGeoch, J. E. M., and Palmer, D. N. (1999). Ion pores made of mitochondrial ATP synthase subunit c in the neuronal plasma membrane and Batten disease. Mol. Genet. Metab. 66, 387–392. Michalewski, M., Kaczmarski, W., Golabek, A. A., Kida, E., Kaczmarski, A., and Wisniewski, K. E.

64

E. Kida et al.

(1998). Evidence for phosphorylation of CLN3 protein associated with Batten disease. Biochem. Biophys. Res. Commun. 253, 458–462. Mitchison, H. M., Hofmann, S. L., Becerra, C. H. R., Munroe, P. B., Lake, B. D., Crow, Y. J., Stephenson, J. B., Williams, R. E., Hofman, I. L., Taschner, P. E. M., Martin, J. J., Philippart, M., Andermann, E., Andermann, F., Mole, S., Gardiner, R. M., and O’Rawe, A. M. (1998). Mutations in palmitoyl-protein thioesterase gene (PPT1; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits. Hum. Mol. Genet. 7, 291–297. Mitchison, H. M., Bernard, D. J., Greene, N. D., Cooper, J. D., Junaid, M. A., Pullarkat, R. K., de Vos, N., Breuning, M. H., Owens, J. EW., Mobley, W. C., Gardiner, R. M., Lake, B. D., Taschner, P. E., and Nussbaum, R. L. (1999). Targeted disruption of the CLN3 gene provides a mouse model for Batten disease. Neurobiol. Dis. 6, 321–334. Medd, S. M., Walker, J. E., and Jolly, R. D. (1993). Characterization of the expressed genes for subunit c of mitochondrial ATP synthase in sheep with ceroid lipofuscinosis. Biochem. J. 293, 65–73. Mole, S. E., Mitchison, H. M., and Munroe, P. B. (1999). Molecular basis of the neuronal ceroid lipofuscinoses: Mutations in CLN1, CLN2, CLN3, and CLN5. Hum. Mutat. 14, 199–215. Munroe, P. B., Mitchison, H. M., O’Rawe, A. M., Anderson, J. W., Boustany, R-M., Lerner, T. J., Taschner, P. E. M., de Vos, N., Breuning, M. H., Gardiner, R. M., and Mole, S. E. (1997). Spectrum of mutations in the Batten disease gene, CLN3. Am. J. Hum. Genet. 6, 1310–316. Ng Ying Kin, N. M. K., Palo, J., Haltia, M., and Wolfe, L. S. (1983). High levels of brain dolichols in neuronal ceroid-lipofuscinosis and senescence. J. Neurochem. 40, 1465–1473. O’Brien, J. S., and Kishimoto, Y. (1991). Saposin proteins: Structure, function, and role in human lysosomal storage disorders. FASEB J. 5, 301–308. O’Brien, J. S., Carson, G. S., Seo, H. C., Hiraiwa, M., and Kishimoto, Y. (1994). Identiﬁcation of prosaposin as a neurotrophic factor. Proc. Natl. Acad. Sci. (USA) 91, 9593–9596. Oka, A., Kurachi, Y., Mizuguchi, M., Hayashi, M., and Takashima, S. (1998). The expression of late infantile neuronal ceroid lipofuscinosis (CLN2) gene product in human brain. Neurosci. Lett. 257, 113–115. Page, A. E., Fuller, K., Chambers, T. J., and Warburton, M. J. (1993). Puriﬁcation and characterization of a tripeptidyl peptidase from human osteoclastomas: evidence for its role in bone resorption. Arch. Biochem. Biophys. 306, 354–359. Palmer, D. N., Martinus, R. D., Cooper, S. M., Midwinter, G. G., Reid, J. C., and Jolly, R. D. (1989). Ovine ceroid lipofuscinosis. The major lipopigment protein and the lipid-binding subunit of mitochondrial ATP synthase have the same NH2-terminal sequence. J. Biol. Chem. 264, 5736– 5740. Palmer, D. N., Fearnley, I. M., Walker, J. E., Hall, N. A., Lake, B. D., Wolfe, L. S., Haltia, M., Martinus, R. D., and Jolly, R. D. (1992). Mitochondrial ATP synthase subunit c storage in the ceroid-lipofuscinoses (Batten’s disease). Am. J. Med. Genet. 42, 561–567. Palmer, D. N., Bayliss, S. L., Clifton, P. A., and Grant, V. J. (1993). Storage bodies in the ceroidlipofuscinoses (Batten disease): Low-molecular-weight components, unusual amino acids and reconstitution of ﬂuorescent bodies from non-ﬂuorescent components. J. Inherit. Metab. Dis. 16, 292–295. Palmer, D. N., Jolly, R. D., van Mil, H. C., Tyynel¨a, J., and Westlake, V. J. (1997a). Different pattern of hydrophobic protein storage in different forms of neuronal ceroid lipofuscinosis (NCL, Batten disease). Neuropediatrics 28, 45–48. Palmer, D. N., Tyynel¨a, J., van Mil, H. C., Westlake, V. J., and Jolly, R. D. (1997b). Accumulation of sphingolipid activator proteins (SAPs) A and D in granular osmiophilic deposits in miniature Schnauzer dogs with ceroid-lipofuscinosis. J. Inher. Metab. Dis. 20, 74–84. Pardo, C. A., Rabin, B. A., Palmer, D. N., and Price, D. L. (1994). Accumulation of the adenosine triphosphate synthase subunit c in the mnd mutant mouse: A model for neuronal ceroid lipofuscinosis. Am. J. Pathol. 144, 829–835.

2. Cellular Pathology and Pathogenic Aspects of NCLs

65

Pearce, D. A., and Sherman, F. (1998). A yeast model for the study of Batten disease. Proc. Natl Acad. Sci. (USA) 95, 6915–6918. Pearce, D. A., Ferea, T., Nosel, S. A., Das, B., and Sherman, F. (1999a). Action of BTN1, the yeast orthologue of the gene mutated in Batten disease. Nat. Gen. 22, 55–58. Pearce, D. A., Carr, CJ, Das, B., and Sherman, F. (1999b). Phenotypic reversal of the btn1 defects in yeast by chloroquine: A yeast model for Batten disease. Proc. Natl. Acad. Sci. (USA) 96, 11341– 11345. Poorthuis, B. J. H. M., Wevers, R. A., Kleijer, W. J., Groener, J. E. M., de Jong, J. G. N., van Weely, S., Niezen-Koning, K. E., and van Diggelen, O. P. (1999). The frequency of lysosomal storage diseases in The Netherlands. Hum. Genet. 105, 151–156. Puranam, K. L., Guo, W-X., Qian, W-H., Nikbakht, K., and Boustany, R. M. (1999). CLN3 deﬁnes a novel antiapoptotic pathway operative in neurodegeneration and mediated by ceramide. Mol. Genet. Metab. 66, 294–308. Qi, X., Kondoh, K., Krusling, D., Kelso, G. J., Leonova, T., and Grabowski, G. A. (1999). Conformational and amino acid residue requirements for the saposin C neuritogenic effect. Biochemistry 38, 6284–6291. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M. F., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A. E. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nature 23, 233– 236. Rawlings, N. D., and Barrett, A. J. (1999). Tripeptidyl-peptidase I is apparently the CLN2 protein absent in classical late-infantile neuronal ceroid lipofuscinosis. Biochim. Biophys. Acta 1429, 496– 500. Reitman, M. L., and Kornfeld, S. (1981). UDP-N-acetylglucosamine:glycoprotein N-acetylglucosamine-1-phosphotransferase. Proposed enzyme for the phosphorylation of the high mannose oligosaccharide units of lysosomal enzymes. J. Biol. Chem. 256, 4275–4281. Rohrer, J., Schweizer, A., Russell, D., and Kornfeld, S. (1996). The targeting of lamp1 to lysosomes is dependent on the spacing of its cytoplasmic tail tyrosine sorting motif relative to the membrane. J. Cell. Biol. 132, 565–576. Sandhoff, K., Kolter, T., and van Echten-Deckert, G. (1995). Sphingolipid metabolism. Sphingolipid analogs, sphingolipid activator proteins, and the pathology of the cell. Ann. N.Y. Acad. Sci. 845, 139–151. Sandoval, I. V., Arredondo, J. J., Alcalde, J., Noriega, A. G., Vandekerckove, J., Jimenez, M. A., and Rico, M. (1994). The residues Leu(Ile)475-Ile(Leu,Val,Ala)476, contained in the extended carboxyl cytoplasmic tail, are critical for targeting of the resident lysosomal membrane protein LIMP II to lysosomes. J. Biol. Chem. 269, 6622–6631. Santavuori, P., Rapola, J., Haltia, M., Tyynel¨a, J., Peltonen, L., and Mole, S. E. (1999). CLN5. Finnish variant late infantile NCL. In “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 91–101. IOS Press, Amsterdam, The Netherlands. Savukoski, M., Kestil¨a, M., Williams, R., J¨arvel¨a, I., Sharp, J., Harris, J., Santavuori, P., Gardiner, M., and Peltonen, L. (1994). Deﬁned chromosomal assignment of CLN5 demonstrates that at least four genetic loci are involved in the pathogenesis of human ceroid lipofuscinosis. Am. J. Hum. Genet. 55, 695–701. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finish variant late infantile neuronal ceroid lipofuscinosis. Nat. Gen. 19, 286–288. Sharp, J., Wheeler, R. B., Lake, B. D., Fox, M., Gardiner, R. M., and Williams, R. E. (1999). Genetic and physical mapping of the CLN6 gene on chromosome 15q21-23. Mol. Genet. Metab. 66, 329– 331. Seitelberger, F., Jacob, H., and Schnabel, R. (1967). The myoclonic variant of cerebral lipidosis. In

66

E. Kida et al.

“Inborn Disorders of Sphingolipid Metabolism” (S. M. Aronson and B. W. Volk, eds.), pp 43–74. Oxford, Pergamon Press. Sleat, D. E., Sohar, I., Lackland, H., Majercak, J., and Lobel, P. (1996). Rat brain contains high levels of mannose-6-phosphorylated glycoproteins including lysosomal enzymes and palmitoyl-protein thioesterase, an enzyme implicated in infantile neuronal lipofuscinosis. J. Biol. Chem. 271, 19191– 19198. Sleat, D. E., Donnelly, R. J., Lackland, H., Liu, C-G., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Sleat, D. E., Sohar, I., Pullarkat, P. S., Lobel, P., and Pullarkat, R. K. (1998). Speciﬁc alteration in levels of mannose 6-phosphorylated glycoproteins in different neuronal ceroid lipofuscinoses. Biochem. J. 334, 547–551. Sleat, D. E., Gin, R. M., Sohar, I., Wisniewski, K. E., Sklower Brooks, S., Pullarkat, R. K., Palmer, D. N., Lerner, T. J., Boustany, R. M., Uldall, P., Siakotos, A. N., Donnelly, R. J., and Lobel, P. (1999). Mutational analysis of the defective protease in classic late-infantile neuronal ceroid lipofuscinosis, a neurodegenerative lysosomal storage disorder. Am. J. Hum. Genet. 64, 1511–1523. Sohar, I., Sleat, D. E., Jadot, M., and Lobel, P. (1999). Biochemical characterization of a lysosomal protease deﬁcient in classical late infantile neuronal ceroid lipofuscinosis (LINCL) and development of an enzyme-based assay for diagnosis and exclusion of LINCL in human specimens and animal models. J. Neurochem. 73, 700–711. Suopanki, J., Tyynel¨a, J., Baumann, M., and Haltia, M. (1999). Palmitoyl-protein thioesterase, an enzyme implicated in neurodegeneration, is localized in neurons and is developmentally regulated in rat brain. Neurosci. Lett. 265, 53–56. Tahvanainen, E., Ranta, S., Hirvasniemi, A, Karila, E., Leisti, J., Sistonen, P., Weissenbach, J., Lehesjoki, A. E., and de la Chapelle, A. (1994). The gene for a recessively inherited human childhood progressive epilepsy with mental retardation maps to the distal short arm of chromosome 8. Proc. Natl. Acad. Sci. (USA) 91, 7267–7270. Tanner, A., and Dice, J. F. (1995). Batten disease ﬁbroblasts in culture accumulate mitochondrial ATP synthase subunit 9. Cell Biol. Int. 19, 71–75. Tanner, A., Shen, B. H., and Dice, J. F. (1997). Turnover of F1F0-ATP synthase subunit 9 and other proteolipids in normal and Batten disease ﬁbroblasts. Biochim. Biophys. Acta 1361, 251–262. Town, M., Jean, G., Cherqui, S., Attard, M., Forestier, L., Whitmore, S. A., Callen, D. F., Gribouval, O., Broyer, M., Bates, G. P., vant Hoff, W., and Antignac, C. (1998). A novel gene encoding an integral membrane protein is mutated in nephropathic cystinosis. Nat. Genet. 18, 319– 324. Tsuboi, K., Hiraiwa, M., and O’Brien, J. S. (1998). Prosaposin prevents programmed cell death of rat cerebellar granule neurons in culture. Brain Res. Dev. Brain Res. 110, 249–255. Tyynel¨a, J., Palmer, D. N., Baumann, M., and Haltia, M. (1993). Storage of saposins A and D in infantile neuronal ceroid lipofuscinosis. FEBS Lett. 330, 8–12. Tyynel¨a, J., Baumann, M., Henseler, M., Sandhoff, K., and Haltia, M. (1995). Sphingolipid activator proteins in the neuronal ceroid-lipofuscinoses: An immunological study. Acta Neuropathol. (Berl.) 89, 391–398. Tyynel¨a, J., Suopanki, J., Baumann, M., and Haltia, M. (1997a). Sphingolipid activator proteins (SAPs) in neuronal ceroid lipofuscinoses (NCL). Neuropediatrics 28, 49–52. Tyynel¨a, J., Suopanki, J., Santavuori, P., Baumann, M., and Haltia, M. (1997b). Variant late infantile neuronal ceroid-lipofuscinosis: pathology and biochemistry. J. Neuropathol. Exp. Neurol. 56, 369– 375. Vaccaro, A. M., Salvioli, R., Barca, A., Tatti, M., Ciaffoni, F., Maras, B., Siciliano, R., Zappacosta, F., Amoresano, A., and Pucci, P. (1995). Structural analysis of saposin C and B: Complete localization of disulﬁde bridges. J. Biol. Chem. 270, 9953–9960.

2. Cellular Pathology and Pathogenic Aspects of NCLs

67

Vaccaro, A. M., Salvioli, R., Tatti, M., and Ciaffoni, F. (1999). Saposins and their interaction with lipids. Neurochem. Res. 24, 307–314. Verheijen, F. W., Verbeek, E., Aula, N., Beerens, C. E. M. T., Havelaar, A. C., Joosse, M., Peltonen, L., Aula, P., Galjaard, H., van der Spek, P. J., and Mancini, G. M. S. (2000). A new gene, encoding an anion transporter, is mutated in sialic acid storage diseases. Nat. Genet. 23, 462–465. Verkruyse, L. A., and Hofmann, S. L. (1996). Lysosomal targeting of palmitoyl-protein thioesterase. J. Biol. Chem. 26, 15831–15836. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Vines, D., and Warburton, N. J. (1998). Puriﬁcation and characterization of a tripeptidyl aminopeptidase I from rat spleen. Biochim. Biophys. Acta 1384, 233–242. Vines, D., and Warburton, N. J. (1999). Classical late infantile neuronal ceroid lipofuscinosis ﬁbroblasts are deﬁcient in lysosomal tripeptidyl peptidase I. FEBS Lett. 443, 131–135. von Heijne, G., and Gavel, Y. (1988). Topogenic signals in integral membrane proteins. Eur. J. Biochem. 174, 671–678. Waliany, S., Das, A. K., Gaben, A., Wisniewski, K. E., and Hofmann, S. L. (2000). Identiﬁcation of three novel mutations of the palmitoyl-protein thioesterase (PPT) gene in children with neuronal ceroid-lipofuscinosis. Hum. Mutat. 2, 206–207. Williams, R. E., Lake, B. D., Elleder, M., and Sharp, J. D. (1999a). CLN6. Variant late infantile/early juvenile NCL. In “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 102–114. IOS Press, Amsterdam, The Netherlands. Williams, R. E., TopHu, M., Lake, B. D., Mitchell, W., and Mole, S. E. (1999b). CLN7. Turkish variant late infantile NCL. In “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel et al., eds.), pp. 114–115. IOS Press, Amsterdam, The Netherlands. Wimer Mackin, S., and Granger, B. L. (1996). Transmembrane domain mutations inﬂuence the cellular distribution of lysosomal membrane glycoprotein A. Biochem. Biophys. Res. Commun. 229, 472–478. Wisniewski, K. E., Maslinska, D., Kitaguchi, T., Kim, K. S., Goebel, H. H., and Haltia, M. (1990a). Topographic heterogeneity of amyloid ␤-protein precursor epitopes in brains with various forms of neuronal ceroid lipofuscinoses suggesting defective processing of amyloid precursor protein. Acta Neuropathol. 80, 26–30. Wisniewski, K. E., Kida, E., Gordon Majszak, W., and Saitoh, T. (1990b). Altered amyloid ␤-protein precursor processing in brains of patients with neuronal ceroid lipofuscinosis. Neurosci Lett. 120, 94–96. Wisniewski, K. E., Kida, E., Patxot, O. F., and Connell, F. (1992). Variability in the clinical and pathological ﬁndings in the neuronal ceroid lipofuscinosis: Review of data and observations. Am. J. Med. Genet. 42, 525–532. Wisniewski, K. E., Kida, E., Connell, F., Elleder, M., Eviatar, L., and Konkol, R. J. (1993). New subform of the late infantile form of neuronal ceroid lipofuscinosis. Neuropediatrics 24, 155–163. Wisniewski, K. E., Golabek, A. A., and Kida, E. (1994). Increased urine concentration of subunit c of mitochondrial ATP synthase in neuronal ceroid lipofuscinoses patients. J. Inherit. Metab. Dis. 17, 205–210. Wisniewski, K. E., Kaczmarski, W., Golabek, A. A., and Kida, E. (1995). Rapid detection of subunit c of mitochondrial ATP synthase in urine as a diagnostic screening test for neuronal ceroidlipofuscinosis. Am. J. Med. Genet. 57, 246–249. Wisniewski, K. E., Zhong, N., Kaczmarski, W., Kaczmarski, A., Sklower-Brooks, S., and Brown, W. T. (1998a). Studies of atypical JNCL suggest overlapping with other NCL forms. Pediatr. Neurol. 18, 36–40. Wisniewski, K. E., Zhong, N., Kaczmarski, W., Kaczmarski, A., Kida, E., Schwarz, K. O., Lazzarini,

68

E. Kida et al.

A. M., Rubin, A. J., Stenroos, E. S., Johnson, W. G., and Wisniewski, T. M. (1998b). Compound heterozygous genotype is associated with protracted juvenile neuronal ceroid lipofuscinosis. Ann. Neurol. 42, 106–110. Wolfe, L. S., Kin, N. M., Baker, R. R., Carpenter, S., and Andermann, F. (1977). Identiﬁcation of retinoyl complexes as the autoﬂuorescent component of the neuronal storage material in Batten disease. Science 195, 1360–1362. Yan, W. L., Lerner, T. J., Haines, J. L., and Gusella, J. F. (1994). Sequence analysis and mapping of a novel human mitochondrial ATP synthase subunit 9 cDNA (ATP5G3). Genomics 24, 375–377. Zeman, W., and Dyken, P. (1969). Neuronal-ceroid lipofuscinosis (Batten’s disesae): Relationship to amaurotic. idiocy? Pediatrics 44, 570–583. Zhong, N., Wisniewski, K. E., Kaczmarski, A., Ju, W., Xu, W., McLendon, L., Liu, B., Kaczmarski, W., Sklower Brooks, S., and Brown, W. T. (1998). Molecular screening of Batten disease: Identiﬁcation of a missense mutation (E295K) in the CLN3 gene. Hum. Genet. 102, 57–62.

3

Positional Candidate Gene Cloning of CLN1 Sandra L. Hofmann,∗ Amit K. Das, Jui-Yun Lu, and Abigail A. Soyombo Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research University of Texas Southwestern Medical Center Dallas, Texas 75390

I. Introduction II. Linkage Disequilibrium Mapping of the CLN1 Locus in the Finnish Population III. Palmitoyl-Protein Thioesterase Deﬁnes a New Pathway in Lysosomal Catabolism IV. Enzymology of PPT V. Posttranslational Processing and Lysosomal Targeting of PPT VI. The Physiological Role of PPT VII. Palmitoyl-Protein Thioesterase-2 (PPT2) VIII. The PPT cDNA and Gene IX. The Molecular Genetics of CLN1/PPT Deﬁciency A. PPT Deﬁciency as a Simple Recessive Genetic Trait B. Speciﬁc Mutations in PPT: Some Examples X. Laboratory Diagnosis of PPT Deﬁciency XI. Prospects for Cause-Speciﬁc Treatment of PPT Deﬁciency References

* Address for correspondence: E-mail: [email protected] Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

69

70

S. L. Hofmann et al.

ABSTRACT Mutations in the CLN1 gene encoding palmitoyl-protein thioesterase (PPT) underlie the recessive neurodegenerative disorder, infantile Batten disease, or infantile neuronal ceroid lipofuscinosis (INCL). The CLN1 gene was mapped to chromosome 1p32 in the vicinity of a microsatellite marker HY-TM1 in a cohort of Finnish INCL families, and mapping of the PPT gene to the CLN1 critical region (and the discovery of mutations in PPT in several unrelated families) led to conclusive identiﬁcation of PPT as the disease gene. PPT is a lysosomal thioesterase that removes fatty acids from fatty-acylated cysteine residues in proteins. The accumulation of fatty acyl cysteine thioesters can be reversed in INCL cells by the exogenous administration of recombinant PPT, which enters the cells through the mannose 6-phosphate receptor pathway. Over two dozen PPT mutations have been found in PPT-deﬁcient patients worldwide. In the United States, all PPTdeﬁcient patients show “GROD” histology but the age of onset of symptoms is later in some children due to the presence of missense mutations that result in enzymes with residual PPT activity. Now that INCL is known to be caused by a defect in a soluble lysosomal enzyme, appropriate therapies may be forthcoming. Prospects for therapy include enzyme replacement, stem cell transplantation, gene therapy, and metabolic therapy aimed at depleting the abnormal substrate accumulation in the disease.

I. INTRODUCTION Infantile Batten disease, or infantile neuronal ceroid lipofuscinosis (INCL) is caused by autosomal recessive mutations in a single gene, designated CLN1. The CLN1 gene encodes a soluble lysosomal enzyme, palmitoyl-protein thioesterase (PPT), which hydrolyzes fatty acids from lipid-modiﬁed proteins. Prior to the mid1990s, INCL was considered quite rare outside of Finland, where the disorder was ﬁrst described, and physicians in the United States were reluctant to make the diagnosis unless the patient reported Finnish ancestry. Following the discovery of the CLN1 gene in 1995, it is now apparent that mutations in CLN1 account for between 20% and 25% of all cases of neuronal ceroid lipofuscinosis in the United States. Of U.S. patients with defects in CLN1, about half closely resemble the classical “Finnish” patients and, unfortunately, show the same fulminant course, with absence of higher cortical function by age 3. Somewhat surprisingly, the remaining half of U.S. patients with defects in CLN1 follow a clinical course virtually indistinguishable from late-infantile or juvenile Batten patients. However, all CLN1 patients, regardless of age of onset and pace of progression, display a common characteristic ultrastructural pathology, termed granular osmiophilic deposits, or GROD.

3. CLN1/Palmitoyl-Protein Thioesterase

71

The neurodegenerative disorder caused by PPT deﬁciency is unique among many other lysosomal storage diseases in that neuronal loss, rather than neuronal storage, dominates the clinical picture. The major ﬁndings at autopsy are limited to the central nervous system, and in the ﬁnal stages of the disease the brain is very small and atrophic, often weighing less than 500 g, a ﬁnding distinctly different from other lysosomal storage diseases that affect the brain. The cause of the severe neuronal loss, which is most prominent in neocortical areas, is one of the central mysteries surrounding INCL. The discovery of the basic defect in INCL is a classic success story of the melding of the new “reverse” genetics (or positional cloning) with classical biochemistry to gain very rapid insight into a previously enigmatic biological process.

II. LINKAGE DISEQUILIBRIUM MAPPING OF THE CLN1 LOCUS IN THE FINNISH POPULATION The search for the CLN1 gene began in 1989, with the collection of blood samples from members of 15 Finnish INCL families. A random scan of markers located at intervals across the human genome showed that CLN1 was linked to two markers, D1S57 and D1S7, on chromosome 1p32 (Jarvela et al., 1991). The CLN1 region was further reﬁned by linkage analysis of an additional 35 INCL families, placing the gene within a 25-cM chromosomal region in the vicinity of the L-myc oncogene (Jarvela, 1991). A genetic technique well suited to the study of homogenous populations, termed linkage disequilibrium mapping, was applied to Finnish samples, and assigned the CLN1 locus to a 300-kb region centromeric to L-myc (Hellsten et al., 1995). A physical map consisting of genomic DNA clones was constructed over this region and a number of novel transcripts in the CLN1 region were identiﬁed. While the work to identify the CLN1 gene was proceeding, the gene encoding a new hydrolytic enzyme (PPT) was mapped to chromosome region 1p32 by ﬂuorescence in situ hybridization (FISH) to metaphase chromosomes (Schriner et al., 1996). This general chromosomal region agreed well with the previously reported location of CLN1 and was therefore considered as a possible candidate for CLN1. Fine mapping of the PPT gene on the constructed physical map (Figure 3.1) revealed that several of the genomic clones in the critical CLN1 region contained the PPT gene, and a high-resolution technique (Fiber-FISH) was then applied to locate the PPT gene precisely on the map by hybidizing the PPT-containing clones isolated from phage libraries (Vesa et al., 1995). PPT was found to be located approximately 200 kb centromeric from the L-myc gene. The ﬁnding of mutations in this gene in multiple INCL patients veriﬁed that the PPT gene and the CLN1 gene were one and the same (Vesa et al., 1995).

72

S. L. Hofmann et al.

Figure 3.1. Physical map of the CLN1 region at 1p32. Known genes in the region are indicated by boxes and genomic clones by horizontal bars. The human PPT gene was found to be located approximately 200 kb centromeric from the L-myc gene in the vicinity of the microsatellite marker HY-TM1, which had been shown to be in strong linkage disequilibrium with CLN1. [Reproduced from Vesa et al. (1995), with permission.]

III. PALMITOYL-PROTEIN THIOESTERASE DEFINES A NEW PATHWAY IN LYSOSOMAL CATABOLISM Palmitoyl-protein thioesterase (PPT) was discovered during efforts to understand the mechanism of the turnover of fatty acids bound to proteins (Camp and Hofmann, 1993; Camp et al., 1994). Many proteins associated with the plasma membrane, including those that transmit signals (such as hormonal signals) from outside the cell to the cell interior, are modiﬁed by fatty acids that are covalently attached to cysteine residues in the protein backbone (Figure 3.2). These fatty acids are crucial for membrane association and participate in protein–protein interactions that are important in signal transduction (Mumby, 1997). PPT was identiﬁed and characterized based on its ability to hydrolyze the 16-carbon fatty acid palmitate from the oncogene H-Ras in in vitro assays. Using the removal of palmitate from H-Ras as an assay for the enzyme, PPT was puriﬁed and the primary amino acid sequence was deduced from the cloned PPT cDNA (Camp and Hofmann, 1993; Camp et al., 1994). From a comparison of the amino-terminal sequence of the mature protein with the amino acid sequence deduced from the cDNA, it was concluded that PPT was synthesized with a cleavable signal peptide. As signal peptides mediate the co-translational translocation of proteins across membranes in the endoplasmic reticulum, it seemed likely that PPT was either a secreted protein, or one that resides in an extracytoplasmic compartment within the cell, such as endoplasmic reticulum, Golgi, or lysosomes. The chromosomal localization of PPT1 to 1p32 (Schriner et al., 1996), and its implication in a putative lysosomal storage disease (Vesa et al., 1995), led to the appreciation of PPT’s true role in the lysosomal degradation of S-acylated proteins.

3. CLN1/Palmitoyl-Protein Thioesterase

73

Figure 3.2. The thioesterase cleavage site of PPT. Palmitoylated proteins are normally found associated with the inner surface of the plasma membrane as shown. Fatty acids such as palmitate are often found in thioester linkage to cysteine residues in proteins. PPT removes fatty acids from proteins by hydrolyzing a thioester bond between the fatty acid and the cysteine residue. The natural substrates of PPT are fatty acylated proteins and peptides undergoing degradation in the lysosome.

IV. ENZYMOLOGY OF PPT A number of studies have been performed on the puriﬁed PPT protein. The key points of these studies are summarized in Table 3.1. PPT readily hydrolyzes fatty acids from modiﬁed cysteine residues in several proteins, including H-Ras, G proteins, and palmitoylated albumin (Camp et al., 1994; Soyombo and Hofmann, 1997). Palmitoyl-CoA and synthetic compounds consisting of palmitate bound in thioester linkage to sugars are also substrates, indicating a lack of speciﬁcity for the “leaving” group in the thioesterase reaction (Camp et al., 1994; van Diggelen et al., 1999; Voznyi et al., 1999). Oxyesters do not appear to be substrates. Fatty acids from between 14 and 18 carbons are hydrolyzed at nearly equivalent rates, with a rather steep dropoff in activity outside this range (Camp et al., 1994). In reactions utilizing most protein substrates, the addition of detergent to the reaction mixtures is required, presumably to solubilize the substrate (Camp and Hofmann, 1993). Detergent is not required for the hydrolysis of the water-soluble substrate palmitoyl CoA (Camp et al., 1994). The pH optimum depends on the substrate used in the assay. PPT is more active against protein substrates at neutral pH, but some small molecule substrates are hydrolyzed at a pH optimum closer to 5.0. PPT is slowly inactivated by 1 mM DTT, probably because it contains several intramolecular disulﬁde bonds. It is inactivated by heavy metals and stabilized in the presence of EDTA, presumably due to the presence of neighboring sulfhydryls in disulﬁde linkage at amino acid residues 45 and 46 (Bellizzi et al., 1999). The substrate analog hexadecylsulfonyl ﬂuoride irreversibly inactivates the enzyme and modiﬁes the active site serine (Das et al., 2000). In contrast, the

74

S. L. Hofmann et al.

Table 3.1. Properties of Palmitoyl-Protein Thioesterase 1. 37-kDa lysosomal thioesterase 2. Speciﬁc for long-chain fatty acyl thioesters with preference for 14–18 carbons 3. Substrates in vivo: fatty acid thioesters of cysteine-containing peptides. 4. Substrates in vitro: palmitoyl CoA, S-methylumbelliferyl-6S-palmitoyl-␤-glucoside, S-fatty acylated peptides and proteins. Speciﬁc activity of recombinant PPT is ∼1 ␮mol of palmitoylCoA hydrolyzed per minute per milligram of protein at pH 5. (Turnover number: 0.62/s). 5. Acidic to neutral pH optimum, depending on substrate; enzyme is unstable at alkaline pH 6. Inhibited by diethylpyrocarbonate and insensitive to phenylmethanesulfonyl ﬂuoride and diisopropylﬂuorophosphate 7. Appears as a 37-kDa doublet (or triplet) by SDS-PAGE due to heterogenous glycoslyation. Has three asparagine-linked glycosylation sites. Glycosylation required for activity/stability. 8. Minimally processed—removal of signal peptide and N-terminal dipeptide. Fully active after signal peptide removal. 9. Catalysis via Ser-Asp-His triad. Structurally similar to bacterial lipases—␣/␤ hydrolase fold. 10. Two disulﬁde bonds. Loses activity upon reduction. Sensitive to heavy-metal contamination of buffers. Stabilized by storage in EDTA. 11. Modiﬁed by mannose 6-phosphate; targeted to lysosomes via the mannose 6-P receptor 12. Ubiquitously expressed. Highest protein/enzyme activity in brain and testes.

enzyme is insensitive to the class-speciﬁc serine-modifying reagent PMSF due to geometric constraints surrounding the active site serine. Diethylpyrocarbonate rapidly inactivates the enzyme, indicating the presence of a crucial histidine residue (Camp and Hofmann, 1993). PPT has been crystallized and its three-dimensional structure determined ◦ to 2.0 A resolution (Bellizzi et al., 1999) (Figure 3.3). The solved structure reveals an ␣/␤ fold, consisting of a central six-stranded parallel ␤ sheet alternating with ␣ helices. This structure is characteristic of a number of lipases and esterases (Schrag and Cygler, 1997). The closest structural neighbors to PPT are carboxylesterase from Pseudomonas ﬂuorescens and lipase from Candida antarctica. Structurally, PPT most closely resembles the dienelactone hydrolase and haloperoxidase subfamilies because, like these two subfamilies, PPT has an insertion between ␤4 and ␣B that forms one domain of the protein. A second domain created by a large insertion between ␤6 and ␤7 (residues 140–223) forms most of the fatty acid-binding site (Bellizzi et al., 1999). The catalytic mechanism of PPT can be inferred from its structure and is consistent with biochemical data. PPT utilizes a triad composed of serine, histidine, and aspartic acid. This “catalytic triad” of amino acids is utilized by many classic hydrolytic enzymes, such as chymotrypsin (Gold and Fahrney, 1964). In PPT, the members of the triad are Ser115, His289, and Asp233. Ser115, the catalytic nucleophile, is modiﬁed by palmitate in a structure that was solved using crystals grown in the presence of the substrate palmitoyl CoA (Bellizzi et al., 1999).

3. CLN1/Palmitoyl-Protein Thioesterase

75

Figure 3.3. Three dimensional structure of PPT. PPT is a globular enzyme consisting of six parallel ␤ strands alternating with ␣ helices organized in a structure known as the ␣/␤ hydrolase fold typical of lipases. There is a large insertion between ␤6 and ␤7 (residues 140–223), which forms a second domain that forms most of the fatty acid-binding site. Catalytic active site residues Ser115, Asp233, and His289 are shown. [Reprinted from Bellizzi et al., (1999) with permission. Copyright 1999 National Academy of Sciences U.S.A.]

V. POSTTRANSLATIONAL PROCESSING AND LYSOSOMAL TARGETING OF PPT The posttranslational processing and lysosomal targeting of PPT1 has been well established (Hellsten et al., 1996; Sleat et al., 1996; Verkruyse and Hofmann, 1996; Verkruyse et al., 1997). As a classical soluble lysosomal enzyme, PPT is synthesized on membrane-bound ribosomes and targeted to the lysosome through the mannose 6-phosphate receptor pathway, a hallmark of lysosomal enzyme trafﬁcking (Hellsten et al., 1996; Verkruyse and Hofmann, 1996). This scheme, reviewed in (Kornfeld, 1990), is presented in Figure 3.4. PPT is synthesized on membrane bound ribosomes and is translocated into the lumen of the endoplamic reticulum in a process mediated by a 25 amino

76

S. L. Hofmann et al.

Figure 3.4. Lysosomal enzyme trafﬁcking. PPT is synthesized on membrane-bound ribosomes and is phosphorylated (P) on oligosaccharide mannose residues in the cis-Golgi. The mannose 6-phosphate binds to a speciﬁc receptor (the mannose 6-phosphate receptor) located in the trans-Golgi. The mannose 6-phosphate receptor targets the newly synthesized PPT to the lysosome. Mannose 6-phosphate receptors are also found on the cell surface, where they can recapture mannose 6-phosphate-modiﬁed proteins and carry them to the lysosome. The mannose 6-phosphate receptor pathway provides a means to correct lysosomal storage disorders by enzyme replacement therapy. (Adapted from Molecular Cell C 1986, 1990, 1996 by Scientiﬁc American Books, Inc. used with Biology by Lodish et al. permission by W. H. Freeman and Company.)

acid signal peptide that is removed co-translationally (Camp et al., 1994). In the Golgi network, three asparagine-linked glycosylation sites (at residues 197, 212, and 232) are modiﬁed by complex oligosaccharides (Bellizzi et al., 1999). Like other proteins in this pathway, the earliest oligosaccharides are of the highmannose type, which are sensitive to cleavage by endoglycosidase H (Verkruyse and Hofmann, 1996). Further processing of the oligosaccharides can be inferred from the observation that the mature protein puriﬁed from bovine brain contains some hybrid structures partially resistant to endoglycosidase H (Camp et al., 1994). Oligonucleotide-directed mutagenesis of the N-linked glycosylation sites in PPT has revealed that glycosylation is necessary for enzyme activity and/or stability. Mutant enzymes that are glycosylated at any two of the three sites (or at Asn232 alone) retain 75% or more of normal activity, while a mutant enzyme that is glycosylated at Asn212 alone retains about 50% of normal activity, and an enzyme in which all three glycosylation sites have been altered has no

3. CLN1/Palmitoyl-Protein Thioesterase

77

detectable activity (Bellizzi et al., 1999). Furthermore, when recombinant PPT is deglycosylated in vitro using PNGase F, it seems to precipitate from solution in largely inactive form (Verkruyse and Hofmann, unpublished results). Therefore, the oligosaccharides that modify PPT play an important role in maintaining PPT structure and function. Oligosaccharides also play a special role in the “life cycle” of lysosomal enzymes, because these sugar residues are important for the next step in PPT maturation, in which PPT is recognized by a phosphotransferase that modiﬁes one or more of the mannoses by phosphate (Hellsten et al., 1996; Verkruyse and Hofmann, 1996). It is this mannose 6-phosphate that serves as a signal for targeting PPT (and most lysosomal enzymes) to the lysosome (Kornfeld, 1990). Experimental conﬁrmation of this process comes from the observation that ﬁbroblasts from patients with the rare disorder I-cell disease (who lack the phosphotransferase) secrete all of their PPT into the tissue culture medium (Verkruyse et al., 1997). Interestingly, mannose 6-phosphate receptors are also found on the surface of cells, and like many soluble lysosomal enzymes, mannose 6-phosphate-modiﬁed PPT added to the cell exterior is taken up into the cell by receptor-mediated endocytosis after binding to the mannose 6-phosphate receptor (Figure 3.4). The mannose 6-phosphate receptor pathway therefore provides a means of delivery of exogenously added enzyme to the cell interior and serves as the basis for lysosomal enzyme replacement therapy. In fact, mannose 6-phosphate modiﬁed PPT has been added to INCL cells and shown to correct the metabolic defect in these cells (Lu et al., 1996). In contrast to other lysosomal enzymes, activation by proteolytic processing does not seem to be a feature of the enzyme, as PPT is fully active following removal of the signal peptide (Camp et al., 1994). The mature enzyme appears as a doublet at 37 kDa/35 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, due to heterogeneous glycosylation (Camp et al., 1994; Hellsten et al., 1996; Verkruyse and Hofmann, 1996). An additional two amino-terminal amino acids are present in the recombinant enzyme (His-Leu) that are not present in the mature enzyme puriﬁed from brain as determined by N-terminal amino acid sequencing. This minor processing, which is consistent with the action of a lysosomal dipeptidyl aminopeptidase on PPT, seems to be of little signiﬁcance, as both unprocessed and amino-terminally processed forms are fully active (Camp et al., 1994).

VI. THE PHYSIOLOGICAL ROLE OF PPT PPT was ﬁrst puriﬁed by virtue of its ability to remove fatty acids from cysteine residues in proteins in vitro. A role for PPT in removing fatty acids from fatty acylated proteins in vivo has been demonstrated by metabolic labeling studies

78

S. L. Hofmann et al.

Figure 3.5. Identiﬁcation of metabolites that accumulate in PPT-deﬁcient cells. (A) INCL and control lymphoblasts were labeled with [35S]cysteine, extracted with organic solvents, and subjected to thin-layer chromatography. At least four discrete compounds (arrows) are shown to be speciﬁc for INCL cells. The compounds have been shown to be cysteine thioesters of long-chain fatty acids (primarily palmitate), and presumably represent small fatty acylated peptides. (B) Correction of the metabolic defect in INCL cells by addition of mannose 6-phosphate-modiﬁed PPT to the cell culture medium. The correction is mediated through the mannose 6-phosphate receptor pathway because it is blocked in the presence of mannose 6-phosphate. aRecombinant PPT that is produced in the Sf9 expression system (and does not contain mannose 6-phosphate) is ineffective in correcting the metabolic abnormality. [Reprinted from Lu et al. (1996), with permission. Copyright 1996 National Academy of Sciences U.S.A.]

(Lu et al., 1996; Hofmann and Lu, 1999; Hofmann and Verkruyse, 1999). If cells from INCL patients are labeled with [35S]cysteine, the label is incorporated into newly synthesized proteins. If lipid extracts are subsequently made from the cells after labeling, one sees speciﬁc accumulation of [35S]cysteine-labeled compounds by thin-layer chromatography (Figure 3.5A). These compounds are speciﬁc to PPT-deﬁcient patients and are not seen in normal controls or in cells derived from patients with other forms of Batten disease. There is further evidence that the palmitate- and cysteine-labeled compounds are derived from acylated proteins undergoing degradation in the lysosome (Lu and Hofmann, manuscript in preparation). Their formation is blocked by cycloheximide, which blocks the incorporation of cysteine into protein, and by inhibitors of lysosomal function, such as chloroquine and leupeptin. In addition,

3. CLN1/Palmitoyl-Protein Thioesterase

79

the accumulating compounds largely co-migrate with the lysosomal fraction in density-gradient fractionation of subcellular organelles. It is likely that the lipid thioesters that accumulate in INCL cells are toxic to neurons and that this toxicity is central to the mechanism of neurodegeneration in INCL. The accumulation of lipid thioesters in INCL cells can be prevented by the addition of mannose 6-phosphate-modiﬁed PPT to the tissue culture medium (Figure 3.5B). As discussed in the preceding section, the demonstration of correction of the metabolic defect in INCL cells by recombinant PPT serves as a rationale for enzyme replacement as a therapy for INCL.

VII. PALMITOYL-PROTEIN THIOESTERASE-2 (PPT2) A second lysosomal thioesterase has been identiﬁed based on a 20% amino acid identity with PPT (Soyombo and Hofmann, 1997). Like PPT, it is ubiquitously expressed, but it has a distinct distribution within tissues. PPT2 is easily identiﬁed in human urine (Sleat et al., 1997). Small long-chain fatty acid thioesters are excellent substrates for PPT2, but palmitoyl-proteins (at least those that are substrates for PPT) are not hydrolyzed. Careful studies suggest that PPT2 does not complement the metabolic defect of PPT-deﬁcient cells (Soyombo and Hofmann, 1997). Therefore, the physiological function of PPT2 is unknown. The gene for PPT2 is located within the major histocompatibility complex III on chromosome 6p21.3. This location does not correspond to any other forms of NCL where the chromosomal location of the disease gene is known.

VIII. THE PPT cDNA AND GENE The PPT gene spans approximately 25 kb and is comprised of nine exons (Figure 3.6A). cDNAs encoding human PPT have been characterized (Schriner et al., 1996). A major 2.5-kb mRNA is detected in most tissues. The human PPT cDNA consists of a short 5 -untranslated region of 14 base pairs, an open reading frame of 918 base pairs, and a 1388-bp 3 untranslated region. The amino acid sequence deduced from the cDNA contains 306 amino acids, of which the ﬁrst 25 amino acids constitute a leader peptide (Figure 3.6B). Sequence motifs characteristic of thioesterases (Naggert et al., 1988) (glycine-X-serine-X-glycine, and glycineaspartic acid-histidine) are present at amino acid residues 113–117 and 287–289, respectively. Thioesterases contain the classical “catalytic triad” residues of serine, aspartic (or glutamic) acid, and histidine, as do many lipases and proteases (Lawson et al., 1994; Witkowski et al., 1994). Three potential asparagine-linked glycosylation sites are found near the carboxyl terminus of the protein at positions

80

S. L. Hofmann et al.

Figure 3.6. PPT gene and protein. (A) The PPT gene spans 25 kb and is comprised of nine exons. Exon 1 contains a very short 5 -untranslated region and exon 9 contains 1388 bp of 3 untranslated region. A single 2.4-kb message is produced. (B) Schematic representation of PPT protein as deduced from the cDNA sequence. PPT is a single chain enzyme with a cleaved 25-amino acid signal peptide. The mature protein begins at amino acid residue 28. (A dipeptide is removed from the N-terminus without an effect on enzyme activity.) The locations of consensus motifs containing active site serine and histidine residues and three asparagine-linked glycosylation sites are shown.

197, 212, and 232. All of these sites are utilized to some degree in vivo (Bellizzi et al., 1999). PPT mRNA is found ubiquitously in a variety of tissues from the human (Schriner et al., 1996) and rat (Camp et al., 1994), with fairly high and uniform levels in lung, spleen, brain, and testis, and relatively little mRNA in liver and skeletal muscle. The correlation between mRNA levels and levels of enzyme activity is imperfect, as much higher activity (and protein) levels are found in testis and brain as compared to other tissues (Camp and Hofmann, 1993). Interestingly, brain and testis are the two most severely affected organs histopathologically in INCL (Haltia et al., 1973). Database searches reveal the presence of close PPT orthologs in mammals as well as in diverse organisms, such as Drosophila (fruit ﬂy), Caenorhabditis elegans (roundworm), ﬁssion yeast, and even plants (Arabidopsis and others) (Das et al., 1998). These observations highlight the universal occurrence of protein palmitoylation in eukaryotic cells (which has been demonstrated in animals and plants) and presumably reﬂects the need for disposal and recycling of the digestion products resulting from this process.

3. CLN1/Palmitoyl-Protein Thioesterase

81

IX. THE MOLECULAR GENETICS OF CLN1/PPT DEFICIENCY A. PPT deﬁciency as a simple recessive genetic trait Because PPT is a single-chain soluble lysosomal enzyme, the genetics of enzyme deﬁciency are relatively straightforward and easily understood as a simple recessive genetic trait. That is, the enzyme is encoded by two alleles (a maternal and a paternal) in each cell. Both must be defective to cause the disease. Carriers for PPT deﬁciency (for example, the parents of affected children) have one-half of the normal PPT activity. As is the case for most enzymatic deﬁciencies, 50% of normal activity is more than sufﬁcient for normal cellular function. There are a number of ways that the PPT gene can be defective and lead to PPT deﬁciency. Nonsense alleles (mutations that cause premature termination and truncation of the enzyme) contribute nothing to the overall enzymatic activity. Other mutations that create functionless or missing enzyme include frameshift mutations (small insertions or deletions that lead to garbled protein downstream of the mutation) or large deletions. Mutations occurring near splice sites may cause exons to be skipped and important coding regions of the protein to be absent. All of these severe forms of mutations have been described in PPT deﬁcient patients (Das et al., 1998; Mitchison et al., 1998; Munroe et al., 1998; Santorelli et al., 1998; Vesa et al., 1995; Waliany et al., 1999), with the exception of large deletions. Patients who inherit two such severe mutations will have no functional PPT from either allele; all of these patients studied to date have pursued a uniformly rapid and progressive course. More subtle mutations (missense alleles) that cause amino acid substitutions may cause a range of enzyme activity, from very severe (no functional residual activity) to trivial, as in the case of amino acid polymorphisms that have only a slight effect on enzyme function. An example of a polymorphism in PPT is a rare isoleucine to threonine mutation that has been found in a parent of a child with INCL. In this case, one allele had a known INCL mutation and the polymorphism was found on the other allele. This polymorphism is found occasionally in the general population (1.5%) (Das et al., 1998). In other lysosomal storage disorders, “pseudo-deﬁciency” alleles have been described that result in even lower levels (10% or less) of enzyme activity as measured in a test tube, but which have no clinical signiﬁcance (Hohenschutz et al., 1989; Nelson et al., 1991). Such alleles understandably create diagnostic confusion. Other missense alleles have been found only in late-onset NCL patients. These mutations result in PPT enzymes with a small amount of residual activity. These mutations are referred to as late-infantile or juvenile NCL with GROD, to highlight the pathological ﬁnding that is characteristic of PPT deﬁciency. Typically, these patients are compound heterozygotes, with one severe allele (that

82

S. L. Hofmann et al.

contributes nothing) and one allele with a small amount of residual activity, in the range of 2–4% of normal.

B. Speciﬁc mutations in PPT: some examples Over two dozen mutations occurring in all nine exons of PPT gene have been described (Das et al., 1998; Mitchison et al., 1998; Munroe et al., 1998; Santorelli et al., 1998; Vesa et al., 1995; Waliany et al., 1999). These mutations are illustrated in Figure 3.7 and include 13 missense, 6 nonsense, one single-base insertion, two single-base deletions, a 3-bp in-frame deletion, and a splice-site mutation. No larger deletions in the PPT gene have been reported. Certain mutations have occurred repeatedly or have been co-inherited with well-deﬁned nonsense alleles that contribute no residual enzyme activity, allowing certain genotypes to be correlated with the age of onset of symptoms (Table 3.2). In Finland, virtually all cases of infantile neuronal ceroid lipofuscinosis are caused by homozygous mutations at position 364 of the PPT cDNA, which changes a C to a T and causes a substitution of the amino acid arginine with a tryptophan residue at position 122 of the PPT protein (designated c.364C → T, Arg122Trp). These patients follow a uniformly rapid course, with ﬁrst symptoms no later than 18 months and loss of higher cortical function by age 3. Brain tissue and other cells from Finnish NCL patients contains no detectable PPT protein, and when the allele is expressed in heterologous (COS) cells, the overexpressed protein localizes in the endoplasmic reticulum, the site of degradation of misfolded proteins. From these observations and from considerations of the effect of this amino acid change on the protein three-dimensional structure, it seems that the Arg122W mutations cause misfolding, destabilization, and rapid degradation of the mutant PPT protein.

Figure 3.7. Location of 24 known mutations within the nine exons of the PPT gene. Missense mutations are shown above the gene and nonsense mutations, deletions and insertions are shown below. Common mutations are indicated in bold. Arg122Trp (R122W) is the common Finnish mutation and Arg151Stop (R151X) accounts for 40% of alleles outside of the Finnish population. Thr75Pro (T75P), also known as the “Scottish” mutation, accounts for most cases of juvenile-onset PPT deﬁciency worldwide.

3. CLN1/Palmitoyl-Protein Thioesterase

83

Outside of Finland, the most common mutation is c.451C → T (Arg151Stop), which causes premature termination of the PPT protein (Das et al., 1998). Patients who are homozygous for this mutation have a course similar to Finnish infants. As one is unable to detect this mutation by PCR using cDNA from affected patients, it is assumed that this mutation is associated with low levels of mRNA. This observation is expected from the ﬁnding that nonsense mutations that occur at greater than 50 bp from 3 donor splice sites cause message instability, due to coupling of transcription and translation by an unknown mechanism (Nagy and Maquat, 1998). The c. 451C → T mutation is in a position such that one would expect an unstable mRNA. No PPT protein is detected in these patients as well. Another nonsense mutation that has been observed in the homozygous state and that leads to a typical infantile phenotype is Leu10Stop (Munroe et al., 1998). Missense mutations that have occurred in typical infantile subjects include: c.541G → A (Val181Met), c.541G → T (Val181Leu) (Milà and Mallolas, 1998), c.125G → A (Gly42Glu), c.117T → A (His39Gln), c.550G → A (Glu184Lys), and c.353G → A (Gly118Asp). These mutations presumably do not contribute a signiﬁcant amount of enzyme activity; however, some of these have been observed only once, and so more data are needed before ﬁrm conclusions regarding these mutations can be made. One PPT mutation has been associated with a late-infantile phenotype in three families (Waliany et al., 1999). In each family, the age of onset of symptoms was 3–3.5 years. The mutation c.529C → G (Gln177Glu) would be predicted to cause a more subtle change in PPT structure. The defective enzyme has not been studied, but presumably has a small amount of residual enzymatic activity. Several mutations in PPT have been associated with a juvenile onset NCL (so-called JNCL with GROD) (Das et al., 1998; Mitchison et al., 1998; Waliany et al., 1999). Typically, these children come to medical attention at the age of 5–7 years with visual difﬁculties. Parents report that color distortion is a common presenting ﬁnding, as is loss of central vision. A diagnosis of Leber’s optic atrophy is sometimes made before more sophisticated tests are employed and before other signs appear. Unfortunately, cognitive decline and in some instances behavioral disturbances (including psychosis), become manifest from months to several years later, and progress to severe dementia and eventual death in the third to fourth decade. Anecdotally, seizures appear later and may be less severe as compared to patients with JNCL caused by mutations in CLN3. The most common of the late-onset PPT mutations, observed in over a dozen families, is a c.223A → C (Thr75Pro) mutation. The Thr75Pro mutation occurs at a nonconserved site in PPT on a turn at the start of helix ␣1, which may disrupt the geometry of the ␣ helix (Bellizzi et al., 1999). A small amount of residual activity associated with this mutant has been detected (Hofmann et al., 1999). Other mutations associated with juvenile-onset phenotypes are listed in Table 3.2. Interestingly, the mutations associated with JNCL with GROD are all

84 Table 3.2. Location of Mutations in the PPT Gene and Associated Phenotypes in Published Cases of NCL

Exon (5 )

Mutation

Amino acid change/effect

Phenotype a

Number of alleles reported

References

1 1 (5 )

c.3G→A c.29T→A

Met1Ile Leu10Stop

LINCL/JNCL INCL

1 (3 ) 2 2 2 2

c.117T→A c.125G→A c.163A→T c.169-170insA c.223A→C

His39Gln Gly42Glu Lys55Stop Frameshift Thr75Pro

INCL INCL INCL INCL JNCL

1 1 2 3 18

(Das et al., 1998) (Das et al., 1998) (Munroe et al., 1998; Vesa et al., 1995) (Santorelli et al., 1998; Waliany et al., 1999) (Das et al., 1998; Mitchison et al., 1998; Waliany et al., 1999)

3 (5 ) 3 (5 ) 3 (3 ) 3 (3 ) 4 4 4 5

c.236A→G c.255-257delCTT c.325T→G c.353G→A c.364A→T c.398T c.401T→C c.451C→T

Asp79Gly Phe84del Tyr109Asp Gly118Asp Arg122Trp Frameshift Ile134Thr Arg151Stop

JNCL LINCLb INCL/LINCLa INCL INCL INCL Polymorphism INCL

1 1 2 1 85 1 3 38

(Mitchison et al., 1998) (Waliany et al., 1999) (Das et al., 1998) (Waliany et al., 1999) (Das et al., 1998; Vesa et al., 1995) (Das et al., 1998) (Das et al., 1998) (Das et al., 1998; Mitchison et al., 1998; Munroe et al., 1998; Waliany et al., 1999)

2 8

(Das et al., 1998) (Mitchison et al., 1998; Das et al., 1998; Munroe et al., 1998)

5 5 6 (5 ) 6 (5 ) 7 7 8 8 8 9 (5 ) 9 (3 )

c.490C→T c.529C→G c.541G→A c.550G→A c.644delA c.656T→A IVS7-2A→T c.739T→C c.749G→T c.871C→T c.888G→A

Arg164Stop Gln177Glu Val181Met Glu184Lys Frameshift Leu219Gln Splice site Tyr247His Gly250Val Gln291Stop Trp296Stop

INCL INCL INCL/LINCL/JNCLc INCL –d JNCL INCL JNCLa JNCL INCL –e

3 3 4 1 1 1 1 1 1 1 1

(Das et al., 1998; Waliany et al., 1999) (Das et al., 1998; Waliany et al., 1999) (Das et al., 1998; Waliany et al., 1999) (Das et al., 1998) (Das et al., 1998) (Mitchison et al., 1998) (Das et al., 1998) (Das et al., 1998) (Das et al., 1998) (Waliany et al., 1999) (Das et al., 1998)

a The M1I allele was co-inherited with either the Tyr247His and Tyr109Asp alleles in two subjects, a JNCL and LINCL subject, respectively. Therefore, the relative contribution of these three mutations to the phenotypes is unclear. b The Phe84del allele was co-inherited with the Gln177Glu allele in a LINCL subject. Therefore, the relative contribution of this allele is unclear. However, Phe84 is an invariant residue throughout evolution, so Phe84del would be expected to be a severe mutation. c The Val181Met allele has been co-inherited with Arg122Trp, Arg151Stop, and Thr75Pro in an INCL, LINCL, and two JNCL subjects, respectively. Therefore, the relative contribution of this allele is unclear. However, Val181 is an invariant residue throughout evolution, so the impact of the the mutation would be expected to be severe. d Unable to assess (co-inherited with Thr75Pro). e Unable to assess (co-inherited with Gln177Glu).

85

86

S. L. Hofmann et al.

expected to lead to small, local changes that only indirectly affect the catalytically active residues or fatty acid-binding site (Bellizzi et al., 1999).

X. LABORATORY DIAGNOSIS OF PPT DEFICIENCY PPT deﬁciency may be suspected in any child with visual impairment, psychomotor deterioration, and seizures. In the very young child, microcephaly may be a presenting ﬁnding, and visual ﬁndings may be unappreciated. In the few PPTdeﬁcient patients with presentations in the late-infantile age range (2–4 years), seizures have often been prominent, just as in classical LINCL. In older children, visual difﬁculties are usually the ﬁrst manifestation, and anecdotal evidence suggests that seizures are not as prominent or occur later as compared with classical JNCL caused by mutations in CLN3. The ﬁnding of granular osmiophilic deposits on electron microscopic examination of peripheral blood leukocytes serves to narrow the differential diagnosis, although as many as 15% of INCL patients show nondiagnostic ﬁndings on initial examination (Wisniewski et al., 1992). Furthermore, late-onset PPT-deﬁcient subjects often show a mixed picture consisting of GROD and curvilinear or ﬁngerprint inclusions (Das et al., 1998). Therefore, caution must be used if ultrastructure alone is relied upon to determine the underlying enzyme deﬁciency, as these results may occasionally be misleading. The most direct and precise means of conﬁrming the diagnosis of PPT deﬁciency is based on the enzymatic assay of PPT from any available cell type (such as leukocytes or ﬁbroblasts). A two-stage thioesterase assay utilizing a 4-methylumbelliferyl derivative of palmitoyl-S-thioglucose at acidic pH is available for clinical use (Voznyi et al., 1999). The substrate is available from Dr. Otto van Diggelen, Department of Clinical Genetics, Erasmus University, The Netherlands. DNA-based testing is applicable for the Finnish population, since the major mutation covers 98% of disease alleles (Vesa et al., 1995). Prenatal testing has been applied successfully in Finland, by examination of chorionic villi, which show the characteristic GROD and by linkage studies for families with one affected child (Rapola et al., 1993). PPT activity can be measured in amniocytes (de Vries et al., 1999). DNA-based mutation detection can be offered to families seeking prenatal diagnosis for the disorder when the molecular defect in the family at risk has been established.

XI. PROSPECTS FOR CAUSE-SPECIFIC TREATMENT OF PPT DEFICIENCY An appreciation that INCL and related disorders are caused by a deﬁciency in lysosomal PPT suggests two general approaches to therapy. One approach, applicable to all lysosomal storage diseases, seeks to replace the missing enzyme

3. CLN1/Palmitoyl-Protein Thioesterase

87

directly. Enzyme replacement therapy has proven to be remarkably effective in Gaucher disease, a lysosomal storage disease that affects bone and visceral organs (reviewed by Grabowski et al., 1998). However, enzyme replacement therapy for lysosomal storage disorders affecting the central nervous system faces the added problem of delivery to neuronal cells. The target organs in Gaucher disease are accessible from the bloodstream; in contrast, central nervous system neurons seem to be relatively inaccessible to blood-borne proteins, as they are protected by a blood–brain barrier as well as a cerebrospinal ﬂuid–brain barrier. Some success in correcting central nervous system (CNS) disease has been observed in the case of the murine lysosomal storage disease (mucopolysaccharidosis VII) using treatment with the missing lysosomal enzyme, ␤-glucuronidase, early in postnatal life (O’Connor et al., 1998; Vogler et al., 1999). Little information on how enzymes may be safely delivered directly into the brain parenchyma is available, but preclinical animal studies are ongoing. Generation of the missing enzyme within the brain through the use of viral-mediated gene delivery is an active area of investigation, but the ﬁeld is still in its infancy. Obstacles to successful gene therapy in other systems have included difﬁculty in transfection of nondividing cells, low levels of expression, and development of antibodies to viral or (theoretically) to the therapeutic proteins. Some newer viral vectors show promise in overcoming some of these obstacles and are at the preclinical stage for selected lysosomal storage diseases (Barranger et al., 1999; Daly et al., 1999). Along these same lines, cells that produce the missing lysosomal enzyme might be used therapeutically. Neural progenitor stem cells have shown promise in a murine model of mucopolysaccharidosis VII (Snyder et al., 1995). One way to introduce cells into the CNS is (surprisingly) through bone marrow transplantation. It seems that microglial cells of the CNS are bonemarrow derived, and slowly populate the brain after transplantation (Krivit et al., 1995b). The donor microglial cells (which are really a specialized form of tissue macrophage) secrete many lysosomal enzymes that are competent for uptake into neurons through the mannose 6-phosphate receptor pathway. Therefore, bone marrow transplantation provides a continuous cell-derived source of therapeutic enzyme. This approach has shown reasonable success when applied to some lysosomal storage diseases, but not to others (Hoogerbrugge and Valerio, 1998; Kaye, 1995; Krivit et al., 1995a, 1998; O’Marcaigh and Cowan, 1997). Four Finnish infants with INCL have received bone marrow transplants; one died of complications of the transplant, one has done much better than age-matched controls but is still severely retarded at age 4 years, and in the other two cases, follow-up has been too short to permit conclusions (P. Santavuori, personal communication). It is likely that bone marrow transplant may provide amelioration but will not be curative in these severely affected infants. The utility of bone marrow transplantion in juvenile-onset patients is unknown. In any event, an HLA-identical sibling (or matched anonymous donor) must be available, which further limits this approach. In addition, if an HLA-matched sibling is identiﬁed, the donor is

88

S. L. Hofmann et al.

likely to be a carrier of the disease mutation, and the procedure may (theoretically) be less successful because only half of the normal amount of enzyme will be available for correction. New methods, such as correction of the defective gene in vivo by homologous recombination, using a method known as chimeraplasty, show some potential but have yet to be translated into the clinical arena (Xiang et al., 1997; Yoon et al., 1996). These newer technologies bear watching for the future. A second conceptual approach to therapy for INCL would seek to deplete the abnormal substrate accumulation. There is a precedent to this approach in the glycosphingolipid disorders (Platt and Butters, 1998), in which a small molecule inhibitor of glycosphingolipid synthesis, N-butyldeoxynojirimycin, has been used to ameliorate lysosomal accumulations in mice with Tay-Sachs (Platt et al., 1997) and Sandhoff disease (Jeyakumar et al., 1999). Human clinical trials of the compound in Gaucher disease have been initiated. A second example of substrate depletion therapy is the use of cysteamine to treat cystinosis, a disorder of lysosomal cystine transport. In this instance, cysteamine is used to promote cystine breakdown and excretion through alternative transport mechanisms (Gahl et al., 1995). In the case of INCL, little is known about the biosynthesis of lipid palmitoyl cysteine thioesters in cells, and no speciﬁc inhibitors are available. However, the concentration of accumulating lipid cysteine thioesters could possibly be reduced through the use of an appropriate reducing agent or nucleophile, because thioesters are high-energy, relatively unstable compounds amenable to chemical hydrolysis. An assay for the accumulation of cysteine thioesters such as the one presented in Figure 3.5 could be used to screen for such compounds. The use of pharmacological agents would be limited by their toxicity; for example, ␤-mercaptoethanol is very effective in breaking thioester bonds, but its reducing power makes it a very potent cellular poison. Perhaps less toxic compounds could be identiﬁed. In summary, a great deal of progress has been made in our understanding of infantile NCL in recent years, offering hope that these advances will lead to better therapy for this devastating disease.

Acknowledgments This work was supported in part by the National Institutes of Health (NS 36867 and NS 35323).

References Barranger, J. A., Rice, E. O., and Swaney, W. P. (1999). Gene transfer approaches to the lysosomal storage disorders. Neurochem. Res. 24, 601–615. Bellizzi, J. J., III, Widom, J., Kemp, C., Lu, J.-Y., Das, A.K., Hofmann, S. L., and Clardy, J. (2000). The

3. CLN1/Palmitoyl-Protein Thioesterase

89

crystal structure of palmitoyl protein thioesterase 1 and the molecular basis of infantile neuronal ceroid lipofuscinosis. Proc. Natl. Acad. Sci. U.S.A. 97, 4573–4578. Camp, L. A., and Hofmann, S. L. (1993). Puriﬁcation and properties of a palmitoyl-protein thioesterase that cleaves palmitate from H-Ras. J. Biol. Chem. 268, 22566–22574. Camp, L. A., Verkruyse, L. A., Afendis, S. J., Slaughter, C. A., and Hofmann, S. L. (1994). Molecular cloning and expression of palmitoyl-protein thioesterase. J. Biol. Chem. 269, 23212–23219. Daly, T. M., Vogler, C., Levy, B., Haskins, M. E., and Sands, M. S. (1999). Neonatal gene transfer leads to widespread correction of pathology in a murine model of lysosomal storage disease. Proc. Natl. Acad. Sci. (USA) 96, 2296–300. Das, A. K., Becerra, C. H. R., Yi, W., Lu, J.-Y., Siakotos, A. N., Wisniewski, K. E., and Hofmann, S. L. (1998). Molecular genetics of palmitoyl-protein thioesterase deﬁciency in the U. S. J. Clin. Invest. 102, 361–370. Das, A. K., Bellizzi, J. J., III, Tandel, S., Biehl, E., Clardy, J., and Hofmann, S. L. (2000). Structural basis for the insensitivity of a serine enzyme (palmitoyl-protein thioesterase) to phenylmethylsulfonyl ﬂuoride. J. Biol. Chem. 275, 23847–23851. de Vries, B. B., Kleijer, W. J., Keulemans, J. L., Voznyi, Y. V., Franken, P. F., Eurlings, M. C., Galjaard, R. J., Losekoot, M., Catsman-Berrevoets, C. E., Breuning, M. H., Taschner, P. E., and van Diggelen, O. P. (1999). First-trimester diagnosis of infantile neuronal ceroid lipofuscinosis (INCL) using PPT enzyme assay and CLN1 mutation analysis. Prenat. Diagn. 19, 559–562. Gahl, W. A., Schneider, J. A., and Aula, P. P. (1995). Lysosomal transport disorders: Cystinosis and sialic acid storage disorders In “The Metabolic and Molecular Bases of Inherited Disease” C. R. Scriver A. L. Beaudet, W. S. Sly and D. Valle, eds.), pp. 3763–3797. McGraw-Hill, New York. Gold, A. M., and Fahrney, D. (1964). Sulfonyl ﬂuorides as inhibitors of esterases. II. Formation and reactions of phenylmethanesulfonyl ␣-chymotrypsin Biochemistry 3, 783–791. Grabowski, G. A., Leslie, N., and Wenstrup, R. (1998). Enzyme therapy for Gaucher disease: The ﬁrst 5 years. Blood. Rev. 12, 115–33. Haltia, M., Rapola, J., and Santavuori, P. (1973). Infantile type of so-called neuronal ceroid lipofuscinosis. Part II. Histological and electron microscopic studies. Acta Neuropathol. 26, 157–170. Hellsten, E., Vesa, J., Heiskanen, M., Makela, T. P., Jarvela, I., Cowell, J. K., Mead, S., Alitalo, K., Palotie, A., and Peltonen, L. (1995). Identiﬁcation of YAC clones for human chromosome 1p32 and physical mapping of the infantile neuronal ceroid lipofuscinosis (INCL) locus. Genomics 25, 404–412. Hellsten, E., Vesa, J., Olkkonen, V. M., Jalanko, A., and Peltonen, L. (1996). Human palmitoyl protein thioesterase: Evidence for lysosomal targeting of the enzyme and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. Embo. J. 15, 5240–5245. Hofmann, S. L., and Lu, J. Y. (1999). Metabolic labeling of protein-derived lipid thioesters in palmitoylprotein thioesterase-deﬁcient cells. Meth. Mol. Biol. 116, 213–219. Hofmann, S. L., and Verkruyse, L. A. (1999). Fatty acid analysis of protein-derived lipid thioesters isolated from palmitoyl-protein thioesterase-deﬁcient cells. Meth. Mol. Biol. 116, 221–228. Hofmann, S. L., Das, A. K., Yi, W., Lu, J. Y., and Wisniewski, K. E. (1999). Genotype-phenotype correlations in neuronal ceroid lipofuscinosis due to palmitoyl-protein thioesterase deﬁciency. Mol. Genet. Metab. 66, 234–239. Hohenschutz, C., Eich, P., Friedl, W., Waheed, A., Conzelmann, E., and Propping, P. (1989). Pseudodeﬁciency of arylsulfatase A: A common genetic polymorphism with possible disease implications. Hum. Genet. 82, 45–48. Hoogerbrugge, P. M., and Valerio, D. (1998). Bone marrow transplantation and gene therapy for lysosomal storage diseases. Bone Marrow Transplant. 21 Suppl. 2, S34–S36. Jarvela, I. (1991). Infantile neuronal ceroid lipofuscinosis (CLN1): Linkage disequilibrium in the Finnish population and evidence that variant late infantile form (variant CLN2) represents a nonallelic locus. Genomics 10, 333–337.

90

S. L. Hofmann et al.

Jarvela, I., Schleutker, J., Haataja, L., Santavuori, P., Puhakka, L., and Manninen, T., et al. (1991). Infantile form of neuronal ceroid lipofuscinosis (CLN1) maps to the short arm of chromosome 1. Genomics 9, 170–173. Jeyakumar, M., Butters, T. D., Cortina-Borja, M., Hunnam, V., Proia, R. L., Perry, V. H., Dwek, R. A., and Platt, F. M. (1999). Delayed symptom onset and increased life expectancy in Sandhoff disease mice treated with N-butyldeoxynojirimycin. Proc. Natl. Acad. Sci. (USA) 96, 6388– 6393. Kaye, E. M. (1995). Therapeutic approaches to lysosomal storage diseases. Curr. Opin. Pediatr. 7, 650–654. Kornfeld, S. (1990). Lysosomal enzyme targeting. Biochem. Soc. Trans. 18, 367–374. Krivit, W., Lockman, L. A., Watkins, P. A., Hirsch, J., and Shapiro, E. G. (1995a). The future for treatment by bone marrow transplantation for adrenoleukodystrophy, metachromatic leukodystrophy, globoid cell leukodystrophy and Hurler syndrome. J. Inherit. Metab. Dis. 18, 398–412. Krivit, W., Sung, J. H., Shapiro, E. G., and Lockman, L. A. (1995b). Microglia: The effector cell for reconstitution of the central nervous system following bone marrow transplantation for lysosomal and peroxisomal storage diseases. Cell Transplant. 4, 385–392. Krivit, W., Shapiro, E. G., Peters, C., Wagner, J. E., Cornu, G., Kurtzberg, J., Wenger, D. A., Kolodny, E. H., Vanier, M. T., Loes, D. J., Dusenbery, K., and Lockman, L. A. (1998). Hematopoietic stem-cell transplantation in globoid-cell leukodystrophy. N. Engl. J. Med. 338, 1119–1126. Lawson, D. M., Derewenda, U., Serre, L., Ferri, S., Szittner, R., Wei, Y., Meighen, E. A., and Derewenda, Z. S. (1994). Structure of a myristoyl-ACP-speciﬁc thioesterase from Vibrio harveyi. Biochemistry 33, 9382–9388. Lu, J. Y., Verkruyse, L. A., and Hofmann, S. L. (1996). Lipid thioesters derived from acylated proteins accumulate in infantile neuronal ceroid lipofuscinosis: Correction of the defect in lymphoblasts by recombinant palmitoyl-protein thioesterase. Proc. Natl. Acad. Sci. (USA) 93, 10046–10050. Mil`a, M., and Mallolas, J. (1998). Neuronal Ceroid Lipofuscinosis Database (Sara Mole, moderator), direct submission. Mitchison, H. M., Hofmann, S. L., Becerra, C. H., Munroe, P. B., Lake, B. D., Crow, Y. J., Stephenson, J. B., Williams, R. E., Hofman, I. L., Taschner, P. E. M., Martin, J. J., Philippart, M., Andermann, E., Andermann, F., Mole, S. E., and Gardiner, R. M., and O’Rawe A. M. (1998). Mutations in the palmitoyl-protein thioesterase gene (PPT; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits. Hum. Mol. Genet. 7, 291–297. Mumby, S. M. (1997). Reversible palmitoylation of signaling proteins. Curr. Opin. Cell. Biol. 9, 148–154. Munroe, P. B., Greene, N. D., Leung, K. Y., Mole, S. E., Gardiner, R. M., Mitchison, H. M., Stephenson, J. B., and Crow, Y. J. (1998). Sharing of PPT mutations between distinct clinical forms of neuronal ceroid lipofuscinoses in patients from Scotland [letter]. J. Med. Genet. 35, 790. Naggert, J., Witkowski, A., Mikkelsen, J., and Smith, S. (1988). Molecular cloning and sequencing of a cDNA encoding the thioesterase domain of the rat fatty acid synthetase. J. Biol. Chem. 263, 1146–1150. Nagy, E., and Maquat, L. E. (1998). A rule for termination-codon position within intron-containing genes: When nonsense affects RNA abundance. Trends Biochem. Sci. 23, 198–199. Nelson, P. V., Carey, W. F., and Morris, C. P. (1991). Population frequency of the arylsulphatase A pseudo-deﬁciency allele. Hum. Genet. 87, 87–88. O’Connor, L. H., Erway, L. C., Vogler, C. A., Sly, W. S., Nicholes, A., Grubb, J., Holmberg, S. W., Levy, B., and Sands, M. S. (1998). Enzyme replacement therapy for murine mucopolysaccharidosis type VII leads to improvements in behavior and auditory function. J. Clin. Invest. 101, 1394– 1400. O’Marcaigh, A. S., and Cowan, M. J. (1997). Bone marrow transplantation for inherited diseases. Curr. Opin. Oncol. 9, 126–130.

3. CLN1/Palmitoyl-Protein Thioesterase

91

Platt, F. M., and Butters, T. D. (1998). New therapeutic prospects for the glycosphingolipid lysosomal storage diseases. Biochem. Pharmacol. 56, 421–430. Platt, F. M., Neises, G. R., Reinkensmeier, G., Townsend, M. J., Perry, V. H., Proia, R. L., Winchester, B., Dwek, R. A., and Butters, T. D. (1997). Prevention of lysosomal storage in Tay-Sachs mice treated with N-butyldeoxynojirimycin. Science 276, 428–431. Rapola, J., Salonen, R., Ammala, P., and Santavuori, P. (1993). Prenatal diagnosis of infantile neuronal ceroid-lipofuscinosis, INCL: Morphological aspects. J. Inherit. Metab. Dis. 16, 349– 352. Santorelli, F. M., Bertini, E., Petruzzella, V., Di Capua, M., Calvieri, S., Gasparini, P., and Zeviani, M. (1998). A novel insertion mutation (A169i) in the CLN1 gene is associated with infantile neuronal ceroid lipofuscinosis in an Italian patient. Biochem. Biophys. Res. Commun. 245, 519–522. Schrag, J. D., and Cygler, M. (1997). Lipases and alpha/beta hydrolase fold. Meth. Enzymol. 284, 85–107. Schriner, J. E., Yi, W., and Hofmann, S. L. (1996). cDNA and genomic cloning of human palmitoylprotein thioesterase (PPT), the enzyme defective in infantile neuronal ceroid lipofuscinosis [published erratum appears in Genomics (1996) 38, 458]. Genomics 34, 317–322. Sleat, D. E., Sohar, I., Lackland, H., Majercak, J., and Lobel, P. (1996). Rat brain contains high levels of mannose-6-phosphorylated glycoproteins including lysosomal enzymes and palmitoylprotein thioesterase, an enzyme implicated in infantile neuronal lipofuscinosis. J. Biol. Chem. 271, 19191–19198. Sleat, D. E., Kraus, S. R., Sohar, I., Lackland, H., and Lobel, P. (1997). alpha-Glucosidase and N-acetylglucosamine-6-sulphatase are the major mannose-6-phosphate glycoproteins in human urine. Biochem. J. 324, 33–39. Snyder, E. Y., Taylor, R. M., and Wolfe, J. H. (1995). Neural progenitor cell engraftment corrects lysosomal storage throughout the MPS VII mouse brain. Nature 374, 367–370. Soyombo, A. A., and Hofmann, S. L. (1997). Molecular cloning and expression of PPT2, a homolog of lysosomal palmitoyl-protein thioesterase with a distinct substrate speciﬁcity. J. Biol. Chem. 272, 27456–27463. van Diggelen, O. P., Keulemans, J. L., Winchester, B., Hofman, I. L., Vanhanen, S. L., Santavuori, P., and Voznyi, Y. V. (1999). A rapid ﬂuorogenic palmitoyl-protein thioesterase assay: Pre- and postnatal diagnosis of INCL. Mol. Genet. Metab. 66, 240–244. Verkruyse, L. A., and Hofmann, S. L. (1996). Lysosomal targeting of palmitoyl-protein thioesterase. J. Biol. Chem. 271, 15831–15836. Verkruyse, L. A., Natowicz, M. R., and Hofmann, S. L. (1997). Palmitoyl-protein thioesterase deﬁciency in ﬁbroblasts of individuals with infantile neuronal ceroid lipofuscinosis and I-cell disease. Biochim. Biophys. Acta 1361, 1–5. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Vogler, C., Levy, B., Galvin, N. J., Thorpe, C., Sands, M. S., Barker, J. E., Baty, J., Birkenmeier, E. H., and Sly, W. S. (1999). Enzyme replacement in murine mucopolysaccharidosis type VII: Neuronal and glial response to beta-glucuronidase requires early initiation of enzyme replacement therapy. Pediatr. Res. 45, 838–844. Voznyi, Y. V., Keulemans, J. L. M., Mancini, G. M. S., Catsman-Berrevoets, C. E., Young, E., Winchester, B., Kleijer, W. J., and van Diggelen, O. P. (1999). A new simple enzyme assay for pre- and postnatal diagnosis of infantile neuronal ceroid lipofuscinosis (INCL) and its variants. J. Med. Genet. 36, 471–474. Waliany, S., Das, A. K., Gaben, A., Wisniewski, K. E., and Hofmann, S. L. (2000). Identiﬁcation of three novel mutations of the palmitoyl-protein thioesterase-1 (PPT1) gene in children with neuronal ceroid-lipofuscinosis. Hum. Mutat. 15, 206–207.

92

S. L. Hofmann et al.

Wisniewski, K. E., Kida, E., Patxot, O. F., and Connell, F. (1992). Variability in the clinical and pathological ﬁndings in the neuronal ceroid lipofuscinoses: Review of data and observations. Am. J. Med. Genet. 42, 525–532. Witkowski, A., Witkowska, H. E., and Smith, S. (1994). Reengineering the speciﬁcity of a serine active-site enzyme: Two active-site mutations convert a hydrolase to a transferase. J. Biol. Chem. 269, 379–383. Xiang, Y., Cole-Strauss, A., Yoon, K., Gryn, J., and Kmiec, E. B. (1997). Targeted gene conversion in a mammalian CD34+-enriched cell population using a chimeric RNA/DNA oligonucleotide. J. Mol. Med. 75, 829–835. Yoon, K., Cole-Strauss, A., and Kmiec, E. B. (1996). Targeted gene correction of episomal DNA in mammalian cells mediated by a chimeric RNA.DNA oligonucleotide. Proc. Natl. Acad. Sci. (USA) 93, 2071–2076.

4

Biochemistry of Neuronal Ceroid Lipofuscinoses Mohammed A. Junaid∗ and Raju K. Pullarkat Department of Developmental Biochemistry New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314

I. Introduction II. Genetic Defects A. PPTI B. CLN2p C. CLN3 Protein III. NCL are Lysosomal Storage Diseases A. Oligosaccharyl Diphosphodolichol B. Subunit c of Mitochondrial ATP Synthase C. Mannose 6-phosphorylated Glycoproteins D. Sphingolipid Activator Proteins (saposins) IV. Remaining Issues and Future Directions References

ABSTRACT This chapter summarizes the recent advances that have been made with respect to biochemical characterization of the neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses (NCL) or Batten disease. Genomic and proteomic approaches have presently identiﬁed eight different forms of NCL (namely, CLN1 through CLN8) based on mutations in speciﬁc genes. CLN1 and CLN2 are caused by mutations in genes that encodes lysosomal enzymes, * Corresponding author: Institute for Basic Research, 1050 Forest Hill Road, Staten Island, NY 10314. Email: [email protected].

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

93

94

M. A. Junaid and R. K. Pullarkat

palmitoyl protein thioesterase and pepstatin-insensitive proteinase, respectively. The protein involved in the etiology of CLN3 is a highly hydrophobic, presumably transmembrane protein. NCL are considered as lysosomal storage diseases because of the accumulation of autoﬂuorescent inclusion bodies. The composition of inclusion bodies varies in different forms of the NCL. The major storage component in CLN2 is the subunit c of mitochondrial ATP synthase complex and its accumulation is the direct result of lack of CLN2p in this disease. Mannose-6-phosphorylated glycoproteins accumulate in CLN3 and most likely their accumulation is the result of an intrinsic activity of the CLN3 protein. Signiﬁcant levels of oligosaccharyl diphosphodolichol also accumulate in CLN3 and CLN2, whereas lysosomal sphingolipid activator proteins (saposins A and D) constitute major component of the storage material in CLN1. The issue of selective loss of neuronal and retinal cells in NCL still remains to be addressed. Identiﬁcation of natural substrates for the various enzymes involved in NCL may help in the characterization of the cytotoxic factor(s) and also in designing rationale therapeutic interventions for these group of devastating diseases.

I. INTRODUCTION The term neuronal ceroid lipofuscinoses (NCL) or Batten disease refers to a group of familial, genetically heterogeneous neurodegenerative disorders that are characterized by the accumulation of autoﬂuorescent inclusion bodies in brain and other tissues (Boustany, 1996; Zeman et al., 1970). Clinical characteristics of NCL include progressive visual failure, psychomotor deterioration, ataxia, seizures, and severe dementia that ultimately lead to premature death. Unfortunately, no effective treatment is available for this group of devastating neurodegenerative disorders, hence carrier identiﬁcation by screening in the high-risk population and prenatal diagnosis are the only means of controlling NCL. The pathologic hallmark of NCL is the characteristic ultrastructural features of the accumulating autoﬂuorescent inclusion bodies—a microscopic criterion that is used for diagnosis. Although systematic studies are lacking on the prevalence of NCL, these are considered to be the most common neurodegenerative diseases of infancy and childhood. Most of these disorders are inherited in an autosomal recessive manner, although there are at least two reports of families affected with the adult form of the disease that display autosomal dominant mode of inheritance (Dom et al., 1979; Boehme et al., 1971). Earlier classiﬁcations of NCL into infantile, late-infantile, juvenile, and adult forms were based primarily on the age of onset of clinical symptoms and the characteristic ultrastructural appearance of the accumulated autoﬂuorescent inclusion bodies. With the discovery of genetic defects, a new system of

95

4. Biochemistry of NCL Table 4.1. Genetic Variants of Neuronal Ceroid Lipofuscinoses Trivial name

Disease

Onset

CLN1

6–18 mo

GROD

1p32

PPTI

Vesa et al., 1995

CLN2 CLN5

2–4 yr 4–7 yr

CB CB/FP

11p15 13p22

CLN6

4–8 yr

CB/FP

15q21-23

CLN2p/TPP1 Membrane protein Unknown

Sleat et al., 1997 Savukoski et al., 1998 Sharp et al., 1997

CLN7

4–8 yr

CB/FP

?

Unknown

Wheeler et al., 1999

CLN3

6–10 yr

FP

16p12

Membrane protein

International Batten Disease Consortium, 1995

EPMR/NR

CLN8

5–10 yr

RP

8p23

Membrane protein

Ranta et al., 1999

Adult Kufs disease

CLN4

∼30 yr

G/FP/RP

?

?

Berkovic et al., 1988

Infantile Infantile Late-infantile Classic Finnish variant Costa Rican variant Turkish variant Juvenile Classical

Pathology

Locus

Product

Reference

GROD, granular osmiophilic deposits; CB, curvilinear bodies; FP, ﬁngerprint proﬁles; RP, rectilinear proﬁles; EPMR/NR, progressive epilepsy with mental retardation or Northern epilepsy; PPTI, palmitoyl-protein thioesterase; TPP1, tripeptidyl peptidase 1.

classiﬁcation has been introduced that identiﬁes the disease with its gene. Currently, at least eight different forms of NCL have been identiﬁed based on the genetic defects (see Table 4.1).

II. GENETIC DEFECTS In the past few years, advances in positional cloning and proteomics have led to the chromosomal mapping and gene identiﬁcation of seven of the eight NCL. Only the gene for CLN4 remains to be identiﬁed. Two of the seven gene products have already been puriﬁed and characterized. These are for the diseases CLN1 and CLN2, caused by mutations in genes that encode lysosomal enzymes, palmitoylprotein thioesterase (PPTI) (Vesa et al., 1995) and pepstatin-insensitive proteinase (CLN2p) (Sleat et al., 1997), respectively. Genetic defects and chromosomal localization for two relatively rare late-infantile forms, CLN5 (Savukoski et al., 1998) and CLN6 (Sharp et al., 1997) have been identiﬁed. Among these, the gene product of CLN5 has been proposed as a 407-amino acid residues long,

96

M. A. Junaid and R. K. Pullarkat

hypothetical membrane-bound protein based on the predicted hydrophobicity index. While a new locus has been identiﬁed for another rare form, CLN7, the gene and the product remains to be identiﬁed (Wheeler et al., 1999). The majority of CLN3 patients carry a 1.02-kb deletion in the gene that encodes a putative highly hydrophobic transmembrane protein (International Batten Disease Consortium, 1995). This cln3 gene is proposed to transcribe a protein of 438 amino acid residues. Most recently, another disease, referred to as progressive epilepsy with mental retardation or Northern epilepsy (EPMR/NR), which is restricted mostly to the Finnish population, has been included under NCL. The genetic defect for this disease, categorized as CLN8, has been identiﬁed (Ranta et al., 1999). The gene is predicted to transcribe a putative highly hydrophobic transmembrane protein of 286 amino acid residues. A naturally occurring animal model for NCL known as motor neuron degeneration (mnd) mouse also has mutations in an orthologous gene for cln8.

A. PPTI PPTI is a soluble lysosomal thioesterase involved in the removal of fatty acyl moieties from proteins (Verkruyse and Hoffman, 1996). The enzyme occurs as a doublet of molecular mass 39 and 37 kDa, presumably as a result of differential glycosylation, and has a pH optimum between 4 and 5. Unlike other lipid modiﬁcations such as N-terminal myristoylation or C-terminal cysteine prenylation, PPTI removes fatty acyl moieties from thioester linkages. Lymphoid cells derived from CLN1 patients accumulate [35S] cysteine-labeled lipid thioesters—a defect that can be reversed by including recombinant PPTI in the culture medium (Lu et al., 1996). The identities of these accumulating lipid thioesters are still unknown. Under in vitro conditions, depalmitoylation of H-Ras and the G␣s subunits of heterotrimeric GTP-binding proteins by the PPTI have been demonstrated, suggesting that these could be natural substrates (Camp and Hofmann, 1993). However, storage of H-Ras or any peptide fragments originating from it in CLN1 is not known. Data from our laboratory has shown that the levels of H-Ras remain unaffected in CLN1 (Morris and Pullarkat, unpublished). The natural substrate(s) of the PPTI, thus, remains to be identiﬁed. The molecular pathogenesis of CLN1 presumably results from defective intracellular transport of the enzymatically inactive PPTI due to a single point mutation that causes a change of a tryptophan to an arginine residue. In transfection experiments utilizing COS-1 cells, it was demonstrated that while the wild-type PPTI is sorted to lysosomes, the mutant inactive protein carrying the same mutation as that occurring in CLN1 patients remains in the endoplasmic reticulum (Hellsten et al., 1996). Biochemical diagnosis of CLN1 that utilize either radiolabeled (Cho and Dawson, 1998) or ﬂuorogenic (van Diggelen et al., 1999) palmitoylated peptides

4. Biochemistry of NCL

97

as substrates for PPTI assay have been described. With these assays, detection of patients as well as heterozygous carriers is possible.

B. CLN2p CLN2p is one of the most abundant lysosomal proteases and is insensitive to the common aspartyl protease inhibitor pepstatin A. When CLN2p was discovered as a missing mannose 6-phosphorylated protein in CLN2 patients, it was reported to be a novel protein (Sleat et al., 1997). However, later GenBank sequence submission revealed it to be the same tripeptidyl peptidase 1 (TPPI) that was earlier puriﬁed from rat spleen (Rawlings and Barrett, 1999; Vines and Warburton, 1998, 1999). The amino acid sequence of CLN2p is highly conserved among various species. The murine sequence is about 84% identical to the human sequence (GenBank accession numbers AJ011912 and AF111172). The CLN2p/TPPI is transcribed as a single polypeptide of molecular mass 61 kDa that is proteolytically cleaved and posttranslationally modiﬁed to the mature single-polypeptide, 46-kDa enzyme (Junaid et al., 2000). The mature protein has ﬁve N-glycosylation sites, and all are probably glycosylated. The enzyme cleaves tripeptide from amino-termini of peptides that bear free ␣-amino groups (Junaid et al., 2000; Vines and Warburton, 1998). It was claimed that the rat spleen TPPI also possesses a carboxypeptidase activity against angiotensin II (Vines and Warburton, 1998). In contrast, the CLN2p puriﬁed from bovine or human brain was absolutely free of any carboxypeptidase activity (Junaid et al., 2000). Moreover, unlike the TPPI, the CLN2p cleave tripeptides sequentially only upon prolonged incubation (Junaid and Pullarkat, unpublished). Under in vitro conditions, CLN2p proteolytically cleave naturally occurring neuropeptides such as angiotensin II, substance P and ␤-amyloid (Junaid et al., 2000). The signiﬁcance of CLN2p/TPPI activity against ␤-amyloid is presently unclear, since, in Alzheimer disease patients, the activity of this proteinase is found to be significantly elevated in brain (Junaid and Pullarkat, 1999). The puriﬁed CLN2p has a broad substrate speciﬁcity under in vitro conditions and cleave peptide bonds adjacent to neutral, acidic, and basic residues. The crucial natural substrate for CLN2p still remains to be identiﬁed. A highly speciﬁc biochemical diagnostic test for CLN2 based on the measurement of CLN2p/TPPI activity in patients and heterozygous carriers has been described (Junaid et al., 1999). This test is based on the CLN2p/TPPI activity against a synthetic tetrapeptide linked to 7-amino-4-(triﬂuoromethyl)coumarin. The diagnostic assay can be performed in leukocytes prepared from heparinized blood samples (Table 4.2). There is no detectable CLN2p/TPPI activity in red blood corpuscles. Two other assays for CLN2p/TPPI for the diagnosis of CLN2 have also been described (Sohar et al., 1999; Vines and Warburton, 1999), but these assays detect residual peptidase activities in CLN2 patients.

98

M. A. Junaid and R. K. Pullarkat Table 4.2. CLN2p/TPPI Activity in Human Blood

Number RBC Leukocytes Normal controls CLN2 patients Obligate heterozygotes

CLN2p/TPPI activitya nmol/h/mg protein

Range

Not detected 11 10 38

1947 ± 153 Not detected 1002 ± 220

1633–2107 442–1287

a

Enzyme activity is expressed as average mean ±SD.

While CLN2p/TPPI is deﬁcient in CLN2, its activity is increased in several other neurodegenerative disorders (Junaid and Pullarkat, 1999). This increased CLN2p activity may result from inﬁltrating glial cells, since, all these neurodegenerative diseases result in neuronal loss followed by glial cell proliferation. In neurological conditions such as Krabbe disease or autism, where there is no evidence of any signiﬁcant neuronal loss, the CLN2p/TPPI activity remains unaffected.

C. CLN3 protein Despite rigorous attempts by a number of laboratories, the identity of the CLN3 protein remains elusive. The predicted translation product is a 483-residue protein with four N-glycosylation sites (International Batten Disease Consortium, 1995). The putative CLN3 protein was also shown to undergo phosphorylation both at serine and threonine residues (Michalewski et al., 1998). A prenylation motif exists at the C-terminus, and there is in vitro evidence for farnesylation of a cysteine residue at this motif (Pullarkat and Morris, 1997). Based on its hydrophobicity index, the CLN3 protein has been proposed to have six transmembrane segments (Janes et al., 1996). This model however, does not account for the prenylation motif, and the farnesylated C-terminus is also expected to be embedded in the cytoplasmic side of the membrane. The presence of a prenyl group in CLN3 protein may offer a unique situation whereby a transmembrane protein possesses a farnesyl membrane anchor. The absence of a good antibody is the main reason for lack of functional characterization of the CLN3 protein. Mostly, the antibodies for CLN3 protein were generated against short synthetic peptide sequences. These antibodies have provided conﬂicting results with regard to the molecular mass and cellular localization of the CLN3 protein. Antibodies generated against peptides comprising of either residues 4–19 and 242–258 showed the presence of 43-kDa protein in cells stably expressing the CLN3 protein (Jarvela et al., 1998, 1999).

4. Biochemistry of NCL

99

Based on the open reading frame of the cln3 gene, a molecular mass of 48 kDa is predicted without any post-translational modiﬁcations. There is no evidence where the truncation of the nascent CLN3 polypeptide is occurring in the expressed protein. The cellular localization of the CLN3 protein also remains disputed with claims of localization in lysosomes (Jarvela et al., 1998), Golgi bodies (Kremmidiotis et al., 1999), and mitochondria (Katz et al., 1997). These studies show the CLN3 protein as 43-kDa and 50-kDa proteins in transfected cells and mouse tissues, respectively. In primary neuronal cultures, the protein was found to be concentrated in the synaptic ends and growth cones. A yeast ortholog btn1 for the cln3 gene was found to be localized in vacuoles that are the equivalent of lysosomes (Croopnick et al., 1998). Functionally, in yeast the btn1 product was found to be nonessential for cell viability, mitochondrial function, or mitochondrial protein catabolism (Pearce and Sherman, 1997). It was, however, found to be associated with regulation of the lysosomal pH (Pearce et al., 1999b). Yeast lacking the btn1 gene were found to have an abnormally acidic vacuole, and this condition could be reversed by including chloroquine in the culture medium (Pearce et al., 1999a). Recently, two laboratories have reported the generation of knockout mice for CLN3 by targeted disruption of the orthologous gene (Mitchison et al., 1999; Katz et al., 1999). These mice accumulate autoﬂuorescent inclusion bodies in various cell types—a characteristic feature found in CLN3 patients. Loss of certain cortical interneurons as well as hypertrophy of hippocampal interneurons was clearly evident in the knockout mouse. In addition, higher CLN2p activity was observed in the mouse brain, consistent with that observed in autopsy brain samples of CLN3 patients. These knockout mice should greatly facilitate deciphering of the functional aspects of the CLN3 protein.

III. NCL ARE LYSOSOMAL STORAGE DISEASES NCL have long been considered as storage diseases because of the accumulation of autoﬂuorescent inclusion bodies in various cell types. Evidence is now emerging that implicate NCL as a group of lysosomal storage diseases. Characterization of the inclusion bodies have revealed it to be a complex mixture of lipids and proteins, and their composition varies in different forms of the disease.

A. Oligosaccharyl diphosphodolichol Lipids isolated from NCL brain samples were found to contain elevated levels of dolichol, which is also excreted in urine (Hall and Patrick, 1985; Wolfe et al., 1986). Several investigators have shown the storage of oligosaccharyl

100

M. A. Junaid and R. K. Pullarkat

diphosphodolichol (oligo-PP-dol) in brain tissues from patients (Pullarkat et al., 1988; Hall and Patrick, 1988). The increase in oligo-PP-dol was more pronounced in CLN2 and CLN3, while CLN1 showed only marginal change. The accumulating oligo-PP-dol contains di-N-acetylglucosamine residues attached to tetra- or penta-mannosyl moiety that in turn is phosphorylated (Hall and Patrick, 1988). The elevated dolichols appear to be secondary biochemical effects rather than a primary defect in NCL. Several other neurodegenerative diseases, such as Down syndrome, Alzheimer, Huntington, and Creutzfeld-Jacob, also display elevated urinary excretion of dolichols.

B. Subunit c of mitochondrial ATP synthase Initial extensive studies with ovine model for NCL and later with CLN2 have demonstrated that the major storage protein in these diseases is the highly hydrophobic subunit c of mitochondrial ATP synthase (Palmer et al., 1986, 1992). A speciﬁc delay in the degradation of subunit c due to cellular proteolytic dysfunction was shown in the ﬁbroblasts derived from CLN2 patients (Ezaki et al., 1996). A lysosomal pepstatin-insensitive proteinase (CLN2p) was later found to be the underlying genetic defect in CLN2 (Sleat et al., 1997). Synthetic amino-terminal peptide fragments from subunit c sequence are substrates for the CLN2p (Junaid et al., 2000). These peptide fragments can be proteolytically cleaved by ﬁbroblast extracts from normal subjects, while extracts from CLN2 patients lack this proteolytic activity. This clearly demonstrates that the accumulation of subunit c is the direct result of lack of CLN2p. It is unclear, however, why subunit c accumulates in other NCL forms such as CLN3 or mnd mouse, which has mutation in the gene orthologous for cln8, in spite of severalfold higher CLN2p activity being present (Junaid and Pullarkat, 1999). It is also interesting that subunit c accumulates in other unrelated lysosomal diseases such as mucopolysaccharidoses type I-III, mucolipidosis type I, GM1 and GM2 gangliosidoses, and Niemann-Pick disease types A and C (Elleder et al., 1997). Thus the signiﬁcance of subunit c in the pathophysiology of NCL is unclear. While CLN2p cleaves synthetic amino-terminal peptides of varying lengths from subunit c sequence, the native peptide isolated from CLN2 patients could not be hydrolyzed. On the other hand, puriﬁed CLN2p can cleave puriﬁed subunit c from bovine brain. It is possible that the accumulated subunit c in CLN2 patients undergo secondary modiﬁcation near the N-terminal, thereby becoming inaccessible for CLN2p proteolysis. We have observed that CLN2p cleaves only those peptides that have free amino-terminal residue, whereas peptides with blocked amino groups of the N-terminal residue are not substrates. There are reports of ⑀-N-trimethylation of the lysine43 of subunit c in canine NCL model (Katz et al., 1994). However, such a modiﬁcation so far from the proteinase cleavage site is not expected to exert any effect.

4. Biochemistry of NCL

101

C. Mannose 6-phosphorylated glycoproteins The posttranslational modiﬁcation in the form of mannose 6-phosphate is generated on newly synthesized lysosomal proteins (Kornfeld, 1987). It serves as a recognition signal for mannose 6-phosphate receptors of proteins that are destined for lysosomes, wherein the recognition signal is believed to be enzymatically removed. Initially, the levels of a 46-kDa glycoprotein was found to be drastically elevated in CLN3, while at the same time it was missing in CLN2 (Pullarkat and Zawitosky, 1993). This 46-kDa protein was later identiﬁed as the deﬁcient mannose 6-phosphorylated CLN2p that resulted from the underlying genetic defect in this disease. In CLN3, the overall levels of all mannose 6-phosphorylated proteins are drastically elevated, while in CLN4, two of these proteins are increased (Sleat et al., 1998). The activities of various lysosomal enzymes, including CLN2p, were also found to be elevated in CLN3, but the increase in CLN2p was not proportional to the increase in the mannose 6-phosphorylated form. It was found that at least mannose 6-phosphorylated form of CLN2p is enzymatically inactive (Junaid and Pullarkat, 1999). This might be necessary for a proteinase to remain in an inactive form while it is being transported to its destination.

D. Sphingolipid activator proteins (saposins) Saposins are small-molecular-mass, heat-stable lysosomal proteins that originate from a single precursor molecule that cleaves into four different peptides. These proteins activate lysosomal hydrolases involved in the degradation of sphingolipids. The major storage materials in the CLN1 are two of the saposins A and D (Tyynela et al., 1993). Accumulation of these two proteins seems to be an indirect effect, since saposins accumulation have also been demonstrated in CLN3, Gaucher, Niemann-Pick types A and B, fucosidosis, Tay-Sachs, and infantile Sandhoff diseases. Thus, the signiﬁcance of saposins accumulation in NCL is unclear.

IV. REMAINING ISSUES AND FUTURE DIRECTIONS The remarkable progress in the past few years in identifying the genetic defects in seven of eight forms of NCL is indeed a success story. Since accumulation of autoﬂuorescent inclusion bodies in lysosomes is the pathological hallmark of NCL, it is tempting to speculate that these group of disorders may have common metabolic aberrations. Chemical analyses of the isolated inclusion bodies have demonstrated the heterogeneous nature of the compounds among different forms of NCL. Also, the identity of compound(s) causing autoﬂuorescence is still unknown. Neuronal

102

M. A. Junaid and R. K. Pullarkat

death followed by gliosis is another common feature of NCL. What causes the neuronal and retinal cell degeneration in NCL needs to be addressed. The selective neuronal and retinal loss most likely results from accumulation of speciﬁc factors that may be peptides. The fact that the symptoms manifest several years after birth, as evident in CLN3 and CLN4, implies that accumulation of these factors above certain threshold levels are necessary to elicit the toxicity. It is possible that materials accumulating in lysosomes due to deﬁciencies of speciﬁc proteins are spilled out into the extracellular milieu and cause cytotoxicity. In lysosomal storage diseases it is not uncommon to detect storage materials in urine (Wisniewski et al., 1995) and cerebrospinal ﬂuid (Pullarkat et al., 1981). Identiﬁcation of these cellular degenerative factors and their pharmacological depletion will certainly help in designing rationale therapeutic intervention for these devastating diseases. A protease deﬁciency as the underlying defect in CLN2 is clearly established. Are other forms of NCL also caused by protease deﬁciency? PPTI is involved in the hydrolysis of fatty acyl thioesters. It may also be possible that PPTI itself has proteolytic activity, since a number of esterases and thioesterases also possess protease activity (Crews et al., 1996; Cho and Cronan, 1994). This may be the reason why saposins constitute the major portion of the accumulated inclusion bodies in CLN1. The CLN2p/TPPI is a peptidase most likely involved in the degradation of subunit c, but it is less likely that the neurodegeneration is related to the accumulating subunit c. It is also unlikely that cells synthesize one proteinase to degrade only one peptide/protein. Thus, other peptides or proteins that are natural substrates of the CLN2p/TPPI remain to be identiﬁed. Marked storage of mannose 6-phosphorylated glycoproteins in CLN3 suggest that the CLN3 protein may be a phosphatase involved in the removal of phosphate groups from lysosomally targeted mannose 6-phosphorylated proteins. Similar to the glucose 6-phosphatase system, the CLN3 protein as a membrane-bound entity may possess multifunctional activities involved in the transport of lysosomal proteins into the organelle as well as dephosphorylation of the mannose 6-phosphate moiety. So far, the identity of the phosphatase involved in dephosphorylation of mannose 6-phosphate moiety from lysosomally targeted glycoproteins has remained elusive despite extensive search (Bresciani and von Figura, 1996; Bresciani et al., 1992). Also, contrary to expectation, activities of certain abnormal acid phosphatases are elevated in CLN3 (Faisal Khan et al., 1995). There is no evidence of any genetic redundancy in CLN3 that could account for elevated acid phosphatase activity. A situation similar to the lack of activity of mannose 6-phosphorylated form of CLN2 may also be possible in CLN3, where another lysosomal proteinase remains inactive due to lack of dephosphorylation. In this context it is interesting to mention that urine samples from CLN3 patients were found to contain signiﬁcant amounts of low-molecular-mass peptides (LaBadie and Pullarkat, 1990).

4. Biochemistry of NCL

103

Acknowledgments Supported in part by a grant from the National Institutes of Health (NS 30147) and funds from New York State Ofﬁce of Mental Retardation and Developmental Disabilities.

References Berkovic, S. F., Carpenter, S., Andermann, F., Andermann, E., and Wolfe, L. S. (1988). Kufs disease: A critical reappraisal. Brain 111, 27–67. Boehme, D. H., Cottrell, J. C., Leonberg, S. C., and Zeman, W. (1971). A dominant form of neuronal ceroid lipofuscinosis. Brain 94, 745–760. Boustany, R.-M. (1996). Neurodystrophies and neurolipidoses. In “Handbook of Clinical Neurology” (H. W. Moser, ed.), Vol. 22 (66), pp. 671–700. Elsevier Science, Amsterdam, The Netherlands. Bresciani, R., and von Figura, K. (1996). Dephosphorylation of the mannose-6-phosphate recognition marker is localized in late compartments of the endocytic route: Identiﬁcation of purple acid phosphate (uteroferrin) as the candidate phosphatase. Eur. J. Biochem. 238, 669–674. Bresciani, R., Peters, C., and von Figura, K. (1992). Lysosomal acid phosphatase is not involved in the dephosphorylation of mannose 6-phosphate containing lysosomal proteins. Eur. J. Cell Biol. 58, 57–61. Camp, L. A., and Hoffman, S. L. (1993). Puriﬁcation and properties of a palmitoyl protein thioesterase that cleaves palmitate from H-Ras. J. Biol. Chem. 268, 22566–22574. Cho, H., and Cronan, J. E. (1994). Protease I of Escherichia coli functions as a thioesterase in vivo. J. Bacteriol. 176, 1793–1795. Cho, S., and Dawson, G. (1998). Enzymatic and molecular biological analysis of palmitoyl protein thioesterase deﬁciency in infantile neuronal ceroid lipofuscinosis. J. Neurochem. 71, 323– 329. Crews, C. M., Lane, W. S., and Schreiber, S. L. (1996). Didemnin binds to the protein palmitoyl thioesterase responsible for infantile neuronal ceroid lipofuscinosis. Proc. Natl. Acad. Sci. U.S.A. 93, 4316–4319. Croopnick, J. B., Choi, H. C., and Mueller, D. M. (1998). The subcellular location of the yeast Saccharomyces cerevisiae homologue of the protein defective in the juvenile form of Batten disease. Biochem. Biophys. Res. Commun. 250, 335–341. Dom, R., Brucher, J. M., Ceuterick, C., Carlton, H., and Martin, J. J. (1979). Adult ceroid lipofuscinosis (Kufs disease) in two brothers: Retinal and visceral storage in one; diagnostic muscle biopsy in the other. Acta Neuropathol. 45, 67–72. Elleder, M., Sokolova, J., and Hrebicek, M. (1997). Follow-up study of subunit c of mitochondrial ATP synthase (SCMAS) in Batten disease and in unrelated lysosomal disorders. Acta Neuropathol. 93, 379–390. Ezaki, J., Wolfe, L. S., and Kominami, E. (1996). Speciﬁc delay in the degradation of mitochondrial ATP synthase subunit c in late infantile neuronal ceroid lipofuscinosis is derived from cellular proteolytic dysfunction rather than structural alteration of subunit c. J. Neurochem. 67, 1677– 1687. Faisal Khan, K. M., Sklower Brooks, S., and Pullarkat, R. K. (1995). Abnormal acid phosphatases in neuronal ceroid-lipofuscinoses. Am. J. Med. Genet. 57, 285–289. Hall, N. A., and Patrick, A. D. (1985). Dolichol and phosphorylated dolichol content of tissues in ceroid-lipofuscinosis. J. Inher. Metab. Dis. 8, 178–183. Hall, N. A., and Patrick, A. D. (1988). Accumulation of dolichol-linked oligosaccharides in ceroidlipofuscinosis (Batten disease). Am. J. Med. Genet. Suppl. 5, 221–232. Hellsten, E., Vesa, J., Olkkonen, V. M., Jalanko, A., and Peltonen, L. (1996). Human palmitoyl

104

M. A. Junaid and R. K. Pullarkat

protein thioesterase: Evidence for lysosomal targeting of the enzyme and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. EMBO J. 15, 5240–5245. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949–957. Janes, R. W., Munroe, P. B., Mitchison, H. M., Gardiner, R. M., Mole, S. E., and Wallace, B. A. (1996). A model for Batten disease protein CLN3: Functional implications from homology and mutations. FEBS Lett. 399, 75–77. Jarvela, I., Sainio, M., Rantamaki, T., Olkkonen, V. M., Carpen, O., Peltonen, L., and Jalanko, A. (1998). Biosynthesis and intracellular targeting of the CLN3 protein defective in Batten disease. Hum. Mol. Genet. 7, 85–90. Jarvela, I., Lehtovirta, M., Tikkanen, R., Kyttala, A., and Jalanko, A. (1999). Defective intracellular transport of CLN3 is the molecular basis of Batten disease (JNCL). Hum. Mol. Genet. 8, 1091– 1098. Junaid, M. A., and Pullarkat, R. K. (1999). Increased brain lysosomal pepstatin-insensitive proteinase activity in patients with neurodegenerative diseases. Neurosci. Lett. 264, 157–160. Junaid, M. A., Sklower Brooks, S., Wisniewski, K. E., and Pullarkat, R. K. (1999). A novel assay for lysosomal pepstatin-insensitive proteinase and its application for the diagnosis of late-infantile neuronal ceroid lipofuscinosis. Clin. Chim. Acta 281, 169–176. Junaid, M. A., Wu, G., and Pullarkat, R. K. (2000). Puriﬁcation and characterization of bovine brain lysosomal pepstatin-insensitive proteinase, the gene product deﬁcient in the human late-infantile neuronal ceroid lipofuscinosis. J. Neurochem. 74, 287–294. Katz, M. L., Christianson, J. S., Norbury, N. E., Gao, C.-L., Siakotos, A. N., and Koppang, N. (1994). Lysine methylation of mitochondrial ATP synthase subunit c stored in tissues of dogs with hereditary ceroid lipofuscinosis. J. Biol. Chem. 269, 9906–9911. Katz, M. L., Gao, C.-L., Prabhakaram, M., Shibuya, H., Liu, P.-C., and Johnson, G. S. (1997). Immunochemical localization of the Batten disease (CLN3) protein in retina. Invest. Opthalmol. Vis. Sci. 38, 2375–2386. Katz, M. L., Shibuya, H., Liu, P.-C., Kaur, S., Gao, C.-L., and Johnson, G. S. (1999). A mouse gene knockout model for juvenile ceroid-lipofuscinosis (Batten disease). J. Neurosci. Res. 57, 551– 556. Kornfeld, S. (1987). The trafﬁcking of lysosomal enzymes. FASEB J. 1, 462–468. Kremmidiotis, G., Lensink, I. L., Bilton, R. L., Woollatt, E., Chataway, T. K., Sutherland, G. R., and Callen, D. F. (1999). The Batten disease gene product (CLN3p) is a golgi integral membrane protein. Hum. Mol. Genet. 8, 523–531. LaBadie, G. U., and Pullarkat, R. K. (1990). Low molecular weight urinary peptides in ceroid lipofuscinoses: Potential biochemical markers for the juvenile subtype. Am. J. Med. Genet. 37, 592– 599. Lu, J.-Y., Verkruyse, L. A., and Hofmann, S. L. (1996). Lipid thioesters derived from acylated proteins accumulate in infantile ceroid lipofuscinosis: Correction of the defect in lymphoblasts by recombinant palmitoyl-protein thioesterase. Proc. Natl. Acad. Sci. (USA) 93, 1046–1050. Michalewski, M. P., Kaczmarski, W., Golabek, A. A., Kida, E., Kaczmarski, A., and Wisniewski, K. E. (1998). Evidence for phosphorylation of CLN3 protein associated with Batten disease. Biochem. Biophys. Res. Commun. 253, 458–462. Mitchison, H. M., Bernard, D. J., Greene, N. D. E., Cooper, J. D., Junaid, M. A., Pullarkat, R. K., de Vos, N., Breuning, M. H., Owens, J. W., Mobley, W. C., Gardiner, R. M., Lake, B. D., Taschner, P. E. M., and Nussbaum, R. L. (1999). Targeted disruption of the cln3 gene provides a mouse model for batten disease. Neurobiol. Dis. 6, 321–334. Palmer, D. N., Barns, G., Husbands, D. R., and Jolly, R. D. (1986). Ceroid lipofuscinosis in sheep: II. The major component of the lipopigment in liver, kidney, pancreas, and brain is low molecular weight protein. J. Biol. Chem. 261, 1773–1777.

4. Biochemistry of NCL

105

Palmer, D. N., Fearnley, I. M., Walker, J. E., Hall, N. A., Lake, B. D., Wolfe, L. S., Haltia, M., Martinus, R. D., and Jolly, R. D. (1992). Mitochondrial ATP synthase subunit c storage in the ceroid-lipofuscinoses (Batten disease). Am. J. Med. Genet. 42, 561–567. Pearce, D. A., and Sherman, F. (1997). BTN1, a yeast gene corresponding to the human gene responsible for Batten’s disease, is not essential for viability, mitochondrial function, or degradation of mitochondrial ATP synthase. Yeast 13, 691–697. Pearce, D. A., Carr, C. J., Das, B., and Sherman, F. (1999a). Phenotypic reversal of the btn1 defects in yeast by chloroquine: A yeast model for Batten disease. Proc. Natl. Acad. Sci. (USA) 96, 11341– 11345. Pearce, D. A., Ferea, T., Nosel, S. A., Das, B., and Sherman, F. (1999b). Action of BTN1, the yeast orthologue of the gene mutated in Batten disease. Nat. Genet. 22, 55–58. Pullarkat, R. K., and Morris, G. N. (1997). Farnesylation of Batten disease CLN3 protein. Neuropediatrics 28, 42–44. Pullarkat, R. K., and Zawitosky, S. E. (1993). Glycoconjugate abnormalities in the ceroidlipofuscinoses. J. Inher. Metab. Dis. 16, 317–322. Pullarkat, R. K., Reha, H., and Beratis, N. G. (1981). Accumulation of ganglioside GM2 in cerebrospinal ﬂuid of a patient with the variant AB of infantile GM2 gangliosidosis. Pediatrics 68, 106–108. Pullarkat, R. K., Kim, K. S., Sklower, S. L., and Patel, V. K. (1988). Oligosaccharyl diphosphodolichols in the ceroid-lipofuscinoses. Am. J. Med. Genet. Suppl. 5, 243–251. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M., de, F., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A.-E. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Rawlings, N. D., and Barrett, A. J. (1999). Tripeptidyl-peptidase I is apparently the CLN2 protein absent in classical late-infantile neuronal ceroid lipofuscinosis. Biochem. Biophys. Acta 1429, 496– 500. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukowski, M., Jarvela, I. E., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late infantile neuronal ceroid lipofuscinoses map to chromosome 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591–596. Sleat, D. E., Donnelly, R. J., Lackland, H., Liu, C.-G., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Sleat, D. E., Sohar, I., Pullarkat, P. S., Lobel, P., and Pullarkat, R. K. (1998). Speciﬁc alterations in levels of mannose 6-phosphorylated glycoproteins in different neuronal ceroid lipofuscinoses. Biochem. J. 334, 547–551. Sohar, I., Sleat, D. E., Jadot, M., and Lobel, P. (1999). Biochemical characterization of a lysosomal protease deﬁcient in classical late infantile neuronal ceroid lipofuscinosis (LINCL) and development of an enzyme-based assay for diagnosis and exclusion of LINCL in human specimens and animal models. J. Neurochem. 73, 700–711. Tyynela, J., Palmer, D. N., Baumann, M., and Haltia, M. (1993). Storage of saposins A and D in infantile neuronal ceroid-lipofuscinosis. Fed. Eur. Biochem. Soc. 330, 8–12. van Diggelen, O. P., Keulemans, J. L. M., Winchester, B., Hofman, I. L., Vanhanen, S. L., Santavuori, P., and Voznyi, Y. V. (1999). A rapid ﬂuorogenic palmitoyl-protein thioesterase assay: Pre- and postnatal diagnosis of INCL. Mol. Genet. Metab. 66, 240–244. Verkruyse, L. A., and Hofmann, S. L. (1996). Lysosomal targeting of palmitoyl-protein thioesterase. J. Biol. Chem. 271, 15831–15836.

106

M. A. Junaid and R. K. Pullarkat

Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Vines, D. J., and Warburton, M. J. (1998). Puriﬁcation and characterization of a tripeptidyl aminopeptidase I from rat spleen. Biochim. Biophys. Acta 1384, 233–242. Vines, D. J., and Warburton, M. J. (1999). Classical late infantile neuronal ceroid lipofuscinosis ﬁbroblasts are deﬁcient in lysosomal tripeptidyl peptidase I. FEBS Lett. 443, 131–135. Wheeler, R. B., Sharp, J. D., Mitchell, W. A., Bate, S. L., Williams, R. E., Lake, B. D., and Gardiner, R. M. (1999). A new locus for variant late infantile neuronal ceroid lipofuscinosis—CLN7. Mol. Genet. Metab. 66, 337–338. Wisniewski, K. E., Kaczmarski, W., Golabek, A. A., and Kida, E. (1995). Rapid detection of subunit c of mitochondrial ATP synthase in urine as a diagnostic screening method for neuronal ceroidlipofuscinoses. Am. J. Med. Genet 57, 246–249. Wolfe, L. S., Palo, J., Santavuori, P., Andermann, F., Andermann, E., Jacob, J. C., and Kolodny, E. (1986). Urinary sediment dolichols in the diagnosis of neuronal ceroid-lipofuscinosis. Ann. Neurol. 19, 270–274. Zeman, W., Donahue, S., Dyken, P., and Green, J. (1970). Leukodystrophies and poliodystrophies. In “Handbook of Clinical Neurology” (P. J. Vinken, and G. W. Bruyn, eds.), Vol. 10, pp. 588–679. Elsevier Science Amsterdam, The Netherlands.

5

Positional Cloning of the JNCL Gene, CLN3 Terry J. Lerner∗ Molecular Neurogenetics Unit Massachusetts General Hospital Charlestown, Massachusetts 02129 and Department of Neurology Harvard Medical School Boston, Massachusetts 02114

I. II. III. IV. V. VI. VII. VIII. IX. X. XI.

Introduction CLN3 Maps to Chromosome 16 A Subunit 9 Gene Is Not CLN3 Reﬁned Localization of CLN3 Physical Mapping of the CLN3 Candidate Region Exon Trapping Yields a Candidate cDNA The Common Mutation in JNCL is a 1-kb Genomic Deletion Mutational Analysis of the CLN3 Gene Tissue Expression of CLN3 CLN3 Encodes a Novel Protein Animal Models of JNCL References

I. INTRODUCTION Juvenile neuronal ceroid lipofuscinosis (CLN3, JNCL, Batten or SpielmeyerVogt-Sjogren disease, MIM304200) is the most common neurodegenerative disorder of childhood. Inheritance of the disease is autosomal recessive. Its incidence * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

107

108

T. J. Lerner

is estimated at 1–5/100,00 births (Zeman, 1974), with an increased prevalence in the northern European population. Onset begins with visual failure between the ages of 5 and 10 years. Seizures and mental deterioration manifest several years later, leading to death in the second or third decade. There is no cure for JNCL. Treatment is largely symptomatic. Diagnostic criteria of JNCL include neurological studies (electroencephalograms, visual-evoked responses, and electroretinograms); magnetic resonance imaging (MRI); elevated urinary dolichol levels; and electron microscopic examination of lymphocytes and skin, conjunctiva, or rectal tissues. Peripheral blood lymphocytes appear vacuolated. Deep skin and rectal biopsies show striking deposits of a PAS-positive, sudanophilic, autoﬂuorescent storage material. These inclusions are ﬁlled with membranes that appear as “ﬁngerprint proﬁles” on electron microscopy (Santavuori, 1988; Wisniewski et al., 1988). With the isolation and characterization of the JNCL gene CLN3 in 1995 (International Batten Disease Consortium, 1995), direct, reliable DNA diagnosis of JNCL has became possible for the majority of patients (see Sections VII and VIII). In 1993, the International Batten Disease Consortium was founded to accelerate the search for CLN3. Members included the laboratories of Dr. Terry Lerner (Massachusetts General Hospital), Dr. R. Mark Gardiner (University College London Medical School), Dr. Martijn Beuning (Leiden University), Dr. David Callen (Adelaide Women’s and Children’s Hospital), and Dr. Norman Doggett (Los Alamos National Laboratory). As a result of this collaboration, researchers in each laboratory gained access to an international patient resource, detailed genetic maps based on highly informative microsatellite markers, extensive genome-wide and chromosome-speciﬁc physical maps, and the most efﬁcient tools for isolating genes.

II. CLN3 MAPS TO CHROMOSOME 16 Eiberg (1989) ﬁrst mapped the JNCL locus CLN3 to chromosome 16. Linkage was conﬁrmed with the classical protein marker haptoglobin on the long arm of the chromosome (16q22) with a LOD score of 3 at = .00 in males and = .26 in females. Subsequent multipoint analysis with DNA RFLP markers conﬁrmed linkage to the chromosome and mapped the gene to a 15-cM region, ﬂanked by D16S150 and D16S148 and spanning the centromere (Gardiner et al., 1990). In a later study, the same laboratory reported a new localization of the gene in a 2.3-cM region between D16S148 and D16S67, outside of the original locus and on the short arm (p) of the chromosome (Callen et al., 1991). Using the marker D16S285 (Konradi et al., 1991), Yan et al. (1993) showed that CLN3 does not localize to this region in the U.S. collection of JNCL families and mapped the gene back to the original candidate region between D16S148 and D16S150.

5. Positional Cloning of CLN3

109

III. A SUBUNIT 9 GENE IS NOT CLN3 Palmer (1992) demonstrated the abnormal accumulation of the proteolipid subunit 9 in the inclusions found in both JNCL and LINCL, where it accounts for 19% and 85% of the protein mass, respectively. This protein is a normal component of H+-ATP synthase, a multisubunit ATP-generating enzyme at the end of the mitochondrial respiratory chain. Subunit 9 transports protons across the inner mitochondrial membrane (Sebald and Hoppe, 1981). In many genetic human diseases involving the accumulation of an insouble protein, cloning of the gene for that protein has led directly to the genetic defect. Experiments mapping the subunit 9 genes P1 and P2 to chromosomes 17 and 12, respectively, excluded these genes as the site of CLN3 (Dyer and Walker, 1993). Yan et al. (1994) discovered a previously unreported subunit 9 gene, P3, and demonstrated the mapping of this gene to chromosome 2, also excluding it as the JNCL gene.

IV. REFINED LOCALIZATION OF CLN3 Reﬁned localization of CLN3 only became possible with the advent of highly polymorphic microsatellite markers. Linkage studies by two independent laboratories (Mitchison et al., 1993; Lerner et al., 1994) yielded signiﬁcant evidence for strong allelic association (linkage disequilibrium) between CLN3 and the microsatellite markers at D16S288 (Shen et al., 1991), D16S298 and D16S299 (Thompson et al., 1992), and also the RFLP marker D16S272 (Lerner et al.,1992, 1994). The ﬁnding of linkage disequilibrium between JNCL and the markers in this region is consistent with a founder effect in the disease. A collaborative study was initiated to analyze the pooled family resource of these two laboratories with the goal of ﬁne-mapping the gene (Mitchison et al., 1994). One hundred forty-two JNCL families with a total of 200 affected and 161 unaffected siblings and originating from 16 different countries were included. Five markers, D16S288, D16S299, D16S298, SPN (Rogaev and Keryanov, 1992), and D16S383 (Shen et al., 1993), were typed in all families. Crossover events were observed for both D16S288 and D16S383, deﬁning new ﬂanking markers (Figure 5.1). No crossover events were observed between the gene and D16S298, D16S299, and SPN. These results localize the gene to a 2.1-cM (sex-averaged) interval on 16p12.1-p11.1 between the markers D16S288 and D16S383. Within the D16S288-D16S383 interval, four microsatellite markers (D16S288, D16S299, D16S298, and SPN) are in strong disequilibrium with CLN3 (Table 5.1). A high-risk haplotype is deﬁned based on the 7 allele (142 bp) at D16S288, the 5 allele (118 bp) at D16S299, the 6 allele (180 bp) at D16S298,

110

T. J. Lerner

Figure 5.1. A genetic map of human chromosome 16, showing the DNA markers used in the reﬁned localization of the JNCL gene CLN3. Distances are in centimorgans.

and the 1 allele (251 bp) at SPN. The “7561” haplotype is found on 28% of disease chromosomes and none of the normal chromosomes. A core haplotype with the 5 allele at D16S299 and the 6 allele at D16S298 is greatly enriched, present on 73% of the disease chromosomes and on only 3% of the control nondisease chromosomes. Recombination between these two markers is rare. The haplotype 75** is never found without the associated 6 allele at D16S298 on the disease chromosome, whereas the haplotype **61 is present on 7% of disease chromosomes and 8% of control chromosomes. These results, taken together, indicate that ancient recombinations between D16S299 and D16S288 and between D16S298 and SPN appear to have been relatively frequent, while

111

5. Positional Cloning of CLN3 Table 5.1. Distribution of Haplotype Frequencies on Disease and Control Chromosomes Disease chromosomes

Haplotype S288

S299

S298

SPN

7 5 6 * 5 6 7 5 6 * 5 6 * * 6 7 5 * Other disease haplotypes Other control haplotypes Total

1 1 * * 1 *

Control chromosomes

No.

Frequency

No.

Frequency

72 68 29 22 17 0 52 0 —– 260

0.28 0.26 0.11 0.08 0.07 0.00 0.20 0.00 —— 1.00

0 2 0 5 22 3 14 228 —– 274

0.00 0.01 0.00 0.02 0.08 0.01 0.05 0.83 —— 1.00

recombination events between D16S299 and D16S298 have been rare. These results strongly suggest that CLN3 lies closest to D16S299 and D16S298. This conclusion is further supported by genetic studies of the isolated Finnish population (Mitchison et al., 1995). The 6 allele at D16S298 is present on 96% of Finnish JNCL chromosomes. Estimates using the Luria-Delbruck equation predict that CLN3 lies 8.8 kb (range 6.3–13.8) from D16S298 and 165.4 kb (range 132.4–218.1 kb) from D16S299. Thus, it is likely that the major mutation found in Finland is the same as that found in other European countries and the United States. In addition, two patients were identiﬁed who have deletions of the D16S298 locus. One patient, who is of Moroccan origin and from a consanguineous relationship, is homozygous for the null allele at D16S298 (Taschner et al., 1995). The extent of the deletion in this patient was estimated by PCR and hybridization analysis to be ∼29 kb, with 5 kb distal to and ∼24 kb proximal to the D16S298 locus. A second patient from Finland was found to be hemizygous for D16S298 (International Batten Disease Consortium, 1995). These independent ﬁndings support the linkage disequilibrium mapping results deﬁning D16S298 as the marker closest CLN3.

V. PHYSICAL MAPPING OF THE CLN3 CANDIDATE REGION In parallel to efforts to reﬁne the genetic locus of CLN3, a physical map consisting of yeast artiﬁcial chromosomes (YACs) and cosmid contigs was generated to span the candidate region (Jarvela et al., 1996). Oligonucleotide primers at each CLN3related locus were used to screen the CEPH YAC libraries (Albertson et al., 1990; Cohen et al., 1993) and a ﬂow-sorted chromosome 16 YAC library (McCormick

112

T. J. Lerner

et al., 1993). The resultant map consists of 72 YACs and encompasses the closest ﬂanking markers (D16S288 and D16S383), including both D16S299 and D16S298. The map was ordered using 42 sequence-tagged sites (STS): tel-D16S297IL4R-D16S288-D16S272-D16S299-D16S298-D16S48-SPN/D16S383. The YAC clones, which had been selected with primers for the D16S298 locus, proved unstable, when sized by pulsed ﬁeld gel electrophoresis and analyzed for STS content. Therefore, chromosome walking was initiated in the Los Alamos ﬂow-sorted chromosome 16 cosmid library (Stallings et al., 1992) and a total human genomic cosmid library (Blonden et al., 1989) to obtain a cosmid contig mapping to the deletion in the Moroccan patient. The walk, starting from the D16S48 locus in Los Alamos contig c343.1 and proceeding toward the D16S299 locus, yielded a 185-kb contig cNL/343.1 (Taschner et al., 1995). Cosmid NL11A, the most distal clone in the contig, was found to contain the D16S298 locus and to encompass the region deleted in the Moroccan patient (Figure 5.2).

Figure 5.2. A physical map of the CLN3 candidate region (International Batten Disease Consortium, 1995). The positions of selected DNA markers used for linkage and haplotype analyses are indicated. Individual cosmids NL11A and NL60D3 of cosmid contig CNL/343.1, which contains D16S298 and D16S48, and cosmid contig C182, which contains D16S299 are shown. Three yeast artiﬁcial chromosomes (Cy21B11, Cy30G12, and Cy85D3) that form part of a 980-kb contig spanning the candidate region are indicated by horizontal lines. PstI restriction fragments of NL11A that could be ordered are shown. The genomic extent of cDNA2-3 is shown below the map, with the arrow indicating the direction of transcription. (This ﬁgure has been reproduced with the permission of Cell Press.)

5. Positional Cloning of CLN3

113

VI. EXON TRAPPING YIELDS A CANDIDATE cDNA Cosmid clone NL11A, the most likely site of the JNCL gene CLN3, was selected for exon trapping for the isolation of candidate JNCL gene transcripts. Exon ampliﬁcation was carried out using the pSPL3 vector and PstI-digested NL11A target DNA (Church et al., 1994; Lerner et al., 1995). A 18-bp exon was isolated and used to screen a commercial fetal brain cDNA library (Stratagene), yielding a 1.7-kb cDNA (clone 2-3). Mapping studies showed that clone 2-3 is contained in its entirety within cosmid NL11A, spans the D16S298 locus, and overlaps the deletion found in the Moroccan patient, thus making it an optimal candidate for CLN3.

VII. THE COMMON MUTATION IN JNCL IS A 1-kb GENOMIC DELETION To screen for possible genomic alterations associated with the cDNA2-3 gene, Southern blots of PstI-digested DNA from unrelated JNCL patients were scanned by hybridization with a probe, representing either the 5 or the 3 half of the cDNA (Figure 5.3A). When the 5 probe was used, patients homozygous for the D16S299/D16S298 “56” haplotype (lanes 1–3) displayed the loss of a 3.8-kb PstI fragment, also present in controls (lane 4), and gained a novel 2.8-kb fragment. Patients heterozygous for the D16S299/D16S298 “56” haplotype displayed both 3.8- and 2.8-kb bands (lane 5). The restriction patterns were also altered in patients with the “56” haplotype when several other enzymes were tested, supporting the hypothesis of a genomic deletion present on the “56” chromosome. Figure 5.3B demonstrates the Mendelian inheritance of this deletion in a family with an affected child homozygous for the “56” haplotype. To determine the effect of this genomic deletion on the cDNA transcript, PCR ampliﬁcation of RT-cDNA from patients homozygous for the “56” chromosome haplotype was carried out. Sequence analysis of the rt-PCR products revealed the loss of 217 bp of internal coding sequence from the full-length control cDNA (see Section X). This deletion causes a frameshift, generating a novel termination codon 84 bp downstream of the deletion junction. The predicted product is a truncated protein of 181 amino acids, compared to 438 amino acids in the control. Further testing conﬁrmed the 1-kb genomic deletion of the clone 2-3 gene associated with the D16S299/D16S298 “56” haplotype as the most common mutation in JNCL, accounting for at least 81% of disease chromosomes. Eightyone unrelated JNCL patients representing 24 haplotypes and originating from 16 countries were screened for the presence of the 1-kb deletion (Table 5.2). Of these patients, 46 were homozygous for the “56” haplotype, 24 were heterozygous for

114

T. J. Lerner

Figure 5.3. (a) Southern blot analysis of cDNA2-3 in JNCL patients (International Batten Disease Consortium, 1995). Genomic DNA was digested with PstI, fractionated by agarose gel electrophoresis, and transferred to nylon membrane. Lanes 1–3, patients homozygous for the “56” alleles; lane 4, unaffected control; lane 5, patient heterozygous for the “56” alleles. The left panel was probed with a radiolabeled PCR fragment corresponding to the 5 half of cDNA2-3. The right panel was probed with a radiolabeled PCR fragment corresponding to the 3 half of cDNA2-3. (b) Southern blot analysis of cDNA2-3 in a family with an affected child homozygous for the “56” haplotype. Southern blots were prepared as above and hybridized with the 5 probe. The affected child is shown by the closed symbol and the carriers by the half- closed symbols. Progeny are shown by diamonds, and the birth order of some individuals has been changed to protect conﬁdentiality. The chromosomes segregating in this pedigree have been distinguished by extensive typing with markers mapping to the candidate region (Lerner et al., 1994). (This ﬁgure has been reproduced with the permission of Cell Press.)

the “56” haplotype, and 11 did not carry the “56” haplotype on either chromosome. In all 70 patients with an affected “56” chromosome, the deleted fragment was detected and in all 46 homozygotes for this haplotype, only the deleted fragment was found. Smaller numbers of chromosomes bearing closely related haplotypes also carried this deletion, suggesting that these chromosomes most probably derived from the 56 chromosome by mutation of the polymorphic marker or recombination.

115

5. Positional Cloning of CLN3 Table 5.2. Deletion Analysis of JNCL Patients D16S299/D16S298 haplotype

2.5-kb fragmenta

3.5-kb fragmenta

Number of chromosomesb

56 56 Related Related Other Other

+ − + − + −

− + − + − +

116 0 15 8 1 22

a Genomic PCR was carried out using a primer pair ﬂanking the deletion, yielding a 3.5-kb ampliﬁcation product on control chromosomes and a 2.5-kb ampliﬁcation product on chromosomes bearing the 1-kb deletion. b The total number of chromosomes was 162.

VIII. MUTATIONAL ANALYSIS OF THE CLN3 GENE The ﬁnding of additional mutations of the gene encoding cDNA2-3 in JNCL patients supported the conclusion that this gene is the JNCL gene CLN3. Subsequent mutational analysis revealed, in addition to the common 1-kb deletion and the deletions found in the Moroccan and Finnish patient, 20 mutations in 11 of the 15 exons of the 2-3 gene (International Batten Disease Consortium, 1995; Mitchison et al., 1997; Munroe et al., 1997). No mutations were found in the gene sequence upstream of exon 5. While the majority of these novel mutations are private, i.e., found in only one family, ﬁve of the mutations occur in more than one family. Furthermore, all families with the same mutation have the same or closely related haplotypes, suggesting the presence of smaller founder effects. The 20 mutations include 6 missense mutations, 5 nonsense mutations, 3 small deletions, 3 small insertions, 2 splice-site mutations, and one intronic mutation (Figure 5.4). The majority of patients have mutations that are predicted to give rise to truncated proteins, and these patients all have the classical JNCL phenotype. Several patients, heterozygous for the 1-kb deletion and a missense mutation, have nonclassical phenotypes. One patient, with the leu101pro mutation, remained conversant until death at the age of 25. Two other patients, heterozygous for the 1-kb deletion and either the leu170Pro or the Glu295lys mutation, have a disease that is dominated by visual failure. Both these patients have nearly normal IQ and completed higher education. Phenotypic variability within families with more than one affected child is also observed. For example, the affected older sibling of one of the patients with the predominant visual phenotype died at the age of 22 with the classical disease phenotype. Intrafamilial variation is seen in many diseases, but its cause is unknown. Genetic and environmental factors, undoubtedly, come into play.

116

T. J. Lerner

Figure 5.4. Schematic representation of locations of mutations in CLN3 (Munroe et al., 1997). Mutations identiﬁed above the cDNA are point mutations in the open reading frame and mutations below the cDNA are deletions, insertions, or point mutations in introns. Missense mutations are in boldface and intronic mutations are in italics. Large genomic deletions are shown as solid horizontal bars. The deleted nucleotides relate to the cDNA only. (This ﬁgure has been reproduced with the permission of The University of Chicago Press.)

Because of the slow progression of symptoms in JNCL and its similarity to other neurological disorders, diagnosis is often missed or delayed. Now, with the identiﬁcation of the mutations underlying this disease, direct DNA testing is available for the majority of families for the diagnosis and prenatal and carrier testing of JNCL (Taschner et al., 1997).

IX. TISSUE EXPRESSION OF CLN3 Northern blot analysis, using the CLN3 cDNA as probe, showed a 1.7-kb transcript in mRNA isolated from the brain, the site of massive neuronal death in JNCL patients, and from a wide variety of tissue (International Batten Disease Consortium, 1995). Consistent with these ﬁndings, inclusions are found in many JNCL tissues in addition to the brain. The tissue expression of CLN3 reﬂects the expression pattern of the other NCL genes so far identiﬁed (Vesa et al., 1995; Sleat et al., 1997; Savukoski et al., 1998), and offers no clue toward understanding the neuronal speciﬁcity of this group of disorders.

X. CLN3 ENCODES A NOVEL PROTEIN Sequence analysis shows that the CLN3 cDNA spans 1689 bp, including a predicted open reading frame of 1314 bp (International Batten Disease Consortium,

5. Positional Cloning of CLN3

117

1995; GeneBank Accession Number U32680). The predicted product is a protein of 438 amino acids with a molecular mass of 48 kDa. No homology has been found at either the nucleotide or the protein level with any known gene, indicating that CLN3 encodes a novel protein of unknown function. Computer predictions for the CLN3 polypeptide reveal matches for N-glycosylation sites, glycosaminoglycan attachment sites, c-AMP- and cGMPdependent protein kinase phosphorylation sites, protein kinase C phosphorylation sites, casein kinase II phosphorylation sites, and myristoylation sites. The PSORT program for prediction of protein localization sites (Nakai and Kanehisa, 1992) indicates that the CLN3 protein may be a membrane protein. This localization is supported by hydropathy calculations that suggest the presence of several hydrophobic domains and by the numerous potential N-glycosylation and myristoylation sites.

XI. ANIMAL MODELS OF JNCL Homologs of the CLN3 protein have been identiﬁed in numerous species, as diverse as yeast (Genebank Accession Number Z49334) and the mouse (Genebank Accession Number U47106; Lee et al., 1996). The protein product of the yeast gene BTN1 is 39% identical and 59% similar to the human CLN3 protein. The product of the mouse gene Cln3 is 85% identical to the human protein (Lee et al., 1996). The conservation of this protein across species suggests that it plays an important role in the cell. The missense mutations so far identiﬁed in humans affect amino acid residues that are conserved in these homologs, indicating that these residues must be critical for the functions of the CLN3 protein. Studies of a yeast model implicate a role for the CLN3 protein in the regulation of lysosomal pH (Pearce and Sherman, 1997, 1998; Pearce et al., 1999). Overexpression studies localize the BTN1 protein to the yeast vacuole, the equivalent of the mammalian lysosome (Croopnick et al., 1998). Yeast knockouts, lacking the BTN1 gene, have abnormally acidic vacuoles in the early stages of growth. It is postulated that this defect in the regulation of lysosomal pH may lead to aggregation of lysosomal proteins, including the CLN1 and CLN2 gene products, or to altered activity of lysosomal proteases. Two mouse strains, the mnd and the nclf, also develop a disease that closely resembles human NCL (Bronson et al., 1993, 1998). However, neither is caused by mutations in Cln3, the mouse locus that lies on mouse chromosome 7 (Lee et al., 1996). The mnd mutation maps to a gene on mouse chromosome 8 (Messer et al., 1992) that is the homolog of a newly recognized subtype of NCL, CLN8, the gene for progressive epilepsy with mental retardation (Ranta et al., 1999). The nclf mutation maps to mouse chromosome 9 (Bronson et al., 1998) and is syntenic with CLN6 (Sharp et al., 1997; Haines et al., 1998). In the absence

118

T. J. Lerner

of a natural mouse model for JNCL, several groups have used gene-targeting techniques to generate mice bearing mutations in Cln3 (Greene et al., 1999; Katz et al., 1999; Lerner et al., unpublished). These mice develop the inclusions that are the hallmark of the disease and exhibit some neuropathological abnormalities (Mitchison et al., 1999). These animal models will be critical for studies of the pathogenesis underlying the disease and for the evaluation of therapies.

Acknowledgments The author would like to thank the JNCL families and their physicians. Without their help and encouragement, the identiﬁcation of CLN3 would not have been possible. TJL is funded by grants from the National Institute of Neurological Disorders and Stroke (NS32099), The JNCL Research Fund, The Children’s Brain Diseases Foundation, and The Batten Disease Support and Research Association.

References Albertson, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le Paslier, D., and Cohen, D. (1990). Construction and characterization of a yeast artiﬁcial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. (USA) 87, 4256–4260. Blonden, L. A. J., den Dunnen, J. T., van Paassen, H. M. B., Wapenaar, M. C., Grootscholten, P. M., Ginjaar, H. B., Bakker, E., Pearson, P. L., and van Ommen, G. J. B. (1989). High resolution deletion breakpoint mapping in the DMD gene by whole cosmid hybridization. Nucleic Acids Res. 17, 5611–5621. Bronson, R. T., Lake, B. D., Cook, S., Taylor, S., and Davisson, M. T. (1993). Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten disease). Ann. Neurol. 33, 381–385. Bronson, R. T., Donahue, L. R., Johnson, K. R., Tanner, A., Lane, P. W., and Faust, J. R. (1998). Neuronal ceroid lipofuscinosis (nclf), a new disorder of the mouse linked to chromosome 9. Am. J. Med. Genet. 77, 289–297. Callen, D. F., Baker, E., Lane, S., Nancarrow, J., Thompson, A., Whitmore, S. A., MacKennan, D. H., Berger, R., Cherif, D., Jarvela, I., Peltonen, L., Sutherland, G. R., and Gardiner, R. M. (1991). Regional mapping of the Batten disease locus (CLN3) to human chromosome 16p12. Am. J. Hum. Genet. 49, 1372–1377. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, A. J. (1994). Isolation of genes from complex sources of mammalian DNA using exon ampliﬁcation. Nat. Genet. 6, 98–105. Cohen, D., Chumakov, I., and Weissenbach, J. (1993). A ﬁrst-generation physical map of the human genome. Nature 266, 698–701. Croopnick, J. B., Choi, H. C., and Mueller, D. M. (1998). The subcellular location of the yeast Saccharomyces cerevisiae homologue of the protein defective in the juvenile form of Batten disease. Biochem. Biophys. Res. Commun. 250, 335–341. Dyer, M. R., and Walker, J. E. (1993). Sequences of members of the human gene family for the c subunit of mitochondrial ATP synthase. Biochem. J. 293, 51–64. Eiberg, H., Gardiner, R. M., and Mohr, J. (1989). Batten disease (Spielmeyer-Sjogren disease) and haptoblobins (HP): Indication of linkage and assignment to chromosome 16. Clin. Genet. 36, 217–218.

5. Positional Cloning of CLN3

119

Gardiner, R. M., Sandford, A., Deadman, M., Poulton, J., Reeders, S., Jokiaho, I., Peltonen, L., Eiberg, H., and Julier, C. (1990). Batten disease (Spielmeyer-Vogt, juvenile-onset neuronal ceroid lipofuscinosis) gene (CLN3) maps to human chromosome 16. Genomics 8, 387–390. Greene, N. D. E., Bernard, D. L., Taschner, P. E. M., Lake, B. D., de Vos, N., Breuning, M. H., Gardiner, R. M., Mole, S. E., Nussbaum, R. L., and Mitchison, H. M. (1999). A murine model for juvenile NCL: Gene targeting of mouse Cln3. Mol. Genet. Metab. 66, 309–313. Haines, J. L., Boustany, R-M. N., Alroy, J., Auger, K. A., Shook, K. S., Terwedow, H., and Lerner, T. J. (1998). Chromosomal localization of two genes underlying late-infantile neuronal ceroid lipofuscinosis. Neurogenetics 1, 217–222. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949–957. Jarvela, I. E., Mitchison, H. M., O’Rawe, A. M., Munroe, P. B., Taschner, P. E. M., de Vos, N., Lerner, T. J., D’Arigo, K. L., Callen, D. F., Thompson, A. D., Knight, M., Marrone, B. L., Mundt, M. O., Meincke, L., Breuning, M. H., Gardiner, R. M., Doggett, N. A., and Mole, S. E. (1995). YAC and cosmid contigs spanning the Batten disease (CLN3) region of 16p12.1-p11.2. Genomics 29, 478–489. Katz, M. L., Shibuya, H., Liu, P. C., Kaur, S., Gao, C. L., and Johnson, G. S. (1999). A mouse knockout model for juvenile ceroid-lipofuscinosis (Batten disease). J. Neurosci. Res. 57, 551– 556. Konradi, C., Ozelius, L., Yan, W., Gusella, J. F., and Breakeﬁeld, X. O. (1991). Dinucleotide repeat polymorphism on human chromosome 16. Nucleic Acids Res. 19, 5449. Lee, R. L., Johnson, K. R., and Lerner, T. J. (1996). Isolation and chromosomal mapping of a mouse homolog of the Batten disease gene CLN3. Genomics 35, 617–619. Lerner, T., Wright, G., Dackowski, W., Shook, D., Anderson, M. A., Klinger, K., Callen, D., and Landes, G. (1992). Molecular analysis of human chromosome 16 cosmid clones containing NotI sites. Mamm. Genome 3, 92–100. Lerner, T. J., Boustany, R-M. N., MacCormack, K., Gleitsman, J., Schlumpf, K., Breakeﬁeld, X. O., Gusella, J. F., and Haines, J. L. (1994). Linkage disequilibrium between the juvenile neuronal ceroid lipofuscinosis gene and marker loci on chromosome 16p12.1 Am. J. Hum. Genet. 54, 88–94. Lerner, T. J., D’Arigo, K. L., Haines, J. L., Doggett, N. A., Taschner, P. E. M., Buckler, A. J., and the Batten Disease Consortium (1995). Isolation of genes from the Batten candidate region using exon ampliﬁcation. Am. J. Med. Genet. 57, 320–323. McCormick, M. K., Campbell, E., Deaven, L., and Moyzis, R. (1993). Low-frequency chimeric yeast artiﬁcial chromosome libraries from ﬂow-sorted human chromosomes 16 and 21. Proc. Natl. Acad. Sci. (USA) 90, 1063–1067. Messer, A., Plummer, J., Maskin, P., Cofﬁn, J. M., and Frankel, W. M. (1992). Mapping of the motor neuron degeneration (Mnd) gene, a mouse model of amyotrophic lateral sclerosis (ALS). Genomics 18, 7097–802. Mitchison, H. M., Thompson, A. D., Mully, J. C., Kozman, H. M., Richards, R. I., Callen, D. F., Stallings, R. L., Doggett, N. A., Attwood, J., McKay, T. R., Sutherland, G. R., and Gardiner, R. M. (1993). Fine genetic mapping of the Batten disease locus CLN3 by haplotype analysis and demonstration of allelic association with chromosome 16p microsatellite loci. Genomics 16, 455– 460. Mitchison, H. M., Taschner, P. E. M., O’Rawe, A. M., De Vos, N., Phillips, H. A., Thompson, A. D., Kozman, H. M., Haines, J. L., Schlumpf, K., D’Arigo, K., Boustany, R-M. N., Callen, D. F., Beuning, M. H., Gardiner, R. M., Mole, S. E., and Lerner, T. J. (1994). Genetic mapping of the Batten disease locus (CLN3) to the interval D16S288-D16S383 by analysis of haplotypes and allelic association. Genomics 33, 465–468. Mitchison, H. M., O’Rawe, A. M., Taschner, P. E. M., Sandkuijl, L. A., Santavuori, P., de Vos, N., Breuning, M. H., Mole, S. E., Gardiner, R. M., and Jarvela, I. E. (1995). Batten disease gene CLN3:

120

T. J. Lerner

Linkage disequilibrium mapping in the Finnish population and analysis of European haplotypes. Am. J. Hum. Genet. 56, 654–662. Mitchison, H. M., Munroe, P. B., O’Rawe, A. M., Taschner, P. E. M., de Vos, N., Kremmidiotis, G., Lensink, I., Munk, A. C., D’Arigo, K. L., Anderson, J. W., Lerner, T. J., Moyzis, R. K., Callen, D. F., Breuning, M. H., Doggett, N. A., Gardiner, R. M., and Mole, S. E. (1997). Genomic structure and complete nucleotide sequence of the Batten Disease gene, CLN3. Genomics 40, 346–350. Mitchison, H. M., Bernard, D. J., Greene, N. D., Cooper, J. D., Junaid, M. A., Pullarkat, R. K., de Vos, N., Breuning, M. H., Owens, J. W., Mobley, W. C., Gardiner, R. M., Lake, B. D., Taschner, P. E., and Nussbaum, R. L. (1999). Targeted disruption of the Cln3 gene provides a mouse model for Batten disease. Neurobiol. Dis. 6, 321–34. Munroe, P. B., Mitchison, H. M., O’Rawe, A. M., Anderson, J. W., Boustany, R-M. N., Lerner, T. J., Taschner, P. E. M., de Vos, N., Breuning, M. H., Gardiner, R. M., and Mole, S. E. (1997). Spectrum of mutations in the Batten disease gene, CLN3. Am. J. Hum. Genet. 61, 310–316. Nakai, K., and Kanehisa, M. (1992). A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14, 897–911. Palmer, D. N., Fearnley, I. M., Walker, J. E., Hall, N. A., Lake, B. D., Wolfe, L. S., Haltia, M., Martinus, R. D., and Jolly, R. D. (1992). Mitochondrial ATP synthase subunit c storage in ceroid-lipofuscinosis (Batten disease). Am. J. Med. Genet. 42, 561–567. Pearce, D. A., and Sherman, F. (1997). BTN1, a yeast gene corresponding to the human gene responsible for Batten disease, is not essential for viability, mitochondrial function, or degradation of mitochondrial ATP synthase. Yeast 13, 691–697. Pearce, D. A., and Sherman, F. (1998). A yeast model for the study of Batten disease. Proc. Natl. Acad. Sci. (USA) 95, 6915–6918. Pearce, D. A., Ferea, T., Nosel, S. A., Das, B., and Sherman, F. (1999). Action of BTN1, the yeast orthologue of the gene mutated in Batten disease. Nat. Genet. 22, 55–58. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A-E. (1999). The neuronal ceroid lipofuscinosis in the human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Rogaev, E. I., and Keryanov, S. A. (1992). Unusual variability of the complex dinucleotide repeat block at the SPN locus. Hum. Mol. Genet. 1, 657. Santavuori, P. (1988). Neuronal ceroid lipofuscinosis in childhood. Brain Dev. 10, 80–83. Savukoski, M., Klockars, T., Homberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sebald, W., and Hoppe, J. (1981). On the structure and genetics of the proteolipid subunit of the ATP synthase complex. Curr. Topi. Bioenerget. 12, 1–64. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukoski, M., Jarvela, I., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late-infantile neuronal ceroid lipofuscinosis map to chromosome 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591–595. Shen, Y., Holman, K., Thompson, A., Kozman, H., Callen, D. F., Sutherland, G. R., and Richards, R. I. (1991). Dinucleotide repeat polymorphism at the D16S288 locus. Nucleic Acids Res. 19, 5445. Shen, Y., Holman, K., Doggett, N. A., Callen, D. F., Sutherland, G. R., and Richards, R. I. (1993). Four dinucleotide repeat polymorphisms on human chromosome 16. Hum. Mol. Genet. 2, 1745. Sleat, D. E., Donnelly, R. J., Lackland, H., Leu, C-G., Sohar, I., Pullarkat, R., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Stallings, R. L., Doggett, N. A., Callen, D., Apostolou, S., Chen, L. Z., Nancarrow, J. K., Whitmore, S. A., Harris, P., Mitchison, H., Breuning, M., Saris, J., Fickett, J., Cinkosky, M., Torney, D. C., Hildebrandt, C. E., and Moyzis, R. K. (1992). Evaluation of a cosmid contig physical map of human chromosome 16. Genomics 13, 1031–1039.

5. Positional Cloning of CLN3

121

Taschner, P. E. M., de Vos, N., Thompson, A. D., Callen, D. F., Doggett, N. A., Mole, S. E., Dooley, T. P., Barth, P. G., and Beuning, M. H. (1995). Chromosome 16 microdeletion in a patient with juvenile neuronal ceroid lipofuscinosis (Batten disease). Am. J. Hum. Genet. 56, 663–668. Taschner, P. E. M., de Vos, N., and Breuning, M. H. (1997). Rapid detection of the major deletion in the Batten disease gene CLN3 by alelle speciﬁc PCR. J. Med. Genet. 34, 955–956. Thompson, A. D., Shen, Y., Holman, K., Sutherland, G. R., Callen, D. F., and Richards, R. I. (1992). Isolation and characterization of (AC)n microsatellite markers from human chromosome 16. Genomics 13, 402–408. Vesa, J., Hellsten, E., Verkruyse, L-A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Wisniewski, K. E., Rapin, I., and Heaney-Kieras, J. (1988). Clinico-pathological variability in the childhood neuronal ceroid lipofuscinoses and new observations on glycoprotein abnormalities. Am. J. Med. Genet. Suppl. 5, 27–46. Yan, W., Boustany, R-M. N., Konradi, C., Ozelius, L., Lerner, T., Troffater, J. A., Julier, C., Breakeﬁeld, X. O., Gusella, J. F., and Haines, J. L. (1993). Localization of juvenile, but not late-infantile, neuronal ceroid lipofuscinosis on chromosome 16. Am. J. Hum. Genet. 52, 89–95. Yan, W. L., Lerner, T. J., Haines, J. L., and Gusella, J. F. (1994). Sequence analysis and mapping of a novel human mitochondrial ATP synthase subunit 9 cDNA (ATP5G3). Genomics 24, 375–377. Zeman, W. (1974). Studies in the neuronal ceroid lipofuscinosis. J. Neuropathol. Exp. Neurol. 33, 1–12.

This Page Intentionally Left Blank

6

Studies of Homogenous Populations: CLN5 and CLN8 Susanna Ranta Department of Molecular Genetics The Folkh¨alsan Institute of Genetics 00280 Helsinki, Finland and Department of Medical Genetics University of Helsinki 00014 Helsinki, Finland

Minna Savukoski Department of Human Molecular Genetics National Public Health Institute 00300 Helsinki, Finland and Department of Medical Genetics University of Helsinki 00014 Helsinki, Finland

Pirkko Santavuori Department of Neurology Hospital for Children and Adolescents Helsinki University Central Hospital 00029 Helsinki, Finland

Matti Haltia Department of Pathology University of Helsinki and Helsinki University Central Hospital 00014 Helsinki, Finland

I. Introduction II. Clinical Data A. Finnish-Variant Late-Infantile NCL B. Northern Epilepsy Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

123

124

S. Ranta et al.

III. Neurophysiology A. Finnish-Variant Late-Infantile NCL B. Northern Epilepsy IV. Neuroradiology A. Finnish-Variant Late-Infantile NCL B. Northern Epilepsy V. Morphology, Cytochemistry, and Biochemistry A. Finnish-Variant Late-Infantile NCL B. Northern Epilepsy VI. Molecular Genetics and Cell Biology A. CLN5 B. CLN8 VII. Diagnosis A. Finnish-variant Late-Infantile NCL B. Northern Epilepsy VIII. Treatment IX. Mouse Homolog for CLN8 References

ABSTRACT Finland and the Finns have been the subject of numerous genetic and genealogical studies, owing to enrichment of certain rare hereditary disorders in the Finnish population. Two types of NCL have so-far been found almost exclusively in Finland: Finnish variant late infantile NCL, vLINCL (CLN5), and the Northern epilepsy syndrome or Progressive epilepsy with mental retardation, EPMR (CLN8). The ﬁrst symptoms of Finnish vLINCL are concentration problems or motor clumsiness by 3 to 6 years of age, followed by mental retardation, visual failure, ataxia, myoclonus, and epilepsy. Northern epilepsy, the newest member of the NCL family with the most protracted course, is characterized by the onset of generalized seizures between 5 and 10 years of age and subsequent progressive mental retardation. Visual problems are slight and late, while myoclonus has not been observed. Both the Finnish vLINCL and Northern epilepsy are pathologically characterized by intraneuronal cytoplasmic deposits of autoﬂuorescent granules which are Luxol fast blue-, PAS-, and Sudan black B-positive in parafﬁn sections. In Northern epilepsy the intraneuronal storage process and neuronal destruction are generally of mild degree but highly selective and, in contrast to other forms of childhood onset NCL, the cerebellar cortex is relatively spared. By electron microscopy the storage bodies mainly contain rectilinear complex type and ﬁngerprint proﬁles in Finnish vLINCL and structures resembling curvilinear proﬁles in Northern epilepsy. Mitochondrial

6. Studies of Homogenous Populations: CLN5 and CLN8

125

ATP synthase subunit c is the main stored protein in both disorders. Both the CLN5 and CLN8 genes encode putative membrane proteins with yet unknown functions. Furthermore, a well studied spontaneously occurring autosomal recessive mouse mutant, motor neuron degeneration (mnd) mouse, is a homolog for CLN8.

I. INTRODUCTION The concept of “Finnish disease heritage” refers to a group of more than 30 monogenic diseases, more prevalent in Finland than in other countries (Norio et al., 1973; Peltonen, 1997; de la Chapelle and Wright, 1998). Three neuronal ceroid lipofuscinosis (NCL) subtypes are enriched in Finland and form part of the Finnish disease heritage: infantile NCL (INCL; CLN1)(Haltia et al., 1973a, 1973b, Santavuori et al., 1973), Finnish-variant late-infantile NCL (vLINCL; CLN5) (Santavuori et al., 1982), and the Northern epilepsy syndrome or progressive epilepsy with mental retardation, EPMR (CLN8)(Hirvasniemi et al., 1994, Haltia et al., 1999). The most common NCL subtype in Finland, however, is juvenile NCL (JNCL; CLN3) (Santavuori, 1988; Martin et al., 1999). INCL and JNCL are also seen in other parts of the world, whereas, with the exception of one Dutch and one Swedish patient with Finnish vLINCL, Finnish vLINCL and Northern epilepsy have so far been observed only in Finland. Both disorders are rare; to date only 26 patients with Finnish vLINCL and 26 patients with Northern epilepsy have been reported in Finland.

II. CLINICAL DATA A. Finnish-variant late-infantile NCL Finnish-variant late-infantile NCL usually presents with visuomotor problems and/or impaired concentration by 3–6 years of age. Fine or gross motor clumsiness and mental decline may begin at the same time or later. Seizures. In most cases the ﬁrst epileptic attacks are complex partial seizures debuting between 8 and 9 years of age. Generalized tonic-clonic seizures begin a few months up to 2 years later, while complex partial seizures decrease in frequency. The onset of myoclonus takes place between 7 and 10 years of age. Myoclonic jerks may precipitate seizures or increase after them. Truncal myoclonus interferes with walking ability (Santavuori et al., 1991). Dementia. Mental deterioration can sometimes be observed already by 3–4 years of age. In most patients, however, mental decline begins some years later. By 6 years of age the intelligence quotient (IQ) may still be normal but

126

S. Ranta et al.

the neuropsychological proﬁle shows some deviant features. Most patients with Finnish vLINCL are markedly mentally retarded by 11 years of age. Neurological ﬁndings. At the early stage of the disease, gross and ﬁne motor clumsiness and problems with balance and coordination can be observed. By that time walking ability is still normal. After a couple of years, at the latest by 10 years of age, marked truncal ataxia becomes evident and independent walking ability is soon lost. Dystonic postures may begin at the same stage, speech becomes severely dysarthric, and the ﬁrst extrapyramidal signs are found. Ophthalmological ﬁndings. In most cases visual failure and macular degeneration are ﬁrst noticed between 5 and 8 years of age. By that time, electroretinograms also reveal retinal degeneration. Behavioral problems. Patients with Finnish vLINCL show much less aggressive behavior or irritability than patients with INCL or JNCL (Santavuori et al., 1999). Some patients, however, need medication due to behavioral problems. Routine laboratory investigations of blood, urine and cerebrospinal ﬂuid are normal. In particular, no vacuolated lymphocytes have been observed. (Santavuori et al., 1982).

B. Northern epilepsy Seizures. The ﬁrst presenting symptom in the Northern epilepsy syndrome is epilepsy. Most patients suffer their ﬁrst seizure between ages 5 and 10, at an average of 6.7 years of age. The ﬁrst seizures can be triggered by fever. All patients have generalized tonic-clonic seizures, while approximately one-third occasionally also suffer from complex partial seizures during childhood. Almost 40% of patients experience prolonged postictal mental dullness lasting 1–3 days, during which they need help in their daily activities. At the initial stage of the disease, the epileptic attacks occur once a month or 2 months. Toward puberty the frequency of the attacks increases, up to 4–10 a month. During early adulthood the seizures occur less frequently, usually 4–6 times a year. The seizure activity decreases in adulthood, when patients can be seizure-free for several years. However, complete remission has not been described. Northern epilepsy patients do not have myoclonic seizures (Hirvasniemi et al., 1994, 1995). Dementia. Most patients initially develop normally before the onset of epilepsy. Mental retardation is usually observed 2–5 years after the ﬁrst seizures. Because of difﬁculties at school, some patients may need special education classes. Mental decline is most rapid during childhood and puberty, when epileptic activity is most pronounced, but continues slowly throughout life. By the age of 40, all patients are at least moderately retarded (Hirvasniemi and Karumo, 1994; Hirvasniemi et al., 1994, 1995).

6. Studies of Homogenous Populations: CLN5 and CLN8

127

Neurological ﬁndings. At the onset of the disease, neurological examination does not show any abnormalities. As the disease progresses, difﬁculties in ﬁne and gross motor tasks are observed. By middle age, patients are clumsy, have difﬁculties with equilibrium, and their walking is slow and broad-based, with small steps. Most patients have dysphasic speech. One severely affected adult patient completely lost her ability to speak (Hirvasniemi et al., 1995). Ophthalmological ﬁndings. Retinal degeneration, a characteristic ﬁnding in NCL, has not been reported in Northern epilepsy. However, some of the patients have diminished (<1.0) visual acuity with no ocular abnormality (Hirvasniemi et al., 1995). Detailed neuroophthalmological studies have not been published. Behavioral problems. In childhood and puberty nearly half of the patients have behavioral problems, such as irritability, restlessness, disobedience, noisy wakefulness during nights, and inattentiveness. They have often been treated with neuroleptic drugs (Hirvasniemi et al., 1994, 1995). Routine laboratory investigations of blood, urine, and cerebrospinal ﬂuid show no consistent abnormality. In particular, no vacuolated lymphocytes have been detected. Urinary screenings of amino acids, oligosaccharides, glycosaminoglycans, and organic acids have also given normal results (Hirvasniemi et al., 1994).

III. NEUROPHYSIOLOGY A. Finnish-variant late-infantile NCL Giant visual evoked potentials (VEPs), giant somatosensory evoked potentials (SEPs), and posterior spikes to low-frequency photic stimulation in the electroencephalogram (EEG) are characteristic ﬁndings in Finnish vLINCL. These ﬁndings become visible in an individual order, usually between 7 and 10 years of age, sometimes earlier. Abnormal SEP is often the ﬁrst ﬁnding (Santavuori et al., 1991, 1999).

B. Northern epilepsy At the onset of Northern epilepsy the EEG recordings are occasionally normal. However, by puberty EEG practically always reveals slowing down of the background activity with a 6 to 7-Hz theta rhythm and impaired reaction to eye opening. At this stage, delta activity is abundant, while sleep-speciﬁc potentials can be totally absent. The amount of diffuse delta and theta activities diminishes during the progression of the disease. Clear interictal epileptiform activity is overall relatively scanty but can be observed in nearly half of the EEG recordings.

128

S. Ranta et al.

Nearly half of the patients have abnormal VEPs with delayed latencies. In addition, half of the patients have abnormal nerve conduction velocities (NCV) with no clinical symptoms of neuropathy, and approximately one-third have abnormal brainstem auditory evoked potentials (BAEVs) (Hirvasniemi et al., 1994; Lang et al., 1997).

IV. NEURORADIOLOGY A. Finnish-variant late-infantile NCL At an early stage of Finnish vLINCL, magnetic resonance imaging (MRI) reveals high signal rims around the lateral ventricles in the white matter and a lower signal in the thalami than the basal ganglia on T2-weighted images. Moderate cerebellar and slight cerebral atrophy are found. Progressive severe cerebral and particularly cerebellar atrophy are seen during the later course of the disease. The early MRI changes are important for the clinical diagnosis (Autti et al., 1992, 1997).

B. Northern epilepsy Cerebellar and brainstem atrophy in MRI and computerized tomography (CT) scans are the ﬁrst abnormal signs appearing in early adulthood. Later, as the disease progresses, cerebral atrophy is also observed. All patients over 30 years of age show evidence of progressive cortical and/or central cerebral atrophy. The degree of the cerebral atrophy correlates with the IQ (Hirvasniemi and Karumo, 1994).

V. MORPHOLOGY, CYTOCHEMISTRY, AND BIOCHEMISTRY A. Finnish-variant late-infantile NCL Macroscopic autopsy ﬁndings. All autopsied patients have shown severe generalized cerebral and extreme cerebellar atrophy (Figure 6.1.), with brain weights of the order of 500–700 g. The cortical ribbon is thin and the white matter is reduced in amount, grayish, and tough. There is pronounced ventricular dilatation. No macroscopic extraneural lesions have been observed (Tyynel¨a et al., 1997). Histology. The most characteristic feature, observed at all ages studied, is the presence of storage granules in the cytoplasm of most nerve cells. Small amounts of similar storage material may be seen in many other cell types throughout the body. Biopsy and autopsy studies of patients at different ages suggest that

6. Studies of Homogenous Populations: CLN5 and CLN8

129

Figure 6.1. The brain of a 14-year-old Finnish vLINCL patient shows pronounced generalized atrophy, particularly striking in the cerebellum (brain weight 655 g).

the most pronounced storage is initially found in the large pyramidal cells of the deeper cortical layers. At this stage, the neurons of the superﬁcial part of lamina III characteristically show frequent meganeurites ﬁlled with storage granules (Figure 6.2A). During later stages, there is progressive loss of neurons, particularly in laminae III and V, with occasional ﬁgures of neuronophagy and pronounced astrocytic hyperplasia and hypertrophy (Tyynel¨a et al., 1997). In the hippocampus the sectors CA2–CA4 show pronounced intraneuronal storage, while CA1 is only mildly affected. In the cerebellar cortex there is an almost total destruction of the granule cells, while an occasional preserved Purkinje cell may be seen with dilated dendrites loaded with storage granules. There is pronounced proliferation and hypertrophy of the Bergmann astrocytes. The subcortical structures show moderate to pronounced intraneuronal storage but, with the exception of the thalami, only mild to moderate neuronal loss. There is advanced loss of myelin in the cerebral and cerebellar white matter, accompanied by astrocytic proliferation and hypertrophy (Tyynel¨a et al., 1997). Ultrastructure. At electron microscopy the storage granules correspond to electron-dense cytosomes surrounded by a lysosomal membrane and with a variable internal ultrastructure. In brain biopsies and autopsies some intraneuronal cytosomes show features resembling ﬁngerprint or curvilinear proﬁles, as seen in patients with classic LINCL (cLINCL) or JNCL, while the ultrastructure of most cytosomes corresponds to the so-called rectilinear complex (Figure 6.2B)

130

S. Ranta et al.

Figure 6.2. (A) Cerebral cortical nerve cells show storage granules immunoreactive for the subunit c of the mitochondrial ATP synthase. Note the ballooning of the cell bodies and the meganeurites ﬁlled with the storage material. Parafﬁn section, immunoperoxide stain for subunit c of the mitochondrial ATP synthase (×300). (B) The intraneuronal membranebound storage bodies in Finnish vLINCL consist largely of membraneous proﬁles with an ultrastructure corresponding to the rectilinear complex (electron micrograph ×20,000).

(Santavuori et al., 1982; Tyynel¨a et al., 1997; Elleder et al., 1999). In skin and rectal mucosal biopsies, non-neuronal cells (endothelial, smooth muscle, and Schwann cells) predominantly show inclusions of atypical curvilinear or rectilinear complex type, while autonomic ganglion cells of the vermiform appendix and rectum mainly contain ﬁngerprint bodies (Santavuori et al., 1982). Blood lymphocytes contain cytosomes with variegated structures including ﬁngerprint proﬁles. These inclusions are almost identical to those seen in patients with other vLINCLs (CLN6 and CLN7) (Rapola and Lake, 2000). Cytochemistry and biochemistry. The storage granules are relatively resistant to lipid solvents and stain positively with the Luxol fast blue, PAS and Sudan black B stains in parafﬁn sections. They are autoﬂuorescent when viewed in ultraviolet light. They bind antibodies raised against the subunit c of the mitochondrial ATP synthase (Figure 6.2A) and the sphingolipid activator proteins A and D. However, isolation and puriﬁcation of the cerebral storage granules and subsequent quantitative sequence analysis showed subunit c to be the major component of the pathological cytosomes, with only minor accumulation of the sphingolipid activator proteins (Tyynel¨a et al., 1997).

6. Studies of Homogenous Populations: CLN5 and CLN8

131

B. Northern epilepsy Macroscopic autopsy ﬁndings. The only disease-related macroscopic abnormality noted in three autopsied patients was moderate generalized cerebral gyral atrophy in one of them (Herva et al., 2000). Histology. All three autopsied patients showed deposits of granular storage material in the cytoplasm of most neurons and, to a much lesser degree, in many other cell types throughout the body, including, e.g., heart muscle cells, Kupffer cells of the liver, and distal convoluted tubules of the kidney (Herva et al., 2000). Although the intraneuronal storage was almost ubiquitous, the amount of the stored material varied greatly, resulting in a characteristic, highly selective distributional pattern. In the cerebral neocortex the large pyramidal neurons of lamina III showed pronounced ballooning of their cell bodies, while the less ballooned neurons of the upper parts of this lamina displayed numerous axonal spindles (meganeurites), distended by the storage granules. Other neocortical laminae were much less affected, with mild patchy neuronal loss in lamina V. In the hippocampus the sectors CA2 (Figure 6.3A), CA3, and CA4 showed pronounced storage, with some neuronal loss in CA2, while CA1 was almost intact (Figure 6.3B). Slight to moderate intraneuronal storage occurred in the basal ganglia and thalamus, most brainstem nuclei, as well as in the spinal cord. However, the pigmented brainstem nuclei were almost intact. In sharp contrast to other childhood-onset forms of NCL, even the cerebellar cortex was relatively preserved. Occasional ﬁgures of neuronophagy and some astrocytic hyperplasia and hypertrophy were seen in the hippocampal CA2 ﬁeld, and modest patchy astrocytic proliferation even in the deeper neocortical layers. The white matter was relatively spared. Studies of blood smears did not disclose any vacuolated lymphocytes (Haltia et al., 1999; Herva et al., 2000). Ultrastructure. The membrane-bound electron-dense storage cytosomes contain loosely packed curved lamellar structures, resembling curvilinear proﬁles

Figure 6.3. In Northern epilepsy patients the hippocampal sector CA2 shows pronounced intraneuronal storage (A), while the CA1 ﬁeld is only minimally affected (B). Parafﬁn section, immunoperoxidase stain for subunit c of the mitochondrial ATP synthase (×200).

132

S. Ranta et al.

Figure 6.4. (A) The storage granules in Northern epilepsy consist of membrane-bound electrondense aggregates with an internal ultrastructure resembling curvilinear proﬁles (electron micrograph ×10,000). In parafﬁn sections the intraneuronal storage bodies are Sudan black B-positive (B) and show strong autoﬂuorescence in ultraviolet light (C).

(Figure 6.4A). In addition, some electron-dense granular material may be seen (Herva et al., 2000). Cytochemistry and biochemistry. The intracytoplasmic storage granules are Luxol fast blue-, PAS-, and Sudan black B-positive in parafﬁn sections (Figure 6.4B), and they are autoﬂuorescent in ultraviolet light (Figure 6.4C). They are immunoreactive for subunit c of the mitochondrial ATP synthase (Figure 6.3A) and sphingolipid activator proteins, and also show amyloid-betalike immunoreactivity. However, N-terminal sequence analysis of puriﬁed storage material reveals only one major sequence, indicating that subunit c is the major storage protein (Herva et al., 2000).

VI. MOLECULAR GENETICS AND CELL BIOLOGY A. CLN5 Isolation of the CLN5 gene. The CLN5 gene was assigned to chromosome 13q2132 (Savukoski et al., 1994). Subsequently, the region was reﬁned by haplotype and linkage disequilibrium analyses to 200 kb and a physical map was constructed across the disease gene region (Klockars et al., 1996). The CLN5 gene was initially identiﬁed by traditional positional cloning using a fetal brain cDNA library screening. The assembly of the CLN5 sequence was expedited by large-scale sequencing of the critical region (Savukoski et al., 1998).

6. Studies of Homogenous Populations: CLN5 and CLN8

133

Table 6.1. Mutations in CLN5 and CLN8

Nucleotide change CLN5 1517G > A

Mutation type

Amino acid change/predicted consequence

Location

Nationality of the patients

Nonsense

W75X

Exon 1

Finnish

2467delAT

2-bp Deletion

Y392X

Exon 4

Finnish

2127G > A

Missense

D279N

Exon 4

Dutch

CLN8 C.70C > G

Missense

R24G

Exon 2

Finnish

Cln8 (Mnd mouse) 267-268insC

1-bp Insertion

Frameshift after P89, Truncated 116 aa protein

Reference

Savukoski et al., 1998 Savukoski et al., 1998 Savukoski et al., 1998 Ranta et al., 1999 Ranta et al., 1999

Gene structure. The 4.1-kb CLN5 gene consists of four exons and contains a coding region of 1221 bp, predicting a polypeptide of 407 amino acids. In the genomic DNA, CLN5 spans approximately 13 kb (Savukoski et al., 1998). Mutations in CLN5. So far, three mutations have been identiﬁed in CLN5 (See Table 6.1). The most frequently seen mutation, CLN5 Fin major, was observed in 94% of the Finnish disease chromosomes. It is a 2-bp deletion (2467delAT or C.1175delAT) in exon 4, resulting in a substitution of tyrosine to STOP at codon 392 (Y392X) and leading to a predicted truncated protein of 391 amino acids. The CLN5 Fin major mutation has also been observed in heterozygous form in a single Finnish patient with a fourth, yet-unidentiﬁed mutation (Rapola et al., 1999). The second known mutation, CLN5 Fin minor, has been observed homozygous in a Finnish family with two affected siblings. In addition, a Swedish patient with a single CLN5 Fin minor mutation and an unidentiﬁed mutation in the second allele has been documented (Savukoski, 1999). A 1-bp substitution (1517G > A or C.225G > A) results in a nonsense mutation (W75X) and a predicted polypeptide of only 74 amino acids. The third and only known mutation of non-Finnish origin, CLN5 European, a missense change (2127G > A or C.835G > A) resulting in an aspartic acid-to-asparagine substitution at codon 279 (D279N), was detected homozygous in a single Dutch patient. Screening of 700 controls originating from the high-risk region on the west coast of Finland for the CLN5 Fin major mutation revealed a local carrier frequency of 1:24–1:100 (Savukoski et al., 1998). The carrier frequency of the CLN5 Fin major mutation

134

S. Ranta et al.

varies between 1:300 and 1:1000 elsewhere in Finland (Tomi Pastinen, personal communication). Tissue expression of the CLN5 gene. Transcripts of 2.0, 3.0, and 4.5 kb were detected in all tissues tested when the tissue expression pattern of CLN5 was monitored by Northern hybridization. An additional 5.5-kb signal was seen in skeletal muscle. Of the transcripts identiﬁed, the 4.5 signal corresponds best to the assembled 4.1 kb CLN5 cDNA. The other signals may represent alternatively spliced transcripts. Among adult tissues, the level of expression was highest in aorta, kidney, lung, and pancreas. A fairly uniform expression was seen in all fetal tissues (brain, heart, kidney, liver, spleen, lung), except for fetal thymus, which showed approximately two times higher signal intensity (Savukoski et al., 1998). Computer predictions. No previously known genes or proteins homologous to CLN5 were identiﬁed through database searches. Several potential modiﬁcation sites, including protein kinase C phosphorylation sites, casein kinase II phosphorylation sites, tyrosine kinase phosphorylation sites, N-myristoylation sites, and N-glycosylation sites were identiﬁed. The molecular weight predicted from the 407-amino acid sequence of CLN5 is 46 kD, and the calculated pI 8.41. Based on hydrophobicity predictions, CLN5 was suggested to be a transmembrane protein with two transmembrane domains and an intraluminar loop. The location of the CLN5 protein within the cell is unknown (Savukoski et al., 1998).

B. CLN8 Isolation of the CLN8 gene. The CLN8 gene was assigned to the telomeric region of chromosome 8p (Tahvanainen et al., 1994). A yeast artiﬁcial chromosome (YAC) contig was then constructed across the 4-cM genetic region harboring the disease locus (Ranta et al., 1996). The critical gene region was further reﬁned to less than 700 kb and a bacterial artiﬁcial chromosome (BAC) contig across the critical region was completed (Ranta et al., 1997). The CLN8 gene was identiﬁed by positional cloning using a YAC insert to screen a normalized brain cDNA library (Ranta et al., 1999). Gene structure. The total length of the assembled cDNA sequence is 4819 bp, including a coding region of 861 bp, predicting a protein of 286 amino acids. The CLN8 gene has three exons. The 5 untranslated region consists of a noncoding exon 1 and 123 bp of the 5 sequence of exon 2. The coding region is divided into exons 2 and 3. The total length of exon 3 as well as the intron sizes are unknown. The 3 untranslated region contains at least four poly-A tails suggesting alternative splicing (Ranta et al., 1999). The CLN8 mutation. A C.70C > G change in exon 2 resulting in an arginine-to-glycine substitution at codon 24 (R24G) was found to fully co-segregate with the disease phenotype (Table 6.1). Screening of 271 unrelated Finnish

6. Studies of Homogenous Populations: CLN5 and CLN8

135

controls for the C.70C > G mutation revealed two carriers, giving a carrier frequency of 1:135 in Finland. Additional screening of 92 controls from the high-risk Kainuu region revealed a local carrier frequency of 1:46, strongly suggesting that this is the gene defect underlying Northern epilepsy (Ranta et al., 1999). Tissue expression of the CLN8 gene. When the tissue expression pattern of CLN8 was studied by Northern hybridizations, RNA transcripts of 1.4, 3.4, and 7.5 kb were detected in all tissues. Of the transcripts identiﬁed by Northern analysis, the 1.4-kb signal corresponds most closely to the ﬁrst poly-A tail at 1.3 kb and the 3.4 kb signal to the third (at 3.23 kb) and fourth (at 3.28 kb) polyA tails. The other signals most likely represent alternatively spliced transcripts. Expression was also detected in fetal tissues (Ranta et al., 1999). Computer predictions. Although several identical human and mouse ESTs were identiﬁed, database searches revealed no previously known genes or proteins homologous to CLN8 (Ranta et al., 1999). Several potential modiﬁcation sites, such as an N-glycosylation site, two protein kinase C phosphorylation sites, two casein kinase II phosphorylation sites, ﬁve N-myristoylation sites, a prokaryotic membrane lipoprotein lipid attachment site, and a leucine zipper pattern were identiﬁed. The molecular weight predicted from the polypeptide sequence is 33 kD and the predicted pI is 9.6. Based on hydrophobicity predictions, CLN8 was suggested to be a transmembrane protein with several transmembrane domains. Intracellular localization. Evidence from cell biological studies strongly suggest that CLN8 is an endoplasmic reticulum (ER) resident protein which recycles between ER and ER-Golgi intermediate compartment (Lonka et al., 2000).

VII. DIAGNOSIS The diagnosis of NCL has traditionally been based on careful clinical evaluation of the patient, neurophysiological studies, and demonstration of characteristic inclusions in tissue specimens observed by light and electron microscopy. Today, DNA-based genetic tests or assays for speciﬁc enzyme activities are also available for some of the NCL types.

A. Finnish-variant late-infantile NCL Finnish vLINCL (CLN5) is clinically a variant of the late-infantile NCL (LINCL) with onset usually between ages 3 and 6 (Santavuori et al., 1982, 1993). Although the age of onset can overlap with the classic LINCL (cLINCL; CLN2), Finnish vLINCL can be distinguished from cLINCL, based on milder clinical course, differences in ultrastructure of the pathological inclusions (Santavuori et al., 1982) as well as genetic analyses or enzyme assay for CLN2. The phenotypes of Finnish

136

S. Ranta et al.

Table 6.2. Characteristics of Finnish vLINCL and Northern Epilepsy Finnish vLINCL

Northern epilepsy

Age at onset

3–6 years

5–10 years

Presenting symptom

Visuomotor and concentration problems; motor clumsiness and muscular hypotonia

Seizures

Seizure type

Generalized tonic-clonic (all patients) Partial (may occur at onset)

Generalized tonic-clonic (all patients) Partial (30% of the patients during the early years)

Mental retardation

Present, progressive

Present, progressive

Visual failure

Early, progressive

Not a prominent feature

EEG

Progressive slowing of background activity, low-rate intermittent photic spikes

Progressive slowing of background activity, scanty interictal epileptiform activity

Myoclonus

Present

Not present

Life expectancy

Around 20 years of age (13–35 years)

Late middle age

Electron microscopy

Mainly rectilinear complex and ﬁngerprint proﬁles

Structures resembling curvilinear proﬁles and granular material

vLINCL (see Table 6.2) and the other two variants of late-infantile NCL (CLN6, CLN7) can overlap. However, the clinical course in CLN6 is usually more rapid than in Finnish vLINCL. The clinical phenotype together with typical MRI ﬁndings, lack of vacuolated lymphocytes, and the ophthalmological ﬁndings strongly support diagnosis of Finnish vLINCL. The nationality of the patient should also be taken into account while considering differential diagnosis between the variant LINCLs. Furthermore, as the gene underlying Finnish vLINCL is now known, the diagnosis can usually be conﬁrmed by DNA analysis.

B. Northern epilepsy Children with Northern epilepsy are usually ﬁrst examined by a pediatric neurologist because of epilepsy which may be difﬁcult to control with conventionally used anticonvulsants. A diagnosis other than idiopathic epilepsy is often suspected only after mental decline has become evident. If a child with intractable epilepsy has no known etiology for the seizures, no deﬁnite MRI ﬁndings, and within a few years shows mental decline, the possibility of Northern epilepsy should be considered. At our present stage of knowledge the only possibility for conﬁrming the Northern epilepsy diagnosis relies on DNA analyses. The age of onset of the Northern epilepsy syndrome overlaps with that of JNCL. However, differential

6. Studies of Homogenous Populations: CLN5 and CLN8

137

diagnosis between these two NCL types is easy: contrary to Northern epilepsy, vacuolated lymphocytes and visual failure combined with macular and retinal degeneration are characteristic ﬁndings in JNCL, and epilepsy is seldom the ﬁrst sign of disease. The clinical picture and course of the disease as well as MRI ﬁndings distinguish Northern epilepsy, as seen in the Finnish patients (see Table 6.2), from all variant LINCLs.

VIII. TREATMENT The treatment for Finnish vLINCL and Northern epilepsy is symptomatic, and there is no known cure. Parents and other members of the family need guidance and support in dealing with everyday aspects of these rare but devastating neurodegenerative disorders. Bone marrow transplantations are not expected to be beneﬁcial with Finnish vLINCL or Northern epilepsy and have not been attempted. In addition to antiepileptic drugs, some patients need medication for behavioral and neurological problems during childhood and puberty. Anticonvulsants. At the early stage of Finnish vLINCL, monotherapy with lamotrigine or valproate is recommended. Later on, these drugs are often used in combination. Some patients may need benzodiazepine (clobazam or clonazepam) as a third antiepileptic drug. Most patients with Finnish vLINCL also require baclophen and tizanidine to prevent myoclonic jerks and dystonia and to reduce the development of contractures. In Northern epilepsy, clonazepam has had the best antiepileptic effect. In puberty, when seizures are most frequent, clonazepam has produced seizurefree periods of up to 3 years. The beneﬁt of clonazepam is also evident in the EEG recordings, especially in childhood and puberty, but also in middle age. Only a transient response was achieved with valproate and phenobarbital, whereas phenytoin and carbamazepine proved ineffective. So far there is no experience of the use of lamotrigine on Northern epilepsy (Hirvasniemi et al., 1994, 1995).

IX. MOUSE HOMOLOG FOR CLN8 A spontaneously occurring well-characterized autosomal recessive NCL mutant, the motor neuron degeneration (mnd) mouse, was originally considered a model for amyotrophic lateral sclerosis (Messer and Flaherty, 1986). Previous histopathological studies on mnd had revealed accumulation of autoﬂuorescent inclusions immunoreactive with antibodies to the subunit c of the mitochondrial ATP synthase indicating that mnd is a model for NCL (Bronson et al., 1993; Messer and Plummer, 1993; Pardo et al., 1994). Mnd mice experience early onset retinal and adult-onset progressive motor system degeneration (Messer and Flaherty, 1986;

138

S. Ranta et al.

Messer et al., 1993). The motor dysfunction leads to spastic limb paralysis and premature death. The severity of the phenotype depends also on the genetic background of the mice (Messer et al., 1995). The sequence of the mouse gene (Cln8) corresponding to the human CLN8 was assembled from ESTs homologous to the human gene. At the nucleotide level, the coding sequences of the human and mouse genes were found to be 82% identical. At the polypeptide level an 85% identity was revealed. The CLN8 mutation site was found to be conserved in the mouse. The mouse Cln8 gene was assigned to the same region on mouse chromosome 8 as mnd. A homozygous 1-bp insertion (267-268insC) in the Cln8 gene resulting in a frameshift and a predicted stop codon 27 codons downstream was identiﬁed using mnd mouse DNA. This ﬁnding veriﬁes that the previously identiﬁed human gene underlies Northern epilepsy and that mnd is a naturally occurring animal model for this disorder (Ranta et al., 1999). Interestingly, unlike patients with Northern epilepsy, mnd mice do not suffer from epileptic seizures. The motor dysfuction and visual failure, severe in mnd, are also not prominent features in the Northern epilepsy syndrome. The differences between the clinical presentations may partly be explained by the difference between the gene defects, a missense mutation leading to Northern epilepsy syndrome and a frame shift and a truncated protein leading to mnd. Furthermore, more severe mutations in the human gene might result in a strikingly different clinical phenotype.

References Autti, T., Raininko, R., Launes, J., Nuutila, A., and Santavuori, P. (1992). Jansky-Bielschowsky variant disease: CT, MRI, and SPECT ﬁndings. Pediatr. Neurol. 8, 121–126. Autti, T., Raininko, R., Vanhanen, S. L., and Santavuori, P. (1997). Magnetic resonance techniques in neuronal ceroid lipofuscinoses and some other lysosomal diseases affecting the brain. Curr. Opin. Neurol. 10, 519–524. Bronson, R. T., Lake, B. D., Cook, S., Taylor, S., and Davisson, M. T. (1993). Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten’s disease). Ann. Neurol. 33, 381–385. de la Chapelle, A., and Wright, F. A. (1998). Linkage disequilibrium mapping in isolated populations: The example of Finland revisited. Proc. Natl. Acad. Sci. (USA) 95, 12416–12423. Elleder, M., Lake, B. D., Goebel, H. H., Rapola, J., Haltia, M., and Carpenter, S. (1999). Deﬁnitions of the Ultrastructural Patterns found in NCL. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel, S. E. Mole, and B. D. Lake, eds.), pp. 5–15. IOS Press, Amsterdam, The Netherlands. Haltia, M., Rapola, J., and Santavuori, P. (1973a). Infantile type of so-called neuronal ceroidlipofuscinosis. Histological and electron-microscopic studies. Acta Neuropathol. 26, 157– 170. Haltia, M., Rapola, J., Santavuori, P., and Ker¨anen, A. (1973b). Infantile type of so-called neuronal ceroid-lipofuscinosis. Morphological and biochemical studies. J. Neurol. Sci. 18, 269–285. Haltia, M., Tyynel¨a, J., Hirvasniemi, A., Herva, R., Ranta, U. S., and Lehesjoki, A.-E. (1999). CLN8:

6. Studies of Homogenous Populations: CLN5 and CLN8

139

Northern epilepsy. In: “The Neuronal Ceroid Lipofuscinoses (Batten’s Disease)” (H. H. Goebel, S. E. Mole, and B. D. Lake, eds.), pp. 117–121. IOS Press, Amsterdam, The Netherlands. Herva, R., Tyynel¨a, J., Hirvasniemi, A., Syrj¨akallio-Ylitalo, M., and Haltia, M. (2000). Northern epilepsy: A novel form of neuronal ceroid-lipofuscinosis. Brain Pathol. 10, 215–222. Hirvasniemi, A., and Karumo, J. (1994). Neuroradiological ﬁndings in the northern epilepsy syndrome. Acta Neurol. Scand. 90, 388–393. Hirvasniemi, A., Lang, H., Lehesjoki, A. E., and Leisti, J. (1994). Northern epilepsy syndrome: An inherited childhood onset epilepsy with associated mental deterioration. J. Med. Genet. 31, 177– 182. Hirvasniemi, A., Herrala, P., and Leisti, J. (1995). Northern epilepsy syndrome: Clinical course and the effect of medication on seizures. Epilepsia. 36, 792–797. Klockars, T., Savukoski, M., Isosomppi, J., Laan, M., J¨arvel¨a, I., Petrukhin, K., Palotie, A., and Peltonen, L. (1996). Efﬁcient construction of a physical map by ﬁber-FISH of the CLN5 region: Reﬁned assignment and long-range contig covering the critical region on 13q22. Genomics 35, 71–78. Lang, A. H., Hirvasniemi, A., and Siivola, J. (1997). Neurophysiological ﬁndings in the northern epilepsy syndrome. Acta Neurol. Scand. 95, 1–8. Lonka, L., Kytt¨al¨a, A., Ranta, S., Jalanko, A., and Lehesjoki, A.-E. (2000). The neuronal ceroid lipofuscinosis CLN8 membrane protein is a resident of the endoplasmic reticulum. Hum. Mol. Genet. 9, 1691–1697. Martin, J.-J., Ceuterick, C., Elleder, M., Kraus, J., Nevsimalov´a, S., Sixtov´a, K., Zeman, J., Santavuori, P., Chabrol, B., Kohlsch¨utter, A., Lake, B. D., Christomanou, H., Cardona, F., Nardocci, N., Kmiec, T., Pineda, M., Mil´a, M., Ferrer, I., Navarro, C., Uvebrant, P., Hofman, I., Taschner, P. E. M., Williams, R. E., Topc¸u, M., and C ¸ aliskan, M. (1999). NCL in different European countries. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel, S. E. Mole, and B. D. Lake, eds.), pp. 128–141. IOS Press, Amsterdam, The Netherlands. Messer, A., and Flaherty, L. (1986). Autosomal dominance in a late-onset motor neuron disease in the mouse. J. Neurogenet. 3, 345–355. Messer, A., and Plummer, J. (1993). Accumulating autoﬂuorescent material as a marker for early changes in the spinal cord of the Mnd mouse. Neuromuscul. Disord. 3, 129–134. Messer, A., Plummer, J., Wong, V., and Lavail, M. M. (1993). Retinal degeneration in motor neuron degeneration (mnd) mutant mice. Exp. Eye Res. 57, 637–641. Messer, A., Plummer, J., MacMillen, M. C., and Frankel, W. N. (1995). Genetics of primary and timing effects in the mnd mouse. Am. J. Med. Genet. 57, 361–364. Norio, R., Nevanlinna, H. R., and Perheentupa, J. (1973). Hereditary diseases in Finland; rare ﬂora in rare soul. Ann. Clin. Res. 5, 109–141. Pardo, C. A., Rabin, B. A., Palmer, D. N., and Price, D. L. (1994). Accumulation of the adenosine triphosphate synthase subunit C in the mnd mutant mouse. A model for neuronal ceroid lipofuscinosis. Am. J. Pathol. 144, 829–835. Peltonen, L. (1997). Molecular background of the Finnish disease heritage. Ann. Med. 29, 553– 556. Ranta, S., Lehesjoki, A. E., Hirvasniemi, A., Weissenbach, J., Ross, B., Leal, S. M., de la Chapelle, A., and Gilliam, T. C. (1996). Genetic and physical mapping of the progressive epilepsy with mental retardation (EPMR) locus on chromosome 8p. Genome Res. 6, 351–360. Ranta, S., Lehesjoki, A. E., de Fatima Bonaldo, M., Knowles, J. A., Hirvasniemi, A., Ross, B., de Jong, P. J., Soares, M. B., de la Chapelle, A., and Gilliam, T. C. (1997). High-resolution mapping and transcript identiﬁcation at the progressive epilepsy with mental retardation locus on chromosome 8p. Genome Res. 7, 887–896. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M. F., Hirvasniemi, A., de la Chapelle, A., Gilliam,

140

S. Ranta et al.

T. C., and Lehesjoki, A. E. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Rapola, J., and Lake, B. (2000). Lymphocyte inclusions in Finnish variant late infantile neuronal ceroid lipofuscinosis (CLN5). Neuropediatrics 31, 33–34. Rapola, J., L¨ahdetie, J., Isosomppi, J., Helminen, P., Penttinen, M., and J¨arvel¨a, I. (1999). Prenatal diagnosis of variant late infantile neuronal ceroid lipofuscinosis (vLINCL; CLN5). Prenat. Diagn. 19, 685–688. Santavuori, P. (1988). Neuronal ceroid-lipofuscinoses in childhood. Brain. Dev. 10, 80–83. Santavuori, P., Haltia, M., Rapola, J., and Raitta, C. (1973). Infantile type of scalled neuronal ceroidlipofuscinosis. A clinical study of 15 patients. J. Neurol. Sci. 18, 257–267. Santavuori, P., Rapola, J., Sainio, K., and Raitta, C. (1982). A variant of Jansky-Bielschowsky disease. Neuropediatrics 13, 135–141. Santavuori, P., Rapola, J., Nuutila, A., Raininko, R., Lappi, M., Launes, J., Herva, R., and Sainio, K. (1991). The spectrum of Jansky-Bielschowsky disease. Neuropediatrics 22, 92–96. Santavuori, P., Rapola, J., Raininko, R., Autti, T., Lappi, M., Nuutila, A., Launes, J., and Sainio, K. (1993). Early juvenile neuronal ceroid-lipofuscinosis or variant Jansky-Bielschowsky disease: Diagnostic criteria and nomenclature. J. Inherit. Metab. Dis. 16, 230–232. Santavuori, P., Rapola, J., Haltia, M., Tyynel¨a, J., Peltonen, L., and Mole, S. E. (1999). CLN5 Finnish Variant Late Infantile NCL. In: “The Neuronal Ceroid Lipofuscinoses (Batten Disease)” (H. H. Goebel, S. E. Mole, and B. D. Lake, eds.), pp. 91–101. IOS Press, Amsterdam, The Netherlands. Savukoski, M. (1999). Molecular genetics of the late infantile neuronal ceroid lipofuscinosis (LINCL): One gene (CLN5) and two gene loci (CLN2 and CLN6). Academic dissertation, National Public Health Institute. Savukoski, M., Kestil¨a, M., Williams, R., J¨arvel¨a, I., Sharp, J., Harris, J., Santavuori, P., Gardiner, M., and Peltonen, L. (1994). Deﬁned chromosomal assignment of CLN5 demonstrates that at least four genetic loci are involved in the pathogenesis of human ceroid lipofuscinoses. Am. J. Hum. Genet. 55, 695–701. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Tahvanainen, E., Ranta, S., Hirvasniemi, A., Karila, E., Leisti, J., Sistonen, P., Weissenbach, J., Lehesjoki, A. E., and de la Chapelle, A. (1994). The gene for a recessively inherited human childhood progressive epilepsy with mental retardation maps to the distal short arm of chromosome 8. Proc. Natl. Acad. Sci. (USA) 91, 7267–7270. Tyynel¨a, J., Suopanki, J., Santavuori, P., Baumann, M., and Haltia, M. (1997). Variant late infantile neuronal ceroid-lipofuscinosis: Pathology and biochemistry. J. Neuropathol. Exp. Neurol. 56, 369– 375.

7

Molecular Genetic Testing for Neuronal Ceroid Lipofuscinoses Nanbert Zhong∗ Molecular Neurogenetic Diagnostic Laboratory New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314 and Department of Neurology SUNY Health Science Center at Brooklyn Brooklyn, New York 11203

I. Introduction II. Specimens Required for Genetic Testing A. Peripheral Blood B. Tissues III. Molecular Genetic Testing for JNCL A. Molecular Testing for the 1.02-kb Common Deletion in the CLN3 Gene B. Molecular Detection of Uncommon Mutations IV. Molecular Genetic Testing for LINCL and INCL A. Molecular Testing for Common Mutations in INCL and LINCL B. Gene Scan of Uncommon Mutations in LINCL V. Molecular Screening of Carrier Status in NCL Families A. Family Members of Individuals with NCL are Encouraged to be Screened for Carrier Status B. Characterize Familial Mutations before Screening for Carrier Status is Requested VI. Prenatal Diagnostic Testing for NCL A. Specimens Used for Prenatal Molecular Testing * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

141

142

N. Zhong

B. Information about Familial Mutation(s) is a Basic Requirement for Prenatal Molecular Genetic Testing C. Molecular Approaches for Prenatal Diagnosis of NCL VII. Important Issues in the Molecular Genetic Testing A. Testing Five Common Mutations in CLN1 , CLN2 , and CLN3 may Detect 70% of Classical INCL, LINCL, and JNCL Cases B. Clinical and Pathological Data Should be Collected before Genetic Testing is Requested C. Molecular Screening of Carrier Status in NCL-Affected Families is Encouraged References

ABSTRACT Eight different NCL forms have been recognized to be encoded by genes CLN1–8. CLN1,2,3,5,and8 have been cloned, and at least 85 mutations have been detected. Molecular technology can now be applied to genetic testing for NCLs; testing is now available in clinic diagnostic and research laboratories for CLN genes that have been cloned. Molecular genetic testing makes it possible not only to conﬁrm clinical and pathological diagnoses but also to offer pre-symptom diagnosis and carrier screening for NCL families. In addition, DNA-based mutation analysis may predict prenatal outcome more accurately for pregnant women in NCL families.

I. INTRODUCTION The neuronal ceroid lipofuscinoses (NCLs) are a group of newly categorized lysosomal storage disorders with autosomal recessive inheritance. Eight different NCL forms have been recognized in this group, which result from not only the deﬁciency of lysosomal enzymes but also the dysfunction of structural proteins (Mole, 1998; Bennett and Hofmann, 1999; Zhong, 2000). Clinically, NCLs are characterized by progressive deterioration of vision, seizures, cognitive and motor dysfunction, and involuntary movement and developmental disabilities. Three classical NCL forms, the infantile (INCL), late-infantile (LINCL), and juvenile (JNCL), are among the most common childhood-onset neurodegenerative disorders, with an estimated incidence of 1/12,500 to 1/100,000 globally (Mole, 1998). In the United States, more than 440,000 families are affected by NCL (Rider and Rider, 1997), and this ﬁgure has increased in recent years with the progress of molecular genetic testing.

7. DNA Testing for NCL

143

Clinically, the ﬁrst presenting symptom in NCL may vary among the eight different forms, which are distinguished typically on the basis of age at onset, clinical manifestations, and ultrastructural ﬁndings (Wisniewski et al., 1998, 1999, 2000). The typical ultrastructural ﬁndings of lysosomal storage of lipofuscin inclusions in NCL are composed of granular osmiophilic deposits (GRODs) in INCL, mainly curvilinear (CV) proﬁles in LINCL, and ﬁngerprint (FP) proﬁles in JNCL (Wisniewski et al., 1998). Eight genes, designated CLN1–8, have been recognized to encode the different NCL forms. Five of them, CLN1–3, CLN5, and CLN8, encoding INCL, LINCL, JNCL, FNCL (Finnish-variant LINCL), and progressive epilepsy with mental retardation (EPMR) respectively, have been cloned (International Batten Disease Consortium, 1995; Vesa et al., 1995; Sleat et al., 1997; Savukoski et al., 1998; Ranta et al., 1999). At least 77 mutations, including 26 in CLN1, 26 in CLN2, and 25 in CLN3 (Mole et al., 1999), and four novel mutations, including three point mutations and one small deletion in CLN2 (Zhong et al., unpublished data), have been identiﬁed in classical NCL-affected patients. Five mutations, the 223A→G (Y109D) and 451 C→T (R151X) in CLN1, 636 C→T (R280X) and T523-1 G →C (IVS 5-1) in CLN2, and a deletion of 1.02-kb genomic fragment involving exon 7-8 of CLN3, have been characterized as common in INCL, LINCL, and JNCL (International Batten Disease Consortium, 1995; Munroe et al., 1997; Das et al., 1998; Zhong et al., 1998a, 1998b, 2000a). In addition, three mutations were observed in CLN5 in which a 2-bp deletion in exon 4 accounts for almost 90% (17/19) of mutations detected (Savukoski et al., 1998). A missense mutation, 70C→G resulting in R24G, was found to be homozygous in EPMR patients and co-segregated with EPMR phenotypes (Ranta et al., 1999). Molecular cloning, mutation identiﬁcation in CLN genes, and characterization of common mutations in different forms of NCLs make it possible to offer molecular genetic testing for either conﬁrming pathological ﬁndings and clinical diagnosis or identifying familial mutation(s) that would be beneﬁcial for presymptom diagnosis, carrier screening, and prediction prenatally of outcome of pregnancy in NCL families. In this chapter, an overview of molecular genetic testing of NCL, along with diagnostic strategies for requesting genetic testing, is discussed.

II. SPECIMENS REQUIRED FOR GENETIC TESTING A. Peripheral blood Genomic DNA is the most common material used for genetic testing. The DNA can be extracted from any human tissues, including peripheral white blood cells. Usually, 5–10 ml of whole blood from an adult or 3–5 ml from a child are required

144

N. Zhong

for DNA extraction. The peripheral blood should be drawn into purple-topped vaccutainer tubes containing EDTA-K3. Classically, genomic DNA is extracted from white blood cells with proteinase K and phenol/chloroform. This procedure provides good-quality DNA with little protein contamination, which can be used for both Southern hybridization and polymerase chain reaction (PCR). Recently, variant commercial kits have become available, most of which replace phenol/chloroform with high-salt solution to precipitate proteins (Buffone, 1985). In our laboratory, we use the Puregene kit (Gentra, Minneapolis, MN) for routine DNA extraction for NCL specimens. The quality and quantity of the isolated genomic DNA are good for both Southern hybridization and PCR and can be stored at 4◦ C for years without degradation. RNA is used for research-based genetic testing. The RNA can be extracted directly from peripheral blood or more commonly from banked cell cultures of ﬁbroblasts or lymphoblasts. For the latter 5–10 ml of blood are drawn in green-topped tubes, lymphocytes are isolated, and a long-term lymphoblast cell line is established by transfection with Epstein-Barr (EB) virus. The extracted RNA is used for Northern hybridization to detect gene deletion and mRNA splicing(s), and for reverse transcription (RT) to perform RT-PCR to study gene mutation(s) at the cDNA level.

B. Tissues Genomic DNA can be extracted from any human tissues. Tissues may be obtained from biopsy or autopsy specimens, such as human brain, skin, or muscle. A commercial kit for isolating genomic DNA can be used. However, for extracting genomic DNA from brain tissues, we recommend to use the classical proteinase/phenol protocol.

III. MOLECULAR GENETIC TESTING FOR JNCL A. Molecular testing for the 1.02-kb common deletion in the CLN3 gene

1. PCR ampliﬁcation of the 1.02-kb common deletion A 1.02-kb deletion of the genomic fragment involving exons 7 and 8 in the CLN3 gene underlying JNCL was found to be the common mutation in JNCL alleles (International Batten Disease Consortium, 1995). DNA testing of this common deletion was described either with a protocol of long-range PCR (Zhong et al., 1998a) or a protocol of allele-speciﬁc ampliﬁcation (Taschner et al., 1997). Both protocols can be scaled down to 10-␮l reaction and detected by micro-agarose gel (Zhong et al., 2000).

145

7. DNA Testing for NCL

Long-range PCR ampliﬁes a single 3.3-kb genomic fragment from normal individuals, double bands of 2.3 kb and 3.3 kb from heterozygous carriers, and a single band of 2.3 kb from JNCL-affected patients (Zhong et al., 1998a). Allelespeciﬁc PCR detects a 729-bp single band from normal controls, 729-bp/426-bp bands from heterozygotes, and a 426-bp single band from JNCL-affected patients (Taschner et al., 1997). Both procedures have been validated for clinical molecular diagnostic testing (Zhong et al., 2000a).

2. Protocols of DNA testing for the 1.02-kb deletion Primers used for detecting the common 1.02-kb deletion in the CLN3 gene are provided in Table 7.1. PCR reaction is conducted in a ﬁnal volume of 10 ␮l in 0.2-ml thin-wall PCR tube(s). Long-range PCR employs Taq Extender for amplifying long (>2-kb) fragments from genomic DNA (Table 7.2). Only the twosegment thermocycling condition (30 s at 94◦ C, and 5 min at 72◦ C) is performed. A regular PCR reaction containing three primers and routine condition with three-segment thermocycling is applied in allele-speciﬁc PCR (Table 7.3). PCR product is detected with 1% agarose gel (Zhong et al., 2000a). Table 7.1. Primers Used for Testing Common Mutations in CLN1–3 NCL

Gene

INCLa

CLN1

LINCLa

JNCL

CLN2

CLN3

Mutation

Primer

Sequence

Ta

223A→G

223F 223A 223G

ggagttgtaagtgagttatag ccttacctccatcagggt ccttacctccatcagggg

57◦ C

451C→T

451F 451C 451T

ttctcacagtgccttgtgc gctctctcctgggcatcg gctctctcctgggcatca

57◦ C

IVS5-1

IntR1 T523-1G T523-1C

ggtggtaaggaattgaggac agcctgacttctccctacag agcctgacttctccctacac

64◦ C

636C→T

636C 636T

ccctctgtgatccgtaagc cccctctgtgatccgtaagt

1.02-kb deletion

BDNZ1Fb BDNZ2R

attctgtggggaccagcctgtgtg gcctcaggagatgtgagcaacaag

72◦ C

INTF7c 3.3R 2.3R

cattctgtcacccttagaagcc gggggaggacaagcactg ggacttgaaggacggagtct

56◦ C

Ta: annealing temperature for PCR-thermocycling. a Zhong et al. (2000). b Zhong et al. (1998a). c Taschner et al. (1997).

146

N. Zhong Table 7.2. PCR Ampliﬁcation for 1.02-kb Deletion in CLN3 Final concentration

1 × (␮l)

Long-range PCR dH2O 10 × Taq Extender buffer (Stratagene) dNTPs [10 mM] (Perkin-Elmer) Mixed primers (50 pmol/each) Taq Extender (Stratagene) Taq Polymerase (Perkin-Elmer) DNA

— 1× 1 mM 0.3125 pmol 0.125 U/␮l 0.125 U/␮l ∼1 ng/␮l

6.125 1.0 1.0 0.125 0.5 0.25 1.0

Allele-speciﬁc PCR dH2O 10 × Taq Buffer II (Perkin-Elmer) dNTPs [2.5 mM] (Perkin-Elmer) MgCl2 [25 mM] (Perkin-Elmer) Mixed primers (50 pmol/each) Taq Polymerase (Perkin-Elmer) DNA

— 1× 0.2 mM 1.5 mM 0.5 pmol 0.025 U/␮l ∼1 ng/␮l

7.05 1.0 0.8 0.6 0.1 0.05 1.0

Reagents

3. Interpretation of testing results It has been reported that up to 96% of JNCL alleles carry the 1.02-kb deletion, which is most likely in a homogenous population, such as the Finnish (J¨arvel¨a et al., 1996), or in clinically typical and well-characterized JNCL patients (Munroe et al., 1997). However, testing for the 1.02-kb deletion in the CLN3 gene may diagnose ∼70% of clinically referred JNCL cases in North America (Zhong et al., 1998a, 2000). The remaining 30% would be uncommon mutations, including point mutations, insertions, and non-1.02-kb deletions (International Batten Table 7.3. ASPE Reaction (␮l) for Common Mutations in CLN1 and CLN2

dH2O 10 × Taq Buffer II (Perkin-Elmer) dNTPs [2.5 mM] (Perkin-Elmer) MgCl2 [25 mM] (Perkin-Elmer) Common primer [50 pmol/␮l] Allele-specifc primer [50 pmol/␮l] Taq Polymerase [5u/␮l] (Perkin-Elmer) DNA [10 ng/␮l] Total

CLN1

CLN2

12.7 2.0 1.6 1.2 0.2 0.2 0.1 2.0 —— 20

16.375 2.5 2.0 1.25 0.125 0.125 0.125 2.5 ——– 25

7. DNA Testing for NCL

147

Disease Consortium, 1995; Munroe et al., 1997; Zhong et al., 1998a). Three possible DNA testing results: a single normal band “N,” a single mutant band “M,” or double-bands of both normal and mutant “N/M,” are expected. 1. Interpretation of ﬁnding of a single PCR band “M” is that the subject is affected with JNCL. 2. Detection of both “N” and “M” bands indicates that the subject is heterozygous for the 1.02-kb deletion. The subject could be either an affected JNCL patient who carries another uncommon mutation on the second allele or a carrier who does not have a mutation on the second chromosome. Distinguishing JNCL-affected patients from carriers requires integration of clinical information and pathological ﬁndings. Usually, this is not difﬁcult to obtain for elderly individuals once clinical neurodegenerative symptoms and electron microscopic (EM) ﬁngerprint (FP) proﬁles are documented. However, it is not easy for younger siblings who have not yet reached the age of clinic onset. 3. Interpretation of the ﬁnding of the homozygote of “N” alleles is complicated. A single “N” band can be seen in normal individuals from the general population as well as in JNCL-affected individuals who have uncommon mutations on both chromosomes. If a subject has typical JNCL clinical and pathological phenotypes but no 1.02-kb deletion has been detected on both chromosomes, further study with gene scan on the CLN3 locus to investigate mutation(s) other than the 1.02-kb deletion is highly recommended.

B. Molecular detection of uncommon mutations

1. Single-strand conformation polymorphism (SSCP) analyses To date, at least 24 mutations have been reported as familial-speciﬁc or “private” mutations in the CLN3 gene (Mole et al., 1999). They spread along the CLN3 locus (Munroe et al., 1997) that encodes a 1.7-kb transcript (International Batten Disease Consortium, 1995) and spans 16 kb in the genomic structure (Mitchison et al., 1998a). These mutations include point mutations and large and small deletions. Some of them involve intron–exon junction sites that lead to splicing errors. Most mutations that account for 63% (15/24) cluster at exons 6, 7, 8, and 13. So far, no mutation has been reported at exons 1 to 4 or at the promoter region. Application of SSCP technology combined with direct DNA sequencing can speciﬁcally analyze the clustered regions and possibly detect the clustered mutations (Munroe et al., 1997; Zhong et al., 1998b); this methodology is sensitive enough, combined with the sensitivity of detecting the 1.02-kb deletion, of detecting ∼90% of JNCL mutations reported.

148

N. Zhong

2. RT-PCR to analyze mutation in the CLN3 coding region One approach for detecting any mutation(s) in the cDNA region, including aberrant splicing, is reverse-transcribing mRNA into cDNA, followed by PCR to amplify the CLN3 coding region. Total RNA extracted, as described above, from cultured lymphcytes or ﬁbroblasts, or directly from whole blood, is used as template for reverse transcription (RT). The synthesized cDNA is ampliﬁed by primers (forward: 5 gacctgaacttgatg, reverse: 5 ctgcgtcctgaggatcc) to obtain a 1.3-kb fragment of the CLN3 coding sequence. This approach is good for detecting deletion/insertion or aberrant splicing when the ampliﬁed PCR products are mobilized in high-resolution gel. However, we have found that RT-PCR ampliﬁed mRNA products were heterogenous species, which included a lot of in vivo alternatively spliced mRNA molecules with unknown reason, especially when longterm cultures of EB-tranfected lymphoblasts were used as the source of extracting RNA (Zhong et al., unpublished data). Employing cultured ﬁbroblasts or RNA extract directly from fresh blood may improve the artiﬁcial splicing forms of CLN3 mRNA, but once alternatively spliced mRNA is detected, it is difﬁcult to interpret the result unless mutation(s) can be conﬁrmed from intron–exon junction(s) in genomic DNA.

3. Gene scan for CLN3 locus Gene scan refers to molecular studies of the whole CLN3 gene locus. Technically, it refers to PCR ampliﬁcation and sequencing analyses of the whole genomic sequence of the CLN3 genomic structure, which would include the whole exon sequences, intron–exon junctions, and CLN3 promoters as well as some intron sequences. We have developed PCR/sequencing analyses to conduct gene scans that analyze all exons, intron–exon junctions, and ∼1-kb of promoter region sequences (Zhong et al., unpublished data). The ampliﬁed genomic DNA fragments ranges from 0.5 to 1.2 kb. Direct sequencing of the PCR-ampliﬁed DNA fragments would allow detecting any mutation(s) embedded. Gene scan is labor-intensive, costly, and time-consuming. Usually, it is done on a research-based analysis. Applying robotic automation may stimulate this study. However, gene scan may be the best approach for searching for mutations in JNCL-affected patients who have been characterized to be heterozygous for the 1.02-kb deletion but for whom a mutation on the second allele is unknown. In addition, gene scan may be applied to study clinically typical JNCL cases with typical ﬁngerprint (FP) proﬁle detected pathologically but for which no mutations could be detected by either SSCP or RT-PCR. Generally speaking, if no mutation can be found by gene scan, a variant form of NCL should be considered and other loci such as CLN1 should be studied (see discussion that follows).

7. DNA Testing for NCL

149

4. Southern hybridization for detecting large deletion Large deletions involving the CLN3 locus may not be detected by the molecular technology described above, especially if the deletion involves only one chromosome. Four deletions, including the 1.02-kb common deletion, have been reported, among which the largest deletion is 6 kb, spanning intron 5 to intron 15. The three uncommon deletions account for 12.5% (3/24) of CLN3 mutations. Use of a probe of cDNA2-3 to hybridize genomic DNA on Southern blot that is digested with restriction enzyme Pst I may detect these deletions (International Batten Disease Consortium, 1995).

IV. MOLECULAR GENETIC TESTING FOR LINCL AND INCL A. Molecular testing for common mutations in INCL and LINCL

1. Ampliﬁcation of common mutations in CLN1 and CLN2 Four point mutations, 223A→G (Y109D) and 451 C→T (R151X) in CLN1, and 636 C→T (R280X) and T523-1 G→C (IVS 5-1) in CLN2, have been characterized as common (Das et al., 1998; Zhong et al., 1998b) and account for two-thirds of clinically referred INCL and LINCL cases (Zhong et al., 2000a). PCR protocols with allele-speciﬁc primer extension (ASPE) have been applied successfully in amplifying speciﬁcally for these four common mutations (Zhong et al., 2000a).

2. ASPE-PCR ASPE employs two sets of PCR reactions, one for detecting the normal (N) allele and the other for the mutant (M) allele, to test a speciﬁc point mutation. Each reaction contains a common primer and an allele-speciﬁc primer (Table 7.1). PCR is conducted in 20- to 25-␮l reactions (Table 7.3), and four controls, including one normal, one heterozygote, and one homozygote of the speciﬁc mutation and one blank with dH2O, are always included in each batch of ASPE ampliﬁcation (Fig. 7.1).

3. Interpretation of test results The three outcomes obtained from ASPE-PCR consist of N/N, N/M, and M/M. The N presents a normal allele, and M presents a mutant allele (Figure 7.1). 1. A DNA testing result of N/N indicates that only one normal allele could be detected from both chromosomes. This is always seen in normal controls and

150

N. Zhong

Figure 7.1. ASPE-PCR of common mutations in CLN1 and CLN2. Arrows indicate normal (N) and mutant (M) alleles. Testing for mutation 451T→C (R151X) in CLN1 (a), and 636 C→T (R280X) in CLN2 (b) is shown. M/M is homozygous and N/M is heterozygous for the mutation. N/N is homozygous with no mutation detected. Lane “B” is a blank control.

in NCL-affected individuals who do not carry the speciﬁc mutation being tested in both chromosomes. 2. A result of N/M indicates that the subject being tested carries the speciﬁc mutation in one chromosome, but not in the second chromosome. This is seen either in carriers such as parents and normal siblings of an affected child in an NCL family. Affected individuals who have a common mutation that is

7. DNA Testing for NCL

151

being tested in one allele but another uncommon mutation in the second allele may also show the N/M pattern. 3. M/M is interpreted as NCL-affected because mutations are found on both chromosomes. The individual is homozygous for the mutation.

4. Alternative analyses of common mutations in CLN2 PCR ampliﬁcation of a fragment that contains both mutations 636 C→T (R280X) and T523-1 G→C (IVS 5-1) in CLN2 followed by direct DNA sequencing analyses has been described previously (Zhong et al., 1998b). Using this approach, we identiﬁed a novel mutation at IVS5-1, T523-1 G→A, causing aberrant RNA splicing (Hartikainen et al., 1999).

B. Gene scan of uncommon mutations in LINCL

1. Mutations identiﬁed from CLN2 locus The genomic structure of CLN2 locus, which is localized at 11p15, consists of 13 exons and 12 introns and spans a 6.7-kb genomic sequence (Liu et al., 1998). A total of 26 mutations have been identiﬁed in the CLN2 gene (Mole et al., 1999). Using 13 pairs of primers, Sleat et al. (1999) identiﬁed 24 mutations, including the two common mutations as well as T523-1 G→A described above from 74 classical LINCL families. Unlike mutations for JNCL that cluster at certain exons in CLN3, mutations in CLN2 spread along the whole coding sequence (Sleat et al., 1999).

2. Gene scan of CLN2 We have developed a gene scan approach to study the whole CLN2 locus (GenBank Accession # AF039704). Four genomic fragments ranging from 0.9 to 1.3 kb that include the entire CLN2 coding sequence, all exon–intron junctions, some intronic sequences, and a ∼500-bp promoter region (Liu et al., 1998) can be PCR-ampliﬁed and sequenced. Recently, four novel mutations, two missense mutations (G284V, R127Q), one nonsense mutation (W460X), and one small deletion, have been identiﬁed (Zhong et al., 2000b) in LINCL-affected individuals who were heterozygous for one of the two common mutations.

V. MOLECULAR SCREENING OF CARRIER STATUS IN NCL FAMILIES A. Family members of individuals with NCL are encouraged to be screened for carrier status NCLs encoded by CLN1–8 genes are inherited in an autosomal recessive manner. Parents of NCL-affected individuals are obligate carriers. When mutations

152

N. Zhong

identiﬁed from the proband who is affected with NCL are not identical on the two chromosomes, characterization of the genetic inheritance of mutations should be the primary genetic testing performed for the family in order to obtain information about which mutation derives from which chromosome. The possibility of being a carrier for nonsymptomatic sibling(s) of the proband is 2/3 and of being NCL-affected is 1/3. Genetic testing for these sibling(s) may help identify carrier status and make presymptomatic diagnosis. Grandparents from both maternal and paternal sides should be tested to trace the mutation. Secondary-degree relatives of the proband, such as uncles and aunts, are encouraged to have genetic testing because they all have a 50% possibility of being carriers. If carrier status is conﬁrmed, their offspring can be offered the test.

B. Characterize familial mutations before screening for carrier status is requested Information on familial mutation(s) should be known in advance of requesting molecular testing for screening carrier status. This information may help the DNA diagnostic laboratory study the speciﬁc locus. If there is no familial information regarding the mutation(s), a nonspeciﬁc “shotgun” approach to exclude common mutations may help identify genetic risk of being a carrier (Zhong et al., 2000a). Usually, this nonspeciﬁc testing is used only for the normal mate of an NCL carrier to predict genetic risk for their offspring(s). We have performed carrier screening in 165 individuals from genetically characterized NCL families, among which we identiﬁed 70 (42%) carriers (Zhong et al., 2000a).

VI. PRENATAL DIAGNOSTIC TESTING FOR NCL A. Specimens used for prenatal molecular testing Chorionic villus samples (CVS) and aminiotic ﬂuid (AF) obtained during the ﬁrst trimester are the most common specimens used for routine prenatal testing, although fetal blood cells can be isolated from maternal peripheral blood at an earlier stage. Ten to twenty milligrams (mg) of CVS is usually obtained by 10–12 weeks’ gestation, but could be obtained as early as the ninth gestational week. CVS specimens must be dissected to clean up maternal materials contaminated before sending to the DNA diagnostic laboratory. AF is usually obtained by 14–16 weeks’ gestation. DNA can be isolated directly from CVS and AF cells, although the yield of recovered DNA is low. Directly isolated DNA is usually enough for most PCRbased molecular testing, which can shorten the period of obtaining testing results.

7. DNA Testing for NCL

153

Cultured CVS or AF is preferred to conﬁrm genetic testing results obtained from directly extracted DNA and kept as backup specimens. This is very important if the pregnant mother is a heterozygote and testing result showed that the fetus is also heterozygous. Cultured CVS or AF must be tested to conﬁrm that the carrier status of the fetus is not an artiﬁcial result from the contamination of maternal materials. Other fetal tissues including fetal blood, skin, liver, umbilical vessels, and brain can be used for prenatal diagnosis, too (Chow et al., 1993). Prenatal diagnosis may also be performed at an earlier stage in single blastomeres from in vitro-fertilized embryos (Syvanen et al., 1997).

B. Information about familial mutation(s) is a basic requirement for prenatal molecular genetic testing To offer prenatal diagnostic testing, basic information about familial mutation(s) carrier status should be obtained in advance. Once the familial mutations have been characterized, molecular genetic testing will be able to detect the speciﬁc mutations for fetus. Information about prenatal testing may provide accurate genetic counseling. If no information regarding the familial mutation(s) is available when prenatal testing is requested, the result of prenatal testing for common mutation(s) in pregnant women should be integrated with Bayesian calculation when genetic counseling is provided to evaluate genetic risk (Zhong et al., 2000).

C. Molecular approaches for prenatal diagnosis of NCL Before the era of molecular genetics, prenatal diagnosis of NCL depended on ultrastructural studies with electron microscopy (EM). MacLeod et al. (1984, 1985, 1988) successfully identiﬁed curvilinear (CV) inclusions from uncultured AF cells at 16 weeks’ gestation, by which LINCL was diagnosed. Examination of uncultured CVS tissues, with either membrane-bound inclusions in typical INCL (Rapola et al., 1988, 1990; Goebel et al., 1995) or ﬁngerprint (FP) inclusions in typical JNCL (Conradi et al., 1989) could be observed in the ﬁrst trimester of pregnancies. Negative evidence of FP in uncultured AF cells, lymphocytes isolated from fetal blood, or fetal skin biopsy specimens excludes the presence of JNCL (Kohlschutter et al., 1989). If the gene underlying a particular NCL has not yet been cloned, indirect testing with linkage studies would play an important role. Molecular-based prenatal diagnosis was ﬁrst applied for INCL with restriction fragment length polymorphism (RFLP) (J¨arvel¨a et al., 1991). PCR-based polymorphic marker may also be employed for indirect prenatal diagnosis, once the underlying gene is assigned to a particular locus (Vesa et al., 1993; Taschner et al., 1995).

154

N. Zhong

Presently, most molecular prenatal diagnoses are conducted with direct molecular testing, for which information about familial mutation(s) is valuable to focus the prenatal testing with the molecular technology described above. The ﬁrst DNA-based direct prenatal diagnosis was reported by Munroe et al. (1996) to test a 1.02-kb deletion in a JNCL-affected family. Currently, molecular testing of speciﬁc mutation(s) is available for INCL (de Vries et al., 1999), LINCL (Berry-Kravis et al., 2000), JNCL (Munroe et al., 1996), and FNCL (Syvanen et al., 1997; Rapola et al., 1999). Theoretically, it should be available for EPMR, too, because most EPMR contains a common missense mutation of 70C→G (Ranta et al., 1999). Recently, our laboratory has conducted molecular prenatal tests for ﬁve pregnancies with uncultured AF or CVS, one for INCL, three for LINCL, and one for JNCL (Zhong et al., unpublished data).

VII. IMPORTANT ISSUES IN THE MOLECULAR GENETIC TESTING A. Testing ﬁve common mutations in CLN1 , CLN2 , and CLN3 may detect 70% of classical INCL, LINCL, and JNCL cases Testing for the ﬁve common mutations, the 223A→G and 451 C→T in CLN1, 636 C→T and T523-1 G→C in CLN2, and a 1.02-kb deletion in CLN3, allows identiﬁcation of at least 70% of classical pediatric NCL cases (Zhong et al., 2000). This ﬁgure, obtained from testing 180 NCL families (Table 7.4), conﬁrmed that these ﬁve mutations account for the majority of NCL mutations. However, negative results from testing the common mutations should be carefully interpreted and detailed explanation should be provided for patients and families who request genetic testing, because the subject who has been tested may still carry uncommon mutation(s) that account for the remaining 30% of clinically referred NCL cases.

Table 7.4. Frequency of NCL Homozygotes and Heterozygotes Frequency (%) INCL (n = 27)

LINCL (n = 76)

JNCL (n = 77)

Homozygotes Double hetrozygotes Single hetrozygotes

6 (22.2) 4 (14.8) 11 (40.7)

14 (18.4) 7 (9.2) 33 (43.4)

42 (54.5)

Total probands detected

21 (77.8)

54 (65.8)

58 (75.3)

Mutations

16 (24.7)

7. DNA Testing for NCL

155

B. Clinical and pathological data should be collected before genetic testing is requested Clinical symptoms, such as the age at onset, the ﬁrst symptom of seizure or vision loss, and pathological ﬁndings, are important to evaluate different forms of NCL (Wisniewiski et al., 1992, 1998, 1999). Ultrastructural study should be conducted before the case is referred to DNA testing. Classical NCLs usually show typical EM proﬁle(s), which may help in determining which CLN gene should be the focus of initial DNA testing. The importance of pathological ﬁndings has been documented in atypical JNCL and LINCL patients who carry GROD proﬁles (Mitchison et al., 1998b); in these patients, mutations on the CLN1 gene, rather than CLN2 or CLN3, should be tested initially. If EM cannot detect lysosomal inclusions of lipofuscin storage from buffy coats or skin punch biopsy, the referred individual is usually not likely to have NCL. If INCL or LINCL can be determined by testing PPT1 or TPP1 (Vesa et al., 1995; Sleat et al., 1997) to show lysosomal enzyme deﬁciency, gene scan should be offered deﬁnitely to characterize familial mutation(s). Occasionally, in clinically and pathologically diagnosed NCL patient(s), deﬁciency cannot be documented in the CLN1–3 genes that underlie classical NCLs; in these cases, the gene or locus for a variant form of NCL should be considered. Ethnic background is as an important issue to direct DNA testing for CLN5–8, although CLN6−7 are still being identiﬁed and cloned.

C. Molecular screening of carrier status in NCL-affected families is encouraged As a result of genetic testing, the incidence of NCL is now higher than it used to be. The estimated NCL frequency has increased from 1/100,000 to 1/25,000–1/12,500 (Rider and Rider, 1997; Mole, 1998), and the carrier frequency has increased from 1/150 to 1/55–1/80 in the general population. If a carrier mates randomly with an individual from the general population, the possibility of having an affected child in the family would be 1/220 to 1/320. DNA testing will help predict more accurately the genetic risks for the pregnancy. If negative results were obtained by testing for the ﬁve common mutations, which detects ∼70% of NCL mutations, the risk of the couple having an affected infant would be reduced to ∼1/400 to 1/740 (Zhong et al., 2000a). Currently, no treatment is available for the NCLs. Knowing carrier status and having prenatal testing is the only way to prevent NCL-affected pregnancies. Because of the increased frequency of both affected individuals and carriers, molecular screening in children who have progressive seizures or impairment of vision with no other abnormalities observed has been proposed (Zhong et al., 2000a), which may recognize and identify NCL patients and families at an earlier stage.

156

N. Zhong

Acknowledgments This study was supported in part by grants from the Batten Disease Support and Research Foundation (BDSRA), the New York State Ofﬁce of Mental Retardation and Developmental Disabilities (OMRDD), and the Children’s Brain Research Foundation. We would like to thank all the families and physicians who have participated in our research studies.

References Bennett, M. J., and Hofmann, S. L. (1999). The neuronal ceroid lipofuscinoses (Batten disease): A new class of lysosomal storage diseases. J. Inherit. Metab. Dis. 22, 535–544. Berry-Kravis, E., Sleat, D. E., Sohar, I., Meyer, P., Donnelly, R., and Lobel, P. (2000). Prenatal testing for late infantile neuronal ceroid lipofuscinosis. Ann. Neurol. 47, 254–257. Buffone, G. J. (1985). Isolation of DNA from biological specimens without extraction with phenol. Clin. Chem. 31, 164–165. Chow, C. W., Borg, J., Billson, V. R., and Lake, B. D. (1993). Fetal tissue involvement in the late infantile type of neuronal ceroid lipofuscinosis. Prenat. Diagn. 13, 833–841. Conradi, N. G., Uvebrant, P., Hokegard, K. H., Wahlstrom, J., and Mellqvist, L. (1989). First-trimester diagnosis of juvenile neuronal ceroid lipofuscinosis by demonstration of ﬁngerprint inclusions in chorionic villi. Prenat. Diagn. 9, 283–287. Das, A. K., Becerra, C. H. R., Yi, W., Lu, J-Y., Siakotos, A. N., Wisniewski, K. E., and Hofmann, S. L. (1998). Molecular genetics of palmitoyl-protein thioesterase deﬁciency in the U.S. J. Clin. Invest. 102, 361–370. de Vries, B. B., Kleijer, W. J., Keulemans, J. L., Voznyi, Y. V., Franken, P. F., Eurlings, M. C., Galjaard, R. J., Losekoot, M., Catsman-Berrevoets, C. E., Breuning, M. H., Taschner, P. E., and van Diggelen, O. P. (1999). First-trimester diagnosis of infantile neuronal ceroid lipofuscinosis (INCL) using PPT enzyme assay and CLN1 mutation analysis. Prenat. Diagn. 19, 559–562. Goebel, H. H., Vesa, J., Reitter, B., Goecke, T. O., Schneider-Ratzke, B., and Merz, E. (1995). Prenatal diagnosis of infantile neuronal ceroid-lipofuscinosis: A combined electron microscopic and molecular genetic approach. Brain Dev. 17, 83–88. Hartikainen, J. M., Ju, W., Wisniewski, K. E., Moroziewicz, D. N., McLendon, L., Zhong, D., Brown, W. T., and Zhong, N. (1999). Late infantile neuronal ceroid lipofuscinosis is due to splicing mutations in the CLN2 gene. Mol. Genet. Metab. 67, 162–168. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949– 957. J¨arvel¨a, I., Rapola, J., Peltonen, L., Puhakka, L., Vesa, J., and Ammala, P., et al. (1991). DNA-based prenatal diagnosis of the infantile form of neuronal ceroid lipofuscinosis (INCL, CLN1). Prenat. Diagn. 11, 323–328. J¨arvel¨a, I., Mitchison, H. M., Munroe, P. B., O’Rawe, A. M., Mole, S. E., and Syv¨anen, A-C. (1996). Rapid diagnostic test for the major mutation underlying Batten disease. J. Med. Genet. 33, 1041– 1042. Kohlschutter, A., Rauskolb, R., Goebel, H. H., Anton-Lamprecht, I., Albrecht, R., and Klein, H. (1989). Probable exclusion of juvenile neuronal ceroid lipofuscinosis in a fetus at risk: An interim report. Prenat. Diagn. 9, 289–292. Liu, C-G., Sleat, D. E., Donnelly, R. J., and Lobel, P. (1998). Structural organization and sequence of CLN2, the defective gene in classical late infantile neuronal ceroid lipofuscinosis. Genomics 50, 206–212. MacLeod, P. M., Dolman, C. L., Nickel, R. E., Chang, E., Zonana, J., and Silvey, K. (1984). Prenatal diagnosis of neuronal ceroid lipofuscinosis. N. Engl. J. Med. 310, 595.

7. DNA Testing for NCL

157

MacLeod, P. M., Dolman, C. L., Nickel, R. E., Chang, E., Nag, S., Zonana, J., and Silvey, K. (1985). Prenatal diagnosis of neuronal ceroid-lipofuscinoses. Am. J. Med. Genet. 22, 781–789. MacLeod, P. M., Nag, S., and Berry, C. (1988). Ultrastructural studies as a method of prenatal diagnosis of neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. 5, 93–97. Mitchison, H. M., Munroe, P. B., O’Rawe, A. M., Taschner, P. E. M., de Vos, N., and Kremmidiotis, G., et al. (1998a). Genomic structure and complete nucleotide sequence of the Batten disease gene, CLN3. Genomics 40, 346–350. Mitchison, H. M., Hofmann, S. L., Becerra, C. H. R., Munroe, P. B., Lake, B. D., and Crow, Y. J., et al. (1998b). Mutations in the palmitoyl-protein thioesterase gene (PPT; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits. Hum. Mol. Genet. 7, 291– 297. Mole, S. E. (1998). Batten disease: Four genes and still counting. Neurobiol. Dis. 5, 287–303. Mole, S. E., Mitchison, H. M., and Munroe, P. B. (1999). Molecular basis of the neuronal ceroid lipofuscinoses: Mutations in CLN1, CLN2, CLN3, and CLN5. Hum. Mutat. 14, 199–215. Munroe, P. B., Rapola, J., Mitchison, H. M., Mustonen, A., Mole, S. E., Gardiner, R. M., and Jarvela, I. (1996). Prenatal diagnosis of Batten’s disease. Lancet 347, 1014–1015. Munroe, P. B., Mitchison, H. M., O’Rawe, A. M., Anderson, J. W., Boustany, R.-M., and Lerner, T. J., et al. (1997). Spectrum of mutations in the Batten disease gene, CLN3. Am. J. Hum. Genet. 61, 310–316. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., and Messer, A., et al. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Rapola, J., Santavuori, P., and Heiskala, H. (1988). Placental pathology and prenatal diagnosis of infantile type of neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. 5, 99–103. Rapola, J., Salonen, R., Ammala, P., and Santavuori, P. (1990). Prenatal diagnosis of the infantile type of neuronal ceroid lipofuscinosis by electron microscopic investigation of human chorionic villi. Prenat. Diagn. 10, 553–559. Rapola, J., Lahdetie, J., Isosomppi, J., Helminen, P., Penttinen, M., and Jarvela, I. Prenatal diagnosis of variant late infantile neuronal ceroid lipofuscinosis (vLINCL[Finnish]; CLN5). (1999) Prenat. Diagn. 19, 685–688. Rider, J. A., and Rider, D. L. (1997). Batten disease, a twenty-eight-year struggle: Past, present and future. Neuropediatrics 28, 4–5. Savukoski, M., Klockers, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sleat, D. E., Donnelly, R. J., Lackland, H., Liu, C-G., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Sleat, D. E., Gin, R. M., Sohar, I., Wisniewski, K., Sklower-Brooks, S., and Pullarkat, R. K., et al. (1999). Mutational analysis of the defective protease in classic late-infantile neuronal ceroid lipofuscinosis, neurodegenerative lysosomal storage disorder. Am. J. Hum. Genet. 64, 1511–1523. Syvanen, A. C., J¨arvel¨a, I., and Vesa, J. (1997). DNA diagnosis and identiﬁcation of carriers of infantile and juvenile neuronal ceroid lipofuscinoses. Neuropediatrics 28, 63–66. Taschner, P. E. M., de Vos, N., Post, J. G., Meijers-Heijboer, E. J., Hofmann, I., and Loonen, M. C., et al. (1995). Carrier detection of Batten disease (juvenile neuronal ceroid-lipofuscinosis). Am. J. Med. Genet. 57, 333–337. Taschner, P. E. M., de Vos, N., and Breuning, M. H. (1997). Rapid detection of the major deletion in the Batten disease gene CLN3 by allele speciﬁc PCR. J. Med. Genet. 34, 955–956. Vesa, J., Hellsten, E., Makela, T. P., Jarvela, I., Airaksinen, T., Santavuori, P., and Peltonen, L. (1993). A single PCR marker in strong allelic association with the infantile form of neuronal ceroid

158

N. Zhong

lipofuscinosis facilitates reliable prenatal diagnostics and disease carrier identiﬁcation. Eur. J. Hum. Genet. 1, 125–132. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Wisniewski, K. E., Kida, E., Patxot, O. F., and Connell, F. (1992). Variability in the clinical and pathological ﬁnding in the neuronal ceroid lipofuscinoses: Review of data and observations. Am. J. Med. Genet. 42, 525–532. Wisniewski, K. E., Zhong, N., Kaczmarski, W., Lach, A., Sklower-Brooks, S., and Brown, W. T. (1998). Studies of atypical JNCL suggest overlapping with other NCL forms. Pediatr. Neurol. 18, 36–40. Wisniewski, K. E., Kaczmarski, A., Kida, E., Connell, F., Kaczmarski, W., Michalewski, M. P., Woroziewicz, D. N., and Zhong, N. (1999). Reevaluation of neuronal ceroid lipofuscinoses: Atypical juvenile onset may be the result of CLN2 mutations. Mol. Genet. Metab. 66, 248–252. Zhong, N. (2000). Neuronal ceroid lipofuscinoses and possible pathogenic mechanism. Mol. Genet. Metab. 71, 195–206. Zhong, N., Moroziewicz, D. N., Jurkiewicz, A., Ju, W., Johnston, L., Wisniewski, K. E., and Brown, W. T. (2000b). Heterogeneity of late-infantile neuronal ceroid lipofuscinosis (LINCL). Genet. in Med. 2(6), in press. Zhong, N., Wisniewski, K. E., Hartikainen, J., Ju, W., Moroziewicz, D. N., Mclendon, L., Sklower Brooks, S., and Brown, W. T. (1998a). Two common mutations in the CLN2 gene underlie late infantile neuronal ceroid lipofuscinosis. Clin. Genet. 54, 234–238. Zhong, N., Wisniewski, K. E., Kaczmarski, A. L., Ju, W., Xu, W. M., Xu, W. W., Mclendon, L., Liu, B., Kaczmarski, W., Sklower-Brooks, S., and Brown, W. T. (1998b). Molecular screening of Batten disease: Identiﬁcation of a novel missense mutation (E295K). Hum. Genet. 102, 57–62. Zhong, N., Wisniewski, K. E., Ju, W., Moroziewicz, D. N., Jurkiewicz, A., Jenkins, E. C., and Brown, W. T. (2000a). Molecular diagnosis of, and carrier screening for, the neuronal ceroid lipofuscinoses (NCLs). Genet. Testing 4, 243–248.

8

Genetic Counseling in the Neuronal Ceroid Lipofuscinoses Susan Sklower Brooks∗ Department of Human Genetics New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314

I. II. III. IV. V. VI. VII. VIII.

Introduction Inheritance Genetics Diagnostic Conﬁrmation Genetic Counseling Carrier Screening Reproductive Options Conclusion References

I. INTRODUCTION The neuronal ceroid lipofuscinoses (NCLs), commonly known as Batten disease, are the most frequent neurodegenerative disorders of childhood. In the past their diagnosis was based entirely on clinical and pathological ﬁndings. Today, advances in our understanding of these disorders on a biochemical and molecular level has led to deﬁnitive testing suitable for diagnosis of affected individuals, presymptomatic diagnosis, and carrier identiﬁcation. This chapter reviews genetic counseling for the NCLs. * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

159

160

S. Sklower Brooks

Figure 8.1. Segregation of recessive forms of neuronal ceroid lipofuscinosis.

II. INHERITANCE All of the NCLs are inherited in an autosomal recessive manner with the exception of a very rare adult type (MIM163350, Parry disease) that is dominant. For the autosomal recessive disorders, each parent of an affected child is an obligate carrier and has a 50/50 chance of passing on the mutated gene. Thus, as shown in Figure 8.1, in any given pregnancy the risk that such an obligate heterozygous carrier couple will have affected child is 25% (1/4); 50% (1/2) for the child to be a carrier; and 25% (1/4) chance for the child to inherit two normal alleles. For each unaffected child the chance that he or she is a carrier is 66% (2/3).

III. GENETICS While four discrete clinical syndromes were initially deﬁned based on the age of onset and pathology, it has been clear for many years that there is genetic heterogeneity in the NCLs (see Chapter 1). This heterogeneity is due to both different genetic loci and multiple mutations within each speciﬁc locus. Molecular dissection of the NCLs has conﬁrmed that there are at least eight distinct genetic loci (Mole, 1999). They are designated CLN1 through CLN8. Six of these loci have been mapped and each is on a different chromosome (see Table 1.2; J¨arvel¨a et al., 1991a; Sharp et al., 1997; Gardiner et al., 1990;

8. Genetic Counseling in NCL

161

Savukoski et al., 1998; Tahvanainen et al., 1994). Within each distinct locus, many disease causing mutations have been identiﬁed that explain the allelic heterogeneity (www.ucl.ac.uk/ncl).

IV. DIAGNOSTIC CONFIRMATION Diagnostic conﬁrmation is critical to genetic counseling. The NCLs must be distinguished from other neurodegenerative disorders of childhood. Before genetic counseling, all records must be reviewed with careful assessment of the clinical phenotype and morphology (see Chapters 1 and 2). The family history should be carefully detailed in a pedigree. The proband, if available, should be examined. Deﬁnitive laboratory testing should be performed to conﬁrm the clinical diagnosis. If the proband is not available, testing could be carried out on the parents. Recent developments in molecular and biochemical research has led to the development of several reliable diagnostic tests to conﬁrm the diagnosis and classify the subtypes (see Chapters 4 and 7).

V. GENETIC COUNSELING Once this information is obtained, the counselor can proceed with discussion of the issues and risks with the family. For many of the NCLs the onset is late and the diagnosis may take several years to be recognized. With the diagnosis, however, the devastating nature of these conditions becomes clear to the family. By the time the diagnosis of NCL is made in the proband, the family has often had several children. When the genetic counselor begins the discussion, it is not uncommon for the family’s concern to shift from the proband to the younger children in the family, as the parents suddenly realize that their younger children are also at risk to be affected. The genetic counselor needs to address many psychosocial issues, some of which are common to families of handicapped children in general and some that relate to the progressive nature of the diseases. Issues that may arise are the anxiety provoked by not knowing the diagnosis initially and then the trauma of learning the progressive nature and fatal prognosis. Parents may have feelings of frustration, because treatment is limited to symptomatic therapy. They grieve for the “normal” child they had hoped for and lost. Parents often experience a sense of isolation from their friends and family. Several NCL support groups have formed that empower parents and reduce isolation. The Batten Disease Support and Research Association holds

162

S. Sklower Brooks

Figure 8.2. Pedigree of a family with juvenile neuronal ceroid lipofuscinosis. All three children were born prior to the onset of symptoms in the proband.

annual meetings for families and professionals, issues a newsletter, and provides telephone and Internet contacts. The Children’s Brain Disease Research Foundation has been instrumental in lobbying Congress for funding for research in NCL and for supporting meetings where families and researchers gather to advance the understanding of the NCLs. The Institute for Basic Research Batten Disease Registry collects clinical, pathological, and genetic data from families to aid in research studies. In addition, the Registry provides expertise to assist in the diagnosis of atypical cases. The Internet has also provided an invaluable resource. Several Web pages relevant to NCL are listed in Table 8.1.

VI. CARRIER SCREENING Families also have great concern that their unaffected children may be carriers. Although the gene frequency in most populations is relatively small, which minimizes the risk that unrelated spouses will be carriers, the parents realize that they, by chance, are both carriers. Thus, their concern for their unaffected children is high. There are several concerns regarding the timing for testing of unaffected children and adolescents (Wertz et al., 1994). The children may be overwhelmed with their sibling’s illness and not ready to understand or cope with testing (Fanos, 1997). The testing may show that the individual is affected but presymptomatic.

163

8. Genetic Counseling in NCL Table 8.1. Useful NCL Addresses and Websites Sponsor Batten Disease Support and Research Association 2600 Parsons Avenue Columbus, Ohio 43207-2972 Tel. 800-448-4570

Website www.bdsra.org

Information Information about the diseases; links to other sites; bulletin board

Children’s Brain Disease Foundation 350 Parnassas Avenue, Suite 900 San Francisco, CA 94117 Tel. 415-566-5402

Provides information to the public, raises public awareness, research funding

Batten Disease Registry NYS Institute for Basic Research 1050 Forest Hill Road Staten Island, New York 10314 718-494-5201 fax 800-952-9628 [email protected]

Collects clinical, pathological and genetic data for research; provides expert diagnostic review of atypical cases

JNCL Research Fund P.O. Box 766 Mundelein, Illinois 60060

www.jnclresearch.org

Fund raising for research

Ofﬁce of Communications and Public Liason National Institutes of Health Neurological Institute P.O. Box 5801 Bethesda, Maryland 301-496-5751 800-352-9424

www.ninds.nih.gov/ patients/disorder/ batten/battenfs.htm

Information about the diseases; support group contracts

University College London Medical School

www.ucl.ac.uk/ncl

Mutations

Foreknowledge of an inevitable illness when there is no therapy may rob the individual of a period of normalcy. However, testing in infancy or early childhood may limit the trauma of carrier identiﬁcation, compared to learning of carrier status when the child is of marriageable age. The incidence of the various NCLs varies from a high of about 1:20,000 for INCL in Finland (Uvebrandt and Hagberg, 1997) to less than 1:100,000. Since these are recessive conditions, at the low end the carrier frequency is about 1:71 and at the high end it is less than 1:158. For a non-Finnish unaffected sibling the a priori risk to have an affected child is (2/3) × (1/158) × (1/4), about 1:1000, or 100 times greater than a person with no known risk.

164

S. Sklower Brooks

In the past it was not possible to identify carriers reliably. Advances in molecular and biochemical testing now make it possible to identify carriers reliably in families where there is an affected child. It is more difﬁcult to determine the carrier status of individuals in the general population in the United States by molecular means, because of the large number of mutations. In some countries, such as Finland, where a single molecular mutation accounts for the majority of cases, population screening to determine the carrier status of the general population is feasible. Carrier testing for late-infantile NCL in unrelated spouses is possible by biochemical analysis and ﬁnding about half of the expected enzyme activity (Junaid et al., 1999).

VII. REPRODUCTIVE OPTIONS As with other recessive conditions, there are several reproductive options that need to be explained to families by the genetic counselor. These are listed in Table 8.2. Here we will limit discussion to prenatal diagnosis for the NCLs. The earliest prenatal diagnosis attempts relied on identifying storage bodies by electron microscopy (MacLeod et al., 1984, 1985, 1988, Conradi et al., 1989; Kohlschutter et al., 1989; Rapola et al., 1988, 1990, 1993). However, these studies are technically challenging, and families cannot be fully reassured that the results are reliable (Lake, 1993; Chow et al., 1993; Goebel, 1995). Using linkage, J¨arvel¨a et al. (1991a), were able to perform prenatal diagnosis for infantile NCL. Van Diggelin et al. (1999) showed retrospectively that palmitoyl-protein thioesterase (PPT) could be analyzed in CVS or AF. The combination of PPT activity and CLN1 mutation analysis in CVS identiﬁed a fetus affected with infantile NCL (de Vries et al., 1999). The feasibility of prenatal testing for late-infantile NCL enzymatically was demonstrated by Junaid et al. (1999). Using both molecular mutation and biochemical analyses, Berry-Kravis (2000) excluded CLN2 in an at-risk pregnancy.

Table 8.2. Reproductive Options for Families with Childhood-Onset (Autosomal Recessive) Neuronal Ceroid Lipofuscinoses • Have no additional children • Accept 1:4 risk • Adoption • Prenatal diagnosis via chorionic villus sampling or amniocentesis • Artiﬁcial insemination by donor • In vitro fertilization and preimplantation testing of embryo

8. Genetic Counseling in NCL

165

Combining electron microscopy and informative restriction length polymorphisms (RFLPs) ﬂanking the CLN3 locus, Uvebrant et al. (1993) successfully excluded juvenile NCL with >99% conﬁdence in CVS from an at-risk pregnancy. In a pregnancy in which the electron microscopy ﬁndings were suggestive of NCL, linkage disequilibrium of intragenic markers in CLN3 allowed for successful molecular diagnosis of juvenile NCL in the fetus of a Finnish woman. This diagnosis was further conﬁrmed by identifying homozygosity of the common 1-kb mutation in the affected sibling and the affected fetus (Munroe et al., 1996). Tashner et al. (1997) developed an allele-speciﬁc PCR test to detect the major CLN3 deletion that was suitable for prenatal diagnosis and carrier detection. Prenatal testing is not available for CLN4. Rapola et al. (1999), reported prenatal diagnosis of CLN5, the Finnish late-infantile variant. Electron microscopy of a CVS sample did not show inclusions, but the fetus was found to have the maternal 2-bp deletion and the paternal haplotype found in the affected proband. Following termination, the fetus was found to have inclusions consistent with variant late-infantile NCL. There are 26 known mutations in CLN1, 31 in CLN2, 24 in CLN3, and 3 in CLN5 (www.ucl.ac.uk/ncl). For successful molecular prenatal diagnosis the mutations in the affected proband must be identiﬁed, preferably before a pregnancy. If the proband is not available, the DNA from the parents should be studied to identify each mutation. However, if it is possible to identify only one of the proband’s mutations, prenatal diagnosis could be limited to exclusion. That is, if the fetus inherits the known mutation, there is a 50/50 chance that the fetus is affected. On the other hand, if the fetus does not inherit the known mutation, then the fetus could be only a carrier or normal. The feasibility of preimplantation diagnosis for INCL was reported by Syv¨anen et al. (1997). They developed a solid-phase minisequencing test with whole-genome ampliﬁcation suitable for reliable identiﬁcation of the common Finnish infantile NCL mutation in single blastomeres.

VIII. CONCLUSION Genetic counseling for the NCLs is complex. The diagnosis must be carefully conﬁrmed and the speciﬁc form of NCL identiﬁed through biochemical or molecular genetic testing. The clinical course and prognosis need to be addressed. The risk of recurrence, including carrier testing issues and reproductive options, must be explained. Through all of this discussion, the counselor must be able to understand the psychosocial issues that are affecting the family and provide emotional support.

166

S. Sklower Brooks

Acknowledgments The author would like to thank Jacquelyn Krogh, M. S., Nancy Zellers, M. S., and Sarah Nolin, Ph.D., for their critical review of the manuscript.

References Berry-Kravis, E., Sleat, D. E., Sohar, I., Meyer, P., Donnelly, R., and Lobel, P. (2000). Prenatal testing for late infantile neuronal ceroid lipofuscinosis. Ann. Neurol. 47, 243–256. Chow, C., Borg, J., Billson, V. R., and Lake, B. D. (1993). Fetal tissue involvement in the late infantile type of neuronal ceroid lipofuscinosis. Prenat. Diagn. 13, 833–841. Conradi, N. G., Uvebrant, P., H¨okeg˚ard, L. H., Wahlstr¨om, H., and Mellqvist, L. (1989). First-trimester diagnosis of juvenile neuronal ceroid lipofuscinosis by demonstration of ﬁngerprint inclusions in chorionic villi. Prenat. Diagn., 9, 283–287. de Vries, B. B. A., Kleijer, W. J., Keulemans, J. L. M., Voznyi, Y. V., Franken, P. F., Eurlings, M. C. M., Galjaard, R. J., Losekoot, M., Catsman-Berrevoets, C. E., Breuning, M. H., Taschner, P. E. M., and van Diggelen, O. P. (1999). First-trimester diagnosis of infantile neuronal ceroid lipofuscinosis (INCL) using PPT enzyme assay and CLN1 mutation analysis. Prenat. Diagn. 19, 559–562. Fanos, J. H. (1997). Developmental tasks of childhood and adolescence: Implications for Genetic Testing. Am. J. Med. Genet. 71, 22–28. Gardiner, M., Sandford, A., Deadman, M., Poulton, J., Cookson, W., Reeders, S., Jokiaho, I., Peltonen, L., Eiberg, H., and Julier, C. (1990). Batten disease (Spielmeyer-Vogt disease, juvenile onset neuronal ceroid-lipofuscinosis) gene (CLN3) maps to human chromosome 16. Genomics 8, 387– 390. Goebel, J. H., Vesa, J., Reitter, B., Goecke, T. O., Schneider-R¨atzke, B., and Merz, E. (1995). Prenatal diagnosis of infantile neuronal ceroid-lipofuscinosis: A combined electron microscopic and molecular genetic approach. Brain Dev. 17, 83–85. J¨arvel¨a, I., Santavuori, P., Vesa, J., Rapola, J., Palotie, A., and Peltonen, L. (1991a). Infantile form of neuronal ceroid lipofuscinosis (CLN1) maps to the short arm of chromosome 1. Genomics 9, 170–173. J¨arvel¨a, I., Rapola, J., Peltonen, L., Puhakka, L., Vesa, J., and Amm¨al¨a, P., et al. (1991b). DNA-based prenatal diagnosis of the infantile form of neuronal ceroid lipofuscinosis INCL, CLN1). Prenat. Diagn. 11, 323–328. Junaid, M. A., Brooks, S. S., Wisniewski, K. E., and Pullarkat, R. K. (1999). A novel assay for lysosomal pepstatin-insensitive proteinase and its application for the diagnosis of late-infantile neuronal ceroid lipofuscinosis. Clin. Chim. Acta 281, 169–176. Kohlsch¨utter, A., Rauskolb, R., Goebel, H. H., Anton, L. I., Albrecht, R., and Klein, H. (1989). Probable exclusion of juvenile neuronal ceroid lipofuscinosis in a fetus at risk: An interim report. Prenat. Diagn. 9, 289–292. Lake, B. D. (1993). Morphological approaches to the prenatal diagnosis of late-infantile and juvenile Batten disease. J. Inher. Metab. Dis. 16, 345–348. Macleod, P., Dolman, C., Nickel, R., Chang, E., Zonana, J., and Silvey, K. (1984). Prenatal diagnosis of neuronal ceroid lipofuscinosis. N. Engl. J. Med. 310, 595. MacLeod, P. M., Dolman, C. L., Nickel, R. E., Chang, E., Nag, S., Zonana, J., and Silvey, K. (1985). Prenatal diagnosis of neuronal ceroid-lipofuscinosies. Am. J. Med. Genet. 22, 781–789. MacLeod, P. M., Nag, S., and Berry, C. (1988). Ultrastructural studies as a method of prenatal diagnosis of neuronalceroid-lipofuscinosis. Am. J. Med. Genet. Suppl. 5, 93–97. Munroe, P. B., Rapola, J., Mitchison, H. M., Mole, S. E., Gardiner, R. M., and J¨arvel¨a, I. (1999). Prenatal diagnosis of Batten’s disease. Lancet 347, 1014–1015.

8. Genetic Counseling in NCL

167

Mole, S. E. (1999). Batten’s disease: Eight genes and still counting? Lancet 354, 443–445. Munroe, P. B., Rapola, J., Mitchison, M., Mustonen, A., Mole, S. E., Gardiner, M., and J¨arevel¨a, I. (1996). Prenatal diagnosis of Batten’s disease. Lancet 347, 1014–1015. Rapola, J., Santavuori, P., and Heiskala, H. (1988). Placental pathology and prenatal diagnosis of infantile neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. 5, 99–103. Rapola, J., Salonen, R., Amm¨al¨a, P., and Santavuori, P. (1990). Prenatal diagnosis of the infantile type of neuronal ceroid lipofuscinosis by electron microscopic investigation of human chorionic villi. Prenat. Diagn. 10, 553–559. Rapola, J., L¨ahdetie, J., Isosomppi, J., Helminen, P., Penttinen, M., and J¨arvel¨a, I. (1999). Prenatal diagnosis of variant late infantile neuronal ceroid lipofuscinosis (vLINCLFinnish; CLN5). Prenat. Diagn. 19, 685–688. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukoski, M., J¨arvel¨a, I. E., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late infantile neuronal ceroid lipofuscinosis map to chromosomes 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591–595. Syv¨anen, A. C., J¨arvel¨a, I., Paunio, T., and Vesa, J. (1997). DNA diagnosis and identiﬁcation of carriers of infantile and juvenile neuronal ceroid lipofuscinnosis. Neuropediatrics 28, 63–66. Tahvanainen, E.;, Ranta, S., Hirvasniemi, A., Karila, E., Leisti, J., Sistonen, P., Weissenbach, J., Lehesjoki, A.-E., and de la Chapelle, A. (1994). The gene for a recessively inherited human childhood progressive epilepsy with mental retardation maps to the distal short arm of chromosome 8. Proc. Natl. Acad. Sci. (USA) 91, 7267–7270. Tashner, P. E., deVos, N., and Breuning, M. H. (1997). Rapid detection of the major deletion in the Batten disease gene CLN3 by allele speciﬁc PCR. J. Med. Genet. 34, 955–956. Uvebrant, P., Bj¨orck, E., Conradi, N., H¨okeg˚ard, K-H., Martinsson, T., and Wahlstr¨om, J. (1993). Successful DNA-based prenatal exclusion of juvenile neuronal ceroid lipofuscinosis. Prenat. Diagn. 13, 651–657. Van Diggelen, O. P., Keulemans, J. L., Winchester, B., Hofman, I. L., Vanhanen, S. L., Santavuori, P., and Voznyi, Y. V. (1999). A rapid ﬂuorogenic palmitoyl-protein thioesterase assay: pre- and postnatal diagnosis of INCL. Mol. Genet. Metab. 66, 240–244. Wertz, D. C., Fanos, J. H., and Reilly, P. R. (1994). Genetic testing for children and adolescents: Who decides? J. Am. Med. Assoc., 272, 875–881.

This Page Intentionally Left Blank

9

Neurotrophic Factors as Potential Therapeutic Agents in Neuronal Ceroid Lipofuscinosis Jonathan D. Cooper∗ and William C. Mobley Department of Neurology and Neurological Sciences, and the Program in Neuroscience Stanford University School of Medicine Stanford, California 94305

I. II. III. IV.

V. VI. VII. VIII.

Introduction Mouse Models of NCLs Characterization of the CNS of Mouse Models of NCLs Neurotrophic Factors as Potential Therapeutic Agents in Neurodegenerative Disorders?—The Neurotrophic Factor Hypothesis NTF Expression and Actions beyond the “Neurotrophic Factor Hypothesis” Failure of NTF Signaling—A Cause of Neuronal Dysfunction and Degeneration? Treatment with IGF-1—Implications for the Treatment of NCLs Toward Clinical Trials of NTFs References

* Present address and address for correspondence: Department of Neuropathology, Institute of Psychiatry, King’s College London, De Crespigny Park, London, SE5 8AF, United Kingdom. E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

169

170

J. D. Cooper and W. C. Mobley

I. INTRODUCTION The neuronal ceroid lipofuscinoses (NCLs) are progressive, fatal neurodegenerative disorders of unknown pathogenesis with onset ranging from infancy to adulthood. Childhood forms are manifested by blindness, seizures, and dementia (Dyken, 1988; Goebel, 1995). Collectively these disorders represent the most common inherited neurodegenerative storage disorder of childhood, with an incidence of 1 in 12,500 live births (Goebel, 1995). The NCLs have traditionally been divided into four main types (Dyken, 1988; Goebel, 1995), although variant forms are reported (Dyken, 1988; Santavuori et al., 1991; Dyken and Wisniewski, 1995). In recent studies, genes have been discovered for the infantile form (CLN1) (Haltia-Santavuori disease) (Vesa et al., 1995), late-infantile form (CLN2) (Jansky-Bielschkowsky disease) (Sleat et al., 1997), juvenile form (CLN3) (Batten disease or Spielmeyer-Sjogren disease) (International Batten Disease Consortium, 1995), Finnish variant of the late-infantile form (CLN5) (Savukoski et al., 1998) and most recently, progressive epilepsy with mental retardation that was recently recognized as a new NCL subtype (CLN8) (Ranta et al., 1999). The gene for Kufs disease (CLN4), an adult-onset form of this disorder, awaits deﬁnition. The characteristic feature of NCL pathology is the lysosomal accumulation of autoﬂuorescent proteolipid in the brain and other tissues (Koenig, 1964; Haltia et al., 1973; Dyken, 1988; Goebel, 1995). Ultrastructurally, these electrondense accumulations exhibit granular, curvilinear or ﬁngerprint-like appearances, which are characteristic for each form of NCL (Santavuori, 1988; Goebel, 1995, 1997). Biochemical studies of these deposits in CLN2, CLN3 and CLN4 have shown that the major protein component is subunit c of the mitochondrial ATPase (Hall et al., 1991; Kominami et al., 1992; Palmer et al., 1992). In CLN1, deposits are composed largely of saposins A and D (Tyynel¨a et al., 1993). The molecular mechanisms by which mutations in the CLN genes lead to pathophysiology are, as yet, unidentiﬁed.

II. MOUSE MODELS OF NCLs The development of an animal model that recapitulates the clinical and pathological features of NCLs represents an initial step toward discovering underlying disease mechanisms and testing potential treatment strategies. Although NCLs occur naturally in a range of animal species (Goebbel et al., 1999; Jolly, 1995) there is no animal model in which the disease is caused by mutations in CLN3. As such, it was necessary to utilize targeted disruption of the mouse Cln3 gene in embryonic stem cells to generate mice with a Cln3 null allele, a goal that has now been achieved by two different laboratories (Katz et al., 1999; Mitchison et al., 1999).

NTFs as Therapeutic Agents in NCLs

171

Initial characterization of both these strains of Cln3 −/− mice show progressive accumulation of autoﬂuorescent material with the staining and ultrastructural characteristics of the material stored in Batten disease patients (Katz et al., 1999; Mitchison et al., 1999). More detailed analysis of one of these mouse lines has revealed that Cln2 protease activity in the brain was signiﬁcantly elevated, implying that a correlation with human disease also exists at the biochemical level (Mitchison et al., 1999). Two naturally occurring autosomal mutant mice, mnd and nclf, have also been shown to model late-infantile variant forms of the disorder. The mnd mouse was ﬁrst characterized as exhibiting adult-onset upper and lower motor neuron degeneration (Messer and Flaherty, 1986; Messer et al., 1987), but closer examination revealed pathology similar to that seen in NCLs (Bronson et al., 1993; Mazurkiewicz et al., 1993; Pardo et al., 1994). The mice exhibit progressive retinopathy leading to blindness (Messer et al., 1993) and early, widespread accumulation of subunit c and autoﬂuorescent lipopigment in many tissues (Bronson et al., 1993; Messer and Plummer, 1993; Pardo et al., 1994). Most recently, the mnd mouse has been shown to represent a naturally occurring model of cln8, a late-infantile variant form of NCL (Ranta et al., 1999). The mouse cln8 gene encodes a putative transmembrane protein, and in mnd bears a 1-bp insertion, which results in a frameshift and a truncated protein (Ranta et al., 1999). Another spontaneous mutant mouse, nclf, has also recently been identiﬁed which exhibits a grossly similar phenotype to the mnd/mnd mouse (Bronson et al., 1998). The nclf gene has been mapped to mouse chromosome 9 (Bronson et al., 1998), in a region syntenic to human chromosome 15q21 near the mapped locus for CLN6, another late-infantile variant form of NCL (Sharp et al., 1997).

III. CHARACTERIZATION OF THE CNS OF MOUSE MODELS OF NCLs To determine which therapeutic strategies may be beneﬁcial in reversing pathological changes and restoring neuronal function, it is essential to have a detailed understanding of which neuronal populations are affected in the NCLs and how their normal function is compromised. We have utilized the autoﬂuorescent properties of accumulated lipopigment to reveal which neuronal populations show NCL-like pathological changes and examined the onset and progression of pathological changes in the CNS of cln3 null mutant mice, and the mnd and nclf mouse models of variant late-infantile NCL. In all three mutant mice we found a pronounced, early accumulation of autoﬂuorescent lipopigment in subpopulations of GABAergic interneurons in the cortex and hippocampus (Cooper et al., 1999a; Mitchison et al., 1999, Lam et al., 1999). To determine the identity of those neurons that contained particularly dense accumulation of lipopigment, confocal microscopy was used to conﬁrm the co-localization of lipopigment and

172

J. D. Cooper and W. C. Mobley

immunoﬂuorescence staining for several different markers of GABAergic phenotype, including the calcium-binding proteins parvalbumin (PV) and calbindin (Cb) and the neuropeptide somatostatin (SOM), which are all co-localized with GABA in many distinct subpopulations of GABAergic neurons (Freund and Buzs´aki, 1996). To ask whether lipopigment accumulation marked neurons whose phenotype is affected during disease progression, we examined populations of PVpositive neurons in the entorhinal cortex and subpopulations of PV-, Cb-, SOM-, and GAD-positive neurons in the hippocampal formation. In all three mutant mice we detected at least partial loss of staining for some, but not all, of these phenotypic markers, and pronounced hypertrophy of remaining detectable interneurons (Cooper et al., 1999a; Mitchison et al., 1999; Lam et al., 1999). Evidence from the spontaneous mutants mnd and nclf highlight the progressive nature of these morphological alterations, with more signiﬁcant effects on both interneuronal number and size evident in both mutant strains. The extent of these changes differed markedly in these two mutants, with mnd showing more profound changes in the number of different subpopulations of hippocampal interneurons than nclf mice at 9 months of age (Cooper et al., 1999a; Lam et al., 1999). Though the cellular changes in Cln3 −/− mice were less severe than in mnd and nclf mice, we did observe signiﬁcant loss of PV-positive neurons in the entorhinal cortex that is also reﬂected in the hippocampus, and a strong trend toward reduced numbers of SOM-positive neurons in the hippocampus (Mitchison et al., 1999). It is not yet clear whether the apparent loss of interneurons is due to cell death or the downregulation of normally expressed phenotypic markers (Cooper et al., 1999a). There was also signiﬁcant hypertrophy of many subpopulations of interneurons, indicating dysregulation of cell volume (Mitchison et al., 1999). Distinct effects of Cln3 disruption on different interneuronal populations raise the possibility that different mechanisms may be operative. Since there is progressive cortical and cerebellar atrophy and selective loss of neurons in Batten disease, it will be important to examine the CNS of aged Cln3 −/− mice for evidence of the progressive development of more signiﬁcant pathological changes. Since these three mouse models of NCLs were generated in different background strains, it is difﬁcult to make direct comparisons between Cln3 −/− mice and the spontaneous mutants (mnd and nclf ). However, it is apparent that GABA-ergic neurons are affected in each of these three mutant mice, albeit with different degrees of involvement in particular populations of interneurons in each mouse model. Indeed, it will be very informative to extend these studies to mouse models of other forms of the NCLs as they become available. Inhibitory interneurons in the hippocampus and cortex exert a powerful inﬂuence on excitatory transmission in these brain regions (Freund and Buzsaki, 1996; Singer, 1996). It will be important to examine whether morphological abnormalities in any of these three mutant mice are reﬂected in compromised

NTFs as Therapeutic Agents in NCLs

173

neuronal function. This question is particularly pertinent when considering the functional status of interneurons that exhibit profoundly abnormal morphology, which may be expected to be severely compromised in their ability to function normally. Perhaps the most clinically relevant questions to ask are whether such structural changes are accompanied by alterations in excitatory transmission or thresholds for seizure activation. We have already begun to investigate these issues in the mnd mouse, and have recently reported electrophysiological ﬁndings that suggest that functional inhibition in the dentate gyrus may be compromised in mnd mice that demonstrated signiﬁcantly increased amplitude ratios and the presence of multiple population spikes (Cooper et al., 1999b). Although these studies have already started in vivo, there is great scope for the extension of electrophysiological studies in vitro. This approach is particularly attractive since hippocampal slice methodology is very well established and lends itself to the screening of potential therapeutic and pharmacological manipulations that may directly address underlying pathophysiological mechanisms. Our ﬁndings demonstrate that in all three mutant mice, progressively fewer GABA-ergic interneurons in both hippocampus and cortex can be detected by staining for markers that are normally present. The possibility arises that the reduction in number of immunohistochemically detected interneurons in these mice does not signify death, but instead marks downregulation of these markers to the extent that they are no longer detectable. Indeed, we found that many interneurons retained expression of GAD in the hippocampal formation of aged mnd mice, suggesting that at least some populations of these neurons remain alive despite the absence of other normally expressed phenotypic markers (Cooper et al., 1999a). This raised the intriguing possibility that these populations of “phenotypically silent” interneurons might persist in a form that is amenable to therapeutic intervention.

IV. NEUROTROPHIC FACTORS AS POTENTIAL THERAPEUTIC AGENTS IN NEURODEGENERATIVE DISORDERS?—THE NEUROTROPHIC FACTOR HYPOTHESIS Neurotrophic factors (NTFs) are polypeptides that support the growth, differentiation, and survival of neurons (Longo et al., 1993; Bothwell, 1995; Yuen et al., 1996). A number of NTFs have been discovered and their actions in the peripheral and central nervous system characterized in some detail (summarized in Table 9.1). The neurotrophins are an important family of this class of molecules. Nerve growth factor (NGF) is the prototypic member of the neurotrophin family of growth factors, the ﬁrst-discovered and best-characterized NTF. Indeed, the discovery of NGF was instrumental to the formulation of the “neurotrophic factor hypothesis.” This postulates that once a developing neuron has grown its process into

174 Table 9.1. Partial List of Neurotrophic Factors with Actions on Motor and Peripheral Nervous System (PNS) Neurons Family

Member

Signaling receptor

Responsive neuronsa,b,c

Nerve growth factor (NGF)

TrkA, p75NTR

Brain-derived neurotrophic factor (BDNF) Neurotrophin-3 (NT-3)

TrkB, p75NTR

Neurotrophin-4/5 (NT-4/5)

TrkB, p75NTR

Ciliary neurotrophic factor (CNTF) eukemia inhibitory (LIF or CDF/LIF)

CNTF receptor (CNTFR␣, gp130, LIFR␤ subunits) IF receptor (gp130, LIFR␤ subunits)

PNS: 1, 3, 4; CNS: 5, 6, 11, 13, 14, 18–20, 24

Insulin-like growth factor (IGF)

IGF-1

PNS: 1, 3; CNS: 5, 6, 11, 14, 15, 25, 26

IGF-2

Type I IGF receptor (IGFIR) less so insulin receptor (IR) IGFIR and less so IR

Transforming growth factor-␤ (TGF-␤) family

TGF-␤1, TGF-␤2, TGF-␤3

TGF-␤ types I, II, and III receptors

PNS: 1; CNS: 5, 11, 14, 18

Glial cell line-derived neurotrophic factor (GDNF)

ret, GDNF family receptor (GFR) ␣-1 and ␣-2

PNS: 1–5, CNS: 5, 11, 13, 22

Neurotrophin

Neuropoietic cytokine

TrkC, less so TrkA and TrkB p75NTR

PNS: 1, 2 (small sensory neurons), 3; CNS: 6, 7, 17, 19 PNS: 1, 2; CNS: 5, 6, 8, 9, 11, 12, 18 20, 22, 25 PNS: 1, 2 (large sensory neurons), 3; CNS: 5, 6, 9, 11, 18, 20, 22, 24, 25 PNS: 1–3; CNS: 5, 6, 9, 11 12, 18, 20, 24, 25

PNS: 1–3, CNS: 5

PNS: 1, 3; CNS: 5, 6

Fibroblast growth factor (FGF)

Other growth factors

Neurturin (NTN) Persephin (PSP) Artemin (ARTN)

ret, GFR ␣-2 and ␣-1 ret, GFR ␣-4 ret, GFR ␣-3 and ␣-1

PNS: 1–5, CNS: 5, 11, and possibly 13, 24 CNS: 5, 11 PNS: 1–3; CNS: 11

Acidic FGF (aFGF or FGF-1)

FGF receptors 1–4 (FGFRs 1–4)

PNS: 1, 3, 4; CNS: 5, 14, 16, 18–20, 23, 25

Basic FGF (bFGF or FGF-2) FGF-5

FGFRs 1–3 FGFR-1, FGFR-2

PNS: 1, 3, 4; CNS: 5, 11, 14, 16, 18–21, 25 PNS: None known; CNS: 5

Transforming growth factor alpha (TGF-␣) Platelet-derived growth factor (PDGF: AA, AB BB isoforms)

Epidermal growth factor receptor

PNS: 1; CNS: 11

PGDF ␣- and ␤-receptors

PNS: None known; CNS: 5, 10, 11, 20

c-kit

PNS: 1; CNS: 15 (possibly)

Stem cell factor a

PNS: (1) DRG sensory neurons; (2) cranial sensory neurons; (3) sympathetic neurons; (4) parasympathetic neurons; (5) enteric neurons. CNS—speciﬁc neuronal populations: (5) motor neurons; (6) basal forebrain cholinergic neurons; (7) striatal cholinergic neurons; (8) basal forebrain ␥ -aminobutyric (GABA)-ergic neurons; (9) mesencephalic GABA-ergic neurons; (10) cerebellar GABA-ergic neurons; (11) substantia nigra dopaminergic neurons; (12) cerebellar granule cells; (13) Purkinje cells. c CNS—neurons of the: (14) cortex, (15) cerebellum, (16) spinal cord, (17) brainstem, (18) hippocampus, (19) thalamus, (20) striatum, (21) septum, (22) trigeminal mesencephalic nucleus, (23) subiculum, (24) locus coeruleus, (25) retinal ganglion, (26) olfactory bulb. b

175

176

J. D. Cooper and W. C. Mobley

its target, it competes with other developing neurons of the same type for a limited supply of a NTF provided by the target. Successful competitors survive; unsuccessful ones die. Under this hypothesis, a NTF should be diffusible and act on speciﬁc cell surface receptors localized to the processes of innervating neurons. It also predicts that a NTF(s) will be present at a concentration lower than that necessary to maintain the viability of all innervating neurons. In our view, reasonable extensions of the hypothesis are that: (1) the target would produce one or only a limited number of NTFs for each innervating population; (2) correspondingly, there could be a speciﬁc NTF for each neuronal population—literally thousands of such factors would exist to act on the many thousands of different neuronal populations in the nervous system; (3) neurons would be the only cells to respond to a NTF; and (4) as for survival, differentiation would also be regulated by limiting concentrations of NTFs. Although important aspects of NTFs and their signaling biology were accurately predicted by the “neurotrophic factor hypothesis,” there is considerably more complexity and diversity than was initially anticipated.

V. NTF EXPRESSION AND ACTIONS BEYOND THE “NEUROTROPHIC FACTOR HYPOTHESIS” Studies on NTFs have considerably broadened our knowledge about their actions. Neurotrophins and other NTFs act by binding to speciﬁc cell surface receptors. Activated receptors initiate intracellular signaling events, leading to induction of gene expression and changes in neuronal morphology and function. Many investigations have been directed at characterizing these signaling events, not only for the neurotrophins but for many other NTFs including ciliary neurotrophic factor (CNTF), the insulin-like growth factors (IGFs), the ﬁbroblast growth factors (FGFs), and numbers of the glial cell line-derived nerve factor (GDNF) family (Yuen et al., 1996; Baloh et al., 1998) (Table 9.1). There is much that was not predicted by the original formulation of the “neurotrophic factor hypothesis.” For example, it is now evident from data for the expression and actions of neurotrophins that, in addition to target-derived delivery, autocrine and non-targetderived paracrine modes of presentation are likely to be important (Schecterson and Bothwell, 1992). Another departure from the original ”neurotrophic factor hypothesis” is evidence that an individual population of neurons can respond to many different NTFs. As such, it is possible that several factors acting together determine whether particular neuronal populations live or die. An interesting correlate is data showing that a single factor can act on many different neuronal populations. Thus the expectation that thousands of NTFs would be required to direct the development of an equally large number of neuronal populations may be incorrect. Instead, precise combinations of a limited number of factors may be important. It is also apparent that certain NTFs act on non-neuronal cells

NTFs as Therapeutic Agents in NCLs

177

(Yuen et al., 1996; Lindsay et al., 1996). Indeed, many NTFs were ﬁrst discovered through their actions on such cells. The “neurotrophic factor hypothesis” created the expectation that speciﬁc NTFs would act through speciﬁc receptors. While this is the case, there is considerably more diversity than expected. Recently, it has become apparent that the actions of NTFs are not restricted to developing postmitotic neurons. Rather, these factors can also act on dividing neuroblasts as well as on mature neurons that have established stable synaptic contacts. NTFs are now known to play a role in the functional modiﬁcation of synaptic connections within the central and peripheral nervous systems (Berninger and Poo, 1996; Bonhoeffer, 1996; Lo, 1995; Stoop and Poo, 1996). NTF actions at central nervous system (CNS) synapses are particularly interesting. NTF secretion is increased by neuronal depolarization or synaptic activation (Bl¨ochl and Theonen, 1995; Gu et al., 1994; Wang and Poo, 1997), and neurotrophic factor expression within the CNS is regulated by electrical activity (Ballar´ın et al., 1991; Gall and Isackson, 1989; Gwag and Springer, 1993; Kesslak et al., 1998; Knipper et al., 1994; Patterson et al., 1992; Theonen et al., 1991; Wetmore et al., 1994; Zafra et al., 1991). Moreover, there is widespread cortical and hippocampal expression of neurotrophins and their cognate receptors (Barbacid, 1994; Bothwell, 1995; Phillips et al., 1990; Hofer et al., 1990; Wetmore et al., 1990). These ﬁndings suggest that neurotrophins may play a role in synaptic plasticity within the CNS. These new data give exciting hints regarding a role for neurotrophins modifying the structure and function of synaptic connections, a role not anticipated in the “neurotrophic factor hypothesis.”

VI. FAILURE OF NTF SIGNALING—A CAUSE OF NEURONAL DYSFUNCTION AND DEGENERATION? Studies of the cell biology of NTF signaling are creating new possibilities for exploring the pathogenesis of neurodegeneration. Our laboratory has long been interested in the degeneration of basal forebrain cholinergic neurons (BFCNs) in Alzheimer’s disease and elderly Down syndrome patients, and we have entertained the hypothesis that failed NGF signaling contributes to this phenotype. In recent studies in a mouse model of Down syndrome, the partial-trisomy 65Dn mouse, we discovered that there is age-related atrophy and apparent loss of these neurons (Holtzman et al., 1996). Interestingly, in spite of normal levels of NGF in the hippocampal target of these cells, and apparently normal hippocampal innervation by cholinergic axons, NGF levels in the basal forebrain were decreased (J. D. Cooper and W. C. Mobley, unpublished observations). The signaling endosome hypothesis argues that retrograde transport of NGF marks the retrograde NGF signal (Grimes et al., 1996, 1997). If so, our ﬁndings would indicate that BFCNs in partial-trisomy 65Dn mice receive less NGF signaling from the target

178

J. D. Cooper and W. C. Mobley

and are thereby trophically deprived. Signiﬁcantly, in view of the important role for NGF in the growth and maintenance of BFCNs, failed NGF signaling could explain the dysfunction and death of these neurons. We have shown that delivering NGF to BFCN cell bodies reverses atrophy and the apparent loss of these cells (J. D. Cooper and W. C. Mobley, unpublished observations).

VII. TREATMENT WITH IGF-1—IMPLICATIONS FOR THE TREATMENT OF NCLs Collectively, NTFs represent a group of molecules that exert a powerful inﬂuence on neuronal development, differentiation, and survival, in addition to regulating many aspects of normal neuronal biology. We were interested in whether treatment with an NTF might be capable of reversing pathology involving interneurons in mnd mice. Insulin-like growth factor-1 (IGF-1) was previously shown to have beneﬁcial effects on detectable GABA-ergic interneuronal number and dendritic morphology in a canine tissue culture model of NCL (Dunn et al., 1994). Moreover, expression of IGF receptors is widespread throughout the CNS (Adamo et al., 1989) and, as such, treatment with IGF can be considered as targeting one speciﬁc trophic factor to many neuronal populations. Therefore, we compared the effect of 7 days of treatment by intracerebroventricular infusion with 2 ␮g/day IGF-1 or artiﬁcial cerebrospinal ﬂuid vehicle in aged control and mnd animals on interneuronal number in the entorhinal cortex and hippocampal formation. Remarkably, treatment with IGF-1 signiﬁcantly increased the number of SOM-positive hilar interneurons compared with age-matched, vehicle-treated mnd mice (Cooper et al., 1999a). The effect of IGF-1 treatment on cross-sectional area was more robust than the effect on neuronal number, signiﬁcantly reducing the size of SOM-positive hilar interneurons, PV-positive neurons in the stratum oriens, and PV-positive neurons of the dentate gyrus (Cooper et al., 1999a). In spite of this, we detected no obvious difference in IGF-1 treated animals in the density of lipopigment deposits in SOM- or PV-positive neuronal cell bodies or in the morphology of their dendrites. It is remarkable that just 1 week of IGF-1 treatment was effective in partially restoring interneuronal number and reducing hypertrophy in some subhippocampal subregions (Cooper et al., 1999a). These ﬁndings are evidence that at least some “phenotypically silent” neurons are growth factor-responsive. Indeed IGF-1 treatment acted to reverse the neurodegenerative phenotype in responsive cells, suggesting that IGF-1 could have a role in therapy. However, IGF-1 treatment had no effect on the size or number of PV-positive interneurons in the entorhinal cortex, suggesting that other mechanisms may operate in this brain region, that degenerative changes had become irreversible before treatment was commenced, or that a longer course of treatment would be required to see an effect. It will be informative to test further the effect of IGF-1 and other neurotrophic

NTFs as Therapeutic Agents in NCLs

179

factors, particularly at younger ages, to test whether a more robust effect in reversing the degenerative changes can be produced. Although our ﬁndings have direct implications for devising potential therapeutic strategies for the treatment of patients with NCLs, rigorous tests of candidate strategies in appropriate animal models will be required.

VIII. TOWARD CLINICAL TRIALS OF NTFs Robust NTF effects on survival and differentiation of normal neurons have suggested that these factors may be used to enhance the survival and function of neurons threatened by neurological diseases. In recent years, animal models of human neurological disorders have been used to test the therapeutic potential of NTFs. In a line of investigation that was not predicted by the “neurotrophic factor hypothesis” but followed logically from it, NTFs have been shown to protect against neuronal dysfunction and death in several animal models of injury and neurological disease (Yuen et al., 1996). The emergence of NTFs as potential therapies for neurological disorders is exciting but not without certain problems, as the technicalities of appropriate and targeted delivery remain unsolved. However, systematic study may yet reveal the true potential of NTFs as therapeutic agents to treat neurological disorders including the NCLs.

Acknowledgments J. D. Cooper and W. C. Mobley thank their colleagues, Jane Chua-Couzens, Andrew Feng, Dawn Lam, Pavel Belichenko, Ahmad Salehi, Josh Kilbridge, Janice Valletta, Alfredo Ramirez, Arthur Lee, David Holtzman, Hannah Mitchison, Nick Greene, Robert Nussbaum, Paul Buckmaster, and Anne Messer, for their contributions to this work, and Drs. Alison Barnwell and Pavel Belichenko for critical review of the manuscript. This work was supported by National Institutes of Health grant NS29110 (A. M.), The Remy foundation (J. D. C.), The Batten’s Disease Support and Research Association, The Natalie Fund and the Children’s Brain Diseases Foundation (W. C. M). IGF-1 was provided by Dr. Nicola Neff of Cephalon, Inc.

References Adamo, M., Raizada, M. K., and LeRoith, D. (1989). Insulin and insulin-like growth factor receptors in the nervous system. Mol. Neurobiol. 3, 71–100. Ballar´ın, M., Ernfors, P., Lindefors, N., and Persson, H. (1991). Hippocampal damage and kainic acid injection induce a rapid increase in mRNA for BDNF and NGF in the rat brain. Exp. Neurol. 114, 35–43. Baloh, R. H., Tansey, M. G., Lampe, P. A., Fahrner, T. J., Enomoto, H., Simburger, K. S., Leitner, M. L., Araki, T., Johnson, E. M., and Milbrandt, J. (1998). Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFRalpha3-RET receptor complex. Neuron 21, 1291–1302. Barbacid, M. (1994). The Trk family of neurotrophin receptors. J. Neurobiol. 25, 1386–1403.

180

J. D. Cooper and W. C. Mobley

Berninger, B., and Poo, M. (1996). Fast actions of neurotrophic factors. Curr. Opin. Neurobiol. 6, 324–330. Bl¨ochl, A., and Thoenen, H. (1995). Characterization of nerve growth factor (NGF) release from hippocampal neurons: Evidence for a constitutive and an unconventional sodium-dependent regulated pathway. Eur. J. Neurosci. 7, 1220–1228. Bonhoeffer, T. (1996). Neurotrophins and activity-dependent development of the neocortex. Curr. Opin. Neurobiol. 6, 119–126. Bothwell, M. (1995). Functional interactions of neurotrophins and neurotrophin receptors. Annu. Rev. Neurosci. 18, 223–253. Bronson, R. T., Lake, B. D., Cook, S., Taylor, S., and Davisson, M. T. (1993). Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten’s disease). Ann. Neurol. 33, 381–385. Bronson, R. T., Donahue, L. R., Johnson, K. R., Tanner, A., Lane, P. W., and Faust, J. R. (1998). Neuronal ceroid lipofuscinosis (nclf ), a new disorder of the Mouse linked to chromosome 9. Am. J. Med. Genet. 77, 289–297. Cooper, J. D., Messer, A., Feng, A. K., Chua-Couzens, J., and Mobley, W. C. (1999a). Apparent loss and hypertrophy of interneurons in a mouse model of neuronal ceroid lipofuscinosis: Evidence for partial response to insulin-like growth factor-1 treatment. J. Neurosci. 19, 2556–2567. Cooper, J. D., Mobley, W. C., and Buckmaster, P. S. (1999b). Compromised functional inhibition in the hippocampus of the mnd mouse model of neuronal ceroid lipofuscinosis. Soc. Neurosci. Abstr. 25, 1593. Dunn, W. A., Raizada, M. K., Vogt, E. S., and Brown, E. A. (1994). Growth factor-induced growth in primary neuronal cultures of dogs with neuronal ceroid lipofuscinosis. Int. J. Dev. Neurosci. 12, 185–196. Dyken, P. (1988). Reconsideration of the classiﬁcation of the neuronal ceroid lipofuscinoses. Am. J. Med. Genet. Suppl. 5, 69–84. Dyken, P., and Wisniewski, K. (1995). Classiﬁcation of the neuronal ceroid-lipofuscinoses: Expansion of the atypical forms. Am. J. Med. Genet. 57, 150–154. Freund, T. F., and Buzsaki, G. (1996) Interneurons of the hippocampus. Hippocampus 6, 347–470. Gall, C. M., and Isackson, P. J. (1989). Limbic seizures increase neuronal production of messenger RNA for nerve growth factor. Science 245, 758–761. Goebel, H. H. (1995). The neuronal ceroid-lipofuscinoses. J. Child. Neurol. 10, 424–437. Goebel, H. H. (1997). Morphologic diagnosis in neuronal ceroid lipofuscinosis. Neuropediatrics 28, 167–169. Goebel, H. H., Mole, S. E., and Lake, B. D. (eds.) (1999). “The Neuronal Ceroid Lipofuscinoses (Batten Disease),” Biomedical and Health Research Vol. 33. IOS Press, Amsterdam, The Netherlands. Grimes, M. L., Zhou, J., Beattie, E. C., Yuen, E. C., Hall, D. E., Valletta, J. S., Topp, K. S., LaVail, J. H., Bunnett, N. W., and Mobley, W. C. (1996). Endocytosis of activated TrkA: Evidence that nerve growth factor induces formation of signaling endosomes. J. Neurosci. 16, 7950–7964. Grimes, M. L., Beattie, E. C., and Mobley, W. C. (1997). A signaling organelle containing the nerve growth factor-activated receptor tyrosine kinase, TrkB. Proc. Natl. Acad. Sci. (USA) 94, 990–914. Gu, Q., Liu, Y., and Cynader, M. S. (1994). Nerve growth factor-induced ocular dominance plasticity in adut cat visual cortex. Proc. Natl. Acad. Sci. (USA) 91, 8408–8412. Gwag, B. J., and Springer, J. E. (1993). Activation of NMDA receptors increases brain-derived neurotrophic factor (BDNF) mRNA expression in the hippocampal formation. Neuroreport 5, 125–128. Hall, N. A., Lake, B. D., Dewji, N. N., and Patrick, AD (1991). Lysosomal storage of subunit c of mitochondrial ATP synthase in Batten’s disease (ceroid-lipofuscinosis). Biochem. J. 275, 269–272. Haltia, M., Rapola, J., Santavuori, P., and Keranen, A. (1973). Infantile type of so-called neuronal ceroid-lipofuscinosis. 2. Morphological and biochemical studies. J. Neurol. Sci. 18, 269–285.

NTFs as Therapeutic Agents in NCLs

181

Hofer, M., Pagliusi, S. R., Hohn, A., Leibrock, J., and Barde, Y. A. (1990). Regional distribution of brain-derived neurotrophic factor mRNA in the adult mouse brain. EMBO J. 9, 2459–2464. Holtzman, D. M., Santucci, D., Kilbridge, J., Chua-Couzens, J., Fontana, D. J., Daniels, S. E., Johnson, R. M., Chen, K., Sun, Y., Carlson, E., Alleva, E., Epstein, C. J., and Mobley, W. C. (1996). Developmental abnormalities and age-related neurodegneration in a mouse model of Down syndrome. Proc. Natl. Acad. Sci. (USA) 93, 13333–13338. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell 82, 949–957. Jolly, R. D. (1995). Comparative biology of the neuronal ceroid lipofuscinoses (NCL): An overview. Am. J. Med. Genet. 57, 307–311. Katz, M. L., Shibuya, H., Liu, P. C., Kaur, S., Gao, C. L., and Johnson, G. S. (1999). A mouse gene knockout model for juvenile ceroid-lipofuscinosis (Batten disease). J. Neurosci. Res. 57, 551–556 Kesslak, J. P., So, V., Choi, J., Cotman, C. W., and Gomez-Pinilla, F. (1998). Learning upregulates brain-derived neurotrophic factor messenger ribonucleic acid: A mechanism to facilitate encoding and circuit maintenance? Behav. Neurosci. 112, 1012–1019. Koenig, H. (1964). Neuronal lipofuscin in disease. Its relation to lysosomes. Trans. Am. Neurol. Assoc. 89, 212–213. Kominami, E., Ezaki, J., Muno, D., Ishido, K., Ueno, T., and Wolfe, L. S. (1992). Speciﬁc storage of subunit c of mitochondrial ATP synthase in lysosomes of neuronal ceroid lipofuscinosis (Batten’s disease). J. Biochem. 111, 278–282. Knipper, M., da Penha Berzaghi, M., Bl¨ochl, A., Breer, H., Thoenen, H., and Lindholm, D. (1994). Positive feedback between acetylcholine and the neurotrophins nerve growth factor and brainderived neurotrophic factor in the rat hippocampus. Eur. J. Neurosci. 6, 668–671. Lam, H. H. D., Mitchison, H. M., Greene, N. D. E., Nussbaum, R. L., Mobley, W. C., and Cooper, J. D. (1999). Pathologic involvement of interneurons in mouse models of neuronal ceroid lipofuscinosis. Soc. Neurosci. Abstr. 25, 1593. Lindsay, R. M., and Yancopoulos, G. D. (1996). GDNF in a bind with known orphan: Accessory implicated in new twist. Neuron 17, 571–574. Lo, DC. (1995). Neurotrophic factors and synaptic plasticity. Neuron 15, 979–981. Longo, F. M., Holtzman, D. M., Grimes, M. L., and Mobley, W. C. (1993). Nerve growth factor: Actions in the peripheral and central nervous systems. In “Neurotrophic Factors” (J. Fallon and S. Loughlin, eds.), pp. 209–256. Academic Press, New York. Mazurkiewicz, J. E., Callahan, L. M., Swash, M., Martin, J. E., and Messer, A. (1993). Cytoplasmic inclusions in spinal neurons of the motor neuron degeneration (Mnd) mouse. J. Neurol. Sci. 116, 59–66. Messer, A., and Flaherty, L. (1986). Autosomal dominance in a late-onset motor neuron disease in the mouse. J. Neurogenet. 3, 345–355. Messer, A., and Plummer, J. (1993). Accumulating autoﬂuorescent material as a marker for early changes in the spinal cord of the Mnd mouse. Neuromusc. Disord. 3, 129–134. Messer, A., Strominger, N. L., and Mazurkiewicz, J. E. (1987). Histopathology of the late-onset motor neuron degeneration (Mnd) mutant in the mouse. J. Neurogenet. 4, 201–213. Messer, A., Plummer, J., Wong, V., and La Vail, M. M. (1993). Retinal degeneration in motor neuron degeneration (mnd) mutant mice. Exp. Eye. Res. 57, 637–641. Mitchison, H. M., Bernard, D. J., Greene, N. D., Cooper, J. D., Junaid, M. A., Pullarkat, R. K., de Vos, N., Breuning, M. H., Owens, J. W., Mobley, W. C., Gardiner, R. M., Lake, B. D., Taschner, P. E., and Nussbaum, R. L. (1999). Targeted disruption of the Cln3 gene provides a mouse model for Batten disease. Neurobiol. Dis. 6, 321–34. Palmer, D. N., Fearnley, I. M., Walker, J. E., Hall, N. A., Lake, B. D., Wolfe, L. S., Haltia, M., Martinus, R. D., and Jolly, R. D. (1992). Mitochondrial ATP synthase subunit c storage in the ceroid-lipofuscinoses (Batten disease). Am. J. Med. Genet. 42, 561–567.

182

J. D. Cooper and W. C. Mobley

Pardo, C. A., Rabin, B. A., Palmer, D. N., and Price, D. L. (1994). Accumulation of the adenosine triphosphate synthase subunit c in the mnd mutant mouse. Am. J. Pathol. 144, 829–835. Patterson, S. L., Grover, L. M., Schwartzkroin, P. A., and Bothwell, M. (1992). Neurotrophin expression in rat hippocampal slices: A stimulus paradigm inducing LTP in CA1 evokes increases in BDNF and NT-3 mRNAs. Neuron 9, 1081–1088. Phillips, H. S., Hains, J. M., Laramee, G. R., Rosenthal, A.,, and Winslow, J. W. (1990). Widespread expression of BDNF but not NT3 by target areas of basal forebrain cholinergic neurons. Science 250, 290–294. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M. F., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A. E. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Santavuori, P. (1988). Neuronal ceroid lipofuscinosis in childhood. Brain Dev. 10, 80–83. Santavuori, P., Rapola, J., Nuutila, A., Raininko, R., Lappi, M., Launes, J., Herva, R., and Saino, K. (1991). The spectrum of Jansky-Bielschowsky disease. Neuropediatrics 22, 92–96. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Schecterson, L. C., and Bothwell, M. (1992). Novel roles for neurotrophins are suggested by BDNF and NT-3 mRNA expression in developing neurons. Neuron 9, 449–463. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukoski, M., Jarvela, J., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late infantile neuronal ceroid lipofuscinosis map to chromosomal 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591–596 Singer, W. (1996). Neurophysiology: The changing face of inhibition. Curr. Biol. 6, 395–397. Sleat, D., Donnelly, R. J., Lackland, H., Liu, C.-G., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997). Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Stoop, R., and Poo, M. M. (1996). Synaptic modulation by neurotrophic factors. Prog. Brain Res. 109, 359–364. Thoenen, H., Zafra, F., Hengerer, B., and Lindholm, D. (1991). The synthesis of nerve growth factor and brain-derived neurotrophic factor in hippocampal and cortical neurons is regulated by speciﬁc transmitter systems. Ann. N.Y. Acad. Sci. 640, 86–90. Tyynel¨a, J., Palmer, D. N., Baumann, M., and Haltia, M. (1993). Storage of saposins A and D in infantile neuronal ceroid-lipofuscinosis. FEBS Lett. 330, 8–12. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Wang, X. H. and, and Poo, M. M. (1997). Potentiation of developing synapses by postsynaptic release of neurotrophin-4. Neuron 19, 925–935. Wetmore, C., Ernfors, P., Persson, H., and Olson, L. (1990). Localization of brain-derived neurotrophic factor mRNA to neurons in the brain by in situ hybridization. Exp. Neurol. 109, 141–152. Wetmore, C., Olson, L. and, and Bean, A. J. (1994). Regulation of brain-derived neurotrophic factor (BDNF) expression and release from hippocampal neurons is mediated by non-NMDA type glutamate receptors. J. Neurosci. 14, 1688–1700. Yuen, E. C., Howe, C. L., Yiwen, L., Holtzman, D. M., and Mobley, W. C. (1996). Nerve growth factor and the neurotrophic factor hypothesis. Brain Dev. 18, 362–368. Zafra, F., Castr´en, E., Thoenen, H., and Lindholm, D. (1991). Interplay between glutamate and gammaaminobutyric acid transmitter systems in the physiological regulation of brain-derived neurotrophic factor and nerve growth factor synthesis in hippocampal neurons. Proc. Natl. Acad. Sci. (USA) 88, 10037–10041.

10

Animal Models for the Ceroid Lipofuscinoses Martin L. Katz∗ University of Missouri School of Medicine Mason Eye Institute Columbia, Missouri 65212

Hisashi Shibuya Department of Veterinary Medicine Nihon University Fujisawa, Japan 252-8510

Gary S. Johnson Department of Veterinary Pathobiology University of Missouri College of Veterinary Medicine Columbia, Missouri 65211

I. The Need for Animal Models II. The Human Disorders III. Naturally Occurring Ceroid Lipofuscinosis in Animals as Models for the Human Disorders A. English Setter Dogs B. South Hampshire Sheep C. Tibetan Terrier Dogs D. mnd Mice E. nclf Mice IV. Animal Models Created through Molecular Genetic Manipulation A. Mouse Gene Knockout Models of Juvenile NCL (CLN3) B. Mouse Gene Knockout Model of Late-Infantile NCL V. Future Directions References * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

183

184

M. L. Katz et al.

I. THE NEED FOR ANIMAL MODELS As with many human maladies, the search for effective treatments or cures for the various ceroid lipofuscinoses would be greatly facilitated if appropriate animal models were available for studies on the mechanisms underlying the disease pathologies and for screening potential therapeutic interventions. This is particularly true for relatively rare diseases for which it would be difﬁcult to amass a sufﬁciently large pool of human subjects for controlled clinical intervention trials. Since the recognition of the human ceroid lipofuscinoses as distinct disease entities, a number of naturally occurring diseases with similar features have been described in animals (Bildfell et al., 1995; Bronson et al., 1993; Chang et al., 1994; Goebel et al., 1988; Jarplid and Haltia, 1993; Jolly, 1995; Jolly et al., 1992a, 1992b; Jolly and Palmer, 1995; Koppang, 1988, 1992; Palmer et al., 1997; Tayler and Farrow, 1992; Weissenbock and Rossel, 1997). Some of these animals have been used in research to elucidate the mechanisms involved in the human disease pathologies (Jolly et al., 1980, 1988; Koppang, 1988; Palmer et al., 1986a, 1986b, 1988, 1989, 1990). However, it was not until the relatively recent identiﬁcation of the gene defects involved in the human disorders (International Batten Disease Consortium, 1995; Sleat et al., 1997; Vesa et al., 1995) that it was possible to evaluate whether the naturally occurring animal diseases are good models for the human counterparts. Identiﬁcation of the genes involved in the human disorders also provided the information necessary for creating animal models through molecular genetic manipulation.

II. THE HUMAN DISORDERS The hereditary neuronal ceroid lipofuscinoses (NCLs) are autosomal recessively inherited neurodegenerative diseases that have a number of clinical and pathological features in common (Boustany et al., 1988; Wisniewski et al., 1988). Despite their similarities, however, the NCLs are actually a group of distinct disorders that result from defects in different genes. The most common diseases that are classiﬁed as NCLs result from defects in the CLN1, CLN2, and CLN3 genes associated with what are commonly referred to as infantile, late-infantile, and juvenile NCL, respectively. Defects in at least ﬁve other genes cause NCL-like disorders (Dyken and Wisniewski, 1995; Dyken, 1988; Klockars et al., 1996; Mole, 1999; Savukoski et al., 1998; Sharp et al., 1997). Given this genetic heterogeneity, one must ask whether a single animal model will be adequate to address questions of disease mechanisms and evaluate therapeutic interventions, or whether animal models will be needed to mimic each speciﬁc gene defect. To address the latter question, it

NCL Animal Models

185

will be necessary to review brieﬂy what is known about each of the more common human NCLs. The infantile disease (CLN1) is characterized by an early onset and rapid progression of clinical symptoms. As the name implies, the disorder becomes apparent in infancy, usually before the age of 1 year. Symptoms include prominent myoclonus, visual loss due to retinal atrophy, dementia, and motor deterioration (Wisniewski et al., 1988). Eventually, affected children become vegetative and may remain in this state for years before dying between the ages of 8 and 13 years (Boustany et al., 1988; Wisniewski et al., 1988). Lysosomal storage bodies with contents that have granular ultrastructural appearances accumulate in many tissues of affected individuals. Among the molecular constituents of the storage bodies are large amounts of sphinglipid activator proteins (SAPs) (Tyynela et al., 1993, 1995, 1997a). The defective gene in children with infantile NCL was identiﬁed as the palmitoyl-protein thioesterase 1 gene (PPT1) (Vesa et al., 1995). This enzyme, apparently located in lysosomes (Hellsten et al., 1996; Sleat et al., 1996), is thought to be involved in the catabolism of lipid-modiﬁed proteins, but its normal substrates have not been identiﬁed. The basis for the association of PPT1 defects with the lysosomal accumulation of SAPs has not been determined. The late-infantile form of NCL (CLN2) has a somewhat later onset, with clinical symptoms typically ﬁrst appearing between 3 and 5 years of age. In this type of NCL, cognitive deﬁcits are typically one of the earliest signs of the disease (Wisniewski et al., 1988). Cognitive decline is accompanied by seizures of various types and by severe motor deterioration. Affected children become blind due to retinal degeneration. As with the infantile disease, children with CLN2 eventually become vegetative. Death usually occurs between 7 and 10 years of age (Wisniewski et al., 1988). In this form of NCL, lysosomal storage bodies accumulate in cells throughout the central nervous system, as well as in many other cell types. The contents of the storage bodies have a distinctive ultrastructural appearance that is usually referred to as curvilinear proﬁles (Goebel and Sharp, 1998). A predominant molecular constituent of the storage bodies is the complete subunit c protein of mitochondrial inner membrane ATP synthase (Ezaki et al., 1995; Hall et al., 1991; Katz et al., 1997c; Kominami et al., 1992; Palmer et al., 1992). The gene that is defective in children with the late-infantile disease (the CLN2 gene) apparently encodes a lysosomal peptidase (Sleat et al., 1997, 1999). How deﬁciencies in this enzyme lead to the speciﬁc accumulation of the subunit c protein or to the disease pathology are not understood. The form of childhood NCL with the latest onset is the juvenile type (CLN3). In this disease, symptoms usually do not become apparent until 5–7 years of age. In the majority of cases, the initial symptom is visual loss due to retinal degeneration (Wisniewski et al., 1988). This is followed by the development of a

186

M. L. Katz et al.

variety of types of seizures and motor problems. Cognitive decline occurs more slowly in this form of NCL than in the earlier-onset types. Ultimately, affected children become vegetative, usually in their late teens. Death usually occurs in the late teens and early twenties. As in other forms of NCL, accumulation of lysosomal storage bodies occurs in neurons and many other cell types. The predominant ultrastructural appearance of the storage body contents is usually described as a ﬁngerprint pattern. As in the late-infantile disorder, the storage bodies contain large amounts of the mitochondrial subunit c protein (Hall et al., 1991; Katz and Rodrigues, 1991; Palmer et al., 1992). The CLN3 gene that is defective in the juvenile disease encodes a protein that, based on the predicted amino acid sequence, is localized to a cellular membrane (International Batten Disease Consortium, 1995). Evidence obtained to date indicates that this protein is localized to either the mitochondria or lysosomes (Haskell et al., 1997; Jarvela et al., 1998; Kaczmarski et al., 1997; Katz et al., 1997a). As for the other forms of NCL, the mechanisms by which the gene defect leads to speciﬁc lysosomal storage or to the disease pathology are not known. In addition to the more common forms of NCL, there are a number of rare variants that each appear to result from defects in different genes. At least eight distinct NCL diseases have been identiﬁed to date (Dyken and Wisniewski, 1995; Dyken, 1988; Klockars et al., 1996; Mole, 1999; Savukoski et al., 1998; Sharp et al., 1997). Among the more rare forms, it is not known whether the speciﬁc gene defects affect similar metabolic pathways to those affected by CLN1, CLN2, and CLN3 gene defects.

III. NATURALLY OCCURRING CEROID LIPOFUSCINOSIS IN ANIMALS AS MODELS FOR THE HUMAN DISORDERS As indicated earlier, NCL-like disorders have been reported in a number of mammalian species. These include dogs, cats, cattle, sheep, and mice (Bildfell et al., 1995; Bronson et al., 1993; Chang et al., 1994; Goebel et al., 1988; Jarplid and Haltia, 1993; Jolly, 1995; Jolly et al., 1992a, 1992b; Jolly and Palmer, 1995; Koppang, 1988, 1992; Palmer et al., 1997; Tayler and Farrow, 1992; Weissenbock and Rossel, 1997). However, many of the disorders in animals were reported as isolated cases in veterinary patients, and only a small number of the animal diseases have been evaluated as potential models for the human disorders. The animal NCLs that have been most extensively studied will be described brieﬂy.

A. English setter dogs The ﬁrst animal disease to be studied extensively as a potential model for the human NCLs occurs in English setters that originated in Norway. A disorder

NCL Animal Models

187

with similarities to human juvenile ceroid lipofuscinosis was ﬁrst described in this breed in the late 1950s (Koppang, 1992). Affected dogs appear clinically normal early in life, but undergo a progressive neuronal degeneration that results in cognitive and motor decline. Neuronal degeneration is accompanied by blindness and seizures. The disease results in death at approximately 2 years of age. As with the human childhood NCLs, the disorder in the dogs was shown to be inherited in an autosomal recessive pattern (Koppang, 1988, 1992). Neuronal degeneration in the dogs is accompanied by a massive accumulation of autoﬂuorescent lysosomal storage bodies in neurons and many other cell types (Katz et al., 1994; Koppang, 1988). The storage bodies were shown to be rich in the mitochondrial subunit c protein (Katz et al., 1994). On the basis of clinical, biochemical, and pathological features, the English setter disorder was long considered to be a good model for the juvenile disease in humans (Katz et al., 1994; Koppang, 1988, 1992). With publication of the identity of the human CLN3 gene in 1995 (International Batten Disease Consortium, 1995), it became possible to determine whether the canine disorder resulted from a defect in the canine ortholog of the gene that was involved in human juvenile NCL. Using the human gene sequence information, we determined the nucleotide sequences of the English setter ortholog of the CLN3 gene and its cDNA in both affected and normal English setters. No sequence differences other than single-base substitutions in some of the introns were identiﬁed (Shibuya et al., 1998). Using an intragenic polymorphism as a marker, linkage analysis was performed with an informative English setter pedigree. Neither allele was speciﬁcally associated with the disease phenotype. Thus, defects in the canine ortholog of the CLN3 gene were ruled out as the cause of the disease in this breed (Shibuya et al., 1998). This conclusion was conﬁrmed by linkage analysis of a large English setter pedigree from Norway (Lingaas et al., 1998). Elimination of a mutation at the CLN3 locus as being the cause of NCL in the English setter led to the hypothesis that the canine disease might result from a defect in the ortholog of the CLN2 gene. Using the human CLN2 gene sequence information (Liu et al., 1998; Sleat et al., 1997), we determined the cDNA sequences of the canine CLN2 ortholog in an affected and a normal English setter. No differences were detected (Figure 10.1). As with CLN3, a polymorphism was found in one of the canine CLN2 introns that was informative for linkage analysis in an English setter family. The two alleles segregated independently from the disease in this family (Figure 10.2). Thus, CLN2 was also eliminated as the locus for the English setter disease. Support for this conclusion is supported by the ﬁnding that the English setter disorder is not linked to canine orthologs of genes that map close to human CLN2 (Lingaas et al., 1998). In addition, affected English setters showed normal levels of activity of the pepstatin-insensitive protease activity that has been attributed to the CLN2 protein (Sohar et al., 1999).

188

M. L. Katz et al.

The clinical, biochemical, and pathological similarities between NCL in the English setter and the human late-infantile and juvenile disorders suggest that these dogs may be of some use as models for the human NCLs. However, elimination of defects in the CLN2 and CLN3 loci as causes for the canine disorder indicates that the English setter disease is not a close homolog of either of these human diseases. Thus, it is not apparent to what extent research with the English setter model would be applicable to human late-infantile or juvenile NCL. It is clear that there are a number of other types of NCL. The gene defect in the setters may be in an ortholog of one of the genes involved in these other, more rare forms.

B. South Hampshire sheep An autosomal recessively inherited disease in South Hampshire sheep has been proposed as a model for some of the human NCLs. This model has been developed and studied extensively by R. D. Jolly and colleagues (Broom et al., 1998; Fearnley et al., 1990; Jolly, 1995; Jolly et al., 1980, 1988, 1992a, 1992b; Palmer et al., 1986a, 1986b, 1990). As in the human NCLs, the ovine disease is characterized by progressive atrophy of the retina and central nervous system. Generalized seizures do not typically occur in affected sheep, and when they do, it is usually when death is imminent. However, the sheep do develop localized tremors that have been interpreted as partial symmetrical seizures that do not generalize (Mayhew et al., 1985). As in the human disorders, affected sheep show massive accumulation of autoﬂuorescent lysosomal storage bodies in neurons and many other cell types. On the basis of clinical symptoms, disease pathology, and storage body chemical composition, the sheep model most closely resembles the human juvenile disorder (Jolly et al., 1992b). However, genetic mapping studies indicate that the gene defect in the sheep is syntenic with a region of the human genome to which a late-infantile variant form of human NCL (CLN6) has been mapped (Broom et al., 1998). The greatest contribution of the sheep model to our understanding of the NCLs was the discovery that the mitochondrial subunit c protein is a major constituent of the lysosomal storage bodies in these animals (Fearnley et al., 1990;

Figure 10.1. cDNA sequence of canine ortholog of the CLN2 gene (top line), and predicted amino acid sequences of the canine (second line), human (third line) (Sleat et al., 1997), and mouse (fourth line) (Katz et al., 1999a) proteins. Hyphens in the human and mouse sequences indicate identity with the canine sequence. The N-terminal of the CLN2 protein that has been isolated from human tissues (residue 196) is indicated by an open arrow. The locations of the introns are indicated by ﬁlled arrows. Positions at which mutations resulting in single amino acid substitutions have been found in alleles of the gene associated with clinical ceroid lipofuscinosis are indicated by boxes (Sleat et al., 1999).

(continues)

190 Figure 10.1. (continued)

191

(continues)

Figure 10.1. (continued)

NCL Animal Models

193

Figure 10.2. Pedigree of an English setter family showing the pattern of inheritance of two alleles of the CLN2 gene. The two alleles are distinguished by a single nucleotide difference (T or C). Affected dogs are indicated by ﬁlled symbols and phenotypically normal obligate heterozygotes are indicated by half-ﬁlled symbols. There was no association between CLN2 genotype and disease status.

Palmer et al., 1986a, 1989, 1990). This observation led to the demonstration that the same small hydrophobic protein is abundant in the storage bodies that accumulate in most forms of human NCL other than the infantile type (Ezaki et al., 1995, 1996; Hall et al., 1991; Katz et al., 1995, 1997c; Kominami et al., 1992; Palmer et al., 1992; Rowan and Lake, 1995; Tyynela et al., 1997b; Wisniewski et al., 1995). Determining why this speciﬁc protein accumulates in the NCLs may be the key to understanding how mutations in a variety of different genes result in similar disorders. In this respect, the sheep should be a good model for elucidating the mechanisms involved in the speciﬁc accumulation of the subunit c protein.

C. Tibetan terrier dogs Ceroid lipofuscinosis has been described in a number of dog breeds in addition to the English setters (Appleby et al., 1982; Cummings and deLahunta, 1977; Goebel et al., 1988; Jolly, 1995; Palmer et al., 1997; Rac and Giesecke, 1975; Tayler and Farrow, 1992). However, the Tibetan terrier is the only other breed that has been studied in sufﬁcient detail for these animals to be evaluated as a model for the human disorders. Like the human childhood-onset NCLs, ceroid lipofuscinosis in Tibetan terriers is inherited in an autosomal recessive pattern (Riis et al., 1992). The ﬁrst clinical symptom to become apparent is night blindness, which can be detected with electrorintography as early as 7 weeks of age (Riis et al., 1992). As in the human disorders, vision loss is due primarily to a progressive retinal degeneration. Behavioral changes and loss of training begin to appear between 4 and 6 years of age. Mild ataxia develops at 8–9 years. Unlike the human childhood disorders, neither seizures nor shortening of life span have been reported in these animals. Clinically, the Tibetan terrier disease has a later onset and a milder course that the human NCLs. The disease in Tibetan terriers, like that in humans and other animals, is accompanied by accumulation of autoﬂuorescent lysosomal storage bodies in neurons and other cell types (Alroy et al., 1992; Riis et al., 1992). Storage body accumulation is

194

M. L. Katz et al.

accompanied by neuronal degeneration in both the retina and the brain. However, brain atrophy appears to be much more mild than in the human NCLs. As in the human late-infantile and juvenile NCLs, the lysosomal storage bodies in the Tibetan terriers are rich in the mitochondrial subunit c protein (Jolly et al., 1992b). To determine whether the Tibetan terrier is homologous to one of the human NCLs, it will be necessary to identify or at least map the gene defect in these dogs. Studies have been initiated to determine whether affected Tibetan terriers have a mutation in the canine ortholog of either the CLN2 or CLN3 gene. In addition, DNA samples are being collected from appropriate Terrier families to map the disorder on the evolving canine genome map (Mellersh et al., 2000). Until these genetic analyses are completed, it will not be known whether the Tibetan terrier disease is a suitable model for one of the human NCLs.

D. mnd Mice A naturally occurring mutation resulting in motor neuron degeneration in a substrain of C57BL/6 mice was ﬁrst described almost 15 years ago (Messer and Flaherty, 1986). Initially, the disease in this mouse strain (since designated mnd) was proposed as a model for amyotropic lateral sclerosis (ALS) (Messer et al., 1987). However, histological examination of neural tissues led to the discovery that the disease is characterized by a progressive accumulation of autoﬂuorescent intracellular inclusions, similar to those that accumulate in the NCLs (Messer and Plummer, 1993). Subsequently, affected mice were found to undergo retinal degeneration (Chang et al., 1994; Messer et al., 1993), and the intracellular inclusions that accumulate in cells were shown to contain the mitochondrial subunit c protein (Bronson et al., 1993). Thus, the mnd strain was proposed as a model of NCL (Bronson et al., 1993; Chang et al., 1994). Recently, the mutation causing the disease in mnd mice was found to be a 1-bp insertion in the ortholog of a gene that when defective in humans causes progressive epilepsy with mental retardation (EPMR) (Ranta et al., 1999). The human disease, now classiﬁed as a new NCL subtype (CLN8), is an autosomal recessive disorder characterized by an onset of generalized seizures between 5 and 10 years of age and subsequent progressive metal retardation. The function of the protein encoded by the CLN8 gene is not known, but based on the predicted amino acid sequence, it is likely to be a transmembrane protein (Ranta et al., 1999). Abnormalities have been reported in mitochondria-associated membranes of mnd/mnd mice (Vance et al., 1997), which suggests that the CLN8 gene might encode a mitochondrial membrane protein. Dietary supplementation with carnitine slowed the disease progression in mnd/mnd mice and prolonged their life spans (Katz et al., 1997b), suggesting that a similar treatment may be beneﬁcial for humans with the CLN8 disorder.

NCL Animal Models

195

E. nclf Mice A mouse strain with a phenotype very similar to that of the mnd strain has been described and proposed as another potential animal model for NCL (Bronson et al., 1998). This mouse strain has been designated nclf. The disorder in these mice is inherited as an autosomal recessive trait. Homozygous nclf mice develop progressive retinal atrophy early in life and become paralyzed at about 9 months of age. Lysosomal storage bodies with staining and ultrastructural properties similar to those of the storage material in the human NCLs were found to accumulate in neurons and many other cell types. The genetic defect in the nclf mice has been mapped to a region of mouse chromosome 9 that is syntenic to human chromosome 15q21, where the gene that is defective in the CLN6 form of human NCL has been mapped (Sharp et al., 1997). Thus, the nclf strain is likely to be a suitable model for the latter disorder.

IV. ANIMAL MODELS CREATED THROUGH MOLECULAR GENETIC MANIPULATION With the development of technology for molecular manipulation of speciﬁc genes in mice, it has become possible to generate mouse strains in which the murine orthologs of genes involved in human inherited diseases are disrupted (Capechi, 1994). This technique, designated targeted gene replacement, has been employed to generate mouse models for a number of inherited human disorders (Bahn et al., 1999; Bourdeau et al., 1999; Leheste et al., 1999; Rudmann and Durham, 1999; Taketo, 1999; Willecke et al., 1999; Wong et al., 1999). Once the genes involved in the human NCLs were identiﬁed, it became possible to employ this technology to develop mouse models for those forms of NCL for which no naturally occurring mutant mouse strains have been identiﬁed. Targeted gene replacement has been or is currently being used to develop mouse models of the human CLN2 and CLN3 disorders.

A. Mouse gene knockout models of juvenile NCL (CLN3 ) The mouse ortholog of the CLN3 gene consists of 15 exons and with the intervening introns is over 14 kb in length (Katz et al., 1999b). The mouse gene is designated Cln3. Gene targeting has been used to generate two mouse strains in which the Cln3 gene has been disrupted by replacement of portions of the normal gene with a neomycin-resistance gene (Figure 10.3) (Greene et al., 1999; Katz et al., 1999b). In both strains, there is widespread intracellular accumulation of autoﬂuorescent lysosomal storage bodies with ultrastructural characteristics similar to those that accumulate in human juvenile NCL (Katz et al.,

Figure 10.3. Regions of the Cln3 gene that have been knocked out in two mouse strains are shown in ﬁlled boxes above and below the schematic diagram of the Cln3 gene (not drawn to scale). The mouse gene contains 15 exons. Most of exon 7 and all of exon 8 are deleted in knockout A (Katz et al., 1999b), whereas most of exon 1 and exons 2-6 are deleted in knockout B (Greene et al., 1999).

NCL Animal Models

197

1999b; Mitchison et al., 1999). In one strain, behavioral abnormalities including hyperactivity and hind limb stiffness have been observed (Katz et al., 1999b). Premature death between 4 and 10 months of age occurred in many of the mice from the latter strain (Katz et al., 1999b). There was substantial phenotypic variability these animals. In the mice characterized by Katz and colleagues to date, the Cln3 mutation was on a mixed C57BL/6 and 129SV/J background (Katz et al., 1999b). This mixed background was probably responsible for the phenotypic variability. Backcrosses are currently being performed to place the Cln3 mutation on a pure C57BL/6 background. When this has been accomplished, further phenotypic characterization will be undertaken. In the Cln3 knockout strain generated by Greene and colleagues (Greene et al., 1999), a more detailed phenotypic characterization was carried out in mice with the mutation on a mixed 129SV–NIH Black Swiss genetic background (Mitchison et al., 1999). The storage bodies in these animals stained with an antibody directed against the mitochondrial subunit c protein, a major constituent of the storage material in human juvenile NCL. In these animals, there were reduced numbers of speciﬁc neuronal cell types in the cerebral cortex compared to normal control mice. In other areas of the brain, there was neuronal hypertrophy. Elevated activity levels of the lysosomal peptidase that is absent in human CLN2 patients were also detected in the affected mice. The latter observation most likely reﬂects an overall increase in lysosomal enzymes in these animals. On the basis of the characterizations carried out to date, it appears that both Cln3 mutant mouse strains will be useful in studying the mechanisms underlying disease pathology in juvenile NCL and for screening potential therapeutic interventions.

B. Mouse gene knockout model of late-infantile NCL Identiﬁcation of the gene that is defective in human children with late-infantile NCL (Sleat et al., 1997) enabled work to begin on constructing a mouse gene knockout model for this disorder. The ﬁrst step in this process was to characterize the mouse ortholog of the CLN2 gene (Katz et al., 1999a). The mouse Cln2 gene had the same genomic organization as its human ortholog, although the intron sizes varied somewhat between the species. The mouse gene spans more than 6 kb and consists of 13 exons separated by introns ranging in size from 111 to 1259 bp (Figure 10.4). The mouse cDNA contains an open reading frame that predicts a protein product of 562 amino acids. The mouse and human coding regions are 86% and 88% identical at the nucleic acid and amino acid levels, respectively, with one less codon in the mouse than in the human cDNA (Figure 10.1). The Cln2 gene maps to a region of mouse chromosome 7 that corresponds to human chromosome 11p15 where the CLN2 gene has been mapped.

198

M. L. Katz et al.

Figure 10.4. Region of the Cln2 gene that has been replaced by the neomycin resistance gene in the Cln2 knockout mouse strain that is under development. The Cln2 gene (drawn to scale) contains 13 exons (shown by ﬁlled boxes). Exons 4–6 are deleted in the knockout construct.

Once the Cln2 gene had been characterized, a targeting construct was made to disrupt this gene in mouse embryonic stem (ES) cells. After incorporation of the targeting construct, an ES clone was identiﬁed in which three of the Cln2 exons were replaced by a neomycin resistance gene (Figure 10.4). The ES cells containing this knockout allele were incorporated into blastocyst-stage embryos and transferred into pseudo-pregnant recipient foster mothers. The embryos developed into mice that were chimeras containing a signiﬁcant fraction of their cells derived from the modiﬁed ES cell line. To complete the development of the Cln2 knockout model, the chimeric mice are being bred to normal animals, and the offspring will be screened for heterozygosity at the Cln2 locus. Heterozygous mice will then be bred to obtain animals that are homozygous for the knockout allele. The homozygous knockout animals will be monitored for the appearance of phenotypic features of NCL.

V. FUTURE DIRECTIONS None of the animal models identiﬁed or developed to date replicate the human NCL disorders perfectly. Nonetheless, they have been and will continue to be valuable tools in studies to determine the mechanisms that underlie the human disease pathologies. The availability of these animal models will also hasten the development of effective treatment interventions for the human NCLs. Screening of potential therapies can be done relatively quickly and at modest cost using animal models, particularly the mouse models. The most promising therapies can then be evaluated in human clinical trials. For those afﬂicted with the NCLs and their families, the time for hope is short, as the neurological degeneration progresses relentlessly. The goal in developing suitable animal models is to provide tools that will be keys to discovery of effective therapeutic interventions for the NCLs that will halt or at least delay the neurological degeneration associated with these disorders.

NCL Animal Models

199

Acknowledgments Original work conducted in the authors’ laboratories was supported by the Batten Disease Support and Research Association, the Children’s Brain Diseases Foundation, and by National Institutes of Health grants NS30155 and NS38987.

References Alroy, J., Schelling, S. H., Thalhammer, J. G., Raghavan, S. S., Natowicz, M. R., Prence, E. M., and Orgad, U. (1992). Adult onset lysosomal storage disease in a Tibetan terrier: Clinical, morphological and biochemical studies. Acta Neuropathol. 84, 658–663. Appleby, E. C., Longstaffe, J. A., and Bell, F. R. (1982). Ceroid-lipofuscinosis in two saluki dogs. J. Comp. Pathol. 92, 375–380. Bahn, A. K., Mizoguchi, E., Smith, R. N., and Mizoguchi, A. (1999). Colitis in transgenic and knockout animals as models of human inﬂammatory bowel disease. Immunol. Rev. 169, 195–207. Bildfell, R., Matwichuk, C., Mitchell, S., and Ward, P. (1995). Neuronal ceroid-lipofuscinosis in a cat. Vet. Pathol. 32, 485–488. Bourdeau, A., Dumont, D. J., and Letarte, M. (1999). A murine model of hereditary hemorrhagic telangiectasia. J. Clin. Invest. 104, 1343–1351. Boustany, R. N., Alroy, J., and Kolodny, E. H. (1988). Clinical classiﬁcation of neuronal ceroid lipofuscinosis subtypes. Am. J. Med. Genet. Suppl. 5, 47–58. Bronson, R. T., Lake, B. D., Cook, S., Taylor, S., and Davisson, M. T. (1993). Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten’s disease). Ann. Neurol. 33, 381–385. Bronson, R. T., Donahue, L. R., Johnson, K. R., Tanner, A., Lane, P. W., and Faust, J. R. (1998). Neuronal ceroid lipofuscinosis (nclf ), a new disorder of the mouse linked to chromosome 9. Am. J. Med. Genet. 77, 289–297. Broom, M. F., Zhou, C. M., Broom, J. E., Barwell, K. J., Jolly, R. D., and Hill, D. F. (1998). Ovine ceroid lipofuscinosis: A large animal model syntenic with the human neuronal ceroid lipofuscinosis variant CLN6. J. Med. Genet. 35, 717–721. Capechi, M. R. (1994). Targeted gene replacement. Sci. Am. 270, 52–59. Chang, B., Bronson, R. T., Hawes, N. L., Roderick, T. H., Peng, C., Hageman, G. S., and Heckenlively, J. R. (1994). Retinal degeneration in motor neuron degeneration: A mouse model for ceroidlipofuscinosis. Invest. Ophthalmol. Vis. Sci. 35, 1071–1076. Cummings, J. F., and deLahunta, A. (1977). An adult case of canine ceroid-lipofuscinosis. Acta Neuropathol. 39, 43–51. Dyken, P. R. (1988). Reconsideration of the classiﬁcation of the neuronal ceroid-lipofuscinoses. Am. J. Med. Genet. Suppl. 5, 69–84. Dyken, P., and Wisniewski, K. (1995). Classiﬁcation of the neuronal ceroid-lipofuscinoses: Expansion of the atypical forms. Am. J. Med. Genet. 57, 150–154. Ezaki, J., Wolfe, L. S., Higuti, T., Ishidoh, K., and Kominami, E. (1995). Speciﬁc delay of degradation of mitochondrial ATP synthase subunit c in late infantile neuronal ceroid lipofuscinosis (Batten disease). J. Neurochem. 64, 733–741. Ezaki, J., Wolfe, L. S., and Kominami, E. (1996). Speciﬁc delay in degradation of mitochondrial ATP synthase subunit c in late infantile neuronal ceroid lipofuscinosis is derived from cellular proteolytic dysfunction rather than structural alteration of subunit c. J. Neurochem. 67, 1677–1687. Fearnley, I. M., Walker, J. E., Martinus, R. D., Jolly, R. D., Kirkland, K. B., Shaw, G. J., and Palmer, D. N. (1990). The sequence of the major protein stored in ovine ceroid-lipofuscinosis is identical

200

M. L. Katz et al.

with that of the dicyclohexylcarbodiimide-reactive proteolipid of mitochondrial ATP synthase. Biochem. J. 268, 751–758. Goebel, H. H., and Sharp, J. D. (1998). The neuronal ceroid-lipofuscinoses: Recent advances. Brain Pathol. 8, 151–162. Goebel, H. H., Bilzer, T., Dahme, E., and Malkush, F. (1988). Morphological studies in canine (dalmation) neuronal ceroid-lipofuscinosis. Am. J. Med. Genet. Suppl. 5, 127–140. Greene, N. D. E., Bernard, D. L., Taschner, P. E. M., Lake, B. D., de Vos, N., Breuning, M. H., Gardiner, R. M., Mole, S. E., Nussbaum, R. L., and Mitchison, H. M. (1999). A murine model for juvenile NCL: Gene targeting of mouse Cln3. Mol. Genet. Matabol. 66, 309–313. Hall, N. A., Lake, B. D., Dewji, N. N., and Patrick, A. D. (1991). Lysosomal storage of subunit c of mitochondrial ATP synthase in Batten’s disease (ceroid-lipofuscinosis). Biochem. J. 275, 269– 272. Haskell, R. E., Derken, T. A., and Davidson, B. L. (1997). Intracellular localization of the Batten gene product, CLN3. Soc. Neurosci. 23, 860. Hellsten, E., Vesa, J., Olkkonen, V. M., Jalanko, A., and Peltonen, L. (1996). Human palmitoyl protein thioesterase: Evidence for lysosomal targeting and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. EMBO J. 15, 5240–5245. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease, CLN3. Cell. 82, 949–957. Jarplid, B., and Haltia, M. (1993). An animal model for the infantile type of neuronal ceroidlipofuscinosis. J. Inher. Metab. Dis. 16, 274–277. Jarvela, I., Sainio, M., Rantamki, T., Olkkonen, V. M., Carpen, O., Peltonen, L., and Jalanko, A. (1998). Biosynthesis and intracellular targeting of the CLN3 protein defective in Batten disease. Hum. Molec. Genet. 7, 85–90. Jolly, R. D. (1995). Comparative biology of the neuronal ceroid-lipofuscinoses (NCL): An overview. Am. J. Med. Genet. 57, 307–311. Jolly, R. D., and Palmer, D. N. (1995). The neuronal ceroid-lipofuscinoses (Batten disease): Comparative aspects. Neuropathol. Appl. Neurobiol. 21, 50–60. Jolly, R. D., Janmaat, A., West, D. M., and Morrison, I. (1980). Ovine ceroid-lipofuscinosis I: A model for Batten’s disease. Neuropathol. Appl. Neurobiol. 6, 195–206. Jolly, R. D., Shimada, A., Craig, A. S., Kirkland, K. B., and Palmer, D. N. (1988). Ovine ceroidlipofuscinosis II: Pathologic changes interpreted in light of biochemical observations. Am. J. Med. Genet. Suppl. 5, 159–170. Jolly, R. D., Gibson, A. J., Healy, P. J., Slack, P. M., and Birtles, M. J. (1992a). Bovine ceroidlipofuscinosis: Pathology of blindness. N. Z. Vet. J. Jolly, R. D., Martinus, R. D., and Palmer, D. N. (1992b). Sheep and other animals with ceroidlipofuscinosis: Their relevance to Batten disease. Am. J. Med. Genet. 42, 609–614. Kaczmarski, W., Kida, E., Lach, A., Rubenstein, R., Zhong, N., and Wisniewski, K. (1997). Expression studies of CLN3 protein. Neuropediatrics 28, 33–36. Katz, M. L., and Rodrigues, M. (1991). Juvenile ceroid-lipofuscinosis: Evidence for methylated lysine in storage body protein. Am. J. Pathol. 138, 323–332. Katz, M. L., Christianson, J. S., Norbury, N. E., Gao, C., Siakotos, A. N., and Koppang, N. (1994). Lysine methylation of mitochondrial ATP synthase subunit c stored in tissues of dogs with hereditary ceroid-lipofuscinosis. J. Biol. Chem. 269, 9906–9911. Katz, M. L., Gao, C., Tompkins, J. A., Chin, D. T., and Bronson, R. T. (1995). Mitochondrial ATP synthase subunit c stored in hereditary ceroid-lipofuscinosis contains trimethyllysine. Biochem. J. 310, 887–892. Katz, M. L., Gao, C., Prabhakaram, M., Shibuya, H., Liu, P., and Johnson, G. S. (1997a). Immunochemical localization of the Batten disease (CLN3) protein in retina. Invest. Ophthalmol. Vis. Sci. 38, 2373–2384.

NCL Animal Models

201

Katz, M. L., Rice, L. M., and Gao, C. (1997b). Dietary carnitine supplements slow disease progression in a putative mouse model for hereditary ceroid-lipofuscinosis. J. Neurosci. Res. 50, 123– 132. Katz, M. L., Siakotos, A. N., Gao, Q., Freiha, B., and Chin, D. T. (1997c). Late-infantile ceroidlipofuscinosis: Lysine methylation of mitochondrial subunit c from lysosomal storage bodies. Biochim. Biophys. Acta 1361, 66–74. Katz, M. L., Liu, P., Grob-Nunn, S., Shibuya, H., and Johnson, G. S. (1999a). Characterization and chromosomal mapping of a mouse homolog of the late-infantile ceroid-lipofuscoinosis gene CLN2. Mamm. Genome. 10, 1050–1053. Katz, M. L., Shibuya, H., Liu, P., Kaur, S., Gao, C., and Johnson, G. S. (1999b). A mouse gene knockout model for juvenile ceroid-lipofuscinosis. J. Neurosci. Res. 57, 551–556. Klockars, T., Savukoski, M., Isosomppi, J., Laan, M., Jarvela, I., Petrukhin, K., Palotie, A., and Peltonen, L. (1996). Efﬁcient construction of a physical map by ﬁber-ﬁsh of the CLN5 region: Reﬁned assignment and long-range contig covering the critical region on 13q22. Genomics 35, 71–78. Kominami, E., Ezaki, J., Muno, D., Ishido, K., Ueno, T., and Wolfe, L. S. (1992). Speciﬁc storage of subunit c of mitochondrial ATP synthase in lysosomes of neuronal ceroid lipofuscinosis (Batten’s disease). J. Biochem. 111, 278–282. Koppang, N. (1988). The English setter with ceroid-lipofuscinosis: A suitable model for the juvenile type of ceroid-lipofuscinosis. Am. J. Med. Genet. Suppl. 5, 117–126. Koppang, N. (1992). English setter model and juvenile ceroid-lipofuscinosis in man. J. Med. Genet. 42, 594–599. Leheste, J. R., Rolinski, B., Vorum, H., Nykjaer, A., Jacobsen, C., Aucouturier, P., Moskaug, J. O., Otto, A., Christensen, E. I., and Willnow, T. E. (1999). Megalin knockout mice as an animal model of low molecular weight proteinuria. Am. J. Pathol. 155, 1361–1370. Lingaas, F., Aarskaug, T. M. S., Bjerkas, I., Grimholt, U., Moe, L., Juneja, R. K., Wilton, A. N., Galibert, F., Holmes, N. G., and Dolf, G. (1998). Genetic markers linked to neuronal ceroid lipofuscinosis in English setter dogs. Animal Genet. 29, 371–376. Liu, C., Sleat, D. E., Donnelly, R. J., and Lobel, P. (1998). Structural organization and sequence of CLN2, the defective gene in classical late infantile neuronal ceroid lipofuscinosis. Genomics 50, 206–212. Mayhew, I. G., Jolly, R. D., Pickett, B. T., and Slack, P. M. (1985). Ceroid-lipofuscinosis (Batten’s disease): Pathogenesis of blindness in the ovine model. Neuropathol. Appl. Neurobiol. 11, 273– 290. Mellersh, C. S., Hitte, C., Richman, M., Vignaux, F., Priat, C., Jouquand, S., Werner, P., Adre, C., DeRose, S., Patterson, D. F., Ostrander, E. A., and Galibert, F. (2000). An integrated linkageradiation hybrid map of the canine genome. Mamm. Genome 11, 120–130. Messer, A., and Flaherty, L. (1986). Autosomal dominance in a late-onset motor neuron disease in the mouse. Ann. Neurol. 33, 381–385. Messer, A., and Plummer, J. (1993). Accumulating autoﬂuorescent material as a marker for early changes in the spinal cord of the Mnd mouse. Neuromusc. Disord. 3, 129–134. Messer, A., Strominger, N. L., and Mazurkiewicz, J. E. (1987). Histopahtology of the late-onset motor neuron degeneration (Mnd) mutant in the mouse. J. Neurogenet. 4, 201–213. Messer, A., Plummer, J., Wong, V., and LaVail, M. M. (1993). Retinal degeneration in motor neuron degeneration (mnd) mutant mice. Exp. Eye Res. 57, 637–641. Mitchison, H. M., Bernard, D. J., Greene, N. D., Cooper, J. D., Juniad, M. A., Pullarkat, R. K., deVos, N., Bruening, M. H., Owens, J. W., Mobley, W. C., Gardiner, R. M., Lake, B. D., Taschner, P. E., and Nussbaum, R. L. (1999). Targeted disruption of the Cln3 gene provides a mouse model for Batten disease. Neurobiol. Dis. 6, 321–334. Mole, S. E. (1999). Batten’s disease: Eight genes and still counting?. Lancet 354, 443–445.

202

M. L. Katz et al.

Palmer, D. N., Barns, G., Husbands, D. R., and Jolly, R. D. (1986a). Ceroid lipofuscinosis in sheep. II. The major component of the lipopigment in liver, kidney, pancreas, and brain is low molecular weight protein. J. Biol. Chem. 261, 1773–1777. Palmer, D. N., Husbands, D. R., Winter, P. J., Blunt, J. W., and Jolly, R. D. (1986b). Ceroid lipofuscinosis in sheep. I. Bis(monoacylglycero)phosphate, dolichol, ubiquinone, phospholipids, fatty acids, and ﬂuorescence in liver lipopigment lipids. J. Biol. Chem. 261, 1766–1772. Palmer, D. N., Martinus, R. D., Barns, G., Reeves, R. D., and Jolly, R. D. (1988). Ovine ceroidlipofuscinosis: Lipopigment composition is indicative of a lysosomal proteinosis. Am. J. Med. Genet. Suppl. 5, 141–158. Palmer, D. N., Martinus, R. D., Cooper, S. M., Midwinter, G. G., Reid, J. C., and Jolly, R. D. (1989). Ovine ceroid-lipofuscinosis. The major lipopigment protein and the lipid-binding subunits of mitochondrial ATP synthase have the same NH2-terminal sequence. J. Biol. Chem. 264, 5736– 5740. Palmer, D. N., Fearnley, I. M., Medd, S. M., Walker, J. E., Martinus, R. D., Bayliss, S., Hall, N. A., Lake, B. D., Wolfe, L. S., and Jolly, R. D. (1990). Lysosomal storage of the DCCD-reactive proteolipid subunit of mitochondrial ATP synthase in human and ovine ceroid-lipofuscinosis. In “Lipofuscin and Ceroid Pigments” ( E.A. Porta, ed.), pp. 211–223. Plenum Press, New York. Palmer, D. N., Fearnley, I. M., Walker, J. E., Hall, N. A., Lake, B. D., Wolfe, L. S., Haltia, M., Martinus, R. D., and Jolly, R. D. (1992). Mitochondrial ATP synthase subunit c storage in the ceroid-lipofuscinoses (Batten disease). Am. J. Med. Genet. 42, 561–567. Palmer, D. N., Tyynela, J., van Mil, H. C., Westlake, J. V., and Jolly, R. D. (1997). Accumulation of sphingolipid activator proteins (SAPs) A and D in granular osmiophilic deposits in miniature Schnauzer dogs with ceroid lipofuscinosis. J. Inher. Metab. Dis. 20, 74–84. Rac, R., and Giesecke, P. R. (1975). Lysosomal storage disease in Chihuahuas. Austral. Vet. J. 51, 403–404. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., Bonaldo, M. F., Hirvasniemi, A., de la Chapelle, A., and Lehesjoki, A. E. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–236. Riis, R. C., Cummings, J. F., Loew, E. R., and de Lahunta, A. (1992). Tibetan terrier model of canine ceroid lipofuscinosis. Am. J. Med. Genet. 42, 615–621. Rowan, S. A., and Lake, B. D. (1995). Tissue and cellular distribution of subunit c of ATP synthase in Batten disease (neuronal ceroid-lipofuscinosis). Am. J. Med. Genet. 57, 172–176. Rudmann, D. G., and Durham, S. K. (1999). Utilization of genetically altered animals in the pharmaceutical industry. Toxicol. Pathol. 27, 111–114. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E. S., and Peltonen, L. (1998). CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 19, 286–288. Sharp, J. D., Wheeler, R. B., Lake, B. D., Savukoski, M., Jarvela, I. E., Peltonen, L., Gardiner, R. M., and Williams, R. E. (1997). Loci for classical and a variant late infantile neuronal ceroid lipofuscinosis map to chromosomes 11p15 and 15q21-23. Hum. Mol. Genet. 6, 591–595. Shibuya, H., Liu, P., Katz, M. L., Siakotos, A. N., Nonneman, D. J., and Johnson, G. J. (1998). Coding sequence and exon/intron organization of the canine CLN3 (Batten disease) gene and its exclusion as the locus for ceroid lipofuscinosis in English setter dogs. J. Neurosci. Res. 52, 268–275. Sleat, D. E., Sohar, I., Lackland, H., Majercak, J., and Lobel, P. (1996). Rat brain contains levels of mannose-6-phosphorylated glycoproteins including lysosomal enzymes and palmitoyl-protein thioesterase, an enzyme implicated in infantile neuronal lipofuscinosis. J. Biol. Chem. 271, 19191– 19198. Sleat, D. E., Donnelly, R. J., Lackland, H., Liu, C., Sohar, I., Pullarkat, R. K., and Lobel, P. (1997).

NCL Animal Models

203

Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277, 1802–1805. Sleat, D. E., Gin, R. M., Sohar, I., Wisniewski, K., Sklower-Brooks, S., Pullarkat, R. K., Palmer, D. N., Lerner, T. J., Boustany, R., Uldall, P., Siakotos, A. N., Donnelly, R. J., and Lobel, P. (1999). Mutational analysis of the defective protease in classical late-infantile neuronal ceroid lipofuscinosis, a neurodegenerative lysosomal storage disorder. Am. J. Hum. Genet. 64, 1511– 1523. Sohar, I., Sleat, D. E., Jadot, M., and Lobel, P. (1999). Biochemical characterization of a lysosomal protease deﬁcient in classical late infantile neuronal ceroid lipofuscinosis (LINCL) and development of an enzyme-based assay for diagnosis and exclusion of LINCL in human specimens and animal models. J. Neurochem. 73, 700–711. Taketo, M. M. (1999). Apc gene knockout mice as a model for familial adenomatous polyposis. Prog. Exp. Tumor Res. 35, 109–119. Tayler, R. M., and Farrow, B. R. H. (1992). Ceroid lipofuscinosis in the border collie dog: Retinal lesions in an animal model of juvenile Batten disease. Am. J. Human Genet. 42, 622–627. Tyynela, J., Palmer, D. N., Baumann, M., and Haltia, M. (1993). Storage of saposins A and B in infantile neuronal ceroid-lipofuscinoses. FEBS Lett. 330, 8–12. Tyynela, J., Baumann, M., Hensler, M., Sandhoff, K., and Haltia, M. (1995). Sphingolipid activator proteins (SAPs) are stored together with glycosphingolipids in the infantile neuronal ceroidlipofuscinosis (INCL). Am. J. Med. Genet. 57, 294–297. Tyynela, J., Suopanki, J., Baumann, M., and Haltia, M. (1997a). Sphingolipid activator proteins (SAPs) in neuronal ceroid-lipofuscinosis (NCL). Pediatrics 28, 49–52. Tyynela, J., Suopanki, J., Santavuori, P., Baumann, M., and Haltia, M. (1997b). Variant late infantile ceroid-lipofuscinosis: pathology and biochemistry. J. Neuropathol. Exp. Neurol. 56, 369–375. Vance, J. E., Stone, S. J., and Faust, J. R. (1997). Abnormailities in mitochondria-associated membranes and phospholipid biosynthetic enzymes in the mnd/mnd mouse model of neuronal ceroid lipofuscinosis. Biochim. Biophys. Acta 1344, 286–299. Vesa, J., Hellsten, E., Verkruyse, L. A., Camp, L. A., Rapola, J., Santavuori, P., Hofmann, S. L., and Peltonen, L. (1995). Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Weissenbock, H., and Rossel, C. (1997). Neuronal ceroid-lipofuscinosis in a domestic cat: Clinical, morphological and immunohistochemical ﬁndings. J. Comp. Pathol. 117, 17–24. Willecke, K., Temme, A., Teubner, B., and Ott, T. (1999). Characterization of targeted connexin32deﬁcient mice: A model for the human Charcot-Marie-Tooth (X-type) inherited disease. Ann. N.Y. Acad. Sci. 883, 302–309. Wisniewski, K. E., Rapin, I., and Heaney-Kieras, J. (1988). Clinico-pathological variability in the childhood neuronal ceroid-lipofuscinoses and new observations on glycoprotein abnormalities. Am. J. Med. Genet. Suppl. 5, 27–46. Wisniewski, K. E., Golabek, A. A., and Kida, E. (1995). Increased urine concentration of subunit c of mitochondrial ATP synthase in neuronal ceroid lipofuscinosis patients. J. Inherit. Metabol. Dis. 17, 205–210. Wong, F. S., Dittel, B. N., and Janeway, C. A. J. (1999). Transgenes and knockout mutations in animal models of type 1 diabetes and multiple sclerosis. Immunol. Rev. 169, 93–104.

This Page Intentionally Left Blank

11

Experimental Models of NCL: The Yeast Model David A. Pearce∗ Center for Aging and Developmental Biology Department of Biochemistry and Biophysics University of Rochester School of Medicine and Dentistry Rochester, New York 14642

I. II. III. IV. V.

Introduction Yeast as a Model for JNCL What Does Btn1p Do? Yeast as a Therapeutic Model for JNCL A Yeast Model for INCL References

I. INTRODUCTION Genes encoding predicted proteins with high sequence similarity to CLN3 have been identiﬁed in mouse, dog, rabbit, nematode, and the yeast Saccharomyces cerevisiae (Lee et al., 1996; Shibuya et al., 1997; Katz et al., 1997; Wilson et al., 1994; Pohl and Aljinovic, 1995). The yeast Saccharomyces cerevisiae is often described as a model eukaryotic organism, due to the many fundamental similarities shared between itself and the cells, albeit differentiated, of higher eukaryotes such as humans. Studying the function of a particular protein in the unicellular yeast provides a very powerful tool for understanding a protein’s function. The entire genome of S. cerevisiae has * Address

for correspondence: E-mail david [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

205

206

D. A. Pearce

been sequenced, and is predicted to encode around 6100 genes, many of whose homologs have been associated to inherited genetic disorders.

II. YEAST AS A MODEL FOR JNCL Although CLN1, CLN2, CLN3, CLN5, and CLN8 have been identiﬁed, only CLN3 has a homolog in the yeast S. cerevisiae. We previously reported that the corresponding yeast gene, denoted BTN1, encodes a nonessential protein that is 39% identical and 59% similar to human CLN3 (Pearce and Sherman, 1997); see Figure 11.1. Essentially, by computer analysis human CLN3 and yeast BTN1 encode the same protein when we factor in the evolutionary divergences that have clearly occurred from yeast to human. To study the function of Btn1p in yeast and therefore to apply our ﬁndings to what CLN3 might be doing in the cell, we deleted the BTN1 gene from yeast, btn1-. This provides us with a situation where we have a single-celled organism that is normal, and one that is identical for its whole genome except that we have deleted one speciﬁc gene, BTN1. We then refer to this as our “Battens disease yeast,” as it is normal except that it is lacking the yeast equivalent to CLN3, which is associated to Batten disease. Having created our “Batten disease yeast,” we focused our research on deducing whether this protein is involved in mitochondrial function. Our reasoning behind this was simply because at the time many researchers believed that, due to the accumulation of mitochondrial ATP-synthase subunit c in juvenile neuronal ceroid lypofuscinose (JNCL) that CLN3 must be mitochondrial. In summary, we found that btn1- strains had no mitochondrial defects. In particular, oxidative phosphorylation or the ability to derive energy in the mitochondria was not affected. Furthermore, we demonstrated that btn1- strains had no apparent differences in the degradation of proteins within the mitochondria, and most tellingly, degradation of mitochondrial ATP-synthase subunit c was unaffected (Pearce and Sherman, 1997). We therefore considered that it was unlikely that Btn1p, and consequently CLN3, were indeed mitochondrial proteins. In addition, it is worth noting that btn1- strains do not show evidence of accumulation of an autoﬂuorscent pigment. The value of yeast as a tool for understanding the function of a protein relies heavily on the ease of which we can delete speciﬁc genes from the yeast and then assess the effect that the absence of this gene might have. As described above, we ﬁrst used our btn1- strains to look at a speciﬁc biochemical attribute, namely, degradation of mitochondrial ATP-synthase subunit c, as this had been implicated in the disease process of Batten disease. Having eliminated any connection between the function of Btn1p with what was essentially the only clue as to what was the function of Btn1p, and therefore CLN3, we needed to uncover an effect that btn1- had on the yeast. In other words, we

11. Experimental Models of NCL: The Yeast Model

207

Figure 11.1. Btn1p is homologous to human CLN3. Protein alignment of yeast Btn1p and human CLN3 show that the two proteins show 39% identity and 59% similarity. The protein sequence of Btn1p and human CLN3 is presented followed by a consensus sequence that was generated using MultiAlin (Corpet, 1998). Identical residues are shaded black and similar residues gray. In the consensus sequence, ! represents I or L; $ represents L or M; % represents F or Y; + represents K, R, or Q; # represents B, D, N, Q, or Z; and “represents E, Z, or Q.

208

D. A. Pearce

needed to uncover a phenotype. We therefore went about comparing the growth of normal and btn1- strains on a variety on media. For example, both strains were grown at elevated temperatures, in the presence of heavy metals or drugs, and growth compared. One such experiment revealed that btn1-, but not normal strains, could grow in the presence of the drug, D-(−)-threo-2-amino-1[p-nitrophenyl]-1,3-propanediol (denoted ANP), which is derived from chloramphenicol (Pearce and Sherman, 1998). We went on to show that resistance to this drug was dependent on the pH of the growth media. If the pH of media containing ANP was decreased to below pH 6.5, normal yeast gained the ability to grow, whereas if the pH was at pH 6.8 or above, btn1-, but not normal strains, could grow. This difference in essence is a fundamental difference between normal and btn1- yeast strains, our phenotype. To conﬁrm the speciﬁcity of this phenotype to the “Batten disease yeast,” we introduced a plasmid borne copy of BTN1 into btn1-, and conﬁrmed that the expression of BTN1 restored an inability to grow in the presence of ANP at elevated pH. This speciﬁcally demonstrated that our phenotype was due to the presence or absence of BTN1. Furthermore, and most signiﬁcantly, we expressed plasmid-borne human CLN3 in btn1- and demonstrated that expression of human CLN3 also restored an inability for btn1- to grow in the presence of ANP. This indicates that human CLN3 can substitute the function of Btn1p in btn1-. The fact that CLN3 functions to complement btn1- is strong evidence that CLN3 and Btn1p share the same function within a cell. Having uncovered a phenotype for btn1- strains, we used two approaches in which we manipulated the sequence of Btn1p to gain further insight into the function of the protein. First we introduced point mutations into BTN1 that corresponded to point mutations in CLN3 that were associated to Batten disease. Second, we fused a ﬂuorescent protein called the green ﬂuorescent protein (GFP) to the amino and carboxyl termini of Btn1p. The vast majority of individuals with Batten disease have the major 1.02-kb deletion in CLN3, which results in a predicted translation product of the ﬁrst 153 amino acids rather than the full-length 438 amino acids (International Batten Disease Consortium, 1995). Our studies mentioned above concentrated on a similar situation in yeast whereby we had deleted the entire BTN1 gene. To further the “Battens disease yeast” as a model for studying the disease, we looked at the sequence data on the various point mutations identiﬁed in CLN3 that were also associated to the disease as well as the 1.02-kb deletion (International Batten Disease Consortium, 1995). Six missense mutations in CLN3 were reported. The point mutations in CLN3 were leucine → proline at position 101; leucine → proline at position 170; glutamic acid → lysine at position 295; valine → phenylalanine at position 330; arginine → cysteine at position 334; arginine → histidine at position 334. Interestingly, the L101P, L170P, and E295K

11. Experimental Models of NCL: The Yeast Model

209

mutations were judged to present a nonclassical or less severe form of Batten disease, whereas V330F, R334C, and R334H present the classical or severe form of Batten disease. Each of these residues are conserved in the yeast Btn1p, suggesting that they may be important for the correct function of the CLN3 protein. The fact that mutation in these residues leads to Batten disease also suggests that each of these residues is important to the normal functioning of CLN3. We therefore altered the yeast DNA sequence of BTN1 by in vitro mutagenesis such that these mutations now occurred in Btn1p. By expressing each of these mutated forms of Btn1p in a btn1- strain, we assayed our phenotype, growth on ANP. Simply put, we measured the ability of the mutant Btn1p to restore the yeast back to the state at which it would be if it contained a normal functional Btn1p. This revealed that the equivalent mutations to L170P and E295K gave virtually no growth on ANP, much like the normal protein, suggesting that Btn1p, and most likely CLN3, with these mutations was almost completely functional. This correlated with the fact that individuals with the L170P and E295K mutations had a less severe course of Batten disease, which in turn suggests that the mutant CLN3 is not completely inactive in its function. Furthermore, the equivalent to the V330F, R334C, and R334H mutations in Btn1p grew well on the ANP, almost like the complete deletion, btn1-, suggesting almost complete inactivation of the protein’s activity. This again correlated to the disease, as these mutations cause classical or severe Batten disease, which would be expected to be due to inactive CLN3. Overall, we concluded from this that the ANP phenotype can be used as a measure of the functionality of Btn1p and therefore CLN3, which thus far correlates directly to what is known about the severity of the disease. We have recently completed a similar study in which we expressed CLN3 containing the point mutations associated to Batten disease in a btn1- strain and conﬁrmed our ANP phenotype to Batten disease severity model using the human protein (Haskell et al., 2000) The second manipulation of the Btn1p protein sequence simply placed the GFP at the amino and carboxyl termini of the protein. The rationale for doing this was simple. With the presence of the ﬂuorescent tag on the protein, we could visualize the location of this tagged Btn1p under the microscope. Most important, by assessing the growth of a btn1- strain expressing these Btn1pGFP fusions on ANP, we would know if the protein was functional or not. If the Btn1p-GFP fusion is functional, we can assume that the protein is localized to the correct compartment. As it turns out, if the GFP is fused to the carboxy terminus of Btn1p, the protein is indeed functional (Pearce et al., 1999), and localizes to the vacuolar compartment of yeast (Croopnick et al., 1999; Pearce et al., 1999). We can conclude from this that Btn1p is in fact a vacuolar protein, and that CLN3 would localize to the analogous compartment in human cells, the lysosome. Studies of CLN3 have indeed conﬁrmed localization to the lysosome (Jarvela et al., 1998, 1999; Haskell et al., 2000).

210

D. A. Pearce

III. WHAT DOES Btn1p DO? The most exciting step in understanding what Btn1p might function as in the yeast cell has been our uncovering the reason why btn1- strains are resistant to ANP. Having established that btn1-, but not normal strains, are resistance to ANP, we went on to show that resistance to this drug is dependent on the pH of the growth medium. If the pH of media containing ANP was decreased to below pH 6.5, normal yeast gained the ability to grow, whereas if the pH was at pH 6.8 or above, btn1-, but not normal strains, could grow (Pearce and Sherman, 1998). This suggested to us that perhaps btn1- strains had an inherent ability to decrease the pH of the growth media. It has long been known that as yeast grow, they acidify, or decrease the pH of, the medium. We therefore investigated whether btn1- strains have an increased ability to acidify growth media compared to normal. This was performed by simply taking samples of yeast throughout the growth course, resuspending the cells in fresh media, and over time monitoring the pH of this medium using a pH electrode to measure the rate at which the yeast strains acidiﬁed the medium. This did in fact demonstrate that btn1- strains have an elevated rate of acidiﬁcation of the medium compared to normal. Curiously, this elevated rate of acidiﬁcation was demonstrated only in the early phases of growth, and was apparently normalized later in growth. This elevated rate of medium acidiﬁcation explained quite clearly that the reason that btn1- strains are resistant to ANP is that they decrease the pH of the medium containing ANP to the point where ANP is no longer toxic to the cells. The next phase of our research focused on why btn1- strains have this elevated rate of acidiﬁcation. The yeast plasma membrane H+-ATPase drives uptake of nutrients into the cell in exchange for protons. It is this activity that results in the growth medium becoming acidic as the yeast grows. We therefore surmised that the activity of the plasma membrane H+-ATPase may be elevated in btn1- strains. To investigate this possibility we isolated the plasma membranes from normal and btn1- strains throughout the growth curve and assayed the activity of the plasma membrane H+-ATPase. This demonstrated that in the early phase of growth btn1- strains do have an elevated activity of plasma membrane H+-ATPase, which correlates directly to our observations on an elevated rate of acidiﬁcation. Later in growth, activity of plasma membrane H+-ATPase is apparently normalized, as is the rate of acidiﬁcation. We therefore concluded that resistance to ANP through an elevated rate of medium acidiﬁcation in btn1- is attributable directly to the elevated activity of plasma membrane H+-ATPase (Pearce et al., 1999). The next question was why a vacuolar protein such as Btn1p, when deleted, exerts this alteration in the activity of the plasma membrane H+-ATPase. It has been widely assumed that the plasma membrane H+-ATPase must have a general role in the maintenance of intracellular pH homeostasis simply

11. Experimental Models of NCL: The Yeast Model

211

because of its ability to pump protons into the surrounding medium. The vacuole has also been implicated in the maintenance of pH homeostasis by virtue of the fact that it is the major acidic compartment within the cell. With btn1- strains having an elevation of proton pumping out of the cell through the plasma membrane H+-ATPase, it seemed likely that there may be a perturbation in intracellular pH. Using ﬂuorescent dyes that have been speciﬁcally characterized to localize to the cytoplasm and vacuole, respectively, and that emit a varying ﬂuorescent signal depending on the pH in this location, we measured cytoplasmic and vacuolar pH in btn1- and normal strains. The cytoplasmic-associated dye, ﬂuorescein, carboxyseminaphthorhodaﬂuor-1 (C.SNARF-1), revealed that there was no signiﬁcant difference in cytoplasmic pH of btn1- and normal strains. Both btn1- and normal strains had a cytoplasmic pH of 6.8. However, the vacuole-associated dye, 6-carboxyﬂuorescein diacetate (6-CFDA), revealed that there was a difference in vacuolar pH between btn1- and normal strains (Pearce et al., 1999). Speciﬁcally, in the early phase of growth, btn1- had a more acidic vacuolar pH of 5.8 as compared to 6.2 for normal strains. Again, as with the rate of acidiﬁcation and the activity of plasma membrane H+-ATPase, this difference in vacuolar pH became normalized during growth. Vacuolar pH of btn1- strains in early growth was 5.8, whereas later in growth vacuolar pH was 6.2. The vacuolar pH of normal strains was consistently 6.2 throughout all phases of growth. It therefore seemed that a decreased vacuolar pH in btn1- results in an imbalance in pH homeostasis such that activity, and therefore proton pumping of the plasma membrane H+-ATPase, is increased. That the elevated rate of acidiﬁcation, increased activity of plasma membrane H+-ATPase, and decreased vacuolar pH all returned to normal during growth indicated that btn1- strains recognize and correct these abnormalities. To address this, we asked whether there is a fundamental difference between btn1- and normal strains by examining and comparing the expression of all yeast genes in btn1- and normal strains using a DNA microarray (DeRisi et al., 1997). This revealed that only two yeast genes had signiﬁcantly different expression between btn1- and normal strains. There was no apparent increased gene expression in normal strains compared to btn1-, but, btn1- had elevated expression of two genes, HSP30 and BTN2. HSP30 encodes a small heat-shock protein that localizes to the plasma membrane. Furthermore, Hsp30p has been shown to be a stress-induced downregulator of the plasma membrane H+-ATPase (Piper et al., 1997). This was of immediate interest, as we have shown that btn1- has an elevated activity of plasma membrane H+-ATPase that is returned to normal during growth. Increased expression of HSP30 would therefore decrease the activity of plasma membrane H+-ATPase. We assessed the expression of HSP30 throughout growth of btn1- and normal strains and found that, during growth, expression of HSP30 is increased in btn1- at about the point at which plasma membrane H+-ATPase

212

D. A. Pearce

activity is returned to normal. Interestingly, the level of HSP30 expression in btn1- is maintained at about two times the level of that in normal strains, presumably to continue keeping the plasma membrane H+-ATPase activity in check. BTN2 encodes a previously uncharacterized protein of 410 amino acids. Analysis of the expression of BTN2 throughout the growth curve revealed that its expression was increased at the same time that HSP30 expression was increased, but as growth continued, BTN2 expression was six- to sevenfold higher in btn1- than in normal strains. This suggests that Btn2p is the major component of correcting for the absence of Btn1p. So what is Btn2p and what does it do? These are questions that we are working on now. A major clue as to the function of Btn2p is that it shares signiﬁcant homology with the human protein HOOK1. Over a span of 102 amino acids Btn2p is 38% similar to HOOK1, which indicates that while these two proteins are not true homologs, they are most likely related in some way. The corresponding HOOK1 protein from Drosophila is a novel protein involved in the endocytosis of transmembrane ligands (Kramer and Phistry, 1996, 1999). Drosophila HOOK1 apparently acts as a negative regulator of the fusion of mature multivesicular bodies (MVBs) to the late endosome and lysosome (Sunio et al., 1999). If Btn2p is also involved in a novel endocytic pathway in yeast, an increased expression of BTN2 in btn1- may compensate the absence of Btn1p. Hypothetically, an increase in Btn2p might decrease fusion of a particular type of vesicle to the yeast vacuole. As these vesicles are most likely acidic, this might contribute indirectly to the slight elevation in the vacuolar pH from 5.8 to 6.2. Clearly, we need to establish exactly what Btn2p does in the yeast model. BTN2 expression continues to increase through growth of btn1-, it would suggest that it might be the primary method of compensating for an absence of Btn1p. An overview of what is occurring in btn1- compared to normal strains is presented as a cartoon in Figure 11.2. So what does Btn1p do? Obviously, there is much work still to be done. Our ﬁndings have shown that Btn1p is a vacuolar protein, and that yeast lacking the protein have a defective vacuolar pH, or at least a defective regulation of vacuolar pH. Our most recent studies have conﬁrmed that btn1- strains, and strains bearing deletions of either HSP30 (hsp30-) or BTN2(btn2-), the genes upregulated in btn1-, result in a similar phenotype, notably sensitivity for growth in the presence of the weak organic acid, sorbic acid, at low pH (Pearce and Sherman, submitted). This new phenotype ties together the function of Btn1p, Btn2p, and Hsp30p as all being involved in maintaining pH homeostasis. In particular, the nature of sorbic acid suggests that btn1-, and also btn2- and hsp30- strains, have a defect in the ability to grow when presented with a weak acid environmental insult. This strengthens the thought that the absence of Btn1p in yeast and perhaps CLN3 in humans results in a inability to maintain controlled pH homeostasis, particularly at the lysosome.

11. Experimental Models of NCL: The Yeast Model

213

Figure 11.2. pH homeostasis is disturbed in early growth of btn1- strains. A schematic representation showing that as normal and btn1- strains grow, there is an imbalance of pH within the vacuolar (lysosomal) compartment of btn1- strains in the early phase of growth. The btn1- strains use the plasma membrane H+-ATPase to pump more protons into the surrounding medium. As the yeast grow, normal strains maintain a balanced pH environment, while btn1- strains using altered gene expression balance the disparity in proton pumping that causes an imbalance in the intracellular pH.

IV. YEAST AS A THERAPEUTIC MODEL FOR JNCL Having established that an underlying defect in btn1- strains is a decreased vacuolar pH early in growth and that yeast use coordinate gene expression to correct this, we addressed the possibility of correcting vacuolar pH with a drug.

214

D. A. Pearce

Essentially, we wanted to see if we could reverse the effects of lacking Btn1p by treating btn1- with chloroquine. Chloroquine, a lysosomotropic agent, is widely used as an antimalarial agent, due to its toxicity to Plasmodium falciparum trophozoites (Slater, 1993). Chloroquine accumulates in the acidic food vacuole, causing an increase in pH that is believed to inhibit the mobilization of food reserves during this stage of the parasites development (Goldberg et al., 1990). It is this ability of chloroquine to raise the pH of the acidic vacuolar compartment that prompted us to investigate whether the pH of the vacuole in btn1- yeast strains could be raised. We found that growing btn1- strains in the presence of chloroquine results in the loss of resistance to ANP. During early growth of btn1- strains in the presence of chloroquine, plasma membrane H+-ATPase activity is decreased and vacuolar pH is increased, changes that result in btn1- resembling normal strains. In essence, we have reversed the biochemical effect of lacking Btn1p. However, as growth continues, plasma membrane H+-ATPase becomes abnormally low and vacuolar pH becomes abnormally high in both btn1- and normal strains. This essentially can be viewed as a secondary effect, and even other cellular changes may also occur from an abnormally low activity of plasma membrane H+-ATPase and an abnormally high vacuolar pH. Furthermore, although we have shown that chloroquine does reverse to a degree the increased expression of HSP30 and BTN2 in btn1-, the levels of expression are not returned fully to the levels seen in normal strains. In addition, normal strains are again affected by chloroquine, with HSP30 expression considerably decreased. No doubt chloroquine affects more than just the BTN1-mediated pH homeostasis in yeast, and it would be interesting to examine the effect of chloroquine on the expression of all yeast genes. It obviously needs to be established whether or not any of the defects found in btn1- strains are truly associated with individuals having Batten disease. Nevertheless, the yeast model is currently a valuable but as yet unproven model to gather information on the pathogenesis of Batten disease.

V. A YEAST MODEL FOR INCL The previously described “Batten disease yeast model” came about due to the fact that the whole genome of S. cerevisiae was sequenced revealing that this yeast had a protein homologous to CLN3. Recently a second yeast, Schizosaccharomyces pombe, has had its entire genome sequenced. This revealed that S. pombe also contains a homolog to human CLN3. In addition S. pombe contains a protein that is 32% identical and 47% similar to human CLN1 (Figure 11.3), a protein thiolesterase that is associated to infantile NCL (Vesa et al., 1995). The presence of a CLN1 homolog in S. pombe presents the opportunity to study this protein in this organism.

11. Experimental Models of NCL: The Yeast Model

215

Figure 11.3. Protein alignment of Schizosacchomyces pombe CLN1 with human CLN1, demonstrating that the two proteins are 32% identical and 47% similar. The protein sequence of S. pombe CLN1 and human CLN1 is presented followed by a consensus sequence that was generated using MultiAlin (Corpet, 1998). Identical residues are shaded black and similar residues gray. In the consensus sequence, ! represents I or L; $ represents L or M; % represents F or Y; + represents K, R, or Q; # represents B, D, N, Q ,or Z; and “represents E, Z, or Q.

Acknowledgments I am indebted to Fred Sherman for his support, advice, and for preparing Figure 11.2. The research described herein was supported by National Institutes of Health grant R01 NS36610 and by the JNCL Research Fund.

References Corpet, F. (1998). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16, 10881–10890

216

D. A. Pearce

Croopnick, J. B., Choi, H. C., and Mueller, D. M. (1998). The subcellular location of the yeast Saccharomyces cerevisiae homologue of the protein defective in juvenile form of Batten disease. Biochem. Biophys. Res. Commun. 250, 335–341. DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997). Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278, 680–686. Goldberg, D. E., Slater, A. F. G., Cerami, A., and Henderson, G. B. (1990). Hemoglobin degradation in the human malaria pathogen Plasmodium falciparum: A catabolic pathway initiated by a speciﬁc aspartic protease. Proc. Natl. Acad. Sci. (USA) 87, 2931–293. Haskell, R. E., Carr, C. J., Pearce, D. A., Bennett, M. J., and Davidson, B. L. (2000). Batten disease: Evaluation of CLN3 mutations on protein localization and function. Hum. Mol. Genet., in press. International Batten Disease Consortium (1995). Isolation of a novel gene underlying Batten disease. Cell 82, 949–957. Jarvela, I., Sainio, M., Rantamaki, T., Olkkonen, V. M., Carpen, O., Peltonen, L., and Jalanko, A. (1998). Biosynthesis and intracellular targeting of the CLN3 protein defective in Batten disease. Hum. Mol.Genet. 7, 85–90. Jarvela, I., Lehtovirta, M., Tikknen, R., Kyttala, A., and Jalenko, A. (1999). Defective intracellular transport of CLN3 is the molecular basis of Batten disease (JNCL). Hum.Mol.Genet. 8, 1091–1098. Katz, M. L., et al. (1997). Genbank direct submission, accession U92812. Kramer, H., and Phistry, M. (1996). Mutations in the Drosophila hook gene inhibit endocytosis of the boss transmembrane ligand into multivesicular bodies. J. Cell Biol. 133, 1205. Kramer, H., and Phistry, M. (1999). Genetic analysis of hook, a gene required for endocytic trafﬁcking in Drosophila. Genetics 151, 675–684. Lee, R. L., Johnson, K. R., and Lerner, T. J. (1996). Isolation and chromosomal mapping of a mouse homolog of the Batten disease gene CLN3. Genomics 35, 617–619. Pearce, D. A., and Sherman, F. (1997). BTN1, a yeast gene corresponding to the human gene responsible for Batten’s disease, is not essential for viability, mitochondrial function, or degradation of mitochondrial ATP synthase. Yeast 13, 691–697. Pearce, D. A., and Sherman, F. (1998). A yeast model for the study of Batten disease. Proc. Natl. Acad. Sci. (USA) 95, 6915–6918. Pearce, D. A., Ferea, T., Nosel, S. A., Das, B., and Sherman, F. (1999). Action of Btn1p, the yeast orthologue of the gene mutated in Batten disease. Nat. Genet. 22, 55–58. Piper, P. W., Ortiz-Calderon, C., Holyoak, C., Coote, P., and Cole, M. (1997). Hsp30, the integral plasma membrane heat shock protein of Saccharomyces cerevisiae, is a stress-inducible regulator of plasma membrane H+-ATPase. Cell Stress Chaper. 2, 12–24. Pohl, T. M., and Aljinovic, G. (1995). Genbank direct submission, accession Z49335. Shibuya, H., et al. (1997). Swiss-Prot direct submission, accession O29611. Slater, A. F. G. (1993). Chloroquine: Mechanism of drug action and resistance in Plasmodium falciparum. Pharmacol. Ther. 57, 203–235. Sunio, A., Metcalf, A. B., and Kramer, H. (1999). Genetic dissection of endocytic trafﬁcking in Drosophila using a horseradish peroxidase-bride of sevenless chimera: hook is required for normal maturation of multivesicular endosomes. Mol. Biol. Cell 10, 847–859. Vesa, J., et al. (1995). Mutations in the palmitoyl protein thiolesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature 376, 584–587. Wilson, R., et al. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368, 32–38.

12

Outlook for Future Treatment Nanbert Zhong∗ Department of Human Genetics New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314 and Department of Neurology SUNY Health Science Center at Brooklyn Brooklyn, New York 11203

Krystyna E. Wisniewski Department of Pathological Neurobiology New York State Institute for Basic Research in Developmental Disabilities Staten Island, New York 10314 and Department of Neurology SUNY Health Science Center at Brooklyn Brooklyn, New York 11203

I. Molecular Cloning for CLN4 , CLN6 , and CLN7 II. Characterization of Native Substrates for CLN-Encoded Lysosomal Enzymes III. Proteomic Studies of CLN-Encoded Proteins IV. Uncovering the Pathogenesis of the NCLs V. Potential Drugs in Experimental Models May Eventually Lead to Clinical Trials in NCL-Affected Patients VI. Gene Therapy References * Address

for correspondence: E-mail: [email protected]

Advances in Genetics, Vol. 45 C 2001 by Academic Press. Copyright All rights of reproduction in any form reserved. 0065-2660/01 $35.00

217

218

N. Zhong and K. E. Wisniewski

ABSTRACT Currently, no treatment is available for neuronal ceroid lipofuscinoses. The progress of human genome project will stimulate molecular cloning of unidentiﬁed genes underlying the NCLs, which will lead eventually clinical management and therapies for NCL. Characterizing the native substrate(s) for the palmitoyl-protein thioesterase-1 (PPT1) and tripeptidyl peptidase 1 (TPP1), understanding the protein functions encoded by CLN genes, and uncovering the pathological metabolic mechanism for the NCLs are the bases of designing rational treatments for the NCLs. Testing potential therapeutic agents, replacing deﬁcient enzymes, and developing gene therapy will be the major tasks for NCL researchers.

I. MOLECULAR CLONING FOR CLN4 , CLN6 , AND CLN7 Progress has been made in molecular cloning of CLN4, CLN6, and CLN7. Use of an approach similar to the one for cloning CLN2 to study adult-onset neuronal ceroid lipofuscinose (ANCL), the recessively inherited adult form of NCL, underlied by CLN4, suggested that CLN4 may also encode a lysosomal glycoprotein (Sleat et al., 1998). Locus of CLN6 has been narrowed recently to 4cM at 15q21-23 by linkage studies (Sharp et al., 1999). Accomplishing molecular cloning of these unidentiﬁed genes will be the necessity for designing treatment.

II. CHARACTERIZATION OF NATIVE SUBSTRATES FOR CLN-ENCODED LYSOSOMAL ENZYMES The future of treatment for NCLs such as infantile NCL (INCL) and late-infantile NCL (LINCL) caused by lysosomal enzymatic deﬁciency may lie in enzyme replacement therapy. Before such therapy can be developed, (1) the native substrate(s) for the enzyme, (2) the process of enzyme turnover, and (3) the regulation of enzyme expression must be understood. In addition, the in vitro expressed and puriﬁed lysosomal enzymes must be able to maintain their biological activity for such therapy to be viable. Two lysosomal enzymes, the palmitoyl-protein thioesterase-1 (PPT1) and tripeptidyl peptidase 1 (TPP1), are known to be involved in INCL and LINCL, respectively. Identiﬁcation and characterization of their native substrates may lead to better understanding of the pathophysiology of INCL and LINCL; it is clear

12. Outlook for Future Treatment

219

that different pathogenic mechanisms are involved because the storage material within the lipofuscins (SAPs vs subunit c) is different.

III. PROTEOMIC STUDIES OF CLN-ENCODED PROTEINS The three proteins encoded by CLN3, CLN5, and CLN8 are membranous, but the function of these proteins is unknown. Although the CLN3 gene has been cloned for 5 years, efforts of generating antibodies for Battenin in the past years were not quite successful. The major difﬁculty was that Battenin is a highly hydrophobic protein with six (Janes et al., 1996) or eight (Zhong et al., unpublished data) transmembrane domains. Similar difﬁculties have been noticed for CLN8encoded protein (Kaczmarksi et al., unpublished data). Continuing to generate highly sensitive and speciﬁc antibodies for CLN-encoded proteins will lead to better understanding of protein localization, the process of turnover, and protein– protein interactions for which we (Zhong et al., 2000a) have proposed that these proteins, along with other unidentiﬁed proteins, may compose a novel membranous transporting complex. Two such unidentiﬁed proteins, BIPf and BIPs (fast and slow Battenin-interactive protein), have been characterized recently as interacting with the CLN3-encoded proteins Battenin and Battenim (Zhong et al., 1999). Further exploration of this complex may lead to new insights into the functions of CLN-encoded proteins.

IV. UNCOVERING THE PATHOGENESIS OF THE NCLs The NCLs are a group of neurodegenerative disorders sharing common features and phenotypes. Accumulation of mitochondrial subunit c of ATP synthase has been recognized in all NCLs except INCL. This pathological change is a hallmark of the NCLs, but the mechanism whereby similar pathological changes are caused by different genetic deﬁciencies has been a puzzle to researchers studying NCLs. Recently, the accumulation of subunit c in JNCL has been demonstrated to result from “gain of function” of Battenim, the mutant form of Battenin that derives from 1.02-kb deletion in the CLN3 gene, through the increased capability of interaction between Battenim and BIPf (fast Battenininteractive protein), which also interacts with subunit c (Zhong et al., 2000b). This ﬁnding may uncover the mechanism of the accumulation of mitochondrial ATPase subunit c in JNCL and lead to a new theory of a “secondary defect” involved in the pathogenesis of the NCLs (Zhong et al., 2000b). Whether proteins encoded by CLN5 and CLN8 are also interacting with Battenin or BIP and participating in this secondary mechanism is an interesting question.

220

N. Zhong and K. E. Wisniewski

This new theory may open a new avenue to pursue for design of a rational therapy.

V. POTENTIAL DRUGS IN EXPERIMENTAL MODELS MAY EVENTUALLY LEAD TO CLINICAL TRIALS IN NCL-AFFECTED PATIENTS The symptomatic, rather than causal, treatment of giving antioxidants to NCL patients to improve IQ level and to reduce neurological signs and epilepsy was initiated in the 1970s on the basis of the hypothesis that lipofuscins stored in NCLs are due to lipid peroxidation (Santavuori and Moren, 1977; Westermarck and Santavuori, 1984). Recently, Lamotrigine (LTG) was given to INCL patients to control seizures (Aberg et al., 1997). The severity of seizures in 15/16 (94%) and the frequency of seizures in 14/16 (88%) of patients receiving the treatment were signiﬁcantly decreased, with no severe side effects. In a subsequent study, LTG was observed to have favorable effects in 23/28 (82%) patients affected with JNCL (Aberg et al., 1999). In light of this, LTG appears to be a valuable drug in treating NCL. Supplementation with antioxidant polyunsaturated fatty acid in six children affected with JNCL initially showed some potential beneﬁts in slowing clinical progression (Bennett et al., 1994), but the same approach when applied to mnd mice before and after birth does not alter the clinical and pathological course (Bennett et al., 1997). Experimental evidence obtained from human JNCL and LINCL cases suggested that lipofuscin accumulation is linked to altered carnitine biosynthesis. Dietary supplementation of carnitine in mnd mice, a model of human progressive epilepsy with mental retardation (Ranta et al., 1999), signiﬁcantly slows the lipofuscin accumulation in the brain neurons and prolongs life span (Katz et al., 1997). NCLs are progressive neurodegenerative disorders. Applying neurotrophic factors (NTFs) showed promising effects on both the NCL canine neuronal culture model and the mnd mouse model (Dunn et al., 1994; Cooper et al., 1999). This approach may restore “silent” neurons that are positive to response to certain NTFs such as IGF-1 (Cooper et al., 1999). However, it may not be able to control the progressive degeneration of neurons with genetic deﬁcit for CLN-encoded proteins. Whether those “silent” neurons eventually undergo degeneration is an open question. Bone marrow transplantation (BMT) has been applied in genetic disorders. However, it appears that BMT is not successful in the NCL disorders. This

12. Outlook for Future Treatment

221

was documented both in native NCL-affected animal models such as English setter dogs (Deeg et al., 1990) and lambs (Westlake et al., 1995), and in human LINCL and JNCL (Lake et al., 1995, 1997), in which BMT did not correct clinical and pathological progression. It was interesting that chloroquine can reverse phenotypes in btn-1 knockout yeast strain, although not much is known about this model for studying NCL pathogenesis (Pearce et al., 1999). Applying chloroquine into mammalian cells did not reproduce this reversible phenomenon (Golabek et al., personal communication). Whether this chemical can be used as a therapeutic agent in the human NCLs is an open question.

VI. GENE THERAPY The use of gene therapy in treating the NCL disorders poses a challenge because of the unknown pathogenic mechanism, although genes CLN1–3, CLN5, and CLN8 have been cloned. Both in vivo and ex vivo approaches might be applicable. Strategies of gene augmentation to correct “loss of function,” therapeutic RNA editing such as ribozymes to target speciﬁc transcripts (Phylactou et al., 1998), and allele-speciﬁc inhibition of “gain of function” should be our future goals. To approach this goal, NCL animal models, including both native and artiﬁcial knockouts, and transgenic technology will play important roles. In humans, the supplementary gene can be introduced into cells derived from patients (ex vivo approach) or injected into patient tissues (in vivo approach). For central nervous system disorders such as the NCLs, transgenic delivery of the external gene is not quite successful. Direct injection of recombinant virus carrying human erythropoirtin into skeletal muscle provided evidence that systemic gene delivery can be achieved practically (Kessler et al., 1996). Gene transfer by intravenous injection of ␤-glucuronidase (GUSB) can clear lysosomal storage in a murine model of mucopolysaccharidosis type VII (MPS VII) (Daly et al., 1999), which provided evidence that lysosomal storage disease is treatable. A major problem researchers faced previously in gene therapy is how to control the gene expression level and the distribution of introduced gene product. Recent progress in studying recombinant virus made it possible for the introduced gene product to be expressed at a high level, not only in neurons but also in astrocytes, under controlled gene copies (Davidson et al., 2000). Instead of the use of direct injection in the in vivo approach, the challenge of the ex vivo approach for gene therapy for neurological disorders in which the causative gene defect has been identiﬁed is to introduce replaced gene into either embryonic stem cells or bone marrow stromal cells. Both types of cells have the potential to be differentiated into neurons (Li et al., 1998; Pereira et al.,

222

N. Zhong and K. E. Wisniewski

1998). Injection of these cells introduced with vector carrying target gene will allow the potential cells to migrate along the neuron migration pathway and lose immunoactivity (Azizi et al., 1998). Because INCL and LINCL are caused by lysosomal enzyme deﬁciency, they should be the best models to start with for gene therapy. Recent progress with knockout mice models provides an advantage for this type of research. The human normal CLN1 or CLN2 gene can be engineered into vector to be introduced into the mouse model that does not have normal PPT1 or TPP1 enzyme expression. After the introduction of the CLN1 or CLN2 gene, analyses of PPT1 or TPP1 enzymatic activity may guide controlling of enzyme expression in vivo. JNCL, FNCL, and EPMR appear to be caused by membrane protein deﬁciency. The functions of Battenin (the protein encoded by CLN3, CLN5encoded protein, and CLN8-encoded protein are unknown, as is the pathogenesis. Whether replacing the mutant protein may reverse the brain damage is an open question. Our data on Battenin associated with other membranous proteins (Zhong et al., 1999) has led us to hypothesize a novel trans-membranous complex that consists of Battenin, BIPs, BIPf, and possibly proteins encoded by CLN5 and CLN8. In addition, ﬁnding “gain of function” for the Battenim may lead to a new approach for designing a rational therapy for JNCL. In this case, introducing Battenim-speciﬁc ribozymes or antisense approach to catalyze Battenim transcripts may be applied.

References Aberg, L., Heiskala, H., Vanhanen, S. L., Himberg, J. J., Hosking, G., Yuen, A., and Santavuori, P. (1997). Lamotrigine therapy in infantile ceroid lipofuscinosis (INCL). Neuropediatrics 28, 77–79. Aberg, L., Kirveskari, E., and Santavuori, P. (1999). Lamotrigine therapy in juvenile ceroid lipofuscinosis. Epilepsia 40, 796–799. Azizi, S. A., Stokes, D., Augelli, B. J., Digirolamo, C., and Prockop, D. J. (1998). Engraftment and migration of human bone marrow stromal cells implanted in the brains of albino rats-similarities to astrocyte grafts. Proc. Natl. Acad. Sci. (USA) 95, 3908–3913. Bennett, M. J., Gayton, A. R., Rittey, C. D., and Hosking, G. P. (1994). Juvenile neuronal ceroidlipofuscinosis: Developmental progress after supplementation with polyunsaturated fatty acids. Dev. Med. Child. Neurol. 36, 630–638. Bennett, M. J., Boriack, R. L., and Birch, D. G. (1997). In-utero and post-delivery supplementation of motor neuron degeneration mutant mice with polyunsaturated fatty acids does not alter the clinical or pathological course. Neuropediatrics 28, 82–84. Cooper, J. D., Messer, A., Feng, A. K., Chua-Couzens, J., and Mobley, W. C. (1999). Apparent loss and hypertrophy of interneurons in a mouse model of neuronal ceroid lipofuscinosis: Evidence for partial response to insulin-like growth factor-1 treatment. J. Neurosci. 19, 2556– 2567. Daly, T. M., Vogler, C., Levy, B., Haskins, M. E., and Sands, M. S. (1999). Neonatal gene transfer leads to widespread correction of pathology in a murine model of lysosomal storage disease. Proc. Natl. Acad. Sci. (USA) 96, 2296–2300.

12. Outlook for Future Treatment

223

Davidson, B. L., Stein, C. S., Heth, J. A., Martins, I., Kotin, R. M., Derksen, T. A., Zabner, J., Ghods, A., and Chiorini, J. A. (2000). Recombinant adeno-associated virus type 2, 4, and 5 vectors: Transduction of variant cell types and regions in the mammalian central nervous system. Proc. Natl. Acad. Sci. (USA) 97, 3428–3432. Deeg, H. J., Shulman, H. M., Albrechtsen, D., Graham, T. C., Storb, R., and Koppang, N. (1990). Batten’s disease: Failure of allogeneic bone marrow transplantation to arrest disease progression in a canine model. Clin. Genet. 37, 264–270. Dunn, W. A., Raizada, M. K., Vogt, E. S., and Brown, E. A. (1994). Growth factor-induced growth in primary neuronal cultures of dogs with neuronal ceroid lipofuscinosis. Int. J. Dev. Neurosci. 12, 185–196. Janes, R. W., Munroe, P. B., Mitchison, H. M., Gardiner, R. M., Mole, S. E., and Wallace, B. A. (1996). A model for Batten disease protein CLN3: Functional implications from homology and mutations. FEBS Lett. 399, 75–77. Katz, M. L., Rice, L. M., and Gao, C. L. (1997). Dietary carnitine supplements slow disease progression in a putative mouse model for hereditary ceroid-lipofuscinosis. J. Neurosci. Res. 50, 123–132. Kessler, P. D., Podsakoff, G. M., Chen, X., McQuiston, S. A., Colosis, P. C., Matelis, L. A., Kurtzman, G. J., and Byrne, B. J. (1996). Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Proc. Natl. Acad. Sci. (USA) 93, 14082–14087. Lake, B. D., Henderson, D. C., Oakhill, A., and Vellodi, A. (1995). Bone marrow transplantation in Batten disease. Am. J. Med. Genet. 57, 369–373. Lake, B. D., Steward, C. G., Oakhill, A., Wilson, J., and Perham, T. G. (1997). Bone marrow transplantation in late infantile Batten disease and juvenile Batten disease. Neuropediatrics 28, 80–81. Li, M., Pevny, L., Lovell-Badge, R., and Smith, A. (1998). Generation of puriﬁed neural precursors from embryonic stem cells by lineage selection. Curr. Biol. 8, 971–974. Pearce, D. A., Carr, C. J., Das, B., and Sherman, F. (1999). Phenotypic reversal of the defects in yeast by chloroquine: A model for Batten disease. Proc. Natl. Acad. Sci. (USA) 96, 11341–11345. Pereira, R. F., O’Hara, M. D., Laptev, A. V., Halford, K. W., Pollard, M. D., Class, R., Simon, D., Livezey, K., and Prockop, D. J. (1998). Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc. Natl. Acad. Sci. (USA) 95, 1142–1147. Phylactou, L. A., Kilpatrick, M. W., and Wood, M. J. A. (1998). Ribozymes as therapeutic tools for genetic disease. Hum. Mol. Genet. 7, 1649–1653. Ranta, S., Zhang, Y., Ross, B., Lonka, L., Takkunen, E., Messer, A. M., Sharp, J., Wheeler, R., Kusumi, K., Mole, S., Liu, W., Soares, M. B., de Fatima Bonaldo, M., Hirvasniemi, A., de la Chapelle, A., Gilliam, T. C., and Lehesjoki, A. (1999). The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 23, 233–2236. Santavuori, P., and Moren, R. (1977). Experience of antioxidant treatment in neuronal ceroidlipofuscinosis of spielmeyer-sjogren type. Neuropadiatrics 8, 333–344. Sharp, J. D., Wheeler, R. B., Lake, B. D., Fox, M., Gardiner, R. M., and Williams, R. E. (1999). Genetic and physical mapping of the CLN6 gene on chromosome 15q21-23. Mol. Genet. Metab. 66, 329–331. Sleat, D. E., Sohar, I., Pullarkat, P. S., Lobel, P., and Pullarkat, R. K. (1998). Speciﬁc alterations in levels of mannose 6-phosphoryled glycoproteins in different neuronal ceroid lipofuscinoses. Biochem. J. 334, 547–551. Westermarck, T., and Santavuori, P. (1984). Principle of antioxidant therapy in neuronal ceroid lipofuscinosis. Med. Biol. 62, 148–151. Westlake, V. J., Jolly, R. D., Jones, B. R., Mellor, D. J., Machon, R., Zanjani, E. D., and Krivit, W. Hematopoietic cell transplantation in fetal lambs with ceroid-lipofuscinosis. Am. J. Med. Genet. 57, 365–368. Zhong, N., Ju, W., Moroziewicz, D., Jurkiewez, A., Wisniewski, K., and Brown, W. T. (1999). Molecular

224

N. Zhong and K. E. Wisniewski

pathogenic studies of Batten disease: Identiﬁcation and characterization of Battenin-interactive proteins. J. Mol. Diag. 1, G23 (Abstr.). Zhong, N., Ju, W., Moroziewicz, D., Jurkewez, A., Wisniewski, K., and Brown, W. T. (2000a). CLNencoded proteins do not interact with each other. Neurogenetics 86, in press. Zhong, N., Ju, W., Moroziewicz, D., Jurkewez, A., Wisniewski, K., and Brown, W. T. (2000b). Proteins BIPs and BIPf interact with Battenin/Battenim and may play central roles in the pathegenesis of NCL. The 8th International Congress on Neuronal Ceroid Lipofuscinoses, Sept. 20–24, 2000, Oxford, UK (Abstr.).

0

Appendix: Batten Support Groups

UNITED STATES OF AMERICA Batten Disease Support and Research Association (BDSRA) (includes USA, Canada, Australia, and New Zealand) 2600 Parsons Avenue Columbus, OH 43207 Contact: Mr. Lance Johnston, Executive Director Phone: (800) 448-4570 and (740) 927-4298 E-mail: [email protected] Web: http://bdsra.org Children’s Brain Diseases Foundation 350 Parnassus Avenue, Suite 900 San Francisco, CA 94117 Contact: Dr. Alfred Rider Phone: (415) 566-5402 Fax: (415) 863-3452 Batten Disease Registry NYS Institute for Basic Research in Developmental Disabilities 1050 Forest Hill Road Staten Island, NY 10314 Contact: Prof. Krystyna E. Wisniewski Department of Pathological Neurobiology Phone: (718) 494-5202 Fax: (718) 982-6346 E-mail: [email protected] National Organization for Rare Disorders, Inc. (NORD) P.O. Box 8923 New Fairﬁeld, CT 06812-8923 Phone: (203) 746-6518, Toll free: (800) 999-6673 Fax: (203) 746-6481 E-mail: [email protected] or [email protected] Web: http://www.rarediseases.org/*

225

226

Appendix

State and regional chapters of BDSRA

Alabama 3560 Alabama Hwy 155 Jemison, AL 35085 Contact: Becky Lucas Phone: (205) 668-0812

Delaware Valley 25 Aberdeen Drive Sicklerville, NJ 08081 Contact: Gregg Froio Phone: (609) 435-0212

Metro New York/New Jersey 21 Glenda Drive Deerpark, NJ 11729 Contact: Eric Faret Phone: (631) 586-4315

Northern California 1721 Mt. Vernon Drive San Jose, CA 95125 Contact: Liz Aurelio Phone: (408) 448-2530 E-mail: [email protected] 3567 Mignon Street Sacramento, CA 95826 Contact: Nancy Peterson Phone: (916) 362-9783

Southern California 5065 Frink Ave. San Diego, CA 92117 Contact: Shannon Killebrew-Ross Phone: (619) 276-4441 E-mail: [email protected]

Batten Support Groups

Florida 1625 28 Avenue North St. Petersburg, FL 33713 Contact: Karen Upchurch Phone: (813) 894-4318 E-mail: [email protected]

Gulf Coast 23211 Tony Wallace Road Robertsdale, AL 36567 Contact: Michele Kingston Phone: (334) 947-6254

Louisiana 806 N. Ferrylake Court Slidell, LA 70461 Contact: Jim Little Phone: (504) 781-5260 E-mail: jamesﬂittle [email protected]

Michigan 16022 Blue Skies Livonia, MI 48154 Contact: Linda Houghby Phone: (734) 591-3062 E-mail: daveh@e mail.com

Mid-Atlantic (MD, DE, DC, NJ, WV, East. PA, and North VA) 13818 Greenﬁeld Ave. P.O. Box 283 Maugansville, MD 21767-0283 Contact: Vicky Lumm Phone: (301) 790-1417

227

228

Midwest (IL and WI) 13560 Mohawk Lane Orland Park, IL 60462 Contact: Barbara McDonough Phone: (708) 460-3054 E-mail: [email protected]

Minnesota 5376 Cottage Avenue White Bear Twp, MN 55110 Contact: Joni Metcalf Phone: (651) 429-3871 E-mail: joni [email protected]

Mississippi 7825 Frank Snell Road Pascagoula, MS 39581 Contact: Paula Stampley Phone: (228) 588-2067

New England (CT, RI, MA, VT, NH, ME) 11 Ammonoosuc St., Apt. 1A Woodsville, NH 03785 Contact: Ann Salladin Phone: (603) 747-4191

New York (upstate) 31 Huntington Parkway Hamlin, NY 14461 Contact: Kristin Coon Phone: (716) 964-8734

Appendix

Batten Support Groups

Ohio 3038 Ramona Ave. Cincinnati, OH 45211 Contact: Bob Wilhelm Phone: (513) 481-6149 E-mail: [email protected]

Paciﬁc Northwest (WA, OR, ID) 1401 15th Street Anna Cortes, WA 98221 Contact: Mark Vance Phone: (360) 299-3027 E-mail:[email protected]

Southeast (NC, SC, VA) 5359 Deep River Road Sanford, NC 27330 Contact: Curtis Lowther Phone: (919) 774-1933

Tennessee 520 Green Meadows Road Rockwood, TN 37854 Contact: Ethel Flanagan Phone: (615) 354-3619

Texas 1535 Jerry Maschek St. West Texas, TX 76691 Contact: Michele Neal Phone: (254) 826-4651 E-mail: bdsra@ﬂash.net

Web site for current information on each chapter www.bdsra.org

229

230

Appendix

CANADIAN CHAPTER 12 Bell Street Regina, Saskatchewan S4S 4B7 Contact: Bev Maxim Phone: (306) 789-9047 E-mail: [email protected]

Battens list on the Web (particularly concerned with caring for a child with Batten disease) 1556 Union Avenue, Box 189 Ruthven, Ontario NOP1GO, Canada Contact: Eadie Mastronardi Phone: (519) 322-2987 Fax: (519) 326-1417 E-mail: [email protected]

EUROPEAN SUPPORT GROUPS The Czech Republic The Prague NCL Group Institute for Inherited Metabolic Disorders 1st Faculty of Medicine and General University Hospital Unemocnice 5, CZ-12853 Prague 2, Czech Republic Contact: Milan Elleder, M.D., Ph.D. Phone: +420 2 295 202 Fax: +420 2 2491 6306 E-mail: [email protected]

Denmark Dansk Spielmeyer-Vogt Forening Korsevaenget 58 DK-4100 Ringsted, Denmark Chairman: Ole Tornvig-Christensen Phone and Fax: +45 57 61 10 15 E-mail: [email protected]

Batten Support Groups

Finland Finnish INCL-Association via Finnish Association on Mental Retardation Valokkiviita 5 FIN-60150 Sein¨ajoki, Finland Special worker: Pirjo Saari for INCL Phone: +358 6 4192701 Fax: +358 6 4192705 E-mail: pirjo.saari@famr.ﬁ Spielmeyer-Jansk´y Association Via Federation for the Visually Handicapped M¨akel¨ankatu 50 FIN-00510 Helsinki, Finland Special worker: Maria-Liisa Punkari for LINCL and JNCL Phone: +358 9 3960 4329 Fax: +358 9 3960 4200 Family Federation of Finland (for genetic counseling only) P.O. Box 849 FIN-00101 Helsinki, Finland Phone: +358 9 616 22246 Fax: +358 9 645 018

France Association Vaincre les Malades Lysosomales 9, place du 19 mars 1962—Parc Affaires 2000 F-91035 Evry CEDEX, France Phone: +33 1 60 91 75 00 Fax: +33 1 69 36 93 50 E-mail: [email protected] Web: http://www.provnet.fr/VML/fr/accueil.htm Laboratoire de G´en´etique (Professeur Livia Poenaru) Facult´e de M´ed´ecine Cochin Port-Royal 24, rue du Faubourg Saint Jacques F-75014 Paris, France Contact: Dr. Catherine Caillaud, M.D., Ph.D. Phone: +33 1 44 41 24 02 (direct), +33 1 42 34 15 74 (secretary) Fax: +33 1 44 41 24 46 E-mail: [email protected]

231

232

Appendix

Germany NCL Gruppe Deutschland e.V. Vierkaten 32b D-21269 Neu-W¨ulmsdorf, Germany Phone and Fax: +49 40 700 7521

Italy COMETA/A.S.M.M.E. Via Garibaldi 8, Legnaro I-Padova 35020, Italy Contact: Mrs. Marzenta, president of the group Dr. Alberto Burlina, medical support Phone and Fax: +39 049 9903303

The Netherlands De Nederlandse Vereniging Batten-Spielmeyer-Vogt (BSV) President: Mr. K. Kovacsevits De Ruijterstraat 11 NL-2851 Haastrecht, The Netherlands Phone: +31 1825 01967 Fax: +31 1825 22822 E-mail: [email protected] Secretary: Mrs. Anna Agricola De Rijlst 38 8521 NJ St Nicolaasga Friesland, Holland, Nederland Phone: +31 513 432344 E-mail: [email protected] Mw Drs. Irene Hofman (medical consultant) C/o Bartimeushage, Postbox 87 NL-3940 AB Doorn, The Netherlands Phone and Fax: +31 317 615191 or Bergweg 30, NL-3911 VB Rhenen The Netherlands Phone and Fax: +31 317 615191 E-mail: [email protected]

Batten Support Groups

233

Norway Norsk Spielmeyer—Vogt forening (NCL) P.O. Box 55 N-4262 Avaldsnes, Norway Chairman: Mr. Reidar Dombestein Phone and Fax: +47 88004474 E-mail: [email protected]

Sweden Parents association for Spielmeyer—Vogt is part of the Swedish association for the visually impaired (SRF Synskadades Riksf¨orbund) Sandsborgsv¨agen 52 S-122 88 Enskede, Sweden Contact: Eva Setreus Phone: +46 8 39 90 00 Fax: +46 8 39 93 22 Pedagogical, psychological and social support for JNCL families: Spielmeyer—Vogt support person (consultant) Contact: Hj¨ordis Gustavsson Ekeskolan, Box 9024 ¨ S-700 09 Orebro, Sweden Phone: +46 19-676 21 00 Fax: +46 19 676 22 00 Coordinator for medical support board: Contact: Paul Uvebrant ¨ Sahlgrenska University Hospital Ostra S-416 85 G¨oteborg, Sweden Phone: +46 31 343 47 31 Fax: +46 31 25 79 60 E-mail: [email protected]

Switzerland Retinitis pigmentosa—Vereinigung Schweiz Langstrasse 120 CH-8004 Z¨urich, Switzerland Contact: Mrs. Ch. Fasser Phone: +44 1 2911872 Fax: +41 1 2911850

234

Appendix

United Kingdom Batten Support and Research Trust, Reg. Charity No. 107095 Contact. Mr. R J Ford, 83 Weymouth Bay Avenue Weymouth, Dorset DT3 5AD, England, U.K. Batten Disease Family Association, c/o Heather House Heather Drive, Tadley Hampshire RG26 4QR, England, U.K. Manager: Sarah Kenrick Heather House offers services to young adults with a visual impairment and a degenerative illness, especially juvenile NCL. Provision will include a nursing and social care service; an activity and resource center; family support; outreach services; research. Contact the manager, or placement coordinator (below) for further information, to pursue a referral, or to arrange a visit. SeeAbility 56-66 Highlands Road Leatherhead, Surrey KT22 8NR, England, U.K. Placement Coordinator for Heather House: Sue Ogden Phone: +44 1372 373086 Research Trust for Metabolic Diseases in Children (RTMDC) Golden Gates Lodge, Weston Road Crewe, Cheshire CW2 5XN, England, U.K. Contact: Mrs. Lesley Green, Director of Support Services Phone: +44 1270 250221 Fax: +44 1270 250224 Language: French and German available Society for the Study of Inborn Errors of Metabolism (SSIEM) Hon Secretary: Dr. J. H. Walter Willinck Biochemical Genetics Unit Royal Manchester Children’s Hospital Pendlebury, Manchester M27 4HA, England, U.K. Phone: +44 161 727 2137/8 Fax: +44 161 727 2137 Web: http://www.ssiem.org.uk/

Batten Support Groups

235

ELSEWHERE Australia The Australian Chapter of the Batten Disease Support and Research Association Contact: Harry Partridge Level 4, 1 Chandos St St. Leonards, NSW 2065, Australia Phone and Fax: +61 2 9460 9000 E-mail: [email protected]

Costa Rica ˜ Con Enfermedades Progresivas (Batten), APRONEP Association Pro Ninos Contact: Mr. Yamileth Ch´avez Soto, Education Committee Coordinator 75 metros al sur de la F´abrica Ne´on Nieto San Juan de Tib´as, San Jos´e, Costa Rica Phone and Fax: +506 236 96 20

New Zealand New Zealand Afﬁliate of BDSRA P.O. Box 232, Old Station Road Ohakune, New Zealand Contact: Kerry Parkes Phone and Fax: +011-06-385 8103

South Africa Contact: Mr. Marius VanZyl Roy Campbell 46, Sasolburg 9570 Orange Free State So. Africa Phone: +011-27 16 976 5294

236

Appendix

Venezuela Fundacion Thairy Rojas Funtharo (Thairy Rojas Foundation) Contact: Mr. Elimar Rojas or Mrs. Miriam Rojas Avenida 14, Casa No. 27, Sector Carabobo, Urb. Tamare. Ciudad Ojeda, Zulia, Venezuela ZP-4017 Phone: +58 65 405740 E-mail: [email protected] or ﬂ[email protected] or [email protected] ˜ Contact: Dr. Joaquin Pena Facultad de Medicina Departmento de Pediatr´ıa Hospital Universitario Maracaibo. Venezuela Urb. Canaima, Calle 42, No. 15-18 Maracaibo, Zulia, Venezuela Phone: +58 61 494408 Fax: +58 61 492186 E-mail: [email protected]

Subject Index A Adult neuronal ceroid lipofuscinosis, 8, 24 AF, see Amniotic ﬂuid Amniotic ﬂuid, NCL testing, 152–153 ANCL, see Adult neuronal ceroid lipofuscinosis Animal models, for human disorders for ceroid lipofuscinoses, 184 CLN8 homolog, 137–138 English setter dog, 186–188 JNCL, 117–118, 195–197 LINCL, 197–198 mnd mouse, 194 mouse, 170–173 nclf mouse, 195 South Hampshire sheep, 188, 193 Tibetan terrier dog, 193–194 H+-ATPase and Btn1p, 210–212 in lysosome pH, 53 B Batten disease, see Neuronal ceroid lipofuscinoses Batten support groups, 225–236 Behavior in Finnish LINCL, 126 in Northern epilepsy, 127 Blood, peripheral, in NCLs, 143–144 Brain CLN2 neurons, 45 CLN3 subject, 49–50 BTN1 JNCL yeast model, 206–209, 213–214 protein function, 210–212 C Carrier status, NCLs, 151–152, 155, 162–164 Central nervous system, NCL mouse models, 171–173

Ceroid lipofuscinoses, animal models English setter dog, 186–188 mnd mouse, 194 nclf mouse, 195 necessity, 184 South Hampshire sheep, 188, 193 Tibetan terrier dog, 193–194 Chorionic villus samples, NCL testing, 152–153 Chromosome 16, CLN3 mapping, 108 Clinical data Finnish LINCL, 125–126 Northern epilepsy, 126–127 Clinopathology, NCL cases, 8 CLN encoded lysosomal enzymes, 218–219 proteomics, 219 CLN1 characterization, 185 deﬁnitive diagnosis, 14–15 electrophysiology studies, 14 EM studies, 14 linkage disequilibrium mapping, 71 mutations, 39, 154 PCR ampliﬁcation, 149 PPT1 issues, 39–42 PPT1 role, 96–97 PPT deﬁciency, 81–82 PPT mutations, 82–86 SAPs, 40–42 symptoms, 14 in variant juvenile NCL, 15–16 CLN2 biochemical assay, 18–19 brain neurons, 45 characterization, 185 defective protein, 46–47 EEG, 18 features, 42 gene scanning, 151 incidence, 16–18 lysosomal storage, 42–45

237

238 mutation testing, 151, 154 pathogenesis, 46 PCR ampliﬁcation, 149 TPP1, 18–19, 97–98 CLN3 amino acid sequence, 51 animal models, 117 brain tissue, 49–50 categories, 21 characterization, 185–186 chromosomal mapping, 108 deletion testing, 144–147 encoded protein, 116–117 English setter dog model, 187–188 exon trapping, 113 function, 53 gene scan, 148 glycosylation, 51 heterozygosity, 22 homozygosity, 22 identiﬁcation, 50, 98–99 incidence, 19–21 localization, 109–111 mouse knockout models, 195–197 mouse models, 171–172 mutations, 52, 115–116, 147–149, 154 neuronal death, 54 physical mapping, 111–112 sequence homology, 52–53 Southern hybridization, 149 structural modeling, 50 as subunit 9 gene, 109 tissue expression, 116 yeast model, 206–209 CLN4 electrophysiological studies, 24 gene cloning, 218 genetic defects, 58–59 symptoms, 24 CLN5 characteristics, 24–25 computer predictions, 134 gene defects, 54 gene isolation, 132 mutations, 133–134 tissue expression, 134 CLN6 characteristics, 25 gene cloning, 218 genetic defects, 56–57

Subject Index CLN7 characteristics, 25, 29 gene cloning, 218 genetic defects, 57–58 CLN8 characteristics, 29 computer predictions, 135 gene isolation, 134 genetic defects, 54–56 mouse homolog, 137–138 mutation, 134–135 tissue expression, 135 CNS, see Central nervous system Computer modeling CLN5, 134 CLN8, 135 CVS, see Chorionic villus samples D Data, clinical Finnish LINCL, 125–126 Northern epilepsy, 126–127 Degeneration, neurons, NTF role, 177–178 Deletions CLN3, 144–147, 149 JNCL mutation, 113–114 Dementia in Finnish LINCL, 125–126 in Northern epilepsy, 126 DNA CLN3 deletion, 145 JNCL CLN3 cDNA, 113 NCLs, genetic testing, 143–144 PPT cDNA, 79–80 Drugs, NCL treatment, 220–221 E EEG, see Electroencephalography Electroencephalography for classic late-infantile NCL, 16–18 Finnish LINCL, 127 Northern epilepsy, 127–128 Electron microscopy INCL, 14 NCLs, 3 variant late-infantile NCL with GROD, 15 EM, see Electron microscopy English setter dog, as human disorder model, 186–188

239

Subject Index Enzymes, lysosomal CLN-encoded, substrates, 218–219 oligosaccharide role, 76–77 Enzymology, PPT, 73–74 Exons, for JNCL CLN3, 113 F Fatty acids, PPT hydrolysis, 73 Finnish late-infantile neuronal ceroid lipofuscinosis biochemistry, 130 causative mutation, 82 characteristics, 24–25 clinical data, 125–126 CLN1 linkage disequilibrium mapping, 71 cytochemistry, 130 diagnosis, 135–136 genetic defects, 54 histology, 128–129 neurophysiology, 127 neuroradiology, 128 treatment, 137 ultrastructure, 129–130 G Genes BTN1, 206–209 btn1-, 213–214 CLN1, 14–16, 37–42, 71, 149, 154 CLN2, 16–19, 42–49, 149–151, 154 CLN3, 19–23, 49–54, 108–113, 115–117, 144–149, 154, 171–172, 187–188, 195–197 CLN4, 24, 58–59, 218 CLN5, 24–25, 54, 132–134 CLN6, 25, 56–57, 218 CLN7, 25, 29, 57–58, 218 CLN8, 29, 54–56, 134–135, 137–138 NCL-associated genes, 10–12 PPT, 79–80 subunit 9, 109 TPP1, 18–19 Gene therapy, NCL disorders, 221–222 Genetic counseling, for NCLs, 161–162, 164–165 Genetic defects NCLs, 37, 54–56, 96–99, 160–161 NCLs without, 56–59

Genetic testing for INCL, 149–151 for JNCL, 144–149 for LINCL, 149–151 for NCLs, 143–144, 154 for prenatal NCLs, 153 Glycosylation, CLN3p, 51 Granular osmiophilic deposits in INCL, 14–15 in JNCL, 15–16 in LINCL, 15 in NCLs, 3 GROD, see Granular osmiophilic deposits H Histology Finnish LINCL, 128–129 Northern epilepsy, 131 Human disorders, animal models, 184–186 English setter dog, 186–188 mnd mouse, 194 nclf mouse, 195 South Hampshire sheep, 188, 193 Tibetan terrier dog, 193–194 I INCL, see Infantile neuronal ceroid lipofuscinosis Infantile neuronal ceroid lipofuscinosis characterization, 185 deﬁnitive diagnosis, 14–15 electrophysiology studies, 14 EM studies, 14 mutation testing, 39, 149–151, 154 PPT1 deﬁciency, 39–42 PPT role, 78–79 SAPs, 40–42 symptoms, 3, 14 treatment, 86–88 yeast model, 214 Insulin-like growth factor-1, 178–179 J JNCL, see Juvenile neuronal ceroid lipofuscinosis

240

Subject Index

Juvenile neuronal ceroid lipofuscinosis amino acid sequence, 51 animal models, 117–118 brain tissue, 49–50 categories, 21 characterization, 185–186 common mutation, 113–114 gene deletion, 144–147 gene exon trapping, 113 gene identiﬁcation, 50 gene localization, 109–111 gene mapping, 108 gene mutations, 52, 115–116, 147–149, 154 with GROD, 15–16 heterozygosity, 22 homozygosity, 22 incidence, 19–21 mouse gene knockout models, 195–197 neuronal death, 54 PPT mutations, 83 protein function, 53 protein sequence homology, 52–53 protein structural modeling, 50 subunit 9 gene, 109 symptom onset, 3 tissue expression, 116 yeast model, 206–209, 213–214

pathogenesis, 46 symptom onset, 3 TPP1 analysis, 18–19 Late-onset neuronal ceroid lipofuscinosis, 83, 86 LINCL, see Late-infantile neuronal ceroid lipofuscinosis Linkage disequilibrium mapping, CLN1, 71 Lysosomal-associated membrane proteins, 52 Lysosomal enzymes CLN-encoded, substrates, 218–219 oligosaccharide role, 76–77 Lysosomal storage in CLN1, 40–41 in CLN2, 42–45 NCLs as disease and mannose 6-phosphorylated glycoproteins, 101 and mitochondrial ATP synthase subunit c, 100 and oligosaccharyl diphosphodolichol, 99–100 and saposins, 101 Lysosomes pH from V-ATPase, 53 targeting, PPT, 75–77 M

K Kufs’ disease, genetic defects, 58 L Late-infantile–early-juvenile neuronal ceroid lipofuscinosis, 25, 56–57 Late-infantile neuronal ceroid lipofuscinosis biochemical assay, 18–19 brain neurons, 45 characterization, 185 defective protein, 46–47 EEG, 18 features, 42 gene scan, 151 with GROD, 15 incidence, 16–18 lysosomal storage, 42–45 molecular testing, 149–151 mouse gene knockout models, 197–198 mutation testing, 154

Mannose 6-phosphorylated glycoproteins, 101 Mapping chromosome 16, CLN3, 108 CLN3, 111–112 linkage disequilibrium, CLN1, 71 physical, CLN3, 111–112 Mitochondrial ATP synthase subunit c in CLN2 lysosomal storage, 42–45 in CLN2 pathogenesis, 45–46 in CLN3, 50 in NCL, 100 and progressive neuronal degradation, 48 as TTPI substrate, 47–48 Models animal, see Animal models CLN5, 134 CLN8, 135 potential NCL drugs, 220–221 structural, for CLN3p, 50 yeast, for NCLs, 206–209, 213–214

Subject Index Molecular genetics CLN5, 132–134 CLN8, 134–135 PPT deﬁciency, 81–82 PPT mutations, 82–86 Molecular screening, NCL carrier status, 151–152, 155 Mouse model CLN8 homolog, 137–138 CNS characterization, 171–173 gene knockout models, 195–198 mnd mouse, 194 nclf mouse, 195 NCLs, 170–171 Mutations CLN3, 52, 115–116 CLN5, 133–134 CLN8, 134–135 INCL, 39, 149–151 JNCL, 113–114, 147–149 LINCL, 149–151 NCL, 10–12, 153–154 PPT, 82–86 TPP1, 47 N NCLs, see Neuronal ceroid lipofuscinoses Neurodegenerative disorders, NTFs as therapeutic agents, 173–176 Neuronal ceroid lipofuscinoses ANCL, 8, 24 animal models, 184–186 associated genes, 10–12 carrier status, 151–152, 155, 162–164 clinopathology, 8 deﬁnition, 3 diagnosis, 10, 161 Finnish LINCL, 24–25, 54, 71, 82, 125–130, 135–137 gene therapy, 221–222 genetic counseling, 161–162 genetic defects, 37, 54–56 genetics, 160–161 genetic testing, 143–144, 155 groups, 36 IGF-1 treatment, 178–179 INCL, see Infantile neuronal ceroid lipofuscinosis

241

inclusion bodies, 3 inheritance, 160 JNCL, see Juvenile neuronal ceroid lipofuscinosis late-onset NCL, 83, 86 LINCL, see Late-infantile neuronal ceroid lipofuscinosis LINCL–JNCL, 25, 56–57 mannose 6-phosphorylated glycoproteins, 101 mitochondrial ATP synthase subunit c, 100 mouse models, 170–173 NTFs as therapeutic agents, 179 oligosaccharyl diphosphodolichol, 99–100 pathogenesis, 219–220 potential drug models, 220–221 prenatal diagnosis, 153–154 prenatal testing, 152–153 reproductive options, 164–165 saposins, 101 Turkish LINCL, 25, 29, 57–58 without genetic defects, 56–59 Neurons CLN2 brain, 45 death in CLN3, 54 NTF role, 177–178 progressive degradation, 48 Neurophysiology Finnish LINCL, 127 Northern epilepsy, 127–128 Neuroradiology Finnish LINCL, 128 Northern epilepsy, 128 Neurotrophic factors expression and actions, 176–177 signaling failure, 177–178 as therapeutic agents, 173–176, 179 Northern epilepsy biochemistry, 132 characteristics, 29 clinical data, 126–127 cytochemistry, 132 diagnosis, 136–137 genetic defects, 54–56 histology, 131 neurophysiology, 127–128 neuroradiology, 128 treatment, 137 ultrastructure, 131–132 NTFs, see Neurotrophic factors

242

Subject Index O

Oligosaccharides, in lysosomal enzymes, 76–77 Oligosaccharyl diphosphodolichol, in NCL, 99–100 Ophthalmology in Finnish LINCL, 126 in Northern epilepsy, 127 P Palmitoyl-protein thioesterase cDNA, 79–80 deﬁciency laboratory diagnosis, 86 mutations, 82–86 as recessive genetic trait, 81–82 treatment, 86–88 enzymology, 73–74 ﬁne mapping, 71 in lysosomal catabolism, 72 lysosomal targeting, 75–77 physiological role, 77–79 posttranslational processing, 75–77 PPT gene span, 79–80 Palmitoyl-protein thioesterase-1 in CLN1, 96–97 in INCL, 39–42 in JNCL with GROD, 16 Palmitoyl-protein thioesterase-2, 79 Pathogenesis CLN2, 46 NCLs, 219–220 Peripheral blood, in NCLs, 143–144 Physical mapping, CLN3, 111–112 Polymerase chain reaction CLN1, 149 CLN2, 149 CLN3, 144–145, 148 Polymorphisms, NCL-associated genes, 10–12 Posttranslational processing, PPT, 75–77 PPT, see Palmitoyl-protein thioesterase PPT1, see Palmitoyl-protein thioesterase-1 PPT2, see Palmitoyl-protein thioesterase-2 Prenatal molecular testing, for NCL, 152–153 Progressive neuronal degradation, 48 Prosaposin, 41–42 Proteolytic processing, and PPT, 77 Proteomics, CLN-encoded proteins, 219

S Saposins in CLN1, 40–42 in CLN2, 45 deﬁnition, 41 mechanism of action, 41 in NCL, 101 PPT1 interaction, 42 SAPs, see Saposins Seizures in Finnish LINCL, 125 in Northern epilepsy, 126 SEPs, see Somatosenory evoked potentials Sequence homology, CLN3p, 52–53 Signaling, NTFs, failure, 177–178 Single-strand conformation polymorphism, for JNCL mutations, 147 Somatosenory evoked potentials, in Finnish LINCL, 127 Southern hybridization, for CLN3 deletion, 149 South Hampshire sheep, as human disorder model, 188, 193 Sphingolipid activator proteins, 101 SSCP, see Single-strand conformation polymorphism Storage, see Lysosomal storage T Testing genetic, see Genetic testing prenatal, for NCL, 152–153 Therapeutics NTFs as agents, 173–176, 179 yeast model for JNCL, 213–214 Tibetan terrier dog, as human disorder model, 193–194 Tissues CLN3 expression, 116 CLN5 expression, 134 CLN8 expression, 135 NCL genetic testing, 144 TPP1, see Tripeptidyl-peptidase 1 Tripeptidyl-peptidase 1 in classic late-infanile NCL, 18–19 CLN2p role, 97–98 mitochondrial ATP synthase subunit c as substrate, 47–48 mutations, 47

243

Subject Index Turkish late-infantile neuronal ceroid lipofuscinosis, 25, 29, 57–58

VEP, see Visual evoked potentials Visual evoked potentials, in Finnish LINCL, 127

U Ultrastructure Finnish LINCL, 129–130 Northern epilepsy, 131–132 V +

Vacuolar H -ATPase, 53 V-ATPase, see Vacuolar H+-ATPase

Y YACs, see Yeast artiﬁcial chromosomes Yeast as INCL model, 214 as JNCL model, 206–209, 213–214 Yeast artiﬁcial chromosomes, for CLN3 mapping, 111–112