Advances in
MICROBIAL PHYSIOLOGY
This Page Intentionally Left Blank
Advances in
MICROBIAL PHYSIOLOGY Edited by
A...
8 downloads
770 Views
16MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Advances in
MICROBIAL PHYSIOLOGY
This Page Intentionally Left Blank
Advances in
MICROBIAL PHYSIOLOGY Edited by
A. H. ROSE School of Biological Sciences Bath University, U K and
D. W. TEMPEST Depurtmmt of Moleculur Biology and Biorrc~hnologj~ University of Shefield, U K
Volume 31
ACADEMIC PRESS Harcourr Brace Jooanovich, Puh1ishcr.s
London
San Diego New York Boston Sydney Tokyo Toronto
ACADEMIC PRESS LIMITED 2 4 2 8 Oval Road London NW 1 7DX US.Edition,puhlished by ACADEMIC PRESS INC. San Diego C A 92101
Copyright 0 1990 by ACADEMIC PRESS LIMITED This book is printed on acid-free paper
All Rights Reserved
No part o f this book may be reproduced in any form by photostat, microfilm, or any other means, without written permission from the publishers British Lihrury Cutuloguing in Publication Data
Advances in microbial physiology. Vol. 31 I . Micro-organisms-Physiology I. Rose, A. H. 11. Tempest, D. W. 576.11 QR84 ISBN 0-12-027731-X ISSN 0065-291 1
Typeset and printed in Great Britain by Galliard (Printers) Ltd, Great Yarmouth
Contributors S. J. Assinder School of Biological Sciences, The University of Wales Bangor, Bangor, Gwynedd LL57 4UW, UK R. G. Board School of Biological Sciences, University of Bath, Bath BA2 7AY, YK W. J. Ingledew Department of Biochemistry and Microbiology, University of St Andrews, St Andrews KY16 9AL, UK S. Mann School of Chemistry, University of Bath, Bath BA2 7AY, UK A. D. Moodie Department of Biochemistry and Microbiology, University of St Andrews, St Andrews KY16 9AL, UK N. H. C. Sparks School of Chemistry, University of Bath, Bath BA2 7AY, UK K. Watson Department of Biochemistry, Microbiology and Nutrition, University of New England, Armidale, Australia 235 1 P. R. Wheeler Department of Applied Biology, University of Hull, Hull HU6 7RX, UK P. A. Williams School of Biological Sciences, The University of Wales Bangor, Bangor, Gwynedd LL57 4UW, UK
This Page Intentionally Left Blank
Contents Contributors
V
The TOL Plasmids: Determinants of the Catabolism of Toluene and the Xylenes SUSAN J. ASSINDER and PETER A. WILLIAMS
I. Introduction Biochemistry of the pathway Ill. Organization of the catabolic genes IV. Regulation of catabolic genes V. Recombination and transposition VI. Growth of TOL strains on benzoate ("benzoate curing") VII. Evolution of catabolic pathways VIII. Use of TOL plasmid genes in construction of novel strains and vectors IX. Epilogue X. Acknowledgements References 11.
2 12 18 23 34 39 44 55 64
64 64
Recent Research into the Physiology of Mycobacterim leprae PAUL R. WHEELER 1. Introduction 11. Growth of Mycohucterium leprae 111. The cell envelope IV. Metabolism in Mycohucterium leprae V. Interaction of Mvcohucterium leprae with host cells VI. Possible applications VII. Conclusions VTII. Acknowledgements References
71 73 75 86 99 111
115 118 119
*
Magnetotactic Bacteria: Microbiology, Biomineralization, Palaeomagnetism and Biotechnology STEPHEN MANN, NICK H. C. SPARKS and RON G. BOARD
I.
Introduction 11. Occurrence Ill. Methods of study
125 126 134
Physiology Fine structure Biomineralization Magnetotaxis Palaeomagnetism IX. Biotechnological applications X. Addendum XI. Acknowledgements References
IV. V. VI. VII. VTII.
141 146 i48 165 173 176 177 179 179
Microbial Stress Proteins K.WATSON I. Introduction 11. What are stress proteins? 111. Stress proteins are highly conserved IV. Induction of stress-protein synthesis V. Acquired thermotolerance VI. Immune response VII. Protein assembly and translocation VIII. Summary IX. Acknowledgements References
183
184 192 194 203 210 212 215 216 216
Microbial Anaerobic Respiration ALAN D. MOODIE and W. JOHN INGLEDEW 225
I. Introduction 11. General overview of the organization and function of respiratory chains 111. Methanogenesis IV. Sulphate as a respiratory oxidant V. Fumarate respiration VI. Oxides of nitrogen as respiratory oxidants VII. Other anaerobic oxidants VIII. Conclusions References
230 235 243 252 256 26 1 265 265
Author index Subject index
27 1 29 1
The TOL Plasmids: Determinants of the Catabolism of Toluene and the Xylenes SUSAN J . ASSINDER and PETER A . WILLIAMS School of Biological Sciences. The University of Wales Bangor Bangor. Gwynedd LL57 4UW U K
.
.
I . Introduction . . . . . . . . . . . . . . . . A . Catabolic plasmids . . . . . . . . . . . . . B. Pseudomonas puridu (uroillu) mt-2 and aromatic catabolism . . . C. The TOL plasmid of Pseudomunus purida mt-2 . . . . . . D . Other properties of the plasmid . . . . . . . . . . E. Other TOL plasmids . . . . . . . . . . . . . . F. Other pathways for toluene catabolism . . . . . . . . I1 . Biochemistry of the pathway . . . . . . . . . . . . A . Enzymes of the upper-pathway operon . . . . . . . . B. Enzymes of the meru-pathway operon . . . . . . . . I11 . Organization of the catabolic genes . . . . . . . . . . . A . Molecular characterization of pWWO . . . . . . . . . B. Organization of the structural xyl genes on pWWO . . . . . C . The upper-pathway operon . . . . . . . . . . . D. The meru-pathway operon . . . . . . . . . . . E. Regulatory genes . . . . . . . . . . . . . . IV . Regulation of catabolic genes . . . . . . . . . . . . A . Physiological studies of regulatory mutants . . . . . . . B. Molecular analysis of TOL regulatory genes . . . . . . . C. Structure of TOL plasmid promoters . . . . . . . . . D. A model for gene regulation on pWWO . . . . . . . . E. Involvement of RpoN in TOL regulation . . . . . . . . V Recombination and transposition . . . . . . . . . . . A . InpWWO . . . . . . . . . . . . . . . . B. In other TOL plasmids . . . . . . . . . . . . VI . Growth of TOL strains on benzoate (“benzoate curing”) . . . . . A . Effect of benzoate on Pseudomonusputidu HSl . . . . . . B. Effect of benzoate on Pseudomonas puridu MT53 . . . . . . C. Effect of benzoate on Pseudumonas spp. MT14, MT15 and MT20 . D. Explanation for the counterselection against wild type during benzoate growth . . . . . . . . . . . . . . . . V11. Evolution of catabolic pathways . . . . . . . . . . . A . Evolutionary relationships between TOL plasmids . . . . . B. Evolutionary relationships with other catabolic plasmids . . . .
,
.
ADVANCES IN MICROBIAL PHYSIOLOGY. VOL. 31 ISBN 0.12-027731-X
2 2 3 4 8 10
12 12 13 16 18 18
20 20 21 23 23 24 25 26 29 31 34 34 38 39 39 40 40 41 44 45 52
Copyright C 1990. by Academic Press Limited All rights of reproduction in any form reserved
2
S. J. ASSINDER A N D P.A. WILLIAMS
VIII. Use of TOL plasmid genes in construction of novel strains and vectors . , A. Multiplasmid Pseudornonus spp. . . . . . . . . . . B. Strains with hybrid pathways . . . . . . . . . . ' C. Extension of range of TOL substrates . . . . . . . . D. Strains for bioaccumulations . . . . . . . . . . ' E. Use of TOL genes to create vectors for recombinant DNA studies ' IX. Epilogue . . . . . . . . . . . . . . . . , X. Acknowledgements . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . '
55 56 51
60 61
62 64 64 64
1. Introduction A. CATABOLIC PLASMIDS
In 1970, the role of plasmids as vectors of auxiliary bacterial functions appeared to be limited to drug resistance and synthesis of compounds toxic to other organisms such as colicins and enterotoxins. By 1973, this list had been extended to include the ability to utilize certain compounds as carbon sources by four papers published from the same laboratory in Urbana, Illinois. In each of these reports, the host bacterium was a Pseudonionas sp. and the compounds involved were relatively uncommon carbon sources, even for a genus with such catabolic versatility: salicylate (Chakrabarty, 1972), camphor (Rheinwald et al., 1973), octane and other short-chain alkanes (Chakrabarty et al., 1973) and naphthalene (Dunn and Gunsalus, 1973). The experimental evidence that plasmids encoded these catabolic abilities was circumstantial, based on a high loss of the catabolic phenotype under non-mutagenic conditions and its transfer by conjugation between genetically distinguishable strains. In retrospect, two features found during many previous investigations of strains capable of degrading esoteric compounds might well have led to an earlier association between catabolism and plasmids: (a) It was not uncommon during laboratory subculture for many strains spontaneously to lose the catabolic ability for which they had been isolated: in hindsight many of these could have been due to loss of a catabolic plasmid. (b) Long lag phases occur before appearance of microbial degraders after application of some compounds, in particular aromatic herbicides, to soil or to soil suspensions (Audus, 1960). It was this fact which led Waid (1972), with no prior knowledge of the discovery of catabolic plasmids being made in Illinois, to suggest that plasmids might participate in microbial herbicide degradation, a prediction which was to be fulfilled with the later discovery of a plasmid determining 2,4-dichlorophenoxyacetate dissimilation (Pemberton and Fisher, 1977).
THE TOL PLASMIDS
3
The fifth catabolic plasmid to be reported was in Pseudomonus putidu mt-2, then known as Ps. uruillu mt-2: its plasmid is the archetype of the family of TOL plasmids and is the best-studied catabolic plasmid.
B.
Pseudomonus putidu (urvillu) mt-2
AND AROMATIC CATABOLISM
This bacterium was isolated by Hosokawa in Japan in the early 1950s: its mt-2 designation is because the selective carbon source used in its isolation was mtoluate (3-methylbenzoate; T. Nakazawa, personal communication). However, this did not appear in the early literature where the only reported aromatic carbon source was benzoate; benzoate-grown cells were the source of the catechol 2,3-oxygenase (metapyrocatechase, C230) which was the subject of the pioneer studies on the enzymology of extradiol ring cleavage dioxygenase carried out by Hayaishi and his colleagues (Nozaki et u/., 1963a,b). Catabolism of benzoate in Ps. putidu involves dioxygenation to 3,5cyclohexadiene- 1,2-diol- 1-carboxylic acid (benzoate dihydrodiol) (Fig. 1 ; Reiner and Hegeman, 1971)followed by dehydrogenation to catechol (Fig. 1; Reiner, 1972). Most strains metabolize the catechol by the /I-ketoadipate or ortho-cleavage pathway (Ornston and Stanier, 1966) involving an intradiol ring cleavage by catechol 1 ,Zoxygenase ((2120) producing cis,cis-muconate which is then converted to succinyl-CoA and acetyl-CoA (Fig. 1). Pseudomoncis putidu mt-2 is atypical in metabolizing the catechol formed from benzoate by the alternative metu-cleavage pathway initiated by extradiol ring cleavage with C230 (Fig. 1). The metu-pathway differs significantly from the 8ketoadipate pathway in being able to tolerate alkyl substituents on the catechol; thus it serves as a route for growth substrates which can be converted to alkylcatechols, in particular 3-methylcatechol and 4-methylcatechol. This enables Ps.putidu mt-2 to utilize not only benzoate but also m-toluate and ptoluate (4-methylbenzoate) which are converted to 3-methylcatechol and 4methylcatechol, respectively (Murray et ul., 1972). Two early experiments showed that aromatic catabolism in strain mt-2 was not exclusively by the metu pathway but that it could also express enzymes of the 8-ketoadipate route. Incubation of cells grown on a non-aromatic carbon source in media containing catechol surprisingly caused induction of C120 (Murray e f u/., 1972), the activity of which had not previously been suspected in this strain. Subsequently, Nakazawa and Yokota (1973a) showed that colonies of spontaneous mutants of mt-2 could be recognized on agar plates which included benzoate as a carbon source. These mutants had lost their C230 activity but contained induced levels of C120 and grew faster on media containing benzoate. The high frequency of their occurrence, viewed in the light of the discovery of the salicylate plasmid (Chakrabarty, 1972), led to the
4
S. J . ASSINDER A N D P. A. WILLIAMS
Oio-
ccooCHO
B-Ketoadipate
Meta pathway
or ortho pathway
Succina te
Pyruvate
Acetyl -CoA
Acetaldehyde
+
+ +
COP
FIG. 1. Alternative pathways for benzoate catabolism in Pseudomonas putida. The first two common steps convert benzoate (1) to catechol(3). The pathways diverge in the ring-cleavage reactions catalysed by catechol 1,2-oxygenase (reaction a) and catechol 2.3-oxygenase (reaction b). Names of the compounds are: 1, benzoate; 2, benzoate dihydrodiol (1,2-dihydrocyclohexa-3,5-diene carboxylate); 3, catechol; 4, cis,cis-muconate; 5, 2-hydroxymuconic semialdehyde.
suggestion that the meta-pathway enzymes might exist as a gene cluster specified by a plasmid (Nakazawa and Yokota, 1973a).
c.
THE TOL PLASMID OF Pseudomonas puridu mt-2
Evidence for a catabolic plasmid in strain mt-2 was published independently by three laboratories (Nakazawa and Yokota, 1973b; Williams and Murray, 1974; Wong and Dunn, 1974). The evidence was twofold:
THE TOL PLASMIDS
5
(a) A high frequency of conjugational transfer between strains of Ps. putida of the ability to utilize, for example, m-toluate and p-toluate. (b) A high frequency of loss of that ability induced by mitomycin C. Williams and Murray (1974) also showed that, during growth on liquid benzoate-minimal medium, spontaneous mutants accumulated which had lost the ability to grow on the two toluates (Mtol- Ptol-); they retained the ability to grow on benzoate (Ben’) but by the P-ketoadipate path. Clearly these mutants were analogous, if not identical, to those reported by Nakazawa and Yokota (1973a). They lacked detectable levels of any of the meta-pathway enzymes assayed and it was proposed that they had lost a plasmid, designated TOL, containing the complete meta-pathway genes. Its loss during growth on benzoate, called “benzoate curing”, was attributed to a growth advantage conferred on spontaneous plasmid-free strains as a result ofchanging from the meta to the B-ketoadipate pathway. “Benzoate curing” will be discussed in Section VI. Earlier metabolic studies in other bacteria had shown that m- andp-toluates were metabolic products of m- and p-xylenes, respectively, which were oxidatively metabolized by way of the corresponding methylbenzyl alcohols and benzaldehydes (Omori et al., 1967; Davis et al., 1968; Omori and Yamada, 1969).Worsey and Williams (1975) showed that strain mt-2 was also capable of growth on toluene and m- and p-xylenes and that, after growth on these hydrocarbons, cells contained induced levels of non-specific benzyl-alcohol dehydrogenase (BADH) and benzaldehyde dehydrogenases (BZDH) in addition to the meta-pathway enzymes necessary for further metabolism of benzoate and toluates. Furthermore, during both plasmid loss and conjugational transfer, the ability to utilize the hydrocarbons was wholly linked to the ability to utilize the two toluates and to possession of C230 activity. The TOL plasmid therefore encoded enzymes for conversion of the aromatic hydrocarbons to the corresponding carboxylic acids as well as the meta-pathway enzymes (Fig. 2). The metabolic versatility endowed by the plasmid was shown to extend even further by inclusion of 3-ethyltoluene and 1,2,4-trimethylbenzene (pseudocumene) as primary growth substrates (Kunz and Chapman, 1981a). The presence of the plasmid and its genes, the xyl cluster (Worsey et al., 1978), thus enables a host cell to grow on 20 substrates, five each of hydrocarbons, alcohols, aldehydes and carboxylic acids (Table 1). The plasmid in Ps. putida has been named pWW0 (Worsey et al., 1978)and is referred to as such in many of the subsequent publications. However, in some papers other names have been used. In this review we will refer to the native plasmid as pWW0, when the authors have used that nomenclature, otherwise we shall refer to it as TOL, which was the original name. Nakazawa and her co-workers have used as vector for the xyl genes plasmid pTN2, which is an
6
S J . ASSINDER AND P. A. WILLIAMS
x:::: 0 RZ
O2
XO (xylMA)
CHpOH
\
Rl
NAD+i 6 ' NAD+X 0-
BADH (xylB)
NADH
Rl
R2
BZDH ( x y l c )
NmH
Rl
R2
Upper pathway operon
FIG. 2. Complete pathway encoded by TOL plasmids. The following hydrocarbons ( I ) serve as growth substrates: toluene (R, = R, = H); m-xylene ( R , =CH,, R, = H); p-xylene ( R , = H, R, = CH,); 3-ethyltoluene ( R , = C2H,, R, = H); 1,2,4-trimethylbenzene (pseudocumene)( R , = R, = CH,). Numbered compounds (toluene catabolism only) are: 2, benzyl alcohol; 3, benzaldehyde; 4, benzoate; 5, benzoate dihydrodiol ( 1,2di hydrocyclohexa-3.5-dienecarboxylate); 6, catechol; 7,2-hydroxymuconic semialdehyde; 8,4-oxalocrotonate (enol); 9,4-oxalocrotonate (keto); 10, 2-oxopentcnoate (enol) o r 2-hydroxypent-2,4-dienoate;1 1, 4-hydroxy-2-oxovalerate. Enzyme abbreviations are: XO, xylene oxygenase; BADH, bcnzyl-alcohol dehydrogenase; BZDH, benzaldehyde dehydrogenase; TO, toluate 1,2-dioxygenase; DHCDH, 1,2-dihydroxycyclohexa-3,S-diene carboxylate (benzoate dihydrodiol) dehydrogenase; C230, catechol2,3-oxygenase; HMSH, 2-hydroxymuconic-semialdehyde hydrolase; HMSD, 2-hydroxymuconic-semialdehyde dehydrogenase; 401, 4-oxalocrotonate isomerase; 4 0 D , 4-oxalocrotonate decarboxylase; OEH, 2-0x0-4-pentenoate (or 2-hydroxy-2,4dienoate) hydratase; HOA, 4-hydroxy-2-oxovalerate aldolase. The genes encoding the protein subunit(s) are as designated. Their expression is regulated in two distinct operons, the upper-pathway operon and the metu- (or lower-) pathway operon.
THE TOL PLASMIDS
TO (xy/D or xylXVZ1
coo-
C230 ( xy/f )
OEH (xylJ)
HOA ( xy/K )
CH 3 .CO.COO-
+
Rz.CH2.CHO Me&-pathway operon
7
8
S. I. ASSINDER A N D P. A. WILLIAMS
TABLE I . Substrates which support growth of TOL' Pseudomonus strains A. Hydrocarbons
Toluene (methylbenzene) ni-Xylene (1.3-dimethylbenzene) p-Xylene (1.4-dimethylbenzene) Pseudocumene ( 1.2.44rimethylbenzene) 3-Ethyltoluene
B. Alcohols Benzyl alcohol /v-Methylbenzyl alcohol (3-methylbenzyl alcohol) p-Methylbenzyl alcohol (4-methylbenzyl alcohol) 3.4-Dimethylbenzyl alcohol 3-Ethylbenzyl alcohol C. Aldehydes
Benzaldehyde ni-Tolualdehyde (3-methylbenzaldehyde) p-Tolualdehyde (4-methylbenzaldehyde) 3.4-Dimethylbenzaldehyde 3-Eth ylbenzaldehyde
,
D. Carboxylic acids Benzoate ni-Toluate (3-methylbenzoate) p-Toluate (4-methylbenzoate) 3.4-Dimethylbenzoate 3-Ethylbenzoate
RP4 replicon carrying an insert from TOL (Section V), and we shall refer to this as pTN2 where applicable. All other isofunctional plasmids will be referred to by the specific plasmid name, e.g. pDK 1, pWW53, or generically as TOL plasmids. D. OTHER PROPERTIES OF THE PLASMID
Whereas catabolism coded by pWWO has been intensively investigated, very little work has been carried out on the other genes of the plasmid. Like the naphthalene plasmid NAH and the salicylate plasmid SAL, pWWO is of the incompatibility group IncP9 (Austen and Dunn, 1977; White and Dunn, 1978) which also contains some resistance plasmids (Bayley et ul., 1979).The plasmid is conjugative, and transfer occurs in liquid media between strains of Ps.putidu mt-2 at frequencies higher than transconjugants for each donor cell (Williams and Murray, 1974).A more detailed analysis of the system showed
THE TOL PLASMIDS
9
that, in the host-strain mt-2, the conjugation system is derepressed and is also “surface preferred”, the plasmid being transferred at frequencies of about 2 x lo-’ on agar surfaces, an excess of about 18-fold over the frequency in liquid media (Bradley and Williams, 1982). In a Ps. aeruginosa host, conjugation was repressed and transfer frequencies were consequently much lower. Electron microscopy showed the constitutive production of thick flexible pili in derepressed strains. Benson and Shapiro (1978) introduced a carbenicillin resistance gene into TOL by means of the transposon Tn401, and demonstrated that the plasmid had a broad host range since conjugation could take place between TOL’ Ps. putida donors and Escherichia coli recipients. Although the TOL+ E. coli transconjugants were Cb‘, they did not grow on m-toluate. As in other examples discussed later, this is the result of the inability of E. coli to express the xyl genes. The replication and conjugation genes of the plasmid have not been studied. The structure of a variety of Tn5 insertion mutants and some derived deletion mutants led Franklin et al. (1981) to the conclusion that these functions were located in the region of Xhol fragments A and H since very few insertions or deletions in the plasmid were found in that region, suggesting that they would have been lethal. However, they were unable to construct minireplicons from TOL suggesting that replication determinants of the plasmid were not clustered but rather dispersed around the plasmid as in some other broad host-range plasmids. An additional property of TOL which has been demonstrated is its ability to confer resistance to the reactive singlet oxygen species produced in solution by excitation with visible irradiation in the presence of a photosensitizer (Yano et al., 1981). This was a novel property for a plasmid and did not appear to be related to resistance to ultraviolet radiation conferred by some other plasmids, including the camphor catabolic plasmid CAM (Jacoby, 1974).It is not known whether there is any connection between this resistance and the catabolic functions or whether they are unlinked properties. McClure and Venables (1986) adapted strain mt-2 to growth on the aromatic amines aniline and m- and p-toluidine. The adapted strain UCC2 contained two plasmids, a deleted derivative of pWWO identical in restriction enzyme digests to pWW0-8 and a 79 kbp plasmid pTDN1. The latter plasmid codes for enzymes converting the amines to catechols and their subsequent metabolism by a meta pathway (McClure and Venables, 1987). However, pTDN1 bears no homology either to pWWO or to the chromosome of mt-2 (Saint et al., 1990) and its origin in the adaptation experiment remains unknown. The absence of any relationship between the mera-pathway genes of pTDN1 and pWWO is remarkable in the light of the strong homology between the isofunctional genes of TOL and NAH plasmids (Section VII).
10
S. J. ASSINDER A N D P. A. WILLIAMS
E. OTHER
TOL
PLASMIDS
Selective enrichment from natural populations (e.g. soil) in mineral-salts medium with m-toluate as the sole carbon source is a powerful method of obtaining bacteria with the same phenotype as Ps. putidu mt-2. This has been done many times in the authors’ laboratory since 1975 and the resulting strains almost always show three common features: (a) They are Pseudomonas species, although not always fluorescent strains. (b) They grow on all of the TOL-specific substrates, although the selection is only for m-toluate utilization. (c) They contain plasmids which carry the TOL genes. There must be some underlying principle which determines the almost obligatory plasmid-coded nature of the catabolic genes, presumably due to some factors in the ecology of plasmid-host symbioses and the role of toluene-xylene catabolism in soil populations. As with antibiotic resistance in clinical isolates and crown-gall induction in Agrohacterium spp., it is difficult to understand why certain bacterial functions appear only on plasmids, particularly when their frequent existence on transposons could equally well result in their chromosomal integration. The other TOL plasmids which have been reported are those in 13 different isolates (Williams and Worsey, 1976),XYL (Friello et al., 1976b), pKJ1, also encoding resistance to streptomycin and sulphonamides (Yano and Nishi, 1980), pDKl (Kunz and Chapman, 1981b), pWW53 (Keil et al., 1985a), a number of unnamed plasmids (Clarke and Laverack, 1984),pTKO (Keshvarz et al., 1985),pDTG5Ol (Whited ef al., 1986),pGB (Bestetti and Galli, 1987)and one of several plasmids in Pseudomonas sp. ESTlOOl (Kivisaar et a/., 1989). There are, however, two TOL strains which do not conform to the three features mentioned above. Pseudomonas putida MW1000 was isolated in the USA and was used in a pilot biotechnology process to convert toluene to adipic acid (Maxwell, 1982; Hagedorn and Maxwell, 1988). It has no plasmid but contains DNA highly homologous to the catabolic DNA of pWWO inserted in its chromosome (Sinclair et a/., 1987).This strain could well have arisen by a transposition or recombination event between a resident pWW0like plasmid and the chromosome (see Section V). The second strain is Alcaligenes eutrophus strain 345, which contained a plasmid pRAl000, virtually identical in restriction-enzyme digest to pWWO but which, in its natural host, encoded only the catabolism of m- and p-toluates but not the xylene precursors (Hughes et al., 1984). The TOL plasmids other than pWWO which have been closely investigated are all clearly differentfrom the archetypal plasmid in a number of properties
THE TOL
PLASMIDS
I OH
CH3
CHO
8 OH
OH
OH
GrnH COOH
FIG. 3. Alternative pathways for toluene (1) catabolism as far as ring cleavage. Numbered compounds are: 2, toluene dihydrodiol; 3,3-methylcatechol; 4,2-hydroxy6-oxohepta-2,4-dienoate; 5, p-cresol; 6, p-hydroxybenzyl alcohol; 7, p-hydroxybenzaldehyde; 8, p-hydroxybenzoate; 9, protocatechuate (3,4-dihydroxybenzoate);10, 3-carboxy-cis,ris-muconate.
12
S. J. ASSINDER A N D P. A. WILLIAMS
such as size, fragmentation with restriction enzymes, incompatibility, transmissibility and behaviour during benzoate selection (“curing”). One line of work in the authors’ laboratory has been a comparison of some of these other plasmids with pWW0. The rationale is that, whereas investigation of pWW0 has led to a detailed understanding of the gene organization and regulation of the toluene-xylene pathway, comparison with other isofunctional plasmids should cast light on the past history of the genes and therefore their evolution (Section VII). F. OTHER PATHWAYS FOR TOLUENE CATABOLISM
The TOL pathway is only one of three metabolic routes which have been described by which toluene can be catabolized. The most studied alternative pathway involves an initial dioxygenase attack which dihydroxylates the aromatic ring to form toluene dihydrodiol (Gibson et al., 1970). This is then dehydrogenated to form 3-methylcatechol which is further metabolized by the metu pathway (Fig. 3; Gibson et ul., 1968). There is no evidence that this pathway, called the TOD pathway, is plasmid encoded but rather there is strong evidence that it is chromosomal. It is likely that strains which use this route can also catabolize benzene via catechol with the same enzymes (Gibson et al., 1968). A second alternative pathway has not yet been investigated in great detail and may well be of rarer occurrence since it has been described in only one bacterium, a strain of Ps.mendocinu (Gibson, 1988). The toluene ring is singly hydroxylated to form p-cresol, the methyl group of which is then successively oxidized, as in the TOL pathway, through p-hydroxybenzyl alcohol and phydroxybenzaldehyde to p-hydroxybenzoate (Fig. 3). This is then further monohydroxylated to protocatechuate (3,4-dihydroxybenzoate) which can serve as a ring-fission substrate for the intradiol ring-fission enzyme protocatechuate 3,4-dioxygenase. The enzyme which converts the methyl group of p-cresol to p-hydroxybenzyl alcohol, namely p-cresol methylhydroxylase, is not an oxygenase as in the analogous reaction of the TOL pathway and derives its oxygen from water rather than dioxygen. This reaction is not unique to this pathway for toluene catabolism and has been described in a p-cresol-utilizing strain of Ps.putidu (Hopper and Taylor, 1977). 11. Biochemistry of the Pathway
Biochemical characterization of the catabolic pathway and its enzymes has been less intensively pursued than has the genetics, and this section is therefore bound to present a less complete view than some of the others.
THE TOL PLASMIDS
13
A. ENZYMES OF THE UPPER-PATHWAY OPERON
Although there are early reports of partial purification of a three-component enzyme converting toluene to benzyl alcohol from a strain of Ps. aeruginosa (Nozaka and Kusunose, 1968), it has not yet proved possible to assay the product of the TOL xylMA, usually referred to as xylene oxidase (XO) or xylene mono-oxygenase, in cell extracts. Its activity has been assessed in whole cells either by stimulation of oxygen uptake in the presence of one of the hydrocarbon substrates (as in Franklin and Williams, 1980)or by chemical or enzymic determination of the products, benzyl alcohol and benzaldehyde, formed by its action on toluene (Harayama et al., 1986a).The enzyme has been presumed to be a mono-oxygenase catalysing a reaction of the type R-CH,
+ 0, + XH, + R-CH,OH + H,O + X
where XH, is a hydrogen donor; preliminary evidence suggests that NAPH takes this role (S. Harayama, personal communication). Although there is no confirmation of this mechanism by way of biochemical characterization of the proteins, their amino-acid sequence has been deduced from the sequence of the xyIMA region of pWW0 (Suzuki et ul., 1990).According to this sequence, the XylM protein has a subunit of 4165Da and shares limited homology (25%) to the AlkB protein involved in plasmid-coded hydroxylation of shortchain alkanes. The XylA protein has a subunit of 37044Da, and may have two domains, an N-terminal region with homology with chloroplast ferredoxins and a C-terminal region homologous with ferredoxin-NADP reductases, and could have evolved by fusion of two such ancestral genes. The substrate specificity of XO appears to extend beyond the hydrocarbons since it will further hydroxylate its product, benzyl alcohol, to benzaldehyde, thus duplicating the action of the second enzyme of the pathway, namely BADH (Harayama et al., 1986a).There is no evidence to indicate whether this additional activity constitutes a physiologically important route to benzaldeh yde. An interesting by-product of cloning the xylMA region has been the demonstration that, in uiuo, XO is able to convert indole to the insoluble blue dye indigo (Mermod et al., 1986a; Keil et al., 1987a),a reaction which occurs during growth in the presence ofadded indole either on agar plates or in liquid media. In E. coli hosts, the cloned gene results in indigo synthesis even in the absence of indole since the action of the tryptophanase in E. coli on tryptophan produces indole endogeneously. Indigo synthesis had earlier been observed as a result of cloning genes for dioxygenases, such as naphthalene dioxygenase, involved in dihydroxylation of the aromatic nucleus (Ensley et al., 1983).The mechanism of dioxygenasecatalysed formation of indigo is believed to proceed by way of dihydroxylation
14
S J ASSINDER A N D P A WILLIAMS
of the heterocyclic ring of indole to produce 2,3-dihydro-2,3-dihydroxyindole, exactly analogous to the formation of the normal products, e.g. naphthalene to 1,2-dihydro-l,2-dihydroxynaphthalene.This then undergoes two sequential spontaneous reactions: a dehydration to 3hydroxyindole, two molecules of which then condense to give indigo (Fig. 4). It is not clear how XO could achieve the same result. It could directly hydroxylate indole to 3-hydroxyindole which would then spontaneously dimerize. However, this would imply a very broad specificity for XO since the methylene group at position 3 of indole bears very little in common with the methyl group of toluene in either reactivity or geometry. An alternative explanation is that, in at least some circumstances, the mechanism of XO has more in common with the dioxygenases than has previously been suspected. The two dehydrogenases converting benzyl alcohol through benzaldehyde to benzoate encoded by plasmids pWWO (Shaw and Harayama, 1990) and pWW53 (Chalmers et al., 1990) have been purified to homogeneity; comparison of the DNA encoding the genes from both plasmids suggests that the pWW53 enzymes are highly homologous to those from pWWO (Keil et al., 1987a). Both studies (Chalmers er al., 1990; Shaw and Harayama, 1990)show the subunit sizes of the enzymes to be identical within experimental error (BADH, 4 2 4 3 kDa; and BZDH, 53.6-57 kDa) and these values agree well with the sizes of the gene products of xylB and xylC, 40 and 57kDa, respectively, determined by SDS-PAGE analysis of the cloned genes from pWWO (Harayama et al., 1989a). However, Chalmers et al. (1990)indicate that the enzymes from pWW53 are tetrameric whereas Shaw and Harayama (1990) propose that the pWWO-coded enzymes are dimers. On the basis of other similarities it would be surprising if two such apparently similar proteins formed different quaternary structures. One other major difference in properties between the pWWO and the pWW53 enzymes is that the two BZDH proteins differ significantly in their kinetic parameters, K,, and V,,,,,. These two sequential dehydrogenases would seem to be ideal candidates for having evolved by an ancestral gene duplication and subsequent divergence since they catalyse similar reactions on substrates of similar structure and are closely linked within the same regulon. However, in the absence of DNAsequence information, there appears to be no evidence to support this hypothesis, and hybridization and restriction map comparisons suggest there is no relationship (Keil et al., 1987a). Interestingly, the molecular weights, subunit structures, kinetic parameters and N-terminal amino-acid sequences of BADH and BZDH from pWW53 are very similar to the respective isofunctional enzymes isolated from Acinetohucter c'alcouc'eticus,indicating common evolutionary origins (Chalmers et al., 1990; R. M. Chalmers and C. A. Fewson, personal communication).
H OH
FIG. 4. Proposed mechanisms for formation of indigo by bacterial oxygenases. (A) Reaction catalysed by naphthalene dioxygenase, involving oxidation of naphthalene (1) to naphthalene dihydrodiol (1,2-dihydro-1,2-dihydroxynaphthalene)(2). (B) Hypothetical scheme for conversion of indole (3)to indigo (6). Reaction (a)is the dioxygenase-catalysed conversion of indole to indole dihydrodiol(4), analogous to reaction A. This is followed by spontaneous dehydration to 3-hydroxyindole (5) in reaction (b), which then is spontaneously oxidized to indigo (6) in reaction (c). Indigo formation by xylene oxygenase might involve direct hydroxylation to 3hydroxyindole (reaction d) as a first step, analogous to reaction C .( C )Reaction catalysed by xylene oxygenase, involving conversion of toluene (7) to benzyl alcohol (8).
16
S. J. ASSINDER AND
P.A. W I L L I A M S
B. ENZYMES OF THE mela-PATHWAY OPERON
There has been no reported enzymic study of the toluate 1,2-dioxygenase (.uq'lD)activity from pWW0. Genetic analysis of the xy/D region showed the presence of four complementation units (Harayama ct al., 1986b) which suggested that, like many other dihydroxylating dioxygenases which have been purified, it is a multicomponent enzyme made up of a terminal oxygenase, consisting of two non-identical subunits, a short electrontransport chain of a ferredoxin-like molecule and an NADH-dependent ferredoxin reductase. However, it is likely that two of the complementation units are intragenic and that there are only three genes, xylXYZ. This is supported by SDS-PAGE analysis of the protein products from the xy/D region of pWWO (Harayama and Rekik, 1990). In having only three components, toluate 1,2-dioxygenase is similar to the only enzyme with an overlapping activity which has been purified, namely the chromosomally encoded benzoate 1,2-dioxygenase from Ps. aruilla C. This has two different subunits in its terminal oxygenase (Yamaguchi and Fujisawa, 1980, 1982), corresponding to the . y l X Y gene products, and a single electron-transport protein which is a 37-38 kDa NADH-cytochrome-c reductase (Yamaguchi and Fujisawa, 1978), corresponding to the xy/Z gene product. Careful chemical and stereochemical analysis of the product of oxidation ofp-toluate (p-toluate dihydrodiol) by the enzyme from plasmid pDTGSO1 has shown it to be ( -)-cis- I ,Zdihydro- 1,2-dihydroxy-4-methyIcyclohexa-3,5-diene1carboxylate (Whited et al., 1986). As with XO, molecular biology h a s outstripped biochemistry in characterizing the proteins of toluate 1,2-dioxygenase. The DNA of the q M Y Z region has been sequenced and the amino-acid sequence of its proteins deduced (S. Harayama, E. L. Neidle and L. N. Ornston, personal communication). Homology between the pWWO .ryIXYZ DNA and the isofunctional chromosomal genes henABC has been demonstrated. Products of .rylX and .ry/Y show similarities with the Q and 'I/ subunits of other ringhydroxylating dioxygenases, and the N-terminus of the xylZ protein resembles plant-type ferredoxins whereas its C-terminus is similar to chloroplast ferredoxin-NADP reductases. The best studied of the pWWO catabolic enzymes is C230, which was first purified and crystallized in 1963 (Nozaki et al., 1963a). It contains essential ferrous ions and is easily inactivated by agents such as hydrogen peroxide which oxidize the ferrous ions to ferric ions (Nozaki et a/., 1968). Even aerial oxidation causes loss of activity, but considerable protection against this is afforded by ethanol or acetone (Nozaki et a/., 1963b),one of which is normally incorporated at 10% in buffers during cell disruption and assay of cell extracts for C230 activities. Early preparations of the enzyme had a low content of
THE TOL PLASMIDS
17
iron (approximately 1 gram atom of iron per molecule, based on M,= 140 kDa) but a more-recent purification obtained a three-fold higher content of iron which correlated with a similar increase in specific activity (Nakai eta/., 1983a).The active molecule consists of four identical subunits of 35 kDa, and is presumed to contain one ferrous ion per subunit. Partial amino-acid sequences at the N-’terminus (53 residues) and the C-terminus (six residues) agreed with the sequence deduced from the nucleotide sequence of .ydE (Nakai et a/., 1983b; Zukowski et a/., 1983). Meta pathways in general serve as non-specific routes by which aromatic rings with alkyl substitutents can be metabolized without chemical modification of the substituents; by contrast, the /I-ketoadipate pathway cannot metabolize compounds that give rise to alkylcatechol metabolites. In order to support growth on a wide range of substrates, most of the reactions of the metu pathway must exhibit a relaxed substrate specificity. The enzymes at the divergence on the pathway following ring cleavage are exceptions to this. 2-Hydroxymuconic semialdehyde (ZHMS), the ring-cleavage product from catechol, in theory can be converted to 2-hydroxypent-2,4-dienoate by the action of either the hydrolase branch, consisting of 2HMS hydrolase(HMSH), or the 4-oxalocrotonate branch made up of 2HMS dehydrogenase (HMSD), 4oxalocrotonate isomerase (401) and 4-oxalocrotonate decarboxylase (40D) (Fig. 2). On the basis of the substrate specificitiesof HMSH and HMSD in two Ps.puridu strains, mt-2 (Murray et a/., 1972) and the phenol-cresol degrader, strain U (or NCIB 10015)(Sala-Trepat et ul., 1972),it was proposed that the two branches complemented rather than duplicated each other. The ringcleavage product of 3-methylcatechol is a methyl ketone and cannot serve as a substrate for HMSD, which is an aldehyde dehydrogenase; 3-methylcatechol can therefore be dissimilated only by the hydrolase branch. 2Hydroxymuconic-semialdehyde hydrolase exhibits a low specificity for the ring-fission products of catechol and 4-methylcatechol, so it is likely that these are dissimilated preferentially by the 4-oxalocrotonate branch. This hypothesis was confirmed when mutants of strain U blocked in enzymes of each branch were obtained (Bayly and Wigmore, 1973; Wigmore et ul., 1974) and by using cloned genes for strain mt-2 (Harayama et u/., 1987a). Whereas benzoate and p-toluate (the precursors of catechol and 4-methylcatechol) are metabolized almost exclusively by the 4-oxalocrotonate branch in the wildtype mt-2, a s ? Gmutant (blocked in HMSD)can grow on them, albeit slowly, since they can then be channelled through the less efficient hydrolase branch (Harayama et al., 1987a). There have been relatively few studies on the later enzymes of the TOL rnetu operon other than C230. 2-Hydroxymuconic-semialdehyde hydrolase has been purified and shown to be a dimer of 65 kDa made up of apparently identical subunits (Duggleby and Williams, 1986). Harayama et a/. (1 989b)
18
S J ASSINDER AND P A WILLIAMS
have purified 401, which is a tetramer of four identical subunits of only 7.5 kDa, and both 4 0 D and 2-hydroxypent-2,4-dienoatehydratase, which appear to form a complex in uiuo ( M , = 130 kDa), made up of polypeptides of 27 and 28 kDa. Comparison with SDS-PAGE electrophoresis from cloned genes (Harayama and Rekik, 1990) suggest that these are the polypeptides associated with the hydratase and the decarboxylase, respectively. Purified isomerase, decarboxylase and hydratase have served to clarify the exact chemical structures of some of the pathway intermediates as shown in Fig. 2, some of which can exist in two or more isomeric forms. Because the product of the decarboxylase is the unstable enol form, 2-hydroxypent-2,4dienoate, rather than the more stable keto form, 2-oxopent-4-enoate, as had previously been thought, it has been proposed that association of the hydratase and decarboxylase has evolved to channel 2-hydroxypent-2,4dienoate efficiently down the pathway before i t can spontaneously isomerize into non-metabolizable forms (Harayama et ul., 1989b). Kunz et ul. (1981) showed that the ability of strain mt-2 to utilize two amino acids, allylglycine and cis-crotylglycine, as carbon sources was dependent upon the presence of pWW0. Metabolism involved primary oxidation by a chromosomally determined amino-acid dehydrogenase to convert allylglycine to 2-hydroxypent-2,4-dienoate, and crotylglycine to its corresponding methyl analogue, both intermediates on the TOL pathways. These were then further metabolized by the last two enzymes of the TOL pathway, the hydratase and aldolase (Fig. 2). The ability to utilize the two amino acids was, however, hostcell dependent, presumably determined by whether the host cell contained an amino-acid dehydrogenase with the particular specificity which could be recruited. Growth on allylglycine has proved a useful experimental tool. For example, loss of the ability to grow on allylglycine has been used in analysis and screening of strains carrying mutations in the gene for the aldolase (Harayama and Rekik, 1989). 111. Organization of the Catabolic Genes A. MOLECULAR CHARACTERIZATION OF
pwwo
Physical evidence for the presence of covalently closed circular DNA in Ps. putida mt-2 was obtained only after isolation techniques used successfully for
E. coli had been adapted to Pseudomonus spp. A single plasmid of size 78.1 MD was shown to be present by electron microscopy (Duggleby et ul., 1977); the size is now more usually quoted in kilobase pairs, i.e. 117 kbp. The ability to visualize plasmids revealed one unexpected fact. A phenotypically cured strain Paw8 (Mtol- Ptol- Ben') derived from the wild type was found to contain a plasmid, pWW0-8, clearly derived from pWW0 by
T H E TOL PLASMIDS
19
a deletion of about 3 9 k b p (Bayley rt al., 1977). Furthermore, in 10 phenotypically identical strains isolated after grow’th on benzoate, four lacked plasmids as expected, whereas six contained a plasmid indistinguishable from pWW0-8 on restriction-enzyme digestion. This showed that loss of the TOLspecific catabolic phenotype could result either from loss of the complete plasmid o r from precise deletion of a region which was presumed to encode the catabolic genes (Fig. 5). Complete restriction maps for Hind111 and Xhol were
J
117 0 kbp
FIG. 5. Restriction map of TOL plasmid pWW0. The restriction sites for XhoI (inner circle), EcoRI and Hind111 (outer circle) are shown. The restriction fragments are lettered alphabetically in order of decreasing size for each enzyme. The unshaded area below the map shows the extent of the 39 kbp catabolic region which is readily deleted as a result of recombination between the two 1.4 kbp direct repeats (double-headed arrows). The shaded together with the unshaded areas denote the extent of the 56 kbp region found in co-integrates such as pTN2 (Nakazawa et al., 1978) which corresponds with the transposon Tn4651 (Tsuda and Iino, 1987).
20
S. J . ASSINDER A N D P. A. WILLIAMS
obtained for pWW0-8 (Downing ef al., 1979) and for pWWO (Downing and Broda, 1979).The deletion in pWW0-8 was shown to be caused by reciprocal recombination between a pair of homologous sequences of approximately 1.4 kbp directly repeated at the ends of the 39 kbp region (Meulien et a/., I98 I). B. ORGANIZATION OF THE STRUCTURAL XJ’/GENES ON
pwwo
The location of catabolic genes on or near the 39kbp region deleted in formation of pWW0-8 was substantiated by the co-integrate plasmid pTN2, formed by insertion of 56 kbp of pWWO DNA into the broad host-range plasmid RP4 (Nakazawa et af.,1978).In addition to the three drug resistances of RP4 (Tc, Ap, Km), pTN2 carries all of the catabolic genes of pWW0, conferring the ability to grow on the complete range of TOL substrates with regulated enzyme expression. The 56 kbp insert of TOL DNA encompasses the 39 kbp region which is readily deleted upon benzoate selection (Fig. 5). The first model for organization of the catabolic-pathway genes proposed, on the basis of regulatory data, that there existed two distinct operons, one encoding enzymes catalysing conversion of hydrocarbons to carboxylic acids asd a second responsible for further conversion of the carboxylic acids to central metabolites (Worsey el u/., 1978; Section IV). The two operons have by convention been referred to as the upper-puthway operation and the locrier- or rnefu-pathwaji upcvon, respectively. Physical separation of the two operons first became apparent through the analysis of Nakazawa et a/. (1980). The phenotypes of deleted mutant derivatives of pTN2, viewed in conjunction with the restriction maps of pWWO and pWW0-8, indicated that xylB and sjK’were located on a region of the plasmid distinct from that encoding the early meru-pathway genes .u)fDEFC.This was strongly re-inforced by a series of Tn5 insertion mutants which identified two regions in which insertions caused some loss of catabolic function, separated by a segment of DNA of around 14kbp in which insertions had no such effect (Franklin et ul., 1981). Insertions in one of the two regions produced a Mxy- Mtol’ phenotype (defining the location of the upper-pathway operon) whereas, in the second region (the mcva-pathway operon), insertions caused an Mxy - Mtolphenotype (Fig. 5). C. THE UPPER-PATHWAY OPERON
The upper pathway is composed of three enzymes, namely XO, BADH and BZDH. The genes were initially designated as xy/A, xy/B and xy/C, respectively, and localized on pWWO to a region of approximately 8 kbp in size. Their order was established to be xy/CA B by insertion mutagenesis and subcloning (Timmis et a/., 1985; Harayama et al., 1986b) and by cloning xyIB (Inouye c~ta/., 1981a) and .uylC (Lebens and Williams, 1985).
T H E TOL PLASMIDS
21
However, it was found that these three genes make up only about 50% of the available DNA, prompting a search for additional gene products encoded by this region. Cloning of the upper-pathway genes into an expression vector and identification of their products in maxicells of E. d i showed that the operon contains at least five genes in the order qdCMABN (Harayama et a/., 1989a; Fig. 6). The .uylC gene encodes the 57 kDa protein BZDH. The . y d M and . y l A genes encode, respectively, 35 and 40 kDa polypeptides, shown by genetic complementation to be subunits of XO. The structural gene for BADH, .vy/B, encodes a 40 kDa polypeptide. The .uy/N product is a 52 kDa protein, processed to 47 kDa, whose physiological role is as yet unknown. No protein synthesis was detected downstream of .uy/N, implying that this is the last gene of the operon. The operator-promoter at the start of the upper-pathway operon (OPl)was first located by subcloning DNA from pTN9, a derivative of pTN2 in which there had been a large spontaneous deletion of DNA between OPI and .\-?*/E (for C230). This plasmid was thus a natural OPI-xyIE transcriptional fusion, puttingan easily detectable marker gene under the control ofOPl (Nakazawa et a/., 1980). When the lengths of the five upper-pathway genes are estimated from the sizes of their products, most of the DNA between . Y . ~ and C .uy/N can be accounted for, but there exists a region of 1.7 kbp between OP1 and .uylC in which no gene function has been identified. A n ORF has been shown to begin just downstream of OPI (Inouye et u/., 1984b),leading to the suggestion that a small polypeptide is encoded between OPI and .uy/C (Lebens and Williams, 1985). However, polypeptide synthesis was not identified from this region in maxicells (Harayama et ul., 1989a) implying that it encodes either no polypeptide or one present only in a small quantity. In the absence of further data, the function of this 1.7 kbp promoter-proximal region remains unclear. D. THE m e t a - P A r H w A Y OPERON
The first gene of this operon to be cloned was xy/E(for C230) (Franklin et al., 1981; Inouye et a/., 1981a) due to the ease with which its expression can be detected in E. coli or Ps.puridu. Transformant colonies carrying a functional C230 gene will turn bright yellow when sprayed with l O m catechol ~ due to formation of 2-hydroxymuconic semialdehyde. The complete operon was cloned as a functional unit by ligating together two adjacent Sstl fragments of pWW0 in the broad-range vector pKT23 1 (Franklin et a/., 1981).The resulting recombinant plasmid supported growth of the host Pseudomonus sp. on mtoluate, demonstrating the presence and regulated expression of all of the metu-pat hwa y enzymes. Transposon mutagenesis analysis of the cloned meta pathway initially established the gene order as .uy/DLEGFJIH (Harayama et a/., 1984),located
28 12
57 2039) ( 36 w2
35 40 40 52
57
kDa OPI ORF
28 29 60 341 4239 I 8 36
*c __f
I
U U I E E l xyl
C
M
A
B
N
64
-00 X
Y
Z L T E
G
F J Q K I H
S
R
HinQI XhoI Barn1 SmaI
EmRI
SStI
0
5
I
1
10 kbp I
FIG. 6. Organization of the xyl genes on TOL plasmid pWW0. The linearized map corresponds roughly to the 39 kbp region shown in Fig. 5. Restriction sites are shown for the six enzymes HindIII, XhoI, BumH1, SmaI, EcoRI and SstI. Gene designations are as detailed in Fig. 2, with the addition of .uylN, xyIQ and xyIT which encode polypeptides of unknown function, and the two regulatory genes xylS and .uylR. OP1 and OP2 are the operator-promoter regions of the upper- and metu-pathway operons, respectively, and ORF represents a possible open-reading frame of unknown function at the start of the upper-pathway operon. The sizes of the gene products in kDa are shown. The directions of transcription are indicated by the arrows. The diagram was adapted from Williams et al. (1988b). Data on locations of the upper- and meta-pathway genes were taken from Harayama et al. (1989a) and Harayama and Rekik (1990b), respectively.
THE TOL PLASMIDS
23
downstream of what has been interpreted as either a single operatorpromoter region OP2 (Inouye et ul., 1984a) or a regulatory region containing two overlapping promoters (Mermod rt ul., 1984; Section IV). Subsequent analysis involving identification of the metu-pathway gene products in maxicells of E. co/i has shown that the genetic organization is more complex. The operon contains 13 genes in the order q L Y Y Z L T E G F J Q K I H (Harayama and Rekik, 1989, 1990; Fig. 6). The first three genes, .uyIXYZ (formerly xylD), encode different subunits of toluate 1,2-dioxygenase of sizes 57,20 and 38 kDa, respectively. The s ~ d LE, , G, F, J , K, I and H genes encode, 1-carboxyla te dehydrogenase respectively, 1,2-dihydroxy-3,5-cyclohexadiene(28 kDa), C230 (35 kDa), HMSD (60 kDa), HMSH (34 kDa), 2-hydroxypent2,4-dienoate hydratase (28 kDa), 4-hydroxy-2-oxovalerate aldolase (39 kDa), 4 0 D (29 kDa) and 401 (7.5 kDa). Two new genes, s y I T and .Y,IVQ, were identified, encoding polypeptides of 12 and 42 kDa, respectively; the functions of these gene products remain to be determined. The mPtu-pathway operon extends overa region of 10 kbp, with most of the DNA between .YJy/Xand sjVH consisting of coding sequence. E. REGULATORY GENES
Two regulatory genes, q , I S and .uj?lR,are associated with the TOL catabolic genes on pWW0 (Worsey rt af.,1978). These are located at the downstream end of the nieta-pathway operon with s , i S being adjacent to .YJ,/H(Fig. 6). Transcription of . Y J ~ R is in the same direction as the nwtu-pathway operon, whereas that of sy/S is in the opposite direction (Spooner et a/., 1986). The functional analysis of the TOL regulatory genes is considered in detail in Section IV. IV. Regulation of Catabolic Genes The route of aromatic catabolism adopted by strains of TOL' Ps. putidu with the dual genetic capability to dissimilate catechol via both orfho and nzetu cleavage is governed by the different regulatory mechanisms of the two pathways. In both pathways, the first two steps oxidize benzoate to catechol, but thereafter the pathways diverge (Fig. 1). Expression of chromosomal pketoadipate-pathway enzymes depends upon the conversion of catechol by basal levels of C120 to cis, cis-muconate, its product inducer (Ornston and Stanier, 1966; Feist and Hegeman, 1969). In contrast, the plasmid-coded enzyme C230 which initiates the metu pathway is induced by benzoate itself (Murray c ~ u/., t 1972; Worsey and Williams, 1977).During growth on benzoate, the nwtu pathway is thus fully induced and will rapidly metabolize any
24
S J ASSINDER AND P A. WILLIAMS
catechol formed, preventing formation of ciwis-muconate, which is necessary for ortho-pathway induction. Therefore, in a strain in which the genetic information for both pathways is present simultaneously, benzoate is preferentially degraded by the plasmid-coded mrta pathway. Expression of the structural genes on TOL plasmid pWWO is controlled by two positively acting regulatory proteins encoded by the sylR and .uq'lS genes, located adjacent to the meta-pathway operon (Fig. 6).Evidence for the precise role of these regulatory products in gene expression comes both from physiological analysis of regulatory mutants and from cloning, sequencing and in tlifro mutagenesis of the regulatory genes and the operator-promoter regions of the upper- and meta-pathway operons. A. PHYSIOLOGICAL STUDIES OF REGULATORY MUTANTS
Expression of both TOL operons is induced by the upper-pathway substrates toluene and m-xylene and by their respective alcohol metabolites, whereas benzoate and m-toluate induce only the meta-pathway operon (Worsey and Williams, 1977; Worsey et d., 1978).Analysis of non-inducible mutant strains (Worsey et NI., 1978) and of some plasmid deletion mutants isolated through benzoate curing (Worsey and Williams, 1977; Section VI) led to the initial proposition that two positive regulatory molecules are involved in gene expression, one of which (XylR, the .uylR gene product) interacts with hydrocarbon substrates and their alcohol metabolites while the other (XylS, the XJISgene product) interacts with the carboxylic acid catabolites (Worsey rt a/., 1978).XylR was presumed to participate in regulation of both structural gene operons, thus accounting for induction of meta-pathway enzymes by upper-pathway substrates, whereas XylS was involved in expression of the metu pathway only (Fig. 7). Direct evidence for positive regulation by XylR was obtained through construction of a strain partially diploid for the TOL genes (Franklin and Williams, 1980).This contained an RP4:TOL co-integrate plasmid defective for xy/A (encoding xylene oxidase) together with a .KJIR- derivative of pWWO carrying the resistance transposon Tn40l. The double-plasmid strain contained induced levels of xylene oxidase when grown in the presence of mxylene, showing that xylR+ is transdominant to .uylR- and that its gene product is a positive regulator of the upper-pathway operon. The same conclusion was reached by Nakazawa et ul. (1980) using a similar experimental rationale. Evidence for positive regulation of the meta-pathway operon by XylS was obtained by cloning from pTN2 into an E. coli vector the 9.5 kbp fragment SstI-D (Fig. 5) carrying xyIDEFG (Inouye rt d., 1981b). The enzymes were inducible in E. coli in the presence of m-toluate or benzoate only when a
25
THE TOL PLASMIDS
-
Hydrocarbons Alcohols
/
-Acids-
LZY pathway
I
pothwoy
I
[
1
1 xylS
I
I
r- 1 xylR
FIG. 7. Early model for regulation of the xyl genes on pWW0. A regulator molecule encoded by xylR combines with the hydrocarbon and alcohol growth substrates to induce both the upper- and meta-pathway enzymes. The product of a second gene, .uylS, interacts with the carboxylic acids to induce the meta pathway only.
3.2 kbp PstI fragment, also derived from the TOL region of pWW0, was provided either cis or rrans. This fragment was presumed to carry the xylS gene, producing a positive regulator molecule activated by the carboxylic-acid co-inducers but not by m-xylene or m-methylbenzyl alcohol. Subsequent refinement of the model with respect to the relationship between xylR and xylS arose from studies involving Tn.5 transposon regulatory mutants of pWWO (Franklin er al., 1983). As expected, xyIB (encoding benzyl-alcohol dehydrogenase) was induced by m-methylbenzyl alcohol in a xyIS- mutant, but not in a xy1R- mutant, whereas xylE (for catechol2.3-oxygenase) was induced by m-toluate in a xylR- mutant but not in a x y f S - mutant. Unexpectedly, however, xylE was not induced by mmethylbenzyl alcohol in x y K mutants. It appears that induction of the mefa pathway by XylR has an absolute requirement for the presence of a functional xylS gene, suggesting that some interaction of these regulatory components is involved. Confirmation of this hypothesis was provided by molecular cloning ofxyfR and the demonstration that XylR is not effective as an activator of the meta-pathway operon unless a n additional fragment containing x y f S is also provided (Inouye et al., 1983). B. MOLECULAR ANALYSIS OF
TOL
REGULATORY GENES
Initial localization of the regulatory genes on pWWO relied on mapping of Tn5 insertion mutants of xylS and xylR within a 1.5-3.0 kbp region of the plasmid downstream of the gene cluster for mera-cleavage enzymes (Franklin et al., 1983). An a priori requirement for cloning and functional analysis of
26
S J ASSINUER A N D P A WILLIAMS
regulatory genes is a system whereby the activities of such genes may be detected and quantified. A suitable rationale was devised by Inouye et a/. (1981b, 1983) employing the s y l E gene product, C230. Plasmids were constructed containing the operator-promoter regions of the upper and lower operons, OP1 and OP2, respectively, located upstream of the cloned xy1E gene. Fragments of DNA presumed to contain xy/R and/or xy/S were inserted truns on a compatible vector, and the activity of C230 monitored in the presence of a suitable inducer. Subsequent analysis by subcloning (Inouye et al., 1983)and transposon mutagenesis (Spooner rt u/., 1986)showed that sy/R and .uy/Sare divergently transcribed within the 6.4 kbp XhoI-D fragment of pWWO(Fig. 6). Both the .uy/S and .uylR genes have been sequenced and their products identified using the maxicell system of E. coli. Sequencing of DNA of the S J ~ S gene revealed an open-reading frame of 963 bp, corresponding to a protein with an M, of 36502Da (Inouye rt ul., 1986b; Spooner P I al., 1986). Visualization of XylS in maxicells required over-expression in tuc' (Inouye et ul., 1986b; Spooner rt al., 1987) or lambda P, (Mermod et al., 1987) promoter expression vectors, resulting in identifications polypeptides of 36 and 33 kDa, respectively. The G + C content of the coding region is 53% (Inouye ul., 1986b) with a significant use of rare codons, possibly contributing to its poor expression in E. coli (Spooner et al., 1987). The predicted amino-acid sequence shows an excess ( + 15) of basic over acidic amino-acid residues, as might be expected for a DNA-binding protein. Cells of E. coli carrying a cloned xylR gene produce a polypeptide of approximately 67 kDa (Inouye et al., 1985; Spooner "t ul., 1986). This is consistent with the observed open-reading frame of 1698 bp. encoding a 566 amino-acid polypeptide (M,= 63.741 kDa). The G + C content of the coding region is 58% which iscloser to that ofthechromosome in P.s.putidu(60-63Y0) than to that of the chromosome in E. coli (50-51%) (Normore, 1976). The codon usage in .ujVR is similar to that of.ry/E which shows preferential usage of G and C in the third position (Nakai et al., 1983b). C. STRUCTURE OF
TOL
PLASMID PROMOTERS
A consideration of the structure of the promoter sequences in pseudomonads involved in degradation of toluene to central metabolites encompasses four main elements. These are upper- and meta-pathway operon promoters and promoters of the two regulatory genes .K.vISand .uylR. There is currently some confusion in the literature as regards the relevant terminology; the upperpathway promoter is known both as OP1 and Pu, and the metu-pathway promoter as both OP2 and Pm. For the purposes of this review, we will use the notation OP1 and OP2 when referring to the upper- and meta-operon promoters, respectively, and Ps and Pr for promoters of .uylS and .uylR. All
THE TOL PLASMIDS
27
four promoters have been cloned, sequenced and the transcriptional startpoints determined by S 1 nuclease and/or reverse transcriptase mapping. Sequence comparisons have yielded important information pertaining to the respective roles of the various promoter regions in gene expression. The .uvlRgene is expressed constitutively with transcription in both E. coli and Ps. puticlu initiating at two sites separated by 30 bp (Inouye rt d., 1985). Consensus sequences resembling those of E. coli promoters (Raibaud and Schwartz, 1984) are found in the - 10 and -35 regions preceding both transcription-initiation sites (Fig. 8a). Promoters conforming to this pattern are known to be recognized by the major RNA polymerase from E. coli containing the sigma factor 0” (Reznikoff rt ul., 1985).Although the amounts of . y / R transcript do not differ significantly in E. coli and Ps. putidu, the activity of C230 synthesized under the control of the syIR promoter in E. co/i is only 20% of that observed in Ps. putidu (Inouye et ul., 1985).The difference may be ascribed to the low stability of the mRNA or to its poor efficiency of translation in E. coli. Mutants of P. putidu have been isolated which express the rnrtu-pathway enzymes constitutively and their promoter sequences have been characterized (Mermod rt u/., 1984). Similarly, Inouye rt ul. ( 1986a) examined the promoter region of pTN8, a mutant derivative of an RP4:TOL co-integrate plasmid which confers constitutive high expression of the rrretu-pathway enzymes. Three transcription start sites were identified and the nucleotide sequence preceding each of these was determined. On the basis of their own analysis and that of Mermod et al. (1984), Inouye P I uI. (1986a) proposed a concensus sequence for constitutive pronioters from Pseudomonus sp. This contains a sequence similar to the - 10 region of promoters from E. c d i and is not present in the promoter regions of inducible operons (Fig. 8a). Whereas transcription from Pr is constitutive, expression from the other three promoters is subject to complex regulatory constraints. There are no consensus promoter sequences as in E. coli in the -35 and - 10 regions preceding the transcription-initiation sites of the regulated catabolic promoters. However, a striking degree of homology has been reported between the upstream regions of OPI and Ps and the concensus sequences of nitrogen-regulated (ntr)and nitrogen-fixation ( n i f )promoters (Dixon, 1984; Johnston and Downie, 1984). Comparison of the sequences of the two TOL promoters with that of the nifLA promoter of Klehsieliu pneumoniur (Drummond et ul., 1983; Ow and Ausubel, 1983) has revealed substantial homology in the - 24 (TGGC) and - 12 (TTGC) regions (Fig. 8b; Ramos rt ul., I987a). Inouye et ul. (1984a) found a single transcription-initiation site for the metu-pathway operon in both E. coliand Ps.putidu. The promoter (designated OP2) exhibits some homology with Ps and OPI in the -24 region but there is
28
S.J. ASSINDER AND P. A. WILLIAMS
(4 ConmtYutiva promoter.: Eachuichia coli oonaonnun:
-35 TTGACA
-10
TATAAT
1
AGG~ATTTCAGTTGTCGTTGGT~CTTTCAGGA 1 CTTKAGGACCACCT Z~GCAAATGC~GTGGCAGA 1 CGACTCCACTTGAACGTGTTGTOGTACCA~CT 1 TGTGGTACCATTTGCT~T~AAECTZC~GGTCA v TTAAAACTATAAAGCT~CT~T~AZ~CE 1 T~AAGCGGATACAGGTECAZLLGGCTA v GAAGCGGATACAGGAGTGTAAAAAATGGCTATCTCTA 1
Rl R Z
pTNEP1 pTNEP2 pTNEP3 pNM74 pNM77
CAATAT~AAATAC~C~CTCEAGT~TAAAT
mhR
-
heudomonar sp. conseneus:
(bl Rmgulated promotorn:
-11 -13 I AA--AAATGGTAAATAT
-24
TGGC
nr/nilconsenrus:
-12
TTGC
1
PI
--TTCTTZAAAGAACG~ETTCGTTCTGCTTGGCGTTATTTTTGCTTGGAMAGTGG
~ P I
GATGAETAA~GGGATEGGTATAAGCAATGGCA~GCCGGCGG~CTAGCTATACGAGA
PI.
TCAATGTTTCTGCACATCACGCCGAT~G~CGCACGGT~CATGGTTATCACC 1
--
1
fieudomonaa sp. conseneus: -45
AA-AAG----TC
-24 TGGC-T
-12 TTGCT-G
l*
K:}
GGAGTGCAAAAAATGGCTATCTCTAGAAA~~~ACCCCTTAGGCTTATGCAACAGA
Pm,
TCTAGAAAGGCCTACCCC-CTTTATGCAACAGAAACAAATAATGGA
v
FIG. 8. (a) Alignment of constitutive promoters of Pseudomonasputida. Pr, and Pr, are promoters of xylR (Inouye et ul., 1984a); pTN8-Pl; pTN8-P2 and pTN8-P3 are promoters from the mutant RP4::TOL co-integrate pTN8 which expresses the meta pathway constitutively (Inouye et al., 1986a);pNM74-P and pNM77-P are promoters of constitutive mutants of the meta-pathway operon (Mermod et ul., 1984);nahR is the promoter of the regulatory gene involved in naphthalene degradation on plasmid NAH7 (Schell, 1986).Sequences resembling the - 10 and - 35 consensus sequences in Escherichia coli are underlined. Regions of homology between the eight promoters are overlined and a consensus sequence for constitutive promoters in Pseudomonasputida is derived (Inouye et al., 1986a).(b) Alignment of the promoters of the pWW0 upperpathway operon (OP1; Inouye et al., 1984a), the xylS gene (Ps;Inouye et al., 1986b; Spooner et a/., 1986) and the NifA or NtrC plus NtrA-regulated nifLA operon of Klebsiella pneumoniue (Pla; Drummond et al., 1983).Sequences showing homology to the ntrlnif - 12 and -24 consensus sequences are underlined. Regions of homology between OP1 and Ps are overlined and consensus sequences derived from the two operons in the -12, -24 and -45 regions are given. The sequence of the merapathway operon (OP2; Inouye et al., 198413; Pm,; Mermod et al., 1984) is given and a region of homology to OP1 and Ps in the -24 region overlined. The sequence of a second overlapping meta-operon promoter is also shown (Mermod et al., 1984) and sequences resembling the - 10 and -35 consensus sequences in Esrherichia coli underlined. The main transcription-initiation sites are indicated by vertical arrows; alternative sites identified for OP2 are designated by asterisks.
29
THE TOL PLASMIDS
little similarity elsewhere in the sequence (Fig. 8b). This promoter was also reported by Mermod et ul. (1984) (and designated Pm,)but two additional transcriptional start-points were identified. They also found a second overlapping promoter region (Prn,)containing sequences with some similarity to the - 10 and -35 consensus sequences in E. coli (Fig. 8b). The absence of significant homology between OP2 and the OP1 and Ps promoters is presumably a reflection of its distinct functional role, since it is the only one out of the three promoters which is not activated by the XylR regulatory protein. D. A MODEL FOR GENE REGULATION ON
pwwo
The current model for the regulatory action of XylR and XylS has evolved through a consideration of a diversity of lines of experimental evidence. I t has increased considerably in complexity from the original model proposed by Worsey et ul. (1978), although this remains substantially correct. The system has as its key element expression of q d R , and is believed to involve a regulatory cascade hingeing on the ability of XylR to interact with both the OP1 and Ps promoter sequences (Fig. 9). The primary product of .uylR is an inactive or inefficient protein which becomes activated in the presence of upper-pathway substrates. It then stimulates transcription both of the genes Benzoate
I
.,
Toluene
FIG. 9. Regulatory circuits controlling expression of xyl genes in Pseudomonasputida growing on m-toluate and m-xylene. Symbols: 0, an inactive form of XylR unable (or only able inefficiently) to stimulate transcription from OP1 Pu and Ps; an active form of XylR which with RpoN stimulates transcription from OP1 Pu and Ps;0, an inactive form of XylS which at low concentration does not stimulate transcription from OP2 Pm; A, an active form of XylS which stimulatestranscription from OP2 Pm.
Solid and broken arrows indicate positive and negative control, respectively. Adapted from Ramos e / ul. (1987a).
30
S J ASSINDER A N D P A WILLIAMS
for the upper-pathway enzymes from the OPI promoter and of the xylS gene from Ps.The XylS regulatory protein so produced interacts in turn with OP2, thus leading to simultaneous co-induction of the upper and metu pathways. Fine tuning of the system appears to be achieved through autogenous repression of xylR expression (Inouye et al., 1987a). A direct effect of XylR on .uylS transcription has been demonstrated by Ramos et ul. (1987a) who found an increase in the amount of .uylS mRNA produced in the presence of m-xylene; this was dependent upon the host E. coli or Ps.putidu strain possessing a functional xylR gene. Similarly, Inouye at ul. ( 1 987a) constructed a series of vectors comprising the .uylS promoter cloned upstream of the .uyIEgene, and found that a functional .uylR gene was essential for induction of C230 activity by m-xylene. Monitoring of,uylS transcripts by primer extension (Inouye et al., 1987a)confirmed that control of .uylS by xylR occurs at the level of transcription. It is suggested (Ramos et ul., 1987a) that coinduction of the upper- and metu-pathway operons by upper-pathway substrates eliminates the possibility of a transient block occurring in the flow of metabolites, with concomitant loss from the cell of accumulated carboxylic acids. In contrast, the .uylS gene is expressedat a low basal level. Binding of metupathway substrates is presumed to result in a conformational change in the primary inactive XylS regulator molecule and its conversion to a form capable of stimulating mrtu-operon transcription by binding to OP2. Evidence for a direct and specific binding of m-toluate to XylS is provided by isolation of mutants exhibiting altered inducer specificity (Ramos et a/., 1986). The role of sylS has been further clarified by experiments involving overproduction of the XylS regulatory protein by cloning the gene under the transcriptional control of a strong promoter from E. coli (Inouye et ul., 1987b; Spooner et ul., 1987). This elicited high constitutive expression of the n7etupathway operon in the absence of any known inducer. I t is suggested that over-expression increases the cellular concentration of a small fraction of active XylS regulator molecules that normally co-exists in equilibrium with an inactive form. The requirement for m-toluate, the role of which, in uiuo, is to displace this equilibrium in favour of the active regulator, is circumvented as a consequence of hyperproduction of the XylS protein. The XylR protein exhibits a very broad effector specificity, recognizing as inducers not only pathway substrates but also p-chlorobenzaldehyde and a wide variety of mono- and di-substituted methyl-, ethyl- and chloro-toluenes and benzyl alcohols (Abril et ul., 1989).The xylSgene product interacts with a narrower spectrum of effectors; for example, it will not recognize 4ethylbenzoate, a fact which has been successfully exploited in isolation ofsylS mutants exhibiting altered substrate specificities (Ramos et ul., 1986; Section VII).
31
THE TOL PLASMIDS
There is some evidence for involvement of additional elements in the TOL regulatory system. Transposon mutagenesis of the xylS gene in pWWO eliminated induction of the lower pathway by rn-toluate or rn-methylbenzyl alcohol but not by unsubstituted compounds such as benzoate and benzyl alcohol (Franklin r t ul., 1983). Furthermore, Ps.putidu transformed with a plasmid carrying an OP~-.Y.VIE fusion expressed elevated levels of C230 after addition of benzoate in the absence of known TOL plasmid regulatory genes (Cuskey and Sprenkle, 1988).Induction was not observed in an E. coli host or in a mutant of Ps.puticia lacking chromosomally encoded benzoate catabolic functions. Therefore, i t is suggested that a gene exists o n the chromosome in Ps.putidu whose product is normally involved in regulating expression of the chromosomal benzoate dioxygenase gene but which can also interact with benzoate to promote induction of the nletu operon. The exact nature of this interaction is unclear; there is evidence for the existence of a specific promoter in Ps. putidu upstream of the . y l E gene of pWWO which is stimulated by a chromosomal regulatory element in this bacterium with benzoate acting as a co-inducer (F. C. H. Franklin, personal communication). Similar specific promoter regions were identified by Keil rf al. (1987b) upstream of the syIL and sylE genes on the co-integrate TOL plasmid pWW53-4. However, these allowed only low constitutive expression, and enzyme levels were unaffected by the presence of any inducers, including benzoate. E. INVOLVEMENT OF
RpON
IN
TOL
REGULATION
As already discussed, both OPI and Ps exhibit strong homology with promoters of ntr and nifgenes (Dixon, 1986).Transcription of ntr operons in enterobacteria is controlled by a system involving the product of the regulatory gene ntrC, whereas expression of most nifoperons requires the nil' specific regulatory gene nifA (Dixon, 1986). Both systems are dependent upon the rpoN ( n t r A ) gene whose product (RpoN) acts as a specific sigma factor (d4) for transcription initiation (Ow and Ausubel, 1983; Merrick and Stewart, 1985). The mechanism proposed for activation of ntr/n(f promoters involves recognition of the - 12 (TTGC) and -24 (TGGC) regions by oS4-RNA polymerase coupled with interaction of NtrC and NifA with either the promoter sequence or the RNA polymerase to initiate transcription (Reitzer and Magasanik, 1986). It has been shown that transcription of the xyICAB operon from OPI in E. coli is activated by the regulatory genes ntrC and nfA in addition to .ujdR (Dixon, 1986). In all instances activation is dependent upon the presence of a functional rpoN gene. This suggests that XylR-mediated induction of the upper pathway involves the RpoN product. Involvement of RpoN in induction of XylS by XylR has also been demonstrated (Ramos et ul., 1987a)
32
S.J. ASSINDER A N D P. A. WILLIAMS
using an assay system comprising an OP2:lacZ fusion vector with a second plasmid carrying xylS and .uylR trans. Induction of P-galactosidase mediated by m-xylene was observed in an RpoN' E. coli host but not in an RpoNbackground, whereas m-toluate induction via OP2 was independent of RpoN. Quantitative analysis of the xylS transcript in both RpoN' and RpoN- E. mli hosts confirmed that m-xylene induction of the meta operon involves an increase in transcription of .uylS which requires a functional rpoN gene. The basal level (sylR-independent) expression of .uyICAB and xylS is also dependent on RpoN (Ramos et al., 1987a). Alignment of the amino-acid sequence of XylR with those of the NtrC and NifA proteins from K . pneumoniae shows clear homology except for the Nterminal regions (Inouye et al., 1988; Fig. 10).The similarities are particularly striking in the central region of XylR (amino-acid residues 234473) which corresponds to the regions of the other two regulators proposed to interact with the RpoN-containing RNA polymerase (Drummond et al., 1986). The Cterminal region (amino-acid residues 5 15-558) contains non-polar residues and a DNA-binding motif in all three proteins (Pabo and Sauer, 1984). The lack of homology in the N-terminal regions suggests that this determines functions specific to XylR, in particular the binding of an aromatic hydrocarbon inducer. Although NtrC and NifA can substitute for XylR in regulation of expression from OP1 and Ps, XylR plus RpoN cannot substitute for either NtrC or NifA in stimulating transcription from the nifLA promoter (Dixon, 1986).This suggests that XylR-regulated promoters should exhibit a region of similarity not found for the nifLA promoter. There is substantial homology in A Xyl R
0 2101 211 ] 229
I
I
234
D
473
229i
E NtrC
C
I
515 558
566
1181 1:2k81 120 1139 139 I 138
378 3781
426 26 469 469
182 1821 185 211 203
449
477 524 520
F NifA
I22 22
L
1
FIG. 10. Region relationships between XylR, NtrC and NifA proteins. Solid bars indicate the polypeptides of Pseudornonas putida XylR, Klebsiella pneurnoniae NtrC and NifA, respectively. Homologous sequences among the three proteins are boxed and denoted as regions B, C and D. The sequence in region E of NtrC is homologous to the stress-responding proteins, and the sequence in region F of NifA is common to NifA of Klebsiella pneurnoniae and Rhizobium rneliloti. Redrawn from Inouye et al. (1988).
33
THE TOL PLASMIDS
the -45 regions of OP1 and Ps suggesting one possiblecandidate for the XylR binding site (Fig. 8b; Ramos et a/., 1987a). Deletion analysis of the upstream region of .vyICAB has also revealed a region between - 133 and - I74 which is required for efficient XylR-mediated transcription in response to m-xylene (Nakazawa et al., 1990; Fig. 11). This is presumed to be analogous to the upstream activator sequence required for NifA-mediated activation of nif promoters; this consists of a region of DNA with two-fold rotational symmetry located 10C150 bp upstream from the start of transcription (Buck rt al., 1986). It is suggested that the action of XylR leads to formation of a loop in the DNA resulting in the juxtaposition of the upstream activator sequence and OP1. The upstream region of xylS also exhibits significant sequence homology to .vjKAB around the region of the upstream activator sequence. The rpoN gene in Ps. putida has been cloned (Kohler rt u/., 1989) and sequenced (Inouye ef al., 1989). The cloned gene complemented an RpoN- E. coli mutant with respect to the XylR-mediated activation of an O P l - q E fusion gene in response to m-xylene. The predicted amino-acid sequence (497 residues; M,= 56.215 kDa) is highly homologous to RpoN proteins from Azotohuctrr vinelmdii, K. pnrunzoniae and Rhizohium mrliloti. Conserved regions were identified similar to other prokaryotic sigma factors and to the N-terminus of the 8' subunit of the RNA polymerase (RpoC) from E. coli. These regions have been suggested previously to play a role in a protein-protein interaction between RpoN and core RNA polymeraseand/or activator molecules (Merrick et a/., 1987). The RpoN protein was first identified in E. coli on the basis of its involvement in expression of nitrogen regulons, but it is now believed to have a more global role. In addition to the XylR-mediated activation of genes in P.v.puiitlu, physiological functions known to depend on the rpoN gene include: (a) formation of pilin in Ps. urruginosu (Ishimoto and Lory, 1989) and SJ+/
-
xy/S
-
UASZ
UAS 3
xylCAB
n
UASl
-132
TCGCTGCCTTGATCAAATCGACAGGTGGTTATG--------CGCGATTGATGATTTG I I I I I I I I I IIIIIII II I I I I I I I I I TCTGCCACTTTAGCATTTGCTTAGGTGGTCCTGAAAGATTAACCAATTGATTAACTG
a mRNA2
t '
mRNAl
-136
- - -21
+1
-12
-103
bp
ATGGCATGGCGGTTGCTAGCTATACGAGA
-108
bp
TTGGCGTTATTTTTGCTTGGAAAAGTGG
Ill1 I
I I I I I I
I I
I
+l
FIG. 11. Upstream activator sequences (UAS1, UAS2, UAS3) and the promoters ( - 24, - 12) of .qJCMABNand .rjdS. Nucleotides are numbered from the transcription start sites. Inverted repeats are indicated by horizontal arrows and homologous bases are joined by lines. mRNAl and mRNA2 represent transcriptional start sites of xylR. Redrawn from Nakazawa rt a!. (1990).
34
S. 1. ASSINDER A N D
P.A. WILLIAMS
expression in uitro of flagellar genes in Cuulohacter crescentus (Nifa et ul., 1989); (b) diverse metabolic activities including hydrogen oxidation and denitrification in Alcaligenes eutrophus and Ps.,fucilis (Rommermann et ul., 1989); (c) DctD-mediated activation of C,-dicarboxylic-acid transport gene c k t A in R . rneliloti(Ronson et ul., 1987);and (d)expression of the&M‘gene in E. coli encoding anaerobically inducible formate hydrogenlyase (Birkman et a/., 1987). The diverse role of RpoN in Ps. puridu was demonstrated in a RpoNmutant strain isolated by replacement of the intact chromosomal rpoN gene with one disrupted by in uitro insertion mutagenesis (Kohler et ul., 1989).The mutant was unable to utilize nitrate or urea as a nitrogen source, nor C,dicarboxylic acids (succinate, fumarate) or a-ketoglutarate as sources of carbon; uncharged amino acids could be used neither as a carbon nor as a nitrogen source. The mutant was non-motile and of different colony morphology to the wild type, suggesting that alterations of cell-surface components had affected production of flagella. Although it is far from clear why q d R , ntrC, n$4, dcrD and possibly a substantial number of other genes have evolved to use RpoN for their transcription, a link between at least some of them is that they play a part in bacterial response to a nutrient-poor environment. The ntr/n(j’system comes into play under conditions of limiting nitrogen source; xylR and dcrD are operative when the carbon source is restricted to aromatic hydrocarbons/alcohols and dicarboxylic acids, respectively. Further investigation is needed to evaluate fully the significance of those features shown to be RpoN dependent to the overall regulatory network in Ps.putidu. V. Recombination and Transposition A. IN
pwwo
During an investigation into segregational instability of the TOL plasmid from strain mt-2 in Ps.ueruginosu PAO, White and Dunn (1977) noticed that transfer of a compatible R plasmid, R91, into the TOL’ Ps.ueruginosu gave rise to some transconjugants in which the catabolic phenotype had been stabilized. Although the plasmid DNA was not physically characterized, genetic evidence (conjugational co-transfer and co-transduction) indicated that stabilization was the result of fusion of the two plasmids to form a recombinant plasmid pND3 carrying both the carbenicillin resistance gene from R91 and the full catabolic phenotype of TOL. This was later confirmed when pND3 DNA was isolated (Lehrbach et ul., 1982). I t is of interest that pND3 retained the IncP9 incompatibility of the TOL plasmid (Austen and Dunn, 1977; White and Dunn, 1978) whereas subsequent examples of R p1asmid::TOL co-integrates have the incompatibility of only the R plasmid.
THE TOL PLASMIDS
35
Nakazawa ~t a/. (1978) and Chakrabarty rt a/. (1978) isolated co-integrate plasmids from TOL and RP4 by using the R plasmid to stabilize segregational instability of the TOL plasmid in Ps. ueruginosu at 42°C (Nakazawa, 1978). Both co-integrates contained a TOL insert of the same size (56 kbp) although the sites of insertion in RP4 differed; in one the tetracycline-resistance gene was no longer functional, presumably because of insertional inactivation by the TOL DNA (Chakrabarty et a/., 1978). The TOL genes could also be translocated from RP4 onto a resistance plasmid R702 in a manner which resembled transposition (Chakrabarty e t a/., 1978). Using a different procedure, Jacoby ei af. (1978) also isolated an RP4:TOL co-integrate in which the Tc' gene had been inactivated and from which further transposition of the TOL genes was possible. Some doubt was cast on the possibility that these results could be explained by transposition rather than legitimate recombination when the inserts in eight independently isolated R:TOL co-integrates were accurately mapped (Lehrbach r t d . , 1982).Although there wereclear similarities(forexamp1e four had indistinguishable 69 kbp inserts and two had the same 56 kbp insert), the TOL inserts were not identical (Fig. 12a). Either their ,formation was not by transposition or else the mechanism of transposition was unusual and did not involve a unique segment of TOL DNA. The largest of the TOL inserts was 104 kbp found in the R91 co-integrate pND3 (White and Dunn, 1977).It seems likely that the reason that only pND3 retains IncP9 incompatibility is that its insert is sufficiently large to incorporate the incompatibility determinants of TOL. Recombination between TOL DNA and chromosomal DNA has been observed. WR21 I is a transconjugant resulting from conjugational transfer of pWW0 into P.seuilot,nionassp. B13 (Reineke and Knackmuss, 1979; see Section Vlll). The xji genes in WR21 1 were clearly not in its plasmid, which was identical to the cryptic deletion derivative pWW0-8, and were inferred to be integrated into its chromosome (Jeenes et ul., 1982). Rescue of the genes from the chromosome as an R::TOL plasmid was achieved by: (a) transfer into WR211 of an IncP9 R plasmid to expel the pWWO-8-like plasmid: (b) use of the R + transconjugant as a donor in a mating selecting for transfer of Mtol' (Jeenes and Williams, 1982). The DNA inserted into the R plasmid as a result of this procedure was identical to the 56 kbp insert of pTN2 (Nakazawa et a/., 1978)but had acquired a 3kbp insert of unknown origin within the s y / genes which blocked expression of the upper pathway and thus conferred an Mxy - phenotype. It is interesting to compare these results with those obtained using Ps. putidu MW 1000. This independently isolated strain contains chromosomally located
36
S. J. ASSINDER A N D P. A. WILLIAMS
11710 kbp
(Tn4653) tnpA
I
THE TOL PLASMIDS
37
TOL genes, but Sinclair et al. (1987) demonstrated that recombination could occur between the TOL genes and a resident R plasmid to produce an R::TOL co-integrate containing 56 kbp of TOL DNA almost identical to the same region found in pWW0. Of direct relevance to the following discussion is that growth of Psrudonionas sp. containing the R::TOL plasmids on benzoate (Jeenes and Williams, 1982; Sinclair rf al., 1987) resulted in loss of the Mtol' phenotype due t o deletion of the same 39 kbp region (as well as, in the case of the plasmids formed from WR211, their 3 kbp insert) as occurs in formation of pWW0-8 from pWWO (Bayley er uf.,1977; see Section Ill). The resulting plasmids thus no longer conferred the ability to grow on any of the TOL substrates, yet contained a 17 kbp insert of pWWO DNA resulting from deletion of the 39 kbp catabolic region from the 56 kbp insert, The identical I7 kbp appeared in other experiments. Hybridization between pWWO restriction fragments and chromosomal DNA from benzoate-cured derivatives of Ps. putidu mt-2 showed that some of them contained either one or two copies of this region in their chromosomes (Meulien and Broda, 1982). The most likely explanations are either that the 56 kbp TOL DNA had at some stage been integrated into the chromosome but that deletion of the 39 kbp catabolic region had occurred leaving the residual 17 kbp, or alternatively that the 17 kbp region had been formed on a plasmid as a result of deletion of the 39 kbp catabolic region and had thence translocated into the chromosome. I t appears that this 17 kbp can act in the same way as a transposon. Whilst investigating plasmid pWW60-I, which determines naphthalene catabolism, spontaneous mutants with altered naphthalene catabolism were found when pWW60-I was maintained in a PaW340, a plasmid-free derivative of strain mt-2 (Cane and Williams, 1982).Some of these mutants resulted from insertion into pWW60-1 of the same 17 kbp of pWWO DNA; it was assumed that this had translocated by recombination or transposition from the chromosome where it must have resided as in the strains examined by Meulien and Broda (1982). Definitive proof that most of the recombination events described are the result of transposition has been obtained by Tsuda and Iino ( 1 987,1988).They confirmed that both the 56 kbp region, encompassing the complete catabolic genes, and the residual 17kbp region, formed after deletion of the 39kbp region, are transposons which have been named Tn4651 and Tn4652, respectively. The structural genes essential for the transposition mechanism, FIG. 12. (a)Extent of pWWO DNA found in various R p1asmid::pWWOco-integrates. Adapted from Lehrbach er al. (1982).(b)Location of the two TOL transposons Tn4651 and Tn4653 on pWW0. The position of the tnpS, tnpT and res genes shared by both transposons is indicated together with the two distinct tnpA genes used by each transposon individually. Adapted from Tsuda and Iino (1988).
38
S. J . ASSlNOtR A N D P A. WILLIAMS
tnpA, tnpS and tnpT, and the resolution site yes, are located on the 17 kbp of Tn4652 while no transposition functions are on the 39 kbp catabolic region (Fig. 12b; Tsuda and Iino, 1987). Although these two transposable elements, sharing exactly the same tnp genes, account for the majority of the recombination events already described, it does not explain all of the R::TOL co-integrate plasmids mapped by Lehrbach et al. ( 1982). Transposition from pWWO is yet more complex. Another larger transposon (Tn4653) of 70 kbp is also present; this encompasses Tn4651 and shares with it tnpT, fnpS and res but has a unique tnpA (the transposase) and also an adjacent tnpR (the resolyase) (Fig. 12b; Tsuda and Iino, 1989).Both Tn465 1 and Tn4653 are class11 transposons (Tn3-like) but, whereas the latter shares similarities with other class-I1 transposons, the former appears to be the first of a new subgroup. Comparison of the maps of Tn4651 and Tn4653 (Tsuda and Iino, 1988)with the inserts of pWWO in the eight R::pWWO co-integrates examined by Lehrbach et al. (1982) shows that four correspond to the 69-70 kbp Tn4653 and two to the 56 kbp Tn4651. One of the remaining two shares a terminus in common with Tn465I and the other shares one terminus with Tn4653 (Fig. 12) suggesting that they both might be the result of imprecise transposition events using transposition machinery encoded by the transposons. One recombination event which does not fit with the transposon hypothesis is pKF439, formed between the salicylate-catabolic plasmid SAL and pWWO 1985). pKF439 consists of the entire 81 kbp SAL replicon (Furukawa et d., with an insert of 57 kbp of pWW0. Although this insert carries all of the TOL catabolic genes, and is very similar in size to Tn465 1, the published map shows it to be displaced by 5-7 kbp at either end, a position which does not include tnpT, tnpS and I'LJS as mapped by Tsuda and Iino (1988). This could be the result of a very aberrant transposition event, but another possible, and more likely, explanation is that SAL and pWWO are of the same incompatibility group and share regions of homology spread over the plasmid (Lehrbach et LII., 1983). Thus pKF439 could be due to legitimate reciprocal recombination between two such homologous regions. Chakrabarty d.(1978) suggested that the transposable part of pWWO could exist as a separate replicon which was the result of dissociation of the complete 117 kbp plasmid into two smaller elements, namely a transfer factor and the non-transmissible catabolic replicon. There has been no subsequent confirmation of this finding nor has any other laboratory reported a similar result. I
B. IN OTHER
TOL
PLASMIDS
Some other TOL plasmids also very readily form co-integrates with RP4. The non-transmissibility of both pWW53 and pDKl provides a simple positive
THE TOL PLASMIDS
39
selection for formation of such co-integrates; RP4 is transferred into the host and the RP4’ TOL’ transconjugant is used as a donor in a mating, selecting for Mtol’ transconjugants. For both plasmids, co-integrate formation appears to be far more frequent than mobilization, and the size of the TOL plasmid DNA incorporated into the RP4 replicon seems to vary from cointegrate to co-integrate (Pickup, 1984; Shaw and Williams, 1988), although there might be some hot spots where the recombination events occur. Whether there are transposition genes on these plasmids which are involved in formation of such co-integrates requires further investigation.
VI. Growth of TOL Strains on Benzoate (“Benzoate Curing”)
Although all strains containing TOL plasmids will grow on benzoate and metabolize it through the plasmid-coded meta pathway, segregant strains accumulate during growth on benzoate which are defective in expression of that pathway and which no longer have the full TOL catabolic phenotype. This observation has been a very useful tool in the study of the family of plasmids. With pWW0, the appearance of mutants which had lost the ability to grow on all of the TOL substrates provided the first evidence for the plasmid nature of the pathway (Nakazawa and Yokota, 1973a; Williams and Murray, 1974). Loss of the wild-type phenotype under these non-mutagenic conditions, assumed to be the result of plasmid curing, has been used as a diagnostic means of implicating plasmids as vectors for the pathway, particularly before the refinement of plasmid isolation (Williams and Worsey, 1976).Total loss of the wild-type phenotype has been shown to arise not only from loss of the resident plasmid but also from the deletion from the plasmid of all of the catabolic genes. Examples are pWW0, resulting in formation of the cryptic pWW0-8 (Bayley et al., 1977), and pDK1, leaving a residual 20 MDa replicon (Kunz and Chapman, 198 1b). Not all segregants which are found after benzoate growth have lost the complete TOL phenotype and many retain the ability to grow on a limited range of TOL substrates. This phenomenon is plasmid dependent; for example, no such “partial” TOL mutants have been described for pWW0 but three examples where such mutants do arise are given below. A. EFFECT OF BENZOATE ON
Pseudomonas pufida HS1
When grown on benzoate, Ps. putidu HSl (also called PpCl), host to the 120 MDa plasmid pDK1, segregated a unique set of plasmid-deletion mutants (Kunz and Chapman, 1981b) typified by the following:
40
S. J . ASSINDER A N D P. A. WILLIAMS
(a) PpCTl (plasmid size 80 MDa) which retained the ability to grow on only four of the TOL substrates, namely toluene, benzyl alcohol, benzaldehyde and benzoate, and used the P-ketoadipate pathway for dissimilation of catechol formed from each. It lacked all activities of the mera-pathway enzymes. This could be explained if the deletion has removed the mera-pathway operon, leaving only the upper-pathway operon. (b) PpCM 1 (plasmid size 100 MDa) which had lost the ability to grow on all of the hydrocarbons, alcohols and aldehydes but grew on m-toluate using the meta pathway. In this plasmid the deletion appeared to have removed the upper-pathway operon but not the mera-pathway operon. (c) PpCCl (plasmid size 20 MDa) had the characteristic “fully cured” phenotype, and was able to grow on benzoate but only by the P-ketoadipate route. All of the x y f genes appeared to have been deleted. B. EFFECT OF BENZOATE ON
Pseudomonas putidu MT53
Two classes of mutants appear sequentially during growth of the host to plasmid pWW53 on benzoate (Osborne et af., 1988). After 40-60 h growth in a chemostat with limiting benzoate, the population of cells consisted predominantly of plasmid-deletion mutants with phenotype identical to PpCM 1 from HSI already described, i.e. growth on benzoate and the toluates but loss of the ability to grow on the pathway substrates above the carboxylic acids; these are discussed further in Section VII. However, during further growth, these mutants were gradually replaced by strains which had lost the complete TOL phenotype and also appeared to have retained no plasmid. c . EFFECT OF BENZOATE ON
Pseudomonas SPP. MT14, MT15
AND
MT20
These three strains were isolated in the selective enrichments of Williams and Worsey (1976). The plasmids in all three are very large ( >250 kbp) and are consequently difficult to analyse in detail. Their complex restriction-enzyme digests show that they are very similar but not identical (Keil and Williams, 1985). During growth on benzoate, there is very strong selection against the wild-type strain, resulting in total loss of the complete TOL phenotype after about 20 generations (Williams and Worsey, 1976). The mutants fall into several phenotypically distinct classes which have a range of unexpected phenotypes (Williams and Worsey, 1976; Keil and Williams, 1985; K. ODonnell, unpublished results). For example, one class, the so-called B3 mutants, grow on m-xylene using the TOL pathway but do not grow on its metabolite, m-toluate. These segregants are caused by a range of large deletions of about 100 kbp (Pickup and Williams, 1982; Pickup et al., 1983; Keil and Williams, 1985). It was originally thought that these large deletions
THE TOL PLASMIDS
41
caused the characteristic phenotypes by loss of the regulatory gene, .ry/S, and the first model for regulation of TOL genes was proposed to explain the B3 mutants of PS.putidu MT20, host to pWW20 (Worsey and Williams, 1977). Experiments were subsequently performed which showed that the same model was applicable to regulation of gene expression on pWW0 (Worsey rt a/., 1978). However, deletion of xyIS alone is far too simplistic an explanation for the different classes of deletion mutants formed from these strains. Experimentally, it has not yet been ascertained whether .ry/S is present or absent from plasmids in the deletion mutants, but it has been shown that the beginning of the metu-pathway operon including the OP2 region has been deleted and, because this is the binding site for the XylS protein, this undoubtedly is a major reason for their characteristic phenotype (Keil and Williams, 1985). D. EXPLANATION FOR THE COUNTERSELECTION AGAINST WILD TYPE DURING BENZOATE GROWTH
The common feature of all of the benzoate-selected segregants is that they dissimilate benzoate by the 8-ketoadipate pathway and are defective in the functioning of the TOL pathway when growing on benzoate. Obviously, in cells where the plasmid has been lost or the complete .ry/ genes deleted, metabolism of benzoate can proceed by the P-ketoadipate pathway as for any other strains of Ps. putidu. In those examples where the metu pathway is retained but its level of expression become decreased, the /I-ketoadipate pathway is able to take over as an overflow pathway for benzoate metabolism. If there is a build up of catechol in the medium as a result of poor expression of the mrtu-pathway enzymes, then the basal uninduced activity of C120 can act to produce cis,cis-muconate which will initiate induction of the ortho pathway (see Section IV). Thus, in the B3 mutants of strains MT14, MT15 and MT20, deletions in the plasmids remove the ability of benzoate and its alkyl derivatives to induce meru-pathway enzymes (Worsey and Williams, 1977). Benzoate is therefore metabolized by ortho cleavage and m- and p-toluates can no longer support growth. The complete TOL pathway is still induced by the hydrocarbons, so toluene and m- and p-xylenes remain as growth substrates. In deletion mutant PpCTl of Ps.putidu HS1, only themeta-pathway enzymes are deleted, so toluene, benzyl alcohol and benzaldehyde can be converted to benzoate by the upper-pathway operon, and benzoate can be dissimilated by ortho cleavage but none of the alkyl-substituted substrates can serve as growth sources (Kunz and Chapman, 1981b). In the deletion mutants of Ps.putidu MT53, deletion removes the upper-pathway operon (thus producing a hydrocarbon-negative phenotype) as a result of recombination between the two duplicate operons which are present on the plasmid (see Section VII;
42
S. J. ASSINDER A N D
P. A. WILLIAMS
Osborne rt al., 1988). Fo'r reasons which are not yet clear, the level of expression of the meta-pathway enzymes from these deletion mutants is much lower than in wild-type MT53. Growth on rn-toluate is therefore slower, and it is presumed that expression of C120 found during growth on benzoate is the result of catechol accumulation and consequent induction of the /3ketoadipate pathway (Osborne et al., 1988). Where there is both total loss of the xyl genes and defective expression of them, a faster rate of growth of the segregants on benzoate has been noted and measured (Nakazawa and Yokota, 1973a; Williams and Murray, 1974; Worsey and Williams, 1977; Stephens and Dalton, 1987).Any such segregants which are formed within the culture will therefore be at a growth advantage and will outgrow the wild-type or any other cells using the plasmid meta pathway. It has not yet been explained why growth invariably appears to be faster, and sometimes considerably so (Worsey and Williams, 1977), by the ortho-cleavage route. There has been some disagreement as to why deletion mutants and cured strains arise in benzoate-containing media. It was originally suggested that they occurred spontaneously at low frequency and that it was the more rapid growth rate which amplified their frequency in cultures to readily detectable values (depending on the strain from 2 to 100%) (Nakazawa and Yokotoa, 1973a; Williams and Murray, 1974). Noting that high concentrations of benzoate are growth inhibitory, Clarke and Laverack (1984) demonstrated that direct plating of some of their own isolates onto plates containing benzoate, at concentrations just below the minimum inhibitory concentration for each strain, caused substantial curing of three out of five strains with TOL plasmids and one out of two strains with NAH (naphthalene) plasmids. Under these conditions benzoate must play an active role in curing since cultures were directly spread onto agar plates containing a high concentration of benzoate to give single colonies, and there was therefore no opportunity for selection for faster growth. Furthermore, with the NAH strains, the hypothesis that cured strains change their pathway of benzoate utilization cannot apply since benzoate is not an intermediate in naphthalene catabolism. However, the concentrations of benzoate used in this experiment (30-50 m ~ are ) considerably higher than those used in the usual benzoate-curing protocol of 5-10 m~ (Williams and Murray, 1974) and may well therefore be acting in a different way. Keshvarz et ul. (1985) carried out an analysis of chemostat growth of wildtype Ps.putidu PPKl containing a TOL plasmid (pTKO) of about 150 kbp. Whereas growth for up to 600 hours on succinate caused no plasmid loss, in benzoate-limited cultures there was a rapid decline in pTKO+ strains. This started after about 100 hours, the culture becoming predominantly plasmidfree, but TOL strains never disappeared even after prolonged culture, and +
+
THE TOL PLASMIDS
43
occasionally there were oscillations in the proportions of TOL' and TOLstrains. On changing the limiting carbon source back to m-toluate, TOL+ strains rapidly re-established their predominance. In some TOL+ strains, isolated after prolonged culture on benzoate, the plasmid was stabilized and did not segregate TOL- derivatives even after 600 hours of benzoate limitation. This suggests that retention of TOL+ strains in the benzoatelimited cultures might have been due to selection of curing-resistant mutants; the nature of these was not analysed. Based on these results and the observation that there was no detectable difference in growth rate on benzoate between TOL+ and TOL- strains, the hypothesis that growth rate alone can account for the appearance of cured strains was rejected in place of a suggestion that plasmid loss is related to a failure in the control of plasmid partitioning at cell division, presumably brought about by the presence of benzoate. The occurrence of an unusual feature on the effect of benzoate was noted in P.seudornonu.s sp. MT14. This strain contains two large catabolic plasmids, a TOL plasmid pWW14 and a plasmid pWW17 encoding phenylacetate catabolism and resistance to mercury (Pickup e / ul., 1983).Because pWW 14 is a member of the same group of plasmids which includes pWW 15 and pWW20 (see p. 40), MT14 segregates a similar range of deletion mutants with intermediate TOL phenotypes after growth on benzoate. However, at the same time, the plasmid pWW17 undergoes similar large deletions affecting its genetic markers. There is no apparent explanation why loss of the ability to grow on phenylacetate or resistance to mercury should have any selective advantage or effect on growth on benzoate. It suggests that, whatever is the mechanism which causes deletions in pWW14, that same mechanism is also acting upon pWW17. Using Ps. pu/idu MT15 from the same group as MT14, Stephens and Dalton (1987) concluded that factors other than growth rate must account for formation of plasmid-deletion mutants and curing. Although there were differences in growth rates between the wild type and its segregants, which they attributed to inhibition of the wild type by benzoate, other weak organic acids such as acetate, butyrate and even rn-toluate appeared to influence plasmid loss and deletion. They proposed that benzoate, together with other weak organic acids, caused some disturbance in membrane function resulting in faulty plasmid partitioning and deletion formation. In a subsequent study which involved growing strain MT15 in a chemostat in the presence of benzoate but with growth rate limited by potassium ions or glucose, the same authors argued that benzoate acted in two ways, firstly to inhibit the growth rate of plasmid-containing cells and secondly to induce segregational instability of the plasmid (Stephens and Dalton, 1989). In a re-examination of Ps.puridumt-2 and the archetypal plasmid pWW0 in
44
S. J. ASSINDER A N D P. A WILLIAMS
which the phenomenon had first been observed, Williams et al. (1988a) concluded that growth rate differences between wild type and "benzoate cured" strains, formed spontaneously in cultures, were sufficient to account for the observations. In contrast to the results with strain MT15 (Stephens and Dalton, 1987), other organic acids did not affect plasmid stability. Benzoate itself did not cause any segregational instability in transposon-labelled pWW0-8 plasmids or a related IncP9 plasmid such as the naphthalene plasmid pWW60-I, as would be expected if it disrupted normal plasmid partitioning as proposed (Keshvarz et al., 1985; Stephens and Dalton, 1987).Seeding of wildtype cultures with genetically marked strains having the cured phenotype showed definitively that these took over the population due to their faster growth rate. It could be that the different hypotheses proposed to account for the effect of benzoate on TOL plasmid-containing strains represent real differences in the causative factors since both the plasmid-encoded mechanisms of segregation and partitioning will vary from plasmid to plasmid, and the competitive effectiveness between plasmid-coded and chromosomal pathways will also vary with each plasmid-host combination. However, the ubiquity of the phenomenon using TOL strains, isolated from different geographical locations and studied in different laboratories, gives some credence to the possibility that there could be a single explanation to account for all strains.
VII. Evolution of Catabolic Pathways The xyl genes from pWW0 have been shown to be capable of transposing and/or recombining C J ~bloc as a functional unit, both with other plasmids (Tsuda and lino, 1987, 1988) and into and out of chromosomes (Jeenes and Williams, 1982). I t is thus an attractive hypothesis that the presence of x j - 1 genes on a wide variety of TOL plasmids is due to their divergent dissemination by a series of recombination-transposition events with natural selection for retention of the TOL' phenotype. The most direct approach to provide experimental evidence for this supposition, and the one adopted in the authors' laboratory in recent years, is to compare the gene structure and organization on a range of TOL plasmids isolated from geographically diverse locations as a means of monitoring the evolution and spread of the catabolic functions. A related topic which may be addressed in a similar manner concerns evolution of those plasmids which encode the metabolism of different primary substrates but where the pathway used involves some identical catabolic activities; an example are the NAH plasmids responsible for naphthalene catabolism which, in common with TOL, carry a set of genes directing meta cleavage of catechol. Comparison of the genetic organization on these other
45
THE TOL PLASMIDS
plasmids with TOL has provided information on the possible mode of evolution of related catabolic pathways. A. EVOLUTIONARY RELATIONSHIPS BETWEEN
TOL
PLASMIDS
Detailed comparative studies carried out on two independently isolated TOL plasmids, pDKl and pWW53, serve to illustrate the relationships which exist within the family of TOL plasmids. Pseudomonus putidu HS1 is the host to the 125 kbp plasmid pDKl (Kunz and Chapman, 1981b). The initial point of interest with strain HS1 was its segregation of a unique set of plasmid-deletion mutants during growth on benzoate (Section VI). One of these, PpCT1, retained the ability to grow on toluene but no longer supported growth on substituted toluenes, metabolizing toluene and benzoate via the /l-ketoadipate pathway; this is consistent with the plasmid carrying only the upper-pathway operon. Characterization of the DNA encoding the catabolic functions was achieved by forming co-integrates between RP4 and both pDK I and the plasmid in PpCTl (Shaw and Williams, 1988).These consisted of the entire RP4 replicon with inserts of 40 and 20 kbp from the respective TOL plasmid. Each conferred the same catabolic phenotype as its parental plasmid and were named pDK2 and pDKT2, respectively. Genes for the upper and mrtu pathways are located on spatially distinct regions of pDK2; as predicted from its biochemical phenotype, pDKT2 carries the genes for the upper pathway only. The first work on the 107-1 10 kbp TOL plasmid pWW53 from Ps. putidu MT53 also described a co-integrate with RP4, designated pWW53-4, which comprised a 35 kbp insertion of pWW53 into the complete RP4 replicon (Keil et al., 1985a, 1987a,b) (Fig. 13). The pWW53 DNA contained in pWW53-4 includes separate upper- and rnrta-pathway operons and the regulatory genes .KYISR,which together confer the full TOL phenotype on a host pseudomonad. However, when the wild-type plasmid pWW53 was re-investigated, it became apparent that its genetic organization was more complex than suggested by the analysis of pWW53-4. A second complete nieta-pathway operon was discovered, additional to the one present on pWW53-4 (Osborne rt al., 1988). This was located on the opposite side of the xylCABoperon and transcribed in the same direction as its isofunctional counterpart. The existence of a second mrta-pathway operon accounted for segregation by strain MT53 of deletion mutants with the phenotype Mxy- Mtol' during benzoate growth (Section VI). It became clear that these mutants had undergone deletions of pWW53 DNA as a consequence of recombination between the two directly repeated homologous operons, creating a hybrid meta-pathway operon and deleting intervening DNA carrying the upper-pathway genes (see plasmids pWW53- 1, pWW53-2, Fig. 13; Osborne et al., 1988).
46
S. J . ASSINDER A N D P. A. WILLIAMS
FIG. 13. Complete BamHl ( I ) map of pWW53 and partial Kpnl (2) and Hind111 (3) maps of the relevant region of the plasmid, showing the relative location of the catabolic genes. The directions of transcription are indicated by arrows. The extents of the deletions in pWW53-1 and pWW53-2 consequent on recombination between the two metu-pathway operons are indicated. The shaded area represents the region of pWW53 DNA inserted in the RP4 co-integrate plasmid pWW53-4 (Keil et ul., 1987b). Adapted from Osborne et ul. (1988).
A comparison of the restriction-enzyme maps of the various operons on pDKl and pWW53 with those of the pWWO operons shows some interesting features. The upper-pathway operon is highly conserved with few differences in restriction-enzyme sites within the coding regions and an identical gene order on all three plasmids (Fig. 14a). Similarly, restriction-enzyme maps for two of the four rneta-pathway operons (pDK1 and pWW53 operon2) are identical (Fig. 14b); they also share a significant number of sites in common with maps for pWWO and pWW53 operonl. The two pWW53 mrra-pathway operons hybridize strongly both to each other (Osborne et af.,1988) and to the equivalent operons on pWWO (Keil et al., 1985a) and pDKl (Shaw and Williams, 1988). Assaying of subclones has shown that the order of the structural genes is identical in all four instances; however, specific activities of
47
THE TOL PLASMIDS (a )
OPI ORF
SrnX E P
BXb
XBgHSHH
I
I 1
P So
SrnX EPSaBgBXb I
XBgSH H H X H
I
I
SQ
P
1 1
S m X EPSaBgBXb 1
1
I 1
pww53
XQS
I 1
1 1
pwwo
so
Sa
Xb PSa
H
I
H H X H I
I l l
1
I
1
pDKl
I
XbP 6a
So
P P EBgXKXK I
P
X
SPE PKPY
I
I
B
Xb PgP
E B g P K XKXb
X
Xb
Sm I
B
I
Srn Srn
psp EBgX KXKPSrnPX E SmSSrnSmP PXS I
I
I
Xb E
I I I I I / I
I
S
XK;)S~PXE
I
Xb E
I
I
1
I 1 I
E
-
PSPEB~XK
0
pwwo
PSSmSrnX P X
I
I
I
Srn
I
111 I
EI
I
SrnSrn
(pWW5311
(PWW5312
SmSSrnSmP PXS E
I
I
S
E
I I
pDK I
SrnSrn
5 kbp
FIG. 14. Comparison of the restriction-enzyme maps of (a) upper- and (b) mefapathway operons of pWW0, pWW53 and pDK1. Restriction enzymes are as follows: E, EcoRI; B, BumHI; Bg, Bg/lI; H, HindlII; Sa, Sun; S, Ssstl; Sm, SmaI; P, PstI; X, X ~ J I ; Xb, Xhrrl. Adapted from Williams rt ul. (1988b).
the enzymes encoded by pDKl and pWW53 operon2 are of an order of magnitude lower than those encoded by the other two operons. The relative locations and directions of transcription of the structural operons and regulatory genes on pWW0, pDKl and pWW53 are summarized in Fig. 15. A further level of complexity is apparent for pWW53 and pDKl which relates to location of the TOL regulatory genes. Both plasmids carry a
I l l
I
I
I I
I
I
I
I I
I I
I
I l l
I
I
I
I
I
I
I
I
I II
I
I I1
I
I I
I 1
I
I I
I I
I
I I I
I
I
l
l
I
I IHUW I 1 IIIP'J!H
EMMd
IWX
I1 I I 1
I
IHUoEI IUPU!H wad IWX
49
THE TOL PLASMIDS
single copy of xylR; in pWW53, this is located at the downstream end of meta operonl with transcription in the same direction as that of the mera-pathway genes (analogous to the position of .uylR on pWW0; Keil er al., 1987b). On pDK1, the .uylR gene is located at the upstream end of the mera-pathway operon and is transcribed in the opposite direction (Shaw and Williams, 1988). However, due to differences in overall gene organization on pDKl and pWW53, the position of .uy/R with respect to the upper-pathway operon is identical for the two plasmids. Both pWW53 and pDKl have been shown to carry multiple homologous copies of .uq'/S.Three functional . q i S genes have been located on pWW53: .yl/S,, downstream of meta operonl; x.v/S2, downstream of meta operon2; and .uy/S3, located between the two nzetapathway operons (S. J. Assinder and P. A. Williams, unpublished observations). Two copies of .uy/S have been identified on pDKI, one (sylS,) adjacent to .uyIR (Shaw and Williams, 1988)and the other (.uylS2)downstream of the meta-pathway operon (exactly equivalent to of pWW53) (L. E. Shaw, unpublished data). It is tempting to hypothesize as to the evolutionary relationship between the three replicons, although there is limited merit in speculating at too great a length since the various theories are experimentally untestable. For example, the two copies of the meta-pathway operon on pWW53 may represent an ancient duplication which has diverged through acquisition of neutral mutations. A plasmid of the pWWO type could then have evolved through the co-acquisition of .uy/CAB with .ry/(DLEGFJIH), and .uy/S,R ; similarly, the inheritance of .uy/S,R and .u,vlCAB with .vy/(DLEGFJIH), and .uj1/S2 would give rise to a plasmid of the pDKl type. Alternatively, pWW53 may originally have had only a single meta-pathway operon of either the pWWO or pDK 1 type and acquired an additional operon through recombination either with a second TOL plasmid of the other type or with chromosomally integrated TOL genes. There is some justification in favouring the former of these two possibilities since it has been shown (Chatfield and Williams, 1986) that many independently isolated TOL plasmids from geographically diverse locations carry two genes for C230. In a number of instances, one gene has an identical restriction-enzyme map to the C230 gene within .uy/(DLEGFJIH),and the other is identical to the gene within xyl(DLEGFJIH),. This would appear to indicate that duplications of the meru-pathway operon of the type observed in pWW53 are relatively common in nature and that pWWO and pDKl are the exceptions rather than the rule in carrying only a single set of mera-pathway genes. Although the data can be taken as strongly supportive of an evolutionary relationship between pWW0, pDKl and pWW53, it is clear that the mere transfer of coding DNA between them, mediated by the recognized TOL q3/S2
50
S J ASSINDER A N D P A WILLIAMS
transposons, Tn465I and Tn4653 (Tsuda and Iino, 1987, 1988), does not in itself suffice as an explanation for the horizontal spread of the xyl genes. Simple transposition events involving contiguous DNA regions are insufficient to account for the different relative orientations of transcriptional units observed on the three replicons. If evolution of these plasmids has involved transposition events, then the transposon(s) subsequently must have undergone considerable internal re-arrangements, resulting in some cases in duplication of the catabolic regions. Furthermore, there is an even greater variation in the size of the TOL inserts from pWW53 and pDKl in the RP4::TOL co-integrates we have examined (Pickup, 1984; L. E. Shaw and P. A. Williams, unpublished data) than described by Lehrbach et ul. (1982) for pWW0. There may be some areas of pWW53 and pDK 1 which preferentially act as termini for recombination (see p. 39) but there is no evidence at the time ofwriting to suggest that these plasmids have a transposition machinery either related or unrelated to that of pWW0. It seems likely that the catabolic genes may be transferred on modules smaller than the TOL transposon, possibly involving recombination between regions of homology as reported for the deleted derivatives of pWW53 (Osborne et ul., 1988). There is evidence to suggest that homologous recombination may also have played a significant role in evolution of pDKI. As already discussed, one of the two copies of xyIS on pDK 1 ( x y l S J is located adjacent to xyIR, in this respect resembling xvlS of pWWO and xylS, of pWW53. In all three instances, .xylS and xylR are transcribed in opposite directions from between two EgnI sites 0.6kbp apart (Spooner et ul., 1986; Keil et ul., 1987b; Shaw and Williams, 1988).However, the downstream end of the pDK 1 xylS, gene appears from its restriction-enzyme map to resemble more closely xylS, of pWW53 than xylS, (Fig. 16),suggesting that evolution of pDK 1 has at some stage involved homologous recombination between two divergent copies of an ancestral xylS gene ( S . J. Assinder and P. A. Williams, unpublished observation). The importance of gene duplications in evolution of catabolic plasmids is further shown by the deletion behaviour of the pWW14, pWW 15 and pWW20 group of plasmids during growth on benzoate (Section VI). Keil et al. (1985b) showed that pWW15 encodes two genes for C230, one homologous to xylE of pWWO and forming part of a complete metu-pathway operon, and a second with no detectable homology. Some of the deletions were shown to have removed most of the DNA between the two genes including the beginning of the meta-pathway operon including OP2, giving rise to the Mxy+/Mtolphenotype (Keil et ul., 1985b). Homologous gene copies have subsequently been identified on pWW15 (K. ODonnell, unpublished data), including two functional copies of the upper-pathway operon and two copies of the metu-pathway operon, albeit one of them incomplete. Deletions have been
----
51
THE TOL PLASMIDS
xylS
'
Srn pwwo
Bg
Bg
XYlSI
Sm
1
pww53 SI
B
P
H
Sm
Bg
H
I
I
Ba
60
xylR
Bg
Eg
P
Srn I X
B
H
Sa
I I
Sax
xylR ?
XYlSl
Sa E pDKl' SI
r
xylR
X
Bg
Bg
I
I
I
P So Srn XbB I
XH
So
I
Ill
XSo
XYl%
S a E E pww53 s3
I
I
X
'
P
Bg
I
I
EH 1 1
SoE K 1 1 I I
SE
H
I'
B
FIG. 16. Comparison of the restriction-enzyme maps of the xylS genes on pWW0 (Spooner et al., 1986), pWW53 (Keil et al., 1987b; S. J. Assinder and P. A. Williams, unpublished data) and pDKl (Shaw and Williams, 1988). The directions of transcription are indicated by arrows. The location of.uylR on pDK 1 is tentative based on the similarity of restriction-enzymes sites to the s y l R regions of pWW53 and pWW0. Restriction enzyme designations are as for Fig. 13.
observed which appear t o involve recombination between the duplicated regions, with a decreased functional efficiency of the resulting hybrid catabolic genes giving rise to the unusual phenotypes o f the hosts. O n e of the results of investigating p W W 15 was the observation that some of the deletion mutants unable to grow on m-toluate reverted to pseudo-wildtype phenotypes after selection for growth o n this substrate. However, this phenotype was rapidly lost in the absence of selection. The mutants exhibited low uninducible activities of the rnera-pathway enzymes; in the revertants, the activities were elevated but still uninducible. Physical analysis of the plasmid DNA showed that the phenotypic reversion was caused by a tandem amplification of between 4 a n d 10 copies of a 23-28 k b p region carrying some
52
S J ASSINDER A N D P A. WILLIAMS
of the meta-pathway genes (Keil and Williams, 1985b). This is a further example of the flexible response of plasmid DNA to external selective pressures. I t is worth noting that, of the TOL plasmids analysed to date, only one is difficult to accommodate within the proposed evolutionary model. Plasmid pGB (Bestetti and Galli, 1987) is the smallest known TOL plasmid (85 kbp) and is unique in that its host strain was isolated on 1,2,4-trimethylbenzene rather than m-toluate. It confers the same phenotype on host cells as other TOL plasmids, but cloned fragments carrying either of the structural operons from pWWO do not significantly hybridize with any of the pGB fragments. The regulatory system on this plasmid also differs; whereas carboxylic acids are unable to back-induce the xyICAB operon on pWW0, they are able to cause induction of BADH in pGB+ strains. This appears to indicate a common regulatory mechanism for both operons as is found with naphthalene plasmids (Yen and Gunsalus, 1985; see p. 55) rather than the pWWO .K.vIS/.K.SIR system. I t is possible that pGB is simply an atypical member of the TOL plasmid family. Alternatively, future work could reveal a greater degree of structural diversity within the TOL genes than is currently apparent. In other words, the presence on some plasmids of non-homologous copies of the C230 gene (Chatfield and Williams, 1986) may be a manifestation of a more general phenomenon extending to entire non-homologous operons, of which pGB would be an extreme example. In summary, transposition appears likely to form the basis for evolution of the family ofTOL plasmids by facilitating gross transfer of substantial regions of genetic material. Upon this phenomenon are superimposed the effects of less-defined structural re-arrangements occurring within the transposable regions. In theory, this could give rise to a large number of arrangements of catabolic genes on different TOL plasmids, an expectation which is increasingly being realized as more plasmids are subjected to structural analysis. B. EVOLUTIONARY RELATIONSHIPS WITH OTHER CATABOLIC PLASMIDS
The Pseudomonus Inc P9 incompatability group contains, in addition to the TOL plasmid pWW0, the plasmid SAL responsible for salicylate degradation (Chakrabarty, 1972) and the plasmids NAH7 (Yen and Gunsalus, 1982) and pWW60-1 (Cane and Williams, 1982) encoding enzymes necessary for bacterial utilization of naphthalene (and salicylate). All of these plasmids share a common sequence of reactions involving the meta pathway. DNA-DNA hybridization demonstrated six regions of pWWO exhibiting homology with NAH and/or SAL plasmids, constituting in total approximately 34% of the TOL DNA (Heinaru et af., 1978; Lehrbach ef ul., 1983).
THE TOL PLASMIDS
53
Some of the hybridizing regions could be accounted for by common transfer and replication functions.as would be expected for plasmids of the same incompatibility group, but there was also evidence of hybridization between those regions encoding their respective meta-pathway operons. Detailed analysis of gene structure and organization on the various catabolic plasmids has provided further insight into the extent of their genetic relatedness. The biochemical pathway for breakdown of naphthalene encoded on plasmids NAH7 and pWW60-I involves its conversion to salicylate which is then channelled into central metabolites via the metu cleavage of catechol (Fig. 17).On both plasmids, genes encoding the early enzymes of the pathway (naphthalene to salicylate) and the meta-pathway genes (salicylate to pyruvate) are clustered in two distinct operons (Yen and Gunsalus, 1982; Cane and Williams, 1986). Genes within the meru-pathway operons of NAH7 and pWWO are arranged in an identical order with the exception of the last two genes (encoding 4 0 D and 40J) whose relative order is reversed (Yen and Gunsalus, 1982; Harayama r t ul., 1987b). Furthermore, the nucleotide sequence of pWWO . K ~ /isE 80% homologous with that of the isofunctional NAH7 gene nukH (Harayama et ul., 1987b). Similarly, the gene order within the nwru-pathway operon of pWW60-1 has been shown by DNA-DNA hybridization and subcloning to be identical with that of pWW53-4 (and by extrapolation to pWW0) (Assinder and Williams, 1988). The existence of strong similarities in gene organization within the structurally heterogeneous group of NAH and TOL plasmids suggests a possible model for evolution of these long catabolic pathways. It is conceivable that the toluene degradative pathway evolved through chance combination on a single replicon of three pre-evolved metabolic “modules”, consisting of: genes for breakdown of toluene to benzoate (ancestral .qK’MABN); (2) genes for oxidation of benzoatelm-toluate to catechols (ancestral .q,lXYZL),possibly recruited by recombination from the isofunctional chromosomal hen genes; (3) genes for the metu-pathway enzymes (ancestral sjdEGFJQKIH). (1)
Co-inheritance of modules (2) and (3) in an appropriate orientation would lead to formation of an operon structure, conferring a selective advantage upon the host by facilitating growth on m-toluate as the sole source of carbon. Simultaneous or subsequent recruitment of module ( 1) would further expand the substrate range of the host to include toluene and the xylenes. Applying a similar argument to the NAH plasmids, the meru-pathway gene cluster may have recruited a gene encoding salicylate hydroxylase (nuhG)resulting in the ability of the host strain to grow on salicylate as the sole carbon source. The
54
S. J. ASSINDER A N D P. A. WILLIAMS
a
Naphthalene
.I1
&OH
k h
CH3-C-COOH
s
/I
ooH COOH Salicylate
a:: 47
Catechol
J8 CHO
COOH
m0
7
CH2
COOH
0 0 : . COOH
412
413 Acetaldehyde t Pyruvate
FIG. 17. Plasmid-coded pathway for catabolism of naphthalene. Enzymes (genes) shown are: (1) naphthalene djoxygenase (nahA); (2) naphthalene-cis-dihydrodiol dehydrogenase (nahB); (3) 1,2-dihydroxynaphthalene dioxygenase (nahC); (4) 2hydroxychromene-2-carboxylateisomerase (nahD); ( 5 ) 2-hydroxybenzalpyruvate aldolase (nahE);(6) salicylaldehyde dehydrogenase (nahF);(7)salicylate hydroxylase (nahG); (8) catechol 2,3-oxygenase (nahH); (9) 2-hydroxymuconic-semialdehyde dehydrogenase (nahl);(10) 4-oxalocrotonate isomerase (nahJ);(11) 4-oxalocrotonate decarboxylase (nahK); (12) 2-0x0-4-pentenoate hydratase (nahL); (1 3) 4-hydroxy2-oxovalerate aldolase (nahM);(14) 2-hydroxymuconic-semialdehydehydrolase.
THE TOL PLASMIDS
55
full NAH catabolic functions would then evolve through co-acquisition of an ancestral upper-pathway operon directing breakdown of naphthalene to salicylate. There is evidence to suggest that the catabolic genes of NAH7 are carried on a transposable element analogous to the TOL transposon of pWWO (M. Tsuda, personal communication), thus providing a mechanism for their dissemination between replicons. Similar arguments can also be applied to evolution of other catabolic pathways; for example, a plasmid has been isolated recently carrying specific genes for breakdown of biphenyl to catechol which is then degraded via a rnetu-cleavage pathway. The organization of the metu-pathway operon appears to be identical with that of pWWO (I. Carr, unpublished data). If it is assumed that the toluene degradative pathway was formed from three distinct genetic units, co-ordinated expression of the catabolic genes also had to evolve in order for the pathway to function efficiently. The fact that xy/S and q i / R are found in a variety of positions relative both to each other and to the nwtu-pathway genes in different TOL plasmids (Williams ot ul., 1988b) implies that they did not constitute an integral part of the ancestral nwtupathway operon. Furthermore, despite the similarities in their genetic organization, regulation of gene expression on the NAH plasmids differs significantly from that on TOL. On NAH7, the product of the positive regulatory gene nukR co-ordinately activates transcription of both structural gene operons in the presence of salicylate as inducer (Yen and Gunsalus, 1985). This supports the hypothesis that regulatory control of catabolic pathways may have evolved subsequent to development of their catalytic functions. The F presence of internal promoter sequences upstream of x y / L and . Y ? ~on pWW53-4 (Keil et id., 1987b), which allows low constitutive expression of the enzymes in the absence of OP2, suggests that the operon originally evolved as an unregulated pathway for degradation of catechols. It was probably at a later stage in its evolutionary history that specific regulatory genes were recruited with concomitant development of the complex regulatory network now operative. VIII. Use of TOL Plasmid Genes in Construction of Novel Strains and Vectors The TOL pathway has served as a useful model system for constructing strains with modified or entirely novel catabolic properties. The stimulus for this work has been two-fold, namely degradation of recalcitrant natural and synthetic chemicals by microbial action and synthesis of metabolites which are difficult or expensive to synthesize by chemical methods. The properties of the TOL pathway which make it useful for these purposes are:
56
S J ASSINDER AND P A. WILLIAMS
(a) The complete pathway exhibits a broad specificity in its ability to effect dissimilation of a range of substituted toluenes (Worsey and Williams, 1975; Kunz and Chapman, 1981a).To support this broad specificity, the enzymes must be non-specific and many of them may have an even broader specificity than the range of growth substrates would indicate. The block to any particular compound being a growth substrate for TOL' strains could be due to only a single enzyme with a narrower substrate range or even due to the absence of induction in its presence. (b) Catechol and substituted catechols are critical metabolites where many different aerobic pathways for aromatic catabolism converge. Apart from those relatively few pathways in which 1,4-dihydroxy carboxylic acids (gentisate and homogentisate) are substrates for ring fission, all aerobic aromatic catabolism proceeds via a catechol metabolite before ring opening by either an intradiol (ortho)or an extradiol (meta) dioxygenase. This allows the possibility of linking together parts of different pathways to produce hybrid catabolic routes not otherwise found in nature. Although this manipulation is possible with all aromatic pathways and is not unique to TOL, the presence of the TOL pathway genes on a transmissible plasmid facilitates strain construction in uiuo by conjugation, and makes cloning strategies relatively easy because of the ease with which plasmid DNA can be purified.
A. MULTIPLASMID Psdonjonas SP.
A much publicized example of a constructed strain which involved the TOL plasmid was the multiplasmid Pseudonmnas sp. (Friello et al., 1976a) which was proposed as a potentially useful strain for degrading crude oil, either to clean up oil spillages or to produce protein from petroleum. This organism was constructed by transferring into a Ps. aeruginosu host several different catabolic plasmids, TOL, NAH (for naphthalene catabolism) and CAM-OCT (a plasmid co-integrate carrying genes for catabolism of both camphor and short-chain alkanes). It was argued that a single strain, capable of simultaneously degrading a range of different substrates, would have advantages over a mixed culture, each component of which would have only a single relevant degradative capability, because it would eliminate interactions between strains due to mutual inhibitory or toxicity effects (Friello rt al., 1976a). Although this strain was recognized as an interesting model for catabolism of multiple substrates, there was some lively discussion as to whether it would actually degrade more than a small fraction of natural crude oils, whether it would be genetically sufficiently stable and whether it could compete effectively in the marine or terrestrial environments where its use had been proposed (Kallio, 1976a,b; Chakrabarty, 1976).
THE TOL PLASMIDS
57
B. STRAINS WITH HYBRID PATHWAYS
1. Phenol Catuholism
A relatively straightforward example of a hybrid pathway was formed in Ps. purirlu PPI-2 which grows on phenol or benzoate, both metabolized via catechol and the fl-ketoadipate pathway (Wong and Dunn, 1976).A mutation in the chromosomal C 120 gene simultaneously destroyed its ability to grow on either compound. However, after transfer by conjugation of TOL into the C130- mutant, growth on phenol was restored since phenol was converted by the chromosomal phenol hydroxylase into catechol which was then further dissimilated by the plasmid mefu pathway. The growth rate was slow in the transconjugants because the meta-pathway genes are not induced by phenol, but spontaneous faster-growing segregants were found in which regulation of the plasmid pathway had been modified to accept phenol as an inducer. 2. Methylsalicylate Catabolism
In a very similar demonstration the range of substrates used for growth was extended by introduction of TOL into Ps.putidu S1 (Nakazawa and Yokota, 1977). This strain grows on salicylate which is converted via salicylate hydroxylase (SH) to catechol and thence by the /I-ketoadipate pathway. Although SH is non-specific and can convert 3-methylsalicylate to 3methylcatechol, 3-methylsalicylate cannot serve as a growth substrate for strain SI since the /I-ketoadipate pathway cannot completely metabolize alkyl-substituted catechols. By transfer of TOL into S1, transconjugants were obtained which had acquired the ability to grow on 3-methylsalicylate since its metabolite, 3-methylcatechol, was completely dissimilated by the plasmidcoded m m pathway. 3. Hulogenutecl Benzoic Acid Cataholi.sm
Some of the most difficult xenobiotics to degrade are the halogenated aromatic compounds, particularly those with more than one halogen atom in the ring. Many such compounds are used as agrochemicals or are byproducts of industrial processes such as the paper industry. Their recalcitrance is a result of the biochemical difficulty of removing the halogen substituent(s). There appears to be one main pathway for achieving this which involves formation of halocatechols which are then metabolized by a modified orrhocleavage pathway, involving ring cleavage via a C120 followed by subsequent elimination of the halogen atom (usually chlorine) as a halide ion (Gaunt and Evans, 1971 ). One of the most intensively studied examples of hybrid pathway formation
58
S J ASSlNDtR A N D
P
A WILLIAMS
has been the use by Knackmuss and his co-workers of pWWO to extend the ability of a Psrudomonas strain to degrade chlorobenzoic acids. Pseudomonas sp. B13 grows on 3-chlorobenzoate (3CB) by the modified orrho pathway (Hartmann rt ul., 1979).The only metabolic block preventing BI 3 growing on other chlorinated benzoates, such as 4-chlorobenzoate (4CB), appeared to be the limited specificity of the benzoate 1,2-dioxygenase for benzoate and 3CB only (Reineke and Knackmuss, 1978). Because pWWO encodes an enzyme, toluate 1,2-dioxygenase, catalysing an analogous step but with a broad specificity for alkyl- and halo-benzoates (Reineke and Knackmuss, 1978), it was a logical step to transfer pWWO into B13 in the expectation that transconjugants would be able to grow on 4CB by recruiting the plasmid enzyme to circumvent the metabolic block. Although the primary transconjugant obtained in this mating, WR2 1 I , which was selected for its ability to grow on m-toluate. failed to grow on 4CB, spontaneous mutants of WR21 I (such as WR216) which were4CB' appeared at high frequency and secondary mutants which could grow on dichlorobenzoates such as 3,5-dichlorobenzoate (35DCB) could also be selected (Fig. 18; Reineke and Knackmuss, 1979). Detailed examination of these B13 transconjugants has shown the following: (a) Catabolism of both haloaromatics and alkylaromatics within the same cell is usually incompatible; utilization of methylcatechols via a nieta cleavage and of halocatechols via an ortho cleavage cannot co-exist. Thus, WR2I 1 is Mtol'4CB- whereas its mutant WR216 is Mtol- 4CB'. The reason for the
lmt-21. Mxy' Mtol' 3cB4cB-
[8131
jpWW
A
Mxy-
Mtol3CB' 4cB-
m (a1
MwyMtol' 3CB' 4cB-
,IWR216] (b)
MxyMtol3CB+ 4CB'
FIG. 18. Selection of derivatives of Pseudomonas B13 capable of growth on 4chlorobenzoate. In step (a) the TOL plasmid pWWO was transferred into strain B13 selecting for acquisition of the ability to grow on m-toluate, giving rise to transconjugant WR211. In step (b) the transconjugant WR211 was plated onto 4chlorobenzoate plates and spontaneous mutant WR216 was selected. Phenotype designations: Mxy', ability to grow on m-xylene; Mtol+,ability to grow on m-toluate; 3CB', 4 C B +,abilities to grow on 3- and 4-chlorobenzoate, respectively.
THE TOL PLASMIDS
59
incompatibility is that 4-chlorocatechol formed from 4CB is preferentially attacked by C230 to form a product which cannot be further metabolized and accumulates in the medium. In order to acquire the ability to grow on 4CB, the C230 gene must be inactivated and this blocks catabolism of m-toluate; in order to become 4CB' WR216 must mutate to Mtol-. In WR216, inactivation is the result ofinsertion of 3 kbp of unknown origin into the .y?dE gene (Jeenes and Williams, 1982). However, WR211 is able to utilize m-toluate and 3CB simultaneously which appears to contradict the statement already made. This is because, although C230 attacks 3-chlorocatechol as it does 4-chlorocatechol, the product of the reaction is a highly reactive acyl chloride which inactivates the enzyme. Activity of C230 cannot therefore be detected in WR211 growing on 3CB, and 3-chlorocatechol is channelled down the modified ortho route (Reineke e l a/., 1982). (b) Selection pressures for new catabolic phenotypes within strain B13 resulted in changes in the structural integrity of pWW0 DNA (Section V) which included transposition into the chromosome, partial recombination of thechromosomal insert with the plasmid and insertion of novel DNA into the plasmid (Jeenes p t a/., 1982). It has proved difficult to find an explanation for most of the changes recorded, and independent repetition of the selections which gave rise to WR21 I and WR216 tend to produce structural changes in the plasmid DNA often of quite a different kind (Jeenes, 1982). These experiments show that the plasmid DNA of pWW0 is, in the right host and with the appropriate selection pressures, liable to undergo major rearrangements. I t can be seen that the events giving rise to these structural changes are analogous to those that occur in natural populations of saprophytic bacteria as plasmids transfer between different hosts and nutritional pressures change. Since plasmids, in contrast to chromosomes, are not subject to the selection constraints of carrying genes essential to survival of their hosts, these experiments give an important insight into a potentially important role of plasmids in evolution of novel combinations of DNA. Unexplained structural changes in plasmid DNA were also noted in a similar series ofexperiments carried out by Chaterjee and Chakrabarty ( 1 982). In transferring TOL plasmids into the 3CB-degrading strain of Ps. putidu AC858 in order to increase its range of halobenzoate catabolism, it was found that integration of 41.5 kbp of TOL DNA into the chromosome occurred as did some recombination between non-catabolic TOL DNA and the plasmid in AC858, pAC25, which carries the genes for 3CB catabolism. Biochemical examination of the B13-derived strains indicated that, as predicted, the toluate dioxygenase of the TOL plasmid had been recruited and
60
S J ASSINDER A N D P A. WILLIAMS
was functional in conferring the extended ability of the mutants to catabolize chlorobenzoates (Reineke and Knackmuss, 1980). However, in such experiments where there is transfer of a complete catabolic pathway, it is not always possible to analyse all of the factors involved in determining novel growth phenotypes. There was some indication from the experimental results which suggested that three additional factors could also be involved. These were alteration of both the substrate specificity and regulation of the toluate dioxygenase and participation of the next enzyme of the pathway, dihydrodihydroxybenzoate dehydrogenase (xJ~L.) (Reineke and Knackmuss, 1980). The alternative way of creating new catabolic functions and one which can more easily distinguish the individual factors involved is to transfer individual genes or gene clusters cloned onto suitable vectors. Using this approach, it was shown that BI 3 could acquire a 4CB' phenotype by introduction of only the . ~ y l Dgene, whereas the 35DCB' phenotype required both S J ~ D and X J ~ L (Lehrbach rt a/., 1984). Even in this experiment, two spontaneous mutations occurred during the selection procedures: (a) A deletion of 0.8 kbp upstream of .YJDL which increased the recombinant plasmid stability in B13. (b) A further mutation essential for acquisition of 35DCB'. Later experiments indicated that this was a regulatory mutation which enabled induction of the two enzymes in the presence of 35DCB (Ramos et al., 1986). C. EXTENSION OF RANGE OF
TOL
SUBSTRATES
In an elegant series of experiments, Timmis and his co-workers demonstrated that it is possible to extend the catabolic range of the TOL pathway by effecting changes in the specificity of individual regulator proteins and catabolic enzymes. If biochemical analysis has pinpointed elements in a pathway which are barriers to dissimilation of a novel substrate, it should be possible to modify sequentially the blocking components, thereby creating a new pathway in a rational way. Pseudomonas putida mt-2 is unable to grow on 4-ethyltoluene (4ET) or 4ethylbenzoate (4EB). Regarding the latter substrate, the reasons are that 4EB does not effectively interact with the regulatory protein XylS to induce the niera-pathway operon and because 4-ethylcatechol, its metabolite, inactivates C230 (Ramos et al., 1987b). The effector specificity of XylS was determined using recombinant plasmid constructs with the mera-pathway operatorpromoter region (P,,,, OP2) upstream of a marker gene and co-existing with a cloned X ~ [ in S the same host cell (Ramos et al., 1986).With lacZ as the marker
THE TOL PLASMIDS
61
gene, the specific activity of P-galactosidase in cells grown in the presence of substituted benzoates was used as a quantitative measure of the XylS specificity. With a tetracycline resistance gene as the marker gene, modified xy1S mutants were obtained by selection for increased levels of resistance in the presence of poor inducers. The regulatory block to 4EB catabolism was overcome by isolating a mutant .uylS allele (xylS4E)which was induced by 4EB. The second step was to select for 4EB' mutants of a strain containing both the recombinant .UJ'IS~E+ plasmid and pWWO (Ramos et al., 1987b).In this way, a mutation in xylE was selected which rendered the C230 less susceptible to inactivation by 4-ethylcatechol. The 4EB' phenotype of the mutant, carrying the sylS4E allele on a recombinant plasmid trans to the mutated .Y,vIE gene on pWW0, is potentially unstable because of possible independent loss of either plasmid. Abril et al. (1989)eliminated this possibility by selecting for strains which had lost the resistance marker of the recombinant plasmid and yet were still 4EB': in these, recombination between themutant xylS and the wild-type xylS had occurred resulting in transfer of xylS4E onto the pWWO plasmid. The only remaining block to 4ET catabolism was now shown to be inability of the toluene oxidase ( . ~ y l Ato ) hydroxylate 4ET. This was overcome simply by selecting for growth on 4ET after mutagenesis (Abril et al., 1989). The plasmids in the final strains thus contained three mutations in the genes q d S , xyIE and .ryIA, together necessary for the new phenotype. Because each arose at a frequency of about 10-8-10-9, the frequency of all three arising simultaneously (about excludes the possibility of directly mutating wild-type mt-2 to 4ET'. D. STRAINS FOR BIOACCUMULATIONS
The first use of a TOL strain to synthesize chemicals was by the Celanese Corporation (Maxwell, 1982; Hagedorn and Maxwell, 1988). Pseudomonas putidu MW1000, a strain with its TOL genes chromosomally integrated (Sinclair ef al., 1987), was manipulated to convert toluene to muconic acid which could subsequently be chemically hydrogenated to adipic acid for the synthetic-polymer industry. The strategy employed was firstly to mutate the gene for C230, thus channeling catechol formed from toluene down the P-ketoadipate pathway. Muconate cycloisomerase (muconate-lactonizing enzyme) was then inactivated by mutation causing stoicheiometric accumulation of cis,cis-muconate. Although the patent describes accumulation of muconate in culture to concentrations greater than 3 0 m ~ the , fact that biotechnological synthesis of adipic acid has not replaced chemical synthesis is a reflection of the economics not the science. A number of other TOL intermediates have potential more as fine chemicals
62
S. J. ASSINDER A N D P. A. WILLIAMS
than as bulk chemicals. cis-Dihydrodiols have been of some interest since they are difficult to synthesize by chemical means and can be used as starting materials for other products. For example, benzene cis-dihydrodiol has been commercially made using bacteria and is the starting material for the polymer polyphenylene (Ballard et al., 1983). Both of the cis-dihydrodiols of benzoate and of the toluates and the corresponding catechols can be accumulated in high yields by the use of cloned xylD and xylDL genes, respectively (Zeyer et al., 1985). High expression of the enzymes necessary for effective bioconversions is best achieved by cloning them in an E. coli host on a vector with a strong regulated E. coli promoter. E. USE OF
TOL
GENES T O CREATE VECTORS FOR RECOMBINANT
DNA
STUDIES
There have been several plasmids constructed in which TOL-plasmid genes have been used as an integral part of the vector function or as a means of investigating other genetic systems. The ease with which C230 can be detected qualitatively and/or assayed quantitatively in a range of different hosts has led to its use as a marker gene. Spraying a plate of tranformants or transconjugants with a 5-10m~solution of catechol rapidly distinguishes C230 colonies since they turn yellow due to accumulation of 2-hydroxymuconic semialdehyde. Since catechol is vastly cheaper than, for example, X-gal, and appears to have no problems getting into bacterial cells, C230 appears to be of potentially wider application than ,4-galactosidase. The activity of C230 within strains can be assessed either qualitatively by a visual estimate of the degree of yellow produced by such colonies or quantitatively by determining its specific activity in cell extracts. Thus Zukowski c a r ul. (1983) used the pWWO xyIE gene to construct a promoter probe vector pTG402 consisting of the xylE gene from pWWO inserted into a plasmid which replicates in both E. coli and Bacillus strhtilis. Although this plasmid expressed C230 in E. coli, it did not do so in B. suhtilis unless a promoter was closed upstream of it. Furthermore, shotgun cloning into the upstream region of chromosomal DNA from B. suhtilis, B. pumilis, B. lichenformis or E. coli suggested that promoters from any of these strains could cause C230 expression in a B. subrilis host thus extending its use as a promoter probe vector for Gram-negative and Gram-positive organisms. Derivatives of this plasmid in which the B. subtilis ctc promoter was inserted upstream of xylE have been used to study the effect on transcription from this promoter of single-base substitutions (Ray et al., 1985) and their suppression by second-site mutations (Ray et ul., 1988). Ingram et a/. (1989) constructed a plasmid capable of replication in Streptomyces spp. with xyIE under the control of the galactose-inducible galPl promoter from S. lividuns, and used the +
THE TOL PLASMIDS
63
C230 activity as a measure of transcription from wild-type and mutant promoter alleles. In a similar vein, a fragment carrying x y / E was inserted into a cloned region of the alginate gene cluster from Ps. aeruginosa containing a/gD, the gene for GDP-mannose dehydrogenase (Deretic et al., 1987b).The resulting a/gD-xylE transcriptional fusion facilitated analysis of the regulation of alginate synthesis in mucoid and non-mucoid strains of Ps. aeruginosa. A broad host-range promoter vector, pCF32, for use in Gram-negative bacteria was constructed by ligating x y / E downstream of the Km' determinant of pKT240 (Spooner et a/., 1987). A small HindIII-EcoRI fragment carries the Km' gene and its promoter and lies between xylE and the Sm' which are transcribed in opposite directions away from the fragment. Excision and replacement of the HindTTI-EcoRI fragment with a promoter fragment results in loss of kanamycin resistance and either altered activity of the C230 or increased resistance to streptomycin, depending on the direction of transcription from the promoter. Potential regulatory proteins acting at the promoter can be introduced trans on a second compatible plasmid vector. A similar promoter-probe vector, pTS 1045, was constructed from three plasmids, namely R 1b679A, pACYC 177 and pTS87 (Tnouye et al., 1986a). This 16.1 kbp plasmid has a 1.2kbp BarnHI fragment upstream of xyfE, replacement of which by a promoter fragment in the correct orientation causes expression of the C230. Deretic et a/. (1987a) constructed a plasmid containing a 5'-truncated xy/E gene for use in generating fusion proteins with the C-terminus provided by .uv/E. Thus, by fusion with afgD, they increased the stability of the fusion piotein and also showed that it could facilitate its size determination. At least two vectors have been constructed which utilize the regulatory systems of TOL plasmids to control expression of a cloned gene. Vector pNM 185 has a broad host-range based on pKT23 I which carries xylS from pWW0 and the promoter of the rneta-pathway operon OP2 (P,) (Mermod ei a/., 1986b). Downstream of the promoter are unique EcoRI, SsrT and SsiII sites into which DNA can be cloned. Using both C230 and /3-galactosidase genes as markers, Mermod et al. (1986b) showed that m-toluate at concentrations around 1 p~ caused induction of the marker genes in a wide range of Gram-negative bacterial hosts although the ratio of induced-touninduced activities was decreased as the taxonomic distance from Pseudonzonas sp. increased. An analogous plasmid, pEHK455, has been constructed from TOL plasmid pWW53 which has an expression cassette under control of the upper-pathway regulatory genes xylR and OPl. Insertion of genes on EcoRI, Sac1 or KpnI fragments downstream of the promoter allows rn-xylene induction of the cloned genes (H. Keil, personal communication).
64
S. J. ASSINDER AND
P. A. WILLIAMS
IX. Epilogue Around 1970, the study of bacterial catabolism of aromatic compounds was a relatively esoteric backwater of microbiology which had contributed little to mainstream science apart from the description of yet more elaborate biochemical pathways. TOL plasmids are just one of the aspects of aromatic catabolism which, in the subsequent 20 years, have moved into the centre of modern microbiology. Analysis of the xyl genes of Pseudomonas spp. is comparable with that of the nifgenes of Klebsiella spp., being arguably the two best described of the long multigene regulatory units. Although the analysis has not reached the level of sophistication afforded by the lac genes of E. coli K12, there seems to be no reason why the next few years should not result in equally detailed descriptions of various aspects of toluene-xylene catabolism, notably its enzymology, regulation, transposition, its contribution to an understanding of evolution and its use as a model system for biodegradation of xenobiotics. X. Acknowledgements
We would like to express our appreciation of the following colleagues who have helped us in the preparation of this review by sending us preprints of their manuscripts, intimations of their current work and invaluable comments on drafts of the review: Charles Fewson, Chris Franklin, Shigy Harayama, Heinrich Keil, Teruko Nakazawa, Linda Shaw and Masataka Tsuda. REFERENCES Abril, M.-A,, Michan. C., Timmis, K. N. and Ramos, J. L. (1989). Journal ofBacreriologr 171. 6782. Assinder, S. J. and Williams, P. A. (1988). Journal qfGmeru1 Microbiology 134. 2769. Audus, L. J. (1960). hi “Herbicides in the Soil” (E. K. Woodford and G. R. Sagar, eds). pp. 1-19. Blackwell, Oxford. Austen. R. A. and Dunn, N. W. (1977). Austrulirm Journul of Biologicul Science 30, 357. Ballard. D. G . H., Courtis, A., Shirley, 1. M. and Taylor, S . C. (1983). Journul of rhe Clicwicd Socierj, Cheniical Conimunications 634, 954. Bayley, S. A., Duggleby. C. J., Worsey. M. J., Williams, P. A., Hardy, K. G. and Broda, P. (1977). Molecular and General Genetics 154, 203. Bayley, S. A., Morris, D. W. and Broda, P. (1979). Narure 280. 338. Bayly, R. C. and Wigmore, G. J. (1973). Journal qfBacteriologj 113, 1112. Benson. S. and Shapiro, J. (1978). Journal of Eacreriology 135, 278. Bestetti, G. and Galli, E. (1987). Journul of’Eucteriology 169, 1780. Birkman, A., Sawers, R. G. and Bock, A. (1987). Molecular and Generid Gr~ncvic.v210. 535. Bradley, D. E. and Williams, P. A. (1982). Journal of General Microbiology 128, 3019. Buck, M., Miller, S..Drumniond, M. and Dixon, R. (1986). Nature 320, 374. Cane, P. A. and Williams, P. A. (1982). Journul of General Microbiology 128, 2281. Cane, P. A. and Williams, P. A. (1986). Journul of General Microbiology 134, 2769. Chakrabarty, A. M. (1972). Journal of Bacteriology 112, 815.
THE TOL PLASMIDS
65
Chakrabarty, A. M. (1976). American Socie/y,/or Microbiology News 42, 520. Chakrabarty, A. M., Chou, G. and Gunsalus, I. C. (1973). Proceedings 9ftlie National Academy of Sciences of the Unired Stares of America 70, 1137. Chakrabarty, A. M., Friello, D. A. and Bopp, L. H. (1978). Proceedings ofthe National Academy of Sciences of the United States of‘ America 75, 3109. Chalmers, R. M., Scott, A. J. and Fewson. C. A. (1990). Journul uf Genertrl MicWbifJlfJgj’ 136,637. Chaterjee, D. K. and Chakrabarty, A. M. (1982). Molecular and Gerierul Genc,/ics 188. 279. Chatfield, L. K. and Williams, P. A. (1986). Journal of Bucreriology 168, 878. Clarke, P. H. and Laverack. P. D. (1984). FEMS Microbiology Lerter.~24, 109. Cuskey, S. M. and Sprenkle, A. (1988). Journal ~ f ’ B a c t e r i o l o g170, ~ ~ 3742. Davis. R. S.. Hossler. F. E. and Stone, R. W. (1968). Cunadian Journal of Mic,rohiologj, 14, 1005. Deretic. V.. Chandrasekharappa, S., Gill. J. F., Chaterjee, D. K. and Chakrabarty, A. M. (1987a). Gene 57. 6 1. 169, 351. Deretic, V.. Gill, J. F. and Chakrabarty, A. M. (3987b). Journal ofBuc~teriologj* Dixon. R. (1984). Nucleic Acids Research 12, 781 I. Dixon, R. (1986). Moleculur und General Genetics 203, 129. Downing, R. G. and Broda, P. (1979). Molecular and General Generics 177, 189. Downing, R. G., Duggleby, C. J., Villems, R. and Broda, P. (1979). Molecular and General genetic.^ 168, 97. Drummond, M., Clements, J., Merrick. M. J. and Dixon. R. (1983). Nurure 301, 302. Drummond, M., Whitty, P. and Wootton. J. (1986). EMBO Journal 5, 441. Duggleby, C. J. and Williams, P. A. (1986). Journul qf General Microhiologr 132. 717. Duggleby, C. J.. Bayley, S. A.. Worsey, M. J., Williams. P. A. and Broda, P. (1977). Journul o/’ BacfrriolfJgy 130, 1274. Dunn, N. W. and Gunsalus, 1. C . (1973). Journal of Bacrc.riology 114, 974. Ensley, B.D.. Ratzkin. B. J., Osslund, T. D.. Simon, M. J., Wackett, L. P. and Gibson, D. T. (1983). Science 222, 167. Feist, C. F. and Hegeman, G. D. (1969). Journal o/Baclerio/ogy 100. 1121. Franklin. F. C. H. and Williams, P. A. (1980). Moleculur and General Genetics 177, 321. Franklin. F. C. H.. Bagdasarian. M., Bagdasarian. M. M. and Timmis, K. N. (1981).Proceedings uf the Nulional Aca(1em.r of Sciences of the United Strrres of Anierica 78, 7458. Franklin. F. C. H.. Lehrbach, P. R., Lurz, R., Rueckert, B., Bagdasarian, M. and Timmis, K. N. ( 1 983). Journal of Bucteriology 154, 676. Friello, D. A,, Mylroie, J. R. and Chakrabarty. A. M. (l976a). In “Biodeterioration of Materials” (J. M. Sharpley and A. M. Kaplan. eds), Vol. 3, pp. 205-214. Applied Science Pubhcations, Essex. Friello. D. A., Mylroie, J. R.,Gibson, D. T.,Rogers, J. E. and Chakrabarty, A. M. (1976b). Journal Of’ Buclrrio/ogy 127, 12 I 7. Furukawa, K.. Miyazaki. T. and Tomizuka, N. (1985). Journd of Bacteriolog~~ 162, 1325. Gaunt. J. K. and Evans, W. C. (1971). Bioclie~ticalJournal122, 533. Gibson. D. T. (1988). hi “Microbial Metabolism and the Carbon Cycle” (S. R. Hagedorn. R. S. Hanson and D. A. Kunz, eds), pp. 33-58. Harwood Academic Publishers, Chur. Switzerland. Gibson, D. T.. Koch, J. R. and Kallio, R. E. (1968). Biochemistry 7, 2653. Gibson, D. T., Hensley. M., Yoshioka, H. and Mabry, T. J. (1970). Biochemistry 9, 1626. Hagedorn, S. R. and Maxwell, P. C. (1988). In “Microbial Metabolism and the Carbon Cycle” (S. R. Hagedorn, R. S. Hanson and D. A. Kunz, eds), pp. 471487. Harwood Academic Publishers, Chur, Switzerland. Hardyama. S., Lehrbach, P. R. and Timmis, K. N. (1984). Journal of Bucteriologj. 160. 251. Hardyama. S., Leppik, R. A., Rekik, M., Mermod, N., Lehrbach. P. R., Reineke, W. and Timmis, K. N. (1986a). Journal of Bacteriology 167, 455. Harayama. S., Rekik. M. and Timmis, K. N. (1986b). Molecular and General Generics 202, 226. Harayama, S., Mermod. N., Rekik, M., Lehrbach, P. R. and Timmis, K. N. (1987a). Journal of Bucrrriology 169, 558. Harayama. S., Rekik, M., Wasserfallen, A. and Bairoch, A. (1987b). Molecular and General Generics 210, 241.
66
S.J. ASSINDER A N D P. A. WILLIAMS
Harayama. S. and Rekik, M. (1989). Gene 78, 19. Harayama. S. and Rekik, M. (1990). Molecular and General Genetics 222, 113 Harayama, S., Rekik, R., Wubblots, M., Rose, K., Leppik, R. A. and Timmis. K. N. (1989a). Journal of Bacteriology 171, 5048. Harayama, S.. Rekik, M., Ngai, K.-L. and Ornston, L. N. (1989b). Journal qf Bacteriology 171. 625 I . Hartmann, J.. Reineke, W. and Knackmuss, H.-J. (1979). Appliedand Environmental Microhiology 37, 421. Heinaru, A. L., Duggleby, C. J. and Broda, P. (1978). Molecular and General Getrelics 160, 347. Hopper. D. J. and .Taylor, D. G . (1977). Biuchcmicu/ Journal 167, 155. Hughes, E. J. L., Bayly. R. C. and Skurray, R. A. (1984). Journal of Bacterio/fJgj 158, 73. Ingram, C., Brawner, M.. Youngman. P. and Westpheling, J. (1989).Journal of Bacteriolugj 171. 6617. Inouye. S.. Nakazawa, A. and Nakazawa. T. (1981a). Juurnal uf Bacteriology 145, 1137. Inouye, S., Nakazawa. A. and Nakazawa, T. (1981b). Journal of Bac*teriology 148, 413. Inouye. S., Nakazawa, A. and Nakazawa. T. (1983). Journal uf Bacteriology 155, 1192. Inouye, S., Nakazawa, A. and Nakazawa, T. (1984a). Gene 29. 323. Inouye, S., Ebina, Y.,Nakazawa. A. and Nakazawa, T. (1984b). Proceedings qf the National Academy uf Sciences qf the United States of America 81, 1688. Inouye, s., Nakazawa, A. and.Nakazawa, T. (1985). Juurnal Uf BUCterifJkJgj 163, 863. Inouye, S., Asai. Y., Nakazawa, A. and Nakazawa, T. (1986a). Journal uf f?acterio/fJgj 166. 739. Inouye, S., Nakazawa, A. and Nakazawa, T. (l986b). Gene 45,235. Inouye, S., Nakazawa. A. and Nakazdwa, T. (1987a). Proceedings uf /he Narional Acudeniy of Sciences ef the United States qf America 84, 5 182. Inouye. S., Nakazawa. A. and Nakazawa. T. (1987b). Juurnd uf Bucteriolugy 169. 3587. Inouye, S., Nakazawa, A. and Nakazawa, T. (1988). Gene 66, 301. Inouye, S., Yamada. M., Nakazawa, A. and Nakazawa, T. (1989). Gene 84. 145. Ishimoto, K. S. and Lory, S. (1989). Proceedings ufrhe Nuiiunul Acudenij ufSciiwe.s qfrlic~United Stcites qf America 86, 1954. Jacoby, G . A. (1974). In “Microbiology 1974“ (D. Schlessinger, ed.), pp. 36-42. American Society for Microbiology, Washington DC. Jacoby. G . A., Rogers, J. E.. Jacob, A. E. and Hedges, R. W. (1978). Nature 274. 179. Jeenes, D. J. (1982). PhD Thesis: University of Wales. Jeenes, D. J. and Williams. P. A. (1982). Journal of Bacteriology 150, 188. Jeenes. D. J.. Reineke, W., Knackmuss, H A . and Williams, P. A. (1982).Journul u/Bacreriologj~ 150, 180.
Johnston. A. W. B. and Downie, J. A. (1984). Trends in Biochemicul Sciences 4, 367. Kallio. R. E. (1976a). Aniericun Socieiy,/br Microhiologj News 42, 204. Kallio. R. E. (1976b). Anierican Socie/y,for Microbiology News 42, 394. Keil. H. and Williams. P. A. (1985). Journal qf Generirl Microhiology 131, 1023. Keil. H.. Keil. S., Pickup, R. W. and Williams, P. A. (l985a). Journal of Bacleriohgy 164, 887. Keil, H., Lebens, M. R. and Williams, P. A. (1985b). Journul uf Bacteriolugy 163, 248. Keil, H., Saint, C. M. and Williams. P. A. (1987a). Journal qfBacreriology 169, 764. Keil. H.. Keil, S. and Williams, P. A. (1987b). Journal qf General Miiwbiologjs 133. 1149. Keshvarz, T., Lilly, M. D. and Clarke, P. H. (1985). Journal qfGeneral Microbiology 131, 1193. Kivisaar, M. A., Habicht, J. K.and Heinaru, A. L. (1989). Juurnul qf’BUCleri(Jl(JgJ2171, 5 1 I I. Kohler, T., Harayama. S., Ramos, J.-L. and Timmis, K. N. (1989). Journal q f B U c t e r i / h g j 171, 4326. Kunz. D. A. and Chapman, P. J. (1981a). Journal qf Bacteriology 146, 179. Kunz, b. A. and Chapman, P.J. (1981b). Journal qfBacieriology 146, 952. Kunz, D. A., Ribbons, D. W. and Chapman, P. J. (1981). Journal of Bacteriology 148, 72. Lebens, M. R. and Williams, P. A. (1985). Journal ofGeneral Microbiology 131, 3261. Lehrbach, P. R.. Ward, J., Meulien, P. and Broda, P. (1982). Journul q/Bacterio/ugj~152, 1280. Lehrbach. P. R., McGregor, I., Ward, J. M. and Broda, P. (1983). Plasmid 10, 164. Lehrbach, P. R., Zeyer, J., Reineke, W., Knackmuss, H A . and Timmis, K. N. (1984). Juurnul U / Bacteriology 158. 1025.
THE TOL PLASMIDS
67
Maxwell. P. C. (1982). United States Patent No. 4,355,107. McClure. N. C. and Venables, W. A. (1986). Jpurnul of General Microbiologj. 132, 2209. McClure, N. C. and Venables, W. A. (1987). Journal of General Microbiology 133, 2073. Mermod. N.. Lehrbach, P. R.. Reineke, W. and Timmis, K. N. (1984). EMBO Journal 31. 2461. Mermod, N., Harayama, S. and Timmis, K. N. (1986a). Bioteclinolngj~4, 321. Mermod, N., Ramos, J. L., Lehrbach, P. R. and Timmis, K. N. (1986b).Journalc?fBNi.reriologj.167, 447. Mermod, N., Ramos, J. L., Bairoch. A. and Timmis, K. N. (1987). Molecular atid Ganiwl Giwi~iii~.s 207, 349. Merrick. M. J., Gibbins, J. and Toukdarian. A. (1987). Moleidur und Gencrul Grtirrics 210, 323. Merrick. M. J. and Stewart. W. D. P. (1985). Gene 35, 297. Meulien, P. and Broda. P. (1982). Journul o/Bac/erin/ng)3152, 91 I . Meulien. P.. Downing, R. G. and Broda, P. (1981). Molecular untl Genrrul Grnerii~s184. 97. Murray. K.. Duggleby. C. J.. Sala-Trepat. J.-M. and Williams, P. A. (1972). Europeun Jnurtiul (Jf Biochrniisrry 28, 30 I . Nakai. C., Hori. K.. Kagiyama, H., Nakazawa. T. and Nozaki, M. (1983a). Journcd ofBin/ngiid Chenii.vlry 258, 29 16. Nakai. C., Kagiyama, H., Nozaki, M., Nakazawa, T., Inouye, S., Ebina, Y. and Nakazawa. A. ( I983b). Journal o/’ Biological Clieniistry 258, 2923. Nakazawa. T. (1978). Journal n f Bacieriology 133, 527. Nakazawa. T. and Yokota. T. (1973a). Journd (JfBucreriologj~115. 262. Nakazawa, T. and Yokota, T. (1973b). Jupatiese Journal qf Bucieriologj~28, 46. Nakazawa. T.. and Yokota, T. (1977). Journal n f Bucteriology 129, 39. Nakazawa, T.. Hayashi. E.. Yokota, T.. Ebina. Y. and Nakazawa, A. (1978). Jnurnul u/’ Buc,rerio/ogy 134, 270. Nakazawa, T., Inouye, S. and Nakazawa, A. (1980). Journal of Bacteriology 144, 222. Nakazawa, T., Inouye, S. and Nakazawa, A. (1990). In “Pseudomonas: Biotransformations, Pathogenesis and Evolving Biotechnology” (S. Silver, A. M. Chakrabarty, B. lglewski and S . Kaplan, eds), pp. 133-140. American Society for Microbiology, Washington. DC. 171, Nifa. A. J.. Mullin. D. A., Ramakrishnan. G. and Newton, A. (1989). Jourtiol~~fBtrcirriology 383. Normore. M. W. (1976). In “Handbook of Biochemistry and Molecular Biology” (G. D. Fasman ed.). pp. 65-240. C R C Press, Cleveland, Ohio. Nozaka, J. and Kusunose. M. (1968). Agriculiurul and Biolngical Clieniisrry 32, 1484. Nozaki. M.. Kagiyama. H. and Hayaishi. 0. ( 19634. Bioihmiical und Binplij~sical Ro.vruri,/i Comniioiicurions 11, 65. Nozaki, M., Kagiyama, H. and Hayaishi, 0. (1963b). Biocheniische Zeitschrifi 338, 582. Nozaki. M.. Ono, K., Nakazawa. T., Kotani, S. and Hayaishi, 0. (1968). Journal o / Biologicul C‘lienii.v/rj,243. 2682. Omori. T. and Yamada, K. (1969). Agriiwlrurul and Biologicul Chrniisrry 33, 659. Omori. T.. Horiguchi. S. and Yamada, K. (1967). Agriculiural and Biological Cheniisrry 31. 1337. Ornston. L. N. and Stanier. R. Y. (1966). Journd qf’Biologicul Chemisirj. 241. 3776. Osborne. D. J.. Pickup, R. W. and Williams, P. A. (1988). Journal ~ f G e n e r u Microbiology l 134. 2965. Ow, D. and Ausubel, F. M. (1983). Nature 301. 307. Pabo, C. 0. and Sauer, R. T. (1984). Annual Reoietc*qf Generics 53. 293. Pemberton. J. M. and Fisher, P. R. (1977). Nurure 268, 732. Pickup. R. W. (1984). P h D Thesis: University of Wales. Pickup, R. W. and Williams, P. A. (1982). Journul o f G m i w l Microbio/ogy 128, 1385. Pickup, R. W., Lewis, R. J. and Williams, P.A. (1983). Journalu/General Microbiology 129, 153. Raibaud. 0. and Schwartz, M. (1984). Annual Rruirn. o/Genrrics 18, 173. Ramos, J. L.. Stolz. A., Reineke, W. and Timmis, K. N. (1986). Proceeditigs qf the Naiionul A r d e n i y of Sciences n f the Unired States of Americu 83, 8467. Ramos. J. L.. Mermod, N. and Timmis, K. N. (1987a). Molecular Micwhiohgj. I, 293. Ramos. J. L., Wasserfallen, A., Rose, K. and Timmis, K. N. (1987b). Science 235, 593. Ray. C.. Hay, R. E.. Carter. H. L. and Moran. C. P. (1985). Journul ofBacteriologj, 163, 610.
68
S. J. ASSINDER AND
P.A. WILLIAMS
Ray. C., Igo, M., Shafer, W., Losick, R. and Moran, C. P. (1988). Journal oflacreriologp 179,900. Reineke. W. and Knackmuss, H A . (1978). Biochimica el Biophysica A d a 542,412. Reineke, W. and Knackmuss, H.-J. (1979). Nature, /London 277, 385. Reineke, W. and Knackmuss, H.-J. (1980). Journal qf Bacteriology 142. 467. Reineke, W., Jeenes, D. J., Williams, P. A. and Knackmuss, H.-J. (1982). Journal qj’Bacteriology ISO, 195. Reiner, A. M. (1972). Journal qf Biological Chemistry 247, 4960. Reiner, A. M. and Hegeman, G. D. (1971). Biochen?istry 10, 2530. Reitzer, L. J. and Magasanik, B. (1986). Cell 45, 785. Reznikoff, W. S.. Siegele, D. A., Cowing, D. W. and Gross, C. A. (1985). Annual Reuiew qfCenrtic.v 19, 355.
Rheinwald. J. G., Chakrabarty, A. M. and Gunsalus, I. C. (1973). Proceedings qf the Nutionul Academj- qf Scirnce.v of rhe h i r e d Stares qf America 70, 885. Rommermann. D., Warrelmann, J., Bender, R. A. and Friedrich, B. (1989). Journalqf’Bacreriolc~gy 171, 1039.
Ronson, C. W., Nixon. B. T.. Albright, L. M. and Ausubel, F. M. (1987). Journal qj’Bacteriology 169, 2424.
Saint,
c. R., McClure, N. C. and
Venables, W. A. (1990). Journd qf General MicrOhIcJkJgy
136,615.
Sala-Trepdt, J. M., Murray, K. and Williams, P. A. (1972). European Journal qfBiuchemi,stry 28, 347.
Schell, M. ( 1986). Proi,iw/ing.s(Ift/leNoriond Academy ofSi.ience.v qfthe United States ofAmerica 83, 369.
Shaw, J. P. and Harayama. S. (1990). European Journal rJf Eiochemisrry, in press. Shaw, L. E. and Williams, P. A. (1988). Journal qfGenerul Microbiology 134. 2463. Sinclair, M. I.. Maxwell. P. C., Lyon. B. R. and Holloway. B. W. (1987). Journul~~f’Bacleriologj~ 168, 1302.
Spooner, R. A., Lindsay. K. and Franklin, F. C. H. (1986). Journal qf’Ceneral Microhiologj, 132, 1347.
Spooner, R. A., Bagdasarian, M. and Franklin, F. C. H. (1987). JournalqfBucteriology 169,3581. Stephens, G. M. and Dalton, H. (1987). Journal qj’General Microhiology 133. 1891. Stephens. G. M. and Dalton, H. (1989). FEMS Microhiokogy Le//ers 55, 175. Suzuki, M., Hayakawa. T., Rekik, M. and Harayama. S. (1990). Journul of’&(J/OgiCU/ Chemistrj~. in press. Timmis. K. N., Lehrbach. P. R., Harayama, S., Don, R. H., Mermod, N., Bas. S., Leppik. R., Weightman. A. J., Reineke, W. and Knackmuss. H A . (1985). In “Plasmids in Bacteria” (D. R. Helinski, S. N. Cohen. D. 8. Clewell, D. A. Jackson and A. Hollaender, eds), pp. 719-739. Plenum Press, New York and London. Tsuda, M. and lino, T. (1987). Moleculur and General Genetii:s 210. 270. Tsuda, M. and lino. T. (1988). Moleculur and Cenerul Genetics 213, 72. Tsuda, M. and lino, T. (1989). Journal qf Bucieriology 171, 1386. Waid, J. S. (1972). Re.vidue Ral~iews44, 65. White, G . P. and Dunn, N. W. (1977). Au.strulian Journal OfI?ilJ/OgiCl// Science 30,345. White. G. P. and Dunn, N. W. (1978). Genetical Research 32, 207. Whited, G. M., McCombie, R., Kwart, L. D. and Gibson, D. T. (1986). J~urnalc?/BNcreriologj, 166, 1028.
Wigmore, G. J., Bayly. R. C. and Di Berardino, D. (1974). Journal qf Eacrrriology 120, 31. Williams, P. A. and Murray, K. (1974). Journal qfBucreriology 120, 416. Williams, P. A. and Worsey, M. J. (1976). Journul ?fEac/erio/ogy 125, 818. Williams, P. A., Taylor, S. D. and Gibb, L.E. (1988a). Journul qfGenerul Microhiology 134,2039. Williams, P. A.. Gibb, L. E., Keil, H. and Osborne. D. J. (1988b). In “Microbial Metabolism and the Carbon Cycle” (S. R. Hagedorn, R. S. Hanson and D. A. Kunz, eds), pp. 339-358. Harwood Academic Publishers, Chur, Switzerland. Wong, C. L. and Dunn. N. W. (1974). Grneticd Research 23, 227. Wong, C. L. and Dunn, N. W. (1976). Genetical Research 27, 405. Worsey, M. J. and Williams. P.A. (1975). Journal qf Bacreriology 124, 7.
THE TOL PLASMIDS
69
Worsey, M. J. and Williams, P. A. (1977). Journal qf Bacteriology 130, 1149. Worsey, M. J., Franklin, F. C. H. and Williams, P. A. (1978). Journal of Bacleriology 134, 757. Yamaguchi, M. and Fujisawa. H. (1978). Journal of Biological Chemistry 253, 8848. Yamaguchi. M. and Fujisawa, H. (1980). Journal of Bio/ogicu/ Cheniis/ry 255. 5058. Yamaguchi, M. and Fujisawa, H. (1982). Journal of BiO/<JgicU/Chemis/ry 257, 12497. Yano. K. and Nishi. T. (1980). Journal ofBacteriology 143, 552. Yano, K.. Homma, S. and Takagi, M. (1981). Biochemical and Biophj..sicu/ Research Comniunications 99, 1245. Yen, K.-M. and Gunsalus. I . C. ( 1982). Proceedings of /he National Acadenij, of Sciences o f t h e h i r e d States of' America 79. 874. Yen, K.-M. and Gunsalus, I . C.'(l985).Journal o f B a c / e r i r h g y 162, 1108. Zeyer, J., Lehrbach. P. R. and Timmis, K. N. (1985). Appliedand Enuironmen/ul Mic~rohiologjsSO, 1409. Zukowski, M. M., Gaffney, D. F., Speck, D., Kaufman, M., Findeli, A,, Wisecup, A. and Lecocq, J.-P. (1983).Proceedings of rhe National Academy ofScience.7 of rhe United States of America 80, 1101.
This Page Intentionally Left Blank
Recent Research into the Physiology of Mycobacterium leprae PAUL R.WHEELER Depcrrtrnmt of' Applied Biology, University of
Hull,
Hull HU6 7 R X , U K
I.
Introduction
.
.
.
.
.
.
.
,
.
.
.
11. Growth of Mycobucrerium lrprue . . . . . . A. Rate of growth and death of Myrohacrerium kprue
111.
IV.
V.
v1. VII. VIII.
. . .
. . . . . . . .
.
. . . .
B. Other actinomycetes in isolates of Mycohactrriuni leprar The cell envelope . . . . . . . , . . . . . A. The plasma membrane . . . , . . . , , , . B. Thecell wall . . . . . . , . . . . . . . C. Wall-associated proteins . . . , . . . . . . . D. Outer layers . , . . , . . . , . , . . . E. Biosynthesis of the envelope . . . , . , , , , , Metabolism in Mj*cobac/rrium Irprue , , . . , , , . . A. lntracellular structure. . . . . . . . . . . . B. Catabolic activities and energy metabolism . . . . . . C. Biosynthetic activities in Mycohac/erium leprar . . . . . Interaction of Mycohacrerium kprur with host cells. . . . . . A. Attempts to kill Mycobucrerium leprue and its intracellular survival B. Stress response to growth in the host . . , , . . . . C . Iron-regulated envelope proteins, exochelins and mycobactin . . D. Adaptation to acquiring nutrients from host cells . . . . . Possible applications . . . . . . . . . . . . . A. Axenic culture of Mycobucrcriuni Ieprur . . . . . . . B. Drug screening . . . . . . , . . . . . . Conclusions . . . . . . . . , . . . . . . Acknowledgements . . . . . . . , , . . . . . References . . . . . . . . . . . . . . . .
. . . . .
,
71 73 73 74 7.5 75 77 78 81
,
82
.
. .
. . . . . . . . .
.
. . . . .
86 86 87 90 99 100
103 104 106 111 11 1 114 1 1.5
118 119
I. Introduction Leprosy bacilli were amongst the first microbes observed to be involved in human disease (Hansen, 1874). Mycobacterium leprae has been consistently isolated from patients suffering from leprosy ever since. Like tubercle bacilli, A D V A N C E S IN MICROBIAL P H Y S I O L O G Y . VOL. 31
ISBN 0-12-027731-X
Copyright IYW. hy Academic Press Limited All rights of reproduction in any form reserved
72
P K WHEELER
leprosy bacilli can be stained with carbol-fuschin and appear as acid-fast rods, though most of the rods do not stain solidly. The overwhelming difficulty in experimental leprosy is that it has proved impossible to develop a system for its axenic culture. Indeed, only 30 years ago (Shepard, 1960) was M . leprae successfully transmitted to an experimental animal-into the foot-pads of mice. Subsequently, disseminated infections have been obtained in athymic mice (Lancaster et ul., 1983), and mangabey monkeys develop experimental leprosy which is a useful model for the course of the human disease (Wolf et al., 1985). The major source of M . k p r u c organisms for work on their physiology has, however, been the experimentally infected armadillo (Kirchheimer and Storrs, 1971) from which about 100 mg (dry weight)-i.e. 10' 2-bacteria can often be obtained. Typically, armadillos are anaesthetized and inoculated intravenously with 108-109M . kpruc organisms. While this is a heavy inoculum, it still takes 12-18 months before the animals develop disseminated disease with sufficiently heavy loads of M . leprar (Rees, 1988). The armadillo was selected because of its low body-core temperature, but the reason most armadillos develop systemic experimental infections is probably due to a defect in their immunity to M.leprw (Binford ~t ul., 1977).Subsequent to the establishment of experimental infection, leprosy was found in wild-caught armadillos. Epidemiological studies traced the infection back to at least seven years previous, and to a separate geographical location, from where experimental armadillo leprosy was developed (Smith ~t ul., 1983; Truman et ul., 1986), no doubt much to the relief of scientists who were working on the experimental disease. Without doubt, this article could not have been written without the armadillo. The considerable attention that leprosy receives is fully warranted. There are I 1 million recorded cases world-wide and, although the disease is not fatal, the misery caused by its disfigurement and stigmatization is disproportionate to the number of individuals affected. Chemotherapy is successful, but requires a long (up to two-year course) of multidrug therapy (Waters, 1989; World Health Organization, 1985). This involves using dapsone, rifampicin and clofazamine. The only effective agents left in reserve are the thioamides, which are unpleasant and relatively toxic (Cartel et ul., 1983),and thiacetazone and thiambutosine, which have no bactericidal effect (Colston et ul., 1978). As dapsone resistance is common, and at least some cases of rifampicin resistance have been seen, it is important to develop new drugs. So far, inhibitors of dihydrofolate reductase based on brodimoprim (Seydel LV a/., 1986),inhibitors of ribonucleotide reductase more potent than thiacetazone (Schaper et al., 1986), ofloxacin (Pattyn, 1987) and minocycline (Gelber, 1987) appear to be particularly promising, A trial vaccine, based on killed, armadillo-derived leprosy bacilli, is in the early stages of assessment (The Lancet, 1987). Since clinical leprosy occurs in
PHYSIOLOGY
OF
M YCOBACTL'RILM LL'PRAC
73
individuals with deficiency in cell-mediated immunity, and mycobacteria themselves modulate the immune response ( M . leprae has a specific immunosuppressive effect), the study of the complex immunology of leprosy has been extensive and fascinating and often dealt with fundamental problems (for reviews, see Kaufmann, 1987; Rook, 1987; Stanford, 1989). The purpose of this review is not, then, to deal with the clinical side, or treatment, or clinical aspects of immunity. Instead, it is to look at the world more from the point of the leprosy bacilli themselves-how they survive in the host which they invade, how they grow, obtain their nutrients and synthesize their structures. Mjwhacterium leprae grows and divides inside macrophages (Mor, 1983) and the Schwann cells of nerve tissue (Mukherjee and Antia, 1985).Thus, while metabolism of M . leprae as studied on isolated suspensions will be reviewed, it will not be dealt with isolation; control of metabolism, and the interaction of M . leprae with host cells are important topics. With this background, some of the applications of research into the physiology of M . leprue-the possibility of screening for drugs without having to grow M . leprue in experimental animals and even the possibilities of axenic culturecan then be discussed.
11. Growth of Mycobacterium leprae A . RATE OF GROWTH AND DEATH OF
Mycohacterium Ieprae
When a suspension o f M . leprae is inoculated into the foot-pad of a mouse, the bacterial population reaches a plateau. Depending upon the isolate, this plateau is 4 x lo5 or 1.3 x lo6 organisms (Rees, 1986),and the plateau value is conserved on passage of the bacteria. The lighter the inoculum, the longer it takes to reach the plateau; with an inoculum of 1-10 organisms, 12 months should be allowed (Shepherd and McRae, 1965;Colston et al., 1978).In disseminated infections, as in lepromatous leprosy and in the armadillo, far greater numbers of bacteria occur. However, division is always very slow with a mean generation time of 12 days (Levy, 1976). However, this value may not reflect how often the dividing bacteria divide. Regardless of the tissue in which they grow, most M . leprae organisms appear dead or moribund whether they are examined by the Ziehl-Neelsen stain (Rees and Valentine, 1962), looking at Na+/K+ ratios (Seydel et al., 1985),vital staining using fluorescein diacetate (Kvach et al., 1984) or under the electron microscope (Silva et a/., 1982). Perhaps M . leprue organisms are in a state of flux between actively dividing, dormant, moribund and dead states. It is apparent that, generally, only 10-30% are intact and thus probably capable of dividing at any one time, so that those which are dividing must divide much more often than the mean
74
P K WHtCLtR
generation time, and perhaps at a rate approaching the rate observed in other pathogenic mycobacteria (Hastings and Morales, 1982). It is not certain why some mycobacteria, in particular M . Irprur, grow so slowly. Mycobacteria have a thick, lipid-rich cell wall and this may retard passage of nutrients into cells. However, this appears unlikely to explain differences in growth rates as slow-growing mycobacteria (which divide every 12-24 hours) and fast-growing mycobacteria (which divide about every two hours) have very similar walls. A more-promising candidate for the factor which limits or controls growth is the rate at which the mycobacterial cell can synthesize DNA or RNA. It takes the slow-growing M . tuherc~ulo.si.s640 minutes to replicate its genome while it takes the fast-growing M. .smrgniuti.s just I10 minutes (Hiryanna and Ramakrishnan, 1986). It has been calculated, from the time required to add one nucleotide residue to a growing RNA chain, that it takes M . tuberculosis 450 seconds to transcribe its 16S, 2 3 s and 5s rRNA genes while this takes Esclzrrichiu coli only about 45 seconds (Harshey and Ramakrishnan, 1977). Furthermore, M . tuberculosis has only one rRNA operon, M . sme~gtizatishas two and E. coli has seven (Bercovier Pt ul., 1986). I t should be possible to confirm that nucleic-acid synthesis is limiting to growth if growth of mycobacteria can be inhibited, without any threshold effect, by inhibitors of DNA or RNA synthesis. Lack of any threshold effect should indicate that there is no excess of the activity being inhibited over that which supports growth, and therefore it is limiting to growth (Kell, 1987). As well as performing experiments with growth inhibitors on cultivatable mycobacteria, it would be of great interest to measure the rate of DNA and RNA synthesis in M . leprue, the slowest-growing of all known bacteria. B. OTHER ACTINOMYCETES IN ISOLATES OF
Mj-cohucteriuni kprtir
Isolated suspensions of M . leprar often contain other actinomycetes. This is particularly common in isolates from armadillos (Portaels rt ul.. 1985) which are, after all, wild-caught animals (armadillos cannot be bred reliably in captivity) and harbour a variety of mycobacterial infections in the wild (Smith et al., 1983). It has been suggested that the other actinomycetes, which may be corynebacteria (Cocito and Delville, 1983) or mycobacteria (Cocito and Delville, 1983; Portaels et a/.. 1982, 1985), are in fact “helper” organisms, even symbionts, which M . leprue needs for growth, and this could explain the failure to grow M . &rue in axenic culture. Support for this idea comes from work showing 14-fold stimulation of the growth yield of M . Ieprar in mice by live “leprosyderived corynebacteria” (Delville rt ul., I982), though this increase represented just over one logarithmic unit in seven and was not tested for statistical significance. Further support comes from the observation that exochelin from a difficult-to-grow mycobacterium isolated from armadillos mediates iron
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
75
uptake into M . leprae (Hall and Ratledge, 1987). However, sources of M . leprae-human skin and wild-caught armadillos-are liable to contamination with environmental microbes so any actinomycetes other than M . leprae could simply be contaminants. It now appears that suspensions of M . leprue obtained from experimentally infected athymic mice are usually free from other actinomycetes (Portaels et a/., 1985) suggesting that M . leprae does not need any “symbiont” to grow in these mice. As, however, the symbiont idea is a persistent one in mycobacteriology, it would be useful if dilutions of suspensions of M . leprae made with a view to diluting out any other actinomycetes were to be inoculated into germ-free athymic mice, and a determined search made to detect any associated acid-fast bacilli, “leprosyderived corynebacteria” or non-acid-fast forms. Finally, on a practical note, it is important to check for contaminants in suspensions of M . leprue, when they may interfere with experimental work. I t is possible to d o this by looking for breakdown products of lipids which do not occur in M . leprae. In this way, contaminations can be detected at a rate of one organism for each 1000 M . Ieprae organisms (Larsson et af., 1985). I t is certainly advisable to perform any experiments on several isolates of M . leprae to check that results are consistent and not influenced by chance contaminants which will not be the same from one isolate to another (Portaels et al., 1982, 1985).
111. The Cell Envelope
Most studies on the envelope of M . leprae have been directed at its structure, although the term “structure” implies something that is fixed while the term “physiology” suggests dynamic processes. However, a study of the structure of the envelope of M . leprae, particularly at a molecular level, is the study of a most dynamic system, one which must replicate itself each time the bacterial cell divides. Producing a new envelope makes considerable demands on the anabolic aspects of the physiology of the bacteria. For example, about 40% of the weight of M . leprae is lipid which must be synthesized; most of that lipid is in the envelope (Draper, 1982).
A. T H E PLASMA MEMBRANE
There is something unusual. about the plasma membrane of M . leprae. Sections prepared for electron microscopy that are prefixed with aldehydes show M . leprae cells with a symmetric double membrane, while both membranes stain positively with a periodic acid-Schiff base stain, i.e. PAS+
76
P R WHEELER
(Silva and Macedo, 1984).Other mycobacteria (and Gram-positive bacteria generally) havejust the outer membrane that is PAS', and have symmetric but PAS-, membranes when they are moribund or dead. This applies to mycobacteria whether grown in oiuo or in axenic culture (Silva and Macedo, 1984).Thus, the double, PAS' membrane is a special feature in M . Ieprue. However, this unusual staining is an artifact due to prefixation with aldehydes, compounded by using frozen, infected tissue. When sections are fixed with osmium tetroxide as the first part of the fixation process, 90% of M . Iqmw cells have asymmetric double membranes when fresh infected tissue is used and 25% have asymmetric double membranes when frozen infected tissue is used. These asymmetric double membranes have only the outer membrane PAS' (Silva et al., 1989).What is unusual about M . leprae is the susceptibility of its plasma membrane to aldehyde fixation and freezing. Neither M . uuiuni, M . lqwaeniurium, M . tuberculosis H3,Ra (Silva et al., 1989)nor a range of cultivatable mycobacteria (Silva and Macedo, 1984)showed such susceptibility in their plasma membranes to either or both treatments. Lipids in the plasma membrane of M . leprae are, in general, typical of mycobacteria, diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylinositol and mono-acylated phosphatidylinositol mannosides making up most of the polar lipids. Diacylated phosphatidylinositol mannosides, which are usually found in mycobacteria, were not detected in M . Ieprue (Minnikin et d., 1985).However, a simplified pattern of phosphatidylinositol mannosides was also found in host-grown M . lepraenwrium (Young, 1981). so it needs to be investigated whether such a pattern is found in mycobacteria grown in cioo generally rather than being a characteristic of difficult mycobacteria. Bacterial plasma membranes contain many enzymes. However, few attempts have been made to locate enzymes in M . leprae (Wheeler, 1984b) as the ultrasonic disruption used to prepare extracts for enzymology would be sufficient to shake some enzymes from the membranes, making interpretation of findings equivocal (Brodie and Gray, 1957). However, a 3,4-dihydroxyphenylalanine-oxidizing activity is firmly bound to membranes (Prabhakaran et al., 1973). The role of this activity is not known but it appears to be restricted amongst mycobacteria to M . leprae. Also, acid hydrolases P-glucuronidase and N-acetyl-P-glucosaminidase, which hydrolyse oligosaccharides to monosaccharides to which bacteria are permeable, were shown to be on the surface, presumably in the membrane, of M . leprae (Wheeler et al., 1982).Other proteins which are involved in iron uptake and wall synthesis can be detected in membrane fractions of mycobacteria. As these appear either to be involved in translocation of material from the membrane to the cell wall, or in the process of translocation themselves, they are dealt with in Section 1II.C.
77
PHYSIOLOGY OF M YCOEACTERIUM LEPRAE
B. THE CELL WALL
The cell wall of M . leprae contains peptidoglycan (Fig. l), as in most bacteria. However, the polymer differs from most in that N-glycollylmuramic acid (NGMA) residues are linked to the tetrapeptide (Draper et al., 1987). Residues of NGMA are typical of mycobacterial peptidoglycans (Draper, 1982) but other bacteria usually contain N-acetylmuramic acid residues. The tetrapeptide in M . leprae is unusual, too, having glycine substituting for L-alanine (Draper et al., 1987; Fig. 1). Studies with relatively easy-to-handle mycobacteria (reviewed by Draper, 1982) show that about one NGMA residue in nine is linked to a side chain of arabinogalactan containing 3-4 arabinose residues for each galactose residue (Draper tv al., 1987). Arabinose residues are esterified with mycolic acids. Mycolic acids are 8-keto fatty-acid esters; in M . leprae they contain about 80 carbon atoms (Kusaka et al., 1981). The wall components are probably arranged (Fig. 2) to give a hydrophobic exterior, with mycolic acid residues forming a parallel binding region (suggested by Minnikin, 1982) which might function like an outer membrane. There is virtually no information on the permeability of mycobacteria, though it is often speculated that their wall makes them less permeable than other bacteria to many molecules. However, one interesting observation is that M . leprae is relatively permeable to the
I
GlcNac
I
Me so - Diarninop Irnelate"
I D -Alanine*
FIG. 1. The peptidoglycan unit in Mycobncterium leprae walls. * forms cross links with vneso-diaminopimelate in adjacent peptide chains; GlcNac, N-acetyl /Iglucosamine residue; NGMA, N-glycolyllmuramicacid residue.
78
P R WHEELER
I! I!l1!
)B e ,
t
FIG. 2. Structure of cell envelope of Mycohacteriurn Ieprue. All of the components, their locations and covalent bonding are shown but the orientation of lipids has not been determined. A, plasma membrane; B, cell wall; C, outer layers (probably the electron-transparent zone); D, a host cell; e, peptidoglycan; C, arabinogalactan; g, mycolic acid residue; h, phenolic glycolipid I ; j, lipoarabinomannan; m, carbohydrate; -, fatty-acyl chain. Structures for g and h are shown in more detail in Fig. 3. tetracycline minocycline (Gelber, 1987). The inference is that minocycline enters because it is particularly lipophilic. The wall of mycobacteria makes them relatively permeable to hydrophobic molecules a n d relatively impermeable to hydrophilic molecules. However, hydrophilic molecules (e.g. glucose, adenosine) d o enter M . leprae (Wheeler, 1984b) while lipoarabinomannan lipopolysaccharides span the entire envelope (Fig. 2; Hunter et ul., 1986) perhaps providing a passage for the entry of many hydrophilic molecules. C. WALL-ASSOCIATED PROTEINS
Apart from the structural elements already referred to, which confer shape and hydrophobic nature on the wall, the wall of M . leprue contains a considerable amount of protein. When organisms are extracted t o remove soluble proteins and superficial lipids (see Section 1II.D) and lipoarabinomannan, 26% of the remaining cell-wall core is protein (Kaplan p t al.,
PHYSIOLOGY OF MYCOEACTERIUM LEPRAE
79
1988). Further extraction of bound lipid, digestion of peptidoglycan and removal of carbohydrate leaves a wall-protein complex containing minimal residual amounts of sugar and peptidoglycan (about 2% each of the total weight of the complex); the complex can be resolved in 6~ urea showing a molecular mass of 2000-20,000kDa (Hunter et al., 1989). The complex includes avidly bound proteins, recognized by both monoclonal antibodies raised against a 65 kDa protein in soluble extracts of M . leprae (Kaplan et al., 1988)and by T cells derived from leprosy patients which react against 7, 16, and 28 kDa peptides (Mehra et al., 1989). As the complex retains all of the immunological activity, for Tcells, ofintact M . leprae(Kap1an er al., 1988)it is probably the major determinant in provoking protective immunity against leprosy. Some peptides are more avidly bound than others. When walls are prepared by differential centrifugation, most of the 65 kDa protein is lost (Kaplan et al., 1988), but there is preliminary evidence for a covalent attachment between a 23 kDa peptide and diaminopimelate (Hunter et al., 1989) in the peptidoglycan (Fig. 1) in M . tuberculosis. The wall-protein complex of M . leprae thus appears to be one of 28, 16 and 7 kDa peptides in avid contact with a small amount of peptidoglycan to which highly variable amounts of a 65 kDa protein are attached (Hunter el a/., 1989).The variability of the amount of 65 kDa protein is consistent with the likelihood that it is involved in assembly of protein complexes and subunits, like the GroEL protein in walls of E. coli (see Section V.C). The wall-protein complex is obviously of great immunological interest but there must also be wall-associated proteins, possibly part of the complex, which are involved in metabolic functions such as wall assembly. Clues as to which proteins with enzyme activity may be found in M . leprae come from studies in other actinomycetes, in which wall-associated activities with functions in the biosynthesis of mycolate or location of mycolate in the mycobacterial cell wall (see Section I1I.E. for further details) have been found. An enzyme which condenses two fatty-acid (palmitic acid) molecules to give a C,, acid identical in its chemical form to mycolic acid is found in the wall of Bacterionema marruchotii. The wall fraction is absolutely essential to detect its activity; a membrane fraction is not a substitute. If a similar enzyme is involved in forming the /3-keto ester, mycolic acid (Fig. 3), it is likely to be in the wall of M . leprae. Mycolic acids are probably transferred to arabinogalactan by a trehalose mycolyltransferase, an enzyme which has been detected in M . smegniatis (Sathyamoorthy and Takayama, 1987). If this enzyme is found in all mycobacteria (which is likely as they all have mycolates in their walls) then it must surely function in the wall, though most of the activity of this easily dissociated enzyme appeared in the 105,000 x g supernatant of disrupted M . smegmatis (Sathyamoorthy and Takayama, 1987),presumably because it was shaken out of the envelope during disruption. There is also a lectin with
80
P R. W H E E L E R
Yycollc acld HO COOH I I I ~ ~ ~ ~ y c ~ i a t e u n i t ( o -XH,~ ~ . ~ ~ . ( ~ ~ ,
Phenolic glycollpld I Phthiocerol
-
0
0
H,C OCH, -(CHZ)..CH.CH.CHZ,CH~ I I
(CH,).--CH.CHz.CH
I
0
I
0
FIG. 3. Chcmical structures of mycolic acid and phenolic glycolipid I. Terms used: nieromycolate, up to C,, fatty acid, with unsaturated bond, cyclopropyl rings, and other functions; phthiocerol, C3s-C37 dihydroxy alcohol; mycocerosate, C,,-C,, tetrainethyl branched fatty acid.
a subunit molecular mass of 12 kDa excreted by M . smrgmaris into its medium. The binding properties of the lectin are most interesting as it only binds strongly with mycobacterial arabinogalactan (Kundu r t ul., 1989).If this lectin is widespread amongst mycobacteria, and has a function in the envelope, it may be in organizing and orientating the arabinogalactan in the arabinogalactan-mycolate complex. Finally, iron-regulated envelope proteins (TREPs) appear in the envelope of M . l q r u e , Analogous proteins (180,84,29,25 and 14 kDa) appear in the wall of iron-deficiently grown M . smegmutis. Evidence that at least two, the 25 and 14kDa IREPs, are truly wall associated comes from the demonstration that, after a one-day incubation of an iron-deficient (axenic) culture, these two IREPs appear in the membrane only of M . smegmatis, revealing their location and showing that the wall is not contaminated with them during fractionation of the bacteria. After incubation for three days in iron-deficient culture, the 25kDa and I4kDa IREPs appear in the wall, suggesting that they are synthesized in the membrane and transferred to the wall (Sritharan and Ratledge, 1990). The IREPs are not, however, covalently bound to the peptidoglycan (Hall et ul., 1987).In M . Ieprue, IREPs would be expected to be present in the wall and to be involved in iron acquisition as the ability to
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
81
scavenge iron from the environment is a prerequisite for pathogenicity (Griffiths, 1985; discussed further in Section V.C). D. OUTER LAYERS
Mycobacterial material does not finish at the boundary of the cell wall. Huge amounts of a distinctive glycolipid (phenolic glycolipid I, PGL-I; see Figs 2 and 3) occur in host tissue from which all M . leprae organisms have been isolated. Phenolic glycolipid is not covalently bound to the wall, but probably associates with the outside of the wall through hydrophobic interactions (shown in Fig. 2) between its fatty-acyl side chains which are mycocerosate moieties and the fatty-acyl chains of mycolic acids (structures in Fig. 3). The glycolipid is certainly located on the outside of isolated M . leprae organisms (Young et al., 1984; Boddingius and Dijkman, 1989) and probably forms, in part, the electron-transparent zone observed around M . leprae (Fig. 4). Other
FIG. 4. Transmission electron micrograph showing Mycobacterium leprae organisms inside a bone-marrow macrophage 1 day post-infection. The mycobacterial cells (about 0.5 pm diameter), inside phagosomes, are of variable integrity but this variability was present in the suspension of Mycobacteriunz leprae prior to infection. A dense layer (ODL) appears outside an electron-transparent thin layer which probably corresponds to lipid material at the outside o f the cell wall. An electron-transparent zone (ETZ) surrounds the bacteria, and prevents contact between mycobacteria and host-cell hydrolytic enzymes shown by the black, granular staining which detects acid phosphacase.
82
P R WHEELER
.lipids which are not bound covalently to the wall, and may contribute to the electron-transparent zone are phthiocerol dimycocerosate (the structure in Fig. 3 without the sugar and phenolic-group residues, essentially the lipid part of PGL-I; Draper et al., 1983) and trehalose monomycolate (Dhariwal ut al., 1987). The latter, however, probably represents mycolate in transit to the arabinogalactan-mycolate complex of the cell wall. Trehalose dimycolate, also known as cord factor, cannot be detected in M . ieprae (Dhariwal et al., 1987). Thus one of the few mycobacterial components which is cytotoxic (though toxicity can only be demonstrated by injecting experimental animals with cord factor; Silva et a/., 1988) is absent from M . leprae. All of the abovementioned components are minor components, compared with PGL-I, thus PGL-I must be the major mycobacterial component of the electrontransparent zone. E. BIOSYNTHESIS OF THE ENVELOPE
The prospect of studying biosynthesis of the complex structures already reviewed above, shown in a very simplified form in Fig. 2 (and for mycolic acid and PGL-I in more detail; Fig. 3), in such a difficult-to-obtain microbe as M . leprae seems daunting. However, many of the types of molecules that are synthesized are found in rapidly growing mycobacteria. For instance, peptidoglycan biosynthesis could be studied in M . smegmaris, and biosynthesis of the a-type of mycolate in M. fallax, which produces substantially only amycolate (Wheeler, 1986b). Then M . feprue could be used to address the problem of detailed differences between M. leprae and other mycobacteria, e.g. the glycine-residue substitution in the peptidoglycan and the length of the cc-chain in the mycolate. Even so, information on envelope biosynthesis is extremely scarce and fragmentary. A D,D-carboxypeptidase has been found in membrane fragments of M . smegmatis which hydrolyses links between residues of tncsodiaminopimelate and D-alanine and between D-alanine residues (Eun r t NI., 1978).A similar enzyme could be operating in M . /cyme (see Fig. 2) but, apart from a report of incorporation of labelled amino acids into the peptidoglycan of M . smegmatis (Murty and Venkitasubramanian, 1984).nothing else definite is known about peptidoglycan metabolism. A y-glutamyl transpeptidase, which hydrolyses bonds between D- as well as L-amino acids and uses glycyl-r>amino-acid dipeptides as acceptors for glutamate (Shetty et al., 1981),may be involved in cell-wall metabolism. Although glutamate has not been detected with certainty as a component of the peptidoglycan of M . leprae, polyglutamic acid peptides are found covalently attached to the peptidoglycan of M . tuberculosis (Wietzerbin-Falszpan et ul., 1973). Biosynthesis of mycolate, the major lipid in the wall, and its attachment to
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
83
the wall, are subjects of great interest. As these lipids are only found in mycobacteria, it is thought that any agent that interfered with their biosynthesis might provide a lead to developing highly selective drugs against all mycobacteria (Wheeler, I986b). A possible scheme for mycolate biosynthesis is shown in Fig. 5. Enzymes have not been identified in mycobacteria for any of the steps except for a trehalose mycolyltransferase (mentioned in Section 1II.C) which catalysed the following reactions (Sathyamoorthy and Takayama, 1987): trehalose 6-monomycolate + [14C]trehalose =['4C]trehalose 6-monomycolate + trehalose (i) [ ''C]trehalose 6-monomycolate
+ trehalose 6-monomycolaie e[14C]trehalo~e6,6'-dimycolate + trehalose (ii)
If this enzyme can use arabinogalactan as a mycolate acceptor (the last step in the scheme in Fig. 5) it would be the enzyme involved in transferring mycolate residues to their final location in the wall. It is definitely an anabolic enzyme as it has no acylhydrolase activity for trehalose mycolates. The condensation step, to give the mycolates which are 8-keto esters of two fatty acids (in M . leprae it involves a c 2 6 acid and a meromycolate; see Fig. 3 for mycolate structure and Fig. 5 for this step in the pathway), appears to occur as the last step in mycolate biosynthesis. In experiments with [14C]acetate in intact M . ,/orfuitum, c24-Cz6 acids and meromycolates (see Fig. 5 ) become labelled early during incubations and their specific radioactivity then falls as the specific radioactivity of mycolates increases (Lacave e f al., 1987). No enzyme has been detected in mycobacteria for this step, but the type of condensing enzyme which may be involved has been demonstrated in walls of Bucterionema matruchotii (see Section 1II.C; and Shimikata et al., 1986)and in extracts of Corynebacteria diplztheriae (Walker et al., 1973),where it catalyses condensation of two palmitate molecules into a P-keto ester (corynemycolic acid). This is a reaction which is probably much more amenable to biochemical studies than formation of mycolates, typically with 70-80 carbon atoms, in mycobacteria (Fig. 5). Information on steps on the pathway for mycolate biosynthesis before the condensation step has proved very hard to come by, and attempts to obtain such information have sometimes yielded results which seem unrelated to the pathway. Homologous series of fatty acids, which appear to be precursors of meromycolates from the positions of functions such as double bonds and cyclopropyl rings, have been isolated from intact M. tuberculosis (Takayama eta/., 1978).This suggested that chain elongation was taking place, two carbon atoms at a time, through a fatty-acyl elongase type of reaction. Fatty-acyl elongase activity to extend palmitate to up to C S 6acids has been demonstrated in cell-free extracts of M . tuberculosis (Qureshi et al., 1984). In addition,
id
o-c24:I -.5h
Elongation, desaturotion. introduction of cyclopropyl rings (requires S-odenosylmethtonine)
/
Methylation of the ocid; then epoxide formotion, elongation
i
0- ,C, -CS4 a -rneromycolo te
+ Ketomeromycolote 0- C-,,C ,,
4
a-rnycolate
Condensation
+Ketornycolote Transfer
Ketomycolate
I
Arabinose
\
a -mycol ate
I
Arobinose
-Peptidoglycan-arabinogalactan
wal I matrix-
FIG. 5. A working hypothesis for mycolate biosynthesis in Mycohacterium kprue. It is important to note that this hypothesis is based on detection of a homologous series of Patty acids and studies on incorporation of radioactive label into growing mycobacteria that produce the same types of mycolates as Mycohacterium leprae. Studies with cell-free extracts have been carried out with other actinomycetes. None of the reactions shown has been demonstrated, but some enzyme activities with model substrates suggest that at least some of the reactions in this scheme occur (details are in the text). Glucose stimulates condensation reactions in Bacterionema rnatruchotii. Transfer reactions have been demonstrated with trehalose; coenzyme A and possibly acyl-carrier protein may be involved in other reactions. 0 ,carrier molecule.
85
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
S-methyl[ ''C]adenosylmethionine was incorporated almost entirely into C4,-C,, acids suggesting that introduction of cyclopropyl rings (see Fig. 5) occurs late on the pathways to meromycolates (Qureshi et al., 1984). However, the products of the cell-free system were not meromycolates or their likely precursors. Ketomycolates and a-mycolates, the two types which occur in M . Ieprae, are almost certainly synthesized by separate, parallel pathways (Fig. 5) as their stereochemistry and chain length are different. Moreover, at least in growing cultures of M.,fortuitum(Lacave et al., 1987)and M . aurum (Lacave et al., I989), oxygenated mycolates are labelled before a-mycolate in experiments using [14C]acetate, which rules out a-mycolate as a precursor of ketomycolate. The homologous series of fatty acids (Takayama et al., 1978) already referred to strongly suggests a C,, A5 acid as an intermediate for mycolate biosynthesis (Fig. 4), at least for a-mycolate biosynthesis (Minnikin, 1982). This is strongly supported by the finding that CZ4A5 is the major unsaturated C,,-C,, acid in M . phlei (Couderc et al., 1988). However, and perhaps this is a measure of the difficulties and frustrations inherent in trying to elucidate these pathways, formation of such an intermediate has never been demonstrated in mycobacteria. A desaturase for C,40 has been isolated from M . smegmatis (Kikuchi and Kusaka, 1986), but its only product is a Cz4 A15 acid. The other desaturase demonstrated in M . phlei is a A9 desaturase which acts on a C,, (, acid (Fulco and Bloch, 1964). Elongation of this product would again give C24 I A15. As PGL-I is such a prominent antigen in M . leprae, its biosynthesis is also of great interest. Its structure is shown in Fig. 3 (see also Hunter et al., 1982). Suspensions of M . ieprae incorporated carbon from [14C]palmitate into PGL-I (Franzblau et al., 1987) suggesting that this activity may be amenable to study, although so far labelled PGL-I has only been identified by thin-layer chromatography (Franzblau et al., 1987). Mycobacterium leprae in macrophages incorporated carbon from ['4C]acetate into PGL-I (Mukherjee et al., 1985). However, since M . leprae does not incorporate acetate into lipids (see Section IV.B.l; also Wheeler and Ratledge, 1988a) it is likely that the macrophages converted acetate into intermediates, probably fatty acids, which M . leprue could then use. An alternative approach to elucidating the pathway of biosynthesis, but again concentrating on biosynthesis of the lipid part of the glycolipid, is to use growing tubercule bacilli. In this way, incorporation of [2-14C]propionate into their phenolic glycolipid has been demonstrated (Thurman and Draper, 1989) and an enzyme, mycocerosate synthase, demonstrated in M . tuberculosis (Rainwater and Kolattukudy, 1985). The enzyme uses saturated fatty acids as its substrates, and elongates them using methylmalonyl-CoA instead of the usual substrate for an elongase, malonylCoA. In this way the characteristic tetramethyl branched fatty acids found as part of the PGL-I molecule (Fig. 3), namely mycocerosates, are synthesized.
,
,
,
86
P. K. W H E t L k K
IV. Metabolism in Mycobacterium leprae As M . Ieprue has not been cultivated axenically and has only been observed to divide inside host cells (see Section I), it must be considered an obligate intracellular parasite. As such, its metabolism may reflect a dependence upon host cells since it has certain key activities lacking. Thus a major objective in studying metabolism in M . leprue is to determine which activities are lacking, and thus to what extent M . leprue is dependent upon the host. I t then follows that potential axenic culture media could be devised so as to compensate for the metabolic deficiencies in M . kprue. When any activities are shown to be lacking in M . Iepru', it is important to distinguish whether this is a reversible adaptive change for intracellular growth, as will occur in other intracellular mycobacteria which can be grown both axenically and it1 uioo, or whether it is an activity permanently lost. Therefore, this review contains information on metabolism in M . uuium and M . microti, both grown axenically and in animals, which helps to interpret findings, usually of lack of activity, in M . Iepruc. All of the experiments reviewed here with intact M . uuiuni and M . microti were carried out in buffers, not growth media, and the bacteria were not dividing. This is essential, otherwise observed metabolic differences between M . Ieprac and other mycobacteria could simply be a result of the other mycobacteria growing during incubations in which metabolic activities were determined. So far, I have concentrated on metabolic activities lacking in M . Ieprue. There will, however, be many metabolic activities in M . kprue which are found in the saprophyte M . smegmutis or even E. coli. Where found, they are referred to, as it is importadnt to know the metabolic pathways which operate in M . leprue, and to rule out possible deficiencies as well as demonstrate them. A. INTRACELLULAR STRUCTURE
I t is inside the cell (as opposed to the envelope) where most of the metabolic activities reviewed below take place. In the electron microscope, intracellular structure appears typically bacterial, with ribosomes (Rastogi rt al., 1982) and storage granules (Hirdta, 1983). Paracrystalline bodies, which can be stained for carbohydrate with periodate-silver, are also found in a few M . feprae cells, and also in about 5% of M . uuium cells-but only when grown in host tissue (Rastogi el ul., 1982). Mesosomes have been demonstrated in sections of M . leprae (Hirata, 1978) but these are generally considered to be artifacts in bacteria. There has been no convincing demonstration of DNA in electron micrographs but the genome is slightly smaller than that of M . tuhcrculosis, and unusually rich in guanine and cytosine residues for a mycobacterium (Athwal et d., 1984; Clark-Curtiss et ul., 1985). Its homology with DNA from other mycobacteria and corynebacteria is low (Antoine et ul., 1988;
PHYSIOLOGY OF MYCOBAC7TRILIM LLPRAE
87
Grosskinsky et al., 1989). Part of the ribosomal RNA has been sequenced and its base composition places M . feprae firmly in the taxonomic group mycobacteria, equally distant from M . auium and M . tuberculosis (Smida et af., 1988). B. CATABOLIC ACTIVITIES AND ENERGY METABOLISM
I. Catabolism of’ Carbon Sources One of the reasons why M . feprae might be dependent upon the host is that if it is a metabolic cripple, in the sense that it lacks central pathways for carbon dissimilation (Doelle, 1975), it would be unable to generate energy. At one time, this idea seemed particularly attractive because of studies with M . leprarmurium. This mycobacterium, the causative agent of rat leprosy, was not cultivated axenically until about two decades ago (Ogawa and Motomura, 1971; Pattyn and Portaels, 1980). It lacked the ability to dissimilate glucose, though it could use the second part of the Embden-Meyerhof pathway to dissimilate glycerol (Tepper and Varma, 1972). However, all of the enzymes of the Embden-Meyerhof glycolysis pathway, the hexose monophosphate pathway (Wheeler, 1983) and the TCA cycle (Wheeler, 1984a; Wheeler and Bharadwaj, 1983) have been detected in M . feprae. Reports that aketoglutarate dehydrogenase is not present in extracts of M . feprae (Mori et ul., 1971, 1984) reflect the difficulty in detecting this enzyme generally in mycobacteria. Most enzymes catalysing reactions’in carbon metabolism are present in extracts of M . Ieprue at about one-tenth of their specific activity in extracts of other mycobacteria (Wheeler, 1984b, 1986~).a-Ketoglutarate dehydrogenase is particularly difficult to detect but, if sought with sufficient determination, it can be found. Neither a-ketoglutarate dehydrogenase, nor any of the other enzymes of carbon metabolism, is a contaminant derived from the host tissue from which M . leprae must be isolated. All of them were detected in extracts made from M . leprae treated with sodium hydroxide, to abolish host-derived activities, and all of them could be distinguished by their biochemical properties, often by mobility on polyacrylamide gels, from host enzymes. The authenticity of bacterial enzymes when the bacteria are harvested from the host is clearly very important, and it is dealt with comprehensively in reviews by Wheeler ( 1 984b) and Barclay and Wheeler ( 1989). With their complement of catabolic enzymes, it is not surprising that suspensions of M . Ieprae break down carbon sources such as pyruvate, glucose and glycerol to release carbon dioxide. Lipids are also possible carbon sources for M . Ieprae. Carbon dioxide can be released from a wide range of fatty acids (P. R. Wheeler, K. Bulmer and C. Ratledge, unpublished observation) and is
88
I' R WHEELER
also released from L-3-phosphatidylcholine (P. R. Wheeler and C. Ratledge, personal communication) but not from acylglycerols (P. R. Wheeler, unpublished observation). The last example may be a matter of presenting M . leprae with acylglycerols in a form in which they can be metabolized, rather than a true lack of ability to use them. Further details of the phospholipase, which must release fatty-acyl moieties from phosphatidylcholine before they can be oxidized to carbon dioxide, are presented later (Section IV.C.1). The order of rapidity of release of carbon dioxide from saturated fatty acids is C , , > C, > C,, > C,, > C,, > C , , > CZ4. This pattern occurs in other mycobacteria, regardless of how they are grown, and does not appear to be related to the ability to accumulate fatty acids. Therefore, it is probably related to p-oxidation of the fatty acids. Enzymes for /%oxidation in M . kprar have been identified, and the one which accepts a saturated fatty acid (as a CoA ester), acyl-CoA dehydrogenase, has 1.5 times more activity with decanoylCoA than palmitoyl-CoA. This higher activity with decanoyl-CoA is observed with the acyl-CoA dehydrogenase in extracts from M . auiuni and M . niicrotias well as from M . keprm. This supports the view that evolution ofcarbon dioxide from fatty acids is at least partly related to the activity of this enzyme with different substrates, though carbon dioxide is released from decanoic acid 2-10 times more rapidly than from palmitic acid using intact mycobacteria, including M . kprat (P. R. Wheeler, K. Bulmer and C. Ratledge, unpublished observation). A4ycobuc'teriiirn Ieprue uses one unusual carbon source not taken up by other mycobacteria, 6-phosphogluconate, which is taken up and rapidly oxidized to carbon dioxide (Wheeler, 1983).Mycohacterium kprae may have a specific mechanism for uptake of this substrate, as it certainly does not hydrolyse it to phosphate and gluconate and then use the gluconate (Wheeler, 1983).The intracellular mechanism for utilization of 6-phosphogluconate by M . Icprue involves a great (about 100-fold) excess of 6-phosphogluconate dehydrogenase activity over the activity of the previous enzyme in the hexose monophosphate pathway, namely glucose-6-phosphate dehydrogenase. This excess is unique amongst mycobacteria so far studied (Wheeler, 1983). One possibility is that M. ltpraecan use its ability to scavenge 6-phosphogluconate from macrophages in which they reside; 6-phosphogluconate is generated during activation of macrophages (Karnovsky et al., 1975). The one carbon substrate which M . leprae does not use, but which other mycobacteria metabolize rapidly, is acetate (Wheeler and Ratledge, 1988a). Acetate enters M . keprrir at pH 5 but not at pH 7. I t is not metabolized at either pH value. The reason appears to be that phosphotransacetylase, the enzyme that converts acetyl phosphate into acetyl-CoA in the only mycobacterial pathway for activating acetate, is deficient in M . leprae. This deficiency cannot be explained by repression of phosphotransacetylase in host-grown
PHYSIOLOGY
89
OF M YCOBACTERlUM LEPRAt
mycobacteria, as its activity is slightly enhanced when M . microti or M . avium is grown in vioo as opposed to axenically. Acetate is an unlikely exogenous carbon source in the environment of M . leprae, namely the host cell, added to which the mycobacterium would not be able to metabolize efficiently any acetate generated endogenously by deacetylation reactions. In E. coli, this deficiency is not fatal but does restrict the number of carbon sources on which the microbe can grow (Le Vine et al., 1980); so, by analogy with E. coli, it may be that M . Ieprae is limited in the number of carbon sources it can metabolize by its inability to metabolize acetate efficiently. 2. Eriergy Metabolism Since carbon dioxide is evolved from carbon sources when they are incubated with suspensions of M . leprae, it appears that the TCA cycle is being used for oxidative metabolism and energy generation. No formal demonstration of ATP generation coupled to oxygen consumption has been made with M . leprae, though it has with M . lepraemurium (Ishaque et al., 1981). What has been detected in M . leprue are the cytochromes for a complete electrontransport chain (Fig. 6, from results of Ishaque e f a/. (1977) and Mori ef a/. (1984)) and ATP. The product of coupled electron transport, namely ATP, is present at a mean intracellular concentration of 2 m in~ M . leprae (about lOOpg (lo6 organisms)-'; Nam-Lee and Colston, 1985; Kvach et al., 1986; Franzblau and Hastings, 1987). Together, their presence strongly suggests that M . Ieprue is capable of oxidative metabolism. Mycobacteria grown in host tissue generally appear to show a slower rate of oxidative metabolism than mycobacteria grown axenically, a phenomenon discussed most recently by Segal ( I 984) and Barclay and Wheeler (1989), and this is probably a result of Malote -FAD-phospholipid
NADH-FlovoproteinNQ,
Succinote -Flovoprotein
cyt b (or 6 ,?)+cyt
o
c-cyt
cyt
02
? or
\
v2
0,
FIG. 6. Electron transport in Mycobacterium Ieprar. Components have either been detected in Mvcobacteriurn leprae treated with sodium hydroxide or are distinct from host components and therefore must be authentic bacterial components, unless annotated with a question mark. cyt, cytochrome.
90
P R WHEFLFR
down-regulation. Mvcohucterium leprue has a fumarase uniquely susceptible to proteolytic activity amongst the mycobacteria so far studied (Wheeler, 1984a; 1986a) so, if the activity of the TCA cycle can be modulated by a protease at this point, it may represent a mechanism for control of the cycle and thus oxidative metabolism.
c.
BIOSYNTHETIC ACTIVITIESI N Mycohucterium lcprue
I f it is not the failure of M . Ieprue to use the carbon sources provided in the usual culture media that has thwarted attempts to cultivate it axenically, it may be that M . leprue requires biosynthetic intermediates and has become dependent upon its host for them. Many parasites have evolved this kind of metabolic dependency. For instance, trypanosomes (Hammond and Gutteridge, 1984) and malarial parasites (Sherman, 1979) cannot synthesize purines by the de i i o i i o pathway, and Giurdiu lunthliu, a flagellate protozoon which causes diarrhoea, lacks the ability to synthesize purines, pyrimidines (Aldritt et ul., 1985) and fatty acids (Gillin pt a/., 1986; Jarrol et d., 1981), so that they must scavenge the intermediates they cannot synthesize for themselves from their host. I. Futtjv- A cid Biosynthesis urttl Sruvengittg in M ycobacterium leprae M?,cohrrc.tPriiinileprcre synthesizes many unique lipids, some of which are discussed in Section 111 and represented in Fig. 2. As many of the lipids are not found elsewhere in nature, or are at least restricted to mycobacteria, M . Icpruo must synthesize them itself. However, fatty acids are intermediates on pathways for lipid synthesis, and some fatty acidscould be scavenged from the environment. I f M . Iqwcir lacked the ability to synthesize fatty acids, then it would be dependent on the host for fatty acids. Suspensions of M . IcJpruedid not incorporate label from carbon sources (e.g. acetate (see Section 1V.B.I), glucose, glycerol) into fatty acids (Wheeler and Ratledge, 1988a). Even though this activity was repressed in M . uuium and M . microtigrown in iiitio, it was still detectable so that there may be a deficiency in fatty-acid biosynthesis de n o w in M . leprue. However, with extracts of M . feprue, a trace activity of fatty-acid synthase ( I .7 pmol malonyl-CoA incorporated into fatty acid per minute per mg protein) could be detected (Wheeler et a/., 1990). This was about 600 times lower than the activity previously reported for M . tuh~~rcu1u.si.sgrown in Youmans and Karlson medium though it was about 5 % of the repressed fatty-acid synthase activity found in M . nticroti grown in mice. When the activity in M . loprue was converted to pg lipid synthesized per min per 10'" bacteria it became clear that, relying entirely on cle n o w fatty-acid biosynthesis, it would take 23 days
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
91
for M . leprae to synthesize sufficient lipid for a population of organisms to double. The mean generation time for M . leprae is 12 days (Levy, 1976). Extrapolation from activities measured in extracts to requirements of intact organisms can be misleading. However, when M . microti and M . avium are grown in Dubos medium, where they rely on fatty-acid biosynthesis to supply all of their lipid requirement, the measured rates of de novo synthesis would provide them with sufficient lipid to double their population every 6.1 and 5.2 hours, respectively. Since their mean generation time in this medium is about 24 hours (Chadwick, 1982; Wheeler, 1987a), fatty-acid biosynthesis does not limit their growth rate. These calculations with M . microti and M . auium validate the conclusion that fatty-acid biosynthesis limits the growth rate of M . leprur. Thus leprosy bacilli need a source of fatty acid when they are growing inside cells and probably also if primary culture on axenic medium is to be achieved. Though de nooo fatty-acid synthase activity in M . leprae is inadequate for growth, M . leprue does contain a highly active fatty-acid elongase capable of modifying fatty acids by lengthening them two carbons at a time. An activity of acetyl-CoA-dependent fatty-acyl-CoA elongase has been demonstrated with decanoyl-CoA and palmitoyl-CoA as substrates and is present in extracts of M . Ieprae at an activity similar to that found in extracts of M. auiun?,also grown inside experimental host animals (Wheeler et a/., 1990). Strangely, this acetyl-CoA-dependent elongase is more active than malonyl-Co A-dependent elongase in intracellular mycobacteria, even though the malonyl-CoAdependent reaction is energetically more favourable as it is driven by a decarboxylation step which does not occur in the former system. In M . leprae, M. uiiiuni (Wheeler et a/., 1990) and M . lepraemurium (Kusaka, 1977), acetylCoA-dependent elongation is readily detected while malonyl-CoA-dependent elongation is barely, if at all, detectable. In order to supply the malonyl-CoA (albeit in only small quantities) for lipid metabolism, the enzyme acetyl-CoA carboxylase (the enzyme that converts acetyl-CoA to malonyl-CoA) must be present in M . leprae. This enzyme is difficult to assay in mycobacteria (Erfle, 1973) and could not be detected in extracts of M . lepraemurium (Kusaka, 1977), presumably because it was repressed by the lipid-rich Ogawa medium on which it was grown (Ratledge, 1982).The best opportunity for detecting and characterizing this enzyme in M . Ieprae seems to be to use the emerging mycobacterial genetics. Biotinylated proteins of M . leprae are expressed in E. coli (Collins et al., 1987) and, if these are acyl-CoA carboxylases, it should be possible to express them in a way which may be impossible in host-grown M . leprae. As acetyl-CoA needed for elongation and carboxylation reactions cannot be generated from acetate in M . leprae (see Section 1V.B.I), most of the acetylCoA required during fatty-acid anabolism must be supplied from pyruvate,
92
P. R. WHEELER
using pyruvate dehydrogenase (Wheeler, 1984a). The exogenous fatty acids that are required by M . Ieprae to be incorporated into their complex lipids must initially be used to prime the elongation systems already referred to. However, it is unlikely that free fatty acids are scavenged directly from the host or would be suitable for axenic culture of M . leprap as they are too toxic, both for host cells and mycobacteria (Saito et al., 1984).Therefore, exogenous fatty acids are probably going to form the fatty-acyl moieties of lipids such as lipoproteins, acylglycerols or phospholipids in the host. As bacteria generally are not permeable to these molecules, they would have to be broken down to release fatty acids which could then be taken up, probably by specific transport mechanisms (Nunn, 1986)or in hydrophobic mycobacteria possibly
Host cell
Reoctions on surface Cell of Mycobuchrium Iepue of or outside Mycobucterium /epro# Long-chain fotty acids, rnerornycolates 3
FIG. 7. Proposed scheme for scavenging of fatty-acid moieties from the environment by Mycohricterium leprue. Reactions annotated by a question mark have not been shown in MJ’C/Jh~iCttJriLW?? lepruc, but seem likely. It is unlikely, by analogy with other microbes, that catabolic activities (e.g. (I-oxidation) and anabolic activities (e.g. fattyacid elongase) occur at thc same time. -, fatty acids or fatty-acyl moieties; 0,carrier molecule.
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
93
by a facilitated diffusion mechanism. A clue as to which lipids is provided by isolation of difficult-to-grow mycobacteria. Their primary cultivation is usually best carried out using media which include phosphatidylcholine, such as Lowenstein-Jensen or Ogawa media (Chadwick, 1982; Portaels et al., 1988). Following this lead, recent work demonstrated a phospholipase activity which can release fatty acids from phosphatidylcholine in M . leprae; it has either A , or both A , and A, activity (P. R. Wheeler and C . Ratledge, unpublished observation). Like the acetyl-CoA-dependent fatty-acyl-CoA elongase, this phospholipase activity is present at relatively high activity, similar to the activity in M . avium and M . microti grown in vivo (P. R. Wheeler and C. Ratledge, unpublished observations) and it is induced or derepressed in M . avium and M . microti grown in vivo or in axenic medium containing a source of lipids. So it appears that, with high activities of both phospholipase and elongase, M . leprue at least as isolated from the armadillo is committed to scavenging fatty-acid moieties from its environment (summarized in Fig. 7). 2. Nucleotide Metabolism: Pyrimidine Scavenging and Nucleotide Biosynthesis and Scavenging A pyrimidine-scavenging activity, leading to incorporation of thymidine into DNA, has been known for a long time (Drutz and Cline, 1972).This is because it seemed an attractive activity to use for estimating the viability of M. feprue in suspension (Khanolkar et al., 1978)or even intracellular M . leprae (Nath er al., 1982; Mittal et al., 1983).However, recent work has shown that many other pyrimidines are incorporated into the DNA of M . leprae, virtually all more rapidly than thymidine (Wheeler, 1989a).Cytidine and uracil are incorporated most rapidly, and can be used to supply all other bases (see Fig. 8). Pyrimidine biosynthesis could not be detected in M . leprae using the classic precursors 14C-labelled carbon dioxide and aspartate but, when the bacteria were sonicated and extracts prepared, enzymes for the de novo pathway of pyrimidine synthesis could be detected (Wheeler, 1989b).Comparative studies with M . microti and M . avium, grown both in vivo (in mice) and axenically, showed that pyrimidine biosynthetic activity was strongly depressed in mycobacteria growing in host tissue (Wheeler, 1990). This appeared to be a result of feedback inhibition because, as with M . leprar, the enzymes could be detected when host-grown mycobacteria were sonicated and extracts made, a procedure which diluted any feedback inhibitors present in the bacterial cells over 100-fold (Wheeler, 1989b).Aspartate transcarbamylase, the first enzyme on the pathway, was also repressible, but only during axenic culture (i.e. of M . microti and M . avium) in the presence of pyrimidines. However, the specific activity of this enzyme was higher in mycobacteria grown in vivo than in those grown axenically without added pyrimidines, so that control by feedback
94
P. R. W H E E L E R
Host cell Reoctiona on surface
Cell of Mycobacterium leproe
of or outride Mycobacterium leproe
I
FIG. 8. Scheme showing pyrimidine scavenging and nucleotide synthesis by M~~c.ohtrc.ri~r.irrt~i kiyuc. Major reactions (-4and Minor reactions (--- +) arc indicated. For enzymes, low or inhibited activity occurs in Myohucteriuni kpriw; for uptake, the substrate is present at low concentrations, < I p ~ inside , the host cell. Feedback inhibition (...-+) is also shown. Enzyme types shown: I , phosphoribosyltransferases; 2, nucleoside kinases (deoxynucleoside-kinase activity also, for Cdr. Udr as well as Tdr): 3, nucleoside phosphorylases (can use deoxyribose I-phosphate or ribose I-phosphate); 4,deaniinase; 5, CTP synthetase. CI indicates that the enzyme presence was suggested by studies with intact M j ~ c o b ~ i c r ~ r i uIepwcJ, t ~ z h that d U M P is required for this reaction, and L' that conversion to dCDP; d U D P was implied by studies with inhibitors (Colston er d., 1978; Schaper er d., 1986).Bases: C, cytosine: U, uracil: T, thymine. Nucleosides: Cr, cytidine; Ur, uridine; Tdr, thymidine.
PHYSIOLOGY OF MYCOEACTERIUM LEPRAE
95
inhibition must be the mechanism for its control in all host-grown mycobacteria, including M . Ieprae, studied so far (Wheeler, 1990). Finally, the effect of the nucleotides UTP, CTP, and ATP as feedback inhibitors (see Fig. 8) could be demonstrated on aspartate transcarbamylase activity using extracts of M . lepruc, M . microti and M . uvium (Wheeler, 1990). Uridine nucleotides are the end-products of the de nouo biosynthetic pathway, and the most common source of the pyrimidine ring in host cells (Lesse rt ul., 1984). Mycohucterium leprue can either synthesize the uracil base structure itself, or acquire it from the host (Wheeler, 1990) and then make all of the other pyrimidine nucleotides from it (Wheeler, 1989a; Fig. 8). It can be deduced from various approaches that M . leprae can also make pyrimidine deoxyribonucleotides (Fig. 8), which indeed it must, as they are virtually unavailable in host cells (Cohen et ul., 1983; Pogolotti and Santi, 1982). Nucleotides inside host cells (e.g. UMP, UTP) are broken down by M . leprae to nucleosides (e.g. uridine) which it can then take up (this is discussed further in the following section). 3. Nucleotide Metabolism: Purine Scavenging Like pyrimidine biosynthesis, purine biosynthesis de nouo could not be detected in M . leprur (Wheeler, 1987a) using the classical precursors which are, for purine synthesis de n o w , 14C-labelledserine and glycine. However, unlike pyrimidine metabolism, enzymes of the de nouo synthetic pathway for purines could not be detected in M . leprue (Wheeler, 1987b). Furthermore, purine biosynthesis could be detected quite readily in M . microti or M . auium, both grown in mice. Experiments with these two cultivatable mycobacteria, grown either in mice or in axenic culture with or without purines, could not explain the failure of intact M . leprae to synthesize the purine ring by regulatory mechanisms (Wheeler, I987a). Repression or inhibition of purine synthesis was very weak with studies using M . microti or M . avium. Only in M . avium was any notable depression of purine biosynthesis observed. Even so, relative to hypoxanthine incorporation, the rate of purine biosynthesis was depressed only five- to six-fold in M . avium grown in a minimal medium, containing a low concentration of nitrogenous nutrients and 50 P M adenine, or grown in mice, compared with M . uuium grown in Dubos medium (Wheeler, 19874. Relative rates were useful in interpreting experiments with mycobacteria grown in different ways, as their metabolic status appeared to vary depending on growth conditions. For instance M . microti isolated from mouse tissue synthesized purines 1.3 times more rapidly than M . microti grown in Dubos medium, but they scavenged hypoxanthine 1.5 times more rapidly (Wheeler, 1987a). Even when M . leprae was stored by incubating in buffer, and even when incubations with serine were carried out for 7 days,
96
P
H WHEtLEH
purine biosynthesis could not be detected. The rate of purine biosynthesis in M . microti, judged by incorporation of serine into nucleic acids, was 600 times greater than the lowest possible rate detectable, and therefore the highest possible rate of synthesis in M . Ieprae. Thus M . leprae depends upon the host for a supply of preformed purines, even though i t can synthesize the pyrimidine ring. Any single source of the purine ring is sufficient to supply the purine requirement of M . leprae though some, for instance guanine nucleotides or inosine, could only be utilized very slowly (Khanolkar and Wheeler, 1983). The most readily available sources of purines are described in Fig. 9, which illustrates purine scavening in M . leprae. Inside the host cell, both purines and pyrimidines will be present mainly as nucleotides (Huntinget al., 1981; Lesse et ul., 1984). For example, the base hypoxanthine is present at up to 2 0 p while ~ the adenine nucleotides AMP, ADP and ATP together are found at 6 m ~ (Baulieu et al., 1982; Hunting et ul., 1981). (A more comprehensive survey is given in Table I1 of an article by Barclay and Wheeler (1989).) However, M . leprae cannot take up nucleotides directly: this has been shown with labelled AMP, GMP (Wheeler, 1987a), ATP (Nam-Lee and Colston, 1985) and the pyrimidine nucleotides UMP and UTP (Wheeler, 1990). For all nucleotides, any uptake of radioactivity is dependent upon the presence of phosphatase activity. Most of the phosphatase is adsorbed from the host. Whether this adsorption is an adaptation by M . leprae or an artifact will be discussed later (Section V.D.4).However, if phosphatase activity is inhibited by molybdate or fluoride, or abolished by treatment of the suspension of M . leprar with sodium hydroxide, uptake of radioactivity is inhibited or completely abolished (Wheeler, 1987a, 1990). Nucleosides are always detected in the incubation mixtures containing nucleotides when the surface phosphatase activity is not abolished (Wheeler, 1987a, 1990).I t follows that, inside the cell, M . leprae first hydrolyses nucleotides to nucleosides (e.g. AMP to adenosine; UMP to uridine) and then takes up the nucleoside. This is a typically microbial activity. Most microbes are impermeable to bulky, charged nucleotides. Only a few specialized parasites, such as Bdellovihrio hacteriovorus (Ruby and McCabe, 1986)and Rickettsia spp. (Atkinson and Winkler, 1985; Winkler, 1976), have mechanisms for taking up nucleotides directly. Evidently, M . Ieprae is not as specialized as these parasites in this respect. 4 . Amino-Acid Uptake and Biosjntht.sis
Aspartate, serine and glycine were all taken up by M . leprae so that the failure of the leprosy bacilli to use them to synthesize purines cannot be explained as a failure to transport these precursors (Wheeler, 1987a). The only pathways of amino-acid metabolism that have been studied in M .
PHYSIOLOGY
Host cell
OF
MYCOEACTERIUM LEPRAE
Reactions on surface of or ortride M)+co~oc-
97
CelI of Mycobocterhm /eproe
terium /epros
T'
No direct uptake
AMP ATP
GDP
GTP
A Ir
_____
Hx
_____
G
_____
-
Gr - - - - Serine Glycine-
FIG. 9. Scheme showing scavenging of purine nucleotides by Mycobacterium leprae. Major reactions (-) and minor reactions (---+) are indicated. For enzymes there is low activity; for uptake, the substrate was at a low concentration, < 2 ,UM,inside the host cell. The ability of Mycohacterium leprae to metabolize substrates is related to activity of enzyme types I (phosphoribosyltransferases) and 2 (nucleoside kinases). Other enzyme types: 3, nucleoside phosphorylases; 4, deaminases; 5, oxidoreductases (deaminating); 6, oxidoreductases together with amino-group-adding or deaminating reactions have been shown for these interconversions (Khanolkar and Wheeler, 1983). Bases: A, adenine; Hx, hypoxanthine; G , guanine. Nucleosides: Ar, adenosine, Ir, inosine, Gr, guanosine.
98
P K WHEELER
kprae are those for synthesis of amino acids from aspartate (Fig. 10).Very
small amounts of radioactivity appeared in the amino acids shown in Fig. 10 when suspensions of M . lepme were incubated with labelled aspartate (Sritharan et al., 1989). The slow rate of incorporation may be a result of repression, as in M . uuium, with homoserine dehydrogenase being undetectable (Sritharan et a/., 1989). Amino acids could also function as feedback inhibitors (Fig. 10)in M . Ieprae and, if available in the host, they may be accumulated, as has been shown in M . .sniegmatis (Sritharan et al., 1987),to concentrations (1-10 mM) at which they function as inhibitors. Since M . uuiuni from host tissue has no detectable homoserine dehydrogenase, it synthesizes only a trace of methionine and threonine (Sritharan et ul.. 1989). In contrast, extracts of M . leprae have homoserine dehydrogenase at above 70 times the specific activity found in extracts of M . auiurn, and M . leprue incorporates carbon from aspartate mainly into methionine as well as lysine (Sritharan P I id., 1989).This may be an adaptation to the availability to M . Ieprue of some amino acids, but not others, when inside host cells. Direct studies of amino-acid acquisition by M . leprur are very limited.
Aspartate.
%
Asparagine
I
4 Is0leuc I ne .'
FIG. 10. Biosynthesis of amino acids from aspartate by Mycohucterium leprrw. In experiments with aspartate, --+ indicates activity in Mycohacterium leprae and -11 activity present in most microbes but not in Mycohacterium leprae. For enzyme activity, ... + indicates feedback inhibition; 1, aspartokinase; 2, homoserine dehydrogenase.
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
99
Apart from aspartate, glycine and serine, uptake of only glutamate (Prabhakaran et af., 1983)and leucine (Prasad and Hastings, 1985) has been demonstrated. All incubations lasted at least 24 hours, so that the mechanism of uptake may have been diffusion or facilitated diffusion rather than (or as well as) active transport. Mycohucterium leprae does take up amino acids from mixtures of these acids (protein hydrolysates) and incorporates them into proteins. That protein synthesis is involved is confirmed by the inhibitory effect of chloramphenicol but not cycloheximide (Khanolkar, 1982). Unfortunately, the protein synthesized by M . leprae in these incubations was not hydrolysed and analysed, so it is not possible to deduce which of the amino acids supplied were used. An unusual activity is uptake (Khanolkar e t al., 1981)and subsequent oxidation (Prabhakaran et al., 1973)of 3,4-dihydroxyphenylalanine(DOPA). As DOPA is so easily auto-oxidized, it would be easy to dismiss these observations as artifacts and not metabolic processes. Although DOPA oxidation probably has nothing to do with pathways of amino-acid utilization in M . kprue (DOPA oxidation is a metabolic “dead e n d producing melanin), it may have something to do with oxidation and reduction of quinones (DOPA quinone is the product of the oxidation) and thus the respiratory chain (Mori et al., 1984). The final activity to be dealt with in amino-acid metabolism is ;j-glutamyl transpeptidase (Shetty et al., 1981).As this is likely to be involved in cell-wall metabolism. the reader is referred to Section 1II.E. 5. Folute Biosyntlzesis
If M . leprae was unable to synthesize folate and tetrahydrofolate, it would be dependent (at least indirectly) on other microbes for the folate ring. In fact, the two key enzymes for the end part of the pathway for dihydrofolate synthesis, dihydropteroate synthase (Kukarni and Seydel, 1983) and dihydrofolate reductase (Seydel ef al., 1986), were both detected in cell-free extracts made from radiation-killed M . leprae, which clearly retained these enzyme activities after irradiation. The objective of the work on folate biosynthesis was to explain the action of dapsone, and search for new drugs acting on the pathway. With sulphones and benzylpyrimidines (e.g. brodimoprim) active against M . leprae (Seydel ef ul., 1986), it was not surprising to find that this pathway is operating in M . leprue. V. Interaction of Mycobacterium leprae With Host Cells Mycohacterium leprae enters host cells through phagocytosis (Band et al., 1986;Lowrie, 1986).The organism must first be able to survive attempts by the
100
P. R. WHEELER
host cell to kill, and starve it. Then it must acquire nutrients from the host cell in order to grow and divide.
A. ATTEMPTS TO
KILL
Mycobacterium leprae
AND ITS INTRACELLULAR
SURVIVAL
It is difficult to determine exactly the mechanisms used by host cells in their attempts to kill mycobacteria, as the experimental work inevitably involves taking cells (macrophages) out of the complex interregulated immune system inside the host. What seems reasonably certain is that macrophages are activated, and that they then mount a potentially lethal toxic, chemical attack directed apparently at the surface of the invading mycobacterium (Lowrie and Andrew, 1988).The potentially lethal elements are toxic oxygenderived radicals and a drastic reduction in pH value which allow the action of degradative enzymes to digest the bacteria. Additionally, free fatty acids, some of which are toxic to mycobacteria, may be released (Kanetsuna, 1985).These changes usually follow fusion of phagosomes and lysosomes, though the fall in pH value can occur in phagosomes without fusion taking place (Mellman e l a/., 1986). I t is evidently misleading to pick out any one element as the main mechanism involved in killing mycobacteria. Experimentally, it was possible to show killing of intracellular tubercle bacilli by peroxide (Lowrie, 1983) but, more recently, it has been shown that killing of strains of M . tuberculosis by macrophages (producing peroxide) from immune pulmonary granulomas is not related to the susceptibility of the bacteria to peroxide(Lowrie et af.,1985). Thus if peroxide is involved in killing it may be potentiating other killing mechanisms, or require to be in some way directed, but is not on its own the killing mechanism. Mycohacterium leprae appears to be potentially highly susceptible to attack by oxygen-derived radicals, as it lacks any detectable catalase, the enzyme required to break down peroxide (Wheeler and Gregory, 1980). Although it has superoxide dismutase activity (Kusunose et uf., 1981; Wheeler, 1984c; Wheeler and Gregory, 1980),this appears not enough on its own to protect M . /eprue.In other microbes lacking one ofcatalase or superoxide dismutase, very high activity of the other enzyme is required to prevent very highly toxic hydroxyl radicals forming (Halliwell, 1982). Moreover, strains of tubercle bacilli lacking catalase but with superoxide dismutase, which occurs in all strains of tubercle bacilli, are particularly susceptible to oxygen free radicals in cell-free systems (Jackett et al., 1978; Sharp et ul., 1985)and, in similar model cell-free systems, M . leprue is almost as susceptible as these strains (Klebanoff and Shepard, 1984; Sharp et al., 1985; see Table I in Barclay and Wheeler
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
101
(1989) for comparisons). Nevertheless, M . leprae is a successful pathogen and must have ways which are effectiveinside the host ofevading attempts to kill it. While M . leprae stimulates peroxide and superoxide generation by macrophages only weakly, it is certainly not inhibitory to this process (Holzer et al., 1986; Sharp and Banerjee, 1985; Kaplan et al., 1986). The mycobacterium organisms can also inhibit phagosome-lyosome fusion, but 14 hours after phagocytosis), this is a weak effect. As an early event ( inhibition of fusion can be reversed by coating the bacteria with antiserum against M . leprae (Frehel and Rastogi, 1987) though reversal of fusion inhibition was not observed later (14 hours or more after phagocytosis) (Sibley et al., 1987). The component which inhibits fusion thus appears to be on the surface of the mycobacterial cells, and perhaps is secreted. A more promising way for M . leprae to avoid killing by the host cell lies in its ability to escape from phagosomes or phagolysosomes into a relatively friendly environment, namely the cytoplasm of the macrophage (Evans et a/., 1973),where M . Ieprae has been shown to divide (Mor, 1983). However, escape into the cytoplasm is not immediate and the ability of activated macrophages to clear M . leprae in uitro (Sibley et al., 1987) suggests that the mycobacterium can be exposed to attempts by the host cell to kill it. Perhaps the key protection for M . leprae from a toxic environment is a capsule-like layer, observed as an electron-transparent zone (see Fig. 4). This zone appears around M . Ieprae inside host cells and, in some electron micrographs, hydrolytic enzymes produced by macrophages appear to be excluded from the wall of the engulfed M . leprae by their electron-transparent zone (Ryter et al., 1984, and see Fig. 4). Firmer evidence for a protective role for the electron-transparent zone is its correlation with pathogenicity in mycobacteria. Saprophytic mycobacteria never produce such a zone. Pathogens vary in their ability to produce an electron-transparent zone inside host cells (Rastogi and David, 1988). This variation amongst pathogens is possibly explained by other survival mechanisms being more important to some pathogens. For instance, M . tuberculosis H,,R, (v = virulent) is relatively poor at forming an electrontransparent zone (about 15% of H,,R, cells form a thin electron-transparent zone; H,,R, (a = avirulent; poor growth in guinea-pigs) cells never do so (Frehel et al., 1986);but the tubercle bacilli can inhibit phagosome-lysosome fusion. Phenolic glycolipid, the main mycobacterial component of the electron-transparent zone in M . leprae, can scavenge peroxide and protect cells against peroxide-dependent killing, as shown by coating Staphylococcus aureus with PGL-I (Neil1 and Klebanoff, 1988). If PGL-I and other lipids coating the surface of M. leprae (see Section 1II.D) can act in this way inside host cells, then the electron-transparent zone which includes these lipids may indeed be an important survival mechanism in M . Ieprue.
102
P R WHEELER
Other mycobacteria which are surrounded by a wide electron-transparent zone, the M . uiiium group of organisms, have peptidoglycolipid as the major mycobacterial component of their electron-transparent zone. In both M . leprae and M . uvium, however, the zone is formed round the bacteria inside host cells. It appears to be a result of production of lipid by these bacteria following their interaction with host cells. With live bacteria, the proportion of the population surrounded by an electron-transparent zone increases with time, though killed mycobacteria, when engulfed in host cells, also form a zone. This suggests a role for an interaction with host components rather than the need for live mycobacteria, at least for initial formation ofa zone(Ryter P I al., 1984; Frehel PI a/., 1986). There must be another, mycobacteriumdependent factor in the formation of an electron-transparent zone, other than production of unbound lipids since M . tuberculosis (which forms poor zones) and M . .smegmciri.s and M . gusrri (which form no zones and are killed by macrophages; Frehel ef al., 1986) all produce mycosides (glycolipids or peptidoglycolipids) which are not bound to the wall. Studies with mutants which do not produce mycosides should help to determine the importance of unbound lipids and of the electron-transparent zone in pathogenicity. Such work must becarried out with mycobacteria other than M . leprae, as mutants cannot be raised with an uncultivatable microbe. However, studies with mutants need to be done with considerable caution. A strain of M . avium which lacks the ability to synthesize peptidoglycolipid still multiplied inside macrophages and formed electron-transparent zones almost as well as M . uoium, which could synthesize peptidoglycolipid. I t seems possible that precursors of peptidoglycolipid functioned as well as the peptidoglycolipid in these experiments (Rastogi and David, 1988). In this context, it is worth remembering that phthiocerol dimycocerosate, a possible precursor of PGL-I. is present in small amounts as one of the unbound lipids of M . kprue (Section 1II.D). To summarize, the electron-transparent zone appears to be a mainly lipoidal barrier which forms as a reaction between host cells and pathogenic mycobacteria, principally M . avium and M . leprue. I t appears to be a physical barrier to harmful components of the host-defence system, and a scavenger of toxic oxygen-derived radicals. A major component of the zone in M . keprae is PGL-I. However, this lipid is not confined to the zone (see Section 1II.D) so that the effects of PGL-I on host cells may not be related to zone formation. Recently, it has been shown that the weak inhibition of phagosome-lysosome fusion is not related to zone formation (Frehel and Rastogi, 1987), although this inhibition generally appears to be mediated by surface or superficial lipids (Goren, 1977) which might include PGL-I in M . leprue. Finally, the host is not required for formation of superficial lipid material, at least in M . uvium which can be grown axenically and which excreted
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
103
peptoglycolipid into culture medium (Draper and Rees, 1973). Recent electron micrographs, using for the first time a relatively gentle technique for embedding bacteria in Lowicryl resin, show a transparent zone about the same size, 50-100 nm outside the peptidoglycan, as the zone observed around M . aviurn and M . tuberculosis. No such zone is seen around M . smegrnatis (FrChel et al., 1988). Thus it may be that, on infection, M . leprae and other mycobacteria which produce an electron-transparent zone enter host cells already surrounded by some sort of capsule.
B. STRESS RESPONSE TO GROWTH IN THE HOST
Macrophages respond to ingestion of bacteria in a way which can be generalized as host-defence. However, bacteria have general response mechanisms too, and a well studied one is their stress response. Typically, stress such as temperature, toxic, or generally unfavourable or radically changed conditions can induce a stress response in bacteria. When microbes are growing inside a host, they usually show a stress response. One of the characteristics of the stress response in bacteria is that a number of distinctive stress proteins, highly conserved not only in bacteria but throughout all living organisms, are synthesized in large amounts. Their role appears to be to regulate cell functions and, during stress, to make sure that the functions essential for the cell’s survival under difficult conditions are carried out (Lindquist, 1986). It is the high degree of conservation of stress proteins throughout nature that has enabled their identification in M . leprae. During a programme to raise monoclonal antibodies to antigens in M . leprae using cell-free extracts, it was found repeatedly, and in independent laboratories, that antibodies were raised to five dominant antigens (Engers et al., 1985; also see Table 1 in Young, 1988). Later, all of the five antigens were shown to be expressed in a E.gtl1 genomic library for M . leprae by screening with the monoclonal antibodies that had been raised against them in cell extracts (Young et al., 1985). Thus it was possible to characterize the five M . leprae antigens, not only by their antigenic cross-reactivity but also by their sequences. So far, two are known to be stress proteins. A 65kDa protein, found in all mycobacteria studied to date, corresponds to the GroEL protein of E. coli, with over 50% sequence homology (Schinnick et al., 1988). The GroEL protein is involved in assembly of protein subunits to make oligomeric proteins (Hemmingsen et al., 1988). A 70 kDa protein, found also in tubercle bacilli, has a high degree of DNA sequence homology with the hsp 70-family protein from Plasmodium ,fakiparum,E. coli and Xenopus laevis. I t bound strongly to ATP (Garsia et al., 1989), a characteristic of the hsp70 family of proteins which are involved in
104
P. R. WHEELER
protein translocation and secretion and probably recognize signal peptides in immature proteins (Chirico et al., 1988). Strictly, the evidence shows that stress proteins are produced by M . leprae, not that a stress response occurs in M . leprae for it to survive and grow in the host. Stress proteins were originally identified by studying the response of cells to shock, but they are synthesized at a lower level duringgrowth without stress (Lindquist, 1986). Without the capacity for axenic culture for M . leprae, the stress response in mycobacteria growing in the host will have to be studied in tubercle bacilli (for which gene libraries are also available) as they can be grown in uiuo as well as axenically. However, elaboration of stress proteins generally by microbes during infection (Lindquist, I986), and the essential requirement of Sulmonella typhimurium to mount a stress response to toxic oxygen metabolites (see Section V.A) for its intracellular survival (Morgan P ( al., 1986) in particular, suggest that the relatively large amounts of immunodominant stress proteins found in extracts of M . leprue indicate that it too mounts a stress response for successful intracellular infection of its host.
C. IRON-REGULATED ENVELOPE PROTEINS, EXOCHELINS AND MYCOBACTIN
All microbes, including mycobacteria, must be able to respond to a particular stress, namely iron depletion, to survive and grow inside the host. However, this response is not part of the general stress response. Iron deprivation is a stress which all microbes must be able to overcome. In an aerobic environment, iron, in the ferric state, is in saturated solution at about M at neutral pH values. Inside the host, free iron is virtually nonexistent; it is all sequestered in iron proteins such as ferritin and transferrin. Moreover, the host responds generally to infection by decreasing the rate of iron absorption by the intestine and increasing the amount of iron sequestered in ferritin (see Barclay, 1985). During mycobacterial infections, the amount of iron (stored in iron proteins) in macrophages decreases in proportion to the intensity of the cell-mediated immune response mounted against the mycobacteria (Lepper and Wilks, 1988). This part of the host response to infection is known as nutritional immunity, and examples of other nutrients which the host attempts to withhold from mycobacteria will be given later (Section V.D). For the reasons already stated, possession of a specialized mechanism to scavenge iron is a prerequisite for microbial pathogenicity (Griffiths, 1985). However, the response to iron stress appears to be distinct from the more general response to stress (Lindquist, 1986) discussed in Section V.B. When strains of mycobacteria are subject to zinc depletion (one of the ways of inducing a general stress response), synthesis of the 65 kDa stress protein is
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
105
usually enhanced (de Bruyn et al., 1989), but synthesis of protein associated with iron deficiency is not (Sritharan and Ratledge, 1990). The response to iron depletion in mycobacteria is to elaborate in a coordinated fashion a set of iron-regulated envelope proteins (IREPs) and two siderophores known as exochelin and mycobactin (Hall et al., 1987; Sritharan and Ratledge, 1989). Four of these proteins are recognized by SDS-polyacrylamide-gel electrophoresis in M . smegmatis, and polyclonal antibodies raised against one of them, a 29 kDa protein in the cell wall, strongly inhibited exochelin-mediated iron uptake (Hall et al., 1987).A similar pattern of IREPs is observed in M . auium grown iron deficiently, or harvested from host tissue as well as M . leprae, while such proteins are notably absent from M. auium grown iron sufficiently (Sritharan and Ratledge, 1990). As expected for proteins involved in acquiring such a difficult-to-obtain nutrient from the environment, IREPs appear to be wall associated (see Section 1II.C). Of the two siderophores, exochelin is the one involved in scavenging iron from the environment. The affinity for iron of the exochelins so far detected is high enough for them to remove iron from host iron proteins (Ratledge, 1982) and thus to be able to transport iron back into the mycobacterium. However, exochelin has not been detected in M . leprae. This is probably simply because little exochelin is found in mycobacteria themselves; most is excreted, and the prospects of finding exochelin which is a small, unstable peptide (Ratledge, 1982; Sritharan, 1988) in a homogenate of infected tissue seem daunting. Exochelin-mediated iron uptake by M . leprae can, however, be demonstrated by using 55Fe-labelled exochelin from either M . neoaurum or an armadilloderived mycobacterium, ADM 8563. Uptake appeared to be by facilitated diffusion (Hall and Ratledge, 1987). As iron-sufficiently grown ADM 8563 organisms did not take up iron by an exochelin-mediated system (while irondeficiently grown ADM 8563 did; Hall and Ratledge, 1987), this provides further evidence, in addition to the appearance of IREPs, that M . leprae is growing iron deficiently in the host. Utilization of exochelin from other mycobacteria might be taken as an indication that M . leprae could need commensal or helper mycobacteria to provide exochelin in order that it can grow (see Section 1I.B). However, as nude mice can be infected with pure cultures of M . leprae, this interpretation of the work on exochelin seems unlikely to be correct, and it would seem that exochelin from M . neoaurum is simply useful as a model to study exochelin-mediated iron uptake into M . Ieprut1. The other siderophore, mycobactin, is probably involved in iron storage rather than iron transport (Ratledge, 1982; Wheeler and Ratledge, 1988b). There is evidence, though very indirect, that mycobactin is produced by M . Ieprae, from an observation that a chloroform extract of purified M . leprae could support growth of M . paratuberculosis (Dhople and Osborne, 1988).
106
P. R. WHEELER
Mycohucterium puratuherculosis needs either mycobactin or exochelin to support growth following isolation. The factor extracted from M . leprue is more likely to be mycobactin, which is chloroform soluble, rather than exochelin since water-soluble exochelins mediate iron uptake into M . Ieprae (Hall and Ratledge, 1987). D. ADAPTATION TO ACQUIRING NUTRIENTS FROM HOST CELLS
Clearly, a response to iron deprivation is an adaptation to acquiring this vital nutrient from the host. Although the chemistry of iron makes its depletion particularly severe on organisms (see Section V.C), other nutrients are also in short supply. Intracellular M . leprae must compete with the metabolic processes of the host cell for nutrients and, moreover, the host will attempt to deplete nutrients as a response to infection in an attempt to acquire nutritional immunity. Two host-enzyme activities which are enhanced during infection are arginase (K. B. Kannan and V. P. Bharadwaj, personal communication) and adenosine deaminase (V. P. Bharadwaj, personal communication) and it may be that their effect is to deprive M . leprae of the nutrients arginine and adenosine. This section attempts to provide a picture, often from very preliminary or sparse data, of the likely adaptations of M . lepruc. to acquiring what must often be limited nutrients from the host cell. 1. Hydroluses
Many potential nutrients are large molecules (proteins, polysaccharides) or are chemically modified (e.g. with charged phosphate groups) so that they cannot be taken up directly by M . leprue. Thus if they are to be utilized they must be broken down first. Often, the enzymes involved in this first step in utilization will be hydrolases. Proteases which might break down host-derived peptides have not been detected in M . leprue but, in a survey of pathogenic and non-pathogenic mycobacteria, appearance of protease activity in culture filtrates was associated only with the pathogens (Kannan et al., 1987). It may be that M . Ieprae produces extracellular protease, but trying to detect such activity in a homogenate of host tissue (from which M . leprae must be harvested) seems a daunting task. Mycohucterium leprue has a protease activity which digests its own fumarase (Wheeler, 1984a). This activity, particularly if it digests other proteins in M . Icprae, may be important in survival of the mycobacterium. In enteric bacteria, the ability to degrade endogenous protein is important for controlling metabolic activity and recycling nutrients to enable survival during starvation (Reeve et al., 1984). Acid mucopolysaccharides, including hyaluronic acid, were detected in the
PHYSIOLOGY OF M YCOBACTERlUM LkPRAL
107
limiting membranes of lepra cell phagosomes by microscopy and thus appear to be possible nutrients for M . leprae. In the same study, one of the enzymes for breaking down the polysaccharides, /l-glucuronidase, appeared to be associated with leprosy bacilli in the phagosomes (Matsuo and Skinsnes, 1974). B-Glucuronidase, and N-acetyl-8-glucosaminidase were later confirmed to be present in M . leprae, and distinguished from lysosomal enzymes (Wheeler et a/., 1982).As these enzymes are surface located (see Section IILA), they could be involved in utilization of mucopolysaccharide, though hyaluronidase, the enzyme needed for breaking down the mucopolysaccharide to oligosaccharides which are substrates for P-glucuronidase and Nacetyl-B-glucosaminidase, could not be detected (Wheeler et al., 1982).Thus it may be that M . leprae needs the host to start breaking down hyaluronic acid before the bacteria can use it as a carbon source. The phospholipid and triglyceride contents of human leprous tissue are both elevated (Kumar er al., 1987),and, though these lipids are initially broken down by host enzymes when macrophages are infected (see Section V.A), it may be that, during the long-term infection, they are valuable carbon sources for M. leprae. To utilize these reserves, M . leprae must break down the lipids to release fatty acids. As discussed earlier (Section IV.C.l) M . leprae seems to be well adapted to scavenging host lipids, and has readily detectable phospholipase activity to break down phospholipid. Control of this activity must be very important. With some microbes, phospholipase appears to be a powerful and destructive toxin (MacLennan, 1962), yet M . leprae does not produce toxins so that its phospholipase must be regulated so as only to provide M . leprae organisms with fatty acids which they require. It is also possible, even likely, that activity of both host and M . leprae phospholipases is modulated by extracellular amphipathic lipids, notably PGL-I, produced by M. leprae. The phospholipase activity of M. leprae is difficult to detect with micelles or liposomes prepared solely from phosphatidylcholine: 2-lysophosphatidylcholine must be included to obtain full activity (P. R. Wheeler and C. Ratledge, unpublished observation). The effect of PGL-I has not been tested, but it inevitably enters membranes containing phosphatidylcholine (Laneelle, 1989) and, almost certainly, like lipopolysaccharide (another amphipathic, extracellular microbial lipid), affects phospholipase activity (Scott et a/., 1980).Clearly, there is a lot of interesting and complex work to do in this field. Hydrolase activity for triglyceride, a triacylglycerol lipase, has been demonstrated in M . Ieprae (Talati and Mahadevan, 1985). This notoriously difficult-to-assay activity has only been shown with tributyrin as a substrate (i.e. with C, fatty-acyl residues), while acylglycerols available in the host will have Cl0-C,, fatty-acyl moieties (see Table I1 in Barclay and Wheeler, 1989). Bacteria need specialized transport systems for taking up phosphorylated substrates. Otherwise phosphorylated substrates must be hydrolysed by a
108
P R WHEELER
phosphatase and the dephosphorylated substrate taken up. Of the substrates which might be available in host cells, M . leprae can take up 6phosphogluconate rapidly and glucose 6-phosphate slowly (Wheeler, I984a; see also Section IV.B.1) but it is not permeable to nucleotides (see Section IV.C.3). However, acid phosphatase can be detected at low activity in extracts made from M . leprar treated with sodium hydroxide; in extracts from untreated M . leprue, activity is swamped by a 13-fold excess of host-derived phosphatase. Intact, untreated M . leprae hydrolyses nucleotides rapidly and incorporates released nucleosides, such as adenosine and uridine, readily (see Section 1V.C) while M . lrprue treated with sodium hydroxide does not. This might indicate that host-derived phosphatase is necessary, though sodium hydroxide treatment could, conceivably, abolish any phosphatase activity derived from the envelope of M . leprae. Another experimental approach shows preferential adsorption of acid phosphatase, and suggests that acid phosphatase may be adaptively acquired from the host by M . lrprue. This approach was used by Fairfield ct ul. (1983) who took the high superoxide dismutase:haemoglobin ratio in a lysate of the parasite, compared with red-blood-cell lysate, to indicate that PIusmodium herghei, which fails to elaborate its own superoxide dismutase, acquires for its own purposes host superoxide dismutase. In homogenates of armadillo tissue, the acid phosphatase:catalase ratio was 0.18; in extracts of untreated M . leprac it was 3.9. It is quite attractive to imagine M . kprrre, an obligate, persistent parasite with so little apparent metabolic activity (Wheeler, 1984b, 1986c),acquiring host enzymes for its own purpose. However, the following caveats are important: (a) acid phosphatase is lysosomal while superoxide dismutase and catalase are not, and this difference might account for the preferential adsorption of the lysosomal enzyme following disruption of infected tissue and thus lysosomal contents; (b) if host-derived acid phosphatase is used by M . leprae, it must be able to function at a location remote from the plasma membrane, 50-100 nm outside the peptidoglycan layer on the edge of the electron-transparent zone (see Section V.A and Fig. 4). 2. Activities tltrit are Enhunced when Mycobacterium leprae organisrns are in Macrophages
Incubations demonstrating incorporation of exogenous labelled thymidine into macromolecules of M . kprae have usually been carried out with M . lcprue which had been previously phagocytosed by macrophages (Drutz and Cline, 1972; Nath rt a/., 1982). Incorporation of leucine, uridine and inorganic phosphate (Prasad and Hastings, 1985)into M . leprae in macrophages has also been shown. Calculated rates of incorporation of labelled substrates into
PHYSIOLOGY OF M YCOBACTERILIM LEPRAE
109
suspensions of M . leprae, and M . leprae present in macrophages, seemed to show that rates were higher when the mycobacterium was inside macrophages (Wheeler, 1984b). The few direct comparisons that have been made bear this conclusion out. Uracil (Vejare and Mahadevan, 1987), thymidine (Wheeler, 1989a; Harshan, 1989),thymine (Wheeler, 1989a), adenosine (Harshan, 1989) and aspartic acid (Sritharan, 1988) are incorporated into M . leprae in macrophages 3-15 times more rapidly than M . leprae in suspensions, even though the substrates may be diluted in metabolic pools inside the macrophages. Even macrophage extracts stimulate the rate of aspartate incorporation into suspensions of M . leprae (Sritharan, 1987). Whether this stimulation of activities when M . leprae is in cells is a general phenomenon, or whether it is restricted to substrates available in the host which enter scavenging pathways (all of those listed can be classified as such), is not clear from work done to date. 3. Amino-Acid Acquisition and Nutritional Immunirjq
In studies with M . leprae in macrophages, not enough bacteria were present to study the metabolic fate of incorporated compounds. It is very difficult to get more than 10 M . leprae organisms in any macrophage; the most-efficient method of obtaining macrophages, peritoneal lavage, only yields 105-106 macrophages per mouse. Studies showing that carbon from aspartate is incorporated into methionine and lysine (Sritharan er al., 1989) were carried out with suspensions of (109-10'0)M . leprae which had been harvested from armadillo tissue (where the bacteria resided in macrophages). The appearance of label almost entirely in methionine and lysine in M . leprue may as already stated (Section IV.C.4) be an adaptation to lack of availability of these amino acids in host cells. Nothing is known about metabolism of methionine and lysine inside macrophages during infection. It is, however, known that arginine catabolism by the host increases during infection with M . leprae (K. B. Kannan and V. P. Bhardwaj, personal communication), and that host catabolism of isoleucine (Hatch, 1975) and tryptophan (Byrne et al., 1986) limits or stops growth of intracellular parasites during infection. Moreover, at least in the case of tryptophan, catabolism is directed as a response to infection by the immune system (Byrne et al., 1986; Pfefferkorn, 1984). 4. Elevated Metabolic Activities in M ycobacterium leprae
Most metabolic activities operate in M. leprae at about 10% of the specific activity detected in other mycobacteria (Wheeler, 1984b, 1986~). Thus, if any activity is found at levels approaching that found in other mycobacteria, it may be a preliminary indication that that activity is particularly important for
110
P R WHEELER
M . leprue. This section reviews these stimulated activities, and is therefore rather speculative since variations in activities may simply be a result of differences in optimal conditions and stability of activities, particularly for enzyme assays. For some enzymes, it is difficult to see any relationship between their high activity and the physiology of M . Ieprur. For example, isocitrate dehydrogenase and succinate dehydrogenase are present at similar or slightly higher specific activities in crude extracts of M . leprue (Wheeler, 1984a; Wheeler and Ratledge, 1988a) than in similarly prepared extracts of other mycobacteria (Wheeler, 1984b, 1986~).However, activities of other enzymes in the TCA cycle are low, relative to those in other mycobacteria as is oxidation of TCA cycle intermediates by intact M . Ieprue (Wheeler, 1984a). For most elevated activities, however, there seems to be a possible explanation in terms of the metabolic relationship of M . leprue with host cells. The two glyoxylate by-pass enzymes in M . Ieprae are at higher specific activity than in extracts of either M . microti or M . uvium grown in uivo (Wheeler and Ratledge, 198th). Elevated activity of these two enzymes is associated with adaptation to low oxygen tension in M . tuberculosis, and a cessation of division with survival, possibly dormancy (Wayne and Lin, 1982). The possibility that M . Iepruc. is better suited to oxygen tensions below that in air is discussed further in Section V1.A. As argued in Section 1V.B.1 the very high activity of 6-phosphogluconate dehydrogenase in M . Ieprue appears to be a genuine reflection of a metabolic capability, and not an artifact. This activity, in a strange parallel with Plusmodium spp. which have 6-phosphogluconate dehydrogenase but no glucose-6-phosphate dehydrogenase to produce the 6phosphogluconate (Sherman, 1979),enables M . Ieprue, like Plusmodium spp., to scavenge 6-phosphogluconate. Other enzyme activities already referred to in Section IV.C.1 are phospholipase (at 65-90% of the specific activities in extracts of M . microti or M . uvium grown in oivo) and acetyl-CoA-dependent fatty-acyl elongase (at 40-75% of the specific activities in extracts of M . microti or M . uuium grown in uioo). Their elevated activities in M . leprue may enable the bacteria efficiently to scavenge fatty acids from host phospholipids (see Fig. 7), a view supported by the stimulation of both of the above activities in M . microti and M . uvium when they are grown in vivo, i.e. intracellularly. Adenosine kinase activity in M . leprue is present at 3-4 times higher specific activity than that detected in M . microti or M . uuium grown in vivo. This enzyme can, however, be induced by growing mycobacteria axenically in the presence of purines when, in M. microti, activity is elevated nearly 40-fold (Wheeler, 1987b). This shows that mycobacteria can respond to a supply of exogenous purines, and, for M . kprue grown in viuo, the most plentiful supply would be adenine nucleotides, which (see above, Section V.D. 1) M . Iepruc hydrolyses to release and take up adenosine (see Fig. 9). It may be that elevated activity of adenosine kinase in M . leprue permits efficient utilization
PHYSIOLOGY OF MYCOBACTERIUM LEPRAE
111
of this most plentiful source of purines. Host adenosine deaminase activity is enhanced during leprosy (V. P. Bharadwaj, personal communication), and it is possible that this may result in deprivation of purines for M . leprae. As M . leprue lacks the ability to synthesize purines de nouo, this might be a potent bacteriostatic mechanism against M. leprae. However, it needs a great deal more investigation. Inside host cells where M . leprae resides, free adenosine is almost non-existent (Hartwick et a/., 1979),so the host's adenosine deaminase would have to act on adenosine released from adenine nucleotides (Fig. 9) before M . leprae took up the adenosine if it were to play any part in nutritional immunity. In general, relative activities for scavenging purines and pyrimidines by intact M . leprae were above average. Thus, M . leprae incorporated hypoxanthine, adenosine (Wheeler, 1987a) and uracil (Wheeler, 1990) into bases recovered from hydrolysed nucleic acids at 15,37 and 21 %, respectively, of the rates observed in M . microti grown in uivo. Absolute rates of incorporation are, in M . Ieprae, from 0.2% of the uracil supplied (at 50 ,UM)to 0.6% of the adenosine supplied (at 6 0 , ~in~24) hours per I O ' O bacteria. The overall impression is one of M . leprae scavenging purines and pyrimidines from the host (Figs 8 and 9). Though it is committed to scavenging purines, there appears to be a mechanism by which it can synthesize pyrimidines readily should pyrimidines become unavailable from the host. Although intact M . leprae as harvested from host tissue do not synthesize pyrimidines de nouo, they possess enzymes for synthesis at fairly high activities (Wheeler, 1989b, 1990). For instance, aspartate carbamayltransferase is present at 20% of the specific activity in M . auium and M . microtigrown in uiuo. If pyrimidines could not be scavenged from the host, the intracellular concentration of pyrimidine nucleotides in M . leprae would fall as pools become exhausted. This would relieve feedback inhibition of aspartate carbamayltransferase (discussed in Section IV.C.2) so that pyrimidine nucleotides could be synthesized denouo by M. leprae.
VI. Possible Applications A. AXENIC CULTURE OF
Mycohacterium leprae
From the foregoing, it is easy to regard M . leprae as a well-adapted obligate intracellular parasite. However, there is information which should provide leads to the axenic culture of M . leprae. There seems little point in including unusual carbon sources in potential axenic culture medium for M . leprae, as glycerol, used in most mycobacterial media (Chadwick, 1982),and TCA-cycle intermediates (which can be derived from casamino acids, also used in many mycobacterial media) are metabolized by M . leprae (Section 1V.B.1). A range
112
P R
WHEtLER
of carbon sources should be provided, rather than attempting to grow M . leprae on a single carbon source. This practice is standard for isolating, and growing to high yield, slow-growing mycobacteria (Ratledge, 1976, 1982)and may be critical for M . Ieprae which may be compromised in its carbon metabolism by its deficiency in acetate metabolism (discussed in Section IV.B.l.). With its extremely low activity for fatty-acid synthesis on isolation from host tissue, apparently below what is required to supply its lipid requirement (see Section W.C.!), M . leprae should be supplied with a source of lipid at least for isolation. This is standard practice for isolation of other slowgrowing, and difficult-to-grow, mycobacteria (Portaels er ul., 1988), when media including phosphatidylcholine are used (Chadwick, 1982). Inclusion of lecithin seems appropriate for M . leprae, as the bacteria produce phospholipase (P. R. Wheeler and C. Ratledge, unpublished observation). Further studies might indicate better sources of lipid for M . leprue. For instance, sphingolipids might be preferable, if M . leprae utilizes these lipids when it is growing in Schwann cells in nerves. Low oxygen tension has often been claimed to be important for growth of M . Ieprae, and many attempts at axenic culture made in such conditions. Often, the result has been a two- or three-fold increase of numbers of acid-fast bacilli counted in the medium (Chatterjee, 1965; Ishaque, 1989) but these increases should not be regarded as indicating growth since clumps of mycobacteria tend to separate in buffered salts and other media which do not support growth, thereby giving an apparent increase in numbers (Katoch and Desikan, 1983).Attempts to use ATP content as a measure of the energy state of M . leprue growing under low oxygen tension proved contradictory to start with. Thioglycollate at 1 gl-' has been reported to both delay (Nam-Lee and Colston, 1985) and accelerate (Franzblau and Harris, 1988) decay of ATP in M . Ieprae organisms. However, when M . Ieprae was maintained under oxygen kept at a constant concentration between 2.5 and lo%, ATP maintenance was enhanced (Franzblau and Harris, 1988) over ATP maintenance in M . ieprue kept in air (20% 02). Myc'ohuc'reriurn Ieprae lacks a detectable catalase (see Section V.A) and this may make it relatively susceptible to peroxides which can form in complex aerobic culture media over a long time (Barry er a/., 1956). This could be overcome by adding catalase or a peroxide scavenger to culture media. Finally, the concentration of oxygen in subcutaneous tissue where M . leprae multiplies in the host is 2.5% (Sever, 1936). Even though most of the foregoing evidence in favour of low oxygen tension is weak or circumstantial, it still seems prudent to include incubations at low oxygen tension during attempts at axenic culture. Research on nucleotide metabolism provides the clearest pointer to requirements for growth of M . leprae. Though pyrimidines (Section IV.C.2) can be synthesized by M . leprae, purines (Section IV.C.3) cannot. Thus a
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
113
source of purine must be included in any potential culture medium for M . leprar if it is to have any chance of,supporting growth. Adenosine appears to be most useful as it is incorporated into M . leprae most rapidly (Khanolkar and Wheeler, 1983), though hypoxanthine might be preferable as it supplies guanine bases in nucleic acids more rapidly than adenosine (Wheeler, 1987a). There is, of course, no reason why only one purine should be added; perhaps adenosine and guanine would be the ideal combination. It is not known whether an iron-chelating siderophore must be supplied for M . Ieprae to grow. Some mycobacteria-M.pararuherculosis, M . avium (Snow, 1970) and certain strains of M . uaccae (Messenger et al., 1986)-need mycobactin or exochelin. If M . leprae requires a siderophore for growth, exochelin from M . neoaurum or ADM 8563 (see Section V.B) could be used. Some general considerations are at what temperature to induce growth, and whether to use solid or liquid medium. Successful isolation of difficult-to-grow mycobacteria is usually achieved on solid, egg-based media (e.g. see Portaels et al., 1988), and it may be that M . leprae needs a solid support for growth. Interestingly, difficult-to-grow mammalian cells and tissue, with exacting requirements, also need a solid support, and it may be be useful to borrow ideas from their culture, for instance using hollow fibres or beads for support (Varani et al., 1983; Bunch, 1988).The optimum temperature for growth will probably be 32-34°C. It is well known that M . leprae prefers relatively cool sites for growth in the host. When the optimum temperature has been determined for physiological activities, it has been 33-34°C. This optimum temperature has been shown for 3,4-dihydroxyphenylalanine uptake (Khanolkar et a/., 1981),palmitate oxidation (Franzblau, 1988), incorporation of palmitate into PGL-I and ATP maintenance (Franzblau and Harris, 1988). As the reader may have guessed, I have tried to grow M . leprae axenically, using the information already presented above-and failed. There are, presumably, other metabolic deletions yet to be deduced and, to this end, work on the physiology of M . kprae must continue. However, recent work on the genetics of mycobacteria might help. Recently, it has been shown that recombinant DNA can be introduced into mycobacteria (Snapper et al., 1988) and this raises the possibility of treating M. leprae as an auxotroph and introducing foreign genes to complement its auxotrophy and thus succeed in axenic cultivation, an idea introduced by B. R. Bloom at the 13th International Leprosy Congress held at Den Haag in September 1988. Mycobacterium leprae must be a multiple auxotroph. If its auxotrophy were simple, it surely would have been cultured axenically by empirical at tempts. So, perhaps by devising media with the specific additions already suggested, and inoculating with M . leprae including recombinant DNA, cultivation and elucidation of the full requirements of M . leprae may be achieved. One feature of the M . leprae genome which might be important in
114
P R WHFFLFR
expression of its DNA is the presence of repetitive sequences (Clark-Curtiss and Docherty, 1989) which may be insertion sequences. Similar insertion sequences have been found in M . paratuberculosis and, much less frequently, in some pathogenic strains of M . avium (McFadden et a/., 1987).They d o not transpose at a detectable frequency. With at least 8-19 insertions, they may be involved in disruption of the function of chromosomal genes slowing down the metabolism of the mycobacteria to a rate which enables them to be successful as chronic pathogens. In M . avium and M . paratuherc~ulosis, insertion sequences are related to mycobactin dependence. In M . lrprue, insertion sequences may account for its multiple auxotrophy and failure to grow axenically. Mycohacterium puraruherculosis may provide a simple model for apparent auxotrophy resulting from disruption of gene function by insertion sequences. I t can be grown axenically, strictly needing mycobactin initially (Barclay and Ratledge, 1983; Merkal and McCullough, 1982) but, after four or five subcultures, it can grow in the absence of mycobactin. This would be consistent with curing of an insertion element, which occurs at about the same rate as mutagenesis. This could be followed by selection for bacteria that produce mycobactin, rather than derepression of mycobactin synthesis which would be expected to enable growth in the absence of mycobactin to occur much earlier. B. DRUG SCREENING
While there is presently no method for axenic culture of M . fqwue, drug screening will remain a problem. For most microbes, screening of drugs is a simple matter of looking for growth inhibition in a series ofculture flasks. For M . leprae, experimental growth has to be in mice, and growth inhibition, or killing, established in mice fed with the agent to be tested. This takes 12 months to complete (Colston et ul., 1978), requires grams of agent, which can be hopelessly large amounts for new, experimental agents, and involves the pharmokinetics of drugs in mice. However, many agents have effects on metabolic activities which can be demonstrated in intact, non-growing M . leprae (Barclay and Wheeler, 1989; Hastings ef id., 1988; Wheeler, 1984b). It is a notable feature of studies on the physiology of M . leprue that scientists have been interested mainly in effects of inhibitors (on intact bacteria) that are generally indirect. Inhibitors are rarely used directly to show how metabolic pathways are working. Thus, considerable interest is generated when, for example, palmitate oxidation and incorporation of hypoxanthine into nucleic acids (Wheeler, 1988)are shown to be inhibited by dapsone which has its primary effect on folate biosynthesis. What appears Lo microbiologists in other fields to be an irritating artifact is
PHYSIOLOGY OF M YCOBACTERIUM LEPRAE
115
potentially very useful to workers dealing with M . leprae, since the indirect nature of the inhibition suggests that the activity being inhibited might be inhibited generally by a range of inhibitors of remote metabolic activities. If this is so, its inhibition could be useful in a drug-screening system. The drugscreening systems which have been tested most extensively are shown in Table I . It is not possible to assess the usefulness of different systems very well at present, as they need to be used outside the laboratories which devised them, something which has not yet been tackled. A blind evaluation of five systems, with tests carried out in the laboratories that devised them, appeared to show that none of the systems was dependable enough for routine use (World Health Organization, 1989). However, one of the five methods was assessed in an earlier blind trial when biopsies were transported to independent laboratories. Then, excellent concordance (for 12 out of 13 biopsies) in demonstration of dapsone resistance or susceptibility of the leprosy bacilli was obtained between growth in mice (the established method) and thymidine incorporation by bacteria inside macrophages (Sathish et al., 1985). All of the methods referred to in Table 1 take less than 21 days to perform. With more bacteria, results can be obtained in 24 hours. For testing for drug sensitivity or resistance in individual patients, the numbers of bacteria needed in a test are critical; about lo7 for each incubation is an absolute maximum. However, for rapid screening of a range of agents, speed may be more important and, even using systems which require lo9 bacteria, 1000 incubations can be done using the M . leprae organisms from one heavily infected liver. As the availability of a good screening method, or perhaps several in combination, would greatly simplify the search for new antileprosy agents, identification of the systems that are most promising followed by intensive developments of those systems must be an important priority in leprosy research. VII. Conclusions
Mycohucteriurn leprae has physiological features typical of many microbes (both saprophytic and pathogenic), in particular its carbon and energy metabolism. However, the overall view is of a well-adapted obligate intracellular parasite. Though it does not produce its own catalase, M . leprue inside host cells is surrounded by a thick (5CrlOOmm) zone of lipoidal capsular material which appears to protect it from the toxic environment that the host cell creates in its attempt to kill invading microbes. Mycohacterium leprue has the capability of shutting down its TCA cycle, and thus oxidative metabolism, by proteolytic digestion ofone of thecycle enzymes. Like dormant tubercle bacilli, it has high
TABLE 1 . Potential systems for screening drugs and agents against Mycohucterium leprue Number of organisms per incubation and time to complete test
Agents which inhibit activity"
References
Activity in macrophages containing
Mycobacterium kprae
- lo6. 21 days
Thymidine into DNA
Thymine into DNA (in these experiments, incorporated about four times more rapidly than thymidine) Uracil into DNA and RNA Effects on macrophages: Mycohucreriuni leprue inhibits F, receptor and sialic acid expression Fluorescence after incubation with fluorescein diacetate
I
Rifampin, clofazamine (B663), DDS'. DDS has no activity against DDS-resistant M. leprue
Mittal et 01. (1983, 1985) Nath ei (11. (1982)
-3 x lo6. 14 days
Clofazamine, DDS
Wheeler (1989)
- lo6, -
Rifampin, DDS
Vejare and Mahadevan (1987)
Rifampin, DDS diflurisal, indole-2-carboxylic acid
Mahadevan ei ul. (1986) Hooper et 01. (1988)
14 days
- IO'-lO*, -
14 days
Activity in Mymbacterium leprae in suspension Hypoxanthine into DNA and RNA
Clofazamine. DDS, brodimorprim. DDS has no activity against DDS-resistant M. leprae
2 lo'. 1G14 days
or 2
Palmitate into PGL-I' spot o n TLC plate
-
lo9, 2 days
Rifampin. DDS
Franzblau ei al. ( I 987) Ramashesh et al. (1987)
10'. 7-14 days
Rifampin, DDS. clofazamine
Franzblau (1988)
Rifampin, clofazamine, ethionamide, but no significant inhibition by DDS
Franzblau and Hastings (1987) Kvach C I a/. (1986)
Both allow individual bacteria to be visualized. The percentage of M. leprae metabolically active indicates effect of agents only on bacteria from treated patients
Kvach ei a/. (1984) Seydel ei al. (1985)
-
Decay of intracellular ATP
105-10". -3 weeks
Na+/K' ratio
- lo4,
v
M. Hooper. E. G. Beveridge and P. R. Wheeler (unpublished results)
lo9. 21 days. Also worked in macro phages
Palmitate-+carbondioxide
Fluorescence after incubation with fluorescein diacetate
Diflurisal, indole-2carboxylic acid
Wheeler (1988)
3 days
lo4, -2 days
I
All systems devised using Mycobacfmium leprae in macrophages are shown. Systems using suspensions of Mycobacterium leprae are those tested with a range of agents, and where the activity being inhibited is consistent in controls lacking the agent. a Agents which inhibit at concentrations near their minimum inhibitory concentration as shown in mice or patients for antileprosy agents, or for experimental agents, no higher than about two orders ofmagnitude above the value at which they, or related agents, are effective against other microbes. DDS indicates 4,4-diaminodiphenylsulphone(dapsone). PGL-I indicates phenolic glycolipid 1.
118
P R WHtkLER
activities of the alternative glycoxylate bypass enzymes, though M . IepraL. are dividing with a mean generation time of 12 days. The physiology of M . leprue enables it to utilize important available nutrients in the host cell, such as nucleotides, which it can hydrolyse to nucleosides, some of which, particularly adenosine and uridine, are rapidly incorporated into its DNA and RNA. Lipids would also be available, and it is known that at least phospholipids can be used as nutrients, first being hydrolysed with a phospholipase when the released fatty acids can be used as either energy sources, or elongated when their metabolic fate is probably as structural lipids. Mycohucteriurn leprue acquires its nutrients without producing any toxins. There is no sign of the damage caused by phospholipase when it acts as a toxin, and it acquires iron without producing haemolysins. In these respects it is similar to mycobacterial pathogens in general. An intriguing possibility is that there is a general mechanism at the level of the genome which slows down the physiology of M . leprue and enables it to be a successful pathogen. There are about 20 insertion sequences, apparently not transposable, which may block specific functions. Insertion sequences are also found in M . puratuherculosis, another chronic pathogen, and some persistent strains of M . auium from which M . pararuherculosis is virtually indistinguishable by taxonomic means (Hurley e/ al., 1988). Mycohacferium kprue is, however, a distinct species (Smida P / ul., I988), not just a slowed-down strain of anot her known m ycobacteri um. Mycohucteriur?i Iqmw is so well adapted to intracellular growth that i t has evaded axenic cultivation so far. Biochemical studies suggest that purines and a scavenger of peroxide are essential additions to media, while phospholipids (lecithin) and exochelin from M . nwuuruni should promote growth and may be needed for isolation. However, these suggestions alone are not enough; more information is needed. In the meantime, inhibition of readily measurable activities in M . kprae, such as ATP content, palmitate oxidation and hypoxanthine or (in macrophages) thymidine incorporation by a wide range of agents, should allow a drug-screening method to be set up without axenic culture, probably based on several of the activities being measured in combination.
VIII. Acknowledgements
I would like to thank Colin Ratledge for helpful comments in the preparation of this article and novel ideas in the quest for axenic culture of M . Ieprue. I am grateful to C . Frehel for photographs of M . ieprae in macrophages. The UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases provided financial support in the period in which this article was prepared.
PHYSIOLOGY OF M YCOBACTKRIUM LEPRAE
119
References Aldritt. S. M.. Tien. P. and Wang. C. C. (1985). Journul of'Espi~rinientulMedicine 161, 437. Antoine, I., Coene, M. and Cocito. C. (1988). Journul of MediculMicrohiology 27, 45. Athwal. R. S., Deo, S. S. and Imaeda, T. (1984). inrernational JournalofSysremuric Bucteriology34, 371. Atkinson. W. H. and Winkler, H. H. (1985). Journul Sf Bucteriology 161, 32. Band, A. H.. Chitamber, S. D., Bhattacharya, A. and Talwar, G. P. (1986).International Journulqf Lrpro.v.v 54, 294. Barclay. R. (1985). Merliid Luhorulory Sciences 42, 166. Barclay. R. and Ratledge, c. (1983). Journul ofBuc~/rrio/ogy153, 1 138. Barclay. R. and Wheeler, P. R. (1989).In "The Biology of the Mycobacteria" (C. Ratledge, J. Stanford and J. M. Grange. eds), vol. 3, pp. 37-106. Academic Press, London. Barry. V. C., Conalty, M. L., Denneny, J. M. and Winder, F. (1956). Nature 178. 596. Baulieu. R., Bory, C. and Baltassat. P. (1982). Journul qf'Chrornatogruphy 233, 131. Bercovier. H.. Kafri, 0.and Sela, S. ( I 986). Biocheniic,ulundBiopit.v.sicul Reseurcit Conmiunicurions 136. 1136. Binford,C. H.. Meyers. W. M.. Walsh. G . P., Storrs, E. E. and Brown, H. L. (1977).J o u m a l ~ f r h e Ri~riculoi~n~l~~tlt~liul Socirrj. 22. 377. Boddingius. J. and Dijkman, H. P. (1989). Journal of Histochemistry and Cytochemistry 37,455. Brodie. A. F. and Gray, C. T. (1957). Science 125, 534. Bunch. A. W. (1988). Jourtiul of Microhiokqicd Methods 8, 103. Byrne. G. 1.. Lehmann. L. K. and Landry, G. J. (1986). Infection wid Immunity 53. 347. Cartel. J. L.. Millan, J.. Guelpa-Lauras, C. C. and Grosset, J. H. (1983). lnternarionul Journul o/ Lc,pri~.~j, 51. 46 1. Chadwick. M. V. (1982)."Mycobacteria". Institute for Medical Laboratory Services Monographs. Wright. Bristol. Chatterjee. B. R. (1965). Itirrrnurionul Jourfiu/ of Lc,pro,s),33, 551. Chirico, W. J., Waters. M. G. and Blobel, G . (1988). Nufure 332, 805. Clark-Curtiss, J. and Docherty. M. A. (1989). Journul of'Inficrious Diseuse 159, 7. Clark-Curtiss, J., Jacobs, W. R., Docherty, M. A,, Ritchie, L. R. and Curtiss. R., Ill. (1985).Journul (JfBcfcVerio/ogj~161, 1093. Cocito, C. and Delville, J. (1983). Rerie\c*sof Inficfious Diseases 5, 649. Cohen, A., Barankiewicz, J.. Lederman. H. M. and Gelfand, E. W. (1983). Journul oJ'Biolcigicd Clwniisrr~.253, 12334. Collins. M. E., Moss. M. T., Wall. S. and Dale, J. W. (1987). FEMS Micrahiulogj, Lerrer.7 43, 53. Colston. M. J., Hilson, G . R. F. and Banerjee, D. K. (1978). Leprosy Review 49, 7. Couderc. F., Aurelle, H.. Prom&, D., Savagnac, A. and Promk, J. C. (1988). Biomedicul and Etii+vnnienlu/ Muss Spectrometry 16, 3 17. de Bruyn. J., Bosmans, R.. Nyabenda, J. and Van Vooren, J. P. (1989). Journal of Generul M i c ~ h i o l o g j 135, , 79. Delville, J.. Spina, A,, Rajjan, W. and Cocito. C. (1982). FEMS Microhic~logyLctriw 15, 253. Doelle. H. W. ( I 975). "Bacterial Metabolism", Academic Press, New York. Dhariwal. K. R.. Yang. Y-M., Fales, H. M. and Goren, M. B. (1987). Journul of' Generul Micwhiologj* 133, 201. Dhople, A. M. and Osborne, L. (1988). Indiun Journal of Leprosy 60, 348. Draper. P. (1982). I n "The Biology of the Mycobacteria" (C. Ratledge and J. Stanford, eds), vol. I , pp. 9-52. Academic Press, London. Draper, P. and .Rees, R.J. w . ( I 973). Journal of Generul Microhiokogy 77, 79. Draper. P.. Payne, S. N.. Dobson. G. and Minnikin. D. E. (1977).Journulqf Generul Micrd~iology 129, 859. Draper, P., Kandler, 0. and Darbre, A. (1987). Jiiurnul of Generul Microbiology 133, 1 187. Drutz, D. J . and Cline, M. J. (1972). Journal of h/lctiou.s Diseuse 125, 416. Engers, H. D.. Abe, M. and Bloom, B. R. (1985). W H O sponsored workshop. Infection mid h i n i u n i t j ~48, 603.
120
P K. W H E E L t R
Erfle, J. D. (1973). Biochimicu er BkJphph?:SiCU/ Aetu 316, 143. Eun, H. M., Yapo, A. and Petit. J. F. (1978). Europeun Journu/ ofBioc/ienii.vtrj,86, 97. Evans, M. J.. Newton, H. E. and Levy. L. (1973). In/iv/ion und Ininiuniry 1, 76. Fairfield, A. S.. Meshnick, S. R. and Eaton, J. W. (1983). S c i i v m 221, 764. Franzblau, s. G . (1988). Journal of Clinicd Microhiohgy 26, 18. Franzblau, S. G . and Harris, E. B. (1988). Journd of Clinical Microhiologji 26, 1124. Franzblau, S . G . and Hastings, R. C. (1987). Antimicrobiu/ Agenls und Chiwiolherupy 31, 780. Franzblau, S. G.. Harris. E. B. and Hastings, R. C. (1987). F E M S Micwhiolugv Ler/er.s 48, 407. Frehel, C. and Rastogi, N. (1987). In/ilcriori mid Ininiuni/,r 55, 2916. Frehel. C.. Ryter, R.. Rastogi, N. and David, H. L. (1986). Annulev rle Mic,robinlogic, (/n.s/i/u/ Pusreur) 1378, 239. Frehel. C.. Rastogi. N., Benichou, J. C. and Ryter. A. (1988).FEMS MimJhiology Le//ers 56. 225. Fulco, A. J. and Bloch. K. (1964). Journd c!fBio/ogi(.u/Chenrisrrj, 239, 993. Garsia, R. J., Hellqvist, L., Booth, R. J.. Radford, A. J.. Britton. W. J.. Astbury, L., Trent, R. J. and Basten, A. (1989). lnficcrion und /niniuni/y 57, 204. Diseusos 156. 236. Gelber. R. H. ( 1987).Jourricd o / Iu/~.c,/~ou.v Gillin, F. D., Gault. M. J., Hoffinann. A. F.. Gurantz, D. and Sauch, J. F. (1986). / n / i ~ ~ i fut7d ~/7 Ininiunirj. 53, 64 1. Goren, M. B. (1977). Annuul Rrrricw, n/htic~rnhio/ogy31, 507. Griffiths, E. (1985). I n "The Virulence of Escherichiu i d i " (M. Surman, ed.). SGM series. pp. 193-226. Academic Press, London. Grosskinsky, C. M.. Jacobs. W.R., Clark-Curtiss, J. and Bloom. B. R. (1989). h / i w i f J n UJid Ininirtni/j, 57, 1535. Hall, R. M. and Ratledge, C. (1987). Journul o/Genertrl Microhiohgy 133, 193. Hall. R. M., Sritharan, M., Messenger, A. J. M. and Ratledge, C. (1987). JfJurnd u / Gmerul Mil'r(JhilJ/fJgj' 133, 2 107. Halliwell, B. ( 1982). Tr07ds in Bioc,/ien?icu/SC8iences7, 270. Hammond, D. J. and Gutteridge, W. E. (1984). Molecwlur und Biocheniic,trlPurusirolugy 13. 243. Hansen, G. A. ( 1874). Norsk Muguziii./ur La~,geroi~k.nskobel 4,76. (For an English translation see Pallamary. P. (1955). /n/erna/ionu/ Joirrriul of Leprosy 23, 307.) Harshan, K. V. (1989). PhD Thesis: All India Institute for Medical Science, New Delhi, India. Harshey, R. M. and Raniakrishnan, T. (1977). Jnurnd of&lC/WffJ/fJg.I 129, 616. Hartwick, R. A,, Kistulovic, A. M. and Brown, P. R. (1979).Journal of Chmmutogruphy 186,659. Hatch. T. P. (1975). /n/i,c/ion und Ininiunirj. 12. 21 I . Hastings, R. C. and Morales, M. J. (1982). Internurional Joirrnd o/'Lepros,v 50. 579. Hastings, R. C.. Gillis, T. P.. Krahenbuhl, J. L. and Franzblau. S. G . (1988). Clinicul MiCrOhi(JhgicU/ Reriiws 1, 330. Hemmingsen. S. M.. Woolford, C. and van der Vies, S . M. (1988). N u w r 333, 330. Hirata, T. (1978). Inrerntr/ionrrl Journfd of' Lcpv.s,v 46, 372. Hirata, T. (1983)./n/erna/ic~nrdJournd of Lcprosy 51, 84. Hiriyanna. K. T. and Raniakrishnan. T. (1986). Arcliioe.~of Microbiology 144, 105. Holzer, T. J., Nelson, K. E., Schauf. V.. Crispen. R. G. and Anderson, B. R. (1986). In/iwiorr N J I ~ Ininiuniry 57, 5 14. Hooper, M., Bhagria. A.. Beveridge, E. G.,Jagannathan, R., Mahadevan, P. R. and Yeap, S. K. ( 1988). Heulrh c(JOplTUlifJt7LlJ//?r'.S 7. 259. Hunter, s.w., Fujiwara. T. and Brennan, P. J. (1982). JfJUrnU/oJ/Bif)/(Jglc,u/Chrnii.s/r.y 259. 15072. Hunter, S. W.. Gaylord. H. and Brennan, P. J. (1986).Journd ~fBiologiculCheniisrry 261, 12345. Hunter. S. W.,McNeil, M., Modlin, R. L., Mehra. V., Bloom. B. R. and Brennan. P. J. (1989). Journul Of /nV?7l//lfJ/ogj'142, 2864. Hunting, D.. Hardern. J. and Henderson, J . F. (1981). Cunadian Journul q f B i o c l i e n ~ i s t 59. r ~ 838. Hurley, S . S., Splitter, G . A. and Welch. R. A. (1988). /n/emu/ionul ./ournu/ of Sy.s/ernu/ic Bucreriology 38, 143. Ishaque. M. (1989). Inrernurionnl Jo~rrndn/ Leproq?57, 1 15. Ishaque. M.. Kato, L. and Skinsnes, 0. K. (1977). fnrrrnarionul Jourfld n/Lepro.sy 45, 114. Ishaque, M., Adapoe. C. and Kato. L. (1981). Cunudiun Journal ofBiochenii.srrj- 59, 75. Jackett, P.S., Aber, V. R. and Lowrie, D. B. (1978). Journul of General Microbiology 104, 37.
PHYSIOLOGY OF M YCOBAC’TERIUM LEPRAE
121
Jarroll, E. L., Muller, P. J.. Meyer, E. A. and Morse, S. A. (1981). Molecular and Biochemical Parasitology 2, 187. Kanetsuna, F. (1985). Microbiology und Immunology 29, 127. Kannan. K. B., Katoch, V. M., Sharma, V. D. and Bharadwaj, V. P. (1987).FEMS Microbiology Lc/rer.~48.3 1. Kaplan. G., Nathan, C. F.. Gandhi, R.. Horwitz, M. A,, Lewis, W. R. and Cohn, Z. A. (1986). Juurnd u/ Immunology 137, 983. Kaplan. J. M.. Hunter. S. W.. McNeil, M.. Stewart, C., Modlin, R. L., Reast, H., Convit, J., Salgame, P., Mehra, V., Bloom, B. R. and Brennan, P. J. (1988). Proceedings qf the Nafional Aca&niy ( I f Sciences q/’ the Unired Stures qf‘ America 85, 19 17. Karnovsky, M. L., Lazdins, J.. Drath, D. and Harper. A. (1975).Annals u / / h e New York Academy oi’Sciences 256. 266. Katoch, V. M. and Desikan, K. V. (1983). Leprosy in Indiu 55, 292. Kaufmann. S. H. E. (1987).Microbiolugical Science 4, 324. Kell. D. B. ( 1987). Journal uf Gi~neralMicrobiulogj~133, I65 I. Khanolkar. S. R. (1982).Journal q/General Microbiology 128, 423. Khanolkar. S. R. and Wheeler, P. R. (1983). FEMS Microbiology Lerters 20, 273. Khanolkar. S. R., Ambrose. E. J.. Chulawalla, R. and Bapat, C. V. (1978).Leprosy Reoiew 49, 187. Khanolkar, S. R., Ambrose. E. J. and Mahadevan, P. R. (1981).JuurnalcfGenrral Microbiology 127, 385. Kikuchi, S. and Kusaka, T. (1986).Journal CJ/’ Biochemistry, Tokyo 96, 841. Kirchheimer, W. F. and Storrs, E. E. (1971). Infema/ional Journul e/’Lepm.sj. 23, 307. Klebanoff. S. J. and Shepard. C. C. (1984). Infection and Immunity 44, 534. Kukarni. V. M. and Seydel, J. K. (1983).Chemo/herapy 29, 58. Kumar, B., Jamundar. S.. Dahiya, R.. Kaur, S. and Ganguly, K. N. ( I 987).lntrrnarionul Juurnalq/’ Lepro.sj. 55, 162. Kundu, M., Basu, J. and Chakrabarti, P. (1989). FEBS L e t f m 256, 207. Kusa ka. T. ( I 977). lnrrrnciric~nalJuunid of Lepro.vy 45, 132. Kusaka. T.. Kohasa. K.. Fukinushi. Y. and Akimori. H. (1981). Interttatiunal Journal uf Leprosj, 49, 406. Kusunose. E.. Kusunose, M., Ichihara, K. and Izumi, S. (1981).FEMS Microbiology Letters 10,49. Kvach. J . T.. Munguia, G . and Strand, S . S. ( I 984). Inrernutionul Journal of Leprosy 52. 176. Kvach. J. T., Neubert, T. A., Palomino. J. C. and Heine, H. (1986).Int~~rnationul JournaIufLepro.sj. 54, I . Lacave. C.. Laneelle. M.-A., Daffe, M.. Montrozier, H., Rools, M.-F. and Asselineau, C. (1987). European Journal u/ Biochemistry 163, 369. Lacave, C.. Laneelle. M.-A.. Dare, M., Montrozier. H. and Lankelle, G. (1989). European Journal u/’ Biochmiisrrj~ 181. 459. Lancaster. R. D., Hilson, G . R. F., McDougall, A. C. and Colston, M. J. (1983). Infection and Immunity 39, 865. The Lancer (1987). Leading article (May 23), Vaccines against Leprosy, pp. 1183-1 184. Laneelle. G. (1989).Acra Leprolugica 7 ( I ) , 65. Larson, L., Draper, P. and Portaels, F. (1985). International Journal ?/‘Leprosy 53, 441. Lepper, A. W. D. and Wilks, C. R. (1988). Journul u/Comporatiue Patholugy 98, 31. Lesse, H. J., Biggers, J. D.. Mioz, E. A. and Lechene, C. ( I 984). Anal~vticolBioc,hemi.srry 140,443. Le Vine, S. M., Ardeshir, F. and Amers, G . F.-L. (1980). Journal qf’Bacteriology 143, 1081. Levy, L. (1976).Lepro.s,v Review 47. 103. Lindquist, S. (1986).Annuul Reoitw. o/’Biochemisrr~55, 1151. Lowrie. D. B. (1983). Journal n/’ Medicd Microbiolugy 16, I . Lowrie, D. B. (1986).In “The Biology of the Mycobacteria”( C. Ratledge and J. Stanford,eds), vol. 2, pp. 235-278., Academic Press, London. Lowrie. D. B. and Andrew, P. W. (1988). Brirish Medical Bulletin 44, 624. Lowrie, D. B., Jacket, P. S. and Andrew, P. W. (1985). Immunolugy Letters 11, 195. MacLennan, J. D. ( I 962). Bacterirhgicu/ R e o i w s 26, 177. Mahadevan, P. R., Jagannathan, R., Bhagaria, A,, Vejare, S. and Agrawal, S. (1986). Leprosy Rerieiv 57 (3). 182.
122
P. R. W H E E L E R
Matsuo, E. and Skinsnes, 0. K. (1974). /nrernu/ional Journul of' Lrpriuj~42,399. McFadden, J. J., Butcher, P. D., Thompson, J., Chiodini, R. and Hermon-Taylor. J. (1987). Mo/ecu/ur Microbio/ogy 1, 283. Mehra, V.. Bloom, B. R. and Torigan, V. K. (1989). Journal of' Inimunology 142. 2873. Mellman, I., Fuchs. R. and Helenius. A. (1986). Annuul Rriliew of' Bioclieniistr)~55, 663. Merkal, R. S. and McCullough, W. G. (1982). Current Micr(JhifJ/Ogj'7.333. Messenger. A. J. M., Hall. R. M. and Ratledge, c.( 1986).Journu/f?/GPIi~'rN/ Microhiologj:l132,845. Minnikin, D. E. ( 1 982). I n "The Biology of the Mycobacteria" (C. Ratledge and J. Stanford, eds), vol. 1, pp. 95-184. Academic Press, London. Minnikin, D.E., Dobson, G. and Draper. P. (1985). Journu/ qf'Generul M;CrfJhifJ/(Jg.I'131. 2007. Mittal. A,. Sathish, M., Seshadri. P. S. and Nath. 1. ( I 983). Anriniier~~hicr/Agi~nt,strnt/C/ic~nto//i~~rrr~l)~ 24, 579. Mittal. A.. Sathish. P. S.. Conalty, M. L.. OSullivan. J. F. and Nath, 1. (1985). Leproq. Rrriiw, 56, 99. Mor, N. ( I 983). /n/i,c~/ionU J I Ininiunity ~ 42. 802. Morgan. R. W.. Christnian. M. F., Jacobson, F. S.. Storz, G. and Ames, B. N. ( 1 986). P~fJCWdi/ig.S (J/' / / i e Ntrtionul Ac,uc/c.niy of' Scicwcr,s of' /hi, Unirod Slures of' Aniericu 83,8059. Mori. T., Kohsaka, K. and Tanaka, Y. (1971). /n/i~rnutionulJfJurnu/ o/'Lopro.sy 39,796. Mori. T..Miyata. T., Kohsaka. K. and Makino. M. (1984)./ n / i ~ r n l r t i f J ~ l u / ~ f J u r n c t / f J / ' ~ ~ ~ p ~ f ~ . s j ~ 5 3 . 6 0 0 . Mukherjee. R. M. and Antia. N. H. (1985). J ( J u ~ / I uo/'Clinicu/ / MicrfJhifJ/fJg)'21, 208. Mukherjee, R., Mistry. Y., Antia. N. H., Klein. N. and Vemuri. N. (1985)./CRS Midii,ul Si~irtiw 13.203. Murty, M. V. V. S. and Venkitasubramanian, T. A. (1984) Annukes di, Mii'r(JhkJ/fJgiP I /nstitut Pu.stcw) A135. 367. Nam-Lee. Y.and Colston. M. J. (1985). Journal qf'Grncrul Microhiologj, 131, 3331. Nath. I.. Prdsad, H. K.. Sathish. M.. Sreevatsa, K. N., Desikan. K. V.. Seshadri, P. S. and lyer. C. G. S. ( I 982). Antiniicrohiul Agetirs und Cheniotlierupj~21. 26. M d i c i n r 167. 30. Neill, M. A. and Klebanofl. S. J. (1988). Journul of' Espc~rin~entul Nunn. w. D. (1986). MicrohiokJgico/Roiieiix 50. 179. Ogawa, T. and Motomura. K. (1971). Kiru.suru Arcliiivs q / Esperinwntul Medicine. 44, 167. Pattyn, s. R. (1987). Antiniicrohiul Agrnts und C/ifwJrhc,rupy 31,671. Pattyn. s. R. and Portaels. F. ( I 980). /nt~~rnu/ionu/ JfJurncd of Leprosy 48,7. Pfefferkorn. E. R. ( 1 984). Proerrdings oftlie Notioncd A c ~ d e n i of'Sciivzci~s j~ f?f'//?l, United Sttrtr.~ of Antrric,cr 81. 908. Pogololti. A. I. and Santi, D. V. (1982). Anulyticol Bioclieniisrrj. 126,335. Portaels, F., Francken. A. and Pattyn. S. R. (1982). Annales de la SociktP Belge (fe Mkdicin TrfJpiru/e62,233. Portaels. F.. de Ridder. K. and Pattyn. S. R. ( I 985). Annu/i,.s t l Microhio/ogir ~ (/n.stirur Pusteur) 136A. 181. Portaek. F., de Muynck, A. and Sylla. M. P. (1988). Journd o/'Generol Mic,rfhifJ/OgJ 134. 849. Prabhakaran, K.. Harris. E. B. and Kirchheimer, W. F. (1973). Mic7-fJhifJ.Y 8, 151. Prabhakaran. K., Harris, E. B. and Kirchheimer, W. F. (1983). Archiues qf'Microhio/og)' 134.320. Prasad, H. K. and Hastings, R. C. (1985). Journal of'Clinicul MiCrfJhi(J/Og)'21,279. Qureshi. N.. Sathayanloorthy, N. and Takayarna. K. (1984). Journul of' Eucteriology 157.46. Rainwater. D. L. and Kolattukudy, P. E. (1985). Journul of' Biologicd CAoni.s/r),260,616. Ramashesh, N.,Hastings, R. C. and Krahenbuhl, J. L. (1987). /n/ec./ion and Immunity 55. 1203. Rastogi, N. and David, H. L. (1988). Bioc,liinriiJ70, 1101. Rastogi, N., Frehel. c.. Ryter, A. and David. H. L. (1982). Annules tkr MicwJhifJ/fJgie(/n.sti/u/ Pusriwr) 1338. 109. Ratledge. c. (1976). Ailiwci~sin Microhid Physio/f~gy13. 1 16. Ratledge. C. (1982).Iri "The Biology of the Mycobacteria" (C. Ratledge and J. Stanford, eds). vol. I, pp. 186-212. Academic Press, London. Rees, R. W. J. (1986). Lepro.sj3 Rei~icw57(2), 1. Rees. R. W. J. (1988). British Medicul Bulleiin 44,650. Rees, R. W. J. and Valentine, R. C. (1962). Intmi~itionalJournul of' Leprosy 30. I. Reeve. C. A.. Bockman, A. and Martin, A. (1984). Journul qf Bacteriology 157,758.
PHYSIOLOGY OF MYCOEACTERIUM LEPRAE
123
Rook, G. A. W. (1987). Clinical and E.vperimmtu1 Immunology 69, 1. Ruby, E. G . and McCabe, J. B. (1986). Journal o$Bacteriology 167, 1066. Ryter. A.. Frehel. C., Rastogi, N. and David, H. L. (1984). Acta'Leprologica 2, 21 1. Saito, H., Tomioka. H. and Yoneyama, T. ( I 984).Antimicrobial Agentsand Chemotheropy 26,164. Sathayamoorthy, N. and Takayama, K. (1987). Journal of Biological Chemistry 262, I341 7. Sathish. M., Rees, R. W. J.. Seshadri, P. S. and Nath. 1. (1985).International JournalofLeprosy 53, 378. Schaper. K.-J.. Seydel, J. K.. Rosenfield, M. and Kazda, J. (1986). Lepro.sJ>Reiliew 57(3), 254. Schinnick, T. M.. Vodkin, M. H. and Williams. J. C. (1988).In/kction and Immunity 56, 446. Scott. W. A.. Zrike. J. M., Hamill, A. L., Kempe, J. and Cohn. A. 2.(1980).J r ~ u m a / c ~ f E . ~ p ~ ~ r i n i ~ i i ~ a ~ Mrdkiiie 152, 324. W. ( 1984).I n "The Mycobacteria: A Sourcebook" (G. P. Kubica and L. G . Wayne. eds), pp. 547-574. Marcel Dekker. New York. Sever, M. H. (1936).American Journal o f P l i j ~ . ~ i ( ~115, l o g 38. ~ Seydel, J. K., Rosenfield, M., Sathish, M., Wiese, M., Schaper, K.-J., Hatchel, G..Haller. R., Kamy, M. and Dhople, A. M . (1986). Lepro.yj, Rericw. 57(3). 235. Seydel, U., Lindner. B. and Dhople, A. M. ( 1985).Intrrnirtioriirl JIJU~IIUI ( J f Leprosy 53, 365. Sharp, A. K. and Banerjee, D. K. (1985).Clinicd und E.~prrinieniirlI n i ~ ~ i ~ t i60. ~ l203. ~~gj~ Sharp. A. K.. Colston. M. J. and Banerjee. D. K. (1985). J ( J U ~ ~o Uf M / r d i ~ dMicrohiologj. 19. 77. Shepard, C. C. (1960).Journal o / ' E . ~ p ~ r i n ~ i Mrdicinr ~ntal 112, 445. Shepard. C. C. and McRae, D. H. (1965). Journul (Jf BuCfrrkJlfJgJ89. 365. Sherman. 1. W. ( 1979). Mii~robiologic~al Rri:ielrs 43. 453. Shimikata, T.. Tsubokura, K. and Kusaka, T. ( 1986).Ardiire.v ofBiochcvnistry and Biopl1j.sic.s 247, 302. Shetty. K. T., Antia. N. H. and Krishnaswamy, P. R. (1981).Internr~tionrrlJournuI of' L e p r ( ~ . ~ y 49.49. Sibley. L. D., Frdnzblau, S. G. and Krahenbuhl, J. L. (1987). Infection and Inmiunity 55, 680. Siha. C. L., Tincani, 1.. Brandao Filho, S. L. and Faccioli, L. H. (1988). Journul of GennPraI M i ~ r ( ~ h i o l (134, ~ g j ~1629. Silva. M. T. and Macedo. P. M. (1984). Journal qf'General Microbiology 130, 369. Silva. M. T., Macedo, P. M.. Costa. M. H. L.. Gon~alves,H., Torgal, J. and David, H. L. (1982). Annules ~kMicwhiologir (Institut Pusteur) 133B. 75. Silva. M. T., Portaels, F. and Macedo. P. M. (1989). Intc~rnotionalJournal of' Leprosj, 57. 54. Smida. J., Kazda. J. and Stackenbrandt, E. (1987). International Journal of Leprosy 56, 449. Smith, J. H., Folse. D. S. and Long, E. G. (1983).Journal ofthe Reticuloendothelial Society 34,75. Snapper. S. B.. Lugosi. L., Jekkel, A.. Melton. R. E., Kieser, P.. Bloom, B. R. and Jacobs, W. R. ( 1 988). Procwt/irig.s of the Nationul A i ~ d e m yof S1ience.v of the United Stutes ( I f Anierico 88, 6987. Snow. G . A. (1970). BUCti~i(J/cJgicUlRei:ieiv.y 34, 99. Sritharan. M. (1988).PhD Thesis: University of Hull. Sritharan. M. and Ratledge, C. (1989). FEMS Microbiologj, Letters 60, 183. Sritharan, M. and Ratledge, C. (1990). Biology (!/Mrtals 2, 203. Sritharan. V. (1987). PhD Thesis: University of Hull. Sritharan. V.. Ratledge, C. and Wheeler. P. R. (1987).Journal o/'Generul Microbiology 133.278 I. Sritharan. V., Wheeler. P. R. and Ratledge. C. (1989).Journul qfGeneral Microbiology 136, 203. Stanford. J. L. (1989).In "The Biology of the Mycobacteria"(C. Ratledge. J. L. Stanford and J. M. Grange. eds), vol. 3. pp. 567-596. Academic Press, London. Takayama. K.. Qureshi, N. and Schnoes. M. K. (1978). Lipids 13, 575. Talati, S. and Mahadevan, P. R. (1985) IRCS Medical Science (Bioclirniistrj~)13, 290. Tepper, B. S. and Varma, K. G. (1972). Journal of Generul Microbiolog), 73, 143. Thurman. P. and Draper, P. (1989). Acra Leprologica, 7(1),74. Truman, R. W., Shannon, E. J., Hagstadt, H. V., Hugh-Jones, M. E., Wolff, A. and Hastings. R. C. ( 1986). Americun Journol of Tropicid Medicine and Hygiene 35, 588. Varani, J. D.. Dame, M., Beak, T. F. and Wass. J. A. (1983).Biotechnology and Bioengineering 25, 1359. Vejare, S . and Mahadevan. P. R. (1987). Journal of Bioscirnw 11, 455.
124
P K. WHEELER
Walker, R. W.. Prome. J. C. and Lacave. C. (1973) Biochiniicu et Biop/iysicu Actu 326, 52. Waters. M. F. R. (1989). /ti "The Biology of the Mycobacteria" (C. Ratledge. J. L. Stanford and J. M. Grange, eds), vol. 3, pp: 405476. Academic Press, London. Wayne. L. G. and Lin. K.-Y. (1982). It!/i.c/i~~n und /niniunitj, 37, 1042. Wheeler. P. R. ( 1 983). J O U r / l U / O/Ge/ifWI/MiC/YJhi(J/(JgJ'129, 1481. Wheeler, P. R. ( 1 984a). J { J U ~ ~fJ/I UGPtlcVW/ / MiCrfJhicJ/Og.l'130, 38 I . Wheeler, P. R. ( I984b). /nternrr/ioncr/ Jourtid of' L ~ ~ Y J52. . Y208. ). Wheeler. P. R. ( 1984~)./n/er/inriotiu/ J o u r n d of' Lepro.q~52, 49. Wheeler, P. R. (1986a)./ti "Proceedings of the Indo-UK Symposium on Leprosy. Agra, April 7-10, 1986. Central Jalma Institute for Leprosy. ICMR" (V. M. Katoch. ed.). pp. 195-205. Coronation Press. Agra. Wheeler, P. R. ( 1986b). L c p Wheeler, P. R. ( 1986~).Lrpr Wheeler. P. R. ( 1987a). J ~ J u ~ /~~Ju/ /' G c w YMic*rohirJ/ogj, ~ 133. 2999. MicV'OhidfJgJ' 133, 301 3. Wheeler, P. R. (1987b). JfJU/'/lU/(!/'Gc,/ics/'c// Wheeler. P. R. ( 1 988). Jourtld Of Mrt/ic~r/MiC~Ohi~J/fJgl' 25. 167. L P ~ / c I 57. . . F 179. Wheeler. P. R. (1989a). FEMS Mic'/YJhi(J/fJg.l' ~ 185. Wheeler, P. R. (1989b). FEMS Mic,ro/jio/ogj,L c , / t c ~57, Wheeler. P. R. ( 1990). Joitrncd (J/'Generu/A 4 i ~ r ~ ~ h i ~136, ~ k ~189. g.1 ~ g j . 2321. Wheeler. P. R. and Bharadwaj, V. P. (1983). Journd o/Ganeru/ M i c r ( ~ h i ( ~ / r 129, Wheeler. P. R. and Gregory, D. ( 1980). J ~ ~ i ~o/'Grticw/ i t d Mic,rohio/og,v 121, 457. Wheeler, P. R. and Ratledge. C. (1988a). Joirr/iu/ of t i c w i d Micwhio/ogj. 134, 21 I I. Wheeler, P. R. and Ratledge. C . (l988b). Bri/i,s/i Mcvlicd Bu//r/in 44, 547. Wheeler. P. R.. Bharadwaj. V. P. and Gregory, D. (1982). Journd o/Generu/ Microhio/oJgj7128, 1063. Wheeler, P. R.. Bulnier. K. and Ratledge, C. (1990). Journd o/'Getieru/ M i c r o h i o / o ~ j136, ~ 21 I . Wietzerbin-Falszpan, J., Das. B. C.. Gros. C.. Petit, J.-F. and Lederer, E. ( 1973). Europecui Jour/itr/ o / Biodw?iis/r>~ 32. 525. Winkler, H. H. (1976). Journcd o/Bio/ogi:icu/ Clirniistrj, 251, 389. Wolf. R. H.. Gormus. B. J., Martin. L. N.. Baskin, G. B.. Wdkh, G . P., Meyers, W. M. and Binford, C. 11. ( 1985) Science 255, 529. World Health Organization (1985). UNDP/World Bank/WHO special programme for research and training in tropical diseases. Tropical disease research, seventh programme report ( I January 1983-31 December '1984). Leprosy. chapt. 8. World Health Organization, Geneva. World Health Organization ( I 989). UNDP/World Bank/WHO special programme for research and training in tropical diseases. Tropical disease research, ninth programme report (198771988). Leprosy. chapt. 4. World Health Organization, Geneva. YOUIlg. D. B. ( I 98 I ) . / ! l / C I . / l U / / O / I N / JOur/iU/ Of Lt/N'fJ.Yj' 49, 198. Young, D. B. (1988). Briti.v/i Midicd Bu//rtin 44, 562. Young, D. B.. Khanolkar. S. R.. Barg, L. L. and Buchanan,T. M. (1984). fr~/i.c/ioncmc//mnirini/~43, 183. Young. R. A,, Mehra. V.. Sweetser, D.. Buchanan, T., Clark-Curtiss, J. and Davis, R. W. (1985). No/urr 316. 450.
Note Added in Proof. To be Read in Conjunction with p. 79 The wall protein complex from M . Ieprae acts as a vaccine against leprosy in mice as it protects them against challenge with live M . leprae. The individual peptides which form part of the complex have no protective effect on their own (R. M. Gelber, P. J. Brennan, S. W. Hunter, M. W. Munn, J. M. Monson, L. P. Murray, P. Sin, M. Tsang, E. G. Engelman and N. Mohagheghpour (1990). Injection and Immunity 58, 71 1). A wall fraction from M . aurum catalyses cell-free incorporation of [14C]acetate into mycolic acid (C. Lacave, M.-A. Laneelle and G. Laneelle (1990). Biochimicu et Biophysic'a Acta 1042, 315). This is the first demonstration of complete cell-free synthesis of mycolate in mycobacteria although individual enzymes, in what must be a series of reactions. have not been demonstrated.
.
Magnetotactic Bacteria: Microbiology Biomineralization. Palaeomagnetism and Biotechnology STEPHEN MA"". NICK H . C. SPARKS" and RON G . BOARDb Schools of Chemistry" and Biological Sciencesh Universiry of Bath. Bath BA2 7 A Y . U K 1. Introduction . . . . . . . . . I1. Occurrence . . . . . . . . . . I11. Methods of study . . . . . . . . A . Enrichment cultures . . . . . . B. Axenic culture . . . . . . . IV . Physiology . . . . . . . . . . A . Physiology and niche exploitation . . B. Ayuuspirillum mugnetotacticum . . . V . Fine structure . . . . . . . . . VI . Biomineraliza tion . . . . . . . . A . Structure of magnetic inclusions . . . B. Morphology of magnetite crystals . . C . Crystal growth . . . . . . . D . Mechanisms of biomineralization . . . VII . Magnetotaxis . . . . . . . . . A. Cell motility . . . . . . . . B. Ecological significance . . . . . C. Magnetotactic or homeostatic mechanism? VIII . Palaeomagnetism . . . . . . . . IX . Biotechnological applications . . . . . X . Addendum . . . . . . . . . . XI . Acknowledgements . . . . . . . . References . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
. .
. .
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
. .
. .
.
.
.
.
.
.
.
. . . . . . . . . . . . .
. . . . . . . . . . . . .
. . . . . . . . . . . . .
. . . . . . . . . . . . .
. . . . . . . . . . . . .
. . . . . . . . . . . . .
. . . . . . . . . . . . .
125 126 134 134 138 141 141 144 146 148 148 154 157 160 165 166 169 172 173 176 117 119 179
I. Introduction Major discoveries in microbiology invariably herald intense research activity involving other disciplines. particularly biochemistry. molecular biology and genetics. Such activity followed Blakemore's (1975) report on the occurrence ADVANCES I N MICROBIAL PHYSIOLOGY. VOL 31 ISBN 0-12-027731-x
Copyright I 1990. by Ac'idemic Press Limited All rights of reproduction in rny form reserved
126
s
MANN. N
nc
SPARKS A N D R G BOARD
of bacteria that respond to the earth’s magnetic field such that “the cell is effectively a self-propelled magnetic compass needle” (Guell et al., 1988). In this instance, however, it involved an unusually broad spectrum of scientific disciplines. The ubiquitous distribution of magnetotactic bacteria raised important questions among earth scientists about the possible contribution of these organisms to magnetostratigraphy and palaeomagnetism. Crystallographers were intrigued by the precise replication of species-specific crystallochemical properties accompanying the biosynthesis of intracellular, membrane-bound single crystals of the magnetic iron oxide magnetite (Fe,O,), which is responsible for the organisms’ magnetotactic response. Chemists continue to have an interest in these organisms because they provide a way of producing small (ca. 50nm), highly uniform magnetite crystals without recourse to the drastic regimes of temperature, pH and pressure which are often needed for their industrial production. Commercial uses of such crystals would be in the manufacture of magnetic tape, magnetic printing inks, catalysts, targeting pharmaceuticals in human medicine (Widder et al., 1978; Matsunaga and Kamiya, 1987) and the separation ofcell types in pathological investigations (Schwartz and Blakemore, 1984). Progress on all fronts has been severely limited, however, due to the problems associated with the isolation of magnetotactic bacteria and, even with the few strains in axenic culture, finding culture conditions that can be relied upon to provide dense cell suspensions for biochemical study. If the biotechnological potential of these organisms is to be realized, then increased effort must be given to studies concerned with the isolation and cultivation of magnetotactic bacteria. Hopefully this review will provide a timely stimulus to such studies. 11. Occurrence
Since Blakemore’s (1975) publication on the existence of magnetotactic bacteria, many studies have established that such organisms occur in a variety of habitats worldwide (Table I). Indeed, only sediments taken from thermal sources, such as hot springs and ocean thermal vents, have so far proved negative for magnetotactic bacteria (D. Bazylinski, personal communication). In his 1982 review, Blakemore refers to a survey conducted in North America by Dr T. T. Moench who detected, but did not enumerate, magnetotactic bacteria in 37 of 41 samples taken from fresh water and marine environments. In a survey of 60 mud samples from ponds in the FRG, Oberhack et al. (1987) recorded the occurrence of a range of morphological types of magnetotactic bacteria in 12 samples. Judging from the observations summarized in Table 1, sewage-treatment oxidation ponds, the settling basins of water purification
TABLE 1. The occurrence of magnetotactic bacteria in various niches Country
Assay method"
USA
MT-L MT-L MT-F I MT-L MT-L
NT
Australia/ MT-L New Zealand MT-L
NT NT
Brazil'
FRG
MT-L/E MT-E MT-L MT-L
UK
MT-L MT-E
Japan
MT-L MT-E MT-E
Ponds and Sewage-treatment WaterBvers, Estuaries Saltmarsh lakes oxidation purification streams and marine ponds ponds settling and ponds sediments ponds NT
+
NT
NT NT
NT NT
NT NT NT
NT NT
+
NT NT
NT NT
+
NT
+
NT NT
+ +
NT NT NT NT
NT NT NT NT
NT NT
NT NT
NT NT NT
NT NT NT
NT
+
+
+ + + + + + +
+
+
+ + + + + +
References
NT NT NT NT
Blakemore (1982) Moench and Konetzka (1978) Stolz e t a / . (1988) Bazylinski et al. (1988)
NT NT
Lins de Barros and Esquivel (1980), Frankel et a/. (1979).
NT
NT NT
Blakemore (1982) Kirschvink (1980)
NT NT NT NT
NT NT NT NT
NT NT NT NT
Spormann and Wolfe (1984) Vali et a/. (1987) Oberhack et a/. (1987) Wolfe et a/. (1987)
+ NT
+ +
NT
NT NT NT
NT NT NT
+
+
+b
+ NT
+
NT
Sparks et a/. ( I 986, 1989) Carlile (1985), Carlile ct a/. (1987) Matsuda ef a/. (1983) Mizota and Maeda (1983) Matsunaga and Kamiya (1987)
MT-L, mud samples taken to the laboratory and magnetotactic bacteria harvested with a magnet. MT-F, magnet used to recover magnetotactic bacteria in situ. MT-E, mud sample stored for weeks/months in laboratory and a magnet used to attract organisms to the side of the container or to demonstrate magnetotatic response of bacteria in a hanging drop prepared from the mud-water interface. 1. axenic culture obtained. *Samples collected from Santa Barbara Basin (34' 1 4 N, 1 2 0 I'W) at a depth of 598 m (temperature of site, 8°C). Magnetotactic algae of genus Anisonema (Eug/enophvceae)isolated from coastal mangrove swamp in North-eastern Brazil (Torres de Araijo ef a/., 1985).
NT, not tested.
128
S MANN. N H C SPARKS A N D R. G BOARD
plants and natural ponds with accumulated organic sediments are particularly good sampling sites for magnetotactic bacteria. Three surveys in the UK (Sparks et al., 1986, 1989 and unpublished observations) have identified saltmarsh pans (Fig. la) as an important niche for these organisms, especially the coccal forms (Table 2). These authors detected magnetotactic bacteria in 28 out of 29 samples taken from saltmarsh pans located alongside the Firth of Forth (Scotland), the River Dee (Wales) the River Severn (Gloucestershire), the River Axe (Devonshire) and the River Colne (Essex). Many of these pans have been sampled seasonally over several TABLE 2. The results of surveys to establish the occurrence of magnetotactic bacteria in the
UK” ~
Water
Fresh
Status
Static No sediment Sediment Flowing Sluggish over sediment Fast over silt, sand or gravel
p H value
Negative
Positive
7.48.4 7.c7.7 5.5-6.5
2 6 7
0 15 0
7.3-8.2 6.2-7.0
I 14
8 12
2
0
32
35
Mine water Total Salt
No. of samples
Saltmarsh pans
6.9-7.9
1
28
Boating pond
6.6-7.1
0
3
Estuary Silt Sand
6.9-7.5 7.5-8.0
0 2
3 0
Beach Silt Sand
7.3 6.9
0 0
I 1
Harbour Polluted
7.5
2
0
5
36
Total Grand total “Based on Sparks observations).
P I a/.
37
71 (108)
(1986, 1989) and N. H. C. Sparks and J. Lloyd (unpublished
MAGNETOTACTIC BACTERIA
129
(b) FIG. I. (a)Saltmarsh pan in the River Colne, Essex, UK. (b) Boating-lake on WestonSuper-Mare beach, UK.
130
s. MANN.
N.
n. c. SPARKS A N D R. G . BOARD
years. Invariably, magnetotactic bacteria were detected when the samples were stored in the laboratory, often within 24 hours of collection. Observations made over a four-year period showed that magnetotactic bacteria were always present in a children’s boating pond (Fig. lb), a manmade feature on the beach at Weston-super-Mare (Avon). Such organisms occurred also in 15 of 21 sediment samples taken from freshwater ponds with pH values ranging from 7.0 to 7.7, but not in those having an acid reaction (Table 2). Protracted incubation of sediment samples taken from streams yielded positive cultures in 16 out of 31 cases, the highest success rate being achieved with fine sediments from slow-flowing streams. When the results of the surveys of Sparks et al. (1986,1989) are considered along with the information presented in Table 1 and the review by Blakemore (1982),certain generalizations can be made about conditions which appear to favour the growth of magnetotactic bacteria in nature. An organic-rich, fine sediment having a neutral-to-alkaline reaction and subjected to periodic disturbance would appear to be a favoured niche. As yet the information does not allow conclusions to be made about the tolerance/requirements of magnetotactic bacteria with respect to sodium chloride. It needs to be stressed that a variety of techniques have been used in the studies summarized in Tables 1 and 2. In some instances (Matsunaga and Kamiya, 1987)a magnet has been used to harvest magnetotactic bacteria from sediments in situ. In other cases, samples of mud and overlying water have been taken from the sampling site, stored in dim light in the laboratory and observed for upwards of six months. The latter procedure was adopted by Sparks et al. (1986, 1989) in order to study samples obtained from sites scattered throughout the UK. Differences in sampling methods must be borne in mind when considering the range of morphologies of bacteria exhibiting the magnetotactic response (Table 3). Rod-shaped and vibrioid magnetotactic bacteria have been seen in material collected by a magnet from sediments in situ (Matsunaga and Kamiya, 1987).By way of contrast, magnetococci (Table 3) appear to be the dominant magnetotactic bacteria in sediment samples incubated in the laboratory. It is notable that the formal definition of Bilophococcus magnetotacticus was based on organisms occurring in enrichment culture but not isolated in axenic culture (Moench, 1988)-see Table 6. Such samples must be considered to be perturbed ecosystems. As such, organisms that are not dominant in the native site may well become so, at least transiently, in a sample stored in the laboratory. A succession of magnetotactic bacteria in sediments stored in the laboratory have been observed on at least two occasions. The results of a study by Vali et al. (1987), together with the methods of observation, are summarized in Table 4. It is evident that the original sample of mud contained low numbers of magnetotactic spirilla and cocci. Magnetococci were the dominant morpho-
131
MAGNETOTACTIC BACTERIA
TABLE 3. Morphology of magnetotactic bacteria’ Morphology“ Spirillah
Vibrioidsd
Cocci‘ (large, 1.6+0.2pm)
Rods
Present in Sediment from Exeter River, USA Schweinsberger Moor, FRG Ditch, UK Saltmarsh pans, Essex, UK Santa Barbara Basin, USA Pond, Japan Woodshole, USA Saltmarsh pans, UK
References Blakemore et a/. (1979) Spormann and Wolfe (1984) N. H. C. Sparks and J. Lloyd (unpublished observations) Stolz et a/. (1986) Matsuda el a/. (1983) Bazylinski et a/. (1988) N. H. C. Sparks and J. Lloyd (unpublished observations)
Common in fresh- and sea-water Sparks et a/. (1986, 1989), Lins de samples worldwide Barros and Esquivel (1981), Moench and Konetzka (1978). Vali er a/. (1987). Oberhack el u/. (1987) Santa Barbara Basin, USA
Stolz ei 01. (1986), Vali et a/. (1987)
Sediment from Exeter River, USA
Mann et d.(1987a)
* For illustrations of cell types, see Blakemore el a/. (1989).
’The majority of organisms examined to date are propelled by flagella. However, Wolfe el a/. (1987) have reported the occurrence of magnetobacteria that glide or twitch. * An axenic culture of Aquaspirillum magnetotacticum was isolated by Maratea and Blakemore (1981). A formal description of magnetococcus based on material from enrichment cultures, Bilophococcus magnetotactis gen. nov. sp. nov., was proposed by Moench (1 988). An axenic culture of an anaerobic vibrioid was obtained by Bazylinski et a/. (1988).
logical form during the three-day to two-month period of incubation. When the rate of movement of cells in an imposed magnetic field and characteristics of the magnetosomes are considered, it would appear that there was a succession of coccal types during this phase of incubation. The dominance of the magnetococci was eclipsed by magnetospirilla by the fourth month and the latter were again outnumbered by magnetococci by the sixth month of incubation. Further incubation led to a marked die-off of magnetotactic bacteria. Because Vali and his collaborators “trawled” for magnetotactic bacteria by suspending a bar magnet in the water overlying a deep column of mud, the results summarized in Table 4 probably reflect accurately a succession of organisms. The factors contributing to such a succession have not been studied. Great care needs to be taken in the interpretation of results
132
S. MANN. N. H. C. SPARKS A N D R. G.BOARD
TABLE 4. Succession of magnetotatic bacteria in an enrichment culture” Incubation
Dominant organisms
Magnetosomes
1-2 days
Spirilla and cocci; present in low numbers only
Not determined
2-3 days
Cocci; rate of movement in an imposed magnetic field, cu. 20 p m s-
One chain of 1&12 prismatic magnetosomes each cu. 1SOx 120nm
2 months
Cocci; rate of movement ca. SOpms-’; covered with fine pili
200 prismatic magnetosomes (70 x 130nm) cell; straight, parallel and partially looped chains and “nearly unordered clusters”
4 months
Spirilla (up to 8 pm)
1-3 chains strung out along the long axis of cell; ca. SO dimorphic magnetite crystals (5&80 nm)
6 months
Cocci; half moved to north pole and vice versa
> 6 months
Very few magnetotactic bacteria present
’
“A glass vessel (IOcm in diameter and 25 cm in height) was filled with S00ml of fresh mud from a pond near Landshut in Bavaria. After settling, about 2-3 cm ofclear water was left above the mud. The cylinder was loosely covered and kept under dimmed daylight at room temperature (cu. 20-23 C). I t was left to rest during the whole period of the experiment, no further additions of mud were made. The bacteria were sampled by a magnet which was mounted with the South Pole directed down a few millimetres above the water/mud interface. where its magnetic field had a magnitude of about 100 oe. Normally after about half an hour enough bacteria were concentrated in the uppermost layer, forming a muddy cloud just below the water surface, where they could be gently aspirated with a pipette”. (Vali el a/. (l987).)The pH drifted from 7 to 7.5 i n the course of incubation.
when a small sample from the sediment-water interface of material stored in the laboratory is examined with a light microscope. Thus Sparks et al. (1986, 1989)concluded that magnetococci were the dominant organisms in the vast majority of instances. If material from stored sediments was examined with electron optics, then magnetotactic spirilla and vibrioids were seen to occur in very low numbers, particularly with sediments incubated for several months. These observations suggest that the succession noted by Vali et al. (1987)may be a common occurrence. Recently, N. H. C.Sparks and J. Lloyd (unpublished observations) observed large numbers of both maghetotactic spirilla and cocci in samples from salt pans in Essex which had been stored overnight in the laboratory. The behaviour of these two organisms in an imposed magnetic field (bar magnet) differed such that their occurrence was easily detected by
MAGNETOTACTIC BACTERIA
133
FIG. 2. Accumulation of magnetotactic bacteria at the meniscus of a water drop under the influence of a bar magnet.
light microscopy. The magnetococci collected at the meniscus (Fig. 2) of the water drop whereas the magnetospirilla formed a band immediately behind the meniscus. This phenomenon became less pronounced upon further incubation and was confined to samples taken from a small number of locations in the sediment-water interface. Indeed, systematic sampling of the interface revealed enormous variations in the densities of the populations of magnetococci. These observations suggest that the factors favouring the growth of magnetotactic bacteria noted previously relate to gross features of an environment and that subtle and localized amendments provide niches in which particular morphological forms of magnetotactic bacteria flourish. The unpublished observations of N. H. C. Sparks and J. Lloyd on the heterogeneity in population sizes of magnetococci across the surface of sediment incubated in the laboratory suggest that perhaps even the mostsensitive monitoring systems, such as the membrane-inlet quadrapole mass spectrometer of Lloyd et al. ( 1986), would provide only an imperfect definition of the niches that support the growth of magnetotactic bacteria listed in Table 3. Consequently, detailed knowledge about the occurrence and relative abundance of the various morphological types of magnetotactic bacteria in nature will have to await the development of type-specific media that permit the quantitative isolation of particular groups of organisms. It is interesting to
134
S. MANN. N. H. C. SPARKS A N D R. G. BOARD
note, however, that of all the magnetotactic bacteria studied to date only eubacteria and not archaebacteria have been observed. The magnetotactic response has also been observed in eukaryotic micro-organisms,namely algae (Lins de Barros et al., 1981; Torres de Araujo et al., 1985). At present these systems have not been studied in detail and as a consequence little is known about them. 111. Methods of Study
Only three cultures of magnetotactic bacteria are currently in axenic culture: these are two spirilla (Aquaspirillum magnetotacticurn, Blakemore, 1982; NMG- 1F, T. Matsunaga, personal communication) and the vibrioid organism designated MV-1 (Bazylinski et al., 1988). Consequently, an unusually heavy reliance has had to be placed on enrichment cultures to provide organisms for study. The first part of this section deals with such cultures. The second is concerned with methods that have been developed for the isolation and maintenance of pure cultures of magnetotactic bacteria. A. ENRICHMENT CULTURES
Enrichment cultures are obtained simply by simulating a natural niche in the laboratory (Table 5). In their simplest form, sediment together with overlying water from a pond, estuary, etc., in which magnetotactic bacteria are known to occur, is incubated in dim light at an appropriate temperature (Fig. 3). Periodically a sample from the sediment-water interface is examined with a light microscope.A drop of the sediment-water mixture on a microscope slide is exposed to a magnetic field, either a bar magnet or a Helmholtz coil (paired
FIG. 3. Loosely capped bottle used for the enrichment of magnetotactic bacteria: S, sediment; W, overlying water; C, loose-fitting cap.
TABLE 5. Enrichment-ulture
methods used to produce large numbers of magnetotactic bacteria for laboratory study
Method 1. Beaker (2-2.5 I) with a layer
(5cm) of mud from oxidation pond overlayed with secondary influent from sewage works. A “large clump” of duck weed (Lemna sp.) added to each culture. Each beaker wrapped to the water line with brown paper covered with aluminium foil and capped with Saran Wrap (Dow Chemical Co.) to prevent evaporative water loss. Incubation in subdued light at room temperature (2CL27”C)
Observations Enrichment was intended to simulate small sewage oxidation ponds Large populations of magnetococci occurred within 1-2 months
References Moench and Konetzka (1 978). Moench ( I 988)
Magnetotactic bacteria harvested by attaching stirring bar magnets on opposite sides of beaker with modelling clay. Magnets situated at mid point of the column of water overlying the mud. Magnetotactic bacteria removed by Pasteur pipette and stored in liquid nitrogen if not required immediately
Sediment from the “top few centimeters” of deposit in ponds together with overlying water (ratio of sediment to water, 1.2) stored in bottles (3W800ml). The loosely capped bottles wcre incubated at room temperature (18-23°C) or at 6°C.
Method of harvesting magnetotactic bacteria similar to that described in method 1.
Spormann and Wolfe ( I 984)
Mud (3cm deep) from ponds overlayed with pond water (3cm) in large trays covered with glass sheet. Water loss made good periodically with distilled water
Method of harvesting magnetotatic bacteria similar to that described in method I
Carlile e/ at. (1987)
Method of harvcsting magnetotactic bacteria similar to that described in method 1
N. H. C. Sparks and J. Lloyd (unpublished observations)
4.Winogradskay columns. Sediment known to contain magnetotactic bacteria was placed to a depth of 2 cm in a large glass vessel; strips of filter paper were added and the sediment and filter paper covered with a 2-4cm layer of silica sand (Fisons 40-100 mesh with low iron content). Artificial sea-water added to a depth of > 15 cm. Incubation in dim light at room temperature
136
S. MANN. N. H.C. SPARKS A N D R. G. BOARD
coils separated by a distance equal to the radius of each coil). When magnetotactic bacteria are present, they swim in the magnetic field until the meniscus is reached. With magnetococci (Table 3), the cells form a dense ribbon contiguous with the meniscus (Fig. 2). Magnetospirilla, on the other hand, swim to the meniscus, reverse the direction of movement and form a diffuse band of cells just back from the meniscus. This has been attributed to aerotaxis overriding magnetotaxis (Spormann and Wolfe, 1984). With the enrichment cultures under discussion, a band of magnetospirilla just back from the meniscus of a drop of sediment-water is of rare occurrence. We have seen it with a sample from a farm pond and with another from a saltmarsh pan located in the marshy border of the River Colne, Essex. The success of an enrichment culture can be roughly assessed by the rate at which a band of magnetococci forms at the meniscus. With successful enrichment cultures such a band (Fig. 2) is formed within a few minutes whereas only a paltry aggregation of organisms occurs over a long period with a poor enrichment. In our experience, the latter situation is common with enrichment cultures using sediments from streams, particularly rapidly flowing ones. Some workers (Spormann and Wolfe, 1984; Moench and Konetzka, 1978) have used bar magnets, either attached to the side of a vessel or suspended in the water above the sediment, to attract magnetotactic bacteria. Matsunga and Kamiya (1987) used a samarium-cobalt magnet (the second-strongest magnet available commercially) to harvest magnetotactic bacteria, mainly vibrioids and rods, from pond sludge which had been enriched with succinic acid and nitrate. The magnet was attached to the bottom (outside) of an open plastic box which was then inverted in the water overlying the sludge. They obtained from lo7 to lo9 magnetotactic bacteria per “trawl”. In the majority ofcases the organisms are harvested with a Pasteur pipette or a syringe. A recent report indicates that the harvesting method may well influence the range of magnetotactic bateria in a dense cell suspension. Wolfe er al. (1987),who described a “capillary racetrack” method for isolating from enrichment cultures, appear to be the first workers to observe magnetotactic bacteria that move by gliding or twitching. Moench and Konetzka (1978) state that “wispy layers of magnetococci” formed throughout the water column of their enrichment cultures. Indeed, the diffuse nature of the aggregates led them to describe the aggregation thus: “the layering of cigarette smoke in an undisturbed and dimly lit room”. By direct cell counts they demonstrated that populations of 1.0 x lo9 magnetococci per ml were obtained at the magnetic focus of the magnet in such enrichment cultures. Indeed, with a 30 minute harvesting period populations of this magnitude were obtained daily from 10 to 30 days of incubation of enrichment cultures. According to Blakemore ( 1 982), 10’-lo4 magnetotactic bacteria per ml are of common occurrence in the sediment slurry of aquatic environments
MAGNETOTACTIC BACTERIA
137
sampled throughout New England, USA. Thus if the primary object is to obtain large numbers of magnetotactic bacteria for laboratory study, then enrichment cultures offer advantages over harvesting them from natural niches in the field. It must t e stressed, however, that the methods described in this section have favoured the growth of magnetococci in the majority of studies. By using a modification of the Winogradsky column method (Fig. 3), N. H. C. Sparks and J. Lloyd (unpublished observations) have produced flourishing cultures of magnetotactic bacteria, again mainly magnetococci, and maintained large populations over many months. Mud which was known to contain magnetotactic bacteria was mixed with strips of filter paper in a large vessel. The mixture was overlayed with silica sand and artificial sea-water. When small amounts of a sediment-filter paper mixture were overlayed with a deep column of sand, large populations of magnetococci occurred within the column. With large amounts of sediment and filter paper, the organisms occurred at the sand-water interface. In the latter case, there was a very heterogenous distribution of magnetotactic bacteria, mainly magnetococci, over the surface of the sand. As the enrichment cultures set up by Sparks and Lloyd did not contain calcium sulphate (other than that contained in the sample of sediment), the influence of sulphide concentration on the development of populations of magnetococci was investigated. It is evident from Fig. 4 that a sulphide concentration of CCI. 50 ppm appears to optimize the growth conditions for these organisms and that higher concentrations are toxic. The role of sulphide has not been identified but it is surmised that it may be poising the redox potential of the enrichment culture. Until such times as there are suitable media for the isolation of the full range of magnetotactic bacteria, enrichment cultures will remain an important source of organisms for laboratory study. This section has demonstrated that there are well-tried methods that can be relied upon for a supply of the mostcommonly occurring organism, the magnetococci. The successes which have attended modifications of the Winogradsky-column method suggest that large populations of other forms of magnetotactic bacteria might be established in niche-simulating conditions within the laboratory. . Various methods have been adopted in order to “purify” magnetotactic bacteria harvested by magnets as described above. Courteaux (1 986) achieved some success using a bar magnet to attract such organisms along flattened capillary tubes or through a small piece of non-absorbent cotton wool. In the latter case, the cotton wool impeded the movement of non-magnetotactic bacteria, N. H. C. Sparks and J. Lloyd (unpublished observations) used a weak agar solution for this purpose. Of the methods tried to date, that of Wolfe et al. (1987k-a “capillary racetrack” method-appears to be particularly well suited to freeing magnetotactic bacteria from contaminants. It could well
s. MANN. N. n. c. SPARKS AND R. G . BOARD xi04 8
7654-
3-
21-
0 Added sulphide (ppm)
FIG. 4. Effect of added sulphide on magnetococcal numbers in enriched samples (after 10 days).
prove to be an important means of harvesting such organisms at the first stage in attempts to isolate axenic cultures. In brief, a portion of sediment containing magnetotactic bacteria is placed alongside the reservoir of a capillary tube which has been filled with membrane-sterilized water and is positioned in a specially designed slide holder filled with distilled water. A bar magnet is placed outside the holder and near the sealed tip of the capillary furthest from the reservoir. The migration of magnetotactic bacteria out of the cotton wool and along the lumen of the capillary tube is observed microscopically (dark field illumination, stage phase-3 setting with x 10 or x 16 phase ocular). Creeping, gliding and twitching magnetotactic bacteria as well as those propelled by flagella were observed. B. AXENIC CULTURE
Two of the three magnetotactic bacteria ( A . magnetotacticum and MV-1) that have been isolated and maintained in pure culture will be discussed in this section. A formal definition of another magnetotactic bacterium, Bilophococcus magnetotactis has been based on material obtained from enrichment cultures (Moench, 1988; see Table 6).
139
MAGNETOTACTIC BACTERIA
TABLE 6. Phenotypic properties of magnetotactic bacteria* Property
Shape
Size Gram strain Cell-wall type Flagella G + C (rnol%) Relationship
Anaerobic vi brioid MV-I*
Aquaspirillum magnetotacricum MS-I"
Helical (right-handed) with coccoid elements in late growth 0.2-0.4 x 4.C6.0 pm Negative Gram-negative Single, bipolar 64.9 Micro-aerophilic
Bilophococcus mugnetotuctis'
Vibrioid
coccus
0.2-0.4 x 1-3 prn ND ND Single, polar 53.5 Micro-aerophilic
1.6 pm Negative Gram-negative Two bundles 61.7 & 0.1 Micro-aerobic
ND ND
-
-
to 0,
Catalase Oxidase Anaerobic growth with NO; NO Optimum growth temperature lntracytoplasmic inclusions Cytochromes Energy derived from
ND
-
+
30°C
ND
ND ND ND
poly /l-hydroxy butyrate a, h, c- and o types Organic' but not amino acids
ND
Sulphur
ND Organic and possibly certain amino acids
c-type ND
* For additional details, see Blakemore et a/. (1989). Propertiesdetermined by Maratea and Blakemore(l981). Blakemore(l982) and Blakemoreet ul. (1979, 1980). Details taken from Bazylinski er a/. (1988). ' Based on the work of Moench and Konetzka (1978) and Moench (1988). Gene libraries of this organism have been constructed in Escherichia coli with cosmids pLAFR3 and c2RB as vectors (Waleh, 1988).The recA gene of Aquaspirillum mqnetotacticum has been isolated from a library and introduced into a recA mutant strain of Escherichia coli (Berson et al., 1989). Those of the TCA cycle appear to be the preferred substrates. ND, not determined.
1. Aquaspirillum magnetotacticurn This organism (Table 6) was isolated in axenic culture by Blakemore et al. (1979) and formally named by Maratea and Blakemore (1981). Enrichment cultures were used in the initial stages of its isolation. Jars filled to about twothirds of their volume with mud and water from Cedar Swamp, Mass., USA, were left undisturbed in dim light a t ca. 22°C. After several months the
140
s
MANN, N
nc
SPARKS A N D R G BOARD
populations of magnetotactic bacteria had increased from an initial density of ca. 200 to 106-107 cells per ml of surface sediment. Large numbers of many morphological forms of magnetotactic bacteria were present. Permanent bar magnets were used to harvest magnetotactic bacteria which, after being washed in filtered, sterilized bog water, were injected through the stopper of vessels containing prereduced medium of the following composition: 10 ml of filtered bog or swamp water; 1 ml of a vitamin mixture; 1 ml of a mixture of mineral salts; 0.5 mM potassium phosphate buffer (pH 6.7). The following was dissolved in the mixture: vitamin B,,, 5 pg; ammonium chloride, 25 mg; sodium acetate (anhydrous), 10mg; resazurin, 0.2 mg; ionagar No. 2, 90 mg. The pH value was adjusted to between 6 and 7 with sodium hydroxide. The medium was prereduced under dinitrogen with titanium citrate as reductant and dispensed into culture vessels in an anaerobic hood. Material from wellisolated colonies was serially diluted in prereduced medium containing 0.85% (w/v) ionagar No. 2. This procedure was repeated on three occasions to ensure the purity of the isolate. It needs to be stressed that the magnetospirillum was a very minor member of the enrichment cultures; its presence was not noted during investigations with light microscopy. After isolation and purification, the magnetospirillum was grown in a medium of the following composition (per 98 ml of water): vitamin mixture, 1 ml; mineral-salts mixture, 1 ml;potassium phosphate, 5 mM; ferric quinate, 25 p ~ prepared by mixing 2.7 g ferric chloride and 1.9 g quinic acid in 1 1 distilled water; succinic acid, 0.1 g; sodium acetate (anhydrous), 10 mg; sodium nitrate, 10mg; sodium thioglycollate, 5 mg; agar, 130 mg. The pH was adjusted to 6.7 with sodium hydroxide. The headspace was amended to contain 0.6-1.0% (v/v) dioxygen. In a commentary on their development of, and attempts to amend, this medium, Blakemore et al. (1979) noted that: (i) intermediates of the tricarboxylic acid (TCA)cycle, /3-hydroxybutyrate, tartaric, lactic and pyruvic acids, but not amino acids, could be used as sole sources of carbon; (ii) nitrate was essential for growth in chemically defined medium; (iii) vitamins were not essential for growth; (iv) ferric quinate was essential for magnetite synthesisit could not be replaced by ferric citrate or ferric chloride, or by iron chelated with ~-jl-3,4-dihydroxyphenylalanine, protocatechuic acid, L-epinephrine, Larterenol or EDTA; and (v) that micro-aerophilic conditions have to be created for the successful growth of this magnetospirillum. They noted also that growth without magnetite synthesis occurred when the medium lacked ferric quinate. Strain MV-1 of a vibrioid magnetotactic bacterium (Table 6) was isolated from sulphide-rich sediment of an estuarine salt marsh near Boston, Mass., USA, by Bazylinski et al. (1988). The methods used in the isolation of this organism have not been reported in detail. Judging from their paper, the
MAGNETOTACTIC BACTERIA
141
authors used organic acids which were oxidized by the organism, with nitrous oxide serving as the terminal electron acceptor.
IV. Physiology There is limited information about the physiology of magnetotactic bacteria in general. Consequently, the first part of this section deals with those physiological traits that may play a part in fitting such organisms to their niches. The second part deals with the physiological studies done on A . magnetotacticum. A. PHYSIOLOGY AND NICHE EXPLOITATION
Cells of diverse morphology exhibit magnetotaxis as a consequence of magnetite inclusions in their cells (Table 3). As magnetosomes have been found in sediments dating back 50 million years (see Section VIII, Palaeomagnetism), there is presumably a marked phylogenetic diversity within this group of organisms. Magnetotactic bacteria appear to share another attribute in addition to that of the biosynthesis of membrane-bound magnetite (see Section VI, Biomineralization); uiz. a predeliction for niches within sediments or, more commonly, at the sediment-water interface. It can be inferred, therefore, that in terms of their place in a food chain, magnetotactic bacteria use simple products arising from the anaerobic digestion of organic debris. The range of substrates used to date in the isolation or axenic culture of magnetotactic bacteria (Blakemore et al., 1979; Bazylinski et al., 1988)is paltry when compared to the range that is known to occur in sediments (Kiene and Capone, 1988).It needs to be stressed also that there can be a marked stratification in the concentrations of substrates in such systems (Nedwell, 1987).Consequently it would be premature to assume that only a few common biochemical pathways are used by magnetotactic bacteria to exploit the nutrients in or at the surface of sediments. Moreover, there is as yet no compelling evidence (see Section VII) that magnetotaxis is linked exclusively with niche location and nutrient exploitation. Alternative interpretations of possible selective advantages of magnetotaxis will be considered below. If magnetotaxis is linked with nutrient exploitation then competition between magnetotactic bacteria and other organisms for common substrates needs to be considered. For example, methanogens would presumably be direct competitors to those bacteria that produce extracellular magnetite crystals of ill-defined morphology as a consequence of using the Fe3+ ion as an electron acceptor in highly reduced environments (Lovley et al., 1987).The
142
S. MANN. N. H. C. SPARKS AND R. G.BOARD
anaerobic vibrioid isolated from sulphide-rich muds by Bazylinski et al. (1988) would be another potential competitor to the methanogens. This magnetotactic bacterium links the oxidation of organic acids with the reduction of nitrous oxide. As yet, however, the redox potential favouring its growth, and therefore its ability to compete with methanogens, has not been established. It would appear from the limited information available that this anaerobic magnetotactic bacterium is tolerant of sulphides. The more-commonly occurring magnetotactic bacteria do not appear to have this attribute. Indeed, spatial separation would appear to be required for the growth of such organisms in environments in which sulphate-reducing bacteria flourish. Thus in enrichment cultures the former occur in the rusty-red surface layer on black/grey sediment (Fig. 5). Our experience (N. H. C . Sparks and J. Lloyd, unpublished observations) with enrichment cultures have led us to the opinion that sulphide at concentrations of up to 50ppm may stimulate the growth of magnetococci, and between ca. 50-300 ppm (Fig. 4) is inhibitory rather than lethal. Indeed, we have observed large populations of magnetotactic bacteria after protracted incubation of sediments which initially were black throughout. There are at least two possible interpretations of this observation. Firstly, the sulphide was influencing the redox potential in the enrichments such that conditions favourable to the growth of magnetococci were quickly established. Secondly, hydrogen sulphide was protecting magnetococci against hydrogen peroxide. The latter mechanism is known to be important in the case of organisms of the genus Beggiatoa (Krieg and Hoffman, 1986) which also occur at the water-sediment interface (Jorgensen and Revsbech, 1983).
FIG. 5. Stratification typical of a positive enrichment culture.
MAGNETOTACTIC BACTERIA
I43
It needs to be emphasized that we have never seen Beggiatoa spp. in enrichment cultures dominated by magnetotactic bacteria. This observation emphasizes a point made previously, namely that very subtle differences in the properties of a niche have a profound influence in the selection of one organism at the expense of another. Should organic acids that are known to support the growth of A. magnetotacticurn, for example, diffuse into the water column above sediments, then levels of oxygen conducive to the growth of autochthonous water bacteria such as caulobacters (Poindexter, 1964) and opportunistic organisms such as pseudomonads would result. This is a situation in which magnetotaxis linked with aerotaxis (Spormann and Wolfe, 1984) could well confer a selective advantage on A. magnetotacticurn. By initially exploiting a geomagnetic field and then subsequently a response to PO,, this organism would locate a niche favourable for microaerobic growth. Currently this scenario is commonly used to account for the apparent abundance of magnetospirilla in nature. The studies by Blakemore et al. (1985) have shown that NO, as well as low p 0 , are required for Fe,O, formation (see later). Whether or not magnetospirilla “sense” optimal NO; concentration along a gradient has not been established. An alternative view to that of aerotaxis determining niche location and resource exploitation was discussed by Blakemore (1982). He noted that magnetospirilla are easily damaged by hydrogen peroxide-the organism is more sensitive than Chrornobacteriurn spp. (Sneath, 1 9 5 2 b a n d that growth can be enhanced by the addition of catalase to a growth medium. He noted also that the relatively high concentration of iron within the cells could in theory afford protection against peroxides. If this evidence is considered in the context of a selective advantage to the organism, then magnetotaxis could be seen to be merely a means whereby magnetospirilla escape from environments in which high pOz may be conducive to peroxide formation. Proof of the selective advantages of this phenomenon would be difficult to obtain in practice in view of the multiplicity of systems that have evolved to protect micro-organisms from oxygen toxicity (Morris, 1988). Recently it has been shown (Short and Blakemore, 1989) that proteins with superoxide dismutase (SOD) activity were produced when A . magnetotacticurn MS-1 was grown micro-aerobically with a dissolved oxygen tension of 1YOsaturation. About 95% of the SOD activity was located in the periplasmic space with the irontype SOD being dominant in terms of total activity. However, with cultures grown at a higher oxygen tension (10% of saturation), there was an appreciable increase in the contribution to the total SOD activity by a manganese-type enzyme. As there is as yet no convincing evidence that magnetococci respond to pOz, their apparent dependence on magnetotaxis to locate the mud-water interface of a niche may be primarily an adaptation that ensures survival in niches
144
s. MA”.
N . n. c. SPARKS A N D R. G.BOARD
subjected to periodic and violent perturbation. This is obviously the situation occurring in the boating pond at Weston-super-Mare (Fig. lb) as a consequence of tidal action. In this siiuation magnetotaxis appears to confer a high survival value in the sense that some members of a population remain after a niche has been violently disrupted. A corollary to such a hypothesis is that physiological adaptability to exploit a niche is perhaps subordinate to magnetotaxis in terms of survival. B. AQUASPIRILLUM MAGNETOTACTICUM
Aquaspirillum magnetotacticum is a chemotroph that metabolizes a broad range of organic carbon sources, particularly intermediates of the TCA cycle (Blakemore, 1982; Blakemore et al., 1979). It is an obligate microaerophile that grows micro-aerobically (optimal growth being obtained in cultures having a dissolved oxygen tension at 1 % of saturation; Short and Blakemore, 1989) but not anaerobically with nitrate or ammonium as sole sources ofcombined nitrogen (Bazylinski and Blakemore, 1983).The synthesis of membrane-enveloped magnetite crystals (see Section VI for a detailed discussion) under closely controlled conditions with respect topOz and nitrate content of a medium results in the cells containing upwards of 2% iron on a dry-weight basis (Blakemore et al., 1985). The iron content of other magnetotactic bacteria is equally large, 3.8% of the dry-cell weight of magnetococci (Moench and Konetzka, 1978) and 1.6% of that of an anaerobic vibrioid (Bazylinski et al., 1988). As pointed out by Moench and Konetzka (1978),the iron content of magnetococci, for example, is 280 times that in dried cells of Escherichia coli, and 430 times in terms of iron per cell of E. coli. The concentration of this element in chemoheterotrophs in general is of the order 0.025% dry weight (Neilands, 1974). The response of A . magnetotacticum to the iron content of a growth medium appears to differ from that of many other chemoheterotrophs. Thus material yielding a positive test for the iron carrier hydroxamate was present in the spent culture fluid of A . magnetotacticum grown in high ( 2 0 ~but ~ )not low (5 PM) concentrations of iron (Paoletti and Blakemore, 1986)-the reverse of the normal response (Neilands, 1982). According to Paoletti and Blakemore (1986) the total iron concentration in the natural habitat of A . magnetotact~ spent . culture supernatant of A . magnetotacticum grown icum is ca. 2 0 ~The in the higher iron concentration enhanced the growth of an “enterobactin”deficient mutant (Lt-2-ent-7)of Salmonella typhimurium in a low-iron medium. A non-magnetic mutant (NM-1A) of A . magnetotacticum produced hydroxymates at both iron concentrations. Outer-membrane proteins (OMPs), the receptors for siderophores in many bacteria, were co-ordinately produced by A . magnetotacticurn at the iron concentrations that induced the
MAGNETOTACTIC BACTERIA
145
production of hydroxymate. An iron-repressible OMP (55 kDa) was produced by A . magnetotacticum grown in a medium of low iron content. Paoletti and Blakemore (1986) were unable to offer an explanation for this unusual response of A . magnetotacticum to the iron content of the medium, but they did stress that other Aquaspiriflum spp. responded in a similar manner. Thus, A. magnetotacficum appears to be well adapted for the scavenging of iron needed to satisfy its very large requirements for magnetite biosynthesis. Generally, the studies of iron metabolism by heterotrophic bacteria have been concerned with transport (Neilands, 1974) and the synthesis of iron metallo-enzymes such as the cytochromes (Crichton and CharloteauxWeuters, 1987).With magnetotactic bacteria, such studies need to be extended to include the biosynthesis of magnetite (see Section VI). In their studies of nitrate metabolism by A . magnetotucticum, Bazylinski and Blakemore (1983) used a Petroff-Hausser cell-counting chamber to establish population sizes, electron microscopy to demonstrate magnetic inclusions and direct microscopic examination to determine cell magnetism. They noted the fraction of cells, both the quick and the dead, that reversed direction when a small permanent magnet located 5-10cm from the microscope stage was rotated through 1800. All three methods, especially the last mentioned, are cumbersome and time consuming. The demonstration that magnetotactic bacteria exhibit optical birefringence (Rosenblatt et al., 1982) has led to an elegant method of measuring cell magnetism in a population. Thus Blakemore et af. (1985) fixed the magnetospirilla in 5 ml of culture fluid with one drop of gluteraldehyde (10% w/v). Fixed cells were placed in a cuvette (3 ml; 1 cm path length) which was situated within a Helmholtz-coil pair and contained in a Mumetal canister to eliminate the ambient magnetic field. The optical axis was arranged such that it was perpendicular to the applied magnetic field. Birefringence increased as the field strength increased over the range 0.1-25.0 Oe. As only magnetic cells contributed to birefringence, their concentration in a population (determined by direct microscopic counts) could be determined. When Blakemore and his collaborators used this technique in studies on the influence of PO, on the growth of A. magnetotucticum, they noted the following. The magnetospirilla grew after a protracted lag phase in media contained in sealed containers. Growth never occurred with small inocula in media which were in free exchange with the atmosphere. When the initial pOz in the headspace of a culture vessel was between 0.5-5.0 kPa, more than 50% of the cells of magnetospirilla had magnetosomes. Outside of this range, Fe,O, production declined even though there was cell growth. The nitrogen source also played a role. Thus, with nitrate, optimal Fe,O, formation occurred with 1 kPa PO, but with 0.5 kPa when ammonium was used as the sole nitrogen source. Not only did optimal
s. M A N N . N . n.c. SPARKS A N D R. G. BOARD
146
PO, give the largest proportion of magnetosome-containing cells, but also cells with the highest average numbers of such inclusions. These observations led Blakemore and his associates to conclude that magnetospirilla had a specific requirement for oxygen and nitrate for growth and for Fe,O, synthesis. V. Fine Structure Table 7 summarizes the main ultrastructural features of A . magnetotacticum and Bil. magnetotacticus. Apart from membrane-enveloped crystals of magnetite (magnetosomes), and often large intracellular globules of poly-phydroxybutyrate, these two organisms do not differ in their fine structure from other commonly occurring heterotrophic bacteria. The size, morphology and distribution of magnetite in magnetotactic bacteria are summarized in Table 8. It is evident that the morphology and the distribution of the crystals varies markedly between cells of different morphologies. Presumably this reflects a feature noted previously, the phylogenetic diversity of this group of organisms. Membrane-bound crystals have been reported by Towe and Moench (1981) and Mann et al. (1987a), but to date only the membranes enclosing the crystals synthesized by A. magnetotacticum have been studied in detail (Gorby et al., TABLE 7. A summary of the fine structure of magnetotactic bacteria Structure
Aquaspirillum
Bilophococcus
magnetotacticurn
rnagnetoractisb
MS-1" Flagella
Single bipolar
Two adjacent tufts 10-15 flagella per tuft. Flagella inserted into a circular area on the cell surface. Polar membrane in flagellar region.
Cell wall
Gram-negative type
Grdm-negatiVe type
Cellular inclusions Magnetosomes' Sulphur
Present Not present
Present Present in invaginations of cytoplasmic membrane Not presentd
Poly-/3-hydroxybutyrate
Present
Description based on Balkwill et al. (1980) and Gorby et al. (1988). Description based on Moench (1988). Details of crystal size and morphology given in Table 8. Staining with Sudan Black can give false information; extraction of polymers together with studies of ultrastructure of inclusions are required in addition to cytochemical evidence.
'
147
MAGNETOTACTIC BACTERIA
TABLE 8. Cell and crystal morphology Bacteria Morphology
Bacillus coccus Spirillum coccus coccus coccus coccus coccus coccus coccus Bacillus coccus coccus Vibrio coccus ~
Size (pm)
No. and distribution of crystals per chain or aggregate 9, single chain 8, double chain 20, double chain 20, numerous chains 30. random 20, four chains 16, double chain 12, double chain 30, random 5, single chain 12, single chain 10, double chain 9, single chain 14, single chain 30, 3 double chains
1.97 x 0.87 2.10 3.50 x 0.30 1.10 3.30 x 2.50 1.30 2.10 1S O
3.50 1.10 2.41 x 0.73 1.08 2.00 x 1.50
2.35 x 0.64 3x2 ~~
a
Crystal Morphology’
W R C R RWC R W W
RWC C W
R R C B
Size (nm) 100 x 60 100x60 60 x 60 100 x 60 40 90 x 60 130 x 80 100 x 70 40 90 x 90 50 x 40 110x80 90 x 60 60 x 60 98 x 38
~~
R, Rectangular; W, rectangular (waisted); C, cubic; B, bullet.
1988). Lipid analysis of these membranes revealed the presence of (a) neutral lipids and free fatty acids, (b) glycolipids and sulpholipids and (c) phospholipids (phosphatidylserine and phosphatidylethanolamine) in a weight ratio of 1:4:6. Gel electrophoresis of proteins derived from the outer and inner membranes of the magnetospirilla, as well as the soluble cell fraction and those of the purified magnetosome fraction, showed that the last mentioned contained two proteins (molecular masses 15,000 and 33,000 Da) which were not found elsewhere in the cell. Gorby and his co-workers discussed three possible enzymic functions of these two proteins which were unique to the envelopes of purified magnetosomes: (i) the accumulation of supersaturating quantities of iron within vesicles, (ii) the oxidation of iron, or (iii) the reduction and dehydration of the ferrihydrite precursor. The relevance of these possible contributions to magnetite biomineralization is discussed in the following section. In the course of their detailed studies of the fine structure of A . magnetotacticurn, Gorby et al. (1988) found no evidence of an intimate association between the magnetosome and cytoplasmic membranes. In other words, the available evidence does not support the view that magnetite biogenesis occurs in invaginations of the cytoplasmic membrane. Moreover, they noted the occurrence of “empty” vesicles having trilaminate membranes and the dimensional and spatial characteristics of magnetosomes in
148
s. MANN. N. n. c. SPARKS AND R. G . BOARD
magnetospirilla grown in an iron-poor medium. This observation suggests that the production of intracellular vesicles precedes magnetite biomineralization in this organism.
VI. Biomineralization
In this section, we will review the processes of magnetite biomineralization in magnetotactic bacteria. The structural, morphological and crystal growth properties of the magnetite inclusions are described and proposed mechanisms of biomineralization discussed. More extensive details of magnetite biomineralization in unicellular organisms can be found elsewhere (Mann, 1985; Mann and Frankel, 1989). A. STRUCTURE OF MAGNETIC INCLUSIONS
The structure of magnetic particles extracted from a range of bacteriacoccus (Mann ( ~ ul., t 1984a), vibrioid (Sparks et al., 1990) and spirillumtype cells (Mann el al., 1984b)-as well as from algae (Torres de Araujo et al., 1985), has been determined by electron diffraction. The data clearly identify the biogenic mineral as magnetite (Fe30,) but are not intrinsically accurate enough to be able to give confident values of the unit-cell parameter to more than two decimal places. Moreover, because of the relatively large inaccuracy in electron diffraction data, it is difficult to distinguish the small differences between magnetite d spacings and those of the related cation-deficient orthorhombic spinel y-Fe203 (maghemite). Since magnetite crystals can be readily converted to maghemite by oxidation, particularly when the particle size is small, the possibility that many of the bacterial and algal deposits are maghemite or a mixture of magnetite and maghemite must always be considered. Although 57Fe Mossbauer spectroscopy can clearly distinguish between these two minerals, the amount of material required is often much greater than that experimentally available. As a consequence, the only bacterial magnetites studied to date by Mossbauer spectroscopy are from A . magnetotacticum (Frankel et al., 1983) and the marine vibrioid MV-1 (Bazylinski et al., 1988);thedata show conclusively that in these organisms the magnetic biomineral is in the form of stoicheiometric magnetite (Fig. 6). Electron diffraction analysis of magnetosomes gives rise to statistical data, having been derived usually from a population of crystals. Because information on individual particles is critical for elucidation of the mechanisms of mineral growth and nucleation, lattice-imaging techniques, in which the crystal lattice is directly imaged, have been used to determine the
149
MAGNETOTACTIC BACTERIA
I
I
A‘ A*’
I
-10 0
I
-5 0
I 0.0
1
50
1
100
VELOCITY (mm/SEC) FIG. 6. Mossbauer spectrum of frozen cells of Aquaspirillurn magnetotacticurn. Subspectra A , and A, are due to iron(n1)in tetrahedral sites and iron(1rr)and iron(rn) in octahedral sites, respectively, in the Fe,O, lattice, B and C correspond to hydrous ferric oxide and iron@), respectively, in the cells. Reproduced with permission from Frankel rt al.
(1983).
detailed crystallochemical properties of bacterial magnetite. The structural information obtained from high-resolution transmission electron microscopy (HRTEM) arises from the analysis of lattice fringes or, in the case of very thin crystals, of geometric arrays of “dots” which correspond to columns of atoms or tunnels in the projected structure. The degree of definition of the lattice fringes in terms of their contrast, regularity and continuity across the crystal studied is a good indicator of the crystallographic order within the sample. Thus, areas of local disorder within crystalline materials can be identified by modulations in the imaged lattice planes. Similarly, the presence of local order (5-1Onm in extension) within bulk amorphous materials can be identified. Depending on the alignment of individual particles with respect to the electron beam, lattice images of magnetic crystals formed in A. mugnetotacticurn (Mann et al., 1984b), MV-1 (Sparks et al., 1990),coccoid (Mann et al., 1984a; Matsuda rt al., 1983) and wild-type (Mann el al., 1987b) cells showed fringe spacings corresponding to { 1 1 l} (4.8 A), (222) (2.4A), (220) (2.9 A), (200) (4.2 A) and (31 1 j (2.4 A) lattice planes of magnetite. The angles between fringes viewed along the same crystal projection were consistent in all cases with the cubic space group of magnetite. Computational calculations of the projected charge density for stoicheiometric magnetite under conditions of known crystal thickness and defocus have been undertaken (Mann et ul.,
150
s. MA",
N.
n. c. SPARKS A N D R. G . BOARD
1987b) and shown to match the experimental images obtained in the electron microscope. There has been no evidence presented to date that indicates structural irregularities, such as dislocations or stacking faults, in the mature bacterial magnetites. Lattice fringes recorded on individual mature particles are welldefined, continuous and regularly spaced throughout the inclusions (Figs
FIG. 7. HRTEM image of magnetite crystal from Aquaspirillurn rnagneroracticurn. The crystal is oriented along the [OIT] direction and exhibits a characteristic morphology based on an octahedral prism of { 111 } faces truncated by { 100) faces. The lattice fringes correspond to the (711) planes. Bar marker represents 20nm.
MAGNETOTACTIC BACTERIA
151
FIG. 8. HRTEM electron micrograph of a bacterial magnetite crystal from coccoid cells. The crystal is oriented along the [01 I] zone and has a characteristic rectangular shape when viewed in projection. Truncated faces are identified. Lattice fringes correspond to (1 1 l), (111) and (200) planes. Bar marker represents 20nm.
7-10); this indicates that the majority of the biological particles are singledomain crystals with a high degree of structural perfection. Such materials are formed by highly controlled crystal-growth processes. Many magnetotactic bacteria organize their magnetite crystals into chains which often run parallel to the long axis of the cell. The crystals are crystallographically oriented such that the [l 1 I ] axis lies parallel to the direction of the chain (Mann et al., 1984b). This arrangement may have functional value because the [I 113 crystal axis is also the easy axis of magnetization in magnetite. The latter corresponds to the direction along which the electron spins can be more-readily coupled and hence is the optimal direction for the organization of an interacting assembly of magnetic crystals. Although most of the bacterial magnetite crystals are single-domain particles, twinned crystals are occasionally observed (Mann and Frankel, 1989). The majority of particles are single-contact twins with a { 11 1) twin plane centrally located within the two-domain crystals. This plane is also the twin plane of inorganic magnetite. Twinned particles can maintain their magnetic single-domain nature since the [1 1 11 easy axis of magnetization is
152
S. MA”.
N
H C SPARKS A N D R. G
BOARD
FIG. 9. HRTEM image of magnetite crystal from a marine vibrioid bacterium. The crystal is oriented along the [lTO] direction and truncated Faces are identified. Lattice fringes correspond to ( I 1 I), (TI 1) and (200) planes. Bar marker represents 10 nm.
FIG. 10. Individual anisotropic single crystal of bacterial magnetite from wild-type cells. The crystal is oriented along the [IT01 direction. The top edge corresponds to the (111) face and the well-formed side edges are the (1 11) and (TTT)faces, respectively. Lattice fringes correspond to (TTl), (1 11) and (002) planes. Bar marker represents IOnm.
154
s. MA".
N.
n. c. SPARKS A N D R. G. BOARD
symmetry invariant across the twin plane. Thus it seems unlikely that twinning of the particles has some inherent biological function but arises from growth irregularities during the early stages of crystal formation. B. MORPHOLOGY OF MAGNETITE CRYSTALS
Low-magnification electron micrographs of bacterial magnetite indicate a variety of morphological forms which are species specific (Sparks et al., 1986). Viewed in projection, cubic, rectangular, hexagonal and bullet-shaped particles have been observed. The true three-dimensional morphology has been established through the identification of different sets of lattice spacings and their corresponding angular relations within crystals oriented along a range of different crystallographic directions. However, the conclusions refer only to idealized crystal morphologies since many biogenic crystals exhibit local distortions in shape which are difficult to rationalize in terms of crystal symmetry. The simplest morphological form is that exhibited by crystals synthesized in A . magnetoracticum (Fig. 7). The { 11l } planes run parallel to the large top edges and intersect the small truncated edges at 125". This angle is consistent with a crystal imaged along the [011] zone such that the longer edges correspond to { 1 1 l } faces and the short truncated edges to { 100) faces viewed end-on, i.e. parallel to the direction of the electron beam. On the basis of these and other data, an idealized morphology of the mature crystals from A. magnetoracticum has been determined (Mann et al., 1984b). The crystals are cubo-octahedral (Fig. 1 la). This crystal habit is common in inorganic magnetite and reflects the stability of the close-packed { 1 1 l} faces and the strongly bonded cubic {loo} faces. A similar analysis of magnetite crystals formed in coccoid cells has given rise to some interesting morphological results. The rectangular morphology of these crystals, when viewed side-on at low magnification, turns out to be the projection of a truncated hexagonal prism. In one coccus type (Mann et al., 1984a)(Fig. 8), the hexagonal prism (Fig. 1 lc) is capped by only one of the four symmetry-related { 111 } sets comprising the octahedral faces; the other { 11 1 faces are not expressed in the crystal morphology. Furthermore, the crystal is preferentially elongated along one of the four [ I l l ] axes. A similar discrimination is made with regard to faces of index (110). Six of the 12 symmetry-related { 1lo} faces are extensively formed as the elongated sides of the hexagonal prism whereas the remaining six forms are expressed as small truncated faces at the ends. A related hexagonal habit has been determined for magnetite crystals synthesized in the cultured marine vibrioid MV- 1 (Sparks et al., 1990).Viewed side-on, the angle between the top and side faces is 110" and the lattice images
MAGNETOTACTIC BACTERIA
155
b
a
(111)
d
C
rolv
-
FIG. 11. Idealized crystal morphologies of bacterial magnetite. (a) cubo-octahedron (Aquuspirillum magnetotacticurn); (b) and (c) hexagonal prisms (coccoid and vibrioid cells); (d) elongated cubo-octahedron (wild-type cells).
clearly indicate that both these faces are of (111) form (Fig. 9). Crystals imaged perpendicular to the top { 1 11) face show a well-defined hexagonal cross-section with {220} planes running parallel to the six edges. Matsuda et al. (1983) have obtained similar results in an unspecified coccus cell type. The idealized morphology of the crystals is based on an elongated hexagonal prism of { 1 10) faces capped and truncated by { 11I } faces (Fig. 1lb). Again, faces of identical symmetry are selectively exhibited; for example, one of the [1 111axes is elongated and six of the { 1lo} faces are absent. The most extreme example of this apparent biological preference for hexagonal magnetite habits has been found in wild-type bacterial cells synthesizing single-domain bullet-shaped crystals (Mann et al., 1987a,b) (Fig. 10). These crystals exhibit an elongated cubo-octahedral form comprising a hexagonal prism of { 1 11} and { loo} faces, capped by { 1 1 1 } faces and with associated (111) and (100) truncations (Fig. lld). The axis of
156
S M A N N , N H C SPARKS A N D R G BOARD
elongation lies parallel to the [ 1 121 crystallographic axis. Again, there is biological differentiation of symmetry-equivalent faces. In particular, whereas the other cell types synthesize crystals that are centrosymmetric, the bulletshaped crystals deviate significantly from the idealized morphology and are clearly non-centrosymmetric; for example, the capped { 1 1 1 } face is only apparent at one end of the crystal (Fig. 10). Although only a few morphological types have been studied to date at the nanometre level, there are some common relationships which are becoming apparent and which provide important insights into the biological control over the growth of bacterial magnetite. Firstly, there appears to be at least three distinct types of crystal morphology in magnetotactic bacteria: (a) type I, cubo-octahedral (abiogenic); (b) type 11, elongated cubo-octahedral; (c) type 111, elongated hexagonal prisms. Type I and I1 morphologies are closely related even though in the final product they appear to be very different. In fact, type I1 crystals at early stages of growth (<30nm) are isometric cubo-octahedral (Mann et al., 1987b; see below for details). Subsequent growth is primarily constrained in one direction resulting in elongated crystals. Type 111 crystals are fundamentally different to the other two classes. Although a range of truncated faces may be expressed (see above) these crystals appear to develop anisometrically very early on in the mineralization process. Furthermore, they remain centrosymmetric throughout their growth. Secondly, the crystals are capped by faces of the { 1 1 1 } form. The adoption of this morphological arrangement as a common feature, and the organization of the capped { 1 1 1 ) faces end-to-end within chains of crystals, has important implications in the magnetotactic function of the organisms since the { 1 1 1 ) crystallographic direction also corresponds to the easy axis of magnetization in the spinel structure. It also suggests a common nucleation surface. Thirdly, why are the elongated hexagonal habits so common? Although the faces comprising the hexagonal prisms are different between cell types, the adoption of this three-fold axial symmetry suggests a specific relation between crystallographic development and the enclosed biological environment in which it takes place. Fourthly, why is the apparent breaking of crystal symmetry so prevalent in bacterial magnetites? We will consider this in more detail below. Finally, the crystal forms are based on combinations of { 1 1 l}, {loo} and { 110) faces and no higher index faces such as (21 I } and (31 I } are apparent. This suggests that the crystals in different species are formed under similar thermodynamic and kinetic conditions.
MAGNETOTACTIC BACTERIA
157
C. CRYSTAL GROWTH
The investigation of the processes of crystal growth of bacterial magnetite has focused on structural studies of immature crystals since the crystallochemical properties of these crystals reflect the intrinsic mechanisms of crystal synthesis. Crystals from A . mugnetofacticum at early stages of growth have been studied in situ by HRTEM (Mann et al., 1984b). Although smaller crystals often appeared to be located at the ends of the chains, n o linear sequence of crystallographic development along the chain could be determined. Thus, both well-developed and irregular particles were often observed adjacent to each other. Lattice imaging of the immature irregular particles showed the presence of contiguous crystalline and non-crystalline regions within the magnetosomes (Fig. 12). The crystalline zone was always observed to be single domain with well-ordered lattice planes of magnetite. No other crystalline phases were observed. As can be seen in Fig. 12 the lattice fringes often appeared to extend into the amorphous region in a preferential direction which may indicate a preferred nucleation and growth direction. The nature of the amorphous phase has been determined by Mossbauer
FIG. 12. HRTEM image of an immature particle from Aquuspirillum magnetotucticum showing the co-existence of crystalline and non-crystalline phases. The crystalline zone shows well-ordered (222) lattice fringes and is single domain. The fringes extend into the amorphous phase in a preferential direction. The superimposed black dashed line indicates the extent of the low-contrast edge of the particle against the background carbon noise of the grid. Bar marker represents 5 nm.
158
s. MANN. N
ti. c. SPARKS AND R. G.BOARD
spectroscopy investigations of wet packed cells of A. magnetotacticum enriched in "Fe (Frankel el a/., 1983). Spectra at 200,80 and 4.2 K are shown in Figs 6 and 13. The 200K spectrum was analysed as a superposition of spectra corresponding to Fe,O, (spectra Al and A2),a broadened quadrupole doublet with parameters characteristic of iron(1n) (spectrum B), and a weak quadrupole doublet with parameters corresponding to iron@)(spectrum C). Spectrum B was also observed in lyophilized cells and had isomer-shift and quadrupole-splitting parameters similar to iron in ferritin and in the mineral
4,
1
I
I
IOO-
095-
w Z w
c
z 090 I00
095-
090-
085-
- 100
00 50 VELOCITY I MMISEC)
-5 0
I00
FIG. 13. Mossbauer spectra of Aquaspirillum magnetotacticum at (a) 80 and (b)4.2 K. Note the reduction in the intensity of spectrum B at 4.2K. (c) Cells at 4 . 2 K after anaerobic incubation above freezing temperature for 24 hours. Note enhancement of spectrum C at the expense of B. Reproduced with permission from Frankel ef al. (1 983).
MAGNETOTACTIC BACTERIA
159
ferrihydrite (Fe,O, .nH,O), indicative of iron(n1) with six-fold oxygen coordination. The relative intensity of the ferrihydrite to magnetite spectra was variable from sample to sample, depending on growth conditions. At 80 K, the Fe,O, and ferrihydrite spectral parameters and relative intensities were unchanged. Between 80 and 4.2 K, however, the intensity of the ferrihydrite doublet decreased with decreasing temperature, indicating magnetic ordering in this material. A similar temperature dependence for the ferrihydrite component was also obtained in lyophilized cells. The isomer-shift and quadrupole-splitting parameters of the iron(rr) spectrum corresponded to the high-spin state in co-ordination with oxygen or nitrogen. This spectrum was not observed with lyophilized cells, possibly as a result of oxidation during sample preparation. Wet packed cells kept unfrozen under anaerobic conditions contained increased amounts of the iron(n) component and correspondingly less of the iron(rrr) material (Fig. 13c). Thawing and aeration of these frozen cells resulted in increases in iron(rr1) spectral lines and concomitant decreases in iron(rr) spectral lines. This indicated that the iron (11) and iron(rn) components are interchangeable under these conditions. Additional studies (Frankel et al., 1983) with cell fractions showed that the hydrous ferric oxide (ferrihydrite) component was associated with the magnetosomes. Thus, the early particles comprise both crystalline magnetite and amorphous iron(rr1) domains consistent with the HRTEM results (Fig. 12). In contrast, the iron(r1)component does not appear to be associated directly with the crystals but probably with the peptidoglycan layer of the cell wall (Ofer et al., 1984). Mossbauer spectroscopy studies have also been undertaken on a cloned non-magnetotactic strain of A . magnetotacticum (Frankel et al., 1983). The only iron-containing mineral present in these cells was a hydrous ferric oxide of particle size ca. 10nm. Unlike the crystals synthesized by A . magnetotacticum, mature magnetite crystals from coccoid, MV-1 and wild-type cells are anisotropic in shape (see above) and an interesting question relates to the corresponding features of the immature crystals. In MV-1 (Sparks et al., 1990)and coccoid cells (Mann et al., 1984a),the shapes of the early crystals ( < 15 nm) were comparable with their mature counterparts; in contrast, in wild-type cells (Mann et al., 1987a,b), crystals below 20 nm in dimensions were isotropic cubo-octahedral compared to the elongated bullet shape of the corresponding mature particles. As with A . magnetotacticurn, amorphous hydrous iron(rr1) phases have been observed in MV-1 by Mossbauer spectroscopy (Bazylinski et al., 1988)and by HRTEM in wild-type (Mann et al., 1987b) and coccoid cells (Mann et al., 1984a). However, direct evidence for their involvement at the nucleation or early growth stage of magnetite development is lacking. Crystals at
160
S. MANN. N . H. C. SPARKS A N D R. G . BOARD
intermediate stages of growth in coccoid cells show characteristic rounded edges and irregular, structurally disordered surfaces. These observations suggest that the growth of the crystals occurs through surface-mediated reactions involving the phase transformation of ferrihydrite to magnetite. Similar evidence for the involvement of surface-adsorbed iron(n1) phases in magnetite growth in wild-type cells has been presented by Mann et al. (1987b). Amorphous regions and structural irregularities were imaged only in the tapered end of bullet-shaped crystals indicating that this face represents the growth front in the anisotropic development of these magnetosomes. D. MECHANISMS OF BlOMlNERALlZATlON
1. Crystal Nucleation
On the basis of the HRTEM, Mossbauer spectroscopy and biochemical results, a sequence of events leading to bacterial magnetite synthesis can be proposed (Fig. 14). These involve: (i) uptake of iron(irr) from the environment via a reductive step in membrane transport (Paoletti and Blakemore, 1986);(ii) transport of iron@) (or iron(m), as ferritin?) to and across the magnetosome membrane; (iii) precipitation of hydrated ferric oxide within the magnetosome vesicles; and (iv) phase transformation of the amorphous iron(m) phase to magnetite both at the nucleation stage and during surface-controlled growth. In this sequence the unique stage in biomineralization appears to be the controlled transformation of the hydrous ferric oxide to magnetite, as the initial stages of the sequence are likely to involve processes similar to the formation and transport of ferrihydrite cores in the iron storage protein, ferritin.
Fe3+ - chelate
-
Fe2+-ni
Fe203.nH20
Magnetosome membrane
Cytoplasmic membrane FIG. 14. Proposed scheme for bacterial magnetite formation.
MAGNETOTACTIC BACTERIA
161
Fundamental to the control of magnetite biomineralization is the organization and ultrastructure of the surrounding magnetosome membrane. This membrane, which has an overall composition similar to other cell membranes, contains two proteins (Gorby et al., 1988) that may be specific to the nucleation and growth of magnetite. The formation of the enclosed vesicle appears to occur prior to mineralization. In this respect, the organic compartment provides a spatial constraint for growth and the potential for chemical specificity via selective ion transport. Furthermore, the presence of a charged organic surface may be an important factor in determining the kinetics and structural characteristics of the nucleation event. Thin sections of cells cultured under iron limitation show the presence of immature iron-containing particles apposed to the inner surface of the trilaminate magnetosome membrane (Gorby et al., 1988).Both the nucleation of an amorphous iron(rr1)precursor and, subsequently, crystalline magnetite will be energetically favoured on the surface of the membrane since bonding interactions between ions in the embryonic clusters and charged residues of the membrane will lower the surface energy of the new interface. In this respect, the amorphous phase will be kinetically favoured over magnetite since extensive dehydration is not required for cluster formation in the incipient nuclei. The single-crystal nature of the majority of bacterial magnetites implies that nucleation of magnetite from the iron(m) precursor phase occurs at one primary nucleation site which grows at the expense of other potential sites. For example, if crystal nuclei do initiate at other sites, they must rapidly redissolve and reprecipitate at the primary site. It is therefore tempting to suggest that the surrounding magnetosome membrane may play a crucial role in the generation of a local environment for site-directed nucleation. One possibility is that protein molecules, active in nucleation, are spatially organized at a unique site in the membrane, and all other potential sites are deactivated by inhibitor molecules located within the vesicle. Furthermore, because the crystals are preferentially oriented with the ( 1 1 1 ) face perpendicular to the chain axis, it seems probable that the membrane exerts a degree of crystallographic control on the magnetite face that is nucleated adjacent to the organic surface. (An alternative hypothesis would be that the crystals are free to rotate and thereby aligned by magnetic forces generated within the existing chain.) It seems most probable that the { 11 1) face is involved as a nucleation surface in the synthesis of bullet-shaped particles in wild-type cells (Mann er af., 1987b).The immature crystals are isotropic with well-defined { 11 l } faces, whereas the mature crystals are elongated prisms capped only a t one end by a well-formed { 11 1 ) face. It is difficult to envisage a crystal growth process which involves the development of each crystal from a central origin such that
162
S. MANN, N. H. C. SPARKS A N D R. G . BOARD
the particle grows in one direction with a well-formed { 11 1) face and at the same time in the opposite direction with an ill-defined tapered face of the same index. More probable is a process involving nucleation of a (111) face adjacent to the organic membrane followed by unidirectional growth away from this surface. In other cell-types, however, it may not be the (111) face that is preferentially selected in nucleation. For example, in coccoid cells, it is the { 1 10) faces which are well-developed and stabilized, and which may bear molecular correspondence with the adjacent organic membrane. In general, since the preferred orientation of the magnetite nucleus will be dependent on the energetics of interaction between the crystal faces and the organic substrate, a subtle change in the composition and structure of the surrounding membrane could, in principle, result in different selectivity of the nucleation face in different cell types.
2. Chemical Control Compartmentalization of biological space through the formation of the magnetosome vesicles enables the chemical processes of magnetite formation to be optimized and regulated by biochemical pathways. The membrane acts as a potential gate for compositional, pH and redox differentiation between the vesicle and cellular environments. In particular, the supersaturation level within the vesicle must be finely controlled since the crystals exhibit a high degree of structural perfection. A simple change in anion (chloride, sulphate, phosphate) concentration is known to have a marked influence on magnetite precipitation in uitro (Couling and Mann, 1985; Mann et al., 1989; Sidhu et al., 1978; Tamaura et al., 1981) which suggests that there must be precise biological control over extraneous ions within the envelope surrounding the magnetite crystals. The phase transformation of amorphous hydrated ferric oxide to magnetite can occur at neutral pH provided the redox potential of the reaction environment is of the order of - 100mV (Garrels and Christ, 1965). It is important to stress that the redox potential will be extremely sensitive to the pH value such that small changes in the pH value could have marked influence on the phase transformation processes. For example, a slight lowering of the pH value will favour more positive values of the redox potential which ultimately favour transformation to less-hydrated, more-crystalline ferric oxides such as goethite (a-FeOOH). The rate of transformation of hydrated ferric oxide to magnetite is likely to be slow as dehydration, dissolution, reprecipitation and partial reduction of iron(1Ir) are probably involved. Investigations of the transformation of ferric oxides to magnetite under aqueous conditions in inorganic systems have
163
MAGNETOTACTIC BACTERIA
Fe(Il)-
[Fe#k$l~O),(OH),]n+
-0 Fe304
+
H+
+
H20
FIG. 15. Two-step reaction sequence for magnetite synthesis from the reaction of aqueous iron@) with ferrihydrite.
shown that the critical step is the involvement of aqueous iron(rr) ions at the ferric oxide surface (Tamaura et al., 1981, 1983). A two-step process is postulated (Fig. 15). The rate of magnetite formation appears to be essentially first order with respect to the concentration of the surface intermediate formed in step 1 (Tamaura et al., 1983). Although the composition of the intermediate released into solution is unknown, the formation of Fe,O, in the second step involves the release of one further proton. The resultant lowering in the reaction pH value and subsequent increase in redox potential implies that for the phase transformation to magnetite to proceed to any significant extent within the magnetosome vesicle, there must be precise regulation of the pH value and hence redox potential within the localized mineralization zone. On the basis of these in vitro observations, it seems probable that the immature bacterial crystals develop through phase transformation processes involving a solution interface between the crystalline and amorphous phases. Initially, the amorphous phase is the kinetically favoured product resulting from iron(I1) oxidation; continual influx of iron(@ across the magnetosome membrane will result either in additional ferric oxide formation or reaction of iron@) with the pre-existing, iron(rrr)phase to give magnetite within the vesicle. The second pathway becomes competitive with a continual increase in iron(rr) influx.
3. Crystal Growth and Morphology The above discussion suggests that the growth of bacterial magnetite occurs from the structural modification of amorphous precursor phases sited at the
164
s. M A N N , N. ti. c. SPARKS A N D R.G . BOARD
crystal surface rather than from the direct addition of ions from aqueous solution. These surface reactions are kinetically constrained and result in slow crystal growth and highly ordered, morphologically specific crystals. Figure 11 shows idealized species-specificcrystal morphologies for bacterial magnetite. As the morphology of a crystal arises from the interaction between its structure and the local environment, the ultimate forms of these crystals are determined by precise biological control of crystal growth. Thus, although the biological- organization and function of the mineral inclusions of diverse magnetotactic bacteria could have a common evolutionary origin, the crystallochemical processes which are biologically mediated appear to be species specific. Inorganic magnetite is often found in octahedral, rhombododecahedral and cubic habits, which can be rationalized from the spinel (cubic)crystal structure and the relatively low surface energy of the low-index { 11l}, { 1lo} and { 100) crystal planes. However, crystal habits are very sensitive to changes in the environmental conditions of growth such that the level of supersaturation, the direction of supply of ions, the concentration of extraneous ions and molecules, pH value, redox potential and temperature can all modify the crystal shape. Thus the selective chemical control of the magnetosome environment and the geometric constraints imposed by the organization of the surrounding trilaminate membrane may be responsible for the unique crystal habits exhibited by magnetite formed in coccoid, vibrioid and wildtype cells. One of the most surprising aspects concerning the shape of bacterial magnetite crystals is the predominance of anisotropic forms compared to the isotropic habits of inorganic origin. Thus the elongated morphology of bacterial magnetites must reflect some fundamental feature of the mechanism of biomineralization. The concept of an imposed spatial constraint is applicable to the growth of bullet-shaped magnetites in wild-type cells (Figs 10 and 1 Id). Development of the crystals takes place in two distinct stages (Mann et al., 1987b). The first stage involves the development of isotropic magnetite crystals, of cubooctahedral morphology, which grow to a size of 20nm. There is no spatial constraint imposed on crystal growth at this stage since the crystal grows out from the membrane wall equally in all directions. The second stage involves anisotropic growth along the [ 1 123 direction, resulting in three of the { I 1 1 ) and { 1003 planes becoming elongated. Dimensional analysis indicates that this stage is associated with a spatial constraint in the development of the width of the crystal and, in some crystals, kinking of the particles. One can envisage that the crystals grow either within preformed elongated vesicular sacs or in vesicles that are continuously being extended along a preferential direction (perhaps parallel to the cell membrane) during crystal growth. Thus
MAGNETOTACTIC BACTERIA
165
the cytoskeletal organization of the vesicular system may be of primary importance in morphological specificity. Provided there is a continual flux of iron into the vesicles, the crystals will grow to fill the space made available to them. This results in a dimensional constraint being placed on crystal width, whereas particle length is less restricted. Kinking and curvature in the crystal habit would then be the consequence of corresponding deviations in the shape of the organic compartment. However, such a passive role for the membrane would not explain the preferential crystallographic alignment of the crystals within an elongated biological compartment. The crystallographic orientation of the crystals is established at the nucleation stage through specific formation of the { 1 111 face on the immobile wall of the expanding vesicle. In this process the orientation set by the nucleation interactions must be coupled to the axis of unidirectional growth and vesicle elongation. A different mechanism of anisotropic growth appears to be present in the coccoid and MV-1 crystals. The crystal habit of these particles (Fig. 1 1band c) appears to be established not via spatial restriction of a growing isotropic crystal (as above), but as an intrinsic property of the initial crystals nucleated within the magnetosome vesicles. Although specific molecules present within this environment could give rise to novel crystal habits, one would predict that these would remain isotropic since the activity of growth mediators is equivalent on symmetry-related surfaces. One possibility is that the spatial organization of ion-transport centres on the magnetosome membrane generates different growth rates of symmetry-equivalent directions because the flux of ions to the crystal surfaces is highly directional. Thus the hexagonal prism morphology could be related to a three-fold symmetry of transport centres on the membrane and elongation could arise by a greater flux rate in the axial direction. Moreover, vectorial crystal growth would be enhanced if the membrane and crystal surfaces were in direct contact throughout crystal growth such that lateral ion diffusion via solution was minimized.
VII. Magnetotaxis Life on earth has evolved under the influence of the earth’s magnetic field and, perhaps not surprisingly, some organisms are thought to have adapted such that they can detect and exploit this phenomenon. To take two diverse species, both the pigeon and the yellow fin tuna are thought to navigate using geomagnetic cues (Presti, 1985; Walker et al., 1985).However the complexity of such organisms and the variety of navigational cues that they might use at any one time (e.g. light intensities, stars, wind direction, tidal stream direction, etc.) makes it almost impossible to say with any certainty how much reliance is put on magnetotaxis per se. Consequently, the discovery of a very simple
166
S . MANN. N. H. C. SPARKS A N D R. G . BOARD
unicellular organism which demonstrated an unequivocal response to a magnetic field was a major step forward in the understanding of magnetotaxis. It is the intracellular alignment of magnetite crystals which makes magnetotactic bacteria susceptible to magnetic fields. The crystals, which are most often arranged in chains-although aggregates of crystals are a feature in some magnetotactic bacteria (Fig. 16), fall into the permanent singlemagnetic-domain size range (35-120 nm; Butler and Banerjee, 1975). Thus each crystal acts as a dipole bar magnet. The crystals are aligned within the chains such that the magnetic polarity is consistent. Hence the overall magnetic moment of the chain is the sum of the moment of each crystal within the chain. For example A. magnetotucticum, which typically has 22 50nm particles, has an overall magnetic moment of Em= 1.3 x emu. The integrity of the chain is maintained, and clumping prevented, by the phospholipid vacuole which encapsulates each crystal (T. Matsunaga, personal communication). The nature of the magnetic interaction between the geomagnetic field and the magnetite crystals is such that the magnetotactic effect is purely passive, This has been reviewed in detail by Blakemore and Frankel (1981). The bacterium is oriented along the magnetic field lines by the torque exerted by the field on the magnetic moment; the orientational energy being expressed (Bean, 1989) as; Em= uB sin 8,
where u is the bacterial magnetic moment, B is the magnetic field and 8 is the couple between u and B. A. CELL MOTILITY
Although the cells are aligned in the geomagnetic field they are not propelled by it. This can be readily demonstrated using live and dead bacteria and is a feature of the relatively weak geomagnetic fields (0.24 gauss near Rio de Janeiro, Brazil, to cu. 0.65 gauss at the poles) and also the stronger induction fields such as those exerted by bar magnets (100 gauss). Once oriented, the organisms propel themselves along the magnetic force lines. All the organisms studied to date achieve this by the use of flagella. Recently, however, Wolfe et al. (1987) has reported gliding and twitching magnetotactic bacteria. Using time-lapse photography and still-frame video techniques, Lloyd (1989) demonstrated that magnetococci, magnetospirilla and magnetovibrios adopt a helical “flight path” when under the influence of a magnetic field (Fig. 17). Lloyd postulated that magnetococci exhibit this type of flight path due to a combination of interrelated factors. These include the angle of the magnetic chain to the flagella, the rotation of the flagella and the irregular surface of the
MAGNETOTACTIC BACTERIA
167
(b) FIG. 16. (a) Electron micrograph showing the characteristic chain-like arrangement of crystals of bacterial magnetite seen in situ (bar marker represents 200nm). (b) Aggregated crystals (inset) of bacterial magnetite seen in situ (bar marker represents 1 pm (inset, I00 nm)).
168
S. MA”.
N . H. C. SPARKS A N D R. G . BOARD
FIG. 17. Time-lapse photomicrograph showing the helical “flight paths” of magneto bacteria.
FIG. 18. Banding patterns resulting from the imposition of a magnetic field (bar magnet) on a water drop containing large numbers of magnetotactic bacteria.
MAGNETOTACTIC BACTERIA
169
organism that may accentuate the rotation. Lloyd contends that a helical flight path confers certain ecological advantages (discussed below) on the organism. At very high cell densities, in the presence of an imposed magnetic field, intracellular magnetic attractions give rise to banding patterns (Fig. 18). Carlile et al. ( 1987)suggested that dense populations of magnetotactic bacteria may be considered as ferromagnetic fluids. The mechanism proposed by Guell et al. (1 988) to account for these stable bands invokes hydrodynamic coupling forces between proximate cells. This interactive force results, the authors contend, in cells swimming side by side, the interactive force dominating competing Brownian and cell-cell magnetic forces. Spormann (1987) considered the role of chemotactic and tactile responses, and of fluid dynamics, in forming and maintaining banding patterns. It should be appreciated, however, that wave or band formation is unlikely to occur in viva There are two reasons for this; firstly, the geomagnetic field (approx. 0.5 gauss) is below the required value of0.8 gauss (Spormann, 1987)and, secondly, native cell densities are insufficient. B. ECOLOGICAL SIGNIFICANCE
The majority of magnetotactic bacteria studied to date have been recovered from the water-sediment interface-a micro-aerophilic environment thought to favour these organisms. It has been postulated (Spormann and Wolfe, 1984) that the magnetotactic response provides bacteria with the means of moving along an oxygen gradient, allowing them to swiftly reach a region (normally at the sediment-water interface) of optimal PO,. Having attained the correct oxygen tension the organism’s magnetotactic response is overridden by a finer chemotactic response. This allows the organism to move around within the PO,-defined zone without recourse to the cruder magnetotactic response. Although defined as magnetotactic, it is important to remember that aerotaxis (in A. magnetotacticurn) and a tactile response-where a vibrioid organism on coming into contact with a sediment particle briefly reverses its direction before moving forward again-were noted by Spormann and Wolfe (1 984). This latter response would aid penetration of, and movement within, the loosely packed sediment-water interface; however, the extent to which these responses are interrelated is not known. It is notable that, although considered to be micro-aerophilic, the authors have found that all organisms examined so far are motile for periods in excess of one hour in a drop of water placed on a microscope slide. Thus although protracted exposure to high oxygen tensions may well be toxic to magnetotactic bacteria, these organisms can tolerate short periods of exposure to such conditions. The ecological advantages of magnetotaxis rely on the vectoring of the
170
S. MA”.
N . H. C. SPARKS A N D R. G.BOARD
geomagnetic lines of force. These vary depending on where in the world they are measured. For example, the geomagnetic field points straight down at the North Pole, straight up at the South Pole and is horizontal at the equator. Between the equator and the poles the lines of force emerge from the earth’s surface at increasing angles, the so-called angle of dip. Magnetotactic bacteria isolated in the northern hemisphere are oriented towards the North Pole whereas in the southern hemisphere their polarity is reversed in favour of the South Pole. Because the geomagnetic field lines energe from the earth at an angle, the organisms are oriented down towards the sediment (Fig. 19).When compared with the more common “run-tumble’’ motility exhibited by organisms such as E. coli, magnetotaxis is energetically a very efficient and effective response with a migration speed of greater than 90% of the overall forward speed. Ecologically, this rapid response could be of major benefit. We suggest here another function of magnetotaxis, one which could hold particular significance for magnetococci (the dominant organism in most enrichment cultures). These organisms are frequently recovered from environments which are subject to relatively violent perturbation. For example, marine species of magnetotactic bacteria residing in saltmarsh pans and artificial ponds and lakes such as those discussed by Sparks et al. (1986, 1989) are subjected to periodic displacement from their niche at the sediment-water interface due to I . MEMBRANE BWNO MAQNETITE CRYSTALS ( M A G M T O S M E S )
PASSIVELY A L I W 1%
CELL ALMJO GEOMAGNETIC
FIELD L I N E S .
2. FLAGELL4 PROPEL THE ORGANISM 00W*rARDS.
4
0
- 7 -
/
7-7-7-7-
-~-7- -~-~ ~
-~-,-
3. AEROTACTIC AESWNSE LOCATES
FIG. 19. Schematic diagram showing the effect of the geomagnetic field on magnetotactic bacteria.
MAGNETOTACTIC BACTERIA
171
tidal flooding. We propose that the magnetotactic response allows an organism to rapidly regain its position (whether this is a function of PO,, nutrition or other factors) within the sediment following such disturbance. Lloyd (1989) postulated that the helical flight path adopted by magnetotactic organisms confers an advantage in this situation, where the organism has to contend with a rising fluid flux caused by water being displaced by settling particles. It is notable that the upthrust is greater in systems with a high organic loading (Verstraete and Vaerenbergh, 1986). Another stress imposed upon marine magnetotatic bacteria is the periodic drying out of the watersediment interface such as occurs around the low-water level during spring tides. This necessitates the organisms moving deeper into the sediment in order to maintain the correct oxygen tension and nutritional status. These phenomena have been noted by N. H. C. Sparks and J. Lloyd (unpublished observations). Similar phenomena occur in freshwater streams which are subject to frequent changes of water level (i.e. streams draining moorland, hillsides, etc.). N. H. C . Sparks and J. Lloyd (unpublished observations) sampled two such streams (tributaries of the East Dart River, UK) at various states of water flow and depth, and found this to be related to the depth of the organisms in the sediment (“pea” gravel). The magnetite crystals synthesized by these organisms are species specific and consequently under genetic control. The polarity of the magnetosome
FIG. 20. Chain of bacterial magnetite,viewed in situ, showing the developmentof new crystals (arrowed)at the ends of the chain. Bar marker represents 100 nm.
172
s. MANN, N. n. c. SPARKS A N D R. G .BOARD
chain, however, cannot be encoded. This information can only be passed on by transferring part of the magnetosome chain to the daughter cell on cell division. Once this has occurred new crystals will be synthesized a t the ends of the chains (Fig. 20), the chain eventually gaining its full complement of crystals. Should part of the chain fail to be passed across during cell division then there is an equal probability of either north- or south-seeking cells being produced. Although under normal circumstances the small percentage of the population with the reverse polarity would swim up out of the water-sediment interface into a toxic zone of high pot, the heterogeneity within the population ensures the survival of the species should the magnetic field reverse. This flexibility is an important feature of the magnetotactic response as the values of the geomagnetic elements are not constant with time but drift over the years, fluctuate with daily, monthly and annual periodicities and are occasionally perturbed by magnetic storms (Skiles, 1985). The interaction between genetic inheritance and non-genetic information transmission across generations, as described above, has been studied by Lumsden (1984). Using a series of models the author investigated the mode of magnetic information (i.e. North- or South-Pole seeking) transfer, concluding that although non-genetic, the extent of transfer is such that it resembles genetic determinism in its effects. Furthermore, Lumsden contends that this mode of non-genetic inheritance “may be the result of selection in a spatially inhomogeneous, temporally varying environment”. C. MAGNETOTACTIC OR HOMEOSTATIC MECHANISM?
At this point it is pertinent to consider that some, if not all, so-called magnetotactic bacteria may be simply “magnetic bacteria”, i.e. the magnetic crystals are incorporated into the cell to serve a function other than as a navigational aid. Support for this viewpoint can be gained from the several species ofmagnetotactic bacteria that have been examined where the magnetic crystals are not aligned in chains but clumped (Fig. 16b) The random arrangement of these crystals could be expected to lead to a near-neutral magnetic moment for the cell. Furthermore, explanations offered to explain the ecological advantages that magnetotaxis might confer on aquatic bacteria remain highly speculative, particularly when one considers organisms inhabiting niches at the equator (where the geomagnetic field runs parallel to the sediment-water interface). Is it feasible, on the other hand, to consider the crystals as serving a purely homeostatic function? For example, does the relatively high concentration of iron within the cells afford protection, as suggested by Blakemore ( I 982), against hydrogen peroxide-which is known to be highly toxic for A . rnugnetotucticum? Alternatively, can iron be mobilized out of the magnetosomes for homeostatic purposes? If so, this would be much
MAG N ETOTACTIC BACTE R 1A
173
more energetically demanding than providing soluble iron from the iron storage protein ferritin, which has a mineral core of hydrated ferric oxide. VIII. Palaeomagnetism The remanent magnetism found in deep-sea sediments provides a detailed and accurate record of the earth’s geohistory, marking geomagnetic reversals and secular variations. Furthermore, according to Blakemore et al. (1979), the critical requirements for low PO, levels exhibited by A . magnetotacticum may provide clues about geochemical changes in the earth’s atmosphere. Although there are several magnetic minerals, the most commonly observed and magnetically stable phase in these sediments is magnetite. It used to be assumed that the magnetites in such sediments were of lithogenic origin (i.e. volcanic ashfalls, micrometeorites, continental detritus, etc.) or of authigenic origin (formed in situ; Mahler and Taylor, 1988), Recently, however, it has been recognized that a significant proportion, if not the majority, of remanent magnetism in deep-sea sediments results from magnetite of biogenic origin and in particular the remains of magnetotactic bacteria. Indeed, magnetosomes have been found in sediments dating back 50 million years (Petersen et al., 1986). The intracellular magnetites formed by these bacteria are single crystals of high perfection, notable for their species-specific morphology and narrow, single-domain size range. It is the high natural remanence associated with single-domain magnetite that enables bacterial magnetite to dominate the magnetization of sediments, even at relatively low concentrations (for an extensive discussion of remanence and the magnetic properties of magnetotactic bacteria, see Moskowitz et al., 1988). By encapsulating and so controlling the mineralization process, magnetotactic bacteria are able to synthesize anisotropic crystals of unusual shape. Crystals such as these are specific to biogenic systems and, consequently, this allows a ready, quantitative assessment of their distribution. The magnetites produced by lithogenic or authigenic processes are typically of a cubo-octahedral or irregular morphology (Mahler and Taylor, 1988). They lack the single-domain size specificity of the bacterial magnetites ranging from super-paramagnetic through to multidomain particles. A recent study (Lovley et al., 1987) identified another potential source of super-paramagnetic and multidomain magnetite, uiz. biologically induced magnetite from the anaerobic iron-reducing bacterium GS-15 (Fig. 21). This organism forms large amounts of ultrafine-grained magnetite as a consequence of coupling the oxidation of organic matter to the reduction of iron(m) located outside the cell. During growth in a medium containing
174
s. MANN. N. ti. c. SPARKS A N D R. G . BOARD
FIG. 21. Extracellular crystals of bacterial magnetite formed by the organism GS-15 (Lovley el al., 1987). Bar marker represents 20nm.
acetate as the sole electron donor, and about 0.2mol iron(rrr) (as amorphous ferric oxide) per litre, GS-I 5 converted the non-magnetic brown amorphous ferric oxide to black solid material that was strongly attracted to a magnet. Because these crystals are formed extracellularly, the crystallization process cannot be controlled and, consequently, the particles are poorly crystalline, with ill-defined morphologies and a wide particle-size range. In fact, the crystals formed by this process closely resemble those formed lithogenically and authigenically. Therefore, unless the crystals are found associated with the bacteria it is impossible to determine whether such crystals in the sediments are of biogenic or pedogenic origin. Lovley et al. (1987)contend, however, that bacteria similar to GS-15 could have played a major role in the formation of magnetic deposits as far back as the Precambrian. Indeed, in a recent study (N. H. C. Sparks, unpublished observations) the anisotropic magnetite crystals present in Quaternary and Tertiary sediments (Fig. 22) were found to be crystallochemically identical to those synthesized by extant species of magnetotactic bacteria. Similar findings have been reported by Vali et al. (1987) and Vali and Kirschvink (1989). Apart from the palaeomagnetic implications it is evident that the ecology and physiology of these bacteria has remained virtually unchanged for millions of years. Although magnetotactic bacteria have been described as ubiquitous (see Section I) not all sediments show evidence of biogenic magnetite. It is notable
MAGNETOTACTIC BACTERIA
175
FIG. 22. Bacterial magnetite recovered from Quaternary sediments. A typical crystal is shown in the inset. Bar marker represents 50nm (inset, 20nm).
176
S.MA”.
N. H. C. SPARKS A N D R. G. BOARD
that Stolz et a&.(1986) were only able to recover single-domain bacterial magnetite from the top metre of various Californian sediments. Vali et a/. (1987)suggested four reasons to account for the lack of bacterial magnetite in sediments: unfavourable conditions for bacterial growth and multiplication; environmental conditions may be incompatible with magnetite formation; magnetite may be masked by other minerals, and the magnetosomes might be subject to corrosion or partial or total dissolution. As evidence of the latter, the authors cite the significantly smaller dimensions (10%) of the fossil magnetosomes compared with their extant counterparts. Vali and his colleagues suggested that this may be due to reducing conditions found in the sediment. Besides dissolution other changes may also occur with time. For example, some magnetosomes recovered from marine environments have been completely maghemitized (Fe,O, oxidized to y-Fe,O,) although this was not a feature of magnetosomes recovered from freshwater sediments (Vali et a/., 1987). Stolz et al. (1986) comment that the eventual fate of biogenic magnetite depends on the conditions pertaining in the sediment and that the loss of the single-domain bacterial magnetite with depth in open ocean basins “may limit the extent of the biogenic magnetite contribution to rock magnetism to marine sediments with low organic content such as calcareous oozes and limestones”.
IX. Biotechnological applications As was noted in the Introduction, many commercial uses of the minute (ca. 50 nm) permanent magnets of magnetotactic bacteria have been
contemplated. The use of such magnets in the manufacture of magnetic tape and magnetic printing inks are two obvious applications. As far as we are aware, the largest culture to date (10001) produced 5 g of magnetite (T. Matsunaga, personal communication). As yet, however, no system has attained commercial scale. The failure to devise methods for the bulk production of magnetotactic bacteria in axenic culture is a major impediment to their commercial exploitation. A novel use of magnetic particles from magnetotatic bacteria, the immobilization of bioactive substances, was discussed by Matsunaga and Kamiya (1987). As was noted earlier (p. 136), these workers used a samariancobalt magnet to harvest the organisms from pond sludge which had been enriched with succinate and nitrate. The harvested cells were washed with distilled water and digested in 5 M sodium hydroxide for 12 hours, cu. 20 ,ug of magnetic particles were isolated from 1 mg dry weight of bacteria. After further washing with distilled water the magnetic particles were collected using a samarium-cobalt magnet and suspended for 10 minutes in 1 ml of y-
MAGNETOIACTIC BACTERIA
177
aminopropyltriethoxysilane at room temperature. The coated magnets were washed with distilled water and treated for 1 h with 2.5%(v/v) gluteraldehyde in 1 ml of 0.1 M phosphate buffer (pH 7.0).The particles were then suspended in 1 mg ml- ' of enzyme (either uricase or glucose oxidase) for 12 hours at 4°C. After washing in distilled water, the coated magnetic particles were stored in 0.1 M phosphate buffer at 4°C. The amounts of glucose oxidase immobilized (200 pg mg- ' on magnetic particles harvested from bacteria) was far greater than that on synthetic magnetite (25 pg mg- ') or zinc ferrite (1.8 pg mg- '). With uricase the amounts were 186, 7.6 and 5.9 pgmg-', respectively. The activity of the immobilized enzymes were: glucose oxidase, 59 U mg- ' for bacterial magnetite particles, 1.8 U mg-' for synthetic magnetite and 1.5 Umg-' for zinc ferrite. The figures for uricase were 5.9 x lo-' Umg-', 2 x lo-' Umg-' and 1.5 x lo-' U mg-'. There was no detectable loss of activity of either glucose oxidase or uricase when enzymes immobilized on bacterial magnetite were used on five consecutive occasions, a magnet being used to separate the enzymes from the reaction mixtures. Enzymes on synthetic magnetite or zinc ferrite lost 80% of their initial activity with five consecutive uses. The authors attributed the superior performance of the enzyme-coated bacterial particles to their small size (50 x l00nm) cf. that of synthetic magnetite and zinc ferrite (50 x 150 nm), their uniform shape and freedom from clumping. The two other magnetic materials formed aggregates of 0.5-5pm in size. Matsunaga and Kamiya (1987) speculated that the magnetic particles from bacteria may well be suitable as carriers in the sitedirected delivery of drugs, a topic discussed by Widder et d. ( 1 978). In US patent 4677067, Schwartz and Blakemore (1987) considered the application of "magnetotactic bacteria in clinical assay, immunoassay, and cell separation procedures and the like". Whole cells of A . magnetotacticurn, or magnetosomes thereof, have foreign molecules, such as antigens or chemically reactive groups, attached to their outer membranes. The ability of the latter to form stable attachments to foreign molecules may be enhanced with bifunctional cross-linking reagents.
X. Addendum A recent investigation has reported the presence of organized intracellular crystals of the magnetic iron sulphide mineral greigite (Fe,S,) in a multicellular magnetotactic bacterium (Fig. 23) common in brackish, sulphide-rich water and sediment (Mann rt al., 1990; Farina et al., 1990).This is the first report of a bacterial magnetic iron sulphide used in magnetotaxis. The greigite crystals are discrete, aligned in chains, of uniform particle size and associated with crystals of the non-magnetic mineral iron pyrite (FeS,). These
178
s. MANN, N . n.c. SPARKS A N D R. G . BOARD
FIG, 23. Transmission electron micrograph showing a multicellular, magnetotactic bacterium containing discrete, organized, intracellular iron sulphide particles. The motile, spherical (3-8 pm diameter) multicellular aggregate consists of about 7-20 individual prokaryotic cells. Each cell is approximately ovoid and has numerous flagella on one side. Bar marker represents 1 pm.
features clearly suggest that greigite formation, like magnetite deposition, is genetically controlled. Structurally, Fe,S, and Fe,O, are isomorphous, with both materials adopting the face-centred-cubic spinel structure. Whether this structural similarity has relevance to the cellular mechanisms of their synthesis is unclear. In terms of their magnetic properties, the saturation magnetization of greigite is approximately one-third that of magnetite (Spender et al., 1972). The permanent magnetic single-domain size range for greigite has not been determined, but it is probably similar to magnetite because the magnetic ordering temperatures and magnetic anisotropy constants of the two minerals are similar. Thus the 75nm bacterial greigite particles are likely to be permanent magnetic single domains which when aligned in chains give rise to the magnetotactic response of the intact organism.
MAGNETOTACTIC BACTERIA
179
Another recent investigation has reported the occurrence of living magnetic bacteria, similar to those found in salt and fresh-water sediments, in the A horizon of a well-developed soil profile in a typical meadow environment in Southern Bavaria (Fassbinder et al., 1990).,These workers used an optical microscope equipped with a rotating magnetic field to detect and enumerate such organisms in field samples. They suggested that “magnetic bacteria and their magnetofossils can contribute to the magnetic properties of soil”.
XI. Acknowledgements NHCS was supported by SERC Advanced Fellowship No. 85616. Electronoptic facilities were provided partly by SERC. Technical assistance with microbiological techniques was providtd by Mr P. Jewell. REFERENCES
Balkwill, D. L., Maratea, D. and Blakemore, R. P. (1980). Journal of Bacteriology 141, 1399. Bazylinski, D. A. and Blakemore, R. P. (1983). Appliedand Environmental Microbiology & , I 1 18. Bazylinski, D. A., Frankel, R. B. and Jannasch, H. W. (1988). Nature, London 334, 518. Bean, C. (1989). Biophysical Journal 54,258a. Berson, A. E., Hudson, D. V. and Waleh, N. S. (1989). Archives of Microbiology 152, 567. Blakemore, R. P. (1975). Science, New York 190, 377. Blakemore, R. P. (1982). Annual Reoiew qf Microbiology 36, 217. Blakemore, R. P. and Frankel, R. F. (1981). Scientijc American Dec., 42. Blakemore, R. P., Maratea, D. and Wolfe, R. S. (1979). Journal of Bacteriology 140, 720. Blakemore, R. P., Short, K. A., Bazylinski, D. A., Rosenblatt, C. and Frankel, R. B. (1985). Geomicrobiology Journal 4, 53. Blakemore, R. P., Blakemore, N. A., Bazylinski, D. A. and Moench, T. T. (1989). In “Bergey’s Manual of Systematic Bacteriology”(J. T. Staley, M. P. Bryant. W. Pfennig and J. C. Holt, eds), vol. 3, pp. 1882-1889. Williams and Wilkins, London. Butler, R. F. and Banerjee, S. K. (1975). Journal of Geophysical Research 80, 4049. Carlile, M. J. (1985) SNIPPETS (Serendipitous Notes in Physics, Education and Technological Science) 10, 5 . Carlile, M. J., Dudeney, A. W. C., Hebenstreit, B. J. and Heerema, R. H. (1987). Journal of Magnetism and Magnetic Material 67, 29 1. Chrichton, R. R. and Charloteaux-Weuters, M. (1987). European Journalqf Biochemistry 164,485. Couling, S. B. and Mann, S. (1985). Journal of the Chemistry Society, Chemical Communications, 1713.
Courteaux, L. (1986). BSc report, University of Bath, England. Farina, M., Esquivel, D. M. S. and Lins de Barros, H. G. P. (1990). Nature, London 343, 256. Fassbinder, J. W. E., Stanjek, H. and Vali, H. (1990). Nature, London 343, 161. Frankel, R. B., Blakemore, R. P. and Wolfe, R. S. (1979) Science 203, 1355. Frankel, R. B., Papaefthymiou, C. C., Blakemore, R. P. and OBrien, W. D. (1983). Biochimica Biophysica Acta 763, 147. Carrels, R. M. and Christ, C. L. (1965). “Solution, Minerals and Equilibria”. Harper and Row, New York. Gorby, Y. A., Beveridge, T. J. and Blakemore, R. P. (1988). Journal of Bacteriology 170, 834. Guell, D. C., Brenner, H., Frankel, R. B. and Hartman, H. (1988). Journal of Theoretical Biology 135. 525.
180
S.MANN. N . H . C. SPARKS A N D R. G. BOARD
Jorgensen, B. B. and Revsbech, N. P. (1983). Applied and Environmental Microbiology 45, 1261. Kiene, R. P. and Capone, D. G. (1988). FEMS Microbiology Ecology IS, 27. Kirschvink, J. L. (1980), Journal of Experimental Biology 86, 345. Kreig, N. R. and Hoffman, P. S. (1986). Annual Reviews of Microbiology 40, 107. Lins de Barros, H. G . P., Esquivel, D. M. S., Danon, J. and Oliveira, L. P. H. (1981). Annals o f the Academy o f Brazilian Science 54, 258. Lins de Barros, H. G. P. and Esquivel, D. M. S. (1986).Journal of E.xperimenta1 Biology 121, 153. Lloyd, D., Davies, K. J. P. and Boddy, L. (1986). FEMS Microbiology Ecology 38, 1 1 . Lloyd, J. (1989). BSc report, University of Bath, England. Lovley, D. R.. Stolz, J. F.. Nord, Jr., G. I. and Phillips, E. J. P. (1987). Nature, London 330, 252. Lumsden, C. J. (1984). Journal qf Theoretical Biology I 1 I. 1 . Mahler, B. A. and Taylor, R. M. (1988). Nature, London 336, 368. Mann, S. (1985).In “Magnetite Biomineralization and Magnetoreception in Organisms; A New Biomagnetism”(J. L. Kirschvink. D. S. Jones and B. J. MacFadden, eds), pp. 31 1-332. Plenum Press, New York. Mann. S. and Frankel, R. B. (1989). In “Biomineralization: Chemical and Biochemical Perspectives” (S. Mann, J. Webb and R. J. P. Williams, eds), pp. 398426. VCH, London. Mann, S., Moench, T. T. and Williams, R. J. P. (1984a).Proceedings qf the Royal Society. London B 221, 385. Mann, S., Frankel, R. B. and Blakemore, R. P. (1984b). Nature, London 310, 405. Mann, S., Sparks. N. H. C. and Blakemore, R. P. (1987a).Proceedingsqf the Royal Society, London B 231, 469. Mann, S., Sparks, N. H. C. and Blakemore, R. P. (1987b).Proceedings oj’the Royal Society, London B 231,477. Mann, S., Sparks. N. H. C., Larcombe, M. C.. Couling, S. B. and Frankel, R. B. (1989).Journal of the Chemistry Society, Furaday Transactions I 85.3033. Mann, S., Sparks. N. H. C.. Frankel, R. B., Bazylinski, D. A. and Jannasch, H. (1990). Narure, London 343.258. Maratea, D. and Blakemore, R. P. (1981). International Journal of Systematic Bacteriology 31, 452. Matsuda, T., Endo. J., Osakabe. N. and Tonamura, A. (1983). Nature, London 302,41 I . Matsunagd, T. and Kamiya, S. (1987). Applied Microbiology and L)iotec~hnology26, 328. Mizota, M. and Maeda, Y. (1983).Annual Report of Research. Reactor Institute, Kyoto University 16, 144. Moench, T. T. (1988). Antonie uun Leeuwenhoek 54, 483. Moench, T. T. and Konetzka, W. A. (1978). Archives uf Microbio1og.y 119, 203. Morris, J. G . (1988). I n “Homeostatic Mechanisms in Micro-organisms” FEMS Symposium 44 (R. Whittenbury, G. W. Gould, J. G. Banks and R. G . Board eds), pp. 84-98. Bath University Press, Bath. Moskowitz, B. M., Frankel. R. B., Flanders, P. J., Blakemore, R. P. and Schwartz, 8 . B. (1988). Journul of Magnetism and Magnetic Materials 13, 273. Nedwell, D. B. (1987). FEMS Microbiology Ecology 45, 47. Neilands, J. B. (1974). In “Microbial Iron Metabolism-A Comprehensive Treatise” (J. B. Neilands, ed.), pp. 3-34. Academic Press, New York. Neilands, J. B. (1982). Annuol Reviews qf Microbiology 36, 285. Oberhack. M., Sussmuth, R. and Frank, H. (1987). Natufforsch 42c, 300. Ofer, S., Nowick, I.. Bauminger, R. and Wolfe, R. S. (1984). Biophysical Journul46, 57. Paoletti, L. C. and Blakemore, R. P. (1986). Journal of Bacteriology 167, 73. Petersen, N., von Dobeneck, T. and Vali, H. (1986). Nuture, London 320, 611. Poindexter, J. S. ( I 964). Bucreriology Reviews 28, 23 1. Presti, D. E. (1985).1n“MagnetiteBiomineralization and Magnetoreception in Organisms; A New Biomagnetism” (J. L. Kirschvink, D. S. Jones and B. J. MacFadden, eds), pp. 455482. Plenum Press, New York. Rosenblatt, C., Torres De ArdUJO, F. F. and Frankel, R. B. (1982).Biophysics Journal 40, 83. Schwartz, B. B. and Blakemore, N. (1984). US Patent No. 4677067. Short, K. A. and Blakemore, R. P. (1989).Archives of Microbiology 152, 342.
MAGNETOTACTIC BACTERIA
181
Sidhu, P. S., Gilkes, R. J. and Posner, A. M. (1978). Journal of Inorganic Nucleation Chemistry 40, 429. Skiles, D. D. (1985).In “Magnetite Biomineralization and Magnetoreception in Organisms: A New Biomagnetism” (J. L. Kirschvink, D. S. Jones and 8. J. MacFadden, eds), pp. 43-102. Plenum Press, New York. Sneath, P. H. A. (1955). Journal qJ’General Microhiology 1, i. Sparks, N. H. C., Courteaux, L., Mann, S. and Board, R. G.(1986). FEMS Microbiological Lerters 22, 171. Sparks, N. H. C., Lloyd, J. and Board, R. G . (1989). Letters in Applied Microbiolcig~~ 22, 109. Sparks, N. H. C., Mann, S.,Bazylinski, D. A., Lovley, D. R., Jannasch, H. W. and Frankel, R. B. ( I 990). Earth and Planelary Science Letters. in press. Spender, M. R., Coey, J. M . D. and Morrish, A. H. (1972). Canadian Journd u/’Phy.sic.s50, 2313. Spormann, A. M. (1987). FEMS Microbiology Ecology 45, 37. Spormann. A. M. and Wolfe, R. S. (1984). FEMS Microhiologica/ Letters 22, 171. Stolz, J . F., Chang, S.-B. R., and Kirschvink, J. L. (1986). Nature. London 321. 849 Tamaura. Y., Buduan. P. V. and Katsura. T. (1981). Journal of the Chenii.strj. Socie/,v. &f/tfJn Trtorsoc~tion.~, 1807. Tamaura, Y.. Ito, K. and Katsura. T.( 1983).Journdof’theChcwistrj~Society, Dalton Tran.strction,s. 189. Torres de Araujo. F. F., Pires, M. A., Frankel, R. B. and Bicudo, C . E. M. (1986). Eiophj~.sicul Journal 50, 375. Towe. K. M. and Moench, T. T. (1981). Earth and Planetary Science Letters 52, 213. Vali, H.. Forester. 0..Amarantidis, G. and Petersen, N. (1987).Earth and Planetary Science Letters 86, 389. Vali, H. and Kirschvink, J. L. (1989). Nature, London 339. 203. Verstraete. W. and van Vaerenbergh, E. (1986).In”Biotechnology”(H.J. Rehm and G . Reed, eds), pp. 43-1 13. Weinham, New York. Waleh, N. S. (1988). Molecular and General Genetics 214, 567. Walker, M. M.. Kirschvink, J. L. and Dizon, A. E. (1985). In “Magnetite Biomineralization and Magnetoreception in Organisms; A New Biomagnetism”(J. L. Kirschvink. D. S. Jonesand B. J. McFadden, eds), pp. 417438. Plenum Press, New York. Widder, K. J., Senyei, A. E. and Scarpelli, D. G . (1978).Proceeding.s,fi,rthe Society ~f’Experinienta1 Biologj, and Medicine 58, 141. Wolfe, R. S., Thauer, R. K. and Pfennig, N. (1987). FEMS Microbiology Ecology 45, 31.
This Page Intentionally Left Blank
Microbial Stress Proteins K. WATSON Department of Biochemistry, Microbiology and Nutrition, University of New England, Armidale, Australia 2351 I. Introduction
.
.
.
11. What are stress proteins?
. .
. .
. .
. .
. .
. .
.
. . . . .
. . Ill. Stress proteins are highly conserved . . IV. Induction of stress-protein synthesis A. Formation of abnormal or damaged proteins . B. Oxygen stress . . . . . . . . . C. Temperature . . . . . . . . . V. Acquired thermotolerance . . . . . . . VI. Immune response . . . . . . . . . VII. Protein assembly and trans!ocation . . . . , VIII. Summary . . . . . . . . . . . IX. Acknowledgements . . . . . . . . . References . . . . . . . . . . .
.
. . .
. . . . . . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
. . . . . .
.
.
,
,
. . .
. . .
.
.
.
.
. .
. .
.
. .
.
.
.
,
.
.
. .
. . . . . . .
183 184 192 194 194 197 202 203 210 212 215 216 216
I. Introduction All organisms, from bacteria and fungi to plants and animals, respond to a wide range of environmental stresses by inducing the synthesis of a small set of proteins, the so-called stress proteins. An obvious, but far from resolved, function for stress proteins is to protect cells from a further and potentially lethal stress challenge. Nevertheless, despite the intense study of these stress proteins in the past 10 years their function remains enigmatic. Part of the confusion has been the complexity of different forms of stress proteins, most of which are produced in unstressed cells under normal physiological conditions. The wide variety of stresses which induce an elevated synthesis of stress proteins has further added to the complexity of the stress response. It is this multistress response in almost all organisms so far examined that has led to contradictory interpretations for the phenomenon. However, progress in the past few years in our understanding of the function of some of the major stress proteins in normal unstressed cells has been extremely encouraging and is likely to lead to a more unified theory for the stress phenomenon. ADVANCES IN MICROBIAL PHYSIOLOGY, VOL 31
ISBN 012-027731-X
Copyright 8 1990, by Academic Press Limited All rights of reproduction in dny form reserved
184
K WATSON
Considerable emphasis in recent years has been placed on gene regulation and associated molecular biology of the stress proteins. An early article by Ashburner and Bonner (1979)reviewed gene regulation and the effects of heat shock and other stresses on synthesis of stress proteins by Drosophilu sp. More recent reviews on heat-shock induction of stress proteins in eukaryotes, with particular reference to D.melanogaster, cover aspects of gene regulation and activation (Bienz and Pelham, 1987;Tanguay, 1983,1988) and developmental induction of stress proteins (Bienz, 1985; Bond and Schlesinger, 1987). The genetics and regulation of the heat-shock response in Eschevichia coli has also recently been reviewed (Neidhardt et ul., 1984; Neidhardt and VanBogelen, 1987). Comprehensive overviews on the heat-shock response in different organisms have been presented by Craig (1985), Lindquist (1986) and Lindquist and Craig ( I 988), while those by Subjeck and Shyy (1 986) and Welch (1986) concentrate on the mammalian heat-shock response. Shorter reviews covering speculations on the functions of heat-inducible stress proteins include those by Burdon (1986),Pelham (1986,1988), Schlesinger et al. (19824, Schlesinger (1986) and Pardue (1988). In addition, four monographs on stress proteins, with emphasis on the heat-shock response, have been published (Schlesinger P I NI., 1982b; Nover, 1984; Atkinson and Walden, 1985; Pardue ef ul., 1989). The main experimental systems examined with respect to stress proteins have been D.mrlanogasrer, E. coli and Saccharomyces cevevisiae, together with various mammalian tissue-culture cells and a range of plant cells. The present review focuses on the physiological response of microorganisms, both prokaryotic and eukaryotic, to stresses. Particular consideration will be placed on temperature, oxidative and chemical stresses, the last including ethanol, protein-synthesis inhibitors and amino-acid analogues. Where appropriate, attention will be drawn to similarities or differences in the stress response of micro-organisms to that of higher eukaryotes and mammalian systems. 11. What are stress proteins?
The landmark observation in the concept of a universal cellular stress response was in 1962 by Ritossa who reported that specific puffs in the polytene chromosomes of D.busckii could be induced by a brief heat shock. This initial observation was largely ignored and the significance was not recognized until some 10 years later when it was reported that a small number of polypeptides could be induced by a mild heat-shock treatment of salivary glands from D.melunogaster (Tissieres rt ul., 1974). In the 15 years since 1974, every organism so far examined has been shown to respond to a mild temperature shock (with respect to normal growth temperature) by increased synthesis of specific proteins. These proteins have been collectively termed the
MICROBIAL STRESS PROTEINS
185
heat-shock proteins or hsps. It is now well established that hsps or closely related proteins are also induced when organisms are exposed to diverse environmental stresses other than heat. Stresses known to induce heat shock or closely related proteins include ethanol, arsenite, heavy metals, amino-acid analogues, oxidative agents and anaerobiosis (Ashburner and Bonner 1979; Nover, 1984; Table I). The term “stress proteins” has thus been applied to describe this class of protein. Heat-stress proteins comprise three main groups. These groups are 85-1 10 kDa, 60-80 kDa and < 50 kDa proteins, respectively. In addition, ubiquitin, a 8.5 kDa protein, is a key component of the stress response in all eukaryotic cells. In accordance with convention, the heat-shock-inducible proteins will be referred to as hsp70, hsp26, etc., where the number after hsp refers to the molecular mass, usually as estimated by sodium dodecyl sulphate-polyacrylamide-gel electrophoresis (SDS-PAGE). It is highly significant that most, if not all, heat-shock-inducible proteins or stress proteins are present in unstressed cells. It is certain that proteins of this class play essential roles under normal physiological conditions. The most extensively studied group of evolutionarily conserved heatinducible and related proteins are those of molecular mass around 70 kDa. The Hsp70 genes in eukaryotic cells, including Sacch. cerevisiae, have been shown to be members of a multigene family. In Sacch. cerevisiue at least nine genes related to Hsp70 of higher eukaryotes have been identified (Craig er al., 1985; Lindquist and Craig, 1988; Rose et al., 1989; Normington er al., 1989). Seven of the members of the yeast Hsp70 multigene family are constitutively expressed, albeit at different levels, in the unstressed cell. Two of the genes, termed SSA3 and SSAI, are transcribed at markedly elevated levels following a mild heat shock. Transcription of four other genes, SSAI, SSCI, SSDl (Lindquist and Craig, 1988) and KAR2 (Normington et al., 1989), is elevated to a lesser extent after a heat shock. Three subfamilies, SSA (WernerWashburne et al., 1987), SSCI (Craig et al., 1987)and KAR2 (Normington er al., 1989)are essential for cell viability. The nucleotide homologies among the yeast Hsp70 multigene family range from 50 to 90% (Lindquist and Craig, 1988). By comparison, the D. melanogasrer (Palter er al., 1986) and human (Mues et al., 1986)Hsp70 multigene families consist of a minimum of nine and 10 genes, respectively. As with the yeast Hsp70 family, only some are heatshock inducible. In Neurospora crassa, hsp70 resolved into at least seven polypeptides as observed by two-dimensional gel electrophoresis (Kapoor and Lewis, 1987a). Four of these are constitutively expressed in unstressed cells, two of which are elevated in response to a heat shock while one is decreased. The other two are apparently induced only following a heat shock or treatment of cells with hydrogen peroxide. On the other hand, prokaryotes, exemplified by E. coli, appear to have a single hsp70-like protein, the product
186
K WATSON
of the dnaKgene (Bardwell and Craig, 1984),identified as a host gene required for A DNA replication (Georgopoulous, 1977; Saito and Uchida, 1977). It is noteworthy that the dnuK protein in E. coli is an abundant protein at the growth temperature of 37°C (Herendeen et al., 1979) which is synthesized at elevated levels following heat shock (VanBogelen et al., 1987a). Preliminary hybridization studies have indicated the presence of a single Hsp70-related sequence in the genomes of certain thermophilic bacteria (Lambert et al., 1988). In Sacch. cerevisiae, a 100 kDa stress-inducible protein has been shown to be a nuclear protein, and two genes in the hsp90 family have also recently been identified (unpublished results, quoted in Lindquist and Craig, 1988). The analogue in E. coli of the yeast hsp90 protein is the protein identified as C62.5 by SDS-PAGE (Bardwell and Craig, 1987). Although there appear to be multiple low-molecular-weight ( <40 kDa) stress proteins in D. melunoguster (Craig, 1985), plants (Schoffl et al., 1986) and mammalian cells (Lindquist, 1986), only a single small stress-associated protein, hsp26, has been well characterized in Sacch. cereuisiae (Petko and Lindquist, 1986). The hsp26 of Sacch. cereuisiae is present in normal, unstressed cells. Synthesis of hsp26 is inducible by a temperature increase and hsp26 mRNA accumulates during development changes associated with transition from the log to stationary phase of growth and on onset of sporulation (Kurtz et al., 1986). Rossi and Lindquist (1989) have recently concluded that the intracellular location of hsp26 depends more upon the physiological state of the cell than upon the presence or absence of stress. No small heat-shock or stress-associated proteins with significant sequence homology to eukaryotes have been reported in E. coli. The stress response and related heat-shock response have been extensively studied using E. coli and Sacch. cerevisiae as model prokaryotic and eukaryotic organisms, respectively. However, an increasing number of other micro-organisms have been examined in recent years, including the prokaryote Bacillus suhtilis, the filamentous fungus N . crassa, the ciliated protozoan Terrahymenu pyriformis and the slime mould Dictyostelium discoideum. Table 1 presents a selection of recent references on the synthesis of heatshock and related stress proteins in prokaryotic and eukaryotic microorganisms. It is striking that synthesis of a specific set ofproteins, in some cases homologous proteins from quite different organisms, is stimulated in response to a wide variety of environmental stresses. Although nucleic-acid and aminoacid homologies of stress proteins from micro-organisms have been mostly confined to studies on E. coli and Sacch. cereuisiae, it is clear that the stress or heat-shock response is ubiquitous. The function of these proteins in different organisms, once elucidated, is likely to be identical or very similar.
187
MICROBIAL STRESS PROTEINS
TABLE 1. Selected references on stress proteins in micro-organisms Stress proteins
Organism
Reference
Fungi
Achlya ambisexuulis 30 to 35°C 29 to 37°C Achlyu klebsiunu 24 to 37°C Blasrocludiella emersonii 27 to 38°C Usiilago maydis 28 to 42°C Diciyosrelium discoideum 22 to 30°C
Neurospora crassu 30 to 4548°C
28 to 48°C
28 to 4&48"C Ethanol Carbon-source starvation
hsp44, hsp46, hsp70, hsp78 hspl8-28, hsp43, hsp70, hsp74, hsp85, hsp96
Gwynne and Brandhorst (1982) Silver e/ ul. (1 983)
hsp26, hsp52, hsp60, hsp68-72, hsp85, hsp96
LeJohn and Braithwaite (1984)
hsp70, hsp82 plus 12 other hsps
Bonato
hsp70
Holden ei a/. (1989)
hsp70, hsp82 plus at least 8 polypeptides hsp26-32
Loomis and Wheeler (1980, 1982). Rosen e / a/. (1989, Manrow and Jacobson (1987)
hsp30-38, hsp67, hsp83, hsp98 hsp70, hsp80, hsp90, plus 10 other hsps
Plesofsky-Vig and Brambl (1985) Roychowdhury and Kapoor (1986), Curle and Kapoor (1988) Kapoor (1982)
hsp23, hsp43, hsp78, hsp99, hspl05 hsp35, hsp80 hsp80
el
ul. (1987)
Roychowdhury and Kapoor (1986) Roychowdhury and Kapoor (1986)
Protozoa
Leishmaniu donavani Leishmaniu enrieiii Leishmania iropica 26 to 37°C
hsp54, hsp74. hsp88
Lawrence and Robert-Gero (1985)
Leishmania major 25 to 37°C
hsp70, hsp83
Van der Ploeg er a/. (1985)
hsp22-26, hsp68, hsp70, hsp83
Hunter e/ a/. (1984)
56, 78, 94 kDa plus 4 minor polypeptides
Lawrence and Robert-Gero (1985)
Leishmania mexicana 24 to 34°C Leishrnuniu iropicu Arsenite
(< O ~ I I I I I U P ' I I
K. WATSON
TABLE l.-con/d. Organism
Stress proteins
Reference
Protozoa (conid) Trypanosoma cruzi 27 to 37°C
Carbon-source starvation Tetrahymenu pyriformis 28 to 34°C
28 to 34°C Arsenite Tetrahymena thermophila 30 to 40°C 30 to 40-43”C 30 to 39°C
Amino-acid analogues, puromycin, paromom ycin, tetracycline Canavanine
Yeasts Candida alhicons 23 to 37°C
Ethanol Saccharomyces cereuisiue 23 to 37°C
hsp55, hsp60, hsp70, hsp83 plus 20 other hsps Ubiquitin
Alcina et a/. (1988)
h~p25-29, hsp70-75 PIUS 4 other hsps
Guttman e/ a/. (1980). Gorovsky e/ 01. (1982), Galego and Rodrigues-Pousada (l985), Coias e / a/. (1 988) Neves et a/. ( I 988) Amaral rt al. (1988)
Ubiquitin hsp25-29, hsp35, hsp70-75, hsp92, 35-46 kDa, 83 kDa
Swindle e/ ul. (1 988)
hsp80, hsp91 hsp30, hsp73, hsp80, hsp58 At least 25 polypeptides including hsps30-34. hsp74, hsp85 Similar to above hsps
Jones and Findly (1986) Hallberg et a/. (1985) Wilhem et ul. (1982)
hsp28, hsp45, hsp60, hsp73
Jones and Findly (1986)
hspl8-22, hsp40, hsp60, hsp68-70 hsp4348, hsp56, hsp64, hsp73, hsp84 34-38 kDa, 46 kDa, 64-68 kDA. 82 k D d
Dabrowa and Howard (1984)
At least 17 polypeptides plus other less pronounced proteins hsp38, hsp79, hsp90, hsplOO hsp70, hsp80, hsplOO
U biquiti n
Wilhem el a/. (1982)
Zuethen et ul. (1988) Zuethen e / ul. (1988)
Miller e f a / . (1979, 1982)
McAlister et ul. (1979) Hall (1983), Cavicchioli and Watson (1986) Finley e / a/. (1987), Tregcr et d.(1988). Grant el a / . (1989)
189
MICROBIAL STRESS PROTEINS
TABLE I.-conrd. Organism
Yeasts (contd) 23 to 36°C 23 to 40°C Ethanol Dinitrophenol Starvation Glucose starvation Sporulation Paroinoniycin Amino-acid analogues DNA-damaging agents
Stress proteins
hsp4 1, hsp45, hsp49, hsp72, hsp84 hsp70, hsp85, hsp98 At least 4 hsps hsp70, hsp85, hsp98 Ubiquitin At least 6 polypeptides plus 5 hsps hsp26, hsp84 Ubiquitin Ubiquitin Ubiquitin
Reference
Shin et a/. (1987) Weitzel et ul. (1985) Plesset et ul. (1982) Weitzel et ul. ( I 985) Finley et ul. (1987) Boucherie (1985) Kurtz el a/. (1986) Grant el ul. (1989) Finley el ul. (1987) Grant el ul. (1989)
Bacteria Bucillus unnrhrucis Bucillus cereus Bucillus meguterium Bucillus suhtilis 37 to 48 C But.il1u.r psychrophilus 0 to 32°C Burillus subtilis 37 to 50°C
Ethanol 37 to 43°C 37 to 48°C 37 to 5G52"C H202
hsp66 plus others
Streips and Polio (1985)
hsp28, hsp29, hsp35, hsp79 plus others
McCallum et ul. (1986)
hspl3-3 I, hsp66, hsp76, hsp82, hsp87 plus others Similar to above heat shock but less pronounced hsp22, hsp32, hsp69, hsp84 hsp23, hsp40, hsp66, hsp74, hsp80, hsp97 hsp66 plus at least 10 hsps Similar to above heat shock
Arnosti et ul. (1986)
Bacleroides .frugilis UV irradiation (254nm) 70 kDa, 90 kDa, 95 kDa 70 kDa, 90 kDa, 95 kDa, HZ02 100 kDa 34 kDa, 37 kDa, 70 kDa, Anaerobic to aerobic 90 kDa, 106 kDa
Arnosti et ul. (1986) Todd ei ul. (1985) Qoronfleh and Streips (1987) Richter and Hecker (1986) Richter and Hecker (1986). Murphy et ul. (1987) Schumann et ul. (1982) Schumann et a/. (1984) Schumann el ul. (1984)
190
K.WATSON
TABLE l.--contd. Organism Bacteria (contd) Caulobacrer crescentus 30 to 40°C
30 to 42°C
HZO,
Stress proteins
At least 20 polypeptides including hsp62 (groEL) hsp70 (dnaK) hsp28, hsp37, hsp62 (groEL) hsp70 (dnaK), hsp92 (Ion) hsp62 (groEL)
Ciosrridium ucrrohutylicum 28 to 45°C hsp16-18, hsp22-28, hsp49 hsp68, hsp74, hsp83 Butanol hsp 16- 18, hsp22, hsp68, hsp74, hsp83 Anaerobic to aerobic hsp22, hsp68 Escherichiu coli 28 to 42°C
37 to 10°C Aerobic to anaerobic Anaerobic to aerobic Ethanol
CdCI,
Superoxide radical anion (0;) UV irradiation Abnormal protein
Starvation conditions (glucose and nitrogen) Alkaline shift
At least 17 polypeptides including grpE, groEL (hsp58), groES, dnaK (hsp70), C62.5 (hsp83), Ion At least 13 polypeptides At least 18 polypeptides At least 19 polypeptides Similar to heat shock (28 to 42°C)
Reference
Gomes er a/. (1986)
Reuter and Shapiro (1987) Reuter and Shapiro (1987) Terracciano et a/. (1988) Terracciano el a/. (1988) Terracciano et 01. (1988) VanBogelen et a/.(1987a,b), Neidhardt and VanBogelen (1987). Jenkins P I a/. (1988)
Jones et ul. (1987) Smith and Neidhardt (1983a) Smith and Neidhardt (1983b) VanBogelen et a/. (1987a,b), Neidhardt and VanBogelen (1987) At least 17 polypeptides Neidhardt and VanBogelen (1987) plus 5 hsps including groE, dnaK and C62.5 At least 15 polypeptides Neidhardt and VanBogelen plus 4 hsps including (1987), Jenkins et a/. groE, dnaK and groES (1988) At least 13 polypeptides Walkup and Kogoma (1989) plus groEL Krueger and Walker (1984) groEL, dnaK, plus other polypeptides Ito et a/. (1986), groEL, dnaK, C62.5 plus Parsell and Sauer (1989), other polypeptides Snow and Hipkiss (1987) Ion plus other GoR and Goldberg (1985) hsps At least 30 polypeptides Groat and Matin (!986), Jenkins el al. (1988), Groat et a/. (1986) dnaK, groE Taglicht et al. (1987)
191
MICROBIAL STRESS PROTEINS
TABLE I.-contd. Organism Bacteria (coi7id) Halobacterium sp. 37 to 60°C Legionella pneumophilo 30 to 42 C
Abnormal protein
Stress proteins
hsp21-28, h~p44-45, hsp75-105
Daniels et al. (1984)
hspl7, hsp60, hsp70, hsp78, hsp85 Similar to heat shock but less pronounced
Lema
el
al. (1988)
Lema
el
al. (1988)
Methylophilus methylotrophus hspl4-16, hsp2e27, 30 to 40°C hsp6G63, hsp78, hsp83 13 kDa, 30 kDa, 36 kDa, Ethanol 78 kDa, 94 kDa 14 Da, 20 kDa, 29 kDa, Methanol 36 kDa, 78 kDa, 83 kDa, 94 kDa Mycoharlerium hovis 30 to 43°C
My.~ocorcus.ran thus 28 to 40°C Pseudomonos aeruginosa 30 to 45°C
Ethanol Phormidium laminosum 45 to 55°C UV irradiation (254 nm) Nalidixic acid Salmonella ryphimurium 28 to 42°C
32 to 45°C
H*01 Aerobic to anaerobic Anaerobic to aerobic Ethanol
Reference
Watt and North (1987) Watt and North (1987) Watt and North (1987)
hsp71 plus other hsps
Mehlert and Young (1989)
hspl8, hsp26, hsp43, hsp68 hspY7
Nelson and Killeen (1986). Killeen and Nelson (1988)
17 proteins including hsp61 (groEL), hsp76 (dnaK) 22-38 kDa, 7G76 kDa, 8 6 9 1 kDd
Allan
el
al. (1988)
Allan
el
ul. ( I 988)
hsp33, hsp86, hsp89 26 kDa. 34 kDa. 43 kDa
Nicholson et al. (1987) Nicholson et al. (1987)
At least 13 polypeptides including hsp69 (dnaK), hsp56 (groEL) At least 28 polypeptides At least 30 polypeptides including 5 hsps At least 14 polypeptides At least 12 polypeptides At least 19 polypeptides including groEL, dnaK
Christman et al. (1985) Morgan et al. (1986) Spector el al. ( 1 986) Christman el a/. (1985), Morgan el al. (1986) Morgan el ul. (1986) Morgan er al. (1986) Morgan el al. (1986)
192
K.WATSON
TABLE 1.-cow. Organism
Stress proteins
Bacteria (conrd) Starvation conditions (PO:., NH4, glucose nicotinate) Synechococcus sp. 39 to 47°C
Reference
63 polypeptides, the number depending on starvation conditions
Spector el a/. (1986)
hspl l-24, hsp45-19, hsp61-65, hsp74, hsp78-79, hsp91
Borbely e / al. (1985), Suranyi et al. (1989)
hsp22, hsp38, hsp64, hsp66, hsp86
Jerez (1988)
hspl622, hsp35, hsp67, hsp75, hsp94 Similar to heat shock but less pronounced
Jerez (1988)
Sulfolobus acidocaldurius
70 to 85°C Thiobacillus ferrooxidans 30 to 85°C
Ethanol
Jerez (1988)
Zymomonus mobilis
30 to 45°C Ethanol
hspl4, hspl9, hsp38, hsp54, hsp66 14kDa. 31 kDa, 38kDa, 38 kDa, 66 kDa
Michel and Starka (1986) Michel and Starka (1986)
111. Stress Proteins are Highly Conserved An impressive feature of heat-shock or stress proteins is their high degree of conservation from bacteria, protozoa and fungi to fruit flies, chickens and mammals. The most highly conserved stress-inducible protein, at least in eukaryotic cells, is ubiquitin (Sharp and Li, 1987). The monomeric unit is a 76 amino-acid residue protein of molecular mass 8500 Da found in all eukaryotic organisms so far examined. Amino-acid sequence homology is total in organisms as diverse as humans, fish and insects (Finley et al., 1988).Ubiquitin variants characterized to date include those from D. discoideum (Westpahl et a/., 1986) and Sacch. cereuisiue (Ozkaynak et a/., 1987). The amino-acid sequence of yeast ubiquitin differs by three residues (96% homology) from that of animals and by four residues (95% homology) from D. dzscoideurn. In Sacch. cereuisiae and other organisms, ubiquitin is encoded by a family of natural gene fusions, either to itself as a polyubiquitin gene or to unrelated amino-acid sequences (Ozkaynak et al., 1987; Rechsteiner, 1987, 1988; Finley et a/., 1989; Redman and Rechsteiner, 1989). Polyubiquitin genes ranging in
MICROBIAL STRESS PROTEINS
193
number from 15 in D . melanogaster (Arribas et al., 1986),nine in human beings (Wiborg et al., 1985), five in Sacch. cereuisiae (Ozkaynak et al., 1984, 1987) to two in D. discoideum (Giorda and Ennis, 1987) have been identified. It is generally believed that ubiquitin is transcribed as a polycistronic mRNA, translated into a polypeptide and then cleaved proteolytically to yield the free ubiquitin monomer. Covalent binding of ubiquitin to various acceptor proteins helps promote regulation of a number of cellular processes many of which are related to a stress response. These include selective protein degradation (Hershko and Ciechanover, 1986; Finley and Varshavsky, 1985; Rechsteiner, 1987, 1988). DNA repair (Jentsch et al., 1987) and response of cells to heat, starvation and amino-acid analogues (Finley et al., 1987). One function for ubiquitin in the stress response of eukaryotic micro-organisms is that of removal of abnormal or denatured proteins (see Section IV). Although no prokaryotic equivalent of ubiquitin has been identified, the ATP-dependent protease coded by the Ion gene, a stress-inducible protein with a mass of 94 kDa (Goff et al., 1984; Phillips et af., 1984),plays an important role in removal of abnormal proteins and incompletely folded proteins from E. coli (Goff and Goldberg, 1985; Goff et al., 1988). Sequence analysis has demonstrated little or no homology between the Ion gene product and the eukaryotic hsp90 or any other stress protein (Chin et al., 1988).Interestingly, Latchman ef al. (1987) have shown that the Ion protein and hsp90 share an antigenic determinant thus demonstrating that at least one region in the two proteins is exceptionally well conserved. Stress proteins belonging to the hsp70 group are among the most highly conserved proteins known. High nucleotide and amino-acid sequence homologies have been characterized for proteins isolated from a wide variety of plant, animal, fungal and bacterial species. Amino-acid homology is frequently clustered, suggesting evolutionary conservation of common functional protein domains. Overall, at the amino-acid residue level, the hsp70 from D. melanogaster shows more than 70% homology with the human hsp70 (reviewed in Lindquist, 1986)and 50% identity with dnaK, the equivalent in E. coli of hsp70 (Bardwell and Craig, 1984). Very recently, Craig et al. (1989) characterized a protein (hsp70) from Sacch. cereuisiae, termed Ssclp, which was localized in mitochondria and which was 58% identical with dnaK with one region showing more than 70% homology. By comparison, other hsp70 proteins in Sacch. cereuisiae show about 50% homology with dnaK. An abundant heat-stress inducible protein with a molecular weight of 58 kDa (hsp58) has recently been purified from T. pyrijormis and shown to be related to the groEL stress protein from E. coli (McMullin and Hallberg, 1988; Reading et al., 1989).The 58 kDa protein is localized in mitochondria and, in common with most stress proteins, is constitutively expressed. A 2-3fold increase in the rate of synthesis of the protein is observed following a mild
194
K.WATSON
heat shock (McMullin and Hallberg, 1987,1988).Comparison of the predicted amino-acid sequence of the stress-inducible hsp58 and the groEL proteins revealed 54% amino-acid identity (Reading et al., 1989).Furthermore, it has been shown that these two stress-inducible proteins are evolutionarily homologous with the ribulose bisphosphate carboxylase-oxygenase (Rubisco) subunit-binding protein found in higher plant chloroplasts (Hemmingsen et af., 1988). The significance of these findings in relation to the role of stress proteins in protein folding and assembly is discussed in Section VI. More recently, Fayet et al. (1989) presented data which demonstrated that the groEL and groES stress proteins were essential for cell viability at all temperatures. The higher eukaryotic hsp83 is about 60% identical at the amino-acid sequence level with the equivalent in Sacch. cerevisiae (hsp90) and about 40% with the protein denoted C62.5 from E. coli(Hackett and Lis, 1983; Farrell and Finkelstein, 1984; Bardwell and Craig, 1987). Genes coding for stress-induced proteins not only exhibit homology in their protein-encoding sequences, but in addition their regulatory sequences are highly conserved. A consensus sequence, C-GAA-TTC-G, termed the heatshock regulatory element (reviewed in Bienz and Pelham, 1987; Tanguay, 1988),can be found at variable distances 5’ upstream of the TATA box. This sequence is found in all heat-shock-inducible eukaryotic genes sequenced so far. Similarly in prokaryotes the regulatory sequences of a number of heatshock-inducible genes have been identified as a consensus sequence CCCCATtT, at about the - 10 region, and a sequence T-C-CTTGAA at the -35 region (Cowing et al., 1985). It is evident, therefore, that stress proteins in prokaryotic and eukaryotic micro-organisms are among the most evolutionarily conserved proteins known. The demonstration that many of the stress or heat-shock proteins are developmentally regulated (Bienz, 1985; Bond and Schlesinger, 1987) and are also present in unstressed cells (Lindquist and Craig, 1987) further attests to their fundamental importance in basic cellular physiology.
IV. Induction of Stress-Protein Synthesis A. FORMATION OF ABNORMAL OR DAMAGED PROTEINS
The heat-shock response resulting in synthesis of specific heat-shock proteins can also be induced by stresses other than heat. Many of these treatments have the common property of inducing accumulation of damaged, denatured or otherwise improperly folded proteins. Generation of such proteins following an environmental stress has been proposed as the major trigger for induction of the heat-shock response (Hightower, 1980).
MICROBIAL STRESS PROTEINS
I95
One line of evidence derives from studies on ubiquitin. A mild heat shock is known to induce synthesis of ubiquitin or ubiquitin-protein conjugates in a number of experimental systems including avian cells (Bond and Schlesinger, 1985, 1987),HeLa cells (Parag et al., 1987) and Succh. cereuisiae (Finley et al., 1987).The ubiquitin system plays a key role in the response of Succh. cereuisiae to various stresses (Finley e f al., 1987).Mutants defective in the polyubiquitin gene UB14 are hypersensitive to high temperatures, starvation and aminoacid analogues (Finley et al., 1987), stresses which are also known to induce hsp synthesis. Finley et ul. (1987) suggested that the increased synthesis of ubiquitin in stressed cells is an attempt to maintain a pool of free ubiquitin, one that would otherwise become depleted through the formation of ubiquitin-protein conjugates. Presumably the conjugates would consist of damaged as well as normal proteins. Both types of protein conjugate may be subject to selective degradation. The involvement of the ubiquitin system in protein degradation, particularly of abnormal proteins, following a heat shock has been established in mammalian cells (Parag et al., 1987; Carlson and Reichsteiner, 1987; Carlson et al., 1987).However, it remains an open question as to whether or not all damaged proteins are processed through the ubiquitin system. Further evidence for a key role for ubiquitin in stress-related functions comes from studies on the RAD6 gene in Sacch. cereuisiae, which is required for a number ofcellular functions including DNA repair (Jentsch ef al., 1987). Jentsch et al. (1987) have shown that the RAD6 gene product is a ubiquitin conjugation enzyme. Most recently, a second ubiquitin-carrier protein, which shares significant sequence homology with the RAD6 protein, has been identified as the product of cdc34, a cell-division-cycle gene required for transition from the G1 to the S phase in Sacch. cereuisiue (Goebl et al., 1988). Treger et al. (1 988) demonstrated that exposure of rapidly dividing Succh. cereuisiae to DNA-damaging agents induced an increase in expression of the UB14 gene. Increased UB14 transcription was also noted in high-density cultures of Sacch. crreuisiae and during meiosis. Synthesis of abnormally high levels of aberrant polypeptides has recently been shown to trigger increased transcription of the UB14 gene in Succh. cereuisiue (Grant et al., 1989). Treatment of exponential-phase cultures of Succh. cereuisiae with paromomycin, which induces mistranslation of mRNA, led to a 2-3-fold increase in transcription of UB 14 and hsp70 mRNAs. The degree of transcriptional activation of these two stress-related proteins was comparable to that observed following a mild heat shock from 30 to 37°C. Although prokaryotes lack ubiquitin, they do have ATP-dependent proteolytic systems, the best characterized of which is the Ion-coded protease, the product of the lon gene. A major function for this protease appears to be proteolytic cleavage of damaged proteins. Mutations in the Ion gene result in
196
K WATSON
cells with a decreased ability to degrade abnormal proteins (Kowitt and Goldberg, 1977; Gottesman and Zipser, 1978; Chung and Goldberg, 1981). Conversely, cells with an increased content of the lon-coded protease exhibit several-fold higher rates of degradation of abnormal proteins (Goff and Goldberg, 1987; Goff et al., 1988). In view of these observations, it is not surprising to note that the lon-coded protease is a heat-shock inducible protein in E. coli. The rate of transcription of the protease increases several-fold upon a temperature upshift from 28-30°C to 42°C (Phillips et al., 1984; Goff et al., 1984; Goff and Goldberg, 1985).In addition, increased transcription of the lon gene was also demonstrated on exposure of E. coli to 4% ethanol (Travers and Mace, 1982; VanBogelen et al., 1987a), a treatment expected to induce translational errors and denaturation of some proteins. All of these observations establish a link between cellular stress responses and intracellular protein degradation of damaged or abnormal proteins. Furthermore, E. coli when induced to synthesize large amounts of aberrant polypeptides showed an increase in transcription of the lon gene and other heat-shock inducible genes (Goff et al., 1988).Aberrant polypeptides appeared as a result of production of incomplete polypeptides following puromycin treatment and by incorporation of canavanine, an amino-acid analogue of arginine. Cells forced to produce incorrectly folded proteins following cloning of foreign genes, specifically human-tissue plasminogen activator and serum albumin, also overproduced the Ion-coded protease (Goff et al., 1988). In related experiments, Ito et al. (1986) demonstrated that introduction into E. roli of a gene encoding a hybrid protein consisting of the periplasmic maltosebinding protein and the cytoplasmic P-galactosidase protein (MalE-Lac2 hybrid protein) induced synthesis of heat-shock proteins, including the groE and dnaK proteins. It was proposed that E. coli recognizes the hybrid protein, consisting of two proteins from different cell compartments, as abnormal, and synthesizes the heat-shock proteins as a stress response. In higher eukaryotes abnormal proteins can activate synthesis of hsps. The experimental system adopted by Ananthan et al. (1986) to test the mechanism of this response comprised a Drosophila hsp70-E. coli 8-galactosidase fusion gene in which heat-induced production of /3-galactosidase served as a sensitive assay for transcriptional activation of hsp70. Micro-injection into nuclei of frog oocytes of the fusion gene together with purified, non-denatured bovine P-lactoglobulin or bovine serum albumin, did not result in activity, above background, of the Drosophila hsp70-E. coli-P-galactosidase fusion gene. By contrast, when the bovine proteins were first denatured by reductive carboxymethylation, each caused about a 10-fold increase in concentration of the hsp70-/3-galactosidase hybrid gene product. It was concluded from these studies that activation of hsp genes by denatured proteins and by heat shock occurred by a common or related mechanism.
MICROBIAL STRESS PROTEINS
197
B. OXYGEN STRESS
Paradoxically, oxygen-derived reactive molecular species have been implicated as causative agents of oxidative damage to a wide range of cellular components. These include DNA, lipids, proteins and amino acids. Oxidative damage can occur as a result of presence of high concentrations of the superoxide anion (O;), hydrogen peroxide and the highly reactive hydroxyl radical (OH'). These species are formed as by-products of normal aerobic metabolism (e.g. mitochondrial, microsomal and photo-oxidative), increase in oxygen tension or by redox reactions (e.g. those involving hydroquinones, haemoglobins or glutathione). The highly reactive hydroxyl radical is produced from hydrogen peroxide in the presence of suitable transition metals, particularly iron(1i) (Halliwell and Gutteridge, 1986). How cells cope with oxidative stress from normal or abnormal production of reactive oxygen species has been extensively studied in recent years. Although the relative cytotoxicity of the various oxygen species is not fully understood, the major intracellular defence enzymes are thought to be superoxide dismutase, hydroperoxidase or catalase and glutathione peroxidases. In addition, various antioxidant defence mechanisms, for example ascorbate, a-tocopherol and b-carotene, have been identified in biological systems (Sies, 1986). A detailed account of the biology of oxidative stress is beyond the scope of this review and the interested reader is referred to recent reviews on the subject (Fridovich, 1986; Sies, 1986; Halliwell, 1987; Cadenas, 1989). Likewise, the related topics of interaction of reactive oxygen species with DNA (Imlay and Linn, 1988) and the SOS response in E. coli(Walker, 1984,1987) have been well covered in several recent reviews. The latter response is induced when cells are exposed to agents, including reactive oxygen species, that damage DNA or interfere with DNA replication. In microbial systems, the effects of oxidative damage on stress-protein induction have been most extensively studied in the obligate aerobe Bacillus subtilis and the facultative anaerobes E. coli, Salmonella typhimurium and Sacch. cereuisiae. Woods and Jones (1986) have recently reviewed the effects of environmental stress, including oxidative stress, in Bacteroides sp. and Closrridium sp., both obligate anaerobes. Specificemphasis in this section will be given to possible interrelationships between oxidative stress and other stresses, particularly heat, although it should be pointed out that a consistent pattern of responses among these organisms has yet to emerge. In addition, there has been increasing evidence that the response of cells to oxygen stress effected by hydrogen peroxide is quite different from that caused by compounds capable of superoxide anion generation (Christman et al., 1985; Imlay and Linn, 1987; Kogoma et al., 1988). Walkup and Kogoma (1989) have recently demonstrated that the pattern of protein synthesis in E. coli resulting from stress by
198
K WATSON
hydrogen peroxide is quite distinct from that arising during superoxide anion stress. The importance of defence enzymes in protecting cells from oxidative damage is exemplified by studies on various mutants of E. coli. Mutants that are deficient in superoxide dismutase are impaired in aerobic growth and exhibit increased sensitivity to the mutagenic effects of hyperbaric oxygen (Carlioz and Touati, 1986; Farr et al., 1986).Conflicting reports on the role of hydroperoxidase in protecting E. coli against oxidative stress appear in the literature. Mutants deficient in this enzyme have been reported to be either sensitive to hydrogen peroxide (Loewen, 1984; Meir and Yagil, 1984) or to have only slightly increased sensitivity to killing by hydrogen peroxide (Einsenstark and Perrot, 1987). Schellhorn and Hassan (1988) recently examined the response to oxidative stress of double mutants defective in both superoxide dismutase and hydroperoxidase. These authors showed that the former enzyme was more important than hydroperoxidase in protecting cells from the stress of pure oxygen and from compounds that generate the superoxide anion. However, both superoxide dismutase and hydroperoxidase were required for effective defence against hydrogen peroxide and oxidants that generate superoxide radicals. A possible role for glutathione in oxidative stress was proposed by these authors who found that mutants deficient in superoxide dismutase were more sensitive to air than their parental strains following depletion of their glutathione levels. By contrast, both Greenberg and Demple ( I 986) and Imlay and Linn (1987) have reported that glutathionedeficient cells exhibit normal levels of resistance to hydrogen peroxide. Unexpectedly, E. coli strains overproducing superoxide dismutase were hypersensitive to hyperbaric oxygen and paraquat, compounds that generate superoxide radicals (Bloch and Ausubel, 1986; Scott et a/., 1987). Scott et ul. (1987) proposed that high levels of the dismutase may lead to increased levels of hydrogen peroxide with subsequent production of species, such as the hydroxyl radical, that are more reactive than the superoxide anion. Recently, two modes of killing by hydrogen peroxide were distinguished in E. coli (Imlay and Linn, 1986). The first mode occurred at relatively low concentrations (less than 5 mM) of hydrogen peroxide, required active metabolism and appeared to result from DNA damage. The second occurred at higher concentrations (greater than 10 mM) of hydrogen peroxide and was not especially enhanced in DNA-repair-deficient strains (Imlay and Linn, 1986). The latter mechanism has been suggested to be mediated by hydroxyl. radicals on the basis that thiourea, a hydroxyl radical scavenger, prevented mode-one but not modetwo killing by hydrogen peroxide (Brandi ef a/., 1987). Anaerobically grown cells, not unexpectedly, were particularly susceptible to mode-one killing. Protection of cells from oxidative damage by catalase and superoxide dismutase was excluded on the basis of non-induction of these enzymes by
MICROBIAL STRESF PROTEINS
199
hydrogen peroxide or a temperature upshift. By contrast, exposure of E. co/i to sublethal doses of hydrogen peroxide have been reported to induce a 10-fold increase in synthesis of catalase (Imlay and Linn, 1987).Interestingly, cells in the stationary phase of growth were intrinsicially resistant to 10mM hydrogen peroxide. On entry into the stationary phase, cells synthesized a 16kDa protein. This observation led to the suggestion that the 16 kDa protein may play a more general role in the stress response. Salmonella typhimurium adapted to hydrogen peroxide is not only less sensitive to toxic doses of the peroxide but also to killing by heat (Christman et al., 1985).In E. coli, pretreatment with hydrogen peroxide induces resistance to lethal doses of this antimicrobial agent and to near-ultraviolet radiation (Tyrrell, 1985)but not to heat. In a related observation, Privalle and Fridovich ( I 987) reported heat-shock induction of the manganese-containing superoxide dismutase in E. coli, thus providing further evidence for a relationship between heat stress and oxidative stress. In Sal. typhimurium, protection against oxidative damage by hydrogen peroxide correlated with induction of catalase and the dismutase (Christman et a/., 1985; Morgan et a/., 1986). By contrast, neither superoxide dismutase nor catalase were induced by hydrogen peroxide or temperature stress in B. suhtilis (Murphy et al., 1987).I t should be noted that levels of endogenous catalase in B. suhtilis are about 1000-fold higher than those in E. coli and Sal, typhimurium, both facultative anaerobes (Murphy et al., 1987).On the other hand, levels of superoxide dismutase in B. suhtilis are comparable to those in aerobically grown Sal. typhimurium. A note of caution in interpreting these observations is required. Only a limited number of organisms and strains have been examined and it would be premature to conclude that all obligate aerobes and facultative anaerobes are intrinsically different in their levels of catalase and of the dismutase. Murphy et a/. (1987) further reported that pretreatment of B. suhtilis with sublethal concentrations (50 PM) of hydrogen peroxide protected cells against a later challenge by a lethal concentration ( 1 O m ~ )Sublethal . concentrations of the peroxide induced synthesis of eight proteins, four of which (54, 40, 20 and 16 kDa) were also induced by a heat shock from 38°C up to 48°C. Jenkins et al. (1988) established that induction of starvation proteins in E. coli, by deprivation of glucose or of a nitrogen source, led to the development of cross-protection to heat and hydrogen peroxide stress. Each produced its own distinct protein pattern, with several starvation proteins common to both heat and oxidative stress, and three proteins common to all of the stresses. However, these three proteins were not sufficient for heat or hydrogen peroxide resistance since peroxide-adapted cells, despite synthesizing the three proteins, were not heat resistant. It was concluded that the so-called Pex proteins (i.e. independent of positive CAMP regulation during starvation; Schultz et al., 1988)were the most critical for protection against oxidative stress.
200
K WATSON
Mutations in E. coli that affect sensitivity to oxygen were exploited by Jamison and Adler (1 987) to identify three classes of oxygen-sensitive mutants. Class 2 and 3 mutants, as well as three out of 10 class-1 mutants, exhibited similar levels of catalase, superoxide dismutase and peroxidase to those of the wild-type parent. The remaining seven class- 1 mutants contained lower enzyme activities than the corresponding wild-type. Class- I mutants were unable to grow after exposure to oxygen. Class-2 mutants were able to grow at a lower rate, while class-3 mutants formed filaments in response to oxygen. Synthesis of stress proteins in obligate anaerobic bacteria in response to oxidative stress is not well documented, presumably because of the inhibitory effects of oxygen on protein and nucleic-acid synthesis. Glass et al. (1979) reported that exposure of Bacteroides thetaiotaomicron to oxygen resulted in immediate inhibition of protein and nucleic-acid synthesis. On the other hand, these authors reported synthesis of guanosine tetra- and pentaphosphates in cells exposed to oxygen (Glass et al., 1979). A mild heat shock also stimulated synthesis of adenylated nucleotides which led the authors to suggest a common physiological response for heat shock and oxidative stress. These results may be related to the observed synthesis of adenylated nucleotides following onset of oxidation stress by Sal. typhimurium and E. coli (Lee et al., 1983; Bochner et al., 1984). In one of the few reports on synthesis of stress proteins in obligate anaerobes exposed to oxygen, Terracciano et al. (1 988) described synthesis of two proteins of molecular mass 68 and 22 kDa in Clostridium acetobutylicum subjected to oxidative stress. Significantly, both stress proteins were also inducible by heat and butanol stress. Schumann et al. (1984) reported induced synthesis of various stress proteins on exposure of Bacteroides fragilis to oxygen and hydrogen peroxide. Three of the proteins with masses of 106,90 and 70 kDa were synthesized in response to either stress. Proteins with masses of 37 and 34 kDa were characteristic for oxygen stress and a 95 kDa protein specific for hydrogen peroxide stress. The pioneering work of Fridovich and his co-workers established a role for superoxide dismutase and catalase as scavenging enzymes for detoxification of hydrogen peroxide and oxygen-derived free radicals in E. coli and Sacch. cereuisiue (Fridovich, 1978, 1986). More recently, induction of a copper-zinc superoxide dismutase and catalase by oxygen in batch-grown (Lee and Hassan 1985, 1986) and continuous-grown Sacch. cereuisiae (Lee and Hassan, 1987) has been demonstrated. Furthermore, a mutant of this yeast deficient in this dismutase was observed to be hypersensitive to oxygen (Van Loon er al., 1986) and to show a dramatic decrease in growth rate compared with the wild-type when grown on ethanol or acetate (Westerbeek-Morres et al., 1988). However, the growth rate was unaffected when 10% glucose was the carbon source. Verduyn et al. (1988) presented evidence that, in a catalase-negative mutant
MICROBIAL STRESS PROTEINS
20 1
of Hansenulu polymorphu utilizing methanol, cytochrome-c peroxidase was a key enzyme in detoxification of hydrogen peroxide. Catalase in this yeast is specifically induced during growth on substrates that require the action of hydrogen peroxide-producing oxidases (e.g. n-alkanes, methanol). Kuyumdzhieva-Savova et ul. (1985) reported elevated levels of superoxide dismutase and catalase in various yeasts (species of Cundidu, Torufopsis, Hunsenulu and Pichiu) growing on methanol. I t appears, therefore, that the dismutase, catalase and cytochrome-c peroxidase play some role, as yet imprecisely defined, in detoxification of hydrogen peroxide and oxygenderived reactive free radical species in micro-organisms. Some evidence of a function for glutathione peroxidase (both selenium-dependent and seleniumindependent forms) in the response of Succh. cereuisiue to oxidative stress was recently presented by Galiazzo et ul. (1987). In eukaryotic micro-organisms as in prokaryotes, there are few data concerning the function of stress proteins in oxidative stress. Chary and Natwig (1989) presented evidence for several differentially regulated catalase genes in N . crussu. Synthesis of catalase-l (Cat-1) was stimulated in heatshocked cells and in paraquat-treated cells, the latter treatment resulting in intracellular production of superoxide. However, the predominant catalase activity in heat-shocked cells was due to another catalase protein, Cat-2, which in turn was not induced in paraquat-treated cells. In N . crussu, exposure of cells to 0.5-2 mM hydrogen peroxide for one hour induced synthesis of a subset of hsp70 stress proteins as well as a specific oxidative responsive protein, designated OSP80 (Kapoor and Lewis, 1987a). In a later communication, the same authors (Kapoor and Lewis, 1987b) suggested a link between oxidative stress and heat stress in N . CYUSSU on the basis that heat shock induced synthesis of peroxidase activity. Furthermore, heat shock led to tolerance of normally lethal doses of hydrogen peroxide. In Succh. cereuisiue, a mild heat shock induces tolerance to lethal doses (IOmM) of the peroxide not only in aerobically but also in anaerobically grown cells (E. Steels and K. Watson, unpublished results). In relation to oxidative stress in higher eukaryotes, Courgeon et ul. (1988) reported that hsp68-70 and hsp23 were transcriptionally increased severalfold, and actin by 6-7-fold following treatment of D. melunoguster with 1 mM hydrogen peroxide. These authors further reported that molecular oxygen was not active in inducing synthesis of hsps in this fly. It is clear that the identity and characterization of stress proteins induced in organisms on exposure to various oxidative stresses have not been firmly established, although this may at least in part be due to variations in responses between species or even strains of micro-organisms. The difficulties in identifying specific oxidatively induced proteins are likely to be related to a
202
K. WATSON
whole range of variables. These include species-specific proteins, differences in sensitivity to oxidative stresses including strain variability, and variations in experimental protocol. C. TEMPERATURE
Temperature is arguably the single most important parameter governing growth and metabolism of poikilothermic organisms. It is perhaps not surprising, therefore, that induction of stress-protein synthesis has been extensively examined in the response to temperature stress. This usually refers to a temperature upshift, ranging from a few degrees to over 20°C above the conventional growth temperature. Increased synthesis of a small specific subset of proteins by exposure of cells to a temperature upshift is universal with all organisms so far examined. The micro-organisms which have been most thoroughly studied have been E. coliand Succh. cereuisiae and, to a lesser extent, B. suhtili,~,N . crassa and Tetrahymenu spp. However, an increasing number of other micro-organisms have been studied with respect to stress proteins and temperature shock (Table I). In Section V the proposed correlation between heat-shock proteins and acquired thermotolerance will be examined. Acquired thermotolerance is the most characteristic physiological response of micro-organisms subjected to a mild temperature shock. Incubation for relatively short periods at non-lethal temperatures induces synthesis of heatshock proteins and produces transient tolerance to normally lethal temperatures. This phenomenon is known as “heat-shock acquisition of thermotolerance”. The heat-shock response can be observed in microorganisms which grow over a wide range of temperatures. However, the magnitude and nature of the response varies with the temperature stress. In E. coli, a relatively mild temperature upshift from 28-30°C to 36-42°C results in a transient increase in synthesis of hsps, while a marked temperature upshift from 28-30°C to 47-5OoC, which is a lethal temperature range, results in almost exclusive synthesis of hsps with inhibition of normal protein synthesis (VanBogelen et al. 1987a,b).The more mild temperature stress induces a 2-20fold increase in synthesis of at least 17 polypeptides (Neidhardt et al., 1984; VanBogelen el al., 1987a,b). The increased rate of synthesis peaks after 5-15 minutes following the temperature stress and then declines to a steady-state level, somewhat greater than that at the initial growth temperature (Yamamori and Yura, 1982). Similar kinetics of synthesis of hsps are observed in Sacch. cereuisiae in response to temperature stresses. Temperature-sensitive cell-division-cycle mutants (Hartwell, 1974) undergo marked changes in the products of protein synthesis when cells grown at 23°C a permissive temperature, are shifted to
MICROBIAL STRESS PROTEINS
203
36"C, a restrictive temperature. Initial studies on the heat-shock response in Sacch. ceruisiue employed temperatures of 22-23°C for growth and 36-37°C for heat shock. Maximum rate of hsp synthesis peaked at 2&60 minutes following a heat shock, after which protein synthesis reached a new steadystate level, comparable to that of organisms grown continuously at 23 or 37'C (Miller et a/., 1979, 1982; McAlister et al., 1979). A temperature upshift from 25°C to above 42°C represents a severe heat stress that arrests cell division and results in cessation of protein synthesis within 40-60 minutes at 42°C (Piper vt al., 1986).On the other hand, a shift from 23 to 30°C does not result in any major alteration in the pattern of protein synthesis (McAlister et u/., 1979). In germinating conidia spores of N . crussu, a temperature upshift from 30 to 45'C induced rapid hsp synthesis, peaking after 30-60 minutes and rapidly declining thereafter (Plesofsky-Vig and Brambl, 1985). Parallel with this pattern of hsp synthesis, cells recovered their normal protein synthesis after about 90 minutes at 45°C or following a temperature shift down to 30°C. At higher temperatures (above 46"C), protein synthesis was not observed and, at 4748"C, hsp synthesis was inhibited by 95-100%. In summary, it is reasonably well established that, in a wide range of microorganisms as well as higher eukaryotes and mammalian cells, the kinetics of induction of hsps are remarkably similar. A relatively mild heat shock elicits increased synthesis of highly conserved proteins, these being the heat-shock proteins. Maximum rates of protein synthesis occur 5-60 minutes after the heat shock, after which there is a rapid decline concurrent with the onset of normal protein synthesis. This recovery period is variable but generally occurs 60-90minutes after incubation at the heat-shock temperature or at the normal growth temperature. Equally well established is the phenomenon of heatshock acquisition of thermotolerance. However, the crucial question as to a causal relationship between the appearance of heat-shock proteins and cell thermotolerance, is far from resolved. V. Acquired Thermotolerance
Acquired thermotolerance refers to the transient, non-heritable acquisition of resistance to a normally lethal temperature induced by a short prior exposure to a non-lethal heat shock. The phenomenon of thermotolerance has been extensively studied in mammalian cells. Studies have been primarily stimulated by increased interest in the use of hyperthermia by itself, or in conjunction with radiation and chemotherapy, as treatments for certain cancers. The results and conclusions of these studies have been conflicting, particularly with respect to the role of hsps in the development of cell thermotolerance (Henle and Dethlefsen, 1978; Li and Mivechi, 1986; Subjeck and Shyy, 1986; Carper et al., 1987; Landry et a/., 1987, and references therein).
204
K WAISON
Some of these discrepancies can be attributed to variation in experimental protocols such as measurement of cell thermotolerance. In addition, differences in intrinsic resistance of various tissue-culture cell lines (normal and tumour) need to be addressed. Recent evidence has pointed to possible involvement of hsp70 (Li and Laszlo, 1985), hsp27 (Landry et uf., 1989) and calcium ions (Landry et ul., 1988) in development of thermotolerance in mammalian cells. The situation with regard to a correlation between hsp appearance and the acquisition of thermotolerance in micro-organisms is no less equivocal. It has been known for many years (e.g. Elliker and Frazier, 1938) that the temperature of incubation influences the ability of bacteria to withstand a subsequently more-severe heat stress. The question as to the function of hsps in microbial resistance to temperature stress has arisen relatively recently, since the late 1970s. Initial studies with Succh. cerevisiue indicated a close relationship between rate of synthesis of hsps (using hsplOO as a measure of hsp synthesis) and heat-shock acquisition of thermotolerance to a challenge of 52°C for five minutes (McAlister and Finkelstein, 1980). However, critical examination of the data highlights a key parameter which is rarely probed with respect to such experiments, namely the kinetics of the loss of thermotolerance following prolonged incubation of cells at either the heatshock temperatures (e.g. 37°C) or during recovery at normal growth temperatures (e.g. 25°C). From the data of McAlister et ul. (1979) and McAlister and Finkelstein (1980), it can be estimated that, following a fourhour incubation at the heat-shock temperature (37"C), the level of hsplOO was approximately 80% of the maximum level observed after two hours at 37°C. However, the kinetics of loss of thermotolerance were such that, after onehour incubation following a heat shock, there was a marked decrease in thermotolerance (McAlister and Finkelstein, 1980)which essentially reverts to normal thermotolerance after incubation for four hours (Hall, 1983; Cavicchioli and Watson, 1986). Interestingly, thermotolerance can be reinduced by a heat shock at appropriate periods at least up to eight hours following the initial heat shock (Cavicchioli and Watson, 1986). It is evident, therefore, that there is little correlation between the amount of hsp synthesized, at least as reflected by hsp100, and loss of thermotolerance in Sacch. cereuisiue. The likelihood that hsplOO in Succh. cerevisiue is involved in thermotolerance was made untenable by gene-cloning experiments. Under conditions where hsplOO represented up to one-fifth of the total protein synthesized during a temperature shift from 23 to 3 6 T , no effect on synthesis of other major hsps and no alteration in the phenotypic response of heatshock acquisition of thermotolerance were noted (Finkelstein and Strdusberg, 1983). Furthermore, SDS-PAGE indicated that high levels of the major hsps in Succh. cereuisiue were present at least up to four hours after a heat shock
MICROBIAL S1 RESS PROTEINS
205
(Watson et al., 1984).More quantitative data to include levels of the different hsps are required to confirm these observations. Close examination of available data on E. coli and Sal. typhimurium shows similar anomalies between induction of hsp synthesis and acquisition of transient thermotolerance. In E. coli, the heat-induced (3M3"C) increase (10fold) in the rate of synthesis of the groEL protein peaked at 5-10 minutes and then rapidly declined to a steady-state level somewhat higher (five-fold) than observed at the initial temperature (30°C). Acquired thermotolerance, tested after an exposure to 55°C for 10 minutes, peaked (10% survivors) after 30 minute incubation at 42°C and then declined to a steady-state level approaching the endogenous value (less than 1 YOsurvivors) after two hours at 42°C. Related to these studies, a temperature-sensitive mutant defective in the rpoH heat-shock regulator gene was shown to be unable to produce an effective increase in hsp synthesis at 42°C and rapidly died at the challenge temperature of 55°C (Neidhardt and VanBogelen, 1981 ;Yamamori and Y ura, 1982). Recent studies (Kusukawa and Yura, 1988) using a series of temperature-resistant revertants of an rpoH strain have demonstrated a correlation between the maximum permissive growth temperature and levels of the major groES, groEL and dnaK heat-shock proteins. On the other hand, E. c d i carrying the tinaK756 mutation, although more thermosensitive than the wild type at 5 2 T , showed heat-shock acquisition of thermotolerance comparable to that of the wild type (Ramsay, 1988). These results suggest therefore that, although the dnaK protein has no or little effect on induced thermotolerance, it may have a protective effect during heat inactivation or growth at high temperatures. Acquired thermotolerance in E. coli can be induced by stresses other than a temperature shock, including addition of ethanol, cadmium chloride or hydrogen peroxide (VanBogelen et al., 1987a). It is noteworthy that, of these stresses, only ethanol induced a similar pattern of hsp synthesis to that produced by a temperature upshift (VanBogelen et af., 1987a). Exposure of cells to cadmium chloride induced six, and hydrogen peroxide only one, out of 17 of the heat-inducible polypeptides found in E. coli. It was noteworthy that the hydrogen peroxide-induced protein with a molecular mass of 62.5 kDa was also induced by ethanol and cadmium chloride. This hsp shows considerable homology with hsp90 of Sacch. cerevisiae and hsp83 of D. melanogaster (Bardwell and Craig, 1987). A most intriguing observation with E. coli was that, under conditions in which the pattern of hsps was comparable to that following a mild heat shock, no induced thermotolerance was found. These results were obtained by addition of isopropyl-B-D-thiogalactopyranoside(IPTG) to cells containing multiple copies of the rpoH gene under the control of the IPTG-inducible promoter. Although interpretation of these results is debatable, they
206
K WATSON
nevertheless call into question the role of hsps in acquired thermotolerance. VanBogelen et al. (1987a)have proposed that thermotolerance and heat shock are two distinct inducible states. The former they believe is a transient state associated with resistance to a high lethal temperature, while the latter is a more permanent state necessary for physiological adjustment to growth at an elevated but non-lethal temperature. Heat-shock acquisition of thermotolerance in Sal. typhimurium (Mackay and Derrick, 1986) was reported to differ from the transient state observed with E. coliand Sacch. cerevisiac. In these experiments, a mild heat shock from 37 to 42”C, 45°C or 48”C, as anticipated, resulted in resistance to a lethal temperature challenge of 55°C for 25 minutes. Unexpectedly, the resistance, following incubation at the appropriate heat-shock temperature, did not rapidly decline. On the contrary, thermotolerance persisted for at least 10 hours and, even after prolonged (31-hour) incubation a t 42,45 or 48”C, cell survival at the challenge temperature was 3.6, 11.9 and 0.15%, respectively, compared with 0.001% for control cells that were not heat-shocked. It should be noted, however, that the experimental conditions differed in two important aspects from those usually described for E. coli and Sacch. cerevisiae. The heat shock was relatively small (3742”C, 45°C or 48°C) and, more importantly, stationary-phase cells were used as opposed to logarithmicphase cells. The differences may thus be more a reflection of experimental protocol rather than an intrinsic difference in the heat-shock response between Sal. typhimurium and E. coli or Sacch. cerevisiae. In the experiments with Sal. typhimurium, data on changes in the rate of synthesis and the amounts of individual hsps following the heat shocks would have been extremely informative. It is well established that stationary-phase or “old” cells are intrinsically more resistant than logarithmic-phase or “young” cells to various stresses. In Sncch. cerevisiae, for example, logarithmic-phase cells are much more thermosensitive than stationary-phase cells (Schenberg-Frascino and Moustacchi, 1972; Parry et al., 1976; Walton et al., 1979). Furthermore, the heat-shock response in logarithmic and stationary-phase cells of Sacch. cerevisiae is also significantly different. Logarithmic-phase cells respond to a mild heat shock in the established manner by acquiring a transient resistance to a lethal temperature challenge. Stationary-phase cells, on the other hand, exhibit intrinsic thermal resistance relative to logarithmic-phase cells and, consequently, the heat-shock acquisition of thermotolerance is less marked. Kapoor (1986) has also observed, in N . crassa, that mycelial age is an important factor in the ability of cells t o mount a heat-shock response, which declines noticeably in older mycelia. Experiments in which amino-acid analogues and inhibitors of protein synthesis were used to probe the relationship between hsps and acquired
MICROBIAL STRESS PROTEINS
207
thermotolerance have confused rather than clarified the issue. In early experiments, McAlister and Finkelstein (1980) reported that pretreatment of Sacch. cereuisiae with cycloheximide inhibited heat-shock acquisition of thermotolerance. Similarly, in N . crussa, cycloheximide inhibited acquired thermotolerance (Plesofsky-Vig and Brambl, 1985) and, in E. coli, chloramphenicol had a similar effect (Yamamori and Yura, 1982).Contrary to these observations, Hall (1 983) reported that, in Sacch. cereuisiae, pretreatment of cells with cycloheximide at a concentration sufficient to block protein synthesis by more than 99% did not inhibit heat-shock acquisition of thermotolerance. The experiments of Watson et al. (1 984) showed that Sacch. cereuistue, pre-incubated (1 5 minutes) at 23°C and then subjected to a mild heat shock (37°C for 30 minutes), both in the presence of cycloheximide, acquired a thermotolerant state. An important aspect of the experimental protocol was that viability of cells was measured by the methylene-blue procedure (Lee et al., 1981).Under the conditions of heat stress, it is possible that this method gave a different measure of cell survival as compared with the standard plate-count method which measured cell growth and reproduction. Experiments using the latter procedure showed a low but significant and reproducible acquisition of thermotolerance in cells pretreated with cycloheximide (K. Watson and R. Cavicchioli, unpublished results). These results indicate that, although hsps may not be required for cell survival following a short exposure to a lethal temperature, they may be required for cell recovery and growth following such a heat stress. In a series of papers, Hallberg and his associates (Hallberg et al. 1985; Hallberg, 1986; Kraus et al., 1986) distinguished two mechanisms for thermotolerance in Tetrahymena thermophila. The ability of cells to survive a short-term (one hour) exposure to a temperature (43°C) a few degrees above the maximum for growth did not require hsp73 or hsp80, synthesis of which was blocked by cycloheximide. However, long-term (more than one hour) survival at 43°C or a brief exposure to 46"C, a temperature well above the maximum for growth, depended on continuous synthesis of the two hsps. Stimulation of stress-protein synthesis does not always correlate with acquisition of thermotolerance. In Sacch. cereuisiae, for example, induction of stress-protein synthesis by exposure of cells to amino-acid analogues at 23°C does not confer the thermotolerant state (Hall, 1983).On the other hand, the presence of analogues before and during a mild heat shock led to the thermotolerant state. Similarly, in T.pyriformis, induction of hsp synthesis by canavanine, an analogue of arginine, did not confer thermotolerance (Jones and Findly, 1986). However, a prior incubation with or without canavanine during a heat shock led to the thermotolerant state. It is noteworthy that mammalian systems respond in a similar manner when exposed to amino-acid analogues (Li and Laszlo, 1985).
208
K WATSON
It could be reasoned that incorporation of amino-acid analogues into induced hsps, as well as into other cell proteins, would render them nonfunctional. Analogue-substituted hsp could not therefore confer upon cells the characteristics of acquired thermotolerance. However, it would be difficult to reconcile this argument with observations on Succh. cereuisiue (Hall, 1983)and T. pyrgormis (Jones and Findly, 1986) in which apparently non-functional hsps rendered cells thermotolerant. Anomalous observations have also been reported for arsenite-induced hsp synthesis and acquired thermotolerance. In experiments on T. pyriformis subjected to arsenite stress followed by challenge at 39°C acquisition of thermotolerance was not conferred by the presence of heat-shock and arsenite-inducible proteins with molecular masses of 92 kDa and 35 kDa, respectively, or by those belonging to the two major groups of 7&75 kDa and 25-29 kDa (Amaral et ul., 1988). In these experiments, arsenite-treated cells were no more thermotolerant to a 39°C challenge than control cells. By contrast, cells exposed to a mild heat shock (34°C for 30 minutes) acquired tolerance to a 39°C challenge. Under these conditions, two additional proteins with molecular masses of 46 and 58 kDa, not noted in arsenite-treated cells, were induced in the heat-shocked cells. Presumably, these two proteins play a key role in acquired thermotolerance. By comparison, in higher eukaryotes arsenite has been observed to induce hsp synthesis and thermotolerance in some instances (Li, 1983; Lee and Hahn, 1988) but not in others (Landry and Chretien, 1983). Table 2 summarizes available data on various stresses which lead to transient thermotolerance in micro-organisms. It should be noted that, with some micro-organisms, agents known to induce thermotolerance induce hsps and conversely agents known to induce hsps also induce thermotolerance. Ethanol stress, for example, falls into this category. Furthermore, in Succh. cereuisiue (Watson and Cavicchioli, 1983)and E. coli(Travers and Mace 1982), a mild heat shock induced a marked but transient tolerance to high concentrations of ethanol. Although a causal relationship among heat shock, ethanol tolerance, thermotolerance and hsp is thus implied, the response varied in detail in different micro-organisms. Ethanol induces all 17 heatinducible polypeptides in E. coli (VanBogelen et ul., 1987a), a number of hsps in Succh. crreuisiue (Plesset ef ul., 1982)and only two (hsp80 and hsp35), in N . crussu (Roychowdhury and Kapoor, 1988). This discussion serves to highlight the equivocal experimental data relating to stress-protein synthesis and acquired thermotolerance. It should be admitted that anyone who is not thoroughly confused with the current literature does not understand the present contradictions. It is clear that the widely different stresses and equally variable experimental protocols adopted have contributed to some of these contradictions. In addition, consideration
209
MICROBIAL STRESS PROTEINS
TABLE 2. Treatments leading to acquisition of thermotolerance in micro-organisms Treatment
Thermotolerance
Escherrchiu coli 28 to 42°C for I5min
50°C for 30min
VanBogelen er ul. (1987b)
Ethanol (10%) for I5 min at 28°C
50°C for 30min
VanBogelen ef a/. (l987b)
Hydrogen peroxide (70pgml-I) for 60min at 28°C
50°C for 30min
VanBogelen et ul. (1987b)
CdC1,(600 PM) for I5 min at 28°C
50°C for 30min
VanBogelen
30 to 42°C for 30min
55°C for 10min
Yamamori and Yura (1982)
My.~ococcusxunrhus 28 to 36°C for 60min
40°C for 60min
Nelson and Killeen (1986)
Neurosporu crussu 30 to 45°C for 60min
50°C for 2 h
Plesofsky-Vig and Brambl (1985)
Succhuromyces cerevisiue 23 t o 37°C for 30min
52°C for 5min
McAlister and Finkelstein ( 1 980). Watson el ul. (1 984)
23 to 37°C for 60min
52°C for 8min
Hall (1983)
Ethanol (8%) for 20min at 23’C
49°C for 1Omin
Plesset et ul. ( 1 982)
Paromom ycin
50°C for Smin
Grant
Tetruhymenu rhermophilu 30 to 40°C for 60min
43°C for 60min
Hallberg
U.stilago muydis 32 to 42°C for IOmin
48°C for Smin
Taylor and Holliday (1 984)
Ultraviolet radiation ( I O O J m-’)
48°C for 5 min
Taylor and Holliday (1984)
Reference
1’1
ul. (198717)
el u/. (1989)
el
al. (1985)
should be given to variations in stress-protein synthesis with respect to the cell-division cycle and growth phase as well as developmental-stage dependence on stress resistance. The transient nature of the heat-shock acquisition of thermotolerance should be given more consideration as should the kinetics of recovery of cells from stress. Considerable attention has been given, in the past, to the relationship between the rate of hsp synthesis, heat shock and thermotolerance. There are few data available concerning quantitative changes in hsps with respect to these parameters.
210
K WATSON
Many of the reported differences may simply be due to strain variation, including variability in the intrinsic stress resistance of micro-organisms and mammalian cell-tissue culture. Cell ploidy is another variable which should be examined. In Sacch. cerevisiae, intrinsic heat resistance is independent of cell ploidy, but heat-shock acquisition of thermotolerance is not, haploid cells being the most thermotolerant followed by diploids and tetraploids (Piper et al., 1987). Finally, the experimental conditions usually adopted, i.e. a rapid temperature shift to a higher, non-lethal temperature followed by a short exposure to a generally lethal temperature, may bear no relationship to real environmental stresses to which organisms would normally be exposed. Living organisms are more likely to experience a gradual temperature increase (heat shock) as a result of changes in their environment. The kinetics of hsp synthesis and acquired thermotolerance under these conditions are thus likely to be quite different from published data. On the other hand, it is inconceivable, given the highly conserved nature of stress proteins, that the heat-shock response is a laboratory artifact. In this context it may be noted that, in the parasitic protozoa Trypanosoma brucei(Lawrence and Robert-Gero, 1985; Hunter et al., 1984; Van der Ploeg et al., 1985)and Leishmania major (Van der Ploeg et al., 198S),a temperature shift from the insect vector, at 22-28"C, to a mammalian host at 37°C elicits a typical heat-shock response. Similarly, the dimorphic fungal pathogen Histoplasma capsulatum exists in a mycelial form in the soil and as a yeast in infected hosts. Heat-shock proteins are synthesized following the transition from the mycelial to the yeast phase, brought about by a typical heat shock from 25 to 3440°C (Shearer et al., 1987).
VI. Immune Response
Mycobacterial infections, particularly those associated with Mycobacterium leprae and M. tuberculosis, which are the causative agents of leprosy and tuberculosis, respectively, are major health problems world-wide. Generation of monoclonal antibodies to mycobacterial proteins has resulted in characterization of a number of major protein antigens (see references quoted in Shinnick, 1987, and Young, 1988).Among the major immunogenic proteins of mycobacteria are 65 kDa and 70-71 kDa antigens. Young and his associates (Young, 1988; Young et al., 1987, 1988; Mehlert and Young, 1989) reported that mycobacterial protein antigens exhibit remarkable sequence homology to prokaryotic and eukaryotic stress proteins. The mycobacterial7 1 kDa protein antigens (carboxy-terminal) exhibited 40% amino-acid sequence homology with the corresponding region (residues
MICROBIAL STRESS PROTEINS
21 1
451-618) of the E. coli dnaK protein, thus indicating that the M . tuhercukosis and M. leprae 71 kDa antigens are both members of the highly conserved stress proteins belonging to the hsp70 family. The 65 kDa antigen is the best-characterized strongly immunogenic protein, eliciting antibody and T-cell responses associated with mycobacterial infections (Young, 1988).The amino-acid sequences of the 65 kDa antigens of M . tuberculosis and M. leprae are essentially identical (Mehra et al., 1986; Shinnick, 1987)and remarkably homologous with the groEL protein, a major stress-inducible protein in E. coli. In addition, Young et al. (1 988) pointed out a significant sequence homology between the 18 kDa antigen in M . leprae and the soybean 17 kDa heat-shock protein. The analogy between the mycobacterial protein antigens and stress proteins is further supported by the presence in the mycobacterial65 kDa protein of a presumptive heat-shock promoter consensus sequence at the - 10 and - 35 regions (Young, 1988). Vodkin and Williams (1988) also identified a heatshock promoter sequence in a major antigen of Coxiella hurnetii, the causative agent of Q fever. Furthermore, amino-acid sequence analysis revealed that the protein antigen of C. burnetii was 55% homologous with the mycobacterial 65 kDa protein. Recent evidence utilizing a rat model system for adjuvant-induced arthritis has demonstrated a role for the mycobacterial 65kDa stress protein in stimulation of auto-immune responses (Res et al., 1988; Van Eden et al., 1988). Holoshitz et al. (1989) recently described the isolation of T-cell-receptorbearing lymphocytes from the synovial fluid of a rheumatoid arthritis patient. These T-lymphocyte clones, which were isolated from an auto-immune inflammatory site, responded specifically to mycobacterial antigens. Similarly, Modlin et a/.(1989) isolated T-cell-receptor lymphocyte lines from leprosy skin lesions which responded in uirro to mycobacterial antigens. Further evidence supporting the general finding that human lymphocytes and T cells respond to mycobacterial antigens, specifically to the 65 kDa protein, has been presented by Haregewoin et al. (1989).On the basis that eukaryotic and prokaryotic hsps share antigenic properties, the authors speculated that the same immune cell line that has evolved to remove damaged or stressed cells in homeostasis has, in addition, developed the ability to mount an immune response by recognizing similar antigens from invading micro-organisms. Stress proteins belonging to the hsp70 family have also recently been identified as antigens recognized during the immune response to parasitic protozoan infections. An antigen (75 kDa protein) of Plasmodium falciparum, a causative agent of malaria, shows more than 60% amino-acid homology with hsp70 from D. melanogaster, with some regions showing more than 80% homology (Bianco et al., 1986; Ardeshir et al., 1987).Many parasitic protozoa have biphasic life cycles that include the insect vector and the mammalian
212
K. WATSON
host. Adaptation of the protozoa involves extreme differentiation and almost certainly includes a temperature upshift from the insect host (22-28°C) to the homeothermic mammalian host (37°C). The latter constitutes a classic heatshock response that could be an important signal in differentiation of the parasitic protozoa for adaptation in the mammalian host. A regulatory role for heat-shock genes during differentiation in the parasitic protozoa Trypanosoma brucei (Hunter et al., 1984; Lawrence and Robert-Gero, 1985; Van der Ploeg et al., 1985)and Leishmania spp. (Van der Ploeg et al., 1985)has been demonstrated. More recently, major antigens from parasites responsible for leishmaniasis (Smith et al., 1988),schistosomiasis (Headstrom et af., 1987) and filariasis (Selkirk et al., 1987)have been sequenced and shown to be closely related to hsp70. Dimorphic pathogenic fungi, which shuttle between mycelial and yeast forms, have also been shown to increase synthesis of hsp during temperature-induced differentiation from the mycelial (saprophitic) to the yeast (pathogenic) forms (Shearer et al., 1987). It has been postulated that stress-protein synthesis could be a characteristic feature of bacterial infection (Young, 1988). The relatively hostile environment experienced by phagocytes, for example, could stimulate synthesis of stress proteins by invading bacteria. These proteins in turn could stimulate the host immune system. The highly conserved nature of stress proteins with invading bacteria and host-harbouring homologous stress proteins raises the intriguing possibility of auto-immune regulation of self-protein, with possible serious pathogenic consequences. Equally, it could be argued that continuous exposure to self-stress proteins could induce tolerance to invading bacteria. On the other hand, it is likely that the host immune response is directed towards species-specific variable regions in the bacterial stress proteins. In summary, there are increasing data identifying stress proteins as major immune-response targets in a number of human pathogens and infectious diseases. It is intriguing that both host and invading pathogen have common epitopes that are recognized by antibodies and T lymphocytes. Further studies relating stress proteins, infection and immunity are likely to prove extremely rewarding.
VII. Protein Assembly and Translocation The findings that one of the mammalian hsp70 family is a protein involved in ATP-catalysed uncoating of clathrin-coated vesicles (Chappell et af., 1986) and that the glucose-regulated protein grp78 (60% homology with hsp70; Munro and Pelham, 1986)is identical with the immunoglobulin heavy-chainbinding protein (bip) led to speculation that heat-shock proteins may be involved in re-assembly of protein structure and consequent restoration of
MICROBIAL STRESS PROTEINS
213
function (Pelham, 1986). The grp78 and grp94 proteins were originally identified as mammalian proteins which are induced when cells are starved of glucose (Shiu et al., 1977). More recently, it has been demonstrated that grps can be induced under a variety of stress conditions (Lee, 1987; Watowich and Morimoto, 1988).It is evident from recent work that grp78 and grp94, which are localized in the endoplasmic reticulum, are related to hsp70 and hsp90, respectively. Amino-acid sequence homology studies revealed a 60% identity between grp78 and hsp70 (Munro and Pelham, 1986; Hendershot er al., 1988) and a 50% homology between grp94 and hsp90 (Mazzarella and Green, 1987; Sorger and Pelham, 1987). Furthermore, the observation that grp78 is identical with bip (Munro and Pelham, 1986) was an important clue as to possible functions for stress proteins. A homologue of the mammalian BiPIGRP78 gene has very recently been identified as the KAR2 gene in Sacch. cereuisiae (Normington et al., 1989; Rose eta/., 1989),which is a member of the yeast Hsp70 gene family. While the yeast KAR2 gene is heat-shock inducible, the mammalian BiPIGRP78 is not (Normington el al., 1989).Conversely, BiPIGRP78 is inducible by agents, such as calcium ions, ionophores and /3-mercaptoethanol (Lee, 1987; Kim and Lee, 1987),which do not induce hsp70 synthesis. There is ample evidence that the presence of misfolded proteins in the endoplasmic reticulum is associated with synthesis of bip/grp78 (Bole et al., 1986; Gething et a/., 1986; Dorner et al., 1987; Kozutsumi et a/., 1988; Gething and Sambrook, 1989). Kassenbrock rt a/. (1988) have demonstrated that bip can differentiate between native and abnormal proteins and can form tight complexes with misfolded or aberrantly glycosylated polypeptides. Association of bip with misfolded forms of the influenza virus haemoglutin precursor (Hurtley et al., 1989)adds further to the concept that bip and related stress proteins may play key roles in intracellular transport of correctly folded proteins. Although the function of grp94 is lesswell understood, the observation that it is found in complexes with a variety of proteins (Deshaies et u/., 1988a) would suggest a similar physiological role to that of grp78. Support for this concept comes from recent evidence that grp78 and grp94 have common positive transcription factors (Chang et al., 1989)and are co-ordinately regulated (Lee, 1987). The dnaKlhsp70 and groEL/hsp60 proteins have been identified as a family of prokaryotic and eukaryotic proteins which facilitate intracellular protein transport and post-translational assembly of oligomeric proteins. These proteins, which have been termed “molecular chaperones” (Ellis, 1987), have been shown to play an important role in folding and assembly of proteins imported into mitochondria and the endoplasmic reticulum. McMullin and Halberg (1987, 1988) described a highly evolutionarily conserved mitochondrial protein which was induced by heat shock in T. thermophila. The protein, termed hsp58, was homologous to the groEL protein in E. coli and
214
K.WATSON
displayed antigenic similarity with mitochondrially located proteins in Sacch. cereuisiae, frog, maize and human cells. Characterization of the equivalent hsp60 stress protein in Sacch. cereuisiae (Reading et al., 1989)revealed the presence of an amino-terminal extension of about 22 amino-acid residues, typical of many mitochondrial targeting peptides (Attardi and Schatz, 1988). Cheng el a/. (1989) demonstrated that mutants of Sacch. cereuisiae defective for constitutive expression of hsp60 accumulated incompletely processed proteins imported into the mitochondrial matrix. Very recently, Ostermann et al. (1989) have reported that proteins, once imported into mitochondria, do not refold spontaneously and that the hsp60 stress protein is involved in correct folding of such imported proteins. One function of hsp60 is thus envisaged as the capture of unfolded proteins following translocation across the mitochondrial membrane, consequently preventing formation of misfolded proteins. Comparison of the predicted products of the Hsp60 in Sacch. cerevisiae and GroEL genes in E. coli showed 54% amino-acid homology whereas comparison with the a-component of the Rubisco plant-binding protein showed 43% identity (Reading et af., 1989). The latter is an abundant chloroplast protein associated with assembly of the oligomeric Rubisco enzyme. Similarly, the groEL gene product is required for bacteriophage-head assembly in E. coli (Sternberg, 1973; Georgopoulos and Hohn, 1978) while, more recently, Bochkareva et al. (1988) reported transient association of the groEL protein with unfolded newly synthesized pre-&lactamase and chloramphenicol acetyltransferase. A requirement for groEL and groES stress proteins in assembly of prokaryotic Rubisco in E. coli was recently demonstrated by Goloubnikoff et a/. (1989). It was noteworthy in these experiments that heat shock of E. coli harbouring an Anacystis nidulans Rubisco expression plasmid not only increased synthesis of the groEL protein but also resulted in a six-fold increase in specific activity of Rubisco. These observations are consistent with the suggestion that stress proteins may have a general role in protein folding and solubilization of protein aggregates (Pelham, 1986).A possible correlation between the stress response and protein folding in E. coli has recently been demonstrated by Parsell and Sauer (1989) who reported that misfolded protein induced synthesis of typical heat-shock proteins including groEL, dnaK and C62.5. The close amino-acid homology of the bacterial groEL protein and the plant Rubisco-binding protein led to the proposed term “chaperonin” for this class of proteins (Ellis, 1987; Hemmingsen et al., 1988). It has been proposed that chaperonins act by preventing formation of misfolded proteins which might arise during protein synthesis, translocation of proteins across membranes and recovery from stress such as heat shock. An important feature of chaperonins is that they do not form part of the final assembled protein.
MICROBIAL STRESS PROTEINS
215
Their role in protein assembly and translocation, although essential, is a transient one. A role for stress proteins of the hsp70 family in protein translocation has also recently been demonstrated. Mutants of Sacch. cerevisiae depleted of a subset of hsp70 polypeptides (Ssal, Ssa2 and Ssa4) accumulated precursor forms of proteins normally targeted for importation into the endoplasmic reticulum and mitochondrial membranes (Deshaies et a/., 1988b). In a related observation, Chirico et al. (1988) reported that highly purified hsp70 proteins (Ssal, Ssa2) stimulated protein translocation across microsomal membranes. Importation of M 13 procoat protein into microsomes has also recently been shown to be stimulated by purified members of the hsp70 family (Zimmermann et al., 1988). An additional soluble component that improves the efficiency of protein translocation into mitochondria (Murakami et al., 1988)and microsomes (Chirico et al., 1988;Zimmermann et al., 1988)seems to be required. A prerequisite for protein translocation across membranes is a degree of protein unfolding (Rothman and Kornberg, 1986; Attardi and Schatz, 1988; Hart1 et al., 1989). One function of hsp70 stress proteins may therefore be to interact with tightly folded cytosolic or nascent proteins to produce a translocation-competent open conformation essential for import into the mitochondria or endoplasmic reticulum. Once the unfolded proteins are translocated into the appropriate membrane compartment, a mechanism for protein refolding into functional domains is required. The eukaryotic hsp60 stress protein and the homologous prokaryotic groEL protein, acting in conjunction with ATP, are likely participants in protein folding and assembly in mitochondria and the bacterial cytosol, respectively. In the microsomal system, the hsp70-related stress protein bip/grp78, which is localized in the endoplasmic reticulum, could function in an analogous manner to hsp60 and the groEL protein. The recently described hsp7O protein Sscl, located in mitochondria in Sacch. cerevisiae (Craig et al., 1989), could also conceivably function in facilitating assembly of protein complexes following translocation across the mitochondrial inner membrane. VIII. Summary
There is general agreement that a function, perhaps the major function, of stress proteins under normal physiological conditions is to help assembly and disassembly of protein complexes and to catalyse protein-translocation processes. It remains unclear, however, as to what role these processes play in stressed cells. It could be that cells under stress produce abnormal, misfolded or otherwise damaged proteins and that increased synthesis of stress proteins
216
K. WATSON
is required to counter protein modifications. A role for stress proteins in recovery of cells from stress, as opposed to a role in helping cells to withstand a lethal stress, is thus suggested. The intracellular location of stress proteins, in the unstressed and stressed cell, is worthy of further studies. Members of the hsp70 family are associated with the cytosol, mitochondria and endoplasmic reticulum. There is evidence, particularly from studies on mammalian cells (Tanguay, 1985; Welch and Mizzen, 1988; Arrigo et ul., 1988),that following stress hsps migrate to various cellular compartments and subsequently delocalize after stress. However, there is little comparable data from microbial systems for this phenomenon (e.g. Rossi and Lindquist, 1989). The question as to the role of stress proteins in the transient acquisition of thermotolerance remains to be answered. It is insufficient to equate the kinetics of stress-protein synthesis with acquisition of thermotolerance. Quantitative data on the amount of stress protein present at various times, including the recovery period, is required. The demonstration that microbial stress proteins are important antigenic determinants of micro-organisms causing major debilitating diseases in the world is an exciting observation. Studies on the interplay of pathogen and host, both carrying similar antigenic hsp determinants, will be a challenging area for future research. It is likely that E. coli and Succh. cereoisiae, with their well-established biochemical and genetic properties, will continue to be the experimental systems of choice for studies on stress proteins. On the other hand, it is encouraging that studies on other micro-organisms have expanded in the past few years and have made substantial contributions towards our understanding of the stress response. The ubiquitous nature of the stress response and the remarkable evolutionary conservation of the stress proteins continue to be attractive areas for research.
IX. Acknowledgements I wish to thank Jon Lewis and Robin Hesketh for critical comments on the manuscript and Jean Hansford and Robyn Curry for preparation of the manuscript. REFERENCES Alcina, A., Urzainqui, A. and Carrasco, L. (1988). European Journal of Biochemistry 172, 121. Allan, B., Linesman, M., MacDonald, L. A,, Lam, J. S. and Kropinsk, A. M. (1988). Journal qf Bacteriology 170, 3668. Amaral, M. D., Galego, L. and Rodrigues-Pousada, C. (1988). Europeun Journal of Biocheniistry 171, 463. Ananthan, J., Goldberg, A. L. and Voellmy, R. (1986). Science 232, 522.
MICROBIAL STRESS PROTEINS
217
Ardeshir, F., Flint, J. E., Richman, J. and Reese, R. T. (1987). EMBO Journal 6, 493. Arnosti. D. N., Singer, V. L. and Chamberlin, M. J. (1986). Journal qf Bacteriology 168, 1243. Arribas, C., Sampedro, J. and Izquierdo, M. (1986). Biochimica ei Biophysica Acta 868, 119. Arrigo, A-P., Suhjan, J. P. and Welch, W. J. (1988). Molecular and Cellular Biology 8, 5059. Ashburner, M. and Bonner, J. J. (1979). Cell 17, 241. Atkinson, B. G. and Walden, D. B. (eds) (1985). “Changes in Eukaryotic Gene Expression in Response to Environmental Stress”. Academic Press, London. Attardi, G . and Schatz, G. (1988). Annual Review of Cell Biology 4, 289. Bardwell, J. C. A. and Craig, E. A. (1984). Proceedings ofthe National Academy qfScienres e f t h e United States of America 81, 848. Bardwell, J. C. A. and Craig, E. A. (1987). Proceedings ofthe National Academy of‘ Sciences qfthe United States of America 84, 5177. Bianco, A. E., Favaloro, J. M., Burkot. T. R., Culvenor, J. G., Crewther, P. E., Brown, G. V., Anders, R. F., Copel, R. L. and Kemp, D. J. (1986). Proceedings of’ the National Acadeniy of Sciences of the United States of America 83, 8713. Bienz, M. (1985). Trend.7 in Biochemical Sciences 10, 157. Bienz, M. and Pelham, H. R. B. (1987). Advances in Genetics 24. 31. Bloch, C. A. and Ausubel, F. R. (1986). Journal of Bacteriology 168, 795. Bochner, B. R., Lee, P. C., Wilson, S. W., Cutler, C. W. and Ames, B. N. (1984). Cell 37, 225. Bochkareva, E. S., Lissin, N. M. and Girshovich, A. S. (1988). Nature, London 336, 254. Bole, D. G., Hendershot, L. M. and Kearney, J. F. (1986). Journal of Cell Biology 102, 1558. Bonato, C. M., Silva, A. M., Gomes, S. L., Maia, J. C. C. and Juliani, M. H. (1987). European Journal qf Biochemistry 163, 21 1. Bond, U. and Schlcsinger. M. J. (1985). Molecular and Cellular Biology 5. 949. Bond, U. and Schlesinger, M. J. (1987). Advances in Generics 24, I . Borbely, G., Suranyi, G., Koroz, A. and Palfi, Z . (1985). Journal of Bacteriolugy 161, 1125. Boucherie, H. (1985). Journal of Bacteriology 161, 385. Brandi, G.. Sestili, P., Pedrini, M. A,, Salvaggio, L., Cattabeni, F. and Cantoni, 0.(1987). Mutation Research 190, 237. Burdon, R. H. (1986). Biochemical Journal240, 313. Cadenas. F . (1989). Annual Review of Biochemistry 58, 79. Carlioz, A. and Touati, D. (1986). EMBO Journal 5, 623. Carlson, N. and Rechsteiner, M. (1987). Journal of Cell Biology 104, 537. Carlson, N., Rogers, S. and Rechsteiner, M. (1987). Journal qf Cell Biology 104, 547. Carper, S. W., Duffy, J. J. and Gerner, W. E. (1987). Cancer Research 47, 5249. Cavicchioli, R. and Watson, K . (1986). FEBS Letters 207, 149. Chang, S. C., Erwin, A. E. and Lee, A. S. (1989). Mulecular and Cellular Biology 9, 2153. Chappell, T. G., Welch, W. J., Schlossman, D. M., Palter, K. P., Schlesinger, M. J. and Rothman, J. E. (1986). Cell, 45, 3. Chary, P. and Natvig, D. 0. (1989). Journal qf Bacteriology 171, 2646. Cheng. M. Y.,Hartl, F.-U., Martin, J., Pollock, R. A,, Kalovsek, F., Neupert, W., Hallberg, E. M., Hallberg, R. L. and Horwich, A. L. (1989). Nature, London 337, 620. Chin, D. T., Goff, S. A,, Webster, T., Smith, T. and Goldberg, A. L. (1988). Journal of Biological Chemistry 263, 1 1 7 18. Chirico, W. J., Waters, M. G . and Blobel, G. (1988). Nature, London 332, 805. Christman, M. F., Morgan, R. W., Jacobson, F. S. and Ames, B. N. (1985). Cell 41, 753. Chung, C. H. and Goldberg, A. L. (1981). Proceedings ofthe National Academy qf Sciences of rhe United States of Americu 78, 493 1. Coias, R., Galego, L., Barahona, 1. and Rodrigues-Pousada, C. (1988). European Journal of Biochemi.ytry 175, 467. Courgeon, A.-M., Rollet, E., Becker, J., Maisonhaute. C. and Bet-Belpomme, M. (1988). European Journal of Biochemistry 171, 163. Cowing, D. W., Bardwell, J. C. A., Craig, E. A., Woolford, C., Hendrix, R. W. and Gross, C. A. (1985). Proceedings of the National Academy of Sciences of the United Stares of America 82, 2679. Craig, E. A. (1985). CRC Critical Reviews in Biochemistry 18, 239.
218
K. WATSON
Craig, E. A., Kramer, J. and Kosic-Smithers, J. (1987).Proceedings ofthe National Academy of Sciences ofthe United Slates of America 84, 4156. Craig, E. A., Slater, M. R., Boorstein, W. R. and Palter, K. (1985).UCLA Symposium on Molecular Biology 30,659. Craig, E . A., Kramer, J., Shilling, J., Werner-Washburne, M.. Holmes, S., Kosic-Smithers, J. and Nicolet, C. M. (1989).Molecular and Cellular Biology 9,3000. Curle, C. A. and Kapoor, M. (1988).Biochemistry and Cell Biology 66, 81. Dabrowa, N. and Howard, D. H. (1984).Infection and Immunity 44,537. Daniels, C. J., McKee, A. H. Z. and Doolittle, W. F. (1984).EMBO Journal 3, 745. Deshaies, R. J., Koch, B. D. and Schekman, R. (1988).Trends in Biochemical Sciences 13, 384. Deshaies, R. J., Koch, B. D., Werner-Washburne. M., Craig, E. A. and Schekman, R. (1988). Nature, London 332, 800. Dorner, A. J., Bole, D. G. and Kaufman, R. J. (1987).Journal of Cell Biulogy 102,2665. Einsenstark, A. and Perot, G . (1987).Molecular and General Genetics 207, 68. Elliker, P. R. and Frazier, W. C. (1938).Journal of Bacteriology 36, 83. Ellis, J. (1987).Nature, London 328, 378 Farr, S. F., DAri, R. and Touati, D. (1986).EMBO Journal5, 623. Farrell, F. W.and Finkelstein. D. B. (1984).Journal of Biological Chemistry 259, 5745. Fayet, 0.. Ziegelhoffer, T. and Georgopoulos, C. P. (1989).Journal of Bacteriology 171, 1379. Finkelstein, D.B. and Strausberg, S. (1983).Journtrl uf’ Biological Chemistry 258, 1908. Finkelstein, D. 8.. Strausberg, S. and McAlister, L. (1982).Journal qf Biological Chemi.stry 258, 1908. Finley, D. and Varshavsky, A. (1985).Trends in Biochemical Sciences 10, 343. Finley, D., Ozkaynak, E. and Varshavsky, A. (1987).Cell 48. 1035. Finley, D., Ozkaynak, E., Jentsch, S., McGrath, J. P., Bartel, B., Pazin, M., Snapka, R. M. and Varshavsky, A. (1988).I n “Ubiquitin” (M. Reichsteiner, ed.), pp. 39-76. Plenum Press, New York. Finley. D., Bartel. B. and Varshavsky, A. (1989).Nature, London 338, 394. Fridovich, I. (1978).Annual Reuiew of Biochemistry 4, 147. Fridovich, I. (1986).Archives of Biochemistry and Biophysics 247, I. Galego, L. and Rodrigues-Pousada, C. (1985).European Journal of Biochemistry 149, 571. Galiazzo, F.,Schiesser, A. and Rotilio. G. (1987).Biochemical and Biophysical Research Communications 147, 1200. Georgopoulos, C. P. (1977).Molecular and General Genetics 151, 35. Georgopoulos. C. P. and Hohn, B. (1978).Proceedings of the National Academy uf Sciences of the United States qf America 75, 13 1. Gething, M. J. and Sambrook, J. (1989).Biochemical Society Symposium 55, 155. Gething. M. J., McCammon. K. and Sambrook, J. (1986).Cell, 46, 939. Giorda, R. and Ennis, H. L. (1987).Molecular and Cellular Biology 6, 2097. Glass, T.L., Holmes, W. M., Hylemon, P. B. and Stellwag, E. J. (1979).Journal of Bacteriology 137. 956. Goebi, M. G., Yochem. J., Jentsch, S., McGrath. J. P.,Varshavsky, A. and Byers, B. (1988). Science 241, 1331. Go@,S. A., Casson, L. P. and Goldberg, A. L. (1984).Proceedings of the National Academy of Sciences ofthe United Slates of America 81, 6647. Goff, S. A. and Goldberg, A. L. (1985).Cell 41, 587. Goff, S. A. and Goldberg, A. L. (1987).Journal of Biological Chemistry 262, 4508. Goff, S. A., Voellmy, R. and Goldberg, A. L. (1988).In “Ubiquitin” (M. Rechsteiner, ed.), pp. 207-238.Plenum Press, New York. GoloubinoK, P., Gatenby, A. A. and Lorimer, G. H. (1989).Nature, London 337, 44. Gomes. S . L., Juliani, M. H., Maia, J. C. C. and Silva,A. M.(1986).JournalqfBacteriology168.923. Gorovsky. M. A.. Glover, C. V. C., Guttmann, S. D., Vaura, K. J., Horowitz, S. and Pederson, D. S. (1982).In “Heat Shock from Bacteria to Man” (M. J. Schlesinger, M. Ashburner and A. Tissieres, eds), pp. 299-308.Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Gottesman, S. and Zipser, D. (1978).Journal of Bacteriology 133, 844. Grant. C . M.,Firoozan, M. and Tuite, M. F. (1989).Molecular Microbiology 3, 215. Greenberg, J. T. and Demple, B. (1986).Journal of Bacteriology 168. 1026.
MICROBIAL STRESS PROTEINS
219
Groat, R. G. and Matin, A. (1986). Journal of Industrial Microbiology I, 69. Groat, R. G., Schultz, J. E., Zychlinsky, E., Bockman, A. and Matin, A. (1986). Journal of Bacteriology 168, 486. Guttman, S. D., Glover, C. V. C., Allis, C. D. and Gorovsky, M. A. (1980). Cell 22, 299. Gwynne, D. 1. and Brandhorst, B. P. (1982). Journal qf Bacteriology 149,488. Hackett, R. W. and Lis, J. T. (1983). Nucleic Acids Research I I , 7011. Hall, B. (1983). Journal of Bacteriology 156, 1363. Hallberg, R. L., Kraus, K. W. and Hallberg, E. M. (1985).Molecular and Cellular Biology 5,2061. Hallberg, R. L. (1986). Molecular and Cellular Biology 6, 2267. Halliwell, B. (1987). Federation qf the American Society,for Experimental Biology Journal I , 358. Halliwell, B. and Gutteridge, J. M. (1986). Archiues of Biochemistry and Biophysics 246, 501. Haregewoin, A., Soman, G., Horn, R. C. and Finberg, R. W. (1989). Nature, London 340, 309. Hartl, F.-U., Pfmner, N., Nicholson, D. and Neupert, W. (1989). Biochimica et Biophysicu A m 988, I. Hartwell, L. H. (1974). Bacteriological Reviews 38, 164. Headstrom. R.,Culpepper, P. J., Harrison, R. A., Abaigan, N. and Newport. G. (1987).Journal uf E.~-perinientaIMedicine 165, 1430. Hemmingsen, S. M., Woolford, C., van der Vies, S. M., Tilly, K., Dennis, D. T., Georgopoulos, C. P., Hendrix, R. W. and Ellis, R. J. (1988). Nature, London 333, 330. Hendershot, L. M., Ting, J. and Lee, A. S. (1988). Molecular and Cellular Biology 8, 4250. Henle, K. J. and Dethlefsen, L. A. (1978). Cancer Research 38, 1843. Herendeen. S. L., VanBogelen, R. A. and Neidhardt, F. C. (1979).Journalof Bucreriology 139, 185. Hershko. A. and Ciechanover, A. (1986).Progress in Nucleic Acid Research and Molecular Biology 33, 19. Hightower, L. E. (1980). Journul of Cellular Physiology 102, 407. Holden, D. W., Kronstad, J. and Leong, S. A. (1989). EMBO Journal8, 1927. Holoshitz, J., Koring, F., Coligan, J. E., De Bruyn, J. and Strober, S. (1989). Nature, London 339. 226. Hunter, K. W., Cook, C. L. and Hayunga, E. G. (1984). Biochemical and Biophysical Research Communications 125, 755. Hurtley, S. M., Bole, D. G., Hoover-Litty, H., Helenius, A. and Copeland, C. S. (1989).Journaluf Cell Biology 108, 21 17. Imlay, J. A. and Linn. S. (1986). Journal of Bacteriology 166, 519. Imlay, J. A. and Linn, S. (1987). Journal of Bacteriology 169, 2967. Imlay, J. A. and Linn, S. (1988). Science 240, 1302. Ito, K., Akiyama, Y., Yura, T. and Shiba, K. (1986). Journal of Bacteriology 167, 201. Jamison, C. S. and Adler, H. 1. (1987). Journal uf Bacteriology 169, 5087. Jenkins, D. E., Schultz, J. E. and Matin, A. 1988). Journal of Bacteriology 170, 3910. Jentsch, S.. McGrath, J. P. and Varshavsky. A. (1987). Noture, London 329. 131. Jerez, C. A. ( I 988). FEMS Microbiology Letters 56, 289. Jones, K. A. and Findly, R. C. (1986). Journul of Biological Chemistry 261, 8703. Jones, P. G., VanBogelen, R. A. and Neidhardt, F. C. (1987). Journal sf Bacteriology 169, 2092. Kapoor, M. (1982).Inrernu/iontrl Journul of' Biochemis/ry 15. 639. Kapoor, M. (1983). International Journal of Biochemistry 15, 639. Kapoor, M. (1986). Inrernarional Journal qf Biochemistry 18, 15. Kapoor, M. and Lewis, J. (1987a). Cunudian Journal of Microbiology 33, 162. Kapoor. M. and Lewis, J. (1987b). Biochemical and Biophysical Research Communications 147, 904. Kassenbrock, C. K., Garcia, P. D., Walter, P. and Kelly, R. B. (1988). Nature, London 333,90. Killeen, K. P. and Nelson, D. R. (1988). Journal of Bacteriology 170, 5200. Kim, Y. K. and Lee, A. S. (1987). Molecular and Cellular Biology 7, 2974. Kogoma, T., Farr, S. B., Joyce, K. M. and Natvig, D. 0. (1988). Proceedings r f t h e Narional Academ.v of Sciences of the United States of America 85, 4799. Kowitt, J. D. and Goldberg, A. L. (1977). Journal of Biological Chemistry 252, 1154. Kozutsumi. Y., Segdl. M.. Normington, K., Gething, M.-J., and Sambrook. J. (1988), Nuture, Lonilon 332. 462. Kraus, K. W., Hallberg, E. M. and Hallberg, R. L. (1986).Molecular and Cellular Biology 6,3854.
220
K. WATSON
Krueger, J. H. and Walker, G. C. (1984). Proceedings of the National Acadenfy of Sciences of the United States of America 81, 1499. Kurtz, S., Rossi, J., Petko, L. and Lindquist (1986). Science 221, 1154. Kusukawa, N. and Yura, T. (1988). Genes and Development 2, 874. Kuymdzhieva-Savova, A., Savov, V. A., Genova, L. K. and Peikova, S. P. (1985). FEMS Microbiology Letters 21, 103. Lambert, E., Cowan, D. and Piper, P. W. (1988). FEMS Microbiology Letters 56, 157. Landry, J. and Chretien, P. ( 1983). Canadiun Journal (JfBiochemixtry and Cell Biology 61, 428.
Landry, J., Lamarche, S . and Chretien, P. (1987). In “Thermotolerance” (K.J. Henle, ed.), pp. 145-174. CRC Press, Boca Raton, Florida. Landry, J., Crete, P., Lamarche, S . and Chretien, P. (1988). Radiation Research 113, 426. Landry, J., Chretien, P., Lambert, H., Hickey, E. and Weber, L. A. (1989). Journal of Cell Biology 109,7.
Latchman, D. S., Chan, W. L., Leaver, C. E. L., Patel, R., Oliver, P. and La Thangus, N. B. (1987). Comparative Biochemistry and Physiology 878, 961. Lawrence, F. and Robert-Gero, M. (1985). Proceedings of the National Academy of Sciences ofthe United States of America 82. 4414. Lee, P. C., Bochner, B. R. and Ames, B. N. (1 983). Proceedings of the National Academy of Sciences of the United States of America 80, 7496. Lee, A. S . (1987). Trends in Biochemical Sciences 12, 20. Lee, K . 4 . and Hahn, G. M. (1988). Journal ofCellular Physiology 136, 411. Lee, S . S., Robinson, F. M. and Wang, H. Y. (1981). Bioiechnoiogy and Bioengineering Symposium 11, 641.
Lee, F. J. and Hassan, H. M. (1985). Journal of Free Radicals in Biology and Medicine 1, 319. Lee, F. J. and Hassan, H. M. (1986). Journal of Industrial Microbiology 1, 187. Lee, F. J. and Hassan, H. M. (1987). Applied Microbiology and Biotechnology 26, 531. LeJohn, H. B. and Braithwaite, C. E. (1984). Canadian Journulof Biochemistry and Cell Biology 62, 837.
Lema, M. W., Brown, A., Butler, C. A. and Hoffman, P. S . (1988). Canadian Journal of Microbiology 34, 1148. Li, G. C. (1983). Journal of Cellular Physiology 115, 116. Li, G. C. and Laszlo, A. (1985). In “Changes in Eukaryotic Gene Expression in Response to Environmental Stress” (B. G. Atkinson and D. B. Walden, eds), pp. 349-371, Academic Press, London. Li, G . C. and Mivechi, N. F. (1986). In “Hyperthermia in Cancer Treatment” (L. J. Anghileri and J. Robert, eds), pp. 59-78. C R C Press, Boca Raton, Florida. Lindquist, S . (1986). Annual Review of Biochemistry 55, 1151. Lindquist, S . and Craig, E. A. (1988). Annual Review of Genetics 22, 631. Loewen, P. C. (1984). Journal of Bacteriology 157, 622. Loomis, W. F. and Wheeler, S. A. (1980). Developmental Biology 79, 399. Loomis, W. F. and Wheeler, S . A. (1982). Developmental Biology 90, 412. Mazzarella, R. A. and Green, M. (1987). Journal of Biological Chemistry 262, 8875. McAlister, L., Strausberg, S., Kulaga, A. and Finkelstein, D. B. (1979). Current Genetics 1, 67. McAlister, L. and Finkelstein, D. B. (1980). Biochemical and Biophysical Research Communica/ions 93, 8 19. McCallum, K. L., Heikkala, J. J. and h i s s , W. E. (1986). Canadian Journal of Microbiology 32, 516.
McMullin, T. W. and Hallberg, R. L. (1987). Molecular and Cellular Biology 7, 4414. McMullin. T. W. and Hallberg, R. L. (1988). Molecular and Cellular Biology 8, 371-380. Mackey, B. M. and Derrick, C. M. (1986). Journal of Applied Bacteriology 61, 389. Manrow, R. E. and Jacobson, A. (1987). Proceedings of the National Academy of Science.7 of the United States of America 84, 1858. Mehlert, A. and Young, D. B. (1989). Molecular Microbiology 3, 125. Mehra. V.. Sweelser, D. and Young, R. A. (1986). proceedings ofthe National Academy of Sciences nf the Uniled Stcites of America 83. 7013.
MICROBIAL STRESS PROTEINS
22 1
Meir, E. and Yagil. E. (1984). Curreni Microbiology 11, 13. Michel, G. P. F. and Starka, J. (1986). Journalof’Bacteriology 165, 1040. Miller, M. J., Xuong, N. H. and Guidushek, P. E. (1979). Proceedings ofthe National Academy of Sciences of the United States of America 76, 5222. Miller, M. J., Xuong, N. H. and Guidushek, P. E. (1982). Journal of Bacteriology 151, 31 1. Modlin, R. L., Pirmez, C., Hofman, F. M., Torigian, V., Uyemura, K., Rea, T. H., Bloom, B. R. and Brenner. M. B. (1989). Nature, London 339, 544. Morgan, R. W., Christman, M. F., Jacobson, F. S., Storz, G. and Ames, B. N. (1986).Proceedings#/ ihe National Academy of Sciences of the United Stales of America 83, 8059. Mues, G . I., Munn, T. Z. and Raese, J. D. (1986). Journal of Biological Chemistry 264, 874. Munro, S. and Pelham, H. R. B. (1986). CeN46, 291. Murakami, H., Pain, D. and Blobel, G. (1988). Journal Sf Cell Biology 107, 2051. Murphy, P., Dowds, B. C. A., McConnell, D. J. and Devine, K. M. (1987).Journalof Bacteriology 169. 5766. Neidhardt, F. C. and VanBogelen, R. A, (1981). Biochemical and Biophysical Research Communicaiions 100, 894. Neidhardt, F. C., VanBogelen, R. A. and Vaughn, V. (1984). Annual Review of Generics 18, 295. Neidhardt, F. C. and VanBogelen, R. A. (1987).In “Escherichia coli and Salmonella iyphimurium: Cellular and Molecular Biology”(F.C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter and H. E. Umbarger, eds), vol. 2, pp. 1334-1345. American Society for Microbiology, Washington DC. Nelson, D. R. and Killeen, K. P. (1986). Journal sf Bacieriology 168, 1100. Neves, A. M., Barahona, I., Galego, L. and Rodrigues-Pousada, C. (1988). Gene 73, 87. Nicholson, P., Osborn, R. W. and Howe, C. J. (1987). FEBS Letters 221, 110. Normington, K.. Kohno. K.. Kozutsumi. Y., Gehring. M. J. and Sambrook. J. (1989). Cell 57. 1223. Nover, L. (1984). “Heat Shock Response of Eukaryotic Cells”. Springer-Verlag, Berlin. Ostermann, J., Horwich, A. L., Neupert, W. and Hartl, F.-U. (1989). Nature, London 341, 125. Ozkaynak, E., Finley, D. and Varshavsky, A. (1984). Nature, London 312,663. Ozkaynak, E., Finley, D., Solomon, M. and Varshavsky, A. (1987). EMBO Journal 6, 1429. Palter, K., Watanase, M., Stinoon, L., Mahowald, A. and Craig, E. A. (1986). Molecular and Cellular Biology 6, 1 181. Parag, H. A,, Raboy. B. and Kulka, G. (1987). EMBO Journal, 6, 55. Pardue, M. L. (1988).Gcwcs und Dewlopniiw 2, 783. Pardue, M. L.. Seramisco, J. R. and Lindquist, S. L. eds (1989).“UCLA Symposium on Molecular and Cellular Biology”, vol. 96. Alan R. Liss, New York. Parry, J. M., Davies, P. J. and Evans, W. E. (1976). Molecular and General Genetics 146, 27. Parsell. D. A. and Sauer, R. T. (1989). Genes und Development 3, 1226. Pelham, H. R. B. (1986). Cell46, 959. Pelham, H. R. B. (1988). Nature, London 332, 716. Petko, L. and Lindquist, S. (1986). Cell 45, 885. Phillips. T. A., VanBogelen, R. A. and Neidhardt, F. C. (1984).Journal of Bacteriology 159, 283. Piper, P.W., Curran, B., Davies, M. W., Lockheart, A. and Reid, G. (1986).European Journalof Biochemistry 161, 525. Piper, P. W., Davies, M. W., Curran, B., Lockheart, A., Spalding, A. and Tuite, M. F. (1987). Current Genetics 11, 595. Plesofsky-Vig, N. and Brambl, R. (1985). Journal of Bacteriology 162, 1083. Plesset, J., Palm, C. and McLaughlin, C. S. (1982). Biochemical and Biophysical Research Communications 108, 1340. Privalle. C. T. and Fridovich, 1. (1987). Proceedings of the National Academy of Sciences of the United Stares of America 84, 2723. Qoronfleh, M. W. and Streips, U. N. (1987). FEMS Microbiology Leiters 43, 373. Ramsay, N. (1988). Molecular and General Genetics 211, 332. Reading, D. S., Hallberg, R. L. and Myers, A. M. (1989). Naiure, London, 337, 655. Rechsteiner, M. (1987). Annual Review of Cell Biology 3, 1. Rechsteiner, M. (1988). “Ubiquitin”. Plenum Press, New York.
222
K. WATSON
Redman, K. L. and Rechsteiner, M. (1989), Nature, London 338,438. Res, P. G . H., Schaar, C. G., Breedveld, F. C., Vanteden, W., Van Embden, J. D. A., Cohen, 1. R. and De Vries, R. R. P. (1988). Lancet ii, 478. Reuter, S. H. and Shapiro, L. (1987). Journal qf Molecular Biology 194, 653. Richter, A. and Hecker, M. (1986). FEMS Microbiology Letters 36,69. Ritossa, F. (1962). Experientia 18, 571. Rose, M. D., Misra, L. M. and Vogel, J. P. (1989). Cell 57, 121 1 Rosen, E., Sivertsen, A,, Firtel, R. A,, Wheeler, S. A. and Loomis, W. F. (1985). In “Changes in Eukaryotic Gene Expression in Response to Environmental Stress“(B. G . Atkinson and D. B. Walden, eds), pp. 257-258. Academic Press, London. Rossi, J. M. and Lindquist, S. (1989). Journal of Cell Biology 108, 425. Rothman, J. E. and Kornberg, R. D. (1986). Nature, London 322, 209. Roychowdhury, H. S. and Kapoor, M. (1988). Canadian Journal ?/Microbiology 34, 162. Saito, H. and Uchida, H. (1977). Journal of Molecular Biology 113, 1. Schellhorn, H. E. and Hassan, H. M. (1988). Canadian Journal of Microbiology 34, 225. Schenberg-Frascino, A. and Moustacchi, E. (1972). Molecular and General Generics 115, 243. Schlesinger, M. J., Aliperti, G. and Kelley, P. M. (1982a). Trends in Biochemical Sciences 6, 222. Schlesinger, M. J., Ashburner, M. and Tissieres, A., eds (1982b). “Heat Shock from Bacteria to Man”. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Schlesinger, M. J. 1986. Journal qf Cell Biology 103, 321. Schoffl, F., Baumann, G., Raschke, E. and Bevan, M. (1986). Philosophical Transactions ofthe Royal Society. London, Series B 314, 453. Schultz, J. E., Latter, G. 1. and Matin, A. (1988). Journal of Bacteriology 170, 3903. Schumann, J. P., Jones, D. T. and Woods, D. R. (1982). Journal of Bacteriology 151, 44. Schumann, J. P., Jones, D. T. and Woods, D. R. (1984). FEMS Microbiology Letters 23, 131. Scott, M. D., Meshnick, S. R. and Eaton, J. (1987). Journal of Biological Chemistry 262, 3640. Selkirk, M., Rutherford, P., Denham, D. A., Parton, F. and Maizels, R. (1987).Biochemical Society Symposium 53, 9 1. Sharp, P. M., and Li, W. H. (1987). Journal of Molecular Evolution 25, 58. Shearer, G., Birge, C. H., Yuckenberg, P. D., Kobayashi, G. S. and Medoff, G . (1987). Journalof General Microbiology 133, 3375. Shin, D-Y., Matsumoto, K., Iida, H., Uno, I. and Ishikawa, T. (1987). Molecular and Cellular Biology 7, 244. Shinnick, T. M. (1987). Journal of Bacteriology 169, 1080. Shiu, R. P. C., Pouyssegur, J. and Pastan, I. (1977). Proceedings of the Nationul Academy of Sciences OJthe United States of America 74, 3840. Sies, H. (1986). Angewandte Chemie, International Edition in English 25, 1058. Silver, J. C., Andrews, D. R. and Pekkala, D. (1983). Canadian Journal of Biochemistry and Cell Biology 61,447. Smith, M. W. and Neidhardt, F. C. (1983a). Journal of Bacteriology 154, 336. Smith, M. W. and Neidhardt, F. C. (1983b).Journal of Bacteriology 154, 344. Smith, D. F., Searle, S., Campo, A. J. R., Coulson, R. M. R. and Ready, P. D. (1988). Journal qf Cellular Biochemistry 12D, 296. Snow, A. and Hipkiss, A. R. (1987). Biochemical Society Transactions 15, 965. Sorger, P. K. and Pelham, H. R. B. (1987). Journal of Molecular Biology 194, 341. Spector, M. P., Alibadi, Z., Gonzalez, T. and Foster, J. W. (1986).Journal qf Bacteriology 168,420. Streips, U. N. and Polio, F. W. (1985). Journal qf Bacteriology 162, 434. Sternberg, N. (1973). Journal of Molecular Biology 76, 1. Subjeck, J. R. and Shyy, T.-T. (1986). American Journal of Physiology 250, C1. Suranyi, G., Korez, A., Palfi, Z. and Borbely, G. (1987). Journal of Bacteriology 169, 632. Swindle, J., Ajioka, J., Eisen, H., Sanwal, B., Jacquemot, C., Browder, Z. and Buck, G. (1988). EMBO Journal 7 , 1121. Taglicht, D., Padan, E., Oppenheim, A. B. and Schuldiner, S. (1987).Journal of Bacteriology 169, 885. Tanguay, R. M. (1983). Canadian Journal of Biochemistry and Cell Biology 61, 387. Tanguay, R. M. (1985). I n “Changes in Eukaryotic Gene Expression in Response to
MICROBIAL STRESS PROTEINS
223
Environmental Stress” (B. G. Atkinson and D. B. Walden, eds), pp. 91-1 13. Academic Press, London. Tanguay, R. M. (1988). Biochemistry and Cell Biology 66, 584. Taylor, S. Y. and Holliday, R. (1984). Current Genetics 9, 59. Terracciano, J. S., Rapaport, E. and Kashket, E. R. (1988). Applied and Emironmental Microbiology 54, 1989. Tissieres, A,, Mitchell, H. K. and Tracy, U. (1974). Journal of Molecular Biology 84, 389. Todd, J. A., Hubbard, T. J. P., Travers, A. A. and Ellar, D. J. (1985). FEBS Letters 188, 209. Travers, A. A. and Mace, H. A. F. (1982). In “Heat Shock from Bacteria to Man” (M. J. Schlesinger, M. Ashburner and A. Tissieres, eds), pp. 127-130, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Treger, J. M., Heichman, K. A. and McEntee, K. (1988). Molecular and Cellular Biology 8, I 132. Tyrrell, R. M. (1985). Mutation Research 145, 129. VanBogelen, R. A., Acton, M. A. and Neidhardt, F. C. (1987a). Genes and Development 1, 525. VanBogelen, R. A,, Kelley, P. M. and Neidhardt, F. C. (1987b). Journal sf Bacteriology 169.26. Van der Ploeg, L. H. T., Giannini, S. H. and Cantor, C. R. (1985). Science 228, 1443. Van Eden, W., Thole, J. E. R. van der Zee, R., Noordzij, A,, Van Embden, J. D. A., Hensen. E. J. and Cohen, I. R. (1988). Nature, London 331, 171. Van Loon, A. P. G., Pesold-Hurt, B. and Schatz, G .(1986). Proceedings ofthe National Academy qf Sciences of the United States of America 83, 3820. Verduyn, C., Giuseppin, M. L., SchelTers, W. A. and van Dijken, J. P. (1988). Applied and Environmental Microbiology 54,2086. Vodkin. M. H. and Williams, J. C. (1988). Journal qf Bacteriology 170, 1227. Walker, G. C. (1984). Microbiological Reviews 48, 60. Walker, G. (1987). In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology” (F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaefer and H. E. Umbarger, eds), vol. 2, pp. 1346-1357. American Society for Microbiology, Washington DC. Walkup, L. B. and Kogoma, T. (1989). Journal of Bacteriology 171, 1476. Walton, E. F., Carter, B. L. A. and Pringle, J. R. (1979). Molecular and General Genetics 171, 1 1 1 . Watowich, S. S. and Morimoto, R. 1. (1988). Molecular and Cellular Biology 8, 393. Watson, K. and Cavicchioli, R. (1983). Biotechnology Letters 5, 683. Watson, K., Dunlop, G. and Cavicchioli, R. (1984). FEBS Letters 172, 299. Watt, P. W. and North, M. J. (1987). FEBS Letters 215, 295. Weitzel, G., Pilatus, U. and Rensing, L. (1985). Experimental Cell Research 159, 252. Welch, W. J. (1987). Advances in Experimental Medicine and Biology 225, 287. Welch, W. J. and Mizzen, L. A. (1988). Journal of Cell Biology 106, 1117. Werner-Washburne, M., Stone, D. E. and Craig, E. A. (1987). Molecular and Cellular Biology 7. 2568. Westerbeek-Marres. C. A. M., Moore, M. M. and Autor, A. P. (1988). European Journal of Biochemistry 174, 6 1 1. Westpahl, M., Muller-Taubenberger, A,, Noegel, A. and Gerish, G. (1986). FEBS Letters 209,92. Wiborg, O., Pedersen, M. S., Wind, A,, Berglund, L. E., Marckar, K. A. and Vuust, J. (1985). EMBO Journal 4, 755. Wilhem, J. M., Spear, P. and Sax, C. (1982). In “Heat Shock from Bacteria to Man” (M. J. Schlesinger, M. Ashburner and A. Tissieres, eds), pp. 309-3 14, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Woods, D. R. and Jones, D. T. (1986). Advances in Microbial Physiology 28, I . Yamamori, T. and Yura. T. (1982). Proceedings of the National Academy qfSciences of‘the United Stales of Ameri1.a 79. 9860. Young, D. B. (1988). Microbiological Sciences 5, 143. Young, D. B., Ivanyi, J., Cox, J. H. and Lamb, J. R. (1987). Immunology Today 8, 215. Young. D. B.. Lathigra, R., Hendrix, R., Sweetser, D. and Young, R. A. (1988). Proceedings ofthe Nutional Acudemy qf Sciences of the United Stares of America 85, 4267. Zuethen, M. L., Dabrowa. N., Aniebo, C. M. and Howard, D. H. (1988). Journal of General Microhiology 134. 1375. Zimmermann. R., Sagstetter, M., Lewis, M. J. and Pelham, H. R. B. (1988). EMBO Journal7,2875.
This Page Intentionally Left Blank
Microbial Anaerobic Respiration ALAN D. MOODIE and W . JOHN INGLEDEW
.
Department of Biochemistry and Microbiology University of St Andrews. St Andrews KY16 9AL. U K
. . . . . . . . . . . . . . . 1. lntroduction A . Definition of anaerobic respiration . . . . . . . . 9. The organisms and their niches . . . . . . . . . I1 . General overview of the organization and function of respiratory chains A. The chemi-osmotic theory . . . . . . . . . . 9. Structure of respiratory chains . . . . . . . . . C. Thermodynamic considerations . . . . . . . . . . . . . . . . . . . . . . . 111. Methanogenesis A . Pathway of carbon dioxide reduction . . . . . . . . Methanogenesis utilizing formate . . . . . . . . . 9. C. Use of other C , compounds . . . . . . . . . . IV. Sulphate as a respiratory oxidant . . . . . . . . . . A . Sulphate reduction . . . . . . . . . . . . B. Substrates for catabolism and formation of a Ap . . . . . . . . . . . . . . . . . C. Sulphur reduction V. Fumarate respiration . . . . . . . . . . . . . A . Structure of fumarate reductase . . . . . . . . . 9. Coupling of fumarate respiration to ATP synthesis . . . . VI . Oxides of nitrogen as respiratory oxidants . . . . . . . . A . Nitrate reductase . . . . . . . . . . . . . 9. Nitrite reduction . . . . . . . . . . . . . C. Nitric-oxide reductase . . . . . . . . . . . D . Nitrous-oxide reductase . . . . . . . . . . . VII . Other anaerobic oxidants . . . . . . . . . . . . A. Trimethylammonium N-oxide reduction . . . . . . . B. Dimethyl sulphoxide reduction . . . . . . . . . C. Iron(ir1) reduction . . . . . . . . . . . . . VIII . Conclusions . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . .
.
. . . . . . .
. . . .
. . . .
. .
. .
. . . .
. . . . .
225 225 221 230 230 230 233 235 236 239 240 243 244 241 251 252 252 253 256 256 258 260 261 261 261 262 263 265 265
.
I Introduction A. DEFINITION OF ANAEROBIC RESPIRATION
What is meant by anaerobic respiration and what is required for it? Utilization of molecular oxygen as a respiratory oxidant by animals. plants and microorganisms and its regeneration by plants is both prominent and obvious to ADVANCES IN MICROBIAL PHYSIOLOGY. VOL. 31 ISBN 0-12-027731-X
Copyright 0 1990. by Academic Press Limited All rights of reproduction in any form ~ ~ e ~ e d
226
A. D. MOODIE AND
W.J. INGLEDEW
a student of the biological sciences. The oxygen is reduced to water by oxidation of foodstuffs resulting in a net release of energy. A portion of this energy can be harnessed and utilized by the organism through the processes of aerobic respiration and oxidative phosphorylation, i.e. biosynthesis of ATP. However, not all niches are aerobic, and a lack of oxygen in an environment leads to use of other potential respiratory oxidants. Nonetheless, the advantages of oxygen as a respiratory oxidant are great; hence utilization of alternative oxidants is generally confined to anaerobic niches and, therefore, microbes. An alternative oxidant must be a compound which is reducible by a biological system such that energy can be harnessed by the organism and neither the oxidant nor its reduced product are toxic at the concentrations required. Carbon dioxide, nitrate and sulphate are alternative oxidants of major environmental significance, their reduction playing significant roles in the global carbon, nitrogen and sulphur cycles, respectively. In microbial ore extraction, use of iron(rrr)as an alternative oxidant in the anaerobic parts of the leaching dumps is of economic importance and use of trimethylammonium N-oxide (TMAO)as a respiratory oxidant is important in spoilage of fish. These and other oxidants are crucial to the life forms which exploit these anaerobic niches. Growth of micro-organisms in an anaerobic environment may proceed by fermentation or by anaerobic respiration. These two modes of growth are not always wholly distinct; fermentation processes produce their own oxidants to balance NADH production and consumption, and in some cases these can be linked to the respiratory chain. Such a phenomenon is found in fermentative bacteria which produce succinate as a product. These produce fumarate first and then utilize a respiratory fumarate reductase to reduce it to succinate. Given an appropriate donor, reduction of fumarate to succinate (fumarate respiration) can support ATP synthesis. The definition of anaerobic respiration used herein is that of a respiratorychain redox process yielding ATP and utilizing an alternative oxidant to oxygen. The same thermodynamic principles which govern aerobic respiration apply, i.e. there must be a suitably large redox potential difference between the donor substrates and the oxidant to support cell maintenance and growth. Oxygen is ideal as a respiratory oxidant; it is readily available in a variety of niches and it can freely diffuse across lipid membranes. The product of oxygen reduction is water which is non-toxic and so will not give rise to product inhibition of the enzyme. Many of the alternative oxidants are much less ideal. Their availability may be confined to selected niches, they or the product of their reduction may be toxic, they are also likely to be less diffusible than 0, (if they are not gaseous) and may require additional transport systems for both the oxidant and product. Thermodynamically, the redox potential of many other oxidants will not be as oxidizing as the O,/H,O couple, so that less
MICROBIAL ANAEROBIC RESPIRATION
227
energy is made available to the cell. This is illustrated in Fig. 1 where the standard electrochemical spans exploited by different organisms in different growth modes are shown. In Fig. la, four representative respirations are shown. With reduction of nitrate and sulphate these diagrams do not tell the whole story for some organisms. The product of nitrate reduction, nitrite, is often further reduced; for sulphate it is an eight-electron reduction of sulphate to sulphide. Aerobically, the products of these anaerobic respirations can often be re-oxidized as indicated, sometimes by species which specialize in that role. Some redox potentials of other important organic and inorganic couples are shown in Fig. 1 b. Individually, some of these respirations are the subject of extensive reviews and even books; herein we can attempt only to outline, summarize and provide a bibliography. General reviews can be found in Anthony (1988), Ingledew and Poole (1984), Jones et af.(1987), Daniels et af. (1984), Keltjens and Van der Drift (1986),Odom and Peck (1984), Postgate and Kelly (1982) and Cole and Ferguson (1988). B. THE ORGANISMS AND THEIR NICHES
Anaerobic niches are found in soil, marshes, organic sludges, river beds, ocean floors and within various animals, especially in the gut. Anaerobic environments are normally formed by aerobes reducing any available oxygen. This is essential for obligate anaerobes because of the toxicity to them of even trace amounts of oxygen. Other anaerobes are facultative; they use oxygen preferentially as a respiratory oxidant, but resort to alternative oxidants when an anaerobic environment prevails. Some of the more common of the heterotrophic and chemoautotrophic couples are listed in Fig. l b with their mid-point potentials and n values. As already noted, anaerobic respiration utilizing oxides of nitrogen, sulphur and carbon play significant roles in their respective elemental global cycles. Oxides of nitrogen are major alternative oxidants. Starting with nitrate there are a number of end products depending on the organism (see Section VI). Denitrifying bacteria reduce oxides of nitrogen to nitrogen gas which returns to the atmosphere to be recycled to ammonium by nitrogen-fixing bacteria. Dissimilatory reactions carried out by bacteria in the nitrogen cycle can be coupled to respiration as alternative oxidants allowing ATP synthesis. Most of these bacteria, in the anaerobic phase of the nitrogen cycle, have been classified as eubacteria because of sequence homologies within their 16s ribosomal RNA. Some other bacteria, such as Escherichia cofi, although not denitrifiers can reduce nitrate as far as nitrite and nitric oxide by utilizing the respiratory chain. Nitrate can also be reduced to ammonium. This reaction is generally assimilatory, involving enzymes which are cytoplasmic, and a coupled respiratory process is not involved.
228
A. D. MOODIE A N D W. J. INGLEDEW
-500
-
H, NAOH
NAD*
NAOH
H*
NAO,
Eh (mvI VALUE
0-
I I
W
m
4
FUMARATE
SUCCINATE
II 1
*so0
-
1000
-
-I
I
FIG. I. (a) Comparison of the thermodynamics of aerobic and some anaerobic respirations. The y axis indicates the approximate Eh values of donor and acceptor couples. On the extreme left, aerobic oxidation of NADH is illustrated. Next to this the solid line describes nitrate respiration wherein nitrate is reduced to nitrite. The dotted line indicates aerobic oxidation of nitrite by which the chemoautotroph Nitrobacter sp. lives. The third respiration is that of fumarate (solid line). The product, succinate, can support aerobic respiration in many systems (dotted line). On the right, a number of aerobic and anaerobic respirations are compounded. Sulphate respiration utilizes hydrogen (solid line). The hydrogen sulphide produced can be re-oxidized by the thiobacilli either aerobically or utilizing nitrate respiration (Thiobacillus denitrijicans).
Sulphate can serve as a respiratory electron acceptor being reduced through a series of steps to hydrogen sulphide. This contributes to the anaerobic phase of the global sulphur cycle. The majority of sulphate-reducing bacteria are classified as eubacteria. The aerobic phase of the sulphur cycle is contributed to by the thiobacilli which re-oxidize hydrogen sulphide to sulphate (Postgate and Kelly, 1982; Fig. la). Carbon dioxide and other C1compounds can also be utilized as respiratory oxidants in processes that lead to production of methane. The bacteria which catalyse this process are the methanogens. Relatively little is known of their
MICROBIAL ANAEROBIC RESPIRATION
229
(b) -500
b, *V) VALUE A P S A W
0
+
FUMARATE+-~UCCINATE
sw
.WOO 2NO
N,O N,O
AN*
.1W
FIG. I-contd. The half reactions of the couples are not balanced. The dotted lines show how products of anaerobic respiration can be re-oxidized by various organisms under aerobic conditions. (b) Mid-point potentials of important donor and acceptor couples in anaerobic respiration. The n value of each reaction is indicated in parentheses. As shown, the equations are chemically incomplete. DHAP, dihydroxyacetone phosphate; a-GP, a-glycerophosphate; OAA, oxaloacetate; DMS, dimethylsulphide; DMSO, dimethylsulphoxide; TMAO, trimethylammonium oxide; TMA, trimethylamine; APS, adenosine phosphosulphonate; AMP, adenosine monophosphate; NAD', nicotinamide adenine dinucleotide.
respiratory systems although Section 111 deals with the chemistry of methanogenesis. They are difficult bacteria to work with (Daniels et al., 1984). The methane that is produced by their activity may be re-oxidized at the aerobic interface by methylotrophs or may escape into the atmosphere. It has been claimed that release of methane into the atmosphere by this process has increased due to the activities of man (creating anaerobic environments through waste disposal) and that this contributes to global warming.
230
A. D. MOODIE AND W. J. INGLEDEW
11. General Overview of the Organization and Function of Respiratory
Chains A. THE CHEMI-OSMOTIC THEORY
In the late 1950s and early 1960s Mitchell developed the chemi-osmotic hypothesis to explain coupling of respiration to ATP synthesis (Mitchell, 1961; Nicholls, 1982). There are a number of criteria to be met within this hypothesis, principally that the respiratory system must be embedded in a closed relatively proton-impermeable membrane. Other requirements include: (1) a proton-translocating electron-transport chain; (2) a proton-translocating ATPase; (3) membrane-carrier systems to control movement of ions and metabolites across the membrane. These requirements have been shown to be met in respiring systems and form the basis for current thinking in this field. A schematic diagram of the process is illustrated in Fig. 2. A number of bacteria contain elements of both systems (a) and (b) in Fig. 2. The level of complexity of debate on chemi-osmosis has risen over the years such that mechanistic (and not unimportant semantic) controversies continue. However, the chemi-osmotic model is appropriate, sufficient and established in the context of the requirements of this review. An overview of the theory and the thermodynamics of these processes is included later in this review as these set the limits on possible pathways and models of anaerobic respiration. The principles which govern oxidative phosphorylation are generally applicable, hence an outline of the aerobic mitochondria1 respiratory chain is presented as a reference point. B. STRUCTURE OF RESPIRATORY CHAINS
In a respiratory chain, reducing equivalents are transferred from a substrate through a series of individual redox centres of overall increasing potential to the respiratory oxidant. In mitochondria, these individual redox centres may be flavins, iron-sulphur centres, quinones, cytochromes and copper (in approximately ascending order of potential). In bacterial systems, additional types of centres such as molybdenum, nickel and more-complex quinones, such as pyrroloquinoline quinone, can also function (for an overview see Anthony, 1988). The redox centres are incorporated into protein complexes within the membrane, some of which have been found to constitute coupling sites (Fig. 2). The concept of a coupling site is a useful holdover from the prechemi-osmosis theories. It corresponds to an ATP-synthesizing segment (a proton-translocating segment) of the respiratory chain. These are generally
- *M1
[SITE 0)
- 200 SITE 1 Eh lmV1 VALUE 0
SITE t '200
+400
sm 3
CY
1
HEHBRAPE
FIG. 2. Organization and structure of respiratory chains. Construction of mitochondria-like (a) and Escherichia coli-like (b) respiratory chains is illustrated. An Eh value scale is included on the left to illustrate the Ehrange of the coupling sites and some half couples. (a) The mitochondria-like respiratory system is shown comprising of site 0 - 3 as described in the text. An ATPase is also included although this has no reference to the Eh scale. C indicates cytochrome c and Q, quinone. (b)(i) The Escherichia coli-like system shows site 1 (such as one of the NADH dehydrogenases (1) and formate dehydrogenase) and a single site encompassing mitochondria1 sites 2 and 3. In addition, a number of dehydrogenases, including succinate and NADH dehydrogenase (2), can feed in at the level of quinone, Q, or menaquinone, MQ. The oxidoreductases, cytochromes ho or hd, then constitute the terminal segment of the respiratory chain. (ii) A nitrate reductase (NR) can function as an alternative oxidant for quinol. This contributes to a Ap by release of protons periplasmically from quinol oxidation and consumption of protons cytoplasmically with nitrate reduction. (iii) Fumarate reductase (FR) activity, although not itself proton translocating, can support proton translocation by acting as an acceptor for reducing equivalents passing through a site-1 dehydrogenase.
232
A. D MOODIE A N D W. J. INGLEDEW
delimited into three spans of the available Eh range; from low potential substrates to quinone, from quinone to cytochrome c and from cytochrome c to oxygen (Fig, 2a). In mitochondria, the respiratory system can be resolved, in both functional and protein-chemical terms, into coupling sites and complexes. Site 0 is the energy-linked transhydrogenase which has been described in mitochondria and some bacteria including Escherichia coli and Paracoccus denitrificans. Being energy linked, it is proton translocating and contributes to the proton-motive force when operating in the NADH-forming direction (Ingledew and Poole, 1984). However, its normal function is to provide NADPH for biosynthesis. This membrane-bound transhydrogenase is devoid of redox prosthetic groups. A distinct soluble transhydrogenase, not associated with energy coupling, it contains a flavin and is present in some bacteria (Ingledew and Poole, 1984; Jones, 1988). Site 1 is the energy-linked coupling site for NADH, and in bacteria other low-potential substrates. It corresponds to the NADH dehydrogenase or complex I. This site transfers reducing equivalents from NADH to a quinone with concomitant transmembrane proton translocation, a process with a AE, value of about - 320 mV (from about - 320 mV to about 0 mV, ordinate of Fig. 2). In bacterial systems, a greater diversity in dehydrogenases is observed. A few bacteria have similar respiratory chains to the mammalian system but even these retain additional features which give extra flexibility. The prosthetic groups found in this low-potential region of the respiratory chain are generally flavins and iron-sulphur centres. A number of bacterial dehydrogenases which transfer reducing equivalents across the potential span of about -300mV to approximately OmV can be coupled and thought of as constituting a site 1. In E. coli, malate dehydrogenase and formate dehydrogenase are energy linked and proton pumping (Garland et al., 1975; Ingledew and Poole, 1984).Many micro-organisms can synthesize respiratory NADH dehydrogenases which lack site- 1 coupling; this alternative is shown in Figs 2bi and ii. In mitochondria, complex I1 is succinate dehydrogenase and is not a coupling site. The Em, value of the succinate/fumarate couple is, at + 30 mV, too high for site-1 energy coupling. The reducing equivalents are transferred to quinone. Some other dehydrogenases are similarly linked to the respiratory chain, i.e. they feed their reducing equivalents to quinone without site 1 coupling. As previously noted, some variants of NADH dehydrogenase and the a-glycerol-phosphate dehydrogenase in E. coli (not NAD' linked) are in this category. The succinate/fumarate couple can operate as a respiratory oxidant (fumarate succinate); this enzyme, fumarate reductase, is very similar to succinate dehydrogenase (Fig. 2biii). Coupling site 2 in mitochondria corresponds to the cytochrome hc, --f
MICROBIAL ANAEROBIC RESPIRATION
233
complex (complex 111). At this site, reducing equivalents are transferred from quinones, through bound quinones, cytochromes and an iron-sulphur centre (Rieske), to a cytochrome c with accompanying proton translocation. The potential range is from around OmV to approximately 300mV (Fig. 2). A cytochrome be, complex is also found in some bacteria, e.g. Paracoccus denitr@cans (see Jones, 1988, for bacterial electron-transport chain arrangements). Escherichia coli has no complex 111 but does achieve energy coupling from quinol oxidation. Often, in bacteria site 2 and site 3 are combined as one site transferring reducing equivalents from quinone to oxygen in a single complex. The quinol :oxygen oxidoreductases cytochrome bo and bd in E. coli fall into this category (Poole and Ingledew, 1987; Fig. 2bi). Other bacteria may contain both the mammalian and the E. coli types of system. In E. coli, cytochrome bo has been reported to be a proton pump (Puustinen et al., 1989) whereas cytochrome hd is thought not to be; nonetheless, cytochrome bd contributes to proton movements by transmembrane separation of its proton generating and consuming reactions (for reviews, see Ingledew and Poole, 1984; Poole and Ingledew, 1987; Anraku and Gennis, 1987). Finally, in mitochondria and some bacteria, reducing equivalents pass from cytochrome c to oxygen via a cytochrome-c oxidase (cytochrome uu3 or Complex IV) with proton translocation in addition to transmembrane separation of oxidation of cytochrome c and reduction of oxygen, making this a third coupling site (Wikstrom et al., 1981). In bacterial systems an aa3- type cytochrome oxidase with proton-pumping activity has been found in P. denitriJicans (Solioz et al., 1982). Respiration through the systems already described move protons from the inner phase to the outer; these return via the ATP synthase (an ATPase). This is the membrane-bound enzyme which couples synthesis and hydrolysis of ATP to movement of protons across the coupling membrane. The direction of their movement is determined by the magnitude of the Ap (proton electrochemical potential). The process works by utilizing the Ap as a driving force for inward movement of protons across the membrane. Hydrolysis of ATP by this enzyme pumps protons out of the cytosol and into the bulk phase so maintaining a Ap when it is low (Fig. 2a). C. THERMODYNAMIC CONSIDERATIONS
The Ap arises through respiratory-chain-driven proton translocation from one compartment, the cytoplasm (bacterial) or matrix (mitochondrial), to the outer compartment, the exterior bulk phase (bacteria) or cytosol (mitochondrial). Movement of protons involves movement of both charge and chemical entity; thus there are two component forces to the Ap, an electrical
234
A. D. MOODIE A N D W. J. INGLEDEW
component and a concentration component. The concentration (chemical) term is usually expressed as ApH and the electrical component (the membrane potential, A$) as mV. The forces are related (Mitchell, 1966, 1968):
The magnitude of Ap, the redox potential difference between couples (AEh where AEh= Ehdonor - Ehaccep,or) and the number of protons translocated for each electron pair (H+/2e-) are related by
The proton-motive force can be utilized by a number of transport processes but the principal one is driving proton transport linked to ATP synthesis. The number of protons translocated for each molecule of ATP synthesized is the H+/ATP ratio and is related to Ap and the free energy of hydrolysis of the terminal phosphate ester of the ATP by AGATp < -(H+/ATP)FAp.
(3)
The AGATp value is usually expressed in kJ mol-’ and the Ap value in mV. Thus a conversion factor is required in calculations (this is the joule equivalent of the faraday; F= 0.0965 kJ mol-’ mV-’). The two ratios H+/2e- and H+/ATP cover generation of the Ap and its utilization, respectively, so they can be divided to give the overall ATP/2e- ratio for the respiratory process [(H+/2e-) x (ATP/H+)]. The H+/ATP ratio in bacterial systems is about 3 (Kell, 1986) and the Hf/2e- value will be determined by the number of coupling sites involved in the respiratory process; this will be a function of the AE, available. By substituting equation 2 into equation 3 we get equation 4 which relates the AGATp value attainable to the AE,, available. The two forces being “geared” together by the ATP/2e- ratio: AGATp < - F6Eh/(ATP/2e-).
(4)
The quoted values for mid-point potentials are pH-value dependent for reactions involving protons and it is the Ehwhich determines the driving force. One of the largest AE, values utilized is that available to Afkafogenes eutropha growing on hydrogen and oxygen with a AE, value of approximately -1240mV. A survey of the literature indicates that the narrowest thermodynamic limits which can support cell growth are approximately - 350 mV. This is observed in some chemo-autotrophs such as Thiobaciflus ,ferrooxidans growing aerobically on iron(rr) and Nitrobacter sp. growing
MICROBIAL ANAEROBIC RESPIRATION
235
aerobically involving oxidation of nitrite to nitrate (Ingledew, 1982; Haddock and Hamilton, 1977). 111. Methanogenesis
Methanogens are anaerobes which respire to produce methane. They are found in a variety of anaerobic niches including the rumen of animals, anoxic areas of the sea and lakes, as well as Man-made environments such as sludges (Large, 1983). Methane is produced from the respiratory reduction of simple carbon compounds such as carbon dioxide and is generally known as marsh gas, being associated with anaerobic marsh, foul smells and explosive dangers. Methanogens have been classified as archaebacteria (Woese, 1987). They are all strict anaerobes and in terms of their carbon dioxide fixation fall somewhere between the autotrophs and heterotrophs. Fixation of carbon dioxide does not proceed via the Calvin cycle, hexulose phosphate cycle or serine pathway but via phosphoenolpyruvate carboxylase, pyruvate synthase and 2-oxoglutarate synthase, the last two requiring a unique reductant (Large, 1983). Thirteen genera of methanogens have been reported. These are: Methanosarcina, Methanobacterium, Methanogenium, Methanoplanus, Methanolobus, Methanococcoids, Methanothermus, Methanothrix, Methanospirillum, Methanohrevibacter, Methanococcus, Methanosphaera and Methanomicrobium (Jones et al., 1987). Methanogenic bacteria have devised unique pathways for harnessing energy from their simple substrates and possess unique coenzymes and ATP-synthesizing mechanisms. For reviews see Daniels et al. (l984), Wolfe (1985), Keltjens and Van der Drift (1 986), Jones et al. ( I 987) and Lancaster ( 1 987). The substrates used by the methanogens are mainly simple C , compounds, utilization of acetate being an exception. Carbon monoxide, carbon dioxide, hydrogen, formate, methanol, methylamines and acetate can be used as oxidants, and often (by a “disproportionation”) as reductants, e.g. formate can be both reductant and oxidant (see,p.239). A given methanogen will not utilize all of these compounds; there are species differences in specificities. Carbon dioxide is the most oxidized of the C , compounds and the classic electron acceptor for these organisms. The final product of the respiratory reduction is methane. This eight-electron process (from carbon dioxide) is catalysed by a complex multi-enzyme pathway. The biochemistry and physiology of the respiratory processes and mechanisms of energy coupling are not well resolved in these bacteria. Many of the enzymes are very labile in the presence of oxygen, making any study difficult. Those that have been studied are often unique. The available evidence suggests that respiration leading to methane production generates a Ap for
236
A D. MOODIE AND W. J. INGLEDEW
ATP synthesis and hence growth (Daniels et al., 1984; Blaut and Gottschalk, 1985). There is also one hypothesis which includes substrate-level phosphorylation (Lancaster, 1986).
A. PATHWAY OF CARBON DIOXIDE REDUCTION
C O , + 8[H] +CH,
+ 2H,O
(5)
Equation 5 shows the simplest situation for a methanogen, namely reduction of carbon dioxide to methane by transfer of eight reducing equivalents. The overall Em,for the CH, couple is -244mV. This potential is relatively low compared with other alternative electron acceptors discussed in this review. The most common substrate combination used to grow methanogens is hydrogen as a reductant with carbon dioxide as the terminal electron acceptor and carbon source (equation 6). CO,
+ 4H, + CH, + 2H,O
Using hydrogen as a source of electrons the above equation gives a AE, value of approximately - 176 mV; thermodynamically, this is the most advantageous for these organisms. From equation 4, it can be calculated that this is insufficient a drop in AEm value to make an ATP molecule from an electron pair (if AC,,, is to be maintained at approximately - 50 kJ mol- I). Most of the enzymes involved in this respiratory process are cytoplasmic or loosely bound to the membrane (Jones el ul., 1987), although a membrane-bound hydrogenase has been identified (Doddema et al., 1979). The membranes of hydrogen/carbon dioxide-grown cells also appear to lack cytochromes and quinones (Kuhn et al., 1983; Balch et al., 1979). There is thus a problem as to how the process can be arranged so that it is coupled to generation of a Ap. It is apparent that a classic site-I coupling site cannot operate (see Sections I and 11). To give some insight into the possible mechanisms of Ap generation, the steps in carbon dioxide reduction will be outlined first and then fitted into schemes compatible with the data and the requirement to generate a Ap. The mechanism of carbon dioxide reduction utilizing hydrogen has been elucidated (Fig. 3, adapted from previous reviews). The initial two-electron reduction of carbon dioxide involves forming formylmethanofuran from methanofuran (MFR, previously called the carbon dioxide reduction factor, CDR; Leigh et al., 1985; Fig. 3 step I). The direct electron donor for MFR is thought to be a coenzyme, F,,,, a deazaflavin analogue (Em,= - 350 mV) which functions as a low-potential donor (Cheeseman et al., 1972). Ferredoxins are not normally found in methanogens containing F,,,
MICROBIAL ANAEROBIC RESPIRATION
237
METHANOFURAN (MFR)
FORMYL - METHANOFURAN
5- FORMYLTETRAHY OROMETHANOPTERIN I 5 - FORMYL- H,MPT)
2e-
FIG. 3. Pathway of carbon dioxide reduction to methane by methanogens. Carbon dioxide is reduced to methane by four two-electron equivalent transfers as shown. Positive signs indicate stimulatory effects of ATP and coenzyme M in the reaction sequence.Coenzyme M stimulation via the RPG effect (named after R. P. Gunsalus; see text) gives positive control between the initial two-electron reduction ofcarbon dioxide and the final two-electron reduction producing methane. The carbon atom in carbon dioxide is shown in bold to distinguish its reaction sequence as it is reduced. In the skeleton structures illustrated, R represents further hydrocarbon groupings (see the text for references). MFR, methanofuran; H,MPT, tetrahydromethanopterin; CoM, coenzyme M. The numbered steps arc explained in the text. although the Methanosarcinaceae which contain ferredoxin appear to have little F42, (Eirich et al., 1979; Hatchikian et al., 1982; Hausinger et al., 1982). The formyl group of formyl-MFR is transferred to the reduced coenzyme methanopterin (H,MPT; Fig. 3. step 2). 5-Formyl-H4MPT is formed (Donnelly et al., 1985). A cyclohydrolase reversibly forms $10-methenylH4MPT (step 3) (Van Beelen et al., 1984) and the second two-electron reduction reduces this to methylene-H,MPT (step 4). This reaction is catalysed by methylene-H,MPT dehydrogenase for which the reductant is F42, (Methanobacterium thermautotrophicum; Hartzell et al., 1985). Methylene-H,MPT is then reduced in the third two-electron transfer (step 5) to give methyl-H,MPT. A methyl-group transfer to coenzyme M from methylH,MPT gives rise to methyl-coenzyme M (step 6). The H,MPT is then recycled at step 2. Coenzyme M is 2-mercaptoethanesulphonic acid (HSCH2CH2S0,; Taylor and Wolfe, 1974). Methyl-coenzyme M is reduced by a two-electron step with release of methane and regeneration of the
238
A D MOODIE A N D W J INGLEDEW
coenzyme (step 7). The coenzyme-M methylreductase is stimulated by catalytic amounts of ATP. The mechanism of ATP stimulation is unclear but enzymic control rather than hydrolysis is indicated (Gunsalus and Wolfe, 1978). Coenzyme M also feeds back to stimulate the initial step in carbon dioxide reduction (Fig. 3). This is the so-called RPG effect discovered by R. P. Gunsalus (Gunsalus and Wolfe, 1977). Two additional redox cofactors, F,,, (a nickel-containing tetrapyrrole) and component B (7-mercaptoheptanoylthreonine phosphate) are also involved in methane formation, although their function is unclear (Noll et al., 1986; Ellefson et al., 1982). Both are associated with the methylreductase. Reduced nicotinamide adenine dinucleotide does not appear to be directly involved although a F,,,-NADP+ transhydrogenase activity has been identified in Methanohacterium ruminantium (Tzeng ef al., 1975a; Jones and Stadtman, 1980). It has been shown by radioactive labelling that most of the protons incorporated into methanedo not arise from the hydrogen reductant but from water (Spencer et al., 1980). Thus hydrogen does not directly reduce the substrate; it may, however, only be separated by a rapidly proton-exchanging coenzyme. How can these reactions and their location be constituted into a scheme for generation of a Ap? The answer probably comes not from respiratory-linked proton pumping but from separation into bulk and cytoplasmic phases of the proton-generating and consuming reactions. Such schemes, originally proposed to account for coupling of iron@) oxidation in Thiohacillus Jerrooxidans, appear to apply to a number of bacteria utilizing inorganic couples in their respiration (Ingledew et al., 1977). These principles are outlined in Fig. 4. A periplasmic hydrogenase can donate electrons to the cytoplasmic enzymes with release of protons. There will also be cytoplasmic proton consumption by methane formation. Release of all eight protons periplasmically and their cytoplasmic consumption would mean that Ap was less than - 176 mV (Fig. 4a; equation 2). If the reaction were only partially separated (Fig. 4b), however, a larger Ap could be generated (but the proton current would be smaller). In the example shown, the Ap value could be less than - 352 mV with half the proton current (from equation 2). As gases, both carbon dioxide and methane will be freely permeable across the cytoplasmic membrane although a porter for bicarbonate is a possibility. There is a sodium-ion requirement for growth of some methanogens (Perski et al., 1982). This sodium requirement appears to be connected with ATP synthesis although the mechanistic details are unresolved. Explanations for the sodium requirement that have been suggested include enzyme activation, a sodium-motive force exchanging sodium ions for protons via a cytoplasmic membrane antiporter, and regulation of internal pH value (see Lancaster, 1987). The latter two are related and it appears that a strong possibility
239
MICROBIAL ANAEROBIC RESPIRATION
@
(bl PERIPLAUI MEMBRANE CYTOPLASM
Ap (-352mV
CH+* ZH.0
(CI
ZHCOOH
coz+ BH'
[Overall: CHCOOH
-
CH,
+
3C4 ZyOl +
FIG. 4. Models for generation of a Ap in methanogens. (a) A full transmembrane charge separation model. (b) A partial transmembrane charge separation model. (c) A model for Ap formation utilizing formate. This model shows partial transmembrane charge separation. The deazaflavin analogue, coenzyme F240ris shown as a possible electron-transfer component in carbon dioxide reduction to methane. Values for Ap are calculated from equation 2.
involves regulation of the internal pH value and consequently the balance of A+ and ApH (equation 1) via a controlled N a + / H + antiporter. There is a proposal that some methanogens contain internal specialized vesicles, called methanochondrions (Spencer et al., 1980; Doddema et al., 1979), for energy production, rather than use the cytoplasmic membrane. This proposal originates from uncoupler and inhibitor studies. However, electronmicroscope studies have not connected the presence of these internalized vesicles with energy production as they are only present under certain growth conditions which do not correlate well with methanogenesis (Sprott et al., 1984). B. METHANOGENESIS UTILIZING FORMATE
4HCOOH +4H, + 4C0, 4HCOOH +CH, + 2H,O
+ 3C0,
240
A. D. MOODIE A N D W. J. INGLEDEW
Formate can be used as both an energy source and a carbon source in over half of the known methanogens (Jones et d., 1987). Formate is split into carbon dioxide and hydrogen by a soluble formate hydrogenlyase activity (equation 7), thus providing both the reductant (hydrogen) and oxidant (carbon dioxide) for growth as outlined in the preceding section (equation 6; Tzeng et al., 1975b). The net result of growth on formate is shown in equation 8. In addition to hydrogenases, soluble formate dehydrogenases have been identified, although with difficulty because of their sensitivity to oxygen (Schauer and Ferry, 1982). The latter enzymes may reduce F420 and NADPH (Jones and Stadtman, 1980), which suggests that all reduction reactions are not from hydrogen or periplasmic in origin as in Fig. 4a. A possible scheme for Ap generation during growth on formate is illustrated in Fig. 4c. This should be compared to Fig. 4a and b where use of coupled and non-coupled reactions increases the magnitude of Ap. C. USE OF OTHER
c , COMPOUNDS
Methanol, acetate and methylamines can also be used as substrates by some of the Methanosarcinaceae (Jones et al., 1987). Cytochromes and corrinoids (vitamin B12) have been identified in species capable of utilizing these substrates (Kuhn el al., 1983; Blaylock and Stadtman, 1966). Reduction of methanol to methane also requires methanol oxidation for a supply of reducing equivalents for methanol reduction. Complete oxidation of methanol to carbon dioxide involves three two-electron oxidations: CH,OH + CH,O + 2e- + 2H' C H 2 0 H 2 0-+ HCOOH + 2e- + 2Ht HCOOH --+ CO, + 2e- + 2H'
+
Em7=-182mV Em, = - 503 mV Em7 = -432 mV
(9) (10) (1 1)
The six electrons produced can then be used to produce three equivalents of methane from methanol via coenzyme F420(equation 12).
The carbon dioxide produced can be utilized as an oxidant and coupled to hydrogen oxidation (from formate) giving energy coupling as before, e.g. Fig. 5a. Co-utilization of the two oxidants gives the overall equation 13. 4CH30H 4CO,
+ 3CH4 + 2HzO
(13)
Reduction of methanol does not involve the enzyme pathways of carbon dioxide reduction. The methyl group of methanol is transferred to coenzyme
MICROBIAL ANAEROBIC RESPIRATION
24 1
J 2CH,+2H,O IOwrall LCH,OH-3CH,*
Cq*
2npl
Cl
dl
I
'
3CH++ 6HzO IOverall LCl$NH.* ZHg-3CH,+
C&*
LNHJ
FIG. 5. Schemes for generation of a Ap from utilization of other substrates by methanogens. (a) Methanol utilization wherein methanol is used as both an oxidant (large type) and a reductant. These reaction sequences are discussed in the text. Some of the carbon dioxide produced is also utilized as an oxidant (large type). A Ap is generated by hydrogen oxidation (from formate) in the periplasm and proton consumption in the cytoplasm, as with most of these models. (b) Scheme for Ap generation for growth utilizing hydrogen as a reductant and methanol as an oxidant only. (c) Scheme for Ap generation utilizing methylamine to provide both an oxidant and reductant. The carbon moiety is oxidized to carbon dioxide which functions as the respiratory oxidant (large type). (d) Scheme for Ap generation utilizing carbon monoxide. Two alternatives are shown. In the upper scheme, the site of carbon monoxide oxidation is periplasmic; in the lower scheme carbon monoxide oxidation is cytoplasmic but linked to a site-1 proton-pumping component.
242
A. D. MOODIE A N D W. J. INGLEDEW
M via a cobamide (vitamin BIZ; equation 14) using two methyl transferases which are stimulated by ATP. Reduction of methyl-S-Coenzyme M is then as before, using F 4 Z O (Shapiro and Wolfe, 1980; Shapiro, 1982; Van der Meijden el al., 1983).
- . Methyltransferase 1
CH,OH
Methyltransferase 2
CH,-B,,
CH,-Coenzyme M (14)
The presence of cytochromes in methanol-reducing bacteria has been suggested to be a function of the mid-point potential of F420 (Em7= - 350 mV). Transfer of electrons from the CH,OH/CH,O couple to F,,, may be energy requiring so it has been suggested that cytochromes act to perform reversed electron transfer at the expense of Ap (see Daniels et al., 1984). The overall reaction is, however, very favourable so that reversed electron transfer may not be required. The methanogen Methanosphaeru stadtmaniae can grow on methanol only in the presence of hydrogen. This bacterium lacks cytochromes and is thought to utilize a hydrogenase for reduction of methanol (Fig. 5b; Miller and Wolin, 1983, 1985). Methylamines can serve as substrates for some methanogens. Utilization of these compounds as growth substrates has been demonstrated for Methanosarcina harkeri although other less-common amines, such as ethyldimethylamine and in mixed culture creatine, sarcosine, choline and betaine, are also utilized (Hippe et af., 1979). For reduction the methyl groups are transferred to HS-Coenzyme M and then processed as already described for methanol. The amines also have to produce reducing equivalents and in the process, will also produce carbon dioxide, some of which can be utilized as an oxidant (equation 15; Higgins, 1980). CH,NH,
+ H,O+NH, + 2[H] + HCHO
(15)
The formaldehyde produced can be further oxidized as in equations 10 and 1 1. A scheme capable of generating a Ap is illustrated in Fig. 5c. Transfer of a methyl group to coenzyme M and its reduction to methane would be required to prime the system by acting as an oxidant before any carbon dioxide was produced. An overall balance has been experimentally determined and is compatible with this model (equation 16; Hippe et al., 1979). 4CH,NH,
+ 2H,O + 3CH, + CO, + 4NH3
(16)
Acetate can be used as the sole energy source although growth utilizing acetate as a substrate is poor. The acetate molecule is first cleaved into a methyl group and carbon monoxide; the mechanism is not known but the process must be energy requiring (31 kJmol-'; equation 17). This energy is
MICROBIAL ANAEROBIC RESPIRATION
243
equivalent to one molecule of ATP although it is not known that ATP is involved. However, this energy must be expended, and so it is probable that more than one ATP molecule must be synthesized for each acetate utilized if growth is to occur. The small energy yield from acetate results in other substrates being used as energy sources preferentially if they are present in growth media, any acetate present being used only as a carbon source (Jones et al., 1987;although see Vogels and Visser, 1983). As with methanol, a corrinoid binds the methyl group before transferring it to coenzyme M (Kenealy and Zeikus, 1981);action of a methyltransferase followed by reduction gives rise to methane. The use of corrinoids to transfer methyl groups is found only in the methanosarcinacae, not in the formate- or hydrogen/carbon dioxide-utilizing bacteria (Kenealy and Zeikus, 1981). The electrons for methyl-coenzymereductase are thought to come from a membrane-bound dehydrogenase (equation 18); carbon monoxide is produced from the carboxyl group of the acetate (equation 7). CH,COOH +CO + CH,OH
(17)
The membrane-bound carbon monoxide dehydrogenase then catalyses oxidation of carbon monoxide producing carbon dioxide and protons. CO
+ H,O+CO, + 2Ht + 2e-
Em, = -540mV
(18)
These reactions can be coupled by adaptations of the schemes shown for other methanogens. Growth on carbon monoxide as the sole energy source has been shown for Methanohacterium thermoautotrophicum. Carbon monoxide is disproportionated into carbon dioxide and protons by a carbon monoxidedehydrogenating enzyme which reduces F4,0. The F420 then reduces carbon dioxide via the methylreductase reactions to methane giving the overall reaction shown in equation 19 (Daniels et af., 1977; Fig. 5c). 4CO
+ 2H20
3C0,
+ CH,
AG = -21 1 kJ mol- (CH,)
(19)
IV. Sulphate as a Respiratory Oxidant Sulphate reducers are strictly anaerobic heterotrophic or autotrophic bacteria which utilize sulphate as a respiratory oxidant in an eight-electron reduction to hydrogen sulphide (equation 20). These bacteria are of importance ecologically in the sulphur cycle and economically as an agent in metal corrosion under anaerobic conditions (Hamilton, 1985). The pK, values of important reactants in anaerobic respiration are given in Table 1 . For ease of
244
A.
D.M O O D I E A N D W. J. INGLEDEW
TABLE 1. Values for pK, for compounds commonly available in bacterial niches Values for Compound Hydrogen sulphide Sulphuric acid Sulphurous acid Nitric acid Nitrous acid Carbonic acid
PK,
QK2
7.04 - 3.00 1.81
1 1.96 1.92 6.9 I
- 1.4
3.4 6.37
10.25
presentation, one form may be referred to although others may be present. We leave the reader to work these out. Bacteria normally maintain their cytoplasmic pH value close to 7.4 (Booth, 1985). Because they produce hydrogen sulphide, these bacteria are also referred to as sulphidogens. SO:-
+ 8[H] + 2H+ -+H,S + 4H,O
(20)
Sulphate-reducing bacteria were first identified almost 100 years ago (Postgate, 1984). Eight major genera have been described. Desulfovibrio and Desulfotomaculum were, until 1980, the most studied groups. More recently Desulfobacter, Desulfoscarcina, Desulfococcus, Desulfonema, Thermodesulfobacterium and Desulfobulbus have been recognized (Widdel, 1987). A tenth genus of sulphidogens, Desulfuromonas, incorporates the elemental-sulphurreducing bacteria. A. SULPHATE REDUCTION
Species of Desulfouihrio are the subjects of the following discussion unless otherwise indicated. These bacteria possess hydrogenases, formate dehydrogenases and other dehydrogenase activities as well as membraneassociated c-type cytochromes, ferredoxins, flavodoxins and menaquinone. Many sulphidogens also possess membrane-bound fumarate, nitrate and nitrite reductases thus enabling them to use alternative oxidants (for a review, see Peck and LeGall, 1982). The sulphate-reducing reactions are cytoplasmic so that the first step in metabolism is transport. The sulphate ion is highly polar and unlikely to be permeable in the absence of a porter system (Alexander et al., 1987). It is also likely that transport of sulphate is an energy-consuming process. A A+ would
245
MICROBIAL ANAEROBIC RESPIRATION
normally exist to exclude sulphate by the relationship described in the Nernst equation, n being the ionic valence: -59 [A;:] AII/(mV)= -logloT. n "40;,1
It is thus expected to enter in a charged compensated mode. From the energetic point of view, the best solution would be to exchange it with the product, sulphide, but concentrations of this will be extremely low in the cytoplasm and the predominant hydrogen sulphide will freely diffuse out. The bisulphide ion could partially compensate. It is most likely, however, that sulphate enters by proton symport or hydroxyl-ion antiport thus consuming some of the (chemi-osmotic) proton current. The second step in sulphate utilization is its reduction to bisulphite. The HSO,/SO:- couple has an Em, of -516mV so direct reduction does not occur. Sulphate is first converted to adenosine-5'-phosphosulphonate (APS). This reaction, catalysed by ATP sulphurylase, is given in equation 22. SO:-+ATP4- + H f - + A P S 2 - + P P : PP:- + H 2 0 + 2 P : - + H t
A G = + 4 6 k J mol-' AG = - 33 kJ mol-
'
(22) (23)
Formation of APS is thermodynamically unfavourable but the reaction is driven towards completion by coupling to pyrophosphate hydrolysis by pyrophosphatase (equation 23; AG = -33 kJ mol-I). Thus two ATP equivalents are consumed. Pyrophosphatase activity appears to be regulated by the ambient redox potential and is inactivated in the presence of oxygen (Ware and Postgate, 1971). Even after pyrophosphate hydrolysis, APS formation is still unfavourable (net AG value, + 13 kJ mol-'). The reaction is driven by coupling to the next, very exergonic, reaction in the sulphatereduction sequence (APS-AMP; AG = -68 kJ mol-'). The APS is reduced by APS reductase, a soluble cytoplasmic enzyme found in all of the sulphatereducing bacteria (equation 24).The Em7value for APS reduction to bisulphite is considerably higher than that for sulphate reduction to bisulphite. APS+2e-+H++AMP+HSO;
Em,=-60mV
(24)
The APS reductase has been purified from D. vulgaris, has a molecular weight of 220,000, contains a single flavin, FAD, and 12-non-haem iron and acidlabile sulphur atoms which are constituted into iron-sulphur clusters (Bramlett and Peck, 1975). Reduced ferredoxin has been proposed as the reductant for this reaction (Peck and LeGall, 1982). Bisulphite is further reduced to hydrogen sulphide in a six-electron
246
A. D. MOODIE A N D W. I. INGLEDEW
reduction catalysed by a soluble cytoplasmic bisulphite reductase (equation 25). HSO;
+ 6e- + 7H+ + H,S f 3H,O
Em7= - 116mV
(25)
Four bisulphite reductases have been identified in the reducing bacteria. These are desulfoviridin (Lee and Peck, 1971) and desulforubidin (Lee et al., 1973) both from Drsulfovibrio species, pigment P,,, from Desulfotomaculum nigrificans (Trudinger, 1970), and desulfofucidin isolated from Thermodesuljobacterium commune (Hatchikian and Zeikus, 1983). The enzymes are a,b, tetramers with a molecular weight of about 200,000. All are sirohaem- and iron-sulphur-(four clusters)-containing proteins. Both ferredoxin and/or flavodoxin have been suggested as reductants for this reaction. From available data, ferredoxin is the more likely candidate (Peck and LeGall, 1982;Peck and Lissolo, 1988, and articles quoted therein). A similar enzyme from E. coli utilizes NADPH (Section VIB). Variations and side reactions on these pathways have been reported. In formation of APS, Desdfotomaculum nigrificans utilizes pyrophosphate kinase, not pyrophosphatase, giving acetyl phosphate from pyrophosphate and acetate. Acetyl phosphate is then used in forming ATP by acetate kinase (Reeves and Guthrie, 1975; equations 26 and 27). PP, + acetate + acetyl phosphate + P, (pyroph0sphate:acetate kinase) AC= +9.6kJmol-’ acetyl phosphate + ADP +acetate + ATP (acetate kinase) A G = -12.5kJmol-’
(26) (27)
This phosphoryl transferase in Desulfotomaculum nigrificans means that, in net terms, only one ATP molecule is used to activate sulphate. This is because, for the two molecules of ATP used in sulphate activation, there is a single ATP molecule formed by acetate kinase. Initial APS formation is only favourable when coupled to APS reduction, as before. Unlike Desulfovibrio vulgaris, oxidative phosphorylation is not mandatory for growth on sulphate. Because of this, Desulfovihrio vulgaris gives higher growth yields than Desuljotomaculum orientis (Peck and LeGall, 1982). Variations in the bisulphite reduction have also been reported. Reduction of bisulphite to hydrogen sulphide can release intermediates indicative of a “trithionate pathway” involving trithionate and thiosulphate as intermediates (equations 28-30).
+ 2e- + 5 H t +S,Og- + 3HzO + 2e- + H + + S 2 0 : - + HSO; S,O:- + 2e- + 3Hf + H,S + HSO:.
3HSO;
s,oi
Em7= - 173 mV Em7= +225mV Em7= - 312 mV
(28) (29) (30)
247
MICROBIAL ANAEROBIC RESPl RATION
Equation 28 has a reaction order of three for bisulphite. These intermediates can be detected under certain conditions, but not normally, and it has not been possible to isolate trithionate and thiosulphate reductases. It is generally thought that this pathway does not operate in vivo. Desulfovihrio species can grow using either trithionate or thiosulphate as an electron acceptor but this probably involves an initial splitting to bisulphite (and possibly elemental sulphur) before reduction by sulphite reductase (Chambers and Trudinger, 1975).These polysulphur oxyanions have a complex chemistry and are quite reactive; biologically catalysed and non-biological side reactions must be distinguished. 8. SUBSTRATES FOR CATABOLISM A N D FORMATION OF A
Ap
The organic substrates oxidized by sulphate-reducing bacteria include lactate, pyruvate, ethanol, malate, fatty acids and acetate although particular substrates are often limited to a small number of species. Space and data allow consideration of only a few of these examples (see Postgate and Kelly, 1982). 1. Hydrogen/Sulphate
Bacteria utilizing hydrogen as an energy source can grow either autotrophically fixing carbon dioxide or by utilizing acetate as a carbon source. In Desulfovibrio species hydrogen/sulphate respiration generates a Ap. At first aquaintance the mechanism for Ap generation appears straightforward (Fig. 6).Generation of protons in the periplasm and the consumption of protons in the cytoplasm gives a H+/2e- value of approximately 2 supported by a AE,,, value of approximately - 323 mV. However, if the (speculative) needs of transport are considered and the H+/ATP ratio is 3, the balance sheet can come to no gain (Fig. 6)!This is because the equivalent of two ATP molecules are invested to form APS. Clearly this is not correct. The bacteria grow and an approximate ATP/SOi- ratio of unity has been measured, so either the H+/2e- ratio is greater or the transport mechanism is not so expensive. Clearly, an enigma remains in the energy conservation of this system. Although, in Fig. 6 (and elsewhere), the site of hydrogen oxidation is shown as periplasmic, the same net, or 3H +/2e-, transmembrane charge separation can be achieved with a cytoplasmic site and site-1 proton translocation. Three types of hydrogenase have been identified in Desulfovibrio species; these are Fe-, NiFe-, and NiFeSe-containing hydrogenases, which have periplasmic, membranous and cytoplasmic locations (variable between species).The Fe-containing hydrogenase has been found only in the periplasm and can be identified by its greater sensitivity to inhibition by carbon monoxide compared with the other hydrogenases. Molecular weights are in the
248
A. D. MOODIE AND W. J. INGLEDEW
Em, (mV) VALUE
PERIPLASM MEMBRANE CYTOPLASM &Ha>
-400.
-300-200.
-'I
APS A dSO;
+
AMP
0
so--& ,;-
-
-=-a=-
, ZH'
NET ' +8H*
?
--c
so:
'*
I
L
2H'
-8H* (OMITTING TRANSPORT)
FIG. 6. Utilization of hydrogen and generation of Ap by sulphate-reducing bacteria. A scheme for coupling of hydrogen/sulphate respiration is illustrated. Hydrogen is oxidized periplasmically and electrons transferred across the membrane to a carrier in the cytoplasm (possibly ferredoxin, Fd(?)).These reducing equivalents are used to reduce APS (adenosine phosphosulphate) and then bisulphite to hydrogen sulphide. The electrode potentials of the APS and bisulphite reductions are indicated by the Em, values scaled to the horizontal arrows of the reaction. Two pyrophosphate bonds are hydrolysed in the process (hence two equivalents of ATP are invested) and sulphate will require transport, the mechanism of which is not known. A transmembrane charge separation equivalent to the translocation of eight protons is achieved, but some of this proton current must be used for sulphate transport. C3,cytochrome c,; PPi, inorganic pyrophosphate; Pi, inorganic phosphate.
range 50,00(r90,000, and iron-sulphur groups are detectable in all three enzymes (for a recent review of identified hydrogenases, see Peck and Lissolo, 1988). As shown in Fig. 6, the external periplasmic hydrogenase has a close association with cytochrome c3. In Desuljiouibrio species, cytochrome c3 has a molecular weight of 13,000 and contains four c-type haem groups although inter-species homology for amino-acid sequence in cytochrome c3 can be as low as 25% (Odom and Peck, 1984). The function and integration of activity of the hydrogenases are problematical. The periplasmic enzyme oxidizes hydrogen periplasmically, donating electrons to the internal APS reductase and bisulphite reductase via ferredoxin or flavodoxin, giving a mechanistic H+/2e- ratio of 2. The cytoplasmic enzyme catalysing the same reaction gives a H+/2e- ratio of zero. The membrane-bound enzyme could conceivably have a H '/2e- ratio greater than 2 (say 3) involving proton translocation by a site 1. The activities of the
MICROBIAL ANAEROBIC RESPIRATION
249
periplasmic and membrane-bound enzymes would be differentially controlled by a Ap (respiratory control). Thermodynamics give the overall H+/2e- ratio equal to or greater than 3 (assuming a A p value of - 220 mV). The process may involve more than one hydrogenase, and an intricate pathway for reduction of bisulphite to hydrogen sulphide has been proposed by Peck and Lissolo (1988).Such control could give a H+/2e- value of 2 or 3, thus accounting for the ATP yield even allowing for transport (Fig.6). Ap-Coupled ATP synthesis for reduction of sulphate to hydrogen sulphide has been measured at an approximate ATP/SOt- ratio of unity but, if coupled to bisulphite reduction, the ATP/SO:- ratio is 3, the ATP deficit of two equivalents being utilized during sulphate activation to APS (Badziong and Thauer, 1978). 2. Lactate/Sulphate Modelling growth on lactate and sulphate is more complex, although a chemiosmotic model involving hydrogen cycling has been suggested by Odom and Peck (1981; Fig. 7a). As shown this involves the cytoplasmic generation and periplasmic oxidation of hydrogen. Lactate is oxidized to pyruvate by a membrane-bound dehydrogenase. Pyruvate is then converted to acetyl phosphate and carbon dioxide with liberation of hydrogen, by a phosphoroclastic reaction. This will involve pyruvate dehydrogenase, phosphotransacetylase and a cytoplasmic hydrogenase, which have been activities found in all Desu!fouihrio species (Peck and LeGall, 1982). Adenosine triphosphate is made by substrate-level phosphorylation utilizing acetate kinase to produce ATP and acetate from acetyl phosphate and ADP. Reducing equivalents from lactate have been suggested to be used also for hydrogen generation. This reduction would be expected to involve reversed electron flow and utilization of a Ap (the lactate/pyruvate Em7 value is -190mV, that for the H,/H+ couple is -420mV). The electron-carrier protein (ECP)for this transfer has been suggested by Kramer et al. (1987)to be a membrane-bound c-type cytochrome, cc,. However, this reversed electrontransport part of the scheme does not contribute net to Ap as it consumes and generates the same number of periplasmic protons. Alternatively, the lactate/pyruvate couple (Em7 = - 190 mV) is reducing enough to reduce APS directly to bisulphite (Em, = -60mV) in the cytoplasm with no formation of A p but with substrate-level phosphorylation for ATP production. Hydrogen is then oxidized periplasmically and the reducing equivalents used for bisulphite reduction (Fig. 7b). Energetically, these schemes are similar and suffer from the same problems as hydrogen/sulphate respiration. The cost of transport, in this case lactate as well as sulphate, remains enigmatic. Lactate movement (presumably as a weak acid) could be compensated directly or indirectly (in the steady state) by movement of acetate.
250
A. 0. MOODIE A N D W. 1. INCLEDEW
l
l
PERlPLIYl MEMBRANE CYTOPLASM
la1
zco. 2 ACETYL PHOSPHATE
y
m
PAIETATE
SH'
Sq'* - \
HS .
+
3H,O
2AOP
z h LH+
2 ACETYL-PHOSPHATE 2 ACETATE
4e-
c,
Fdl'l
FIG. 7. Sulphate-reducing bacteria: utilization of lactate and generation of a Ap, (a) Partial hydrogen-cycling scheme. The hydrogen cycling does not contribute to generation of a Ap but oxidation of hydrogen produced in the phosphoroclastic reaction does. cc, and c3 are cytochromes possibly involved in electron transfer. Fd indicates ferredoxin, and Pi inorganic phosphate. (b) Non-hydrogen-cycling scheme. In both schemes, the equivalent investment of two ATP molecules in priming sulphate (see the text) is balanced by substrate-level generation of ATP from acetyl phosphate. Transport mechanisms for lactate and sulphate are not considered.
MICROBIAL ANAEROBIC RESPIRATION
25 1
To account for some discrepancies, a second proposal, the trace hydrogen transformation model, has been made (Lupton et al., 1984). In this model, hydrogen is used only to monitor the redox state of electron-transfer components in the cytoplasm. During growth on lactate, periplasmic hydrogenase acts only to oxidize the small amounts of hydrogen generated during redox-state monitoring of the ferredoxin. The main function of the periplasmic hydrogenase is then as a constitutive enzyme for growth using hydrogen. This model involves vectorial movement of protons across the membrane and gives the same net ATP production as the hydrogen-cycling model. 3. AcetatelSulphate
Acetate can be catabolized by some sulphate-reducing bacteria. Desuljobacter postgatei utilizes only acetate as its source of reducing equivalents. Oxidation of acetate involves some of the enzymes of the TCA cycle, succinate and malate dehydrogenases being membrane bound and all other enzymes being cytoplasmic (Thauer, 1982).These bacteria lack succinyl-CoA thiokinase and so do not carry out substrate-level phosphorylation. The more reducing intermediates oxoglutarate or isocitrate may serve to reduce APS via NADPH and a membrane-bound NADPH dehydrogenaselcytoplasmic ferredoxin interaction (Kroger et al., 1988). 4. FormatelSulphate
A formate dehydrogenase activity has been identified in some Desuljovibrio species. The enzyme is periplasmic and has a close physical association with cytochrome cSs3in Desuvovibrio vulgaris; the electron acceptor for formate may be cytoplasmic ferredoxin. Scalar production of protons in the periplasm upon formate oxidation will generate a Ap (Peck and LeGall, 1982). C. SULPHUR REDUCTION
Desulfuromonas acetoxidans uses sulphur as an electron acceptor for acetate metabolism. The reactions involved are coupled to membrane-bound enzymes and the TCA cycle although malate dehydrogenase is not thought to be membrane bound but may be coupled to a membrane-bound NADH dehydrogenase. Reduction of sulphur by acetate (equation 3 1) is exothermic overall. CHjCOOH+4S+2H,0+2C0,
+4H,S
A G = -23.8kJmol-'
(31)
However, when the individual steps of acetate catabolism are considered, a problem arises with succinate. Succinate has too high a potential to reduce
252
A. D. MOODIE A N D W. J. INGLEDEW
elemental sulphur (A& values of approximately + 300mV), so that reversed electron transfer (at the expense of Ap) is presumably utilized. Low growth yields were reported by Pfennig and Biebl (1976). In Desuljiuromonas acetoxidans, membrane-bound dehydrogenases are present for NADH, succinate and hydrogen sulphide but not NADPH. A c-type cytochrome may also be involved in sulphur reduction. This may be the sulphur/hydrogen sulphide oxidoreductase or a mediator between the dehydrogenases and sulphur reduction (Kroger et al., 1988). V. Furnarate Respiration
A number of bacteria and a few eukaryotic micro-organisms are capable of anaerobic growth on a non-fermentable carbon source when fumarate is present. Fumarate functions as a respiratory oxidant (Kroger, 1978), and is reduced to succinate (equation 32, n = 2, Em, = 30 mV). When the donor is low enough in potential to incorporate a site 1, oxidative phosphorylation results.
coo
-0oc
-
coo-
I
coo-
The energetics of fumarate respiration have been extensively reviewed (lngledew and Poole, 1984; Kroger, 1978). A. STRUCTURE OF FUMARATE REDUCTASE
Reduction of fumarate to succinate is catalysed by respiratory fumarate reductases. These enzymes are succinate: fumarate oxidoreductases. Fumarate reductases are very similar to succinate dehydrogenases, but each seems to be tuned to catalysing one or other direction better. Fumarate reductases have been studied extensively in Vihrio succinogenes and E. coli. They are membrane-associated enzymes, having two catalytic subunits which contain the prosthetic groups (a covalently bound flavin and three iron-sulphur clusters) and two small hydrophobic anchor polypeptides. In succinate dehydrogenases, a 6-type cytochrome constitutes one of the small polypeptides. Fumarate reductase has been isolated from E. coli in both the twosubunit and four-subunit forms (i.e. with or without the anchor polypeptides; Dickie and Weiner, 1979; Lemire et ul., 1982). In E. coli, fumarate reductase genes are arranged as an operon which consists of a promoter-operator
253
MICROBIAL ANAEROBIC RESPl RATION
region, four cistrons (frdA, B, C and D ) and a transcriptional terminator. The complete nucleotide sequence of this operon has been determined (S. T. Cole, 1982;Cole et ul., 1982; Edlund et al., 1979; Grundstrom and Jaurin, 1982).The flavin-containing subunit, the product of frdA, consists of 602 amino-acid residues and has extensive homology to the flavin subunit of mitochondria1 succinate dehydrogenase (S. T. Cole, 1982; Kenney et al., 1977). The ironsulphur protein subunit (the product of frdb) consists of 244 amino-acid residues and also has extensive sequence homology with succinate dehydrogenase. The genes,frdC andfrdll code for the two small hydrophobic polypeptides ( M ,= 15,000 and 13,000, respectively). Amplified expression of fumarate reductase in E. coli has been achieved in a number of different ways. These include gene-dosage effects with chromosomal duplication, replicating 3, frd phages and multicopy hybrid plasmids (Goldberg et ul., 1983; Cole and Guest, 1979a,b, 1980; Guest, 1981 ; Lohmeier ef al., 1981). In addition, a number ofgenetically modified forms oftheenzyme have been created which are assisting study of the enzymes structure-function relationships (Condon and Weiner, 1988). Detailed biophysical studies, primarily using electron paramagnetic resonance, have revealed the presence of three different iron-sulphur centres in fumarate reductase; these are a two-iron (2Fe-2s) ferredoxin centre, a fouriron (4Fe-4s) ferredoxin centre, both paramagnetic in the reduced form, and a three-iron (3Fe-4s) centre paramagnetic in the oxidized form (Ingledew, 1983; Cammack et ul., 1986; Morningstar ef al., 1985) in addition to the flavin. All of the iron-sulphur centres show n = I tedox transitions, the three-iron centre has an Em7 value of -50mV, the two-iron centre one of -50mV and the four-iron centre one of -285mV (Simpkin and Ingledew, 1985; Cammack et al., 1986).The flavin can undergo n = 1 or n = 2 tedox transitions, the Em, value of the n = 2 transition being - 12mV (Simpkin, 1985).It has been shown that, in E. coli, the catalytic portion of the fumarate reductase is located on the cytoplasmic face of the membrane (Fig. 8). The catalytic subunits can be visualized as 4 nm-diameter knobs by negative-staining electron microscopy. Further evidence for this arrangement comes from crossed immunoelectrophoresis and immunoabsorption studies using artificial reductants and studies with mutants lacking the dicarboxylate carrier(Jones and Garland, 1977; Van der Plas et al., 1983; Lemire ef al., 1983; Simpkin and Ingledew, 1984; for a summary see Ingledew and Poole, 1984). B. COUPLING OF FUMARATE RESPIRATION TO
ATP
SYNTHESIS
Growth of cells on non-fermentable carbon sources utilizing fumarate as a respiratory oxidant is well documented (reviewed in Ingledew and Poole, 1984; Kroger, 1978) but this does not necessarily prove that ATP is being made by
254
D. MOODIE AND W. J. INGLEDEW
PERIPLASM
MEMBRANE
CYTOPLASM
HDANk. ; . . nH+t DEHY DROGENASE
+
H+
NAD+
0 41 Pd ti
FIG. 8. Fumarate respiration in Escherichia coli: generation of a Ap. The NADH dehydrogenase developed during growth during fumarate respiration is proton translocating. The formate dehydrogenase may have either a periplasmic (not shown) or cytoplasmic substrate site, but either could contribute to generation of a Ap. The glycerol-3-phosphate dehydrogenase (aGPdH) does not contribute to Ap formation. All of the dehydrogenases reduce menaquinone (MQ) which is in turn oxidized by fumarate via fumarate reductase (FR).
oxidative phosphorylation. Fumarate may merely be providing a sink which enables anabolism to proceed, thereby sustaining the cell by substrate-level phosphorylation. If we consider growth of E. coli on the non-fermentable carbon source glycerol, the presence of an oxidant (whether coupled or not) allows anabolism to proceed with a net gain of two equivalents of ATP from one equivalent of glycerol from substrate-level phosphorylation (oxygen or nitrate as oxidant) or one equivalent of ATP from one equivalent of glycerol (fumarate as oxidant). The difference is due to the fact that, with fumarate as oxidant, the full TCA cyclecannot operate. Mutants which are defective in the respiratory ATP synthase can grow on glycerol with oxygen but not on glycerol with fumarate, indicating that two equivalents of ATP from one equivalent of glycerol is sufficient to sustain growth but one equivalent of ATP is not. It follows from this that additional ATP is normally synthesized
MICROBIAL ANAEROBIC RESPIRATION
255
through oxidative phosphorylation during fumarate respiration (Miki and Lin, 1975a; Gutowski and Rosenberg, 1976). Further proof of the ability of fumarate respiration in E. coli to support oxidative phosphorylation comes from studies by Macy ef al. (1976).These authors grew E. colianaerobically on hydrogen with malate; addition of malate is equivalent to adding fumarate because of the presence of the enzyme fumarase. As there is no substrate-level phosphorylation in the presence of hydrogen, its oxidation must be linked to oxidative phosphorylation for the cells to have grown. An outline of the coupling (or otherwise) of some dehydrogenases from E. coli to proton transport by fumarate reduction is shown in Fig. 8. A NADH dehydrogenase and formate dehydrogenase are coupled; glycerol-3-phosphate dehydrogenase is not. There is one report of direct measurement of ATP synthesis coupled to fumarate respiration (Miki and Lin, 1975a). Generation of a Ap by fumarate respiration has been inferred from solute accumulation (b-galactosides, lactose, phosphate, amino acids and fluorescent probes; Boonstra et al., 1975, 1978; Haddock and Kendall-Tobias, 1975; Konings and Kaback, 1973; Miki and Lin, 1975a; Rosenberg et al., 1975; Singh and Bragg, 1975, 1976). The magnitude of the Ap generated by fumarate respiration has been measured using the distribution of probes (Hellingwerf et al., 1981); values of 105 mV (whole cells) and 103 mV (inverted vesicles) were obtained. These measurements are low compared with those obtained with oxygen as oxidant. There is, however, an unusual feature in these results; no significant ApH value was measured in whole cells, even when the pH,,, value was as low as 5.2. Yet E. coli generally exhibits homeostasis of the cytoplasmic pH value. This problem could be due to collapsing of the ApH by fumarate/proton symport through the dicarboxylate porter although, in the steady state, succinate export would balance this. A A p value can be generated by coupling fumarate reduction to oxidation of hydrogen, NADH, formate and glycerol 3phosphate, utilizing the anaerobically induced glycerol-3-phospha te dehydrogenase (Miki and Lin, 1975a,b) but not to the aerobically induced glycerol-3-phosphate dehydrogenase (Fig. 8). Generation of a Ap arises from respiratory driven proton translocation. Proton translocation has been demonstrated by the technique of oxidant pulse. This involves adding a small amount of the oxidant to resting anaerobic cells and observing transient pH changes during consumption of the oxidant. Brice et al. (1 974) obtained a ratio of 1. I5 0.16 protons translocated for each fumarate reduced for oxidation of endogenous substrates by E. coli. These findings were confirmed by Gutowski and Rosenberg (1976, 1977) using a strain of E. coli defective in the protontranslocating ATPase, which eliminated the possibility of the protons being translocated by ATP hydrolysis, ATP having been synthesized by oxidantenabled substrate-level phosphorylation.
256
A. D. MOODIE AND W. J. INGLEDEW
VI. Oxides of Nitrogen as Respiratory Oxidants Oxides of nitrogen can be utilized as terminal oxidants. Depending on the donor couple and the particular oxide, site 1 and site 2 can be utilized for oxidative phosphorylation. Denitrifying bacteria utilize these couples in anaerobic respirations yielding dinitrogen (equation 33). Escherichia coli, although not a denitrifier, can utilize nitrate and nitrite but cannot reduce them to nitrogen. The products may then be nitrite or ammonium. The enzymes involved are usually integral parts of the respiratory chains of these organisms. Assimilatory reduction of oxides of nitrogen is not considered herein. These produce ammonium for anabolism and are not coupled to ATP synthesis. Not all of the denitrifying enzymes have been positively identified in each denitrifying bacteria but an overview is given. NO; --+NO; + N O
+ N,O + N,
(33)
A. NITRATE REDUCTASE
Nitrate is reduced to nitrite in a two-electron reduction by nitrate reductase; the Em,value for the reaction is +420mV (equation 34). Extensive studies of this enzyme in E. coli(for reviews, see Stouthamer et al., 1980; Ingledew and Poole, 1984) and in the denitrifying bacterium Paracoccus delenitrificans(Ferguson. 1988) have shown this enzyme to be expressed under anaerobic growth conditions in the presence of nitrate, and to be repressed by aerobic growth. NO;
+ 2e- + 2 H f +NO; + H,O
Em, = +420mV
(34)
This couple has a AE,,, value with the NADH/NAD + couple of - 740mV, and -390mV with succinate. These values are ample to drive proton translocation through sites 1 and 2. Nitrate reductase itself does not pump protons across the membrane but it does support site-I proton translocation and form a site 2 by charge separation. A Ap is also generated by nitrate reductase from quinol and succinate oxidation; protons from oxidation of the quinol are released in the periplasm and protons consumed for nitrate reduction in the cytoplasm (Fig. 9ai). Consistent with this model H+/NO; ratios of 4 for L-malate and formate have been measured in E. cofi (Fig. 9ai). The substrate succinate and D-lactate give H+/NO, ratios of 2, reflecting the lack of site 1 in these dehydrogenases (Garland et al., 1975; Jones, 1980).In P. denitrificans there is a larger ATP/O, ratio compared with the ATP/NO; ratio. This increased yield is due to the cytochrome bc, complex operating in the electron pathway to oxygen but not to nitrate (Parsonage and Ferguson, 1983).The preferential use of oxygen over nitrate as an oxidant in an aerobic environment containing nitrate by P . denitriJicans shows tight on/off regulation and the enzymes must be under a control system giving maximum
aNiI Escherichir coli
liiil
liil
blhl PWNKM
4
4
dntlrhcans
liil
FIG. 9. Respiration utilizing oxides o f nitrogen: coupling of respiration to generation of a Ap. (a) Eschrrichia coli respiratory systems using oxides of nitrogen. (i) nitrate respiration supporting proton translocation: NR, nitrate reductase; SDH, succinate dehydrogenase; Mo, molybdenum-containing cofactor; b, a cytochrome b; Q, quinone. (ii) Periplasmic nitrite reduction: C,,, cytochrome c , ~ ~ .(iii) Cytoplasmic nitrite reduction regenerating NAD'. (b) Paracoccus dcnitrificans respiratory systems using oxides o f nitrogen. (i) Nitrate respiration. (ii) Nitrite respiration: A, azurin; C, a cytochrome c: d,, cytochrome c d , . (iii) Nitric oxide respiration. (iv) Nitrous oxide respiration.
258
A. D. MOODIE A N D W. J INCLEDEW
growth efficiency under prevailing environmental conditions (Ferguson, 1987). The nitratereductasein E. colihas threesubunitsa,/?andyin theratio2:2:4 with molecular weights of l50,000,6O,OOO and 20,000, respectively, giving the holoenzyme a molecular weight of 500,OOO (see Ingledew and Poole, 1984).The enzyme in P. denirrificans is very similar with molecular weights of 127,000, 61,000, and 21,000 reported for the a, p, and y subunits, respectively, in the same ratio as found in E. coli. (Craske and Ferguson, 1986). The y subunit is known to be labile during purification and this may have led to reports of nitrate reductases from Pseudomonas aeruginosa and Bacillus lichenformis having only a and /? subunits (Carlson et al., 1982;Van’t Rient et al., 1979).The possibility of two acceptor groups for the two-electron oxidation of quinol has arisen in P. denitrijicans where a second b-type cytochrome in they subunit has been suggested (Ballard and Ferguson, 1987).The a subunit in both E. coli and P. denitrijicans contains the nitrate-reducing molybdopterin prosthetic group. Nitrate reductase is a trans-membranous protein with the nitrate-reduction site on the cytoplasmic side and the quinol-binding site near the periplasmic side of the membrane (Boxer and Clegg, 1975). The b-type cytochrome (subunit y ) reported in nitrate reductases from E. coli and P. denirrificans is thought to be the prosthetic group closest to the periplasm and has been postulated as the electron acceptor from quinol (Fig. 9ai and bi). Chlorate is an analogue of nitrate and can be reduced by nitrate reductase to chlorite; this latter kills the cell. Chlorate has been used extensively for detection of nitrate reductase in mutants of E. coli. If cells can produce active nitrate reductase in the presence of chlorate then they will be killed. Thus growth on chlorate-containing plates is a screen for nitrate reductase deficiency. A range of mutants defective in the enzyme and in cofactor processing have been isolated (Cole, 1988). Chlorate is reduced by nitrate reductase in inverted vesicles or permeabilized cells of P. denitrijicans. Intact cells, however, reduce chlorate at a much slower rate than nitrate because the carrier system for nitrate does not transport chlorate (John, 1977),the large A+ acting to exclude the permeant anion. A permeability barrier also exists for chlorate in E. coli (Kristjansson and Hollocher, 1979). B. NITRITE REDUCTION
I . Escherichia coli It has been suggested that, in E. coli, nitrite is the final product of nitrate reduction. Indeed, nitrite does build up in the media of nitrate-grown cells (Ingledew and Poole, 1984).It is not strictly true, however, to say that nitrite is the sole final reduction product. It is known that E. coli will reduce nitrite if no
MICROBIAL ANAEROBIC RESPIRATION
259
oxygen or nitrate is present (Abou-Jaoude et al., 1977, 1979). Three distinct nitrite reductase activities have been reported in E. coli when grown under anaerobic conditions. Two of these activities are due to sirohaem-containing soluble cytoplasmic enzymes which reduce nitrite to ammonium. The first is a soluble cytoplasmic NADH-dependent reductase (equation 35; see Cole, 1988; Jackson et al., 1981; Coleman et al., 1978a,b). NO;
+ 3NADH + 5H'
+ NH:
+ 3NAD' + 2H,O
(35)
This enzyme operates as a dissimilatory nitrite reductase when it is being used to regenerate NAD' for catabolic processes (Fig. 9aiii). An assimilatory function producing ammonium for biosynthesis is also envisaged (Cole and Brown, 1980). The second soluble nitrite reductase is actually an NADPHdependent sulphite reductase which can also reduce nitrite to ammonium (McRee et al., 1986). These enzymes are not coupled to Ap generation but support catabolism and hence substrate-level ATP synthesis by regenerating NAD' ; their use is not therefore defined as anaerobic respiration. The third nitrite reductase in E. coli is cytochrome C 5 5 2 , and is associated with the periplasmic side of the membrane. This is the only nitrite reductase in E. coli which is associated with Ap generation. Cytochrome ( ' 5 5 2 has six covalently bound c-type haem centres and has a molecular weight of 69,000 (Kajie and Anraku, 1986).It reduces nitrite in a series of electron transfers to ammonium. Cytochrome ~ 5 5 binds 2 carbon monoxide showing an inhibition up to 60% of nitrite-reductase activity (J. A. Cole, 1982).It is also inhibited by copper(n) and cyanide (Kajie and Anraku, 1986).The direct electron donor for cytochrome c552 is not known, although a possible b-type cytochrome or ubiquinol binding site is postulated (Fig. 9aii). Electron transfer from formate to nitrite has been shown to generate a Ap (Pope and Cole, 1982). 2. Denitrijying Bacteria In the denitrifying bacterium P . denitrijicans, nitrite is first reduced to nitric oxide (equation 36). NO;
+ e- + 2Hf + N O + H,O
Em, = f350mV
(36)
The nitrite reductase in P. denitrijicans is periplasmic so nitrite needs to move out of the cytoplasm where it has been formed by action of nitrate reductase. Transport of nitrate and nitrite is an unresolved problem. An obvious solution is a NO;/NO, antiporter which would not consume any proton current. An initial uptake of nitrate using a NO;/H+ symport would be required to prime the system (Boogerd et al., 1983).However, no evidence for
260
A D MOODIE A N D W J INGLEDEW
these porters has been found when using swelling studies on whole cells to observe nitrate movement (Parsonage et al., 1985). Both nitrate(the anion) and nitrous acid have finite permeabilities through lipid bilayers, while nitrate will distribute in response to the A$ (equation 21). Nitrite will partition across the membrane according to the transmembrane pH difference if the permeant species is nitrous acid (Addanki et al., 1968). Entry of nitrate must be charge compensated, otherwise the A$ would operate to exclude nitrate. So, with nitrate reductase beingcytoplasmic, the Kmdpp value for nitrate would be 1000fold more in coupled cells than in uncoupled cells if a A$ of 177 m V existed in the coupled cells (OmV in the coupled cells). Overall, however, nitrate entry by proton symport and nitrite exit by diffusion of nitrous acid would not, in the steady state, consume proton current. The denitrifying bacteria Ps. aeruginosa and P . denitrificans have periplasmic nitrate reductases containing haems c and d , (cytochrome cd,). The electron donor for cytochrome cd, is cytochrome cS5, or the copper protein azurin (see Zunift et al., 1988, and other articles in the symposium volume). These nitrate reductases contain one c-type and one d-type haem in each subunit of a homodimeric enzyme ( M , = 120,000). They also reduce oxygen to water but the reaction appears to be of little importance in viuo (Ingledew and Saraste, 1979; Timkovich and Robinson, 1979). Unlike E. coli, P. denitrificans supplies electrons to its nitrite reductase via the hc, complex (Fig. 9bii). If a quinone (Q cycle) is invoked (as is likely; John and Whatley, 1977; Ferguson, 1987), then two protons for each electron will be translocated at thecytochrome bc, coupling site. Measured ATP ratios for this reaction are complicated by the further reduction of nitric oxide to nitrous oxide which is also Ap generating (Ferguson, 1987; Carr et al., 1989). Periplasmic copperprotein nitrite reductases, which are distinct from cytochrome cd, but also periplasmic, have been isolated from some denitrifying bacteria (see Zumft rt al., 1988); these reductases have similar H+/e- ratios as cytochrome cd,. Unlike E. coliwhere nitrite is found to accumulate in media under anaerobic growth conditions using nitrate as a respiratory oxidant, there is no reported build up of any of the intermediates for reduction of nitrate to dinitrogen in P. rlenifrificans (Ferguson, 1988; lngledew and Poole, 1984). C . NITRIC-OXIDE REDUCTASE
A membrane-bound nitric-oxide reductase with a periplasmic active site has been described in Ps.stutzeri(Zumft etal., 1988; Shapleigh eral., 1987). A nitric oxide-reducing capability of nitrite reductase of Ps. aeruginosa has also been proposed (Kim and Hollocher, 1983; Johnson et al., 1980). However, strong evidence has been obtained for a separate enzyme complex catalysing reduction of nitric oxide to nitrous oxide in P. denitr8cans (equation 37, Carr
MICROBIAL ANAEROBIC RESPIRATION
26 1
er al., 1989). A polarographic study identified nitric oxide as an intermediate species in denitrification although no reductase has been isolated and characterized.
Electron donation is from cytochrome c and the cytochrome hc, complex (which translocates protons) and overall Ap generation supports the reported ATP/2e- ratio of 0.75 for the NADH : nitric-oxide oxidoreductase activity (Fig. 9biii; Carr et al., 1989). D. NITROUS-OXIDE REDUCTASE
This is the most oxidizing of the oxides of nitrogen (Em,= + 1355mV). It is thermodynamically capable of supporting energy coupling at all three sites although functionally a site 3 is probably not included. Nitrous-oxide reductase is periplasmic and soluble in P. denirrificans (Boogerd et al., 1981; Snyder and Hollocher, 1987). Nitrous oxide is reduced to dinitrogen in a twoelectron transfer (equation 38). The enzyme is a dimer with a molecular weight of 144,000 containing four copper atoms in each subunit. A similar enzyme has been purified from the marine denitrifying bacterium Ps.perfectomarinus. This reductase, like other reductases of oxides of nitrogen in P. denitrlficans is inhibited by nitric oxide (Matsubara rt al., 1982). N 2 0 + 2H'
+ 2e- -+N, + H,O
Em7= + 1355mV
(38)
The energy coupling is similar to nitric-oxide and nitrite reductases, and is a simple reduction consuming one proton for each electron but supporting proton translocation through sites 1 and 2 (Fig. 9biv). VII. Other Anaerobic Oxidants A. TRIMETHYLAMMONIUM N-OXIDE REDUCTION
Trimethylamine oxide (TM AO) can function as a terminal electron acceptor for micro-organisms growing under anaerobic conditions (Barrett and Kwan, 1985). Escherichia coli and Salmonella typhimurium can utilize TMAO reduction to support generation of a Ap (Lin and Kuritzkes, 1987). These bacteria can synthesize four TMAO-reductase activities, three of which are inducible and the fourth constitutive (Shimokawa and Ishimoto, 1979; Kwan and Barrett, 1983a). The TMAO and dimethyl-sulphoxide (DMSO) reductases from E. coli can
262
A. D. MOODIE A N D W. J. INGLEDEW
catalyse each other's reactions although with different affinities. Purified DMSO reductase has also been shown to reduce a variety of other substrates including chlorate. (Weiner et al., 1988; Sagai and Ishimoto, 1973).The many similarities between the TMAO reductase and DMSO reductase in E. coli have led to the suggestion that they are the same enzyme, although from the independent gene loci reported for each this would seem unlikely (Bilous and Weiner, 1988; Takagi and Ishimoto, 1983). The major inducible TMAO-reductase in E. coli is membrane bound with a molecular weight of approximately 200,000; it contains iron-sulphur groups and a molybdenum cofactor (Yamamoto et al., 1986). The site of TMAO reduction has not been identified as cytoplasmic or periplasmic in these bacteria, although a soluble periplasmic TMAO reductase has been identified in the phototroph Rhodopseudomonas capsulata (Bragg and Hackett, 1983; McEwan et al., 1985). Reduction of TMAO to trimethylamine is a twoelectron reaction which consumes two protons (equation 39). (CH,),NO
+ 2e- + 2H'
-+(CH3),N+ H,O
Em, = + 130mV
(39)
An Em7value of 130 mV supports site-1 oxidative phosphorylation. Lactate, formate, hydrogen, some amino acids and NADH have been identified as substrates for TMAO reduction in E. coli, with b- and c-type cytochromes being implicated in the electron-transport pathway between the dehydrogenases and the reductase (Bragg and Hackett, 1983; Yamamoto and Ishimoto, 1978; Nishimura ef al., 1983; Ringo et al., 1984). Quinones are involved as shown by the requirement for menaquinone to be present in membranes of both E. coli and Sal. typhimurium if TMAO is to be reduced (Cox and Knight, 1981; Meganathan, 1984; Kwan and Barrett, 1983b).The presence of nitrate under anaerobic growth conditions or aerobic growth represses TMAO reductase activity, whereas TMAO in the growth media induces synthesis of the reductase (Sagai and Ishimoto, 1973).Measured H+/2e- ratios of 3 4 for TMAO reduction by endogenous substrates have been obtained for E. coli (Takagi et al., 1981).The TMAO reduction product, trimethylamine (TMA), is of importance as the characteristic odour of decaying fish. The origin of TMAO in fish has not been positively identified but probably involves oxidation of TMA (Barrett and Kwan, 1985). B. DIMETHYL SULPHOXIDE REDUCTION
Dimethyl sulphoxide reduction has been reported in a variety of microorganisms (Zinder and Brock, 1978).Anaerobic growth of E. coliusing DMSO as a terminal oxidant is associated with a membrane-bound reductase; the product is dimethyl sulphide (DMS). Activity of DMSO reductase is repressed
MICROBIAL ANAEROBIC RESPIRATION
263
by nitrate or aerobic growth. Anaerobic growth on DMSO co-induces synthesis of nitrate, fumarate and TMAO reductases (Bilous and Weiner, 1985). Dimethyl-sulphoxide reductase from E. coli has been purified and shown to have a molecular weight of 155,000. It contains iron-sulphur groups and a molybdenum cofactor (Weiner et al., 1988). The two-electron reduction of DMSO to DMS has been characterized by Wood (1981; equation 40). (CH,),SO
+ 2e- + 2H'
-+(CH,)$
+ H,O
Em7= + 160 mV
(40)
This reaction, like TMAO reduction, has a high enough potential to support site 1 and has been shown to support proton translocation. Ratios for H+/2eof 2.9 have been obtained for DMSO reduction in the presence of glycerol as a reductant (Bilous and Weiner, 1985b). Proton release into the periplasm is most probably by vectorial transfer involving menaquinone and site 1 (Fig. 10a). A cytoplasmic location has been determined for the catalytic site of the DM SO reductase in E. coli (J. H. Weiner, personal communications). Consumption of two protons in the cytoplasm upon DMSO reduction will result in a contribution to the Ap only if electrons are vectorially transferred from the periplasmic surface of the enzyme.
c.
IRON(III) REDUCTION
Thiohacillus ferrooxidans is capable of growth by three redox processes, namely iron(r1) oxidation by oxygen, elemental sulphur oxidation by oxygen and anaerobic oxidation of elemental sulphur by iron(m) (Ingledew, 1982; Corbett and Ingledew, 1987; Bacon and Ingledew, 1989; M. A. Sharpe and W. J. Ingledew personal communications). The reaction of interest here is the
s
+
n,o
FIG. 10. Respiration of dimethyl sulphoxide (DMSO) and iron(1n). (a). Scheme for dimethyl sulphoxide (DMSO) supporting site-1 proton translocation in Escherichiu coli: MQ, menaquinone. (b). Scheme for elemental sulphur reduction of iron(rn) in Thiobacillus ferrooxidans (elemental sulphur/iron(nr) respiration). The overall process is acidogenic in the bulk phase but this will not give rise to large changes in pH value as the values will normally be around 2.0 and sulphate can buffer in this region. The Ap is maintained by proton translocation through the bc, complex. C indicates cytochrome c. Unknown components are identified with a question mark.
264
A D MOODIE A N D W. J. INGLEDEW
anaerobic reaction, the reduction of iron(rr1) utilizing elemental sulphur as a reductant. These bacteria are acidophiles involved in leaching of pyritic ores, and oxidation of elemental sulphur by iron(rrr) has been demonstrated in iron(Ir)/oxygen-grown cells but there were debates as to whether this process can be coupled to an energy-conserving system. This doubt stems from two sources. The first is a claim that cells cannot be grown on this couple; the second are reports that oxidation of elemental sulphur by oxygen is only energy-conserved beyond the iron(rr) site, i.e. only at the level of the oxygen reductase, site 3; Sugio et al., 1981, 1985, 1988). On the other hand, there are reports implicating the cytochrome bc, region in oxidation of elemental sulphur and showing that elemental sulphur/oxygen growth has a higher growth yield than iron(rr)/oxygen growth (Corbett and Ingledew, 1987; Kelly, 1982; see below). These findings appear incompatible. There is sufficient chemical energy available from oxidation of elemental sulphur by iron(rn) (AEh2average value approximately -410mV) for cell maintenance and growth should the cells have the ability to harness this energy. The potentials of the two ends of this latter process (S/SO:- and Fe3+/Fe2+)would implicate the cytochrome bc, region (site 2) of the respiratory chain, if the reaction were coupled. This contention is supported by observations that HOQNO (2-nheptyl-4-hydroxyquinoline N-oxide) inhibits both oxidation of elemental sulphur by oxygen and by iron(rrr), HOQNO being a classic site-2 inhibitor (Kelly, 1982; Corbett and Ingledew, 1987). Recently it has been claimed that T. ,ferrooxidans can be maintained and grown anaerobically on elemental sulphur with iron(r1r)as an oxidant (M. A. Sharpe, personal communications). An increase in both cell numbers and biomass on anaerobic growth of T.,ferrooxidans with elemental sulphur and iron(rr1) has been demonstrated. Cells so grown lacked the cytochrome a , of the oxygen reductase in this bacterium and hence associated oxygen-linked respiratory activities, but they retained high levels of elemental sulphur to iron (111) activity. In the study conducted by Sugio et al. (1988),an attempt was made to grow T.ferrooxidans on elemental sulphur with iron(rrr)as a terminal acceptor. There appear to be number of errors in the way the experiment was devised. The only carbon source made available to the bacterium was in the form of bicarbonate added at the beginning of the incubation. The culture was subsequently purged with dinitrogen. Bicarbonate added to an acidic media will very rapidly break down to carbon dioxide (the media were at about pH 2.0) and this will be purged at the commencement of incubation. Thus no carbon source was available for growth in their experiments. In addition the dominant anion in their culture was chloride. This is known to be unsuitable for growth in acidic media (Alexander et al., 1987). A model to explain coupling of oxidation of elemental sulphur to iron(1r) reduction and Ap generation is illustrated in Fig. lob.
MICROBIAL ANAEROBIC RESPIRATION
265
VIII. Conclusions Carbon dioxide, nitrate, sulphate and related compounds are aiternative oxidants of major environmental significance, their reduction playing important roles in the global carbon, nitrogen, and sulphur cycles. The sulphate-reducing bacteria are also of commercial importance in that they generate toxic fumes and cause corrosion of metal pipes in anaerobic situations; this is particularly important in the oil industry (Hamilton, 1985). In microbial ore extraction the use of iron(irr)as an alternative oxidant in the anaerobic parts of the leaching dumps is of importance in enhancing solubilization of the pyritic ore (M. A. Sharpe and W. J. Ingledew, personal communications). Reduction of TMAO as a respiratory oxidant is important in the fishing industry as it is responsible for the amine smell of spoiled fish. We have reviewed available information on utilization by bacteria of alternative oxidants to oxygen, concentrating on the way in which these respirations are utilized by the cell to generate a Ap. The mechanism of oxidative phosphorylation is universal but these bacteria have often provided unique and interesting mechanisms for establishing a Ap. Thermodynamically and chemically less advantaged than aerobes they nonetheless play a vital role in the ecology of our planet. REFERENCES
Abou-Jaoude, A., Chippaux, M., Pascal, M. C. and Casse, F. (1977). Biochemical and Biupli~.sicd Research Communicuiions 78, 579. Abou-Jaoudc. A., Pascal, M. and Chippaux. M. (1979). Europenn Journalqf'Bic~chemi.s/ry95,315. Addanki, S., Cahill. F. D. and Sotos, J. F. (1968). Journal qf Biological Chemistry 243. 2337. Alexander, B., Leach, S. and Ingledew, W. J. (1987). Journal ufGeneral Microbiology 133, 1171. Anraku. Y. and Gennis, R. B. (1987). Trends in Biochemical Sciences 12, 262. Anthony, C., ed. (1988). "Bacterial Energy Transduction". Academic Press, London. Bacon, M. and Ingledew, W. J. (1989). FEMS Microbiology Lerrers 58, 189. Badziong. W. and Thauer. R. K. (1978). Archities of Microbiology 117, 209. Balch, W. E., Fox, G. E., Magrum, L. J., Woese, C. R. and Wolfe, R. S . (1979). Microhiolugj~ Reviews 43, 260. Ballard, A. L. and Ferguson, S . J. (1987). Biochemical Socie/y Trunsuc/ions 15. 937. Barrett, E. L. and Kwan. H. S . (1985). Annual Reuie~'q/'Microhiology 39, 131. Bilous, P. T. and Weiner, J. H. (198%). Journal qf Bucreriology 162, 1151. Bilous. P. T. and Weiner, J. H. (198%). Journal qf Bacreriology 163, 369. Bilous, P. T.and Weiner, J. H. (1988). Juurnal qf'Bacteriology 170, 151 1. Blaut, M. and Gottschalk, G. (1985). Trends in Biochemical Sciences 10, 486. Blaylock. B. A. and Stadtman, T. C. (1966). Archives of Biocliemistry and Biophysics 116, 138. Boogerd. F. C.. Van Verseveld, H. W. and Stouthamer, A. H. (1983).Biochiniicu e / Biop/i.~xicuAc/u 723, 4 15. Boogerd. F. C., Van Verseveld, H. W. and Stouthamer. A. H. (1981). Biochimicuer Biophy.sicu AcIu 683, 181. Boonstra, J., Huttunen. M. T. and Konings, W. N. (1975). Journal uf Biologicul Clwmisrry 250, 6792. Boonstra, J., Downie. J. A. and Konings, W. N. (1978). Journal qf'Bacreriology 136, 844. Booth, 1. R. (1985). Microbiological Reviews 49, 539.
266
A. D. MOODIE A N D W. J. INGLEDEW
Boxer, D. H. and Clegg, R. A. (1975). FEES Letters 60,54. Bragg. P. D. and Hackett, N. R. (1983). Biochimica et Biophysica Acla 725, 168. Bramlett, R. N. and Peck, H. D. (1975).Journal of Biological Chemistry 250, 2979. Brice, J. M., Law, J. F., Meyer, D. J. and Jones, C. W. (1974). Biochemical Society Transactions 2, 523. Carlson, C. A,, Ferguson, L. P. and Ingraharn. J. L. (1982). Journal of Bacteriology 151, 162. Carnmack, R.. Patil, D. S. and Weiner, J. H. (1986). Biochimica et Biophysica Acta 870, 545. Carr, G. J., Page, M. D. and Ferguson, S. J. (1989). European Journal of Biochemistry 179,683. Chambers, L. A. and Trudinger, P. A. (1975). Journal of Bacteriology 123, 36. Cheeseman, P., Toms-Wood, A. and Wolfe, R. S. (1972). Journal of Bacteriology 112, 527. Cole, J. A. (1982). Biochemica[ Suciety Transacfions 10,476. Cole. J. A. (1988). Symposia of’the Society for General Microbiology 42, 281. Cole, J. A. and Brown, C. M. (1980). FEMS Microbiology Letters 7, 65. Cole, J. A. and Ferguson, S. J., eds (1988). Symposia of’the Society,for General Microbiology 42. Cole, S. T. (1982). European Journul of Biochemistry 122, 479. Cole, S. T., Grundstrom, T., Jaurin, B.,Robinson, J. J. and Weiner, J. H. (1982). European Journal uf Biochemistry 126, 21 1. Cole, S. T. and Guest, J. R. (1979a). FEMS Microbiology Letters 5, 65. Cole, S. T. and Guest, J. R. (l979b). European Journal of Biochemistry 102, 65. Coleman, K. J., Cornish-Bowden, A. and Cole, J. A. (1978a). Biochemical Journal 175,483. Coleman, K. J.. Cornish-Bowden. A. and Cole, J. A. (1978b). Biochemical Journal 175, 495. Condon, C. and Weiner, J. H. (1988). Molecular Microbiology 2, 43. Corbett, C. M. and Ingledew, W. J. (1987). FEMS Microbiology Letters 41, I . Cox, J. C. and Knight, R. (1981). FEMS Microbiology Letters 12, 249. Craske, A. and Ferguson, S. J. (1986). European Journal of Biochemistry 158, 429. Daniels, L., Fuchs, G., Thauer, R. K. and Zeikus, J..G. (1977). Journal of Bacteriology 132, 118. Daniels, L.. Sparling, R. and Sprott. G. D. (1984). Biochimica et Biophysica Acra 768, 113. Dickie, P. and Weiner, J. H. (1979). Canadian Journal of Biochemistry 57, 813. Doddema, H. J., Van der Drift, C., Vogels, G. D. and Veenhuis, M.(1979).Journal Of’Bacteriolog.~ 140. 1081. Donnelly, M. I., Escalante-Semerena, J. C., Rinehart, K. L. and Wolfe, R. S. (1985). Archives u/ Biochemistry and Biophysics 242. 430. Edlund, T., Grundstrom, T. and Normark, S. (1979). Molecular and General genetic.^ 173, 115. Eirich, L. D., Vogels, G. D. and Wolfe, R. S. (1979). Journal of Bacteriology 140, 20. Ellefson. W. L., Whitman, W. B. and Wolfe. R. S. (1982). Proceedings of the National Academy qf Sciences of the United States of America 79, 3707. Ferguson, S. J. (1987). Trends in Biochemical Sciences 12, 354. Ferguson, S. J. (1988). Symposia of the Society for General Microbiology 42, 1. Garland, P. B., Downie, J. A. and Haddock, B. A. (1975). Biochemical Journal 152, 547. Goldberg, I., Lonbcrg-Holm, K., Bagley, E. A. and Stieglitz. B. (1983).Appliedand Enuironnientul Microbiology 45, 1838. Grundstrom, T. and Jaurin, B. (1982). Proceedings of the National Academy of Sciences of’ the United States u/‘ America 79, I I 1 I. Guest. J. R. (1981). Journalof General Microbiology 122, 171. Gunsalus, R. P. and Wolfe. R. S. (1977). Biochemicaland Biophysical Research Communications 76, 790. Gunsalus, R. P. and Wolfe, R.S. (1978). Journal of Eacreriology 135, 851. Gutowski, S. J. and Rosenberg, H. (1976). Biochemical Journal 160, 813. Gutowski, S. J. and Rosenberg, H. (1977). Biochemical Journal 164, 265. Haddock, B. A. and Kendall-Tobias, M. W. (1975). Biochemical Journal 152, 635. Haddock, B. A. and Hamilton, W. A. eds. (1977). Symposia of the Societyfor General Microbiology 27.
Hamilton, W. A. (1985). Annual Review of Microbiology 39, 195. Hartzell, P. L., Zvilius, G., Escalante-Semerena, J. C. and Donnelly, M. I. (1985). Biochemiculand Biophysical Research Communications 133, 884. Hatchikian, E. C., Bruschi, M., Forget, N. and Scandellari, M. (1982). Biochemical and Biophvsical Research Communications 109, 13 16.
MICROBIAL ANAEROBIC RESPIRATION
267
Hatchikian, E. C. and Zeikus, J. G . (1983). Journal qfBacteriology 153, 1211. Hausinger, R. P., Moura. I.. Moura, J. J. G., Xavier, A. V.. Santos, M. H., LeGall. J. and Howard, J. B. (1982).Journal of Biological Chemistry 257. 14192. Hellingwerf, K. J., Bolscher, J. G. H. and Konings, W. N. (1981).European JournulqfEiochemistry 113, 369. Higgins, I. J. (1980).I n “Diversity of Bacterial Respiration Systems” (C. J. Knowles, ed.), vol. 1 , pp. 187-221. CRC Press, Boca Raton. Hippe, H., Caspari, D., Fiebig, K. and Gottschalk, G (1979).Proceedings of the National Academ! of Sciences of the United States of America 76. 494. Houwen, F. P., Van der Drift, C . and Vogels, G. D. (1983).Journal uf Bacteriolog). 153, 6. Ingledew, W. J. (1977). FEMS Microbiology Letters 2, 193. Ingledew, W. J. (1982). Biochimica et Biophysica Acta 683, 89. Ingledew, W. J. ( 1983).Journal of General Microbiohgy 129, 165 1. Ingledew. W. J. and Poole, R. K. (1984). Microbiological Reviews 48, 222. Ingledew, W. J. and Saraste, M. (1979). Biochemical Society Transactions 7, 166. Ingledcw. J. C.. Cox, J. C. and Halling, P. J. (1977). F E M S Mic1~~hic~10g.1. L P I I E I2.. . ~193. Jackson, R. H., Cornish-Bowden, A. and Cole, J. A. (1981). Biochemical Journal 193, 861. John, P. (1977).Journal of General Microbiology 98, 231. John, P. and Whatley, F. R. (1977). Biochimica et Biophysica Acta 463, 129. Johnson,M. K., Thomson, A. J., Walsh,T. A., Barber, D. and Greenwood, C. (1980).Biochemicul Journal 189,285. Jones, J. B. and Stadtman, T. C. (1980).Journal of Biological Chemistry 255, 1049. Jones, R. W. and Garland, P. B. (1977). Biochemical Journal 164, 199. Jones, R. W. (1980). FEMS Microbiology Letters 8, 167. Jones, W. J., Nagle, D. P. and Whitman, W. B. (1987). Microbiological Reviews 51, 135. Jones, C. W. (1988). I n “Bacterial Energy Transduction” (C. Anthony, ed.), pp. 1-82, Academic Press, London. Kajie, S. and Anraku, Y. (1986). European Journal qf Biochemistry 154, 457. Kell, D. B. (1986). Methods in Enzymology 127, 538. Kelly, D. P. (1982). Philosophical Transactions of the Roval Society of London B 298, 499. Keltjens, J. T. and Van der Drift, C. (1986). FEMS Microhiokogy Reviews 39. 259. Kenealy, W. and Zeikus, J. G. (1981). Journal of Eacteriology 146, 133. Kenney, W. C., Walter, W. H. and Singer, T. P. (1977).Journal qf Biological Chemistry 247,4510. Kim, C. and Hollocher, T. C. (1983).Journal of Biological Chemistry 258, 4861. Konings, W. N. and Kaback, H. R. ( 1973).Plocwdin,y.s of the National Academy qfSciences of the United States qf America 70, 3376. Kramer, J. F., Pope, D. H. and Salerno, J. C. (1987).1n”Advances in Membrane Biochemistry and Bioenergetics”(C. H. Kim, H. Tedeschi, J. J. Diwan and J. C. Salerno, eds), pp. 249-258. Plenum Press, New York. Kristjansson, J. K. and Hollocher, T. C . (1979). Journal of Bacteriology 137, 1227. Kroger, A. (1978). Biochimica el Biophysica Acta 505, 129. Kroger, A., Schroder, J., Paulsen, J. and Beilmann, A. (1988).Symposia of the Society,for General Microbiology 42, 133. Kuhn, W., Fiebig, K.. Hippe, H., Mah, R. A., Huser, B. A. and Gottschalk, G. (1983). FEMS Microbiology Letters 20, 407. Kwan, H. S. and Barrett, E. L. (1983a).Journal of Bacteriology 155, 1455. Kwan, H. S. and Barrett, E. L. (1983b). Journal of Bacteriology 155, 1147. Lancaster, J. R. (1986). FEBS Letters 199, 12. Lancaster, J. R. (1987).In “Advances in Membrane Biochemistry and Bioenergetics” (C. H. Kim, H. Tedeschi, J. J. Diwan and J. C. Salerno, eds), pp. 363-388. Plenum Press, New York. Large, P. J. (1983).“Methylotrophy and Methanogenesis”, Aspects of Microbiology, Vol. 8. Van Nostrand Reinhold, London. Lee, J. and Peck. H. D. (1971). Biochemicul and Biophysical Research Communications 45. 583. Lee, J., Yi, C., LeGall, J. and Peck, H. D. (1973).Journal of Bacteriology 115, 453. Leigh, J. A., Rinehart, K. L. and Wolfe, R. S. (1985). Biochemi,stry 24, 995. Lemire, B. D., Robinson, J. J. and Weiner, J. H. (1982). Journal qf Bucteriologj> 152, 1126.
268
A. V. MOODIE A N D W.J. INGLEDEW
Lemire, B. D., Robinson, J. J.. Bradley, R. D., Scraba, D. G . and Weiner, J. H. (1983). Journal of Bacteriology 155, 39 I . Lin, E. C. C. and Kuritzkes, D. R. (1987). In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology”(F. C. Heidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter and H. E. Umbarger, eds), vol. 1, pp. 201-221. American Society b r Microbiology, Washington DC. Lohmeier. E., Hagen, D. S., Dickie, P. and Weiner, J. H. (1981). Canadian JournalofBioehami.str~~ 59, 158.
Lupton, F. S., Conrad, R. and Zeikus, J. G. (1984). Journal of Bacteriology 159, 843. Macy, J.. Kulla, H. and Gottschalk, G . (1976). Journal uf Bacteriology 125, 423. Matsubara. T., Frunzke, K. and Zumft. W. G. (1982). Journal of Bacterio1og.y 149, 816. McEwan, A. G., Wetzstein, H,G., Ferguson, S. J. and Jackson, J. B. (1985). Biochimicu rt Biiphysicu Ai,tcr 806. 4 10. McRee, D. E., Richardson, D. C., Richardson, J. S. and Siege], L. M. (1986).JournalofBifJlo~iciJl Chernisrry 261, 10277. Meganathan, R. (1984). F E M S Microbiology Lrfters 24, 57. Miki, K. and Lin, E. C. C. (1975a). Journal q/’Bacteriology 124, 1282. Miki. K. and Lin, E. C. C. (197%). Journal of’Eacteriology 124, 1288. Miller, T. L. and Wolin, M. J. (1983). Journal ofBacteriology 153, 1051. Miller, T. L. and Wolin, M. J. (1985). Archives qf Microbiology 141, 116. Mitchell, P. (1961). Noture 191, 144. Mitchell, P. ( 1966).“Chemiosmotic Coupling in Oxidative and Photosynthetic Phosphorylation”. Glynn Research, Bodmin Cornwall. Mitchell, P. ( 1 968). “Chemiosmotic Coupling and Energy Transduction”. Glynn Research, Bodmin, Cornwall. Morningstar, J . E., Johnson, M. K., Cecchini, G., Ackrell, B. A. C. and Kearney, E. B. (1985). Journul of Biologicd Chemistry 260, 1363I. Nicholls, D. G. (1982). “Bioenergelics: An Introduction to the Chemiosmotic Theory”. Academic Press, London. Nishirnura. Y.,Tan, 1. K. P., Ohgami, Y.,Kohgami, K. and Kamihara, T. (1983). F E M S Microbiology Letters 17, 283. Noll, K. M., Rineharl, K. L., Tanner, R. S. and Wolfe, R. S. (1986). Proceedings ofthe National Academy c?fScience.rof the United Stares of America 83. 4238. Odom, J. M. and Peck, H. D. (1981). FEMS Microbiology Letters 12, 47. Odom, J. M. and Peck. H. D. (1984). Annuul Review q / Microbiology 38, 551. Parsonage, D. and Ferguson, S. J. (1983). F E B S Letters 153, 108. Parsonage, D., Greenfield, A. J. and Ferguson, S. J. (1985). Biochimica er Biophysica Acru 807.81. Peck. H. D. and LeGall, J. ( I 982). Philosophical Tran.wctions ofthe R(iyu1 Society ( I f London B 298, 443. Peck, H. D. and Lissolo, T. (1988). Symposia of the Society,fiw General Microbiology 42, 99. Perski, H. J., Schonheit, P. and Thauer, R. K. (1982). FEBS Lerrers 143, 323. Pfennig, N. and Biebel, H. ( I 976). Archives of Microbiology 110, 3. Poole, R. K. and Ingledew, W. J. (1987). I n “Escherichia coli and Salmonella typhimurium: Ccllular and Molecular Biology” (F. C. Heidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter and H. E. Umbarger. eds), vol. 1, pp. 17&200. American Society of Microbiology, Washington DC. Pope, N. R. and Cole, J. A. (1982). Journal qfGenera1 Microbiology 128, 219. Postgate, J. R. and Kelly, D. P., eds (1982). Philosophical Transactions of the Royal Socierv of’ London B 298. 429. Postgate, J. R. (1984). “The Sulphate Reducing Bacteria”, 2nd edn. Cambridge University Press, Cambridge. Puustinen. A., Finel, M., Virkki, M. and Wilkstrom, M. (1989). FEBS Microbiology Letterx 249. 163. Reeves, R. E. and Guthrie, J. D. (1975). Biochemiculurid Biophysical Re.warch Communications66, 1389. Ringo, E.. Stenberg, E. and Strom, A. R. (1984). Applied and EnL~ironmentulMicrobiology 47, 1084.
MICROBIAL ANAEROBIC RESPIRATION
2 69
Rosenberg, H., Cox, G. B., Butlin, J. D. and Gutowski, S. J. (1975). Biochemical Journal 146.41 7. Sagai, M. and Ishimoto, M. (1973). Journal ofBiochemi.s/ry 73, 843. Schauer, W. L. and Ferry, J. G. (1982). Journal of Bacteriology 150, 1. Shapiro, S. and Wolfe, R. S. (1980). Journal of Bacteriology 141, 728. Shapiro, S. (1982). Canadian Journal o/ Microbio1og.v 28, 1409. Shapleigh. J. P.. Davies. K. J. P. and Payne, W. J. (1987). Bioc~liiniicuPI Bi(~p/ij..~ict/ Ac,ru 91 1. 334. Shimokawa. 0. and Ishimoto, M. (1979). Journul sf’ Bioc/iemistry 86, 1709. Simpkin, D. and Ingledew, W. J. (1984). Journal of General Mk‘rObiokJgy 130. 2851. Simpkin, D. and Ingledew, W. J. (1985). Biochemical Sociery Transactions 13, 603. Simpkin, D. (1985). PhD Thesis: University of St Andrews, UK. Singh, A. P. and Bragg, P. D. (1975). Biochimicu et Biophysica Acta 396. 229. Singh. A. P. and Bragg, P. D. (1976). Biochimica et Biophysica Acta 423, 450. Snyder, S. W. and Hollocher, T. C. (1987). Journal qf Biological Chemistry 262. 651 5. Solioz, M., Carafoli, E. and Ludwig, B. (1982). Journal of Biological Chemistry 257. 1579. Spencer, R. W., Daniels, L., Fulton, G. and Orme-Johnson, W. H. (1980). Biocheniistr~19, 3678. Sprott, G. D., Sowden, L. C., Colvin, J. R. and Jarrell, K. F. (1984). Canadian Journal sf’ Microbiology 30,594. Stouthamer. A. H.. Van’t Rient, J. and Oltmann, L. F. (1980). I n “Diversity of Bacterial Respiratory Systems“ ( C . J. Knowles. ed.), vol. 2, pp. 1 9 4 8 . CRC Press. Boca Raton. Sugio. T.. Tano, T. and Imai, K. (1981). Agriculturirl und Biologicul Chcwii.\trj, 45, 393. Sugio, T., Domatsu, C., Munakata, O., Tano, T. and Imai, K. (1985). Applied und Enirironmen/al Microbiology 49, 1401. Sugio, T., Wada, K., Mori, M., Inagaki, K. and Tano. T. (1988). Applied and Ent1ironniental Microbiolog~~ 54, 150. Takagi, M. and Ishimoto. M. (1983). FEMS Microbiology Le//ers 17, 247. Takagi. M., Tsuchiya, T. and Ishimoto, M. (1981). Journal of Bacteriology 148, 762. Taylor, C. D. and Wolfe, R. S. (1974). Journal of Biological Chemi.stry 249, 4879. Thauer, R. K. (1982). Philosophical Transactions qf the Royal Society of London B 298. 467. Timkovich. R. and Robinson, M. K. ( I 979). Bioc~hmliculand Biopliy.sica/ Research Conimunications 88, 649. Trudinger, P. A. ( I 970). Journal uf BUcteriokJg?, 104, 158. Tzeng, S. F.. Wolfe, R. S . and Bryant, M. P. (1975a). Journal of Bactrriolugy 121, 154. Tzeng. S. F., Bryant, M. P. and Wolfe, R. S. (3975b). Journal of Bac~teriology121, 192. Van Beelen. P.. Van Neck, J. W., de Cock, R. M., Vogels, G. D., Guijt, W. and Haasnoot, C. A. G. (1984). Biochemistry 23, 4448. Van der Meijden. P., Heythuysen, H. J., Sliepenbeek, H. T., Houwen, F. P., Van der Drift, C. and Vogels, G. D. (1983). Journal uf’Bacteriology 153, 6. Van der Plas, J., Hellingwerf, K. J., Seijen, H. G.. Guest, J. R., Weiner, J. H. and Konings, W. N. (1983). J(JUrnU/of Bucrrriulog,~153, 1027. Van’t Rient, J.. Wientjcs, F. B.. Van Doorn. J. and Planta, R. J. (1979). Biochiniic,u r t Biop/i~’.vica Acta 576, 347. Vogels. G . D. and Visser, C. M. (1983). FEMS Microbiology Letters 20, 291. Ware, B. A. and Postgate, J. R. (1971). Journal of General Microbiology 67, 145. Weiner, J. H., MacIsaac. D. P., Bishop. R. E. and Bilous. P. T. (1988).Journalof Bacteriology 170, 1505. Widdel, F. (1987). “Environmental Microbiology of Anaerobes”. Wiley, New York. Wikstrom. M.. Krab, K. and Sarastc, M. (1981). “Cytochrome Oxidasc, A Synthesis”. Academic Press, London. Woese. C. R. (1987). Microbiological Reviews 51, 221. i Sciencw 10, 396. Wolfe, R. S. (1985). Trivid.?i ~ Bioclic~mii~al Wood. P. M. (1981). FEES Letters 124, 11. Yamamoto, 1. and Ishimoto, M. (1978). Journal of’Biocheniistry 84, 673. Yamamoto, I., Okubo, N. and Ishimoto, M. (1986). Journal oJ’Biochemisrry 99, 1773. Zinder, S. H. and Brock, T. D. (1978). Journal of General Microbiology 105, 335. Zumft, W. G.. Viebrock, A. and Korner, H. (1988). Symposia q/ /he Socie/y for General Microbiology 42, 245.
This Page Intentionally Left Blank
Author Index Numbers in bold rc+r
10
the p q e s on nhich references ure listed
A
Abaigan, N., 212, 219 Abe, M., 103, 119 Aber, V. R., 100, 120 Abou-Jaoude, A., 259, 265 Abril, M.-A., 30, 61, 64 Ackrell, B. A. C., 253, 268 Acton, M. A., 186, 190, 196, 202, 205, 206, 208, 223 Adapoe, C,, 89, 120 Addanki, S., 260, 265 Adler, H. I., 200, 219 Agrawal, S., 116, 121 Ajioka, J., 188, 222 Akimori, H., 77, 121 Akiyama, Y., 190, 196, 219 Albright, L. M., 34, 68 Alcina, A., 188, 216 Aldritt, S. M., 90, 119 Alexander, B., 244, 264,265 Alibadi, Z., 191, 192, 222 Aliperti, G., 184, 222 Allan, B., 191, 216 Allis, C. D., 188, 219 Amaral, M. D., 188, 208,216 Amarantidis, G., 127, 130, 131, 132, 174, 176, 181 Ambrose, E. J., 93, 99, 113, 121 Amers, G. F.-L., 89, 121 Ames, B. N., 104, 122, 191, 197, 199, 200,217, 220,221
Ananthan, J., 196, 217
ut
the end
of euch chupter
Anders, R. F., 21 I , 217 Anderson, B. R., 101, 120 Andrew, P. W., 100, 121 Andrews, D. R., 187,222 Aniebo, C. M., 188, 223 Anraku, Y., 233, 259, 265, 267 Anthony, C., 227, 230,265 Antia, N. H., 73, 82, 85, 99, 122, 123 Antoine, I., 86, 119 Ardeshir, F., 89, 121, 21 I , 217 Arnosti, D. N., 189, 217 Arribas, C., 193, 217 Arrigo, A-P., 216, 217 Asay, Y., 21, 28, 63, 66 Ashburner, M., 184, 185,217, 222 Asselineau, C., 83, 85, 121 Assinder, S. J., 53, 64 Astbury, L., 103, 120 Athwal, R. S., 86, 119 Atkinson, B. G., 184, 217 Atkinson, W. H., 96, 119 Attardi, G., 214, 215, 217 Audus, L. J., 2, 64 Aurelle, H., 85, 119 Austen, R. A., 8, 34, 64 Ausubel, F. M., 27, 31, 34, 67, 68 Ausubel, F. R., 198, 217 Autor, A. P., 200, 223
B Bacon, M., 263, 265 Badzoig, W., 249, 265
212
AUTHOR INDEX
Bagdasarian, M., 9, 20, 21, 25, 26, 30, 3 I , 63, 65, 68 Bagley, E. A., 253, 266 Bairoch, A., 26, 53, 65, 67 Balch, W. E., 236, 265 Balkwill, D. L., 146, 179 Ballard, A. L., 258, 265 Ballard, D. G. H.. 62, 64 Baltassat, P., 96, 119 Band, A. H., 99, 119 Banerjee, D. K., 72, 73, 94, 100, 101, 114, 119, 123
Banerjee, S. K., 166, 179 Bapat, C. V., 93, 121 Barahona, I., 188, 217, 221 Barankiewicz, J., 95, 119 Barber, D., 260, 267 Barckar, K. A., 193, 223 Barclay, R., 87, 89, 96, 100, 104, 107, 114, 119
Bardwell, J. C. A,, 186, 193, 194, 205, 217
Barg, L. L., 81, 124 Barrett, E. L., 261, 262, 263, 265, 267 Barry, V. C., 1 12, I I 9 Bartel, B., 192, 218 Bas, S., 20, 68 Baskin, G. B., 72, 124 Basten, A,, 103, 120 Basu, J.. 80, 121 Baulieu, R., 96. 119 Baumann, G., 186, 222 Bauminger, R., 159, 180 Bayley, S. A., 8, 18, 19, 37, 39, 64, 65 Bayly, R. C., 10, 17, 64, 66, 68 Bazylinski, D. A., 127, 131, 139, 140, 141, 142, 143, 144, 145, 148, 159, 177, 179, 180 Beak, T. F., 113, 123 Bean, C., 166, 179 Becker, J., 201, 217 Beilmann, A., 251, 252, 267 Bender, R. A., 34, 68 Benichou, J. C., 103, 120 Benson. S., 9, 64 Bercovier, H., 74, 119 Berglund, L. E., 193, 223 Berson, A. E., 139, 179 Bestetti, G., 10, 52, 64 Bet-Belpomme, M., 201, 217
Bevan, M., 186, 222 Beveridge, E. G., 116, 120 Beveridge, T. J., 146, 147, 161, 179 Bhadadwaj, V. P.,87, 124 Bhagaria, A., 116, 121 Bhagria, A., 116, 120 Bharadwaj, V. P., 76, 106, 107, 121, 124 Bhattacharya, A., 99, 119 Bianco, A. E., 21 1, 217 Bicudo, C. E. M., 127, 134, 148, 181 Biebel, H., 252, 268 Bienz, M., 184, 194, 217 Bilous, P. T., 262, 263, 265, 269 Binford, C. H., 72, 119, 124 Birge, C. H., 210, 212, 222 Birkman, A., 34, 64 Bishop, R. E., 262, 263, 269 Blakemore, N., 126, 177, 180 Blakemore, R. P., 125, 126, 127, 130, 131, 145, 155, 166,
134, 136, 139, 140, 141, 143, 144, 146, 147, 148, 149, 150, 151, 154, 156, 157, 158, 159, 160, 161, 164, 172, 173,179, 180 Blaut, M., 236, 265 Blaylock, B. A., 240, 265 Blobel, G., 104, 119, 214, 215, 217, 221 Bloch, C. A,, 198, 217 Bloch, K., 85, 120 Bloom, B. R., 78, 79, 87, 103, 113, 119, 120, 121, 122, 123, 21 I , 221 Board, R. G., 127, 128, 130, 131, 132, 154, 170, 180 Bochkareva, E. S., 214, 217 Bochner, B. R., 200, 217, 220 Bock, A,, 34,64 Bockman, A., 106, 122, 190, 219 Boddy, L., 133, 179 Boggers, J. D., 96, 121 Bole, D. G., 213, 217, 218, 219 Bolscher, J. G. H., 255, 267 Bonato, C . M., 187, 217 Bond, U., 184, 194, 195, 217 Bonner, J. J., 184, 185, 217 Bonstra, J., 255, 265 Boogerd, F. C., 259, 261, 265 Boorstein, W. R., 185, 218 Booth, R. J., 103, 120 Bopp, L. H., 35, 38, 65 Borbely, G., 192, 217, 222 Bory, C., 96, 119
AUTHOR INDEX
Bosrnans, R., 105, 119 Both, 1. R., 244, 265 Boucherie, H., 189, 217 Boxer, D. H., 258, 266 Bradley, D. E., 9, 64 Bradley, R. D., 253, 267 Bragg, P. D., 255, 262, 266, 269 Braithwaite, C. E., 187, 220 Brambl, R., 187, 203, 207, 209, 221 Brarnlett, R. N., 245, 266 Brandao Filho, S. L., 82, 123 Brandhorst, B. P., 187, 219 Brandi, G., 198, 217 Brawner, M., 62, 66 Breedveld, F. C., 21 I , 222 Brennan, P. J., 78, 79, 85, 120, 121 Brenner, H., 126, 169, 179 Brenner, M. B., 21 I , 221 Brice, J. M., 255, 266 Britton, W. J., 103, 120 Brock, T. D., 262, 269 Broda, P., 8, 18, 19, 20, 34, 35, 37, 38, 39, 50, 52, 64, 65, 66, 67 Brodie, A. F., 76, 119 Browder, Z., 188, 222 Brown, A,, 191, 220 Brown, G. V., 21 I , 217 Brown, H. L., 72, 119 Brown, J. M., 259, 266 Brown, P. R., 11 I , 120 Bruschi, M., 237, 266 Bryant, M. P., 238, 240, 269 Buchanan, T., 103, 124 Buchanan, T. M., 81, 124 Buck, G., 188, 222 Buck, M., 33,64 Buduan, P. V., 162, 163, 180 Bulmer, K., 90, 91, 124 Bunch, A. W., 1 1 3, 119 Burdon, R. H., 184, 217 Burkot, T. R., 21 1, 217 Butcher, P. D., 114, 122 Butler, C. A., 191, 220 Butler, R. F., 166, 179 Butlin, J. D., 255, 268 Byers, B., 195, 218 Byrne, G. I., 109, 119
C Cadenas, F., 197,217
273
Cahill, F. D., 260, 265 Caltelle, M.-A., 85, 121 Cammack, R., 253, 266 Campo, A. J. R., 212, 222 Cane, P. A., 37, 52, 53, 64 Cantoni, O., 198, 217 Cantor, C. R., 187, 210, 212, 223 Capone, D. G., 141, 179 Carafoli, E., 233, 269 Carlile, M. J., 127, 135, 169, 179 Carlioz, A., 198, 217 Carlson, C. A., 258, 266 Carlson, N., 195, 217 Carper, S. W., 203, 217 Carr, G. J., 260, 261, 266 Carrasco, L., 188, 216 Cartel, J. L., 72, 119 Carter, B. L. A., 206, 223 Carter, H. L., 62, 67 Caspari, D., 242,267 Casse, F., 259, 265 Casson, L. P., 193, 196, 218 Cattabeni, F., 198, 217 Cavicchioli, R., 188, 204, 205, 207, 208, 209, 217,223 Cecchini, G., 253, 268 Chadwick, M. V.,91,93, 1 1 1 , 112, 119 Chakrabarti, P., 80, 121 Chakrabarty, A. M., I , 2, 3, 10, 35, 38, 52, 56, 59, 63, 64, 65, 68 Chalmers, R. M., 14, 65 Chamberlin, M . J., 189, 217 Chambers, L. A,, 247, 266 Chan, W. L., 193, 220 Chandrasekharappa, S., 63, 65 Chang, S.-B., 127, 131, 176, 180 Chang, S. C., 213, 217 Chapman, P. J., 5, 10, 18, 39, 41, 45, 56, 66 Chappell, T. G., 212,217 Charloteaux-Weuters, M., 145, 179 Chary, P., 201, 217 Chaterjee, D. K., 59, 63, 65 Chatfield, L. K., 49, 52, 65 Chatterjee, B. R., 112, 119 Cheesman, P., 236, 266 Cheng, M. Y . , 214, 217 Chin, D. T., 213, 217 Chiodini, R., 114, 122 Chippaux, M., 259, 265
274
AUTHOR INDEX
Chirico, W. J., 104, 119, 214, 215, 217 Chitamber, S. D., 99, 119 Chou, G., 2, 65 Chretien, P., 203, 204, 208, 220 Chrichton, R. R., 145, 179 Christ, C. L., 162, 179 Christman, M . F., 104, 122, 191, 197, 199, 217, 221 Chulawalla, R., 93, 121 Chung, C. H., 196, 217 Ciechanover, A., 193, 219 Clark-Curtiss, J., 86, 87, 103, 114, 119, 120, 124 Clarke, P. H., 10, 42, 44, 65, 66 Clegg, R. A,, 258, 266 Clements, J., 27, 28, 65 Cline, M. J., 93, 108, 119 Cocito, C., 74, 86, 119 Coene, M., 86, 119 Coey, J. M. D., 178, 180 Cohen, A., 95, 119 Cohen, 1. R., 21 I , 222, 223 Cohn, A. Z., 107, 123 Cohn, Z. A,, 101, 121 Coias, R., 188, 217 Cole, J. A., 227, 253, 258, 259, 266, 267, 268 Cole, S. T., 253, 266 Coleman, K. J., 259, 266 Coligan, J. E., 21 I , 219 Collins, M. E., 91, 119 Colston, M. H., 72, 73, 94, 100, 114, 119, 123 Colston, M. J., 72, 89, 96, 112, 121, 122 Colvin, J. R., 239, 269 Conalty, M. L., 112, 116, 119, 122 Condon, C., 253, 266 Conrad, R., 251, 268 Convit, J., 78, 79, 121 Cook, C. L., 187, 210, 212, 219 Copel, R. L., 21 I , 217 Copeland, C. S., 213, 219 Corbett, C. M., 263, 264, 266 Cornish-Bowden, A., 259, 266,267 Costa, M. H. L., 73, 123 Couderc, F., 85, 119 Couling, S. B., 162, 179, 180 Coulson, R. M. R., 212, 222 Courgeon, A.-M., 201, 217
Courteaux, L., 127, 128, 130, 131, 132, 137, 154, 170, 179, 180 Courtis, A., 62, 64 Cowan, D., 186, 220 Cowing, D. W., 27,68, 191, 217 Cox, G. B., 255, 268 Cox, J. C., 238, 262, 266, 267 Cox. J. H.. 210. 21 1. 223 Craig, E. A., 184, 185, 186, 193, 194, 205,213,215,217,218,220,221,223 Craske, A., 258, 266 Crete, P., 204, 220 Crewther, P. E., 21 1, 217 Crispen, R. G., 101, 120 Culpepper, P. J., 212, 219 Culvenor, J. G., 21 1, 217 Curle, C. A., 187, 218 Curran, B., 203, 210, 221 Curtiss, R. 111, 86, 119 Cuskey, S. M., 31,65 Cutler, C. W., 200, 217
D Dabrowa, N., 188, 218, 223 DalTe, M., 83, 85, 121 Dahiya, R., 107, 121 Dale, J. W., 91, 119 Dalton, H., 42, 43, 44, 68 Dame, M., 113, 123 Daniels, C. J., 191, 218 Daniels, L., 227, 228, 235, 236, 238, 239, 242, 243, 266, 269 Danon, J., 127, 134, 179 Darbre, A., 77, 119 DAri, R., 198, 218 Das, B. C., 82, 124 David, H. L., 73, 86, 101, 102, 120, 122, 123 Davies, K. J. P.,133, 179, 260, 269 Davies, M. W., 203, 210, 221 Davies, P. J., 206, 221 Davis, R. S., 5, 65 Davis, R. W., 103, 124 de Bruyn, J., 105, 119, 211, 219 de Cock, R. M., 237, 269 Delville, J., 74, 119 Demple, B., 198, 218 de Muynck, A,, 93, 112, 113, 122 Denham, D. A., 212,222
275
AUTHOR INDEX
Denneny, J. M., 112, 119 Dennis, D. T., 194, 214, 219 Deo, S. S., 86, 119 Deretic, V., 63, 65 de Ridder, K., 74, 75, 122 Derrick, C. M., 206, 220 Deshaies, R. J., 213, 214, 218 Desikan, K. V.,93, 108, 112, 116, 121, 122 Dethlefsen, L. A., 203, 219 Devine, K. M., 189, 199, 221 De Vries, R. R. P., 21 I , 222 Dhariwal, K. R., 82, 119 Dhople, A. M., 72, 73, 99, 105, 117, 119, 123 Di Berardino, D., 17, 68 Dickie, P., 252, 253, 266, 268 Dixon. R., 27, 28, 31, 32, 33, 64, 65 Dizon, A. E., 165, 181 Dobson, G., 76, 77, 119, 122 Docherty, M. A,, 86, 114, 119 Doddema, H. J., 236, 239, 266 Doelle, H. W., 87, 119 Domatsu, C., 264, 269 Don, R. H., 20, 68 Donnclly, M. I., 237, 266 Doolittle, W. F., 191, 218 Dorner, A. J., 213, 218 Dowds, B. C. A,, 189, 199, 221 Downie, J. A,, 27, 66, 232, 255, 256, 265, 266 Downing, R. G., 20, 65, 67 Draper, P., 75, 76, 77, 85, 103, 119, 121, 122, 123 Drath, D., 88, 121 Drummond, M., 27, 28, 32, 33, 64,65 Drutz, D. J., 93, 108, 119 Dudeney, A. W. C., 127, 135, 169, 179 Duffy, J. J., 203, 217 Duggleby, C. J., 3, 17, 18, 19, 20, 28, 37, 39, 52, 64, 65, 66, 67 Dunlop, G., 205, 207, 209,223 Dunn, N. W., 2, 4, 8, 34, 35, 57, 64, 65, 68,69
E Eaton, J., 198, 222 Eaton, J. W., 108, 120 Ebina, Y., 17, 19,20, 21, 26, 28, 35, 66,67
Edlund, T., 253, 266 Einsenstark, A., 198, 218 Eirich, L. D., 237, 266 Eisen, H., 188, 222 Ellar, D. J., 189, 223 Ellefson, W. L., 238, 266 Elliker, P. R., 204, 218 Ellis, J., 213, 214, 218 Ellis, R. J., 194, 214, 219 Endo, J., 127, 131, 149, 155, 180 Engers, H. D., 103, 119 Ennis, H. L., 193, 218 Ensley, B. D., 13, 65 Erflc, J. D., 91, 119 Erwin, A. E., 213, 217 Escalante-Semerena, J. C., 237, 266 Esquivel, D. M. S., 127, 131, 134, 179 Eun, H. M., 82, 120 Evans, M. J., 101, 120 Evans, W. C., 57,65 Evans, W. E., 206, 221
F Faccioli, L. H., 82, 123 Fairfield, A. S., 108, 120 Fales, H. M., 82, 119 Farr, S. B., 197, 219 Farr, S. F., 198, 218 Farrell, F. W., 194, 218 Favaloro, J. M., 21 1, 217 Fayet, O., 194, 218 Feist, C. F., 23, 65 Ferguson, L. P., 258, 266 Ferguson, S. J., 227, 256, 258, 260, 261, 262, 265,266, 268 Ferry, J. G., 240, 269 Fewson, C. A., 14.65 Fiebig, K., 236, 240, 242, 267 Finberg, R. W., 21 I , 219 Findeli, A,, 17, 62, 69 Findly, R. C., 188, 207, 208, 219 Finel, M., 233, 268 Finkelstein, D. B., 188, 194, 203, 204, 207, 209, 218, 220 Finley, D., 188, 189, 192, 193, 195, 218, 221 Firoozan, M., 188, 189, 195, 209, 218 Firtel, R. A., 187, 222 Fisher, P. R., 2, 67
216
AUTHOR INDEX
Flanders, P. J., 173, 180 Flint, J. E., 21 1, 217 Folse, D. S., 72, 74, 123 Forester, O., 127, 130, 131, 132, 174, 176, 181 Forget, N., 237, 266 Foster, J. W., 191, 192, 222 Fox, G. E., 236, 265 Francken, A., 74, 75, 122 Frank, H., 126, 127, 131, 180 Frankel, R. B., 126, 127, 131, 134, 139, 140, 141, 142, 143, 144, 145, 148, 149, 151, 154, 157, 158, 159, 162, 169, 173, 177, 179. 180, 181 Frankel, R. F., 166, 179 Franklin, F. C. H., 5, 9, 13, 20, 21, 23, 24, 25, 26, 28, 29, 30, 31, 41, 50, 51, 63, 65, 68, 69 Franzblau, S. G., 85, 89, 101, 112, 113, 114, 117, 120, 123 Frazier, w.c.,204, 218 Frehel, C., 86, 101, 102, 103, 120, 122, I23 Fridovich, I., 199, 221 Fridovich, T., 197, 200, 218 Friedrich, B., 34, 68 Friello, D. A., I , 10, 35, 38, 56, 65 Frunzke, K., 261, 268 Fuchs, G., 243, 266 Fuchs, R., 100, 122 Fujisawa, H., 16, 69 Fujiwara, T., 85, 120 Fukinushi, Y., 77, 121 Fulco, A. J., 85, 120 Fulton, S., 238, 239, 269 Furukawa, K., 38, 65 G
Gaffney, D. F., 17, 62, 69 Galego, L., 188, 208, 216, 217, 218, 221 Galiazzo, F., 201, 218 Galli, E., 10, 52, 64 Gandhi, R., 101, 121 Ganguly, K. N., 107, 121 Garcia. P. D., 213, 219 Garland, P. B., 232. 253, 256, 266, 267 Carrels, R. M., 162, 179 Garsia, R. J., 103, 120 Gatenby, A. A., 214, 218
Gault, M. J., 90, 120 Gaunt, J. K., 57, 65 Gaylord, H., 78, 120 Gehring, M. J., 185, 213, 221 Gelber, R. H., 72, 78, I20 Gelfand, E. W., 95, 119 Gennis, R. B., 233, 265 Genova, L. K., 201, 220 Georgopoulos, C. P., 186, 194, 214. 218, 219 Gerish, G., 192, 223 Gerner, W. E., 203, 217 Gething, M. J., 213, 218, 219 Giannini, S. H., 187, 210, 212, 223 Gibb, L. E., 22, 44, 47, 48, 55, 68 Gibbins, J., 33, 67 Gibson, D. T., 10, 12, 13, 1 6 , 6 5 6 8 Gilkes, R. J., 162, 180 Gill, J. F., 63, 65 Gillin, F. D., 90, 120 Gillis, T. P., 114, 120 Giorda, R., 193, 218 Girshovich, A. S., 214, 217 Giuseppin, M. L., 200, 223 Glass, T. L., 200, 218 Glover, C. V. C., 188, 218, 219 Goebl, M. G., 195, 218 Goff, S. A., 190, 193. 196, 213, 217, 218 Goldberg, A. L., 190, 193, 196, 213, 217, 218, 219 Goldberg, I., 253, 266 Goloubinoff, P., 214, 218 Comes, S. L., 187, 190, 217, 218 Goncalves, H., 73, 123 Gonzalez, T., 191, 192, 222 Gorby, Y. A,, 146, 147, 161, 179 Goren, M. B., 82, 102, 119, 120 Gormus, B. J., 72, 124 Gorovsky, M. A., 188, 218, 219 Gottesman, S., 196, 218 Gottschalk, G., 236, 240, 242, 255, 265, 267, 268 Grant, C. M., 188, 189, 195, 209, 218 Gray, C. T., 76, 119 Green, M., 21 3, 220 Greenberg, J. T., 198, 218 Greenfield, A. J., 260, 268 Greenwood, C., 260, 267 Grcgory, D., 76, 100, 107, 124 Griffiths, E., 81, 104, 120
AUTHOR INDEX
Groat, R. G., 190, 218, 219 Gros., C., 82, 124 Gross, C. A., 27, 68, 194, 217 Grosset, J. H., 72, 119 Grosskinsky, C. M., 87, 120 Grundstrom, T., 253, 266 Guell, D. C., 126, 169, 179 Guelpa-Laurds, C. C., 72, 119 Guest, J. R., 253, 266, 269 Guidushek, P. E., 188, 203, 221 Guijt, W., 237, 269 Gunsalus, 1. C., 2, 52, 53, 55, 65, 68, 69 Gunsalus, R. P., 238, 266 Gurantz, D., 90, 120 Guthrie, J. D., 246, 268 Gutowski, S. J., 255, 266, 268 Gutteridge, J. M., 197, 219 Gutteridge, W. E., 90, 120 Guttman, S. D.. 188, 218, 219 Gwynnc, D. I., 187, 219
H Haasnoot, C. A. G., 237, 269 Habicht, J. K., 10, 66 Hackett, N. R., 262, 266 Hackett, R. W., 194, 219 Haddock, B. A., 232, 235, 255, 256, 266 Hagedorn, S. R., 10, 61, 65 Hagen, D. S., 253, 268 Hagstadt, H. V., 72, 123 Hahn, G. M., 208, 220 Hall, B., 188. 204, 207, 208, 209, 219 Hall, R. M., 75, 80, 105, 106, 113, 120, 122 Hallberg, E. M., 188. 207, 709, 214, 217, 219 Hallberg, R. L., 188. 193, 194. 207, 209. 213, 214,217. 219, 220, 221 Haller, R., 72, 99, 123 Halling, P. J., 238. 267 Halliwell, B., 100, 120, 197, 219 Hamill, A. L., 107, 123 Hamilton, W. A., 235, 243, 265, 266 Hammond, D. J., 90, 120 Hansen, G. A., 71, 120 Harayama, S., 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 33, 34, 53, 69, 66, 67, 68 Hardern, J., 96, 120 Hardy, K. G., 19, 37, 39,64
277
Haregewoin, A., 21 1, 219 Harper, A., 88, 121 Harris, E. B., 76, 85, 99, 112, 113, I 17, 120, 122 Harrison, R. A,, 212, 219 Harshan, K. V., 109, I20 Harshey, R. M., 74, 120 Hartl, F.-U., 214, 215, 217, 219, 221 Hartman, H., 126, 169, 179 Hartmann, J., 58, 66 Hartwell, L. H., 202, 219 Hartwick, R. A,, 1 I I , 120 Hartzcll, P. L., 237, 266 Hassan, H. M., 198, 200, 220, 222 Hastings, R. C., 72, 74, 85, 89. 99, 108, 114, 117, 120, 122, 123 Hatch, T. P., 109, 120 Hatchel, G., 72, 99, 123 Hatchikian, E. C., 237. 246, 266, 267 Hausinger, R. P., 237, 267 Hay. R. E., 62, 67 Hayaishi, 0..3. 16, 67 Hayakawa, T., 13,68 Hayashi, E., 19, 20, 35, 67 Hayunga, E. G.. 187,210. 212, 219 Headstrom. R., 212, 219 Hebenstreit, B. J., 127, 135, 169, 179 Hecker, M., 189. 222 Hedges, R. W.. 35, 66 Heerema, R. H., 127, 135, 169, 179 Hegeman, G. D., 3, 23, 65, 68 Heichman, K. A., 188, 195, 223 Heikkala, J. J., 189, 220 Heinaru, A. L., 52, 66 Heine, H., 89, 117, 121 Helenius, A., 100, 122, 213, 219 Hellingwerf, K. J., 253, 255, 267, 269 Hellqvist, L., 103, 120 Hemmingsen, S. M., 103, 120, 194, 214, 219 Hendershot, L. M., 213, 217, 219 Henderson, J. F., 96, 120 Hendrix, R., 210, 21 I , 223 Hendrix, R. W., 194, 214, 217, 219 Henle, K. J., 203, 219 Hensen, E. J., 21 I , 223 Hensley, M., 12, 65 Herendeen, S. L., 186, 219 Hermon-Taylor, J., 114, 122 Hershko, A., 193, 219
278
AUTHOR INDEX
Heythuysen, H. J., 242, 269 Hickey, E., 204, 220 Higgins, I. J., 242, 267 Hightower, L. E., 194, 219 Hilson, G. R. F., 72, 73, 94, 114, 119, 121 Hipkiss, A. R., 190, 222 Hippe, H.. 236, 240, 242, 267 Hirata, T., 86. 120 Hiriyanna, K. T., 74, 120 Hoffman, P. S., 142, 179, 191, 220 Hoffmann, A. F., 90, 120 Hofman, F. M., 21 1, 221 Hohn, B., 214, 218 Holden, D. W., 187, 219 Holliday, R., 209, 223 Hollocher, T. C., 258, 260, 261, 267, 269 Holloway, B. W., 10, 37, 61, 68 Holmes, S., 193, 215, 218 Holmes, W. M., 200, 218 Holoshitz, J., 21 I , 219 Holzer, T. J., 101, 120 Homma, S., 9, 69 Hooper, M., 116, 120 Hoover-Litty, H., 213, 219 Hopper, D. J., 12, 66 Hori, K., 17, 67 Horiguchi, S., 5, 67 Horn, R. C., 21 1, 219 Horowitz, S., 188, 218 Horwich, A. L., 214, 217, 221 Horwitz, M. A., 101, 121 Hossler, F. E., 5, 65 Houwen, F. P., 252, 269 Howard, D. H., 188, 218, 223 Howard, J. B., 237, 267 Howe, C. J., 191, 221 Hubbard, T. J. P., 189, 223 Hudson, D. V., 139, 179 Hughes, E. J. L., 10, 66 Hugh-Jones, M. E., 72, 123 Hunter. K. W., 187, 210, 212, 219 Hunter, S. W., 78, 79, 85, 120, 121 Hunting, D., 96, I20 Hurley, S. S., 118, 120 Hurtley, S. M., 213, 219 Huser, B. A., 236, 240, 267 Huttunen, M. T., 255, 265 Hylemon, P. B., 200, 218
I Ichihara, K., 100, 121 Iida, H., 189, 222 lino, T., 19, 37, 38, 44, 50, 68 Imaeda, T., 86, 119 Imai, K., 264, 269 Imlay, J. A., 197, 198, 199, 219 Inagaki, K., 264, 269 Ingledew, W. J., 227, 232, 233, 235, 238, 244, 252, 253, 256, 258, 260, 263, 264, 265, 266, 267, 268,269 Ingraham, J. L., 258, 266 Ingram, C., 62, 66 Inniss, W. E., 189, 220 Inouye, S., 17, 20, 21, 23, 24, 25, 26, 27, 28, 30, 32, 33, 63, 66, 67 Ishaque, M., 89, 112, 120 Ishikawa, T., 189, 222 Ishimoto, K. S., 33, 66 Ishimoto, M., 261, 262, 268, 269 Ito, K., 163, 180, 190, 196, 219 Ivanyi, J., 210, 21 I , 223 lyer, C. G. S., 93, 108, 116, 122 Izquierdo, M., 193, 217 Izumi, S., 100, 121 J
Jacket, P. S., 100, 121 Jackett, P. S., 100, 120 Jackson, J. B., 262, 268 Jackson, R. H., 259, 267 Jacob, A. E., 35, 66 Jacobs, W. R., 86, 87, 113, 119, 120, 123 Jacobson, A., 187, 220 Jacobson, F. S., 104, 122, 191, 197, 199, 217, 221 Jacoby, G . A., 9, 3 5 6 6 Jacquemot, C., 188, 222 Jagannathan, R., 116, 120, 121 Jamison, C. S., 200, 219 Jamundar, S., 107, 121 Jannasch, H. W., 127, 131, 139, 140, 141, 142, 144, 148, 159, 177, 179, 180 Jarrell, K. F., 239, 269 Jarroll, E. L., 90, 121 Jaurin, B., 253, 266 Jeenes, D. J., 35, 37, 44, 59, 66, 68 Jekkel, A., 113, 123
AUTHOR INDEX
Jenkins, D. E., 190, 199, 219 Jentsch, S., 192, 193, 195, 218, 219 Jerez, C. A., 192, 219 John, P., 258, 260, 267 Johnson, M. K., 253,260, 267, 268 Johnston, A. W. B., 27, 66 Jones, C. W., 232, 233, 255, 266, 267 Jones, D. T., 189, 200, 222,223 Jones, J. B., 238, 240, 267 Jones, K. A., 188, 207, 208, 219 Jones, P. G., 190, 219 Jones, R. W., 253, 256, 267 Jones, W. J., 227, 235, 236, 240, 243, 267 Jorgensen, B. B., 142, 179 Joyce, K. M., 197, 219 Juliani. M. H., 187, 190, 217, 218 K
Kaback, H. R., 255, 267 Kafri, O., 74, 119 Kagiyama, H., 3, 16, 17, 26, 67 Kajie, S., 259, 267 Kallio, R. E., 12, 56, 65, 66 Kalovsek, F., 214, 217 Kamihara, T., 262, 268 Kamiya, S., 126, 127, 130, 136, 176, 177, 180
Kamy, M., 72, 99, 123 Kandler, O., 77, 119 Kanetsuna, F., 100, 121 Kannan, K. B., 106, 121 Kaplan, G., 101, 121 Kaplan, J. M., 78, 79, 121 Kapoor, M., 185, 187, 206, 208, 210, 218, 219, 222 Karnovsky, M. L., 88, 121 Kashket, E. R., 190, 200, 223 Kassenbrock, C. K., 213, 219 Kato, L., 89, 120 Katoch, V. M., 106, 112, 121 Katsura, T., 162, 163, 180 Kaufman, M., 17, 62,69 Kaufman, R. J., 213, 218 Kaufmann, S. H. E., 73, 121 Kaur, S., 107, 121 Kazda, J., 72, 87, 94, 118, 123 Kearney, E. B., 253. 268 Kearney, J. F., 213, 217
279
Keil, H., 10, 13, 14, 22, 31, 40, 41, 45, 46, 47, 48, 49, 50, 51, 52, 55, 66, 68 Keil, S., 10, 31, 45, 46, 49, 50, 51, 55, 66 Keinaru, A. L., 10, 66 Kell, D. B., 74, 121, 234, 267 Kelley, P. M., 184, 190, 202, 209, 222, 223 Kelly, D. P., 227, 228, 247, 264, 267, 268 Kelly, R. B., 213, 219 Keltjens, J. T., 227, 235, 267 Kemp, D. J., 21 1,217 Kempe, J., 107, 123 Kendall-Tobias, M. W., 255, 266 Kenealy, W., 243, 267 Kenney, W. C., 253, 267 Keshvarz, T., 10, 42, 44, 66 Khanolkar, S. R., 81, 93, 96, 97, 99, 113, 121, 124 Kiene, R. P., 141, 179 Kieser, P., 113, 123 Kikuchi, S., 85, 121 Killeen, K. P., 191, 209, 219, 221 Kim, C., 260, 267 Kim, Y. K., 213, 219 Kirchheimer, W. F., 72, 76, 99, 121, 122 Kirschvink, J. L., 127, 131, 165, 174, 176, 179, 180, 181 Kistulovic, A. M., 1 I I , 120 Kivisaar, M. A., 10, 66 Klebanoff, S. J., 100, 101. 121, 122 Klein, N., 85, 122 Knackmuss, H.-J., 20, 35, 58, 59, 60, 66, 68 Knight, R., 262, 266 Kobayashi, G. S., 210, 212, 222 Koch, B. D., 213, 214, 218 Koch, J. R., 12, 65 Kogoma, T., 190, 197, 219, 223 Kohasa, K., 77, 121 Kohgami, K., 262, 268 Kohler, T., 33, 34, 66 Kohno, K., 185, 213, 221 Kohsaka, K., 87, 89, 99, 122 Kolattukudy, P. E., 85, 122 Konetzlea, W. A., 127, 131, 135, 136, 138, 139, 144, 180 Konings, W. N., 253, 255, 265, 267, 269 Korez, A., 192, 222 Koring, F., 21 1, 219
280
AUIHOR INDEX
Kornberg, R. D., 215.222 Korner, H., 260, 269 Koroz, A., 192, 217 Kosic-Smithers, J., 185, 193, 215, 218 Kotani, S., 16, 67 Kowitt, J. D., 196, 219 Kozutsumi, Y., 185, 213, 219, 221 Krab, K., 233, 269 Krahenbuhl, J. L., 101, 114, 117, 120, 122, 123 Kramer, J., 185. 193, 215, 218 Kramer, J. F., 249, 267 Kraus, K. W., 188, 207, 209, 219 Kreig, N. R., 142, 179 Krishnaswamy, P. R., 82, 99, 123 Kristjansson. J. K., 258, 267 Kroger, A., 25 I , 252, 253, 267 Kronstad, J.. 187. 219 Kropinsk, A. M., 191, 216 Krueger, J. H., 190, 220 Kuhn, W., 236, 240, 267 Kukarni, V. M.. 99, 121 Kulaga, A., 188, 203, 204, 220 Kulka, C.. 195, 221 Kulla, H., 255, 268 Kumar, B., 107, 121 Kundu. M., 80, 121 Kunz, D. A., 5, 10, 18, 39, 41, 45, 56, 66 Kuritzkes, D. R., 261, 267 Kurtz, S., 186, 189, 220 Kusaka, T.. 77, 83, 85, 91, 121, 123 Kusukawa, N., 205. 220 Kusunose, E.. 100. 121 Kusunose, M., 13. 67, 100, I21 Kuymdzhieva-Savova, A., 201, 220 Kvach, J. T., 89, 117, 121 Kwan, H. S., 261, 262, 263, 265, 267 Kwart, L. D., 10, 16, 68
L Lacavc, C., 83, 85, 121, 123 Lam, J. S., 191, 216 Lamarche, S., 203, 204, 220 Lamb, J. R.. 210, 21 I , 223 Lambert, E., 186, 220 Lambert, H., 204, 220 Lancaster, J. R., 235, 238. 267 Lancaster, R. D., 72, 121 Landry, G. J., 109, 119
Landry, J., 203, 204, 208, 220 Laneelle, C., 85, 107, 121 Laneelle, M.-A., 83, 85, 121 Larcombe, M. C., 162, 180 Large, P. J., 235, 267 Larrson, L., 75, 121 Laszlo, A., 204, 207, 220 Latchman, D. S., 193, 220 La Thangus, N. B., 193, 220 Lalhigra, R., 219, 21 I , 223 Latter, G. I., 199, 222 Laverack, P. D., 10, 42, 65 Law, J. F., 255, 266 Lawrence, F., 187, 210, 212, 220 Lazdins, J., 88, 121 Leach, S., 244, 264, 265 Leaver, C. E. L., 193, 220 Lebens, M. R., 20, 21, 50, 52, 66 Lechene, C., 96, 121 Lecocq, J.-P., 17, 62, 69 Lederer, E., 82, 124 Ledcrman, H. M., 95, 119 Lee, A. S., 213, 217, 219, 220 Lee, F. J., 200, 220 Lee, J., 246, 267 Lee, K.-J., 208, 220 Lee, P. C., 200, 217, 220 Lee, S. S., 207, 220 LeGall, J., 237, 244, 245, 246, 249, 251, 267, 268 Lehmann, K. L., 109, I19 Lehrbach, P. R., 13, 17, 20, 21, 23, 35, 27, 28, 29, 31, 34, 35, 37, 38, 50, 52. 60, 62, 63, 65, 66, 67, 68, 69 Leigh, J. A., 236, 267 LeJohn, H. B., 187, 220 Lema, M.W.. 191, 220 Lemire, B. D., 252, 253, 267 Leong, S. A., 187, 219 Lepper. A. W. D., 104, 121 Leppik, R. A., 13, 14, 20, 21, 22, 65, 66, 68 Lesse, H. J., 96, I21 Le Vine, S. M., 89, 121 Levy, L., 73, 91, 101, 120, 121 Lewis, J., 185, 201, 219 Lewis, M. J., 215, 223 Lewis, R. J., 40, 43, 67 Lewis, W. R., 101, 121 Li, G. C., 203, 204, 207, 208, 220
AUTHOR INDEX
Li, W. H.. 192, 222 Lilly, M. D., 10, 42, 44, 66 Lin, E. C. C., 255, 261, 267, 268 Lin, K.-Y., 110, 124 Lindner, B., 73, I 1 7, 123 Lindquist. S., 103, 104. 121, 184, 185, 186, 189, 193, 194,216,220,221,222 Lindsay, K., 23, 26, 28, 50, 51. 68 Linesman, M., 191, 216 Linn, S.. 197, 198, 199, 219 Lins d e Barros, H. G. P., 127, 131. 134, 179, 180 Lis, J. T., 194, 219 Lissin, N. M., 214, 217 Lissolo, T.. 246, 248, 249, 268 Lloyd, D., 133. 166, 171, 179 Lloyd, J., 127, 128, 130, 131, 132, 170, 180 Lockheart, A,, 203, 210, 221 Loewen, P. C., 198, 220 Lohmeier, E., 253, 268 Lonberg-Holm, K., 253, 266 Long, E. G., 72, 74, 123 Loomis, W. F., 187, 220, 222 Lorimer, G. H., 214. 218 Lory, S., 33, 66 Losick, R., 62, 68 Lovley, D. R., 141, 173, 174, 179, 180 Lowrie, D. B., 99, 100, 120, I21 Ludwig, B., 233, 269 Lugosi, L., 113. 123 Lumsden, C. J., 172, 179 Lupton, F. S., 251, 268 Lurz, R., 25, 31, 65 Lyon, B. R., 10, 37, 61, 68 M Mabry, T. J., 12, 65 McAlister, L., 188, 203, 204, 207, 209, 220 McCabe, J. B., 96, 123 McCallum, K. L., 189, 220 McCammon, K., 213, 218 McClure, N. C., 9, 67, 68 McCombie, R., 10. 16, 68 McConnell, D. J., 189, 199, 221 McCullough, W. G., 114, 122 MacDonald, L. A., 191, 216 MeDougall, A. C., 72, 121
28 1
Mace, H. A. F., 196, 208, 223 Macedo, P. M., 73, 76, 123 McEntee, K., 188, 195, 223 McEwan, A. G., 262,268 McFaddcn, J. J., 114, 122 McGrath, J. P., 192, 193, 195, 218, 219 MeGregor, I., 38, 52, 66 Maclsaac, D. P., 262, 263, 269 McKee, A. H. Z., 191, 218 Mackey, B. M., 206, 220 McLaughlin, C. S.. 189, 208, 209, 221 MacLennan, J. D., 107, 121 McMullin, T. W., 193, 194, 213, 220 McNeil, M., 78, 79, 120, 121 McRae, D. H., 73, 123 McRee, D. E., 259, 268 Macy, J., 255, 268 Maeda, Y., 127. 180 Magasanik, B., 31, 68 Magrum, L. J., 236, 265 Mah, R. A,, 236, 240, 267 Mahadevan, P. R., 99, 107, 109, 113, 116, 120, 121, 123 Mahler, B. A,, 172, 173, 179 Mahowald, A., 185, 221 Maia, J. C. C., 187, 190, 217, 218 Maisonhaute, C., 201, 217 Maizels, R., 212, 222 Makino, M., 87, 89, 99, 122 Mann, S., 127, 128, 130, 131, 132, 146, 148, 149, 150, 151, 154, 155, 156, 157, 159, 160, 161, 162, 164. 170, 177, 179, 180
Manrow, R. E., 187, 220 Maratea, D., 131, 139, 140, 141, 144, 146, 172, 179, 180 Martin, A., 106, 122 Martin, J., 214, 217 Martin, L. N., 72, 124 Matin, A., 190, 199, 218, 219, 222 Matsubara, T., 261, 268 Matsuda,T., 127, 131, 149, 155, 180 Matsumoto, K., 189, 222 Matsunaga, T.. 126. 127, 130, 136, 176, 177, 180 Matsuo, E., 107, 122 Maxwell, P. C., 10, 37, 61, 65, 67, 68 Mazzarella, R. A., 213, 220 Medoff, G., 210, 212, 222 Meganathan, R., 262, 268
282
AUTHOR INDEX
Mehlert, A., 191, 210, 220 Mehra, V., 78, 79, 103, 120, 121, 122, 124, 21 1, 220 Meir, E., 198, 220 Mellrnan, L., 100, 122 Melton, R. E., 113, 123 Merkal, R. S., 114, 122 Mermod, N., 13, 17, 20, 23, 26, 27, 28, 29, 30, 31, 32, 33, 63, 65, 67, 68 Merrick, M. J., 27, 28, 31, 33, 65, 67 Meshnick, S. R., 108, 120, 198, 222 Messenger, A. J. M., 80, 105, 113. 120, 122 Meulien, P., 20, 34, 35, 37. 38. 50, 66, 67 Meyer, D. J., 255, 266 Meyer, E. A., 90, 121 Meyers, W. M., 72, 119, 124 Michan, C., 30, 61, 64 Michel, G. P. F., 192, 221 Miki, K., 255, 268 Millan, J., 72, 119 Miller, M. H., 188. 203, 221 Miller, S., 33, 64 Miller, T. L., 242, 268 Minnikin, D. E., 76, 77, 85, 119, 122 Mioz, E. A., 96, 121 Misra, L. M., 185, 213, 222 Mitchell, H. K., 184, 223 Mitchell, P., 230, 234, 268 Mittal, A,, 93, 116, 122 Mivechi, N. F., 203, 220 Miyata, T., 87, 89, 99, 122 Miyazaki, T., 38, 65 Mizota, M., 127, 180 Mizzen, L. A., 216, 223 Modlin, R. L., 78, 79, 120, 121, 211, 221 Moench, T. T., 127, 130, 131, 135, 136, 138, 139, 144, 146, 148, 149, 154, 159, 180, 181 Montrozier, H., 83, 85, 121 Moore, M. M., 200, 223 Mor, N., 73, 101, 122 Morales, M. J., 74, 120 Moran, C. P., 62, 67, 68 Morgan, R. W., 104, 122, 191, 197, 199, 217, 221 Mori, M., 264, 269 Mori, T., 87, 89, 99, 122 Morirnoto, R. I., 213, 223
Morningstar, J. E., 253, 268 Morris, D. W., 8, 64 Morris, J. G., 143, 180 Morrish, A. H., 178, 180 Morse, S. A., 90, 121 Moskowitz, B. M., 173, 180 Moss, M. T., 91, 119 Motomura, K., 87, 122 Moura, I., 237, 267 Moura, J. J. G., 237, 267 Moustacchi, E., 206, 222 Mues, G. I., 185 221 Mukherjee, R. M., 73, 85, 122 Muller, P. J., 90, 121 Muller-Taubenberger, A., 192, 223 Mullin, D. A., 34, 67 Munakata, 0..264, 269 Munguia, G., 117, 121 Munn, T. Z., 185, 221 Munro, S., 212, 213, 221 Murakami, H., 215, 221 Murphy, P., 189, 199, 221 Murray, K., 3, 4, 5, 8, 17, 28, 39. 42, 67, 68 Murty, M. V. V. S., 82, 122 Myers, A. M., 193, 194, 214, 221 Mylroie, J. R., I , 10. 56, 65 N Nagle, D. P., 227, 235, 236, 240, 243, 267 Nakai, C., 17, 26, 67 Nakazawa, A., 17, 19, 20, 21, 23, 24, 25, 26, 27, 28, 30, 32, 33, 35, 63, 66, 67 Nakazawa, T., 3, 4, 5, 16, 17, 19, 20, 21, 23, 24, 25, 26, 27, 28, 30, 32. 33, 35, 39, 42, 51, 63, 66, 67 Narn-Lee, Y., 89, 96, 112, 122 Nath, I., 93, 108, 115, 116, 122, 123 Nathan, C. F., 101, 121 Natvig, D. O., 197, 201, 217, 219 Nedwell, D. B., 141, 180 Neidhardt, F. C., 184, 186, 190, 193, 196, 202, 205, 206, 208, 209, 219, 221, 222, 223 Neilands, J. B., 144, 145, 180 Neill, M. A., 101, 122 Nelson, D. R., 191, 209, 219, 221 Nelson, K. E., 101. 120
283
AUTHOR INDEX
Neubert, T. A,, 89, 117, 121 Neupert, W., 214, 215. 217, 219, 221 Neves, A. M., 188. 221 Newport, G., 212,219 Newton, A,, 34, 67 Newton, H. E., 101, 120 Ngai, K.-L., 17, 18, 21, 66 Nicholls, D. G., 230. 268 Nicholson, D., 215, 219 Nicholson, P., 191, 221 Nicolet, C. M., 193, 215, 218 Nifa, A. J., 34, 67 Nishi, T., 10, 69 Nishimura, Y., 262, 268 Nixon, H. T., 34, 68 Noegel. A., 192, 223 Noll, K. M., 238. 268 Noordzij, A., 21 1, 223 Nord, Jr, G. I., 141, 173, 174, 179 Normark, S., 253, 266 Normington, K., 185, 213, 219, 221 Normore, M. W., 26, 67 North, M. J., 191, 223 Nover, L., 184, 185, 221 Nowick, I., 159, 180 Nozaka, J., 3, 13, 16. 67 Nozaki, M., 16, 17, 26, 67 Nunn, W. D., 92, 122 Nyabenda, J., 105, 119
0 Oberhack, M., 126, 127, 131, 180 OBrien, W. D., 148, 149, 158. 159, 179 Odom, J. M., 227, 248, 249, 268 Ofer, S., 159, 180 Ogawa, T., 87, 122 Ohgami. Y., 262, 268 Okubo, N., 262, 269 Oliveira, L. P. H., 127, 134, 179 Oliver, P., 193, 220 Oltmann, L. F., 256, 269 Omori, T., 5, 67 Ono, K., 16, 67 Oppenheim, A. B., 190, 222 Orme-Johnson, W. H., 238, 239, 269 Ornston, L. N., 3, 17, 18, 21, 66, 67 Osakabe, N., 127, 131, 149, 155, 180 Osborn, R. W., 191, 221
Osborne, D. J., 22, 23, 40, 42, 45, 46, 47, 48, 50, 55, 67, 68 Osborne, L., 105, 119 Osslund, T. D., 13, 65 Ostermann, J., 214, 221 OSullivan, J. F., 116, 122 Ow, D., 27. 3 1, 67 Ozkaynak, E., 188, 189, 192, 193, 195, 218. 221
P Pabo, c. 0..32, 67 Padan, E., 190, 222 Page, M. D., 260, 261, 266 Pain, D., 2 15, 221 Palfi, Z., 192, 217, 222 Palm. C., 189, 208, 209, 221 Palomino, J. C., 89, 1 1 7, 121 Palter, K., 185, 218, 221 Palter, K. P., 212. 217 Paoletti, L. C., 144, 145, 160, 180 Papaefthymiou, G. C., 148, 149, 158. 159, 179 Parag, H. A,, 195, 221 Pardue, M. L., 184, 221 Parry, J. M., 206, 221 Parsell, D. A., 190, 214, 221 Parsonage. D., 256, 260, 268 Parton, F., 212, 222 Pascal, M. C., 259, 265 Pastan, I., 213, 222 Patel, R., 193, 220 Patil, D. S., 253, 266 Pattyn, S. R., 72, 74, 75, 87, 122 Paulsen, J., 251, 252, 267 Payne, S. N., 77, 119 Payne, W. J., 260, 269 Pazin, M., 192, 218 Peck, H. D., 227, 244, 245, 246, 248, 249, 25 1, 266, 267, 268 Pedersen, M. S., 193, 223 Pederson, D. S., 188, 218 Pedrini, M. A., 198, 217 Peikova, S. P., 201, 220 Pekkala, D., 187, 222 Pelham, H. R. B., 184, 194, 212, 213, 214, 215, 217, 221, 222, 223 Pemberton, J. M., 2, 67 Perot, G., 198, 218
284
AlJTHOR INDEX
Perski, H. J., 238, 268 Pesold-Hurt, B., 200, 223 Peterson, N., 127, 130, 131, 132, 172, 174, 176, 180, 181 Petit, J.-F., 82, 120, 124 Petko, L., 186, 189, 220, 221 Pfanner, N., 215, 219 Pfefferkorn, E. R., 109, 122 Pfennig, N.. 127, 131, 137, 166, 181, 252, 268 Phillips, E. J. P., 141, 173, 174, 179 Phillips, T. A., 193, 196, 221 Pickup, R. W., 10, 23, 39, 40, 42, 43, 45, 46, 50, 66, 67 Pilatus, U., 189, 223 Piper, P. W.. 186, 203, 210, 220, 221 Pires, M. A,, 127, 134, 148, 181 Pirmcz, C., 21 I , 221 Planta, R. J., 258, 269 Plesofsky-Vig, N., 187, 203, 207. 209, 22 1 Plesset. J., 189. 208, 209, 221 Pogolotti, A. I., 95, 122 Poindexter, J. S., 143, 180 Polio, F. W., 189, 222 Pollock, R. A,, 214, 217 Poolc, R. K., 227, 232, 233, 252, 253, 256. 258, 260, 267, 268 Pope, D. H., 249, 267 Pope, N. R., 259,268 Portaels, F., 74. 75, 76, 87, 93, 112, 113, 121, 122, 123 Posner, A. M., 162, 180 Postgate, J. R., 227, 228, 244, 245, 247, 268, 269 Pouyssegur, J., 213, 222 Prabhakaran, K.. 76, 99, 122 Prasad, H. K., 93, 99, 108, 116, 122 Presti, D. E., 165, 180 Pringle, J. R., 206. 223 Privalle, C. T., 199, 221 Prome, D., 85, 119 Prome, J. C., 83, 85, 119, 123 Puustinen, A., 233, 268
Q Qoronfleh, M. W., 189, 221 Qureshi, N., 83, 85, 122, 123
R Raboy, B., 195, 221 Radford, A. J., 103, 120 Raese, J. D., 185, 221 Raibaud, O., 27, 67 Rainwater, D. L., 85, 122 Rajjan, W., 74, 119 Ramakrishnan, G.. 34,67 Ramakrishnan. T., 74. 120 Ramashesh, N., 117, 122 Ramos, J. L., 26, 27, 29, 30, 31, 32, 33, 34, 60, 6 I , 63, 64, 66, 67 Ramsay, N.. 205, 221 R a p p o r t , E., 190. 200, 223 Raschke, E., 186, 222 Rastogi, N., 86, 101, 102, 103, 120, 122, 123 Ratledge, C., 75, 80, 85, 88, 90, 91. 98, 105, 106, 109, 110, 112, 113, 114, 119, 120, 122, 123, 124 Ratzkin, B. J., 13, 65 Ray. C., 62, 67, 68 Rea, T. H., 21 I , 221 Reading, D. S.. 193. 194, 214, 221 Ready, P. D., 2 12, 222 Reast, H., 78, 79, 121 Rochsteiner, M., 192, 193, 195, 217, 221, 222 Redman, K. L.. 192, 222 Rccs, R. W. J.. 72, 73, 103, I 1 5, 119, 122, 123 Reesc, R.T., 21 I , 217 Reeve, C. A., 106, 122 Reeves, R. E., 246, 268 Reid, G., 203, 221 Reineke, W., 13, 20, 23, 27, 28, 29, 30. 35, 58, 59, 60, 65, 66, 67, 68 Reincr, A. M., 3, 68 Reitzer, L. J., 3 I , 68 Rekik, M., 13, 15, 16, 17, 18, 20, 21, 22, 23, 53, 65, 66, 68 Rekik, R., 14, 21, 22, 66 Rensing, L., 189, 223 Res, P. G. H., 21 I , 222 Reuter, S. H., 190, 222 Revsbcch, N. P., 142, 179 Reznikoff, W. S., 27, 68 Rheinwald, J. G., 2, 68 Ribbons, D. W., 18,66
AUTHOR I N D E X
Richardson, D. C., 259, 268 Richardson, J. S., 259, 268 Richman, J., 21 1, 217 Richter, A., 189, 222 Rinehart, K. L., 236, 237, 238, 266, 267, 268 Ringo, E., 262, 268 Ritchie, L. R., 86. 119 Ritossa, F., 184, 222 Robert-Gero, M., 187, 210, 212, 220 Robinson, F. M., 207, 220 Robinson, J. J., 252, 253, 266, 267 Robinson, M. K., 260, 269 Rodrigues-Pousada, C., 188, 208, 216, 217, 218, 221 Rogers, J. E., 10, 35, 65, 66 Rogers, S., 195, 217 Rollet, E., 201, 217 Rommermann, D., 34,68 Ronson, C. W., 34, 68 Rook, G . A. W., 73, 123 ROOIS,M.-F., 83, 85, 121 Rose, K., 14, 21, 22, 60, 61, 66, 67 Rose, M. D., 185, 2 13, 222 Rosen, E., 187, 222 Rosenberg, H., 255. 266. 268 Rosenblatt, C., 143, 144, 145, 179. 180 Rosenfield, M., 72, 94, 99, 123 Rossi, J. M., 186, 189, 216, 220, 222 Rothman, J. E., 211, 215. 217,222 Rotilio, G., 201, 218 Roychowdhury, H. S., 187, 208, 222 Ruby, E. G., 96, 123 Rutherford, P., 212, 222 Ryter, A,, 86, 101, 102, 103, 120, 122, 123 Ryter, R., 101, 102, 120 S
Sagai, M., 262, 268 Sagstetter, M., 215, 223 Sahinnick, T. M.. 210, 21 1, 222 Sahwa, J. P., 14, 39, 45, 46, 49, 50, 51, 68 Saint, C. M., 13, 14, 45, 66 Saint, C. R., 9, 68 Saito, H., 92, 123. 186, 222 Sala-Trepat, J. M., 3, 17, 28, 67, 68 Salerno, J. C., 249, 267
285
Salgame, P., 78, 79, 121 Salvaggio, L., 198, 217 Sambrook, J., 185, 213, 218, 219, 221 Sampedro, J., 193, 217 Santi, D. V., 95, 122 Santos, M. H., 237, 267 Sanwal, B., 188, 222 Saraste, M., 233, 260, 267. 269 Sathayamoorthy, N., 79, 83, 85. 122, 123 Sathish, M., 72, 93, 99, 108, 115, 116, 122, 123 Sathish, P. S., 116, 122 Sauch, J. F., 90, 120 Sauer, R. T., 32, 67, 190, 214, 221 Savagnac, A,, 85, 119 Savov, V. A., 201, 220 Sawers, R. G., 34, 64 Sax, C., 188, 223 Scandellari, M., 237, 266 Scarpelli, D. G., 126, 177, 181 Schaar, C. G., 21 I , 222 Schaper, K.-J., 72, 94, 99, 123 Schatz, G., 200, 214, 215, 217, 223 Schauer, W. L., 240, 269 Schauf, V., 101, 120 Scheffers, W. A., 200, 223 Schekman, R., 213, 214, 218 Schell, M., 28, 68 Schellhorn, H. E., 198, 222 Schenberg-Frascino, A., 206, 222 Schiesser, A,, 201, 218 Schinnick, T. M., 103, 123 Schlesinger, M. J., 184, 194, 195, 212, 217, 222 Schlossman, D. M., 212, 217 Schnoes, M. K., 83, 85, 123 Schoffli, F., 186, 222 Schonheit, P., 238, 268 Schroder, J., 251, 252, 267 Schuldiner, S., 190, 222 Schultz, J. E., 190, 199, 219, 222 Schumann, J. P., 189, 200,222 Schwartz, B. B., 126, 173, 177, 180 Schwartz, M., 27, 67 Scott, A. J., 14, 65 Scott, M. D., 198, 222 Scott, W. A., 107, 123 SCrdbd, D. G.. 253, 267 Searle, S., 2 12, 222
286
AUTHOR INDEX
Segal, W., 89, 123 Segel, M., 213, 219 Seijen, H. G., 253, 269 Sela, S., 74, 119 Selkirt, M., 212, 222 Senyei, A. E., 126, 177, 181 Seramisco, J. R., 184, 221 Seshadri, P. S., 93, 108, I 15. 1 16, 122, 123
Sestili, P., 198, 217 Sever, M. H., 112, 123 Seydel, J. K., 72, 94, 99, 121, 123 Seydel, U., 73, 117, 123 Shafer, W., 62, 68 Shannon, E. J., 72, 123 Shapiro, J., 9, 64 Shapiro, L., 190, 222 Shapiro, S., 242, 269 Shapleigh, J. P.,260, 269 Sharma, V. D., 106, 121 Sharp, A. K., 100, 101, 123 Sharp, P. M., 192, 222 Shearer, G., 210, 212, 222 Shepard, C. C., 72, 73, 100, 121, 123 Sherman, I. W., 90, 110, 123 Shetty, K. T., 82, 99, 123 Shiba, K., 190, 196, 219 Shilling, J., 193, 215, 218 Shimikata, T., 83, 123 Shimokawa, O., 261, 269 Shin, D-Y., 189, 222 Shirley, 1. M., 62, 64 Shiu, R. P. C., 213, 222 Short, K. A., 143, 144, 145. 179, 180 Shyy, T.-T., 184, 203, 222 Sibley, L. D., 101, 123 Sidhu, P. S., 162, 180 Siegel, L. M., 259, 268 Siegele. D. A., 27, 68 Sies, H., 197, 222 Silkstrom, M., 233, 268 Silva, A. M., 187, 190, 217, 218 Silva, C. L., 82, 123 Silva, M. T., 73, 76, 123 Silver, J. C., 187, 222 Simon, M. J., 13, 65 Simpkin, D., 253, 269 Sinclair, M. I., 10, 37, 61, 68 Singer, T. P., 253, 267 Singer, V. L., 189, 217
Singh, A. P., 255, 269 Sivertsen, A,, 187, 222 Skiles, D. D., 172, 181 Skinsnes, 0. K., 89, 107, 120, 122 Skurrdy, R. A,, 10, 66 Slater, M. R., 185, 218 Sliepenbeek, H. T., 242, 269 Smida, J., 87, 118, 123 Smith, D. F., 212, 222 Smith, J. H., 72, 74, 123 Smith, M. W., 190, 222 Smith, T., 213, 217 Snapka, R. M., 192, 218 Snapper, S. B., 1 13, 123 Sneath, P.H. A., 143, 180 Snorger, P. K., 213, 222 Snow, A., 190, 222 Snow, G. A., 113, 123 Snyder, S. W., 261, 269 Solioz, M., 233, 269 Solomon, M., 192, 193, 221 Soman, G., 21 I , 219 Sotos, J. F., 260, 265 Sowden, L. C., 239, 269 Spalding, A,, 210, 221 Sparks, N. H. C., 127, 128, 130, 131, 132, 146, 149, 150, 154, 155, 156, 159, 160, 161, 162, 164,. 170, 177, 180 Sparling, R., 227, 228, 235, 236, 242, 266
Spear, P., 188, 223 Speck, D., 17, 62, 69 Spector, M. P., 191, 192, 222 Spencer, R. W., 238, 239, 269 Spender, M. R.,178. 180 Spina, A., 74, 119 Splitter, G. A,, 118, 120 Spooner, R. A,, 23, 26, 28, 30, 50, 51, 63, 68 Spormann, A. M., 127, 131, 135, 136, 143, 169, 180 Sprenkle, A,, 31, 65 Sprott, G. D., 227, 228, 235, 236, 239, 242, 266, 269 Srecvatsa, K. N., 93, 108, 116, 122 Sritharan, M., 80, 105, 120, 123 Sritharan, V., 98, 109, 123 Stackenbrandt, E., 87, 118, 123 Stadtman, T. C., 238, 240, 265, 267 Stanford, J. L., 73, 123
AUTHOR INDEX
Stanier, R. Y., 3, 67 Starka, J., 192, 221 Stellwag, E. J., 200, 218 Stenberg, E., 262, 268 Stephens, G. M., 42,43,44, 68 Sternberg, N., 214, 222 Stewart. C., 78, 79, 121 Stewart, W. D. P.. 31, 67 Stieglilz, B., 253, 266 Stinoon, L., 185, 221 Stolz, A., 30, 60, 67 Stolz. J. F., 127, 131, 141, 173, 174, 176, 179, 180 Stone, D. E.. 185, 223 Stone, R. W., 5, 65 Storrs, E. E., 72, 119, 121 Storz, G., 104, 122, 191, 199, 221 Stouthanier, A. H., 256, 259. 261, 265, 269 Strand, S. S., 117, 121 Strausberg, S., 188, 203, 204, 220 Streips, U. N., 189, 221, 222 Strober, S., 21 I , 219 Strom, A. R., 262, 268 Subjeck, J. R., 184. 203, 222 Sugio, T., 264, 269 Suhjan, J. P., 216, 217 Suranyi. G., 192, 217, 222 Sussmuth, R.. 126, 127, 131, 180 Suzuki, M., 13, 68 Sweetser, D., 103, 124, 21 I , 220 Swindle, J., 188, 222 Sylla, M. P., 93, 112. I 13, 122 T Taglicht, D., 190, 222 Takagi, M., 9, 69, 262, 269 Takayama, K., 79,83, 85, 122, 123 Talati, S., 107, 123 Talwar, G. P., 99, 119 Tamaura. Y., 162. 163, 180 Tan, 1. K. P., 262, 268 Tanaka, Y., 87, 122 Tanguay, R. M., 184, 194, 216, 222, 223 Tanner, R. S., 238, 268 Tano, T., 264, 269 Taylor, C. D., 237, 269
287
Taylor, D. G., 12, 66 Taylor, R. M., 172, 173, 179 Taylor, S. C., 62, 64 Taylor, S. D., 44, 68 Taylor, S. Y., 209, 223 Tepper, B. S., 87, 123 Terraccioano, J . S., 190, 200, 223 Thauer, R. K., 127, 131. 137, 166, 181, 238, 243, 249, 251, 265, 266, 268,269 Tlir Lritici~r,72, 121 Thole, J. E. R., 21 I , 223 Thompson, J.. 114, 122 Thomson, A. J., 260, 267 Thurman, P., 85, 123 Tien, P., 90, 119 Tilly, K., 194, 214, 219 Timkovich, R., 260, 269 Timmis, K. N., 9, 13, 14, 15, 17, 20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 Tincani, I., 82, 123 Ting, J., 213, 219 Tissieres, A., 184, 222, 223 Todd, J. A., 189. 223 Tomioka, H., 92, 123 Tomizuka, N., 38, 65 Toms-Wood, A,, 236, 266 Tonamura, A,, 127, 131, 149, 155, 180 Torgal, J., 73, 123 Torigan, V. K., 79, 122 Torigian, V., 21 I , 221 Torres de Araujo, F. F., 127, 134, 145, 148, 180, 181 Touati, D.. 198, 217, 218 Toukdarian, A., 33, 67 Towe, K. M., 146. 181 Tracy, u., 184, 223 Travers, A. A., 189, 196, 208, 223 Trcger, J. M., 188, 195, 223 Trent, R. J., 103, 120 Trudinger, P. A., 246, 247, 266, 269 Truman, R. W., 72, 123 Tsubokura, K., 83, 123 Tsuchiya. T., 262, 269 Tsuda, M.. 19, 37, 38, 44, 50, 68 Tuite, M. F., 188, 189, 195, 209, 210, 218, 221 Tyrrell, R. M., 199, 223 Tzeng, S. F., 238, 240, 269
288
AU'rHOH INDEX
U Uchida, H., 186, 222 Uno, I., 189, 222 Urzainqui, A,, 188, 216 Uyemura, K., 21 I , 221 V
Valentine, R. C., 73, 122 Vali, H., 127, 130, 131, 132, 172, 174, 176, 180, 181 Van Beelen, P., 237, 269 VanBogelen, R. A.. 184, 186, 190, 193, 196, 202, 205, 206, 208, 209, 219, 221, 223
Van der Drift, C., 227, 235, 236, 239, 242, 266, 267, 269 Van der Meijden, P., 242, 269 Van der Plas, J., 253, 269 Van der Ploeg, L. H. T., 187, 210, 212, 223
van der Vies, S. M.. 103, 120, 194, 214, 219
van der Zee, R., 21 I , 223 van Dijken, J. P., 200, 223 Van Doorn, J., 258, 269 van Eden, W., 21 I , 223 Van Embden, J . D. A,, 211, 222, 223 Van Loon, A. P. G., 200, 223 Van Neck, J. W., 237, 269 Vanteden, W., 2 I I , 222 Van? Rient, J., 256, 258, 269 van Vaerenbergh. E., 171, 181 Van Verseveld, H. W., 259, 261, 265 Van Vooren, J. P., 105, 119 Varani, J. D., 113, 123 Varma, K. G., 87, 123 Varshavsky, A., 188, 189, 192, 193, 195. 218, 219, 221
Vaughn, V., 184, 221 Vaura, K. J., 188, 218 Veenhuis, M., 236, 239, 266 Vejare, S., 109, 116, 121, 123 Vemuri, N., 85, 122 Venables, W. A., 9. 67, 68 Venkitasubramanian, T. A., 82, 122 Verduyn, C., 200, 223 Verstraete, W., 171, 181 Viebrock, A., 260, 269
Villems, R., 20, 65 Virkki, M., 233, 268 Visser, C. M., 243, 269 Vodkin, M. H., 103, 123, 211, 223 Voellmy, R., 193, 196, 217, 218 Vogel, J. P., 185, 213, 222 Vogels, G. D., 236, 237, 239, 242, 243, 266,269
von Dobeneck, T., 172, 180 Vuust, J., 193, 223 W Wackett, L. P., 13, 65 Wada, K., 264, 269 Waid, J. S., 2, 68 Walden, D. B., 184, 217 Waleh, N. S., 139, 179, 181 Walker, G. C., 190, 197, 220,223 Walker, M. E., 165, 181 Walker, R. W., 83, 123 Walkup, L. B., 190, 197, 223 Wall, S., 91, 119 Walsh, G. P., 72, 119, 124 Walsh, T. A., 260, 267 Walter, P., 213, 219 Walter, W. H., 253, 267 Walton, E. F., 206, 223 Wang, C. C., 90, 119 Wang, H. Y., 207,220 Ward, J. M., 34, 35, 37, 38, 50, 52, 66 Ware, B. A., 245, 269 Warrelmann, J., 34, 68 Wass, J. A., 113, 123 Wasserfallen, A., 53, 60, 61, 65, 67 Watanase, M., 185, 221 Waters, M. F. R., 72, 124 Waters, M. G., 104, 119, 214, 215, 217 Watowich, S. S., 213, 223 Watson, K., 188, 204, 205, 207, 208. 209, 217, 223 Watt, P. W., 191, 223 Wayne, L. G., 110, 124 Weber, L. A,, 204, 220 Webster, T., 213, 217 Weightman, A. J., 20, 68 Weiner, J. H., 252, 253, 262, 263, 265, 266, 267, 268,269
Weitzel, G., 189, 223 Welch, R. A.. 118, 120
289
AUTHOR INDEX
Welch, W. J., 184, 212, 216, 217, 223 Werner-Washburne, M., 185, 193, 213,
215,218, 223 Westerbeek-Marres, C. A. M., 200, 223 Westpahl, M., 192, 223 Westpheling, J., 62, 66 Wetzstein, H. G., 262, 268 Whatley, F. R., 260, 267 Wheeler, P. R., 76, 78, 82, 83. 85, 87, 88, 89, 90. 91, 92, 93, 95, 96, 97, 98, 100, 105, 106, 107, 108, 109, 110, 1 1 1 , 113, 114, 116, 117, 119, 121, 123, 124 Wheeler, S. A., 187, 220, 222 White, G. P., 8- 34. 35, 68 Whited, G. M., 10, 16, 68 Whitrnan, W. B., 227, 235, 236, 238, 240, 243, 266, 267 Whitty, P., 32, 65 Wiborg, 0.. 193, 223 Widdel, F., 244, 269 Widder, K. J., 126, 177, 181 Wiener, J. H., 262, 263, 269 Wientjes, F. B., 258, 269 Wiese, C. R., 235, 269 Wiese, M., 72, 99, 123 Wietzerbin-Falszpan, J., 82, 124 Wigrnore, G. J., 17, 64, 68 Wikstroin, M., 233, 269 Wilhelrn, J. M., 188, 223 Wilks, C. R., 104, 121 Williams, J. C., 103, 123, 21 I. 223 Williams, P. A.. 3, 4, 5, 8, 9, 10. 13, 14, 17, 18, 19, 20, 21, 22, 23, 24, 2X, 29, 31, 35, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47. 48, 49, 50, 51, 52, 53, 55, 56, 59, 64. 65, 66, 67, 68, 69 Williams, R. J. P., 148, 149, 154, 159, 180 Wilson, S. W., 200, 217 Wind, A., 193. 223 Winder, F., 1 12, 119 Winkler, H. H., 96, 119, 124 Wisecup, A., 17, 62, 69 Woese, C. R., 236, 265 Wolf, R. H., 72, 124 Wolfe, R. S., 127, 131, 135, 136, 137, 139, 140, 141, 143, 144, 159, 166, 169, 172, 179, 180, 181, 235, 236, 237, 238, 240, 242, 265,266, 267, 268, 269 Wolff, A,, 72, 123
Wolin, M. J., 242, 268 Wong, C. L., 4, 57, 69 Woods, D. R., 189, 200, 222, 223 Woolford, C., 103, 120, 194, 214, 217.
219 Wootton, J., 32, 65 World Health Organization, 72, 115,
124 Worsey, M. J., 5, 10, 18, 19, 20, 23, 24. 29, 37, 39, 40, 41, 42, 56, 64, 65, 68,
69 Wubblots, M., 14, 21, 22, 66
X Xavier, A. V., 237, 267 Xuong, N . H., 188. 203, 221
Y Yagil, E., 198, 220 Yarnada, K., 5. 67 Yarnada, M., 33.66 Yamaguchi, M., 16,69 Yarnarnori, T., 202, 205, 207. 209, 223 Yarnarnoto, I., 262, 269 Yang, Y-M., 82, 119 Yano, K., 9, 10, 69 Yapo, A., 82, 120 Yeap, S. K., 116, 120 Yen, K.-M., 52, 53, 55, 69 Yi, C., 246, 267 Yochern, J., 195, 218 Yokota, T., 3, 4, 5, 19, 20, 35, 39, 42, 57, 67 Yoneyarna, T., 92, 123 Yoshioka, H., 12,65 Young, D. B., 76, 81, 103, 124, 191, 210. 21 I , 212, 220, 223 Young, R. A., 103, 124, 211, 220, 223 Youngman, P., 62,66 Yuckenberg, P. D., 210, 212, 222 Yura, T., 190, 196, 202, 205, 207, 209,
219, 220. 223 Z Zeikus, J. G., 243, 246, 251, 266, 267,
268 Zeyer, J., 60, 62, 66, 69
290 Ziegelhoffer, T., 194, 218 Zimmermann, R., 21 5, 223 Zinder, S.H., 262, 269 Zipser, D., 196, 218 Zrike, J. M., 107, 123
AUTHOR INDEX
Zuethen, M. L., 188, 223 Zukowski, M. M., 17, 62,69 Zumft, W. G., 260, 261, 268, 269 Zvilius, G., 237, 266 Zychlinsky, E., 190, 219
Subject Index NOIC
Abbreviations used in sub-cntries: C120 - Catechol 1,2-oxygenase C230 - Catechol 2,3-oxygcnase (metapyrocatechase) EMP Embden-Meyerhof pathway PGL-I - Phenolic glycolipid-I SOD - Superoxide dismutase TCA - Tricarboxylic acid cycle TMAO - Trimethylamine oxide ~
A
Acetate, growth on, 242-243, 251 M . keprue not able to metabolize, 88, I12 in sulphur reduction, 251-252 Acetate/sulphate, growth on, 25 1 N-Acetyl-[Lglucosaminidase, M . Ieprae, 107 Acetyl-CoA, source in M. leprue, 91-92 Acetyl-CoA carboxylase, in M . Ieprae, 91 Acetyl-CoA-dependent fatty-acyl-CoA elongase, 83, 91, 110 Acetyl phosphate, 246 Acid mucopolysaccharides, as nutrients for M . Ieprw, 106, 107 Acid phosphatase, 96, 108 Acinetobucter culcoaceticus, 14 Actinomycetes, as ‘helper’ organism for M. Ieprae, 75 Acyl-CoA dehydrogenase, 88 Acylglycerol, M . leprae metabolism, 88
Adenosine-5’-phosphosulphonate (APS), 245 Adenosine-5’-phosphosulphonate(APS) reductase, 245 Adenosine, axenic culture of M . Ieprue, 113 Adenosine deaminase, 106, 11 1 Adenosine kinase, 110 Adenosine triphosphate, see ATP Adipic acid, 61 Aerotaxis, magnetotactic bacteria, 136, 143, 169 Akuligenes eutrophus strain 345, plasmid pRA1000, 10 Alcohols, TOL’ Pseudomonus putida growth on, 5, 8 Aldehyde, fixation, M . Ieprae susceptibility, 76 TOL’ Pseudomonus putida growth on, 5, 8 ulgD-.uylE gene fusion, 63 Alginate gene cluster, 62, 63 Alkalogenes eutropha, 234 Alkylaromatics, catabolism, 58
292
SUBJECT INDEX
Alkylcatechol, metabolism, 3 Allylglycine, metabolism, 18 Amino-acid analogues, effect on acquired thermotolerancc, 207 208 Amino acids, biosynthesis from aspartate ( M . Ieprae), 98 uptake and biosynthesis by M . Iepme. 96-99, 108, 109 protein synthesis in, 99 Ammonium, nitrite reduction to, 256, 259 Anaerobes, 227 Anaerobic niches, 227-230 Anaerobic respiration, 225-269 definition, 225-227 importance of, 226, 265 oxidants, 2. 226, 227, 228 see c i h Fumurate respiration; Mcthanogenesis; Nitrogen, oxides oT; Sulphatc DMSO, 226, 262-263 iron(u1) reduction, 226, 263-264 TMAO, 226, 261-262, 265 redox potentials of donorfacceptor couples, 227, 229 respiratory chains in, see Respiratory chains thermodynamics, 226, 234 comparison with aerobic respiration, 227, 228 Antigens, M. Ieprue, 79, 103, 210-21 1 Aqumpirilltmi mu~nerotrir.tic,iini,1 44 see cilso Magnetite; Magnetotactic bacteria axenic culturc, 131, 139-140 biotechnological applications, 177 line structure, 146-148 iron content and in medium, 144-145 iron scavenging, 145 magnetic moment, 166 magnetite crystal, 148-149 growth, 157 lattice images, 149, 150 morphology, 147, 150, 154, 155 magnetotaxis with aerotaxis, 136, 143, 169 micro-acrophilic, 144, 169 nitrate metabolism, 145 -
non-magnetic mutant (NM-IA), 144, I59 occurrence, 131 optical birefringence, 145 outer-mernbranc protcins (OMPs), 144- I45 oxygen tension for growth, 143, 144, 145-146, 173 phenotypic properties, 139 physiology, 143, 144-146 Arabinogalactan, 77, 79, 83 Arabinose, 77 Arginase, 106 Arginine, catabolism, 109 Aromatic catabolism, 3 4 .see ulso Pseudoinonas puticki mi-2; TOL plasmids; Tolucnc cat a bolism Arsenite, induced heat-shock protein synthesis, 208 Asparate carbamoyltransferase, 1 1 1 Aspartate, amino-acid synthesis from, M . Ieprue, 98, 109 Aspartate transcarbamylase, 93 ATP, in acetate utilization. 242-243 hydrolysis, 233, 234, 245 in M. leprue metabolism, 89, 112 synthesis in anaerobic respiration, 226, 230, 233, 234 carbon dioxide reduction, 238. 239 fumarate respiration coupling, 253-255 hydrogen/sulphate respiration, 248, 249 lactate/sulphatc growth, 249, 250 nitratefnitrite reduction, 256, 259 in sulphate reduction, 246 utilization in sulphate reduction, 245, 246 ATP-dependent proteolytic systems, 193, 195-196 ATP synthase, 233 Axenic culture, magnetotactic bacteria, 138-141 M. leprae, see Mycohricterium leprur
B B3 mutants, Pseudomonos putidu, 40, 41
293
SUBJECT INDEX
Bacillus subt ilis, C230 expression in, 62 pretreatment with sublethal peroxide, effects, 199 stress proteins in, 189 Bacteria, stress proteins in, 189--192 Bucterionerna niatruchofii, 19, 83, 84 Barrerodits fkagilis, stress proteins, 189, 200 Bacieroides thetaiotaontieron, oxidativc stress, 200 Beggiatou, I42 Benzaldehyde dehydrogenasc (BZDH), 5, 14 Benzoate, 3 calabolism, 3 4 , 6 pathways, see Toluene catabolism curing, 5, 24, 3 9 4 4 see ulso Benzoate, growth of TOL strains on growth of TOL strains on, 3 9 4 4 counterselection explanation, 4 1 4 4 Ps.putidu HSI, 3 9 4 0 fs.putidu MT14, MT15, MT20, 4W1 fs. putidu MT53, 40 induction of C230, 3, 23 Benzoate 1,2-dioxygenase, 16 gene, chromosomal, 3 1 Benzoic acid, halogenated, catabolism, 51-60 Benzyl alcohol, conversion to benzoate, 6, 14 Bcnzyl-alcohol dehydrogenase (BADH), 5, 14 Bilophococcus magnetorueticus, 130, 131, 138 fine structure, 146 phenotypic properties, 139 Bioaccumulations, strains for, 61-62 Bip (immunoglobulin heavy-chain binding protein), 212, 213, 215 Bisulphite, formation and reduction, 245-246 Bisulphite reductases, 246
C C120 (catechol 1,2-oxygenasc), 3, 23 C230 (catechol 2,3-oxygenase), 3
applications, vectors for recombinant studies, 62 detection, 21, 62 enzyme characteristics, 16-1 7 in haloaromatic/alkylaromatic catabolism, 59 induction by benzoate, 23 in molecular analysis of .yIS/.vjJR genes, 26 sj-lE gene encoding, 17 SLV ulso .yVE gcne; x!-l genes two, in TOL plasmids, 49, 50, 52 Cadmium chloride and thermotolerancc 205 'Capil!ary racetrack' method, 136, 137-138 Carbon dioxide, reduction, 228, 235, 236-239 A p generation, 236, 238-239 relcasc by M . Ieprae, 87, 88 Carbon monoxide, growth on, 241, 243 Carbon sources, magnetotactic bacteria, 140 M . kprae, see Mycohucteriuni leprae Psrudonionus strains, 5, 8 Carboxylic acids, TOL Ps.p u t i h growth, 5, 8 Carboxypeptidase, 82 Catabolic genes, see also Plasmid pWW0; TOL plasmids; .vjd genes organization, 18-23 plasmid-coded nature, 10 recombination and transposition, 34-39 regulation, 23-34 Catabolic pathway, aromatic substrates, see Toluene catabolism Catabolic plasmids, SPC Plasmid pWW0; Plasmids; TOL plasmids Catalase, 198-199 in hydrogen peroxide detoxification, 199, 200-201 induction, 199, 200 in M . Ieprue axenic cultures, 112 Catechol, mctabolism, 3, 4, 6, 23, 56 s m ulso Toluene catabolism Catechol 1,2-oxygenase (C120), 3, 23 Catechol 2,3-oxygenase, see C230 +
294
SUBJECT INDEX
cdc34 gene, product as ubiquitin-carrier protein, 195 cdc mutants, heat-shock response, 202-203 Cell ploidy, heat-shock acquisition of thermotolerance, 210 Chapteronin, 214 Chemi-osmotic theory, 230 Chloroate, nitrate reductase detection, 258 3-Chlorobenzoate (3CB), 58, 59 4-Chlorobenzoate (4CB), 58 Chlorobenzoic acid degradation, plasmid pWW0, 58 Clostridium acetohirt!~licum,190, 200 Coenzyme M, 237, 240 Coenzyme-M methylreductase, 238 Consensus sequences, constitutive promotors, 27, 28 heat-shock proteins, 21 1 OPI and .uylS (ps) promotor, 27, 28,3 I OP2 promotor, 27, 28 stress protein genes, 194 .u!/R ( P r ) promotor, 27, 28 Cord factor, 82 Corrinoids, 240, 243 Corynebacteria, as 'helper' organism for M . Ieprue, 75 Co.riellu hurnelii, 2 1 I p-Cresol methyl-hydroxylase, 12 cis-Crotylglycine, 18 Cycloheximide, heat-shock acquisition of thermotolerance, 207 Cytochrome hc,, 232, 233, 256, 260, 264 Cytochrome bd, 233 Cytochrome ho, 233 Cytochrome c, 233 Cytochrome r 3 , 248 Cytoehrome L ' ~ ~260 , , Cytochrome c552r257, 259 Cytochrome ccm, 249 Cytochrome c d , , 260 Cytochrome-c oxidase (cytochrome ua,), 233 Cytochrome-r peroxidase, 201 Cytochromes, M. kprae, 89
D Dapsone, 99, I 14
Dehydrogenases, 232 Denitrifying bacteria, 256, 259-260 Desaturase, 85 Desulfihicter posrgmtei, 25 1 Desulfiitomaculum nigrificuns, 246 Desulfovibrio sp., 244, 247 Desulfovibrio vulgaris, 245, 246, 25 1 Desulfuromonas ucetoxidans, 25 I , 252 Dictyostelium discoideum, stress proteins, 187, 192 cis-Dihydrodiols, 62 Dihydrofolate reductase, 99 Dihydropteroate synthase, 99 3,4-Dihydroxyphenylalanine(DOPA), 99 3.4-Dihydroxyphen ylalanine-oxidizing activity, 76 Dimethyl sulphoxide (DMSO), reduction, 226, 262-263 Dimethyl-sulphoxide (DMSO) reductase, 261-262, 262-263 Dissociation constant, pKa, reactants in anaerobic respiration, 243, 244 dnuk gene, 186, 2 13 dnuK756 mutant, thermotolerance acquisition, 205 DNA synthesis, limiting growth of M . Ieprue, 7 4 . Drnsophilu sp., hsp70-E. coli 8-galactosidase fusion gene, 196 Drosophila melmogostrr, hsp70 homology with human hsp70, 193 Hsp70 multigene family, I85 stress protein, discovery, I84 induction, oxidative stress, 201 Drug-screening, M . leprue, 114-1 17
E EcoRI, 19 Electron-transparent zones, 103 Mycobuctrrium, 81-82, 101-103 Electron-transport chain, 23 1-233 M . Ieprae, 89 Energy metabolism, M. Ieprue, 89-90 Enrichment culture, magnetotactic bacteria, see Magnetotactic bacteria
295
SUBJECT INDEX
Envelope, M . Ieprue, see M)mbucterium leprue Enzymes, see ulso indiuiduul enzymes M . leprue, carbon source catabolism, 87, 110 cell envelope, 76, 79, 82 TOL plasmids encoding, 5, 6, 7, 13-18 Escherichiu coli, acquired thermotolerance, stresses inducing, 205 consensus sequences of promotors, 27, 28 fumarate reductase, 252, 253 groEL protein, see groEL protein heat-shock protein synthesis, 202, 205 kinetics, 205 hsp70 in, 185, 193 nitrate reduction, 256, 257 nitrite reduction, 257, 258-259 oxygen-sensitive mutants, 200 respiratory chain/system, 23 I , 232, 233 rpoH mutant, 205 RpoN protein, 33 strcss proteins in, 190, 202, 205 superoxide dismutase mutants, 198 TOL' transconjugants, 9 vector pTG402 (.uyIEgene) in, 62 Ethanol stress, 208 4-Ethylbenzoate (4EB) catabolism, 60-6 1 Eukaryotes, stress protein induction, 196, 20 1, 203 Evolution, benzyl-alcohol deh ydrogenase/benzaldeh yde dehydrogenase, 14 catabolic pathways, 44445, 53 novel D N A combinations, plasmid role, 59 RpoN use in transcription, 34 TOL plasmids, 44-52 relations with other catabolic plasmids, 52-55 Exochelin, 105-106
F F,,,,
236, 239, 240, 243
F,,o, 238 Fatty acid, biosynthesis cle novo in M . Ieprcii>, 90-9 2 8-oxidation, 88 carbon dioxide release from, M . leprup, 87, 88 homologous series in mycolate biosynthesis, 83, 85 release from phosphatidylcholine in M . Icprue, 88, 93, 107 scavenging in M . Ieprue, 90, 92-93, 112 Fatty-acid elongase, 83, 91, I10 Fatty-acid synthase, 90. 91 Fcrrcdoxin, 237, 246 Ferric oxide, hydrous (ferrihydrite), 159, 160, 162-163 Ferric quinate, 140 Ferrihydrite, 159, 160, 162-163 Flavins, 232 fumarate rcductase, 252, 253 Folate synthesis, M . lcprue, 99 Formate, methanogenesis utilizing, 239-40 Formate dehydrogenase, 232 Formate/sulphate, growth on, 25 1 Fumarase, M. Icywue, 90 Fumarate reductase, 231, 232 biophysical studies, 253 genes, and amplified expression, 253 structure, 252-253 Fumarate respiration, 226, 252-255 coupling to AIP synthesis, 253-255 Fungi, stress proteins in, 187
G /l-Galactosidase, fusion gene with, 196 Gene, see ulso indiuiduul genes; Plasmid p W W 0 ; Toluene catabolism amplification, TOL plasmid, 51 duplications, catabolic plasmids, 45, 49, 50 evolution catabolic enzymes (dehydrogenases), 14 Geomagnetic field, 166, 170, 172 Glucose oxidase, 177 Glucose-regulated protein (grp78), 212-213, 215
296
SUBJECT INDEX
/Kilucuronidase, M . Ieprue, 107 7-Glutamyl transpeptidase, 82, 99 Glutathione, 198 Glycerol, growth on, 254 Glycolipid, phenolic (PGL-I), 78, 80, 81 N-Glycollylmuramic acid (NGMA) 77 Greigites, 177-1 78 groEL protein, 79, 103 hsp58 homology with, 193-194 hsp60 comparison, 214, 215 kinetics of synthesis, 205 M . kprue antigen homology. 79, 103, 21 1 molecular chaperone, 2 I3 role in protein folding/assembly, 214, 215 Rubisco-binding protein homology, 194, 214 groES stress protein, 214 role in cell viability, 194 grp78, 2 12-2 13, 2 I5 grp94. 21 3 GS-15 bacterium, 173-174
H Haloaromatics, catabolism, 58 Halocatechols. 57 Halogenated benzoic-acid catabolism, 57-60 Hunsenulu poljwwrphu, 20 1 Heat, protection, by induction of starvation proteins, 199 Heat-shock, as distinct state from acquired thermotolerance, 206 genes, regulatory role in infections, 212 Ion protease induction, 196 tolerance to hydrogen peroxide after, 199, 201 ubiquitin induction, 195 Heat-shock proteins, 185-1 86 we d s o individual lisps; Stress proteins acquired thermotolerance, 202, 203-210 see ulso Thermotolerance for cell recovery/growth after stress, 207
conservation of sequences/homology, 193-194, 21 1 groups, 185 immune response and, 2 1 1-2 I 2 induction, 184, 186, 202-203 by abnormal proteins, 196 by arsenite, 208 kinetics, 203 Inn protease, 196 oxidative stress relationship, 199, 200 stationary/log-phase cells, 199, 206 summary of data, 208, 209 thermotolerance correlation, 202, 204, 205, 206 in micro-organisms, types and references, 187-192 promotor consensus sequence, 21 I in protein assembly and translocation, 213-215 Heat-shock regulatory element, 194 Herbicide degradation, 2 High-resolution transmission electron microscopy (HRTEM), magnetite, 149-151, 152, 153 Hind111 restriction enzyme, 19, 46 Histoplwna ccipsulutum, 2 10 Homoserine dehydrogenase, 98 Host cell, M.leprue interaction, see M!w)hacterium Ieprrie hsp, 185 induction, 202-203 hsp58 193- 194, 2 I3 Hsp60 gene, 2 14, 2 15 hsp60 product, groEL product comparison, 214, 215 Hsp70 genes. 185 SSA3, SSA4 genes, 185 hsp70 proteins, 103, 185 conserved sequences/homologies, 193 induced by hydrogen peroxide, 201 M . I q m e antigens as, 21 1 in Neurosporu crussu, Sricck. cerevisiae, 185 Plusmodium ,jiilcipurum antigens, 2 I 1 in protein assembly and translocation, 2 12, 2 15 protein unfolding for, 215 SSa I , Ssa2, 2 15 Ssclp, 185, 193, 215
297
SUBJECT INDEX
hsp90 protein, 186, 194 hsp26 protein, 186 Ion protein homology, 193 hsplOO protein, 204 Hyaluronic acid. 106, 107 Hydrocarbons, TOL ' Ps.putickr growth, 5, 8 Hydrogen, cycling in lactate/sulphate growth, 249, 250 oxidation, hydrogen/sulphate respiration, 247, 248 reductant, carbon dioxide reduction to methane, 236 H ydrogenase, in Desulfouihihrio sp., 247-248 periplasmic, 248, 251 Hydrogen peroxide, 197 acquired thcrmotolcrance induced by. 205 increased, in overproduction of superoxide dismutase, 198 killing modes, 198 M. tuhrridosis killing, 100, I 12 protection, by catalase, 200, 201 by cytochromc-i* pcroxidase. 201 by iron, in magnetotactic bactcria, 143, 172 starvation proteins induction, 199 by sulphide, in magnetococci, 142 by superoxide dismutase, 200-201 scavenging by PGL-I, 101, 102 sensitivity of E. coli SOD and hydroperoxidase mutants, I98 stress protein induction, 197, 199. 200-20 1 S. typhiniuuium protection against, 199 sublethal, protection from lethal levels, 199, 201 tolerance, by heat shock, 199, 201 Hydrogen/sulphate rcspiration, 247-249 Hydrogen sulphide, 243 bisulphite reduction to, 245-246, 246-247 Hydrolases, M. k i p m , 106-108 Hydroperoxidasc, 198 mutants deficient and hydrogen peroxide sensitivity, 198
4-Hydroxy-2-oxovalerate aldolase (HOA), 6, 18 Hydroxyl radical, 197 killing mediated, 197, 198 Hydroxymate, 144 2-Hydroxymuconic semialdehyde (2HMS), 17 2-Hydroxymuconic semialdchydc hydrolase (ZHMSH), 17 2-Hydroxypent-2,4-dienoate, 18 Hypoxanthine, axcnic culturc of M . ll~pruc,I 13
I Immune response, stress proteins and. 210-212 Immunity, nutritional, M. li.prcie infections, 104, 106, 109 wall-protein complex of M . kpreiiJ in, 79 Immunoglobulin heavy-chain binding protein (bip), 212, 213, 215 Incompatibility group (IncP9) plasmids, 8, 52 Indigo, synthesis/indole convcrsion. 13-14, 15 Indolc, conversion to indigo, 13. 14, 15 Iron, sre d s o Magnetite; Magnetotactic bacteria amorphous, in magnetite crystal formation, 159, 160 content of magnetotactic bacteria, 144 deprivation, 104 in mycobacteria, 105, 106 protection from hydrogcn peroxide damage, 143, 172 scavcnging, by A yuuspirilluni t ~ i c i ~ n r ~ r o t c r i ~ t i i . u n i . 144, 145 by mycobacteria, 104-106 storagc, mycobactin role. 105-106 uptake, cxochelin-mediated, 105 by M . Irprne, 76 Iron(iii) reduction, 226, 263-264, 265
298
SUBJECT INDEX
Iron oxide, in magnetotactic bacteria, see Magnetite Iron-regulated envelope proteins (IREPs), 105 in M. Ieprae, 80, 105 Iron-repressible outer membrane protein (IROMP), in A . niu~iietotuc~tii~uni, I45 Iron sulphide, magnetic, 177-178 Iron-sulphur centres, 232 fumarate reductase, 252, 253 TMAO-reductase, 262 Isocitrate dehydrogenase. 110 kopropyl-/h-thiogalactopyranoside (IPTC), 205
K Kanamycin resistance. in vectors with TOL genes, 63 KAR2 gene, 185, 213 /j-Ketoadipate pathway, sw Toluene catabolism, ortho-cleavage pathway 2-Ketoglutarate dehydrogenase, 87 Ketomycolates, 85 Klebsiellu pneunioniuc~,Nt rC and NifA proteins, 32
L Ldctatc/sutphate, growth on, 249-251 Lectin, M . smiytnciti.~wall-associated, 79-80 Leishmuniu, heat-shock response, 21 0. 212 Leprosy, 72 set ulso M ~ d m ~ t t r i uIeprue m chemotherapy, 72 vaccine, 72 Lipids in M. Irprue, cell wall, 81, 85, 102 electron-transparent zone, 102 plasma membrane, 76 Lipoarabinomannan, 78 Ion gene, 193, 195-196 function of protease, 195-196 transcription increased by temperature, 196
M Macrophage, intracellular M. Ieprrie, 101 activities enhanced, 108- I09 drugs active and screening systems, I I6 iron in, 104 M. ltzprue killing mechanisms, 100 Maghemite, 148, 176 Magnetic moment, 166 Magnetite crystals, 126, 148 see also Magnetosomes aggregates, 166, 167, 172 in chains, 151, 157, 166, 171 composition, evidence, 148 crystallochcmical properties, 149-1 54 formation, 143, 160-165, 171 chemical control, 162-1 63, 164 control/site, 161 ferrihydrite phase transformation, 159, 160, 162-163 mechanisms, 160-165 nucleation, 160-162 rate of/two-step reaction, 162- I63 requirements, 145, 146, 162 scheme, 160- 161 growth, 157-160, 159, 163-165 amorphous iron in, 157, 159, 160 anisotropic, mechanism, 164, 165, I73 information transfer on, 171-1 72 spatial constraints controlling, 164-165 lattice images, 149, 150 as magnetotactic or homeostatic mechanism?, I72 membranes enveloping, 146-147, 162 morphology, 148, 154-156, 163-165 bullet-shaped, 153, 155-156, 164 control and constraints, 164-165 cubo-octahedral/elongated cubooctahedral, 154, 155, 156, 164 hexagonal, 154-1 55, 165 single-domain, 151, 155, 173 types, 156 orientation, control, 151, 165 palaeomagnetic aspects, 141, 172-176 lack in sediments, reasons, 176
SUBJECT INDEX
in Quaternary/Tertiary sediments, 174, 175 size, 147, 164 super-paramagnetic and multidomain, 173-1 74 twinned crystals, 15I Magnetococci, 130-1 31 detection, 132-1 33 enrichment cultures, 136 Magnetosomes, 146 magnetite crystals, s w Magnetite crystals membranes, 146, 147, 162 palaeomagnetic aspects, 141, 173-176 polarity, 171-172 Magnetospirilla, 131 see ulso A yuaspirillum mugneiotucticum
detection, 132-133 enrichment cultures, 133, 136 hydrogen peroxide damage of, 143 Magnetotactic bacteria, 125-181 w e ulso A yuaspirillum tnagnetotacticum; Magnetite crystals; Magnetotaxis aerotaxis, 136, 143, 169 applications, 126. 176- I77 axenic culture, 138-141 biomineralization, 148-1 65 see ulso Magnetite crystals biotechnological implications, 126, 176-177 cell motility, 166-168 banding patterns, 168, 169 creeping/gliding, 136, 138, 166 helical 'flight path', 166, 168, 169, 171 discovery, 125- 126 ecological significance, 169-172 geomagnetic field effect, 170 enrichment culture, 130, 134-138 bacterial counts, 136 'capillary racetrack' method, 136, 137-138 harvesting method, 136-1 37, I76 magnets used in, 134, 136, 137, 176 methods summary, 135 'purification' method, 137-1 38,176 Stratification in, 142 success assessment, 136
299
succession in, 130- I3 I , I32 sulphide effect, 137, I38 Winogradsky column method, modification, 135, 137 fine structure, 146-148 greigite in, 177-178 hydrogen pcroxidc toxicity, protection from, 142, 143, 172 intracellular vesicles, 147-148, 161 magnetic moment, 166 magnetism measurement, 145 methods of study, 130, 134-141 micro-aerophilic, 144, 169 morphology, 130, I3 1 niche exploitation, 14 1-145 niches at sediment-water interface. 133, 137, 141 observation/sampling methods, 130 occurrence, 126-1 34 conditions for, 130 habitats, 126, 127, 133 in storcd scdiments/samples, 130, 131, 132 succession of types, 131, 132 U K surveys, 128 optical birefringence, 145 oxygen tensions, for growth, 143, 144, 145, 173 toxic to, 143, 169 palaeomagnetism and, 141, 173-176 phenotypic properties, 139 physiology, 141-146 population density/heterogeneity, I33 size, 147 survival, of drying-out, 171 of violent perturbations/ environments, 143, 144, 170 Magnetotaxis, 165-173 .see also Magnetotactic bacteria, cell motility ecological significance, 169-1 72 nutrient exploitation and, 141-142 selective advantage, I4 1-142, 143-144, 171, 172 transfer of information on, 172 Magnets, magnetotactic bacteria as. 126, 176 in magnetotactic bacteria enrichment cultures, 134, 136, 137, 176
300
SUBJECT INDEX
Malate dehydrogenase, 232, 251 Malonyl-CoA. 9 I Media, axcnic culture of magnetotactic bacteria, 140 slow-growing mycobacteria, 93, 1 12, 1 I3 Menaquinone. 262, 263 Meromycolate. in mycolate biosynthesis, 83 Mesosomes, 86 Miw-pathway, sc~c~ rinc/c.r Toluene catabolism Methane production, 228. 229. 235 carbon dioxide reduction to, 235, 236-239 Mc~thcinobtic~ic~riiiti~ ruiniticintiuni. 238 Mrtheitiohcic~ter~iir,li
thr~rt~iociutotropliic~uni, 243 Methanochondrions. 239 Methanofuran (MFR), 236 Methanogenesis, 235-243 carbon dioxide rcduction, 235, 236-239 A p generation, 236, 238-239 formate as reductant/oxidant, 239-240 Ap generation, 239, 240 methanol reduction, 240-242 Ap generation, 241-242 other carbon compounds, 240-243 acetate, 242 carbon monoxide, 241, 243 methylamine, 241, 242 proton electrochemical potential (Ap)generation models. 238, 239 substrates, 235 Methanogens, 141, 142. 228, 235 Methanol reduction, 240-242 Methanopterin, 237 Mrthiinosiircinci harkrri, 242 Mc~tlianosphcirrci.studtmunirie, 242 Methylamine, 241, 242 Methylsalicylate catabolism, 57 Minocycline, 78 Mitochondria, protein asscnibly, stress protein role, 21 5 respiratory chain, 230, 231, 232 Molecular chapterones, 213
Monoclonal antibodies, M . lcprue, 79, 103 Mossbauer spectroscopy, magnctitc in magnetotactic bacteria, 149 cikris-Muconate, 3, 23, 24, 41, 61 MV-1 strain, vibrioid magnetotactic bacteria, axenic culture. 140-141 magnetitc crystal growth, 159 phenotypic properties, 139 sulphide tolerance, 142 Mqwihat.tcvium ariiurn, electron-transparent zone, 102 fatty-acid biosynthesis, 91 genome, inscrtion sequences, 114, 118 iron-regulated envelope proteins, 105 metabolism, 86 mutant lacking peptidoglycan, I02 peptoglycolipid excretion, axenic culture, 102-103 purine biosynthesis, 95 M y o hat.tcviiini lrprcir , actinomycetes in isolates, 74-75 antigcns, 79, 103, 210-21 1 immune response to, 210-21 1 stress proteins homology, 79. 103, 210-21 I as auxotroph, 113-1 14 axenic culture, conditions assessed, I 1 1-1 14 difficulties, 72, 86, 1 1 1 medium constituents, 112-1 13 temperature, 113 biosynthetic activities, 90-99 amino acids, 96-99, 108 fatty acids, 90-93, I12 folate, 99 nucleotide incorporation rates. 1 1 I pyrimidincs, 93-95, 108, 110 cell envelope, 75-85 biosynthesis, 82-85 electron-transparent zone, 8 1-82, 101. 102 outer laters, 81-82 structure, 78 cell wall, 77-78 assembly, 79, 82-85 -associated proteins, 78-81 peptidoglycan, 7, 79, 82, 102 permeability, 77
SUBJECT INDEX
contaminant detection, 75 death rate, 73 drug screening, 114-1 17 bacteria number needed, 1 15 potential systems, I 15. I 16- 1 I7 electron-transparent zone, lipid in, 102 pathogenicity correlation, 101, 102 protective effect, 101, 102 genome, 86, 113-1 14, 1 I8 insertion sequences, 114, 1 18 growth of, fatty-acid biosynthesis limiting, 9 I 'helper' organisms/symbionts in, 74-75, 105 mean generation time, 73, 91 nucleic acid syntheses as limiting factor, 74 rate, 73-74 interaction with host cells, 99- I I I , 21 1 amino-acid acquisition, 96-99, 109 elevated metabolic activities, 109-1 1 1 exochelins and mycobactin, 105- I06 host attempts to withhold nutrients, 104, 106, 109 host enzyme acquisition, 108 intracellular survival mechanisms, 100-103 iron-regulated envelope proteins, 104-105
killing mechanisms, 100 nutrient acquisition from host, 106-1 I 1 slow-down of physiology, 1 14, 1 I8 stress response, 103-104, 21 I intracellular, activities enhanced, 108- I09 iron-regulated envelope proteins (I REPS), 80, 104- 105 iron uptake, 76, 104-106, I13 metabolism, 86-99 acetate not metabolized, 88-89, 112 carbon sources catabolized, 87-89. 107, 108, 110, 112 deficiencies in, 86, 112
30 1
electron transport, 89 elevated activities, 109-1 1 1 EMP and TCA cycle cnzymcs. 87. 89, 110 energy, 89-90 oxidative, 89 monoclonal antibodies to antigen, 79, 103 oxygen tensions, 110, I12 peroxide susceptibility, 100. I I2 phosphatase in nucleotide scavcnging. 96. 108 plasma membrane, 75-76 lipids and proteins, 76 PAS staining, 75-76 possible applications, 1 1 1 - 1 15 scavenging, fatty acids, 90, 92-93. I12 iron, 104-106 peroxide by PGL-I, 101, 102 purincs, 95-96, 97, 108, 110-1 I I pyrimidines, 93-95, 108, 1 I 1 structure, 86-87 wall-protein complex, 79 Mj~cobrrcleriunimicroti, fatty-acid biosynthesis, 91 metabolism, 86 purine biosynthesis, 95, 96 n ~ o ~ r u r i exochelin. ~~ii, Mj~cob~ii.tc~riuni I05 M!~c.ohrrc~teriiini p~irrit~hc~ri~~losis. insertion sequence, 114. 118 mycobactin, 106, I14 M~~i~obcri~~eriuni sincyniutis, cell-envelope biosynthesis, enzymes. 82 exochelin, 105 genome replication time, 74 iron-regulated envelope proteins (IREPs), 80, 105 t rehalose m ycol ylt ransferase and lectin in, 79-80 ~ ! ' i ~ i i h ~ i ~ . t t~rb~rc~ulo.sis, i~riu~~i electron-transparcnt zone, 101 genome replication time, 74 killing by pcroxide, 100 lipid part of PGL-I, biosynthesis, 85 Myc.obucterium tuberculosis. mycolate biosynthesis, 83-84 Mycobactin, 105-106, I14
302
SUBJECT INDEX
M ycoce rosa tes, 8 5 M ycolate, r-type, 82, 85 biosynthesis, 82-84 possible scheme, 83, 84 Mycolic acids, 77, 79, 80 Mycosides, 102 N NADH dehydrogenase, 232. 254, 255 NADPH, in respiratory chains, 232 NAH plasmid(s), 9, 44 benzoate curing, 42 evolution, 53, 55 genes, 53, 54 expression regulation, 55 NAH7 plasmid, 52, 53 catabolic genes on transposable element, 55 gene expression regulation, 55 mim-pathway genesjoperons, 53 p W W 0 evolutionary rclationship, 52-53, 55 Naphthalene, catabolic pathway, 53, 54 Naphthalene dioxygenase, 13-14, I5 Naphthalene plasmids, see NAH plasmids Nrurosporu criissu. stress proteins, 187 hsp70, 185 induction by heat shock, 203 induction by oxidativc damage, 201 NifA protein, 31, 32 nif gene, 27, 28, 3 I promotors, 27, 28, 31 Nitrate, metabolism, Ayuuspirilluni magnetotacticurn, 145 reduction (to nitrite), 226, 227, 228, 256-258 TMAO reductase repression, 262 transport, 259-260 Nitrate reductase, 23 1, 256-258 mutant detection, 258 subunits, characteristics, 258 Nitric-oxide reductase, 260-261 N I trite, reduction, 258-260 denitrifying bacteria, 259-260 E. cdi, 258-2 59
transport, 259-260 Nitrite reductase, 259 Nitrogen, cycle, 227, 256 -fixation gene, see njj’gene oxides, as respiratory oxidants, 256-261 nitrate reduction, 256-258 nitric-oxide reduction, 260-261 nitrite reduction, 258-260 nitrous oxide reduction, 261 Nitrogen-regulated gene, ser ntr gene Nitrous oxide, nitric oxide reduction to, 260-261 reduction to dinitrogen, 261 Nitrous-oxide reductase, 261 NtrC protein, 31, 32 ntr gene, 27, 28, 31 promotors, 27, 28, 31 Nucleosides, nucleotide uptake by M . Ieprue, 96, 108 Nucleotide synthesis and scavenging by M.leprar, 93-96, 108 purines, 95-96, 108, I1&11 I pyrimidines, 93-95, 108, 11 1 Nutritional immunity, 104, 106, 109 0.
Oil spillages, multiplasmid pseudomonad strains for, 56 Operator-promolor, TOL plasmids, set d s o Promotor consensus sequences, scc Consensus sequences evolution, 55 ntr and nif’promotor homology, 27, 28, 31 OP1 ( Pu), 2 I , 26-27 localization, 21 polypeptide between .qK21 , as XylR binding site?, 33 XylR interaction, 29-30, 33 in .uylSJ.uylRanalysis, 26 OP2 (h), 26,27-29 deletion, 41 homology absent with OP1 and Ps, 29 in vector pNM 185, 63 XylS interaction, 29, 30
303
SUBJECT INDEX
in .uyIS/.ryIR analysis, 26 promotor structure, 26-29 upstream activator sequences, 33 .\-?*IRgene ( P r ) ,26-27, 28 sjLY gene (Ps),26, 27, 33 XylR interaction, 29-30, 33 Orientational energy, 166 OSP80 protein, 201 Outer-membrane proteins (OMPs), 144-145 4-Oxalocrotonate decarboxylase (40D). 6, 18 4-Oxalocrotonatc isomerase (401). 6, I8 Oxidative damage, defence mechanisms, 197, 198 see also Catalase; Hydrogen peroxide; Superoxide dismutase cytochrome-c-peroxidase, 201 molecular species causing, 197 protein/nucleic-acid synthesis inhibition, 200 stress protein induction, 197-202 eukaryotes, 201 by hydrogen peroxide, 197, 199, 200
in obligate anaerobes, 200 starvation proteins, 199 superoxide dismutase/catalase, 198, 199 Oxidative metabolism, Mjwbac.terium SP., 89-90 Oxidative phosphorylation, 226, 230, 255 2-Oxopoentenoate hydratase, 6, 18 Oxygen, as ideal respiratory oxidant, 226 -sensitive mutants, E. coli, 200 tensions, magnetotactic bacteria growth, 143, 144, 145, 173 M . lcprae growth, 110, 112 toxic to magnetotactic bacteria, 143, 169 Oxygen-derived radicals, M . Ieprae susceptibility, I 0 0
P Palaeomagnetism, 141, 173-176 Paracoccus denitr$cans, 256, 257
cytochrome bc,, 233 nitric-oxide reductase, 260 nitrite reductase, 260 nitrous-oxide reductase, 261 Paracrystalline bodies, 86 Peptidoglycan, M . rraium mutant lacking, 102 in M . Ieprae cell wall, 77, 79 biosynthesis, 82 Periodic acid-Schiff base stain (PAS), M . leprue membrane, 75-76 Peroxide detoxification, sec~Hydrogen peroxide Pcx proteins, 199 pH value, magnetite crystal formation, 162, 163 Phagosomes, 100 Phagosome-lysosomc fusion, inhibition by M . Ieprue, 100, 101, 102 Phenol catabolism, strains with hybrid pathway, 57 Phenolic glycolipid I (PGL-I), 78, 80, 81 biosynthesis, 85 effect on phospholipases, 107 lipid part, biosynthesis, 85 peroxide scavenging by, 101, 102 Phosphatase, in nucleotide scavenging by M . Icprae, 96, 108 Phosphatidylcholine, fatty-acid release from, M. Irprae, 88,93, 107 Phosphatidylinositol mannosides, 76 6-Phosphogluconate, utilization by M. leprue, 88, 108, 1 10 scavenging, 88 6-Phosphogluconate dehydrogenase, 88, 110
Phospholipase, M . leproe, 88, 93, 107, 110 Phospholipid, M. leprae nutrient acquisition, 107 Phosphotransacetylase, 88 Phthiocerol dimycocerosate, 80, 82, 102 pK,, reactants in anaerobic respiration, 243, 244 Plasm id(s), see also individual plusmids (below); TOL plasmids catabolic, 2-3 evidence for, 2-3, 4-5, 39 evolutionary relationships, 52-55
304
SLJBJECT INDEX
Plasmid( s)-conrrl. curing, 5, 3 9 4 4 deletion mutant, PpCC1, 39 PpCM I , 39 PpCTI, 39, 41.45 incompatibility group IncP9, 8, 52 NAH, see NAH7 plasmid; NAH Plasmids promotors. . s w Operator-promotor resistance, 20, 34, 35 SAL, 52 Plasmid pCF32, 63 Plasmid pDK1, 38. 39, 45 co-integrates with RP4, 45 evolution, 45, 50 relationship with pWW53, 4 5 4 9 restriction-enzyme map, 46 transcription comparison with p W W 0 and PWW53.47-49 Plasmid pDK2, 45 Plasmid pDKT2, 45 Plasmid pEHK455, 63 Plasmid pGB, 52 Plasmid pKF439, 38 Plasmid pKT240, 63 Plasmid pND3, 34 Plasmid pNM185, 63 Plasmid pRA 1000, I0 Plasmid pTDN1, 9 Plasmid pTG402, 62 Plasmid pTKO, 42 Plasmid pTN2, 5, 8, 19. 20, 35 regulation of twrfa-pathway by XylS, 24 Plasmid pTN8, promotor, 27 Plasmid pWW0, 5 see ulso TOL plasmids 17 kbp region as transposon, 37 application, in construction of new strains, 58 in vector creation, 62 benzoate curing, 39, 4 3 4 4 benzyl-alcohol dehydrogenase/benzaldehyde dehydrogenase, 14 chlorobenzoic acid degradation, 58 conjugative transfer, 8-9 enzymes encoded, see d s o specific enzymes; Toluene catabolism
evolution, 49 NAH plasmid relationship, 52-55 pDKl/pWW53 plasmids relationship, 47-49 gene organization, 20 gene-regulation model, 29-31 host range, 9 incompatibility group (IncP9), 8, 52 tneta-pathway genes, 21-23, 24-25 siv also Toluene catabolism NAH7 plasmid comparison, 53 pWW53 and pDKl plasmids comparison, 46-47 molecular characterization, 18-20 mutants, 39 promotors. .sw Operator-promotor properties, 8-9 recombination and transposition, 34-38,44 chromosomal DNA with, 35 regulatory genes, 23-25, 48 localization. 25-26, 48 resistance (drug) genes, 9, 20 resistance to reactive singlet oxygen species, 9 restriction map, 19, 48, 5 I R plasmid co-integrates, 20, 35-38 segregational instability, 34, 44 size, 18 structural integrity of DNA, changes, 59 transcription comparison with pDKl and pWW53.4149 transposable part as separate replicon, 37, 38 transposon location, 36-37. 38 .YJV genes, SCLJ NISO .vyI genes organization, 20-23 regulation, 23-25 xy/S gene, restriction map, 51 .YJL%'YZgene homology with henABC' genes, 16 Plasmid pWW0-8, 9 deletion from pWW0, 18-19, 20, 39 loss of TOL-specific catabolic phenotype, 19, 39 Plasmid pWW14, 43, 50 Plasmid pWW15, 43, 50, 5 1 Plasmid pWW17, 43
SUBJECT INDEX
Plasmid pWW20, 43, 50 Plasmid pWW53, benzyl-alcohol dehydrogenase/ benzaldehyde dehydrogenase, 14 pDK 1 evolutionary relationship, 4549 pEHK455 construction from, 63 restriction-enzyme map, 46 RP4 co-integrate, 4 5 4 6 . 55 second mrtu-pathway operon, 45, 49 .yyIS gene. comparison with pWW0, 51 Plasmid pWW53-4, 45, 46. 55 Plasmid pWW60-I, 37 Plasmid RP4, .set RP4 Plustnorliiini ,fdc.ipnriini antigens. hsp70 family, 21 1 Polyubiquitin genes, 192, 195 Promotor. C230 cxpression in B. suhtilis, 62 ntr and nif'genes, 27, 28, 31 probe vectors, 62. 63 on pWW53-4. 55 TOL plasmids, . s i ~Operator~ promotor Protcases, M . li>prtre, 106 Protein, abnormal/damaged, stress-protein induction, 194-196 assembly and stress proteins, 212-214 degradation, ubiquitin role in, 195 misfolded and bip/grp78 synthesis, 213 in M . lrprur plasma membrane, 76 synthesis, in M . Icywrie amino-acid uptake, 99 translocation, stress proteins and, 214215 wall-associated in M . Icprue, 78-8 I Proton electrochemical potential ( A p ) gcncration, 233 electrical/concentration components, 233-234 fumarate respiration, 253-255 methanogenesis, set^ Methanogcnesis respiration using oxides of nitrogen, 256, 257 nitrate rcduction, 256, 257 nitrite reduction, 257, 259, 260 sulphate reduction, 247-251
305
acetate/sulphate, 25 1 formate/sulphate, 25 1 hydrogen/sulphate, 247-249 lactatc/sulphatc, 249-25 1 sulphur/iron(iu) respiration, 263. 264 Proton pump, 233 Proton translocation, 230, 232, 233, 233-234 fumarate respiration, 255 nitrate respiration, 256. 257 Protozoa, stress proteins in, 187-1 88, 210 heat-shock, 210, 211, 212 Pscwdomonas spp., multiplasmid, construction, 56 Pstwbmonus ueruginosu, 260 Psc~u~lornotius ur i~illrmet -2, sw Pscwtlonionus putidu mt-2 Pscw~lomonusnzendocinu, I 2 P.s~u~lonionus puticlrr, aromatic catabolism in, evidence, 3-4 mutants, mctri-pat hwa y expressed constitutively, 27 rpoN gene, cloning, 33 Pscudomonas p u t irlu A C85 8, TO L plasmid transfer, 59 Psc~udonionrisputis B 13, 58, 60 haloaromatic/alk ylaroniatic catabolism, mutually incompatible, 58-59, 60 WR211 transconjugant. 35, 58 Psi~udonioncisputidu HS I , growth on benzoate, plasmid-deletion mutants. 3 9 4 0 , 41 p D K l in, SPC Plasmid pDKl Psrudomonus putidu mt-2, 4-cthylbenzoate (4EB) catabolism block, 60-61 aromatic catabolism in, si'c Toluene catabolism benzoate curing, 5, 39 explanation, 4 3 4 4 growth on toluidine, 9 substrates supporting growth, 5, 8 TOL plasmid, ser Plasmid pWW0; TOL plasmids xyIS gene, 4-ethylbenzoate catabolism block, 61 PscJudomonusputidu mt-2 UCC2 strain, 9
306
SUBJEC'T INDEX
Pseudomonas puridu MT 14,
growth on benzoate, TOL mutants, 40-41, 50 pWW14 and pWW17 plasmids, 43, 50, 51 Pseudomonus putidu MTI 5, growth on benzoate, TOL mutants, 40-41, 43, 51 Pseudomonus putidu MT20, B3 mutants, 40, 41 growth on benzoate, TOL mutants, 40-4 I Pseudomonus putidu MT53, growth on benzoate, TOL mutants, 40,41 Pseudomonus putidu M W 1000, 10, 6 1 Pseudomonus putidu PPI-2 strain, 57 Pseudonzonus putidu SI strain, 57 Purine nucleotides, biosynthesis, in M . microti, M . uviuni, 95 deprivation, by host in M . leprue infections, 1 I I scavenging by M. leprue, 95-96, 97 source in axenic culture of M . Icprue, 1 I3 sourccs for M . lepruc, 96, 113 pWW0, see Plasmid pWWO Pyrimidine, biosynthesis and scavenging, M . Ieprue, 93-95.108 Pyrophosphate, hydrolysis, 245 Pyruvate dehydrogenase, 92
Q Quinol, 256 Quinol :oxygen oxidoreductases, 23 3 Quinone, 232, 260 in TMAO reduction, 262
R RAD6 gene, 195 Recombination, plasmid pWW0-8 deletion caused by, 20 TOL plasmids, 34-39, 44 Redox centres, 230, 231 Redox potential, 234 enrichment cultures of magnetotactic bacteria, 142, 143
respiratory oxidants, 226, 227, 229 Resistance plasmid, 20, 34, 35 Respiration, 226, 227, 228-229 see also Anaerobic respiration aerobic vs. anaerobic, thermodynamics, 227, 228 Respiratory chains, 230-235 coupling sites, 230, 231, 232 M. leprui, 89 redox centres, 230, 231 structure and organization, 230-233 thermodynamic considerations, 226, 228, 233-235 Respiratory oxidants, 226 alternative/anaerobic, 226, 227, 26 1-264 see ulso Anaerobic respiration; Carbon dioxide; Nitrogen, oxides of; Sulphate oxygen as ideal, 226, 233 redox potentials, 226-227, 229 Restriction-enzyme map, plasmid pDK1, 46 plasmid pWW53, 46 plasmid pWW0, 19, 48, 51 Rhodopseudomonus cupsulu~u,262 Ribulose bisphosphate carboxylaseoxygenase (Rubisco), 194, 214 RNA, ribosomal (rRNA), M. leprur, 87 synthesis, limiting growth of M. Ieprue', 74 RP4, pWWO plasmid co-integrates, 20, 35-3 7 TOL plasmids co-integrate formation, 20, 38-39, 45, 50 rpoH, mutant defect, 205 RpoN, in TOL regulation, 31-34 rpoN gene, 3 1, 33 RpoN- mutant, 34 Rubisco-binding proteins, stress protein homology, 194, 214 S Succliuromyces cerevisiue, heat-shock protein
induction/thermotolerance, 204 heat-shock response, 202-203
SUBJECT INDEX
hsp26 protein, 186 hsp60 role in protein folding, 214 Hsp70 genes, 185 hsp7O protein, 193 hsp90 protein, 186 K A R 2 gene, 185, 213 stress proteins in, 188-189, 203, 204 superoxide dismutase/catalase induction, role, 200-201 Salicylate hydroxylase, 53, 57 Salmonellu typhimurium, heat-shock acquisition of thermotolerance, 205, 206 protection against hydrogen . peroxide, 199 stress proteins in, 104, 191, 199 SAL plasmid, 52 Siderophores, 105-1 06, I 13 Sigma factors, 27, 31, 33 Sodium, requirement by methanogens, 238 Starvation proteins, induction, 199-200 Sfrepfoniycesspp., TOL genes in vectors, 62 Stress proteins, 103, 183-223 see ulso Heat-shock proteins; specific sfress proteins abnormal protein degradation and, 195, 21 1 acquired thermotolerance, see Thermotolerance conservation, sequences, 185, 186, 192-193 definition, 184-185 discovery, 184 gencs coding, consensus sequence, 194, 21 1 groups, 185 host homology and auto-immune response, 2 I2 immune response and, 210-212 induction, 184, 194-203 abnormal/damaged proteins, 194-196 heat-shock (temperature), see Heatshock proteins by hybrid/aberrant proteins, 196 oxygen stress, see Oxidative damage intracellular location, 215, 216
307
mycobacterial antigen homology, 79, 103-104,210-21 I in normal unstressed cells, 185, 186 nucleic-acid and amino-acid homologies, 185, 186, 192-194, 21 I protein assembly and translocation, 212-215 protein folding, 194, 213-214 synthesis, in bacterial infections, 21 I , 212 types in micro-organisms, references, 186, 187-192 Stress response, 103, 183 M . leprue, 103-104 Succinate, 25 1, 252 Succinatc:fumarate oxidoreductasc, 252 Succinate dehydrogenase, 110, 232, 252 Succinate/fumarate couple, 231, 232 Sulphate, reduction, 226, 227, 228, 244-247 acetate/sulphate, 251 ATP utilization, 245, 246 to bisulphite, 245 bisulphite reduction to hydrogen sulphide, 245-246, 246-247 formate/sulphate, 25 1 hydrogen/sulphate, 247-249 lactate/sulphate, 249-25 I Ap generation, 247-251 reactions, 244-247 substrates for catabolism, 247-251 transport of sulphate, 244-245 as respiratory oxidant, 227, 228, 243-252 Sulphide, bisulphite reduction to, 245-246, 246-247 in enrichment cultures for magnetotatic bacteria, 137, 138 in magnetotatic bacteria, protection against peroxide, 142 tolerance of anaerobic vibrioid MV-I, 142 Sulphidogens, 244 Sulphur, cycle, 228, 243 reduction, 251-252 of iron(iri), 263, 264
308
SUBJECT INDEX
Superoxide anion, 197 Superoxide dismutase (SOD), 100, 108, 197 in A. mugnetotucticum, 143 in hydrogen peroxide detoxification, 199,200-201 induction, 199, 200 mutants deficient and oxidative damage, 198 overproducing strains and oxidative damage hypersensitivity, 198
T T-cells, mycobacterial antigen response to, 21 1 Temperature, axenic culture of M . leprae, 113 stress protein induction, 186, 202-203 see also Heat-shock proteins: individual lisps Tetruhymena p y r I f h i i s , heat-shock protein induction, 207, 208 hsp58 homology with groEL protein, 193-1 94 Tetrohymenu thcrmophila, hsp58, 213 thermotolerance mechanisms, 207 Thermodynamics, respiration, 226, 228, 233-235 Thermotolerance, 202, 203-210 arsenite-induced hsp synthesis and, 208 as distinct state from heat shock, 206 heat-shock acquisition, 204-206 amino-acid analogues effect, 207-208 cell ploidy, 210 cycloheximide inhibition of, 207 in E. coli, 202, 205 kinetics, 205 in Surch. cereuisiue, 204 stationary/log-phase cells, 199, 206 in S. typhiniurium, 206 heat-shock protein induction, correlation, 202, 204, 205, 206 lack of correlation, 204-205, 205-206, 207 kinetics of loss of, 204, 206
mechanisms, 207 reasons for contradictory evidence, 208-2 10 stresses (treatments) inducing, 205. 208, 209 Thiobucillus jerrooxiduns, 234, 238, 263-264 Thymidine, scavenging by M . lrprur, 93, 108 TMAO, see Trimethylamine oxide (TMAO) t p genes, 38 T O D pathway, 12 TOL plasmids, 1-69 sei’ a1.w Plasmid(s); Plasmid p W W 0 ; Pseudomonas putida spp.; .rsl genes benzoate curing, 5, 24, 3944 set ulso Benzoate chromosomal DNA recombination, 35 co-integrates, 20, 35-38, 50 in construction of novel strains/vcctors, 55-63 for bioaccumulations, 61-62 catabolic pathways linked, 56 multiplasmid Psrudomonus spp., 56 properties predisposing, 55-56 range of substrate extension, 60-61 strains with hybrid pathways, 5 7-60 vectors, 62-63 enzymes encoded, 5, 6, 13-18 evolutionary relationships, 45-52 with other catabolic plasmids, 52-55 selective pressure response, 52, 59 transposition role, 50, 51, 52 genes, SLY Plasmid p W W 0 ; Tolucne catabolism; .ry/ genes mutants/’partial’ mutants, 19, 39 -41, 45 see also Benzoate P S . putidu HSI, 3 9 4 0 Ps. putidu MT14, MT15, and MT20,4&4l, 43 Ps. puticlu MT53, 40 Ps. putidu PPKI, 42 in other TOL strains, 10-12 partitioning failure, 43, 44
SUBJECT INDEX
pathway encoded by, 5-6 in Ps. puridu mt-2, 3, 4-8 see also Plasmid pWWO recombination and transposition, 34-39, 50 in evolution of, 50, 51, 52 other plasmids, 38-39 pWW0, 34-38 RP4 co-integrate, see RP4 rolc in evolution of novel DNA combinations, 59 segregational instability, 34, 44 selection method, 10 Toluate 1,2-dioxygenase, 16, 58, 59 see ~ l s o.uyID gene m-Toluate, metabolism by Ps. putidu mt-2, 3 Toluene catabolism, 3, 5-6 alternative pathways for, 1 I , I 2 biochemistry, 12-18 evolution of pathways, 44-55 gene organization, 18-23 se'c ulsn xyl genes two operons, 6, 20 gene regulation, 23-24 .wi' i/l.so Operator-promotor; .\-I-/ genes additional elements, 31 co-induction of upper- and ni~tcrpathways, 30. 31, 55 model, 29-31 molecular analysis of genes, 25-26 mutants, 24-25 promotors, 26-29 RpoN involvemcnt, 31-34 [I-ketoadipate pathway, s c Toluene ~ catabolism, orlho-cleavage pathway metu-pathway, 3, 4, 6, 20 biochemistry/cnzymes, 7, 16-1 8 expression in Ps. putidu MT53 mutants, 4 1 4 2 metir-pathway operon, 7, 21-23 SCP also s y l genes duplications, 45, 49 evolution (pDKI and pWW53). 4647 gene organization, 21-23 induction, 29, 30, 31 mutants lacking, 5, 39
309
of NAH7, 53 promotor (OP2), siv Operatorpromotor pTDNl and pWWO gene homology absent, 9 pWWO and NAH7 comparison, 53 regulation, 23-24. 30, 31 regulatory genes, 23 rpoN gene in regulation, 32 two copies on pWW53,45. 49 ortho-cleavage pathway, 3, 4, 5, 17. 41 regulation, 23-24 regulatory genes, 23 see ulso .q!R gene; sjLS gene upper-pathway, biochcmistry, 6, 13-15 upper-pathway operon, 6, 20, 26. 27 evolution (pDK1 and pWW53), 46 gene organization, 20-21 promotor (OPI), scc Operatorpromotor Toluene dihydrodiol, 12 Transcription, initiation, nwru-pathway operon, 27-29 lon gene, 196 pWW53, p D K l and pWWO plasmids comparison, 4 7 4 8 and .ydS genes, 26 Transhydrogenasc, 232 Transposition, TOL plasmids, 34-39, 50 in evolution of, 50, 51, 52 Transposon, 17kbp of TOL plasmid acting as, 37 hypothesis for recombination of TOL plasmids, 37-38 location on pWW0. 36-37, 38 Transposon Tn5, 20, 25 Transposon Tn401, 9 Transposon Tn4651, 37-38, 50 Transposon Tn4652, 37-38 Transposon Tn4653, 37, 38, 50 Trehalose dimycolate, 82 Trehalose monomycolate, 82 Trehalose mycolyltransferase, 79, 83 Triacylglycerol lipase. 107 .\-?i/R
310
SUBJECT INDEX
Tricarboxylic acid (TCA) cycle enzymes, in magnetotactic bacteria, 140 in M. leprue, 87, 89, 110 Triglyceride, M. leprue nutrient acquisition, 107 Trimethylamine oxide (TMAO), reduction, 226, 261-262, 265 Trimethylamine oxide (TMAO) reductase, 261 -262 Trimethylamine (TMA), 262 'Trithionate pathway', 246 Trj'panosomu sp., heat-shock response, 210,212 Tryptophan catabolism, 109 U UB14 polyubiquitin gene, mutants defective, 195 Ubiquitin, 185 amino-acid homology, I92 functionirole, 193, 195 induction of synthesis, 195 transcription, 193, 195 Ubiquitin-protein complexes, 195 Uricase, 177 Uridine nucleotides, in M. liywur, 95 V
Vector, s w ulso Plasmid(s)
pCF32, 63 pKT240, 63 pNM 185, 63 pTG402, 62 pTS1045, 63 TOL genes creating, 62-63 Vihrio surrinogrwrs, 252
X Xliol, 19 XI102 genes, 9 m- and p-Xylene, growth on, 5, 41 see ulso Toluene catabolism; .uyl
genes 8 3 mutants, 40, 41 catabolism pathways, 5 , 6
Xylene mono-oxygenase, 13 Xylene oxidase (XO), 13, 14, 15 .uyl genes see also Plasmid pWW0; Toluene catabolism cluster, 5 co-ordinated expression, 30, 31, 55 evolution, 44 loss, 5, 39, 41, 42 molecular analysis, 25-26 organization, 18-23 map, 20, 22 PWWO, p D K l and pWW53.47-49 promotors, we Operator-promotors regulation, 23-34 see ulso Toluene catabolism evolution, 55 model, 29-31 mutants, 24-25 RpoN involvemcnt, 31-34 XylS and XylR role and action. 24-25, 30, S5 regulatory, 23 see also sy1R gene; .rylS gene molecular analysis, 25-26 in vector construction, 63 xylA gene, 13, 21 XylA protein, 13 xylS gene, 14, 20 induction, 25 .vytC gene, 14, 20, 2 I uyIDEFG genes, 20 .vylD gene, 16, 60 .r.vlE gene, 20 s w ulso C230 ulgD gene fusion, 63 expression detection, 21, 62 homology with NAH7 gene nuhH, 53 induction, 25 in vector pTG402, 62 xyIL gene, 60 xylM gene, 13, 21 XylM protein, 13 .uylN gene, product, 21 .u.vIQ gene, 23 xyIR gene, 23, 24 codon usage, 26 promotor (Pr), 26-27 transcription in pDK1, PWW53, 49
31 I
SUBJECT INDEX
transcription and sequencing, 26, 33 XylR protein, binding site, 33 broad effector specificity, 30 effect on .vdS transcription, 30, 31 function/role, 24, 25, 29-30 OPI and Ps interaction, 29-30, 33 positive regulation by, 24, 25 RpoN involvement, 3 1-32 .ryIS gene, 23, 24 expression, 30 mutant, 4-ethylbenzoate catabolism, 61 promotor (Ps), 26, 27 in pWW53 and pDKI, homology, 49 restriction-enzyme map on p w w o , 51
role/function, 24-25, 30 transcription and sequencing, 26, 30, 31 XylS protein, interaction with OP2, 29, 30 narrow effector specificity, 30, 60 overproduction, 30 positive regulation by, 24-25 . y l T gene, 23 .vy/XYZ gene, sequencing, I6
Y Yeasts, stress proteins in, 188-189
Z Zinc depletion, 104- I05
This Page Intentionally Left Blank