VITAMINS A N D HORMONES VOLUME 55
Editorial Board
FRANK CHYTIL
MARYF. DALLMAN JENNY P. GLUSKER
ANTHONY R. MEANS BE...
57 downloads
1254 Views
39MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
VITAMINS A N D HORMONES VOLUME 55
Editorial Board
FRANK CHYTIL
MARYF. DALLMAN JENNY P. GLUSKER
ANTHONY R. MEANS BERTW. O’MALLEY VERNL. SCHRAMM MICHAELSPORN ARMENH. TASHJIAN,JR.
VITmINS AND HORMONES ADVANCES IN RESEARCH AND APPLICATIONS
Editor-in-Chief
GERALDLITWACK Department of Biochemistry and Molecular Pharmacology Jefferson Medical College Thomas Jefferson University Philadelphia, Pennsylvania
Volume 55
ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto
This book is printed on acid-free paper. @ Copyright 0 1999 by ACADEMIC PRESS All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the Publisher. The appearance of the code at the bottom of the first page of a chapter in this book indicates the Publisher’s consent that copies of the chapter may be made for personal or internal use of specific clients. This consent is given on the condition, however, that the copier pay the stated per copy fee through the Copyright Clearance Center, Inc. (222 Rosewood Drive, Danvers, Massachusetts 01923). for copying beyond that permitted by Sections 107 or 108 of the US. Copyright Law. This consent does not extend to other kinds of copying, such as copying for general distribution, for advertising or promotional purposes, for creating new collective works, or for resale. Copy fees for pre-1999 chapters are as shown on the title pages. If no fee code appears on the title page, the copy fee is the same as for current chapters. 0083-6729/99 $25.00
Academic Press a division of Harcourt Brace & Company 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http://www.apnet.com
Academic Press 24-28 Oval Road, London NW 1 7DX, UK http://www.hbuk.co.uk/ap/ International Standard Book Number: 0- 12-709855-0 PRINTED IN THE UNlTED STATES OF Ah4ERICA 98 99 00 01 02 03 BB 9 8 7 6
5
4
3 2
I
Former Editors KENNETHV. THIMANN ROBERTS. HARRIS Newton, Massachusetts
JOHN A. LORRAINE University of Edinburgh Edinburgh, Scotland
PAUL L. MUNSON University of North Carolina Chapel Hill, North Carolina
JOHN GLOVER University of Liverpool Liverpool, England
GERALDD. ALJRBACH Metabolic Diseases Branch National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland
University of California Santa Cruz, California
IRAG. WOOL University of Chicago Chicago, Illinois
EGONDICZFALUSY Karolinska Sjukhuset Stockholm, Sweden
ROBERTOLSON School of Medicine State University of New York at Stony Brook Stony Brook, New York
DONALDB. MCCORMICK Department of Biochemistry Emory University School of Medicine Atlanta, Georgia
This Page Intentionally Left Blank
Contents PREFACE ..........................................................
xi
G-Protein-Coupled, Extracellular Ca2+-SensingReceptor: A Versatile Regulator of Diverse Cellular Functions
STEPHEN QUINN, EDWARD M. BROWN, PETERM. VASSILEV, AND STEVEN C. HEBERT I. Introduction: Ca2-Sensing and the Maintenance of Mineral IonHomeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Indirect Evidence That Parathyroid and Other Cells Sense Ca? Via a G-Protein-Coupled CaR . . . . . . . , . . 111. Isolation of a Bovine Parathyroid CaR by E in Xenopus laevis Oocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rv. Structural Similarity of the CaR to Other GPCRs . . . . . V. Are There Other C a y Sensors? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI. Signal Transduction Pathways Employed by the CaR . . VII. The CaR Gene and Regulation of CaR Expression . . . . . . . . . VIII. Structure-Function Relationships of the CaR . . . . . . , . . . . . . . . . . . . . . . IX. The CaRs Tissue Distribution and Functions in Tissues Involved in Mineral Ion Homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . X. Human Diseases Resulting from C a R Mutations Clarify the Receptor’s Physiological Roles . . . . . . ................................... XI. Tissue Distribution and Functions of the CaR in Tissues Uninvolved in Systemic Ion Homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................. XII. CaR-Based Therapeutics . . . . . . . . . . XIII. Summa...................................................... .................................. References . . . . . . . . . . . . .
2 8
9 12 14 17 18 20 21
31 42
55 56 56
Peptide Hormones, Steroid Hormones, and Puffs: Mechanisms and Models in Insect Development AND L. I. GILBERT V. C. HENRICH, R. RYBCZYNSKI,
1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. PTTH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Juvenile Hormone and the Prothoracic Gland . . . . . . . . . . . . . . . . . . . . . . vii
73 79 92
...
CONTENTS
Vlll
Tv. Ecdysteroid Action ............................................ References
...................................................
93 115
Nuclear Matrix and Steroid Hormone Action AND THOMAS C. SPELSBERG THOMASJ . BARRETT
I . Introduction and Background ................................... I1. Nuclear Matrix-Chromatin Structure ............................ I11. Steroid-Hormone-Induced Effects on Chromatin Structure and Matrix Composition ........................................ IV Contributions of the Nuclear Matrix to Steroid-Mediated GeneTranscription ............................................ V. Role of the Nuclear Matrix in Steroid Hormone Signaling and Nuclear Binding .......................................... VI . Maintenance of the Nuclear Matrix by Steroid Proteins . . . . . . . . . . . . . . VII. Conclusions and Future Directions ............................... References ...................................................
127 128 131
133 136 141 145 150
Coregulatory Proteins in Nuclear Hormone Receptor Action
DEANP. EDWARDS I . Introduction ................................................. I1. Nuclear Receptor Superfamily: Structure and Function . . . . . . . . . . . . . . I11. Accessory Proteins That Modulate Nuclear Receptor Binding toTargetDNASequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tv. Nuclear Receptor Transcriptional Coactivators ..................... V. Summary and Future Questions ................................. References ...................................................
165 166 169 178 200 204
Molecular Action of Androgen in the Normal and Neoplastic Prostate JOHN M. KOKONTIS AND SHUTSUNG LIAO I. Introduction ................................................. I1. Metabolic Activation ofAndrogens ............................... I11. ARStructure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
220 221 226
ix
CONTENTS
Iv. Mechanism of AR Activation
v.
....................................
ARMutation ................................................. VI . AR Expression in the Normal Prostate and in Prostate Cancer . . . . . . . . VII . Androgen-Regulated Genes ..................................... VIII . AR Function in Prostate Cancer ................................. IX. Concluding Remarks .......................................... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
236 244 249 256 267 273 274
Regulation of Androgen Action
A . K. ROY.Y. LAVROVSKY. C. S. SONG. S. CHEN.M . H . JUNG. N . K . VELU.B .Y. BI. AND B . CHATTERJEE I . Introduction ................................................. I1. Androgen Receptor and Androgen Response Elements . . . . . . . . . . . . . . . I11. Regulation of Androgen Receptor Gene Expression . . . . . . . . . . . . . . . . . . Tv. Ligand-Mediated Activation and Inhibition of Androgen ReceptorFunction ............................................ v. Enzymatic Regulation of Androgen Action ......................... VI. Mediation of Androgen Action by Peptide Growth Factors . . . . . . . . . . . . VII . Androgen Action in Target Cells Containing High Levels of Androgens and Androgen Receptor ............................. VIII . Summary .................................................... References ...................................................
309 311 320 323 326 331 332 337 339
Regulation of Estrogen Action: Role of 17P-Hydroxysteroid Dehydrogenases
PIRKKO VIHKO.AND REIJO VIHKO HELLEVIPELTOKETO. I . Introduction ................................................. ......................... I1. I11. 17HSD Type 1Enzyme and Ovarian E2 Production . . . . . . . . . . . . . . . . . Expression and Action of 17HSD v p e 1and Type 2 Enzymes duringpregnancy ............................................. V. Physiological Role and Expression of l7HSD Type 1and Type 2 Enzymes in Peripheral Tissues .................................. VI. Structure and Function of 17HSD Type 1Enzyme: Applications to the Prevention and Treatment of Estrogen-Dependent Cancers ...... VII. Regulation of hHSD17BI Gene Expression ........................ .............................................. VIII . References ..................................... ..
rv
353 355 360 367 373 378 381 385 386
X
CONTENTS
Steroidogenic Acute Regulatory Protein
DOUGLAS M. STOCCO I. Introduction ................................................. 11. What Are the Factors Involved in the Acute Regulation ofsteroidogenesis? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . HI. The Steroidogenic Acute Regulatory Protein ....................... IV. Consequences of a Disordered StAR Gene . . . . V. Putative Mechanism ofAction of StAR . . . . . . . VI. Conclusions ............................. ...... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
399 402 404
429 430
Regulated Expression of the Bone-Specific Osteocalcin Gene by Vitamins and Hormones
JANE B. LIAN,GARYS. STEIN, JANET L. STEIN, AND ANDREJ. VANWIJNEN I. Introduction ................................................. 11. Protein Properties and Function Rely on the Vitamin-K-Dependent Synthesis of y-Carboxyglutamic Acid Residues ..................... 111. Regulated Expression of Osteocalcin during Osteoblast Differentiation ............................................... IV. Properties of the Rat Osteocalcin Promoter ........................ V. Chromatin Structure, Nucleosome Organization, and Osteocalcin Gene-Nuclear Matrix Interactions Support Interrelationships between Activities at Multiple Independent Promoter Elements . . . . . . . VI. Closing Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
INDEX. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
443 444 448 458
477 487 488
511
Preface This volume of Vitamins and Hormones covers mainly steroid hormone action, although two contributions discuss calcium and peptide hormones. The first chapter, by Edward M. Brown and collaborators, is devoted to a G-protein-coupled extracellular sensing calcium receptor that plays a role in various cellular functions. The second article, from the laboratory of L. I. Gilbert and his co-workers, focuses on peptide and steroid hormones in insect development. This is followed by a treatise from the laboratory of T. C. Spelsberg on the nuclear matrix and steroid hormone action. D. P. Edwards contributes a timely essay on coregulatory proteins in steroid hormone receptor action. This is followed by two papers on androgen action, one from the laboratory of S. Liao on the molecular action of androgen in normal or neoplastic prostate and a second from the laboratory of A. K. Roy on the regulation of androgen action. Another article deals with the role of 17P-hydroxysteroid dehydrogenases in estrogen action, as discussed by R. Vihko and colleagues. D. M. Stocco then provides a review of the steroidogenic acute regulatory (StAR) protein. Finally, the laboratory of G. Stein ably provides a review of the topic of vitamin D and steroid hormone control of the osteocalcin gene. This volume, then, provides an important update on steroid hormone action and related areas. Academic Press continues to be helpful in the preparation of these books. Subsequent volumes will deal with widely variable subject matter, consistent with the expanded scope of this serial publication. GERALD LITWACK
xi
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
G-Protein-Coupled, Extracellular Ca2+-SensingReceptor: A Versatile Regulator of Diverse Cellular Functions EDWARD M. BROWN,* PETER M. VASSILEV," STEPHEN QUINN,* AND STEVEN C. HEBERTT *Endocrine-HypertensionDivision, Department of Medicine Brigham and Women's Hospital and Harvard Medical School Boston, Massachusetts 02115, and ?Renal Division, Department of Medicine Vanderbilt University Medical Center Nashville, Tknnessee 37201
I. Introduction: CaE+-Sensingand the Maintenance of Mineral Ion Homeostasis 11. Indirect Evidence That Parathyroid and Other Cells Sense Caz+ via a G-ProteinCoupled CaR 111. Isolation of a Bovine Parathyroid CaR by Expression Cloning in Xenopus laevis Oocytes Tv. Structural Similarity of the CaR to Other GPCRS V. Are There Other Ca:+ Sensors? VI. Signal "ransduction Pathways Employed by the CaR VII. The CaR Gene and Regulation of CaR Expression VIII. Structure-Function Relationships of the CaR M. The CaRs Tissue Distribution and Functions in Tissues Involved in Mineral Ion Homeostasis A. Parathyroid B. C Cells C. Kidney D. Bone E. Intestine F. Placenta X. Human Diseases Resulting from CaR Mutations Clarify the Receptor's Physiological Roles A. Familial Hypocalciuric Hypercalcemia B. Neonatal Severe Hyperparathyroidism C. Mouse Models of FHH and NSHPT D. Human Forms of Hypocalcemia Due to Activating CaR Mutations XI. Tissue Distribution and Functions of the CaR in Tissues Uninvolved in Systemic Ion Homeostasis A. Spatial Heterogeneity of Cat+ and Local Ca? Homeostasis B. Microenvironments with Varying Levels of Cat+ C. Possible Roles of the CaR in Local Homeostasis D. CaR in Tissues Uninvolved in Systemic C a p Homeostasis XII. CaR-Based Therapeutics XIII. Summary References
1
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99 $25.00
2
EDWARD M. BROWN et al.
I. INTRODUCTION: CaF-SENSINGAND THE MAINTENANCE OF MINERAL IONHOMEOSTASIS Calcium ions play crucial roles in multiple intra- and extracellular processes (Brown, 1991; Pietrobon et at., 1990). Calcium is a key intracellular second messenger and cofactor for various proteins and enzymes, regulating functions as diverse as neurotransmission, muscular contraction, hormonal secretion, cell division, and cellular motility (Pietrobon et al., 1990).In the extracellular space, calcium is a cofactor for clotting factors, adhesion molecules, and other proteins. It also regulates neuronal excitability and is an essential component of the mineral phase of the skeleton. Bone provides both a structural framework protecting crucial bodily structures and enabling locomotion and a large reservoir of mineral ions that can be mobilized in times of need (Brown, 1991; Stewart and Broadus, 1987). In free-living terrestrial organisms, there is only intermittent availability of calcium ions from the environment in the diet (Stewart and Broadus, 1987). For this reason, tetrapods (mammals, birds, reptiles, and amphibians) possess a complex homeostatic mechanism whose principal function is to ensure near constancy of the extracellular ionized calcium concentration (Ca?') (Fig. 1)(Brown, 1991; Stewart and Broadus, 1987). This system enables great flexibility in terms of adjusting the fluxes of calcium ions between the extracellular fluid (ECF) and the environment in kidney and intestine as well as between the ECF and the mineral phase of bone. The egg-laying cycle of birds affords a particularly striking example of the capacity of this system to adjust to large alterations in the requirements of an organism for calcium ions. A laying hen deposits a quantity of calcium in each egg that is more than 10%of that present in the entire hen's skeleton. Mobilizing this amount of calcium from the diet and skeleton and then replacing the lost skeletal calcium over a matter of hours, as frequently as every day, requires that total plasma ionic calcium be turned over approximately four times every minute (Hurwitz et al., 1973). Nevertheless, in this setting the homeostatic mechanism maintains the serum ionized calcium concentration nearly invariant (Diaz et al., 1997a;Hurwitz, 1996) so as to ensure proper functioning of processes requiring constant availability of Ca:+ (e.g., hormonal secretion, cardiac contractility, etc.). The maintenance of near constancy of Ca?+in tetrapods necessitates that specific cells of the mineral ion homeostatic system detect and respond in a homeostatically appropriate manner to changes in plasma calcium concentration on the same order as its normal variability. In
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
3
FIG.1. Schematic diagram illustrating the regulatory system maintaining CaE+homeostasis. The solid arrows and lines show the effects of PTH and 1,25(OH),D,; the dotted arrows and lines demonstrate examples of how C a p or phosphate ions exert direct actions on target tissues. Abbreviations are the following: Ca2+,calcium; PO,, phosphate; ECF, extracellular fluid; PTH, parathyroid hormone; 1,25(OH),D, 1,25-dihydroxyvitamin D; 25(OH)D, 25-hydroxyvitamin D; minus signs indicate inhibitory actions, while plus signs show positive effects. (Reproduced with permission from Brown et al., 1994. Copyright 0 1994 Williams and Wilkins.)
normal humans, the coefficient of variation of the serum ionized calcium concentration is 2% or less, only slightly greater than the precision of the ion-sensitive electrodes used to measure it (Parfitt, 1987; Parfitt and Kleerekoper, 1980).Therefore, there must be cells capable of sensing changes in CaE+ of this magnitude. This article limits the term Ca:+-sensing to actions of Ca:+ occurring within or close to the level of extracellular calcium to which a given cell is normally exposed. In some instances, especially for epithelial cells, as discussed in more detail in Section XI,B, there can be large differences in the levels of Ca:+ in the ECF to which the opposite sides of a given cell are exposed (Brown, 1991).For example, the concentration of total Ca:+ in the prostatic secretions is about 30 mM (Valtin, 19831, while the level of ionized calcium on the side of prostatic cells facing the blood is probably close to that within the circulation (-1.2-1.3 mM).Alternatively, the level of CaE+ in which a cell is bathed may vary sub-
4
EDWARD M. BROWN et al.
stantially, as within the lumen of the proximal portions of the gastrointestinal tract (e.g., stomach and duodenum), depending on the availability of calcium within the diet. What are the most important cells that sense Cap? Classical examples are the parathyroid hormone (PTH)-secreting chief cells of the parathyroid gland and the calcitonin-secreting C cells of the thyroid gland, which secrete less and more, respectively, of these so-called calciotropichormones in response t o elevations in Ca:+ (Brown, 1991). Figure 2A shows the steep inverse sigmoidal relationship between circulating levels of the intact, secreted form of parathyroid hormone, PTH (1-841, and Ca:+ in normal humans (Brent et al., 1988). This curve can be described quantitatively by four parameters (Fig. 2B) (Brown, 1983): maximal secretory rate at low C a p (parameterA), maximal slope (e.g., at the midpoint) (parameter B), midpoint or set point (e.g., the level of C a p that produces half-maximal inhibition of PTH secretion) (parameter C),and minimal secretory rate at high C a r (parameter D ) . The set point is related to the normal level of Ca:+ within the ECF, although the level at which the serum ionized calcium concentration is “set” is usually slightly higher than the parathyroid set point per se. As a result, ambient PTH levels in uiuo are about 20-25% of their maximal levels at low C a r (Brent et al., 1988). The steepness of the curve relating PTH to C a p plays a key role in determining the range over which Ca:+ varies in uiuo, since it ensures that small changes in C a r engender large alterations in PTH. The latter, in turn, normalize Ca:+ through the mechanisms illustrated in Fig. 1. There is also a steep sigmoidal relationship between C a p and calcitonin (CT) secretion, although this relationship is positive with respect to C a r , rather than negative, as for PTH (Austin and Heath, 1981;Fajtova et a,?., 1991; Scherubl et al., 1993). CT can also contribute to maintaining Ca:+ within its normal limits, since this hormone exerts hypocalcemic actions, principally by inhibiting osteoclastic bone resorption and enhancing renal Ca2+excretion (Austin and Heath, 1981; Stewart and Broadus, 1987). Although CT does not contribute importantly to mineral ion homeostasis in adult humans, it does exert potent calciotropic actions in some species, such as the rat. Additional tissues involved in calcium homeostasis also sense Ca:+. For instance, the conversion by renal proximal tubular cells of 25-hydroxyvitamin D to 1,25dihydroxyvitamin D, the most active natural form of vitamin D, is directly modulated by physiologically relevant changes in Ca:+ (Weisingeret al., 1989; Brown, 1991). That this action of Ca:+ is not an indirect one, mediated by concomitant changes in circulating PTH levels, has been shown by studies in which PTH levels were “clamped” by
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
5
I -I
100.
a
EX
; IA.
0
* w
u)
SO'
4 W -I W
a I I-
n
1.03.0 2.0
0
[ Ca+ +I, m M
MlNlMUN
X
FIG.2. (A) The steep inverse sigmoidal relationship between PTH levels and C a r in uiuo. These studies were carried out by infusing EDTA or calcium in normal humans and
measuring circulating levels of intact PTH as a function of serum ionized calcium concentration, here expressed as millimolar levels. (Reproduced in modified form with permission from Brown, 1991. Copyright @ 1991 The American Physiological Society.) (B) Four-parameter model of the inverse sigmoidal relationship between extracellular CP]} + 0,where Y is the maxcalcium and PTH release based on Y = {(A - D)/[l + (X/ imal secretory rate, B is the slope of the curve at its midpoint, C is the midpoint or set point, and D is the minimal secretory rate. Reproduced with permission from E. M. Brown, Four parameter model of the sigmoidal relationship between parathyroid hormone release and extracellular calcium concentration in normal and abnormal parathyroid tissue. J.Clin. Endocrinol. Metab., 56,572-581, 1983; 0 The Endocrine Society.
infusing parathyroid hormone into parathyroidectomized rats by minipump (Weisinger et al., 1989).These animals still showed a steep inverse relationship between circulating levels of 1,25-dihydroxyvita-
6
EDWARD M. BROWN et al.
min D and Ca:+, not unlike that between PTH and Ca:+. A similar inverse function relating Ca?+ to 1,25-dihydroxyvitamin D has been observed in a boy with hypoparathyroidism (Carpenter et al., 1990). This relationship between vitamin D metabolism and C a p is physiologically appropriate. Elevating the level of 1,25-dihydroxyvitamin D during hypocalcemia produces greater absorption of dietary Ca2+ and promotes bone resorption, thereby mobilizing skeletal Ca2+ stores and restoring Ca?+ toward normal (Stewart and Broadus, 1987). Ca:+ also directly modulates the function of other elements of the mineral ion homeostatic system. Raising the peritubular but not the luminal level of Ca:+ in perfused tubules of the thick ascending limb (TAL) of Henle’s limb inhibits the reabsorption of both Ca2+and magnesium (Mg2+) ions (Quamme, 1982).This direct effect of Caz+on tubular reabsorption increases Ca2+ excretion-a homeostatically appropriate response. High CaE+also inhibits bone resorption in organ culture (Raisz and Niemann, 1969) as well as by isolated osteoclasts (Malgaroli et al., 1989; Zaidi et al., 1989). Since the level of Ca:+ beneath a resorbing osteoclast can be markedly higher than that in the systemic ECF (e.g., 8-40 mM) (Silver et al., 19881, this resorbed Ca2+could feed back to limit further osteoclast-mediated breakdown of bone. Elevated levels of Ca:+ also stimulate several aspects of osteoblast function in uitro that could promote increased bone formation in viuo and, therefore, reductions in Ca:+. These include enhancing osteoblastic proliferation (Kanatani et al., 1991; Quarles et al., 1997; Sugimoto et al., 1993) and chemotaxis (Godwin and Soltoff, 1997), increasing release of insulin-like growth factor-I1 (IGF-11) (Honda et al., 1995) and stimulating bone formation in organ culture (Raisz and Niemann, 1969).Finally, Ca?+ modulates aspects of intestinal function that may be relevant to mineral ion homeostasis. CaE+ and 1,25-dihydroxyvitamin D act together to increase duodenal levels of the intracellular calcium-binding protein, calbindin D9K, which may play a role in vitamin D-mediated absorption of dietary calcium (Brehior et al., 1989). This body of data strongly suggests that, in addition to the control of mineral ion homeostasis by the classical calciotropic hormones, PTH, CT, and 1,25-dihydroxyvitamin D, Ca?+itself can act, in effect, as a local or systemic calciotropic “hormone” (Fig. 3). This hormone-like role of Caz+ could modulate the function of many cells and tissues involved in mineral ion metabolism via changes in the local or systemic levels of Gag+ arising from the Ca2+-translocatingactions of these tissues. Although the effects of Ca:+ on the cellular functions described earlier could contribute to maintaining extracellular calcium homeostasis (e.g., as indicated in Figs. 1and 3), Gag+ also modulates the function of
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
7
SYSTEMIC CONTROL OF HORMONAL SECRETION
1 PTH
CONTROL OF HORMONE ACTION
LOCAL PARACRINE
AUTOCRINE
FIG.3. Schematic diagram illustrating the manner in which changes in C a p modulate the function of selected cells involved in mineral ion homeostasis. See text for details.
various other cell types seemingly uninvolved in mineral ion metabolism. Many studies on the effects of Ca2+on various cellular functions have attempted to determine the involvement of the cytosolic calcium concentration (Cay+)in these processes by totally removing extracellular Ca2+.In some cases, however, these studies have documented substantial alterations in cellular function over a range of C a p close to or within physiologically relevant levels. Elevating CaE+,for example, inhibits cyclic AMP (CAMP)accumulation (Siege1 and Daly, 1985) and modulates agonist-evoked phospholipase 4 activity (Matsuoka et al., 1989)in platelets. Raising CaE+ also promotes the differentiation of sev-
8
EDWARD M. BROWN et al.
era1 types of epithelial cells in culture, including keratinocytes (Bikle et al., 1996;Hennings et al., 1980),mammary cells (McGrath and Soule, 1984), urothelial cells of the bladder (Southgate et al., 19941, and intestinal epithelial cells (Black and Smith, 1989; Buset et al., 1986; for review, see Brown, 1991). C a p likewise modulates the function of the testosterone-producing, testicular leydig cells, including the secretion of parathyroid hormone-related peptide (PTHrP) from the malignant Leydig cell line H-500 (Rizzoli and Bonjour, 1989). The physiological relevance of these diverse actions of Ca:+ are uncertain, but they suggest that C a p could exert more generalized effects on various cells, extending well beyond those involved solely in maintaining mineral ion homeostasis. How do these various cells sense Cap? For many years, the mechanisms(s) underlying Ca:+-sensing was obscure. Only since about 1993, have studies elucidated the molecular nature of one such Ca:+-sensora Ca:+-sensing receptor (CaR) initially cloned from bovine parathyroid gland that belongs to the large superfamily of guanine nucleotide regulatory (GI-protein-coupled receptors (GPCRs) (Brown et al., 1993). This discovery has enabled rapid elucidation of the CaRs role in Ca:+sensing by parathyroid and several other cell types, both those involved and those uninvolved in mineral ion metabolism (Chattopadhyay et al., 1996b;Chattopadhyay and Brown, 1997).This article describes the isolation of the CaR and related progress in this area, including the receptor’s predicted structure and the second messenger pathways to which it couples, its tissue distribution and known functions, and the data for its physiological importance that have been afforded by the creation of CaR-deficient mice and the discovery of inherited human diseases of Ca:+ homeostasis resulting from CaR mutations. 11. INDIRECT EVIDENCE THATPARATHYROID AND OTHERCELLS SENSE Ca? VIAA G-PROTEIN-COUPLED CaR
The initial evidence for the presence of a G-protein-coupledCaR came from studies in bovine parathyroid cells examining the actions of Caz+, the physiological agonist for the putative CaR, on intracellular second messengers. The Caz+-inducedchanges in these intracellular signaling pathways closely resemble those caused by known GPCRs, particularly the so-called “calcium-mobilizing”receptors (Brown, 1991;Juhlin et al., 1990; Nemeth and Scarpa, 1986; Shoback et al., 1988).A key observation was that the putative Cap-sensing receptor stimulated release of Ca2+from its intracellular stores (Nemeth and Scarpa, 1986,
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
9
1987). This action suggested that the CaR evoked a second-messengerdependent mobilization of intracellular calcium, most likely via inosito1 1,4,5-trisphosphate (IPJ, a product of the receptor-mediated activation of the phospholipase C (PLC). In fact, subsequent studies showed that high CaE+(Brown et al., 1987) and other CaR agonists [e.g., other divalent cations (MgE+,Ba?+, and Sr?+)(Brown et al., 1990; Shoback et al., 19881, trivalent cations (La:+ and Gd:+) (Brown et al., 19901, and even organic polycations (spermine or neomycin)l (Brown et al., 1991; Ridefelt et al., 1992) activated PLC, thereby generating its immediate products, diacylglycerol and IP, (Kifor and Brown, 1988; Kifor et al., 1992). 111. ISOLATION OF A BOVINEP A R A T ~ O CaR I D BY EXPRESSION CLONING IN Xenopus laevis OOCYTES Expression cloning in Xenopus laevis oocytes has afforded an effective means for the cloning of Ca2+-mobilizingGPCRs for which no molecular probes (e.g., oligonucleotides complementary to its cDNA or antibodies) were available. Injection of X . laeuis oocytes with poly(A)+ RNA [which is enriched in messenger RNA(mRNA)lisolated from a tissue expressing the receptor in question directs synthesis of that receptor via the oocyte's protein biosynthetic machinery. The resultant receptor protein couples to the oocyte's endogenous G proteids) and PLC. Subsequent exposure of the mRNA-injected oocytes to that receptor's agonists produces G-protein-dependent activation of PLC and an ensuing rise in Ca:+(Dascal, 1987). Since the oocytes also contain a large conductance chloride channel activated by increases in Cap+(Dascal, 19871, agonist-evoked, Caf' -dependent increases in C1 current are a sensitive parameter of the receptor's presence that can be followed during the expression cloning process. In a similar manner, Brown et al. (1993) injected X. laeuis oocytes with poly(A)+RNA isolated from bovine parathyroid glands; the oocytes then acquired CaR agonist (e.g., Gd:+)-evoked increases in PLC activity and Ca2+-activated chloride currents. Size fractionation of the poly(A)+RNA yielded fractions of 4-6 kilobases (kb) in size that conferred substantially larger GD:+-evoked Cl- currents following their injection into oocytes. A cDNA library constructed from the most active RNA fractions was screened by injecting additional oocytes with synthetic messenger RNA prepared from the cDNA inserts of pools of -600 independent cDNA clones. The screening of progressively smaller pools of clones that were positive for Gd:+-evoked C1- currents led to even-
10
EDWARD M. BROWN et al.
tual isolation of a single 5.3-kb clone exhibiting agonist-evoked activation of chloride currents with a potency series essentially identical to that for activation of the putative CaE+-sensing receptor in bovine parathyroid cells (Brown et al., 1993). The cloned receptor was called BoPCaR (Bovine Parathyroid Ca:+-Sensing Receptor). The amino acid sequence of BoPCaR predicted from the nucleotide sequence of its cloned cDNA revealed a very large (-600 amino acids) amino (NH,)-terrninal extracellular domain (ECD), a central core of some 250 amino acids with seven predicted transmembrane domains (TMDs)characteristic of GPCRs and an intracellular carboxyl (C)-terminal tail of -200 amino acids (Brown et al., 1993) (e.g., Fig. 4). As might have been expected given the millimolar concentrations of CaE+ within the ECF, there are no high affinity Ca2+binding sites within the receptor's ECD and extracellular loops (ECLs) that might have participated in the binding of C a g . Instead, the CaRs ECD and second extracellular loop (ECL2) contain clusters of negatively charged amino acids (i.e., aspartate and glutamate) that might represent sites for the sensing of Ca:+ and other polycationic agonists. Similar clusters of acidic residues are thought to bind Ca2+in other low-affinity Ca2+-binding proteins (i.e., calsequestrin and calreticulin) (Fliegel et al., 1987). These clusters of negatively charged amino acids could also provide for the highly cooperative control of PTH secretion by CaE+ (Brown, 1983, 1991), presumably through allosteric interactions involving the binding of several Ca2+ions to distinct regions on the receptor. Indeed, the Hill coefficient for the recombinant CaR expressed in mammalian cells is 3-4 (Bai et al., 19961, as compared with the value of unity for the interaction of a ligand with a single, noncooperativebinding site. The ECD of the CaR also contains multiple N-linked glycosylation sites (Brown et al., 1993; Fan et al., 1997), while its intracellular domains [three intracellular loops (ICLs) and C-terminal tail] harbor several predicted consensus protein kinase C (PKC) and protein kinase A (PKA)phosphorylation sites (Brown et al., 1993; Chattopadhyay and Brown, 1997). The cloning of BoPCaR made it feasible to employ nucleic-acid-hybridization-based techniques to search for additional Ca:+-sensing receptors [called CaRs in this article; in some cases, the alternative desFIG.4. Schematic representation of the predicted topological structure of the C a d cloned from human parathyroid gland. Abbreviations include: SP = signal peptide; HS = hydrophobic segment. Also delineated are missense and nonsense mutations causing either familial hypocalciuric hypercalcemia or autosomal dominant hypocalcemia. These are indicated using the three-letter amino acid code, with the normal amino acid indicated before and the mutated amino acid shown after the numbers ofthe relevant codons. (Reproduced with permission from Brown et al., 1997).
X Inactivating lk Activating
S
Pro39Ala SarS3Pro
A.nll8Lym
Prollhu
Qlu127Ala
Arg6aC.t
Phm128L.u ThrllUCt GlU 191LyD
Arg66Cys Tbrl3R(rt
AlallCThr
clyl43Glu Oln245Arp A.nl78A.p Phr612S.r ArglBSGln QlnCBlRim hp2llGly Ph.806S.r -2 18Sir Pro221S.r -227-u (Gln) ClU297LY. Cym582~yr Sir607Stop Smr657Tyr Gly67OArg
A ~ ~ ~ B O C ~ S Pro747r-ahift P X - O ~ ~ B A ~ ~ Arg795Trp VB1817Ilr Thr876hlu
0 Consewed
A
Acidic
0 PKC site
L HOO
Z
12
EDWARD M. BROWN et al.
ignation CaSR (Janicic et al., 1995~) has been employed, while the abbreviation CaS, for calcium sensor, has sometimes been used to describe another putative Ca:+-sensing protein with an entirely distinct structure (Lundgren et al., 1994)-see Section Vl. Full-length CaRs have subsequently been cloned from human (Garrett et al., 1995a)and chicken parathyroid (Diaz et al., 1997); rat (Riccardi et al., 19951, human (Ada et aZ., 1995b), and rabbit kidney (Butters et al., 1997); and rat C cells (Garrett et al., 1995~) and striatum of rat brain (Ruat et al., 1995). All are highly homologous 0 9 0 % identical in their amino acid sequences to BoPCaR in the case of the vertebrate CaRs) and represent species and tissue homologs of the same ancestral gene. An extensive search, however, has not yet uncovered additional CaR isoforms arising from distinct genes. IV. STRUCTURAL SIMILARITY OF THE CaR TO OTHERGPCRs The deduced amino acid sequence of the extracellular Ca2+-sensing receptor contains the canonical seven-membrane-spanning domain found in all GPCRs [see Fig. 4 (Bockaert, 1991; Jackson, 199111. According to the evolutionary tree generated from the database for GPCRs [GCRD; http://www.uthscsa.edu (Kolakowski, 199411, the CaR belongs to family C (Fig. 5). Family C GPCRs are defined as sharing 220% amino acid identity over their seven-membrane-spanning region (Kolakowski, 1994). The family contains three groups of receptors. Group I consists of the metabotropic glutamate receptors, mGluRs 1-8, which are receptors for the excitatory neurotransmitter, glutamate, that are widely expressed in the central nervous system (CNS) (Nakanishi, 1994). In contrast to the ionotropic glutamate receptors (iGluRs) [i.e., the N-methybaspartate (NMDA) receptor], which are ion channels containing an agonist binding site within the same channel molecule, the mGluRs are GPCRs. Group I1 contains two members, the CaR and a recently discovered, multigene subfamily of putative pheromone receptors, VRs or GoVNs (Matsunami and Buck, 1997;Ryba and Trindell, 1997). The latter are found exclusively in Galphao-expressing neurons of the vomeronasal organ (VNO) of the rat, a small sensory organ thought to be involved in regulating instinctual behavior via input from pheromones within the environment (Matsunami and Buck, 1997). Group I11 contains a receptor, the GABA, receptor, for the inhibitory neurotransmitter, y-aminobutyric acid (GABA) (Kaupmann et aZ., 1997).As with the glutamate receptors, there are both ionotropic (e.g.,
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR VR4 VR5 VR14 GoVN2 GOVN7 GoVN4 GOVN3 VRI vR2 VR3
13
t
Group II
t
1
Group I
[ GABA-B GABA-0 l1a b LIV-BP
3Group Ill
FIG.5. “Tree” diagram illustrating the degrees of homology and proposed evolutionary relatedness of the members of the family C GPCRs. The farther to the lefl that a given receptor branches off, the less related it is to the other receptors. For details see text.
ligand-gated receptor channels activated by GABA) and G-protein-coupled GABA receptors. The extracellular ligand-binding domains of the family C GPCRs appear to be structurally similar to those of the bacterial periplasmic binding proteins (PBPs) (Conklin and Bourne, 1994; Oh et al., 1993). Although initial support for this similarity was based on molecular modeling (O’Hara et al., 1993; Tam and Saier, 1993) using the known clawlike tertiary structure of the PBPs (Oh et al., 19931, the identified sequence homology between the ECD of the GABA, receptors and the LIV (leucine-isoleucine-valine)bacterial nutrient-binding protein (Kaupmann et al., 1997) has added strong support for an evolutionary link between members of the family C GPCRs and the bacterial periplasmic, nutrient-binding proteins. The bacterial PBPs comprise at least eight families that recognize a broad range of extracellular solutes for cellular uptake, including organic nutrients as well as inorganic ions, such as phosphate and nickel (Sharff et al., 1992; Tam and Saier, 1993). In addition, some PBPs
14
EDWARD M. BROWN et al.
function in chemoreception or sensory transduction (Sharff et al., 1992; Tam and Saier, 1993). In their capacities as cell surface receptors involved in chemoreception, sensory transduction, and transport functions, the soluble PBPs interact with integral membrane proteins in the bacterial cell membrane followingtheir binding of specific chemofactors or nutrients to transmit the signal or transport the nutrient. Thus it seems likely that the family C GPCRs, including the CaR, evolved from the fusion of an ancient family of solute-binding proteins to transmembrane proteins with the seven-membrane-spanning, “serpentine” motif that evolved separately to transmit extracellular signals to the interior of eukaryotic cells in the GPCRs.
V. ARETHEREOTHERCa:+ SENSORS? It is likely that there are Ca:+ receptors or sensors in addition to the CaR that mediate the substantial number of actions of Ca:+ on various cell types. The availability of the cloned CaR has enabled determination in several cases of which of these diverse cell types express the CaR, as described in more detail later. For example, the stimulatory effect of C a p on CT secretion and many of the actions of Ca? on the kidney are likely CaR mediated. The presence of the CaR in a cell whose function is modulated by CaE+does not prove, however, the involvement of the CaR in mediating that action of CaE+. The availability of mice with targeted disruption of the CaR gene (see Section X,C) (Ho et al., 1995) and the discovery of human diseases caused by CaR mutations (see Sections X,A, X,B, and X,D) (Chattopadhyay et al., 1996b) will ultimately be very useful in assessing this receptor’s role in Cap-induced changes in various cellular functions. Furthermore, there are many cell types whose functions are modulated by Ca? but that do not, in fact, express the CaR or have not yet been examined for its expression. In the former case, the actions of Ca:+ are presumably mediated by one or more additional CaE+receptors or sensors whose presence has been inferred on the basis of the evidence discussed later. Monoclonal antibodies directed at a large protein expressed at high levels in parathyroid, proximal tubular, and placental cells modulates the Cap-sensing functions of these cells (Juhlin et al., 1990). For example, these antibodies block the inhibition of PTH secretion from human parathyroid cells by Ca:+ (Juhlin et aZ., 1987). Furthermore, this putative CaE+-sensingprotein is expressed at markedly reduced levels in pathological parathyroid glands from patients with various forms of hyperparathyroidism (HPT) (Juhlin et al., 1988).In HPT, the abnormal
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
15
cells are often less sensitive than normal t o the suppressive actions of Ca: on PTH release (Brown, 1983;Habener, 1978;Nygren et al., 1988), providing indirect evidence that this receptor mediates or is at least closely linked to the CaE+-sensingfunction in parathyroid cells. cDNAs encoding the putative Ca:+ sensor recognized by these antibodies, which is a member of the low-density lipoprotein (LDL) receptor superfamily, have been isolated from human (Hjalm et al., 1996; Lundgren et al., 1994) and rat cDNA libraries (Saito et al., 1994). They encode a very large, -500-kDa protein, called either gp330 or megalin. The large size of this protein has so far frustrated attempts to express its full-length cDNA, but future studies should clarify its role in CaE+sensing and whether it interacts with the CaR in tissues expressing both proteins (e.g., parathyroid, proximal tubule, and placenta). A well-studied example of another CaE+-sensingcell that appears t o express a Ca:+-sensing mechanism distinct from the CaR is the osteoclast. Several groups first reported in 1989 that raising Ca:+ had direct effects on isolated osteoclasts in uitro-inhibiting bone resorption and promoting elevations in Ca:+-reminiscent of those in parathyroid cells (Malgaroli et al., 1989; Zaidi et al., 1989).Although it is not yet known whether this mechanism functions in a physiologically relevant manner in uiuo, it could represent a CaF-sensing system through which the osteoclast monitors and regulates its own resorptive activity. Subsequent studies, primarily by Zaidi and coworkers, have clarified several features of Ca:+-sensing by osteoclasts, although molecular characterization of the sensor and/or receptor has not yet been achieved. Raising Ca:+ causes marked retraction of osteoclasts, reduced expression of podosomes (which anchor the osteoclast t o the underlying bone), and inhibition of the release of hydrolytic enzymes and bone resorption in uitro (Malgaroli et al., 1989; Zaidi et al., 1991).The Ca:+-induced changes in Caf+ are likely an important mediator of the accompanying changes in cellular function, as the calcium ionophore, ionomycin, produces many of the same effects. Not all osteoclasts, however, express this Ca:+-sensing mechanism. Osteoclasts freshly isolated from medullary bone of Japanese quail, for instance, do not respond to Ca:+, but culturing these cells for 5-8 days confers upon them the ability to sense Ca:+ in a manner similar to that of chick or rat osteoclasts (Bascal et al., 1994). A variety of polyvalent cations mimic the actions of Ca;+ on the osteoclast, but their pharmacological profile in this cell type differs distinctly from that in parathyroid and other CaR-expressing cells. In general, the activation of the CaR in parathyroid cells by Ca,: Mg:+, and Ba:+ occur at several-fold lower concentrations than those modulating
16
EDWARD M. BROWN et al.
the function of osteoclasts (Brown et al., 1990; Shoback et al., 1988;Zaidi et al., 1991).The lower affinity of the osteoclast Cap-sensing mechanism may be physiologically appropriate for this cell type, since CaE+ directly measured beneath resorbing osteoclasts can be as high as 40 mM (Silveret al., 1988).Additional polyvalent cations activating the osteoclast’s Ca:+-sensing mechanism include Ni:+, C d r (which doesn’t activate the CaR) (Shankar et al., 1992b),and La:+ (which does stimulate the CaR) (Shankar et al., 1992a). The CaF-sensing receptor in the osteoclast may be related to the ryanodine receptor (Zaidi et al., 19951, since agents [e.g., ryanodine (Zaidi et al., 1992) or caffeine (Shankar et al., 1995)1that interact with the ryanodine receptor [which mediates high Cap-induced release of Ca2+from intracellular stores (e.g., in skeletal muscle)]modulate C a r sensing by osteoclasts. In addition, osteoclasts bind [3H1-ryanodine, which is displaced by CaE+as well as by the ryanodine receptor antagonist, ruthenium red (Zaidi et al., 1995).Finally, an antibody recognizing an epitope within the channel-formingdomain of the ryanodine receptor potentiates the actions of N i r and labels the plasma membrane of nonpermeabilized osteoclasts, while an antibody directed at an intracellular epitope does not (Zaidi et al., 1995). These results suggest that a ryanodine-like Ca:+ sensor is present on the plasma membrane of the osteoclast (unlike the location of the ryanodine receptor in other cells where it is located intracellularly) that acts as a C a r sensor or in close association with another Cap-sensing molecule. Cloning of this putative C a p sensor and characterization of its structure and function(s) by expression in heterologous cells would be of substantial interest. Raising Ca? has several actions on cells of the osteoblast lineage. C a r stimulates the formation of bone in bone explants (Raisz and Niemann, 1969). In addition, C a p and other polycations [e.g., strontium (Canalis et al., 199611 stimulate the proliferation (Godwin and Soltoff, 1997; Quarles et al., 1997; Sugimoto et al., 1993) and/or chemotaxis (Godwin and Soltoff, 1997) of osteoblast-like cells and increase the release of insulin-like growth factor-I1 from osteoblasts (Honda et al., 1995).High Ca:+ also modulates intracellular second messengers in the murine osteoblastic cell line, MC3T3-El. High Ca:+ elevates diacylglycerol (Hartle et al., 1994) and CAMPlevels (Hartle et al., 1996) in these cells, without, however, producing the increases in inositol phosphates that would have been expected from activation of phosphoinositide-specific PLC. Quarles and coworkers (1997) failed to detect transcripts for the CaR by reverse-transcription-based polymerase chain reaction (RT-PCR)and Northern blot analysis and suggested that a dis-
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
17
tinct Ca:+-sensing receptor mediated the actions of Ca:+ on osteoblasts. In preliminary studies, they have also reported amplifying a PCR product from osteoblasts using degenerate primers based on the CaRs sequence, which was related to but distinct from the CaR (Quarles, 1997). To date, however, they have not reported the cloning of a full-length cDNA for this presumably novel form of Cap-sensing receptor. Moreover, we found that MC3T3-El cells obtained from their original source in Japan express both CaR transcripts and protein as assessed by RTPCR, Northern blot analysis, Western blot analysis, and immunocytochemistry (Yamaguchi et al., 1998a). Clearly, additional studies of the mechanism(s) underlying CaE+-sensingby osteoblasts are warranted. VI. SIGNAL TRANSDUCTION PATHWAYS EMPLOYED BY THE CaR The CaR stably transfected into human embryonic kidney (HEK293) cells activates phospholipases C, 4,and D, whereas CaR agonists have no effects on these phospholipases in nontransfected HEK cells (Kifor et al., 1997). Moreover, CaR agonists stimulate the same three phospholipases in bovine parathyroid cells, presumably via the CaR, since high Caz+ no longer exerts these effects in cultured parathyroid cells, in which the level of CaR expression decreases dramatically after 3-4 days in culture (Kifor et al., 1997). CaR-mediated activation of PLC in parathyroid and CaR-transfected HEK cells appears to be a direct, Gprotein-mediated process, probably involving G,,,, in this and in most other mammalian cells, since this effect is not blocked by pertussis toxin. In X . laeuis oocytes expressing the CaR, however, petussis toxin markedly attenuates the high Ca:+-elicited increase in IP, (Brown et al., 1993). Therefore, the CaR apparently activates PLC in the oocyte through a pertussis-toxin-sensitiveG protein. The specificity for G-protein-couplingof various other GPCRs can also differ when expressed in X . Zaeuis oocytes from that observed in their native cells (Moriarty et al., 1989). Activation of phospholipaseA, (PLAJ and phospholipase D (PLD)by high Ca?+,in contrast, are probably indirect, utilizing CaR-mediated, PLC-dependent activation of protein kinase C (Kifor et aZ., 1997), since down-regulation or inhibition of PKC largely abrogates CaR-mediated activation of PLD and/or P&. The high CaF-evoked, transient increase in Caf' in parathyroid cells likely results from IP,-mediated release of Ca2+from intracellular stores. High cap also evokes a sustained rise in C a p in both parathyroid cells and CaR-transfected
18
EDWARD M. BROWN et al.
HEK293 cells through an unknown influx pathway(s) for Ca:+. The CaR increases the open state probability of a Ca2+-permeable,nonselective cation channel (NCC) in CaR-transfected HEK cells studied using the patch-clamp technique (Ye et al., 1996b).Activation of a similar NCC in bovine parathyroid cells by high Ca:+, presumably by a CaRmediated mechanism, may contribute to the high Ca:+-evoked, sustained increase in CaB+in this cell type (Changet al., 1995). In the CaRexpressing C-cell line rMTC44-2 (Fajtova et al., 1991), as well as in AtT-20 cells, in contrast, voltage-gated Ca2+ channels are the major source of the high Ca:+-elicited increases in Caf+ that likely mediate stimulation of CT and adrenocorticotropin (ACTH) secretion. The CaR confers high Ca:+-induced inhibition of CAMPaccumulation when expressed in HEK293 cells stably transfected with the CaR (Rogers et al., 1995b).The similar, high Ca:+-evoked inhibition of CAMP accumulation in bovine parathyroid cells is pertussis-toxin-sensitive (Chen et al., 1989), suggesting that the CaR inhibits adenylate cyclase via one or more isoforms of the inhibitory G protein, Gi. Studies using tubules isolated from the medullary thick ascending limb of the kidney, however, have suggested that high Ca:+-induced inhibition of agoniststimulated cAMP accumulation (Takaichi and Kurokawa, 1988)can occur through an indirect mechanism involving arachidonic acid (Firsov et al., 1995). That is, addition of arachidonic acid to tubule suspensions produced a pertussis-toxin-sensitive reduction in cAMP accumulation (Firsov et al., 1995). Thus additional studies are needed to determine whether the lowering of CAMP by Ca:+ in other cells expressing the CaR entails a similar mechanism or whether the CaR can directly inhibit adenylate cyclase via Gi. High Ca:+ exerts numerous additional actions on parathyroid cells, including inhibition of the expression of the PTH gene, modulation of K+channels (Conigrave et al., 1993;Kanazirska et al., 1995;Lopez-Barneo and Armstrong, 1983), stimulation of the hexose monophosphate shunt, and, perhaps, inhibition of parathyroid cellular proliferation (for review, see Brown, 1991). Additional studies are needed to determine which of these diverse actions of Ca:+ are CaR mediated and to identify the signal transduction pathways underlying them. VII. THECaR GENEAND REGULATION OF CaR EXPRESSION
The human CaR gene contains at least seven exons (Pearce et al., 1995). Six encode the receptor's large N-terminal ECD and/or its upstream untranslated regions, whereas a single exon codes for the receptors TMDs and C terminus. The regulatory regions of the gene have
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
19
not yet been characterized but will be of substantial interest, since expression of the CaR can change under several circumstancesin viuo and in uitro. Cultured calf parathyroid cells exhibit a rapid (within hours) and marked (up to 80-85%) reduction in CaR mRNA and protein (Brown et al., 1995; Mithal et al., 1995). This reduction in CaR expression probably contributes in a major way to the accompanyingdecrease in high CaF-evoked inhibition of PTH release. There is also reduced expression of the CaR in experimentally induced chronic renal insufficiency in the rat (Mathias et al., 19971, which might contribute to the associated reduction in urinary Ca2+excretion in this setting, given the inverse relationship between CaR activity and renal excretion of Ca2+ (see sections 1X.C. and X.A.) (Chattopadhyay et al., 1996b; Hebert et al., 1997). Since, as described later, 1,25-dihydroxyvitamin D can upregulate renal expression of the CaR gene (Brown et al., 19961, the decrease in CaR gene expression with impaired renal function might result, in part, from the concomitant reduction in 1,25-dihydroxyvitamin D levels that occurs with renal insufficiency (Stewart and Broadus, 1987).Alternatively, the increase in circulating PTH levels with chronic renal failure (Stewart and Broadus, 1987) might also contribute t o the reduced CaR gene expression-a possibility yet to be investigated directly. There is a substantial developmental increase in CaR expression in both rat kidney (Chattopadhyay et al., 1996a)and hippocampus (Chattopadhyay et al., 1997a).The up-regulation of the CaR in the kidney occurs in the immediate peri- and postnatal period, and the ensuing higher level of CaR expression persists through adulthood (Chattopadhyay et al., 1996a).In contrast, the increase in the expression of the CaR in brain takes place about a week postnatally and is transient, decreasing several-fold about 2 weeks later to a lower level that is stable into adulthood (Chattopadhyay et al., 1997a). The factors controlling these changes in expression of the CaR gene, including the relative importance of alterations in gene transcription vs posttranscriptional mechanisms, have not been investigated. Studies on the control of the CaRs expression by hormonal and other factors are also at an early stage. Treatment of rats with 1,25(OH),D in uiuo produces a modest rise in the level of CaR mRNA in parathyroid and kidney in one (Brownet al., 1996)but not in another study (Rogers et al., 1995c),whereas chronic reductions or elevations in serum calcium concentration had no effect on CaR mRNA levels in the parathyroid in either of these studies. In contrast, raising the level of Caz+caused an approximately 2-fold increase in CaR mRNA in AtT-20 cells (Emanuel et al., 1996).The physiological relevance of this action of Caz+ on CaR expression is not known, but it raises the possibility that the
20
EDWARD M. BROWN et al
control of the receptor’s expression in tissues involved in Ca:+ homeostasis, such as the parathyroid, might differ from that in tissues (e.g., the brain) uninvolved in mineral ion metabolism. In addition to the actions of 1,25(OH), vitamin D and Caz+on CaR expression, the cytokine IL-1p modestly up-regulates the level of CaR mRNA in bovine parathyroid gland fragments (Nielsen et al., 1997). VIII. STRUCTURE-FUNCTION RELATIONSHIPS OF THE CaR Although detailed information on the structure-function relationships of the CaR are not yet available, several preliminary studies have begun to address the structural basis for the receptor’s biological functions. Hammerland et al. (1995) examined the role of the CaR’s ECD in the binding of polycationic ligands by swapping the ECDs between the CaR and mGluR1. The chimeric receptor with the mGluRl ECD and the remainder of the receptor from the CaR (MGluR1-CaR)was activated by glutamate but not by Ca:+ or other polycationic ligands. Conversely, the chimeric receptor with the CaR’s ECD and the MGluRs TMDs, ECLs, ICLs, and C-terminal tail (CaR-mGluR)was activated by polycationic CaR ligands but not by glutamate (Hammerland et al., 1995). Of interest, in a CaR construct lacking the entire ECD (Hammerland et al., 1995), Ca;+ had no effect on the receptor, but there was still some stimulation by Gdz+.This latter observation suggests that binding determinants for Gd:+ that are sufficient for activating the CaR might reside within the receptor’s ECLs or TMDs. One possible candidate for such an additional binding site is the highly acidic ELEDE (single letter amino acid code for glutamate-leucine-glutamate-aspartate-glutamate) motif in ECL2 (Brown et al., 19931, although this has not been directly investigated by mutational analysis. In contrast, the considerably more hydrophobic “calcimimetic” CaR activators currently in trials for treatment of primary and secondary HPT (e.g., NPS R-568) interact within the CaRs TMDs (Hammerland et al., 1996). That is, R-568 potentiates the activation of the wild-type CaR by Caf+ and of the mGluR-CaR chimera by glutamate but not of the CaR-mGluR chimera by Ca;+. Activators of PKC, such as phorbol myristate acetate (PMA), substantially blunt the high Ca;+-elicited increases in inositol phosphates and CaiJ+in bovine parathyroid cells (Kifor et al., 1990; Membreno et al., 1989; Nygren et al., 1988; Racke and Nemeth, 1993). The presence of predicted PKC phosphorylation sites within the CaRs intracellular domains suggests that PKC may modulate the receptor’s function by phorphorylating one or more of these sites (Chattopadhyay and Brown, 1997).PKC could also, of course, exert additional effects on the PLC/IP,
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
21
pathway by phosphorylating G protein(s), PLC, or other elements within this signal transduction pathway. We (Bai et al., 1998) have investigated the role of these predicted PKC phosphorylation sites within the CaR's intracellular domains in preliminary studies (one each in ICLB and ICL3 and three within the C-terminal tail for the human CaR). For the human receptor, deletion of the two PKC sites within the ICLs has little or no impact on the modulation of high Ca2'-elicited increases in Cap+ by PMA in HEK cells transiently transfected with the mutant CaRs. In contrast, deletion of the PKC site at residue 888 within the CaRs C-terminal tail substantially resuces the effect of PMA. Removal of the two additional PMC sites within the tail have relatively little impact by themselves but produce a modest further reduction in the effect of PMA on high CaE+-evokedincreases in Cap'. Thus the CaRs PKC sites appear to be responsible for much of the inhibitory effect of PKC activators on CaR signaling via the PLC-IP, pathway, although the residual effect of PMA (-30% of that observed with the wildtype receptor) suggests that PKC can regulate other elements in this pathway as well. In contrast to the effect of PKC activators on the CaRs signaling, activators of CAMP-dependentprotein kinase have no apparent effect on high CaE+-elicitedelevations in the levels of inositol phosphates and C a F in bovine parathyroid cells (Brown, 1991). There have, however, been no studies t o date on the impact of PKA on the expressed, recombinant CaR. Shoback and coworkers have reported preliminary studies on the importance of various residues within the CaRs intracellular domains on its activation of downstream signaling (Chang et al., 1997). The phenylalanine at residue 707 (phe707) within ICLB appears critical for activation of PLC, presumably via Gq,ll (Hawkins et al., 1989; Varrault et al., 19951, as do several residues within ICL3. Additional studies are needed t o identify precisely the residues within ICLB that are important in this regard and whether the same or different residues are important for the CaRs coupling to other effectors [e.g., inhibition of adenylate cyclase via Gi (Chen et al., 1989; Varrault et al., 1995).
IX.THECaRs TISSUEDISTRIBUTION AND FUNCTIONS IN TISSUES INVOLVED IN MINERAL IONHOMEOSTASIS A. PARATHYROID The parathyroid glands of humans (Gogusev et al., 1997; Kifor et al., 1996), rats (Autry et al., 1997), mice (Ho et al., 1995), rabbits (Butters et al., 1997), and chickens (Diaz et al., 1997) express abundant CaR
22
EDWARD M. BROWN et al.
mRNA and protein, as assessed by Northern blot analysis and immunohistochemistry or Western blot analysis, respectively. As in a number of other cell types, substantial CaR immunoreactivity can be present within the cytoplasm of parathyroid chief cells. It is presently unclear whether this immunoreactivity represents receptor in the process of being biosynthesized or might possibly indicate that the CaR has intracellular functions. For example, the concentration of Ca2+ within the endoplasmic reticulum (ER) approaches millimolar levels (Pietrobon et al., 1990). It is not known with certainty how the level of filling of the ER is monitored and controlled. Could the CaR serve some function in this regard? As noted previously, the CaR couples to activation of PLC, P L h , and PLD and probably also to inhibition of adenylate cyclase. Studies of inherited diseases of CaE+ homeostasis due to inactivating mutations of the CaR and of mice with “knockout” of the CaR gene provide strong evidence for the central role of the CaR in the control of PTH secretion by Ca:+ (see Section X for details). The intracellular mechanism(s) through which the CaR mediates the inverse control of PTH secretion, however, remains an important unresolved issue. Products of the stimulation of PLC (i.e., IPS-producing a transient increase in Ca?+and/or diacylglycerol),PLA, (e.g., arachidonic acid and/or its products), or PLD (viz., phosphatidic acid); the high Ca:+-elicited, sustained increase in Ca?+, or decrease in cellular CAMP;and/or other mediators have all been proposed as playing key roles in high CaE+-inhibitedPTH secretion (for review, see Brown, 1991). In virtually all instances, however, conditions can be found where alterations in the relevant mediators can be dissociated from concomitant changes in hormonal secretion. In fact, even the crucial step(s) in the secretory pathway regulated by the CaR remain largely unknown (that is, beginning with the budding of secretory granules at the Golgi apparatus to their eventual exocytosis at the plasma membrane). Thus, despite rapid progress in defining the molecular elements of the exocytotic apparatus in other cell types and the cloning of the CaR, we still lack any clear understanding of how parathyroid cells respond to CaE+ in a fashion opposite to that of most other secretory cells. Another feature of parathyroid function that is likely controlled by the CaR is the expression of the PTH gene. Garrett e t al. (1995b)showed in preliminary studies that the calcimimetic CaR agonist, NPS R-568, which activates the receptor at low Ca:+ by an apparently allosteric mechanism, increasing the CaRs affinity for Ca:+, decreases the level of PTH mRNA in bovine parathyroid cells. It remains to be determined whether this CaR-mediated decrease in PTH gene expression occurs at
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
23
a transcriptional and/or posttranscriptional level. The CaR may also reduce parathyroid cellular proliferation, since humans homozygous for inactivating CaR mutations or mice homozygous for targeted disruption of the CaR gene (see Sections X,B and X,C) show marked parathyroid cellular hyperplasia (Chattopadhyay et al., 199613; Ho et al., 1995). Although the receptor may inhibit parathyroid cellular proliferation directly, indirect effects are also possible. For example, severe hypocalcemia might indirectly enhance parathyroid (PT)cellular growth by decreasing the level of 1,25(OH),D (Weisingeret al., 19891,since the latter directly inhibits parathyroid cellular proliferation (Kremeret al., 1989).
B. CCELLS Studies on the regulation of CT secretion by Ca:+ initially stressed how different it was from Ca:+-regulated PT secretion (Eskert et al., 1989; Fajtova et al., 1991; Fried and Tashjian, 1986). In contrast to the latter, CT secretion is stimulated by elevating Ca:+, similar to the more classical, positive relationship between Ca2+and exocytosis in most other hormone-secreting cells (Fajtova et al., 1991; for review, see Brown, 1991). Moreover, influx of extracellular Ca2+is the principal contributor to high Ca:+-evoked increases in Caf+in C cells (Fajtova et al., 1991; Fried and Tashjian, 1986; Muff et al., 1988). In parathyroid cells, in contrast, mobilization of intracellular Ca2+contributes in a major way in this regard, particularly immediately after raising Ca? (Nemeth and Scarpa, 1987).The patterns of high Ca:+-evoked increases in Ca:+ also differ between the two cell types. Individual C cells often show oscillations in Cap+(Eskert et al., 1989; Fajtova et al., 19911, which are either much less apparent (Miki et al., 1995)or absent in single parathyroid cells (Fajtova et al., 1991).Finally, the bulk of the high Ca:+-evoked influx of C a r into C cells takes place via voltage-sensitive Ca2+channels, whereas considerable controversy exists concerning the channels through which uptake of C a r takes place in parathyroid cells (Brown, 1991;Muff et al., 1988;Pocotte et al., 1995).Most investigators assumed, therefore, that the Caz+-sensingmechanisms in parathyroid and C cells were distinctly different, perhaps involving some form of voltage-sensitive Ca2+channel in the latter. A study utilizing Northern blot analysis, in situ hybridization, and immunohistochemistry with anti-CaR antisera, however, has convincingly demonstrated that C cells express the same CaR that is present in parathyroid and kidney cells (Garrett et al., 1995~). Furthermore, a reevaluation of the characteristics of the Ca:+-sensing mechanism in C cells has underscored several similarities in its pharmacology and oth-
24
EDWARD M.BROWN et a1
er properties to those of the CaR (Zink-Lorenzet al., 1995). Not all CaR agonists in the parathyroid cell evoke CT secretion from C cells, however. For example, while raising Mg:+ inhibits PTH secretion (albeit with 2- to 3-fold lower potency than for Cap), Mg:+ has little or no effect on CT secretion from CaR-expressing sheep parafollicular cells (McGehee et al., 1997). Tamir and coworkers (1996) have proposed detailed mechanisms for the CaR-mediated regulation of CT secretion from sheep parafollicular cells by Ca:+. Using electrophysiological techniques, measurement of Cap+and the use of various pharmacological probes, these investigators provide evidence for the following sequence of events underlying CaRstimulated CT secretion in this cell type (McGehee et al., 1997). There is an initial CaR-mediated activation of phosphatidylcholine-specific PLC that provides a source of diacylglycerol (DAG)for the PKC-induced activation of a nonselective cation channel. The latter permits entry of Na+ and Ca2+into the cells, which produces cellular depolarization, activation of voltage-gated, principally L-type Ca2+channels; and the ensuing exocytosis of 5-hydroxytryptamine (5-HT)-and CT-containing secretory vesicles. The CaR may regulate other processes in C cells as well, including a pertussis-toxin-sensitive, PKC-mediated acidification of the 5-HT-containingvesicles (in contrast, the stimulation of secretion of 5-HT and CT by high C a p are pertussis-toxin-insensitive) (Tamir et al., 1996). This vesicular acidification is thought to play an important role in the loading of secretory vesicles with 5-HT and neurotransmitters or hormones. C. KIDNEY Microdissection of short segments of rat renal tubules, isolation of RNA, and subsequent reverse-transcription-based polymerase chain reaction with CaR-specific primers has enabled determination of the distribution of CaR transcripts along the nephron. Riccardi et al. (1996) showed using this approach that CaR transcripts are present along essentially the entire nephron, including glomerulus, proximal convoluted (PCT) and proximal straight tubule (PST), medullary thick ascending limb (MTAL),cortical thick ascending limb (CTAL),distal convoluted tubule (DCT), cortical collecting duct (CCD), and inner medullary collecting duct (IMCD).Inaccessible segments that could not be assessed for CaR transcripts in this study were the thin descending and ascending limbs of Henle's loop and the connecting segment between the DCT and CCD.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
25
The available studies using immunohistochemistry with CaR-specific antisera have confirmed the localization of the CaR protein within the proximal tubule (Riccardi et al., 19981,MTAL (Riccardi et al., 1998), CTAL (Butters et al., 1997), DCT (Riccardi et al., 1998), and CCD (Riccardi et al., 1998) as well as IMCD (Butters et al., 1997; Sands et al., 1997). In proximal tubule, the CaR is localized principally, if not exclusively, at the base of the brush border on the apical membrane of the tubular epithelial cells. There is also a predominantly apical distribution of the CaR in IMCD. The receptor in CTAL is expressed at high levels on the basolateral aspect of the tubular epithelial cells. It is also expressed predominantly basolaterally in MTAL and DCT, albeit at lower levels (Riccardi et al., 1998). Within the CCD, the CaR is expressed in some, but not all, type A intercalated cells, which are involved in acid secretion and were identified on the basis of costaining with anti-H+ATPase antibodies (Riccardi et al., 1998). Knowing the location of the receptor along the nephron and the effects of CaE+ on tubular function have clarified the functional significance of renal CaRs. Additional clues in this regard are afforded by studies of the “experiments-in-nature” provided by disorders of mineral ion homeostasis caused by inactivating or activating mutations of the CaR (see Sections X,A, X,B, and X,D) (Chattopadhyay et al., 1996b). Previous studies demonstrated that raising peritubular levels of Ca? or Mg:+ reduces the tubular reabsorption of both ions in perfused TAL segments (Quamme and Dirks, 1980; Quamme, 1982). The reabsorption of Ca2+and Mg2+in CTAL takes place principally through a paracellular pathway and is driven by a lumen-positive, transepithelial potential gradient generated by the transport of sodium, potassium, and chloride ions by the apical Na+/K+/2Cl- cotransporter combined with recycling of K+ into the lumen through an apical K+channel (Fig. 6) (De RoufEgnac and Quamme, 1994;Hebert et al., 1997).PTH and other hormones increasing CAMPaccumulation (e.g., glucagon, p-adrenergic catecholamines, and calcitonin) enhance Ca2+ and Mg2+reabsorption by stimulating the overall activity of the cotransporter and, in turn, the magnitude of the lumen positive potential (De Rouffignac and Quamme, 1994; Hebert et al., 1997). Studies using the patch clamp technique have shown that high Ca:+ and neomycin (another CaR agonist) inhibit the apical K+ channel through a mechanism involving a P-450 metabolite(s) of arachidonic acid, probably 20-HETE (Fig. 6) (Wang et al., 1996).In the absence of apical recycling, luminal K+ is depleted, the activity of the cotransporter decreases and paracellular transport of Ca2+and Mg2+diminish. The reduced capacity of patients
26
EDWARD M. BROWN et al
lumen-positive voltage
FIG.6. Diagram showing schematically how the CaR may regulate intracellular second messengers and ionic transport in the renal TAL.Hormones stimulating CAMPaccumulation, such as PTH, activate the paracellular reabsorption of Ca2+and Mg2+by stimulating the activity of the Na+LK+/2Cl- cotransporter as well as an apical K+ channel and, in turn, the lumen-positive, transepithelial potential. The CaR, similarly located on the basolatera1 membrane, stimulates arachidonic acid (AA)production through direct or indirect activation of PLA, (21, which is metabolized via the P-450 pathway to an active metabolite inhibiting the apical K+ channel (4)and, perhaps, the cotransporter (3).Both actions reduce overall cotransporter activity, thereby reducing the lumen-positive potential and paracellular transport of divalent cations. The CaR probably also inhibits adenylate cyclase (1) and reduces hormone-stimulated divalent cation transport as a result. (Reproduced from Bone, 20, Brown, E. M., and Hebert, S. C., Calcium-receptor regulated parathyroid and renal function, 303-309. Copyright 1997 with permission from Elsevier Science.)
with inactivating CaR mutations to excrete Ca2+ in the urine in response to their hypercalcemia, provides indirect support for the role of the CaR in regulating renal tubular Ca2+ reabsorption (see Section X,A). In contrast, patients with activating CaR mutations show excessively high levels of urinary Ca2+ at any given level of CaE+, presumably as a result of “activated CaRs along the nephron, particularly in CTAL (see Section X,D) (Chattopadhyay et al., 1996b). Hypercalcemic patients can have abnormally reduced urinary concentrating ability and, sometimes, overt nephrogenic diabetes insipidus
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
27
(Gill and Bartter, 1961; Stewart and Broadus, 1987; Suki et al., 1969). The identification of the CaR in nephron segments involved in urinary concentration has provided new insights into how high Ca:+ regulates this parameter of renal function. Perfusion of the lumen of isolated rat IMCD tubules with high Ca:+ or neomycin, likely through activation of CaRs located on the apical membrane, reversibly diminishes vasopressin-elicited, transepithelial water flow by about 40% (Sands et al., 1997). The presence of the CaR within the same apical endosomes containing the vasopressin-regulated water channel, aquaporin-2, suggests that the CaR inhibits vasopressin-stimulated water flow in the IMCD by either enhancing the endocytosis or reducing the exocytosis of these endosomes out of or into the apical plasma membrane, respectively (Sands et al., 1997). Moreover, by producing CaR-mediated inhibition of NaCl reabsorption in MTAL (Hebert et al., 1997; Wang et al., 1996), high C a p would also reduce the magnitude of the medullary countercurrent gradient, thereby producing a further diminution in maximal urinary concentrating capacity in hypercalcemic patients (Fig. 7A). Of interest, as described in greater detail in Section X,A, patients with inactivating CaR mutations concentrate their urine normally despite being hypercalcemic (Marx et al., 1981b).Moreover, those with activating mutations can develop defective urinary concentrating capacity at normal or even low levels of serum calcium, presumably as a result of being overly sensitive to the usual effects of elevated Ca:+ on the urinary concentrating mechanism (Pearce et al., 1996b). Are there physiological implications of the abnormal, apparently CaR-mediated renal handling of water in hypercalcemic patients? We have previously suggested that this provides a mechanism for integrating renal handling of divalent cations, particularly calcium and water, thereby enabling appropriate “trade-offs”in the regulation of these aspects of renal function under particular physiological circumstances (Hebert et al., 1997). For instance, consider a situation where a systemic calcium load requires disposal. CaR-mediated integration of increased urinary Ca2+concentration as a result of reduced reabsorption of Ca2+ in CTAL, and perhaps DCT, with concomitant inhibition of maximal urinary concentrating ability might limit the resultant increase in luminal levels of Ca2+in IMCD that might otherwise predispose to forming Ca2+-containingrenal stones. The presence of abundant CaRs in the subfornical organ (SFO) (Rogers et al., 1997), an important hypothalamic thirst center (Simpson and Routenberg, 19751, may provide an additional layer of integration of calcium and water metabolism. Ca:+-evoked, CaR-mediated thirst and attendant drinking behavior could prevent dehydration that might otherwise ensue if there
A 4Caz+-receptor activation
.C Lumen positive voltage
4Ca2'and Mgz+ reabsorption
B
concentrating ability
(
Decreased CaZ+ Reabsorption, Increased
Decreased Urinary
Ca2* Excretion
FIG.7. Hypothetical mechanisms interrelating systemic calcium and water homeostasis in humans. See text for details. (A) The postulated renal mechanisms through which the CaR inhibits maximal urinary concentrating capacity, (Reproduced with permission from Brown, E. M., and Hebert, S. C. (1997).Novel insights into the physiology and pathophysiology of Ca2+-sensingreceptor. Reg. Peptide Lett. VII, 43-47.) (B)Activation of CaRs in the subfornical organ (SFO)may also increase intake of water, thereby mitigating loss of free water as a result of diminished urinary concentration. High CaF-induced reduction in gastrointestinal (GI) motility might also maximize intestinal, particularly colonic, absorption of water. (Reproduced from Brown et al., 1996, with permission.)
1
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
29
was a fixed renal loss of free water as a result of resistance of the kidney to vasopressin (Fig. 7B). Finally, in addition to high Ca:+-evoked thirst, previous studies have demonstrated a specific “calcium appetite” (Tordoff, 1994) that could appropriately modulate intake of calciumcontaining food during hypo- and hypercalcemia. We suggest on the basis of these data, therefore, that there could are multiple layers of integration and coordination in the regulation of various homeostatic mechanisms (i.e., those controlling systemic water and mineral ion metabolism), which are designed to optimize the adaptation of terrestrial organisms to their only intermittent access to dietary calcium and water.
D. BONE Studies have provided strong evidence that the CaR is expressed in a variety of cells within the bone and bone marrow (for additional details, see Section XI,C,3), including those that might represent bone cells or their precursors (House et al., 1997). For example, monocyte-macrophage-like cells express the CaR and could potentially serve as osteoclast precursors, since cells of the monocyte-macrophage lineage are known to form mature multinucleated osteoclasts through a process of differentiation and fusion (Stewart and Broadus, 1987). Indeed, one study found that high concentrations of ca:+ promote the fusion of alveolar macrophages to form multinucleated giant cells, but the mechanism underlying this action has not been further elucidated (Jin et al., 1990).In addition, alkaline-phosphatase-expressing cells derived from marrow, potentially representing preosteoblasts, also express the CaR. As already noted, however, there is substantial evidence for the expression of Ca:+-sensing receptors other than the CaR in bone cells, and additional studies are needed to assess the relative importance of these various Ca:+-sensing mechanisms, including the CaR, in the physiological regulation of bone cell function and bone turnover by Ca:+ (Quarles, 1997).
E. INTESTINE We (Chattopadhyay et al., 1998a)and others (Gama et al., 1997)have shown that several types of cells within the small and large intestines express the CaR, which might, therefore, directly or indirectly contribute to mineral ion homeostasis through its actions on intestinal function. The CaR is expressed by both normal (Chattopadhyay et al., 1998a)and malignant epithelial cells (Gama et al., 1997; Kallay et al.,
30
EDWARD M. BROWN et al.
1997) derived from the small intestinal villus and crypt as well as from the large intestinal crypt. Moreover, Ca:+ exerts several direct actions on intestinal epithelial cells that could potentially be mediated by the CaR. For example, raising Ca:+, in conjunction with addition of 1,25dihydroxyvitamin D to duodenal explants, increases the level of the mRNA for the calcium-binding protein, calbindin D9K (Brehior et al., 19891, which may be involved in duodenal Ca2+absorption. Ca:+ also promotes the differentiation of intestinal goblet cells (Black and Smith, 1989) and inhibits the proliferation of human Caco-2 colon cancer cells in association with a reduction in their expression of the c-myc protooncogene (Kallay et al., 1997). Since Caco-2 cells express the CaR, the latter might mediate this regulation of c-myc expression by Ca:+ (Kallay et al., 1997). Finally, application of low levels of Ca:+ to the apical but not the basolateral side of Caco-2 cells up-regulates c-myc expression (Kallay et al., 1997).The lower third of the lumen of the colonic crypts has been suggested to contain reduced levels of Ca:+ (Whitfield, 1995). Therefore, Ca:+-sensing by the CaR might represent a key cellular “switch” that inhibits the proliferation and promotes the differentiation of intestinal epithelial stem cells at the crypt bases as they migrate up the crypts (Kallay et al., 1997; Whitfield, 1995). The presence of a similar, CaR-mediated mechanism within both small and large intestine might, therefore, indirectly contribute to mineral ion homeostasis by regulating the proper sequence of intestinal epithelial cell differentiation that is crucial for maintaining the normal absorptive and secretory functions of the intestine.
F. PLACENTA During pregnancy, the placenta plays an important role in fetal mineral ion metabolism owing t o the fact that all fetal Ca2+must be transported from the maternal circulation via the placenta. Much of the fetal skeleton forms during the third trimester, and about 30 g of calcium have been deposited in the newborn’s skeleton at the time of birth (Rodda et al., 1992). Ca:+-sensing cells are present in the placenta that may play some role in the regulation of Ca2+transport between mother and fetus, possibly by regulating PTHrP production by placental cells (Hellman et al., 1992); the fetal parathyroid gland also secretes PTHrP in utero, however, which might also contribute in this regard (Rodda et al., 1992).As with parathyroid chief cells, high levels of Ca:+ raise the level of Ca? in human placental cytotrophoblasts (Bradbury et al., 1996; Juhlin et a,!., 1990), suggesting similarities in the mechanism(s) underlying Ca:+-sensing in the two cell types.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSING RECEPTOR
31
Juhlin and coworkers have shown that gp330, the large putative Ca:+-sensing protein, is expressed in cytotrophoblastic cells of the placenta (Hjalm et al., 1996; Juhlin et al., 1990; Lundgren et czl., 1994). Bradbury et al. (1998) have shown expression of transcripts for the Gprotein-coupled CaR in cytotrophoblast cells from human term placenta. In addition to transcripts similar to those in other CaR-expressing cells, which encode the full receptor protein, an additional transcript is expressed in both cytotrophoblasts and in human parathyroid that is alternatively spliced (Bradbury et al., 1998). This RNA species lacks exon 3 and encodes a truncated and presumably inactive receptor protein, because it introduces a frame shift that produces a premature stop codon within the CaR’s ECD. It is possible, therefore, that one or both of these CaE+-sensingproteins mediates the previously described actions of Ca? on Ca:+ and PTHrP release in this cell type. Additional studies are needed to determine their relative importance. Indeed the significance of their coexpression in placenta, proximal tubule and parathyroid remains uncertain. Could they interact in ways that regulate the sensitivity of the cell to Caz+ or contribute in some manner to determining the downstream signaling pathways to which these Ca:+ sensors couple in these and other cells?
X. HUMAN DISEASESRESULTING FROM CaR MUTATIONS CLARIFY THE RECEPTOR’S PHYSIOLOGICAL ROLES
A. FAMILIAL HYPOCALCIURIC HYPERCALCEMIA The availability of the cDNA clone for the human CaR made it possible to search its gene for mutations in several inherited and sporadic disorders of mineral ion homeostasis. The generally benign hypercalcemic syndrome, familial hypocalciuric hypercalcemia [FHH; sometimes termed either familial benign hypercalcemia (FBH) (Foley et al., 1972) or familial benign hypocalciuric hypercalcemia (FBHH) (Bai et czl., 1997a)1,is an autosomal dominant disorder with nearly 100%penetrance that exhibits characteristic clinical features suggesting generalized Caz+ resistance (Heath, 1994; Law and Heath, 1985; Marx et al., 1981a).Affected members of families with this syndrome generally lack the usual symptoms and signs of hypercalcemia, such as altered mental status, weakness, difficulty concentrating the urine, and a variety of gastrointestinal symptoms (e.g., constipation, nausea, and anorexia) (Stewart and Broadus, 1987). In addition, studies utilizing induced hyper- and hypocalcemia have demonstrated an increase in the set point
32
EDWARD M.BROWN et al.
for CaE+-regulatedPTH secretion in FHH (e.g., there is resistance of the parathyroid to C a p ) (Auwerx et al., 1984; Khosla et al., 1993). Furthermore, individuals with FHH have markedly lower urinary Ca2+excretion than expected for their degree of hypercalcemia. This abnormality in renal Ca2+ handling persists even after parathyroidectomy, indicating that it is not simply the result of blunted suppression of PTH secretion at elevated Ca? but rather represents an intrinsic renal tubular defect (Attie et al., 1983; Davies et al., 1984). Moreover, of the maneuvers normally elevating urinary Ca2+ excretion by direct renal actions, only the loop diuretic ethacrynic acid, which inhibits the Na+/K+/2C1- cotransporter, increases urinary Ca2+ excretion in hypoparathyroid patients with FHH (Attie et al., 19831, suggesting abnormally avid tubular reabsorption of Ca2+in the TAL. Finally, patients with FHH concentrate their urine normally despite being hypercalcemic, unlike comparably hypercalcemic patients with primary HPT, who have reduced maximal urinary concentrating capacity (Marx et al., 1981b). Thus patients with FHH exhibit apparent resistance to several of the expected actions of elevated CaE+on renal function, namely hypercalciuria and defective urinary concentrating ability. The FHH gene was initially mapped to the long arm of chromosome 3 (band q21-24)in four large families (Chou et al., 1992). Linkage analysis also afforded formal proof that individuals with FHH are heterozygous for the disease gene. Ninety percent or more of FHH families large enough for genetic analysis have their disease gene linked to the chromosome 3q locus (Heath et al., 1993; Trump et al., 1995).A single family, in contrast, has a disorder with a similar phenotype linked to the short arm of chromosome 19 (band 19~13.3) (Heath et al., 1993), and in another family with atypical FHH (i.e., osteomalacia in some affected members and a progressive rise in PTH in older members of the family) the syndrome was linked to neither chromosome 3 nor chromosome 19 (Trump et al., 1995). Pollak et al. (1993) demonstrated that the CaR gene is present on the long arm of chromosome 3 near the FHH locus and identified unique missense mutations (e.g., changes in a single nucleotide substituting a new amino acid for the one normally coded for) in each of three FHH families with genetic linkage to chromosome 3. Subsequently, -40 additional CaR mutations have been identified in FHH (Fig. 4) (Aida et al., 1995a; Chou et al., 1995; Heath et al., 1996; Janicic et al., 1995b; Kobayashi et al., 1997; Pearce et al., 1995). Each family generally has its own unique mutation, although a few unrelated families share the same mutation [e.g., Arg185Gln (Bai et al., 1997a; Pollak et al., 1993)l. Most are missense mutations that cluster within (a)the first half of the
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
33
ECD; (b) the ECD immediately before TMD1; or ( c ) the CaRs TMDs, ICLs, or ECLs. In addition to point mutations, several other types of mutations have recently been described in FHH. One family harbors a nonsense mutation just before TMDl (e.g., ser607stop),producing a truncated and presumably biologically inactive ECD that might even be secreted, since it lacks membrane-anchoring TMDs (Pearce et al., 1995).Another mutation produces a single nucleotide deletion with an adjacent transversion (e.g., a change from one nucleotide to another) within codon 747, thereby altering the downstream reading frame and resulting in premature termination after codon 776 within TMD4 (Pearce et al., 1995). Finally, a Nova Scotian family has insertion of a 383-bp Alu repetitive sequence at codon 876 within the CaRs C-terminal tail (Janicic et al., 1995b).This Alu element contains stop signals within all three reading frames, thereby predicting a truncated CaR protein with a long stretch of phenylalanines within its C-terminal tail that are encoded by the element’s long poly(A/T) tract. Interestingly, the Alu element has approximately doubled in size in a subsequent generation of this family (Janicic et al., 1995a). Only about two-thirds of FHH families linked to the chromosome 3 locus have identifiable mutations in the CaR’s coding sequence (Aida et al., 1995a; Chou et al., 1995; Heath et al., 1996; Janicic et al., 1995b; Kobayashi et al., 1997; Pearce et al., 1995). Introns or upstream or downstream regulatory domains of the CaR presumably harbor mutations in the remaining families, but this remains to be documented. Such mutations might interfere with the gene’s normal expression, thereby reducing the number of normal receptors on the surface of parathyroid and renal cells. Several apparently benign polymorphisms reside within the CaR’s C-terminal tail (Heath et al., 1996). These amino acid variations are not associated with overt hypo- or hypercalcemia and are present within a substantial proportion of the population (- 10-30%). Recent preliminary data suggest subtle differences in serum calcium concentration, all encompassed within the normal range, between individuals expressing certain of the polymorphic forms of the CaR, suggesting a functional impact of these amino acid variations (Coleet al., 1997).It is possible, therefore, that future studies may reveal that these modest functional alterations predispose to disorders of CaE+-sensing(i.e., primary hyperparathyroidism). Investigations using mammalian expression systems have characterized the impact of FHH mutations on the CaRs function (Bai et al., l996,1997a,b; Pearce et al., 1996a). Figure 8A shows the effects of several point mutations introduced into the wild-type human CaR on high
34
EDWARD M. BROWN et al.
-
wild type
+ R62M e R66C +T138M
-b- Rl85Q L Rl95W
n
B
10
20
50
40
30
1.0-
0.8-
8C
c
F2 E
0.6-
0.4-
b
Z
0.2
-
-
+ WT
ECsoI 3.7 mM (+/ 0.05)
--C-- F128L
ECso=2.2m M (+/-0.05)’ EC, = 2.7 mM (+/ 0.04)’ EC, = 2.8 mM (+/ 0.06).
+ T151M
-
E191K
p
0.00
.
,
1
2
.
.
.
I
.
.
3
.
1
4
-1 10
Ca2+ (mM)
FIG.8. (A) Expression of CaRs bearing inactivating mutations in HEK 293 cells. Results show the effects of varying levels of CaI+ on the cytosolic calcium concentration in HEK293 cells transiently transfected with the wild-type CaR or mutant CaRs bearing the indicated mutation. (Reproduced from Bai et al., 1996, with permission from The American Society for Biochemistry and Molecular Biology.) (B) Expression of mutant CaRs bearing activating mutations in HEK293 cells. Results show the effects of varying levels of Ca? on Ca:+ in HEK293 cells transiently transfected with the wild-type CaR or mutant CaRs harboring the indicated activating mutations. (Reproduced from The Journal of Clinical Investigation, 1996,98,1860-1866, by copyright permission of The American Society for Clinical Investigation.)
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
35
Ca?+-evoked elevations in Ca:+ in transiently transfected HEK293 cells. Some of these mutations, namely, argl85gln and arg795trp, markedly reduce the CaR’s apparent affinity and/or maximal biological activity. Others (e.g., thrl38met or arg62met) diminish apparent affinity only modestly, without changing maximal response (Bai et al., 1996). Some, but not all mutant CaRs with the most dramatically reduced biological activities show decreased cell surface expression of the mature, fully glycosylated receptor. Interestingly, the degree of elevation of Ca:+ in FHH families with the functionally most abnormal mutant receptors can be very mild. For example, affected family members with the nonsense mutation at codon 607 have serum calcium levels at or only slightly above the upper limit of normal (Pearce et al., 1995). Moreover, as described in more detail later (Section X,C), mice with targeted disruption of one CaR allele likewise have very mild hypercalcemia (Ho et al., 1995). These mice have about 50% reductions in CaR expression in parathyroid and kidney, suggesting that there is no upregulation of the normal CaR allele despite the reduction in total cell surface expression of the CaR. Therefore, the pathophysiology of the Ca:+ “resistance” in most cases of FHH as well as in the heterozygous mice appears to be a reduction in the complement of normal CaRs on the cell surface that produces a mild (10-15%) increase in set point for Caz+.Furthermore, although no mutations have been demonstrated in the CaR in primary HPT, in which the abnormal parathyroid gland(s) also exhibits an increase in set point, these pathological glands likewise show substantial (-60%) reductions in CaR immunoreactivity (Gogusev et al., 1997; Kifor et al., 1996). Therefore, a decrease in cell surface density of otherwise normal CaRs probably contributes importantly to the pathophysiology of the latter condition as well. Mutations profoundly impairing the CaRs biological activity in spite of an apparently normal level of receptor protein expression on Western blot analysis, in contrast, can produce more severe hypercalcemia (Bai et al., 1996). For instance, affected family members with the arg795trp or arg185gln mutations have serum calcium concentrations approximately 2 and 3 mg/dl higher, respectively, than unaffected family members (most FHH families have 0.5-1.5 mg/dl elevations in Caz’) (Bai et al., 1996). Indeed, although coexpression of most FHH mutations with the wild-type CaR (e.g., mimicking the heterozygous state of FHH) has no apparent effect on the normal receptor’s function, both arg795trp and arg185gln shift the EC,, (effectiveagonist concentration eliciting half of the maximal response) of the wild-type CaR rightward (Bai et al., 1996). These two mutant CaRs probably interfere with the normal receptor’s function in some fashion, perhaps because (a)the nor-
36
EDWARD M. BROWN et a1
ma1 receptor reaches the cell surface in reduced quantities, (b) there is a decreased concentration of G protein(s) available to the normal CaR as a result of formation of an inactive complex of the mutant receptor with this G protein(s1, and/or (c) the normal and mutant CaRs form a heterodimeric receptor complex with reduced biological activity. Presently available data do not permit differentiation among these possibilities. Transient transfection has also been performed with cDNAs encoding the mutant CaRs with the deletion and transversion in codon 747 (Pearce et al., 1996a) or the inserted Alu element at codon 876 (Bai et al., 1997b). Both mutant CaRs showed essentially no biological activity when expressed in HEK293 cells. Truncated proteins were produced in vitro that were of the sizes expected based on the presence of premature stop codons. Based on the functional properties of these various FHH mutations, the following tentative conclusions can be drawn about structure-function relationships for the CaR from these “experiments-in-nature” and its role in mineral ion and water metabolism. First, some missense mutations in the ECD alter the receptor’s apparent affinity for CaE+ without modifying its level of expression (at least as determined from Western blot analysis, which does not distinguish intracellular forms of the receptor from those on the cell surface). These mutated amino acids may directly or indirectly modify the affinity of the CaR for CaE+.Elucidating the ECD’s three-dimensional structure will, however, be necessary to determine precisely how the CaR interacts with its polycationic ligands. Second, additional mutations likely interfere with the ability of the receptor to activate G proteids) (i.e., arg795trp) or perhaps other processes required for signal transduction (e.g., conformational changes in the receptor’s ECD, TMDs, and/or ICLs). Third, the elevated parathyroid set point for Ca? results from reduced cell surface expression of normally functioning CaRs, in some cases exacerbated by a “dominant negative” interaction between wild-type and mutant receptors of undefined mechanism(s). Fourth, similarly, the excessively avid renal tubular reabsorption of Ca2+ and Mg2+ by the TAL in FHH likely reflects renal tubular “resistance”to the calciuric action of elevated Ca:+ and illustrates the CaR’s key role in regulating renal tubular Ca2+reabsorption (e.g., Fig. 6). Fifth, the persistence of this tubular defect after parathyroidectomy makes another important point about renal Ca2+handling in the TAL. Since multiple hormones stimulate the Na+K+/2Cl- cotransporter in a CAMP-dependent manner (De Rouffignac and Quamme, 19941, the high CaE+-induced reduction in PTH secretion may be insufficient by itself to inhibit renal tubular reabsorption of Ca2+in the TAL. Thus, CaR-mediated inhibition of the
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
37
action of all of these hormones directly at the level of the CTAL is probably crucial for the hypercalciuria normally seen with hypercalcemia, independent of circulating PTH levels. Finally, the normal urinary concentrating ability in FHH provides further indirect evidence that the CaR mediates the inhibition of urinary concentrating ability encountered in hypercalcemic individuals.
B. NEONATAL SEVERE HYPERPARATHYROIDISM Neonatal severe hyperparathyroidism (NSHPT) is a severe form of symptomatic hypercalcemia encountered in infants during the first year of life, most commonly in the immediate postnatal period, which is accompanied by hyperparathyroid bone disease (Heath, 1994). NSHPT was described well before FHH (Pratt et al., 19471, and its relationship to the latter was not initially recognized (Chattopadhyay et al., 1996b; Marx et al., 1982). Despite the severe hypercalcemia, relative hypocalciuria can be present in NSHPT, as can hypermagnesemia (Aida et al., 1995a). Unlike FHH, serum levels of PTH are generally frankly high in NSHPT, usually being elevated 5- to 10-fold. Parathyroidectomy can be life-saving in very severe cases of NSHPT. At parathyroidectomy, the parathyroid glands are usually found to be substantially enlarged. Over the past 10-15 years, however, it has been recognized that there is a broader spectrum of clinical seventy in NSHPT. In some cases, the disorder runs a self-limited course with conservative medical therapy, reverting to mild hypercalcemia that resembles that present in FHH during the first year of life (Heath, 1994). Early descriptions showed that NSHPT and FHH could coexist in the same kindred. In 15 families with FHH, three infants in two separate kindreds had NSHPT (Marx et al., 19821, suggesting that some cases of the latter could represent the homozygous form of FHH. Pollak et al. (1994b) demonstrated in 11families in which the FHH gene mapped t o chromosome 3q that consanguineous unions of affected individuals in 4 of these families produced children with NSHPT. The inheritance of genetic markers closely linked to the FHH gene provided strong evidence that NSHPT represents the homozygous form of the same disease in these families. Subsequent studies have confirmed that the inheritance of two abnormal copies of the CaR gene can produce NSHPT (Aida et al., 1995a; Chou et al., 1995; Janicic et al., 1995b; Kobayashi et al., 1997). Since they lack any normal copies of the CaR gene, these infants exhibit much more severe biochemical and clinical manifestations than in FHH, owing to severe resistance of CaR-expressing tissues, especially the parathyroid glands, to Caz+.In one described case, the parents of an infant with NSHPT each had different CaR mutations, pro-
38
EDWARD M. BROWN et al.
ducing a severely affected neonate who was a compound heterozygote (Kobayashi et al., 1997). Not all cases of NSHPT, however, represent homozygous or compound heterozygous FHH. In fact, most cases occur sporadically or in FHH families with only one affected parent (Chattopadhyay et al., 1996b; Heath, 1994).What are the possible explanations for these cases? Amutation might be present in one CaR allele as well as in another gene on a different chromosome that can cause an FHH-like clinical picture [i.e., the one on chromosome 19p (Heath et al., 1993)or the locus on neither chromosome 3 nor 19 (Trump et al., 199511. No documentation of this form of compound heterozygote, involving the CaR and some other gene presumably involved in Cap-sensing, has been provided to date. Another possible explanation in a child with NSHPT and a single abnormal CaR allele arising from an FHH father and a normal mother is the impact of normal maternal CaE+ homeostasis on the affected fetus’s parathyroid glands in utero (Bai et al., 1997a; Chattopadhyay et al., 199613).The placenta actively transports calcium from mother to fetus via the placental calcium pump (Rodda et al., 19921, generating a level of CaE+ in cord blood about 10%higher than that in the maternal circulation. Therefore, the normal mother exposes her fetus’s parathyroid glands, which have abnormal CaE+-sensingdue to the presence of a heterozygous FHH mutation to a level of Ca:+ that would “overstimulate” these parathyroids since the normal level of C a p is recognized as “hypocalcemic.” Therefore, an additional degree of “secondary” fetal-neonatal hyperparathyroidism ensues on top of the abnormal CaE+sensing already present as a result of the heterozygous CaR mutation. This hypothetical sequence of events is supported by the existence of cases of NSHPT with an autosomal dominant pattern of inheritance in a setting where the father had FHH and the mother appeared to have normal mineral ion homeostasis (Chattopadhyay et al., 1996b; Heath, 1994). Postnatally, the “secondary” HPT eventually subsides, leaving the infant with the clinical and biochemical features of FHH. In many described cases, however, children with FHH born to a normal mother do not have hypercalcemia that is more severe than that in infants born to an affected mother. In addition, there are no clear differences between mice heterozygous for CaR gene “knockout”that are born of normal mothers compared to those born of mothers heterozygous for disruption of the CaR gene (Ho et al., 1995). Much remains to be learned, therefore, about the factors determining clinical severity of neonates with inherited heterozygous CaR mutations. NSHPT can also result from de nouo heterozygous CaR mutations (Bai et al., 1997a; Pearce et al., 1995) 6 e . , a single de nouo CaR mutation in the offspring of normal parents). Two such infants presented
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
39
with hyperparathyroid bone disease but with hypercalcemia that was less severe than that seen in NSHPT due to homozygous CaR mutations (Pearce et al., 1995). We documented another case of de nouo heterozygous NSHPT in an infant harboring the same arg185gln mutation described previously that produced a greater elevation of Ca:+ than in most FHH kindreds (Bai et al., 1997a). In this latter case, the relatively large discrepancy between the set points of the mother’s and infant’s parathyroid glands may have produced more severe hyperparathyroidism in the prenatal state, leading to hyperparathyroid bone disease in the infant at the time of birth. The parathyroid hyperplasia in NSHPT suggests that, in addition to its involvement in Ca2’-regulated PTH secretion, the CaR likely functions directly or indirectly to inhibit parathyroid cellular proliferation (Chattopadhyay et al., 1996b; Heath, 1994). In the parathyroid, the CaR acts, in effect, as a tumor suppresser gene. Interestingly, preliminary studies have shown that a CaR harboring an activating mutation stimulates cellular proliferation and acts as an oncogene in a transformation assay utilizing NIH 3T3 fibroblasts (Hoff et al., 1997).Therefore, depending on the cellular context in which it is expressed, the receptor can either stimulate or inhibit various aspects of cellular function, such as hormonal secretion, gene expression, and/or cellular proliferation. OF FHH AND NSHPT C. MOUSEMODELS
Ho and coworkers (1995) employed targeted disruption of the CaR gene to generate mice heterozygous or homozygous for “knockout”of the CaR gene. These mice exhibit clinical and biochemical findings, suggesting that they represent animal models of FHH and NSHPT, respectively. The homozygous mice show essentially complete absence of CaR protein in parathyroid and kidney, whereas there are -50% reductions in receptor protein in the heterozygous mice. The latter are phenotypically unremarkable, fertile, and have a normal life span. Their serum calcium levels average 10.4 mg/dl, -10% higher than in normal littermates. The heterozygotes likewise have mild (- 10-15%) but significant increases in serum magnesium concentration. Serum PTH levels are -50% higher in heterozygous than in normal mice, and urinary calcium excretion is slightly lower than in normal mice. Skeletal X rays are normal. Thus mice heterozygous for knockout of the CaK. gene exhibit many of the phenotypic and biochemical features present in FHH. Mice homozygous for CaR gene inactivation, in contrast, although of nearly normal size at birth, grow much more slowly than their normal or heterozygous littermates during the first few postnatal weeks-if
40
EDWARD M. BROWN et al.
they survive that long (Ho et al., 1995). Most homozygotes die within the first 2 weeks postnatally, with only occasional ones surviving for 3 or 4 weeks. The homozygotes are also severely hypercalcemic, averaging 14.8 mg/dl. Their serum magnesium concentrations are slightly higher than in heterozygotes. Similar to the elevated Mg:+ levels in FHH and NSHPT, this elevation in M g y provides indirect evidence that the CaR contributes to “setting” Mgy (Strewler, 1994). Serum PTH levels are -10-fold higher than in normal mice, an increase comparable t o that seen in NSHPT. In spite of their severe hypercalcemia, urinary calcium concentration is lower than in normal mice. The homozygous mice, like infants with NSHPT, show substantial parathyroid hyperplasia, providing additional evidence that the CaR suppresses parathyroid proliferation. Skeletal X rays show reductions in density, kyphoscoliosis, and bowing of long bones. Thus mice homozygous for CaR gene knockout exhibit several similarities to NSHPT. Much work remains, however, in utilizing this animal model to study further Caz+sensing in tissues normally expressing the CaR, including those seemingly uninvolved in Ca2+metabolism (e.g., the brain).
D. HUMAN FORMS OF HYPOCALCEMIA DUETO ACTIVATING CaR MUTATIONS The existence of inherited forms of hypercalcemia due to inactivating CaR mutations suggested that familial hypocalcemia(s) might result from activating CaR mutations. Indeed, several kindreds with autosomal dominant hypocalcemia have clinical findings suggesting the presence of activating CaR mutations that “reset” downward the set points of both parathyroid and kidney for Ca? (Baron et al., 1996; Chattopadhyay et al., 1996b;Lovlie et al., 1996; Pearce et al., 1996b;Perry et al., 1994;Pollak et al., 1994a).Some individuals with this condition are asymptomatic, but a substantial number exhibit the signs and symptoms present in other hypocalcemic patients, including seizures, paresthesias, muscle cramps, and laryngospasm. Affected individuals exhibit mild to moderate reductions in Cay, sometimes accompanied by hypomagnesemia and inappropriately elevated urinary Ca2+ excretion given their hypocalcemia (e.g.,“relative”hypercalciuria). PTH levels are low normal and fail to show the expected rise with hypocalcemia, indicating inappropriate Caz+-sensingby the parathyroid glands. Because of their tendency toward hypercalciuria, patients with activating mutations are susceptible to marked hypercalciuria and renal complications of overtreatment with vitamin D, even without overt hypercalcemia (Pearce et al., 199613). These complications include nephrocalcinosis, renal stones, reversible (occasionally irreversible) reductions in renal function, and polydipsia
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
41
and polyuria. As a result, these patients should be treated with caution, aiming to raise serum calcium only to the point where seizures or other serious hypocalcemic complications cease. This syndrome was shown to be linked to the CaR locus on chromosome 3 by Finegold et al. (1994). Pollak et al. (1994b) then reported a CaR mutation at residue 127 in a family with autosomal dominant hypocalcemia that increased the CaRs activity at low Ca?. Subsequently, nearly 10 missense mutations have been identified in families with autosomal dominant hypocalcemia (Baron et al., 1996; Chattopadhyay et al., 199613; Lovlie et al., 1996; Pearce et al., 1996b; Perry et al., 1994; Pollak et al., 1994a)and in a few cases of sporadic hypocalcemia (Baron et al., 1996; De Luca et al., 1997; Mancilla et al., 1997) (Fig. 4). Most reside within the CaR’s ECD, although three are present within the regions encompassed by the receptor’s TMDs. The predominance of activating mutations in the CaR’s ECD provides further support for the extracellular domain’s role in activation of the receptor by Ca:+. Expression of several of the known activating mutations in HEK293 cells has shown a clear left-shift in the CaRs activation by Ca?(Bai et al., 1996; Pearce et al., 1996b)(Fig. 8B) and, in some cases, an increase in the maximal activity, particularly when changes in inositol phosphates were assessed (De Luca et al., 1997; Mancilla et al., 1997).Activating mutations in other GPCRs, like the thyroid-stimulating hormone (TSH) and luteinizing hormone (LH) receptors, are usually present in TMDs and presumably facilitate signal transduction or mimic the active state of the receptor, thereby producing ligand-independent activation (Spiegel, 1996).The mutations in the CaRs TMDs may act in a similar manner. Mutations within the ECD, in contrast, may increase the affinity of the CaR for Ca:+ or favor its active conformation, thereby initiating signal transduction at inappropriately low Ca:+. As a result, the parathyroid gland secretes PTH only at inappropriately low concentrations of Ca:+, a secretory response further supporting the key role of CaR-mediated Ca:+-sensing by the parathyroid in mineral ion homeostasis. Furthermore, the abnormally elevated level of urinary Ca2+ excretion despite hypocalcemia in these patients (Baron et al., 1996; Pearce et al., 1996b) probably reflects direct inhibition of renal tubular reabsorption of Ca2+(and Mg2+)by mutant CaRs activated at inappropriately low Ca:+. The latter is the opposite of the effects of inactivating FHH mutations on renal Ca2+handling (Attie et al., 1983)and provides further indirect support for the direct regulation of renal tubular Ca2+handling by the CaR. There may also be “resetting” downward of the coordinate modulation of renal handling of Ca2+ and water by Ca:+ (Hebert et al., 19971, as these patients seem to develop polyuria and polydipsia, presumably due to defective urinary con-
42
EDWARD M. BROWN et al.
centration and/or increased thirst-symptoms of hypercalcemia in otherwise normal persons-at normal or even low levels of Caz+ during treatment with vitamin D (Pearce et al., 1996b).
XI. TISSUEDISTRIBUTION AND FUNCTIONS OF THE CaR IN TISSUES UNINVOLVED IN SYSTEMIC IONHOMEOSTASIS
A. SPATIAL HETEROGENEITY OF Ca:+ Caz+HOMEOSTASIS
AND
LOCAL
The homeostatic system illustrated in Fig. 1 is remarkable for the precision with which it maintains near constancy of CaE+.From the discussion to this point, it is clear that CaR-expressing, Ca:+-sensing cells are key elements within this system, acting as “calciostats” that can sense and correct small changes in Ca:+. Nevertheless, as elaborated on in the remainder of this article, it is apparent, on the one hand, that there are numerous microenvironments where Ca? either differs from its systemic level or varies largely independently of the latter. On the other hand, it is equally clear that a number of cell types express the CaR that are not involved in Ca:+ homeostasis. In some cases, these cells may be involved in the regulation of local Caz+homeostasis, sensing changes in Caz+within their immediate microenvironment and adjusting the movements of either ions (e.g., divalent cations) or water so as to adjust the local ionic composition in a physiologically appropriate manner. In other cases, it appears that cells may utilize extracellular ionic clues characteristic of a particular microenvironment to regulate functions that have nothing to do with either systemic or local Caz+ homeostasis. In the following discussion, we first describe instances where local levels of Caz+ differ from its systemic level and then provide examples of how Ca:+-sensing mediated by the CaR may contribute to the regulation of the local ionic milieu k e . , regulation of local Ca:+ homeostasis) or provide information used by cells for other, nonhomeostatic purposes.
B. MICROENVIRONMENTS WITH VARYING LEVELSOF Ca:+ 1. Locations Where Environmental Ca2+Contributes
to Variations in Caz+ As noted previously, there is only intermittent availability of Ca2+in the diet to free-living terrestrial organisms. As a result, the levels of
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
43
Caz+ and other ions within the gastrointestinal tract can vary substantially. Since cells within both the stomach (Ray et al., 1997) and small intestine express the CaR on their surfaces that face the lumen, it is likely that these cells will experience alterations in Ca? that could modulate their functions in physiologically relevant ways. On-going studies should shed considerable light on the importance of this Capsensing in regulating various aspects of the function of these cells (Chattopadhyay et al., 1998a; Ray et ul., 1997).
2. Changes in Local Caf+As a Result of Alterations in Epithelial Ionic lFunsport Transport of Ca2+across epithelial cells in the kidney and elsewhere occurs through transcellular [e.g.,in DCT (Friedman and Gesek, 1995)l and/or paracellular [i.e., in CTAL (De Rouffignac and Quamme, 1994; Hebert et al., 199711pathways. In some instances, as in the renal proximal tubule, the transport of ions occurs in such a way that the composition of the fluid being reabsorbed reflects, in general, that present within the tubular fluid (e.g., with respect to Na+, K+, Ca2+,and C1-). In other cases, however, there is selective reabsorption of certain ions, sometimes without accompannying water, that modifies substantially the concentrations of Ca:+ or other ions in the reabsorbed fluid (and, therefore, of that remaining in the tubular lumen as well). For instance, in proximal portions of the nephron, less Mg2+is reabsorbed than monovalent ions and Ca2+(De Rouffignac and Quamme, 1994).As a result, Mg? within the tubular fluid rises progressively so that it is about 1.8fold higher in the TAL than in the initial glomerular filtrate. Although the level of Ca? increases only slightly within the tubular fluid of the nephron proximal to the TAL, in the latter segment, Na+, K+, Ca2*, Mg2+,and C1- are reabsorbed by both transcellular and paracellular routes with little accompanying water (Kikeri et al., 1989). Therefore, the concentration of C a r (and Mg?) to which CaRs on the basolateral surface of the tubular epithelial cells are exposed should be appreciably higher than in the tubular fluid or systemic ECF. These local changes in C a y occurring as a result of epithelial ion transport could provide signals to CaRs that are to some extent independent of systemic levels of Caz+.An interesting issue that could be readdressed in the context of the relevance of these local changes in Ca:+ t o Ca;+-sensing is the impact of the so-called “unstirred layers” of fluid in the immediate vicinity of biological membranes. The particular ion-transporting properties of specific tissues can lead to levels of Ca:+ that differ markedly from those in the systemic ECF. For example, lactating mothers elaborate -200 mg of calcium daily per
44
EDWARD M. BROWN et al.
liter of milk, yielding a concentration of Ca:+ approximately twice that in plasma (Prentice et al., 1995).An even more extreme example is afforded by the prostatic fluid, where Ca:+ reaches 30 mM(Valtin, 1983). Doubtless, ionized levels of Ca:+ in these fluids are lower due to the presence of Ca2+ complexes with proteins and/or other ions, but they may still differ substantially from those in the general ECF and provide signals to CaRs known to be present, for example, in the ductal epithelial cells of the breast (Cheng et al., 1998). 3. Alterations in Local Cai+Resulting from Movement of Water without Ions In contrast to the TAL, where Ca2+(and Mg2+)are transported in the absence of accompanying water, in the IMCD the reverse is largely true. That is, through the regulation of aquaporin-2 water channels by vasopressin, reabsorption of water is largely independent of that of ions. As a result, the kidney adjusts the amount of “free” water that is retained or excreted. As discussed previously, these changes in water reabsorption can be accompanied by alterations in the levels of Ca:+ that could be sufficiently high to promote renal stone formation if there were excessive reabsorption of water at a time when a Ca2+load is being excreted. The presence of CaRs on the apical (i.e., luminal) aspect of the tubular epithelial cells of the IMCD provides an illustrative example of how this receptor can be involved in local Ca:+ homeostasis. Since elevations in C a p within the tubular fluid in the IMCD inhibit vasopressin-stimulated water reabsorption, presumably via a CaR-mediated mechanism(s), excessivelyhigh levels of Ca:+ feed back to reduce the level of Ca:+ within the fluid in a homeostatically relevant manner. Of interest, whereas the homeostatic mechanism controlling systemic Ca:+ does so largely by adjusting the movements of Ca2+into and out of the ECF (i.e., through intestine, kidney, and bone), in the IMCD the CaR modulates Caz+ largely through altering the movement of water.
4. Alterations in Local Cai+Owing to Fluxes of Ca2+ between the Intra- and Extracellular Spaces A substantial body of data documents that Ca:+ can change appreciably due to alterations in the fluxes of calcium between the intra- and extracellular spaces. Substantial, neuronal activity-dependent changes in Ca:+ take place within the extracellular microenvironment of the brain owing to Ca2+influx through various channels (e.g., NMDA channels) (Arens et al., 1992; Heinemann et al., 1977; Lucke et al., 1995). These are often accompanied by alterations in the extracellular levels of Na,’ and K; owing to influx of Na+ through voltage-sensitive Na+
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
45
channels and efflux of K+ through Ca2+-activatedand other K+ channels. An extreme example of these changes in extracellular ions is afforded by those measured during strong electrical stimulation of the cerebellum of the anesthetized rat (Nicholson et al., 1977). During brief stimulation in this experimental model, Ca:+ decreases by up to 90%, whereas K,' increases several-fold. These changes are reversible within a matter of seconds after termination of the electrical stimulation. Even much milder, physiological activation of neurons can produce readily detectable changes in CaE+.Stroking the paw of an anesthetized cat with a camel's hair brush, for instance, reduces Ca:+ by several percent within the contralateral primary somatosensory cortex receiving the afferent impulses from the stroked paw (Heinemann et al., 1977). Although the magnitude of this change in Ca:+ may seem small, recall that the CaR is readily able to detect reductions in Ca:+ of this magnitude or less (e.g., Fig. 2). We used modeling to examine the special case of the synaptic cleft (Vassilev et al., 1997b). An elevation in Ca:+ in the postsynaptic dendritic spines in hippocampus as a result of Ca2+influx through NMDA channels is a major factor in the induction of long-term potentiation (LTP) (Jahr and Stevens, 1993). Ca2+influx within or in close proximity to synaptic clefts likewise plays key roles in all steps of synaptic transmission, both pre- and postsynaptically (Bliss and Collingridge, 1993). The synaptic cleft can be represented as a thin disk of ECF (e.g., Fig. 9). At high stimulation frequencies, it is possible that the interval between pulses would not be sufficient for diffusion of Ca:+ from the periphery of the cleft to replace that depleted at the cleft's center owing to activation of postsynaptic, Ca2+-permeableion channels. We developed a computer model t o approximate the changes in Ca,"' that could occur in the synaptic cleft as a result of influx of Ca2+from the synaptic cleft into the postsynaptic compartment through iGluRs and Ca2+ eMux via Ca2+pumps and Na-Ca exchangers. The concentrations of Ca:+ inside of the cleft were estimated using a compartmental model that incorporated flux across the postsynaptic membrane and radial diffusion from the cleft's edge. The simulations suggest that substantial depletion of Ca:+ can occur in synaptic clefts during activation of iGluRs, particularly at the high stimulation frequencies that are used to induce LTP. In contrast, only minimal, transitory changes in Ca:+ were predicted at low frequencies. These frequency-dependent alterations in Ca:+ dynamics are a reflection of the activity of iGluRs and might potentially be involved in modulating presynaptic function via a retrograde messenger mechanism if there are Ca:+ sensors on the presynaptic membranes. The CaR is
46
EDWARD M. BROWN et al.
FIG.9. Possible locations and functions of the CaR in a hypothetical hippocampal pyramidal neuron. The CaR could reside on the plasma membrane inside or outside of the synaptic cleft either pre- or postsynaptically. It might also be present intracellularly on synaptic vesicles or other intracellular organelles that contain concentrations of calcium within the millimolar range. Functions shown as possibly being regulated by the CaR include control of ion channel activity and synaptic vesicle release as well as the regulation of vesicular calcium stores. Note that the synaptic cleft is drawn considerably larger in scale relative to the other synaptic structures than it actually is. (From Brown et al., 1995, with permission. Copyright 0 1995 Cell Press.)
known to be present in nerve terminals in hippocampus and other areas of the brain and could potentially play such a role (Chattopadhyay et al., 1997a; Ruat et al., 1995). Another example of a tissue in which alterations in cellular activity produce changes in Caz+ is the beating heart (Bers, 1983). Pacing of a frog heart in uitro produces substantial reductions in Caz+. Even greater changes in Caz+ might occur in this setting within the spatially restricted space of the T-tubular system, in which narrow infoldings of the plasma membrane invaginate into the muscle fibers of heart cells, providing a close proximity between the extracellular fluid within the T tubules and the intracellular sites where calcium ions are involved in stimulus-contraction coupling (Almers et al., 1981). One final example where depletion of Caz+ has been described as a result of fluxes of calcium ions between the intra- and extracellular fluid is the pancreatic islet. During the phasic spontaneous electrical activity of isolated islets studied in uitro, the initiation of action poten-
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
47
tials, producing activation of voltage-sensitive calcium channels and several-fold increases in Ca:+, was associated with substantial (-0.5 mM) reductions in Ca:+ (Perez-Armandarizet al., 1995).With cessation of this electrical activity, both Caf+and Ca:+ returned t o their baseline levels. Given that Ca:+ is about 10,000-fold higher than Caf+,it may seem surprising that alterations in cellular activity, which generally increase the free cytosolic calcium concentration by 10-fold or less (Pietrobon et al., 1990) (although the levels in close proximity to Ca2+-conducting channels in the plasma membrane are doubtless much higher), are capable of significantly reducing C a p . The answer to this apparent paradox clearly lies in the fact that the restricted ECF spaces within intact tissues provide only a limited store of Caz+ and that the magnitude of the influx of Ca:+ required to produce a given change in Caf+ is much larger than the resultant change in free cytosolic calcium owing to the presence of intracellular Ca2+buffers, It is also likely that there will be substantial heterogeneity in terms of where and how large the changes in C a 4 are that occur over the surfaces of individual cells, depending on the distributions of sites of Ca2+influx and eMux as well as of the CaR itself in cells expressing the receptor. One particularly interesting microenvironment in this regard is that present within caveolae. These small flasklike invaginations of the cell surface are thought to play key role in potocytosis, transcytosis, and pinocytosis (Anderson, 1993; Lisanti et al., 1995). In addition, they may act as “message centers” within the cell, as they have recently been found to contain important elements in signal transduction, including GPCRs and tyrosine-coupled receptors as well as G proteins, isoforms of PKC, Ca2+-ATPase,and IPS-regulated channels (Anderson, 1993; Lisanti et al., 1995). The CaR is predominantly localized within caveolae of parathyroid cells (Kiforet al., 1998). Therefore, there could be large local fluxes of Ca2+out of and potentially into the cell via calcium-transporting mechanisms within caveolae that might substantially modulate Gal+within the immediate microenvironment. The latter changes in Ca:+ could be particularly relevant in CaR-expressing cells. The distribution of intracellular Ca2+buffers will also likely modify the patterns of changes in Caf+ as well as in CaE+,since a larger magnitude of Cat+ influx will be needed to produce a given change in Ca:+ if that influx occurs where there is a locally high concentration of intracellular buffer(s).Therefore, the presence of Caf+buffers, such as the calbindins, in CaR-expressing cells, including parathyroid, duodenal epithelial cells (Brehior et al., 19891, and cells of the DCT (Clemens et
-
48
EDWARD M. BROWN et al.
al., 1989), could modify local changes in C a p occurring in association with alterations in Caf+,including those caused by activation of the CaR.
5. Variations in Local C a r Owing to Movements of Ca2+ into and out of Extracellular Reservoirs Movement of Ca2+into or out of the skeleton affords an excellent example of how Ca2+ fluxes into or out of reservoirs containing large amounts of this ion can perturb local (and even systemic)levels of Ca:+. As noted previously, the levels of C a p beneath an actively resorbing osteoclast can be as high as 40 mM (Silver et al., 1988).Although the impact of releasing this resorbed Ca2+into the immediate environment of the osteoclast on local levels of Ca:+ is not known, it is likely that the latter would change substantially. Indeed, in circumstances where there is uncontrolled release of skeletal Ca2+,as with skeletal metastases of certain malignancies (e.g., breast), even the systemic level of Ca:+ can rise to levels well above normal (Stewart and Broadus, 1987). Presumably Ca:+ within the skeletal microenvironment is much higher. Moreover, since some ductal breast cancer cells express abundant CaRs, their behavior within bone might be modulated by local release of Ca2+within the skeletal microenvironment. Depending on the effects of C a p on the functions of such cells, it could in some cases further aggravate the situation [e.g., if Ca:+ stimulated cellular proliferation in a CaR-mediated manner, as recently described in CaR-transfected cells (Hoff et al., 1997; Mailland et al., 199711. Note in passing that, during pathological bone resorption, ions other than Ca2+are released (i.e., protons and phosphate) that might also modify the local ionic composition substantially. If there are cells that sense these other ions, they might utilize this information to modulate their own functions in potentially homeostatically relevant ways (Brown, 1991). In addition to releasing calcium ions, the skeleton also has a substantial capacity to take up Ca:+, both as part of its normal turnover and in pathological states (Stewart and Broadus, 1987). Several hundred milligrams of C a p enter the skeleton daily as a result of osteoblast-mediated bone formation. It is probable that there is local depletion of Ca:+ (and phosphate ions) in the vicinity of active osteoblasts. Since osteoblasts sense Cap, either via the CaR (Yamaguchi et al., 1998a) or some other Cap-sensing mechanism (Quarles, 19971, their behavior could be modulated by local changes in Ca:+. Local elevation in Ca:+ due to osteoclastic bone resorption could initially promote proliferation of osteoblast precursors and their chemotaxis to sites of resorption. Perhaps local decreases in Ca:+ due to bone formation are also
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEFTOR
49
sensed and utilized by osteoblasts to regulate their function at this stage in the cycle of bone turnover. Furthermore, in contrast to malignancies that resorb bone excessively, some cancer cells promote bone formation, particularly prostate cancer cells (Stewart and Broadus, 1987), which can in some cases be so exuberant that it lowers the systemic level of Cay. If these cells also expressed the CaR, the latter might also participate in the pathophysiology of such pathological states. ROLESOF THE CaR IN LOCAL IONICHOMEOSTASIS C. POSSIBLE
As noted earlier, the CaR on the apical membrane of the IMCD may provide a prototypical example of the role of the CaR in local CaE+ homeostasis (Sands et al., 1997).Several other examples are given later of locations where the CaR may function, at least in part, to modulate the levels of C a y within particular microenvironments, although much additional work is required to clarify further the roles of the receptor in such microenvironments. 1. Brain Cells, Including Neurons and Glia
Although the CaR may perform a variety of functions in nervous tissue, many of which are doubtless poorly understood at present, it likely plays a role in regulating the movements of Ca2+between the intraand extracellular spaces within the brain. In adult rat brain, the CaR has been localized using both immunocytochemistry and in situ hybridization (Chattopadhyay et al., 1997a; Rogers et al., 1997; Ruat et al., 1995).The receptor is expressed at varying levels in numerous regions of brain. The highest levels are present within the SFO and olfactory bulbs. Substantial levels of expression are also found in hippocampus, striatum, cingulate cortex, cerebellum, the ependymal zones of the cerebral ventricles, and perivascular nerves around cerebral arteries (Chattopadhyay et al., 1997a; Rogers et al., 1997; Ruat et al., 1995).Abundant CaR expression in the SFO, an important hypothalamic thirst center (Simpson and Routenberg, 1975),implies that it may play a role in the central control of systemic fluid and electrolyte metabolism, as noted previously. Therefore, although mineral ion homeostasis has not usually been thought to have central regulatory elements (i,e., in the brain), perhaps there are more complex interrelationships between the regulation of mineral ion homeostasis and other homeostatic systems with prominent neuroendocrine elements (i.e., water homeostasis) than previously recognized. The CaR is expressed in synaptic areas of all regions of hippocampus,
50
EDWARD M. BROWN et al.
although it is not currently known with certainty whether it has a predominant pre- and/or postsynaptic localization (Chattopadhyay et al., 1997a; Ruat et al., 1995). Its overall distribution is similar to those of the mGluRs and iGluRs (e.g., the NMDA receptor), both of which serve important roles in certain forms of LTP. It is of interest, therefore, that large increases in CaR expression occur in the developing rat hippocampus at a time when brain development is progressing rapidly and LTP can first be induced. The function(s) that the receptor plays during this period of time, however, is essentially unknown (Chattopadhyay et al., 1997a; Chattopadhyay and Brown, 1997). The CaRs expression in the cerebellar granule and Purkinje cells likewise suggests a potential role in regulating cerebellar function, but no studies on the functions of the CaR in these cell types have been reported. The use of brain tissue from mice with targeted disruption of the CaR gene should eventually facilitate studies of whether the CaR plays any such postulated roles, although at present the limited viability of the homozygous mice complicates such studies (Ho et al., 1995). How might the CaR regulate the function of cerebellar, hoppocampal, and other neurons? We have shown the presence of a Ca2+-permeable nonselective cation channel whose activity is modulated by the CaR in rat hippocampal pyramidal neurons (Ye et al., 1996a).Application of increasing concentrations of Ca:+ and other CaR agonists, such as spermine and neomycin, to cultured rat hippocampal pyramidal neurons studied using the cell-attached mode of the patch-clamp technique produces a several-fold increase in the open state probability (Po) of the NCC. An NCC with similar properties is regulated in a CaR-dependent fashion in HEK293 cells that have been stably transfected with CaR but not in nontransfected cells, which do not express the CaR (Ye et al., 1996b). Furthermore, CaR agonists activate a very similar NCC in hippocampal pyramidal neurons that were cultured from wild-type mice but not in those from mice with “knockout” of the CaR gene (Ye et al., 1997b). The relationship of this NCC t o iGluRs, such as the NMDA channel is not yet clear. CaR-mediated activation of this Ca2+-permeable cation channel, however, could potentially contribute to the alterations in Ca:+ thought to be involved in regulating synaptic plasticity. In addition to its effects on the NCC, the CaR also stimulates the activity of a Ca2+-activatedK’ channel in hippocampal pyramidal neurons from wild-type but not from CaR knockout mice (Vassilev et al., 1997a). Thus the receptor could potentially modulate ionic permeabilities that would have important effects on the relative concentrations of Ca2+intra- and extracellularly as well as on related neuronal properties, such as excitability. For instance, during neuronal activation, the ensuing reduc-
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
51
tion in Caz+ would reduce activation of NCCs and perhaps provide a negative feedback mechanism for avoiding excessive elevations in neuronal Caf+.Conversely, in neurons in which the CaR is strongly coupled to Ca2+-activatedK+ channels, the receptor could function in a positive feedback mode. That is, reduced activity of the receptor during neuronal activity-dependent reductions in Ca:+ would diminish the CaRs tendency to hyperpolarize the cell through Ca2+-activatedK+ channels, thereby increasing neuronal excitability and potentially stimulating voltage-gated Ca2+channels and contributing to further increases in Caf+. Note that there may well be endogenous CaR agonists within the brain other than CaE+.Spermine can be a potent polycationic CaR agonist (Quinn et al., 1997). In view of the presence of substantial levels of spermine in various tissues, including the brain, it could modulate CaR-regulated processes in these tissues (Quinn et al., 1997).Another CaR agonist of potential relevance to brain pathology is amyloid P-peptideb). Micromolar concentrations of such peptides, probably in a fibrillar form(s), potently activate NCC in neurons from wild-type mice but not those from mice with knockout of the CaR as well as in CaRtransfected HEK cells but not nontransfected HEK cells (Ye et al., 1997a).It is possible, therefore, that amyloid p-fibrils deposited in brain regions involved in the pathology ofAlzheimer's disease where the CaR is expressed at substantial levels, such as hippocampus, could modulate the activity of these CaRs, contributing to the pathophysiology of Alzheimer's disease in ways that are currently not understood (Ye et al., 1997a). In addition to being present in neurons, we have also shown in recent studies (Chattopadhyay et al., 199813) that the CaR is also expressed in oligodendroglia, where it regulates Ca2+-activatedK+ channels. The CaR present in these cells, which are thought t o play a role in local ionic homeostasis within the brain, could contribute to such homeostatic mechanisms. For instance, since neuronal activity-dependent reductions in Ca:+ are accompanied by increases in KO+, decreased stimulation of oligodendroglial CaRs would diminish the activity of these Ca2+activated K+ channels, thereby potentially mitigating further increases in KO+. 2 . Lens Epithelial Cells
High Caz+has several effects on lens epithelial cells in culture, namely, disruption of the integrity of the plasma membrane integrity, loss of the cytoskeletal protein, vimentin, and stimulation of Ca2+-ATPase that could contribute to cataract formation (for review, see Delamere
52
EDWARD M. BROWN et al
and Paterson, 1981). In addition, clinical observations, such as the development of cataracts in patients with hypoparathyroidism and the high Ca2+content of these cataracts, suggest a role(s) for Ca:+ (and potentially the CaR) in the physiology and pathophysiology of lens epithelial cells (Duncan and Bushell, 1975). We found that cultured human lens epithelial cells express the CaR (Chattopadhyayet al., 1997b). The receptor stimulates a Ca2+-activatedK+ channel with a conductance of -82 pS, increasing its open state probability. We previously found that high Ca? also stimulates Ca2+-activatedK+ channels in parathyroid cells (Kanazirska et al., 1995)and in hippocampal neurons cultured from wild-type mice as well as those from mice homozygous for targeted disruption of the CaR gene (Vassilev et al., 1997a).In view of the key role of Ca:+ in maintaining integrity of the lens, it is possible that the CaR could contribute importantly to local ionic homeostasis in the lens. Examination of the properties of the lens and of lens epithelial cells from mice with targeted disruption of the CaR could provide useful information in this regard. 3. Bone Marrow Cells and Platelets in Peripheral Blood We showed that several types of cells within the bone marrow express the CaR, including megakaryocytes, erythroid progenitors, myeloid precursors, and cells with the morphological appearance of monocytemacrophages (Houseet al., 1997).Of the cells of the various hematopoietic lineages expressing the CaR in marrow, the only ones whose mature cells in peripheral blood express the CaR are platelets and macrophages-monocytes (House et al., 1997).We employed immunostaining with CaR-specific antisera as well as RT-PCR to identify CaR protein and transcripts in monocytes, respectively (Yamaguchi et al., 1998131, whereas Bornefalk et al. (1997) who demonstrated that high Ca:+ stimulates secretion of IL-6 both in uiuo and in uztro from peripheral blood monocytes, were unable to identify CaR transcripts in these cells. The reason(s) for the discrepancy between these two studies requires further study. Other studies examining the effects of physiologically relevant changes in C a p on marrow-derived cells are scarce. Raising C a p potentiates the fusion of rat alveolar macrophages induced by 1,25-dihydroxyvitamin D, (Jin et al., 1990).Elevating C a p stimulates colony formation and increases Caf+ in erythroid precursors from uremic patients, an effect potentiated by 1,25(OH),D (Carozziet al., 19901, potentially because the latter upregulates expression of the CaR (Brown et al., 1996).In the marrow, the CaR is expressed in hematopoietic precursors that likely experience significantvariations in the levels of Caz+
G-PROTEIN-COUPLED, EXTRACELLULAR Caz+-SENSING RECEPTOR
53
to which they are exposed as a result in changes in bone turnover within the local bone-bone marrow microenvironment. In addition to the effects of C a p on hematopoietic cells already described, it is also possible that the CaR could regulate other functions of these cells. For example, since the CaR is expressed on erythroid and some myeloid precursors within the marrow but not on mature cells of those lineages within peripheral blood (with the exception of monocytes), perhaps it could control trafficking of these cells between marrow and peripheral blood. Finally, CaE+ modulates a variety of processes in platelets, such as stimulating arachidonic acid release (Matsuoka et al., 1989) and inhibiting CAMPaccumulation (Siege1and Daly, 1985), effects that could potentially be mediated by the CaR. It is of interest that Ca:+ has been measured directly in platelet clumps during platelet activation and decreases substantially (Owen et al., 1995).Therefore, activity-dependent changes in Ca:+ in the microenvironment to which platelets are exposed in peripheral blood could potentially both modulate their function(s) and also affect local levels of Ca:+ by regulating fluxes of Ca2+ between platelets and their immediate environment. 4. Breast Duct Cells We have shown that the CaR is expressed at high levels in normal duct cells of the breast as well as in duct cells of both fibrocystic breast tissue and ductal carcinoma of the breast (Cheng et al., 1998). Ca:+ plays an important role in the breast, not only in its normal physiologic function(s) but also in pathologic states. Ca:+ is clearly an important constituent of milk, which contains approximately 200 mg of Ca2+per liter (Prentice et al., 1995). A diagnostically significant characteristic of breast cancer that is useful in the radiological detection of early cancers during mammographic screening is their tendency to form microcalcifications within the ducts (Galkin et al., 1977). Moreover, in uitro studies have demonstrated that elevating CaE+within the physiologic range induces terminal differentiation of normal human breast epithelial cells in culture (McGrath and Soule, 1984). Although only limited data are available concerning the regulation of the transport of Ca2+into milk, the presence of the CaR in ductal cells suggests the possibility that it could be involved in regulating such transport processes. In addition, metastatic cancer of the breast has a marked tendency to spread t o bone (Percival et al., 1985). In view of the recent demonstration that numerous cells within the bone marrow normally express the CaR (House et al., 1997), perhaps the presence of the CaR on malignant breast cells contributes to the propensity of these and other CaR-expressing malignant cells to metastasize to bone, in
54
EDWARD M. BROWN et al.
which there are locally high levels of Ca:+ during bone resorption (Silver et al., 1988). Given the importance of Caz+in the breast, therefore, it is likely that the CaR could play diverse roles in the physiology and pathophysiology of breast tissue.
D. CaR IN TISSUES UNINVOLVED IN SYSTEMIC Ca:+ HOMEOSTASIS 1. Keratinocytes Tissues uninvolved in Ca:+ homeostasis that express the CaR include human keratinocytes (Bikle et al., 1996). Differentiation of human and mouse keratinocytes in uitro is known to be triggered by increases in Ca;+, which elicit changes in several intracellular signaling pathways, including the accumulation of inositol phosphates (Moscat et al., 1989) and elevations in Caf+resulting from both release of Ca2+from intracellular stores and Ca2+influx through NCC (Bikle et al., 1996).Bikle and coworkers (1996) have shown that human keratinocytes express transcripts for the CaR, and the differentiating stimulus of an increase in Caz+leads to an increase in CaR mRNA. Thus the CaR might mediate the effects of Ca:+ on keratinocyte differentiation through its known capacity to activate PLC and NCC (Bikle et al., 1996;Ye et al., 1996a,b).
2. Gastric Antral Gastrin-Secreting Cells In addition to being present in the intestine, recent studies have identified the CaR in the gastrin-secreting cells of the gastric antrum (Ray et al., 1997).CaR transcripts and CaR protein were identified using RTPCR as well as immunocytochemistry and Western blot analysis, respectively, of primary cultures enriched in human gastrin-secreting cells. The CaR expressed in these cells may explain the previously observed stimulatory effects of elevated levels of Ca:+ on gastrin secretion in uitro and in uiuo (Behar et al., 1977). The physiological relevance of the CaR expressed in this cell type, however, remains unclear. 3. Enteric Nervous System We have shown that the CaR is expressed in the enteric nervous system along the entire gastrointestinal tract, both in Auerbach’s plexus between the circular and longitudinal smooth muscle layers in the intestinal wall and in the region of Meissner’s plexus within the submucosa (Chattopadhyay et al., 1998a; Rogers et al., 1995a).Both plexi contribute to regulating key intestinal functions, including motility as well as secretory and absorptive activities. It is of interest in this regard that changes in Caz+ are known to affect many of these processes, particu-
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
55
larly motility, as hypercalcemic patients are commonly constipated, while those with hypocalcemia may have increased gastrointestinal (GI) motility (Stewart and Broadus, 1987)-effects potentially mediated by the CaR. XII. CaR-BASED THERAPEUTICS The CaR represents an important target for the development of CaRbased therapeutics for the treatment of disorders in which the CaR is over- or underactive (Nemeth, 1995).Although the development of such therapeutics has so far been directed at parathyroid disorders, it appears likely that it could extend to a wider variety of diseases of CaR-expressing tissues in which the CaR malfunctions or in which modulating the receptor’s activity would have desirable therapeutic consequences. Clinical studies are currently underway that are testing so-called“calcimimetic”CaR activators in the treatment of primary and secondary HPT (Silverberget al., 1997). These agents are hydrophobic, low-molecular-weight drugs that allosterically modify the CaR (Nemeth, 1995).They are ineffective in the absence of Ca:+, but in the presence of Ca2+or other polycationic CaR agonists they enhance the receptor’s apparent affinity for these agonists. Calcimimetic CaR activators will likely prove to be useful for treating conditions with dysfunction of CaRs in a wide variety of CaR-expressing tissues. In primary HPT, calcimimetics produce rapid (within minutes) and substantial (>50%) reductions in circulating PTH levels that are followed several hours later by decreases in serum calcium concentration, particularly at higher doses (Silverberg et al., 1997), because the drug “resets”the elevated set point of pathological parathyroid tissue toward normal. There is an initial increase in urinary Ca2+ excretion in patients with primary HPT during treatment with a calcimimetic that would have been anticipated, in part, as a result of the attendant rapid reduction in serum PTH. It is also possible that additional, direct actions of calcimimetics on CaRs in CTAL and, perhaps, DCT will lead to sustained hypercalciuria. CaR agonists will also be very useful for treating uremic hyperparathyroidism (Nemeth, 1995). Conversely, a kidney-specificCaR antagonist might represent an effective form of therapy for individuals with Ca2+-containingrenal stones. In the latter clinical setting, reducing the activity of CaRs in CTAL would likely lower urinary Ca2+excretion markedly (e.g.,similar t o the renal Ca:+ “resistance”in FHH).
56
EDWARD M.BROWN’et al.
The cloning of the G-protein-coupled CaR has provided an actual or potential molecular explanation for many of the known effects of Ca:+ on the tissues involved in maintaining systemic CaE+homeostasis, particularly parathyroid and kidney. In addition to providing molecular tools for demonstrating the presence of CaR mRNA and protein within these tissues, the cloned receptor has made it possible to identify human diseases resulting from inactivating or activating mutations of this receptor as well as to create mice with targeted disruption of the CaR gene. The characteristic alterations in parathyroid and renal functions of these patients as well as those present in the CaR “knockout” mice have been a valuable source of information for dissecting the CaRs physiological roles in mineral ion metabolism. Nevertheless, much remains to be learned about how the CaR regulates other tissues involved in systemic homeostasis, such as bone and intestine. Although these human diseases and mouse models will be useful tools in further studies of these latter tissues, the development of potent and specific CaR antagonists-tools not currently available-would be extremely useful in this regard. Moreover, much remains to be learned about the CaRs functions in tissues not directly involved in systemic mineral ion homeostasis, where the receptor likely serves numerous additional roles, some related to local intra- and extracellular regulation of ions and others unrelated to either systemic or local ionic homeostasis. In any event, the CaR and perhaps other receptors and/or sensors for calcium or other extracellular ions will likely be versatile regulators of a wide variety of cellular functions (Brown, 1991; Whitfield, 1995) and important therapeutic targets. ACKNOWLEDGMENTS The authors gratefully acknowledge generous grant support from numerous sources, including the National Institutes of Health (48330, DK41415, DK46422, and DK52005 to O.K., E.M.B., P.M.V., S.Q. and S.C.H.), The St. Giles Foundation (to E.M.B., P.M.V. and S.C.H.), NPS Pharmaceuticals, Inc. (to E.M.B.), the National Dairy Council (to E.M.B.), the NSBRI (to E.M.B.), and the Stanley Foundation (to E.M.B. and P.M.V.). REFERENCES Aida, K., Koishi, S., Inoue, M., Nakazato, M., Tawata, M., and Onaya, T. (1995a). Familial hypocalciuric hypercalcemia associated with mutation in the human Ca2+-sensing receptor gene. J. Clin. Endocrinol. Metab. 80,2594-2598. Aida, K., Koishi, S., Tawata, M., and Onaya, T. (1995b). Molecular cloning of a putative Ca2+-sensingreceptor cDNA from human kidney. Biochem. Biophys. Res. Commun. 214,524-529. Almers, W., Fink, R., and Palade, P. T.(1981). Calcium depletion in frog muscle tubules:
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
57
The decline of calcium current under maintained depolarization. J. Physiol. (London) 312,177-207. Anderson, R. G. W. (1993). Plasmalemmal caveolae and GPI-anchored membrane proteins. Cum Opin. Cell Biol. 5, 647-652. Arens, J., Stabel, J.,and Heinemann, U.(1992). Pharmacological properties of excitatory amino acid induced changes in extracellular calcium concentration in rat hippocampal slices. Can. J. Physiol. Pharmacol. 70, S194-SZO5. Attie, M. F., Gill, J.,Jr., Stock, J. L., Spiegel, A. M., Downs, R. W., Jr., Levine, M. A., and Marx, S. J. (1983). Urinary calcium excretion in familial hypocalciuric hypercalcemia. Persistence of relative hypocalciuria after induction of hypoparathyroidism. J. Clin. Invest. 72,667-676. Austin, L. A., and Heath, H., I11 (1981). Calcitonin: Physiology and pathophysiology. N. Engl. J. Med. 304,269-278. Autry, C. P., Brown, E. M., Fuller, F. H., Rogers, K. V., and Halloran, B. P. (1997). Ca2+ receptor mRNA and protein increase in the rat parathyroid gland with age. J . Endocrinol. 153,437-444. Auwerx, J., Demedts, M., and Bouillon, R. (1984).Altered parathyroid set point to calcium in familial hypocalciuric hypercalcaemia. Acta Endocrinol. (Copenhagen) 106, 215-218. Bai, M., Quinn, S. J., Trivedi, S., Kifor, O., Pearce, S. H. S., Pollak, M. R., Krapcho, K. J., Hebert, S. C., and Brown, E. M. (1996). Expression and characterization of inactivating and activating mutations of the human CaE+-sensingreceptor. J. Biol. Chem. 271,19537-19545. Bai, M., Pearce, S. H. S., Kifor, O., Trivedi, S., Stauffer, U. G., Thakker, R. V., Brown, E. M., Steinmann, B. (1997a). In vivo and in vitro characterization of neonatal hyperparathyroidism resulting from a de novo, heterozygous mutation in the Ca2+sensing receptor gene: Normal maternal calcium homeostasis as a cause of secondary hyperparathyroidism in familial benign hypocalciuric hypercalcemia. J. Clin. Invest. 99,88-96. Bai, M., Janicic, N., Trivedi, S., Quinn, S. J., Cole, D. E. C., Brown, E. M., and Hendy, G. N. (199713).Markedly reduced activity of mutant calcium-sensing receptor with an inserted Alu element from a kindred with familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. J. Clin. Invest. 99,1917-1925. Bai, M., Trivedi, S., Lane, C. R., Yang, Y., Quinn, S. J., and Brown, E. M. (1998). Protein kinase C phosphorylation of CaF-sensing receptor (CaR) inhibits its coupling to Ca2+ store release. J. Biol. Chem. (in press). Baron, J., Winer, K. K., Yanovski, J. A., Cunningham, A. W., Laue, L., Zimmerman, D., and Cutler, G. B., Jr. (1996). Mutations in the Ca2+-sensingreceptor gene cause autosomal dominant and sporadic hypoparathyroidism. Hum. Mol. Genet. 6,601-606. Bascal, Z., Alam, A,, Zaidi, M., and Dacke, C. (1994). Effect of raised extracellular calcium on cell spread area in quail medullary bone osteoclasts. Exp. Physiol. 79,15-24. Behar, J.,Hitchings, M., and Smyth, R. D. (1977).Calcium stimulation ofgastrin and gastric acid secretion: Effect of small doses of calcium carbonate. Gut 18,442-448. Bers, D. M. (1983). Early transient depletion of extracellular Ca during individual cardiac muscle contractions. Am. J. Physwl. 244, H462-H468. Bikle, D., Ratnam, A., Mauro, T., Harris, J., and Pillai, S. (1996). Changes in calcium responsiveness and handling during keratinocyte differentiation. Potential role of the calcium receptor. J. Clin. Inuest. 97, 1085-1093. Black, B., and Smith, J. (1989).Regulation of goblet cell differentiation by calcium in embryonic chick intestine. FASEB J. 3,2653-2659.
58
EDWARD M. BROWN et al.
Bliss, T. V. P., and Collingridge, G. L. (1993). A synaptic model of memory: Long-term potentiation in the hippocampus. Nature (London) 361,31-39. Bockaert, J . (1991). G proteins, G. protein-coupled receptors: Structure, function and interactions. Cum Opin. Neurobiol. 1,32-42. Bornefalk, E., Ljunghall, S., Lindh, E., Bengsten, O., Johansson, A., and Ljunggren, 0. (1997). Regulation of interleukin-6 secretion from mononuclear blood cells by extracellular calcium. J. Bone Miner. Res. 12,228-233. Bradbury, R. A., McCall, M. N., Brown, M. J., and Conigrave, A. D. (1996). Functional heterogeneity of human term cytotrophoblasts revealed by differential sensitivity to extracellular Ca2+ and nucleotides. J. Endocrinol. 149, 135-144. Bradbury, R. A., Sunn, K. L., Crossley, M. C., Bai, M., Brown, E. M., Delbridge, L., and Conigrave, A. D. (1998). Expression of the parathyroid Ca2+sensing receptor in cytotrophoblasts from human term placenta. J. Endocrinol. 156,425-430. Brehior, A., Perret, C., and Thomasset, M. (1989). 1,25-dihydroxycholecalciforoland calcium regulate the calbindin-D9K (CaBP 9K) gene expression in fetal rat duodenal organ culture. J. Bone Miner. Res. 4 (Suppl. l), S292. Brent, G., LeBoff, M., Seely, E., Conlin, P., and Brown, E. M. (1988). Relationship between the concentration and rate of change of calcium and serum intact parathyroid hormone levels in normal humans. J. Clin. Endocrinol. Metab. 67,944-950. Brown, A. J., Zhong, M., Ritter, C., Brown, E. M., and Slatopolsky, E. (1995). Loss of calcium responsiveness in cultured bovine parathyroid cells is associated with decreased calcium receptor expression. Biochem. Biophys. Res. Commun. 212, 861-867. Brown, A. J., Zhong, M., Finch, J., Ritter, C., McCracken, R., Morrissey, J., and Slatopolsky, E. (1996). Rat calcium-sensing receptor is regulated by vitamin D but not by calcium. Am. J. Physiol. 270, F454-F460. Brown, E. M. (1983). Four parameter model of the sigmoidal relationship between parathyroid hormone release and extracellular calcium concentration in normal and abnormal parathyroid tissue. J. Clin. Endocrinol. Metab. 56, 572-581. Brown, E. M. (1991). Extracellular Ca2+sensing, regulation of parathyroid cell function, and role of Ca2+and other ions as extracellular (first)messengers. Physiol. Rev. 71, 371-411. Brown, E. M., and Hebert, S. C. (1997). Calcium-receptor regulated parathyroid and renal function. Bone 20,303-309. Brown, E. M., Enyedi, P., LeBoff, M., Rothberg, J., Preston, J., and Chen, C. (1987). High extracellular Ca2+and Mg2+stimulate accumulation of inositol phosphates in bovine parathyroid cells. FEBS Lett. 218,113-118. Brown, E. M., Fuleihan, G. E.-H., Chen, C., and Kifor, 0. (1990). A comparison of the effects of divalent and trivalent cations on parathyroid hormone release, 3',5'-cyclicadenosine monophosphate accumulation, and the levels of inositol phosphates in bovine parathyroid cells. Endocrinology (Baltimore) 127, 1064-1071. Brown, E. M., Butters, R. R., Katz, C., and Kifor, 0.(1991). Neomycin mimics the effects of high extracellular calcium concentrations on parathyroid function in dispersed bovine parathyroid cells. Endocrinology (Baltimore) 128,3047-3054. Brown, E. M., Gamba, G., Riccardi, D., Lombardi, D., Butters, R. R., Kifor, O., Sun, A., Hediger, M., Lytton, J., and Hebert, S. C. (1993). Cloning and characterization of a n extracellular Ca2+-sensingreceptor from bovine parathyroid. Nature (London) 366, 575-580. Brown, E. M., Pollak, M. R., and Hebert, S. C. (1994). Cloning and characterization of extracellular Ca2+-sensingreceptors from parathyroid and kidney: Molecular physiology and pathophysiology of Ca2+-sensing.Endocrinologist 4,419-426.
G-PROTEIN-COUPLED,EXTRACELLULAR Ca2+-SENSINGRECEPTOR
59
Brown, E. M., Vassilev, P. V., and Hebert, S. C. (1995). Calcium ions as extracellular messengers. Cell (Cambridge, Mass.) 83,679-682. Brown, E. M., Harris, H. W., Jr., Vassilev, P. M., and Herbert, S. C. (1996). The biology of the extracellular Ca2+-sensing receptor. In “Principles of Bone Biology” (J. P. Bilezikian, L. G. Raisz, and G. A. Rodan, eds.), pp. 243-262. Academic Press, San Diego, CA. Brown, E. M., Bai, M., and Pollak, M. R. (1997). Familial benign hypocalciuric hypercalcemia and other syndromes of altered responsiveness to extracellular calcium. In “Metabolic Bone Diseases” (S. M. Krane and L. V.Arioli, eds.), 3rd ed., 479-499. Academic Press, San Diego, CA. Buset, M., Lipkin, M., Winawer, S., Swaroop, S., and Friedman, E. (1986). Inhibition of human colonic epithelial cell proliferation in vivo and in vitro by calcium. Cancer Res. 46,5426-5430. Butters, R. R., Jr., Chattopadhyay, N., Nielsen, P., Smith, C. P., Mithal, A., Kifor, O., Bai, M., Quinn, S. J., Goldsmith, P., Hunvitz, S., Krapcho, K., Busby, J., and Brown, E. M. (1997). Cloning and characterization of a calcium-sensing receptor from the hypercalcemic New Zealand white rabbit reveals unaltered responsiveness to extracellular calcium. J. Bone Miner. Res. 12,568-579. Canalis, E., Hott, M., Deloffre, P., Tsouderos, Y., and Marie, P. (1996). The divalent strontium salt S12911 enhances bone cell replication and bone formation in vitro. Bone 18,517-523. Carozzi, S., Ramello, A., Nasini, M., Schelotto, C., Caviglia, P., Cantaluppi, A,, Salit, M., and Lamperi, S. (1990). Bone marrow erythroid precursor Ca2+ regulates the response to human recombinant erythropoietin (rHuEPO) in hemodialysis patients. Int. J. Artif: Organs 13,747-750. Carpenter, T. O., Insogna, K. L., Boulware, S. D., and Mitnick, M. A. (1990). Vitamin D metabolism in chronic childhood hypoparathyroidism: Evidence for a direct regulatory effect of calcium. J. Pediatr. 116,252-257. Chang, W., Chen, T.-H., Gardner, P., and Shoback, D. (1995). Regulation of Ca2+-conducting currents in parathyroid cells by extracellular Ca2+and channel blockers. Am. J. Physiol. 269, E864-E877. Chang, W., Pratt, S., Chen, T.-H., and Shoback, D. M. (1997). Mutagenesis of the bovine parathyroid calcium-sensing receptor (CaR) reveals domains in the second and third intracellular loops critical for G-protein dependent activation of phospholipase C. J. Bone Miner. Res. 12 (Suppl. 11, S326 (Abstr. No. F401). Chattopadhyay, N., and Brown, E. M. (1997). Calcium-sensing receptor: Roles in and beyond systemic calcium homeostasis. Biol. Chem. Hoppe-Seyler 378,759-768. Chattopadhyay, N., Baum, M., Bai, M., Riccardi, D., Hebert, S. C., Harris, H. W., and Brown, E. M. (1996a). Ontogeny of the extracellular calcium-sensing receptor in rat kidney. Am. J. Physiol. 271, F736-F743. Chattopadhyay, N., Mithal, A., and Brown, E. M. (199613). The calcium-sensing receptor: A window into the physiology and pathophysiology of mineral ion metabolism. Endocr: Rev. 17,289-307. Chattopadhyay, N., LBgradi, G., Bai, M., Kifor, O., Ye, C., Vassilev, P. M., Brown, E. M., and Lechan, R. M. (1997a). Calcium-sensing receptor in the rat hippocampus: A developmental study. Deu. Bruin Res. 100,13-21. Chattopadhyay, N., Ye, C., Singh, D. P., Kifor, O., Vassilev, P. M., Sinohara, T., Chylack, T., Jr., and Brown, E. M. (1997b). Expression of extracellular calcium-sensing receptor by human lens epithelial cells. Biochem. Biophys. Res. Commun. 233, 801-805. Chattopadhyay, N., Cheng, I., Rogers, K. V., Riccardi, D., Hall, A., Diaz, R., Hebert, S. C.,
60
EDWARD M. BROWN et a1
Soybel, D. I., and Brown, E. M. (1998a). Identification and localization of extracellular Ca2+-sensingreceptor in rat intestine. Am. J. Physiol. 274, G122-G130. Chattopadhyay, N., Ye, C., Vassilev, P M.., Nishimura, R., and Brown, E. M. (1998b). Expression of extracellular calcium-sensing receptor in rat oligodendrocytes: Evidence for its role in proliferation and opening of Ca2+-activatedK+channels. Glia (in press). Chen, C., Barnett, J.,Congo, D., and Brown, E. M. (1989). Divalent cations suppress 3’,5’adenosine monophosphate accumulation by stimulating a pertussis toxin-sensitive guanine nucleotide-binding protein in cultured bovine parathyroid cells. Endocrinology (Baltimore) 124,233-239. Cheng, I., Klingensmith, M. K., Chattopadhyay, N., Butters, R. R., Soybel, D. I., and Brown, E. M. (1998). Identification and localization of the extracellular calcium-sensing receptor in human breast. J. Clin. Endocrinol. Metab. 83,703-707. Chou, Y.-H., Brown, E. M., Levi, T., Crowe, G., Atkinson, A., Amqvist, H., Toss, G., Fuleihan, G., Seidman, J. G., and Seidman, C. E. (1992). The gene responsible for familial hypocalciuric hypercalcemia maps to chromosome 3q in four unrelated families. Nut. Genet. 1,295-300. Chou, Y.-H., Pollak, M. R., Brandi, M., Toss, G., Arnqvist, H., Atkinson, A., Papapoulos, S., Marx, S. J., Brown, E. M., Seidman, J. G., and Seidman, C. E. (1995). Mutations in the human Ca2+-sensingreceptor gene that cause familial hypocalciuric hypercalcemia.Am. J. Hum. Genet. 66,1075-1079. Clemens, T., McGlade, S.,Garrett, K., Craviso, G., and Hendy, G. N. (1989). Extracellular calcium modulates vitamin D-dependent calbindin-D28k gene expression in chick kidney cells. Endocrinology (Baltimore) 124,1582-1584. Cole, D. E. C., Peltekova, V. D., Rubin, L. A., Hawker, G. A., Vieth, R., Hwang, D., Evroski, J., and Hendy, G. N. (1997). Genetic determinants of serum calcium concentration: Potential roles for the A986S and R990G polymorphisms of the calcium-sensing receptor (CASR) gene. J. Bone Miner. Res. 12 (Suppl. 11, S257 (Abstr. No. T621). Conigrave, A. D., Poronnik, P. P. K., Delbridge, L., Young, J.A., and Cook, D. I. (1993). An inwardly rectifying K+ channel in human adenomatous parathyroid cells. Cell Calcium 14,517-523. Conklin, B., and Bourne, H. (1994). Marriage of the flytrap and the serpent. Nature (London) 367,22. Dascal, N. (1987). The use of Xenopus oocytes for the study of ion channels. CRC. Crit. Rev. Biochem. 22,317-387. Davies, M., Adams, P., Lumb, G., Berry, J., and Loveridge, N. (1984). Familial hypocalciuric hypercalcemia: Evidence for continued enhanced renal tubular reabsorption of calcium following total parathyroidectomy. Acta Endocrinol. (Copenhagen) 106, 499-504. Delamere, N. A., and Paterson, C. A. (1981). In “Mechanisms of Cataract Formation in the Human Lens” (G. Duncan, ed.), pp. 219-236. Academic Press, New York. De Luca, F., Ray, K., Mancilla, E. E., Fan, G.-F., Winer, K. K., Gore, P.,Spiegel, A. M., and Baron, F. (1997). Sporadic hypoparathyroidism caused by de novo gain-of-function mutations of the Ca2+-sensingreceptor. J. Clin. Endocrinol. Metab. 82,2710-2715. De RouEgnac, C., and Quamme, G. A. (1994). Renal magnesium handling and its hormonal control. Physiol. Rev. 74,305-322. Diaz, R., Hunvitz, S., Chattopadhyay, N., Pines, M., Yang, Y., Kifor, O., Einat, M., Butters, R. R., Hebert, s.C., and Brown, E. M. (1997). Cloning, expression and tissue localization of the calcium-sensing receptor in the chicken (Gallus domesticus). Am. J. Physiol. 273, R1008-R1016. Duncan, G., and Bushell, A. R. (1975). Ion analyses of human cataractous lenses. Exp. Eye Res. 20,223-230.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
61
Emanuel, R. L., Adler, G. K., Kifor, O., Quinn, S. Q., Fuller, F., Krapcho, K., and Brown, E. M. (1996). Ca2+-sensingreceptor expression and regulation by extracellular calcium in the AtT-20 pituitary cell line. Mol. Endocrinol. 10,555-565. Eskert, R., Scherubl, H., Petzelt, C., Friedhelm, R., and Ziegler, R. (1989). Rhythmic oscillations of cytosolic calcium in rat C-cells. Mol. Cell. Endocrinol. 64,267-270. Fajtova, V., Quinn, S., and Brown, E. M. (1991). Cytosolic calcium responses of single rMTC 44-2 cells to stimulation with external calcium and potassium. Am. J. PhysioZ. 261, E151-158. Fan, G., Goldsmith, P. K., Collins, R., Dunn, C. K., Krapcho, K. J., Rogers, K. V., and Spiegel, A. M. (1997). N-linked glycosylation of the human Ca2+receptor is essential for its expression at the cell surface. Endocrinology (Baltimore) 138,1916-1922. Finegold, D. N., Armitage, M. M., Galiani, M., Matise, T. C., Pandian, M. R., Perry, Y.M., Deka, R., and Ferrell, R. E. (1994). Preliminary localization of a gene for autosomal dominant hypoparathyroidism to chromosome 3q13. Pediatr. Res. 36,414-417. Firsov, D., Aarab, L., Mandon, B., Siaume-Perez, S., Rouffignac, S. D., and Chabardes, D. (1995). Arachidonic acid inhibits hormone-stimulated CAMPaccumulation in the medullary thick ascending limb of the rat kidney by a mechanism sensitive to pertussis toxin. Pfluegers Arch. 429,636-646. Fliegel, L., Ohnishi, M., Carpenter, M. R., Khanna, V. K., Reithmeier, R. A. F., and MacLennan, D. H. (1987). Amino acid sequence of rabbit fast-twitch skeletal muscle calsequestrin from its cDNA and peptide sequencing. Proc. Natl. Acad. Sci. U.S.A. 84, 1167-1171. Foley, ‘I! Jr., , Harrison, H., Arnaud, C., and Harrison, H. (1972). Familial benign hypercalcemia. J. Pediatr. 81,1060-1067. Fried, R., and Tashjian, A. J. (1986). Unusual sensitivity of cytosolic free Ca2+to changes in extracellular Ca2+in rat C-cells. J. Biol. Chem. 261,7669-7674. Friedman, P., and Gesek, F. (1995). Cellular calcium transport in renal epithelia: Measurement, mechanisms, and regulation. Physiol. Rev. 75,429-471. Galkin, B. M., Feig, S. A,, Patchefsky, A. S., Rue, J. W., Gamblin, W. J., Jr., Gomez, D. G., Marchant, L. M. (1977). Ultrastructure and microanalysis of “benign” and “malignant” breast calcifications. Radiology 124, 245-249. Gama, L., Baxendale-Coc, L. M., and Breitwieser, G. E. (1997). Calcium sensing receptors in intestinal epithelium. Am. J. Physiol. 273, C1168-C 1175. Garrett, J. E., Capuano, I. V., Hammerland, L. G., Hung, B. C. P., Brown, E. M., Hebert, S. C., Nemeth, E. F., and Fuller, F. (1995a). Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J. Biol. Chem. 270,1291912925. Garrett, J. E., Steffey, M. E., and Nemeth, E. F. (1995b). The calcium receptor agonist R568 suppresses PTH mRNAin cultured bovine parathyroid cells. J. Bone Miner. Res. 10 (Suppl. l), 387 (abstr.). Garrett, J. E., Tamir, H., Kifor, O., Simon, R. T., Rogers, K. V., Mithal, A., Gagel, R. F., and Brown, E. M. (1995~).Calcitonin-secreting cells of the thyroid express an extracellular calcium receptor gene. Endocrinology (Baltimore) 136,5202-5211. Gill, J. J., and Bartter, F. (1961). On the impairment of renal concentrating ability in prolonged hypercalcemia and hypercalciuria in man. J. Clin. Invest. 40,716-722. Godwin, S. L., and Soltoff, S. P. (1997). Extracellular calcium and platelet-derived growth factor promote receptor-mediated chemotaxis in osteoblasts through different signaling pathways. J. Biol. Chem. 272,11307-11312. Gogusev, J., Duchambon, P, Hory, B., Giovannini, M., Goureau, Y., Sarfati, E., and Drueke, T. (1997). Depressed expression of calcium receptor in parathyroid gland tissue of patients with hyperparathyroidism. Kidney Znt. 51,328-336.
62
EDWARD M.BROWN et al.
Habener, J. (1978). Responsiveness of neoplastic and hyperplastic parathyroid tissue to calcium in uitro. J. Clin. Invest. 62,436-450. Hammerland, L. G., Krapcho, K. J., Alasti, N., Garrett, J. E., Capuano, I. V., Hung, B. C. P., and Fuller, F. (1995). Cation binding determinants of the calcium receptor revealed by functional analysis of chimeric receptors and a deletion mutant. J. Bone Miner. Res. 10 (Suppl. 11,S156 (abstr.). Hammerland, L., Garrett, J., Krapcho, K., Simin, R., Capuano, I., Alasti, N., and Nemeth, E. (1996). NPS R-467 activation of chimeric calcium-metabotropic glutamate receptor and a calcium receptor deletion mutant indicates a site of action within the transmembrane domain of the calcium receptor. J. Bone Miner. Res. 11 (Suppl. l),S158 (Abstr. No. P272). Hartle, J. E. 11, Arthur, J. M., Raymond, J. T., and Quarles, L. D. (1994). Evidence for a cation sensing receptor in osteoblasts coupled to G-protein activation and DNA synthesis. J. Bone Miner. Res. 9 (Suppl. l),S159 (abstr.). Hartle, J. E., 11, Prpic, V., Siddhanti, S. R., Spurney, R. F., and Quarles, L. D. (1996). Differential regulation of receptor-stimulated cyclic AMP production by polyvalent cations in MC3T3-El osteoblasts. J. Bone Miner. Res. 11 (Suppl. 11,789-799. Hawkins, D., Enyedi, P., and Brown, E. M. (1989). The effects of high extracellular Ca2+ and Mg2+concentrations on the levels of inositol1,3,4,5-tetrakisphosphate in bovine parathyroid cells. Endocrinology (Baltimore) 124, 838-844. Heath, D. (1994). Familial hypocalciuric hypercalcemia. In “The Parathyroids” (J.Bilezikian, R. Marcus, and M. Levine, eds.), pp. 699-710. Raven Press, New York. Heath, H., 111, Jackson, C., Otterud, B., and Leppert, M. (1993). Genetic linkage analysis of familial benign (hypocalciuric) hypercalcemia: Evidence for locus heterogeneity. Am. J. Hum. Genet. 53,193-200. Heath, H., 111, Odelberg, S., Jackson, C. E., Teh, B. T., Hayward, N., Larsson, C., Buist, N. R. M., Krapcho, K. J., Hung, B. C., Capuano, I. V., Garrett, J. E., and Leppert, M. F. (1996). Clustered inactivating mutations and benign polymorphisms of the calcium receptor gene in familial benign hypocalciuric hypercalcemia suggest receptor functional domains. J. Clin. Endocrinol. Metab. 81,1312-1317. Hebert, S. C., Brown, E. M., and Harris, H. W. (1997). Role of the Ca2+-sensingreceptor in divalent mineral ion homeostasis. J. Exp. Biot. 200,295-302. Heinemann, U., Lux, H. D., and Gutnick, M. J. (1977). Extracellular free calcium and potassium during paroxysmal activity in cerebral cortex of the rat. Exp. Brain Res. 27,237-243. Hellman, P. P. R., Juhlin, C., Akerstrom, G., Rastad, J., and Gylfe, E. (1992). Parathyroidlike regulation of parathyroid-hormone-related protein release and cytoplasmic calcium in cytotrophoblast cells of human placenta. Arch. Biochern. Biophys. 293, 174-180. Hennings, H., Michael, D., Cheng, C., Steinert, P., Holbrook, K., and Yuspa, S. (1980). Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell (Cambridge, Mass.) 19,245-254. Hjalm, G., Murray, E., Crumley, G., Harazim, W., Lundgren, S., Onyango, I.,Ek, B.,Larsson, M., Juhlin, C., Hellman, P., Davis, H., Akerstrom, G., Rask, L., and Morse, B. (1996). Cloning and sequencing of human gp330, a Ca2+-bindingreceptor with potential intracellular signaling properties. Eur J. Biochem. 239, 132-137. Ho, C., Conner, D. A., Pollak, M. R., Ladd, D. J., Kifor, O., Warren, H., Brown, E. M., Seidman, C. E., and Seidman, J. G. (1995). Amouse model for familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nut. Genet. 11,389-394. Hoff, A. O., Cote, G. J., Fritsche, H. A., Jr., Schultz, P., Khorana, S., Parthasarathy, R.,
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
63
and Gagel, R. F. (1997). An activating mutation of the calcium-sensing receptor creates a new oncogene. J. Bone Miner. Res. 12 (Suppl. l),S143. Honda, Y., Fitzsimmons, R. J., Baylink, D. J., and Mohan, S. (1995). Effects of extracellular calcium on insulin-like growth factor I1 in human bone cells. J. Bone Miner. Res. 10,1660-1665. House, M., Kohlmeier, L., Chattopadhyay, N., Kifor, O., LeBoff, M., Glowacki, J., and Brown, E. M. (1997). Expression of an extracellular calcium-sensing receptor in human and mouse bone marrow cells. J. Bone Miner. Res. 12,1959-1970. Hurwitz, S. (1996). Homeostatic control of plasma calcium concentration. Crit. Reu. Biochem. Mol. Biol. 31,41-100. Hurwitz, S., Bar, A., and Cohen, I. (1973). Regulation of calcium absorption in fowl intestine. Am. J. Physiol. 225, 140-154. Jackson, T. (1991). Structure and function of G protein coupled receptors. Pharmacol. Ther. 50,425-442. Jahr, C. E., and Stevens, C. F. (1993). Calcium permeability of the N-methyl D-aspartate receptor channel in hippocampal neurons in culture. Proc. Natl. Acad. Sci. U.S.A.90, 11573-11577. Janicic, N., Pausova, Z., Cole, D., and Hendy, G. (1995a). De novo expansion of a n Alu insertion mutation of the Ca2+-sensingreceptor gene in familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. J. Bone Miner. Res. 10 (Suppl. 11, s191. Janicic, N., Pausova, Z., Cole, D. E. C., and Hendy, G. N. (1995b). Insertion of a n Alu sequence in the Ca2+-sensing receptor gene in familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Am. J. Hum. Genet. 66,880-886. Janicic, N., Soliman, E., Pausova, Z., Seldin, M. F., Riviera, M., Szpirer, J., and Hendy, G. N. (1995~).Mapping of the calcium-sensing receptor gene (CaSR) to human chromosome 3q13.3-21 by fluorescence in situ hybridization, and localization to rat chromosome 11and mouse chromosome 16. Mamm. Genome 6,798-801. Jin, H. J., Miyaura, C., Tanaka, H., Takito, J., Abe, E., and Suda, T. (1990). Fusion of mouse alveolar macrophages induced by 1-alpha, 25-dihydroxyvitamin D, involves extracellular, but not intracellular, calcium. J. Cell. Physiol. 142,434-439. Juhlin, C., Johansson, H., Holmdahl, R., Gylfe, E., Larsson, R., Rastad, J.,Akerstrom, G., and Klareskog, L. (1987). Monoclonal anti-parathyroid antibodies interfering with a Ca2+-sensor of human parathyroid cells. Biochem. Biophys. Res. Commun. 143, 570-574. Juhlin, C., Klareskog, L., Nygren, P., Ljunghall, S., Gylfe, E., Rastad, J., and Akerstrom, G. (1988). Hyperparathyroidism is associated with reduced expression of a parathyroid calcium receptor mechanism defined by monoclonal antiparathyroid antibodies. Endocrinology (Baltimore) 122,2999-3005. Juhlin, C., Lundgren, S., Johansson, H., Rastad, J., Akerstrom, G., and Klareskog, L. (1990). 500 Kilodalton calcium sensor regulating cytoplasmic Ca2+in cytotrophoblast cells of human placenta. J. Biol. Chem. 266,8275-8280. Kallay, E., Kifor, O., Chattopadhyay, N., Brown, E. M., Bischoff, M. G., Peterlik, M., and Cross, H. S. (1997). Calcium dependent c-myc proto-oncogene expression and proliferation of Caco-2 cells: A role for a luminal extracellular calcium-sensing receptor. Biochem. Biophys. Res. Commun. 232,SO-83. Kanatani, M., Sugimoto, T., Fukase, M., and Fujita, T. (1991). Effect of extracellular calcium on the proliferation of osteoblastic MC3T3-El cells: Its direct and indirect effects via monocytes. Biochem. Biophys. Res. Commun. 181, 1425-1430. Kanazirska, M. P. V., Vassilev, P. M., Ye, C. P., Francis, J. E., and Brown, E. M. (1995). Ex-
64
EDWARD M. BROWN et al.
tracellular Ca2+-activatedK+channels modulated by variations in extracellular Ca2+ in dispersed bovine parathyroid cells. Endocrinology (Baltimore) 136,2238-2243. Kaupmann, K., Huggel, K., Heid, J., Flor, P. J., Bischoff, S., Kickel, S. J., McMaster, C., Angst, C., Bittiger, H., Froestl, W., and Bettler, B. (1997). Expression cloning of GABA, receptors uncovers similarity to metabotropic glutamate receptor. Nature (London) 386,239-246. Khosla, S., Ebeling, P. R., Firek,A. F., Burritt, M. M., Kao, P. C., and Heath, H. 111. (1993). Calcium infusion suggests a “set-point’’abnormality of parathyroid gland function in familial benign hypercalcemia and more complex disturbances in primary hyperparathyroidism. J. Clin. Endocrinol. Metab. 76,715-720. Kifor, O., and Brown, E. M. (1988). Relationship between diacylglycerol levels and extracellular Ca++ in dispersed bovine parathyroid cells. Endocrinology (Baltimore) 123,2723-2729. Kifor, O., Congo, D., and Brown, E. M. (1990). Phorbol esters modulate the high Ca2+stimulated accumulation of inositol phosphates in bovine parathyroid cells. J. Bone Miner. Res. 5,1003-1011. Kifor, O . , Kifor, I., and Brown, E. M. (1992). Effects of high extracellular calcium concentrations on phosphoinositide turnover and inositol phosphate metabolism in dispersed bovine parathyroid cells. J. Bone Miner. Res. 7,1327-1335. Kifor, O.,Moore, F. J., Wang, P., Goldstein, M., Vassilev, P. M., Kifor, I., Hebert, S. C., and Brown, E. M. (1996).Reduced immunostaining for the extracellular Ca2+-sensingreceptor in primary and uremic secondary hyperparathyroidism. J. Clin. Endocrinol. Metab. 81, 1598-1606. Kifor, O., Diaz, R., Butters, R. R., and Brown, E. M. (1997).The Ca2+-sensingreceptor activates phospholipases C, A,, and D by high extracellular Ca2+in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK293)cells. J. Bone. Minel: Res. 12,715-725. Kifor, O., Diaz, R., Kifor, I., and Brown, E. M. (1998). The calcium-sensing receptor is localized in caveolin-rich plasma membrane domains of bovine parathyroid cells. J. Biol. Chem. (in press). Kikeri, D., Sun, A., Zeidel, M., and Hebert, S. C. (1989). Cell membranes impermeable to NH,. Nature (London) 339,478-480. Kobayashi, M., Tanaka, H., Tsuzuki, K., Tsuyuki, M., Igaki, H., Ichinose, Y., Aya, K., Nishioka, N., and Seino, Y. (1997). Two novel missense mutations in calcium-sensing receptor gene associated with neonatal severe hyperparathyroidism. J. Clin. Endocrinol. Metab. 82,2716-2719. Kolakowski, L. F. (1994). GCRDb: A G-protein-coupled receptor database. Recep. Channels 2, 1-7. Kremer, R., Bolivar, I., Goltzman, D., and GN, G. H. (1989). Influence ofcalcium and 1,25dihydroxycholecalciferol on proliferation and proto-oncogene expression in primary cultures of bovine parathyroid cells. Endocrinology (Baltimore) 125,935-941. Law, W., Jr., and Heath, H., I11 (1985). Familial benign hypercalcemia (hypocalciuric hypercalcemia). Clinical and pathogenetic studies in 21 families. Ann. Intern. Med. 105, 511-519. Lisanti, M. P., Tang, Z., Scherer, P. E., Kubler, E., Koleske, A. J., and Sargiacomo, M. (1995). Caveolae, transmembrane signaling and cellular transformation. MoZ. Membr. Biol. 12,121-124. Lopez-Barneo, J.,andkmstrong, C. M. (1983). Depolarizing response of rat parathyroid cells to divalent cations. J. Gen. Physiol. 82,269-294. Lovlie, R., Eiken, H., and Sorheim, H. (1996). The Ca2+-sensing receptor gene (PCAR1)
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
65
mutation T151M in isolated autosomal dominant hypoparathyroidism. Hum. Genet. 98,129-133. Lucke, A., Kohling, R., Straub, H., Moskopp, D., Wassman, H., and Speckmann, E.-J. (1995). Changes of extracellular calcium concentration induced by application of excitatory amino acids in the human neocortex in vitro. Brain Res. 671,222-226. Lundgren, S . , Hjalm, G., Hellman, P., Ek, B., Juhlin, C., Rastad, J., Klareskog, L., Akerstrom, G., and Rask, L. (1994). A protein involved in calcium sensing of the human parathyroid and placental cytotrophoblast cells belongs to the LDL-receptor protein superfamily. Exp. Cell Res. 212,344-350. Mailland, M., Waelchli, R., Ruat, M., Boddeke, H. G. W. M., and Seuwen, K. (1997). Stimulation of cell proliferation by calcium and a calcimimetic compound. Endocrinology (Baltimore) 138,3601-3605. Malgaroli, A., Meldolesi, J., Zambone-Zallone, A., and Teti, A. (1989). Control of cytosolic free calcium in rat and chicken osteoclasts. The role of extracellular calcium and calcitonin. J. Biol. Chem. 264,14342-14349. Mancilla, E. E., De Luca, F., Ray, K., Winer, K. K., Fan, G . 3 , and Baron, J. (1997).ACa2+sensing receptor mutation causes hypoparathyroidism by increasing receptor sensitivity to Ca2+and maximal signal transduction. Pediatr. Res. 42,443-447. M a n , S . J., Attie, M. F., Levine, M. A., Spiegel, A. M., Downs, R. W. J., and Lasker, R. D. (1981a). The hypocalciuric or benign variant of familial hypercalcemia: Clinical and biochemical features in fifteen kindreds. Medicine (Baltimore) 60,397-412. M a n , S . J.,Attie, M. F., Stock, J. L., Spiegel, A. M., and Levine, M. A. (1981b). Maximal urine-concentrating ability: Familial hypocalciuric hypercalcemia versus typical primary hyperparathyroidism. J. Clin. Endocrinol. Metab. 52,736-740. M a n , S . J., Attie, M., Spiegel, A. M., Levine, M., Lasker, R., and Fox, M. (1982). An association between neonatal severe primary hyperparathyroidism and familial hypocalciuric hypercalcemia in three kindreds. N. Engl. J. Med. 306,257-284. Mathias, R., Nguyen, H., Zhang, M., and Portale, A. (1997). Expression of the renal calcium-sensing receptor is reduced in rats with experimental chronic renal insufficiency. J. Bone Miner. Res. 12 (Suppl. 11, S326 (Abstr. No. F400). Matsunami, H., and Buck, L. B. (1997). A multigene family encoding a diverse array of putative pheromone receptors in mammmals. Cell (Cambridge, Mass.) SO, 775-784. Matsuoka, I., Nakahata, N., and Nakanishi, H. (1989). Inhibitory effect of 8-bromo cyclic GMP on an extracellular Ca2+-dependent arachidonic acid liberation in collagenstimulated rabbit platelets. Biochem. Pharmacol. 38, 1841-1847. McGehee, D. S.,Aldersberg, M., Liu, K.-P., Hsuiung, S.-C., Heath, M. J. S., and Tamir, H. (1997). Mechanism of extracellular Ca2+ receptor-regulated hormone release from sheep parafollicular cells. J. Physiol. (London) 502,31-44. McGrath, C., and Soule, H. (1984). Calcium regulation of normal human mammary epithelial cells in culture. In Vitro Cell Deu. Biol. 20,652-662. Membreno, L., Chu, T., Woodley, S., Gagucas, R., and Shoback, D. M. (1989). The effect of protein kinase-C agonists on parathyroid hormone release and intracellular free Ca2+in bovine parathyroid cells. Endocrinology (Baltimore) 124,789-797. Miki, H., Maercklein, P. B., and Fitzpatrick, L. A. (1995). Spontaneous oscillations of intracellular calcium in single bovine parathyroid cells may be associated with the inhibition of parathyroid-hormone secretion. Endocrinology (Baltimore) 136, 29542959. Mithal, A., Kifor, O., Kifor, I., Vassilev, P., Butters, R. R., Krapcho, K. J., Simin, R. R., Fuller, F., Hebert, S. C., and Brown, E. M. (1995). The reduced responsiveness of cultured bovine parathyroid cells to extracellular Ca2+is associated with marked re-
66
EDWARD M. BROWN et al.
duction in the expression of extracellular Ca2+-sensing receptor messenger ribonucleic acid and protein. Endocrinology (Baltimore) 136,3087-3092. Moriarty, T., Sealfon, S., Carty, D., Roberts, J., and Iyengar, R. (1989). Coupling of exogenous receptors to phospholipase C in Xenopus laeuis oocytes through pertussis toxin-sensitive and -insensitive pathways. Cross-talk between heterotrimeric G-proteins. J. Biol. Chem. 264, 13524-13530. Moscat, J., Fleming, T. P., Molloy, C. J.,Lopez-Barahona, M., andAaronson, S.A. (1989). The calcium signal for Balb/MK keratinocyte terminal differentiation induces sustained alterations in phosphoinositide metabolism without detectable protein kinase-C activation. J . Biol. Chem. 264,11228-11235. Muff, R., Nemeth, E. F., Haller-Brem, S., and Fischer, J.A. (1988).Regulation ofhormone secretion and cytosolic Ca2+by extracellular Ca2+ in parathyroid cells and C-cells: Role of voltage-sensitive Ca2+channels. Arch. Biochem. Biophys. 265, 128-135. Nakanishi, S. (1994). Metabotropic glutamate receptors: Synaptic transmission, modulation and plasticity. Neuron 13,1031-1037. Nemeth, E. F. (1995). Ca2+ receptor-dependent regulation of cellular functions. News Physiol. Sci. 10, 1-5. Nemeth, E. F., and Scarpa, A. (1986). Cytosolic Ca2+ and the regulation of secretion in parathyroid cells. FEBS Lett. 203, 15-19. Nemeth, E. F., and Scarpa, A. (1987). Rapid mobilization of cellular Ca2+ in bovine parathyroid cells by external divalent cations. J.Biol. Chem. 202,5188-5196. Nicholson, C., Ten Bruggencate, G., Steinberg, R., and Strokle, H. (1977).Calcium modulation in brain extracellular microenvironment demonstrated with ion-selective microelectrode. Proc. Natl. Acad. Sci. U.S.A. 74, 1287-1290. Nielsen, P. K., Rasmussen, A. K., Butters, R. R., Feldt-Rasmussen, T., Bendtzen, K., Diaz, R., Brown, E. M., and Olgaard, K. (1997). Inhibition of PTH secretion by interleukinl p (IL-1p) in bovine parathyroid glands in vitro is associated with an up-regulation of the calcium-sensing receptor mRNA (CaRmRNA). Biochem. Biophys. Res. Commun. 238,880-885. Nygren, P., Gylfe, E., Larsson, R., Johansson, H., Juhlin, C., Klareskog, L., Akerstrom, G., and Rastad, J. (1988). Modulation of the Ca2+-sensing function of parathyroid cells in vitro and in hyperparathyroidism. Biochim. Biophys. Acta 968,253-260. Oh, B.-H., Pandit, J., Kang, C.-H., Nikaido, K., Gocken, S., Ames, G. F. L., and Kim, S.-H. (1993). Three-dimensional structures of the periplasmic lysine/arginine/ornithine-binding protein with and without a ligand. J. Biol. Chem. 268,11348-11355. O’Hara, l?, Sheppard, P., Thogersen, H., Venezia, D., Haldeman, B., McGrane, V., Houamed, K., Thomsen, C., Gilbert, T., and Mulvihill, E. (1993). The ligand binding domain in metabotropic glutamate receptors is related to bacterial periplasmic binding proteins. Neuron 11,41-52. Owen, W. G., Bichler, J., Ericson, D., and Wysokinski, W. (1995). Gating of thrombin in platelet aggregates by PO,-linked lowering of extracellular Ca2+concentration. Biochemistry 34,9277-9281. Parfitt, A. (1987). Bone and plasma calcium homeostasis. Bone 8 (Suppl. 11, 1-8. Parfitt, A., and Kleerekoper, M. (1980). Clinical disorders of calcium, phosphorus and magnesium metabolism. In “Clinical Disorders of Fluid and Electrolyte Metabolism” (M. Maxwell and C. Kleeman, eds.), 3rd ed., pp. 947-1151. McGraw-Hill, New York. Pearce, S. H. S., Trump, D., Wooding, C., Besser, G., Chew, S., Heath, D., Hughes, I., and Thakker, R. V (1995). Calcium-sensing receptor mutations in familial benign hypercalcaemia and neonatal hyperparathyroidism. J. Clin. Znuest. 96,2683-2692. Pearce, S. H. S., Bai, M., Quinn, S. J., Kifor, O., Brown, E. M., and Thakker, R. V. (1996a).
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
67
Functional characterization of calcium-sensing receptor mutations expressed in human embryonic kidney cells. J. Clin. Invest. 98, 1860-1866. Pearce, S. H. S., Williamson, C., Kifor, O., Bai, M., Coulthard, M. G., Davies, M., LewisBarned, N., McCredie, D., Powell, H., Kendall-Taylor, €?, Brown, E. M., and Thakker, R. V. (199613).A familial syndrome of hypocalcemia with hypercalciuria due to mutations in the calcium-sensing receptor. N. Engl. J. Med. 335, 1115-1122. Percival, R. C., Yates, A. J., and Gray, R. E. (1985). Mechanism of malignant hypercalcemia in carcinoma of the breast. Br. Med. J. Clin. Res. 291,776-779. Perez-Armandariz, E. M., Atwater, I., and Bennett, M. V. L. (1995). Mechanisms for fast intercellular communication within single islet of Langerhans. In “Pacemaker Activity and Intercellular Communication” (J. D. Huizinga, ed.), pp. 305-321. CRC Press, Boca Raton, FL. Perry, Y., Finegold, D., Armitage, M., and Ferell, R. (1994). A missense mutation in the Ca-sensing receptor causes familial autosomal dominant hypoparathyroidism. Am. J . Hum. Genet. 55 (Suppl.), A17 (abstr.). Pietrobon, D., Di Virgilio, F., and Pozzan, T. (1990). Structural and functional aspects of calcium homeostasis in eukaryotic cells. Eur. J. Biochem. 120, 599-622. Pocotte, S., Ehrenstein, G., and Fitzpatrick, L. (1995). Role of calcium channels i n parathyroid hormone secretion. Bone 16, S365-S372. Pollak, M., Brown, E., Chou, Y., Hebert, S., Marx, S., Steinmann, B., Levi, T., Seidman, C., and Seidman, J. (1993). Mutations in the human Ca2+-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell (Cambridge, Mass.) 75, 1297-1303. Pollak, M., Brown, E., Estep, H., McLaine, P., Kifor, O., Park, J., Hebert, S., Seidman, C., and Seidman, J. (1994a). Autosomal dominant hypocalcaemia caused by Ca2+-sensing receptor gene mutation. Nut. Genet. 8,303-307. Pollak, M., Chou, Y., Marx, S., Steinmann, B., Cole, D., Brandi, M., Papapoulos, S., Menko, F., Hendy, G., Brown, E., Seidman, C., and Seidman, J. (1994b). Familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Effects of mutant gene dosage on phenotype. J. Clin. Invest. 93,1108-1112. Pratt, E., Geren, B., and Neuhauser, E. (1947). Hypercalcemia and idiopathic hyperplasia of the parathyroid glands in a n infant. J. Pediatr. (St. Louis) 30,388-399. Prentice, A., Jarjou, L. M. A., Cole, T. J., Stirling, D. M., Dibba, B., and Fairweather-Tait, S. (1995). Calcium requirements of lactating Gambian mothers, effects of a calcium supplement on breast-milk calcium concentration, maternal bone mineral content and urinary calcium excretion. Am. J . Clin. Nutr. 62,58-67. Quamme, G. A., and Dirks, J. (1980). Intraluminal and contraluminal magnesium on magnesium and calcium transfer in the rat nephron. Am. J. Physiol. 238, F187-Fl98. Quamme, G. A. (1982). Effect of hypercalcemia on renal tubular handling of calcium and magnesium. Can. J. Physiol. PharmacoE. 60, 1275-1280. Quarles, D. L., Hartle, J. E., 11, Siddhanti, S. R., Guo, R., and Hinson, T. K. (1997). A distinct cation-sensing mechanism in MC3T3-El osteoblasts functionally related to the calcium receptor. J. Bone Miner. Res. 12,393-402. Quarles, L. D. (1997). Cation-sensing receptors in bone: Anqvel paradigm for regulating bone remodeling? J. Bone Miner. Res. 12,1971-1974. Quinn, S.,Ye, C., Diaz, R., Kifor, O., Bai, M., Vassilev, P. M., and Brown, E. M. (1997). The calcium-sensing receptor: Atarget for polyamines. Am, J. PhysioZ. 273, C1315-C1323. Racke, F. K., and Nemeth, E. F. (1993). Protein Kinase C modulates hormone secretion regulated by extracellular polycations in bovine parathyroid cells. J. Physiol. (London) 468,163-176.
68
EDWARD M. BROWN et al.
Raisz, L., and Niemann, I. (1969). Effect of phosphate, calcium, and magnesium on bone resorption and bone formation in tissue culture. Endocrinology (Baltimore) 85, 446-452. Ray, J. M., Squires, P. E., Curtis, S. B., Meloche, M. R., and Buchan, A. M. J. (1997). Expression of the calcium-sensing receptor on human antral gastrin cells in culture. J . Clin. Invest. 99,2328-2333. Riccardi, D., Park, J., Lee, W.-S., Gamba, G., Brown, E. M., and Hebert, S. C. (1995). Cloning and functional expression of a rat kidney extracellular calcium/polyvalent cation-sensing receptor. Proc. Nutl. Acad. Sci.U.S.A. 92, 131-135. Riccardi, D., Lee, W.-S., Lee, K., Segr6, G. V., Brown, E. M., andHebert, S. C. (1996). Localization of the extracellular Ca2+-sensingreceptor and PTH/FTHrP receptor in rat Kidney. Am. J. Physiol. 271, F951-F956. Riccardi, D., Hall, A., Chattopadhyay, N., Xu, J., Brown, E. M., and Hebert, S. C. (1998). Localization of the extracellular Ca2+/(polyvalentcation)-sensing receptor protein in rat kidney. Am. J. Physiol. 274, F611-F622. Ridefelt, T., Hellman, P., Wallfelt, C., Akerstrom, G., Rastad, J., and Gylfe, E. (1992). Neomycin interacts with Ca2+-sensingof normal and adenomatous parathyroid cells. Mol. Cell. Endocrinol. 83,211-218. Rizzoli, R., and Bonjour, J.-P. (1989). High extracellular calcium increases the production of parathyroid hormone-like activity by cultured leydig cells associated with humoral hypercalcemia. J. Bone Miner. Res. 4,839-844. Rodda, C., Caple, I., and Martin, T. (1992). Role of PTHrP in fetal and neonatal physiology. In “Parathyroid Hormone Related Protein: Normal Physiology and its Role in Cancer” (B. Halloran, and R. Nissenson, eds.), pp. 169-196. CRC Press, Boca Raton, FL. Rogers, K., Dunn, C., Chinn, J., Hebert, S., Soybel, D., and Brown, E. (1995a). Localization of calcium receptor expression of the rat myenteric plexus. Abstr Neurosc. Meet., p. 1634. Rogers, K., Dunn, C., Hebert, S., Brown, E., and Nemeth, E. (1995b). Pharmacological comparison of bovine parathyroid, human parathyroid, and rat kidney calcium receptors expressed in HEK 293 cells. J. Bone Miner. Res. 10 (Suppl. 11, S483 (Abstr. No. T516). Rogers, K. V.,Dunn, C. K., Conklin, R. L., Hadfield, S., Petty, B. A., Brown, E. M., Hebert, S. C., Nemeth, E. F., and Fox, J. (1995~).Calcium receptor mRNA levels in the parathyroid glands and kidney of vitamin D-deficient rats are not regulated by plasma calcium or 1,25-dihydroxyvitamin D3. Endocrinology (Baltimore) 136,499-504. Rogers, K. V., Dunn, C. K., Brown, E. M., and Hebert, S. C. (1997). Localization of calcium receptor mRNA in the adult rat central nervous system by in situ hybridization. Brain Res. 744,47-56. Ruat, M., Molliver, M., Snowman, A., and Snyder, S. (1995). Calcium sensing receptor: Molecular cloning in rat and localization to nerve terminals. Proc. Nutl. Acad. Sci. U.S.A. 92,3161-3165. Ryba, N. J. P., and Trindell, R. (1997). Anew multigene family of putative pheromone receptors. Neuron 19,371-379. Saito, A., Pietromonaco, S., Loo, A. K., and Farquhar, M. G. (1994). Complete cloning and sequencing of rat gp330/”megalin,” a distinctive member of the low density lipoprotein receptor gene family. Proc. Natl. Acad. Sci. U.S.A.91,9725-9729. Sands, J. M., Naruse, M., Baum, M., Jo, I., Hebert, S. C., Brown, E. M., and Harris, W. H. (1997). Apical extracellular calcium/polyvalent cation-sensing receptor regulates vasopressin-elicited water permeability in rat kidney inner medullary collecting duct. J. Clin. Invest 99,1399-1405.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
69
Scherubl, H., Kleppisch, T., Zink, A., Raue, F., Krautwurst, D., and Hescheler, J. (1993). Major role of dihydropyridine-sensitiveCa2+channels in Ca2+-inducedcalcitonin secretion. Am. J. Physiol. 264, E354-E360. Shankar, V. A., Alam, A. S., Bax, C. M., Pazianis, M., Huang, C. L., and Zaidi, M. (1992a). Activation and inactivation of the osteoclast Ca2+receptor by the trivalent cation, La2+.Biochem. Biophys. Res. Commun. 187,907-912. Shankar, V. S., Bax, C. M., Alam, A. S., Bax,B. E., Huang, C. L., and Zaidi, M. (1992b). The osteoclast Ca2+ receptor is highly sensitive to activation by transition metal cations. Biochem. Biophys. Res. Commun. 187,913-918. Shankar, V. S., Pazianis, M., Huang, C. L., Simon, B., Adebanjo, C. A., and Zaidi, M. (1995). Caffeine modulates Ca2+ receptor activation in isolated rat osteoclasts and induces intracellular Ca2+release. Am. J.Physiol. 268, F447-F454. Sharff, A. J., Rodseth, L. E., Spurlino, J. C., and Quiocho, F. A. (1992). Crystallographic evidence for a large ligand-induced hinge-twist motion between the two domains of the maltodextrin binding protein involved in active transport and chemotaxis. Biochemistry 31,10657-10663. Shoback, D., Membreno, L. A., and McGhee, J. (1988). High calcium and other divalent cations in increase inositol trisphosphate in bovine parathyroid cells. Endocrinology (Baltimore) 123,382-389. Siegel, A. M., and Daly, J. W. (1985). Receptor (norepinephrine), P-site (2‘,5’-dideoxyadenosine), and calcium-mediated inhibition of prostaglandin and forskolin-activated CAMPgenerating systems in human platelets. J. Cyclic Nucleotide Protein Phosphorylation Res. 10,229-246. Silver, I. A., Murrils, R. J., and Etherington, D. J. (1988). Microlectrode studies on the acid microenvironment beneath adherent macrophages and osteoclasts. Exp. Cell Res. 175,266-276. Silverberg, S., Bone, H., 111, Marriott, T., Locker, F., Thys-Jacobs, S., Dziem, G., Kaatz, S., Sanguinetti, E., and Bilezikian, J. (1997). Short-term inhibition of parathyroid hormone secretion by a calcium-receptor agonist in patients with primary hyperparathyroidism. N. Engl. J. Med. 337,1506-1510. Simpson, J. B., and Routenberg, A. (1975). Subfornical organ lesions reduce intravenous angiotensin-induced drinking. Brain Res. 88, 154-161. Southgate, J., Hutton, K. A., Thomas, D. F., and Trejdosiewicz, L. K. (1994). Normal human urothelial cells in vitro: Proliferation and induction of stratification. Lab. Invest. 71,583-594. Spiegel, A. M. (1996). Mutations in G protein and G protein-coupled receptors in endocrine disease. J. Clin. Endocrinol. Metab. 81,2434-2442. Stewart,A. F., and Broadus,A. E. (1987). Mineral metabolism. In “Endocrinology and Metabolism” (P. Felig, J. D. Baxter,A. E. Broadus, and L. A. Frohman, eds.), 2nd ed., pp. 1317-1453. McGraw-Hill, New York. Strewler, G. J. (1994). Familial hypocalciuric hypercalcemia-from the clinic to the calcium sensor. West. J. Med. 160,579-580. Sugimoto, T., Kanatani, M., Kano, J., Kaji, H., Tsukamato, T., Yamaguchi, T., Fukase, M., and Chihara, K. (1993). Effects of high calcium concentration on the functions and interactions of osteoblastic cells and monocytes and on the formation of osteoclastlike cells. J. Bone Miner. Res. 8,1445-1452. Suki, W. M., Eknoyan, G., Rector, F. C., Jr., and Seldin, D. W. (1969). The renal diluting and concentrating mechanism in hypercalcemia. Nephron 6,50-61. Takaichi, K., and Kurokawa, K. (1988). Inhibitory guanosine triphosphate-binding protein-mediated regulation of vasopressin action in isolated single medullary tubules of mouse kidney. J. Clin. Invest. 82, 1437-1444.
70
EDWARD M. BROWN et al.
Tam, R., and Saier, M. H., Jr. (1993). Structural, functional, and evolutionary relationships among extracellular solute-binding receptors of bacteria. Microbiol. Rev. 57, 320-346. Tamir, H., Liu, K. P., Aldersberg, M., Hsuiung, S. C., and Gershon, M. D. (1996). Acidification of serotonin-containing secretory vesicles induced by a plasma membrane calcium receptor. J. BioE. Chem. 271,6441-6450. Tordoff, M. G. (1994). Voluntary intake of calcium and other minerals by rats. Am. J . Physiol. 167, R470-R475. Trump, D., Whyte, M. P., Wooding, C., Pang, J. T., Pearce, S. H. S., Kocher, D. B., and Thakker, R. V. (1995). Linkage studies in a kindred from Oklahoma, with familial benign (hypocalciuric) hypercalcaemia (FBH) and developmental elevations in serum parathyroid hormone levels, indicate a third locus for FBH. Hum. Genet. 96, 183-187. Valtin, H. (1983). “Renal Function. Mechanisms Preserving Fluid and Electrolyte Balance in Health.” Little, Brown, Boston. Varrault, A., Pena, M. S., Goldsmith, P. K., Mithal, A., Brown, E. M., and Spiegel, A. M. (1995). Expression of G protein alpha-subunits in bovine parathyroid. Endocrinology (Baltimore) 136,4390-4396. Vassilev, P. M., Ho-Pao, C. L., Kanazirska, M. P., Ye, C., Hong, K., Seidman, C. E., Seidman, J. G., and Brown, E. M. (1997a). Ca,-sensing receptor (CaRbmediated activation of K+ channels is blunted in CaR gene-deficient mouse neurons. NeuroReport 8, 1411-1416. Vassilev, P. M., Mitchel, J.,Vassilev, M., Kanazirska, M., and Brown, E. M. (1997b). Assessment of frequency-dependent alterations in the level of extracellular Ca2+in the synaptic cleff. Biophys. J. 72,l-14. Wang, W.-H., Lu, M., and Hebert, S. C. (1996). Cytochrome P-450 metabolites mediate extracellular Ca2+-inducedinhibition of apical K+ channels in the TAL. Am. J. Physiol. 271,C103-Clll. Weisinger, J. R., Favus, M. J., Langman, C. B., and Bushinsky, D. (1989). Regulation of 1,25-dihydroxyvitamin D, by calcium in the parathyroidectomized, parathyroid hormone-replete rat. J. Bone. Miner. Res. 4,929-935. Whitfield, J. (1995). Calcium as differentiator and killer-colon cells. I n “Calcium in Cell Cycles and Cancer,” (J.Whitfield, ed.), pp. 153-177. CRC Press, New York. Yamaguchi, T., Chattopadhyay, N., Kifor, O., Butters Jr., R. R., Sugimoto, T., and Brown, E. M. (1998a). Mouse osteoblastic cell line (MC3T3-El) expresses extracellular calcium-sensing receptor and its agonists stimulate chemotaxis and proliferation. J. Bone Miner. Res. (in press). Yamaguchi, T., Olozak, I., Chattopadhyay, N. Butters Jr., R. R., Kifor, O., Scadden, D. T., and Brown, E. M. (1998b).Expression ofextracellular calcium (Ca2+)-sensingreceptors in human peripheral blood monocytes. Biochem. Biophys. Res. Commun. 246,501-506. Ye, C., Kanazirska, M., Quinn, S. J., Brown, E. M., and Vassilev, P. M. (1996a). Modulation by polycationic Ca2+-sensing receptor agonists of nonselective cation channels in rat hippocampal neurons. Biochem. Biophys. Res. Commun. 224,271-280. Ye, C., Rogers, K. V., Bai, M., Quinn, S. J., Brown, E. M., and Vassilev, P. M. (199613). Agonists of the Ca2+-sensing receptor (CaR) activate nonselective cation channels in HEK293 cells stably transfected with the human CaR. Biochem. Biophys. Res. Commun. 226,572-579. Ye, C., Ho, C., Kanazirska, M., Quinn, S. J., Rogers, K. V., Seidman, C. E., Seidman, J. G., Brown, E. M., and Vassilev, P. M. (1997a). Calcium-sensing receptor as a target for the actions of amyloid p proteins. J. Neurosci. Res. 47,547-554.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
71
Ye, C., Ho-Pao, C. L.,Kanazirska, M., Quinn, S. J., Seidman, C. E., Seidman, J. G., Brown, E. M., and Vassilev, P. M. (199713). Deficient cation channel regulation by extracellular Ca2+in neurons from mice with targeted disruption of the Caz+-sensing receptor gene. Brain Res. Bull. 44,75-84. Zaidi, M., Datta, H. K., Patchell, A., Moonga, B., and MacIntyre, I. (1989). “Calcium-activated” intracellular calcium elevation: a novel mechanism of osteoclast regulation. Biochem. Biophys. Res. Cornmun. 183, 1461-1465. Zaidi, M., Kerby, J., Huang, C. L., Alam, T., Rathod, H., Chambers, T. J., and Moonga, B. (1991). Divalent cations mimic the inhibitory effect of extracellular ionised calcium on bone resorption by isolated rat osteoclasts: further evidence for a “calcium receptor.’J. Cell Physiol. 149,422-427. Zaidi, M., Shankar, V. S., Alam, A. S. T., Moonga, B. S., Pazianis, M., and Huang, C. L. (1992). Evidence that a ryanodine receptor triggers signal transduction in the osteoclast. Biochem. Biophys. Res. Commun. 188,1332-1336. Zaidi, M., Shankar, V. S., Tunwell, R., Adebanjo, 0.A., Mackrill, J., Pazianis, M., O’Connell, D., Simon, B. J., Rifkin, B. R., and Venkitaraman, A. R. (1995).Aryanodine receptor-like molecule expressed in the osteoclast plasma membrane functions in extracellular Ca2+ sensing. J. Clin. Znuest. 96,1582-1590. Zink-Lorenz, A., Flockerz, V., Freichel, M., Grauer, A., Hafner, M., and Raue, F. F. (1995). Evidence for a “calcium-sensing” receptor in C-cells. J. Bone Miner. Res. 10 (Suppl. 11, S284 (Abstr. No. S533).
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
Peptide Hormones, Steroid Hormones, and Puffs: Mechanisms and Models in Insect Development V. C. HENRICH," R. RYBCZYNSKI,t AND L. I. GILBERT? *Department of Biology, University of North Carolina at Greensboro, Greensboro,North Carolina 27412-5001, and ?Department of Biology, Campus Box 3280 Coker Hall, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280
I. Introduction A. Model Insects for Endocrinological Studies 11. PTTH A. Structure B. The PTTH Transductory Cascade C. PTTH-Stimulated Protein Synthesis 111. Juvenile Hormone (JH) and the Prothoracic Gland IF? Ecdysteroid Action A. Ecdysteroid Regulation of Drosophila Development B. Effect of Ecdysone on Polytene Chromosomes C. Ecdysone Receptor D. Ecdysteroid-Responsive Genes E. Mechanisms for Spatial and Temporal Diversity in the Response to Ecdysone F. Ecdysone Action Involves Interactions with Other Developmental Pathways G. Summary References
I. INTRODUCTION The postnatal physical development of homeothermic animals (birds and mammals) is chiefly a period of increase in size, with a few final touches such as the appearance of secondary sexual characteristics or flight feathers. Perfection of motor and behavioral skills is often the dominant feature of this period. The development of many invertebrates is similar since numerous systems typical of the adult are laid down during embryogenesis. However, other invertebrates, fish, and amphibians exhibit distinctly different adult and preadult morphologies. The metamorphosis of the preadult (larva) into the adult is accomplished by a complex program of gene activity that results in a considerable morphological, physiological, and behavioral re-modeling of the organism (see Gilbert et al., 1996). This restructuring is initiated and coordinated by hormones, the syntheses of which are ultimately controlled by physical and environmental factors, such as size of the or73
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729199$25.00
74
V. C. HENRICH et a1
BRAIN NEUROSECRETORY CELLS
CORPUS ALLATUM
PROTHORACICOT ROPE JUVENILE
HORMONE
WFiMONE
PROTHORACIC GLAND
3-DEHYDROECDYSONE
ECDYSONE
t
PO-HYDROXYECDYSONE
FIG.1.A schematic and simplified representation of the major hormonal axes controlling insect molting and metamorphosis. The term regulation in regard to juvenile hormone synthesis includes a complex series of factors including trophic and static peptides, neuronal input, ecdysone effects, degradative enzymes, and possibly other factors (see text).
PEFTIDE HORMONES, STEROID HORMONES, AND PUFFS
75
ganism and photoperiod (see Bollenbacher and Granger, 1985). Developmental events in insects and other arthropods are triggered by the steroid “molting hormone” 20-hydroxyecdysone (20E). This hormone belongs to a family of related ecdysteroids that controls more of the world’s biomass and a greater number of living species than any other known class of steroid hormones. A surge in the whole body titer of 20E and other structurally related ecdysteroids is associated with embryonic and larval molts. Among insects with distinct larval and adult forms, 20E, prothoracicotropic hormone (PTTH), and juvenile hormone (JH)play central roles in controlling metamorphosis (Fig. 1;see Gilbert et al., 1996). Finally, ecdysteroids and JHs are required for adult reproductive processes. In general, ecdysteroids act as triggers for alterations in transcription, which, in turn, lead t o subsequent cellular and organismal changes. Their action is modified by the J H class of hormones (Fig. 1). The classic paradigm of insect endocrinology states that high ecdysteroid titers in the presence of high J H titers lead to larval-larval molts. High ecdysteroid titers in the absence of J H lead to the metamorphic molt to the pupa and thence to the adult. From the standpoint of hormone action, this central dogma represents a simple example of combinatorial hormonal control, and how these hormones work at the molecular level has been an ongoing subject of investigation. Nevertheless, although the basic tenets of the paradigm have been confirmed in some insect species, notably many of the Lepidoptera (moths and butterflies) including the tobacco hornworm, Manduca sexta, this interactive regulation has not been well documented in the higher Diptera, including the fruit fly, Drosophila melanogaster. In fact, although applied J H analogues disrupt specific aspects of Drosophila development, its normal role in this species remains a matter for conjecture. The prohormone precursor of 20E is synthesized by the prothoracic gland under the control of PTTH. PTTH is produced by two large neurosecretory cells in the lateral region of the brain of moths and butterflies and is released from axon terminals located in a neurohemal organ, the corpus allatum. Additionally, the corpus allatum contains the cells that produce JH. In higher flies such as Drosophila, the prothoracic gland, corpus allatum, and a third structure, the corpus cardiacum, are found together in a composite organ, the ring gland (Dai and Gilbert, 1991). The large polyploid cells of the paired prothoracic glands synthesize the prohormone 3-dehydroecdysone,which is derived from cholesterol, and is rapidly converted by a hemolymph (blood) ketoreductase to ecdysone, which, in turn, is converted in target tissues
A
1
Days After Ecdysls
B
wandering pupariation eclosion
23
1
t
Ag
500 400
2
300-
! i
B w
200 100
a
L
40
-
0 0
60
e
b
c
20
\ 24
embryo1 I L
40
I
72 IIL
I
96 IUL
120 0
24
40
I
PA
72
96 0
I
24
40
72
0
A
Hours
FIG.2. Ecdysteroid titers during the development of Manduca sexta (A) and Drosophila melanogaster (B). In (A), IVL,fourth larval instar; VL,fifth larval instar; PP, prepupal stage; P, pupation; PA, pupal-adult development; A, adult. Lower case letters denote ecdysteroid peaks cited in text. (Modified with permission from Bollenbacher et al., 1981.) In (B), same as in (A) but titers are based on whole animal extractions rather than hemolymph because of the minute size of Drosophila. Eclosion denotes the time of adult escape from remnants of the puparium. (Modified with permission from Riddiford, 1993.)
5z
77
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
to 20E by a monooxygenase system (Warren et al., 1988; see Gilbert et al., 1996). The hormone 20E appears to be the true, active steroidal molting hormone of insects, although ecdysone and other derivatives may possess biological activity.l
A. MODELINSECTS FOR ENDOCRINOLOGICAL STUDIES In D.melanogaster and M. sexta, the two insect species that are the primary focus of this article, ecdysteroid peaks occur during embryogenesis, during each larval stage (instar), and on multiple occasions during and after metamorphosis (Fig. 2). As depicted in the figure, each ecdysteroid peak elicits development change. During the embryonic and larval stages of both species, these peaks are essential for the synthesis of the next instar’s cuticle (exoskeleton) and the subsequent shedding of the older, partially digested cuticle. This sequence of events is termed molting. In the last larval stage, a series of increases in the ecdysteroid titers leads to a variety of coordinated cellular changes that together comprise the process of metamorphosis. However, the specific changes elicited by ecdysone vary widely among insect species. The differences in life cycle and the timing of ecdysteroid peaks evident in these two insects typify the variety that exists among the insect orders. For somewhat different but complementary reasons, Drosophila and Manduca have emerged as important organisms for understanding the molecular basis of the hormonal regulation of molting. In these two model systems, studies centering on the hormonal regulation of developmental events have concentrated on two basic questions. What regulatory factors are responsible for triggering the periodic synthesis of ecdysteroids by the prothoracic gland? What is the mechanistic basis for ecdysteroid action in target tissues, keeping in mind that the response of individual cells to this single hormone varies both temporally and spatially? The tobacco hornworm has several features that are useful for endocrine experimentation. Its large size (up to 8 cm in length and 10 g during the fifth and final instar) eliminates the common problem of obtaining enough insect tissue for physiological and biochemical studies. It is relatively easy, for example, to recover sufficient quantities of
-
lIn this article, 20E is not distinguished from its precursor ecdysone because in many articles and reviews, 20E is simply called ecdysone, the latter being used in a generic sense rather than as the name for a specific steroid. Ecdysteroids here refer to the collection of endogenous steroids structurally related to ecdysone and including ecdysone. Detailed discussions concerning functional and structural differences among the individual ecdysteroids are available elsewhere (Henrich and Brown, 1995;Lafont, 1997).
78
V. C. HENRICH et al.
ecdysteroids and JHs that individual molecular species can be characterized in a rigorous manner (e.g.,Warren and Gilbert, 1986).Moreover, the life cycle staging of Manduca can be controlled and synchronized, and this has led to the assembly of an exact development profile of hormone titers (Fig. 2) and their developmental consequences. The reproducibility of these titer peaks enables experimental studies of the events that precede and elicit them. This attribute, in turn, has facilitated the identification of factors, notably PTTH, responsible for the stimulation of ecdysteroid synthesis by the prothoracic gland. The results of these ongoing studies suggest general mechanisms by which organisms regulate steroidogenesis and overall hormone titers, including feedback mechanisms. With respect to the regulation of the ecdysteroid titers, studies with Drosophila have been less abundant and systematic, although recent investigations have begun t o yield the experimental tools necessary for the full exploitation of Drosophila’s genetic technology. However, although individual larvae can be staged precisely, it is difficult to obtain developmentally homogeneous animal cultures, particularly as the onset of metamorphosis approaches, and this has limited progress toward the elucidation of mechanisms by which ecdysteroid synthesis is stimulated. In fact, the timing and duration of ecdysteroid titer peaks in third-instar Drosophila larvae (Fig. 2B) has not been established unequivocally. The advantages of Drosophila derive from the ability to produce mutant and transgenic strains that can be studied in a well-understood developmental framework. Over the past several years, mutations for genes involved in both the regulation and response of ecdysone-induced events have been recovered and studied. Some encode proteins whose vertebrate homologues perform similar functions, whereas others define novel genes for which no connection with hormonal regulation in other systems has yet been noted. It is hypothesized that mutational screens will result in the identification of novel genes that affect hormonal regulation in Drosophila and will lead ultimately to the further elucidation of hormonal regulation in other species, including vertebrates. Transgenic strains designed to assess the dynamics of ecdysteroid response have also been constructed and tested, based on predictions and insights from earlier studies. The relative simplicity of the Drosophila endocrine system and the well-defined response of Drosophila tissues to ecdysone establish a solid foundation for precise mechanistic studies whose developmental outcome is readily ascertained. As will be noted later, the most important advantage of Drosophila for hormonal studies is something of a biological happen-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
79
stance, namely, it is possible to visualize the transcriptional effects of ecdysone on giant chromosomes. This review is devoted for the most part to those events associated with the stimulation of ecdysone synthesis, that is, PTTH structure and activity, and especially to the effect of ecdysone on target cells, particularly at the molecular level.
11. PTTH A. STRUCTURE In 1922, the Polish biologist Stefan Kopek demonstrated that the brain controlled the larval-pupal molt (metamorphosis) of the gypsy moth Lymantria dispar in a way that was independent of nervous connections (Koped, 1922).Using the now primitive techniques of larval ligation and brain extirpation he demonstrated that the brain released a factor into the hemolymph required for normal molting. This was the first demonstration that hormones can originate in nervous tissue, that is, the beginning of the field of neuroendocrinology. Several subsequent decades of research revealed that the control of molting and metamorphosis was exerted by ecdysteroids synthesized by the prothoracic gland under the control of KopeC’s brain factor. Agui et al. (19791, using microdissection of the brain of the tobacco hornworm M.sexta and an in uitro assay, demonstrated that the site of PTTH production is two pairs of large lateral neurosecretory cells that transport PTTH down their axons to the release site in the corpus allatum (see Gilbert et al., 1996). Release of PTTH from the axon terminals appears to be under the proximate control of muscarinic acetylcholinergic neurons (Shirai et al., 1994);involvement of nicotinic neurons, perhaps via sensory system input, may also be possible (Lester and Gilbert, 1987). The purification of PTTH extended over several decades and proved to be a labor-intensive task fraught with difficulties and frustrations, and requiring millions of silkworm (Bombyx mori) brains (see Ishizaki and Suzuki, 1992). Only in 1991 has an amino acid sequence of a purified PTTH been obtained (Kataoka et al., 1991).After this monumental protein purification effort, the isolation of cDNA and genomic clones and the development of antibodies was accomplished quickly (see Ishizaki and Suzuki, 1994). Analysis of purified Bombyx PTTH and its cDNA and genomic clones indicated that as in the case of many polypeptide hormones, PTTH is
80
V. C. HENRICH et al.
synthesized as a precursor molecule (224 amino acids) that undergoes intracellular processing t o a final secreted size (109 amino acids) (see Ishizaki and Suzuki, 1994). The mature protein appears to be a homodimer containing intra- and intermolecular disulfide bonds (Fig. 3A), and the intramonomeric folding controlled by these bonds is critical for bioactivity (Ishibashi et al., 1994).The amino acid sequence contains also a potential glycosylation site (Kawakami et al., 1990).The observed difference in molecular weight between that deduced from the amino acid sequence (monomer 12.5 kDa) and that observed on reducing sodium dodecyl sulfate (SDS) gels (monomer - 16.5 kDa) is consistent with glycosylation. However, bioactive FTTH can be expressed in Escherichia coli, suggesting that glycosylation is not absolutely necessary for activity, at least in the bioassay utilized (Kawakami et al., 1990). Sequence analysis indicates that processing of the precursor might generate two additional smaller peptides (- 2 and 6 kDa), and it has been speculated that these peptides could act in a paracrine manner to modulate the activity of some cells endogenous to the corpus allatum, such as those involved in J H synthesis (Ishizaki and Suzuki, 1992). cDNAs for PTTHs from two other lepidopterans have been now obtained: Antheraea pernyi (Sauman and Reppert, 1996) and Samia cynthia (Ishizaki and Suzuki, 1994).As in the case of Bombyx PTTH, Antheraea and Samia PTTH sequences begin with a probable signal sequence and the mature peptides contain putative N-glycosylation sites. The three PTTHs exhibit only modest amino acid identity for the preprocessed (47-66%) and mature forms (46 to 60%: Fig. 3B). However, other sequence characteristics are well conserved. For instance, the cysteines involved in intra- and intermonomer cross-linking of Bombyx PTTH are conserved in the Antheraea and Samia sequences, suggesting very similar folding patterns (Figs. 3A and 3B). Similarly, the arrangement of amino acid types (acidic,basic, nonpolar, uncharged polar) is well conserved among the three sequences. For example, the locations of basic amino acids in the two-thirds of the sequences are closest to the carboxy end (Fig. 3 0 . Finally, the overall hydrophilic character of all three sequences is interrupted by two hydrophobic regions, one occurring in approximately the middle of the proteins and the other just before the carboxy terminus (Fig. 3D). This strong structural similarity among lepidopteran PTTHs does not result, however, in proteins that are active across lepidopteran species (e.g., Gray et al., 1994; Gilbert et al., 1996; R.Rybczynski and L. I. Gilbert, unpublished observations), indicating that the primary amino acid sequence is critical to bioactivity. Several short regions of the sequences aligned in Fig.
-
-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
81
3B are quite dissimilar at the amino acid level and might well be involved in species-specific receptor binding. PTTH activity has been demonstrated in extracts of brains from other insect species, including Drosophila (Kim et al., 1997) and the tobacco hornworm (M. sexta), the latter being perhaps the most well studied insect at the endocrinological level. Despite considerable effort, the relationships between the PTTHs of these other species remains conjectural. A Manduca PTTH has been isolated and partially sequenced by Muehleisen et al. (1993) but the sequence obtained showed no similarity to the lepidopteran PTTHs discussed earlier. Instead, it was homologous to members of the cytosolic retinoic acid binding protein family. Complicating the subject are the findings that immobilized monoclonal antibodies against Bombyx PTTH can remove PTTH activity fromManduca brain homogenates (Rybczynskiet al., 1996) and that polyclonal antibodies against Bombyx PTTH can block the action of Manduca PTTH in vitro (R. Rybczynski and L. I. Gilbert, unpublished observations). These latter data suggest that Manduca PTTH is indeed similar to other described lepidopteran PTTHs even though bioactivity is species-specific.Species-specificitymay depend on tertiary structure or species-specificprimary domains. In the Drosophila nervous system, cells reactive to Bombyx:PTTH antibodies have been described (Zitiian et al., 19931, but a biochemical characterization of semipure Drosophila PTTH suggests that the fly PTTH is a much larger protein (- 45 kDa) than the demonstrated lepidopteran PTTHs and that extensive glycosylation is needed for activity (Kim et al., 1997). This observation contrasts with the finding of significant Drosophila PTTH activity at a low (I 10 kDa) as well as a high ( 2 10 kDa) molecular weight (Henrich, 1995). Drosophila PTTH also differs from lepidopteran PTTHs in that a significant fraction of PTTH activity appears to be located outside the brain, in the ventral ganglion (Henrich et al., 1987; Henrich, 1995). The issue is further confused by the observation that the prothoracic glands of the blood-sucking hemipteran Rhodnius can be stimulated to produce ecdysteroids by apparently physiological doses of either Bombyx brain extracts or recombinant Bornbyx PTTH (Vafopoulouand Steel, 1997). How the PTTH receptor of the Rhodnius prothoracic gland recognizes a PTTH from an insect as taxonomically and evolutionarily distant as a moth, while the PTTH receptors from various moths apparently recognize only their conspecific PTTH, is unknown. Partially characterized ecdysiotropic molecules will not be discussed here. These comprise smaller molecules (< 10 kDa) than the PTTHs already considered and include (1)the brain-derived “small P T T H of
82
V. C. HENRICH et al.
B
101 1QI
1 s
FIG.3. Characteristics and comparisons of lepidopteran PTTHs. Only the sequences of the mature monomer are shown. Dashes indicate gaps necessary to align the three sequences. (A) Predicted location of intra- and intermonomer disulfide bonds (indicated by cross-hatched lines). The double-headed arrow indicates the location and attachment of the second subunit in the mature PTTH homodimer. (Redrawn after Ishibashi et al., 1994.) (B) Comparison of deduced amino acid sequences among the three PTTHs. Conserved amino acids are boxed. The arrow indicates the location of the intermonomeric disulphide bond, and the closed triangles indicate cysteines involved in intrasubunit bonds. (C) Comparison of amino acid charge characteristics among the three F’TTHs. (D) Predicted hydrophobic and hydrophilic regions in the three moth PTTHs.
Munduca, which activates ecdysteroidogenesis in larval but not pupal prothoracic glands (Bollenbacher et al., 1984);(2) bombyxin, which was isolated from Bombyx based on its ability to stimulate ecdysteroido-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
83
C
P =Non-polar $$$ = Uncharged polar
= Acidic = Basic
D
increasing hydrophiiicity
Increasing hydrophobicity
FIG.3. Continued
genesis in the moth Samia, but which is inactive in Bombyx (see Ishizaki and Suzuki, 1992);and (3) gut-derived molecules from several moths species, whose natural release into the hemolymph is problematic (Gelman and Bell, 1995). Other tissues can also be ecdysteroidogenic, particularly gonads, and ecdysiotropic proteins for these tissues have also been demonstrated (e.g., Wagner et al., 1997). Also intriguing is the finding that the synthesis of ecdysteroids by tick (noninsect) integument is stimulated by a central nervous system extract or by manipu-
84
V. C. HENRICH et al
lation of cyclic AMP (CAMP)levels (see later) in a manner reminiscent of the PTTH-prothoracic gland axis (Lomas et al., 1997).
B. THEPTTH TRANSDUCTORY CASCADE 1. CAMP and Protein Kinase A The neurohormonal stimulation of ecdysteroid synthesis by the prothoracic gland has proven to be analogous to the regulation of the vertebrate adrenocorticotropic axis. In fact, the importance of CAMP as the second messenger mediating the steroidogenic response to peptide hormones is now well established in both insect and vertebrate experimental systems. Early studies of the Manduca prothoracic gland revealed a correlation between ecdysteroid production and cAMP levels (Vedeckis et al., 1976). Subsequently, using an in uitro assay, Smith et al. (1984)found that PTTH evoked rapid increases in larval prothoracic gland CAMPlevels (detectable in < 5 min). [Note that the in uitro assay consisted of using one prothoracic gland as the experimental (receiving PTTH, CAMP,etc.) and the contralateral gland as the control. The amount of ecdysteroid synthesized by each is quantified by radioimmunoassay (RIA) and an activation ratio determined, i.e., the quantity synthesized by the experimental divided by that synthesized by the control gland.] In pupal glands, a similar effect was seen, although it was necessary to use phosphodiesterase inhibitors to counter higher pupal phosphodiesterase levels (Smith and Pasquarello, 1989). PTTH-stimulated increases in prothoracic gland CAMPgeneration and ecdysteroid synthesis are dependent on the influx of external Ca2+,and the data indicate the participation of a Ca2+-calmodulin-dependent adenyl cyclase in the generation of cAMP (Smith et al., 1985; Meller et al., 1988, 1990). This Ca2+ influx occurs apparently via L-type Ca2+ channels, and the release of Ca2+from internal stores does not seem to be involved (Birkenbeil, 1996; Girgenrath and Smith, 1996). How PTTH controls the opening of Ca2+ channels is currently unknown, but Girgenrath and Smith (1996) hypothesize that a PTTH-associated Gs protein could be involved. The nature of the PTTH receptor itself is also conjectural at present. Based on the similarity between the insect PTTH-prothoracic gland axis and various vertebrate systems, for example, the adrenocorticotropin (ACTH)-adrenal (see Stocco and Clark, 1996) or follicle-stimulating hormone-luteinizing hormone (FSH-LH)-gonadal axes, one could speculate that the PTTH receptor is a glycosylated protein that traverses the plasma membrane seven times and links with G proteins via a cytoplasmic loop domain (Mountjoy et al., 1992; Heckert and Griswold, 1993; McFarland et al., 1989).
85
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
Likewise, the PTTH receptor may be internalized via the coated pit pathway and ligand binding may increase the rate of receptor internalization, as reported for the LH receptor (Ghinea et al., 1992). The expression of the putative PTTH receptor in the prothoracic gland may vary developmentally, with lowest levels seen at times when ecdysteroid production must be maintained at minimum levels. In Bombyx for instance, Gu et al. (1996) found that at the beginning of the last larval stage, when the hemolymph ecdysteroid titer is naturally low, glands fail to respond to PTTH, although they can be activated with CAMPanalogs, that is, it appears that PTTH receptors are absent from the prothoracic gland at this time. However, the situation is complicated by species-specificdevelopmental nuances. In contrast with Bombyx, a t the equivalent period in Manduca, prothoracic glands respond readily to PTTH with increased ecdysteroid synthesis (Smith and Pasquarello, 1989; Rybczynski and Gilbert, 1994). The PTTH-stimulated generation of CAMPin prothoracic glands results in rapid activation of a CAMP-dependentprotein kinase A (PKA), - 90% of maximum within 5 min (Smith et al., 1986). The proteins phosphorylated directly by PTTH-activated PKA in the prothoracic glands are not known, and given the complexity of phosphorylation cascades in most cells, it seems likely that PTTH stimulation results in the activation of several additional kinases (see later). Regardless of the probable complexity of phosphorylation and dephosphorylation events in the PTTH transductory cascade, it is clear that PKA plays a pivotal role since PTTH-stimulated ecdysteroid synthesis is inhibited when either larval or pupal prothoracic glands are incubated with PKA inhibitors (Watson et al., 1993; Smith et al., 1996).A number of PTTH- or CAMP-dependent protein phosphorylations have been observed in the prothoracic gland (e.g., Rountree et al., 1987, 1992; Combest and Gilbert, 1992; Song and Gilbert, 1994). The most obvious and consistent PTTH-stimulated phosphorylation involves a protein of 34 kDa (p34), the identity and function of which is addressed later. Outside of the Lepidoptera, little research has been conducted to elucidate putative PTTH transductory events. As in Manduca, the ability of Drosophila ring glands to be stimulated by neural extracts in uitro is dependent on external Ca2+,but the CAMPanalogues that stimulate a robust steroidogenic response from Manduca prothoracic glands show minimal effects on Drosophila ring glands (Henrich, 1995). It is possible that PTTH transduction in the fly involves a different pathway than that in lepidopterans. However, understanding the effects of Drosophila PTTH is hindered by confusion as to the size of the molecule (see earlier) and the fact that the Drosophila prothoracic gland is part of the
-
86
V. C. HENRICH et al.
ring gland, which contains several endocrine glands and multiple cell types. Thus, it is unclear in experiments with ring glands whether or not ecdysteroidogenesis by the prothoracic gland cell is affected directly or indirectly by a treatment, even in in uitro situations. Numerous mutations that impair ecdysteroid synthesis and/or the development of the ring gland have been catalogued, the most widely studied being ecdysoneless (ecd). Mutant larvae that are homozygous for a temperature-sensitive allele die as late larvae at restrictive temperatures. The mutation causes an accumulation of cholesterol derivatives in an in uitro ring gland assay (Warren et al., 19961, and an abnormally high concentration of lipid droplets is found in mutant prothoracic glands (Dai et al., 1991). However, the ecdysoneless mutation poses several difficulties for analysis that may also hold for other ecdysteroid synthesis mutations. First, the conditional mutation (ecdl) inhibits ecdysteroidogenesis only partially so that larvae survive until metamorphosis because they apparently produce a sufficient level of ecdysteroids to elicit early larval molts. Stronger mutations of the ecd locus cause embryonic lethality (Henrich et al., 1993). Second, the mutation exerts pleiotropic effects, notably a disruption of the peripheral neural development that might be an expected phenotypic consequence of signal transduction mutations. Although this leads to the inference that steroidogenic and target cell developmental processes may be functionally connected, it also complicates the interpretation of mutant effects. The precise nature of the ecdysoneless gene’s effects on ecdysteroid synthesis awaits cloning of the ecd gene.
2. Ribosomal Protein S6 The phosphoprotein p34 was hypothesized to be the ribosomal protein S6, a component of the 40s ribosomal subunit, based on molecular weight, subcellular localization, and the observation that S6 phosphorylation in vertebrate cells is often evoked by hormones (see Gilbert et al., 1988). Furthermore, S6 phosphorylation can result in the selective translation of specific mRNAs, a feature that is consistent with the requirement for protein synthesis during PTTH-stimulated ecdysteroidogenesis (see next section). The positive identification of p34 ribosomal S6 was accomplished in two ways. First, PTTH-dependent p34 phosphorylation was blocked by the immunosuppressant rapamycin (Song and Gilbert, 19941, which specificallyinhibits S6 phosphorylation mediated by the 70 kDa S6 kinase (Price et al., 1992). This blockade was also the result of S6 kinase inhibition in the case of the prothoracic gland (Song and Gilbert, 1994). Second, two-dimensional (2-D) gel electrophoresis of ribosomal proteins confirmed the presence of ribosomal
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
87
phosphorylated S6 protein from PTTH-stimulated prothoracic glands and its phosphorylation at up to five sites (Songand Gilbert, 1995).Further, PTTH-stimulated S6 phosphorylation precedes increased ecdysteroidogenesisand its dephosphorylation is congruent with decreased ecdysteroid synthesis (Rountree et al., 1992; Song and Gilbert, 1995). Studies with anti-S6 antibodies revealed that peak S6 protein levels in the prothoracic gland co-occur with the peaks of ecdysteroid production and 2-D polyacrylamide gel electrophoresis (PAGE) analysis showed high levels of S6 phosphorylation in uiuo just preceding these peaks of ecdysteroid synthesis (Song and Gilbert, 1997).Finally, administration of rapamycin in vivo results in a dose-dependent decrease in ecdysteroid titer with an attendant delay in molting (Song and Gilbert, 1994). Phosphorylated S6 presumably controls PTTH-stimulated ecdysteroidogenesisby modulating the translation of a protein whose presence is necessary for increased ecdysteroid synthesis (see following section), a conclusion supported by rapamycin effects on the pattern of PTTH-stimulated protein synthesis (Song and Gilbert, 1995). How S6 phosphorylation controls translation in the prothoracic gland has not been elucidated. However, in vertebrate systems, S6 phosphorylation results in an increased rate of translation initiation and specifically upregulates the translation of mRNAs possessing a polypyrimidine tract at their 5’ transcriptional start (see Ferrari and Thomas, 1994).Known mRNAs possessing such a polypyrimidine tract include some coding for proteins important in translation such as ribosomal proteins and elongation factors (see Ferrari and Thomas, 1994).How phosphorylated S6 produces this selective translation is not entirely clear. Phosphorylated S6 might recognize the polypyrimidine motif itself, affect the affinity of 40s ribosomes for polypyrimidine tract-containing mRNAs, or interact with other proteins that facilitate the translation of such mRNAs (see Ferrari and Thomas, 1994). Analysis of the deduced amino acid sequence of S6 indicates not only the presence of a serine-rich carboxy terminus that is likely to be the site of multiple, S6 kinaseP70-dependentphosphorylations (Song and Gilbert, 19971,but also the presence of five consensus sites for PKA activity (R. Rybczynski and L. I. Gilbert, unpublished observation).However, it is likely that PKA does not phosphorylate S6 directly in uiuo, nor is it likely that it phosphorylates the S6 kinaseP70 directly. Rapamycin is a specific inhibitor of S6 kinasesP70,including the Manduca form (Song and Gilbert, 19941, without activity against P u s . This rapamycin sensitivity also rules out the PTTH-dependent phosphorylation of S6 by a second S6 kinase of higher molecular weight (- 90 kDa)
88
V. C. HENRICH et al.
since this enzyme is likewise unaffected by rapamycin. Thus, it is probable that one or more biochemical steps are interposed between the earliest PTTH-stimulated events (Ca2+influx, CAMPgeneration, and PKA activation) and the activation of the S6 kinaseP70. One possible intermediate in this cascade is phosphatidylinositol-3-OH kinase, which has been shown to activate the S6 kinaseP70 in mammalian cells (Chung et al., 1994) and is expressed in several isoforms, including one that is activated by both a and Py G protein subunits (Stoyanov et al., 1995).Furthermore, this G-protein-activated PI-3K is inhibited by nanomolar concentrations of the inhibitor wortmannin (Stoyanov et al., 1995) and, interestingly, similar concentrations of wortmannin inhibit PTTHstimulated ecdysteroidogenesis (Q.Song and L. I. Gilbert, unpublished observations). However, a simple scenario beginning with receptor activation and continuing with G-protein-release-activation and subsequent PISK (phosphatidylimosito1-3-OHkinase) activation is unlikely since inhibition of PKA results in inhibition of PTTH-dependent ecdysteroidogenesis (Watson et al., 1993; Smith et aZ.,1996). Perhaps PKA regulates PI-3K activation. In support of this speculation is the observation that the deduced amino acid sequence of the mammalian cyclic nucleotide-dependent PI-3K contains several consensus sites for cyclic nucleotide-dependent kinase phosphorylation (R. Rybczynski and L. I. Gilbert, unpublished observation).
PROTEIN SYNTHESIS C. PTTH-STIMULATED It is generally accepted in the case of vertebrates that the stimulation of steroid hormone production by peptide hormones depends on new protein synthesis by the steroidogenic cells (see Stocco and Clark, 1996). That is, when steroidogenic cells are incubated with translation inhibitors, it is not possible to stimulate steroid hormone synthesis above the basal rate. Similarly, protein synthesis, and possibly RNA synthesis, are required for PTTH-stimulated increases in ecdysteroidogenesis in Manduca (Smith et al., 1987; Keightley et al., 1990; Rybczynski and Gilbert, 1995a). In mammals, such observations have resulted in the identification of several labile proteins that are believed to facilitate the delivery and binding of cholesterol to a mitochondria1 P450 enzyme, which is the first and rate-limiting step in vertebrate steroid hormone synthesis (see Stocco and Clark, 1996). In Manduca prothoracic glands, PTTH stimulates specifically the synthesis and/or accumulation of at least three and perhaps as many as seven or eight proteins (Rybczynski and Gilbert, 1994, 1995b, also unpublished observations). This selective increase in translation is likely controlled by
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
89
the PTTH-dependent phosphorylation of the S6 ribosomal protein just discussed. Two of these PTTH-stimulated insect proteins have been identified: one is a p tubulin (Rybczynski and Gilbert, 199513) and the second is a cognate 70-kDa heat-shock protein (hsp7O; Rybczynski and Gilbert, 1995a). Currently, it appears that neither of these two proteins functions directly in the rate-limiting movement or synthesis of an ecdysteroid precursor. Watson et al. (1996) have shown that pharmacologic disruption of the pupal microtubule cytoskeleton can inhibit PTTHstimulated ecdysteroidogenesis but this effect is not seen with larval glands and likely reflects a disturbance of a stage-specific association of the gland's translation apparatus with the microtubule system (R. Rybczynski and L. I. Gilbert, unpublished observations; see also Luby-Phillips,1993).p Tubulins are abundant proteins and participate, via their role as the backbone of microtubules in a wide range of other cellular functions, some of which could contribute to ecdysteroidogenesis. These include linking microtubules to clathrin-coated vesicles (see Pley and Parham, 1993), a possible route for cholesterol uptake, and linking microtubules to mitochondria (Hargreaves and A d a , 1985), and a probable intracellular site in ecdysteroidogenesis that may need to be held in special apposition to another synthesis site, the smooth endoplasmic reticulum. The function of PTTH-stimulated hsp70 synthesis and accumulation is more problematic, and like tubulin, the problem of determining its role(s) in ecdysteroidogenesis is complicated by the wide range of cellular activities in which hsp proteins participate. The time course of PTTH-stimulated hsp7O synthesis is relatively slow compared to the ecdysteroidogenic response (Rybczynski and Gilbert, 1995a). Perhaps hsp70 plays a chaperone role, supporting the tropic effects of PTTH on general protein synthesis (Rybczynski and Gilbert, 1994; see Gilbert et al., 1996).Alternatively or additionally, hsp70 might modulate the assembly of ecdysteroid receptor complexes that undergo stage-specific and ecdysteroid-dependentchanges in abundance and subunit composition in the prothoracic gland (see subsequent section on the ecdysone receptor). An hsp7O has also been identified as the ATP-dependent uncoating enzyme involved in clathrin coated vesicle disassembly (see Pley and Parham, 19931,again suggesting a connection between PTTHstimulated protein synthesis and cholesterol movement. The other proteins whose syntheses are stimulated by PTTH have not been identified. A Manduca homologue of the diazepam binding inhibitor (DBI) is expressed in a number of tissues, including the prothoracic gland (Snyder and Feyereisen, 1993).In vertebrates, this protein
90
V. C. HENRICH et al
increases the conversion of cholesterol to pregnenolone (the rate-limiting reaction in vertebrates), but whether or not DBI controls acute, peptide-hormone-stimulated steroid hormone synthesis is a matter of some controversy (cf. Stocco and Clark, 1996;Amri et al., 1997). DBI mRNA levels in the prothoracic gland are quite low relative to those in nonsteroidogenic organs (Snyder and Feyereisen, 1993),and there appears to be no evidence indicating that PTTH causes rapid increases in DBI translation. However, this does not preclude a role for DBI in some aspect of insect ecdysteroidogenesis, for example, DBI could be crucial to cholesterol movement in basal (nonstimulated) cells. Two other vertebrate proteins are implicated in the acute control of steroid hormone synthesis [steroidogenesis-activator polypeptide (SAP)and steroidogenic acute regulatory WAR): see Stocco and Clark, 19961, and insects might well possess homologues that could regulate the rate-limiting step in PTTH-stimulated ecdysteroid synthesis. StAFt, like DBI, is implicated in increasing the rate of cholesterol conversion to pregnenolone in mammalian steroidogenic cells, and the data suggest strongly that its rapid synthesis is necessary to support rapid increases in steroid hormone synthesis (see Stocco and Clark, 1996). In the mammalian mitochondrion, StAR undergoes rapid posttranslational size processing and phosphorylation that are associated with cholesterol uptake. Evidence points to the possible presence of a StAR protein homologue in Manduca prothoracic glands (R. Rybczynski and L. I. Gilbert, unpublished observations). Analysis of radiolabeled prothoracic gland proteins synthesized during PTTH stimulation revealed the rapid appearance of newly synthesized proteins at the appropriate molecular weights and antibodies against StAR react with Manduca prothoracic gland proteins at these same molecular weights (R. Rybczynski and L. I. Gilbert, unpublished observations). The possibility that the rate-limiting step in ecdysteroid synthesis is controlled by the PTTH-stimulated translation of one or more proteins that have no vertebrate counterpart must also be considered. In vertebrates, the first biochemical step in the production of steroid hormones, the conversion of cholesterol to pregnenolone, is the rate-limiting step (see Stocco and Clark, 1996). In insects, the first reaction is the conversion of cholesterol t o 7-dehydrocholesterol,but this is most probably not the rate-limiting step in ecdysteroid synthesis (Grieneisen et al., 1993).The rate-limiting step in ecdysteroid synthesis may be the movement of 7-dehydrocholesterolfrom the endoplasmic reticulum t o the mitochondrion (Warren and Gilbert, 1996) and could involve an insectspecific protein. Identification of the protein that regulates acute ecdysteroid synthesis and an understanding of the factors that regulate
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
91
FIG.4. Amodel for the action of prothoracicotropic hormone (PTTH) on cells of the prothoracic gland: R, FTTH receptor; a,p, and 7 , G protein subunits; CaM, calmodulin; A.C., adenylyl cyclase; PKA, protein kinase A; PI-3K, phosphatidylinositol-3-OH kinase; S6 k, S6 kinaseP70;pS6, phosphorylated ribosomal protein S6; C, cholesterol; 7dC, 7-dehydrocholesterol; 3dE, 3-dehydrocholesterol; E, ecdysone; 20E, 20-dehydroxyecdysone; EcR, ecdysone receptor. E is converted to 20E by an ecdysone 20-monoxygenase in peripheral, “target” tissues.
92
V. C. HENRICH et al.
its expression will remain a central issue in insect endocrinology because ecdysteroid-regulated gene expression is key to insect development. Figure 4 provides a schematic summary of the known and postulated effects of PTTH on prothoracic gland cells, as already discussed.
111. JUVENILE HORMONE AND
THE
PROTHORACIC GLAND
Juvenile hormones comprise a family of sequiterpenoid hormones produced by the corpus allatum (see Gilbert et al., 1996). At least four juvenile hormones have been identified among the insect orders ( J H I, J H 11, J H 111, and J H bis-epoxide). Additionally, in some species at certain stages, the corpus allatum synthesizes and releases primarily J H acids rather than the methylated JHs. The active J H is characteristic for a given species. For example, J H I and I1 are the predominant JHs among the Lepidoptera, whereas J H I11 appears to be the active hormone in most other orders of insects. J H bis-epoxide is a special case in that it has been found to be synthesized only by the corpus allatum of cyclorapphous flies (the higher Diptera). The control of J H synthesis appears to involve both stimulatory (allatotropins) and inhibitory (allatostatins) small proteins produced by the brain and other tissues (see Gilbert et al., 1996; Rachinsky and Tobe, 1996), but the mode of action of these peptides on the cells of the corpus allatum is not known with certainty. These two classes of molecules may act by eliciting changes in intracellular Ca2+and CAMPlevels in the corpus allatum (see Rachinsky and Tobe, 1996). An understanding of such putative second-messenger events and how they control J H synthesis is confused by apparent differences among species, that is, whether or not a gland synthesizes J H in the absence of allatotropins, as well as by changes in the gland’s responsiveness during development (see Rachinsky and Tobe, 1996). If, via its action on gene activity, ecdysone can be considered the motive force behind molting and metamorphosis, then it may be appropriate to consider J H as the navigator in the journey of insect development. The relative presence or absence of J H determines whether hemolymph ecdysteroid titer surges will elicit a larva-to-larva molt or a metamorphic molt of larva to pupa and then pupa to adult (see Riddiford, 1994). Despite J H s importance in modulating the action of ecdysone, and its demonstrated ability to elicit gene activity in a number of tissues (see Riddiford, 1994), little is definitively known of its intracellular mode of action (see Riddiford, 1996). However, evidence indicates that J H can bind to the insect retinoid X receptor (RXR)
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
93
homologue Ultraspiracle (USP) (Jones and Sharp, 1997; see Section IV,B), a key component of the ecdysone receptor complex. This observation suggests that J H modulation of the effects of ecdysone may occur at the earliest point in the action of ecdysone or involve USP isoforms that are not part of the receptor complex. The complexity and uncertainty in regard to the action of J H at the cellular and molecular levels extends to its effects on the PTTH-prothoracic gland axis and only a few examples are given here. Treatment of lepidopteran larvae with J H or J H analogs can delay or accelerate development, depending on the stage at which it is applied (Safranek et al., 1980).In Manduca, Rountree and Bollenbacher (1986)found that elevated J H levels repress PTTH release from the brain during the early fifth instar, but it is not clear that J H has the same effect on earlier larval stages or in other species (Lonard et al., 1996). For instance, Gu et al. (1997) found that application of J H analogs to early fifth-instar Bombyx larvae had no effect on PTTH release but appeared rather to inhibit the expression of PTTH receptors in the prothoracic gland. Further evidence that PTTH, JH, and ecdysteroids interact in a complex regulatory loop is provided by data indicating that J H synthesis by the corpus allatum of Bombyx is regulated by circulating ecdysteroid levels (Gu and Chow, 1996) and that S6 phosphorylation in Manduca larval glands is diminished by J H in vitro without apparent effect on PTTHstimulated ecdysteroidogenesis (Rountree et al., 1987). IV. ECDYSTEROID ACTION Whereas most of the experimentation concerning the regulation of ecdysteroid production has been performed in Manduca, most of the work on the effects of ecdysone on target tissues, particularly at metamorphosis, has been performed with Drosophila.
A. ECDYSTEROID REGULATION OF DROSOPHILA DEVELOPMENT In D. melanogaster, a single ecdysteroid peak occurs during embryogenesis and each of the first two larval instars, the embryonic peak possibly having a role in “molting.” In contrast to the paucity of research on the embryonic peak, the ecdysteroid peaks that occur in the third (final) instar and during early pupal-adult development have been the subject of intensive study. In the late third instar, a small ecdysteroid peak is believed to simulate wandering behavior (the prewandering peak; d in Fig. 2B) and is followed several hours later by a relatively
94
V. C. HENRICH et a1
large late larval peak (peak e) that, in turn, leads to pupariation. About 8-12 h later, another small prepupal peak occirs (peak f). Finally, the largest ecdysteroid peak occurs about 24 h after pupariation and elicits pupal-adult development (peak g). Major morphological changes begin as peak e reaches its apex, only some of which are described here. The larva becomes sluggish, ceases wandering, and contracts in length, and the outer cuticle hardens into a puparial (prepupal)case. Glue protein is secreted from the salivary gland that attaches the puparium to a dry and safe location. The fat body also produces new proteins in response to this ecdysteroid peak. As the peak recedes abruptly following pupariation, the outer larval cuticle tans and the imaginal discs, nests of undifferentiated cells in the larva, begin to develop adult structures during metamorphosis. About 10 h after the late larval ecdysteroid peak, the smaller, prepupal ecdysteroid peak (fin Fig. 2B) stimulates the deposition of pupal cuticle in the imaginal discs that precedes their differentiation into adult structures, which occurs later in conjunction with the largest ecdysteroid surge of the Drosophila life cycle. This prepupal peak also precedes the histolysis of the salivary gland, the degeneration of specific neurons and the differentiation of adult neurons, and the reorganization and histolysis of several other larval tissues. Larval molting through the five instars of Manduca is also triggered by ecdysteroid titer peaks. Similarly, in the final instar, a “prewandering” ecdysteroid peak reprograms cells that subsequently undergo morphogenetic changes in response to the later pupal ecdysteroid peak. Riddiford (1994) has noted that the reprogramming of epidermal cells that occurs in Manduca is a more typical course for insect metamorphosis than the extensive degeneration and replacement of cells that characterizes the period of the development of the Drosophila outer cuticle. Moreover, there is no true equivalent in Manduca for peaks e and f in Drosophila (see Fig. 2A), and many of the developmental changes that ensue in response to these multiple peaks occur simultaneously in response to the single pupal ecdysteroid peak in Manduca. In fact, the cellular course of metamorphosis in the cyclorapphous flies such as Drosophila is unique compared t o virtually all other insects. The profound and global changes elicited by ecdysteroids during metamorphosis in Drosophila have inspired numerous studies concerning the mode of ecdysteroid action in target cells. The major impetus for these molecular and genetics studies of ecdysteroid action is based on the discovery in the 1950s and 1960s that ecdysone acts directly on the polytene chromosomes in the larval salivary glands of the midge, Chironornus tentans (Clever and Karlson, 1960; see also Beer-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
95
mann, 1952). It was observed that the incubation of salivary glands in a culture medium containing ecdysone led to the appearance of specific expansions (swellings) known as Balbiani rings along the chromosome within a matter of minutes and provided the first experimental demonstration that steroids act directly on gene transcription. Balbiani rings can be considered giant puffs, the latter being areas of intense RNA synthesis and dispersed banding that exhibit a looser and less-ordered internal structure. During the same general period, Becker (1959,1962)observed that the appearance and regression of such chromosomal puffs in the Drosophila salivary gland occurred in a precise pattern during the larval and prepupal periods, suggesting a functional association with the ecdysteroid fluctuations that occur during this same developmental period. B. EFFECTOF ECDYSONE ON POLYTENE CHROMOSOMES The chromosomes of the third instar salivary glands of Drosophila and Chironomus are polytene, having undergone multiple rounds of DNA replication in the absence of cell division. Therefore, individual genes are directly observable under the light microscope because over 1000 copies of each chromosome lie side by side in the nucleus of each salivary gland cell during the final instar, producing a banding pattern that enables identification of gene loci in single squash preparations. In the late 1960s,Ashburner and his colleagues defined the location and timing of salivary gland puffs along the 102 chromosomal subintervals of the Drosophila genome during the developmental period that includes the three ecdysteroid peaks (d, e, and fin Fig. 2B)mentioned earlier. The pattern of appearance for several of the individual puffs is shown in Fig. 5 (Ashburner, 1967,1969)and represents a small sample of the hundreds of puffs that were characterized morphologically. The developmental progression of this pattern is highly coordinated and invariant under controlled conditions. A set of intermolt puffs appear in response to the small prewandering, ecdysteroid peak (d in Fig. 2B), and these regress as a second and larger peak (e in Fig. 2B) occurs during the wandering phase of the third instar. This larger peak also elicits the appearance of new puffs (“early puffs”) that later regress as a wave of late puffs appears. The late puffs generally linger through the formation of the prepupa. About 10 h later, a second wave of early and late puffing occurs in response to a smaller prepupal ecdysteroid peak (fin Fig. 2B) and precedes the histolysis of the salivary gland. During this second wave, some puffs expand, much as they did in the first wave,
96
V. C.HENRICH et al
ECDYSTEROIDLEVELS
Chromosome Location
Gene Product
Homology/ Description
A Time Course of Puff Appearance llOh 115h 120h 125h 130h
INTERMOLT PUFFS 3c 258 68C 900
SgsS
Novel/Glue protein NoveliGiue proteln NoveilGIus protein NovellGiue protein
285
Broad
BTBRinc finger protein
23E 63F 74E-F
E63 E74
75A-B
€75
Novel/ I%++-blndlna protein etr ProtooncogeniTranscription Factor ERRIiNuclear ReceDtor
Sgs4 Sgsl Sgs3,7,8
EARL Y PUFFS
EARL Y-LATE PUFFS 46F 78D
DHR3 E78
Nuclear receptor Nuclear receptor
LATE PUFFS 22C 63E 71E
-1IW
- -
-11111111
L71E
Novel
82F
-111
~*011,1*1..1
IWIII(*HI*II
#1"11*
""40,
STAGESPECIFIC PUFFS 75CD 93F
mi!-F1 E93
SFllNuclear receptor Novel/ Tranrcrlption factor?
-111
I -
FIG.5. Schematic diagram of selected salivary gland puff patterns during late larval and prepupal development in Drosophila. Ecdysteroid peaks shown correspond to peaks e and f i n Fig. 2B. Puff locations 1 through 20 reside on the X chromosome, locations 21-60 reside on chromosome 2, and locations 61-100 reside on chromosome 3. Solid lines indicate times of puff expansion on the polytene chromosome and dashed lines indicate times of puff regression. Based on the data ofAshburner (1967,1969). References for descriptions and homologies, where known, are provided in the text.
but some puffs fail to reappear and others arise that were not present in the earlier wave. When dissected out and placed in culture medium supplemented with ecdysteroids, the salivary glands display a puffing pattern in uitro that resembles the in uivo pattern with 20E being the most potent ecdysteroid (Ashburner, 1971). Further experiments in uitro demonstrated that the early puffs at chromosomal locations 74E-F and 75A-B appear within minutes of treatment with ecdysteroids (Ashburner, 1972), and these puffs fail to regress when translation is inhibited by the addition of cycloheximide to the culture medium (Ashburner, 1974). Moreover, late puffs fail to
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
97
appear as a result of this treatment. These observations form the basis of the Ashburner model, which postulates that ecdysone interacts with an intracellular receptor and when activated by hormone the receptor induces the transcription of “early puff genes. The gene products of these loci subsequently repress their own transcription and activate the transcription of a second class of “late puffs” (Ashburner et al., 1973). The Ashburner model actually accounts for only a subset of puffs within the entire ecdysteroid-induced hierarchy seen in the salivary gland. Other “early puffs” are inhibited by cycloheximide; still other “early-late”puffs appear later than the early puffs but are not affected by cycloheximide treatment. Nevertheless, as many of the puff genes have been cloned, the essential features of the model have been verified. Even some of the puffs that did not easily fit the model at the time now appear to play an essential role in coordinating and modulating the transcriptional hierarchy. With the discovery of nuclear receptors and the general acceptance of steroid hormone action via these transcription factors, new attention has centered on some features of the salivary gland transcriptional hierarchy that have been inaccessible, unexplained, or unexplored. For example, what gene products are synthesized as this hierarchy proceeds in response to ecdysone? How do they relate to subsequent puffing events? How do these changes influence developmental events in the salivary gland and are these events occurring in a variety of other ecdysteroid-responsive tissues? What mechanisms underlie the differences in response seen in the two waves, despite their relatively brief temporal separation? Given the known similarities in the two waves, do these represent highly conserved aspects of response in other Drosophila tissues, at other developmental times, and if so, in other insect species as well? This section delineates the established molecular mechanisms associated with the response to ecdysteroids in salivary glands and also presents some new studies concerned with the unresolved questions just raised.
C. ECDYSONE RECEPTOR 1. Molecular Biology of the Ecdysone Receptor The Ashburner model postulated the existence of an intracellular receptor that has now been identified and characterized. The functional ecdysone receptor in Drosophila and numerous other insects is a heterodimer composed of two nuclear receptor family members, the ecdysone receptor (EcR) and USP (Yaoet al., 1993;Thomas et al., 1993). EcR is an insect homologue of the vertebrate farnesol X receptor (Forman et al., 1995)and USP is homologous to the RXR (Oro et al., 1990).
98
V. C. HENRICH et al.
EcR and both of the vertebrate homologues have been associated with activating ligands (Koelle et al., 1991; Mangelsdorf et al., 1992; Kitareewan et al., 1996). Experiments have indicated that USP has the potential to be a juvenile hormone receptor as well as a component of the ecdysteroid receptor (Jones and Sharp, 1997). If this proves to be true, then a mechanism of combinatorial control between the ecdysteroids and J H mediated by USP is analogous to the modes of control exhibited by RXRs in conjunction with several receptor partners (Mangelsdorf and Evans, 1995). EcR may also have the ability to form heterodimeric partners with other nuclear receptors (Zelhof et al., 1995a; White et al., 1997). EcR and USP belong to the very large nuclear receptor superfamily, and in vertebrates this superfamily can be separated into four divisions based on their DNA-binding characteristics (see Mangelsdorf et al., 1995). Two of these classes are of heuristic value in regard to the functional ecdysone receptor. Class I includes the vertebrate steroid receptors that form homodimers after ligand binding and it is these homodimers that bind DNA and control gene transcription. The ligand-"ready" receptors of class I are not simple monomers but are instead complexes containing additional proteins, including hsp90 and one to several additional proteins, such as hsp70 and immunophilin chaperones p60 and p23, depending on the receptor type (see Pratt and Toft, 1997). Receptor-associated proteins appear to function in the correct folding of the receptor and the presence of hsp90 is required for maintenance of a ligand binding conformation of several of the vertebrate steroid receptors (see Pratt and Toft, 1997). Class I1 receptors are heterodimers in which one subunit is an RXR protein. This group includes the vertebrate receptors for thyroid hormone, all-trans-retinoic acid, vitamin D, and eicosinoids. These receptors are not associated with hsp90 and bind DNA in the absence of ligand. Nonliganded class I1 receptors appear to be neutral or negative in regard to basal gene transcription (see Tsai and O'Malley, 1994; Cherbas and Cherbas, 1996). Classes I11 and IV are orphan receptors, that is, receptors for which no ligand has been identified. Class I11 receptors, such as the insect receptor DHR3 (discussed later), bind DNA as dimers, whereas class IV molecules, such as the insect receptor FTZ-F1 (also discussed later) bind DNA as monomers. Based on a number of features, the ecdysone receptor appears to be a fairly typical member of the class I1 receptor family. Two subunits comprise the functional receptor, EcR, and USP, with the latter being an insect homolog of RXR. Furthermore, EcR-USP bind DNAin the absence of a ligand (e.g., Yao et al., 19921, and evidence suggests that the
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
99
nonliganded receptor can repress the basal transcription of some genes (see Cherbas and Cherbas, 1996). Despite these characteristics, the ecdysone receptor may not be a typical member of the class I1 nuclear receptor family. First, its ligand is a steroid and all vertebrate steroid hormones bind class I homodimeric receptors. Second, Song et al. (1997) have shown that an immunophilin, FKBP46, interacts with the EcR-USP complex in Manduca, and such chaperone molecules have been implicated in the formation or mammalian steroid receptor complexes, which are class I receptors (Pratt and Toft, 1997).Third, at some stages in Manduca, only a fraction of the EcR protein appears to be bound to its heterodimeric partner USP (Song and Gilbert, 1998). It is unclear if this reservoir of EcR is monomeric or homodimeric, is associated with DNA, or is responsible for J H binding (Jones and Sharp, 1997). These composite observations suggest that the functional ecdysteroid complex may be more complicated than originally thought, especially when the diversity of EcR and USP proteins is also considered. The expression of the EcR-encoding gene is regulated dynamically and spans a region of over 70 kilobases (kb) of DNA in Drosophila (Koelle et al., 1991). Its transcript levels fluctuate in concert with each of the ecdysteroid peaks during larval and prepupal development, presumably because the expression of EcR is regulated by ecdysteroids. The EcR gene contains two alternative promoters that result in the production of at least three isoforms through alternative splicing. Consequently, the amino-terminal domains of these isoforms are unique, whereas the DNA-binding and ligand-binding domains are identical. Two of these isoforms have been analyzed in developing tissues with immunostaining using isoform-specific antibodies (Talbot et al., 1993). The A isoform is expressed predominantly in cells that later undergo metamorphosis into adult structures and in the ring gland. By contrast, the B1 isoform is expressed primarily in larval tissues such as the salivary gland, which undergo histolysis during metamorphosis. Within the nervous system, the A isoform is associated with those neurons that persist through metamorphosis but that degenerate shortly after adult emergence (Robinow et al., 1993). The B1 isoform, on the other hand, predominates in neural cells during proliferation and regression (Truman et al., 1994), likely reflecting unique subroles for each isoform in the direction of neural development. Homologues of the EcR-Bl isoform have been identified in a variety of insect species (reviewed by Henrich and Brown, 1995). Also, A isoforms have been identified in M. sexta (Jindra et al., 19961, B. mori (Kamimura et al., 1997), and the mealworm, Tenebrio molitor (Mouillet et al., 1997).At least one cluster of amino acids appears to be high-
100
V. C. HENRICH et al.
ly conserved within the A-isoform-specific transactivation domain among these species. Nevertheless, the clear-cut separation of isoforms to larval and adult cell types observed in Drosophila does not hold generally for other insects. For example, both isoforms are expressed in the larval epidermis of Manduca. Each isoform shows a unique profile through the final two instars of the larval stage, probably because each isoform fulfills specific ecdysteroid-responsive functions to regulate the complex changes that occur in epidermal cells during this time. A similar mixture of EcR isoforms has been observed in the larval epidermis of Thebrio and the silk glands of Bombyx.Therefore, although the isoforms may execute different transcriptional programs, these functions are not necessarily separated spatially in other insects as they are in Drosophila. By comparison with EcR, the transcriptional expression of the ultruspiracle (usp)gene appears to be relatively simple in Drosophila. Transcript levels vary much less during premetamorphic development, although a second, small mRNAin mature ovaries and the earliest stages of embryogenesis has been noted (Khoury-Christianson et al. 1992; Henrich et al., 1994). USP forms heterodimers with DHR38, the Drosophila homologue of the orphan receptor, NGFlB, just as RXR forms heterodimers with NGFlB (Sutherland et al., 1995). The pattern of DHR38’s expression in tissues has not yet been reported, so while this heterodimerization may be important for ecdysteroid responsiveness in some tissues, it may not be relevant in all tissues, including the salivary gland. Obviously, though, the ability of USP and EcR to form dimers with other receptors would affect ecdysone responsiveness whenever it occurs. The usp locus is a single copy gene in Drosophila (Henrich et al., 1990; Oro et al., 1990; Shea et al., 1990). Nevertheless, there is also evidence that multiple forms of USP exist in Drosophila and other insects that leave open the possibility of posttranslational modifications. In other insects, notably Manduca (Jindra et al., 19971, Bombyx (Kamimura et al., 1997), and the mosquito, Aedes (Kapitskaya et al., 1996), multiple usp genes have already been identified. In this respect, the presence of multiple USP-encoding genes describes a situation that more resembles the multiple gene copies of RXR found in vertebrate genomes. The expression of the two usp genes during the last two larval instars of Manduca varies more extensively than does the expression of the single usp gene in Drosophila (Henrich et al., 1994; Jindra et al., 1997). Moreover, each usp form shows a unique pattern of expression during this period. Their expression has been followed in larval epidermal cells of Manduca (Asahina et al., 1997) and reveals a complexity that is remi-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
101
niscent of the EcR isoforms. It follows that each combination of EcR isoforms and USP forms could carry out unique subfunctions in the developing epidermal cell. In Manduca, it is also now known that the two USP gene products exist in both phosphorylated and nonphosphorylated states. Interestingly, the phosphorylated form of USPa becomes predominant in the ecdysteroidogenic prothoracic gland when ecdysteroid titers are elevated. It has been proposed that this conversion represents an important aspect of negative feedback that involves the phosphorylation of USP (Song and Gilbert, 1998). In Drosophila, the occurrence of anomalous USP bands on Western blots has not been explained, and phosphorylation or other forms of posttranslational modification may prove to be important for understanding USP's activity in flies (Henrich et al., 1994).Vertebrate steroid hormone receptors exhibit both basal and ligand-stimulated phosphorylation (see Ortf et al., 1992). Although the functional significance of various receptor phosphorylation states is not completely clear, in some cases the evidence indicates that phosphorylation can regulate receptor-mediated transcription (Denner et al., 1990). Like other steroid hormone receptors, the heterodimeric ecdysone receptor interacts with an enhancer sequence in the promoter of ecdysteroid-regulated genes. Some of these ecdysone response elements (EcREs) have been characterized. Generally, they are palindromic and are composed of two inverted repeats separated by a single nucleotide. The half site sequence is highly variable: PuG(G/T)T(C/G)A (seehtoniewskiet al., 1993).The diversity of EcRE characteristics and their impact on tissue-specific and temporal regulation of the ecdysteroid response is discussed later. Suffice it to say that with multiple EcREs, EcRs, USPs, and perhaps other receptor-associated proteins, insects possess the raw material for constructing subtle, tissue-and stage-specific responses to a single steroid hormone. Clearly, understanding ecdysteroid-dependent events in insects will require a more complete knowledge of the in vivo diversity and dynamics of ecdysone receptors. 2. Effects of Receptor Mutations on Developmental Processes Mutational analysis of EcR and usp mutations has begun to yield important information about the role of ecdysteroids in developmental processes. Isoform-specific mutations of EcR have been generated and recovered. Mutations involving the common exon regions that encode the DNA-binding domain and ligand binding domain of EcR cause embryonic lethality, which is to be expected if the embryonic ecdysteroid peak triggers events necessary for subsequent development. Mutations
102
V. C. HENRICH et al.
within the EcRBl isoform-specific region cause death at the time of entry into metamorphosis and disrupt puffing in the salivary gland. The puffing response is restored only through the transgenic introduction of EcRBl into these mutants, indicating that this isoform alone is sufficient for the normal response of the salivary gland chromosomes (Bender et al., 1997). Three usp mutant alleles have been identified (Perrimon et al., 1985). Because it is a single copy gene in Drosophila, it is possible to relate directly the effects of usp mutations to developmental phenotypes. All of the mutations cause a failure of first instar larval molting, and each one involves a structural disruption of the USP DNA-binding domain; one produces a truncated protein in the DNA binding domain (usp2;Oro et aZ., 1990), whereas the other two (usp3 and usp4) are missense mutations (Henrich et al., 1994). Genetic studies have shown that normal usp function is required maternally for the completion of embryogenesis and, by corollary, that the presence of maternally derived usp transcripts permits survival through the first instar of the resulting progeny (Perrimon et al., 1985). Still, the observation that usp mutations cause first instar lethality, whereas EcR mutations cause late embryonic lethality in the aftermath of the embryonic ecdysteroid peak, raises the possibility that EcR fulfills a vital function during embryogenesis that does not involve USP, particularly since EcR mRNA appears in the earliest stages of embryogenesis and may be also sequestered maternally (Talbot et al., 1993). An alternative candidate partner for EcR during embryonic development is DHR3, since this orphan receptor interacts with EcR in. uitro (White et al., 1997), and mutations of its gene cause embryonic lethality (Carney et al., 1997).As will be noted, DHR3 is also the product of an early-late puff in the salivary gland. For genetic mosaics containing patches of usp mutant tissue, the eyes develop morphological abnormalities that reveal a requirement for normal USP activity. Interestingly, the developmental defects caused by the mutation extend into adjacent, genetically normal tissues, that is, they are nonautonomous (Oro et al., 1992). Mutant usp patches cannot be produced experimentally during embryonic stages (Oro et al., 1992) and a genetically derived deficit of normal USP function during embryogenesis causes wing and leg imaginal discs to develop abnormally at metamorphosis (Henrich et al., 1994). Strangely, usp mutant patches develop normally in the thorax of mosaics even when generated as early as the first larval instar. This suggests that some other receptor performs a USP-redundant function that mediates ecdysteroid responsiveness in mutant cells, but another explanation is that the mutant al-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
103
leles, although lethal in the entire organism, carry enough residual function to permit the survival of mutant patches in an otherwise genetically normal mosaic. In fact, the mutant proteins specified by the lethal mutations usp3 and usp4 retain the ability to heterodimerize with EcR and display a reduced affinity for an EcRE (Henrich et al., 1994). D. ECDYSTEROID-RESPONSIVE GENES 1. Molecular Characterization As the molecular components involved in the salivary gland‘s transcriptional hierarchy have been described and studied, the tenets of the Ashburner model have provided a continuing framework for understanding the course of transcriptional events that occur in response to ecdysone. Several of the intermolt genes expressed in the salivary gland in response to the prewandering ecdysteroid peak (d in Fig. 2B) have been cloned (located at chromosomal positions 3C on the X 25B on chromosome 2; and 68C, 71C, and 90B on chromosome 3) and encode the secreted glue proteins that affix the prepupa for metamorphosis. At least four of the early puff genes, mapped to 2B5 on the X and 63F, 74E-F, and 75A-B on chromosome 3, have also been cloned and characterized. All are relatively large and, except for 63F, encode DNA-binding proteins with multiple isoforms. In this respect, the fact that these “early puff” products have proven to be transcription factors supports the relationship between early and late puff genes described in the Ashburner model. The 2B5 locus is known as the Broad-complex (BR-C; based on mutant wing phenotypes) and encodes a zinc finger protein. The gene encodes at least 13 different isoforms whose expression differs among various tissues. These isoforms carry a common amino-terminal region known as POZ or BTB (Zollman et al., 1994), but include different zinc finger regions (DiBello et al., 1991). The 74E-F locus encodes two isoforms known as E74A and E74B that resemble the human ets protooncogene, a transcription factor (Burtis et al., 1990). Finally, the 75A-B gene encodes an orphan nuclear receptor (E75) that resembles the mammalian estrogen-related receptor (ERR1).The gene spans over 50 kb and encodes at least three isoforms. One of these isoforms, E75B, is missing the first of the two cysteine-cysteine zinc fingers that characterize nuclear receptors and has been postulated to play a dominant negative role in the governance of transcriptional activity (Segraves and Hogness, 1990). All three of the aforementioned puffs are elicited by ecdysone in both
104
V. C. HENRICH et al
the salivary gland and another polytene tissue, the fat body. In fact, these three early puff genes are expressed in a variety of tissues, although the onset of expression is not simultaneous, implying that other factors are necessary for their ecdysteroid inducibility (Huet et al., 1993).By contrast, the 63F early puff is expressed in the salivary gland, but not the fat body, and encodes a calcium-binding protein (Andres and Thummel, 1995). 2. Mutations of “Early Puff‘ Genes Disrupt Ecdysteroid-Responsive ?Fanscription
Mutations of the E74, E75, and BR-C genes have been recovered and tested in a variety of studies for their effects on gene expression and developmental processes. In all cases, the developmental phenotypes evoked by individual mutations depend on whether the structural alterations are isoform-specific or affect common exon regions. For example, mutations of the 2B5 locus fall into one of at least three different complementation groups, reflecting the structural complexity of the gene. Interestingly, mutations of BR-C do not cause death until the late third instar, indicating that this protein plays an essential role a t the time of metamorphosis, but not before (Kisset al., 1988). Molecular characterization and genetic analyses of early puff gene mutations have further established a functional connection between early puff gene products and late puff gene expression. For example, the promoter of a late puff gene L71E contains several BR-C and E74 binding sites and fails to be activated normally in either E74 or BR-C mutants. Promoter activity in double mutants is reduced even further, indicating that the two early puff products act together on L71E promoter activation (Urness and Thummel, 1995; Fletcher and Thummel, 1995).When a specific isoform ( Z l ) of BR-C is introduced transgenically into BR-C mutants, L71E expression is restored in their salivary glands (Crossgrove et al., 1996). The repression of three intermolt puffs (3C, 68C, and 90B) during the late larval ecdysteroid peak also depends on normal function of both BR-C and E74, and mutations of the early puff genes significantly affect the expression of the intermolt genes (Guay and Guild, 1991; D’Avino et al., 1995).However, the transcriptional regulation of the intermolt genes is complex. Within the promoters of both the sgs3 ( 6 8 0 and sgs4 ( 3 0 genes also lie EcR-USP binding sites, thus implicating a role for the ecdysone receptor itself in the control of their expression, and other binding sites have been identified in these promoters which confer tissue specificity (Lehmann and Korge, 1995; Lehmann et al., 1997).
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
105
3. Several Puff Genes Encode Nuclear Receptors Other genes in the salivary gland’s hierarchy have now been cloned based on their chromosomal positions, and unexpectedly, many of these genes encode members of the nuclear receptor superfamily. In fact, at least 7 of the 16 nuclear receptor genes known in Drosophila have been implicated in the regulation of the salivary gland’s ecdysone-inducible puffing hierarchy.Yet, only EcR and, perhaps, USP have so far been associated with an activating ligand. Two early-late puffs at 46F and 78C encoding orphan receptors appear after the early puffs but do not require the early puff gene products for transcription (Koelle et al., 1992; Stone and Thummel, 1993).Mutations of the 78C product (known as E78) do not affect viability, but reduce the size of specific late puffs, suggesting a modulatory role for this receptor (Russell et al., 1996). The product of the early-late puff at 46F, the orphan nuclear receptor DHR3, plays a central role in the orchestration of the ecdysone-inducible hierarchy during the third instar (White et al., 1997)and, as already noted, is required for survival through embryogenesis (Carney et al., 1997).Still another stage-specificpuff appears at 75C-D during the interval between the two puffing waves that encodes the orphan receptor FTZ-F1 (Lavorgna et al., 1991, 1993).The 75C-D gene product was first identified as a transcription factor responsible for the expression of the embryonic segmentation gene, fushi tarazu (ftz). The mammalian homologue of FTZ-F1, steroidogenic factor-1(SF-l), can be activated by oxysterols (Lala et al., 1997)and plays a central role in the development of mammalian steroidogenic and reproductive tissues (Luo et al., 1994) but the potential developmental roles of FTZ-F1 in Drosophila awaits the isolation of mutations of its gene. The mechanistic roles of these orphan receptors in the orchestration and coordination of puffing events is beginning to be unraveled, and the interplay of three of them (E75, DHR3, and FTZ-F1) is illustrated schematically in Fig. 6. DHR3 is expressed later than the early puffs, is present as the early puffs regress, and precedes the appearance of the 75C-D puff. A combination of approaches has demonstrated that DHR3 represses the transcription of the early puff genes at 74E-F and 75A-B, perhaps by replacing USP as EcR’s heterodimeric partner. DHR3 also has the ability to form heterodimers with the single-fingered E75B nuclear receptor (which is of course, the 75A-B early puff product). This complex represses FTZ-F1 transcription, although DHR3 alone increases the rate of transcription at the 75C-D puff. Thus, as E75B titers fall, DHR3 activates 75C-D, and ultimately FTZ-F1 is translated (White et al., 1997).
1
Pupation FIG.6. Regulatory interactions of the ecdysteroid receptor and selected salivary puff gene products. (a)EcR/USP heterodimer increases transcription of early puff genes (2B5, 74E-F, 75A-B, and others); (b) somewhat later, the early-late puff gene at 46F is activated; (c) the 46F product, known as DHR3, is translated, and (d) putatively forms a heterodimer with EcR to repress transcription of 74E-F and 75A-B, as indicated by dashed arrows; (e) meanwhile, the early puff products BR-C and E74 activate late puff transcription a t 71E; (f) DHR3 also forms a heterodimer with the E75B isoform to repress transcription of a gene located a t 75C; (g) as E75B levels decline, DHR3 activates 75C transcription, resulting in the appearance of a midprepupal puff; (h) its product, FTZF1, activates transcription of the prepupal-specific early gene at 93F; (i) meanwhile, the EcR/USP heterodimer increases transcription of the early puff genes to begin the second wave of puffing that marks the prepupal period. EcR, USP, E75, DHR3, and FTZFl are all nuclear receptors. Jagged lines indicate translation of a gene product. References contained within text.
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
107
In turn, the appearance of FTZ-F1 after the first puffing wave provides an essential precursor for the subsequent puffing pattern and the developmental events that ensue in the salivary gland. The early midprepupal puff at 93F, which appears only in the second wave, is induced prematurely by activating an FTZ-F1 transgene controlled by a heat shock promoter, thus demonstrating both the necessity and sufficiency of FTZ-F1 for transcription at 93F (Woodard et al., 1994). This product of 93F specifies a protein, E93, that shows no similarity with any known protein, although it displays structural features reminiscent of transcription factors (Baehrecke and Thummel, 1995). It has been proposed that E93 participates in the regulation of the apoptosis of the salivary gland as the prepupal period ends (Jiang et al., 1997). Collectively,these experiments reveal that DHR3 serves as a link between the two waves of puffing that occur during the onset of metamorphosis by suppressing the transcription of early genes associated with the first wave of puffing, and later, by activating FTZ-F1, which, in turn, is responsible for carrying out transcriptional activities connected with the second wave. In light of these findings, it is also apparent that the salivary gland’s response to the late larval ecdysteroid titer peak permanently alters the resulting mixture of transcription factors that participate in the cell’s next hormonal response. Although much of the response to ecdysone, notably the appearance of the same early puffs, remains unchanged in the two waves, the appearance of stage-specificpuffs indicates that the differentiation state of the salivary gland changes over only a few hours. The extensive involvement of several orphan receptors in this linear developmental process could not be predicted prior to their discovery, and it is still unclear to what extent receptor partner “swapping” or the presence of unknown metabolites and hormones contribute to the regulation of puffing patterns. The ability to express transgenic orphan receptor genes ectopically provides a powerful tool for future analyses of the roles played by each of these orphans. It will also be important and interesting to determine whether other steroid-hormone-regulated transcriptional pathways also involve orphan receptors to the extent seen in the Drosophila salivary gland. AND TEMPORAL DIVERSITY E. MECHANISMSFOR SPATIAL IN THE RESPONSETO ECDYSONE
Ecdysone, like other steroid hormones, elicits a highly variable pattern of transcriptional response from individual cell types. This fact is illustrated by the response seen in the polytene chromosomes of other
108
V. C. HENRICH et al.
larval tissues such as the fat body. Although many of the “early puff” genes are identical in both the salivary gland and fat body, other puffs are tissue-specific (Richards, 1982).For example, the 63F early puff occurs only with salivary gland polytene chromosomes. Simplistically, the appearance of a puff is the consequence of an activated EcR recognizing its response element and, in turn, increasing the transcriptional rate of a nearby gene. For the purposes of discussion, therefore, at least five different variables have been defined that contribute to the diversity of responses observed among Drosophila and other insect cells: (1) the existence of structural variants of the receptor itself, (2) variations in the structure and function of the ecdysone response element in different promoters, (3) the availability of various cofactors and competitors that modify the function of the receptor at its response element, (4) variations in the quantitative titer of receptor components, and ( 5 )variations in response to individual ecdysteroids. For the latter cases, the evidence is still sketchy, but lines of indirect evidence will be presented that suggest the possible importance of these parameters for hormone response.
1. Receptor and Early Puff Gene Product Isoforms Provide a Basis for Tissue Diversity As already noted, the existence of multiple isoforms of the EcR gene product may explain at least some of the differences in the response of various tissues to ecdysone. Similarly, three of the early puff genes encode transcription factors with multiple isoforms. The timing and tissue specificity of transcripts encoding these “early p u p isoforms varies in a predictable fashion (Huet et al., 1993). Moreover, mutant alleles that disrupt specific isoforms often elicit developmental phenotypes that represent a subset of those that affect common exon regions, further establishing the functional subroles of each isoform. For example, alleles of the reduced bristles on palpus (rbp) complementation group within the BR-C gene complex are required for the proper attachment of thoracic muscles to epidermal cells; the expression of the Z 1 BR-C isoform that rescues “late puff activation also rescues the defect caused by this mutation completely (Sandstrom et al., 1997).Mutations in other complementation groups within the BR-C disrupt optic lobe organization (Restifo and White, 1991), elongation, eversion of adult appendages, and fusion of the imaginal discs to form a continuous adult cuticle (Kiss et al., 1988). Consistently, a different BR-C isoform predominates in imaginal discs than in the other tissues (Huet et al., 1993). A similar pattern has been noted for isoform-specific mutations of the 74E-F gene. Mutations of the E74B isoform, which is expressed in late
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
109
larval tissues, disrupt puparium formation, whereas A-isoform-specific mutations disrupt later prepupal and pupal development (Fletcher et al., 1995). 2. EcREs Display a Diversity of Response Numerous lines of evidence have demonstrated that EcREs vary both structurally and functionally (see Cherbas, 1993).As noted previously, the consensus EcRE is a relatively variable response element. The first identified EcRE lies in the promoter of the gene that encodes a 27-kDa heat shock protein, the hsp27 EcRE, and it remains the most widely used response element for experimental studies (Riddihough and Pelham, 1987). Differences in the affinity of the receptor for specific response elements undoubtedly plays some role in the coordination of responses among tissues. For example, the isoform-specific promoters of E74 display vastly different responses to a given ecdysteroid level, one being a “high-sensitivity”promoter (E74B)and the other (E74A)a “lowsensitivity” promoter (Karim and Thummel, 1991).Significantly,the B isoform transcript is detectable in the salivary gland when ecdysteroid titers are low, whereas the A isoform transcript accumulates later, as the B transcript disappears (Huet et al., 1993). The heterogeneity of EcRE function is also illustrated by the activities of three response elements in the Eip28/29 gene, one of which lies in the promoter region, and two on the 3’ side of the gene (Cherbas et al., 1991).The net effect of these activities on transcript levels in whole body RNA preparations leads to the false conclusion that the gene’s activity is not ecdysone-dependent. Only in transgenic reporter constructs is the inducibility of individual EcREs in Eip28/29 apparent, and each one displays a unique profile of activity (Andres and Cherbas, 1994).Another aspect of functional diversity is illustrated by E93, the prepupal-specific early puff in the salivary gland. The E93 gene is expressed in a variety of tissues, but is ecdysone-responsive only in the salivary gland (Baehrecke and Thummel, 1995).This finding illustrates that the activity of individual EcREs in a given promoter depends not only on their own sequence, but also on the presence of other regulatory cofactors. The importance of other regulatory factors is exemplified by the fairly common finding that the promoter context of EcREs clearly influences their function. In the case of the intermolt genes, sgs3 and sgs4, for example,the tissue-specific control of their expression depends upon the presence of binding sites for both the EcR-USP heterodimer and Forkhead (FKH),a homologue of the vertebrate hepatocyte nuclear factor-4 (HNF4) transcription factor (Lehmann et al., 1997). Mutants of thefih gene fail to develop salivary glands (Weigelet al., 1989)and an-
110
V. C. HENRICH et al
tibodies to FKH decorate over 60 sites along the polytene chromosomes of the salivary gland, including all of the intermolt genes (Mach et al., 1996). Therefore, the promoters of the intermolt genes appear to lie at a point of intersection between the gland’s developmental pathway and the ecdysone-induced hierarchy. The importance of context has been further established in the case of the fat body protein-1 ( f i p l )gene promoter (Antonieweski et al., 1994). This gene is ecdysone-inducible but its expression is confined solely to fat body cells. Interestingly, the endogenous palindromic element can be replaced by specific direct repeat elements without altering the tissue-specific or ecdysone-responsive activities of the promoter, as measured by transgenic fusion reporter genes. However, the widely used hsp27 EcRE does not function when substituted for the endogenous element in the fbpl promoter (Antoniewski et al., 1996). The underlying mechanistic explanation for the functionality of direct repeats, but the failure of a related palindromic repeat, remains conjectural. It is worth noting that a few experiments have suggested that the EcR-USP complex itself takes on variable forms that remain undefined, but which affect promoter activity (Lehmann et al., 1997). The fact that a promoter’s activity varies among cell types also shows that the presence of cell-specific cofactors are responsible for mediating the ecdysone response. A few such factors have been identified tentatively. The orphan nuclear receptor, DHR78 (also known as XR78E/F), can compete for the Eip28/29 EcRE, and thus may repress transcription by blocking the EcR-USP heterodimer. Similarly, another orphan, DHR96, competes in a similar fashion for the hsp27 EcRE (Fisk and Thummel, 1995; Zelhof et al., 199513). Using a biochemical approach, Song et al. (1997) have shown that an immunophilin interacts with the EcR-USP complex in Manduca, and as noted earlier, such chaperone molecules have been implicated in the formation of mammalian receptor complexes (Pratt and Toft, 1997). Undoubtedly, other cofactors remain to be identified.
3. The Response to Ecdysone Is a Function of Receptor Titer Obviously, the degree of response to ecdysone in target cells depends on the amount of available EcR and USP. Clearly, the whole body levels of EcR vary enormously during Drosophila’s larval development, whereas USP titers are relatively stable (Koelle et al., 1991; Henrich et al., 1994). Nevertheless, it remains to be seen what the absolute titers of these two factors are in individual cells since one of them should be rate-limiting. It is conceivable that EcR is rate-limiting in some cells, whereas USP is rate-limiting in others, such that the degree and na-
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
111
ture of the ecdysone response varies as a consequence. It must be reemphasized that Drosophila USP may be exceptional, since several other insect genomes carry more than one USP gene and the expression of these genes vanes more than appears to be the case in Drosophila (e.g., Song and Gilbert, 1998). Another factor that obviously affects the availability of EcR and USP is the presence of other possible heterodimeric partners. As already noted, EcR has shown the capability to heterodimerize with DHR3, and USP has shown the ability to heterodimerize with DHR38, the mammalian homologue of nerve growth factor l-B (NGF1-B), which interacts with the mammalian RXR. DHR38 expression increases during the late third larval instar, although it is not correlated with any chromosomal puff in the salivary gland of late last instar larvae (Horner et al., 1995). Apparently, its possible role in mediating ecdysone-inducible events involves its interaction with USP in other tissues. EcR also has the ability to interact with the product of the sevenup (sup)gene locus. This receptor is the Drosophila homologue of COUP-TF, and it plays a central role in the differentiation of specific cells in the eye (Mlodzic et al., 1990).Apparently, the presence of SVP negatively regulates EcR activation by displacing USP, and thereby dissociating the functional receptor (Zelhof et al., 1995b). If, as experimental evidence has suggested, J H stabilizes the formation of USP homodimers (Jones and Sharp, 19971, then of course, the modulatory effect of J H on the ecdysone response is obvious and the direct consequence of an effect on the availability of USP as a heterodimeric partner for EcR.
4. Possible Roles of Other Ecdysteroids The discovery that many of the genes activated by ecdysone in the salivary gland encode orphan receptors raises the possibility that ecdysteroid metabolites may play some role in the secondary phases of the hormone response. Nevertheless, this question has received very limited attention, although there is indirect evidence to support this possibility. For example, 20HE is converted to 3-dehydro-20E (3D20E) only during the late third instar (see Lafont, 1997). Interestingly, the f i p I gene shows a much greater response to low doses of 3D20E than it does to 20E (Somme-Martin et al., 1990). Further indications that ecdysteroid metabolism is an important aspect of response is illustrated by the effects of the ecdysteroid agonist (and commercial insecticide), RH5849. The lethal effects of the compound have been attributed to the cell’s inability to degrade it (Retnakaran et al., 1995). On the other hand, 20E is actually a metabolite of ecdysone (ecdysone used here as the name of a specific molecule), which in fact, is the primary product
112
V. C. HENRICH et al
of the Drosophila ring gland. Some puffs on the polytene chromosomes of the fat body expand more quickly and robustly when incubated with ecdysone than they do with 20E, and therefore, this ecdysteroid may play a role in the orchestration of overall activities (Richards, 1982).In Manduca, the profile of ecdysone titers is distinct from 20E, even though ecdysone is the precursor of 20E, leaving the possibility that ecdysone plays a unique role in the course of developmental processes (Warren and Gilbert, 1986). Another possibility that remains completely unexplored is that nutrients derived from the fly’s diet activate one or more of the orphan receptors, analogousto the activation seen for various vertebrate orphans, including RXR (Kitareewan et al., 1996).
F. ECDYSONE ACTIONINVOLVES INTERACTIONS WITH OTHER DEVELOPMENTAL PATHWAYS The orchestrated hierarchy seen in the polytene chromosomes of the salivary gland may convey the perception that ecdysteroids alone trigger the responses observed before and during metamorphosis. The sequence of transcriptional effects that leads to the apoptosis of the salivary gland further supports this view. However, it is not known what functions are carried out by the salivary gland as the onset of metamorphosis approaches other than the production of glue proteins. In fact, the interaction of FKH and the EcR-USP complex in the promoter of intermolt genes may prove to be more representative of how ecdysteroids regulate gene expression and ultimately, the developmental fate of cells. The modulatory aspects of ecdysone on developmental processes are observed when the eye-antenna1disc is dissected out of larvae and placed into an insect culture medium. During this time, the disc normally undergoes a complex pattern of developmental changes. Some of these events, such as the pigmentation of cells, require the presence of ecdysone in the culture medium, but other events, such as neurite outgrowth, proceed even in the absence of the hormone (Li and Meinertzhagen, 1995). These observations illustrate perhaps the greatest advantage of future endocrine studies with Drosophila, namely, the possibility of understanding how ecdysteroid-regulated pathways interact with the many other well-defined developmental pathways already identified in this species. Genetic studies have demonstrated, for example, that ecdysone-induced gene expression and the action of a homeotic gene, Deformed, share overlapping functions that are necessary for proper neural development (Restifo and Merrill, 1994). Similarly, the interaction of an isoform-specificmutation of the
PEF'TIDE HORMONES, STEROID HORMONES, AND PUFFS
113
early puff gene, BR-C, with mutations of another gene, stubbloid (sbd), that is necessary for normal peripheral neural development reveals a point of intersection between two pathways that remains to be explored more fully (Beaton et al., 1988). The sbd locus encodes a transmembrane serine protease that apparently regulates the degradation of proteins in the developing peripheral neuron (Appelet d., 1993). It is also known that ecdysteroids play some role in adult reproductive processes, and in fact, USP was identified as a factor that is necessary for oocyte chorion gene expression in the ovary (Shea et al., 1990). The activity of ecdysone during embryogenesis in conjunction with other pathways is of particular interest. The isolation of embryonic lethal alleles at the DHR3 and EcR loci point to the essential nature of proper ecdysone action during this time. Similarly, strong allelic combinations of the ecdysone-deficientmutation, ecdysoneless (ecd),also arrest development sometime late in embryogenesis (Henrich et al., 1993). In the case of DHR3, abnormalities in peripheral neural development are observed in mutant embryos (Carney et al., 1997). Of course, an important aspect for regulating the progression of hormonally governed activities involves the feedback mechanism by which ecdysteroid synthesis is regulated. In this respect, the observation in Manduca that USP is phosphorylated in the presence of a relatively high titer of ecdysone provides an attractive entree into the exploration of this question, and further illustrates that a functional relationship exists between the prothoracic gland that produces the ecdysone precursor (3-dehydroecdysone)and target tissues (Song and Gilbert, 1998). In fact, as ecdysteroid titers rise, it is obvious that the prothoracic gland is an important target tissue that must respond by reducing its output of precursor, particularly since the normal expression of specific genes requires not only a rise in ecdysteroid titers, but also a subsequent decline (Clark et al., 1986). G. SUMMARY The molecular characterization of the salivary gland puff genes has already yielded a series of novel and important insights concerning the coordinated regulation of responses by ecdysteroids. Clearly, a major segment of the response, as Ashburner's model articulated, involves the production of transcription factors that in turn regulate the pattern of response. Specific interactions among and between these factors continue to be defined, although most of the puff genes remain to be cloned. This transcriptional hierarchy appears to intersect at various levels
114
V. C. HENRICH et al.
with genes involved in ongoing cellular activities. In some cases, these functions are activated directly by ecdysteroids, whereas in others, ecdysteroid activation pathways interact with other signal transduction pathways and cell-specific functions, In each cell type, there is a diversity of ecdysteroid response that can be traced to a combination of several different variables. The ecdysone receptor complex itself is composed of two major partners as well as several other proteins (Song et al., 1997). One of the major partners, EcR, possesses multiple isoforms that may affect its activation in other tissues. The other partner, USP, by virtue of its apparent ability to be activated by juvenile hormone (Jones and Sharp, 19971, may be dissociated from the heterodimer when juvenile hormone is present. Both EcR and USP can also be dissociated by other partners and there are indications in Manduca that its phosphorylation properties may affect USP function (Song and Gilbert, 1998). The variable nature of EcREs, both in terms of their receptor affinity and their promoter context also suggests the importance of other coregulators. Generally, the milieu and titer of proteins is obviously different among cells, so that the activation of specific promoters, the availability of competitive or modulatory factors, and the rate of hormone metabolism all act together to dictate the net response of individual cells. Biologically, the general effect of pulses of ecdysone seems to involve a combination of triggering, rate-setting, and interactive modes of action that serve to coordinate a variety of individual developmental processes, including ecdysone synthesis itself. Based on the available information, the response of individual cell types appears to involve many of the same players, including EcR and USP as well as the early puff gene products. The general significance of these studies is underscored by studies revealing that many factors crucially involved in ecdysone biosynthesis and response have vertebrate homologues, and therefore must have evolved before the divergence of vertebrates and invertebrates. Early examples indicate that not only are these individual molecular components conserved among diverse species, but that their regulatory interactions have been sustained through evolution as well. If this proves to be the case, then insect endocrine studies will continue to provide seminal insights concerning hormonal regulation in all animal species. ACKNOWLEDGMENTS Research from the laboratory of L. I. Gilbert was supported by grants IBN-9603710 from the National Science Foundation and DK-30118 from the National Institutes of Health. Research from the laboratory of V. C. Henrich was supported by grant IBN9316896 from the National Science Foundation.
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
115
REFERENCES Agui, N., Granger, N. A,, Bollenbacher, W. E., and Gilbert, L. I. (1979). Cellular localization of the insect prothoracicotropic hormone: In uitro assay of a single neurosecretory cell. Proc. Natl. Acad. Sci. U.S.A. 76,5694-5698. Amri, H., Drieu K., and Papadopoulos, V. (1997). Ex viuo regulation of adrenal cortical cell steroid and protein synthesis, in response to adrenocorticotropic hormone stimulation, by the Ginkgo bilboa extract EGb 761 and isolated ginkgolide B. Endocrinology (Baltimore) 138,5415-5426. Andres, A. J., and Cherbas, P. (1994). Tissue-specific regulation by ecdysone: Distinct patterns of Eip28/29 expression are controlled by different ecdysone response elements. Dev. Genet. 15,320-331. Andres, A. J., and Thummel, C. S. (1995). The Drosophila 63F early puff contains E63-1, a n ecdysone-inducible gene that encodes a novel Ca2+-bindingprotein. Development (Cambridge, UK) 121,2667-2679. Antoniewski, C., Laval, M., and Lepesant, J.-A. (1993). Structural features critical to the activity of an ecdysone receptor binding site. Insect Biochem. Mol. Biol. 23,105-114. Antoniewski, C., Laval, M., Dahan, A., and Lepesant, J.-A. (1994). The ecdysone response enhancer of the fbpl gene of Drosophila melanogaster is a direct target for the EcR/USP nuclear receptor. Mol. Cell. Biol. 14,4465-4474. Antoniewski, C., Mugat, B., Delbac, F., and Lepesant, J.-A. (1996). Direct repeats bind the EcRlUSP receptor and mediate ecdysteroid responses in Drosophila melanogaster Mol. Cell. Biol. 16, 2977-2986. Appel, L. F., Prout, M., Abu-Shumays, F., Hammonds, A., Garbe, J. C., Fristrom, D., and Fristrom, J. (1993). The Drosophila Stubble-stubbloid encodes a n apparent transmembrane serine protease required for epithelial morphogenesis. Proc. Natl. Acud. Sci. U.S.A. 90,4937-4941. Asahina, M., Jindra, M., And Riddiford, L. M. (1997). Developmental expression of ultraspiracle proteins in the epidermis of the tobacco hornworm, Manduca sextu, during larval life and the onset of metamorphosis. Genes Dev. Euol. 207,381-388. Ashburner, M. (1967). Patterns of puffing activity in the salivary gland chromosomes of Drosophila. I. Autosomal puffing patterns in a laboratory stock of Drosophila melanogaster Chromosoma 21,398-428. Ashburner, M. (1969). Patterns of puffing activity in the salivary gland chromosomes of Drosophila. 11.The X-chromosome puffing patterns of D. melanogaster and D. simulam. Chromosoma 27,47-63. Ashburner, M. (1971). Induction of puffs in polytene chromosomes of in uitro cultured salivary glands ofDrosophilamelanogaster by ecdysone and ecdysone analogues. Nature (London) 230,222-223. Ashburner, M. (1972). Patterns of puffing activity in the salivary gland chromosomes of Drosophila. VI.Induction by ecdysone in salivary glands of D. melanogaster cultured in uitro. Chromosoma 38,255-281. Ashburner, M. (1974). Sequential gene activation by ecdysone in polytene chromosomes of Drosophila melanogaster 11. The effects of inhibitors of protein synthesis. Dev. Biol. 39, 141-157. Ashburner, M., Chihara, C., Meltzer, P., and Richards, G. (1973). Temporal control ofpuffing activity in polytene chromosomes. Cold Spring Harbor Symp. Quant. Biol. 38, 655-662. Baehrecke, E. H., andThummel, C. S. (1995). The Drosophila E93 gene from the 93F early puff displays stage- and tissue-specific regulation by 20-hydroxyecdysone. Deu. Biol. 171,85-97.
116
V. C. HENRICH et al.
Beaton, A. H., Kiss, I., Fristrom, D., and Fristrom, J. W. (1988). Interaction of the Stubble-stubbloid locus and the Broad-Complex ofDrosophila melanogaster. Genetics 120, 453-464. Becker, H. J. (1959). Die Puffs der Speicheldriisenchromosomen von Drosophila melanogaster. I. Beobachtungen zum Verhalten des Puffmasters in Normalstamm und bei zwei Mutanten, giant und lethal-giant-larvae. Chromosoma 10,654-678. Becker, H. J. (1962). Die Puffs der Speicheldrusenchromsomen von Drosophila melanogaster. 11. Die Auslosung der Puffbildung, ihre Spezifitat und ihre Beziehung zur Funktion der Ringdriise. Chromosoma 13,341-384. Beermann, W. (1952). Chromomeren Konstanz und Spezifishce Modifiakationen der Chromosomenstrukture in der Entwicklung und Organdiffernzierung von Chironomus tentans. Chromosoma 5,139-198. Bender, M., Imam, F. B., Talbot, W. S., Ganetzky, B., and Hogness, D. S. (1997). Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell (Cambridge, Mass.) 91,777-788. Birkenbeil, H. (1996). Involvement of calcium in prothoracicotropic stimulation of ecdysone synthesis in Galleria mellonella. Arch. Insect Biochem. Physiol. 33,39-52. Bollenbacher, W. E., and Granger, N. A. (1985). Endocrinology of the prothoracicotropic hormone. In “Comprehensive Insect Physioliology,Biochemistry, and Pharmacology” (G. A. Kerkut and L. I Gilbert, eds.), Vol. 7, pp. 109-151. Pergamon Press, Oxford. Bollenbacher, W. E., Smith, S. L., Goodman, W., and Gilbert, L. I. (1981). Ecdysteroid titer during larval-pupal-adult development of the tobacco hornworm, Manduca sexta. Gen. Comp. Endocrinol. 44,302-306. Bollenbacher, W. E., Katahira, E. J.,OBrien, M. A., Gilbert, L. I., Thomas, M. K., Agui, N., and Baumhover, A. H. (1984). Insect prothoracicotropic hormone: Evidence for two molecular forms. Science 224,1243-1245. Burtis, K. C., Thummel, C. S., Jones, C. W., Karim, F. D., and Hogness, D. S. (1990). The Drosophila 74EF early puff contains E74, a complex ecdysone-inducible gene that encodes two ets-related proteins. Cell (Cambridge, Mass.) 61,85-99. Carney, G. E., Wade, A. A., Sapra, R., Goldstein, E. S., and Bender, M. (1997). DHR3, a n ecdysone-inducible early-late gene encoding a Drosophila nuclear receptor, is required for embryogenesis. Proc. NatL Acad. Sci. U S A . 94,12024-12029. Cherbas, L., Lee, K., and Cherbas, P. (1991). Identification of ecdysone response elements by analysis o f the Drosophila Eip28f29 gene. Genes Dev. 5,120-131. Cherbas, P. (1993). The IVth Karlson Lecture: Ecdysone-response genes. Insect Biochem. Mol. Biol23,3-11. Cherbas, P., and Cherbas, L. (1996). Molecular aspects of ecdysteroid hormone action. In “Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells” (L. I. Gilbert, J. Tata, and B. G. Atkinson, eds.), 3rd ed., pp. 175-221. Academic Press, San Diego, CA. Chung, J., Grammar, T. C., Lemon, K. P., Kazlauskas, A., and Blenis, J. (1994). PDGFand insulin-dependent activation mediated by phosphatidylinositol-3-OH kinase. Nature (London) 370, 71-75. Clark, W. C., Doctor, J.,Fristrom, J. W., and Hodgetts, R. B. (1986). Differential responses of the dopa decarboxylase gene to 20-OH-ecdysone in Drosophila melanogaster. Dev. Biol. 114, 141-150. Clever, U., and Karlson, P. (1960). Induktion von Puff-Veranderungen in den Speicheldrusen-chromosomen von Chironomus tentans durch Ecydson. Exp. Cell Res. 20, 623-626. Combest, W. L., and Gilbert, L. I. (1992). Polyamines modulate multiple protein phos-
PEF’TIDE HORMONES, STEROID HORMONES, AND PUFFS
117
phorylation pathways in the insect prothoracic gland. Mol. Cell. Endocrinol. 83, 11-19. Crossgrove, K., Bayer, C. A., Fristrom, J. W., and Guild, G. M. (1996). The Drosophila Broad-Complex early gene directly regulates late gene transcription during the ecdysone-induced puffing cascade. Deu. Biol. 180,745-758. Dai, J.-D., and Gilbert, L. I. (1991). Metamorphosis of the corpus allatum and degeneration of the prothoracic gland during larval-pupal-adult transformation of Drosophila melanogaster: A cytophysiological analysis of the ring gland. Deu. Biol. 144, 309-326. Dai, J.-D., Henrich, V. C., and Gilbert, L. I. (1991). An ultrastructural analysis of the ecdysoneless (1(3)ecdlts) ring gland during the third larval instar of Drosophila melanogaster Cell Tissue Res. 265,433-445. DAvino, P. P., Crispi, S., Polito, L. C., and Furia, M. (1995). The role of the BR-C locus on the expression of genes located at the ecdysone-regulated 3C puff of Drosophila melanogaster. Mech. Dew. 49,161-171. Denner, L. A., Weigel, N. L., Maxwell, B. L., Schrader, W. T., and O’Malley, B. W. (1990). Regulation of progesterone receptor-mediated transcription by phosphorylation. Science 250,1740-1743. DiBello, P. R., Withers, D. A., Bayer, C. A., Fristrom, J. W., and Guild, G. M. (1991). The Drosophila Broad-Complex encodes a family of related proteins containing zinc fingers. Genetics 129,385-397. Ferrari, S., and Thomas, G. (1994). S6 phosphorylation and the p70s6k/p85s6k. Crit. Rev. Biochem. Mol. Biol. 29,385-413. Fisk, G . J., and Thummel, C. S. (1995). Isolation, regulation, and DNA-binding properties of three nuclear hormone receptor superfamily members. Proc. Natl. Acad. Sci. U.S.A. 92,10604-10608. Fletcher, J. C., and Thummel, C. S. (1995). The ecdysone-inducible Broad-Complex and E74 early genes interact to regulate target gene transcription and Drosophila metamorphosis. Genetics 141, 1025-1035. Fletcher, J . C., Burtis, K. C . , Hogness, D. S., and Thummel, C. S. (1995). The Drosophila E74 gene is required for metamorphosis and plays a role in the polytene chromosome puffing response to ecdysone. Development (Cambridge, UK)121,1455-1465. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMonis, T., Lamph, W. W., Evans, R. M., and Weinberger, C. (1995). Identification of a nuclear receptor that is activated by farnesol metabolites. Cell (Cambridge, Mass.) 81,687-695. Gelman, D. G., and Bell, R. A. (1995). Low molecular weight ecdysiotropins in the hemolymph of 5th instars of the European corn borer, Ostrinia nubilalis (Lepidoptera: Pyralidae), and the gypsy moth, Lymantria dispar (Lepidoptera: Lymantriidae). Eur. J. Entomol. 92,131-141. Ghinea, N., Vu Hai, M. T., Groyer-Picard, M. T., Houillier, A., Schoevaert, D., and Milgrom, E. (1992). Pathways of internalization of the hCG/LH receptor: Immunoelectron microscopic studies in Leydig cells and transfected L-cells. J. Cell Biol. 118, 1347-1358. Gilbert, L. I., Combest, W. L., Smith, W. A., Meller, V. H., and Rountree, D. B. (1988). Neuropeptides, second messengers and insect molting. BioEssuys 8,153-157. Gilbert, L. I., Rybczynski, R., and Tobe, S. (1996). Endocrine cascade in metamorphosis. In “Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells” (L. I. Gilbert, J. Tata, and B. G. Atkinson, eds.), 3rd ed., pp. 59-107. Academic Press, San Diego, CA.
118
V. C. HENRICH et al.
Girgenrath, S., and Smith, W. S. (1996). Investigation of presumptive mobilization pathways for calcium in the steroidogenic action of big prothoracicotropic hormone. Znsect Biochem. Mol. Biol. 26,455-463. Gray, R. S., Muehleisen, D. P., Katahira, E. J., and Bollenbacher, W. E. (1994). The prothoracicotropic hormone (F'FTH) of the commercial silkmoth, Bombyx mori, in the CNS of the tobacco hornworm, Manduca sexta. Peptides (N.Y) 15,777-782. Grieneisen, M. L., Warren, J. T., and Gilbert, L. I. (1993). Early steps in ecdysteroid biosynthesis: Evidence for the involvement of cytochrome P-450 enzymes. Insect Biochem. Mol. Biol. 23, 13-23. Gu, S.-H., and Chow, Y.-S. (1996). Regulation of juvenile hormone biosynthesis by ecdysteroid levels during the early stages of the last two larval instars of Bombyx mori. J. Insect Physiol. 42,625-632. Gu, S.-H., Chow, Y.-S., Lin, F.-J., Wu, J.-L., and Ho, R .J. (1996).A deficiency in prothoracicotropic hormone transduction pathway during the early last larval instar of Bombyx mori. Mol. Cell. Endocrinol. 120,99-105. Gu, S.-H., Chow, Y.-S., and Yin, C.-M. (1997). Involvement of juvenile hormone in regulation of prothoracicotropic hormone transduction during the early last larval instar of Bombyx mori. Mol. Cell. Endocrinol. 127, 109-116. Guay, P. S., and Guild, G. M. (1991). The ecdysone-induced puffing cascade in Drosophila salivary glands: A Broad-Complex early gene regulates intermolt and late gene transcription. Genetics 129, 169-175. Hargreaves, A. J., and A d a , J . (1985). Localization and characterization of tubulin-like proteins associated with brain mitochondria: The presence of a membrane-specific isoform. J. Neurochem. 45,490-496. Heckert, L., and Griswold, M. D. (1993).Expression of the FSH receptor in the testis. Recent Prog. Horm. Res. 48,61-77. Henrich, V. C. (1995). Comparison of ecdysteroid production in Drosophila and Munduca: Pharmacology and cross-species neural reactivity. Arch. Insect Biochem. Physiol. 30,239-254. Henrich, V. C., and Brown, N. E. (1995). Insect nuclear receptors: A developmental and comparative perspective. Insect Biochem. Mol. Biol. 25,881-897. Henrich, V. C., Pak, M. D., and Gilbert, L. I. (1987). Neural fa c txs that stimulate ecdysteroid synthesis by the larval ring gland ofDrosophila melanogaster. J. Comp. Physiol., B 157,543-549. Henrich, V. C., Sliter, T. J., Lubahn, D. L., MacIntyre, A., and Gilbert, L. I. (1990).Amember of the steroidlthyroid hormone receptor superfamily in Drosophita melanogaster shows extensive sequence similarity with a mammalian counterpart. Nucleic Acids Res. 18,4143-4148. Henrich, V. C., Livingston, L., and Gilbert, L. I. (1993). Developmental requirements for the ecdysoneless (ecd)locus in Drosophila melanogaster. Dev. Genet. 14,369-377. Henrich, V. C., Szekely, A. A,, Kim, S. J., Brown, N., Antoniewski, C., Hayden, M. A., Lepesant, J.-A., and Gilbert, L. I. (1994). Expression and function of the ultraspiracle (usp) gene locus during development in Drosophila melanogaster. Dev. Biol. 165, 38-52. Horner, M., Chen, T., and Thummel, C. S. (1995). Ecdysone regulation and DNA binding properties of Drosophila nuclear hormone receptor superfamily members. Deu. Biol. 168,490-502. Huet, F., Ruiz, C., and Richards, G. (1993). Puffs and PCR: The in vivo dynamics of early gene expression during ecdysone responses in Drosophila. Development (Cambridge, UK) 118,613-627. Ishibashi, J., Kataoka, H., Isogai, A., Kawakami, A., Saegusa, H., Yagi, Y., Mizoguchi, A.,
PEFTIDE HORMONES, STEROID HORMONES, AND PUFFS
119
Shizaki, H., and Suzuki, A. (1994). Assignment of disulfide bond location in prothoracicotropic hormone of the silkworm, Bombyx mori: A homodimeric protein. Biochemistry 33,5912-5919. Ishizaki, H., and Suzuki, A. (1992). Brain secretory peptides of the silkmoth Bombyx mori: Prothoracicotropic hormone and bombyxin. Prog. Brain Res. 92, 1-14. Ishizaki, H., and Suzuki, A. (1994). The brain secretory peptides that control moulting and metamorphosis of the silkmoth, Bombyx mori. Int. J. Deu. 38,301-310. Jiang, C., Baehrecke, E. H., and Thummel, C. S. (1997). Steroid regulated programmed cell death during Drosophila metamorphosis. Development (Cambridge, UK) 124, 4673-4683. Jindra, M., Malone, F.,Hiruma, K., and Riddiford, L. M. (1996). Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Dev. Biol. 180, 258-272. Jindra, M., Huang, J.-Y., Malone, F., Asahina, M., and Riddiford, L. M. (1997). Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta. Insect Mol. Biol. 6,41-53. Jones, G., and Sharp, P. A. (1997). Ultraspiracle: An invertebrate nuclear receptor for juvenile hormones. Proc. Natl. Acad. Sci. U.S.A.94,13499-13503. Kamimura, M., Tomita, S., Kiuchi, M., and Fujiwara, H. (1997).Tissue-specific and stagespecific expression of two silkworm ecdysone receptor isoforms-Ecdysteroiddependent transcription in cultured anterior silk glands. Eur. J. Biochem. 248, 786-793. Kapitskaya, M., Wang, S., Cress, D. E., Dhadialla, T. S., and Raikhel, A. S. (1996). The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: Cloning and characterization of isoforms expressed during vitellogenesis. Mol. Cell. Endocrinol. 121, 119-132. Karim, F. D., and Thummel, C. S. (1991). Ecdysone coordinates the timing and amounts of E74A and E74B transcription in Drosophila. Genes Deu. 5,1067-1079. Kataoka, H., Nagasawa, H., Isogai, A., Ishizaki, H., and Suzuki, A. (1991). Prothoracicotropic hormone of the silkworm, Bombyx mori: Amino acid sequence and dimeric structure. Agric. Biol. Chem. 55,73-86. Kawakami, A., Kataoka, H., Oka, T., Mizoguchi, A., Kimura-Kawakami, M., Adachi, T., Iwami, M., Nagasawa, H., Suzuki, A., and Ishizaki, H. (1990). Molecular cloning of the Bombyx mori prothoracicotropic hormone. Science 247,1333-1335. Keightley, D. A., Lou, K. J., and Smith, W. A. (1990). Involvement oftranslation and transcription in insect steroidogenesis. Mol. Cell. Endocrinol. 74,229-237. Khoury-Christianson, A. M., King, D. L., Hatzivassiliou, E., Casas, J. E., Hallenbeck, P. L., Nikodem, V. M., Mitsialis, S. A., and Kafatos, F. C. (1992). DNA binding and heteromerization of the Drosophila transcription factor chorion factor lhltraspiracle. Proc. Natl. Acad. Sci. U S A . 89, 11503-11507. Kim, A.-J., Cha, G.-H., Kim, K., Gilbert, L. I., and Lee, C. C. (1997). Purification and characterization of the prothoracicotropic hormone of Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 94, 1130-1135. Kiss, I., Beaton, A. H., Tardiff, J., Fristrom, D., and Fristrom, J. W. (1988). Interactions and developmental effects of mutations in the Broad-Complex of Drosophila melanogaster. Genetics 118,247-259. Kitareewan, S., Burka, L. T., Tomer, K. B., Parker, C. E., Deterding, L. J., Stevens, R. D., Forman, B. M., Mais, D. E., Heyman, R.A., McMorris, T., and Weinberger, C. (1996). Phytol metabolites are circulating dietary factors that activate the nuclear receptor RXR. Mol. Biol. Cell 7, 1153-1166.
120
V. C. HENRICH et al.
Koelle, M. R., Talbot, W. S., Segraves, W. A., Bender, M. T., Cherbas, P., and Hogness, D. S. (1991). The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily Cell (Cambridge, Mass.) 67,59-77. Koelle, M. R., Segraves, W. A., and Hogness, D. S. (1992). DHR3:AnewDrosophila steroid receptor homolog. Proc. Natl. Acad. Sci. U.S.A. 89,6167-6171. KopeC, S. (1922). Studies on the necessity of the brain for the inception of insect metamorphosis, Biol. Bull. Woods Hole, Mass.) 42,323-342. Lafont, R. (1997). Ecdysteroids and related molecules in animals and plants. Arch. Insect Biochem. Physiol. 35,3-20. Lala, D. S., Syka, P. M., Lazarchik, S. B., Mangelsdorf, D. J., Parker, K. L., and Heyman, R. A. (1997). Activation of the orphan nuclear receptor steroidogenic factor 1by oxysterols. Proc. Natl. Acad. Sci. U.S.A. 94,4895-4900. Lavorgna, G., Ueda, H., Clos, J., and Wu, C. (1991). FTZ-F1, a steroid hormone receptorlike protein implicated in the activation offushi tarazu. Science 252,848-851. Lavorgna, G., Karim, F. D., Thummel, C. S., and Wu, C. (1993). Potential role for a FTZF1 steroid receptor superfamily member in the control of Drosophila metamorphosis. Proc. Natl. Acad. Sci. U.S.A. 90,3004-3008. Lehmann, M., and Korge, G. (1995). Ecdysone regulation of the Drosophila Sgs-4 gene is mediated by the synergistic action of ecdysone receptor and SEBP 3. EMBO J. 14, 716-726. Lehmann, M., Wattler, F., and Korge, G. (1997). Two new regulatory elements controlling the Drosophila Sgs-3 gene are potential ecdysone receptor and fork head binding sites. Mech. Dev. 62, 15-27. Lester, D. S., and Gilbert, L. I. (1987). Developmental changes in the concentration of a-bungarotoxin binding sites in the brain of the tobacco hornworm, Manduca sexta. Neurochem. Znt. 10,571-581. Li, C., and Meinertzhagen, I. A. (1995). Conditions for the primary culture of eye imagnial discs from Drosophila melanogaster. J.Neurobiol. 28,363-380. Lomas, L. O., Turner, P. C., and Rees, H. H. (1997). A novel neuropeptide-endocrine interaction controlling ecdysteroid production in ixodid ticks. Proc. R. Sac. London. Ser. B 264,589-596. Lonard, D. M., Bhaaskaran, G., and Dahm, K. H. (1996). Control of prothoracic gland activity by juvenile hormone in fourth instar Manduca sexta larvae. J. Insect Physiol. 42,205-213. Luby-Phillips, K. (1993). Effect of cytoarchitecture on the transport and localization of protein synthetic machinery. J. Cell. Biochem. 52,140-147. Luo, X., Ikeda, Y.,and Parker, K. L. (1994). Acell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell (Cambridge, Mass.) 77,481-490. Mach, V., Ohno, K., Kokubo, H., and Suzuki, Y. (1996). The Drosophila fork head factor directly controls larval salivary gland-specific expression of the glue protein gene Sgs3. Nucleic Acids Res. 12,2387-2394. Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR heterodimers and orphan receptors. Cell (Cambridge, Mass.) 83,841-850. Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., Zhou, J. Y., Ong, E. S., Kakizuka, A,, and Evans, R. M. (1992). Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev. 6,329-344. Mangelsdorf, D. J., Thummel, C. U., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blomberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995). The nuclear receptor superfamily: The second decade. Cell (Cambridge, Mass.) 83, 835-839.
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
121
McFarland, K. C., Spengel, R., Phillips, H. S., Kohler, M., Rosemblit, N., Nikolics, K., Segaloff, D. L., and Seeburg, P. H. (1989). Lutropin-choriogonadotropinreceptor: An unusual member of the G protein-coupled receptor family. Science 245,494-499. Meller, V. H., Combest, W. L., Smith, W. A., and Gilbert, L. I. (1988). Acalmodulin-sensitive adenylate cyclase in the prothoracic glands of the tobacco hornworm, Manduca sexta. Mol. Cell. Endocrinol. 59,67-76. Meller, V. H., Sakurai, S., and Gilbert, L. I. (1990). Developmental regulation of calmodulin-dependent adenylate cyclase in an insect endocrine gland. Cell. Regul. 1,771-780. Mlodzik, M., Hiromi, Y., Weber, U., Goodman, C. S., and Rubin, G. M. (1990). The Drosophila seven-up gene, a member of the steroid receptor gene superfamily, controls photoreceptor cell fates. Cell (Cambridge, Mass.) 60,211-224. Mouillet, J.-F., Delbecque, J.-P.,Quennedey, B., and Delachambre, J. (1997). Cloning of two putative ecdysteroid receptor isoforms from !Z'enebrio molitor and their developmental expression in the epidermis during metamorphosis. Eul: J. Biochem. 248, 856-863. Mountjoy, K. G., Robbins, L. S., Mortrud, M. T., and Cone, R. D. (1992). The cloning of a family of genes that encode the melanocortin receptors. Science 257,1248-1251. Muehleisen, D. P., Gray, R. S., Katahira, E. J., Thomas, M. K., and Bollenbaeher, W. E. (1993). Immunoaffinity purification of the neuropeptide prothoracicotropic hormone from Manduca sexta. Peptides (N.Y) 14,531-541. Oro, A. E., McKeown, M., and Evans, R. M. (1990). Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature (London) 347,298-301. Oro, A. E., McKeown, M., and Evans, R. M. (1992). The Drosophila retinoid X receptor homolog ultraspiracle functions in both female reproduction and eye morphogenesis. Development (Cambridge, UK) 115,449-462. Orti, E., Bodwell, J. E., and Munck, A. (1992). Phosphorylation of steroid hormone receptors. Endocl: Rev. 13, 105-128. Perrimon, E., Engstrom, L., and Mahowald, A. P. (1985). Developmental genetics of the 2C-D region of the Drosophila X-chromosome. Genetics 111,23-41. Pley, U., and Parham, P. (1993). Clathrin: Its role in receptor-mediated vesicular transport and specialized functions in neurons. Crit. Rev. Biochem. Mol. Biol. 28,431-464. Pratt, W. B., and Toft,D. 0. (1997). Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr. Rev. 18,306-360. Price, D. J., Grove, J. R., Calvo, V., Avruch, J., and Bierer, B. E. (1992). Rapamycin-induced inhibition of the 70-kilodalton S6 protein kinase. Science 257,973-977. Rachinsky, A., and Tobe, S. S. (1996). Role of second messengers in the regulation of juvenile hormone production in insects, with particular emphasis on calcium and phosphoinositide signaling. Arch. Insect Biochem. Physiol. 33,259-282. Restifo, L. L., and Merrill, V. K. L. (1994). Two Drosophilu regulatory genes, Deformed and the Broad-Complex, share common functions in development of adult CNS, head, and salivary glands. Deu. Biol. 162,465-485. Restifo, L. L., and White, K. (1991). Mutations in a steroid hormone-regulated gene disrupt the metamorphosis of the central nervous system in Drosophila. Dev. Biol. 148, 174-194. Retnakaran, A., Hiruma, K., Palli, S. R., and Riddiford, L. M. (1995). Molecular analysis of the mode of action of RH-5992, a lepidopteran-specific, non-steroidal ecdysteroid agonist. Insect Biochem. Mol. Biol. 25,109-117. Richards, G. (1982). Sequential gene activation by ecdysteroids in polytene chromosomes of Drosophila melanogaster VII. Tissue specific puffing. Wilhelm Roux's Arch. Deu. Biol. 191, 103-111.
122
V. C. HENRICH et al.
Riddiford, L. M. (1993). Hormones and Drosophila development. In “The Development of Drosophila melanogaster” (M. Bate and A. M. Arias, eds.), Vol. 2, pp. 899-939. Cold Spring Harbor Lab. Press, Plainview, NY. Riddiford, L. M. (1994). Cellular and molecular actions of juvenile hormone. I. General considerations and premetamorphic actions. Adu. Insect Physiol. 24, 213-274. Riddiford, L. M. (1996). Molecular aspects of juvenile hormone action in insect metamorphosis. I n “Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells” (L. I. Gilbert, J. Tata, and B. G. Atkinson, eds.), 3rd ed., pp. 223-251. Academic Press, San Diego, CA. Riddihough, G., and Pelham, H. R. B. (1987). An ecdysone response element in the Drosophila hsp27 promoter. EMBO J. 6,3729-3734. Robinow, S., Talbot, W. S., Hogness, D. S., and Truman, J. W. (1993). Programmed cell death in the Drosophila CNS is ecdysone-regulated and coupled with a specific ecdysone receptor isoform. Development (Cambridge, UK) 119,1251-1259. Rountree, D. B., and Bollenbacher, W. E., (1986). The release of the prothoracicotropic hormone in the tobacco hornworm, Manduca sexta, is controlled intrinsically by juvenile hormone. J. Exp. Biol. 120,41-58. Rountree, D. B., Combest, W. L., and Gilbert, L. I. (1987). Protein phosphorylation in the prothoracic glands as a cellular model for juvenile hormone-prothoracicotropichormone interactions. Insect Biochem. 17,943-948. Rountree, D. B., Combest, W. L., and Gilbert, L. I. (1992). Prothoracicotropic hormone regulates the phosphorylation of a specific protein in the prothoracic glands of the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 22,353-362. Russell, S. R. H., Heimbeck, G., Goddard, C. M., Carpenter, A. T. C., and Ashburner, M. (1996). The Drosophila Eip78C gene is not vital but has a role in regulating chromosomal puffs. Genetics 144,159-170. Rybczynski, R., and Gilbert, L. I. (1994). Changes in general and specific protein synthesis that accompany ecdysteroid synthesis in stimulated prothoracic glands of Manduca sexta. Insect Biochem. Mol. Biol. 24, 175-189, Rybczynski, R., and Gilbert, L. I. (1995a). Prothoracicotropic hormone elicits a rapid, developmentally specific synthesis of p tubulin in an insect endocrine gland. Deu. Biol. 169,15-28. Rybczynski, R., and Gilbert, L. I. (199515). Prothoracicotropic hormone-regulated expression of a hsp 70 cognate protein in the insect prothoracic gland. Mol. Cell. Endocrinol. 115,73-85. Rybczynski, R., Mizoguchi, A., and Gilbert, L. I. (1996). Bombyx and Manduca prothoracicotropic hormones: An immunologic test for relatedness. Gen. Comp. Endocrinol. 102,247-254. Safranek, L., Cymborowski, B., and Williams, C. M. (1980). Effects of juvenile hormone on ecdysone-dependent development in the tobacco hornworm, Manduca sexta. Biol. Bull. (Woods Hole, Mass.) 158,248-256. Sandstrom, D. J., Bayer, C. A., Fristrom, J. W., and Restifo, L. L. (1997). Broad-Complex transcription factors regulate thoracic muscle attachment in Drosophila. Deu. Biol. 181,168-185. Sauman, I., and Reppert, S. M. (1996). Molecular characterization of prothoracicotropic hormone (PTTH) from the giant silkmoth Antheraea pernyi: Developmental appearance of PTTH-expressing cells and relationship to circadian clock cells in central brain. Deu. Biol. 178, 418-429. Seagraves, W. A., and Hogness, D. S. (1990). The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila encodes two new members of the steroid receptor superfamily. Genes Deu. 4,204-219.
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
123
Shea, M. J., King, D. L., Conboy, M. J., Mariani, B. D., and Kafatos, F. C. (1990). Proteins that bind to Drosophila chorion cis-regulatory elements: A new C2H2 zinc finger protein and a C2C2 steroid receptor-like component. Genes Deu. 4,1128-1140. Shirai, Y., Iwasaki, T., Matsubara, F.,and Aizono, Y. (1994). The carbachol-induced release of prothoracicotropic hormone from brain-corpus cardiacum-corpus allatum complex of the silkworm, Bombyx mori. J. Insect Physiol. 40,469-473. Smith, W. A., and Gilbert, L. I. (1989). Early events in peptide-stimulated ecdysteroid secretion by the prothoracic glands of Manduca sexta. J. Exp. Zool. 252,262-270. Smith, W. A., and Pasquarello, T. J. (1989). Developmental changes in phosphodiesterase activity and hormonal response in the prothoracic glands of Manduca sexta. Mol. Cell. Endocrinol. 63,239-246. Smith, W. A., Gilbert, L. I., and Bollenbacher, W. E. (1984). The role of cyclic AMP in the regulation of ecdysone synthesis. Mol. Cell. Endocrinol37,285-294. Smith, W. A., Gilbert, L. I., and Bollenbacher, W. E. (1985). Calcium-cyclic AMP interactions in prothoracicotropic hormone stimulation of ecdysone synthesis. Mol. Cell. Endocrinol. 39, 71-78. Smith, W. A., Combest, W, L., and Gilbert, L. I. (1986). Involvement of cyclic AMP-dependent protein kinase in prothoracicotropic hormone-stimulated ecdysone synthesis. Mol. Cell. Endocrinol. 47,25-33. Smith, W. A., Rountree, D. B., Bollenbacher, W. E., and Gilbert, L. I. (1987). Dissociation of the prothoracic glands of Manduca sexta into hormone-responsive cells. In “Progress in Insect Neurochemistry and Neurophysiology” (A. Borkovec and D. Gelman, eds.), pp, 319-322. Humana Press, Clifton, NJ. Smith, W. A., Varghese, A. H., Healy, M. S., and Lou, K. J. (1996). Cyclic AMP is a requisite messenger in the action of big PTTH in the prothoracic glands of pupal Manduca sexta. Insect Biochem. Mol. Biol. 26, 161-170. Snyder, M. J., and Feyereisen, R. (1993). A diazepam binding inhibitor (DBI) homolog from the tobacco hornworm, Manduca sexta. Mol. Cell. Endocrinol. 94, R1-R4. Somme-Martin, G., Colardeau, J., Beydon, P,Blais, C., Lepesant, J.-A., and Lafont, R. (1990). P1 gene expression in Drosophila larval fat body: Induction by various ecdysteroids. Arch. Insect Biochem. Physiol. 15,43-56. Song, Q., and Gilbert, L. I. (1994). S6 phosphorylation results from prothoracicotropic hormone stimulation of insect prothoracic glands: A role for S6 kinase. Deu. Genet. 15,332-338. Song, Q., and Gilbert, L. I. (1995). Multiple phosphorylation of ribosomal protein S6 and specific protein synthesis are required for prothoracicotropic hormone-stimulated ecdysteroid biosynthesis i n the prothoracic glands of Manduca sexta. Insect Biochem. Mol. Biol. 25,591-602. Song, Q., and Gilbert, L. I. (1997). Molecular cloning, developmental expression, and phosphorylation of ribosomal protein S6 in the endocrine gland responsible for insect molting. J. Biol. Chem. 272,4429-4435. Song, Q., and Gilbert, L. I. (1998). Alterations in Ultraspiracle (USP) content and phosphorylation state accompany feedback regulation of ecdysone synthesis in the insect prothoracic gland. Insect Biochem. Mol. Biol. (in press). Song, Q., Alnemri, E. S., Litwack, G., and Gilbert, L. I. (1997).An immunophilin is a component ofthe insect ecdysone receptor complex.Insect Biochem. Mol. Biol. 27,973-982. Stocco, D. M., and Clark, B. J. (1996). Regulation of the acute production of steroids in steroidogenic cells. Endocx Rev. 17,221-244. Stone, B. L., and Thummel, C. S. (1993). The Drosophila 78C early late puff contains E78, a n ecdysone-inducible gene that encodes a novel member of the nuclear hormone receptor superfamily. Cell (Cambridge, Mass.) 75,307-320.
124
V. C. HENRICH et al.
Stoyanov, B., Volinia, S., Hanck, T.,Rubio, I., Loubtchenkov, M., Malek, D., Stoyanova, S., Vanhaesebroeck, B., Dhand, R., Niirnberg, B., Gierschik, P., Seedorf, K., Hsuan, J. J., Waterfield, M. D., and Wetezker, R. (1995). Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science 269,690-693. Sutherland, J. D., Kozlova, T., Tzertzinis, G., and Kafatos, F. C. (1995). Drosophila hormone receptor 38: A second partner for Drosophila USP suggests an unexpected role for nuclear hormone receptors of the nerve growth factor-induced protein B type. Proc. Natl. Acad. Sci. U.S.A. 92,7966-7970. Talbot, W. S., Swywryd, E. A., and Hogness, D. S. (1993).Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell (Cambridge, Mass.) 73,1323-1337. Thomas, H. E., Stunnenberg, H. G., and Stewart, A. F. (1993). Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature (London) 362,471-475. Truman, J. W., Talbot, W. S., Fahrbach, S. E., and Hogness, D. S. (1994). Ecdysone receptor expression in the CNS correlates with stage-specific responses to ecdysteroids during Drosophila and Manduca development. Development (Cambridge, UK) 120, 219-234. Tsai, M.-J., and O'Malley, B. W. (1994). Molecular mechanisms of action of steroidkhyroid receptor superfamily members. Annu. Rev. Biochem. 63,451-486. Umess, L. D., and Thummel, C. S. (1995). Molecular analysis of a steroid-induced regulatory hierarchy: The Drosophila E74A protein directly regulates L71-6 transcription. EMBO J . 14,6239-6246. Vafapoulou, X., and Steel, C. G. H. (1997). Ecdysteroidogenic action of Bombyx prothoracicotropic hormone and bombyxin on the prothoracic glands of Rhodnius prolixus in vitro. J. Insect Physiol. 43,651-656. Vedeckis, W. V., Bollenbacher, W. E., and Gilbert, L. I. (1976). Insect prothoracic glands: A role for cyclic AMP in the stimulation of a-ecdysone secretion. Mol. Cell. Endocrinol. 5 , 8 1 4 8 . Wagner, R. M. Loeb, M. J., Kochansky, J. P., Gelman, D. B., Lusby, W. R., and Bell, R. A. (1997). Identification and characterization of an ecdysiotropic peptide from brain extracts of the gypsy moth, Lymantria dispal: Arch. Insect Biochem. Physiol. 34, 175-189. Warren, J. T., and Gilbert, L. I. (1986). Ecdysone metabolism and distribution during the pupal-adult development of Manduca sexta. Insect Biochem. 16,65-82. Warren, J. T., Bachman, J. S., Dai, J.-D., and Gilbert, L. I. (1996). Differential incorporation of cholesterol and cholesterol derivatives by the larval ring glands and adult ovaries of Drosophila melanogaster: a putative explanation for the 1(3)ecd1mutation. Insect Biochem. Mol. Biol. 26,931-943. Warren, J. T., Sakurai, S., Rountree, D. B., Gilbert, L. I., Lee, S.-S., and Nakanishi, K. (1988). Regulation of the ecdysteroid titer of Manduca sexta: Reappraisal of the role of the prothoracic glands. Proc. Natl. Acad. Sci. U.S.A. 85,958-962. Watson, R. D., Yeh, W. E., Muehleisen, D. P., Watson, C. J.,and Bollenbacher, W. E. (1993). Stimulation of ecdysteroidogenesis by small prothoracicotropic hormone: Role of cyclic AMP. Mol. Cell. Endocrinol. 92, 221-228. Watson, R. D., Ackerman-Morris, S., Smith, W. A., Watson, C. J., and Bollenbacher, W. E. (1996). Involvement of microtubules in prothoracicotropic hormone-stimulated ecdysteroidogenesis by insect (Manduca sexta) prothoracic glands. J . Exp. 2001.276, 63-69. Weigel, D., Jurgens, G., Kuttner, F., Seifert, E., and Jackle, H. (1989). The homeotic gene
PEPTIDE HORMONES, STEROID HORMONES, AND PUFFS
125
fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell (Cambridge, Mass.) 57,645-657. White, K. P., Hurban, P., Watanabe, T., and Hogness, D. S. (1997). Coordination of Drosophila metamorphosis by two ecdysone-induced nuclear receptors. Science 276, 114-117. Woodard, C. T., Baehrecke, E. H., and Thummel, C. S. (1994).Amolecular mechanism for the stage-specificity of the Drosophila prepupal genetic response to ecdysone. Cell (Cambridge, Mass.) 79, 607-615. Yao, T. P., Forman, B. M., Segraves, W. A., Oro, A. E., McKeown, M., Cherbas, P., and Evans, R. M. (1992). Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell (Cambridge, Mass,) 71,63-72. Yao, T. P., Forman, B. M., Jiang, Z. Y., Cherbas, L., Chen, J. D., McKeown, M., Cherbas, P., and Evans, R. M. (1993). Functional ecdysone receptor is the product of EcR and ultraspiracle genes. Nature (London) 366,476-479. Zelhof, A. C., Yao, T., Chen, J. D., Evans, R. M., and McKeown, M. (1995a). Seven-up inhibits ultraspiracle-based signalling pathways in vitro and in viuo. Mol. Cell. Biol. 15,6736-6745. Zelhof, A. C. Yao, T., Evans, R. M., and McKeown, M. (1995b). Identification and characterization of a Drosophila nuclear receptor with the ability to inhibit the ecdysone response. Proc. Natl. Acad. Sci. U.S.A. 92,10477-10481. Zitiian, D., Sehnal, F., and Bryant, P. J. (1993). Neurons producing specific neuropeptides in the central nervous system of normal and pupanation-delayed Drosophila. Dev. Biol. 156, 117-135. Zollman, S., Gotd, D., Prive, G. G., Courderc, J. L., and Laski, F. A. (1994). The BTB domain, found primarily in zinc finger proteins, defines an evolutionarily conserved family that includes several developmentally regulated genes in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 91, 10717-10721.
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
Nuclear Matrix and Steroid Hormone Action THOMAS J. BARRETT AND THOMAS C. SPELSBERG Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota 55905 I. Introduction and Background 11. Nuclear Matrix-Chromatin Structure A. Chromatin Structure B. The Nuclear Matrix: Definition and Structure C. Nuclear Matrix Proteins 111. Steroid-Hormone-Induced Effects on Chromatin Structure and Matrix Composition A. The Steroid Receptor Supergene Family B. Mechanism of Steroid Action on Gene Transcription C. Steroid-Induced Changes in Chromatin Structure IV Contributions of the Nuclear Matrix to Steroid-Mediated Gene Transcription A. Role of the Chromatin-Matrix-Associated High-Mobility Group Proteins in ER and PR Action B. Role of Chromatin-Matrix Proteins in GR Action on Gene Transcription C. Role of Matrix Proteins in Vitamin D Action on Gene Transcription V. Role of the Nuclear Matrix in Steroid Hormone Signaling and Nuclear Binding A. Potential Role of Nuclear Matrix Channels in Steroid Signaling B. Studies in This Laboratory on Steroid Receptor Binding to the Nuclear Matrix C. Novel Nuclear Matrix Acceptor Sites for PR VI. Maintenance of the Nuclear Matrix by Steroid Proteins A. Androgens and Apoptosis: The Prostate Nuclear Matrix B. Estrogen and Breast Cancer Carcinoma Nuclear Matrix C. Estrogen Regulation of Nuclear Matrix Intermediate Filaments D. Interferon Induction of Specific Nuclear Matrix Proteins VII. Conclusions and Future Directions A. Chromatin Remodeling B. Potential HRE-MAR Interactions during Transgene Expression C. Estrogen and Nuclear Matrix: Potential Role in “Gene Memory” D. Nuclear Matrix Proteins as Biomarkers for Cancer and Apoptosis References
I. INTRODUCTION AND BACKGROUND Since there have been multiple reviews on various aspects of the nuclear matrix (see Berezney and Jeon, 1995, and Romanini and Fraschini, 1996,for major reviews),including steroid hormones and the nuclear matrix (see reviews by Beato et al., 1996; Spelsberg et al., 1996; Lauber et al., 1995),this article focuses on newer and/or novel aspects 127
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99 $25.00
128
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
on the subject. The nuclear matrix has been shown to have a role in DNA organization, replication, transcription, and the processing of mRNA and possibly intranuclear signaling for the regulation of gene transcription (Berezneyand Jeon, 1995; Spelsberg et al., 1996;Lauber et al., 1995). The matrix attachment regions (MARS)or sites throughout the genome involve 1-4% of the DNA and occur at DNase hypersensitive sites near active genes and contain many transcription factors (Guo et al., 1995; Merriman et al., 1995), including nuclear protooncogenes (Evan and Hancock, 19851,tumor suppressor genes (Durfeeet al., 1994; Mancini et al., 19941, and DNA repair enzymes (Smith and Berezney, 1982,1983).It is further speculated that there may be constitutive and regulatory MARS,the latter transiently attached to transcriptionally active genes and involved in their regulation (Bode et al., 1995). The nuclear matrix has been implicated in the actions of steroid hormones on gene expression (for reviews, see Lauber et al., 1995; Beato et al., 1996; Spelsberg et al., 1996). In uiuo and in uitro analyses has demonstrated that steroid receptors are localized to the nuclear matrix in a wide variety of target tissues (Ruh et al., 1996). Steroid hormones have been shown to regulate the mRNA and protein levels of a variety of nuclear protooncogenes and tumor suppressor genes, which are associated with the nuclear matrix (for a review, see Schuchard et al., 1993).Similarly, a steroid regulation of the levels of several nuclear matrix intermediate filament proteins has been reported in steroid-responsive breast cell lines, but not in nonresponsive cell lines (Coutts et al., 1996). The authors’ laboratory has previously reported that the chromatin acceptor sites for the avian progesterone receptor and the nuclear matrix binding sites are one and the same. In fact, the isolated receptor binding protein for the avian progesterone receptor, involved in the nuclear acceptor sites, was shown to be associated with the nuclear matrix and to bind specifically to an element residing within an MAR (Lauber et al., 1997). This article discusses these observations for the nuclear matrix and the avian oviduct progesterone receptor as well as other characteristics of the nuclear matrix associated with steroid hormone action. Where possible, pertinent reviews are referenced in place of original publications, due to space and reference limitations.
-
11. NUCLEAR MATRIX-CHROMATIN STRUCTURE
A. CHROMATIN STRUCTURE The eucaryotic nucleus can be thought of as a highly ordered, compartmentalized organelle. Classical ultrastructural studies have dem-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
129
onstrated that the cell nucleus is an elaborate structure composed of regions of chromatin, which includes the DNA bound with a variety of proteins and attached to a nonchromatin infrastructure of nucleoprotein fibrillary network, which includes the nuclear matrix. Nuclear DNA exists as a hierarchy of chromatin structures, resulting in compaction of nuclear DNA about 10,000-fold. The primary repeated structural unit of chromatin is the nucleosome (Van Holde, 1988).The nucleosome consists of 146 base pairs (bp) of DNA wrapped around a protein core of histones H2A, H2B, H3, and H4 (core histones). These histones are arranged as an (H3-H4), tetramer and two H2A-H2B dimers positioned on each face of the tetramer, giving rise to the 10-nm fiber. The DNA between the nucleosomes (linker DNA) is bound by histone H1 or linker histones. The linker histones and core histones maintain the higher order folding of chromatin, known as the solenoid or 30-nm chromatin fiber. AND STRUCTURE B. THENUCLEAR MATRIX: DEFINITION As depicted in Fig. 1,the solenoid, in turn, is organized into loop domains, with the base of the loop attached to the nuclear matrix (Gasser and Laemmli, 1986, 1987). The DNA regions attached to the nuclear matrix contain adenosine thymidine (AT)-rich domains and are referred to as matrix (or scaffold) association regions (MARS or SARs or SIMARs: Berezney and Coffey, 1974,1975,1976,1977; Berezney, 1979, 1991; Laemmli et al., 1992).The DNAloops have an average size of between 5 and 200 kilobases (kb), with 20% of the loops being around 7.5 kb (probably encompassing one gene) and 80% being between 50 and 175 kb (encompassing many genes). The nuclear matrix is defined as the nuclear structure remaining after the nuclease treatment of saltextracted nuclei (Berezney, 1991). Depending on the method of isolation, nuclear matrices contain large amounts of protein, tightly bound RNA, lesser amounts of DNA, and only trace amounts of lipids if nonionic detergent extraction is performed.
C. NUCLEAR MATRIXPROTEINS The major component of isolated matrices is a multitude of different proteins with an enrichment of the higher molecular weight nonhistone proteins in the nucleus and a depletion of low-molecular-weight proteins, especially the histones. The nuclear matrix proteins can be separated into two major classes: those that are common matrix proteins found in all cell lines and tissues and those that are cell type, tissue, and differentiation state specific (Fey and Penman, 1988; Stuurman et al., 1990; Dworetzky et al., 1990; Getzenberg, 1994). The common nuclear matrix proteins are the lamins A and C but not
130
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
Other Active Genes
Active (-60 kb)
GllVI Ina-”---
Chrr
FIG.1. Model depicting nuclear matrix attachment regions (MARS)or sites to the DNA. The MAR involved in holding the chromatin loop is shown as a “constitutive” MAR, which is a permanent structure established during cell division in a pattern determined by the cell phenotype and differentiation state. Each constitutive MAR maintains its DNA loop in a particular structural state, for example, active vs inactive genes, and serves as a n origin of replication. In the looped regions other “regulatory” MARS are transiently attached to transcriptionally active genes and are involved in the regulation of gene expression. Not shown are nucleosomal structures, histones H1,and other potential protein structures. NM, nuclear matrix. (Adapted from Bode et d.,1995.)
B and several nuclear matrins (Berezney, 1991). The exact function of these proteins is not known but they have been shown to bind DNA. There is a myriad of other proteins that have been identified as minor components of the nuclear matrix (see review by Martelli et al., 1996). Other prominent proteins that are associated with the nuclear matrix are the oncogene proteins (Evan and Hancock, 1985);tumor suppressor gene proteins such as retinoblastoma protein (Durfee et al., 1994; Mancini et at., 1994);splicing factors (Smith et al., 1989);transcription factors such as nuclear matrix protein-1 (NMP-1) and NMP-2 (Guo et al., 1995; Merriman et al., 1995)and others (Nardozzaet al., 1996; van Wijnen et al., 1993; Kim et al., 1996); DNA-binding proteins such as RBF (Schuchard et at., 1991a,b);or enzymes such as DNA polymerase ci (Smith and Berezney, 1982, 19831, RNA polymerase I (Dickinson et al., 1990),RNA polymerase I1 (Lewis et al., 1984), histone deacetylase (Hendzel et al., 1991),protein kinase C (Capitani et al., 1987); and finally, casein kinase 2 (Tawfic and Ahmed, 1994a).Note that the nuclear matrix contains RNA (both heteronuclear RNAs and small nuclear
NUCLEAR MATRIX AND STEROID HORMONE ACTION
131
RNAs). The biological significanceof some of these associations also remains to be determined. One primary role of the nuclear matrix is to maintain the shape and size of the nucleus utilizing the nuclear actin molecules (review by Verheijen et al., 1988). There are a multitude of functions associated with nuclear matrix including DNA loop attachment sites, DNA synthesis, gene transcription, RNA splicing, RNA transport, and viral protein and gene regulatory protein associations with the matrix (Verheijen et al., 1988). The significance of these associations is unknown, but they are obviously involved in the replication and transcription of the DNA. The exact molecular mechanism of action of the nuclear matrix remains to be determined. In any event, the primary goal of this article is to discuss and interpret the literature regarding the mechanisms of steroid hormone action associated with nuclear matrix-chromatin structure and to generate new models to explain these interactions. 111. STEROID-HORMONE-INDUCED EFFECTS ON CHROMATIN STRUCTURE AND MATRIXCOMPOSITION A. THESTEROID RECEPTORSUPERGENE FAMILY
The steroid receptors are ligand-activated transcription factors (Yamamoto, 1985). The steroid receptor supergene family can be divided into two smaller subfamilies based on the class of ligand they bind, in particular the steroid-bindingreceptors and the non-steroid-bindingreceptors. The steroid-binding receptors are the glucocorticoid receptor (GR), progesterone receptor (PR), androgen receptor (AR),mineralocorticoid receptor (MR), and estrogen receptor (ER). Their ligands in humans are cortisol, progesterone, androstenedione (women) and testosterone (men), aldosterone, and estradiol, respectively. The nonsteroid-binding receptors are the vitamin D, receptor (VDR), retinoic acid receptor (RAR), and thyroid hormone receptor (TR). They bind 1,25-dihydroxycholecalciferol,retinoic acid, and triiodothyronine (TJ, respectively. It is now known that this receptor superfamily also contains the so-called orphan receptors, which utilize unknown ligands.
B. MECHANISM OF STEROID ACTIONON GENETRANSCRIPTION After diffusion of the steroid into the cell, the classic model of steroid hormone action suggests that receptors undergo a hormone-induced transformation of the native form of the receptor to a form that can interact with target genes. The steroid receptor dimerizes and binds to
132
THOMAS J. BARFtETT AND THOMAS C. SPELSBERG
specific acceptor sites on the chromatidDNA to alter gene expression. In many genes, the steroid receptors bind to specific cis-acting DNA sequences, referred to as hormone response elements (HREs). These elements function as enhancer-like DNA sequences and are required for the steroid hormone regulation of transcription (Jensen, 1991). However, not all steroid-responsive genes contain these elements, and several additional signaling pathways, involving a variety of nuclear proteins, have now been identified. Steroid receptor regulation of gene transcription (review by Beato et al., 1996) has been shown to involve interactions with general transcription factors (TAFI13O,TBP, TFIIB, and dTAF,,110), sequence-specifictranscription factors (AP-1,GATA-1, RelA, OTF1, and PML), coactivators (RIP140, ERAP, TIF-2, SRC-1, RSP6, TIF1, SUG1, and GRIP170), and chromatin-nuclear matrix factors (HMG-1,Brm, SWIISNF, Spt6, and RBF). Van Steensel et ul. (1995) have characterized the steroid receptor binding domains required for binding to the nuclear matrix for the glucocorticoid and androgen receptors. The following is a discussion of steroid-hormone receptor interaction with chromatin-DNA and nuclear matrix proteins in the context of gene transcription. C. STEROID-INDUCED CHANGES IN CHROMATIN STRUCTURE Steroid hormones have long been known to affect chromatin structure. For example, the mouse mammary tumor virus (MMTV) promoter is transcriptionally controlled by glucocorticoids and progestins. The hormone receptors bind to an HRE and facilitate the interaction of other transcription factors, in particular NF-1/CTF-1 and OTFl/Oct-1 (see reviews by Beato, 1991; Beato et al., 1996). Functional studies with cell lines carrying stable minichromosomes (Richard-Foy and Hager, 1987; Cordingley et al., 1987) and in uitro nucleosome reconstitution studies (Perlmann and Wrange, 1988; Piiia et al., 1990;Archer et al., 1991) suggest that hormone receptors recognize the HRE in the MMTV promoter. However, access of the transcription factor NF-1 is hindered by the nucleosomal organization. These and other in uivo chromatin DNase-1 hypersensitive region analyses (Chavez et al., 1995; Candau et al., 1996) suggest that the basal repression of the MMTV promoter before hormone induction is due to chromatin ultrastructure. Hormone induction is believed to cause a displacement or disruption of the nucleosome over the hormone response region, which facilitates NF-1 interaction and transcription. A similar mechanism of nucleosome disruption has been postulated for the hormone regulation of the glucocorticoid-induced rat tyrosine aminotransferase gene (Nitsch et al., 1990). Steroid-induced DNase-1 hypersensitive regions have also
NUCLEAR MATRIX AND STEROID HORMONE ACTION
133
been found in the chicken lysozyme gene in oviduct cells (Fritton et al., 1983), the chicken vitellogenin gene in liver (Burch and Weintraub, 1983), and the rabbit uteroglobin gene in endometrium (Jantzen et al., 1987). In these cases, it was assumed that the DNase-1 hypersensitive regions are due to steroid-induced disruption of nucleosome(s). Chromosome structure and nuclear matrix interaction appear to also be important in steroid hormone-mediated transcriptional control. A good example is the osteocalcin gene promoter (Montecinoet al., 1996; Stein et al., 1997). The osteocalcin gene promoter is extremely complex and is regulated in a tissue type and developmental stage specific manner. In immature, proliferating normal osteoblasts, the osteocalcin gene is repressed and refractive to vitamin D. Nucleosomes occupy the VDR response element (VDRE)and the flanking osteocalcin boxes I (OC Box I) and OC Box I1 (Montecino et al., 1994). Further, there are no nuclease hypersensitive sites at the VDRE or surrounding flanking sequences (OC Box) in the promoter of this transcriptionally inactive gene. In contrast, when the osteoblasts are not proliferating, the osteocalcin gene is transcriptionally up-regulated and a vitamin D-mediated enhancement of transcription is observed. In the activated state, the VDRE and surrounding DNA region of the OC gene become flanked by DNase 1hypersensitive sites. Such DNase hypersensitive sites have been associated with MAR sequences and attached nuclear matrix (Berezney and Jeon, 1995; Lauber et al., 1995). Moreover, in ROS 17-2.8 osteosarcoma cells that have vitamin D receptors, there is a further transcriptional up-regulation of the osteocalcin gene, with marked changes in nucleosome placement at the VDRE and in the OC Box. In addition these gene promoter sequence become DNase 1hypersensitive (Montecinoet al., 1994;Breen et al., 1994).However, in ROS 24-1 cells, which lack the vitamin D receptor, there is a complete absence of hypersensitivity at these sites and nucleosomes are present in the VDRE and OC Box domains of this osteocalcin gene promoter (Montecino et al., 1994; Breen et al., 1994). These studies demonstrate a functional relationship between structural modifications in chromatin and the hormone-mediated regulation of gene transcription. OF THE NUCLEAR MATRIX TO STEROID-MEDIATED IV. CONTRIBUTIONS GENETRANSCRIPTION
A. ROLEOF THE CHROMATIN-MATRIX-ASSOCIATED HIGHMOBILITY GROUPPROTEINS IN ER AND PR ACTION Evidence suggest that the construction of a successful minimal transcription initiation complex requires DNA sequence recognition, DNA
134
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
binding, and the bending of the DNA (see review by Beato and SanchezPacheco, 1996). The family of mammalian high mobility group (HMG) proteins are abundant, chromatin-nuclear matrix-associated proteins that bind nonspecifically to DNA and promote DNA bending (Paul1 et al., 1993).The HMG-1Y protein assembles with transcription complexes containing transcription factors such as ATF-2, Jun, and NF-KB(Du et al., 1993), whereas the HMG-2 protein can either activate or repress basal promoter activity in transcription reconstitution assays (Stelzer et al., 1994).The HMG-1 protein has been reported to enhance the binding of ER and PR to their respective HREs (Verrier et al., 1995; Ofiate et czl., 1994). Although HMG-1 protein promotes ER-ERE binding, it fails to stimulate transcription initiation in the presence or absence of hormone. In contrast, tumor-associated transplantation antigen (TATA)-bindingprotein-associated factor (TAF,,30), although not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1 (Verrier et al., 1997). So it appears that HMG-1 protein is an architectural element that bends DNA and facilitates the binding of proteins such as TAF',,30 to their DNA elements. In general, protein-protein interactions could facilitate chromatin looping, allowing the ER complex and proximal promoter distances to be reduced. This is demonstrated by the estrogen-stimulated increase in ligation efficiencybetween distal enhancer and proximal promoter regions in the prolactin gene (Cullen et al., 1993). In the case of HMG-1 protein promoting PR DNA binding, the physiological relevance and molecular mechanism are unknown. B. ROLEOF CHROMATIN-MATRIX PROTEINS IN GR ACTION ON GENETRANSCRIPTION A convergence of biochemical and genetic studies has identified several ATP-dependent multiprotein complexes that may help transcriptional activators overcome chromatin-mediated repression (Kingston et al., 1996). The SWI-SNF complex is an example of one of these complexes. The SWI (for mating type switching) and SNF (for sucrose nonfermenting) genes were first identified in yeast (SWI-SNF gene complex) by mutations interfering with the activation of several inducible promoters (Peterson, 1996). Glucocorticoid receptor expression studies in yeast have revealed that the glucocorticoid receptor interacts with proteins that are components of the SWI-SNF complex, namely SWI3 both in uitro and in viuo (Yoshinaga et al., 1992).Evidence suggest that the SWI-SNF are a set of pleiotropic transactivators, which appear to be important for transcription of inducible genes, probably by mecha-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
135
nisms involving remodeling chromatin (Winston and Carlson, 1992; Reyes et al., 1997). A screen for suppressors of the swi-snf phenotype identified several mutations in core histones and other structural proteins of chromatin suggesting that components of the SWI-SNF complex counteract the repression activity of chromatin proteins. A suppressor of the swi-snfphenotype, Spt6, potentiates transactivation by ER in yeast and has been postulated to act as a coactivator (Baniahmad et al., 1995). Ahomologue of SWIB in Drosophila (Brahma [brml)is a helicase with DNA-dependent ATPase activity (Tamkun et al., 1992). The human, hbrm, is a 180-kDa nuclear factor that can act as a transcription factor when fused to a heterologous DNA-binding domain. The mouse brm is expressed ubiquitously, whereas hbrm is expressed only in selected cells. In cell lines lacking hbrm, the GR induction of a transfected reporter is weak and can be selectively enhanced by cotransfection of an hbrm expression vector (Muchardt and Yaniv, 1993). A second human homologue of yeast SWIB and Drosophila brm, named BRG1, is a nuclear protein of 205 kDa, which ATPase domain can, as a chimeric protein, restore GR-dependent transcription in yeast lacking SWI2 (Khavari et al., 1993). Like SWIB in yeast, hbrm is part of a large multiprotein complex, which could be involved in the remodeling of chromatin required for transcription. These complexes may also act as a bridge between activators and the basal transcriptional machinery. The human SWI-SNF complex has been shown to mediate ATP-dependent disruption of a nucleosome containing GALCbinding sites, and enables binding of transactivators linked to the GAL4 DNA-binding domain to the nucleosome core (Kwon et al., 1994). Moreover, the retinoblastoma gene product (Rb) up-regulates GR-mediated transactivation, which is dependent on hbrm (Singh et al., 1995). Thus, components of the SWI-SNF complex also can act as a connection between gene regulation and cell cycle. C. ROLEOF MATRIXPROTEINS IN VITAMIN D ACTION ON GENETRANSCRIPTION The bone-specific nuclear matrix protein-1 (NMP-1) and NMP-2 interact with DNA sequences overlapping and flanking the VDRE in the osteocalcin gene promoter, respectively (Bidwell et al., 1993). Further characterization of NMP-2 has revealed that it is an AML-related transactivation protein (Merriman et al., 1995; Lindenmuth et al., 1997) and that AML transcription factors activate the bone-specific osteocalcin promoter through an NMP-2-binding site (Banerjee et al., 1996). Using in situ immunofluorescence and deletion mutation analysis, Zeng et al.
136
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
(1997) identified and characterized the nuclear matrix targeting signal in the AML transcription factors. This protein domain is physically distinct from the nuclear localization signal and functions independently of the DNA-binding activity. Moreover NMP-1 has been shown to be a YY1 transcription factor (Guo et al., 1995). Overexpression of YY1, which binds to a site overlapping the osteocalcin gene VDRE, abrogates the vitamin-D-mediated up-regulation of transcription (Stein et al., 1997). Alvarez et al. (1997) have shown that the rat osteoblast and osteosarcoma nuclear matrix proteins bind with sequence specificity to the rat type I collagen promoter, suggesting that nuclear matrix may be pivotal in mediating the tissue-specific regulation of type I collagen expression. In summary, these findings, along with the previously mentioned nucleosome disruption studies, suggest that both the nuclear matrix and chromatin structure associated with a gene are important in modulating accessibility of promoter sequences to transcription factors and in coordinating the activity of multiple regulatory domains.
I? ROLEOF THE NUCLEAR MATRIX IN STEROID HORMONE SIGNALING AND NUCLEAR BINDING ROLEOF NUCLEAR MATRIX CHANNELS A. POTENTIAL IN STEROID SIGNALING Razin (1996) and Razin and Gromova (1995) envisioned the nuclear matrix as a system of channels connecting the nuclear interior with nuclear pores (cytoplasm). As depicted in Fig. 2, active DNA sequences (both in terms of transcription and replication) are attached to these channels in such a way that the transport of important macromolecules, such as regulatory factors, from the cytoplasm to the nucleus is rapid and efficient, enabling direct access to these multiprotein complexes. Such a model could explain rapid steroid hormone receptor shuttling and nuclear interactions (LaCasse et al., 1993; GuiochonMantel et al., 1996). This could facilitate the movement of activated steroid hormone receptor to the multiprotein complexes involved in DNA replication, gene transcription, and/or the cell cycle, accounting for rapid and tissue-specific hormone-mediated responses in the cell. IN THISLABORATORY ON STEROID RECEPTOR BINDING B. STUDIES TO THE NUCLEAR MATRIX
Early work showed that whole nuclei and/or nuclear matrix contained saturable high-affinity binding sites for activated progesterone
NUCLEAR MATRIX AND STEROID HORMONE ACTION
,,
137
Loops of chromatin fibers attached to the nuclear matrix (scaffold). Nucleosomes and 30 nm fibers are not shown for simplicity.
Active genes attached to the matrix channels through regulatory domains
/
Nuclear Pore
Y.r
Channel
An RNP-transported to cytoplasm
Nuclear Lamina
FIG.2. Aproposed model ofchromosome organization, based on a n assumption that the nuclear matrix is a system of internal nuclear channels. (Taken in part from The channels model of the nuclear matrix structure, S. V. Razin and I. I. Gromova, BioEssuys, 17. Copyright 0 1995. Reprinted by permission of Wiley-Liss, Inc., a subsidiary of John Wiley & Sons, Inc.)
receptors (Spelsberg et al., 1976, 1983, 1984; Thrall and Spelsberg, 1980). Only DNA associated with chromatin-nuclear matrix proteins would be bound specifically by the PR. Pure genomic DNA did not specifically bind PR with saturable kinetics (Toyoda et al., 1985; Hora et al., 1986; Spelsberg et al., 1987a, 1989; Goldberger and Spelsberg, 1988; Schuchard et al., 1991a,b; Rejman et al., 1991). Laboratories investigating other steroid receptor systems have reported specific receptor-binding sites (acceptor sites) in the nuclear chromatin and nuclear matrix for a variety of steroid receptors (Rories and Spelsberg, 1989; Landers and Spelsberg, 1991,1992; Ruh et al., 1996). In previous studies in the avian PR system, a receptor binding factor (RBF) was isolated as an “activity” in the avian oviduct chromatin, which was subsequently localized to the nuclear matrix. By reconstituting crude or subsequently purified RBF protein fractions back to DNA, saturable high-capacity binding sites could be obtained. These sites displayed in uivo patterns of binding using seasonally active and inactive PR and binding kinetics (Spelsberg et al., 1976, 1989; Hora et al., 1986;
138
THOMAS J. BARRETTAND THOMAS C. SPELSBERG
FIG.3. Computer generated model of a RBF dimer. Analysis of the primary and secondary structure of the RBF protein was performed by computer using peptide structure and helical wheel algorithms contained in sequence analysis software package produced by the Genetics Computer Group (GCG) of the University of Wisconsin, Biotechnology Center, Madison (Lauber et al.,1997; Barrett et al.,1998).
Schuchard et al., 1991b).Moreover, this binding displayed a specificity to the eucaryotic genomic DNA in the reconstituted complex by not showing any binding to insect or bacterial genomic DNA (Toyoda et al., 1985; Spelsberg et al., 1987a).Thus, RBF appears to be a DNA binding protein and an essential protein component of progesterone receptor nuclear acceptor sites. A computer-generated structure of RBF in Fig. 3 shows structural similarities to several other DNA-binding proteins, including transcription factors (Berget al., 1990; Bergemann et al., 1992; Somers and Phillips, 1992; Qian et al., 1993; Raunmann et al., 1994). Immunohistochemical staining showed that RBF was located in the nucleus and colocalized in cells that also expressed progesterone receptor, such as avian oviduct and rat reproductive tissues (Zhuanget al., 1993).
NUCLEAR MATRIX AND STEROID HORMONE ACTION
139
FIG.4.Cascade model for steroid hormone action on gene expression. The regulatory gene represents a n early gene with a MAR/acceptor site, that is, RBF and DNA elements in the c-myc gene promoter. The structural gene represents a late gene. S, steroid; R, steroid receptor; SRE,steroid receptor response element. (Adapted from Landers and Spelsberg, 1991.)
C. NOVELNUCLEAR MATRIXACCEPTOR SITESFOR
THE
PR
It had been previously hypothesized and is outlined in Fig. 4 that steroid-inducedgene regulation might involve early “regulatory”genes whose transcription would be rapidly modulated by steroid receptor binding and whose protein products would, in turn, regulate the transcription of genes involved in “later” cellular events (Spelsberg et al., 1983,1987b;Rories and Spelsberg, 1989;Landers and Spelsberg, 1991, 1992).The rapidly responding c-myc gene was shown to fit this model. Fink et al. (1988) showed that the avian c-myc gene, a nuclear protooncogene,was rapidly regulated by progesterone in viva Even though there is no classical steroid hormone response element present in the 5‘-flanking region, this rapid progesterone-mediated down-regulation of the c-myc gene occurred within minutes, was steroid-dose-dependent, and tissue-specific. A variety of other nuclear protooncogenes have also been shown to rapidly respond to steroid hormones (for a review, see Schuchard et al., 1993; Spelsberg et al., 1993). Subsequently,
140
THOMAS J. BARRETT AND THOMAS C . SPELSBERG
A
t
---
I
H
-676
RBF
1I I I 1
Nuclear
I I I 1
I
1
I
1
I I
I Attachment I I Matrix
,hl, 16
11 Jd?
-
,
I
-252
-102
I
-
1
;++I I++/
I
- II -
1
I I I
1 1 1
I I I
I 1
I I I
1 1 1
I
1
- I ++++
!--/++++I
++
I I
---
t345
t1
I I
U S 4 M ~ - 2 u
>
K
J
-582
I I
c-myc gene
I
I I I
I I I
I I I I I
I
+
-
I I I
B
Nuclear Malrix
I
4!? :
j 450 ; -423
Nuclear Matrix
-310
Potentlal MAR Complex
FIG.5 . Schematic representation of the avian c-myc gene and the DNAfragments used for analyses of RBF and nuclear matrix DNA binding. (A) The c-myc gene promoter was subdivided into subfragments H, I, J, and K by restriction enzyme digests. A polymerase chain reaction (PCR) was used to generate subfragments of the I region (II-III). Shown is a summary of the results of Southern blots, southwestern blots, and mobility shift assays. Four plus signs indicate highest affinity. (Taken in part from Lauber et al., 1997). (B) Proposed model of the nuclear matrix attachment and RBF complex for steroid receptor binding in the c-myc gene promoter. Evidence suggests that the nuclear matrix shares sequence homology with regions flanking the RBF-binding element in the 5 ’ flanking region of the c-myc gene. The interaction of nuclear matrix DNA and a dimer of RBF to specific regions in the c-myc promoter would potentially form the secondary structures necessary for high-affinity steroid-receptor-binding sites and subsequent regulation of the c-myc gene transcription by steroid hormones. The RBF dimer is included since the peptide structure indicates a possible leucinei-isoleucine-likezipper structure in the C-terminal end of the protein. (Taken in part from Lauber et al., 1997).
Schuchard et al. (1991a,b)demonstrated by Southern blot analyses that the nuclear matrix DNA shows sequence homology with the 5’-flanking regions of a few rapidly responding steroid regulated genes, in particular c-myc and c-jun. In short, the nuclear matrix appears to be attached
NUCLEAR MATRIXAND STEROID HORMONE ACTION
141
to the promoters of these genes. There was no nuclear matrix DNA sequence homology with genomic sequences in several late steroid regulated genes such as the ovalbumin or the a-actin genes. Since the RBF protein is localized in the avian oviduct nuclear matrix, and the matrix is attached to the c-myc promoter region, it was of interest to determine whether or not, RBF also binds to the 5’4anking region of the c-myc gene. Studies by Lauber et al. (1997) using southwestern blotting analyses identified a 54-bp RBF-binding element in the c-myc promoter, with a striking feature of a predominately 5’-GC-richregion and 3’AT-rich region containing a long poly(A)-poly(T) track (i.e., polypurine-polyprymidine tract).As outlined in Fig. 5A, the nuclear matrix was shown not to bind to this element, but to bind to regions flanking the RBF element. In MCF-7 cells stimulated with estrogen and progesterone, transient transfection studies showed that the overexpression of RBF results in a decrease of the c-myc promoter activity (Lauber et al., 1997). Studies have shown that the RBF binds to either a single- or double-stranded DNA element possibly as a dimer via its C-terminal domain (Barrett et al., 1998).This is depicted in Fig. 5B. Moreover, preliminary evidence suggests that RBF can bind to PRB, with an affinity capable of inhibiting PRB binding to its PR element (PRE) (Barrett et al., 1998). It remains to be determined if cofactors, such as HMG-1, will impinge on PR-RBF protein interactions and DNA binding. VI. MAINTENANCE OF THE NUCLEAR MATRIX BY STEROID HORMONES A. ANDROGENS AND APOPTOSIS:THEPROSTATE NUCLEAR MATRIX One of the frequently studied models of programmed cell death, or apoptosis, is the response of prostatic grandular epithelium to androgen withdrawal. Apoptosis, which occurs in the rat prostate after orchiectomy (androgen withdrawal), is the cause of the loss of 80% of the secretory epithelium between 2 and 6 days (Berges et al., 1993). In this apoptotic process, the nucleolus dissolves (Kerr, 1971), chromatin condenses (English et al., 19891, and there is an influx of calcium (Kyprianou et al., 1988) and the formation of apoptotic bodies (English et al., 1989).Apoptosis in the prostate is also associated with a decline in prostatic rRNA synthesis and assembly after androgen deprivation (Mainwaring and Wilce, 1973; Mainwaring and Derry, 1983). With androgen withdrawal, there is a modulation of gene expression so that the expression of some genes, for example, c-fos, c-myc, and heat-shock proteins (Buttyan et al., 1989), is enhanced, and that of others, in particu-
142
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
lar protein B23 (Tawficet al., 1993)and protein kinase CK2 (Tawfic and Ahmed, 1994b),is repressed. Furthermore, in prostatic cells, both protein B23 (Nakayasu and Berezney, 1991)and protein kinase CK2 (Tawficand Ahmed, 1994a)are associated with the nuclear matrix, and phosphorylation of nuclear-matrix-associated protein B23 is directly affected by changes in nuclearmatrix-associated CK2 activity (Tawfic and Ahmed, 199410). Protein B23 is associated with DNA synthesis (Feuerstein and Randazzo, 1991; Takemura et al., 19941, chromosome organization in mitosis (Hernandez-Verdun and Gautier, 1994), and ribosome synthesis (Tawfic et al., 1995). On androgen deprivation, the nuclear-matrix-associated CK2 declines rapidly, affecting the rate of phosphorylation of proteins intrinsic to the nuclear matrix. In contrast, androgen administration to castrated rats causes nuclear-matrix-associated CK2 to rapidly increase in prostatic cells (Tawfic and Ahmed, 1994b).One could envision a mechanism where the decline in phosphorylation would enhance protein B23 susceptibility to proteolytic degradation during programmed cell death. On the other hand, the early availability of nuclear-matrixassociated CK2 activity after androgen administration may be pivotal in the phosphorylation and stability of the newly translated matrix-associated protein B23 (Tawfic et al., 1995).
B. ESTROGEN AND BREAST CELLCARCINOMA NUCLEARMATRIX The small heat shock protein hsp27 plays a role in both growth and drug resistance of human breast cancer cells in culture (Oesterreich et al., 1993). Moreover, elevated levels of hsp27 correlate with increased invasion of human breast cancer cells (Lemieux et al., 1996).Analyses of various tumors from breast cancer patients demonstrated that hsp27 is not an independent prognostic marker in breast cancer (Oesterreich et al., 1996a,b).However, hsp27 does predict a significantly worse outcome in a subset of estrogen receptor-positiveand/or untreated breast cancer patients and the expression of hsp27 correlates with the expression of ER in breast tumors (Tandonet al., 1990; Dunn et al., 1993; Oesterreich et al., 1996a,b). Estrogen induces hsp27, correlating with its induction of cell proliferation, in both breast cancer tumors (Seymor et al., 1990)and breast cancer cell lines (Moretti-Rojaset al., 1988).The proximal promoter of hsp27 contains an ER element (ERE) separated by a TATA box (ERE-TATAbox), which Oesterreich et al. (1997)reported was bound by a nuclear matrix protein Hsp27 ERE-TATA binding protein, called HET. The HET protein, in turn, is related by sequence homology to the scaffold attachment factor SAF-B, which is known to
NUCLEAR MATRIXAND STEROID HORMONE ACTION
143
bind to S/MARs, which are AT-rich DNA regions shown to be involved in attaching the base of chromatin loops to the nuclear matrix. The HET protein is localized within the nuclear matrix, and western blot analysis showed that the HET protein is present in ER-positive human breast cancer cells at greater protein levels than ER-negative breast cancer cells (Oesterreich et al., 1997). Transient transfection assays revealed overexpression of the HET protein causes a decrease in the hsp27 promoter activity in a dose-dependent manner (Oesterreich et al., 1997). These authors hypothesize that the HET protein might stabilize an ER-Spl complex that binds cooperatively to an imperfect distal ERE half-site in the promoter of the ER-inducible hsp27 gene (Porter et aZ., 1996).A similar situation has been described for the vitellogenin B1 promoter, where the relatively weak estrogen response is potentiated through chromatin structure (Schild et d., 1993).Thus, it appears that estrogen regulates the nuclear-matrix-associated HET protein, which in turn, binds to the hsp27 promoter and decreases transcription of hsp27, a protein that enhances growth and drug resistance in human breast cancer cells.
C. ESTROGEN REGULATION OF NUCLEAR MATRIX INTERMEDIATE FILAMENTS Structural and functional connections are formed by the tissue matrix system, which enables dynamic interactions and communication between the nuclear matrix, the cytoskeleton, and the extracellular matrix (Pienta and Coffey, 1992).Alterations that independently affect the nuclear matrix, the cytoskeleton (Zambetti et al., 19911, or the extracellular matrix (Boudreau et al., 1995; Streuli et al., 1995) all have been shown to alter the pattern of eucaryotic gene expression. Direct connections between the cell periphery and the nuclear matrix have been demonstrated via the nuclear matrix-intermediate filament (NM-IF) system (Djabali et al., 1991; Georgatos and Blobel, 1987). It is with the understanding that the NM-IF system is intimately connected to the nuclear matrix but, not by definition “nuclear matrix,” that the authors include the following discussion that estrogen regulates the expression of three NM-IF proteins. T47D5 human breast cancer cells, which are ER-positive, grown in estrogen-depleted conditions show dramatically reduced levels of three NM-IF fraction proteins, cytokeratins 8,18, and 19 (Coutts et al., 1996). In contrast, the estrogen-nonresponsive but ER positive, T5-PRF cells (derived from T47D5 cells) overexpress the three cytokeratins compared to the parent cells grown in the presence of estrogen. Moreover, treating the T47D5 cells in estrogen-re-
144
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
plete conditions with the antiestrogens 4-hydroxytamoxifen or ICI164384 resulted in a significant reduction in protein levels (Coutts et al., 1996). So, it appears estrogen regulates three NM-IF proteins in human breast cancer cells, and these proteins may play a role in estrogen action in human breast cancers.
D. INTERFERON INDUCTION OF SPECIFIC NUCLEAR MATRIXPROTEINS Even though this review deals with steroid hormone action, the induction of nuclear matrix protein by interferon (IFN) was judged to be sufficiently interesting to be included. The interferons are a family of secreted multifunctional proteins that are associated with a broad range of biological activities and regulatory functions such as control of cell proliferation, differentiation, and regulation of the immune system (Sen and Lengyel, 1992;Sen and Ransohoff, 1993).The steroid hormone and IFN signaling pathways are intimately associated in numerous experimental systems. Glucocorticoids regulate interferon-a (IFN-a) production in mononuclear cells (Norbiato et al., 1996).The active metabolite of vitamin D, decreases levels of interferon-? (IFN--y) in T lymphocytes (Alroy et al., 1995). Cotransfection assays performed in Jurkat T cells demonstrated that the activity of the initial 108 bp of the IFN--ypromoter was down-regulated in the presence of dexamethasone (Cippitelli et al., 1995).The mouse interferon+ gene in L929 cells is induced by dexamethasone (Soury et al., 1995).Retinoic acid inhibits IFNy synthesis in myelin basic protein-specificMM4 Thl cells, a mouse spinal cord derived cell like (Cantorna et al., 1996).On the other hand, interferons have been shown to enhance, both in uitro and in uiuo, the antiproliferative activity of some steroid hormones and antihormones, which mainly act via steroid receptor (Sica et al., 1996;Lindner et al., 1997;Fanjul et al., 1996). Moreover, IFN might produce changes in cancer cells that enhance or restore hormone sensitivity (Iacopino et al., 1997). In the endometrium of cyclic ewes, interferon-.r regulates estrogen receptor levels (Spencer et .id., 1995). Furthermore, in numerous systems, there is crosstalk between the IFN and steroid-signaling pathways, where one pathway will impinge on the gene-specific regulation of expression of the other (Obermeieret al., 1995;Walker et al., 1997;Lindner et al., 1997; Lin et al., 1996; Tanaka et al., 1996; Smith and Berman, 1992). Some interferon-induced proteins, such as interferon-stimulated protein of 20 kDa (ISG2O: Gongora et d., 1997), PML (Mu et d , 1994; Liu et al., 1995; Terris et al., 1995; Koken et al., 1995), nuclear dot protein 52 (NDP52: Korioth et al., 19951, and SPlOO protein (Grotzinger et al., 1996;Szostecki et al., 1990),have been located in distinct nuclear struc-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
145
tures termed nuclear bodies or promyelocytic leukemia protein-nuclear bodies (PML-NB). These are large multiprotein complexes associated with the nuclear matrix. Under nonpathological conditions, electron microscopy reveals that the PML-NB complexes are distributed evenly throughout the nucleus-nuclear matrix. The number and morphology of PML-NB complexes are variable, particularly throughout the cell cycle and in some pathological contexts. In acute promyelocytic leukemia (APL),the PML protein is part of a fusion product with the retinoic acid receptor a ( M a )resulting from the t(15:17) chromosomal translocation (de-The et al., 1991). The PML-NB complexes display an altered nuclear localization when compared to that of its normal PML and RARa counterparts (Weis et al., 1994). In leukemic cells, PML-NB complexes are disrupted into a microparticulate pattern as a consequence of the expression of the PML-RARa fusion protein. Retinoic acid treatment triggers a reorganization of the nucleus to generate normal appearing PML-NB complexes, which, in turn, is linked to the differentiation of the APL cells. So it appears that normal distribution of the matrix-associated PML-NB complex is pivotal in maintaining the normal structure and function of the lymphoid cells. VII. CONCLUSIONS AND FUTURE DIRECTIONS
A. CHROMATIN REMODELING There is a growing body of evidence that the structure of transcriptionally active chromatin differs from that of the bulk of the genome, such as DNase I hypersensitivity and histone acetylation-deacetylation being associated with active genes (Davie, 1996,1997). It is beyond the scope of this article to fully address this topic. However, there appears to be a link between steroid hormone action and histone modification. The estrogen receptor has been shown t o interact with various intermediary transcription factors (Hong et al., 1997; Henttu et al., 1997; Cavaillks et al., 1995; Kamei et al., 1996; Lee et al., 1995; vom Baur et al., 1996). The estrogen receptors interaction with cyclic AMP (CAMP)response-element-binding (CREB)-bindingprotein (CBP) is of particular interest. The CBP has its own intrinsic histone acetyltransferase activity (Bannister and Kouzarides, 1996; Ogryzki et al., 1996) and is associated with two other histone acetyltransferase proteins, the p300 CBP-associated factor (PCAF;Yang et al., 1996) and the activator of retinoid receptors (ACTR; Chen et al., 1997). Moreover, the SWI-SNF complex, as described previously, participates in the remod-
146
THOMAS 3. BARRETT AND THOMAS C. SPELSBERG
eling of chromatin and the modification of histone tails. Moreover, SWI-SNF has been shown to mediate glucocorticoid (GC) regulation. Taken together, these data suggest that histone acetylation-deacetylation may accompany steroid hormone-dependent transcription. These and other regulatory events, conceivably induced by steroid hormones, may interact in unique combinations to activate specific promoters.
B. POTENTIAL HRE-MAR INTERACTIONS DURING TRANSGENE EXPRESSION Presently, the expression level of foreign genes in mice is largely unpredictable and highly dependent on their integration site. However, some gene constructs are expressed in an integration-site-independent manner. The expression level of these transgenes depends on their copy number and are “insulated from the genomic site of integration. Although the exact sequences responsible for this insulation effect have not been clearly defined, the MARS, locus control regions (LCRs), and specialized chromatin structures (SCS, in Drosophila) have been shown, depending on experimental context, to act as enhancers or insulators or to have no effect on transgene expression levels (reviews by Bode et al., 1996;Attal et al., 1996). Thus, although it currently seems impossible to define which DNA sequence or combination of sequences constitutes an insulator and which mechanisms are involved in establishing gene insulation (Attal et al., 1996).Once these insulating boundaries are better delineated, the question remains as to how will the incorporation of hormone response elements into the design of the promoter affect tissue specificity and overall inducibility of the transgene. Moreover, it has yet to be determined if the RBF element with its flanking matrix attachment sites could play a role in steroid hormonemediated expression of a transgene. One could envision an idealized transgene driven by tissue-specificity, chromatin-matrix interactions, and steroid hormone responsiveness.
C. ESTROGEN AND NUCLEAR MATRIX:POTENTIAL ROLE IN “GENEMEMORY” In the chicken liver, after the initial activation of vitellogenin I (VTGI), vitellogenin I1 (VTGII),vitellogenin I11 (VTGIII), and very low density apolipoprotein I1 (Apo VLDLII) genes by estrogen, subsequent estrogen responses occur more rapidly (Deeley et al., 1977, Jost et al., 1978; Codina-Salada et al., 1983; Evans et al., 1988). If the initial response is allowed to decay to baseline, subsequent administration of es-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
147
trogen results in an earlier accumulation of these egg yolk protein mRNAs. Therefore, the hepatocyte appears to remember the prior exposure to estrogen in a chronological sense, although the estrogen receptor mRNA and protein profiles are identical after primary and secondary estrogen treatments (Evans et al., 1987). Early in development, the egg yolk genes are committed to tissue-specific expression (Evans et al., 1988; Elbrecht et al., 1984)and can retain memory of estrogen exposure for up to 6 months (Burch and Evans, 1986).Thus, memory must be marked in such a way that it persists through several rounds of replication. However, markers of estrogen-dependent alterations in chromatin for the VTGII gene, such as DNase I hypersensitivity (Burch and Weintraub, 1983) and DNA demethylation (Burch and Evans, 1986), last for only 7 weeks and 25 weeks, respectively. Therefore, other estrogen-dependent alterations in the chromatin structure or other molecular mechanism(s) could account for hepatic cell memory. Edinger et al. (1997) have shown by in uiuo dimethylsulfate (DMS) footprinting of genomic DNA amplified by ligation-mediated polymerase chain reaction (PCR) that there is a rapid (5 min) estrogendependent altered DMS accessibility within the EREs of the Apo VLDLII gene promoter. Moreover, the yolk protein genes VTGI, VTGII, VTGIII, and Apo VLDLII display a lag after the administration of estrogen before the rapid accumulation of mRNA. The basis for this lag appears to be due to a delayed increase in the rate of transcription, which results in delayed mRNA accumulations. On a secondary exposure to estrogen, these delays decrease, resulting in a more rapid onset of transcription for VTGI, VTGII, and Apo VLDLII genes (Edinger et al., 1997). The appearance of these altered DNA-protein interactions occurs very rapidly with respect to the accumulation of mRNA, raising the questions of whether the lag and memory are encoded pre- or posttranscriptionally and what role does the nuclear matrix-chromatin Play-
PROTEINS AS BIOMARKERS FOR CANCER D. NUCLEAR MATRIX AND APOPTOSIS 1. Nuclear Matrix Proteins as Cancer Markers Nuclear morphological changes have been correlated with disease progression in carcinomas of the breast (Pienta and Coffey, 1991) and colon (Mulder et al., 19921, and changes in nuclear volume have shown prognostic value in squamous cell carcinoma of the uterine cervix (Sorensen et al., 1992), malignant melanoma (Sorensen et al., 1991),
148
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
and bladder carcinoma (Nielsen et al., 1989). Since nuclear morphology and the three-dimensional structure of the nucleus is largely defined by the nuclear matrix and is the site of actively transcribed genes, it is likely changes in nuclear matrix and/or transcription precede neoplastic transformation, which are reflected in altered nuclear morphology (Keeseeet al., 1996).These specific alterations in nuclear protein structure, including those that comprisethe nuclear matrix, could help to define these observations at the biochemical level and be used as tumor markers. In prostatic adenocarcinoma, the nuclear matrix protein PC-1 was observed in nuclear matrix protein extracts from 14 out of 14 tumors but 0 out of 10 normal proteins (Partin et al., 1993). In a study involving nuclear matrix proteins extracted from either normal human diploid osteoblasts or MG-63 human osteosarcoma cells, at least five proteins were identified that characterized the neoplastic phenotype in osteosarcoma (Bidwell et al., 1994).Tumor-specificor tumor-associated nuclear matrix proteins have been identified in rat prostate (Getzenberg et al., 1991) and human bladder carcinomas (Getzenberg et al., 1996)and in squamous cell carcinoma of the head and neck (McCaffery et al., 1997; Donat et al., 1996). Two of the better characterized nuclear matrix proteins that are being used as diagnosticcancer markers are NuMAand PC-1. Nuclear mitotic apparatus protein, or NuMA, is a nuclear phosphoprotein with a molecular mass of approximately 240 kDa that associates with spindle poles during mitosis (Lydersen and Pettijohn, 1980).Elevated amounts of NuMA were detected from extracted tumor-derived cell lines, such as MCF7 breast, SKBr3 breast, ME 180 cervix, HeLa cervix, and COLO colon as compared to normal cells (Keeseeet al., 1996).Moreover, a soluble form of NuMA can be detected in serum and urine. Early indications are NuMA levels are elevated in serum of patients with breast, bladder, colon, ovary, and prostate cancers. NuMA is also detected in the urine of patients with bladder cancer (Keesee et al., 1996). The nuclear matrix protein PC-1 was consistently detected in nuclear matrix preparations from prostate cancer tissue but was undetectable in benign or normal adjacent prostate tissues (Keesee et al., 1996). Characterization of PC-1 suggest that the polypeptide is either a fragment or an isoform of heterogeneous nuclear ribonuclear protein K (hnRNP K) (Keeseeet al., 1996). It is currently unclear whether the mechanism underlying the association of some nuclear matrix proteins with neoplastic disease simply reflects the up-regulation of cancer-related genes and their protein products during tumorigenesis or the d e novo expression of new genes
NUCLEAR MATRIX AND STEROID HORMONE ACTION
149
required for transformation awaits further investigation. The diagnosis and management of cancer requires markers with a high degree of sensitivity and tissue and/or cancer specificity. Nuclear matrix proteins could represent a new class of tumor markers that could enable the development of assays with increased efficacy for the detection and treatment of cancer. 2. Molecular Changes in the Nuclear Matrix During Apoptosis The balance between proliferation and cell death is a determining factor in the growth kinetics of normal and neoplastic tissue. In neoplastic tissue, necrosis and apoptosis are the two major forms of cell death. Discrimination between these two phenomena is important in understanding mechanisms of tumor growth. In multicellular organisms, apoptosis, or programmed cell death, occurs during morphological modeling of tissues during development, removal of autoreactive immune cells, hormone or age-related atrophy, and maintenance of normal cell turnover. Apoptosis is an energy-requiring process, where the apoptotic cell undergoes a distinct series of morphological changes. After receiving the proper stimulus, the cell’s chromatin condenses and clumps, there is cleavage of the DNA, the nuclear envelope collapses, and there is a loss of cytoplasmic volume and blebbing of the cellular membrane. The resulting fragments, so-called apoptotic bodies, contain nuclear remnants and intact organelles. The apoptotic bodies are recognized and rapidly engulfed by phagocytic cells, macrophages, and/or adjacent cells. As a result, there is no accompanying inflammatory response associated with apoptosis. In contrast, necrotic cell death is characterized by swelling of the endoplasmic reticulum and mitochondria. The cells are unable to maintain ion transport systems, which results in cell swelling and lysis. This provokes inflammatory responses in the surrounding cells in the tissue. Necrosis is due to noxious stimuli or severe injury, such as hyperthermia, hypoxia, ischemia, lytic viral infection, and physical or chemical trauma (Tanuma, 1996). During apoptotic death, there is a marked degradation of several components of the nuclear matrix, that is, lamins, NuMA, topoisomerase 11, poly(ADP-ribose) polymerase (PARP), and numatrin/B23. Several reports have demonstrated that degradation of lamin is a distinctive feature of many types of apoptosis (Ucker et al., 1992; Oberhammer et al., 1994; Lazebnik et al., 1995a; Neamati et al., 1995; Tinnemans et al., 1995; Weaver et al., 1996). In apoptotic thymocytes, proteolyses of lamin B, precedes oligonucleosomalDNA fragmentation (Neamati et al., 1995). These results are intriguing due to nuclear lamins’ ability to bind S/MAR sites (LudBrus et al., 1994). Moreover,
150
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
severed interaction between DNAand the lamins appears to allow DNA to segregate into apoptotic bodies (Lazebnik et al., 1995b). The 240-kDa nuclear matrix protein NuMA is cleaved during apoptosis into a 200- and a 40-kDa fragment (Miller et al., 1994; Hsu and Yeh, 1996; Weaver et al., 1996). It appears that NuMA protein becomes phosphorylated in response t o dexamethasone treatment in thymocytes (Weaver et al., 1996). This phosphorylation might trigger conformational changes within the protein, rendering it a target for a proteolytic enzyme (Weaver et al., 1996). NuMAhas been shown to bind S/MARs (Luderus et al., 1994) and to be a component of nuclear matrix core filaments (Zeng et al., 1994). So, NuMA cleavage might lead to a loss of interactions with other nuclear proteins and depolymerization of the nuclear matrix. PARP is a nuclear matrix component that is degraded by a protease resembling those of the interleukin-1-P-converting enzyme (ICEbced3 family (Kaufman et al., 1993; Lazebnik et al., 1994). During apoptosis, there is enhanced poly(ADP-ribosy1)ationof histone H1 (Noon et al., 1996) and HMG-1 (Giancotti et al., 1996). Both these poly(ADP-ribosy1)ationsmight facilitate internucleosomal DNA fragmentation by increasing the susceptibility of chromatin to endonuclease activity. However, it remains to be determined how the decline of PARP activity due to its proteolysis (Weaver et al., 1996) impinges on the possible poly(ADP-ribosy1)ation-mediatedDNA fragmentation susceptibility. In conclusion, the nuclear matrix undergoes dramatic changes during the apoptotic process. Detection of these changes is helpful in identifying apoptosis in a cell population. Differences between apoptotic, nectotic, and viable cells in their protein profiles will enable a population of cells to be fully characterized, thus furthering our understanding of the phenomena of tumorigenic growth. REFERENCES Alroy, I., Towers, T. L., and Freedman, L. P. (1995). Transcriptional repression of the interleukin-2 gene by vitamin D,: Direct inhibition of NFAT p-AP-1 complex formation by a nuclear hormone receptor. Mol. Cell. Biol. 15,5789-5799. Alvarez, M., Long, H., Onyia, J., Hock, J., Xu, W., and Bidwell, J. (1997). Rat osteoblast and osteosarcoma nuclear matrix proteins bind with sequence specificity to the rat type I collagen promoter. Endocrinology (Baltimore) 138,482-489. Archer, T. K., Cordingley, M. G., Wolford, R. G., and Hager, G. L. (1991). Transcription factor accesses mediated by accurately positioned nucleosomes on the mouse mammary tumor virus promoter. Mol. Cell. Biol. 11,688-698. Attal, J., Cajero-Juarez, M., Petitclerc, D., Theron, M.-C., Stinnakre, M.-G., Bearzotti, M., Kann, G., and Houdebine, L.-M. (1996). The effect of matrix attached regions (MAR) and specialized chromatin structure (SCS) on the expression of gene constructs in cultured cells and in transgenic mice. Mol. Bid. Rep. 22,37-46. Banerjee, C., Stein, J. L., van Wijnen,A. J., Frenkel, B., Lian, J. B., and Stein, G. S. (1996).
NUCLEAR MATRM AND STEROID HORMONE ACTION
151
Transforming growth factor-beta 1 responsiveness of the rat osteocalcin gene is mediated by an activator protein-1 binding site. Endocrinology (Baltimore) 137,1991-2000. Baniahmad, C., Nawaz, Z., Baniahmad, A., Gleeson, M. A. G., Tsai, J. J., and OMalley, B. W. (1995).Enhancement of human estrogen receptor activity by SPT6: Apotential co-activator. Mol. Endocrinol. 9,34-43. Bannister, A. J., and Kouzarides, T. (1996). The CBP co-activator is a histone acetyltransferase. Nature (London) 384,641-643. Barrett, T. J., Tomlinson, A. J., Benson, L. M., Sandhu, N. P., Subramanian, M., Naylor, S., and Spelsberg, T. C. (1998). Structure/function analyses of a nuclear matrixassociated steroid receptor binding factor (RBF) and the RBF DNA binding element. Submitted. Beato, M. (1991). Transcriptional regulation of mouse mammary tumor virus by steroid hormones. CRC Crit. Rev. Oncog. 2,195-210. Beato, M., and SBnchez-Pacheco,A. (1996). Interaction of steroid hormone receptors with the transcription initiation complex. Endoc. Rev. 17, 587-609. Beato, M., Chavex, S., and Truss, M. (1996). Transcriptional regulation by steroid hormones. Steroids 61,240-251. Berezney, R. (1979). Dynamic properties of the nuclear matrix. In “The Cell Nucleus” (D. H. Busch, ed.), Vol. 7, pp. 413-456. Academic Press, New York. Berezney, R. (1991). The nuclear matrix: A heuristic model for investigating genomic organization and function in the cell nucleus. J. Cell Biochem. 40, 109-123. Berezney, R., and Coffey, D. (1974). Identification of a nuclear protein matrix. Biochem. Biophys. Res. Commun. 60,1410-1419. Berezney, R., and Coffey, D. S. (1975). Nuclear protein matrix: Association with newly synthesized DNA. Science 189,291-293. Berezney, R., and Coffey, D. S. (1976). The nuclear protein matrix: Isolation, structure and function. Adv. Enzyme Regul. 14,63-100. Berezney, R., and Coffey, D. S. (1977). Nuclear matrix: Isolation and characterization of a framework structure from rat liver nuclei. J. Cell Biol. 73,616-637. Berezney, R., and Jeon, K. W., eds. (1995). “International Review of Cytology/Cell Biology.” Academic Press, San Diego, CA. Berg, J. N., van Opheusden, J. H. J., Burgering, M. J. M., Boelens, R., and Kaptein, R. (1990). Structure ofArc repressor in solution: Evidence for a family of p-sheet DNAbinding proteins. Nature (London) 346, 586-589. Bergemann, A. D., Ma, Z.-W., and Johnson, E. M. (1992). Sequence of cDNA comprising the human pur gene and sequence-specific single-stranded-DNA-binding properties of the encoded protein. Mol. Cell. Biol. 12,5673-5682. Berges, R., Furuya, Y., Remington, L., English, H. F., Jacks, T., and Isaacs, J. T. (1993). Cell proliferation, DNA repair, and p53 function are not required for programmed death of prostatic glandular cells induced by androgen ablation. Proc. Natl. Acad. Sci. USA. 90,8910-8914. Bidwell, J. P., van Wijnen, A. J., Fey, E. G., Dworetzky, S., Penman, S., Stein, J. L., Lian, J. B., and Stein, T.S. (1993). Osteocalcin gene promoter binding factors are tissuespecific nuclear matrix components. Proc. Natl. Acad. Sci. U.S.A. 90,3162-3166. Bidwell, J. P., Fey, E. G., van Wijnen, A. J., Penman, S., Stein, J. L., Lian, J. B., and Stein, G. S. (1994). Nuclear matrix proteins distinguish normal diploid osteoblasts from osteocarcoma cells. Cancer Res. 54,28-32. Bode, J., Schlake, T., Rios-Ramirez, M., Mielke, C., Stengert, M., Kay, V., and KlehrWirth, D. (1995). Scaffold/matrix-attached regions: Structural properties creating transcriptionally active loci. Int. Rev. Cytol. 162A, 389-454. Bode, J., Stengert-Iber, M., Kay, V., Schlake, T., and Dietz-F’feilstetter, A. (1996).Scaf-
152
THOMAS J. BARRETTAND THOMAS C. SPELSBERG
fold/matrix-attached regions: Topological switches with multiple regulatory functions. Crit. Rev. Eukaryotic Gene Expression 6, 115-138. Boudreau, N., Myers, C., and Bissell, M. J. (1995). From laminin to lamin: Regulation of tissue-specific gene expression by the ECM. Dends Cell Biol. 5,1-4, Breen, E. C., van Wijnen, A. J., Lian, J. B., Stein, G. S., and Stein, J. L. (1994). Zn viuo occupancy of the vitamin D responsive element in the osteocalcin gene supports vitamin D dependent transcriptional upregulation in intact cells. Proc. Natl. Acad. Sci. U.S.A.91,12902-12906. Burch, J. B. E., and Evans, M. I. (1986). Chromatin structural transitions and the phenomenon of vitellogenin gene memory in chickens. Mol. Cell. Biol. 6, 1886-1893. Burch, J. B. E., and Weintraub, H. (1983). Temporal order of chromatin structure changes associated with activation of the major chicken vitellogenin gene. Cell (Cambridge, Mass.) 33,65-76. Buttyan, R., Olsson, C. A., Pintar, J., Chang, C., Bandyk, M., Ng, P.-Y., and Sawczuk, I. S. (1989). Induction of the TRPM-2 gene in cells undergoing programmed cell death. Mol. Cell. Biol. 9,3473-3481. Candau, R., Chavez, S., and Beato, M. (1996). The hormone responsive region of mouse mammary tumor virus positions a nucleosome and precludes access of nuclear factor I to the promoter. J. Steroid Biochem. Mol. Biol. 57, 19-31. Cantorna, M. T., Nashold, F. E., Chun, T. Y., and Hayes, C. E. (1996). Vitamin A downregulation of IFN-gamma synthesis in cloned mouse T h l lymphocytes depends on the CD28 costimulatory pathway. J. Zmmunol. 156,2674-2679. Capitani, S., Girard, P. R., Mazzeli, G. J., Kuo, J. F., Berezney, R., and Manzoli, F. A. (1987). Immunochemical characterization of protein kinase C in rat liver nuclei and subnuclear fractions. Biochem. Biophys. Res. Commun. 142,367-375. Cavaillbs, V., Dauvois, S., L’Horset, F., Lopez, G., Hoare, S., Kushner, P. J., and Parker, M. G. (1995). Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J. 14,3741-3751. Chavez, S., Candau, R., Truss, M., and Beato, M. (1995). Constitutive repression and nuclear factor I-dependent hormone activation of the mouse mammary tumor virus promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 15,6987-6998. Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M. L., Nakatani, Y., and Evans, R. M. (1997). Nuclear receptor co-activator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBPIp3OO. Cell (Cambridge, Mass.) 90,569-580. Cippitelli, M., Sica, A., Viggiano, V., Ye, J.,Ghosh, P., Birrer, M. J.,and Young, H. A. (1995). Negative transcriptional regulation of the interferon-gamma promoter by glucocorticoids and dominant negative mutants of c-jun. J. Biol. Chem. 270, 12548-12556. Codina-Salada, J., Moore, J. P., and Chan, L. (1983). Kinetics of primary and secondary stimulation of the mRNA for apoVLDL-11, a major yolk protein, in the cockerel liver by estrogen. Endocrinology (Baltimore) 113,1158-1160. Cordingley, M. G., Riegel, A. T., and Hager, G. L. (1987) Steroid-dependent interaction of transcription factors with the inducible promoter of mouse mammary tumor virus in uiuo. Cell (Cambridge, Mass.) 48,261-270. Coutts, A. S., Davie, J. R., Dotzlaw, H., and Murphy, L. C. (1996). Estrogen regulation of nuclear matrix-intermediate filament proteins in human breast cancer cells. J. Cell. Biochem. 63,174-184. Cullen, K. E., Kladde, M. P., and Seyfred, M. A. (1993). Interaction between transcription regulatory regions of prolactin chromatin. Science 261,203-206. Davie, J. R. (1996). Histone modifications, chromatin structure, and the nuclear matrix. J. Cell. Biochem. 62, 149-157.
NUCLEAR MATRIX AND STEROID HORMONE ACTION
153
Davie, J. R. (1997). Nuclear matrix, dynamic histone acetylation and transcriptionally active chromatin. Mol. Biol. Rep. 24, 197-207. Deeley, R. G., Udell, D. S., Burns, A. T. H., Gordon, J. I., and Goldberger, R. F. (1977). Kinetics of avian vitellogenin messenger RNA induction. Comparison between primary and secondary response to estrogen. J. Biol. Chem. 252,7913-7915. de-The, H., Lavau, C., Marchio, A., Chomienne, C., Degos, L., and Dejean, A. (1991). The PML/RARa fusion mRNA generated by the t(15;17) translocation of acute promyelocytic leukemia encodes a functionally altered RAR. Cell (Cambridge, Mass.) 76, 333-343. Dickinson, P., Cook, P. R., and Jackson, D. A. (1990). Active RNA polymerase I is fixed within the nucleus of HeLa cells. EMBO J . 9,2207-2214. Djabali, K., Portier, M.-M., Gros, F., Blobel, G., and Georgatos, S. D. (1991). Network antibodies identify nuclear lamin B as a physiological attachment site for peripherin intermediate filaments. Cell (Cambridge, Mass.) 64,109-121. Donat, T. L., Sakr, W., Lehn, J. E., and Pienta, K. J. (1996). Nuclear matrix protein alteration in intermediate biomarkers in squamous cell carcinoma of the head and neck. Otolaryngol. Head Neck S u g . 114,387-393. Du, W., Thanos, D., and Maniatis, T.(1993). Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements. Cell (Cambridge, Mass.) 74, 887-898. Dunn, D. K., Whelan, R. D., Hill, B., and King, R. J. (1993). Relationship of hsp27 and oestrogen receptor in hormone sensitive and insensitive cell lines. J. Steroid Biochem. Mol. Biol. 46,469-479. Durfee, T., Mancini, M. A., Jones, D., Elledge, S. J., and Lee, W. H. (1994). The aminoterminal region of the retinoblastoma gene product binds a novel nuclear matrix protein that co-localizesto centers for RNAprocessing. J. Cell. Biochem. 127,609-622. Dworetzky, S. I., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1990). Progressive changes in the protein composition of nuclear matrix during rat osteoblast differentiation. Proc. Natl. Acad. Sci. U.S.A. 87,4605-4609. Edinger, R. S., Mambo, E., and Evans, M. I. (1997). Estrogen-dependent transcriptional activation and vitellogenin gene memory. Mol. Endocrinol. 11,1985-1993. Elbrecht, A., Lazier, C. B., Protter, A. A., and Williams, D. L. (1984). Independent development programs for two estrogen-regulated genes. Science 255,639-641. English, H. F., Kyprianou, N., and Isaacs, J. T. (1989). Relationship between DNAfragmentation and apoptosis in the programmed cell death in the rat prostate following castration. Prostate 15,233-250. Evan, G . I., and Hancock, D. C. (1985). Studies on the interaction of human c-myc protein with cell nuclei: p62cmycas a member of a discrete subset of nuclear protein. Cell (Cambridge, Mass.) 43,253-261. Evans, M. I., OMalley, P. J., Krust, A., and Burch, J. B. E. (1987). Developmental regulation of the estrogen receptor and the estrogen responsiveness of five yolk protein genes in the avian liver. Proc. Natl. Acad. Sci. U S A . 84,8493-8497. Evans, M. I., Silva, R., and Burch, J. B. E. (1988). Isolation of chicken vitellogenin I and I11 cDNAs and the developmental regulation of five estrogen-responsive genes in the embryonic liver. Genes Den 2,116-124. Fanjul, A. N., Bouterfa, H., Dawson, M., and Pfahl, M. (1996). Potential role for retinoic acid receptor-gamma in the inhibition of breast cancer cells by selective retinoids and interferons. Cancer Res. 56,1571-1577. Feuerstein, N., and Randazzo, P. A. (1991). In vivo and in vitro phosphorylation studies of numatrin, a cell cycle regulated nuclear protein, in insulin-stimulated NIH 3T3 HIR cells. Exp. Cell Res. 194,289-296.
154
THOMAS J. BARRETTAND THOMAS C. SPELSBERG
Fey, E. G., and Penman, S. (1988). Nuclear matrix proteins reflect cell type of origin in cultured human cells. Proc. Natl. Acad. Sci. U.S.A. 85,121-125. Fink, K. L., Wieben, E. D., Woloschak, G. E., and Spelsberg, T. C. (1988). Rapid regulation of c-myc proto-oncogene expression by progesterone in the avian oviduct. Proc. Natl. Acad. Sci. U.S.A. 85, 1796-1800. Fritton, H. P., Sippel, A. E., and Igo-Kemenes, T. (1983). Nuclease-hypersensitive sites in the chromatin domain of the chicken lysozyme gene. Nucleic Acids Res. 11, 3467-3485. Gasser, S. M., and Laemmli, U. K. (1986). The organization of chromatin loops: Characterization of a scaffold attachment site. EMBO J. 5,511-518. Georgatos, S. D., and Blobel, G. (1987). Lamin B constitutes an intermediate filament attachment site at the nuclear envelope. J. Cell Biol. 105, 117-125. Getzenberg, R. H. (1994). Nuclear matrix and the regulation of gene expression: Tissue specificity. J. Cell. Biochem. 55, 22-31. Getzenberg, R. H., Pienta, K. J., Huang, E. Y., and Coffey, D. S. (1991). Identification of nuclear matrix proteins in the cancer and normal prostate. Cancer Res. 51, 6514-6520. Getzenberg, R. H., Konety, B. R., Oeler, T. A., Quigley, M. M., Hakam, A., Becich, M. J., and Bahnson, B. R. (1996). Bladder cancer associated nuclear matrix proteins. Cancer Res. 56, 1690-1694. Giancotti, V., Bandiera, A., Sindici, C., Perissin, L., and Crane-Robinson, C. (1996). Calcium-dependent ADP-ribosylation of high-mobility-group I (HMGI) proteins. Biochem. J. 317,865-870. Goldberger, A., and Spelsberg, T. C. (1988). Partial purification and preparation of polyclonal antibodies against the chromatin acceptor proteins for the avian oviduct progesterone receptor. Biochemistry 27,2103-2109. Gongora, C . , David, G., Pintard, L., Tissot, C., Hua, T. D., Dejean, A., and Mechti, N. (1997). Molecular cloning of a new interferon-induced PML nuclear body-associated protein. J. Biol. Chem. 272, 19457-19463. Grotzinger, T., Sternsdorf, T., Jensen, K., and Will, H. (1996). Interferon-modulated expression of genes encoding the nuclear-dot-associated proteins SplOO and promyelocytic leukemia protein (PML). Eur J. Biochem. 238,554-560. Guiochon-Mantel, A., Delabre, K., Lescop, P., and Milgrom, E. (1996). Intracellular traffic of steroid hormone receptors. J. Steroid Biochem. Mol. Biol. 56,3-9. Guo, B., Odgren, P. R., van Wijnen, A. J., Last, T. J., Nickerson, J., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1995). The nuclear matrix protein NMP-1 is the transcription factor YY1. Proc. Natl. Acad. Sci. U.S.A. 92, 10526-10530. Hendzel, M. J., Delcuve, B. P., and Davie, J. R. (1991). Histone deacetylase is a component of the internal nuclear matrix. J. Biol. Chem. 266,21936-21942. Henttu, P. M., Kalkhoven, E., and Parker, M. G. (1997).AF-2 activity and recruitment of steroid receptor co-activator 1 to the estrogen receptor depend on a lysine conseryed in nuclear receptors. Mol. Cell. Biol. 17,1832-1839. Hernandez-Verdun, D., and Gautier, T. (1994). The chromosome periphery during mitosis. BioEssays 16, 179-185. Hong, H., Kohli, K., Garabedian, M. J., and Stallcup, M. R. (1997). GRIP1, a transcriptional co-activator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol. Cell. Biol. 17,2735-2744. Hora, J., Horton, M. J., Toft, D. O., and Spelsberg, T. C. (1986). Nuclease resistance and the enrichment of native nuclear acceptor sites for the avian oviduct progesterone receptor. Proc. Natl. Acad. Sci. U.S.A. 83,8839-8843.
NUCLEAR MATRIX AND STEROID HORMONE ACTION
155
Hsu, H.-L., and Yeh, N.-H. (1996). Dynamic changes of NuMA during the cell cycle and possible appearance of a truncated form of NuMA during apoptosis. J. Cell Sci. 109, 277-288. Iacopino, F., Robustelli, D. C. G., and Sica, G. (1997). Natural interferon-alpha activity in hormone-sensitive, hormone-resistant and autonomous human breast cancer cell lines. Int. J. Cancer 71,1103-1108. Jantzen, C. Fritton, H. P., and Igo-Kemenes, T. (1987). Partial overlapping of binding sequences for steroid hormone receptors and DNaseI hypersensitive sites in the rabbit uteroglobin gene region. Nucleic Acids Res. 15,4525-4552. Jensen, E. V. (1991). Overview of the nuclear receptor family. In “Nuclear Hormone Receptors: Molecular Mechanisms, Cellular Functions, Clinical Abnormalities” (M. G. Parker, ed.), pp. 1-14. Academic Press, San Diego, CA. Jost, J.-P., Ohno, T., Panyim, S., and Schuerch, A. R. (1978). Appearance of vitellogenin sequences and rate of vitellogenin synthesis in chicken liver following primary and secondary stimulation by 17P-estradiol. Eur. J. Biochem. 84,355-361. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S. C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996). A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell (Cambridge, Mass.) 85,403-414. Kaufmann, S. H., Desnoyers, S., Ottaviano, Y., Davidson, N. E., and Poirier, G. G. (1993). Specific proteolytic cleavage of poly(ADP-ribose) polymerase: An early marker of chemotherapy-induced apoptosis. Cancer Res. 53,3976-3985. Keesee, S. K., Briggman, J. V., Thill, G., and Wu, Y.J. (1996). Utilization of nuclear matrix proteins for cancer diagnosis. Crit. Rev. Eukaryotic Gene Expression 6,189-214. Kerr, G. F. R. (1971). Shrinkage necr0sis:Adistinct mode of cellular death. J.Pathol. 105, 13-20. Khavari, P. A. Peterson, C. L., Tamkun, J. W., Mendel, D. B., and Crabtree, G. R. (1993). BRGl contains a conserved domain of SW12/SNF2 family necessary for normal mitotic growth and transcription. Nature (London) 366, 170-174. Kim, M. K., Lesoon-Wood,L. A., Weintraub, B. D., and Chung, J . H. (1996).Asoluble transcription factor, Oct-1, is also found in the insoluble nuclear matrix and possesses silencing activity in its alanine-rich domain. Mol. Cell. Biol. 16,4366-4377. Kingston, R. E., Bunker, C. A., and Imbalzano,A. N. (1996). Repression and activation by multiprotein complexes that alter chromatin structure. Genes Dev. 10,905-920. Koken, M. H., Linares-Cruz, G., Quignon, F., Viron, A., Chelbi-Aliz, M. K., SobczakThepot, J., Juhlin, L., Degos, L., Calvo, F., and de-The, H., (1995). The PML growthsuppressor has an altered expression in human oncogenesis. Oncogene 10, 1315-1324. Korioth, F., Gieffers, C., Maul, G. G., and Frey, J. (1995). Molecular characterization of a DNP52, a novel protein of the nuclear domain 10, which is redistributed upon virus injection and interferon treatment. J. Cell. Biochem. 130,l-13. Kwon, H., Imbalzano, A. N., Khavari, P. A., Kingston, R. E., and Green, M. R. (1994). Nucleosome disruption and enhancement of activator binding by a human SWUSNF complex. Nature (London) 370,477-481. Kyprianou, N., English, H. F., and Isaacs, J. T. (1988). Activation of a CA2+-MG2+-dependent endonuclease as an early event in castration-induced prostatic cell death. Prostute 13,103-117. LaCasse, E. C., Lochnan, H. A., Walker, P., and Lefebvre, Y. A. (1993). Identification of binding proteins for nuclear localization signals of the glucocorticoid and thyroid hormone receptors. Endocrinology (Baltimore) 132,1017-1025.
156
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
Laemmli, U. K., Kas, E., Poljak, L., and Adachi, Y. (1992). Scaffold-associated regions: Cis-acting determinants of chromatin structural loops and functional domains. Curr. Opin. Genet. Deu. 2,275-285. Landers, J. P., and Spelsberg, T.C. (1991). Updates and new models for steroid hormone action. Ann. N.Y Acad. Sci. 637, 26-55. Landers, J. P., and Spelsberg, T. C. (1992). New concepts in steroid hormone action: Transcription factors, proto-oncogenes and the cascade model for steroid regulation of gene expression. Crit. Rev. Eukaryotic Gene Expression 2, 19-63. Lauber, A. H., Sandhu, N. P., Schuchard, M., Subramaniam, M., and Spelsberg, T.C . (1995). Nuclear matrix acceptor binding sites for steroid hormone receptors: A candidate nuclear matrix acceptor protein. In “International Review of CytologyEell Biology” (R. Berezney and K. W. Jeon, eds.), pp. 337-376. Academic Press, San Diego, CA. Lauber, A. H., Barrett, T. J., Subramaniam, M., Schuchard, M., and Spelsberg, T. C . (1997).ADNA binding element for a steroid receptor binding factor is flanked by dual nuclear matrix attachment sites in the c-myc gene promoter. J. Biol. Chem. 272, 24657-24665. Lazebnik, Y. A., Kaufmann, S. H., Desnoyers, S., Poirier, G. G., and Earnshaw, W. C. (1994). Cleavage of poly(ADP-ribose)polymerase by a proteinase with properties like ICE. Nature 371,346-347. Lazebnik, Y. A., Takahashi, A., Moir, R. D., Goldman, R. D., Poirier, G. G., Kaufmann, S. H., and Earnshaw, W. C. (1995a). Studies of the lamin proteinases reveal multiple parallel biochemical pathways during apoptotic execution. Proc. Natl. Acad. Sci. U.S.A. 92,9042-9046. Lazebnik, Y. A., Takahashi, A., Poirier, G. G., Kaufmann, S. H., and Earnshaw, W. C. (1995b). Characterization of the execution phase of apoptosis in vitro using extracts from condemned-phase cells. J. Cell Sci. Suppl. 19,41-49. Lee, J. W., Ryan, F., Swaffield, J. C., Johnston, S. A., and Moore, D. D. (1995). Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature (London) 374,91-94. Lemiew, P., Lawrence, J., Steeg, P., Oesterreich, S., and Fuqua, S. A. W. (1996). Transfection of hsp27 overexpression affects growth and motility of an estrogen receptor negative human breast cancer cell line. Proc. Am. Assoc. Cancer Res. 37,68. Lewis, C. D., Lebkowski, J. S., Daly, A. K., and Laemmli, U. K. (1984). Interphase nuclear matrix and metaphase scaffolding structures. J. Cell Sci., Suppl. 1,103-122. Lin, H. Y., Thacore, H. R., Davis, F. B., and Davis, P. J. (1996). Thyroid hormone analogues potentiate the antiviral action of interferon-gamma by two mechanisms. J . Cell. Physiol. 167, 269-276. Lindenmuth, D. M., van Wijnen, A. J., Hiebert, S., Stein, J. L., Lian, J. B., and Stein, G. S. (1997). Subcellular partitioning of transcription factors during osteoblast differentiation: Developmental association of the AMLICBFaIPEBP2cr-relatedtranscription factor-NMP-2 with the nuclear matrix. J. Cell. Biochem. 66, 123-132. Lindner, D. J., Kolla, V., Kalvakolanu, D. V., and Borden, E. C . (1997). Tamoxifen enhances interferon-regulated gene expression in breast cancer cells. Mol. Cell. Biochem. 167,1997. Liu, J. H., Mu, Z. M., and Chang, K. S. (1995). PML suppresses oncogenic transformation of NIHi3T3 cells by activated neu. J. Exp. Med. 181, 1965-1973. Luderus, M. E. E., den Blaauwen, J. L., de Smit, 0. J . B., Compton, D. A., and van Driel, R. (1994). Binding of matrix attachment regions to lamin polymers involves singlestranded regions and the minor groove. Mol. Cell. Bioll4,6297-6305. Lydersen, B. K., and Pettijohn, D. E. (1980). Human-specific nuclear protein that associ-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
157
ates with the polar region of the mitotic apparatus: distribution in a humadhamster hybrid cell. Cell (Cambridge, Mass.) 22, 489-499. Mainwaring, W. I. P., and Derry, N. S. (1983).Enhanced transcription of rRNA genes by purified androgen receptor complexes in vitro. J. Steroid Biochem. 19,101-108. Mainwaring, W. I. P., and Wilce, P. A. (1973).The control of the form and function of the ribosomes in androgen-dependenttissues by testosterone. Biochem. J. 134,795-805. Mancini, M. A., Shan, B., Nickerson, J. A., Penman, S., and Lee, W.-H. (1994). The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated proteins. Proc. Natl. Acad. Sci. U.S.A. 91,418-422. Martelli, A. M., Cocco, L., Riederer, B. M., and Neri, L. M. (1996).The nuclear matrix: A critical appraisal. Histol. Histopathol. 11,1035-1048. McCaffery, J. D., Gapany, M., Faust, R. A., Davis, A. T., Adams, G. L., and Ahmed, K. (1997).Nuclear matrix proteins as malignant markers in squamous cell carcinoma of the head and neck. Arch. Otolaryngol Head Neck Surg. 123,283-288. Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidwell, J. P., Fey, E., Lian, J., Stein, S., and Stein, G. S. (1995).The tissue-specific nuclear matrix, NMPS, is a member of the AML/CBF/PEBPa/Runt domain transcription factor family: Interactions with the osteocalcin gene promoter. Biochemistry 34,13125-13132. Miller, T.E., Beausang, L. A., Meneghini, M., and Lidgard, G. (1994).Cell death and nuclear matrix proteins. Zn “Apoptosis 11:The Molecular Basis ofApoptosis in Disease” (L. D. ‘Ibmei and F. 0. Cope, eds.), pp. 357-376. Cold Spring Harbor Lab. Press, Cold Spring Harbor, NY. Montecino, M., Pockwinse, S.,Lian, J. B., Stein, G. S., and Stein, J. L. (1994).DNase/hypersensitive sites in promoter elements associated with basal and vitamin D dependent transcription of the bone-specific osteocalcin gene. Biochemistry 33,348-353. Montecino, M., Lian, J. B., Stein, G. S., and Stein, J. L. (1996). Changes in chromatin structure support constitutive and developmentally regulated transcription of the bone-specific osteocalcin gene in osteoblastic cells. Biochemistry 35,5093-5102. Moretti-Rojas, I., Fuqua, S. A. W., Montgomery, R. A. I., and McGuire, W. L. (1988).A cDNA for the estradiol-regulated 24 K protein: Control of mRNA levels in MCF-7 cells. Breast Cancer Res. n e a t . 11,155-163. Mu, Z. M., Chin, K. V., Liu, J. H., Lozano, G., and Chang, K. S. (1994).PML, a growth suppressor disrupted in acute promyelocytic leukemia. Mol. Cell. Biol 14, 68586867. Muchardt, C., and Yaniv, M. (1993). A human homologue of Saccharomyces cerevisiae SNF2ISWI2 and Drosophila-brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO J. 12,4279-4290. Mulder, J. R., Offerhaus, J. A., de Feyter, E. P., Floyd, J. J., Kern, S. E., Vogelstein, B., and Hamilton, S. R. (1992).The relationship of quantitative nuclear morphology to molecular genetic alterations in the adenoma-carcinoma sequence of the large bowel. Am. J. Pathol. 141,797-804. Nakayasu, H., and Berezney, R. (1991). Nuclear matrix: Identification of the major nuclear matrix proteins. Proc. Natl. Acad. Sci. U.S.A. 88,10312-10316. Nardozza, T. A., Quigley, M. M., and Getzenberg, R. H. (1996).Association of transcription factors with the nuclear matrix. J. Cell. Biochem. 61,467-477. Neamati, N., Fernandez, A., Wright, S., Kiefer, J., and McConkey, D. J. (1995).Degradation of human B, precedes oligonucleosomal DNA fragmentation in apoptotic thymocytes and isolated thymocyte nuclei. J. Zmmunol. 154,3788-3795. Nielsen, K., Orntoft, T., and Wolf, H. (1989). Sterologic estimates of nuclear volume in noninvasive bladder tumors (Ta) correlated with the recurrence pattern. Cancer (Philadelphia) 64,2269-2274.
158
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
Nitsch, D., Steward, A. F., Boshart, M., Mestril, R., Weih, F., and Schiitz, G. (1990). Chromatin structure of the rat tyrosine aminotransferase gene relate to the function if its cis-acting elements. Mol. Cell. Biol. 10, 3334-3342. Noon, Y.S., Kim, J. W., Wang, K. W., Kim, Y. S., Choi, K. H., and Joe, C. 0. (1996). Poly (ADP4bosyl)ation of histone H1 correlates with internucleosomal DNA fragmentation during apoptosis. J. Biol. Chem. 271,9129-9134. Norbiato, G., Bevilacqua, M., Vago, T., and Clerici, M. (1996). Glucocorticoids and interferon-alpha in the acquired immunodeficiency syndrome. J. Clin. Endocrinol. Metab. 81,2601-2606. Oberhammer, F. A., Hochegger, K., Froschl, G., Tiefenbacher, R., and Pavelka, M. (1994). Chromatin condensation during apoptosis is accompanied by degradation of lamin A+B, without enhanced activation of cdc2 kinase. J. Cell Biol. 126,827-837. Obermeier, H., Sellmayer, A., Danesch, U., and Aepfelbacher, M. (1995). Cooperative effects of interferon-gamma on the induction of NADPH oxidase by retinoic acid or 1,25(0H),-vitamin D, in monocytic U937 cells. Biochim. Biophys. Acta 1269,25-31. Oesterreich, S., Weng, C.-N., Qui, M., Hilsenbeck, S. G., Osborne, C. K., and Fuqua, S. A. W. (1993). The small heat shock protein hsp27 is correlated with growth and drug resistance in human breast cancer cell lines. Cancer Res. 53,4443-4448. Oesterreich, S., Hickey, E., Weber, L., and Fuqua, S. A. W. (1996a). Basal regulatory elements of the hsp27 promoter in human breast cancer cell lines. Biochem. Biophys. Res. Commun. 222,155-163. Oesterreich, S., Hilsenbeck, S. G., Allred, D. C., Ciocca, D., Chamness, G. C., Osborne, C. K . , and Fuqua, S. A. W. (199613). The small heat shock protein hsp27 is not a n independent prognostic marker in auxillary lymph node-negative breast cancer patients. Clin. Cancer Res. 2,1199-1206. Oesterreich, S., Lee, A. V., Sullivan, T. M., Samuel, S. K., Davie, J. R., and Fuqua, S.A. W. (1997). Novel nuclear matrix protein HET binds to and influences activity of the HSP27 promoter in human breast cancer cells. J. Cell. Biochem. 67,275-286. Ogryzki, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996). The transcriptional co-activators p300 and CBP are histone acetyltransferases. Cell (Cambridge, Mass.) 87,953-959. Oiiate, S . A., Prendergast, P., Wagner, J . P., Nissen, M., Reeves, R., Pettijohn, D. E., and Edwards, D. P. (1994). The DNA-bending protein HMG-1 enhances progesterone receptor binding to its target DNA sequences. Mol. Cell. Biol. 14,3376-3391. Partin, A. W., Getzenberg, R. H., CarMichael, M. J., Vindivich, D., Yoo, J., Epstein, J. I., and Coffey, D. S. (1993). Nuclear matrix protein patterns in human benign prostatic hyperplasia and prostate cancer. Cancer Res. 53,744-746. Paull, T. T., Haykinson, M. J., and Johnson, R. C. (1993). The nonspecific DNA-binding and -bending proteins HMGl and HMG2 promote the assembly of complex nucleoprotein structures. Genes Deu. 7, 1521-1534. Perlmann, T., and Wrange, 0. (1988). Specific glucocorticoid receptor binding to DNA reconstituted in a nucleosome. EMBO J. 7,3073-3079. Peterson, C. L. (1996). Multiple switches to turn on chromatin. Curr. Opin. Genet. Dev. 6, 171-175. Pienta, K. J., and Coffey, D. S. (1991). Correlation of nuclear morphometry with progression of breast cancer. Cancer (Philadelphia) 68,2012-2016. Pienta, K. J., and Coffey, D. S. (1992). Nuclear-cytoskeletal interactions: Evidence for physical connections between the nucleus and cell periphery and their alteration by transformation. J. Cell. Biochem. 49,357-365. Pifia, B., Truss, M., Ohlenbusch, H., Postma, J., and Beato, M. (1990). DNArotational po-
NUCLEAR MATRIX AND STEROID HORMONE ACTION
159
sitioning in a regulatory nucleosome is determined by base sequence. An algorithm to model the preferred superhelix. Nucleic Acids Res. 18,6981-6987. Porter, W., Wang, F., Duan, R., and Safe, S. (1996). Role of estrogen receptor/Spl complexes in estrogen-induced heat shock protein 27 gene expression. Mol. Endocrind. 10,1371-1378. Qian, X., Jeon, C., Yoon, H., Aganval, K., and Weiss, M. A. (1993). Structure of a new nucleic-acid-binding motif in eukaryotic transcriptional elongation factor TFIIS. Nature (London) 365,277-279. Raunmann, B. E., Rould, M. A., Pabo, C. O., and Sauer, R. T. (1994). DNArecognition by psheets in the Arc repressor-operator crystal structure. Nature (London) 367,754-757. Razin, S . V. (1996). Functional architecture of chromosomal DNA domains. Clin. Reu. Gene Expression 6,247-269. Razin, S. V., and Gromova, I. I. (1995). The channels model of the nuclear matrix structure. BioEssays 17,443-450. Rejman, J., Landers, J. P., Goldberger, A., McCormick, D., Gosse, B., and Spelsberg, T. C. (1991). Purification of a nuclear protein (Receptor Binding Factor-1) associated with the chromatin acceptor sites for the avian oviduct progesterone receptor. J. Protein Chem. 10,651-667. Reyes, J. C., Muchardt, C., and Yaniv, M. (1997). Components of the human SWI/SNF complex are enriched in active chromatin and are associated with the nuclear matrix. J. Cell. Biochem. 137,263-274. Richard-Foy, H., and Hager, G. L. (1987). Sequence-specific positioning of nucleosomes over the steroid-inducible MMTV promoter. EMBO J. 6,2321-2328. Romanini, M. G. M., and Fraschini, A. (1996). Facts and paradoxes in current notions of nuclear organization and function. Histol. Histopathol. 11,513-519. Rories, C., and Spelsberg, T.C. (1989). Ovarian steroid action on gene expression: Mechanisms and models. Annu. Rev. Physiol. 51, 653-681. Ruh, M. F., Dunn, R., and Ruh, T. S. (1966). Interrelationships between nuclear structure and ligand-activated intracellular receptors. Crit. Rev. Eukaryotic Gene Expression 6,271-283. Schild, C., Claret, F.-X., Wahli, W., and Wolffe, A. P. (1993). A nucleosome-dependenstatic loop potentiates estrogen-regulated transcription from the Xenopus vitellogenin B1 promoter in uitro. EMBO. J. 12,423-433. Schuchard, M., Rejman, J. J., McCormick, D. J., Gosse, B., Ruesink, T., and Spelsberg, T. C. (1991a). Characterization of a purified chromatin acceptor protein (receptor binding factor-1) for the avian oviduct progesterone receptor. Biochemistry 30,4535-4542. Schuchard, M., Subramaniam, M., Ruesink, T., and Spelsberg, T. C. (1991b). Nuclear matrix localization and specific matrix DNA binding by receptor binding factor-1 of the avian oviduct progesterone receptor. Biochemistry 30,9516-9522. Schuchard, M., Landers, J. P., Punkay-Sandhu, N., and Spelsberg, T. C. (1993). Steroid hormone regulation of nuclear proto-oncogenes. Endocr. Reu. 14,659-669. Sen, G. C., and Lengyel, P. (1992). The interferon system. A bird’s eye view of its biochemistry. J. Biol. Chem. 267,6017-5020. Sen, G. C., and Ransohoff, R. M. (1993). Interferon-induced antiviral actions and their regulation. Adv. Virus Res. 42, 57-102. Seymor, L., Bezwoda, R., Meyer, K., and Behr, C. (1990). Detection of p24 protein in human breast cancer: Influence of receptor status and oestrogen exposure. Br. J. Cancer 61,886-890. Sica, G., Iacopino, F., and Recchia, F. (1996). Interferon and hormone sensitivity of endocrine-related tumors. Anti-Cancer Drugs 7,150-160.
160
THOMAS J. BARREWAND THOMAS C. SPELSBERG
Singh, P., Coe, J., and Hong, W. J. (1995).A role for retinoblastoma protein in potentiating transcriptional activation by the glucocorticoid receptor. Nature (London) 374, 562-565. Smith, H.C., and Berezney, R. (1982).Nuclear matrix-bound deoxyribonucleic acid synthesis: An in uitro system. Biochemistry 21,6751-6761. Smith, H. C., and Berezney, R. (1983).Dynamic domains of DNA polymerase (Y in regenerating rat liver. Biochemistry 22,3042-3046. Smith, B., and Berman, B. (1992).Characterization of a glucocorticoid-induced inhibitor of interferon-gamma induction of HLA-DR expression. J. Invest. Dermatol. 99, 35-39. Smith, H. C., Harris, S. G., Zillmann, M., and Berget, S. M. (1989).Evidence that a nuclear matrix protein participates in premessenger RNA splicing. Exp. Cell Res. 182, 521-533. Somers, W. S., and Phillips, S. E. V.(1992).Crystal structure of the met repressor-operator complex at 2.8 resolution reveals DNA recognition by P-strands. Nature (London) 359,387-393. Sorensen, F. B.,Kristensen, I. B., Grymer, F., and Jakobsen,A. (1991).DNA-level, tumor thickness, and sterological estimates of nuclear volume in stage I cutaneous malignant melanomas. A comparative study with analysis of prognostic impact. Am. J. Dermatopathob 13,ll-19. Sorensen, F.B., Bichel, P., and Jakobsen, A. (1992).DNA level and stereologic estimates of nuclear volume in squamous cell carcinoma of the uterine cervix. Cancer (Philadelphia) 69,187-199. Soury, B., Hentzen, D., Vignal, M., Christeff, N., and Doly, J. (1995).Induction of interferon-beta gene expression by dexamethasone in murine L929 cells. Mol. Endocrinol. 9,199-207. Spelsberg, T. C., Webster, R. A., and Pikler, G. M. (1976).Chromosomal proteins regulate steroid binding to chromatin. Nature (London) 262,65-67. Spelsberg, T. C., Littlefield, B. A., Seelke, R., Martin-Dani, G., Toyoda, H., Boyd-Leinen, P., Thrall, C., and Kon, 0. L. (1983).Role of specific chromosomal proteins and DNA sequences in the nuclear binding sites for steroid receptors. Recent Prog. Horm. Res. 39,463-517. Spelsberg, T. C., Gosse, B. J., Littlefield, B. A., Toyoda, H., and Seelke, R. (1984).Reconstitution of native-like nuclear acceptor sites of the avian oviduct progesterone receptor: Evidence for involvement of specific chromatin proteins and specific DNA sequences. Biochemistry 23,5103-5113. Spelsberg, T. C., Hora, J., Horton, M., Goldberger, A., Littlefield, B., Seelke, R., and Toyoda, H. (1987a).Specific DNA binding proteins and DNA sequences involved in steroid hormone regulation of gene expression. In “DNA Protein Interactions and Gene Regulation” (E. G. Thompson and J. Papaconstantinous, eds.), pp. 259-267. University of Texas Press, Austin. Spelsberg, T. C., Horton, M., Fink, K., Goldberger, A., Rories, C., Gosse, B., and Rasmussen, K., (1987b).A new model for steroid regulation of gene transcription using chromatin acceptor sites and regulatory genes and their products. In “Recent Advances in Steroid Hormone Action” (V. K. Moudgil, ed.), pp. 31-48.de Gruyter, Berlin and New York. Spelsberg, T. C., Rories, C., Rejman, J., Goldberger, A., Fink, K., Lau, C. K., Colvard, D., and Wiseman, G. (1989).Steroid action on gene expression: Possible roles of regulatory genes and nuclear acceptor sites. Biol. Reprod. 40,54-69. Spelsberg, T. C., Subramaniam, M., Harris, S. A., Oursler, M. J., Schuchard, M., Landers, J. P., and Sandhu, N. (1993).Nuclear proto-oncogenes as regulatory genes and as
a
NUCLEAR MATRIX AND STEROID HORMONE ACTION
161
marker genes for steroid action in all target tissues. In “Proto-oncogenes and Growth Factors in Steroid Hormone Induced Growth and Differentiation” (K. Sahaib and G. Stancel, eds.), pp. 69-86. CRC Press, Boca Raton, FL. Spelsberg, T. C., Lauber, A., Sandhu, H., and Subramaniam, M., (1996). Composition and structure of a nuclear matrix acceptor site for the avian progesterone receptor in c-myc gene promoter. Recent Prog. Horm. Res. 51,63-96. Spencer, T. E., Ing, N. H., Ott, T. L., Mayes, J . S., Becker, W. C., Watson, G. H., Mirando, M. A., and Bazer, F. W. (1995). Intrauterine injection of ovine interferon tau alters oestrogen receptor and oxytocin receptor expression in the endometrium of cyclic ewes. J. Mol. Endocrinol. 15,203-220. Stein, G. S., Lian, J. B., van Wijnen, A. J., and Stein, J. L. (1997). The osteocalcin gene: A model for multiple parameters of skeletal-specific transcriptional control. Mol. Biol. Rep. 24, 185-196. Stelzer, G., Goppelt, A., Lottspeich, F., and Meisterernst, M. (1994). Repression of basal transcription by HMG2 is counteracted by TFIH-associated factors in an ATP-dependent process. Mol. Cell. Biol. 14,4712-4721. Streuli, C. H., Schmidhauser, C., Bailey, N., Yurchenco, P., Skubitz, A. P. N., Roskelley, C., and Bissel, M. J. (1995). Laminin mediates tissue-specific gene expression in mammary epithelia. J. Cell Biol. 129,591-603. Stuurman, N., Meijne, A. M. L., van der Pol, A. J., de Jong, L., van Driel, R., and van Renswoude, J . (1990). The nuclear matrix from cells of different origin. Evidence for a common set of matrix proteins. J. Biol. Chem. 265,5460-5465. Szostecki, C., Guldner, H. H., Netter, N. J., and Will, H. (1990). Isolation and characterization of cDNA encoding a human nuclear antigen predominantly recognized by auto-antibodies from patients with primary biliary cirrhosis. J. Zmmunol. 145, 4338-4347. Takemura, M., Ohta, N., Furuichi, Y., Takahashi, T., Yoshida, S., Olson, M. 0. J., and Umekawa, H. (1994). Stimulation of calf thymus DNA polymerase alpha activity by nucleolar protein B23. Biochem. Biophys. Res. Commun. 28,46-51. Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatucci, A. M., Kaufman, T. C., and Kennison, J. A. (1992). Brahma: Aregulator ofDrosophila homeotic genes structurally related to the yeast transcriptional activator SNF2ISWI2. Cell (Cambridge, Mass.) 68,561-572. Tanaka, H., Makino, Y., Miura, T., Hirano, F., Okamoto, K., Komura, K., Sato, Y., and Makino, I. (1996). Ligand-independent activation of the glucocorticoidreceptor by ursodeoxycholicacid: Repression of IFN-gamma-induced MHC class I1 gene expression via a glucocorticoid receptor-dependent pathway. J. Immunol. 156, 1601-1608. Tandon,A. K., Clark, G. M., Chamness, G. C., Fuqua, S.A. W., Welch, W. J., Riehl, R. M., and McGuire, W. L. (1990). Heat shock stress response proteins: Biological and clinical significance in breast cancer. Proc. Am. SOC.Clin. Oncol. 9,84. Tanuma, S. (1996). Molecular mechanisms of apoptosis. Zn “Apoptosis in Normal Development and Cancer” (M. Sluyser, ed.), pp. 39-60. Taylor & Francis, Bristol, PA. Tawfic, S., and Ahmed, K. (1994a). Association of casein kinase 2 with nuclear matrix. J. Biol.Chem. 269,7489-7493. Tawfic, S., and Ahmed, K. (199413). Growth stimulus-mediated differential translocation of casein kinase 2 to the nuclear matrix. Evidence based on androgen action in the prostate. J. Biol. Chem. 269,24615-24620. Tawfic, S., Goueli, S., Olson, M. 0.J., and Ahmed, K. (1993).Androgenic regulation of the expression and phosphorylation of prostatic nucleolar protein B23. Cell. MoZ. Biol. Res. 39,43-51.
162
THOMAS J. BARRETT AND THOMAS C. SPELSBERG
Tawfic, S., Olson, M. 0. J., and Ahmed, K. (1995). Role of protein phosphorylation in posttranslational regulation of protein B23 during programmed cell death in the prostate gland. J. Biol. Chem. 270,21009-21015. Terris, B., Baldin, V., Dubois, S., Degott, C., Flejou, J . F., Henin, D., and Dejean, A. (1995). PML nuclear bodies are general targets for inflammation and cell proliferation. Cancer Res. 55,1590-1597. Thrall, C. L., and Spelsberg, T. C. (1980). Factors affecting the binding of chick oviduct progesterone receptor to DNA: Evidence that DNA alone is not the nuclear acceptor site. Biochemistry 19,4130-4138. Tinnemans, M. M. F. J., Lenders, M.-J. J. H., tenVelde, G. P. M., Ramaekers, F. C. S., and Schutte, B. (1995). Alterations in cytoskeletal and nuclear matrix-associated proteins during apoptosis. Eur: J. Cell Biol. 68,35-46. Toyoda, T., Seelke, R., Littlefield, B. A., and Spelsberg, T. C. (1985). Evidence for specific DNA sequences in the nuclear acceptor sites of the avian oviduct progesterone receptor. Proc. Natl. Acad. Sci. U.S.A. 82,4722-4726. Ucker, D. S., Obermiller P. S., Eckhart, W., Apgar, J. R., Berger, N. A., and Meyers, J. (1992). Genome digestion is a dispensable consequence of physiological cell death mediated by cytotoxic T-lymphocytes. Mol. Cell. Biol. 12,3060-3069. Van Holde, K. E., (1988). “Chromain.” Springer Verlag, New York. van Steensel, B., Jenster, G., Damm, K., Brinkmann, A. O., and van Driel, R. (1995). Domains of the human androgen receptor and glucocorticoid receptor involved in binding to the nuclear matrix. J. Cell. Biochem. 57,465-478. Lian, J. B., Stein, J. L., and Stein, van Wijnen, A. J.,Bidwell, J. P., Fey, E. G., Penman, S., G. S. (1993). Nuclear matrix association of multiple sequence-specific DNA binding activities related to SP-1, ATF, CCAAT, C/EBP, OCT-1, and AP-1. Biochemistry 32, 8397-8402. Verheijen, R., van Venrooij, W., and Ramaekers, F. (1988).The nuclear matrix: Structure and composition. J. Cell Sci. 90, 11-36. Verrier, C. S., Bailey, L. R., Yee, C. J.,Roodi, N., Jensen, R. A., Bustin, M., and Parl, F. F. (1995). The interaction of the estrogen receptor with its DNAresponse element is facilitated by the high mobility group protein, HMG-1. Protein Eng. 8,78. Verrier, C. S., Roodi, N., Yee, C. J., Bailey, L. R., Jensen, R. A., Bustin, M., and Parl, F. F. (1997). High-mobility group (HMG) protein HMG-1 and TATA-binding protein associated factor TAF,,30 affect estrogen receptor-mediated transcriptional activation. Mol. Endocrinol. 11,1009-1019. vom Baur, E., Zechel, C., Heery, D., Heine, M. J., Garnier, J. M., Vivat, V., Le Douarin, B., Gronemeyer, H., Chambon, P., and Losson, R. (1996). Differential ligand-dependent interactions between the AF-2 activating domain of nuclear receptors the putative transcriptional intermediary factors mSUGl and TIF1. EMBO J . 15,110-124. Walker, G., F‘feilschifier, J., and Kunz, D. (1997). Mechanisms of suppression of inducible nitric-oxide synthase (iNOS) expression in interferon (1FN)-gamma-stimulated RAW 264.7 cells by dexamethasone: Evidence for glucocorticoid-induced degradation of iNOS protein by calpain as a key step in post-transcriptional regulation. J. Biol. Chem. 272,16670-16687. Weaver, V. M., Carson, C. E., Walker, P. R., Chaley, N., Lach, B., Raymond, Y., Brown, D. L., and Sikorska, M. (1996). Degradation of nuclear matrix and DNA cleavage in apoptotic thymocytes. J. Cell Sci. 109,45-56. Weis, K. S., Rambaud, S., Lavau, C., Jansen, J., Carvalho, M., Carmo-Fonseca, M., Lamond, A. I., and Dejean, A. (1994). Retinoic acid regulates aberrant nuclear localization of PML-RARol in acute promyelocytic leukemia cells. Cell (Cambridge, Mass.) 76,345-356.
NUCLEAR MATRIX AND STEROID HORMONE ACTION
163
Winston, F., and Carlson, M. (1992). Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection. Bends Genet. 8,387-391. Yamamoto, K. R. (1985). Steroid receptor regulated transcription of specific genes and gene networks. Annu. Rev. Genet. 19,209-252. Yang, X. J., Ogryzki, V. V., Nishikawa, J., Howard, B. H., and Nakatani, Y. (1996). A p3OO/CBP-associatedfactor that competes with the adenoviral oncoprotein E 1A. Nature (London) 382,319-324. Yoshinaga, S. K., Peterson, C. L., Herskowitz, I., andyamamoto, K. R. (1992). Roles of SWI1, SWIZ, and SWI3 proteins for transcriptional enhancement by steroid receptors. Science 258,1598-1604. Zambetti, G., Ramsey-Ewing, A., Bortell, R., Stein, G., and Stein, J. (1991). Disruption of the cytoskeleton with cytochalasin D induces c-fos gene expression. Exp. Cell Res. 192,93-101. Zeng, C., He, D., and Brinkley, B. R. (1994). Localization ofNuMAprotein isoforms in the nuclear matrix of mammalian cells. Cell. Motil. Cytoskel. 29, 167-176. Zeng, C., van Wijnen, A. J., Stein, J. L., Meyers, S., Sun, W., Shopland, L., Lawrence, J. B., Penman, S., Lian, J. B., Stein, G. S., and Hiebert, S. W. (1997). Identification of a nuclear matrix targeting signal in the leukemia and bone-related AMLKBF-a transcription factors. Proc. Natl. Acad. Sci. U.S.A. 94,6746-6751. Zhuang, Y.-H., Landers, J. P., Schuchard, M. D., Syvala, H., Gosse, B., Ruesnik, T., and Tuohimaa, P. (1993). Immunohistochemical localization of the avian progesterone receptor and its candidate acceptor protein, RBF-1. J. Cell Biochern. 54, 1-11.
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
Coregulatory Proteins in Nuclear Hormone Receptor Action
DEAN P. EDWARDS Department of Pathology and Molecular Biology Program, University of Colorado School of Medicine, Denver, Colorado 80262
I. Introduction 11. Nuclear Receptor Superfamily: Structure and Function 111. Accessory Proteins that Modulate Receptor Binding to Target DNA Sites A. Proteins That Facilitate Receptor-DNA Interaction B. Inhibitors of Receptor-DNA Interaction W. Nuclear Receptor Transcriptional Coactivators A. p160 Family of Coactivators B. Other Coactivators (ERAP160, RIP140, TIF1, TRIPI-Sug-1, hRPF1, ARA,) C. pBOO/CBP Cointegrators D. Perturbation of Receptor Coactivation-Corepressor Interactions by Steroid Antagonists E. Mechanism ofAction V. Summary and Future Questions References
I. INTRODUCTION Steroid hormones exert their major biological effects on differentiation, growth, homeostasis, and behavior by binding to nuclear receptors, which, in turn, regulate patterns of gene expression in appropriate target cells. During the mid to late 1980s, isolation and cloning of the steroid receptor genes as well as the identification and characterization of target genes regulated by steroids revealed that steroid receptors are members of a superfamily of ligand-activated transcriptional regulatory proteins that bind to specific DNA sequences [hormone response elements (HREs)] thereby altering rates of transcription. Despite the wealth of information that followed on the structural and functional domains of nuclear receptors, how these receptors regulate gene transcription in response to hormone remains an essential question. The discovery of coregulatory proteins that associate with hormone-activatedreceptors has provided important insights into this question. Coregulatory proteins have been identified that can either modulate receptor-DNA interaction, act as signaling intermediates between the receptor and the transcriptional machinery, or participate in targeted remodeling of chromatin. This article reviews recent work 165
Copyright 0 1999 by Academic Press. All rights of reproduction in any form resewed. 0083-6729199 525.00
166
DEAN P. EDWARDS
with these coregulatory proteins with focuses on their role in the mechanism of action of the steroid hormone class of receptors. Other nuclear receptors are discussed largely for the purpose of comparison with steroid receptors, Little mention is made of the cytosolic heat-shock proteins and immunophilins that interact with nonliganded steroid receptors at earlier steps in the activation pathway. This was the subject of an excellent review (Pratt and Toft, 1997).
11. NUCLEAR RECEPTOR SUPERFAMILY STRUCTURE AND FUNCTION Members of the steroid receptor superfamily include not only receptors for steroid hormones (estrogens, progesterone, glucocorticoids, androgens, and mineralocorticoids), but also receptors for various other lipophilic ligands such as thyroid hormone, retinoids, and vitamin D, (Tsai and O’Malley, 1994; Mangelsdorf and Evans, 1995; Mangelsdorf et al., 1995,) as well as orphan receptors whose ligands remain unknown (Enmark and Gustafsson, 1996). Endogenous ligands for a few receptors initially classified as orphans have now been identified including 9-cis-retinoic acid (Mangelsdorf et al., 1990; Heyman et al., 1992; Levin et al., 1992) as a ligand for retinoid X receptor (RXR),fatty acids (Devchand et al., 1996; Yu et al., 1995), and prostaglandin J, metabolites (Kliewer et al., 1995) as ligands for peroxisome-proliferator-activated receptors (PPAR), and certain intermediate metabolites such as oxysterols and farnesoids are ligands, respectively, for LXRa and FXR (Forman et al., 1995; Janowski et al., 1996; Forman et al., 1997). Ligand-signaling pathways for the majority of orphan receptors remain unknown and it will be of interest to learn how many of these may be ancestral genes that do not require a ligand-activated mechanism. Sequence and mutational analyses have determined that all nuclear receptors share a modular domain structure composed of a carboxylterminal ligand-binding domain (LBD),a central DNA-binding domain (DBD), and an amino terminal domain that has transcriptional modulatory function (Fig. 1).The DBD is highly conserved and contains two asymmetric zinc fingers as the signature structural motif that defines members of the nuclear receptor superfamily. The core DBD contains two a helices, one extending from the base of each zinc-binding module. Specific residues in the amino-terminal-most a helix make hydrogen bonds with specific bases in the major groove of HREs. The C-terminalmost helix lies above and perpendicular to the recognition helix, but it does not itself make base-specific contacts (Freedman, 1992). The LBD
167
COREGULATORY PROTEINS
NB
C
D
E
F
C
N :
!
AF-1
V
!
AF-2
Steroid
L
FIG.1.Modular structure of steroid-nuclear receptors and mechanism of action of steroid hormones. Letter designations for the domains of the steroid-nuclear receptor molecule are A/B, amino terminus; C, DNA binding domain; D, hinge; E, ligand binding domain; F, C-terminal LBD extension. SR, steroid receptor; AF-1 and AF-2, transcriptional activation functions; HRE hormone response element; TATA, TBP binding sequence; pol 11, RNA polymerase I1 holoenzyme.
is less conserved among family members than the DBD and is a more complex region capable of mediating multiple functions (Simons, 1998). In addition to providing a pocket for binding cognate ligands, the LBD contains determinants for binding heat shock proteins (Pratt and Toft, 1997), dimerization (Glass, 1994), and a ligand-dependent transcriptional activation function, termed AF-2 (Danielian et al., 1992; Parker, 1995). The crystal structures of the LBDs of four different nuclear receptors have now been solved, including the unliganded (apo) LBD of RXR (Bourguet et al., 1995) and liganded (holo) LBDs of the retinoic acid receptor (RAR), the thyroid hormone receptor (TR), and the estrogen receptor (ER) (Renaud et al., 1995; Wagner et al., 1995; Brzozowski et al., 1997).These studies have revealed a similar overall secondary and tertiary structure for the LBD consisting of 11or 12 (Y helices folded into a three-layer antiparallel helical sandwich. In combination with two conserved p strands positioned between bundles of the antiparallel helices, this structure forms a hydrophobic core that binds ligand (Wurtz et al., 1996). Biochemical studies have indicated that ligand binding induces a conformational change in the carboxyl terminal tail of the LBD of several nuclear receptors (Allan et al., 1992; Weigel et al., 1992; Beekman et al., 1993; Bhat et al., 1993; Leid, 1994; Kuil et al.,
168
DEAN P. EDWARDS
1995). The crystallographic data are consistent with this. Although crystal structures for a single apo and holo LBD have not been reported, comparison of apo RXR with holo LBDs of other receptors shows that the major conformational change induced by ligand is a repositioning of the C-terminal-most helix 12. Helix 12 projects away from the hydrophobic core in the apo LBD and is folded tightly against the core in holo LBDs (Wurtz et al., 1996).AF-2 function is dependent on conserved hydrophobic and hydrophilic residues in the amphipathic a helix 12 (Danielian et al., 1992).Therefore, AF-2 is believed to be created by the repositioning of helix 12 next to other dispersed elements in the LBD to generate a new surface for interaction with other proteins. The amino terminus of nuclear receptors is the most divergent with respect to length and amino acid sequence. Many nuclear receptors contain a second transcriptional activation function (AF1)in the amino terminus (Metzger et al., 1995a).AF-1 is less well defined than AF-2 but appears to be important for mediating cell type and promoter-specific transcriptional responses. Structural analysis of a minimal core AF-1 in the glucocorticoid receptor (GR) by circular dichroism and nuclear magnetic resonance (NMR) spectroscopy observed that AF-1 is largely unstructured in aqueous solution but acquires significant helical structure in the presence of the a-helix-promoting solvent TFE (trifluoroethanol). This suggests that AF-1 has the potential to adopt helical structure in response to binding target proteins (Dahlman-Wright et al., 1995; Dahlman-Wright and McEwan, 1996).AF-1 and AF-2 have been shown to be capable of functioning independently or t o act synergistically in a cell- and promoter-specific manner (Bocquel et al., 1989; Lees et al., 1989; Tora et al., 1989; Pham et al., 1992; Tzukerman et al., 1994).Thus in many cell types, full transcriptional activity of receptors requires a functional interaction between AF-1 and AF-2. Nuclear receptors are phosphoproteins, and most of the phosphorylation sites that have been identified are serine-threonine residues located in the amino terminus (Weigel, 1996, and references therein). Only a few nuclear receptors (RARP and ER) have been found to contain tyrosine phosphrylation sites (Rochette-Egly et al., 1992; Migliaccio et al., 1996).Hormone binding to steroid receptors results in a rapid increase in phosphorylation, suggesting a role for phosphorylation in the receptor-activation process (Beck et al., 1992,1996;Orti et al., 1993; Arnold et al., 1994; Zhang et al., 1995).Although the functional role of phosphorylation has not been well defined, it has been implicated in multiple receptor functions including DNA binding, transcriptional activation, and receptor stability (Ali et al., 1993; Almlof et al., 1995; Bai and Weigel, 1996;Arnold et al., 1994; Takimoto et al., 1996; Webster et al., 1997).
COREGULATORY PROTEINS
169
Members of the nuclear receptor superfamily can be classified based on differences in mechanism of action (Tsai and O’Malley, 1994; Mangelsdorfet al., 1995). The steroid hormone class of receptors associates with heat-shock proteins and immunophilins in the absence of hormone (Pratt and Toft, 1997).As depicted in Fig. 1,hormone binding induces a series of changes in the receptor molecule including dissociation from heat-shock proteins, conformational change, dimerization, binding to DNA, recruitment of coactivators (Horwitz et al., 1996; Glass et al., 19971, and, finally, enhancement of transcription. Steroid receptors bind predominantly as preformed homodimers to HREs that are composed of two hexanucleotide recognition sequences arranged as inverted palindromes with a three-nucleotide spacer between the core halfsites (Truss and Beato, 1993;Zilliacus et al., 1995).The nonsteroid class of nuclear receptors do not appear to associate stably with heat-shock proteins and they typically bind to target DNAsequences in the absence of ligand. Therefore, ligand activation with this class of receptors occurs by altering receptors already bound to DNA. A subgroup of nonsteroid receptors (TR and RAR) actively silence basal transcription by recruiting one or more corepressors, the silencing mediator for retinoid and thyroid receptors (SMRT) and nuclear receptor corepressor (NCOR). Thus, for TR and RAR, ligand activation involves a derepression mechanism requiring dissociation of corepressors and a second step of recruitment of transcriptional coactivators (Chen and Evans, 1995; Horlein et al., 1995).The nonsteroid class of nuclear receptors most typically bind as heterodimers with RXR t o core hexanuclotide HREs arranged as direct repeats (DRs). Variable nucleotide spacing between the half-sites largely determines the specificity for different RXR heterodimers (Mangelsdorf and Evans, 1995). Orphan nuclear receptors, which comprise the largest class of the superfamily, are capable of binding to direct repeat HREs as heterodimers with RXR, or they can bind as monomers to HRE half-sites (Enmark and Gustaffson, 1996). 111. ACCESSORYPROTEINS THATMODULATE NUCLEAR RECEPTOR TO TARGET DNA SEQUENCES BINDING A.
PROTEINS THATFACILITATE RECEPTOR-DNA INTERACTION
1. RXR Is a Coregulator of Nonsteroid and Orphan Nuclear Receptors
A recurrent theme in the study of sequence-specific transcription factors is the requirement of accessory nuclear proteins for their highaffinity binding to target DNA. This discovery, in part, has been facilitated by the overexpression and purification of recombinant transcrip-
170
DEAN P. EDWARDS
tional activators, resulting in the removal of another factor required to form a stable DNA complex. The missing nuclear factors have been isolated and identified either biochemically or by cloning strategies. In the early 199Os, the former orphan nuclear receptor RXR was discovered concurrently by several different laboratories to be a common accessory nuclear protein required for high-affinity DNA binding of a group of receptors for nonsteroid ligands including RAR, TR, and vitamin D receptor (VDR). RXR acts by heterodimerizing with other nuclear receptors resulting in each dimer partner contacting either the 5' or 3' halfsite of the appropriate HRE (Yu et al., 1991; Kliewer et al., 1992;Zhang et al., 1992; Leid et al., 1992). Since the initial discovery of RXR as a coregulator for this group of nuclear receptors, it has since been shown t o serve a similar role by heterodimerizingwith PPAR, LXRa, FXR, and certain orphan nuclear receptors (Table I). A Drosophila homolog of RXR,ultraspiracle, heterodimerizes with the insect ecdysone receptor, indicating that there has been a conservation in function of RXR as a coregulatory factor for other nuclear receptors (Yao et al., 1992). In addition to being required for high-affinity DNA binding, RXR is also essential for maximal transcriptional activity of this group of nuclear receptors. Although RXR can form homodimers and bind to DR HREs, it has much weaker DNA-binding and transcriptional activities than RXR heterodimer receptors. Thus the main physiological role of RXR is thought to be that of a master coregulator for certain classes of nuclear receptors. In general, RXR heterodimers appear to act as functional TABLE I ACCESSORY PROTEINS THATMODULATE NUCLEAR RECEPTOR-DNA INTERACTION Accessory protein RXR
HMG-1I-2
Nuclear receptor
Effect
Mechanism
Positive Nonsteroid receptors (TR, RAR, VDR, PPAR, LXR, FXR),orphan receptors (COUP-TF, XONR, NURRI, NGFIB, MB67) Steroid receptors Positive
Heterodimerization
Calreticulin
All classes of nuclear receptors
TRUP
TR, RAR
Ternary HMG-receptorDNA complex Negative Binds to a conserved sequence, KXFF(K/R)R, in the DBDs of NRs Negative Binds to the hinge and amino portion of the LBD
COREGULATORY PROTEINS
171
units that can respond to signaling by RXR ligands, the ligand for the partnered receptor, or both. Whether signaling by RXR ligands is permitted appears to depend on which nuclear receptor is dimerized with RXR (Mangelsdorf and Evans, 1995). At about the same time that RXR was discovered as a common coregulatory factor for a subgroup of nuclear receptors, several other laboratories isolated nuclear proteins of unknown identity in the range of 50-65 kDa that were required for high-affinity binding of TR and VDR to their target DNA sequences (Liao et al., 1990; Sone et al., 1991; Beebe et al., 1991; Ross et al., 1992; Murray and Towle, 1989; Burnside et al., 1990). Whether any of the accessory proteins detected in these studies are one of the three RXR subtypes was not determined. Thus, to date, only RXRs have been shown to facilitate the sequence-specific DNA-binding activity of this group of nuclear receptors. RXRs have not been observed to interact with, or affect the activity of, steroid receptors.
2. Nuclear Proteins That Facilitate Steroid Receptor-DNA Binding Nuclear accessory proteins that facilitate the sequence-specificDNAbinding activity of the steroid class of receptors have also been described. These proteins do not heterodimerize with steroid receptors per se, they form a ternary complex with receptor homodimers on target DNA. Several studies have isolated nuclear proteins that enhance the binding of purified ERs to estrogen response elements (EREs). These proteins have been characterized only by their molecular mass, and they include two nonhistone chromatin proteins of 50-70 kDa, a 45kDa single-stranded DNA-binding protein and two proteins of 45 and 48 kDa (Hughes et al., 1989; Feavers et al., 1989;Mukhejee and Chambon, 1990; Landel et al., 1994).Whether any of these ER-DNA binding accessory factors are the same or different proteins remains to be determined. Interestingly, the 45- and 48-kDa proteins together with heat-shock protein 70 (hsp70)were found to make a stable complex with ER when bound to EREs, and their presence increased the rate of ER association with DNA (Landel et al., 1994). The hsp7O has been found t o be associated as part of a larger multiprotein complex with several different steroid receptors in their nonliganded state (Pratt and Toft, 1997). Whether hsp70 remains associated with activated receptors on DNA appears to differ between receptor types. GR was reported to remain associated with hsp70 when complexed to a glucocorticoid response element (Srinivasan et al., 1994), whereas hsp70 was not detected as a component of the activated progesterone receptor (PR)-DNA complex (Ofiate et al., 1991). Other studies have reported
172
DEAN P. EDWARDS
the presence of proteins, or other macromolecules, in nuclear extracts that facilitate the binding of GR and androgen receptors (AR)to DNA cellulose, or to specific androgen-glucocorticoid response elements (ARE-GREs) (Tymoczko et al., 1988; Cavanaugh and Simons, 1990, 1994; Kupfer et al., 1993, 1994; De Vos et al., 1994).An accessory protein responsible for enhancing the DNA-binding activity of GR and AR was identified as a 110-kDametalloendoprotease involved in the intracellular degradation of insulin (Kupfer et al., 1993). Since this is largely a cytoplasmic protein, its role in GR-AR-DNA binding in uiuo remains unclear. Earlier studies from our laboratory showed that binding of human PR to progesterone response elements (PREs) was enhanced by the presence of another nuclear protein(s) present in several cell types (Edwards et al., 1989). In subsequent studies, we identified the chromatin high-mobility group proteins HMG-1 and -2 as the major factors responsible for facilitating the sequence-specific DNA-binding activity of PR in uitro (Ofiate et al., 1994; Prendergast et al., 1994; Boonyaratanakornkit et al., 1998). 3. HMG-1 and -2 Are Coregulators of the Steroid Class of Nuclear Receptors High-mobility group proteins are nonhistone chromatin proteins that fall into three structurally unrelated families including HMG-1 and -2, HMGI(Y), and HMG-14/-17. These were originally defined as proteins that are extractable from nuclei or chromatin by 0.35-M NaCl, which are acid soluble with a high content of charged amino acids and exhibit a high electrophoretic mobility on protein gels due to a small molecular mass (ranging from 10 to 30,000 kDa). HMG-1 and -2 have a tripartite structure consisting of two repeated DNA-binding domains, termed HMG boxes A and B, and a highly acidic carboxyl-terminal tail. As DNA binding proteins, HMG-1 and -2 have no known sequence specific recognition site. They prefer to bind to irregular structures in DNA, most notably bends or four-way junction DNA. HMG-1 and -2 bind in the minor groove and when bound to DNA can further manipulate structure by inducing bends or local unwinding and the acidic carboxylterminal tail has been implicated in DNA unwinding. The physiological role of HMG-1 and -2 remains poorly understood. This ability to recognize and manipulate DNA structure has led to the idea that these proteins have roles in several essential cellular processes that require transient manipulation of DNA structure including DNA replication, DNArepair, recombination, and transcription (Bustin and Reeves, 1996 and references therein). Indeed several studies have now implicated
COREGULATORY PROTEINS
173
HMG-1 and -2 as coregulatory factors for several different classes of eucaryotic transcriptional activators including Hox proteins (Zappavigna et al., 19961, octamer transcription factors (Zwilling et al., 1995), the adenovirus major late promoter transcription factor (Tremethick and Molloy, 1988), the p53 tumor suppressor (Jayaraman et al., 1998) and several yeast activators (Paul1 et al., 1996). HMG-1 and -2 have also been found to be essential components for activator-enhanced transcription in vitro using minimal purified components of the transcription initiation complex (Shykind et al., 1995). The solution structure of the HMG box has revealed a novel DNAbinding motif consisting of three a helices folded into an L shape. Helices 1and 2 form the short arm of the L, which is held at an approximately 80" angle from helix 3 and an extended amino terminal segment that together form the long arm. The extended amino terminal segment and part of helix 3 make contact in the minor groove. This structural motif is thought to be important for recognition of bends in DNA structure (Weir et al., 1993; Read et al., 1993, 1995). Several diverse proteins contain HMG boxes (Landsman and Bustin, 1993; Bustin and Reeves, 1996). This includes small-molecular-mass proteins that are analogous to HMG-1 and -2, in that they contain multiple HMG boxes comprising a major portion of the protein and do not bind to specific DNAsequences. HMG-1and HMG-2 are produced from separate genes, have 82% amino acid sequence identified, and are considered the archtypical proteins of this group. Another group includes sequence specific transcription factors that have a single HMG box contained in a much larger protein such as LEF-1 and SRY (Giese et al., 1992; Ferrari et al., 1992). The initial discovery of HMG-1 as an accessory factor required for high-affinity binding of PR to PREs in vitro was made when full-length recombinant PR was expressed in the baculovirus insect cell system and purified to near homogeneity. Compared with PR in crude nuclear extracts, the purified receptor exhibited a substantial reduction in affinity for its target DNA that was fully restored by addition of nuclear extracts. Biochemical fractionation and add-back experiments revealed that HMG-1, as a highly purified protein and in stoichiometric amounts with PR, functionally substituted for nuclear extracts. Addition of purified HMG-1 increased the DNA binding of purified PR to the same high affinity observed with native PR in nuclear extracts (Oiiate et al., 1994; Prendergast et al., 1994). This enhancement effect was found to be highly specific for HMG-1 and has not been observed with several other proteins tested, including carrier proteins such as albumins, a va-
174
DEAN P. EDWARDS
riety of other nuclear proteins and general transcriptional factors, and other HMG related or HMG-1 box containing proteins. The only proteins observed with this activity are HMG-1 and the closely related HMG-2. The two proteins are interchangeable with respect to functional interaction with PR (Boonyaratanakornkit et al., 1998). The mechanism by which HMG-1 and -2 increases the binding affinity of PR for target DNA sequences has not been precisely determined. HMG-1 and -2 are capable of making direct protein contact with PR in the absence of DNA. However, these interactions are weak, suggesting the two proteins interact transiently. In the absence of receptors, HMG-1 and -2 alone have no detectable affinity for PREs. However, HMG-1 is a component of the stimulated PR-PRE complex, suggesting that HMG1 increases PR-DNA binding affinity by establishing additional protein-protein or protein-DNA contacts (Boonyaratanakornkit et al., 1998). Several nuclear receptors have been shown to bend target DNA to which they are bound (Leidiget al., 1992;Nardulli and Shapiro, 1992; King et al., 1993; Lu et al., 1993; Nardulli et al., 1995). DNA bending was further shown with PR to be an intrinsic property of the purified receptor (Prendergast et al., 1996). Low-affinity binding of purified PR to PREs in the absence of other proteins is sufficient to induce a directional bend of 30-40" toward the major groove that is relatively unchanged by the addition of HMG-1 and -2 (Prendergast et al., 1996).Because HMG-1 has a higher affinity for bent DNA than linear B form DNA(Pi1et al., 1993;Ofiate et al., 19941,these data further suggest that receptor-induced DNA bending also contributes to the recruitment of HMG-1 and -2. Unresolved questions are the stoichiometry of HMG molecules in the high-affinity PR-DNAcomplex, the sites of protein interaction between receptor and HMG-1 and -2, and the sites of HMG-DNA contacts in the HRE. In addition to increasing the sequence-specificDNA-binding affinity of PR in uitro, HMG-1 and -2 were also observed to increase the transcriptional activity of PR. In mammalian cells contransfected with an HMG-1 or -2 expression plasmid, hormone-dependent PR-mediated transactivation of a PRE-controlled reporter gene was increased by a factor of -8-fold, as compared with cells transfected with PR alone. This enhancement is largely due to an increase in the maximal transcriptional activity of the liganded receptor. HMG-1 and -2 have no effect on the basal promoter activity of target genes and have minimal effect on PR transactivation in the absence of ligand (Boonyaratanakornkit et al., 1998).Since HMG-1 and -2 are ubiquitous proteins expressed in all higher eucaryotic cells, these contransfection assays were done on a cel-
COREGULATORY PROTEINS
175
lular background of endogenous HMG-1 and -2. That substantial effects on PR activity were observed suggests that cellular HMG-1 and -2 available to interact with receptors may in fact be limiting. The question of whether HMG-1 and -2 modulate the sequence-specific DNA-binding and transcriptional activity of other nuclear receptors has also been investigated. Similar to results with PR, HMG-1 and -2 have been observed to markedly increase the DNA-binding affinity of all steroid hormone receptors examined including ER, AR, and GR (Boonyaratanakornkit et al., 1998).Additionally, HMG-1 was reported to increase the transcriptional activity of ER in a cell-free transcription assay and to bind directly to ER by coimmunoprecipation assays (Verrier et al., 1997). In contrast, HMG-1 and -2 have no effect on the binding of purified VDR, RAR, and RXR t o their direct repeat consensus HREs, including homodimer and RXR heterodimer forms of these receptors. HMG-1 and -2 in uitro were not observed to make direct protein contacts with VDR in solution and had little or no effect on the transcriptional activity of VDR and RAR when overexpressed in mammalian cells (Zappavigna et al., 1996; Boonyaratanakornkit et al., 1998). Thus, a correlation has been observed between the effects of HMG-1 and -2 on nuclear receptor-DNA binding in uitro and transcriptional activity in mammalian cells. Based on these results HMG-1 and -2 have been proposed t o be coregulatory proteins for steroid receptors, but not for other classes of nuclear receptors. Why HMG-1 and -2 functionally interact specifically with steroid receptors is notknown. This could be due to a difference in the structural arrangement of the target HREs for which these two classes of nuclear receptors bind. Steroid receptors interact mainly with palindromic HREs, whereas nonsteroid receptors interact preferentially as heterodimers with direct repeat HREs. Alternatively, this may be due to structural features in the DNA-binding domain that appear to be unique to nonsteroid receptors and certain orphan nuclear receptors. Crystallography of an RXR-TR DBD heterodimer complexed to a DR-4 element (Rastinejad et al., 1995) and NMR structure of the RXR DBD in solution (Lee et al., 1993), revealed the presence of a third a helix in the carboxyl-terminal extension (CTE) of the DNA-binding domains of these receptors that has not been detected in the DBDs of steroid receptors (Schwabe et al., 1990, 1993; Hard et al., 1990; Luisi et al., 1991). The CTE is required for high-affinity DNA binding and makes extensive contacts in the minor groove to provide additional protein-DNA interactions beyond that of the core DBD in the major groove of the HRE. The fact that HMG-1 and -2 are minor-groove DNA-binding proteins, raises the possibility
176
DEAN P. EDWARDS
that they may functionally substitute for the CTE as a second protein associated with the steroid receptor-DNA complex. Future studies will be required to test these hypotheses. OF RECEPTOR-DNA INTERACTION B. INHIBITORS
At least two proteins have been isolated that act as negative modulators of nuclear receptor-DNA interaction. Calreticulin is a calciumbinding storage protein found largely in the lumen of the endoplasmic reticulum that also binds to an amino acid motif, KXGFFKR (where X is either G, A, or V), contained in the cytoplasmic domain of integrin (Y subunits. Two different research groups independently discovered that the core DBDs of all nuclear receptors contain closely related sequences, KXFF(WR)R, and that calreticulin can inhibit binding of GR and AR to target DNAs by interacting directly with the DBDs of these receptors. Additionally, overexpression of calreticulin in mammalian cells inhibited glucocorticoid and androgen induction of target reporter gene expression (Dedhar et al., 1994; Burns et al., 1994). Since the initial studies with GR and AR, calreticulin has subsequently been shown to have similar inhibitory effects on other classes of nuclear receptors including RXR and VDR, RAR-RXR,and PPAR-RXR heterodimers, and the orphan receptors HNF-4 and COUP-TF (Wheeler et al., 1995; Winrow et al., 1995; Desai et al., 1996; Shago et al., 1997). In addition to inhibiting receptor-dependent transcription of reporter genes, calreticulin has been observed to inhibit hormone induction of endogenous target genes such as the glucocorticoid regulated cytochrome P450 and tyrosine amino transferase genes in mouse fibroblasts and hepatocytes, respectively (L. Burns et al., 1994; K. Burns et al., 1997); vitamin-D,regulated osteocalcin gene and other mineralization markers in bone (Wheeler et al., 1995; St. Arnaud et al., 1995);and retinoic-acid-induced RARp, CRABPII, and markers of neuronal differentiation in P19 cells (Desai et al., 1996; Shago et al., 1997). Overexpression of calreticulin was reported to have no effect on transcriptional activation mediated by other families of transcription factors such as cyclic AMP (CAMP)response-element-binding (CREB)protein and ATFS. Based on these collective results, calreticulin has been proposed to function as a general negative modulator of all nuclear receptor signaling pathways. However, one study with RXR-PPAR heterodimers found that calreticulin interference with DNA-binding activity in uitro did not extend to an inhibition of transcriptional activity in whole cells (Winrow et al., 1995). With all other nuclear receptors examined, a correlation has been observed between calreticulin inhibition of DNA-binding activity in uitro
COREGULATORYPROTEINS
177
and inhibition of transcriptional activation in uivo. Thus, it appears that calreticulin can inhibit a wide number of nuclear receptors in both the steroid and nonsteroid classes. The physiological relevance of these observations has been questioned because calreticulin is localized mainly in the endoplasmic reticulum. Whether sufficient quantities of endogenous calreticulin are ever present in the nuclei of cells to functionally interact with nuclear receptors, or whether such interactions occur only with overexpressed calreticulin, remains unclear. Immunocytochemical studies have detected low levels of calreticulin in the cytoplasm and nucleus of mammalian cells (Roderick et al., 1997). However, biochemical studies have indicated that calreticulin is not an integral nuclear protein (Michalak et al., 1996). Use of a green-fluorescent-tagged calreticulin protein (GFP-CRT)showed that GFP-CRT was localized in the nucleus of several different cell types at low levels, whereas dexamethasone treatment increased the amount of GFP-CRT in the nucleus. This suggests that calreticulin translocates to the nucleus via interaction with GR in the cytoplasm (Roderick et al., 1997). Steroid receptors appear to continuously shuttle between the cytoplasm and nucleus in the absence of ligand, suggesting they have the opportunity to associate with other proteins in the cytoplasm. However, GR appears to have a much longer residence time in the cytoplasm in the absence of ligand than other receptors (Yang and DeFranco, 19961, which raises the question of whether nuclear localization of calreticulin by this mechanism may be specific for GR. It will be important in future studies to better define a physiological role for calreticulin in nuclear receptor signaling. Using a two-hybrid screening assay in yeast, a gene product was isolated that inhibits the transcriptional activity of TR and RAR by disrupting receptor binding to target DNA sequences. Because TR was used as the bait, the protein was termed thyroid receptor uncoupling protein (TRUP). The isolated cDNA encodes for a 266-amino-acid ribosomal protein of unknown function with sequence identity to surf-3, PLA-X, and L7a (Burris et al., 1995). TRUP interacts in a ligand-independent manner with a region of TR containing the hinge and amino terminal portion of the LBD. TRUP was reported to have no effect on the transcriptional activity or in uitro DNA-bindingactivities of at least two other nuclear receptors: RXR homodimers and ER. These data suggest that TRUP acts as a negative modulator of only a subset of nuclear receptors. The two nuclear receptors (TR and RAR) affected by TRUP are set apart mechanistically from others because they bind to their target DNA sequences in the absence of ligand and actively silence basal gene transcription. Interestingly, TRUP was also observed to interfere
178
DEAN P. EDWARDS
with the silencing activity of TR in the absence of T3. Further studies t o determine whether TRUP interacts with other members of the nuclear receptor superfamily and to establish the physiological relevance of TRUP in TR and RAR transcriptional signaling will be of interest. Table 1 summarizes accessory nuclear proteins of known identify that modulate nuclear receptor-DNA interaction and that have also been shown to effect the transcriptional activity of receptors in mammalian cells. The table includes the class of nuclear receptor affected, whether the modulatory effect is to facilitate or inhibit receptor-DNA binding and what is known about the mechanism of action. IV NUCLEAR RECEPTOR TRANSCRIPTIONAL COACTIVATORS Cell-free receptor-dependent transcription assays have indicated that nuclear receptors enhance transcription by stabilizing or recruiting the assembly of the preinitiation complex at the promoter. The preinitiation complex contains RNA polymerase I1 and the minimal general transcription factors required for basal transcription (Beato and Sanchez-Pacheco, 1996, and references therein). How nuclear receptors communicate with the preinitiation complex is not known. One possibility is direct binding to general transcription factors. Indeed, nuclear receptors have been shown to interact in uitro with TFIIB, TBP, and TBP-associated factors (TAFs) (Ing et al., 1992; Jacq et al., 1994; Blanco et al., 1995; Schwerk et al., 1995; May et al., 1996; Mengus et al., 1997). However, these interactions have not always been observed to require receptor ligand or a functional AF-1 or AF-2, and in some cases interactions appear to be indirect. This suggests that other proteins may be required to serve as intermediates. Receptor coupling with the preinitiation complex could also be achieved through intermediary, or coactivator, proteins that function as a bridge between the DNA-bound nuclear receptor and basal transcription factors. Transcriptional coactivators have been characterized for other families of sequence specific transcriptional activators (Berger et al., 1992; Goodrich and Tijian, 1994). Operationally, coactivators are not part of the basal transcriptional initiation complex, they are not transcriptional activators themselves because they lack a DNA-binding domain, and they are recruited to specific DNA targets via protein interaction with the transcriptional activator. Functionally, coactivators should not affect basal transcription and they should be required for transcriptional enhancement induced by the sequence specific transcription factor. The existence of coactivators for nuclear receptors was first predict-
COREGULATORY PROTEINS
179
ed based on the ligand and AF-2-dependent transcriptional interference, or squelching, that was observed between two different types of nuclear receptors (Tora et al., 1989; Tasset et al., 1990; Meyer et al., 1989; Nagpal et al., 1992; Tzukerman et al., 1994). This suggested the presence of a common limiting proteinb) that binds to the highly conserved AF-2 region to mediate functional responses (Horwitz et al., 1996; Glass et al., 1997, references therein). As a result of these observations, several laboratory groups concurrently sought to isolate proteins that interact with AF-2 in a ligand-dependent manner. Several experimental approaches were used, including biochemical isolation of proteins that bind to the expressed recombinant LBD of the estrogen receptor, expression cloning for gene products that bind to the LBDs of nuclear receptors, genetic screens in yeast for proteins that potentate the transcriptional activity of nuclear receptors, and the yeast two-hybrid screening method using the LBD of nuclear receptors as the bait. These approaches independently resulted in the isolation of a novel family of AF-2 interacting proteins of approximately 160 kDa (p160) that possess many of the properties expected of a transcriptional coactivator for nuclear receptors. Several other proteins unrelated to p160 have also been isolated that bind to the LBD of nuclear receptors in a ligand- and AF-2-dependent manner. Whether some of these other AF2-interacting proteins are capable of enhancing transcriptional activity of receptors in mammalian cells is uncertain. During the course of these studies it was also discovered that two known coactivators for other families of eucaryotic transcriptional activators associate with nuclear receptors and exhibit receptor coactivation function. These coactivators include the adenovirus E 1A gene product-associated protein p300 and the closely related CBP (CREB binding protein) that interacts with the CAMPresponse element binding protein, CREB.
A. ~ 1 6 FAMILY 0 OF COACTIVATORS Steroid receptor coactivator 1(SRC-1)was the first AF-2-interacting protein identified that exhibited the ability to markedly enhance the transcriptional activity of nuclear receptors in mammalian cells. An SRC-1 cDNA was cloned by yeast two-hybrid screening using the LBD of human PR as the bait and a human B-lymphocyte cDNA expression library as the target (Ofiate et al., 1995). Initial characterizations showed a hormone-dependent interaction of the encoded SRC-1 polypeptide with the LBD of PR, both in vitro and in whole cells. In transient transfection assays, overexpression of SRC-1 in mammalian cells enhanced the transcriptional activity of PR by as much as 15-fold7with-
180
DEAN P. EDWARDS
out altering the basal activity of the target gene promoter. SRC-1 coexpression was also observed to partially reverse the sequelching effect of ER on the transcriptional activity of PR. These initial data strongly suggested that SRC-1 encodes for a shared limiting protein that mediates the function of AF-2 (Ofiate et al., 1995).The original SRC-1 cDNA encoded an N-terminal-truncated version of the protein with a molecular mass of 125 kDa. Through interaction expression cloning, other groups subsequently isolated SRC-1cDNAs containing the missing N-terminal sequences. Interestingly,full-length clones were isolated independently as gene products that interacted with the LBD of thyroid hormone receptor (Takeshitaet al., 1996),p300, and CBP (Kameiet al., 1996;Yao et al., 1996). Full-length cDNAs for mouse and human SRC-1 encode proteins of predicted molecular masses of 153 and 160 kDa, receptively. A human protein of 160 kDa, termed ER-associated protein 160 (ERAP 160)was isolated biochemically that binds to the LBD of ERs in uitro in a hormone agonist and AF-Zdependent manner (Halachmi et al., 1994). Based on antibody cross-reactivity it appears that ERAP 160 is related, if not identical, to human SRC-1 (Hanstein et al., 1996). Based on the collective work of several groups, SRC-1 has been observed to possess many of the properties expected of a bona fide nuclear receptor coactivator. Although SRC-1 was initially characterized as a PR interacting protein, it has since been shown to interact i n uitro and i n uiuo in a hormone-dependentmanner with the LBDs of several classes of nuclear receptors including ER, GR, TR, RXR,RAR, VDR, and PPAR (Takeshita et al., 1996; Kamei et al., 1996; Yao et al., 1996; Jeyakumar et al., 1997; Direnzo et al., 1997;Torchia et al., 1997; Ofiate et al., 1998; Gill et al., 1998;Ding et al., 1998).In most of these studies, coexpression of SRC-1 was also shown to enhance transcriptional activity of receptors in mammalian cells or in yeast. Whether SRC-1 interaction is restricted to nuclear receptors has not been rigorously tested. No functional interaction was detected with other eucaryotic transcription activators such as E2F, E47, and CREB (Oiiate et al., 1995). However, SRC-1 has been observed to enhance the activity of SP-1 and GAL4, albeit to a lesser extent than nuclear receptors (Ofiate et al., 1998). Based on Far Western blots using 32P-LBDsof different nuclear receptors as probes, and pull-down assays with recombinant GST-SRC-1, SRC-1 has been observed to bind directly to the LBD and not to require an intermediary protein. As also expected of a coactivator, SRC-1 possesses an intrinsic transcriptional activation function. When fused to a heterologous DNA binding domain, SRC-1 sequences are capable of mediating transcriptional activation (Kamei et al., 1996; Oiiate et al., 1998).
COREGULATORY PROTEINS
181
Binding of SRC-1to nuclear receptors is dependent on both hormone agonist and a functional AF-2. Mutations in conserved residues in amphipathic a helix 12that disrupt AF-2 function,without altering steroid or DNA-binding activity, greatly reduces interaction of SRC-1with the LBD of several different nuclear receptor (Takeshita et al., 1996; Jeyakumar et al., 1997; Torchia et al., 1997). Interaction is also dependent on an active AF-2 conformation in the LBD. Steroid antagonists induce a conformation in the C-terminal tail that is distinct from that induced by agonist and they fail to activate AF-2 function (Allan et al., 1992;Beekman et al., 1993). SRC-1is unable to bind to the LBD of ER, o r the LBD of PR in the presence of antiestrogens or antiprogestins, respectively (Ofiate et al., 1995).These data taken together strongly support the idea that SRC-1is a mediator of AF-2 function. SRC-1 is widely expressed in different cell lines and tissues and appears to be localized largely in the nucleus (Yao et al., 1996; Kamei et al., 1996).The fact that overexpression of SRC-1can markedly enhance transcriptional activity of nuclear receptors on a cellular background of endogenous SRC-1, suggests that it is a limiting protein in many cell types. To investigate whether SRC-1 is required for transcriptional activity of nuclear receptors, experiments have been done to deplete SRC-1 from the cell. Microinjection of cells with affinity purified neutralizing antibodies to SRC-1effectively prevented RAR-, ER-, and TRdependent transcription in response to the specifichormonal ligands for each of these receptors. Interestingly, progesterone-dependentPR-mediated transcription was only partially inhibited by microinjectionof an anti-SRC-1 antibody (Torchia et al., 1997).The C-terminal fragment of SRC-1 that contains a single nuclear receptor binding site, but lacks transcriptional activation domains, behaved in the manner expected of a dominant negative repressor of endogenous SRC-1. Coexpression of the C terminus of SRC-1 nearly abolished hormone-dependent transcriptional activity of PR and TR in different mammalian cells (Ofiate et al., 1995). These functional SRC-1 depletion experiments provide strong evidence that SRC-1,or related proteins, have essential roles in the transcriptional activity of steroid receptors. By discovery, SRC-1 is a member of a growing family of nuclear receptor coactivators that contain significant amino acid sequence homology and simiIar functional properties. This is referred to here as the p160 family of nuclear receptor coactivators (Fig. 2A). By expression cloning for proteins that interact in a hormone-dependentmanner with the LBD of ER and RAR, a human cDNA was isolated that encodes for a 159-kDaprotein [transcriptionalintermediary factor (TIF2)Ithat has 40% amino acid sequence identity to human SRC-1(Voegelet al., 1996).
182
DEAN P. EDWARDS
A
824
NR
-.
NR
.
1129
1464
I
I I IV/Nrn
lillililllllrillililil
1
775
n
1
GRIPlflIF2
RXR
170356 495
CREB Bromo
20%
2183
2414/2441
AD
FIG.2. Structural and functional domains of nuclear receptor transcriptional coactivators. (A) p160 family of coactivators. Based on sequence similarities, p160 coactivators have been divided into the three classes shown. The first 300 amino terminal residues of all p160 coactivators contain conserved basic helix-loop-helix (bHLH) and PAS dimerization motifs. A centrally located nuclear receptor (NR) interaction domain is found in all three classes of p160 coactivators. This region contains three LXXLL motifs, 1-111 (solid black bars). SRC-1 contains a second NR interaction domain containing a single LXXLL motif (IV)that is lacking in other classes of p160 coactivators. A p3OO/CBP interaction site is located just C terminal to the central NR interaction domain. A histone acetyltransferase catalytic domain (HAT)is located within the C-terminus of SRC-1 and ACTR. The location of transcriptional activation domains (AD) is indicated by solid lines beneath each schematic. (B) p300/CBP coactivators. A nuclear receptor interaction domain (NR) with a single IXXLL motif (solid black bar) is located in the first approximately 170 amino terminal residues. A second RXR selective interaction site is located more amino terminal that also contains a single LXXLL motif. There are separate domains for binding CREB, ElA, and p160 coactivators. AHAT catalytic domain is located between the bromo domain and the E1A binding site.
Yeast 2 hybrid screening with the LBD of GR as the bait pulled out a protein from a mouse library termed GR interacting protein 1(GRIP1) that has 94% amino acid identity to TIF2 (Hong et al., 1996,1997).Thus GRIP1 is an ortholog of TIFB and the two proteins appear to represent a class of the p160 coactivator family distinct from SRC-1 (Fig. 2A). A third class of the coactivator family includes proteins termed ACTR, p/CIP, RAG3 and AIB1. The cDNAs for these factors encode for pro-
COREGULATORY PROTEINS
183
teins with a molecular mass of approximately 155 kDa, slightly smaller than the other two classes of coactivators. p/CIP (CBP-interacting protein) was identified by interaction cloning as a protein that binds to a region in the C terminus of CBP. It has 31% amino acid sequence homology with SRC-1 and 36% homology with TIFB (Torchiaet al., 1997). ACTR was isolated in a yeast one-hybrid screening for human proteins that augment retinoic acid-induced RAR-mediated transcription (Chen et al., 1997). FtAC3 (receptor-associated coactivator 3) was isolated by a standard yeast two-hybrid screening using full-length RAFt fused to the GAL4DBD as the bait (Li et al., 1997). AIBl (amplified in breast cancer 1)was isolated serendipitously as a cloned expression sequence from an amplified chromosomal region (20q) in breast cancer (Anzick et aZ., 1997). The AIBl gene is most closely related to p/CIP, ACTR, and RAC3 and has 45% amino acid identity with TIFB and 33% identity with SRC-1 (Fig. 2A). As determined by RNA Northern blot analysis, AIBl was found to be overexpressed in the majority of ER-positive breast cancer cell lines and primary breast tumor biopsies tested (64%). In contrast other p160 coactivators, TIFB and SRC-1 were not overexpressed in the same cell lines and tumors. Thus, overexpression ofAIB1 in breast cancer is of potential clinical relevance if it were to perturb estrogen receptor signaling pathways and responsiveness to hormonal therapies. The functional domains of the p160 nuclear coactivators have been only partially characterized. The highest degree of sequence homology among family members is in the first 300 amino acids of the amino terminus. This region harbors sequences strikingly similar to the basic helix-loop-helix (bHLH) motif, followed by a PAS (period protein selfassociation domain) motif (Fig. 2A). The bHLH motif is a conserved DNA-binding domain present in several families of sequence-specific DNA-binding proteins. The PAS motif has been shown to function as a dimerization domain in several other proteins including Period (PER), Single-minded (SIM), and the aryl hydrocarbon receptor (AHR)and its heterodimeric partner ARNT (Huang et al., 1993). Whether the bHLH within the context of nuclear receptor coactivators is capable of binding DNA, or whether the PAS domain can interact with other proteins, is unknown. The first 93 amino acids in SRC-1 were found to exhibit a week transcriptional activation function (Ofiate et al., 1998) and a nuclear localization function has been attributed to the amino terminus of TIFB (Voegel et aZ., 1996). However, the N terminus appears to be dispensable for nuclear receptor interaction and for coactivator activity, suggesting that this region has a role in aspects of coactivator function not yet appreciated (Chen et al., 1997; Ofiate et al., 1998).
184
DEAN P. EDWARDS
Nuclear receptor (NR) interaction sites have been mapped in the p160 coactivators by deletion and truncation mutation analysis (Fig. 2A). Using PR as the target, SRC-1 was found to contain two separate nuclear receptor binding sites. One is located in the C terminus (between aa 1140 and 1440) and the other in the middle of the protein between residues 360 and 780. This middle region can be further dissected into two smaller fragments (aa 360-633 and aa 634-780) that retain receptor binding, albeit the 634-780 fragment exhibits the strongest binding of the two. This suggests there are multiple interaction sites within this middle domain (Ofiate et al., 1995,1998). A minimal region in SRC-1 for binding RAR has similarly been defined between aa 569 and 789 (Yao et aZ., 1996). The other classes of p160 coactivators have a strong receptor interaction domain located at a comparable region in the middle of the protein, but they lack a receptor binding site at the C terminus (Ding et al., 1998).Aminimal nuclear receptor interaction domain within ACTR was mapped between aa 621 and 821 and similar to SRC-1, this region can be subdivided into two smaller fragments (aa 621-728 and 729-821) that retain nuclear receptor binding activity (Chen et al., 1997).The receptor interaction site in GRIP1 is located between aa 624 and 776 (Ding et d,1998) (Fig. 2A). Based on presently available information, only SRC-1 has two widely separated receptor interaction domains (Ding et al., 1998). The reason for this difference between SRC-1 and other p160 coactivation is unknown. The presence of highly conserved LXXLL (X can be any amino acid) sequence motifs are contained within the boundaries of the functionally mapped nuclear receptor interaction domains of p160 coactivators (Torchia et al., 1997; Heery et al., 1997; Ding et al., 1998). This appears to be a minimum core consensus sequence essential for binding of p160 to the LBDs of nuclear receptors. This has been termed a leucinecharged domain (LCD) by Torchia et al. (1997) or a nuclear receptor interaction box (NR box) by Ding et al. (1998).The convention NR box will be used here. There are three L m L motifs in the centrally located receptor interaction domain of SRC-1(NR boxes I, 11, and 111)and one motif in the C terminus (NR box IV) (Fig. 2A). Three conserved LXXLL motifs are also present in comparable positions in the central NR interaction domains of the other classes of p160 coactivators (Fig. ZA). To assess the importance of these motifs for nuclear receptor interaction, point mutations in the four NR boxes within the context of fulllength SRC-1were observed to abolish nuclear receptor binding in uiuo by yeast two-hybrid assay and in vitro by GST-ER LBD pull-down assay. When overexpressed in mammalian cells, these mutant SRC-1s also impaired ER-dependent transcription, indicating they behave as
COREGULATORY PROTEINS
185
dominant negative repressors of endogenous SRC-1 (Heery et al., 1997). Additionally, peptides encompassing individual LXXLL motifs can block binding of SRC-1 to nuclear receptors in uitro (Heery et al., 1997) and they can inhibit receptor-mediated transcription within cells (Torchia et al., 1997). When fused to the GAL4DBD, an eightamino-acid peptide containing a single LXXLL motif was found to be able t o interact with nuclear receptors in a yeast two-hybrid assay, suggesting that this minimal core sequence is both necessary and sufficient to bind nuclear receptors. However, the LXXLL sequence alone cannot be sufficient since it is present in many proteins. These motifs are predicted to have amphipathic a helical character with the leucines aligned on the hydrophobic interaction face. Thus, the ability of these core motifs to function likely depends on secondary structure and surface accessibility. Indeed, there are two LXXLL motifs in SRC-1 that lie outside (aa 111-118 and 913-920) the functionally defined receptor interaction domains that when fused with GAL4 DBD do not interact with nuclear receptors in two-hybrid assays (Heery et al., 1997). It was noted that these non-receptor-binding LXXLL motifs contain proline residues and are not likely to have a helical character (Heery et al., 1997). The transcriptional activation domains of p160 coactivators have been mapped by fusing different coactivator sequences to a heterologous DNA-binding domain and determining the minimal sequences that will support transcriptional activation mediated by the heterologous DBD. Mapping has also been done by coexpressing regions of coactivators in yeast and determining the sequence regions that are sufficient to support AR-2 function of nuclear receptors. Two separable activation domains (termedAD1 andAD2) have been identified in SRC1(Ofiate et al., 1998).AD1 is localized within the amino terminus between aa 1 and 93 and the stronger AD2 domain lies between aa 840 and 948. This places AD2 just C-terminal to the middle nuclear receptor interaction site (Fig. 2A). Similarly, two separate transcriptional activation domains were mapped in ACTR: a strong domain (ADA) between aa 1030 and 1088 and a weaker domain (ADB) between aa 1123 and the C terminus (Chen et al., 1997). In GRIP1, a single activation domain (AD) was identified between aa 730 and 1121 (Hong et al., 1997). The nature of the transcriptional domains in p160 coactivators is largely unknown. These presumably are sites for binding general transcriptional factors or other proteins. Interestingly, the ADA region in ACTR does not bind to the general transcription factors TFIIB, TBP, or TAFs, but it is contained within a minimal region that binds CBP. Similarly positioned p300 CBP interaction sites that overlap activation
186
DEAN P. EDWARDS
domains have been identified in all three classes of p160 coactivators (Fig. 2A). In SRC-1, the p300KBP interaction domain lies between aa 789 and 993 (Yao et al., 1996) and in GRIPl this domain is located between aa 775 and 1129 (Ding et al., 1998) (Fig. 2A). The coincidence of p300KBP binding sites with transcriptional activation domains suggests that p300KBP may mediate the transcriptional enhancement activity of p160 coactivators. In summary, these functional domain mapping studies indicate that p160 coactivators are modular proteins that contain multiple and separable domains for nuclear receptor binding and for transcriptional activation. Why the p160 coactivators have multiple nuclear receptor interaction sites is not clear. Individual NR boxes in different classes of coactivators may not be functionally equivalent with respect to nuclear receptor specificity. A direct comparison of SRC-1 and GRIPl for binding to a wide group of steroid and nonsteroid nuclear receptors indicated that full-length SRC-1 and GRIPl both interact efficiently with all classes of nuclear receptors, with one minor difference. SRC-1 binds poorly to AR, while GRIPl binds AR with the same efficiency as other receptors. When the contribution of individual NR boxes were assessed, a nuclear receptor preference was observed that was not the same for SRC-1 and GRIP1. For example, the three NR boxes in the central domain of SRC1 as a unit, preferentially bind ER, PR, VDR, RAR, and TR, whereas NR box IV in the C terminus has a preference for AR and GR. GRIPl does not have a C-terminal NR box. Thus, all the receptor binding in GRIP-1 is mediated by the central domain, which has a different nuclear receptor preference profile than the isolated central domain of SRC-1 (Ding et al., 1998). Results from the analysis of mutations of individual GRIPl NR boxes have indicated that NR box I1 has a preference for interaction with ER and TR, whereas NR box I11 prefers AR and GR. Mutations in NR box I1 in SRC-1 have a more deleterious effect on ER and RAR binding than binding to other nuclear receptors. Conversely, mutations in SRC-1 NR box I11 affected other receptors more than ER and RAR (Torchia et al., 1997; Ding et al., 1998). Thus, individual NR boxes in different p160 coactivators appear to have overlapping but nonidentical preferences for specific types of nuclear receptors. As suggested by Ding et al. (1998), multiple NR boxes with these properties may have evolved as a way for a single structural motif to interact with a wide group (perhaps all) of nuclear receptors. Additionally, this may afford a level of receptor specificity for a particular p160 coactivator. Thus, depending on the concentration of a specific coactivator in the cell, a subgroup of nuclear receptors may utilize one p160 coactivator over another. It has also been proposed that the p160
COREGULATORY PROTEINS
187
coactivators may use multiple NR boxes to bind simultaneously to two AF-2 domains of a receptor dimer when complexed to DNA, to couple two receptor dimers bound to tandem HREs, or to couple two types of nuclear receptors as a way to mediate “crosstalk”between different hormone signaling pathways (Heery et al., 1997; Torchia et al., 1997; Ding et al., 1998). The mechanism of coactivator binding to receptors is not well defined. The core AF-2 that forms part of amphiphatic a helix 12 is essential for the binding of p160 coactivators to the LBD. Mutations of key residues that impair AF-2 function, without altering steroid- or DNA-bindingactivity of receptors, have been reported to greatly reduce p160 binding (Voegel et al., 1996; Takeshita et al., 1996; Hong et al., 1997; Li et al., 1997; Chen et al., 1997; Jeyakumar et al., 1997). Additionally, a 20amino-acid peptide containing the AF-2 core of TRP effectively inhibited the binding of SRC-1 to the receptor (Jeyakumar et al., 1997). However, the core AF-2 may not be sufficient for p160 binding. Point mutations in LBD regions outside of helix 12 have been observed to also reduce the function of AF-2 without altering steroid and DNA binding (O’Donnell and Koenig, 1990; Henttu et al., 1997).A conserved lysine residue at aa 366 of mouse ER, which is predicted to be positioned at the C terminus of helix 3, was observed to be important for both AF-2 function and SRC-1binding. Mutation of lysine 366 (lys-rala) reduced both AF-2 function and SRC-1 binding (Henttu et al., 1997). These results suggest that the receptor surface for binding p160 coactivators is created by ligand-induced repositioning of the core AF-2 in helix 12 next to other key dispersed residues within the LBD. B. OTHERCOACTIVATORS ( E W 1 6 0 , RIP140, TIF1, T R I P ~ - S U G - ~ , H R P F ~AR , A,,). Several other proteins unrelated in primary amino acid sequence to p160 coactivators have been isolated that bind to activated nuclear receptors. These include ERAP16O (ER-associated protein 160), RIP140 (receptor-interacting protein 140),TRIPl (thyroid-receptor-interacting protein 11, TIFl (transcriptional intermediary factor 11, and ARA,, (androgen-receptor-associated protein 70). ERAP160 and RIP140 were defined biochemically as proteins that bind directly in uitro to the LBD of ER (Halachmi et al., 1994; Cavaillhs et al., 1994, 1995). TIFl was isolated by a modified version of the yeast two-hybrid genetic screening assay using the LBD of IlxR as the bait (Le Douarin et al., 1995).TRIPl was identified as a human protein that interacts with the TR-LBD in a T3-dependent manner in a yeast two-hybrid screening (Lee et al.,
188
DEAN P. EDWARDS
1995a,b). Sequence analysis of TRIP1 revealed it to be similar to a yeast transcriptional coactivator Sug-1 (Rubin et al., 1996). Similar to p160 coactivators, RIP140 and TIFl have been observed to interact with several different classes of nuclear receptors (RIP140 with ER, RXR, RAR, and TR; TIFl with RXR, RAR, and ER) (L'Horset et al., 1996;Le Douarin et al., 1996). These interactions are dependent on both ligand agonist and a functionally intact AF-2 and do not occur in the presence of hormone antagonists. An additional similarity with p 160 coactivators is the presence of LXXLL motifs in RIP140 and TIFl (Keery et al., 1997). Two strong nuclear receptor binding domains, that harbor NR boxes, have been functionally mapped within RIP140, and, when fused to a heterologous DBD, RIP140 exhibits transcriptional activation function (L'Horset et al., 1996). Despite these many similarities with p160 coactivators, neither RIP140 nor TIFl have been observed t o exhibit transcriptional enhancement activity when coexpressed with nuclear receptors in mammalian cells. RIP140 overexpression generates a modest 2-fold enhancement of ER mediated transcription when expressed at low levels, whereas ER activity in fact is inhibited at high levels (Cavaillhs et al., 1995; L'Horset et al., 1996). Similarly, TRIP1-Sug-1 do not appear to have coactivator function for nuclear receptors in mammalian cells (Lee et al., 1995a,b; Le Douarin et al., 1995, 1996). Why these other proteins, in particular RIP140 and TIF1, are unable to potentiate AF-2 activity when overexpressed in mammalian cells is not entirely clear. It is possible that endogenous levels of these proteins in mammalian cells are higher than p160 coactivators, or that other associated proteins required for RIP140 and TIFl to function are limiting. Alternatively, these proteins may not serve as bridging factors with the general transcriptional machinery. Indeed the latter explanation may be the case with TIF1. Two TIFl interacting proteins have been identified, mHPla and mMODI, which are homologs of the Drosophila heterochromatinic proteinl. Also, TIFl was reported to be unable to interact in uitro with general transcription factors (Le Douarin et al., 1996). These data taken together, suggest that TIFl may function to couple receptors with specific chromatin sites involved in remodeling of nucleosomal structure. Recent studies of nuclear receptor-coactivator interactions in yeast suggest that RIP140 does have significant coactivator function. In contrast to results in mammalian cells, coexpression of RIP140 in yeast enhanced the transcriptional activity of ER and RAR by as much as 10-fold and it did not generate the squelching observed in mammalian cells (Joyeux et al., 1997).Yeast do not appear to express transcriptional coactivators capable of supporting AF-2 function. Agene bank search of Saccharomyces cereuisiae revealed no significant se-
COREGULATORY PROTEINS
189
quence homologies with any known mammalian nuclear receptor AF-2 interacting proteins, pSOO/CBPs or the corepressors NCOR and SMRT (Walfish et al., 1997). When the LBDs of all five steroid receptors and several nonsteroid nuclear receptors were fused to the GAL4 DBD (to eliminate the amino terminal AF-1) and tested for their ability to mediate transcription in yeast, ligand-dependent transactivation was not observed unless the p160 coactivator GRIPl was coexpressed. In contrast, when the amino terminus of GR was linked to the DBD, it was constitutively active, and coexpression of GRIPl had no further effect (Hong et al., 1997). These data provide strong evidence that AF-2 function is mediated primarily by p160 coactivators and that other endogenous coactivators in yeast are able to mediate AF-1 responses. Thus, yeast cells with a null background for AF-2 coactivators provide an excellent experimental system to study receptor-coactivator interactions (Walfish et al., 1997; Hong et al., 1997). These data taken together with the ability of RIP140 to exhibit strong coactivation function in yeast suggests that RIP140 is a bonafide nuclear receptor coactivator. To confirm the coactivator function of RIP140 in mammalian cells will require depletion experiments with dominant negative repressors of endogenous RIP140, or by cellular targeting with neutralizing antibodies, competing peptides, or antisense RNA. As suggested by these yeast studies, it may not always be possible to demonstrate transcriptional coactivation function in mammalian cells by simply overexpressing coactivators. In the null background of yeast cells, p160 coactivators have been shown to strongly potentiate AF-2 activity for all classes of nuclear receptors. In contrast, coactivation function has not been observed consistently in mammalian cells for all the same classes of nuclear receptors (Walfish et al., 1997; Hong et al., 1997). Two additional interesting proteins that exhibit steroid receptor coactivator function are the androgen-receptor-associated protein ARA,, and hRPF1. ARA,, was isolated in a yeast two-hybrid screening as a 70-kDa protein that interacts with the LBD of human AR in a hormoneagonist-dependent manner (Yeh and Chang, 1996). The androgen antagonist hydroxyflutamide does not promote these interactions, suggesting that this is an AF-2 interacting protein although a correlation between binding and AF-2 activity was not reported. Interestingly, coexpression of ARA,, in prostate cancer cells (DU145) that lack ARA,, expression, and in yeast, enhanced the transcriptional activity ofAR by a factor of 10 but had minimal effects on other nuclear receptors, including RAR, TR, ER, PR, and GR. In mammalian cells that do express ARA70, transfection of antisense ARA,, RNA partially blocked AR activity (Yeh and Chang, 1996). These data suggest that ARA,, is a spe-
190
DEAN P. EDWARDS
cific coactivator for androgen receptors. Why an AR would require its own transcriptional coactivator is not clear. The relative expression of ARA,, was reported t o vary considerably in different tissues and cell lines (Yeh and Chang, 1996).In this regard, it is of interest to note that SRC-1 interacts efficiently with a broad number of nuclear receptor types with the exception of AR (Ding et al., 1998). Agenetic screen for suppressors of ligand-dependentPR-mediated inhibition of growth of yeast cells resulted in the isolation of a yeast protein, RSP5, that potentiates the transcriptional activity of PR and GR when overexpressed in yeast and mammalian cells (Imhof and McDonnell, 1996). A human homolog of RSP5, hRPF1, was reported to have similar activity. As with other nuclear receptor coactivators, overexpression of hRPFl enhanced the transcriptional activity of GR and PR without affecting basal activity of hormone responsive reporter genes. Moreover, enhancement was not restricted to a single cell type or target promoter and overexpression of hRPF-1 in mammalian cells partially reversed ER squelching of PR transcription, indicating that it is a limiting cellular factor. Curiously, hRPFl had no potentiating effect on the transcriptional activity of ER, suggesting that it is a coregulatory factor specifically for GR and PR. However, experiments with other nuclear receptors were not reported. RSP5 is an E3 ubiquitin-protein ligase and hRPFl has significant sequence homology with human E6A€' (E6-associatedproteins), a protein involved in ubiquitination and degradation of p53 (Huibregtse et al., 1995). However, the ubiquitination activity of RSP5 does not appear to be required for its effect on steroid receptor function. Mutations in RSP5 that are required for ubiquitination conjugation had no effect on the ability of RSP5 to potentiate the transcriptional activity of PR or GR. RSP5 was initially identified as a suppressor of mutations of an essential gene, SPT3, which is a yeast TPB-associated factor most closely related to human TAF,, 18 (Winston, 1992; Eisenmann et al., 1992). When coexpressed in mammalian cells, hRPFl and SPT3 acted synergisticallyto enhance the transcriptional activity of GR. Whether hRPFl interacts directly with GR and PR, or potentiates AF-1-AF-2 function was not reported. Further studies of hRPF-1 should provide important insights into how steroid receptors functionally couple with the general transcriptional apparatus.
C. p300/CBP COINTEGRATORS The CAMPresponse element binding protein, CREB, mediates transcriptional enhancement of many CAMPresponsive genes. CREB activation is tightly regulated by protein kinase A (PKA)phosphorylation of serine 133 (Ser-133). CBP is a 265-kDa protein that binds to CREB
COREGULATORY PROTEINS
191
in a Ser-133 phosphorylation-dependent manner and functions as an essential cofactor in the CREB transcriptional signaling pathway. Overexpression of CBP in mammalian cells enhances the transcriptional activity of CREB in a PKA-dependent manner, and microinjection of neutralizing antibodies to CBP inhibits CAMP-induced gene transcription (Chrivia et al., 1993; Kwok et al., 1994). The domain of CBP that interacts with CREB has been mapped to a minimal 160 aa region near the amino terminus. A separate transcriptional AD has been localized to a glutamine rich region in the C terminus between aa 1678 and 2441 (Fig. 2B). The C-terminal activation domain is capable of binding the general transcriptional factor TFIIB and the site of interaction has been narrowed to a subregion (aa 1680-1890) that contains significant homology to a zinc-finger domain in the yeast transcriptional coactivator ADA-2 (Berger et al., 1992; Kwok et al., 1994). CBP has also been observed by coimmunoprecipitation assays t o interact directly with components of the RNApolymerase I1 holoenzyme and to be an essential intermediate for the indirect association of phosphorylated CREB with the RNA polymerase I1 complex (Kee et al., 1996). Thus, CBP appears to facilitate the recruitment of the general transcriptional apparatus by simultaneously binding to CREB and downstream general transcription factors. CBP itself contains a consensus PKA phosphorylation site in the C-terminal activation domain. The role of this PKA site in CBP function, if any, remains to be determined. It has been speculated that it may regulate CBP interaction with downstream general transcription factors. However, this site is dispensable for the intrinsic transcription activation function of the C terminus when it is linked to a heterologous DBD (Kwok et al., 1994; Kee et al., 1996). p300 was initially identified as a protein that interacts with the adenovirus-transforming protein E1A. Its association with E1A has been shown to correlate with E1A-transforming activity and the ability of E 1A to perturb the cell cycle, cellular differentiation, and the activity of certain transcriptional enhancers (Lundblad et al., 1995). p300 and CBP share extensive sequence homology and appear to be functionally interchangeable as transcriptional coactivators of phosphorylated CREB. Homologous regions in the amino terminus of p300 and CBP interact with CREB in a Ser-133 phosphopration-dependent manner. In addition to interacting with CREB and ElA, p300/CBPs have been observed to interact with, and to be functionally important for, several other families of transcription activators including STATs, AP1, c-myb, and Myo-D (Bhattacharya et al., 1996; Yang et al., 1996). Thus p300/ CBPs appear to be common coactivators for multiple different transcriptional signaling pathways.
192
DEAN P. EDWARDS
The involvement of p3OOKBP in nuclear receptor signaling was discovered as the result of identification of p160 coactivators as targets of p300KBP. In a search for proteins that interact with p300/CBP, human SRC-1 (Kamei et al., 1996)and the related p/CIP (Torchia et al., 1997) were pulled out of yeast two-hybrid screening assays using CBP as the trap. Similarly, mouse SRC-1 was isolated as a p300-interacting protein (Yao et d., 1996). Subsequently, other known p160 coactivators have been shown to also interact with p300/CBP (Heery et al., 1997; Chen et al., 1997; Ding et al., 1998).The p160 interaction domain within p300/CBP was initially mapped broadly to the C-terminal-most -500 amino acids (Yao et al., 1996). Further deletion and truncation analysis within this region have defined a minimal p160 interaction site between aa 2058 and 2163. (Torchia et al., 1997) (Fig. 2B). In addition to interacting with p160 coactivators, p300/CBP can interact independently with several different classes of nuclear receptors through an amino terminal site. This NR interaction site has been mapped to the first -170 amino acids in the N terminus (Chakravarti et al., 1996)(Fig. 2B). Interestingly, this region in both CBP and p300 contains a single LXXLL motif, which has been shown by mutagenesis t o be essential for CBP binding to nuclear receptors (Heery et al., 1997).Curiously, a second NR-interaction site has been identified in CBP between amino acids 356 and 495, which appears to be selective for RXR and also contains a single LXXLL motif (Fig. 2B). Based on pull-down assays with recombinant GST-CBP fusion proteins, and Far Western blots using 32P-labeledLBD of nuclear receptors as probes, it appears that CBP can interact directly with the LBD of nuclear receptors in a ligand-agonistdependent manner. The extent to which p300/CBP interaction with nuclear receptors is dependent on a functional AF-2 has not been well addressed. Similar to studies with p160 coactivators, agonist-dependent p300KBP binding to the LBDs of nuclear receptors has been observed t o occur in vivo, as determined by yeast and mammalian two-hybrid interaction assays (Charkravarti et al., 1996; Kamei et al., 1996; Torchia et al., 1997; Chen et al., 1997). A three-way complex between nuclear receptors, p160 coactivators, and p300/CBP has been demonstrated in uitro (Kamei et al., 1996; Yao et al., 1996;Hanstein et al., 1996).An interesting question that has not been resolved is how this ternary complex assembles. One study showed by use of an expressed N-terminal nuclear receptor interaction domain of CBP (lacking the p160 interaction domain), that CBP and SRC-1 can bind simultaneously to the LBD of nuclear receptors in a hormone agonist dependent manner (Kamei et al., 1996).This suggests that p300/CBP can associate with nuclear receptors through simulta-
COREGULATORY PROTEINS
193
neous direct (N-terminal NR boxes) and indirect mechanisms (C-terminal p160 sites). Alternatively, it has been suggested that p300XBP associates with nuclear receptors primarily through an indirect mechanism, where p160 coactivators bound t o m - 2 recruit p300/CBP to form a coactivator complex (Hanstein et al., 1996). That p300/CBPs have important functional roles in nuclear receptor signaling has been shown by similar approaches used to characterize the p160 coactivators. Overexpression of p300KBP in mammalian cells has been observed to enhance the ligand-induced transcriptional activity of several different classes of nuclear receptors (Hanstein et al., 1996; Chakravarti et al., 1996; Kamei et al., 1996; Torchia et al., 1997). Microinjection of mammalian cells with neutralizing antibodies to CBP resulted in a substantial inhibition of ligand-induced RAR and RXRdependent transcriptional activation, indicating that p3OOKBPs are essential components of activated nuclear receptor complex. Other experimental approaches used to address the requirement of p300/CBPs for nuclear receptor function have also provided insights into its mechanism of action. For example, microinjection of a peptide containing the minimal p300KBP interaction domain of p160 (see Fig. 2B), to disrupt the formation of pl6O-CBP complexes without effecting pl60-nuclear receptor interaction, inhibited RAR-dependent transcription (Torchia et al., 1997). When the p3OOKBP interaction domain in ACTR was mutated as an internal deletion, without affecting NR-interaction sites, ACTR no longer exhibited nuclear receptor coactivation function when overexpressed in mammalian cells (Chen et al., 1997). These data taken together suggest that p300/CBPs are essential for the functional activity of p160 coactivators. Just as p160 coactivators in the absence of an interacting p300KBP have little nuclear receptor coactivation function, pSOO/CBP in the absence of p160 coactivators also do not appear to be very functional. Inhibition of nuclear-receptor-dependent transcriptional activation by microinjection of antibodies to the p160 related coactivator, p/CIP, could not be rescued by overexpression of p/CIP. Rescue required coexpression of both plCIP and CBP (Torchia et al., 1997). These data suggest that p160 coactivators and p300/CBP are required to function together as a complex. Since p300KBP can bind directly to general transcription factors in the RNA polymerase I1 holoenzyme (Kee et al., 1996) it is tempting to speculate that p300KBPs function as adaptors between the p160 coactivators and the general transcriptional apparatus. Further evidence that the p160 coactivators and p300KBPs have distinct functional roles in nuclear receptor signaling pathways is provided by the observation that coexpression of both SRC-1 and p300/CBP enhanced the transcriptional activity of ER
194
DEAN P. EDWARDS
and PR in a synergistic, rather than an additive, manner (Smith et al., 1996). Because p300/CBPs are common components of coactivator complexes for several families of sequence specific transcriptional activators, these proteins have also been proposed to function as cointegrators of multiple diverse transcriptional signaling pathways. Indeed, p300 CBPs may serve as mediators of crosstalk between extracellular signal transduction pathways and nuclear receptors.
D. PERTURBATION OF RECEPTOR COACTIVATOR-COREPRESSOR INTERACTIONS BY STEROID ANTAGONISTS The preponderance of experimental evidence shows that most classes of steroid receptor ligands that act as strong antagonists promote the binding of receptors to target HREs, both in uitro and in whole cells (Bagchi et al., 1988; Kumar and Chambon, 1988; Meyer et al., 1990; Reese and Katzenellenbogen, 1991,1992; Delabre et al., 1993; McDonnell et al., 1995; Metzger et al., 1995b; Kuil and Mulder, 1996; Gass et al., 1998). This includes the partial estrogen antagonist tamoxifen, pure antiestrogens such as ICI 164,384, and the partial progesterone antagonist RU486. Although the pure antiprogestin ZK98299 was initially proposed to represent a class of compound that fails to stimulate PR-DNA binding, this was based on in uitro electrophoretic gel mobility shift assays (EMSA) (Klein-Hitpass et al., 1991; Takimoto et al., 1992). Subsequent studies have shown ZK98299 to effectively stimulate PR binding to PREs in whole cells and to be able to induce PR binding to PREs in uitro by use of a modified EMSA procedure (Delabre et al., 1993; Gass et al., 1998). Thus, the ability of most ER and PR antagonists to inhibit receptor activation occurs at a step downstream of receptor-DNA binding. The identification of nuclear receptor coactivators has provided important insights into the molecular mechanism of action of these steroid antagonists. Binding of antiestrogens to ER and antiprogestins t o PR induces a conformational change in the carboxyl-terminal tail of receptors that is distinct from that induced by agonists, and these antagonists also fail to activate AF-2 function. A difference in receptor conformation at the C terminus was initially shown by different biochemical methods including partial proteolysis, mutagenesis, and differential reactivity t o an antibody directed to the C-terminal tail of PR (Allan et al., 1992;Vegeto et al., 1992; Beekman et al., 1993; Weigel et al., 1992).Crystallography studies of the ER LBD bound to 17P-estradiol and the antiestrogen raloxifene are consistent with the biochemical data and further show that the core AF-2 in CY helix 12 is positioned
COREGULATORY PROTEINS
195
differently in the ER LBD complexed t o the antiestrogen as compared to 176-estradiol (Brzozowski et al., 1997). Studies from several laboratory groups have observed that p160 coactivators, as well as RIP140 and TIF1, are unable to associate with the LBD of ER bound to antiestrogens or to the LBD of PR bound to RU486 (Cavaillks et al., 1995; Le Douarin et al., 1995; Ofiate et al., 1995; Voegel et al., 1996). Similarly, glucocorticoid antagonists and RAR-specific antagonists do not allow coactivator binding to the LBD of GR and RAR, respectively (Kamei et al., 1996; Hong et al., 1997). Thus, it is generally believed that an inability of receptors to associate with p160 (or p300 CBP) coactivators is an essential step down stream of receptor-DNA binding that is disrup ted by antagonists. However, an inability to recruit coactivators appears to be only part of the story. Several research groups recently discovered that binding of antagonists to ER and PR promotes an inappropriate association of receptors with the corepressors NCOR and SMRT (Smith et al., 1997; Jackson et al., 1997; Wagner et al., 1998). These antagonist-dependent corepressor interactions have been observed in whole cells by yeast and mammalian two-hybrid assay. In the absence of ligand or the presence of hormone agonist, minimal interactions were detected between receptors and corepressors, whereas strong interactions were observed in the presence of antagonists. Interestingly, Wagner et al. (1998) showed a correlation between the antagonist potential of different classes of antiprogestins and the strength of PR-corepressor interactions. For example, the mixed agonist RTI-020 gave a modest interaction, the partial antagonist RU486 stimulated a much stronger interaction and the pure antagonist ZK98299 induced the strongest interaction of PR with NCOR or SMRT. Mixed steroid antagonists such as tamoxifen and RU486 can act either as weak agonists or complete antagonists. Which activity predominates is highly dependent on the cell or tissue type and the promoter context of the target gene (Berry et al., 1990; McDonnell et al., 1995). This suggests that cell-type-specificcoregulatory factors have a strong role in determining the relative agonist-antagonist activity exhibited by these compounds. Under conditions where tamoxifen and RU486 exhibit partial agonist activity, overexpression of NCOR or SMRT was found to completely inhibit the partial agonist activity of both compounds (Smith et al., 1997; Jackson et al., 1997; Wagner et al., 1998). This strongly suggests that NCOR and SMRT can act as functional corepressors of ER or PR. It is not likely that association of these corepressors with ER and PR is a normal response to native hormonal ligands. NCOR and SMRT were initially identified as proteins that interact with the hinge region of unliganded TR and RAR to mediate
196
DEAN P. EDWARDS
transcriptional silencing that is unique t o this subclass of nuclear receptors (Chen and Evans, 1995; Horlein et al., 1995).Thus, it is likely that altered conformations in steroid receptors induced by antagonists are somehow sensed by these corepressors as an attempt by the cell to repress an improperly activated receptor. These intriguing results indicate that inhibition of receptor activation by steroid antagonists is not due simply to a failure to interact with coactivators, but also to an active repression brought about by the recruitment of one or more transcriptional corepressors. These preliminary observations with corepressors raise interesting and potentially relevant questions as to the extent to which the relative expression, or availability, of cellular coactivators-corepressors is a determinant of the agonist-antagonist potential of these synthetic compounds. For example, in tissues where tamoxifen is a partial agonist such as bone and uterus (Barzel, 1988; Love et al., 1992; Felson et al., 1993; Kedar et al., 1994), could this be due to low levels of available NCOR and SMRT? Could variable expression of these corepressors in breast tumors be responsible for the relative agonist-antagonist balance of tamoxifen, or to the ability of tamoxifen to acquire agonist activity with prolonged treatment (Jordan et al., 1987; Hu et al., 1993; Santen, 1996)? Conversely, could overexpression of transcriptional coactivators increase the agonist potential of tamoxifen or RU486? Overexpression of the p160 coactivator SRC-1 in mammalian cells was observed to enhance the agonist activity of tamoxifen under conditions where tamoxifen behaves as a partial agonist. However, SRC-1overexpression was not able to convert tamoxifen from an antagonist to an agonist in a cellular and target promoter context where it behaves as an effective antagonist (Smith et al., 1997). Interestingly, overexpression of SRC-1 was unable to reverse the repression of the partial agonist activity of tamoxifen mediated by SMRT, suggesting that corepressor interaction with the steroid receptor-antagonist complex is dominant (Smith et al., 1997).Whether other transcriptional coactivators exist that are capable of functionally converting an antagonist to an agonist is not known. Studies with a ribosomal protein, L7-SPA, identified to interact with the hinge region of PR when it is bound t o antiprogestins suggests that this may be so. Overexpression of L7-SPA increased the agonist potential of RU486 and tamoxifen under conditions where these compounds behave as effective antagonists (Jackson et al., 1997).The nuclear function of L7-SPA is unknown and whether L7-SPA is a true transcriptional coactivator or binds directly to receptors in an antagonist-specificmanner has not been established. A number of interesting questions remain regarding to the mechanism of steroid-antagonist-dependentrecruitment of corepressors by
COREGULATORY PROTEINS
197
ER and PR. The location of the corepressor interaction sites within ER and PR have not been mapped, and whether corepressors bind directly or indirectly has not been determined by use of in uitro protein interaction assays with purified components. SMRT was observed to bind to ER in uitro in an ER-GST pull-down experiment, but the interaction was not antagonist dependent as it is in uiuo. This suggests that another factor may be involved in coupling corepressors with ER or PR in an antagonist-dependent manner. Using different domains of ER and PR in the yeast two-hybrid assay, the LBD was observed to be sufficient for association with NCOR in response to antagonists. However, other regions outside the LBD may also be involved as suggested by the different results obtained with full-length PR and the LBD of PR. NCOR was reported to interact with the LBD of PR only in response to partial antagonists such as RU486, but not the purer antagonist ZK98299 (Jackson et al., 1997).In contrast, ZK98299 stimulated a strong interaction of NCOR-SMRT with full-length PR (Wagner et al., 1998).Does the unique conformation in the AF-2 core induced by antagonists provide a surface for association with corepressors, or is this provided by a conformational change in another region of the receptor? Although coactivators in uitro are unable to associate with the LBD bound to antagonists in the apparent absence of NCOR-SMRT, what is the possibility that corepressors in uiuo inhibit coactivator binding, either by competition for interaction with AF-2 or by steric hindrance? E. MECHANISMOF ACTION The molecular mechanism of action nuclear receptor-associated coactivators is not known. The recent discovery that p160 coactivators and p300 CBP have histone acetyltransferase (HAT) enzyme activity suggests that these proteins may not function simply as a physical link with the general transcriptional apparatus, but may also be involved in targeted remodeling of chromatin. A correlation has been observed between transcriptionally active chromatin and hyperacetylation of conserved lysine residues in the amino terminal tail of core histones. It is generally believed that acetylation of these positively charged lysine residues decreases the affinity of core histone-DNA interactions and destabilizes nucleosomal structure to facilitate access of transcription factors (Wolffe and Pruss, 1996; Brownell and Allis, 1996; Pazin and Kadonaga, 1997). The discovery that a yeast transcriptional coactivator, GCN5, and a related human protein, pCAF (Brownell et al., 1996; Yang et al., 1996)possess HAT activity, has lead to the idea that histone acetylation can be targeted to specific promoters via protein interaction of HATS with transcriptional activators. Two of the p160 nuclear re-
198
DEAN P. EDWARDS
ceptor coactivators (SRC-1 and ACTR) and p3OO/CBP have now been shown to have intrinsic HAT activity. Deletion and truncation mutation analysis have mapped the HAT catalytic domain in p300/CBP to a region between the bromo and E1A domains (Bannister and Kouzarides, 1996; Ogryzko et al., 1996).The HAT catalytic domain of the p160 coactivators is located within the C terminus, between aa 1107 and 1441for SRC-1 (Spencer et al., 1997) and between aa 1029 and 1292 for ACTR (Chen et al., 1997 (Fig. 2A). Interestingly, sequence analysis of the HAT catalytic domains of the p160 and p300/CBP coactivators does not show similarity to any other proteins, including the HAT domain and conserved acetyl coenzyme A (acetyl-CoA) binding sites in GCN5 and pCAF. This suggests that p160 and p300/CBP coactivators represent a novel class of histone acetyltransferases. That this is the case is further strengthened by the different substrate specificities observed for p160 and p300/CBP, as compared with GCN5 and pCAF. Purified p300/CBP acetylates all four core histones, H2A, H2B, H3, and H4, both in free form and in mononucleosomes (Bannister and Kouzaarides, 1996; Ogryzko et al., 1996).The p160 coactivators, preferentially acetylate H3 and H4, also on free histones and mononucleosomes (Spencer et al., 1997; Chen et al., 1997).In contrast, GCN5 and pCAF acetylate H3 and H4 only in free form, with a preference for H3 (Yang et al., 1996).Acetylation of histones in uitro by p300/CBP and SRC-1 has further been shown to occur on the same lysine residues in the N terminus that are acetylated in uiuo, suggesting that this in uitro enzymatic activity is physiologically relevant. At least one other histone acetyltransferase enzyme has been found to be associated with a hormone activated nuclear receptor complex. pCAF (p300/CBP-associated factor) was first identified as a protein that interacts with p300/CBP and was subsequently determined to have significant homology to the yeast GCN5 and to possess HAT enzyme activity (Yang et al., 1996). More recently pCAF was found to be recruited to the activated nuclear receptor complex either indirectly through interaction with p160 coactivators (Chen et al., 1997) or by direct binding to receptors (Jenster et al., 1997). Thus, nuclear receptors are capable of recruiting a coactivator complex that contains at least three different classes of HAT enzymes including p160 coactivators, p300/CBP and pCAF (Fig. 3). These findings raise the possibility that HAT enzyme activity may be a common feature of all transcriptional coactivators. Why receptors need to recruit multiple HAT enzymes is not known. The fact that each of the three classes of enzymes has a different substrate specificity suggests that multiple HATS are required for full acetylation of core histones on nucleosomes.
199
COREGULATORYPROTEINS
Nucleosome
HZG
HMG
FIG.3. Proposed mechanism of action of steroid receptor coregulatory proteins. HMG, high mobility group proteins; HRE, hormone response element; AF-1 and AF-2, transcriptional activation functions in the amino and carboxyl terminus, respectively, of steroid receptors; DBD, DNA-binding domain of steroid receptors; HAT, histone acetyltransferase activity; pol 11, RNA polymerase I1 holoenzyme.
The only experiments that have addressed the role of histone acetylation in steroid hormone action in whole cells have been done by treatment of cell cultures with histone deacetylase inhibitors, such as trichostatin A (TSA).Treatment with TSAwas observed to potentiate both progesterone and glucocorticoid induction of transiently transfected and chromosomally integrated target genes (Bartsch et al., 1996; Jenster et al., 1997). Because TSA increases global histone acteylation, a direct role for histone modification in steroid receptor action in uiuo is difficult to interpret from these kinds of experiments. However, under conditions where TSA potentiated progesterone induction of a chromosomal integrated mouse mammary tumor virus (MMTV) gene construct, it also generated a DNase I hypersensitive site over phased MMTV nucleosomes, suggesting that TSA had altered nucleosome structure in the vacinity of the MMTV promoter. A direct requirement of HAT enzyme activity for receptor-dependent transcription on chromatin templates has not been established. Nor it is known mechanistically how acetylation of core histone tails contributes to regulated transcription. Nonetheless, these intriguing preliminary observations that coactivators have intrinsic HAT activity strongly supports the notion
200
DEAN P. EDWARDS
that targeted histone acetylation contributes to steroid-hormone-induced transcriptional signals in uiuo. Interestingly, the corepressors NCOR and SMRT that interact with TR and RAFi to mediate transcriptional silencing form a complex with mammalian homologs of a yeast corepressor Sin3 and a yeast histone deactylase RPD3. The corepressor function of NCOR-SMRT has been shown to be dependent on an association with Sin3-RPD3, indicating that targeted deacetylation of core histones is integral to the transcriptional silencing activity of these proteins (Nagy et al., 1997; Heinzel et al., 1997; Alland et al., 1997). Thus, NCOR and SMRT are predicted to have the opposite effect on nucleosome structure as coactivators and to impair access of general transcription factors to the promoter. The fact that functionally important downstream targets in the general transcription apparatus have not been identified for p160 coactivators, taken together with their observed intrinsic HAT activity, has raised the question of whether these coactivators function solely through targeted remodeling of chromatin and may not act as bridging proteins with the preinitiation complex. However, two studies have shown functional effects of CBP and SRC-1 in receptor-dependent cellfree transcription assays in the absence of nucleosomes. Using a thyroid hormone receptor-GAL4 DBD fusion protein and a naked DNA template containing the tk-promoter and upstream GAL4 DNA binding sites, T3 induction of transcription from GAL4-tk was increased 5-fold by addition of excess CBP (Kamei et al., 1996). In a separate study, addition of the dominant negative C-terminal domain of SRC-1 (which contains a single NR interaction and lacks the transcriptional activation domain, see Fig. 2A) inhibited PR-dependent transcription from a simple PRE-TATA template (Jenster et al., 1997). These results suggest that nuclear receptor coactivators are capable of facilitating receptor-dependent recruitment or stabilization of the preinitiation complex independent of chromatin. Thus, it has been proposed that nuclear receptor coactivators have dual functions. One is to target the remodeling of nucleosome structure to enable access of general transcription factors to specific promoters. The other is to provide a physical link with general transcriptional factors t o recruit, or stabilize, the assembly of the transcriptional preinitiation complex (Jenster et al., 1997).
V. SUMMARY AND FUTURE QUESTIONS Multiple proteins capable of associating with the hormone-activated steroid receptor-DNA complex have been identified that have positive
COREGULATORY PROTEINS
201
or negative modulatory effects at different steps in the steroid hormone transcriptional signaling pathway. Based on data reveiwed in this article, a working model for the role of positive modulatory proteins in steroid hormone action is depicted in Fig. 3. HMG-1 and -2 increase the affinity of steroid receptors for HREs by stabilizing structural distortions in the target DNA induced by receptors and/or establishing additional protein-protein and protein-DNA interactions. By stabilizing structural conformations or bends in DNA at the promoter, HMG-1 and -2 may also function as architectural cofactors (Grosschedi et al., 1994; Wolffe, 1994)to facilitate the assembly of higher order coactivator-genera1 transcription factor complexes. p160 coactivators bind directly to the hormone-dependent transcriptional activation domain AF-2 and are proposed to assemble as a complex of proteins composed minimally of p160, p300/CBP, and p/CAF. This coactivator complex functions as a unit by dual mechanisms. One is to form a protein bridge with general transcription factors, facilitating recruitment or stabilization of the preinitiation complex. The second is targeted remodeling of chromatin. Most of the known coactivators that associate with nuclear receptors have intrinsic histone acetyltransferase activity. The enzymatic activity of the complex is proposed to contribute to disruption of nucleosome structure at the promoter, enabling access of general transcription factors in the context of the repressive effects of chromatin. Because studies of these coregulatory proteins are in their infancy, features of this model are expected to change rapidly. There are a number of important questions in this model that will be challenges for future studies. Are there specific AF-1 coactivators, or are the known coactivators able to mediate the function of AF-1 (Fig. 3)? A few studies have suggested that known coactivators are capable of mediating functional responses through amino terminal domains. Within the context of full-length ER, functionally disruptive point mutations in AF-2 did not abolish the ability of coexpressed SRC-1to augment ERdependent transcription (Smith et al., 1997). SRC-1 coexpression also was observed to substantially enhance the constitutive ligand-independent transcriptional activity of a truncated PR containing the amino terminus and DBD (Oiiate et al., 1998).As further evidence that amino terminal domains are involved in recruiting known coactivators are reports that SRC-1 and CBP can mediate functional synergy between AF1and AF-2. In mammalian two-hybrid assays, a strong hormone agonist-dependent interaction was observed between separately expressed amino-terminal (AF-l-containing) and carboxyl-terminal (AF-2-containing) domains of ER and AR. Coexpression of either SRC-1 or CBP increased these interdomain interactions (McInerney et al., 1996; Ikonen et al., 1997).Along similar lines, in uitro binding of SRC-1 to full-
202
DEAN P. EDWARDS
length PR was observed to involve cooperative interactions between the amino and carboxyl terminal domains. The strength of SRC-1 binding to full-length PR in uitro is 3- to 5-fold higher than the sum of SRC-1 binding to separately expressed amino and carboxyl terminal domains (Ofiate et al., 1998). These data collectively suggest that SRC-1 and CBP act as adaptors to functionally couple AF-1 and AF-2 in a manner that is required for full transcriptional activity of steroid receptors. Whether SRC-1 or CBP merely substitute functionally for other endogenous AF-1 coactivators in these experiments is not known. It will be interesting to learn from future biochemical or genetic screening experiments to learn whether there is a separate family or subclass ofAF1interacting coactivators. The extent to which coactivator association with nuclear receptors is influenced by DNA, and whether coactivators alter the affinity of receptors for DNA, are questions that have not been thorougly investigated. p160, CBP, and RIP140 have all been shown to associate with receptors on target DNA. This was observed as a ligand-dependent binding of coactivators to receptors on a biotinylated DNA probe immobilized to streptavidin resins (L’Horsetet al., 1996;Jeyakumar et al., 1997) or by supershift of receptor-DNA complexes when coactivators were added to EMSA reactions (Torchia et al., 1997; Chen et al., 1997). Studies have not addressed the question of whether coactivators interact in a different way with receptors on DNA as compared t o receptors in solution. This is a potentially important question since DNA binding induces conformational changes in the amino and carboxyl terminus of receptor, the nature of which may be influenced by the sequence of the HRE (Fritsch et al., 1992; Lefstin et al., 1994). Could DNA-sequencedependent conformational changes in receptor modulate the aflinity of coactivator binding, the preference for a specific coactivator, or the sites of protein interaction within the receptor or the coactivator? Only a single study has addressed the question of whether coactivators affect the strength of receptor interaction with HREs. ACTR recruited to the receptor-DNA complex was not observed to alter the affinity of receptor for DNA, suggesting that coactivators do not function by stimulating receptor-DNA binding (Chen et al., 1997). Why there are so many different nuclear receptor coactivators that each have the ability to bind directly to receptors is unclear. They could serve redundant essential functions. Alternatively, a specific coactivator may have a preference for a subgroup of nuclear receptors, in which case the relative receptor affinity and the cellular level of the coactivator could dictate a receptor preference in the cell. Little is known of the relative distribution and level of expression of the known coactivator
COREGULATORY PROTEINS
203
proteins in different cell and tissue types. Nor is anything known about what regulates expression, cellular availability or activity of these coactivators. To furhter complicate matters, it is likely that additional coactivators exist that remain to be identified and multiple splice variant forms of the different classes of p160 coactivators have been detected. It appears that receptors recruit a coactivator complex, not just a single coactivator.At least three different classes of coactivators have been identified to be capable of associating as a complex with receptors including p160, p300 CBP, and pCAF’. What has not been determined is whether coactivator complexes assemble in a stepwise fashion, with p160 acting to nucleate the complex, or whether preformed complexes exist in the cell that bind as a unit to receptors. As new coactivators are likely t o be discovered, what is the possibility that coactivator complexes contain more proteins than the three classes identified at the present time? Could there be multiple preformed coactivator complexes, each with different protein compositions, nuclear receptor preferences, and functions? It will be important in future studies to determine the composition and stoichiometry of native coactivator complexes, the affinities of the individual interaction sites between protein components, and the functional and structural contribution of each interaction site. Analogous with the general transcriptional apparatus, multiple weak protein-protein interactions may be important for creating a stable coactivator complex. Much remains to be learned about the mechanism of action of these steroid receptor coregulatory proteins. Functionally important protein torgets, either in the general transcriptional apparatus or in specific chromatin sites, have yet to be identified. It also is unknown how acetylation and deacetylation of core histones contributes to receptor-dependent activated transcription. Core histones may not be the only cellular substrates for the acetyltransferase activities of these coactivators. p53 was shown to be acetylated in uiuo and in uitro by p300, and acetylation by p300 increased the DNA-bindingactivity of pi53 (Gu and Roeder, 1997). This suggests that coactivators may acetylate nuclear receptors themselves, or nonhistone chromatin proteins, as a mechanism to modulate protein-protein or protein-DNA interactions. To identify important protein targets and to elucidate the mechanism of action of coactivators, it will be important to establish cell-free chromatin-based receptor-dependent transcription assays with purified components. It will also be important to determine the physiological role of these coregulatory proteins in steroid hormone action in animal models in uiuo. It is becoming increasingly evident that the activity of steroid receptors can be appreciably modulated by the relative balance of coactiva-
204
DEAN P. EDWARDS
tors and corepressors. The main determinant of the strength of coactivators or corepressor interaction with receptors appears to be ligandinduced conformational changes, which signals the recruitment of these coregulatory proteins. Steroid receptors are capable of assuming multiple conformations in response to binding different classes of synthetic ligands that exhibit varying biological potencies as hormone agonists or antagonists (Clemm et al., 1995;McDonnell et al., 1995;Wagner et al., 1996; Allan et al., 1996; Gass et al., 1998). This raises the question of how synthetic agonists and antagonists, which are used clinically for a variety of purposes, modulate the interaction of receptors with coactivators or corepressors in the cell. In breast cancer and other hormone-responsive endocrine tumors, one should probably now consider the relative cellular levels of coactivators and corepressors that are available to interact with receptors as a potential factor determining the responsiveness of tumors to hormone antagonists. Steroid antagonists may be less effective in tumor cells that have low levels of corepressor and high levels of coactivators. Although antibodies have been produced against nuclear receptor coactivators and corepressors for research purposes, there is clearly a need to develop reagents that can be used for immunocytochemical localization and quantitation of these coregulatory proteins in clinical samples. Screening of breast tumors for relative levels of expression of different coactivators and corepressors along with estrogen receptors may be an important additional predictor of the responsiveness of a tumor to antiestrogen therapy. In conclusion, significant progress has been made in the past few years in our understanding of how steroid receptors regulate gene transcription. This is due in part to the identification of different classes of coregulatory proteins. Proteins have been described that can either facilitate or inhibit receptor-DNA binding and enhance or repress the transcriptional activity of receptors bound to DNA. Study of the structural and functional properties of these coregulatory proteins is still in the early stages. Future work in this area is anticipated to reveal exciting new information and research opportunities. REFERENCES Ali, S., Metzger, D., Bornert, J.-M., and Chambon, P. (1993). Modulation oftranscriptional activation by ligand-dependent phosphorylation of the human oestrogen receptor A/B region. EMBO J. 12(3), 1153-1160. Allan, G. F., Leng, X., Tsai, S. F., Weigel, N. L., Edwards, D. P., Tsai, M.-J., and OMalley, B. W. (1992). Hormone and antihormone induce distinct conformational changes which are central to steroid receptor activation. J . Biol. Chem. 267, 19513-19520. Allan, G. F., Lombardi, E., Haynes-Johnson, D., Palmer, S., Kiddow, M., Kraft, P., Campen, C., Rybczynski, P., Combs, D. W., and Phillips, A. (1996). Induction of a novel con-
COREGULATORY PROTEINS
205
formation in the progesterone receptor by ZK299 involves a defined region of the carboxyl-terminal tail. Mol. Endocrinol. 10, 1206-1213. Alland, L., Muhle, R., Hou, H., Jr., Potes, J., Chin, L., Schreiber-Agus, N., and DePinho, R. A. (1997). Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature (London) 387,49-55. Almlof, T., Wright, A. P. H., and Gustafsson, J.d. (1995). Role of acidic and phosphorylated residues in gene activation by the glucocorticoid receptor. J. Biol. Chem. 270(29), 17535-17540. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X.-Y., Sauter, G., Kallioniemi, 0.-P., Trent, J . M., and Meltzer, P. S. (1997). AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277,965-968. Arnold, S. F., Obourn, J. D., Jaffe, H., and Notides, A. C. (1994). Serine 167 is the major estradiol-induced phosphorylation site on the human estrogen receptor. Mol. Endocrinol. 8,1208-1214. Bagchi, M. K., Elliston, J. F., Tsai, S. Y., Edwards, D. P., Tsai, M. J., and OMalley, B. W. (1988). Steroid hormone-dependent interaction of human progesterone receptor with its target enhancer element. Mol. Endocrinol. 2,1221-1229. Bai, W., and Weigel, N. L. (1996). Phosphorylation of S e P 1 in the chicken progesterone receptor modulates its transcriptional activity. J. Biol. Chem. 271(22), 12801-12806. Bannister, A. J., and Kouzarides, T. (1996). The CBP co-activator is a histone acetyltransferase. Nature (London) 384,641-643. Bartsch, J., Truss, M., Bode, J., and Beato, M. (1996). Moderate increase in histone acetylation activates the mouse mammary tumor virus promoter and remodels its nucleosome structure. Proc. Natl. Acad. Sci. U.S.A. 93, 10741-10746. Barzel, U. S. (1988). Estrogen in the prevention and treatment of postmenopausal osteoporosis. Am. J. Med. 85,847-850. Beato, M., and Sanchez-Pacheco, A. (1996). Interaction of steroid hormone receptors with the transcription initiation complex. Endocr. Reu. 17(6), 587-609. Beck, C. A., Weigel, N. L., and Edwards, D. P. (1992). Effects of hormone and cellular modulators of protein phosphorylation on transcriptional activity, DNA binding, and phosphorylation of human progesterone receptors. Mol. Endocrinol. 6,607-620. Beck, C. A., Zhang, Y., Weigel, N. L., and Edwards, D. P. (1996). Two types of anti-progestins have distinct effects on site-specific phosphorylation of human progesterone receptor. J. Biol. Chem. 271(2), 1209-1217. Beebe, J. S., Darling, D. S., and Chin, W. W. (1991). 3.5,3'-triiodothyronine receptor amiliary protein (TRAP) enhances receptor binding by interactions within the thyroid hormone response element. Mol. Endocrinol. 5,85-93. Beekman, J. M., Allan, G. F., Tsai, S.Y., Tsai, M.-J., and O'Malley, B. W. (1993). Transcriptional activation by the estrogen receptor requires a conformational change in the ligand binding domain. Mol. Endocrinol. 7,1266-1274. Berger, S., Piiia, B., Silverman, N., Marcus, G . A., Agapite, J., Regier, J . L., Triezenberg, S.J., and Guarente, L. (1992). Genetic isolation of ADA2: A potential transcriptional adaptor required for function of certain acidic Activation domains. Cell (Cambridge, Mass.) 70,251-265. Berry, M., Metzger, D., and Chambon, P. (1990). Role of the two activating domains of the oestrogen receptor in cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamaxifen. EMBO J. 9,2811-2818. Bhat, M. K., Parkison, C., McPhie, P., Liang, C.-M., and Cheng, S.-Y. (1993). Conformational changes of human p l thyroid hormone receptor induced by binding of 3,3',5triiodo-1-thyronnine. Biochem. Biophys. Res. Commun. 195(1), 385-392.
206
DEAN P. EDWARDS
Bhattacharya, S., Eckner, R., Grossman, S., Oldread, E., Arany, Z., DAndrea, A., and Livingston, D. M. (1996). Cooperation of Stat2 and p3OO/CBP in signalling induced by interferon-a. Nature (London) 383,344-347. Blanco, J. C. G., Wang, I.-M., Tsai, S. Y., Tsai, M.-J., O'Malley, B. W., Jurutka, P. W., Haussler, M. R., and Ozato, K. (1995). Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. Proc. Natl. Acad. Sci. U.S.A. 92,1535-1539. Bocquel, M. T., Kumar, V., Stricker, D., Chambon, P., and Gronemeyer, H. (1989).The contribution of the N- and C-terminal regions of steroid receptors to activation of transcription is both receptor- and cell-specific.Nucleic Acids Res. 17, 2581-2595. Boonyaratanakornkit, V., Melvin, V., Prendergast, P., Altmann, M., Ronfani, L., Bianchi, M. E., Taraseviciene, L., Nordeen, S. K., and Allegretto, E. A. (1998). High mobility group chromatin proteins-1 and -2 functionally interact with steroid hormone receptors to enhance their DNA binding in uitro and transcriptional activity in mammalian cells. Mol. Cell. Biol. 18(8),(in press). Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-a. Nature (London) 375,377-382. Brownell, J. E., and Allis, C. D. (1996). Special HATS for special occasions: Linking histone acetylation to chromatin assembly and gene activation. Cum Opin. Genet. Dev. 6,176-184. Brownell, J. E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D. G., Roth, S. Y., and Allis, C. D. (1996). Tetrahymena histone acetyltransferase A A homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell (Cambridge, Mass.) 84, 843-851. Brzozowski, A. M., Pike, A. C. W., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Ohman, L., Greene, G. L., Gustafsson, J.-A., and Cariquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature (London) 389, 753-757. Burns, K., Opas, M., and Michalak, M. (1997). Calreticulin inhibits glucocorticoid-but not CAMP-sensitive expression of tyrosine aminotransferase gene in cultured McARH7777 hepatocytes. Mol. Cell. Biochem. 1Wl-2),37-43. Burns, L., Duggan, B., Atkinson, E. A., Famulski, K. S., Nemer, M., Bleackley, R. C., and Michalak, M. (1994). Modulation of gene expression by calreticulin binding to the glucocorticoid receptor. Nature (London) 376,476-480. Burnside, J., Darling, D. S., and Chin, W. W. (1990). Anuclear factor that enhances binding of thyroid hormone receptors to thyroid hormone response elements. J. Biol. Chern. 265(5), 2500-2504. Bunis, T. P., Nawaz, Z., Tsai, M.J., and O'Malley, B. W. (1995). A nuclear hormone receptor-associated protein that inhibits transactivation by the thyroid hormone and retinoic acid receptors. Proc. Natl. Acad. Sci. U.S.A. 92, 9525-9529. Bustin, M., and Reeves, R. (1996). High-mobility-group chromosomal proteins: Architectural components that facilitate chromatin function. Prog. Nucleic Acid Res. Mol. Biol. 54,35-93. Cavailles, V., Dauvois, S., Danielian, P. S., and Parker, M. G. (1994). Interaction of proteins with transcriptionally active estrogen receptors. Proc. Natl. Acad. Sci. U.S.A. 91,10009-10013. Cavailles, V., Dauvois, S., L'Horset, F., Lopez, G., Hoare, S., Kushner, I? J., and Parker, M. G. (1995). Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J. 14(15), 3741-3751. Cavanaugh, A. H., and Simons, S. S., Jr. (1990). Glucocorticoid receptor binding to calf
COREGULATORY PROTEINS
207
thymus DNA. 1. Identification and characterization of a macromolecular factor involved in receptor-steroid complex binding to DNA. J.Biol. Chem. 29, 989-996. Cavanaugh, A. H., and Simons, S. S., Jr. (1994). Factor-assisted DNA binding as a possible general mechanism for steroid receptors. Functional heterogeneity among activated receptor-steroid complexes. J. Steroid Biochem. Mol. Biol. 48(5/6), 433-446. Chakravarti, D., LaMorte, V. J., Nelson, M. C., Nakajima, T., Schulman, I. G., Juguilon, H., Montminy, M., and Evans, R. M. (1996). Role of CBP/p300 in nuclear receptor signalling. Nature (London) 383,99-103. Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M. L., Nakatani, Y., and Evans, R. M. (1997). Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBPIp3OO. Cell (Cambridge, Mass.) 90,569-580. Chen, J . D., and Evans, R. M. (1995). A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature (London) 377,454-457. Chrivia, J. C., Kwok, R. P. S., Lamb, N., Haiwara, M., Montminy, M. R., and Goodman, R. H. (1993). Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature (London) 365,855-859. Clemm, D. L., Macy, B. L., Santiso-Mere, D., and McDonnell, D. P. (1995). Definition of the critical cellular components which distinguish between hormone and antihormone activated progesterone receptor. J. Steroid Biochem. Mol. Biol. 53, 487495. Dahlman-Wright, K., and McEwan, I. J. (1996). Structural studies of mutant glucocorticoid receptor transactivation domains establish a link between transactivation activity in vivo and a-helix-forming potential in uitro. J. Biol. Chem. 35, 1323-1327. Dahlman-Wright, K., Baumann, H., McEwan, I. J., Almlof, T., Wright, A. P. H., Gustafsson, J.-A., and Hard, T. (1995). Structural characterization of a minimal functional transactivation domain from the human glucocorticoid receptor. Proc. Natl. Acad. Sci. U S A . 92,1699-1703. Danielian, P. S., White, R., Lees, J. A., and Parker, M. G. (1992). Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptor. EMBO J. 11,1025-1033. Dedhar, S.,Rennie, P. S., Shago, M., Hagesteijn, C.-Y. L.,Yang, H., Filmus, J., Hawley, R. G., Bruchovsky, N., Cheng, H., Matusik, R. J., and Giguere, V. (1994). Inhibition of nuclear hormone receptor activity by calreticulin. Nature (London) 367,480-483. Delabre, K., Guiochon-Mantel, A., and Milgrom, E. (1993). In viuo evidence against the existence of antiprogestins disrupting receptor binding to DNA. Proc. Natl. Acad. Sci. U.S.A. 90,4421-4425. Desai, D., Michalak, M., Singh, N. K., and Niles, R. M. (1996). Inhibition of retinoic acid receptor function and retinoic acid-regulated gene expression in mouse melanoma cells by calreticulin. J. Biol. Chem. 271(25), 15153-15159. Devchand, P. R., Keller, H., Peters, J. M., Vazquez, M., Gonzalez, F. J., and Wahli, W. (1996). The PPARa-leukotriene B, pathway to inflammation control. Nature (London) 384,39-43. De Vos, P., Claessens, F.,Celis, L., Peeters, B., Rombauts, W., Heyns, W., and Verhoeven, G. (1994). Nuclear extracts enhance the interaction of fusion proteins containing the DNA-binding domain of the androgen and glucocorticoid receptor with androgen and glucocorticoid response elements. J. Steroid Biochem. Mol. Biol. 48(4), 317-323. Ding, X. F., Anderson, C. M., Ma, H., Hong, H., Uht, R. M., Kushner, P. J., and Stallcup, M. R. (1998). Nuclear receptor-binding sites of coactivators glucocorticoid receptor
208
DEAN P.EDWARDS
interacting protein 1 (GRIP11 and steroid receptor coactivator 1 (SRC-1): Multiple motifs with different binding specificities. Mol. Endocrinot. 12(2), 302-313. Direnzo, J., Soderstrom, M., Kurokawa, R., Ogliastro, M.-H., Ricote, M., Ingrey, S., Horlein, A., Rosenfeld, M. G., and Glass, C. K. (1997). Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the itneractions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors. Mol. Cell. Biol. 17(4), 2166-2176. Edwards, D. P., Kiihnel, B., Estes, P. A., and Nordeen, S. K. (1989). Human progesterone receptor binding to mouse mammary tumor virus deoxyribonucleic acid: Dependence on hormone and nonreceptor nuclear factor(s). Mol. Endocrinol. 3,381-391. Eisenmann, D. M., Amdt, K. M., Ricupero, S. L., Rooney, J. W., and Winston, F. (1992). SPT3 interacts with TFIID to allow normal transcription in saccharomyces cerevisiae. Genes Deu. 6,1319-1331. Enmark, E., and Gustafsson, J.-A. (1996). Orphan nuclear receptors-the first eight years. Mol. Endocrinol. 10(11), 1293-1307. Feavers, I. M., Jiricny, J., Moncharmont, B., Saluz, H. €?, and Jost, J. P. (1987). Interaction of two nonhistone proteins with the estradiol response element of the avian vitellogenin gene modulates the binding of estradiol-receptor complex. Proc. Natl. Acad. Sci. U.S.A. 84,7453-7457. Felson, D. T., Zhang, Y., Hannan, M. T., G e l , D. P., Wilson, P. W. F., a n d h d e r s o n , J. J. (1993). The effect of postmenopausal estrogen therapy on bone density in elderly women. N. Engl. J. Med. 329,1141-1146. Ferrari, S., Harley, V. R., Pontiggia, A., Goodfellow,P. N., Lovell-Badge, R., and Bianchi, M. E. (1992). SRY, like HMGI, recognizes sharp angles in DNA. EMBO J. 11(12), 4497-4506. Forman, B. M., Goode E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMorris, T., Lamph, W. W., Evans, R. M., and Weinberger, C. (1995). Identification of a nuclear receptor that is activated by farnesol metabolites. Cell (Cambridge, Mass.) 81,687-693. Forman, B. M., Ruan, B., Chen, J., Schroepfer, G. J., and Evans, R. M. (1997). The orphan nuclear receptor LXRa is positively and negatively regulated by distinct products of mevalonate metabolism. Proc. Natl. Acad. Sci. U S A . 94, 10588-10593. Freedman, L. P. (1992). Anatomy of the steroid receptor zinc finger region. Endocr. Rev. 13(2), 129-145. Fitsch, M., Welch, R. D., Murdoch, F. E., Anderson, I., and Gorski, J. (1992). DNA allosterically modulates the steroid binding domain of the estrogen receptor. J. Biol. Chem. 267(3), 1823-1828. Gass, E. K., Leonhardt, S. A., Nordeen, S. K., and Edwards, D. P. (1998).The antagonists RU486 and ZK98299 stimulate progesterone receptor binding to DNA in uitro and i n uivo but have distinct effects on receptor conformation. Endocrinology (Baltimore) 139(4), 1905-1919. Giese, K., Cox, J., and Grosschedl, R. (1992). The HMG domain of lymphoid enhancer factor 1 bends DNA and facilitates assembly of functional nucleoprotein structures. Cell (Cambridge, Mass.) 69, 185-195. Gill, R. K., Atkins, L. M., Hollis, B. W., and Bell, N. H. (1998). Mapping the domains of the interaction of the vitamin D receptor and steroid receptor coactivator-1. MoZ. Endocrinol. 12,57-65. Glass, C. K. (1994). Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endoc: Rev. 16(3), 391-407. Glass, C. K., Rose, D. W., and Rosenfeld, M. G. (1997).Nuclear receptor coactivators. Curr. Opin. Cell Biol. 9,222-232.
COREGULATORY PROTEINS
209
Goodrich, J. A., and Tjian, R. (1994). TBP-TAF complexes: Selectivity factors for eukaryotic transcription. Curr. Opin. Cell Biol. 6,403-409. Grosschedi, R., Giese, K., and Pagel, J. (1994). HMG domain proteins: Architectural elements in the assembly of nucleoprotein structures. Pends Genet. 10(3), 94-100. Gu, W., and Roeder, R. G. (1997). Activation of p53 sequence-specific DNA binding by acetylation of the p53 c-terminal domain. Cell (Cambridge, Mass.) 90,595-606. Halachmi, S., Marden, E., Martin, G., MacKay, H., Abbondanza, C., and Brown, M. (1994). Estrogen receptor-associated proteins: Possible mediators of hormone-induced transcription. Science 264,1455-1458. Hanstein, B., Eckner, R., Direnzo, J., Halachmi, S., Liu, H., Searcy, B., Kurokawa, R., and Brown, M. (1996). P300 is a component of an estrogen receptor coactivator complex. Proc. Natl. Acad. Sci. U.S.A.93,11540-11545. Hard, T., Kellenbach, E., Boelens, R., Maler, B. A., Dahlman, K., Freedman, L. P., Carlstedt-Duke, J.,Yamamoto, K. R., Gustafsson, J.-A., and Kaptein, R. (1990). Solution structure of the glucocorticoid receptor DNA-binding domain. Science 249,157-160. Heery, D. M., Kalkhoven, E., Hoare, S., and Parker, M. G. (1997). A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature (London) 387,733-735. Heinzel, T., Lavinsky, R. M., Mullen, T.-M., Soderstrom, M., Laherty, C. D., 'Ibrchia, J., Yang, W.-M., Bran, G., Ngo, S. D., Davie, J. R., Seto, E., Eisenman, R. N., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1997). Acomplex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature (London) 387, 43-48. Henttu, P. M. A,, Kalkhoven, E., and Parker, M. G. (1997). AF-2 activity and recruitment of steroid receptor coactivator 1to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol. Cell. Biol. 17(4), 1832-1839. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B., Eichele, G., Evans, R. M., and Thaller C. (1992). 9-Cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell (Cambridge, Mass.) 68,397-406. Hong, H., Kohli, K., Trived, A., Johnson, D. L., and Stallcup, M. R. (1996). GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. U.S.A. 93, 4948-4952. Hong, H., Kohli, K., Garabedian, M. J., and Stallcup, M. R. (1997). GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol. Cell. Biol. 17(5), 2735-2744. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamel, Y., Soderstrom, M., Glass, C. K., and Rosenfeld, M. G. (1995). Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature (London) 377,397-403. Horwitz, K . B.,Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996). Nuclear receptor coactivators and corepressors. Mol. Endocrinol. 10(10), 1167-1177. Hu, H. F., Veroni, M., DeLuise, M., Wakeling, A., Sutherland, R., Watts, C. K., and Zalcberg, J. R. (1993). Circumvention of tamoxifen resistance by the pure anti-estrogen ICI182,780. Int. J. Cancer 66,873-876. Huang, Z . J., Edery, I., and Rosbash, M. (1993). PAS is a dimerization domain common to Drosophila period and several transcription factors. Nature (London) 364, 259-262. Hughes, M. J., Liang, H., Jiricny, J., and Jost, J.-P.(1989). Purification and characterization of a protein from HeLa cells that binds with high affinity to the estrogen response element, GGTCAGCGTGACC. J . Biol. Chern. 28,9137-9142.
2 10
DEAN P. EDWARDS
Huibregtse, J. M., Scheffner, M., Beaudenon, S., and Howley, P. M. (1995).Afamily of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc. Natl. Acad. Sci. U.S.A. 92,2563-2567. Ikonen, T., Palvimo, J. J., and Janne, 0. A. (1997). Interaction between the Amino- and Carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J. Biol. Chem. 272(47), 29821-29828. Imhof, M. O., and McDonnell, D. P. (1996). Yeast RSP5 and its human homolog hRPFl potentiate hormone-dependent activation of transcription by human progesterone and glucocorticoid receptors. Mol. Cell. Biol. 16, 2594-2605. Ing, N. H., Beekman, J. M., Tsai, S. Y., Tsai, M.-J., and OMalley, B. W. (1992). Members of the steroid hormone receptor superfamily interact with TFIIB (S300-11).J. Biol. Chem. 267(25), 17617-17623. Jackson, T. A., Richer, J. K., Bain, D. L., Takimoto, G. S., Tung, L., and Horwitz, K. B. (1997). The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7ISPA and the corepressors NCoR or SMRT. MoZ. Endocrinol. 11,693-705. Jacq, X., Brou, C., Lutz, Y., Davidson, I., Chambon, P., and Tora, L. (1994). Human TAF,,30 is present in a district TFIID complex and is required for transcriptional activation by the estrogen receptor. Cell (Cambridge, Mass.) 79,107-117. Janowski, B. A., Willy, P. J., Devi, T. R., Falck, J. R., and Mangelsdorf, D. J. (1996). An oxysterol signalling pathway mediated by the nuclear receptor LXRa. Nature (London) 383,728-731. Jayaraman, L., Moorthy, N. C., Murthy, K. G. K., Manley, J. L., Bustin, M. and Prives, C. (1998). High mobility group protein-1 (HMG-1) is a unique activator of p53. Genes Devel. 12,463-472. Jenster, G., Spencer, T. E., Burcin, M. M., Tsai, S. Y., Tsai, M.-J., and O’Malley, B. W. (1997). Steroid receptor induction of gene transcription: a two-step model. Proc. Natl. Acad. Sci. U.S.A. 94,7879-7884. Jeyakumar, M., Tanen, M. R., and Bagchi, M. K. (1997). Analysis of the functional role of steroid receptor coactivator- 1in ligand-induced transactivation by thyroid hormone receptor. Mol. Endocrinol. 11,755-767. Jordan, V. V., Fritz, N. F., and Tormey, D. C. (1987). Endocrine effects of adjuvant chemotherapy and long-term tamoxifen administration of node-positive patients with breast cancer. Cancer Res. 47,624-630. Joyeux, A,, CavaillBs, V., Balaguer, P., and Nicolas, J. C. (1997). RIP 140 enhances nuclear receptor-dependent transcription in vivo in yeast. Mol. Endocrinol. 11(2), 193-202. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S.-C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996). A CBP integrator complex mediates transcriptional activation and AP-1 inhibitor by nuclear receptors. Cell (Cambridge, Mass.) 85,403-414. Kedar, R. P., Bourne, T. H., Powles, T. J., Collins, W. P., Ashley, S. E., Cosgrove, D. O., and Campbell, S. (1994). Effects of tamoxifen on uterus and ovaries of postmenopausal women in a randomized breast cancer prevention trial. Lancet 343,1318-1321. Kee, B. L., Arias, J., and Montminy, M. R. (1996). Adaptor-mediated recruitment of RNA polymerase I1 to a signal-dependent activator. J. Biol. Chem. 271(5), 2373-2375. King, I. N., de Soyza, T., Catanzaro, D. F., and Lavin, T. N. (1993). Thyroid hormone receptor-induced bending of specific DNA sequences is modified by an accessory factor. J. Biol. Chem. 268,495-501.
COREGULATORY PROTEINS
211
Klein-Hitpass, L., Cato, A. C. B., Henderson, D., and Ryffel, G. (1991). Two types of antiprogestins identified by their differential action in transcriptionally active extracts from T47D cells. Nucleic Acids Res. 19, 1227-1234. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992). Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D, signalling. Nature (London) 355,446-449. Kliewer, S.A., Lenhard, J. M., Willson, T. M., Patel, I., Morns, D. C., and Lehmann, J. M. (1995).A prostaglandin J, metabolite binds peroxisome proliferator-activated receptor y and promotes adipocyte differentiation. Cell (Cambridge, Mass.) 83,813-819. Kuil, C . W., and Mulder, E. (1996). Deoxyribonucleic acid-binding ability of androgen receptors in whole cells: Implications for the action of androgens and antiandrogens. Endocrinology (Baltimore) 137,1870- 1877. Kuil, C. W., Berrevoets, C. A., and Mulder, E. (1995). Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. J. Biol. Chem. 270(46), 27569-27576. Kumar, V., and Chambon, P. (1988). The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell (Cambridge, Mass.) 55, 145-156. Kupfer, S. R., Marschke, K. B., Wilson, E. M., and French, F. S. (1993). Receptor accessory factor enhances specific DNA binding of androgen and glucocorticoid receptors. J. Biol. Chem. 268(23), 17519-17527. Kupfer, S. R., Wilson, E. M., and French, F. S. (1994). Androgen and glucocorticoid receptors interact with insulin degrading enzyme. J. B i d . Chem. 269(32), 2062220628. Kwok, R. P. S., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Blchinger, H. I?, Brennan, R. G., Roberts, S. G. E., Green, M. R., and Goodman, R. H. (1994). Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature (London) 370, 223-229. Landel, C. C., Kushner, P. J., and Greene, G. L. (1994). The interaction of human estrogen receptor with DNA is modulated by receptor-associated proteins. Mol. Endocrinol. 8,1407-1419. Landsman, D., and Bustin, M. (1993).A signature for the HMG-1 box DNA-binding proteins. BioEssays, 15(8), 539-546. Le Douarin, B., Zechel, C . , Garnier, J.-M., Lutz, Y., Tora, L., Pierrat, P., Heery, D., Gronemeyer, H., Chambon, l?, and Losson, R. (1995). The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors is fused to B-raf in the oncogenic protein T18. EMBO J. 14(9), 2020-2033. Le Douarin, B., Nielsen, A. L., Garnier, J.-M., Ichinose, H., Jeanmougin, F., Losson, R., and Chambon, P. (1996).A possible involvement of TIFa and TIFlp in the epigenetic control of transcription by nuclear receptors. EMBO J. 15(23), 6701-6715. Lee, J. W., Ryan, F., SwaMeld, J. C., Johnston, S. A., and Moore, D. D. (1995a). Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature (London) 374,91-94. Lee, J. W., Choi, H.-S., Gyuris, J., Brent, R., and Moore, D. D. (1995b).Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Mol. Endocrinol. 9,243-254. Lee, M. S., Kliewer, S. A., Provencal, J., Wright, P. E., and Evans, R. M. (1993).Structure of the retinoid X receptor a DNA binding domain: A helix required for homodimeric DNA binding. Science 260, 1117-1120. Lees, J. A,, Fawell, S. E., and Parker, M. G. (1989). Identification of two transactivation domain in the mouse oestrogen receptor. Nucleic Acids Res. 17,5477-5487.
2 12
DEAN P. EDWARDS
Lefstin, J. A., Thomas, J. R., and Yamamoto, K. R. (1994). Influence of a steroid receptor DNA-binding domain on transcriptional regulatory functions. Genes Dev. 8(23), 2842-2856. Leid, M. (1994). Ligand-induced alternation of the protease sensitivity of retinoid X receptor a.J. Biol. Chem. 269(19), 14175-14181. Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, Zacharewski, T., Chen, J.-Y., Staub, A., Gamier, J.-M., Mader, S., and Chambon, P. (1992). Purification, cloning and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently. Cell (Cambridge, Mass.) 68,311-395. Leidig, F., Shepard, A. R., Zhang, W., Stelter, A., Cattini, P.A., Baxter, J. D., and Eberhardt, N. L. (1992). Thyroid hormone responsiveness in human growth hormone-related genes. J. Biol. Chem. 267,913-921. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Huselton, C., Allenby, G., Speck, J., Kratzeisen, C. I., Rosenberger, M., Lovey, A., and Grippo, J. G. (1992). 9Cis retinoic acid stereoisomer binds and activates the nuclear receptor RXRa. Nature (London) 355,359-361. L’Horset, F., Dauvois, S., Heery, D. M., Cavaillhs, V., and Parker, M. G. (1996). RIP-140 interacts with multiple nuclear receptors by means of two distinct sites. Mol. Cell. Biol. l 6 ( l l ) , 6029-6036. Li, H., Gomes, P. J., and Chen, J. D. (1997). Receptor-associated coactivator 3, a steroidhuclear receptor coactivator that is related to steroid receptor coactivator 1 and transcriptional intermediate factor 2. Proc. Natl. Acad. Sci. U.S.A. 94, 8419-8484. Liao, J., Ozono, K., Sone, T., McDonnell, D. P., and pike, J. W. (1990). Vitamin D receptor interaction with specific DNA requires a nuclear protein and 1,25-dihydroxyvitamin D,. Proc. Natl. Acad. Sci. U.S.A. 87,9751-9755. Love, R. R., Mazess, R. B.,Barden, H. S.,Epstein, S., Newcomb, P. A., Jordan, V. C., Carbone, P.P., and DeMets, D. L. (1992). Effects of tamoxifen on bone mineral density in post menopausal women with breast cancer. N . Engl. J. Med. 326,852-856. Lu, X. P., Eberhardt, N. L., and Pfahl, M. (1993). DNA bending by retinoid X receptorcontaining retinoid and thyroid hormone receptor complexes. Mol. Cell. Biol. 13, 6509-6519. Luisi, B. F., Xu, W.X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature (London) 352,497-505. Lundblad, J. R., Kwok, R. P. S., Laurance, M. E., Harter, M. L., and Goodman, R. H. (1995). Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP.Nature (London) 374,85-91. Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR Heterodimers and Orphan receptors. Cell (Cambridge, Mass.) 83,841-850. Mangelsdorf, D. J., Ong, E. S., Dyck, J.A., and Evans, R. M. (1990). Nuclear receptor that identifies a novel retinoic acid response pathway. Nature (London) 345,224-229. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schiitz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995). The nuclear receptor superfamily: The second decade. Cell (Cambridge, Mass.) 83,835-839. May, M., Mengus, G., Lavigne, A X . , Chambon, P., and Davidson, I. (1996). Human TAF,,28 promotes transcriptional stimulation by activation function 2 of the retinoid X receptors. EMBO J. 15(12), 3093-3104. McDonnell, D. P., Clemm, D. L., Hermann, T., Goldman, M. E., and Pike, J. W. (1995).
COREGULATORY PROTEINS
213
Analysis of estrogen receptor function in vitro reveals three distinct classes of antiestrogens. Mol. Endocrinol. 9,659-669. McInerney, E. M., Tsai, MA., OMalley, B. W., and Katzenellenbogen, B. S. (1996).Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc. Nutl. Acad. Sci. U.S.A. 93, 10069-10073. Mengus, G., May, M., Carre, L., Chambon, P., and Davidson, I. (1997). Human TAF,,135 potentiates transcriptional activation by the AF-2s of the retinoic acid, vitamin D3, and thyroid hormone receptors in mammalian cells. Genes Den. 11, 1381-1395. Metzger, D., Ali, S., Bornert, J.-M., and Chambon, P. (1995a). Characterization of the amino terminal transcriptional activation function of the human estrogen receptor in animal and yeast cells. J. Biol. Chem. 270(16), 9535-9542. Metzger, D., Berry, M., Ali, S., and Chambon, P. (1995b). Effect of antagonists on DNA binding properties of the human estrogen receptor in vitro and in vivo. Mol. Endocrinol. 9,579-591. Meyer, M. E., Gronemeyer, H., Turcotte, B., Bocquel, M. T., Tasset, D., and Chambon, P. (1989) Steroid hormone receptors compete for factors that mediate their enhancer function. Cell (Cumbridge, Mass.) 57,433-442, Meyer, M.-E., Pornon, A., Ji, J., Bocquel, M.-T., Chambon, P., and Gronemeyer, H. (1990). Agonistic and antagonistic activities of RU486 on the functions of the human progesterone receptor. EMBO J. 9,3923-3932. Michalak, M., Burns, K., Andrin, C., Mesaeli, N., Jass, G. H., Busaan, J. L., and Opas, M. (1996). Endoplasmic reticulum form of calreticulin modulates glucocorticoid-sensitive gene expression. J. Biol. Chem. 271(46), 29436-29445. Migliaccio,A., Domenico, M. D., Castoria, G., deFalco, A., Bontempo, P., Nola, E., and Auricchio, F. (1996). Tyrosine kinase/p21rae/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J. 15(6), 1292-1300. Mukhejee, R., and Chambon, P. (1990).A single-stranded DNA-binding protein promotes the binding of the purified oestrogen receptor to its responsive element. Nucleic Acids Res. 18(19), 5713-5716. Murray, M. B., Towle, H. C. (1989).Identification of nuclear factors that enhance binding of the thyroid hormone receptor to a thyroid hormone response element. Mol. Endocrinol. 3(9), 1434-1442. Nagpal, S., Saunders, M., Katner, P., Durand, B., Nakshatri, H., and Chambon, P. (1992). Promoter context- and response element-dependent specificity of the transcriptional activation and modulating functions of retinoic acid receptors. Cell (Cambridge, MUSS.)70,1007-1019. Nagy, L., Kao, H.-Y., Chakravarti, D., Lin, R. J., Hassig, C. A., Ayer, D. E., Schreiber, S. L., and Evans, R. M. (1997). Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell (Cambridge, Mass.) 89, 373-380. Nardulli, A. M., and Shapiro, D. J. (1992). Binding of the estrogen receptor DNA-binding domain to the estrogen response element induces DNA bending. Mol. Cell Biol. 12, 2037-2042. Nardulli, A. M., Grobner, C., and Cotter, D. (1995). Estrogen receptor induced DNA bendOrientation or the bend and replacement of an estrogen response element with an intrinsic DNA binding sequence. Mol. Endocrinol. 9, 1064-1076. ODonnell, A. L., and Koenig, R. J. (1990). Mutational analysis identifies a new functional domain at the thyroid hormone receptor. Mol. Endocrinol. 4,715-720. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996). The
214
DEAN P. EDWARDS
transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell (Cambridge, Mass.) 87,953-595. Oiiate, S. A., Estes, P. A., Welch, W. J., Nordeen, S. K., Edwards, D. P. (1991). Evidence that heat shock protein-70 associated with progesterone receptors is not involved in receptor-DNA binding. Mol. Endocrinol5,2004. Oiiate, S. A., Prendergast, P., Wagner, J. P., Nissen, M., Reeves, R., Pettijohn, D. E., and Edwards, D. P. (1994). The DNA-bending protein HMG-1 enhances progesterone receptor binding to its target DNA sequences. Mol. Cell. Biol. 14(5),3376-3391. Oiiate, S. A., Tsai, S. Y., Tsai, M.-J., and OMalley, B. W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357. Oiiate, S. A., Boonyaratanakornkit, V., Spencer, T.E., Tsai, S. Y., Tsai, M.-J., Edwards, D. P., and O’Malley, B. W. (1998). The steroid receptor coactivator-one (SRC-1) contains multiple receptor interacting and activation domains that cooperatively enhance the AF-1 and AF-2 domains of steroid receptors. J. Biol. Chem 273(20), 12101-12108. Orti, E., Hu, L.-M., and Munck, A. (1993). Kinetics of glucocorticoid receptor phosphorylation in intact cells. J. Biol. Chem. 268(11), 7779-7784. Parker, M. G. (1995). Structure and function of estrogen receptors. Vitam. Horm. (N.Y) 51,267-287. Paull, T. T., Carey, M., and Johnson, R. C. (1996). Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitiation complexes in vitro. Genes Dev. 10,2769-2781. Pazin, M. J., and Kadonaga, J. T. (1997). What’s up and down with histone deacetylation and transcription? Cell (Cambridge, Mass.) 69,325-328. Pham, T. A., Hwung, Y.-P., Santiso-Mere, D., McDonnell, D. P., and O’Malley, B. W. (1992). Ligand-dependent and -independent function of the transactivation regions of the human estrogen receptor in yeast. Mol. Endocrinol. 6,1043-1050. Pil, P. M., Chow, C. S., and Lippard, S. J. (1993). High-mobility-group 1protein mediates DNA bending as determined by ring closures. Proc. Natl. Acad. Sci. U.S.A. 90, 9465-9469. Pratt, W. B., and Toft, D. 0. (1997). Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocl: Rev. 18(3),306-360. Prendergast, P., Oiiate, S. A., Christensen, K., and Edwards, D. P. (1994). Nuclear accessory factors enhance the binding of progesterone receptor to specific target DNA. J. Steroid Biochem. Mol. Bid. 48(1), 1-13. Prendergast, P., Pan, Z., and Edwards, D. P. (1996). Progesterone receptor-induced bending of its target DNA Distinct effects of the A and B receptor forms. Mol. Endocrinol. 10,393-407. Rastinejad, F., Perlmann, T., Evans, R. M., and Sigler B. P. (1995). Structural determinants of nuclear receptor assembly on DNA direct repeats. Nature (London) 375, 203-211. Read, C. M., Cary, P. D., Crane-Robinson, C., Driscoll, P. C., and Norman, D. G. (1993). Solution structure of a DNA-binding domain from HMG1. Nucleic Acids Res. 21(15), 3427-3436. Read, C. M., Cary, P. D., Crane-Robinson, C., Driscoll, P. C., Carrillo, M. 0. M., and Norman, D. G. (1995). The structure of the HMG box and its interaction with DNA. Nucleic Acids Mol. Biol. 9,221-250. Reese, J. C., and Katzenellenbogen, B. S. (1991). Differential DNA-binding abilities of estrogen receptor occupied with two classes of antiestrogens: Studies using human es-
COREGULATORY PROTEINS
2 15
trogen receptor overexpressed in mammalian cell. Nucleic Acids Res. 19, (23), 6595-6602. Reese, J. C., and Katzenellogen, B. S. (1992). Examination of the DNA-binding ability of estrogen receptor in whole cells/implications for hormone-independent transactivation and the actions of antiestrogens. Mol. Cell. Biol. 12,4531-4538. Renaud, J.-P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the RAR-y ligand-binding domain bound to all-trans retinoic acid. Nature (London) 378,681-689. Rochette-Egly, C., Gaub, M.-P., Lutz, A., Ali, S., Scheuer, I., and Chambon, P. (1992). Retinoic acid receptor+: Immunodetection and phosphorylation on tyrosine residues. Mol. Endocrinol. 66(12), 2197-2209. Roderick, H. L., Campbel1,A. K., and Llewellyn, D. H. (1997). Nuclear localization of calreticulin in uiuo is enhanced by its interaction with glucocorticoid receptors. FEBS Lett. 405(2), 181-185. Ross, T. K., Moss, V. E., Prahl, J. M., and DeLuca, H. F. (1992). A nuclear protein essential for binding of rat 1,25-dihydroxyvitamin D, receptor to its response elements. Proc. Natl. Acad. Sci. U.S.A. 89,256-260. Rubin, D. M., Coux, O., Wefes, I., Hengartner, C., Young, R. A., Goldberg, A. L., and Finley, D. (1996). Identification of the gal4 suppressor Sugl as a subunit of the yeast 26s proteasome. Nature (London) 379,655-657. Santen, R. J. (1996). Editorial: Long term tamoxifen therapy: Can a n antagonist become a n agonist? J. Clin. Endocrinol. Metub. 81,2027-2029. Schwabe, J. W. R., Neuhaus, D., and Rhodes, D. (1990). Solution structure of the DNAbinding domain of the oestrogen receptor. Nature (London) 348,458-461. Schwabe, J. W. R., Chapman, L., Finch, J. T., and Rhodes, D. (1993). The crystal structure ofthe estrogen receptor DNA-binding domain bound to DNA How receptors discriminate between their response elements. Cell (Cambridge, Mass.) 75, 567-578. Schwerk, C., Klotzbucher, N., Sachs, M., Ulber, V., and Klein-Hitpass, L. (1995). Identification of a transactivation function in the progesterone receptor that interacts with the TAF,,110 subunit of the TFIID complex. J. Biol. Chem. 270(36), 21331-21338. Shago, M., Flock, G., Hagesteijn, C.-Y. L., Woodside, M., Grinstein, S., Giguere, V., and Dedhar, S. (1997). Modulation of the retinoic acid and retinoid X receptor signaling pathways in P19 embryonal carcinoma cella by calreticulin. Exp. Cell Res. 230, 50-60. Shykind, B. M., Kim, J., and Sharp, P. A. (1995). Activation of the TFIID-TFIIA complex with HMG-2. Genes Deu. 9, 1354-1365. Simons, S. S., Jr. (1998). Structure and function of the steroid and nuclear receptor ligand-binding domain. In “The Molecular Biology of Steroid and Nuclear Hormone Receptors’’ (L. P. Freedman, ed.), pp. 35-104. Birkhaeuser, Boston. Smith, C. L., Ofiate, S. A., Tsai, M.-J., and O’Malley, B. W. (1996). CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptordependent transcription. Proc. Nutl. Acad. Sci. U S A . 93,8884-8888. Smith, C . L., Nawaz, Z., and O’Malley, B. W.(1997). Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol. Endocrinol. 11,657-666. Sone, T., Ozono, K., and Pike, J. W. (1991). A55-kilodalton accessory factor facilitates vitamin D receptor DNA binding. Mol. Endocrinol. 5, 1578-1586. Spencer, T. E., Jenster, G., Burcin, M. M., Allis, C. D., Zhou, J., Mizzen, C. A., McKenna, N. J., Onate, S. A., Tsai, S. Y., Tsal, M.-J., and O’Malley, B. W. (1997). Steroid receptor coactivator-1 is a histone acetyltransferase. Nature (London) 389, 194-197.
216
DEAN P. EDWARDS
Srinivasan, G., Patel, N., and Thompson, E. (1994). Heat shock protein is tightly associated with the recombinant human glucocorticoid receptor: Glucocorticoid response element complex. Mol. Endocrinol. 8,189-196. St. Arnaud, R., Prud’Homme, J., Leung-Hagesteijn, C., and Dedhar, S. (1995). Constitutive expression of calreticulin in osteoblasts inhibits mineralization. J. Cell Biol. 131(5), 1351-1359. Takeshita, A., Yen, P. M., Misiti, S., Cardona, G. R., Liu, Y., and Chin, W. W. (1996). Molecular cloning properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology (Baltimore) 137(8),3594-3597. Takimoto, G. S., Tasset, D. M., Eppert, C., and Horwitz, K. B. (1992). Hormone-induced progesterone receptor phosphorylation consists of sequential DNA-independent and DNA-dependent stages: Analysis with zinc-finger mutants and the progesterone antagonist ZK98299. Proc. Natl. Acad. Sci. U.S.A. 89,3050-3054. Takimoto, G. S., Hovland, A. R., Tasset, D. M., Melville, M. Y., Tung, L., and Horwitz, K. B. (1996). Role of phosphorylation on DNA binding and transcriptional functions of human progesterone receptors. J.Biol. Chem. 271(23), 13308-13316. Tasset, D., Tora, L., Fromental, C., Scheer, E., and Chambon, P. (1990). Distinct classes of transcriptional activating domains function by different mechanisms. Cell (Cambridge, Mass.) 62,1177-1187. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989). The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell (Cambridge, Mass.) 59,477-487. Torchia, J., Rose, D. W., Inostroza, J., Kamei, Y., Westin, S., Glass, C. K., and Rosenfeld, M. G. (1997). The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature (London) 387,677-683. Tremethick, D. J., and Molloy, P. L. (1988). Effects of high mobility group proteins 1and 2 on initiation and elongation of specific transcription by RNA polymerase I1 in vitro. Nucleic Acids Res. 16,11107-11123. Truss, M., and Beato, M. (1993). Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors. Endocrin Rev. 14(4),459-479. Tsai, M.-J., and O’Malley, B. W. (1994). Molecular mechanisms of action of steroidkhyroid receptor superfamily members. Annu. Rev. Biochem. 63,451-486. Tymoczko, J. L., Ahern, S., Unger, A. L., Colby, J. L., and Ede, G. (1988). Identification of a protein from rat liver cytosol that enhances activation of the glucocorticoid receptor. Biochem. J. 25%,47-52. Tzukerman, M. T., Esty, A., Santiso-Mere, D., Danielian, P., Parker, M. G., Stein, R. B., Pike, J. W., and McDonnell, D. P. (1994). Human estrogen receptor transactivationa1 capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol. Endocrinol. 8,21-30. Vegeto, E., Allan, G. F., Schrader, W. T., Tsai, M.-J., McDonnell, D. P., and O’Malley, B. W. (1992). The mechanism of RU486 antagonism is dependent on the conformation of the carboxy-terminal tail of the human progesterone receptor. Cell (Cambridge, Mass.) 69,703-713. Verrier, C. S., Roodi, N., Yee, C. J., Bailey, L. R., Jensen, R. A., Bustin, M., and Parl, F. F. (1997). High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF,,30 affect estrogen receptor-mediated transcriptional activation. Mol. Endocrinol. 11,1009-1019. Voegel, J. J., Heine, M. J. S., Zechel, C., Chambon, P., and Gronemeyer, H. (1996). TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J. 15(14), 3667-3675.
COREGUJATORY PROTEINS
217
Wagner, B. L., Pollio, G., Leonhardt, S., Wani, M. C., Lee, D.Y.-W., Imhof, M. O., Edwards, D. P., Cook, C. E., and McDonnell, D. P. (1996). 16u-substituted analogs of the antiprogestin RU486 induce a unique conformation in the human progesterone receptor resulting in mixed agonist activity. Proc. Natl. Acad. Sci. U.S.A. 93,8739-8744. Wagner, B. L., Norris, J. D., Knotts, T. A., Weigel, N. L., and McDonnell, D. P. (1998). The nuclear corepressors NcoR and SMART are key regulators of both ligand and 8-bromo-CAMP dependent transcriptional activity of the human progesterone receptor. Mol. Cell. Biol. 18(3), 1369-1378. Wagner, R. L., Apriletti, J. W., McGrath, M. E., West, B. L., Baxter, J. D., and Fletterick, R. J. (1995). A structural role for hormone in the thyroid hormone receptor, Nature (London) 378,690-697. Walfish, P. G., Yoganathan, T.,Yang, Y.-F., Hong, H., Butt, T. R., and Stallcup, M. R. (1997). Yeast hormone response element assays detect and characterize GRIP1 coactivator-dependent activation of transcription by thyroid and retinoid nuclear receptors. Proc. Natl. Acad. Sci. U.S.A. 94,3697-3702. Webster, J. C., Jewell, C. M., Bodwell, J. E., Munck, A., Sar, M., and Cidlowski, J. A. (1997). Mouse glucocorticoid receptor phosphorylation status influences multiple functions of the receptor protein. J. Biol. Chem. 272(14), 9287-9293. Weigel, N. L. (1996). Steroid hormone receptors and their regulation by phosphorylation. Biochem. J. 319,657-667. Weigel, N. L., Beck, C. A., Estes, P. A., Prendergast, P., Altmann, M., Christensen, K., and Edwards, D. P. (1992). Ligands induce conformational changes in the carboxyl-terminus of progesterone receptors which are detected by a site-directed antipeptide monoclonal antibody. Mol. Endocrinol. 6,1585-1597. Weir, H. M., Kraulis, P. J., Hill, C. S., Raine, A. R. C., Laue, E. D., and Thomas, J . 0. (1993). Structure of the HMG box motif in the B-domain of HMG1. EMBO J. 12(4), 1311-1319. Wheeler, D. G., Horsford, J., Michalak, M., White, J. H., and Hendy, G. N. (1995). Calreticulin inhibits vitamin D3 signal transduction. Nucleic Acids Res. 23(16), 3268-3274. Winrow, C. J., Miyata, K. S., Marcus, S. L., Burns, K., Michalak, M., Capoine, J. R , and Rachubinski, R. A. (1995). Calreticulin modulates in uitro DNA binding but not the in uiuo transcriptional activation by peroxisome proliferator-activated receptor/ retinoid X receptor heterodimers. Mol. Cell. Endocrinol. 111,175-179. Winston, F. (1992). Analysis of SPT genes: A genetic approach toward analysis of TFIID, histones, and other transcription factors of yeast. In “Transcriptional Regulation” S. L. McKnight and K. R. Yamamoto, (eds.), pp. 1271-1293, Cold Spring Harbor Lab. Press, Cold Spring Harbor, Ny. Wolffe, A. P. (1994). Architectural transcription factors. Science 264,1100-1101. Wolffe, A. P., and Pruss, D. (1996). Targeting chromatin disruption: Transcription regulators that acetylate histones. Cell (Cambridge, Mass.) 84, 817-919. Wurtz, J.-M., Bourguet, W., Renaud, J.-P., Vivat, V., Chambon, P., Moras, D., and Gronemeyer, H. (1996). A canonical structure for the ligand-binding domain of nuclear receptors. Nut. Struct. Biol. 3(1), 87-94. Yang, J., and DeFranco, D. B. (1996). Assessment of glucocorticoid receptor-heat shock protein 90 interactions in uivo during nucleocytoplasmic trafficking. Mol. Endocrinol. 10,3-13. Yang, X.-J., Ogryzko, V. V., Nishikawa, J.-I., Howard, B. H., and Nakatani, Y. (1996). A pSOO/CBP-associatedfactor that competes with the adenoviral oncoprotein E1A. Nature (London) 382,319-324.
218
DEAN P. EDWARDS
Yao, T.-P., Segraves, W. A., Oro, A. E., McKeown, M., and Evans, R. M. (1992). Drosophila ultraspiracle modulates ecdysome receptor function via heterodimer formation. Cell (Cambridge, Mass.) 71,63-72. Yao, T.-P., Ku, G., Zhou, N., Scully, R., and Livingston, D. M. (1996). The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc. Natl. Acad. Sci. U.S.A. 93,10626-10631. Yeh, S., and Chang, C. (1996). Cloning and characterization of a specific coactivator, ARA7,, for the androgen receptor in human prostate cells. Proc. Natl. Acad. Sci. U.S.A. 93,5518-5521. Yu, K., Bayona, W., Kallen, C. B., Harding, H. P., Ravera, C. P., McMahon, G., Brown, M., and Lazar, M. A. (1995). Differential activation of peroxisome proliferator-activated receptors by eicosanoids. J. Biol. Chem. 270(41), 23975-23983. Yu, V. C., Deisert, C., Andersen, B., Holloway, J. M., Devary, 0. V., Naar, A. M., Kim, S. Y., Boutin, J.-M., Glass, C. K., and Rosenfeld, M. G. (1991). RXRP:A coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell (Cambridge, Mass.) 67, 1251-1266. Zappavigna, V., Falciola, L., Citterich, M. H., Mavilio, F., and Bianchi, M. E. (1996). HMGl interacts with HOX proteins and enhances their DNA binding and transcriptional activation. EMBO J. 15(18), 4981-4991. Zhang, X.-K., Hoffmann, B., Tran, P. B.-V., Graupner, G., and Pfahl, M. (1992). Retinoid X receptor is a n auxiliary protein for thyroid hormone and retinoic acid receptors. Nature (London) 355,441-445. Zhang, Y., Beck, C. A., Poletti, A., Edwards, D. P., and Weigel, N. L. (1995). Identification of a group of Ser-Pro motif hormone-inducible phosphorylation sites in the human progesterone receptor. Mol. Endocrinol. 9,1029-1040. Zilliacus, J., Wright, P. H., Carlstedt-Duke, J., and Gustafsson, J.-A. (1995). Structural determinants of DNA-binding specificity by steroid receptors. Mol. Endocrinol. 9(4), 389-400. Zwilling, S., G n i g , H., and Wirth, T. (1995). High mobility group protein 2 functionally interacts with the POU domains of octamer transcription factors. EMBO J. 14(6), 1198-1208.
VITAMINS AND HORMONES, VOL. 55
Molecular Action of Androgen in the Normal and Neoplastic Prostate JOHN M. KOKONTIS AND SHUTSUNG LIAO Ben May Institute for Cancer Research and Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637
I. Introduction 11. Metabolic Activation of Androgens A. Differential Function of Androgens B. Structure, Expression, and Function of 5a-Reductase C. 5a-Reductase Inhibitors 111. AR Structure A. AR Gene and mRNA Structure B. AR Protein Structure N. Mechanism of AR Activation A. Transformation B. Domain Interactions during Activation C. Antiandrogens D. AR-Associated Proteins E. Stimulation of AR Activity by Growth Factors and Modulators of Protein Phosphorylation V. ARMutation A. Androgen Insensitivity Syndrome B. AR Mutation in Prostate Cancer VI. AR Expression in the Normal Prostate and in Prostate Cancer A. AR Expression and Mesenchyme-Epithelial Interactions during Prostate Development B. AR Expression in Adult Prostate C. AR Expression in Prostate Cancer D. Regulation ofAR Expression VII. Androgen-Regulated Genes A. Androgen Response Elements B. Androgen-Induced Genes in the Prostate C. Androgen-Repressed Genes in the Prostate D. Posttranscriptional Effects of AR VIII. Androgen Receptor Function in Prostate Cancer A. Adaptation of Prostate Tumor Cells from Androgen Dependence to Androgen Independence B. Androgen Withdrawal and Apoptosis IX. Concluding Remarks References
219
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99 $25.00
220
JOHN M.KOKONTIS AND SHUTSUNG LIAO
I. INTRODUCTION Androgens are steroid hormones that are required for normal male sexual development and maintenance of the male phenotype. Androgenic substances were recognized as early as 200 B.C. Crystals obtained by sublimation of extracts of male sexual and accessory organs have been used in China since then for treatment of patients who lacked “maleness” activity. These crystals may have been pure androgens. In the United States and Europe, male hormones were isolated and their structures were determined in the 1920s. Many of the physiological functions of androgens were identified during the following three decades. Pure androgenic steroids were first used in hospitals for certain hypogonadal patients in the 1930s. In the 1940s, Charles Huggins initiated hormonal therapy of cancer, demonstrating that prostate cancer could be treated by castration and estrogen administration (Huggins et al., 1941). In the early 1960s, it was shown that androgens can rapidly enhance RNA synthesizing activity in cell nuclei (Liao et al., 1965) and increase the level of mRNA associated with prostate cell nuclei and ribosomes (Liao and Williams-Ashman, 1962;Liao, 1965).These observations supported the “hormone-gene” theory that tied the molecular action of steroid hormones to the regulation of gene expression (Mueller et al., 1961; Karlson, 1963; Williams-Ashman et al., 1964; Liao and Fang, 1969). In the late 1950s, Elwood Jensen proposed that estrogen action is dependent on a receptor for estrogen in the target cells (Jensen and Jacobson, 1962). This conclusion was based on the observation that the major ovarian estrogen, 17p-estradiol, without metabolic conversion, could be retained by target organs such as the uterus. Discovery of the androgen receptor (AR)took a different course. It was found in 1967 that testosterone was converted by 5a-reductase t o 5a-dihydrotestosterone (5a-DHT1,which was retained in prostate cell nuclei where androgen modulates gene expression (Anderson and Liao, 1968; Bruchovsky and Wilson, 1968). Since this nuclear retention was dependent on a protein that could specifically bind Cia-DHT and other potent androgens as well as antiandrogens but not nonandrogenic steroids (Fang and Liao, 1969, 1971; Fang et al., 1969; Liao and Fang, 1969; Liao et al., 1973a), the protein was recognized as AR. The various effects of androgens on growth, differentiation, and development are now known to be mediated by b r e d u c t a s e and AR in normal target cells. In addition, they are also involved in the etiology of many human diseases. Therefore, 5a-reductase inhibitors and an-
MOLECULAR ACTION OF ANDROGEN
22 1
tiandrogens that can prevent binding of 5a-DHT and other androgens to AR are designed to control androgen-dependent diseases such as prostate cancer and abnormalities such as acne and baldness. This article provides an overview of findings concerning the structure, function, expression, and control of 5a-reductase and AR with a primary focus on the prostate during development, normal adult function, and neoplastic transformation and progression.
11. METABOLICACTIVATION OF ANDROGENS A. DIFFERENTIAL FUNCTION OF ANDROGENS Testosterone is the most abundant circulating androgen in males and is secreted principally by the Leydig cells of the testis. The adrenal glands produce a small amount of circulating testosterone either directly or by peripheral conversion of secreted androstenedione or dehydroepiandrosterone.The ovary produces a small amount of testosterone in females. 5a-DHT is also produced by the testis, but most of the circulating 5a-DHT is derived from the metabolic conversion of testosterone in target tissues and organs. Only a small percentage of the total serum testosterone and 5a-DHT is available for uptake by cells because of the presence in the serum of binding proteins, such as the high-affinity carrier sex-hormone-bindingglobulin (SHBG; Liao, 1975; Petra, 1991).SHBG is present in humans and many animals but not in the rat. Although evidence exists for receptor-mediated uptake of SHBG and for the subsequent steroid-mediated activation of a cyclic AMP (cAMP)-signalingpathway (Nakhla et al., 1997;Dinget al., 1998), free and loosely bound (to low-affinity carriers such as albumin) steroids are thought to be the active hormone fraction in serum (Mendel, 1989).Various steroid-bindingproteins may act as reservoirs for steroid hormones in delaying metabolic conversion and excretion (Liao and Fang, 1969; Liao, 1975). Testosterone is converted by 5a- or 5P-reductase to 5a- or 5P-dihydrotestosterone, which are isomeric androstanes differing in molecular configuration about carbon 5 (Fig. 1).Many androgens are derivatives of 5a-androstanes, whereas 5P-androstanes are not androgenic. In vivo, 501- and 5P-androstanes are not interconverted. Testosterone and androgenic 5a-androstanes can enhance erythropoietic activity by stimulating erythropoietin production in kidney, whereas nonandrogenic 5P-androstanes can promote erythropoiesis by stimulating heme biosynthesis in liver and through other unknown mechanisms. It is now
222
JOHN M. KOKONTIS AND SHUTSUNG LIAO
17pEstradlol
t
Aromhtase
v
Testosterone
/ \
# J \ FO 5u-reductase
0
A
H
5breductase
H
H
5a-Dlhydrotestosterone
0 0 '
5p-Di hydrotestosterone
FIG.1. Pathways of metabolic conversion of testosterone to 17P-estradiol, 5a-dihydrotestosterone, and 5P-dihydrotestosterone.
clear that 5a-DHT is the key active androgen in many peripheral target organs, including prostate and skin. Both testosterone and 5a-DHT appear to play important roles during the development of androgenregulated organs. Testosterone also has additional roles in regulating certain functions of brain and testis as well as muscle growth in adults. Some of these activities may be dependent on aromatization of the Aring of testosterone to form estrogens (Fig. 11,which activate estrogen receptor (ER). Many organs of both male and female require balanced function of androgen and estrogen. For example, AR and ER (both a and p forms) are coexpressed in many cells of the male and female reproductive tract and accessory sex organs, including seminal vesicle, prostate (West et al., 1990; Kuiper et al., 1996), and uterus (Horie et al., 1992; Mertens et al., 1996). Lack of balanced androgen or estrogen ac-
MOLECULAR ACTION OF ANDROGEN
223
tion may cause infertility in genetic males (Sharpe, 1997; Hess et al., 1997). AND FUNCTION OF 5a-REDUCTASE B. STRUCTURE, EXPRESSION,
After freely diffusing across the plasma membrane of a cell, testosterone may be metabolized to a variety of steroids. In most androgensensitive cells, however, testosterone is converted to the more potent androgen 5a-DHT by steroid 5a-reductase, an NADPH-dependent enzyme localized in the endoplasmic reticulum and nuclear membrane (Gloyna and Wilson, 1969; Thigpen et al., 1993a).In early studies with rat ventral prostate, 5a-DHT was shown to be the predominant steroid present in nuclei of cells or tissue sections exposed to isotopically labeled testosterone (Anderson and Liao, 1968; Bruchovsky and Wilson, 1968) and is the active androgen in the prostate. Two hydrophobic isozymes of 5au-reductase,type 1 and type 2, are now known to be expressed in mammalian tissues (Russell and Wilson, 1994;Russell et al., 1994).The cDNAfor the rat type 1isozyme, encoding a 29-kDa protein, was isolated by expression cloning (Andersson et al., 1989),and the human homologue was soon isolated using the rat cDNA as probe (Andersson and Russell, 1990).It soon became apparent that type 15a-reductase expression was normal in male pseudohermaphroditic individuals exhibiting 5a-reductase deficiency (Jenkins et al., 1992), and a cDNA encoding the 28-kDa type 2 isozyme required for normal male sexual development was cloned shortly thereafter (Andersson et al., 1991).Although sharing 50%amino acid sequence identity, the two isozymes exhibit strikingly different biochemical behavior and tissue expression patterns. Type 15a-reductase has a broad neutral to basic pH optimum and low (micromolar)K,, whereas type 2 shows a sharp acidic pH optimum and 1000-fold greater affinity for testosterone (Andersson et al., 1991; Normington and Russell, 1992).Type 15a-reductase is highly expressed in liver and skin, whereas type 2 is the predominant isoform expressed in fetal genital skin, male accessory glands and prostate, including benign prostatic hypertrophy (BPH) and adenocarcinoma of the prostate (Normington and Russell, 1992; Thigpen et al., 1993b). In normal prostate, BPH, and prostatic carcinoma, the type 2 isoform is expressed by stromal cells and basal epithelial cells, but not by luminal epithelial cells (Silver et al., 1994a,b; Levine et aZ., 1996),whereas type 1 5a-reductase has been localized in luminal epithelial cells (Bonkhoff et al., 1996). In the regenerating rat ventral prostate, type 1 5a-reductase mRNA is expressed in basal epithelial
224
JOHN M. KOKONTIS AND SHUTSUNG LIAO
cells, whereas type 2 is expressed in stromal cells (Berman and Russell, 1993). In contrast, in rat epididymis, both isoforms are expressed in the epithelial layer. Thus, based on the biochemical characteristics and tissue distribution, the two 5a-reductase isoforms appear to play distinct but possibly overlapping roles: Type 2 has been proposed t o play an anabolic role, particularly in target organ development, whereas type 1 may function more in catabolism of testosterone for the purpose of pharmacological clearance (Normington and Russell, 1992). About three dozen mutations in the 5a-reductase type 2 gene have been described in individuals diagnosed with 5a-reductase deficiency (Imperato-McGinley and Gautier, 1992; Russell et al., 1994).As noted earlier, these mutations lead to a form of pseudohermaphroditism. The level of testosterone in these individuals is adequate for the development of the epididymis, vas deferens, and seminal vesicle from the Wolffian ducts, but is inadequate for the virilization of the urogenital sinus and development of the prostate and external genitalia. Amale pattern of musculoskeletal development occurs during puberty, but growth of facial and body hair and development of acne and male pattern baldness are often lacking in these individuals. Some mutations result in a total loss of steroid 5a-reductase activity, whereas others lower the affinity of the enzyme for testosterone or NADPH. No mutation of the type 1isozyme has been linked to the syndrome of 5a-reductase deficiency. However, testosterone is the direct precursor for the enzymatic synthesis of both 5a-DHT and 17P-estradiol. If steroid 5a-reductase type 1 activity is absent, more testosterone may be converted to estradiol. The accumulation of toxic levels of estradiol may lead to fetal death in rats with deficiency in type 1steroid 5a-reductase (Mahendroo et al., 1997).
c. 5a-REDUCTASE INHIBITORS Antiandrogens can be very effective at inhibiting androgen binding and activation of the AR,but they can cause undesirable side effects. Inhibitors of 5a-reductase may have advantages over antiandrogens, since they can selectively suppress 5a-DHT-dependent disorders such as prostate cancer, BPH, acne, baldness, female hirsutism, skin aging, and androgen-dependent breast cancer and hepatoma without significantly affecting physiological processes believed to be controlled by testosterone, such as libido, spermatogenesis, sexual behavior, and smooth muscle growth (Metcalf et al., 1989; Randall, 1994).A number of natural and synthetic compounds that differentially inhibit 5a-reductase type 1and type 2 isozymes have been identified (Fig. 2). The
225
MOLECULAR ACTION OF ANDROGEN
type 2, but not type 1human isozyme is very sensitive to 4-azasteroid inhibitors such as finasteride [17p-(N-tert-butylcarbarnoyl)-4-aza-5auandrost-1-en-3-one] and 4-MA [17~-NN-diethylcarbamoyl-4-methyl-4aza-5a-androstan-3-onel (Normington and Russell, 1992), whereas the human (but not rat) type 1isozyme is selectively inhibited by the benzoquinolinone inhibitor LY191704 (Hirsch et d.,1993).An enantiomer of the LY191704 racemic mixture, LY300502, inhibited testosterone-induced proliferation and prostate-specific antigen expression in LNCaP cells (Sutkowski et al., 1996). Finasteride is now widely prescribed under the trade name Proscar for the treatment of BPH. In about 20-30% of BPH patients, finasteride appears to be effective in reducing prostate size and increasing urine flow (Gormley et al., 1992; Stoner, 1996). Finasteride appears to be effective in reducing the size of enlarged prostates that have a relatively large epithelial component and not as effective in small prostates with a relatively large stromal cell component (Lepor et al., 1996; Walsh, 1996). Finasteride is also being tested in clinical trials as a chemopreventative for prostate cancer and as a therapeutic agent for treatment of some forms of alopecia. Other 5a-reductase inhibitors have been derived from natural sources. Unsaturated fatty acids, in particular y-linolenic acid, have been shown to inhibit both isozymes of 5a-reductase (Liang and Liao,
d?c'
O
CH3 LY300502
Flnasterlde (Proscar)
4-MA
NI H
OH HO
-
-00,
OH (-) Eplgallocatechln-3-gallate (EGCG)
y-Llnolenlc acld
FIG.2. Sa-Reductase inhibitors.
226
JOHN M. KOKONTIS AND SHUTSUNG LIAO
1992; R. A. Hiipakka and S. Liao, unpublished results). y-Linolenic acid suppressed the testosterone-dependent growth of flank organs of male hamsters, apparently by inhibiting conversion of testosterone to 5aDHT (Liang and Liao, 1997). Green tea catechin gallates, such as epigallocatechin-3-gallate and epicatechin-3-gallates7 are selective inhibitors of the type 1 isozyme (Liao and Hiipakka, 1995). Dietary isoflavanoids and some lignins have also been shown to inhibit &-reductase activity (Evans et al., 1995). 111. AR STRUCTURE A. AR GENEAND MRNASTRUCTURE The androgen receptor is a member of a large growing family of DNAand ligand-binding transcription factors that also includes receptors for estrogen, progesterone, glucocorticoids, mineralcorticoids, retinoids, 1725-dihydroxyvitaminD, and thyroid hormone, among others as well as a group of proteins that share the homologous nuclear receptor structure but for which no ligands are yet known (Beato et al., 1995;Tsai and O’Malley, 1994; Enmark and Gustafsson, 1996).AR is a protein of low abundance even in cells and tissues that are most sensitive to androgen, and is typically present at about 50,000 molecules per cell. Isolation of the AR cDNA was achieved by screening human and rat cDNA libraries with synthetic radiolabeled oligonucleotide probes corresponding to the most highly conserved portions of a consensus DNAbinding domain sequence (Changet al., 1988a,b; Lubahn et al., 1988a,b; Tan et al., 1988). Other laboratories soon confirmed the human AR cDNA sequence (Trapman et al., 1988; Brinkmann et al., 1989; Tilley et al., 1989; Govindan, 1990). The cDNA for mouse AR was cloned shortly after (Faber et al., 1991a; He et al., 1991; Charest et al., 1991; Gaspar et al., 1991).AR mRNA is normally transcribed from a single copy gene located in the qll-12 region of the X chromosome (Brown et al., 1989).The gene spans over 90 kilobases (kb) and contains 8 exons, each of which contributes to the amino acid sequence (Kuiper et al., 1989; Lubahn et al., 1989; Marcelli et al., 1990). The intron-exon boundaries of the AR gene resemble those of the genes encoding other steroid receptors, suggesting that the genes share common ancestry (Faber et al., 1989, 1991b). A single TATA-less promoter drives transcription of the AR gene to produce a 10.6-kbmessage, of which only 2.7 kb encodes protein (Tilley et al., 1990; Faber et al., 1993). The 5’ and 3’ untranslated regions of the AR mRNA, 1.1and 6.8 kb in length, respectively, make
MOLECULAR ACTION OF ANDROGEN
227
up the remainder of the message (Faber et al., 1991b). LNCaP human prostate carcinoma cells also express an 8.5-kb AR transcript that lacks 3 kb of the 3’ untranslated region, most likely due to alternative splicing (Faber et al., 1991b). In Xenopus laevis, a shorter species of AR mRNA that codes for a smaller receptor protein was found to be specifically expressed in proliferating areas of juvenile larynx (Fischer et al., 1993). B. AR PROTEIN STRUCTURE Human AR is composed of about 900-920 amino acids, the exact number of which varies because of polymorphisms in the lengths of polyglutamate and polyglycine tracts (Chang et al., 1988a,b; Lubahn et al., 1988a,b; Tan et al., 1988; Trapman et al., 1988; Brinkmann et al., 1989; Tilley et al., 1989; Govindan, 1990). The protein has a calculated molecular weight of about 98,000 kDa but migrates during sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis as a 110-kDa protein (Johnson et al., 1987; van Laar et al., 1989). The only posttranslational modification of AR known to occur is phosphorylation (Blok et al., 1996). however, phosphorylation accounts for only a shift in the mobility of the receptor from 110 to 112 kDa (Jenster et al., 1994). Additionally, a smaller 87-kDa AR isoform may be expressed as a minor species in a variety of fetal tissues and normal human skin genital skin fibroblasts, probably as a result of translation initiation at an internal methionine, but the function of this form is not known (Wilson and McPhaul, 1994,1996). Like other members of the nuclear receptor family, AR can be subdivided into four structural and functional domains (Fig. 3): (1)the amino-terminal domain, which contains amino acid sequences important in transactivation; (2) the DNA-binding domain, which contains two “zinc-finger” structures, which mediate sequence-specific DNA binding and also function in receptor dimerization; (3) the carboxyl-terminal steroid-binding domain, which functions in ligand binding, receptor dimerization, transactivation repression, and, probably, along with the N-terminal domain, in interactions with associated transcription cofactors and components of the transcription preinitiation complex; and (4) a “hinge”region that separates the DNAbinding domain from the steroid-binding domain and contains a basic nuclear localization motif that is required for nuclear localization (Simental et aZ., 1991; Jenster et al., 1991,1993; Zhou et al., 1994). Functional characterization of AR has been achieved largely through the analysis of deletion mutants expressed in cultured cells that express no endogenous AR. For assay of transactivation function, AR expres-
228
JOHN M.KOKONTIS AND SHUTSUNG LIAO
N-terminal domaln
Blndlng domains DNA -
b
Androgen I
15-3lGln 5Gln
hAR rAR
m2 i
556 623 666
-
-
i
ml
I
918
-
T i mil
5Arg 3Gln 22Gln
4pro 5A,a
-
mAR
899
5Arg 3Gln
4Pro
bGln ljh 3Gln ljh 2Gln
5Ala
4Gli
FIG.3. Polyamino acid stretches and functional domains of the human (h),rat (r), and mouse (m) androgen receptors.
sion vectors are commonly cotransfected into cells with reporter genes (chloramphenicol acetyl transferase or luciferase) linked downstream of enhancer-promoters containing androgen responsive elements (ARES) such as the mouse mammary tumor virus (MMTV) long-terminal repeat (Cato et al., 1987). 1. The Amino-Terminal Domain
The amino-terminaldomain of AR contains multiple regions required for the full transcription activation function of the receptor, because deletion of specific stretches of residues results in diminished ability to transactivate reporter genes (Simental et al., 1991;Jenster et al., 1991, 1992, 1995; Gao et al., 1996; Chamberlain et al., 1996). Jenster et al., 1991,1992) initially resolved two distinct regions in the human AR required for full transcriptional activation, one of which is present in a segment containing residues 51 to 211, and the other of which is present in a segment containing residues 244 to 360. These workers subsequently found that sequences between residues 360 and 485 also contributed to transactivation function (Jenster et al., 1995).This was confirmed by Gao et al. (1996),who found that deletion of residues 80 to 93 or residues 245 t o 485 from AR yielded a transactivationally defective protein. Deletion of the intervening residues had little effect. Interestingly, Jenster et al. (1995)also found that the regions required for optimal transactivation were different when transactivation by a con-
MOLECULAR ACTION OF ANDROGEN
229
stitutively active receptor truncated at the carboxyl terminal was examined. Additionally,regions required for optimal transactivation were found to be promoter-dependent. Using rat AR, Chamberlain et al. (1996) also demonstrated that two distinct transactivation domains exist within the first 360 residues and were able to disrupt the first one by point mutagenesis. Amino-terminal domain deletions not only disrupt transactivation function of the mutant receptor, but receptors with such deletions also appear to be dominant negatives when coexpressed with wild-type AR. This is because coexpression of mutant AR with wild-type receptor results in a transactivationally defective AR heterodimer that competes with wild-type homodimers for DNA binding sites (Palvimo et al., 1993; Kallio et al., 1994b). A striking feature of the amino-terminal domain of AR is the prevalence of homopolymeric amino acid repeats, most notably a polyglutamine repeat and a polyglycine repeat, which range from 15 to 31 residues in length for polyglutamine (Edwards et al., 1992) and 16 to 27 residues in length for polyglycine (Changet al., 1988b;Lubahn et al., 1988a; Tan et al., 1988; Trapman et al., 1988;Brinkmann et at., 1989; Tilley et al., 1989; Govindan, 1990; Sleddens et al., 1991); (Fig. 3). Among other known members of the nuclear receptor superfamily, only rat glucocorticoid receptor and chicken progesterone receptor have comparably sized polyglutamine (rGR) or polyglutamate (cPR) repeats (Miesfeld et al., 1986; Conneely et al., 1987).Androgen receptors in rat and mouse have shorter glutamine and glycine repeats and are present at slightly different positions in the amino-terminus, suggesting that these repeat structures are not critical to the function of AR. However, expansion of the polyglutamine repeat to 40 to 65 residues has been closely associated with X-linked spinal and bulbar muscular atrophy (La Spada et al., 1991) and has been reported to be a causal factor in reduced transactivation function of AR (Pinsky et al., 1992; Mhatre et al., 1993; Chamberlain et aZ., 1994). It has also been suggested that shorter polyglutamine and polyglycine repeat length in African-American men, and by inference, higher transactivational function in AR, may be linked t o the higher risk of prostate cancer in this population (Edwards et al., 1992; Irvine et al., 1995; Giovannucci et al., 1997; Stanford et al., 1997). Gao et al. (1996) found that increased polyglutamine length as well as decreased length or absence of the polyglutamine or polyglycine repeats resulted in diminished transactivation function in transfected CV1 cells, prompting them to speculate that the repeats serve as spacers to position properly critical transactivation domains with respect to one another. Others, however, have been unable to show that increased length of the polyglutamine repeat affects the transactivation function
230
JOHN M. KOKONTIS AND SHUTSUNG LIAO
of the receptor (Choong et al., 1996; Neuschmid-Kaspar et al., 1996). Choong et al. (1996) reported that increased length of the polyglutamine repeat instead lowered the level of AR mRNA and protein expression in transfected COS cells. Similarly, Brooks et al. (1997) observed lower expression of AR with 65 CAG repeats in stably transfected motor neuron cells compared with a receptor containing 24 CAG repeats. At the present time it is therefore unclear how alterations or polymorphisms in polyglutamine and polyglycine repeat length affect AR expression level or activity. Besides the large polyglutamine and polyglycine repeats, the amino-terminal domain of AR contains shorter runs of three to eight homopolymeric amino acids including glutamine, alanine, leucine, proline, and serine. Systematic analysis of the contribution of these repeat motifs to AR activity has not been done, although glutamine- and proline-rich regions are commonly found in transcriptional activation domains (Tjian and Maniatis, 1994; Gill et al., 1994; Kim and Roeder, 1994). 2. The DNA-Binding Domain The DNA-binding domain of AR consists of about 70 amino acids positioned, as in other nuclear receptors, between the amino-terminal domain and the carboxyl-terminal ligand-binding domain. Steroid receptors exhibit the greatest sequence similarity in this domain; for example, the identity of amino acid residues in this domain between AFt and receptors for estrogens, glucocorticoids, mineralcorticoids, and progestins is 56,76,76,and 79%,respectively (Changet al., 1988a).The amino acid sequences of AR DNA-binding domain from human (Chang et al., 1988b;Lubahn et al., 1988a; Tan et al., 1988;Trapman et al., 1988; Brinkmann et al., 1989; Tilley et al., 1989; Govindan, 19901, rat (Chang et al., 1988b; Tan et al., 1988), mouse (Faber et al., 1991a), rabbit (Krongrad et al., 1995), and canary (Nastiuk and Clayton, 1994) are identical, whereas the X. Zaevis AR DNA-binding domain has only two differences and these are in serine vs threonine usage (Fischer et al., 1993). X-ray crystallographic (Luisi et al., 1991) and two-dimensional lH nuclear magnetic resonance (NMR) studies of glucocorticoid (Hard et al., 1990a,b) and estrogen (Schwabe et al., 1990) receptors have revealed that the sulfur atoms of eight cysteine residues coordinate two Zn+2ions in a tetrahedral conformation in motifs known as “zinc fingers” (Fig. 4). The two fingers form a single globular unit that contains two overlapping perpendicular helices. The amino-terminal zinc finger extends into the first recognition helix, which interacts with bases of the hormone response element (HRE) in the major groove of the DNA. Three amino acids in this helical region, the so-called “P-box,” are con-
FIG.4. The model structure of an AR DNA-binding domain dimer complexed with DNA is probably very similar to that of a glucocorticoid receptor DNA-binding domain dimer shown in this figure. The model was deduced from the crystal structure (Luisi et al., 1991) using data obtained from the Molecular Modeling Data Base (PBD file 1GLU; National Center for Biotechnology Information) and using the Cn3D program (Hogue, 1997).
232
JOHN M.KOKONTIS AND SHUTSUNG LIAO
served among androgen, glucocorticoid,mineralcorticoid, and progestin receptors and define the HRE-binding specificity of the receptor (Danielsen et al., 1989; Umesono and Evans, 1989; Mader et al., 1989; Zilliacus et al., 1995). The second zinc finger extends out of the recognition helix and folds into the second helical structure that overlays the recognition helix, making contacts with hydrophobic amino acid residues to stabilize the domain. The second finger and helical region may function to prevent promiscuous binding to noncognate HREs since chimeric DNA binding domains lose binding specificity(Danielsen et al., 1989). The second zinc finger also contains amino acids (the “Dbox”), which make protein-protein contacts at the dimerization interface to promote cooperative binding of receptor dimers, at least with respect to the glucocorticoid receptor, to DNA response elements (Hard et al., 1990b; Luisi et al., 1991; Dahlman-Wright et al., 1991, 1993). Besides functioning in DNA binding, the DNA-binding domain also contains two amino acids (Arg617 and Lys618) near the carboxyl-terminal end that contribute to a bipartite nuclear localization signal, which extends into the hinge region (Zhou et al., 1994). 3. The Steroid-Binding Domain The steroid-binding domain is the second most conserved domain of nuclear receptors, with the overall sequence similarity in this domain between AR and other nuclear receptors ranging from 15to 54% (Chang et al., 1988b). The amino acid sequences of the human, rat, and mouse AR steroid-binding domains are identical, indicating complete sequence conservation evolutionarily. The modular nature of this domain and the conservation of its function among nuclear receptors was demonstrated by the construction of chimeric glucocorticoid estrogen (Green and Chambon, 1987) and glucocorticoid thyroid hormone (Thompson and Evans, 1989) receptor molecules that could bind estrogen or thyroid hormone and transactivate glucocorticoid-responsive promoters. Androgens bind to AFt in this region with high affinity (KD = 0.3 nM) and specificity to trigger conformational changes that result in receptor transformation, dimerization, DNA binding, and gene transactivation. Analyses of the crystallographic structures of the ligandbinding domains of other nuclear receptors, including thyroid hormone receptor (Wagner et al., 1995),retinoic acid receptor gamma (Renaud et al., 1995), retinoid X receptor alpha (Bourguet et al., 19951, and estrogen receptor (Brzozowski et al., 1997) have revealed conserved structural patterns (Wurtz et al., 1996).A ligand-binding site exists in a hydrophobic pocket. Ligand binding appears to trigger a conformational change whereby a carboxy-terminal 01 helix covers the pocket like a lid
MOLECULAR ACTION OF ANDROGEN
233
N
H1
H7
$2-loop FIG.5. The three-dimensional structures of nuclear receptor ligand-binding domains analyzed so far appear to be very similar (Wurtz et al., 1996). The model structure of the ligand-binding domain of AR is probably similar to the one shown in this figure for the retinoic acid receptor gamma ligand-binding domain. The model was deduced from the crystal structure (Renaud et al., 1995) using data obtained from the Molecular Modeling Data Base (PBD file ZLBD; National Center for Biotechnology Information) and using the Cn3D program (Hogue, 1997). (H: helix).
(Fig. 5, helix 12), trapping the ligand and simultaneously creating a surface that may interact with transcriptional coactivators (Wurtz et al., 1996;Brzozowski et al., 1997).Most analyses of t h e m steroid-binding domain thus far have relied on indirect methods of measuring conformational changes including measuring differences in protease sensitivity, electrophoretic gel migration rate, or sedimentation rate in a density gradient.
234
JOHN M.KOKONTIS AND SHUTSUNG LIAO
Deletion studies of the steroid-binding domain in the glucocorticoid receptor (Godowskiet al., 1987; Hollenberg et al., 1987)had shown that short carboxyl-terminal truncations resulted in loss of steroid binding and transactivation, whereas truncations that removed most or the entire steroid-binding domain resulted in constitutively active receptors (with variable transactivation function), suggesting that in the absence of ligand, the steroid-binding domain actively inhibits transactivation. Deletion of the repressive ligand-binding domain may thereby release the transactivation regions in the amino terminus to full activity in the absence of ligand. The case with estrogen receptor appears to be different, however. Deletion of any part or all of the steroid-binding domain resulted in loss of steroid binding and only poor transactivation function, suggesting the presence of a second transactivation function (AF2) in the steroid-binding domain in addition to one (AF-1)in the aminoterminal domain (Kumar et al., 1987; Webster et al., 1988; Tora et al., 1989; Danielian et al., 1992; Krause et al., 1995). The situation for AR appears to resemble that of the glucocorticoid receptor, as short deletions inactivate AR, whereas deletion of most of the steroid-binding domain results in constitutively active, ligand-independent receptors (Simental et al., 1991; Jenster et al., 1991, 1992). Simental et al. (19911, however, reported much reduced transactivation function in receptor with complete truncation of the steroid-binding domain. In an in vitro transcription system using glutathione S-transferase (GST)-AR fusion proteins, an AR construct consisting of the DNA-binding domain and steroid-binding domain had higher transactivation function than either the DNA-binding domain-hinge region or an amino-terminal domain-DNA-binding domain-hinge construct (Snoek et al., 1996). The latter construct was missing the amino-terminal231 amino acids ofAR, making a comparison of the relative contributions of the amino-terminal vs carboxyl-terminal domains in this system difficult. Additionally, the presence of the GST domain at the amino terminus may unpredictably affect AR function. Nevertheless, it is likely that a transactivation region resides in the steroid-binding domain of AR. In an attempt to map the residues in the androgen and progesterone receptor steroid-binding domains that confer steroid-binding specificity, Vivat et al. (1997) analyzed the steroid-binding and transactivation properties of proteins consisting of the GAL4 DNA steroid-binding domain fused with chimeric androgen-progesterone receptor steroidbinding domains. They divided the steroid-binding domains of each receptor into five subregions and replaced each subregion with the corresponding subregion of the other receptor to make a total of 10 chimeric constructs. For the AR steroid-binding domain, only the sin-
MOLECULAR ACTION OF ANDROGEN
235
gle replacement of the carboxyl-terminal subregion 5 with the corresponding subregion 5 of the progesterone receptor conferred weak binding activity with RU987, a synthetic progestin. Replacement of subregions 1and 5 resulted in a domain with strong affinity for progesterone and RU987 and weak affinity for testosterone and dihydrotestosterone. This fusion protein, however, exhibited no transactivation function with either androgen or progesterone, indicating that other regions or residues are required to create an active conformation. In the reciprocal experiment, replacement of subregion 3 of the progesterone steroidbinding domain with the corresponding subregion of AR resulted in a protein with dual androgen and progesterone binding affinity and androgen- and progesterone-induced transactivation. Replacement with subregion 5 abolished progesterone binding but conferred weak androgen binding and androgen-induced transactivation. Vivat et al. then identified four residues in subregion 3 (788-RHLS-791) of the AR steroid-binding domain that could confer androgen binding to the progesterone receptor steroid-binding domain. These residues may be contained in a helix (helix 7, Fig. 5 ) that is near the steroid binding pocket of a consensus ligand-binding domain derived from known crystal structures of other receptors (Wurtz et al., 1996; Vivat et al., 1997). The observation that the reciprocal construct was inactive, however, suggests that the ligand-binding domains of nuclear receptors, although probably sharing a homologous fold structure, cannot be reduced to modular and freely interchangeable components.
4.AR Phosphorylation Like other steroid receptors, AR is a phosphoprotein. However, the role of phosphorylation in the regulation of AR activity is not yet clear. Initial reports had shown that phosphorylation was responsible for the heterogeneity of LNCaP cell AR size seen on SDS-polyacrylamide gel electrophoresis (SDS-PAGE)gels, and there appears to be a correlation of the extent of phosphorylation with androgen binding, receptor transformation, and nuclear extractability (van Laar et al., 1990, 1991; Kuiper et al., 1991),although not all hyperphosphorylated receptor was nuclear (Kuiper et al., 1993). However, Kemppainen et al. (19929, examining AR expression in COS cells, argued that increased phosphorylation correlated only with increased receptor stability and accumulation. Androgen-induced phosphorylation occurred within 30 min, suggesting that a change in conformation on androgen binding made potential sites available or accessible to phosphorylation before changes in the level of receptor due to androgen occurred (Kuiper et al., 1993). Partial proteolysis of 32P-labeledAR suggested that the amino-
236
JOHN M.KOKONTISAND SHUTSUNG LIAO
terminal domain is most heavily phorphorylated (Kuiper et al., 19931, which was confirmed by deletion mapping (Jenster et al., 1994).With analysis of specific phosphorylation sites, it became possible to assess definitively whether androgen binding resulted in the phosphorylation of specific sites. Kuiper and Brinkmann (1995) observed androgen-induced phosphorylation of a specificsite or sites present in a tryptic peptide in LNCaP cells; the phosphorylation state of three other peptides was less affected by androgen. They also found by phosphoamino acid analysis that all the observed phosphorylation ofAR occurred on serine residues. In contrast, Zhou et al. (1995b), using COS cells transfected with AR expression vectors, found threonine as well as serine to be a phosphorylated residue, although serine labeling was more predominant. These workers identified three serine residues phosphorylated in AR: Ser 81, Ser 94, and Ser 650, the last of which is located in the hinge region. Ser 81 and Ser 94 correspond to two residues also identified by Jenster et al. (1994) as proline-directed phosphorylated residues. Substitution of Ser 81 and Ser 94 with alanine had no effect on transactivation function, but substitution of Ser 650 resulted in a 30% reduction of transactivation function (Zhou et al., 1995b).Phosphorylation of AR, particularly with respect to receptor function in hormone-independent prostate cancer, and to the recent observations of AR activation by growth factor and protein kinase signaling pathways (Culiget al., 1995; Nazareth and Weigel, 1996; see Section IV,E), will continue to be an area of great interest.
IV. MECHANISMOF AR ACTIVATION
A. TRANSFORMATION Transformation is a term used to describe the activation of nuclear receptors to a DNA-binding competent state and is caused physiologically by ligand binding, or biochemically by isolation from cells in a high concentration of salt or at high temperature. Transformation can be measured by the shift in sedimentation rate between liganded or nonliganded receptors during sucrose gradient centrifugation from about 8s to 4s. Unliganded steroid receptors are usually present in the cell in a complex consisting at least partly of heat-shock proteins hsp90, hsp70, and hsp56 that interact with the receptor steroid-binding domain (Marivoet et al., 1992; Nemoto et al., 1992; Veldscholte et al., 1992a; Smith and Toft, 1993).RNA may also be a component of these AR complexes (Hiipakka and Liao, 1988,1989).Steroid-bindingresults
MOLECULAR ACTION OF ANDROGEN
237
in the dissociation of heat-shock proteins and release of the receptor as a 4s species that can dimerize and bind DNA. The role of heat-shock proteins is unclear, but they appear to act as chaperones and may be involved in the maintenance of a hormone-accessible structure or may fulfill other regulatory functions (Gething and Sambrook, 1992; Smith and Toft, 1993; Tsai and OMalley, 1994). In contrast to Nemoto et al. (19921, who found no dependence of androgen binding on the presence of hsp90, Fang et al. (1996) using a temperature-sensitive mutant of hsp90, found that high-affinity androgen binding and full transactivation function required the presence of wild-type hsp90. The difference might be attributed to the fact that Nemoto et al. used AR constructs lacking the amino-terminal domain. Similar requirements for hsp90 have been found for glucocorticoid (Breznick et al., 1989; Bohen, 1999, mineralcorticoid (Nemotoet al., 1993),and dioxin (Pongratz et al., 1992) receptors. The crystal structure of the amino terminus of yeast hsp90 suggests that it may act as a kind of “molecular clamp’’ in the binding of ligand proteins to hsp90 (Prodromou et al., 1997). Early models of steroid activation of hormone receptors envisioned that unliganded receptor was present in the cytoplasm. On steroid binding, associated proteins dissociated and the steroid-receptor complex translocated to the nucleus. These models have been reevaluated with findings that unliganded steroid receptor is often present in the nucleus (Murdoch and Gorski, 1991). It is now generally believed that, with the exception of glucocorticoid receptor, unliganded steroid receptors are present in the nucleus in a loosely associated state, and upon disruption or fixation of the cell, may leak out into the cytoplasm. In the presence of steroid, receptors are tightly bound to nuclear components or chromatin and fractionate with the nuclei. However, nuclear vs cytoplasmic localization is still a controversial issue. In the case of AR, both perinuclear cytoplasmic localization (Simental et al., 1991;Kemppainen et al., 1992;Zhou et al., 1994) and nuclear localization (Jenster et al., 1991) in the absence of androgen have been reported in transfected cells. In rat ventral prostate epithelial cells, castration had no effect on the nuclear localization of AR (Husmann et al., 1990).We have observed strictly nuclear localization of AR in LNCaP cells in the absence or presence of androgen (J.M. Kokontis and S. Liao, unpublished results). DURING ACTIVATION B. DOMAIN INTERACTIONS
From the work of many laboratories investigating structure-function relationships of the steroid-binding domain of AR and that of oth-
238
JOHN M. KOKONTIS AND SHUTSUNG LIAO
er receptors, the picture is emerging that the steroid-binding domain serves as a ligand-activated switch that modulates DNA binding and transactivation functions localized in the same domain and/or at the amino-terminal regions of the receptor. As mentioned earlier, deletion studies of the steroid-binding domain in the glucocorticoid and androgen receptors had suggested the presence of a transactivation "masking" function in the absence of ligand. Follow-up experiments were done t o characterize further the interaction between the transactivation regions present in the amino-terminal domain and masking regions in the AR carboxyl-terminal domain. Using the baculovirus expression system to overexpress full-length AR as well as truncated receptors lacking either the amino-terminal or steroid-binding domains, Wong et al. (1993)demonstrated that androgen was necessary for dimerization and in uitro DNA binding to occur and that AR, unlike the glucocorticoid receptor, bound to oligonucleotide HREs as a dimer and not as monomer. In addition, they showed that the amino-terminal domain conferred androgen-dependency to dimerization and DNA binding, since truncated receptors lacking the amino-terminal domain could bind DNA independently of androgen. This result, together with the finding that the steroid-binding domain represses amino-terminal transactivation in the absence of steroid, suggests that global and reciprocal interactions may occur between the amino- and carboxyl-terminal domains upon androgen binding. Similarly, Ikonen et al. (1997) found that amino-terminal truncations in rat AR resulted in loss of activity when the steroidbinding domain was present, but the loss was much less severe when the steroid-binding domain was also absent. The presence of the aminoterminal domain also appears to inhibit the rate of steroid dissociation from the receptor and thereby stabilizes the receptor against degradation (Zhou et al., 1995a). Karvonen et al. (19971, using an in uiuo promoter interference assay for AR DNA-binding, observed androgen-independent promoter interference when a carboxyl-terminal deletion mutant ofAR was used, but observed androgen-dependent promoter interference when an amino-terminal deletion mutant of AR was used. Their results, in contrast to the results of Wong et al. (19931, suggest that a major portion of the amino-terminal domain is not required for maintaining the nonliganded receptor in a non-DNA-binding conformation. Langley et al. (1995) used a yeast two-hybrid assay for protein-protein interaction to show that the amino-terminal and carboxylterminal domains of AR could interact specifically in the absence of DNA-binding domain sequences. This interaction was also androgendependent. Because they could not demonstrate interaction between two steroid-binding domains, they proposed that the androgen-recep-
MOLECULAR ACTION OF ANDROGEN
239
tor dimer exists in an antiparallel configuration, with the amino-terminal domain of one receptor molecule forming intermolecular contacts with the steroid-binding domain of its partner. However, they also showed that two amino-terminal domains could interact weakly with each other. Doesburg et al. (1997) used a similar approach but showed that two steroid binding domains can interact with each other if a higher concentration of androgen (0.1-1 p M ) is used, consistent with previous findings that had shown dimerization of estrogen and progesterone receptors to be mediated by intermolecular interactions in the steroid binding domain (Kumar and Chambon, 1988;Guiochon-Mantel et al., 1989; Fawell et al., 1990). Doesberg et al. proposed that androgen binding elicits conformational changes that enable intramolecular interaction between the amino-terminal domain and steroid-binding domain, and which enable intermolecular interactions between steroidbinding domains oriented in a parallel configuration. Additionally, the dimerization interface in the DNA-binding domain would also contribute to dimer stability. The exact nature of AR dimer configuration is thus an unsettled question, and probably awaits the crystallographic analysis of the conformational changes that occur on androgen binding.
C. ANTIANDROGENS Antiandrogens are synthetic compounds that compete for binding to AR but do not elicit androgenic effects. Antiandrogens are useful clinically for the treatment of acne, alopecia, seborrhea, hirsutism, and most importantly for the treatment of androgen-dependent prostate cancer (Namer, 1988).Antiandrogens block the effect of adrenal androgens after castration or are used in conjunction with a luteinizing hormone releasing hormone (LHRH) agonist, such as goserelin (Zoladex), which pharmacologically blocks testicular secretion of androgen (Furr, 1989). Administration of peripherally active antiandrogens to noncastrated men results in a surge of testicular androgen secretion because antiandrogens block the negative feedback effect of androgens on the hypothalamus and pituitary gland. Steroidal antiandrogens, such as cyproterone acetate, and nonsteroidal antiandrogens are in clinical use, although the nonsteroidal antiandrogens have more tolerable side effects (Fig. 6). Flutamide, the first nonsteroidal antiandrogen developed, is a pure antiandrogen that is metabolized to its more active form hydroxyflutamide (Liao et al., 1974; Neri et al., 1979).Anandron or nilutamide (RU 23908) has a structure similar to flutamide and binds to AR with an activity similar t o that of hydroxyflutamide but has a longer pharmacological half-life (Moguilewskyand Bouton, 1988; Tremblay et
240
&o&op;& JOHN M. KOKONTISAND SHUTSUNG LIAO
OH
0
A Testosterone
5a-Dlhydrotestosterone (5a-DHT)
Meth Itrlenolone
(#iesl)
Dlmethyl-lQ-nortestosterone (DMW
6 I
902
‘6 OH 0 y c & i 3
NH
F3cDNH
OZN
Hydroxyflutamlde
Anandron
Casodex (lCl178,334)
RU 3882
H 02@
CI
Cyproterone acetate
Splronolactone
FIG.6. Androgens (top row) and antiandrogens (bottom two rows).
al., 1987). In the search for a peripherally selective nonsteroidal antiandrogen that would not sensitize the pituitary to LHRH, the antiandrogen bicalutamide, or Casodex (ICI 176,334)was developed. Casodex shows higher affinity to AR than hydroxyflutamide and in addition shows partial peripheral selectivity in humans and complete peripheral selectivity in animals (Furr et al., 1987; Furr, 1995).This is believed to be true because it does not readily cross the blood-brain barrier, particularly in rodents (Furr, 1995).Interestingly, Casodex acts as a true antiandrogen against the mutant LNCaP AR, unlike hydroxyflutamide, which acts as an agonist with this receptor (Veldscholteet al., 1990a, 1992a; Kokontis et al., 1991). This raises the possibility of using Casodex against prostate tumors that can utilize hydroxyflutamide as an androgen agonist (the “flutamide withdrawal effect”; see Section
MOLECULAR ACTION OF ANDROGEN
241
V,B), but withdrawal responses to Casodex have also been observed (Small and Carroll, 1994; Nieh, 1995; Scher and Kolvenbag, 1997). The mechanism(s) by which antiandrogens inhibit AR activity is instructive of how androgens themselves activate the receptor. The model emerging is that antiandrogens can bind to the receptor but incompletely elicit the conformational changes necessary for dimerization-DNA binding and/or interaction with transcriptional coactivators, depending on the antiandrogen. Wong et al. (1993) had found that different antiandrogens had different effects on AR dimerization and DNA binding, and presumably receptor conformation. Although cyproterone acetate and RU486 (which is also a glucocorticoid and progestin antagonist) induced dimerization and DNA binding, hydroxyflutamide inhibited DHT-induced dimerization and DNA binding. Using HeLa cells expressing AR, Kuil et al. (1995) examined protease resistance and sedimentation rate of ligand-receptor complexes after treatment with androgens and antiandrogens and found that binding of hydroxyflutamide rendered AR frozen in an untransformed conformation in a complex with heat-shock proteins, while RU486, like androgen agonists, could promote dissociation of heat shock proteins and receptor transformation into a smaller species. Using a promoter interference assay for DNA binding, Kuil and Mulder (1996) similarly observed that RU486 induced DNA binding by AR but this DNA binding did not result in transactivation. Kallio et al. (1994a) had found earlier that dihydrotestosterone but not cyproterone acetate binding could protect a 30-kDa steroid-binding domain fragment against proteolysis, suggesting that agonist binding causes a specific conformational change in the steroid-binding domain to render it resistant to proteolysis. This idea is consistent with the general model emerging that steroid receptor agonists and antagonists differentially affect receptor conformation, which, in turn, differentially affects a receptor's interaction with coactivators, corepressors, and other components of the cellular transcriptional machinery (Allan et al., 1992a,b; Tsai and O'Malley, 1994; McInerney et al., 1996; Smith et al.., 1997; Shibata et al., 1997). The determination of the crystal structure of the estrogen receptor steroidbinding domain complexed with estrogen or raloxifene shows quite clearly how ligand structure impacts on the conformation of the domain (Brzozowski et al., 1997).
PROTEINS D. AR-ASSOCIATED After binding of hormone and dimerization, the activated AR homodimer can bind to an androgen response element in the promoter region of a target gene and initiate events that culminate in the tran-
242
JOHN M. KOKONTISAND SHUTSUNG LIAO
scription of the gene. The specific events involved in this process are not clear at present, but based on recent findings with other nuclear receptors, they probably involve the recruitment by the receptor of associated proteins or coactivators that then interact with general transcription factors to stabilize formation of the transcription preinitiation complex. A family of related coactivating proteins has been characterized, either biochemically or by interaction cloning, which appear to interact with receptors for progesterone, estrogen, glucocorticoid, and thyroid hormone (Oiiate et al., 1995;Halachmi et al., 1994; Cavailles et al., 1995; Le Douarin et al., 1995;Voegel et al., 1996; Hong et al., 1996; Takeshita et al., 19961, as well as androgen (Yeh and Chang, 1996).Yeh and Chang (1996) used the steroid-binding domain of AR in a two hybrid screen to isolate a protein from a human brain library that specifically enhanced transactivation in prostate tumor cells induced by AR and not receptors for estrogen, glucocorticoid, or progesterone. In addition to physically interacting with the hormone-binding domains of steroid receptors, most of these coactivators have been shown to bind specifically to the c-AMP response element-binding (CREB) binding protein (CBP),or the related protein p300, which appear to be general factors capable of integrating signaling from AP-1, CAMP,and cytokines as well as nuclear receptors (Kamei et al., 1996; Yao et al., 1996; Chakravarti et al., 1996; Smith et al., 1996; Bhattacharya et al., 1996; Hanstein et al., 1996; Torchia et al., 1997; Heery et al., 1997).CBP/p300 also displays histone acetyltransferase activity, leading to the prediction that this protein can modulate chromatin structure perhaps to a more open conformation to facilitate the formation of an active transcription complex (Ogryzko et al., 1996; Bannister and Kouzarides, 1996).The steroid receptor coactivator 1(SRC-1)itself exhibits histone acetyltransferase activity (Spencer et al., 1997; Jenster et al., 1997). Transactivation by AR in CV-1 cells was shown to be enhanced by coexpression of F-SRC-1, CBP/p300, and RIP-140, but not SRC-1(Ikonen et al., 1997). These coactivators were also shown to enhance transactivation by truncated AR lacking the steroid-binding domain, thus implicating the amino-terminal domain in interactions with coactivators. Coexpressed F-SRC-1 and CBP/p300 could also mediate transactivation by amino-terminal and carboxyl-terminalAR domains expressed as separate chimeric yeast two-hybrid proteins, suggesting that coactivators contact both amino-terminal and carboxyl-terminal domains (Ikonenet al., 1997). Besides coactivators, corepressors have been identified that may mediate transcriptional repression by thyroid hormone and retinoic acid receptors through formation of a complex of receptor, corepressor, and histone deacetylase (Heinzelet al., 1997;Alland et al.,
MOLECULAR ACTION OF ANDROGEN
243
1997). The AR amino-terminal domain (residues 142-485) has been shown by two-hybrid interaction assay to interact directly with the subunits of the general transcription factor TFIIF (McEwen and Gustafsson, 1997). TFIIF is thought to function in two ways: to help recruit RNA polymerase I1 to the promoter complex and to increase elongation efficiency by preventing polymerase pausing (Conaway and Conaway, 1993; Orphanides et al., 1996). OF AR ACTMTYBY GROWTH FACTORS E. STIMULATION AND MODULATORS OF PROTEIN PHOSPHORYLATION
Peptide growth factors have been shown to activate AR independently of steroid. Culig et al. (1994) demonstrated that insulin-like growth factor-I (IGF-I), and to lesser extents, keratinocyte growth factor (KGF) and epidermal growth factor (EGF) could activate transcription of reporter genes linked with ARE-containing promoters in transfected DU145 cells. This activation was dependent on the cotransfection of AR expression vector and could be completely inhibited by the antiandrogen Casodex, indicating that the transactivation was mediated through AR. In LNCaP cells, IGF-I could stimulate secretion of prostate-specific antigen (PSA) in the absence of androgen, showing that the effect could occur with a natural promoter. Interestingly, the combination of R1881 and IGF-I did not result in transactivation higher than R1881 alone, suggesting that IGF-I treatment does not potentiate the activity of a ligand-activated receptor, but instead may induce conformational changes in the unliganded receptor, possibly by altering the receptor’s phosphorylation state, to mimic the changes that occur after hormone binding. Similar findings have been reported with IGF-I and the estrogen receptor (Aronica and Katzenellenbogan, 1993; Newton et al., 1994) and estrogen activation of estrogen receptor has been shown to be enhanced by activation of the ras-mitogen-activated protein (MAP) kinase pathway (Kato et al., 1995). Using CV-1 or HeLa cells transfected with rat AR, Reinikainen et al. (1996) similarly showed that both IGF-I and EGF could augment transactivation by testosterone of a MMTV-linked reporter gene, but had little or no activity alone. Collectively, such activity by mitogenic peptide growth factors has obvious implications for the growth of AR-positive prostate tumor cells in the absence of androgen. Other regulators that activate protein kinase A (PKA) or protein kinase C (PKC) can also affect AR activity. Ikonen et al. (1994) found that activators of PKA [8-bromo-cyclic-AMP(8-Br-c-AMP)]and PKC [phorbol 12-myristate 13-acetate (PMA)] could increase androgen-induced
244
JOHN M. KOKONTISAND SHUTSUNG LIAO
transactivation of reporter genes linked to ARE-containing promoters in CV-1 cells cotransfected with rat AR expression vector. The protein phosphatase-1 and -2A inhibitor okadaic acid also potentiated androgen induction, similar to the effect of okadaic acid on other receptors (Power et al., 1991a,b). Increased transactivation by 8-Br-c-AMP could be blocked by Casodex. In contrast, de Ruiter et czl. (1995) found that PMA but not 8-Br-c-AMP could stimulate androgen-induced reporter gene expression in CHO cells expressing human AR. The difference in 8-Br-c-AMPsensitivity could reflect differences in the cells used or an intrinsic difference between rat and human ARs. Chicken progesterone receptor can be activated by 8-Br-c-AMP in the absence of ligand, while human progesterone receptor is insensitive to 8-Br-cAMP in the absence of ligand, but can be stimulated by 8-Br-c-AMP in the presence of hormone (Denner et al., 1990; Beck et al., 1992). Culig et al. (1997) similarly found that treatment of transfected DU145 cells with luteinizing hormone releasing hormone, which increases intracellular c-AMP level, or a c-AMP analog slightly induced androgen-responsive reporter gene expression when given alone but strongly induced transactivation when given in combination with androgen. Unlike Ikonen et al. (19941, Nazareth and Weigel(1996) found that another PKA activator, forskolin, could activate human AR in CV1 cells in the absence of hormone, and this activation could be blocked by a PKAinhibitor peptide. Forskolin activation could also be blocked by antiandrogens Casodex and hydroxyflutamide, and the activation depended on the presence of a n intact AR DNA binding domain. The reason for the difference in results with the preceding studies is unclear, but again may have to do with differences between rat and human AR or in the different methods used to deliver AR expression vector to cells. While it is presumed that the phosphorylation state of AR is altered after treatment with growth factors and agents known to activate PKA or PKC, no study yet has identified changes in the phosphorylation state of specific AR residues after activation. It is likely that AR coactivators are also targets of protein kinase activity.
V. ARMUTATION A. ANDROGENINSENSITMTY SYNDROME Like steroid 5a-reductase deficiency, defects in AR function resulting from mutation have severe effects on male development. Nearly 200 different naturally occurring mutations and over 270 total mutations of
MOLECULAR ACTION OF ANDROGEN
245
the AR gene have been described that result in the partial or complete loss of AR function or to altered hormone binding specificity. [For excellent reviews, see McPhaul et al. (1993) and Quigley et al. (1995). For a complete listing of known AR mutations, the reader is referred to the compilation by Gottlieb et al. (1997) or to an Internet site (http://www.mcgill.ca/androgendb/)maintained and updated monthly by this group.] Androgen receptor possibly represents the most frequently mutated transcription factor (Semenza, 19941, however, it is probably more accurate to state that it may be the transcription factor in which mutation is most easily tolerated by the affected individual. In addition, the chromosomal location of the AR gene on the hemizygous X chromosome ensures that recessive phenotypes will be expressed in male offspring. Individuals with loss of function mutations in AR are karyotypically male, have testes and a normal to high amount of circulating testosterone, but androgen target tissues and organs, including the prostate, cannot respond to it and do not develop normally, thus furnishing a natural “knockout”experiment providing proof of the critical role androgen and its receptor have in normal primary and secondary male sexual development. Individuals suffering from androgen insensitivity syndrome (AIS)range phenotypically from female (complete AIS) to undervirilized or infertile male (partial AIS), depending on the severity of the loss of function. Adult individuals with complete AIS have normal female external genitalia, breast development, and variable amounts of pubic hair, but possess a close-ended vagina, no ovaries or uterus, and internal testes (Morris, 1953). Feminization is thought to result from estrogen, unopposed by androgenic effects, produced by the testes or from aromatization of testosterone. In general, the degree of receptor functionality loss, determined by measuring the ability of mutant receptors to bind androgen or DNA, coincides with the degree of feminization. However, other genetic factors besides the mutant AR or epigenetic factors may contribute to the AIS phenotype since mildly disruptive AR mutations sometimes are found in individuals with complete AIS and with normal 5a-reductase (Bevan et al., 1996, 1997; Weidemann et al., 1996). Most mutations in AIS are missense mutations that give rise to single amino acid substitutions in the DNA-binding and the steroid-binding domains (Gottlieb et al., 19971, with exons 5 and 7 in the steroidbinding domain particularly prone to mutation (McPhaul et al., 1992). In addition, nonsense mutations and frameshift mutations occur less frequently throughout the open reading frame that create sites of premature termination of translation (Batch et al., 1992; Baldazzi et al., 1994;Lobaccaro et al., 1995;Bruggenwirth et al., 1996).Splicing defects have also been described which lead to deletion of entire exons (Ris-
246
JOHN M.KOKONTISAND SHUTSUNG LLAO
Stalpers et al., 1990; Quigley et al., 1992a; Yong et al., 1994; Lim et al., 1997). Deletion of the entire AR gene has also been reported (Quigley et al., 1992b).A single base deletion near the end of the amino-terminal domain occurs in the testicular feminized (Tfm) mouse (Charest et al., 1991; He et aE., 1991; Gaspar et al., 19911, a widely used model system for androgen insensitivity. In the Tfm rat, a single base change results in a single amino acid substitution in exon 5 (R734Q) of the steroidbinding domain and yields a receptor that binds androgen poorly (Yarbrough et al., 1990).
B. AR MUTATION IN PROSTATECANCER Mutations in the AR gene have been detected in prostate cancer specimens in about 10 to 20% of cases with the general finding that the frequency of mutation appears to be higher in hormone-refractory, metastatic tumors compared to untreated lower grade primary tumors (Hakimi et al., 1996). Since the growth of early stage prostate cancer appears to be mediated by wild-type AR, it appears that receptor mutation may have a role in conferring growth advantage to cells during progression; however, the relatively low frequency of mutation even among hormone-refractory tumors suggests that prostate tumor cells are adept at progressing toward hormone independence while expressing wild-type AR. In contrast to mutations causing AIS, mutations found in prostate cancer occur throughout the reading frame (Gottlieb et al., 1997) and generally do not result in loss of function, but rather may result in gain of function, if any change in receptor activity is observed. Gain of function takes the form of increased affinity for adrenal androgens, androgen metabolites, nonandrogenic steroids such as progesterone or estrogen, and antiandrogens, suggesting that tumor cells expressing mutant receptor would be able to utilize these ligands during androgen deprivation therapy and thereby proliferate (Culig et al., 1993a; Klocker et al., 1994). The first mutation of t h e m gene in prostate cancer was found in the well-studied cell line LNCaP. This was the first prostate cancer cell line to be established that could be proliferatively stimulated by androgen (Horoszewicz et al., 1983; van Steenbrugge et al., 1989), would stably express AR (van Laar et al., 1990; Quarmby et al., 1990; Tilley et al., 1990), and could express androgen-induced gene products such as PSA (Young et al., 1991; Montgomery et al., 1992; Henttu et al., 1992). Several groups had noted anomalous proliferative behavior of these cells in response to antiandrogens; instead of being repressed, they were stimulated by cyproterone acetate and hydroxyflutamide (Wilding et al., 1989; Olea et al., 1990; Schuurmans et al., 1990; Veldscholte et al.,
MOLECULAR ACTION OF ANDROGEN
247
1990b). Sequencing of the AR gene led to the identification of a mutation at position 877 from threonine to alanine that was responsible for increased binding afinity for progesterone, estrogen, and cyproterone acetate and hydroxyflutamide(Veldscholteet al., 1990a, 199213; Harris et al., 1990; Kokontis et al., 1991).Casodex retains antagonistic activity with this mutant receptor (Veldscholteet al., 1992a).The established cell lines DU145 and PC-3 express no or little AR mRNA or protein, but do not possess observable genomic mutations in the AR gene. The recently established androgen-dependentxenograft CWR22 also contains a mutation (H874Y), which increases the ability of dehydroepiandrosterone to induce transactivation compared to wild-type receptor (Tan et al., 1997). Initial screens for AR mutation in untreated primary prostate tumor specimens detected mutation at low frequency. Newmark et al. (19921, examined polymerase chain reaction (PCR)-amplified tumor DNA by denaturing gradient gel electrophoresis and single-stranded DNA conformational polymorphism analyses and found an AR mutation in one out of 26 stage B tumor specimens. This single base change in codon 730 (V730M)was found in about half of the tumor cells and was not present in lymphocytes from the same patient, indicating that it was a somatic and not a germ-line mutation. This mutant was later shown to be activated by hydroxyflutamide, androsterone, and 5a-androstane3P,17p-diol, which are androgen metabolites that bind weakly to wildtype AR (Peterziel et al., 1995). However, since the patient had not undergone either antiandrogen or androgen deprivation therapy, the mutation was clearly not selected for. Culig et al. (1993b)found no mutations in 15 primary tumor specimens by direct sequencing of PCRamplified AR DNA. Similarly, Suzuki et al. (1993) found no mutations in eight untreated primary tumors after PCR amplification and singlestranded DNA conformational polymorphism analysis. Elo et al. (1995) also screened 29 untreated and treated prostate cancer patients and 6 BPH patients and found one germ-line mutation (R726L) in the group of untreated patients that conferred estrogen inducibility to the receptor. Tilley et al. (1996), on the other hand, screened 25 primary untreated prostate tumors and found 11(44%)that had undergone AR mutation. The presence of mutation correlated with rapid progression after initiation of hormonal therapy. Screens of metastatic prostate tumors for AR mutations have yielded generally higher frequencies of mutation. Culig et al. (1993b) obtained cells from fine-needle aspirates of seven metastatic prostate tumors and found that one expressed mutant AR (V715M) that could be activated by progesterone and the adrenal androgens dehydroepiandrosterone and androstenedione in cells transfected with AR ex-
248
JOHN M. KOKONTIS AND SHUTSUNG LIAO
pression and reporter vectors. However, unlike the situation with the mutant LNCaPAR, this mutation did not increase the relative binding affinity of the receptor for these steroids. This group also reported a second AR mutation from metastatic tissue that similarly alters the ability of the receptor to transactivate a reporter gene in the presence of androstenedione and the testosterone metabolites androsterone and androstandiol (Culig et al., 1996).Androstenedione could also increase the gel electrophoretic mobility of a mutant receptor-target DNA complex, but not a wild-type receptor-DNAcomplex. Taplin et al. (1995) obtained bone marrow samples containing prostate tumor cells from 10 patients with androgen-independent metastatic disease and found that five expressed mutant AR. One of the five had a receptor with amino acid substitutions at four sites. Functional analysis of two of the mutant ARs (H874Y and T877S) revealed that estrogen and progesterone as well as androgens could transactivate an androgen-responsive reporter gene in transfected cells. The H874Y mutation is identical to the CWR22 xenograft AR mutation. Gaddipati et al. (1994) reported that 6 out of 24 metastatic cancer patients had a single mutation (T877A)that was identical to the LNCaP lesion. These authors discounted the possibility that these results could have arisen due to contamination of samples with LNCaP AR DNA. Castagnaro et al. (1993) found 2 out of 10 advanced prostate cancer specimens had AR mutations in codons 340 and 798. Other studies, however, found few or no mutations in screens for AR mutations in hormone-independent disease (Mohler et al., 1993; Ruizeveld de Winter et al., 1994; Muir et al., 1994; Evans et al., 1996). Overall, mutation ofAR appears to occur in a minority of androgen-independent, metastatic prostate cancer cells, but the frequency may depend a great deal on the sensitivity of the methods (direct sequencing versus electrophoretic migration screening methods) used to detect them. Given the observation that certain mutations can clearly alter AR ligand specificity,AR mutation has been postulated as playing a key role in the “flutamide withdrawal syndrome” (Scher and Kelly, 1993; Dupont et al., 1993; Taplin et al., 1995). This phenomenon occurs in a subset of patients experiencing relapse of tumor growth, measured by increasing serum PSA concentration, after long-term antiandrogen treatment. After cessation of antiandrogen treatment, symptoms improve, and serum PSA level drops, suggesting that the antiandrogen is acting agonistically in the tumor cells to promote growth and PSA secretion. In support of this, Suzuki et al. (1996) reported that in 2 out of 4 patients who experienced improvement after antiandrogen withdrawal (out of 22 total prostate cancer patients), AR mutations occurred
MOLECULAR ACTION OF ANDROGEN
249
during antiandrogen treatment. These mutations, which were identical to the LNCaP cell AR mutation (T877A), were not present in biopsy specimens of untreated tumors. Importantly, AR in tumors from the other two patients was wild-type, indicating that mutation may account for a fraction of the antiandrogen withdrawal cases, but not all cases. Other mechanisms may be responsible for cases of antiandrogen withdrawal syndrome when tumor cells express wild-type AR (see later). More data have to be acquired to determine the precise role of mutation in the withdrawal response. As noted earlier, shorter polyglutamine and polyglycine repeat length has been correlated with higher transactivational function or expression level ofAR, which has been associated with higher risk of prostate cancer (Edwards et al., 1992; Irvine et al., 1995; Giovannucci et al., 1997; Stanford et al., 1997). However, when CAG repeat length was measured in prostate cancer specimens, no correlation was found between CAG repeat length and tumor grade, serum PSA at diagnosis, or time to PSA relapse (Hardy et al., 1996). However, there did appear to be a significant correlation between reduced CAG repeat length and age at prostate cancer onset, suggesting that CAG repeat length may impinge on mechanisms involved in tumor initiation but not in progression of the localized primary tumor to advanced stages. A correlation of increased CAG repeat length and age of onset and severity of spinal and bulbar muscular atrophy seems to be well established (La Spada et al., 1991; Doyu et al., 1992; Igarashi et al., 1992). Schoenberg et aZ. (1994) found in a screen of 40 prostate cancer specimens 1 cancer specimen that yielded two PCR amplification products, one corresponding to a CAG repeat length of 24 and one corresponding to 18 CAGs. Amplification of DNA from nontumor cells from the same patient yielded only product corresponding to 24 CAGs. Interestingly, this patient exhibited improvement after flutamide withdrawal. However, it is not clear whether the deletion of 6 CAG codons in the AR gene is related to this observation (Hakimi et al., 1996).
VI. AR EXPRESSION IN THE NORMAL PROSTATE AND IN
PROSTATE CANCER
AND MESENCHYME-EPITHELIAL INTERACTIONS A. AR EXPRESSION DURING PROSTATE DEVELOPMENT
The normal development of the prostate and the maintenance of function and structure in the adult is dependent on testicular androgens
250
JOHN M.KOKONTIS AND SHUTSUNG LIAO
and functional AR (Cunha et al., 1987). During mammalian fetal development, androgen from the testes stimulates branching prostatic epithelial bud growth and glandular morphogenesis into the surrounding mesenchyme of the urogenital sinus (Cunha et al., 1987). Cunha and coworkers demonstrated in a series of elegant experiments that fetal urogenital sinus mesenchyme (UGM) plays an instructive role in the glandular proliferation and morphogenesis of urogenital sinus epithelium (UGE). Using chimeric tissue recombinants of UGM and either urinary bladder or vaginal epithelium implanted under the kidney capsules of host animals, they showed that UGM could induce prostatic glandular morphogenesis when paired with the normally nonglandular epithelia (Cunha et al., 1980a,b,c, 1983; Neubauer et al., 1983). It was also shown using recombinants of UGM and urinary tract epithelium from normal and androgen-insensitive Tfm mice that functional AR in UGM, but not in epithelium, was necessary for glandular proliferation and morphogenesis in the epithelium to occur (Cunha and Lung, 1978; Cunha and Chung, 1981; Sugimura et al., 1986; Donjacour and Cunha, 1993). Wild-type AR, however, was required in seminal vesicle mesenchyme-induced seminal vesicle epithelium for the expression of seminal vesicle secretory proteins (Cunha and Young, 1991). Chung and Cunha (1983) reported that the degree of epithelial proliferation observed in an implant was directly related to the amount of UGM used initially, suggesting that UGM provides a possibly limiting supply of a factorb) and/or of an extracellular matrix that is required for prostatic epithelial proliferation and morphogenesis. Lasnitski and Mizuno obtained very similar results using whole and recombinant organ culture of mesenchyme and epithelial layers of urogenital sinus from fetal rat (1977, 1979) and from fetal Tfm mice (1980).They found that epithelial prostatic bud development was dependent on androgen and on mesenchymal cells that expressed functional AR. Consistent with the instructive role of mesenchyme in inducing androgen-dependent morphogenesis of epithelium, Shannon and Cunha (1983, 1984) and Takeda et al. (1985) showed by autoradiographic analysis that labeled androgen (testosterone, DHT, or R1881) bound to the nuclei of mesenchymal but not epithelial cells in the fetal urogenital sinus. Epithelial cell nuclei do not bind androgen until 4-6 days postnatally (Cooke et al., 19911, and then the level eventually exceeds the level of binding in the stromal compartment. However, both mesenchyme and epithelial cells in the fetal urogenital sinus appear to express AR mRNA and protein, measured by immunohistochemical and in situ hybridization using anti-AR antibodies and labeled AR cDNA, suggesting that only the receptor present in the mesenchymal cells is capable of binding androgen (Takeda and Chang, 1991).
MOLECULAR ACTION OF ANDROGEN
25 1
The idea that androgen induces a paracrine factor (“andromedin”)in prostate mesenchymal cells that stimulates growth and/or morphogenesis in developing epithelial cells was supported by the finding that keratinocyte growth factor [KGF or fibroblast growth factor (FGF-7)1 can substitute for androgen in the induction of glandular morphogenesis in rodent urogenital epithelium (Yan et al., 1992; Rubin et al., 1995; Sugimura et al., 1996).Yan et al. (1992)reported that androgen induced the level of KGF mRNA4- to 7-fold in isolated rat ventral prostate stroma1 cells grown in vitro and that KGF was mitogenic in isolated epithelial cells but not in stromal cells. Sugimura et al. (1996) found that antibodies against KGF inhibited androgen-induced growth of ventral prostate explants and reduced the number of ductal end buds, and the antiandrogen cyproterone acetate could partially block the stimulatory effect of KGF. However, Thomson et al. (1997) recently found that neither KGF nor KGF receptor mRNA levels were induced by androgen in organ cultures of rat ventral prostate, seminal vesicle, or coagulating gland when normalized to the epithelial marker cytokeratin 19, leaving the role of KGF in prostatic mesenchymal-epithelial interactions in question. These authors pointed out that KGF has been shown to activate AR in an antiandrogen-inhibitable way (Culig et al., 1994), leaving open the possibility that KGF mimics androgen by activating AR in mesenchymal cells, not by serving as an andromedin in epithelial cells. Additionally, the finding that prostatic development is presumably normal in the KGF knockout mouse (Guo et al., 1993,1996), suggests that KGF may be part of a redundant signaling pathway. Shima et al. (1995) reported that conditioned medium from cultured wild-type UGM grown in the presence of androgen-induced epithelial growth and morphogenesis in bladder mesenchyme and seminal vesicle epithelium recombinants, whereas conditioned medium from androgen-treated Tfm UGM had no effect. These workers also observed several 30-ma-sized androgen-sensitive secreted proteins present in conditioned medium from normal UGM but not Tfm UGM cultures. Stromal-epithelial interactions, as the phrase should imply, are not unidirectional. Prostate epithelium, under the influence of androgen, appears to induce reciprocally the differentiation of UGM cells into smooth muscle cells and to participate in the homeostatic maintenance of the stromal compartment of the prostate. Hayward et al. (1996) and Cunha et al. (19961, using the same chimeric tissue recombination system, found that only nonneoplastic epithelia could induce smooth muscle development from rat UGM. Conversely, seminal vesicle mesenchyme from neonatal mouse could induce differentiation and suppress the proliferation of Dunning tumor cells cografted into nude mouse hosts. They further hypothesize that derangement of reciprocal
252
JOHN M.KOKONTIS AND SHUTSUNG LIAO
homeostatic interactions between adult smooth muscle and glandular epithelium, possibly initiated by mutation in epithelial cells, may be a critical event in prostatic carcinogenesis.Although this is an attractive hypothesis, most of the mechanistic details, including the identification of the epithelial and smooth muscle maintenance factors and the precise role of androgen in the interaction, obviously remain to be determined. Rowley et al. (1995) identified a factor from urogenital sinus mesenchyme that may function as a paracrine inhibitor of epithelial cell proliferation. €3.
AR EXPRESSION IN ADULTPROSTATE
AFt is a widely expressed protein in human and rodent tissues, with detectable expression found in male and female urogenital tissues and organs, brain, muscle, skin, kidney, adrenal glands, and liver (Takeda et al., 1990; Ruizeveld de Winter et al., 1991; Liang et al., 1993). Immunohistochemical analysis of AR in normal adult mouse, rat ventral prostate, and human prostate has shown clearly that AR is expressed strongly and uniformly in secretory luminal epithelial cells and less intensely and uniformly in stromal fibroblasts (Tan et al., 1988; Takeda et al., 1990; Prins et al., 1991;Ruizeveld de Winter et al., 1991; Chodak et al., 1992). Perivascular and periacinar smooth muscle cells in the different lobes of the rat prostate are AR positive, while endothelial cells lack expression (Prins et al., 1991). Basal epithelial cells, which are thought to represent the proliferating stem cell compartment of the epithelium, were reported by Prins et al. (1991) and Leav et al. (1996) to be negative for AR protein expression. However, AR mRNA was detectable in basal epithelial cells (Leav et al., 19961, and Soeffing and Timms (1995) reported both AR mRNA and protein expression in these cells. Prostatic neuroendocrine cells have been reported to be AR-negative (Krijnen et al., 1993; Bonkoff et al., 19931, and variably positive and negative (Nakada et al., 1993). The presence of neuroendocrine cells in the normal prostate and in prostatic carcinoma has led to a suggestion that these cells could play a role in the regulation of prostate growth and in prostatic carcinogenesis (di Sant’Agnese and Cockett, 1996).
C. AR EXPRESSION IN PROSTATE CANCER It was initially assumed that the level of AR expression in metastatic prostate tumor cells should be a good predictor of whether a particular patient would respond well to androgen ablation or antiandrogen
MOLECULAR ACTION OF ANDROGEN
253
therapy. However, after numerous immunohistochemical analyses of tumor specimens before and after endocrine therapy, it has become apparent that no good correlation exists between the percentage of ARimmunopositive cells in a biopsy sample and time to progression to androgen independence (Sadi et al., 1991; Sadi and Barrack, 1993; Tilley et al., 1994). Greater heterogeneity of AR staining in a tumor sample was found, however, to correlate with poorer prognosis, possibly reflecting greater genomic instability (Sadi and Barrack, 1993; Magi-Galluzzi et al., 1997). Heterogeneity in AR expression was also observed in the probasin-large T-antigen transgenic mouse model for prostate carcinoma (Greenberg et al., 1995).Retention ofAR expression in metastatic tumors after relapse from androgen ablation or antiandrogen therapy has been found to be much more common than loss of expression (van der Kwast et al., 1991; Ruizeveld de Winter et al., 1994; Hobisch et al., 1995, 1996; Taplin et al., 1995). Not only is retention ofAR expression a common feature of recurrent disease, but amplification of the AR gene has been detected in 30% of relapsed tumors and has been proposed as a mechanism by which prostate tumors can evade hormone deprivation therapies (Visakorpi et al., 1995; Koivisto et al., 1997). Amplification of the AR gene was not found in primary tumors before androgen deprivation therapy, but only occurred in metastatic tumors in the same patient after treatment and in patients who had initially responded well to the treatment. This suggests that these tumors are not hormone-independent but are hypersensitive and have adapted to low residual levels of androgen, possibly derived from the adrenal glands, by increasing AR expression through gene amplification. Consistent with this idea, increased expression of AR mRNA was observed by in situ hybridization in cells with amplified AR genes (Koivisto et al., 1997). Androgen hypersensitivity predicts that tumors with AR gene amplification should be vulnerable to maximal androgen blockade (androgen deprivation plus antiandrogen treatment). This was found to be true in a case study (Palmberget al., 1997). Apparent androgen independence may therefore reflect only that the extent of androgen blockade is insufficient to suppress growth and such cells are actually hypersensitive to androgen.
D. REGULATION OF AR EXPRESSION 1. Structure of the AR Promoter The AR promoter lacks TATA and CCAAT boxes and has two closely spaced transcription initiation start (TIS) sites, TIS I and TIS 11, located about 1.1kb upstream of the transiation start site (Tilley et al.,
254
JOHN M. KOKONTIS AND SHUTSUNG LIAO
1990;Faber et al., 1991b, 1993).In LNCaP cells and in COS cells transfected with an AR promoter construct, both start sites appear to be used with about equal efficiency (Faber et al., 1993).Wolf et al. (1993) detected a third start site 5 bp downstream of TIS 11. About 40 bp upstream of the TIS I start site is a GC box, a consensus binding site for the transcription factor SP1, which is necessary for transcription initiation at TIS I1 because mutagenesis of this element abolishes or disrupts the amount of transcript initiated from the TIS I1 but not at the TIS I site (Faber et al., 1993). By deleting sequences upstream and downstream of the transcription start sites, Faber et al. (1993) also showed that a sequence or sequences within a region bounded by -5 t o +57 relative t o the TIS I site appear to be required for transcription initiating at TIS I. At about -60 to -150 is a purine-rich tract the deletion of which results in a 5-fold reduction in promoter acttivity (Mizokami et al., 1994). Chen et al. (1997)hypothesized that this tract may function as a weak SP1 binding site to recruit SP1 t o the vicinity of the GC box. SP1 in turn is thought to recruit and stabilize the TFIID complex at the TATA-less start site (Pugh and Tjian, 1991). Further upstream at about -500 bp is a potential CAMPresponse element (CRE) which, through the CREB protein, may mediate the induction of AR transcription by agents such as forskolin and cholera toxin, which induce adenylate cyclase and raise CAMPlevels in cells (Mizokami et al., 1994). In the mouse AR promoter, Lindzey et al. (1993) also found areas both 3' and 5' to the transcription start site, including a potential CRE in the 5'-untranslated region, which mediated the induction of promoter activity by forskolin. In the 5'-untranslated region of the human AR mRNA, Mizokami and Chang (1994)identified two regions, one of which may form a stem-loop structure, which were necessary for efficient translation of an adjacent reporter gene but had no net effect on transcriptional efficiency and RNA stability. Transcription of the mouse AR gene is negatively controlled by factors that bind t o elements upstream and downstream of the transcription start site (Kumar et al., 1994; Grossmann et al., 1994; Grossmann and Tindall, 1995). The rat AR gene appears to be subject to negative control by the transcription factor NF-KB,which binds at an NF-KBsite located at -574 to -554 of the rat AFt 5' promoter region (Supakar et al., 1996).This negative regulation may be related to the decline in AR expression in the livers of aged rats. 2. Androgen Receptor Autoregulation Androgen receptor appears to regulate its own message and protein levels, but the mechanism by which this autoregulation occurs is not clear at the present time. Both positive and negative regulation of AR
MOLECULAR ACTION OF ANDROGEN
255
mRNA has been observed, depending on the method of analysis and on the cell or tissues examined. With Northern blot analysis, rat ventral prostate, seminal vesicle, coagulating gland, epididymis, brain, and kidney, AR mRNA levels increased after castration and the increase could be suppressed by exogenous androgen, suggesting negative regulation (Tan et al., 1988; Quarmby et al., 1990; Shan et al., 1990; Blok et al., 1992).Down-regulation was not observed in the Tfm rat, implying that functional AR was required (Quarmby et al., 1990).Using in situ hybridization, however, Takeda et al. (1991) found that castration caused a modest reduction in AR mRNA in rat ventral prostate, which could be reversed by exogenous androgen. To account for the differences in results, these authors suggested that in the ventral prostate after castration,= mRNAmay be comparatively more stable than most other RNAs, the levels of which are rapidly declining due to apoptotic regression. This relative stability may result in an apparent increase in AR mRNA level when equivalent amounts of total or poly(A)+RNA are hybridized on Northern blots and normalized to an mRNA such as 6actin. This would not account for the negative regulation observed in other, nonregressing tissues such as brain. More recently, others using in situ hybridization have observed elevation of AR mRNA in rat prostate after castration; however, the elevation in the ventral and dorsal lobes was transient, lasting only 3 days, whereas the elevation in the lateral lobe was prolonged (Prins and Woodham, 1995).It is possible that variation in the timing of measurement of AR mRNA level in response to androgen accounts for some of the different results reported by different laboratories. Androgen receptor mRNAin the PC-82 human prostate tumor xenograft was reported to be unaffected by androgen withdrawal (Ruizveld de Winter et al., 1992). In the LNCaP cell line, AR mRNAis clearly down-regulatedby androgen (Quarmbyet al., 1990; Krongrad et al., 1991; Kokontis et al., 19941, and this down-regulation appears to occur at the level of transcription initiation (Wolf et al., 1993). In PC-3 and DU145 cells transfected with the AR cDNA linked with a cytomegalovirus(CMV) promoter, androgen up-regulates expression (Dai et al., 1996).Two ARE half-sites in the amino-terminal region of the AR open reading frame were found to be responsible for this effect (Dai and Burnstein, 1996).On the other hand, in LNCaP cells and COS-1 cells expressing an exogenous AR cDNA, androgen downregulated expression and sequences mediating down-regulation also appeared to be present in the AR open reading frame, not in the promoter (Burnstein et al., 1995). Cell-specific factors, possibly related to the hormone-dependentstatus of the cell, may therefore affect the kind of autoregulation observed. Whatever the situation is with AR mRNA, AR protein expression ap-
256
JOHN M. KOKONTIS AND SHUTSUNG LIAO
pears to be uniformly up-regulated by androgen in nearly all systems examined (Blondeau et al., 1982; Syms et al., 1985;Kronrad et al., 1991; Ruizveld de Winter et al., 1992; Prins and Woodham, 1995). This may occur, in spite of lower levels of AR mRNA, through stabilization of receptor through ligand binding (Kemppainen et al., 1992)or through another mechanism. Mora et al. (1996) found that a rapid androgen upregulation of AR level in ventral prostates of castrated rats could be inhibited by simultaneous treatment with cycloheximide, suggesting that translation of new protein was involved. This is consistent with previous observations that suggest a role for AR in a general and rapid stimulation of translation initiation in rat ventral prostate (Liang and Liao, 1975; Liao et al., 1975; Liang et al., 1977). However, the stimulation of Met-tRNAfMet binding t o the small ribosomal subunit by androgen reported earlier by Liang and Liao was not inhibited by cycloheximide, indicating perhaps that these are two different phenomena. Mora and Mahesh (1996) also reported an inverse correlation between AR level and the level of c-fos in rat ventral prostate. We have observed in androgen-independent LNCaP 104-R1and 104-R2 cells that androgen has no positive effect on the already high level of AR protein expression, and even causes a reduction in AR protein at high concentrations, while androgen down-regulation of AR mRNA persists (Kokontis et al., 1994, 1998).Androgen receptor protein levels are induced in the progenitor androgen-dependent 104-S cells, similar to other LNCaP cells. Thus, in androgen-independent cells, the level ofAR protein may have become uncoupled with the normal mechanism by which androgen regulates its receptor level. This may be an important difference between androgen-dependent and -independent prostate tumor cells that express AR.
VII. ANDROGEN-REGULATED GENES RESPONSEELEMENTS A. ANDROGEN The AR binds as a homodimer t o near-palindromic DNA elements called androgen response elements usually located near the promoter region of target genes. The 5' upstream regions of many androgen-regulated genes have been analyzed in sufficient detail to show that these elements confer androgen inducibility to expression of the genes or to downstream reporter constructs (Table 1). Electrophoretic mobility shift assay and DNA footprinting analysis have confirmed that such elements are physically and specificallybound by AR. The first sequences
257
MOLECULAR ACTION OF ANDROGEN
TABLE I FUNCTIONAL ANDROGEN RESPONSE ELEMENTS OF VARIOUS ANDROGEN-REGULATED GENESAND PROMOTERS Gene Human PSA (ARE I, proximal, noncoding strand) Human PSA (ARE 11, middle, noncoding strand) Human PSA (ARE 111, distal, noncoding strand) Rat dorsal prostate probasin (proximal, noncoding strand) Rat dorsal prostate probasin (distal) Rat ventral prostate C3 Rat liver tyrosine aminotransferase Mouse sex-limited protein MMTV distal I MMTV proximal I1 MMTV proximal I11 MMTV proximal IV Human glycoprotein a subunit (noncoding strand) ARE consensus GRE consensus
Response element
Reference
AGCACTtgcTGTTCT
Riegman et al., 1991b
GAGACTcccTGATCC
Cleutjens et al., 1996
GATACAataTGTTCC
Cleutjens et al., 1997b
ATACAAataGGTTCT
Rennie et ah, 1993
ATAGCAtctTGTTCT
Rennie et al., 1993
AGTACGtgaTGTTCT TGTACAggaTGTTCT
Claessens et al., 1989; Tan et al., 1992 Denison et al., 1989
AGAACAggcTGTTTC GTTACAaacTGTTCT GGTATCaaaTGTTCT AGCTCTtagTGTTCT ATTTTCctaTGTTCT GGTACTtggTGTAAT
Adler et al., 1992 Ham et al., 1988 Ham et al., 1988 Ham et al., 1988 Ham et al., 1988 Clay et al., 1993
GGAPTACAnnnTGTTCT AGTACAnnnTGTTCT
Roche et al., 1992 Lucas and Granner, 1992
recognized as ARES were present in the MMTV long-terminal repeat (Cato et al., 1987; Parker et al., 1987; Otten et al., 1988) and were first recognized as elements bound by glucocorticoid and progesterone receptors (Scheidereit et al., 1983; Payvar et al., 1983; von der Ahe et al., 1985; Cat0 et al., 1986). Shortly after, mineralcorticoid receptor was also found to bind to the same elements (Cato and Weinmann, 1988>, establishing these four steroid receptors as a subfamily that bind to an HRE with the consensus sequence 5’-AGTACAnnnTGTTCT-3’(Lucas and Granner, 1992). Using a random oligonucleotide-binding-site selection procedure (Pollack and Treisman, 19901, Roche et al. (1992) found that AR binds to a consensus element with a similar sequence: 5’-G@/,&!AnnnTGTTCT-3’. Estrogen receptor binds to a response element of similar inverted repeat structure but distinct sequence: 5’AGGTCAnnnTGACCT-3’ (Lucas and Granner, 1992). This AGGTCA half-site is also recognized by retinoid X receptor (RXR) homo- and het-
258
JOHN M. KOKONTIS AND SHUTSUNG LIAO
erodimers in a direct repeat orientation with variations in the spacing between half-sites conferring specificity to receptor binding (Mangelsdorf and Evans, 1995). Interestingly, in t h e m subgroup, the strongest HREs are not perfectly palindromic, suggesting that structural asymmetry exists in the receptor-DNA complex. Multiple HREs have a synergistic effect on transactivation by steroid receptors and the spacing of HREs with respect to one another and to the promoter and transcription start site often greatly affect the strength of the hormone-induced transactivation, possibly reflecting the involvement of accessory transcriptional coactivators (Cat0 et al., 1988; Ham et al., 1988; Beato, 1991). The receptors for androgen, glucocorticoid, progesterone, and mineralcorticoid can bind to the same HRE sequence, which is inconsistent with the specificity with which these hormones activate target genes. Given that glucocorticoid and its receptor are ubiquitously present in cells, it has been postulated that sequences outside the HRE help confer hormone response specificity to a promoter. For example, mutations in the MMTV long-terminal repeat (LTR)were observed to differentially affect transactivation by these receptors (Cat0 et al., 1988; Gowland and Buetti, 1989).Mutations in the nuclear factor I (NFI)site, which lies adjacent to the most proximal HRE, decreased transactivation by androgen and glucocorticoid receptors, but not progesterone receptor. Expression of the mouse sex-limited protein (Slp) is androgen-dependent due to the presence of a consensus HRE within a proviral LTR 2 kb upstream of the Slp gene (Loreni et al., 1988).Although the isolated HRE can confer androgen and glucocorticoid inducibility to a reporter gene, a 120-base pair (bp) fragment containing the HRE confers only androgen inducibility, suggesting that additional transcription factors bind in this region and restrict inducibility to AR (Adler et al., 1991, 1992). In addition, Oct-1 or an Oct-l-like factor may specifically bind to a site in this region (Scarlett and Robins, 1995; Scarlett et al., 1997), although the mechanism whereby AR specificity is obtained is not yet clear. Further work has shown that in the mouse liver, testosterone-modulated and sex-specificgrowth hormone expression appears to control expression of the sex-limited protein (Georgatsou et al., 1993; Nelson and Robins, 1997). In LNCaP cells stably transfected with a glucocorticoid receptor expression vector, both glucocorticoid and androgen induce the expression of prostate-specific antigen mRNA, yet only androgen stimulates cell proliferation and expression of a specifically induced novel mRNA (Cleutjens et al., 1997a).Androgen receptor will most likely turn out to be only one of several cell-specific factors that provide specificity in the regulation of androgen-sensitive genes (Gordon et al., 1995).
MOLECULAR ACTION OF ANDROGEN
259
Steroid receptors, includingAR, have been shown t o interact with the c-jun and c-fos proteins, which dimerize to form the AP-1 transcription factor (Pfahl, 1993). AP-1 and glucocorticoid receptor were originally found to inhibit each other by direct protein interaction (Jonat et al., 1990; Yang-Yen et al., 1990; Schule et al., 1990) and glucocorticoid-receptor-inhibited AP-1 activity by interference at composite elements composed of adjacent glucocorticoid receptor element (GRE) and AP-1 sites (Mordacq and Linzer, 1989; Diamond et al., 1990). Such composite elements have not been found in androgen-responsivegenes, with the possible exception of the MMTV LTR (de Ruiter et at., 1995),but cjun has been shown to interact directly with AR to repress (Sato et al., 1997)as well as enhance receptor transactivation (Bubulyaet al., 1996). Overexpression of c-jun and c-fos has also been shown to inhibit AR activity in LNCaP cells (Young et al., 1994; Sat0 et al., 1997) and treatment of these cells with phorbol ester, which activates protein kinase C and AP-1 (Boyle et al., 19911, has been reported t o inhibit androgen induction of prostate-specific antigen (Andrews et al., 1992).Conversely, AR has been shown to repress c-jun function in a hormone-dependent manner (Kallio et al., 1995; Sat0 et al., 1997). Some of the effects in which direct protein-protein interaction has not been demonstrated may result from competition for limited amounts of commonly required transcriptional coactivators such as CBP/p300. Positive and negative AP-1-steroid receptor interactions probably indicate the involvement of other interacting proteins that are cell-type-specific (Shemshedini et al., 1991; Pfahl, 1993). Recently, AR and RelA, the p65 subunit of the NF-KBtranscription factor, have been reported to mutually inhibit the transcriptional activity of the other when overexpressed in COS-1 cells (Palvimo et al., 1996). Evidence for direct physical interaction was not found, suggesting that an intermediate factor is involved or that the proteins compete for a limiting coactivator. B. ANDROGEN-INDUCED GENESIN THE PROSTATE 1. Prostate-Specific Antigen Prostate-specific antigen is an androgen-regulated kallikrein-like serine protease that is expressed by secretory epithelial cells of the human prostate. Kallikreins are seminal fluid proteases believed to be required for semen gel dissolution (Aumiller and Seitz, 1990). PSA has proven useful as a serum marker for screening for the presence of prostate cancer and for monitoring the effectiveness of therapy (Carter et al., 1992). PSA was also found to be up-regulated by androgen in the LNCaP cell line (Riegman et al., 1991b;Young et al., 1991;Henttu et al.,
260
JOHN M. KOKONTIS AND SHUTSUNG LIAO
1992).Riegman et al. (1991b)found an ARE in a reverse orientation at - 170 t o - 156 in the PSA promoter region (Table 1, PSA ARE-I),which was essential for androgen induction of PSA promoter-reporter constructs in transfected COS cells. Subsequent analysis of sequences farther upstream revealed a second lower affinityARE-like region at -400 to -366 bp that cooperates with the proximal element to provide additional regulation by AR (Cleutjens et al., 1996).Interestingly, the core sequence (Table 1, PSA ARE-11) confers greater androgen and glucocorticoid inducibility t o promoter activity in LNCaP cells than in nonprostate cell lines, suggesting cell-specificity.More recently this group found yet another high-affinity ARE (Table 1, PSAARE 111) located at about 4.2 kb upstream of the PSA transcription start site that synergistically contributes to the androgen responsiveness of the PSA gene (Cleutjens et al., 1997b). In reporter constructs linked with a 6-kb upstream PSA fragment, mutation of ARE 111 had the most dramatic effect on promoter activity compared with mutation of ARE I or ARE 11, indicating a critical role for this distant element. Incorporation of the 6-kb fragment in a LacZ transgene construct conferred prostate-specific and androgen-regulated expression of LacZ in transgenic mice The 5’ flanking region of a related prostate(Cleutjens et al., 1997~). specific protease, glandular kallikrein-1, is also regulated by androgen and contains at least one ARE (Riegman et al., 1991a; Murtha et al., 1993). PSA expression may also be regulated by an autocrine factor produced by androgen-independent prostate tumor cells (Hsieh et al., 1993).
2. The Rat Probasin Gene Probasin is an androgen-regulated 20-kDa secretory protein produced by the rat dorsolateral prostate (Matuo et al., 1989; Spence et al., 1989).Probasin is structurally related to the ligand carrier proteins rat a,-urinary globulin and bovine P-lactoglobulin, but no ligand for probasin is yet known. The probasin promoter contains two AREs at -236 to -223 (ARE-1)and at - 140 to - 117(ARE-2;Rennie et al., 1993; Table 1).Unlike the PSAAREs that are independently active to varying degrees, both probasin AREs are required for androgen-dependent transactivation of downstream reporter genes, as mutation of either element results in complete loss of both transactivation and AR binding (Rennie et al., 1993; Kasper et al., 1994). Although ARE-1 is a lower affinity element,ARE-2 is higher affinity and quite different from a consensus ARE in sequence. However, when present together in the same fragment, both sites are occupied with the same binding kinetics, suggesting that cooperative binding takes place and that the region be-
MOLECULAR ACTION OF ANDROGEN
261
haves as a transcriptional enhancer unit (Kasper et al., 1994).Disruption of the spacing between the two sites also results in decreased promoter activity.Additionally, the probasin ARES are quite specific for AR as glucocorticoid and progesterone receptors have much lower ability to transactivate the probasin promoter (Rennie et al., 1993). Claessens et al. (1996) also found that ARE-2 of the probasin promoter was specifically bound by AR and not glucocorticoid receptor. Although a transgenic construct containing 450 bp of the probasin 5’ upstream region (-426 to +28) was sufficient to direct androgen-dependent expression of reporter genes or SV40 large T antigen t o epithelial cells of the mouse prostate (Greenberg et al., 1994, 1995), a larger 11-kb upstream probasin fragment was capable of directing much stronger expression, suggesting that, like the PSApromoter, distant upstream elements may contribute to the strength of the probasin promoter (Yan et al., 1997). 3. The Rat C3 Gene of a-Protein This major secretory protein of rat ventral prostate was discovered in 1971 as a low-affinity high-capacity steroid-binding protein in rat ventral prostate (Fang and Liao, 1971).The protein was later described by several laboratories as prostate-binding protein (Heyns and DeMoor, 1977)or prostatein (Lea et al., 1979).The function of this protein is not known, but it binds cholesterol stoichiometrically in uiuo (Chen et al., 1982) and may play a role in sperm capacitation (Davis, 1981). a-Protein is a tetramer that consists of three different subunits called C1, C2, and C3 (Chen et al., 1982;Liao et al., 1982),and the mRNAlevel of each is regulated by androgen. The number of C3 mRNA molecules per ventral prostate epithelial cell drops from about 100,000 copies t o about 100copies within 7 days after castration (Parker and Scrace, 1978).Putative ARES have been found in the promoters for all three genes and an ARE present in the first intron of the C3 gene can confer androgenresponsive expression of reporter genes in transfected cells (Claessens et al., 1990; Tan et al., 1992; Table 1).However, androgen appears to more greatly affect mRNA stability than transcription rate (Page and Parker, 1982;Zhang and Parker, 1985).The C1 subunit has been shown to inhibit the binding and promote the release of AR from nuclear chromatin in uitro (Shyr and Liao, 1978; Chen et al., 1982;Liao et al., 1982). 4. Spermine-Binding Protein Another androgen-regulated secretory protein in rat ventral prostate is spermine-binding protein, a 34-kDa protein that binds polyamines, perhaps as a result of a carboxy terminus that is extremely rich in aspartate and glutamate residues (Liang et al., 1978;Chang et al., 1987a;
262
JOHN M. KOKONTISAND SHUTSUNG LJAO
Anderegg et al., 1988). The protein and mRNA levels of spermine-binding protein drop to a level 20% of control within 2 days after castration, which can be restored to normal levels by administration of testosterone (Hiipakka et al., 1984; Chang et al., 1987a).A similar protein is expressed in mouse prostate (Mills et al., 1987),but no human homolog has been reported. At least one ARE-like site is present in the proximal 5’ flanking region of the mouse gene, but insertion of a 1.8-kb upstream region of the mouse gene conferred only slight androgen-responsiveness to reporter gene expression, suggesting either that more active ARES are more distantly located, or that spermine-binding protein mRNA is controlled by androgen through a posttranscriptional mechanism (J.M. Kokontis and S. Liao, unpublished data).
5. Peptide Growth Factors The levels of KGF mRNA were reported to be up-regulated in uitro by androgen in stromal cells isolated from rat prostate (Yan et al., 19921, although a question exists whether the up-regulation occurs in uiuo if KGF mRNA levels are normalized to the relative abundance of the cellular compartments in which it is expressed (Thomson et al., 1997; see Section V1,A). Fasciana et al. (1996) isolated genomic sequences upstream of the KGF open reading frame and determined by deletion analysis that a region between - 1.9 and - 1.2 kb fragment can confer androgen-responsiveness to reporter gene expression in transfected LNCaP cells. As of yet, however, ARE sites have not been specifically identified. In the adult rat ventral prostate, Nishi et al. (1996) found that KGF does not appear to be androgen-dependent because levels of its message do not fall after castration. Of all the growth factors and receptors examined in this study, including KGF, bFGF, epidermal growth factor (EGF), transforming growth factor a (TGFa), and hepatocyte factor (HGF), only EGF mRNA fell after castration and increased 2- to 3fold over control levels after androgen administration (Nishi et al., 1996). EGF receptor has been reported to be up-regulated by androgen in several cell types, including LNCaP cells (Schuurmans et al., 1988; Liu et al., 1993; Brass et al., 1995). However, others have observed no effect of androgen on EGF receptor levels in LNCaP cells (Sherwood and Lee, 1995; Sherwood et al., 1998). Androgen-induced growth factor (AIGF/FGF-8) was isolated in conditioned medium from testosterone-stimulated Shionogi mammary carcinoma SC-3 cells (Tanaka et al., 1992;Koga et al., 1995).Cloning of the AIGF cDNA revealed that AIGF is homologous to members of the FGF family of growth factors and that its mRNA level is strongly up-regulated by androgen in SC-3 cells (Tanaka et al., 1992). Presently it is not
MOLECULAR ACTION OF ANDROGEN
263
known whether this up-regulation occurs at the transcription activation level or at a posttranscriptional level. Expression of the receptor for AIGF, FGFR-1, is also up-regulated by androgen in SC-3 cells, possibly through induction of AIGF, which by itself up-regulates the expression of its receptor (Saito et al., 1991;B. Sat0 et al., 1993).Deregulated expression of AIGF or an AIGF-like factor may enable Shionogi 115 cells that have become androgen-insensitive after long-term androgen deprivation to grow independently of androgen (N. Sat0 et al., 1993).AIGF mRNA is expressed in a variety of adult rat tissues, including prostate, and in human prostate carcinoma cell lines, including LNCaP cells, but it does not appear to be up-regulated by androgen (Tanaka et al., 1995; Schmitt et al., 1996). In LNCaP cells AIGF is less mitogenic than either bFGF or testosterone (Tanaka et al., 1995).However, AIGF mRNA was shown to be induced by androgen in the human breast cancer cell line MDA-MB-231 (Payson et al., 1996). The role of AIGF in human prostate cancer is therefore unclear at the present time. 6, The c-myc Gene Expression of the c-myc protooncogene has been reported to be both positively and negatively regulated by androgen in LNCaP cells, and the type of regulation directly correlates with the positive or negative effect of androgen on LNCaP cell proliferation (Wolf et al., 1991, 1992; Kokontis et al., 1994). Wolf et al. (1992),examining c-myc down-regulation, determined that androgen represses c-myc transcription at the level of transcription initiation, as c-myc mRNA turnover rate was unaffected by androgen and blockage of c-myc transcript elongation by androgen between the first and second exons was not observed. They hypothesized that a GRE-like site in the first intron of the c-myc gene may mediate AR repression of transcription, as glucocorticoid has similarly been shown to repress c-myc transcription in P1798 murine lymphosarcoma cells (Forsthoefel and Thompson, 1987).Alternatively,AR may interfere with AP-1 regulation of the c-myc promoter. Overexpression of the c-myc gene from an androgen-insensitive retroviral promoter has been shown to block the repressive effect of androgen on LNCaP cell proliferation (Kokontis et al., 1994). Lower concentrations of androgen stimulate LNCaP cell proliferation according to the wellcharacterized biphasic growth response of these cells to androgen (Horoszewiczet al., 1983; Schuurmans et al., 1988;van Steenbrugge et al., 19891,and concentrations of androgen that induce proliferation also induce c-myc mRNA levels, although the mechanism by which this occurs is not yet clear (Kokontis et al., 1994).LNCaP 104-S cells overex-
264
JOHN M. KOKONTISAND SHUTSUNG LIAO
6
0 5 % r
- R1881
+ R1881
T
4
X
cn - 3
8g
c
2 1 0
1044 MV7
1044 MV7-c-myc
FIG.7. Effect of constitutive overexpression of c-myc on cell proliferation in retrovirally infected LNCaP 104-Scells.
pressing c-myc have a higher basal rate of proliferation but are growthstimulated by androgen to the same degree as control cells, suggesting that c-myc may mediate some but not all the proliferative effects of androgen (Fig. 7). Unregulated expression of c-myc in mouse urogenital sinus cells implanted in the kidney capsule of host animals has been shown to lead to development of hyperplasia and, in combination with v-ras, carcinoma (Thompson et al., 1989).Overexpression of c-myc has been observed in high-grade prostate tumors and in prostate tumor cell lines (Buttyan et al., 1987; Rijnders et al., 1985).Amplification of the cmyc gene has been detected in a significant percentage of metastatic prostate tumors (Jenkins et al., 1997). In the rat ventral prostate, c-myc mRNAis rapidly induced after castration and is repressed by treatment of castrated rats with androgen, indicating that c-myc expression is negatively controlled by androgen in this system (Quarmby et al., 1987; Buttyan et al., 1988). Buttyan et al. (1988) also observed increased expression of c-fos and heat-shock protein hsp7O after castration. A similar pattern of induced gene expression was seen in regressing Shionogi mammary cancer tumor after castration of mouse hosts (Rennie et al., 1988). Expression of c-myc measured by in situ hybridization was localized to ventral prostate luminal epithelial cells, the same cells undergoing apoptotic elimination. As c-myc overexpression can trigger apoptosis in growth factor-de-
MOLECULAR ACTION OF ANDROGEN
265
prived cells (Evan et al., 1992; Wagner et al., 1993; Harrington et al., 1994; Packham and Cleveland, 1999, it may play a role in mediating apoptosis after androgen withdrawal. 7. Nkx3.1 The murine Nkx3.1 gene encodes a 38-kDa homeoprotein that is specifically expressed in developing and adult male urogenital organs, including testis, seminal vesicle, and prostate (Sciavolinoet al., 1997). Castration resulted in an 8-fold reduction in Nkx3.1 mRNA expression in prostate after 2 days, which, along with the tissue distribution of Nkx3.1 expression, suggests that this gene is positively regulated by androgen during fetal development and in the adult. The human homolog of Nkx3.1 was also found to be specificallyexpressed among adult human tissues in prostate and testis and in the LNCaP cell line, but not in the androgen-independent cell lines PC-3 or DU145 (He et al., 1997). Nkx3.1 mRNA expression was strongly induced by androgen in LNCaP cells. The gene for human Nkx3.1 mapped t o chromosome band 8p21 (He et al., 1997), which is frequently deleted in prostatic carcinoma (Isaacs et al., 1995). This observation suggests that loss of Nkx3.1 expression may potentially have a role as a suppressor of dedifferentiation and neoplastic transformation in prostate cells. C. ANDROGEN-REPRESSED GENESIN
THE
PROSTATE
Androgen receptor also represses gene expression in rat ventral prostate. After castration, the level of mRNA encoding the Ybl subunit of glutathione S-transferase increases rapidly and declines after androgen treatment (Chang et al., 1987b). Similar effects are seen with expression of the mRNA for a protein called TRPM-2 (testosterone-repressed prostate message-21, or sulfated glycoprotein-2 (SGP-2) expressed in many cells undergoing apoptosis, including rat ventral prostate epithelial cells (Leger et al., 1987; Bettuzzi et al., 1989).TRPM2-SGP-2 is identical to a protein called clusterin, an inhibitor of complement-mediated autolysis of red blood cells (Cheng et al., 1988;Jenne and Tschopp, 1989). Expression of TRPM-2-SGP-2 in regressing prostate may be a survival mechanism for limiting autophagic lysis of epithelial cells during apoptosis (Rennie et al., 1994;Akakura et al., 1996). Expression of transforming growth factor-p (TGF-P)is also rapidly upregulated in rat ventral prostate on castration and repressed on androgen treatment (Kyprianou and Isaacs, 1989; Nishi et al., 1996). Prostatic acid phosphatase (PAP) activity, a serum marker for prostate cancer, was found to be down-regulated by androgen in LNCaP
266
JOHN M. KOKONTISAND SHUTSUNG LIAO
cells and the down-regulation correlated with an increase in phosphotyrosine level, tyrosyl kinase activity, and cell proliferation in these cells (Lin et al., 1986;Lin and Clinton, 1986).PAP mRNAwas also found to be down-regulated by androgen in these cells (Henttu et al., 1992), however, the effect was found by Lin and Garcia-Arenas (1994) to be cell-density-dependent. The tyrosine phosphorylation status of p185 cErbB-2 was also found to be sensitive to PAP activity in LNCaP cells, possibly defining a proliferative signaling pathway for androgen in these cells (Lin and Meng, 1996,1997; Lin et al., 1998). Constitutive expression of PAP in PC-3 cells resulted in lower cellular phosphotyrosine level and a correspondingly lower growth rate (Lin et al., 1992). The mechanism by which androgen down-regulates the mRNAlevels of PAP or of the genes mentioned earlier is not known. However, the repression by androgen of glycoprotein hormone (Y subunit gene transcription in the pituitary gland appears to be mediated by the binding ofAR to a 5' flanking ARE positioned next to CRE and CCAAT elements (Table 1; Clay et al., 1993).
D. POSTTRANSCRIPTIONAL EFFECTSOF AR Androgen has well-established effects on gene transcription, but it also can effect the level of specific mRNAs by posttranscriptional means. For example, although androgen induces transcription of the rat C3 gene 5- to 10-fold in the ventral prostate, it induces the steady state level of the C3 mRNA by more than 50-fold (Page and Parker, 1982; Zhang and Parker, 1985). In mouse kidney, androgen had no effect on the transcription rate of three genes but induced the steady state level of the mRNAs 10- to 20-fold (Berger et al., 1986). Androgen receptor has been shown t o bind to RNA and ribonucleoproteins (Liao et al., 1973b, 1980), so it is possible that it may affect RNA processing or stability. The fate of AR after DNA binding and transactivation is unknown, but it may be involved in a recycling mechanism involving the processing, transport, and utilization of mRNA (Hiipakka and Liao, 1988). The association of AR with the nuclear matrix of target cells (Getzenberg and Coffey, 1990; Getzenberg et al., 19901, a possible site of RNA transcription and processing, may be related to the posttranscriptional effects of androgen. Besides affecting the transcription rate and stability of mRNA, AR may also influence the translation and turnover rates of specific proteins. In LNCaP cells, expression of proliferating cell nuclear antigen (PCNA)protein, but not mRNA, is induced by androgen (Perry and Tindall, 1996).Androgen treatment for 12 h resulted in an increase in both
MOLECULAR ACTION OF ANDROGEN
267
PCNA half-life and translation rate, as measured by polysome runoff assay. Although this effect could have been indirect, that is, due to transcriptional activation by AR of genes encoding factors involved in protein translation and turnover, it points out the possibility that AFi may function at levels other than transcription in the regulation of gene expression.
VIII. AFt FUNCTION IN PROSTATE CANCER TUMOR CELLSFROM ANDROGEN A. ADAPTATIONOF PROSTATE DEPENDENCE TO ANDROGEN INDEPENDENCE Prostate cancer is the most commonly diagnosed malignancy and the second leading cause of cancer death among American men (Wingo et al., 1997). Some form of androgen deprivation or antiandrogen therapy, based on the observation made by Huggins et al. in 1941 that prostate tumor cells are initially dependent on testicular androgen for growth and survival, remains the most effective treatment for metastatic prostate cancer. This is because the relatively slow growth rate of prostate cancer confers resistance to genotoxic chemotherapeutic agents that are more effective against faster growing types of tumors. Unfortunately, after 1 to 3 years of endocrine therapy, hormone-independent prostate tumor cells usually reemerge as cells that are refractory to further endocrine control, suggesting that either hormonedependent cells can adapt over time to hormone independence or hormone-independent cells are present even at early stages. If the latter is true, androgen deprivation therapy may allow the selective outgrowth of these preexistent hormone-independent clones (Isaacs and Coffey, 1981; Gingrich et al., 1997). This selection model for prostate tumor cell progression implies that hormone-dependent and -independent cells arise during tumor initiation simultaneously from precursor cells and that hormone-dependent cells may suppress the growth of hormone-independent cells or simply outgrow hormone-independent cells so that hormone-independent cells are present in very low numbers. Otherwise, androgen deprivation therapies would not be expected to have such a generally beneficial effect and the effect would not be expected to last as long as it does. This model additionally implies that androgen-independent tumor cells are able to cometastasize with androgen-dependent cells from the primary site to secondary sites and persist until androgen deprivation permits their emergence. Much evidence exists, however, for the ability of androgen-dependent prostate
268
JOHN M. KOKONTIS AND SHUTSUNG L U O
tumor cells to adapt t o a low-androgen environment, resulting in cells that either can utilize different steroids or lower concentrations of androgen, or are independent of steroid altogether. Adaptation, as discussed earlier, may occur through mutation, amplification of the AR gene, recruitment of alternative receptor activation pathways, and reversible, epigenetic changes in proliferation behavior in response to androgen (Suzuki et al., 1996; Koivisto et al., 1997; Culig et al., 1994; Langeler et al., 1993; Joly-Pharaboz et al., 1995). Adaptation to growth under initially suppressive conditions, of course, may also involve the bypass of AR signaling and subsequent loss of receptor expression. Adaptation with continued or enhanced expression of AR, on the other hand, implies a continuing necessity for receptor signaling. In our studies, we have observed adaptation as an androgen-dependent clone of the LNCaP cell line, called 10443, is subjected to long-term androgen deprivation in uitro (Kokontis et al., 1994).Although LNCaP 104-S cells can grow slowly in the absence of androgen in uitro, these cells do not form tumors in castrated nude mice, and 10443 tumors in intact male mice regress after castration, indicating that these cells are dependent on androgen in uiuo (Umekita et al., 1996).After long-term androgen deprivation, 10443 cells give rise to cells called 104-R1 and subsequently to a faster-growing stage of cells called 104-R2, both of which can grow in the absence of androgen and in the presence of Casodex, indicating that these cells are truly androgen-independent (Kokontis et al., 1994,1998). Dramatically increased AR expression accompanies this transition, but this increased expression does not result from AR gene amplification. Growth of 104-R1 and 104-R2 cells in the presence of Casodex negates the possibility that AE is activated by an alternative signaling pathway perhaps stimulated by a secreted autocrine growth factor, since in all reported cases, antiandrogen can block this type of activation. However, coculture of 104-R2 cells with 1 0 4 3 cells tagged by expression of green fluorescent protein resulted in a slightly higher proliferation rate in 1 0 4 3 cells both in the absence and presence of androgen, suggesting that 104-R2 cells may constitutively secrete a general autocrine growth factor that is not secreted by 10443cells (Fig. 8). Loss of androgen-dependency in 104-R1and 104-R2 cells does not correlate with loss of AR expression or function, consistent with loss of hormone-sensitivity that is concomitant with continued AR expression and function in the Shionogi mammary carcinoma system (Darbre and King, 1987;Furuya et al., 1992; Rennie et al., 1994) and in mouse prostate carcinoma cell lines (Baley et al., 1995).However, loss of AR expression was observed by Bruchovsky et al. (1990) in Shionogi tumor cells during the progression to androgen independence.
MOLECULAR ACTION OF ANDROGEN
269
1044 10442 None Co-cultured Cell Line FIG.8. Coculture of androgen-independent LNCaP 104-R2cells, androgen-dependent 104-Scells enhances the proliferation of 1043 cells. LNCaP 10443 cells were tagged by retroviral infection with a vector encoding green fluorescent protein (GFP). GFP-tagged 104-Scells (lo4cells) were cultured alone or with untagged cells (lo4cells each of 10443 or 104-R2)for 6 days. The number of GFP-expressing 104-Scells was then determined by flow cytometry. The presence of 104-R2cells, although significantly enhancing 104-S cell proliferation, did not replace the effect of androgen.
The induction of PSA by androgen is paradoxically heightened in androgen-independent 104-R1and 104-R2cells compared with androgendependent 10443 cells. It is unclear how AFt functions in 104-R1 and 104-R2 cells, but it is possible that it may be recruited by an alternative signaling pathway to regulate cell proliferation in a ligand-independent manner, while it retains androgen-dependent function for the induction of “normal” androgen target genes such as PSA. Such an alternative pathway may be similar to the situation described recently for estrogen receptor activation of the TGF-P3 gene promoter (Yang et al., 1996). Importantly, the proliferation of 104-R1and 104-R2cells is repressed by androgen even at subnanomolar concentrations, suggesting that a negative regulatory pathway in most LNCaP cells that is normally sensitive to androgen at high concentrations (Sonnenschein et al., 1989; Wolf et al., 1991; Smith et al., 1994; Joly-Pharaboz et al., 1995) is hypersensitive to androgen at low concentration in these cells. The an-
270
JOHN M. KOKONTIS AND SHUTSUNG LIAO
tiandrogen Casodex can completely block this repression of proliferation, an effect also observed by Soto et al. (1995) with Anandron and LNCaP LNO cells. Repression of proliferation by androgen is caused by arrest of the cell cycle at the G1 stage (Joly-Pharaboz et al., 1998, and appears to be mediated by androgen-induced accumulation of the cdk inhibitor p27=P1 (Kokontis et al., 1998).After continuous exposure to inhibitory concentrations of androgen, 104-R1cells readapt and regain positive proliferative sensitivity to androgen (Kokontis et al., 19981. These cells now proliferate optimally at previously inhibitory concentrations of androgen, indicating that the initial adaptation to independence is reversible. This secondary adaptation is accompanied by reduced expression of androgen. The observations that (1)androgen can severely inhibit prostate tumor cell growth after androgen deprivation and (2) this inhibition can be blocked by antiandrogen suggest an alternative mechanism for the antiandrogen withdrawal response in tumor cells expressing wild-typeAR:Withdrawal of antiandrogen may restore repression of cell proliferation by circulating androgen in hypersensitive cells that have arisen during androgen deprivation. However, the clinical existence of such hypersensitive, androgen-independent cells and the generality of androgen repression of prostate cancer cells in patients after androgen deprivation need to be verified. Another example of an androgen-repressed prostate tumor cell line is the ARCaP cell line (Zhau et al., 1996).Unlike LNCaP 104-R1and 104-R2 cells, however, not only proliferation but also expression of PSA is inhibited by androgen in these cells.
B. ANDROGENWITHDRAWAL AND A~OPTOSIS As discussed earlier, androgen withdrawal in the rat ventral prostate initiates a program of gene expression, including induction of c-fos, cmyc, TRPM-2ISGP-2, and TGF-P1, which culminates in the halting of normal cellular activity and in the irreversible internucleosomal cleavage of chromosomal DNA, proteolytic breakdown of nuclear and cytoplasmic structure and phagocytosis by neighboring cells, all typical features of apoptosis (Kyprianou and Isaacs, 1988; Furuya et al., 1994; Nicholson and Thornberry, 1997). This process appears to be independent of the tumor suppressor p53, since apoptotic regression of the prostate occurs normally in p53-knockout mice (Bergeset al., 1993).Evidence points to the paracrine involvement of TGF-P1 in the induction of apoptosis in rat ventral prostate epithelial cells as it is rapidly induced in stromal cells after androgen withdrawal (Kyprianou and Isaacs, 1989; Nemeth et al., 1997; Lee, 1996). Epithelial cells express
MOLECULAR ACTION OF ANDROGEN
271
abundant TGF-P type I and type I1 receptors, while stromal cells themselves do not express receptors for TGF-P1 (Kim et al., 1996). In addition, exogenous TGF-P1 causes apoptosis in cultured rat prostate epithelial cells (Ilio et al., 1995; Hsing et al., 1996). Sells et al. (1994) identified novel genes induced during apoptosis in regressing rat ventral prostate, which may function in prostatic apoptosis. One of these, Par-4, is a novel leucine zipper transcription factor that enhances apoptosis in Dunning AT-3 cells (Sells et al., 1997). Sandford et al. (1984) demonstrated that cycling of apoptosis and regeneration would occur if androgen was cyclicallygiven and withdrawn to castrated rats. It is now recognized that basal epithelial cells that, along with stromal cells, are resistant to apoptosis, probably serve as stem cells during prostate development and adult homeostasis and during the androgen-induced regeneration of the luminal secretory epithelium (Shenvood et al., 1991; Bonkhoff and Remberger, 1996).This regeneration phenomenon has been adapted to study the cyclical apoptotic regression and regrowth of the Shionogi mammary tumor and LNCaP prostate tumor in host animals and clinical prostate tumors during intermittent androgen withdrawal (Akakura et al., 1993; Sat0 et al., 1996; Goldenberg et al., 1995). By interrupting androgen deprivation with periods of androgen replacement, these investigators found that they could extend the time of hormone-dependence past the time the tumors would have become independent during continuous deprivation, and thus keep prostate tumors under endocrine control for a longer period. Eventually, however, the tumors become completely resistant to androgen withdrawal. These findings nevertheless point out the feasibility of manipulating tumor cells to lengthen the period of androgenic control over prostate tumor cell survival and growth. Prostate tumor cells can undergo apoptosis after androgen withdrawal, but a high degree of variability exists among these cells in their sensitivity t o androgen withdrawal. Factors that confer resistance or sensitivity to apoptosis after androgen withdrawal are obviously of great interest. In prostate tumors the stromal cell component is much reduced or absent, so it is not clear whether the same mechanisms that operate in regressing normal prostate function in regressing prostate tumors. Androgen-dependent PC-82 human prostate carcinoma cells were shown to undergo apoptosis after castration of host animals (Kyprianouet al., 19901,but androgen-sensitiveDunning tumors do not (Westin et al., 1993;Brandstrom et al., 1994).Westin et al. (1995)found in study of apoptosis before and after castration therapy, that only 6 out of 18 prostate tumors underwent an increase in apoptotic index after castration, 3 were unaffected, whereas 15 of 18 showed a decrease in
272
JOHN M.KOKONTIS AND SHUTSUNG LIAO
proliferation index as measured by Ki-67 expression. Increased expression of Bcl-2, but not p53 or c-myc, correlated with greater resistance to apoptosis. Increased expression of the antiapoptotic protein Bcl-2 has been generally associated with advanced prostate tumor grade and with the emergence of androgen-independent tumor cells (McDonnell et al., 1992; Colombel et al., 1993; Bubendorf et al., 1996; Krajewska et al., 1996; Bauer et al., 1996; Lipponen and Vesalainen, 19971, although one recent study found no association of Bcl-2 expression with prostate tumor progression (Noordzij et al., 1997). Elevated levels of Bcl-2 family members Bcl-X, and Mcl-1 have also been associated with advanced prostate tumor grade (Krajewska et al., 1996). Apoptosis resistance and high Bcl-2 expression were also correlated with increased metastatic potential in LNCaP cells (McConkey et al., 1996).Inhibition of Bcl-2 expression by introduction of an anti-Bcl-2ribozyme into LNCaP cells was reported to induce apoptosis in a low-Bcl2-expressing variant subline, but not in a high-Bcl-2-expressingvariant, indicating that Bcl-2 is critical for the survival of these cells (Dorai et al., 1997).Raffo et al. (1995)also reported that overexpression of Bcl2 in two plasmid-transfected LNCaP clones resulted in androgen-independent growth in uitro and in uiuo. However, we found that Bcl-2 overexpression in a retrovirally infected pool of LNCaP 1 0 4 3 cells, which consisted of hundreds of clones, had no effect on proliferation, while it did confer resistance to W-light-induced apoptosis (J.M. Kokontis and S. Liao, unpublished results). Berchem et al. (1995) reported that Bcl2 protein levels in LNCaP cells are induced by androgen by about 50% over control, and that androgen thereby confers resistance t o apoptosis induced by etoposide. In our studies, LNCaP 104-R1and 104-R2 cells expressed higher levels of endogenous Bcl-2 than did 104-S cells. However, androgen did not induce Bcl-2 mRNA or protein expression in any of the cell lines. Increased Bcl-2 expression in advanced-grade tumors may confer increased resistance to apoptosis after androgen withdrawal, resulting in androgen-independent survival, but not androgen-independent cell proliferation. Hormone-dependent cells, therefore, may be categorized in at least two classes: those that require androgen as a survival and proliferation factor and those that, possibly by overexpressing Bcl-2 or a related protein, require androgen only as a proliferation factor. Androgen may elicit the production of autocrine factors in hormone-dependent tumor cells, such as AIGF in the Shionogi carcinoma system, which act as survival factors to repress apoptosis and as growth factors to stimulate cell proliferation. Alternatively, androgen may repress the expression of factors such as TGF-@1or Fas (Frost et al., 1997; Weitzman et al., 1997; Rokhlin et al., 1997)to suppress apop-
MOLECULAR ACTION OF ANDROGEN
273
tosis. Increase in Bcl-2 expression is likely only one of many events that contribute to progression of prostate cancer cells to androgen-independence. Interestingly, Bcl-2 expression in breast cancer does not appear to be correlated with hormone-independence, but rather with an indolent phenotype and responsiveness to endocrine therapy (Leek et al., 1994; Elledge et al., 1997; Keen et al., 1997). However, the level of the proapoptotic Bcl-2 family member Bax appears to decline during mammary carcinoma progression, suggesting that these cells may become resistant to apoptosis through a related mechanism (Bargou et al., 1995, 1996; Krajewski et al., 1995; Reed, 1997).
rx.CONCLUDING REMARKS Elucidation of the role of 5a-reductase and AR in androgen action and determination of the structure and function of various AR domains have made it possible to understand the molecular basis of androgen action in normal and abnormal individuals. Intensive studies have begun to reveal the mechanisms involved in AR-mediated control of gene expression in androgen-target organs. Despite these successful efforts, additional studies are needed to understand how androgen regulation of the expression of specific genes affects the development and growth of androgen-sensitive organs or tumors. The demonstration that androgens and AR can work together to suppress the growth of certain prostate tumors adds another complexity to the repertoire of androgen action. The finding that AR level andAR function are closely tied to the progression of androgen-dependent prostate tumors to androgen-independent tumors and their reverse progression through adaptation to an androgenic environment also indicates that an intricate relationship exists between AR function and the development and growth of androgen-sensitive organs or tumors. Nevertheless, studies of the molecular action of androgen in the last 3 decades have made significant contributions to medicine. Androgen insensitivity syndromes and androgen-related abnormalities or diseases, such as prostate cancer, acne, and baldness, have been related to mutations in genes for 5a-reductase and AFi or their abnormal cellular activities. Natural and synthetic compounds that can interfere with 5areductase and AR actions have been isolated or designed to control these androgen-related abnormalities and diseases. For a better understanding of androgen action and medical utilization of this knowledge, it is important to recognize that the development and growth of androgen-related organs and tumors are affected by
274
JOHN M. KOKONTIS AND SHUTSUNG LIAO
many factors that may not be directly related to 5a-reductase or AR. For example, estrogenic substances that are produced from androgens or present in the diet have a delicate relationship with androgen action, but the precise mechanism of the interaction is not clear. The development and growth of androgen-target organs such as prostate and prostate tumors are also heavily influenced by other hormones and vitamins, such as glucocorticoids, peptide growth factors, retinoids, and vitamin D. Since zinc and citrate accumulate in some prostate tissues, it is worthwhile to evaluate carefully their roles in the normal physiology and pathology of organs under androgenic regulation. For greater understanding of the biological role of androgens, it is also necessary to consider the regulation of cell-cell interactions, cell cycle, and apoptosis, as well as angiogenesis in androgen-sensitive organs and tumors. REFERENCES Adler, A. J., Scheller, A., Hoffman, Y., and Robins, D. M. (1991). Multiple components of a complex androgen-dependent enhancer. Mol. Endocrinol. 5, 1587-1596. Adler, A. J., Danielson, M., and Robins, D. M. (1992). Androgen-specific gene activation via a consensus glucocorticoid response element is determined by interaction with nonreceptor factors. Proc. Natl. Acud. Sci. U.S.A. 89, 11660-11663. Akakura, K., Bruchovsky, N., Goldenberg, S. L., Rennie, P. S., Buckley, A. R., and Sullivan, L. D. (1993). Effects of intermittent androgen suppression on androgen-dependent tumors. Cancer (Philadelphia) 71,2782-2790. Akakura, K., Bruchovsky, N., Rennie, P. S., Coldman, A. J., Goldenberg, S. L., Tenniswood, M., and Fox, K. (1996). Effects of intermittent androgen suppression on the stem cell composition and the expression of the TRPM-2 (clusterin) gene in the Shionogi carcinoma. J. Steroid Biochem. Mol. Biol. 59,501-511. Allan, G. F., Leng, X., Tsai, S. Y., Weigel, N. L., Edwards, D. P.,Tsai,M.-J., and OMalley, B. W. (1992a). Hormone and antihormone induce distinct conformational changes which are central to steroid receptor activation. J. Biol. Chem. 267, 19513-19520. Allan, G. F., Tsai, S. Y., Tsai, M.-J., and OMalley, B. W. (1992b). Ligand-dependent conformational changes in the progesterone receptor are necessary for events that follow DNA binding. Proc. Natl. Acad. Sci. U.S.A. 89,11750-11754. Alland, L., Muhle, R., Hou, H., Jr., Potes, J., Chin, L., Schreiber-Agus, N., and DePinho, R. A. (1997). Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature (London) 387,49-55. Anderegg, R. J., Carr, S. A., Huang, I. Y., Hiipakka, R. A., and Liao, S. (1988). Correction of the cDNA-derived protein sequence of prostatic spermine binding protein: Pivotal role of tandem mass spectroscopy in sequence analysis. Biochemistry 27,4214-4221. Anderson, K. M., and Liao, S. (1968). Selective retention of dihydrotestosterone by prostatic nuclei. Nature (London) 219,277-279. Andersson, S., and Russell, D. W. (1990). Structural and biochemical properties of cloned and expressed human and rat steroid 5 alpha-reductases. Proc. Natl. Acad. Sci. U.S.A. 87,3640-3644. Andersson, S., Bishop, R. W., and Russell, D. W. (1989). Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation. J. Biol. Chem. 264,16249-16255.
275
MOLECULAR ACTION OF ANDROGEN
Andersson, S., Berman, D. M., Jenkins, E. P., and Russell, D. W. (1991).Deletion of steroid 5 alpha-reductase 2 gene in male pseudohermaphroditism. Nature (London) 354, 159-161. Andrews, P. E., Young, C. Y., Montgomery, B. T., and Tindall, D. J. (1992). Tumor-promoting phorbol ester down-regulates the androgen induction of prostate-specific antigen in a human prostatic adenocarcinoma cell line. Cancer Res. 52, 1525-1529. Aronica, S. M., and Katzenellenbogen, B. S. (1993). Stimulation of estrogen receptor-mediated transcription and alteration of the phosphorylation state of the rat uterine estrogen receptor by estrogen, cyclic adenosine monophosphate and insulin-like growth factor-I. Mol. Endocrinol. 7,743-752. Aumiller, G., and Seitz, J. (1990). Protein secretion and secretory processes in male accessory sex glands. Znt. Rev. Cytol. 121, 127-131. Baldazzi, L., Baroncini, C., Pirazzoli, P., Balsamo, A., Capelli, M., Marchetti, G., Bernardi, F., and Cacciari, E. (1994). Two mutations causing complete androgen insensitivity: A frame-shift in the steroid binding domain and a Cys Phe substitution in the second zinc finger of the androgen receptor. Hum. Mol. Genet. 3,1169-1170. Baley, P. A., Yoshida, K., Qian, W., Sehgal, I., and Thompson, T. C. (1995). Progression to androgen insensitivity in a novel in vitro mouse model for prostate cancer. J. Steroid Biochem. Mol. Biol. 52, 403-413. Bannister, A. J., and Kouzarides, T. (1996). The CBP coactivator is a histone acetyltransferase. Nature (London) 384,641-643. Bargou, R. C., Daniel, P. T., Mapara, M. Y., Bommert, K., Wagener, C., Kallinich, B., Royer, H. D., and Dorken, B. (1995). Expression of the bcl-2 gene family in normal and malignant breast tissue: Low bax-alpha expression in tumor cells correlates with resistance towards apoptosis. Znt. J. Cancer 60,854-859. Bargou, R. C., Wagener, C., Bommert, K., Mapara, M. Y., Daniel, P. T., Arnold, W., Dietel, M., Guski, H., Feller, A., Royer, H. D., and Dorken, B. (1996). Overexpression of the death-promoting gene bax-alpha which is downregulated in breast cancer restores sensitivity to different apoptotic stimuli and reduces tumor growth in SCID mice. J . Clin. Invest. 97,2651-2659. Batch, J.A., Williams, D. M., Davies, H. R., Brown, B. D., Evans, B.A., Hughes, LA., and Patterson, M. N. (1992). Androgen receptor gene mutations identified by SSCP in fourteen subjects with androgen insensitivity syndrome. Hum. Mot. Genet. 1, 497-503. Bauer, J. J., Sesterhenn, I. A., Mostofi, F. K., McLeod, D. G., Srivastava, S., and Moul, J. W. (1996). Elevated levels of apoptosis regulator proteins p53 and bcl-2 are independent prognostic biomarkers in surgically treated clinically localized prostate cancer. J. Urol. 156,1511-1516. Beato, M. (1991). Transcriptional control by steroid receptors. FASEB J. 5,2044-2051. Beato, M., Herrlich, P., and Schiitz, G. (1995). Steroid hormone receptors: Many actors in search of a plot. Cell (Cambridge, Mass.) 83,851-857. Beck, C. A., Weigel, N. L., and Edwards, D. P. (1992). Effects ofhormone and cellular modulators of protein phosphorylation on transcriptional activity, DNA binding, and phosphorylation of human progesterone receptors. Mol. Endocrinol. 6,607-620. Berchem, G. J., Bosseler, M., Sugars, L. Y., Voeller, H. J., Zeitlin, S., and Gelmann, E. P. (1995). Androgens induce resistance to bcl-2-mediated apoptosis in LNCaP prostate cancer cells. Cancer Res. 55,735-738. Berger, F. G., Loose, D., Meisner, H., and Watson, G. (1986).Androgen induction of messenger RNA concentrations in mouse kidney is posttranscriptional. Biochemistry 25, 1170-1175. +
276
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Berges, R. R., Furuya,Y., Remington, L., English, H. F., Jacks, T., and Isaacs, J. T. (1993). Cell proliferation, DNA repair, and p53 function are not required for programmed cell death of prostatic glandular cells induced by androgen ablation. Proc. Natl. Acad. S C ~U.S.A. . 90,8910-8914. Berman, D. M., and Russell, D. W. (1993). Cell-type-specific expression of rat steroid 5 alpha-reductase isozymes. Proc. Natl. Acad. Sci. U.S.A.90,9359-9363. Bettuzzi, S., Hiipakka, R. A., Gilna, P., and Liao, S. (1989). Identification of the androgen-repressed mRNA for a 48-kilodalton prostate protein as sulfated glycoprotein-2 by cDNA cloning and sequence analysis. Biochem. J. 257,293-296. Bevan, C. L., Brown, B. B., Davies, H. R., Evans, B. A., Hughes, I. A., and Patterson, M. N. (1996). Functional analysis of six androgen receptor mutations identified in patients with partial androgen insensitivity syndrome. Hum. Mol. Genet. 5, 265-273. Bevan, C. L., Hughes, 1.A., and Patterson, M. N. (1997). Wide variation in androgen receptor dysfunction in complete androgen insensitivity syndrome. J. Steroid Biochern. Mol. Biol. 61, 19-26. Bhattacharya, S., Eckner, R., Grossman, S., Oldread, E., Arany, Z., D'Andrea, A., and Livingston, D. M. (1996). Cooperation of Stat2 and p300/CBP in signalling induced by interferon-a. Nature (London) 344-347. Blok, L. J., Bartlett, J. M., Bolt-de Vries, J., Themmen, A. P., Brinkmann, A. O., Weinbauer, G. F., Nieschlag, E., and Grootegoed, J. A. (1992). Effect of testosterone deprivation on expression of the androgen receptor in rat prostate, epididymis and testis. Int. J. Androl. 15,182-198. Blok, L. J., de Ruiter, I? E., and Brinkmann, A. 0. (1996).Androgen receptor phosphorylation. Endocr. Res. 22,197-219. Blondeau, J. P., Balieu, E. E., and Robel, P. (1982).Androgen-dependentregulation of androgen nuclear receptor in the rat ventral prostate. Endocrinology (Baltimore) 110, 1926-1932. Bohen, S. P. (1995). Hsp9O mutants disrupt glucocorticoid receptor ligand binding and destabilize aporeceptor complexes. J. Biol. Chem. 270,29433-29438. Bonkhoff, H., and Remberger, K. (1996). Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: A stem -ell model. Prostate 28, 98 -106. Bonkhoff, H., Stein, U., and Remberger, K. (1993).Androgen receptor status in endocrineparacrine cell types of the normal, hyperplastic, and neoplastic human prostate. Virchows Arch. A: Pathol. Anat. Histopathol. 423,291-294. Bonkhoff, H., Stein, U., Aumuller, G., and Remberger, K. (1996). Differential expression of 5 alpha-reductase isoenzymes in the human prostate and prostatic carcinomas. Prostate 29,261-267. Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-alpha. Nature (London) 375,377-382. Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T. (1991). Activation of protein kinase C decreases phosphorylation of c-Jun a t sites that negatively regulate its DNA-binding activity. Cell (Cambridge, Mass.) 64, 573-584. Brandstrom, A., Westin, P., Bergh, A., Cajander, S., and Damber, J.-E. (1994). Castration induces apoptosis in the ventral prostate but not in an androgen-sensitive prostatic adenocarcinoma in the rat. Cancer Res. 54,3594-3601.
MOLECULAR ACTION OF ANDROGEN
277
Brass, A. L., Bernard, J., Patai, B. L., Salvi, D., and Rukstalis, D. B. (1995).Androgen upregulates epidermal growth factor receptor expression and binding affinity in PC3 cell lines expressing the human androgen receptor. Cancer Res. 55,3197-3203. Breznick, E. H., Dalman, F. C., Sanchez, E. R., and Pratt, W. B. (1989). Evidence that the 90-kDa heat shock protein is necessary for the steroid binding conformation of the L cell glucocorticoid receptor. J. Biol. Chem. 264,4992-4997. Brinkmann, A. O., Klassen, P., Kuiper, G. G. J. M., van der Korput, J. A. G. M., Bolt, J., de Boer, W., Smit, A., Faber, P. W., van Rooij, H. C. J., Geurts van Kessel, A., Voorhorst, M. M., Mulder, E., and Trapman, J. (1989). Structure and function of the androgen receptor. Urol. Res. 17,87-93. Brooks, B. P., Paulson, H. L., Merry, D. E., Salazar-Grueso, E. F., Brinkmann,A. O., Wilson, E. M., and Fischbeck, K. H. (1997). Characterization of an expanded glutamine repeat androgen receptor in a neuronal cell culture system. Neurobiol. Dis. 3, 313-323. Brown, C. J., Goss, S. J., Lubahn, D. B., Joseph, D. R., Wilson, E. M., French, F. S., and Willard, H. F. (1989).Androgen receptor locus on the human Xchromosome: Regional localization to Xqll-12 and description of a DNApolymorphism. Am. J. Hum. Genet. 44,264-269. Bruchovsky, N., and Wilson, J. D. (1968). The conversion of testosterone to 5a-androstan17P-ol-3-oneby rat prostate in vivo and in vitro. J. Biol. Chem. 243,2012-2021. Bruchovsky, N., Rennie, P. S., Coldman, A. J., Goldenberg, S. L., To, M., and Lawson, D. (1990). Effects of androgen withdrawal in the stem cell composition of the Shionogi carcinoma. Cancer Res. 50,2275-2282. Bruggenwirth, H. T., Boehmer,A. L., Verleun-Mooijman, M. C., Hoogenboezem, T., Kleijer, W. J., Otten, B. J., Trapman, J., and Brinkmann, A. 0. (1996). Molecular basis of androgen insensitivity. J . Steroid Biochem. Mol. Biol. 58,569-575. Brzozowski, A. M., Pike, A. C. W., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Omhan, L., Greene, G. L., Gustafsson, J.-A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature (London) 389, 753-758. Bubendorf, L., Sauter, G., Moch, H., Jordan, I?, Blochlinger, A., Gasser, T. C., and Mihatsch, M. J . (1996). Prognostic significance of Bcl-2 in clinically localized prostate cancer. Am. J. Pathol. 148,1557-1565. Bubulya, A,, Wise, S. C., Shen, X.-Q., Burmeister, L. A., and Shemshedini, L. (1996). cJun can mediate androgen receptor-induced transactivation. J. Biol. Chern. 271, 24583-24589. Burnstein, K. L., Maiorino, C. A., Dai,J. L., and Cameron, D. J. (1995). Androgen and glucocorticoid regulation of androgen receptor cDNA expression. Mol. Cell. Endocrinol. 115, 117-186. Buttyan, R., Sawchuk, I. S., Benson, M. C., Siegal, J. D., and Olsson, C. A. (1987). Enhanced expression of the c-myc protooncogene in high-grade human prostate cancers. Prostate 11,327-337. Buttyan, R., Zakeri, Z., Lockshin, R., and Wolgemuth, D. (1988). Cascade induction of cfos, c-myc, and heat shock 70K transcripts during regression of the rat ventral prostate gland. Mol. Endocrinol. 2,650-657. Carter, H. B., Morrell, C. H., Pearson, J. D., Brant, L. J., Plato, C. C., Metter, E. J., Chan, D. W., Fozard, J. L., and Walsh, P. C. (1992). Estimation of prostatic growth using serial prostate-specific antigen measurements in men with and without prostate disease. Cancer Res. 52,3323-3328.
278
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Castagnaro, M.,Yandell, D. W., Dockhorn-Dworniczak, B., Wolfe, H. J., and Poremba, C. (1993). Androgen receptor gene mutations and p53 gene analysis in advanced prostate cancer. Verh. Dtsch. Ges. Pathol. 77, 119-123. Cato, A. C. B., and Weinmann, J. (1988). Mineralcorticoid regulation of transfected mouse mammary tumor virus DNA in cultured kidney cells. J. Cell Biol. 106, 2119-2125. Cato, A. C. B., Miksicek, R., Schiitz, G., Amemann, J., and Beato, M. (1986).The hormone regulatory element of mouse mammary tumor virus DNA mediates progesterone induction. EMBO J. 5,2237. Cato, A. C. B., Henderson, D., and Ponta, H. (1987). The hormone response element of the mouse mammary tumor virus DNA mediates the progestin and androgen induction of transcription in the proviral long terminal repeat region. E M 3 0 J. 6, 363-368. Cato, A. C. B., Skroch, P., Weinmann, J., Butkeraitis, P., and Ponta, H. (1988). DNA sequences outside the receptor-binding sites differentially modulate the responsiveness of the mouse mammary tumor virus promoter to various steroid hormones. EMBO J. 7,1403-1410. Cavaillhs, V., Dauvois, S., L'Horset, F., Lopez, G., Hoare, S., Kushner, P. J., and Parker, M. G. (1995). Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J. 14,3741-3751. Chakravarti, D., LaMorte, V. J., Nelson, M. C., Nakajima, T., Schulman, I. G., Juguilon, H., Montminy, M., and Evans, R. M. (1996). Role of CBP/pSOO in nuclear receptor signalling. Nature (London) 383, 99-103. Chamberlain, N. L., Driver, E. D., and Miesfeld, R. L. (1994). The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Res. 22,3181-3186. Chamberlain, N. L., Whitacre, D. C., and Miesfeld, R. L. (1996). Delineation of two distinct type 1activation functions in the androgen receptor amino-terminal domain. J. Biol. Chem. 271,26772-26778. Chang, C., Saltzman, A. G., Hiipakka, R. A., Huang, I. Y., and Liao, S. t1987a). Prostatic spermine-binding protein: Cloning and nucleotide sequence of cDNA, amino acid sequence and androgenic control of mRNA level. J . 3201.Chem. 262,2826-2831. Chang, C . , Saltzman, A. G., Sorensen, N. S., Hiipakka, R. A., and Liao, S. (198713).Identification of glutathione S-transferase Ybl mRNA as the androgen-repressed mRNA by cDNA cloning and sequence analysis. J. Biol. Chem. 262, 11901-11903. Chang, C., Kokontis, J., and Liao, S. (1988a). Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240,324-326. Chang, C., Kokontis, J., and Liao, S. (1988b). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc. Natl. Acad. Sci.U.S.A. 85,7211-7215. Charest, N. J., Zhou, Z. X., Lubahn, D. B., Olsen, K. L., Wilson, E. M., and French, F. S. (1991). A frameshift mutation destabilizes androgen receptor messenger RNA in the Tfm mouse. Mol. Endocrinol. 5, 573-581. Chen, C., Schilling, K., Hiipakka, R. A., Huang, I. Y., and Liao, S. (1982). Prostate alphaprotein. Isolation and characterization of the polypeptide components and cholesterol binding. J. Biol. Chem. 257,116-121. Chen, S . , Supakar, P. C., Vellanoweth, R. L., Song, C. S., Chatterjee, B., and Roy, A. K. (1997). Functional role of a conformationally flexible homopurine/homopyrimidine domain of the androgen receptor gene promoter interacting with S p l and a pyrimidine single strand DNA-binding protein. Mol. Endocrinol. 11,3-15.
MOLECULAR ACTION OF ANDROGEN
279
Cheng, C. Y., Mathur, P. P., and Grima, J. (1988). Structural analysis of clusterin and its subunits in ram rete testis fluid. Biochemistry 27,4079-4088. Chodak, G. W., Kranc, D. M., Puy, L. A., Takeda, H., Johnson, K., and Chang, C. (1992). Nuclear localization of androgen receptor in heterogeneous samples of normal, hyperplastic and neoplastic human prostate. J. Urol. 147, 798-803. Choong, C. S., Kemppainen, J. A., Zhou, Z. X., and Wilson, E. M. (1996). Reduced androgen receptor gene expression with first exon CAG repeat expansion. Mol. Endocrinol. 10,1527-1535. Chung, L. W., and Cunha, G. R. (1983). Stromal-epithelial interactions: 11. Regulation of prostatic growth by embryonic urogenital sinus mesenchyme. Prostate 4, 503-511. Claessens, F., Celis, L., Peeters, B., Heyns, W., Verhoeven, G., and Rombauts, W. (1989). Functional characterization of a n androgen response element in the first intron of the C3(1) gene of prostatic binding protein. Biochem. Biophys. Res. Commun. 164, 833-840. Claessens, F., Rushmere, N. K., Davies, P., Celis, L., Peeters, B., and Rombauts, W. A. (1990). Sequence-specific binding of androgen-receptor complexes to prostatic binding protein genes. Mol. Cell. Endocrinol. 74,203-212. Claessens, F., Alen, P., Devos, A., Peeters, B., Verhoeven, G., and Rombauts, W. (1996). The androgen-specific probasin response element 2 interacts differentially with androgen and glucocorticoid receptors. J. Biol. Chem. 271,19013-19016. Clay, C. M., Ken, R. A., Finicle, A. B., Heckert, L. L., Hamernik, D. L., Marschke, K. M., Wilson, E. M., French, F. S., and Nilson, J. H. (1993). Transcriptional repression of the glycoprotein hormone alpha subunit gene by androgen may involve direct binding of androgen receptor to the proximal promoter. J. Biol. Chem. 268,13556-13564. Cleutjens, K. B., van Eekelen, C. C. E. M., van der Korput, H. A., Brinkmann, A. O., and Trapman, J. (1996). ' b o androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J. Biol. Chem. 271, 6379-6388. Cleutjens, K. B., Steketee, K., van Eekelen, C. C. E. M., van der Korput, J. A. G. M., Brinkman, A. O., and Trapman, J. (1997a). Both androgen and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growthstimulating properties of LNCaP cells. Endocrinology (Baltimore) 138,5293-5300. Cleutjens, K. B., van der Korput, H. A., van Eekelen, C. C. E. M., van Rooij, H. C., Faber, P. W., and Trapman, J. (199713). An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostatespecific antigen promoter. Mol. Endocrinol. 11, 148-161. Cleutjens, K. B., van der Korput, H. A., van Eekelen, C. C. E. M., Sikes, R. A., Fasciana, C., Chung, L. W., and Trapman, J. (1997~).A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans. Mol. Endocrinol. 11,1256-1265. Colombel, M., Symmans, F., Gil, S., O'Toole, K. M., Chopin, D., Benson, M., Olsson, C. A., Korsmeyer, S., and Buttyan, R. (1993). Detection of apoptosis-suppressing oncoprotein bcl-2 in hormone refractory human prostate cancers. Am. J. Pathol. 143, 390-400. Conaway, R. C., and Conaway, J. W. (1993). General initiation factors for RNApolymerase 11. Annu. Rev. Biochem. 62,161-190. Conneely, 0 .M., Dobson, A. D. W., Tsai, M.-J., Beattie, W. G., Toft, D. O., Huckaby, C. S., Zarucki, T., Schrader, W. T., and O'Malley, B. W. (1987). Sequence and expression of a functional chicken progesterone receptor. Mol. Endocrinol. 1,517-525.
280
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Cooke, P. S., Young, P., and Cunha, G. R. (1991). Androgen receptor expression in developing male reproductive organs. Endocrinology (Baltimore) 128,2867-2873. Culig, Z., Hobisch, A., Cronauer, M. V., Cato, A. C. B., Hittmair, A., Radmayr, C., Eberle, J., Bartsch, G., and Klocker, H. (1993a). Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol. Endocrinol. 7,1541-1550. Culig, Z., Klocker, H., Eberle, J., Kaspar, F., Hobisch, A., Cronauer, M. V., and Bartsch, G. (1993b). DNA sequence of the androgen receptor in prostatic tumor cell lines and tissue specimens assessed by means of polymerase chain reaction. Prostate 22, 11-22. Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A., Bartsch, G., and Klocker, H. (1994). Androgen receptor activation in prostate tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res. 54,5474-5478. Culig, Z., Hobisch,A., Cronauer, M. V., Hittmair, A., Radmayr, C., Bartsch, G., and Klocker, H. (1995). Activation of the androgen receptor by polypeptide growth factors and cellular regulators. World J. Urol. 13,285-289. Culig, Z., Stober, J., Gast, A., Peterziel, H., Hobisch, A., Radmayr, C., Hittmair, A., Bartsch, G., Cato, A. C., and Klocker, H. (1996). Activation of two mutant androgen receptors from human prostatic carcinoma by adrenal androgens and metabolic derivatives of testosterone. Cancer Detect. Prev. 20,68-75. Culig, Z., Hobisch, A., Hittmair, A., Cronauer, M. V., Radmayr, C., Zhang, J., Bartsch, G., and Klocker, H. (1997). Synergistic activation of androgen receptor by androgen and luteinizing hormone-releasing hormone in prostatic carcinoma cells. Prostate 32, 106-114. Cunha, G. R., and Chung, L. W. (1981). Stromal-epithelial interactions-I. Induction of prostatic phenotype in urothelium of testicular feminized (Tfm/y) mice. J. Steroid Biochem. 14,1317-1324. Cunha, G. R., and Lung, B. (1978). The possible influence of temporal factors in androgenic responsiveness of urogenital tissue recombinants from wild-type and androgen-insensitive (Wm) mice. J. Exp. 2001.205,181-193. Cunha, G. R., and Young, P. (1991). Inability of Tfm (testicular feminization) epithelial cells to express androgen-dependent seminal vesicle secretory proteins in chimeric tissue recombinants. Endocrinology (Baltimore) 128,3293 -3298. Cunha, G. R., Lung, B., and Reese, B. (1980a). Glandular epithelial induction by embryonic mesenchyme in adult bladder epithelium of BALBIc mice. Invest. Urol. 17, 302-304. Cunha, G. R., Reese, B. A., and Sekkingstad, M. (1980b). Induction of nuclear androgenbinding sites in epithelium of the embryonic urinary bladder by mesenchyme of the urogenital sinus of embryonic mice. Endocrinology (Baltimore) 107,1767-1770. Cunha, G. R., Chung, L. W., Shannon, J. M., and Reese, B. A. (1980~).Stromal-epithelial interactions in sex differentiation. Biol. Reprod. 22, 19-42. Cunha, G. R., Fujii, H., Neubauer, B. L., Shannon, J. M., Sawyer, L., and Reese, B. A. (1983). Epithelial-mesenchymal interactions in prostatic development. I. Morphological observations of prostatic induction by urogenital sinus mesenchyme in epithelium of the adult rodent urinary bladder. J. Cell Biol. 96,1662-1670. Cunha, G. R., Donjacour, A. A., Cooke, P. S., Mee, S., Bigsby, R. M., Higgins, S. J., and Sugimura, Y. (1987). The endocrinology and developmental biology of the prostate. Endocr. Rev. 0,338-362. Cunha, G. R., Hayward, S. W., Dahiya, R., and Foster, B. A. (1996). Smooth muscle-ep-
MOLECULAR ACTION OF ANDROGEN
281
ithelial interactions in normal and neoplastic prostatic development. Acta Anat. 155, 63-72. Dahlman-Wright, K., Wright, A., Gustafsson, J.-A., and Carlstedt-Duke, J. (1991). Interaction of the glucocorticoid receptor DNA-binding domain with DNA as a dimer is mediated by a short segment of five amino acids. J. Biol. Chem. 266,3107-3112. Dahlman-Wright, K., Grandien, K., Nilsson, S., Gustafsson, J.-A., and Carlstedt-Duke, J. (1993). Protein-protein interactions between the DNA-binding domains of nuclear receptors: Influence on DNA-binding. J. Steroid Biochem. Mol. Biol. 45,239-250. Dai, J. L., and Burnstein, K. L. (1996). Two androgen response elements in the androgen receptor coding region are required for cell-specific up-regulation of receptor messenger RNA. Mol. Endocrinol. 10,1582-1594. Dai, J . L., Maiorino, C. A., Gkonos, I? J., and Burnstein, K. L. (1996). Androgenic up-regulation of androgen receptor cDNA expression in androgen-independent prostate cancer cells. Steroids 61,531-539. Danielian, P. S., White, R., Lees, J. A., and Parker, M. J. (1992). Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11,1025-1033. Danielsen, M., Hinck, L., and Ringold, G. M. (1989). Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell (Cambridge, Mass.) 67,1131-1138. Darbre, P. D., and King, R. J. B. (1987). Progression to steroid insensitivity can occur irrespective of the presence of functional steroid receptors. Cell (Cambridge, Mass.) 51, 521-528. Davis, B. K. (1981). Timing of fertilization in mammals: Sperm cholesterol/phospholipid ratio as a determinant of the capacitation interval. Proc. Natl. Acad. Sci. U.S.A. 78, 7560-7564. Denison, S. H., Sands, A., and Tindall, D. J. (1989).A tyrosine aminotransferase glucocorticoid response also mediates androgen enhancement of gene expression. Endocrinology (Baltimore) 124,1091-1093. Denner, L. A., Weigle, N. L., Schrader, W. T., and O'Malley, B. W. (1990). Regulation of progesterone-mediated transcription by phosphorylation. Science 250, 1740-1743. de Ruiter, P. E., Teuwen, R., Trapman, J., Dijkema, R., and Brinkmann, A. 0.(1995). Synergism between androgen and protein kinase-C on androgen-regulated gene expression. Mol. Cell. Endocrinol. 110, Rl-R6. Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990). Transcription factor interactions: Selectors of positive or negative regulation from a single DNA element. Science 249, 1266-1272. Ding, V. D. H., Moller, D. E., Feeney, W. P., Didolkar, V., Nakhla, A. M., Rhodes, L., Rosner, W., and Smith, R. G. (1998). Sex hormone-binding globulin mediates prostate androgen receptor action via a novel signaling pathway. Endocrinology (Baltimore) 139, 213-218. di Sant'Agnese, P. A., and Cockett, A. T. (1996). Neuroendocrine differentiation in prostatic malignancy. Cancer (Philadelphia) 78,357-361. Doesburg, P., Kuil, C. W., Berrevoets, C. A., Steketee, K., Faber, P. W., Mulder, E., Brinkmann, A. O., and Trapman, J. (1997). Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36,1052-1064. Donjacour, A. A., and Cunha, G. R. (1993). Assessment of prostatic protein secretion in tissue recombinants made of urogenital sinus mesenchyme and urothelium from normal or androgen-insensitive mice. Endocrinology (Baltimore) 132,2342-2350.
282
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Dorai, T., Olsson, C. A., Katz, A. E., and Buttyan, R. (1997). Development of a hammerhead ribozyme against bcl-2. I. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate cancer. Prostate 32,246-258. Doyu, M., Sobue, G., Mukai, E., Kachi, T., Yasuda, T., Mitsuma, T., and Takahashi, A. (1992). Seventy of X-linked recessive bulbospinal neuronopathy correlates with size of the tandem CAG repeat in androgen receptor gene. Ann. Neurol. 32,707-710. Dupont, A., Gomez, J. L., Cusan, L., Koutsilieris, M., and Labrie, F. (1993). Response to flutamide withdrawal in advanced prostate cancer in progression under combination therapy. J. Urol. 150,908-913. Edwards, A., Hammond, H. A., Jin, L., Caskey, C. T., and Chakraborty, R. (1992). Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12,241-253. Elledge, R. M., Green, S., Howes, L., Clark, G. M., Berardo, M., Allred, D. C., Pugh, R., Ciocca, D., Ravdin, P., O’Sullivan, J., Rivkin, S., Martino, S., and Osborne, C. K. (1997). bcl-2, p53, and response to tamoxifen in estrogen receptor-positive metastatic breast cancer: A Southwest Oncology Group study. J. Clin. Oncol. 16,1916-1922. Elo, J. P., Kvist, L., Leinonen, K., Isomaa, V., Henttu, P., Lukkarinen, O., and Vihko, P. (1995). Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J. Clin. Endocrinol. Metab. 80,3494-3500. Enmark, E., and Gustafsson, J.-A. (1996). Orphan nuclear receptors-the first eight years. MoZ. Endocrinol. 10, 1293-1307. Evan, G. I., Wyllie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H., Brooks, M., Waters, C. M., Penn, L. Z., and Hancock, D. C. (1992). Induction of apoptosis in fibroblasts by c-myc protein. Cell (Cambridge, Mass.) 69, 119-128. Evans, B. A., Griffiths, K., and Morton, M. S. (1995). Inhibition of 5 alpha-reductase in genital skin fibroblasts and prostate tissue by dietary lignans and isoflavonoids. J. Endocrinol. 147,295-302. Evans, B. A., Harper, M. E., Daniells, C. E., Watts, C. E., Matenhelia, S., Green, J., and Griffiths, K. (1996). Low incidence of androgen receptor gene mutations in human prostatic tumors using single strand conformation polymorphism analysis. Prostate 28,162-171. Faber, P. W., Kuiper, G. G. J. M., van Rooij, H. C. J., van der Korput, J.A. G. M., Brinkman, A. O., and Trapman, J. (1989). The N-terminal domain of the human androgen receptor is encoded by one, large exon. Mol. Cell. Endocrinol. 61, 257-262. Faber, P. W., King, A., van Rooij, H. C., Brinkmann, A. O., de Both, N. J., and Trapman, J. (1991a). The mouse androgen receptor. Functional analysis of the protein and characterization of the gene. Biochem. J. 278,269-278. Faber, P. W., van Rooij, H. C. J.,van der Korput, H.A. G. M., Baarends, W. M., Brinkmann, A. O., Grootegoed, J. A., and Trapman, J. (1991b). Characterization of the human androgen receptor transcription unit. J. Biol. Chem. 266,10743-10749. Faber, P. W., van Rooij, H. C. J., Schipper, H. J., Brinkmann, A. O., and Trapman, J. (1993). ?tvo different, overlapping pathways of transcription initiation are active on the TATA-lesshuman androgen receptor promoter. J . Biol. Chem. 268,9296-9301. Fang, S., and Liao, S. (1969). Antagonistic actions of anti-androgens in the formation of a specific dihydrotestosterone-receptorprotein complex in rat ventral prostate. Mol. Pharmacol. 6,420-431. Fang, S., and Liao, S. (1971). Androgen receptors: Steroid- and tissue-specific retention of a 17P-hydroxy-5u-androstan-3-one protein complex by the cell nuclei of ventral prostate. J. Biol. Chem. 246,16-24. Fang, S., Anderson, K. M., and Liao, S. (1969). Receptors for androgens: On the role of
MOLECULAR ACTION OF ANDROGEN
283
specific proteins in selective retention of 17p-hydroxy-5ct-androstan-3-one by rat ventral prostate in vivo and in vitro. J. Biol. Chem. 244, 6584-6595. Fang, Y., Fliss, A. E., Robins, D. M., and Caplan, A. J. (1996). Hsp9O regulates androgen receptor binding affinity in uiuo. J. Biol. Chem. 271,28697-28702. Fasciana, C., van der Made, A. C., Faber, P. W., and Trapman, J. (1996). Androgen regulation of the rat keratinocyte growth factor (KGF/FGF7) promoter. Biochem. Biophys. Res. Commun. 220,858-863. Fawell, S . E., Lees, J. A., White, R., and Parker, M. G. (1990). Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor. Cell (Cambridge, Mass.) 60,953-962. Fischer, L., Catz, D., and Kelley, D. (1993). An androgen receptor mRNAisoform associated with hormone-induced cell proliferation. Proc. Nutl. Acad. Sci. U.S.A. 90, 8254-8258. Forsthoefel, A. M., and Thompson, E. A. (1987). Glucocorticoid regulation of transcription of the c-myc cellular protooncogene in P1798 cells. Mol. Endocrinol. 1,899-907. Frost, P., Ng, C. P., Belldegrun, A., and Bonavida, B. (1997). Immunosensitization of prostate carcinoma cell lines for lymphocytes (CTL, TIL, LAK)-mediated apoptosis via the Fas-Fas-ligand pathway of cytotoxicity. Cell. Immunol. 180,70-83. Furr, B. J. (1989). Pharmacology of the luteinising hormone-releasing hormone (LHRH) analogue, Zoladex. Horm. Res. 32 (Suppl. 1),86-92. Fun; B. J. (1995). Casodex: Preclinical studies and controversies. In “Annals of the New York Academy of Sciences. Steroid Receptors and Antihormones” (D.Henderson, D. Philibert, A. K. Roy, and G. Teutsch, eds.), Vol. 761,79-96. N.Y. Acad. Sci., New York. Furr, B. J., Valcaccia, B., Curry, B., Woodburn, J. R., Chesterson, G., and Tucker, H. (1987). ICI 176,334: A novel non-steroidal, peripherally selective antiandrogen. J. Endocrinol. 113,R7-R9. Furuya,Y., Shirasawa, H., Sato, N., Watabe,Y., Simizu, B., and Shimazaki, J. (1992). Loss of androgen dependency with preservation of functional androgen receptors in androgen-dependent mouse tumour (Shionogi carcinomall5). J. Steroid Biochem. Mol. Biol. 42,569-574. Furuya, Y., Berges, R., Lundmo, P., and Isaacs, J. T. (1994). Cell proliferation, p53 gene expression, and intracellular calcium in programmed cell death: Prostate model. In “Apoptosis 11: The Molecular Basis of Apoptosis in Disease” (L. D. Tomei and F. 0. Cope, eds.), pp. 231-252. Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y. Gaddipati, J. P., McLeod, D. G., Heidenberg, H. B., Sesterhenn, I. A., Finger, M. J., Moul, J. W., and Srivastava, S. (1994). Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res. 54,2861-2864. Gao, T., Marcelli, M., and McPhaul, M. J. (1996). Transcriptional activation and transient expression of the human androgen receptor. J.Steroid Biochem. Mol. Biol. 59,9-20. Gaspar, M.-L., Meo, T., Bourgarel, P., Guetnet, J.-L., and To&, M. (1991). A single base deletion in the Tfm androgen receptor gene creates a short-lived messenger RNA that directs internal translation initiation. Proc. Natl. Acad. Sci. U.S.A. 88,8606-8610. Georgatsou, E., Bourgarel, P., and Meo, T. (1993). Male-specific expression of mouse sexlimited protein requires growth hormone, not testosterone. Proc. Nutl. Acad. Sci. U S A . 90,3626-3630; published erratum: p. 6894. Gething, M. J.,and Sambrook, J. (1992). Protein folding in the cell. Nature (London) 355, 33-45. Getzenberg, R. H., and Coffey, D. S. (1990). “issue specificity of the hormonal response in sex accessory tissues is associated with nuclear matrix protein patterns. Mol. Endocrinol. 4, 1336-1342.
284
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Getzenberg, R. H., Pienta, K. J., and Coffey, D. S. (1990). The tissue matrix: Cell dynamics and hormone action. Endocr. Reu. 11,399-417. Gill, G., Pascal, E., Tseng, Z. H., and Tjian, R. (1994).Aglutamine-richhydrophobic patch in transcription factor S p l contacts the dTAF,,110 component of Drosophila TFIID complex and mediates transcriptional activation. Proc. Natl. Acad. Sci. U.S.A. 91, 192-196. Gingrich, J. R., Barrios, R. J., Kattan, M. W., Nahm, H. S., Finegold, M. J., and Greenberg, N. M. (1997). Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res. 57,4687-4691. Giovannucci, E., Stampfer, M. J., Krithivas, K., Brown, M., Brufsky, A., Talcott, J., Hennekens, C. H., and Kantoff, P. W. (1997). The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. Proc. Natl. Acad. Sci. U.S.A. 94, 3320-3323. Gloyna, R. E., and Wilson, J. D. (1969). A comparative study of the conversion of testosterone to 17P-hydroxy-5a-androstan-3-one (dihydrotestosterone) by prostate and epididymis. J. Clin. Endocrinol. Metab. 29, 970-977. Godowski, P. J.,Rusconi, S., Miesfeld, R., andyamamoto, K. R. (1987). Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature (London) 325,365-368. Goldenberg, S . L., Bruchovsky, N., Gleave, M. E., Sullivan, L. D., andAkakura, K. (1995). Intermittent androgen suppression in the treatment of prostate cancer: A preliminary report. Urology 46,839-845. Gordon, D. A., Chamberlain, N. L., Flomerfelt, F. A., and Miesfeld, R. L. (1995). A cellspecific and selective effect on transactivation by the androgen receptor. Exp. Cell Res. 217,368-377. Gormley, G. J., Stoner, E., Bruskewitz, R. C., Imperato-McGinley, J., Walsh, P. C., McConnell, J. D., Andriole, G. L., Geller, J., Bracken, B. R., Tenover, J. S. et al. (1992). The effect of finasteride in men with benign prostatic hyperplasia. The Finasteride Study Group. N. Engl. J. Med. 327,1185-1191. Gottlieb, B., Trifiro, M., Lumbroso, R., and Pinsky, L. (1997). The androgen receptor gene mutations database. Nucleic Acids Res. 25, 158-162. Govindan, M. V. (1990). Specific region in hormone binding domain is essential for hormone binding and trans-activation by human androgen receptor. Mol. Endocrinol. 4, 417-427. Gowland, P. L., and Buetti, E. (1989). Mutations in the hormone regulatory element of mouse mammary tumor virus differentially affect the response to progestins, androgens, and glucocorticoids. Mol. Cell. Biol. 9,3999-4008. Green, S., and Chambon, P. (1987). Oestradiol induction of a glucocorticoid-responsive gene by a chimaeric receptor. Nature (London) 325,75-78. Greenberg, N. M., DeMayo, F.J., Sheeppard, P. C., Barrios, R., Lebovitz, R., Finegold, M., Angelopoulou, R., Dodd, J. G., Duckworth, M. L., Rosen, J. M., and Matusik, R. J. (1994). The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol. 8,230-239. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen, J. M. (1995). Prostate cancer in a trasgenic mouse. Proc. Natl. Acad. Sci. U.S.A. 92,3439-3443 Grossmann, M. E., and Tindall, D. J. (1995). The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA. J. Biol. Chem. 270, 10968-10975.
MOLECULAR ACTION OF ANDROGEN
285
Grossmann, M. E., Lindzey, J., Kumar, M. V.,and Tindall, D. J. (1994). The mouse androgen receptor is suppressed by the 5’-untranslated region of the gene. Mol. Endocrinol. 8,448-455. Guiochon-Mantel, A., Loosfelt, H., Lescop, P., Sar, S., Atger, M., Perrot-Applanat, M., and Milgrom, E. (1989). Mechanisms of nuclear localization of the progesterone receptor: Evidence for interaction between monomers. Cell (Cambridge, Mass.) 57,1147-1154. Guo, L., Yu, &.-C., and Fuchs, E. (1993). Targeting expression of keratinocyte growth factor to keratinocytes elicits striking changes in epithelial differentiation in transgenic mice. EMBO J. 12,973-986. Guo, L., Degenstein, L., and Fuchs, E. (1996). Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev. 10,165-175. Hakimi, J. M., Rondinelli, R. H., Schoenberg, M. P., and Barrack, E. R. (1996). Androgenreceptor gene structure and function in prostate cancer. World J. Urol. 14,329-337. Halachmi, S., Marden, E., Martin, G., MacKay, H., Abbondanza, C., and Brown, M. (1994). Estrogen receptor-associated proteins: Possible mediators of hormone-induced transcription. Science 264,1455- 1458. Ham, J., Thomson, A., Needham, M., Webb, P., and Parker, M. (1988). Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumor virus. Nucleic Acids Res. 16,5263-5276. Hanstein, B., Eckner, R., DiRenzo, J., Halachmi, S., Liu, H., Searcy, B., Kurokawa, R., and Brown, M. (1996). p300 is a component of a n estrogen receptor coactivator complex. Proc. Natl. Acad. Sci. U.S.A. 93, 11540-11545. Hard, T., Kellenbach, E., Boelens, R., Dahlman, K., Carlstedt-Duke, J., Freedman, L. P., Maler, 13.A., Hyde, E. I., Yamornoto,K. R., Gustafsson, J.-A.,and Kaptein, R. (199Oa). 1H-NMR studies of the glucocorticoid receptor DNA-binding domain: Sequential assignments and identification of secondary structure elements. Biochemistry 29, 9015-9023. Hard, T., Kellenbach, E., Boelens, R., Maler, B. A., Dahlman, K., Freedman, L. P., Carlstadt-Duke, J., Yamomoto, K. R., Gustafsson, J.-A., and Kaptein, R. (1990b). Solution structure of the glucocorticoid receptor DNA-binding domain. Science 249, 157-160. Hardy, D. O., Scher, H. I., Bogenreider, T., Sabbatini, l?, Zhang, Z. F., Nanus, D. M., and Catterall, J. (1996). Androgen receptor CAG repeat lengths in prostate cancer: Correlation with age of onset. J. Clin. Endocrinol. Metab. 81,4400-4405. Harrington, E. A., Bennett, M. R., Fanidi, A., andEvan, G. I. (1994). c-Myc-induced apoptosis in fibroblasts is inhibited by specific cytokines. EMBO J. 13,3286-3295. Harris, S. E., Rong, Z., Harris, M. A,, and Lubahn, D. B. (199O).Androgen receptor in human prostate carcinoma LNCaP/ADEP cells contains a mutation which alters the specificity of the steroid-dependent transcriptional activation region. Program 72nd Ann, Meet. Endocl: Soc. Atlanta, GA, Abstr. No. 275. Hayward, S. W., Cunha, G. R., and Dahiya, R. (1996). Normal development and carcinogenesis of the prostate. A unifying hypothesis. Ann. N.Y Acad. Sci. 784,50-62. He, W. W., Kumar, M. V.,and Tindall, D. J. (1991). A frame-shift mutation in the androgen receptor gene causes complete androgen insensitivity in the testicular-feminized mouse. Nucleic Acids Res. 19,2373-2378. He, W. W., Sciavolino, P. J., Wing, J., Augustus, M., Hudson, P., Meissner, P. S., Curtis, R. T., Shell, B. K., Bostwick, D. G., Tindall, D. J., Gelmann, E. P., Abate-Shen, C., and Carter, K. C . (1997).A novel human prostate-specific, androgen-regulated homeobox gene (NKX3.1)that maps to 8p21, a region frequently deleted in prostate cancer. Genomics 43,69-77.
286
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Heery, D. M., Kalkoven, E., Hoare, S., and Parker, M. G. (1997).Asignature motifin transcriptional co-activators mediates binding to coactivators. Nature (London) 387, 733-736. Heinzel, T., Lavinsky, R. M., Mullen, T.-M., Saderstram, M., Laherty, C. D., Torchia, J., Yang, W.-M., Brard, G., Ngo, S. D., Davie, J. R., Seto, E., Eisenman, R. N., Roe, D. W., Glass, C. K., and Rosenfeld, M. G. (1997).Acomplex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature (London) 387, 43-48. Henttu, P., Liao, S., and Vihko, P. (1992).Androgens up-regulate the human prostate-specific antigen messenger ribonucleic acid (mRNA), but down-regulate the prostatic acid phosphatase mRNA in the LNCaP cell line. Endocrinology (Baltimore) 130, 766-772. Hess, R. A., Bunick, D., Lee, K.-H., Bah, J., Taylor, J., Korach, K., and Lubahn, D. B. (1997). A role for estrogens in male reproductive system. Nature (London) 390, 509-5 12. Heyns, W., and DeMoor,P. (1977).Prostatic binding protein: A steroid-binding protein secreted by rat prostate. Eur. J. Biochem. 78,221-230. Hiipakka, R. A., and Liao, S. (1988). Intracellular inhibition of chromatin binding and transformation of androgen receptor by B'deoxyadenosine. J. Biol. Chem. 263, 17590-17595. Hiipakka, R. A., and Liao, S. (1989). Steroid receptor recycling and interaction with RNA. Am. J. Clin. Oncol. 11, S18-S22. Hiipakka, R. A., Chen, C., Schilling, K., Oberhauser, A., Saltzman,A., and Liao, S. (1984). Immunochemical characterization of the androgen-dependent spermine-binding protein of the rat ventral prostate. Biochem. J. 218,563-571. Hirsch, K. S., Jones, C. D., Audia, J. E., Andersson, S., McQuaid, L., Stamm, N. B., Neubauer, B. L., Pennington, P., Toomey, R. E., and Russell, D. W. (1993). LY191704: A selective, nonsteroidal inhibitor of human steroid 5 alpha-reductase type 1. Proc. Natl. Acad. Sci. U.S.A. 90, 5277-5281. Hobisch, A., Culig, Z., Radmeyer, C., Bartsch, G., Klocker, H., and Hittmair, A. (1995). Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res. 56,3068-3072. Hobisch, A., Culig, Z., Radmayr, C., Bartsch, G., Klocker, H., and Hittmair, A. (1996).Androgen receptor status of lymph node metastases from prostate cancer. Prostate 28, 129-135. Hogue, C. W. V. (1997). Cn3D: A new generation of three-dimensional molecular structure viewer. !&ends Biochem. Sci. 22,314-316. Hollenberg, S. M., Giguere, V., Segui, P., and Evans, R. M. (1987). Colocalization of DNAbinding and transcriptional activation functions in the human glucocorticoid receptor. Cell (Cambridge, Mass.) 49,39-46. Hong, H., Kohli, K., Trivedi, A., Johnson, D. L., and Stallcup, M. R. (1996). GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. U.S.A. 93, 4948-4952. Horie, K., Takakura, K., Imai, K., Liao, S., and Mori, T. (1992). Immunohistochemical localization of androgen receptor in the human endometrium, decidua, placenta and pathological condition of the endometrium. Hum. Reprod. 7,1461-1466. Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J., Rosenthal, H., Chu, T. M., Mirand, E. A., and Murphy, G. P. (1983). LNCaP model of human prostatic carcinoma. Cancer Res. 43, 1809-1818. Hsieh, J.-T., Wu, H.-C., Gleave, M. E., von Eschenbach, A. C., and Chung, L. W. K. (1993).
MOLECULARACTION OF ANDROGEN
287
Autocrine regulation of prostate-specific antigen gene expression in a human prostate cancer (LNCaP) subline. Cancer Res. 53,2852-2857. Hsing, A. Y., Kadomatsu, K., Bonham, M. J., and Danielpour, D. (1996). Regulation of apoptosis induced by transforming growth factor-pl in nontumorigenic and tumorigenic rat prostatic epithelial cell lines. Cancer Res. 56,5146-5149. Huggins, C . , Stevens, R. E., and Hodges, C. V. (1941). Studies on prostatic cancer. 11.The effects of castration on advanced carcinoma of the prostate gland. Arch. Surg. (Chicago) 43,209-223. Husmann, D. A., Wilson, C. M., McPhaul, M. J., Tilley, W. D., and Wilson, J. D. (1990). Antipeptide antibodies to two distinct regions of the androgen receptor localize the receptor protein to the nuclei of target cells in the rat and human prostate. Endocrinology (Baltimore) 126,2359-2368. Igarashi, S., Tanno, Y., Onodera, O., Yamazaki, M., Sato, S., Ishikawa, A., Miyatani, N., Nagashima, M., Ishikawa, Y., Sahashi, K., et al. (1992). Strong correlation between the number of GAG repeats in androgen receptor genes and the clinical onset of features of spinal and bulbar muscular atrophy. Neurology 42,2300-2302. Ikonen, T., Palimo, J. J., Kallio, P. K., Reinikainen, P., and Janne, 0. (1994). Stimulation of androgen-regulatedtransactivation by modulators of protein phosphorylation. Endocrinology (Baltimore) 136,1359-1366. Ikonen, T., Palvimo, J. J., and Janne, 0. A. (1997). Interaction between the amino- and carboxyl-terminal regions of the r at androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J. Biol. Chem. 272, 29821-29828. Ilio, K. Y., Sensibar, J. A., and Lee, C. (1995). Effect of TGF-beta 1,TGF-alpha, and EGF on cell proliferation and cell death in rat ventral prostatic epithelial cells in culture. J. Androl. 16,482-490. Imperato-McGinley, J., and Gautier, T. (1992). Inherited 5a-reductase deficiency in man. Dends Genet. 2,130-133. Irvine, R. A., Yu, M. C., Ross, R. K., and Coetzee, G. A. (1995). The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Res. 55,1937-1940. Isaacs, J. T., and Coffey, D. S. (1981). Adaptation versus selection as the mechanism responsible for the relapse of prostate cancer to androgen ablation therapy as studied in the Dunning R-3327-H adenocarcinoma. Cancer Res. 41,5070-5075. Isaacs, W. B., Bova, G. S., Morton, R. A., Bussemakers, M. J., Brooks, J. D., and Ewing, C. M. (1995). Molecular biology of prostate cancer progression. Cancer Surv. 23, 19-32. Jenkins, E. P., Andersson, S., Imperato-McGinley, J., Wilson, J. D., and Russell, D. W. (1992). Genetic and pharmacological evidence for more than one human steroid 5 alpha-reductase. J. Clin. Invest. 89,293-300. Jenkins, R. B., Qian, J., Lieber, M. M., and Bostwick, D. G. (1997). Detection of c-myc oncogene amplification and chromosomal anomalies in metastatic prostate carcinoma by fluorescence in situ hybridization. Cancer Res. 57,524-531. Jenne, D. E., and Tschopp, J. (1989).Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: Identity to sulfated glycoprotein-2, a constituent of rat testis fluid. Proc. Natl. Acad. Sci. U.S.A. 86,7123-7127. Jensen, E. V., and Jacobson, H. I. (1962). Basic guide to the mechanism of estrogen action. Recent Prog. Horm. Res. 18,387-414. Jenster, G., van der Korpu, H. A. G. M., van Vroonhoven, C., van der Kwast, T., Trapman,
288
JOHN M. KOKONTIS AND SHUTSUNG LIAO
J., and Brinkmann, A. P.(1991).Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol. Endocrinol. 5,1396-1404. Jenster, G., van der Korput, J. A. G. M., Trapman, J., and Brinkman, A. 0. (1992).Functional domains of the human androgen receptor. J. Steroid Biochem. Mol. Biol. 41, 671-675. Jenster, G., Trapman, J., and Brinkmann, A. 0. (1993).Nuclear import of the human androgen receptor. Biochem. J. 293,761-768. Jenster, G., de Ruiter, P. E., van der Korput, H. A., Kuiper, G. G., Trapman, J., and Brinkmann, A. 0. (1994).Changes in the abundance of androgen receptor isotypes: Effects of ligand treatment, glutamine-stretch variation, and mutation of putative phosphorylation sites. Biochemistry 33, 14064-14072. Jenster, G., van der Korput, H. A. M. G.,Trapman, J.,and Brinkmann, A. 0. (1995).Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J. Biol. Chem. 270,7341-7346. Jenster, G., Spencer, T.E., Burcin, M. M., Tsai, S. Y., Tsai, M. J., and O’Malley, B. W. (1997).Steroid receptor induction of gene transcription: A two-step model. Proc. Natl. Acad. Sci. U S A . 94,7819-7884. Johnson, M. P., Young, C. Y. F., Rowley, D. R., and Tindall, D. J. (1987).A common molecular weight of the androgen receptor monomer in different target tissues. Biochemistry 26,3174-3182. Joly-Pharaboz, M.-O., Soave, M.-C., Nicolas, B., Mebarki, F., Renaud, M., Foury, O., Morel, Y., and Andre, J. G. (1995).Androgens inhibit the proliferation of a variant of the human prostate cancer cell line LNCaP. J. Steroid Biochem. Mol. Biol. 55,67-76. Jonat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C. B., Gebel, S.,Ponta, H., and Herrlich, P. (1990).Antitumor promotion and antiinflammation: Down modulation of AP-1 (fos/jun) activity by glucocorticoid receptor. Cell (Cambridge, Mass.) 62,1189-1204. Kallio, P.J., Janne, 0.A., and Palvimo, J. J. (1994a).Agonists, but not antagonists, alter the conformation of the hormone binding domain of androgen receptor. Endocrinology (Baltimore) 134,998-1001. Kallio, P. J., Palvimo, J . J., Mehto, M., and Janne, 0.A. (1994b).Analysis of androgen receptor-DNA interactions with receptor proteins produced in insect cells. J . Biol. Chem. 269,11514-11522. Kallio, P. J., Poukka, H., Moilanen, A., Janne, 0.A., and Palvimo, J. J . (1995).Androgen receptor-mediated transcriptional regulation in the absence of direct interaction with a specific DNAelement. Mol. Endocrinol. 9,1017-1028. Kamei, Y.,Xu,L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S.-C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M.G. (1996).A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell (Cambridge, Mass.) 85,403-414. Karlson, P.(1963).New concepts on the mode of action of hormones. Perspect. Biol. Med. 6,203-214. Karvonen, U., Kallio, P. J., Jlnne, 0.A., and Palvimo, J. J.(1997).Interaction of androgen receptors with androgen response element in intact cells. J. Biol. Chem. 272, 15973-15979. Kasper, S., Rennie, P. S., Bruchovsky, N., Sheppard, P.C . , Cheng, H., Lin, L., Shiu, R. P., Snoek, R., and Matusik, R. J. (1994).Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J. Biol. Chem. 269,31763-31769. Kato, S., Endoh, H., Masuhiro, Y.,Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S.,
MOLECULAR ACTION OF ANDROGEN
289
Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995). Activation of estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270, 1491-1494. Keen, J. C., Dixon, J. M., Miller, E. P., Cameron, D. A., Chetty, U., Hanby, A., Bellamy, C., and Miller, W. R. (1997). The expression of Ki-S1and BCL-2 and the response to primary tamoxifen therapy in elderly patients with breast cancer. Breast Cancer Res. Treat. 44,123-133. Kemppainen, J. A., Lane, M. V., Sar, M., and Wilson, E. M. (1992). Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. J. Biol. Chem. 267,968-974. Kim, I. Y., Ahn, H.-J., Zelner, D. J., Park, L., Sensibar, J. A., and Lee, C. (1996). Expression and localization of transforming growth factor+ receptors type I and type I1 in the rat ventral prostate during regression. Mol. Endocrinol. 10, 107-115. Kim, T. F., and Roeder, R. (1994). Proline-rich activator CTFl t,argets the TFIIB assembly step during transcriptional activation. Proc. Natl. Acad. Sci. U.S.A. 91, 4170-4174. mocker, H., Culig, Z., Kaspar, F., Hobisch, A., Eberle, J., Reissigl, A,, and Bartsch, G . (1994). Androgen signal transduction and prostatic carcinoma. World J. Urol. 12, 99-103. Koga, M., Kasayama, S., Matsumoto, K., and Sato, B. (1995). Molecular mechanism of androgen-dependentgrowth in transformed cells. Pathway from basic science to clinical application. J. Steroid Biochem. Mol. Biol. 54, 1-6. Koivisto, P., Kononen, J., Palmberg, C., Tammela, T., Hytinen, E., Isola, J., Trapman, J., Cleutjens, K., Noorrdzij, A., Visakorpi, T., and Kallioniemi, 0.-P. (1997).Androgen receptor gene amplification: A possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res. 57,314-319. Kokontis, J., Ito, K., Hiipakka, R. A,, and Liao, S. (1991). Expression and function of normal and LNCaP androgen receptors in androgen-insensitive human prostatic cancer cells: Altered hormone and antihormone specificity in gene transactivation. Receptor 1,271-279. Kokontis, J., Takakura, K., Hay, N., and Liao, S. (1994). Increased androgen receptor activity and altered c-myc expression in prostate cancer cells after long-term androgen deprivation. Cancer Res. 54,1566-1573. Kokontis, J. M., Hay, N., and Liao, S. (1998). Progression of LNCaP prostate tumor cells during androgen deprivation: Hormone-independent growth, repression of proliferation by androgen and role for p27=P1 in androgen-induced cell cycle arrest. Mol. Endocrinol. 12,941-953. Krajewska, M., Krajewski, S., Epstein, J. I., Shabaik, A., Sauvageot, J., Song, K., Kitada, S., and Reed, J. C. (1996). Immunohistochemical analysis of bcl-2, bax, bcl-X, and mcl-1 expression in prostate cancers. Am. J. Pathol. 148,1567-1576. Krajewski, S., Blomqvist, C., Franssila, K., Krajewska, M., Wasenius, V. M., Niskanen, E., Nordling, S., and Reed, J . C. (1995). Reduced expression of proapoptotic gene BAX is associated with poor response rates to combination chemotherapy and shorter survival i n women with metastatic breast adenocarcinoma. Cancer Res. 55,4471-4478. Krause, W. L., McInerney, E. M., and Katzenellenbogen, B. S. (1995). Ligand-dependent, transcriptionally productive association of the amino- and carboxyl-terminal regions of a steroid hormone nuclear receptor. Proc. Natl. Acad. Sci. U.S.A.92,12314-12318. Krijnen, J. L., Janssen, P. J., Ruizeveld de Winter, J. A., van Krimpen, H., Schroder, F. H., and van der Kwast, T. H. (1993). Do neuroendocrine cells in human prostate cancer express androgen receptor? Histochemistry 100,393-398.
290
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Krongrad, A., Wilson, C., Wilson, J., Allman, D., and McPhaul, M. J. (1991).Androgen increases androgen receptor protein while decreasing receptor mRNA in LNCaP cells. Mol. Cell. Endocrinol. 76, 79-88, Krongrad, A., Wilson, J. D., and McPhaul, M. J. (1995). Cloning and partial sequences of the rabbit androgen receptor: expression in fetal urogenital tissues. J. Androl. 16, 209-2 12. Kuil, C. W., and Mulder, E. (1996). Deoxyribonucleic acid-binding ability of androgen receptors in whole cells: Implications for the action ofandrogens and antiandrogen. Endocrinology (Baltimore) 137,1870-1877. Kuil, C. W., Berrevoets, C. A., and Mulder, E. (1995). Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. J. Biol. Chem. 270,27569-27576. Kuiper, G. G., and Brinkmann, A. 0. (1995). Phosphotryptic peitide analysis of the human androgen receptor: Detection of a hormone-induced phosphopeptide. Biochemistry 34,1851-1857. Kuiper, G. G. J. M., Faber, P. W., van Rooij, H. C. J., van der Korput, J. A. G. M., RisStalpers, C., Klassen, P., Trapman, J., and Brinkman, A. 0. (1989). Structural organization of the human androgen receptor gene. J. Mol. Endocrinol. 2, Rl-R4. Kuiper, G., de Ruiter, P. E., Grootegoed, J. A., and Brinkmann, A. 0. (1991). Synthesis and post-translational modification of the androgen receptor in LNCaP cells. Mol. Cell. Endocrinol. 80,65-73. Kuiper, G. G. J. M., de Ruiter, F? E., Trapman, J., Boersma, W. J. A., Grootgoed, J. A., and Brinkmann, A. 0. (1993). Localization and hormonal stimulation of phosphorylation sites in the LNCaP-cell androgen receptor. Biochem. J. 291,95-101. Kuiper, G. J. M., Enmar, E., Pelto-Huikko, M., Nilsson, S., and Gustafsson, J.-K. (1996). Cloning of a novel estrogen receptor expressed in r a t prostate and ovary. Proc. Natl. Acad. Sci. U.S.A. 93, 5925-5930. Kumar, M. V., Jones, E. A., Grossman, M. E., Blexrud, M. D., and Tindall, D. J. (1994). Identification and characterization of a suppressor element in the 5'-flanking region of the mouse androgen receptor gene. Nucleic Acids Res. 22,3693-3698. Kumar, V., and Chambon, P. (1988). The estrogen receptor binds tightly to its responsive element a s a ligand-induced homodimer. Cell (Cambridge, Mass.) 55, 145-156. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J. R., and Chambon, P. (1987). Functional domains of the human estrogen receptor. Cell (Cambridge, Mass.) 51,941-951. Kyprianou, N., and Isaacs, J. T. (1988). Activated programmed cell death in the rat ventral prostate following castration. Endocrinology (Baltimore) 122,552-561. Kyprianou, N., and Isaacs, J. T. (1989). Expression of transforming growth factor-p in the rat ventral prostate during castration-induced programmed cell death. Mol. Endocrinol. 3,1515-1522. Kyprianou, N., English, H. F., and Isaacs, J. T. (1990). Programmed cell death during regression of PC-82 human prostate cancer following androgen ablation. Cancer Res. 50,3748-3753. Langeler, E. G., van Uffelen, C. J. C., Blankenstein, M. A., van Steenbrugge, G. J., and Mulder, E. (1993). Effect of culture conditions on androgen sensitivity of the human prostatic cancer cell line LNCaP. Prostate 23,213-223. Langley, E., Zhou, Z. X., and Wilson, E. M. (1995). Evidence for a n anti-parallel orientation of the ligand-activated human androgen receptor dimer. J. Biol. Chem. 270, 29983-29990. Lasnitski, I., and Mizuno, T. (1977). Induction of the rat prostate gland by androgens in organ culture. J. Endocrinol. 74,47-55.
MOLECULAR ACTION OF ANDROGEN
29 1
Lasnitski, I., and Mizuno, T. (1979). Role of mesenchyme in the induction of the rat prostate gland by androgens in organ culture. J. Endocrinol. 82, 171-178. Lasnitski, I., and Mizuno, T. (1980). Prostatic induction: Interaction of epithelium and mesenchyme from normal wild-type mice and androgen-insensitive mice with testicular feminization. J. Endocrinol. 85,423-428. La Spada, A. R., Wilson, E. M., Lubahn, D. B., Harding, A. E., and Fischbeck, K. H. (1991). Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature (London) 352,77-79. Lea, 0.A., Petrusz, P., and French, F. S. (1979). Prostatein: A major secretory protein of the rat ventral prostate. J. Biol. Chem. 254,6196-6202. Leav, I., McNeal, J. E., Kwan, P. W., Komminoth, P., and Merk, F. (1996). Androgen receptor expression in prostatic dysplasia (prostatic intraepithelial neoplasia) in the human prostate: an immunohistochemical and in situ hybridization study. Prostate 29,137-145. Le Douarin, B., Zechel, C., Gamier, J.-M., Lutz, Y., Tora, L., Pierrat, B., Heery, D., Gronemeyer, H., Chambon, P., and Losson, R. (1995). The N-terminal part of TIF1, a putative mediator of the ligand dependent activation function (AF-2) of nuclear receptor, is fused to B-raf in the oncogenic protein T18. EMBO J. 14,2020-2033. Lee, C. (1996). Role of androgen in prostate growth and regression: Stromal-epithelial interaction. Prostate, Suppl. 6,52-56. Leek, R. D., KaMamanis, L., Pezzella, F., Gatter, K. C., and Harris, A. L. (1994). bcl-2 in normal human breast and carcinoma, association with oestrogen receptor-positive, epidermal growth factor receptor-negative tumours and in situ cancer. BK J. Cancer 69,135-139. Leger, J. G., Montpetit, M. L., and Tenniswood, M. P. (1987). Characterization and cloning of androgen-repressed mRNAs from rat ventral prostate. Biochem. Biophys. Res. Commun. 147,196-203. Lepor, H., Williford, W. O., Barry, M. J., Brawer, M. K., Dixon, C. M., Gormley, G., Haakenson, C., Machi, M., Narayan, P., and Padley, R. J. (1996). The efficacy of terazosin, finasteride, or both in benign prostatic hyperplasia. Veterans Affairs Cooperative Studies Benign Prostatic Hyperplasia Study Group. N. Engl. J. Med. 335,533-539. Levine, A. C., Wang, J. P., Ren, M., Eliashvili, E., Russell, D. W., and Kirschenbaum, A. (1996). Immunohistochemical localization of steroid 5 alpha-reductase-2 in the human male fetal reproductive tract and adult prostate. J. Clin. Endocrinol. Metab. 81, 384-389. Liang, T., and Liao, S. (1975). Avery rapid effect of androgen on initiation of protein synthesis in prostate. Proc. Natl. Acad. Sei. U.S.A. 72,706-709. Liang, T., and Liao, S. (1992). Inhibition of steroid 5cu-reductase by specific aliphatic unsaturated fatty acids. Biochem. J. 285,557-562. Liang, T., and Liao, S. (1997). Growth suppression of hamster flank organs by topical application of g-linolenic and other fatty acid inhibitors of 5a-reductase. J. Invest. Dermatol. 109, 152-157. Liang, T., Casteiieda, E., and Liao, S. (1977). Androgen and initiation of protein synthesis in the prostate. J. Biol. Chem. 252,5692-5700. Liang, T., Mezetti, G., Chen, C., and Liao, S. (1978). Selective polyamine-binding proteins: Spermine binding by an androgen-sensitive phosphoprotein. Biochim. Biophys. Acta 542,430-441. Liang, T., Hoyer, S.,Yu, R., Soltani, K., Lorincz, A. L., Hiipakka, R. A., and Liao, S. (1993). Immunocytochemical localization of androgen receptors in human skin using monoclonal antibodies against the androgen receptor. J. Invest. Dermatol. 100,663-666.
292
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Liao, S. (1965). Influence of testosterone on template activity of prostatic ribonucleic acids. J. Biol. Chem. 240,1236-1243. Liao, S. (1975). Cellular receptors and mechanisms of action of steroid hormones. Znt. Reu. Cytol. 41,87-172. Liao, S., and Fang, S. (1969). Receptor-proteins for androgens and the mode of action of androgens on gene transcription in ventral prostate. Vitam. Horm. (N.W 27,17-90. Liao, S., and Hiipakka, R. A. (1995). Selective inhibition of steroid 5a-reductase isozymes by tea epicatechin-3-gallate and epigallocatechin-3-gallate.Biochem. Biophys. Res. Commun. 214,833-838. Liao, S., and Williams-Ashman, H. G. (1962). An effect of testosterone on amino acid incorporation by prostatic ribonucleoprotein particles. Proc. Natl. Acad. Sci. U.S.A.48, 1956-1964. Liao, S., Leininger, K. R., Sagher, D., and Barton, R. W. (1965). Rapid effect oftestosterone on ribonucleic acid polymerase activity of rat ventral prostate. Endocrinology (Baltimore) 77, 763-765. Liao, S., Liang, T., Fang, S., Castaneda, E., and Shao, T. (1973a). Steroid structure and androgenic activity: Specificity involved in the receptor binding and nuclear retention of various androgens. J. Biol. Chem. 248,6154-6162. Liao, S., Liang, T., and Tymoczko, J. (1973b). Ribonucleoprotein binding of steroid-"receptor" complexes. Nature (London), New Biol. 241,211-213. Liao, S., Howell, D. K., and Chang, T.-M. (1974). Action of a nonsteroidal antiandrogen, flutamide, on receptor binding and nuclear retention of 5a-dihydrotestosterone in rat ventral prostate. Endocrinology 94,1205-1209. Liao, S., Tymoczko, J. L., Casteneda, E., and Liang, T.(1975j.Androgen receptors and androgen-dependent initiation of protein synthesis in the prostate. Vitam. Horm. (N.Y ) 33,297-318. Liao, S., Smythe, S., Tymoczko, J., Rossini, G. P., Chen, C., and Hiipakka, R. A. (1980). RNA-dependent release of androgen and other steroid receptor complexes from DNA. J. Biol. Chem. 245,5545-5551. Liao, S., Chen, C., and Huang, I.-Y. (1982). Prostate a-protein: Complete amino acid sequence of the component that inhibits nuclear retention of AR complex. J. Biol. Chem. 267,122-125. Lim, J., Ghadessy, F. J., and Yong, E. L. (1997). A novel splice site mutation in the androgen receptor gene results in exon skipping and a non-functional truncated protein. Mol. Cell. Endocrinol. 131,205-210. Lin, M.-F., and Clinton, G. M. (1986). Human prostatic acid phosphatase has phosphotyrosy1 protein phosphatase activity. Biochem. J. 235,351-357. Lin, M.-F., and Garcia-Arenas, R. (1994). Effect of cell density on androgen regulation of the mRNA level of human prostatic acid phosphatase. Mol. Cell. Endocrinol. 99, R2 1-R24. Lin, M.-F., and Meng, T. C. (1996). Tyrosine phosphorylation of a 185 kDa phosphoprotein (pp185) inversely correlates with the cellular activity of human prostatic acid phosphatase. Biochem. Biophys. Res. Commun. 226,206-213. Lin, M.-F., and Meng, T. C. (1997). Prostatic acid phosphatase may down-regulate tyrosine phosphorylation of c-ErbB-2/Neu oncoprotein in human prostate carcinoma cells. Schilling Res. Conb: Horm. Cancer, Santa Cruz, CA, Abstract. Lin, M.-F., Lee, C.-L., and Clinton, G. M. (1986). Tyrosyl kinase activity is inversely related to prostatic acid phosphatase activity in two human prostate carcinoma cell lines. Mol. Cell. Biol. 6,4753-4757. Lin, M . 3 , DeVolio, J., and Garcia-Arenas, R. (1992). Expression of human prostatic acid
MOLECULARACTION OF ANDROGEN
293
phosphatase activity and the growth of prostate carcinoma cells. Cancer Res. 52, 4600-4607. Lin, M.-F., Meng, T. C., Rao, P. S., Chang, C., Schonthal, A. H., and Lin, F.-F. (1998). Expression of human prostatic acid phosphatase correlates with androgen-stimulated cell proliferation in prostate cancer cell lines. J. Biol. Chem. 273,5939-5947. Lindzey, J., Grossman, M., Kumar, M. V., and Tindall, D. J. (1993). Regulation of the 5’flanking region of the mouse androgen receptor gene by CAMPand androgen. Mol. Endocrinol. 7,1530-1540. Lipponen, P., and Vesalainen, S. (1997). Expression of the apoptosis suppressing protein bcl-2 in prostatic adenocarcinoma is related to tumor malignancy. Prostate 32,9-15. Liu, X.-H., Wiley, H. S., and Meike, A. W. (1993). Androgens regulate proliferation of human prostate cancer cells in culture by increasing transforming growth factor-cx (TGF-a) and epidermial growth factor (EGF)/TGF-cxreceptor. J. Clin. Endocrinol. Metab. 77,1472-1478. Lobaccaro, J . M., Lumbroso, S., Poujol, N., Georget, V., Brinkmann, A. O., Malpuech, G., and Sultan, C. (1995). Complete androgen insensitivity syndrome due to a new frameshik deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor. Mol. Cell. Endocrinol. 111,21-28. Loreni, F., Stavenhagen, J., Kalff, M., and Robins, D. M. (1988).Acomplex androgen-responsive enhancer resides 2 kilobases upstream of the mouse Slp gene. Mol. Cell. Biol. 8,2350-2360. Lubahn, D. B., Joseph, D. R., Sar, M., Tan, J., Higgs, H. N., Larson, R. E., French, F. S., and Wilson, E. (1988a). The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in the prostate. Mol. Endocrinol. 2,1265-1275. Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French, F. S., and Wilson, E. M. (1988b). Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 240,327-330. Lubahn, D. B., Brown, T. R., Simental, J. A., Higgs, H. N., Migeon, C. J., Wilson, E. M., and French, F. S. (1989). Sequence of the intron/exon junctions of the coding re.egion of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc. Natl. Acad. Sci. U.S.A. 86, 9534-9538. Lucas, P. C., and Granner, D. K. (1992). Hormone response domains in gene transcription. Annu. Rev. Biochem. 61,1131-1173. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Science 352,497-505. Mader, S., Kumar, V., de Verneuil, H., and Chambon, P. (1989). Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature (London) 338,271-274. Magi-Galluzzi, C., Xu, X., Hlatky, L., Hahnfeldt, P., Kaplan, I., Hsiao, P., Chang, C., and Loda, M. (1997). Heterogeneity of androgen receptor content in advanced prostate cancer. Mod. Pathol. 10,839-845. Mahendroo, M. S., Cala, K. M., Landrum, D. P., and Russell, D. W. (1997). Fetal death in mice lacking 5alpha-reductase type 1caused by estrogen excess. Mol. Endocrinol. 11, 917-927. Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR heterodimers and orphan receptors. Cell (Cambridge, Mass.) 83,841-850. Marcelli, M., Tilley, W. D., Wilson, C. M., Griffin, J . E., Wilson, J. D., and McPhaul, M. J.
294
JOHN M. KOKONTIS AND SHUTSUNG LIAO
(1990). Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: Premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol. Endocrinol. 4, 1105-1116. Marivoet, S., Van Dijck, P., Verhoeven, G., and Heyns, W. (1992). Interaction of the 90 kDa heat shock protein with native and in vitro translated androgen receptor and receptor fragments. Mol. Cell. Endocrinol. 88,165-174. Matuo, Y., Adams, P. S., Nishi, N., Yasumitsu, H., Crabb, J. W., Matusik, R. J., and McKeehan, W. L. (1989). The androgen-dependent rat prostate protein, probasin, is a heparin-binding protein that co-purifies with heparin-binding growth factor-1. In Vitro Cell Dev. Biol. 25,581-584. McConkey, D. J., Greene, G., and Pettaway, C. A. (1996). Apoptosis resistance increases with metastatic potential in cells of the human LNCaP prostate carcinoma line. Cancer Res. 56,5594-5599. McDonnell, T. J., Troncoso, P., Brisbay, S. M., Logothetis, C., Chung, L. W. K., Hsieh, J.-T., Tu,S.-M., and Campbell, M. L. (1992). Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res. 52,6940-6944. McEwen, I. J., and Gustafsson, J.-A. (1997). Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF. Proc. Natl. Acad. Sci. U.S.A. 94,8485-8490. McInerney, E. M., Tsai, M. J., O’Malley, B. W., and Katzenellenbogen, B. S. (1996).Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc. Natl. Acad. Sci. U.S.A. 93, 10069-10073. McPhaul, M. J., Marcelli, M., Zoppi, S., Wilson, C. M., Griffin, J. E., and Wilson, J. D. (1992). Mutations in the ligand-binding domain of the androgen receptor gene cluster in two regions of the gene. J. Clin. Invest. 90,2097-2101. McPhaul, M. J., Marcelli, M., Zoppi, S., Griffin, J. E., and Wilson, J. D. (1993). Genetic basis of endocrine disease 4. The spectrum of mutations in the androgen receptor gene that causes androgen resistance. J. Clin. Endocrinol. Metab. 76,17-23. Mendel, C. M. (1989). The free hormone hypothesis: a physiologically based mathematical model. Endocl: Rev. 10,232-274. Mertens, H., Heineman, M., Koudstaal, J., Theunissen, P., and Evers, J. (1996). Androgen receptor content in human endometrium. Eul: J . Obstet. Gynecol. Reprod. Biol. 70,ll-13. Metcalf, B. W., Levy, M. A., and Holt, D. A. (1989). Inhibitors of steroid 5wreductase in benign prostatic hyperplasia, male pattern baldness and acne. ?Fends Pharmacol. 10,491-495. Mhatre, A. N., Trifiro, M. A., Kaufman, M., Kazemi-Esfarjani, P., Figlewicz, D., Rouleau, G., and Pinsky, L. (1993). Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbarmuscular atrophy. Nut. Genet. 5, 184-188. Miesfeld, R., Rusconi, S., Godowski, P. J., Maler, B. A., Okret, S., Wikstrom, A.-C., Gustafsson, J.-A., and Yamamoto, K. R. (1986). Genetic complementation of a glucocorticoid receptor deficiency by expression of a cloned receptor cDNA. Cell (Cambridge, Mass.) 46,389-399. Mills, J. S., Needham, M., and Parker, M. G. (1987). Androgen regulated expression of a spermine binding protein in mouse ventral prostate. Nucleic Acids Res. 15, 7709-7724. Mizokami, A., and Chang, C. (1994). Induction of translation by the 5’-untranslated region of human androgen receptor mRNA. J. Biol. Chem. 269,25655-25659.
MOLECULAR ACTION OF ANDROGEN
295
Mizokami, A., Yeh, S.-Y., and Chang, C. (1994). Identification of 3‘, 5’-cyclic adenosine monophosphate response elements in the human androgen receptor gene promoter. Mol. Endocrinol. 8,77-88. Moguilewsky, M., and Bouton, M. M. (1988). How the study of the biological activities of antiandrogens can be oriented towards the clinic. J. Steroid Biochem. 31, 699-710. Mohler, J. L., Sharief, Y., Elwady, M., Quigley, C. A., Schalken, J. A., Wilson, E. A., and French, F. S. (1993). Do androgen receptor mutations have a role in androgen inde7thAnn. Meet. Soc. Basic Uro. Res., San Antonio, pendent prostatic carcinoma? PFOC. TX, Abstract. Montgomery, B. T., Young, C. Y., Bilhartz, D. L., Andrews, P. E., Prescott, J. L., Thompson, N. F., and Tindall, D. J. (1992). Hormonal regulation of prostate-specific antigen (PSA) glycoprotein in the human prostatic adenocarcinoma cell line, LNCaP. Prostate 21,63-73. Mora, G. R., and Mahesh, V. B. (1996). Autoregulation of androgen receptor in rat ventral prostate: Involvement of c-fos as a negative regulator. Mol. Cell. Endocrinol. 124, 111-120. Mora, G. R., Prins, G. S., and Mahesh, V. B. (1996).Autoregulation of androgen receptor protein and messenger RNA in rat ventral prostate is protein synthesis dependent. J. Steroid Biochem. Mol. B i d . 58,539-549. Mordacq, J. C., and Linzer, D. I. H. (1989). Co-localization of elements required for phorbol ester stimulation and glucocorticoid repression of proliferin gene expression. Genes Deu. 3,760-769. Morris, J. M. (1953).The syndrome of testicular feminization in male pseudohermaphrodites. Am. J. Obstet. Gynecol. 65, 1192-1211. Mueller, G. C., Gorski, J., and Aizawa,Y. (1961).The role of protein synthesis in early estrogen action. Proc. Natl. Acad. Sci. U.S.A. 47,164-169. Muir, G. H., Wooster, R., Shearer, R. J., Fisher, C., Dearnaley, D. I?, and Stratton, M. R. (1994). The androgen receptor gene in relapsed prostate cancer. Proc. 8th Ann. Meet. Soc. Basic Urol. Res., San Francisco, Abstract. Murdoch, F. E., and Gorski, J. (1991). The role of ligand in estrogen receptor regulation of gene expression. Mol. Cell. Endocrinol. 78, C103-C108. Murtha, P., Tindall, D. J., and Young, C. Y. (1993). Androgen induction of a human prostate-specific kallikrein, hKLK2: Characterization of a n androgen response element in the 5’ promoter region of the gene. Biochemistry 32,6459-6464. Nakada, S. Y., di Sant’Agnese, P. A., Moynes, R. A., Hiipakka, R. A., Liao, S., Cockett, A. T., and Abrahamsson, P. A. (1993).The androgen receptor status of neuroendocrine cells in human benign and malignant prostatic tissue. Cancer Res. 53, 1967-1970. Nakhla, A. M., Romas, N. A., and Rosner, W. (1997). Estradiol activates the prostate androgen receptor and prostate-specific antigen secretion through the intermediacy of sex hormone-binding globulin. J.Biol. Chem. 272, 6838-6841. Namer, M. (1988). Clinical applications of antiandrogens. J. Steroid Biochem. 31, 719-729. Nastiuk, K. L., and Clayton, D. F. (1994). Seasonal and tissue-specific regulation of canary androgen receptor messenger RNA. Endocrinology (Baltimore) 134, 640-649. Nazareth, L. V., and Weigel, N. L. (1996). Activation of the human androgen receptor through a protein kinase A signaling pathway. J.Biol. Chem. 271,19900-19907. Nelson, S. A,, and Robins, D. M. (1997). Two distinct mechanisms elicit androgen-dependent expression of the mouse sex-limited protein gene. Mol. Endocrinol. 11,460-469. Nemeth, J. A., Sensibar, J. A., White, R. R., Zelner, D. J., Kim, I. Y., and Lee, C. (1997). Prostatic ductal system in rats: Tissue-specific expression and regional variation in stromal distribution of transforming growth factor-beta 1. Prostate 33,64-71.
296
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Nemoto, T., Ohara-Nemoto, Y., and Ota, M. (1992).Association of the 90-kDa heat shock protein does not affect the ligand-binding ability of androgen receptor. J. Steroid Biochem. Mol. Biol. 42, 803-812. Nemoto, T., Ohara-Nemoto, Y., Sato, N., and Ota, M. (1993). Dual roles of 90-kDa heat shock protein in the function of the mineralocorticoid receptor. J. Biochem. (Tokyo) 113,769-775. Neri, R., Peets, E., and Watnick, A. (1979). Anti-androgenicity of flutamide and its metabolite Sch 16423. Biochem. SOC.Duns. 7,565-569. Neubauer, B. L., Chung, L. W., McCormick, K. A., Taguchi, O., Thompson, T. C., and Cunha, G. R. (1983). Epithelial-mesenchymal interactions in prostatic development. 11. Biochemical observations of prostatic induction by urogenital sinus mesenchyme in epithelium of the adult rodent urinary bladder. J. Cell Biol. 96, 1671-1676. Neuschmid-Kaspar, F., Gast, A., Peterziel, H., Schneikert, J., Muigg, A., Ransmayr, G., mocker, H., Bartsch, G., and Cato, A. C. (1996). GAG-repeat expansion in androgen receptor in Kennedy’s disease is not a loss of function mutation. Mol. Cell. Endocrinol. 117,149-156. Newmark, J. R., Hardy, D. O., Tonb, D. C., Carter, B. S., Epstein, J. I., Isaacs, W. B., Brown, T. R., and Barrack, E. R. (1992).Androgen receptor gene mutations in human prostate cancer. Proc. Natl. Acad. Sci. U.S.A.89,6319-6323. Newton, S. K., Buric, R., Trapp, T., Brockmeier, S., Pagotto, U., and Stalla, G. K. (1994). The unliganded estrogen receptor (ER) transduces growth factor signals. J. Steroid Biochem. Mol. Biol. 48,481-486. Nicholson, D. W., and Thornberry, N. A. (1997). Caspases: Killer proteases. Dends Biol. Sci. 22,299-306. Nieh, P. T. (1995). Withdrawal phenomenon with the antiandrogen casodex. J . Urol. 163, 1070-1072. Nishi, N., Oya, H., Matsumoto, K., Nakamura, T., Miyanaka, H., and Wada, F. (1996). Changes in gene expression of growth factors and their receptors during castrationinduced involution and androgen-induced regrowth of rat prostates. Prostate 28, 139-152. Noordzij, M. A., Bogdanowicz,J. F., van Krimpen, C., van der Kwast, T. H., and van Steenbrugge, G. J. (1997). The prognostic value of pretreatment expression of androgen receptor and bcl-2 in hormonally treated prostate cancer patients. J. Urol. 158, 1880-1884. Normington, K., and Russell, D. W. (1992). Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions. J. Biol. Chern. 267, 19548-19554. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996). The transcriptional coactivator p300 and CBP are histone acetyltransferases. Cell (Cambridge, Mass.) 87,953-960. Olea, N., Sakabe, K., Soto, A. M., and Sonnenschein, C. (1990). The proliferative effect of “anti-androgens” on the androgen-sensitive human prostate tumor cell line LNCAJ?. Endocrinology (Baltimore) 126, 1457-1463. Ofiate, S. A., Tsai, S. Y.,Tsai, M.-J., and O’Malley, B. W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357. Orphanides, G.,Lagrange, T., and Reinberg, D. (1996).The general transcription factors of RNA polymerase 11. Genes Dev. 10,2657-2683. Otten, A. D., Sanders, M. M., and McKnight, G. S. (1988). The MMTV LTR promoter is induced by progesterone and dihydrotestosterone but not by estrogen. Mol. Endocrinol. 2, 143-147.
MOLECULAR ACTION OF ANDROGEN
297
Packham, G., and Cleveland, J. L. (1995). c-Myc and apoptosis. Biochim. Biophys. Acta 1242,ll-28. Page, M. J., and Parker, M. G. (1982). Effect of androgen on the transcription of rat prostatic binding protein genes. Mol. Cell. Endocrinol. 27,343-355. Palmberg, C., Koivisto, P., Hyytinen, E., Isola, J., Visakorpi, T., Kallioniemi, 0. P., and Tammela, T. (1997). Androgen receptor gene amplification in a recurrent prostate cancer after monotherapy with the nonsteroidal potent antiandrogen Casodex (bicalutamide) with a subsequent favorable response to maximal androgen blockade. Eur. Urol. 31,216-219. Palvimo, J. L., Kallio, P. J., Ikonen, T., Mehto, M., and Janne, 0.A. (1993). Dominant negative regulation of trans-activation by the rat androgen receptor: Roles of the N-terminal domain and heterodimer formation. Mol. Endocrinol. 7,1399-1407. Palvimo, J. J., Reinikainen, P., Ikonen, T., Kallio, P. J., Moilanen, A., and Janne, 0. A. (1996). Mutual transcriptional interference between RelA and androgen receptor. J. Biol. Chem. 271,24151-24156. Parker, M. G., and Scrace, G. T. (1978). The androgenic regulation of abundant mRNA in rat ventral prostate. Eur. J. Biochem. 85,399-406. Parker, M. G., Webb, P., Needham, M., White, R., and Ham, J. (1987). Identification of androgen response elements in mouse mammary tumour virus and the rat prostate C3 gene. J. Cell. Biochem. 35,285-292. Payson, R. A., Wu, J., Liu, Y., and Chi,, I. M. (1996). The human FGF-8 gene localizes on chromosome 10q24 and is subjected to induction by androgen in breast cancer cells. Oncogene 13,47-53. Payvar, F., DeFranco, D., Firestone, G. L., Edgar, B., Wrang, O., Okret, S., Gustafsson, J.-A., and Yamamoto, K. R. (1983). Sequence-specific binding of glucocorticoid receptor to MTV DNA a t sites within and upstream of the transcribed region. Cell (Cambridge, Mass.) 35,381. Perry, J. E., and Tindall, D. J. (1996). Androgens regulate the expression of proliferating cell nuclear antigen posttranscriptionally in the human prostate cancer cell line, LNCaP. Cancer Res. 66,1539-1544. Peterziel, H., Culig, Z., Stober, J., Hobisch, A., Radmayr, C., Bartsch, G., Klocker, H., and Cato, A. C. (1995). Mutant androgen receptors in prostatic tumors distinguish between amino-acid-sequence requirements for transactivation and ligand binding. Int. J. Cancer 63,544-550. Petra, P. H. (1991). The plasma sex steroid binding protein (SBP or SHBP): A critical review of recent developments on the structure, molecular biology and function. J. Steroid Biochem. Mol. Biol. 40,735-753. Pfahl, M. (1993). Nuclear receptor/AP-1 interaction. Endocr. Rev. 14,651-658. Pinsky, L., Mhatre, A. N., and Kazemi-Esfarjani, P. (1992). Spinal and bulbar muscular atrophy (SBMA): Characterization of mutant androgen receptors having an amplified polyglutamine tract. Am. J. Hum. Genet. 51, A41. Pollack, R., and Treisman, R. (1990). A sensitive method for the determination of proteinDNA binding specificities. Nucleic Acids Res. 18, 6197-6204. Pongratz, I., Mason, G. G. F., and Poellinger, L. (1992). Dual roles of the 90-kDa heat shock protein hsp9O in modulating functional activities of the dioxin receptor. J. Biol. Chem. 267,13728-13734. Power, R. F., Lydon, J. P., Conneely, 0. M., and OMalley, B. W. (1991a). Dopamine activation of an orphan of the steroid receptor superfamily. Science 252, 1546-1548. Power, R. F., Mani, S. K., Codina, J., Conneely, 0. M., and O'Malley, B. W. (1991b). Dopaminergic and ligand-independent activation of steroid hormone receptors. Science 254,1636-1639.
298
JOHN M. KOKONTISAND SHUTSUNG LIAO
Prins, G. S., and Woodham, C. (1995). Autologous regulation of androgen receptor messenger ribonucleic acid in the separate lobes of the rat prostate gland. Biol. Reprod. 53,609-619. Prins, G. S., Birch, L., and Greene, G. L. (1991).Androgen receptor localization in different cell types of the adult rat prostate. Endocrinology (Baltimore) 129,3187-3199. Prodromou, C., Roe, S. M., Piper, P. W., and Pearl, L. H. (1997). Amolecular clamp i n the crystal structure of the N-terminal domain of the yeast Hsp9O chaperone. Nat. Struct. Biol. 4,477-482. Pugh, B. F., and Tjian, R. (1991). Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes Den 5, 1935-1945. Quarmby, V. E., Beckman, W. C., Wilson, E. M., and French, F. S. (1987). Androgen regulation of c-myc messenger ribonucleic acid levels in rat ventral prostate. Mol. Endocrinol. 1, 865-874. Quarmby, V. E., Yarbrough, W. G., Lubahn, D. B., French, F. S., and Wilson, E. M. (1990). Autologous down-regulation of androgen receptor messenger ribonucleic acid, Mol. Endocrinol. 4,22-28. Quigley, C. A., Evans, B. A., Simental, J. A., Marschke, K. B., Sar, M., Lubahn, D. B., Davies, P., Hughes, I. A., Wilson, E. M., and French, F. S. (1992a). Complete androgen insensitivity due to deletion of exon C of the androgen receptor gene highlights the functional importance of the second zinc finger of the androgen receptor in vivo. Mol. Endocrinol. 6, 1103-1112. Quigley, C. A., Friedman, K. J.,Johnson, A., Lafreniere, R. G., Silverman, L. M., Lubahn, D. B., Brown, T. R., Wilson, E. M., Willard, H. F., and French, F. S. (1992b). Complete deletion of the androgen receptor gene: Definition of the null phenotype of the androgen insensitivity syndrome and determination of carrier status. J. Clin. Endocrinol. Metab. 74,927-933. Quigley, C. A., De Bellis, A., Marschke, K. B., el-Awady, M. K., Wilson, E. M., and French, F. S. (1995). Androgen receptor defects: Historical, clinical, and molecular perspectives. Endocr. Rev. 16,271-321. published erratum: No. 4, p. 546. Raffo, A. J., Perlman, H., Chen, M.-W., Day, M. L., Streitman, J . S., and Buttyan, R. (1995). Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in viuo. Cancer Res. 55,4438-4445. Randall, V. A. (1994). Role of 5 alpha-reductase in health and disease. Baillieres Clin. Endocrinol. Metab. 8,405-431. Reed, J. C. (1997). Bcl-2 family proteins and the hormonal control of cell life and death in normalcy and neoplasia. Vitam. Horm. (N.Y) 53,99-138. Reinikainen, I?, Palvimo, J. J., and Janne, 0. (1996). Effects of mitogens on androgen receptor-mediated transactivation. Endocrinology (Baltimore) 137,4351-4357. Renaud, J. P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the RAR-gamma ligand-binding domain bound to alltrans retinoic acid. Nature (London) 378,681-689. Rennie, P. S., Bruchovsky, N., Buttyan, R., Benson, M., and Cheng, H. (1988). Gene expression during the early phases of regression of the androgen-dependent Shionogi mouse mammary carcinoma. Cancer Res. 48,6309-6312. Rennie, P. S., Bruchovsky, N., Leco, K. J., Sheppard, P. C., McQueen, S. A., Cheng, H., Snoek, R., Hamel, A., Bock, M. E., MacDonald, B. S., Nickel, B. E., Chang, C., Liao, S., Cattini, I? A., and Matusik, R. J. (1993). Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol. Endocrinol. 7, 23-36. Rennie, P., Bruchovsky, N., Akakura, K., Goldenberg, S., Otal, N., Akakura, S., Wong, P.,
MOLECULAR ACTION OF ANDROGEN
299
and Tenniswood, M. (1994). Effect of tumour progression on the androgenic regulation of the androgen receptor, TRPM-2 and YPTl genes in the Sionogi carcinoma. J. Steroid Biochem. Mol. Biol. 50, 31-40. Riegman, P. H., Vlietstra, R. J., van der Korput, H. A., Romijn, J. C., and Trapman, J . (1991a). Identification and androgen-regulatedexpression of two major human glandular kallikrein-1 (hGK-1) mRNA species. Mol. Cell. Endocrinol. 76,181-190. Riegman, P. H. J., Vietstra, R. J., van der Korput, J. A. G. M., Brinkman, A. O., and Trapman, J. (1991b). The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol. Endocrinol. 5, 1921-1930. Rijnders, A. W. M., van der Korput, J. A. G. M., van Steenbrugge, G. J., Romijn, J . C., and Trapman, J. (1985). Expression of cellular oncogenes in human prostatic carcinoma cell lines. Biochem. Biophys. Res. Commun. 132,548-554. Ris-Stalpers, C., Kuiper, G. G., Faber, P. W., Schweikert, H. U., van Rooij, H. C., Zegers, N. D., Hodgins, M. B., Degenhart, H. J., Trapman, J., and Brinkmann, A. 0. (1990). Aberrant splicing of androgen receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity. Proc. Natl. Acad. Sci. U.S.A.87,7866-7870. Roche, I? J., Hoare, S. A., and Parker, M. G. (1992). Aconsensus DNA-binding site for the androgen receptor. Mol. Endocrinol. 6,2229-2235. Rokhlin, 0 .W., Bishop, G. A., Hostager, B. S.,Waldschmidt, T.J.,Sidorenko, S. P., Pavloff, N., Kiefer, M. C., Umansky, S. R., Glover, R. A., and Cohen, M. B. (1997). Fas-mediated apoptosis in human prostatic carcinoma cell lines. Cancer Res. 57,1758-1768. Rowley, D. R., Dang, T. D., Larsen, M., Gerdes, M. J., McBride, L., and Lu, B. (1995). Purification of a novel protein (ps20) from urogenital sinus mesenchymal cells with growth inhibitory properties in vitro. J. Biol. Chem. 270,22058-22065. Rubin, J. S., Bottaro, D. P., ChBdid, M., Miki, T., Ron, D., Cunha, G. R., and Finch, P. W. ( 1995). Keratinocyte growth factor as a cytokine that mediates mesenchymal-epithelial interaction. EXS 74, 191-214. Ruizeveld de Winter, J. A., Trapman, J.,Vermey, M., Mulder, E., Zegers, N. D., and van der Kwast, T. H. (1991). Androgen receptor expression in human tissues: An immunohistochemical study. J. Histochem. Cytochem. 39,927-936. Ruizveld de Winter, J . A., van Weerden, W. M., Faber, P. W., van Steenbrugge, G. J., Trapman, J., Brinkmann, A. O., and ven der Kwast, T. H. (1992). Regulation of androgen receptor expression in the human heterotransplantable prostate carcinoma PC-82. Endocrinology (Baltimore) 131,3045-3050. Ruizeveld de Winter, J. A,, Janssen, P. J. A., Sleddens, H. M. E. B., Verleun-Mooijman, M. C. T., Trapman, J., Brinkmann, A. O., Santerse, A. B., Schroder, F. H., and van der Kwast, T. H. (1994). Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am. J. Pathol. 144,735-746. Russell, D. W., and Wilson, J. D. (1994). Steroid 5a-reductase: Two genedtwo enzymes. Annu. Rev. Biochem. 63,25-61. Russell, D. W., Berman, D. M., Bryant, J. T., Cala, K. M., Davis, D. L., Landrum, C. P., Prihoda, J. S., Silver, R. I., Thigpen, A. E., and Wigley, W. C. (1994). The molecular genetics of steroid 5 alpha-reductases. Recent Prog. Horm. Res. 49,275-284. Sadi, M. V., and Barrack, E. R. (1993). Image analysis of androgen receptor immunostaining in metastatic prostate cancer. Cancer (Philadelphia) 71,2574-2580. Sadi, M. V., Walsh, P. C., and Barrack, E. R. (1991). Immunohistochemical study of androgen receptors in metastatic prostate cancer. Cancer (Philadelphia) 71, 3057-3064. Saito, H., Kasayama, S., Kouhara, H., Matsumoto, K., and Sato, B. (1991). Up-regulation
300
JOHN M. KOKONTIS AND SHUTSUNG LIAO
of fibroblast growth factor receptor mRNA levels by basic FGF or testosterone in androgen-sensitive mouse mammary tumor cells. Biochem. Biophys. Res. Commun. 174,136-141. Sandford, N. L., Searle, J. W., and Kerr, J. F. R. (1984). Successive waves of apoptosis in the rat ventral prostate after repeated withdrawal of testosterone stimulation. Pathology 16,406-410. Sato, B., Kouhara, H., Koga, M., Kasayama, S., Saito, H., Sumitani, S., Hashimoto, K., Kishimoto, K., Tanaka, A., and Matsumoto, K. (1993).Androgen-induced growth factor and its receptor: Demonstration of the androgen-induced autocrine loop in mouse mammary carcinoma cells. J. Steroid Biochem. Mol. Biol. 47,91-98. Sato, N., Watabe, Y., Suzuki, H., and Shimazaki, J. (1993). Progression of androgen-sensitive mouse tumor (Shionogi carcinoma 115) to androgen-insensitive tumor after long-term removal of testosterone. Jpn. J. Cancer Res. 84,1300-1308. Sato, N., Gleave, M. E., Bruchovsky, N., Rennie, P. S., Goldenberg, S. L., Lange, P. H., and Sullivan, L. D. (1996). Intermittent androgen suppression delays progression to androgen-independent regulation of prostate-specific antigen gene in the LNCaP prostate tumour model. J. Steroid Biochem. Mol. Biol. 58, 139-146. Sato, N., Sadar, M. D., Bruchovsky, N., Saatcioglu, F., Rennie, P. S., Sato, S., Lange, P. H., and Gleave, M. E. (1997). Androgenic induction of prostate-specific antigen gene is repressed by protein-protein interaction between the androgen receptor and Apl/c-Jnn in the human prostate cancer cell line LNCaP. J. Biol. Chem. 272, 17485-17494. Scarlett, C . O., and Robins, D. M. (1995). In uiuo footprinting of an androgen-dependent enhancer reveals an accessory element integral to hormonal response. Mol. Endocrinol. 9,413-423. Scarlett, C. O., Scheller, A., Thompson, E., and Robins, D. M. (1997). Involvement of an octamer-like sequence within a crucial region of the androgen-dependent Slp enhancer. DNA Cell Biol. 16,45-57. Scheidereit, C., Geisse, S., Westphal, H. M., and Beato, M. (1983). The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature (London) 304,149-752. Scher, H. I., and Kolvenbag, J. G. (1997). The antiandrogen withdrawal syndrome in relapsed prostate cancer. Eur. Urol. 31 (Suppl. 2),3-7. Scher, H. I., and Kelly, W.K. (1993). Flutamide withdrawal syndrome: Its impact on clinical trials in hormone refractory prostate cancer. J . Clin. Oncol. 11, 1566-1572. Schmitt, J. F., Hearn, M. T., and Risbridger, G. P. (1996). Expression of fibroblast growth factor-8 in adult rat tissues and human prostate carcinoma cells. J. Steroid Biochem. Mol. Biol. 57, 173-178. Schoenberg, M. P., Hakimi, J. M., Wang, S., Bova, G. S., Epstein, J. I., Fischbeck, K. H., Isaacs, W. B., Walsh, P. C., and Barrack, E. R. (1994). Microsatellite mutation (CAG24 -+ 18) in the androgen receptor gene in human prostate cancer. Biochem. Biophys. Res. Commun. 198,74-80. Schule, R., Rangarajan, P., Kliewer, S., Ransone, L. J., Bolado, J., Yang, N., Verma, I. M., and Evans, R. M. (1990). Functional antagonism between oncoprotein c-jun and the glucocorticoid receptor. Cell (Cambridge, Mass.) 62,1217-1226. Schuurmans, A. L. G., Bolt, J., Voorhorst, M. M., Blankenstein, R. A., and Mulder, E. (1988). Regulation of growth and epidermal growth factor receptor levels of LNCaP prostate tumor cells by different steroids. Int. J. Cancer 42,917-922. Schuurmans, A. L. G., Bolt, J., Veldscholte, J., and Mulder, E. (1990). Stimulatory effects of antiandrogens on LNCaP human prostate tumor cell growth, EGF-receptor level and acid phosphatase secretion. J. Steroid Biochem. Mol. Biol. 37,849-853.
MOLECULAR ACTION OF ANDROGEN
301
Schwabe, J. W. R., Neuhaus, D., and Rhodes, D. (1990). Solution structure of the DNAbinding domain of the oestrogen receptor. Nature (London) 348,458-461. Sciavolino, P. J., Abrams, E. W., Yang, L., Austenberg, L. P., Shen, M. M., and Abate-Shen, C. (1997).Tissue-specific expression of murine Nkx3.1 in the male urogenital system. Deu. Dyn. 209,127-138. Sells, S. F., Wood, D. P., Jr., Joshi-Barve, S. S., Muthukumar, S., Jacob, R. J., Crist, S. A., Humphreys, S., and Rangnekar, V. M. (1994). Commonality of the gene programs induced by effectors of apoptosie in androgen-dependent and -independent prostate cells. Cell Growth Differ.5,457-466. Sells, S . F., Han, S. S., Muthukkumar, S., Maddiwar, N., Johnstone, R., Boghaert, E., Gillis, D., Liu, G., Nair, P., Monnig, S., Collini, P., Mattson, M. P., Sukhatrne, V. P., Zimmer, S. G., Wood, D. P. J., McRoberts, J. W., Shi,Y., and Rangnekar, V. M. (1997). Expression and function of the leucine zipper protein Par-4 in apoptosis. Mol. CeZZ. Biol. 17,3823-3832. Semenza, G. L. (1994). Transcriptional regulation of gene expression: Mechanisms and pathophysiology. Hum. Mutat. 3,180-199. Shan, L., Rodriguez, M. C., and Janne, 0.A. (1990). Regulation of androgen receptor protein and mRNA concentrations by androgens in rat ventral prostate and seminal vesicles and in human hepatoma cells. Mol. Endocrinol. 4, 1636-1646. Shannon, J. M., and Cunha, G. R. (1983).Autoradiographic localization of androgen binding in the developing prostate. Prostate 4,367-373. Shannon, J. M., and Cunha, G. R. (1984). Characterization of androgen binding and deoxyribonucleic acid synthesis in prostate-like structures induced in the urothelium of testicular feminized (TfmN) mice. Biol. Reprod. 31, 175-183. Sharpe, R. M. (1997). Do males rely on female hormones? Nature (London) 390,447-448. Shemshedini, L., Knauthe, R., Sassone-Corsi, P., Pornon, A., and Gronemeyer, H. (1991). Cell-specific inhibitory and stirnulatory effects of Fos and Jun on transcription activation by nuclear receptors. EMBO J. 10,3839-3849. Sherwood, E. R., and Lee, C. (1995). Epidermal growth factor-related peptides and the epidermal growth factor feceptor in normal and malignant prostate. World J. Urol. 13,290-296. Sherwood, E. R., Theyer, G., Steiner, G., Berg, L. A., Kozlowski, J. M., and Lee, C. (1991). Differential expression of specific cytokeratin polypeptides in the basal and luminal epithelia of the human prostate. Prostate 18,303-314. Sherwood, E. R., Van Dongen, J.L., Wood, C. G., Liao, S., Kozlowski,J.M., and Lee, C. (1998). Epidermal growth factor receptor activation in androgen-independent but not androgen-stimulated growth of human prostatic carcinoma cells. Br. J. Cancer 77,855-861. Shibata, H., Spencer, T. E., Onate, S. A., Jenster, G., Tsai, S. Y., Tasi, M. J., and OMalley, B. W. (1997). Role of co-activators and co-repressors in the mechanism of steroidlthyroid receptor action. Recent Prog. Horm. Res. 52,141-164. Shima, H., Tsuji, M., Elfman, F., and Cunha, G. R. (1995). Development of male urogenital epithelia elicited by soluble mesenchymal factors. J. AndroZ. 16, 233-241. Shyr, C., and Liao, S. (1978).A protein factor that inhibits binding and promotes the release of the androgen-receptor complex from nuclear chromatin. Proc. Natl. Acad. Sci. U.S.A. 75,5969-5973. Silver, R. I., Wiley, E. L., Davis, D. L., Thigpen, A. E., Russell, D. W., and McConnell, J. D. (1994a). Expression and regulation of steroid 5 alpha-reductase 2 in prostate disease. J. Urol. 152,433-437. Silver, R. I., Wiley, E. L., Thigpen, A. E., Guileyardo, J. M., McConnell, J. D., and Russell, D. W. (199413).Cell type specific expression of steroid 5 alpha-reductase 2. J. Urol. 152,438-442.
302
JOHN M. KOKONTIS AND SHUTSUNG LIAO
Simental, J. A., Sar, M., Lane, M. V., French, F. S., and Wilson, E. M. (1991). Transcriptional activation and nuclear targeting signals of the human androgen receptor. J. Biol. Chem. 266,510-518. Sleddens, H. F.B. M., Oostra, B. A., Brinkmann, A. O., and Trapman, J . (1991). Trinucleotide repeat polymorphism in the androgen receptor gene. Nucleic Acids Res. 20, 1427. Small, E., and Carroll, P. R. (1994). Prostate-specific antigen decline after Casodex withdrawal in advanced prostate cancer in progression under combination therapy. Urology 43,408-410. Smith, C. L., Oiiate, S. A., Tsai, M.-J., and O'Malley, B. W. (1996). CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptordependent transcription. Proc. Natl. Acad. Sci. U.S.A. 93,8884-8888. Smith, C. L., Nawaz, Z., and O'Malley, B. W. (1997). Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol. Endocrinol. 11,657-666. Smith, C. M. Ballard, S. A., Wyllie, M. G., and Masters, J. R. W. (1994). Comparison of testosterone metabolism in benign prostatic hyperplasia and human prostate cancer cell lines in uitro. J. Steroid Biochen. Mol. Biol. 50,151-159. Smith, D. F., and Toft, D. 0. (1993). Steroid receptors and their associated proteins. Mol. Endocrinol. 7,4-11. Snoek, R., Rennie, P. S., Kaspar, S., Matusik, R. J., and Bruchovsky, N. (1996). Induction of cell-free, in vitro transcription by recombinant androgen receptor. J. Steroid Biochem. Mol. Biol. 59, 243-250. Soeffing, W. J., and Timms, B. G. (1995). Localization of androgen receptor and cell-specific cytokeratins in basal cells of rat ventral prostate. J. Androl. 16,197-208. Sonnenschein, C., Olea, N., Pasanen, M. E., and Soto, A. M. (1989). Negative controls of cell proliferation: Human prostate cancer cells and androgens. Cancer Res. 49, 3474-3481. Soto,A. M., Lin, T.-M., Sakabe, K., Olea, N., Damassa, D. A., and Sonnenschein, C. (1995). Variants of the human prostate LNCaP carcinoma cell line as tools to study discrete components of the androgen-mediated proliferative response. Oncol. Res. 7, 545-558. Spence, A. M., Sheppard, P. C., Davie, J. R., Matuo, Y., Nishi, N., McKeehan, W. L., Dodd, J . G., and Matusik, R. J. (1989). Regulation of a bifunctional mRNAresults in synthesis of secreted and nuclear probasin. Proc. Natl. Acad. Sci. U.S.A. 86,7843-7847. Spencer, T.E., Jenster, G., Burcin, M. M., Allis, C. D., Zhou, J., Mizzen, C. A,, McKenna, N.J., Onate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1997). Steroid receptor coactivator-1 is a histone acetyltransferase. Nature (London) 389,194-198. Stanford, J. L., Just, J. J., Gibbs, M., Wicklund, K. G., Neal, C. L., Blumenstein, B. A., and Ostrander, E. A. (1997). Polymorphic repeats in the androgen receptor gene: Molecular markers of prostate cancer risk. Cancer Res. 57,1194-1198. Stoner, E. (1996). 5alpha-reductase inhibitors/finasteride. Prostate, Suppl. 6,82-87. Sugimura, Y., Cunha, G. R., and Bigsby, R. M. (1986). Androgenic induction of DNA synthesis in prostatic glands induced in the urothelium of testicular feminized (TfmN) mice. Prostate 9,217-225. Sugimura, Y., Foster, B. A., Ham, Y.K., Lipschutz, J . H., Rubin, J. S., Finch, P. W., Aaronson, S. A., Hayashi, N., Kawamura, J., and Cunha, G. R. (1996). Keratinocyte growth factor (KGF) can replace testosterone in the ductal branching morphogenesis of the rat ventral prostate. Int. J. Deu. Biol. 40,941-951. Supakar, P. C., Jung, M., Song, C. S., Chattejee, B., and Roy, A. K. (1996). Nuclear factor KBfunctions as a negative regulator for the rat androgen receptor gene and NF-
MOLECULAR ACTION OF ANDROGEN
303
KBactivity increases during the age-dependent desensitization of the liver. J. Biol. Chem. 270,837-842. Sutkowski, D. M., Audia, J . E., Goode, R. L., Hsiao, K. C., Leibovitch, I. Y., McNulty, A. M., and Neubauer, B. L. (1996). Responses of LNCaP prostatic adenocarcinoma cell cultures to LY300502, a benzoquinolinone human type I 5a-reductase inhibitor. Prostate, Suppl. 6,62-66. Suzuki, H., Sato, N., Watabe, Y., Masai, M., Seino, S., and Shimazaki, J. (1993). Androgen receptor gene mutations in human prostate cancer. J. Steroid Biochem. Mol. Biol. 46,759-765. Suzuki, H., Akakura, K., Komiya, A., Aida, S., Akimoto, S., and Shimazaki, J. (1996). Codon 877 mutation in the androgen receptor gene in advanced prostate cancer: relation to antiandrogen withdrawal syndrome. Prostate 29, 153- 158. Syms, A., Norris, J., Panko, W., and Smith, R. (1985). Mechanism of androgen receptor augmentation. J. Biol. Chern. 260,455-461. Takeda, H., and Chang, C. (1991).Immunohistochemical and in-situ hybridization analysis of androgen receptor expression during the development of the mouse prostate gland. J. Endocrinol. 129, 83-89. Takeda, H., Mizuno, T., and Lasnitski, I. (1985). Autoradiographic studies of androgen binding sites in the rat urogenital sinus and postnatal prostate. J. Endocrinol. 104, 87-92. Takeda, H., Chodak, G., Mutchnik, S., Nakamoto, T., and Chang, C. (1990). Immunohistochemical localization of androgen receptors with mono- and polyclonal antibodies to androgen receptor. J. Endocrinol. 126,17-25. Takeda, H., Nakamoto, N., Kokontis, J., Chodak, G. W., and Chang, C. (1991).Autoregulation of androgen receptor expression in rodent prostate: Immunohistochemical and in situ hybridization analysis. Biochem. Biophys. Res. Commun. 177,488-496. Takeshita, A., Yen, l? M., Misiti, S., Cardona, G. R., Liu, Y, and Chin, W. W. (1996). Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology (Baltimore) 137,3594-3597. Tan, J., Joseph, D. R., Quarmby, V. E., Lubahn, D. B., Sar, M., French, F. S., and Wilson, E. M. (1988). The rat androgen receptor: primary structure, autoregulation of its messenger ribonucleic acid and immunocytochemical localization of the receptor protein. Mol. Endocrinol. 2, 1276. Tan, J., Marschke, K. B., and Ho, K. C. (1992). Response elements of the androgen-regulated C3 gene. J. Biol. Chem. 267,4456-4466. Tan, J., Sharie, F. Y., Hamil, K. G., Gregory, C. W., Zang, D. Y., Sar, M., Gumerlock, P. H., deVere White, R. W., Pretlow, T. G., Harris, S. E., Wilson, E. M., Mohler, J. L., and French, F. S. (1997). Dehydroepiandrosterone activates mutant androgen receptors expressed in the androgen-dependent human prostate cancer xenograft CWR22 and LNCaP cells. Mol. Endocrinol. 11,450-459. Tanaka, A., Miyamoto, K., Minamino, N., Takeda, M., Sato, B., Matsuo, H., and Matsumoto, K. (1992). Cloning and characterization of a n androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc. Natl. Acad. Sci. U.S.A.89,8928-8932. Tanaka, A,, Miyamoto, K., Matsuo, H., Matsumoto, K., andYoshida, H. 11995). Human androgen-induced growth factor in prostate and breast cancer cells: Its molecular cloning and growth properties. FEBS Lett. 363,226-230. Taplin, M.-E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, A. E., Ogata, G. K., Keer, H. N., and Balk, S. P. (1995). Mutation of the androgen-receptor gene in metastatic androgen-dependent prostate cancer. N. Engl. J. Med. 332, 1393-1398. Thigpen, A. E., Cala, K. M., and Russell, D. W. (1993a). Characterization of Chinese ham-
304
JOHN M.KOKONTIS AND SHUTSUNG LIAO
ster ovary cell lines expressing human steroid 5 alpha-reductase isozymes. J. Biol. Chem. 268,17404-17412. Thigpen, A. E., Silver, R. I., Guileyardo, J. M., Casey, M. L., McConnell, J. D., and Russell, D. W. (199313).Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. J. Clin. Invest. 92,903-910. Thompson, C. C., and Evans, R. M. (1989). Trans-activation by thyroid hormone receptors: Functional parallels with steroid hormone receptors. Proc. Natl. Acad. Sci. U.S.A. 86,3494-3498. Thompson, T. C., Southgate, J., Kitchener, G., and Land, H. (1989). Multistag carcinogenesis induced byras and myc oncogenes in a reconstituted organ. Cell (Cambridge, MUSS.)56,917-930. Thomson, A. A., Foster, B. A., and Cunha, G. R. (1997).Analysis of growth factor and receptor mRNA levels during development of the rat seminal vesicle and prostate. Development (Cambridge, UK)124,2431-2439. Tilley, W. D., Marcelli, M., Wilson, J. D., and McPhaul, M. J. (1989).Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl. Acad. Sci. U.S.A. 86,327-331. Tilley, W. D., Marcelli, M., and McPhaul, M. J. (1990). Expression of the human androgen receptor gene utilizes a common promoter in diverse human tissues and cell lines. J . Biol. Chem. 265,13776-13781. Tilley, W. D., Lim-Tio, S. S., Horsfall, D. J., Aspinall, J. O., Marshall, V. R., and Skinner, J. M. (1994). Detection of discrete androgen receptor epitopes in prostate cancer by immunostaining: Measurement by color video image analysis. Cancer Res. 54, 4096-4102. Tilley, W. D., Buchanan, G., Hickey, T.E., and Bentel, J. M. (1996). Mutations in the androgen receptor gene are associated with progression of human prostate cancer to androgen independence. Clin. Cancer Res. 2,277-285. Tjian, R., and Maniatis, T. (1994). Transcriptional activation: A complex puzzle with few easy pieces. Cell (Cambridge, Mass.) 77,5-8. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989). The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell (Cambridge, Mass.) 59,477-487. ‘Ibrchia, J., Rose, D. W., Inostroza, J., Kamei, Y., Westin, S., Glass, C. K., and Rosenfield, M. G. (1997). The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature (London) 387,677-684. Trapman, J.,Klassen, P.,Kuiper, G., van der Korput, J.,Faber, P. W., van Rooij, H., Geurts van Kessel, A., Voorhorst, M. M., Mulder, E., and Brinkman, A. 0. (1988). Cloning, structure and expression of a cDNAencoding the human androgen receptor. Biochem. Biophys. Res. Commun. 153,241. Tremblay, D., Dupont, A., Meyer, B. J., and Pottier, J. (1987). The kinetics of antiandrogens in humans. In “Prostate Cancer: A Research into Endocrine Treatment and Histopathology” (G. P. Murphy, S. Khoury, R. Kuss, C. Chatelain, L. Denis, eds.), pp. 345-350. Liss, New York. Tsai, M.-J., and O’Malley, B. W. (1994). Molecular mechanisms of action of steroidkhyroid receptor superfamily members. Annu. Rev. Biochem. 63,451-486. Umekita, Y., Hiipakka, R. A., Kokontis, J. M., and Liao, S. (1996). Human prostate tumor growth in athymic mice: Inhibition by androgens and stimulation by a 5a-reductase inhibitor. Proc. Natl. Acad. Sci. U.S.A. 93, 11802-11807. Umesono, K., and Evans, R. M. (1989). Determinants of target gene specificity for steroidkhyroid hormone receptors. Cell (Cambridge, Mass.) 57,1139-1146.
MOLECULAR ACTION OF ANDROGEN
305
van der Kwast, T. H., Schalken, J., Ruizeveld de Winter, J. A., van Vroonhoven, C. C. J., Mulder, E., Boersma, W., and Trapman, J. (1991). Androgen receptors in endocrinetherapy-resistant human prostate cancer. Znt. J. Cancer 48, 189-193. van Laar, J. H., Bolt-de Vries, J., Voorhorst-Ogink, M. M., and Brinkmann, A. 0. (1989). The human androgen receptor is a 110 kDa protein. Mol. Cell. Endocrinol. 63,39-44. van Laar, J. H., Bolt-de Vries, J., Zeers, N. D., Trapman, J., and Brinkman, A. 0. (1990). Androgen receptor heterogeneity and phosphorylation in human LNCaP cells. Biochem. Biophys. Res. Commun. 166,193-200. van Laar, J. H., Berrevoets, C. A., Trapman, J., Zegers, N. D., and Brinkmann, A. 0. (1991). Hormone-dependent androgen receptor phosphorylation is accompanied by receptor transformation in human lymph node carcinoma of the prostate cells. J. Biol. Chem. 266,3134-3738. van Steenbrugge, G. J., Groen, M., van Dongen, J. W., Bolt, J., van der Korput, H., Trapman, J., Hasenson, M., and Horoszewicz, J. s. (1989). The human prostatic carcinoma cell line LNCaP and its derivatives. Urol. Res. 17,71-77. Veldscholte, J., Ris-Stalpers, C., Kuiper, G. G. J. M., Jenster, G., Berrevoets, C., Claassen, E., van Rooij, H. C. J., Trapman, J., Brinkmann, A. O., and Mulder, E. (1990a). Amutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens.Biochem. Biophys. Res. Commun. 173,534-540. Veldscholte, J., Voorhorst-Ogink, M. M., Bolt-de Vries, J., van Rooij, H. C. J., Trapman, J., and Mulder, E. (1990b). Unusual specificity of the androgen receptor in the human tumor cell line LNCaP: High affinity for progestagenic and estrogenic steroids. Biochim. Biophys. Acta 1052,187-194. Veldscholte, J., Berrevoets, C. A., Brinkmann, A. O., Grootegoed, J. A., and Mulder, E. (1992a). Anti-androgens and the mutated androgen receptor of the LNCaP cells: Differential effects on binding affinity, heat-shock protein interaction, and transcription activation. Biochemistry 31,2393-2399. Veldscholte, J.,Berrevoets, C.A., Ris-Stalpers, C., Kuiper, G. G. J. M., Jenster, G., Trapman, J., Brinkmann, A. O., and Mulder, E. (199213). The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J. Steroid Biochem. Mol. Biol. 41, 665-669. Visakorpi, T., Hyytinen, E. R., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C., Palotie, A,, Tammela, T., Isola, J. J., and Kallioniemi, 0.-P. (1995). In uivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet. 9,401-406. Vivat, V., Gofllo, D., Garcia, T., Wurtz, J.-M., Bourguet, W., Philibert, D., and Gronemeyer, H. (1997). Sequences in the ligand-binding domains of the human androgen and progesterone receptors which determine their distinct ligand identities. J. Mol. Endocrinol. 18,147-160. Voegel, J. J., Heine, M. J. S., Zechel, C., Chambon, P., and Gronemeyer, H. (1996). TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF2 of nuclear receptors. EMBO J. 15,3667-3675. von der Ahe, D., Janich, S., Scheidereit, C., Renkawitz, R., Schutz, G., and Beato, M. (1985). Glucocorticoid and progesterone receptors bind to the same sites in two hormonally regulated promoters. Nature (London) 313,706-709. Wagner, A. J., Small, M. B., and Hay, N. (1993). Myc-mediated apoptosis is blocked by ectopic expression of Bcl-2. Mol. Cell. Biol. 13,2432-2440. Wagner, R. L., Apriletti, J. W., McGrath, M. E., West, B. L., Baxter, J. D., and Fletterick,
306
JOHN M. KOKONTIS AND SHUTSUNG LIAO
R. J. (1995). A structural role for hormone in the thyroid hormone receptor. Nature (London) 378,690-697. Walsh, P. C. (1996). Treatment of benign prostatic hyperplasia. N. Engl. J. Med. 335, 586-587. Webster, N. J., Green, S., Jin, J. R., and Chambon, P. (1988). The hormone-binding domains of the estrogen and glucocorticoid receptors contain a n inducible transcription activation function. Cell (Cambridge, Mass.) 54, 199-207. Weidemann, W., Linck, B., Haupt, H., Mentrup, B., Romalo, G., Stockklauser, K., Brinkmann, A. O., Schweikert, H. U.,and Spindler, K. D. (1996). Clinical and biochemical investigations and molecular analysis of subjects with mutations in the androgen receptor gene. Clin. Endocrinol. 45,733-739. Weitzman, A. L., Liu, Q. Y., and Stein, C. A. (1997). Paclitaxel, estramustine, mitoxantrone, and prednisone-induced modulation of human prostate cancer cell apoptosis. Schilling Res. Conf :Horm. Cancer, Santa Cruz, CA, Abstract. West, N. B., Chang, C., Liao, S., and Brenner, R. M. (1990). Localization and regulation of estrogen, progestin and androgen receptors in the seminal vesicle of the rhesus monkey. J. Steroid Biochem. Mol. Biol. 37,ll-21. Westin, P., Bergh, A., and Damber, J.-E. (1993). Castration rapidly results in a major reduction in epithelial cell numbers in the rat prostate, but not in the highly differentiated Dunning R3327 prostatic adenocarcinoma. Prostate 22,65-74. Westin, P., Stattin, P., Damber, J. E., and Bergh, A. (1995). Castration therapy rapidly induces apoptosis in a minority and decreases cell proliferation in a majority of human prostatic tumors. Am. J . Pathol. 146, 1368-1375. Wilding, G., Chen, M., and Gelman, E. P. (1989). Aberrant response in vitro of hormoneresponsive prostate cancer cells to anti-androgens. Prostate 14, 103-115. Williams-Ashman, H. G., Liao, S., Hancock, R. L., Jurkowitz, L., and Silverman, D. A. (1964). Testicular hormones and synthesis of ribonucleic acids and proteins in the prostate gland. Recent Prog. Horm. Res. 20,247-299. Wilson, C. M., and McPhaul, M. J . (1994).A and B forms of the androgen receptor are present in human genital skin fibroblasts. Proc. Natl. Acad. Sci. U.S.A. 91,1234-1238. Wilson, C. M., and McPhaul, M. J. (1996).A and B forms of the androgen receptor are expressed in a variety of human tissues. MoE. Cell. Endocrinol. 120,51-57. Wingo, P. A., Landis, S., and Ries, L. A. G. (1997).An adjustment to the 1997 estimate for new prostate cancer cases. CA-Cancer J. Clin. 47,239-242. Wolf, D., Herzinger, T., Herminkink, H., Blaschke, D., and Horz, W. (1993). Transcriptional and posttranscriptional regulation of human androgen receptor by androgen. Mol. Endocrinol. 7,924-936. Wolf, D. A., Schulz, P., and Fittler, F. (1991). Synthetic androgens suppress the transformed phenotype in the human prostate carcinoma cell line LNCaP. Br. J. Cancer 64,47-53. Wolf, D. A., Kohlhuber, F., Schulz, P., Fittler, F., and Eick, D. (1992). Transcriptional down-regulation of c-myc in human prostate carcinoma cells by the synthetic androgen mibolerone. Br. J . Cancer 65,376-382. Wong, G I . , Xhou, Z.-X., Sar, M., and Wilson, E. M. (1993). Steroid requirement for androgen receptor dimerization and DNA binding. J. Biol. Chem. 268, 19004-19012. Wurtz, J.-M., Bourguet, W., Renaud, J. I?, Vivat, V., Chambon, P., Moras, D., and Gronemeyer, H. (1996).A canonical structure for the ligand-binding domain of nuclear receptors. Nut. Struct. Biol. 3,87-94, published erratum: No. 2, p. 206. Yan, G., Fukabori,Y., Nikolaropoulos, S., Wang, F., and McKeehan, W. L. (1992).Heparinbinding keratinocyte growth factor is a candidate stromal epithelial cell andromedin. Mol. Endocrinol. 6,2123-2128.
MOLECULAR ACTION OF ANDROGEN
307
Yan, Y., Sheppard, P. C., Kasper, S., Lin, L., Hoare, S., Kapoor, A., Dodd, J. G., Duckworth, M. L., and Matusik, R. J. (1997). Large fragment of the probasin promoter targets high levels of transgene expression to the prostate of transgenic mice. Prostate 32, 129-139. Yang, N.N., Venugopalan, M., Hardikar, S., and Glasebrook, A. (1996). Identification of a n estrogen response element activated by metabolites of 17P-estradiol and raloxifene. Science 273, 1222-1225. Yang-Yen, H. F., Chambard, J. C., Sun, Y. L., Smeal, T.,Schmidt, T. J., Drouin, J., and Karin, M. (1990). Transcriptional interference between c-jun and the glucocorticoid receptor: Mutual inhibition of DNA binding due to direct protein-protein interaction. Cell (Cambridge, Mass.) 62, 1205-1215. Scully, R., and Livingston, D. M. (1996). The nuclear hormone Yao, T.-P., Ku, G., Zhou, N., receptor coactivator SRC-1 is a specific target of p300. Proc. Natl. Acad. Sci. U.S.A. 938,10626-10631. Yarbrough, W. G., Quarmby, V. E., Simental, J. A., Joseph, D. R., Sar, M., Lubahn, D. B., L, 0. K., French, F. S., and Wilson, E. M. (1990). A single base mutation in the androgen receptor gene causes androgen insensitivity in testicular feminized rats. J. Biol. Chem. 265,8893-8900. Yeh, S., and Chang, C. (1996). Cloning and characterization of a specific coactivator, ARA,,, for the androgen receptor gene. Proc. Natl. Acad. Sci. U.S.A.93,5517-5521. Yong, E. L., Chua, K. L., Yang, M., Roy, A., and Ratnam, S. (1994). Complete androgen insensitivity due to a splice-site mutation in the androgen receptor gene and genetic screening with single-stranded conformation polymorphism. Fertil. Steril. 61, 856-862. Young, C. Y., Montgomery, B. T., Andrews, P. E., Qui, S., Bilhartz, D. L., and Tindall, D. J. (1991). Hormonal regulation of prostate-specific antigen messenger RNA in human prostatic adenocarcinoma cell line LNCaP. Cancer Res. 61,3748-3752. Young, C. Y., Murtha, P. E., and Zhang, J. (1994). Tumor-producing phorbol ester-induced cell death and gene expression in a human prostate adenocarcinoma cell line. Oncol. Res. 6,203-210. Zhang, Y. L., and Parker, M. G. (1985). Regulation of prostatic steroid binding protein mRNAs by testosterone. Mol. Cell. Endocrinol. 43, 151-154. Zhau, H. Y., Chang, S. M., Chen, B. Q., Wang,Y., Zhang, H., Kao, C., Sang, Q. A., Pathak, S. J., and Chung, L. W. (1996). Androgen-repressed phenotype in human prostate cancer. Proc. Natl. Acad. Sci. U.S.A. 93, 15152-15157. Zhou, Z.-X., Sar, M., Simental, J. A., Lane, M. V., and Wilson, E. M. (1994). A ligand-dependent bipartite nuclear targeting signal i n the human androgen receptor. J. Biol. Chem. 269,13115-13123. Zhou, Z.-X., Lane, M. V., Kemppainen, J. A., French, F. S., and Wilson, E. M. (1995a). Specificity of ligand-dependent androgen receptor stabilization: Receptor domain interactions influence ligand dissociation and receptor stability. Mol. Endocrinol. 9, 208-218. Zhou, Z.-X., Kemppainen, J. A., and Wilson, E. M. (1995b3. Identification of three prolinedirected phosphorylation sites in the human androgen receptor. Mol. Endocrinol. 9, 605- 615. Zilliacus, J., Wright, A. P. H., Carlstedt-Duke, J., and Gustafsson, J.-A. (1995). Structural determinants of DNA-binding specificity by steroid receptors. MoZ. Endocrinol. 9, 389-400.
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
Regulation of Androgen Action A. K. ROY. Y. LAVROVSKY. C. S. SONG, S. CHEN. M.’H. JUNG, N. K. VELU, B. Y. BI, AND B. CHATTERJEE Department of Cellular and Structural Biology University of Texas Health Science Center at San Antonio San Antonio, Texas 78284-7762 I. Introduction 11. Androgen Receptor and Androgen Response Elements A. Androgen Receptor Gene and Protein Structure B. Specific Androgen Receptor Binding Sites at Target Genes C. Modulation of Androgen Receptor Function by Direct Interaction with Other Nuclear Receptors and Nonreceptor Regulatory Factors 111. Regulation of Androgen Receptor Gene Expression Iv. Ligand-Mediated Activation and Inhibition of Androgen Receptor Function A. Role of the Hormonal Ligand in Receptor Activation B. High-Affinity Ligands with Antiandrogenic Action V. Enzymatic Regulation of Androgen Action A. Activation and Inactivation of Androgenic Steroids by 5a-Reductase and Hydroxysteroid Dehydrogenase B. Inactivation of Androgens by Hydroxysteroid Sulfotransferase C. Other Enzymatic Pathways for Androgen Modification VI. Mediation of Androgen Action by Peptide Growth Factors VII. Androgen Action in Target Organs Containing High Levels ofAndrogens and Androgen Receptor A. Androgen Action in Adrenal Cortex and Testis B. Androgen Action in Prostate VIII. Summary References
I. INTRODUCTION Androgens belong to a class of C-19 steroids secreted primarily by the testis and adrenal cortex (Roy and Chatterjee, 1995). Hormonally active androgens promote reproductive and anabolic (myotropic) functions (Mooradian et al., 1987). Both reproductive and anabolic effects of androgens are mediated by their interaction with the androgen receptor (AR), a member of the steroid-thyroid hormone-retinoid-vitamin D superfamily of nuclear receptors (NRs) that function as ligand-activated transcription factors (Mangelsdorf et al., 1995). The NR superfamily also includes receptors for peroxisome proliferators (PPAR) and a 309
Copyright 0 1999 by Academic Press. All rights of reproduction in any farm reserved. 0083-6729199 $25.00
310
A. K. ROY et al.
number of orphan receptors (without or with yet-to-be identified ligands) and constitutes the largest group of eucaryotic transcription factors. Testosterone (TI and its 5a-reduced derivative 5a-dihydrotestosterone (DHT) are the two most predominant forms of physiological androgens. A number of naturally occurring (2-19 steroids, such as dehydroepiandrosterone (DHEA) and androstenedione, which do not possess any significant hormonal activity, are also chemically grouped with androgenic steroids. These C-19 steroids without hormonal activity may serve as precursors or inactivated forms of the receptor-active hormone at the target cell level. In fact, in humans, the most abundant circulating form of C-19 steroid is DHEA, which is of adrenal origin. There is no major sex difference in the level of DHEA in the human and its circulating concentration in the male is about 100-fold higher than that of T. Precise physiological function of such high levels of DHEAis largely unknown (Baulieu et al., 1965; Hopper and Yen, 1975; Parker and Odell, 1980; Labrie et al., 1988; Mortola and Yen, 1990; Orentreich et al., 1992; Roy and Belanger, 1993). Testosterone, the predominant circulating androgenic hormone of most mammalian species is synthesized and secreted by Leydig cells of the testis. Leydig cells are scattered outside the seminiferous tubules and their endocrine function is primarily controlled by the leutenizing hormone (LH) of the pituitary gland. Leydig cells contain androgen receptor and are, therefore, suspected to be under additional regulatory control by androgens (Bremner et al., 1994; Vornberger et al., 1994; Shan et al., 1997). Most androgen target cells contain not only AR but also the enzyme 5a-reductase (Russell and Wilson, 1994). The affinity of DHT for AR is about 2- to 3fold higher than T, and T dissociates from the receptor at about a 5-fold faster rate than DHT. Furthermore, when bound to DHT the receptor is more stable (Grinoet al., 1990;Zhou et al., 1995). Thus, DHT can amplify considerably the androgenic signal and functions physiologically as a “superandrogen.” On the other hand, a number of target tissues contain enzymes that can convert the receptor-active androgenic steroids t o their receptor-inactive forms through structural alterations such as oxidation, sulfonation, and glucuronidation (Gurpide, 1978; Roy, 1992; Hobkirk, 1993; Penning, 1997; Strott, 1996; Guillemette et al., 1996). However, under appropriate conditions, these metabolically altered androgens can be converted back to their biologically active forms and, therefore, can function as “proandrogens.” During embryogenesis, the indifferent gonads of the heterogametic (XY)male differentiate into testes under the influence of the regulatory protein encoded by the SRY gene present on t h e y chromosome (Jost, 1970; Koopman et al., 1991). Thereafter, endocrine secretions from the
REGULATION OF ANDROGEN ACTION
311
fetal testes dictate the male-specific sexual differentiation. This includes regression of the Miillerian ducts; differentiation of the Wolffian ducts to epididymes, vasa deferentia, and seminal vesicles; and development of the prostate from urogenital sinus and formation of maletype urogenital tracts and the external genitals. Regression of the Miillerian ducts is mainly controlled by the peptide hormone Miillerian-inhibiting substance (MIS) produced by the Sertoli cells of the testis (Donahoe et al., 1987; Josso et al., 1991). Additional male-specific developmental events are mediated by androgens produced by fetal testes. Furthermore, the local amplification of the androgenic signal by conversion of T to DHT plays an essential role in remodeling of the urethra and development of the prostate, penis, and scrotum (Wilsonet al., 1993). Many of these androgen-initiated developmental events continue after birth and constitute an integral component of the sexual maturation. These maturational events, ranging from changes in brain function to alterations in physical characteristics, are also dependent on androgenic hormones. 11. ANDROGEN RECEPTOR AND ANDROGEN RESPONSE ELEMENTS Almost all of the androgen functions, except its conversion to estrogen by the enzyme aromatase in certain target cells are known to be mediated by the androgen receptor. However, certain minor non-receptor-mediated actions involving androgen interaction with circulating sex hormone-binding globulins (Nakhla et al., 1997)and other yet-to-be characterized non-receptor-mediated pathways, such as those indicated for estrogen signaling, cannot be discounted totally (Aronica et ul., 1994; Das et al., 1997). Ligand-activated AR functions as a transcription factor and influences cell function by regulating the transcription of androgen target genes (Lindzey et al., 1994; Zhou et al., 1994a). GENEAND PROTEIN STRUCTURE A. ANDROGENRECEPTOR The androgen receptor is coded by a single copy gene, which is located on the X chromosome. In the human, it is situated at Xqll-ql2 and spans a DNA region of about 90 kilobase (kb) pairs (Brown et al., 1989; Kuiper et al., 1989; Faber et al., 1991a). The receptor is encoded by an ll-kb mRNA species containing a 2.8-kb-long open reading frame. The protein coding mRNA sequence is flanked by untranslated regions (UTRs)of 1.1kb at the 5’ end and 6 kb at the 3’ end (Changet ul., 1988a; Lubahn et al., 1988a; Trapman et al., 1988; Tilley et al., 1989).Alter-
312
A. K.ROY et a1
nate splicing within the long 3’ UTR generates a minor 8-kb mRNA species. The genomic AR is organized into eight exons, and all of the exon-intron boundaries have been characterized (Lubahn et al., 1988b; Faber et al., 1991b). The long first exon encodes the 5’ UTR as well as the AFi amino-terminal domain, whereas exons 2 and 3 encode the DNA-binding domain. The steroid-binding domain spans exons 4 through 8. In addition to a segment of the ligand-binding domain, exon 8 contains the sequence information for the entire 6-kb 3’ UTR. The sites for two functional polyadenylation signals within exon 8, separated from each other by a 221-base pair (bp) DNA sequence, have also been identified (Liao et al., 1989; Rundlett et al., 1990; Simental et al., 1992; Jenster et al., 1992). Although it has been discovered that estrogen receptors are coded by two distinct genes (Kuiper et al., 1996; Mosselman et al., 1996), the mammalian androgen receptor appears to be coded by a single gene localized on the X chromosome (Brown et al., 1989; Kuiper et al., 1989; Brinkmann et al., 1989).The strongest argument for the absence of additional androgen receptor genes (except in pathological situations with gene duplication) is the extensive catalog of human androgen insensitivity syndromes, all of which are associated with mutations in the known AR gene locus (Gottlieb et al., 1997). However, contrary views are not disregarded totally (Sheridan, 1991; Wilson, 1996). Historical, clinical, and molecular aspects of the androgen insensitivity syndromes have been the subject of a masterful review and are not discussed here (Quigley et al., 1995). All steroid hormone receptors share a striking structural resemblance (Tsai and O’Malley, 1994). This common structural feature includes an N-terminally located segment of variable length (-25-600 amino acids) that contributes to the transactivation function. This is followed by a 66-68 amino acid long DNA-bindingdomain that harbors the two zinc fingers and allows the receptor to stably insert itself into the major groove of the DNA duplex. The N-terminal transactivation domain and the centrally positioned DNA-binding domain are linked to a C-terminally located “ligand-binding” domain (-250-300 amino acids) through a “hinge region” (-50-70 amino acids) of the receptor protein. The ligand-binding domain also contributes to a transactivation function of the receptor and contains regions that allow receptor dimerization and cooperative interaction with the N-terminal region. The human AR is an approximately 110-kDa protein with minor size variations due to polymorphism in the number of polyglutamine (-11-31 residues) and polyglycine (-24 glycine residues) stretches present within the N-terminal transactivation domain, and the degree
313
REGULATION OF ANDROGEN ACTION
5‘
3
Modulator DNA-Binding Hinge Ligand-Binding TAF-1 ‘ I TAFQ n
‘
’
FIG.1. Genomic origin of the functional domains of the androgen receptor gene. Eight exons (dark lines, marked 1-8) of the primary transcript give rise to the corresponding domains (A to H) of t h e m protein. Assigned functional roles of these structural domains are indicated on the top of the linearized protein structure. The drawing is not to scale.
of phosphorylation of the receptor protein (Quarmby et al., 1990; Jenster et al., 1991).Additionally, the AR mRNA can utilize an alternative translation initiation site producing an N-terminally truncated form of 87-kDa protein (“Aform” of AR) (Wilson and McPhaul, 1994).Whether the A form of AR plays any unique physiological function is presently unknown. Figure 1shows the genomic origin of the various structural domains of the human AR mRNA and the protein. The hnctional relevance of the segmented domain structure of the NR superfamilyis supported by results of deletion mutagenesis and domain swappingamong various receptor proteins (Picard and Yamamoto, 1987; Godowski et al., 1988; Evans, 1988; Tsai et al., 1988; Guiochon-Mantel et al., 1989;Simental et al., 1991;Jenster et al., 1993).However, it needs to be emphasized that much of the complex functional role of any globular protein is dependent on the overall protein conformation dictated by the unique folding of the whole protein molecule. Thus, only those functional properties requiring small segments of the primary structure, such as the short stretch of amino acid sequences within the “hinge”region that specifies the nuclear translocation signal or each of the -20 amino acid zinc-finger loops responsible for DNA-protein contacts, can be strictly assigned to certain primary amino acid sequences. On the other hand, the complex functional characteristics involving specific and discriminatoryligand binding and protein-protein interaction involving transcriptional activation or repression of different target
314
A. K. ROY et al.
genes would require interaction among various structural domains that gives rise to the unique three-dimensional configuration of the receptor protein. In fact, even minor conformational perturbation associated with specific ligand-receptor interaction leads to unfolding of phosphorylation sites, dissociation of the heat-shock proteins, exposure of nuclear translocation signals, and interaction with other trans-regulatory proteins (Guiochon-Mantelet al., 1989; Simental et al., 1991; Kemppainen et al., 1992; Beekman et al., 1993; Kuil and Mulder, 1995; McEwan and Gustafsson, 1997). It was revealed that interactions between N- and Cterminal ends of the AR play an important role in the overall transcriptional activation of target genes (Ikonen et al., 1997; Doesburg et al., 1997). Such end-to-end interaction appears to be stabilized both by ligand binding and by interaction with coactivator proteins such as members of the steroid receptor coactivator (SRC-1) family and CBP [cyclic AMP (CAMP)response-element-binding (CREB) protein] (Ofiate et al., 1995;Takeshitaet al., 1996; Kamei et al., 1996;Chakravarti et al., 1996). Results of these studies clearly show that although specific functional roles can largely be assigned to different structural segments, the overall target-gene-specific regulatory function of the hormone-receptor complex requires a certain degree of synergy among various structural domains in the context of the entire receptor structure. Approximately 500 amino acid residues flanking the DNA-binding domain at the N-terminal end of the AR provide an important role in the transactivation function of the receptor protein (Rundlett et al., 1990; Jenster et al., 1991; Simental et al., 1991).A region within the Nterminal domain spanning amino acids 142-240 is required for full transcriptional activity. The interaction between the amino terminal and the steroid-binding carboxy-terminal end in the AR transactivation function was initially indicated by the finding that a segment within the hormone-binding domain exerts an inhibitory influence in the transcription regulatory activity of the AR, and deletion of this region results in ligand-independent activation of the receptor (Simental et al., 1991).Additionally, it was observed that the higher order protein structure resulting from the interaction between the N- and C-terminal regions provides the appropriate surface for interactions with auxiliary factors (coregulators)as well as with the factors that are components of the basal transcription machinery (McEwan and Gustafsson, 1997;Ikonen et al., 1997; Doesburg et al., 1997).As with other steroid receptors, the transactivation potential of the N-terminal region of the AR is determined by both the net charge of the amino acid residues and the overall protein conformation. The amino terminal domain of the AR is also marked by several stretches of homopolymeric amino acids, a gluta-
REGULATION OF ANDROGEN ACTION
315
mine repeat encoded by (CAG), starting at amino acid 58 and often ending at 79, followed by nine nonpolymorphic proline repeats (amino acids 372-379) and another polymorphic repeat of -24 glycine residues (amino acids 449-472) located toward the end of this domain (Chang et al., 1988b; Lubahn et al., 1988b;Liao et al., 1989). The variability of the glutamine and glycine repeat lengths imposes changes in the absolute number of amino acids comprising the AR protein isolated from different individuals in the general population (Sleddens et al., 1992). Expansion of the polyglutamine stretch over 40 causes reduced transactivation function and a neuromuscular disorder called spinal bulbar muscular atrophy (Kennedy's syndrome) (Mhatre et al., 1993; Chamberlain et al., 1994; Tut et al., 1997). The 66-amino-acid-long centrally located DNA-binding domain (DBD), arising from exons 2 and 3, contains nine conserved cysteine residues (Lubahn et al., 1989;DeVos et al., 1991).Eight of these residues are involved in generating two zinc-coordinated stem-loop structures commonly known as type I1 zinc fingers that enable the receptor to bind to the major groove of the DNA duplex (Freedman, 1992). Studies with hybrid receptors have indicated that the first zinc finger (proximal to the N-terminal side of the protein) determines the sequence-specificityfor the receptor protein, whereas the other helps to stabilize the DNA-receptor complex (Umesono and Evans, 1989;Tsai and O'Malley, 1994).In addition to specifying DNA binding, the second zinc finger also contributes to receptor dimerization, which is a multidomain function. The hinge region between the DNA- and hormone-binding domains contains the sequence information for nuclear targeting (Simental et al., 1991; Jenster et al., 1993; Zhou et al., 1994b;Nemoto et al., 1994; Kallio et al., 1994).Deletion mutagenesis has led to the identification of discrete nuclear localization signals (NLS) for the steroid hormone receptors (Picard and Yamamoto, 1987; Guiochon-Mantelet al., 1989). For AR, a bipartite nucleoplasmin-like nuclear targeting sequence has been localized to the DNA binding and hinge regions at amino acids 617-633 (Simental et al., 1991;Jenster et al., 1993;Zhou et al., 1994b). The DNAbinding domain and the ligand-binding domain contain information that contributes to receptor dimerization (Wong et al., 1993; Nemoto et al., 1994; Kallio et al., 1994).All steroid hormone receptors possess a heptad repeat of hydrophobic residues within the steroid-binding region, and this conserved repeat region has been suggested to play an important role in receptor homodimerization (Fawell et al., 1990).At least three phosphorylation sites have also been identified for AR-two in the amino-terminal region and one in the hinge region (Golsteynet al., 1990; Kuiper et al., 1993; Zhou et al., 1994a;Jenster et al., 1994).Although the
316
A. K. ROY et al
precise role of phosphorylation in AR function is unclear, it is likely to be important in protein-protein interactions that are critical for signal transduction.
B. SPECIFIC ANDROGEN RECEPTOR BINDING SITESAT TARGET GENES Specific DNA-binding sites for steroid hormone receptors, commonly known as hormone response elements (HREs), are generally made up of 15-bp regions of the target gene consisting of two imperfect inverted repeats of “half recognition sites” separated by three base pair spacers (Cato et al., 1987; Ham et al., 1988). Receptors for androgen, progesterone, and gluco- and mineralocorticoids use TGTTCT half-sites, whereas estrogen receptor prefers AGGTCA half-sites (Tsai and O’Malley, 1994; Mangelsdorf et al., 1995). Since steroid receptors function as dimeric transcription factors, each of the half-sites is bound to one receptor monomer. Binding of steroid hormone receptors t o their respective HREs is not highly specific.Additionally, ligand-activated steroid receptors not only form homodimers, they can also function as heterodimers, thus expanding the variability of the HREs for each type of the receptor protein (S. Chen et al., 1997b).One of the puzzling aspects of the molecular biology of steroid hormone action is the observation that AR, progesterone receptor (PR), glucocorticoid receptor (GR), and mineralocorticoid receptor (MR) all recognize the same HRE and yet, in the physiological context, each one of these steroid hormones functions with a very high degree of target-gene-specificity. Resolution of this regulatory paradox has been attempted through a number of experimental approaches. Initially it was thought that identification and characterization of androgen response elements (AREs) of the naturally occurring androgen-regulated gene promoters may resolve the issue. However, AREs, identified in a number of androgen-regulated genes such as that of mouse prostatic secretory protein C3 (Ho et al., 1993; Claessens et al., 1993),human prostate-specific antigen (Riegman et al., 1991; Zhou et al., 19971, rat prostate basic protein (probasin) (Rennie et al., 1993), and mouse sex-limited hepatic protein (Robins et al., 19941, have only introduced further complexity. AR-mediated activation of these target genes points to multifactorial contributions in the maintenance of receptor specificity, including other receptor-associated nuclear proteins and possibly chromosomal configurations that contribute to the AR-specific regulation. To identify any preferential recognition sequence for the AR, a fusion protein containing its DNA-bindingdomain was used t o retrieve specifically bound oligonucleotide duplexes from a random oligonucleotide
REGULATION OF ANDROGEN ACTION
317
pool by electrophoretic retardation of the DNA-protein complex. Subsequent PCR amplification of the retarded sequences followed by three additional rounds of selection through the same procedure yielded a preferred sequence with the following structure of the complementary strand: 5'-GGA/TACA"NTGTTCT-3' (Roche et al., 1992). However, this experimentally deduced consensus element still showed a high degree of cross-reactivity with other members of the C-21 and C-19 steroid hormone receptors. A similar experimental approach has also been used to identify an 11-bpARE sequence consisting of two overlapping direct repeats showing a certain degree of preferential binding and activation by AR, as compared to GR, in transfected cells (Zhou et al., 1997). The role of adjacently located cis-elements for non-NR class of transcription factors in the regulation of steroid hormone target gene specificity was indicated with the mouse mammary tumor virus (MMTV) long-terminal repeat (LTR) model system (Ringold et al., 1988). The MMTV promoter contains a number of C-21 and C-19 steroid-receptorbinding sites, the most proximal of which is located around - 120. At a nearby position (around -70) lies a binding site for nuclear factor 1 (NFl), which plays an important role in both transcriptional activation and in receptor discrimination (Gowland and Buetti, 1989;Truss et al., 1995). This part of the promoter sequence is organized in a nucleosome structure composed of a 144-bp DNA sequence wrapped around an octameric histone arrangement (a tetramer of histones H3 and H4, and two dimers of H2A and H2B) with the major groove of the DNA helix facing the exterior surface. When the MMTV promoter is organized as a chromatin structure (nucleosomes), specific DNA-binding proteins such as NRs that require only the major groove can effectively interact with the HRE, but not NF1, which requires multiple contacts at both sides of the DNA for its sequence-specific interaction. However, nucleosomal remodeling initiated by the NR-DNA interaction enables adequate access of NF1 to its binding site, resulting in transcriptional activation. Within this chromatin context, PR (and possibly also AR) serves as a relatively poor destabilizer of the nucleosome and, consequently, weakly transactivates the target gene, while GR acts as a highly efficient activator of the transcriptional initiation (Smith and Hager, 1997). Such discriminatorial function between GR and PR is lost when the same DNA construct is assayed in the transient transfection where formation of physiologically relevant nucleosomal structures has not been detected (Archer et al., 1992). Synergistic cooperation between two AREs located far apart is also used as a regulatory strategy. This is indicated by the observation that at the probasin gene, two AREs situated more than 100 bp apart can form a functional androgen response unit (Rennie et al., 1993). DNaseI
3 18
A. K. ROY et al.
footprinting has identified two separate ARES: ARE-1 at -236 to -223 and ARE-2 at - 140 to - 117 at the rat probasin promoter. Even in the transient transfectional assay, the probasin promoter fragment containing both of these AREs and the adjoining DNA sequences showed a higher sensitivity to AR than either PR or GR. More interestingly, mutational disruption of any one of the two AREs caused more than 95% loss of AR-mediated transactivation. OF ANDROGEN RECEPTORFUNCTION C. MODULATION BY DIRECT INTERACTION WITH OTHERNUCLEAR RECEPTORS ANDNONRECEPTORREGULATORYFACTORS
AR action on target gene expression is not only influenced by interaction with other regulatory proteins due to their physical proximity to ARE at DNA-binding sites, but also by direct protein-protein interactions irrespective of the location of the &-elements. Such a possibility for C-21 to C-19 steroid hormone receptors was initially raised by the observation that the p65 subunit of NF-KB(RelA) is capable of associating with GR, and overexpression of p65 antagonizes the GR-mediated transactivation of the MMTV promoter (Ray and Prefontaine, 1994). This report was followed by a similar observation of RelA-mediated inhibition of AR function in cotransfected COS-1 cells (Palvimo et al., 1996). Although unlike with GR, only a weak physical association between AR and RelA was detected, the authors suggested that the AR-RelA complex may be stabilized through another protein mediator. In addition to RelA, a physical association between AR and a number of other transcription factors and the resulting interference with their respective transactivational functions have been reported. These include down-regulation of the matrix metalloproteinase (MMP)genes by Ets-related transcription factors in the prostatic carcinoma cells (Schneikeret et al., 19961,AP-1(Jun-Fos)-mediated interference of the androgenic induction of the prostate-specific antigen (PSA) gene in the LNCaP cells (Sat0 et al., 1997), inhibition of the (Y subunit of folliclestimulating hormone (FSH) and LH in the pituitary gland (Heckert et al., 1997) and androgenic inhibition of the DHEA-sulfotransferase in the liver (Song et al., 1998).AR negatively regulates the expression of interstitial collagenase (MMPl), stromelysin I (MMP3),and matrilysin (MMP7). In the case of MMPl gene promoter, AR appears to provide regulatory function by physical association and consequent disabling of the Ets-related transcription factors that are required for the activation of this gene. Inhibitory action of AR on MMP3 and MMP7 genes may be mediated by AR-AP-1 interaction, while the induction of PSA by AR is also inhibited by AP-1 overexpression. Inhibition of the go-
REGULATION OF ANDROGEN ACTION
319
nadotropin a-subunit gene by AR requires two non-ARE cis-elements at the corresponding gene promoters. Mutational analyses identified these two negative regulatory elements as the cyclic AMP response element (CRE) and a-basal element (&BE).Studies with deletion mutants of AR showed that specific regions within both the DBD and the ligand-binding domain (LBD) of AR contribute t o this repressor function with the DBD playing the major role. It has also been suggested that in the presence of the androgen agonist, the LBD may unmask the repressor function that resides within the DBD. Recently, we have observed that the androgenic down-regulation of the DHEA-sulfotransferase gene in rat liver is mediated through the interaction of AR with two other transcription factors, i.e., Oct-1 and C/EBP (Songet al., 1998). This observation underscores the degree and extent of cross-talk between AR and other classes of transcription factors in the mediation of negative regulation. Formation of AR-GR heterodimers as the basis of the antagonistic roles of these two steroid hormone receptors in certain tissues such as the skeletal muscle is indicated by the formation of AR-GR heterodimers. Mutant forms of receptors that failed to form heterodimers did not influence the transactivation function of the respective receptor proteins (S. Chen et al., 1997b). Identification of a number of coactivators and corepressors that are capable of associating with different members of the NR superfamily has added further complexity to the mechanism of steroid hormone action (Beato et al., 1995;Horwitz et al., 1996).Specificinteraction of NRs with other nuclear proteins in the regulation of target gene expression was implicated initially by the observation that additional nuclear proteins [called thyroid hormone receptor (TR)-associated proteins (TRAPS)]are needed for stabilization of the TR-TR response element (TRE) interaction (Murray and Towle, 1989). Subsequently,two estrogen receptor (ER)-associatedproteins, ERAP-160 and RIP-140, which are capable of binding to the ligand-activated ER, were identified (Halachmi et ul., 1994;Cavaillks et ul., 1995).These initial reports were followed quickly by the identification and characterization of a number of NR-associated proteins that can function as either coactivatorsor corepressors (Horwitz et al., 1996).Most of these coregulators interact with the C-terminal region of NRs in a hormone-dependent manner and many of them cross-react with several members of the NR superfamily. Although it has been reported that an AR-associated 70-kDa protein (ARA70) displays a high degree of receptor and ligand specificity, this observation still needs further substantiation (Yeh and Chang, 1996). The promiscuous steroid receptor coactivator SRC-1, which has been extensively characterized, not only interacts with the C-terminal acti-
320
A. K. ROY et al.
vation domain (AF-2) of NRs, but also possesses histone acetyl-transferase (HAT) activity (Spencer et al., 1997).As mentioned before, such enzymatic activity of the steroid receptor coactivators can influence the nucleosomal reorganization that leads to further accessibility to other transcription factors and amplification of the steroid signal for the regulation of target gene expression. In this context, it is of interest to note that a family of secondary regulatory proteins with HAT activity, called CBP/p300 (so named because of their initial identification as a 300-kDa protein bound to CREB), also associates with NRs and enhances their transregulatory function (Bannister and Kouzarides, 1996; Ogryzko et al., 1996; H. Chen et al., 1997).A new model of steroid hormone action based on the interaction of these coregulatory proteins with both HAT and histone deactylase (HD) activity has been suggested (Jenster et al., 1997). The model proposes that NRs and the associated coactivators have intrinsic activation functions due to their ability to stabilize the preinitiation complex containing the RNA polymerase 11. Such a regulatory unit containing the SRC-1 with HAT activity attracts additional regulatory proteins such as p300KBP and p300-CBP-associated factors (PCAFs), which are also HAT proteins, aiding in the remodeling of the nucleosome structure. On the other hand, corepressors such as silencing mediator for retinoid and thyroid receptors (SMRT)-nuclear receptor corepressor (NCoR)(Chen and Evans, 1995; Horlein et al., 1995) attract proteins with HD activity that can reestablish the nucleosomal barrier and prevent an open access to the cis-regulatory elements, thereby turning off the target gene. 111. REGULATION OF ANDROGEN RECEPTOR GENEEXPRESSION The androgen sensitivity of target tissues during development, maturation, and aging is dictated to a great extent by the cellular content of AR. Thus, spatiotemporal control of AR gene expression plays an overwhelming role in the regulation of androgen action (Supakar et al., 1993; Supakar and Roy, 1996). The androgen receptor gene promoters from a number of species including man, rat, and mouse have been isolated and characterized (Baarends et al., 1990; Tilley et al., 1990; Song et al., 1993; Faber et al., 1993; Mizokami et al., 1994). The AR promoter at its proximal region does not contain the canonical TATA and CCAAT elements and, like most other TATA-less promoters, it contains the GC box instead, which is preceded by a long (-90 bp) stretch of homopurine-homopyrimidine (pur-pyr) element. This pur-pyr domain of the AR gene promoter is evolutionarily conserved and primar-
REGULATION OF ANDROGEN ACTION
32 1
ily consists of a GGGGA repeat. Similar to the GC box, the pur-pyr domain of the AR promoter can specifically bind the transcription factor S p l (S. Chen et al., 1997a). The important functional role of S p l binding at the pur-pyr site in the regulation of AR promoter is indicated by the observation that either deletion or mutagenesis of the pur-pyr region can cause 3- to 4-fold decline of the promoter activity (Mizokami et al., 1994; S. Chen et al., 1997a). Studies in our laboratory have indicated that the pur-pyr domain of the AR can exist in both classical duplex form (B-DNA)and in an intramolecular triple-helical conformation (H-DNA) stabilized by Hoogsteen hydrogen bonds. Furthermore, the triplex form of the pur-pyr region can be stabilized by a sequence-specific single-strand pyrimidine-rich DNA binding protein (ssPyrBF). The pur-pyr domain of AR can bind multiple S p l only when it is in the BDNA conformation. However, stabilization of the triplex conformation by ssPyrBF could prevent its interaction with the S p l protein. We also observed that S p l interacts with the pur-pyr domain with a lower affinity than with the GC box, which is located only 3 bp downstream. From all of these observations, we have proposed that the nuclear level of ssPyrBF in androgen target cells can determine the AR promoter conformation and that multiple weak S p l sites at the pur-pyr region immediately upstream of the GC box can serve as a readily available storage site for this key transcription factor, enhancing the assembly of the initiation complex ( S . Chen et al., 1997a). Beyond the pur-pyr domain, the AR promoter contains binding sites for more than 20 transcription factors, which in various combinations can determine its tissue and developmental-age-specific expression (Roy and Chatterjee, 1995).Presence of putative CREB binding sites located around -500 bp position of the human AR promoter and in sequences containing the 5’ untranslated region of the mouse AR gene have also been reported (Lindzey et al., 1993; Mizokami et al., 1994). These cis-elements may mediate CAMPaction on AR gene expression via the CREB protein. Hepatic expression of rat AR increases during sexual maturation and declines progressively during aging. The hepatic level of AR mRNA in a 20-month-old rat is about 70-fold lower than that of a 3-month-old young adult (Supakar et al., 1993). We have identified a novel cis-element at the rat AR promoter spanning -311 to -329 bp positions. It binds a positively acting nuclear factor, which shows an age-associated correlation similar to the age-dependent changes in the hepatic expression of the AR mRNA. We have designated it as the age-dependent factor (ADF). ADF activity in the rat liver is low before puberty, increases with maturation, and declines during aging. Titration of ADF
322
A. K. ROY et al.
activity in liver nuclear extracts from 3- and 24-month-old rats showed about a 7-fold decline. Mutational inactivation of the ADF site at the AR promoter caused about a 4-fold loss of promoter function. Although both the rat and mouse AR promoter contain ADF binding sites, it is precisely deleted from the human AR gene. Absence of the ADF element may be one of the reasons for the lack of any major age-dependent changes in the AR expression in the human liver. In most of the target cells, expression ofAR is greatly muted. This suggests critical roles of negative regulators in the control of AR gene expression. Several negatively acting transcription factors for the AR gene have been described. The potential role of ssPyrBF counteracting the positive regulatory role of Spl (S. Chen et al., 1997a) has already been mentioned. Two negative regulatory regions, one upstream and another downstream of the transcription initiation site of the mouse AR,have also been suggested (Kumar et al., 1994; Grossmann and Tindall, 1995). However, the nature of the repressor proteins has not been established. Studies in our laboratory have identified two negative regulatory elements at the rat AR gene promoter. One of these at -388 to -340 binds the transcription factor NF1 and an unidentified nuclear protein, whereas the other at -574 to -554 binds the NF-KB.The physiological relevance of the NF-KBsite is indicated by the fact that the age-dependent decline of AR gene expression in the rat liver parallels a gradual increase of NF-KBactivity in the nuclei of the liver cells (Supakar et al., 1995). Ligand-activated AR also exerts a considerable degree of autoregulation on AR gene expression (Krongrad et al., 1991; Wolf et al., 1993; Grossmann et al., 1994; Mora and Mahesh, 1996; Dai and Bernstein, 1996; Wiren et al., 1997). In some cells, androgens positively regulate AR gene expression, whereas in others, they act as negative regulators. In LNCaP cells, androgen down-regulates AR mRNA by about 3-fold within 49 h and a 4-fold reduction of AR gene transcription occurs 96 h after androgen treatment (Krongrad et al., 1991). However, in PC3 cells, transfected with an AR expression vector, androgen up-regulates AR expression and two ARES within the coding region of human AR cDNA that are separated by a 182-bpspace appear to be involved in this autoregulatory action (Dai and Bernstein, 1996). In addition to its regulation at the level of transcription, AR can also control translation of its corresponding mRNA. The 5’ untranslated region of the human AR mRNA has been implicated in the stimulation of AR mRNA translation (Mizokami and Chang, 1994). A potential stem-loop structure within this region may contribute to such enhancement of translational activity. All of these observations clearly highlight the complexity of the reg-
REGULATION OF ANDROGEN ACTION
323
ulated expression of the AR gene under different developmental and physiological conditions. IV. LIGAND-MEDIATED ACTIVATION AND INHIBITION OF ANDROGEN RECEPTOR FUNCTION
A. ROLEOF THE HORMONAL LIGAND IN RECEPTOR ACTIVATION One of the structural characteristics of all naturally occurring hormonal steroids is an 0x0-functional group at the C-3 position of the steroid backbone. For C-19 androgenic steroids, another important structural requirement is the presence of a 17P-hydroxy group. Additionally, the stereochemistry of the A-B ring region of the steroid backbone in trans orientation is needed for effective AR-ligand interaction. Because of these structural requirements, 5a-dihydrotestosterone functions as the most potent natural androgen. On the basis of the relative lengths of the A/B domains, members of the NR superfamily can be divided into two subgroups (Tsai and 0’Malley, 1994). In the absence of corresponding ligands, members of one of the subgroups with a relatively long A-B domain, represented by AR, GR, PR, MR, and ER, form cytoplasmic complexes with heat-shock proteins (hsp90, hsp70, and hsp56), whereas members of the other subgroup represented by TR, retinoic acid receptor (RAR), retinoid X receptor (RXR), vitamin D receptor (VDR), PPAR, and most orphan receptors are localized in the nucleus even in the absence of the corresponding hormonal ligands. Ligand binding to NRs with a longer A-B domain results in conformational perturbations leading to dissociation of the heat-shock proteins, exposure of phosphorylation sites, receptor dimerization, and nuclear translocation. Ligand-dependent changes in the receptor conformation can be followed by differential sensitivity of the receptor protein to protease digestion (Beekman et al., 1993). Even minor differences in the conformation of the AR due to its binding either to an agonist or an antagonist, can be distinguished by the peptide pattern generated by limited digestion with trypsin (Kuil and Mulder, 1995). Compared to T, DHT binds to AR with a higher affinity and DHT-AR dissociates with a slower rate than T-AR complex (Grino et al., 1990;Zhou et al., 1995).Furthermore, after its dissociation from the ligand, AR undergoes rapid degradation and the androgen-bound AR is -6-fold more stable than the receptor after its dissociation from the ligand (Kemppainen et al., 1992). The higher affinity of DHT for AR, slower rate of dissociation of the DHT-AR complex and the greater sta-
324
A. K. ROY et al
bility of the liganded receptor protein may contribute to the status of DHT as a “superandrogen.” At the molecular level, the transduction of the androgenic signal to gene expression mediated by changes in the receptor conformation has mostly been explored through the MMTV LTR as a model target. The MMTV LTR functions as a very effective target for C-21-C-19 steroid receptors. However, as already mentioned, in the transient transfection assay it lacks the discriminatory function for various C-21-C-19 steroid hormone receptors. This has led to some concern in the interpretation of results obtained with this model, especially because of the observation that mutations within the hormone regulatory elements of MMTV LTR can alter its receptor preference for transcriptional activation (Gowland and Buetti, 1989).Nevertheless, MMTV LTR has served as a very useful tool for exploring androgen action and studies with this system have revealed that among the naturally occurring androgens (at physiological concentrations), DHT is the most potent mediator of the AR transactivation function. However, at a high ligand concentration (-100 nM) estradiol-17p and progesterone increased the AR-mediated activation of the MMTV promoter function by 5- to 10-fold.At this high concentration, the synthetic antiandrogenic steroid cyproterone acetate also caused about 50-fold stimulation of the MMTV promoter by AR in transfected CV1(monkey kidney derived) cells. At 1 0 - aconcentration, even the nonsteroidal antiandrogen hydroxyflutamide showed agonist activity with about a 25-fold increase in the MMTV-driven CAT activity in AR-transfected CV1 cells (Kemppainen et al., 1992).Additionally, the observation of the AR-mediated transcriptional activation of the MMTV LTR by certain herbicides and pesticides has raised concerns about their widespread application in the environment (Wong et al., 1995). Results of the foregoing in vitro studies clearly show that, at high concentrations, a large number of nonandrogenic ligands are capable of binding t o the AR and transactivating the target gene. It is also a possibility that when the AFt is increased to an abnormally high level, physiological concentrations of cross-reactive ligands are sufficient to induce the androgen response. This is one of the possible explanations for the finding that in transgenic female mice, even in the absence of androgen treatment, targeted overexpression of t h e m in the liver causes its virilization (Chatterjee et al., 1996).Thus, a high concentration of either the cross-reactive ligand or the cross-reactivereceptor may evoke a receptor-specific biological response. However, phylogenetic analysis has suggested that ancestral orphan receptors that do not require any activating ligand may have preceded the evolution of the ligand-activated members of the NR superfamily (Escriva et al., 1997).Thus, a vestigial property of weak nonligand-mediated activation function of AR cannot be discounted totally.
325
REGULATION OF ANDROGEN ACTION
For the androgen receptor, a 258-amino-acid-long stretch spanning positions 653 to 910 has been implicated in the formation of its steroid binding pocket (Simental et al., 1991; Jenster et al., 1991). The ligandbinding sites for steroid receptors are created by protein folding in a fashion similar to the active sites of catalytic enzymes. For both the catalytic sites of enzymes and ligand-binding sites of the receptors, a balance between binding affinity-dissociation rate and the substrate-ligand specificity is of critical importance. The low-affinity substrate binding sites of catalytic enzymes can utilize a number of weak interactions to design their active center allowing a higher discriminatory property. However, creation of high-affinity ligand-binding sites of steroid hormone receptors primarily on the basis of strong hydrophobic interactions limit the discriminatory options, resulting in a compromised ligand-specificity. Despite the dominant role of relatively nonspecific hydrophobic interactions, a stringent three-dimensional structure seems to be a requirement for the AR LBD in the maintenance of its ligand-specificity. This is reflected by the observation that a single amino acid substitution (from Thr to Ala) due to a point mutation (from A to G) in the exon 8 of the human AR considerably alters the ligandspecificity of the receptor protein found in prostate-cancer-derived LNCaP cells (Harris et al., 1990;Veldscholte et al., 1990).Furthermore, it now appears that ligand-induced conformational change may play an important role in the stabilization of the ligand-NR complex. Introduction of the ligand into the steroid-binding pocket of the NR causes a backward folding of the extreme C-terminal helix over the bound ligand, thereby hindering its dissociation (Brzozowskiet al., 1997).
LIGANDSWITH ANTIANDROGENIC B. HIGH-AFFINITY
ACTION
Binding of the ligand at the specific steroid binding pocket of the AR causes conformational change of the receptor protein. Furthermore, androgen agonists and antagonists alter the receptor conformation differently so that only agonist-induced conformational changes can initiate the cascade of steps that ultimately leads to transcriptional regulation. Based on these rationales, it has been argued that all highaffinity ligands for the AR may not promote conformational changes that are conducive t o its transactivational function. Furthermore, highaffinity ligands that do not cause transcriptional activation of the AR target genes should prevent the hormonal agonists from interacting with the ligand-binding site of the receptor protein. Screening of a large number of synthetic compounds for AR binding and activation function has led to the selection of three potent antiandrogens for clinical applications. Among these, the first successfully used antiandrogen is the
326
A. K. ROY et al.
cyproterone acetate, which is a steroid derivative. However, this compound possesses partial agonistic activity, and it is also an activator of the progesterone receptor (Neumann and Jacobi, 1982). The two other potent antiandrogens, hydroxyflutamide and Casodex, are nonsteroidal compounds (Neri et al., 1979; Furr, 1995). Unlike cyproterone acetate, hydroxyflutamide does not have any progestin activity. However, in the MMTV promoter assay it shows agonist activity at concentrations greater than 1 JJM(Kemppainen et al., 1992). The most recently introduced antiandrogen, Casodex, has a higher affinity for AR than hydroxyflutamide and at 1-@concentration in the culture medium, it did not cause transcriptional activation of the stably integrated MMTV-CAT in CV1 cells (Fuhrmann et al., 1992). However, the sensitivity of this stable transfection assay is not as high as that of the transient transfection, as it failed to detect the agonistic activity of both cyproterone acetate and hydroxyflutamide. All of these antiandrogens are currently being used in the treatment of various clinical conditions (e.g., prostate cancer) that require pharmacological regulation of androgen action. Other synthetic antiandrogens that are being considered for therapeutic applications include nilutamide and WIN 49596 (Janknegt et al., 1993; Winneker et al., 1989).
V. ENZYMATIC REGULATION OF ANDROGEN ACTION Enzymatic modification of steroid hormones in target cells plays an important role in the overall control of hormone action. It involves activation, inactivation, and attenuation of the hormonal signal. Additionally, it can enhance the specificity of the hormonal ligand within the overlapping and cross-reactive signal transducing processes. The major pathways for enzymatic activation and inactivation of androgens are outlined in Fig. 2.
A. ACTIVATIONAND hACTIVATION OF ANDROGENIC STEROIDS BY 5a-REDUCTASE AND HYDROXYSTEROID DEHYDROGENASE Testosterone is the major androgenic steroid secreted by the Leydig cells of the testes. In most of the major target tissues, it is converted to 5a-dihydrotestosterone by the enzyme steroid 5a-reductase. Although this enzyme was identified in the early 1950s (Schneider, 19521, its role in the activation of the androgenic steroids was not realized until the late 1960s when two groups of investigators reported that androgen targets such as the rat ventral prostate contained high concentrations of
327
REGULATION OF ANDROGEN ACTION 0-GIUC
fl
OH@OH
Testosteroneglucuronide
@KuDp
Testosterone sulfate PAP*
UDP-Gtu-COOH
PAPS
NADPH
0
Testosterone
Androstanediol
NADPH, NADH
NADP+
H Dihydrotestosterone
NADPH + 0 2
HO Estradiol
FIG.2. Major enzymatic pathways for androgen modification in target cells. Steps 1 and 5 are irreversible, whereas step 4 is a reversible reaction. Steps 2 and 3 can be reversed by separate enzymatic pathways involving steroid sulfatase and steroid glucuronidase, respectively.
5a-reductase and that DHT bound to AR accumulates in the prostatic nuclei (Anderson and Liao, 1968; Bruchovsky and Wilson, 1968). Reduction of the androgenic steroids a t the 501 position also makes them more susceptible to further reduction by 301- and 3P-hydroxysteroid dehydrogenases. The resultant hydroxylated steroids can subsequently be modified by enzymatic sulfonation and glucuronidation (Russell and Wilson, 1994). Androgen sulfates and glucuronides do not bind to AR and are hormonally inactive. Two isoforms of 5a-reductase have been cloned and genetic disorders associated with mutations in the 5a-reductase type 2 gene have been identified (Wilson et al., 1993). Males with this disease are born with differentiated male internal genitalia, but lack the male external genitalia and prostate. These observations extend the conclusions drawn from biochemical and molecular studies and explain how conversion of
328
A. K. ROY et a2
testosterone to DHT in target cells plays a critical role in the development of male reproductive organs during embryogenesis and in their appropriate functioning in the adult. Because of their potential clinical applications, inhibitors of 5a-reductase have been the subject of considerable research interest. Certain 4-azasteroids were shown to be potent inhibitors of this enzyme (Liang et al., 1984). One of these azasteroids, finasteride, is currently being used as a therapeutic agent to control benign prostatic hyperplasia (Imperato-McGinley et al., 1990; Imperato-McGinley, 1994). It is of interest to note that naturally occurring y-linolenic acid can also inhibit 5areductase activity (Liang and Liao, 1992). Specific androgen-inactivating enzymes are also involved in the regulation of androgen action in target organs. Two major pathways of androgen inactivation in target cells have been identified, one involving hydroxysteroid dehydrogenase and another mediated by hydroxysteroid sulfotransferase (Gurpide, 1978; Roy, 1992). Although hydroxysteroid dehydrogenases catalyze both oxidation and reduction, tissue-specific expression of individual isoforms with predominantly reductase or dehydrogenase activity can provide the directionality of the enzymatic conversion (Penning, 1997). 17P-Hydroxysteroiddehydrogenase can reversibly act on testosterone to produce androstenedione and on 5a-dihydrotestosterone to produce 5a-androstanedione, whereas 3aand 3p-hydroxysteroid dehydrogenases can convert Sa-dihydrotestosterone to 3a- and 3P-androstanediols and vice versa. All of these metabolized forms of testosterone and DHT have very weak androgenic activity. Genetic deficiency of the type I11 isoform of 17P-hydroxysteroid dehydrogenase is known to cause pseudohermaphroditism in the male (Andersson et al., 1996). This is primarily due to decreased formation of testosterone from androstenedione in the testes. A severe form of 3Phydroxysteroid dehydrogenase deficiency can also cause pseudohermaphroditism in the male (Simard et al., 1995; Penning, 1997). In contrast to these developmental defects, mediated primarily due to altered androgen biosynthesis, the 3a-hydroxysteroid dehydrogenases are capable of regulating androgen action in target cells. In the prostate, this enzyme converts the potent androgen DHT to 3a-androstanediol, which binds poorly to AR (Liao et al., 1973; Taurog et al., 1975). However, in the case of dog, where age-related hypertrophy of the prostate is a species-specific phenomenon, it has been suggested that the prostateexpressed isoform of this enzyme catalyzes the reverse reaction to maintain a high level of receptor-active androgens (Jacobi et al., 1978; Isaacs, 1983). These findings have led to the search for specific in-
REGULATION OF ANDROGEN ACTION
329
hibitors of the enzyme with potential therapeutic applications for prostatic hypertrophy and hyperplasia (Penning, 1997). Oxidoreductive modification not only activates or inactivates androgenic steroids, it can also provide a mechanism for their target cell discrimination. Enzymatic modificaiton of androgens appears to provide the basis for their differential effect on the reproductive tissues and skeletal muscle (Celotti and Cesi, 1992; Roy et al., 1997).The myotropic function of “anabolic steroids” is of considerable public interest because of their potential abuse by athletes (Wilson, 1988). The enzyme 5a-reductase is widely expressed among both reproductive and nonreproductive target tissues. Target cells in reproductive tissues such as the prostate and seminal vesicle express high levels of 5au-reductase, whereas skeletal muscle contains a very low level of this enzyme (Russell and Wilson, 1994). One of the synthetic steroids, 19-nortestosterone, is less than half as effective as testosterone in its ability to bind to AR.However,when nortestosterone is converted to its 5a-dihydro derivative (5a-dihydronortestosterone)by 5a-reductase, its ability to interact with AR is further reduced. Thus, in the reproductive tissues, which contain high levels of 5a-reductase, 19-nortestosterone shows very low hormonal response, whereas it maintains its effectiveness on the skeletal muscle (Toth and Zakar, 1982). OF ANDROGENS BY HYDROXYSTEROID B. INACTIVATION SULFOTRANSFEMSE
Hydroxysteroid sulfotransferases catalyze sulfonation reactions by transferring the sulfate group from phosphoadenosinephosphosulfate (Roy, 1992; Hobkirk, 1993; Wood et al., 1996; Strott, 1996). Sulfonated steroid hormones do not bind to their corresponding receptor proteins and, therefore, are hormonally inactive. Both androgen- and estrogen-specific sulfotransferases have been cloned and characterized (Chatterjee et aE., 1987; Ogura et al., 1989; Nash et al., 1988; Demyan et al., 1992). Recombinantly produced androgen-specific sulfotransferase produced in the baculoviral expression system shows that the enzyme is capable of sulfonating both testosterone and DHT (Chatterjee et al., 1994). However, steroids that are acted on initially by the hydroxysteroid dehydrogenase are preferred substrates for the androgen sulfotransferase. Studies on spatiotemporal changes in androgen sensitivity of the rat liver during maturation and aging show that differential androgen sensitivity within the liver lobule precisely correlates with the cellular pattern of up-regulation and down-regulation of androgen and estrogen sulfotransferases (Manciniet al., 1991,1992).Fur-
330
A. K. ROY et al.
thermore, in a heterologous cell system, transfected androgen sulfotransferase inhibits DHT-mediated stimulation of the MMTV-CAT and probasin-LUC with about 95% efficiency (Chan et al., 1998). All of these results point to an important enzymatic component in the ageand tissue-specific inactivation of androgen action. PATHWAYS FOR ANDROGEN MODIFICATION C. OTHERENZYMATIC In addition to the enzymatic activation and inhibition of androgen action by target cell AR described earlier, androgen action can also be mediated through the estrogen receptor system. Such an interaction is achieved through conversion of testosterone to estradiol by the enzyme aromatase present in many target tissues, especially in adipose tissues and in the brain (Thompson and Siiteri, 1974;Abdelgadir et al., 1997). Conversion of the androgen to estradiol allows target cells to use the estrogen receptor for mediating androgen function. Aromatase-mediated conversion of testosterone to estradiol is thought to play an important role in the development and maintenance of male and female patterns of sexual behavior. Additionally, genetic deficiency of P-450 aromatase in man can cause eunuchoid skeleton and spermatogenic defects (Carani et al., 1997). Formation of testosterone glucuronide catalyzed by the hepatic enzyme androgen UDP-glucuronosyltransferase appears to serve primarily as a mechanism for inactivation and clearance of androgens from the systemic circulation rather than to regulate androgen action at the level of target cells (Rittmaster et al., 1989). However, an androgen-dependent increase in the UDP-glucuronosyltransferase in LNCaP cells suggests a potential regulatory role of glucuronidation in androgen action (Guillemette et al., 1996). Finally, the enzymatic synthesis of functional androgens from hormonally inert steroids, in AR-containing target cells, may significantly contribute t o androgen action. Despite low levels of serum testosterone, the intraprostatic concentration of DHT in castrated men is reported to be unusually high (-40% of the normal) (Labrie, 1991). High levels of functional androgens in the prostate in the absence of the testicular source could be due to the local synthesis of androgens from the adrenal-derived DHEA and DHEA-sulfate. Such conversion would require a concerted action of steroid sulfatase, 3P-hydroxysteroid dehydrogenase, 17P-hydroxysteroid dehydrogenase, and 5a-reductase. Thus, a more effective inhibition of androgen action in life-threatening clinical conditions such as prostate cancer would require a combination therapy involving the removal of the endocrine source, inhibition of andro-
REGULATION OF ANDROGEN ACTION
33 1
gen generating enzymes in the target cells, and use of antiandrogens that block AR function.
VI. MEDIATION OF ANDROGEN ACTIONBY PEPTIDE GROWTH FACTORS Physiological regulation of development, growth, and differentiated functions requires complex coordination among endocrine, paracrine, and autocrine regulators. The critical role of paracrine mediation of androgen action was initially indicated in the developing mouse mammary gland. Both in tissue recombination experiments and in cocultures of dissociated cells derived from normal and AR-negative XTfmN embryos, it was observed that the presence of the wild-type mesenchyme was essential for testosterone-dependent regression of the glandular epithelium (Kratochwil and Schwartz, 1976; Drews and Drews, 1977). A similar and more detailed analysis of tissue recombination from testicular feminized (Tfm) and wild-type animals in the prostatic development produced identical results; that is, androgen-dependent epithelial differentiation occurred only when the mesenchymal layer was derived from normal and not from Tfm mice (Cunha and Lung, 1978; Cunha et al., 1983). These studies also showed that androgen-induced morphogenesis can proceed even if the epithelial layer is derived from the Tfm genotype, provided the mesenchymal layer is of wild-type origin. Taken together, these results led to the conclusion that certain paracrine mediators induced by androgen action on the mesenchymal cells influence the male-specific epithelial differentiation. Further analysis of the mesenchymal mediator of androgen action on epithelial cells indicated that androgen-sensitive mesenchymal cells secrete a member of the fibroblast growth factor family known as keratinocyte growth factor (KGF) or fibroblast growth factor-7. Prostatic epithelial cells, but not the mesenchymal cells, express a splice variant of the bek receptor gene that specifically binds to KGF (Yan et al., 1992). The role of KGF as a secondary mediator of androgen action was further substantiated by the finding that KGF can replace testosterone in supporting the ductal branching of the rat ventral prostate during morphogenesis in vitro and antibody to KGF can inhibit this process (Cunha, 1996). However, KGF-null mice failed to show any developmental abnormality of the prostate or other reproductive tissues (Guo et al., 1996). The latter observation may indicate a redundancy of the growth factor signaling pathways. It is also of interest to note that -225 to +190 region of the human KGF promoter can provide cell-typespecific expression of this gene in both human and murine fibroblasts.
332
A. K. ROY et al.
This region is also highly conserved (-80% homology among rat, mouse, and human) and contains two weak androgen-responsive regions (Finch et al., 1995; Fasciana et al., 1996). In addition to the stimulating effect of androgens on proliferation and differentiation of the prostatic epithelial cells (especially the basal cells) mediated by the KGF, an inhibitory effect of another mesenchymal-derived growth factor, transforming growth factor P (TGFP)has also been implicated. TGFf.3 inhibits androgen-induced growth and ductal morphogenesis of the developing mouse prostate (Cunha, 1996). In the adult gland, TGFP is down-regulated by androgens and it is expressed at a high level during prostatic regression after castration (Kyprianou et al., 1991). Thus, the epithelial-mesenchymal interactions in the androgen-regulated organs may involve a dual control mechanism with a positive mediator, KGF, and a negative mediator, TGFP.
VII. ANDROGEN ACTIONIN TARGETCELLSCONTAINING HIGHLEVELS OF ANDROGENS AND ANDROGEN RECEPTOR Androgenic influence on target-cell function depends on a large number of variables that include the local concentration of androgens and androgen-dependent paracrine mediators, the target cell level of AR and receptors for the paracrine mediators, cellular levels of androgenactivating, inactivating, converting enzymes, cellular level of heat shock and other proteins that bind AR, nuclear level of AR coactivators-corepressors, and chromosomal arrangement-methylation status of the androgen target genes. Among these variables, the available amounts of the androgenic ligand and the AR are the two major determinants in the mediation of androgen action. In this last section, we highlight some of the complexities and challenges in androgen action with two types of target tissues, one containing high levels of the androgenic ligand and the other with high levels of AR.
A. ANDROGEN ACTION IN ADRENAL CORTEX AND TESTIS We have developed a highly sensitive and quantitative assay for the AR mRNA based on a competitive reverse transcriptase polymerase chain reaction (Supakar et al., 1993). Using this assay, we have examined the steady-state levels of AR mRNA in various tissues of the male rat. Our results show that all tissues examined so far express quantifiable amounts of AR mRNA with highest level in the prostate (10,100 pg/pg total RNA) and lowest in the spleen (70 pg/pg). Interestingly, the
FIGURE 3. Immunolocalization of the androgen receptor in mouse adrenal, testis, and prostate. (A) Adrenal gland showing scattered nuclear staining only in the cortical portion of the gland (in all three zones, glomerulosa sasciculata and reticularis); the medullary part of the gland is marked with the letter M. (B) An enlarged picture of the adrenal cortex showing nuclear immunoreactivity not only within the three adrenocortical zones, but also in the flat capsular cells (marked with arrowheads). (C) Testis; in addition to Leydig cells (circled and labeled with the letter L) and several other cell types, the spermatids within the germinal epithelium show intense immunoreactivity. (D)Prostate showing nuclear immunostaining of both epithelial and stromal cell types. All sections were lightly counterstained with hematoxylin.
This Page Intentionally Left Blank
REGULATION OF ANDROGEN ACTION
333
adrenal gland also contains a relatively high level of AR transcript (2400 pg/pg); the adrenal from the female rat showing about a third as much AR mRNAcompared to its male counterpart. These results are in general agreement with relative levels of AR in these tissues determined by Western blot and ligand-binding assays for the AR protein (Bentvelsenet al., 1996).Western blot assay has also demonstrated that the total rat testicular extract contains approximately as much immunoreactive AR as the adrenal gland of the female. Cellular localization of immunoreactiveAR in the adrenal, testis, and prostate is shown in Fig. 3 (see color plate). In the adrenal gland, highly immunoreactiveAR-containingcells are seen only in the adrenal cortex, the steroidogenic portion of this composite endocrine organ. These AR-containing cells are scattered in all three zones (glomerulosa, fasciculata, and reticularis) as well as in the flat cells of the outer capsule. The female pattern of staining (not shown in the figure) is similar to the male with fewer immunopositive cells distributed throughout the cortex. These results extend the observations made with the monkey adrenal gland (Hirst et al., 1992). The functional role of AR in adrenocortical cells has not been adequately explored and remains obscure. Androgens may be involved in the regulation of corticosterone biosynthesis (Kitay et al., 1966).Endocrine manipulations have indicated that AR level in the adrenal cortex is up-regulated by androgens and it is not influenced by the pituitary adrenocorticotropin (ACTH), which is the major regulator of the adrenocortical function (Bentvelsen et al., 1996). These observations are consistent with the sexually dimorphic pattern of AR expression in the adrenal cortex, with up-regulation of AR by androgens in the male (Toscano et al., 1990). Immunolocalization of AR in testicular cells has previously been described by several groups of investigators (Ruizeveld de Winter et al., 1991; Bremner et al., 1994; Vornberger et al., 1994; Shan et al., 1997). In addition to Leydig and Sertoli cells, high expression of AR is also observed in peritubular myoid cells and cells of the arterioles. However, the presence of AR in germ cells has been controversial. In our hands, Bouin-fixed parrafin sections of mouse testis immunostained with an affinity-purified antipeptide AR antibody, clearly show immunostaining not only in Leydig and Sertoli cells but also in spermatids (Fig. 3). We feel that the observed lack of immunostaining of the spermatogenic cells, as reported by certain authors (Ruizeveld de Winter et al., 1991; Bremner et al., 1994),may be due to incomplete fixation and/or antigen retrieval. Irrespective of this controversy, presence ofAR in the androgen-secreting Leydig cells and in the paracrine Sertoli cells are well established. Again, similar to steroidogenic cells of the adrenal cortex,
334
A. K. ROY et al.
presence of AR in the Leydig cells, which are the main source of androgens, potentially creates an autocrine loop and a regulatory paradox. Elucidation of the molecular biology of androgen action in these two cell types will, therefore, provide interesting insights into the cellular control of steroid hormone action. Regulation of androgen action in Sertoli cells is thought to be influenced by CAMP.Sertoli cells are targets of the pituitary FSH, which can activate adenyl cyclase and increase the level of CAMP(Sanborn et al., 1991; Blok et al., 1992).Among its many cellular functions, CAMPregulates CREB, a transcription factor that binds to CRE (Gonzalez and Montminy, 1989; Meyer and Habener, 1993; Lamas and Sassone-Corsi, 1997). The AR gene promoter contains a CRE that functions as a positive regulator for this gene (Lindzeyet al., 1993; Mizokami et al., 1994). The level of AR in Sertoli cells undergoes marked changes during different stages of the spermatogenic cycle. A progressive increase in the Sertoli cell AR from stage I through stage VII is followed by a precipitous decline at stage VIII. The low level of AR is maintained for the remainder of the spermatogenic process (up to stage XII) and begins to rise again after stage I (Bremner et al., 1994). Such a cyclic change of AR expression in the Sertoli cell correlate with the cellular level of CREB, providing a functional relevance of the molecular finding concerning the identification of CRE at the AR gene promoter.
ACTION IN PROSTATE B. ANDROGEN During embryogenesis, the prostate gland develops from the urogenital sinuses under the guidance of the androgen DCT. In the adult, the prostate functions as a secretory organ and is composed of many different cell types, which can be broadly grouped into two classes: epithelial and stromal cells. The fibromuscular stromal tissue serves as a supporting layer for the secretory epithelial layer of the gland. Among the epithelial cells that line the secretory lumen of the gland and the secretory ducts, two distinct subtypes can be recognized. These are the columnar epithelial cells situated on the luminal side and the nonsecretory basal cells located along the basement membrane. The basal cells are thought to be the progenitors of the columnar cells. In addition to its embryonic development, both the maintenance of the normal tissue architecture and the secretory function of the prostate gland are regulated by androgens. After androgen withdrawal, the prostatic epithelium, compared to the stroma, undergoes disproportionate degrees of involution through apoptotic cell death, which can be reversed by androgen supplementation (DeKlerk and Coffey, 1978; Evans and Chan-
REGULATION OF ANDROGEN ACTION
335
dler, 1987; Kyprianou and Isaacs, 1988; Isaacs et al., 1994). Such a reversible cycle of involution and growth of the prostatic epithelium constitutes normal physiology of seasonal breeders such as deer and sheep (Johnson and Everitt, 1988). In most mammals, except man, dog, and lion, the prostate gland ceases to grow after sexual maturation. In man, the prostate gland begins to show signs of hyperplasia at about the fourth decade of life with extensions of branches of epithelial ducts around the urethra (McNeal, 1983). These prostatic outgrowths during old age cause obstruction of the urethra and produce the clinical condition of benign prostatic hyperplasia (BPH). The hyperplastic growth associated with BPH enhances the chance for carcinogenesis in both epithelial and stromal tissues. Since BPH is an androgen-dependent phenomenon, a number of different endocrine interventions, including androgen withdrawal (by castration) and inhibition of AR function (by androgen antagonist) or inhibition of androgen activation (by inhibiting 5a-reductase) can all ameliorate this clinical condition. Besides its important clinical relevance, the exquisite sensitivity of the prostatic epithelial cells to androgens has made this cell system a favorite model for studying the molecular basis of androgen action. Both the maintenance of differentiated functions and cell proliferation-apoptosis in the prostatic epithelial cells are regulated by androgens (Isaacs, 1994). In contrast to the maintenance of differentiated function, androgenic regulation of cell proliferation may be limited only to cells with unusually high levels ofAR, as seen in the prostate and the seminal vesicle. Effects of androgens on the regulation of well-characterized genes of secretory proteins such as the human prostate-specific antigen (Riegman et al., 1991; Luke and Coffey, 1994) and rat probasin (Rennie et al., 1993) are serving as prototypes for exploring the mechanism of androgenic regulation of differentiated functions. For studies on androgenic regulation of prostatic cell proliferation and apoptosis, cyclin-dependent kinases (CDKs) and clusterin have been the focus of investigative inquiry (Lu et al., 1997; Bruchovsky et al., 1996). However, a complete understanding of the basic mechanism of AR function in the context of specific target gene expression is certainly the critical issue and will have an important impact on all of these inquiries. To explore the mechanism of androgenic regulation of specific gene expression, genes encoding a number of prostatic secretory proteins including human PSA, prostate-specific glandular kallikrein (hK2) (both members of the serine protease family) and human prostatic acid phosphatase (hPAP),rat probasin and rat steroid-binding protein prostatein have been cloned and characterized (Allison et al., 1989;Riegman et al.,
336
A. K. ROY et al.
1991; Tan et al., 1992; Rennie et al., 1993; Murtha et al., 1993; Banas et al., 1994).Among these secretory proteins, androgenic regulation of probasin has been brought to the most advanced level with extensive characterization of the androgen response elements and androgen responsive regions of the gene promoter. Both rat probasin and C3 promoters have also been used successfully to target an oncogene to the transgenic mouse prostate (Greenberg et al., 1995; Maroulakou et al., 1994). Of particular interest among the inducible prostatic genes, in the general context of androgen action, is the calreticulin (Michalak et al., 1992). It is a calcium-binding protein which also contains a nuclear localization signal and a peptide domain that can specifically interact with KXGFFKR(X = G, A, or V), a sequence motif present within the DNA-binding domain of a number of NRs, including the AR (Dedhar et al., 1994;Bruchovsky et al., 1996).In the electrophoretic mobility shift assay, preincubation of AR with calreticulin totally abolishes its ability to bind labeled ARES.From these observations, it appears that androgen-dependent up-regulation of calreticulin may serve as a brake to control the extent of androgen signaling after reaching its optimal function. It is tempting to speculate that a similar mechanism may control AR function in Leydig and adrenocortical androgen-producing cells, where high levels of both androgens and AR will otherwise run amok. Clusterin was initially identified in the rat prostate as one of the testosterone-repressed prostatic mRNAs (TRPM-2) (Buttyan et al., 1989).It is a 78-kDa dimeric protein where both of the subunits are derived from a single precursor protein. Clusterin is highly expressed in cells undergoing apoptosis, and in the prostate it is repressed by androgens and is up-regulated after androgen withdrawal (Ahuja et al., 1994; Bruchovsky et al., 1996). However, whether such correlative effects are causally related to apoptosis or merely reflect changes associated with the apoptosis response, is not clear. Studies with human prostate cancer-derived cells have indicated the possible role of androgens in the regulation of CDKs that are involved in mitosis. Androgen treatment ofAR-positive LNCaP cells, but not ARnegative PC3 cells, causes a rapid up-regulation of CDK2 and CDK4 genes. Androgen-mediated up-regulation of CDK2 and CDK4 genes was concomitantly associated with a down-regulationof the CDK inhibitor p 16 (Lu et al., 1997).These specific changes in gene expression can propel the LNCaP cells into the S phase of the cell cycle and promote their proliferation. Again, whether these changes are midstream events of cells already committed to enter the S phase due to some other upstream effect of the AR-mediated signaling mechanism of cell prolifer-
REGULATION OF ANDROGEN ACTION
337
ation or one of the primary events that lead to cell proliferation remain to be established. These results make one important point that in LNCaP cells androgen itself, without the assistance of paracrine factors, may be able to promote mitogenesis, provided that these cells have not acquired the ability to express growth factor genes during carcinogenesis. Using a polymerase chain reaction (PCR)-based cDNA subtraction method, a group of investigators have generated a catalog of rat prostatic mRNAs that are either up- or down-regulated by androgens (Wang et al., 1997). Using this screening procedure, they have identified 25 mRNAs that are up-regulated by androgens and through statistical means predicted that androgens upregulate about 56 total genes in the rat prostate. They also identified 4 genes that are down-regulated by androgens (including TRPM-2) and estimated that 6 other genes may be under the negative control of androgens. Known genes (present in the cDNA sequence database) that were found to be up-regulated through this screen include two prostateins (C2A and C3), sperminebinding protein, probasin, two cystatin-related proteins (1and 2), calreticulin, farnesyl pyrophosphate synthelase, low-density lipoprotein (LDL) receptor, adrenomedulin, and histo-blood group A transferase. According to the authors, the last five cDNAs represent novel androgen-regulated genes of the prostate. However, as mentioned before, the androgenic induction and possible functional role of calreticulin have already been described (Bruchovsky et al., 19961, and the authors may have been unaware of these developments. Elucidation of the functional significance of the other cDNAs and those without a corresponding match in the database may provide important new information concerning the regulation of androgen action in the prostate.
VIII. SUMMARY Hormonally active androgens are C-19 steroids with an oxo-functional group at the C-3 position and a hydroxy group at 17p. Testis and adrenal cortex are the two principal androgen secreting glands. Androgenic steroids relay their signaling function by specifically binding to the androgen receptor in target cells. Such ligand-receptor interaction results in conformational changes of the receptor protein leading to a cascade of events that include dissociation of the receptor from heatshock proteins, receptor phosphorylation, translocation into the nucleus, binding to the androgen response elements at the target gene, destabilization of nucleosomal structure, and activation of the target gene
338
A. K. ROY et a1
transcription. Regulation of androgen action occurs at the level of both the hormonal ligand and the receptor protein. Androgen target cells contain steroid modifying enzymes that can activate, inactivate, and alter the receptor specificity of androgens. Steroid 5a-reductase converts testosterone to 5a-dihydrotesterone, which is a more potent androgenic ligand. Tissue-specific expression of 5a-reductase varies considerably with prostate having very high and muscle having very low levels of this enzyme. During embryogenesis, deficiency of the type 2 isozyme of 5a-reductase causes developmental abnormalities of male reproductive organs. Males with severe genetic deficiency of this enzyme are born without the male-type external genitalia and also lack prostate. In the middle-aged human male, pharmacological inhibition of this enzyme can retard the age-associated growth of the prostate gland. Two major enzymatic pathways for androgen inactivation in target cells are mediated by hydroxysteroid dehydrogenase and hydroxysteroid sulfotransferase. Additionally, target cells that contain aromatase can convert testosterone to estradiol and relay the androgenic signal through the estrogen receptor pathway. A number of synthetic ligands can bind to the androgen receptor with high affinity, but do not significantly activate the receptor protein. Some of these synthetic ligands, such as cyproterone acetate, hydroxyflutamide, and Casodex are being used as therapeutic agents to regulate androgen action in clinical conditions involving abnormal androgen function. The paramount role of the androgen receptor in the mediation of androgen action in target cells is indicated by the complete androgen-insensitivity phenotype associated with mutational inactivation of the androgen receptor gene. This observation suggests that most of the androgen signaling is mediated through a single gene product, that is, the androgen receptor. Target cells, such as the epithelial cells of the prostate that express high levels of the androgen receptor, also depend on androgens for cell survival. Androgen withdrawal leads to a massive apoptotic response in these cell types. Whether the regulation of mitotic-apoptotic response in these cells is directly controlled by androgens or through the mediation of paracrine growth factors is unclear. However, studies with prostatecancer-derived LNCaP cells have shown that androgen alone can promote mitogenesis by up-regulating the cyclin-dependent kinases. Finally, the control of runaway androgen action in androgen-producing endocrine cells of the testis and adrenal cortex, both of which also contain relatively high levels of androgen receptor, remains a regulatory enigma. It is possible that in these cells, androgens regulate the expression of a specific androgen receptor inactivating protein. Activation of this negative regulatory pathway, only at a high level of ligand-activated receptor, can prevent uncontrolled androgen action, and mal-
REGULATION OF ANDROGEN ACTION
339
functioning of this control mechanism during old age in certain mammalian species may result in hormonal carcinogenesis. ACKNOWLEDGMENTS We gratefully acknowledge the dedicated secretarial support of Ms. Nyra White. Studies on androgen action and androgen receptor gene regulation were supported by National Institutes of Health grants R37/R01 DK14744 and R01/R37 AG10486. Literature search for this review was completed in December 1997. REFERENCES Abdelgadir, S. E., Roselli, C. E., Choate, J. V., and Resko, J. A. (1977). Distribution of aromatase cytochrome P450 messenger ribonucleic acid in adult rhesus monkey brains. Biol. Reprod. 57, 772-771. Ahuja, H. S., Tenniswood, M., Lockshin, R., and Zakeri, Z. F. (1994). Expression of clusterin in cell differentiation and cell death. Biochem. Cell Biol. 72,523-530. Allison, J., Zhang, Y. L., and Parker, M. G. (1989). Tissue-specific and hormonal regulation of the gene for rat prostatic steroid-binding protein in transgenic mice. Mol. Cell. Biol. 9, 2254-2257. Anderson, K. M., and Liao, S. (1968). Selective retention of dihydrotestosterone by prostatic nuclei. Nature (London) 219,277-279. Anderson, S., Geissler, W. M., Wu, L., Davis, D. L., Grumbach, M. M., New, M. I., Schwarz, H. P., Blethen, S. L., Mendonca, B. B., Bloise, W., Witchel, S. F., Cutler, G. B. J.,Griffin, J. E., Wilson, J. D., and Russel, D. W. (1996). Molecular genetics and pathophysiology of 17 beta-hydroxysteroid dehydrogenase 3 deficiency. J. Clin. Endocrinol. Metab. 81, 130-136. Archer, T. K., Lefebvre, P., Wolford, R. G., and Hager, G. L. (1992). Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 255,1573-1576. Aronica, S . M., Kraus, W. L., and Katzenellenbogen, B. S. (1994). Estrogen action via the CAMP signaling pathway: Stimulation of adenylate cyclase and CAMP-regulated gene transcription. Proc. Natl. Acad. Sci. U.S.A.91,8517-8521. Baarends, W. M., Themmen, A. P., Blok, L. J., Mackenbach, P., Brinkmann, A. O., Meijer, D., Faber, P. W., Trapman, J., and Grootegoed, J. A. (1990). The rat androgen receptor gene promoter. Mol. Cell. Endocrinol. 7 4 , 7 5 4 4 . Banas, B., Blaschke, D., Fittler, F., and Horz, W. (1994). Analysis of the promoter of the human prostatic acid phosphatase gene. Biochim. Biophys. Acta 1217,188-194. Bannister, A. J., and Kouzarides, T.(1996). The CBP co-activator is a histone acetyltransferase. Nature (London) 384,641-643. Baulieu, E., Corpechot, C., Dray, F., Emiliozzi, R., Lebeau, M., Maurais-Jarvis, P., and Robel, P. (1965). An adrenal secreted “androgen”: Dehydroisoandrosterone sulfate. Its metabolism and tentative generalization on the metabolism of other steroid conjugates in man. Recent Prog. Horm. Res. 21,411-500. Beato, M., Herrlich, P., and Schutz, G. (1995). Steroid hormone receptors: Many actors in search of a plot. Cell (Cambridge, Mass.) 83,851-857. Beekman, J. M., Allan, G. F., Tsai, S. Y., Tsai, M. J., and O’Malley, B. W. (1993). Transcriptional activation by the estrogen receptor requires a conformational change in the ligand binding domain. Mol. Endocrinol. 7,1266-1274. Bentvelsen, F. M., McPhaul, M. J., Wilson, C. M., Wilson, J. D., and George, F. W. (1996). Regulation of immunoreactive androgen receptor in the adrenal gland of the adult rat. Endocrinology (Baltimore) 137,2659-2663. Blok, L. J., Hoogerbrugge, J. W., Themmen, A. P., Baarends, W. M., Post, M., and Groote-
340
A. K.ROY et al.
goed, J . A. (1992). Transient down-regulation of androgen receptor messenger ribonucleic acid (mRNA) expression in Sertoli cells by follicle-stimulating hormone is followed by up-regulation of androgen receptor mRNA and protein. Endocrinology (Baltimore) 131,1343-1349. Bremner, W. J., Millar, M. R., Sharpe, R. M., and Saunders, P. T. (1994). Immunohistochemical localization of androgen receptors in the rat testis: evidence for stage-dependent expression and regulation by androgens. Endocrinology (Baltimore) 135, 1227-1234. Brinkmann, A. O., Faber, P. W., van Rooij, H. C. J., Kuiper, G. G., Ris, C., Haassen, P., van der Korput, J. A., Voorhorst, M. M., van Laar, J. H., and Mulder, E. (1989). The human androgen receptor: Domain structure, genomic organization and regulation of expression. J. Steroid Biochem. 34,307-310. Brown, C. J., Goss, S. J., Lubahn, D. B., Joseph, D. R., Wilson, E. M., French, F. S., and Willard, H. F.(1989).Androgen receptor locus on the humanXchromosome: Regional localization to Xqll-12 and description of a DNApolymorphism. Am. J. Hum. Genet. 44,264-269. Bruchovsky, N., and Wilson, J. D. (1968). The conversion of testosterone to 5-alpha-androstan-17-beta-ol-3-one by rat prostate in vivo and in vitro. J. Biol. Chem. 243, 20 12-202 1. Bruchovsky, N., Snoek, R., Rennie, P. S., Akakura, K., Goldenberg, L. S., and Gleave, M. (1996). Control of tumor progression by maintenance of apoptosis. Prostate, Suppl. 6, 13-21. Brzozowski, A. M., Pike, A. C. W., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Ohman, L., Greene, G. L., Gustafsson, J. A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature (London) 389,753-758. Buttyan, R., Olsson, C. A., Pintar, J., Chang, C., Bandyk, M., Ng, P. Y., and Sawczuk, I. S. (1989). Induction of the TRPM-2 gene in cells undergoing programmed death. Mol. Cell. Biol. 9,3473-3481. Carani, C . , &in, K., Simoni, M., Faustini-Fustini, M., Serpente, S., Boyd, J., Korach, K. S., and Simpson, E. R. (1997). Effect of testosterone and estradiol in a man with aromatase deficiency. N. Engl. J.Med. 337,91-95. Cato, A. C., Henderson, D., and Ponta, H. (1987). The hormone response element of the mouse mammary tumour virus DNA mediates the progestin and androgen induction of transcription in the proviral long terminal repeat region. EMBO J. 6,363-368. Cavaillbs, V., Dauvois, S. L., Horset, F., Lopez, G., Hoare, S., Kushner, P. J., and Parker, M. G. (1995). Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J. 14,3741-3751. Celotti, F., and Negri, C. P. (1992). Anabolic steroids: Areview of their effects on the muscles, of their possible mechanisms of action and of their use in athletics. J. Steroid Biochem. Mol. Biol. 43,469-477. Chakravarti, D., LaMorte, V. J., Nelson, M. C., Nakajima, T., Schulman, I. G., Juguilon, H., Montminy, M., and Evans, R. M. (1996). Role of CBP/P3OO in nuclear receptor signalling. Nature (London) 383,99-103. Chamberlain, N. L., Driver, E. D., and Miesfeld, R. L. (1994). The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Res. 22,3181-3186. Chan, J., Song, C. S., Matusik, R. J., Chattejee, B., and Roy, A. K. (1998). Inhibition of androgen action by dehydroepiandrosterone sulfotransferase transfected in PC-3 prostate cancer cells. Chem.-Biol.Interact. 109,267-278. Chang, C . S., Kokontis, J., and Liao, S. T. (1988a). Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240,324-326.
REGULATION OF ANDROGEN ACTION
341
Chang, C. S., Kokontis, J., and Liao, S. T. (198813). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc. Natl. Acad. Sci. U.S.A. 85, 7211-7215. Chattejee, B., Majumdar, D., Ozbilen, O., Murty, C. V., and Roy, A. K. (1987). Molecular cloning and characterization of cDNA for androgen-repressible rat liver protein, SMP-2. J. Biol. Chem. 262,822-825. Chatterjee, B., Song, C. S., Kim, J. M., and Roy, A. K. (1994). Androgen and estrogen sulfotransferases of the rat liver: Physiological function, molecular cloning, and in vitro expression. Chem.-Bid. Interact. 92,273-279. Chatterjee, B., Song, C. S., Jung, M. H., Chen, S., Walter, C. A., Herbert, D. C., Weaker, F. J., Mancini, M. A., and Roy, A. K. (1996). Targeted overexpression of androgen receptor with a liver-specific promoter in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 93,728-733. Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M. L., Nakatani, Y., and Evans, R. M. (1997). Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBPlp300. Cell (Cambridge, Mass.) 90,569-580. Chen, J. D., and Evans, R. M. (1995). A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature (London) 377,454-457. Chen, S., Supakar, P. C., Vellanoweth, R. L., Song, C. S., Chatterjee, B., and Roy, A. K. (1997a). Functional role of a conformationally flexible homopurine/homopyrimidine domain of the androgen receptor gene promoter interacting with S p l and a pyrimidine single strand DNA-binding protein. Mol. Endocrinol. 11,3-15. Chen, S., Wang, J., Yu, G., Liu, W., and Pearce, D. (1997b). Androgen and glucocorticoid receptor heterodimer formation. A possible mechanism for mutual inhibition of transcriptional activity. J. Biol. Chem. 272,14087-14092. Claessens, F., Celis, L., De, V. P., Heyns, W., Verhoeven, G., Peeters, B., and Rombauts, W. (1993). Functional androgen response elements in the genes coding for prostatic binding protein. Ann. N.Y Acad. Sci. 684,199-201. Cunha, G. R. (1996). Growth factors as mediators of androgen action during male urogenital development. Prostate, Suppl. 6,22-25. Cunha, G. R., and Lung, B. (1978). The possible influence of temporal factors in androgenic responsiveness of urogenital tissue recombinants from wild-type and androgen-insensitive (Tfm) mice. J. Exp. 2001.205, 181-193. Cunha, G. R., Chung, L. W., Shannon, J. M., Taguchi, O., and Fujii, H. (1983). Hormoneinduced morphogenesis and growth Role of mesenchymal-epithelial interactions. Recent Prog. Horm. Res. 39,559-598. Dai, J. L., and Bernstein, K. L. (1996). TWO androgen response elements in the androgen receptor coding region are required for cell-specific up-regulation of receptor messenger RNA. Mol. Endocrinol. 10, 1582-1594. Das, S. K., Taylor, J. A., Korach, K. S., Paria, B. C., Dey, S. K., and Lubahn, D. B. (1997). Estrogenic responses in estrogen receptor-alpha deficient mice reveal a distinct estrogen signaling pathway. Proc. NatL. Acad. Sci. U.S.A. 94, 12786-12791. Dedhar, S., Rennie, P. S., Shago, M., Hagesteijn, C. Y., Yang, H., Filmus, J., Hawley, R. G., Bruchovsky, N., Cheng, H., and Matusik, R. J. (1994). Inhibition of nuclear hormone receptor activity by calreticulin. Nature (London) 367,480-483. DeKlerk, D. P., and Coffey, D. S. (1978). Quantitative determination of prostatic epithelial and stromal hyperplasia by a new technique: Biomorphometrics. Invest. Urol. 16, 240-245. Demyan, W. F., Song, C. S., Kim, D. S., Her, S., Gallwitz, W., Rao, T. R., Slomczynska, M., Chattejee, B., and Roy, A. K. (1992). Estrogen sulfotransferase of the rat liver: com-
342
A. K.ROY et al.
plementary DNA cloning and age- and sex-specific regulation of messenger RNA. Mol. Endocrinol. 6,589-597. DeVos, V. P., Claessens, F., Winderickx, J.,Van, D. P., Celis, L., Peeters, B., Rombauts, W., Heyns, W., and Verhoeven, G. (1991). Interaction ofandrogen response elements with the DNA-binding domain of the r at androgen receptor expressed in Escherichia coli. J. Biol. Chem. 266,3439-3443. Doesburg, P., Kuil, C. W., Berrevoets, C. A., Steketee, K., Faber, P. W., Mulder, E., Brinkmann, A. O., and Trapman, J. (1997). Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36,1052-1064. Donahoe, P. K., Cate, R. L., MacLaughlin, D. T., Epstein, J., Fuller, A. F., Takahashi, M., Coughlin, J. P., Ninfa, E. G., and Taylor, L. A. (1987). Mullerian inhibiting substance: Gene structure and mechanism of action of a fetal regressor. Recent Prog. Horm. Res. 43,431-467. Drews, U., and Drews, U. (1977). Regression of mouse mammary gland anlagen in recombinants ofTfm and wild-type tissues: Testosterone acts via the mesenchyme. Cell (Cambridge, Mass.) 10,401-404. Escriva, H., Safi, R., Hanni, C., Langlois, M. C., Saumitou-Laprade, P., Stehelin, D., Capron, A., Pierce, R., and Laudet, V. (1997). Ligand binding was acquired during evolution of nuclear receptors. Proc. Natl. Acad. Sci. U.S.A. 94,6803-6808. Evans, G. S., and Chandler, J. A. (1987). Cell proliferation studies in the ra t prostate: 11. The effects of castration and androgen-induced regeneration upon basal and secretory cell proliferation. Prostate 11,339-351. Evans, R. M. (1988). The steroid and thyroid hormone receptor super-family. Science 240, 889-895. Faber, P. W., King, A., van Rooij, H. C. J., Brinkmann, A. O., de Both, B. N., and Trapman, J. (1991a). The mouse androgen receptor. Functional analysis of the protein and characterization of the gene. Biochem. J. 278,269-278. Faber, P. W., van Rooij, H. C. J., van der Korput, H. A., Baarends, W. M., Brinkmann, A. O., Grootegoed, J. A., and Trapman, J. (1991b). Characterization ofthe human androgen receptor transcription unit. J. Biol. Chem. 266,10743-10749. Faber, P. W., van Rooij, H. C. J., Schipper, H. J., Brinkmann, A. O., and Trapman, J. (1993). Two different, overlapping pathways of transcription initiation are active on the TATA-less human androgen receptor promoter. The role of Spl. J . Biol. Chem. 268,9296-9301. Fasciana, C., van der Made, A. C., Faber, P. W., and Trapman, J. (1996). Androgen regulation of the rat keratinocyte growth factor (KGFIFGF7) promoter. Biochem. Biophys. Res. Commun. 220,858-863. Fawell, S. E., Lees, J. A., White, R., and Parker, M. G. (1990). Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor. Cell (Cambridge, Mass.) 60,953-962. Finch, P. W., Lengel, C., and ChBdid, M. (1995). Cloning and characterization of the promoter region of the human keratinocyte growth factor gene. J. Biol. Chem. 270, 11230-11237. Freedman, L. P. (1992). Anatomy of the steroid receptor zinc finger region. Endocr. Rev. 13,129-145. Fuhrmann, U., Bengtson, C., Repenthin, G., and Schillinger, E. (1992). Stable transfection of androgen receptor and MMTV-CAT into mammalian cells: Inhibition of cat expression by anti-androgens. J . Steroid Biochem. Mol. Biol. 42,787-793. Fun; B. J. (1995). Casodex: Preclinical studies and controversies. Ann. N.Y Acad. Sci. 761,79-96.
REGULATION OF ANDROGEN ACTION
343
Godowski, P. J., Picard, D., and Yamamoto, K. R. (1988). Signal transduction and transcriptional regulation by glucocorticoid receptor-LexA fusion proteins. Science 241, 812-816. Golsteyn, E. J., Goren, H. J., Lehoux, J. G., and Lefebvre, Y.A. (1990). Phosphorylation and nuclear processing of the androgen receptor. Biochem. Biophys. Res. Commun. 171,336-341. Gonzalez, G. A., and Montminy, M. R. (1989). Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell (Cambridge, Mass.) 59, 675-680. Gottlieb, B., Trifiro, M., Lumbroso, R., and Pinsky, L. (1997).The androgen receptor gene mutations database. Nucleic Acids Res. 25, 158-162. Gowland, P. L., and Buetti, E. (1989). Mutations in the hormone regulatory element of mouse mammary tumor virus differentially affect the response to progestins, androgens, and glucocorticoids. Mol. Cell, Biol. 9,3999-4008. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen, J. M. (1995). Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. U.S.A. 92,3439-3443. Grino, P. B., Griffin, J. E., and Wilson, J. D. (1990). Testosterone at high concentrations interacts with the human androgen receptor similarly to dihydrotestosterone. Endocrinology (Baltimore) 126, 1165-1172. Grossmann, M. E., and Tindall, D. J. (1995). The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA. J. Biol. Chem. 270, 10968-10975. Grossmann, M. E., Lindzey, J., Blok, L., Perry, J. E., Kumar, M. V., and Tindall, D. J. (1994). The mouse androgen receptor gene contains a second functional promoter which is regulated by dihydrotestosterone. Biochemistry 33,14594-14600. Guillemette, C., Hum, D. W., and Belanger, A. (1996). Regulation of steroid glucuronosyltransferase activities and transcripts by androgen in the human prostatic cancer LNCaP cell line. Endocrinology (Baltimore) 137,2872-2879. Guiochon-Mantel, A., Loosfelt, H., Lescop, P., Sar, S., Atger, M., Perrot-Applanat, M., and Milgrom, E. (1989). Mechanisms of nuclear localization of the progesterone receptor: Evidence for interaction between monomers. Cell (Cambridge, Mass.) 57,1147-1154. Guo, L., Degenstein, L., and Fuchs, E. (1996). Keratinocyte growth factor is required for hair development but not for wound healing. Genes Deu. 10,165-175. Gurpide, E. (1978).Enzymatic modulation of hormonal action at the target tissue. J. Toxicol. Enuiron. Health 4,249-268. Halachmi, S., Marden, E., Martin, G., MacKay, H., Abbondanza, C., and Brown, M. (1994). Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription. Science 264, 1455-1458. Ham, J., Thomson, A., Needham, M., Webb, P., and Parker, M. (1988). Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumour virus. Nucleic Acids Res. 16, 5263-5276. Harris, S. E., Rong, Z., Harris, M. A., and Lubahn, D. B. (1990).Androgen receptor in human prostate carcinoma LNCaP/ADEP cells contains a mutation which alters the specificity of the steroid-dependent transcriptional activation region. Program 72nd Annu. Meet. Endocr. SOC. Am., Abstr. No. 275. Heckert, L. L., Wilson, E. M., and Nilson, J. H. (1997). Transcriptional repression of the alpha-subunit gene by androgen receptor occurs independently of DNA binding but requires the DNA-binding and ligand-binding domains of the receptor. Mol. Endocrinol. 11,1497-1506. Hirst, J. J., West, N. B., Brenner, R. M., and Novy, M. J. (1992). Steroid hormone recep-
344
A. K. ROY et al
tors in the adrenal glands of fetal and adult rhesus monkeys. J. Clin. Endocrinol. Metab. 75,308-314. Ho, K. C., Marschke, K. B., Tan, J.,Power, S. G., Wilson, E. M., and French, F. S. (1993). A complex response element in intron 1 of the androgen-regulated 20-kDa protein gene displays cell type-dependent androgen receptor specificity. J. Biol. Chem. 268, 27226-27235. Hobkirk, R. (1993). Steroid sulfation. Current concepts. Dends Endocrinol. Metab. 4, 69-74. Hopper, B. R., and Yen, S. S. (1975). Circulating concentrations of dehydroepiandrosterone and dehydroepiandrosterone sulfate during puberty. J. Clin. Endocrinol. Metab. 40,458-461. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., and Glass, C. K. (1995). Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor [see comments]. Nature (London) 377,397-404. Horwitz, K. B., Jackson, T. A., Blain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996). Nuclear receptor coactivators and corepressors. Mol. Endocrinol. 10, 1167-1177. Ikonen, T., Palvimo, J. J., and Janne, 0.A. (1997). Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J. Biol. Chem. 272, 29821-29828. Imperato-McGinley, J. (1994). Benign prostatic hyperplasia: Dihydrotestosterone and 5 alpha-reductase inhibition therapy. Prog. Clin. Biol. Res. 386, 197-203. Imperato-McGinley, J., Shackleton, C., Orlic, S., and Stoner, E. (1990). C19 and C21 5 beta/5 alpha metabolite ratios in subjects treated with the 5 alpha-reductase inhibitor finasteride: Comparison of male pseudohermaphrodites with inherited 5 alpha-reductase deficiency. J. Clin. Endocrinol. Metab. 70,777-782. Isaacs, J. T. (1983). Changes in dihydrotestosterone metabolism and the development of benign prostatic hyperplasia in the aging beagle. J. Steroid Biochem. 18, 749757. Isaacs, J. T. (1994). Role of androgens in prostatic cancer. Vitam. Horm. (N.Y) 49, 433-502. Isaacs, J. T., Furuya, Y., and Berges, R. (1994). The role of androgen in the regulation of programmed cell death/apoptosis in normal and malignant prostatic tissue. Semin. Cancer Biol. 5,391-400. Jacobi, G. H., Moore, R. J., and Wilson, J. D. (1978). Studies on the mechanism of 3 alpha-androstanediol-induced growth of the dog prostate. Endocrinology (Baltimore) 102,1748-1758. Janknegt, R. A., Abbou, C. C., Bartoletti, R., Bernstein-Hahn, L., Bracken, B., Brisset, J. M., Calais DaSilva, F., Chisolm, G., Crawford, E. D., Debruyne, F. M. J., Dijkman, G. D., Frick, J., Goedhals, L., Knonagel, H., and Venner, P. M. (1993). Orchiectomy and nilutamide or placebo as treatment of metastatic prostatic cancer in a multinational double-blind randomized trial. J. Urol. 149,77-83. Jenster, G., van der Korput, H. A., van Vroonhoven, C., van der Kwast, T. H., Trapman, J., and Brinkmann, A. 0. (1991). Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol. Endocrinol. 5, 1396-1404. Jenster, G., van der Korput, J. A., Trapman, J., and Brinkmann, A. 0. (1992). Functional domains of the human androgen receptor. J. Steroid Biochem. Mol. Biol. 41, 671-675.
REGULATION OF ANDROGEN ACTION
345
Jenster, G., Trapman, J., and Brinkmann, A. 0. (1993). Nuclear import of the human androgen receptor. Biochem. J. 293,761-768. Jenster, G., de Ruiter, P. E., van der Korput, H. A., Kuiper, G. G., Trapman, J., and Brinkmann, A. 0. (1994). Changes in the abundance of androgen receptor isotypes: effects of ligand treatment, glutamine-stretch variation, and mutation of putative phosphorylation sites. Biochemistry 33,14064-14072. Jenster, G., Spencer, T.E., Burcin, M. M., Tsai, S. Y., Tsai, M. J., and O’Malley, B. W. (1997). Steroid receptor induction of gene transcription: Atwo-step model. Proc. Natl. Acad. Sci. U S A . 94,7879-7884. Johnson, M., and Everitt, B. (1988). “Essential Reproduction.” Blackwell Scientific, Oxford. Josso, N., Boussin, L., Knebelmann, B., Nihoul-Fekete, C., and Picard, J. Y. (1991).Antimullerian hormone and intersex states. Pends Endocrinol. Metab. 2,227-233. Jost, A. (1970). Hormonal factors in the sex differentiation of the mammalian foetus. Phi10s. Pans. R. SOC.London, Sex B 259,119-130. Kallio, P. J., Palvimo, J. J., Mehto, M., and Janne, 0.A. (1994).Analysis of androgen receptor-DNA interactions with receptor proteins produced in insect cells. J. Biol. Chem. 269,11514-11522. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S. C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996). A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell (Cambridge, Mass.) 85,403-414. Kemppainen, J. A., Lane, M. V., Sar, M., and Wilson, E. M. (1992). Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J. Biol. Chem. 267,968-974. Kitay, J. I., Coyne, M. D., Nelson, R., and Newsom, W. (1966). Relation of the testis to adrenal enzyme activity and adrenal corticosterone production in the rat. Endocrinology (Baltimore) 78,1061-1075. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., and Lovell-Badge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature (London) 351, 117-121. Kratochwil, K., and Schwartz, P. (1976). Tissue interaction in androgen response of embryonic mammary rudiment of mouse: Identification of target tissue for testosterone. Proc. Natl. Acad. Sci. U.S.A. 73,4041-4044. Krongrad, A,, Wilson, C. M., Wilson, J. D., Allman, D. R., and McPhaul, M. J. (1991).Androgen increases androgen receptor protein while decreasing receptor mRNA in LNCaP cells. Mol. Cell. Endocrinol. 76,79-88. Kuil, C. W., and Mulder, E. (1995). Effects of androgens and antiandrogens on the conformation of the androgen receptor. Ann. iV.X Acad. Sci. 761,351-354. Kuiper, G. G., Faber, P. W., van Rooij, H. C. J., van der Korput, J. A., Ris-Stalpers, C., Klaassen, P., Trapman, J., and Brinkmann, A. 0. (1989). Structural organization of the human androgen receptor gene. J. Mol. Endocrinol. 2, Rl-R4. Kuiper, G. G., de Ruiter, P. E., Trapman, J., Boersma, W. J., Grootegoed, J. A,, and Brinkmanh, A. 0. (1993). Localization and hormonal stimulation of phosphorylation sites in the LNCaP-cell androgen receptor. Biochem. J. 291,95-101. Kuiper, G. G., Enmark, E., Pelto-Huikko, M., Nilsson, S., and Gustafsson, J. A. (1996). Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. U.S.A.93,5925-5930. Kumar, M. V.,Jones, E. A,, Grossmann, M. E., Blexrud, M. D., and Tindall, D. J. (1994). Identification and characterization of a suppressor element in the 5‘-flanking region of the mouse androgen receptor gene. Nucleic Acids Res. 22,3693-3698.
346
A. K. ROY et al.
Kyprianou, N., and Isaacs, J. T. (1988). Activation of programmed cell death in the rat ventral prostate after castration. Endocrinology (Baltimore) 122,552-562. Kyprianou, N., Martikainen, P., Davis, L., English, H. F., and Isaacs, J. T. (1991). Programmed cell death as a new target for prostatic cancer therapy. In “Prostate Cancer: Cell and Molecular Mechanisms in Diagnosis and Treatment” ( J . T. Isaacs, ed.), pp. 265-278. Cold Spring Harbor Lab. Press, Cold Spring Harbor, NY. Labrie, C., BBlanger, A., and Labrie, F. (1988). Androgenic activity of dehydroepiandrosterone and androstenedione in the rat ventral prostate. Endocrinology (Baltimore) 123,1412-1417. Labrie, F. (1991). Intracrinology. Mol. Cell. Endocrinol. 78, C113-C118. Lamas, M., and Sassone-Corsi, P. (1997). The dynamics of the transcriptional response to cyclic adenosine 3’,5’-monophosphate: Recurrent inducibility and refractory phase. Mol. Endocrinol. 11,1415-1424. Liang, T., and Liao, S. (1992). Inhibition of steroid 5 alpha-reductase by specific aliphatic unsaturated fatty acids. Biochem. J. 285,557-562. Liang, T., Heiss, C. E., Cheung, A. H., Reynolds, G. F., and Rasmusson, G. H. (1984). 4Azasteroidal5 alpha-reductase inhibitors without affinity for the androgen receptor. J. Biol. Chem. 259, 734-739. Liao, S., Liang, T., Fang, S., Castaneda, E., and Shao, T. C. (1973). Steroid structure and androgenic activity. Specificities involved in the receptor binding and nuclear retention of various androgens. J. Biol. Chem. 248,6154-6162. Liao, S. S., Kokontis, J., Sai, T., and Hiipakka, R. A. (1989). Androgen receptors: Structures, mutations, antibodies and cellular dynamics. J. Steroid Biochem. 34, 41-51. Lindzey, J., Grossmann, M., Kumar, M. V., and Tindall, D. J. (1993). Regulation of the 5‘flanking region of the mouse androgen receptor gene by CAMPand androgen. Mol. Endocrinol. 7,1530-1540. Lindzey, J., Kumar, M. V., Grossman, M., Young, C., and Tindall, D. J. (1994). Molecular mechanisms of androgen action. Vitam. Horn. (N.Y) 49,383-432. Lu, S., Tsai, S. Y., and Tsai, M. J. (1997). Regulation of androgen-dependent prostatic cancer cell growth: Androgen regulation of CDK2, CDK4, and CKI p16 genes. Cancer Res. 57,4511-4516. Lubahn, D. B., Joseph, D. R., Sar, M., Tan, J.,Higgs, H. N., Larson, R. E., French, F. S., and Wilson, E. M. (1988a). The human androgen receptor: Complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol. Endocrinol. 2,1265-1275. Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French, F. S., and Wilson, E. M. (198813). Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 240,327-330. Lubahn, D. B., Brown, T. R., Simental, J. A., Higgs, H. N., Migeon, C. J., Wilson, E. M., and French, F. S. (1989). Sequence of the intronfexon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc. Natl. Acad. Sci. U.S.A. 86, 9534-9538. Luke, M. C., and Coffey, D. S. (1994). Human androgen receptor binding to the androgen response element of prostate specific antigen. J. Androl. 15,41-51. Mancini, M. A., Chattejee, B., and Roy, A. K. (1991). Age-dependent reversal of the lobular distribution of androgen-inducible alpha 2u globulin and androgen-repressible SMP-2 in rat liver. J. Histochem. Cytochem. 39,401-405. Mancini, M. A., Song, C. S., Rao, T. R., Chattejee, B., and Roy, A. K. (1992). Spatio-temporal expression of estrogen sulfotransferase within the hepatic lobule of male rats:
REGULATION OF ANDROGEN ACTION
347
Implication of in situ estrogen inactivation in androgen action. Endocrinology (Baltimore) 131,1541-1546. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., and Chambon, P. (1995). The nuclear receptor superfamily: the second decade. Cell (Cambridge, Mass.) 83,835-839. Maroulakou, I. G.,Anver, M., Garrett, L., and Green, J. E. (1994). Prostate and mammary adenocarcinoma in transgenic mice carrying a rat C3(1) simian virus 40 large tumor antigen fusion gene. Proc. Natl. Acad. Sci. U.S.A. 91, 11236-11240. McEwan, I. J., and Gustafsson, J. (1997). Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF. Proc. Natl. Acad. Sci. U.S.A. 94,8485-8490. McNeal, J. E. (1983). The prostate gland: Morphology and pathobiology. Monog. Urol. 4, 3-33. Meyer, T. E., and Habener, J. F. (1993). Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr. Rev. 14,269-290. Mhatre, A. N., Trifiro, M. A., Kaufman, M., Kazemi-Esfarjani, P., Figlewicz, D., Rouleau, G., and Pinsky, L. (1993). Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbar muscular atrophy. Nut. Genet. 5, 184-188. Michalak, M., Milner, R. E., Burns, K., and Opas, M. (1992). Calreticulin. Biochem. J . 285,681-692. Mizokami, A., and Chang, C. (1994). Induction of translation by the 5'-untranslated region of human androgen receptor mRNA. J. Biol. Chem. 269,25655-25659. Mizokami, A., Yeh, S. Y., and Chang, C. (1994). Identification of 3',5'-cyclic adenosine monophosphate response element and other cis-acting elements in the human androgen receptor gene promoter. Mol. Endocrinol. 8 , 7 7 4 8 . Mooradian, A. D., Morley, J. E., and Korenman, S. G. (1987). Biological actions of androgens. Endocr. Rev. 8,1-28. Mora, G. R., and Mahesh, V. B. (1996). Autoregulation of androgen receptor in rat ventral prostate: Involvement ofc-fos as a negative regulator. Mol. Cell. Endocrinol. 124, 111-120. Mortola, J. F., and Yen, S. S. (1990). The effects of oral dehydroepiandrosterone on endocrine-metabolic parameters in postmenopausal women. J. Clin. Endocrinol. Metab. 71, 696-704. Mosselman, S., Polman, J., and Dijkema, R. (1996). ER beta: Identification and characterization of a novel human estrogen receptor. FEBS Lett. 392,49-53. Murray, M. B., and Towle, H. C. (1989). Identification of nuclear factors that enhance binding of the thyroid hormone receptor to a thyroid hormone response element. Mol. Endocrinol. 3, 1434-1442. Murtha, P., Tindall, D. J., and Young, C. Y. (1993). Androgen induction of a human prostate-specific kallikrein, hKLK2: Characterization of a n androgen response element in the 5' promoter region of the gene. Biochemistry 32,6459-6464. Nakhla, A. M., Romas, N. A., and Rosner, W. (1997). Estradiol activates the prostate androgen receptor and prostate-specific antigen secretion through the intermediacy of sex hormone-binding globulin. J. Biol. Chem. 272, 6838-6841. Nash, A. R., Glenn, W. K., Moore, S. S., Kerr, J., Thompson, A. R., and Thompson, E. 0. (1988). Oestrogen sulfotransferase: Molecular cloning and sequencing of cDNA for the bovine placental enzyme. Aust. J. Biol. Sci. 41,507-516. Nemoto, T., Ohara-Nemoto, Y., Shimazaki, S., and Ota, M. (1994). Dimerization charac-
348
A. K.ROY et al
teristics of the DNA- and steroid-binding domains of the androgen receptor. J. Steroid Biochem. Mol. Biol. 50,225-233. Neri, R.,Peets, E., and Watnick, A. (1979).Anti-androgenicity of flutamide and its metabolite Sch 16423.Biochem. SOC.fians. 7,565-569. Neumann, F., and Jacobi, G. H. (1982).Antiandrogens in tumor therapy. Clin. Oncol. 1, 41-65. Ogryzko, V.V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996).The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell (Cambridge, Mass.) 87,953-959. Ogura, K.,Kajita, J., Narihata, H., Watabe, T., Ozawa, S., Nagata, K., Yamazoe, Y., and Kato, R. (1989).Cloning and sequence analysis of a rat liver cDNA encoding hydroxysteroid sulfotransferase. Biochem. Biophys. Res. Commun. 165,168-174. Oiiate, S. A., Tsai, S. Y., Tsai, M. J., and OMalley, B. W. (1995).Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357. Orentreich, N., Brind, J. L., Vogelman, J . H., Andres, R., and Baldwin, H. (1992).Longterm longitudinal measurements of plasma dehydroepiandrosterone sulfate in normal men. J. Clin. Endocrinol. Metab. 76, 1002-1004. Palvimo, J. J., Reinikainen, P., Ikonen, T., Kallio, P. J., Moilanen, A., and Janne, 0. A. (1996).Mutual transcriptional interference between RelA and androgen receptor. J. Biol. Chem. 271,24151-24156. Parker, L. N., and Odell, W. D. (1980).Control of adrenal androgen secretion. Endocr. Reu. 1,392-410. Penning, T. M. (1997).Molecular endocrinology of hydroxysteroid dehydrogenases. Endoer. Rev. 18,281-305. Picard, D., and Yamamoto, K.R. (1987).Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J.. 6,3333-3340. Quarmby, V. E., Kemppainen, J. A., Sar, M., Lubahn, D. B., French, F. S., and Wilson, E. M. (1990).Expression of recombinant androgen receptor in cultured mammalian cells. Mol. Endocrinol. 4,1399-1407. Quigley, C. A., De, B. A., Marschke, K. B., el-Awady, M. K., Wilson, E. M., and French, F. S. (1995).Androgen receptor defects: Historical, clinical, and molecular perspectives. Endocr. Rev. 16,271-321. Ray, A., and Prefontaine, K. E. (1994).Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappa B and the glucocorticoid receptor. Proc. Natl. Acad. Sci. U.S.A. 91,752-756. Rennie, P. S.,Bruchovsky, N., Leco, K. J., Sheppard, P. C., McQueen, S. A., Cheng, H., Snoek, R., Hamel, A., Bock, M. E., and MacDonald, B. S. (1993).Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol. Endocrinol. 7,23-36. Riegman, P. H.,Vlietstra, R. J., van der Korput, J. A., Brinkmann, A. O., and Trapman, J. (1991).The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol. Endocrinol. 5,1921-1930. Ringold, G. M., Yamamoto, K. R., Bishop, J. M., and Varmus, H. E.(1988).Glucocorticoidstimulated accumulation of mouse mammary tumor virus RNA: Increased rate of systhesis of viral RNA. Proc. Natl. Acad. Sci. U.S.A. 74,2879-2883. Rittmaster, R. S., Leopold, C. A., and Thompson, D. L. (1989).Androgen glucuronyl transferase activity in rat liver, evidence for the importance of hepatic tissue in 5 alphareduced androgen metabolism. J. Steroid Biochem. 33,1207-1212. Robins, D. M.,Scheller, A., and Adler, A. J. (1994).Specific steroid response from a nonspecific DNA element. J. Steroid Biochem. Mol. Biol. 49,251-255.
REGULATION OF ANDROGEN ACTION
349
Roche, P. J., Hoare, S.A., and Parker, M. G. (1992).Aconsensus DNA-binding site for the androgen receptor. Mol. Endocrinol. 6,2229-2235. Roy, A. K. (1992). Regulation of steroid hormone action in target cells by specific hormoneinactivating enzymes. Proc. SOC.Exp. Biol. Med. 199,265-272. Roy, A. K., and Chatterjee, B. (1995). Androgen action. Crit. Rev. Eukaryotic Gene Expression 5, 157-176. Roy, A. K., Vellanoweth, R. L., Jung, M. H., and Chatterjee, B. (1997). Cellular and molecular effects of androgenic-anabolic steroids. In "Endocrine. Toxicology" (J. A. Thomas and H. D. Colby, eds.), 2nd ed., pp. 213-225. Taylor &Francis, Washington, DC. Roy, R., and Belanger, A. (1993). ZR-75-1 breast cancer cells generate nonconjugated steroids from low density lipoprotein-incorporated lipoidal dehydroepiandrosterone. Endocrinology (Baltimore) 133,683-689. Ruizeveld de Winter, J . A., Trapman, J., Vermey, M., Mulder, E., Zegers, N. D., and van der Kwast, T. H. (1991). Androgen receptor expression in human tissues: an immunohistochemical study. J. Histochem. Cytochem. 39,927-936. Rundlett, S. E., Wu, X. P., and Miesfeld, R. L. (1990). Functional characterizations of the androgen receptor confirm that the molecular basis of androgen action is transcriptional regulation. Mol. Endocrinol. 4,708-714. Russell, D. W., and Wilson, J. D. (1994). Steroid 5 alpha-reductase: Two genedtwo enzymes. Annu. Rev. Biochem. 63,25-61. Sanborn, B. M., Caston, L. A., Chang, C., Liao, S., Speller, R., Porter, L. D., and Ku, C. Y. (1991). Regulation of androgen receptor mRNA in rat Sertoli and peritubular cells. Biol. Reprod. 45,634-641. Sato, N., Sadar, M. D., Bruchovsky, N., Saatcioglu, F., Rennie, P. S., Sato, S., Lange, P. H., and Gleave, M. E. (1997). Androgenic induction of prostate-specific antigen gene is repressed by protein-protein interaction between the androgen receptor and AP-l/c-Jun in the human prostate cancer cell line LNCaP. J. Biol. Chem. 272, 17485-17494. Schneider, J. J. (1952). Conversion of desoxycorticosterone to four allopregnane metabolites by rat liver in vitro. J. Biol. Chem. 199,235-244. Schneikert, J., Peterziel, H., Defossez, P. A., mocker, H., Launoit, Y., and Cato, A. C. (1996). Androgen receptor-Ets protein interaction is a novel mechanism for steroid hormone-mediated down-modulation of matrix metalloproteinase expression. J. B i d . Chem. 271,23907-23913. Shan, L. X., Bardin, C. W., and Hardy, M. P. (1997). Immunohistochemical analysis of androgen effects on androgen receptor expression in developing Leydig and Sertoli cells. Endocrinology (Baltimore) 138, 1259-1266. Sheridan, P. J. (1991). Can a single androgen receptor fill the bill? Mol. Cell. Endocrinol. 76, C39-C45. Simard, J., Rheaume, E., Mebarki, F., Sanchez, R., New, M. I., Morel, Y., and Labrie, F. (1995). Molecular basis of human 3 beta-hydroxysteroid dehydrogenase deficiency. J. Steroid Biochem. Mol. Biol. 53,127-138. Simental, J. A., Sar, M., Lane, M. V., French, F. S., and Wilson, E. M. (1991). Transcriptional activation and nuclear targeting signals of the human androgen receptor. J . Biol. Chem. 266,510-518. Simental, J. A., Sar, M., and Wilson, E. M. (1992). Domain functions of the androgen receptor. J. Steroid Biochem. Mol. Biol. 43,37-41. Sleddens, H. F., Oostra, B. A., Brinkmann, A. O., and Trapman, J. (1992). Trinucleotide (GGN) repeat polymorphism in the human androgen receptor (AR)gene. Hum. Mol. Genet. 2,493.
350
A. K. ROY et al.
Smith, C. L., and Hager, G. L. (1997). Transcriptional regulation of mammalian genes in vivo. A tale of two templates. J. Biol. Chem. 272,27493-27496. Song, C. S., Her, S., Slomczynska, M., Choi, S. J., Jung, M. H., Roy, A. K., and Chatterjee, B. (1993). A distal activation domain is critical in the regulation of the rat androgen receptor gene promoter. Biochem. J. 294,779-784. Song, C. S., Jung, M. H., Kim, S. C., Hassan, T., Roy, A. K., and Chatterjee, B. (1998). Tissue-specific and androgen-repressible regulation of the rat dehydroepiandrosterone sulfotransferase gene promoter. J.Biol. Chem. 273,21856-21866. Spencer, T. E., Jenster, G., Burcin, M. M., Allis, C. D., Zhou, J.,Mizzen, C. A., McKenna, N. J., Ofiate, S. A., Tsai, S. Y., Tsai, M. J., and OMalley, B. W. (1997). Steroid receptor coactivator-1 is a histone acetyltransferase. Nature [London) 389,194-198. Strott, C. A. (1996). Steroid sulfotransferases. Endocl: Rev. 17,670-697. Supakar, P. C., and Roy, A. K. (1996). Role of transcription factors in the age-dependent regulation of the androgen receptor gene in rat liver. Biol. Signals 5, 170-179. Supakar, P. C., Song, C. S., Jung, M. H., Slomczynska, M. A., Kim, J. M., Vellanoweth, R. L., Chatterjee, B., and Roy, A. K. (1993). A novel regulatory element associated with age-dependent expression of the rat androgen receptor gene. J. Biol. Chem. 268, 26400-26408. Supakar, P. C., Jung, M. H., Song, C. S., Chatterjee, B., and Roy, A. K. (1995). Nuclear factor kappa B functions as a negative regulator for the rat androgen receptor gene and NF-kappa B activity increases during the age-dependent desensitization of the liver. J. Biol. Chem. 270,837-842. Takeshita, A., Yen, P. M., Misiti, S., Cardona, G. R., Liu, Y., and Chin, W. W. (1996). Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology [Baltimore) 137,3594-3597. Tan, J. A., Marschke, K. B., Ho, K. C., Perry, S. T., Wilson, E. M., and French, F. S. (1992). Response elements of the androgen-regulated C3 gene. J. Biol. Chem. 267, 4456-4466. Taurog, J. D., Moore, R. J., and Wilson, J. D. (1975). Partial characterization of the cytosol 3alpha-hydroxysteroidNAD(P)+ oxidoreductase of rat ventral prostate. Biochemistry 14,810-817. Thompson, E. A., and Siiteri, P. K. (1973). Studies on the aromatization of C-19 androgens. Ann. N.Y Acad. Sci. 212,378-391. Tilley, W. D., Marcelli, M., Wilson, J. D., and McPhaul, M. J. (1989). Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl. Acad. Sci. U.S.A. 86,327-331. Tilley, W. D., Marcelli, M., and McPhaul, M. J . (1990). Expression of the human androgen receptor gene utilizes a common promoter in diverse human tissues and cell lines. J. Biol. Chem. 265,13776-13781. Toscano, V., Caiola, S., Maroder, M., Adamo, M. V., Argiolas, L., Familiari, A., and Familiari, G. (1990). Effects of dihydrotestosterone treatment on adrenal gland function and morphology in adult female guinea-pigs. J. Steroid Biochem. 36,89-97. Toth, M., and Zakar, T. (1982). Relative binding affinities of testosterone, 19-nortestosterone and their 5 alpha-reduced derivatives to the androgen receptor and to other androgen-binding proteins: A suggested role of 5 alpha-reductive steroid metabolism in the dissociation of “myotropic” and “androgenic” activities of 19-nortestosterone. J. Steroid Biochem. 17,653-660. Trapman, J., Klaassen, P., Kuiper, G. G., van der Korput, J. A., Faber, P. W., van Rooij, H. C. J., van Geurts, K., Voorhorst, M. M., Mulder, E., and Brinkmann, A. 0. (1988). Cloning, structure and expression of a cDNA encoding the human androgen receptor. Biochem. Biophys. Res. Commun. 153,241-248.
REGULATION OF ANDROGEN ACTION
35 1
Truss, M., Bartsch, J., Schelbert, A., Hache, R. J., and Beato, M. (1995).Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo. EMBO J. 14,1737-1751. Tsai, M. J., and OMalley, B. W. (1994). Molecular mechanisms of action of steroidithyroid receptor superfamily members. Annu. Rev. Biochem. 63,451-486. Tsai, S. Y., Carlstedt-Duke, J.,Weigel, N. L., Dahlman, K., Gustafsson, J. A., "sai, M. J., and OMalley, B. W. (1988). Molecular interactions of steroid hormone receptor with its enhancer element: Evidence for receptor dimer formation. Cell (Cambridge, Mass.) 55,361-369. Tut, T.G., Ghadessy, F. J., Trifiro, M. A., Pinsky, L., and Yong, E. L. (1997). Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. J. Clin. Endocrinol. Metab. 82, 3777-3782. Umesono, K., and Evans, R. M. (1989). Determinants of target gene specificity for steroidkhyroid hormone receptors. Cell (Cambridge, Mass.) 57, 1139-1146. Veldscholte, J., Ris-Stalpers, C., Kuiper, G. G., Jenster, G., Berrevoets, C., Claassen, E., van Rooij, H. C. J., Trapman, J., Brinkmann, A. O., and Mulder, E. (1990).A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem. Biophys. Res. Commun. 173,534-540. Vornberger, W., Prins, G., Musto, N. A., and Suarez-Quian, C. A. (1994). Androgen receptor distribution in rat testis: New implications for androgen regulation of spermatogenesis. Endocrinology (Baltimore) 134,2307-2316. Wang, Z., Tufts, R., Haleem, R., and Cai, X. (1997). Genes regulated by androgen in the rat ventral prostate. Proc. Natl. Acad. Sci. U.S.A. 94, 12999-13004. Wilson, C. M., and McPhaul, M. J. (1994). A and B forms of the androgen receptor are present in human genital skin fibroblasts. Proc. Natl. Acad. Sci. U.S.A. 91, 12341238. Wilson, J. D. (1988).Androgen abuse by athletes. Endocr. Reu. 9,181-199. Wilson, J. D. (1996). Role of dihydrotestosterone in androgen action. Prostate, Suppl. 6, 88-92. Wilson, J. D., Grifin, J . E., and Russell, D. W. (1993). Steroid 5 alpha-reductase 2 deficiency. Endocr. Rev. 14,577-593. Winneker, R. C., Wagner, M. M., and Batzold, F. H. (1989). Studies on the mechanism of action of win a steroidal androgen receptor antagonist. J. Steroid Biochem. 33, 1133-1138. Wiren, K. M., Zhang, X., Chang, C . , Keenan, E., and Orwoll, E. S. (1997). Transcriptional up-regulation of the human androgen receptor by androgen in bone cells. Endocrinology (Baltimore) 138, 2291-2300. Wolf, D. A., Herzinger, T., Hermeking, H., Blaschke, D., and Horz, W. (1993). Transcriptional and posttranscriptional regulation of human androgen receptor expression by androgen. Mol. Endocrinol. 7,924-936. Wong, C., Kelce, W. R., Sar, M., and Wilson, E. M. (1995).Androgen receptor antagonist versus agonist activities of the fungicide vinclozolin relative to hydroxyflutamide. J. Biol. Chem. 270,19998-20003. Wong, C. I., Zhou, Z. X., Sar, M., and Wilson, E. M. (1993). Steroid requirement for androgen receptor dimerization and DNA binding. Modulation by intramolecular interactions between the NH2-terminal and steroid-binding domains. J. Biol. Chem. 268,19004-19012. Wood, T. C., Her, C.,Aksoy, I., Otterness, D. M., and Weinshilboum, R. M. (1996). Human dehydroepiandrosterone sulfotransferase pharmacogenetics: quantitative Western
352
A. K.ROY et at.
analysis and gene sequence polymorphisms. J. Steroid Biochem. Mol. Biol. 59, 467-478. Yan, G., Fukabori,Y., Nikolaropoulos, S., Wang, F., and McKeehan, W. L. (1992). Heparinbinding keratinocyte growth factor is a candidate stromal-to-epithelial-cell andromedin. Mol. Endocrinol. 6,2123-2128. Yeh, S., and Chang, C . (1996). Cloning and Characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proc. Natl. Acad. Sci. U.S.A. 93,5517-5521. Zhou, Z., Corden, J. L., and Brown, T. R. (1997). Identification and characterization of a novel androgen response element composed of a direct repeat. J. Biol. Chem. 272, 8221-8235. Zhou, Z.-X., Sar, M., Simental, J. A., Lane, M. V., and Wilson, E. M. (1994a). A ligand-dependent bipartite nuclear targeting signal in the human androgen receptor. Requirement for the DNA-binding domain and modulation by NH2-terminal and carboxyl-terminal sequences. J. Biol. Chem. 269,13115-13123. Zhou, Z.-X., Wong, C . I., Sar, M., and Wilson, E. M. (1994b). The androgen receptor: An overview. Recent Prog. Horm. Res. 49,249-214. Zhou, Z.-X., Lane, M. V., Kernppainen, J.A., French, F.S.,and Wilson, E. M. (1995). Specificity of ligand-dependent androgen receptor stabilization: Receptor domain interactions influence ligand dissociation and receptor stability. Mol. Endocrinol. 9, 208-218.
VITAMINS AND HORMONES, VOL. 55
Regulation of Estrogen Action: Role of 17P-Hydroxysteroid Dehydrogenases HELLEVI PELTOKETO, PIRKKO VIHKO, AND REIJO VIHKO Biocenter Oulu and WHO Collaborating Centre for Research on Reproductive Health University of Oulu, FIN-90220 Oulu, Finland
I. Introduction 11. 17HSD Enzymes A. General Properties of 17HSD Type 1Enzyme, mRNAs, and Gene B. General Properties of 17HSD Type 2 Enzyme, mRNAs, and Gene 111. 17HSD Type 1Enzyme and Ovarian E2 Production A. Expression of 17HSD Type 1Enzyme and Its Role in Ovarian E2 Production B. Regulation of 17HSD Type 1Expression in Ovaries Iv. Expression and Action of 17HSD Type 1and Type 2 Enzymes during Pregnancy A. Expression and Action of 17HSD Type 1 and Type 2 Enzymes in Fetoplacental Unit B. Regulation of 17HSD Type 1Expression in Human Cells of Placental Origin V. Physiological Role and Expression of 17HSD Type 1and Type 2 Enzymes in Peripheral Tissues A. 17HSD Type 1and Type 2 Enzymes in Normal and Malignant Breast Tissue B. 17HSD Type 1and Type 2 Enzymes in Endometrial “issue C. Expression of 17HSD Type 1and Type 2 Enzymes in Other Peripheral Tissues VI. Structure and Function of 17HSD Type 1Enzyme: Applications to the Prevention and Treatment of Estrogen-Dependent Cancers VII. Regulation of hHSDl7Bl Gene Expression A. Structure and Function of the hHSDl7Bl Promoter B. Structure and Function of the hHSDl7B1 Enhancer C. Structure and Function of the hHSDl7Bl Silencer VIII. Conclusions References
I. INTRODUCTION Proper and relevant steroid hormone influence in steroid target cells, mediated by specific receptors, is ensured by strict multistage control. For example, steroid hormone secretion by premenopausal ovarian tissues is tightly and cyclically regulated, as are distribution and concentrations of the nuclear steroid hormone receptors. Availability and ac353
Copyright0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99 $25.00
354
HELLEVI PELTOKETO et al.
tivity of the hormone ligand in the target cells are additionally affected by the action of the binding proteins in the circulation and peripheral steroid-metabolizing enzymes. The extent of the hormone response is further modulated by activators and inactivators, which interact with the receptors and receptor-DNA complexes, as well as by concurrence of other signaling pathways, through phosphorylation of the receptors or interaction between the receptors and other transcription factors (Bai and Weigel, 1995, and references therein; Parker, 1995, and references therein). Estrogens are classical endocrine factors that induce and maintain female secondary sexual characteristics and facilitate a large number of different functions outside the female reproductive system, such as bone and lipid metabolism. During the reproductive years of women, the estrogens released from the ovary into the circulation exert feedback action on the hypothalamic-pituitary unit to affect the synchronized preovulatory release of gonadotropins. Together with other hormones, estrogens therefore coordinate the menstrual cycle (Richards, 1980; Hillier et al., 1994). During human pregnancy, the placenta develops as an additional major source of estrogens (Pepe and Albrecht, 1995, and references therein). Estrogens are also autocrine regulators, which play a vital role at the site of their formation, and they also can act in the same cells (as intracrine factors), where they have been synthesized from circulating precursors. The intracrinological machinery, which largely operates in peripheral tissues, is especially dominant after menopause, and the steroid ligand supply is extensively modulated by it (Labrie, 1991). In this article, we will concentrate on the availability of the ligand and, in particular, the role of 176-hydroxysteroid dehydrogenase (17HSD) enzymes in the regulation of estrogen action. These enzymes catalyze the interconversions between 17P-hydroxysteroids and 17-ketosteroids, the former type of the ligand being able to activate the receptor remarkably more efficiently than the latter. The 17HSD enzymes are essential for the final step in gonadal endocrine estradiol (E2) biosynthesis and they are also involved in modulation of the steroid action in peripheral tissues (autocrine-intracrine regulation). Even though 17HSD enzyme reactions may not be the rate-limiting steps in steroidogenesis, as the ones catalyzed by several P450 enzymes, the development-, tissue-, and cell-specific expressions of certain 17HSD enzymes suggest that they have other than a housekeeping role in steroid hormone action. In this article, findings concerning the expression and regulation of 17HSDenzymes are reviewed, and the contribution of the enzymes in the regulation of the estrogen response is discussed.
ROLE OF 17HSDS IN ESTROGEN ACTION
355
11. 17HSD ENZYMES Six human and/or rodent enzymes have been named 17HSDs (types 1-6). More enzymes, possessing 17HSD enzyme activities along with other activities, such as rat 3P-hydroxysteroid dehydrogenase-A5-A4 isomerase type 1 (de Launoit et al., 19921, have also been described. Furthermore, there is kinetic evidence of the existence of additional forms of 17HSD enzymes. The nomenclature of the enzymes is partly misleading, since the enzyme group consists of both 17-ketosteroid reductases and 17P-hydroxysteroiddehydrogenases, and the enzymes are hence likely to be renamed in the future. The 17HSD enzymes are nicotinamide adenine dinucleotide [NAD(H)l-and/or its phosphate form [NADP(H)I-dependent enzymes that catalyze the hydrid transfer between 17P-hydroxy and 17-ketosteroid pairs in a positional and stereospecific manner, even though some of them also have secondary 20a-hydroxysteroid dehydrogenase (2OHSD) activity. Since both estrogens and androgens possess their highest activity in the 17P-hydroxyform, the 17HSD enzymes regulate the biological activity of sex hormones and thus contribute to the control of steroid hormone action. The 17HSD enzymes primarily convert the relatively inactive sex steroids estrone (El), androstenedione (Adione), and 5a-androstanedione to their more potent forms: E2, testosterone (T), and 5a-dihydrotestosterone (DHT) and vice versa. In addition, 17HSD type 6, for example, is part of the catabolic cascade of DHT converting 5a-androstanediol to androsterone (Biswas and Russell, 1997). Reductive 17HSD enzyme activities are essential for E2 and T biosynthesis in the gonads. They are also present in certain extragonadal tissues of several species, including primates and rodents (Martel et al., 19921, and can thus convert low-activity circulating precursors to their more potent forms in peripheral tissues. Instead, widely expressed oxidative 17HSD enzyme activities tend to decrease the potency of estrogens and androgens and consequently may protect tissues from excessive hormone action. Despite the same reaction type catalyzed by the different 17HSDs, the enzymes are different in many respects, starting from the low identity of their primary structures. Five of them, namely enzyme types 1 to 4, and 6, belong to the short-chain dehydrogenase-reductase (SDR) protein family (Jornvall et aZ.,1995), sharing an identity of less than 30%, whereas 17HSD type 5 is a member of the aldoketoreductase (AKR)protein family (Deyashiki et al., 1995).As can be expected on the basis of their dissimilar primary structures, 17HSD enzymes also differ in their substrate and cofactor specificities. In particular, 17HSD
356
HELLEVI PELTOKETO et al.
type 1and 3 enzymes catalyze reductive reactions of estrogens and androgens (Poutanen et al., 1993; Geissler et al., 1994; Miettinen et al., 1996a1, whereas type 2, 4, 5, and 6 enzymes are oxidative (Wu et al., 1993;Adamski et al., 1995; Deyashiki et al., 1995; Biswas and Russell, 1997). Furthermore, certain 17HSDs convert primarily estrogens, whereas part of them accept effortlessly both phenolic and neutral steroids as a substrate. There are also species-specific differences in substrate specificities; whereas human 17HSD type 1 enzyme gives preference to estrogens over androgens, the rodent type 1enzymes efficiently catalyze reduction of both of them (Nokelainen et al., 1996; Puranen et al., 1997a). Finally, some of the enzymes named 17HSD, also catalyze several other reactions, such as P-oxidation of fatty acids and oxidation of xenobiotics, as the type 4 and 5 enzymes, respectively, do (Deyashiki et al., 1995; Dieuaide-Noubhani et al., 1996; Leenders et al., 1996; &in et al., 1997). The 17HSD enzymes are expressed in distinct, though in some cases, overlapping patterns. Whereas 17HSD type 3 enzyme almost exclusively exists in the testis (Geissler et al., 1994; Sha et al., 1997),the type 5 enzyme is most abundantly detected in the liver and kidney (Deyashiki et al., 19951, and type 6 in the liver and prostate (Biswas and Russell, 1997), The type 2 (Casey et al., 1994; Mustonen et al., 1997a) and type 4 (Adamski et al., 1995) enzymes, on the other hand, are very widely expressed in both classical steroidogenic and peripheral tissues. The expression of type 1enzyme, in turn, parallels E2 biosynthesis in human ovarian granulosa cells and placental trophoblasts, and the enzyme is additionally expressed in certain target tissues of estrogen action. The 17HSD enzymes also show differential expression patterns during fetal life (Mustonen et al., 1997a). Of the days tested (fetal days 7, 11, 15, and 171, 17HSD type 1mRNA has been found to be expressed only on day 7 in a sample of whole mouse embryos. The amount of 17HSD type 2 mRNA increases gradually from slight expression on day 7 to very abundant expression on fetal day 17, correlating with the development of the tissues predominantly containing the type 2 enzyme in adult animals (Mustonen et al., 1997a,b, 1998).The signal for type 3 has been detected in fetal testes on days 15.5 and 17 of the gestation (Sha et al., 1996), which is in agreement with the evidence showing that the type 3 enzyme is critical for the normal development of male genitalia (Geissler et al., 1994;Andersson et al., 1996; Andersson and Moghrabi, 1997). In line with the results obtained from the tissues of adult animals, 17HSD type 4 enzyme is constitutively expressed throughout fetal life. Finally, a faint signal for 17HSD type 5 enzyme has been detected on embryonic day 7, after which expression vanishes and reappears again on day 15 (Mustonen et al., 1997a).
ROLE OF 17HSDS IN ESTROGEN ACTION
357
Collectively, the tissue-, cell-, and development-specific expressions of the different 17HSD enzymes as well as their substrate and cofactor specificities may enable a particular physiological function of each member of the 17HSD enzyme family. Several 17HSD enzymes, even the counteracting ones, may also coexist in a same tissue and even in the same cell type (Miettinen et al., 1996a), whereupon ligand activity is dependent on the total influence of the actions of different enzyme types. The main properties of the cloned rodent and human 17HSD enzymes are shown in the Table I. In the following we focus on the type 1 and 2 enzymes, whose role in regulation of estrogen action is best characterized.
PROPERTIES OF 17HSD TYPE 1ENZYME, A. GENERAL MRNAs, AND GENE Human 17HSD type 1enzyme mainly catalyses reduction of E l to E2, being able to use both NADH and NADPH as a cofactor. The human type 1 enzyme also reduces androgens in cultured cells to some extent, but clearly prefers phenolic substrates over neutral ones (Poutanen et al., 1993; Nokelainen et al., 1996; Puranen et al., 1997a). Rodent type 1enzymes, instead, catalyze effectively both androgenic and estrogenic substrates (Akinola et al., 1996; Nokelainen et al., 1996; Puranen et al., 1997a).The 17HSD type 1enzymes can also be compelled to catalyze oxidative reactions, but only in the presence of a substantial excess of the cofactors NAD+ or NADP+ (Karavolas and Engel, 1971; Puranen et al., 1994). In different types of cultured cells, type 1enzyme is exclusively reductase and the intracellular environment does not appear to affect the direction of the reaction (Miettinen et al., 1996a). The human gene encoding 17HSD type 1enzyme, hHSD17Bl (previously also called EDHl7B2),is localized in the chromosomal loci 17q12-21 together with hHSD17BPl (Tremblay et al., 1989; Luu-The et al., 1990; Winqvist et al., 1990; Peltoketo et al., 1992; Simard et al., 1993). The latter gene shares an 89% overall identity with hHSDl7B1 and its function, if any, is unknown. Due to the two transcription start points, the hHSD17Bl gene is transcribed into two mRNA transcripts, 1.3and 2.3 kilobases (kb)in size (Luu-The et al., 1989,1990).The longer mRNA,whose function remains obscure, is constitutively expressed in several tissues (Tremblay et al., 1989; Luu-The et al., 1990; Miettinen et al., 1996a) and cell lines with a minor association to the presence of the 17HSD type 1 protein (Poutanen et al., 1992a Miettinen et al., 1996a). Instead, 1.3-kb mRNA is expressed in cells producing 17HSD type 1 enzyme, and its amount largely correlates with the concentration of the protein (Poutanen et al., 1992a Miettinen et al., 1996a). It is
TABLE I ENZYMATIC PROPERTIES AND TISSUEDISTRIBUTIONS OF THE CLONED17HSD ENZYMES ____
Type/ protein family
Species cloned
Subcellular localization
1/SDR
Human
Cytosolic
Human
Tissue distribution Ovary, placenta,
Microsomal
Rat Mouse
~
Substrate specificity
Putative Function
Reference
Estrogens
Reductive
Peltoketo ef al. (1988);
Estrogens, androgens
E2 production Reductive E2, T oroduction
Luu-The et al. 1989) Ghersevich et al. (1 994a) Nokelainen et al. (1996)
Placenta, liver, small intestine, uterus, breast, prostate Placenta, liver, small intestime
Estrogens, androgens, (progestins)"
Oxidative E2, T inactivation (20aP activation)
Wu et al. (1993)
uterus, breast ovary
Rat Mouse 2lSDR
~
~
Akinola efal. (1996) Mustonen et al. (1997a)
3lSDR
Human Mouse
Microsomal
Testis
Androgens, estrogens
Reductive T production
Geissler el al. (1994) Sha et al. (1997)
41SDR-MFEb
Porcine Human Mouse Rat
Peroxisomal
Multiple tissues
acyl-CoA (estrogens)
Oxidative oxidation of fatty acids (E2 inactivation)
Lenders et al. (1994) Adamski ef al. (1995) Normand et al. (1995) Corton et al. (1996); Dieuaide-Noubhanief al. (1 996); Qin et al. ( 1997)
SIAKR
Mouse
Cytosolic
Liver, kidney, testis
Steroids (xenobiotics)
Oxidative inactivation
Deyashiki ef al. (1995)
6lSDR
Rat
Membranebound
Prostate, liver
Androgens
Oxidative DHT inactivation
Biswas and Russell (1997)
5ubstrates or functions presented in parentheses are not the primary substrates or activities of an enzyme. bMFE, multifunctional enzyme.
ROLE OF 17HSDS IN ESTROGEN ACTION
359
also the 1.3-kb mRNA whose transcription is subject to regulation (Tremblay et al., 1989; Poutanen et al., 1992a; Ritvos and Voutilainen, 1992; Tremblay and Beaudoin, 1993; Reed et al., 1994; Jantus-Lewintre et al., 1994a,b; Piao et al., 1995, 1997a). Like the human gene, the rat gene is also transcribed into two mRNAs 1.4 and 1.7 kb in size (Ghersevich et al., 1994a; Akinola et al., 1996). However, the two rat mRNA transcripts are to be caused by two polyadenylation signals not by two promoters, as in the human gene (Akinola et al., 1996, 199713). This explains why, unlike the human mRNAs the two rat mRNA transcripts are regulated in parallel, both in uiuo and in cultured cells (Ghersevich et al., 1994a,b,c;Kaminski et al., 1997). Type 1 17HSD enzyme plays a central role in both endocrine and auto-intracrine E2 action. First, expression of the type 1enzyme is associated with E2 production into the circulation from the ovaries during the follicular phase of the cycle (Ghersevich et al., 1994b,d; Sawetawan et al., 1994) and from the human placenta during pregnancy (Fournet-Dulguerov et al., 1987; Dupont et al., 1991; Blomquist and D’Ascoli, 1995).Second, 17HSD type 1enzyme converts circulating E l to E2 in some estrogen target cells, such as breast (Poutanen et al., 1992b; Miettinen et al., 1996a) and endometrial (Maentausta et al., 1991) epithelial cells, being thereby involved in the regulation of local E2 concentrations. In cultured breast cancer cells, the presence of 17HSD type 1enzyme has been shown to be associated with estrogendependent growth of the cells; that is, cells transfected with the 17HSD type 1 cDNA expression vector respond to E l , whereas the growth of cells without 17HSD type 1enzyme, is increased only by E2 (Miettinen et al., 199613). Thus, the action of 17HSD type enzymes, together with other factors, may lead to the accumulation of E2 in tissues, consequently increasing their exposure to the hormone. The action of 17HSD type 1enzyme in gonadal and extragonadal tissues is dealt with in more detail in Sections 111,IV, and V.
B. GENERAL PROPERTIES OF 17HSD TYPE 2 ENZYME, MRNAs, AND GENE The 17HSD type 2 enzyme is a membrane-associated protein that gives preference for NAD+ as a cofactor (Wu et al., 1993). Human and rodent 17HSD type 2 enzymes predominantly catalyze reactions opposite to those catalyzed by the type 1enzyme, being most efficient in catalyzing E2, T, and DHT to their less active 17-keto metabolites (Wu et al., 1993;Akinola et al., 1996). However, when the type 1and type 2 enzymes have been expressed together in culture cells, 17HSD type 1
360
HELLFJI PELTOKETO et al.
enzyme has always shown a higher catalytic efficacy than the type 2 enzyme (Miettinen et al., 1996a). The type 2 enzyme can, to a lesser extent, also convert 20a-dihydroprogesterone(20aP) to progesterone (P) (Wu et al., 1993). The type 2 enzyme exists in several tissues and cell lines where the type 1enzyme has also been detected, such as the human placenta, endometrium, and certain breast cancer cell lines (Wu et al., 1993; Casey et al., 1994; Miettinen et al., 1996a). In addition, both rodent and human type 2 enzymes are widely distributed in the gastrointestinal and urinary tracts, liver, and adrenals of adults (Casey et al., 1994; Miettinen et al., 1996a;Mustonen et al., 1997a, 1998)and developing fetuses (Mustonenet al., 1997b).The mode of action and the tissue distribution of 17HSD type 2 enzyme suggest that the enzyme may have a protective role in these tissues by lowering the concentrations of highly active sex steroids. The human gene encoding the type 2 enzyme, hHSD17B2, spans more than 40 kb and is localized on chromosome 16, 16q24.1-q24.2 (Casey et al., 1994; Durocher et al., 1995; Labrie et al., 1995).Two alternatively spliced mRNAs are encoded by the gene, one matching the identified type 2 mRNA, 1.45-1.5 kb in size, and the known 17HSD type 2 protein (Labrie et al., 1995). Instead, the protein product of another transcript does not possess 17HSDenzyme activities and its function is unknown. The possible association between the function of hHSDl7B2 and the loss of heterozygosity frequently observed in the 16q24 region in prostate (Carter et al., 1990; Bergerheim et al., 1991) and gynecological (Sato et al., 1991; Risinger et al., 1994)carcinomas is under intensive investigation (Durocher et al., 1995; Elo et al., 1997). The rat gene, rHSDl7B2,also encodes an mRNA 1.5 kb in size (Akinola et al., 1996),whereas the mouse analogue results in transcripts of about 0.9 and 1.2 kb (Mustonen et al., 1997a). AND OVARIAN E2 PRODUCTION 111. 17HSD TYPE1ENZYME
A. EXPRESSION OF 17HSD TYPE 1ENZYME AND ITSROLE IN OVARIAN E2 PRODUCTION Two different cell populations, the theca and granulosa cells, are involved in ovarian follicular E2 biosynthesis (see, e.g., Adashi, 1991, and references therein). Theca cells contain a machinery to produce androgenic precursors, which are then processed to estrogens in the granulosa cells. The granulosa cells of maturating follicles express the enzymes required for the last two steps in E2 production; cytochrome
ROLE OF 17HSDS IN ESTROGEN ACTION
36 1
P450 aromatase (P450arom)catalyzes the formation of the phenolicAring characteristic of estrogens, and 17HSD type 1enzyme converts 17ketosteroids into highly active 17P-hydroxysteroids. The estrogenspecificity of human 17HSD type 1 enzyme (Poutanen et al., 1993; Nokelainen et al., 1996; Puranen et al., 1997a) indicates that in developing human granulosa cells, E2 is mostly produced from A-dione via E l (Sawetawan et al., 1994).This is also in line with the studies showing that cultured human ovarian theca cells secrete 10 time more Adione than T (McNatty et al., 1979; Hillier et al., 1991; Bergh et al., 1993)and is supported by the findings that minor androgene-reductive 17HSD enzyme activity has been detected in human ovaries (Pittaway et al., 1977). Instead, the differences in the substrate specificities between human and rodent 17HSD type 1enzymes (Nokelainen et al., 1996;Akinola et al., 1996; Puranen et al., 1997a)suggest that in rodent granulosa cells the pathway from A-dione to T and further to E2 may also be possible. The essential role of P450arom in E2 biosynthesis has been comprehensively reviewed elsewhere (Simpson et al., 1994; Richards et al., 1995). Investigations have demonstrated that 17HSD activity is not constant in ovaries, as previously suggested, but that the expression of the 17HSD type 1 enzyme is strictly regulated during follicular development, both in human and rat ovaries (Ghersevich et al., 1994b,d; Sawetawan et al., 1994). The correlation of 17HSD type 1 mRNA expression with 17HSD enzyme activity and with E2 production in granulosa cells further confirms that the type 1enzyme is the major 17HSD involved in E2 biosynthesis during follicle maturation (Ghersevich et al., 1994b,d).Both in human and rat ovarian granulosa cells, expressions of P450arom (Richards, et al., 1987, 1995; Hickey et al., 1988; Overes et al., 1992) and 17HSD type 1 (Ghersevich et al., 1994b,d; Sawetawan et al., 1994)are associated with the maturation stage of follicles, which, in turn, is related to the capacity of these cells to produce E2 (Richards, 1980; Richards et al., 1987; Fortune, 1994; Freeman, 1994). Immunohistochemical studies have demonstrated that the 17HSDtype 1enzyme in the human ovary is localized in developing follicles ranging from primary follicles to large antral follicles (Sawetawan et al., 19941, and that the enzyme is also present in human luteal granulosa cells (Ghersevichet al., 1995d;Sawetawan et al., 1994).Throughout the rat estrus cycle, 17HSD type 1 enzyme is expressed in the developing primary, secondary, and tertiary follicles (Ghersevich et al., 1994a,b,c;Akinola et al., 1997). Its amount increases as follicular maturation progresses, being highest in tertiary and Graafian follicles. In luteinizing follicles, the expression of rat 17HSD type 1 enzyme is sharply down-regulated, and in atretic follicles or in the corpora lutea
362
HELLEVI PELTOKETO et al.
FIG.1. Darkfield microscope images showing 17HSD type 1and type 2 expression in mouse ovary. (A) Strong mRNA expression for 17HSD type 1 enzyme is detected in growing developing follicles; the largest ones are marked with arrows (bar = 400 pm). (B) The 17HSD type 1 expression is found exclusively in granulosa cells (gc) of the growing follicles, not in the theca cell layers (tc). Some expression of 17HSD type 1 mRNAis seen i n atretic follicles (at)(bar = 100 pm). ( C ) mRNA expression for 17HSD type 2 enzyme is limited exclusively to the surface epithelium of the ovary (arrow) (bar = 100 pm).
ROLE OF 17HSDS IN ESTROGEN ACTION
363
it is no longer significantly present. Figures 1A and 1B show corresponding expression of 17HSD type 1mRNA in mouse ovary, detected by in situ hybridization. For 17HSD type 2 enzyme messenger RNA has not been found in the follicles or corpus luteum of rat or mouse ovaries at any stage of their development (Akinola et al., 1997a; Mustonen et al., 1998).A faint signal for type 2 enzyme has been detected only in the surface epithelium of the rodent ovary (Fig. 1C). P450arom shows even more extensive and stage-specific regulation than 17HSD type 1 enzyme. Whereas Northern blot analysis of total rat RNA extracted from whole ovaries fails to show the differences in the expression of 17HSD type 1mRNAs at the different stages of the estrus cycle (Akinda et al., 1997a), P450arom expression is associated with the changes observed in ovarian E2 biosynthesis and secretion (Richard et al., 1987; Hickey et al., 1988; Akinola et al., 1997a). Most abundant expression of P450arom mRNAs has been demonstrated at proestrus, when estrogen production also reaches a peak just before the preovulatory surge of luteinizing hormone (LH) and subsequent ovulation. Expression of the enzyme is barely detectable at estrus, when E2 secretion also collapses. Amount of P450arom increases and is notable again at metestrus and diestrus, when E2 biosynthesis also begins to rise steadily (Butcheret al., 1974;Freeman, 1994,and references therein). Instead, ovaries of diethylstilbesterol (DESbtreated immature rats, which are known to contain a large number of preantral follicles with a homogenous population of granulosa cells, do not show significant expression of P450arom mRNAs, while the expression of 17HSD type 1 enzyme is highly induced (Ghersevich et al., 1994a; Akinola et al., 1997a). Thus, only 17HSD type 1 enzyme of the two enzymes is expressed in granulosa cells at the early stages of follicular maturation induced by DES, a synthetic estrogen. Altogether, the data indicate that the expressions of both P450arom and 17HSD type 1enzyme are under multihormonal regulation related to differentiation of the follicles. 17HSD type 1 enzyme however, shows a wider expression than P450arom during the different maturational stages of folliculogenesis, and E2 secretion into the circulation follows more closely P450arom than 17HSD type 1enzyme expression. OF 17HSD TYPE 1EXPRESSION IN OVARIES B. REGULATION
Pituitary gonadotropins, follicle-stimulating hormone (FSH) and LH, are the main regulators of the maturation of follicles and E2 secretion, and these processes include regulation of P450arom and 17HSD type 1 enzyme expressions. The effects of gonadotropins on the enzyme ex-
364
HELLEVI PELTOKETO et al.
pressions are further modulated at least by estrogens, androgens, and growth factors. Treatment of immature hypophysectomised rats with FSH results in the development of follicles and simultaneously enhances the expression of 17HSD type 1 and P450arom in granulosa cells, while hrther treatment with human chorionic gonadotropin (hCG) induces luteinization of follicles, resulting in sharp down-regulation of 17HSD type 1enzyme expression (Ghersevich et al., 1994a,c; Akinola et al., 1997a).During luteinization, 17HSD type 1enzyme may thus be down-regulated earlier than P450arom and limit E2 biosynthesis in luteal granulosa cells, or other 17HSD enzyme(s) may exist, being responsible for E2 biosynthesis after ovulation and during pregnancy in rodents. Estrogens alone affect the regulation of 17HSD type 1 enzyme expression and also modulate the influence of FSH on it. As mentioned earlier, a synthetic estrogen DES remarkably elevates 17HSD type 1 enzyme expression in granulosa cells of hypophysectomized immature rats (Ghersevich et al., 1994a). The strong up-regulation of type 1enzyme expression by DES in uiuo suggests that estrogens may regulate 17HSD type 1enzyme expression in granulosa cells via a positive feedback loop, which could help to maintain increasing E2 biosynthesis during follicular development (Richards, 1980;Hickey et al., 1988).No similar phenomenon, however, can be demonstrated in cultured granulosa cells. The dissimilarity between the results from cultured cells and those obtained in uiuo points thus to an indirect, possibly paracrine, effect of estrogen (Ghersevich et al., 1994b).Opposite to the administration of DES or FSH alone, FSH treatment of rats primed with DES leads to down-regulation of 17HSD type 1 enzyme expression in the ovaries (Ghersevich et al., 1994~). Again, cultured granulosa cells respond to simultaneous treatment with E2 and FSH differently from cells in uiuo in treated rats, showing a synergistic increase in 17HSD activity and type 1expression. This points to a complicated and possible paracrine influence of DES and/or FSH on 17HSD type 1enzyme expression. The observations also further demonstrate the correlation between the maturation stage of follicles and 17HSD type 1enzyme expression, since treatment with FSH and DES results in luteinization in uiuo in treated rats, while in cultured granulosa cells it does not. Androgens also potentiate the effects of FSH on 17HSD type 1expression in cultured granulosa cells in a similar manner (Ghersevich et al., 1994~). The influences of FSH, 8-bromo-cyclic adenosine-3',5'-monophosphate (8-Br-CAMP)and forskolin on 17HSD activity and 17HSD type 1 expression are alike in cultured granulosa cells (Tremblay et al., 1989;
ROLE OF 17HSDS IN ESTROGEN ACTION
365
Ghersevich et al., 1994b,c; Kaminski et al., 1997), which is in line with the data showing that CAMP is a major second messenger mediating the effect of FSH in granulosa cells. The protein kinase A (PKA)dependent regulation of 17HSD type 1 enzyme expression is further modulated, not only by estrogens and androgens, but also by certain growth factors. Transforming growth factor P1 (TGFP,) strongly enhances 17HSD activity and 17HSD type 1 enzyme expression in cultured granulosa cells (Kaminski et al., 1997). It also further potentiates the stimulatory effects of FSH and 8-Br-CAMPon 17HSD type 1 expression as it also does on P450arom expression (Adashi and Resnick, 1986; Ying et al., 1986; Adashi et al., 1989; Dorrington et al., 1993; Kaminski et al., 1997), pointing to synergism between the action of TGFP, and the CAMP-PKA pathway. In contrast, neither epidermal growth factor (EGF) nor the transforming growth factor cx (TGFa) or basic fibroblast growth factor (bFGF) affect 17HSD type 1 enzyme or P450arom expression when given alone, but effectively attenuate the stimulatory effects of 8-Br-CAMPand FSH (Hsueh et al., 1981;Adashi and Resnick; 1986; Adashi et al., 1987, 1988; Steinkampf et al., 1988; Bendell and Dorrington, 1990;Ghersevich et al., 1994c, Kaminski et al., 1997). Diacylglycerol analog and protein kinase C (PKC) activator, phorbol-12-myristate-13-acetate (PMA) blocks CAMP-dependent stimulation of 17HSD type 1 enzyme expression similarly to EGF, TGFcx, and bFGF (Kaminski et al., 1997). It can thus be suggested that the influence of the growth factors on 17HSD type 1 enzyme expression is achieved, at least in part, through the PKC-dependent pathway and by its crosstalk with the CAMP-PKA pathway. This is in line with the data indicating that phorbol esters inhibit FSH-CAMP-stimulated steroidogenesis in rat granulosa cells (Shinohara et al., 1985; Suh and Amsterdam, 1990; He et al., 1995). Altogether, the data suggest that in the developing granulosa cells 17HSD type 1 enzyme expression is primarily induced by FSH acting via the PKA-dependent pathway, and the extent of induction is modulated by PKC-dependent inhibition, estrogens, androgens, and autocrine-paracrine growth factors present in the ovary (Ghersevich et al., 1994a,c; Kaminski et al., 1997) (Fig. 2). Luteinizing agents, again, cause a sharp drop in 17HSD type 1enzyme expression, at least in rodent ovaries. The largely parallel response of 17HSDtype 1enzyme and P450arom to various hormonal treatments and their association to follicle maturation suggests that common mechanisms regulate their expression in rat granulosa cells. Nevertheless, there are also some differences in regulation of 17HSD type 1 and P450arom, such as responses of the enzymes to DES and luteinizing factors. The differ-
FIG.2. Schematic representation of the regulation of 17HSD type 1 enzyme expression in rat granulosa cells by pituitary gonadotropins, steroid hormones, and growth factors. The plus and minus signs indicate positive and negative regulation, respectively. A-dione, androstenedione; T, testosterone; E l , estrone; E2, estradiol; EGF, epidermal growth factor; TGF, transforming growth factor; LH, luteinizing hormone; FSH, follicle-stimulating hormone; rec, receptor; 17HSD type 1, 17P-hydroxysteroid dehydrogenase type 1; P450arom, P450 aromatase.
ROLE OF 17HSDS IN ESTROGEN ACTION
367
ences are also reflected in the intensity and extent of expressions of the two key enzymes of E2 biosynthesis, with E2 secretion following more faithfully the P450arom concentrations. IV. EXPRESSION AND ACTION OF 17HSD TYPE 1AND TYPE 2 ENZYMES DURING PREGNANCY
A. EXPRESSION AND ACTION OF 17HSD TYPE 1AND TYPE 2 IN FETO-PLACENTAL UNIT ENZYMES One characteristic phenomenon in human and rodent pregnancies is the rising estrogen concentrations in the circulation, E2 being essential for the maintenance of P action, which, in turn, is crucial for sustaining the pregnancy. However, there are fundamental differences between humans and rodents in the expression of these key enzymes. The human placenta plays a central role in P and E2 production (Simpson and MacDonald, 19811, whereas rat and mouse placentas do not produce E2 (Vinson and Chester-Jones, 1964; Townsend and Ryan, 1970; Rembiesa et al, 1971; Soares and Talamantes, 1983) and synthesize only limited amounts of P (Matt and MacDonald, 1984). The reason is that only the human placenta expresses significant amounts of 17HSD type 1and P450arom enzymes (Fournet-Dulguerovet al., 1987;Dupont et al., 1991; Maentausta et al., 1991; Simpson et al., 1994; and references therein), which catalyze androgenic precursors originating from the maternal and fetal adrenals to E2. The rat placenta also converts P into androgens (mainly A-dione) due its 17a-hydroxylase-C17,20-lyase activity (Warshaw et al., 1986; Gibori et al., 1988, and references therein), which is missing from the human placenta. Instead, rodent ovarian corpus luteum secretes P throughout the gestation, and estrogens are synthesized there from androgens of placental origin (Soares and Talamantes, 1983; Jackson and Albrecht, 1985; Warshaw et al., 1986; Gibori et al., 1988). Interestingly, throughout pregnancy, rat 17HSD type 1enzyme is constantly expressed only in the granulosa cells of developing ovarian follicles, not in the corpora lutea. Its concentration is also minor as compared to that of P450arom, especially at days 15-18 of pregnancy (Akinola et al., 1997a). Thus, concentration and cell distribution of 17HSD type 1do not follow those of P450arom and changes in E2 secretion in the rodent ovary during the gestation. Whether the relatively low expression of 17HSD type 1is sufficient for E2 production in pregnant rat ovaries remains to be clarified. Accordingly, only the human placenta contains P450arom and
368
HELLEVI PELTOKETO et al.
17HSD type 1 enzymes, which are abundantly expressed in syncytiotrophoblasts (Fournet-Dulguerov et al., 1987; Dupon et al., 1991; Maentausta et al., 19911, the cells therefore having a high capacity to produce E2 from androgen precursors of fetal and maternal origin. After the first 7 weeks of gestation, nearly all the estrogens produced are synthesized in the human placenta (Ringler and Strauss, 1990). Opposite to the type 1 enzyme, both human and rodent placentas contain 17HSD type 2 enzyme, whose expression also increases toward the end of the pregnancy (Wu et al., 1993; Blomquist and DAscoli, 1995; Beaudoin et al., 1995; Akinola et al., 1997a; Mustonen et al., 1997b). That agrees with the data showing that the placentas possess increasing oxidative 17HSD activities as pregnancy advances (Blomquistet al., 1993; Blomquist, 1995). The 17HSD type 2 enzyme is also increasingly expressed in the fetus from day 11onward (Mustonen et al., 1997b). The expression of 17HSD type 2 enzyme in mouse placenta is concentrated to certain trophoblast cells, but the cell distribution of the enzyme changes as pregancy advances (Mustonenet al., 1997b).There are four differentiated trophoblast cell types, and the trophoblast giant cells located at the maternal interface constitute one of the cell types in which a wide range of placental peptide .and steroid hormones are predominantly synthesized (Sherman, 1983; Soares et al., 1991, 1993). Spongiotrophoblasts,syncytial cells, and glycogen cells, in turn, are involved in the formation of the junctional zone and the labyrinth zone of the rodent chorioallantoic placenta (Anderson, 1959).At the beginning of the pregnancy on days 3.5 and 5.5, weak mRNAexpression of 17HSD type 2 enzymes is first seen in the epithelium of the uterus (Mustonen et al., 1997b) as the expression is detectable also in the uterus of nonpregnant mouse (Mustonen et al., 1998).On day 7.5, moderate expression extends to the extraembryonic endodermal component of the visceral yolk sac, in which the intense signals for type 2 mRNA remain throughout the days of gestation analyzed (days 8-16). On day 7.5, a clearly detectable signal is also seen in the emerging trophoblast giant cells, and on day 8,17HSD type 2 mRNA is intensely expressed in the continuous layer of trophoblast giant cells of the developing placenta located adjacent to the uterine decidua surrounding the entire developing conceptus. Later, on days 9-12.5, type 2 mRNA continues to be strongly expressed in the trophoblast giant cells, whereas by day 14.5 expression of the mRNA has disappeared therefrom (Mustonen et al., 1997b). On day 9, a strong signal for 17HSD type 2 mRNA is also detected in spongiotrophoblasts,but not in glycogen cells, located in the junctional zone. The signal is weaker on day 12.5 and disappears by day 14.5. In-
ROLE OF 17HSDS IN ESTROGEN ACTION
369
stead, from day 12.5 onward, 17HSD type 2 enzyme is expressed in the labyrinth region of the placenta, in which it is not detected in the earlier phases of the pregnancy, and in late gestation (days 14.5-17.5), type 2 mRNA is predominantly expressed only in the labyrinth region. On the whole, the expression of 17HSD type 2 shifts from the giant cells of choriallantoic placenta to the labyrinth region as the pregnancy progresses (Figs. 3A and 3B). Thus, at the earlier stages of pregnancy, 17HSD type 2 enzyme expression takes place in the cells producing androgens to be used in ovarian estrogen biosynthesis, whereas at the later stages of pregnancy, type 2 enzyme expression and capacity for androgen production are no longer colocalized.Giant cells secrete mainly A-dione, whereas less T is produced (Gibori et al., 1988, and references therein), which agrees with the oxidative activity of 17HSD type 2 enzyme and the absence of reductive 17HSD type 1and 3 enzymes capable of converting A-dione to T. No expression of 17HSD type 1enzyme has been found in either rat (Akinola et al., 1997a) or mouse (Mustonen et al., 1997b) placentas at any stage of development. In the mouse fetus, the 17HSD type 2 expression pattern largely coincides with that found in adult animals (Mustonen et al., 199713).The type 2 is mainly expressed in the endodermal epithelia, the first signals for it being detectable in the liver on fetal day 11. Next day, the expression is strongly enhanced in the liver, and moderate type 2 mRNA expression is simultaneously detected in the esophagus and intestine. In these tissues, abundant constitutive expression of 17HSD type 2 is then maintained throughout pregnancy. At later stages of gestation (days 15-16), mRNAis further detected in epithelial cells of the stomach, tongue, oropharynx and nasopharynx, and kidney. A signal for 17HSD type 1enzyme, on the contrary, has been detected only from the poly(A)+-rich RNA isolated from whole mouse embryo on day 7, the time immediately after blastocyst development. This is in line with several reports suggesting that estrogens play a crucial role in early embryogenesis and/or embryo-uterus interaction. E2 production has been detected to peak 1 day after implantation in rabbits, for example (George and Wilson, 1978), and P450arom, in addition to 17HSD type 1enzyme, has been found to exist in blastocysts (Conley et al., 1994). At later stages of pregnancy expression of 17HSD type 1 mRNA has been undetectable in Northern blot analysis as well as in the sagittal sections of the embryo (Mustonen et al., 1997a,b). Put together, abundant expression of the type 2 enzyme throughout pregnancy in the fetal part of the placenta, visceral yolk sac, and gastrointestinal tract and several other surface epithelial cell layers of the fetus suggests that the type 2 enzyme may play a central role in re-
FIG.3. Darkfield microscope images of in situ hybridizations showing 17HSD type 2 expression in developing mouse placenta. (A)At day 9 of the pregnancy, mRNA for 17HSD type 2 enzyme is intensely expressed in the continuous layer of trophoblast giant cells (g), and the signal for type 2 mRNA is also detected in spongiotrophoblasts of the junctional zone (jz). The uterine decidua (d) does not show any specific signal for the type 2 enzyme (bar = 100 km). (B) On day 14.5 the expression of 17HSD type 2 has predominantly shifted from the gia n t cells ( g ) and the junctional zone (jz) to the labyrinth region (1) (bar = 100 pm).
ROLE OF 17HSDS IN ESTROGEN ACTION
371
ducing the concentrations of active sex steroids available to the fetus. The type 2 enzyme could thus protect the fetus from the excessive action of 17P-hydroxysteroids in the maternal circulation and those present in the amniotic fluid surrounding the fetus (Schindler, 1982). On the other hand, the 17HSD type 2 enzyme may also hinder the entrance of the highly active T and DHT synthesized in male fetal gonads to the maternal circulation. Altogether, 17HSD type 2 enzyme in the developing rodent placenta and fetus may play a role in maintaining a barrier t o the highly active 17P-hydroxyforms of sex steroids between the fetus and the mother. This, in turn, could be vital for normal fetal development and normal progression of pregnancy. The same role may also be suggested t o be held by the type 2 enzyme in human placenta, in which it is expressed adjacent to the type 1 enzyme (Blomquist and D’Ascoli, 1995). Finally, in addition to 17HSD activity, 17HSD type 2 enzyme also possesses 20HSD activity, and the role of this activity in the maintenance of normal gestation and P concentrations in the maternal circulation remains to be studied. OF 17HSD TYPE1EXPRESSION B. REGULATION IN HUMAN CELLSOF PLACENTAL ORIGIN
Abundant expression of P450arom and 17HSD type 1enzymes in human placental syncytiotrophoblasts ensure substantial production of estrogens during pregancy. When screening for the factors possibly involved in maintaining high 17HSD type 1 enzyme expression in the placenta, the main focus has been on paracrine, autocrine, and nutritional agents, which and whose receptors are present in the placenta and which are known to modulate 17HSD type 1enzyme expression, E2 production, and/or estrogen-dependent growth in placental or other cell types. Regulation of the expression of the type 1enzyme as well as P450arom has widely been investigated in the JEG-3 choriocarcinoma cell line, which represents certain characteristics of trophoblasts and has retained the capability of producing E2 from C-19 precursors (Kohler et al., 1971; Bahn et al., 1981) and in addition, in primary cultured trophoblast cells. The three growth factors, EGF, TGFa, and bFGF, which contribute on ovarian 17HSD type 1enzyme expression by reducing FSH-cAMPdependent induction, enhance enzyme expression in JEG-3 cells (Jantus Lewintre et al., 1994a,b). In addition, 17HSD type 1 enzyme expression in JEG-3 cells is increased by CAMPanalogs, PMA and Ca ionophore, the activator of the Ca2+ pathway (Tremblay et al., 1989; Ritvos and Voutilainen, 1992; Tremblay and Beaudoin, 1993; Jantus
372
HELLEVI PELTOKETO et a2
Lewintre et al., 1994a,b; Piao et al., 1997a), of which the first does not further enhance the effect of EGF, whereas the latter ones increase it synergistically (Jantus Lewintre et al., 1994a,b;Piao et al., 1997a).Furthermore, CAMPanalogs and PMA result in a synergistic effect on 1.3kb 17HSD type 1mRNA expression (Tremblay and Beaudoin, 1993), and the Ca ionophore enhances the effects of both 8-Br-CAMPand PMA on 17HSD type 1enzyme expression in JEG-3 cells (Piao et al., 1997a). Contrariwise, CAMPanalog reduces 17HSD type 1enzyme expression in primary cultured cytotrophoblasts, which suggests that response of hHSD17Bl gene to signals of CAMP-dependent pathway may be dependent on the state of differentiation of the cell and the extent of duration of stimulation (Tremblay et al., 1989). Retinoic acids (RAs), which affect the biosynthesis of several essential placental products, such as P, human chorionic gonadotropin subunits, and human placental lactogen (Kato and Braunstein, 1991; Matsuo and Strauss, 1994; Stephanou and Handwerger, 19951,are also able to enhance 17HSD type 1 enzyme expression in JEG-3 cells (Piao et al., 1997a).All-trans-RA (atRA) and 9-cis-RAincrease reductive 17HSD activity and 17HSD type 1mRNA expression several-fold when administered alone and have a particularly strong effect together with EGF, Ca ionophore, PMA,and CAMPanolog. Simultaneous administration of RAs with EGF, Ca ionophore, or PMA, for example, results in 20-to 40fold increases in 17HSD type 1mRNA expression in JEG-3 cells (Piao et al., 1997a). The growth factors and retinoic acids are also potential modulators of 17HSD type 1enzyme expression in the placenta. EGF, bFGF, and TGFa as well as their receptors have been localized in placental trophoblast cells (Maruo et al., 1987; Cattini et al., 1991; Lysiak et al., 1993). EGF, in particular, is an inducer of placental trophoblast differentiation (Morrish et al., 1987), and its receptors are abundantly expressed in syncytiotrophoblasts (Maruo et al., 1987;Amemiya et al., 1994). Retinoic acid receptors (RARs) and their isoforms, in turn, are widely distributed in different tissues, and cultured human trophoblasts have been demonstrated to express at least RARa, RARp, RARy, and retinoid X receptor a (RXRa).During differentiation from cytotrophoblasts to syncytiotrophoblasts, concentrations of the RARa, RARp, and RXRa mRNA increase further (Stephanou et al., 1994). Moreover, the hHSDl7Bl gene contains a DR5-retinoic acid response element (DR5-RARE)(Piao et al., 1995). DR5-RARE is a typical binding site for an RXR/RAR dimer, which is activated by atRA and 9-cisRA (GiguBre, 1994). The regulation of the hHSD17Bl gene by RAs is described in more detail in Section VII. In conclusion,the synergy of RA action with the influence of EGF and
ROLE OF 17HSDS IN ESTROGEN ACTION
373
PKA and C activators results in a considerable increase of 17HSD type 1 enzyme concentration in trophoblast-like cells. Thus, RAs together with EGF and possibly other available factors activating the PKA or PKC pathways may be involved in maintaining high 17HSD type 1enzyme expression and, consequently, E2 production in placental syncytiotrophoblasts. Regulation of 17HSD type 1 enzyme expression in JEG-3 cells differs from that seen in granulosa cells (Ghersevich et al., 1994a; Kaminski et al., 1997) as well as from that observed in T47D breasts cancer cells (see Section V,A), which shows that the 17HSD type 1enzyme is differentially regulated in these cell types.
V. PHYSIOLOGICAL ROLEAND EXPRESSION OF 17HSD TYPE 1 AND TYPE 2 ENZYMES IN PERIPHERAL TISSUES
A. 17HSD TYPE1AND TYPE2 ENZYMES IN NORMAL AND MALIGNANT BREAST TISSUE
The expression patterns of 17HSD type 1 and type 2 enzymes also overlap in tissues other than human placenta. Both of the enzymes have been located in certain target tissues of estrogen action, including breast and endometrium, and/or in cell lines originating from them. Highly variable amounts of 17HSD type 1enzyme have been detected in about 70 and 50% of benign and malignant breast specimens, respectively (Poutanen et al., 199233, 1995; Sasano et al., 19961, and 1.3kb mRNA for type 1enzyme has been found in three of the five tested breast cancer cell lines (Miettinen et al., 1996a). In certain breast tissue specimens, abundant 17HSD type 1enzyme expression is associated with strong stromal proliferation, suggesting that stroma-derived paracrine factors may participate in the regulation of enzyme expression in these tumors (Poutanen et al., 1995).Amoderate relationship between the expressions of 17HSD type 1and progesterone receptor (PR) in the tumor samples has been detected in some (Poutanen et al., 199213) but not all studies (Sasano et al., 1996). Instead, a significant correlation has been observed between expression of 17HSD type 1 and P450arom enzymes in invasive lobular carcinoma samples (Sasano et al., 1996). No such interdependence can be seen in invasive ductal carcinoma, and no other correlations between the two enzyme expressions, PR or estrogen receptor (ER) status, clinical stage, age, and Ki67 labeling indices have been found in the material investigated (Sasano et al., 1996). Estrogen-induced proliferation is assumed to play a central role in
374
HELLEVI PELTOKETO et al.
the promotion of breast cancer and tumor growth (Cullen and Lippman, 1989, and references therein). Increasing interest has been focused on local estrogen metabolism in breast tissue and its influence on the extent of local estrogen action and the risk for breast cancer (Labrie, 1991; Bulun et al., 1993; Santen, 1996). Indeed, E2 has been found to accumulate into breast cancer tissue (Fishman et al., 1977; McNeill et al., 1986; Vermeulen et al., 1986; Thijssen and Blankenstein, 19941, and in addition to 17HSD type 1 enzyme, the presence of other enzymes required for in situ E2 biosynthesis in breast tissue has been demonstrated in several studies (Miller et al., 1982; Bulun et al., 1993; Sasano et al., 1994,1996). The impact of intracellular biosynthesis on estrogen action was illustrated by studies in which 17HSD type 1 enzyme has been expressed in cultured cells in the same amounts as it exists in certain breast tumors. E l increased the growth of the treated cells similarly to E2, whereas the control cells without 17HSD type 1enzyme did not, showing the activity and growth-promoting influence of 17HSD type 1enzyme (Miettinen et al., 1996b, Fig. 4). Several paracrine, autocrine, and nutritional factors that regulate 17HSD type 1 enzyme expression in the placenta and/or ovaries are also available in breast tissue, as are their receptors. Similar to those detected in the choriocarcinoma cell line, RAs increase type 1expression in the T47D breast cancer cell line (Piao et al., 1997a). However, unlike in the JEG-3 cell line (Piao et al., 1997a) and in granulosa cells
g
120 110 100
f0 9 0 E
1:
40 B
0 1 2.5 5 10 25 50 100 estrogen concentration (pmoln)
30
0 1 2.5 5 10 25 50 100 estrogen concentration (pmoUI)
FIG.4. Effect of 17HSD type 1enzyme on estrogen-dependent cell growth. The control cells (A) and MCF-7 cells stably transfected with 17HSD type 1enzyme (B) were grown for 7 days in the presence of E l (clear columns) or E2 (hatched columns). Thereafter, the number of the cells were counted and the values are given as percentage of maximal growth 2 standard deviation (SD). (Data adapted from Miettinen et al., 1996b.)
ROLE OF 17HSDS IN ESTROGEN ACTION
375
(Ghersevich et al., 1994c; Kaminski et al., 1997), CAMPanalog does not have effect on the type 1 enzyme concentration alone and it decreases RA-stimulated 17HSD type 1 enzyme expression in T47D cells. Furthermore, neither EGF nor PMA increase type l enzyme expression or potentiate the influence of RAs on it in the breast cell line, whereas they do that in JEG-3 cells (Piao et al., 1997a). Thus, the expression of the 17HSD type 1enzyme is differently regulated in these two cell lines and possibly also in the two tissues they originate from. Granulosa cells, on the other hand, probably have a unique gonadotropin-dependent system modulated by growth factors and steroid hormones for the regulation of 17HSD type 1enzyme. The type 2 enzyme is expressed in at least certain breast cancer cell lines, of which BT-20 and MDA-MB-361 contain both of the enzymes (Miettinen et al., 1996a). The results from previous studies also indicate the presence of a microsomal and oxidative 17HSD enzyme in normal, benign and malignant breast tissue (Pollow et al., 1977; Fournier et al., 1982; Bonney et al., 1983, 1986; Tait et al., 1989; Mann et al., 1991). Future studies will show what kind of role 17HSD type 1and 2 enzymes play together in exposing-protecting breast tissue to and from excessive estrogen action. IN ENDOMETRIAL TISSUE B. 17HSD TYPE 1AND WE2 ENZYMES
Immunohistochemical staining for 17HSD type 1enzyme recognizes the antigen in glandular and epithelial cells of normal and malignant endometrium, (Maentausta et al., 1991, 1992). Type 2 mRNA is also principally localized in the glandular epithelium of endometrial tissue (Casey et al., 19941, and the type 2 mRNA is also abundantly expressed in endometrial cancer cell line RL95-2 (Miettinen et al., 1996a).Expressions of both type 1 (Maentausta et al., 1991) and type 2 (Casey et al., 1994) are associated with the plasma levels of P, the highest expression for the former being obtained during the early to midsecretory phase (Maentausta et al., 1991) and for the latter during the mid- to latesecretory phase (Casey et al., 1994).The predominant oxidative 17HSD activity of endometrial tissue (Tseng, 1980, and references therein) and the undetectable concentration of 1.3-kb 17HSD type 1mRNA in the total RNA sample isolated from secretory phase endometria, however, indicate that the type 2 enzyme is the principal 17HSD enzyme in the endometrium (Casey et al., 1994). Thus, the type 2 enzyme, in addition to the decreased estrogen receptor concentrations (Fleming et al., 1980) and the increased estrone sulfotransferase activity, may participate in the progestin-induced down-regulation of estrogen action during the
376
HELLEVI PELTOKETO et al.
luteal phase in the endometrium, as suggested (Tseng, 1980, and references therein). Contrary to in humans, however, only slight 17HSD type 2 expression has been detected in rat and mouse uteri, which suggests that the type 2 enzyme may not contribute signficantly to the regulation of estrogen action in rodent uterus (Akinola et al., 1997a; Mustonen et al., 1998).
C. EXPRESSION OF 17HSD TYPE 1AND TYPE 2 ENZYMES IN OTHERPERIPHERAL TISSUES Minor signals of 17HSD type 1 1.3-kb mRNA have been detected outside ovarian, placental, or breast tissues in humans (Luu-The et al., 1990;Miettinen et al., 1996a)whereas type 2 enzyme is more widely expressed (Casey et al., 1994; Miettinen et al., 1996a).Apart from the placenta and uterus, human type 2 mRNA is abundantly expressed in the liver and small intestine, and it is also detectable in other tissues of the gastrointestinal and urogenital tracts, such as the colon, pancreas, and kidney (Casey et al., 1994; Miettinen et al., 1996a). mRNA for the type 2 enzyme has also been localized in neoplastic, both benign and malignant, human prostate tissue (Delos et al., 1995;Elo et al., 1996)and in an epithelial-like prostate cancer cell line (Miettinen et al., 1996a).With the exception of the uterus, the expression pattern of 17HSD type 2 enzyme in rodent tissues is, to a great extent, similar to that in human (Akinola et al., 1996;Mustonen et al., 1997a, 1998).Characteristically, the type 2 enzyme is expressed in epithelial cells of various types, such as the stratified squamous epithelium of the esophagus; the surface epithelial cells of the stomach, small intestine, and colon; and the epithelium of the urinary bladder (Mustonen et al., 1998, Fig. 5). The 17HSD type 2 mRNAis also abundant in the hepatocytes of the liver and the thick limbs of the loops of Henle in the kidneys. In addition, 17HSD type 2 enzyme expression is detectable in the seminiferous tubules and the sebaceous glands of the skin. With the exception of the genital tract and placenta, 17HSD type 2 enzyme is expressed similarly in male and female tissues (Mustonen et al., 1998). Furthermore, in such tissues as the liver and small intestine, for example, the expression of type 2 enzyme is constitutive from late fetal life up to adulthood and no variation in the concentration of type 2 mRNA in these tissues is seen during the estrus cycle of pregnancy in female animals (Akinola et al., 1997a). The data, therefore, suggest that the expression of the type 2 enzyme in different tissues is mostly not related to concentration or type of sex steroid in the blood
ROLE OF 17HSDS IN ESTROGEN ACTION
377
FIG.5. Darkfield microscope images of in situ hybridizations demonstrating 17HSD type 2 enzyme expression in epithelia of esophagus (A), small intesine (B), and urinary bladder (C). The arrows point to the epithelial cell layers containing the signal for type 2 mRNA (bars = 100 bm).
378
HELLEVI PELTOKETO et al.
circulation, and that the P-induced expression in endometrium is an exception. The wide expression of 17HSD type 2 enzyme in the gastrointestinal and urinary tracts, moreover, indicates that the enzyme may be one of the enzymes involved in the rapid degradation and excretion of steroids and steroid-like compounds in the intestine and liver, respectively. The type 2 enzyme could thus control the concentration of active sex steroids to be released into the circulation, as well as the estrogen in those tissues, since estrogen receptors have been localized in many of the cell types of the gastrointestinal and urinary tracts expressing 17HSD type 2 enzyme (Pacchioni et al., 1993; Thomas et al., 1993). In conclusion, 17HSD type 2 enzyme may contribute on steroid inactivation in a range of tissues and cell types not considered classical sex steroid target tissues. The location of the enzyme suggests that it might also participate in the metabolism of other steroid-like compounds, available from nutriments, for example (Mustonen et al., 1998).
VI. STRUCTURE AND FUNCTION OF 17HSD TYPE 1ENZYME: APPLICATIONS TO THE PREVENTION AND TREATMENT OF ESTROGEN-DEPENDENT CANCERS As mentioned in Section V, A, 17HSD type 1enzyme may have a significant role in the regulation of estrogen exposure and estrogen-dependent growth of breast tissue. Much interest has therefore been focused on the possible use of 17HSD type 1 enzyme inhibitors in decreasing both endocrine and intracrine E2 production and, further, the use of inhibitors similar to P450arom inhibitors in the prevention and/or treatment of estrogen-dependent breast cancer (Labrie, 1991; Breton et al., 1996; Penning, 1996). The detailed information about the structure and function of 17HSD type 1enzyme will significantly facilitate the design of specific inhibitors for the enzyme. The 17HSD type 1protein exists in a homodimer (Burns et al., 1972; Nicolas and Harris, 1973; Lin et al., 1992) consisting of noncovalently bound, but strongly associated, subunits (Puranen et al., 1997b). The firm association ensures a stable dimerization state of the enzyme, which is evidently necessary for its proper function. The X-ray structure of the enzyme dimer indicates that there are two dimerization helices in each monomer, forming a four-helix bundle (Ghosh et al., 1995). Disturbance of the formation of the helices by substitutions LeulllGluVa1113Phe or Ala170Glu+Phe172leads to disruption of the dimeric interface, prevents proper folding of the enzyme, and results in an ag-
ROLE OF 17HSDS IN ESTROGEN ACTION
379
gregated and inactive protein of over 300 kDa in size (Puranen et al., 1997b). Similar to 17HSD enzymes types 2 to 4 and 6, the type 1enzyme belongs to the SDR protein family, the members of which share low overall identity of primary structures (15-30%) (Krozowski, 1992, 1994; Baker, 1994; Jornvall et al., 1995). However, several enzymes of the SDR family have kindred secondary structures with alternating a-helices and P strands and, consequently, similar kind of tertiary constructions (Ghosh et al., 1991, 1994, 1995; Varughese et al., 1992). A monomer of human 17HSD type 1 enzyme has a secondary structure consisting of several P strands (PA-PG), and a helixes, aB-aG”, aG’, aG, aH’, and aH, of which aG”, aG’, aG, and aH’ helices are characteristic for the 17HSD type 1enzyme (Ghosh et al., 1995; Labrie et al., 1997). Typically, certain individual amino acids have been conserved among all of the SDR enzymes (Persson et al., 1991).A highly conserved pentapeptide of Tyr-X-X-X-Lys, corresponding to ”37r155and Lys159 in human 17HSD type 1enzyme, is located in the vicinity of the modeled catalytic site comprising a cofactor-binding cleft and a steroid-binding cleft (Ghosh et al., 1995). The tyrosine residue plays a critical role in catalysis of several members of the SDR family (Ensor and Tai, 1991, 1994; Obeid and White, 1992; Chen et al., 1993; Cols et al., 1993) and, in line with that, substitution of Tyr155in the type 1enzyme also leads to a loss of both enzymatic and immunological activity (Puranen et al., 1994, 199713). According to the current model for the catalytic mechanism of 17HSD type 1enzyme, the tyrosine residue is a proton donor, whereas the conserved Lys159appears not to be directly involved in the catalysis (Ghosh et al., 1995, Azzi et al., 1996, Breton et al., 1996). Instead, Lys159is postulated to stabilize the cofactor binding of the enzyme by interacting with the 2’- and 3’-hydroxyl groups of nicotinamide ribose. Substitution of the residue abolished the activity of the type 1enzyme, which confirms the essentiality of the residue (Puranen et al., 199713). Mutation of the third well-conserved residue, Ser142,also results in an inactive enzyme (Puranen et al., 1997a). This is in agreement with the model, suggesting that the serine residue lowers the pK, of Tyr155 by forming a hydrogen bond with its side chain (Ghosh et al., 1995; Labrie et al., 1997). Instead, replacement of His221and G1u282,individually or simultaneously, leads to a relevant decrease in the human 17HSD type 1enzyme activity only in vitro not in viuo (Puranen et al., 1994, 1997a). The result indicates that the hydrogen bonds which appear to exist between the two residues and E2 in crystallized enzyme-E2 complex (Azzi et al., 1996), are not fundamental for the func-
380
HELLEVI PELTOKETO et a1
tion of the enzyme. The absence of a corresponding histidine residue in rodent 17HSD type 1enzymes (Ghersevich et al., 1994a, Nokelainen et al., 1996)likewise points to the minor importance of Hiszz1for the proper function of the type 1enzyme. Substitution of Ser13*, which can be phosphorylated by PKA in uitro (Barbieri et al., 1994) but not in uiuo, does not affect 17HSD activity either (Puranen et al., 1997b). This is also the case with detected polymorphisms, Ala237Valand Ser3lZGly (Normand et al., 1993; Mannermaa et al., 1994; Puranen et al., 1994). Finally, the last 36 amino acids can be deleted from the 17HSD type 1 enzyme without any dramatic effect on its catalytic properties (Puranen et al., 1997b). Interestingly, whereas human 17HSD type 1enzyme predominantly catalyzes the reduction of E l to E2, mouse and rat type 1enzymes also efficiently convert A-dione to T (Nokelainen et al., 1996; Puranen et al., 1997a). The data obtained by analyzing the activity of various rat-human chimeric enzymes indicate that the region between the amino acids 148 and 268 is responsible for the difference in substrate specificity (Puranen et al., 1997a). Results from site-specificmutation analyses together with modeling of the rat 17HSDtype 1enzyme show, moreover, that the difference is due to a combination of several amino acid residues, which vary from the human type 1enzyme to rodent enzymes. The A ~ n l ~ ~ and H i sProls7Ala variations, in particular, together with several amino acid variations at the recognition end of the catalytic cleft built by residues 190-230, alter the structure of the active site of 17HSD type 1enzyme toward being more favorable for an androgenic substrate (Puranen et al., 1997a). In summary, according to the current model, the hydroxyl group of Ser 142 and T y P 5 and the steroid 017 atom form a triangular hydrogen-bond network enabling hydride transfer and reduction of E l by human 17HSD type 1enzyme. Ly.P9 may, furthermore, stablize a ribose group of a cofactor (Ghosh et al, 1995; Azzi et al., 1996; Breton et al., 19961, and the estrogen specificity of the human enzyme is determined by the residues 148-230 (Puranen et al., 1997a). The three conserved residues, serine, tyrosine, and lysine, are also present in 17HSD type 2 enzyme (Wu et al., 1993;Akinola et al., 1996; Mustonen et al., 1997a), suggesting a reaction mechanism of similar kind also in the type 2 enzyme. The accumulating detailed information about the catalytic function and especially the three-dimensional structure of the enzymes will remarkably assist the design of specific inhibitors for the type 1enzyme and possible therapeutic agents for the prevention and treatment of breast cancer.
ROLE OF 17HSDS IN ESTROGEN ACTION
381
VII. REGULATION OF H H S D 7Bl ~ GENEEXPRESSION Results have demonstrated that the 1.3-kb transcript of the
hHSDl7Bl gene rather than 2.3-kb mRNA is mainly translated to 17HSD type 1protein (Poutanen et al., 1992a, Miettinen et al., 1996a) and is subject to various regulations. Thus, knowledge of the structure and function of the promoter for 1.3-kb mRNA, in particular, is critical for understanding the mechanisms controlling 17HSD type 1expression. So far, three functional elements have been identified between the transcription start points for 2.3- and 1.3-kb mRNAs, that is, upstream from the cap site for the shorter transcript. First the fragment -78-+9, with respect to the cap site for the 1.3-kb mRNA, is enough to serve as a promoter for the expression of the 1.3-kb 17HSD type 1mRNA. Second, the region from -661 to -392 enhances the function of the promoter, whereas the action of the area between the enhancer and the promoter leads to decreased activity of the hHSDl7B1 gene (Piao et al., 1995,1997b). AND FUNCTION OF THE hHSDl7B1 PROMOTER A. STRUCTURE
The region from -78 to +9 in the hHSDl7B1 gene contains a sequence typical of a TATA box and a guanine-cytosine (GO-rich area, 30 nucleotides in size (Luu-Theet al., 1990;Peltoketo et al., 1992,1994).The fragment itself induces detectable reporter gene expression in several cell lines (Peltoketo et al., 1996),and, particularly when connected to the hHSDl7B1 enhancer or the Simian virus 40 (SV40) enhancer, the region -78-+9 is able to drive reporter gene expression efficiently (Piao et a,?., 1995).The GC-rich area of the promoter contains interacting binding sites for Sp and AP-2 transcription factors adjacent to each other (Piao et al., 1997b).Two Sp factors, Spl and Sp3, have been found to recognize the Sp motif in the region from -52 to -43. Mutation of the motif abolishes detectable binding and decreases the promoter activity to 30% in JEG-3 cells and to 60% in JAR cells. Moreover, hHSDl7B1 promoter activity is low in certain cell lines expressing small amounts of Spl. Binding to the Sp motif may thus have a substantial role in the complete functioning of the hHSDl7B1 promoter. Instead, the binding ofW-2 to its motifin the region from -62 to -53 results in reduced binding of S p l and Sp3 and, furthermore, mutation of the AP-2 element increases promoter activity to 260%in JEG-3 cells. The data thus imply that AP-2 can repress the function of the hHSDl7B1 promoter by preventing binding to the Sp motif (Piao et al., 199713).
382
HELLEVI PELTOKETO et al.
Both S p l and Sp3 are widely distributed transcription factors that bind to the GC-rich Sp motif with identical affinities (Hagen et al., 1992). S p l activates a wide array of cellular and viral promoters, and it may also interact with several regulatory factors and, consequently, mediate cell- and gene-specific effects on the promoter of the target genes, such as the human chorionic somatomammotropin gene (Lecointe et al., 1994; Li et al., 1994; Jiang et al., 1995; Strom et al., 1996). Instead, Sp3 represses Spl-mediated transcriptional activation by competing with S p l for their common binding site (Hagen et al., 1994; Birnbaum et al., 1995; Dennig et al., 1996) and is able to increase transcription in only a few cases (Udvadia et al., 1995; Dennig et al., 1996). The AP-2 factor, in turn, is activated by several signaling pathways, such as PKC and CAMP(Imagawa et al., 1987). However, the AP2 site at the position -62 to -53 may not be involved in mediating the reported effects of the PKC and CAMPpathways on hHSDl7B1 gene expression (Piao et al., 1997b). Further investigations are needed to clarify the mutual interactions of Spl, Sp3, and AP-2 and their possible role in controlling the tissue- and cell-specific transcription of the hHSDl7B1 gene, AND FUNCTION OF hHSDl7B1 ENHANCER B. STRUCTURE
The hHSD17B1 enhancer is located between the bases -661 and -392, with respect to the cap site of 1.3-kb 17HSD type 1mRNA (Piao et al., 1995). The enhancer remarkably increases transcription efficiency in both orientations, regardless of the promoter type or the distance between the promoter and the enhancer. Furthermore, the action of the enhancer is cell-type-dependent. In the choriocarcinoma cell lines JEG-3 and JAR, the action of the enhancer runs in parallel with endogenous 17HSD type 1enzyme expression. Hence, the enhancer may be essential for the expression of 17HSD type 1 enzyme in J A R and JEG-3 cells and, consequently, for abundant placental expression of the enzyme. In certain breast cancer cell lines, however, the functions of the enhancer and 17HSD type 1 enzyme expression do not correlate very well, which suggests that other regulatory elements of the hHSDl7B1 gene are functional in some breast cancer cell lines, and/or that dissimilar mechanism may take place in regulation of the hHSDl7B1 gene in choriocarcinoma and breast carcinoma cell lines. The function of the enhancer in the two cell types may thus also be related to the data showing that the expressions of 17HSDtype 1enzyme in these cells responds to EGF, CAMP,PMA, and Ca ionophore treatments differently (Piao et al., 1997a; see also Sections IV,B and V,A). The authenticity of the
ROLE OF 17HSDS IN ESTROGEN ACTION
383
hHSDl7B1 enchancer is further supported by results showing that the enhancer is not functional in three cell lines found not to express 17HSD type 1enzyme (Piao et al., 1995). The hHSD17Bl enhancer contains an element typical of the bindingsite of RAR-RXR heterodimers (Piao et al., 1995), which are activated by atRA and 9-cis-RA (GiguBre, 1994). The RARE is able to bind proteins specifically from an FtXRa-RARa extract, and administration of atRA increases the activity of the hHSDl7B1 enhancer linked to either the hHSD17Bl minimal promoter or the TK promoter in T47D and JEG-3 cells (Piao et al., 1995; Peltoketo et al., 1996). Moreover, the introduction of mutations to the RARE abolishes the response to RA completely, verifying direct regulation of the hHSDl7B1 gene by RAs (Piao et al., 1995). The RARE in the hHSD17B1 enhancer is hence a very probable target for the RA action reported to take place at least in JEG3 choriocarcinoma and T47D breast cancer cells (Reed et al., 1994; Piao et al, 1997a).
C. STRUCTURE AND FUNCTION OF hHSDl7BI SILENCER The hHSDl7B1 enhancer (-661/-392) linked adjacently to the minimal promoter (- 78/+ 9) leads to several-fold reporter gene expression compared to that measured with the intact fragment -659/+9. Furthermore, in connection with the SV40 enhancer, shortening of the hHSDl7B1 gene promoter from - 113 to -78 leads to a significant increase in reporter gene expression in all the cell lines tested (Piao et al., 1995), and deletion of the region - 113/-79 from the intact 5' fragment results in elevated reporter gene expression (Peltoketo et al., 1996). In combination, these results suggest that a silencer is located between the bases -392 and -78 and that an essential part of it is situated between - 113 and -78. Shortening of the proximal promoter from - 113 to -78 increases reporter gene transcription only when the promoter is linked to an enhancer (Piao et al., 1995). Hence, the silencer appears mainly to counteract the HSDl7B1 gene and SV40 enhancers, not the hHSDl7B1 basal promoter. The binding motif for GATA factors has been localized in the region between -103 and -98 (Piao et al., 1997b). The transcription factors GATA-2 and, in particular, GATA-3, have been demonstrated to bind their cognate sequence in JEG-3 cells. Mutation of the motif results in decreased binding of the GATA proteins and in transcriptional activity, which is enhanced to the level detected by constructs not containing the silencer element. This suggests that GATA-2 and GATA-3 can repress the function of the hHSD17Bl gene, at least in the constructs used, and
384
HELLEVI PELTOKETO et al.
cell-specific 2.3 kb mRNA
enhancer element
silencer minimal element promoter
FIG.6. Schematic representation of transcriptional regulation of the hHSDl7BI gene. The black box shows the location of the hHSD17Bl enhancer, and the rectangle in it demonstrates the position of the retinoic acid response element (RARE).The GATA binding site of the silencer and the AP-2 and Sp motifs are marked with ellipses. The black arrows represent the transcription start points for 1.3- and 2.3-kb 17HSD type 1mRNAs whereas the gray arrows show the influence of the enhancer element on transcription of 1.3-kbmRNAand the effects ofthe silencer on the enhancer and minimal promoter. Competitive binding between the AP-2 and Sp motifs is represented by double-headed arrow
(-1.
the motif may thus be an essential part of the hHSDl7B1 silencer (Piao et al., 1997b). GATA-2 and GATA-3 are expressed in placental tro-
phoblasts, and are required to direct the trophoblast-specific expression of the gonadotropin a subunit and placental lactogen I genes, for example (Ng et al., 1994; Steger et al., 1994). These transcription factors have also been suggested to play a crucial role in trophoblast cell differentiation (Ng et al., 1994). The presence of the GATA factors in placental trophoblasts and the results of electorophoretic mobility shift assays and reporter gene analyses (Piao et al., 1997b) suggest that GATA factors may be involved in limiting the function of the hHSDl7B1 gene in the placenta. Altogether, the findings point to complicated regulation of hHSD17Bl gene expression, which is a the collective outcome of a cell-specific enhancer containing several interacting subunits and an RARE (Piao et al., 19951, a silencer element with a GATAmotif, a proximal promoter region with competing Sp and AP-2 sites (Piao et al., 1997b),and possibly still unidentified regions. The mutual interactions between the factors binding to these elements, their concentrations as well as their activation-inactivation, ultimately control the tissue-specific expression of the hHSD17l31 gene (Fig. 6).
ROLE OF 17HSDS IN ESTROGEN ACTION
385
VIII. CONCLUSIONS Five 17HSD enzymes have been cloned in addition to the type 1enzyme identified in 1988.All 17HSDs are, at least to some extent, able to modulate the biological activity of estrogens, although 17HSD type 3, for example, is characteristically a key enzyme of T biosynthesis. The results reported have clarified the functions of 17HSD type 1 and type 2 enzymes, in particular, while the contribution of the others to estrogen action has not yet been unraveled. The type 1 enzyme has been shown to be the essential 17HSD enzyme for gonadal E2 biosynthesis and, in addition, an interesting feature of the type 1 enzyme is its intracrinological action in target tissues of estrogens. Evidence is accumlating to indicate that 17HSD type 1enzyme may significantly increase intracellular E2 concentration in certain tissues, such as breast, and consequently add to their exposure to E2. Several groups are presently clarifying the detailed three-dimensional structure of 17HSD type 1 enzyme, aiming at the development of specific inhibitors for the enzyme possibly to be used in the prevention and treatment of breast cancer. Verification of the existence of several distinct oxidative and reductive 17HSD enzymes has notably clarified the picture about estrogen and androgen metabolism, but has also raised new questions. What is the physiological role, if any, of each of the 17HSD enzymes in steroid hormone action? Is the 17HSD activity of some enzymes toward steroids an insignificant evolutionary remnant in addition to their other activities? Will more 17HSD enzymes be identified? How do distinct enzymes locating in the same or adjacent cells act together? Especially, if oxidative type 2 and reductive type 1enzymes coexist in breast epithelial cells, what kind of impact do their relative concentrations and efficacies have on estrogen action? Another interesting question is the role of 17HSD type 2 enzyme in placenta and the gastrointestinal and urinary tracts. Animals lacking the HSD27B2 gene might demonstrate the contribution of the type 2 enzyme to the protection of the fetus and mother from excessive estrogen and androgen influence, and to the neutralization of steroids and steroid-like compounds in the digestive tract. On the whole, several 17HSD enzymes apparently take part in E2 biosynthesis and inactivation in gonads and peripheral tissues. Various enzymes, which differ in enzymatic properties and whose expressions are under cell-, tissue-, and development-specificregulation, provide the means for targeted control of E2 concentration. Especially when several 17HSD enzymes coexist in same tissue or cell, they may enable an elaborate system for the regulation of the supply of an active hormone.
386
HELLEVI PELTOKETO et al.
ACKNOWLEDGMENTS We thank LateefAkinola (W.D.), Sergio Ghersevich, (Ph.D.), Veli Isomaa (Ph.D.), Minna Miettinen (M.Sc.1, Mika Mustonen (Ph.D.), Pasi Nokelainen (M.Sc), Yun-shang Piao (Ph.D.1, and Terhi Puranen (Ph.D.1 for their valuable contribution to the preparation of the manuscript. Special acknowledgment is due to Dr. Mika Mustonen for the in situ hybridization data. World Health Organization Collaborating Centre for Research on Reproductive Health is supported by the Ministries of Education, Social Affairs and Health, and Foreign Affairs, Finland. REFERENCES Adamski, J., Normand, T. Leenders, F., Monte, D., Begue, A., Stehelin, D., Jungblut, P. W., and delaunoit, Y.(1995). Molecular cloning of a novel widely expressed human 80 kDa 17P-hydroxysteroid dehydrogenase N. Biochem. J. 311,437-443. Adashi, E. Y. (1991). The ovarian life cycle. In “Reproductive Endocrinology” (S. S. C. Yen and R. B. Jaffe, eds.), Vol. 4, pp. 181-237. Saunders, Philadelphia. Adashi, E. Y.and Resnick, C. E. (1986). Antagonistic interactions of transformic growth factors in the regulation of granulosa cell differentiation. Endocrinology (Baltimore) 119,1879-1881. Adashi, E. Y., Resnick, C. E., and Twardzik, D. R. (1987). Transforming growth factor-a attenuates the acquisition of aromatase activity by cultured rat granulosa cells. J. Cell. Biochem. 33, 1-13. Adashi, E. Y.., Resnick, C. E., Croft, C. S., May, J. V., and Gospodarowicz, D. (1988). Basic fibroblast growth factor as a regulator of ovarian granulosa cell differentiation: A novel non-mitogenic role. Mol. Cell. Endocrinol. 55,7-14. Adashi, E. Y., Resnick, C. E., Hernandez, E. R., May, J. V, Purchio, A. F., and ’hardzik, D. R. (1989). Ovarian transforming growth factor-p (TGFP): Cellular site(s), and mechanism(s) of action. Mol. Cell. Endocrinol. 61,247-256. Akinola, L. A., Poutanen, M., and Vihko, R. (1996). Cloning of rat 17P-hydroxysteroid dehydrogenase type 2 and characterization of tissue distribution and catalytic activity of rat type 1and type 2 enzymes. Endocrinology (Baltimore) 137, 1572-1579. Akinola, L. A., Poutanen, M., Vihko, R., and Vihko, P. (1997a). Expression of 17p-hydroxysteroid dehydrogenase type 1 and type 2, P450 aromatase and 2Oa-hydroxysteroid dehydrogenase enzymes in immature, mature and pregnant rats. Endocrinology (Baltimore) 138,2886-2892. Akinola, L. A., Poutanen, M., Peltoketo, H., Vihko, R., and Vihko, P. (199713). Characterization of rat 17P-hydroxysteroid dehydrogenase type 1gene and mRNA transcripts. Gene 208,229-238. Amemiya, K., Kurachi, H., Adachi, H., Morishige, K. I., Adachi, IC,Imai, Y., and Miyake, A., (1994). Involvement of epidermal growth factor (EGFYEGF receptor autocrine and paracrine mechanism in human trophoblast cells: Functional differentiation in vitro. J. Endocrinol. 143,291-301. Anderson, J. W. (1959). The placental barrier to gamma-globulins in the rat.Am. J. Anat. 104,403-430. Andersson, S., and Moghrabi, N. (1997). Physiology and molecular genetics of 17p-hydroxysteroid dehydrogenases. Steroids 62, 143-147. Andersson, S., Geissler, W. M., Wu, L., Davis, D. L., Grumbach, M. M., New, M. I., Schwarz, H. P., Blethen, S. L., Mendonca, B. B., Bloise, W., Witchel, S. F., Cutler, G. B., Jr. Griffin, J . E., Wilson, J. D., and Russell, D. W. (1996). Molecular genetics and pathophysiology of 17P-hydroxysteroid dehydrogenase 3 deficiency. J. Clin. Endocrinol. Metab. 81, 130-136.
ROLE OF 17HSDS IN ESTROGEN ACTION
387
Azzi, A., Rehse, P. H., Zhu, D.-W., Campbell, R. L., Labrie, F., and Lin, S.-X. (1996). Crystal structure of human estrogenic 17p-hydroxysteroid dehydrogenase complexed with l7p-estradiol. Nut. Struct. Biol. 3,665-668. Bahn, R. S., Worsham, A., Speeg, K. V., Jr., Ascoli, M., and Rabin, D. (1981). Characterization of steroid production in cultured human choriocarcinoma cells. J. Ctin. Endocrinol. Metab. 52,447-450. Bai, W., and Weigel, N. L. (1995). Phosphorylation and steroid hormone action. Vitam. Horm. (N..E=)51,289-313. Baker, M. E. (1994). Sequence analysis of steroid- and prostaglandin-metabolizing enzymes: Application to understanding catalysis. Steroids 59,248-258. Barbieri, R. L., Gao, X., and Frost, R. A. (1994). Phosphorylation of 17s-hydroxysteroid dehydrogenase in BeWo choriocarcinoma cells. Am. J. Obstet. Gynecol. 171,223-230. Beaudoin, C., Blomquist, C. H., and Tremblay, Y.(1995). Gene expression of 17s-hydroxysteroid dehydrogenase type 2 isozyme in primary cultures of human trophoblasts predicts different mechanisms regulating type 1and type 2 enzymes. Endocrinology (Baltimore) 136,3807-3814. Bendell, J. J., and Dorrington, J. H. (1990). Epidermal growth factor influences growth and differentiation of rat granulosa cells. Endocrinology (Baltimore) 127, 533-540. Bergerheim, U. S., Kunimi, K., Collins, V. P., and Ekman, P. (1991). Deletion mapping of chromosomes 8, 10, and 16 in human prostatic carcinoma. Genes, Chromosomes, Cancer 3,215-220. Bergh, C., Olsson, J. H., Selleskog, U., and Hillensjo, T. (1993). Steroid production in cultured thecal cells obtained from human ovarian follicles. Hxm. Reprod. 8,519-524. Birnbaum, M. J.,van Wijnen, A. J., Odgren, P. R., Last, T. J., Suske, G., Stein, G. S., and Stein, J. L. (1995). S p l trans-activation of cell cycle promoters is selectively repressed by Sp3. Biochemistry 34,16503-16508. Biswas, M. G., and Russell, D. W. (1997). Expression cloning and characterization of oxidative 17p- and 3ru-hydroxysteroiddehydrogenases from rat and human prostate. J . Biol. Chem. 272,15959-15966. Blomquist, C. H. (1995). Kinetic analysis of enzymic activities: Prediction of multiple forms of 176-hydroxysteroid dehydrogenase. J. Steroid. Biochem. Mol. Biol. 55, 515-524. Blomquist, C. H., and DAscoli, T. D. (1995). Gestational development of human placental 17s-hydroxysteroid oxidoreductase types 1and 2. Hum. Reprod. 10,2685-2689. Blomquist, C. H., Hensleigh, H. C., Block, D. L., and Feeney, L. A. (1993). Placental 17phydroxysteroid oxidoreductase, lactate dehydrogenase and malate dehydrogenase during the latter half of pregnancy in the mouse. J. Steroid Biochem. Mol. Biol. 46, 61-67. Bonney, R. C., Reed, M. J., Davidson, K., Beranek, P. A,, and James, V. H. T. (1983). The relationship between 17p-hydroxysteroid dehydrogenase activity and oestrogen concentrations in human breast tumours and in normal tissue. Clin. Endocrinol. 19, 727-739. Bonney, R. C., Reed, M. J., Beranek, P. A., Ghilchik, M. W., and James, V. H. T. (1986). Metabolism of [3H]-oestradiol in uiuo by normal breast and tumour tissue in postmenopausal women. J. Steroid Biochem. 24,361-364. Breton, R., Housset, D., Mazza, C., and Fontecilla-Camps, J. C . (1996). The structure of a complex of human 17p-hydroxysteroid dehydrogenase with estradiol and NADP+ identifies two principal targets for the design of inhibitors. Structure 15, 905-915. Bulun, S. E., Price, T. M., Aitken, J., Mahendroos, M. S., and Simpson, E. R. (1993LAlink between breast cancer and local estrogen biosynthesis suggested by quantification of
388
HELLEVI PELTOKETO et al.
breast adipose tissue aromatase cytochrome P450 transcripts using competetive polymerase chain reaction after reverse transcription. J. Clin. Endocrinol. Metab. 77, 1622-1628. Burns, D. J. W., Engel, L. L., and Bethune, J. L. (1972). Amino acid composition and subunit structure. Human placental 17P-estradiol dehydrogenase. Biochemistry 11, 2699-2703. Butcher, R. L., Collins, W. E., and Fugo, N. W. (1974). Plasma concentration of LH, FSH, prolactin, progesterone and estradiol-17P throughout the 4-day estrous cycle of the rat. Endocrinology (Baltimore) 94, 1704-1708. Carter, B., Ewing, C., Ward, S., Treiger, B., Aalders, T., Schalken, J., Epstein, J., and Isaacs, W. (1990). Allelic loss of chromosome 16q and 1Oq in human prostate cancer. Proc. Natl. Acad. Sci. USA 87,8751-8755. Casey, M. L., MacDonald, P. C., and Andersson, S. (1994). 17P-hydroxysteroid dehydrogenase type 2: Chromosomal assignment and progestin regulation of gene expression in human endometrium. J. Clin. Invest. 94,2135-2141. Cattini, P. A., Nickel, B., Bock, M., and Kardami, E. (1991). Immunolocalization of basic fibroblast growth factor (bFGF) in growing and growth-inhibited placental cells: A possible role for bFGF in placental cell development. Placenta 12,341-352. Chen, Z., Jiang, J. C., Lin, Z.-G., Lee, W. R., Baker, M. D., and Chang, S. H. (1993). Sitespecific mutagenesis of Drosophila alcohol dehydrogenase: Evidence for involvement of tyrosine-152 and lysine-156 in catalysis. Biochemistry 32,3342-3346. Cols, N., Marfany, G., Atrian, S., and Gonzalez-Duarte, R. (1993). Effect of site-directed mutagenesis on conserved positions of Drosophila alcohol dehydrogenase. FEBS Lett. 319,90-94. Conley, A. J., Christenson, L. K., Ford, S. P., and Christenson, R. K. (1994). Immunocytochemical localization of cytochromes P450 17whydroxylase and aromatase in embryonic cell layers of elongating porcine blastocysts. Endocrinology (Baltimore) 135, 2248-2254. Corton, J. C., Bocos, C., Moreno, E. S., Merritt, A., Marsman, D. S., Sausen, P. J., Cattley, R. C., and Gustafsson, J.-A. (1996). Rat 17s-hydroxysteroid dehydrogenase type IV is a novel peroxisome proliferator-inducible gene. Mol. Pharmacol. 50,1157-1166. Cullen, K. J.,and Lippman, M. E. (1989). Estrogen regulation of protein sythesis and cell growth in human breast cancer. Vitam. Horm. (N.U 45, 127-158. de Launoit, Y., Simard, J., Durocher, F., and Labrie, F. (1992). Androgenic 17s-hydroxysteroid dehydrogenase activity of expressed rat type 13p-hydroxysteroid dehydrogenaselA5-A4 isomerase. Endocrinology (Baltimore) 130,553-555. Delos, S., Carsol, J. L., Chazarossian, E., Raynaud, J. P., and Martin, P. M. (1995). Testosterone metabolism in primary cultures of human prostate epithelial cells and fibroblasts. J. Steroid Biochern. Mol. Biol. 55,375-383. Dennig, J., Beato, M., and Suske, G. (1996).An inhibitor domain in Sp3 regulates its glutamine-rich activation domains. EMBO J. 15, 5659-5667. Deyashiki, Y., Ohshima, K., Nakanishi, M., Sato, K., Matsuura, K., and Hara, A. (1995). Molecular cloning and characterization of mouse estradiol 17P-dehydrogenase (Aspecific), a member of the aldoketoreductase family. J. Biol. Chem. 270, 10461-10467. Dieuaide-Noubhani, M., Novikov, D., Baumgart, E., Vanhooren, J. C. T., Fransen, M., Goethals, M., Vandekerckhove, J., VanVeldhoven, P. P., and Mannaerts, G. P. (1996). Further characterization of the peroxisomal 3-hydroxyacyl-CoA dehydrogenases from rat liver. Relationship between the different dehydrogenases and evidence that fatty acids and the C27 bile acids di- and tri-hydroxycoprostanic acids are metabolized by separate multifunctional proteins. Eur. J. Biochem. 240,660-666.
ROLE OF 17HSDS IN ESTROGEN ACTION
389
Dorrington, J. H., Bendell, J. J.,and Khan, S. A. (1993). Interactions between FSH, estradiol-17P and transforming growth factor+ regulate growth and differentiation in the rat gonad. J. Steroid Biochem. Mol. Biol. 44,441-447. Dupont, E., Labrie, F., Luu-The, V., and Pelletier, G. (1991). Localization of 17P-hydroxysteroid dehydrogenase throughout gestation in human placenta. J. Histochem. Cytochem. 39,1403-1407. Durocher, F., Morissette, J., Labrie, Y.,Labrie, F., and Simard, J. (1995). Mapping of the HSD17B2 gene encoding type I1 17P-hydroxysteroid dehydrogenase close to D16S422 on chromosome 16q241-q242. Genomics 25,724-726. Elo, J. P., Akinola, L. A,, Poutanen, M., Vihko, P., Kyllonen, A. P., Lukkarinen, O., and Vihko, R. (1996). Characterization of 17P-hydroxysteroid dehydrogenase isoenzyme expression in benign and malignant human prostate. Znt. J. Cancer 66,37-41. Elo, J. P., Harkonen, P., Kyllonen, A. P., Lukkarinen, O., Poutanen, M., Vihko, R., and Vihko, P. (1997). Loss of heterozygosity at 16q24.1-q24.2 is significantly associated with metastatic and aggressive behavior of prostate cancer. Cancer Res. 57, 3356-3359. Ensor, C . M., and Tai,H.-H. (1991). Site-directed mutagenesis of the conserved tyrosine 151of human placental NAD+-dependent 15-hydroxyprostaglandin dehydrogenase yields a catalytically inactive enzyme. Biochem. Biophys. Res. Commun. 176,840-845. Ensor, C. M., and Tai, H.-H. (1994). Bacterial expression and site-directed mutagenesis of two critical residues (tyrosine-151 and lysine-155) of human placental NAD+-dependent 15-hydroxyprostaglandin dehydrogenase. Biochim. Biophys. Acta 1208, 151-156. Fishman, J., Nisselbaum, J. S., Menendez-Botet, C. J., and Schwartz, M. K. (1977). Estrone and estradiol content in human breast tumors. Relationship to estradid receptors. J . Steroid Biochem. 8, 893-896. Fleming, H., Namit, C., and Gurpide, E. (1980). Estrogen receptors in epithelial and stroma1 cells of human endometrium in culture. J. Steroid Biochem. 12, 169-174. Fortune, J. E. (1994). Ovarian follicular growth and development in mammals. Biol. Reprod. 50,225-232. Fournet-Dulguerov, N., MacLusky, N. J.,Leranth, C. A., Todd, R., Mendelson, C . R., Simpson, E. R., and Naftolin, F. (1987). Immunohistochemical localization of aromatase cytochrome P-450 and estradiol dehydrogenase in the syncytiotrophoblast of human placenta. J. Clin. Endocrinol. Metab. 65, 757-764. Fournier, S., Kuttenn, F., DeCicco, F., Baudot, N., Malet, C., and Mauvais-Jarvis, P., (1982). Estradiol 17P-hydroxysteroid dehydrogenase activity in human breast fibroadenomas. J. Clin. Endocrinol. Metub. 55, 428-433. Freeman, M. E. (1994). The neuroendocrine control of the ovarian cycle of the rat. In “The Physiology of Reproduction” (E. Knobil and J. D. Neill, eds.), 2nd ed., pp. 613-658. Raven Press, New York. Geissler, W. M., Davis, D. L. Wu, L., Bradshaw, K. D., Patel, S., Mendonca, B. B., Elliston, K. O., Wilson, J. D., Russel, D. W., and Andersson, S. (1994). Male pseudohermaphroditism caused by mutations of testicular 17P-hydroxysteroid dehydrogenase 3. Nut. Genet. 7,34-39. George, F.W., and Wilson, J. D. (1978). Estrogen formation in the early rabbit embryo. Science 199,200-201. Ghersevich, S., Nokelainen, P., Poutanen, M., Orava, M., Autio-Harmainen, H., Rajaniemi, H., and Vihko, R. (1994a). Rat 17P-hydroxysteroid dehydrogenase type 1: Primary structure and regulation of enzyme expression in rat ovary by diethylstilbestrol and gonadotropins in viva. Endrocinology (Baltimore) 135, 1477-1487. Ghersevich, S., Poutanen, M., Rajaniemi, H., and Vihko, R. (1994b). Expression of 17p-
390
HELLEVI PELTOKETO et al.
hydroxysteroid dehydrogenase in the rat ovary during follicular development and luteinization induced with pregnant mare serum gonadotrophin and human chorionic gonadotrophin. J. Endocrinol. 140,409-417. Ghersevich, S.,Poutanen, M., Tapanainen, J., and Vihko, R. (199419. Hormonal regulation of rat 17p-hydroxysteroid dehydrogenase type 1in cultured rat granulosa cells: Effects of recombinant follicle-stimulating hormone, estrogens, androgens, and epidermal growth factor. Endocrinology (Baltimore) 135, 1963-1971. Ghersevich, S., Poutanen, M., Martikainen, H., and Vihko, R. (1994d). Expression of 17phydroxysteroid dehydrogenase in human granulosa cells: Correlation with follicular size, cytochrome P-450 aromatase activity and estradiol production. J. Endocrinol. 143,139-150. Ghosh, D., Weeks, C. M., Grochulski, P., Duax, W. L., Erman, M., Rimsay, R. L., and Orr, J. C. (1991). Three-dimensional structure of holo 3a,20p-hydroxysteroid dehydrogenase: A member of a short-chain dehydrogenase family. Proc. Natl. Acad. Sci. U S A 88,10064-10068. Ghosh, D., Wawrzak, Z., Weeks, C. M., Duax, W. L., and Erman, M. (1994). The refined three-dimensional structure of 3aq20P-hydroxysteroid dehydrogenase and possible roles of the residues conserved in short-chain dehydrogenases. Structure 2,629-640. Ghosh, D., Pletnev, V., Zhu, D.-W., Wawrzak, Z., Duax, W. L., Pangborn, W., Labrie, F., and Lin, S.-X. (1995). Structure of human estrogenic 17p-hydroxysteroid dehydrogenase a t 2.20 A resolution. Structure 3,503-513. Gibori, G., Khan, I., Warshaw, M. L., McLean, M. P., Puryear, T. K., Nelson, S., Durkee, T. J., Azhar, S., Steinschneider, A., and Rao, M. C. (1988). Placental-derived regulators and the complex control of luteal function. Recent Prog. Horm. Res. 44,377-429. GiguBre, V. (1994). Retinoic acid receptors and cellular retinoid binding proteins: Complex interplay in retinoid signaling. Endocr. Rev. 15,61-79. Hagen, G., Muller, S., Beato, M., and Suske, G (1992). Cloning by recognition site screening of two novel GT box binding proteins: Afamily of S p l related genes. Nucleic Acids Res. 20,5519-5525. Hagen, G., Muller, S., Beato, M., and Suske, G. (1994). Spl-mediated transcriptional activation is repressed by Sp3. EMBO J. 13,3843-3851. He, H., Herington, A. C., and Roupas, P. (1995). Effect of protein kinase C modulation on gonadotrophin-induced granulosa cell steroidogenesis. Reprod. Fertil. Dev. 7,83-95. Hickey, G. J., Chen, S., Besman, M. J., Shively, J. E., Hall, P. F., Gaddy-Kurten, D., and Richards, J. S. (1988). Hormonal regulation, tissue distribution, and content of aromatase cytochrome P-450 messenger ribonucleic acid and enzyme in rat ovarian follicles and corpora lutea: Relationship to estradiol biosynthesis. Endocrinology (Baltimore) 122,1426-1436. Hillier, S. G., Young, E. L., Illingworth, P. J.. Baird, D. T., Schwall, R. H., and Mason, A. J. (1991). Effect of recombinant activin on androgen synthesis in cultured human theca cells. J. Clin. Endocrinol. Metab. 72, 1206-1211. Hillier, S. G., Whitelaw, P. F., and Smyth, C. D. (1994). Follicular oestrogen synthesis: "Two-cell, two-gonadotropin" model revisited. Mol. Cell. Endocrinol. 100,51-54. Hsueh, A. J . W., Welsh, T. H., and Jones, P. B. C. (1981). Inhibition of ovarian and testicular steroidogenesis by epidermal growth factor. Endocrinology (Baltimore) 108, 2002-2004. Imagawa, M.,Chiu, R., and Karin, M. (1987). Transcription factor AP-2 mediates induction by two different signal-transduction pathway: Protein kinase C and CAMP.Cell (Cambridge, Mass.) 51,251-260. Jackson, J. A., and Albrecht, E. D. (1985). The development of placental androstenedione
ROLE OF 17HSDS IN ESTROGEN ACTION
391
and testosterone production and their utilization by the ovary for aromatization to estrogen during rat pregnancy. Biol. Reprod. 33,451-457. Jantus Lewintre, E., Orava, M., and Vihko, R. (1994a). Regulation of 17p-hydrosysteroid dehydrogenase type 1by epidermal growth factor and transforming growth factor alpha in choriocarcinoma cells. Endocrinology (Baltimore) 135,2629-2634. Jantus Lewintre, E., Orava, M., Peltoketo, H., andVihko, R. (1994b). Characterization of 17p-hydroxysteroid dehydrogenase type 1 in choriocarcinoma cells: Regulation by basic fibroblast growth factor. Mol. Cell. Endocrinol. 104, 1-9. Jiang, S.-W., Shepard,A. R., and Eberhardt, N. L. (1995).An initiator element is required for maximal human chorionic somatomammotropin gene promoter and enhancer function. J. Biol. Chem. 270,3683-3692. Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J., and Ghosh, D. (1995). Short-chain dehydrogenaseheductases (SDR). Biochemistry 34, 6003-6013. Kaminski, T., Akinola, L., Poutanen, M., Vihko, R., and Vihko, P. (1997). Growth factors modulate the follicle-stimulating hormone- and and phorbol-12-myristate-13-acetate cyclic adenosine-3',5'-monophosphate dependent regulation of 17P-hydroxysteroid dehydrogenase type 1expression in rat granulosa cells. Mol. Cell. Endocrinol. 136, 47-56. Karavolas, H. J., and Engel, L. L. (1971). Human placental 17s-estradiol dehydrogenase. VI. Substrate specificity of the diphosphopyridine nucleotide (triphosphopyridine nuc1eotide)-linked enzyme. Endocrinology fBaZtimorei 88, 1165- 1169. Kato, Y., and Braunstein, G. D. (1991). Retinoic acid stimulates placental hormone secretion by choriocarcinoma cell lines in vitro. Endocrinology (Baltimore) 128, 401-407. Kohler, P. O., Bridson, W. E., Hammond, J. M., Weintraub, B., Kirsehner, M.A., and Van Thiel, D. H. (1971). Clonal lines of human choriocarcinoma cells in culture. Acta Endocrinol. (Copenhagen), Suppl. 153,137-153. Krozowski, Z. (1992). llp-Hydroxysteroid dehydrogenase and the short-chain alcohol dehydrogenase (SCAD) superfamily. Mol. Cell. Endocrinol. 84, C25-C31. Krozowski, Z. (1994). The short-chain alcohol dehydrogenase superfamily: Variations on a common theme. J . Steroid Biochem. Mol. Biol. 51, 125-130. Labrie, F. (1991). At the cutting edge: Intracrinology. Mol. Cell. Endocrinol. 78, C113-Cl18. Labrie, L., Luu-The, V.,Lin, S.-X., Labrie, C., Simard, J., Breton, R., and Labrie, F. (1997). The key role of 17p-hydroxysteroid dehydrogenases in sex steroid biology. Steroids 62,148-158. Labrie, Y., Durocher, F., Lachance, Y., Turgeon, C., Simard, J., Labrie, C., and Labrie, F. (1995). The human type I1 17P-hydroxysteroid dehydrogenase gene encodes two alternatively spliced mRNA species. DNA Cell Biol. 14, 849-861. Lecointe, N., Bernard, O., Naert, K., Joulin, V., Larsen, C. J., Romeo, P. H., and MathieuMahul, D. (1994). GATA- and Spl-binding sites are required for the full activity of the tissue-specific promoter of the tal-1 gene. Oncogene 9,2623-2632. Leenders, F., Adamski, J., Husen, B., Thole, H. H., and Jungblut, P. W. (1994). Molecular cloning and amino acid sequence of the porcine 17P-estradiol dehydrogenase. Eul: J. Biochem. 222,221-227. Leenders, F., Tesdorpf, J. G., Markus, M., Engel, T., Seedorf, U., andAdamski, J. (1996). Porcine 80-kDa protein reveals intrinsic 17P-hydroxysteroid dehydrogenase, fatty acyl-CoA-hydratase/dehydrogenase,and sterol transfer activities. J . Biol. Chem. 271,5438-5442.
392
HELLEVI PELTOKETO et al.
Li, Y., Mak, G., and Franza, B. R. (1994). Zn vitro study of functional involvement of Spl, NF-KB/Rel, and AP1 in phorbol12-myristate 13-acetate mediated HIV-1 long terminal repeat activation. J. Biol. Chem. 269,30616-30619. Lin, S.-X., Yang, F., Jin, J.-Z., Breton, R., Zhu, D.-W., Luu-The, V., and Labrie, F. (1992). Subunit identity of the dimeric 17p-hydroxysteroid dehydrogenase from human placenta. J. Biol. Chem. 267,16182-16187. Luu-The, V., Labrie, C., Zhao, H. F., Couet, J., Lachance, Y., Simard, J., Leblanc, G., CBte, J., BBrub6, D., Gagn6, R., and Labrie, F. (1989). Characterization of cDNAs for human estradiol17P-dehydrogenaseand assignment of the gene to chromosome 17: Evidence of two mRNA species with distinct 5’4ermini in human placenta. Mol. Endocrinol. 3, 1301-1309. Luu-The, V., Labrie, C., Simard, J., Lachance, Y., Zhao, H.-F.,Couet, J.,Leblanc, G., and Labrie, F. (1990). Structure of two in tandem human 17P-hydroxysteroid dehydrogenase genes. Mol. Endocrinol. 4,268- 275. Lysiak, J. J., Han, V. K., M., and Lala, P. K. (1993). Localization of tranforming growth factor a in the human placenta and decidua: Role in trophoblast growth. Biol. Reprod. 49, 885-894. Maentausta, O., Sormunen, R., Isomaa, V., Lehto, V . 2 , Jouppila, P., and Vihko, R. (1991). Immunohistochemical localization of 17P-hydroxysteroid dehydrogenase in the human endometrium during the menstrual cycle. Lab. Znuest. 66,582-587. Maentausta, O., Boman, K., Isomaa,V., Stendahl, U., Backstrom, T., andVihko, R. (1992). Immunohistochemical study of the human 17P-hydroxysteroid dehydrogenase and steroid receptors in endometrial adenocarcinoma. Cancer (Philadelphia) 70, 1551-1555. Mann, V. Z., Newton, C. J., and Tait, G.H. (1991). 17P-Hydroxysteroid dehydrogenases in human breast tissues: Purification and characterization of soluble enzymes and the distribution of particulate and soluble forms in adipose, non-adipose and tumour tissues. J. Mol. Endocrinol. 7,45-55. Mannermaa, A., Peltoketo, H., Winqvist, R., Ponder, B. A. J., Kiviniemi, H., Easton, D. F., Poutanen, M., Isomaa, V., and Vihko, R. (1994). Human familial and sporadic breast cancer: Analysis of the coding regions of the 17~-hydroxysteroiddehydrogenase 2 gene (EDH17B2) using a single-strand conformation polymorphism assay. Hum. Genet. 93,319-324. Martel, C., Rheaume, E., Takahashi, M., Trudel, C., Couet, J., Luu-The, V., Simard, J., and Labrie, F. (1992). Distribution of 17p-hydroxysteroid dehydrogenase gene expression and activity in rat and human tissues. J. Steroid Biochem. Mol. Biol. 41, 597-603. Maruo, T., Matsuo, H., Oishi, T., Hayashi, M., Nishino, R., and Mochizuki, M. (1987). Induction of differentiated trophoblast function by epidermal growth factor: Relation of immunohistochemically detected cellular epidermal growth factor recptor levels. J. Clin. Endocrinol. Metab. 64, 744-750. Matsuo, H., and Strauss, J. F.; I11 (1994). Peroxisome proliferators and retinoids affect JEG-3 choriocarcinoma cell function. Endocrinology (Baltimore) 135, 1135-1145. Matt, D. W., and MacDonald, G. J. (1984). In vitro progesterone and testosterone production by the rat placenta during pregnacy. Endocrinology (Baltimore) 114, 741-747. McNatty, K. P., Makris, A., DeGrazia, C., Osathanondh, R., and Ryan, K. (1979). The production of progesterone, androgens, and estrogens by granulosa cells, thecal tissue, and stromal tissue from human ovaries in vitro. J. Clin. Endocrinol. Metab. 49, 687-699. McNeill, J. M., Reed, M. J., Beranek, P. A,, Bonney, R. C., Ghilchik, M. W., Robinson,
ROLE OF 17HSDS IN ESTROGEN ACTION
393
D. J., and James, V. H. T.(1986).Acomparison of the in vivo uptake and metabolism of L3H1 oestrone and L3H1 oestradiol by normal breast and breast tumour tissues in postmenopausal women. Int. J. Cancer 15,193-196. Miettinen, M. M., Mustonen, M. V. J., Poutanen, M. H., Isomaa, V. V., and Vihko, R. K. (1996a). Human 17p-hydroxysteroid dehydrogenase type 1 and type 2 isoenzymes have opposite activites in cultured cells and characteristic cell- and tissue-specific expression. Biochem. J. 314,839-845. Miettinen, M. M., Poutanen, M. H., and Vihko, R. K. (1996b). Characterization of estrogen-dependent growth of cultured MCF-7 human breast cancer cells expressing 17Phydroxysteroid dehydrogenase type 1.Int. J. Cancer 68,600-604. Miller, W. R., Hawkins, R. A., and Forrest, A. P. M. (1982). Significance of aromatase activity in human breast cancer. Cancer Res. 42,3365-3368. Morrish, D. W., Bhardwaj, D., Dabbagh, L. K., Marusyk, H., and Siy, 0. (1987). Epidermal growth factor induces differentation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta. J. Clin. Endocrinol. Metab. 65, 1282-1290. Mustonen, M. V. J., Poutanen, M. H., Isomaa, V. V., Vihko, P. T., and Vihko, R. K. (1997a). Cloning of mouse 17P-hydroxysteroid dehydrogenase type 2, and analyzing expression of the mRNAs for types 1, 2, 3, 4 and 5 in mouse embryos and adult tissues. Biochem. J. 326,199-205. Mustonen, M., Poutanen, M., Chotteau-Lelievre, A., de Launoit,Y., Isomaa, V., Vainio, S., Vihko, R., and Vihko, P. (199715). Ontogeny of 17p-hydroxysteroid dehydrogenase type 2 mRNA expression in the developing mouse placenta and fetus. Mol. Cell. Endocrinol. 134,33-40. Mustonen, M. V. J.,Poutanen, M. H., Kellokumpu, S.,de Launoit, Y., Isomaa, V. V., Vihko, R. K., and Vihko, P. T. (1998). Mouse 17P-hydroxysteroid dehydrogenase type 2 mRNA is predominantly expressed in hepatocytes and in surface epithelial cells of the gastrointestinal and urinary tracts. J. Mol. Endocrinol. 20,67-74. Ng, Y.-K., George, K. M., Engel, J. D., and Linzer, D. I. H. (1994). GATAfactor activity is required for the trophoblast-specific transcriptional regulation of the mouse placental lactogen I gene. Development (Cambridge, UK) 120,3257-3266. Nicolas, J. C., and Harris, J. I. (1973). Human placental 17p-oestradiol dehydrogenase. Sequence of a tryptic peptide containing an essential cysteine. FEBS Lett. 29, 173-176. Nokelainen, P., Puranen, T., Peltoketo, H., Orava, M., Vihko, P., andVihko, R. (1996). Molecular cloning of mouse 17s-hydroxysteroid dehydrogenanse type 1and characterization of enzyme activity. Eur J. Biochem. 236,482-490. Normand, T., Narod, S., Labrie, F., and Simard, J. (1993). Detection of polymorphisms in the estradiol 17P-hydroxysteroid dehydrogenase I1 gene at the EDH17B2 locus on 17qll-q21. Hum. Mol. Genet. 2,479-483. Normand, T., Husen, B., Leenders, F., Pelczar, H., Baert, J.-L., Begue, A., Flourens, A.-C., Adamski, J., and de Launoit, Y. (1995). Molecular characterization of mouse 17p-hydroxysteroid dehydrogenase Iv.J. Steroid Biochem. Mol. Biol. 55,541-548. Obeid, J., and White, P. C . (1992). Tyr-179 and Lys-183 are essential for enzymatic activity of UP-hydroxysteroid dehydrogenase. Biochem. Biophys. Res. Commun. 188, 222-227. Overes, H. W. T., de Leeuw, R., and Kloosterboer, H. J. (1992). Regulation of aromatase activity in FSH-primed rat granulosa cells in vitro by follicle-stimulating hormone and various amounts of human chorionic gonadotrophin. Hum. Reprod. 7 , 191196. Pacchioni, D., Papotti, M., Andorno, E., Bonino, F., Mondardini, A., Oliveri, F., Brunetto,
394
HELLEVI PELTOKETO et al.
M., Bussolati, G., and Negro, F.(1993). Expression of estrogen receptor mRNAin tumorous and non-tumorous liver tissue as detected by in situ hybridization. J. Surg. Oncol, Suppl. 3, 14-17. Parker, M. G. (1995). Structure and functions of steroid receptors. Vitam. Horm. (N.E) 51,267-287. Peltoketo, H., Isomaa, V., Maentausta, O., and Vihko, R. (1988). Complete amino acid sequence of human placental 17p-hydroxysteroid dehydrogenase deduced from cDNA. FEBS Lett. 239, 73-77. Peltoketo, H., Isomaa, V., andVihko, R. (1992). Genomic organization and DNAsequences of human 17p-hydroxysteroid dehydrogenase genes and flanking regions: Localization of multiple Alu sequences and putative cis-acting elements. E u r J. Biochem. 209,459-466. Peltoketo, H., Piao, Y.-S., Mannermaa, A., Ponder, B. A., Isomaa, V., Poutanen, M., Winqvist, R., and Vihko, R. (1994). A point mutation in the putative TATA-box, detected in non-diseased individuals and patients with hereditary breast cancer, decreases promoter activity of the 17p-hydroxysteroid dehydrogenase type 1 gene 2 (EDH17B2) in uitro. G'enomics 23,250-252. Peltoketo, H., Isomaa, V., Poutanen, M., and Vihko, R. (1996). Expression and regulation of 17p-hydroxysteroid dehydrogenase type 1. J. Endocrinol. 150, S21-S30. Penning, T.M. (1996). 17p-Hydroxysteroid dehydrogenase: Inhibitors and inhibitor design. Endom-Relat. Cancer 3,41-56. Pepe, G. J., and Albrecht, E. D. (1995). Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev. 16, 608-658. Persson, B., Krook, M., and Jornvall, H. (1991). Characteristics of short-chain alcohol dehydrogenases and related enzymes. E u r J. Biochem. 200,537-543. Piao, Y., Peltoketo, H., Oikarinen, J., and Vihko, R. (1995). Coordination of transcription of the human 17p-hydroxysteroid dehydrogenase type 1gene (EDH17B2) by a cellspecific enhancer and a silencer: Identification of a retinoic acid response element. Mol. Endocrinol. 9, 1633-1644. Piao, Y.-S., Peltoketo, H., Jouppila, A., and Vihko, R. (1997a). Retinoic acids increase 17phydroxysteroid dehydrogenase type 1expression in JEG-3 and T-47D cells, but the stimulation is potentiated by epidermal growth factor, 12-0-tetradecanoylphorbol13-acetate, and cyclic adenosine 3', 5' monophosphate only in JEG-3 cells. Endocrinology (Baltimore) 138, 898-904. Piao, Y.-S., Peltoketo, H., Vihko, P., and Vihko, R. (1997b). The proximal promoter region of the gene encoding human 17p-hydroxysteroid dehydrogenase type 1 contains GATA, AP-2 and Spl response elements: Analysis of promoter function in choriocarcinoma cells. Endocrinology (Baltimore) 138, 3417-3425. Pittaway, D. E., Andersen, R. N., and Givens, J. R. (1977). Characterization of human ovarian oestradiol-17 beta oxidoreductase activity. Acta Endocrinol. (Copenhagen) 85,624-635. Pollow, K., Boquoi, E., Baumann, J., Schmidt-Gollwitzer, M., and Pollow, B. (1977). Comparison of the in vitro conversion of estradiol-17 beta to estrone on normal and neoplastic human breast tissue. Mol. Cell. Endocrinol. 6, 333-348. Poutanen, M., Moncharmont, B., and Vihko, R. (1992a). 17p-Hydroxysteroid dehydrogenase gene expression in human breast cancer cells, regulation of expression by a progestin. Cancer Res. 52, 290-294. Poutanen, M., Isomaa, V., Lehto, V.-F!, and Vihko, R. (199213). Immunological analysis of 17p-hydroxysteroid dehydrogenase in benign and malignant human breast tissue. Znt. J . Cancer 50,386-390.
ROLE OF l7HSDS IN ESTROGEN ACTION
395
Poutanen, M., Miettinen, M., and Vihko, R. (1993). Differential estrogen substrate specificities for transiently expressed human placental l7P-hydroxysteroid dehydrogenase and a n endogenous enzyme expressed in cultured COS-m6 cells. Endocrinology (Baltimore) 133,2639-2644. Poutanen, M., Isomaa, V., Peltoketo, H., and Vihko, R. (1995). Role of 17P-hydroxysteroid dehydrogenase type 1in endocrine and intracrine estradiol biosynthesis. J, Steroid Biochem. Mol. Biol. 55,525-532. Puranen, T. J., Poutanen, M. H., Peltoketo, H. E., Vihko, P. T., and Vihko, R. K. (1994). Site-directed mutagenesis of the putative active site of human 17P-hydroxysteroid dehydrogenase type 1.Biochem. J.304,289-293. Puranen, T., Poutanen, M., Ghosh, D., Vihko, R., andVihko, P. (1997a). Origin of substrate specificity of human and rat 17P-hydroxysteroid dehydrogenase type 1, using chimeric enzymes and site-directed substitutions. Endocrinology (Baltimore) 138, 3532-3539. Puranen, T., Poutanen, M., Ghosh, D., Vihko, P., and Vihko, R. (199713). Characterization of structural and functional properties of human 17P-hydroxysteroid dehydrogenase type 1using recombinant enzymes and site-directed mutagenesis. Mol. Endocrinol. 11, 77-86. &in, Y. M., Poutanen, M. D., Hayrinen, H. M., Kvist, A.-P., Siivari, K. M., Schmitz, W., Conzelmann, E., Hellman, U., and Hiltunen, K. (1997). Peroxisomal multifunctional enzyme of P-oxidation metabolizing D-3-hydroxyacyl-CoAesters in rat liver: Molecular cloning, expression and characterization. Biochem. J. 321, 21-28. Reed, M. J., Rea, D., Duncan, L. J., and Parker, M. G. (1994). Regulation of estradiol17Phydroxysteroid dehydrogenase expression and activity by retinoic acid in T47D breast cancer cells. Endocrinology (Baltimore) 135,4-9. Rembiesa, R., Marchut, M., and Warchol, A. (1971). Formation and metabolism of progesterone by the mouse placenta in uitro. J. Steroid Biochem. 2,111-119. Richards, J. S. (1980). Maturation of ovarian follicles:Action and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiol. Rev 60,51-89. Richards, J. S., Hickey, F. J., Chen, S., Shively, J. E., Hall, P. F., Gaddy-Kurten, D., and Kurten, R. (1987). Hormonal regulation of estradiol biosynthesis, aromatase acitivity and aromatase mRNA in rat ovarian follicles and corpora lutea. Steroids 50, 393-409. Richard, J. S., Fitzpatrick, S. L., Clemens, J. W., Morris, J. K., Alliston, T., and Sirois, J. (1995). Ovarian cell differentiation: A cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog. Horm. Res. 50,223-254. Ringler, G. E., and Strauss, J. F., I11 (1990). I n vitro systems for the study of human placental endocrine function. Endocr. Rev. 11, 105-123. Risinger, J., Berchuck, A., Kohler, M., and Boyd, J. (1994). Mutations of the E-cadherin gene in human gynecologic cancers. Nut. Genet. 7,98-102. Ritvos, O., and Voutilainen, R. (1992). Regulation of aromatase cytochrome P-450 and 17p-hydroxysteroid dehydrogenase messenger ribonucleic acid levels in choriocarcinoma cells. Endocrinology (Baltimore) 130, 61-67. Santen, R. J. (1996). Estrogen synthesis inhibitors for breast cancer: An introductory overview. Endom-Relat. Cancer 3,l-8. Sasano, H., Nagura, H., Harada, N., Goukon, Y., and Kimura, M. (1994). Immunolocalization of aromatase and other steroidogenic enzymes in human breast disorders. Hum. Pathol. 25,530-535. Sasano, H., Frost, A. R., Saitoh, R., Harada, N., Poutanen, M., Vihko, R., Bulun, S. E., Silverberg, S. G., and Nagura, H. (1996). Aromatase and 17P-hydroxysteroid dehy-
396
HELLEVI PELTOKETO et a2
drogenase type 1 in human breast carcinoma. J. Clin. Endocrinol. Metab. 81, 4042-4046. Sato, T., Saito, H., Morita, R., Koi, S., Lee, J., and Nakamura, Y. (1991).Mlelotype of human ovarian cancer. Cancer Res. 51,5118-5122. Sawetawan, C., Milewich, L., Word, R. A., Carr, B. R., and Rainey, W.E. (1994). Compartmentalization of type I l7P-hydroxysteroid oxidoreductase in the human ovary. Mol. Cell. Endocrinol. 99, 161-168. Schindler, A. E. (1982). Hormones in human amniotic fluid. Endocrinology (Baltimore) 21,l-158. Sha, J.,Baker, P., and O’Shaughnessy, P. J. (1996). Both reductive forms of 17P-hydroxysteroid dehydrogenase (types 1 and 3) are expressed during development in the mouse testis. Biochem. Biophys. Res. Commun. 222,90-94. Sha, J., Dudley, K., Rajapaksha, W. R. A. K. J. S., and OShaughnessy, P. J. (1997). Sequence of mouse 17p-hydroxysteroid dehydrogenase type 3 cDNA and tissue distribution of the type 1 and type 3 isoform mRNAs. J. Steroid Biochem. Mol. Biol. 60, 19-24. Sherman, M. (1983). Endocrinology of rodent trophoblast cells. In “Biology of Trophoblast” (Y. Loke and A. Whyte, eds.), pp. 401-467. Elsevier, Amsterdam. Shinohara, O., Knecht, M., and Catt, K. J. (1985). Inhibition of gonadotropin-induced granulosa cell differentiation by activation of protein kinase C. Proc. Natl. Acud. Scz. USA 82,8518-8522. Simard, J.,Feunteun, J.,Lenoir, G., Tonin, P., Normand, T., Luu-The, V. Vivier, A., Lasko, D., Morgan, K., Rouleau, G. A., Lynch, H., Labrie, F., and Narod, S.A. (1993). Genetic mapping of the breast-ovarian cancer syndrome to a small interval on chromosome 17q12-21: Exclusion of candidate genes EDH17B2 and RARA. Hum. Mol. Genet. 2, 1193-1199. Simpson, E. R., and MacDonald, P. C. (1981).Endocrine physiology of the placenta. Annu. Rev. Physiol. 43, 153-188. Simpson, E. R., Mahendroo, M. S., Means, G. D., Kilgore, W., Hinshelwood, M. M., Graham-Lawrence, S., Amarneh, B., Ito, y., Fisher, C. R., Michael, M. D., Mendelson, C. R., and Bulun, S. E. (1994).Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr. Reu. 15, 342-355. Soares, M. J., and Talamantes, F. (1983). Midpregnancy elevation of serum androstenedione levels in the C3H/HeN mouse: Placental origin. Endocrinology (Baltimore) 113, 1408-1412. Soares, M. J., Faria, T. N., Roby, K. F., and Deb, S. (1991). Pregnancy and the prolactin family hormones: Coordination of anterior pituitary, uterine, and placental expression. Endocr. Rev. 12,402-423. Soares, M. J., Faria, T. N., Hamlin, G. P., Lu, S.-J., and Deb, S. (1993). Trophoblast cell differentation: Expression of the placental prolactin family. In “Trophoblast Cells: Pathways for Maternal-Embryonic Communication” (M. J. Soares, S. Handwerger, and F. Talamantes, eds.). pp. 43-65. Springer-Verlag, New York. Steger, D. L., Hecht, J. H., and Mellon, P. L. (1994). GATA-bindingproteins regulate the human gonadotropin a-subunit gene in the placenta and pituitary gland. Mol. Cell. Biol. 14,5592-5602. Steinkampf, M. P., Mendelson, C. R., and Simpson, E. R. (1988). Effects of epidermal growth factor and insulin-like growth factor I on the levels of mRNA encoding aromatase cytochrome P-450 of human ovarian granulosa cells. Mol. Cell. Endocrinol. 59,93-99. Stephanou, A,, and Handwerger, S. (1995). Retinoic acid and thyroid hormone regulate
ROLE OF 17HSDS IN ESTROGEN ACTION
397
placental lactogen expression in human trophoblast cells. Endocrinology (Baltimore) 136,933-938. Stephanou, A., Sarlis, N. J., Richards, R., and Handwerger, S. (1994). Expression of retinoic acid receptor subtypes and cellular retinoic acid binding protein-I1 mRNAs during differentiation of human trophoblast cells. Biochem. Biophs. Res. Commun. 202,772-780. Strom, A X . , Forsberg, M., Lillhager, P., and Westin, G. (1996). The transcription factors S p l and Oct-1 interact physically to regulate human U1 snRNAgene expression. Nucleic Acids Res. 24, 1981-1986. Suh, B.-S., and Amsterdam, A. (1990). Establishment of highly steroidogenic granulosa cell lines by cotransfection with SV 40 and Ha-ras oncogene: Induction of steroidogenesis by cyclic adenosine 3‘-5’-monophosphate and its suppression by phorbol ester. Endocrinology (Baltimore) 127,2489-2500. Tait, G. H., Newton, C. J. Reed, M. J., and James, V. H. T. (1989). Multiple forms of 17P hydroxysteroid oxidoreductase in human breast tissue. J. Mol. Endocrinol. 2,71-80. Thijssen, J. H. H., and Blankenstein, M. A. (1994).Steroid hormones in the human breast. Endocr- Relat. Cancer 2,43-48. Thomas, M. L., Xu, X., Norfleet, A. M., and Watson, C. S. (1993). The presence of functional estrogen receptors in intestinal epithelial cells. Endocrinology (Baltimore) 132,426-430. Townsend, L., and Ryan, K. J. (1970). In uitro metabolism of pregnenolone-17a3H, progesterone-4-14C by rat placental tissue. Endocrinology (Baltimore) 87, 151-155. Tremblay, Y., and Beaudoin, C. (1993). Regulation of 3p-hydroxysteroid dehydrogenase and 17P-hydroxysteroid dehydrogenase messenger ribonucleic acid levels by cyclic adenosine 3’,5’-monophosphate and phorbol myristate acetate in human choriocarcinoma cells. Mol. Endocrinol. 7,355-364. Tremblay, Y., Ringler, G. E., More, Y., Mohandas, T. K., Labrie, F., Straws, J. F., 111, and Miller, W. L. (1989). Regulation of the gene for estrogenic 17-ketosteroid reductase lying on chromosome 17cen+q25 J. Biol. Chem. 264,20458-20462. Tseng, L. (1980). Hormonal regulation of steroid metabolic enzymes in human endometrium. In “Advances in Sex Steroid Hormone Research (J.A. Thomas and R. L. Singhal, eds.), pp. 329-361. Urban & Schwarzenberg, Baltimore and Munich. Udvadia, A. J., Templeton, D. J., and Horowitz, J. M. (1995). Functional interactions between the retinoblastoma (Rb) protein and Sp-family members: Superactivation by Rb requires amino acids necessary for growth suppression. Proc. Natl. Acad. Sci. USA 92,3953-3957. Varughese, K. I., Skinner, M. M., Whiteley, J. M., Matthews, D. A., and Xuong, N. H. (1992). Crystal structure of rat liver dihydropteridine reductase. Proc. Natl. Acad. Sci. USA 89,6080-6084. Vermeulen,A., Deslypere, J. P., Paridaens, R., Leclercq, G., Roy, F., and Heuson, C. 11986). Aromatase, 17P-hydroxysteroid dehydrogenase and intratissular sex hormone concentrations in cancerous and normal glandular breast tissue in postmenopausal women. Eur J. Cancer Clin. Oncol. 22,515-525. Vinson, G. P. and Chester-Jones, I. (1964). The capacity of mouse fetus and placenta to synthesize steroids from progesterone in uitro. Gen. Comp. Endocrinol. 4,415-419. Warshaw, M. L., Johnson, D. C., Khan, I., Eckstein, B., and Gibori, G. (1986). Placental secretion of androgens in the rat. Endocrinology (Baltimore) 119,2642-2648. Winqvist, R., Peltoketo, H., Isomaa, V., Grzeschik, K.-H., Mannermaa, A., and Vihko, R. (1990). The gene for 17s-hydroxysteroid dehydrogenase maps to human chromosome 17, bands q12-q21, and shows an RFLP with Sca I. Hum. Genet. 85,473-476.
398
HELLEVI PELTOKETO et al,
Wu, L., Einstein, M., Geissler, W. M., Chan, H. K., Elliston, K. O., and Andersson, S. (1993). Expression, cloning and characterization of human 17P-hydroxysteroid dehydrogenase type 2, a microsomal enzyme possessing 2Oa-hydroxysteroid dehydrogenase activity. J. Biol. Chem. 268,12964-12969. Ying, S.-Y., Becker, A,, Ling, N., Ueno, N., and Guillemin, R. (1986). Inhibin and beta type transforming growth factor (TGFP) have opposite modulating effects on the follicle stimulating hormone (FSHbinduced aromatase activity of cultured rat granulosa cells. Biochem. Biphys. Res. Commun. 136,969-975.
VITAMINS AND HORMONES, VOL. 55
Steroidogenic Acute Regulatory Protein
DOUGLAS M. STOCCO Department of Cell Biology and Biochemistry Texas Tech University Health Sciences Center Lubbock, Texas 79430
I. Introduction 11. What Are the Factors Involved in the Acute Regulation of Steroidogenesis? 111. The Steroidogenic Acute Regulatory Protein A. Correlations between StAR and Steroidogenesis B. Further Correlations between StAR and Steroid Biosynthesis C. StAR Expression D. TheStARGene E. Regulation of StAR Expression F. Ca2+Regulation of StAR Expression G. Negative Regulation of the StAR Gene H. Characteristics of the StAR Protein I. StAR and Phosphorylation IV. Consequences of a Disordered StAR Gene A. StAR in Congenital Lipoid Adrenal Hyperplasia B. The StAR Knockout Mouse V. Putative Mechanism of Action of StAR VI. Conclusions References
I. INTRODUCTION Steroids are a very important class of hormones and are mainly synthesized in specialized steroidogenic cells in the adrenal gland, in the ovary and placenta of females, and in the testis of males. The adrenal glucocorticoids are important for the maintenance of carbohydrate metabolism and stress management and the mineralocorticoids for maintaining salt balance. The estrogens and progestins, steroids synthesized in the ovary and placenta, function to induce and maintain secondary sex characteristics and are also essential for reproductive function. Lastly, testicular androgens are responsible for the maintenance of reproductive function and secondary sex characteristics in the male and also constitute an important member of this family. An additional class of steroids known as the neuroactive or neural steroids are synthesized by the central nervous system and appear to have specialized functions in those tissues but are not being considered further in this article. 399
Copyright 0 1999 by Academic Press All rights of reproduction in any form reserved. 0083-6729199 $25 00
400
DOUGLAS M.STOCCO
Although the steroid hormones can be distinguished from one another by their diverse physiological actions in the body, they do, however, share a common characteristic in that, regardless of the tissue of origin, they are all synthesized from a common precursor substrate, cholesterol. Thus, the biosynthesis of all hormonal steroids in response t o trophic hormone and other steroidogenic stimuli begins with the cleavage of a 6-carbon side-chain of the 27-carbon cholesterol molecule t o form the first steroid synthesized, the 21-carbon-containing molecule pregnenolone. This reaction is catalyzed by the cytochrome P450 side chain cleavage enzyme (P45Oscc),which is part of the cholesterol side chain cleavage (CSCC) enzyme system, which is located on the matrix side of the inner mitochondrial membrane (Simpson and Boyd, 1966, 1967; Yago and Ichii, 1969; Churchill and Kimura, 1979). Once pregnenolone is formed, it may be metabolized within the mitochondria to progesterone by a mitochondrial form of the enzyme 3p hydroxysteroid dehydrogenase (3P-HSD)(Sulimoviciet al., 1973; Chapman et al., 1992; Cherradi et al., 1994, 1995, 1997; Sauer et al., 19941, or it may exit the mitochondria and undergo further metabolism by microsomal steroid dehydrogenases and cytochrome P450 steroid hydroxylases with the final steroid hormone product being dependent on the nature of the tissue in which the subsequent steps take place. For many years the action of the P45Oscc enzyme in converting cholesterol to pregnenolone was considered as the rate-limiting step in steroidogenesis. However, it readily became clear that the activity of the P45Oscc enzyme was not the rate-limiting step in this process (Hanukoglu and Hanukoglu, 1986), and that to initiate and sustain steroidogenesis, first, a constant supply of the substrate cholesterol for steroid biosynthesis must be available within the cell and, second, a mechanism must exist for the delivery of this cholesterol to the site of cleavage in the inner mitochondrial membrane where the P45Oscc enzyme resides. The stores of cholesterol found inside steroidogenic cells may be supplied to the cell from serum in the form of high-density lipoprotein (HDL) or low-density lipoprotein (LDL), depending on the species and cell type in question (Kovanen et al., 1980;Gwynne and Mahaffee, 1989), or, from what appears to be a minor source of cholesterol for steroidogenesis in most steroidogenic cells, the de nouo synthesis of cholesterol from acetate. As mentioned earlier, given adequate intracellular cholesterol supplies, two separate but equally important processes must occur. The first process is the mobilization of cholesterol from cellular stores such as lipid droplets or other cellular membranes to the outer mitochondrial membrane, and the second process consists of the transfer of this cholesterol from the outer to the inner mitochondrial membrane (Liscum and Dahl, 1992; Jefcoate et al., 1992; Stocco
STEROIDOGENIC ACUTE REGULATORY PROTEIN
401
and Clark, 1996). The factors and processes responsible for the mobilization of cholesterol to the outer mitochondrialmembrane are thought to involve changes in cellular architecture and putative transport proteins, but their mechanisms of action are not well understood. A number of reviews on the subject of intracellular cholesterol trafficking have been written (Scallen et al., 1985; Pedersen and Brownie, 1986; van Meer, 1989; Schroeder et al., 1991; Jefcoate et al., 19921, and this area certainly deserves a great deal of attention in future studies, as steroid biosynthesis cannot reach maximal levels in the absence of adequate supplies of cholesterol. As mentioned earlier, it was thought that the cleavage of cholesterol was the rate-limiting step in steroidogenesis.Although the action of the P45Oscc may indeed be considered as the rate limiting enzymatic step in steroidogenesis (Stone and Hechter, 1954; Karaboyas and Koritz, 1965;Garren et al., 1971),there were a number of observations that indicated that the true rate-limiting step effected by hormone stimulation in this process is the delivery of cholesterol to the inner mitochondrial membrane, a site that is extremely cholesterol poor, and to the P45Oscc (Karaboyas and Koritz, 1965;Brownie et al., 1972,1973;Simpson et al., 1979;Crivello and Jefcoate, 1980;Mori and Marsh, 1982;Privalle et al., 1983;Jefcoate et al., 1987).For example, it became apparent that when hydroxylated analogs of cholesterol such as 22R-hydroxycholesterol, 20a-hydroxycho1estero1, or 25-hydroxycholesterol, all of which can readily diffuse across the mitochondrial membranes to the P45Oscc, are placed on steoidogenic cells, high levels of the steroids could be formed in the absence of hormone stimulation of the cells (Lambeth et al., 1982; Tuckey and Stevenson, 1984; Tuckey and Atkinson, 1989; Tuckey, 1992). These observations indicated that the P45Oscc was fully active and that it was the lack of availability of cholesterol for cleavage that prevented the production of pregnenolone and subsequent downstream steroids. With these observations came the understanding that the major barrier to be overcome in the translocation of cholesterol to the P45Oscc is the aqueous space between the outer and inner mitochondrial membranes through which the hydrophobic cholesterol must pass. Since the aqueous diffusion of cholesterol is known to be very slow (Phillips et al., 1987; Schroeder et al., 1991; Rennert et al., 1993) and could not provide sufficient substrate t o account for the rapid and large increase in steroid production observed in steroidogenic cells, it followed that stimulation of steroidogenesis requires a mechanism that rapidly transports this steroid precursor across this barrier. In summary, the overall production of steroids is controlled by events that facilitate the transport of cholesterol from lipid droplets and other cellular stores, first, to the mitochondrial outer membrane and, sec-
402
DOUGLAS M. STOCCO
ond, its subsequent translocation across the aqueous intermembrane space of the mitochondria to the inner membrane. Although both processes are necessary to ensure maximal rates of steroid production in response to hormone stimulation, it is the second process, the transfer of cholesterol from the outer membrane across the aqueous intermembrane space to the inner mitochondria1membrane and the P45Oscc enzyme, that is now readily accepted as the rate-limiting step in hormone-regulated steroidogenesis.
11. WHATARE THE FACTORS INVOLVED IN THE ACUTEREGULATION OF STEROIDOGENESIS? The molecular events that regulate the rapid production of hormonal steroids in steroidogenic tissues in response to trophic hormone stimulation have been the subject of intense investigation for over four decades. Regardless of the type of steroidogenic cell studied, the acute response to trophic hormone stimulation usually shares many of the same characteristics. The steroidogenic responses are usually dose-dependent, have the same temporal relationship with the onset of steroid production, occurrring rapidly following stimulation, and are sensitive to protein synthesis inhibitors. For these and other reasons, it is highly likely that the mechanism(s) involved in this acute regulation is similar in all steroidogenically active cell types. The majority of the early studies on the acute regulation of steroid hormone biosynthesis were performed in the adrenal gland. It had been observed that adrenocorticotropic hormone (ACTH)could stimulate the biosynthesis of adrenal steroids under in uitro conditions as well as under in uiuo conditions (Stone and Hechter, 1954; Hechter et al., 1951; Haynes et al., 1952; Saffran et al., 1952).Thus, this in uitro system was essentially the first such model developed and was employed as a useful system in subsequent studies on the hormonal regulation of adrenal steroidogenesis. It was stated earlier that the rate-limiting step in the biosynthesis of all steroid hormones occurs at the level of the conversion of cholesterol to pregnenolone, however, this conclusion was not always immediately obvious until the work of Stone and Hechter (1954). Also, the characteristics of this acute regulation were carefully studied by a number of other investigators and their findings greatly added to our understanding of this important step, as described later. One of the first and most fundamental observations concerning steroidogenesis was that acute steroid production in response to hormone stimulation has an absolute requirement for the synthesis of new proteins. The first of such studies were performed by Ferguson (1962,
STEROIDOGENIC ACUTE REGULATORY PROTEIN
403
1963) who demonstrated that the acute stimulation of corticoid synthesis in adrenal glands by ACTH was sensitive to the protein synthesis inhibitor puromycin. In fact, in one of these studies Ferguson arrived at the prophetic .conclusion that “of the several possible explanations for the observed effects of puromycin, the most provocative but most difficult to prove is the idea that a specific protein must be synthesized in order for the adrenal to increase steroid output.” At approximately this same time, Garren and coworkers conducted a series of studies that very clearly demonstrated that steroidogenesis in adrenal tissue is highly dependent on the synthesis of new proteins in response to ACTH treatment (Garren et al., 1965,1966;Davis and Garren, 1968; Garren, 1968).Importantly, they also observed that although steroid synthesis is dependent on de nouo protein synthesis Le., sensitive to cycloheximide),the conversion of cholesterol esters to free cholesterol is not (Davis and Garren, 1966). This indicated that the hormonally controlled step was distal to cholesterol ester hydrolysis but proximal to its side chain cleavage, that is, at the delivery of cholesterol t o the P45Oscc enzyme. An additional interesting observation, also made by Garren and coworkers, was that while prestimulated adrenal cells had the capacity to continue steroid production in the presence of added cycloheximide, the rate declined very rapidly. Thus, they concluded that the half-life of the putative stimulating factor was very short. These studies gave rise to two additional adjectives that are commonly used to describe the putative protein regulator, cycloheximide sensitive and highly labile (Garren et al., 1965). Following these observations many similar studies were confirmatory of the need for de nouo protein synthesis in the hormone-regulated, acute production of steroids (Karaboyas and Koritz, 1965; Farese, 1967; Cooke et al., 1975; Paul et al., 1976; Farese and Prudente, 1977; Crivello and Jefcoate, 1978; Toaff et al., 1979; Privalle et al., 1983; Solano et al., 1984; Stevens et al., 1993). Studies by van der Molen and colleagues also confirmed the need for de nouo protein synthesis in the stimulation of steroid production in rat Leydig cells and even identified two possible protein candidates (Janszen et al., 1976, 1977). Importantly, Simpson and Boyd (1966) determined that the cycloheximide-sensitivestep in this process was located in the mitochondria, but, just as importantly, it was also noted by Arthur and Boyd (1976) that protein synthesis inhibitors had no effect on the activity of the P45Oscc itself, which is housed in the mitochondria. These observations were quickly followed by studies that demonstrated that inhibition of protein synthesis had no effect on the increased delivery of cellular cholesterol to the outer mitochondrial membrane, but that the delivery of this substrate from the outer membrane to the inner mitochondrial membrane was completely inhibited
404
DOUGLAS M. STOCCO
by cycloheximide (Privalle et al., 1983;Ohno et al., 1983). Furthermore, in both mouse Y-1 adrenal tumor cells and MA-10 mouse Leydig tumor cells in which it has been demonstrated that although cholesterol could be delivered to a so called presteroidogenic pool in the presence of cycloheximide, pregnenolone production did not occur until the inhibitor was removed and the cells were subsequently stimulated with hormone (Stevens et al., 1993).As a result of these many studies, the precise site of the cycloheximide inhibited regulation had been pinpointed, namely, the transfer of cholesterol to the P45Oscc enzyme in the inner mitochondrial membrane. The observation that de nouo protein synthesis was indispensable for the acute production of steroids in response to hormone stimulation has also been made in several different steroidogenic tissues (Krueger and Orme-Johnson, 1983; Epstein and OrmeJohnson, 1991a,b;Pon and Orme-Johnson, 1988; Stocco and Sodeman, 1991; Stocco and Chen, 1991). In summary, a compilation of many observations made over a period of approximately three decades resulted in the overall enumeration of the characteristics to describe the acute regulation of steroidogenesis. Essentially, these characteristics indicated that the acute production of steroids is dependent on a hormone-stimulated, rapidly synthesized, cycloheximide-sensitive and highly labile protein whose function appears to be to mediate the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondria1 membrane and the P45Oscc enzyme. An overall summary of the events and putative participants in the acute regulation of steroid hormone biosynthesis can be seen in Fig. 1. The effort to identify and characterize this acute regulatory protein(s) has been ongoing since the early observations of Ferguson and Garren and their colleagues. Several candidates have emerged from these efforts. A listing of these proteins and the data supporting their candidacies has been collectively reviewed (Stocco and Clark, 19961, as has the characteristics for individual candidates (Papadopoulos, 1993). Only the observations made for one of these candidates, the steroidogenic acute regulatory (StAR)protein is summarized here. 111. THESTEROIDOGENIC ACUTEREGULATORY PROTEIN BETWEEN STARAND STEROIDOGENESIS A. CORRELATIONS
This article attempts to summarize studies performed on a protein that has been proposed as the acute regulator of steroid biosynthesis.
STEROIDOGENIC ACUTE REGULATORY PROTEIN
405
Trophlc Hormone frophlc
ly-1
Hormone Receptor
7
\de
novo synthesis
\\
MITOCHONDRIA
progesterone
FIG.1.Effects of tropic hormone stimulation on steroidogenic cells. This figure depicts the cellular response to tropic hormone stimulation in steroidogenic cells. In response to tropic hormone activation of the adenylate cyclase enzyme results in the intracellular increase in cyclic AMP (CAMP).This increase, in turn, results in the activation of two separate but equally important pathways in support of the acute production of steroids. In one, activation of the cholesterol ester hydrolase by phosphorylation converts cholesterol esters to free cholesterol, which is, in turn, mobilized to the outer mitochondrial membrane by mechanisms still not well understood. Also, other mechanisms involved in the mobilization of cholesterol to the outer mitochondrial membrane may be activated by trophic hormone and may include the action of SCP2 and morphological alterations in the cell, but clearly these events are not well understood. These steps are necessary to ensure a n adequate supply of this precursor for sustained steroid biosynthesis. In addition, the de nouo synthesis of the putative regulatory protein, S M , must be rapidly accomplished in response to hormone stimulation. This protein serves to function in the transfer of the substrate cholesterol to the inner mitochondrial membrane and the site of the CSCC. Once cholesterol is converted to pregnenolone by the P45Oscc it can further be converted within the mitochondria to progesterone via the action of a mitochondrial 3p hydroxysteroid dehydrogenase. Progesterone will then exit the mitochondria and, depending on the tissue, will be converted into either mineralocorticoids, glucocorticoids, androgens, progestins, or estrogens.
406
DOUGLAS M. STOCCO
It was initially described by Orme-Johnson and colleagues as an ACTHinduced 30-kDa phosphoprotein in hormone-treated rat and mouse adrenocortical cells, and as an luteinizing hormone (LH)-inducedprotein in rat corpus luteum cells and mouse Leydig cells (Krueger and Orme-Johnson, 1983; Pon and Orme-Johnson, 1986, 1988; Pon et al., 1986a,b; Alberta et al., 1989; Epstein and Orme-Johnson, 1991a,b). This series of carefully performed studies indicated that a close relationship between the appearance of the 30-kDa proteins and steroid hormone biosynthesis existed in several different steroidogenic tissues and that the synthesis of these proteins, as was steroidogenesis, was sensitive to cycloheximide. Proteins that are probably identical to those described by Orme-Johnson have also been characterized in hormone stimulated MA-10 mouse Leydig tumor cells by Stocco and colleagues (Stocco and Kilgore, 1988; Stocco and Chaudhary, 1990; Stocco and Sodeman, 1991; Stocco and Chen, 1991;Stocco, 1992; Stocco and Ascoli, 1993; Stocco et al., 1995). During the course of studies in both laboratories, these proteins were found to be localized to the mitochondria and consisted of several forms of a newly synthesized 30-kDa protein. In addition to the 30-kDa mitochondrial proteins, precursor forms of these proteins were also detected, a common observation with mitochondrial proteins (Epstein and Orme-Johnson, 1991b; Stocco and Sodeman, 1991).Since the initial observation of these proteins, there have been a number of studies in which correlations between the synthesis of steroids and the synthesis of the 30-kDa proteins have been made (Krueger and Orme-Johnson, 1983; Pon and Orme-Johnson, 1986, 1988; Pon et al., 1986a,b;Alberta et al., 1989; Epstein and Orme-Johnson, 1991a,b; Stocco and Chen, 1991; Stocco, 1992; Stocco and Ascoli, 1993; Stocco et al., 1995). The most compelling, but certainly not exhaustive, list of these correlations include (1)hormone-induced synthesis of the 30-kDa proteins paralleled steroid production in both a time- and dose-responsive manner (Krueger and Orme-Johnson, 1983; Stocco and Sodeman, 1991); (2) their synthesis was sensitive to cycloheximide (Krueger and Orme-Johnson, 1983; Stocco and Sodeman, 1991);(3) they were found associated with the mitochondria, the site of the acutely regulated step (Stocco and Kilgore, 1988; Alberta et al., 1989; Stocco and Chaudhary, 1990; Stocco and Sodeman, 1991; Stocco and Chen, 1991; Epstein and Orme-Johnson, 1991a,b; Stocco, 1992; Stocco and Ascoli, 1993; Stoccoet al., 1995);and (4) the 30-kDa proteins are maximally expressed in the constitutive steroid producing rat R2C Leydig tumor cell line in which steroidogenesis is also constitutive (Stocco and Chen, 1991).However, in spite of the many positive corre-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
407
lations noted, a direct cause and effect relationship between 30-kDa protein expression and steroidogenesis was lacking, and it became increasingly clear that it would be necessary to clone the 30-kDa proteins t o unequivocally prove its function in steroidogenesis. During the process of cloning the cDNA for the 30-kDa protein, the protein was first purified from hormone stimulated MA-10 mouse Leydig tumor cell mitochondria. Tryptic digestion and microsequence analysis of three of the resulting peptides allowed for the design of degenerate oligonucleotides, which were, in turn, used t o obtain and amplify a 400-base pair (bp) specific polymerase chain reaction (PCR) product from an MA-10 cell cDNA library, which was then employed to probe the cDNA library. A full-length 1456-bp cDNA clone containing an open reading frame of 852 nucleotides encoding a protein of 284 amino acids was subsequently obtained (Clark et al., 1994). The presence of identical sequences in the deduced amino acid sequence of the protein and the microsequence analysis of the purified 30-kDa protein confirmed that the reading frame was correct. When compared with other sequences in the database both the nucleic acid sequence and protein sequence were found to be unique, indicating the 30-kDa protein represented a novel protein. However, since that time, homologous regions for specific regions of this protein have been detected and are discussed later. The full-length cDNAwas shown to encode the 37-kDa precursor protein, which could be imported and correctly processed and modified to the mature 30-kDa proteins by isolated mitochondria (Clarket al., 1994).These protein(s) had identical mobilities (PIS)as the hormone-induced proteins observed in MA-10 mouse Leydig tumor cells when separated by two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Most importantly, transient transfection experiments demonstrated that expression of the cDNAderived protein in MA-10 cells resulted in a significant increase in steroid production in the absence of hormone stimulation. In addition, transient transfection of COS-1 cells with a plasmid containing P45Oscc, adrenodoxin and adrenodoxin reductase (Harikrishna et al., 1993), and the cDNA for the 37-kDa protein resulted in a several-fold increase in the conversion of cholesterol to pregnenolone (Sugawara et al., 1995a; Lin et al., 1995; Stocco and Clark, 1996). These results substantiated and extended the previous correlative studies and indicated a direct role for the 30-kDa proteins in hormoneregulated steroid production. As a result of these observations, the protein was named StAR protein (Clark et d,1994).Although the mechanism that StAR uses to transfer cholesterol to the inner mitochondria1
408
DOUGLAS M. STOCCO
membrane and the P45Oscc is not very well understood, it remains the best candidate protein for the acute regulator of steroidogenesis,as proposed by Ferguson and Garren and others.
B. FURTHER CORRELATIONS BETWEEN STAR AND STEROID BIOSYNTHESIS Since the initial characterization of the StAR protein in MA-10 cells, and with the availability of new reagents such as antipeptide antisera and cDNAs to StAR, a number of subsequent studies have also demonstrated close correlations between its presence and steroid hormone biosynthesis in other experimental systems. For example, it was demonstrated that the organophosphate diethylumbelliferyl phosphate, a cholesterol ester hydrolase (CEH) inhibitor, which inhibits steroidogenesis by blocking the transfer of cholesterol into the mitochondria, also inhibited the synthesis of the StAR protein at a concentration that blocked steroid production but had no effect on the activity of the CEH (Choi et al., 1995). Also, mice injected with lipopolysaccharide(LPS)display a 90%reduction in serum testosterone levels within 2 h of treatment, and this decrease was found to be parallel with a decrease in the amount of StAR protein found in the Leydig cells of these animals at this time point (Bosmannet al., 1996).Ramnath et al. (1997) were able to show that the level of steroid synthesis and StAR synthesis were tightly correlated in MA-10 mouse Leydig tumor cells, which had been stimulated with cyclic AMP (CAMP)analog in the presence of low levels of chloride ion, indicating that the increased steroid production observed in low chloride levels was probably due to an increase in StAR protein synthesis. Using both primary cultures of mouse Leydig cells as well as MA-10 cells, Huang et al. (1995) showed that corticotropic-releasinghormone (CRH)treatment resulted in a dose-dependent and time-dependent increase in both intracellular CAMPand steroid hormone production. The correlation of this observation to StAR was later demonstrated when it was shown that this increase in steroid production exactly paralleled an increase in the levels of StAR protein in these cells in response t o CRH, and this was in all probability the reason for the observed increase in steroid synthesis (Huang et al., 1997). Insulin-like growth factor-1 (IGF-1) has been shown to act in concert with trophic hormone to enhance steroidogenesis in primary cultures of Leydig cells. IGF-1 treatment of hCG stimulated rat Leydig cells was shown to result in a significant increase in steroid production over that seen with hCG alone as well as in a con-
STEROIDOGENICACUTE REGULATORY PROTEIN
409
comitant increase in the synthesis of both StAR mRNA and StAR protein (Lin et al., 1998). In yet another study on the role of StAR in steroid hormone biosynthesis, it was found that in rabbit corpora lutea (CL), the time frame for the synthesis of both progesterone and StAR protein is regulated by the steroid hormone estrogen, the luteotrophic agent in the rabbit. This indicated for the first time that the gene for StAR can be regulated by a steroid hormone (Townson et al., 1996). Furthermore, changes in StAR mRNA have been linked to physiological changes in steroid secretion in the sheep and cow (Juengel et al., 1995;Hartung et al., 1995; Pescador et al., 1996).In sheep, hypophysectomy resulted in decreased serum progesterone levels as well as in corpus luteum StAR mRNA levels, both of which could be restored to control levels by treatment with the luteotrophic hormones LH or growth hormone (GH)(Juengel et al., 1995). On the other hand, prostaglandin F,ol (PGF201) and phorbol-12myristate-13-acetate (PMA),which both cause luteal regression, were shown to decrease ovine corpus luteum StAR transcripts. In the cow, Hartung et al. (1995) demonstrated that StAR mRNA increased in the corpus luteum during the estrous cycle, and concluded that both the cell- and tissue-specific characteristics of the expression of StAR were consistent with a role in steroidogenesis. Also, in another study on bovine corpora lutea, it was demonstrated that the synthesis of StAR mRNA and protein were very tightly coupled and that the timing of the appearance of StAR in this tissue was consistent with it having a role in progesterone producti'on (Pescador et al., 1996). This study showed that StAR mRNA and protein levels were low during bovine luteal development, elevated in active CL and absent in regressed CL and in CL treated for 24 h with PGF2a.In a later study, these same investigators then demonstrated that both StAR and P45Oscc expression could be regulated in luteinized porcine granulosa cells by follicle-stimulating hormone (FSH) and CAMPanalog and that this expression was dependent on ongoing protein synthesis (Pescadoret al., 1997).Also, Soumanno and Price (19971, demonstrated that StAR expression could be increased in cattle by treatment with equine chorionic gonadotropin (eCG) but not with FSH. These results indicated that StAR expression was tightly coupled to progesterone production in follicular thecal cells, and could be a key component in its synthesis. Pilon and colleagues (1997)demonstrated that in both the pig and the cow, StAR expression occurred in both adult and fetal tissues. They found that StAR was present in adult testes and ovaries in both species, but only in the fetal testes and not fetal ovaries, an observation consistent with the
410
DOUGLAS M. STOCCO
steroidogenic capacity of those tissues. In addition, they were able to demonstrate the presence of StAR transcripts in both the pig and cow placenta, thus confirming previous observations made in the cow (Pescador et al., 1996). Studies using the rat ovary as a model indicated that StAR expression and serum progesterone levels rose in parallel in response to trophic hormone stimulation, whereas P45Oscc enzyme levels were unchanged during the time period observed (Sandhoff and McLean, 1996a). In a subsequent study, these same investigators demonstrated that treatment of rats with prostaglandin F,,, which causes regression of the corpus luteum, resulted in a pronounced inhibition of both progesterone production and StAR expression (Sandhoff and McLean, 1996b). In porcine granulosa cells, Balasubramanian et al. (19971, found that progesterone synthesis, StAR mRNA and StAR protein were all tightly coupled and increased in response to a combination of both FSH and IGF-1 but not to either agent alone. A subsequent study from this group (LaVoie et al., 19971, was able to demonstrate a good correlation between the expression of both the StAR (r = t-0.71) and P45Osc ( r = +0.37) mRNAs and progesterone synthesis during the pig follicular and luteal phases, indicating that both proteins are present during the steroidogenic life of the follicle and corpus luteum. A similar study by Thompson et al. (1997) indicated that StAR expression could be observed in rat ovarian granulosa cells only following stimulation with FSH, a treatment that also induced progesterone production, being absent in nonstimulated, non-steroid-producing cells. Selvaraj et al. (19961, showed that both progesterone synthesis and StAR expression could be stimulated simultaneously by gonadotropins in immortalized rat granulosa cells that had been transfected with SV40 DNA containing either LH or FSH receptor genes as well as by isoproterenol in cells transfected with the P,-adrenergic receptor gene. In yet another correlation between the appearance of the StAR protein and steroidogenesis, Liu et al. (1996) showed that StAR mRNA was expressed abundantly in both normal human adrenals and in adrenocortical neoplasms, and further, the expression of StAR could be stimulated by ACTH and CAMPanalog. Although expression was slower than that seen in other culture systems, the appearance of StAR as well as P45Oscc paralleled that of cortisol production and, as speculated by the authors, may be tied to the time it takes for those cells to differentiate into highly steroidogenic cells in culture. In addition, Nishikawa et al. (1996) showed a close correlation between ACTH stimulation and StAR protein expression in bovine adrenal fasciculata cells. They also suggested that StAR expression may be regulated by both protein kinase
STEROIDOGENIC ACUTE REGULATORY PROTEIN
411
A(PKA) and protein kinase C (PKC) signaling pathways in this system. Kiriakidou et al. (1996) demonstrated that StAR messenger RNA is expressed in the most steroidogenic compartments of the human ovary and is expressed in luteinized granulosa cells in response to the LH surge, and its expression is antagonized by activators of protein kinase C. In a similar study, treatment of immature rats with pregnant mare serum gonadotropin (PMSG) resulted in a dramatic increase in StAR expression in both the ovarian theca interna cells as well as in the corpora lutea of these animals, further confirming that StAR expression is confined only t o the steroidogenic cells in this organ (Mizutani et al., 1997). Studies by Behrman’s group had demonstrated that rat luteal cells responded to temperature induced heat shock with an induction of heat-shock protein 70 (hsp70) and a concomitant cessation of hormone stimulated progesterone synthesis (Khanna et al., 1994, 1995). These investigators were able to place the locus of this inhibition at the point of cholesterol transfer to the P45Oscc enzyme. Using this same heatshock model, an additional close correlation between the synthesis of the StAR protein and steroid biosynthesis was subsequently demonstrated when Liu and Stocco (1997) showed that in hormone-stimulated, heat shocked MA-10 cells, hsp7O was increased, progesterone synthesis was completely inhibited and most importantly, the synthesis of StAR was completely blocked. These data indicated that the StAR protein is indispensable for cholesterol transfer to the inner mitochondria1 membrane, the step blocked by heat shock. An extensive study was undertaken by Ronen-Fuhrmann et al. (1998) in which both StAR mRNA and protein levels were measured throughout the follicular phase in the rat. It was observed that in response to PMSG, the first phase of StAR expression occurred mostly in the secondary interstitial cells and somewhat less in the theca interna cells and lasted for approximately 24 h. In the second phase, that is, the LH surge as stimulated by human chorionic gonadotropin (hCG), StAR expression was observed in the entire theca interna and interstitial cells as well as in those granulosa cells that were confined to the periovulatory follicles. These results demonstrated that the first phase of StAR expression occurred in nonfollicular androgen-producing cells, whereas the second phase occurred in the granulosa and theca interna cells of the dominant follicles, suggesting a functional collaboration between the different ovarian cell types. In summary, the number of observations that have linked increases as well as decreases in steroid production with the level of expression of the StAR mRNA and synthesis of the StAR protein has been in-
412
DOUGLAS M. STOCCO
creasing on an almost daily basis. In virtually every case, a strong correlation between the presence of the StAR protein and steroid hormone biosynthesis on both a temporal and a spatial level can readily be seen.
C. STAR EXPRESSION Many studies have attempted to determine the role of StAR in regulated steroid production. Thus, employing methodologies such as Northern and Western analysis it has been demonstrated that there is a close temporal and tissue-specific relationship between steroid biosynthesis and StAR mRNA and StAR protein synthesis. One of the first of these studies demonstrated that StAR mRNA and protein were induced in close coordination via a CAMP-mediated mechanism and displayed a time frame that paralleled the acute production of steroid hormones in MA-10 mouse Leydig tumor cells (Clark et al., 1995a). The mechanism of hormone action on StAR expression was speculated to be most likely due to a CAMP-induced change in StAR transcription and/or mRNA stability, although the exact nature of this mechanism had not yet been determined (Sugawara et al., 1995a; Clark et al., 1995a).A study by Clark et al. (1997) has determined that although ongoing translation of the StAR protein did not require new transcription, the continued translation of StAR and steroid hormone production was clearly dependent on continued transcription of the StAR gene. This study also implied that the stability of the StAR mRNA, observed in response to actinomycin D treatment, played very little role in the observed level of acutely synthesized steroids in MA-10 cells. In addition, the tissue-specific expression of StAR protein and mRNA in the adrenal, testis, and ovary of the mouse and human, respectively, provides a further indication of StAR's specific role in steroidogenesis (Sugawara et al., 1995a;Clark et al., 1995a).The precise spatial and temporal relationship between the presence of StAR transcripts and the capacity to produce steroid hormones was also confirmed during mouse embryonic development (Clark et al., 1995a).In situ hybridization of StAR mRNA in embryonic mice using complimentary probes clearly demonstrated that the timing and localization of StAR expression was very similar to that previously shown for P45Oscc and the orphan nuclear receptor steroidogenic factor 1(SF-1).In these studies, StAR was detected in the developing adrenal and testis and was specifically confined to only the steroid-producing cells of those tissues. On the other hand, StAR mRNA was absent in the developing ovary, an organ that is not steroidogenic during development, further indicating the spatial confinement of StAR to steroid producing tissue. In the adult, StAR tran-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
413
scripts were found in the adrenals, testis, and ovary and once again were specifically localized to the steroidogenic cells of those tissues (Clark et al., 1995a). Analysis of the StAR mRNAin the several different species that have been studied to date reveals three specific transcripts of 3.4, 2.7, and 1.6 kilobases (kb) in the mouse (Clark et al., 1995a);three transcripts of 7.4,4.4, and 1.6 kb in the human (Sugawara et al., 1995a);two transcripts of 3.0 and 1.8 kb in the cow (Hartung et al., 1995; Pescador et al., 1996); one transcript of 2.8 kb in the sheep (Juengel et al., 1995); three transcripts of 3.4, 1.7, and 1.2 kb in the rat (Sandhoff and McLean, 1996a;Lee et al., 1997;Kim et al., 1997);and three transcripts of 2.7, 1.6, and 0.8 kb in the pig (Pescador et al., 1997).The differences in length are most likely attributable to differences in the length of the 3’ untranslated regions (B. J. Clark, unpublished observations; Hartung et al., 1995).Although the functional significance of the different sizes of the transcripts is not yet known, Kim et al. (1997)have provided some initial discussion on this subject. Further experimentation will be required to determine the hierarchy of the manner in which the various sized StAR transcripts are utilized for translation. It was also determined in a study that although steroidogenic cells appear to have a specific level of StAR-independent steroidogenesis equal to approximately 10-20% of the total, maintenance of optimal steroid synthesis requires not only ongoing translation of the stAR mRNA, but active transcription of the StAR gene as well (Clark et al., 1997). D. THESTARGENE Full-length cDNA clones for StAR have been isolated for the mouse (Clark et al., 1994),human (Sugawara et al., 1995a),bovine (Hartung et al., 1995), hamster (Fleury et al., 1996),rat (Lee et al., 1997; Mizutani et al., 1997), and the pig (Pilon et al., 1997), and all have at least 84% homology. In addition to the studies on the characterization of the StAR cDNA, the structural gene for StAR has been isolated and characterized for both the mouse and human (Sugawara et al., 1995a,b; Caron et al., 1997a).The genes span 6.5 kb in the mouse and 8 kb in the human with the intronic sequences contributing to the increased length observed in the human. Both genes are organized into 7 exons and 6 introns with exons 3-6 being of identical size. In the human, a StAR pseudogene was identified by RT-PCR amplification of RNA and PCR amplification of human genomic DNA (Sugawara et al., 1995a). Sequence analysis of the pseudogene indicated it lacks introns and had several nucleotide insertions, deletions, and substitutions. The human
414
DOUGLAS M. STOCCO
StAR structural gene was mapped to chromosome 8p.11.2 and the StAR pseudogene to chromosome 13 (Sugawara et al., 1995a).
E. REGULATION OF STAREXPRESSION It was of considerable interest to determine the manner in which the
StAR gene was regulated. Therefore, approximately 1and 1.3kb of the 5’ flanking regions of the mouse and human genes, respectively, have been isolated and sequenced (Clark et al., 1995a; Sugawara et al., 1995b, 1997a,b). As mentioned earlier, StAR expression is regulated through the cAMP second-messenger system. However, when the murine and human StAR promoters were examined, it was found that they lacked a canonical TATA box and also lacked any sequence similar to a consensus CAMP-responsiveelement (CRE).This same situation is also found in most of the cytochrome P450 steroid hydroxylase genes, which are also regulated by cAMP but lack consensus CREs. However, binding sites for the orphan nuclear receptor SF-1 are present in the promoters of all the steroid hydroxylase genes and SF-1has been shown to transcriptionally regulate their expression in a CAMP-dependent manner (Waterman, 1994; Rice et al., 1991).An initial report on the activity of the human promoter demonstrated that a 1.3-kb upstream sequence could confer both basal and CAMP-dependent transcriptional activation of a reporter gene in Y 1mouse adrenal cells (Sugawara et al., 1995b).The human StAR promoter also has been shown to contain multiple SF-1 binding sites, which were located at positions -926 to -918, - 105 to -95, and -42 to -35 relative to the start site of transcription (Suguwara et al., 1997a,b). In addition, two putative S p l consensus sequences were also found in the human StAR 5’ flanking region (Sugawara et al., 1995b). Results obtained by these investigators indicated that SF-1 indeed played a key role in the regulation of both the basal and hormone-stimulated levels of StAR expression and that interaction between SF-1 and these multiple sites were required for maximal StAR promotor activity and its regulation by CAMP.Although the high degree of similarity between the nucleotide sequence for the mouse and human StAR coding region is not extended into the 5‘ flanking regions of the genes, sequence motifs that match the known requirements for binding SF-1 were found at positions -135 and -42 relative to the transcriptional start site in the mouse StAR gene (Clark et al., 1995a; Caron et al., 1997a). Further, deletion of the distal SF-1 site completely inhibited StAR promotor activity (Caron et al., 1997a). Similarly, approximately 1kb of the 5’ upstream sequence of the mouse StAR gene has been shown to be capable of driving expression of a human growth hor-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
415
mone reporter in Y1 cells (Caron et al., 1997a).Also, it was shown in this same study that in the SF-1 knockout mouse, expression of the StAR gene is not detected in the gonadal ridge during embryonic development, whereas it is readily seen in this region in the wild type animal. Lastly, a preliminary report indicates that the rat ovary StAR gene is also subject to regulation by SF-1 (Sandhoff and McLean, 1997; Sandhoff et al., 1997).Thus, it appears that the StAR gene can be regulated by SF-1 and that this regulation can be modulated by the presence of CAMP. As indicated previously, in addition to SF-1, the StAR gene can also be regulated by estrogen in rabbit corpora lutea, but the regulatory sequence for this steroid hormone has not yet been identified and characterized (Townson et al., 1996). Interestingly, it has also been demonstrated that the StAR gene can be up-regulated in the sheep by growth hormone (Juengel et al., 19951, a ligand that purportedly acts through tyrosine protein kinases (Argetsinger et al., 1993).As referred to earlier, expression of the StAR gene can also be regulated and/or modified by IGF-1 (Lin et al., 1998).Thus, the molecular mechanisms controlling both the cell-specific and hormone-dependent expression of the StAR gene may be quite varied and complex, depending on the species and tissue involved. Also, it is not yet clear why different, supposedly SF-1regulated genes such as StAR and P45Oscc appear in widely different time frames when induced by trophic hormone (Ronen-Fuhrmannet al., 1998). Clearly, much remains to be determined in the area of regulation of the StAR gene.
F. CA2+REGULATION OF STAREXPRESSION Elliott et al. (1993)detected the appearance of several 30-kDa mitochondrial proteins in bovine adrenal glomerulosa cells in response to angiotensin I1 and K+ stimulation, agents that increase aldosterone synthesis through the Ca2+second-messenger pathway. The molecular weights and isoelectric points of these proteins indicated that they were in all likelihood StAR. Since that time, StAR was also observed to be induced by angiotensin 11, K+,TPA, and the calcium channel agonist BAY K 8644 (BAY K) in the H295R human adrenocortical tumor cell line, thereby confirming that StAR expression can be regulated by the Ca2+ signaling pathway as well as the CAMP-dependent second-messenger system (Clark et al., 1995b). Furthermore, a dose-dependent inhibition of steroid production has been observed when AII, K+, or BAY Kstimulated H295R cells are cotreated with a specific inhibitor of Ca2+-CaM-dependent protein kinase I1 (CaM kinase 11) (Pezzi et al.,
416
DOUGLAS M. STOCCO
1996). However, the agonist effect on increased StAR expression was not inhibited. The state of StAR phosphorylation was not addressed in these experiments, but four potential CaM kinase 11 sites are present in StAR's sequence. Cherradi et aZ. (1996) have demonstrated that Ca2+clamping of primary cultures of bovine glomerulosa cells resulted in a cycloheximidesensitive increase in the transfer of cholesterol through mitochondrial contact sites to the inner mitochondrial membrane. It was also demonstrated in a second study (Cherradi et al., 19971, that Ca2+resulted in a cycloheximide-sensitive increase in StAR protein in the inner mitochondrial membrane. Surprisingly, it was further observed that StAR was also present in the contact site region of the submitochondrial fractions as were the first two enzymes of the steroidogenic pathway, P45Oscc and 3P-HSD. These findings confirmed that 3P-HSD, as indicated previously (Cherradi et al., 1994,1995), can be found in the mitochondria as well as in the microsomal compartment. Possible implications of this observation are discussed later. Lastly, the observation that Ca2+ second-messenger systems can result in steroid hormone biosynthesis and expression of StAR has been made by Elliott et al. (1997) and Kim et al. (1997) in both bovine and rat adrenal glomerulosa cells. Thus, in addition to the trophic-hormone-induced CAMPsecond-messenger signaling pathway, it is clear that the StAR gene can be up-regulated by tyrosine kinase activation, estrogen, and Ca2+. OF THE STAR GENE G. NEGATIVE REGULATION
In addition to the many examples of positive regulation of the StAR gene that have been detailed, observations have been made indicating that the StAR gene may undergo negative regulation as well. The transcription factor DAX-1 (for Dosage-sensitive sex reversal; Adrenal hypoplasia congenita; X chromosome; gene 1) is an unusual member of the nuclear hormone receptor family that has been shown to be involved in the related diseases of adrenal hypoplasia congenita (AHC) and hypogonadotropic hypogonadism (HHG) (Zanaria et czl., 1994; Muscatelli et aZ., 1994; Guo et al., 1995; Habiby et al., 1996). Mutations in the human DAX-1 gene have been shown to be responsible for these conditions. In addition, duplication of the X chromosome in the Xp21 region, which houses the DAX-1gene, results in male-to-female sex reversal, a condition known as dosage-sensitive sex reversal (DSS) (Bardoni et al., 1994). The DAX-1 protein, although a member of the nuclear hormone receptor family, retains homology only with the ligand-binding domain
STEROIDOGENIC ACUTE REGULATORY PROTEIN
417
of these receptors. The DNA binding domain lacks canonical zinc-finger motifs and consists of three and one half repeats of a 65-67 amino acid sequence in its N terminus (Zanaria et al., 1994). It has recently been shown that DAX-1 expression can block the synthesis of steroids in Y-1 mouse adrenal tumor cells (Zazopoulos et al., 1997). Further, it has been demonstrated that this block in steroidogenesis can be attributed to an inhibition of the expression of the StAR gene that occurs when excess levels of DAX-1 are present (Zazopoulos et al., 1997). Attempts to demonstrate binding of DAX-1 to double-stranded DNA have been unsuccessful. It has been shown that DAX-1 inhibits StAR gene expression by binding to a hairpin structure in single-stranded DNA which is found in the promotor region of the StAR gene (Zazopoulos et al., 1997). Indeed, the DAX-1 protein has been demonstrated to contain a powerful transcriptional silencing domain in its C-terminal region (Lalli et al., 1997). Thus, it is possible that the observed phenotype in DSS may be due to the excess levels of DAX-1 protein, which would result from the duplication of the Xp21 region of the X chromosome. If true, this would represent a situation in which the negative regulation of the StAR gene had most serious consequences, somewhat analogous to the synthesis of nonfunctional StAR protein, which occurs in lipoid CAH.
H. CHARACTERISTICS OF THE STAR PROTEIN StAR protein sequence is highly conserved with 85438% identity and greater than 90% similarity in the species studied. A summary of the deduced amino acid sequences for the bovine, hamster, human, mouse, ovine, porcine, and rat StAR protein can be seen in Fig. 2. The area of greatest divergence appears to be in the putative mitochondrial signal sequence cleavage site described for the mouse sequence. In this region, the protein contains an amino acid motif that is highly conserved in presequences that undergo a sequential two-step cleavage by the matrix processing protease and the mitochondrial intermediate processing peptide respectively (Hendrick et al., 1989).Although the mechanism for StAR import and processing remains to be directly determined, the submitochondrial localization of StAR has been determined. Protein-A gold labeling of immunoreacted StAR in mouse adrenal zona fasciculata cells and rat ovarian theca cells has determined that StAR protein was concentrated within the mitochondria and was localized to the intermembrane space and the intermembrane space side of the crista membrane (King et al., 1995; Ronen-Fuhrmann et al., 1998).As stated, StAR is synthesized in the cytosol as a larger precursor protein and is
418
DOUGLAS M. STOCCO
Starbovine.Gap Starham.Gap Starhuman.Gap Starmouse.Gap Starovine.Gap Starpor.Gap Starrat .Gap Consensus
1 MLLATFKLCA MLLATFKLCA MLLATFKLCA MFLATFKLCA
GSSYRHvRsM GSSYRHLRNM GSSYRHMRNM GSSYRHMRNM
KGLqqQAVLA KGLRHQAVLA KGLRqQAVMA KGLRHQAVLA
IGQELNRRAL IGQELNRRtL IsQELNRRAL IGQELNWRAL
50 GgPaPaaWIN GdsSPG.WIs GgPtPstWIN GdsSPG.Wmg
..................................................
MLLATFKLCA GSSYRHvRNM KGLRHQAVLA 1GQELNRRAL GgPtsGsWIN MFLATFKLCA GSSYRHMRNM KGLRHQAVLA IGQELNRRAL GdPSPG.Wmg MLLATFKLCA GSSYRHMRNM KGLRHQAVLA IGQELNRRAL G-PSPG-WIN 51 QVRRRgSLLG QVRRRSSLLG QVRRRSSLLG QVRRRSSLLG
SQLEdpLYSD QELahIQQGE SQLEaaLYSE QELSYIQQGE SrLEeTLYSD QELaYlQQGE SQLEaTLYSD QELsYIQQGE
EAMQrALGIL vAMQKALSIL EAMQKALGIL vAMQKALGIL
Starbovine.Gap Starham.Gap Starhuman.Gap Starmouse.Gap Starovine.Gap Starpor.Gap Starrat.Gap Consensus
101 rQaNGDEVLS QQENGDEVLS QQDNGDkVMS QQENGDEVLS rQaNGDEVLS rQENGDEVLS QQENGDEVLS QQENGDEVLS
KVIPDVGKVF KVVPDVGKVF KVVPDVGKVF KmVPDVGKVF KVIPDVGKVF KVIPDVGKVF KWPgVGKVF KWPDVGKVF
RLEVWDQPM RLEVVVDQPM RLEWVDQPM RLEVWDQPM RLEVVVDQPM RLEVVVDQPM RLEVllDQPM RLEVVVDQPM
ERLYEELVER DRLYaELVDR ERLYEELVER DRLYEELVDR ERLYEELVER ERLYEELVER DRLYEELVDR ERLYEELVER
150 MEAMGEWNPN MEAMGEWNPN MEAMGEWNPN MEAMGEWNPN MEAMGEWNPs MEAMGEWNPs MEAMGEWNPN MEAMGEWNPN
Starbovine.Gap Starham.Gap Starhuman.Gap Starmouse.Gap Starovine.Gap Starpor.Gap Starrat.Gap Consensus
151 VKEIKVLQKI VKEIKVLQKI VKEIKVLQKI VKEIKVLQrI VKEIKVLQKI VKkIKILQKI VKEIKVLkKI VKEIKVLQKI
GKDTVITHEL GKDTVITHEL GKDTfITHEL GKDTVITHEL GKDTIITHEL GKDTVITHEL GKDTVITHEL GKDTVITHEL
AAEvAGNLVG AAaAAGNLVG AAEAAGNLVG AAaAAGNLVG AAEAAGNLVG AAEAAGNLVG rAaAAGNLVG AAEAAGNLVG
PRDFVSVRCT PRDFVSVRCa PRDFVSVRCa PRDFVSVRCT PRDFVrVRCT PRDFVSVgCT PRDFVSVRCT PRDFVSVRCT
200 KRRGSmCVLA KRRGSTCVLA KRRGSTCVLA KRRGSTCVLA KRRGSmCVLA KRRGSvCVLA KRRGSTCVLA KRRGSTCVLA
Starbovine.Gap Starham.Gap Starhuman.Gap Starmouse.Gap Starovine.Gap Starpor.Gap Starrat.Gap Consensus
201 GMATlYeEMP GiATHFGEMP GMATdFGnMP GMATHFGEMP GtATlYeEMP GMATdFGEMP GMATHFGEMP GMATHFGEMP
qQKGVIRAEH GPTCMVLrPL AGSPSrTKLT WLLSIDLKGW EQsGVIPAEq GPTCMVLHPL AGSPSKTKFT WLLSIDLKGW EQKGVIRAEH GPTCMVLHPL AGSPSKTKLT WLLSIDLKGW EQsGVIRAEH GPTCMVLHPL AGSPSKTKLT WLLSIDLKGW qQKGVIR ................................. EQKGVIRAEH GPTCMVLHPL AGSPSKTKLT WLLSIDLKGW EQsGVIRAEH GPTCMVLHPL AGSPSKTKLT WLLSIDLKGW EQKGVIRAEH GPTCMVLHPL AGSPSKTKLT WLLSIDLKGW
251 LPKTIINQVL LPKsIINQVL LPKsIINQVL LPKTIINQVL
SQTQVDFANH SQTQmEFANH SQTQVDFANH SQTQIEFANH
Starbovine.Gap Starham.Gap Starhwnan.Gap Starmouse.Gap Starovine.Gap Starpor.Gap Starrat.Gap Consensus
Starbovine.Gap Starham.Gap Starhuman.Gap Starmouse.Gap Starovine.Gap Starpor Gap Starrat.Gap
.
100 kdQEGWKKES SNQEGWKKEn SNQEGWKKES nNQEGWKKES KKEn QVRRRSSLLG SQLEdTFYSD QDLaYIQQGE EAMQrALdIL SNQEGWKKES QVRRRSSLLG SQLEaTLYSD QELsYIQQGE EAMQKALGIL nNQEGWKKES QVRRRSSLLG SQLE-TLYSD QEL-YIQQGE EAMQKALGIL SNQEGWKKES
..............................................
250
LRKRLEScPA LRKRLESSsA LRKRLEShPA LRKRLEaSPA
285 lEARC SEARC SEARC SEAqC
...................................
LPKTIINQVL SQTQVDFANH LRKRLESrPA lEARC LPKTIINQVL SQTQIEFASH LRKRLESSPA SEA@
STEROIDOGENIC ACUTE REGULATORY PROTEIN
419
imported and processed t o its mature form by the mitochondria. The steroidogenically active form of the StAR protein is believed t o be the 37-kDa precursor form of the protein in that it is this form that is present on the cytosolic side of the outer mitochondrial membrane, a position that is thought to be required for its activity in cholesterol transfer. This is discussed in further detail later in this article. Import and processing of the 37-kDa form results in the formation of the 30-kDa intramitochondrial mature form of StAR. In uitro transcription-translation systems have been used to demonstrate that isolated mitochondria are competent t o import and process both mouse and bovine StAR protein. Interestingly, bovine StAR protein can successfully be imported into rat heart mitochondria, indicating import of StAR is not dependent on factors specifically present in steroidogenic tissues (Gradi et al., 1995). This observation is consistent with the results obtained from transfection of both murine and human StAR into COS-1 cells in which it was demonstrated that StAR is imported and processed to its mature form in these cells, which are derived from monkey kidney (Sugawara et al., 1995a; Lin et al., 1995; Stocco and Clark, 1996). It was also found that StAR results in a several-fold increase in steroid synthesis when expressed and imported into mitochondria in COS-1 cells that have been cotransfected with P45Oscc and adrenodoxin (Lin et al., 1995; Sugawara et al., 1995a;Stocco and Clark, 1996). The ability of StAR to increase steroid production has also been confirmed in an in uitro reconstituted system. King et al. (1995) demonstrated that StAR protein when added to mitochondria isolated from MA-10 mouse Leydig tumor cells resulted in a time and dose-dependent increase in pregnenolone synthesis. This stimulation was shown to be specific for StAR in that steroid synthesis was not affected by addition of another protein, adrenodoxin, imported into mitochondria. In yet another interesting experiment, Sugawara et al. (1995b) demonstrated that StAR can stimulate cholesterol metabolism in COS-1 cells cotransfected for expression of the mitochondrial enzyme, cholesterol 27-hydroxylase (CYP27), a P450 enzyme usually found in high abundance in the liver. Therefore, StAR's function to translocate cholesterol across the mitochondrial membrane does not
'hamster, FIG. 2. Comparison of the deduced amino acid sequences of StAR protein from bovine, human, mouse, ovine, porcine and rat (only a partial sequence is presented for ovine). This figure depicts StAR protein from several species from which the cDNA has been cloned and the amino acid sequence deduced. Homologies are at least 84% in all cases. Sources: Bov StAR, Hartung et al.(1995);Ham StAR, Fleury et al. (1996); Hum StAR, Gradi et al. (1995); Mus StAR, (Clark et aZ. (1994); Ovi StAR, Juengel et at. (19951; Por StAR, Pilon et al. (1997); and Rat StAR, Sandhoff and McLean (1996a).
420
DOUGLAS M. STOCCO
appear t o be dependent on the presence of the cytochrome P45Oscc enzyme in the inner mitochondrial membrane. Coupled with the observation demonstrating expression of StAR mRNA in human fetal and adult kidney a broader role for StAR in the cell such as in vitamin D or cholesterol metabolism might be possible.
I. STARAND PHOSPHORYLATION The major signaling pathway in trophic hormone stimulated steroidogenesis involves the activation of protein kinase A by increased CAMPaccumulation. The proposal that a PKA-mediated phosphorylation event is required for StAR expression is supported by data that show StAR is not expressed in hormone-treated rat adrenal or MA-10 mouse Leydig tumor cells, which have incorporated a nonphosphorylated analog of threonine, hydroxynorvaline (HNV),into newly synthesized proteins (Griffin-Green and Orme-Johnson, 1991; Stocco and Clark, 1993). Thus, it appears that a labile protein is rapidly synthesized and phosphorylated on a threonine residue in response to hormone stimulation. The nature of observations on this putative phosphoprotein remains to be determined and unfortunately, when the consensus phosphorylation sites in the StAR protein were determined, no consensus threonine PKA sites were found. Thus, the observations obtained with HNV remain a mystery. Although it is still not known if phosphorylation is an absolute requirement for the transfer of cholesterol into the mitochondria, it is clear that the appearance of the mature 30-kDa proteins would not be observed if import was dependent on phosphorylation of the StAR precursor protein. That phosphorylation is not a requirement for protein import has been demonstrated in experiments in which mitochondrialocalized 30-kDa StAR protein has been detected in its unphosphorylated state by two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)in PMA-treated MA-10 mouse Leydig tumor cells (Chaudhary and Stocco, 1991). In that study, it was importantly observed that while PMA could induce StAR protein expression and import, it resulted in only marginal steroid production, thus indicating that phosphorylation of the StAR protein, although not required for protein import, is required for maximal cholesterol transport to the inner mitochondrial membrane. The observation that StAR is not phosphorylated in response to PMA was confirmed in rat adrenal glomerulosa cells, which are also not steroidogenically active in response to PMA (Hartigan et al., 1995). In contrast, PMA-treated bovine adrenal fasciculata cells do synthesize steroids and when examined by two-di-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
421
mensional PAGE, in this case the StAR protein was phosphorylated (Hartigan et al., 1995). These data would appear to indicate that although phosphorylation of StAR itself may not be required for mitochondrial import, phosphorylation of StAR is directly linked to the steroidogenic response of the cell to hormone stimulation. Caution should be observed, however, in that treatment of both Leydig cells and adrenal fasciculata cells with PMA may not be optimal to activate additional events necessary to support full steroidogenesis such as activation of cholesterol ester hydrolase or cholesterol mobilization to the mitochondria. These events may require the role of an activated PKA. Computer analysis and comparison of the StAR protein sequence from several species whose sequences are known has identified two putative PKA-Cam kinase I1 phosphorylation sites and one PKC phosphorylation site. In an attempt to determine the role of phosphorylation on the steroidogenic capacity of the StAR protein, studies were undertaken to mutate the consensus PKA sites that appear at positions 56-57 and 194-195 in the mouse and human StAR proteins, respectively (Arakane et al., 1997a). Both sites are serines and both were altered by site-directed mutagenesis to produce alanine residues at those sites. Mutation of either site resulted in a decrease in 32Pincorporation into the StAR protein, indicating that these sites were phosphorylated in viva More importantly, transfection of COS-1 cells with the StAR protein containing the serine 56-57 to alanine mutation had no effect on steroidogenesis.Conversely, transfection with the serine 194-195 to alanine mutation resulted in a 50-60% inhibition of steroid biosynthesis. These results indicate that phosphorylation of the StAR protein at position 194-195 can significantlyincrease its biological activity, but is not required for full activity. IV. CONSEQUENCES OF A DISORDERED STAR GENE
A. STAR IN CONGENITAL LIPOIDADRENAL HYPERPLASIA The importance of StAR in the regulation of steroidogenesis has also been dramatically demonstrated in studies on the disease congenital lipoid adrenal hyperplasia. Lipoid CAH is a lethal condition that results from an almost complete inability of the newborn infant to synthesize steroids. The lack of mineralocorticoids and glucocorticoids usually results in death within days to weeks of birth if not detected and treated with adequate steroid hormone and salt replacement therapy. As more lipoid CAH patients are detected, however, it is becoming clear that
422
DOUGLAS M. STOCCO
there exists a heterogeneity in the population of patients suffering from this disease (Boseet al., 1996).This condition is manifested by the presence of large adrenals containing very high levels of cholesterol and cholesterol esters and also by an increased amount of lipid accumulation in testicular Leydig cells. As isolated mitochondria from adrenals and gonads of affected patients cannot convert cholesterol to pregnenolone (Camacho et al., 1968; Degenhart et al., 1972; Koizumi et al., 1977; Hauffa et al., 1983, this disease was originally thought to be due to a mutation of P45Oscc (20,22 desmolase) enzyme activity, which is responsible for this conversion (Degenhart et al., 1972), and this belief had persisted until relatively recent times (Hauffa et al., 1985). However, the gene for this enzyme (Lin et al., 1991)and the P45Oscc protein levels (Sakai et al., 1994) have been shown to be normal in patients afflicted with this disease. Therefore, it was deduced that the defect lies upstream of P45Oscc at the point of cholesterol delivery to the enzyme. During the course of related studies, it was subsequently demonstrated that the mRNA and/or protein levels of other factors that either play a role or that have been purported to play a role in the regulation of steroidogenesis were normal in these patients. These proteins included adrenodoxin, adrenodoxin reductase, steroidogenesis-activator polypeptide (SAP),sterol carrier protein 2 (SCPB), hsp78, the peripheral benzodiazepine receptor (PBR) and its ligand the diazepam-binding inhibitor (DBI) (Lin et al., 1991, 1993). Therefore, it seemed quite possible that lipoid CAH might be due to a defect in StAR expression or function since this protein was a candidate for the acute regulator of cholesterol transfer. In studies designed to determine if StAR might be involved in lipoid CAH, Sugawara et al. (1995a)cloned the human StAR cDNA and demonstrated by Northern blot analysis that StAR mRNA is expressed only in the human adrenal, testis, ovary, and to a lesser extent in the kidney of adult tissues. Importantly, this investigation also demonstrated that StAR was not expressed in the human placenta, an observation highly consistent with it being a candidate for causing lipoid CAH since recent clinical studies have shown that placental steroidogenesis persists in lipoid CAH (Saenger et al., 1995). Indeed, when StAR cDNA was prepared by reverse-transcriptase polymerase chain reaction (RT-PCR) using RNA isolated from testicular tissue of two patients with lipoid CAH, Lin et al. (1995) identified nonsense mutations by sequence analysis. This study represented for the first time an observation of a protein that was altered in LCAH. These mutations, which were confirmed in the genomic DNA, were determined to be C to T transitions and resulted in the premature insertion of stop codons, which, in turn, truncated the StAR protein by either 28 amino acids or
STEROIDOGENIC ACUTE REGULATORY PROTEIN
423
93 amino acids. These truncations were confirmed by Western blot analysis following expression of the mutated cDNAs in COS-1 cells (Lin et al., 1995). Furthermore, although expression of the normal human StAR protein in COS-1 cells resulted in an %foldincrease in steroid production, expression of the StAR cDNA from these patients indicated that the protein produced was completely inactive in its ability to promote steroidogenesis. Finally, the need for StAR activity could be circumvented by using freely diffusable 20a-hydroxycholesterol as a substrate for steroidogenesis,indicating that the other components of the steroid-producingmachinery were functional in this system (Lin et al., 1995;Miller, 1995).Apatient sufferingfrom a milder form of lipoid CAH was also shown to have a mutation in the StAR gene (Tee et al., 1995). In this patient, cloned genomic DNA was found to have a T to A transversion in intron 4, 11bp from the splice acceptor site of exon 5 in the StAR gene. This transversion resulted in the finding that although most of the StAR mRNA in this patient was abnormally spliced and nonfunctional, a small percentage was in fact normal StAR mRNA and thus resulted in a milder form of the disease. In addition to the first reports on StAR mutations causing lipoid CAH, many additional examples of mutations in StAR resulting in this disease have been reported (Bose et al., 1996,1997; Fujieda et al., 1997;Nakae et al., 1997; Okuyama et al., 19971, and perhaps it is not as rare as previously thought. This disease seems to affect people of Japanese and Palestinian ancestry disproportionately,and one estimate places the carrier rate for the most common mutation in the Japanese population to be 1in 200 (Bose et al., 1996).A synopsis of the data on lipoid CAH and mutations in the StAR gene has been compiled (Bose et al., 1996).This report also indicates that many of the mutations in the StAR gene leading to lipoid CAH can be diagnosed using specific restriction endonucleases, a contribution that is certain to have a significant clinical impact. Interestingly, this same article discusses the intriguing possibility that steroidogenic cells possess both StAR-dependent and StAR-independent steroid production, a concept also raised by other investigators (Clark et al., 1997; Caron et al., 1997b) and much deserving of further investigation. In fact, this hypothesis would seem to be borne out clinically in that several female patients with 46, XX have now been described who underwent spontaneous puberty, indicating that some degree of StAR-independent ovarian steroidogenesis can occur in lipoid CAH patients (Bose et al., 1996; Fujieda et al., 1997). With the knowledge that mutations in the StAR gene cause lipoid CAH and the concomitant availability of reagents to study and test for this potentially lethal disease, a great deal of interest has been rekin-
424
DOUGLAS M. STOCCO
dled in this condition, which is essentially a human StAR knockout model. As such, a number of review articles on the subject have been written (Miller, 1997, 1998; Arakane et al., 199713; Saenger, 1997). To date, with only one exception (patient 14 in Bose et al., 19961,mutations in the StAR gene are the only reported causes of this potentially lethal disease, and have clearly demonstrated the indispensable role of StAR in the production of steroids. B. THESTAR KNOCKOUT MOUSE The observation that mutations in the StAR gene resulted in lipoid CAH produced compelling evidence for the essential role of this protein in the acute regulation of steroidogenesis. However, it is not possible to perform many desirable studies on this syndrome given the fact that the disease occurs in humans, thus limiting the availability of tissue and experimental paradigms that can be tested. Therefore, an obvious strategy was to produce a knockout of the StAR gene in an animal system with the goal of having a model system to study this interesting protein. With this goal in mind, Caron et al. (1997b) used targeted disruption of the StAR gene in mice to successfully produce StAR knockout mice. Initial observations of these mice have indicated that regardless of genotype, all mice have female external genitalia, as seen in the human. Following birth, all animals failed to grow normally and death occurred within a short period of time, presumably as a result of adrenocortical insufficiency. This was confirmed by the observation that serum levels of corticosterone and aldosterone were depressed while levels of ACTH and corticotropin-releasing hormone (CRH) were elevated. These observations indicated an impairment in the production of adrenal steroids with an accompanying loss of feedback regulation at the level of the hypothalamus or pituitary. Microscopic inspection of the adrenal gland revealed a normal medulla but an abnormal cortex, having a disrupted fascicular zone. Specific staining procedures revealed elevated lipid deposits in the adrenal cortex region of the StAR knockout mouse. Although the StAR knockout mice were all phenotypically sex reversed, the testes of these animals appeared normal on gross inspection. However, once again specific staining indicated the presence of elevated levels of lipid within this organ. In contrast, the ovaries of the StAR knockout mice were essentially indistinguishable from wildtype animals, a similar situation as found with human StAR mutations (Bose et al., 1996, 1997; Fujieda et al., 1997). The availability of the StAR knockout mouse should greatly expedite important studies that
STEROIDOGENIC ACUTE REGULATORY PROTEIN
425
can be performed on this protein within the milieu of an intact endocrine system.
V. PUTATIVEMECHANISMOF ACTIONOF STAR As a result of the studies outlined earlier, it would appear to be clear that StAR has a critical function in the acutely regulated transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Since the mechanism of this transfer is of considerable interest, a model was earlier proposed whereby StAR may act in the transfer of cholesterol to the P45Oscc and appeared in a previous review (Stocco and Clark, 1996). It was proposed that in response to hormone stimulation, the StAR 37-kDa precursor protein was rapidly synthesized in the cytosol and was quickly targeted to the mitochondria via its signal sequence. It was further proposed that as the precursor protein was being imported into the mitochondrial inner compartment and processed, contact sites between the inner and outer membranes were formed. During this time, the signal sequence and targeting sequence were sequentially removed by the matrix processing protease and the mitochondrial intermediate processing peptide resulting in the appearance of the 30-kDa mature form of the protein. StAR then remained associated with either the inner mitochondrial membrane or the intermembrane compartment (King et al., 1995). This model further proposed that during the processing of the protein with the accompanying formation of contact sites, cholesterol was transfered from the outer to the inner mitochondrial membrane (Reinhart, 1990; Jefcoate et al., 1992; Epstein and Orme-Johnson, 1991b; Stocco and Sodeman, 1991) and hence, was available to the P45Oscc for pregnenolone synthesis. After processing, it was proposed that the membranes separated and no further cholesterol transfer could occur without additional synthesis and processing of StAR precursor proteins. Since the half-life of the precursors of the 30-kDa mitochondrial proteins have been shown to be very short (Epstein and Orme-Johnson, 1991b),this would explain the observation that steroidogenesis decays very quickly in the absence of new protein synthesis. The fact that StAR was found to be localized to the mitochondria coupled with the observation that the transport of mitochondrial proteins across the membranes occurs at contact sites (Schwaiger et al., 1987; Vestweber and Schatz, 1988; Rassow et al., 1989; Pon et al., 1989; Pfanner et al., 1990; Hwang et al., 1991) made
426
DOUGLAS M. STOCCO
this a viable model. A model similar to the one just discussed was first suggested by Stevens et al. (1985), who demonstrated that stress-induced ACTH secretion resulted in a dramatic alteration in mitochondrial structure in rat adrenal tissue in which the volume of the matrix compartment increased but not that of the total mitochondrial volume. This resulted in the outer and inner mitochondrial membranes being brought closer together, a condition that may facilitate the exchange of cholesterol and hence increased steroidogenesis. However, reports by Strauss and colleagues (Arakane et al., 1996), have indicated that a revision of this model is required. It has been shown that N-terminal truncations of the StAR protein, which remove as many as 62 amino acids, have no inhibitory effect on steroid production in COS-1 cells transfected with the cDNAs containing the truncations. Western blot analysis and immunostaining for StAR protein indicated that the truncated StAR protein was not imported into the mitochondria. Therefore, it appears that import of the StAR protein is not required for cholesterol transfer to the inner mitochondrial membrane. On the other hand, truncation of the C terminus by 10 amino acids resulted in a decrease in steroid production of 50%, whereas a 28amino-acid truncation resulted in a complete loss of steroid production (Arakane et al., 1996). Thus, it appears that the C-terminal region of the StAR protein is extremely important in cholesterol transfer. This observation could have perhaps been predicted from the observation that all mutations in lipoid CAH have been shown to be in the C-terminal region of the StAR protein. That some of these mutations are single point mutations indicates the powerful role that this portion of the molecule must play in cholesterol transfer (Bose et al., 1996,1997; Fujieda et al., 1997; Nakae et al., 1997; Okuyama et al., 1997). A further indication of the importance of the C-terminal region of the StAR protein in cholesterol transfer can be seen in exciting findings recently reported by Watari et al. (1997). In this study, these investigators report the steroidogenic properties of a protein known as MLN64, which has significant homology to the C-terminal region of StAR. This protein was originally described as a gene product of unknown function that was highly expressed in specific breast tumors (Bieche et al., 1996; MoogLutz et al., 1997). Importantly, expression of the MLN64 protein in COS-1 cells resulted in a 2-fold increase in steroid production, and removal of N-terminal sequences resulted in a further increase in steroid production. Proteins having similar homologies to the C-terminal region of StAR and MLN64 were also found in Caenorhabditis elegans and were proposed to be as much as 600 million years old. Perhaps these proteins represent cellular proteins whose function was to aid in
STEROIDOGENIC ACUTE REGULATORY PROTEIN
42 7
the trafficking of sterols within the cell. The relationship between StAR and MLN64 as well as the role of MLN64 in the cell remain to be determined, and, hopefully, useful information concerning sterol movement in the cell will be obtained. Thus, regions in the C-terminal portion of the StAR protein would appear to be of great importance in implementing the transfer of cholesterol to the inner mitochondrial membrane. Yet another gene, termed CAB1, was recently isolated from gastric and esophageal cancer cell lines and was shown to have considerable homology to the StAR gene (Akiyama et al., 1997). The significance of the homology between the StAR and CAE31 genes is unknown at this point in time, but it was speculated that perhaps CAB1 might be involved in tumor development through estrogen or some other steroid and that overexpression of the CAB1 gene might facilitate steroid production in these cancer cells (Akiyama et al., 1997). Although the mechanism of action of the StAR protein is still unknown, it is becoming increasingly clear that cholesterol transfer requires that it interact with as yet unknown proteins and/or other factors on the outside of the outer mitochondrial membrane and produce alterations that result in cholesterol transfer. This model could still incorporate the formation of contact sites between the two membranes, and the idea of specific protein-protein interactions forming hydrophobic channels through which cholesterol can move also remains a possibility. It is further possible that the import of StAR into the inner mitochondrial compartments, which is known to occur with “normal” StAR, may be the “off switch” for steroidogenesis by removing StAR from its position on the outer membrane and cutting off the flow of cholesterol (Arakane et al., 1996; Clark and Stocco, 1997). To further complicate this area, King and Stocco (1996) have shown that both steroid production and StAR synthesis require the presence ofATP and an electrochemical gradient across the inner mitochondrial membrane, a condition shown to be required for mitochondrial preprotein import. Therefore, much remains to be determined concerning the mechanism whereby StAR can effect cholesterol transfer to the inner mitochondria1 membrane. In this regard, the identification of the components with which StAR interacts on the outer mitochondrial membrane becomes of critical importance in understanding its mechanism of action. Although import of StAR does not appear to be an absolute requirement for cholesterol transfer, the finding that import of other mitochondrial proteins does not induce steroidogenesis and that expression of StAR can directly increase steroid output would suggest a specificity between StAR import and cholesterol transport. In this light, it is especially intriguing that earlier observations have demonstrated that
428
DOUGLAS M. STOCCO
mitochondrial contact sites in bovine adrenocortical cells contain the first two enzymes in the steroidogenic pathway, P45Oscc and 3P-HSD (Cherradi et al., 1994,1995,1997). Thus, it is tempting to further spec-
3
2 1)
N-terrnlnus
2)
Ctermlnus In cholesterol transport?
memb
chol converted t o progesterone which leaves MI
1
Mat rlx mot
ROC
leaves slg seq)
receptor
( f unct Ion??)
FIG.3. Putative model for the transfer of cholesterol: The model in this figure represents a putative mechanism whereby StAR functions. On stimulation of the steroidogenic cell with trophic hormone, the 37-kDa StAR protein precursor is rapidly synthesized in the cytoplasm. This precursor is accompanied by chaperone proteins, which prohibit folding of the precursor, a condition that would make import of the protein into the mitochondrion impossible. The 37-kDa protein is then transported to the mitochondria where the insertion process begins. At some point, either prior to the start of import, or simultaneously with it, sequences in the C-terminal portion of the StAR protein interact with as-yet-unidentified components of the outer mitochondrial membrane and result in cholesterol transfer to the inner mitochondrial membrane. The subsequent cleavage of the precursor protein by the matrix-processing protease results in the formation of the mature 30-kDa form of the StAR protein. Once import of the StAR protein is complete, it is no longer in contact with the outer membrane and further transfer of cholesterol is stopped. Thus, it is the continuous synthesis and processing of precursor StAR to mature StAR, with the continual interaction between the C-terminal part of StAR and the outer mitochondrial membrane, that is responsible for cholesterol transfer. The nature of the components with which StAFt interacts on the outer membrane are unknown, and perhaps PBR and SAP may be involved at this site. Also, observations have shown that the mitochondrial contact sites and inner membranes are enriched for the first two enzymes in the steroidogenic pathway, namely, P45Oscc and 3 p hydroxysteroid dehydrogenase, raising the interesting possibility that cholesterol entering the mitochondria may leave as progesterone and not pregnenolone.
STEROIDOGENIC ACUTE REGULATORY PROTEIN
429
ulate that the interaction of StAR with the mitochondria may cause the formation of a protein complex consisting of P45Oscc and 3P-HSD, the enzymes required for the first two steps in steroidogenesis. In this manner, cholesterol that enters the inner mitochondrial membrane via the action of StAR could quickly be converted to progesterone, as speculated in an earlier study (Cherradi et al., 1995). The possibility that P45Oscc, 3P-HSD, and StAR may all be associated in the same contact sites in steroidogenic cells is supported by the observations of Cherradi et al. (19971, which demonstrated by immunoblot analysis that all three proteins, P45Oscc, 3P-HSD, and StAR, were found in contact sites isolated from mitochondria of hormone-stimulatedbovine glomerulosa cells. It is also possible that the outer mitochondrial membrane protein the peripheral benzodiazepine receptor, which has been shown to play a key role in steroidogenesis, is also involved in the recognition of StAR by the outer mitochondrial membrane (reviewed in Papadopoulos, 1993; Papadopoulos et al., 1996). In addition, it is not yet known what, if any, specific role the steroidogenesis-activatorpolypeptide may play in this process (Pedersen and Brownie, 1983, 1987; Pedersen, 1987). However, at this time these hypotheses are purely speculative and further studies are necessary to confirm the exact relationship between StAR, P45Oscc, 3P-HSD, PBR, SAP,and perhaps additional proteins in the mitochondrial membranes. Figure 3 illustrates a number of factors that may be involved in cholesteroltransport to the inner mitochondrial membrane and their potential interactions with each other.
VI. CONCLUSIONS In summary, the demonstrated characteristics of the StAR protein observed to date make it the most attractive candidate available for the long-sought hormone-stimulated protein factor responsible for acutely regulating the transfer of cholesterol from the outer to the inner mitochondrial membrane, and thus acutely regulating steroid hormone biosynthesis. Additional proteins are unquestionably involved and required in this transfer, but no strong evidence indicates that they are regulatory in nature. Therefore, perhaps the most interesting studies concerning StAR will be to determine the highly specific mechanism whereby StAR is able to effect the transfer of cholesterol to the inner mitochondrial membrane and the P45Oscc. The mechanism of action of StAR in transferring cholesterol to the inner mitochondrial membrane and the roles of other proteins such as P45Oscc, 3P-HSD, PBR, SAP, and perhaps as-yet-unidentifiedmitochondrial proteins remain to be deter-
430
DOUGLAS M. STOCCO
mined and as such should prove to be some of the most interesting questions for the future as the picture of the acute regulation of steroidogenesis continues to unfold. A number of the players appear to be known. Now the challenge is to determine how they work in concert with one another. ACKNOWLEDGMENTS The author would like to acknowledge the support of National Institutes of Health grant HD 17481. He would also like to acknowledge the contributions of Drs. Barbara Clark, Xing Jia Wang, and Zhiming Liu and Ms. Deborah Alberts and Mr. Steven King during the course of this work. REFERENCES Akiyama, N., Sasaki, H., Ishizuka, T., Kishi, T., Sakamoto, H., Onda, M., Hirai, H., Yazaki,Y., Sugimura, T., and Terada, M. (1997). Isolation of a candidate gene, CABI, for cholesterol transport to mitochondria from the c-ERBB-2 amplicon by a modified cDNA selection method. Cancer Res. 57,3548-3553. Alberta, J., Epstein, L. F., Pon, L. A., and Orme-Johnson, N. R. (1989). Mitochondria1 localization of a phosphoprotein that rapidly accumulates in adrenal cortex cells exposed to adrenocorticotropic hormone or to CAMP.J. Biol. Chem. 264,2368-2372. Arakane, F., Sugawara, T., Nishino, H., Liu, Z., Holt, H. A., Pain, D., Stocco, D. M., Miller, W. L., and Strauss, J. F. (1996). Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondria1 import sequence: Implications for the mechanism of StAFt action. Proc. Natl. Acad. Sci. U.S.A. 93,13731-13736. Arakane, F., King, S. R., Du, Y., Kallen, K. B., Walsh, L. P., Watari, H., Stocco, D. M. and Strauss, J. F., I11 (1997a). Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates steroidogenic activity. J . Biol. Chem. 272,32656-32662. Arakane, F., Sugawara, T., Kiriakidou, M., Kallen, C. B., Watari, H., Christenson, L. K., and Strauss, J. F., I11 (1997b). Molecular insights into the regulation of steroidogenesis from laboratory to clinic and back. Hum. Reprod. 12,(Natl. Suppl.), 46-50. Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A,, Silvennoinen, O., Ihle, J. N., and Carter-Su, C. (1993). Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell (Cambridge, Mass.) 74,237-244. Arthur, J. R., and Boyd, G. S. (1976). The effect of inhibitors of protein synthesis on cholesterol side-chain cleavage in the mitochondria of luteinized rat ovaries. Eur. J. Biochem. 49,117-127. Balasubramanian, K., LaVoie, H. A., Garmey, J. C., Stocco, D. M., and Velduis, J. D. (1997). Regulation of porcine granulosa cell steroidogenic acute regulatory protein (StAR)by insulin-like growth factor I: Synergism with follicle-stimulating hormone or protein kinase A agonist. Endocrinology (Baltimore) 138,433-439. Bardoni, B., Zanaria, E., Guioli, S., Floridia, G., Worley, K. C., Tonini, G., Ferrante, E., Chiumello, G., McCabe, E. R. B., Fraccaro, M., Zuffardi, O., and Camerino, G. (1994). A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal. Nut. Genet. 7,497-501. Bieche, I., Tomasetto, C., Regnier, C. H., Moog-Lutz, C., Rio, M. C., and Lidereau, R. (1996). Two distinct amplified regions a t 17qll-q21 involved in human primary breast cancer. Cancer Res. 66,3886-3890. Bose, H. S., Sugawara, T., Strauss, J. F., 111, and Miller, W. L. (1996). The pathophysiol-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
431
ogy and genetics of congenital lipoid adrenal hyperplasia. N. Engl. J. Med. 335, 1870-1878. Bose, H. S., Pescovitz, 0. H., and Miller, W. L. (1997). Spontaneous feminization in a 46,XX female patient with congenital lipoid adrenal hyperplasia due to a homozygous frameshift mutation in the steroidogenic acute regulatory protein. J. Clin. En-
docrinol. Metab. 82,1511-1515. Bosmann, H. B., Hales, K. H., Li, X., Liu, Z., Stocco, D. M., and Hales, D. B. (1996). Endotoxemia causes a dramatic and abrupt decrease in circulating testosterone levels. Endocrinology (Baltimore) 137,4522-4525. Brownie, A. C., Simpson, E. R., Jefcoate, C. R., Boyd, G. S., Orme-Johnson, W. H., and Beinert, H. (1972). Effect ofACTH on cholesterol side-chain cleavage in rat adrenal mitochondria. Biochem. Biophys. Res. Commun. 46,483-490. Brownie, A. C., Alfano, J., Jefcoate, C. R., Orme-Johnson, W., Beinert, H., and Simpson, E. R. (1973). Effect of ACTH on adrenal mitochondrial cytochrome P-450 in the rat. Ann. N.Y; Acad. Sci. 212,344-360. Camacho, A. M., Kowarski, A., Migeon, C. J., and Brough, A. J. (1968). Congenital adrenal hyperplasia due to a deficiency of one of the enzymes involved in the biosynthesis of pregnenolone. J. Clin. Endocrinol. Metab. 28,153-161. Caron, K. M., Ikeda, Y.,Soo, S. C., Stocco, D. M., Parker, K. L., and Clark, B. J. (1997a). Characterization of the promoter region of the mouse gene encoding the steroidogenic acute regulatory protein. Mol. Endocrinol. 11,138-147. Caron, K. M., Soo, S. C., Wetsel, W. C., Stocco, D. M., Clark, B. J., and Parker, K. L. (1997b). Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc. Natl. Acad, Sci. U.S.A. 94,11540-11545. Chapman, J. C., Waterhouse, T. B., and Michael, S. D. (1992). Changes in mitochondrial and microsomal 3p-hydroxysteroid dehydrogenase activity in mouse ovary over the course of the estrous cycle. Biol. Reprod. 47,992-997. Chaudhary, L. R., and Stocco, D. M. (1991). Effect of different steroidogenic stimuli on protein phosphorylation in MA-10 mouse Leydig tumor cells. Biochim. Biophys. Acta 1094,175-184. Cherradi, N., Defaye, G., and Chambaz, E. M. (1994). Characterization of the 3P-hydroxysteroid dehydrogenase activity associated with bovine adrenocortical mitochondria. Endocrinology (Baltimore) 134,1358-1364. Cherradi, N., Chambaz, E. M., and Defaye, G. (1995). Organization of 3P-Hydroxysteroid dehydrogenase/isomerase and cytochrome P-45Oscc into a catalytically active molecular complex in bovine adrenocortical mitochondria. J. Steroid Biochem. Mol. Biol. 55,507-514. Cherradi, N., Rossier, M. F., Vallotton, M. B., and Capponi, A. M. (1996). Calcium stimulates intramitochondrial cholesterol transfer and StAR protein in bovine adrenal glomerulosa cells. J. Biol. Chem. 271,25971-25975. Cherradi, N., Rossier, M. F., Vallotton, M. B., Timberg, R., Friedberg, I., Orly, J., Wang, X. J., Stocco,D. M., and Capponi, A. M. (1997). Submitochondrial distribution ofthree key steroidogenic proteins (steroidogenic acute regulatory progein, P450 side-chain cleavage and 3B-hydroxysteroid dehydrogenase isomerase enzymes) upon stimulation by intracellular calcium in adrenal glomerulosa cells. J . Biol. Chem. 272, 7899-7907. Choi, Y.S., Stocco, D. M., and Freeman, D. A. (1995). Diethylumbelliferyl phosphate inhibits steroidogenesis by interfering with a long-lived factor acting between protein
432
DOUGLAS M. STOCCO
kinase A activation and induction of the steroidogenic acute regulatory (StAR) protein. Eur. J. Biochem. 234,680-685. Churchill, P. F., and Kimura, T. (1979). Topological studies of cytochromes P45Oscc and P45011p in bovine adrenocortical inner mitochondrial membranes. J. Biol. Chem. 254,10443-10448. Clark, B. J., and Stocco, D. M. (1997). Steroidogenic acute regulatory protein. The StAR still shines brightly. Mol. Cell. Endocrinol. 134, 1-8. Clark, B. J., Wells, J., King, S. R., and Stocco, D. M. (1994). The purification, cloning, and expression of a novel LH-induced mitochondrid protein in MA-10 mouse Leydig tumor cells: characterization of the steroidogenic acute regulatory protein (StAR).J . Biol. Chem. 269,28314-28322. Clark, B. J., Soo, S. C., Caron, K. M., Ikeda, Y., Parker, K. L., and Stocco, D. M. (1995a). Hormonal and developmental regulation of the steroidogenic acute regulatory ( S t A R ) protein. Mol. Endocrinol. 9,1346-1355. Clark, B. J., Pezzi, V., Stocco, D. M., and Rainey, W. E. (199513). The steroidogenic acute regulatory protein is induced by angiotensin I1and K+ in H295R adrenocortical cells. Mol. Cell. Endocrinol. 115,215-219. Clark, B. J., Combs, R., Hales, K. H., Hales, D. B., and Stocco, D. M. (1997). Inhibition of transcription affects the synthesis of the steroidogenic acute regulatory protein (StAR) and steroidogenesis in MA-10 mouse Leydig tumor cells. Endocrinology (Baltimore) 138,4893-4901. Cooke, B. A., Janszen, F. H. A., Clotscher, W. F., and van der Molen, H. J. (1975). Effect of protein-synthesis inhibitors on testosterone production in rat testis interstitial tissue and Leydig-cell preparations. Biochem. J. 150,413-418. Crivello, J. F., and Jefcoate, C. R. (1978). Mechanism of corticotropin action in rat adrenal cells. 1. Effect of inhibitors of protein synthesis and of microfilament formation on corticosterone synthesis. Biochim. Biophys. Acta 542,315-329. Crivello, J. F., and Jefcoate, C. R. (1980). Intracellular movement of cholesterol in rat adrenal cells. J. Biol. Chem. 255,8144-8151. Davis, W. W., and Garren, L. D. (1966). Evidence for the stimulation by adrenocorticotropic hormone of the conversion of cholesterol esters to cholesterol in the adrenal, in uiuo. Biochem. Biophys. Res. Commun. 24,805-810. Davis, W. W., and Garren, L. D. (1968). On the mechanism of action of adrenocorticotropic hormone. The inhibitory site of cycloheximide in the pathway of steroid biosynthesis. J. Biol. Chem. 243,5153-5157. Degenhart, H. J., Visser, H. K. A., Boon, H., and ODoherty, N. J. (1972). Evidence for deficient 20u-cholesterol-hydroxylaseactivity in adrenal tissue of a patient with lipoid adrenal hyperplasia. Acta Endocrinol (Copenhagen) 71,512-518. Elliott, M. E., Goodfriend, T.L., and Jefcoate, C. R. (1993). Bovine adrenal golmerulosa and fasciculata cells exhibit 28.5-kilodalton proteins sensitive to angiotensin, other agonists, and atrial natriuretic peptide. Endocrinology (Baltimore) 133, 16691677. Elliott, M. E., Goodfriend, T. L., Ball, D. L., and Jefcoate, C. R. (1997). Angiotensin-responsive adrenal glomerulosa cell proteins: Characterization by protease mapping, species comparison, and specific angiotensin receptor antagonists. Endocrinology (Baltimore) 138,2530-2536. Epstein, L. F., and Orme-Johnson, N. R. (1991a). Acute action of luteinizing hormone on mouse Leydig cells: Accumulation of mitochondrial phosphoproteins and stimulation of testosterone biosynthesis. Mol. Cell. Endocrinol. 81, 113-126. Epstein, L. F., and Orme-Johnson, N. R. (1991b). Regulation of steroid hormone biosyn-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
433
thesis: Identification of precursors of a phosphoprotein targeted to the mitochondrion in stimulated rat adrenal cortex cells. J. Biol, Chem. 266, 19739-19745. Farese, R. V. (1967).Adrenocorticotrophin-induced changes in the steroidogenic activity of adrenal cell-free preparations. Biochemistry 6,2052-2065. Farese, R. V., and Prudente, W. J. (1977). On the requirement for protein synthesis during corticotropin-induced stimulation of cholesterol side chain cleavage in rat adrenal mitochondrial and solubilized desmolase preparations. Biochim. Biophys. Acta 496,567-570. Ferguson, J. J. (1962). Puromycin and adrenal responsiveness to adrenocorticotropic hormone. Biochim. Biophys. Acta 57,616-617. Ferguson, J. J. (1963).Protein synthesis and adrenocorticotropin responsiveness. J. Biol. Chem. 238,2754-2759. Fleury, A., Cloutier, M., Ducharme, L., Lefebvre, A., LeHoux, J., and LeHoux, J. G. (1996). Hamster adrenal acute regulatory rotein cDNA Its characterization and regulation of its expression by ACTH. Endocl: Res. 22,515-520. Fujieda, K., Tajima, T., Nakae, J., Sageshima, S., Tachibana, K., Suwa, S., Sugawara, T., and Strauss, J. F., I11 (1997). Spontaneous puberty in 46,XX subjects with congenital lipoid adrenal hyperplasia. J. CEin. Znuest. 99,1265-1271. Garren, L. D. (1968). The mechanism of action of adrenocorticotropic hormone. Vitamin. Horm. (N.Y) 26,119-145. Garren, L. D., Ney, R. L., and Davis, W. W. (1965). Studies on the role of protein synthesis in the regulation of corticosterone production by ACTH in uiuo. Proc. Natl. Acad. Sci. U.S.A. 53,1443-1450. Garren, L. D., Davis, W. W., and Crocco, R. M. (1966). Puromycin analogs: Action of adrenocorticotropic hormone and the role of glycogen. Science 152,1386-1388. Garren, L. D., Gill, G. N., Masui, H., and Walton, G. M. (1971). On the mechanism of action ofACTH. Recent Prog. Horm. Res. 27,433-478. Gradi, A., Tang-Wai, R., McBride, H. M., Chu, L. L., Shore, G. C., and Pelletier, J. (1995). The human steroidogenic acute regulatory (StAR) gene is expressed in the urogenital system and encodes a mitochondrial polypeptide. Biochim. Biophys. Acta 1258, 228-233. Griffin Green, E., and Orme-Johnson, N. R. (1991). Inhibition of steroidogenesis in rat adrenal cortex cells by a threonine analog. J. Steroid Biochem. Mol. Biol. 40, 421-429. Guo, W., Mason, J. S., Stone, C. G., Morgan, S. A., Madu, S. I., Baldini, A., Lindsay, E. A., Biesecker, L. G., Copeland, K. C., Horlick, M. N. B., Pettigrew,A. L., Zanaria, E., and McCabe, E. R. B. (1995). Diagnosis of X-linked adrenal hypoplasia congenita by mutation analysis of the DAX-1 gene. JAMA, J. Am. Med. Assoc. 274,324-330. Gwynne, J. T., and Mahaffee, D. D. (1989). Rat adrenal uptake and metabolism of high density lipoprotein cholesteryl ester. J. Biol. Chem. 264,8141-8150. Habiby, R. L., Boepple, F!, Nachtigall, L., Sluss, P. M., Crowley, W.F., Jr., and Jameson, J. L. (1996). Adrenal hypoplasia congenita with hypogonadotropic hypogonadism. Evidence that DAX-1 mutations lead to combined hypothalamic and pituitary defects in gonadotropin production. J. Clin. Znuest. 98, 1055-1062. Hanukoglu, I., and Hanukoglu, Z. (1986). Stoichiometry of mitochondrials, cytochromes P450, adrenodoxin and adrenodoxin reductase in adrenal cortex and corpus luteum. Eur. J. Biochem. 157,27-31. Harikrishna, J.A., Black, S. M., Szklarz, G. D., and Miller, W. L. (1993). Construction and function of fusion enzymes of the human cytochrome P45Oscc system. DNA Cell Biol. 12.371-379.
434
DOUGLAS M. STOCCO
Hartigan, J. A., Green, E. G., Mortensen, R. M., Menachery, A., Williams, G. H., and Orme-Johnson, N. R. (1995). Comparison of protein phosphorylation patterns produced in adrenal cells by activation of CAMP-dependent protein kinase and Ca-dependent protein kinase. J. Steroid Biochem. Mol. Biol. 53,l-6. Hartung, S., Rust, W., Balvers, M., and Ivell, R. (1995). Molecular cloning and in uiuo expression of the bovine steroidogenic acute regulatory protein. Biochem. Biophys. Res. Commun. 215,646-653. Hauffa, P. T., Miller, W. L., Grumbach, M. M., Conte, F. A., and Kaplan, S. L. (1985). Congenital adrenal hyperplasia due to deficient cholesterol side-chain cleavage activity (20,22-desmolase) in a patient treated for 18 years. Clin. Endocrinol. 23,481-493. Haynes, R., Savard, K., and Dorfman, R. I. (1952). An action of ACTH on adrenal slices. Science 116,690-691. Hechter, O., Zaffaroni, A., Jacobsen, R. P., Levy, H., Jeanloz, R. W., Schenker, V., and PinCUB,G. (1951). The nature and the biogenesis of the adrenal secretory product. Recent Prog. Horm. Res. 6,215-246. Hendrick, J. P., Hodges, P. E., and Rosenberg, L. E. (1989). Survey of amino-terminal proteolytic cleavage sites in mitochondrial precursor proteins: Leader peptides cleaved by two matrix proteases share a three amino acid motif. Proc. Natl. Acad. Sci. U.S.A. 86,4056-4060. Huang, B. M., Stocco, D. M., Hutson, J. C., and Norman, R. L. (1995). Corticotropin-releasing hormone (CRH) stimulates steroidogenesis in mouse Leydig cells. Biol. Reprod. 53,620-626. Huang, B. M., Stocco, D. M., Li, P. H., Yang, H. Y., Wu, C. M., and Norman, R. L. (1997). Corticotropin-releasing hormone stimulates the expression of the steroidogenic acute regulatoly protein in MA-10 cells. Biol. Reprod. 57,547-551. Hwang, S. T., Wachter, C., and Schatz, G. (1991). Protein import into the yeast mitochondrial matrix: A new translocation intermediate between the two mitochondrial membranes. J. Biol. Chem. 266,21083-21089. Janszen, F. H. A,, Cooke, B. A., van Driel, M. J. A., and van der Molen, H. J. (1976). LH induction of a specific protein (LH-IP) in rat testis Leydig cells. FEBS Lett. 71, 269-272. Janszen, F. H. A., Cooke, B. A., and van der Molen, H. J. (1977). Specific protein synthesis in isolated rat testis Leydig cells. Influence of luteinizing hormone and cycloheximide. Biochem. J . 162,341-346. Jefcoate, C. R., DiBartolomeos, M. J., Williams, C. A., and McNamara, B. C. (1987).ACTH regulation of cholesterol movement in isolated adrenal cells. J. Steroid Biochem. 27, 721-729. Jefcoate, C. R., McNamara, B. C., Artemenko, I., and Yamazaki, T. (1992). Regulation of cholesterol movement to mitochondrial cytochrome P45Oscc in steroid hormone synthesis. J. Steroid Biochem. Mol. Biol. 43, 751-767. Juengel, J. L., Meberg, B. M., Turzillo, A. M., Nett, T. M., and Niswender, G. D. (1995). Hormonal regulation of messenger ribonucleic acid encoding steroidogenic acute regulatory protein in ovine corpora lutea. Endocrinology (Baltimore) 136, 5423-5429. Karaboyas, G . C., and Koritz, S. B. (1965). Identity of the site of action of CAMP and ACTH in corticosteroidogenesis in rat adrenal and beef adrenal cortex slices. Biochemistry 4,462-468. Khanna, A., Aten, R. F., and Behrman, H. R. (1994). Heat shock protein induction blocks hormone-sensitive steroidogenesis in rat luteal cells. Steroids 59,4-9. Khanna, A,, Aten, R. F., and Behrman, H. R. (1995). Physiological and pharmacological inhibitors of luteinizing hormone-dependent steroidogenesis induce heat shock protein-70 in rat luteal cells. Endocrinology (Baltimore) 136, 1775-1781.
STEROIDOGENIC ACUTE REGULATORY PROTEIN
435
Kim,Y. C., Ariyoshi, N., Artemenko, I., Elliott, M. E., Bhattacharyya, K. K., and Jefcoate, C. R. (1997). Control of cholesterol access to cytochrome P45Oscc in rat adrenal cells mediated by regulation of the steroidogenic acute regulatory protein. Steroids 62, 10-20. King, S. K., and Stocco, D. M. (1996). ATP and a mitochondrial electrochemical gradient are required for functional activity of the steroidogenic acute regulatory (StAR) protein in isolated mitochondria. Endocr. Res. 22,505-514. King, S. R., Ronen-Fuhrmann, T., Timberg, R., Clark, B. J., Orly, J., and Stocco, D. M. (1995). Steroid production after in uitro transcription, translation, and mitochondrial processing of protein products of complementary deoxyribonucleic acid for steroidogenic acute regulatory protein. Endocrinology (Baltimore) 136,5165-5176. Kiriakidou, M., McAllister, J . M., Sugawara, T., and Strauss, J. F. (1996). Expression of steroidogenic acute regulatory protein (StAR) in the human ovary. J. Clin. Endocrinol. Metab. 81,4122-4128. Koizumi, S., Kyoya, S.,Miyawaki, T., Kidani, H., Funabashi, T., Nakashima, Y., Ohta, G., Itagaki, E., and Katagiri, M. (1977). Cholesterol side-chain cleavage enzyme activity and cytochrome P450 content in adrenal mitochondria of a patient with congenital lipoid adrenal hyperplasia (Prader Disease). Clin. Chim. Acta 77,301-306. Kovanen, P. T., Goldstein, J. L., Chappell, D. A., and Brown, M. S. (1980). Regulation of low density lipoprotein receptors by adrenocorticotropin in the adrenal gland of mice and rats in vivo. J. Biol. Chem. 255,5591-5598. Krueger, R. J., and Orme-Johnson, N. R. (1983). Acute adrenocorticotropic hormone stimulation of adrenal corticosteroidogenesis. J. Biol. Chem. 258, 10159-10167. Lalli, E., Bardoni, B., Zazopoulos, E., Wurtz, J . M., Strom, T. M., Moras, D., and SassoneCorsi, P. (1997). A transcriptional silencing domain in DAX-1 whose mutation causes adrenal hypoplasia congenita. Mol. Endocrinol. 11, 1950-1960. Lambeth, J. D., Kitchen, S. E., Farooqui, A. A., Tuckey, R., and Kamin, H. (1982). Cytochrome P-45Oscc substrate interactions: Studies of binding and catalytic activity using hydroxycholesterols. J. Biol. Chem. 257,1876-1884. LaVoie, H. A., Benoit, A. M., Garmey, J. C., Dailey, R. A., Wright, D. J., and Veldhuis, J. D. (1997). Coordinate developmental expression of genes regulating sterol economy and cholesterol side-chain cleavage in the porcine ovary. Biol. Reprod. 57, 402- 407. Lee, H. K., Ahn, R. S., Kwon, H. B., and Soh, J. (1997). Nucleotide sequence ofrat steroidogenic acute regulatory protein complementary DNA. Biochem. Biophys. Res. Commun. 230,528-532. Lin, D., Gitelman, S. E., Saenger, P., and Miller, W. L. (1991). Normal genes for the cholesterol side chain cleavage enzyme, P45Oscc, in congenital lipoid adrenal hyperplasia. J. Clin. Invest. 88, 1955-1962. Lin, D., Chang, Y.J., Strauss, J. F., 111, and Miller, W. L. (1993). The human peripheral benzodiazepine receptor gene: Cloning and characterization of alternative splicing in normal tissues and in a patient with congenital lipoid adrenal hyperplasia. Genomics 18,643-650. Lin, D., Sugawara, T., Strauss, J. F., 111, Clark, B. J., Stocco, D. M., Saenger, P., Rogol, A., and Miller, W. L. (1995). Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267,1828-1831. Lin, T., Wang, D., Hu, J., and Stocco, D. M. (1998). Up-regulation of human chorionic gonadotrophin-induced steroidogenic acute regulatory protein by insulin-like growth factor-1 in r a t Leydig cells. Endocrine 8, 73-78. Liscum, L., and Dahl, N. K. (1992). Intracellular cholesterol transport. J. Lipid Res. 33, 1239-1254.
436
DOUGLAS M.STOCCO
Liu, J., Heikkila, P., Kahri, A. I., and Voutilainen, R. (1996). Expression of the steroidogenic acute regulatory protein mRNA in adrenal tumors and cultured adrenal cells. J. Endocrinol. 160,43-50. Liu, Z., and Stocco, D. M. (1997). Heat shock-induced inhibition of acute steroidogenesis in MA-10 cells is associated with inhibition of the synthesis of the steroidogenic acute regulatory (StAR) protein. Endocrinology (Baltimore) 138,2722-2728. Miller, W. (1997). Congenital lipoid adrenal hyperplasia: The human gene knockout of the steroidogenic acute regulatory protein. J. Mol. Endocrinol. 19,227-240. Miller, W. L. (1998). Lessons from congenital lipoid adrenal hyperplasia. Curr. Opin. Endocrinol. Diabetes 5, 155-161. Miller, W. L. (1995). Mitochondria1 specificity of the early steps in steroidogenesis. J. Steroid Biochem. Mol. Biol. 55,607-619. Mizutani, T., Sonoda, Y., Minegishi, T., Wakabayashi, K., and Miyamoto, K. (1997). Molecular cloning, characterization and cellular distribution of rat steroidogenic acute regulatory protein (StAR) in the ovary. Life Sci. 61,1497-1506. Moog-Lutz, C., Tomasetto, C., Regnier, C. H., Wendling, C., Lutz, Y., Muller, D., Chenard, M. P., Basset, P., and Rio, M. C. (1997). MLN64 exhibits homology with the steroidogenic acute regulatory protein (StAR) and is overexpressed in human breast carcinomas. Znt. J. Cancer 71,183-191. Mori, M., and Marsh, J. M. (1982). The site of luteinizing hormone stimulation of steroidogenesis in mitochondria of the rat corpus luteum. J. Biol. Chem. 267,6178-6183. Muscatelli, F., Strom, T. M., Walker,A. P., Zanaria, E., Recan, D., Meindl,A., Bardoni, B., Guioll, S., Zehetner, G., Rabl, W., Schwarz, H. P., Kaplan, J. C., Camerino, G., Meitinger, T., and Monaco, A. P. (1994). Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature (London) 372,672-676. Nakae, J., Tajima, T., Sugawara, T., Arakane, F., Hanaki, K., Hotsubo, T., Igarashi, N., Igarashi, Y., Ishii, T., Koda, N., Kondo, T., Kohno, H., Nakagawa, Y., Tachibana, K., Takeshima, Y., Tsubouchi, K., Strauss, J. F., 111, and Fujieda, K. (1997). Analysis of the steroidogenic acute regulatory protein (StAR)gene in Japanese patients with congenital lipoid adrenal hyperplasia. Hum. Mol. Genet. 6,571-576. Nishikawa, T., Sasano, H., Omura, M., and Suematsu, S. (1995). Regulation of expression of the steroidogenic acute regulatory (StAR) protein by ACTH in bovine adrenal fasciculata cells. Biochem. Biophys. Res. Commun. 223, 12-18. Ohno, Y., Yanagibashi, K., Yonezawa, Y., Ishiwatari, S., and Matsuba, M. (1983).Apossible role of “steroidogenic factor” in the corticoidogenic response to ACTH; Effect of ACTH, cycloheximide and aminoglutethimide on the content of cholesterol in the outer and inner mitochondria1 membrane of rat adrenal cortex. Endocrinol. Jpn. 30, 335-338. Okuyama, E., Nishi, N., Onishi, S., Itoh, S., Ishii, Y., Miyanake, H., Fujita, K., and Ichikawa, Y. (1997). A novel splicing junction mutation in the gene for the steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. J. Clin. Endocrinol. Metab. 82,2337-2342. Papadopoulos, V. (1993). Peripheral-type benzodiazepine/diazepam binding inhibitor receptor: Biological role in steroidogenic cell function. Endocr. Rev. 14,222-240. Papadopoulos, V., Amri, H., Boujrad, N., Cascio, C., Culty, M., Gamier, M., Hardwick, M., Li, H., Vidic, B., Brown, A. S., Reversa, J. L., Bernassau, J. M., and Drieu, K. (1996). Peripheral benzodiazepine receptor in cholesterol transport and steroidogenesis. Steroids 62,21-28. Paul, D. P., Gallant, S., Orme-Johnson, N. R., Orme-Johnson, W. H., and Brownie, A. C.
STEROIDOGENIC ACUTE REGULATORY PROTEIN
437
(1976). Temperature dependence of cholesterol binding to cytochrome P-45Oscc of the rat adrenal. Effect of adrenocorticotropic hormone and cycloheximide. J. Biol. Chem. 251,7120-7126. Pedersen, R. C. (1987). Steroidogenesis activator polypeptide (SAP)in the rat ovary and testis. J . Steroid Biochem. 27,731-735. Pedersen, R. C., and Brownie, A. C. (1983). Cholesterol side-chain cleavage in the rat adrenal cortex: Isolation of a cycloheximide-sensitive activator peptide. Proc. Nutl. Acad. Sci. U.S.A. 80,1882-1886. Pedersen, R. C., and Brownie, A. C. (1986). The mechanism of action of adrenocorticotropic hormone on cholesterol metabolism in the adrenal cortex. In “Biochemical Actions of Hormones” (G. Litwack, ed.), Vol. 13, pp. 130-166. Academic Press, Orlando, FL. Pedersen, R. C., and Brownie, A. C. (1987). Steroidogenesis activator polypeptide isolated from a rat Leydig cell tumor. Science 236,188-190. Pescador, N., Korian Soumano, S., Stocco, D. M., Price, C. A., and Murphy, B. D. (1996). Steroidogenic acute regulatory protein in bovine corpora lutea. Biol. Reprod. 55, 485-491. Pescador, N., Houde, A., Stocco, D. M., and Murphy, B. D. (1997). Follicle stimulating hormone and intracellular second messengers regulate steroidogenic acute regulatory protein messenger ribonucleic acid in luteinized porcine granulosa cells. Biol. Reprod. 57,660-668. Pezzi, V., Clark, B. J., Ando, S., Stocco, D. M., and Rainey, W. E. (1996). Role of calmodulin-dependent protein kinase I1 in the acute stimulation of aldosterone production. J. Steroid Biochem. Mol. Biol. 58,417-424. Pfanner, N., Rassow, J., Wienhues, U., Hergersberg, C., Sollner Becker, K., and Neupert, W. (1990). Contact sites between inner and outer membranes: Structure and role in protein translocation into the mitochondria. Biochim. Biophys. Acta 1018,239-242. Phillips, M. C., Johnson, W. J., and Rothblat, G. H. (1987). Mechanisms and consequences of cellular cholesterol exchange and transfer. Biochim. Biophys. Actu 906,223-276. Pilon, N., Daneau, I., Brisson, C., Ethier, J. F., Lussier, J. G., and Silversides, D. W. (1997). Porcine and bovine steroidogenic acute regulatory protein (StAR) gene expression during gestation. Endocrinology (Baltimore) 138,1085-1091. Pon, L., Moll, T., Vestweber, D., Marshallsay, B., and Schatz, G. (1989). Protein import into mitochondria: ATP-dependent protein translocation activity in a submitochondrial fraction enriched in membrane contact sites and specific proteins. J. Cell Biol. 109,2603-2616. Pon, L. A., and Orme-Johnson, N. R. (1986). Acute stimulation of steroidogenesis in corpus luteum and adrenal cortex by peptide hormones: Rapid induction of a similar protein in both tissues. J. Biol. Chem. 261,6594-6599. Pon, L. A., and Orme-Johnson, N. R. (1988). Acute stimulation of corpus luteum cells by gonadotropin or adenosine 3’5’-monophosphate causes accumulation of a phosphoprotein concurrent with acceleration of steroid synthesis. Endocrinology (Baltimore) 123,1942-1948. Pon, L. A., Hartigan, J. A., and Orme-Johnson, N. R. (1986a). Acute ACTH regulation of adrenal corticosteroid biosynthesis: Rapid accumulation of a phosphoprotein. J. Biol. Chem. 261,13309-13316. Pon, L. A., Epstein, L. F., and Orme-Johnson, N. R. (1986b). Acute CAMPstimulation in Leydig cells: Rapid accumulation of a protein similar to that detected in adrenal cortex and corpus luteum. Endocr Res. 12,429-446. Privalle, C. T., Crivello, J., and Jefcoate, C. R. (1983). Regulation of intramitochondrial
438
DOUGLAS M.STOCCO
cholesterol transfer to side-chain cleavage cytochrome P450scc in rat adrenal gland. Proc. Natl. Acad. Sci. U.S.A.80, 702-706. Ramnath, H. I., Peterson, S., Michael, A. E., Stocco, D. M., and Cooke, B. A. (1997). Modulation of steroidogenesis by chloride ions in MA-10 mouse tumor Leydig cells: Roles of calcium, protein synthesis and the steroidogenic acute regulatory (StAR)protein. Endocrinology (Baltimore) 138,2308-2314. Rassow, J., Guiard, B., Weinhues, U., Herzog, V., Hartl, F. U., and Neupert, W. (1989). Translocation arrest by reversible folding of a precursor protein imported into mitochondria. A means to quantitate translocation contact sites. J. Cell Biol. 109, 1421- 1428. Reinhart, M. P. (1990). Intracellular sterol trafficking. Experientia 46,599-611. Rennert, H., Chang, Y.J.,and Straws, J. F., I11 (1993). Intracellular cholesterol dynamics in steroidogenic cells: A contemporary view. In “The Ovary” (E. Y. Adashi and P. C. K. Leung, eds.), pp. 147-164. Raven Press, New York. Rice, D. A., Mouw, A. R., Bogerd, A. M., and Parker, K. L. (1991). A shared promoter element regulates the expression of three steroidogenic enzymes. Mol. Endocrinol. 5, 1552-1556. Ronen-Fuhrmann, T., Timberg, R., King, S. R., Hales, K., Hales, D. B., Stocco, D. M., and Orly, J. (1998). Spatio-temporal expression patterns of steroidogenic acute regulatory protein (StAR) during follicular development in the rat ovary. Endocrinology (Baltimore) 139,303-315. Saenger, P. (1997). New developments in congenital lipoid adrenal hyperplasia and steroidogenic acute regulatory protein. Pediat. Endocrinol. 44,397-421. Saenger, P., Kionari, Z., Black, S. M., Compagnone, N., Mellon, S. H., Fleischer, A., Abrams, C. A. L., Shackelton, C. H. L., and Miller, W. L. (1995). Prenatal diagnosis of congenital lipoid adrenal hyperplasia. J. Clin. Endocrinol. Metab. 80,200-205. Saffran, M., Grad, B., and Bayliss, M. J. (1952). Production of corticoids by rat adrenals in vitro. Endocrinology (Baltimore) 50,639-643. Sakai, Y.,Yanase, T., Okabe, Y,,Hara, T., Waterman, M. R., Takayanagi, R., Haji, M., and Nawata, H. (1994). No mutation in cytochrome P450 side chain cleavage in a patient with congenital lipoid adrenal hyperplasia. J. Clin. Endocrinol. Metab. 79, 1198-1201. Sandhoff, T.W., and McLean, M. P. (1996a). Hormonal regulation of steroidogenic acute regulatory (StAR)protein messenger ribonucleic acid expression in the rat ovary. Endocrine 4,259-267. Sandhoff, T.W., and McLean, M. P. (1996b). Prostaglandin F2a reduces steroidogenic acute regulatory (StAR) protein messenger ribonucleic acid expression in the rat ovary. Endocrine 5,183-190. Sandhoff, T. W., and McLean, M. P. (1997). Identification and functional characterization multiple steroidogenic factor-1 elements in the rat steroidogenic acute regulatory protein (StAR)gene. J. SOC.Gynecol. Invest. 4(1), Abst. No. 073. Sandhoff, T.W., Hales, D. B., and McLean, M. P. (1997). Steroidogenic factor-1 confers CAMP responsiveness to the rat steroidogenic acute regulatory (StAR) protein gene promoter. J. SOC. Gynecol. Invest. 4(1), Abst. No. 407. Sauer, L. A., Chapman, J. C., and Dauchy, R. T. (1994). Topology of 3P-hydroxy-5-enesteroid dehydrogenase/A5-A4-isomerasein adrenal cortex mitochondria and microsomes. Endocrinology (Baltimore) 134,751-759. Scallen, T. J.,Pastuszyn, A., Noland, B. J., Chanderbhan, R., Kharroubi, A., and Vahouny, G. V. (1985). Sterol carrier and lipid transfer proteins. Chem. Phys. Lipids 38, 239-261. Schroeder, F., Jefferson, J. R., Kier, A. B., Knittel, J., Scallen, T. J.,Wood, W. G., and Ha-
STEROIDOGENICACUTE REGULATORY PROTEIN
439
pala, I. (1991). Membrane cholesterol dynamics: Cholesterol domains and kinetic pools. Proc. SOC.Exp. Biol. Med. 196,235-252. Schwaiger, M., Herzog, V., and Neupert, W. (1987). Characterization of translocation contact sites involved in the import of mitochondrial proteins. J. Cell Biol. 105,235-246. Selvaraj, N., Israeli, D., and Amsterdam, A. (1996).Partial sequencing of the rat steroidogenic acute regulatory protein message from immortalized granulosa cells: Regulation by gonatropins and isoproterenol. Mol. Cell. Endocrinol. 123, 171-177. Simpson, E. R., and Boyd, G. S. (1966).The eholesterol side-chain cleavage system of the adrenal cortex: A mixed function oxidase. Biochem. Biophys. Res. Commun. 24, 10-17. Simpson, E. R., and Boyd, G. S. (1967). The cholesterol side-chain cleavage system of the adrenal cortex. Eur. J. Biochem. 2,275-285. Simpson, E. R., McCarthy, J. L., and Peterson, J. A. (1979). Evidence that the cycloheximide-sensitive site of ACTH action is in the mitochondrion. J. Biol. Chem. 253, 3135-3139. Solano, A. R., Neger, R., and Podesta, E. J. (1984). Rat adrenal cycloheximide-sensitive factors and phospholipids in the control of acute steroidogenesis. J. Steroid Biochem. 21,111-116. Soumano, K., and Price, C. A. (1997). Ovarian follicular steroidogenic acute regulatory protein, low-density lipoprotein receptor, and cytochrome P450 side-chain cleavage messenger ribonucleic acids in cattle undergoing superovulation. Biol. Reprod. 56, 516-522. Stevens, V. L., Tribble, D. L., and Lambeth, J. D. (1985). Regulation of mitochondrial compartment volumes in rat adrenal cortex by ether stress. Arch. Biochem. Biophys. 242, 324-327. Stevens, V. L., Xu, T., and Lambeth, J. D. (1993). Cholesterol trafficking in steroidogenic cells: Reversible cycloheximide-dependent accumulation of cholesterol in a presteroidogenic pool. Eur. J. Biochem. 216,557-563. Stocco, D. M. (1992). Further evidence that the mitochondrial proteins induced by hormone stimulation in MA-10 mouse Leydig tumor cells are involved in the acute regulation of steroidogenesis. J. Steroid Biochem. Mol. Biol. 43,319-333. Stocco, D. M., and Ascoli, M. (1993). The use of genetic manipulation of MA-10 Leydig tumor cells to demonstrate the role of mitochondrial proteins in the acute regulation of steroidogenesis. Endocrinology (Baltimore) 132,959-967. Stocco, D. M., and Chaudhary, L. R. (1990).Evidence for the functional coupling of CAMP in MA-10 mouse Leydig tumor cells. Cell Signal 2, 161-170. Stocco, D. M., and Chen, W. (1991). Presence of identical mitochondrial proteins in unstimulated constitutive steroid-producing R2C rat Leydig tumor and stimulated nonconstitutive steroid-producing MA-10 mouse Leydig tumor cells. Endocrinology (Baltimore) 128,1918-1926. Stocco, D. M., and Clark, B. J. (1993). The requirement ofphosphorylation on a threonine residue in the acute regulation of steroidogenesis in MA-10 mouse Leydig tumor cells. J. Steroid Biochem. Mol. Biol. 46, 337-347. Stocco, D. M., and Clark, B. J. (1996). Regulation of the acute production of steroids in steroidogenic cells. Endocr. Rev. 17,221-244. Stocco, D. M., and Kilgore, M. W. (1988). Induction of mitochondrial proteins in MA-10 Leydig tumour cells with human choriogonadotropin. Biochem. J. 249,95-103. Stocco, D. M., and Sodeman, T.C. (1991). The 30-kDa mitochondrial proteins induced by hormone stimulation in MA-10 mouse Leydig tumor cells are processed from larger precursors. J. Biol. Chem. 266, 19731-19738. Stocco, D. M., King, S., and Clark, B. J. (1995). Differential effects of dimethylsulfoxide
440
DOUGLAS M. STOCCO
on steroidogenesis in mouse MA-10 and rat R2C Leydig tumor cells. Endocrinology (Baltimore) 136,2993-2999. Stone, D., and Hechter, 0. (1954). Studies on ACTH action in perfused bovine adrenals: Site of action of ACTH in corticosteroidogenesis. Arch. Biochem. Biophys. 51, 457-469. Sugawara, T., Holt, J. A., Driscoll, D., Strauss, J. F., 111, Lin, D., Miller, W. L., Patterson, D., Clancy, K. P., Hart, I. M., Clark, B. J., and Stocco, D. M. (1995a). Human steroidogenic acute regulatory protein: Functional activity in COS-1 cells, tissue-specific expression, and mapping of the gene to 8 ~ 1 1 . 2and a pseudogene to chromosome 13. Proc. Natl. Acad. Sci. U.S.A. 92,4778-4782. Sugawara, T., Lin, D., Holt, J. D., Martin, K. O., Javitt, N. B., Miller, W. L., and Strauss, J. F., I11 (1995b). Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 34,12506-12512. Sugawara, T., Kiriakidou, M., McAllister, J. M., Kallen, C. B., and Strauss, J. F., I11 (1997a). Multiple steroidogenic factor 1binding elements in the human steroidogenic acute regulatory protein gene 5’-flanking region are required for maximal promoter activity and cyclic AMP responsiveness. Biochemistry 36,7249-7255. Sugawara, T., Kiriakidou, M., McAllister, J. M., Holt, J. A., Arakane, F., and Strauss, J. F., I11 (1997b). Regulation of expression of the steroidogenic acute regulatory protein (StAR) gene: A central role for steroidogenic factor 1.Steroids 62,5-9. Sulimovici, S., Bartoov, B., and Lunenfeld, B. (1973). Localization of 3-P-hydroxysteroid dehydrogenase in the inner membrane subfraction of rat testis mitochondria. Biochim. Biophys. Acta 321,27-40. Tee, M., Lin, D., Sugawara, T.,Holt, J. A., Guiguen, Y., Buckingham, B., Strauss, J. F., 111, and Miller, W. L. (1995). T-A transversion 11bp from a splice acceptor site in the human gene for steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. Hum. Mol. Genet. 4,2299-2305. Thompson, W. E., Sanbuissho, A., Lee, G. Y., a n d h d e r s o n , E. (1997). Steroidogenic acute regulatory (StAR) protein (p25) and prohibitin (p28) from cultured rat ovarian granulosa cells. J. Reprod. Fertil. 109,337-348. Toaff, M. E., Strauss, J. F., 111, Flickinger, G. L., and Shattil, S. J. (1979). Relationship of cholesterol supply to luteal mitochondrial steroid synthesis. J. Biol. Chem. 254, 3977-3982. Townson, D. H., Wang, X. J., Keyes, P. L., Kostyo, J. L., and Stocco, D. M. (1996). Expression of the steroidogenic acute regulatory protein (StAR) in the corpus luteum of the rabbit Dependence upon the luteotrophic hormone, 17P-estradiol. Biol. Reprod. 55,868-874. Tuckey, R. C. (1992). Cholesterol side-chain cleavage by mitochondria from the human placenta. Studies using hydroxycholesterols as substrates. J. Steroid Biochem. Mol. Biol. 42,883-890. Tuckey, R. C., and Atkinson, H. C. (1989). Pregnenolone synthesis from cholesterol and hydroxycholesterols by mitochondria from ovaries following the stimulation of immature rats with pregnant mare’s serum gonadotropin and human choriogonadotropin. Eul: J.Biochem. 186,255-259. Tuckey, T. C., and Stevenson, P. M. (1984). Properties of bovine luteal cytochrome P45Oscc incorporated into artificial phospholipid vesicles. Znt. J. Biochem. 16, 479-503. van Meer, G. (1989). Lipid traffic in animal cells. Annu. Reu. Cell Biol. 6,247-275. Vestweber, D., and Schatz, G. (1988). Achimeric mitochondrial precursor protein with in-
STEROIDOGENIC ACUTE REGULATORY PROTEIN
441
ternal disulphide bridges blocks import of authentic precursors into mitochondria. A means to quantitate translocation contact sites. J. Cell Biol. 107,2037-2043. Watari, H., Arakane, F.,Moog-Lutz, C., Kallen, C. B., Tomasetto, C., Gerton, G. L., Rio, M., Baker, M. E., and Strauss, J. F., I11 (1997). MLN64 contains a domain with homology to the steroidogenic acute regulatory protein (StAR) that stimulates steroidogenesis. Proc. Natl. Acad. Sci. U.S.A. 94, 8462-8467. Waterman, M. R. (1994). Biochemical diversity of the CAMP-dependent transcription of steroid hydroxylase genes in the adrenal cortex. J. Biol. Chem. 269, 27783-27786. Yago, N., and Ichii, S. 11969). Submitochondrial distribution of components of the steroid 11-P-hydroxylase and cholesterol side chain-cleavage enzyme systems in hog adrenal cortex. J. Biochem. (Ibkyo) 65,215-224. Zanaria, E., Muscatelli, F., Bardoni, B., Strom, T.M., Guioli, S., Guo, W., Lalli, E., Moser, C., Walker, A. P., McCabe, E. R. B., Meitinger, T., Monaco, A. P., Sassone-Corsi, P., and Camerino, G. (1994). An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature (London) 372,635-641. Zazopoulos, E., Lalli, E., Stocco, D. M., and Sassone-Corsi, P. (1997). Binding of DAX-1 to hairpin structures and regulation of steroidogenesis. Nature (London)390,311-314.
This Page Intentionally Left Blank
VITAMINSAND HORMONES, VOL. 55
Regulated Expression of the Bone-Specific Osteocalcin Gene by Vitamins and Hormones JANE B. LIAN, GARY,S. STEIN, JANET L. STEIN, AND ANDRE J. VAN WIJNEN Department of Cell Biology University of Massachusetts Medical Center Worcester,Massachusetts 01655 I. Introduction 11. Protein Properties and Function Rely on the Vitamin-K-Dependent Synthesis of y-Carboxyglutamic Acid Residues 111. Regulated Expression of Osteocalcin during Osteoblast Differentiation A. Gene Expression Characterizing Stages of Osteoblast Growth and Differentiation B. Mediators of Transcriptional Control Supporting Progressive Development of the Osteoblast Phenotype and the Developmental Expression of Osteocalcin C . Osteocalcin Expression Parallels Hormonal and Growth Factor Modifications of Osteoblast Differentiation IV. Properties of the Rat Osteocalcin Promoter A. The Osteocalcin Genes B. Organization of the Bone-Specific Osteocalcin Gene Promoter C. Osteocalcin Promoter Elements Mediating Developmental and TissueSpecific Regulation D. AP-Sites: Convergence of Different Signaling pathways E. Promoter Elements Contributing to Steroid Responsiveness V. Chromatin Structure, Nucelosome Organization, and Osteocalcin Gene-Nuclear Matrix Interactions Support Interrelationships between Activities at Multiple Independent Promoter Elements A. Parameters of Nuclear Architecture Contribute to Transcriptional Control B. Developmental and Steroid Hormone Modifications of Osteocalcin Gene Chromatin Structure and Nucleosome Organization C. Contributions of the Nuclear Matrix to Osteocalcin Gene Expression VI . Closing Remarks References
I. INTRODUCTION Expression of the bone-specific osteocalcin gene and synthesized protein is developmentally regulated during osteoblast differentiation and is responsive to numerous physiologic mediators of bone formation and resorption (e.g., glucocorticoids, vitamin D, bone morphogenetic protein-2). The osteocalcin promoter is a well-established model for understanding transcriptional control in development and maintenance 443
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99$25.00
444
JANE B. LIAN et a1
of the osteoblast phenotype and for studying molecular mechanisms contributing to steroid hormone and growth factor effects on skeletal formation. For many years, the secreted protein has been widely used as the marker of activity of the mature osteoblast phenotype. Afraction of newly synthesized osteocalcin is found in the circulation, and its measurement has proven to be a valuable clinical parameter for assessing bone turnover activity (Priceet al., 1981, Lian and Gundberg, 1988;Calvo et al., 1996). The objective of this article is to demonstrate the contributions of multiple promoter elements to osteocalcin gene expression within the biological context of osteoblast growth and differentiation. The properties of osteocalcin, a vitamin-K-dependent calcium-binding protein, is first discussed in relation to its putative functions. The complexity of regulated expression of the osteocalcin gene is discussed from the perspective of factors and signaling pathways that impinge on promoter domains as well as modifications in chromatin organization that occur during maturation of the osteoblast phenotype. 11. PROTEIN PROPERTIES AND FUNCTION RELYON THE VITAMIN-KDEPENDENT SYNTHESIS OF y-CARBOXYGLUTAMIC ACID RESIDUES
Osteocalcin is a major noncollagenous protein product of the differentiated osteoblast, which forms the bone extracellular matrix (ECM). As the ECM mineralizes, enveloping the osteoblasts, which transform into osteocytes, osteocalcin expression is retained. The protein is synthesized in a pre-pro form of 10,000 kDa (Nishimoto and Price, 1980; Lian and Friedman, 1978);but is secreted as a 5600 kDa that accumulates in the bone extracellular matrix bound to mineral. A characteristic feature of osteocalcin is the presence of three residues of the vitamin K dependently synthesized amino acid, y-carboxyglutamic acid which is the site for interaction with calcium and other divalent metal ions (Hauschka et al., 1989; Price, 1988; Wong et al., 1990) (Fig. 1).Processing of proosteocalcin to the mature peptide may be regulated by the Gla residues (Benton et al., 1995; Scheper et al., 19911, a function that has been definitively established for regulating conversion of the vitamin-K-dependent blood clotting proteins to active enzymes (Suttie, 1993). The propeptide form accumulates intracellularly in vitro (Nishimot0 and Price, 1980).Alternatively, Gla content of the protein may influence structural properties of osteocalcin and binding of the protein to the hydroxyapatite component of bone. Human osteocalcin is incompletely y-carboxylated in adults compared to other species (Cairns and Price, 1994), and the human bone extracellular matrix contains one-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
445
30
- COOH FIG.1.Amino acid sequence of rat osteocalcin. Residues 1-50 of the mature peptide secreted from osteoblasts after processing of an intracellular pre-pro 10-kDa translated protein. Postulated models of protein structure (reviewed in Hauschka et al., 1989; Hauschka and Wians, 1989) indicate that Gla residue distances can facilitate tight binding to Ca2+of hydroxyapatite crystals, which results in accumulation of osteocalcin in the bone ECM bound to mineral. The Gla domain is highly conserved in all species from swordfish to human. Some degree of variability occurs in the amino and carboxy terminal (reviewed in Price et al., 1987). Gla residues a t residues 17, 21, and 24 are shown in black.
third the level of osteocalcin present in rat or bovine bone (Hauschka et al., 1989;Price, 1988;Lian and Gundberg, 1988).A study of circulating osteocalcin as a function of age and menopause has indicated that the osteocalcin synthesized in the late decades has reduced capacity to bind to hydroxyapatite (Knapen et al., 1989). The bone content of osteocalcin also declines from the first to ninth decades (Lian and Gundberg, 19881, and a study by Szulc et al. shows that undercarboxylated serum osteocalcin correlates with lower bone mineral density (1994). However, long-term maintenance on a low-warfarin anticoagulant regimen (which inhibits synthesis of Gla residues) does not appear to be a contributing factor to bone mineral density status (Rosen et al., 1993). One study examining osteocalcin in human bone by immunolocalization shows a reciprocal distribution with bone age (Ingram et al., 1994). Al-
446
JANE B. LIAN et al.
though these clinical studies do not present a clear picture of the role of the y-carboxylated protein, nonetheless, the presence of the Gla residues are presumed to be involved in the normal functioning of osteocalcin. The calcium-binding properties of osteocalcin have been considered in relation to its precise function in bone. The K,, for calcium ion binding to the Gla residues is of the order of 2-3 mM, a weak association, suggesting that osteocalcin could readily buffer or regulate calcium fluctuations in bone. However, osteocalcin does have a high-affinity property for interacting with hydroxyapatite (Boskey et al., 1985; Hauschka and Wians, 1989;Hauschka et al., 1989)crystals of bone, consistent with its regulated expression in relation to mineral deposition. The affinity for hydroxyapatite enables the protein to function in controlling mineral deposition or crystal growth and maturation (Boskey et al., 1985; Romberg et al., 1986). In situ hybridization studies show that osteoblasts at the mineralization front express the highest levels with lower levels observed in osteocytes in uivo (Weinreb et al., 1990; Heersche et al., 1992; Zhou et al., 1994). In rat osteoblast cultures undergoing in uitro differentiation (Aronow et al., 1990) and in uiuo, osteocalcin synthesis and accumulation can be highly correlated to the amount of deposited hydroxyapatite and reaches maximum levels in uiuo during the postnatal growth period (Hauschka et al., 1989; Price, 1988; Lian and Gundberg, 1988). This pattern and the absence of osteocalcin in preosteoblasts is the basis for using osteocalcin as a marker of the differentiated osteoblast. The coupling of osteocalcin expression to bone formation is reiterated by the high degree of correlation of total bone content of osteocalcin to total collagen content. In studies of gene expression in growing rats, collagen and osteocalcin are coordinately expressed (Shalhoub et al., 1991, 1994). Immunolocalization studies show that the protein is distributed throughout mineralized regions of bone matrix, dentin, and calcified cartilage (McKeeet al., 1993; Mark et al., 1987; Boivin et al., 1990; Carlson et al., 1993; Kasai et al., 1994). Taken together, these studies implicate osteocalcin as an integral component of the bone extracellular matrix during its formation and mineralization stages. Nonetheless, other studies, inhibiting osteocalcin accumulation in bone, demonstrate osteocalcin is not required for mineralization (Price et al., 1982; Pastoureau et al., 1993). These in uiuo studies in rat (Price et al., 1982;Feteih et al., 1990) and sheep (Pastoureau et al., 1993), which utilized warfarin inhibition of Gla synthesis to reduce osteocalcin levels in bone, must be interpreted cautiously because low levels (24%) of osteocalcin remained and the drug induced
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
447
effects on other Gla proteins in bone (e.g., matrix Gla protein and protein s)and on other cellular parameters (Barone et al., 1994).Gene ablation studies in mice (Desboiset al., 1995) provide additional insights. Osteocalcin null mutant mice are born with normal skeletal patterning (Desbois et al., 1995).A phenotype could not be revealed until mice reached adult maturity. X ray of the long bones and histologic studies demonstrated a significant increase by 36 weeks in cortical thickness and replacement of the growth plate by newly formed bone. The observation that bone develops in the osteocalcin-gene-ablatedmice and the extracellular matrix mineralizes corroborates results from the warfarin-treated rat studies. The increase in bone mass, reflected by increased binding strength of the long bone (biomechanical testing), suggests that bone formation rate may exceed bone resorption in the older mice. These findings imply that osteocalcin may function either to inhibit the bone formation process or to regulate the bone resorption axis. Bone remodeling is a continuous process that serves to maintain calcium and phosphate homeostasis in response to calcitrophic hormones as well as to maintain bone structure, for example, by removing stress microfractures. This process is accomplished by the specialized multinucleated bone resorbing osteoclast cells, balanced by the replacement of bone tissue from osteoblasts. Crosstalk between osteoblast and osteoclast activities is mediated by cytokines, hormones, and bone matrix proteins. An increase in osteoclast number and surface area in the bones of the osteocalcin (0C)- deficient mice was quantitated by histomorphometric analysis, raising the possibility that the osteoclasts functioned poorly, as in osteopetrosis disorders (Lian and Marks, 1990). However, when the null mice were ovariectomized to induce a rapid increase in bone resorption, a decrease in bone density was observed, as occurs in wild-type animals. Mineral properties of the trabecular bone in the null mice were analyzed by Fourier transform infrared microspectroscopy (Boskey et al., 1998). The spectra reflect less mature bone crystals compared to the wild type. These observations in the osteocalcin-null mouse do not enable us to interpret osteocalcin function with any certainty. For such an abundant noncollagenous extracellular matrix protein, the absence of a phenotype during early stages of postnatal growth suggests that osteocalcin function may be compensated by other calcium-binding proteins in the extracellular matrix. The possibility that osteocalcin may participate in bone turnover or resorption was addressed in a series of in vivo and in vitro studies using several model systems that examined osteocalcin effects directly in cultured cells or in matrix substrates (Malone et al., 1982; Lian et al.,
448
JANE B. LIAN et al.
1984, 1986; Lian and Marks, 1990; Webber et al., 1990; Liggett et al., 1994; Glowacki et al., 1991; Chenu et al., 1994; Defranco et al., 1991; Glowacki and Lian, 1987;Barone et al., 1991; Ingram et al., 1994).The protein has chemoattractant activity for (a) peripheral mononuclear cells (Malone et al., 1982; Lian et al., 1986) (potential progenitors for the multinucleated osteoclasts which resorb bone matrix) and (b) osteoclast-like cells of giant cell tumors (Chenu et al., 1994). Incorporation of osteocalcin into synthetic hydroxyapatite particles implanted subcutaneously in rats provides a signal for osteoclastic-like resorption of the particles (Glowacki et al., 1991; Chenu et al., 1994; Defranco et al., 1991; Glowacki and Lian, 1987). Similar particles placed onto the chick chorioallantoic membrane enhanced osteoclast formation (Webber et al., 1990). Furthermore, osteocalcin contributes to multinucleated cell formation with tartrate-resistant acid phosphatase activity (TRAP) in fetal bone organ cultures (Barone et al., 1991) and cultures of marrow stem cells (Liggett et al., 1994). Lastly, subcutaneous implantation in rats of mineralized bone particles that are 98%deficient in osteocalcin results in a 50%decreased number of osteoclasts and resorption of the bone particles when compared to normal bone implants (Lian et al., 1984; Defranco et al., 1991; Glowacki and Lian, 1987). These findings, although from model systems, do support the concept that osteocalcin may participate in regulating bone turnover. However, the precise function of osteocalcin still remains a compelling question.
111. REGULATED EXPRESSION OF OSTEOCALCIN DURING OSTEOBLAST DIFFERENTIATION Bone-specific gene expression must be understood within the context of transcriptional control during progressive development of the osteoblast phenotype. Numerous cell culture models have been developed in the past decade to experimentally address mechanisms controlling transitions through stages of bone cell differentiation (Aubin and Liu, 1996; Stein and Lian, 1995). Osteoblasts originate from pluripotent mesenchymal stem cells, which give rise to a number of committed cell lineages. The exact pathways in the earliest phases of commitment to the osteoblast lineage and cellular differentiation is an area of intense investigation. Here, characterization of osteocalcin gene regulation has greatly contributed to our understanding of factors regulating development of the osteoblast phenotype. In this section, we confine our considerations of expression of the rat osteocalcin gene to primary cultures of normal diploid calvarial derived cells.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
449
A. GENEEXPRESSION CHARACTERIZING STAGES OF OSTEOBLAST GROWTH AND DIFFERENTIATION Cells that produce a bonelike mineralized extracellular matrix and express genes associated with the osteoblast phenotype can be isolated by collagenase digestion of human bone fragments (Robey and Termine, 1985) and fetal or embryonic calvarial bone from rat, mouse, bovine, or chick (Bellows et al., 1987; Ecarot-Charrier et al., 1983; Nefussi et al., 1985; Whitson et al., 1984; Gerstenfeld et al., 1987). Osteoblasts can also be derived by culture of adherent marrow stromal cells (Beresford et al., 1992; Leboy et al., 1991; Cheng et al., 1994; Kamalia et al., 1992; Kasugai et al., 1991). Characteristic features of these primary osteoblasts are the ability of the cells to multilayer either in uniform sheets (Robey and Termine, 1985; Gerstenfeld et al., 1987) or in focal nodules (Ecarot-Charrier et al., 1983; Pockwinse et al., 1992, 1995; Bhargava et al., 19881, to produce copious amounts of type I collagen, the principle component of the bone ECM, and mineralize their extracellular matrix. The bonelike nodules formed in fetal rat calvaria-derived primary cultures (Fig. 2A) are a composite of cells with a tissuelike organization similar to developing fetal bone (Bhargava et al., 1988;Pockwinse et al., 1992; Gerstenfeld et al., 1988,1993).As cellular multilayering occurs in nodules, osteoblasts secrete collagen and noncollagenous proteins, rendering the matrix competent to undergo an ordered deposition of mineral associated with the orthogonally organized layers of collagen fibrils. When the mineralizing matrix envelops the surface osteoblasts, the cells mature into a more differentiated osteocyte (characterized by plasma membrane extensions). Thus, osteoblasts become heterogenous and exhibit morphological distinctions (Doty and Schofield, 1990). This occurs both in uitro and in uiuo, and is concomitant with organized tissue formation. A temporal pattern of gene expression reflecting progressive differentiation of the osteoblast has been mapped from the proliferating cell to the fully mature osteocyte in uitro (Stein et al., 1990; Stein and Lian, 1993). The general profile of cell growth and bone phenotypic gene expression characterizes three major periods of cell and tissue development and bone formation-proliferation, matrix maturation, and mineralization (Fig. 2B). The proliferation period is characterized by high levels of mRNA transcribed from (a) genes associated with cell growth (e.g., histone H2B, which reflects DNA synthesis, protooncogenes, and growth factors), (b) genes associated with regulation of ECM biosynthesis (Owen et al., 1990a),and ( c )genes determining both commitment to the suppression of osteoblast phenotype and genes expressed later in
450
JANE B. LIAN et al.
A
MATRIX ~ PROLIFERATION M A T U ~ T ~ OMlNERALUATlON APOPTOSIS
f7
P53 0AX
H ISTON E
COLLAGEN TQFO1 MSX-2
ALKALINE PHOSPHATASE MOP CBFAl/AML-3
FRAYJUND
C FOS/C J UN
OSTEOPONTIN BONE SIALO PROTEIN DLX-5 C0FA1 I AML-3
CBFWAML
B
Restriction Points > Proliferation
Mineralization
FIG.2. The osteoblast developmental sequence. (A) Micrographs of osteoblasts: 3H thymidine incorporation shows left, growth stage; middle, histochemical detection of alkaline phosphatase activation in all cells; and right, von Kossa’s stain reveals mineralized nodules. Stages in development of the osteoblast phenotype are defined by the temporal expression of cell growth and osteoblast phenotype-related genes, reflected by the cellular representation of mRNAs, during the development of in uitro formed bonelike tissue (nodules) produced by normal diploid rat osteoblasts. Isolated primary cells from fetal rat calvaria were cultured as described. Cellular RNAisolated from days 5,8,14,21, 28, and 35 were assayed for the steady-state levels of various transcript by Northern blot analysis. Procedures and source of the probes are described in Owen et al.,(1990a), McCabe et al.,(1995,19961, Banejee et al.,(1996a,b), Lynch et al.,(1995), and Shalhoub et al.,(1991,1994). Three periods of gene expression are represented by peak mRNA levels and define a (1)proliferation period, represented here by expression of histone gene (4), AP-1 activity (c-fos-c-jun), along with maximal expression of skeletal regulatory factors (Mxs-2) and genes involved in bone extracellular matrix synthesis [transforming growth factor p l (TGFPl), collagen type 11; (2) a matrix maturation period reflected by the post-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
45 1
mature osteoblasts. The second period of osteoblast differentiation, extracellular matrix maturation, follows the down-regulation of proliferation. Transforming growth factor P (TGFP)and collagen type I mRNAs are reduced to lower levels of expression, but type I collagen synthesis, accumulation, and cross-linking (Gerstenfeld et al., 1988,1993) continues, accounting for up to 35-40% of the ECM (Gerstenfeld et al., 1988; Aronow et al., 1990; Quarles et al., 1992). However, subtle variations in interrelationships between the extent of gene expression and the stage of differentiation can be noted. Reported differences in the temporal pattern of transforming growth factor P (TGFP) (Harris et al., 199413) and collagen gene expression (Birnbaum and Wiren, 1994) in rat calvarial osteoblasts appear to be related to plating density and serum composition. Indeed, dramatic changes in the developmental expression of these genes are observed when cells are cultured on collagen matrices, implicating cell-cell and cell-matrix interactions as key biological determinants of their expression levels (Birnbaum and Wiren, 1994; Franceschi and Iyer, 1992; Franceschi et al., 1994; Andrianarivo et al., 1992; Masi et al., 1992; Lynch et al., 1995; Vukicevic et al., 1990). In the immediate postproliferative period, a large induction of alkaline phosphatase mRNA and enzyme activity occurs (Gerstenfeld et al., 1987; Beresford et al., 1992; Leboy et al., 1991; Cheng et al., 1994) and is a requirement for mineralization of the matrix. In this postproliferproliferative up-regulation of alkaline phosphatase, matrix Gla protein (MGP), and AP1 activity involving fra2/junD and onset of osteocalcin; and (3)a mineralization period where genes, such as osteopontin, osteocalcin, and collagenase, are induced to maximum levels with accumulation of calcium. (B) Model of the reciprocal relationship between proliferation and differentiation in normal diploid cells during development of the osteoblast phenotype. The proliferation-differentiation relationships are schematically illustrated as arrows representing changes in expression of cell-cycle and cell-growth-regulated genes (proliferation arrow) and genes associated with maturation (differentiation arrows) of the osteoblast phenotype as the extracellular matrix accumulates and mineralizes in normal diploid cell cultures. The vertical lines indicate the two experimentally established principal transition points in the developmental sequence exhibited by normal diploid osteoblasts: the first at the completion of proliferation when genes associated with matrix development and maturation are up-regulated and the second a t the onset of ECM mineralization. In the proliferation period, expression of postproliferative genes can be suppressed by several mechanisms, including binding of c-fos-cjun heterodimers to AP1 sites or homeodomain proteins to Hox sequences. The signaling pathways and feedback events (represented by plus and minus signs) are indicated. These include down-regulation of proliferation (-) by the accumulated extracellular matrix (+ECM), which, in turn, leads to up-regulation of postproliferative genes (e.g., alkaline phosphatase). Mineralization leads to both the up-regulation of genes (e.g., osteocalcin) and down-regulation of alkaline phosphatase activity during the third period. Mineralization also leads to turnover of the ECM mediated in part by apoptosis.
452
JANE B. LIAN et al.
ative period, transcription of osteocalcin is first detected with the onset of mineralization, and a third stage of gene expression is initiated, reflected primarily by upregulation of the bone sialoprotein, osteopontin, and osteocalcin. These are all calcium-binding proteins that have been demonstrated by immunolocalization to be associated with the mineral component of bone (Mark et al., 1987; Boivin et al., 1990; Carlson et al., 1993; Kasai et al., 1994; McKee et al., 1993).As mineralization proceeds, alkaline phosphatase mRNA levels are down-regulated, whereas osteocalcin and osteopontin reach their maximal levels, indicating maturation of the osteoblast phenotype. Although osteopontin is expressed in proliferating osteoblasts (Owen et al., 1990a; Chen et al., 1994) and in other tissues (Denhardt and Guo, 1993), osteocalcin expression, which is bone restricted, occurs only postproliferatively (Owen et al., 1990a; Quarles et al., 1992).The postproliferative expression of osteocalcin is further emphasized by its transcriptional enhancement by 1,25(OH),D,, which can be up-regulated only when the gene is transcribed in nondividing cells (Bortellet al., 1992; Owen et al., 1991). Associated with the mineralization phase is a fourth developmental stage characterized by a series of events that may contribute to modifications in organization and turnover of the mature bone extracellular matrix. In Fig. 2A, this stage is designated apoptosis. A continual increase in collagenase mRNA (Shalhoub et al., 1992)reaching maximal levels in heavily mineralized cultures is observed. This increase may be involved in collagen turnover associated with reorganization of the collagen matrix, which undergoes continuous maturation [e.g., crosslinking of collagen fibers (Gerstenfeld et al., 1988, 1993)l. In addition, we detect apoptotic cells associated with the mineralized nodule (Lynch et al., 1994),which may facilitate maintenance of the bonelike extracellular matrix in uitro. During this time, a low level of cell proliferation indicated by histone gene expression and a rise in mRNA of several oncogenes can be detected, suggesting cell turnover. Osteocalcin and osteopontin mRNA levels become down-regulated in late mineralization stage cultures, reflecting perhaps the programmed cell death of this subset of mature osteoblasts. In viuo apoptosis contributes to organ development and one can only speculate as t o why this occurs in uitro.Perhaps apoptosis is a natural mechanism for eliminating osteoblasts that do not become incorporated into an organized mineralized matrix. Studies of bone tissue for the representation of apoptotic cells reveal that hormonal regulation is an important factor in maintaining a viable bone cell population (Tomkinson et al., 1997). Certain functional relationships and signaling mechanisms that reg-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
453
ulate this developmental sequence of bone formation and support progressive differentiation of the osteoblast phenotype have been established and were reviewed (Stein et al., 1996; Stein and Lian, 1993, 1995). In general, from the various experimental manipulations it is clear that for the normal developmental sequence, cells must progress through two restriction points (Fig. 2B). The first is the shutdown of proliferation, contributed to be an accumulation of collagen matrix, which, in turn, promotes expression of the osteoblast phenotype marked by high levels of alkaline phosphatase. The second transition point is mineralization of the ECM for completion of the differentiation process to the osteocyte. An understanding of these restriction points has provided a basis for addressing molecular mechanisms mediating steroid hormone and growth factor modifications of the differentiation pathway. Thus, in conclusion, this primary osteoblast model having many features of intramembranous bone formation, provides an opportunity for studying developmental regulation of osteocalcin gene expression. B. MEDIATORSOF TRANSCRIPTION CONTROL SUPPORTING PROGRESSIVE DEVELOPMENT OF THE OSTEOBLAST PHENOTYPE AND THE DEVELOPMENTAL EXPRESSION OF OSTEOCALCIN
It is apparent that, in addition to bone extracellular-matrix-associated genes, several classes of transcription factors and other regulator y proteins are expressed temporally during differentiation (Fig. 2B), suggesting functional linkage to maturation of the phenotype due to their ability to modulate signaling cascades and gene expression. The oncogene encoded early response gene family (e.g., C-Fos,c-Jun, Jun-B, Fra-1, and Fra-2) (McCabe et al., 1995; Machwate et al., 19951, helixloop-helix proteins (Murray et al., 1992),homeodomain proteins (Hoffmann et al., 1994; Towler et al., 1994b; Ryoo et al., 1997),runt homology-domain proteins (Merriman et al., 19951, the high-mobility group (HMG) chromosomal proteins (e.g. HMG14, HMG17) (Shakoori et al., 19931, metablastin (Schubart, et al., 1992),insulin-like growth factor I (IGF-I) and IGF-binding proteins (Birnbaum and Wiren, 1994; Thrailkill et al., 1995), and bone morphogenetic proteins (BMPs) (Hughes et al., 1995; Harris et al., 1994a; Chen et al., 1991)have been examined as a function of osteoblast differentiation. The transcriptional regulators of the osteocalcingene, which have additionally been identified in regulation of the progressive development of osteoblast maturation, are further discussed. Expression of members of fos and jun family of transcription factors
454
JANE B. LIAN et al.
with respect to both protein (McCabe et al., 1996) and mRNA (McCabe et al., 1995; Machwate et al., 1995)levels are regulated during bone formation in uiuo (Grigoriadis et al., 1993;Wang et al., 1992) and throughout the growth and differentiation of osteoblasts. AP-1 activity is maximal in proliferating cells. In the growth period of osteoblasts, c-fos and c-jun heterodimers form the complexes most represented at AP-1 sites, whereas fra-2 and jun-B are the abundant family member factors found in differentiated rat osteoblast cultures and MC3T3 cells (McCabe et al., 1996). This profile of expression and activity in osteoblasts (i.e., binding t o m - 1 sites in gene promoters) is consistent with findings from studies in other systems (Rezzonicoet al., 1995; Gandarillas and Watt, 1995; Szabo et al., 1991), which has led to an appreciation for their possible role in regulating cellular differentiation. In osteoblasts, the functional significance of relatively high levels of fra-2 compared to other family members for maturation of the differentiation program is supported by antisense studies in cultured rat calvaria-derived cells. Inhibition of translation of fra-2, but not fra-1, blocked the ability of these cells to produce a mineralizing matrix. Antisense inhibition of c-fos initiated in the growth period resulted in a block in maturation at the early stage of differentiation, the matrix maturation period when alkaline phosphatase levels are maximal. This inhibition suggests c-fos is an important determinant for bone formation as suggested from in uiuo studies (Grigoriadis et al., 1993). Several homeobox-containinggenes have been shown to be critical to skeletal patterning and limb development in embryos (Johnson et al., 1994; Balling et al., 1989; Davis et al., 1995; Martinet al., 1995; Jabs et all., 1993; Lufkin et al., 1992; Satokata and Maas, 1994). Particularly relevant to bone formation are the mammalian Msx-1 and Msx-2 members of the Msh homeodomain gene family (Jabs et al., 1993; Satokata and Maas, 1994; Liu et al., 1994) and the Dlx gene family (Lufkin et al., 1992; Ryoo et al., 1997). These factors are expressed in tissues that require epithelial-mesenchymal interaction in the developing embryo and have been implicated as regulators of inductive events in the vertebrae, limbs, and cranium. The importance of Msx-2 and related proteins in orchestrating normal bone development is illustrated by expression of Msx-2 in early developing bone tissue (Liu et al., 1995; Iimura et al., 1994) and by skeletal abnormalities resulting from mutations of the gene in human (Jabs et al., 1993)or in mice (Satokata and Maas, 1994). Msx-2 also provides important signals for apoptosis during limb development (Coelho et al., 1991; Graham et al., 1993). During osteoblast differentiation in uitro, Msx-2 mRNA levels decline from the growth to differentiation periods and then become up-regulated in the
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
455
late stage of mineralization when apoptosis is ongoing. In contrast, Msx-1 mRNA levels are constitutive, consistent with this factor being ubiquitous, compared to the skeletal tissue restricted expression of Msx-2. Furthermore, in antisense studies, inhibition of Msx-2, but not Msx-1 transcripts, inhibited osteoblast differentiation (Hoffmann et al., 1996). These findings support the concept that expression of the Msx-2 homeodomain proteins in early development of bone may be necessary for dictating outcome of osteoprogenitor differentiation to the final stages of production of a mineralized matrix. Notably, several osteoblast cell lines that do not express osteocalcin also lack Msx-2 transcripts (Hoffmann et al., 1994). However, down-regulation of Msx-2 is required for enhanced expression of osteoblast products, as collagen (Dodig et al., 1996) and osteocalcin (Hoffmann et al., 1994;Towler et al., 1994b). The suppressor activity of homeodomain proteins in mature osteoblasts may functionally be related to maintaining critical levels of osteoblast expressed genes in response to bone turnover. In this regard, other homeodomain proteins are temporally expressed during osteoblast differentiation. Dlx-5, a member of the distal-less family of homeobox-containing genes, is also essential for limb development (Lufkin et al., 1992;Ferrari et al., 1995). Dlx-5 exhibits a reciprocal pattern of expression when compared to Msx-2 (Ryoo et al., 1997). Dlx-5 is detectable only in the postproliferative period and becomes up-regulated during the mineralization period reaching maximal levels in concert with the osteocalcin marker of maturation. These findings suggest that Dlx-5 may be an important regulator of gene expression in mature osteoblasts as well as playing an important role in early limb formation. Dlx-5-null mice have not been generated to date to address this interesting aspect of its expression in vitro. In the characterization of bone-specific transcription factor complexes associated with osteocalcin gene sequences, a consensus sequence for CBFa-AML-related proteins, was identified (Bidwell et al., 1993; Merriman et al., 1995; Banerjee et al., 1996a; Ducy et al., 1997). This transcription factor was designated AML because the gene in human is frequently rearranged in acute myelogenous leukemia. The factor is also named polyoma enhancer binding protein (PEBPa) and core-binding factor (CBFa), the preferred nomenclature. The CBFa-AML family of runt homology domain (RHD) transcription factors were initially identified as a pair rule gene controlling Drosophila development and subsequently as a key regulator of mammalian hematopoietic gene expression (Kagoshima et al., 1993; Levanon et al., 1994). To date, three CBFA genes that influence myeloid cell growth and differentiation are
456
JANE B. LIAN et al
known (Speck and Stacy, 1995). It is now known that one of these genes is essential for bone formation during embryogenesis (Komori et al., 1997; Otto et al., 1997). Null mutation of the Cbfa2 IPEBP2aBIAML-1 gene in mice was embryonic lethal due to disruption of hematopoieses and hemorrhage in the central nervous system prior to development of the skeleton (Okuda et al., 1996). However, ablation of the Cbfall AML-3 gene resulted in mice that survived to birth only. In these mice, skeletal formation was blocked at the stage of osteoblast maturation. Although the cartilage anlage of long bone developed and intramembranous skeletal tissue developed alkaline-phosphatase-positive cells, skeletal formation was disrupted by the absence of mineralized bone tissue did not occur (Otto et al., 1997; Komori et al., 1997).At the same time as this knockout was reported by two independent laboratories, the mutational defect in the human disorder, cleidocranial dysplasia, was identified in different families as deletions of the CBFAl gene (Mundlos et al., 1997; Lee et al., 1997). In situ hybridization for Cbfa 1 during mouse development indicates that Cbfa 1is expressed early in development at high levels from gestational age 9.5 to 12. Expression levels then rise in the bony tissues in osteoblasts in later stages of development and postnatally (Komori et al., 1997; Ducy et al., 1997). The significance of the Cbfa 1/AML-3null mutation with respect to our understanding of transcription factors required for development of the skeleton and maturation of the osteoblast phenotype is quite remarkable in that neither of the other two Cbfa/AML genes, having conserved DNA-binding domains, can compensate the skeletal defect. During osteoblast differentiation in uitro, all Cbfa family members are detected by Northern blot analysis and at the protein level using a panel of antibodies generated by the Hiebert laboratory (Banerjee et al., 1997). Cbfa 1and Cbfa 3 appear to be expressed predominantly in the postproliferative mature osteoblast. Cbfa 2 is present in the proliferating osteoblasts and then declines. Although abundant in bone, Cbfa 1/ AML-3 is found in other tissues (Levanon et al., 1994; Ogawa et al., 1993), suggesting a unique splice variant may represent the osteoblastspecific factor. Indeed, several isoforms with different N- and C-terminal extensions have been identified in osteoblasts (Ducy et al., 1997; Stewart et al., 1997). There are two isoforms of Cbfa 1 arising fron exon 0: Cbfal.met1 [designated as OSF-2 (Ducy et al., 1997)l and Cbfal.met 69 [the til locus (Stewart et al., 199711. However, Cbfal.met1 yields a minor product compared to Cbfal.met69 (Stewart et al., 1997; Thirunavukkarasu et al., 1998). Both isoforms differ from the hematopoietic Cbfa 1 (Bae et al., 1995) that arises from exon 1. Notably, Cbfa factors have equal ability to transactivate OC promoter-reported constructs (Baner-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
457
jee et al., 1997). Therefore, the reports of “leaky” OC expression in some nonosseous cells may relate to the presence of Cbfa factors, where different splice variants could account for selective potencies. It is appealing to consider Cbfa 1 of the osteoblast as a master switch factor akin to myoD regulating muscle cell differentiation. It has not been demonstrated that the osteoblast-specific Cbfa 1 factor has the same potency for example as BMP-2, which is competent t o modify the phenotype of a nonosseous cell, diverting the cell to become an osteoblast competent to produce a mineralized matrix (Katagiri et al., 1994). It was reported that forced expression of a Cbfa 1 isoform arising from exon 0 resulted in detectable bone-associated gene mRNAs in nonosseous cells (Ducy et al., 1997). In related experiments using the hematopoietic Cbfa 1 isoform, bone-specific genes could not be activated in nonosseous cells (Tsuji et al., 1998). Antisense inhibition studies that ablate all runt-domain-binding proteins in osteoblasts show a block in extracellular matrix mineralization. Thus, the biological activities of specific Cbfa 1 isoforms remain to be established. Taken together, these findings suggest that the bone restricted Cbfa factors may be critical to maintenance of the osteoblast phenotype and progression to the late stages of differentiation (Banerjee et al., 19971, consistent with postnatal expression of Cbfa 1in mature bone. In summary, there is now sufficient documentation that numerous classes of transcription factors, which are transiently expressed during early embryonic development and specify developmental pattern, position, and differentiation of the skeletal elements, are also reexpressed in the mature osteoblast, regulating several parameters of bone formation. Future identification of the target genes will provide insight for the precise functional roles of these factors in maintaining skeletal homeostasis throughout life.
PARALLELS HORMONAL AND GROWTH C. OSTEOCALCIN EXPRESSION FACTOR MODIFICATIONS OF OSTEOBLAST DIFFERENTIATION Osteoprogenitors (proliferating osteoblasts) are target cells for steroid hormone and growth factors that promote osteoblast differentiation. For example, bone morphogenetic protein-2 directs these cells (Rickard et al., 1994; Hughes et al., 1995) and nonosseous cells (Wang et al., 1993; Katagiri et al., 1994) to a mature osteoblast phenotype reflected by expression of osteocalcin. However, the effects of BMP-2 in osteocalcin gene expression are clearly indirect, usually occurring 2-3 days following BMP-2 exposure. In contrast, a potent enhancer of osteocalcin expression is 1,25(OH),D,, which promotes differentiation of
458
JANE B. LIAN et al.
committed osteoprogenitors to mature osteoblasts. Here a rapid transcriptional increase is observed (Lian and Stein, 1993). Cultures of rat osteoblasts exposed to dexamethasone during the proliferation period results in both an increased number and size of the bone nodules (Shalhoubet al., 1992;Bellows et al., 1987).Postproliferativecultures cannot be stimulated to produce more mineralizing nodules (Shalhoub et al., 1992; Bellows et al., 1987). Fetal rat calvarial-derived osteoblasts lose their phenotypic properties with passaging (Shalhoubet al., 1992;Bellows et al., 1987).Exposure of passaged fetus-derivedosteoblasts after plating during their log growth phase to glucocorticoidsalso results in the formation of mutilayered nodules of osteoblasts and mineralized matrix, as well as modified gene expression that reflects a more differentiated phenotype. Glucocorticoid induces expression of the bone cell phenotype in stromal marrow cell cultures (Chenget al., 1994;Kamalia et al., 1992; Kasugai et al., 1991; Quarles et al., 1992; Chen et al., 1994). Synthetic solubleglucocorticoids(e.g., dexamethasone)profoundly affect transcription of numerous osteoblast parameters, including early response genes, growth-regulated genes, and differentiated associated genes, followed by a cascade of subsequent events (Shalhoubet al., 1992; Wong et al., 1990; Bellows et al., 1987; Centrella et al., 1991; Delany et al., 1994). The accelerated differentiation induced by glucocorticoids is reflected by increased osteocalcin expression (mRNA levels and protein synthesis). Initially, that is in the early postproliferative period, transcription of osteocalcin in increased in the dexamethasone (Dex)-treated cultures compared t o slowly differentiating control cultures. However, in mature osteoblasts, dexamethasone decreases osteocalcin transcription (Morrison and Eisman, 1993; Morrison et al., 1989; Stromstedt et al., 1991; Heinrichs et al., 1993b).Although multiple glucocorticoid response elements (see next section) in the OC promoter contributes to this complex responsiveness (Aslam et al., 1995),the increased expression of osteocalcin in Dex-treated cultures is accounted for by mRNA stabilization (Shalhoub et al., 1998).
IV. PROPERTIES OF THE RATOSTEOCALCIN PROMOTER
A. THE OSTEOCALCIN GENES The human osteocalcin gene has been localized to the 1q distal region of chromosome 1 (Puchacz et al., 1989). A mouse gene (Celeste et al., 1986) has also been mapped to chromosome 3. It is interesting to note that this corresponds to the distal region of human chromosome 1 q (Johnson et al., 1991). From these studies and various reports charac-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
459
terizing gene probes, the osteocalcin gene was initially described as a single-copy gene. However, later studies revealed that three copies of the osteocalcin gene are present in mouse, and perhaps in rat (Rahman et al., 1993; Desbois et al., 1994). Of the three gene copies in mouse, two have similar promoters which regulate tissue-specificexpression in bone. The third gene, designated mOCX (Rahman et al., 1993) or OG3 (Desbois et al., 19941, is regulated by a different promoter that allows for developmental expression of the gene only in several nonbone tissues, including brain, lung, and kidney (Desbois et at., 1994). This promoter lacks the key regulatory basal elements that contribute to bone specific expression (described later) and a vitamin D response element. The coding region of the mOCX-OG3 gene has a similar intron-exon organization as the bone expressed osteocalcin gene but carries five amino acid substitutions, one at the propeptide cleavage site (Rahman et al., 1993). Therefore, it is likely that this protein is not secreted. Indeed, when the osteocalcin gene expressed in bone was ablated in mice (Desbois et al., 1993, no osteocalcin could be detected in either the serum or nonosseous tissues of these mice in which the mOCX-OG3 gene was intact. The function of the nonosseous expressed gene remains to be established. Consideration should be given to the possibilities that it encodes (1)the Gla-containing nephrocalcin isolated from kidney stones (Nakagawa et al., 1991);(2) osteocalcin associated with megakaryocytes and platelets (Thiede et al., 1994) and the hematopoietic environment (Long et al., 1990);and the osteocalcin detected by reversed-transcription polymerase chain reaction (RT-PCR)(Fleet and Hock, 1994) or other methodologies in other nonosseous tissues (Fleet and Hock, 1994;Levyet al., 1983).The cellular levels observed in these nonosseous tissues detected by RT-PCR or only in poly (A)' RNA are three orders of magnitude lower than those found in bone, and polysome association of the mRNA as well as translation of the protein remains to be established. Furthermore, the absence of vitamin-D-responsive regulation of osteocalcin mRNA in peripheral blood platelets, megakaryocytes and nonbone tissue, as well as the inability to demonstrate directly a secreted protein, suggests that control of expression is under a nonskeletal osteocalcin gene promoter. One possibility for this mRNA is a rearranged gene consisting of the osteocalcincoding domain and a unique promoter analogous to that identified in mouse (Rahman et al., 1993; Desbois et al., 1994), or other gene rearrangements. The recent demonstration of secreted osteocalcin protein by a myeloma cell line (NCI-H929)having three copies of chromosome 1 raises this possibility (Barille et al., 1996). Alternatively, aberrant expression of an osteocalcin transactivating factor may contribute to transcription. Nonetheless, the possibility that the osteocalcin in nonskeletal cells and tissues has functional activity remains intriguing.
460
JANE B. LIAN et al.
The bone-expressed human and rat osteocalcin gene promoters have been studied in uivo in transgenic mice (Kesterson et al., 1993; Baker et al., 1992; Sztajnkrycer et al., 1994; Frenkel et al., 1997; Clemens et al., 1997; Sims et al., 1997).When transgenic animals were constructed with 3900 base pairs (bp) of the human osteocalcin promoter fused to the (CAT)reporter (Kesterson et al., 1993; Clemens et al., 1997),expression was observed predominantly in bone, but additionally at reduced levels in hypertrophic chondrocytes and kidney and at very low levels in brain. Osteocalcin expression, regulatable by 1,25(OH),D,, has been found in chick hypertrophic chondrocytes in vitro as the ECM mineralizes; thus, it appears to be under the same regulatory controls as for osteoblasts (Lian et al., 1993a;Clemens et al., 1997). Transgenic mice studies indicate that sequences residing within the proximal 1800 kilobases (kb) of the rat osteocalcin gene promoter support high levels of tissue-specific transcription (Baker et al., 1992; Frenkel et al., 1997). Only trace levels or reporter activity were detected in brain. Tissue-specific transcription of a rat OC promoter-chloramphenical acetyl-transferase (CAT) construct was retained in transgenic mice carrying only 720 nucleotides (nt) of 5' flanking sequences, although the level of expression was dampened (Frenkel et al., 1997). However, this does not preclude the contributions of additional upstream sequences to osteocalcin gene promoter activity. The murine bone specific osteocalcingene exhibits similar cell-specific expression patterns as rat and human, although sequence variations that occur in the vitamin D response elements do not allow enhanced transcription, as occurs in rat and human genes (Clemens et al., 1997; Sims et al., 1997; Lian et al., 1997).
B . ORGANIZATION OF THE BONE-SPECIFIC OSTEOCALCIN GENEPROMOTER The promoters of the osteocalcin genes expressed in rat, human, and mouse bone have a similar overall representation, as well as location of the primary promoter regulatory elements (Fig. 3A). Thus, these genes appear to be organized in a manner that supports similar responsiveness to homeostatic physiologic mediators and developmental expression in relation to bone cell differentiation. In contrast to other bone-related genes (e.g., type I collagen and alkaline phosphatase) (Zernik et al., 1990; Bennett et al., 19891,only a single mRNA transcript has been observed from the osteocalcin gene (Mackowiak et al., 1985).Note that although regulation of expression does not appear to be modulated by changes in the organization of the mRNA transcripts, this does not preclude the presence of sequences in the transcribed region of the osteo-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
461
calcin gene that contributes to control of transcription. In addition to specific promoter sequence, there is evidence for sequences in the first exon and intron that contribute to suppression of osteocalcin transcription, designated as a “silencer”domain (Frenkel et al., 1993,1994; Li et al., 1995;Goto et al., 1996).Although the activity of the OC silencer is profound (up to two orders of magnitude), its physiological role has not yet been clarified. Tissue-specificexpression of a 1.1-kb rat osteocalcin promoter-CAT reporter construct lacking this domain is retained in vitro (Frenkel et al., 1996) and in transgenic mice (Frenkel et al., 1997; Baker et al., 1992). Involvement in developmental control of expression during osteoblast maturation is suggested by variations in protein-DNA interactions, which are observed with nuclear extracts from proliferating cells not expressing osteocalcin compared to differentiated osteoblasts (B. Frenkel, J. Stein, G. Stein, and J. Lian, unpublished data). Studies with the human osteocalcin silencer sequence strengthen this possibility (Li et al., 1995). Identification of promoter regulatory elements (Lian et al., 1989;Theofan et al., 1989)that are responsive to basal and tissue specific transactivation factors, steroid hormones, and other physiologic responses provides a basis for our understanding of regulatory mechanisms contributing to developmental expression of osteocalcin-tissue-specificity and biological activity. The regulatory sequences illustrated in Fig. 3 have been established in the OC gene promoter and coding region by one or more criteria that includes (1)demonstration of an influence on transcriptionalactivity by deletion, substitution, or site-specificmutagenesis; (2) identification and characterization of sequence-specificregulatory element occupancy by cognate transcription factors; and (3) modifications in protein-DNA interactions as a function of biological activity. A series of elements contributing to basal expression include (a) a tumor-associated transplantation antigen (TATA) motif (Lian et al., 1989; Theofan et al., 19891, which is a sequence in the proximal promoter that binds a multisubunit complex containing a CP 1-NFY-CBF-related CCAAT factor complex (Towler et al., 1994a1, and (b) the osteocalcin box (OC box I) (Owen et al., 1990,1993;Heinrichs et al., 1993a, 19951, a 24-nucleotide element with a homeodomain motif as a central core (Hoffmann et al., 1994; Towler et al., 1994b). These elements have been established as required for rendering the gene transcribable. OC box I, the CBFa-AML sites and the steroid hormone response elements are discussed further later. Other regulatory sequences in the OC gene promoter include a series ofAP-1sites (Owen et al., 1990b; Baneljee et al., 1996b; Schule et al., 1990; Bortell et al., 1992, 1993; Jaaskelainen et al., 1994; Lian et al., 1991;Goldberg et al.,
462
JANE B. LIAN et al.
A I
far distal promoter
I
distal promoter
proximal promoter
A
-0.8 kB
-0.6kB
-0.4 kB -0.2kB
OC-BOX II
-
OC-BOX 1
1
I
TGACCC CCAATTAGT CCTGGCAG half HRE & homeodomaln site CAMP RE
B
---
-460
-434
VDR half elements
coo 00 GGGTGAATGAGGACATTACTGAC CGCTCCTT lxi-l m
o
0.
GGGTGAATGAGGACATTACTGACCGCTCCTT
ma
GGGTGAATGAGGACATTACTGACCGCTCCTT
Iyy-1I
6x3 GGGTGAATGAGGACAVACTGACCGCTCCTT
cFOSlcJUN FIG.3. (A) Organization of the bone-specific rat osteocalcin gene promoter showing 1.1 kb of promoter sequences, indicating defined physiologic regulatory elements and the coding region (black boxes, which include 4 exons). Cognate binding factors are shown above the designated regulatory elements. These include the retinoic acid-vitamin D respon-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
463
1996),one of which mediates both TGFp and fibroblast growth factor 2 (FGF-2) responsiveness (Boudreaux and Towler, 1996; Banerjee et al., 1996b), an E box (Tamura and Noda, 1994) that presumably interacts with H-L-H containing-transcription factor complexes (Tamura and Noda, 1994; Siddhanti and Quarles, 1994; Quarles et al., 1997). In the human osteocalcin gene promoter, only an NF-KBsite has been reported to be involved in regulation mediated by tumor necrosis factor (Y (TNFa) (Li and Stashenko, 1993) and an SP-1-like G-C-rich element in the proximal promoter, which bind regulatory repressor proteins may be related to cell type specific expression (Goldberg et al., 1995). The overlapping and contiguous organization of regulatory elements, as illustrated by the TATA-glucocortcoid regulatory element (GRE), Hox-AP-1-OC box I, TGFP-Cbfa 1, and AP-1-YY 1-vitamin D response element (VDRE) provides a basis for combined activities that support responsiveness to physiologic mediators. The majority of the regulatory elements have been identified in the region that spans the promoter from the VDRE domain to the first exon using assays of element or promoter-reporter constructs transiently expressed in cells. However, additional upstream sequences that may contribute to both basal and enhancer-mediated control of transcription and may be required for fidelity of tissue-specific expression when osteocalcin resides in the genome in vivo must be further defined. In the search for DNA sequences involved in the regulation of osteocalcin transcription, one must consider sequences accounting for not only tissue-specificity but developmental regulation of osteocalcin transcription during bone growth. In uivo transcription studies using nuclei from calvaria or long bone show an age-correlated expression (Yoon et al., 1987; Shalhoub et al., 1994). Developmental stages of expression are clear; (1)the absence of osteocalcin expression in proliferating 0steoblast progenitor-like cells; (2) detection in postproliferative committed cells, albeit at low levels; (3) transcriptional up-regulation of the sive element (VDRE),which includes a n m - 1 site and a W1-binding site; a glucocorticoid response element (GRE); and a TGF-P response element (TGRE), which shares responsiveness to fibroblast growth factor (FGF) and binds AP-1 factors. The conserved osteocalcin boxes I and I1 (OC box) and the TATAmotif are the primary proximal transcription regulatory elements. OC box I includes the MSX homeodomain-binding motif as the central core, a cyclicAMP (CAMP)response motif, flankingm-1 sites, and a contiguous E box. OC box I and OC box I1 bind osteoblast-specific complexes are designated OCBP-1 and OCBP-2. OCBPS has been identified as a CBFAl (AML-3bCBFPheterodimeric complex. Several sites of interaction (sites A, B, and C) with a nuclear matrix protein complex are recognition motifs for runt-domain homology proteins as AML-CBFa. (B) Sequences and protein-DNA contacts (circles) for recognition motifs in the VDRE are shown.
464
JANE B.LIAN et al.
gene in osteoblasts during mineralization of the matrix in vitro and during bone growth in uivo; and (4) a decline in transcriptional activity after the postnatal growth period i n viuo and in osteocytes i n uitro (Malavalet al., 1994).This developmental regulation is operative in the presence of the steroid hormones (Owen et al., 1993; Lian et al., 1994). However, this level of osteocalcin transcriptional control is abrogated to a significant effect in osteosarcoma cells (Bortellet al., 1993;Lian et al., 1992, 199313; Shakoori et al., 1994). In addition to elements within the osteocalcin promoter contributing to either suppression or activation of transcription, the representation of several transcription factor complexes within the osteoblast, interacting with specific sequences, varies as a function of cellular differentiation (Hoffmannet al., 1994;Owen et al., 1993;Heinrichs et al., 1995; Banerjee et al., 1996a; Ducy and Karsenty, 1995; Bortell et al., 1992). This provides another level of regulation for control of transcriptional activity and several of these factors have now been identified. Scanning of the promoter for sequences interacting with complexes formed only in osteoblastic cell extracts (e.g., mouse MC3T3-E1, rat calvarial osteoblasts) have been a useful first step in identifying putative regulatory signals. Contributions by multiple elements to bone-specific expression of osteocalcin are implicated (Towler et al., 1994a; Heinrichs et al., 1995; Bidwell et al., 1993; Ducy and Karsenty, 1995).Additionally, gel mobility shift assays, footprint analysis, and partial characterization of the proteins that form complexes that associate with both basal and steroid hormone response elements indicate that distinct transcription factors are present in nuclear extracts from proliferating osteoblasts (not expressing osteocalcin) when compared to postproliferative osteoblasts. These modifications support developmental regulated expression during osteoblast differentiation. In osteosarcoma cells, further differences in the element-specific associated factors are observed (van den Ent et al., 1993;Bortell et al., 1993;Lian et al., 1992, 1993b;Shakooriet al., 19941,and osteosarcoma cell lines exhibiting different phenotypic properties (Rodan and Noda, 1990)can provide valuable information as well. A third level of regulation involves the ability of hormones or growth factors t o modulate binding of nonreceptor transcription factors to other regulatory sequences. For example, vitaminD-induced interactions occur at the basal OC box I and TATA domain (Hodgkinson et al., 1993; Owen et al., 1993; Bortell et al., 1992). It is this complexity that allows for hormone responsiveness in relation to either basal or enhanced levels of expression. The specificprotein-DNA interactions as they relate to transcriptional-activity-mediating developmental and tissue-specific expression of osteocalcin are described in
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
465
detail later for each of the characterized regulatory sequences of the osteocalcin gene.
C. OSTEOCALCIN PROMOTER ELEMENTS MEDIATINGDEVELOPMENTAL AND TISSUE-SPECIFIC REGULATION 1. The Conserved OC Box I: A Homeodomain Protein-Binding Site
The transcription factor complexes binding to OC box I have been partially characterized. Several functional experimental approaches (includingmutation and analysis of the element with transfections into osseous and nonosseous cell lines and overexpression or antisense inhibition of putative transcription factors) strongly support a role for this element in bone-specific osteocalcin gene expression. The OC box I site interacts with a novel bone-specific binding protein and homeodomain transcription factors that regulate skeletal development and specific pattern formation in the embryo. Promoter deletion and mutational analysis of the OC box I (nt -99 to -76) have demonstrated that this sequence is required for basal expression (Hoffmannet al., 1994,1996;Towler et al., 1994a;Heinrichs et al., 1995).This highly conserved 24-nt domain is identical in mouse and rat; the human has only 2 nt substitutions. However, these two nucleotides can be attributed to selective binding of species specific complexes (Heinrichs et al., 1993a, 1995). We first described the OC box with a central core CCAAT motif flanked by two AP-1 sites (Owen et al., 1990b).Several studies have confirmed that none of the known CCAAT box binding factors (CBF-NFY, C-EBP, and TF-NF1) interact with the OC box I sequence (Towleret al., 1994a).Rather, there are striking similarities between sequences residing within the OC box and homeodomain protein-binding sites (CAATTAGT) (Hoffmann et al., 1994, 1996;Towler et al., 1994a,b;Heinrichs et al., 1993a;Catron et al., 1993). Mutational analysis and competition gel mobility or transcription assays provide evidence for binding MSX-1and MSX-2 proteins, members of the Msh homeodomain gene family, to the OC box (Hoffmann et al., 1994; Towler et al., 1994b),as well as rHox (Hu et al., 1999, a member of the Engrailed gene family, and Dlx-5 (Ryoo et al., 1997),a member of the Distal-less family of homeobox-containinggenes essential for limb development (Lufkin et al., 1992; Ferrari et al., 1995). Several studies have established suppressor regulation of the OC gene by these MSX2 homeodomain proteins (Hu et al., 1995;Hoffmann et al., 1994,1996). MSX-2 mRNA levels decline from the growth to differentiation periods in fetal rat calvaria-derivedosteoblast cultures (Hoffmannet al., 1994),
466
JANE B. LIAN et al.
which is consistent with MSX-2 mediating down-regulation of osteocalcin transcription. Dlx-5, which is expressed in mature osteoblasts when osteocalcin expression is maximal, may serve as a transcriptional repressor compatible with regulation of genes expressed in postproliferative bone cells. It appears that there is a requirement to stringently control the levels of the gene product osteocalcin to modulate physiological regulation of skeletal homeostasis. It is becoming increasingly evident that selective utilization of promoter regulatory factors provides the required flexibility to execute such control under diverse biological conditions. Can one attribute tissue-specific regulation of osteocalcin to homeodomain proteins based on these observations? Interestingly, a domain in the mouse a1 collagen promoter confers a high level of osteoblast expression (Pavlinet al., 1992;Liska et al., 1994; Rossert et al., 1996), and this enhanced activity may involve homeodomain protein binding (Rossert et al., 1996; Dodig et al., 1996). A molecular mechanism for consideration in osteocalcin gene activation at the OC box is through binding of a nonhomeodomain protein. We have shown by gel-binding assays that complexes unrelated to Hox proteins binds to the OC box at nucleotides that overlap and flank the core Hox-binding site and this complex, designated OCBP-1, is present only in osteoblasts (Hoffmann et al., 1996). Mutations within the OC box that abrogate binding of the Hox proteins and/or mediate enhancement of binding of the osteoblast-specific complex, results in 2 to 3-fold enhanced transcriptional activity (Hoffmann et al., 1996). The data suggest mutual exclusive occupancy of these two classes of transcription factors, the osteoblast-specific complex, and the homeodomain proteins based on competition and methylation interference studies. However, the function of this factor can only be clarified by cloning and directly testing functional activity by overexpression of the factor. In conclusion, the finding of an osteoblast-specific complex-regulating enhancement of promoter activity together with the observation that a mutation in the OC box permits transcription in nonosseous cells and osteoblasts that do not express osteocalcin (e.g., UMR cells, R2 fibroblasts, FRTL thyroid cells, and HeLa cells), strongly supports the contribution of the OC box in regulating tissue-specific expression of the gene. OC box I is also involved in mediating cyclic AMP (CAMP)responsiveness (PuGGTCAmotif) (Towler and Rodan, 1995). This finding was corroborated in a study examining the rapid response of the OC promoter to parathyroid hormone (PTH) (Yu and Chandrasekhar, 1997). Although the novel CAMPresponse region overlapping the OC box I is essential, full activation appears to require several putative CAMPresponse elements throughout the promoter.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
467
Notably, contiguous to the OC box resides an E box motif postulated t o also contribute to suppression of osteocalcin gene transcription in proliferating osteoblasts and perhaps nonosseous cells. E box motifs bind the Id helix-loop-helix regulatory molecules (Kawaguchi et al., 1992; Tamura and Noda, 1994; Siddhanti and Quarles, 1994). Id is not detected in postproliferative osteoblasts and over expression of Id in MC3T3-El cells suppresses osteoblast differentiation and osteocalcin expression (Murray et al., 1992; Ogata and Noda, 1991). Furthermore, it has been shown that 1,25(OH),D, down-regulates Id expression in Ros 17-2.8 cells (Kawaguchi et al., 19921, conditions that lead to increased osteocalcin expression (van den Ent et al., 1993; Bortell et al., 1993). However, identity of the factor interacting with the OC E box awaits further characterization. Furthermore, Quarles et al. (1997) have shown by mutagenesis of the OC E box sequence that activity of these factors may not be globally essential. In summary, several classes of transcription factors can bind the E-OC box domain contributing to tissue-specific and developmental regulation of the gene by suppressing its activity in nonosseous and proliferating or immature osteoblasts and activating transcription postproliferatively. Caution must be exercised in making generalization about H-L-H protein control of bone related gene transcription. 2. The Cbfa IAML Sequences: Runt Homology Domain Protein-Binding Sites Three sites in the rat promoter (Fig. 3A) were first identified as a consensus sequence in the rat osteocalcin promoter that bound an osteoblast-specific nuclear matrix complex, designated NMP2 (Bidwell et al., 1993; Merriman et al., 1995).The nuclear matrix is an anastomosing network of filaments that provides both structural framework, connecting the nucleus to the cytoplasm, and functions in concentrating and harboring transcription factors as well as providing scaffoldingproteins that bind genes in specific conformations. These sites were established as DNA binding sequences for runt homology domain proteins AMLCBFA-PEBPa transcription factor family (Merriman et al., 1995).These sites also bind an osteoblast-specific nuclear extract complex (Bidwell et al., 1993;Merriman et al., 1995; Banerjee et al., 1996a; Lian et al., 1996; Ducy and Karsenty, 1995).Aseries of studies including competition studies and antibody supershifts of the osteoblast specific complex and the effect of forced expression of CBFA proteins on OC promoter activity established that the CBFA-AML family of proteins regulates osteocalcin expression and functions as a potent enhancer element (Banerjee et al., 1996a, 1997;Ducy et al., 1997; Geoffroy et al., 1995).
468
JANE €3. LIAN et a1
Sequential deletion of 5’ regulatory sequences of the rat (Banerjee et al., 1996b; Hoffmann et al., 1994) established that the proximal Cbfa site (nt - 138 to - 1301, designated site C or OC box I1 (Banerjee et al., 1996a;Bidwell et al., 1993;Merriman et al., 1995)in rat (Banerjee et al., 1996a) and OSE2 in mouse (Geoffroy et al., 19951, contributes t o 75% of basal transcription. Furthermore, a single Cbfa motif of the rat site C (Banerjee et al., 1997)or multimers of mouse OSE2 (Ducy et al., 1997) could confer expression of an OC promoter fragment in nonosseous cells when AML-1B-Cbfa2 was overexpressed (Banerjee et al., 1997). However, our most recent studies (A. Javed, unpublished observations in this laboratory) indicate that mutation of site C-OC box I1 alone within the context of the full OC promoter (- 1100 nt) minimally decreases promoter activity. Only when all three Cbfa recognition sites A, B, and C are mutated, does transcription decrease to 20%of control levels. The residual tissue-specific activity is contributed by the OC box I. These findings suggest a required synergy among the sites for transcriptional control of osteocalcin expression. The .mechanisms accounting for this regulation involve association of Cbfa factors with the nuclear matrix (see Section IV,D). Fundamental questions remain to be addressed related to Cbfa 1regulation of osteoblast-expressedgenes. These include (1)the specific biological activities of different Cbfa proteins present in osteoblasts at different stages of maturation; (2) the sequence-specificpromotor context for binding of individual isoforms; and (3) the regulation of activity of Cbfa factors by interaction with several classes of partner proteins. These partners include heterodimerization with either Cbfp, which results in a transcriptional activator complex, or Groucho/transducin-like enhancer of split (TLE)(Aronsonet al., 1997;Stifani et al., 19921,which represses Cbfa 1activity on the osteocalcin promoter (Guo et al., 1998; Thirunavukkarasu et al., 1998). An additional function of Cbfa complexes that is suggested from mutational analysis of the osteocalcin gene (Javed et al., 1998) and other studies (Palaparti et al., 1997) is a contribution to chromatin organization. Like osteocalcin, the TGFp receptor promoter (Ji et al., 1997) and bone sialoprotein promoter have multiple Cbfa sites which may function in promoter structural oranization through interactions with the nuclear matrix (Stein et al., 1997). Complex splicing variants generate several Cbfa 1proteins (Geoffroyet al., 1998; Stewart et al., 1997)that heterodimerize with members of the CBFP family exhibit tissue-restricted modifications. To what extent these factors contribute to tissue-specific gene regulation remains to be established.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
469
Together, characterization of OC box I and the Cbfa 1sites supports the concept that multiple elements contribute to and may be necessary for stringent tissue-specific gene expression or they may serve redundant functions. It is also of interest t o note that the Cbfa 1site C is contiguous to the AP-l-like sequence that mediates TGFp (Banerjee et al., 1996b) and fibroblast growth factor 2 (FGF-2)(Boudreaux and Towler, 1996)responsiveness. Thus, this conserved OC box I1 domain (Fig. 3A) appears to be a critical element in modulating both tissue-specific and physiological responsiveness of the OC gene. OF DIFFERENT SIGNALING PATHWAYS D. AP-1 SITES:CONVERGENCE
There are several AP-1 motifs within the osteocalcin gene promoter that function as independent elements or overlap other regulatory domains and have shared responsiveness to other physiologic regulators. Initially, two AP-1 sites within the OC box were identified by their ability to bind fos and jun heterodimer complexes (Owen et al., 1990b). However, it is now understood that transcriptional activity at the OC box is mediated largely through the homeodomain protein binding site. In the rat promoter, a single AP-l-like motif mediates TGFp (Banerjee et al., 1996b) and FGF (Boudreaux and Towler, 1996) responsiveness. In the human osteocalcin gene promoter, an additional AP-1 site located between the VDRE and the OC box with homology to a collagen repressor element, functions in suppressing osteocalcin transcription and also influences vitamin D regulation (Goldberget al., 1996). An AP-1 site lies within the vitamin D response element of the rat osteocalcin promoter but is contiguous to the VDRE in the human OC promoter (Ozono et la., 1991).The regulation of AP-1 family members by steroid hormones and their interactions with the steroid receptor has been reviewed (Hyder et al., 1994; Landers and Spelsberg, 1992; Saatcioglu et al., 1994).Functional interactions of the vitamin D receptor by AP-1 binding has been reported in several studies (Owen et al., 1990b; Lian et al., 1991; Breen et al., 1994). The rat osteocalcin VDRE binds recombinant AP-1 factors or AP-1 factors from nuclear extracts of proliferating osteoblasts when minimal binding of VDR occurs, suggesting mutually exclusive occupancy by these factors (Owen et al., 1990b).In studies where the steroid half-elements in the VDRE are mutated, but the AP-1 sequence was retained in rat OC promoter-CAT reporter gene, suppression of promoter activity was observed in the presence of vitamin D, supporting the hypothesis that binding of AP-1 factors oppose the enhancer activity of the vitamin D receptor (VDRI-retinoid X receptor (RXR) heterodimer complex. However, mutations of 2 nt in the
470
JANE B. LIAN et al.
n = 3 spacer of the rat VDRE, which abrogated binding of AP-1 factors and retained VDR-RXR binding, resulted in loss of vitamin-D-mediated enhancer activity (Aslam, 1996; L. R. McCabe, J., Stein, G., Stein, and J. Lian, unpublished observations in this laboratory). This observation suggests that synergistic interactions between AP-1 factor and the VDR-RXR complex may be required for enhancer activity. Notably, the mouse osteocalcin VDRE lacks an internal or contiguous AP-1 motif and is resistant to enhancer activity by 1,25(OH),D3 (Clemens et al., 1997; Lian et al., 1997; Sims et al., 1997). A fra-%containing complex has been shown t o associate with the native rat OC VDRE sequence (McCabe et al., 1996) supporting the general concept that steroid hormone receptor complexes have multiple options for protein-protein interactions to respond to physiological requirements for transcriptional activity of the gene. The significance of fra-2 binding to osteocalcin AP1sites is discussed later. AP-1 activity is maximal in proliferating osteoblasts, consistent with a mode of phenotype suppression that was proposed to explain the absence of osteocalcin transcription and vitamin D inducibility in proliferating cells (Lian et al., 1991). We addressed the mechanism by which suppression of osteocalcin transcription mediated by binding of c-fos and c-jun heterodimers can be reversed postproliferatively when the gene is transcribed. One experimental approach was to examine expression (mRNA and protein levels) of the various fos and jun family members (McCabe et al., 1996). We found fra-2, jun-D, and jun-B protein and mRNA to remain at detectable levels in differentiated 0steoblasts, whereas c-fos and c-jun declined rapidly after the proliferative period. Indeed, the composition of the AP-1 heterodimer complex in differentiated osteoblasts could be accounted for largely by frai2 and jun-D. To test if these family members could functionally regulate the osteocalcin gene, they were overexpressed in ROS cells together with rat OC promoter-deletion constructs. Three- to 4-fold elevations in OC promoter activity were conferred on overexpression of fra-2 and jun-D, whereas c-fos-c-jun decreased promoter activity. Thus, the representation of fra-2 and jun-D in differentiated osteoblasts may account for the high basal levels of osteocalcin transcription that occur as the 0steoblasts mature during mineralization of the extracellular matrix. The enhancer activity was confined largely to the AP-1 site (nt -146 to - 139),which lies contiguous to the Cbfa 1sequence in the proximal promoter (Banerjee et al., 1996a,b);however, fra-2 binding to the VDRE may contribute to the enhancer activity of 1,25(OH),D3. One can conclude that the selective representation of high levels of fos/jun family members during osteoblast differentiation, and the ability for these het-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
47 1
erodimers either to suppress or enhance OC, support the concept that AP-1 sites are key components of developmental regulation of osteocalcin expression. The AP-1 site at nt - 146 to - 139 in the rat osteocalcin promoter, in addition t o its role in regulating basal transcription, can mediate physiologic responsiveness to growth factors. TGFp1, a regulator of bone development, suppresses osteocalcin transcription and promoter activity (Banerjee et al., 1996b; Price, 1988; Pirskanen et al., 1994). The TGFp response element in the proximal region of the rat osteocalcin promoter has been characterized by promoter deletion and mutation analysis (Banerjee et al., 1996b),in which both transcriptional activity and transcription factor binding were assayed. This led t o the identification of an AP-1-CAMP response element (CRE)like sequence in the rat promoter, TGCAGTCA, as the osteocalcin gene TGFp response element. Antibody supershift analysis established that fra-2 is a component of the AP-1 heterodimer binding to the TGFp response element, and fra2 appears to be posttranslationally modified in response t o TGFp (Banerjee et al., 1996b). The data suggests a mechanism whereby TGFpl induces phosphorylation of fra-2 in repression of OC gene transcription. TGFp activity is thus linked to other signaling pathways operative in the control of osteocalcin gene transcription, reflected by binding of proteins encoded by the fos-jun early response gene family t o the osteocalcin TGFP-promoter element. Of interest is the recent finding that basic bFGF or FGF-2 responsiveness of the rat OC promoter is also mediated in part by activities at this AP-1 site (nt - 144 t o -138, GCAGTCA) (Boudreaux and Towler, 1996). FGF-2 responsiveness, however, requires in addition the PuGGTCA motif at -99 t o -90 in the OC box I domain. This motif is one of two PuGGTCA sequences that maps to CAMPresponsiveness (Towler and Rodan, 1995). This CAMPresponse element is also involved in transient parathyroid hormone effects on osteocalcin promoter activity (Yu and Chandrasekhar, 1997).Although mutation and transfection studies in bone cells clearly establish the AP-1 element (nt -144 to -138) both as a TGF-p response element (TGRE) and an FGF response element (FGRE), what cannot be evaluated for comparison are the involved DNA binding factors. The studies characterizing the TGRE and FGRE used nuclear extracts from different cell types and stages of maturation. Because FGF-2 enhances (while TGFp represses) osteocalcin transcription, the interrelationship of transcription factors mediating these responses become important. Thus, it appears that several independent signaling pathways can converge in modulating OC gene transcription at several AP-1 sites and three of these overlap regulatory do-
472
JANE B. LIAN et a1
mains essential for transcription, OC box I, OC box 11-site C, and the VDRE. ELEMENTS CONTRIBUTING TO STEROID RESPONSIVENESS E. PROMOTER The two steroid hormones, glucocorticoids and 1,25(OH),D,, have complex effects on osteoblast growth, differentiation, and cellular activities related to bone turnover. Furthermore, steroid hormone effects in uitro are dependent on species and origin of the osteoblast [vertebrae or long bone (Suwanwalaikorn et al., 199711 coupled with the maturational stage (osteoprogenitors compared to differentiated phenotype). Several unique features of the osteocalcin gene steroid hormone response elements enable the osteocalcin gene to respond to these hormones under the diverse biologic conditions that results as a consequence of stimulation of osteoblast growth or maturation. By appreciating the contribution of specific modifications of transcription factors related to the cellular phenotype and the cascade of factors regulated by steroid hormones that impinge on specific recognition sequences and crosstalk between regulatory sequences (Nanes et al., 1994; Zernik et al., 19901, molecular mechanisms can be dissected that allow for such physiologic control of transcriptional activity. The glucocorticoid regulatory element of the human osteocalcin gene that was initially characterized is associated with the TATA domain (Stromstedt et al., 1991; Morrison and Eisman, 1993). Glucocorticoids mediate transcriptional down-regulation of the rat and human osteocalcin promoters in ROS 17-2.8 cells and human osteoblasts (Liggett et al., 1994; Jaaskelainen et aZ., 1994). The presence of glucocorticoid regulation (GR)binding sites in close proximity to the basal TATA box suggests interference of GR with the positive transcription factors, such as TFIIB, as a mechanism for negative regulation of osteocalcin by glucocorticoids. Glucocorticoid regulation of gene transcription has been well documented to involve GR-protein interactions at the same sites or other sites, including AP-1 regulatory sequences truss and Beato, 1993; Miner and Yamamoto, 1991; Saatcioglu et al., 1994). The rat promoter exhibits both suppressor activities [e.g., in ROS 17-2.8 cells (Jaaskelainen et al., 1994)l and enhanced transcription by glucocorticoid [e.g., in immature osteoblasts (Shalhoub et aZ., 199211. From studies of the rat osteocalcin promoter, it is now appreciated that multiple GRE domains are involved in modulating glucocorticoid effects on osteocalcin gene transcriptional activity (Heinrichs et al., 1993b;Aslam et al., 1995). The highly homologous TATA-GRE domain in the rat and human osteocalcin genes, and the additional high-affin-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
473
ity GREs downstream of the TAT and upstream of the VDRE in the rat gene, are illustrated in Fig. 3. For both genes, these sites were identified using purified glucocorticoid receptor and 32P-labeled DNA fragments, confirming protein-DNA interactions at single-nucleotide resolution by DNase I footprinting and methylation interference assays. Analysis of transcriptional activity by promoter-CAT constructs and protein-DNA binding assays revealed that the distal consensus nGRE (nt -697 to -683) contributed to glucocorticoid suppression of promoter activity. The strong suppressor activity of the distal GRE is consistent with its nucleotide sequence (Truss and Beato, 1993). The proximal GRE (nt -16 to -1) could contribute to both positive or negative control of osteocalcin transcription (Aslam et al., 1995).Analysis of the DNA-binding complexes at the proximal and distal sequences indicate modifications of GR interactions as a function of the transcription activity of dexamethasone on endogenous expression during osteoblast differentiation (Aslam et al., 1995). Note that dexamethasone also has significant effects in stabilizing osteocalcin mRNA, thereby providing a mechanism to support increased protein synthesis in dexamethasone differentiated osteoblasts when transcription is down-regulated (Shalhoub et al., 1998). In addition to these two functional GREs, DNase I, and dexamethasone (DMS) protection assays of purified glucocorticoid receptor bound to osteocalcin DNA fragments identified two seroid half-elements at -98 to -93 and - 114 to - 109, separated by 10 nucleotides, located within and immediately upstream of the rat osteocalcin box (Heinrichs et al., 1993b). Mutation of the high-affinity GRE (- 16 to - 1)in a promoter-CAT construct containing either -348 or -108 nt resulted in only partial loss of the response to dexamethasone, implicating potential utilization of these proximal promoter GR binding sites (Aslam et al., 1995). However, only mutation of all GR binding sites (distal and proximal domain) simultaneously will completely abrogate dexamethasone responsiveness (Aslam, 1996).Notably, the half-steroid motifs have been reported to potentially mediate other activities. In the rat osteocalcin promoter, these motifs mediate CAMPresponsiveness and they bind complexes that recognize the thyroid hormone element palindrome (Towler and Rodan, 1995). In summary, these data demonstrate that multiple sites integrate glucocorticoid regulation of the osteocalcin gene, contributing to the complexity that supports steroid-hormone-dependent transcriptional activities that are unique in various cells. Additionally, glucocorticoid receptor binding within the proximal promoter region of the osteocalcin gene may provide different mechanisms by which glucocorticoids
474
JANE B. LIAN et al.
can exert their effects on basal and vitamin-D-enhanced osteocalcin gene expression or in response to other effects. The vitamin D responsive elements of the rat and human osteocalcin genes have been identified and characterized by several approaches (Morrison et al., 1989; Demay et al., 1990,1992a;Markose et al., 1990; Kerner et al., 1989; Terpening et al., 1991). The osteocalcin VDRE was the first to be identified and is similar to the family of related steroid response elements (Truss and Beato, 1993). The VDRE functions as an enhancer (Yoon et al., 1988;Breen et al., 1994;Morrison et al., 1989;Demay et al., 1990; Markose et al., 1990; Kerner et al., 1989;Terpening et al., 19911, but the VDRE transcription factor complex appears to be a target for modifications in vitamin-D-mediated transcription by other physiologic factors, such as glucocorticoids (Godschalk et al., 1992; Schepmoes et al., 1991), TGFp (Pirskanen et al., 1994; Staal et al., 19941, retinoic acid (MacDonald et al., 19931, and TNFa (Nanes et al., 1994; Mayur et al., 1993). The minimal VDRE is characterized by two half-steroid motifs (either perfect or imperfect direct repeatskeparated by 3 nt indicated by protein-DNA contacts and mutational analysis (Morrison et al., 1989; Demay et al., 1990,1992a;Markose et al., 1990;Kerner et al., 1989;Terpening et al., 1991).Characterization of the VDRE in other vitamin-Dregulated genes [osteopontin (Nodaet al., 1990;Zhang et al., 1992;Rafidi et al., 19941, calbindin D9K (Darwish and DeLuca, 1992), calbindin D28K (Gill and Christakos, 19931,PTH (Demayet al., 1992b),the transcription factor Pit-1 (Rhodeset al., 1993),the integrin p3 subunits (Cao et al., 19931, and the vitamin D, 24-hydroxylase enzyme gene (Zierold et al., 1994; Ohyama et al., 199411 show similar features. Notably, the VDRE of the PTH gene mediates transcriptional down-regulation and regulation of the 24(OH)ase gene is controlled by two independent VDREs. Studies have shown that the thyroid hormone, retinoic acid, and vitamin D receptors can activate from the steroid “core”direct repeat but with different spacers (Perlmann et al., 1993;Umesono et al., 1991;Yu et al., 1991;Carlberg et al., 1993;Kliewer et al., 1992;Schrader et al., 1993). These receptors, including the VDR, can form heterodimers in vitro with the receptor for 9-cis-retinoic acid (9-cis-RA)or RXR (Perlmann et al., 1993; Carlberg et al., 1993; Kliewer et al., 1992; Schrader et al., 1993; Towers et al., 1993; Freedman et al., 1994; Nishikawa et al., 1994; Cheskis and Freedman, 1994).The osteocalcin gene is stimulated by RXR-VDR heterodimers, and 9-cis-RA inhibits 1,25-dihydroxyvitamin D, activation by decreasing availability of the RA receptors (MacDonald et al., 1993). These possibilities provide for regulated activity under diverse biological conditions.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
475
Multiple factors appear t o contribute to the formation of the VDR complex in uiuo, including the possibility for homo- or heterodimer formation with RXR (as discussed above). The transactivation complex of the osteocalcin VDRE formed from nuclear extracts of osteoblast complex formation is potentially influenced by other cell specific nuclear accessory factors, coactivators, or corepressors (Horwitz et al., 1996; Ross et al., 1992; Nakajima et al., 1994; Sone et al., 1991; Oiiate et al., 1995; Li et al., 1997a,b; Schroen et al., 1997; Masuyama et al., 1997); interactions with other transcription factors [e.g., the TATA binding factor TFIID (MacDonaldet al., 1995; Blanco et al., 199513;involvement of the ligand in VDR stabilization (Cheskis and Freedman, 1994; Pan and Price, 1987; Wiese et al., 1992;Arbour et al., 1993; Ross et al., 1993);receptor levels modulated by physiologic factors (Mahonen et al., 1990; Van Leeuwen et al., 1990; Krishnan and Feldman, 1991);phosphorylation of the receptor (Brown and DeLuca, 1990;Jurutka et al., 1993;Darwish et al., 1993; Desai et al., 1995); and vitamin D receptor gene polymorphisms (Morrison et al., 1992). The osteocalcin VDRE functions as an enhancer; it cannot induce transcription but requires basal expression and, furthermore, the increases in transcription are regulated by basal levels. What molecular mechanisms are operative at the osteocalcin VDRE that control these refinements for vitamin D enhancement? For example, why is VDR receptor complex formation at the osteocalcin VDRE either blocked or inactive in proliferating osteoblasts? What allows for a 10- to 20-fold enhanced transcription when basal levels are very low, whereas other vitamin-D-regulated genes (e.g., osteopontin and collagen) are responsive and only a 2- to 3-fold increase when osteocalcin expression is maximal (Owen et al., 1991; Lian et al., 1989; Lian et al., 1994)? Several possibilities for this regulation exist, including evidence for (1) “crosstalk” between activities at the VDRE and proximal basal elements in rat osteocalcin promoter (Bortell et al., 1992; Blanco et al., 1995; MacDonald et al., 1995; Guo et al., 1997);(2) modifications in activity of the VDR-RXR through protein interactions with coactivators (Horwitz et al., 1996; Li et al., 1997b); (3) 1,25(OH),D, regulation of transcription factors contributing to osteocalcin basal expression as Msx-2 (Hodgkinson et al., 1993; Hoffmann et al., 1994) and CBFAl (Zhang et al., 1997); (4) binding of transcription factors other than the VDR-RXR complex to DNA-binding sequences that overlap the steroid half-elements (Fig. 3B); ( 5 ) synergism with other regulatory elements (Sneddon et al., 1997); and (6) chromatin modifications induced by the steroid hormone (Montecino et al., 1996, 1997). Our studies indicate subtle differences in the properties of the vitamin D receptor complex-
476
JANE B. LIAN et al.
es that bind to the rat osteocalcin VDRE are related to the cellular phenotype (e.g.,osteosarcoma, proliferating and differentiated, and diploid cells) (Owen et al., 1993; Bortell et al., 1993; Shakoori et al., 1994; Lian and Stein, 1992). Differences in vitamin D regulation of osteocalcin transcription among the species (e.g.,human, mouse, and rat) may also be accounted for by nucleotide variations of the steroid half-elements and flanking sequences. Notably, although rat (Baker et al., 1992; Frenkel et al., 1997) or human (Kesterson et al., 1993; Clemens et al., 1997; Sims et al., 1997) OC promoter-reporter constructs expressed in transgenic mice or expressed in mouse MC3T3-El cells (Lian et al., 1997)respond to 1,25(OH),D3in the expected 3- to 6-fold increases in transcription, the endogenous mouse OC gene either is not induced or is down-regulated. This sequence-specific regulation by 1,25(OH),D, of mouse OC promoter-reporter constructs was confirmed in uitro osteoblast models [e.g., ROS 17/23 cells (Lian et al., 1997)l. Several possible mechanisms may explain these findings. As described in Section IV,C, AP-1 sequences associated with the rat and human osteocalcin genes are likely a contributing mechanism to the level of vitamin D regulation, but AP-1 sequences do not occur within or contiguous t o the mouse VDRE. The putative mouse VDRE was shown to bind the VDR-RXR heterodimer complex in one study (Lian et al., 19971,but not another report (Zhang et al., 1997), and was down-regulated by 1,25(OH),D3 on a heterologous promoter (Lian et al., 1997). However, a functional mouse VDRE has not been demonstrated by mutational analysis of the mouse promoter. Studies from our group provide evidence for another viable mechanism that influences VDR-mediated activity at the rat osteocalcin VDRE (Guo et al., 1997). W1 is a multifunctional transcription factor (Shrivastava and Calame, 1994; Bushmeyer et al., 1995),and we have identified a YY1 recognition sequence that overlaps the proximal halfsteroid motif of the VDRE. This functional sequence mediates YY1-dependent repression of 1,25(0H),D3-enhanced osteocalcin gene promoter activity (Guo et al., 1997). This recognition sequence is not present in the osteopontin VDRE, a gene that is expressed and vitamin-D-regulated in proliferating osteoblasts. As TFIIB, a TATA binding factor, and the VDR can interact directly (MacDonald et al., 1995; Blanco et al., 1995), and YY1 can function like a TATA-binding protein (Usheva and Shenk, 19941,a plausible mechanism of activity is that YY1-VDRE interactions interfere with the DNA-binding-dependent TFIIB-VDR interaction and consequently abrogates vitamin D enhancement of osteocalcin gene transcription in uiuo. This activity of YY1 at the OC VDRE may involve transient association of YY1 with the nuclear ma-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
477
trix (see Section V,C). Taken together these relationships may provide an explanation for positive or negative activity of a single regulatory sequence under different biological conditions.
V. CHROMATIN STRUCTURE, NUCLEOSOME ORGANIZATION, AND OSTEOCALCIN GENE-NUCLEAR MATRIX INTERACTIONS SUPPORT INTERRELATIONSHIPS BETWEEN ACTIVITIES AT MULTIPLE
INDEPENDENT PROMOTER ELEMENTS OF NUCLEAR ARCHITECTURE CONTRIBUTE A. PARAMETERS TO TRANSCRIPTIONAL CONTROL
There is a growing awareness of functional interrelationships mediating nuclear structure and function. Historically, there was a perceived dichotomy between regulatory mechanisms supporting gene expression and components of nuclear architecture. However, this parochial view is rapidly changing. The emerging concept is that both transcription and DNA synthesis occur in association with structural parameters of the nucleus. Consequently, it has become increasingly evident that the cellular and molecular mechanisms must be defined that contribute to both the regulated and regulatory relationships of nuclear morphology to the expression and replication of genes. During the past several years, there has been an accrual of insight into the complexities of transcriptional control in eucaryotic cells. Our concept of a promoter has evolved from the initial expectation of a single regulatory sequence that determines transcriptional competency and level of expression. We now appreciate that transcriptional control is mediated by an interdependent series of regulatory sequences that reside 5',3' and within transcribed regions of genes. Rather than focusing on the minimal sequences required for transcriptional control t o support biological activity, efforts are being directed toward defining functional limits. Consequently, contributions of distal flanking sequences to regulation of transcription are being experimentally addressed. This is a necessity for understanding mechanisms by which multiple promoter elements are responsive to a broad spectrum of regulatory signals and the activities of these regulatory sequences are functionally integrated. Crosstalk between a series of regulatory domains must be understood under diverse biological circumstances where expression of genes supports cell and tissue functions. The overlapping binding sites for transcription factors within promoter regulatory elements and protein-protein interactions that influence tran-
478
JANE B. LIAN et a1
scription factor activity provide further components of the requisite diversity to accommodate regulatory options for physiologically responsive gene expression. As the intricacies of gene organization and regulation are elucidated, the implications of a fundamental biological paradox become strikingly evident. How, with a limited representation of gene-specific regulatory elements and low abundance of cognate transactivation factors, can sequence-specific interactions occur to support a threshold for initiation of transcription within nuclei of intact cells? Viewed from a quantitative perspective, the in uiuo regulatory challenge is t o account for formation of functional transcription initiation complexes with a nuclear concentration of regulatory sequences that is approximately 20 nucleotides per 2.5 yards of DNA and a similarly restricted level of DNA binding proteins. There is a growing appreciation that nuclear architecture provides a basis for support of stringently regulated modulation of cell growth and tissue specific transcription that is necessary for the onset and progression of differentiation. Here, multiple lines of evidence point to contributions by three levels of nuclear organization to in uiuo transcriptional control where structural parameters are functionally coupled to regulatory events. The primary level of gene organization establishes a linear ordering of promoter regulatory elements. This representation of regulatory sequences reflects competency for responsiveness t o physiological regulatory signals. However, interspersion of sequences between promoter elements that exhibit coordinated and synergistic activities indicates the requirement of a structural basis for integration of activities at independent regulatory domains. Parameters of chromatin structure and nucleosome organization are a second level of genome architecture that reduces the distance between promoter elements, thereby supporting interactions between the modular components of transcriptional control. Each nucleosome (approximately 140 nucleotide base pairs wound around a core complex of two each of H3, H4, H2, and H2B histone proteins) contracts linear spacing by 7-fold. Higher order chromatin structure further reduces nucleotide distances between regulatory sequences. Folding of nucleosome arrays into solenoid-type structures provides a potential for interactions that support synergism between promoter elements and responsiveness to multiple signaling pathways. A third level of nuclear architecture that contributes to transcriptional control is provided by the nuclear matrix (Bird, 1997; Berezney and Jeon, 1995). The anastomosing network of fibers and filaments that constitute the nuclear matrix supports the structural properties of the nucleus as a
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
479
cellular organelle and accommodates structural modifications associated with proliferation, differentiation, and changes necessary to sustain phenotypic requirements of specialized cells (Dworetzky et al., 1990; Fey et al., 1986; Fey and Penman, 1988; Capco et al., 1982; Getzenberg et al., 1991; Pienta and Coffey, 1991; Zeng et al., 1997). Regulatory functions of the nuclear matrix include but are by no means restricted to DNA replication (Berezney and Coffey, 1975; Vaughn et al., 1990;Jackson and Cook, 19861,gene localization (Robinsonet al., 19821, imposition of physical constraints on chromatin structure that support formation of loop domains (Nelkin et al., 1980;Ciejek et al., 1983; Cockerill and Garrard, 1986;Mirkovitch et al., 1984),concentration and targeting of transcription factors (Merriman et al., 1995; Bidwell et al., 1993; Dworetzky et al., 1992; Zeng et al., 1997; Schaack et al., 1990; Dickinson et al., 1992; van Wijnen et al., 19931, RNA processing and transport of gene transcripts (van Eekelen and van Venrooij, 1981;Xing et al., 1993; Jackson et al., 1981; Herman et al., 1978; Blencowe et al., 1994; Mortillaro et al., 1996; Grande et al., 19961, posttranslational modifications of chromosomal proteins (Hendzel et al., 1994), and imprinting and modifications of chromatin structure (Brown et al., 1992). Taken together these components of nuclear architecture facilitate biological requirements for physiologically responsive modifications in gene expression within the contexts of (1)homeostatic control involving rapid, short-term, and transient responsiveness; (2) developmental control that is progressive stage-specific, and (3) differentiation-related control that is associated with long-term phenotypic commitments to gene expression for support of structural and functional properties of cells and tissues. We are just beginning to comprehend the significance of nuclear domains in the control of gene expression. However, it is already apparent that local nuclear environments that are generated by the multiple aspects of nuclear structure are intimately tied to developmental expression of cell growth and tissue-specific genes. From a broader perspective, reflecting the diversity of regulatory requirements as well as the phenotype-specificand physiologically responsive representation of nuclear structural proteins, there is a reciprocally functional relationship between nuclear structure and gene expression. Nuclear structure is a primary determinant of transcriptional control and the expressed genes modulate the regulatory components of nuclear architecture. Thus, the power of addressing gene expression within the three-dimensional context of nuclear structure would be difficult to overestimate. Membrane-mediated initiation of signaling pathways that ultimately influence transcription have been recognized for some time.
480
JANE B. LIAN et al.
Here, the mechanisms that sense, amplify, dampen, and/or integrate regulatory signals involve structural as well as functional components of cellular membranes. Extending the structure-regulation paradigm t o nuclear architecture expands the cellular context in which cell-structure-gene expression interrelationships are operative. B. DEVELOPMENTAL AND STEROID HORMONE MODIFICATIONS OF OSTEOCALCIN GENECHROMATIN STRUCTURE AND NUCLEOSOME ORGANIZATION Modifications in parameters of chromatin structure and nucleosome organization parallel both competency for transcription and the extent t o which the osteocalcin gene is transcribed. Changes are observed in response to physiological mediators of basal expression and steroid hormone responsiveness. This remodeling of chromatin provides a conceptual and experimental basis for the involvement of nuclear architecture in developmental, homeostatic, and physiologic control of osteocalcin gene expression during establishment and maintenance of bone tissue structure and activity (Fig. 4). In both normal diploid osteoblasts and in osteosarcoma, cells basal expression and enhancement of osteocalcin gene transcription are accompanied by two alterations in structural properties of chromatin. DNase I hypersensitivity of sequences flanking the tissue-specific OC box and the vitamin-D-responsive element enhancer domain are observed (Montecino et al., 1994a,b; Breen et al., 1994). Together with modifications in nucleosome placement (Montecinoet al., 1994a), a basis for accessibility of transactivation factors to basal and steroid-hormone-dependent regulatory sequences can be explained. In the early stage, proliferating, normal diploid osteoblasts when the osteocalcin gene is repressed nucleosomes are placed in the OC box and in VDRE promoter sequences, and nuclease hypersensitive sites are not present in the vicinity of these regulatory elements. In contrast, when osteocalcin gene expression is transcriptionally up-regulated postproliferatively and vitamin-D-mediated enhancement of transcription occurs, the OC box and VDRE become nucleosome free and these regulatory domains are flanked by DNase I hypersensitive sites (Fig. 4). Functional relationships between structural modifications in chromatin and osteocalcin gene transcription are observed in response to 1,25(OH),D, in ROS 17-2.8 osteosarcoma cells, which exhibit vitaminD-responsive transcriptional up-regulation. There are marked changes in nucleosome placement at the VDRE and OC box as well as DNase I hypersensitivity of sequences flanking these basal and enhancer osteo-
Nuclear Matrix
VDRE
prox. prom.
1TF's 1
Nuclear Matrix
1 a prox. prom.
DNasel HS YY-1
DNasel HS
VDR/RXR
IVITAMIN D INDUCED1
Nuclear Matrix
-DNasel HS
DNasel HS
FIG. 4.Schematic representation of the association of the osteocalcin promoter with the nuclear matrix and modifications in chromatin organization during osteoblast differentiation. Postulated interactions of the osteocalcin promoter with the nuclear matrix are illustrated for three states of gene transcription. Top panel: In the inactive state (in nonosseous cells or proliferating osteoprogenitors), nucleosomes throughout the gene block transcription factor binding to regulatory sequences in the absence of gene-nuclear matrix interaction. Middle panel: Induction of gene transcription occurring at basal levels (in postproliferative osteoblasts) is reflected by the repositioning of nucleosomes and the detection of hypersensitive sites (HS)in the VDRE domain and the basal OC box domain. Such changes in chromatin may facilitate interaction of the promoter with the nuclear matrix at the NMP-1 (W1)and the three NMP-2 (CBFA1)sites A, B, and C. CBFu factors are largely associated with the nuclear matrix (Zeng et al., 1997). Under basal conditions, the VDRE half-steroid element that binds the NMP-1 nuclear matrix protein complex is tethered to the nuclear matrix. Lower panel: In the presence of the liganded receptor complex, vitamin-D-enhanced transcription is supported by binding of the VDR-RXR receptor complex to the element. The enhancement of hypersensitivity at the VDRE and in a proximal promoter domain modulates these changes in chromatin structure. These postulated transient associations of osteocalcin promoter domains with the nuclear matrix contribute to regulation of basal and steroid hormone mediated transcription.
482
JANE B. LIAN et al.
calcin gene promoter sequences (Montecinoet al., 1994a,b;Breen et al., 1994).The complete absence of hypersensitivity and the presence of nucleosomes in the VDRE and OC box domains of the osteocalcin gene promoter in ROS 24/1 cells, which lack the vitamin D receptor and are therefore refractory to the steroid hormone additionally corroborate these findings (Montecino et al., 1994a,b; Breen et al., 1994). These steroid hormone-responsive alterations in chromatin structure have been confirmed by restriction enzyme accessibility of promoter sequences within intact nuclei (Montecino et al., 1996) and by ligationmediated PCR (LMPCR) (Montecino et al., 1997) at single nucleotide resolution. We have found that agents that induce histone hyper acetylation (sodium butyrate) promote reorganization of the nucleosomal structure in the distal region of the osteocalcin gene promoter (including the VDRE). This transition results in inhibition of the vitamin-D-induced up-regulation of basal transcription in ROS 17-2.8 cells. Additionally, we have established an absolute requirement for sequences residing in the proximal region of the osteocalcin gene promoter for both formation of the proximal DNase I hypersensitive site and basal transcriptional activity. Our approach was to assay nuclease accessibility (DNase I and restriction endonucleases) in ROS 17-2.8 cell lines stably transfected with promoter deletion constructs driving expression of a CAT reporter gene (Frenkel et al., 1996).
C. CONTRIBUTIONS OF THE NUCLEAR MATRIXTO OSTEOCALCIN GENEEXPRESSION Involvement of the nuclear matrix in control of osteocalcin gene transcription is provided by several lines of evidence. One of the most compelling is association of a bone-specific nuclear matrix protein designated NMPB with sequences flanking the VDRE of the osteocalcin gene promoter (Bidwell et al., 1993).An additional NMPB binding site is a tissue-specific regulatory domain in the osteocalcin gene proximal promoter (Banerjee et al., 1996a; Bidwell et al., 1993; Lindenmuth et d., 1997;van Wijnen et al., 1994).Initial characterization of the NMPB factor has revealed that a component is an AML-l-related transactivation protein (Banerjee et al., 1996a; Lindenmuth et al., 1997; van Wijnen et al., 1994). These results implicate the nuclear matrix in regulating events that mediate structural properties of the VDRE domain and basal tissue-specific gene expression. It is apparent from available findings that the linear organization of gene regulatory sequencesis necessary but insufficient to accommodate
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
483
the requirements for physiological responsiveness to homeostatic, developmental, and tissue-related regulatory signals. It would be presumptive to propose a formal model for a three-dimensional organization of the osteocalcin gene promoter that modulates steroid hormone responsive and developmental transcriptional control. However, the working model presented in (Fig. 5 ) represents postulated interactions between OC gene promoter elements that reflect the potential for integration of activities by nuclear architecture to support transcriptional control within a three-dimensional context of cell structure and regulatory requirements at the cell and tissue levels. A role of the nuclear matrix in steroid-hormone-mediated transcriptional control of the osteocalcin gene is further supported by overlapping binding domains within the VDRE for the VDR and the NMP-1 nuclear matrix protein, which we have shown to be aYY1 transcription factor (Guo et al., 1995).One can speculate that reciprocal interactions of NMP-1 and VDR complexes may contribute to competency of the
basal transcription
I
I
proximal DNase HS
distal DNase HS
1
I
Vit D enhancement
FIG.5. Three-dimensional organization of the rat osteocalcin gene promoter. A model is presented for the spatial organization of the rat osteocalcin gene promoter based on evidence for nucleosome placement and the interaction of DNA-binding sequences with nuclear matrix (hatched bars). These components of chromatin structure and nuclear architecture restrict mobility of the promoter and impose physical constraints that reduce distances between proximal and distal promoter elements. Such postulated modifications would mediate transcription factor binding and facilitate cooperative interactions for crosstalk between elements (e.g., VDRE and TATA domains).
484
JANE B. LIAN et a1
VDRE to support transcriptional enhancement. Binding of NMP-2 at the VDRE flanking sequence may establish permissiveness for VDR interactions by gene-nuclear matrix associations that facilitate conformational modifications in the transcription factor recognition sequences. Taken together, these findings provide a basis for involvement of both the nuclear matrix and chromatin structure in modulating accessibility of promoter sequences to cognate transcription factors and facilitating the integration of activities at multiple regulatory domains. In vzvo studies support functional contributions of nuclear matrix proteins to steroid hormone-mediated transcription. Overexpression of AML transcription factors that flank the osteocalcin gene VDRE up-regulates expression, In contrast, overexpression of W1, which binds to a site overlapping the osteocalcin gene vitamin-D-receptor-binding sequences, abrogates the vitamin D enhancement of transcription and displaces VDR-RXR interactions. Functional data supporting nuclear-structuremediated crosstalk between the osteocalcin gene VDRE and the TATA domain are provided by the demonstration that the transcription factor TFIIB and the VDR cooperatively coactivate ligand-dependent transcription (Blanco et al., 1995) and are partner proteins by the two-hybrid system (MacDonaldet al., 1995;Li et al., 1997a; Oiiate et al., 1995). Functional interrelationships between the VDRE and TATA domains under conditions where YY1 occupancy of the VDRE suppresses enhancer activity are consistent with the demonstration of mutual exclusive binding o f W l or the VDR to the basic domain of TFIIB (Guo et al., 1997). Two fundamental questions are raised with respect to functional interactions of transcription factors with the nuclear matrix. Is there a cause or effect relationship between nuclear matrix association of genes and their cognate transcription factors? What is the mechanism that targets transcription factors to the nuclear matrix? We have addressed how the AML transcription factor becomes nuclear matrix associated by functional biochemical and in situ imunofluorescence analysis of AML deletion and point mutations. Our results indicate that (1)sequences required for targeting AML to the nuclear matrix reside in a 31-amino-acid segment within the C terminal that is physically distinct from the nuclear localization signal (Fig. 6), (2) nuclear matrix association ofAML is independent of DNAbinding activity, (3)the principal active and inactive splice variants of the AML transcription factor are differentially localized within the nucleus, and (4)the nuclear matrix targeting signal of AML functions autonomously. Our findings demonstrate that at least two trafficking signals are required for sub-
-
context-dependent trans-activation
A
runt homology domain
NMTS
I
Nm 1
CBFA2 /AML-1 B
87
1
N
AML-1
tNLS1
I
I
mrn-r-mizzz
Nrnllll IQ
'
I
I
I
A ~
351 381
I 250
I
'A
I
Ikxon7A
432
480
t$g$$j h\qc I
lexons 7 8 s! 8
H C
1 CBFAl /AML-3
'k
[mllll 1
N
I
' DNA binding I Aeterornerization
I
CBFA3lAML-2
204
I I I I 1
I I I
I I I I
I
I/'
VWRPY I I I
I
' 416 C
I
\
I
I
I
I
\
'$13 I C
FIG.6 . Schematic representation of the CBFa-AML class of transcription factors. (A) This class of factors is encoded by three distinct genes designated CBFAl (AML-3), CBFA2 (AML-l), and CBFA3 (AML-2) that each produce multiple protein isoforms. Most isoforms share a n intact and highly conserved runt homology domain (rhd),which functions as a sequence-specific DNA-binding domain and interacts with the heterodimerization partner CBFP. The rhd contains a nuclear localization signal (NLS). ?tyo key splice-variants of the CBFA2 gene are shown on the first two lines: (i)the full-length, nuclear-matrix-associatedAML-1B protein contains a C-terminal domain that spans at least two promoter-context-dependent transactivation domains and the nuclear matrix targeting signal (NMTS) and (ii) the truncated and transcriptionally inactive AML-1 protein, which lacks these regulatory domains. Nuclear-matrix-associated active transcription factors that are homologous to AML-1B are encoded by the CBFA3-AML-2 and CBFA1-AML-3 genes. All three proteins share a n NMTS (blocked filling), the runt homology domain (right diagonal stripes), a n N-terminal region (vertical stripe), and a highly conserved C-terminal VWRPY motif (black filling). The bone-related CBFA1-AML-3 protein contains a unique internal region rich i n glutamine ( Q )and alanines (A). (B)The nuclear matrix targeting signal is a 31-amino-acid domain that is highly conserved among vertebrate species, as well as different subtypes of the CBFA-AML transcription factor family (Zeng et al., 1997). The diagram indicates three groups of conserved amino acids (boxes A, B, and C ) ,which'are flanked by putative turn motifs (gray boxes). (Figure continues on next page.)
0
Nuclear Matrix Targeting Signal
I
1 301
351
7
CBFAZAMLl B
BoxA
ATFTYTP-P ATFTYTP-P
--
GAFTYSP-P GAFTYSPTP
CBFA3/AML2
7
- - - - AT- R Y H-TY L V T - S G IG I GMSAMSS - - - - A-SRYH -TYL - - VT-S G IG IGMSAMSS - - - - -TSRYH -TYL - - VS -SG I G I G M S A M S T - - - - A T - R Y H - T Y L - - VT - S G M S L G M S A - TT - - - - - - - H Y H -TY L
---
GAFTYSPTP GAFTYSP-P
CBFAl lAML3
BoxC
Box B VT-SG I G I GMSAMGS
VT
-S G M S L G M S A
- TT - - - - - - - H Y H -TY L
- S S L - SV A G I ! Y S A T P S G T S I - S S L - SV A G M I
GAMSAAF-P YS ATPS G T S I
ATSRFHHTYl
GAMSAAF-P
ATSRFHHTYl
A
,
+o+
VO.,,PPPOP.
hydrophilic
turn
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
487
nuclear targeting of AML transcription factors; the first supports nuclear import and a second mediates association with the nuclear matrix. In addition, our results suggest that loss of the C-terminal nuclear matrix targeting domain of AML, which occurs frequently in leukemiarelated translocations, is functionally linked to abrogated interrelationships between nuclear structure and gene expression, characteristic of tumor cells. A basis is thus provided for addressing perturbations in the composition and/or organization of nuclear architecture that is observed in cancer. Results from Zeng et al., (1997, 1998)provide insight into the functional consequencesof directing transcription factors to the nuclear matrix. Invoking the rationale that guilt by association is biologically relevant, it has been shown that the 31-amino-acid nuclear matrix targeting sequence of the AML transcription factor targets the regulatory protein to a nuclear domain that supports transcription. Colocalization of AML with transcriptionally active RNA polymerase I1 has been demonstrated as well as the requirements for a functional DNAbinding domain and ongoing transcription (Zeng et aZ., 1998). Functional implications for nuclear matrix association of AML transcription factors is more directly provided by studies that establish that targeting to the nuclear matrix is obligatory for maximal transactivation activity (Zeng et aZ., 1997). Taken together, we are increasing our understanding of mechanisms that mediate the assembly of regulatory components to initiate and sustain transcription within the context of nuclear architecture. VI. CLOSINGREMARKS We have attempted to address how physiologic parameters of gene expression are integrated to support requirements of bone development and functional integrity of the tissue. During osteoblast phenotype development and bone formation, stages of maturation are defined by levels of expression of subsets of osteoblast genes. Effects of a hormone or growth factor on expression of a specific gene is related to the phenotype as well as the stage of cellular maturation because of the different representation of proteins that contribute to gene regulation. The osteocalcin gene is responsive to a broad spectrum of physiologic mediators, which supports expression of the protein in a stringently regulated manner using an in uitro model of osteoblast growth and differentiation that has enabled us to elucidate regulatory mechanisms.Acohort of tissue-specific, developmental, steroid hormone, and growth-factor-relat-
488
JANE B. LIAN et al.
ed transcription factor complexes impinge on osteocalcin gene transcription, providing a complex and integrated series of regulatory signals. Observed modifications in the development of the osteoblast phenotype by steroid hormones and growth factors necessitates making a distinction between primary and secondary effects that contribute to modifications in gene transcription. There is a growing body of evidence for crosstalk between steroid and nonsteroid response elements, mediated through structural rearrangements of the promoter. The osteocalcin gene promoter is a striking example of such an interaction, where steroid hormone responsiveness is exquisitely sensitive to basal levels of expression and activities at other regulatory domains. ACKNOWLEDGMENTS We thank Judy Rask for manuscript preparation. This work was supported by National Institutes of Health grants DE12528, AR39588, and PO1 AR42262-01. The contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Health. REFERENCES Andrianarivo, A. G., Robinson, J. A., Mann, K. G., and Tracy, R. P. (1992). Growth on type I collagen promotes expression of the osteoblastic phenotype in human osteosarcoma MG-63 cells. J. Cell. Physiol. 153, 156-165. Arbour, N. C., Prahl, J. M., and DeLuca, H. F. (1993). Stabilization of the vitamin D receptor in rat osteosarcoma cells through the action of 1,25-dihydroxyvitamin D3. Mol. Endocrinol. 7,1307-1312. Aronow, M. A., Gerstenfeld, L. C., Owen, T. A., Tassinari, M. S., Stein, G. S., and Lian, J. B. (1990). Factors that promote progressive development of the osteoblast phenotype in cultures fetal rat calvaria cells. J. Cell. Physiol. 143,213-221. Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M., and Gergen, J. P. (1997). Groucho-dependent and -independent repression activities of Runt domain proteins. Mol. Cell. Biol. 17, 5581-5587. Aslam, F. (1996). Hormonal control of rat osteocalcin gene: contributions of distal and proximal promoter elements to glucocorticoid regulation of osteocalcin gene transcription. Ph.D. Thesis, University of the Punjab, Lahore, Pakistan, and University of Massachusetts Medical Center, Worcester, Massachusetts. Aslam, F., Shalhoub, V., van Wijnen, A. J., Banerjee, C., Bortell, R., Shakoori, A. R., Litwack, G., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). Contributions of distal and proximal promoter elements to glucocorticoid regulation of osteocalcin gene transcription. Mol. Endocrinol. 9,679-690. Aubin, J. E., and Liu, F. (1996).The osteoblast lineage. In “Principles of Bone Biology” (J.P. Bilezikian, L. G. Raisz, and G. A. Rodan, eds.),pp. 51-68. AcademicPress, San Diego, CA. Bae, S. C., Takahashi, E., Zhang,Y. W., Ogawa, E., Shigesada, K., Namba, Y., Satake, M., and Ito, Y. (1995). Cloning, mapping and expression of PEBP2 alpha C, a third gene encoding the mammalian Runt domain. Gene 159,245-248. Baker, A. R., Hollingshead, P. G., Pitts-Meek, S., Hansen, S., Taylor, R., and Stewart, T. A. (1992). Osteoblast-specific expression of growth hormone stimulates bone growth in transgenic mice. Mol. Cell. Biol. 12, 5541-5547.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
489
Balling, R., Mutter, G., Gruss, P., and Kessel, M. (1989). Craniofacial abnormalities induced by ectopic expression of the homeobox gene Hox-1.1 in transgenic mice. Cell (Cambridge, Mass.) 58,337-347. Banejee, C . , Hiebert, S. W., Stein, J. L., Lian, J. B., and Stein, G. S. (1996a). An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 93,4968-4973. Banejee, C., Stein, J. L., van Wijnen, A. J., Frenkel, B., Lian, J. B., and Stein, G. S. (1996b). Transforming growth factor-beta 1 responsiveness of the rat osteocalcin gene is mediated by an activator protein-1 binding site. Endocrinology (Baltimore) 137,1991-2000. Banejee, C., McCabe, L. R., Choi, J.-Y., Hiebert, S. W., Stein, J. L., Stein, G. S., and Lian, J. B. (1997). Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major component of a bone specific complex. J. Cell. Biochem. 66,l-8. Banejee, C., Javed, A., Choi, J., Green, J., van Wijnen, A., Stein, J., Stein, G., and Lian, J. (1998). Representation and activities of multiple Cbfa transcription factors in osteoblasts. J. Bone Miner. Res. (in press) (Abstract). Barille, S., Pellat-Deceunynck, C., Bataille, R., and Amiot, M. (1996). Ectopic secretion of osteocalcin, the major non-collagenous bone protein, by the myeloma cell line NCIH929. J. Bone Miner. Res. 11,466-471. Barone, L. M., Boyd, B., Bettencourt, B., Minkin, C., Stein, G. S., and Lian, J. B. (1991). Osteocalcin (OC), a bone specific protein, mediates differentiation of osteoclasts in two model systems. J. Cell Biol. 115,448A (abstr.). Barone, L. M., Aronow, M. A., Tassinari, M. S., Conlon, D., Canalis, E., Stein, G. S., and Lian, J. B. (1994). Differential effects of warfarin on mRNA levels of developmentally regulated vitamin K dependent proteins, osteocalcin, and matrix GLA protein in vitro. J. Cell. Physiol. 160,255-264. Bellows, C. G., Aubin, J. E., and Heersche, J. N. M. (1987). Physiological concentrations of glucocorticoids stimulate formation of bone nodules from isolated rat calvaria cells in vitro. Endocrinology (Baltimore) 121,1985-1992. Bennett, V. D., Weiss, I. M., and Adams, S. L. (1989). Cartilage-specific 5‘ end of chick alpha 2(I) collagen mRNAs. J. Biol. Chem. 264,8402-8409. Benton, M. E., Price, P. A., and Suttie, J. W. (1995). Multi-site-specificity of the vitamin K-dependent carobxylase: In vitro carboxylation of des-gamma-carboxylated bone Gla protein and Des-gamma-carboxylated pro bone Gla protein. Biochemistry 34, 9541-9551. Beresford, J. N., Bennett, J. H., Devlin, C., Leboy, P. S., and Owen, M. E. (1992). Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J. Cell Sci. 102,341-351. Berezney, R., and Coffey, D. S. (1975). Nuclear protein matrix: Association with newly synthesized DNA. Science 189,291-292. Berezney, R., and Jeon, K. W., eds. (1995). “Structural and Functional Organization of the Nuclear Matrix.” Academic Press, San Diego, CA. Bhargava, U., Bar-Lev, M., Bellows, C. G., and Aubin, J. E. (1988). Ultrastructural analysis of bone nodules formed in vitro by isolated fetal rat calvaria cells. Bone 9, 155-163. Bidwell, J. P., van Wijnen, A. J., Fey, E. G., Dworetzky, S., Penman, S., Stein, J. L., Lian, J . B., and Stein, G. S. (1993). Osteocalcin gene promoter-binding factors are tissuespecific nuclear matrix components. Proc. Natl. Acad. Sci. U.S.A. 90,3162-3166. Bird, R. C. (1997). The cyclin/cyclin-dependent kinase (cdk) complex: regulation of cell cycle progression and nuclear disassembly. In “Nuclear Structure and Gene Expres-
490
JANE B. LIAN et al.
sion” (R.C. Bird, G. S. Stein, J. B. Lian, and J. L. Stein, eds.), pp. 145-174. Academic Press, San Diego, CA. Birnbaum, R. S., and Wiren, D. M. (1994). Changes in insulin-like growth factor-binding protein expression and secretion during the proliferation, differentiation, and mineralization of primary cultures of rat osteoblasts. Endocrinology (Baltimore) 135, 223-230. Blanco, J. C. G., Wang, I.-M., Tsai, S.Y., Tsai, M.-J., O’Malley, B. W., Jurutka, P. W., Haussler, M. R., and Ozato, K. (1995). Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. Proc. Natl. Acad. Sci. U.S.A. 92,1535-1539. Blencowe, B. J., Nickerson, J. A., Issner, R., Penman, S., and Sharp, P. A. (1994). Association of nuclear matrix antigens with exon-containing splicing complexes. J. Cell Biol. 127,593-607. Boivin, G., Morel, G., Lian, J. B., Anthoine-Terrier, C., Dubois, P. M., and Meunier, P. J. (1990). Localization of endogenous osteocalcin in neonatal rat bone and its absence in articular cartilage: Effect of warfarin treatment. VirchoutsArch. A: Pathol. Anat. Histopathol. 417, 505-512. Bortell, R., Owen, T.A., Bidwell, J. P., Gavazzo, P., Breen, E., van Wijnen, A. J.,DeLuca, H. F., Stein, J. L., Lian, J. B., and Stein, G. S. (1992). Vitamin D-responsive proteinDNA interactions at multiple promoter regulatory elements that contribute to the level of rat osteocalcin gene expression. Proc. Natl. Acad. Sci. U.S.A. 89,6119-6123. Bortell, R., Owen, T. A., Shalhoub, V., Heinrichs, A., Aronow, M. A., Rochette-Egly, C., Lutz, Y., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements. Proc. Natl. Acad. Sci. U.S.A. 90, 2300-2304. Boskey, A. L., Wians, F. H. Jr., and Hauschka, P. V. (1985). The effect of osteocalcin on in vitro lipid-induced hydroxyapatite formation and seeded hydroxyapatite growth. Calcif Tissue Znt. 37,57-62. Boskey, A. L., Gadaleta, S., Gundberg, C., Doty, S. B., Ducy, P., and Karsenty, G. (1998). FTIR microspectroscopic analysis of bones of osteocalcin-deficient mice provides insight into the function of osteocalcin. Bone (in press). Boudreaux, J. M., and Towler, D. A. (1996). Synergistic induction of osteocalcin gene expression: Identification of a bipartite element conferring fibroblast growth factor 2 and cyclic AMP responsiveness in the rat osteocalcin promoter. J. Bid. Chern. 271, 7508-7515. Breen, E. C., van Wijnen, A. J., Lian, J. B., Stein, G. S., and Stein, J. L. (1994). In vivo occupancy of the vitamin D responsive element in the osteocalcin gene supports vitamin D-dependent transcriptional upregulation in intact cells. Proc. Natl. Acad. Sci. U.S.A. 91,12902-12906. Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., Xing, Y., Lawrence, J., and Willard, H. F. (1992). The humans XIST gene: Analysis of a 17kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell (Cambridge, Mass.) 71,527-542. Brown, T. A,, and DeLuca, H. F. (1990). Phosphorylation ofthe 1,25-dihydroxyvitamin D3 receptor. A primary event in 1,25-dihydroxyvitamin D3 action. J. Biol. Chem. 265, 10025-10029. Bushmeyer, S., Park, K., and Atchison, M. L. (1995). Characterization of functional domains within the multifunctional transcription factor, YY1. J. Biol. Chem. 270, 30213-30220.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
49 1
Cairns, J. R., and Price, P. A. (1994).Direct demonstration that the vitamin K-dependent bone Gla protein is incompletely gamma-carboxylated in humans. J. Bone Miner: Res. 9,1989-1997. Calvo, M. S., Eyre, D. R., and Gundberg, C. M. (1996).Molecular basis and clinical application of biological markers of bone turnover. Endocr: Rev. 17,333-368. Cao, X.,Ross, F. P., Zhang, L., MacDonald, P. N., Chappel, J.,and Teitelbaum, S. L. (1993). Cloning of the promoter for the avian integrin beta 3 subunit gene and its regulation by 1,25-dihydroxyvitamin D3. J. Biol. Chem. 268,27371-27380. Capco, D. G., Wan, K. M., and Penman, S. (1982).The nuclear matrix: Three-dimensional architecture and protein composition. Cell (Cambridge, Mass.) 29,847-858. Carlberg, C., Bendik, I., Wyss, A., Meier, E., Sturzenbecker, L. J., Grippo, J. F., and Hunziker, W. (1993).Two nuclear signalling pathways for vitamin D. Nature (London) 361,657-660. Carlson, C. S., Tulli, H. M., Jayo, M. J.,Loeser, R. F., Tracy, R. P., Mann, K. G., and Adams, M. R. (1993).Immunolocalization of noncollagenous bone matrix proteins in lumbar vertebra from intact and surgically menopausal cynomolgus monkeys. J . Bone Miner: Res. 8,71-81. Catron, K. M., Iler, N., and Abate, C. (1993).Nucleotides flanking a conserved TAAT core dictate the DNA binding specificity of three murine homeodomain proteins. Mol, Cell. Biol. 13,2354-2365. Celeste, A. J.,Rosen, V., Buecker, J. L., Kriz, R., Wang, E. A,, and Wozney, J. M. (1986). Isolation of the human gene for bone gla protein utilizing mouse and rat cDNAclones. EMBO J. 5,1885-1890. Centrella, M., McCarthy, T. L., and Canalis, E. (1991).Glucocorticoid regulation of transforming growth factor pl activity and binding in osteoblast-enriched cultures from fetal rat bone. Mol. Cell. Biol. 11,4490-4496. Chen, J.,McKee, M. D., Nanci, A., and Sodek, J. (1994).Bone sialoprotein mRNA expression and ultrastructural localization in fetal porcine calvarial bone: Comparisons with osteopontin. Histochem. J. 26,67-78. Chen, T. L., Bates, R. L., Dudley, A., Hammonds, R. G., Jr., and Amento, E. P. (1991). Bone morphogenetic protein-2b stimulation of growth and osteogenic phenotypes in rat osteoblast-like cells: Comparison with TGF-beta 1. J. Bone Miner: Res. 6, 1387-1393. Cheng, S.-L., Yang, J. W., Rifas, L., Zhang, S.-F., and Avioli, L. V. (1994).Differentiation of human bone marrow osteogenic stromal cells in uitro: Induction of the osteoblast phenotype by dexamethasone. Endocrinology (Baltimore) 134,277-286. Chenu, C., Colucci, S., Grano, M., Zigrino, P., Barattolo, R., Zambonin, G., Baldini, N., Vergnaud, P., Delmas, P. D., and Zallone, A. Z. (1994).Osteocalcin induces chemotaxis, secretion of matrix proteins, and calcium-mediated intracellular signaling in human osteoclast-like cells. J. Cell Biol. 127, 1149-1158. Cheskis, B., and Freedman, L. P. (1994).Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR)homodimers into VDR-retinoid X receptor heterodimers. Mol. Cell. Biol. 14,3329-3338. Ciejek, E. M., Tsai, M. J., and O'Malley, B. W. (1983).Actively transcribed genes are associated with the nuclear matrix. Nature (London) 306,607-609. Clemens, T. L., Tang, H., Maeda, S., Kesterson, R. A., DeMayo, F. Pike, J. W., and Gundberg, C. M. (1997).Analysis of osteocalcin expression in transgenic mice reveals a species differences in vitamin D regulation of mouse and human osteocalcin genes. J. Bone Miner: Res. 12,1570-1576. Cockerill, P. N., and Garrard, W. T. (1986).Chromosomal loop anchorage of the kappa im-
492
JANE B. LIAN et al.
munoglobulin gene occurs next to the enhancer in a region containing topoisomerase I1 sites. Cell (Cambridge, Mass.) 44, 273-282. Coelho, C. N. D., Sumoy, L., Rodgers, B. J., Davidson, D. R., Hill, R. E., Upholt, W. B., and Kosher, R. A. (1991). Expression of the chicken homeobox-containing gene GHox-8 during embryonic chick limb development. Mech. Dev. 34,143-154. Danuish, H. M., and DeLuca, H. F. (1992). Identification of a 1,25-dihydroxyvitamin D3response element in the 5’- flanking region of the rat calbindin D-9k gene. Proc. Natl. Acad. Scz. U S A . 89,603-607. Darwish, H. M., Burmester, J. K., Moss, V. E., and DeLuca, H. F. (1993). Phosphorylation is involved in transcriptional activation by the 1,25- dihydroxyvitamin D3 receptor. Biochim. Biophys. Acta 1167, 29-36. Davis, A. P., Witte, D. P., Hsieh-Li, H. M., Potter, S. S., and Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa- 11and hoxd- 11.Nature (London) 375, 791-795. Defranco, D. J., Glowacki, J., Cox, K. A., and Lian, J. B. (1991). Normal bone particles are preferentially resorbed in the presence of osteocalcin-deficient bone particles in vivo. Calcif. Tissue Int. 49,43-50. Delany, A. M., Dong, Y., and Canalis, E. (1994). Mechanisms of glucocorticoid action in bone cells. J. Cell. Biochem. 56,295-302. Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990). DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsive to 1,25-dihydroxyvitamin D3. Proc. Natl. Acad. Sci. U.S.A.87, 369-373. Demay, M. B., Kiernan, M. S., DeLuca, H. F., and Kronenberg, H. M. (1992a). Characterization of 1,25-dihydroxyvitamin D3 receptor interactions with target sequences in the rat osteocalcin gene. Mol. Endocrinol. 6,557-562. Demay, M. B., Kiernan, M. S., DeLuca, H. F., and Kronenberg, H. M. (1992b). Sequences in the human parathyroid hormone gene that bind the 1,25- dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc. Natl. Acad. Sci. U.S.A. 89,8097-8101. Denhardt, D. T., and Guo, X. (1993). Osteopontin: A protein with diverse functions. FASEB J. 7,1475-1482. Desai, R. K., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). Control of 1,25-dihydroxyvitamin D3 receptor-mediated enhancement of osteocalcin gene transcription: Effects of perturbing phosphorylation pathways by okadaic acid and staurosporine. Endocrinology (Baltimore) 136,5685-5693. Desbois, C., Hogue, D. A., and Karsenty, G. (1994). The mouse osteocalcin gene cluster contains three genes with two separate spatial and temporal patterns of expression. J. Biol. Chem. 269,1183-1190. Desbois, C., Hagihara, K., Pinero, G., Boyce, B., Bonadio, J.,Tseng, K. F., Goulet, R., Goldstein, s. Loyer, E., Bradley, A., and Karsenty, G. (1995). Increased bone formation in osteocalcin deficient mice. J. Bone Minel: Res. 10, S139 (abstr.). Dickinson, L. A., Joh, T., Kohwi, Y., and Kohwi-Shigematsu, T. (1992). A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell (Cambridge, Mass.) 70,631-645. Dodig, M., Kronenberg, M. S., Bedalov, A., Kream, B. E., Gronowicz, G., Clark, S. H., Mack, K., Liu, Y. H., Maxon, R., Pan, Z. Z., Upholt, W. B., Rowe, D. W., and Lichtler, A. C. (1996). Identification of a TAAT-containing motif required for high level expression of the COLlAl promoter in differentiated osteoblasts of transgenic mice. J. Biol. Chem. 271,16422-16429. Doty, S. B., and Schofield, B. H. (1990). Histochemistry and enzymology of bone-forming
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
493
cells. In “The Osteoblast and Osteocyte” (B. K. Hall, ed.), pp. 71-102. Telford Press, London. Ducy, P., and Karsenty, G. (1995).Two distinct osteoblast-specific cis-acting elements control expression of a mouse osteocalcin gene. Mol. Cell. Bid. 16, 1858-1869. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., and Karsenty, G. (1997). Osf2ICbfa 1: A transcriptional activator of osteoblast differentiation. Cell (Cambridge, Mass.) 89, 747-754. Dworetzky, S. I., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1990). Progressive changes in the protein composition of the nuclear matrix during rat osteoblast differentiation. Proc. Natl. Acud. Sci. U.S.A. 87,4605-4609. Dworetzky, S . I., Wright, K. L., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1992). Sequence-specific DNA-binding proteins are components of a nuclear matrix-attachment site. Proc. Nutl. Acud. Sci. U.S.A. 89,4178-4182. Ecarot-Charrier, B., Glorieux, F. H., van der Rest, M., and Pereira, G. (1983).Osteoblasts isolated from mouse calvaria initiate matrix mineralization in culture. J. Cell Biol. 96,639-643. Ferrari, D., Sumoy, L., Gannon, J., Sun, H., Brown, A. M., Upholt, W. B., and Kosher, R. A. (1995).The expression pattern of the Distal-less homeobox-containing gene Dlx5 in the developing chick limb bud suggests its involvement in apical ectodermal ridge activity, pattern formation, and cartilage differentiation. Mech. Den 52, 257-264. Feteih, R., Tassinari, M. S., and Lian, J. B. (1990). Effect of sodium warfarin on vitamin K-dependent proteins and skeletal development in the rat fetus. J. Bone Miner. Res. 5,885-894. Fey, E. G., and Penman, S. (1988). Nuclear matrix proteins reflect cell type of origin in cultured human cells. Proc. Natl. Acad. Sci. U.S.A. 85,121-125. Fey, E. G., Krochmalnic, G., and Penman, S. (1986). The nonchromatin substructures of the nucleus: The ribonucleoprotein RNP-containing and RNP-depleted matrices analyzed by sequential fractionation and resinless section electron microscopy. J. Cell Biol. 102, 1654-1665. Fleet, J. C., and Hock, J. M. (1994). Identification of osteocalcin mRNAin nonosteoid tissue of rats and humans by reverse transcription-polymerase chain reaction. J . Bone Miner Res. 9,1565-1573. Franceschi, R. T., and Iyer, B. S. (1992). Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-El cells. J. Bone Minel: Res. 7, 235-246. Franceschi, R. T., Iyer, B. S., and Cui, Y. (1994). Effects of ascorbic acid on collagen matrix formation and osteoblast differentiation in murine MC3T3-El cells. J . Bone Miner Res. 9,843-854. Freedman, L. P., Arce, V., and Fernandez, R. P. (1994). DNA sequences that act as high affinity targets for the vitamin D, receptor in the absence of the retinoid X receptor. Mol. Endocrinol. 8,265-273. Frenkel, B., Mijnes, J.,Aronow, M. A., Zambetti, G., Banejee, C., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Position and orientation-selective silencer in protein-coding sequences of the rat osteocalcin gene. Biochemistry 32,13636-13543. Frenkel, B., Montecino, M., Stein, J. L., Lian, J. B., and Stein, G. S. (1994). A composite intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: Promoter and cell type requirements. Proc. Nutl. Acud. Sci. U.S.A. 91,10923-10927. Frenkel, B., Montecino, M., Green, J.,Aslam, F.,Desai, R., Banejee, C., Stein, J. L., Lain, J. B., and Stein, G. S. (1996). Basal and vitamin D-responsive activity of the rat os-
494
JANE B. LIAN et al.
teocalcin promoter in stably transfected osteosarcoma cells: Requirement of upstream sequences for control by the proximal regulatory domain. Endocrinology (Baltimore) 137, 1080-1088. Frenkel, B., Capparelli, C., vanAuken, M., Bryan J., Stein, J. L., Stein, G. S., and Lian, J. B. (1997). Activity of the osteocalcin promoter in skeletal sites of transgenic mice and during osteoblast differentiation in bone marrow-derived stromal cell cultures: Effects of age and sex. Endocrinology (Baltimore) 138,2109-2116. Gandarillas, A., and Watt, F. M. (1995). Changes in expression of members of the fos and jun families and myc network during terminal differentiation of human keratinocytes. Oncogene 11,1403-1407. Geoffroy, V., Ducy, P., and Karsenty, G. (1995). A PEBP2dAML-1-related factor increases osteocalcin promoter activity through its binding to a n osteoblast-specific cis-acting element. J. Biol. Chem. 270,30973-30979. Geoffroy, V., Corral, D. A., Zhou, L., Lee, B., and Karsenty, G . (1998). Genomic organization, expression of the human CBFAl gene, and evidence for a n alternative splicing event affecting protein function [In Process Citation]. Mamm. Genome 9,54-57. Gerstenfeld, L. C., Chipman, S. D., Glowacki, J., and Lian, J. B. (1987). Expression of differentiated function by mineralizing cultures of chicken osteoblasts. Dev. Biol. 122, 49-60. Gerstenfeld, L. C., Chipman, S. D., Kelly, C. M., Hodgens, K. J., Lee, D. D., and Landis, W. J. (1988). Collagen expression, ultrastructural assembly, and mineralization in cultures of chicken embryo osteoblasts. J. Cell Biol. 106,979-989. Gerstenfeld, L. C., Riva, A., Hodgens, K., Eyre, D. R., and Landis, W. J. (1993). Post-translational control of collagen fibrillogenesis in mineralizing cultures of chick osteoblasts. J. Bone Miner. Res. 8,1031-1043. Getzenberg, R. H., Pienta, K. J., Huang, E. Y., and Coffey, D. S. (1991). Identification of nuclear matrix proteins in the cancerous and normal rat prostrate. Cancer Res. 51, 6514-6520. Gill, R. K., and Christakos, S. (1993). Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses. Proc. Natl. Acad. Sci. U S A . 90,2984-2988. Glowacki, J., and Lian, J. B. (1987). Impaired recruitment and differentiation of osteoclast progenitors by osteocalcin-deplete bone implants. Cell Differ. 21,247-254. Glowacki, J., Rey, C., Glimcher, M. J., Cox, K. A., and Lian, J. (1991). Arole for osteocalcin in osteoclast differentiation. J. Cell. Biochem. 45,292-302. Godschalk, M., Levy, J. R., and Downs, R. W. Jr. (1992). Glucocorticoids decrease vitamin D receptor number and gene expression in human osteosarcoma cells. J. Bone Miner. Res. 7,21-27. Goldberg, D., Gardiner, E., Morrison, N. A., and Eisman, J. A. (1995). G/C element contributes to the cell line-specific expression of the proximal osteocalcin promoter. J . Cell. Biochem. 58,499-508. Goldberg, D., Polly, P., Eisman, J. A., and Morrison, N. A. (1996). Identification of an osteocalcin gene promoter sequence that binds AP1. J. Cell. Biochem. 60,447-457. Goto, K., Heymont, J. L., Klein-Nulend, J.,Kronenberg, H. M., and Demay, M. B. (1996). Identification of an osteoblastic silencer element in the first intron of the rat osteocalcin gene. Biochemistry 35,11005-11011. Graham, A., Heyman, I., and Lumsden, A. (1993). Even-numbered rhombomeres control the apoptotic elimination of neural crest from odd-numbered rhombomeres in the chick hindbrain. Development (Cambridge, UK)119,233-245. Grande, M. A., van der Kraan, I., van Steensel, B., Schul, W., de-Th6, H., van der Voort, H. T., de Jong, L., and van Driel, R. (1996). PML-containing nuclear bodies: their spa-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
495
tial distribution in relation to other nuclear components. J. Cell. Biochem. 63, 280-291. Grigoriadis, A. E., Schellander, K., Wang, Z.-Q., and Wagner, E. F. (1993). Osteoblasts are target cells for transformation in c-fos transgenic mice. J. Cell Biol. 122, 685-701. Guo, B., Odgren, P. R., van Wijnen, A. J., Last, T.J., Nickerson, J., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1995). The nuclear matrix protein NMP-1 is the transcription factor W1. Proc. Natl. Acad. Sci. U.S.A. 92,10526-10530. Guo, B., Aslam, F., van Wijnen, A. J., Roberts, S. G. E., Frenkel, B., Green, M., DeLuca, H., Lian, J. B., Stein, G. S., and Stein, J. L. (1997). YYl regulates MR/RXR mediated transctivation of the vitamin D responsive osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 94,121-126. Guo, B., Javed, A., Green, J., Stein, J. L., Lian, J. B., van Wijnen, A. J., and Stein, G. S. (1998). Groucho/TLE proteins associate with the nuclear matrix and repress CbfdAML mediated transactivation on osteocalcin promoter. J. Bone Miner. Res. (in press) (Abstract). Harris, S. E., Sabatini, M., Harris, M. A., Feng, J. Q., Wozney, J., and Mundy, G. R. (1994a). Expression of bone morphogenetic protein messenger RNAin prolonged cultures of fetal rat calvarial cells. J. Bone Miner. Res. 9,389-394. Harris, S . E., Bonewald, L. F., Harris, M. A., Sabatini, M., Dallas, S., Feng, J. Q., GhoshChoudhury, N., Wozney, J., and Mundy, G. R. (199413). Effects of transforming growth factor beta on bone nodule formation and expression of bone morphogenetic protein 2, osteocalcin, osteopontin, alkaline phosphatase, and type I collagen mRNA in longterm cultures of fetal rat calvarial osteoblasts. J. Bone Miner. Res. 9,855-863. Hauschka, P. V., and Wians, F. H., Jr. (1989). Osteocalcin-hydroxyapatite interaction in the extracellular organic matrix of bone. Anat. Rec. 224, 180-188. Hauschka, P. V., Lian, J. B., Cole, D. E. C., and Gundberg, C. M. (1989). Osteocalcin and matrix Gla protein: Vitamin K-dependent proteins in bone. Physiol. Reu. 69,990-1047. Heersche, J. N. M., Reimers, S. M., Wrana, J. L., Waye, M. M. Y., and Gupta, A. K. (1992). Changes in expression of alpha 1type 1collagen and osteocalcin mRNAin osteoblasts and adontoblasts at different stages of maturity as shown by in situ hybridization. Proc. Finn. Dent. SOC.88,173-182. Heinrichs, A. A. J., Banejee, C., Bortell, R., Owen, T. A., Stein, J. L., Stein, G. S., and Lian, J. B. (1993a). Identification and characterization of two proximal elements in the rat osteocalcin gene promoter that may confer species- specific regulation. J . Cell. Biochem. 53,240-250. Heinrichs, A. A. J., Bortell, R., Rahman, S., Stein, J. L., Alnemri, E. S., Litwack, G., Lian, J. B., and Stein, G. S. (1993b). Identification of multiple glucocorticoid receptor binding sites in the rat osteocalcin gene promoter. Biochemistry 32,11436-11444. Heinrichs, A. A. J., Bortell, R., Bourke, M., Lian, J. B., Stein, G. S., and Stein, J. L. (1995). Proximal promoter binding protein contributes to developmental, tissue-restricted expression of the rat osteocalcin gene. J. Cell. Biochem. 57,90-100. Hendzel, M. J., Sun, J. M., Chen, H. Y., Rattner, J . B., and Davie, J. R. (1994). Histone acetyltransferase is associated with the nuclear matrix. J. Biol. Chem. 269, 22894-22901. Herman, R., Weymouth, L., and Penman, S. (1978). Heterogeneous nuclear RNA-protein fibers in chromatin-depleted nuclei. J. Cell Biol. 78,663-674. Hodgkinson, J. E., Davidson, C. L., Beresford, J., and Sharpe, P. T. (1993). Expression of a human homeobox-containing gene is regulated by 1,25(OH),D, in bone cells. Biochim. Biophys. Acta 1174, 11-16. Hoffmann, H. M., Catron, K. M., van Wijnen, A. J., McCabe, L. R., Lian, J . B., Stein, G. S., and Stein, J. L. (1994). Transcriptional control of the tissue-specific, develop-
496
JANE B. LIAN et al.
mentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins. Proc. Natl. Acad. Sci. U.S.A.91,12887-12891. Hoffmann, H. M., Beumer, T. L., Rahman, S., McCabe, L. R., Banejee, C., Aslam, F., "iro, J. A., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. (1996). Bone tissuespecific transcription of the osteocalcin gene: Role of an activator osteoblast-specific complex and suppressor hox proteins that bind the OC box. J . Cell. Biochem. 61, 310-324. Honvitz, K. B., Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996). Nuclear receptor coactivators and corepressors. Mol. Endocrinol. 10, 1167-1177. Hu, Y., Flanagan, J., Brennan, D. P., Zhou, H., Ng, K. W., Eisman, J. A., and Morrison, N. A. (1995). rHox: A horneobox gene expressed in osteoblastic cells. J. Cell. Biochem. 59,486-497. Hughes, F. J., Collyer, J., Stanfield, M., and Goodman, S. A. (1995). The effects of bone morphogenetic protein-2, -4, and -6 on differentiation of rat osteoblast cells in vitro. Endocrinology (Baltimore) 136,2671-2677. Hyder, S. M., Stancel, G. M., and Loose-Mitchell, D. S. (1994). Steroid hormone-induced expression of oncogene encoded nuclear proteins. Grit. Rev. Eukaryotic Gene Expression 4,55-116. Iimura, T., Oida, S., Takeda, K., Maruoka, Y., and Sasaki, S. (1994). Changes in homeobox-containing gene expression during ectopic bone formation induced by bone morphogenetic protein. Biochem. Biophys. Res. Commun. 201,980-987. Ingram, R. T., Park, Y. K., Clarke, B. L., and Fitzpatrick, L. A. (1994). Age- and genderrelated changes in the distribution of osteocalcin in the extracellular matrix of normal male and female bone. Possible involvement of osteocalcin in bone remodeling. J . Clin. Invest. 93,989-997. Jaaskelainen, T., Pirskanen, A., Ryhanen, S., Palvimo, J. J., DeLuca, H. F., and Maenpaa, I?. H. (1994). Functional interference between AP-1and the vitamin D receptor on osteocalcin gene expression in human osteosarcoma cells. Eur. J. Biochem. 224,ll-20. Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R., Warman, M. L., Mulliken, J. B., Snead, M. L., and Maxson, R. (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell (Cambridge, Mass.) 75,443-450. Jackson, D. A., and Cook, €? R. (1986).Replication occurs at a nucleoskeleton. EMBO J. 5,1403-1410. Jackson, D. A., McCready, S. J., and Cook, P. R. (1981). RNAis synthesized at the nuclear cage. Nature (London) 292,552-555. Javed, A., Gutierrez, S., van Wijnen, A. J., Stein, G. S., Stein, J. L., and Lian, J. B. (1998). Cbfa binding sites are required for hormonal responsiveness in the osteocalcin promoter. J. Bone Miner. Res. (in press) (Abstract). Ji, C., Casinghino, S., McCarthy, T. L., and Centrella, M. (1997). Multiple and essential Sp 1binding sites in the promoter for transforming growth factor-beta type I receptor. J. Biol. Chem. 272,21260-21267. Johnson, R. L., Riddle, R. D., and Tabin, C. J. (1994). Mechanisms of limb patterning. Cum @in. Genet. Dev. 4,535-542. Johnson, T. L., Sakaguchi, A. Y., Lalley, P. A., and Leach, R. J. (1991). Chromosomal assignment in mouse of matrix Gla protein and bone Gla protein genes. Geonomics 11, 770-772. Jurutka, P. W., Terpening, C. M., and Haussler, M. R. (1993). The 1,25-dihydroxy-vitamin D3 receptor is phosphyorylated in response to 1,25-dihydroxy-vitamin D3 and 22-ox-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
497
acalcitriol in rat osteoblasts, and by casein kinase 11, in vitro. Biochemistry 32, 8184-8192. Kagoshima, H., Shigesada, K., Satake, M., Ito, Y., Miyoshi, H., Ohki, M., Pepling, M., and Gergen, P. (1993). The runt domain identifies a new family of heteromeric transcriptional regulators. Bends Genet. 9,338-341. Kamalia, N., McCulloch, C. A. G., Tenenbaum, H. C., and Limeback, H. (1992). Dexamethasone recruitment of self-renewing osteoprogenitor cells in chick bone marrow stromal cell cultures. Blood 79,320-326. Kasai, R., Bianco, P., Robey, P. G., and Kahn, A. J. (1994). Production and characterization of an antibody against the human bone GLA protein (BGP/osteocalcin) propeptide and its use in immunocytochemistry of bone cells. Bone Miner. 25,167-182. Kasugai, S., Todescan, R., Nagata, T., Yao, K. L., Butler, W., and Sodek, J. (1991). Expression of bone matrix proteins associated with mineralized tissue formation by adult rat bone marrow cells in vitro: Inductive effects of dexamethasone on the osteoblastic phenotype. J. Cell. Physiol. 147, 111-120. Katagiri, T., Yamaguchi, A., Komaki, M., Abe, E., Takahashi, N., Ikeda, T., Rosen, V., Wozney, J. M., Fujisawa-Sehara, A., and Suda, T. (1994). Bone morphogenetic protein-2 converts the differentiation pathway of C2C 12 myoblasts into the osteoblast lineage. J. Cell Biol. 127, 1755-1766. Kawaguchi, N., DeLuca, H. F., and Noda, M. (1992). Id gene expression and its suppression by 1,25-dihydroxyvitamin D3 in rat osteoblastic osteosarcoma cells. Proc. Natl. Acad. Sci. U.S.A.89,4569-4572. Kerner, S. A., Scott, R. A., and Pike, J. W. (1989). Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D,. Proc. Natl. Acad. Sci. U.S.A. 86,4455-4459. Kesterson, R. A,, Stanley, L., DeMayo, F., Finegold, M., and Pike, J. W. (1993). The human osteocalcin promoter directs bone-specific vitamin D-regulatable gene expression in transgenic mice. Mol. Endocrinol. 7,462-467. Kliewer, S . A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992). Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature (London) 355,446-449. Knapen, M. H., Hamulyak, K., and Vermeer, C. (1989). The effect of vitamin K supplementation on circulating osteocalcin (bone Gla protein) and urinary calcium excretion. Ann. Intern. Med. 111,1001-1005. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y.-H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997). Targeted disruption of Cbfal results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell (Cambridge, Mass.) 89,755-764. Krishnan, A. V., and Feldman, D. (1991). Stimulation of 1,25-dihydroxyvitamin D3 receptor gene expression in cultured cells by serum and growth factors. J. Bone Miner. Res. 6,1099-1107. Landers, J. P., and Spelsberg, T. C. (1992). New concepts in steroid hormone action: Transcription factors, proto-oncogenes, and the cascade model for steroid regulation of gene expression. Crit. Rev. Eukaryotic Gene Expression 2,19-63. Leboy, P. S., Beresford, J. N., Devlin, C., and Owen, M. E. (1991). Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell cultures. J. Cell. Physiol. 146, 370-378. Lee, B., Thirunavukkarasu, K., Zhou, L., Pastore, L., Baldini, A., Hecht, J., Geoffroy, V., Ducy, P., and Karsenty, G. (1997). Missense mutations abolishing DNA binding of the
498
JANE B. LIAN et al.
osteoblast-specific transcription factor OSF2/CBFAl in cleidocranial dysplasia. Nut. Genet. 16,307-310. Levanon, D., Negreanu, V., Bernstein, Y., Bar-Am, I., Avivi, L., and Groner, Y. (1994). AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization. Genomics 23, 425-432. Levy, R. J., Gundberg, C., and Scheinman, R., (1983). The identification of the vitamin Kdependent bone protein osteocalcin as one of the gamma-carboxyglutamic acid containing proteins present in calcified atherosclerotic plaque and mineralized heart valves. Atherosclerosis (Shannon, Zrel.) 46,49-56. Li, H., Gomes, P. J., and Chen, J. D. (1997a). RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc. Natl. Acad. Sci. U.S.A. 94, 8479-8484. Li, H., Leo, C., Schroen, D. J., and Chen, J. D. (199713). Characterization of receptor interaction and transcriptional repression by the corepressor SMRT. MoZ. Endocrinol. 11,2025-2037. Li, Y. P., and Stashenko, P. (1993). Characterization of a tumor necrosis factor-responsive element which down-regulates the human osteocalcin gene. Mol. Cell. Biol. 13, 3714-3721. Li,Y. P., Chen, W., and Stashenko, P. (1995). Characterization of a silencer element in the first exon of the human osteocalcin gene. Nucleic Acids Res. 23,5064-5072. Lian, J., Stewart, C., Puchacz, E., Mackowiak, S., Shalhoub, V., Collart, D., Zambetti, G., and Stein, G. (1989). Structure of the r at osteocalcin gene and regulation of vitamin D-dependent expression. Proc. Natl. Acad. Sci. U.S.A. 86,1143-1147. Lian, J. B., and Friedman, P. A. (1978). The vitamin K-dependent synthesis of gammacarboxyglutamic acid by bone microsomes. J. Biol. Chem. 253,6623-6626. Lian, J. B., and Gundberg, C. M.(1988). Osteocalcin. Biochemical considerations and clinical applications. Clin. Orthop. Relat. Res. 267-291. Lian, J . B., and Marks, S. C. J . (1990). Osteopetrosis in the rat: Coexistence of reductions in osteocalcin and bone resorption. Endocrinology (Baltimore) 126,955-962. Lian, J. B., and Stein, G. S. (1992). Transcriptional control of vitamin D-regulated proteins. J. Cell. Biochem. 49,37-45. Lian, J. B., and Stein, G. S. (1993). Vitamin D regulation of osteoblast growth and differentiation. In “Nutrition and Gene Expression” (C. D. Berdanier and J. L. Hargrove, eds.), pp. 391-429. CRC Press, Boca Raton, FL. Lian, J. B., Tassinari, M., and Glowacki, J. (1984). Resorption of implanted bone prepared from normal and warfarin-treated rats. J. Clin. Invest. 73,1223-1226. Lian, J. B., Dunn, K., and Key, L. L. J. (1986). In vitro degradation of bone particles by human monocytes is decreased with the depletion of the vitamin K-dependent bone protein from the matrix. Endocrinology (Baltimore) 118,1636-1642. Lian, J. B., Stein, G. S.,Bortell, R., and Owen, T. A. (1991). Phenotype suppressi0n:Apostulated molecular mechanism for mediating the relationship of proliferation and differentiation by Fos/Jun interactions at AP-1 sites in steroid responsive promoter elements of tissue-specific genes. J. Cell. Biochem. 45,9-14. Lian, J. B., Stein, G. S., Owen, T. A., Bortell, R., Shalhoub, V., Heinrichs, A., van Oordt, W. C., and van Wijnen, A. J. (1992). Hormonal influence on expression of growth (H4 histone) and differentiation (osteocalcin) genes is dependent on developmental stage of the osteoblast: Modification of these regulatory controls in tumor cells. In “Chemistry and Biology of Mineralized Tissues” (H. Salvkin, A. P. Price, eds.), pp. 307-316. Elsevier (Excerpta Media), Amsterdam. Lian, J. B., McKee, M. D., Todd, A. M., and Gerstenfeld, L. C. (1993a). Induction of bonerelated proteins, osteocalcin and osteopontin, and their matrix ultrastructural local-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
499
ization with development of chrondrocyte hypertrophy in vitro. J. Cell. Biochem. 52, 206-219. Lian, J. B., Stein, G. S., Stein, J. L., Bortell, R., Owen, T. A., Shalhoub, V., Heinrichs, A., vanoordt, C. W., and van Wijnen, A. J. (199313).Implications of abrogated growth control on expression of a cell cycle-regulated histone and osteoblast-specific osteocalcin genes in osteosarcoma cells. In “Frontiers of Osteosarcoma Research: Interdisciplinary Survey of Clinical and Research Advances” (J. F. Novak and J. H. McMaster, eds.), pp. 227-287. Hogrefe & Huber, Seattle, Washington. Lian, J. B., Stein, G. S., Stein, J. L., van Wijnen, A., Montecino, M., Desai, R., Shakoori, A. R., Breen, E., Hoffmann, H., and Pockwinse, S. M. (1994). Vitamin D regulation of osteocalcin gene transcription: A model for defining molecular mechanisms of 1,25(OH),D, control of osteoblast growth and differentiation. In “Vitamin D: A Pluripotent Steroid Hormone: Structural Studies Molecular Endocrinology,and Clinical Applications” (A. W. Norman, R. Bouillon, and M. Thomasset, eds.), pp. 264-272. de Gruyter, Berlin and New York. Lian, J. B., Stein, G. S., Stein, J. L., van Wijnen, A. J.,McCabe, L., Banerjee, C., and Hoffmann, H. (1996). The osteocalcin gene promoter provides a molecular blueprint for regulatory mechanisms controlling bone tissue formation: Role of transcription factors involved in development. Connect. Tissue Res. 35,15-21. Lian, J. B., Shalhoub, V., Asalm, F., Frenkel, B., Green, J., Hamrah, M., Stein, G. S., and Stein, J. L. (1997). Species-specific glucocorticoid and 1,25-dihydroxyvitamin D responsiveness in mouse MC3T3-El osteoblasts: Dexamethasone inhibits osteoblast differentiation and vitamin D downregulates osteocalcin gene expression. Endocrinology (Baltimore) 138,2117-2127. Liggett, W. H. J.,Lian, J. B., Greenberger, J. S., and Glowacki, J. (1994). Osteocalcin promotes differentiation of osteoclast progenitors from murine long-term bone marrow cultures. J. Cell. Biochem. 55,190-199. Lindenmuth, D. M., van Wijnen, A. J., Hiebert, S., Stein, J. L., Lian, J. B., and Stein, G. S. (1997). Subcellular partitioning of transcription factors during osteoblast differentiation: Developmental association of the AML/CBFa/PEBP2a-related transcription factor-NMP-2 with the nuclear matrix. J . Cell. Biochem. 66,123-132. Liska, D. J., Reed, M. J., Sage, E. H., and Bornstein, P. (1994). Cell-specific expression of alpha 1fI)collagen-hGH minigenes in transgenic mice. J. Cell Biol. 125,695-704. Liu, Y. H., Ma, L., Wu, L. Y., Luo, W., Kundu, R., Sangiorgi, F., Snead, M. L., and Maxson, R. (1994). Regulation of the Msx2 homeobox gene during mouse embryogenesis: A transgene with 439 bp of 5’ flanking sequence is expressed exclusively in the apical ectodermal ridge of the developing limb. Mech. Deu. 48, 187-197. Liu, Y. H., Kundu, R., Wu, L., Luo, W., Ignelzi, M. A. J., Snead, M. L., and Maxson, R. E. J. (1995). Premature suture closure and ectopic cranial bone in mice expressing Msx2 transgenes in the developing skull. Proc. Natl. Acad. Sci. U.S.A. 92, 6137-6141. Long, M. W., Williams, J. L., and Mann, K. G. (1990). Expression of bone-related proteins in the hematopoietic microenvironment. J. Clin. Invest. 86,1387-1395. Lufkin, T., Mark, M., Hart, C . F!, Dolle, I?, LeMeur, M., and Chambon, P. (1992). Homeotic transformation of the occipital bones of the skull by ectopic expression of a homeobox gene. Nature (London) 359,835-841. Lynch, M. P., Stein, J. L., Stein, G. S., and Lian, J. B. (1994). Apoptosis during in vitro bone formation. J . Bone Miner. Res. 9, S352 (abstr.). Lynch, M. P., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). The influence of type I collagen on the development and maintenance of the osteoblast phenotype in primary and passaged rat calvarial osteoblasts: modification of expression of genes support-
500
JANE B. LIAN et a1
ing cell growth, adhesion, and extracellular matrix mineralization. Exp. Cell Res. 216,35-45. MacDonald, P. N., Dowd, D. R., Nakajima, S., Galligan, M. A., Reeder, M. C., Haussler, C. A., Ozato, K., and Haussler, M. R. (1993). Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D,-activated expression of the rat osteocalcin gene. Mol. Cell. Biol. 13, 5907-5917. MacDonald, P. N., Sherman, D. R., Dowd, D. R., Jefcoat, S. C., Jr., and DeLisle, R. K. (1995). The vitamin D receptor interacts with general transcription factor IIB. J. Biol. Chem. 270,4748-4752. Machwate, M., Jullienne, A., Moukhtar, M., and Marie, P. J. (1995). Temporal variation of c-fos proto-oncogene expression during osteoblast differentiation and osteogenesis in developing bone. J. Cell. Biochem. 57,62-70. Mackowiak, S . , Gerstenfeld, L., Hauschka, P. V., and Lian, J. B. (1985). Cell-free translation of the vitamin K-dependent bone protein osteocalcin. Biochem. Biophys. Res. Commun. 132,240-244. Mahonen, A., Pirskanen, A., Keinanen, R., and Maenpaa, P. H. (1990). Effect of 1,25(OH),D, on its receptor mRNA levels and osteocalcin synthesis in human osteosarcoma cells. Biochim. Biophys. Actu 1048,30-37. Malaval, L., Modrowski, D., Gupta, A. K., and Aubin, J. E. (1994). Cellular expression of bone-related proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J. Cell. Physiol. 158, 555-572. Malone, J. D., Teitelbaum, S. L., Griffin, G. L., Senior, R. M., and Kahn, A. J. (1982). Recruitment of osteoclast precursors by purified bone matrix constituents. J. Cell Biol. 92,227-230. Mark, M. P., Prince, C. W., Gay, S., Austin, R. L., Bhown, M., Finkelman, R. D., and Butler, W. T. (1987). A comparative immunocytochemical study on the subcellular distributions of 44 kDa bone phosphoprotein and bone gamma-carboxyglutamic acid (G1a)-containing protein in osteoblasts. J. Bone Miner. Res. 2,337-346. Markose, E. R., Stein, J. L., Stein, G. S., and Lian, J. B. (1990). Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 87,1701-1705. Martin, J. F., Bradley, A., and Olson, E. N. (1995). The paired-liks homeo box gene MHox is required for early events of skeletogenesis in multiple lineages. Genes Deu. 9, 1237-1249. Masi, L., Franchi,A., Santucci, M., Danielli, D., Arganini, L., Giannone, V., Formigli, L., Benvenuti, S., Tanini, A., and Beghe, F. (1992). Adhesion, growth, and matrix production by osteoblasts on collagen substrata. Culcif: Tissue Znt. 51,202-212. Masuyama, H., Brownfield, C. M., St.Arnaud, R., and MacDonald, P. N. (1997). Evidence for ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol. Endocrinol. 11, 1507-1517. Mayur, N., Lewis, S., Cathenvood, B. D., and Nanes, M. S. (1993). Tumor necrosis factor alpha decreases 1,25-dihydroxyvitamin D3 receptors in osteoblastic ROS 17/22?cells. J. Bone Miner. Res. 8,997-1003. McCabe, L. R., Kockx, M., Lian, J., Stein, J.,and Stein, G. (1995). Selective expression of fos- and jun-related during osteoblast proliferation and differentiation. Exp. Cell Res. 218,255-262. McCabe, L. R., Banerjee, C., Kundu, R., Harrison, R. J., Dobner, P. R., Stein, J. L., Lian, J. B., and Stein, G. S. (1996). Developmental expression and activities of specific fos and jun proteins are funtionally related to osteoblast maturation: Role of fra-2 and jun D during differentiation. Endocrinology (Baltimore) 137,4398-4408.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
50 1
McKee, M. D., Farach-Carson, M. C., Butler, W. T., Hauschka, F? V., and Nanci, A. (1993). Ultrastructural immunolocalization of noncollagenous (osteopontin and osteocalcin) and plasma (albumin and alpha 2HS-glycoprotein) proteins in rat bone. J. Bone Miner. Res. 8,485-496. Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidwell, J. P., Fey, E., Lian, J., Stein, J., and Stein, G. S. (1995). The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBPa/runt domain transcription factor family: Interactions with the osteocalcin gene promoter. Biochemistry 34,13125-13132. Miner, J. N., and Yamamoto, K. R. (1991). Regulatory crosstalk at composite response elements. Dends Biochem. Sci. 16,423-426. Mirkovitch, J., Mirault, M. E., and Laemmli, U. K. (1984). Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold. Cell (Cambridge, Mass.) 39,223-232. Montecino, M., Lian, J., Stein, G., and Stein, J. (1994a). Specific nucleosomal organization supports developmentally regulated expression of the osteocalcin gene. J. Bone Miner. Res. 9, S352 (abstr.). Montecino, M., Pockwinse, S., Lian, J., Stein, G., and Stein, J. (1994b). DNase I hypersensitive sites in promoter elements associated with basal and vitamin D dependent transcription of the bone- specific osteocalcin gene. Biochemistry 33,348-353. Montecino, M., Lian, J., Stein, G., and Stein, J. (1996). Changes in chromatin structure support constitutive and developmentally regulated transcription of the bone-specific osteocalcin gene in osteoblastic cells. Biochemistry 35,5093-5102. Montecino, M., Frenkel, B., van Wijnen, A., Lian, J., Stein, J., and Stein, G. (1997). Chromatin hyperacetylation abrogates vitamin D-mediated transcriptional stimulation of the tissue-specific osteocalcin gene in vivo. (Manuscript submitted.) Morrison, N., and Eisman, J. (1993). Role of the negative glucocorticoid regulatory element in glucocorticoid repression of the human osteocalcin promoter. J. Bone Miner. Res. 8,969-975. Morrison, N. A., Shine, J., Fragonas, J. C., Verkest, V., McMenemy, L., and Eisman, J. A. (1989). 1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene. Science 246,1158-1161. Morrison, N. A., Yeoman, R., Kelly, P. J., and Eisman, J. A. (1992). Contribution of transacting factor alleles to normal physiological variability: Vitamin D receptor gene polymorphism and circulating osteocalcin. Proc. Natl. Acad. Sci. U.S.A. 89, 6665-6669. Mortillaro, M. J., Blencowe, B. J., Wei, X., Nakayasu, H., Du, L., Warren, S. L., Sharp, P. A., and Berezney, R. (1996). A hyperphorylated form of the large subunit of RNA polymerase I1 is associated with splicing complexes and the nuclear matrix. Proc. Natl. Acad. Sci. U.S.A. 93,8253-8257. Mundlos, S., Otto, F., Mundlos, C., Mulliken, J. B., Aylsworth, A. S., Albright, S., Lindhout, D., Cole, W. G., Henn, W., Knoll, J. H. M., Owen, M. J., Mertelsmann, R., Zabel, B. U., and Olsen, B. R. (1997). Mutations involving the transcription factor CBFAl cause cleidocranial dysplasia. Cell (Cambridge, Mass.) 89,773-779. Murray, S. S., Glackin, C. A., Winters, K. A., Gazit, D., Kahn, A. J., and Murray, E. J. (1992). Expression of helix-loop-helix regulatory genes during differentiation of mouse osteoblastic cells. J. Bone Miner. Res. 7,1131-1138. Nakagawa, Y., Renz, C. L., Ahmed, M., and Coe, F. L. (1991). Isolation of nephrocalcin from kidney tissue of nine vertebrate species. Am. J. Physiol. 260, F243-F248. Nakajima, S., Hsieh, J. C., MacDonald, P. N., Galligan, M. A,, Haussler, C. A., Whitfield, G. K., and Haussler, M. R. (1994). The C-terminal region of the vitamin D receptor is essential to form a complex with a receptor auxiliary factor required for high affmity binding to the vitamin D-responsive element. Mol. Endocrinol. 8,159-172.
502
JANE B. LIAN et al.
Nanes, M. S., Kuno, H., Demay, M. B., Kurian, M., Hendy, G. N., DeLuca, H. F., Titus, L., and Rubin, J. (1994). A single up-stream element confers responsiveness to 1,25dihydroxyvitamin D3 and tumor necrosis factor-alpha in the rat osteocalcin gene. Endocrinology (Baltimore) 134, 1113-1120. Nefussi, J. R., Boy-Lefevre, M. L., Boulekbache, H., and Forest, N. (1985). Mineralization in vitro of matrix formed by osteoblasts isolated by collagenase digestion. Differentiation (Berlin) 29, 160-168. Nelkin, B. D., Pardoll, D. M., and Vogelstein, B. (1980). Localization of SV40 genes within supercoiled loop domains. Nucleic Acids Res. 8,5623-5633. Nishikawa, J., Kitaura, M., Matsumoto, M., Imagawa, A., and Nishihara, T. (1994). Difference and similarity of DNA sequences recognized by VDR homodimer and VDR/RXR heterodimer. Nucleic Acids Res. 22,2902-2907. Nishimoto, S . K., and Price, P. A. (1980). Secretion of the vitamin K-dependent protein of bone by rat osteosarcoma cells. Evidence for an intracellular precursor. J. Biol. Chem. 255,6579-6583. Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt, D. (1990). Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D, receptor and 1,25-dihydroxyvitamin D, enhancement of mouse secreted phosphoprotein 1(Spp-1or ostepontin) gene expression. Proc. Natl. Acad. Sci. U.S.A. 87, 9995-9999. Ogata, T., and Noda, M. (1991). Expression of Id, a negative regulator of helix-loop-helix DNA binding proteins, is down-regulated a t confluence and enhanced by dexamethasone in a mouse osteoblastic cell line, MC3T3E1. Biochem. Biophys. Res. Comnun. 180,1194-1199. Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K., and Ito, Y. (1993).PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AMLl gene. Proc. Natl. Acad. Sci. U.S.A. 90,6859-6863. Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M., and Kato, Y. (1994). Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J. Biol. Chem. 269,10545-10550. Okuda, T., van Deursen, J.,Hiebert, S. W., Grosveld, G., and Downing, J. R. (1996).AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell (Cambridge, Mass.) 84,321-330. Oiiate, S . A,, Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354- 1357. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W. H., Beddington, R. S. P., Mundlos, S., Olsen, B. R., Selby, P. B., and Owen, M. J. (1997). Cbfal, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell (Cambridge, Mass.) 89, 765-771. Owen, T. A., Aronow, M., Shalhoub, V., Barone, L. M., Wilming, L., Tassinari, M. S., Kennedy, M. B., Pockwinse, S., Lian, J. B., and Stein, G. S. (1990a). Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J. Cell. Physiol. 143,420-430. Owen, T. A,, Bortell, R., Yocum, S. A., Smock, S. L., Zhang, M., Abate, C., Shalhoub, V., Aronin, N., Wright, K. L., van Wijnen, A. J., Stein, J. L., Curran, T., Lian, J. B., and Stein, G. S. (1990b). Coordinate occupancy ofAP-1 sites in the vitamin D responsive
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
503
and CCAAT box elements by Fos-Jun in the osteocalcin gene: Model for phenotype suppression of transcription. Proc. Natl. Acad. Sci. U.S.A. 87,9990-9994. Owen, T. A., Aronow, M. S., Barone, L. M., Bettencourt, B., Stein, G. S., and Lian, J. B. (1991). Pleiotropic effects of vitamin D on osteoblast gene expression are related to the proliferative and differentiated state of the bone cell phenotype: Dependency upon basal levels of gene expression, duration of exposure, and bone matrix competency in normal rat osteoblast cultures. Endocrinology (Baltimore) 128, 1496-1504. Owen, T. A., Bortell, R., Shalhoub, V., Heinrichs, A., Stein, J. L., Stein, G. S., and Lian, J. 3.(1993). Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements. Proc. Natl. Acad. Sci. U.S.A.90,1503-1507. Ozono, K., Sone, T., and Pike, J. W. (1991). The genomic mechanism of action of 1,25-dihydroxyvitamin D3. J. Bone Miner. Res. 6,1021-1027. Palaparti, A., Baratz, A., and Stifani, S. (1997). The Grouchohansducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3. J. Biol. Chem. 272,26604-26610. Pan, L. C., and Price, P. A. (1987). Ligand-dependent regulation of 1,25-dihydroxyvitamin D, receptor in rat osteosarcoma cells. J. Biol. Chem. 262,4670-4675. Pastoureau, P., Vergnaud, P., Meunier, P. J., and Delmas, P. D. (1993). Osteopenia and bone-remodeling abnormalities in warfarin-treated lambs. J. Bone Miner. Res. 8, 1417-1426. Pavlin, D., Lichtler, A. C., Bedalov, A., Kream, B. E., Harrison, J. R., Thomas, H. F., Gronowicz, G. A., Clark, S. H., Woody, C. O., and Rowe, D. W. (1992). Differential utilization of regulatory domains within the alpha l(1) collagen promoter in osseous and fibroblastic cells. J. Cell Biol. 116,227-236. Perlmann, T., Rangarajan, P. N., Umesono, K., and Evans, R. M. (1993). Determinants for selective RAR and TR recognition of direct repeat HREs. Genes Deu. 7,1411-1422. Pienta, K. J., and Coffey, D. S. (1991). Correlation of nuclear morphometry with progression of breast cancer. Cancer (Philadelphia) 68, 2012-2016. Pirskanen, A., Jaaskelainen, T., and Maenpaa, P. H. (1994). Effects of transforming growth factor beta 1on the regulation of osteocalcin synthesis in human MG-63 osteosarcoma cells. J. Bone Minel: Res. 9,1635-1642. Pockwinse, S. M., Wilming, L. G., Conlon, D. M., Stein, G. S., and Lian, J. B. (1992). Expression of cell growth and bone specific genes at single cell resolution during development of bone tissue-like organization in primary osteoblast cultures. J. Cell. Biochem. 49,310-323. Pockwinse, S. M., Stein, J. L., Lian, J. B., and Stein, G. S. (1995). Developmental stagespecific cellular responses to vitamin D and glucocorticoids during differentiation of the osteoblast phenotype: Interrelationship of morphology and gene expression by in situ hybridization. Exp. Cell Res. 216, 244-260. Price, P. A. (1988). Role of vitamin-K-dependent proteins in bone metabolism. Annu. Rev. Nutr. 8,565-583. Price, F! A., Williamson, M. K., and Lothringer, J. W.(1981). Origin of the vitamin K-dependent bone protein found in plasma and its clearance by kidney and bone. J. Biol. Chem. 256,12760-12766. Price, P. A., Williamson, M. K., Haba, T., Dell, R. B., and Jee, W. S. (1982). Excessive mineralization with growth plate closure in rats on chronic warfarin treatment. Proc. Natl. Acad. Sci. U S A . 79,7734-7738. Price, P. A., Fraser, J. D., and Metz-Virca, G. (1987). Molecular cloning of matrix Gla protein: Implications for substrate recognition by the vitamin K-dependent gamma-carboxylase. Proc. Natl. Acad. Sci. U.S.A. 84,8335-8339.
504
JANE B. LIAN et al.
Puchacz, E., Lian, J. B., Stein, G. S., Wozney, J., Huebner, K., and Croce, C. (1989). Chromosomal localization of the human osteocalcin gene. Endocrinology (Baltimore) 124, 2648-2650. Quarles, L. D., Yohay, D.A., Lever, L. W., Caton, R., and Wenstrup, R. J. (1992). Distinct proliferative and differentiated stages of murine MC3T3-El cells in culture: An in vitro model of osteoblast development. J. Bone Minezer.Res. 7,683-692. Quarles, L. D., Siddhanti, S. R., and Medda, S. (1997). Developmental regulation of osteocalcin expression in MC3T3-El osteoblasts: Minimal role of the proximal E-box cis-acting promoter elements. J. Cell. Biochem. 65, 11-24. Rafidi, K., Simkina, I., Johnson, E., Moore, M. A., and Gerstenfeld, L. C. (1994). Characterization of the chicken osteopontin-encoding gene. Gene 140,163-169. Rahman, S., Oberdorf, A., Montecino, M., Tanhauser, S. M., Lian, J. B., Stein, G. S., Laipis, P. J., and Stein, J. L. (1993). Multiple copies of the bone-specific osteocalcin gene in mouse and rat. Endocrinology (Baltimore) 133,3050-3053. Rezzonico, R., Loubat, A., Lallemand, D., Ham, C. M., Far, D. F., Proudfoot, A., Rossi, B., and Ponzio, G. (1995). Cyclic AMP stimulates a JunDIFra-2 AP-1 complex and inhibits the proliferation of interleukin-6-dependent cell lines. Oncogene 11, 1069-1078. Rhodes, S. J., Chen, R., DiMattia, G. E., Scully, K. M., Kalla, K. A,, Lin, S. C., Yu, V. C., and Rosenfeld, M. G. (1993).Atissue-specific enhancer confers Pit- 1-dependentmorphogen inducibility and autoregulation on the pit-1 gene. Genes Dev. 7,913-932. Richard, D. J., Sullivan, T. A., Shenker, B. J., Leboy, P. S., and Kazhdan, I. (1994). Induction of rapid osteoblast differentiation in rat bone marrow stromal cell cultures by dexamethasone and BMP-2. Dew. Biol. 161,218-228. Robey, P. G.,and Termine, J. D. (1985). Human bone cells in vitro. Calcif: Zlssues Int. 37, 453-460. Robinson, S. I., Nelkin, B. D., and Vogelstein, B. (1982). The ovalbumin gene is associated with the nuclear matrix of chicken oviduct cells. Cell (Cambridge, Mass.) 28,99-106. Rodan, G. A., and Noda, M. (1990). Gene expression in osteoblastic cells. Crit. Rev. Eukaryotic Gene Expression 1,85-98. Romberg, R. W., Werness, P. G., Riggs, B. L., and Mann, K. G. (1986). Inhibition of hydroxyapatite crystal growth by bone-specific and other calcium-binding proteins. Biochemistry 25,1176-1180. Rosen, H. N., Maitland, L. A,, Suttie, J. W., Manning, W. J., Glynn, R. J., and Greenspan, S. L. (1993). Vitamin K and maintenance of skeletal integrity in adults. Am. J. Med. 94,62-68. Ross, T. K., Moss, V. E., Prahl, J. M., and DeLuca, H. F. (1992). A nuclear protein essential for binding of rat 1,25-dihydorxyvitamin D3 receptor to its response elements. Proc. Natl. Acad. Sci. U.S.A. 89,256-260. Ross, T. K., Danvish, H. M., Moss, V. E., and DeLuca, H. F. (1993). Vitamin D-influenced gene expression via a ligand-independent, receptor- DNA complex intermediate. Proc. Natl. Acad. Sci. U.S.A.90,9257-9260. Rossert, J.A., Chen, S. S., Eberspaecher, H., Smith, C. N., andde Crombrugghe, B. (1996). Identification of a minimal sequence of the mouse pro-al(I) collagen promoter that confers high-level osteoblast expression in transgenic mice and that binds a protein selectively present in osteoblasts. Proc. Natl. Acad. Sci. U.S.A.93, 1027-1031. Ryoo, H.-M., Hoffmann, H. M., Beumer, T. L., Frenkel, B., Towler, D. A., Stein, G. S., Stein, J. L., van Wijnen, A. J.,and Lian, J. B. (1997). Stage-specific expression of Dlx-5 during osteoblast differentiation: involvement in regulation of osteocalcin gene expression. Mol. Endocrinol. 11,1681-1694.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
505
Saatcioglu, F., Claret, F. X., and Karin, M. (1994). Negative transcriptional regulation by nuclear receptors. Semin. Cancer Biol. 6,347-359. Satokata, I., and Maas, R. (1994). Msxl deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nut. Genet. 6,348-356. Schaack, J., Ho, W. Y., Freimuth, P., and Shenk, T. (1990). Adenovirus terminal protein mediates both nuclear matrix association and efficient transcription of adenovirus DNA. Genes Dev. 4,1197-1208. Scheper, W., Visser, M., Bettencourt, B., Barone, L., Stein, J., Stein, G., and Lian, J. (1991). Site-directed mutagenesis of the osteocalcin gene and expression in CHO cells provides evidence for the vitamin-K carboxylase enzyme binding site. J . Bone Miner. Res. 6, S157 (abstr.). Schepmoes, G., Breen, E., Owen, T. A., Aronow, M. A., Stein, G. S., and Lian, J. B. (1991). Influence of dexamethasone on the vitamin D-mediated regulation of osteocalcin gene expression. J. Cell. Biochem. 47,184-196. Schrader, M., Bendik, I., Becker-Andre, M., and Carlberg, C. (1993). Interaction between retinoic acid and vitamin D signaling pathways. J. Biol. Chem. 268, 17830-17836. Schroen, D. J., Chen, J. D., Vincenti, M. P., and Brinckerhoff, C. E. (1997). The nuclear receptor corepressor SMRT inhibits interstitial collagenase (MMP-1) transcription through a n HRE-independent mechanism. Biochem. Biophys. Res. Commun. 237, 52-58. Schubart, U. K., Xu, J., Fan, W., Cheng, G., Goldstein, H.,Alpini, G., Shafritz, D. A.,Amat, J. A., Farooq, M., and Norton, W. T. (1992). Widespread differentiation stage-specific expression of the gene encoding phosphoprotein p19 (metablastin) in mammalian cells. Diferentiation (Berlin) 61,21-32. Schiile, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans, R. M. (1990). Jun-Fos and receptors for vitamins A and D recognize a common response element in the human osteocalcin gene. Cell (Cambridge, Mass.) 61,497-504. Shakoori, A. R., Owen, T. A., Shalhoub, V., Stein, J. L., Bustin, M., Stein, G. S., and Lian, J. B. (1993).DiffErential expression of thechromosomal high mobility group proteins 14 and 17 during the onset of differentiation in mammalian osteoblasts and promyelocytic leukemia cells. J. Cell. Biochem. 51,479-487. Shakoori, A. R., van Wijnen, A. J., Bortell, R., Owen, T.A., Stein, J . L., Lian, J. B., and Stein, G. S. (1994). Variations in vitamin D receptor transcription factor complexes associated with the osteocalcin gene vitamin D responsive element in osteoblasts and osteosarcoma cells. J. Cell. Biochem. 65,218-229. Shalhoub, V., Jackson, M. E., Lian, J. B., Stein, G. S., and Marks, S. C. J . (1991). Gene expression during skeletal development in three osteopetrotic rat mutations. Evidence for osteoblast abnormalities. J. Biol. Chem. 266,9847-9856. Shalhoub, V., Conlon, D., Tassinari, M., Quinn, C., Partridge, N., Stein, G. S., and Lian, J. B. (1992). Glucocorticoids promote development of the osteoblast phenotype by selectively modulating expression of cell growth and differentiation associated genes. J. Cell. Biochem. 50,425-440. Shalhoub, V., Bortell, R., Jackson, M. E., Marks, S. C. J., Stein, J. L., Lian, J. B., and Stein, G. S. (1994). Transcriptionally active nuclei isolated from intact bone reflect modified levels of gene expression in skeletal development and pathology. J. Cell. Biochem. 56,182-189. Shalhoub, V., Aslam, F., Breen, E., Bortell, R., Stein, G. S., Stein, J. L., and Lian, J. B. (1998). Multiple levels of steroid hormone-dependent control of osteocalcin during osteoblast differentiation: Glucocorticoid regulation of basal and vitamin D stimulated gene expression. J. Cell. Biochem. 69, 154-168.
506
JANE B.LIAN et al.
Shrivastava, A., and Calame, K. (1994).An analysis of genes regulated by the multi-functional transcriptional regulatory YinYang-1. Nucleic Acids Res. 22, 5151-5155. Siddhanti, S. R., and Quarles, L. D. (1994). Molecular to pharmacologic control of 0steoblast proliferation and differentiation. J. Cell. Biochem. 55,310-320. Sims, N. A., White, C. P., Sunn, K. L., Thomas, G. P., Drummond, M. L., Morrison, N.A., Eisman, J. A., and Gardiner, E. M. (1997). Human and murine osteocalcin gene expression: Conserved tissue restricted expression and divergent responses to 1,25-dihydroxyvitamin D3 in vivo. Mol. Endocrinol. 11,1695-1708. Sneddon, W. B., Bogado, C. E., Kiernan, M.S., and Demay, M. B. (1997). DNA sequences downstream from the vitamin D response element of the rat osteocalcin gene are required for ligand-dependent transactivation. Mol. Endocrinol. 11,210-217. Sone, T., Ozono, K., and Pike, J. W. (1991). A 55-kilodalton accessory factor facilitates vitamin D receptor DNA binding. Mol. Endocrinol. 5, 1578-1586. Speck, N. A., and Stacy, T. (1995). A new transcription factor family associated with human leukemias. Crit. Rev. Eukaryotic Gene Expression 5,337-364. Staal, A., Birkenhager, J. C., Pols, H. A., Buurman, C. J., Vink-van Wijngaarden, T., Kleinekoort, W. M., van der Bemd, G. J., and Van Leeuwen, J. P. (1994). Transforming growth factor beta-induced dissociation between vitamin D receptor level and 1,25-dihydroxyvitamin D3 action in osteoblast-like cells. Bone Miner. 26,27-42. Stein, G. S., and Lian, J. B. (1993). Molecular mechanisms mediating proliferatioddifferentiation interrelationships during progressive development of the osteoblast phenotype. Endocr. Rev. 14,424-442. Stein, G. S., and Lian, J. B. (1995). Molecular mechanisms mediating proliferation-differentiation interrelationships during progressive development of the osteoblast phenotype: Update 1995. Endocr. Rev. 4,290-297. Stein, G. S., Lian, J. B., and Owen, T. A. (1990). Relationship of cell growth to the regulation of tissue- specific gene expression during osteoblast differentiation. FASEB J. 4,3111-3123. Stein, G. S., Lian, J. B., Stein, J. L., van Wijnen, A. J., and Montecino, M. (1996). Transcriptional control of osteoblast growth and differentiation. Physiol. Rev. 76,593-629. Stein, G. S., van Wijnen, A. J., Stein, J. L., Lian, J. B., and Montecino, M. (1997). Interrelationships between nuclear structure and transcriptional control of cell cycle and tissue-specific genes. In “Genome Structure and Function” (Nicolini C, ed.), pp. 57-82. Kluwer Academic Publishers, The Netherlands. Stewart, M., Terry, A., Hu, M., O’Hara, M., Blyth, K., Baxter, E., Cameron, E., Onions, D. E., and Neil, J. C. (1997). Proviral insertions induce the expression of bone-specific isoforms of PEBPZalphaA (CBFA1): Evidence for a new myc collaborating oncogene. Proc. Natl. Acad. Sci. U.S.A. 94,8646-8651. Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E., and Artavanis-Tsakonas, S. (1992). Human homologs of aDrosophila enhancer of split gene product define a novel family of nuclear proteins. Nat. Genet. 2,119-127. [Published erratum appears in Nat. Genet. 1992,2(4), 343.1 Stromstedt, P. E., Poellinger, L., Gustafsson, J.A., and Cralstedt-Duke, J. (1991). The glucocorticoid receptor binds to a sequence overlapping the TATA box of the human 0steocalcin promoter: a potential mechanism for negative regulation. Mol. Cell. B i d 11,3379-3383. Suttie, J. W., (1993). Synthesis of vitamin K-dependent proteins. FASEB J . 7,445-452. Suwanwalaikorn, S., van Auken, M., Kang, M. I., Alex, S., Braverman, L. E., and Baran, D. T. (1997). Site selectivity of osteoblast gene expression response to thyroid hormone localized by in situ hybridization. Am. J. Physiol. 272, E212-E217.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
507
Szabo, E., Preis, L. H., Brown, P. H., and Birrer, M. J. (1991). The role ofjun and fos gene induced hemopoietic diffamily members in 12-0-tetradecanoylphorbol-13-acetate ferentiation. Cell Growth Differ. 2,475-482. Sztajnkrycer, M. D., Kronenberg, M. S., Rowe, D. W., and Pan, L. C. (1994). Regulation of mouse bone Gla protein genes by glucocorticoids and 1,25-dihydroxyvitamin D,. J. Bone Miner. Res. 9, S288 (abstr.). Szulc, P., Arlot, M., Chapuy, M. C., Duboeuf, F., Meunier, P. J., and Delmas, P. D. (1994). Serum undercarboxylated osteocalcin correlates with hip bone mineral density in elderly women. J. Bone Miner. Res. 9, 1591-1595. Tamura, M., and Noda, M. (1994). Identification of a DNA sequence involved in osteoblast-specific gene expression via interaction with helix-loop-helix (HLH)-type transcription factors. J. Cell Biol. 126, 773-782. Terpening, C. M., Haussler, C. A., Jurutka, P. W., Galligan, M. A., Komm, B. S., and Haussler, M. R. (1991). The vitamin D-responsive element in the rat bone Gla protein gene is a n imperfect direct repeat that cooperates with other cis-elements in 1,25-dihydroxyvitamin D3-mediated transcriptional activation. Mol. Endocrinol. 5,373-385. Theofan, G., Haberstroh, L. M., and Price, P.A. (1989). Molecular structure ofthe rat bone Gla protein gene and identification of putative regulatory elements. DNA 8, 213-221. Thiede, M. A., Smock, S. L., Petersen, D. N., Grasser, W. A., Thompson, D. D., and Nishimoto, S. K. (1994). Presence of messenger ribonucleic acid encoding osteocalcin, a marker of bone turnover, in bone marrow megakaryocytes and peripheral blood platelets. Endocrinology (Baltimore) 135,929-937. Thirunavukkarasu, K., Mahajan, M., McLarren, K. W., Stifani, S., and Karsenty, G. (1998). Two domains unique to osteoblast-specific transcription factor Osf2/Cbfal contribute to its transactivation function and its inability to heterodimerize with Cbfp. Mol. Cell Biol. 18,4197-4208. Thrailkill, K. M., Siddhanti, S. R., Fowlkes, J . L., and Quarles, L. D. (1995). Differentiation of MC3T3-El osteoblasts is associated with temporal changes in the expression of IGF-I and IGFBPs. Bone 17,307-313. Tomkinson, A., Reeve, J., Shaw, R. W., and Noble, B. S. (1997). The death of osteocytes via apoptosis accompanies estrogen withdrawal in human bone. J. Clin. Endocrinol. Metab. 82,3128-3135. Towers, T. J., Luisi, B. F., Asianov, A., and Freedman, L. P. (1993). DNA target selectivity by the vitamin D3 receptor: Mechanism of dimer binding to an asymmetric repeat element. Proc. Natl. Acad. Sci. U.S.A. 90,6310-6314. Towler, D. A., and Rodan, G. A. (1995). Identification of a rat osteocalcin promoter 3’,5’cyclic adenosine monophosphate response region containing two PuGGTCA steroid hormone receptor binding motifs. Endocrinology (Baltimore) 136, 1089- 1096. Towler, D. A., Benentt, C. D., and Rodan, G. A. (1994a). Activity of the rat osteocalcin basal promoter in osteoblastic cells is dependent upon homeodomain and CP1 binding motifs. Mol. Endocrinol. 8,614-624. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994b). Msx-2/Hox 8.1: A transcriptional regulator of the rat osteocalcin promoter. Mol. Endocrinol. 8,1484-1493. Truss, M., and Beato, M. (1993). Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14,459-479. Tsuji, K., Ito, Y., and Noda, M. (1998). Expression of the PEBPSaA/AMLB/CBFAl gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchyma1 cells. Bone 22, 87-92.
508
JANE B. LIAN et al.
Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991). Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell (Cambridge, Mass.) 66,1255-1266. Usheva, A., and Shenk, T. (1994). TATA-binding protein-independent initiation: YY1, TFIIB, and RNA polymerase I1 direct basal transcription on supercoiled template DNA. Cell (Cambridge, Mass.) 76,1115-1121. van den Ent, F. M., van Wijnen, A. J., Last, T. J., Bortell, R., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Concerted control of multiple histone promoter factors during cell density inhibition of proliferation in osteosarcoma cells: Reciprocal regulation of cell cycle-controlled and bone-related genes. Cancer Res. 53,2399-2409. van Eekelen, C. A., and van Venrooij, W. J. (1981). hnRNA and its attachment to a nuclear protein matrix. J. Cell Biol. 88, 554-563. Van Leeuwen, J. P., Birkenhager, J. C., Buurman, C. J., Schilte, J. P., and Pols, H. A. (1990). Functional involvement of calcium in the homologous up-regulation of the 1,25-dihydroxyvitamin D3 receptor in oseoblast-like cells. FEBS Lett. 270,165-167. van Wijnen, A. J.,Bidwell, J. P., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1993). Nuclear matrix association of multiple sequence-specific DNA binding activities related to SP-1, ATF, CCAAT, C/EBP, OCT-1, and AP-1. Biochemistry 32, 8397-8402. van Wijnen, A. J.,Merriman, H., Guo, B., Bidwell, J. €?, Stein, J. L., Lian, J. B., and Stein, G. S. (1994). Nuclear matrix interactions with the osteocalcin gene promoter: multiple binding sites for the runt-homology related protein NMP-2. J. Bone Miner. Res. 9, S148 (abstr.). Vaughn, J. P., Dijkwel, P.A., Mullenders, L. H., and Hamlin, J. L. (1990). Replication forks are associated with the nuclear matrix. Nucleic Acids Res. 18,1965-1969. Vukicevic, S., Luyten, F. P., Kleinman, H. K., and Reddi, A. H. (1990). Differentiation of canalicular cell processes in bone cells by basement membrane matrix components: Regulation by discrete domains of laminin. Cell (Cambridge, Mass.) 63,437-445. Wang, E. A., Israel, D. I., Kelly, S., and Luxenberg, D. P. (1993). Bone morphogenetic protein-2 causes commitment and differentiation in C3H10T1/2 and 3T3 cells. Growth Factors 9, 57-71, Wang, Z.-Q., Ovitt, C., Grigoriadis, A. E., Mohle-Steinlein, U., Ruther, U., and Wagner, E. F. (1992). Bone and haematopoietic defects in mice lacking c-fos. Nature (London) 360,741-745. Webber, D., Osdoby, P., Hauschka, P., and Krukowski, M. (1990). Correlation of an osteoclast antigen and ruffled border on giant cells formed in response to resorbable substrates. J. Bone Miner. Rex. 5,401-410. Weinreb, M., Shinar, D., and Rodan, G. A. (1990). Different pattern of alkaline phosphatase, osteopontin, and osteocalcin expression in developing rat bone visualized by an in situ hybridization. J. Bone Miner. Res. 5,831-842. Whitson, S. W., Harrison, W., Dunlap, M. K., Bowers, D. E., Jr., Fisher, L. W., Robey, P. G., and Termine, J. D. (1984). Fetal bovine cells synthesize bone-specific matrix proteins. J. Cell Biol. 99,607-614. Wiese, R. J., Uhland-Smith, A., Ross, T. K., Prahl, J. M., and DeLuca, H. F. (1992). Upregulation of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from ligand-induced stabilization. J. Biol. Chem. 267,20082-20086. Wong, M.-M., Rao, L. G., Ly, H., Hamilton, L., Tong, J., Sturtridge, W., McBroom, R., Aubin, J. E., and Murray, T. M. (1990). Long-term effects of physiologic concentrations of dexamethasone on human bone-derived cells. J. Bone Miner. Res. 5.803-813.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
509
Xing, Y.,Johnson, C. V., Dobner, P. R., and Lawrence, J. B. (1993). Higher level organization of individual gene transcription and splicing. Science 259, 1326-1330. Yoon, K., Buenaga, R., and Rodan, G. A. (1987). Tissue specificity and developmental expression of rat osteopontin. Biochem. Biophys. Res. Commun. 148,1129-1136. Yoon, K., Rutledge, S. J. C., Buenaga, R. F., and Rodan, G. A. (1988). Characterization of the rat osteocalcin gene: stimulation of promoter activity by 1,25-dihydroxyvitamin D,. Biochemistry 27,8521-8526. Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, 0. V., Naar, A. M., Kim, S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991). RXR beta: A coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell (Cambridge, Mass.) 67,1251-1266. Yu, X. P., and Chandrasekhar, S. (1997). Parathyroid hormone (PTH1-34) regulation of r a t osteocalcin gene transcription [see comments]. Endocrinology (Baltimore) 138, 3085-3092. Zeng, C., van Wijnen, A. J., Stein, J. L., Meyers, S., Sun, W., Shopland, L., Lawrence, J . B., Penman, S., Lian, J. B., Stein, G. S., and Hiebert, S. W., (1997). Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBFa transcription factors. Proc. Natl. Acad. Sci. U.S.A.94,6746-6751. Zeng, C., McNeil, S., Pockwinse, S., Nickerson, J. A., Shopland, L., Lawrence, J. B., Penman, s.,Hiebert, s. W., Lian, J. B., van Wijnen, A. J., Stein, J. L., and Stein, G. s. (1998). Intranuclear targeting of AML/CBFa regulatory factors to nuclear matrixassociated transcriptional domains. Proc. Natl. Acad. Sci. U.S.A.96, 1585-1589. Zernik, J.,Thiede, M. A., Twarog, K., Stover, M. L., Rodan, G. A., Upholt, W. B., and Rowe, D. W. (1990). Cloning and analysis of the 5‘ region of the rat bone/liver/kidney/placenta alkaline phosphatase gene. A dual-function promoter. Matrix 10,38-47. Zhang, Q., Wrana, J. L., and Sodek, J. (1992). Characterization of the promoter region of the porcine opn (osteopontin, secreted phosphoprotein 1)gene. Identification of positive and negative regulatory elements and a ‘silent’ second promoter. Eur. J. Biochem. 207,649-659. Zhang, R., Ducy, P., and Karsenty, G. (1997). 1,25-dihydroxyvitamin D3 inhibits osteocalcin expression in mouse through an indirect mechanism. J . Biol. Chem. 272, 110-116. Zhou, H., Choong, P., McCarthy, R., Chou, S. T., Martin, T. J., andNg, K. W. (1994). In situ hybridization to show sequential expression of osteoblast gene markers during bone formation in vivo. J. Bone Miner. Res. 9,1489-1499. Zierold, C., Darwish, H. M., and DeLuca, H. F.(1994). Identification of a vitamin D-response element in the rat calcidiol (25-hydroxyvitamin D3) 24-hydroxylase gene. Proc. Natl. Acad. Sci. U.S.A. 91,900-902.
This Page Intentionally Left Blank
Index
A Accessory proteins, modulating nuclear receptor binding to target DNA sequences, 169-178 facilitating steroid receptor-DNA binding, 171-172 HMG-1 and -2,172-176 inhibitors of receptor-DNA interactions, 176-178 retinoid X receptor, 169-171 ACTH, secretion, stress-induced, 426 Adrenal cortex, androgen action, 332-334 Adrenal tissue, steroidogenesis, 403 AF-2 activity, overexpression of coactivators and, 188 function, 181 AF-1 coactivators, 201-202 Age-dependent factor, 321-322 AML, transcription factors, overexpression, 484 Androgens, 2 19-27 4,309 -339 action adrenal cortex and testis, 332-334 mediation by peptide growth factors, 331-332 prostate, 334-337 enzymatic regulation, 326-331 enzymatic pathways, 330-331 inactivation by hydroxysteroid sulfotransferase, 329-330 5a-reductase and hydroxysteroid dehydrogenase, 326-329 apoptosis and, 141-142 dependence, adaptation of prostate tumor cells to independence, 267-270 differential function, 221-223 forms, 310 functions, 309 history, 220
mutation, androgen insensitivity syndrome, 244-246 oxidoreductive modification, 329 withdrawal, apoptosis and, 270-273 Androgen-induced genes, prostate, 259-265 c-myc gene, 263-265 Nkx3.1,265 peptide growth factors, 262-263 prostate-specific antigen, 259 -260 rat C3 gene of a-protein, 261 rat probasin gene, 260-261 spermine-binding protein, 261-262 Androgen insensitivity syndrome, 244-246 Androgen receptor activation, hormonal ligand role, 323-325 amino-terminal domain, 238-239,243, 312,314-315 associated proteins, 241-243 autoregulation, 254-256 binding sites a t target genes, 316 discovery, 220 DNA-binding domain, 312,315 domain interactions during activation, 237-239 encoding, 311- 312 expression adult prostate, 252 mesenchyme-epithelial interactions during prostate development and, 249-252 prostate cancer, 252-253 regulation, 253-256 function modulation by direct interaction with other nuclear receptors and regulatory factors, 318-320 in prostate cancer, 267-273 functional characterization, 227-228 511
512
INDEX
Androgen receptor (cont.) gene expression regulation, 310-313 negative regulation, 322 gene promoter, pur-pyr domain, 321-322 gene structure, 226-227,311-316 hepatic expression, 321-322 hinge region, 315-316 immunolocalization, 333 immunoreactive, cellular localization, 333 interactions between N- and C-terminal ends, 314 ligand-activated, 322 ligand-binding domain, 312 mRNA, 226-227,313 mutation, prostate cancer, 246-249 posttranscriptional effects, 266-267 preferential recognition sequence for, 316-317 promoter structure, 253-254 protein structure, 227-236,311-316 amino-terminal domain, 228-230 DNA-binding domain, 230-232 homopolymeric amino acid repeats, 229-230 phosphorylation, 235-236 steroid-binding domain, 232-235 stimulation of activity by growth factors and modulators of protein phosphorylation, 243-244 transactivation, 314 transformation, 236-237 zinc finger, 313,315 Androgen-receptor-associated protein 70, 187-190 Androgen receptor gene functional domains, 313 Androgen receptor-glucocorticoid receptor heterodimers, 319 Androgen-regulated genes, androgen response elements, 256-259 Androgen-repressed genes, prostate, 265-266 Androgen response elements, 256-259, 316 synergistic cooperation, 317-318 Antiandrogens, 239-241 high-affinity ligands, 325-326
Apoptosis, 452 androgens and, 141-142 androgen withdrawal and, 270-273 nuclear matrix molecular changes during, 149-150 Ap-1 sites, osteocalcin promoter, 469-472
B BAY K 8644,415 Bcl-2, expression, prostate tumors, 272-273 Benign prostatic hyperplasia, 335 Bombyx, prothoracicotropic hormone, 81-83 Bone Ca2+-sensingreceptor in, 29 mineralization, 446 remodeling, 447 resorption, 447-448 Bone marrow cells, Ca2+-sensingreceptor role in local ionic homeostasis, 52-53 Brain cells, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Breast cell carcinoma nuclear matrix, estrogen and, 142-143 Breast duct cells, Ca2+-sensingreceptor role in local ionic homeostatis, 53-54 Breast tissue, normal and malignant, 17p-hydroxysteroid dehydrogenase enzyme, 373-375 8-Bromo-cyclicadenosine-3',5'-monophosphate, effect on l7p-hydroxysteroid dehydrogenase, 364-365
C CAB1 gene, 427 Calcitonin, secretion regulation by Cap, 23-24 Calcium ion channel, prothoracicotropic hormone and, 84-85 Calcium ions, see Ca2+ Calreticulin, 336 nuclear receptor inhibition, 177 CAMP accumulation, high CaF-evoked inhibition, 18 prothoracicotropic hormone transductory cascade, 84-86
INDEX
CAMPresponse element binding protein, 242 CPB effect, 190-191 Cancer estrogen-dependent, 17P-hydroxysteroid dehydrogenase enzyme applications, 378-380 markers nuclear matrix proteins as, 147-149 Ca2+ fluxes between intra- and extracellular spaces, 44-48 intracellular buffers, 47-48 movements into and out of extracellular reservoirs, 48-49 reabsorption in kidney, 25-26 roles in intra- and extracellular processes, 2 steroidogenic acute regulatory protein expression regulation, 415-416 Ca2 elevated levels, 6,7-8 indirect evidence for sensing by cells, 8-9 microenvironments with varying levels, 42-49 alterations from movement of water without ions, 44 Ca2+fluxes between intra- and extracellular spaces, 44-48 Ca2+movement into and out of extracellular reservoirs, 48-49 changes and epithelial ionic transport, 43-44 environmental Ca2+contributing to CaFvariations, 42-43 other sensors, 14-17 spatial heterogeneity, 42 y-Carboxyglutamic acid residues, vitamin-K-dependent synthesis, 444-448 Ca2+-sensingreceptor, 1-56 in bone, 29 bovine parathyroid, isolation, 9-12 in C cells, 23-24 evidence for, 8-9 gene, 18-19 in intestine, 29-30 intracellular domain residues, 21 in kidney, 24-29
5 13
mutations familial hypocalciuric hypercalcemia, 31-37 forms of hypocalcemia due to activating mutations, 40-42 mou8e models, 39-40 neonatal severe hyperparathyroidism, 37-39 in parathyroid, 21-23 in placenta, 30-31 predicted topological structure, 10-11 regulation of expression, 19-20 renal, Ca2+-sensingreceptor, functional significance, 25-27 roles in local ionic homeostasis, 49-54 bone marrow cells, 52-53 brain cells, 49-51 breast duct cells, 53-54 lens epithelial cells, 51-52 signal transduction pathways, 17-18 structural similarity to other Gprotein-coupled receptors, 12-14 structure-function relationships, 20-21,36 therapeutics based on, 55 in tissues uninvolved in systematic 54-55 Ca:homeostasis, Ca2-sensing receptor, mineral ion homeostasis maintenance, 2-8 CbfaiAML sequences, 467-469 C cells, Ca2+-sensingreceptor in, 23-24 c-fos
antisense inhibition, 454 interaction with androgen receptor, 259 C3 gene, a-protein, 261 Cholesterol cleavage, rate-limiting step in steroidogenesis, 400-401 hydroxylated analogs, 401 transfer, putative model, 427-428 Chromatin remodeling, 145-146 structure and nucleosome organization, 128-129,478-479 hormone modifications, 132-133, 480-482 Chromosome, organization, 136-137 c-jun proteins, interaction with androgen receptor, 259
5 14
INDEX
Clusterin, 336 c-myc gene, 263-265 Coactivator complex, 203 Congenital lipoid adrenal hyperplasia, steroidogenic acute regulatory protein, 421-424 Core-binding factor a-AML, 455-457, 467-469 transcription factor representation, 485-486 Coregulatory proteins, 165-204 future questions, 200-204 mechanism of action, 203 modulation of steroid receptor activity, 204 see also Accessory proteins C-19 steroids, 310 Cyclic AMP response-element-bindingbinding protein, 145 Cyclin-dependent kinases, 336 Cycloheximide, steroidogenesis inhibition, 404 Cytochrome P450 aromatase, 363 expression in human cells of placental origin, 371 Cytochrome P450 side chain cleavage enzyme, 400
DAX-1 protein, 416-417 D17B2,360 Dehydroepiandrosterone, 310 DHR3, 105-107 5ct-Dihydrotestosterone, 220,326 production, 221 testosterone conversion to, 221-222 5P-Dihydrotestosterone, testosterone conversion to, 221-222 1,25-Dihydroxyvitamin D, levels and C a r , 4-6 D1~-5,455 DNA, polymerase chain reaction-amplified tumor, 247 DNA-binding domain, androgen receptor, 230-232 Drosoph ila development, ecdysteroid regulation, 93-95 model insects, 76-79
E75,105-106 Early puff genes, isoforms, tissue diversity, 108-109 Ecdysone effect on polytene chromosomes, 95-97 interactions with other developmental pathways, 112-113 response to, spatial and temporal diversity mechanisms, 107-112 receptor and early puff gene product isoforms, 108-109 Ecdysone receptor, 97-103 effects of mutations on developmental processes, 101-103 molecular biology, 97-101 Ecdysteroid, 75-76 action, 93-114 Drosophila development regulation, 93-95 ecdysone receptor, 97-103 effect on polytene chromosomes, 95-97 interactions with other developmental pathways, 112-113 responsive genes, 103-107 spatial and temporal diversity mechanisms, 107-112 diversity of response, 114 possible roles, 111-112 synthesis, rate-limiting, 90, 92 Ecdysteroid receptor isoforms, tissue diversity, 108-109 titer and response to ecdysone, 110-111 Ecdysteroid-responsive genes, 103-107 molecular characterization, 103- 104 mutations of “early puff genes disrupt ecdysteroid-responsive transcription, 104 puff genes encoding nuclear receptors, 105-107 EcREs, diversity of response, 109-110 Embryogenesis, sexual differentiation, 310-311 Endometrial tissue, 17P-hydroxysteroid dehydrogenase enzyme in, 375-376 Enteric nervous system, Ca2+-sensingreceptor in, 54-55
515
INDEX
Enzymatic pathways, androgen modification, 330-331 Epidermal growth factor, androgens activity and, 243 Epithelial ionic transport, alterations and Caychanges, 43-44 Epithelium, androgen-dependent morphogenesis, 250 ER-associated protein 140, 187-190 17P-Estradio1, testosterone conversion to, 222 Estrogen breast cell carcinoma nuclear matrix and, 142-143 effect on 17P-hydroxysteroid dehydrogenase type 1 enzyme expression regulation, 364 function, 354 regulation of nuclear matrix intermediate filaments, 143-144 role in “gene memory“, 146-147 steroidogenic acute regulatory protein regulation, 415 Estrogen receptor binding of antagonists, 195 chromatin-matrix-associated high-mobility group proteins, 133-134 Estrogen response elements, accessory proteins, 171 Extracellular matrix, 444
F Familial hypocalciuric hypercalcemia, 31-37 gene, 32-33 impact of mutations on Ca2+-sensing receptor, 33-35 mouse models, 39-40 Fat body protein-1 gene promoter, 110 Feminization, 245 Feto-placental unit, 17P-hydroxysteroid dehydrogenase enzyme expression and action, 367-371 Finasteride, 328 as 5a-reductase inhibitor, 225 “Flutamide withdrawal syndrome”, 248-249 Follicle stimulating hormone, effect on
17P-hydroxysteroid dehydrogenase, 364-365 FTZF1.105-107
G Gastric antral gastrin-secreting cells, Ca2+-sensingreceptor in, 54 “Gene memory”, estrogen and nuclear matrix role, 146-147 Gene transcription glucocorticoid receptor action, chromatin-matrix protein role, 134-135 mechanism of steroid action on, 131-132 steroid-mediated, nuclear matrix contribution, 133-136 vitamin D action, matrix protein role, 135-136 Glia, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Glucocorticoid receptor action on gene transcription, chromatin-matrix protein role, 134-135 steroid-binding domain, 234,238 Glucocorticoid regulatory element, osteocalcin gene, 472-473 G-protein-coupled receptors, structural similarity of Ca2+-sensing receptor, 12-14 Growth factors, stimulation of androgen receptor activity, 243-244
H Heart, Ca$levels, 46 Heat-shock protein 27, levels and breast cell carcinoma, 142 Heat-shock protein 70,89 in luteal cells, 411 Heat-shock protein 90,237 hHSDl?B1,357 gene expression regulation, 381-384 hHSDl7Bl enhancer, structure and function, 382-383 hHSDl7B1 promoter, structure and function, 381-382 hHSDl7Bl silencer, structure and function, 383-384
5 16
INDEX
High-affinity ligands antiandrogenic action, 325-326 Histone, hyper acetylation, 482 Histone acetyltransferase, activity, 197-198,320 HMG-1 and -2,134 as coregulators of steroid class of nuclear receptors, 172-176 Hormonal ligands, role in androgen receptor activation, 323-325 Hormone response elements, binding to, 316 hRPF1,189-190 Human response elements androgen receptor subgroup, 258 nuclear matrix attachment regions, interactions during transgene expression, 146 20-Hydroxyecdysone, 75 prohormone precursor, 75,77 Hydroxysteroid dehydrogenase activation and inactivation of androgenic steroids, 326-329 deficiency, 328 17P-Hydroxysteroid dehydrogenases, 353-385 catalysis of interconversions, 354 enzymatic properties and tissue distributions, 358 estrogen-induced proliferation, 373-3745 expression, 356-357 during pregnancy, 367-373 gene, 357,359-360 mRNA, 357,359-360 physiological role and expression in peripheral tissues, 373-378 endometrial tissue, 375-376 normal and malignant breast tissue, 373-375 other tissues, 376-378 primary structures, 355 substrate and cofactor specificities, 355-356 type 1enzyme, 357,359 applications to prevention and treatment of estrogen-dependent cancers, 378-380 estrogen-specificity, 361 ovarian E2 production and, 360-367
regulation of expression, 363-367 role, 360-363 regulation of expression during follicular development, 361, 363 in ovaries, 363-367 by pituitary gonadotropins, steroid hormones, and growth factors, 366 type 2 enzyme, 359-360 expression pattern, 369-371 Hydroxysteroid sulfotransferase, androgen inactivation, 329-330 Hypercalcemia familial hypocalciuric, 31-37 neonatal severe hyperparathyroidism, 37-40 reduced renal handling of water, 26-29 Hyperparathyroidism, Ca: sensitivity and, 14-15 Hyperthyroidism, neonatal severe, 37-40 Hypocalcemia, due to activating Ca2+sensing receptor mutations, 40-42
I Insect development, mechanisms and models, 73-114 ecdysteroids, 75-77 2O-hydroxyecdysone,75 juvenile hormone, 75 prothoracic gland and, 92-93 model insects for studies, 76-79 polytene chromosomes, ecdysone effect, 95-97 see also Ecdysteroid; Prothoracicotropic hormone molting and metamorphosis, 73-75 Insulin-like growth factor-I androgens activity and, 243 steroidogenesis, 408 Interferon, induction of nuclear matrix proteins, 144-145 Intermediate filament, nuclear matrix, estrogen regulation, 143-144 Intermolt genes, 110 Intestine, Ca2+-sensingreceptor in, 29-30
INDEX
Intracellular cholesterol trafficking, 400-401 J
Juvenile hormone, 75 prothoracic gland and, 92-93
Keratinocyte growth factor, 331 during prostate development, 251 Keratinocytes, Ca2+-sensingreceptor in, 54 Kidney, Ca2+-sensingreceptor in, 24-29 Knockout mouse, steroidogenic acute regulatory protein, 424-425
L Lens epithelial cells, Ca2+roles in local ionic homeostasis, 51-52 y-Linolenic acid, 328 as 5a-reductase inhibitor, 225-226 Liver, 17s-hydroxysteroid dehydrogenase type 2 expression, 376,378
Magnesium ions, reabsorption in kidney, 25-26 Manduca ecdysteroid peaks, 94 model insects, 76-79 Matrix metalloproteinase genes, 318-319 Mesenchyme-epithelial interactions, during prostate development, 249-252 Mineral ions, homeostasis, maintenance and Cay-sensing, 2-8 MLN64, steroidogenic properties, 426-427 mOCX-OG3 gene, 459 Mouse mammary tumor virus, LTR as model target, 324 Mouse mammary tumor virus gene, 199 Mouse mammary tumor virus promoter, 317 Mouse models familial hypocalciuric hypercalcemia, 31-37
517
neonatal severe hyperparathyroidism, 37-40 mRNA androgen receptor, 226-227,255-256, 313 steroidogenic acute regulatory protein, 409-411 analysis, 413 MSX-1 and MSX-2 proteins, 465-466 Msx-1 and Msx-2,453-454
NCOR, 200 Neonatal severe hyperparathyroidism, 37-39 mouse models, 39-40 Nervous system, enteric, Ca2+-sensingreceptor in, 54-55 Neurons, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Nicotinamide adenine dinucleotide, see 17P-Hydroxysteroid dehydrogenases Nkx3.1 gene, 265 Nuclear architecture, osteocalcin, parameters and transcriptional control, 477-480 Nuclear matrix, 127-150 attachment region, human response elements, interactions during transgene expression, 146 chromatin structure, 128-129 composition, steroid-hormone-induced effects, 131-133 contributions to steroid-mediated gene transcription, 133-136 definition and structure, 129-130 maintenance by steroid hormones, 141-145 androgens and apoptosis, 141-142 estrogen and breast cell carcinoma, 142-143 estrogen regulation of intermediate filaments, 143-144 interferon induction of specific proteins, 144-145 molecular changes during apoptosis, 149-150 osteocalcin gene expression and, 482-487
518
INDEX
Nuclear matrix (cont. ) proteins, 129-131 as cancer markers, 147-149 role in vitamin D action on gene transcription, 135-136 role, 131 in “gene memory”, 146-147 in steroid hormone signaling and nuclear binding, 136-141 laboratory studies, 136-138 novel acceptor sites for progesterone receptor, 139-141 potential role of matrix channels, 136 Nuclear receptor androgen receptor function modulation, 318-320 coactivators association with, DNA effect, 202 corepressor interactions, perturbation by steroid antagonists, 194-197 prediction, 178-179 DNA interaction, inhibitors, 176-178 interaction with nuclear proteins, 319 nonsteroid and orphan, retinoid X receptor as coregulator, 169-171 puff genes encoding, 105-107 steroid class, HMG-1/2 as coregulators, 172-176 transcriptional coactivators, 178-200 mechanism of action, 197-200 ~160,179-187 p300-CBP cointegrators, 190-194 perturbation of receptor coactivatorcorepressor interactions by steroid antagonists, 194-197 Nuclear receptor superfamily, 309-310 classification, 169 domain structure, 166-167 functional significance of segmented domain structure, 313-314 structure and function, 166-169
0 OC box I, 465-467 Osteoblast CaFeffects, 16-17
Ca:-sensing, 48-49 developmental sequence, 449- 450 differentiation Cbfa 1 as determinant, 468 osteocalcin regulated expression, 448-458 gene expression, 449-453 parallels hormonal and growth factor modifications, 457-458 transcription control mediators, 453-457 proliferating, AP-1 activity, 470 Osteocalcin, 443-488 affinity for hydroxyapatite, 446 amino acid sequence, 444-445 bone content, 445 calcium-binding properties, 446 developmental expression, 453-457 nuclear architecture parameters and transcriptional control, 477-480 regulated expression during osteoblast differentiation, 448-458 osteoblast growth and differentiation, 449-453 parallels hormonal and growth factor modifications of osteoblast differentiation, 457-458 transcription control mediators, 454-457 silencer domain, 461 tissue-specific expression, 464-465 Osteocalcin gene, 458-460 activation, 466 chromatin structure and nucleosome organization, hormone modifications, 480-482 expression, nuclear matrix and, 482-487 glucocorticoid regulatory element, 472-473 steroid hormone response elements, 472 transforming growth factor p, 471 vitamin D response elements, 474-476 Osteocalcin promoter AP-1 sites, 469-472 elements contributing to steroid responsiveness, 472-477 elements mediating developmental and tissue-specific regulation, 465-469
INDEX
CbfaIAML sequences, 467-469 OC box I, 465-467 organization, 460-465 regulation of osteocalcin transcription, 464 regulatory elements, 461 three-dimensional organization, 483 Osteoclast, CaF-sensing by, 15-16 Osteoprogenitors, 457 Osteosarcoma cells, 464 Ovarian E2 production, 17p-hydroxysteroid dehydrogenase type 1enzyme role, 360-363 Ovary, 17s-hydroxysteroid dehydrogenase type 1enzyme expression regulation, 363-367
P Parathyroid, Ca2+-sensingreceptor distribution and functions, 21-23 Parathyroid gene, expression and Ca2+sensing receptor, 22-23 Parathyroid hormone, levels and C,a: 4-5 p300 CBP-associated factor, 198 p300-CBP cointegrators, 190-194 functional roles, 193 p160 coactivators, 179-187,201 conserved LXXLL motifs, 184-185 mechanism, 187 multiple nuclear receptor interaction sites, 186 nuclear receptor interaction sites, 184 SRC-1 binding, 181 structural and functional domains, 181-183 transcriptional activation domains, 185-186 Peptide growth factors, 262-263 androgen action mediation, 331-332 Periplasmic binding proteins, bacterial, 13-14 Phorbol 12-myristate 13-acetate, androgens activity and, 243-244 Phosphoprotein, nuclear receptor as, 168 Phosphoprotein p34,86 Phosphorylation androgen receptor, 235-236 modulators, stimulation of androgen receptor activity, 243-244
519
steroidogenic acute regulatory protein, 420-421 Placenta, Ca2+-sensingreceptor in, 30-31 Platelets, peripheral blood, Ca2+-sensing receptor role in local ionic homeostasis, 52-53 Polytene chromosomes, ecdysone effect, 95-97 Posttranscriptional effects, androgen receptor, 266-267 Probasin, 335-336 Probasin gene, 260-261 Progesterone, synthesis, 410 Progesterone receptor binding of antagonists, 195 chromatin-matrix-associated high-mobility group proteins, 133-134 high-affinity binding, HMG-1 as accessory factor, 173-175 novel nuclear matrix acceptor sites, 139-141 Promyelocytic leukemia protein-nuclear bodies, 145 Prostate androgen action, 334-337 androgen-induced genes, 259-265 androgen receptor expression, 252 androgen-repressed genes, 265-266 development, androgen receptor expression and mesenchyme-epithelial interactions, 249-252 hyperplasia, 335 nuclear matrix, 141-142 Prostate cancer, androgen receptor expression, 252-253 function, 267-273 adaptation from androgen dependence to independence, 267-270 androgen withdrawal and apoptosis, 270-273 mutation, 246-249 Prostate-specific antigen, 259-260 induction by androgen in androgen-independent cells, 269 Protein androgen receptor-associated, 241-243 high-mobility group, 172 role in estrogen and progesterone receptor action, 133-134
INDEX
Protein (cont.1 nuclear matrix, 129-131 as cancer markers, 147-149 interferon induction, 144-145 role in vitamin D action on gene transcription, 135-136 synthesis, P'Il'H-stimulated, 88-92 see also Coregulatory proteins a-Protein, C3 gene, 261 Protein B23, 142 Protein kinase A androgens activity and, 243-244 prothoracicotropic hormone transductory cascade, 84-86 Protein kinase C androgens activity and, 243-244 effects on Ca2+-sensingreceptor, 20-21 Protein kinase CK2, 142 Protein PC-1, 148 Prothoracic glands, prothoracicotropic hormone stimulated, 85-87 Prothoracicotropic hormone, 75,79-92 amino acid sequence, 80 Bombyx, 81-83 characteristics and comparisons, 80, 82-83 protein synthesis stimulation, 88-92 purification, 79 structure, 79-84 transductory cascade, 84-88 CAMPand protein kinase A,84-86 ribosomal protein S6,86-88 Proximal tubule, Ca2+-sensingreceptor localization, 25 Pseudohermaphroditism, 328 Puff genes, early and late, 103 Puffs, intermolt, repression, 104 Puromycin, effect on corticoid synthesis, 403
Rat C3 gene of a-protein, 261 probasin gene, 260-261 Receptor-binding factor, 137-141 Receptor-interacting protein 140, 187-190 5a-Reductase
activation and inactivation of androgenic steroids, 326-329 deficiency, mutations in type 2 gene, 224 isoforms, 327 structure, expression, and function, 223-224 tissue expression, 338 5a-Reductase inhibitors, 224-226,328 Regulatory factors, androgen receptor function modulation, 318-320 Retinoic acid, in human cells of placental origin, 372-373 Retinoic acid receptor-vitamin D receptor heterodimer, 474-475 Retinoid X receptor as coregulator of nonsteroid and orphan nuclear receptors, 169-171 in human cells of placental origin, 372 Ribosomal protein S6,prothoracicotropic hormone transductory cascade, 84-86 Runt homology domain protein-binding sites, 467-469
S SDR protein family, 379 Serine residue, effect on 17P-hydroxysteroid dehydrogenase enzyme, 379-380 Sertoli cells, regulation of androgen action, 334 SF-1, steroidogenic acute regulatory protein regulation, 414 Signaling pathways, convergence, osteocalcin promoter, 469-472 Signal signaling, nuclear matrix channel role, 136 Signal transduction pathways, Ca2+-sensing receptor, 17-18 Small intestine, 17P-hydroxysteroid dehydrogenase type 2 expression, 376-377 SMRT, 200 Spermine-binding protein, 261-262 SRC-1 as coactivator, 180 coexpression, 179-180 C terminus, 181
52 1
INDEX
interactions, 319-320 Steroid antagonists mixed, 195-196 perturbation of receptor coactivator-corepressor, 194-197 Steroid-binding domain, androgen receptor, 232-235 Steroid hormone receptors, common structural feature, 312 Steroid hormones common characteristics, 400 function, 165 Steroidogenesis acute regulation, 402-404 in adrenal tissue, 403 cycloheximide-sensitive step, 403-404 rate-limiting step, 400-401 Steroidogenic acute regulatory protein, 399-430 amino acid sequences, 417-418 characteristics, 417-420 congenital lipoid adrenal hyperplasia, 42 1- 424 consensus PKA sites, 421 correlations with steroid biosynthesis, 408-412 steroidogenesis, 404, 406-408 steroidogenic acute regulatory protein, 404,406-408 expression, 410-413 regulation, 414-416 gene, 413-414 negative regulation, 416-417 regulation, 409 import, cholesterol transport and, 426-428 knockout mouse, 424-425 mRNA, 409-411 analysis, 413 phosphorylation, 420-421 putative mechanism of action, 425-429 putative Spl consensus sequences, 414 steroidogenically active form, 419 Steroidogenic cells, effect of tropic hormone stimulation, 404-405 Steroid receptor activity, modulation by coregulatory proteins, 204
binding to nuclear matrix, laboratory studies, 136-138 Steroid receptor coactivator 1(SRC-11,242 Steroid receptor-DNA binding, nuclear proteins that facilitate, 171-172 Steroid receptor supergene family, effects on chromatin structure and matrix composition, 131 Steroid responsiveness, osteocalcin promoter elements contributing to, 472-477 Steroids biosynthesis, correlations with, steroidogenic acute regulatory protein, 408-412 hormonally inert, functional androgen synthesis from, 330-331 Stromal-epithelial interactions, 25 1-252 Synaptic cleft, Ca2+influx, 45-46
T TATA domain, crosstalk with vitamin D response element, 484 Testis, androgen action, 332-334 Testosterone, 310 conversion, 221-222 Testosterone glucuronide, formation, 330 Tetrapods, C a y constancy, 2-3 Therapeutics, Ca2+-sensingreceptorbased, 55 Thyroid hormone receptor associated proteins, 319 Thyroid-receptor-interacting protein 1, 187-190 Tobacco hornworm, as model insect, 77-78 Transcription, ecdysteroid-responsive, early puff gene mutations and, 104 Transcriptional intermediary factor 1, 187-190 Transcription factors, cis-elements, 317 Transductory cascade, 84-88 CAMPand protein kinase A, 84-86 ribosomal protein S6, 86-88 Transformation, androgen receptor, 236-237 Transforming growth factor p, 332 effect on 17P-hydroxysteroid dehydrogenase, 365 temporal pattern, 451
522
INDEX
Transgene expression, potential human response elements-matrix attachment region interactions, 146 Trichostatin A, 199 Tubular reabsorption, direct effect of Cap, 6 p Tubulin, 89 Tyrosine residue, role in catalysis of SDR family, 379
Vitamin D receptor, osteocalcin, 474-476 Vitamin D response element crosstalk with TATA domain, 484 osteocalcin gene, 474-476 osteocalcin promoter, 469-470 Vitamin K, y-carboxyglutamic acid residue synthesis, dependence on, 444-448 Vitellogenins, 146- 147
U
W
Urinary tract, 17s-hydroxysteroid dehydrogenase type 2 expression, 377-378 Urogenital sinus mesenchyme, 250 usp genes, 100-101 mutant, 102-103
V Vitamin D, gene transcription action on gene transcription, matrix protein role, 135-136
Water, movement without ions, C a y alterations, 44
X Xenopus laevis oocytes, expression cloning, Ca2+-sensingreceptor, 9-12
“Zinc finger,” 230-231
This Page Intentionally Left Blank
I S B N 0-12-707855-0