The evolutionary biology of the Bivalvia

The Evolutionary Biology of the Bivalvia

Geological Society Specia l Publication s Series Editors A. J . HARTLEY R. E . HOLDSWORT H

A. C . MORTO N M. S.STOKE R

Special Publicatio n reviewin g procedure s The Society makes every effor t t o ensure that the scientifi c and production qualit y of its book s matches tha t o f it s journals. Sinc e 1997 , al l boo k proposal s hav e bee n referee d b y specialis t reviewers a s wel l a s b y th e Society' s Publication s Committee . I f th e referee s identif y weaknesses i n the proposal, thes e mus t be addressed befor e th e proposal i s accepted . Once the book is accepted, the Society has a team of series editor s (liste d above) who ensure that the volume editors follo w strict guidelines on refereeing an d quality control. We insist that individual paper s ca n onl y be accepte d afte r satisfactor y review b y tw o independen t referees . The question s on th e revie w form s ar e simila r to thos e fo r Journal o f th e Geological Society. The referees' form s an d comments must be available to the Society's serie s editor s o n request. Although man y of th e book s resul t fro m meetings , th e editor s ar e expecte d t o commissio n papers tha t wer e no t presente d a t th e meetin g t o ensur e tha t th e boo k provide s a balance d coverage o f th e subject . Bein g accepte d fo r presentatio n a t th e meetin g doe s no t guarante e inclusion i n the book . Geological Societ y Specia l Publication s are include d in th e IS I Scienc e Citatio n Index , bu t they do not have an impact factor, the latter being applicabl e onl y to journals. More informatio n about submittin g a proposal an d producin g a Specia l Publicatio n ca n b e found o n the Society's we b site: www.geolsoc.org.uk.

GEOLOGICAL SO

ETY SPECIA L PUBLICATIO N NO . 17 7

The Evolutionary Biolog y o f the Bivalvi a

EDITED BY

E. M. HARPE R Cambridge University, UK

J. D. TAYLOR

The Natural History Museum, UK

& J. A. CRAM E

British Antarctic Survey, UK

2000

Published b y The Geological Society London

THE GEOLOGICA L SOCIET Y The Geological Societ y o f London wa s founded i n 180 7 an d is the oldest geologica l societ y i n the world. I t receive d its Royal Charter i n 182 5 for the purpose o f 'investigatin g the mineral structur e of the Earth' an d is now Britain' s national society for geology . Both a learned societ y an d a professional body, the Geological Societ y i s recognized b y the Department o f Trade and Industry (DTI) a s the chartering authorit y for geoscience, abl e to award Chartered Geologis t statu s upon appropriately qualifie d Fellows. Th e Society ha s a membership o f 9099, of whom about 150 0 liv e outside th e UK. Fellowship o f the Society i s open to persons holdin g a recognized honour s degree i n geology o r a cognate subject , or not less tha n six years' relevan t experience i n geology o r a cognate subject . A Fellow wit h a minimum of fiv e years' relevan t postgraduate experienc e i n the practice o f geology ma y apply for chartered status . Successful applicants are entitled to use the designatory postnominal CGeo l (Chartered Geologist) . Fellow s o f the Society may use the letters FGS . Othe r grades o f membership ar e available t o members no t yet qualifying fo r Fellowship . The Society ha s its own Publishing House based i n Bath, UK. It produces the Society's internationa l journals, books an d maps, and is the European distributo r for publications of the American Associatio n o f Petroleu m Geologists (AAPG) , the Society fo r Sedimentary Geolog y (SEPM ) an d the Geological Societ y o f America (GSA) . Members o f the Society ca n buy books a t considerable discounts . The Publishing House has a n online booksho p (http://bookshop.geolsoc.org.uk). Further information on Society membershi p may be obtained fro m th e Membership Service s Manager , Th e Geological Society , Burlingto n House, Piccadilly , London W1V OJU (E-mail: enquiries@ geolsoc.org.uk : Tel: +44 (0) 207 434 9944) . The Society's We b Site can be found a t http://www.geolsoc.org.uk/The Society i s a Registered Charity , number 210161. Published by The Geological Societ y from : The Geological Societ y Publishin g House Unit 7, Brassmill Enterprise Centr e Brassmill Lan e Bath BA1 3JN , UK (Orders: Tel . +44 (0)1225 44504 6 Fax+44 (0)1225 442836 ) Online bookshop: http://bookshop.geolsoc.org.u k The publishers mak e no representation, express o r implied, with regard t o the accuracy of the informatio n contained in this book and cannot accept any lega l responsibility fo r any errors o r omissions tha t may b e made. © The Geological Societ y o f London 2000. All right s reserved. No reproduction, cop y or transmission of this publication ma y be made without written permission. N o paragraph o f this publication may be reproduced, copie d or transmitted sav e with the provisions o f the Copyrigh t Licensing Agency, 90 Tottenham Court Road, Londo n W1P 9HE. User s registere d wit h the Copyright Clearance Center, 2 7 Congress Street , Salem , MA 01970, USA: the item-fee cod e for this publication is 0305-8719/00/$15.00. British Library Cataloguing in Publication Data A catalogue record fo r this book is available fro m th e British Library . ISBN 1-86239-076- 2 ISSN 0305-8719

Typeset b y E & M Graphics, Bath , UK Printed by Alden Press, Oxford , UK.

Distributors USA AAPG Bookstor e PO Box 979 Tulsa OK 74101-0979 USA Orders: Tel. + 1 918 584-255 5 Fax+1 918560-2652 E-mail bookstore@ aapg.org Australia Australian Mineral Foundation Booksho p 63 Conyngham Stree t Glenside South Australia 506 5 Australia Orders: Tel . +61 8 8 379-044 4 Fax+6188 379-463 4 E-mail bookshop@ amf.com.au India Affiliated East-Wes t Press PV T Ltd G-l/16 Ansari Road , Daryaganj , New Delhi 11000 2 India Orders: Tel . +91 1 1 327-9113 Fax+91 1 1 326-0538 E-mail affiliat @ nda. vsnl. net, in Japan Kanda Book Tradin g Co . Cityhouse Tama 20 4 Tsurumaki 1-3-1 0 Tama-shi Tokyo 206-003 4 Japan Orders: Tel. +81 (0)423 57-7650 Fax+81 (0)42357-7651

Contents Preface vi

i

HARPER, E. M, TAYLOR, J. D. & CRAME, J . A. Unravelling the evolutionary biology of th e Bivalvia: a multidisciplinary approach 1 STEINER, G . A. & HAMMER, S . Molecular phylogeny of the Bivalvia inferre d from 18 S rDNA sequences wit h particular reference to the Pteriomorphia 1

1

CAMPBELL, D . C. Molecular evidence on the evolution of the Bivalvia 3

1

CARTER, J. G., CAMPBELL , D. C . & CAMPBELL, M. R . Cladistic perspectives on early bivalve evolution 4

7

COPE, J. C. W. A new look a t early bivalve phylogeny 8

1

SKELTON, P. W. & SMITH , A . B. A preliminary phylogeny for rudist bivalves: siftin g clade s from grade s 9

7

HARPER, E. M., HIDE, E. A. & MORTON, B . Relationships between the extant Anomalodesmata: a cladistic test 12

9

LYDEARD, C., MINTON , R . L. & WILLIAMS, J . D. Prodigious polyphyl y in imperilled freshwater pearly-mussels (Bivalvia: Unionidae): a phylogenetic tes t of species and generic designation s 14

5

BOGAN, A . E. & HOEH, W . R. On becoming cemented: evolutionary relationships amon g th e genera in the freshwater bivalv e family Etheriida e (Bivalvia: Unionidae) 15

9

HEALY, J. M., KEYS, J. L. & DADDOW, L . Y. M. Comparative sper m ultrastructure i n pteriomorphian bivalves with special referenc e t o phylogenetic an d taxonomic implication s 16

9

KEYS, J . L. & HEALY, J . M. Relevance o f sperm ultrastructure t o the classification o f giant clam s (Mollusca, Cardioidea, Cardiidae , Tridacnidae) 19

1

TAYLOR, J. D. & GLOVER , E . A. Functional anatomy, chemosymbiosis and evolution of th e Lucinidae 20

7

KELLY, S . R. A., BLANC , E. , PRICE , S . P. & WHITHAM, A . G . Early Cretaceous gian t bivalve s from seep-relate d limestone mounds , Wollaston Forland, Northeas t Greenland 22

7

MORTON, B . The function o f pallial eyes within the Pectinidae, wit h a new description o f those present in Patinopecten yessoensis 24

7

LOPES, S. G. B . C. , DOMANESCHI , O. , MORAES , D . T . DE, MORITA, M . & MESERANI , G . D E L. C . Functional anatom y of the digestive syste m of Neoteredo reynei (Bartsch , 1920 ) an d Psiloteredo healdi (Bartsch, 1931 ) (Bivalvia: Teredinidone) 25

7

BENINGER, P. G. & DUFOUR, S . C. Evolutionary trajectories of a redundant feature: lessons fro m bivalve gill abfronta l cili a an d mucocyte distributions 27

3

THOMAS, R . D . K. , MADZAMUSE , A., MANNI, P. K. & WATHEN , A. J . Growth patterns of noetiid ligaments: implication s o f developmental model s fo r the origin o f an evolutionary novelt y amon g arcoid bivalves 27

9

YANCEY, T. E. & HEANEY, III, M . J. Carboniferous praecardioid bivalve s fro m th e exceptiona l Buckhorn Asphalt biota of south-central Oklahoma, USA 29

1

VI CONTENT

S

MALCHUS, N. Evolutionary significanc e o f fossil larval shel l characters: a case stud y from th e Ostreiodea (Bivalvia : Pteriomorphia ) 30

3

SAVAZZI, E. Morphodynamics of Bryopa an d the evolution of the clavagellids 31

3

BYRNE, M. Calcium concretions i n the interstitial tissue s of the Australian freshwater musse l Hyridella depressa (Hyriidae ) 32

9

ROGALLA, N. S . & AMLER, M. R. W. Teranota an d its implications o n anomalodesmatan phylogen y 33 9 CRAME, J. A. The nature and origin of taxonomic diversity gradients in marine bivalves 34

7

JABLONSKI, D., ROY , K . & VALENTINE , J. W. Dissecting the latitudina l diversity gradient i n marine bivalves 36

1

MIKKELSEN, P. M. & BIELER , R . Marine bivalves of the Florid a Keys : discovered biodiversity 36

7

DAGUIN, C . & BORSA , P . Genetic relationships of Mytilus galloprovincialis Lamarc k populations worldwide: evidence from nuclear-DN A markers 38

9

CRAMPTON, J. S. & MAXWELL, P. A. Size: al l it's shaped up to be? Evolution of shape through the lifespan o f the Cenozoic bivalve Spissatella (Crassatellidae ) 39

9

JOHNSON, A. L . A., HICKSON , J. A., SWAN , J., BROWN , M. R. , HEATON , T. H. E., CHENERY , S. & BALSON, P. S. The Queen Scallop Aequipecten opercularis: a new sourc e of information on th e late Cenozoic marin e environments in Europe 45

2

PECK, L. S . & CONWAY, L. Z. The myth of metabolic col d adaptation : oxyge n consumptio n i n stenothermal Antarcti c bivalves 44

1

EDELAAR, P . Phenotypic plasticit y o f burrowing depth i n the bivalve Macoma balthica: experimental evidenc e an d general implication s 45

1

CADEE, G. C. Herring gull s feeding on a recent invader in the Wadden Sea, Ensis directus 45

9

SEED, R., RICHARDSON , C . A. & SMITH , K. Marine mussels , their evolutionary success , ecological significanc e an d use as chronometers o f environmental change 46

5

Index 47

9

It is recommended tha t reference to all or part of this book shoul d be made in one of the following ways: HARPER, E. M., TAYLOR , J. D . & CRAME , J. A . (eds ) 2000. Th e Evolutionary Biology o f th e Bivalvia. Geologica l Society , London, Special Publications , 177 . MORTON, B. 2000. Th e functio n o f pallial eyes withi n the Pectinidae, wit h a new descriptio n of thos e present i n Patinopecte n yessoensi s In : HARPER , E. M., TAYLOR , J. D. & CRAME , J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geologica l Society, London , Specia l Publications, 177 , 247-257 .

Preface Bivalves are key components o f Recent marine and freshwater ecosystems , an d have been s o for mos t of th e Phanerozoic . Bivalve s hav e undergon e a n almost relentles s increas e i n diversit y an d hav e exploited a number of varied life habits. Many have abandoned th e primitive burrowin g habit t o attac h to surface s b y flexibl e byssa l threads , o r rigi d attachment b y cementation , o r t o bor e int o rock , shells an d wood, or simply t o rest o n the sedimen t surface. Others swim, at least if danger threatens. In the deep oceans the septibranchs are predatory. The shells o f bivalves - throug h thei r shape , arrange ment o f muscl e scars , hinges , ligaments , growt h lines, microstructur e and chemistry - revea l mor e information abou t the life habits of the animal than for an y other molluscan class. The shell provides a continuous and detailed record of shell growth from the larva l phase t o maturity , a facto r allowin g th e study o f th e bot h chemica l an d structura l signa tures, which may, in turn, be used to interpret both ontogenetic and palaeoenvironmental histories. I t is for thes e reason s tha t palaeontologist s hav e lon g been to the forefront o f evolutionary an d functional studies of bivalves. The lon g histor y o f bot h zoologica l an d palaeontological researc h o n th e bivalve s ha s revealed a startlin g degre e o f convergenc e an d parallel evolutio n whic h ha s hampere d th e inter pretation o f thei r evolutionar y history . However , new discoverie s an d development s mak e i t timel y for a new concerte d effor t to integrat e zoologica l and palaeontologica l technique s t o improv e comprehension o f th e evolutionar y histor y o f th e

class. Molecula r phylogenies , couple d wit h multicharacter morphologica l studies , promis e t o improve th e understandin g o f relationships , alon g with ne w discoverie s o f earl y Palaeozoi c fauna s which illuminat e th e scan t knowledge o f the earl y radiation o f th e class . Th e discover y o f chemo symbiotic relationships, an d the location o f divers e and specialize d bivalve s i n th e dee p sea , hydro thermal vents , cold seep s an d submarine caves , ar e continuously expandin g conception s o f th e morphological range of the class . The Biology and Evolution of the Bivalvia meeting, organized on behalf o f the Malacologica l Society of London, was held in Cambridge (UK) in September 1999 . Attended by nearly 12 0 scientists, it wa s th e firs t internationa l bivalv e meetin g o f zoologists and palaeontologists to be held for over 20 years . Thi s boo k contain s a selectio n o f th e papers presented a t the meeting. We ar e extremely gratefu l t o th e followin g peopl e wh o reviewed papers for the present volume: L. Adamkewicz, M. Amler , E . B . Andrews , M . Angel , A . E . Bogan , J . Buckland-Nicks, C . A . Campbell , J . G . Carter , A . Chartrosse, A . Checa , J . C . W . Cope, J . Davenport , M . Foote, G . Giribet , E . Glover , S . Gofas , E . Gosling , G . Haszprunar, A. Hodgson. J. D. Hudson, J. Hutchinson, D. Jablonski, A . L. A. Johnson, P. A. Johnston, D. S . Jones, H. Jones , M . B . Jones , D . Lees , D . T . J. Littlewood , C . Lydeard, B . Morton , L . S . Peck , H . O . Portner , P . Rainbow, C. A. Richardson, L. R. Saul, J. Schneider, P . W. Skelton, A . B . Smith, G . Steiner , T . Steuber , A . R . H . Swan, J. A. Todd and T. R. Waller.

Liz Harper, John Taylor & Alistair Crame

This page intentionally left blank

Unravelling the evolutionary biology of the Bivalvia: a multidisciplinary approac h E. M. HARPER 1, J. D. TAYLOR2 & J.A. CRAME 3 1 Department of Earth Sciences, Downing Street, Cambridge CB2 3EQ, UK (e-mail: emh21@ cus.cam.ac.uk) 2 Department of Zoology, The Natural History Museum, London SW7 5BD, UK 3 British Antarctic Survey, Madingley Road, Cambridge CBS OET, UK

Bivalves hav e bee n importan t member s o f marin e communities since the early Palaeozoic, i n terms of both their numerical abundance and diversity. They are particularl y prevalen t i n shallo w shel f sediments, bu t the y hav e als o conquere d th e intertidal zone as well a s the dee p sea , where they are successfu l predator s an d ke y component s o f some ven t communities . The y hav e als o invade d freshwater system s a number of times, where today they ar e important (and costly) foulers. I n terms of general communit y structure , bivalve s ar e important a s pre y item s fo r a rang e o f differen t predatory groups , an d a s majo r spac e occupiers , particularly o n hard substrat a where spac e ma y be limited. The abundance and diversity of both Recent and fossil bivalve s hav e mad e the m attractiv e subject s for bot h zoologist s an d palaeontologists , an d bot h disciplines hav e contribute d t o th e presen t syste m of classificatio n an d th e understandin g o f thei r phylogenetic relationships . However , somewha t inevitably, th e focu s o f th e tw o group s ha s bee n rather different , wit h zoologist s concentratin g o n anatomical characters suc h as those associated with the gills and stomach, whils t palaeontologists hav e necessarily dwel t o n hard-par t character s suc h a s dentition an d shel l microstructure . I t i s becomin g increasingly clear , however , tha t convergenc e an d parallelism i s rif e withi n th e clas s an d mor e integrated approache s ar e necessar y t o unrave l these. The las t majo r attemp t t o integrat e th e palaeo ntological an d zoologica l approache s t o bivalv e evolution was more than 20 years ago, at the Royal Society o f London meetin g i n 1977 . Th e resultin g volume o f th e Philosophical Transactions o f th e Royal Society o f London, Volum e 284 , i s stil l a benchmark volume . I n particular, a n earl y attemp t at a cladisti c analysi s o f th e Pteriomorphi a b y Waller (1978 ) an d paper s o n th e origi n an d

taxonomic diversificatio n o f th e bivalve s (Pojet a 1978) an d th e rostroconch s (Runnega r 1978 ) ar e still widel y cited . However , i n 197 7 th e Treatise volumes (Co x e t al 1969 ; Stenze l 1971 ) were stil l very muc h i n vogu e a s a reliabl e dat a source , although even then there was a feeling that it was in need o f a comprehensiv e revisio n (Yong e 1978) . This sentimen t ha s bee n echoe d eve r since , mos t strongly b y Johnsto n & Haggar t (1998 ) i n thei r introduction t o Bivalves: A n Eo n o f Evolution. Paleobiological Studies Honoring Norman D. Newell. The Royal Society volume was also written at a tim e whe n cladisti c studie s wer e virtuall y unknown and there was not the wealth of molecular techniques a t han d t o tackl e question s o f phylogeny. Th e enormou s change s whic h hav e taken plac e i n th e wa y i n whic h evolutionar y processes ar e thought about has changed during the last 2 0 years , a s hav e th e numbe r o f taxa , bot h Recent an d fossil, that have been discovere d during this period , bot h o f whic h hav e inspire d thi s volume o f multidisciplinar y paper s fro m bot h palaeontologists an d zoologists.

Bivalve classification an d phylogen y Despite th e long scientifi c interes t i n bivalves, th e relationships betwee n th e highe r tax a ar e perhap s surprisingly unresolved . Certainl y th e Treatise classification i s no w dated , bu t eve n mor e recen t schemes ar e ofte n deepl y conflicting , probabl y because o f their reliance o n singl e or small group s of character s (Starabogato v 1992 ; Morto n 1996 ; Salvini-Plawen & Steine r 1996 ; Walle r 1998 ; Amler 1999) . Th e relativel y recen t boo m i n molecular technique s i s of great potentia l her e and two papers in this volume have used them to try to elucidate th e relationship s betwee n highe r taxa . Steiner & Hammer have use d a n analysi s o f 18 S rDNA sequences in order to tackle the phylogenetic

From: HARPER , E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications, 177, 1-9 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000 .

2E

. M . HARPE R ET AL.

relationships o f the pteriomorphs, both i n terms of the majo r pteriomorp h tax a (such as the ostreoids , pinnoids an d pterioids , etc.) , an d betwee n th e Pteriomorphia a s a whol e an d th e othe r majo r bivalve clade s (e.g . protobranchs , heteroconchs , anomalodesmatans). Thei r researche s support s the monophyly o f th e Protobranchia , Heteroconchi a and Pteriomorphia , an d floa t th e ide a tha t th e Heteroconchia an d Pteriomorphi a ma y b e siste r taxa. Withi n th e pteriomorphs , ther e i s stron g support fo r tw o majo r clades , ([Pinnoide a (Ostreoidea + Pterioidea) ] an d [(Anomioide a + Plicatuloidea) + (Limioide a + Pectinoidea)] . Further molecula r studie s ar e presente d b y Campbell, als o usin g th e 18 S gene , wh o investigated th e relationships betwee n a wide range of bivalv e superfamilies , order s an d subclasses . Gratifyingly, h e foun d al l superfamilies , whic h have bee n establishe d o n morphologica l grounds , appeared monophyletic , a s were most orders. Only the Myoid a appea r polyphyletic , thu s confirming the suspicion s o f som e previou s worker s (e.g . Momsetal. 1991) . Palaeontologists face the fascinating but difficul t challenge o f trying to test various models of bivalve phylogeny wit h th e know n fossi l record . A t fac e value th e tas k shoul d b e relativel y simpl e a s th e bivalves have , b y virtu e o f their robus t calcareou s valves, a n excellen t fossi l record , bu t thi s ha s no t proved t o b e th e case . I t i s particularl y difficul t because followin g th e goo d fossi l recor d o f th e earliest widel y accepte d bivalve s (Fordilla an d Pojetaia), whic h ar e relativel y abundan t from th e Tommotian o f Nort h America , Europ e an d Australasia, there is an unfortunate gap in the fossi l record o f th e clas s tha t span s fro m th e middl e Middle Cambrian-Earl y Ordovician , som e 4 % o f the entire evolutionary history of the class (Harpe r 1998). Unhappily , thi s ga p i n th e fossi l recor d appears t o cove r a perio d o f majo r evolutionar y changes withi n the class, for on their reappearanc e the bivalve s ar e large r an d mor e divers e bot h taxonomically and in life habits. None the less, new discoveries i n th e las t decad e hav e improve d current knowledg e o f earl y Palaeozoi c bivalv e faunas. Thes e finding s have inspired tw o papers in this volume which tackle the problem in two rather different ways . Carter e t al. hav e undertake n a n ambitiou s cladistic analysi s of 6 2 bivalv e taxa of Palaeozoi c age, including a number of equivocal forms suc h as Tuarangia, usin g 11 7 character s derive d almos t exclusively fro m th e hard-parts. The larg e number of character s (an d states) an d taxa has limite d this study t o a heuristic analysis , an d th e analysi s has revealed 411 most parsimonious trees. Doubtless an increase i n compute r powe r i n th e nex t fe w year s will allo w mor e exhaustiv e searche s an d furthe r

character refinemen t ma y reduc e th e number s o f possible models . Th e paper i s accompanied b y ful l character description s an d th e dat a matri x whic h will allow such future re-analysis. Despit e the large number o f tree s produced , th e consensu s tree s d o introduce a numbe r o f interestin g conclusions , some o f whic h suppor t th e conclusio n o f previou s studies, such as Waller (1998), on the basal position of th e Mytiloide a amongs t th e pteriomorphs , an d the basa l dichotom y withi n th e palaeotaxodont s between th e Nuculanoide a an d th e Nuculoide a + Solemyoida. The y als o suppor t th e vie w o f share d ancestry o f th e Nuculoide a an d th e palaeoheterodonts. I n othe r areas , however , th e author s come t o rathe r differen t conclusion s t o thos e reached b y others. The most striking o f these is the rejection o f th e popula r notio n tha t th e Bivalvi a were derive d fro m th e rostroconchs , preferrin g instead a stenothecoi d monoplacophora n origin . Elsewhere the y ar e a t odd s wit h Walle r (1998) , rejecting a link betwee n th e Anomalodesmat a an d the Heteroconchs, preferrin g t o place the former as a sister group to the pteriomorphs. Again , there are striking anomalie s betwee n th e result s o f thi s analysis an d thos e o f molecula r studies . Cop e has used a mor e traditiona l approach , base d o n th e culmination of detailed research o f a range of early Ordovician bivalv e faunas. He bases his scheme on dentition, shel l microstructur e an d inferre d gil l grade. Cop e identifie s th e evolutio n o f th e filibranch gill, which he infers from dental changes , as providin g th e initia l impetu s fo r th e diversification o f th e bivalve s i n eithe r th e lates t Cambrian o r earlies t Ordovician . H e recognize s two subclasses ; (1 ) the Protobranchia - includin g the Nuculoidea and chemosymbiotic forms such as the solemyoids ; (2 ) the Autolamellibranchiata from whic h h e derive s thre e principa l stocks , th e Trigonioida, th e Anomalodesmat a an d th e Heteroconchia, whic h he believes the n gav e rise to the Pteriomorphia . Two othe r paper s i n th e volum e dea l wit h th e phylogenetic relationship s o f enigmati c highe r bivalve taxa. In a major new synthesis , Skelton & Smith presen t a firs t attemp t a t a comprehensiv e phylogeny fo r th e rudists , a n extinc t grou p o f sessile, epifauna l bivalves tha t flourishe d i n war m temperate an d tropical sea s fro m th e Lat e Jurassi c to th e Lat e Cretaceous . Thei r cladisti c stud y wa s based o n 3 3 skeleta l character s an d 3 1 species , representing eac h o f the highe r tax a recognized i n previous classificatio n schemes . On e o f th e te n most parsimoniou s tree s obtaine d fro m thei r stud y was selected a s a working hypothesis. This showed many o f th e basi c phylogeneti c relationship s established by early workers, suc h as Douville and MacGillavry, wer e perfectly sound. An oute r shel l layer o f fibrilla r prismati c calcit e i s a diagnosti c

INTRODUCTION 3

synapomorphy for all rudists an d attachment t o the substrate b y on e o r th e othe r valv e provide s a fundamental divisio n int o tw o stocks . Othe r features show n b y th e cladogra m includ e th e monophyletic status of the uncoiled rudists, as well as established families suc h as the Radiolitidae an d Hippuritidae. Important ne w ligh t i s she d o n th e origin o f th e latte r famil y b y it s sister-grou p relationship wit h the polyconitid genu s Tepeyacia, from the Albian of Mexico. There is every prospect that future iteration s o f this stud y will refine rudis t phylogeny even further . Deep-sea carnivor y i s jus t on e o f som e rathe r unusual lifestyle s foun d amongs t member s o f th e bivalve subclas s Anomalodesmata . Thi s grou p comprises 1 4 extan t familie s o f morphologicall y disparate bivalves, many from th e deep sea , whose classification an d phylogeneti c relationship s hav e been highly confused. Harpe r e t al. us e a cladistic analysis of a set of anatomical and shel l character s in a n attemp t t o determin e relationship s amongs t this divers e group . On e conclusio n fro m thi s analysis i s that carnivor y ha s arise n independentl y within tw o separat e clades . Tree s generate d fro m shell characters alon e were incongruent with those derived fro m th e tota l evidenc e o f anatom y an d shell, suggestin g tha t althoug h anomalodesmatan s have a lon g fossi l recor d i t ma y b e difficul t t o integrate fossils int o such an analysis. Bivalves pla y a majo r rol e i n freshwate r communities, wher e the y ar e significan t i n wate r filtering, an d thei r larva l phase s ar e importan t parasites o f fish , whils t thei r propensit y t o sprea d has mad e the m importan t biofouler s (Aldridg e 1999). Because o f the natur e o f freshwater bodies, many tax a ar e endemi c t o specifi c region s an d hence i t i s probabl e tha t they , abov e al l othe r bivalves, ma y sho w extrem e degree s o f morpho logical convergence . Similarly , man y geographi cally restricte d tax a ar e a t grea t dange r fro m extinction. Lydear d e t al . hav e use d th e mitochondrial cytochrom e C oxidase subuni t I and 16S rRN A gen e sequence s t o examin e th e phylogenetic relationship s o f fiv e specie s o f Gul f Coastal unioni d generally accepte d as belonging t o three differen t genera . Thes e ar e particularl y important tax a a s the y ar e al l considere d endangered. Their analyses found tha t the five taxa were all distinct and the 'genera ' in which they had previously bee n disperse d i n wer e polyphyletic . The threa t o f morphologica l convergenc e ham pering classificatio n i s a n issu e wit h th e thre e unionid gener a o f cementin g 'freshwate r oysters ' [Etheria (Africa) , Acostaea (Sout h America ) an d Pseudomulleria (India)] . Despit e th e fac t tha t th e cemented habi t withi n th e Bivalvi a a s a whol e i s well know n t o b e polyphyleti c (Yong e 1979 ) an d that thes e freshwate r cementer s hav e highl y

disjunct geographi c distributions , the y hav e traditionally bee n place d withi n a monophyleti c family, th e Etheriidae . Boga n & Hoe h hav e integrated ne w cytochrom e C oxidas e subuni t I DNA sequences from thes e three taxa with existing data fro m othe r unioni d tax a fro m aroun d th e world. Thei r finding s d o no t suppor t a clos e relationship betwee n th e thre e genera , suggestin g rather tha t th e cemente d habi t ha s arise n a t leas t twice. The y als o pos e th e rathe r interestin g question a s to why the cemented habi t migh t hav e evolved in the firs t place , notin g that ther e are no recorded freshwate r cementer s i n eithe r Nort h America o r China , th e majo r hub s o f unioinoi d diversity. Comparative morpholog y continue s t o b e a n important too l i n ou r effort s t o determin e phylogenetic relationship s amongs t bivalves . A major benefi t fro m th e introductio n o f cladisti c methods in phylogenetic reconstruction has been in the objectiv e definitio n o f character s an d thei r states. Concomitantly , ther e ha s bee n a searc h fo r new types o f characters and two papers sho w ho w detailed morphologica l studie s o f bivalv e sperm , using transmissio n electro n microscopy , ca n generate set s o f phylogeneticall y importan t characters. In the first paper, Healy et al. use sperm characters to explore relationship s within the larg e bivalve subclas s Pteriomorphia , e.g . showin g how the Ostreoide a an d Limoidea ar e probabl y closel y linked, a s ar e th e Pterioidea , Pinnoide a an d Pectinoidea. B y contrast, sperm character s sugges t that the Arcoidea an d Limopsoidea are less closely related than generally supposed. At a more detaile d level, Key s & Heal y us e character s o f sper m ultrastructure t o explor e relationship s amongs t th e living specie s of giant clams - Tridacninae . Sper m data support s a clos e relationshi p betwee n gian t clams an d cardiid bivalves, but perhaps indicate s a separate origin of Hippopus an d the other Tridacna species. Amongs t th e specie s o f Tridacna, T . squamosa share s mor e character s wit h T . gigas than wit h th e othe r specie s i n th e subgenus , Chametrachea, wher e i t i s usuall y placed ; a conclusion supporte d b y some molecular data .

Bivalve form and functio n The great diversity of bivalve life habits is reflected in a wide range of morphological variatio n i n terms of bot h shel l an d anatomy . Th e semina l wor k o f Stanley (1970 ) provide d a firm basis for the use of shell character s t o infe r th e lif e habit s o f extinc t taxa an d fe w hav e approache d th e eleganc e o f th e work of C. M. Yonge in demonstrating the variation in anatomical features across the class. Despite th e established interes t i n bivalv e form an d function , there remain s a surprisin g amoun t t o d o and , i n

4

E. M . HARPE R E T AL.

particular, t o synthesiz e th e information . I t i s important to document the morphological diversit y displayed b y th e clas s an d t o investigat e th e constraints and preadaptations which have favoured some body plans and not others. Taylor & Glove r repor t tha t al l th e specie s o f Lucinidae studie d t o dat e harbou r sulphide oxidizing, chemosymbioti c bacteri a withi n thei r gills. Althoug h chemosymbiosi s i n livin g lucinid s has bee n recognize d fo r som e time , i t seem s tha t little though t ha s gon e int o it s mechanic s - i f sulphide-laden wate r i s draw n int o th e mantl e cavity alongsid e th e inhalan t respirator y current , how i s oxidizatio n prevente d befor e reachin g th e chemosymbionts? Taylo r & Glover's carefu l wor k revealed a number of adaptations by which the two sites o f respiratio n an d chemosynthesi s ar e partitioned, e.g . by the detache d anterio r muscl e which separate s th e oxidize d wate r tha t com e i n anteriorly fro m th e sulphide-ric h water s whic h ar e drawn i n posteriorly. Th e presenc e o f mantl e gill s on the internal surfac e o f the anterio r o f the mantle of many taxa underlines this 'switch' in the location of normal respiratory activity. Mantle gills had been described previously , bu t onl y superficiall y an d their complexit y an d tru e significanc e ha d neve r been realized . Thi s underline s th e continue d importance o f anatomica l studie s o f seemingl y familiar bivalves . Suc h i s th e importanc e o f th e chemosymbiotic relationship , tha t evolutionar y syntheses of the lucinoids should take account of it and i t i s therefor e extremel y usefu l t o no w hav e morphological character s whic h ma y b e use d a s markers for the habit . Man y of thes e feature s are demonstrable in the Silurian Ilionia suggestin g that the chemosymbiosi s withi n th e lucinoid s i s extremely ancient. In recen t year s i t ha s becom e apparen t tha t th e very distinctive chemosymbiotic bivalve communities associate d a t th e presen t da y wit h bot h ho t vents an d col d seep s ca n b e trace d bac k throug h considerable period s o f time. Suc h fauna s see m t o have bee n particularl y widesprea d i n th e Cretaceous an d Kell y e t al. recor d a furthe r occurrence i n th e Earl y Cretaceou s (Lat e Barremian) o f Wollasto n Forland , Northeas t Greenland. Sedimentologica l evidenc e indicate s that thi s i s a methan e cold-see p comple x whic h accumulated i n a mid - t o outer-shel f setting . I t i s characterized b y a larg e numbe r o f limeston e mounds, 1- 3 m in diamete r an d up t o 1. 8 m high , that occu r withi n a n otherwis e monotonous , mudstone-dominated sequence . Th e mounds reveal an interna l structur e o f calcite-cemente d tub e systems, laminate d calcit e crust s an d voi d fills . A large new species of the lucinid genus Cryptolucina is a dominan t elemen t withi n the fauna , an d there are occasiona l specimen s o f th e cryptodon t

Solemya too. However, the most distinctive bivalve within the assemblag e i s a large, ne w taxo n which is referre d t o th e anomalodesmata n famil y Modiomorphidae. Thi s ne w bivalv e reache s c. 300 mm in length b y 12 0 mm i n height, an d has a shel l whic h is , i n places , u p t o 2 8 mm thick . I t seems to be yet anothe r new gian t bivalv e taxo n associated exclusivel y with cold seeps. Members of the Pectinida e posses s th e anatomicall y mos t advanced eye s o f an y bivalv e famil y an d i t woul d seem onl y logica l t o conclud e tha t the y hav e developed thes e to provid e an advance d earl y warning system of vicinal predators. However , i n a wide-ranging review o f the functiona l significanc e of pectinid pallia l eyes , Morton suggests tha t their true purpose i s still largely unknown. He firs t add s to ou r anatomica l knowledg e o f pectini d eye s b y describing those of the boreal specie s Patinopecten yessoensis an d then goes o n to show that in almos t all tax a studie d a n escap e respons e ca n onl y b e elicited b y either tactile or chemical stimuli . Visual clues rarely , i f ever , provok e activ e swimming . I s the pectini d ey e a n exampl e o f evolutionar y overdesign? I f pectini d an d spondyli d eye s ar e indeed homologous , i t woul d sugges t tha t the y evolved befor e th e tw o familie s diverge d i n th e Early Jurassic. Sophisticated pallia l eye s ma y have been retaine d sinc e the n fo r a numbe r o f poorl y understood functions . Few organism s hav e evolve d th e capabilit y o f digesting wood , bu t th e teredini d bivalves , th e shipworms, hav e bee n successfu l i n thi s mod e o f feeding, datin g bac k t o th e earlies t Cretaceous , a time whe n angiospermou s woo d woul d hav e become abundan t i n coasta l habitats . Indeed , i n Recent ecosystem s teredinid s hav e bee n th e scourge o f human-mad e coasta l structure s an d boats mad e o f wood . However , relativel y littl e i s known abou t the evolution of this very specialize d habit. Lope s e t al . hav e describe d an d compare d the functiona l anatom y o f th e digestiv e syste m o f two woo d borin g taxa , Neoteredo reynei (Bartsch , 1920) an d Psiloteredo healdi (Bartsch , 1931) , which ar e commo n i n Brazilia n mangroves . Important difference s between th e two suggest tha t N. reyenei, with its enlarged wood-packed appendi x and ana l canal , i s more dependant o n woo d fo r it s nutrition than is Rhealdi, in which these structure s are smal l an d wher e activ e palp s hav e bee n retained, suggestin g th e importanc e o f suspensio n feeding. Ther e i s evidenc e tha t durin g ontogen y wood ma y increase i n importance i n the diet of the latter. Gill structure in bivalves has long been the focu s of functiona l an d evolutionar y studies , an d Bellinger & Dufour describ e an d discus s th e fin e structure o f th e abfronta l surfac e o f th e gil l filaments. Fro m th e supposed primitive functio n a s

INTRODUCTION 5

a mucociliar y cleanin g surfac e i n protobranc h bivalves, tw o evolutionar y trajectorie s involvin g cilia and mucocytes are proposed. One involves the progressive reductio n i n densit y o f cili a an d mucocytes, and the other involves reduction of cilia but retentio n o r increas e i n aci d mucopoly saccharide-secreting mucocytes. Many arcoi d bivalve s ar e characterize d b y a duplivincular ligament , wherei n th e lamellar laye r is embedde d i n th e fibrou s on e i n a distinctiv e series of chevrons. The one prominent exception to this typ e o f organizatio n occur s i n th e famil y Noetiidae, whic h i s characterize d b y vertical , chevron-shaped strips of lamellar ligament. At firs t sight i t woul d appea r tha t thes e tw o type s o f ligament mus t be the product o f two quite distinc t groups, bu t chanc e observation s o n a serie s o f Limopsis ligaments suggested to Thomas et al. that striking difference s i n th e for m o f th e arcoi d ligament ca n b e produce d b y onl y a ver y modes t change i n th e developmenta l process . T o develo p this idea further the y have hypothesized that , along the mantl e isthmus , alternat e zone s o f activatio n and inhibitio n contro l th e productio n o f lamella r ligament that forms either oblique sheets or vertical layers; only a single, simple change of instructions to a narrow field of cells is required to change from one patter n t o th e other . Test s provide d b y tw o contrasting set s o f mathematica l model s indicat e that thi s ma y indee d b e th e cas e an d i t ma y b e concluded that disparate growth patterns can in fact be produced by only subtle character shifts . With the current revolution in the understanding of whic h taxonomi c group s ma y o r ma y no t b e assigned t o the subclas s Cryptodont a (Johnsto n & Collom 1998) , considerabl e importanc e i s no w attached t o a prope r understandin g o f th e Palaeozoic order Praecardioida. Yancey & Heaney present som e timel y informatio n o n th e Lunulacardiidae, th e younges t praecardioid family in Nort h America . Thei r materia l come s fro m th e Pennsylvanian (Uppe r Carboniferous ) Buckhor n Asphalt biot a o f south-centra l Oklahoma , an d comprises a unique assemblage o f smal l bivalves. Some of these are definitely juveniles but others are adults that can be assigned to an unusual new taxon. Characterized b y a distinct change i n shape from a veneriform juvenile to a sub trigonal adult, this new form possesse s bot h stou t teet h an d a prominent ligament. Indeed , wer e i t no t fo r thes e latte r characters, i t coul d easil y b e confuse d wit h a conocardioid rostroconch ! The morpholog y o f larva l shell s o f bot h livin g and fossi l bivalve s ha s th e potentia l t o suppl y useful phylogeneti c information , particularl y where, as in the case o f the oysters, the post-larval shell i s pron e t o a larg e degre e o f ecophenotypi c variation. Malchu s ha s recognize d an d studie d a

number o f prodissoconch s fro m Middl e Jurassi c oysters. Carefu l examinatio n o f thei r morpholog y revealed that the ancestral larva l hing e most likel y evolved fro m a mytilid-lik e provinculum , t o produce a secondaril y symmetrica l hing e line . H e also suggest s tha t th e smal l siz e o f th e pro dissoconch I , alon g wit h the smal l P I/P I I ratios, confirm tha t th e planktotrophi c developmen t styl e seen in modern oyster s is in fact th e plesiomorphic state for the entire superfamily . The tube-dwelling clavagellid bivalves are some of th e mos t enigmati c o f al l bivalve s an d a s indicated by Harper et al., their position within the subclass Anomalodesmat a i s extremel y equivocal , their extreme morphological adaptation s apparentl y masking usefu l phylogeneti c signals . Savazz i ha s investigated th e little-know n clavagelli d Bryopa. Unlike mos t clavagellids, whic h are thought to be facultative semi-endolithi c tub e dwellers , Bryopa appears t o b e full y an d obligatoril y endolithic . Despite th e fac t tha t th e lef t valv e i s permanentl y attached t o the tube, the bivalve appear s t o migrat e forwards within the substratum throughout growth. Despite th e fac t tha t n o livin g animals , o r indee d soft parts , wer e availabl e fo r study , Savazz i wa s able t o us e morphodynami c principle s t o sugges t how this could occur. He envisages a mechanism by which the shell elongates anteriorly , slidin g the sof t parts forward , whils t th e posterio r portio n o f th e right valv e i s continuall y bein g resorbed . Th e strong inequivalvy which results is seen in none of the othe r clavagellid s and , unfortunately , i t seem s that Bryopa i s to o derive d t o provid e th e muc h needed informatio n a s t o th e affinitie s o f th e superfamily. Although th e mineralizatio n o f th e externa l shells of bivalves has been extensively studied and used as a phylogenetically useful characte r (Taylor et al . 1969 , 1973 ; Carte r 1990) , som e interna l tissues are also mineralized an d freshwater mussel s (Unionoida) ofte n hav e larg e accumulation s o f calcium granule s in their tissues . Byrne describe s the fin e structur e an d chemistr y o f abundan t orange, iron-ric h calciu m granule s i n th e Australian freshwate r musse l Hyridella. Comparison o f granul e distributio n an d com position betwee n differen t unionoid s suggest s th e existence o f phylogeneticall y significan t differ ences. Teranota i s a relativel y newl y describe d taxon , known onl y fro m th e Middl e Devonia n o f Germany. Thes e scimitar-shape d bivalve s ar e interpreted b y Rogall a & Amler a s belongin g t o the enigmatic family Orthonotidae , whose affinitie s are debate d a s belongin g t o eithe r th e modio morphids, anomalodesmatan s o r eve n th e heteroconchs. Rogalla & Amler are persuaded of an anomalodesmatan affinit y bu t suppor t a close lin k

6E

. M. HARPE R E T AL.

with th e modiomorphids . Th e discover y o f specimens i n (apparently ) lif e position , embedde d anterior-end downward s a t angle s o f 60-80 ° t o the sedimen t surface , ha s allowe d the m t o reconstruct thes e a s endobyssat e bivalve s wit h n o true siphons .

quality an d completenes s o f th e sourc e dat a fro m regional levels . A n excellent exampl e o f how thes e data ar e acquire d i s th e analysi s b y Mikkelso n & Bieler o f th e bivalv e faun a o f th e Florid a Keys . Prior t o thei r surve y onl y 16 3 specie s wer e recorded fro m th e area . Usin g a combinatio n o f original collecting , searc h o f museu m collection s and scourin g of literature records thi s list has no w Biodiversity and biogeography been increase d t o 32 5 species . Interestingly , bu t The documentatio n an d analysi s o f pattern s o f rather worrying , primar y literatur e source s biodiversity o n regional an d globa l scales , and , i n recovered onl y 44 % o f th e species , althoug h thi s particular, th e latitudina l diversit y gradient , hav e increased t o 73 % whe n 'grey ' literatur e wa s generated muc h interest , a plethor a o f hypothese s included. Museu m collection s wer e th e mos t and considerabl e controversy . Marin e bivalve s important source of records, pickin g up 77% of the have bee n ofte n use d i n suc h analyse s b y bot h species includin g 6 2 no t foun d b y othe r methods . biologists an d palaeontologists. A new analysi s o f The messag e fro m thi s pape r i s tha t a diversit y regional bivalv e fauna s by Crame shows that bot h database fo r a particula r are a base d solel y o n latitudinal an d longitudina l gradient s ar e no t a s literature record s i s likel y t o b e a sever e regular in form as supposed. There is a distinct step underestimate of th e true diversity. Molecular technique s ar e no w bein g use d i n between 2 0 an d 30° N i n th e latitudina l diversit y gradient fo r th e norther n hemispher e an d i n th e biogeographical analysi s t o tes t hypothese s con southern hemispher e th e bivalve faun a of Australi a cerning th e are a o f origi n an d movement s o f forms a distinct hotspot o f diversity. The cause s of species. Th e smoot h blu e mussel , Mytilus these large-scal e pattern s ar e likel y multipl e an d galloprovincialis, ha s a n unusuall y widesprea d complex, an d Cram e criticall y review s variou s distribution i n temperat e an d subpola r water s o f hypotheses emphasizin g tha t historical processes i n both th e norther n an d souther n hemispheres . the Neogene, suc h as the closure o f Tethys and the Introduction b y human s ma y accoun t fo r som e o f northward movement of Australia into the tropics , the distributio n pattern bu t mussel s ar e presen t i n have bee n importan t i n shapin g th e biodiversit y shell midden s predatin g Europea n arriva l i n southern Australia an d natural dispersal als o seem s patterns of a region. Jablonski et al. have also been investigatin g th e likely. Daguin & Borsa used nuclear DNA marker s latitudinal gradien t i n marin e bivalv e diversity , to determin e th e geneti c relationship s an d teas e paying particula r attentio n t o tha t presen t o n th e apart th e histor y o f Mytilus galloprovincialis eastern Pacifi c continenta l shelf . Here , thei r ver y populations aroun d th e world . The y demonstrat e comprehensive dat a se t als o pick s ou t a shar p the geneti c distinctivenes s o f the Australia n popu (50%) fal l i n the numbe r o f species a t the edg e o f lations an d reject th e hypothesis tha t these mussel s the tropics, followed by a much gentler decline into were recentl y introduce d b y humans . By contrast , Arctic regions. They believe that this gradient may the clos e similarit y o f sample s fro m th e be a positiv e functio n o f availabl e energ y and, Mediterranean, th e Nort h Pacifi c an d Chil e using a residuals analysi s to counte r th e effect s o f supports th e hypothesi s tha t mussel s i n th e latte r spatial autocorrelatio n withi n th e data set , demon- two areas hav e been introduce d recently . strate that mean sea-surface temperature is a highly significant predicto r o f bivalv e diversity . It i s als o Ecological and evolutionary trend s apparent tha t bot h infauna l an d epifauna l tax a increase i n diversity fro m th e pole s t o th e tropics , Bivalves have a crucially importan t rol e t o play in although a t somewha t differen t rates . Alon g th e the stud y o f evolutionar y lineages . Crampto n & Pacific coas t o f North America thei r ratio change s Maxwell argu e tha t outline shap e shoul d be a key significantly wit h latitude an d ther e i s preliminary morphological characte r an d proceed t o develo p a evidence fro m th e Mesozoi c fossi l recor d t o new metho d for studying it based o n Fourier shap e suggest tha t it may also change wit h time. Clearly , analysis. A n outline trac e o f either a growth stag e this is a dynamic gradient drive n by the differentia l or the complete adul t valv e i s digitized, yieldin g a diversification o f th e tw o functiona l groups . D o suite o f Fourie r coefficient s tha t describ e a factors such as the mass extinction event at the K- T spectrum o f harmonicall y relate d trigonometri c boundary and global climatic chang e have a role to curves, o r harmonics . Thes e coefficient s ca n the n play in driving thes e clad e dynamics ? be used to compare syntheti c average morphologie s Analysis o f globa l pattern s o f marin e bio - at a variety of ontogenetic an d evolutionary stages . diversity a s exemplifie d i n th e Cram e an d In a detaile d stud y o f th e shallow-burrowin g Jablonski et a l paper s i s highl y dependen t o n th e crassatellid genus , Spissatella, i t wa s show n tha t

INTRODUCTION 7

growth is strongly allometric . Ontogenetic change s in shap e o f individual s ar e invariabl y fa r greate r than tota l evolutionar y change s withi n th e genu s over c . 2 0 Ma. A n overal l stron g correspondenc e between individua l specie s ontogenie s an d evolu tionary changes in adult form strongl y suggest that heterochrony ha s bee n th e dominan t evolutionar y mechanism throughou t th e lifespa n o f Spissatella. There i s goo d evidenc e t o sugges t tha t paedo morphosis an d peramorphosi s occurre d i n approximately equa l frequencie s fro m th e lates t Oligocene onwards. Johnson et al. have highlighted the potential of the Quee n Scallop , Aequipecten opercularis, a s a tool t o investigat e Lat e Cenozoi c palaeoenviron mental change . Occurrin g a t th e presen t da y fro m Norway t o th e Adriatic , i t ha s rapid , year-roun d growth rates tha t ensure recover y o f well-resolve d records o f seasona l variation , an d a fossi l recor d that stretche s bac k int o th e Miocene . Somewha t surprisingly, an oxygen isotope palaeothermometr y study o n mid-Pliocen e shell s indicate d seasona l temperatures simila r t o thos e o f th e presen t day . This stands in marked contrast to a variety of other isotope an d genera l assemblag e dat a whic h suggests tha t th e mid-Pliocen e wa s globall y warmer than now. Perhaps th e souther n North Sea Basin wa s i n som e wa y exemp t fro m thi s genera l trend, o r mayb e eve n thes e well-preserve d fossil s suffered a degre e o f crypti c diageneti c alteration . More promisin g i n thi s particula r respec t ma y b e the stud y of microgrowth increments, fo r thes e d o show markedl y highe r maxim a an d minim a (i.e . related t o extrem e summe r an d winte r temper atures) i n th e mid-Pliocene . Carbo n isotop e an d various trac e elemen t dat a als o offe r considerabl e potential fo r studyin g variatio n i n seasonalit y patterns. The evolutio n o f physiologica l character s ha s been investigate d experimentall y b y Pec k & Con way. The y wer e particularl y concerne d wit h the concep t o f metaboli c col d adaptio n (MCA) , which i s th e hotl y debate d subjec t o f whethe r th e metabolic rates of polar ectotherms ar e elevated t o compensate fo r th e physiologica l constraint s imposed b y living a t low temperatures. Th e recen t demonstration that the muscles of certain polar fis h contain twic e th e numbe r o f mitochondri a a s temperate specie s i s taken by som e t o be evidenc e for th e operation o f MCA. The approach adopte d i n this stud y wa s t o loo k a t rate s o f oxyge n con sumption in two Antarctic bivalve species an d then to compar e th e result s wit h thos e obtaine d previ ously fro m a rang e o f lowe r latitud e taxa . I n thi s way i t wa s possibl e t o show , quit e conclusively , that rate s o f oxyge n consumptio n declin e wit h increasing latitude. Togethe r wit h a similar stud y of Q10 coefficients , th e dat a indicat e tha t ther e i s n o

significant elevatio n o f whole-organis m metabo lism a t lo w temperatures . Th e restricte d temper ature envelop e an d lo w metaboli c rate s o f pola r ectotherms ar e adaptations tha t hav e evolve d ove r at least the last 1 5 Ma, if not considerably longer . Edelaar ha s bee n investigatin g whethe r th e depth o f burrowin g i n th e deposit-feedin g tellini d Macoma balthica might b e regarded a s a trade-off between safet y fro m predator s an d acces s t o it s food source . Obviously , th e deepe r Macoma burrows th e safe r i t i s fro m surface-dwelling predators, bu t th e mor e remot e i t i s fro m it s food . The ke y questio n o f interes t her e i s whethe r organisms suc h as Macoma ca n adjus t t o optimum values by modifying their phenotype (suc h as depth of burrowing) . To tr y an d answe r this , a serie s o f laboratory experiment s wa s devise d t o investigat e depth o f burrowin g with , firstly , foo d (finel y chopped spinach ) either present or absent, and then a commo n predato r (th e shorecrab , Carcinus maenas) eithe r presen t o r absent . Th e result s showed a significan t decreas e i n burrowin g dept h when foo d wa s adde d bu t the n a significan t increase whe n a predato r wa s introduced . O n average, individua l Macoma burrowed 57 % deeper in the presence o f the shorecrab . Suc h behavioural plasticity ma y hav e a numbe r o f importan t ecological an d evolutionar y implications . Fo r example, pronounce d change s i n th e shap e o r density o f growt h ring s migh t reflec t predatio n intensity as much as a low food supply . Ensis directus, a recen t ballast-wate r invade r along Europea n Nort h Se a coasts , show s periodi c mass mortalitie s tha t ar e stil l poorl y understood . Cadee has noticed how , at certain time s durin g the winter, large numbers o f shells become exposed b y at least half their length above the sediment surface and the n canno t re-burrow . A t suc h time s the y become eas y pre y fo r herrin g gulls , wh o hav e perfected a techniqu e o f alternat e shakin g an d dropping t o brea k ope n th e shell . Thi s invariabl y causes damag e t o just the middle par t of the valv e and th e productio n o f a uniqu e typ e o f shel l fragment. Man y type s o f shel l fragmen t ar e no w known t o b e specifi c t o individua l predator s an d thus hav e considerabl e potentia l fo r palaeoeco logical studies . Presumably, avia n predators exer t a significant predatio n pressure o n intertida l an d shallow subtida l bivalve s and , therefore , th e recognition o f diagnosti c shel l damag e cause d b y these predators , whic h i s demonstrabl y differen t from taphonomi c damage , i s extremel y usefu l i n any futur e attempt s t o document thi s activit y fro m the fossil record . Marine mytili d mussel s ar e probabl y th e mos t familiar and well-studied of all bivalves. They have a hug e biomas s an d ar e majo r space-occupyin g organisms upon rocky intertida l shore s throughou t

8E

. M. HARPE R ET AL.

the world , wher e the y ar e ofte n importan t com ponents of intertidal food webs . Seed e t al. revie w the attributes that contribute towards the ecologica l success o f mytili d mussels . The y the n g o o n t o show ho w musse l bed s themselve s for m majo r habitats fo r man y othe r organisms , wit h th e composition an d structur e o f thes e communitie s remarkably simila r i n widely separate d part s of the world. Becaus e o f thei r abundanc e an d accessi bility, as well a s their importanc e a s food, mussels have bee n widel y use d a s sentine l indicator s o f environmental chang e an d pollution . See d e t al . demonstrate, b y detaile d studie s o f shel l growt h and trac e elemen t analysis , how musse l shell s can be used as chronometers o f environmental change. Their work provides a model fo r the interpretatio n of growth patterns in fossil shells.

Future direction s It would be easy to presume tha t the long traditio n of bivalv e stud y by bot h zoologist s an d palaeont ologists, an d thei r basi c familiarit y with the class , has le d to a comprehensive understandin g o f thei r evolutionary history . However, this i s fa r fro m th e case. Th e star t o f th e twenty-firs t centur y offer s many excitin g challenge s t o th e understandin g o f the evolutionary biology of the Bivalvia. Exciting discoverie s continu e t o b e mad e amongst living bivalves, and two in particular have changed th e concept s o f trophi c adaptation s an d evolution o f th e class . Bivalve s ha d lon g bee n regarded a s having two main feedin g strategie s suspension and deposit feeding - wit h a few species nutritionally dependen t o n havin g photosymbiosi s with unicellular algae. It is only 20 years since th e discovery of predatory behaviour amongst bivalves and thi s i s no w recognize d a s a majo r feedin g strategy amongs t a t leas t thre e group s o f deepe r water bivalve s (Morto n 1981) . Similarly , explor ation o f hydrotherma l vent s an d cold-see p site s over the last 20 years has revealed communitie s of bivalves nutritionall y dependen t o n symbioti c sulphur- an d methane-oxidizin g bacteria . I t i s remarkable that this chemosymbiosis has now been recognized in at least six different clade s and many species o f bivalves, living not onl y in the deep se a but als o i n shallo w wate r an d eve n intertida l habitats (Diste l 1998) . Comparativ e morpholog y suggests tha t thi s chemosymbiosi s i s a n ancien t nutritional strateg y whic h ma y dat e bac k t o th e Ordovician. The biolog y o f thes e humbl e animal s continues to surprise , a s witnesse d b y th e extraordinar y behavioural an d morphologica l adaptation s employed b y freshwater unionid bivalves t o ensure transfer o f thei r larva e t o hos t fis h species . Thes e remarkable adaptation s involv e extension s o f th e

mantle edges t o mimic fish , complet e wit h fin-lik e structures an d 'eyes' , an d als o extrude d structure s containing th e glochidian larva e whic h mimi c fis h and arthropod larvae (Haa g et al. 1995) . A remarkable recen t discover y i s that the wormlike anima l Xenoturbella, a ciliated , virtuall y organless ba g fro m norther n Europe , i s i n fac t a highly modifie d shell-les s protobranc h bivalv e (Israelsson 1999) . Thi s umaskin g o f Xenoturbella extends presen t conception s o f th e morphologica l range of bivalves. Palaeontologists als o continu e t o uneart h wonderful an d extraordinar y animal s whic h trul y extend ou r concept s o f morphologica l disparit y amongst bivalves , e.g . th e discover y o f a ne w family, th e Wallowaconchidae , o f large-vane d an d chambered Triassi c bivalve s (Yance y & Stanle y 1999), whic h ma y hav e harboure d microbia l symbionts. Whils t debat e stil l continue s ove r th e life habit s o f enigmati c extinc t tax a suc h a s th e rudists an d inoceramids , ne w discoverie s ar e gradually extendin g ou r knowledg e o f earl y Palaeozoic bivalv e evolutio n an d continuall y extending, o r otherwis e modifying , th e geologica l ranges of known groups. The most recent published compilation o f familia l range s (Skelto n & Benton 1993) i s strikingl y differen t fro m tha t published i n the Treatise an d even then its authors admit that its quality is rather 'patchy' . One of the most obvious short-term challenges is to produce a comprehensive compilatio n o f al l the available phylogeneti c informatio n an d geologica l ranges an d th e presen t author s ech o th e call s b y Yonge (1978 ) an d Johnsto n & Haggar t (1998 ) fo r an updated versio n o f the Treatise.

References ALDRIDGE, D . C . 1999 . Th e morphology , growt h an d reproduction o f Unionida e (Bivalvia ) i n a Fenland waterway. Journal ofMolluscan Studies, 65, 47-60. AMLER, M. R. 1999 . Synoptica l classification of fossil an d Recent Bivalvia . Geologica et Palaeontologica, 33, 237-248. CARTER, J. G. 1990 . Skeletal Biomineralization: Patterns, Processes an d Evolutionary Trends. Va n Nostran d Reinhold, New York . Cox, L . R . & 2 4 others . 1969 . In : MOORE , R . C . (ed. ) Treatise on Invertebrate Paleontology. Part N. Mollusca (1-2), Bivalvia. Geologica l Societ y o f America, Boulder , CO , an d Universit y o f Kansa s Press, Lawrence, KS . DISTEL, D . L . 1998 . Evolutio n o f chemautotrophi c endosymbioses i n bivalves . Bioscience, 48 , 277-286. HAAG, W . R., BUTLER, R. S . & HARTFIELD, P. D. 1995 . A n extraordinary reproductiv e strateg y i n freshwate r bivalves: pre y mimicry to facilitate larva l dispersal. Freshwater Biology, 34, 471-476 HARPER, E . M . 1998 . Th e fossi l recor d o f bivalv e

INTRODUCTION 9 molluscs. In : DONOVAN , S . K . & PAUL , C . R . C . (eds) Th e Adequacy o f th e Fossil Record. Joh n Wiley and Sons, Chichester, 243-267 . ISRAELSSON, O . 1999 . Ne w ligh t o n th e enigmati c Xenoturbella (phylu m uncertain) : ontogen y an d phylogeny. Proceedings o f th e Royal Society o f London, 266B, 835-841. JOHNSTON, P . A . & COLLOM , C . J . 1998 . Th e bivalv e heresies - inoceramida e ar e Cryptodonta , no t Pteriomorphia. In: JOHNSTON , P . A. & HAGGART , J . W. (eds ) Bivalves: A n Eo n o f Evolution. Paleobiological Studies Honoring Norman D. Newell. Calgar y Universit y Press , Calgary , 347-360. & HAGGART , J . W . 1998 . In: JOHNSTON , P . A . & HAGGART, J . W . (eds ) Bivalves: A n Eo n o f Evolution. Paleobiological Studies Honoring Norman D . Newell. Calgar y Universit y Press , Calgary, xi-xii. MORRIS, N. J., DICKINS, J. M . & ASTAFIEVA-URBAITIS , K . 1991. Upper Palaeozoic anomalodesmata n bivalves . Bulletin of the British Museum of Natural History (Geology Series), 47, 51-100. MORTON, B . 1981 . Pre y captur e i n th e carnivorou s septibranch Poromya granulata (Bivalvia : Anomalodesmata: Poromyacea) . Sarsia, 66 , 241-256. 1996. The evolutionar y history of the Bivalvia . In: TAYLOR, J . D . (ed. ) Origin an d Evolutionary Radiation of the Mollusca. Oxford University Press, Oxford, 337-356. POJETA, J. 1978 . The origin and taxonomic diversification of pelecypods . Philosophical Transactions o f th e Royal Society of London, Series B, 284, 225-243 . RUNNEGAR, B . 1978 . Origi n an d evolutio n o f th e Clas s Rostroconchia. Philosophical Transactions o f the Royal Society o f London, Series B , 284 , 319-333. SALVINI-PLAWEN, L . v . & STEINER, G . 1996 . Synapomorphies an d plesiomorphie s i n highe r classification o f th e Mollusca . In : TAYLOR , J . D . (ed.) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press, Oxford, 29-51. SKELTON, P . W . & BENTON , M . J . 1993 . Mollusca :

Rostroconchia, Scaphopod a an d Bivalvia . In : BENTON, M . J. (ed.) Th e Fossil Record 2. Chapma n & Hall, London, 237-263, STAROBOGATOV, Y . I . 1992 . Morphologica l basi s fo r phylogeny and classification of Bivalvia. Ruthenica, 2, 1-25 . STANLEY, S . M. 1970 . Relation o f shell form to life habits of th e Bivalvia . Geological Society o f America Memoir, 125 , 1-296 . STENZEL, H . B . 1971 . Oysters . In : MOORE , R . C . (ed. ) Treatise on Invertebrate Paleontology. Part N. Mollusca (3), Bivalvia. Geologica l Societ y o f America Boulder , CO , an d Universit y o f Kansa s Press, Lawrence, KS. TAYLOR, J . D. , KENNEDY , W . J . & HALL , A . 1969 . Th e shell structur e an d mineralog y o f th e Bivalvia . Introduction, Nuculacea-Trigonacea . Bulletin of th e British Museum (Natural History), Zoology Series, Supplement, 3 , 1-125. ,& 1973 . Th e shel l structur e an d mineralogy o f th e Bivalvia . II . Lucinacea Clavagellacea, Conclusions . Bulletin o f th e British Museum (Natural History), Zoology Series, Supplement, 22 , 253-284. WALLER, T . R . 1978 . Morphology , morphocline s an d a new classificatio n o f the Pteriomorphi a (Mollusca : Bivalvia,). Philosophical Transactions of th e Royal Society o f London, Series B, 284, 345-365 . 1998. Origin of the molluscan Class Bivalvia and a phylogeny of the majo r groups. In: JOHNSTON , P. A. & HAGGART , J . W . (eds ) Bivalves: A n Eo n o f Evolution. Paleobiological Studies Honoring Norman D . Newell. Calgar y Universit y Press , Calgary, 1-45 . YANCEY, T . E. & STANLEY , G . D . 1999 . Gian t alatofor m bivalves i n th e Uppe r Triassi c o f wester n Nort h America. Palaeontology, 42, 1-23 . YONGE, C . M. 1978 . Introductory remarks. Philosophical Transactions of the Royal Society of London, Series 5,284,201. 1979. Cementation i n bivalves. In: VA N DER SPOEL, S., VA N BRUGGEN , A . C . & LEVER , J . (eds ) Pathways i n Malacology. Bohn , Scheltema , Holkema an d Junk, Utrecht, 83-106 .

This page intentionally left blank

Molecular phylogen y o f the Bivalvia inferred fro m 18S rDNA sequences with particular reference t o the Pteriomorphia GERHARD STEINE R & SABIN E HAMME R Institute of Zoology, University of Vienna, Althanstr. 14, A-1090 Vienna, Austria (e-mail: gerhard.steiner@ univie.ac.at) Abstract: Th e classificatio n o f th e Pteriomorphia , a majo r divisio n o f th e Bivalvi a wit h Ordovician origins, is controversial both among palaeontologists and neontologists. To elucidate phylogenetic relationships new near-complet e 18 S rDNA sequences of 26 Pteriomorphia, thre e Protobranchia, thre e Heterodonta, on e Anomalodesmata an d thre e Scaphopod a wer e obtained, aligned wit h 71 other published mollusca n sequences , an d analysed wit h parsimony, maximu m likelihood an d spectra l analysis . Althoug h Bivalvi a appea r diphyleti c du e t o heterogeneit y o f substitution rate s amon g lineages , monophyl y o f Protobranchia , Heteroconchi a an d Pteriomorphia i s supported . Th e heteroconc h Lucinida , Myoid a an d Venerid a ar e no t monophyletic, an d Anomalodesmata aris e fro m withi n Heteroconchia . Th e basa l node s o f Pteriomorphia have little support but two major clades, [Pinnoidea (Ostreoidea + Pterioidea)] and [(Anomioidea + Plicatuloidea) + (Limoidea + Pectinoidea)], ar e resolved wit h more confidence . The strongl y supporte d clad e o f Anomioidea + Plicatuloidea, th e separatio n o f Pinnoidea fro m Pterioidea an d most o f the intrafamiliar relationships ar e not in accordance wit h morphologica l classifications. Combinin g these results with selected morphologica l characters, a phylogenetic hypothesis i s proposed showin g Mytiloidea and Arcoidea a s the basal pteriomorph groups , the latter givin g ris e t o th e clad e unitin g th e pinnoid-ostreoid-pterioi d an d th e anomioid limoid-pectinoid lines.

Molecular character s ar e potentiall y usefu l fo r phylogenetic studies, their usefulness depending on the tim e pas t sinc e th e cladogenese s o r split s i n question. Nucleotid e sequence s characteristicall y provide hig h numbers , usuall y hundred s o r eve n thousands, o f character s o f littl e bu t equa l complexity. They form dat a set s independent fro m morphological dat a an d ar e subjec t t o differen t selective constraints: DNA sequences, especially of ribosomal genes , ar e less selecte d b y lifestyl e an d habitat tha n i s morphology . Thi s i s especiall y important an d neede d whe n man y morphologica l characters and their underlying homology decisions are equivoca l du e t o convergen t and/o r paralle l evolution, a s i s th e cas e i n th e Bivalvia . Thus , i t may b e expecte d tha t molecula r phylogeneti c studies o n bivalves , a group notorious for paralle l evolution, wil l provid e valuabl e insight s into th e branching pattern of its higher taxa. Sequences o f th e nuclear-encode d smal l ribosomal subunit , the 18 S rDNA, are particularly popular for studyin g relationship s amon g and within phyla (e.g. Riutort et al. 1993; Philippe e t al. 1994; Winnepenninck x et al 1994 , 1996 ; Macke y et a l 1996 ; Aguinald o e t a l 1997) . Th e mai n reason fo r thi s popularit y o f thi s gene , a s

summarized b y Winnepenninck x et a l (1994) , i s the alternatio n o f variabl e an d highl y conserve d sequences, facilitatin g amplificatio n an d providing phylogenetic informatio n fo r variou s systemati c levels. The first bivalve 18S rDNA sequences were used for investigations o f relationships o f Mollusc a to other phyla and among molluscan classes (Fiel d et a l 1988 ; Winnepenninck x e t a l 1994 , 1996) . Studies o n bivalv e phylogen y inferre d fro m 18 S rDNA wer e initiate d b y Littlewoo d e t a l (1991) , Rice e t a l (1993 ) an d Kenchingto n e t a l (1994 , 1995), focusin g o n th e familie s Ostreidae , Mactridae, Pectinida e an d Mytilidae . Furthe r complete sequence s were included i n the analyses by Steiner & Mueller (1996), Frischer et al (1998) , Maruyama et al (1998 ) an d Canapa e t al (1999) , whereas Adamkewicz et al (1997 ) and Campbell et al (1998 ) relie d o n partial 18 S rDNA sequences. Monophyly o f th e Bivalvi a wa s unambiguously supported onl y b y th e analysi s o f Frische r e t a l (1998) and , i n a re-analysi s o f Steine r & Muelle r (1996), b y Giribe t & Carranza (1999 ) an d Steine r (1999). Al l othe r analyse s showe d Gastropod a o r Polyplacophora separatin g Pteriomorphi a fro m Heteroconchia. One reason for this unconventional topology wa s attributed to higher substitutio n rate s

From: HARPER, E. M, TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177, 11-29 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y o f London 2000.

12

G. STEINE R & S . HAMME R

in the heterodont and gastropod branches by Steiner & Mueller (1996). However, their study also foun d the phylogenetic signa l fo r a bivalve clad e almos t equally strong as that for competing clades. There ar e considerabl e discrepancie s i n th e molecular studies also in regard to the relationships among th e highe r bivalv e taxa , althoug h protobranchs are generally the first bivalv e branch. Frischer et al. (1998), wit h a limited se t of species , show Pteriomorphi a a s siste r grou p t o th e Heterodonta. Adamkewic z e t al . (1997 ) an d Campbell e t al . (1998 ) presen t paraphyleti c Pteriomorphia wit h respec t t o th e Heterodont a o r Heteroconchia, albei t wit h differen t topologies . A clade of Ostreoidea, Pinnoide a and Pterioidea take s a basa l positio n i n th e tre e o f Adamkewic z e t al . (1997), th e Pectinoidea ar e the siste r grou p to th e Heteroconchia, an d th e anomalodesmata n specie s roots i n the basal polytomy. In contrast, Campbel l et al . (1998) , usin g a differen t specie s set , hav e the Pectinoide a a s th e firs t autobranc h clad e and a polytom y o f Pterioidea , Ostreoide a an d Heterodonta, excludin g th e Pinnoidea . Further more, Adamkewicz et al. (1997) found n o support for th e heteroconc h group s Anomalodesmata , Veneroida and Myoida nor for the Protobranchia . The presen t stud y focuse s o n th e phylogeneti c connection o f th e Pteriomorphi a t o th e othe r bivalve tax a an d o n th e relationship s amon g th e major pteriomorph groups. Pteriomorphia appea r in the fossil recor d no later than the early Ordovician period, wher e mytiloid , arcoi d an d pterioi d forms are als o recognized . Thes e group s experience d periods o f radiatin g diversificatio n i n th e Lat e Devonian and both in the beginning and at the end of th e Mesozoi c (Carte r 1990) . Simila r t o th e molecular studies , phylogeneti c hypothese s base d on morphologica l evidenc e diffe r considerabl y in the statu s o f th e Pteriomorphi a an d i n th e sister group relationships proposed. Figur e 1 summarizes five recentl y published hypotheses . Pteriomorphia appear monophyletic in Cope (1996), Waller (1998) and Morton (1996), althoug h the latter includes the Unionida. Polyphyleti c Pteriomorphi a ar e repre sented in Carter (1990), with separat e origin of the Mytiloidea, an d i n Starobogato v (1992) , wit h Unionida an d Heterodont a separatin g tw o pterio morph groups . Th e ai m o f thi s investigation is t o provide a databas e o f near-complet e 18 S rDN A sequences wit h a t leas t tw o representative s o f al l major pteriomorp h group s an d a t leas t on e o f th e Protobranchia, Heterodont a an d Anomalodesmat a as potential sister-grou p taxa . The tree(s) resultin g from phylogeneti c reconstructio n are expecte d t o elucidate siste r group relationships of the Bivalvi a (by th e inclusio n o f scaphopo d sequences) , th e origin of the Pteriomorphia a s well as relationships within Pteriomorphia . Thes e result s ca n subse -

quently be of aid in evaluating homology decisions of morphological characters .

Materials and Methods Most specimen s sequence d i n thi s stud y wer e collected i n Safag a Ba y (Re d Sea , Egypt) , Rovin j (Northern Adriati c Sea , Croatia ) an d Trondhei m Fjord (Norway), either by scuba diving or dredging. The specie s used for the phylogenetic analyses are listed i n Tabl e 1 wit h thei r EMBL/GenBan k accession number s (sequence s obtaine d herei n ar e in bold).

DNA Extraction Total DN A wa s extracte d fro m adducto r muscle, gills or , in smal l specimens , th e tota l sof t bod y of 30 bivalves (23 pteriomorph, three heterodont, on e anomalodesmatan an d thre e protobranc h species ) and three scaphopods. Minced tissu e samples wer e incubated for 2 h at 65°C in 0.2 mL of sterile water, 5% Chelex® 100 resin (Sigma), 25 uL of proteinase K (2 0 nig mLr 1), 1 0 uL RNAse A (0. 5 m g mL- 1) and 1 0 uL dithiothreito l ( 1 M) o n a shake r an d vortexed severa l time s fo r 5 s durin g incubation. Following centrifugatio n fo r 2 min a t 1 4 000 rpm, the remaining lysate was transferred to a fresh tub e and store d a t 4°C . Dependin g o n th e qualit y an d amount o f genomi c DNA , 1- 5 u L o r appropriat e dilutions o f th e sampl e lysat e wer e use d i n th e amplification procedure .

Polymerase Chain Reaction (PCR) Near-complete sequence s o f th e 18 S rDN A gen e were obtained by a direct PCR product-sequencing approach. In the first step , the complete 18 S rDNA was amplifie d usin g th e primer s F (5'-CC G AAT TCG TC G AC A AC C TG G TT G AT C CTG-3' ) and R (5'-CC C GG G AT C CAA GC T TG A TC C TTC TG C AG G TT C AC C TAC-3' ) (Steine r & Mueller 1996) . Th e PC R wa s performe d o n a Robocycler 9 6 Gradien t (Stratagene ) i n a 2 5 juL reaction mi x containing 1 mM MgCl2, each dNT P at 200 juM , each primer at 50 pM, 2. 5 units of TAQ polymerase (BioTherm , Genecraft) , an d th e supplied reaction buffe r a t x 1 concentration. Afte r an initia l denaturatio n ste p o f 2 min a t 94°C , fiv e PCR cycle s o f 4 0 s a t a 50° C annealin g temperature, 4 0 s at a 72°C primer extension , an d 40 s a t a 94° C denaturatio n wer e performed , followed b y 3 5 cycle s a t a 61° C annealin g temperature an d a fina l prime r extensio n ste p o f 10 min a t 72°C . In th e secon d step , a nested PC R was performe d t o amplif y tw o overlappin g 18 S rDNA fragment s o f 105 0 an d 90 0 bas e pai r (bp )

18S rDNA PHYLOGEN Y O F PTERIOMORPHIA 1

3

Fig. 1 . Comparison of five recently published morphology based phylogenetic hypotheses of pteriomorph relationships with the results obtained in the present study.

length using the tagged primer pairs: pair 1 : F*-T3 pM , primers F*-T3 and R*-T3 at 37.5 pM, 7.5 units (5'-att aa c cc t ca c ta a ag C AA C CT G GT T GA T o f TAQ polymerase (BioTherm, Genecraft), an d the CCT G-3' ) an d R2-STI 2 (5'-cg a tg a ag a ac g ca g supplie d reaction buffe r a t x 1 concentration. Each cgA GAA CTR CGA CGG TAT C-3'); pair 2: F2- o f the 35 PCR cycles consisted of 40 s at 94°C, 40 s STI2 (5'-cga tga aga acg cag cgT CAG AGG YTC a t 52°C and 60 s at 72°C, followed by a final primer GAA GAC G-3') an d R*-T3 (5'-att aac cct cac taa extensio n ste p o f 1 0 min a t 72°C . PC R product s agC CTT CTG CAG GTT CAC CTA C-3'). Lower wer e purified with either Cleanmix purification kit case letter s indicat e th e ta g sequence s (T 3 an d (Talent ) o r QIAquick-spi n PC R purificatio n ki t STI2). Neste d PC R wa s carrie d ou t i n a 7 5 uL (Qiagen) , and sequenced automatically with T3 and reaction mi x containin g 1 mM MgCl 2 eac h dNT P STI 2 sequencing primers on a LI-COR 4000 (VBCat 10 0 uM, primer s R2-STI 2 an d F2-STI 2 a t 7 5 GENOMIC S Bioscience Researc h GmbH) .

14 G

. STEINE R & S. HAMME R

Table 1 . Species used in the phylogenetic analysis Systematic positio n BIVALVIA Pteriomorphia Arcoidea Arcidae

Noetiidae Glycymerididae Mytiloidea Modiolinae Mytilinae

Lithophaginae Pinnoidea Pinnidae Pterioidea Pteriidae

Isognomonidae Malleidae Ostreoidea Gryphaeidae Ostreidae, Ostreina e Ostreidae, Lophina e Ostreidae, Crassostreina e Anomioidea Anomiidae Plicatuloidea Plicatulidae Limoidea Limidae Pectinoidea Spondylidae Pectinidae

Species

EMBL/GENBANK accession numbe r

Area noae Linne, 175 8 Acarplicata (Dillwyn , 1817 ) § Barbatia virescens (Reeve, 1844) Barbatia cancellaria (Lamarck, 1819 ) [p] Anadara ovalis (Bruguiere, 1789) [p] Striarca lactea (Linne, 1758 ) Glycymeris pedunculus (Linne , 1758 ) § Glycymeris sp .

X90960 AJ389630 X9197 AF022470, AF022471 L78852 AF120531 AJ389631 X91978

Modiolus auriculatus Krauss , 184 8 § Brachidontes variabilis (Krauss , 1848 ) § Septifer cf . bilocularis (Linne, 1758 ) § Mytilus galloprovincialis Lamarck, 1819 Mytilus californianus Conrad, 1837 Geukensia demissa (Dillwyn , 1817) Lithophaga lithophaga (Linne, 1758)

AJ389644 AJ389643 AJ389645 L33451 L33449 L33450 AF120530

Pinna muricata Linne , 175 8 § Atrina pectinata (Linne, 1767) Atrina rigida (Lightfoot, 1786 ) [p ]

AJ389636 X90961 L78850

Pteria macroptera (Lamarck , 1819 ) § Pteria hirundo (Linne , 1758 ) Pteria brevialata (Dunker, 1872) [p] Pinctada margaritifera (Linne , 1758 ) § Pinctada imbricata Roding, 1 798 [p] Electroma alacorvi (Dillwyn , 1817 ) § Isognomon legumen (Gmelin , 1791 ) § Isognomon alatus (Gmelin, 1791) [p] Malvifundus regulatus (Forsskal , 1775 ) § Vulsella sp. §

AJ389637 AF120532 L78849 AJ389638 AF022472, AF022473 AJ389641 AJ389639 AF022468, AF022469 AJ389640 AJ389642

Hyotissa cf . hyotis (Linne , 1758 ) § Hyotissa cf . numisma (Lamarck , 1819 ) • Ostrea edulis Linne, 175 8 Ostrea equestris Say , 183 4 [p ] Lopha cristagalli (Linne , 1758) § Crassostrea virginica (Gmelin, 1791 ) Saccostrea cucullata (Born , 1778) §

AJ389632 AJ389633 L49052 AF022466, AF022467 AJ389635 Z29549 AJ389634

Anomia ephippium Linne , 175 8 * Pododesmus caelata (Reeve , 1859) §

AJ389661 AJ389650

Plicatula plicata (Linn e 1767) §

AJ389651

§

Lima lima (Linne , 1758) Limaria hians (Gmelin, 1791 ) Ctenoides annulatus (Lamarck , 1819 ) §

AJ389652 AF120534 AJ389653

Spondylus erassisquamatus Lamarck, 181 9 • Spondylus hystrix Roding, 179 8 § Pecten maximus (Linne , 1758 ) Placopecten magellanicus (Gmelin, 1791 ) Flexopecten glaber (Linne , 1758 ) * Argopecten irradians (Lamarck , 1819 ) Chlamys islandica (Mulle r O.F., 1776 ) Chlamys hastata (Sowerby, 1843 ) Mimachlamys varia (Linne, 1758 )

AJ389646 AJ389647 L49053 X53899 AJ389662 LI 1265 L11232 L49049 L49051

15

18S rDNA PHYLOGEN Y O F PTERIOMORPHIA Table 1. Continued Systematic position

Protobranchia Solemyida Solemyidae Nuculida Nuculidae Nuculanidae Heteroconchia Unionida Unionidae Lucinida Lucinidae Ungulinidae Veneroida Veneridae

Tellinidae Arcticidae Corbiculidae Galeommatidae Cardiidae

Mactridae

Solenidae Myoida Myidae Corbulidae Pholadidae Hiatellidae Anomalodesmata Cuspidariidae CAUDOFOVEATA Limifossoridae POLYPLACOPHORA Ischnochitonina Chitonidae Ischnochitonidae Acanthochitonina Acanthochitonidae

Species

EMBL/GENBANK accession numbe r

Crassadoma gigantea (Gray , 1825 ) Exellichlamys spectabilis (Reeve , 1853 ) § Pedum spondyloideum (Gmelin , 1791 ) §

L49050 AJ389648 AJ389649

Solemya togata (Poli , 1795 ) * [p]

AJ389658

Nucula proxima Say , 182 2 [p ] Yoldia limatula (Say, 1831 ) [p ] Yoldiella nana (Sar s M., 1865 ) t Nuculana pella (Linne , 1767 ) *

AF022476, AF022477 L78848 AJ389659 AJ389665

Anodonta imbecilis Say, 182 9 [p ] Elliptio complanata (Lightfoot , 1786 ) [p ]

L78858 L78857

Cardiolucina semperiana (Issel , 1869 ) § Ciena divergens (Philippi , 1850 ) § Diplodonta cf . subrotundata Issel , 186 9 §

AJ389655 AJ389656 AJ389654

Venus verrucosa Linne, 175 8 Callista chione (Linne, 1758 ) Dosinia discus (Reeve, 1850) [p ] Mercenaria mercenaria (Linne, 1758 ) [p ] Donax variabilis Say, 182 2 [p ] Tellina versicolorDe Kay , 1843 [p ] Arctica islandica (Linne, 1767 ) Corbicula leana Prime, 186 4 [p] Divariscintilla yoyo Mikkelsen & Bieler, 198 9 [p ] Galeomma takii Kuroda, 194 5 Tridacna gigas (Linne, 1758 ) Tridacna squamosa Lamarck, 181 9 Hippopus hippopus (Linne , 1758 ) Hippopus porcellanus Rosewater , 198 2 Fragum unedo (Linne, 1758 ) Corculum cardissa (Linne, 1758 ) Vasticardium flavu m (Linne , 1758 ) Fulvia mutica (Reeve, 1844 ) Mactromeris polynyma (Stimpson , 1860 ) Mulinia lateralis (Say, 1822 ) Spisula solida (Linne, 1758 ) Tresus nutalli (Conrad, 1837 ) Ensis directus Conrad, 184 3 [p]

AJ007614 AJ007613 L78863 L78864 L78867 U93556 U93555 L78861 L78869 X91969 D84189 D84190 D84660 D84661 D84664 D88909 D88910 D88911 L11230 L11268 L11266 LI 1269 L78871

My a arenaria Linne, 175 8 [p ] Corbula contracta Say, 182 2 [p ] Cyrtopleura costata (Linne, 1758 ) [p ] Panopea japonica A . Adams, 185 0 [p]

AF022478, M20094, M21541,M21175, J03774 L78860 L78865 L78870

Tropidomya abbreviata (Forbes, 1843 ) ^

AJ389657

Scutopus ventrolineatus Salvini-Plawen, 196 8

X91977

Liolophura japonica (Lischke , 1873 ) Acanthopleura granulata (Gmelin , 1791 ) [p ] Lepidochitona corrugata (Reeve, 1848 ) [p ]

X70210 L78872 X91975

Crytptochiton stelleri (Middendorf, 1847 ) [p ]

L78873 Table 1 continued overleaf

16

G. STEINE R & S . HAMMER

Table 1 . Continued Systematic positio n

Species EMBL/GENBAN

K accession numbe r

GASTROPODA Neritopsina Neritidae Vetigastropoda Trochidae Caenogastropoda Nassariidae Tonnidae Calyptraeidae Gymnomorpha Onchidiidae CEPHALOPODA Coleoidea Loliginidae SCAPHOPODA Dentaliida Dentaliidae

Nerita albicilla Linne , 175 8 X9197

1

Monodonta labio (Linne, 1758 ) X9427

1

Nassarius siquinjorensis (A . Adams) = crematus (Hinds , 1844 ) X9427 Bursa rana (Linne , 1758 ) X9426 Crepidula adunca Sowerby , 182 5 X9427

3 9 7

Onchidella celtica (Cuvier , 1817 ) X7021

1

Loligo pealei Lesueur, 182 1 [p] n

o ace. numbe r

Antalis vulgaris (D a Costa, 1778 ) X9198 0 3 89660 Antalis inaequicostata (Dautzenberg , 1891) * AJ Dentalium bisexangulatum Sowerby , 186 0 § AJ38966 3 Dentalium laqueatum Verrill , 188 5 " AJ38966 4

Sequences obtaine d in this stud y are in bold. Partia l sequence s ar e indicated wit h [p] . * Greece, Mediterranean; t Trondhei m Fjord , Norway ; $ Northern Adriatic ; § Safaga Bay , Re d Sea ; I Charleston, South Carolin a

Sequence alignment, choice oftaxa and phylogenetic analysis The sequences obtaine d wer e aligne d t o publishe d ones usin g CLUSTAL W (Thompso n e t al 1994 ) with subsequen t manual adjustment i n DCS E (D e Rijk & D e Wachte r 1993) , takin g int o accoun t secondary structura l informatio n whe n possible . Nearly al l bivalv e 18 S rDN A sequences wer e included i n th e alignmen t t o achiev e a dens e taxonomic representation o f species, a s advised by Lecointre e t al . (1993) . Som e heteroconc h partia l sequences o f doubtfu l qualit y an d origi n wer e excluded [e.g . th e anomalodesmata n sequence s o f Adamkewicz e t al. (1997 ) tha t ar e clustering with the Gastropoda] . Onl y tw o specie s o f th e gener a Mytilus, Tridacna an d on e representativ e o f Fragum, an d eac h mactri d genu s wer e used . Because sequenc e divergence, branc h lengths an d resolution amon g thes e tax a are minimal , thi s helped reduc e th e numbe r o f tax a i n th e analyse s and computin g tim e withou t losin g valuabl e information. Al l availabl e pteriomorp h sequence s were include d coverin g mos t majo r groups . Unfortunately, n o representativ e o f th e Dimyida e was available for sequencing. Gastropod sequences were selecte d mainl y fro m th e streptoneura n grade. Thus , th e dat a se t include s 9 1 Bivalvi a

(five Protobranchia , 3 3 Heteroconchia , 5 3 Pteriomorphia), si x Gastropoda , fou r Scaphopoda , one Cephalopoda , fou r Polyplacophor a an d on e Caudofoveata, totallin g 10 7 species . O f these , 2 7 are represented b y partial sequences. The alignment and inpu t fil e i s availabl e b y anonymou s FT P from ftp.ebi.ac.uk/pub/databa.ses/embl/Silign as alignment fil e DS40811 . A relativ e rat e tes t fo r th e complet e 18 S rDNA sequences in the data set was made using the output of th e branc h lengt h tes t o f LINTR E (Takezak i e t al. 1995) . Th e mea n o f th e root-to-ti p distance s in a neighbour-joinin g tre e (usin g Scutopus ventrolineatus or Liolophura japonica a s outgroup) was calculated and the distribution of the individual differences fro m th e mean recorded fo r each taxon in question . Thes e value s wer e teste d b y non parametric test s (Kruskal-Walli s an d Mann Whitney-U-Test in SPSS fo r Windows 6.0.1; SPSS Inc.) and a permutation test [softwar e described i n Nemeschkal (1999)] . Parsimony an d maximu m likelihoo d wer e use d for phylogeneti c reconstructio n because the y both allow for the inclusion of partial sequences . Result s of neighbour-joinin g analyse s wit h th e near complete pteriomorp h sequences wer e simila r t o the othe r result s an d ar e no t shown . Unweighted parsimony analyse s wer e performe d wit h PAUP*

18S rDNA PHYLOGEN Y O F PTERIOMORPHI A

4.0b2 (Swofford 1998) unde r Windows 95 and with PAUP* 4d65 unde r UNIX . Th e hig h numbe r o f species mad e exhaustiv e an d branch-and-boun d searches unfeasible . Fo r th e heuristi c searche s uninformative characters were excluded, gaps were treated a s missin g an d Scutopus ventrolineatus (Caudofoveata) wa s use d a s outgroup . The searc h strategy consiste d o f a n initia l searc h wit h 5 0 random taxo n additio n sequences , TB R branc h swapping, MULPAR S optio n i n effect, n o steepes t descent, keepin g 10 0 mos t parsimoniou s tree s (MPT) o f each replicate. This search wa s repeated three times with different rando m seed numbers. In the second step , all MPT and trees up to 1 % longe r than th e MP T wer e submitte d t o TB R branc h swapping t o fin d al l MPT . Becaus e th e overal l transition/transversion rati o wa s foun d t o b e onl y slightly > 1 , no weighted parsimony searches were made. Bremer suppor t indice s (Breme r 1988 , 1994 ) were calculate d fo r th e stric t consensu s tre e t o assess robustness of each branch in PAUP* usin g a batch fil e produce d b y Tree-Rot (Sorense n 1996 ) with te n rando m additio n sequence s an d keepin g 100 trees per replicate fo r each search . The Breme r support index (or decay index) gives the number of additional step s neede d t o collaps e a clade . Bootstrap value s wer e calculate d fo r th e pteriomorph subtree . The y ar e derive d fro m 100 0 bootstrap replicate s wit h fiv e rando m taxo n addition sequences , TB R branc h swapping , keeping 5 0 mos t parsimoniou s trees . I t shoul d b e pointed ou t tha t th e hig h proportio n (c . 25% ) o f partial sequence s i n th e alignmen t ma y affec t both measure s o f suppor t fo r th e concerne d nodes. For the maximum-likelihood analyses (ML) both PAUP* andfastDNAml 1.0.6 (Olse n e t al. 1992 ) were used . Th e larg e dat a se t an d a limitatio n i n computer resource s force d eliminatio n o f tre e building b y stepwis e addition . Instead , th e stric t consensus tree wa s used as the startin g tree for the calculation o f M L parameter s an d subsequen t branch swapping . In PAUP*, empirica l nucleotid e frequencies wer e used , an d th e value s fo r th e transition/transversion ratio , proportio n o f invari able site s an d gamm a shap e paramete r wer e estimated unde r th e Hasegawa-Kishino-Yan o (HKY85) mode l wit h rat e heterogeneit y an d fou r categories o f substitutio n rates following a gamma distribution. The resulting values were then se t for the nearest-neighbou r interchang e (NNI ) branc h swapping. Thi s procedur e wa s iterate d a s lon g a s better tree s wer e found . Th e option s se t fo r fastDNAml include d the use of empirical nucleotide frequencies, a transition/transversio n rati o o f 1. 2 (as estimate d i n PAUP*), fou r categorie s o f substitution rate s (0.5 , 1 , 2 an d 4 ) an d tre e

17

rearrangements crossin g fiv e branches . Eac h alignment position wa s assigned t o a rate categor y manually by the following criteria: categor y 1 , site s with n o mor e tha n tw o specie s havin g a substitution; categor y 2 , n o mor e tha n thre e different nucleotide s an d substitutions , mainl y among famil y groups ; categor y 3 , al l nucleotide s present, substitutions also within families; categor y 4, hypervariabl e regions , singl e o r multipl e insertions/deletions. As arbitrar y a s this procedur e is, it reflects the bes t estimat e o f substitutio n rates and yield s tree s wit h bette r M L score s tha n b y using uniform rates. The ML trees obtained by both programmes wer e mutually tested and submitted t o branch swapping in an iterative way until no furthe r improvement wa s achieved . I n additio n t o th e complete dat a set, subset s containin g onl y Arcoidea, Pectinoidea , Pinnoidea , Pterioide a an d Ostreoidea (eac h wit h th e neares t outgrou p species), an d Pteriomorphia + Protobranchi a wer e used in both parsimony and ML analyses (includin g stepwise addition ) t o chec k th e influenc e o f th e number o f outgrou p organism s o n th e topology . Resulting tree s wer e handle d wit h TREEVIEW (Page 1996) . The program s PREPARE an d HADTREE (Hendy & Penn y 1993 ) wer e use d fo r spectra l analysis o f th e Pteriomorphi a usin g th e sam e settings a s in Steiner (1999) , i.e . recodin g th e data to two-state characters and the 'sum of 7' option for calculating th e frequencie s o f splits . Becaus e th e number o f specie s i s limite d t o 2 0 i n thes e programs, onl y tw o specie s wit h complet e sequences o f each famil y grou p wer e include d b y chosing th e leas t an d the mos t derived one s i n the ML tree. The protobranch Yoldiella nana was used as outgroup.

Results The 18 S rDN A sequence s obtaine d i n thi s stud y range i n length fro m 168 7 (Flexopecten glaber) t o 1929 (Ctenoides annulatus) bas e pairs , excep t fo r Solemya togata wher e onl y a 778 bas e pair s lon g fragment o f th e 3 ' en d coul d b e sequenced . Thi s species i s nevertheles s include d i n th e analyse s because it is the onl y solemyi d sequenc e availabl e clustering wit h bivalves . Th e alignmen t wit h th e other mollusca n sequence s submitte d t o th e phylogenetic analyses has 202 6 position s o f which 875 are parsimony informative. The distribution of tree length s of on e millio n rando m trees i s highly skewed wit h a g j inde x o f -0.74 fo r the complet e data se t an d -0.6 0 fo r th e Protobranchi a + Pteriomorphia subset . Thi s indicate s a highl y hierarchical dat a structur e bot h fo r th e complet e data and the subset .

18

G. STEINE R & S . HAMMER

Relative rate test The relativ e rate s ar e expresse d i n Fig . 2 b y th e difference fro m th e averag e branc h lengt h i n a NJ tree. Pteriomorphi a hav e th e lowes t rates i n thi s data set and differ significantl y (p < 0.05) both fro m the Heteroconchia an d all other outgroups . Amon g the Bivalvi a onl y th e tw o protobranc h sequences show simila r rate s t o th e fastes t pteriomorphs , th e Limidae. Althoug h Pteriomorphi a ar e represente d by 46 sequences, their range of rates is very small, especially whe n compared t o the Heteroconchia .

Relationships of higher taxa The parsimon y analysi s returne d 3057 1 MP T o f 4617 step s (C I = 0.376 , RC I = 0.259) . Th e stric t consensus tree (Figs 3 and 4) is one of the MPT and fairly wel l resolved , althoug h th e dee p node s especially have low support indices. Monophyly of the Bivalvia i s not supporte d a s the Heteroconchi a are separate d fro m th e Protobranchi a +

Pteriomorphia clad e b y th e Gastropod a an d th e Polyplacophora. Th e partia l sequenc e o f Loligo clusters wit h th e gastropo d Monodonta. Th e Scaphopoda appea r paraphyleti c a t the bas e o f th e tree wit h Dentalium laqueatum joinin g th e caudofoveat outgroup . Excep t fo r Yoldiella an d Nuculana, th e Protobranchi a for m a n unresolve d polytomy wit h th e pteriomorp h clade . Th e Unionida ar e th e siste r grou p t o th e remainde r o f the Heteroconchi a clade . Th e famil y grou p tax a Galeommatidae, Lucinidae , Tridacnida e an d Mactridae ar e monophyleti c wit h hig h branc h support betwee n 8 an d 60 . Monophyl y o f Veneridae, Donacida e an d Cardioidea i s supporte d with Bremer indices from 2 to 4, whereas the orderlevel tax a Lucinida , Venerid a an d Myoid a ar e polyphyletic. Th e branche s connectin g th e famil y group taxa generally hav e little support ( 1 or 2) and are unstabl e with respec t t o th e M L analysi s (se e below). Only the Cardioide a + Tridacnidae branch and th e sister-grou p relatio n o f Myida e an d Corbulidae are robust.

Fig. 2 . Relative rate test comparing th e differences fro m the mean root-to-ti p distance (ordinate ) in an NJ tree with Liolophura japonica a s outgroup by taxonomic grou p (abscissa ) usin g LINTRE. Pteriomorphi a have significantl y lower value s (p < 0.05) tha n both Heteroconchi a alon e an d all outgroup organism s pooled . The pteriomorp h outlier s (circles) correspon d t o the three specie s o f the Limidae an d Lopha cristagalli (Ostreidae ) wit h the highest substitutio n rates.

18S rDNA PHYLOGEN Y O F PTERIOMORPHIA 1

9

Fig. 3 . Strict consensus tree and one of the 30 571 most parsimonious trees (length = 4617, C I = 0.376, RC I = 0.259) found by unweighted parsimony using a heuristic searc h with 50 replicates o f random sequenc e additio n an d TBR branch swapping. The pteriomorph subtre e is shown in detail in Fig. 4. Bremer support indices are indicted abov e the branches.

The branc h o f th e Pteriomorphi a ha s th e sam e Pinnoide a an d Mytiloidea , an d a clad e unitin g support (Breme r inde x 2) as tha t of the Pterioide a and Ostreoidea . As in the heteroconc h Heteroconchia. I t split s u p int o tw o lines : on e clade , th e highes t branc h suppor t value s ar e consists o f th e Arcoide a a s th e basa l branc h detecte d fo r som e o f th e famil y ran k taxa . followed b y a clade of Anomioidea an d Plicatula, Mytiloidea , Anomioidea , Limoidea , Spondylida e being the sister group to Limoidea an d Pectinoidea. an d Pectinida e hav e suppor t indice s o f betwee n 8 The secon d lin e show s a trichotom y o f th e an d 12 , an d bootstra p value s o f > 97; Arcoidea ,

20 G

. STEINE R & S. HAMME R

Fig. 4. Pteriomorph subtre e of the strict consensus tree, continuin g from th e subtree of the outgroup species i n Fig. 3. Bremer support indices are indicted above, and bootstrap values below, the branches.

Ostreioidea an d Pectinoidea ar e intermediate, wit h highes t scor e o f th e entir e pteriomorp h par t o f th e support indice s o f 3- 4 an d bootstra p value s tree . In contrast t o the Heteroconchia, however, all between 78 and 100 . Pinnoidea and Pterioidea have interna l pteriomorp h branche s ar e als o presen t i n branch suppor t indice s o f 2 an d 1 , an d bootstra p th e ML tree . values o f 8 2 an d 74 , respectively . Again , interna l Th e M L tre e (Fig s 5 an d 6 ) ha s lo g likelihoo d branches connectin g thes e famil y group taxa hav e value s o f -26224.8105 5 i n PAUP* an d low suppor t an d bootstra p values , th e exceptio n -2 6 510.05 3 72 in fastDNAml Althoug h its overall being th e clad e o f Plicatula an d th e Anomioide a topolog y is similar to the strict consensus tree, there with a n index o f 1 3 and ful l bootstra p support , the ar e difference s bot h i n th e relationship s o f th e

18S rDNA PHYLOGEN Y O F PTERIOMORPHIA 2

1

Fig. 5 . Maximum likelihood (ML ) tree found by PAUP* (lo g L = -26 224.81 0 55 ) and fastDNAml (log L = -2 6 510.053 72). Details on the search strategy are given in the text. For better readability the lengths of the marked branches are reduced by a factor 1. 5 in Dentalium laqueatum and Tropidomya abbreviata, and by factors 2 or 4 in the Tridacnidae an d Cardiidae, respectively . Thi s is the subtree o f the outgroup specie s to the Pteriomorphia. The pteriomorph subtre e is shown in detail in Fig. 6.

major mollusca n group s an d withi n th e Anomalodesmat a an d Myoida . Tropidomya an d Heteroconchia an d Pteriomorphia . Th e analysi s Panopea ar e th e siste r grou p o f th e Galeom yields monophyleti c Scaphopod a an d Gastropod a matidae . Cyrtopleura i s clos e t o th e Myida e + with Loligo her e bein g closes t t o th e outgroup . Corbulida e clad e forming a paraphyletic group to a Protobranchia for m a clad e containin g mono - par t of the Veneroida an d Lucinida . phyletic Nuculanidae . Th e difference s i n th e Th e M L topolog y fo r th e pteriomorp h famil y Heteroconchia clad e concern th e position of Ensis, group s i s th e sam e a s i n th e parsimon y stric t now a t the base of the Heterodonta, a s well a s the consensu s tree, except for resolving the trichotomy

22 G

. STEINE R & S. HAMME R

Fig. 6 . Pteriomorph subtre e of the maximum likelihood tree, continuing from th e subtree of the outgroup species in Fig. 5.

by connectin g the Pinnoidea a s the siste r grou p to complet e pteriomorp h sequence s onl y (result s no t the Pteriodea + Ostroidea clade . Analyses with the shown ) agre e wit h thes e result s i n regar d t o th e subsets Pteriomorphi a + Protobranchi a an d wit h Anomioide a + Plicatuloidea bein g th e siste r grou p each o f th e famil y group s yiel d identica l results , t o Limoidea + Pectinoidea, i n clustering Ostreoide a although th e estimation s o f parameter s fo r th e t o Pterioidea , an d t o ver y shor t branc h length s o f transition/trans version ratio, proportion o f invariant th e basa l clades . Difference s concer n th e sites an d gamm a shap e diffe r fro m th e analysi s of Mytiloide a an d th e Ostreoide a + Pterioide a clad e the complete dat a set. formin g th e basa l branche s o f th e Pteriomorphi a Neighbour-joining analyse s (HKY8 5 model , varyin g in order according to the parameter used in gamma distribute d rat e heterogeneity ) wit h th e th e analysis . Th e positio n o f th e Pinnoide a als o

18S rDNA PHYLOGENY OF PTERIOMORPHIA

varies bu t neve r cluster s wit h th e Ostreoide a + Pterioidea clade. Spectral analysi s fo r selecte d pteriomorp h species (Fig . 7 ) rank s th e signal s (frequenc y o f occurrence o f a spli t minu s normalized frequenc y of conflictin g splits ) fo r th e famil y grou p tax a highest, a s coul d b e expected . Ther e ar e tw o exceptions: th e node of Anomioidea + Plicatula as the mos t robus t nod e unitin g differen t famil y groups take s ran k 4 , thu s bein g bette r supporte d than th e Anomioidea ; th e Pectinoide a (ran k 66) , represented b y Spondylus hystrix, Placopecten magellanicus an d Argopecten irradians, shows the weakest signa l of th e famil y grou p taxa, and eve n of al l node s foun d i n th e stric t consensus and M L trees. However , it als o ha s ver y lo w conflict . The other branches connecting family group s take ranks 11 (Ostreoide a + Pterioidea) , 2 0 (Ostreoide a + Pterioidea + Pinnoidea) , 3 9 (Pectinoide a + Limoidea) an d 5 5 (Pectinoide a + Limoide a + Anomioidea + Plicatula). Th e numerou s node s i n between ar e mostly thos e unitin g single specie s o f either Limoide a o r Ostreoide a t o othe r familie s which ca n b e explaine d b y th e hig h conflic t o r noise fo r thes e tw o groups . Som e o f th e node s i n this are a that are not i n the ML tre e (no t indicated in Fig . 6 ) represen t th e stronges t signa l fo r connecting th e Mytiloide a an d Arcoide a t o othe r family groups . Nod e 2 7 link s Mytiloide a wit h Ostreoidea an d Yoldiella, nod e 3 8 unites Arcoide a

23

and Pterioidea, nod e 42 Arcoidea with Anomioidea and Plicatula, an d nod e 5 0 Arcoide a wit h Mytiloidea an d Pinnoidea. Th e latte r i s o f interes t because it is also present in some of the neighbourjoining trees an d underlines th e separated origi n of the Pinnoidea an d Pterioidea. The clade connectin g these two groups ranks only 87.

Relationships within pteriomorph family groups (Figs 4 and 6) The results for those pteriomorph groups with more than thre e specie s i n th e dat a se t ar e reporte d i n detail. Arcoidea. I n both analyses , Area noae is the basa l offshoot i n the arcoid tree , an d the Arcidae ar e not monophyletic. Th e stric t consensu s tre e show s Arcidae paraphyleti c t o th e siste r group s Striarca lactea (Noetiidae) an d Glycimerididae, wherea s the ML tre e root s thes e familie s withi n th e Arcidae . The basa l positio n o f Area noae ha s th e highes t Bremer support of all arcoid internal branches. Mytiloidea. Th e representative s o f th e Modiolina e and Lithophagina e appea r ancestra l t o th e monophyletic Mytilinae . Althoug h branch suppor t is low, both parsimony and ML analyses return the same topology. Geukensia and Brachidontes are the

Fig. 7 . Spectral analysis o f selected pteriomorph species. Histogram o f support (positiv e values o n ordinate) and corrected conflict (negativ e value s o n ordinate) for splits (abscissa) in the alignment wit h ne t signal > 0, ranked by net signal (signa l minus conflict). Shaded bar s indicat e node s present i n the ML tree. Specie s selected fo r each taxon : Ostreoidea = Hyotissa hyotis + Lopha cristagalli; Pterioidea = Pteria hirundo + Malvifundus regulatus; Mytiloidea = Modioilus auriculatus + Geukensia demissa', Arcoide a = Area noae + Glycymeris pedunculus', Pinnoide a = Atrina pectiniata + Pinna muricata; Pectinidae = Placopecten magellanicus + Argopecten irradians, Pectinoidea = Pectinidae + Spondylus hystrix', al l species of Anomioidea and Limoidea in the data set .

24

G. STEINE R & S . HAMME R

sister group to the clade of Septifer an d Mytilus tha t is characterize d b y exceptionall y hig h suppor t values. Ostreoidea. Th e sister-grou p relationshi p o f Gryphaeidae an d Ostreida e i s supporte d b y hig h bootstrap values, although the Bremer index for the ostreid branc h i s low . Th e resolutio n withi n th e Ostreidae is poor, resulting in a polytomy of all five species i n th e stric t consensu s tree an d ver y shor t internal branc h length s i n th e M L tree . However , the ML tree recover s th e genu s Ostrea a s a clade . The subfamily Crassostreinae appear s polyphyleti c with Crassostrea a t th e bas e o f th e clad e an d Saccostrea clustering with Lopha. Pterioidea. This taxon name is used here in a sense excluding th e Pinnoidea . O f th e thre e pterioi d families treate d i n thi s dat a se t onl y Isognomonidae, represente d b y tw o Isognomon species, appea r monophyletic , wherea s bot h Pteriidae an d Malleida e ar e polyphyletic . Th e genus Plena forms a paraphyletic stem group of the Pterioidea i n th e M L tree . Th e tw o specie s o f Pinctada ar e recovered a s a clade by ML onl y an d not se t in clos e relationshi p t o Pteria. The pterii d Electroma alacorvi cluster s wit h th e mallei d Vulsella a s th e siste r grou p o f Pinctada. Wit h Malvifundus rootin g jus t abov e th e Pteria grade , this render s Malleida e polyphyletic . Branc h support i s lo w withi n th e Pterioidea , th e mos t robust clad e being that of Electroma and Vulsella. However, the topologies of the parsimony and ML analyses are very similar. Pectinoidea. The two Spondylus specie s comprise a well supporte d siste r grou p t o th e Pectinidae . Branch suppor t value s withi n th e Pectinida e ar e low bu t th e topolog y o f parsimon y an d M L tree s are compatible. Crassadoma and Placopecten take the basa l positio n i n th e pectini d subtree . Th e branching patter n o f th e Chlamys specie s an d Pedum a t th e bas e o f th e remainin g pectinid s i s unresolved i n th e stric t consensu s an d marke d b y very shor t branc h length s i n th e M L tree . Whil e Mimachlamys varia is part of this assemblage in the ML tree the suppor t value of 2 connects it more to the to p par t of the tre e b y parsimony criteria. Th e top par t consist s o f a grade d serie s o f Excellichlamys, Pecten, Argopecten an d Flexopecten.

Discussion Potential limits of methods The dat a se t an d phylogeneti c analysi s presented here is one o f the largest of bivalve 18 S sequences

and the largest of pteriomorph species published to date, an d considerabl e significanc e o f th e result s can b e expected . However , a numbe r o f methodological limitation s an d know n potentia l sources o f erro r mus t b e heede d t o evaluat e th e results adequately. The alignment is a difficult ste p in the analysis of the 18 S rDN A gen e du e t o th e variation s i n sequence length in certain loop regions. This results in many alternative alignments of which only a few were tested. Informatio n about secondary structur e can b e o f assistanc e bu t i s i n itsel f ambiguous . If , for example , on e en d o f a ste m ha s a conserve d sequence o n on e stran d an d substitution s o n th e other strand , th e loo p i s elongate d relativ e t o th e stem in the specie s concerned . Alignin g strictl y t o secondary structur e yield s a les s parsimoniou s alignment in this case . Dense taxonomi c samplin g should improv e alignmen t qualit y a s intermediat e forms are expected t o connect the extremes. Thi s is one o f th e reason s wh y th e partia l sequence s ar e included in the data set. The low overall transition/transversion (s/v) ratio of 1. 2 indicate s a certai n saturatio n o f observe d distances, as was already shown with a smaller data set (Steine r & Muelle r 1996) . Th e erosio n o f th e phylogenetic signa l b y multipl e substitution s concerns mostl y ancien t speciatio n events . Th e deep node s ar e consequentl y no t wel l supporte d and nee d t o b e viewe d wit h greate r cautio n tha n nodes higher up in the tree. O n the other hand, the low overall s/v parameter estimated by and for ML analyses coul d lea d t o erroneou s topologie s i n younger clades where the observed parameter value is muc h higher . Severa l analyse s wit h subset s o f pteriomorph families yield the same topology as the entire set . However , th e tre e topolog y o f thes e speciation event s depends less on the s/v parameter and more on the outgroup. Another potential sourc e of error i s the strategy of the tree search in the computationally demanding ML analysis of this large data set. Taking the strict consensus tre e o f th e parsimon y analysi s a s th e starting tree an d allowing rearrangement s crossin g not mor e than five branches , significantl y narrows the tree space covered by the search. That this range of branc h swappin g ca n alte r an d optimiz e a tre e considerably i s demonstrate d b y th e remova l o f Loligo pealei fro m withi n th e gastropod s i n th e strict consensu s t o a positio n betwee n th e caudofoveat outgrou p and th e scaphopods . I n an y case, th e swappin g rang e i s sufficientl y wid e t o check o n al l topologica l variation s o f th e majo r molluscan classes and subclasses represented i n the study. A frequentl y encountere d problem i s th e 'long branch attraction ' effec t causin g parsimon y an d distance algorithm s t o cluste r distantl y relate d

18S rDNA PHYLOGEN Y O F PTERIOMORPHI A

species o r clades, either because they share a higher substitution rat e tha n th e remainin g lines , increasing thei r rando m sequence s similarities , o r because th e lon g undivide d branche s bea r a hig h number of unobservable multiple hits (Swoffor d e t al. 1996) . Th e hig h degre e o f similarit y o f th e parsimony an d ML results indicates that the 'long branch attraction ' i s no t a n importan t proble m i n the analysis . Th e tax a wit h th e longes t branche s (Cardiidae an d Tridacnidae , Tropidomya abbreviata, Dentalium laqueatum, Monodonta labio) ar e foun d i n th e outgroups , whil e Pteriomorphia hav e shorte r tha n averag e branc h lengths. The error expected to be introduced by the partial sequences i n th e dat a se t (c . 25 % o f th e species ) seems t o b e o f littl e significanc e judge d b y thei r systematically orthodo x positio n i n th e tree s i n most cases . Congener s o f Glycymeris, Atrina, Ostrea, hognomon and Pinctada, represented b y a complete and partial sequence, are monophyletic, at least in the ML tree. Only the genera Barbatia and Pteria d o no t for m clades , althoug h Pteria i s represented b y tw o complet e sequences . Mor e problematic ar e th e systematicall y questionabl e positions o f Loligo pealei an d Ensis directus, two of th e shortes t sequence s used , varyin g greatl y among th e analyses . Thes e finding s nee d confirmation b y mor e an d mor e complet e sequences of the respective taxa.

Relationships of higher taxa The siste r grou p o f Bivalvi a remain s obscure , partly du e t o thei r apparentl y diphyleti c origin . None o f th e conchifera n group s ar e clos e t o the Protobranchi a + Pteriomorphi a clade , an d Heteroconchia stan d isolated between Scaphopod a and Gastropoda . Thus , a siste r grou p o f Bivalvi a and Scaphopod a (e.g . Salvini-Plawe n & Steine r 1996) is not supported here. Monophyletic Bivalvi a are difficul t t o resolv e wit h th e 18 S rDN A (Kenchington et al 1994 ; Steine r & Mueller 1996 ; Winnepenninckx e t al . 1996 ; Adamkewic z e t al . 1997; Campbel l e t al . 1998) , althoug h Steine r & Mueller (1996 ) foun d th e phylogeneti c signa l fo r Bivalvia to be only slightly weaker than conflicting ones. I t wa s shown , however , b y Frische r e t al . (1998) an d Giribe t & Carranz a (1999 ) tha t alignments yieldin g bivalv e monophyl y d o exist . However, Steine r (1999 ) demonstrate d tha t th e alignment o f Giribe t & Carranz a (1999 ) support s the bivalve clade only by a single non-homoplastic position. A commo n featur e o f th e tree s wit h monophyletic Bivalvi a is the para- or polyphyly of Pteriomorphia wit h Ostreida e joinin g th e heterodont branch . However , i n Frische r e t al . (1998) bot h Pteriomorphi a an d Heterodont a form

25

clades bu t Ostreida e ar e th e firs t pteriomorp h offshoot. Apparen t bivalv e polyphyl y i s caused b y separate origi n o f th e Pteriomorphi a an d Heterodonta and/o r Solemya velum clustering wit h the gastropods (Adamkewic z e t al. 1997 ; Campbel l et al. 1998). In the latter cases, this seems due to an aberrant sequenc e o f thi s Solemya species , a s S . togata i n th e present stud y clusters wit h the othe r Protobranchia. A reason fo r the autobranch group s not t o cluste r ma y b e thei r difference s i n substi tution rate s a s suspecte d b y Steine r & Muelle r (1996). The relative rat e tes t showin g pteriomorp h substitution rate s t o b e significantl y lowe r tha n those of the other molluscan groups, and that of the Heteroconchia i n particular , corroborate s thi s explanation. Th e homogeneit y o f rate s amon g th e Pteriomorphia i s remarkabl e an d lend s additiona l weight to the significance o f these results . All analyse s presente d her e indicat e mono phyletic Pteriomorphi a an d Heteroconchi a (Heterodonta + Anomalodesmata) . Th e Proto branchia clad e i s supporte d i n th e M L tre e only . The result s fo r th e Heteroconchi a confir m th e findings o f Adamkewic z e t al . (1997 ) showin g Unionida a s the basal branch, polyphyly of Myoida and Venerida , an d generall y littl e suppor t fo r internal nodes . No t i n agreement i s the position o f the Anomalodesmata : instea d o f joinin g th e gastropod branch, Tropidomya abbreviata emerges from withi n th e Heterodont a togethe r wit h th e hiatelloid Panopea a s siste r grou p t o th e Galeommatidae. Thus , i f th e probabl y artificia l position o f Ensis is not taken into account, the basal heterodont lineag e consist s o f th e Lucinidae , Galeommatidae, Hiatellida e an d Cuspidariidae . This i s a n extraordinar y taxonomi c mi x bu t corroborates McAleste r (1966 ) an d Morton (1996 ) in regar d t o th e ancien t origi n o f Lucinidae an d Galeommatidae. It also agrees with Morton (1996) , Salvini-Plawen & Steiner (1996 ) and Waller (1998 ) on th e heterodon t root s o f th e Anomalodesmata , although onl y wit h a par t o f th e Myoida . O n th e other hand , th e wid e separatio n o f th e ungulini d Diplodonta fro m th e Lucinida e challenge s al l systematic concepts. From these results , it appear s highly unlikel y tha t an y o f th e Heteroconchi a lines i s a candidat e fo r a siste r grou p o f th e Pteriomorphia.

Pteriomorph relationships The Pteriomorphi a ar e supporte d a s a clad e i n al l analyses i n a simila r wa y t o th e Heteroconchia , both i n term s o f Breme r indice s an d o f branc h length in the ML tree. However, the basal node s of the pteriomorp h tre e ar e no t wel l supporte d an d have to be taken cum grano salts. Two major clade s showing stabilit y i n th e analyses , i n tha t al l

26

G. STEINE R & S . HAMME R

algorithms converge on the same topology, though with low branch support, are the lines of (Pinnoide a [Pterioidea + Ostreoidea) ] an d [(Anomioide a + Plicatuloidea) + (Limoidea + Pectinoidea)]. Among these, th e positio n o f th e Pinnoide a varie s most , suggesting a n origi n a s ancien t a s tha t o f th e Arcoidea an d Mytiloidea , lendin g suppor t t o Starobogatov's (1992 ) concep t o f a n earl y separation o f thi s lin e fro m th e othe r Pteriomorphia. Among the hypotheses shown , only Carter (1990 ) consider s a non-monophyl y o f Pinnoidea an d Pterioidea. Non e o f th e hypothese s depicted i n Fig. 1 are full y supported , instead thi s study corroborate s certai n grouping s i n eac h o f them. The specie s se t used for this study contains only single representative s o f man y pteriomorp h families an d som e ar e no t represente d a t all . Th e results, therefore , permi t onl y restricte d inferenc e of intra family relationships. However , it is striking that the Arcidae an d Pteriidae a s the basal families of thei r respectiv e famil y group s appea r para - o r even polyphyletic. The pterioid family Malleidae is also no t supported , wit h Vulsella an d Malvifindus being clearl y separate d o n th e tree . Th e commo n origin o f Gryphaeida e an d Ostreida e i s strongl y supported, contradictin g th e view s o f Stenze l (1971) an d Carte r (1990) . Resolutio n withi n th e Ostreidae i s no t satisfactor y wit h th e 18 S rDNA, paralleling the finding s wit h 28S rDNA sequences (Littlewood 1994) . Th e branchin g orde r o f subfamilies in the Mytiloidea has Modiolinae a s the basal lin e followe d b y Lithophagina e an d Mytilinae. Withi n th e Mytilinae , Septifer an d th e Mytilus specie s ar e se t of f fro m Geukensia an d Brachidontes specie s b y a strongl y supporte d an d comparatively lon g branch . This i s no t congruent with th e recen t result s o f comparativ e sper m morphology (Kafano v & Drozdo v 1998) , suggesting a close r relationshi p o f Brachidontes and Septifer. Th e pectinid topology recovere d her e differs i n one aspect fro m th e one in Frischer e t al (1998). Th e clade of Crassadoma an d Placopecten is confirmed but instea d of being derive d fro m th e Chlamys + Mimachlamys group s it takes the basal position in the pectinid tree. Instead, the Chlamys + Mimachlamys group s give rise to the Decatopecten - Pecten - Aequipecten groups . Th e difference in branching sequence ma y be attributed to the rather distant outgrou p (Crassostrea o r Geukensia} Frischer e t al. (1998 ) used . This demonstrate s th e importance o f usin g no t to o distantl y relate d outgroups in molecular studies as the resulting long branches connecting it to the ingroup may bear 's o many change s tha t th e sequence s hav e becom e effectively randomized ' (Swoffor d e t al . 1996 , p . 478). Th e presen t topolog y lend s suppor t t o th e systematic schem e o f Walle r (1991) , derivin g th e

pectinoid shell morphology with more or less equal size o f shel l auricle s fro m th e chlamydoi d form with pronounce d unequa l auricle s (Frische r e t al . 1998), althoug h Walle r (1991 ) propose d tha t thi s occurred independentl y i n the Aequipecten group .

Morphological aspects and proposed phylogeny Morphological character s importan t fo r relation ships amon g th e majo r pteriomorp h group s wer e selected fro m Carte r (1990 ) and Waller (1998 ) and projected o n the ML tree topology for these groups (Fig. 8a) . Th e M L tre e i s preferre d t o th e stric t consensus parsimon y tre e becaus e i t resolve s th e mytiloid-pinnoid branchin g sequence . Recodin g the character s give n b y thes e author s t o a dat a matrix fo r a combine d molecula r an d morpho logical analysi s ha s bee n attempte d bu t i s no w postponed. At the time of preparation o f this paper, too man y uncertaintie s i n homolog y an d gap s i n character state s for al l the specie s i n the molecular data set were evident, so that a more comprehensive analysis will be presented elsewhere . Non-homoplastic synapomorphie s (i n bold ) fo r the Pteriomorphia i n Fig. 8a are the discontinuity of larval an d post-larva l ligaments , stomac h morph ology o f typ e II I o f Purchon , rectu m wit h a flattened cross-section , connecte d cardi e auricle s and a branchia l ocellu s i n th e juvenile . Th e tw o latter character s liste d b y Walle r (1998 ) ar e somewhat doubtful ; branchia l eye s ar e no t known from al l pteriomorp h group s (Crag g 1996) . A fusion of auricles was reported b y Atkins (1938) for all pteriomorphs excep t fo r Anomia, expanding on the results of Pelseneer (1911 ) but never confirmed on a broad scale . At least in Area noae, this fusio n must occu r lat e i n ontogen y a s juvenile s hav e clearly separat e auricle s (Steiner , pers . comm.) . Another potentia l synapomorphy , thoug h a homoplastic one , i s th e los s o f th e opisthodeti c ligament. Th e reconstructio n o f thi s characte r involves eithe r a reversa l i n th e Mytiloidea o r a n independent los s in the Ostreioide a + Pterioidea + Pinnoidea lin e an d o n th e branc h leadin g t o th e clade including the Arcoidea. Special attentio n i s draw n t o th e fiv e othe r characters tha t evolv e i n paralle l alon g thes e tw o branches: the calcitic prisms in the outer shell layer, the inequivalv e shell , th e presenc e o f a byssa l notch, th e palp-gill connectio n o f type III an d the dominant right abdominal sense organ (ASO). This collection o f parallelisms , cause d b y th e weakl y supported an d short-branche d basa l node s o f th e 18S trees , promp t u s t o propos e a preliminar y phylogenetic hypothesi s combinin g th e mor e reliable branche s o f th e molecula r tre e an d th e

18S rDNA PHYLOGENY OF PTERIOMORPHIA 2

7

Fig. 8 . (a) Morphological characteristic s of major group s of the Pteriomorphia plotted on the idealized ML tree shown in Fig. 6 . (b) Proposed phylogenetic tre e of the Pteriomorphia combinin g molecular and morphological data . Non-homoplastic synapomorphies (bold) an d homoplastic synapomorphie s are shown. Reversals an d convergences o n terminal branches no t shown; (?), questionable homologies .

morphological dat a (Fig . 8b). The propose d definition , thei r presenc e ma y b e synapomorphi c phylogeny recognize s th e Mytiloide a a s th e firs t fo r th e entir e clad e o r fo r th e Limoide a + pteriomorph branch . It s siste r grou p is define d by Pectinoide a only . Th e presenc e o f mantl e eye s i n the los s o f th e opisthodeti c ligament , micro - th e mantl e margin s diagnose s th e latte r (thoug h laterofrontal cilia and a palp-gill connection of type parallele d i n the Arcoidea); the cementatio n o f the III. Th e siste r grou p t o the Arcoidea no w includes righ t valve is synapomorphic fo r the Anomioidea + the ostreoid-pterioid-pinnoid clad e an d shows th e Plicatuloidea . I t i s agai n emphasize d tha t th e calcitic prism s i n th e oute r shel l laye r a s non - propose d tre e i s stil l preliminar y an d ha s t o b e homoplastic synapomorphy . subjecte d t o rigorou s cladisti c testin g bot h b y The other synapomorphies , inequivalv e shells , a morphologica l an d additional molecula r character s byssal notc h an d th e dominan t righ t AS O suffe r a s well as by th e incorporatio n of palaeontologica l reversals i n th e limoi d branch . A possibl e data . synapomorphy fo r th e ostreoid-pteroid-pinnoi d Briefl y summarizin g th e result s fo r th e clade is the inse t of the posterio r peda l retracto r relationship s on a family level, the following can be insertion, wit h th e posterio r adducto r muscl e pointe d ou t withou t goin g int o th e detai l o f experiencing reversal in the Ostreoidea. Ostreoidea morphologica l characters : th e monophyl y o f and Pteriodea can be defined by their monomyarian Mytilina e and Pectinidae i s supported; Arcidae ar e condition an d th e presence o f a n ana l appendage , paraphyletic ; Pteriida e an d Malleida e ar e although Harr y (1985 ) an d Walle r (1998 ) expres s polyphyletic . certain doubt s abou t it s homology . Monomyar y

is also a synapomorphy

of the clade uniting

The authors are indebted to Werner Piller and Martin Zuschin (Institute of Paleontology, University of Vienna)

Limoidea, Pectinoidea , Anomioide a an d for the posibility to colllect in Safaga, Egypt. Additional Plicatuloidea, togethe r wit h th e comple x cross - tissue samples were provided by David Campbell lamellar inner shell layer and th e typ e IV stomach . (Universit y o f Sout h Carolina ) an d Argyr o Zeneto s The comple x mantl e tentacle s a s classifie d b y (Nationa l Cente r o f Marin e Research , Greece) . Rober t Waller (1978 , 1998 ) unfortunatel y lac k a soun d Felbe r and Manfred Muelle r (VBC Genomics Bioscienc e morphological definition . Dependin g o n th e Researc h GmbH , Vienna ) gav e valuabl e technica l

28

G. STEINE R & S . HAMME R

support. Gonzal o Giribe t permitte d th e us e o f fou r sequences prior t o publication. This stud y was funded b y the Fonds zur Foderung der wissenschaftlichen Forschun g (FWF project no. P11846-GEN).

References ADAMKEWICZ, S . L. , HARASEWYCH , M . G. , BLAKE , J. , SAUDEK, D . & BUL , C. J . 1997 . A molecula r phylogeny o f th e bivalv e mollusks . Molecular Biology an d Evolution, 14 , 619-629. AGUINALDO, A. M. A., TURBEVILLE, J. M., LINFORD, L . S., RIVERA, M . C., GAREY, J . R., RAFF, R. A. & LAKE, J . A. 1997 . Evidenc e fo r a clad e o f nematodes , arthropods and other moulting animals. Nature, 387, 489-493. ATKINS, D . 1938 . O n th e ciliar y mechanism s an d interrelationships o f Lamellibranchia . Par t VII . Latero-frontal cili a o f th e gil l filament s an d thei r phylogenetic value . Quarterly Journal o f Microscopic Science, 80, 345-436. BREMER, K. 1988. The limits of amino acid sequenc e data in angiosper m phylogeneti c reconstruction . Evolution, 42, 795-803. 1994. Branc h suppor t an d tre e stability . Cladistics -The International Journal of the Willi Hennig Society, 10 , 295-304. CAMPBELL, D . C., HOEKSTRA, K . J. & CARTER, J . G. 1998. 18S ribosomal DNA an d evolutionary relationships within th e Bivalvia . In : JOHNSTON , P . A . & HAGGART, J . W. (eds) Bivalves: An eo n o f Evolution - Paleobiological Studies honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 75-85. CANAPA, A., MAROTA, L , ROLLO, F . & OLMO, E . 1999 . The small-subunit rRNA gene sequences of venerids and the phylogen y o f bivalvia . Journal o f Molecular Evolution, 48, 463-468. CARTER, J . G . 1990 . Evolutionary significanc e o f shel l microstructure i n th e Paleotaxodonta , Pteriomorhpia an d Isofilibranchi a (Bivalvia : Mollusca). In : CARTER , J . G . (ed. ) Skeletal Biomineralization: Patterns, Processes and Evolutionary Trends. Vol.umel. Va n Nostran d Reinhold, New York, 135-296. COPE, J. C. W. 1996. The earl y evolution of the Bivalvia. In: TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation of th e Mollusca. Oxford University Press, Oxford, 361-370 . CRAGG, S . M . 1996 . The phylogeneti c significanc e o f some anatomical feature s of bivalve velige r larvae . In: TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation of the Mollusca. Oxford University Press, Oxford, 371-380 . DE RIJK , P . & D E WACHTER , R . 1993 . DCSE , a n interactive too l fo r sequenc e alignmen t an d secondary structur e research . CABIOS, 9 , 735-740. FIELD, K . G. , OLSEN , G. , LANE , D. , GIOVANNONI , ST., GHISELIN, M. , RAFF , E., PACE , N . & RAFF , R . 1988. Molecular phylogen y o f th e anima l kingdom . Science, 239, 748-753. FRISCHER, M . E. , WILLIAMS, J . & KENCHINGTON , E. 1998. A molecula r phylogen y o f som e majo r group s o f

Pectinidae inferred from 18 S rDNA gene sequences. In: JOHNSTON , P . A . & HAGGART , J . W . (eds ) Bivalves: An eon of Evolution - Paleobiological Studies honoring Norman D . Newell. Universit y o f Calgary Press, Calgary , 213-221. GIRIBET, G . & CARRANZA , S . 1999 . Point counte r point : What ca n 18 S rDN A d o fo r bivalv e phylogeny ? Journal o f Molecular Evolution, 48 , 256-258 . HARRY, H . W . 1985 . Synopsi s o f th e supraspecifi c classification o f livin g oyster s (Bivalvia : Gryphaeidae an d Ostreidae). Veliger, 28 , 121-158 . HENDY, M . D . & PENNY , D . 1993 . Spectra l analysi s o f phylogenetic data . Journal o f Classification, 10 , 5-24. KAFANOV, A . I . & DROZDOV , A . L . 1998 . Comparative sperm morpholog y and phylogenetic classificatio n of recen t Mytiloide a (Bivalvia). Malacologia, 39 , 129-139. KENCHINGTON, E. , LANDRY , D . & BIRD , C . J . 1995 . Comparison of taxa of the mussel Mytilus (Bivalvia) by analysis of the nuclear small-subunit rRNA gene sequence. Canadian Journal of Fisheries & Aquatic Sciences, 52, 2613-2620. , RODDICK , D . L. , SINGH , K . R . & BIRD , C . J . 1994. Analysis o f small-subuni t rRN A gen e sequence s from si x familie s o f molluscs . Journal o f Marine Biotechnology, 1 , 215-217. LECOINTRE, G. , PHILIPPE, H., LE, L. H. V & LE GUYADER , H. 1993 . Species samplin g ha s a majo r impac t o n phylogenetic inference . Molecular Phylogeny an d Evolution, 2, 205-224. LITTLEWOOD, D . T . J. 1994 . Molecular phylogenetic s o f cupped oyster s base d o n partia l 28 S rRN A gen e sequences. Molecular Phylogenetics an d Evolution, 3, 221-229. , FORD, S . E. & FONG, D . 1991 . Small subuni t rRNA gene sequenc e o f Crassostrea virginica (Gmelin ) and a comparison with similar sequences from othe r bivalve molluscs. Nucleic Acids Research, 19, 6048. MACKEY, L . Y , WINNEPENNINCKX , B. , D E WACHTER , R. , BACKELJAU, T. , EMSCHERMANN , P . & GAREY , J . R . 1996. 18 S rDN A suggest s tha t Entoproct a ar e protostomes, unrelate d t o Entoprocta . Journal o f Molecular Evolution, 42, 552-559. MARUYAMA, T., ISHIKURA , M., YAMAZAKI , S . & KANAI , S . 1998. Molecula r phylogen y o f zooxanthellat e bivalves. Biological Bulletin, 195 , 70-77. MCALESTER, A . L . 1966 . Evolutionar y an d systemati c implications o f a transitional Ordovicia n lucinoi d bivalve. Malacologia, 3 , 433-439. MORTON, B . 1996 . Th e evolutionar y histor y o f th e Bivalvia. In : TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press, Oxford , 337-360. NEMESCHKAL, H . L . 1999 . Morphometri c correlatio n patterns o f adult birds (Fringillidae : Passeriformae s and Columbiformes ) mirro r th e expressio n o f developmental contro l genes . Evolution, 53 , 899-918. OLSEN, G . J. , MATSUDA , H. , HAGSTROM , R . & OVERBEEK , R. 1992 . Documentation fo r fastDNAml 1.0. Electronic file distribute d with the program . PAGE, R . D . M . 1996 . TREE VIEW: A n applicatio n t o display phylogeneti c tree s o n persona l computers .

18S rDNA PHYLOGEN Y O F PTERIOMORPHI A Computer Applications i n th e Biosciences, 12 , 357-358. PELSENEER, P . 1911 . Le s lamellibranche s dTexpeditio n du Siboga . Parti e anatomique . Siboga Expeditie Siboga Expedition Monograph, 71 , 1-125 . PHILIPPE, H. , CHENUIL , A . & ADOUTTE , A . 1994 . Can th e Cambrian explosio n b e inferre d throug h molecula r phylogeny? Development, Supplemen t 1994 , 15-25. RICE, E . L . 1990 . Nucleotid e sequenc e o f th e 18 S ribosomal RN A gen e fro m th e Atlantic se a scallop Placopecten magellanicus. Nucleic Acids Research, 18,5551. , RODDICK, D. & SINGH, R. K. 1993 . A comparison of molluscan (Bivalvia ) phylogenie s base d o n palaeontological an d molecula r data . Molecular Marine Biology and Biotechnology, 2 , 137-146. RIUTORT, M. , FIELD , K . G. , RAFF , R . A . & BAGUNA , J . 1993. 18 S rRN A sequence s an d phylogen y o f th e Platyhelminthes. Biochemical Systematics an d Ecology, 21,11-11. SALVINI-PLAWEN, L . & STEINER , G . 1996 . Syn apomorphies an d plesiomorphie s i n highe r classification o f Mollusca . In : TAYLOR , J . D . (ed.) Origin and Evolutionary Radiation of the Mollusca. Oxford Universit y Press, Oxford, 29-52. SORENSON, M. D. 1996 . Tree-Rot. University of Michigan, Ann Arbor . STAROBOGATOV, Y . I . 1992 . Morphological basi s fo r th e phylogeny and classification o f Bivalvia. Ruthenica, 2, 1-26. STEINER, G . 1999 . Point counte r point : Wha t ca n 18 S rDNA do for bivalve phylogeny? Response. Journal of Molecular Evolution, 48, 258-261. & MULLER , M . 1996 . What ca n 18 S rDN A d o fo r bivalve phylogeny ? Journal o f Molecular Evolution, 43, 58-70. STENZEL, H . B . 1971 . Oysters. In : MOORE , R . C . (ed) Treatise on Invertebrate Paleontology, Part N. Volume 3 , Mollusca 6 , Bivalvia. Geologica l Societ y

29

of America , Boulder , CO , an d Kansa s Universit y Press, Lawrence , KS , N953-N1224 . SWOFFORD, D . L . 1998 . PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates Inc., Sunderland, MA. , OLSEN, G . J., WADDELL, P . J. & HILLIS, D . M. 1996. Phylogenetic inference. In : HILLIS , D . M. , MORITZ , C. & MABLE , B . K . (eds ) Molecular Systematics, 2nd Edition . Sinaue r Associate s Inc. , Sunderland , MA, 407-514. TAKEZAKI, N. , RZHETSKY , A . & NEI , M . 1995 . Phylogenetic tes t o f th e molecula r cloc k an d linearized trees . Molecular Biology an d Evolution, 12, 823-833. THOMPSON, J . D. , HIGGINS , D . G . & GIBSON , T . J . 1994. CLUSTAL W : improvin g th e sensitivit y o f progressive multipl e alignmen t throug h sequenc e weighting, positio n specifi c ga p penaltie s an d weight matri x choice . Nucleic Acid Research, 22 , 4673-4680. WALLER, T . R . 1978 . Morphology, morphocline s an d a new classificatio n o f th e Pteriomorphia . Philosophical Transactions of the Royal Society, London, B284, 345-365 . 1991. Evolutionary relationships among commercia l scallops (Mollusca : Bivalvia : Pectinidae) . In : SHUMWAY, S . E . (ed. ) Scallops: Biology, Ecology and Aquaculture. Volume 21. Elsevier , Ne w York , 1-73. 1998. Origin o f the mollusca n clas s Bivalvi a an d a phylogeny o f majo r groups . In : JOHNSTON , P . A. & HAGGART, J. W. (eds) Bivalves: An Eon o f Evolution - Paleobiological Studies honoring Norman D. Newell. Calgar y Universit y Press, Calgary , 1^7. WlNNEPENNINCKX, B. , BACKELJAU , T . & D E WACHTER, R .

1994. Smal l ribosoma l subuni t RN A an d th e phylogeny o f Mollusca. Nautilus, Suppl . 2, 98-110. ,& 1996 . Investigatio n o f mollusca n phylogeny o n th e basi s o f 18 s rRN A sequences . Molecular Biology and Evolution, 13 , 1306-1317.

This page intentionally left blank

Molecular evidence on the evolution of the Bivalvia D. C. CAMPBELL Department of Geological Sciences, University of North Carolina, Chapel Hill, NC 27599-3315, USA Present address: Biology Department, St Mary's College of Maryland, 18952 E. Fisher Rd, St Mary's City, MD 20686-3001, USA (e-mail: dcampbell@ osprey.smcm.edu) Abstract: Despite widesprea d agreemen t o n the monophyl y o f severa l majo r tax a o f bivalves , others remai n uncertai n an d th e relationship s amon g the m ar e debated . Th e presen t stud y compares new an d published morphological phytogenies with ne w analyses based o n 18 S gene sequences. All but one family an d all superfamilies in the Bivalvia were monophyletic in all the analyses. Several highe r taxa, includin g mos t subclasse s and orders, were also resolved a s monophyletic. Only Myoid a show s stron g evidenc e fo r polyphyly , wit h a t leas t tw o origins fro m Veneroida . Autobranchia was supported as monophyletic in the parsimony analyses. Within Pteriomorphia, Ostreoida i s th e siste r taxo n o f Pterioida , i f no t derive d fro m withi n it , rathe r tha n closes t t o Pectinoida. Th e numerou s point s o f agreemen t wit h morpholog y base d analyse s suggest s tha t both types of evidence are converging on a common phylogeny; however, differences remai n t o be resolved by further study.

The Clas s Bivalvi a ha s bee n recognize d i n essentially its modern for m sinc e Linnaeus (Cox et al. 1969) , bu t th e relationship s o f it s constituen t superfamilies, order s an d subclasse s remai n contested. Mos t familie s an d superfamilie s see m valid, but 'real difficulties arise...whe n attempts are made t o grou p well-define d superfamilie s int o orders an d subclasses' (Newel l i n Cox e t al. 1969 , p. N208) . Th e presen t researc h foun d tha t molecular dat a fro m th e 18 S gen e ca n addres s many of these problems. Most phylogenetic analyses of the Bivalvia so far published ar e based o n what the author considered to b e significan t morphologica l synapomorphie s rather tha n computerize d analyses . Severa l morphological characters are known to have arisen convergently i n differen t bivalv e lineage s (eulamellibranch gil l grade , porcelaneou s micro structure, taxodon t dentition , etc.) , resultin g i n scepticism as to the ability of parsimony analyses to satisfactorily resolv e bivalv e classification . However, Salvini-Plawe n & Steine r (1996 ) attempted a computerized parsimony analysis while noting difficultie s wit h homoplasy . A ne w phylogenetic analysi s (Carter e t al. 2000) wa s als o compared t o th e DN A results . Othe r recen t morphology base d bivalv e phylogenie s includ e Starobogatov (1992) , Morton (1996) , Cop e (1997) and Waller (1998); these summarize much previous work o n th e class . Additiona l phylogeneti c

models fo r specifi c tax a wer e als o considered . The propose d phylogenie s i n thes e paper s were compare d t o th e result s o f th e presen t DNA analyse s an d t o publishe d DNA-base d analyses. The 18 S gene wa s chose n fo r th e presen t stud y because it has been useful i n prior studie s of higher level phylogen y o f th e Bivalvi a an d becaus e th e gene wa s alread y a t leas t partiall y sequence d for severa l tax a (Fiel d e t al . 1988 ; Ric e 1990 ; Holland e t al . 1991 ; Littl e wood e t al . 1991 ; Kenchington et a l 1993 ; Ric e e t al . 1993 ; Kenchington e t a l 1995 ; Steine r & Mlille r 1996 ; Winnepenninckx e t a l 1996 ; Adamkewic z e t a l 1997; Bel l & Grassle 1998 ; Campbel l e t al 1998 ; Frischer et al 1998 ; Maruyama et al 1998 ; Canapa et a l 1999) . Althoug h man y taxonomicall y significant result s wer e obtained , anomalie s an d uncertainties remain . Thus , furthe r stud y o f 18 S gene sequence s promise s importan t dat a fo r resolving the relationships of higher taxa within the Bivalvia. The onl y other gene s fo r which sequence s hav e been obtaine d fo r man y bivalv e superfamilie s ar e the 16 S gene , CO I (bot h mitochondrial ) an d portions of the 28S gene. Mitochondria l gene s ris k reflecting a n organell e phylogen y rathe r tha n th e organismal phylogeny because many bivalves have biparental inheritanc e o f mitochondria , wit h occasional los s an d re-evolutio n o f on e lineag e

From: HARPER, E. M., TAYLOR , J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177 , 31-46 . 1-86239-076-2/007 $ 15.0 0 © The Geological Society of London 2000.

Table 1 . Taxa an d sources Taxon

Reference

Accession numbe r

Brachiopoda Lingula anatina Lamarck, 180 1 ['lingua'} Glottidia pyramidata (Stimpson , 1860) Discinisca tenuis (G. B. Sowerby II , 1846 ) 'Neocrania' anomala (Miiller, 1776) Terebratalia transversa (G. B. Sowerby, 1846 ) Thecidellina blochmanni Dall, 1920 [ blochmanif] Neorhynchia sp . D1157 Eohemithiris grayii (Woodward , 1855 ) ['Eohemithyris']

Mackey etal. 1996 Halanych *f a/. 1995 Cohen e t al. unpublishe d Cohen e t al. unpublished Halanych e t al. 1995 Cohen et al. 1998 Cohen e t al. 1998 Cohen e t al. 1998

X81631 U12647 U08327 U08328 U12650 AF025935 AF025937 AF025936

Phoronida Phoronis architecta Andrews, 189 0

Mackey e t al. 1996

U36271

Polyplacophora Cryptochiton stelleri (Middendorff, 1847 ) Liolophura japonica (Lischke , 1873) Lepidochitona corrugata (Reeve , 1848)

Field etal. 1988 Winnepenninckx et al. 1993 Winnepenninckx e t al. 199 6

M20056-58 X70210 X91975

Gastropoda Nerita albicilla Linnaeus, 1758 Monodonta labio (Linnaeus, 1758) Littorina littorea (Linnaeus, 1758) Crepidula adunca G . B. Sowerby I, 182 5 Thais clavigera (Kuster, 1860 ) Anisodoris nobilis (MacFarland , 1905) Onchidella celtica (Cuvier, 1817 ) Limicolaria kambeul (Bruguiere, 1792 )

Winnepenninckx e t al. 199 6 Winnepenninckx e t al. 1 998/7 Winnepenninckx e t al. 1998 0 Winnepenninckx et al. l99Sb Winnepenninckx e t al. 199 6 Field etal. 1988 Winnepenninckx e t al. 1994 Winnepenninckx et al. 199 2

X91971 X94271 Y91970 X94277 X91979 M20097-99 X70211 X66374

Bivalvia: Nuculoide a Nucula proxima Say , 182 2 Acila castrensis (Hinds, 1843)

new new

AF1 20526 AF120527

Nuculanoidea Nuculana minuta (Miiller, 1776) Neilonella subovata (Verril l & Bush, 1897 )

new new

AF120529 AF207645

Mytiloidea Brachidontes exustus (Linnaeus, 1758) Geukensia demissa (Dillwyn , 1817 ) Modiolus americanus (Leach , 1815 ) Musculus lateralis (Say, 1822) Mytilus californianus Conrad , 183 7 Mytilus edulis Linnaeus, 1758 Septifer bilocularis (Linnaeus, 1758 )

new Kenchington et al. 1995 new new Kenchington e t al. 1995 Kenchington et al. 1995 new

AF229623 L33451 AF229624 AF229625 L33449 L24489 AF229622

Arcoidea Area noae (Linnaeus, 1758) Barbatia virescens (Reeve, 1844) Glycymeris glycymeris (Linnaeus , 1758 ) ['sp.']

Steiner & Muller 1996 Winnepenninckx e t al. 1996 Winnepenninckx e t al. 1996

X90960 X91974 X91978

Anomioidea Pododesmus macrochisma (Deshayes, 1839)

new

AF229627, AF229628

Plicatuloidea Plicatula australis (Lamarck , 1819 ) Pectinoidea Chlamys islandica (Muller, 1776) Argopecten irradians (Lamarck, 1819) Pecten maximus (Linnaeus, 1758) Placopecten magellanicus (Gmelin , 1791) Spondylus sinensis Schreibers , 1793

new

AF229626

Kenchington e t al. 199 3 Rice etal. 1993 Frischer ef a/. 1998 Rice 1990 new

LI 1232 LI 1265 L49053 X53899 AF229629

Pinnoidea Atrina pectinata (Linnaeus, 1767 )

Steiner & Muller 199 6

X90961

Pterioidea Pinctada margaritifera (Linnaeus , 1758 ) Isognomon isognomum (Linnaeus, 1758)

new new

AF229620 AF229621

Ostreoidea Ostrea edulis Linnaeus, 1758 Crassostrea virginica (Gmelin, 1791) Hyotissa hyotis (Linnaeus, 1758)

Frischeretal. 1998 Littlewood etal. 1991 new

L49052 Z29549 AF229618, AF229619

Table 1 . Continued Taxon

Reference

Accession numbe r

Unionoidea Elliptio complanata (Lightfoot , 1786 ) Utterbackia imbecilis (Say, 1829 ) ['Anodonta'] Margaritifera margaritifera (Linnaeus , 1758 )

Adamkewicz e t al. 199 7 Adamkewicz e t al. 199 7 new

L78857 L78858 AF229612

Carditoidea Carditamera floridana Conrad , 183 8

new

AF229617

Cyamioidea Basterotia elliptica (Recluz, 1850 )

new

AF229616

Galeommatoidea Galeomma takii (Kuroda, 1945 ) Divariscintilla yoyo Mikkelsen & Bieler, 198 9

Winnepenninckx et al. 199 6 Adamkewicz et al. 199 7

X91969 L78869

Gastrochaenoidea Gastrochaena stimpsonii Try on, 186 1

new

AF229615

Ensiculus cultellus (Linnaeus, 1758 )

Adamkewicz et al. 1997 ; Bell & Grassle 199 8 new

L78871; U93557 AF229614

Tellinoidea TellinaversicolorDeKay, 184 3 Asaphis deflorata (Linnaeus , 1758 ) Donax variabilis Say, 182 2

Bell & Grassle 199 8 Adamkewicz e t al 199 7 Adamkewicz e t al 199 7

U93556 L78868 L78867

Cardioidea Fulvia mutica (Reeve, 1844 ) Vasticardium flavum (Linnaeus , 1758 ) Tridacna gigas (Linnaeus , 1758 ) Tridacna crocea Lamarck, 181 9 Hippopus hippopus (Linnaeus , 1758 ) Fragum fragum (Linnaeus , 1758 ) Corculum cardissa (Linnaeus , 1758 )

Maruyama et al 199 Maruyama et al 199 Maruyama et al 199 Maruyama et al 199 Maruyama et al 199 Maruyama et al 199 Maruyama et al 199

D88911 D88910 D84189 D88908 D84660 D84662 D88909

Veneroidea Venus verrucosa Linnaeus, 175 8 Mercenaria mercenaria (Linnaeus, 1758 ) Callista chione (Linnaeus, 1758 )

Canapa e t al. 199 9 Frischer et al, unpublishe d Canapa et al 199 9

Arcticoidea Arctica islandica (Linnaeus, 1767 )

Bell & Grassle 1998 , unpublishe d U9355 5

Corbiculoidea Corbicula leana Prime, 186 4

Adamkewicz et al. 199 7 L7886

Mactroidea Mactromeris polynyma (Stimpson , 1860 ) Spisula solida (Linnaeus, 1758 ) Mulinia lateralis (Say, 1822 ) Tresus nuttalli (Conrad, 1837 )

Rice e t al 199 3 Rice e t al. 199 3 Rice et al 199 3 Rice et al 199 3

L11230 LI1266 L11268 LI 1269

Field e t al 1988 ; Campbell e t al 199 8

M20094,M21541, M21175; AF022478

Pholadoidea teredinid (pallet s no t preserved )

new

AF229613

Pandoroidea Pandora arenosa Conrad, 183 4 Lyonsia floridana Conrad , 184 9

new new

AF120539 AF120540

Poromyoidea Myonera specie s

new

AF120544

Solenoidea Ensis directus Conrad, 184 3

Myoidea My a arenaria Linnaeus, 175 8

8 8 8 8 8 8 8

AJ007614 AF106073 AJ007613

1

For Bivalvia , th e superfamil y i s given ; fo r othe r Mollusca , th e class ; an d fo r non-molluscs , th e phylum . Taxonomi c change s o r corrections ar e note d i n squar e brackets . Most o f thes e hav e als o been note d b y th e origina l autho r o r othe r reviewers . However , Neocrania i s a n apparently overlooke d junior homonym . Bell & Grassle (1998) in their tex t give corrected, more complete sequences for Tellina versicolor and Ensis directus than the GenBank files, but only use part of the Arctica islandica sequence; the most complete sequences were used in the present analyses.

34

D. C . CAMPBEL L

(Hoeh e t al. 1997) . Also , the y generall y evolv e more rapidl y tha n nuclea r gene s an d s o ar e les s useful fo r earlie r evolutionar y event s (Hilli s & Dixon 1991) . Finally , th e 18 S gene ha s th e mos t available data. Despite it s potential , molecula r phylogenetic s has often yielde d problematical results , conflicting with previou s morphologica l studies . I n som e cases, revie w o f morphologica l dat a has provided support fo r th e ne w classification , wherea s othe r instances see m t o reflec t problem s wit h th e molecular analyses . Althoug h exception s ar e known (Felsenstein 1978) , usually increasing either the numbe r o f tax a o r th e amoun t o f dat a wil l improve accurac y (Po e & Swoffor d 1999) . I n particular, i t i s importan t t o avoi d wid e phylogenetic gap s amon g tax a t o avoi d spuriou s associations ('long-branc h attraction') (Felsenstei n 1978). B y includin g additiona l taxa , th e presen t study sought to address some of these problems.

Materials and Methods Taxa

The present study sought to include as many higher level tax a a s possible . However , variou s highe r level taxa are used differently b y different authors . A consensu s o f recen t systemati c work s suggest s recognizing fiv e extan t subclasses , althoug h othe r classifications hav e bee n advocate d (e.g . Carte r 1990; Cope 1997 ; Carter et al. 2000). The subclass Protobranchia include s th e order s Nuculoid a an d Solemyoida; th e subclas s Pteriomorphi a include s the orders Arcoida, Limoida, Ostreoida, Pectinoida, Pterioida an d Mytiloida; the subclas s Heterodonta includes th e order s Veneroid a an d Myoida ; th e subclass Palaeoheterodont a include s th e order s Unionoida an d Trigonioida ; an d th e subclas s Anomalodesmata include s th e orde r Phola domyoida. The subclasses other than Protobranchia are often groupe d a s the Autobranchia. Within the Autobranchia, tw o majo r group s hav e bee n recognized: th e Pteriomorphi a an d th e Heteroconchia (includin g Palaeoheterodonta , Heterodonta an d Anomalodesmata). Othe r classifications spli t th e Mytiloid a fro m Pteriomorphi a a s the subclas s Isofilibranchia . Suborder s o f Veneroida are herein referre d to as Lucinoidei an d Veneroidei, followin g th e ending s use d b y Starobogatov (1992 ) i n th e ligh t o f variatio n i n ending and assigned rank. The presen t analyse s include d al l publishe d complete bivalve 18 S sequences, except in the case of multipl e sequence s fo r th e sam e genus . Ne w sequences focuse d o n additiona l highe r taxa . Published partia l sequence s wer e include d i f they represented superfamilie s fo r whic h no mor e than

one complet e sequenc e wa s availabl e an d i f their positio n i n analyse s wa s relativel y well constrained. Tabl e 1 list s th e tax a an d sources . Accession number s allo w locatio n o f th e dat a i n GenBank. I n preliminar y analyses , Brachiopoda , Phoronida an d othe r mollusc s wer e th e closes t relatives o f Bivalvia , s o thes e wer e retaine d a s outgroups fo r th e fina l analyses . Onl y a singl e sequence wa s availabl e fo r Scaphopod a an d Chaetodermomorpha, so they were excluded due to the lon g branc h (a t leas t Cambrian-Recent) . Thi s left multipl e sequence s fo r Polyplacophora , Gastropoda an d Brachiopoda , alon g wit h th e phoronid, for outgroups.

Molecular Techniques Molecular procedure s followe d standar d protocol s for cetyltrimethylammoniu m bromid e (CTAB ) extraction, polymeras e chai n reactio n (PCR ) an d dye-labelled cycl e sequencing . PC R an d sequenc ing primers were designed using published primer s (Rice 1990; Winnepenninckx et al. 1994; Giribe t et al. 1996; Whiting et al. 1997) and results of preliminary researc h b y Campbel l e t al . (1998) . PC R primers wer e CAACCTGGTTGATCCT G (forward) an d CTGATCCTTCTGCAGGTT C (reverse). Additiona l sequencin g primer s wer e GTTCGATTCCGGAGAGGGA an d ATGGTTGCAAAGCTGAAAC (forward) , an d AGGCTCCCTCTCCGGAATCGAAC an d TTGGCAAATGCTTTCGC (reverse) . Th e PC R started wit h 4 min at 94°C, followe d by 26 cycle s with 1 mi n 94°C , 1 mi n a t th e annealin g temperature an d 2 mi n a t 72°C . Annealin g temperatures wer e 56 , 54 , an d 52° C fo r th e firs t three cycles , 50° C fo r th e nex t thre e cycle s an d 48°C fo r th e remainder . Thi s wa s followe d b y 10 min a t 72°C. The sequencin g reaction was held at 96° C for 4 min, followed by 2 5 cycles a t 96° C for 3 0 s an d the n a t 49° C fo r 4 mi n 3 0 s. Th e protobranch and anomalodesmatan sequences were obtained b y Gonzal o Giribe t o f th e America n Museum o f Natura l Histor y fro m specimen s obtained b y the present author . New sequences fo r Pteriomorphia were largely obtained while working at th e America n Museum of Natura l History. Th e new complet e sequence s hav e bot h strand s sequenced. A preliminar y partia l sequenc e wa s included for Teredinidae, as no complete sequences are available . I t agree s wel l wit h unpublishe d preliminary dat a fo r Pholadida e i n th e sam e superfamily. Attempt s a t furthe r sequencin g fro m the teredini d wer e unsuccessful . Th e shell s fro m analysed specimen s wer e deposite d i n th e University o f Nort h Carolin a a t Chape l Hil l collections a s vouchers.

MOLECULAR AND MORPHOLOGICAL EVOLUTION

Analytical Methods The DN A sequence s wer e aligne d b y hand , wit h reference t o th e secondar y structur e mode l o f Winnepenninckx e t al (1994) . Alignmen t procedures remai n problematica l (Giribe t & Wheele r 1999) an d variation s i n alignmen t ma y generat e different cladogram s (Winnepenninck x & Backeljau 1996) . Althoug h computerize d align ments are more replicable than manual alignments , there is no guarantee that they are better. Repeate d alignment o f th e sam e sequence s wa s use d t o identify area s o f uncertai n alignment, whic h were revised t o ensur e consistency . Th e presen t alignment wa s submitte d t o EMB L a t http:7www.ebi.ac.uk/ an d i s alignmen t DS41611 . Maximum parsimony , neighbour-joinin g an d bootstrap analyse s wer e performe d usin g PAUP 3.1.1 (Swoffor d 1993 ) and PAUP*4.0 (Swoffor d 1999). Deca y indice s (als o calle d Breme r indices ) were calculate d usin g TreeRot (Sorenso n 1999) , PAUP 3.1.1 and PAUP*4.0. Multipl e outgroup s were use d a s ther e i s disagreemen t o n the closes t relatives o f th e Bivalvi a (e.g . Runnegar 1996; Waller 1998). After preliminary analyses, including several outgroups, Gastropoda, Polyplacophora an d Brachiopoda wer e selecte d becaus e the y consistently place d close t o Bivalvia, if not within it, an d because multipl e complete sequence s wer e available, decreasin g th e ris k o f long-branc h attraction. Th e firs t 2 0 an d las t 2 3 base s wer e excluded becaus e the y represen t prime r sequenc e rather tha n actua l dat a fo r mos t sequences . Multistate characters wer e treated a s uncertain. Maximum-parsimony analyse s wer e use d t o generate phylogeneti c models . Th e heuristi c analyses use d rando m additio n o f taxa , wit h 10 0 replicates. Tre e bisection-rejoinin g wa s use d fo r branch swappin g (Swoffor d & Begl e 1993) . Th e best treatmen t o f gap s i s debate d (Giribe t & Wheeler 1999) . Althoug h ignorin g the m ca n omi t informative data , the presence o f long indels mad e other method s mor e problematical . Th e firs t analysis treated gap s a s missing data. As a test of the effect o f gaps, a second analysis was performed with gap s treate d a s a fift h characte r state . Thi s represents an extreme weighting of gaps, so clades supported by both analyses are probably relatively stable with respect t o gap weighting. The tree s fro m th e heuristi c searche s wer e combined t o generat e stric t consensu s trees . Bootstrap analysi s use d 10 0 replicates , eac h o f which was a heuristic searc h with closest addition , holding te n tree s a t eac h ste p an d usin g tre e bisection-rejoining. Deca y indices were calculated using heuristic searches of 20 random replicates for trees incompatibl e wit h th e constrain t (Sorenso n 1999). Althoug h no absolute criteria ar e known for

35

evaluating deca y indice s (Swoffor d e t al . 1996) , higher indices suggest stronger support. A neighbour-joinin g tre e wa s als o calculate d (Saitou & Nei 1987) . Neighbou r joinin g i s bette r regarded as an algorithm for generating trees to use in further searchin g rather than as a source for fina l trees, a s it has no optimality criterio n (Swoffor d e t al. 1996) . However , i t ha s bee n widel y use d t o generate fina l trees . I t i s include d fo r compariso n and a s a demonstration of nodes that are robust to multiple method s o f analysis . I t use d a oneparameter mode l wit h gaps coded a s missing data. Hillis & Bul l (1993 ) foun d that , fo r unbiase d data sets , bootstra p value s abov e 70 % correlat e with a 95 % probabilit y o f phylogeneti c accuracy . Asymmetry in the present cladograms and variation in evolutionar y rate s woul d ten d t o rais e th e bootstrap valu e necessary fo r 95% confidence, bu t unless th e dat a ar e extremely divergent , bootstra p percentages tend to underestimate the phylogenetic probability. Results Complete sequenc e length s rang e fro m 179 4 to 2192 bases , wit h th e alignmen t lengt h a t 233 0 bases. Th e longes t sequence s wer e th e anomalodesmatans, rangin g fro m 191 9 to 2192. The next longest were the fragines, from the data of Maruyama e t al . (1998) . Othe r ne w sequence s ranged from 179 4 to 182 0 bases, although some of this variatio n reflect s variatio n i n th e numbe r o f bases resolved nea r the primers . With gap s code d a s missing data , 76 4 include d positions ar e parsimon y informative . Th e nin e shortest trees foun d by parsimony wit h gaps code d as missing wer e 374 4 step s an d were foun d b y 97 of th e replicates . Th e g l valu e wa s -0.730 689, based on 100 000 random trees. Other tree statistics include a consistenc y inde x o f 0.458 1 (0.394 5 excluding uninformativ e characters) , a retentio n index of 0.6999 and a rescaled consistency index of 0.3206. Figur e 1 show s th e stric t consensu s tre e with decay index values indicated an d Fig. 2 shows the bootstrap results. Deca y value s range from 1 to 57, suggestin g tha t long-branc h attractio n ma y cause problems . Th e highes t deca y indice s (ove r 20) were confine d t o Cardiidae, Anomalodesmata , Nuculanoidea an d Caenogastropoda . Th e highes t values are within Cardiidae . The neighbour-joining tree was 3780 step s long, evaluated usin g maximu m parsimony . Th e consistency inde x wa s 0.453 7 (0.390 3 excludin g uninformative characters) , the retention inde x was 0.6946 an d th e rescale d consistenc y inde x wa s 0.3151. Figure 3 shows the neighbour-joining tree . Differences wit h the first analysi s ar e noted .

36 D

. C. CAMPBEL L

Fig. 1 . Strict consensus with gaps coded as missing data . Numbers above branches are the decay index or Bremer support values.

MOLECULAR AND MORPHOLOGICAL EVOLUTION 3

7

Fig. 2 . Strict consensus tree with gaps coded a s missing data. Numbers above branches are the bootstrap percentage s for al l clades wit h least 50 % support. Also, the bootstrap suppor t for other ingroup nodes from Fig. 1 is given. Note that conflicting clade s may have higher bootstrap suppor t if support for the clade is under 50%. The two bold clade s had over 50% bootstrap support but conflict wit h the strict consensus tree.

38 D

. C. CAMPBEL L

With gaps coded a s a fifth characte r state, there were 102 4 parsimony informativ e characters . The 122 shortes t tree s foun d b y parsimon y wit h gap s coded a s missing wer e 5672 steps . Thi s represent s

two group s of trees, foun d b y 5 4 an d 2 1 searches . The remaining 25 searches found three longer local minima. Th e gl valu e wa s -0.801 573, base d o n 100 000 random trees. Othe r tre e statistic s includ e

Fig. 3 . Neighbour-joining tree , gap s code d a s missing data . Clade s no t supported i n Fig. 1 are shown wit h thicke r branches, includin g polytomie s in Fig. 1 resolved by neighbour joining .

MOLECULAR AND MORPHOLOGICAL EVOLUTION 3

9

Fig. 4 . Strict consensus wit h gaps coded a s a fifth characte r state . Numbers above branches ar e the decay index or Bremer support values. Clades no t supported in Fig. 1 are shown with thicker branches , includin g polytomies in Fig. 1 resolved i n this second analysis. Polytomies i n this consensus that were resolved in Fig. 1 are also indicated with thicker branches .

40 D

. C. CAMPBELL

Fig. 5 . Strict consensus tree with gaps coded as a fifth characte r state . Numbers above branches are the bootstrap percentages fo r all clades with least 50% support. Also, the bootstrap suppor t for other ingroup nodes from Fig . 4 is given. Note that conflicting clades may have higher bootstrap suppor t if support for the clade is under 50%. The six bold clades were either unresolved in the strict consensus or had over 50% bootstrap suppor t but conflict with the strict consensus. The clade of Hippopus, Fragum and Corculum, supported in the strict consensus, had 49% support. A clade with 50% bootstrap support also conflicted with the strict consensus; it includes Veneroida, excep t Carditamera, Anomalodesmata and Unionidae, as indicated by the lines to the right.

MOLECULAR AND MORPHOLOGICAL EVOLUTIO N

41

other mollusca n classe s represented . Preliminar y analyses in the present study showed that excluding outgroups wit h onl y a singl e availabl e sequenc e and adding additiona l representative s o f remaining outgroup tax a le d t o stronge r suppor t fo r bivalv e monophyly. The results of Hoeh e t al. (1998) ma y also have been affected b y the higher mutation rate of the 16S gene (Hillis & Dixon 1991), which could lead to greater long-branch attraction. In the present study, th e firs t analysi s (gap s code d a s missin g data) supporte d bivalv e monophyly , thoug h wit h weak deca y an d bootstra p support . Th e secon d analysis (gap s coded a s a fifth characte r state ) di d not resolv e bivalv e monophyl y relativ e t o othe r molluscs, ye t bootstra p suppor t fo r bivalv e Discussion monophyly wa s higher (44.3 % wit h no mor e than In general , agreemen t betwee n th e molecula r an d 18.5% against , a s oppose d t o 17.0 % in th e firs t morphological result s i s good , rangin g fro m th e analysis wit h 21.8 % and 15.8 % supporting th e class t o the genu s level. However, ther e ar e som e highest supported clades with bivalve paraphyly or points o f disagreemen t betwee n them , a s wel l a s polyphyly). Non e o f thes e bootstra p value s ar e disagreements amon g models base d o n either dat a high enoug h t o vie w a s stron g support . Th e source. Higher taxa are used in these discussions as neighbour-joining tre e place s Gastropod a nea r th e defined above, although some papers used the same base o f Heteroconchi a an d Polyplacophor a wit h names differentl y [e.g . Cop e (1997 ) exclude d Nuculanoidea a s basal molluscs . A s Nuculanoidea Arcoida fro m Pteriomorphi a an d Campbel l e t al. was a n exceptionall y lon g branch (decay inde x of (1998) placed Myoida in Anomalodesmata]. 50 wit h gap s code d a s missing ) an d Gastropod a Despite th e wide rang e o f deca y indice s an d moderately lon g (deca y inde x o f 8) , thes e ca n b e sequence lengths , tax a wit h hig h value s generall y dismissed a s probabl e errors , i n additio n t o th e grouped into clades compatible with morphological inherent problems o f evaluating neighbour-joining evidence. Onl y th e neighbour-joinin g tree an d th e trees. Monophyl y for Gastropoda , Polyplacophor a internal topolog y o f Cardiida e conflic t wit h and Mollusca had at least 75% bootstrap support in morphological evidenc e i n th e placemen t o f thes e both analyses , an d othe r outgrou p clade s als o probable long branches. received stron g support. Most morpholog y base d analyse s agre e o n th e The parsimon y analyse s supporte d al l fiv e monophyly o f th e Riva l via, apar t fro m uncertain - subclasses o f th e Bivalvi a a s monophyletic , i n ties abou t poorl y know n Cambria n forms . How- agreement with most morphological studies , except ever, molecular suppor t for this has been weak . In for th e positio n o f Carditamera. The neighbour fact, Hoe h e t al . (1998 ) suggested , base d o n joining analysi s ha d Protobranchi a a s diphyletic . molecular data, that the class is diphyletic and other However, th e bootstrap an d deca y suppor t fo r th e molecular analyse s hav e ha d simila r result s (e.g. subclasses wa s ofte n weaker . Previou s molecula r Kenchington e t al . 1994 ; Steiner & Muller 1996; analyses have frequently faile d t o find monophyl y Winnepenninckxefa/. 1996; Campbell ef al. 1998), of th e subclasses , agai n probably becaus e o f poo r usually interprete d a s error . Thi s ma y reflec t a representation o f some subclasse s (bot h in number limited range of taxa, especially with limited repre- of tax a an d completenes s o f sequences) . Another sentation of protobranchs. Suc h wide phylogenetic source o f anomalous results has been the tendency for Crassostrea virginica (on e of th e firs t specie s spacing o f tax a make s long-branch attractio n a likely problem. If, as suggested by the phylogeny of sequenced an d thu s include d i n mos t analyses ) t o Waller (1998) , th e Bivalvia are relatively distantly place outsid e o f Pteriomorphi a o r mak e related to other conchiferans , thi s problem wil l be Pteriomorphia paraphyletic , wit h Crassostrea a s particularly acute , wit h th e divergenc e betwee n the siste r taxo n t o heterodont s (Steine r & Mulle r them an d othe r extan t mollusc s n o late r tha n th e 1996; Winnepenninckx et al. 1996 ; Campbell et al. earliest Cambria n (Runnegar 1996). Modern proto- 1998). This species seems to have a relatively hig h branchs diverge d from othe r bivalves by th e earl y rate o f molecula r evolutio n relativ e t o othe r Ordovician (Cop e 1996 ; Carter e t al 2000) . Thus, pteriomorphians (Steiner & Muller 1996 ; Canapa et limited samplin g o f outgroup s an d protobranch s al. 1999) , makin g i t a likel y candidat e fo r long branch attraction . Th e inclusio n o f other ostreoid s produces ver y lon g branches . Thi s remain s a problem i n th e presen t study , wit h onl y fou r [Ostrea i n Campbel l e t al . (1998) , Frische r e t al . protobranchs, n o solemyoid s an d onl y tw o o f th e (1998) an d Canap a e t al . (1999) , an d Hyotissa a consistenc y inde x o f 0.431 8 (0.383 7 excludin g uninformative characters) , a retentio n inde x o f 0.6642 and a rescaled consistency index of 0.2868. Figure 4 shows the strict consensus tree with decay index value s indicate d an d Fig . 5 show s th e bootstrap results; differences fro m the first analysis are highlighted i n Fig. 4. Decay values range fro m 1 t o 149 , suggesting tha t long-branc h attractio n may cause problems. Decay indices of over 20 were confined t o Cardiidae , Anomalodesmata , Nuculanoidea, Ostreoidea , Pterioide a an d Caenogastropoda. Again , th e highes t value s ar e within Cardiidae .

42

D. C . CAMPBEL L

hyotis, herein ] help s solv e thi s problem . Mos t previous molecula r analyse s onl y includ e Pteriomorphia an d Heterodonta . Som e o f thes e have supporte d monophyl y fo r bot h include d subclasses (Ric e e t al. 1993 ; Frische r e t al 1998 ; Giribet & Carranza 1998) . Also , som e analyse s in Hoeh et al. (1998) supporte d monophyly of all four subclasses include d i n their analyses , althoug h no t supporting monophyl y fo r th e Bivalvia . Adamkewicz e t al. (1997) published the only prior molecular analysi s t o includ e al l fiv e subclasses , though som e o f thei r sequence s wer e ver y short . Pseudogenes, o r error s b y th e sequencin g laboratory, ma y als o hav e cause d problem s wit h some o f thei r sequence s (Adamkewic z pers . comm.). Onl y Heterodont a and Palaeoheterodont a appeared monophyleti c i n thei r analyses . Th e relatively shor t sequences and limited taxonomical coverage (thoug h muc h wide r tha n an y previou s study) probably affecte d thei r resolutio n o f highe r taxa. Although man y morphological analyse s suppor t the monophyl y o f al l include d subclasse s (e.g . Cope 1997 ; Walle r 1998) , other s disagree . Salvini Plawen & Steine r (1996 ) separate d Trigonioid a from Unionoid a an d Myoid a fro m Veneroid a (which the y divide d into Veneroid a sensu stricto and Lucinoidea) , althoug h the y note d th e ris k o f convergent evolution in some supporting characters (compare th e apomorphie s fo r Trigonioid a wit h the synapomorphie s fo r Eulamellibranchia , node s 14 an d 1 6 i n fig . 2.10) . Morto n (1996 ) ha d Pteriomorphia paraphyleti c t o Palaeoheterodont a and Heterodonta paraphyleti c t o Anomalodesmata . Although Neotrigonia i s no t represente d i n th e present analyses , Hoe h e t al . (1998 ) foun d clos e similarity between Neotrigonia and unionids for the 16S gene, an d morphologica l similaritie s ar e als o strong, wit h plausible fossi l transition s (Newell & Boyd 1975) . Likewise , th e similaritie s betwee n Myoida an d Anomalodesmat a ar e pron e t o convergent evolutio n (Salvini-Plawe n & Steine r 1996), an d the similarities betwee n Trigonioida and Pteriomorphia are probably plesiomorphies (Waller 1998). A s discusse d below , molecula r evidenc e strongly support s placin g Myoid a i n Heterodont a rather than in Anomalodesmata . The relationship s amon g thes e subclasse s ar e much mor e contentious. Almost all morphological studies agree that the Protobranchia ar e basal to the remaining Bivalvia. Most see Pteriomorphia a s the next group to diverge (Waller 1998) , possibly along with th e Palaeoheterodont a (Morto n 1996) . However, Cop e (1997 ) groupe d Heterodont a wit h Pteriomorphia (divide d int o Pteriomorphi a sensu stricto an d Neotaxodonta ) an d Anomalodesmat a with Palaeoheterodonta. Previou s molecular studies provide som e resolutio n o f subclass-leve l

relationships, althoug h ofte n no t well-supported . Adamkewicz e t al . (1997 ) ha d protobranch s an d anomalodesmatans basal , an d tendin g t o plac e outside Bivalvia, and Pteriomorphia paraphyletic to a siste r groupin g o f Palaeoheterodont a an d Heterodonta. Similarly , Campbell e t al. (1998) had Protobranchia basal , wit h tendencie s t o plac e outside Bivalvia, and Pteriomorphia paraphyleti c to Heterodonta. Hoe h e t al . (1998 ) agai n ha d protobranchs basal , tendin g t o plac e outsid e o f Bivalvia, an d Palaeoheterodont a nex t mos t basal , with Pteriomorphi a an d Heterodont a a s siste r taxa. I n th e presen t study , Protobranchia , Anomalodesmata an d Palaeoheterodont a ar e eac h represented by , a t most , fou r complet e sequences , making thei r affinitie s les s certain . However , th e association betwee n Anomalodesmat a an d Heterodonta seem s well-supporte d b y th e presen t molecular dat a a s wel l a s morphological evidenc e (Waller 1998) . Monophyl y fo r Heteroconchi a i s supported b y al l th e analyses , althoug h th e neighbour-joining tre e include s Gastropoda . Bootstrap and decay suppor t are lower than for the Heterodonta an d Anomalodesmat a (withou t Carditamera) clade . The relativ e position s of Protobranchia an d Pteriomorphia , a s wel l a s their positio n relativ e t o Heterodont a an d Anomalodesmata, var y fro m analysi s t o analysis . No relationship s amon g subclasse s ha d a deca y index higher tha n two in th e firs t analysi s or three in the second . Relationships simila r t o thos e propose d b y Waller (1998 ) see m mos t likel y fro m al l available evidence . Th e morphological similaritie s between Palaeoheterodonta , Heterodont a an d Anomalodesmata ar e numerous (Salvini-Plawen & Steiner 1996 ; Walle r 1998) , an d molecula r evidence weakl y support s groupin g Palaeoheterodonta wit h th e othe r tw o (Adamkewicz e t al . 1997 ; presen t study) . Cop e (1997) groupe d Heterodont a an d Pteriomorphi a largely o n th e basi s o f crossed-lamella r microstructure; however, this is convergent an d the basal microstructur e in Pteriomorphi a i s nacreou s (Carter 1990 ; Carte r e t al. 2000). Relationships betwee n order s withi n th e subclasses ar e als o debated . Withi n th e Pteriomorphia, Mytiloid a an d Arcoid a ar e generally agree d t o b e basa l [no t universally , though, e.g . Morto n (1996)] . Mytiloid a i s usually considered basal (Walle r 1998 ; Carte r et al. 2000) , but Arcoid a i s viewe d a s basa l i n som e studie s (Cope 1997) . Among the remaining orders, severa l phylogenetic arrangement s hav e bee n proposed . Limoida wa s traditionall y associate d wit h Pectinoida (Co x e t al . 1969) , bu t Walle r (1978 , 1998) moved it to a more basal position an d Morton (1996) grouped it with Ostreoida. The relationships

MOLECULAR AND MORPHOLOGICAL EVOLUTION

between Ostreoida , Pterioida , an d Pectinoid a ar e particularly debated , wit h abou t equa l suppor t fo r closer relationship s betwee n Ostreoid a an d Pectinoida (Morto n 1996 ; Walle r 1998) , an d between Ostreoid a an d Pterioid a (Carte r 1990) . Assignments o f superfamilie s t o thes e order s ha s also varied . Co x e t al. (1969 ) associate d Plicatulidae wit h Pectinoide a an d Pinnoide a wit h Mytiloida, but Waller (1978 ) an d most subsequent work grou p Plicatulida e wit h Ostreoide a an d Pinnoidea wit h Pterioida . Anomioide a i s usuall y associated with Pectinoidea, bu t Waller (1998) put them i n a polytom y relativ e t o Ostreoide a an d Morton (1996) grouped them with Pterioida. Previous molecular studies have supported som e of thes e ideas . Mytiloid a an d Arcoid a wer e generally relativel y basal , althoug h the position of Ostreoida varied (Kenchington et al. 1994 ; Steine r & Miille r 1996 ; Winnepenninckx e t a l 1996 ; Adamkewicz e t a l 1997 ; Campbell e t a l 1998 ; Frischer e t a l 1998 ; Giribet & Carranz a 1998 ; Steiner 1999 ; Canapa e t a l 1999) . Ostreoid a wa s consistently distan t fro m Pectinoida ; whe n Pterioidea wa s represented , i t groupe d wit h Ostreoida. Pinnoide a als o tende d t o appea r basal, but wit h som e tendenc y t o grou p with Pterioide a and Ostreoidea . Th e slo w evolutionar y rat e o f Atrina, a s show n b y lo w percentag e difference s with th e outgroup , probably affecte d it s apparen t affinities (Steine r & Mulle r 1996) . Onl y Adamkewicz e t al . (1997 ) an d Campbel l e t al . (1998) had multipl e familie s for any pterio morphian orde r (Pinnida e and Pteriidae, an d those plus Isognomonidae, respectively) . These produced weak to strong support for monophyly of Pterioida and Pterioidea. With severa l additiona l superfamilie s an d families represente d (Gryphaeidae , Plicatuloidea , Anomioidea, Spondylida e an d Glycymerididae , a s well a s complet e sequence s fo r Pteriida e an d Isognomonidae), an d better representation o f other superfamilies, th e presen t analyse s wer e abl e t o address additiona l morpholog y base d hypotheses . Ostreoida an d Pterioida sho w a close relationship, with Pterioid a paraphyleti c t o Ostreoida . Th e association o f Pterioide a an d Ostreoid a ha s th e highest deca y suppor t ( 4 in the firs t analysis , 5 in the second ) o f an y supraordina l group within th e Bivalvia. Th e presen t analyse s als o strongl y support monophyly for Ostreoidea , includin g both Gryphaeidae an d Ostreidae , i n agreemen t wit h Waller (1998 ) bu t contrastin g wit h the uncertainty expressed i n Carte r (1990) . Plicatuloide a i s strongly supporte d a s th e siste r taxo n o f Anomioidea and they are both generally associated with Pectinoide a (includin g Spondylida e an d Pectinidae). Thi s associatio n o f Plicatuloide a an d Anomioidea i s unexpecte d fro m morphologica l

43

studies. Also, Arcidae appears paraphyletic relative to Glycymerididae ; thi s i s no t entirel y surprisin g because both Area an d Barbatia ha d arise n b y th e Jurassic, wherea s Glycymeridida e extend s bac k only to the Cretaceous (Co x et al 1969) . However, relationships betwee n Pectinoida , Arcoida , Mytiloida an d th e Ostreoida-Pterioid a clad e ar e poorly resolve d i n th e present study . Ancestors of all four were present in the Ordovician (Carter et al 2000), s o th e radiatio n ma y hav e bee n relativel y rapid, an d the basal branche s ar e moderately long , with ver y fe w branche s withi n th e clade s represented before Late Palaeozoic. In contrast to the Pteriomorphia, there ar e many fewer phylogenie s propose d fo r relationship s among superfamilie s i n Heterodonta . Man y examples o f convergenc e ar e known , an d man y authors have proposed that Veneroida, Myoida and Heterodonta ma y b e polyphyleti c (e.g . Newel l 1965). Althoug h Veneroida is sometimes spli t int o lucinid- an d venerid-centre d groups , th e assign ment o f tax a t o thes e tw o division s (order s o r suborders, depending on the reference) is not wellestablished. Fo r example , Newel l (1965 ) place d Tellinoidea with the Lucinoidei, but Morton (1996) put the m close r t o venerid s an d spli t of f som e o f Newell's lucinoideine s basally , relativ e t o th e res t of Heterodonta an d Anomalodesmata. Despite th e uncertaintie s fro m morphology , th e DNA evidenc e provide s resolutio n o f variou s groups withi n th e Heterodont a abov e th e super family level . Al l parsimon y analyse s supporte d a clade includin g Mactroidea , Veneroidea , Corbiculoidea, Arcticoidea, Myoidea , an d Pholadoidea; thi s ha d 94.2 % an d 100 % bootstrap support an d 3 an d 9 fo r deca y inde x values . Previous molecula r studie s have found suppor t for this grouping (Adamkewicz e t al 1997 ; Canap a et al 1999 ) but mos t studie s hav e no t include d enough representatives of both this group and other heterodonts, preventin g assessmen t o f it s monophyly. This group is similar t o the traditional suborder Veneroidei of morphological analyses , but also include s Mactroidea , Myoide a an d Pholadoidea. Sau l (1973 ) propose d evolutio n o f Mactroidea fro m Arcticoidea , whic h would put i t into thi s group . Othe r molecula r studie s sugges t that Dreissenoidea, Chamoidea an d Pisidiidae ma y belong here (Adamkewicz et al 1997 ; Rosenberg et al 1997 ; Hoeh e t a l 1998) . Anothe r veneroi d group, foun d b y al l parsimon y analyse s bu t wit h weaker bootstra p an d deca y value s (55.7 % an d 45.9%, 2 an d 2) , include d Gastrochaenoidea , Galeommatoidea an d Sportellidae . Stron g suppor t (93.6% and 98.3%, 5 and 6 decay index) for a clade of Sportellida e an d Galeommatoide a agree s wit h recent morphological studies (Salas & Gofas 1998) . This clad e resembles Erycinoine i o f Starobogato v

44

D. C . CAMPBELL

(1992), bu t morphologica l studie s sugges t tha t Cyrenoidea is polyphyletic wit h the other familie s probably i n th e suborde r Veneroidei . Splittin g Myoida amon g Vereroid a wa s als o supporte d b y Adamkewicz et al. (1997) and some morphological studies. Althoug h Gastrochaenoide a ha s bee n recognized a s very different fro m Myoide a (Carte r 1978), it s associatio n wit h Galeommatoide a an d Sportellidae i s unexpecte d an d onl y weakl y sup ported b y bootstra p an d deca y (no t supporte d b y neighbour-joining). Th e Gastrochaenoide a doe s consistently plac e within Heterodonta bu t outsid e Veneroidei, whic h contain s Myoide a an d Pholadoidea. Anothe r groupin g supporte d b y th e present parsimon y analyse s i s Tellinoide a plu s Cardioidea, simila r t o th e suborde r Cardioide i o f Starobogatov (1992 ) bu t includin g Donacidae an d excluding Ungulinoidea . However, thi s ma y b e a case o f long-branc h attraction , a s Tellinoide a an d Cardioidea both have high decay indices. Although this clade received 80.6 % bootstra p suppor t in the first analysis , it only received 27.3 % support in the second, les s tha n th e 43.0 % suppor t for grouping Cardioidea, Gastrochaenida e an d Erycinoinei . Solenoidea and the Galeommatoidea-SportellidaeGastrochaenoidea clade seem to be relatively basal, but wit h poo r bootstra p support . Finally , Carditoidea i s basa l no t onl y to al l othe r sample d heterodonts bu t als o t o Anomalodesmata . Thi s i s unexpected; althoug h they appea r t o b e relatively primitive heterodonts , the y ar e morphologicall y similar t o othe r heterodont s exclusiv e o f anom alodesmatans. Mor e molecula r dat a fo r othe r primitive heterodonts are needed to test this result, especially Crassatelloide a an d Lucinoidea. All bivalv e superfamilie s an d familie s appea r monophyletic excep t Arcidae . Suppor t fo r monophyly o f Nuculida e an d Nuculoide a wa s weak. Although the stric t consensus in th e second analysis di d no t resolv e Nuculida e relativ e t o Nuculanoidea, bootstrap support for Nuculidae was slightly higher tha n in th e firs t analysi s (61.0 % v . 59.4%).

Conclusions Analysis of 18 S rDNA helps resolve several issues in th e phylogen y o f th e Riva l via. I n particular , conflicts betwee n differen t morpholog y base d interpretations can ofte n b e resolved b y use of this new dat a source . Furthe r stud y promise s t o continue t o improv e ou r understandin g of bivalve evolution. The numerou s area s o f agreemen t betwee n th e present stud y an d previou s morphologica l an d molecular studie s sugges t tha t w e ar e converging on a common phylogeny of the Bivalvia. In particular, th e traditiona l subclasses , orders , super -

families an d familie s generall y see m t o b e monophyletic. However , man y importan t tax a remain poorl y know n an d area s o f disagreemen t remain t o b e resolved, especiall y i n th e relation ships betwee n tax a o f equa l rank . Dat a fro m additional gene s an d furthe r morphologica l analyses should resolve man y of these issues. Relationships amon g th e subclasse s ar e no t ye t clear, apar t from th e grouping of Anomalodesmat a and Heterodonta . Heteroconchi a (Palaeo heterodonta, Heterodont a an d Anomalodesmata ) received weake r support . Monophyl y o f th e subclasses is supported, with the possible exception of Carditoidea placin g basally in the HeterodontaAnomalodesmata clade , a s i s monophyl y o f mos t orders, superfamilie s and families. In addition , thre e clade s no t correspondin g t o named highe r tax a ar e strongl y supported . Th e clade o f advance d veneroid s (Mactroidea , Arcticoidea, Corbiculoidea , Veneroidea , Myoidea, and Pholadoidea) , th e Sportellidae-Galeom matoidea clad e an d th e Plicatuloidea-Anomioide a clade ha d ove r 93 % bootstra p suppor t i n bot h analyses. Als o supporte d b y bot h parsimon y analyses and receiving over 75% bootstrap support in a t least on e analysis were a clade of Tellinoide a and Cardioidea , a clad e o f Arcticoide a an d Veneroidea, a clad e o f Anomalodesmat a an d Heterodonta excludin g Carditoidea, an d a clade of Myoidea an d Pholadoidea . Plicatuloide a an d Anomioidea belon g i n Pectinoid a rathe r tha n Ostreoida or a separate order. Myoida i s polyphyletic , wit h a t leas t tw o separate origins from withi n Veneroida, and should not b e considere d a s a n order . However , tw o 'myoid' superfamilies , Myoidea an d Pholadoidea , form a clade within Veneroida. K. Hoekstra , i n he r master' s thesis , establishe d th e usefulness o f 18 S gen e sequenc e dat a fo r suprafamilia l systematics in the Bivalvia and experimented with various molecular techniques . G . Giribe t an d K . Hoekstr a obtained som e sequenc e dat a use d i n th e presen t stud y and helpe d wit h molecula r techniques . Wor k o n severa l pteriomorph sequence s wa s performe d i n W . Wheeler's laboratory, workin g wit h G . Giribet. The Paleontological Society, Sigma Xi, the Geological Society o f America, the Conchologists o f America , a Royste r Dissertatio n Fellowship and a Martin gran t helpe d fun d thi s research . Several peopl e helpe d obtai n specimens . G . Giribet , E . Harper an d a n anonymou s reviewe r provide d helpfu l comments an d corrections.

References ADAMKEWICZ, S . L. , HARASEWYCH , M . G. , BLAKE , J. , SAUDEK, D . & BULT , C . J . 1997 . A molecula r phylogeny o f th e bivalv e mollusks . Molecular Biology an d Evolution, 14, 619-629. BELL, J . L . & GRASSLE , J . P . 1998 . A DN A prob e fo r

MOLECULAR AND MORPHOLOGICAL EVOLUTION identification o f larvae o f the commercia l surfcla m (Spisula solidissimd). Molecular Marine Biology and Biotechnology, 7, 127-137 . CAMPBELL, D. C, HOEKSTRA, K. T. & CARTER, J. G. 1998. 18S ribosomal DN A and evolutionary relationship s within th e Bivalvia . In : JOHNSTON , P . A . & HAGGART, J. W. (eds) Bivalves: an Eon o f Evolution - Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 75-85. CANAPA, A., MAROTA, I., ROLLO, F. & OLMO, E. 1999 . The small-subunit rRNA gene sequences of venerids and the phylogen y o f Bivalvia . Journal o f Molecular Evolution, 48, 463-468. CARTER, J . G . 1978 . Ecolog y an d evolutio n o f th e Gastrochaenacea, wit h notes on the evolution o f the endolithic habitat . Peabody Museum o f Natural History, Yale University, Bulletin, 41, 1-92 . 1990. Evolutionar y significanc e o f shel l microstructure i n th e Palaeotaxodonta , Pteriomorphia, an d Isofilibranchi a (Bivalvia : Mollusca). In: CARTER , J . G . (ed. ) Skeletal Biomineralization: Patterns, Processes, and Evolutionary Trends, Vol. 1 . Va n Nostran d Reinhold, New York, 135-296. , CAMPBELL , D . C . & CAMPBELL , M . R . 2000 . Cladistic perspective s o n earl y bivalv e evolution . This volume. COHEN, B . L. , GAWTHROP , A. B . & CAVALIER-SMITH, T. 1998. Molecula r phylogen y o f brachiopod s an d phoronids base d o n nuclear-encode d smal l subunit ribosomal RN A gen e sequences . Philosophical Transactions of the Royal Society of London, Series 5,353,2039-2061. COPE, J. C. W. 1996 . Early Ordovicia n (Arenig ) bivalve s from th e Llangyno g Inlier , Sout h Wales . Palaeontology, 39, 979-1025. 1997. Th e earl y phylogen y o f th e clas s Bivalvia . Palaeontology, 40, 713-746. Cox, L . R., NEWELL, N . D., BOYD , D . W. ETAL. 1969 . In: MOORE, R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N, Mollusca 6, Bivalvia. Geological Societ y o f America , Boulder , CO , an d University o f Kansa s Press , Lawrence , KS , N1-N952. FELSENSTEIN, J . 1978 . Case s i n whic h parsimon y o r compatibility measure s wil l b e positivel y misleading. Systematic Zoology, 27, 401-^-10. FIELD, K . G. , OLSEN , G . J. , LANE , D . J . E T AL. 1988. Molecular phylogen y o f th e anima l kingdom . Science, 239, 748-753. FRISCHER, M . E., WILLIAMS, J . & KENCHINGTON , E. L . R . 1998. A molecular phylogen y o f some major groups of Pectinida e inferre d fro m 18 S rRN A gen e sequences. In : JOHNSTON , P . A. & HAGGART , J. W . (eds) Bivalves: a n Eo n o f Evolution Paleobiological Studies honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 213-221. GIRIBET, G . & CARRANZA , S. 1998 . What ca n 18 S rDNA do fo r bivalv e phylogeny ? Journal o f Molecular Evolution, 48, 256-258. & WHEELER , W . 1999 . O n gaps . Molecular Phylogenetics and Evolution, 13, 132-143.

45

, CARRANZA, S., BAGUNA, J., RIUTORT, M. & RIBERA , C. 1996 . First molecular evidenc e for the existenc e of a Tardigrad a + Arthropod a clade . Molecular Biology an d Evolution, 13, 76-84. HALANYCH, K. M., BACHELLER, J. D., AGUINALDO, A. M., LIVA, S . M. , HILLIS , D . M . & LAKE , J . A . 1995 . Evidence fro m 18 S ribosoma l DN A tha t th e lophophorates ar e protostom e animals . Science, 267,1641-1643. HILLIS, D . M . & BULL , J . J . 1993 . An empirica l tes t o f bootstrapping as a method fo r assessing confidence in phylogeneti c analysis . Systematic Biology, 42 , 182-192. & DIXON , M. T . 1991. Ribosomal DNA : molecular evolution an d phylogeneti c inference . Th e Quarterly Review of Biology, 66, 411-453. HOEH, W . R. , STEWART , D . T. , SAAVEDRA , C. , SUTHERLAND, B . W . & ZOUROS , E . 1997 . Phylogenetic evidenc e fo r role-reversa l o f gender associated mitochondrial DN A in Mytilus (Bivalvia : Mytilidae). Molecular Biology an d Evolution, 14 , 959-967. , BLACK, M. B. , GUSTAFSON, R., BOGAN, A. E., LUTZ, R. A. & VRIJENHOEK, R. C. 1998. Testing alternative hypotheses o f Neotrigonia (Bivalvia : Trigonioida ) phylogenetic relationship s usin g cytochrom e c oxidase subuni t 1 DN A sequences . Malacologia, 40, 267-278. HOLLAND, P . W. H. , HACKER , A . M . & WILLIAMS , N . A . 1991. A molecula r analysis o f th e phylogeneti c affinities o f Saccoglossus cambrensis Brambel l & Cole (Hemichordata) . Philosophical Transactions of th e Royal Society o f London, Series B , 332 , 185-189. KENCHINGTON, E. L . R. , LANDRY , D. & BIRD , C . J . 1995. Comparison o f taxa of the mussel Mytilus (Bivalvia ) by analysis of the nuclear small-subuni t rRNA gene sequence. Canadian Journal o f Fisheries an d Aquatic Sciences, 52, 2613-2620. , RODDICK , D . L. , SINGH , R . K . & BIRD , C . J . 1994. Analysis o f small - subuni t rRN A gen e sequence s from si x familie s o f molluscs . Journal o f Marine Biotechnology, 1 , 215-217. , NAIDU , K . S. , RODDICK , D . L. , COOK , D . I . & ZOUROS, E . 1993 . Us e o f biochemica l geneti c markers t o discriminat e betwee n adducto r muscle s of th e se a scallo p (Placopecten magellanicus) an d the Icelan d scallo p (Chlamys islandicd). Canadian Journal o f Fisheries an d Aquatic Sciences, 50 , 1222-1228. LITTLEWOOD, D . T . J. , FORD , S . E . & FONG , D . 1991 . Complete nucleotid e sequenc e o f the smal l subuni t ribosomal RN A gen e o f th e America n oyste r Crassostrea virginica (Gmelin ) an d a compariso n with similar sequence s fro m othe r bivalve molluscs . Nucleic Acids Research, 19, 6048. MACKEY, L. Y , WINNEPENNINCKX , B., BACKELJAU , T., DE WACHTER, R. , EMSCHERMANN , P . & GAREY , J . R . 1996. 18 S rRN A suggest s tha t Entoproct a ar e protostomes, unrelate d t o Ectoprocta . Journal o f Molecular Evolution, 42, 552-559. MARUYAMA, T., ISHIKURA , M., YAMAZAKI, S. & KANAI , S . 1998. Molecula r phylogen y o f zooxanthellat e bivalves. Biological Bulletin, 195, 70-77.

46

D. C . CAMPBEL L

MORTON, B . 1996 . Th e evolutionar y histor y o f th e Bivalvia. In: TAYLOR , J . (ed. ) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press , Oxford, 337-359. NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitates, 2206, 1-25 . & BOYD , D . W . 1975 . Parallel evolutio n i n earl y trigoniacean bivalves . Bulletin o f th e American Museum o f Natural History, 154, 53-162. POE, S . & SWOFFORD , D . L . 1999 . Taxo n samplin g revisited. Nature, 398, 299-300. RICE, E . L . 1990 . Nucleotid e sequenc e o f th e 18 S ribosomal RN A gene fro m the Atlanti c se a scallo p Placopecten magellanicus (Gmelin , 1791) . Nucleic Acids Research, 18,5551. , RODDICK, D . & SINGH, R. K. 1993. A comparison o f molluscan (Bivalvia ) phylogenie s base d o n palaeontological an d molecula r data . Molecular Marine Biology and Biotechnology, 2, 137-146. ROSENBERG, G. , TILLIER , S. , TILLIER , A. , KUNCIO , G . S. , HANLON, R . T. , MASSELOT , M . & WILLIAMS , C . J . 1997. Ribosomal RN A phylogeny of selected majo r clades i n th e Mollusca . Journal o f Molluscan Studies, 63, 301-309. RUNNEGAR, B. 1996 . Early evolution of the Mollusca: th e fossil record . In: TAYLOR , J . (ed. ) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press, Oxford, 77-87. SAITOU, N. & NEI, M. 1987. The neighbor joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406-425. SALAS, C . & GOFAS , S . 1998 . Description o f fou r ne w species of Neolepton Monterosato, 187 5 (Mollusca: Bivalvia: Neoleptonidae) , wit h comment s o n th e genus an d o n it s affinit y wit h th e Veneracea . Ophelia, 48, 35-70. SALVINI-PLAWEN, L . V . & STEINER , G . 1996 . Synapomorphies an d plesiomorphie s i n highe r classification o f Mollusca . In : TAYLOR , J . (ed. ) Origin and Evolutionary Radiation of the Mollusca. Oxford Universit y Press, Oxford , 29-51. SAUL, L. R. 1973. Evidence for the origin of the Mactridae (Bivalvia) i n th e Cretaceous . University o f California Publications i n Geological Sciences, 97, 1-59. SORENSON, M . D . 1999 . TreeRot, versio n 2a . Bosto n University, Boston, MA. STAROBOGATOV, YA . I . 1992 . Morphological basi s fo r phylogeny and classification of Bivalvia. Ruthenica, 2, 1-25. STEINER, G . 1999 . What ca n 18 S rDN A d o fo r bivalv e phylogeny? Journal o f Molecular Evolution, 48 , 258-261. & MULLER , M . 1996 . What ca n 18 S rDNA d o fo r bivalve phylogeny ? Journal o f Molecular Evolution, 43, 58-70.

SWOFFORD, D . L . 1993 . PAUP 3.1.1. Smithsonia n Institution, Washington, DC. 1999. PAUP*. Sinaue r Associates, Sunderland, MA . & BEGLE , D . P . 1993 . User's Manual fo r PAUP: Phylogenetic Analysis Using Parsimony. Laboratory o f Molecular Systematics , Smithsonia n Institution, Washington, DC . , OLSEN , G . J., WADDELL, P. J. & HILLIS, D. M. 1996. Phylogenetic inference . In: HILLIS , D. M. & MABLE , B. K . (eds ) Molecular Systematics, 2n d Edition . Sinauer Associates, Sunderland , MA , 407-514. WALLER, T . R . 1978 . Morphology, morphocline s an d a new classificatio n o f th e Pteriomorphi a (Mollusca : Bivalvia). Philosophical Transactions o f th e Royal Society o f London, Series B, 284, 345-365. 1998. Origin o f the molluscan Clas s Bivalvi a an d a phylogeny o f majo r groups . In : JOHNSTON , P . A. & HAGGART, J. W. (eds) Bivalves: a n Eon o f Evolution - Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 1-45. WHITING, M . F. , CARPENTER , J . C. , WHEELER , Q . D . & WHEELER, W . C . 1997 . The Strepsidur a problem : phylogeny o f th e holometabolou s insec t order s inferred fro m 18 S an d 28 S ribosoma l DN A sequences an d morphology. Systematic Biology 46 , 1-68. WlNNEPENNINCKX, B . & BACKELJAU , T. 1996 . 18 S rRN A

alignments derive d fro m differen t secondar y structure model s ca n produc e alternativ e phylogenies. Journal o f Zoological Systematics an d Evolutionary Research, 34, 135-143 . ,& D E WACHTER , R . 1993 . Complete smal l ribosomal subuni t RN A sequenc e o f th e chito n Acanthopleura japonica (Lischke , 1873 ) (Mollusca, Polyplacophora). Nucleic Acids Research, 21 , 1670. ,& 1994 . Small ribosomal subuni t RNA and the phylogeny of the Mollusca. Nautilus, Supp l 2,108,98-110. ,& 1996 . Investigatio n o f mollusca n phylogeny o n th e basi s o f 18 S rRN A sequences . Molecular Biology and Evolution, 13 , 1306-1317. , REID , D . G . & BACKELJAU , T. 19980 . Performance of 18 S rRNA i n littorini d phylogen y (Gastropoda : Caenogastropoda). Journal o f Molecular Evolution, 47, 586-596. , BACKELJAU, T., VAN DE PEER, Y . & D E WACHTER, R . 1992. Structure of the small ribosomal subuni t RNA sequence o f th e pulmonat e snai l Limicolaria kambeul, and phylogenetic analysis of the Mollusca. FEBS Letters, 309, 123-126. , STEINER , G. , BACKELJAU , T . & D E WACHTER , R . 1998&. Detail s o f gastropo d phylogen y inferre d from 18 S rRN A sequences . Molecular Phylogenetics and Evolution, 9, 55-63.

Cladistic perspectives on early bivalve evolution 1

J. G. CARTER1, D. C. CAMPBELL1 & M. R. CAMPBELL 2 Department of Geological Sciences, University of North Carolina at Chapel Hill, Chapel Hill NC 27599-3315, USA (e-mail: clams@ emailunc.edu) 2 Department of Geological Sciences, Indiana University, 1005 East Tenth Street, Bloomington IN 47401, USA Abstract: Parsimony analysi s suggest s derivatio n o f the Bivalvia fro m monoplacophorans rathe r than fro m rostroconchs , an d additionall y indicate s tha t a phylogeneti c classificatio n o f th e Bivalvia ca n b e achieve d b y erectin g th e superorde r Nuculaniformi i nov. an d th e orde r Nuculanoida nov. fo r the superfamil y Nuculanoidea ; relegatin g al l other palaeotaxodonts to the superorder Nuculiformii ; restrictin g th e orde r Nuculoid a t o th e familie s Nuculida e an d Pristiglomidae; expanding th e order Solemyoid a t o include ctenodontid gener a a s basal plesions; restricting the superorde r Heteroconchia to palaeoheterodonts and heterodonts, exclusive of the Modiomorphidae; relegatin g th e ne w famil y Evyanidae , th e Colpomyidae , Matheriida e an d Modiolodontidae to near-basal plesion status withi n th e superorder Pteriomorphia ; restricting the Mytiloida t o th e superfamil y Mytiloidea , inclusiv e o f modiolopsi d gener a a s basa l plesions ; placing Ortonella a s a basal plesion within th e Cyrtodontoida; expanding the order Pectinoida to include th e Myodakryotida e an d th e suborder s Limin a an d Pectinina ; an d expandin g th e superfamily Arcoide a t o includ e th e freji d gener a an d Catamarcaia a s basal plesions , an d th e family Glyptarcidae . Modiomorphid anomalodesmatans appea r t o be more closely related to the Pteriomorphia tha n t o th e Heteroconchia , an d Evyana lie s clos e t o th e commo n ancestr y o f modiomorphids an d colpomyi d pteriomorphians . Arcoid s ma y hav e evolve d fro m left-righ t symmetrical bu t otherwis e rhombopteriid-lik e ancestors , rathe r tha n fro m actinodontoid s o r directly fro m cyrtodontids . The new family Eodonida e is proposed to distinguish the nacreou s genus Eodon fro m the non-nacreous Astartida e within th e superfamily Crassatelloidea .

Bivalves appea r t o hav e evolve d fro m laterall y compressed, stenothecid monoplacophorans similar to earl y Cambria n Anabarella Vostokov a an d Watsonella Graba u (Runnega r & Pojet a 1974) . These two genera are morphologically intermediate between monoplacophorans and both rostroconchs and bivalves . The y diffe r fro m rostroconch s in lacking a tru e pegm a (Runnega r 1996 ) an d the y differ fro m bivalve s in lacking a microstructurally differentiated ligament , althoug h the y d o hav e a ligament precursor (Kouchinsky 1999). Watsonella also resembles bivalves in having a divided larva l shell (Dzi k 1994) . Anabarella, Watsonella an d the Cambrian bivalv e Pojetaia Jel l hav e a columna r prismatic oute r shel l laye r wit h the apice s o f th e prisms mutuall y isolated b y thick , interprismati c organic matrices, together with an inner shell layer consisting o f imbricate d lamina e wit h fibrou s second orde r structura l units . Thes e fibre s constitute matte d an d lamello-fibrilla r structure s ['type-2 nacre' o f Mutvei (1970)] i n stenothecids , but a wide-tablet nacreous structure in Pojetaia an d Fordilla Barrand e (Runnega r & Bentle y 1983 ;

Carter 1990 ; Runnegar & Pojeta 1992; Kouchinsky 1999). Moder n bivalv e nacr e consist s o f smaller , more horizonta l tablets , whic h onl y rarel y sho w traces o f secon d orde r fibre s (Mutve i 1983) . Th e evolutionary transitio n fro m stenotheci d mono placophoran t o tru e bivalv e require d microstructural differentiatio n o f th e ligament , th e evolution o f a t leas t on e adducto r muscle , los s o f permanent shel l gape s an d rearrangemen t o f imbricated, matted/lamello-fibrilla r lamina e int o imbricated nacreou s lamina e a s i n fordilloids , o r imbricated calciti c foliate d lamina e a s i n tuarangioids. The earl y differentiatio n o f th e bivalv e subclasses an d order s i s les s wel l understoo d an d remains controversial. When Fordilla was the only known Cambria n bivalve , Pojet a & Runnega r (1974) suggeste d that i t gave rise t o cycloconchi d palaeoheterodonts, an d palaeoheterodont s the n gave rise to the Pteriomorphia, Isofilibranchi a and Palaeotaxodonta. Pojet a (1975 ) the n offere d a n alternative scenari o i n whic h Fordilla gav e ris e directly t o th e subclas s Isofilibranchia . Babi n

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177 , 47-79 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

48

J. G . CARTE R E T AL.

(1977) suggested that Fordilla gave rise to Babinka Barrande an d Coxiconcha Babin, an d Coxiconcha then gav e rise t o the Isofilibranchia. Pojeta (1978 ) agreed wit h Babi n (1977 ) tha t Babinka evolve d directly fro m a Fordilla-like ancestor , bu t h e favoured a n independen t ancesto r fo r th e Isofilibranchia. Pojet a (1985 ) presente d a phylogeny i n whic h Pojetaia an d Fordilla ar e ancestral t o palaeotaxodont s an d isofilibranchs , respectively. Runnega r & Bentle y (1983 ) allie d Fordilla wit h Modiolodon Ulrich , an d suggeste d that Fordilla evolve d int o mytiloids , orthonotid s and pholadomyoids, wherea s Pojetaia evolved into praenuculid palaeotaxodont s and , throug h them , actinodonts an d non-mytiloi d pteriomorphians . Runnegar & Pojet a (1992 ) an d Runnega r (1996 ) offered stil l anothe r possibility , tha t Fordilla an d Pojetaia wer e stem-grou p bivalve s predatin g th e last common ancesto r o f th e extan t Bivalvia . Runnegar & Pojet a (1992 ) note d tha t i t i s unlikely tha t th e distinctiv e shel l microstructur e of Pojetaia an d Fordilla wa s los t independentl y in line s leadin g t o palaeotaxodont s an d auto lamellibranchs. MacKinnon (1982 , 1985 ) an d Berg-Madse n (1987) suggeste d tha t th e Pteriomorphi a evolve d directly fro m Cambria n Tuarangia MacKinnon . Runnegar & Bentle y (1983) , Runnega r (1983 , 1985) an d Runnegar & Pojeta (1992) believed tha t Tuarangia i s a laterall y compresse d mono placophoran closel y relate d t o Pseudomyona, noting that these two genera have similarly foliated shells. Accordin g t o thei r interpretation , Pseudomyona has a univalved protoconch an d an adductor muscle positioned differently tha n in early bivalves [see als o Runnega r & Jell (1976)] . Tuarangia and Pseudomyona diffe r fro m undoubted Cambrian and Ordovician bivalve s i n thei r D-shaped , largel y calcitic shells . Specimen s o f Middl e Cambria n Tuarangia gravgaerdensis tenuiumbonata, described by Hinz-Schallreuter (1995), show short, anterior an d posterio r ligamen t insertio n areas ; differentiated lef t an d righ t beaks ; an d possibl e anterior an d posterio r adducto r muscl e scars , suggesting close r affinit y wit h th e Bivalvi a tha n with Pseudomyona. Starobogatov (1992) utilized evolutionary trends in shel l an d sof t anatomica l features , plu s larva l structure an d development , t o divid e th e Bivalvi a (including th e Rostroconchia ) int o thre e super orders, 1 5 orders, 3 0 suborders, 1 5 infraorders an d 119 superfamilies . Starobogato v (1992 , fig . 4 ) indicated tha t th e superfamil y Phaseoloide a gav e rise t o th e superorder s Nuculiformi i Dall , Mytiliformii Ferussa c an d Conocardiformi i Neumayr. Phaseolus Monterosat o i s a Recent , resiliated nuculoid , bu t Starobogato v nevertheles s suggested tha t its pattern o f few, radially disposed ,

lamelliform hing e teet h i s a good ancestra l mode l for nuculoid , nucinelloid an d lyrodesmoi d hinges . The lyrodesmoi d hing e woul d the n hav e bee n transformed int o schizodont , actinodont , an d othe r palaeoheterodont an d heterodon t dentitions . Starobogatov include d in th e Conocardiformi i not only fordilloid s an d variou s anatomicall y derive d anomalodesmatans, but als o rostroconchs, some of which h e claime d ha d a ligamen t an d adductors . Within th e Mytiliformii , th e suborde r Lyro desmatoidei wa s identifie d a s th e ancestra l stoc k for th e order Unioniformes (lyrodesmatids, modiomorphids, gastrochaenids , trigonioids , unionoid s and variou s actinodonts) , th e orde r Phola domyiformes (Pholadomyoidea , Clavagelloidea , Pandoroidea, Thracioide a an d ancien t phola domyoid groups ) an d th e orde r Mytiliforme s (mytiloids, pterioids , cyrtodontoids , arcoid s an d early pectinoids) . Starobogato v separate d th e Ctenodontidae fro m th e Solemyida e a t the ordina l level. H e als o separate d advance d pectinoid s (including limoids ) fro m othe r pteriomorphians , implying that advanced pectinoids are more closely related t o unionoid s an d lucinoids . Starobogato v divided th e remainin g pteriomorphian s int o a n ancestral pterioid-early pectinoid clad e and a more derived cyrtodontoid-arcoid-ostreoid-mytiloi d clade, wit h arcoid s evolvin g fro m cyrtodontoid s through th e additio n o f media l hing e teeth , an d mytiloids, ostreoids an d gryphaeoids evolvin g fro m arcoids throug h replacement o f normal hing e teet h with shell marginal denticles. Waller (1998) maintaine d tha t bivalves ar e more closely relate d t o rostroconchs tha n to stenotheci d monoplacophorans, b y virtu e o f sharin g a strong pallial line and a similar lateral profile, i.e. with the ventral, aperture d par t o f th e shel l exceedin g th e dorsal par t i n height . However , th e Lowe r Cambrian stenotheci d Watsonella crossbyi Grabau, 1900, ha s a profile simila r t o bivalve s an d on e of the oldest rostroconchs, Middle Cambria n Ribeiria junior Runnegar , 1996 , ha s a typica l mono placophoran profile . Walle r (1998 ) regarde d fordilloids as stem-group bivalves evolving from an unnamed proto-bivalv e prio r t o mineralizatio n o f the ligament. He summarized features supporting a basal dichotom y betwee n th e Protobranchi a an d Autobranchia, al l o f whic h ar e non-palaeonto logical excep t fo r th e autobranc h patter n o f 'umburrid-like denta l ontogen y wit h elongate , shallowly incline d primar y teet h an d socket s characterizing early growth stages' [citin g Johnston (1991, p. 315)]. Waller (1998) als o summarized the features, non-palaeontologica l excep t fo r pre dominance o f nacreou s shel l microstructure , indicating a basa l spli t i n th e Protobranchi a between th e Nuculanoide a an d th e Nuculoidea Solemyoidea, th e latte r superfamil y expande d t o

EARLY BIVALV E EVOLUTIO N

include th e Ctenodontida e an d Nucinellidae . Within th e Autobranchia , a basa l dichotom y allegedly separate s th e Pteriomorphi a fro m th e Heteroconchia (th e latte r inclusiv e o f th e Palaeo heterodonta, Heterodont a an d Anomalodesmata) . The Pteriomorphia were said to be characterized by four sof t anatomica l feature s plu s discontinuou s fibrous ligamen t ontogen y an d anisomyaria n adductors. Th e Heteroconchi a wer e characterize d as having ligament nymphs and a core homology of 3a/2/3b hinge dentition. Salvini-Plawen & Steine r (1996 ) performe d a phylogenetic analysi s of the Bivalvia based largel y on sof t anatomy . The y utilize d 4 2 character s generalized fo r thre e families , thre e superfamilies, three order s an d thre e subclasses . Unfortunately , they incorrectly assumed that amphidetic ligaments and combine d external/interna l ligamen t ar e les s derived than opisthodetic and external ligaments in their polarizations , an d the y incorrectl y indicate d the absenc e o f a n abdomina l sens e orga n i n th e Unionoida (see Herbers 1914) . They concluded that the Palaeotaxodont a i s monophyletic , wit h th e Solemyidae close r t o th e Nucinellida e tha n t o th e Nuculoidea o r Nuculanoidea ; tha t th e Trigoniida e are closel y relate d t o th e Pteriomorphia ; an d tha t the Unionoida , Veneroida , Lucinoide a an d Myoida-Anomalodesmata-Septlbranchia ar e united i n a tetratomy . Ou r analysi s o f thei r data , with correcte d characte r state s an d polarizations , produced 1 8 equall y parsimoniou s trees . Al l 1 8 trees sho w th e Palaeotaxodont a basa l t o th e Autolamellibranchiata, bu t th e Nucinellidae , Solemyidae, Nuculoide a an d Nuculanoide a comprise a paraphyleti c assemblage . Th e Septibranchia ar e show n a s basa l autolamelli branchs; abov e th e Septibranchi a hal f o f th e tree s unite th e Unionoid a wit h a Pteriomorphia Trigoniidae clad e an d th e othe r hal f unit e th e Unionoida wit h the remainin g autolamellibranchs . In th e latte r subclade , th e Veneroida , Lucinoide a and Myoida-Anomalodesmat a differentiat e i n that sequence. Cope (19960 , b, 1997 ) indicate d tha t Fordilla and Pojetaia ar e palaeotaxodonts , an d h e an d Ratter & Cop e (1998 ) favoure d ultimat e palaeotaxodont ancestr y for al l bivalve subclasses . However, Cop e (I996b) acknowledge d tha t th e extremely smal l shell sizes of Pojetaia an d Fordilla (2-4 mm) mak e i t difficul t t o distinguis h between palaeotaxodont an d actinodon t hinges . Cop e (1996/7) followe d Newel l (1969 , p . N393 ) an d Bailey (1983 ) i n unitin g modiomorphoidean s an d actinodontians i n th e Palaeoheterodonta , althoug h he distinguishe d betwee n th e order s Modio morphoida (Modiolopsida e an d Colpomyidae ) and Actinodontoid a (Actinodontoide a an d Glyptarcoidea). Cop e (I996b) assume d tha t

49

modiomorphoids evolve d fro m actinodontoid s through los s o f hinge teet h bu t h e di d no t addres s the distinctio n betwee n th e familie s Modio morphidae an d Modiolopsidae . Cope (1996a , 1997) suggested that the Anomalodesmata evolve d from weakl y dentat e 'modiomorphoids ' suc h a s colpomyids by reducing the hinge dentition. Ratter & Cop e (1998 ) indicate d tha t frejid s an d parallel odontids share common ancestry in a descendant of Catamarcaia, an d tha t Catamarcaia an d th e Cyrtodontoidea (plu s th e ambonychioidea n an d pterioidean descendant s o f cyrtodontids ) shar e common ancestr y i n a hypothetica l descendan t o f Glyptarca Hicks . Glyptarca presumabl y evolve d from th e nuculoi d Cardiolaria Munier-Chalma s (Cope 19960 ; Ratter & Cope 1998) . Cop e (19960 , b, 1997 ) an d Ratter & Cope (1998 ) subdivide d the Pteriomorphia int o th e subclas s Pteriomorphi a sensu stricto [order s Cyrtodontoida , Limoida , Pterioida (Ambonychioide a an d Pterioidea) , Mytiloida, Ostreoid a an d Praecardioida ] an d Neotaxodonta (Catamarcaia, Arcoide a an d Limopsoidea). Cop e (1996a , p . 366 ) believe d tha t the Limoida , Pterioide a an d Ambonychioide a evolved independentl y fro m th e Cyrtodontidae . I n 1997, h e indicate d tha t th e Neotaxodont a i s characterized b y a uniqu e combinatio n o f duplivincular ligaments , a n ancestra l crossed lamellar o r complex crossed lamellar structure , and a tendenc y t o develo p taxodon t dentition . According t o Cope (1997) , neotaxodont s gav e rise to the Heterodonta, wherea s palaeotaxodont s gav e rise t o th e Palaeoheterodonta . Cope' s (1997 ) suggested porcelaneou s neotaxodon t ancestr y fo r the Heterodont a i s incompatibl e wit h th e observation b y Carte r & Lutz (1990 , pi . 104 ) tha t the Devonia n crassatelloidea n Eodon tenuistriata (Hall, 1870 ) is nacreous. Geyer & Stren g (1998 ) regarde d thei r ne w Middle Cambria n taxo n Arhouriella opheodontoides a s a bivalv e o f undetermine d subclas s and order. However , the holotype ha s overhangin g hinge teet h undercu t by th e hing e plate ; a singl e muscle sca r far from th e shell margins; a hinge bar underlying a putativ e anterior , submargina l ligament insertio n area ; an d a lancet-shaped hing e flange (putativ e posterodorsal ligamen t attachment area), al l o f whic h ar e reminiscen t o f ostracode s (see Scot t 1961) . Th e paratype ha s a more typica l bivalve hing e (possibl y edentulous , reportedl y abraded), bu t muc h mor e elevate d beak s an d a possible ligamen t nymph . I t i s no t obviousl y th e same taxon as their holotype. Other hypothese s fo r earl y bivalv e phylogen y have focuse d o n whethe r nuculoid s gav e ris e t o actinodontoids o r vic e vers a (Dechaseau x 1952 ; Babin 1966 ; Newel l 1969 ; Desparme t e t al. 1971 ; Pojeta 1971 , 1978 ; Morris & Fortey 1976 ; Scarlat o

50

J. G . CARTE R ETAL.

& Starobogatov 1978 ; Morris 1979 , 1980 ; Babin & Le Penne c 1982 ; Liljedahl 19840 , b\ Waller 1990 , 1998; Johnsto n 1991 , 1995 ; Sanche z 1995 ; Cop e 1996a, b, 1997 ; Johnsto n & Zhang 1998 ; Ratte r & Cope 1998) . Nuculoi d ancestr y i s almos t universally favoure d becaus e nuculoid s ar e common earl y Ordovicia n fossils , the y retai n a plesiomorphic protobranc h ctenidiu m an d the y show certai n earl y ontogeneti c feature s simila r t o other mollusca n classes . However , actinodontoi d ancestry fo r th e Nuculoid a wa s suggeste d b y Morris & Fortey (1976 ) an d Morris (1980 ) o n th e basis o f the existenc e o f early Palaeozoi c bivalve s with transitiona l taxodont/actinodon t hinges . Sanchez & Babin (1998) offered a third alternative, that palaeotaxodont s an d palaeoheterodont s originated independently. The present study is a phylogenetic analysis of a wide diversit y o f Palaeozoi c bivalves , base d o n characters o f shel l morphology , hing e dentition , shell musculature , shell mineralogy , and shel l an d ligament microstructure , togethe r wit h fou r sof t anatomical features inferre d from Recen t taxa. The purpose o f thi s stud y i s t o evaluat e whethe r bivalves ar e mor e closel y relate d t o monoplaco phorans o r rostroconch s an d t o establis h a preliminary phylogeneti c classificatio n fo r thi s class.

Analysed taxa The phylogeneti c analysi s include s 6 2 Palaeozoi c bivalve specie s wit h one specie s Lyrodesma majus (Ulrich 1894) , represente d b y separat e entrie s fo r adult an d juvenil e stage s (Appendi x 1) . W e als o analysed: th e Lowe r Cambrian , laterall y com pressed, stenothecid monoplacophorans Anabarella plana Vostokov a 196 2 an d Watsonella crossbyi Grabau 1900 ; th e problematic , Middl e Cambrian monoplacophoran Pseudomyona queenslandica (Runnegar & Jell 1976) ; and the Middle Cambrian, ribeirioid rostroconc h Ribeiria junior Runnegar , 1996. Shell muscle scars for the latter species were inferred fro m th e Lowe r Ordovicia n ribeirioi d rostroconch Ribeiria lucan (Walcott 1924). The two stenothecids serve d a s th e outgrou p fo r th e analysis. Bot h species hav e been implicate d i n the origin o f both th e Bivalvi a an d th e Rostroconchi a (see Pojet a & Runnega r 198 5 an d ref s cite d therein). I n selectin g bivalve s fo r study , firs t preference wa s given t o the best known species o f each genus ; preference wa s otherwise given t o the type species . Al l o f th e studie d gener a hav e Palaeozoic origins , an d al l bu t Acharax an d Modiolus ar e extinct. The represented familie s are also extinct, except for the Nuculidae, Acharacidae, Malletiidae, Limida e and Parallelodontidae .

Character definitions The characters define d for this study (Appendix 2) are al l palaeontologica l i n natur e excep t fo r inferences o f protobranc h o r non-protobranc h ctenidia, an d the presence o r absence o f abdominal, adoral ('cephalic' ) an d anterio r mantl e sens e organs. I t i s assume d tha t protobranc h ctenidi a characterized al l Cambria n monoplacophorans , rostroconchs, fordilloid s an d undoubte d palaeo taxodonts, wherea s non-protobranc h ctenidi a wer e present i n al l undoubte d pteriomorphians , palaeo heterodonts, heterodont s an d pholadomyoids . Th e ctenidial grad e o f Cambria n Pseudomyona, Cambrian Tuarangia an d al l bivalve s wit h inter mediate palaeotaxodont/actinodon t hinge s (e.g . tironuculids an d cardiolariids ) wer e designate d a s uncertain. It was assume d that an abdominal sense organ wa s presen t i n al l undoubte d Trigonioida , Unionoida an d Pteriomorphia , an d absen t i n al l Monoplacophora, Rostroconchia , Tuarangioida , Fordilloida, Tironuculidae, Nuculoida, Solemyoida and Heterodonta . Lucinoids , actinodontoid s (Cyloconchidae, Redoniidae , Nyassidae , an d Lyrodesmatidae), cardiolariids , modiomorphids , Thoralia Morris , Babinka an d Coxiconcha, wer e scored a s uncertai n fo r thi s feature . Th e reade r i s referred t o Herber s (1914) , Yong e (1977) , Haszprunar (1983 , 1985 ) an d Walle r (1998 ) fo r discussion o f this feature. An adora l sens e orga n is present i n moder n nuculid s an d solemyids , bu t is apparentl y absen t i n th e Nuculanoidea , Nucinellidae, Pristiglomida e an d i n autolamelli branch bivalve s (Waller 1998 , p . 16 , and refs cited therein). It was assumed that an adoral sens e organ is present in nuculids and praenuculids as well as in the solemyi d Acharax Dall , bu t thi s featur e wa s indicated a s uncertai n fo r th e Ctenodontidae , Tironuculidae and Cardiolariidae. The adoral sense organ was scored as absent in the Monoplacophora, Rostroconchia, Tuarangioida , Fordilloid a an d Autolamellibranchiata. A n anterio r mantl e sens e organ i s apparentl y restricted t o th e Nuculanoidea (Yonge 1939 ; Allen 1985 ; Allen & Hanna h 1986 ; Waller 1998) . Thi s featur e i s indicate d a s presen t in th e Nuculanoide a bu t uncertai n i n th e Tironuculidae, Cardiolariidae an d Ctenodontidae. I t was score d a s absen t i n th e Monoplacophora , Rostroconchia an d in all other analysed bivalves . A fe w o f th e character s i n thi s stud y ar e continuous i n nature , e.g . hing e arch , shel l elongation, beak positio n an d beak direction . Mos t of these continuous characters, however, are known to sho w quasi-discontinuou s distributions . Al l unknown character state s wer e coded a s uncertain, and al l intermediat e characte r state s an d intraspecific-variable characters as polymorphisms. Polymorphisms comprise d < 2% o f th e obser -

EARLY BIVALV E EVOLUTIO N

vations (se e separat e listing s i n Appendi x 3) . Polymorphic characters , whil e no t idea l fo r phylogenetic analyses , ca n nevertheles s increas e phylogenetic accurac y (Wien s & Servedi o 1997) . Although man y o f th e character s hav e missin g observations, i t i s importan t t o not e tha t missin g data pe r s e d o no t distor t phylogeneti c analyses . Rather, the y merel y mimi c th e effect s o f limite d taxon samplin g (Wien s 1998) . Also , highl y significant character s wit h considerabl e missin g data ma y stil l increas e phylogeneti c accurac y (Smith 1994 ; Wiens 1998) . Current terminolog y o f shel l morpholog y an d shell musculatur e follows the definitions in Cox et al (1969-1971) . Us e o f the ter m 'hinge ' implie s the presenc e o f a divide d larva l shell , wherea s 'pseudohinge' implie s a n undivide d larva l shel l (e.g. i n Pseudomyond). N o distinctio n i s mad e between a 'primary ' pallia l line , whic h maintains contact wit h th e posterio r adductor , an d a 'secondary' pallia l lin e (Yong e 1953) , whic h does not . Thes e tw o mode s o f pallia l attachment are intergradational , and th e relationshi p between the pallia l lin e an d th e posterio r adducto r muscle sca r i s deal t wit h in othe r characters . Th e shell microstructur e terminolog y follow s Carte r (1990). Ligament terminolog y i s presentl y modifie d from Walle r (1990 ) an d Carte r (1990 ) t o defin e a number o f ne w varieties . W e distinguish betwee n true ligament s an d pseudoligaments . Ligament s and pseudoligament s ar e bot h morphologicall y specialized t o enhanc e dorsal flexin g o f th e shell , but onl y tru e ligament s diffe r microstructurall y from th e adjacen t shell . Fo r example , the foliated structure comprise s the pseudoligamen t and the adjacent shel l i n Pseudomyona (se e Runnega r 1983, fig . 6B) , wherea s lamella r an d fibrou s structures compris e th e ligament , an d nacreous , porcelaneous and/o r foliate d structure s compris e the adjacen t shel l i n pteriomorphians . Th e terminology o f ancestrall y dorsa l ligament s i s summarized i n Tabl e 1 . Nuculoid an d solemyoi d internal resili a ar e excluded fro m Tabl e 1 because they ar e no t strictl y homologou s wit h dorsa l ligaments. Despit e th e physica l continuit y o f th e dorsal an d resilia l ligament s i n moder n nuculids (Waller 1990), these two ligaments have ancestrally separate fibrou s layers . Thi s i s show n b y th e Triassic malletii d Palaeoneilo elliptica (Goldfus s 1838), which has a well-mineralized dorsal, simple ligament separat e fro m it s laterall y mineralized , internal resilium. It i s tentativel y assume d tha t discontinuou s fibrous ligamen t ontogen y characterize s al l members of the Modiolopsoidea a s defined by Fang & Morri s (1997 ) (i.e . familie s Modiolopsidae , Colpomyidae and Modiolodontidae), as well as all

51

mytilids an d othe r pteriomorphians , includin g frejids an d glyptarcid s [se e discussion s b y Walle r (1990, 1998) , an d Carter & Seed (1998)] . The term 'latera l tooth', fro m th e definitio n b y Cox et al (1969 , p. N106), is restricted t o exclud e pseudolateral teeth . A latera l tooth , a s presentl y defined, i s partly or entirely located som e distance from th e beak and its proximal end does not extend to the beak. A pseudolateral toot h is partly located some distanc e fro m th e bea k bu t extend s al l th e way to the beak. Rather than utilizing inferences of dental homologie s fo r specifi c subumbonal / cardinal teeth , th e pivota l (majo r o r central ) sub umbonal/cardinal toot h has been identified, an d the shape an d orientatio n o f thi s toot h an d th e subumbonal/cardinal teet h immediatel y anterio r and posterior t o it have been described. I n counting the numbe r o f anterior , subumbonal/cardina l an d posterior teeth, only socketed teeth (i.e. as opposed to unsocketed crura) are included. Some cyrtodontid s presen t a proble m fo r classifying teeth as subumbonal or anterior because what i s probabl y a n homologou s cluste r o f relatively anterio r teet h ma y b e positione d subumbonally o r anterio r t o th e umbones . In suc h cases the more posterior an d posteriorly dippin g of any transitiona l subumbonal/anterio r teeth i n cyrtodontids hav e bee n arbitraril y counte d a s subumbonal, and the more horizontal and anteriorly dipping o f these teeth a s anterior. Unfortunately , it is possibl e tha t som e o f thes e 'subumbonal ' teet h are homologou s wit h anterio r frejid , glyptarci d and/or parallelodontid teeth. Edentulous hinge s als o presen t a proble m fo r phylogenetic studie s because edentul y has clearl y evolved severa l times in this class. Many bivalves have apparentl y los t ancestra l dentitio n i n connection wit h lif e habit s and/o r biomechanica l adaptations reducing the need to precisely guide the valves. Therefore , fiv e categorie s o f subumbona l edentuly are recognized o n the basis of association s with particula r lif e habit s o r biomechanica l adaptations: (1 ) wide , thick , pleated , periostraca l margins (e.g. solemyids); (2) wide, flexible, calciti c simple prismati c margin s (e.g . pterineids) ; (3 ) thick, gasket-lik e periostraca l margin s (e.g . som e mytilids); (4) deep burrowing life habit s with very thin, commonl y spiculos e periostraca l extension s of th e shel l margin s (man y pholadomyoids) ; (5 ) subumbonal edentul y apparentl y resultin g fro m a posterior shift i n the umbones rather than from los s of teeth (e.g. possibly falcatodontids) . 'Taxodonty' (Co x 1969 , p . N108 ) i s her e subdivided int o palaeotaxodonty , pretaxodonty , pseudotaxodonty an d heterotaxodonty . Palaeo taxodonty refer s to five o r more laterall y adjacent , regularly shape d taxodon t teet h tha t ar e neithe r strongly ventrall y divergen t no r ventrall y bifid .

52 J

. G . CARTE R ETAL.

Table 1 . Dorsal ligaments an d their evolutionary derivatives 1. Simple narrow (SN): simpl e ligament with narrow insertion area. (a) SNweak : S N ligamen t wit h plesiomorphically weakl y o r non-mineralize d media l portio n o f inne r sublayer, e.g. Pojetaia Jell . (b) SNstrong : S N ligamen t wit h strongl y mineralize d latera l an d media l portion s o f inne r sublayer , e.g . Cycloconcha milled (Meek , 1871) ; als o th e dorsa l ligamen t bu t no t th e resiliu m i n Nuculoidea pinguis (Lindstrom, 1880) . 2. Simple wide (SW) : simpl e ligamen t wit h wide insertion area , e.g . Paracyclas Hall . 3. Parivincula r narrow (PN): parivincula r ligamen t wit h short , narro w nymp h parallelling dorsa l shell margin . (a) PNweak: PN ligament wit h nymphs not strongly projecting abov e dorsa l shel l margin, e.g . Astarte Sowerby . (b) PNstrong: PN ligament wit h nymphs strongly projecting above dorsa l shel l margin , e.g. Lyrodesma Conrad . (c) PNincip: P N ligament wit h incipient nymp h flanked by very weakly differentiate d lamella r ligament groove , e.g. Silurozodus Liljedahl . 4. Parivincular wid e (PW) : shor t t o intermediat e length , barrel-shape d parivincula r ligamen t wit h wide , strongl y dorsally projecting nymph in which anterior nymph margin rises abruptl y above the hinge line. (a) PWext: externa l PW ligament, e.g . Acharax Dall . (b) PWint: internal PW ligament, partially covered b y the prismatic outer shel l layer , e.g. Solemya Lamarck . 5. Parivincular rampe d (PR) : mediu m t o long , barrel-shape d parivincula r ligamen t wit h wide , strongl y dorsall y projecting nymp h in which nymph margin increases graduall y in height toward the posterior . (a) PRthick: P R ligament attache d t o thick, flat t o concave hinge plate, wit h dorsal margi n o f nymph at or below dorsal edg e of dorsal shel l margin . (i) PRthick-shallow : wit h nymp h a t o r shallowl y submerge d belo w dorsa l edg e o f dorsa l shel l margin , e.g . Modiomorpha Hal l & Whitfield . (ii) PRthick-deep: wit h nymph deeply submerge d belo w dorsa l edge of dorsal shel l margin, e.g . Lahillia larseni Sharman & Newton, 1897 . (b) PRthin : P R ligamen t attache d t o thi n hing e plate , wit h dorsoposterio r nymp h margi n projectin g abov e th e dorsal edg e o f dorsa l shel l margi n ('thin ' refer s t o th e hing e plat e thickness , no t necessaril y t o th e ligamen t thickness). (i) PRthin-weak : relatively weak PRthin ligament, e.g. Edmondia gibbosa M'Coy , 1844 . (ii) PRthin-strong: relatively stron g PRthi n ligament , e.g. Goniophora onyx Liljedahl , 1984 . 6. Parivincular submerge d (PS) : relativel y short , parivincula r ligamen t wit h nymp h dippin g distinctl y posteroventrally relative to dorsal edge o f dorsal shel l margin. (a) PSshallow: PS ligament with fibrous layer shallowly submerged below dorsal edge of dorsal shell margin, e.g. Eodon tenuistriata (Hall , 1870) . (b) PSdeep : P S ligament wit h fibrous laye r deeply submerge d below the dorsal edg e o f dorsal shel l margin, e.g. Montanaria Spriestersbach . 7. Duplivincular horizonta l (DH) : duplivincular ligament with adult insertion grooves nearly parallel t o growth lines on hinge; earl y growt h stag e ma y or may not have inclined insertio n grooves . (a) DHopis: opisthodeti c D H ligamen t wit h ventralmost insertion groove extendin g furthe r posteriorl y tha n the dorsalmost insertio n groove. (i) DHopi s 1: DHopis ligamen t wit h only on e adul t fibrou s laye r bu t wit h another ontogeneticall y attenuated , early post-larval, fibrou s layer , e.g. Mytilus Linne . (ii) DHopis2: DHopis ligament with two or more adult fibrous layers at least in some individuals of the species . In som e DHopis 2 ligament s th e insertio n are a i s ver y narro w an d ther e ar e few , widel y separate d ligamen t grooves (e.g . Aleodonta burei Liljedahl, 1994) . I n others, ther e ar e more numerou s ligament groove s an d the early-formed fibrou s layer s ma y b e largel y restricted t o th e anterio r ligamen t insertio n are a (e.g . Cyrtodonta huronensis Billings, 1858) . A third variety shows only growth lines o n the ligament insertio n area , overlain by relatively thick, fibrous ligament ligament layers, each covering several growt h lines [e.g . Gosseletia triquetra Conrad, 1838 ; se e Carter (1990 , p . 198)] . (iii) DHopis 1-2: DHopi s ligamen t wit h normally only one adult fibrous layer but with additional adul t fibrous layers formed i n some individuals a s a consequence o f traumatic withdrawal o f the mantle margin s [e.g . Pinna Linne; see Yonge (1953)]. (b) DHopis/amph: slightly prosodeti c bu t stil l predominantl y opisthodetic D H ligament, e.g . Actinopteria Hall . (c) DHamph: strongl y amphideti c DH ligament, e.g . Leiopecten Khalfin . 8. Duplivincular inclined (DI): duplivincular ligamen t wit h adult insertion groove s distinctl y dippin g relativ e t o the hinge margin . (a) DIopis: entirel y opisthodeti c D I ligament, e.g . Ischyrodonta Ulrich . (b) DIopis/amph : slightl y prosodetic , bu t predominantl y opisthodeti c D I ligament , e.g . Ptychodesma Hal l & Whitfield. (c) DIamph: strongl y amphidetic D I ligament. (i) Dlamph-incl : DIamph ligamen t wit h all ligament groove s distinctl y incline d relativ e t o growth lines , e.g . Pseudaviculopecten Newell . (ii) DIamph-aliv : DIamph ligamen t wit h posterior ligamen t groove s al l distinctly incline d relativ e t o growt h lines, bu t anterio r par t o f ligamen t changin g t o a broad , flat , insertio n are a covere d b y weakl y o r strongl y mineralized fibrous ligament , e.g. Cosmetodon obsoletus (Meek , 1871) .

EARLY BIVALV E EVOLUTION

53

Table I. Continued 9. Alivincular (ALIV): single, triangular to slightly trapezoidal area of fibrous ligament (resilifer) flanked anteriorly and posteriorly by lamellar ligament . (a) ALIVnar : ALIV ligament with angle of divergence < 20°, e.g . Spondylus Linne . (b) ALIVmod : ALIV ligament with moderate angl e of divergence (20-110°). (i) ALIVmod-trian : ALIVmod ligament with triangular resilifer, e.g. Lentipecten hochstetteri (Zittel, 1864) . (ii) ALIVmod-trap : ALIVmo d ligamen t wit h nearl y trapezoida l resilifer , e.g . Eumorphotis multiformis (Bittner, 1899) . (c) ALIVwide: ALI V ligamen t wit h angl e o f divergenc e > 110° , e.g . Acanthopecten coloradoensis (Newberry , 1861). 10. Multivincular (MULT): serially repeated alivincular ligaments .

Palaeotaxodont teet h ma y b e orthomorphodont , concavodont (distall y concave ) o r convexodon t (distally convex) , o r a combinatio n thereo f [terminology afte r Babi n (1966)] . I n palaeo taxodont hinges , th e toot h numbe r increase s wit h shell growth above c. 1 mm length. Pretaxodonty is presently applie d t o minimall y taxodon t hinge s with only two to four stout, orthomorphodont teeth . Unlike palaeotaxodon t teeth , pretaxodon t teet h d o not increase in number with continued shell growth beyond c . 1 mm length . Fo r example , Pojetaia sarhroensis Geye r & Streng, 1998 , has onl y thre e or fou r pretaxodon t teet h i n shell s 2.2 5 mm i n length, wherea s th e Recen t nuculoi d Microgloma yongei Sander s & Allen , 197 3 has si x t o eigh t palaeotaxodont teet h i n a shel l 1.0m m i n lengt h (Sanders & Alle n 1973 , fig. 10 ) an d Ennucula aegeensis (Forbe s 1843 ) has te n palaeotaxodon t teeth i n a shel l 0.9 8 mm in lengt h (Ockelman n & Waren 1998 , fig. 4C). Pseudotaxodonty (cf . Cox 1969, p . N107 ) presentl y refer s t o fiv e o r mor e closely adjacent , mor e o r les s irregularly shaped , taxodont teeth in one or two rows. Pseudotaxodon t teeth ma y b e strongl y ventrall y divergen t and/o r ventrally bifid , bu t the y ar e no t regularl y concav e or convex . Heterotaxodont y refer s t o hinge s i n which th e anterio r teeth , whic h ma y b e palaeotaxodont o r pseudotaxodont , ar e abruptl y much large r tha n posterio r palaeotaxodon t teet h (e.g. i n Praeleda subtilis, Cop e 1999) . Cope' s (\996a) ter m 'gradidentate ' ha s bee n adopte d fo r taxodont teeth more or less gradually increasing in size anteriorly and posteriorly fro m the subumbonal region. Methods of analysis PAUP* Version 4b2a (Swoffor d 1998 ) was use d with random addition , tre e bisection-reconnectio n (TBR), delaye d transformation , an d on e 42 5 replicate an d tw o 100 0 replicate runs . The deca y index (D.L ) fo r eac h nod e i n th e stric t consensus

tree wa s calculate d usin g a 20-replicat e heuristi c search (rando m addition , TBR , delaye d trans formation) fo r tree s incompatibl e wit h each node . The D.L is the differenc e betwee n the stric t consensus tre e an d th e shortes t tre e incompatibl e with th e node . Wit h referenc e t o Fig . 4 stric t consensus tre e node s wit h D. L othe r tha n zer o include: D.I. = 41 (node 2); D.I. = 6 (node 4); D.L = 5 (node 21); D.L = 4 (nodes 3, 16-20, 31, 55, 64); D.L = 3 (nodes 7, 26, 27, 30, 34); D.L = 2 (nodes 5, 6, 29, 33, 41); and D.L = 1 (nodes 9 22-25, 28, 32, 38-40, 43, 48, 52, 53, 56, 61-63, 65). Appendix 3 shows the database for these analyses. Results The 425 replicate an d two 100 0 replicate heuristi c searches foun d th e sam e 41 1 mos t parsimoniou s trees (lengt h 1103) , suggestin g that all of the mos t parsimonious trees wer e found . Thes e tree s ha d a consistency inde x of 0.5313, a homoplasy inde x of 0.5830, a retention inde x o f 0.6372 and a rescale d consistency inde x o f 0.3385 . Th e strict , Adam s and majorit y rul e consensu s tree s ar e show n i n Figs 1-3 . The stric t consensus tree (Fig . 1) shows that th e Bivalvia (taxa 5-67) resolv e close r t o the laterally compressed monoplacophoran s Watsonella an d Pseudomyona tha n t o th e laterall y compresse d monoplacophoran Anabarella o r th e rostroconc h Ribeiria. Th e stric t consensu s tre e als o indicate s monophyly fo r the subclas s Palaeotaxodont a (tax a 8-19); a clade consistin g o f the Anomalodesmat a (taxon 41 ) togethe r wit h th e Pteriomorphi a (tax a 42-67); a clad e comprisin g th e Tironuculida e (taxon 8) , Praenuculida e (taxo n 9) , Nuculida e (taxon 10 ) and Solemyoida (taxa 17-19); a clade of the Thoraliida e (taxo n 21 ) an d Trigonioid a (tax a 22-25); a clade o f three cycloconchi d gener a (tax a 26-28); a monophyleti c orde r Mytiloid a a s presently define d (tax a 44^4-6) ; a monophyleti c Cyrtodontoida (tax a 50-52) ; monophyleti c

54

J. G . CARTE R ETAL.

Pectinoida as presently defined (taxa 55-57); and a monophyletic orde r Arcoid a (tax a 62-67) . Th e Adams consensus tree (Fig. 2) additionally resolves a clad e comprisin g th e Palaeoheterodont a an d

Heterodonta (i.e . severa l actinodont s plu s th e orders Lucinoida, Trigonioida an d Veneroida; taxa 20-40); a clad e withi n th e Pteriomorphi a comprising th e Colpomyidae , Modiolopsidae ,

Fig. 1 . Strict consensus tree for 411 most parsimonious trees from a 425 replicate, heuristic search .

EARLY BIVALV E EVOLUTIO N 5

Mytilidae, Matheriidae , Modiolodontidae , Cyrto dontidae an d Falcatodontidae , taxa 43-52; an d a second pteriomorphia n clad e represente d b y th e Ambonychioidea, Pectinoida , Pterioida , Ostreoid a and Arcoida. The majority rule consensus tree (Fig.

5

3) adds a weakly supported (53%), poorly resolved association o f th e Palaeotaxodont a togethe r wit h the Palaeoheterodonta an d Heterodonta. From the 411 most parsimonious trees, selecte d for furthe r analysi s were those trees i n whic h th e

Fig. 2 . Adams consensus tree for 411 most parsimonious trees from a 425 replicate, heuristic search.

56 J

. G . CARTER ETAL.

clade o f th e Palaeoheterodont a plu s Heterodont a was resolved a s monophyletic an d exclusive of the Palaeotaxodonta an d Pteriomorphia . Thi s filterin g did no t interfer e with evaluation of th e hypothesi s

of actinodont ancestry to arcoids because all of the most parsimoniou s trees exclude d thi s hypothesis . The filterin g excluded al l but 1 6 trees. I n these 1 6 trees, a palaeoheterodont-heterodon t clad e i s

Fig. 3 . Majority rul e consensu s tre e fo r 411 most parsimoniou s tree s from a 425 replicate, heuristic search . Al l node s are 100 % excep t wher e indicate d otherwise .

EARLY BIVALV E EVOLUTIO N

consistently basa l t o a n Anomalodesmata Pteriomorphia clade. The 1 6 trees differ onl y in the position o f Modiomorpha basa l t o Evyana, o r a s a sister grou p t o Evyana, an d i n th e positio n o f th e Matheriidae (Matheria an d Metapadid) a s a siste r group t o Modiolopsis-Whiteavesia-Modiolus, basal to these three genera or basal to Modiolodon. From thes e 1 6 trees th e reconstructio n (Fig . 4 ) i n which Modiomorpha i s basal t o the Pteriomorphi a and i n whic h th e Matheriida e ar e close r t o th e Cyrtodontidae wa s selected . Thi s selectio n wa s justified o n th e basi s tha t Modiomorpha lack s th e multiple ligamen t insertion s characteristi c o f Evyana an d man y othe r basa l o r near-basa l pteriomorphians (includin g som e colpomyid s an d modiolopsids) an d becaus e matheriid s hav e bee n regarded a s closel y relate d t o cyrtodontid s (Desbiens 1994) . Al l characte r stat e change s fo r Fig. 4 ar e give n i n Appendi x 4 an d th e mor e significant of these are reviewed briefly below. This review i s largel y limite d t o unambiguou s apomorphies and non-terminal nodes. The clad e o f Pojetaia-Fordilla-higheii Bivalvi a (node 5 ) i s characterize d b y th e appearanc e o f a subumbonal socke t i n th e righ t valv e an d a corresponding tooth in the left valve, and the loss of radial costae. The clade of Fordilla-highQr Bivalvia (node 6) begins wit h a more anteriorl y situate d bu t non-terminal beak and loss of an ancestral posterior auricle. Th e commo n ancesto r o f th e subclasse s Palaeotaxodonta an d Autolamellibranchiat a (nod e 7) i s characterize d b y separatio n o f th e lef t valv e (LV) pedal retractor sca r from th e adductor muscle scar, a shift i n the position of the posterior adductor muscle sca r close r t o th e hinge , a mor e solidl y inserted pallia l line , smal l table t nacreou s and/o r porcelaneous [crosse d lamella r (CL) , comple x crossed lamella r (CCL), an d fin e CC L and/o r homogeneous (FCCL/HOM) ] structures , an d mor e extensive mineralizatio n o f th e simple , narro w ligament. Th e Palaeotaxodont a (nod e 55 ) the n differentiates b y evolvin g an anterior mantle sens e organ an d palaeotaxodon t hing e teeth , th e latte r anteriorly concavodon t an d posteriorl y ortho morphodont, wit h th e anterio r toot h ro w les s than one third as long as the posterior tooth row and with the posterio r teet h increasin g i n siz e towar d th e posterior. Th e Autolamellibranchiat a (nod e 8 ) differentiates b y changin g from protobranchiat e t o autolamellibranchiate. Withi n th e Autolamelli branchiata, th e Heteroconchi a a s presently define d (node 35 ) the n separate s fro m th e clad e o f th e Anomalodesmata and Pteriomorphia (nod e 9). The Heteroconchia i s characterize d b y a mor e discoidal, les s dorsall y indente d anterio r shel l margin and , possibl y (ambiguous) , b y a chang e from anisomyaria n t o nearl y isomyarian . Th e Anomalodesmata-Pteriomorphia clad e ha s

57

stronger posteroventra l obliquit y an d possibl y (ambiguous) a stronge r inflectio n i n th e pos teroventral shel l margin . Modiomorpha ha s numerous apomorphies , includin g a medioventra l or posteroventra l sinus , proximit y o f th e anterio r pedal retracto r an d anterio r adducto r muscle , placement o f th e anterio r adducto r clos e t o th e hinge, partial overgrowth of the hinge dentition by the advancin g ligamen t insertio n are a an d a shallowly submerged , parivincula r rampe d ligament. Th e suborde r Pteriomorphi a (nod e 10 ) differs fro m th e Anomalodesmat a i n havin g discontinuous fibrou s ligamen t ontogen y an d multiple ligament grooves. Focusing o n the Palaeotaxodonta, ther e is a basal dichotomy betwee n th e superfamil y Nuculanoidea (Nuculites an d Palaeoneilo) an d othe r tax a traditionally place d i n th e order s Nuculoid a o r Solemyoida. Th e Nuculanoide a (nod e 56 ) i s characterized b y a shallo w pallia l sinu s an d possibly als o (ambiguous ) b y a chang e fro m nacreous t o finel y texture d porcelaneou s micro structure. Th e remainin g Palaeotaxodont a (nod e 57) ar e characterize d b y a n increas e i n umbona l elevation and , excep t fo r Eritropis, als o a chang e from anterio r t o media l beak s an d fro m posterio r orthomorphodont t o posterio r concavodon t denti tion (node 58). Except for the basal genus Eritropis, this clad e i s divided int o the famil y Cardiolariida e Cope 1997 , an d a siste r grou p (nod e 61 ) whic h includes Tironucula (famil y Tironuculidae) , Praenucula (famil y Praenuculidae) , Nuculoidea (family Nuculidae ) and the order Solemyoida . Th e Cardiolariidae (nod e 59 ) i s characterize d b y a heterotaxodont hinge . Th e siste r grou p t o th e Cardiolariidae (node 61) corresponds with a change from posteroventral to anteroventral shell obliquity, nuculiform shel l shape , mor e unifor m siz e i n th e posterior palaeotaxodon t hing e teet h an d a n increase i n th e relative length of the anterio r tooth row. Autapomorphies for Tironucula jugata include an increas e i n the hinge arc h an d th e additio n o f a single posterio r lamella r toot h abov e th e posterio r palaeotaxodont teeth . Autapomorphie s fo r Praenuculafaba includ e reduction in the number of dorsal accessor y muscl e scars t o on e o r two an d a change i n th e posterio r hing e teet h fro m con cavodont to orthomorphodont. The latter, however, is no t widesprea d fo r Praenucula, as concavodon t posterior dentition is present in Praenucula infirma Tunnicliff, 1982 , amon g other species . Th e famil y Nuculidae i s presentl y represente d b y Nuculoidea pinguis. Autapomorphies for this species include an internal resilium and increase i n size of the anterio r adductor muscl e scar s relativ e t o th e posterio r ones. The order Solemyoida (node 64) is characterized by: a triangular posteroventral shel l margin; medial

58 J

. G . CARTER ETAL.

or posterior beaks; a greatly elongated shel l anterior with nearly parallel dorsa l an d ventral margins ; at most, only a slight indentation anterio r t o opistho gyrate beaks ; a n externa l parivincula r wid e ligament; an d anterio r palaeotaxodon t teet h wit h

variable shapes . The hinge dentition i s secondaril y reduced in Acharax and other solemyoideans. The subclas s Autolamellibranchiat a (nod e 8 ) i s characterized b y non-protobranc h ctenidi a an d perhaps also (ambiguous) by non-pretaxodont, non-

Fig. 4 . Cladogram selected from 411 most parsimonious trees to base the present phylogenetic classification .

EARLY BIVALV E EVOLUTIO N

palaeotaxodont hing e teeth . Th e superorde r Heteroconchia (nod e 35 ) i s characterize d b y a change i n th e shap e o f th e anterio r shel l margi n from indente d anterio r t o th e beak s t o discoidal , with a t mos t a ver y sligh t indentation . Thi s nod e may also correspond with a change from unequal to nearly equa l adducto r muscl e scar s (ambiguous) . The Heteroconchi a show s a basa l dichotom y between a n unnamed clad e (nod e 36 ) comprisin g the Lucinoid a (nod e 37) , Thoraliida e an d Trigonioida (node 39), and a second unnamed clade comprising the Cycloconchidae sensu stricto (node 43), Redoniida e (nod e 54) , Nyassida e (nod e 50 ) and basal o r near-basal heterodonts (nod e 46). The lucinoid-thoraliid-trigonioid clad e (nod e 36 ) i s characterized b y a shif t i n the bea k positio n fro m anterior t o medial and , possibly, als o by a slender , non-bifid o r slightl y bifid , righ t pivota l cardina l tooth. Within this clade, the order Lucinoida (node 37) show s a reductio n i n th e shel l length/heigh t ratio t o < 1.25, a mor e nearl y equilatera l shel l shape, an d a wider , simpl e ligament . Th e Thoraliidae show s a n increas e i n umbona l eleva tion, change s fro m posteroventrall y t o antero ventrally oblique , evolve s a mor e robus t righ t pivotal cardina l toot h an d add s a slender , posteroventrally directe d cardina l tooth behind the pivotal cardina l toot h i n th e lef t valve . Th e orde r Trigonioida (nod e 39 ) i s characterize d b y th e change fro m a simpl e t o a n incipien t parivincular narrow ligament . I t ma y b e note d tha t Lyrodesma did not place close to Silurozodus until its juvenile stage was included as a separate taxon. An unname d cycloconchid-redoniid-nyassid heterodont clad e (nod e 42 ) i s characterize d b y posteriorly dippin g pseudotaxodon t hing e teet h located posteriorly t o th e pivotal cardina l toot h in each valve . Withi n this clade , th e Cycloconchida e (as presentl y restricted ; nod e 43 ) show s tw o anterior latera l o r pseudolateral teeth , th e stronge r of these long, slender, lamellar and continuous with the anterio r cardina l tooth . Th e remainin g tax a i n this clad e (nod e 45 ; redoniids , nyassid s an d nea r basal o r basa l heterodonts ) ar e unite d b y sub umbonal pseudotaxodonty an d by posteroventrall y dipping pseudotaxodont teeth anterior to the pivotal cardinal tooth. The nea r basal o r basal heterodon t clad e (nod e 46) is characterized by a shell length/height ratio of < 1.25; thre e o r mor e posterio r latera l o r pseudo lateral teeth , th e stronges t long , slender , an d lamellar; an d a wider posterior hing e plate. Within this clade , Genu s C o f Johnsto n & Goodbod y (1988) shares with Eodon tenuistriata (Hall, 1870 ) (node 48 ) sligh t posterio r rostrateness , a broadl y concave area immediately anterio r to the beaks and reduction o f ancestra l subumbona l pseudo taxodonty to two cardinal teeth.

59

The gener a Redonia an d Noradonta (nod e 54 ) are unite d b y havin g a singl e posterio r latera l o r pseudolateral tooth , a wide r anterio r hing e plat e and, possibly, als o separation o f the posterior pedal retractor sca r from th e posterior adducto r scar (the latter remains uncertain for Noradonta). The family Nyassida e (node 50), represented b y Nyassa, Tanaodon, Montanaria, an d genera A and B of Johnston & Goodbody (1988), is characterize d by th e additio n o f a posteroventral shel l margina l sinus. Possibl e synapomorphie s includ e a slightl y triangular posteroventral margin, a wider posterio r hinge plate and very wide CL and/or CCL structure in the inner shell layer . Within th e superorde r Pteriomorphia , Evyana baltica (Liljedahl, 1989 ) is transitional between the Modiomorphidae an d earl y 'mytiloid ' pterio morphians. Evyana combine s th e deepl y incise d lunule and rather crudely shaped cardinal dentition of Modiomorpha (althoug h mor e distinc t tha n i n Modiomorphd) wit h the opisthodetic, duplivincula r ligament o f other near-basa l pteriomorphian s suc h as colpomyids . Node s 11-1 5 joi n th e variou s 'mytiloid' familie s wit h th e orde r Cyrtodontoida . Node 1 1 correspond s wit h th e appearanc e o f a Fordilla-\ike shel l shap e an d a horizontal , opisthodetic, duplivincula r ligamen t wit h fe w ligament grooves . Nod e 1 2 involves reductio n i n the convexity of the left valve, reduction o f the lef t pivotal subumbonal hinge tooth and closer spacing of th e ligamen t grooves . Nod e 1 3 is supporte d b y only on e ambiguous synapomorph y - a change in the righ t pivota l cardinal/subumbona l toot h fro m bulbous or tuberculiform to more distinctly shaped and slender . Nod e 1 4 coincides wit h shortening of the shel l t o a length/heigh t rati o o f < 1.25 an d reduction of posteroventral shell obliquity. Node 15 is characterize d b y a decreas e i n lef t valv e convexity and partial overgrowth of the hinge plate by the ligament insertion area . Nodes 16-2 0 correspon d with the differentiatio n of th e Ambonychioidea , Pectinoida , Pterioida , Ostreoida an d th e Umburridae-Arcoid a clade . Node 16 is supported by the evolution of a posterior auricle withou t significan t posterio r extension , a byssal sinus , posteroventra l shif t o f th e posterio r adductor muscle scar and calcitic, simple prismati c structure. At node 1 7 the following are observed: a commissural shelf ; a n angula r anterio r auricle ; a n anteriorly dippin g anterio r shel l margin ; an d a straight, proximally restricted gil l wheal , the latter extending fro m th e umbona l cavit y postero ventrally below the posterior adductor . At node 1 8 the left valv e becomes mor e convex than the right one; the duplivincular ligament change s from symmetrical t o asymmetrical; th e subumbonal area has posteriorly dippin g pseudotaxodon t teeth ; th e posterior hinge acquires three or more lateral and/or

60

J. G . CARTE R E T AL.

pseudolateral teeth, wit h the lower ones aligned en echelon closer to the beak, and at least one of these long an d slender ; an d th e toot h closes t t o th e subumbonal area is short and nearly horizontal. The Ostreoida-Arcoid a clad e (nod e 19 ) corresponds wit h a reduce d byssa l sinus ; slightl y more elevate d umbones ; a chang e fro m Pterineaform t o Umburraform shel l shape ; a gil l wheal changin g fro m straigh t an d proximall y restricted, t o distall y posteriorl y curving ; tw o anterior lateral teeth, the stronger of these short and tabular; an d pseudotaxodon t teet h fillin g th e ga p between thes e teet h an d the beak. A t nod e 20 , the duplivincular ligamen t change s fro m opisthodeti c horizontal to amphidetic inclined , and the ligament symmetry change s fro m asymmetrica l t o symmetrical with a wide interfacial angl e between the ligament insertion areas . The clad e o f th e orde r Mytiloid a a s presentl y restricted (nod e 33 ) i s characterize d b y a chang e from Fordillaform t o modiolifor m o r mytilifor m shell shape , an d los s o f subumbona l teet h i n association wit h a thick, gasket-lik e periostracum . Within this clade, the family Mytilidae, represented by Cretaceou s Modiolus, differ s fro m Modiolopsis and Whiteavesia i n reducin g th e convexit y o f it s valves; shifting posteriorly the contact of the pallial line wit h th e posterio r adducto r muscl e scar ; shifting th e posterio r adducto r sca r ventrall y an d posteriorly; an d addin g abundan t irregular simpl e prismatic structur e in the inner shell layer. The superfamil y Cyrtodontoide a (nod e 30 ) i s characterized b y tw o long , lamellar , posterio r lateral teeth, not uniformly aligned en echelon, and separated b y a wide , edentulou s ga p fro m th e subumbonal hing e teeth . Withi n thi s superfamily, Ortonella i s basa l t o th e superfamilie s Cyrtodontoidea an d Falcatodontoidea . Th e Cyrtodontidae, a s represente d b y Cyrtodonta saffordi (Hal l 1859) , ha s a mor e discoida l ventra l shell margin ; more mediall y situate d beaks; mor e equal adducto r muscl e scars ; a gil l whea l proximally dorsoventra l an d distall y posteriorl y curving; a shortene d posterior lateral toot h closest to th e beak ; a thicke r anterio r hing e plate ; an d a deeply bifid , ventrall y o r anteroventrall y ope n subumbonal toot h anterio r t o th e pivota l subumbonal tooth. In contrast, the Falcatodontida e has a posterior auricle ; strong , radial costae ; a less elliptical, mor e triangula r posterio r adducto r muscle scar; two posterior lateral teeth in one valve and thre e i n th e other ; subumbona l edentul y resulting fro m a posterio r shif t i n th e umbones ; and a reductio n i n overgrowt h o f th e hing e dentition. The clade of the Pectinoida (nod e 27) is defined by reduction i n the convexity of the left valve , loss of hinge overgrowt h an d a change in th e ancestral

duplivincular, horizonta l ligamen t fro m opistho detic t o amphidetic . Ambiguou s synapomorphie s include th e adoptio n o f valve-indifferen t pleuro thetic habit s an d a shif t fro m anterio r t o media l beaks. Withi n thi s clade , suborde r Limin a (represented b y Palaeolima) i s characterize d b y a change fro m sligh t posteroventra l t o sligh t anteroventral shel l obliquity ; los s o f th e commissural shelf ; a chang e fro m prosogyrat e t o orthogyrate; closel y t o medium-space d radia l costae; an d th e chang e fro m duplivincular , horizontal, amphideti c ligamen t t o a n alivincula r ligament. Th e suborde r Pectinin a (represente d b y Leiopecten) show s a slight increase in extension of the posterior auricl e beyond the subauricular sinus; a sligh t increas e i n th e shel l length/heigh t ratio ; a more discoidal , anteriorl y incline d anterio r shel l margin; a more convex left valve ; and a hinge with one o r tw o anterio r an d posterior , elongat e teet h that both approximate th e subumbonal area without strong, intervening teeth. Synapomorphies fo r the order Arcoida (nod e 21) include a stronge r inflectio n i n th e posteroventra l shell margin ; posteroventra l inclinatio n o f th e anterior shell margin; reduction of the commissural shelf; secondaril y equivalv e shells ; movemen t o f the posterio r adducto r close r t o th e hinge ; a mor e elliptical anterio r adductor ; increase i n the number of anterior lateral or pseudolateral hinge teeth fro m two t o thre e o r more ; an d a chang e i n th e orientation o f th e pseudotaxodon t subumbona l teeth fro m posteroventrall y incline d t o nearl y vertical or dorsally divergent .

Discussion The present analysi s suggest s tha t the Bivalvia are more closel y relate d t o Watsonella an d Pseudomyona tha n t o Anabarella an d th e Rostroconchia . This analysi s als o suggest s tha t th e commo n ancestor of Tuarangia an d Pojetaia (Fig . 4, node 4) had a non-rostrat e posterior ; a moderatel y t o slightly elongat e ventra l shel l margin ; n o shel l marginal sinuses ; sligh t posteroventra l obliquity ; low, medial beaks with, at most, a slight indentation anterior t o them ; a n angula r posterio r auricle ; n o lunule o r escutcheon ; n o pegm a o r pegma-lik e shelf; thre e o r more subumbonal , dorsal accessor y muscle scars; a non-sinuate pallial line ; a straight , edentulous hinge ; a n aragoniti c shell ; an d a non mineralized o r weakly mineralized, narrow , dorsal, simple ligament. Some of the features indicated for this ancesto r ar e mutuall y inconsistent . Fo r example, presenc e o f a protoconc h (characte r 35 , beak direction) conflicts with medial division of the larval shel l (characte r 98) . Here, PAUP reverted t o a mor e distan t ancestra l stat e fo r characte r 3 5

EARLY BIVALV E EVOLUTION

because Tuarangia an d Pojetaia diffe r i n thi s character. Fo r a simila r reason , a pseudoligamen t and tru e ligamen t ar e indicate d a s presen t unde r different characters . Contrar y t o thes e indications , the immediate common ancestor of Tuarangia an d Pojetaia probabl y had a divided larval shell and a true ligament , althoug h whethe r i t ha d differentiated anterio r an d posterio r adducto r muscles remains uncertain. The presen t dat a reinforc e th e observatio n b y Waller (1998 , fig . 3 ) tha t th e subclas s Palaeo taxodonta show s a basa l dichotom y betwee n th e superfamily Nuculanoide a an d th e superfamilie s Nuculoidea an d Solemyoidea . Thi s i s significan t because Waller's evidence was largely soft anatomical and the present is principally palaeontological . In recognitio n o f thi s dichotomy , th e subclas s Palaeotaxodonta i s divide d int o th e superorder s Nuculaniformii nov. (containin g th e orde r Nuculanoida nov.) and Nuculiformii (nom. transl Starobogatov, 1992, ex Nuculidae Gray, 1824). The Nuculiformii comprise s al l non-nuculanoidea n palaeotaxodonts. It is als o suggested that Eritropis is exclude d fro m th e Cardiolariida e an d tha t th e 'malletiid' Ekstadia Soot-Ryen , 1964 , i s included in thi s family . Th e Cardiolariida e thu s define d i s uniquely characterize d b y a heterotaxodont hinge . In orde r t o preserv e th e orde r Nuculoid a a s nonpar aphyletic, it should be limited to the superfamily Nuculoidea, families Nuculidae and Pristiglomida e (Sanders & Allen, 1973). The Pristiglomidae share numerous apomorphie s wit h th e Nuculidae , including a sharpl y separate d heel , multipl e loop s in the hindgut and a laterally mineralize d resiliu m (Waller 1998) . Contrary t o Cop e (1996a , 1997) , th e Sole myoidea appea r t o b e closel y relate d t o th e Palaeotaxodonta through the family Ctenodontida e Wohrmann, 1893 . A s constitute d b y McAleste r (1969), th e famil y Ctenodontida e i s presentl y shown t o b e paraphyleti c wit h respec t t o th e Solemyoidea. Pojet a (1988 ) indicate d tha t th e Ctenodontidae i s poorl y conceptualized , s o h e tentatively assigned Ctenodonta an d Tancrediopsis, among othe r genera , t o th e nuculanoidea n famil y Malletiidae. Th e presen t analysi s suggest s tha t Ctenodonta an d Tancrediopsis shoul d b e con sidered near-basa l plesion s withi n th e orde r Solemyoida. The present analysis supports the hypothesi s of Sanchez & Babi n (1998 ) tha t nuculoid s an d palaeoheterodonts merel y shar e commo n ancestry. In this regard, it is important to note that Fordilla was diagnose d a s non-pretaxodont . On e migh t argue tha t Fordilla ha s instea d a reduce d pretaxodont dentition, considering its close affinit y with Pojetaia. I n eithe r case , however , fordilloi d dentition, an d henc e th e dentitio n immediatel y

61

preceding th e differentiatio n o f th e subclasse s Palaeotaxodonta an d Autolamelibranchiata , wa s sparsely dentat e an d neithe r palaeotaxodon t no r actinodont. Actinodont y ha s apparentl y evolve d convergently amon g palaeotaxodonts , palaeo heterodonts and pteriomorphians, just as taxodonty sensu lato ha s evolve d convergentl y amon g palaeotaxodonts, actinodonts , unionoids and pteriomorphians. Th e origi n o f th e subclas s Auto lamellibranchiata ma y correlate with a change from pretaxodont t o non-pretaxodon t an d non-palaeo taxodont dentition, as well as with the change fro m protobranch to non-protobranch ctenidia . The superorde r Heteroconchia , a s presentl y restricted t o palaeoheterodont s an d heterodonts , ancestrally differ s fro m th e Anomalodesmat a an d Pteriomorphia i n having a more discoidal anterio r and mor e equa l adducto r muscl e scars . Thes e changes sugges t a shif t fro m relativel y inactiv e to active burrowing life habits. Within th e Heteroconchia , th e thoraliid trigonioid-lucinoid clad e (nod e 36 ) i s no t sup ported by the strict or Adams consensus trees and it is only supported at 56% by the majority consensus tree. It s significanc e is therefor e questioned . Th e other heteroconc h clade , consistin g o f actinodont s and heterodonts , i s supporte d b y th e Adam s consensus tree and therefore more likely reflect s a natural association . Within th e actinodont-heterodon t clade , Noradonta doe s not place close to Lyrodesma i n the Adams o r majorit y consensu s trees , bu t i t i s resolved clos e t o Redonia i n Fig . 4 . Pojet a & Gilbert-Tomlinson (1977 ) an d Babi n (1982a ) placed Noradonta shergoldi Pojet a & Gilbert Tomlinson, 1977 , i n th e famil y Lyrodesmatidae . However, som e specie s o f Noradonta, suc h a s Noradonta redoniaeformis (Thoral , 1935) , ar e strikingly simila r t o Redonia bohemica Barrande, 1881, differin g i n little mor e tha n th e presenc e o f dental microcrenulations . Redonia an d Noradonta lack ligament nymphs (Pojeta 1978, pi. 4, figs 1 and 2; Babin 1982a , pi. 9, fig. 2), but nymphs are well developed i n Lyrodesma. The presen t stud y i s i n agreement wit h Johnston & Goodbody (1988 ) and Babin & Gutierrez-Marc o (1991 ) i n tha t th e taxonomic significance of dental microcrenulation s has bee n overemphasize d i n th e definitio n o f palaeoheterodont families . Eodon i s on e o f th e earlies t know n repre sentatives o f th e superfamil y Crassatelloidea , an d hence o f th e orde r Veneroid a an d grou p Heterodonta. Chava n (1969 , p . N565 ) place d thi s genus i n th e famil y Astartida e d'Orbigny , bu t i t differs fro m astartids i n retainin g a partiall y nacreous interior [Carte r & Lutz 1990 , pi. 104 ; see Taylor (1973 ) fo r Astartidae ] an d i n havin g a ligament transitiona l betwee n simpl e wide , a s i n

Table 2. Classification Class Bivalvia Linne, 175 8 Order Tuarangioid a Mackinnon , 198 2 Genus Tuarangia Mackinnon , 198 2 Genus Pojetaia Jell, 198 0 Genus Fordilla Barrande, 188 1 Subclass Palaeotaxodont a Korobkov , 195 4 Superorder Nuculaniformi i nov. Order Nuculanoid a nov. Superfamily Nuculanoide a Adam s & Adams, 185 8 Family Malletiidae Adam s & Adams, 185 8 Genus Palaeoneilo Hall & Whitfield, 186 9 Genus Nuculites Conrad, 184 1 Superorder Nuculiformi i Gray , 182 4 Genus Eritropis Pojeta & Gilbert-Tomlinson, 197 7 Family Cardiolariida e Cope , 199 7 Genus Ekstadia Soot-Ryen, 196 4 Genus Cardiolaria Munier-Chalmas, 187 6 Genus Praeleda Pfab, 193 4 Unnamed clade Family Tironuculida e Babin, 198 2 Genus Tironucula Morris & Fortey, 197 6 Family Praenuculida e McAlester , 196 9 Genus Praenucula Pfab , 193 4 Order Nuculoid a Gray , 182 4 Superfamily Nuculoide a Gray , 182 4 Family Nuculida e Gray, 182 4 Genus Nuculoidea Williams & Breger, 191 6 Order Solemyoid a Gray , 184 0 Genus Tancrediopsis Beushausen , 189 5 Genus Ctenodonta Salter, 185 2 Superfamily Solemyoide a Gray, 184 0 Family Acharacida e Scarlat o & Starobogatov, 197 9 Genus Acharax Dall , 190 8 Subclass Autolamellibranchiat a Grobben , 189 4 Superorder Heteroconchi a Hertwig , 189 5 Unnamed clad e Order Lucinoida Fleming , 182 8 Superfamily Babinkoide a Horny , 196 0 Family Babinkidae Horny, 196 0 Genus Babinka Barrande, 188 1 Superfamily Lucinoide a Fleming , 182 8 Family uncertain Genus Ilionia Billings, 187 5 Unnamed clad e Family Thoraliidae Morris , 198 0 Genus Thoralia Morris , 198 0 Order Trigonioid a Lamarck , 181 9 Family Lyrodesmatidae Ulrich , 189 4 Genus Lyrodesma Conrad, 184 1 Superfamily Trigonioide a Lamarck , 181 9 Family Schizodida e Newel l & Boyd, 197 5 Genus Silurozodus Liljedahl, 199 2 Unnamed clad e Superfamily Cycloconchoidea Ulrich , 189 3 Family Cycloconchida e Ulrich , 189 3 Genus Cycloconcha Miller, 187 4 Genus Fortowensia Cope, 199 6 Genus Actinodonta Phillips , 184 8 Unnamed clad e Unnamed clad e Genus Copidens Pojet a & Gilbert-Tomlinson, 1977 Genus Ananterodonta Babi n & Gutierrez-Marco, 198 5 Unnamed clad e Genus C Johnston & Goodbody, 198 8 Order Veneroida Rafinesque, 181 5 Superfamily Crassatelloide a Ferussac , 182 2 Family Eodonidae nov. Genus Eodon Hall in Miller, 187 7 Unamed clad e Family Redoniida e Babin , 196 6 Genus Redonia Rouault, 1851 Genus Noradonta Pojeta & Gilbert-Tomlinson, 197 7

Table 2. Continued Family Nyassidae Hall, 188 5 Unnamed clade Genus Nyassa Hal l & Whitfield, 1869 Genus Tanaodon Kirk , 192 7 Unnamed clade Genus A Johnston & Goodbody, 198 8 Genus B Johnston & Goodbody, 198 8 Genus Montanaria Spriestersbach, 190 9 Superorder Anomalodesmat a Dall, 188 9 Order Modiomorphoida Miller, 187 7 Superfamily Modiomorphoide a Miller, 187 7 Family Modiomorphidae Miller, 187 7 Genus Modiomorpha Hal l & Whitfield, 186 9 Superorder Pteriomorphia Beurlen, 194 4 Family Evyanidae nov. Genus Evyana Liljedahl, 199 0 Family Colpomyidae Pojeta & Gilbert-Tomlinson, 197 7 Genus Colpomya Ulrich , 189 4 Order Mytiloida Rafinesque, 1815 Superfamily Mytiloide a Rafinesque, 1815 Genus Modiolopsis Hall , 184 7 Genus Whiteavesia Ulrich , 189 3 Family Mytilidae Rafinesque, 1815 Subfamily Modiolina e Keen , 195 8 Genus Modiolus Lamarck, 179 9 Family Matheriidae Scarlato & Starobogatov, 197 9 Genus Matheria Billings , 185 8 Genus Metapadia Desbiens , 199 4 Family Modiolodontidae Fan g & Morris, 199 7 Genus Modiolodon Ulrich , 189 4 Order Cyrtodontoida Ulrich, 189 4 Genus Ortonella Ulrich, 189 4 Superfamily Cyrtodontoide a Ulrich, 189 4 Family Cyrtodontidae Ulrich, 189 4 Genus Cyrtodonta Billings , 185 8 Superfamily Falcatodontoide a Cope , 1996 b Family Falcatodontidae Cope , 1996 b Genus Falcatodonta Cope, 1996 b Superfamily Ambonychioide a Miller, 187 7 Family Ambonychiidae Miller, 187 7 Genus Ambonychia Hall, 184 7 Family Myalinidae Freeh, 189 1 Genus Septimyalina Newell , 194 2 Order Pectinoida Rafinesque, 1815 Family Myodakryotidae Tunnicliff, 198 7 Genus Myodakryotus Tunnicliff , 198 7 Suborder Limina Rafinesque, 1815 Superfamily Limoide a Rafinesque, 1815 Family Limidae Rafinesque, 1815 Genus Palaeolima Hind, 190 3 Suborder Pectinina Rafinesque, 1815 Superfamily Leiopectinoide a Krasilova , 195 9 Family Leiopectinidae Krasilova, 1959 Genus Leiopecten Khalfin, 194 0 Order Pterioida Gray, 1847 Superfamily Pterioide a Gray, 1847 Family Pterineidae Miller, 187 7 Genus Pterinea Goldfuss, 182 6 Genus Tolmaia Williams , 190 8 Order Ostreoida Ferussac, 182 2 Family Rhombopteriidae Korobkov , 196 0 New genus , new species Johnston, 1993 Family Umburridae Johnston, 199 1 Genus Umburra Johnston , 199 1 Order Arcoida Stoliczka, 187 1 Superfamily Arcoide a Stoliczka , 187 1 Genus Alytodonta Cope , 199 7 Genus Freja Liljedahl , 198 4 Genus Trecanolia Ratte r & Cope, 199 8 Genus Catamarcaia Sanchez & Babin, 199 3 Family Glyptarcidae Cope, 1996 b Genus Glyptarca Hicks , 187 3 Family Parallelodontidae Dall , 189 8 Genus Cosmetodon Branson, 194 2

64

J. G . CARTE R ETAL.

Genus C o f Johnsto n & Goodbod y (1988) , an d parivincular submerged , a s i n astartids . I n recognition o f these distinctions, Eodon is placed in the new crassatelloidean family Eodonidae . The presen t phylogeneti c reconstructio n con flicts wit h Cope' s (1997 ) hypothesi s tha t palaeo heterodonts gav e ris e t o pteriomorphian s an d heterodonts throug h arcoi d intermediates . Th e Heterodonta, a s represente d b y Eodon, i s a siste r group t o th e Redoniida e an d Nyassidae , wit h al l three taxa most likely evolving from cycloconchid like ancestor s independentl y o f th e Arcoida . I n order t o exclud e paraphyl y wit h th e Crassatel loidea, th e superfamil y Cycloconchoidea an d th e family Cycloconchida e ar e restricte d t o Cycloconcha, Actinodonta and Fortowensia among the genera presently studied . This analysis als o conflicts with Waller's (1990 , 1998) hypothesi s tha t th e Heteroconchi a shoul d include the Anomalodesmata. Waller (1998) cited a 3a/2/3b cor e denta l homolog y an d ligamen t nymphs a s apomorphies , separatin g th e Hetero conchia (inclusiv e o f th e Anomalodesmata ) fro m the Pteriomorphia . However , mos t earl y anomalo desmatans ar e edentulous , including som e modio morphids (e.g . Phorinoplax striata Johnston , 1993). Modiomorpha, regarde d a s an anomalodesmatan b y Walle r (1990) , Morri s e t al. (1991) , Johnston (1993) an d Fang (1998), has only crudely formed subumbona l hing e teet h tha t ar e no t obviously consisten t wit h a 3a/2/3 b denta l homology. Evidenc e i s observe d fo r a clos e relationship between the Anomalodesmata and the Pteriomorphia. Fo r thi s reason , th e superorde r Heteroconchia i s restricte d t o th e Palaeo heterodonta an d Heterodonta , exclusiv e o f th e Modiomorphidae an d probabl y mos t othe r anomalodesmatans. However , th e possibilit y tha t some non-modiomorphid s currentl y classifie d a s anomalodesmatans ar e actuall y heteroconch s cannot presently be excluded. It is also noteworthy that ligamen t nymph s ar e absen t i n man y earl y heteroconchs. Walle r (1998 , p . 34 ) acknowledge d their absenc e i n Copidens an d n o evidenc e i s observed fo r them in Actinodonta cuneata Philips, 1848 an d Cycloconcha milleri (Meek , 1871) . Th e latter specie s ha s a dorsall y open , simple , narro w ligament fossette with, at most, only a very weakly developed latera l groove fo r the lamellar ligament. The redoniids Redonia and Noradonta, the nyassids Nyassa an d Tanaodon, an d th e lucinoid s Babinka and Ilionia als o lac k distinc t nymphs . Thus , ligament nymph s ar e clearl y no t a synapomorph y for th e superorde r Heteroconchia , an d thes e structures hav e probabl y evolve d convergentl y in trigonioids, veneroid s and among later lucinoids. Waller (1998 ) appear s t o b e correc t i n regarding mytiloid s (sensu lato] a s near-basa l

pteriomorphians. I n fact , th e superfamil y Modiolopsoidea Fischer , 1887 , a s defined by Fang & Morri s (1997 ) t o includ e th e Modiolopsida e Fischer, Colpomyida e Pojet a & Gilbert-Tomlinson and Modiolodontidae Fan g & Morris, appears to be paraphyletic wit h respec t t o th e remainin g Pteriomorphia. Also , th e famil y Modiolopsida e i s paraphyletic wit h respec t t o th e superfamil y Mytiloidea. Th e famil y Matheriida e Scarlat o & Starobogatov, 1979 , whic h Desbien s (1994 ) included i n th e superfamil y Cyrtodontoidea , i s apparently mor e closel y relate d t o th e Modiolopsidae an d Modiolodontida e tha n t o th e Cyrtodontidae. Within the order Cyrtodontoida , th e superfamily Cyrtodontoidea i s paraphyletic wit h respect t o the superfamily Falcatodontoidea Cope , and within the superfamily Arcoidea, th e family Frejidae Ratter & Cope (represente d b y Freja, Alytodonta an d Trecanolia) i s paraphyleti c wit h respec t t o Catamarcaia, th e famil y Glyptarcida e Cope , an d the family Parallelodontidae Dall . In orde r t o resolv e paraphyleti c relationship s within th e Pteriomorphia , i t i s recommende d tha t the superfamil y Modiolopsoide a i s abandone d relegating th e modiolopsid gener a t o basal plesio n status withi n th e superfamil y Mytiloidea ; relegating Ortonella to basal plesio n status within the Cyrtodontoida ; relegatin g th e freji d gener a t o basal plesion statu s withi n th e superfamil y Arcoidea; an d includin g th e famil y Glyptarcida e within th e superfamil y Arcoidea . Cop e (1997 ) suggested tha t Catamarcaia belong s i n th e Parallelodontidae. However , thi s placement woul d make th e Parallelodontida e paraphyleti c wit h respect t o th e Glyptarcidae . Th e presen t analysi s supports th e suggestio n b y Sanche z (1995 ) tha t Catamarcaia i s basal t o th e Parallelodontidae, bu t also that Catamarcaia is basal to the Glyptarcidae. Therefore, Catamarcaia i s her e place d i n th e superfamily Arcoidea as an isolated plesion basal to both the Parallelodontidae an d Glyptarcidae . The genu s Myodakryotus Tunniclif f wa s regarded b y Tunniclif f (1987 ) an d Pojet a & Runnegar (1985 ; a s Prolobella) a s a possible lin k between th e familie s Cyrtodontida e an d Limidae . Pojeta & Runnegar (1985) place d thi s genus in the Limidae, bu t Tunniclif f (1987 ) assigne d i t t o th e family Myodakryotidae. The present study suggests a basa l relationshi p wit h bot h th e superfamil y Limoidea an d superfamil y Leiopectinoidea . Therefore, th e Myodakryotidae , th e superfamil y Limoidea, the superfamily Leiopectinoidea an d the various other pectinoid superfamilie s ar e placed i n the orde r Pectinoida . Withi n thi s order , th e suborders Limin a Rafinesqu e an d Pectinin a Rafinesque ar e recognized. The present study confirms that the Ostreoida are

EARLY BIVALV E EVOLUTIO N

more closel y relate d t o th e Pterioid a tha n t o th e Pectinoida. Thi s relationshi p i s als o compatibl e with dat a o f shel l microstructur e (Carte r 1990 ; McRoberts & Carter 1994) and DNA (Campbell et al. 1998) . Th e majo r anatomica l an d shel l micro structural features reportedly linking ostreoids with pectinoids (Walle r 1998) , suc h a s tentacl e grad e and calciti c foliate d structure , ar e eithe r plesio morphic or convergent. Umburra apparentl y bridges th e morphologica l gap betwee n th e earl y ostreoi d famil y Rhom bopteriidae and the order Arcoida. This placement is compatibl e wit h th e suggestio n b y Johnsto n (1991) tha t Umburra i s closel y relate d t o th e Rhombopteriidae, bu t i t contradict s Johnston' s hypothesis tha t Umburra i s basa l t o th e Rhom bopteriidae, Pterineida e an d Pectinoida . Th e present analysi s suggest s placemen t o f th e famil y Umburridae betwee n th e order s Ostreoid a an d Arcoida. Johnston (1991 ) an d Walle r (1998 ) define d th e Eupteriomorphia o f Bos s (1982 ) t o includ e th e family Umburridae , th e orde r Pterioid a an d th e order Ostreoida , th e latte r containin g both oyster s and scallops. The y also regarded arcoids, ambonychiids an d limids a s basal to the Eupteriomorphia . According t o th e presen t analysis , arcoid s ar e derived, rathe r tha n basal , relativ e t o th e Pectinoida, Pterioid a an d Ostreoid a a s presentl y defined. Consequently , any phylogenetic definition of the Eupteriomorphia that includes the latter three orders must also include the Arcoida. It is therefore recommended tha t th e nam e Eupteriomorphi a b e abandoned. Th e positio n o f th e Arcoid a i n Fig. 4 contradicts mos t current hypotheses fo r the origi n of this group. It suggests that arcoids evolved fro m left-right symmetrica l relative s o f rhombopteriid s rather tha n fro m cyrtodontid s o r actinodonts . Verification o f mineralogica l dat a fo r rhom bopteriids, umburrids , actinodont s an d earl y arcoids, muc h o f whic h i s presentl y tentative , should help resolve this issue. It may be noted, in this regard, that irreversibly polarizin g oute r layer calcite (characte r 90) , a s suggeste d b y Carte r (1980), reduced the proportion of clades supportin g many o f the node s i n th e majorit y rul e consensu s tree, but resulted in no change in the topology of the Pteriomorphia. Thi s polarizatio n adde d two steps , i.e. replacin g th e appearanc e o f calcite a t node 1 6 and it s secondar y los s a t node 2 1 (Arcoida) , wit h the appearanc e o f calcit e a t node s 26 , 28 , 2 9 an d taxon 60. The taxonomic revisions suggested by the present phylogeneti c analysi s ar e summarize d i n Table 2. This researc h wa s supporte d b y th e Natio n Scienc e Foundation (NS F GB36048). Th e Microstructure data for the Nyassidae are based o n a paper in preparation b y the senior author an d Dr P. A. Johnson.

65

Appendix 1 : Species analysed 1. Clas s Monoplacophora , famil y Stenothecidae : Watsonella crossbyi Grabau , 1900 , Lowe r Cambrian , Siberian Platform . 2 . Clas s Monoplacophora , famil y Stenothecidae: Anabarella plana Vostokova, 1962, Lower Cambrian, Siberia n Platform . 3 . Class Monoplacophora , family uncertain: Pseudomyona queenslandica (Runnegar & Jell, 1976) , Middle Cambrian , Queensland , Australia . 4. Clas s Rostroconchia , orde r Ribeirioida , famil y Ribeiriidae: Ribeiria junior Runnegar , 1996 , Middl e Cambrian, Queensland , Australi a [muscl e scar s based on Ribeiria lucan (Walcott , 1924) , Lowe r Ordovician , Canada]. CLAS S BIVALVIA : 5 . Tuarangia gravgaerdensis Berg-Madsen , 1987 , Middl e Cambrian , Denmark. 6 . Pojetaia runnegari Jell , 1980 , Lowe r Cambrian, Sout h Australi a an d Ne w Sout h Wales , Australia. 7 . Fordilla troyensis Barrande , 1881 , Lowe r Cambrian, Greenland . 8 . Tironucula jugata Morri s & Fortey, 1976 , Lowe r Ordovician , Spitsbergen . 9 . Praenucula faba Liljedahl , 1994 , Uppe r Silurian , Gotland. 10 . Nuculoidea pinguis (Lindstrom , 1880) , Upper Silurian , Wenlock , Gotland . 11 . Cardiolaria beirensis (Sharpe , 1853) , Middl e Ordovician , Spain . 12 . Praeleda subtilis Cope, 1999 , Middle Ordovician , Wales. 13. Eritropisperegrinata Cope , 1999, Middle Ordovician, Wales. 14 . Ekstadia tricarinata Soot-Ryen , 1964 , Uppe r Silurian, Gotland. 15 . Nuculites oblongatus Conrad 1841 , Middle Devonian , Ne w York . 16 . Palaeoneilo fecunda (Hall, 1862) , Uppe r Ordovician , Dubuque , Iowa . 17 . Ctenodonta tennesseensis Pojeta , 1988 , Middl e Ordovician, Tennessee . 18 . Tancrediopsis gotlandica (Soot-Ryen, 1964) , Upper Silurian, Gotland. 19 . Acharax (Nacrosolemyd) trapezoides (Meek , 1874) , Uppe r Carboniferous, easter n Kentucky . 20. Redonia bohemica Barrande, 1881 , Middl e Ordovician , Bohemia , Czec h Republic. 21 . Thoralia languedociana (Thoral , 1935) , Lower Ordovician, souther n France. 22. Adult Lyrodesma majus (Ulrich , 1894) , Ordovician , Ohio . 23 . Juvenil e Lyrodesma (Ulrich , 1894) , a s i n adul t Lyrodesma majus except fo r juvenil e hing e an d ligamen t base d o n Lyrodesma sp . from Lowe r Silurian o f Ohio (Harriso n & Harrison, 1975 , pi . 2 , fig s 14-17) . 24 . Lyrodesma sp. , Middle Ordovician , Britis h Columbia , fro m Johnsto n (1996, pi . 3 , fig s 1-5) . 25 . Silurozodus gotlandicus Liljedahl, 1992 , Uppe r Silurian , Gotland . 26 . Cycloconcha mediocardinalis Miller , 1874 , Uppe r Ordovician, Ohio. 27 . Fortowensia grandis Cope, 1996£> , Lower Ordovician, Arenig , Sout h Wales. 28. Actinodonta cuneata Philips , 1848 , Lowe r Silurian , Llandovery , Wales. 29 . Nyassa dorsata (Goldfuss , 1840) , Middl e Devonian, Hamilto n Group , Ne w York . 30 . Tanaodon louderbacki Kirk , 1927 , Middl e Devonian , Sichua n Province, China . 31 . Noradonta shergoldi Pojet a & Gilbert-Tomlinson, 1977 , Ordovician , Georgin a Basin , Australia. 32 . Ne w genu s A o f Johnsto n & Goodbod y (1988), Middle Devonian, Melville Island, Arctic Canada. 33. Ne w genu s B o f Johnsto n & Goodbod y (1988) , Middle Devonian , Melvill e Island , Arcti c Canada . 34 . Montanaria aff . M. honguedoensis Desbiens , 1994 , Lower Devonian , Emsian , Gaspe , Quebec , Canada . 35 . Copidens browni Pojet a & Gilbert-Tomlinson , 1977 , Ordovician, Australia. 36. Ananterodonta oretanica Babin & Gutierrez-Marco , 1985 , Middl e Ordovician , Llanvirn ,

66

J. G . CARTE R ETAL.

Spain. 37 . Babinka prima Barrande , 1881 , Lowe r Ordovician, Europe . 38 . Ilionia prisca (Hisinger , 1837) , Upper Silurian , Ludlow , Gotland . 39 . Ne w genu s C o f Johnston & Goodbod y (1988) , Middl e Devonian , Melville Island , Arcti c Canada . 40 . Eodon tenuistriata (Hall, 1870) , Middl e Devonian , Mosco w Shale , Morrisville, Ne w York . 41 . Modiomorpha concentrica (Conrad, 1838), Middle Devonian, Chanango Valley, New York. 42 . Evyana baltica (Liljedahl , 1989) , Uppe r Silurian, Wenlock , Gotland . 43 . Colpomya hugini Liljedahl, 1994 , Upper Silurian , Wenlock , Gotland . 44 . Modiolopsis modiolaris (Conrad , 1838) , Uppe r Ordovician, Ne w Yor k State . 45 . Whiteavesia cincinnatiensis (Hal l & Whitfield , 1875) , Uppe r Ordovician, Kentucky . 46 . Modiolus meeki (Evan s & Shumard, 1857) , Uppe r Cretaceous , Montana . 47 . Matheria tener Billings , 1858 , Middl e o r Uppe r Ordovician, Quebec, Canada; ligament based on Matheria rugosa Ulrich , 1892 , Middl e o r Uppe r Ordovician , Minnesota. 48. Metapadia matapediensis Desbiens , 1994, Lower Devonian , Canada . 49 . Modiolodon oviformis (Ulrich, 1890) , Middl e o r Uppe r Ordovician , Trenton , Kentucky. 50. Cyrtodonta saffordi (Hall , 1859), Middle or Upper Ordovician , Nashville , Tennessee . 51 . Ortonella hainesi (Miller , 1874) , Uppe r Ordovician , easter n Nort h America. 52 . Falcatodonta costata Cope , 1996 , Lower Ordovician, Arenig , Sout h Wales . 53 . Ambonychia radiata Hall , 1847 , Upper Ordovician , Ne w Yor k an d Kentucky. 54 . Septimyalina perattenuata (Mee k & Hayden, 1858) , Uppe r Carboniferous , Kentucky . 55 . Myodakryotus deigryn Tunnicliff , 1987 , Uppe r Ordovician, Wales . 56 . Palaeolima retifera (Shumard , 1858), Uppe r Carboniferous , Kentucky . 57 . Leiopecten praerectangularis Krasilova , 1959 , Lowe r Devonian , Kazakhstan. 58 . Pterinea laevis Goldfuss , 1826 , Lower Devonian, Germany . 59 . Tolmaia erugisulca Johnston , 1993, Lowe r Devonian , southeas t Australia . 60 . Rhombopteriid new genus and species of Johnston (1993, fig. 16) , Lowe r Devonian , southeas t Australia . 61 . Umburra cinefacta Johnston , 1991 , Uppe r Silurian , Wenlock, New South Wales, Australia. 62. Frejafecunda Liljedahl, 19840 , Upper Silurian, Gotland. 63. Alytodonta gibbosa Cope , 1997 , Lowe r Silurian , Scotland . 64 . Trecanolia acincta Ratter & Cope, 1998 , Upper Silurian , Wenlock, Sout h Wales . 65 . Catamarcaia chaschuilensis (Acenolaza & Toselli , 1977) , Lowe r Ordovician , Argentina. 66 . Cosmetodon obsoletus (Meek , 1871) , Upper Carboniferous , Kentucky. 67 . Glyptarca serrata Cope, 1996& , Lower Ordovician (Arenig) , South Wales.

Appendix 2: Character definition s 1. Arch of LV ventral hinge margin: 1, straight; 2, weak to medium; 4, strong; 5, no hinge or pseudohinge. 2 . LV convexity: 1 , strong; 2, moderate; 3, weak. 3. Extension of LV posterior auricle beyond sinus: 1, no LV posterior auricle; 2 , sligh t wit h angula r termination ; 3 , moderat e with angula r termination; 5, angula r termination but n o posterior extension . 4. LV posterior auricle: 1, absent; 2, present. 5 . L V posterior auricula r sinus : 1 , absent; 2 , present. 6 . Extensio n o f L V anterio r auricl e beyon d sinus: 1, no LV anterior auricle; 3, moderate with angular termination; 5, with angular termination but no extension.

7. LV anterior auricle : 1 , absent; 2, present. 8. Shape of RV anterio r auricle : A , n o R V anterio r auricle ; no t secondarily absent ; B , dorsa l margi n dip s towar d th e anterior; C, anterior margin nearly straight and vertical; D, anterior margi n nearl y straigh t bu t dippin g towar d th e posterior; E , anterio r margi n i s nearl y straigh t antero ventrally an d < 45 ° t o hinge axis ; dippin g towar d th e posterior; wit h an angular to slightly rounded shoulder . 9. Shape of LV posterior auricle: 1 , primitively absen t or none o f th e following ; 2 , straight , horizontal ; 3 , slope s upward posteriorly ; 4 , straight ; slope s downwar d posteriorly; 5 . curves downward posteriorly. 10 . Relative length o f L V anterior an d posterio r auricles : 1 , bot h primitively absent ; 2 , equal ; 3 , anterio r longer , posterio r shorter o r absent ; 4, posterio r longer , anterio r shorte r o r absent. 11. RV byssal sinus: 1 , absent; 2, present. 12 . LV umbonal elevation : 1 , absent o r slight ; 3 , moderate ; 4 , strong. 13. LV posterior rostrateness : 1 , absent; 2, slight to moderate ; 3 , strong . 14 . L V elongatio n (L/H) : 1 , intermediate (1.25-2.00) ; 3 , lon g ( > 2.00); 5 , shor t (< 1.25) . 15 . L V posteroventra l shel l margin : 1 , rounded, ova l o r slightl y truncat e withou t stron g inflection; 2 , like 1 but with strong inflectio n but neithe r triangular no r rectangular; 3, triangular posteroventrally; 4, triangula r medioposteriorly ; 5 . rectangular . 16 . L V obliquity (predominan t growt h gradien t relativ e t o beak an d hing e axis) : 1 , equilateral ; 2 , slightl y posteroventral; 3 , slightl y anteroventral ; 4 , strongl y anterior; 5 , strongly posterior; 6 , strongly posteroventral . 17. Shap e o f anterio r shel l margin : Beak terminal anterior, n o anterior auricle: G , bea k anterio r t o anteroventral aperture, the latter oriented a t high angle to length axi s o f aperture . 2 , anterio r obsolescen t an d anterior margi n belo w th e byssa l sinus , i f th e latte r i s present, i s strongl y incline d towar d th e posterior ; E , anterior obsolescent, anterior margin below byssal sinus, if the latter i s present, i s broadly ovat e to nearly straigh t and nearly perpendicular t o hinge axis; B, anterior margin slopes posteriorl y an d is broadl y ovate , withou t anterior auricle. Beak anterior bu t no t terminal, n o anterior auricle: 1 , entire anterior is discoidal with, at most, a very slight indentation anterior to beaks; 4, shallow but distinct indentation o r n o indentatio n anterio r t o th e beaks , anterior shel l margi n i s convex wit h a tight curvatur e in comparison wit h th e maximu m posterio r heigh t o f th e shell an d th e anteroventra l margi n i s broadl y ovat e t o straight; 5 , dorsa l anterio r margi n broadl y concav e immediately anterior to beaks and convex anteroventrally; 6, dorsoanterior margi n i s distinctl y indente d anterio r t o beaks, not broadly concave; anterior margin is discoidal to moderately ovate to slightl y triangular, with a convexity that i s nearl y a s wid e a s th e maximu m posterio r shel l height; anterio r margi n is not greatly extende d anteriorl y nor i s i t triangular ; anterio r passe s int o moderatel y t o broadly ovat e margi n anter o ventrally; 7 , presenc e o r absence of indentation immediately anterio r to beak, with shell anterior elongated an d with nearly horizontal dorsal and ventra l areas, an d with discoida l t o moderately ova l anteriormost termination ; A , n o indentatio n anterio r t o beaks, anterio r margi n ver y broadl y ovat e an d nearl y vertical; C, anterior margin slopes dorsally , not forming a straight-edged auricle , an d the n swing s sharpl y downwards to make a broadly ovate to discoidal anterior ; H, shallow, distinct indentation or no indentation anterio r

EARLY BIVALV E EVOLUTIO N

to beaks, anterio r margi n smoothl y an d broadly conve x anterodorsally bu t slightl y straigh t anteroventrally , an d shell i s no t elongat e enoug h t o b e modioliform . Beak anterior bu t no t terminal, with anterior auricle: 3 , anterior margi n ventral to the byssal sinus (if the latter i s present) i s broadl y ovat e t o nearl y straigh t an d posteroventrally inclined ; D , anterio r margi n belo w auricle an d auricula r sinu s (i f th e latte r i s present ) i s broadly ovat e o r straigh t an d nearl y perpendicula r o r anteriorly slightl y incline d t o hing e axis ; F , anterio r margin below auricl e an d auricula r sinus (if the latte r i s present) i s moderatel y ovat e t o discoida l an d anteriorl y inclined. Beak medial o r posterior: 8 , a t mos t a sligh t indentation anterio r t o beak s an d anterio r margi n i s narrowly ovat e to smoothl y triangular but not extremel y elongated, with no anterior auricle; 0, as in option 8, but with distinc t indentatio n anterio r t o beaks ; K , anterio r slightly truncate ; L , sligh t bu t distinc t indentatio n immediately anterio r t o beaks , anterio r margi n nearl y discoidal; P, at most a slight indentation anterior to beaks; anterior greatly elongated wit h nearly parallel dorsa l and ventral margins . 18 . Slop e o f L V sharpl y angula r dorsoanterior shell margin relative to hinge axis (usin g line draw n fro m th e anteriormos t hing e tangen t t o anteroventral shel l margin) : 0 , n o sharpl y angula r dorsoanterior shel l margin ; 1 , nearl y righ t angle ; 2 , slightly < 90° between ligament axis and tangent, angled posteriorly; 5 , > 90° between ligamen t axi s and tangent, angled anteriorly ; 6 , hinge , pseudohinge , ligamen t an d pseudoligament al l absent . 19 . L V adul t ventra l shel l shape: 1, nearly discoidal without posteroventral sinus; 2, moderately t o broadl y ovat e o r straight , moderatel y t o slightly elongate , withou t a media l ventra l o r posteroventral sinus ; 4 , no t elongate , anteroventrall y broadly ovate , nearl y straight , o r straight , wit h posteroventral sinus ; 6 , anteroventrall y concav e an d posteroventrally spatulate ; 7, anteriorly nearly straight or convex, moderatel y elongat e t o elongate , wit h media l ventral or posteroventral sinus ; 8, very elongate, virtually straight o r onl y slightl y convex , withou t media l o r posteroventral sinus. 20. Permanent anterior shell gape: 1, absent; 2 , anter o ventral gap e obliqu e t o hinge axi s in bivalved shell ; 4 , fa r anterio r gap e i n bivalve d shell ; 6 , anterior t o anteroventra l gap e i n univalve d shell ; 7 , anterior gap e closabl e b y flexin g th e shel l margin s an d periostracum. 21 . Permanen t posterio r shel l gape : 1 , absent; 6, present. 22. Posteroventral sinus: 1, absent; 2, present. 23 . L V lunule : 1 , absen t bu t hing e o r pseudohinge present ; 2 , wea k an d shallow ; 5 , sharpl y defined, ver y deep; 6 , no hinge or pseudohinge (Ribeiria lucan). 24 . L V escutcheon : 1 , absen t bu t hing e o r pseudohinge present; 2, weakly developed; 4, no hinge or pseudohinge. 25 . Topograph y o f L V lunule: 1 , lunul e absent bu t hing e o r pseudohing e present . 2 , prominen t growth line s anterio r t o ligamen t are a o n nearl y commarginal, deeply inset lunular surface or on the hinge margin immediatel y ventra l t o beaks ; 4 , n o hing e o r pseudohinge; 5 , smooth . 26 . L V commissural shelf : 1 , absent; 2 , present. 27 . Shel l morphologi c evidenc e fo r branchitellum: 1 , no ; 2 , yes . 28 : Valv e dow n i n pleurothetic taxa : 1 , non-pleurothetic; 2 , L V down ; 4 , either valve down indifferently. 29 . LV beak position: 2, posterior; 3 , medial ; 4 , anterio r bu t no t terminal ; 5 , terminal anterior. 30. Beaks are posteriorly situated : 1 ,

67

no; 2 , yes. 31. Shel l valv e equality : 1 , equivalve; 2 , RV slightly large r o r mor e convex ; 4 , L V slightly large r o r more convex; 5, LV much larger o r more convex ; 6 , n o hinge o r pseudohinge. 32 . Genera l tren d of shell valv e equality: 1 , equivalve; 2 , LV larger o r mor e convex ; 3 , RV larger or more convex; 4, no hinge and pseudohinge. 33. Media l subumbona l septu m or buttress: 1 , absent but a hinge or pseudohinge present; 3, prominent septum deep in umbonal cavity; 4, no hinge or pseudohinge; bu t septum o r pegm a possibl y present . 34 . Umbonal anteroventral buttres s o r umbonal-anteroventra l deck: 1 , absent but hinge or pseudohinge present; 2, nonauricular, ridge-lik e buttress , passin g jus t posterio r t o anterior adducto r scar , possibly continuou s with anterior hinge; 3, buttress passing from hinge line to anteroventra l margin on proximal margin of auricle; 5, anterior pegmalike structur e bu t n o tru e pegma ; 6 , tru e pegma . 35 . Predominant adult beak direction : 1 , prosogyrate with prodissoconch; 2 , orthogyrat e wit h prodissoconch ; 3 , opisthogyrate with prodissoconch; 4 , protoconch present . 36. Distinctive shel l shapes: 0, none of the following; A, mytiliform o r modioliform ; B , Ambonychiaform-, C , Pterineaform; D , Silurozodus-gotlandicusform; E , Arcaform; F , Falcatodontaform', G , Cyrtodontaform', H , Fordillaform', I , Umburraform', J , Nyassaform', K , Eodoniform', L , Solemyaform o r nearly Solemyaform', M , Palaeoneiloform; N , Pinnaform; P , Crassatellaform', Q , Redoniaform', R , Leiopecteniform, Leiopectinellaform, o r Pecteniform; S , Pholadomyaform; T , Orthonotaform', U , Nuculoideaform', 1 , Pojetaiaform', 2 , Anabarellaform', 3 , Nuculaform-, 4 , Permophoriform ; 5 , Matheriaform; 1, Cycloconchaform; 8 , Limaform; 9 , GryphaeaformLophaform. 37 . Distinctiv e prosopon : 1 , neither o f th e following; 2 , edmondii d typ e sharpl y reflecte d commarginal flanges ; 3 , lat e ontogeneti c chang e fro m regular commargina l rib s t o irregula r growt h lines . 38 . Adult L V antimargina l prosopon : 1 , absent ; 2 , fine , regular, closel y space d costa e o r costellae ; 3 , strong , regular, closel y t o medium-space d costa e o r plicae ; 5 , very fine, regular, closely spaced lineations not associated with margina l macrocrenulations ; 9 , largel y smoot h bu t with some radial costellae anteriorly and/o r posteriorly; B, very fine , irregula r radial striae . 39 . Adul t L V ranks o f antimarginal prosopon : 1 , absent; 2 , on e siz e rank ; 3 , more tha n on e siz e rank . 40 . Adul t R V antimargina l prosopon: 1 , absent ; 2 , fine , regular , closel y space d costae o r costellae ; 3 , strong , regular , clos e t o mediu m spaced costa e o r plicae ; 5 , ver y fine , regular , closel y spaced lineation s no t associate d wit h margina l macrocrenulations; 6 , fine, regular , widel y spaced costa e or costellae ; 9 , radia l costella e onl y anteriorl y and/o r posteriorly; B , ver y fine , irregula r radia l striae . 41 . Anterior L V peda l retractor/levato r muscl e sca r position: 1 , separat e fro m adductor ; 2 , jus t touchin g adductor dorsall y o r dorsoposteriorly ; 3 , overlappin g adductor; 6 , just touchin g adducto r posteroventrally ; 7 , primitively no anterior adductor but anterior lef t an d right pedal retractors present. 42. Special support for anterior pedal retractor : 1 , absent; 4 , pegma-lik e shelf ; 5 , tru e pegma. 43. Posterior LV pedal peda l retractor/levato r position: 1 , separat e fro m adducto r an d dorsa l o r dorsoanterior t o it; 2, just touching adductor and dorsal or dorsoanterior t o it ; 3 , overlappin g adducto r an d dorsomedial o r dorsoanterio r t o it ; 4 , confluen t wit h

68

J. G . CARTE R ETAL.

adductor sca r an d dorsomedia l o r dorsoanterio r t o it , o r secondarily absent ; 8 , n o adducto r bu t posterio r peda l retractors present ; 9 , n o adducto r bu t media n posterio r pedal retracto r present . 44 . Junctio n o f L V pallial lin e and posterio r adducto r muscl e scar : 1 , midventral t o anteroventral edg e o f adductor; 2 , posteroventral edg e o f adductor; 3 , posterio r edg e o f adductor ; 4 , adducto r i s entirely interio r t o trend of the pallial lin e but close t o it; 7, primitivel y n o posterio r adductor ; 8 , primitively onl y one adductor. 45. Position o f LV posterior adductor : 1 , just belo w hinge ; 2 , moderatel y ventra l an d posterior t o hinge; 6, primitively no posterior adductor; 7, primitively only one adductor. 46. Buttress or deck for LV posterior adductor: 1 , absen t o r adducto r secondaril y reduced ; 2 , distinct ridg e o r non-auricula r deck ; 3 , primitivel y n o adductors; 4 , primitivel y onl y on e adductor ; 5 , radial , platform-like thickenin g of shel l alon g muscle migration pathway. 47 . Shap e o f L V posterior adducto r scar : 1 , round t o subcircular ; 2 , elliptica l t o subtrapezoida l with length axi s nearl y paralle l o r onl y slightl y obliqu e t o nearest shel l margin ; 3 , subtriangular ; 5 , primitivel y n o adductors; 6, primitively onl y one adductor. 48. Positio n of LV anterior adducto r (inferre d ancestra l position if secondarily reduced) : 1 , o n hing e plat e o r cuttin g int o hinge plat e o r adducto r deck ; 2 , of f hing e plate ; 4 , primitively n o adductors ; 5 , primitivel y onl y on e adductor. 49. LV anterior adductor buttress: 1 , adductor present bu t no t buttressed , o r sligh t buttres s lack s a posterior slop e break ; 3 , buttres s wit h distinc t posterio r slope break ; 4 , adducto r supporte d b y hing e plate ; 5 , adductor secondaril y reduce d an d ther e i s n o trac e o f a former supportin g buttres s o r deck ; 7 , primitivel y n o anterior adductor ; 8 , primitivel y onl y on e adductor . 50 . Shape o f LV anterior adductor : 2 , point o f attachment; 3, round to subcircular ; 4 , elliptica l t o subtrapezoidal ; 5 , subtriangular; 6 , elongate ; 7 , primitivel y n o anterio r adductor; 8 , primitively onl y on e adductor . 51 . Relativ e size o f adducto r scars : 1 , anterio r on e secondaril y reduced; 2, posterior one larger by at least 100% ; 3, nearly isomyarian; 4 , anterio r muc h larger ; 5 , primitivel y n o adductors; 6 , primitivel y onl y on e adductor . 52 : Gil l retractor, suspenso r and mantle bloo d vesse l scars : 1 , none apparent ; 2 , lin e o f scar s proximall y restricted , straight, extending from umbona l cavity posteroventrally , below posterior adductor ; Quenstedt scar may or may not be differentiated ; ma y b e expresse d a s a ridg e o r a s a distinct brea k i n th e slop e o f th e shel l interior ; 3 , proximally dorsoventra l and distall y posteriorl y curvin g scar, usually represented b y a groove on the shell interior ; Quenstedt sca r ma y o r ma y no t b e differentiated ; rarel y expressed a s th e extensio n o f a n umbona l septu m extending dorsoventrall y fro m th e media l o r anterio r umbonal cavity , the n curvin g slightl y towar d th e posterior; no t a n anterio r adducto r buttress ; 4 , anterior-posterior, nearl y horizonta l lin e o f scar s o n flanks o f umbona l shel l interior . 53 . Umbona l t o posteroventral gill wheal: 1 , absent; 2, present ( 2 or 3 in preceding category) . 54. Anterior pallial , protracto r o r other muscle scar not dorsa l t o anterior adductor: 1, none evident; 3, single or multiple scars medioposterior or posteroventral t o anterio r adductor ; adjacen t t o anterio r adductor an d no t extendin g posteriorl y fro m th e pallia l line; 4 , single , discret e sca r a t junctio n o f anterio r adductor with anteroventral pallia l line ; 5 , primitively n o

anterior adducto r scar s an d n o anterio r pallia l line ; 6 , primitively n o anterio r adductor s bu t anterio r pallia l o r cephalic feedin g orga n retractor s present . 55 . Dorsa l accessory muscl e scar s (excludin g on e anterio r an d one posterio r peda l retracto r o r peda l levato r sca r closest t o eac h adducto r an d excludin g scar s o n ventral margi n o f a posterio r interna l ridge , score d elsewhere): 1 , absent; 2, only one or two closely spaced , medial subumbonal , insertin g o n surfac e othe r tha n posteroventral margin of hinge plate an d othe r than apex of umbona l cavity ; 3 , thre e o r more , subumbonal , inserting on concave interior surface , no t on ventral edge of a posterio r interna l ridg e an d no t onl y nea r anterio r adductor muscl e scar , o r betwee n umbona l cavit y an d posterior adductor ; or one or more scars between umbona l apex an d anterior peda l retractor , no t present posteriorl y except possibl y o n ventra l margi n o f posterio r interna l ridge or on ventral margin of posterior hing e plate; 5 , one or tw o closel y spaced , small , isolate d muscl e scar s just ventral to the hinge, between beak and posterior adductor , distinct fro m th e posterio r peda l retractor ; 6 , severa l small, closel y space d muscl e scar s jus t ventra l t o th e hinge, betwee n umbona l cavit y an d posterio r adductor , distinct fro m th e posterior peda l retractor ; 7, onl y one or two closely spaced scars at the far apex of umbonal cavity, excluding anterio r peda l retractor ; 8 , onl y on e o r tw o closely space d scar s o n ventra l edg e o r umbona l cavit y side of hinge plate, not at far apex of umbonal cavity. 56. Depth o f posterior pallia l sinus : 1 , absent; 2, shallow; 3, deep. 57 . Pallia l lin e structure : 1 , solid o r wit h small , closely space d scar s excep t possibl y discontinuou s a t anterodorsal an d posterodorsa l extremities ; 3 , entirel y broken; 4, entirely o f long, radial scars , no t a solid pallia l line wit h proxima l radia l extensions ; 5 , soli d anteriorly , broken posteriorly. 58 . Pallial lin e continuity: 1 , solid or consisting o f closel y spaced , smal l scar s (1 above) ; 2 , at least partiall y discontinuou s (3- 5 above) . 59 . Non-shel l marginal posterio r lateral o r pseudolateral teeth in LV or RV (excluding palaeotaxodon t teeth): 1 , absen t and none of the following; 2, only one suc h tooth i n either o r both valves , not mor e tha n one ; 3, two suc h teeth in on e or both valves , not more tha n two; 4, three o r more suc h teeth in either or both valves; 5, no hinge or pseudohinge . 60. Shap e o f non-palaeotaxodon t posterio r latera l o r pseudolateral toot h closes t t o subumbona l area : 1 , absent; non e o f th e following ; 3 , long , lamella r latera l tooth; 4 , lamella r toot h immediatel y posterio r t o a palaeotaxodont subumbona l tooth , derive d ontogenetically fro m palaeotaxodon t teeth ; 6 , no hinge or pseudohinge; 7 , short , nearl y horizontal , lamella r o r tabular tooth either separated from th e cardinal area by an edentulous gap , separate d fro m th e anterio r are a b y a n edentulous gap , o r adjacen t t o cardina l pseudotaxodont teeth wit h a distinctl y differen t orientatio n tha n th e lamellar/tabular tooth ; 8 , short , distinctl y posteriorl y dipping, lamella r o r tabula r toot h adjacen t t o similarl y posteriorly dippin g cardina l pseudotaxodon t teeth . 61. At least one posterior toot h no t reaching bea k in either or both valves , excludin g palaeotaxodon t an d pseudolateral teeth : 1 , no hinge or pseudohinge present; 2, on e an d onl y on e soli d lamella r o r tuberculifor m posterior latera l i n eithe r o r bot h valves ; no t mor e tha n one i n eithe r valve ; 4 , mor e tha n on e i n eithe r o r bot h valves, uppers en echelon close r t o beak; 5, more than one

EARLY BIVALV E EVOLUTION in either or both valves, not uniformly aligned en echelon, with wide edentulous gap from beak; 7, more than one in either o r both valves , lower s e n echelo n close r t o beak , and n o cardinolatera l no r transitiona l palaeotaxodont / lamellar tooth ; 8 , more than one in either o r both valves, lowers e n echelon close r t o beak; cardinolatera l present; A, n o hing e o r pseudohinge . 62 . Shap e o f stronges t posterior lateral, non-palaeotaxodont tooth: 1, does not apply; 3, strong, long, slender, lamellar; 4, strong but short and tabular or tuberculiform; 7, no hinge or pseudohinge. 63. More than one posterior latera l with lower teeth en echelon close r t o beak: 1 , no, but hinge or pseudohinge present; 2, yes; 3, no hinge or pseudohinge. 64. Posterior palaeotaxodont teeth , no t transitiona l t o lamellar : 1 , no, bu t hing e o r pseudohinge present; 2, yes, wit h littl e increase i n toot h siz e posteriorly ; 3 , yes , wit h grea t increase i n toot h siz e posteriorly ; 4 , n o hing e o r pseudohinge. 65. Distinctive posterio r hing e dentitions : 1, hinge or pseudohinge present but none of the following apply; 2 , lateral , pseudolatera l o r pseudotaxodon t teet h above separat e posterio r palaeotaxodon t o r pseudo taxodont teeth ; 3 , numerou s posterio r teet h dippin g towards posterior , increasin g i n numbe r ontogeneticall y by branchin g and/o r intercalation ; 5 , posterio r lamella r tooth wit h pseudotaxodon t branches , withou t accom panying separate pseudotaxodont or palaeotaxodont teeth; 6, n o hinge o r pseudohinge ; 8 , tw o lon g posterio r pseudolateral teeth , on e abov e th e other , immediatel y posterior t o subumbona l palaeotaxodon t teeth . 66 . Glyptarcid-type hing e (subumbona l pseudotaxodon t teeth represent subdivision s of posterior pseudolatera l tooth, dorsa l an d posterio r t o othe r subumbona l pseudotaxodont teeth) : 1 , neithe r o f th e following ; 5 , primitively n o hing e o r pseudohinge ; 7 , present . 67 . Hinge o r pseudohing e subumbonall y edentulous : ? , yes, bu t associate d lif e habi t an d biomechanica l factor s unknown; 1 , no; 2, yes an d associated with a gasket-like, periostracal margin ; 3, hinge or pseudohinge present and ancestral edentulou s conditio n i s retaine d (Watsonella, Pseudomyona); 5 , n o hing e o r pseudohinge ; 6 , yes , associated wit h wide , flexible , periostraca l margins ; 7 , yes, associate d wit h rigi d shel l margin s an d shallo w burrowing o r semi-infauna l lif e habits , with subumbonal edentuly apparentl y a n artifac t o f posterio r shif t i n th e umbones rathe r tha n actua l toot h reduction ; 8 , yes , associated wit h deep burrowin g habits an d extensio n of rigid shel l margin s by a thin periostracu m studde d with aragonitic spike s o r granules . 68 . Subumbona l pseudotaxodonty, palaeotaxodont y o r pretaxodonty: 1 , hinge o r pseudohing e present but non e of th e followin g apply; 2 , pseudotaxodon t i n on e row , teet h paralle l o r ventrally divergent , possibl y ventrall y bifid ; 3 , pseudotaxodont i n tw o rows , on e ove r th e other ; 4 , palaeotaxodont; 5 , n o hing e o r pseudohinge ; 6 , pseudotaxodont i n on e row , teeth dorsall y divergent ; 7, pretaxodont. 69 . Subumbona l o r anterio r toot h ro w relationship wit h posterio r palaeotaxodon t o r pseudotaxodont toot h row : 1 , hing e o r pseudohing e present bu t no t exclusivel y palaeotaxodon t no r exclusively pseudotaxodont ; 2 , toot h row s i n line ; 3 , posterior ro w overlap s anterio r row ; 4 , n o hing e o r pseudohinge. 70 . Subumbona l dentitio n bulbou s o r tuberculiform, excludin g indistinc t teet h a s i n Modiomorpha an d Ambonychia: 1 , no , bu t hing e o r

69

pseudohinge present ; 2 , yes ; 3 , primitivel y n o hing e o r pseudohinge. 71 . An y non-palaeotaxodont , non pretaxodont subumbona l teeth , includin g indistinc t teeth a s i n Fordilla, Modiomorpha, an d Ambonychia, but excludin g crura l teeth : 1 , absen t bu t hing e o r pseudohinge present ; 2 , present ; 3 , n o hing e o r pseudohinge. 72 . Distinctiv e cardinal-subumbona l dentitions: 0 , n o hing e o r pseudohinge ; 1 , hing e o r pseudohinge presen t bu t non e of the followin g apply ; 2, no anterio r hing e teeth , bu t a t leas t thre e non-bulbous , short subumbonal teeth, and anteriormost dips towards the posterior o r is orthocline; 3, strongly posteriorly concave , distinct, non-taxodont , anterio r subumbona l toot h i n either valve ; 5 , no anterio r hing e teet h bu t a t least thre e non-bulbous, shor t subumbona l teeth , deepl y grooved , and tightl y fan-like , wit h anterio r toot h dippin g toward s the anterior ; A, dorsall y divergen t teeth, subumbona l or anterior an d posterior t o subumbona l area, possibly wit h an edentulous ga p below the beak; C, overlap of anterior palaeotaxodont o r pseudotaxodon t dentitio n b y media l and posterior palaeotaxodont dentition; D, pretaxodont; E, overlap o f media l pseudotaxodon t o r transitiona l pseudotaxodont/lamellar dentitio n b y posterio r pseudo taxodont o r transitiona l pseudotaxodont/lamella r dentition. 73 . Anterior , non-palaeotaxodont , pseudo lateral bu t not anterior latera l teet h i n either o r bot h valves (excludin g crura) . 1 , hing e o r pseudohing e present bu t doe s no t apply ; 2 , on e an d onl y on e solid , long, pseudolateral anterio r tooth in either or both valves; not more than one; 4, more than one solid, long , anterio r pseudolateral tooth in either or both valves; 6, no hinge or pseudohinge. 74 . A t leas t on e adul t anterio r non palaeotaxodont, non-pseudotaxodont , latera l toot h (i.e. no t reachin g beak ) i n eithe r o r bot h valves , excluding crura , bu t includin g small , tuberculifor m teeth: 1 , no, but hinge or pseudohinge is present; 5, more than on e suc h tooth i n a t least on e valve , not uniformly aligned en echelon, wit h wide edentulous ga p to beak; 6 , more tha n on e suc h toot h i n a t leas t on e valve , no t necessarily aligned en echelon, with pseudotaxodont teeth filling ga p to beak; 7, more than one such tooth in at least one valve , lower s e n echelo n close r t o beak ; 8 , on e o r more transitional palaeotaxodont-pseudotaxodont teet h in either o r bot h valves , wit h palaeotaxodon t o r pseudotaxodont teet h fillin g ga p to beak; 0 , n o hinge o r pseudohinge. 75 . Anterio r latera l o r pseudolateral , non-pseudotaxodont, non-palaeotaxodont tooth in LV or RV (minute, tuberculiform teeth are scored as 1 and 2) (this excludes mytili d anterior shell marginal teeth) : 1, absent o r doe s no t appl y but hing e o r pseudohing e i s present; 2 , only on e suc h anterior toot h i n either o r both valves; not more than one; 3 , two suc h teeth i n either o r both valves ; not mor e tha n two ; 4 , thre e o r mor e suc h teeth in either or both valves; 5, no hinge or pseudohinge. 76. Relationship o f strongest non-shel l marginal , non palaeotaxodont, non-pseudotaxodont, anterior latera l or pseudolatera l toot h wit h anterio r cardinal subumbonal tooth: 1, no such anterior tooth, but hinge or pseudohinge present ; 2 , continuou s wit h cardinal subumbonal tooth; 3 , separate fro m cardinal-subumbona l tooth; 4 , separate d fro m cardinal-subumbona l tooth b y palaeotaxodont teeth ; 5 , n o hing e o r pseudohinge . 77 . Strongest non-shel l marginal , anterio r latera l o r pseudolateral, non-palaeotaxodon t tooth: 1, none of the

70

J. G . CARTE R ETAL.

following; 2, very small, short, possibly tuberculiform and impersistent; 3 , strong , long , slende r lamellar ; 4 , stron g but short and tabular; 5, no hinge or pseudohinge; 6, short, derived ontogeneticall y fro m ar m o f anterior , concavodont tooth. 78. Distinctive hinges : 0 , none of the following; 1 , evyanid-type ; 2 , cyrtodont-type ; 3 , rhombopteriid-umburrid-type; 4 , modiomorphid-type ; 5 , thoraliid-type; 6 , gryphaeid-ostreid-type; 7 , right pivotal cardinal-subumbonal toot h nearl y paralle l wit h dorsoanterior shel l margin ; 8 , colpomyid-type ; 9 , subumbonal teet h pseudotaxodon t an d nearl y vertica l o r dorsally divergent in at least one valve; A, only one or two anterior and posterior elongat e hinge teeth approximating the subumbona l area without strong, intervening teeth in adult o r earl y juvenil e shell ; B , montanariid-type ; C , babinkid-type; D , redoniid-type ; F , nyassid-type ; G , cycloconchid-type; H , secondaril y edentulou s fro m immediate palaeotaxodont ancestors; I, subumbonal teeth pseudotaxodont an d onl y posteroventrall y inclined , no t ventrally divergent ; J , tironuculid-type ; K , astartid-crassatellid-type; L , a t leas t partiall y palaeotaxodont wit h anterior toot h row a t least one-thir d as long a s posterior toot h row ; M, lyrodesmatid-type; O, matheriid-type; P , at leas t partiall y palaeotaxodon t wit h anterior tooth row less than one-third as long as posterior tooth ro w an d no t tironuculid-typ e hinge ; R , schizodia n type; T , pretaxodont-type . 79 . R V pivota l cardinal subumbonal tooth : 0 , differentiate d cardinal subumbonal teeth absent in RV but hinge or pseudohinge present, o r otherwis e non e o f th e following ; 1 , amorphous, crudely wedge-shaped, typically with growth lines on articulating surface; 2, bulbous or tuberculiform, rounded t o elliptical , horizontall y elongat e o r oblique , generally non-bifid ; 3 , distinctl y shaped , heavy , subtrigonal, wit h onl y a fain t indicatio n o f bifidness , although the tooth may be smooth or irregularly grooved ; 4, distinctly shaped, heavy, subtrigonal, only superficiall y bifid; 5 , distinctly and regularly shaped , full y bifid , wit h bisectrix oriente d towar d posteroventral , ventra l o r anteroventral direction; 6, distinctly shaped, slender, nonbifid o r slightl y bifi d onl y a t th e fa r dista l end , possibly slightly lobate distally; 7, palaeotaxodont; A, no hinge or pseudohinge; B, pseudotaxodont; G, pretaxodont. 80 . LV cardinal-subumbonal toot h immediatel y anterio r t o LV pivota l cardinal-subumbona l tooth : 0 , hing e o r pseudohinge presen t bu t cardinal-subumbona l teet h absent; 1 , n o toot h i n thi s position ; 2 , slender , no t pseudotaxodont; directe d anteroventrally ; no t paralle l with dorsoanterio r shel l margin ; 3 , slender , no t pseudo taxodont; paralle l o r nearl y paralle l wit h dorsoanterio r shell margin ; 4 , slender , no t pseudotaxodont , no t palaeotaxodont, directed posteroventrally ; 6 , palaeo taxodont; 8 , pseudotaxodon t an d nearl y vertica l o r dipping toward s th e anterior ; A , pseudotaxodon t an d dipping towar d th e posteroventral ; B , n o hing e o r pseudohinge; D , pretaxodont (Pojetaia); E , strongl y an d deeply bifid, opening ventrally or antero ventrally. 81. LV cardinal-subumbonal toot h immediatel y posterio r t o LV pivota l cardinal-subumbona l tooth : 0 , hing e o r pseudohinge presen t bu t cardinal-subumbona l teet h absent i n LV ; 1 , n o cardinal-subumbona l tooth i n thi s position; 2 , slender , no t pseudotaxodont ; directe d posteroventrally; 3 , slender , no t pseudotaxodont ; nearly parallel wit h dorsoposterio r shel l margi n an d bas e o f

ligament nymph ; 4 , slender , nearl y vertica l t o slightl y anteroventrally directed , no t palaeotaxodon t o r pseudotaxodont; 5 , palaeotaxodont ; 6 , pseudotaxodon t and nearl y vertical ; A , pseudotaxodon t an d dippin g towards th e posterior ; D , pseudotaxodon t an d dippin g towards th e anterior ; C , n o hing e o r pseudohinge ; E , pretaxodont. 82 . Pivota l R V cardinal-subumbona l socket: 1 , hinge or pseudohinge present but no socket; 2, proximally floored; 3, unfloored; 4, completely floored; 5, no hinge o r pseudohinge . 83 . Presenc e o r absenc e o f dental striations (not longitudinal grooves). 1 , absent or hinge is edentulous, but hinge or pseudohinge present; 2, present; 3 , n o hing e o r pseudohinge . 84 . Heterotaxodonty: 1 , absen t bu t hing e o r pseudohing e present; 2 , present ; 3 , n o hing e o r pseudohinge . 85 . Predominant anterio r palaeotaxodon t toot h shape . 1 , non-palaeotaxodont but hinge o r pseudohinge present ; 2 , orthomorphodont; 3 , concavodont ; 6 , concavoconvex , convexoconcave or diconvex; 7, no hinge or pseudohinge. 86. Predominan t posterio r palaeotaxodon t toot h shape: 1 , non-palaeotaxodon t bu t hing e o r pseudohing e present; 2 , orthomorphodont ; 3 , concavodont ; 6 , concavoconvex, convexoconcav e o r diconvex ; 7 , n o hinge o r pseudohinge . 87 . Pseudohing e o r hing e overgrowth: 1 , non e o f th e following ; 2 , partia l overgrowth o f hing e dentitio n b y advancin g ligamen t insertion are a o r deepl y incise d lunule ; 4, n o hing e o r pseudohinge; 5 , pseudohing e presen t bu t n o tru e hinge . 88. Widt h o f L V posterio r hing e o r pseudohing e excluding ligamen t insertio n are a an d auricle : 1 , narrow t o medium, obsolescent o r absent; 3, wide ; 4, n o hinge o r pseudohinge. 89 . Widt h o f LV anterior hinge or pseudohing e excludin g ligamen t insertio n area , auricle an d deepl y impresse d lunule : 1 , narro w t o medium, obsolescen t o r absent ; 3 , wide ; 4 , n o hing e o r pseudohinge. 90 . Mineralog y L V outer shel l layer : 1 , aragonite o r predominantl y aragonit e wit h isolate d calcite; 2 , al l calcit e o r al l calcit e i n a continuou s outer sublayer. 91. Mineralogy L V adult inner shell layer : 1, aragonite; 3, calcite. 92. General microstructura l grade of middle/inne r shel l layers : 1 , exclusivel y matte d t o lamello-fibrillar, o r larg e table t nacre , o r Cambria n and entirely regularly foliated , the latter convergen t o n som e post-Ordovician pteriomorphians ; 2 , smal l table t nacreous; CL , CC L and/o r FCCL/HOM . 93 . Predominant lef t outer layer microstructure: 1 , regular simple prismatic ; 2 , mixe d regula r simpl e prismatic , irregular simple prismatic, HOM, or just ISP and HOM; 6, porcelaneous; 7 , non-denticula r composit e prismati c and/or aragoniti c regula r simpl e prismatic ; th e NDC P may grad e laterall y int o irregula r spheruliti c prismatic , regular spherulitic prismatic and/or homogeneous; 8, RSP to ISP to HOM (aragonite) overlyin g a fibrous prismati c sublayer; 9 , aragoniti c F P o r denticula r composit e prismatic, possibl y wit h minor ICCL , FCCL o r irregula r spherulitic an d irregula r simpl e prisms . 94 . Calciti c regular simpl e prism s presen t nea r adul t shel l margins: 1 , no; 2, yes. 95. Calcitic foliated structur e in LV: 1, absent; 2, present. 96: Predominant porcelaneou s structure in inner shell layer: 1 , absent; 2, fine comple x crossed-lamellar and/o r HO M (undifferentiated) ; 5 , irregular comple x crossed-lamella r possibl y als o wit h cone CCL , mediu m and/or coars e textured ; 6, matte d to complex crossed lamellar ; 7 , very wide CL and CCL. 97.

EARLY BIVALV E EVOLUTIO N Aragonitic prism s i n middle and/o r inner shel l layer , excluding adductor myostraca: 1 , minor ISP sublayers; 2, abundan t IS P sublayers ; 3 . vertica l IS P pillars ; 6 , fibrous prism s and matted structure comprise most of the shell interior . 98 . Media l divisio n o f larva l shell : 1 , absent; 2, present. 99. Hinge o r pseudohinge: 1 , absent; 2, present . 100 . Discontinuou s fibrou s ligamen t ontogeny, or derived from such ancestors: 1 , no; 2, yes. 101. Nuculoid/solemyoi d interna l ligament : 1 , absent; 2, presen t a s a resilium (nuculoids) , a s a RV ligamental chondrophore (Palaeozoi c solemyoids ) o r a s a possibl e internal lamellar ligament homolog (modern solemyoids). 102. Spacin g o f elongated ligamenta l grooves : 1 , only one present ; 2 , multipl e groove s closel y spaced ; 3 , multiple grooves moderately spaced ; 4, multiple groove s very widely spaced, including pteriomorphian alivincular and multivincula r ligaments ; 5 , n o ligamen t o r pseudoligament; 6 , pseudoligamen t present . 103 . Mineralization o f ancestrall y elongate d dorsa l ligament (includin g lamella r remnan t o f dorsa l ligament i n resiliated nuculoids) : 1 , non-mineralized or weakly mineralize d withou t accompanyin g resilium ; 2 , mineralization extend s from valv e to valve , whether the ligament i s stil l externa l o r no w submerged ; 6 , n o ligament o r pseudoligament ; 7 , onl y pseudoligamen t present. 104. General ligament grade: 1 , no ligament, or only pseudoligament , or primitivel y weakly mineralized or unmineralized dorsal ligament; 2, well mineralized true ligament o r derive d fro m suc h ancestors . 105 . Genera l categories o f ancestrall y dorsa l ligament s (excludin g nuculoid an d solemyoid interna l ligaments): 0 , neither ligament nor pseudoligament present; 1, pseudoligament; A, D H (duplivincula r horizontal); B, D I (duplivincular inclined); D, SN (simple narrow); E, SW (simple wide); F, PN (parivincular narrow); G, PW (parivincular wide); H, PR (parivincula r ramped) ; J , P S (parivincula r submerged); K, ALIV (alivincular). 106. Major varietie s of ancestrall y dorsa l ligament s (excludin g nuculoi d and solemyoids interna l ligaments): 1 , ligament present but non e o f th e following ; 2 , neithe r ligamen t no r pseudoligament i s present ; 3 , pseudoligament ; A , DHopis; B , DHopis/amph ; C , DHamph ; D , DIopis ; E , DIopis/amph; F , DIamph ; G , DIpros ; K , SNweak ; L , SNstrong; M , PNincip ; N , PNweak ; O , PNstrong , P , PWext; Q, PWint; R, PRthick; S, PRthin; T, PSshallow; 4, PSreduced; 5 , PSdeep ; 7 , ALIVnar ; 8 , ALIVmod ; 9 , ALIVwide; 0 , ALIVsplit . 107 . Detaile d ligamen t varieties (excludin g nuculoi d an d solemyoi d interna l ligaments): 0 , neithe r ligamen t no r pseudoligament ; 1 , pseudoligament; 2 , tru e ligamen t bu t non e o f th e following; A , DHopis2 ; B , DHopis 1; C, DHopi s 1-2; D , Dlamph-incl; 3 , DIamph-aliv ; I , PRthick-shallow ; J , PRthick-deep; K , PRthin-weak ; L , PRthin-strong ; M , PSdeep-sub; N , PSdeep-sub/resil ; O , PSdeep-resil ; P , ALIVmod-trian; Q , ALIVmod-trap ; R , SNweak-opis ; S,

71

SNweak-amph. 108 . Alternativ e grouping s o f simila r dorsal ligament , excludin g palaeotaxodon t interna l ligaments: 0, pseudoligament or no ligament; 1, ligament present bu t non e o f th e followin g apply ; 2 , DHopi s o r DIopis (opisthodeti c duplivincular , regardles s o f inclinations); 3 , DHopis/amp h o r DIopis/amp h (slightl y amphidetic duplivincula r regardles s o f inclinations) ; 4 , DHamph o r DIamp h (strongl y amphideti c duplivincular regardless o f inclinations) ; 5 , S N o r S W (al l simpl e ligaments); 6 , PN , PW , P R o r P S (al l parivincula r ligaments excep t P F an d PW , whic h clearl y evolve d separately). 109 . Additiona l dorsa l ligamen t varieties : 0, ligamen t presen t bu t non e o f th e following ; 5 , pseudoligament or no ligament; 7, DHopis2 ligament with several ligamen t groove s an d wit h early forme d fibrous layers largel y restricte d t o th e anterio r o f th e ligamen t insertion area; 8, DHopis2 ligament with very few, widely spaced ligamen t grooves . 110 . Dorsa l shel l plat e kinetics: 1 , flexibl e b y virtu e o f microstructura l differentiation; 3 , crackin g o f media l dorsa l shel l plat e during growt h t o kee p valve s apar t ventrally ; 4 , pseudoligament; 5 , non e o f th e abov e (mos t Monoplacophora). 111 . Combine d interfacia l angl e o f L-R ligamen t insertio n area s fo r duplivincula r ligaments an d thei r alivincular , multivincula r an d planivincular derivatives , measure d nea r th e adul t hinge margi n (thi s exclude s nuculoi d an d solemyoi d internal ligaments) : 1 , symmetrica l an d < 70°, o r ligament i s no t duplivincula r nor derive d therefrom ; 2 , L-R asymmetrical ; 3, alivincula r and submerge d below shell margins ; 4 , symmetrica l an d >70° ; 5 , pseudo ligament o r n o ligament ; 6 , adul t portio n o f elongate , simple ligament inserts on ventromedial surface o f dorsal hinge margi n wit h n o tru e nymp h bu t possibl y wit h a pseudonymph. 112 . Suppor t fo r palaeotaxodon t internal ligament: 0, no ligament or only pseudoligament present; 1 , ligamen t presen t bu t n o palaeotaxodon t internal ligament; 2, resilifer in one valve opposes a tooth or tooth-lik e structur e i n othe r valve ; 3 , opposin g resilifers, not strongly projecting beneath hinge rotationa l axis; may be symmetrical o r asymmetrical; 5 , ligamenta l chondrophore attaching below beak in RV, with ligament arching upwards without a chondrophore in LV. 113. L- R asymmetrical palaeotaxodon t resilife r (excludin g solemyoid ligamenta l chondrophore) : 0 , neithe r ligament no r pseudoligamen t present ; 1 , absent , bu t a ligament i s present; 2 , present. 114 . Ctenidia l grade : ?, uncertain; 1 , protobranchiate ; 2 , autolamellibranchiate . 115. Abdominal sens e organ: 1 , absent; 2, present. 116 . Adoral an d anterio r mantl e sens e organs : 1 , bot h absent; 2 , adora l sens e organ present; 3, anterio r mantle sense orga n present . 117 . Shel l heigh t abov e dorsa l limits o f apertur e exceed s shel l heigh t belo w dorsa l limits of aperture: 1 , yes; 2, no.

Appendix 3: Database for phylogenetic analysi s Vertical, species number; horizontal, character number. * Polymorphisms, indicated separately as follows. Note that 6-15[l,2] signifies specie s 6, character 15 , character states 1 and 2, etc. Polymorphisms, 5-5[l,2], 6-15[l,2], 6-18[0-5], 6-41[2,3], 6-50[4,6], 6-55[2-7], 7-79[l,2], 8-64[l,2], 8-78[J,L] , 8-86[l-3], 9-14[l,5], 10-38[1,5] , 10-40[l-5], ll-15[l-2] , 1129[3,4], 13-2[l-2] , 13-85[2,3] , 14-29[3,4] , 16-69[2,3] , 16-72[1,C] , 16-86[2,3] , 18-22[1,2] , 21-17[7,8] , 22-35[2,3], 23-35[2,3] , 24-35[2,3] , 25-15[3,5] , 26-29[3,4] , 26-50[4,5] , 26 59[2,3], 26-60[l-3], 26-61[l,2], 26-62[l,3], 26-68[l,2] , 27-15[2,4] , 27-29[3,4], 27-60[l,3], 27-61[l,2] , 27-62[l,3] , 27-79[0,B] , 28-15[l,4] , 28-59[3,4] , 28-60[l,3], 28-61[l,8] , 28 62[1,3], 28-68[l,2], 28-88[l,3] , 29-17[l,6] , 30-60[1,8] , 32-78[B,F] , 34-15[2,3] , 34-19[2,4] , 36-15[l,2] , 36-17[l,4] , 36-34[l,2] , 36-61[4,5] , 37-16[l,3] , 37-17[l,6] , 37-29[2,3] , 3730[1,2], 37-50[4-6], 37-80[l,2], 37-81[l,4], 39-17[5,6], 40-15[2,5], 40-17[5,6], 40-55[4,5], 40-78[B,K], 41-11[1,2], 41-13[1,2], 41-17[6,9], 41-36[A,4], 41-37[1,3], 41-49[1,4], 4315[2,5], 43-43[l,3], 43-93[2,9] , 44-12[l,3], 44-13[l,2] , 44-43[l,2] , 44-56[l,2] , 45-12[l,3] , 45-13[l,2] , 45-16[5,6], 45-36[4,A] , 46-12[l,3], 46-13[l,2] , 48-36[A,H] , 48-48[l,2], 4950[3,4], 50-17[4,H] , 50-49[1,4] , 51-23[1,2] , 51-25[1,5] , 51-49[3,4] , 51-61[5,7] , 51-63[1,2] , 51-109[7,8] , 52-50[3,4] , 52-63[l,2] , 53-3[l,5] , 53-4[l,2] , 53-18[0,l] , 54-18[0,3] , 54 36[A,C], 55-l[l,2], 55-5[l,2], 55-9[2,4] , 55-10[2,4] , 55-16[l,2] , 55-18[l,5] , 56-10[2,3], 56-93[l,2] , 57-16[2,5] , 57-36[R,C] , 58-17[3,D], 58-48[l,2] , 58-59[3,4] , 58-106[A,B] , 58108[2,3], 59-17[2,E], 59-34[l,3], 59-48[l,2], 59-61[5,7] , 60-78[3,I], 61-59[3,4], 61-65[1,3], 61-78[3,I], 62-16[l,2], 62-19[l,2] , 62-88[l,3], 63-74[6,7] , 63-88[l,3], 65-29[3,4] , 6560[1,7], 65-75[3,4], 66-14[l,3] , 66-60[l,7] , 67-60[l,7], 67-78[9,G] . 1234567890123 45678 901234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 123456 67

15311111A11111136G626616441115164454215157487635477511531??56A73465554330605550ABC533774441117111611115610200555001111 22211111A11111142602661111111411115101?1?7487635477511531??11111111311111111110000111115111117111622116711310545001112

31352152C24142113D121111111111311111 401?1??1 ?8746588611 ??1?? 23231111 311111153 1200001111 1511231 ??2111211 671131054 500?112

45211111A11111136G62661644111516446421???7597635477511631??56A73465554330605550ABC5337744411??111111115610200535001111111 51252*11A34112152852111111111311111201515?1??21?21?311??!??!111131111211111111000011122111231??2112211111DKS5011117112 62252111A441111*18*2111111111311111111111*11121221*2111*1321111111117111D11111TGDE41111111111711112211111DKR5011111112

7221111 1A1111111126021111111111411111 1H1111 313121 221 4222 131521111111111111211111110*114111111111111?111122111111DKR5011111112

84211111A11131513602111111111311111131111111?1122143111?1??24111*2114211118146*7654113*113112?11??22111?2DL2501111?1?22

9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122 9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122

12211111A111315*2602111111111*11111101111111?112214311131111111131114311C11111P76541213111112?11??22111?2DL2501111?1?2 22252111A541325228021111111113 11111101111111P112214311131111111131114211111111P76541212111112?11??22111?2DL2501111?1? 2

9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122 9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122 9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122

62211111A11111112602111111111411111171111111?1122143111?2111111121114*11*11111P7654112*111112211212211122DL25011111132 72211111A111321338081111111113111113L1111?1??11?2143111?!??1111121114211111111L00011166111112?11??2211122GP21011111172

9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122 9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122

02111111A111311126021111111114111121Q1111?1121111433111?!112123111111122311111D21141111113112?11??22111?2DL25011112?12 12211111A11132143*02111111111311111301111111?112214311131??1111111111112111111533242111111112?11??22111?2DL2501111??12 22211111A111121551021111111114 11112*P19291111112143311182 111111111112112511111MB8A42111133112?11??2211122FO26011112?12 32211111A11112155102111111111411111*P19291111112234311182 111111111111112111111R63332111111112?11??2211122FM26011112?1 2 42211111A11112155102111111111411112*P192911111??14331118???2811111112112511111MB8A42111133112?11??2211122F026011112?12

9221111A1A111131 * 1300 2 1 1 1 1 1 1 1 122111111 311111111? 111 22 14 3 1 1 121? ?1 1 1 1 2 1 11421111111111 L76 54 11 3211111112911112221111112DL250111 1 11 122

62211111A11111112102111215111*11111171111???111721*311?3111****11111*112141323GB8A41111111112?11??22111?2DL25011112712 72211111A111311*5602111111111*1111110?????1711132132 111?1113***1111111121413236*3341111111112?11??22111?2DL25011112?12

82211111A111111*5102111??Ill141111110111121311122133 111?Ill****11111*112117424GB8A411111*1112?11??22111?2DL25011112?12 92211111A11111136*04112111111411112Ul111???1112234311??1114873211112112211111FBAA41111231112611212211122DL25011112?12 02211111A11111136B04112111111511112Ullll?!??11?144?111?1114*732111121122 11111FBA342111131112611712211172DL25011112?1 2 12211111A111111366021111111114111121J1111?11?1121443111????2111111112112211111MBAA42111113112?11??22111?2DL25011112?12 22211111A111111325041121111114111111J111111??11?146?11??!??1111111112112511111*B8A41111131112611712211122E125011112?12 32211111A111121326041121111114111111J111111??11?143??????1111111111111122 11111B54342111111112?11712211122E125011112?1 2 423 1111 1A11 11 21* 25 0* 111 215 111 411 111 1J 1111 113 311214331118111111111111111111122111111B543411111131111291171221111122J5M60111112? 1 2

52211111A11111522102111111111411111101111???11122143111?11148732 11112112111111FBAA41111133112?11??22111?2DL25011112?1 2 62311111A111115*2*0111121511141111*IK?11111?11122143 111?11143*3111112112111111FBAA41111131112?11??22111?2DL25011112?1 2 72211111A1113151**02111111111**!111101111214111121*341131111111111111122111111C4**32111111112?11??22111?2E125011112?12

423 1111 1A11 11 21* 25 0* 111 215 111 411 111 1J 1111 113 311214331118111111111111111111122111111B543411111131111291171221111122J5M60111112? 1 2

92211111A11112522*021112151114111111K311111411122143 111?1112323111111112111131B6???2111131112?11112211122E12501111211 2 02311111A111121*2*021112151114111121K311111311121343221*1112323111111112121223*22141111131112911512211122JT26011112112 12211111A11*1*126*071115121114 111111**11121311121*4211131111111111111112111111411141111211112 9 11112211122HRI6011112?1 2 22211111A111111266021115121114111111011111?41112214232331111111111111122111111121111111111112911112221322BD22011112212 32211111A111321*6H021111111114123111H111111*?112214?2213 1111111111111122111111821121111111112*11112221322AAA281111221 2 42311111A111**1264071111111114111111A111111*111221321113*111111111121111111111000011111111112?11112221122AAB2116112212 52311111A111**32*4021111111114111111*3111???11122143 111??111111111121111111111000011111111112?11112221222AAA281111221 2 62211111A111**1264071111111114111111A1111?1332122142????1111111111121111111111000011111111112911122221122AAB2116112212

423 1111 1A11 11 21* 25 0* 111 215 111 411 111 1J 1111 113 311214331118111111111111111111122111111B543411111131111291171221111122J5M60111112? 1 2

82311111A111111164021112151114111111*1111????11?*142111????Ill1111111112111111060041111111112??1??22212?2AAA2?11112212 92311111A111115124021111111114111121H1111?12211213*21?131111111111111112111111065141111111112?!1112221222AAA2811112212 02211111A11131512*011111111113111111G1111?1321121*4332??111375411111111211433426E141111213112?11??22212?2AAA2?11112212 12211111A11112552402111*1*1114111121H111121??11?1*4?????11133*3*11111112111111251241111231112?11??22212?2AAA2*11112212 22255111A111315524021111111114111111F1323?!??11321*2 111?1114373*11171111114334200011111111112?11??22212?2AAA2?1111221 2 312**111A24211516E*14115121115111111B132311332122511??15132475411111111221111126424111121121212?1122212?2AAA2?11112212

423 1111 1A11 11 21* 25 0* 111 215 111 411 111 1J 1111 113 311214331118111111111111111111122111111B543411111131111291171221111122J5M60111112? 1 2

5*322*52C**21151*0*111111121431111118162631?32121152221?1111111111111112111111051241111111??2?????2221??2AC2401?112212 6135215262*211513052111111114311111281323?!???!?????????!??1111111101111111111000011111111212*213122214?2K8P1011112212 71332232E2221111*F5211111121?3142111*1111?1???1?2???????1??1111111101111111111A00011111111212?2???22212?2AC24011112212 82232232B24211512*222111112124152111C1111?!?1211*132??1?111*873211112112211111IBAA4111121121222?1122212?2A*A*?1?112212 92332252024211526*1211111121241421*1013361112211*122221311147*3213112112211111IBAA41111233212?????22212?2AB23012112212 02252152B24131512D51111111222315211111331?1?3212213232171113764211112112116334*B8A41111213212?2???22212?2AAA2?12112212 12252152C24131512D11111111212314212111111112121221323233111*76321*112112116334*B8A41111233?12??1??22212?2BFD4014112212 2215215262413152*35*1111111113111112G111131311122142113?11147631111121121164349B86411112*1112?11??22213?2BFD4014112212 32252152B2413252230111111?1113111111F1222?13?1122142??1????477321111211211*4329B86411112*3112?11??22212?2BFD4014112212 41252152B441315123511111111113111112G?????1??11?2142 111?1113793115116112A163349BAD42111211112?11??22212?2BFD401411221 2 52252152B441?2??635?Ill111111*111121E1111?!??1122342??13???4*93215116112A16*339B8641111231?12?11??22212?2BD22014112212 61122252024233*263271111111214111112E0222?1??11?2143????1??4*43211116112A164349BAD42111211112911512221222BF34014112212 712521520241323563521111111114111111E1111?1??1112?33111??112*11111713112E16434*B8642111111112?11??22212?2?????11112212

74

J. G. CARTE R ET AL.

Appendix 4: Character state changes for nodes in Fig. 4 Key: 34(5-6) indicates character 34 changing from stat e 5 to state 6; 34(5-6,7) indicates character 34 changing fro m state 5 to state 6 or state 7 (indeterminate). *, State change of uncertai n hierarchica l positio n du e t o uncertaint y o f character state in one or more adjacent siste r groups. Node l-Anabarella: 2(2-3) , *97(l-6) , *110(3-5) . Node 1-2: 16(6-2) , 18(6-0) , 23(6-1) , 24(4-1) , 25(4-1) , 31(6-1), 32(4-1) , 33(4-1) , 36(2-0) , 59(5-1) , 60(6-1) , 61(A-1), 62(7-1) , 63(3-1) , 64(4-1) , 65(6-1) , 66(5-1) , 67(5-3), 68(5-1) , 69(4-1) , 70(3-1) , 71(3-1) , 72(0-1) , 73(6-1), 74(0-1) , 75(5-1) , 76(5-1) , 77(5-1) , 79(A-0) , 80(B-0), 81(C-0) , 82(5-1) , 83(3-1) , 84(3-1) , 85(7-1), 86(7-1), 87(4-5) , 88(4-1) , 89(4-1) , 99(1-2) , 102(5-6) , 103(6-7), 105(0-1) , 106(2-3) , 107(0-1) , *110(3-4) , 117(1-2). Nod e 2-Watsonella: * 1(5-2), * 15(3-4), *17(G-6), *29(5-4), *35(4-l), *97(l-6), *98(l-2). Node 2-3: *1(5-1) , 3(1-5), 4(1-2), 10(1-4), *15(3-1), 20(6-1), 21(6-1), *29(5-3) , 34(5-1) , 42(4-1) . Nod e 3 Pseudomyona: 2(2-3) , 6(1-5) , 7(1-2) , 8(A-C) , 9(1-2), 12(1-4), *13(l-2) , 16(2-3) , *17(G-D) , 18(0-1) , *44(7-8), *45(6-7) , *46(3-4) , *47(5-6) , *48(4-5) , *49(7-8), *50(7-8), *51(5-6), 59(1-2), 60(1-3), 61(1-2), 62(1-3), 74(1-5), 75(1-3), 77(1-2), *90(l-2), *91(l-3) , *95(l-2). Nod e 3-4 : *17(G-8) , *45(6-2) , *46(3-l) , *48(4-2), *49(7-l) , 67(3-1) , 87(5-1) , *98(l-2) , 102(6-1), 103(7-1) , 105(1-D) , 106(3-K) , 108(0-5) , 109(5-0), 110(4-1) , 111(5-1), 112(0-1) , 113(0-1). Node 4-Tuarangia: 9(1-3) , *13(l-2) , 15(1-5) , 18(0-5) , *35(4-2), *51(5-3), 64(1-3), 69(1-2), 85(1-2), 86(1-2) , *90(l-2), *91(l-3) , *95(l-2) , *107(1-S) . Nod e 4-5 : *l(l-2), *35(4-l), 38(5-1), 40(5-1), *41(7-3), *44(7-l), *47(5-2), *50(7-4) , *51(5-2) , *54(5-l) , 82(1-4) , *107(1-R). Nod e 5-Pojetaia: 9(1-4), 16(2-1) , 36(0-1) , *43(8-l), 55(3-2,7) , *57(l-3) , 68(1-7) , 72(1-D) , 78(0-T), *79(0-G) , *80(0-D) , *81(0-E) . Nod e 5-6 : 3(5-1), 4(2-1) , 10(4-1) , * 17(8-6), 29(3-4) , *43(8-3) , *79(0-1), *80(0-1) , *81(0-1) . Nod e 6-Fordilla. 36(0-H), 52(1-2) , 53(1-2) , *57(l-5) , *71(l-2) . Nod e 6-7: 41(3-1) , 45(2-1) , 58(2-1) , 92(1-2) , *93(7-9) , 103(1-2), 104(1-2) , 106(K-L) , 107(R-2) . Nod e 7-55 : *43(3-l), *51(2-3) , 64(1-3), 68(1-4), 69(1-2), 78(0-P), 79(1-7), 80(1-6) , 81(1-5) , 85(1-3) , 86(1-2) , 116(1-3). Node 55-57 : 12(1-3) . Nod e 57-58 : 29(4-3) , 86(2-3) . Node 58-61: 16(2-3) , 36(0-3), 64(3-2) , 78(P-L). Node 61-Tironucula: 1(2-4) , *14(l-5) , 59(1-2) , 60(1-4) , 65(1-2), 74(1-8) , 76(1-4) , 77(1-6) , 89(1-3) . Nod e 61-62: 17(6-0) , 29(3-2) , 30(1-2) , * 116(3-2). Node 62 Praenucula. 55(3-2) , 86(3-2) . Nod e 62-63 : 16(3-4) . Node 63-Nuculoidea: *36(3-U) , 51(3-4) , 101(1-2) , 112(1-3). Nod e 63-64 : 15(1-3) , 17(0-P) , 19(2-8) , 35(1-3), *36(3-L) , 85(3-6) , 105(D-G) , 106(L-P) , 108(5-1). Nod e 64-65 : 79(7-0) , 80(6-0) , 81(5-0) , 82(4-1). Nod e 65-Ctenodonta: *13(l-2) , 16(4-3) , 17(P-8), 29(2-3), 30(2-1), *86(3-6) . Node 65-Acharax: *12(3-1), 14(1-3) , 20(1-7), 34(1-2) , 38(1-B) , 40(1-B), 51(3-4), 54(1-4), *57(l-4) , *58(l-2) , 64(2-1), 67(1-6), 68(4-1), 69(2-1), 78(L-H), 85(6-1), *86(3-l), *93(9-2), 101(1-2), 112(1-5) . Nod e 64-Tancrediopsis: *12(3-1) , *13(l-2), 23(1-2) , 24(1-2) , 25(1-5) , 46(1-2) , 64(2-3) . Node 58-59 : *14(l-5) , 84(1-2) . Nod e 59-60 : 85(3-1) .

Node 6Q-Cardiolaria: 69(2-3) , 72(1-C) . Nod e 60 Praeleda: 3(1-5) , 4(1-2) , 9(1-5) , 10(1-4) , 13(1-2) , *15(l-2), 17(6-8) , 86(3-2). Node 59-Ekstadia. 17(6-H) , 34(1-2), 41(1-2) , 43(1-2) , *44(l-2) , 49(1-3) , 52(1-4) , 56(1-3), *96(l-2). Node 57-Eritropis: 13(1-3) , 15(1-5), 16(2-6), 17(6-4) , 19(2-4) , 36(0-J) . Nod e 55-56 : 56(1-2), *96(l-2). Node 56-Nuculites: 14(1-3) , 16(2-5) , 17(6-1), 24(1-2) , 34(1-2), *36(0-M) , 49(1-3), 54(1-3) , *55(3-6), *93(9-6) , 103(2-1) . Nod e 56-Palaeoneilo: *36(0-7), 64(3-2) , 85(3-2) , *93(9-2) . Nod e 7-8 : *71(l-2), 114(1-2). Node 8-35: 17(6-1), *51(2-3). Node 35-42: *79(1-B) , 81(1-A) . Nod e 42-45 : 68(1-2) , *78(0-F), *80(1-A) . Nod e 45-49 : 36(0-J) , 48(2-1) , 49(1-4), 72(1-2) . Nod e 49-54 : *17(l-6) , *34(l-2) , 43(3-1), 59(1-2) , 89(1-3) . Nod e 54-Redonia: 2(2-1) , 12(1-3), 36(J-Q) , *44(l-2) , 47(2-1) , 50(4-3) , 61(1-2) , *62(l-3), 68(2-1), 70(1-2), 72(2-3), *78(F-D), 79(B-2), 80(A-1), 81(A-1) . Nod e 54-Noradonta. *15(l-3) , 16(2-6), *78(F-M) , 83(1-2) . Nod e 49-50 : *15(l-3) , 19(2-4), 22(1-2) , *88(l-3) , *96(l-7) . Nod e 50-53 : 16(2-6), *34(l-2), *59(l-4), 61(1-7), *62(l-3), 63(1-2), *93(9-6). Node 53-Nyassa: 48(1-2) , 49(4-3), *60(l-8) , 87(1-2), 96(7-2). Node 53-Tanaodon: 17(1-B) , 29(4-5), 81(A-3), 83(1-2) . Nod e 50-51 : *17(l-5) , 105(D-E) , 106(L-1). Nod e 51-Genu s A Johnsto n & Goodbod y 1988: *50(4-6) , 72(2-5) , *80(A-8) , *93(9-6) . Nod e 51-52: 13(1-2) , *50(4-3) , 68(2-1), *78(F-B) , 79(B-F), *80(A-4), 81(A-3) . Nod e 52-Genu s B Johnsto n & Goodbody 1988 : * 17(5-6), 83(1-2), 88(3-1) . Nod e 52Montanaria. 2(2-3) , 22(2-1) , 23(1-2) , 25(1-5) , *44(l-3), *55(3-8) , 105(E-J) , 106(1-5) , 107(2-M) , 108(5-6). Nod e 45-46 : 14(1-5) , * 15(1-2), *59(l-4) , *62(l-3), *88(l-3) . Nod e 46-Copidens: *60(l-8) , *61(l-7), 63(1-2) , 89(1-3) . Nod e 46-47 : 23(1-2) , 25(1-5), 36(0-K) , *60(l-3) . Nod e 41-Ananterodonta. *2(2-3), 19(2-1) , *61(l-4,5) . Nod e 47-48 : 13(1-2) , 17(1-5), *37(l-3), 59(4-2), *61(l-2), 68(2-1), 78(F-B). Node 48-Genu s C Johnsto n & Goodbod y 1988 : 43(3-4), *76(l-3) , *79(B-6) , 83(1-2) , *105(D-E) , *106(L-1). Node 48-Eodon: *2(2-3) , 14(5-1) , 34(1-2) , 48(2-1), 49(1-3), 52(1-2), 53(1-2), *55(3-4,5), 73(1-2), 75(1-2), *76(l-2) , 77(1-3) , *79(B-2) , *80(A-2) , *81(A-1), 96(1-5) , *105(D-J) , *106(L-T) , 108(5-6) . Node 42-43 : *59(l-3) , 75(1-3) , 76(1-2) , 77(1-3) , *78(0-G), *80(l-8) . Nod e 43-Cycloconcha: 23(1-2) , 25(1-5), 36(0-7) , *73(l-4) . Nod e 43-44 : 16(2-5) , 50(4-3). Nod e 44-Fortowensia: 12(1-3) , *15(l-2,4) , 17(1-6), 47(2-3), 51(3-2) , *73(l-4) , 80(8-3) , 81(A-3) . Node 44-Actinodonta. *41(1-2) , 74(1-7) , 75(3-4) , 77(3-4). Nod e 35-36 : 29(4-3) , *79(l-6) . Nod e 36-38: 13(1-2), 35(1-3) , 43(3-1), 80(1-3). Nod e 38-Thoralia: 12(1-3), *15(l-4) , 16(2-3) , 17(1-7,8) , *78(0-5) , 79(6-3), 81(1-2) , *83(l-2) . Nod e 38-39 : *15(l-5) , *78(0-R), 105(D-F) , 106(L-M) , 108(5-6). Node 39-40: 16(2-5), 29(3-4) , *36(0-P) , 38(1-9) , 39(1-2) , 40(1-9) , *55(3-8), 56(1-2) , *83(l-2) . Nod e 40-41 : 34(1-2) , 48(2-1), *49(l-4), 50(4-3), 68(1-2), 72(1-5), 78(R-M), 79(6-B), 80(3-8) , *81(1-A) , 88(1-3) , 89(1-3) , 106(M-O). Nod e 4\-Lyrodesma majus adult : n o autapomorphies. Nod e 4\-Lyrodesma sp . Johnsto n 1996: 59(1-2) , 60(1-8) . Nod e 4Q-Lyrodesma majus juvenile: *49(l-3) , *81(l-3) , *82(4-3) . Nod e 39 Silurozodus: 14(1-5) , *36(0-D) , 41(1-3) , 43(1-2) , 52(1-2), 53(1-2), *55(3-7) , *82(4-3) , *115(l-2) . Nod e

EARLY BIVALV E EVOLUTIO N 36-37: 14(1-5), 16(2-1) , 105(D-E) , 106(L-1). Node 37Babinka. 12(1-3), *41(l-2), 43(3-4), 47(2-1), *52(l^t), 70(1-2), 78(0-C), 79(6-4), 82(4-3), *83(l-2). Nod e 37Ilionia: *15(l-2) , 17(1-C) , 19(2-4) , 22(1-2) , 24(1-2), 25(1-5), 37(1-4), *41(l-3) , 44(1-4), *50(4-6) , 51(3-4), *52(l-2), 53(1-2) , 57(1^) , 58(1-2) , 80(1-0) , 81(1-0) . Node 8-9 : * 15(1-2), 16(2-6) . Nod e 9-Modiomorpha: 19(2-7), *23(l-5) , *25(l-2) , 36(0-4,A) , 41(1-2) , 48(2-1), 78(0-4) , 87(1-2) , *105(D-H) , *106(L-R) , 107(2-1), *108(5-6) , *79(l-2) . Nod e 9-10 : *79(l-2) , 100(1-2), 102(1-3) , *108(5-2) , *115(l-2) . Nod e 10 Evyana. *23(l-5), *25(l-2), 43(3-4), 52(1-3), *53(l-2), 54(1-3), *70(l-2) , 78(0-1) , *82(4-l) , *105(D-B) , *106(L-D). Nod e 10-11 : 36(0-H) , *105(D-A) , *106(L-A), 107(2-A) , 109(0-8) . Nod e ll-Colpomya: 12(1-3), 13(1-2) , *17(6-H) , 31(1-2), 32(1-3) , 52(1-2) , *53(l-2), *70(l-2) , 78(0-8) , 82(4-2) . Nod e 11-12 : 2(2-3), *17(6-4) , 80(1-0) , 81(1-0) , 102(3-2) . Nod e 12-33: 36(H-A) , 67(1-2), 71(2-1), *79(2-0) , *82(4-l) . Node 33-34 : 19(2-7) , 102(2-1) , 107(A-B) , 109(8-1) , 111(1-6). Nod e 34-Modiolopsis: 43(3-1,2) , 50(4-3) . Node 34-Modiolus: 2(3-2) , 44(1-3) , 45(1-2) , 97(1-2) . Node 33-Whiteavesia: 14(1-3) , 37(1-3) , 51(2-3). Node 12-13: *79(2-6) . Nod e 13-32 : 23(1-2) , 25(1-5) , 78(0-O). Node 32-Matheria: 36(H-5) , 80(0-1), 81(0-3) . Node 32-Metapadia: *15(2-1) . Nod e 13-14 : 14(1-5) , *15(2-1), 16(6-2) , *44(l-2) . Nod e \4-Modiolodon: 34(1-2), 43(3-2) , *48(2-l) , 49(1-3) , 80(0-5) , 81(0-1) . Node 14-15 : 2(3-2) , 87(1-2) . Nod e 15-30 : 59(1-3) , 60(1-3), 61(1-5) , 62(1-3) , 78(0-2) . Nod e 30-31 : 12(1-3), 74(1^) , 75(1-3) , 76(1-3) , 77(1-4) . Nod e 31Cyrtodonta: 19(2-1) , 29(4-3) , *36(H-G) , *48(2-l) , 51(2-3), 52(1-3) , 53(1-2) , 60(3-7) , 62(3-4) , 80(0-E) , 81(0-1), 89(1-3). Node 3l-Falcatodonta: 3(1-5) , 4(1-5), * 15(1-5), *36(H-F), 38(1-3), 39(1-2), 40(1-3), 47(2-3), 59(3-4), *61(5-7) , 67(1-7) , 71(2-1) , 79(6-0) , 82(4-1) , 87(2-1). Node W-Ortonella. 13(1-2) , *15(l-5), 34(1-2), *41(l-2), *48(2-l) , 49(1-3,4) , 79(6-5) , 80(0-1) , 81(0-2), 88(1-3) . Nod e 15-16 : 3(1-5) , 4(1-2) , 9(1-2) , 10(1-4), 11(1-2) , 36(H-C) , 45(1-2), 90(1-2), *93(9-2) , 94(1-2). Nod e 16-29 : *1(2-1) , 16(2-6) , 23(1-5) , 25(1-2), *29(4-5), *50(4-1), 51(2-1), 55(3-5). Node 29Ambonychia: *17(4-E) , * 19(2-1), 20(1^) , 36(C-B) , 38(1-3), 39(1-2), 40(1-3), *44(2-3) , *49(l-5) , 57(1-3), 58(1-2), 59(1-4) , 60(1-7) , 61(1-5) , 62(1-4) , 72(1-2) , 78(0-2), 80(0-4) , 81(0-2) , 93(2-1) . Nod e 29 Septimyalina: 2(2-1) , * 17(4-2), * 19(2-6), *28(l-2) , 31(1-4), 32(1-2), 34(1-4), 47(2-1), *48(2-l), *49(l-6) , 79(6-1). Node 16-17: 6(1-5), 7(1-2), 8(A-B), *17(4-D), 18(0-5), 26(1-2) , 52(1-2) , 53(1-2) , * 109(8-0). Nod e 17-27: 2(2-3) , *28(l-4) , *29(4-3) , 87(2-1) , 106(A-C), 107(A-2), * 108(2-4). Nod e 27-Myodakryotus: 3(5-2) , 8(B-C), *19(2-1), *36(C-8), 38(1-6), *39(l-2), 40(1-6), *41(l-3), *44(2-3) , *48(2-l) , *50(4-5) , *79(6-5) , 80(0-1), 81(0-2) . Nod e 27-28 : *1(2-1) , * 10(4-2), 67(1-0), 71(2-1) , *79(6-0) , 82(4-1) . Nod e 28 Palaeolima: 16(2-3) , 26(2-1) , 35(1-2) , *36(C-8) , 38(1-3), *39(l-2) , 40(1-3) , *96(l-3) , 102(2-4) , 105(A-K), 106(C-8) , 107(2-P) , 108(4-1) . Nod e 28 Leiopecten: 3(5-3) , 5(1-2) , 6(5-3) , 8(B-E) , 14(5-1) , 17(D-F), 31(1-4) , 32(1-2) , 78(0-A) . Nod e 17-18 : *28(l-2), 32(1-2) , *50(4-3) , 59(1-4), 60(1-7), 62(1-3) , 63(1-2), 68(1-2), 78(0-1), *79(6-B), 81(0-A), 111(1-2) . Node 18-26: 3(5-3), 5(1-2), 47(2-1), *61(l-7), 72(1-2),

75

*80(0-A). Node 26-Pterinea: 6(5-3) , *18(5-2), 20(1-2), *31(l-5), *44(2-l) , 60(7-8) . Nod e 26-Tolmaia: 2(2-3) , 8(B-C), 15(1-2) , 16(2-6) , 17(D-2,E) , * 18(5-1), *31(l-4), 38(1-3), 39(1-3) , 40(1-6), *43(3-l) , 50(3-2), 65(1-3), 88(1-3) , *89(l-3) , *106(A-B) , 107(A-2) , *108(2-3). Nod e 18-19 : 11(2-1) , 12(1-3) , *19(2-1) , *29(4-3), 36(C-I), 52(2-3), *61(l-6), 74(1-6) , 75(1-3), 76(1-3), 77(1-4) , *80(0-8) , *89(l-3) . Nod e 19 Rhombopteriid ne w Genu s Johnsto n 1993 : 27(1-2), *31(l-5), 38(1-3) , 39(1-3) , *44(2-3) , 59(4-3), 62(3-4). Node 19-20: *44(2-l), 105(A-B) , 106(A-F), 107(A-D), - 108(2-4), 111(2-4) . Nod e 2to-Umburra. 8(B-C) , 18(5-1), *31(l-4) , 34(1-2) , 43(3-2) , 54(1-3) , 88(1-3) . Node 20-21 : 15(1-2) , 17(D-3) , 26(2-1) , 28(2-1) , 32(2-1), 45(2-1) , 50(3-4) , 75(3-4) , 78(1-9) , 81(A-6) , *90(2-1), *94(2-l) . Nod e 21-22 : *36(I-G) , *52(3-l) , *53(2-l), 89(3-1) . Nod e 22-Freja: 2(2-1) , *35(l-2) , *41(l-3), 54(1-3) , *63(2-l) , 102(2-3) . Nod e 22-23 : 61(6-9), 68(2-6) , 72(1-A) . Nod e 23-Trecanolia: *1(2-1), *9(2-4) , 15(2-1) , *35(l-2) , 59(4-3) , *63(2-l) , *65(l-5), 75(4-3) , 80(8-A) , 81(6-D) , *83(l-2) . Nod e 23-24: 13(1-2) , 16(2-6) , 36(G-E) . Nod e 24 Catamarcaia. *9(2-4) , 34(1-2) , 49(1-3) , *65(l-5) , 77(4-3), 88(1-3), 106(F-D) , *107(D-2), 108(4-2). Node 24-25: *1(2-1) , 8(B-D) , *14(5-3) , *29(3-4) , 51(2-3) , *83(l-2). Node 25-Cosmetodon: 2(2-1) , 3(5-2), 5(1-2), 11(1-2), 13(2-3) , 18(5-2) , *19(l-7) , 27(1-2), *35(l-2) , 37(1-0), 38(1-2) , 39(1-2) , 40(1-2) , *61(9-4) , 80(8-A), 81(6-D), *93(2-9) , *96(l-5) , *107(D-3) . Nod e 25 Glyptarca: 15(2-5) , *19(l-2) , *47(2-l) , 50(4-3) , 59(4-2), *61(9-1) , 62(3-1), *63(2-l) , 66(1-7), 68(6-3) , 72(A-E), 87(2-1) , 111(4-1) . Nod e 21-Alytodonta: 13(1-2), 18(5-0) , *36(I-F) , 38(1-2) , 39(1-2) , 40(1-2) , 61(6-7), 77(4-2) . Nod e 1-Ribeiria: 34(5-6) , 42(4-5) , 43(8-9), 54(5-6).

References ADAMS, H . & ADAMS , A . 1854-1858 . Th e Genera o f Recent Mollusca Arranged According to their Organization. J. van Voorst, London, 2, 1-661. ALLEN, J . A . 1985 . The Recen t Bivalvia , thei r for m an d evolution. In : TRUEMAN , E . R . & CLARKE , M . R . (eds) Th e Mollusca, Volume 10 , Evolution. Academic Press, New York, 337-403. & HANNAH , F . J . 1986 . A reclassificatio n o f th e Recent gener a o f th e subclas s Protobranchi a (Mollusca, Bivalvia) . Journal o f Conchology, 32 , 225-249. BABIN, C . 1966 . Mollusques bivalves et cephalopodes d u Paleozoique Armoricain. Imprimerie Commercial e et Administrative, Brest. 1977. Etude comparee des genres Babinka Barrande et Coxiconcha Babi n (Mollusque s bivalve s d e FOrdovicien). Interet phylogenetique. Geobios, 10, 51-79. 19820. Mollusque s bivalve s e t rostroconches . In : BABIN, C. , COURTESSOLE , R. , MELO U M., PILLET, J., VIZCAINO, D. & YOCHELSON , E. (eds) Brachiopodes (articules) e t Mollusque s (bivalves , rostroconches , monoplacophores, gastropodes ) d e 1'Ordovicie n inferieur (Tremadocien-Arenigien ) de la Montagne Noire (Franc e meridionale) . Memoire d e l a Societe des Etudes Scientifiques d e I'Aude, 37-49.

76

J. G . CARTE R ETAL.

1982/7. Tromelinodonta nov. gen., bivalv e lyrodesmatide (Mollusca ) d e 1'Arenigie n (Ordovicien Inferieur) . Geobios, 15, 423-427. & GUTIERREZ-MARCO , J . 1991 . Middl e Ordovicia n bivalves fro m Spai n an d thei r phyleti c an d palaeogeographic significance . Palaeontology, 34 , 109-147. & LE PENNEC, M. 1982 . Ontogenese et phylogenese, a propo s d e quelque s caractere s dentaire s de s mollusques bivalves. Malacologia, 22, 709-720 . BAILEY, J . B . 1983 . Middl e Devonia n Bivalvi a fro m th e Solsville Membe r (Marcellu s Formation) , centra l New Yor k State. Bulletin o f th e American Museum of Natural History, 174(3), 193-326. BERG-MADSEN, V . 1987 . Tuarangia fro m Bornhol m (Denmark) an d similaritie s i n Baltoscandia n an d Australasian lat e Middl e Cambria n faunas . Alcheringa, 11, 245-259. BEURLEN, K . 194 4 [1947] . Beitrag e zu r Stammes geschichte de r Muscheln . Sitzungsberichte de r Mathematisch-Naturwissenschaftlichen Abteilung der Bayerischen Akademie der Wissenschaften m Munchen, 1944 , 133-145 . Boss, K . J . 1982 . Mollusca . In: PARKER , S . P . (ed. ) Synopsis and Classification of Living Organisms. Volume 1 . McGraw-Hill, Ne w York, 945-1166. CAMPBELL, D. C, HOEKSTRA, K. J. & CARTER, J. G. 1998 . 18S ribosomal DN A and evolutionary relationship s within th e Bivalvia . In : JOHNSTON , P . A . & HAGGART, J. W. (eds) Bivalves, an Eon o f Evolution — Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 75-85. CARTER, J . G . 1980 . Environmenta l an d biologica l controls o f bivalv e shel l mineralog y an d micro structure. In : LUTZ , R . A . & RHOADS , D . C . (eds ) Skeletal Growth o f Aquatic Organisms. Plenum , New York , 69-113. 1990. Evolutionar y significanc e o f shel l microstructure i n th e Palaeotaxodonta , Pterio morphia and Isofilibranchia. In , CARTER , J. G. (ed. ) Skeletal Biomineralization, Patterns, Processes, and Evolutionary Trends, Volume I . Va n Nostrand Reinhold, New York, 135-296. & LUTZ, R . A. 1990 . Bivalvia (Mollusca), Plates. In: CARTER, J . G . (ed. ) Skeletal Biomineralization, Patterns, Processes, and Evolutionary Trends, Volume II . Va n Nostran d Reinhold , Ne w York , 5-28, pi s 1-121. & SEED , R . 1998 . Therma l potentiatio n an d mineralogical evolutio n i n Mytilus (Mollusca ; Bivalvia). In : JOHNSTON , P . A . & HAGGART , J . W. (eds ) Bivalves, a n Eo n o f Evolution — Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 87-117. CHAVAN, A. 1969. Superfamil y Crassatellacea. In : Cox, L . R. & 2 4 other s (eds ) 1969-197 1 Treatise o n Invertebrate Paleontology. Part N. Mollusca 6. Bivalvia. Geologica l Societ y o f America , Boulder, CO, and University o f Kansas Press, Lawrence, KS, N562-N580. COPE, J. C. W. 19960. The early evolution of the Bivalvia. In: TAYLOR , J . (ed. ) Origin an d Evolutionary

Radiation of the Mollusca. Oxford University Press, Oxford, 361-370 . 19966. Early Ordovician (Arenig ) bivalves fro m th e Llangynog inlier , Sout h Wales . Palaeontology, 39 , 979-1025. 1997. Th e earl y phylogen y o f th e clas s Bivalvia . Palaeontology, 40, 713-746. 1999. Middle Ordovicia n bivalve s fro m mid-Wale s and th e Wels h Borderland . Palaeontology, 42 , 467^99. Cox, L . R . & 2 4 OTHERS . 1969-1971 . In: MOORE , R . C . (ed.) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6 . Bivalvia. Geologica l Societ y o f America, Boulder , CO , an d Universit y o f Kansa s Press, Lawrence, KS, 1, 1969, xxxvii , N1-N489; 2, 1969, ii , N491-N952; 3, 1971 , iv , N953-N1124. DALL, W . H. 1889 . O n th e hing e o f pelecypod s an d it s development, wit h a n attemp t towar d a bette r subdivision o f th e group . American Journal o f Science, 38, 445-462. 1898. Contributions to the Tertiary fauna of Florida. Transactions of the Wagner Free Institute of Science of Philadelphia, 3(4) , 571-948 . DECHASEAUX, C . 1952 . Class e de s Lamellibranches . In : PIVETEAUX, J . (ed. ) Traite d e Paleontologie, Tom e II. Masson et Cie, Paris, 220-364. DESBIENS, S . 1994 . Le s bivalve s Cyrtodontace a Ulric h 1894 d e l a Formatio n d e Yor k River , Emsie n d e Gaspesie, Quebec. Geobios, 27, 449-458. DESPARMET, R., TERMIER, G. & TERMIER, H. 1971 . Su r u n bivalve protobranche ante-Arenigien trouve au nord de Wardak (Afghanistan). Geobios, 4, 143-150. DZIK, J . 1994 . Evolutio n o f 'smal l shell y fossils ' assemblages. Acta Palaeontologica Polonica, 39 , 247-313. FANG, Z . 1998 . Revisio n an d taxonomi c positio n o f th e aberrant Devonian bivalve Beichuania. In: MORTON , B. (ed.) Th e Bivalvia - Proceedings of a Memorial Symposium in Honour of Sir Charles Maurice Yonge, Edinburgh, 1986. Hon g Kon g Universit y Press, Hong Kong, 185-191 . & MORRIS , N . J . 1997 . Th e genu s Pseudosanguinolites an d som e modiolifor m bivalves (mainly Palaeozoic). Palaeoworld, Press of University o f Science an d Technolog y o f China, 7, 49-69. FERUSSAC, A . E . D E 1822. Tableaux Systematiques de s Animaux Mollusques classes en families naturelles, dans lesquels on a etablis la concordance de tous les sysfemes. A . Bertrand, London. FISCHER, P . H. 1880-1887 . Manuel d e Conchyliologie e t de Paleontologie Conchyliologique. F. Savy, Paris. FLEMING, J. 1828. A History of British Animals, Exhibiting the Descriptive Characters and Systematical Arrangement of the Genera and Species of Quadrupeds, Birds, Reptiles, Fishes, Mollusca, and Radiata o f th e United Kingdom. Bel l & Bradfute , Edinburgh. FRECH, F . 1891 . Di e devonische n Aviculide n Deutschlands, ei n Beitra g zu r Systemati k un d Stammesgeschichte der Zweischaler. Abhandlungen z. Geolologischen Specialkarte von Preussen und den Thuringischen Staaten, 9(3) . GEYER, G . & STRENG , M . 1998 . Middl e Cambria n

EARLY BIVALV E EVOLUTION pelecypods fro m th e Anti-Atlas , Morocco . Revista Espanola de Paleontologia, num. extr. Homenaje al Prof. Gonzalo Vidal, 83-96 . GRAY, J . E . 1824 . A natura l arrangemen t o f Mollusc a according t o interna l structure . Repository, 15 , 229-239. 1840. Synopsis o f th e contents o f th e British Museum, 42n d Edition. Britis h Museum , London . 1847. A list of the genera of Recent Mollusca, thei r synonyms and types. Proceedings of th e Zoological Society o f London, 15, 129-219. GROBBEN, K . 1894 . Zur Kenntnis s der Morphologic , de r Verwandschaftsverhaltnisse un d de s System s de r Mollusken. Sitzungsberichte de r MathematischNaturwissenschaftlichen Classe der Kaiserlichen Akademie der Wissenschaften, Wien, 103 , 61-86. HALL, J . 1885 . Lamellibranchiata II, Text an d Plates. Containing Descriptions and Figures of the Dimyaria of the Upper Helderberg, Hamilton, Portage, and Chemung Groups. Geological Survey of the State of New York, Paleontology, Vol. 5, Pt. 1. Van Benthuyse n & Sons , Albany , Ne w York , 269-562, pis 34-80, 93-96. HARRISON, W . B . Il l & HARRISON , L . K . 1975 . A Maquoketa-like mollusca n communit y i n th e Brassfield Formatio n (earl y Silurian ) o f Adam s County, Ohio . Bulletins o f American Paleontology, 67, 193-234. HASZPRUNAR, G . 1983 . Comparativ e analysi s o f th e abdominal sens e organ s o f Pteriomorphi a (Bivalvia). Journal o f Molluscan Studies, Supplement, 12A , 47-50. 1985. Th e fin e structur e o f th e abdomina l sens e organs o f Pteriomorphi a (Mollusca , Bivalvia) . Journal o f Molluscan Studies, 51, 315-319. HERBERS, K . 1914 . Entwicklungesgeschicht e vo n Anodonta cellensis Schroter . Zeitschrift fu r Wissenschaftliche Zoologie, 108, 1-174. HERTWIG, R . 1895 . Lehrbuch de r Zoologie, 3r d Edition . Jena. HINZ-SCHALLREUTER, I. 1995 . Muscheln (Pelecypoda) au s dem Mittelkambriu m vo n Bornholm . Geschiebekunde Aktuel, 11 , 71-84. HORNY, R . 1960 . O n th e phylogen y o f th e earlies t pelecypods (Mollusca) . Vestnik Ustfedniho Ustavu Geologickeho, 35, 479-482, pi. 1 . JOHNSTON, P. A. 1991 . Systematics an d ontogeny of a new bivalve, Umburra cinefacta, fro m th e Siluria n o f Australia, implication s fo r pteriomorphia n evolution. Alcheringa, 15 , 293-319. 1993. Lowe r Devonia n pelecypod s fro m southeastern Australia . Association o f Australasian Palaeontologists, Memoir, 14, 1-134. 1995. Evolutionary pathways in the bivalve subclass Pteriomorphia. In : JOHNSTON , P. A. (ed. ) Canadian Paleontology Conference Program and Abstracts, 5, 16-17 . 1996. Middl e Ordovicia n (Caradoc ) pelecypod s from th e Advanc e Formation , Britis h Columbia . Geological Survey o f Canada Bulletin, 491 , 113-129. & GOODBODY , Q . H . 1988 . Middl e Devonia n bivalves fro m Melvill e Island , Arcti c Canada . In : MCMILLAN, N. J., EMBRY, A. F. & GLASS, D . J . (eds)

77

Devonian of the World, Volume III: Paleontology, Paleoecology an d Biostatigraphy. Canadian Society of Petroleum Geologists , Calgary , Alberta, Canada, 337-346. & ZHANG , R . 1998 . Re-interpretation o f Sinodora Pojeta an d Zhang , 1984 , a n unusua l bivalv e (Trigonoida) fro m th e Devonia n o f China . In : JOHNSTON, P . A. & HAGGART , J . W . (eds) Bivalves, An Eon of Evolution — Paleobiological Studies Honoring Norman D. Newell. University of Calgary Press, Calgary, 361-375. KEEN, A . M . 1958 . Marine Shells o f Tropical West America. Stanfor d University Press, Stanford, CA. KOROBKOV, I. A. 1954 . Handbook an d Methodical Guide to the Tertiary Mollusca, Lamellibranchiata. Gosud. Nauchno-tecno'i Isledov. Nefti . Gorno-toplivnoi litry, Leningradskoi Otdeleni e [in Russian], 1960. Rhombopteriidae/am. nov. In: EBERZIN, A . G. (ed.) Osnovui Paleontologhii. Spravochnik dlya paleontologov i geologov SSSR. 3, Mollyuski, Pantsirnye. Dvustvorchatye, Lopatonogie. Moskva, Izdatel'stvo Akademi i Nau k SSSR, 81 . KOUCHINSKY, A . V . 1999 . Shell microstructure s o f th e Early Cambria n Anabarella an d Watsonella a s new evidence o n th e origi n o f th e Rostroconchia . Lethaia,32, 173-180. KRASILOVA, I. N. 1959. A new family Leiopectinidae from the Uppe r Siluria n an d Lowe r Devonia n o f th e northeastern par t o f th e Balkhas h region . Paleontologicheskiai Zhurnal, 1959(2) , 41-4 6 [i n Russian]. LAMARCK, J . B . P . A . D E M. D E 1815-1822. Histoire Naturelle des Animaux sans Vertebres, Volumes 1-7. Verdiere & Deterville, Pari s [se e Volume 6, Part 1 , 1819] LILJEDAHL, L . 19840 . Siluria n silicifie d bivalve s fro m Gotland. Sveriges Geologiska Undersokning, Avhandlingar oc h Uppsater, Seri e C , Nr . 804, 78, 1-82. 1984/7. Silicifie d Siluria n bivalve s fro m Gotland . Lund Publications in Geology, 24, 1-28 . 1994. Silurian nuculoid and modiomorphid bivalves from Sweden . Fossils and Strata, 33, 1-89 . LINNE, K . 1758 . Systerna Naturae pe r Tria Regna Naturae. Edit, decima, L Laurenti i Salvii , Stockholm. MACKINNON, D . I . 1982 . Tuarangia paparua n . gen. and n. sp., a late Middle Cambria n pelecypo d fro m New Zealand. Journal o f Paleontology, 56 , 589-598. 1985. New Zealand lat e Middle Cambria n mollusc s and th e origi n o f Rostroconchi a an d Bivalvia . Alcheringa, 9, 65-81. McALESTER, A. L. 1969 . Family Praenuculidae . In : Cox, L. R . & 2 4 other s (eds ) 1969-1971. Treatise o n Invertebrate Paleontology. Part N. Mollusca 6, Bivalvia. Geologica l Societ y o f America , Boulder , CO, and University of Kansas Press, Lawrence, KS, N229-N230. MCROBERTS, C . A . & CARTER , J . G . 1994 . Nacre i n a n early gryphaei d bivalv e (Mollusca) . Journal o f Paleontology, 68, 1405-1408 . MILLER, S . A. 1877 . Th e American Palaeozoic Fossils, a Catalogue of the Genera and Species, with Names of Authors, Dates, Places of Publication, Groups of

78

J. G . CARTE R ETAL.

Rocks in Which Found, and the Etymology and Significance of the Words, and an Introduction Devoted to the Strati graphical Geology of the Palaeozoic Rocks. Publishe d b y th e author , Cincinnati Time s Co . Boo k an d Jo b Rooms , Cincinnati, Ohio. MORRIS, N . J . 1979 . On th e origi n o f th e Bivalvia . In: HOUSE, M . R . (ed. ) Th e Origin o f Major Invertebrate Groups. Systematic s Associatio n Special Volum e No. 12 , Academic Press , London , 381-413. 1980. A new Lower Ordovicia n bivalv e family , the Thoraliidae (?Nuculoida), interprete d a s actinodon t deposit feeders . Bulletin o f th e British Museum o f Natural History (Geology), 34 , 265-272. & FORTEY , R . A . 1976 . Th e significanc e o f Tironucula gen. nov. t o th e stud y o f bivalv e evolution. Journal o f Paleontology, 50, 701-709. , DICKINS , J . M . & ASTAFIEVA-URBAITIS , K . 1991 . Upper Palaeozoi c anomalodesmata n Bivalvia . Bulletin of the British Museum (Natural History), Geology, 47 , 51-100. MUTVEI, H . 1970 . Ultrastructur e o f th e minera l an d organic component s o f mollusca n nacreou s layer . Biomineralization Research Reports, 2, 48-61. 1983. Ultrastructural evolution of molluscan nacre. In: WESTBROEK , P . & D E JONG , E . W . (eds ) Biomineralization and Biological Metal Accumulation. D. Reidel Co. , Boston, 261-21 \. NEWELL, N . D . 1942 . Lat e Paleozoi c pelecypods , Mytilacea. State Geological Survey o f Kansas, 10 , 1-115. 1969. Classificatio n o f Bivalvia , an d Superfamil y Modiomorphacea. In: Cox, L. R. & 24 others (eds) 1969-1971. Treatise o n Invertebrate Paleontology. Part N. Mollusca 6, Bivalvia. Geological Societ y of America, Boulder , CO , an d Universit y o f Kansa s Press, Lawrence , KS , N205-N224 , an d N393-N399. & BOYD , D . W . 1975 . Parallel evolutio n i n earl y Trigoniacean bivalves . Bulletin o f th e American Museum o f Natural History, 154(2), 53-162. OCKELMANN, K . & WAREN , A . 1998 . Taxonom y an d biological note s o n the bivalve genus Microgloma, with comment s o n protobranc h nomenclature . Ophelia, 48, 1-24 . ORBIGNY, A . D' , 184 4 [1843] . Paleontologie Frangais terrains cretaces, Volume 3 , Mollusques. G . Masson, Paris . POJETA, J. JR 1971. Review of Ordovician pelecypods . U S Geological Survey Professional Paper, 695 , 1-46 , pis 1-20 . 1975. Fordilla troyensis Barrand e an d earl y pelecypod phylogeny . Bulletins o f American Paleontology, 67, 363-384. 1978. Th e origi n an d earl y taxonomi c diversification o f pelecypods . Philosophical Transactions of the Royal Society of London, Series B, 284, 225-246. 1980. Mollusca n phylogeny . Tulane Studies i n Geology an d Paleontology, 16, 55-80. 1985. Earl y evolutionar y histor y o f diasom e mollusks. In : BROADHEAD , T . W . (ed. ) Mollusks, Notes for a Short Course. University of Tennessee

Department o f Geologica l Sciences , Studie s i n Geology, 13 , 102-130 . 1988. Th e origi n an d Paleozoi c diversificatio n o f solemyoid pelecypods . Ne w Mexico Bureau o f Mines an d Mineral Resources Memoir, 44 , 201-271. & GILBERT-TOMLINSON , J . 1977 . Australia n Ordovician pelecypo d molluscs . Bulletin o f th e Bureau of Mineral Resources, Geology and Geophysics, 174, 1-64, pis 1-29 . & RUNNEGAR , B . 1974 . Fordilla troyensis an d th e early histor y o f pelecypo d mollusks . American Scientist, 62, 706-711. & 1985 . Th e earl y evolutio n o f diasom e molluscs. In : WILBUR , K . M . (ed. ) The Mollusca, Volume 10 , Evolution. Academi c Press , London , 295-336. RAFINESQUE, C. S. 1815 . Analyse d e la Nature ou Tableau de L'Univers et des Corps Organises. Published by the author, Palerme, 1-214 . RATTER, V. A. & COPE , J. C . W . 1998 . New neotaxodon t bivalves from th e Silurian o f South Wales an d their phylogenetic significance . Palaeontology, 41 , 975-991. RUNNEGAR, B . N . 1983 . Molluscan phylogen y revisited . Memoirs of the Association of Australasian Palaeontologists, 1 , 121-144. 1985. Shel l microstructure s o f Cambria n molluscs replicate d b y phosphate . Alcheringa, 9 , 245-257. 1996. Earl y evolutio n o f th e Mollusca , th e fossi l record. In: TAYLOR, J. (ed.) Origin and Evolutionary Radiation of th e Mollusca. Oxford University Press, Oxford, 77-87 . & BENTLEY , C . 1983 . Anatomy , ecolog y an d affinities o f the Australia n earl y Cambria n bivalv e Pojetaia runnegari Jell . Journal o f Paleontology, 57, 73-92. & JELL , P . A . 1976 . Australian Middl e Cambria n molluscs an d thei r bearin g o n earl y mollusca n evolution. Alcheringa, 1 , 109-138. & POJETA , J . J R 1974 . Fordilla troyensis an d th e early histor y o f pelecypo d mollusks . American Scientist, 62, 706-711. & 1992 . Th e earlies t bivalve s an d thei r Ordovician descendants . American Malacological Bulletin, 9, 117-122. SALVINI-PLAWEN, L . V . & STEINER , G . 1996 . Synapomorphies an d plesiomorphie s i n highe r classification o f Mollusca . In : TAYLOR , J . (ed. ) Origin and Evolutionary Radiation of the Mollusca. Oxford Universit y Press , Oxford, 29-51. SANCHEZ, T . M . 1995 . Comment s o n th e genu s Catamarcaia Sanche z an d Babi n an d th e origi n o f the Arcoida. Geobios, 28, 343-346. & BABIN , C . 1998 . The origi n o f actinodon t fro m taxodont dentitio n o r vic e versa , a n unnecessar y controversy? In: JOHNSTON , P. A. & HAGGART, J. W (eds) Bivalves, A n Eo n o f Evolution — Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 409-^12. SANDERS, H. L. & ALLEN, J. A. 1973 . Studies on deep-se a Protobranchia (Bivalvia) ; prologu e an d th e

EARLY BIVALV E EVOLUTION Pristiglomidae. Bulletin o f th e Museum o f Comparative Zoology, 145 , 237-362 . SCARLATO, O . A . & STARABOGATOV , Y . I . 1978 . Phylogenetic relation s an d the early evolution o f the class Bivalvia . Philosophical Transactions o f th e Royal Society o f London, Series B , 284 , 217-224. & 1979 . General evolutionary patterns and the system o f th e clas s Bivalvia . Trudy Zoologicheskogo Instituta, Akademiya Nauk, SSSR, 80,5-38 [in Russian]. SCOTT, H . W . 1961 . Shel l morpholog y o f Ostracoda . In : BENSON, R . H . & 1 6 others. In : MOORE , R. C . (ed. ) Treatise on Invertebrate Paleontology, Part Q, Arthropoda 3 , Crustacea, Ostracoda. Geologica l Society of America, Boulder, CO, and University of Kansas Press, Lawrence, KS, Q21-Q37. SMITH, A . B . 1994 . Systematics an d th e Fossil Record, Documenting Evolutionary Patterns. Blackwel l Scientific Publications , Oxford . STAROBOGATOV, Y . I . 1992 . Morphologica l basi s fo r phylogeny and classification of Bivalvia. Ruthenica, 2, 1-25 . STOLICZKA, F . 1870-1871 . Cretaceou s faun a o f souther n India. 3 . Th e Pelecypoda , wit h a revie w o f al l known gener a o f thi s class , fossi l an d Recent . Geological Survey of India, Palaeontologica Indica, Series 6, 3, 1-537. SWOFFORD, D . L . 1998 . PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4b2a. Sinauer Associates, Sunderland , MA. TAYLOR, J . D . 1973 . Th e structura l evolutio n o f th e bivalve shell . Palaeontology, 16 , 519-534. TUNNICLIFF, S . P. 1987. Caradocia n bivalv e molluscs fro m Wales. Palaeontology, 30, 677-690, pis 76-77. ULRICH, E . O . 1893 . Ne w an d littl e know n Lamellibranchiata fro m th e Lower Siluria n rocks of Ohio an d adjacen t states. Report o f th e Geological Survey o f Ohio, 1, 627-693, pis 45-56.

79

1894. Th e Lowe r Siluria n Lamellibranchiat a o f Minnesota. In : Final Report o f th e Geological an d Natural History Survey of Minnesota, Volume 3, 475-628 [publishe d separatel y i n 189 4 prio r t o the entire Volume 3 in 1897]. WALLER, T . 1990 . Th e evolutio n o f ligamen t system s i n the Bivalvia . In , MORTON , B . (ed.) Th e Bivalvia Proceedings of a Memorial Symposium in Honour of Sir Charles Maurice Yonge, Edinburgh, 1986. Hong Kon g University Press , Hong Kong , 47-91. 1998. Origin o f the molluscan clas s Bivalvia an d a phylogeny o f majo r groups . In : JOHNSTON , P . A. & HAGGART, J . W. (eds) Bivalves, An Eo n o f Evolution — Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 1-45. WIENS, J . J . 1998 . Doe s addin g character s wit h missin g data increas e o r decreas e phylogeneti c accuracy ? Systematic Biology, 47, 625-640. & SERVEDIO , M . R. 1997 . Accurac y o f phylogeneti c analysis includin g an d excludin g polymorphi c characters. Systematic Biology, 46, 332-345. WOHRMANN, S . F . VO N 1893. Uebe r di e systematisch e Stellung de r Trigonide n un d di e Abstammun g de r Nayaden. Jahrbuch de r Kaiserlich-Koniglichen Geologischen Reichsanstalt, Wien, 43, 1-28 . YONGE, C . M . 1939 . Th e protobranchiat e Mollusca ; a functional interpretatio n o f thei r structur e an d evolution. Philosophical Transactions of th e Royal Society o f London, Series B, 230, 79-147 . 1953. For m an d habi t i n Pinna carnea Gmelin . Philosophical Transactions of the Royal Society of London, Series B, 237, 335-374 . 1977. For m an d evolutio n i n th e Anomiace a (Mollusca, Bivalvia ) - Pododesmus, Anomia, Patro, Enigmonia (Anomiidae) , Placunanomia, Placuna (Placunidae fam. nov.}. Philosophical Transactions of th e Royal Society o f London, Series B , 276 , 453-523.

This page intentionally left blank

A new look at early bivalve phylogeny JOHN C. W. COPE Department of Earth Sciences, Cardiff University, PO Box 914, Cardiff CF10 3YE, UK (e-mail: [email protected]) Abstract: I n th e 3 0 years sinc e publication o f th e bivalv e Treatise, (Moore , R . C . (ed.) 1969. Treatise o n Invertebrate Paleontology. Part N . Mollusca 6 , Bivalvia, Geologica l Societ y o f America and University of Kansas) important new faunas have been described fro m the early and mid Cambria n an d fro m th e earl y an d mi d Ordovician . Thes e contai n significan t ne w forms , including som e long-rangin g intermediat e groups , tha t indicat e th e relationship s betwee n th e principal bivalv e clades , bu t lack o f fossils fro m th e late Cambria n an d earliest Ordovician i s a major hindrance . Th e principal phas e o f bivalve diversificatio n followe d o n from th e evolutio n of th e filibranch gill in the latest Cambria n or earliest Ordovician . Th e fundamenta l division of the class is into two subclasses, Protobranchia an d Autolamelli branchiata; links between the two can be demonstrated in the early Ordovician. Major division s of each subclas s are recognized a s superorders. Within th e Protobranchia , th e Nuculoid a develope d specialis t food-gatherin g palp s an d a n enlarged foot . Divergin g earl y fro m th e protobranc h stoc k wer e othe r bivalve s tha t live d symbiotically wit h sulphur-oxidizin g chemoautotrophi c bacteria ; thi s allowe d colonizatio n o f anaerobic substrate s an d produce d tw o distinc t stocks : th e deepl y infauna l anteriorl y elongat e Solemyoida an d the shallower infaunal Nucinelloida . The Autolamellibranchiata, initially identified by strongly asymmetrical hinges, diversified in three directions, each characterized by distinctive hinges. The Trigonioida were characterized by ligamental nymph s and frequently denticulat e teeth , an d rapidly regaine d greate r symmetry ; the Anomalodesmata als o develope d a stron g ligamenta l insertio n withi n nymph s an d largel y los t their dentition , whils t th e Heteroconchia, principall y wit h a shell includin g a complex crossed lamellar structure , ha d variou s combination s o f cardina l an d latera l teeth . Heteroconc h diversifications wer e mainl y i n th e Mesozoi c an d Cenozoic , bu t on e Ordovicia n group , th e Glyptarcoidea, i s a good ancestor for the Pteriomorphia. The followin g ne w tax a ar e proposed: Cardiolarioide a superfam . nov., Eritropidae fam . nov. and Catamarcaidae fam. nov.

The phylogen y o f th e bivalve s ha s becom e muc h Pojet a & Gilbert-Tomlinso n 1977 ; Babi n 1982a ; better understoo d ove r th e past 3 0 years an d credit Babi n & Gutierrez-Marco 1991 ; Cop e 1996 , 1999) , for thi s i s du e t o th e renewa l o f interes t i n earl y whic h hav e extende d th e know n range s o f man y Palaeozoic bivalve s followin g a perio d o f man y bivalv e group s an d yielde d intermediat e fossil s years during which interest i n these fossils appear s crucia l t o the understanding o f bivalve evolution , to hav e bee n minimal . I n turn , thi s followe d o n from th e frenzy o f naming new species and genera The earliest bivalves in th e middl e year s o f th e las t century . Th e latel y renewed interes t wa s initiate d b y tw o importan t Knowledg e o f Cambria n bivalve s ha s als o publications: Babin' s (1966 ) descriptio n o f th e increase d dramaticall y ove r pas t 3 0 years . Pojet a Ordovician fauna s o f Brittan y an d Pojeta's (1971 ) (1971 ) examine d th e variou s putativ e Cambria n now classic review of Ordovician bivalves. Both of bivalve s then recorded an d conclude d tha t none of these works demonstrated the unexpected diversity the m could be unequivocally regarded a s a bivalve, of Ordovicia n bivalves , bu t a t tha t tim e link s Pojeta' s (1971 ) suspicion s abou t Lamellodonta between variou s group s o f Ordovicia n bivalve s wer e confirme d whe n Havlice k & Kri z (1978 ) were largely unknown and several major group s of demonstrate d tha t th e mid-Cambria n genus , bivalves wer e the n unknow n befor e th e mi d though t a t th e tim e o f publicatio n o f th e bivalv e Ordovician. Since then important faunas hav e been Treatise (Co x et al 1969 ) to be the earliest bivalve, described fro m th e earl y an d mid-Ordovician (e.g . wa s in fact a distorted obolelli d brachiopod. Pojet a From: HARPER , E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Specia l Publications, 177 , 81-95. 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000 .

82

J. C . W . COPE

(1973, 1975 ) undertoo k a stud y o f th e earl y Cambrian genu s Fordilla an d establishe d tha t i t was indee d a bivalve . Jel l (1980 ) describe d th e early Cambria n genu s Pojetaia tha t is no w known to be widely distributed in early and mid-Cambrian rocks, an d subsequentl y ne w form s hav e bee n described fro m th e early and mid-Cambrian (Berg Madsen 1987 ; Hinz-Schallreute r 1995 ; Geye r & Streng 1998) . I n additio n t o Pojetaia, th e middl e Cambrian bivalve s includ e th e gener a Tuarangia and Camya, which ar e both o f unknown affinities . The genus Arhouriella, describe d fro m th e Middl e Cambrian o f Morocc o (Geye r & Stren g 1998) , i s clearly differen t fro m othe r Cambria n bivalve taxa described hithert o an d th e author s o f th e genu s were unable to suggest a suitable higher level taxon for it. Arhouriella is based on two right valves (only one, th e holotype , show s man y features ) bu t thi s identification depend s upo n th e state d orientation . It bears two peg-like teeth and also seems to have a long posterio r latera l tooth , no t note d i n th e description bu t visibl e i n Geye r & Streng' s illustration (1998 , pi . 7 , fig . A ; se e als o Fig . la) . Geyer & Stren g (1998 , pp . 93 , 94 ) suggeste d tha t Arhouriella ha d a n amphideti c ligament ; th e authors sugges t tw o ligamenta l sites , on e anterio r and one posterior t o the umbones (Geyer & Streng 1998, fig . 8) . I f th e sit e identifie d a s a posterio r ligamental sit e i s such , then this valve is correctl y identified a s a righ t valve . If , however , th e othe r site (Geye r & Streng 1998 , fig . 8, af) wa s th e sol e ligamental site , the n th e specime n shoul d b e interpreted a s a lef t valve . On e peculiar featur e o f Arhouriella i s tha t i t apparentl y doe s no t hav e properly differentiate d denta l sockets ; th e author s believed that this was due to the teeth growing later over the mid part of a juvenile elongate amphidetic ligament Althoug h ther e ar e som e superficia l resemblances t o nucinelloid s (particularl y i f th e holotype wer e i n realit y a lef t valve ) to o littl e i s known abou t Arhouriella t o dra w an y fir m conclusion of its affinities . There stil l remain s onl y a singl e bivalv e speci men known worldwide from rocks of late Cambrian age (Berg-Madsen 1987 ) an d this persistent ga p in the bivalve record i s particularly unfortunate sinc e it is now apparen t tha t this fairly clearl y coincide s with th e appearanc e o f th e filibranc h gil l (Cop e 1995, 1991 b). It is also very apparent that many of the problem s tha t stil l remai n i n earl y bivalv e evolution wil l onl y b e resolve d b y th e discover y and descriptio n o f fauna s fro m thi s late Cambria n lacuna. Cambrian bivalve s ar e certainl y ver y smal l an d these earl y form s nee d no t hav e bee n shallo w infaunal form s tha t comparison s wit h moder n nuculoids have suggested. Tevesz & McCall (1976) suggested tha t bivalve s o f < 1 cm i n lengt h coul d

have functioned equall y wel l as epifaunal crawler s (as thei r tergomya n ancestor s almos t certainl y were). Morto n (1995 ) als o viewe d thes e earl y forms a s surface dwellers that used thei r foo t bot h for feeding and locomotion. Cope (1995) noted that very smal l bivalve s coul d onl y hav e survive d infaunally i n ver y fin e sediment . Thus , th e lif e habits of these early forms are not well-established , but th e adven t o f large r size s i n th e earlies t Ordovician woul d hav e mad e a greate r variet y o f habitats possible . Knowledge o f th e earlies t Ordovicia n bivalv e faunas is also scant. From the early Tremadoc there are onl y a handfu l o f poorl y preserve d mould s described b y Harringto n (1938) , whils t th e lat e Tremadoc fauna s describe d b y Harringto n (1938) , Pojeta & Gilbert-Tomlinso n (1977 ) an d Babi n (1982a), totallin g perhap s te n specie s fro m th e whole o f th e Tremado c Series , merel y hin t a t th e variety o f form s tha t ar e certai n t o b e discovered . The discoverie s o f th e pas t 2 5 year s hav e take n back the origins of many groups to far earlier in the geological pas t tha n wa s conceive d whe n th e Treatise (Co x et al 1969 ) wa s published, but ther e remains this major ga p in knowledge . By th e earl y Ordovician , bivalve s wer e apparently restricte d t o th e peri-Gondwana n sea s (Cope & Babi n 1999) , wherea s i n th e earl y Cambrian the y appea r t o hav e a cosmopolita n distribution. I n th e mi d Cambria n the y ar e known from Baltic a an d Gondwana , an d th e singl e lat e Cambrian specime n i s also Baltican (Berg-Madse n 1987). Earl y bivalve s wer e largel y restricte d t o inshore silt y mud s (Cop e 1996 ) bu t th e lat e Cambrian margin s o f bot h Gondwan a an d Baltic a were largel y rifted , thu s suc h clos e inshor e facie s are consequently rare and this may well explain the, so far, disjunct early bivalve fossil recor d (Cop e & Babin 1999) .

Bivalve taxonomy In trying to produce a satisfactory classification for the bivalves, a large number of schemes have been, and continu e to be, proposed. Th e principal divid e in thes e scheme s ha s bee n betwee n th e zoologist s who naturally rely on soft-part anatomy in drawing distinctions and the palaeontological approac h tha t has largel y relie d upo n feature s suc h a s dentitio n and musculature , togethe r wit h th e fossi l record . More recently , studie s o f shel l microstructur e (Taylor et al 1969 , 1973 ; Carter 1990 ) have added further informatio n t o hel p elucidat e phylogeny , whilst molecula r phylogenie s ar e no w als o bein g reconstructed, base d o n 18 S ribosoma l DN A (rDNA) (e.g . Adamkewic z e t al . 1997) . However , with th e discover y o f ne w fauna s fro m th e Cambrian an d Ordovicia n rock s ove r th e pas t 2 5

BIVALVE PHYLOGEN Y 8

3

Fig. 1 . (a) Arhouriella opheodontoides Geye r & Streng, 1998, Middle Cambrian, Morocco. Holotype: right valve; x 44. Reproduced by permission o f the Societa Espanola di Paleontologia. (b ) Nucinella sohli Pojeta, 1988 , paratype , Upper Cretaceous, Georgia , USA . Photograph kindl y supplie d by J. Pojeta Jr. Holotype: left valve ; x 35. Reproduce d by permission o f the New Mexico Burea u of Mines and Mineral Resources, (c) and (d) Ovatoconcha fragilis Cope , 1996. Moridunian Stage, Arenig, Lower Ordovician, South Wales, (c) Holotype: right valve view of conjoined valves of a silicified composite mould, showing muscle scars; x 3 . (d) External impression of the posterior portio n of a lef t valve, to which the outer part of the silicified shel l adheres , showin g umbonal region and possible periostraca l fring e beyond the mineralized shel l margin , (e) Noradonta redoniaeformis (Thoral) , Lowe r Arenig , Lowe r Ordovician , Montagne Noire. Holotype: left valv e showing cardinal teeth (?two missing) lying beneath lin e of hinge along crenulate posterior tooth, posterior par t of which appears to be of discrete teeth of palaeotaxodontid type. This specie s appears to be a link between N. shergoldi Pojeta & Gilbert-Tomlinson and the cardiolarioids; x 4, Negative kindly loaned by C. Babin. (f) Eritropis peregrinata Cope, Lower Llanvirn, Middl e Ordovician , Mid-Wales . Holotype: lef t valve internal moul d prepared t o show cardiolarioid dentition; x 3.

84

J. C . W . COPE

years, the possibility of a taxonomic scheme based on phylogen y derive d fro m th e fossi l recor d ha s become much more of a realizable objective. One of the ways in which it has been possible t o advance th e understandin g o f th e method(s ) b y which bivalve s evolve d i s th e recognition tha t th e evolution o f the filibranch gil l from a protobranc h gill wa s a singl e evolutionar y ste p (Cop e 1995) . Too ofte n i n th e past , palaeontologist s hav e believed that it would not be possible to determine the gill grade of extinct bivalves and because of this there develope d th e feelin g tha t al l Ordovicia n bivalve group s mus t hav e bee n protobranc h an d that th e filibranc h gil l evolve d separatel y i n different bivalv e groups i n the early Silurian . Suc h a view has also been expressed a s recently as 1997: 'the gills [of most bivalve groups] probably crossed a functiona l threshold during the late Ordovician early Silurian, operating as nutrient filters as well as respiratory organs ' (Bento n & Harpe r 1997 , p . 177). Recognizing that the hinges of some bivalves of palaeotaxodont grad e wer e strongl y asymmetrical , so tha t th e hing e la y alon g th e lin e o f posterio r taxodont teet h whils t th e large r anterio r teet h la y below the hinge, Cope (1995 ) suggeste d tha t these hinges were designed for wider valve opening; the larger anterio r teet h ensurin g tha t ful l denta l articulation wa s preserve d eve n wit h a wid e shel l opening. Cop e (1995 ) correlate d thi s wit h th e evolution of the filibranch gill and the concomitan t need t o voi d pseudofaeces ; later , Cop e (1997Z? ) erected th e famil y Cardiolariida e t o accommodat e such forms. The Cardiolaridae were assigned to the subclass Palaeotaxodont a although , a s argue d b y Cope (1997Z?) , the y wer e likel y t o hav e ha d filibranch gills . Contemporary nuculoids (members of th e famil y Praenuculidae) , o n th e othe r hand , show no such modifications an d early, mid and late Ordovician praenuculi d gener a hav e hing e teet h that, with a wide valve opening, would readily have lost denta l articulatio n a s th e valve s wer e pro gressively opened . B y th e Silurian , however , nuculoid genera such as Nuculoidea sho w enlarged teeth at the anterior and posterior extremities of the hinge plate . Thes e to o ar e clearl y designe d t o accommodate greate r openin g o f the valves, but in this cas e th e hing e i s approximatel y symmetrical , there i s a n interna l resiliu m an d th e augmente d valve openin g the n possible seem s mor e likel y t o be associated with a greatly enlarged foot, a feature characteristic of the Recent Nucula, and which can therefore be assumed to date back to no earlier than the Siluria n whe n th e earlies t nuculoid s wit h a n internal resilium occu r (Pojet a 1971) . It no w seem s clea r tha t th e positio n ha s bee n reached wher e th e tw o subclasse s recognize d b y neontologists ca n b e separate d wit h confidence ,

and thu s th e tim e i s rip e t o produc e a unifie d taxonomic schem e tha t ma y b e use d b y bot h zoologists an d palaeontologists. I n Cope's (1991 b, p. 715) review of bivalve phylogeny, it is noted that 'it may be .. . that a taxonomically mor e defensibl e position woul d b e t o regar d .. . major division s o f the clas s a s superorder s rathe r tha n subclasses' . Therefore, i n thi s accoun t o f bivalv e phylogeny , only tw o subclasse s ar e recognized , th e Proto branchia an d th e Autolamellibranchiata . Withi n each o f thes e subclasse s man y o f th e highes t category subdivisions are ordinal, but in some cases a superordina l categor y i s als o use d for categorie s which had previously bee n regarde d a s subclasse s by palaeontologists . Thi s classificatio n base d o n two subclasse s wa s firs t employe d b y Grobbe n

Fig. 2 . Proposed phylogenetic relationships within the class Bivalvia. The separat e derivation of the Trigonioida, Heteroconchia an d Pteriomorphia from a cardiolarioid ancestor i s supported b y bivalves showin g intermediate character s a s follows: (1 ) cardiolarioid dentition links directly to the early Ordovician Noradonta redoniaeformis (Thoral ) - se e Fig. le ; in turn, this can be linked to N. shergoldi (Pojeta & GilbertTomlinson), Tromelinodonta and thence t o Lyrodesma (see Babin 1982/7 , fig. 1) ; (2) Waller (1998, fig . 5) has shown how the dentition of a 'malletiid ' o r a cardiolarioid (Waller 1998, p. 36) links to other cardiolarioids lik e Inaequidens, thence via Ekaterodonta to a cycloconchid suc h as Copidens (or indeed t o an earlier for m suc h as Carminodonta); (3 ) Cope (1995 , fig. 30.1) showed how the dentition of Cardiolaria linked it to Glyptarca, whils t Ratter & Cope (1998, fig . 7) showed how Glyptarca coul d have given rise to a form that was ancestral t o both arcoids an d cyrtodonts a t the base of the pteriomorphian stocks.

BIVALVE PHYLOGEN Y

(1894) bu t ha s subsequentl y bee n use d b y man y other workers, including Allen (1985), Cox (1959), Waller (1978, 1990 , 1998 ) and Yonge (1959).

Subclass Protobranchi a Pelseneer , 188 9 This grou p i s unifie d b y th e protobranc h gil l tha t typifies the modern nuculoids and solemyoids. The protobranch ctenidium is also simila r t o the gill of primitive archaeogastropods , bu t differ s i n possessing latero-frontal cilia (Walle r 1998 ) an d is widely accepte d a s bein g clos e t o th e primitiv e molluscan gill . Th e earlies t Cambria n bivalves , Fordilla an d Pojetaia, hav e both been assigne d t o the palaeotaxodont s (Runnega r & Pojet a 1992) . These authors recorded that the shell microstructure of these two genera was similar an d resembled tha t of th e oute r shel l laye r o f a Devonia n nuculoi d described b y Carter (1990) , which clearly played a major rol e in making that assignment. Runnegar & Pojeta (1992), however, also left open the possibilty that thes e tw o gener a wer e stem-grou p bivalves . The Palaeotaxodont a mus t no w b e regarde d a s a paraphyletic unit, since the demonstration by Cop e (1995, 1997/? ) that at least one grou p of them was likely t o hav e ha d filibranc h gills , wherea s th e majority o f the palaeotaxodonts ca n be assigned t o the subclas s Protobranchia . Thus , palaeotaxodont s are here regarded a s an informal grade.

Nuculoids Many author s hav e considere d tha t th e genu s Nucula i s th e mos t primitiv e livin g bivalv e an d have modelle d th e anatom y o f earl y Palaeozoi c palaeotaxodont bivalve s o n it . Mor e recently , however, has come the realization tha t some of the features o f Nucula, suc h a s th e enlarge d foo t an d the larg e food-gatherin g palps , ar e specialization s that nee d no t hav e bee n presen t i n th e primitiv e bivalve (Morton 1995 ; Walle r 1998) . Alle n (1978) , in a stud y o f deep-se a protobranchs , argue d tha t both protobranch s an d autolamellibranch s coul d have evolved fro m a n ancestor lik e Nucinella (se e below). H e late r (Alle n 1985 ) conclude d tha t nucinellids were more primitive than nuculoids. It is at least possible tha t som e of the Cambria n bivalves may be nuculoids. The strongest candidat e here i s Pojetaia, whic h ha s palaeotaxodon t dentition an d a shel l structur e havin g element s i n common wit h a Devonia n nuculoi d (Runnega r & Pojeta 1992) . Most o f th e earl y Ordovicia n form s ca n b e included i n the family Praenuculidae, bu t man y of these ar e s o poorl y know n (o r ill-preserved ) tha t they tel l u s little . Th e thre e specie s figure d b y

85

Harrington (1938) , fro m th e Tremado c o f Argentina, a s specie s o f Ctenodonta ar e probabl y praenuculids, a s i s a t leas t on e specime n o f th e types o f th e specie s figure d b y hi m a s Cosmogoniophorina tenuicostata, a s note d b y Pojeta & Gilbert-Tomlinson (1977, p. 11). The only other possibl e Tremado c praenuculi d wa s a for m figured by Pojeta & Gilbert-Tomlinson (1977 , pi. 3, fig. 8 ) a s Deceptrixl sp . A . Althoug h almos t certainly no t a Deceptrix [se e discussio n b y Cop e (1997ft, pp . 736-738) ] thi s specimen , tha t ha s n o preserved dentition , is o f praenuculid shape . Cop e (1996) figured tw o genera of praenuculids from th e early Areni g o f Sout h Wale s (Paulinea an d Pensarnia) i n whic h detail s o f musculatur e an d dentition wer e wel l preserve d an d thes e remai n probably th e bes t know n earl y Ordovicia n nuculoids. I t appear s likel y tha t th e earlies t praenuculids gav e ris e t o th e asymmetricall y hinged cardiolariids ; tha t group may well show the connection betwee n th e protobranc h an d autolamellibranch bivalves (Cope 1995 , 1997ft) . I n the mi d Ordovician , praenuculid s becam e mor e diverse an d includ e form s lik e Similodonta an d Arcodonta (se e Cop e 1999) ; th e famil y continue d on into the Devonian. During th e earl y Ordovicia n nuculoid s diversi fied. Th e ctenodontids , whic h ma y hav e bee n derived fro m a praenuculi d ancesto r (se e below) , became anteriorl y enlarge d an d thei r umbone s migrated rearwards . Th e nuculanid s ar e repre sented, probably from the mid Ordovician onwards, by th e famil y Malletiidae , whos e shel l wa s posteriorly elongate. The majo r innovatio n i n th e nuculoi d stock s appeared i n th e earl y Siluria n whe n th e nuculid s developed a n internal ligament housed in a central resilifer o n th e hing e plate . Som e o f thes e form s developed large r teet h a t eac h en d o f th e hing e plate, suggestin g tha t they had already evolve d th e larger foo t tha t characterize s man y moder n nuculids.

Solemyoids Solemyoids ar e a long-ranging conservative group of protobranc h bivalve s tha t appea r t o hav e changed littl e sinc e th e earl y Ordovician ; the y ar e always dimyarian , alway s edentulou s an d the y often have a periostracum whic h is unusually thick. Harper (1997 , p . 7 6 ) recorde d periostraca l thick nesses o f 10- > 10 0 um, whils t Beedha m & Owen (1965) recorde d u p t o 14 0 (im. Th e periostracu m frequently project s beyond the calcifie d portio n of the valves ; th e valve s gap e anteriorl y an d posteriorly (Pojet a 1988 ; Cop e 1997ft) . Th e valves frequently hav e parallel dorsa l and ventral margins

86

J. C . W . COPE

and ther e ar e well-develope d radia l mantl e muscles. I n addition , Taylo r e t al (1969 ) reporte d that the calcareous shell microstructure o f Solemya was unique . It consist s o f a n oute r prismatic laye r with a unique prism form and an inner layer (that is irregular i n thicknes s an d distribution ) o f finel y laminated homogenou s aragonite . Sinc e then , Carter (1990 ) has examine d furthe r solemyid s an d found, fo r instance , tha t th e Uppe r Carboniferou s species Acharax (Nacrosolemya) trapezoides wa s partially nacreous . The reduce d gu t o f solemyoid s wa s a caus e o f much speculatio n o n their feedin g habit s tha t wa s resolved whe n Cavanaugh (1983) was able to show that the y live d symbioticall y wit h sulphur oxidizing chemoautotrophi c bacteria . I t i s no w known tha t bot h solemyoid s an d nucinelloid s ar e chemoautotrophic, a s note d b y Walle r (1998) ; h e therefore suggeste d tha t chemoautotrophi c symbiotic bacteri a wer e present 'a t the base of the Solemyoidea' (i n whic h h e include d th e nucinelloids) an d suggeste d tha t thi s wa s i n th e earlier par t o f th e Ordovician . Cop e (1996 ) described the solemyoid Ovatoconcha that alread y had anterio r an d posterio r shel l gapes , smal l posteriorly place d umbones , paralle l ventra l an d dorsal shel l margins , strongl y anisomyaria n musculature (with the anterior adducto r the larger ) and radial mantle muscles. In addition, Cope (1996) presented evidenc e t o sho w tha t th e shel l o f Ovatoconcha could have had a thick periostracum . The recen t discover y o f a specime n o f thi s genu s showing wha t appear s t o b e a periostraca l fring e extending beyond the calcified margin s of the shel l (but a t a n angl e t o them ) furthe r confirm s th e solemyoid natur e o f Ovatoconcha, an d tha t earl y Arenig solemyoid s ha d man y o f th e character s o f Recent forms. Figure I d show s this new specime n (NMW 78 . 17G . 1270b ) [compar e to o wit h th e Solemya parkinsoni figure d by Pojeta (1988 , pi . 1, fig. 9) , in which the angle between the periostraca l fringe an d the calcified portion of the shell is more acute]. The origin of the solemyoid s mus t thus go back further tha n the early Arenig. In many respects, th e fact tha t Ovatoconcha is s o like Recen t solemyid s reinforces Waller' s (1998 ) opinio n o n th e earl y origin o f th e chemoautotrophism, suggestin g tha t the divergenc e int o th e praenuculoi d typ e o f nuculoid an d th e chemoautotrophi c grou p o f bivalves mus t have occurred ver y early i n bivalve history. The Solemyida e ar e thu s a grou p tha t i s edentulous through its known stratigraphical range and the present autho r has no problem in including the edentulou s mid-lat e Ordovicia n genu s Psiloconcha in the Solemyoidea, a s was suggested by Pojeta (1988).

Nucinelloids One bivalv e grou p clearl y relate d zoologicall y t o the solemyid s i s th e Nucinelloidea . Th e shel l morphology o f nucinelloid s contrast s markedl y with tha t o f th e solemyoids . Nucinelloid s appear : always t o be smal l (1- 5 mm in length); alway s to be rar e organism s (eithe r a s fossil s o r a s extan t bivalves); t o b e dentate ; strongl y anisomyarian o r monomyarian; and their shell has no gapes. Allen & Sanders (1969 ) describe d a Recen t specie s o f th e Jurassic-Recent genus Nucinella, suggesting that it was a livin g actinodont . I t i s no w clea r tha t an y such similarit y betwee n tha t dentitio n an d tha t o f the Lowe r Palaeozoi c heteroconc h actinodont s i s merely convergence, an d they are in no way related [see also discussion by Cope (1996, pp. 990-991)]. Nucinellid shel l microstructur e wa s investigate d by Taylo r e t al (1973 , p. 287) , wh o reported tha t Nucinella had a homogenous shell simila r to that of Nuculana bu t unlik e tha t o f the solemyoid s o r the nuculoids. Carte r (1990 , pp . 175-176) , however , showed that the shell microstructure of nucinelloids is no t alway s entirel y homogenous ; fo r th e Cretaceous species N. sohli he recorded an irregular simple prismati c t o fibrou s prismati c oute r layer , and a crossed acicula r to homogenous middle shel l layer, whils t Recen t N . walvis ha s a n irregula r simple prismatic to homogemous oute r shel l layer , a fin e comple x crossed-lamella r t o homogenou s middle layer and an homogenous inner layer. Nucinella has a range of Jurassic-Recent and can be related t o the Permian famil y Manzanellidae , a s was suggeste d b y Kee n & Newel l (i n Co x e t al . 1969) wh o place d th e tw o group s i n th e Limopsoidea; the y noted that there was uncertainty with th e orientatio n o f thes e form s an d suggeste d the possibilit y tha t the y migh t b e prosodetic . Following anatomica l wor k b y (amongs t others ) Allen & Sander s (1969) , i t wa s foun d tha t Nucinella wa s o f solemyoi d affinities . Pojet a (1988) suggeste d tha t th e superfamil y Nucinelloidea shoul d contai n th e tw o familie s Nucinellidae an d Manzanellidae; thi s arrangemen t was followe d by Cop e (1991 b). Pojet a (1988 , fig . 3) als o suggeste d tha t the Uppe r Palaeozoi c genu s Clinopistha an d th e middl e Ordovicia n genu s Dystactella wer e directl y ancestra l t o th e Nucinelloidea, and Waller (1990, p. 61) gave assent to this interpretation. However, there must be major reservations abou t includin g i n a lineag e o f smal l dentate bivalve s tha t i s unknow n befor e th e Permian, a grou p o f bivalve s tha t are , a s fa r a s i s known, totall y edentulou s (an d muc h larger) ; th e only rea l poin t o f similarit y betwee n Clinopistha and Nucinella i s that they have similar shell shape s (Pojeta 1988 , fig s 2 an d 4) . Th e presen t autho r would prefe r t o regar d bot h Dystactella an d

BIVALVE PHYLOGEN Y

Clinopistha a s earl y offshoot s o f th e solemyoi d stock. The presen t autho r believe s tha t logi c dictate s that a dentate bivalve, lacking shel l gape s and with the calcifie d margi n o f th e valv e coinciden t wit h the periostracal margin, is likely t o be derived fro m an ancestor sharing these characters. Therefore, i t is believed tha t i t is likely tha t the nucinelloids wer e derived fro m a n earl y dentat e stoc k an d ar e consequently likel y t o b e mor e primitiv e tha n th e solemyoids. Carte r (1990 , p . 178 ) conclude d tha t the common ancesto r o f nucinellids and solemyids had shell s tha t wer e a t leas t partiall y nacreous . Allen's (1985) zoological investigations recognized Nucinella a s a solemyoi d mor e primitiv e tha n th e nuculoids an d suggeste d it s simpl e peg-lik e teet h were mor e primitiv e tha n nuculoi d teeth . Thes e dentate form s constitut e th e superfamil y Nucinelloidea, whils t th e edentulou s anteriorl y elongate form s (presumably ) develope d fro m th e same ancestor , ofte n wit h th e periostracu m extending beyon d th e calcifie d margin s o f th e valves an d wit h well-develope d radia l mantl e muscles, an d anterio r an d posterio r shel l gapes . These constitut e the superfamil y Solemyoidea; th e earliest membe r o f this famil y know n s o far is th e early Arenig genu s Ovatoconcha Cope , 1996 , als o including th e late r Ordovicia n genu s Psiloconcha as well as more recent genera .

Origin of the Solemyoida Pojeta (1988 ) derive d th e solemyoid s fro m th e palaeotaxodont Ctenodonta. Th e presen t autho r does not agree that this genus is related i n any way to the origin of the solemyoids a s was suggested by Pojeta (1988 ) an d followe d b y Walle r (1990 , 1998) - Ctenodonta i s a perfectl y norma l 'mainstream' palaeotaxodon t grad e for m tha t i s anteriorly enlarge d (lik e severa l othe r nuculoi d taxa). Th e suppose d radia l mantl e muscle s show n by Pojeta (1988, e.g. pi. 13 , fig. 10) are interpreted here as no more than a discontinuous pallial line, as noted b y Pojet a whe n h e previousl y figure d th e same specimen (1971 , pi. 4, fig. 10). The lectotype of the type species of Ctenodonta, C. nasuta (Hall) , 1847 , wa s designate d b y McAlester (1968 , p . 22 , an d refigured 1968 , pi . 1, fig. 1) . Th e lectotyp e show s n o featur e o f th e dentition, bu t Pojet a (1971 , pi . 4 ) refigure d it , together with the paratype (recte paralectotype) and specimens o f th e sam e specie s showin g a well developed palaeotaxodon t dentition . Th e nam e Ctenodonta has been much misused throughou t th e history o f Lower Palaeozoi c bivalv e palaeontolog y and, a s pointe d ou t b y Pojet a (1971 , p . 15) , 'Ctenodonta .. . ha s bee n use d s o widel y fo r s o many differen t nuculoid s that the only informatio n

87

it no w convey s i s tha t a nuculoi d i s bein g described'. Thi s i s certainl y th e cas e fo r th e nuculoids described b y Harrington (1938 ) from th e Tremadoc o f Argentin a a s thre e ne w specie s o f Ctenodonta (C . famatinensis, C . laevigata an d C . miniscularia)', non e o f thes e remotel y approache s the ctenodonti d for m an d the y al l resembl e praenuculid shape . O n th e othe r hand , Pojet a & Gilbert-Tomlinson (1977 , p . 9) placed Palaeoneilo iruyensis Harrington , 193 8 tentativel y in Ctenodonta. Thi s specie s i s represente d b y thre e specimens o f whic h Harringto n figure d on e (presumably th e bes t preserved) . Eve n thi s specimen (Harringto n 1938 , pi . 3 , fig . 6 ) i s ver y indifferently preserved , wit h n o dentitio n an d a n outline that has been restored on the photograph. Its umbo i s one-thir d o f th e lengt h fro m th e anterio r margin (Harringto n 1938 , p . 132 ) and , althoug h valve heigh t i s greate r anteriorl y tha n posteriorly , the presen t autho r woul d b e loath e t o giv e thi s specimen an y generi c identity . Thi s appear s t o b e the sole basis for Pojeta's clai m (1988 , p . 211) tha t Ctenodonta occur s in the early Ordovicia n an d the reported mi d Ordovicia n Nort h America n occur rences of Ctenodonta would now all be regarded as from th e lat e Ordovician . Th e presen t autho r dis agrees wit h Pojeta' s (1988 ) placin g o f th e lat e Ordovician specie s Ctenodonta logani Salter, 185 9 within tha t genus , believin g tha t tha t specie s belongs fa r more readily t o Tancrediopsis, althoug h the hinge-angl e i s a little mor e obtus e tha n i n the type specie s T . contracta (Salter) . Middl e Ordovician Ctenodonta specie s ar e typifie d b y those figure d fro m Australi a b y Pojet a & Gilbert Tomlinson (1977) ; thes e (C . macalesteri an d C . youngi), togethe r wit h C . jonesii, previousl y described b y Johnsto n (1888) , al l hav e thei r umbones well into the anterior end of the shell. This is importan t i n vie w o f Pojeta' s (1988 ) claime d derivation o f the solemyid s fro m th e ctenodontids; Pojeta's conclusion s wer e accepte d b y Walle r (1990, 1998) . However , analysi s o f th e recor d o f ctenodontids show s tha t th e earlie r specie s hav e their umbone s wel l t o th e anterio r o f th e shell , which i s contrar y t o wha t woul d b e expecte d i f ctenodontids wer e closel y relate d t o solemyoid s (which hav e their umbones a t the posterio r en d of the shell) . Waller (1990 , 1998 ) believe d tha t th e principa l apomorphy linkin g ctenodontid s an d solemyoid s was tha t the y bot h ha d ligamenta l nymphs . However, th e onl y ctenodontid s t o sho w suc h structures ar e a fe w o f th e lat e Ordovicia n form s figured b y Pojet a (1988) . N o ligamenta l nymph s are know n fro m th e Gondwana n mid-Ordovicia n material (althoug h i t include s well-preserve d silicified replicas) . Accordin g t o Morri s (1979 , p . 392), hi s advanced parinvincula r ligamen t typ e (in

88

J. C . W . COP E

which th e ligamen t i s inserte d i n nymphae ) i s present, amongs t others, i n the Ctenodontacea [sic] and, i n a modifie d version , i n th e Solemyidae . Thus, i n his opinio n there ar e differences betwee n the ligamenta l insertion s i n th e ctenodontid s an d solemyoids. Because Waller (1990, 1998 ) believed these ligamenta l nymph s linke d ctenodontid s an d solemyoids he was forced to conclude (1990, p. 61) that 'th e anatomical features characteristic of the ... Nucinellidae + Ctenodontida e + Solemyida e originated before [hi s italics] the nymphae that are present i n th e Ctenodontida e an d Solemyidae' . Now i t ca n b e show n tha t th e solemyoid s almos t certainly predat e th e ctenodontids an d that pre-late Ordovician ctenodontid s apparentl y did not possess ligamental nymphs . I t ma y b e tha t nymph s wer e perforce develope d i n th e ctenodontid s a s th e rearward migratio n o f th e umbone s shortene d th e effective lengt h o f th e ligament , thu s makin g stronger insertion essential. Thus, it follows that the nymphae are not apomorphic to the two groups but evolved independently. The origin of the ctenodontids does not appear to have bee n previousl y considered , bu t i t seem s probable tha t the y wer e derive d fro m earl y Ordovician praenuculids ; a relativel y equilatera l praenuculid genu s perhap s simila r t o Paulinea (Cope 1996 ) coul d for m a suitabl e ancestor . Ctenodontids coul d hav e evolve d fro m suc h a n ancestor b y anterio r enlargemen t an d gradua l rearward movement of the umbones. However, the origin o f th e solemyid s wa s probabl y a n earlie r event of which, at present, there is no knowledge. The ver y clea r difference s betwee n th e nucinelloids an d th e solemyoid s fro m thei r firs t appearances i n the Permia n an d early Ordovician , respectively, sugges t a lon g separat e history . Pending furthe r informatio n they are both retaine d in the order Solemyoida Dall , 1889. This comprise s two superfamilies : th e Solemyoide a Adam s & Adams, 1857 , whic h contain s th e singl e famil y Solemyidae Adam s & Adam s 1857 ; an d th e Nucinelloidea Yokes , 1956 , i n whic h two familie s are recognized , th e Nucinellida e Yoke s 1956 , an d the Manzanellidae Chronic, 1952 .

Subclass Autolamellibranchiat a Grobben , 1894 Grobben (1894 , p . 73 ) introduced thi s subclas s t o include al l bivalve s wit h gill s othe r tha n o f protobranch grade . Th e subclas s ha s bee n largel y neglected by palaeontologists, but was reintroduced by Nevesskaya et al (1971 ) and followed by other workers, including Starobogatov (1992) and Waller (1978, 1998) . However , al l o f thes e author s have altered th e origina l ter m Autolamellibranchiat a of Grobben (1894 ) t o Autobranchia . Althoug h th e

International Cod e o f Zoologica l Nomenclatur e (ICZN) rules , strictl y speakin g d o no t appl y a t subclass level, the present author feels that as all of these authors have credited Grobben (1894) with its authorship, it should be used in the original spelling and no t th e shortene d ter m no w use d merel y a s a convenience. The subclas s i s characterize d b y filibranch , eulamellibranch o r septibranch gills; later gill types were independentl y derive d fro m filibranc h ancestors i n separat e bivalv e group s a s firs t demonstrated b y Ridewoo d (1903) . Cop e (1995 ) suggested tha t th e evolutio n o f th e filibranc h gil l was a single morphological chang e that occurred i n one group of palaeotaxodont bivalves , late r name d the famil y Cardiolariida e (Cop e 1991 b). Th e characters of this group are a fairly straigh t line of posterior teeth along which the hinge line lay (Cope 1995, fig . 30.1.b ) an d a grou p o f large r anterio r teeth that lie beneath the hinge, constituting a hinge designed to allow full valv e articulation with wider opening o f th e valves , suc h a s woul d hav e bee n needed to void pseudofaeces concomitan t wit h the evolution o f th e filibranc h gill . Cop e (1995 ) correlated thi s wit h th e sudde n increas e i n size , abundance and morphological diversit y o f bivalve s in th e earlies t Ordovician . A s mor e bivalve s wit h the cardiolariid hing e are recognized a s such, it has become clea r tha t thei r morphologica l diversit y is greater than can be comfortably included in a single family. Thus , propose d her e i s th e superfamil y Cardiolarioidea superfam . nov. , t o includ e th e family Cardiolariida e Cope , 1991 b,and the family Eritropidae fam . nov. , t o includ e suc h gener a a s Eritropis Pojeta & Gilbert-Tomlinson, 1977 , whic h have a derived cardiolarioi d dentitio n i n which the posterior teet h have become elongate a t right angle s to the hinge and partially fused [se e Cope (1999, pi. 2, fig s 1 1 an d 12 ; Fig . If)] . A s note d b y Cop e (1999, p. 480) , ther e i s evidenc e tha t th e juvenil e dentition of Eritropis had a dentition which lacke d a subumbona l lacuna. The dental elongation o f the posterior teeth , tha t characterize s Eritropis, ca n also b e see n i n Inaequidens Pojet a & Gilbert Tomlinson, 1977 , which Cope (I991b) ha d already transferred t o the Cariolariidae. The primitiv e cardiolarioi d ca n no w b e envisaged a s havin g a ro w o f subequa l posterio r teeth an d a group o f large r teet h lyin g belo w thi s hinge line . Suc h fossils ma y be expected fro m th e late Cambria n o r earlies t Ordovician . I t i s note worthy tha t amongs t th e gener a o f praenuculoid s known thu s fa r fro m th e earl y Ordovician , som e show a degree of this type of asymmetry, including Pensarnia Cope, 1996 , but the posterior teet h tend to b e o n a n arche d plat e rathe r tha n th e straigh t posterior hing e plat e o f th e cardiolarioids . Th e cardiolarioid asymmetr y provide s a basi c hing e

BIVALVE PHYLOGEN Y

plan from whic h it is possible to readily deriv e the various autolamellibranchiat e bivalv e groups . Waller (1998, fig. 5) depicted a series of dentitions of early-mid-Ordovicia n bivalve s showin g ho w cycloconchid type s coul d b e derive d fro m a 'malletiid' o r cardiolariid type (Waller 1998, p. 33). The Cardiolarioidea are not assigned to an order for the present but form the rootstock of the superorder Heteroconchia Hertwig, 1895 . Whether the cardiolarioids wil l be confirmed in this fundamenta l positio n i n autolamellibranc h evolution depend s upo n th e discover y o f lat e Cambrian t o earl y Ordovicia n representative s o f that group . Thei r morpholog y strongl y suggest s such a positio n bu t th e possibilit y tha t the y represent a nuculoid evolutionar y lin e convergen t on the heteroconchs cannot be excluded at present. One featur e that occur s i n man y groups o f th e Autolamellibranchia is their retention of the byssus. This post-larva l structur e mad e possibl e th e development o f th e epifauna l mode o f lif e tha t i s characteristic o f man y autolamellibranchiat e bivalves. Order Trigonioida Dall, 1889 Many authors treat the trigonioids as being derived from a cycloconchi d ancestor . On e o f th e criteri a usually liste d a s occurrin g commonl y i n th e trigonioids, and one that for many workers was the cause o f th e linkag e o f th e Lowe r Palaeozoi c lyrodesmatids to the Mesozoic trigonioids, was the presence i n both o f denticulat e teeth . Johnsto n (in Johnston & Goodbody 1988 , p . 340 ) showe d that many familie s o f Lower Palaeozoic bivalve s have crenulations o f the teeth and that in som e families only a singl e specie s i s crenulate . I n fact , th e present author believes that the position is yet more variable tha n that , e.g . i n hi s descriptio n o f Glyptarca serrata Cope (1996 , p . 994 ) note d tha t out of a tota l of 484 specimen s two had crenulations o n a singl e toot h ( a differen t on e i n each specimen) . Thus , a s pointed ou t by Johnston (in Johnsto n & Goodbody 1988) , there seems little reason t o accep t crenulatio n o f th e teet h a s a reliable characte r i n familia l diagnoses . Johnston (in Johnsto n & Goodbody 1988 , p . 341) , however, then goe s o n t o poin t ou t tha t Lyrodesma majus (Ulrich) appears to possess ligamental nymphs and later (Johnston 1996 ) confirme d that the genus did indeed possess a short parinvincular ligament with well-developed nympha e resembling the schizodid ligament. H e thu s transferre d th e famil y Lyrodesmatidae t o th e orde r Trigonioida , con firming th e classificatio n o f Newel l & LaRocqu e (in Co x et al 1969) . The Trigonioid a ar e represente d toda y b y th e single genus Neotrigonia, bu t thei r origin s ca n be

89

plausibly trace d bac k t o th e early-middl e Ordovician genu s Noradonta, first describe d fro m the middl e Ordovicia n o f Australi a b y Pojet a & Gilbert-Tomlinson (1977 ) bu t subsequentl y foun d in the early Areni g o f the Montagne Noire (Babin 19820). The dentition of Noradonta redoniaeformis (Thoral) i s very lik e that of a cardiolarioid i n that there is a straightish posterior dentition lying along the hing e line , togethe r wit h a grou p o f large r subumbonal teeth lyin g below th e hinge (Fig . le) . The dentitio n o f Noradonta redoniaeformis differ s from tha t o f a cardiolarioi d suc h a s Deceptrix i n that th e cardina l teet h ar e subparalle l an d th e posterior teeth have become fused t o form a single denticulate posterior tooth. The hinge of Noradonta also differ s fundamentall y fro m th e hinge s o f cycloconchid gener a suc h a s Copidens Pojet a & Gilbert-Tomlinson o r Carminodonta Cope i n tha t the opisthodeti c ligamen t in Noradonta i s paralle l to the posterior toot h (a s it is als o i n Cardiolaria) whilst in the cycloconchids, wit h a sheaf o f teeth, the teet h ar e terminate d b y th e ligamen t an d th e teeth had to be resorbed to allow ligamental growth, as noted by Johnston & Zhang (1998, p. 372). From Noradonta redoniaeformis i t is readily possibl e t o derive th e genu s Tromelinodonta, fro m th e uppe r Arenig of the Massif Armoricain of France (Babin 1982£>), and in turn from Tromelinodonta t o derive the genu s Lyrodesma, whic h i s widel y reporte d from the Ordovician of Europe and North America, and is also known from the Lower Silurian of North America (Harrison & Harrison 1975) . Th e earlies t Lyrodesma recorde d s o fa r i s fro m th e earl y Llanvirn o f Wale s (Cop e 1999 ) an d th e lates t i s from th e Wenloc k Serie s o f Wale s (Ratter , pers . comm.). One featur e tha t ma y b e note d i n thi s evolutionary sequenc e fro m th e cardiolarioi d ancestor through to the lyrodesmatids is the gradual diminution and loss of the strong asymmetry of the hinge tha t characterize d earl y member s o f th e lineage. The relationship between the lyrodesmatids and the late r trigonioid s ha s bee n th e subjec t o f considerable debate , bu t th e basi c proble m i s a distinct stratigraphica l ga p betwee n th e lates t lyrodesmatids an d the earliest trigoniids . Thi s ga p is fille d b y th e schizodids , whic h hav e a ver y similar ligamenta l insertio n t o th e lyrodesmatids , but they lack the denticulate teeth o f the other two groups. I n vie w o f th e argument s of Johnsto n (i n Johnston & Goodbody 1988 , p . 340 ) this does not appear t o b e a significan t phylogeneti c obstacle . Newell & Boy d (1975 ) note d tha t whil e lat e Palaeozoic trigonioid s lac k the denticulate teeth of lyrodesmatids, the y share d th e sam e musculatur e with bot h the m an d th e Mesozoi c trigonioids . A s suggested b y Harriso n (i n Pojeta e t a l 1986) , th e

90

J. C . W . COP E

schizodid denta l arrangemen t o f th e famil y Schizodidae probably aros e throug h paedomorphic retention o f th e juvenil e lyrodesmati d dentition . Pojeta (1978 ) dre w attentio n to th e similaritie s o f the ventrall y flare d denticulat e teeth , th e dorsa l placement o f all the musculature and the positions of th e peda l retractor s a t th e extremitie s o f th e hinge plate in both lyrodesmatids and trigonioids. The Treatise (Co x e t al 1969 ) include d th e Trigonioida i n th e subclas s Palaeoheterodont a Newell, 1965 , whils t Pojet a (1971 ) include d th e trigonioids withi n the order Actinodontoida of that subclass. However , it s ligament , born e withi n strong nymphae , i s unlik e tha t o f th e othe r actinodontoids, a s note d b y Johnsto n (1996 ) an d Johnston & Zhan g (1998) ; th e latte r author s recommended th e retentio n o f th e orde r Trigonioida. Here , th e orde r Trigonioid a i s considered as being an entirely separate division of the subclas s Autolamellibranchiat a fro m th e heteroconchs, wit h whic h the y hav e frequentl y been place d hithert o (e.g . Co x e t al. 1969 ; Pojet a 1971, 1978 ; Babin 19826 ; Cope 19976 , 1999) . Th e group i s characterize d throughou t b y a prismato nacreous shell ; i t share s it s columna r aragonit e prismatic shel l microstructur e wit h tha t o f th e Unionioida, but this was probably derived from th e simpler prismato-nacreous shell of its ancestors. Anomalodesmata The superorder Anomalodesmata constitute a group of essentiall y edentulou s burrowin g bivalve s tha t are characterize d b y a prismato-nacreou s shel l similar t o tha t o f nuculoid s (Taylo r e t al . 1973) . Most moder n forms hav e eulamellibranch-grad e gills bu t som e ar e septibranch . Another characteristic feature of anomalodesmatan shell s is that they frequently displa y a fine-scal e tuberculation . Th e earliest anomalodesmata n hithert o recorde d i s Arenigomya fro m th e early Arenig o f South Wales (Cope 1996) , fo r which , lik e late r Ordovicia n anomalodesmatans, there is as yet no evidence of a strongly parinvincular ligament, although such may have been present. Indeed, as these bivalves largely lacked dentition , th e presenc e o f a well-locate d ligament coul d wel l hav e bee n necessar y fo r accurate valv e articulation . Arenigomya i s on e o f several anomalodesmatan s tha t posses s interna l calcareous structures that may have been concerned with valve articulation (Cope 1996 , fig. 7). There has hitherto been much confusion ove r the affinities o f th e famil y Modiomorphoide a a s defined i n th e Treatise (Co x e t al . 1969) . Suc h confusion i s typifie d b y Pojet a (1971 , p . 20) , 'Pelecypods whic h rang e i n ag e fro m earl y Ordovician to late Permian have been placed in the Modiomorphidae, bu t th e concep t summe d u p b y

the nam e i s vagu e an d uncertain , an d probabl y more than one family-level taxon is included in the Modiomorphidae a s presently recognized' . I t wa s many year s late r befor e thi s taxonomi c proble m was resolved. Fan g & Morris (1997 ) demonstrate d that ther e wa s a rea l differenc e i n th e hing e structures of Ordovician Modiolopsis an d Devonian Modiomorpha. I n modiomorphoids the hinge itself lies alon g th e lin e o f a n elongat e opisthideti c ligament house d withi n usuall y well-develope d nymphae; th e modiolopsoid s lac k th e ligamenta l nymphs tha t th e forme r possess . Fan g & Morri s (1997) als o showed that the family Permophoridae was a junio r subjectiv e synony m o f Modio morphidae an d that the Treatise (Co x e t al. 1969 ) superfamily Modiomorphoide a shoul d b e replace d by th e Modiolopsoidea Fischer , 188 7 (nom. trans. Fang & Morris 1997 ) i n whic h the y include d th e families Modiolopsidae, Colpomyida e an d the new family Modiolodontidae . The y als o suggeste d abandonment o f th e orde r Modiomorphoid a Newell, 196 9 (i n Cox et al. 1969) . Carter & Alle r (1975 ) showe d tha t th e perio stracum o f certai n bivalve s wa s embedde d wit h calcified spicules . The y recognize d tw o type s o f spicules; th e on e i n whic h th e periostraca l calcification too k th e form o f spicules o r granule s cemented within the outer prismatic shell layer they reported i n th e Anomalodesmata , Permophorida e [= Modiomorphidae ] an d mos t o f th e Carboniferous-Recent orde r Myoida . Th e latte r order has been included in the Anomalodesmata b y some authors (e.g. Purchon 1987 ; Waller 1990) . Fang & Morri s (1997 ) conclude d tha t th e Modiomorphidae shoul d b e assigne d t o th e Anomalodesmata becaus e o f th e character s tha t they shared . Cop e (19976 ) suggeste d tha t th e similarities betwee n mytilids and modiomorphoid s were mos t likel y du e t o convergenc e an d cite d evidence produced by Carter (1990) showing a lack of intermediat e forms , despit e a n excellen t fossi l record o f Lat e Palaeozoi c modiomorphoid s an d mytilids. Johnston (1993) followe d Waller's (1990 ) suggestion tha t th e modiomorphoid s belonge d t o the Anomalodesmata 'withou t prejudice'. The origin s o f th e anomalodesmatan s ar e unknown. They differ fro m most possible ancestor s in lackin g teeth . However , th e anomalodesmatan s have a well-located ligamen t which clearly acted as an efficien t substitut e for th e posterio r teeth . Thi s change ma y hav e bee n effecte d i n on e o r mor e stages - eithe r b y the simpl e substitutio n o f the ligament fo r th e teeth , o r b y a n initia l fusio n o r reduction o f th e posterio r teeth , followe d b y thei r loss. A s th e ligamen t i s house d withi n well developed nymphae , thi s clearl y provide d sufficient protectio n agains t an y shearin g motio n along the hinge.

BIVALVE PHYLOGEN Y

Modiolopsoids ar e essentiall y edentulou s (Modiolopsidae), hav e a variabl e numbe r o f anterior teet h (Modiolodontidae ) situate d beneat h the hing e line , o r ma y hav e a blun t subumbona l articulating device (Colpomyidae). The former two are clearly not related to the anomalodesmatans and although th e latte r wer e include d i n th e Isofilibranchia b y Pojet a & Runnegar (1985) they noted tha t som e post-Ordovicia n pholadomyoid s had amorphou s bulbou s teet h comparabl e wit h those o f colpomyids . Fan g & Morris' s (1997 ) placement i s followe d here , pendin g furthe r information. I t had previously bee n suspecte d that modiolopsoids wer e relate d t o th e heteroconchs , being derived from the m by reduction in dentition . However, Carter & Seed (1998 ) demonstrate d that some modiolopsids had multiple insertions of nonparinvincular ligaments , suggestin g tha t the y ha d affinities wit h the Pteriomorphia.

Superorder Heteroconchia This term is used here to link the palaeoheterodont s (from whic h the trigonioids ar e excluded) an d th e heterodonts followin g Pojet a (1971, 1978) . Waller (1998) use d th e ter m i n th e wide r sense , a s employed b y Co x (1960) , i n whic h th e paleo heterodonts, heterodont s an d anomalodesmatan s are included. Waller (1998) claimed that a 3a/2/3b dental arrangemen t wa s a cor e homolog y linkin g these groups. There has been a great deal of debate about th e variou s bivalv e group s possessin g th e heterodont type of hinges that display combinations of cardina l an d lateral teeth . Th e Treatise (Co x e t al. 1969 ) divide d these forms int o two subclasses : the Palaeoheterodont a Newell , 196 5 an d th e Heterodonta Neumayr , 1884 . Thi s schem e ha s subsequently been adopte d by many workers (e.g . Carter 1971 ; Baile y 1983 ; Cop e 1996 , \991a, b) . Others have suggested that the two groups are best combined i n th e superorde r Heteroconchi a Hertwig, 189 5 as they share similar dentitions an d have othe r feature s i n commo n (e.g. Pojet a 1971 , 1978; Babin & Gutierrez-Marco 1991 ) Hitherto, the present author has subscribed to the view that it was possible to separate the two groups and i t wa s suggeste d (Cop e \991b) tha t shel l micro structural difference s coul d distinguis h between prismato-nacreous Palaeoheterodont a an d a crossed-lamellar/comple x crossed-lamella r shel l of the Heterodonta. This view was based very much from a n Ordovicia n perspectiv e an d pre-suppose s that th e shel l microstructure s o f th e man y Lowe r Palaeozoic forms tha t are hitherto unknown would fit int o thi s pattern . Thes e view s hav e change d largely as a result of examining large collections of Silurian bivalve s mad e b y D r V . A . Ratte r i n

91

Cardiff. Hi s collection s includ e topotyp e materia l of Actinodonta cuneata from the Llandovery Serie s of Pembrokeshire an d a new genus and species that occurs i n slightl y younge r rocks. Actinodonta has what ca n b e regarde d a s typica l palaeoheterodont ventrally divergen t multidentat e dentition , simila r to tha t show n b y Ordovicia n gener a suc h a s Carminodonta Cope , 199 6 o r Copidens Pojet a & Gilbert-Tomlinson, 1977 , whilst the new genus has a dentitio n clos e t o tha t o f a crassatelloi d heterodont. Othe r detail s o f th e shel l diffe r i n n o marked wa y an d th e similarit y o f th e tw o ha s allowed them to be incorporated in the same family. Thus, separatio n a t a highe r taxonomi c leve l i s untenable an d s o th e palaeoheterodont s an d heterodonts ar e unite d i n th e superorde r Heteroconchia. Interestingly, b y separatin g ou t fro m thi s grou p the modiomorphoid s [no w include d i n th e Anomalodesmata following Fang & Morris (1997)] and th e trigonioids , th e tw o principa l group s o f bivalves characterize d throughou t b y prismato nacreous shells have been removed. However, it is probable tha t som e o f th e earl y heteroconch s retained thi s basi c prismato-nacreou s shel l micro structure. However, for later heteroconchs the outer shell laye r i s normall y o f prismati c calcite , th e middle laye r is of a crossed-lamellar structur e and there is an inner complex crossed-lamellar layer . It may b e tha t sinc e bivalv e group s quit e clearl y descended fro m th e glyptarcoid s ar e al l charac terized b y a crossed-lamellar shel l microstructure , then the superfamil y Glyptarcoide a also possessed that type of shell microstructure . The Glyptarcoidea hav e a dentition tha t radiate s dorsally from a point within the centre of the valves (see Babi n & Gutierrez-Marco 1991 , fig . 7; Cop e 1996, fig . 5) rather than the subumbona l ventrally divergent dentition of the majority of heteroconchs. The anterio r dentitio n o f Glyptarca, originall y figured from the Arenig of Ramsey Island by Hicks (1873) an d redescribed b y Carte r (1971) , wit h it s strongly curve d anterio r teeth , le d man y author s (e.g. Pojet a 1971 ; Babi n 1966 ; Morri s 1978 ) t o suggest tha t Glyptarca wa s th e idea l ancesto r fo r the cyrtodontids . However , whe n thes e author s made thi s suggestion , th e dentitio n o f Glyptarca was ver y imperfectl y know n a s th e genu s wa s based o n inadequat e typ e material . I n orde r t o stabilize th e nomenclature , Cop e (1996 ) figure d material with well-preserved dentition that showed that Glyptarca lacke d th e subumbona l denta l lacuna tha t i s characteristi c o f th e cyrtodont s an d indeed ha d a comple x subumbona l dentition . Glyptarca coul d b e quit e readil y derive d fro m a cardiolariid ancestor , a s demonstrate d b y Cop e (1995), as could the actinodonts (Walle r 1998 , fig. 5 and text pp. 33-34).

92

J. C . W . COP E

It wa s th e Mesozoi c an d Cenozoi c evolutio n of the heteroconchs tha t wa s responsible fo r th e pre eminent positio n thi s superorde r ha s i n Recen t bivalve faunas. It therefore lies outside of the scope of this review of early bivalve phylogeny.

cardinal teeth , together wit h a half chevron-shape d ligament. There ar e stil l majo r gap s i n ou r knowledg e o f the earl y arcoids , particularl y sinc e ther e ar e n o records betwee n Catamarcaia i n th e Areni g an d Alytodonta i n the early Llandovery . Ratter & Cope (1998) note d tha t Lowe r Palaeozoi c arcoid s ar e particularly characteristi c o f ver y close-inshor e Pteriomorphia facies an d this may explain thei r extreme rarity . The earlies t pteriomorphian s ar e recorde d fro m Sanchez & Babin (1993 ) erecte d th e ne w bivalv e genus Catamarcaia fo r a bivalv e fro m th e mid - the lat e Tremado c o f Australi a (Pojet a & Gilbert Arenig o f Argentina , whic h remain s th e earlies t Tomlinson 1977) . Bot h o f the recorded gener a ar e bivalve ye t know n wit h a duplivincula r ligament . cyrtodontids, bu t sinc e the y ar e preserve d a s As show n b y Cop e (1997a ) an d Ratte r & Cop e sandstone mould s ther e i s n o knowledg e o f thei r (1998), th e dentitio n o f Catamarcaia coul d b e ligament. However , becaus e the y ar e lik e late r derived quit e readil y fro m a n ancesto r lik e th e cyrtodontids tha t hav e multipl e ligamenta l inser heteroconch Glyptarca (se e Ratte r & Cop e 1998 , tions, i t i s probabl y saf e t o assum e tha t the y als o fig. 7) . Wit h th e latte r genu s i t share s stron g had thi s ligamen t type . A s the y predat e anterior teeth and a complex subumbonal dentition, Catamarcaia i t i s possibl e tha t the y an d and differs i n the posterior dentitio n and the lack of Catamarcaia evolve d fro m a commo n ancestor , a duplivincula r ligament . Th e superfamil y such as that proposed b y Cope (1991 a). In turn, from th e cyrtodonts, ambonychiids could Glyptarcoidea, however , is see n a s the most likely origin fo r thi s stock . Thus , i t seem s tha t th e be readil y derive d b y reductio n o f th e anterio r o f Arcoidea coul d hav e bee n derive d directl y fro m the shell ; th e earliest ambonychii d know n hitherto early glyptarcoi d heteroconchs . Cop e (1995 , is the Cleionychia recorded fro m the middle Arenig 1997a, b ) separated th e order Arcoida (fro m whic h of Sout h Wale s b y Cop e (1996) . I n addition , th e he exclude d th e cyrtodontids ) from th e remainde r derivation o f pterioids implie s th e developmen t of of th e pteriomorphs o n the grounds that they wer e asymmetry betwee n th e valve s an d th e earlies t the only group with a chevron-shaped duplivincular pterioid recorde d hithert o wa s fro m th e earl y ligament an d tha t the y lacke d th e calciti c oute r Arenig of South Wales (Cope 1996) . Thus, all these layer that characterizes mos t pteriomorphian shells. early pteriomorphian group s had evolved within the He suggeste d tha t Korobkov' s (1954 ) ter m early Ordovician . The presenc e o f a multipl e non-parinvincula r Neotaxodonta wa s th e most appropriat e availabl e name for this group. It is now clear that this was an ligament i n the modiolopsoids , note d b y Carte r & oversimplistic vie w an d tha t ther e ar e man y Seed (1998) , suggest s tha t the y belong withi n th e synapomorphies uniting the Arcoida wit h the other Pteriomorphia. Th e earlies t for m tha t ca n b e pteriomorphs (Walle r 1998) , s o tha t the y ma y b e included i n thi s superfamil y i s a colpomyi d fro m the Tremado c o f Australi a (Pojet a & Gilbert recombined in the superorder Pteriomorphia. Following th e discover y o f Catamarcaia, othe r Tomlinson 1977) , but , a s pointe d ou t above , th e early arcoid s hav e bee n discovered , includin g colpomyids ma y be anomalodesmatans . Insofa r a s Alytodonta (Cop e 1991 b), Trecanolia an d is known , no multipl e ligamenta l insertion s hav e Uskardita (Ratte r & Cop e 1998) , whic h lin k th e been see n i n a colpomyid . Th e earlies t modio lopsids an d modiolodontid s appea r t o b e fro m th e group t o th e mid-Siluria n genu s Freja. Ratte r & Cope (1998 ) assigne d th e las t fou r gener a t o th e early Areni g o f Sout h Wale s (Cop e 1996) . Th e new family Frejidae , leavin g Catamarcaia without Tremadoc Cosmogoniophorina describe d b y Harrington (1938) is probably a nuculoid (Pojeta & familial assignment . I t i s clea r tha t Catamarcaia has dentitio n tha t differ s fro m tha t of th e Frejida e Gilbert-Tomlinson 1977) . Modiolopsoid s coul d and also from that of the Parallelodontidae, a s noted have bee n derive d fro m cyrtodonts , o r the y coul d by Sanche z (1995) , bu t th e ligamen t o f th e have share d a commo n ancesto r wit h reduce d Parallelodontidae i s simila r t o that of the Frejidae , pteriomorphian dentition . leading Ratter & Cope (1998, fig. 7) to suggest that The othe r principa l pteriomorphia n grou p t o both familie s wer e derive d fro m a commo n post - evolve durin g th e Ordovicia n wa s th e limids . Catamarcaia ancestor . I t is proposed her e tha t th e Tunnicliff (1987 ) describe d th e ne w genu s monotypic famil y Catamarcaida e accommodate s Myodakyrotus fro m th e Upper Ordovician o f North the genu s Catamarcaia. The characteristics o f this Wales. This grou p is dimyarian , a s opposed t o the family includ e a n asymmetri c dentition , whic h normal monomyarian musculature in most limoids , includes lamellar anterior and posterior lateral teeth and i n man y respects i s intermediat e betwee n th e combined wit h a serie s o f largel y chevron-shape d cyrtodontids an d the limids.

BIVALVE PHYLOGEN Y

Conclusions Bivalves first diversifie d i n the Cambrian, perhaps from initia l surfac e dwellers , to produce a limited variety o f form s tha t include d shallo w infauna l burrowers that, like the majorit y o f bivalves, were able t o capitaliz e o n th e substrate s o f th e Lowe r Palaeozoic seas . Probabl y stil l withi n th e Cambrian, som e o f thes e form s migrate d int o partially anaerobi c substrate s wher e the y live d symbiotically wit h chemoautotrophi c sulphur oxidizing bacteria , producin g a rapi d diversifi cation amongst the protobranch bivalves. Towards the end of the Cambrian, or within the very earliest Ordovician, on e grou p o f palaeotaxodont bivalves developed the filibranch gill; this produced a major evolutionary burs t i n th e autolamellibranch s tha t allowed bivalves to take advantage of the increased nutrient supplie s i n th e Ordovicia n sea s (Cop e & Babin 1999) . Fro m th e rootstoc k o f th e newl y evolved heteroconch s a plethor a o f ne w bivalv e groups diversifie d rapidl y an d colonize d semi infaunal an d epifauna l habitats . B y th e en d o f th e early Ordovicia n al l mai n group s o f bivalve s ha d evolved an d link s betwee n man y o f thes e group s can b e establishe d wit h varyin g degree s o f confidence as the fossil record of the Cambrian and Ordovician bivalves becomes better known. I am grateful fo r the assistance of Mrs D. G. Evans, of the Geology Department , Nationa l Museum of Wales, in th e drafting o f Fig. 2.

References ADAMKEWICZ, S . L. , HARASEWYCH , M . G. , BLAKE , J. , SAUDEK, D . & BULT , C . J . 1987 . A molecula r phylogeny o f th e bivalv e mollusks . Molecular Biology an d Evolution, 14, 619-629. ADAMS, H . & ADAMS , A . 1854-1858 . Th e Genera o f Recent Mollusca Arranged According to their Organisation, Vol. 2 . J. van Voorst, London. ALLEN, J. A. 1978 . Evolution of the deep-sea protobranch bivalves. Philosophical Transactions of th e Royal Society o f London, Series B, 284, 387-401. 1985. Th e Recen t Bivalvia : thei r for m an d evolution. In : TRUEMAN , E . R . & CLARKE , M . R . (eds) Th e Mollusca. Vol. 10, Evolution. Academi c Press, New York, 337-403. & SANDERS , H . L . 1969 . Nucinella serrei Lam y (Bivalvia: Protobranchia) , a monomyaria n solemyoid an d possibl e livin g actinodont . Malacologia, 7, 381-396. BABIN, C. 1966 . Mollusques bivalves et cephalopodes d u Paleozoique armoricain. Imprimerie Commercial e et Administrative, Brest . 19820. Mollusqe s bivalve s e t rostroconches . In : BABIN, C., COURTESSOLE, R., MELOU, M. , FILLET, J., VIZCAINO, D . & YOCHELSON , E . L . Brachiopodes (articules) et mollusques (bivalves, rostroconches,

93

monoplacophores, gastropodes) de VOrdovicien inferieur (Tremadocien-Arenigien) de la Montagne Noire (France meridionale). Memoir e d e la Societe des Etude s Scientifique s d e 1'Aude , Sival , Carcassonne, 37-49, pis 8-12 . 1982b. Tromelinodonta nov . gen. , Bivalv e lyrodesmatide (Mollusca ) d e 1 ' Arenigie n (Ordovicien inferieur). Geobios, 15, 423-427. & GUTTIERREZ-MARCO , J . C . 1991 . Middl e Ordovician bivalve s fro m Spai n an d thei r phyleti c and palaeogeographi c significance . Palaeontology, 34, 109-147 . BAILEY, J . B . 1983 . Middle Devonia n Bivalvia fro m th e Solsville Membe r (Marcellu s Formation) , centra l New Yor k State. Bulletin of th e American Museum of Natural History, 174 , 193-326. BEEDHAM, G. E. & OWEN , G . 1965 . The mantl e an d shel l of Solemya parkinsoni (Protobranchia : Bivalvia) . Proceedings of the Zoological Society of London, 145, 405-430. BENTON. M . J . & HARPER , D . A . T . 1997 . Basic Palaeontology. Addiso n Wesley Longman, Harlow. BERG-MADSEN, V . 1987 . Tuarangia fro m Bornhol m (Denmark) an d similaritie s i n Baltoscandia n an d Australasian lat e Middl e Cambria n faunas . Alcheringa, 11, 245-259. CARTER, J . G . (ed. ) 1990 . Skeletal Biomineralization: Patterns, Processes and Evolutionary Trends. Vol s 1. and 2. Van Nostrand Reinhold, New York. & ALLER , R . C . 1975 . Calcification i n th e bivalv e periostracum. Lethaia, 8, 315-320. & SEED , R . 1998 . Therma l potentiatio n an d mineralogical evolutio n i n Mytilus (Mollusca ;

Bivalvia). In: JOHNSTON , P . A . & HAGGART , J . W .

(eds) Bivalves: An Eon of Evolution — Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 87-117. CARTER, R . M . 1971 . Revision o f Areni g Bivalvi a fro m Ramsey Island , Pembrokeshire . Palaeontology, 14, 250-261, pis 38-39. CAVANAUGH, C . M . 1983 . Symbiotic chemoautotrophi c bacteria i n marin e invertebrates fro m sulphide-ric h habitat. Nature, 302, 58-61. CHRONIC, H . 1952 . Molluscan fauna s fro m th e Permia n Kaibab Formation , Walnu t Canyon , Arizona . Bulletin o f th e Geological Society o f America, 63 , 95-166, pis 1-11 . COPE, J . C. W. 1995. The earl y evolution o f the Bivalvia . In: TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation of th e Mollusca. Oxford University Press , Oxford, 361-37 0 1996. Early Ordovicia n (Arenig ) bivalves fro m th e Llangynog Inlier , Sout h Wales . Palaeontology, 39, 979-1025. 19970. Affinitie s o f th e earl y Ordovicia n bivalv e Catamarcaia Sanche z an d Babin, 199 3 and its rol e in bivalve evolution. Geobios Memoire Special, 20 , 126-131. 1997b. The earl y phylogen y o f th e clas s Bivalvia. Palaeontology, 40, 713-746. 1999. Middle Ordovicia n bivalve s fro m mid-Wale s and th e Wels h Borderland . Palaeontology, 42 , 467-499 .

94

J. C . W . COPE

& BABIN, C. 1999. Diversification of bivalves in the Ordovician. Geobios, 32, 175-185. Cox, L . R . 1959 . Th e geologica l histor y o f th e Protobranchia an d th e dua l origi n o f th e taxodon t Lamellibranchia. Proceedings of th e Malacological Society, London, 33, 200-209. 1960. Thoughts on the classification of the Bivalvia. Proceedings o f th e Malacological Society, 34 , 60-88. & 2 4 other s 1969-1971 . In : MOORE , R . C . (ed.) Treatise on Invertebrate Paleontology. Part N. Mollusca 6 , Bivalvia. Geologica l Societ y o f America, Boulder , CO , an d Universit y o f Kansa s Press, Lawrence, KS. DALL, W . H. 1889 . On th e hing e o f pelecypod s an d it s development, wit h a n attemp t towar d a bette r subdivision o f th e group . American Journal o f Science, 38, 445-462. FANG, ZONG-ZI E & MORRIS , N . J . 1997 . Th e genu s Pseudosanguinolites an d som e modiolifor m bivalves (mainl y Palaeozoic) . Palaeoworld, 7 , 50-74. GEYER, G . & STRENG , M . 1998 . Middl e Cambria n pelecypods fro m th e Anti-Atlas , Morocco . Revista Espanola d i Paleontologia, no . extr a Homenaja e al Prof. Gonzal o Vidal , 83-96. GROBBEN, K . 1894 . Zur Kenntnis s der Morphologic , de r Verwandschaftsverhaltnisse un d de s System s de r Mollusken. Sitzungsberichte de r Kaiserlichen Akademie der Wissenschaften, MathematischNaturwissenschaftlichen Classe, 103, 61-86. HARPER, E . M . 1997 . The mollusca n periostracum : a n important constrain t i n bivalv e evolution . Palaeontology, 40, 71-97. HARRINGTON, H . J . 1938 . Sobr e la s fauna s de l Ordoviciano inferio r de l Nort e Argentine . Revista del Museo de La Plata, Nueva Serie, 1, 109-289. HARRISON, W. B. & HARRISON, L. K. 1975. A Maquoketalike mollusca n communit y i n th e Brassfiel d Formation (Earl y Silurian ) o f Adam s County , Ohio. Bulletins o f American Paleontology, 67 , 197-231. HAVLICEK, V . & KRIZ , J . 1978 . Middl e Cambria n Lamellodonta simplex Vogel : 'bivalve ' turne d brachiopod Trematobolus simplex (Vogel) . Journal of Paleontology, 52, 972-975. HERTWIG, C . W . T . R . 1895 . Lehrbuch de r Zoologie. Gustav Fischer, Jena . HICKS, H . 1873 . O n th e Tremado c rock s i n th e neighbourhood o f St . David's , Sout h Wale s an d their fossi l contents . Quarterly Journal o f th e Geological Society of London, 29, 39-52, pis 3-5 . HINZ-SCHALLREUTER, I. 1995. Muscheln (Pelecypoda) au s dem Mittelkambriu m vo n Bornholm . Geschiebekunde aktuell, 11, 71-84. IREDALE, T . 1939 . Grea t Barrie r Ree f expeditio n 1928-1929. Scientific Reports, British Museum (Natural History), 5, [Mollusca, Par t 1] , 209-425. JELL, P . A. 1980 . Earliest know n pelecypod o n Earth . A new Earl y Cambria n genu s fro m Sout h Australia . Alcheringa, 4, 233-239. JOHNSTON, P. A. 1993 . Lower Devonian Pelecypoda fro m south-eastern Australia . Memoirs of th e Association of Australasian Palaeontologists, 14, 1-134 .

1996. Middl e Ordovicia n (Caradoc ) pelecypod s from th e Advanc e Formation , Britis h Columbia . Bulletin o f th e Geological Survey o f Canada, 491, 113-129. & GOODBODY , Q . H . 1988 . Middl e Devonia n bivalves fro m Melvill e Island , Arcti c Canada . In : MCMILLAN, N. J., EMBRY, A. F. & GLASS, D. J. (eds) Devonian of the World. 3. Paleontology, Paleoecology an d Bi o stratigraphy. Canadia n Society o f Petroleu m Geologists , Memoi r 14 , 337-346. & ZHAN G R . 1998 . Re-interpretation o f Sinodora Pojeta an d Zhang , 1984 , a n unusua l bivalv e (Trigonioida) fro m th e Devonia n o f China . In : JOHNSTON, P . A. & HAGGART , J . W . (eds) Bivalves: An Eon of Evolution - Paleobiological Studies Honoring Norman D. Newell. University of Calgary Press, Calgary , 361-375 . JOHNSTON, R . M . 1888 . Systematic Account o f th e Geology o f Tasmania. J. Walch & Sons, Hobart. KOROBKOV, I . A . 1954 . Sprvochnik i metodicheskoe rukovodstro po tretichnum Mollyuskam Plastinchatozhabernye. Nauchno-tecnoi ' Isledov . Leningradskoi Otdeleni e [i n Russian]. MCALESTER, A . L . 1968 . Typ e specie s o f Paleozoi c nuculoid bivalve genera. Memoir of the Geological Society o f America, 105. MORRIS, N . J . 1978 . The infauna l descendant s o f th e Cycloconchidae: a n outlin e o f th e evolutionar y history o f th e Heteroconchia, Superfamilie s Cycloconchacea t o Chamacea . Philosophical Transactions of the Royal Society of London, Series B, 284, 259-275. 1979. On the origi n o f the Bivalvia . In: HOUSE , M . R. (ed. ) The Origin of Major Invertebrate Groups. Systematics Associatio n Specia l Volum e No . 12 . Academic Press , London , 381^-13. MORTON, B . 1995 . Th e evolutionar y histor y o f th e Bivalvia. In : TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press, Oxford , 337-359. NEUMAYR, M . 1884 . Zu r Morphologi c de r Bivalve nschlosses. Kaiserlich-Koniglichen Akademie de r Wissenschaften, Wien. Mathematische, Naturwissenschaftliche Klasse, Sitzungberichte, Abteilung 1 , 88, 385-418. NEVESSKAYA, L. A., SCARLATO, O. A., STAROBOGATOV, YA. L. & EBERZIN , A . G . 1971 . Ne w idea s o n bivalv e systematics. Paleontological Journal, 2 , 3-20 . [English translatio n b y America n Geologica l Institute, published 1972] . NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitates, 2206, 1-25 . & BOYD , D . W . 1975 . Parallel evolutio n i n earl y trigoniacean bivalves . Bulletin o f th e American Museum o f Natural History, 154, 53-162. PELSENEER, P . 1889. Sur l a classificatio n phylogenetique des pelecypodes. Bulletin Scientifique d e l a France et de la Belgique, 20, 27-52. POJETA, J . 1971 . Revie w o f Ordovicia n pelecypods . Professional Paper of the United States Geological Survey , 695. 1973. Fordilla troyensis Barrande: the oldest known pelecypod. Science, 180, 866-868.

BIVALVE PHYLOGENY 1975. Fordilla troyensis Barrand e an d earl y pelecypod phylogeny . Bulletins o f American Paleontology, 67 (287), 363-384 . 1978. The origin and early taxonomic diversificatio n of pelecypods . Philosophical Transactions o f th e Royal Society o f London, Series B, 284 , 225-246, pis 1-15 . 1988. Th e origi n an d Paleozoi c diversificatio n o f solemyoid bivalves . Memoir o f th e Ne w Mexico Bureau o f Mines an d Mineral Resources, 44 , 201-271, pis 1-24 . & GiLBERT-ToMLiNSON , J . 1977 . Australia n Ordovician pelecypo d molluscs . Bulletin o f th e Bureau of Mineral Resources, Geology and Geophysics, 174 , 1-64, pis 1-29 . & RUNNEGA R , B . 1976 . Th e paleontolog y o f rostroconch mollusk s an d th e earl y histor y o f th e Phylum Mollusca. Professional Paper of th e United States Geological Survey, 968. & 1985 . Th e earl y evolutio n o f diasom e molluscs. In : TRUEMAN , E . R . & CLARKE , M . R . (eds) The Mollusca, 10, Evolution. Academic Press , Orlando, 295-336. , ZHANG , R . & YANG , Z . 1986 . Systemati c paleontology o f Devonia n pelecypods o f Guangxi and Michigan . Professional Paper o f th e United States Geological Survey, 1394, 57-108. PURCHON, R . D. 1987 . Classification an d evolution o f the Bivalvia: a n analytica l study . Philosophical Transactions of the Royal Society of London, Series B, 316, 277-302. RATTER, V . A. & COPE , J . C . W . 1998 . New neotaxodon t bivalves from th e Siluria n o f South Wales and their phylogenetic significance . Palaeontology, 41 , 975-991. RIDEWOOD, W . G . 1903 . On th e structur e o f th e gill s o f lamellibranchs. Philosophical Transactions of th e Royal Society of London, Series B, 194, 147-284. RUNNEGAR, B . & POJETA , J . 1992 . The earlies t bivalve s and thei r Ordovicia n descendants . American Malacological Bulletin, 9, 117-122 . SANCHEZ, T . M . 1995 . Comment s o n th e genu s Catamarcaia Sanche z an d Babi n an d th e origi n o f the Arcoida. Geobios, 28, 343-346.

95

& BABIN, C. 1993. Un insolite bivalve, Catamarcaia n.g., d e 1'Areni g (Ordovicie n inferieur ) d'Argentine. Comptes rendus d e V Academie de s Sciences, Paris, Serie II, 316, 265-271. STAROBOGATOV, YA . L . 1992 . Morphologica l basi s fo r phylogeny an d classificatio n o f th e Bivalvia . Ruthenica, 2, 1-25 . TAYLOR, J . D. , KENNEDY , W . J . & HALL , A . 1969 . Th e shell structur e an d mineralog y o f th e Bivalvia . Introduction. Nuculacea-Trigonacea. Bulletin of th e British Museum (Natural History), Zoology Series, Supplement 3. ,& 1973 . Th e shel l structur e an d mineralogy o f th e Bivalvia . II . Lucinacea Clavagellacea, Conclusions . Bulletin o f th e British Museum (Natural History), Zoology Series, 22 , 256-294, pis 1-15 . TEVESZ, M . J . S . & McCALL , P . L. 1976 . Primitive lif e habits an d adaptiv e significanc e o f th e pelecypo d form. Paleobiology, 2, 183-190. TUNNICLIFF, S . P. 1987. Caradocian bivalve molluscs from Wales. Palaeontology, 30, 677-690, pis 76 and 77. YOKES, H . E . 1956 . Note s o n th e Nucinellida e (Pelecypoda) wit h a descriptio n o f a ne w specie s from th e Eocen e o f Oregon . Journal o f Paleontology, 30, 652-671. WALLER, T . R . 1978 . Morphology, morphocline s an d a new classificatio n o f the Pteriomorphia (Mollusca : Bivalvia). Philosophical Transactions of th e Royal Society o f London, Series B, 284, 345-365. 1990. Th e evolutio n o f ligamen t system s i n th e Bivalvia. In : MORTON , B . (ed. ) Th e Bivalvia Proceedings of a Symposium in Honour of Sir Charles Maurice Yonge. Hon g Kon g Universit y Press, Hon g Kong, 49-71. 1998. Origin o f the mollusca n clas s Bivalvi a and a phylogeny o f majo r groups. In: JOHNSTON , P . A. & HAGGART, J . W . (eds ) Bivalves: A n Eo n o f Evolution - Paleobiological Studies Honoring Norman D . Newell. Universit y o f Calgar y Press , Calgary, 1-45. YONGE, C . M. 1959. The status of the Protobranchia i n the bivalve Mollusca. Proceedings of the Malacological Society, London, 33, 210-214.

This page intentionally left blank

A preliminary phylogeny for rudist bivalves: sifting clades from grades PETER W. SKELTON1 & ANDREW B. SMITH 2 1 Department of Earth Sciences, Open University, Milton Keynes MK7 6AA, UK (e-mail: P.W.Skelton@ open.ac.uk) 2 Department of Palaeontology, Natural History Museum, Cromwell Road, London SW7 5BD, UK Abstract: Th e taxonomi c history o f th e lat e Jurassic-Cretaceou s rudis t bivalves (Superfamily Hippuritoidea) i s reviewe d an d a ne w phylogen y base d o n cladisti c analysi s o f 3 2 skeleta l characters i s proposed . Informativ e characters include : relativ e thicknes s an d structure s o f th e outer (calcitic) shel l layer; valve asymmetry and attachment to the substrate by either th e left o r right valve ; for m o f th e ligament ; and , i n th e aragoniti c inne r shell , th e dentitio n an d shell y supports (myophores ) for th e adducto r muscles, as well a s accessor y cavities an d blind-ending (pallial) canals . Th e myocardina l comple x (teet h an d myophores ) i s especiall y importan t fo r discriminating clade s previousl y lumpe d i n paraphyleti c o r eve n polyphyleti c tax a (e.g . Caprinidae, sensu lato, in the bivalve Treatise (Moore , R . C. (ed.) 1969 . Treatise o n Invertebrate Paleontology, Part N. Mollusca 6 , Bivalvia, Geological Societ y o f Americ a an d Universit y of Kansas). As outgroup , a megalodontid bivalv e wa s used , a s thi s share s thre e derive d trait s (massiv e dentition, modified parivincular ligament and posterior myophores) in common with rudists. The clade o f al l rudists i s unite d by possessio n o f a n oute r shel l laye r o f fibrilla r prismati c calcit e (albeit greatl y reduce d i n a fe w taxa). Tw o subclade s ar e distinguishe d accordin g t o th e attachment of the shell - eithe r by the left valve (all 'diceratids', except Diceras and Valletta, plus the monophyleti c requieniids) , o r b y th e righ t valv e (Diceras, Valletta an d al l othe r rudists) . Monophyly o f some previously established familie s i s substantiated. Thes e includ e Caprinidae , sensu stricto (Skelton, P . W. 1978 . Philosophical Transactions of th e Royal Society of London, Series B, 284, 305-318) , Radiolitidae (with Agriopleura as sister taxon) and Hippuritidae (with Tepeyacia emergin g a s a possible siste r taxon) , whil e other s ar e resolve d int o distinc t clades . There i s som e evidenc e fo r th e Polyconitida e Ma c Gillavr y (1937) , thoug h wit h negligibl e bootstrap support .

The rudists are an extinct group of sessile epifaunal radioliti d interna l mould , togethe r wit h tw o bivalves that flourished in low-latitude shallow seas inarticulat e brachiopods (Crania and Discina) and from lat e Jurassi c t o Cretaceou s times . A n a lidded solitar y rugos e coral (Calceola). Lamarc k expansive adaptive radiation spread them across the place d th e grou p alongsid e th e oyster s i n hi s broad carbonat e platform s tha t develope d i n th e 'Conchiferes monomyaires'. Othe r tax a no w equatorial Tethy s Ocea n an d o n scattere d regarde d as rudists were put elsewhere by Lamarck seamounts i n th e Pacifi c (Mass e & Phili p 1986 ; (1819 ) - Diceras amon g chamacea n bivalve s and Ross & Skelto n 1993 ; Phili p e t al 1995 ; Phili p Hippurites wit h the cephalopods. Deshaye s (1825 ) 1998). Th e shell s an d resultin g debri s fro m vas t late r unite d th e hippuritid s wit h th e radiolitid s t o 'meadows' o f rudist s indee d contribute d compris e a more restricte d groupin g o f 'rudistes', substantially t o th e growt h o f th e platforms , whic h he placed in the bivalves, especially i n the late Cretaceou s (Gil i et al. 1995 ; Man y ne w description s followed , wit h muc h Carannante et al. 1999) . speculativ e phylogeneti c pigeon-holing . Th e tax a The nam e (originall y 'les rudistes') wa s firs t no w recognized as rudists were variously classified given b y Lamarc k (1819 ) t o a n assortmen t o f a s brachiopods , corals , cirripedes , anneli d tubes , inequivalve fossi l shell s wit h prominen t beaks , o r members o f a n independent grou p of molluscs , comprising onl y tw o currentl y recognize d rudis t a s wel l a s bivalves , unti l the y wer e finall y genera (Radiolites an d Sphaerulites) plu s a assemble d - togethe r wit h Chama and a few other From: HARPER, E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177 , 97-127 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

98

P. W. SKELTO N & A. B . SMITH

bivalve gener a - within th e Bivalvi a ('Familie Chamaceen'), by Quenstedt (1852) [see Woodward (1855) fo r historica l details] . Munie r Chalma s (1873) was the first to extend the name 'rudistes' t o cover the expanded groupin g of taxa from Diceras onwards. Newel l (1965 ) rename d th e grou p a s 'Superfamily Hippuritace a Gray 1848' , in keeping with moder n nomenclatura l rules , henc e thei r coverage unde r tha t nam e i n th e Treatise o n Invertebrate Paleontology (Dechaseau x e t al. 1969). Following Ride et al. (1999) this should now be corrected t o Hippuritoidea. The divers e an d elaborat e (som e woul d say, 'baroque') morphologie s o f th e rudist s presen t a good arra y o f character s fo r cladisti c analysis . Informative character s include : th e relativ e thickness an d mesostructura l modification s o f th e outer (calcitic ) shel l layer ; valv e asymmetr y an d attachment to the substrat e by either th e lef t valv e (LV) o r th e righ t valv e (RV); the conditio n of th e ligament; th e configuratio n o f th e massiv e (pachyodont) dentition; and the arrangement of the internal shell y support s (myophores ) fo r th e adductor muscles , a s wel l a s variou s associate d accessory cavitie s an d othe r structure s withi n th e aragonitic inner shell. So far, however, this character-rich group has not been extensively subjected to phylogenetic analysis using cladistics . Hand-draw n cladogram s hav e been proposed for caprinids by Skelton (1991) and, more rigorously , b y Skelto n & Mass e (1998 ) fo r those o f th e Lowe r Cretaceous . Smit h (1994 ) an d Steuber (1999a) presented hand-drawn cladograms for a wide r selectio n o f rudists , thoug h base d o n limited data derived from the literature, while Stone & Telfor d (1999 ) constructe d a computer-derive d cladogram, thoug h agai n base d o n rathe r fe w characters and taxa. The most rigorous and detailed analyses t o dat e ar e computer-base d cladogram s constructed fo r variou s caprini d rudists , wit h selected outgrou p taxa, by Chartrousse (I998a). History of ideas on rudist systematics and phylogeny Following th e consensu s o n rudist s a s bivalves , authors a t firs t tende d t o all y the m wit h chamaceans, followin g Quensted t (1852 ) (e.g . Bayle 1855 ; Woodward 1855; Zittel 1885 ; Fischer 1887). Althoug h Douvill e (1886 , 1887 ) als o initially favoure d suc h a link , h e subsequentl y (Douville 1935) preferred a direct derivation from a byssate ancestor, suc h as Pterocardia. The chamid hypothesis wa s finall y rejecte d b y Kenned y et a l (1970), who convincingly showed chamids to be a later, independen t offshoo t fro m th e carditids . However, Pterocardia (probabl y a specialize d

Jurassic cockle ) i s als o a n unlikel y candidat e fo r ancestry, possessin g som e derive d feature s no t shared wit h rudists , suc h a s pronounce d latera l teeth ( a character typica l o f cardiids). Instead , th e hypothesis mos t widel y favoure d toda y i s fo r th e derivation o f th e rudist s fro m megalodontid s [following Boeh m (1882) , an d Dechaseau x (1952)]. Megalodontid s shar e wit h th e earlies t rudists projectin g spirogyrat e umbone s associate d with a modifie d parivincula r ligament , massiv e pachyodont dentitio n an d ledge-lik e myophore s supporting the posterior adductor s (Fig. la; Skelto n 1978). The golden age for the systematic subdivisio n of rudists wa s i n th e lat e nineteent h an d earl y twentieth centuries. The foundations for the current higher leve l classificatio n o f th e grou p wer e lai d down largely by Douville (1886, 1887, 1888, 1889 , and man y subsequen t works , culminatin g i n hi s remarkable synthesi s o f 193 5 - publishe d i n his 89th year). The most important subsequent revision was tha t o f Ma c Gillavr y (1937) , whos e investigations o f Caribbea n rudist s le d t o severa l major conclusion s concernin g rudis t phylogeny in general. Following Munie r Chalma s (1882) , Douvill e (1887) recognize d a fundamenta l distinctio n between a 'serie normale' o f shells wit h one main tooth in the LV and two in the RV (Fig. Ib and c), and a 'serie inverse' showin g two teet h i n the LV (Fig. Id ) and one in the RV. To the 'serie normale' he assigned only the primitive Tribu de Diceratines together with a minor offshoot, th e Bayleines (late r included i n th e Famil y Requieniida e Douville , 1915), whil e si x other tribus were include d i n th e 'serie inverse'. Douvill e furthe r note d tha t attachment to the substratum was by the LV in the 'normal' group , wit h th e exceptio n o f Diceras itself, i n whic h eithe r valv e migh t b e attached , while the 'inverse' forms invariably attached by the RV. Douvill e (1887 ) initiall y accepte d Munie r Chalmas' [Munie r Chalmas (1882)] explanation of dental inversion for the difference between his two series, by analogy with Chama. However, he later argued (Douville 1896 ) that the change in dentition was due , instead, t o suppressio n o f th e anterio r tooth i n th e R V an d enlargemen t o f a n incipien t posterior toot h i n the LV (e.g. Fig. Ib) i n the firs t 'inverse' form , Valletta. From specimen s prepare d b y Bayl e (1873) , Douville (1935) further recognize d that attachment by the LV, or by the RV, had been consistent within different 'Diceras' specie s fro m thei r firs t appear ances. Accordingly , h e propose d a ne w genus , Epidiceras, fo r those species - th e majority - tha t attached by the LV (Fig. Ib), in contrast to the few remaining specie s o f Diceras (sensu stricto) i n which attachmen t wa s b y th e RV , as i n th e typ e

PHYLOGENY O F RUDIST BIVALVES 9

9

Fig. 1 . (a) Pachyrisma grande Morris & Lycett, interior of right valve; Bathonian, Minchinhampton, Glos, UK (NHM, 49964). (b) Epidiceras speciosum (Deshayes) , interior of left (attached ) valve; Oxfordian, Dompcevrin , Meuse, France (NHM , LL 31920). (c) Diceras arietinum Lamarck, interior o f right (attached) valve; as in (b), PWS collection, (d) Monopleura Marians Matheron , interior of left (free ) valve ; Barremian, Brouzet-les-Ales, Gard, France (UCBL, EM 15681) . Scal e bars, 1 0 mm. 1, tooth; (1), incipient tooth; am, anterior myophore ; /, ligamentary insertio n site; pm, posterior myophore.

species Diceras arietinum Lamarck (Fig. Ic). Thus, two distinc t evolutionar y branche s coul d b e recognized, on e commencin g wit h Epidiceras, retaining 'normal ' dentition , an d the other startin g with Diceras, givin g ris e (vi a Valletta) t o th e 'inverse' taxa.

Douville (1887 ) divide d th e 'inverse ' form s among six tribus: (1) Monopleurines, characterize d by simpl e myophora l ledge s adjoinin g th e hing e plates (Fig . Id) , an d interprete d b y Douvill e a s a basal grou p fo r eac h o f th e nex t thre e tribus\ (2 ) Caprotinines, i n whic h a projecting , inwardl y

PHYLOGENY O F RUDIS T BIVALVE S

101

102

P. W . SKELTO N & A . B . SMIT H

104 P

. W. SKELTO N & A. B . SMITH

Fig. 4 . (a) Radiolites sauvagesi d'Hombres-Firmas(?), dorsal aspect of left (free ) valve ; Turonian(?) of Abeih, Lebanon (NHM, L 18719) . (b ) Durania cf. apula (Parona) , postero-ventral aspect of right valve; Campanian, Khash m Hajajah , Riyadh, central Saudi Arabia (King Saud University, College o f Science, El Asa'ad and Skelton collection, HN2.2) . (c) and (d ) Ichthyosarcolites triangularis Desmarest, interior o f left valve , with broken myocardinal arcad e (c) , an d worn surface o f right valve, showing cement-filled pallial canals (d); Cenomanian, Charente, France [NHM , (c), 30382; (d), L63180]. Scale bars, 1 0 mm. See Fig. 1 for key; me, myocardinal arcade; rb , radial band(s).

PHYLOGENY O F RUDIS T BIVALVE S

105

Fig. 5 . (a) to (c) Plagioptychus toucasi Matheron, interiors of left valv e (a) and right valve (b); Santonian, Le Beausset, Var, France (UCBL , E M 15685 , E M 15686) . (c ) Antero-posterio r radial section across both valves ; same provenance (PWS collection) . Scal e bar , 1 0 mm. Se e Fig s 1 and 2 for key.

myophoral organizatio n betwee n th e tw o caprini d (sensu stricto) subfamilie s (Fig . 9) . The caprininids are characterize d b y a n erec t myophora l plat e i n the RV , whic h project s int o th e L V an d face s back ont o th e inne r sid e o f the L V myophore. Th e 'coalcomaninids' ( = Caprinuloidinae Ma c Gillavry) sho w th e opposit e arrangement , with the

LV myophor e projectin g int o th e posterio r accessory ('myophoral' ) cavit y i n th e R V an d facing bac k ont o a n adducto r insertio n sit e o n th e posterior wall of the cavity. A contrastin g approac h t o th e Treatise 'caprotinids' wa s adopte d b y Skelto n (1978) . I n view o f uncertaintie s a t the tim e ove r ho w bes t t o

106

P. W. SKELTO N & A . B . SMIT H

Fig. 6 . Douville's (1889) proposed phylogeneti c schem e for the 'inverse ' rudists .

split up primitive uncoiled rudists, he expanded th e latter family to include th e monopleurids , s o as t o form a coheren t basa l grou p o f uncoile d rudists . The paraphyleti c natur e of thi s las t groupin g wa s highlighted by Smith (1994) a s symptomatic of the need for fuller cladisti c analysi s of the rudists - the main objective of the present paper .

Data and methods Taxa Thirty-five rudis t tax a wer e selecte d fo r cladisti c analysis, togethe r wit h one megalodonti d t o serv e as outgrou p (Tabl e 2) . Mos t ar e singl e species , though in some instances it was felt appropriat e t o select whol e genera for character coding. The taxa chosen provide a representative sampling across the various highe r tax a recognized i n earlie r work . In almost al l cases , character s hav e bee n checke d directly fro m specimens (i n man y instance s including typ e material) , i n additio n t o publishe d figures an d description s (Appendi x 1) . Wher e possible, som e relativel y plesiomorphi c repre sentatives from presumed monophyletic higher taxa were included, to optimize recovery of more basal branching patterns. In addition, however, a number

of tax a o f controversia l o r uncertai n affinitie s (some wit h severa l derive d characters ) wer e included, i n th e hop e o f eithe r clarifyin g thei r relationships o r o f detectin g hithert o unexpected links between established highe r taxa. Dechaseaux e t al (1969 ) lis t 11 5 rudist genera , while a mor e recent , thoug h stil l incomplete , website data base (Steube r 1999/? ) lists 14 2 genera from familie s s o fa r covered , t o whic h shoul d b e added another 12 or so genera from familie s still to be recorde d (givin g a total o f aroun d 15 4 genera). Future taxonomi c revision wil l probabl y dispens e with som e o f thes e gener a throug h synonymy , though this loss i s likely t o be more tha n offset b y the erectio n o f ne w gener a fro m region s wher e much primary taxonomic descriptio n remain s to be done, suc h as Mexico an d the Middle East. Hence, the presen t analysi s i s base d o n onl y a limite d sampling o f th e grou p an d th e result s mus t b e regarded a s preliminary . Futur e wor k wil l b e directed t o includin g mor e tax a an d furthe r refinement o f character coding , in order t o test and build upon the present conclusions . The Middl e Jurassi c (Bathonian ) megalodonti d Pachyrisma grande Morri s & Lycett (Fig. la ) wa s chosen a s th e outgroup . I t i s on e o f th e strati graphically younges t specie s o f describe d

PHYLOGENY O F RUDIST BIVALVE S

Fig. 7 . Horiopleura lamberti Douville , traced drawing of radial section s acros s antero-dorsa l (left ) an d posterio r (right) part s o f articulate d shell , showin g ectomyophora l cavity inserte d behin d pedunculat e posterio r myophora l plate o f lef t valve . Albia n o f Santander , Spai n (PW S collection). Scale bar, 1 0 mm. See Figs 1 and 2 for key .

megalodontids, predatin g b y onl y tw o stage s th e oldest know n (Oxfordian ) rudist s wit h whic h i t already share s severa l derive d character s wit h respect to other bivalves. Spirogyrate rudists , sharin g th e plesiomorphi c external conditio n o f th e ligamen t wit h th e megalodontids (Skelto n 1978 , 1985) , ar e represented b y fiv e species . Thes e includ e th e Oxfordian-Lower Kimmeridgia n typ e specie s o f Douville's (1935) two postulated ancestral diceratid genera, Epidiceras sinistrum (Deshayes) (Fig. Ib) , in whic h attachmen t was b y th e LV , and Diceras arietinum Lamarc k (Fig . Ic) , attache d b y th e RV. Two requieniid s (attache d b y th e LV ) ar e als o included - th e earlies t know n (Uppe r Kimmeridgian-Tithonian) species , Matheronia salevensis Joukowsky & Favre, and the widespread Lower Cretaceou s species , Toucasia carinata (Matheron). Valletta, attache d b y th e RV , and th e supposed progenito r o f Douville' s 'serie inverse' (Douville 1896) , i s represente d b y it s earlies t known species , th e Uppe r Kimmeridgia n V auris Favre. Caprinids (sensu stricto) are at present probably the best understood of the rudist higher taxa, having recently bee n revise d (wit h cladisti c analysis ) b y Chartrousse (1998a , b ) an d Skelto n & Mass e (1998). Si x genera wer e thu s deemed sufficien t t o represent the two subfamilies into which the family has bee n divide d (se e previou s section) . Th e earliest know n member s o f eac h subfamil y ar e Pachytraga tubiconcha Astr e (Hauterivian ; Caprininae) and Retha tulae (Felix) (?HauterivianBarremian; Caprinuloidinae) . I n thes e primitiv e

107

forms, pallia l canal s ar e spars e (Pachytraga) o r absent (Retha). Canaliculat e caprinid s ar e represented by the caprininids Praecaprina varians Paquier (Lowe r Aptian ) an d Caprina adversa d'Orbigny (Cenomanian ) (Fig. 2 c an d d) , an d th e caprinuloidinids Amphitriscoelus waringi Harris & Hodson (Lowe r Aptian ) an d Coalcomana ramosa (Boehm) (Lower Albian) . Monopleurids ar e represente d b y thre e species . One o f th e earlies t specie s assigne d t o th e genu s Monopleura i s M . taurica Pchelintsev , fro m th e Berriasian o f Crime a (Yani n 1975 ; Skelto n 1985) . Many quite disparate species have been assigned to this genus , whic h i s i n nee d o f revision ; th e Barremian M . varians Mathero n (Fig . Id ) i s th e type species . Codin g fo r th e genu s Agriopleura, widely interprete d a s th e sourc e o f th e radiolitid s (Masse & Philip 1974) , is based on the descriptions by Douvill e (1918 ) o f tw o Barremia n specie s [A . blumenbachi (Studer ) an d A . marticensis (Matheron)], which were regarded a s synonymous by Touca s (1907) . Th e questio n o f synonym y i n this case does not affect th e characters code d for in the present analysis . The radiolitids (e.g . Fig. 4 a and b) ar e regarded as probabl y monophyleti c (Skelto n 1978) , s o just six representativ e tax a wer e selecte d fo r th e purposes of this broad analysis. However, it is also by fa r th e mos t divers e o f th e rudis t familie s [Steuber (1999Z? ) records 7 1 genera], s o analysis of other taxa is desirable i n the future, i n order t o test the assumptio n o f monophyly . Th e earlies t examples ye t documente d - fro m th e Uppe r Aptian - hav e been assigne d t o Eoradiolites plicatus (Conrad ) (Masse & Gallo Maresca 1997) . These sho w limite d developmen t o f th e celluloprismatic mesostructur e of the calcitic oute r shell laye r i n th e RV , characteristi c o f mos t radiolitids (Fig . lOa) , bu t ar e otherwis e simila r t o Lower Aptia n Agriopleura sp . fro m Arabi a (Skelton & Masse 2000) . The cosmopolitan genu s Sauvagesia Douvill e show s a mor e derived , polygonal cell pattern throughout its RV outer shell layer. Moreover, certai n specie s hav e pallial canals in th e L V [e.g . th e Maastrichtia n S . macroplicata (Whitfield) fro m Jamaica] . The Turonia n Durania cornupastoris (De s Moulins) is similar to the more primitive specie s o f Sauvagesia, though lackin g a ligamentary invagination . Th e Campanian Maastrichtian Ol d Worl d genus Osculigera Kiihn , however, show s mor e derive d characters , wit h infolding o f the radial bands to form pseudopillars , in additio n t o loss o f the ligament . Pseudosabinia klinghardti (Boehm ) i s anothe r Ol d Worl d for m with man y derive d characters . I t i s a larg e canaliculate recumben t rudist , locall y abundan t in Campanian platfor m deposit s fro m th e easter n Mediterranean to Arabia (Morris & Skelton 1995) .

108

P. W . SKELTO N & A . B . SMIT H

Fig. 8 . Ma c Gillavry' s (1937 ) phylogeneti c schem e fo r th e 'inverse ' rudists , comprisin g thre e mai n type s o f tren d followed independentl y by severa l differen t lineage s (a s discusse d in text) . Trechmannellinae ' i s Dictyoptychidae Skelton; l Ethra' i s Retha Cox. [Copied from Ma c Gillavry (1937) with the author's permission].

Its possessio n o f a fin e celluloprismati c meso structure i n th e oute r shel l laye r o f th e R V (Fig . lOb) wa s note d b y Skelto n (1978) , i n suppor t of Mac Gillavry's (1937 ) assertio n of its sauvagesiine

affinity. Phili p (1986 ) accordingl y remove d th e Genus Sabinia (t o whic h Pseudosabinia wa s originally assigned ) fro m the Caprinidae , wher e Dechaseaux e t al. (1969 ) ha d place d it , t o th e

PHYLOGENY O F RUDIS T BIVALVE S Table 1 . Rudist families a s listed i n Th e Treatis e o n Invertebrate Paleontology (Dechaseaux e t al. 7969) 1 Diceratida e Dall (Pa) 2 Requieniida e Douville (M) 3 Monopleurida e Munier-Chalmas (Pa) 4 Caprotinida e Gray (Po) 5 Caprinida e d'Orbigny (Po) 6 Hippuritida e Gray (M ) 7 Radiolitida e Gray (M) Status of families according to Skelton (1 978). M, monophyletic; Pa, paraphyletic; Po, polypnyletic.

Radiolitidae. However , apparen t difference s i n myocardinal arrangemen t fro m th e type species o f Sabinia, S . anienis Parona , le d Morri s & Skelto n (1995) t o propos e th e ne w generi c nam e Pseudosabinia fo r 'S.' klinghardti. Reinspection of the typ e materia l o f S . anienis wil l b e necessary , however, before i t can be included i n this analysi s as well . Anothe r canaliculat e radiolitid , thi s tim e from th e Maastrichtian o f the Caribbea n region , i s Chiapasella radiolitiformis (Trechmann) . A n interesting feature o f this taxon is its possession o f numerous tightl y pleate d infolding s i n th e oute r shell laye r o f th e RV , somewhat simila r t o thos e seen in Torreites (se e below) .

109

The Polyconitida e ar e represente d b y fou r species, fro m thre e genera . Horiopleura (Fig . 7 ) was selected a s a typical genus, in preference to the relatively mor e derive d Polyconites. Bot h th e earliest know n membe r o f th e family , th e Uppe r Barremian-Lower Aptia n specie s H . dumortieri (Matheron) (Mass e 1996 ) an d th e Albia n typ e species, H . lamberti Douville , wer e coded . Th e other two species included in the analysis are forms whose polyconiti d affinitie s hav e recentl y bee n proposed. Althoug h th e Uppe r Aptian-Albia n Japanese specie s Praecaprotina yaegashii (Yehara) (Fig. 1 1 a) ha d originall y bee n referre d t o Horiopleura, it was given its new generic nam e by Yabe & Nagao (1926), wh o suggested that it might be allie d instea d wit h Pachytraga. Skelto n & Masse (1998) cast doubt on the latter interpretation, and re-emphasize d it s similaritie s wit h Horiopleura. Th e positio n o f Tepeyacia corrugata Palmer (Fig . llb-d) , fro m Mexico , wa s formerl y even les s evident , a s Palme r (1928 ) lacke d information o n it s myocardina l features . H e suggested that it was possibly a monopleurid, while Chubb (1971 ) referred a new Jamaica n specie s (T . multicostata Chubb ) t o th e Radiolitidae . Stud y of similar, bu t bette r preserved , specimen s fro m th e Upper Albian-Lowe r Cenomania n o f S W Mexic o

Fig. 9 . Posterio r myophora l configuration s i n th e tw o subfamilie s o f th e Caprinida e (sensu stricto), show n i n diagrammatic antero-posterio r section s throug h bot h valves , wit h lef t valv e abov e an d righ t valv e below : (a ) 'Coalcomaninae' Coogan (Caprinuloidinae MacGillavry); (b) Caprininae d'Orbigny. [Copied from Chartrousse (1998b) with th e author' s permission] . A , anterior ; BC , bod y cavity ; P , posterior; pac , 'posterio r accessor y cavity ' ( = LV posterior endomyophoral cavity in Caprinuloidinae, and RV posterior ectomyophoral cavity in Caprininae, herein); pmc, 'posterior myophora l cavity ' ( = R V posterio r endomyophora l cavit y i n Caprinuloidinae , an d L V posterio r endomyophoral cavity in Caprininae, herein); pmp, posterior myophore.

110

P. W. SKELTO N & A . B . SMIT H

led Pantoja-Alor & Skelton (1999) to transfe r i t to the polyconitids , base d o n it s myocardina l arrangement (Fig. lib and c). They also reassigned the typ e locality fo r th e species , i n eastern central

Mexico, t o th e Albian, instead of the Turonian , as Palmer (1928 ) had erroneously supposed . The systematic positions of the next three species are currently uncertain. The Lower Aptian species Glossomyophorus costatus Masse , Skelto n & Sliskovic i s a distinctiv e endemic o f th e easter n

Table 2 . Taxa used i n this analysis (see Appendix 1 fo r sources} Outgroup (megalodontid ) PAC Pachyrisma grande Morris & Lycett Spirogyrate rudists EPI Epidiceras sinistrum (Deshayes) MAT Matheronia salevensis Joukowsky & Favre TOU Toucasia carinata (Matheron) DIC Diceras arietinum Lamarc k VAL Valletta auris Favr e Caprinids (sensu stricto) RET Retha tulae (Felix ) AMP Amphitriscoelus waringi Harris & Hodson COA Coalcomana ramosa (Boehm) PACH Pachytraga tubiconcha Astr e PRA Praecaprina varians Paquie r CAP Caprina adversa d'Orbign y Monopleurids MONt Monopleura taurica Pchelintsev MONv Monopleura varians Matheron Kiih n AGR Agriopleura Radiolitids EOR Eomdiolites plicatus (Conrad) SAU Sauvagesia Douvill e DUR Durania cornupastoris (De s Moulins) OSC Osculigera Kiihn PSAB Pseudosabinia klinghardti (Boehm) CHI Chiapasella radiolitiformis (Trechmann ) Polyconitids HORd Horiopleura dumortieri (Matheron) HOR1 Horiopleura lamberti Douvill e PRAE Praecaprotina yaegashii (Yehara) TEP Tepeyacia corrugata Palme r Uncertain (plu s caprotinid) GLO Glossomyophorus costatus Masse , Skelton & Sliskovic HIM Himeraelites Di Stefano CAPR Caprotina striata d'Orbign y Plagioptychid PLA Plagioptychus

Mathero n

Other canaliculate rudists DICT Dictyoptychus morgani (Douville) ICH Ichthyosarcolites triangularis Desmares t ANT Antillocaprina occidentalis (Whitfield) Hippuritids HIP Hippurites BAR Barrettia

Lamarc k monilifera Woodwar d

Torreitinids PTOR Praetorreites omanensis Philip & Platel TOR Torreites sanchezi (Douville )

Fig. 10 . (a ) Biradiolites angulosissimus Toucas , radia l section o f par t o f celluloprismati c oute r shel l laye r (acetate peel); vertical walls formed by localized ridges in the growt h layer s o f fibrilla r prismati c calcite , periodically cappe d of f b y th e fla t base s o f successiv e growth layers , wit h cell s infille d eithe r b y dar k micrit e (upper right ) o r b y microspa r (lowe r part) ; Santonian , Plan d'Aups , Var , Franc e (PW S collection) , (b ) Pseudosabinia klinghardti (Boehm) , commissural sectio n across oute r shel l laye r o f righ t valve , showin g fin e polygonal celluloprismati c mesostructure ; Campanian , NW Turkey , paratype specime n (NHM , L 49455). Scal e bars, 1 mm.

PHYLOGENY O F RUDIS T BIVALVE S

Mediterranean/Arabian region. It displays a curious combination o f monopleuri d (e.g . subequa l L V teeth) and 'caprotinid ' feature s (e.g . projecting LV posterior myophore , facin g i n ont o a n erec t myophoral wal l i n th e RV ) (Mass e e t al. 1984) . Himeraelites D i Stefan o ha s lon g bee n proble matical (an d stil l is) , both fro m stratigraphica l an d taxonomic point s o f view (Mass e e t al. 1998b) . Di Stefano (1888 ) create d severa l specie s whic h ar e now i n nee d o f revision ; mos t (i f no t all ) ma y b e synonymous wit h th e (?Aptian-Albian)-typ e species, H . vultur D i Stefano . Sellaea an d othe r species assigne d t o 'Caprotina' b y D i Stefan o (1888) appear to be closely related to Himeraelites, on th e basi s o f thei r myocardina l arrangement s (Masse e t al . 1998/?) , bu t distinc t fro m Caprotina (sensu stricto; Douvill e 1887) . Th e Cenomania n Caprotina striata d'Orbign y (Fig . 2 a an d b) , b y contrast, i s securel y place d a s th e typ e specie s o f the genu s an d thu s fo r th e Famil y Caprotinidae . However, it is open to question how inclusive that family shoul d be , give n th e establishmen t o f th e Polyconitidae b y Ma c Gillavr y (1937) , th e placement o f Pachytraga an d Retha i n th e Caprinidae b y Skelto n & Mass e (1998 ) an d th e distinct aspect of the Himeraelites group, discusse d above. Th e broa d paraphyleti c concep t o f th e caprotinids proposed by Skelton (1978) is no longer tenable in the context of the present analysis. The Plagioptychidae is here exemplifie d by on e species, the Santonian P. toucasi Matheron (Fig. 5), which show s particularl y clearl y th e myocardina l features tha t le d Douvill e (1888 ) t o separat e Plagioptychus fro m th e caprinids . Onl y tw o othe r genera were assigned to the family by Mac Gillavry (1937) - Mitrocaprina an d Coralliochama - bot h possessing mor e derive d characte r state s tha n Plagioptychus. The nex t thre e specie s considere d her e ar e th e type specie s an d gener a for eac h o f the remaining three canaliculat e familie s recognize d b y Skelto n (1978) [an d by Skelton & Benton (1993)] following Mac Gillavr y (1937) . Dictyoptychus morgani (Douville) (Dictyoptychidae ) i s a Maastrichtia n endemic o f th e Middl e East . Antillocaprina occidentalis (Whitfield ) (Antillocaprinidae ) i s likewise a Maastrichtia n endemic , thoug h o f th e New World . Ichthyosarcolites triangularis Desmarest (Ichthyosarcolitidae ; Fig . 4 c an d d ) i s widespread i n th e Cenomania n o f th e Ol d Worl d Tethyan Realm. As wit h the radiolitids , th e monophyleti c statu s of th e Hippuritida e i s regarde d a s secur e (Skelto n 1978), except in the case of Torreites [typ e species, T. sanchezi (Douville)] , whic h lack s th e characteristic syste m of radial canal s an d pores i n the oute r shel l laye r o f th e LV . Skelton & Wright (1987) followe d earlie r author s (e.g . Ma c Gillavr y

111

1935; Va n Dommelen 1971 ) in interpreting i t as an aberrant hippuritid . However , Philip & Plate l (1994) propose d a n independen t origin , perhap s from plagioptychids , vi a thei r newl y describe d genus Praetorreites (typ e species , P . omanensis Philip & Platel) , i n whic h pillar s ar e onl y incipiently developed . Although a larg e numbe r o f specie s hav e bee n assigned t o th e genu s Hippurites, difference s between the m ar e ofte n subtle . Moreover , man y have bee n show n t o represen t successiv e chrono species withi n lineage s (e.g . Vicen s 1992 ; Simonpietri 1999) . Therefore , i n thi s analysi s th e genus ha s bee n treate d a s whole . Hippurites radiosus de s Moulin s wa s use d a s a standar d fo r checking mos t characters , bein g wel l represente d by many prepared whol e specimen s (Fig . 3 b and c; e.g. Bayle 1855) . Althoug h thi s species had lost its ligament (Vicens 1992) , others stil l retain a vestige of it. Barrettia monilifera Woodward , a Campanian New Worl d endemic , i s a mor e elaborat e form , showing multipl e radia l infolding s (secondar y pillars) o f th e oute r shel l laye r (Fig . 12) . Va n Dommelen (1971) also noted the presence o f pallial canals i n th e LV , besides th e norma l syste m o f radial canal s i n th e thi n oute r shel l layer , a n observation confirme d i n th e specime n illustrate d here.

Definition of characters The present analysi s i s based o n 32 morphologica l characters, on e of which (#01) has ordered multipl e states, th e res t bein g unordered . Th e ful l lis t o f characters is given in Appendix 2, but a synopsis of how they are related to different component s of the shell is given in Table 3. The definitio n and coding o f characters wa s th e most problematica l aspec t o f th e presen t analysis . Groups wit h multicomponen t skeletons , suc h a s vertebrates an d echinoids , len d themselve s t o cladistic analysis of fossil material because discrete homologous element s ma y be self-evident fro m th e pattern of assembly of the skeleton. For example, it is possible t o unambiguously identify th e humerus in tetrapod s a s th e bon e i n th e uppe r forelimb . Bivalve shells, by contrast, must be metaphorically dissected into an arbitrary number of characters. An immediate proble m i n thi s respec t i s th e non independence o f characters selected for coding. If a given aspec t o f th e shel l ca n b e triviall y resolve d into many , potentially additive , characters , i t ma y then dominat e th e parsimon y analysis , swampin g the signal s fro m othe r aspects . I n rudists , fo r example, i t i s eas y t o defin e severa l character s relating t o pallial canals . Canals may be present in the L V and/o r th e RV , an d aroun d th e anterior , posterior, dorsa l and/o r ventra l margins , o r within

112

P. W . SKELTO N & A . B . SMIT H

114

P. W. SKELTO N & A . B . SMIT H

Fig. 12 . Barrettia monilifera Woodward , tangentia l sectio n acros s ventra l margins o f both valves, showin g pallia l canal s in the left valve (within th e inner shell) and moniliform infolding s o f the outer shell layer of the right valve; Campanian, Puerto Ric o (PW S collection). Scal e bar , 5 mm . Se e Fig . 2 fo r ke y ; in, secondar y infolding s o f R V wall (i n som e hippuritids).

of th e analysis , a s the y wer e foun d t o b e intro ducing considerabl e instabilit y t o branchin g patterns ( a commo n sympto m o f homoplasy) . Tabulae, fo r example , appea r i n severa l quit e disparate taxa, including caprinids , hippuritid s an d radiolitids, an d ther e ca n b e littl e doub t tha t the y have evolve d independentl y i n thes e (an d other) groups. Accordingly , the y hav e bee n eliminate d from th e present analysis.

Character coding An outer shell layer of low magnesian calcite, with a fibrilla r prismati c microstructure , seem s t o hav e been ubiquitou s amon g rudists [see Skelton (1976 , fig. 6) for an illustration of this in an hippuritid; and also Al-Aas m & Veize r (1986)] . Thoug h notabl y

Table 3 . Synopsis o f characters coded i n this analysis (see Appendix 2 for full list) 8 (#01-08 ) for calcitic outer shel l laye r 2 (#09-10 ) for attachment t o substrat e 2 (#11-12 ) for condition of ligament 3 (#13-15 ) for shell shap e 4 (#16-19 ) fo r dentitio n 2 (#20-21 ) for anterior myophore s 7 (#22-28 ) for posterior myophores 3 (#29-31 ) for other myocardina l character s 1 (#32 ) for pallial canal s

thin i n som e tax a (e.g . caprinids; Fig . 2e), in n o case ha s complet e absenc e o f th e laye r bee n verified. Character s #01-0 8 concer n th e relativ e thickness, and structural modifications of this layer. Primitively, it rarely exceeds 1 mm in thickness an d may b e bu t a fractio n o f thi s [e. g Pachytraga\ illustrated i n Skelto n & Masse (1998 , fig . 11)] . I n some taxa, however, i t is significantly thickene d i n parts o f th e shell , ofte n u p t o severa l millimetre s [e.g. Agriopleura\ se e Masse & Philip (1974)], and in som e instance s considerabl y mor e (e.g . hippuritids, Fig. 3a; radiolitids, Fig . lOa). Distinctive structura l modification s o f th e oute r shell laye r ar e characteristi c o f certai n taxa . Th e outer shel l laye r o f th e R V ma y b e thickene d i n such a wa y tha t it s inne r margi n i s expose d wel l beyond tha t o f th e L V (#02 ; e.g . Torreites an d Dictyoptychus). Claim s tha t thi s characte r i s als o present i n Durania hav e bee n show n t o b e erroneous (Gil i e t al. 1995 ) an d amon g th e radiolitids considere d her e onl y th e aberran t Pseudosabinia show s it. The radial canals and external pores i n the LV of hippuritids (#04; Fig. 3a and b) are interpreted a s a highly modifie d suspensio n feedin g syste m (Skelton 1976) . I t i s uniqu e t o tha t famil y bu t absent i n Torreites an d Praetorreites. Th e oute r shell laye r o f th e latte r gener a do , however , sho w numerous tigh t longitudina l pleat s i n th e RV , corresponding to salient ridges o n the inner margin of tha t valv e (#03 ; Skelto n & Wrigh t 1987) .

PHYLOGENY O F RUDIS T BIVALVE S

Though n o othe r hippuriti d show s pleatin g o f exactly thi s form , th e multiple-fol d hippuritids, of which Barrettia i s a n example , d o contai n numerous radiall y extende d infolding s o f th e R V outer shel l laye r (Fig . 12; Van Dommele n 1971) . This genus , too , has accordingl y bee n code d fo r possession of character #03. Pleating similar to that in Torreites i s nevertheless present in the RV outer shell laye r o f the polyconitid Tepeyacia [Fig . lid; see also Pantoja-Alor & Skelton, (1999, fig. lb)], as well as the radiolitid Chiapasella. Celluloprismati c mesostructure (#05 and 06; Fig. 10) is known only in radiolitids, as discussed in the previous section. Both radiolitids and hippuritids, as well as some other rudists , posses s a pai r o f modifie d radia l zones of the outer layer around the posterior flank s of th e shell . I n most radiolitids , the y ar e vertica l deflections of the valve margins, marked externally by longitudina l band s (#07 ; Fig. 4b ) whic h ar e usually distinctl y ornamented . I n a few radiolitid s (such a s Osculigera) the y ar e infolde d t o for m 'pseudopillars' [se e also Steuber (19990, fig. 8)]. In hippuritids, by contrast , these zone s are invariably Moldings of the valve margins, creating internally projecting pillar s i n the RV , overlain b y oscules in the L V (#08 ; Fig . 3 b an d c) . Douvill e (1886 ) interpreted radia l band s an d pillars/oscule s a s siphonal structures , thoug h Skelto n (1976 , 1979) doubted th e presenc e o f siphon s i n rudists , an d suggested instea d tha t th e paire d structure s might represent th e site s o f faeca l an d pseudofaeca l rejection. Regardless of the roles of such structures, the difference s i n constructio n betwee n radia l bands an d pillars/oscule s sugges t tha t the y ar e analogous rather than homologous. Hence, they are coded her e a s distinc t characters . Nevertheless , pseudopillars hav e bee n code d alon g wit h pillars , since the y ar e structurall y equivalent . Tepeyacia shows incipient pillars wit h weak inflections of the valve margins (Fig. lid; Palmer 1928) . Characters #09 and 1 0 concern attachment to the substrate by one or the other valve, as discussed in the earlie r sectio n o n th e histor y o f ideas . Th e condition o f th e ligamen t (#1 1 an d 12 ) wa s regarded by Skelton (1978, 1979, 1985) as a crucial factor in the evolutionary histor y of the rudists. The primitive condition, shared with the megalodontids, was a n external , modifie d parivincula r ligamen t (Fig. lb ; Skelto n 1978) . Thoug h shortened , th e ligament wa s stil l externa l i n Valletta. I n al l subsequent 'inverse ' rudists , b y contrast , i t wa s invaginated an d greatl y reduce d t o a residua l connecting strin g betwee n th e valve s (Skelto n 1979), o r entirel y los t (#12) . Invaginatio n o f th e ligament permitted th e growth of 'uncoiled' tubular shells (Skelton 1978, 1985 ) The next three characters (#13-15) cod e for the external symmetr y o f th e shell . Asymmetr y i s

115

usually onl y moderatel y develope d i n th e diceratids. I n late r forms , i t i s mor e pronounced , sometimes with a tendency t o reduction o f the fre e valve (RV, #14; or LV, #15). The 'normal ' an d 'inverse ' pattern s of dentition (#16 an d 17 ) were discusse d i n a n earlie r sectio n (History o f idea s ...) . A distinctiv e dorsa l geniculation of the central tooth in the RV (#18) is exclusive t o th e caprinuloidinid s [se e figure s i n Skelton & Masse (1998)] , whil e complet e los s of this toot h (#19 ) accompanie s atroph y o f th e ligamentary invagination i n certain radiolitids. Anterior myophora l configuration is covered b y characters #2 0 an d 21 . I n mor e primitiv e rudists , the anterior adducto r inserte d directl y o n the valve walls (Fig . lb an d c). Most rudis t tax a develope d myophores, however , eithe r a s simpl e ledge-lik e extensions o f th e hing e plate s (Fig . Id ) o r a s asymmetrical structures . In extrem e cases , th e LV projects acros s int o th e R V (Fig . 4a) an d face s directly ont o the inner wall of the latter (#21). Posterior myophore s are present in all rudists, as well a s th e megalodonti d outgroup . Character s #22-28 ar e a n attemp t t o systematiz e a larg e bu t disparate bod y o f descriptiv e wor k o n thei r different configurations . Dicer as (Fig . Ic ) an d Epidiceras (Fig . lb) shar e wit h Pachyrisma (Fig. la) th e primitiv e conditio n o f havin g myophora l ledges tha t pas s beneat h th e hing e plate s int o th e umbonal cavities. However , som e specimen s fro m the tw o dicerati d gener a ma y sho w myophora l union with the hinge plate in one valve, especially in later specie s (e.g . Skelton 1999 , pi. 1 , fig. 1 and pi. 2, fig. 1). The primitive condition i s retained in the requieniids but in other rudist taxa the posterior myophores are invariably joined to the hinge plates (#22). Various furthe r discret e modification s o f th e posterior myophore s ar e see n amon g uncoile d rudists. Th e L V myophor e ma y b e tilte d steepl y outwards and project across the commissural plane so as to face directl y onto the posterior wal l of the general cavity in the RV (#23), most notably in the radiolitids (Fig. 4a). By contrast, the LV myophore may b e raised u p a s a flat or inwardly tilted plate , rooted b y a stal k o n th e inne r par t o f th e myocardinal platform , an d separate d fro m th e posterior valv e wal l b y a dee p ectomyophora l cavity (#24 ; e.g . Fig s 2a , 7 an d lla) . Thi s configuration i s typica l o f th e polyconitids . Alternatively, in Himeraelites, the LV myophore is raised as a broad, inwardl y slopin g buttress , facing onto a prominent shelf in the RV (#25). A more or less projecting LV posterior myophore may be rooted on the posterior valve wall, close to the valve margin. There, i t may be inclined steepl y inwards s o a s t o fac e a n erect , outward-facin g myophoral plat e in the RV, which is separated fro m

116

P. W . SKELTO N & A . B . SMIT H

the posterior valv e wall by an ectomyophoral cavit y (#26), a s i n caprininid s (Fig s 2 d an d e an d 9b). Alternatively, th e L V myophor e ma y b e incline d outwards s o as to fac e bac k onto a low myophoral shelf o n th e posterio r wal l o f th e R V withi n a n endomyophoral cavit y i n tha t valv e (#27) , a s i n caprinuloidinids (Fig . 9a). Finally, th e L V myophor e ma y project , a s a compressed tooth-lik e stucture , into a myocardina l socket i n th e R V (#28) . Thi s appear s t o b e especially characteristi c o f the hippuritids (Fig. 3b and c ) an d specimen s i n whic h aragoniti c shel l microstructures hav e bee n preserve d sho w myostraca (indicatin g muscle insertion ) o n bot h sides of the myophore (Fig . 3d; Skelton 1976) . Three furthe r posterio r myocardina l character s may b e note d amon g uncoile d rudists . Th e firs t (#29) concern s th e positio n o f th e inne r (ventral ) margin o f th e L V myocardina l platform . I n som e taxa thi s margi n closely skirt s th e ventra l side s of both teet h (e.g . Agriopleura). I n others , th e myocardinal margi n is mor e o r les s ventrall y extended and runs from the base of the anterior toot h to some way alon g the posterior myophore . Part, i f not all, of the posterior myophore , a s well a s the posterio r tooth, thu s becom e separate d fro m th e genera l cavity [e.g . Caprotina (Fig . 2a) an d hippuritid s (Fig. 3b)] . Wher e thi s separatio n i s strongl y developed, a dee p endomyophora l cavit y (#30 ) may appea r i n th e L V betwee n th e posterio r myophore and the inner myocardinal margin, which now form s a thi n erec t lamin a connectin g th e anterior tooth with the postero-ventral valve margin (Fig. 2d) . Thi s cavit y i s typica l o f caprinid s (Skelton & Masse 1998) , thoug h als o presen t t o a variable extent in Plagioptychus (Fig . 5a). The third character (#31 ) i s typica l o f certai n polyconitid s (Douville 1889 ) and comprise s a marke d conica l annexe t o th e L V posterior ectomyophora l cavity , passing beneat h th e ventra l par t o f th e posterio r myophore (Fig . 1 1 a). Th e las t characte r (#32 ) concerns the presence of pallial canals, as discussed earlier.

Cladistic analysis Cladistic analysi s of th e 3 6 tax a liste d i n Tabl e 2 was carrie d ou t usin g th e softwar e program PAUP 4.0 (Swofford 1998 ; beta-test version), based on the 32 character s discusse d abov e and liste d in Appendix 2 . Th e dat a matri x fo r th e analysi s i s shown i n Tabl e 4 . On e characte r wa s code d a s ordered (#01 ) and the rest as unordered; gaps were treated a s 'missing' . Pachyrisma wa s give n a s th e outgroup. Technica l discussio n o f th e principle s involved in the analytical procedure ca n be found in Smith (1994, ch. 3).

Table 4. Data matrix for th e cladistic analysis 00000000011111111112222222222333 12345678901234567890123456789012 PAC 0000000000000001000000000000000 0 EPI 1000000010001001000000000000000 0 MAT 1000000010001101000000000000000 0 TOU 2000000010001101000000000000000 0 DIG 1000000001001001000000000000000 0 VAL 1000000001001000100101000000000 0 RET 1000000001101000110101000010010 0 AMP 1000000001101000110101000010010 2 COA 1000000001101000110101000010010 2 PACK 1000000001101000100101000100010 0 PRA 1000000001101000100101000100010 1 CAP 1000000001101000100101000100010 1 MONt 1000000001101010200101000000000 0 MONv 1000000001101010200101000000000 0 AGR 2000001001101010200011100000100 0 EOR 2000101001101010200011100000100 0 SAU 2000111001101010200011100000100 ? DUR 2000111001111010001011100000100 0 OSC 2000110101111010001011100000100 0 PSAB 2100111001101000200011100000100 2 CHI 2010117001111000001011100000100 1 HORd 1000000001101010200101010000000 0 HOR1 2000007001101010200101010000001 0 PRAE 1000000001101010200101010000071 0 TEP 2010000101101010200101010000707 0 GLO 2000001001101000200101020000000 0 HIM 1000000001101010200101001000070 0 CAPR 1000000001101070200101020000001 0 PLA 2700000001101000200101010000017 1 DICT 2100000001111010100101000000100 2 ICH 1000000001111000200011100000100 2 ANT 1000000001101000200101000000100 2 HIP 2001000101171010200101000001000 0 BAR 2011000101111010200101000001000 1 PTOR 2110000101111010200101000007700 1 TOR 2110000101111010200101000001000 1 Taxa represented by abbreviations in left-hand colum n as in Table 2; character s are numbere d along th e top . See Appendice s for sources of information an d character coding.

Results An heuristi c searc h (base d o n repeate d branc h swapping), with characters equally weighted, found 3190 mos t parsimonious trees , involvin g 6 7 steps . A majority rule tree for these, with nodes supported by < 50% of the most parsimonious trees collapse d together, produce d mixe d results . I t showe d satisfactory resolutio n o f th e mor e basa l phylo genetic nodes , u p t o th e adven t o f uncoilin g and, thereafter, groupe d the caprinids (sensu stricto) as a distinct clade . Th e remainin g uncoile d taxa , however, wer e gathere d i n a largel y unresolve d polytomy, implyin g a considerabl e exten t o f homoplasy. Th e character s wer e therefor e reweighted accordin g t o their rescaled consistenc y

PHYLOGENY O F RUDIS T BIVALVES

indices (to optimize homology, inferred on the basis of congruence ) an d a n heuristi c searc h repeated . This yielde d 10 5 mos t parsimoniou s trees , fo r which the majority rul e tree (wit h nodes supporte d by > 50% trees) is shown in Fig. 13 . Figure 1 3 resolves mos t o f th e clade s expecte d from th e classi c work s o f Douville , Ma c Gillavr y and others , discusse d earlier . I n particular , al l th e deeper branching nodes were supported by 100 % of the mos t parsimoniou s trees . Thus , th e dichotom y between rudist s attachin g b y th e L V (wit h Epidiceras a s siste r grou p t o th e requieniids ) an d those attachin g b y th e R V (wit h Diceras a s siste r group t o th e clad e o f al l rudist s wit h 'inverse ' dentition) i s full y supported . Likewise , Valletta consistently appear s a s sister grou p to the clad e of all uncoiled rudists. The expected clade s of uncoiled rudists receiving 100% suppor t includ e th e caprinid s (sensu stricto, with the two recognized subclades) , th e radiolitid s (including Pseudosabinia), wit h Agriopleura a s a sister group, an d the hippuritids (wit h Torreites and Praetorreites formin g a siste r clad e t o Hippurites and Barrettia). Th e polyconitid s als o appea r a s a clade, thoug h wit h th e inclusio n o f Caprotina, Glossomyophorus, Plagioptychus an d th e hippuritids. There are also some less conventional groupings. Tepeyacia i s show n a s th e siste r grou p t o th e hippuritids an d Glossomyophorus i s paire d wit h Plagioptychus. Ichthyosarcolites emerge s a s a sister grou p t o the Agriopleura/radiolitid clad e an d this grouping is placed i n a polytomy alongside the other tw o canaliculat e taxa , Dictyoptychus an d Antillocaprina. A bootstra p tes t (involvin g repeate d rando m resampling fro m th e dat a matrix ) wa s als o run , using 100 0 replicates . Thi s procedur e effectivel y tests th e breadt h o f suppor t fo r node s i n th e phylogeny; thos e supporte d b y man y character s scored hig h bootstra p percentag e value s and thos e relying on a few characters score d lo w values. The resulting bootstra p value s ar e show n i n Fig . 14 . Most o f th e expecte d node s remai n moderatel y t o well supported by the bootstrap test, especially tha t indicating monophyl y o f al l rudist s wit h 'inverse ' dentition (Valletta onwards ) with a bootstrap scor e of 98%. Monophyly of taxa attaching by the LV, of those attachin g b y th e R V an d o f th e uncoile d rudists (Retha onwards ) ar e al l give n moderat e support, wit h score s > 60%. Monophyl y o f th e caprinids (sensu stricto) i s weake r (55%) , thoug h its tw o subclade s (especiall y th e caprinuloidinids ) are bette r supported , eac h scorin g > 60%. Monophyly o f th e radiolitid s (togethe r wit h Agriopleura) i s wel l supported , a s i s tha t o f th e hippuritids (includin g th e torreitines) , wit h score s of > 80% in each case .

117

The sister grouping of Ichthyosarcolites wit h the Agriopleura/radiolitid clad e i s als o strongl y supported (83%) , thoug h the associatio n wit h the other two canaliculate forms is weaker. The pairing of Tepeyacia wit h th e hippuritid s get s onl y relatively wea k support (40%), while the negligibl e values fo r monophyl y o f th e polyconitid s (includ ing the other taxa cited previously) indicate that this grouping i s relian t o n ver y fe w character s an d i s therefore no t robust. One o f th e 10 5 mos t parsimoniou s trees , i n which th e polyconitid clad e ha s nevertheles s bee n retained (Fig . 15) , ha s bee n selecte d her e a s a working phylogeneti c hypothesi s t o illustrat e th e distribution o f the majo r possibl e synapomorphie s discussed earlier. It must be stressed that this should by n o mean s b e take n a s th e las t word : futur e iterations, involvin g more tax a and characters, wil l be needed t o test furthe r th e grouping s show n an d to resolve outstandin g problems .

Discussion In most respects, th e results of the present analysi s vindicate th e mai n phylogeneti c hypothese s emerging from th e work of Douville, Mac Gillavry and others , a s discusse d earlie r (Histor y o f idea s ...). Thus , littl e doub t ca n remai n concernin g th e fundamental divisio n o f rudist s int o tw o clades , according t o th e valv e o f attachmen t (Douvill e 1935). Th e strengt h o f suppor t fo r Valletta a s th e sister grou p o f al l othe r rudist s wit h 'inverse ' dentition mak e it (or at least an early specie s o f the genus) a likel y progenito r fo r tha t clade , a s postulated b y Douville (1896) . Th e monophyly and prolifi c cladogenesi s - o f the uncoiled rudist s (Skelton 1978 , 1985 ) an d th e polyphyl y o f canaliculate rudist s (Douvill e 1887 , 1888 ; Ma c Gillavry 1937 ; Skelto n 1978 ) ar e als o born e out . The suppor t fo r thes e conclusions , bot h fro m th e majority rul e tre e an d th e bootstra p test , rende r further discussio n unnecessary . The moderate bootstrap scor e for the monophyly of the caprinids (sensu stricto) suggest s that furthe r testing o f thi s nod e i s desirable , thoug h th e tw o subclades recognize d b y Ma c Gillavr y (1937) , Coogan (1973), Chartrousse (19980, b ) and Skelton & Mass e (1998 ) see m mor e secure . Evidently , more needs to be known abou t the basal caprinids , especially Retha, a poin t alread y note d b y Chartrousse (19980) . Although ther e i s goo d suppor t fo r th e monophyly o f th e radiolitid s (plu s Agriopleura) and the hippuritids, onl y a few taxa wer e analyse d for each . Furthe r testing , with more tax a and mor e characters, woul d agai n b e desirable . A particular point tha t call s fo r mor e probin g analysi s i s th e status o f Torreites an d Praetorreites [contras t

118

P. W . SKELTO N & A . B . SMIT H

Fig. 13 . Majority rule consensu s tree fo r th e 10 5 most parsimoniou s trees foun d i n the presen t analysi s (wit h simple reweighting o f character s b y maximu m value o f rescale d consistenc y indices) . Abbreviation s fo r tax a a s i n Tabl e 2 . Numbers are percentages ( > 50%) of the set of most parsimonious trees that support each node; polytomy results fro m < 50% support for incorporated nodes . Analysis using PAUP 4. 0 (Swoffor d 1998) .

PHYLOGENY O F RUDIST BIVALVES

119

Fig. 14 . Tree resultin g from 100 0 bootstra p replicate s randoml y resampled fro m th e characte r matri x (wit h simpl e weighting). Abbreviation s fo r tax a a s i n Tabl e 2 . Number s ar e percentage s o f bootstra p tree s supportin g eac h nod e (giving an indication o f the breadth of character support). Analysis using PAUP 4. 0 (Swoffor d 1998) .

120

P. W . SKELTO N & A . B . SMIT H

Fig. 15 . On e o f th e 10 5 mos t parsimoniou s tree s foun d i n th e presen t analysi s (base d o n simpl e r e weighting o f characters), with significan t postulate d synapomorphie s indicated. Abbreviations for taxa a s in Table 2 (*, possession of pallial canals ) and the characters ar e numbered a s in Appendix 2 . Based o n analysis using PAUP4.0 (Swoffor d 1998) .

Skelton & Wrigh t (1987) , Phili p & Plate l (1994 ) and Morris & Skelton (1995)]. The present analysis retains th e pai r a s a siste r grou p t o th e othe r hippuritids. However, this leaves open the question as to whether some of their distinctive features are relatively derived , o r plesiomorphic , an d eithe r further modified or lost in the other hippuritids (e.g. the pleated infolding s of the outer shell layer). One o f th e mos t intriguin g surprise s o f th e present analysis is the siste r grouping of Tepeyacia and the hippuritids, albei t with only weak bootstra p support. Th e suit e o f highl y derive d characters , already presen t i n eve n th e earlies t know n hippuritids (Simonpietr i 1999) , ha s lon g lef t rudistologists puzzle d as t o thei r origins . Douville (1889) suppose d the m t o hav e evolve d fro m Caprotina, regardin g thei r myocardina l arrange -

ments a s similar . Late r (Douvill e 1891) , h e confusingly state d tha t th e oute r shel l laye r o f hippuritids wa s homologou s t o th e middl e shel l layer o f Plagioptychus an d th e caprinid s supposing the radial canal s i n th e hippuriti d LV to correspond t o th e pallia l canal s i n th e latte r taxa . This i s clearl y a fals e homology , however , a s th e outer shel l laye r i n hippuritids, whic h contains th e radial canals, has the same fibrillar prismatic calcite constitution as that of other rudists (Skelton 1976) . The pallia l canal s o f Plagioptychus, a s well a s the caprinids, i n contrast , ar e i n th e aragoniti c inne r shell. The y diffe r markedl y i n form , moreover , from th e hippuriti d canal s wit h thei r externall y communicating pores. Without commenting on this erroneous suppositio n o f homology, Bilott e (1985 ) interpreted Douville' s (1891 ) statemen t t o impl y a

PHYLOGENY O F RUDIST BIVALVE S

caprinid ancestr y fo r th e hippuritid s an d hypothe sized a punctuationa l transitio n aroun d th e Cenomanian-Turonian boundary . Wit h th e evi dence presente d her e fo r th e siste r groupin g o f Tepeyacia an d the hippuritids, Bilotte' s hypothesi s now seem s unlikely . Althoug h Plagioptychus appears i n th e nex t siste r grou p t o th e Tepeyacia/hippmitid clad e in the majority rul e tre e (Fig. 13) , albei t wit h negligibl e bootstra p suppor t (Fig. 14) , it s pallia l canal s evidentl y evolve d independently o f th e radia l cana l syste m i n hippuritids. Tepeyacia present s som e temptin g possibilitie s as a possible model for the origin of the hippuritids. It is not difficult t o envisage a simple enhancemen t of the paired postero-ventral inflexions of the oute r shell laye r i n th e forme r (Fig . lid) t o yiel d th e pillars an d overlyin g oscule s o f the latte r (Fig . 3b and c) , no r d o th e difference s i n posterio r myo phoral configuration present much of a problem. If the polyconitid-style posterior myophor e in the LV of Tepeyacia (Fig . lib an d c ) wer e extende d t o project in tooth-like fashio n into a socket in the RV, the muscle scar could then have become folde d up on eithe r sid e o f the myophore , exactl y a s see n i n hippuritids (Fig . 3d). Th e socke t i n th e R V i s partially create d i n hippuritids , i n an y case , a s a n embayment between th e ligamentary infoldin g and the first pillar . The origin of the complex canal and pore system of th e hippuritids , however , i s harde r t o interpret . One possible clue is offered b y the sharp infoldings within the outer shell layer of Tepeyacia (Fig . lid), corresponding t o salien t radia l ridge s o n th e R V inner margin. The spacing of these is similar to that of th e radia l cana l mouths opening aroun d th e LV inner margi n o f hippuritid s (Fig. 3b), hinting a t a possible lin k betwee n them . Th e retentio n o f similar infolding s o f th e oute r shel l laye r i n Torreites, an d perhaps , i n modifie d form , i n Barrettia, coul d the n b e plesiomorphi c fo r th e clade, i n contras t t o th e specie s o f Hippurites considered b y th e presen t authors , i n whic h the y appear t o b e lacking . I n thi s respect , Hippurites ('Batolites') organisans Montfort, which does have tight infoldings in its outer shell layer (Dechaseau x 1952), merit s furthe r investigation . Anothe r featur e linking Torreites with Barrettia - thoug h derived in this instanc e - i s the possession o f internal pallia l canals withi n the aragoniti c shel l o f th e L V (Fig. 12; Van Dommelen 1971) . Ther e i s evidentl y stil l much wor k t o b e don e o n th e olde r (pre Campanian) hippuritid s o f th e Ne w World , i n particular, to clarify relationship s withi n the group. Finally, in relation to the affinitie s o f Tepeyacia, it is als o wort h drawing attention to Horiopleural juxi Steuber , recentl y describe d fro m th e Aptia n of Greec e (Steube r 1999a) , i n whic h simila r

121

tight infolding s ar e als o presen t aroun d part s oftheRV. The locatio n o f Glossomyophorus i n th e polyconitid clad e has little bootstrap support . Thi s implies reliance upon a few characters, indicating a need fo r furthe r testin g wit h mor e (an d bette r defined) characters . However , th e similarit y o f it s myocardinal syste m t o thos e see n i n othe r constituents (especiall y Caprotina}, mak e th e proposal quit e plausible . The polyconiti d clad e a s a whol e (Horiopleura dumortieri onwards ; se e Fig . 13) , including th e other tax a discusse d above , receive d negligibl e bootstrap support . Hence, i t would seem that it too is dependent o n rather fe w characters - a t least in the present analysis . Nevertheless , th e consistenc y of thei r myophora l arrangement s (albei t possibl y modified i n th e hippuritids) weigh s i n favou r o f a close relationship between them. Further testing for the monophyly of this grouping is clearly needed . The remainin g groupin g wit h wea k bootstra p support i s tha t o f th e thre e canaliculat e taxa , Dictyoptychus, Antillocaprina an d Ichthyosarcolites. Thes e hav e previousl y bee n allocated amon g separat e familie s (se e earlier History o f idea s ... ) and thei r markedl y differen t myocardinal system s (Ma c Gillavry 1937 ) would seem t o cas t doub t o n close relationshi p betwee n them. The y hav e probably onl y become associated in the present analysis because of their relative lack of plesiomorphi c characte r state s whic h migh t ti e them i n wit h other taxa . Again , further analysi s i s called for. Although th e monophyletic status , o r otherwise , of previousl y establishe d familie s ha s bee n substantiated b y th e presen t analysis , severa l problems evidentl y remain . I t woul d thu s b e premature to propose a formal reclassification here. This mus t awai t furthe r analysi s alon g th e line s discussed above . Conclusions The following points emerg e fro m th e analysis . • Diagnosti c synapomorphie s fo r the clade o f all rudists ar e possessio n o f a n oute r shel l laye r o f fibrillar prismatic calcite and external asymmetr y of the valves. • Withi n th e group , tw o clade s ar e distinguished according t o the attachment of the shell - eithe r by th e L V (all 'diceratids', excep t Diceras an d Valletta, togethe r wit h th e monophyleti c requieniids) o r by th e R V (Diceras, Valletta an d all othe r rudists) ; 'Diceratidae ' ar e thu s paraphyletic. • Monophyl y o f th e rudist s possessin g 'inverse ' dentition (tw o teeth in the LV and one in the RV)

122

P. W. SKELTO N & A . B . SMIT H

is strongl y supported , wit h Valletta a s siste r taxon, an d plausibl e ancestor , t o th e uncoile d rudists (possessing an invaginated ligament). • Th e Caprinida e (sensu stricto), Radiolitida e and Hippuritida e ar e confirme d a s mono phyletic groupings , a s ar e th e tw o caprini d subfamilies Caprinina e an d Caprinuloidina e (= Coalcomaninae). • Th e identificatio n of Agriopleura a s th e siste r taxon for the radiolitids is not a surprise, as it has long been considered a likely ancestor. However, the emergence o f Tepeyacia (a n Albian Mexican form) as the siste r taxo n for hippuritid s (albeit with wea k bootstra p support) i s intriguin g and may offe r som e insigh t into th e origin s o f thi s family o f highly modified rudists. • Th e rampantl y polyphyleti c natur e o f th e Treatise 'Caprinidae ' (sensu lato), asserte d i n earlier studies, is confirmed . • Th e 'Cinderella' taxo n of the Polyconitidae Mac Gillavry, whic h suffere d undu e neglec t i n th e widely use d Treatise classificatio n promulgate d in Dechaseau x et al. (1969) , emerge s fro m th e majority rul e tre e base d o n r e weighted characters, als o includin g th e hippuritid s a s a subclade. However , i t ha s negligibl e bootstra p support an d therefor e need s mor e detaile d testing. • Thi s analysi s mus t b e considere d onl y a s pre liminary, a s man y relationships still hav e t o b e resolved an d other s remai n onl y weakl y supported; futur e iteration s wil l requir e th e inclusion o f mor e taxa , an d more , improved , definition an d coding of characters. Collaboration an d discussio n wit h many colleagues , an d their generou s sharin g o f specimens , hav e helpe d t o sharpen thi s synthesis , an d t o the m w e expres s ou r gratitude, whil e reservin g th e blam e fo r an y remainin g shortcomings fo r ourselves. We are particularly grateful to the referees, Alexandre Chartrousse and Thomas Steuber , who wen t throug h ou r initia l submissio n wit h commendable car e (includin g al l thos e O s and I s i n th e data matrix! ) an d offere d man y valuabl e constructiv e criticisms. I t wa s als o a n enormou s pleasur e t o receiv e comments fro m Professo r Henr y Ma c Gillavry , whos e magisterial thesi s o n Cuba and rudists, published i n 1937 , is stil l a n inspiratio n fo r rudistologists . Thank s als o t o Paul Jeffery (NHM ) and Abel Prieur (UCBL) for access to specimens i n thei r car e an d Joh n Taylo r an d Andre w Lloyd a t th e Ope n University , who skillfull y carrie d ou t the electronic compositio n o f the photographic figures .

Appendix 1 : sources fo r character codin g of tax a Abbreviations fo r Collections : NHM , Natura l Histor y Museum, London ; UCBL , Universit e Claude-Bernard , Lyon, France ; UPM , Universit e d e Provence , Marseille , France. PAC Pachyrisma grande Morri s & Lycett : prepare d topotype specimen s fro m th e Bathonia n o f S W Englan d (NHM, nos 49964 and L6896). EPI Epidiceras sinistrum (Deshayes) : prepare d specimens fro m th e Middl e Oxfordia n o f Dompcevri n (Meuse), NE France (Skelto n 1978 ; NH M , LL 31920-1) , and Bayle's (1873 ) collection of prepared specimen s fro m around the Paris Basi n (numerou s specimen s i n UCBL) . MAT Matheronia salevensis Joukowsk y & Favre : Joukowsky & Favre (1913) , an d specimen s collecte d b y C. Gourra t an d D . Orbett e (Societ e de s naturaliste s d'Oyonnax) fro m th e Uppe r Kimmeridgia n o f th e southern French Jur a (Skelton 1999) . TOU Toucasia carinata (Matheron) : Paquie r (1903 ) and specimen s fro m th e Barremia n o f Orgo n (Bouches du-Rhone), SE France (NHM , L 10330 and unregistered). DIC Diceras arietinum Lamarck : a s fo r Epidiceras, also NH M specimen s no . 3391 5 ('D. originate' = D . arietinum). VAL Valletta auris Favre : Favr e & Richar d (1927 ) and topotype specimens from the Upper Kimmeridgian of Pierre Chate l (Ain), SE France (NH M , L 62220-8) . RET Retha

tulae (Felix): Skelto n & Masse (1998) .

AMP Amphitriscoelus waringi Harri s & Hodson : Chartrousse (1998« , b), als o paralectotyp e specime n figured b y Chartrousse (1998& , fig s 2-6 ; Paleontologica l Research Institute , Ithaca, USA, no. 1539) . COA Coalcomana ramosa (Boehm) : Chartrouss e (19980, b\ als o specime n figure d b y Douvill e (1900 ) (UCBL, E M 15687) . PACK Pachytraga tubiconcha (Astre) : Skelto n & Masse (1998) . PRA Praecaprina varians Paquier : Paquie r (1905) , also type specimens (UCBL) . CAP Caprina adversa d'Orbigny : Douvill e (1887 , 1888), and specimens i n NHM (no. 30378) and UCBL . MONt Monopleura taurica Pchelintsev : Yani n (1975) , also specimen s donate d t o PWS by Professor Yanin . MONv Monopleura varians Matheron: Douvill e (1918) , also his figured specimens (UCBL , EM 15681-3) , a s well as topotyp e specimen s fro m th e Upper Barremia n o f Orgon (Bouches-du-Rhone) , SE France (NH M , L 18597, unregistered '37' ; and UPM). AGR Agriopleura Kiihn : A. blumenbachi (Studer ) and A. marticensis (Matheron) : Douvill e (1918 ) an d specimens fro m th e Barremia n o f S E Franc e (NH M an d UPM). EOR Eoradiolites plicatus (Conrad) : i n Mass e & Gallo Maresca (1997) . SAU Sauvagesia

Douville : S . sharpei (Bayle) , i n

PHYLOGENY O F RUDIS T BIVALVE S Toucas (1909), and S. macroplicata (Whitfield) , in Chubb (1971). DUR Durania (1909).

cornupastoris (De s Moulins) : Touca s

OSC Osculigera Klihn : O , cf . vautrinioides Voge l (Morris & Skelton 1995) . PSAB Pseudosabinia klinghardti (Boehm) : Morri s & Skelton (1995) , a s well a s the type specimen s (NHM , L 49454-6). CHI Chiapasella Chubb (1971) .

radiolitiformis

(Trechmann)

:

HORd Horiopleura dumortieri (Matheron) : Barremian topotype specimen s figured b y Masse (1996) an d Masse et al (19980) , a s wel l a s weathered-ou t specimens , showing interna l features , fro m th e Lowe r Aptia n o f th e Lusitanian Basin , Portugal , figure d by Skelto n & Mass e (1998). HOR1 Horiopleura lamberti Douville : Douvill e (1889), also RV figured b y him (UCBL, EM 15688) , an d articulated specime n fro m Albia n o f Santander , N W Spain (NHM, no. 21253). PRAE Praecaprotina yaegashii (Yehara) : Yab e & Nagao (1926) , als o prepared topotyp e specimen s of both valves, loane d t o PW S fro m th e Tohok u Imperia l University, Sendai, Japan (nos 35442 and 66521). TEP Tepeyacia corrugata Palmer : Palme r (1928) , together wit h specimen s fro m th e Uppe r Albian-Lowe r Cenomanian uppe r par t o f th e Ma i Pas o Formation , Guerrero, SW Mexico (Pantoja-Alor & Skelton 1999) . GLO Glossomyophorus costatus Masse , Skelto n & Sliskovic: Masse et al. (1984) , an d numerous specimens observed by PWS in the Shu'aiba Formation of Arabia. HIM Himeraelites Di Stefano : H . vultur D i Stefan o (Di Stefano 1888) an d congeneric specimen s collected by J.-P. Mass e fro m th e ?Albia n o f Mont e d'Ocre , centra l Italy [illustrate d b y Mass e e t al . (19986)] , als o 'H. ugdulenae D i Stefano ' fro m Termin i Imerese , Sicily , i n the NHM (L 63120). CAPR Caprotina striata d'Orbigny : specimen s fro m the Cenomania n o f L e Mans , Franc e (NH M , L 96200 , registered as 'C. semistriata (d'Orbigny)').

123

PL APlagioptychus Matheron : P . toucasi Matheron , prepared specimen s o f bot h valve s figure d b y Chape r [(1873); copie d i n Dechaseau x (1952) ] an d Douvill e (1888) (UCBL , E M 15685 , 6) , an d P . aguilloni (d'Orbigny) fro m th e Santonia n o f S E Franc e (L a Cadiere) (NHM, unregistered, Trechmann collection) and Austria (Gosau) (NHM, no. L 30151) . DICT Dictyoptychus morgani (Douville) : Douvill e (1904), an d numerous specimens fro m th e Maastrichtian of the United Ara b Emirates an d Oman (NHM), listed i n Morris & Skelton (1995), a s well as sectioned specimen s of 'D . persica Cox ' (syn. ) fro m th e Maastrichtia n o f western Iran (Pul-I-Karah) (NHM, L 58424, L 58420) . ICH Ichthyosarcolites triangularis Desmarest : Douville (1887 ) and specimen s fro m th e Cenomania n of western France (Charente), in the NHM (nos L 63180 and 30382). ANT Antillocaprina occidentalis (Whitfield) : Chub b (1971), and specimens from th e Maastrichtian o f Jamaica (NHM, L 63211 ) an d o f Cub a (Muse o Naciona l d e Historia Natural, La Habana, Cuba). HIP Hippurites Lamarck : especiall y H . radiosus des Moulins, prepare d specimen s fro m th e uppermos t Campanian/basal Maastrichtia n o f Charente , S W Franc e in the NHM (nos L 18965, L 62199 and L 62201), a s well as specimen s of H. socialis Douville , wit h partia l preservation of aragonite, from th e Santonia n of Piolenc , SE France , collecte d b y PWS ; wit h supplementar y information o n the genus from Douvill e (1891). BAR Barrettia monilifera Woodward : Van Dommelen (1971), an d specimen s fro m th e Campania n o f Jamaic a (NHM), Cub a (Muse o Naciona l d e Histori a Natural , La Habana, Cuba) and Puerto Rico (PWS collection) . PTOR Praetorreites omanensis Philip & Platel: Phili p & Plate l (1994) , togethe r wit h a sectioned , articulate d topotype specimen from th e collection o f J. Philip . sanchezi (Douville): Douville' s (1927 ) TOR Torreites holotype (UCBL , E M 15689 ) an d Palmer' s (1933 ) specimens (Muse o Naciona l d e Histori a Natural , L a Habana, Cuba); also Jung (1970), Van Dommelen (1971 ) and specimen s of T . s. milovanovici Grubic, fro m Oman , described b y Skelton & Wright (1987).

Appendix 2: Characters CHARACTER Calcitic outer shell layer #01 Oute r shell layer of fibrillar prismatic calcite

#02 R V inner margin largely exposed beyond LV rim #03 Numerou s tightly infolded longitudina l pleats #04 Radia l canals in LV, connecting to outside via external pores and opening around inner valve margin #05 Celluloprismati c mesostructure present in RV 0 #06 Cell s of celluloprismatic mesostructure largely of polygonal pla n 0 #07 Sharpl y demarcated pai r of radial bands on postero-ventral flank s 0 of shel l #08 Internal longitudinal swellings or pillars on postero-ventral R V wall, 0 with matching indentations or oscules in LV

STATES 0, absent; 1 , thin (mostly < 1 mm); 2, thickened (» 1 mm; often > 2 mm) in large parts of one or both valves [ordered] 0, no; 1 , yes 0, no; 1 , yes 0, no; 1 , yes , no; 1 , yes , no; 1 , yes , no; 1 , yes , no; 1 , yes

124

P. W . SKELTO N & A . B . SMIT H

Appendix 2 Continued Attachment of shell #09 Attachmen t to substrate by LV #10 Attachmen t to substrate by RV

0, no; 1, yes 0, no; 1, yes

Ligament #11 Ligamen t insertio n sit e invaginate d #12 Ligamen t los t

0, no; 1, yes 0, no; 1, yes

Shell shap e #13 Valve s externally asymmetrica l #14 R V relatively muc h reduced, hence low cap-shaped t o operculiform #15 L V relatively muc h reduced, hence low cap-shaped t o operculifor m

0, no; 1, yes 0, no; 1, yes 0, no; 1, yes

Pachyodont dentition #16 Tw o teeth i n RV and one (plus one incipient) i n LV #17 On e tooth i n RV and two in LV #18 Sectio n acros s projecting central tooth of RV shows sharp anteriorward geniculation of its dorsal par t #19 Tw o teeth in LV, only, slotting into grooves insid e dorsal wal l of RV Anterior adducto r myophores #20 Myophora l shelves adjoinin g hinge plates in both valve s #21 L V myophore projecting into RV, with adductor insertion rotate d ou t to face anterior valv e wall of RV Posterior adductor myophores #22 Myophore(s ) alway s attached to hinge plates #23 L V myophore projecting into RV, with adductor insertion rotated ou t to face posterior bod y cavity wall of RV #24 L V myophore a pedunculate plate, rooted o n myocardinal platform, with flaring posterior ri m widely separated fro m posterio r valv e margin by deep ectomyophoral reces s an d with adductor insertion on its inner surface opposin g myophoral shel f or ridge in RV #25 L V myophore a massive buttress, rooted o n myocardinal platform, with raised posterior margi n separated fro m posterio r valv e rim by broad gutter, and with inwardly sloping adductor insertion on its inner face opposin g broad postero-dorsally incline d shel f in RV #26 L V myophore rooted o n posterior valv e wall at rear of myocardinal platform, wit h raised posterior margi n separated fro m posterio r valve rim by narrow gutter, and with adductor insertion rotated steepl y inwards to face erec t posterior myophora l plate in RV, which projects across into LV #27 L V myophore rooted o n posterior valv e wall at rear of myocardinal platform, separate d fro m posterio r valv e rim by narrow gutter, and projecting int o RV, with adductor insertion rotated outwards to face low myophoral shelf o n posterior R V wall, within posterior endomyophoral cavity #28 L V myophore tooth-like an d compressed, projectin g into posterio r myophoral socket i n RV, with adductor insertions on both side s Other myocardinal characters #29 Interio r myocardinal margi n between myophore s i n LV directly skirting ventral bases of both teeth #30 Larg e posterio r endomyophora l cavit y in LV, bounded internally by lamina, and separating posterior toot h and posterior myophor e fro m general cavity #31 Conica l annexe to ectomyophoral reces s penetratin g under ventral part of LV posterior myophor e Pallial canals #32 Pallia l canals regularl y develope d i n aragonitic inner shell layer s

0, no; 1, yes 0, no; 1 , yes, teeth very unequal i n LV (pt < half a t area); 2, yes, teeth equa l t o subequal in LV (pt > half at area) . 0, no; 1 , yes

0, no; 1, yes 0, no; 1, yes 0, no; 1, yes

0, no; 1, yes 0, no; 1, yes 0, no; 1 , RV myophore a flat to gently sloping shelf ; 2, RV myophore a postero-dorsally facin g ridge

0, no; 1, yes

0, no; 1, yes

0, no; 1, yes

0, no; 1, yes

0, no; 1, yes 0, no; 1, yes 0, no; 1, yes

0, no; 1 , yes, in LV only; 2 , yes, in both valves

PHYLOGENY O F RUDIS T BIVALVE S

References AL-AASM, I . S . & VEIZER , J . 1986 . Diageneti c stabilization o f aragonit e an d low-M g calcite , I . Trace element s i n rudists . Journal o f Sedimentary Petrology, 56, 138-152. BAYLE, E . 1855 . Observation s su r l a structur e de s coquilles de s Hippurites, suivie s d e quelque s remarques su r les Radiolites. Bulletin de l a Societe geologique de France, 12(2), 772-807. 1873. Observation s su r quelques espece s d u genr e Diceras. In: BAYAN , J. F . F. (ed.) Etudes faites dans la Collection de I'Ecole des Mines sur des fossiles nouveaux o u mal connus. Unpublishe d repor t deposited a t th e Ecol e d e Mine s (no w a t UCBL) , Paris. BILOTTE, M. 1985 . Le Cretace superieur des plates-formes est-pyreneenes. Strata, Series 2, 5. BOEHM, G. 1882 . (Jber die Beziehungen von Pachyrisma, Megalodon, Diceras un d Caprina. Zeitschrift de r deutschen geologischen Gesellschaft, 34 , 602-617. CARANNANTE, G. , GRAZIANO , R. , PAPPONE , G. , RUBERTI , D. & SIMONE , L . 1999 . Depositiona l syste m an d response t o se a leve l oscillation s o f th e Senonia n rudist-bearing carbonat e shelves . Example s fro m central Mediterranean areas . Fades, 40, 1-24 . CHAPER, M . 1873 . Observation s su r une espec e du genr e Plagioptychus. Etudes faites dans la Collection de I'Ecole de s Mines, 2, 82-90. CHARTROUSSE, A . 19980 . Le s Caprinidae (Rudistes) d u Cretace inferieur. Thes e d e Doctorat, Universit e de Provence - Centr e d e Sedimentologi e e t Paleontologie, Marseille . 1998&. Th e myocardina l organizatio n o f coalcomaninid rudist s revisited . In: MASSE , J.-P . & SKELTON, P . W . (eds ) Quatrieme Congres international su r le s Rudistes. Geobios , Memoir e special, 22, 75-85. CHUBB, L . J . 1971 . Rudist s o f Jamaica . Palaeontographica americana, 7/45, 157-257 . COOGAN, A . H . 1973 . Ne w rudist s fro m th e Albia n an d Cenomanian of Mexico and south Texas. Revista del Instituto mexicano del Petroleo, 5, 51-83. DECHASEAUX, C . 1952 . Class e de s lamellibranches . In : PIVETEAU, J . (ed. ) Traite d e paleontologie, Vol. 2. Masson, Paris, 220-364. , Cox, L . R., COOGAN, A . H. & PERKINS, B. F. 1969 . Superfamily Hippuritace a Gray , 1848 . In : MOORE , R. C . (ed. ) Treatise o n Invertebrate Paleontology, Part N, Mollusca 6, Bivalvia, 2. Geological Societ y of America, Boulder, CO, and University of Kansas, Lawrence, KS, N749-N817. DESHAYES, G . P . 1825 . Quelque s observation s su r le s genres Hippurite et Radiolite. Annales de s Sciences naturelles,5(l\2Q5-2U. DOUVILLE, H. 1886 . Essai sur la morphologic des rudistes. Bulletin de l a Societe geologique de France, 14(3), 389^04. 1887. Sur quelques formes peu connues de la famille des chamides . Bulletin de l a Societe geologique de France, 15(3), 756-802. 1888. Etudes sur les caprines. Bulletin de la Societe geologique de France, 16(3), 699-730. 1889. Su r quelque s rudiste s d u terrai n cretac e

125

inferieur de s Pyrenees . Bulletin d e l a Societe geologique de France, 17(3), 627-635. 1891. Etude s su r le s rudistes . Revisio n de s principales espece s d'Hippurites . Memoires d e l a Societe geologique de France, Paleontologie, 6(1) , 1-31. 1896. Observation s su r l a charnier e de s lamellibranches heterodontes. Bulletin de l a Societe geologique de France, 24(3), 26-28. 1900. Sur quelques rudistes americains. Bulletin de la Societe geologique de France, 28(3), 205-221. 1904. Sur quelques rudistes a canaux. Bulletin de la Societe geologique de France, 4(4), 519-538. 1915. Les requienides et leur evolution. Bulletin de la Societe geologique de France, 14(4), 383-389. 1918. Le Barremien superieur de Brouzet. 3e partie, les rudistes . Memoires de l a Societe geologique d e France, Paleontologie, 52. 1927. Nouveau x rudiste s d u Cretac e d e Cuba . Bulletin d e l a Societe geologique d e France, 7(4) , 49-56. 1935. Le s rudiste s e t leu r evolution . Bulletin d e l a Societe geologique de France, 5(5), 319-358 . FAVRE, J . & RICHARD , A . 1927 . Etud e d u Jurassiqu e superieur de Pierre-Chatel et de la cluse de la Balme (Jura meridional) . Memoires d e l a Societe paleontologique suisse, 46, 1-39 . FISCHER, P . 1887 . Manuel d e conchyliologie e t d e paleontologie conchy liologique ou histoire naturelle des mollusques vivants et fossiles. F . Savy, Paris. FORTEY, R . A . & JEFFERIES , R . P . S . 1982 . Fossil s an d phylogeny - a compromise approach. In: JOYSEY, K. A. & FRIDAY , A. E . (eds ) Problems of Phylogenetic Reconstruction. Systematic s Associatio n Specia l Volume No . 21 , Academi c Press , London , 197-234. GILI, E., MASSE , J.-P . & SKELTON , P. W. 1995 . Rudists as gregarious sediment-dwellers , no t reef-builders, on Cretaceous carbonat e platforms . Palaeogeography, Palaeoclimatology, Palaeoecology, 118 , 245-267. GRAY, J. E. 1848 . On the arrangement of the Brachiopoda . Annals an d Magazine o f Natural History, 2(2) , 435-440. JOUKOWSKY, E . & FAVRE , J . 1913 . Monographi c geologique e t paleontologiqu e d u Salev e (Haut e Savoie, France) . Memoires d e l a Societe d e Physique e t d'Histoire naturelle d e Geneve, 37 , 295-519. JUNG, P . 1970 . Torreites sanchezi (Douville ) fro m Jamaica. Palaeontographica americana, 7/42 , 1-15. KENNEDY, W. J., MORRIS, N. J. & TAYLOR, J. D. 1970 . Th e shell structure , mineralogy an d relationship s o f th e Chamacea (Bivalvia) . Palaeontology, 13, 379-413. LAMARCK, J . B . D E 1819. Histoire naturelle des animaux sans vertebres. Volume 6 (1). Verdiere , Paris , 230-240. MAC GILLAVRY , H . J . 1935 . Remark s o n rudists . Koninklijke Akademie van Wetenschappen te Amsterdam, Proceedings of the Section of Sciences, 38, 558-565. 1937. Geology o f the province o f Camagiiey, Cuba,

126

P. W. SKELTO N & A . B . SMITH

with revisiona l studie s i n rudis t paleontology . Geographische en Geologische Mededeelingen, Physiographisch-Geologische reeks, 14. 1970. Geologica l histor y o f th e Caribbean , 1 . Koninkl. Nederl. Akademie van Wetenschappen, Proceedings B73(l), 64-83. MASSE, J.-P . 1994 . L'evolutio n de s Requieniida e (rudistes) d u Cretac e inferieur : caracteres , signification fonctionell e adaptiv e et relations ave c les modification s de s paleoenvironnements . Geobios, 27, 321-333. 1996. Lowe r Cretaceou s rudis t biostratigraph y o f southern Franc e - a referenc e fo r Mesogea n correlations. In : ALENCASTER , G . & BUITRON SANCHEZ, B. E. (eds) Numero dedicado a la Tercera Conferencia International sobre rudistas. Revist a Mexicana d e Ciencias Geologicas , 12, 236-256. & GALL O MARESCA , M . 1997 . Lat e Aptia n Radiolitidae (rudis t bivalves ) fro m th e Mediter ranean an d southwes t Asiati c regions : taxonomic , biostratigraphic an d palaeobiogeographi c aspects . Palaeogeography, Palaeoclimatology, Palaeoecology, 128, 101-110 . & PHILIP, J. 1974 . Definition, position systematique, repartition stratigraphiqu e e t evolutio n d u genr e Agriopleura Kiih n (rudiste) . Geologic mediterraneenne, 1, 53-62. & 1986 . L'evolution des rudistes au regard des principaux evenement s geologique s d u Cretace . Bulletin des Centres de Recherches ExplorationProduction Elf-Aquitaine, 10 , 437-456. , ARIAS , C . & VILAS , L . 19980 . Lowe r Cretaceou s rudist fauna s o f southeas t Spain : a n overview . In : MASSE, J.-P . & SKELTON , P . W . (eds ) Quatrieme Congres international su r le s Rudistes. Geobios , Memoire special, 22, 193-210 . , GALL O MARESCA , M . & LUPERT O SINNI, E . 1998& . Albian rudis t fauna s fro m souther n Italy : taxonomic, biostratigraphi c an d palaeobiogeo graphic aspects. Geobios, 31, 47-59. , SKELTON , P . W . & SLISKOVIC , T . 1984 . Glossomyophorus costatus nov . gen . nov . sp. , rudiste (Caprotinidae ) nouvea u d e 1'Aptie n d u domaine mediterraneen central et oriental. Geobios, 17, 723-732. MORRIS, N . J . & SKELTON , P. W. 1995 . Late Campanian Maastrichtian rudist s fro m th e Unite d Ara b Emirates-Oman borde r region. Bulletin o f th e British Museum (Natural History), Geology Series, 51, 277-305. MUNIER CHALMAS , H . 1873 . Prodrom e d'un e classification de s rudistes . Journal d e Conchyliologie, 13(3), 71-75. 1882.1. Etudes critiques su r les rudistes. Bulletin de la Societe geologique de France, 10(3), 472-482 . NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum of Natural History, Novitates, 2206. PALMER, R . H . 1928 . The rudistid s o f souther n Mexico . Occasional Papers of the California Academy of Sciences, 14. 1933. Nuevo s rudista s d e Cuba . Revista d e Agricultura, Comercio y Trabajo, 14 , 95-125. PANTOJA-ALOR, J . & SKELTON , P. W . 1999 . Polyconitid

rudists fro m th e Ma i Pas o Formatio n (Albian Lower Cenomanian) around Chumbitaro, Guerrero , SW Mexico . In: HOFLING , R . & STEUBER , T . (eds) Fifth Internationa l Congres s o n Rudists - Abstract s and Fiel d Tri p Guides . Erlanger Geologische Abhandlungen, Sonderaband , 3, 45-47. PAQUIER, V. 1903. Les rudistes urgoniens. Premiere partie . Memoires de la Societe geologique de France, Paleontologie, 29(11) , 1^6 . 1905. Le s rudiste s urgoniens . II . Seri e inverse . Memoires de la Societe geologique de France, Paleontologie, 29(13) , 47-102. PHILIP, J . 1986 . Etude paleontologiqu e d u genr e Sabinia (rudiste a canaux ) de s recif s d u Campanie n d e Tunisie. Geobios, 19, 247-251. 1998. Biostratigraphi e e t paleobiogeographi e de s rudistes: evolutio n de s concepts e t progres recents. Bulletin d e l a Societe geologique d e France, 169 , 689-708. & PLATEL , J.-P. 1994. Praetorreites, nouvea u genr e de rudist e d u Campanie n d'Oman . Geobios, 27 , 303-319. , MASSE , J.-P . & CAMOIN , G . 1995 . Tethya n carbonate platforms. In: NAIRN, A. E. M. ETAL. (eds) The Ocean Basins and Margins, Vol. 8: The Tethys Ocean. Plenum Press, New York, 239-265. QUENSTEDT, F. A. 1852 . Handbuch de r Petrefaktenkunde. Laupp & Siebeck, Tubingen. RIDE, W . D. L., ETAL. (eds) . 1999 . International Trust fo r Zoological Nomenclature, Fourt h edition . International Trus t fo r Zoologica l Nomenclature , C/O The Natural History Museum , London, UK . Ross, D. J. & SKELTON , P. W. 1993 . Rudis t formations of the Cretaceous : a palaeoecological , sedimento logical an d stratigraphica l review . In : WRIGHT , P . (ed.) Sedimentology Review, 1 . Blackwel l Scientific, Oxford , 73-91. SIMONPIETRI, G . 1999 . Systematique, phylogenese, ontogenese chez les Hippuritidae (rudistes de Cretace superieur). Thes e d e Doctoral , Universit e de Provenc e - Centr e d e Sedimentologi e e t Paleontologie, Marseille. SKELTON, P . W . 1976 . Functiona l morpholog y o f th e Hippuritidae. Lethaia, 9, 83-100. 1978. The evolutio n o f functional desig n i n rudist s (Hippuritacea) an d it s taxonomi c implications . Philosophical Transactions of the Royal Society of London, Series B, 284, 305-318. 1979. Preserve d ligamen t i n a radioliti d rudis t bivalve and its implication of mantle margin feeding in the group. Paleobiology, 5 , 90-106. 1985. Preadaptation an d evolutionary innovation in rudist bivalves. In: COPE , J . C. W. & SKELTON , P. W. (eds) Evolutionary Case Histories from th e Fossil Record. Specia l Paper s i n Palaeontology , 33 , 159-173. 1991. Morphogenetic versus environmental cue s for adaptive radiations . In : SCHMIDT-KITTLER , N . & VOGEL, K . (eds ) Constructional Morphology an d Evolution. Springer , Berlin, 375-388. 1999. Synopti c guid e t o Kimmeridgia n rudist s fo r the Kelhei m field visit. In: HOFLING , R . & STEUBER, T. (eds) Fifth International Congress on Rudists Abstracts an d Field Trip Guides. Erlange r

PHYLOGENY O F RUDIST BIVALVES Geologische Abhandlungen , Sonderaband , 3 , 83-89. & BENTON , M . J . 1993 . Mollusca : Rostroconchia , Scaphopoda an d Bivalvia . In : BENTON , M . J . (ed. ) The Fossil Record 2 . Chapma n & Hall , London , 237-263. & MASSE , J.-P . 1998 . Revisio n o f th e Lowe r Cretaceous rudis t gener a Pachytraga Paquie r an d Retha Cox (Bivalvia: Hippuritacea) , an d the origin s of the Caprinidae. In: MASSE , J.-P . & SKELTON, P. W. (eds) Quatrieme Congres International su r les Rudistes. Geobios, Memoir e special, 22 , 331-370. & 2000 . Synoptic guid e t o Lower Cretaceou s rudist bivalve s o f Arabia . In: SCOTT , R . W . & ALSHARHAN, A . (eds ) Middl e Eas t Model s o f Jurassic/Cretaceous Carbonat e Systems . SEPM Special Volume, 69, 85-95. & WRIGHT, V. P. 1987. A Caribbean rudis t bivalve i n Oman: island hopping acros s the Pacific i n the lat e Cretaceous. Palaeontology, 30, 505-529. SMITH, A . B. 1994 . Systematics and the Fossil Record Documenting Evolutionary Patterns. Blackwel l Scientific, Oxford. STEFANO, G . D. 1888 . Stud i stratigrafic i e paleontologic i sul sistem a Cretace o dell a Sicilia . 1 . Gl i strat i co n Caprotina d i Termini-Imerese. Att i dell a Real e Accademia d i Scienze , Letter e e Bell e Arti , (n.s. ) 10, 1-44 . STEUBER, T. 1999a. Cretaceous rudists of Boeotia, centra l Greece. Special Papers in Palaeontology, 61. 1999/7. Databas e o n rudis t palaeontology . Website: http://www.geol.uni-erlangen.de/pal / Steuber/index.htm

127

STONE, J . R . & TELFORD , M . 1999 . Usin g critica l pat h method t o analys e th e radiation o f rudist bivalves . Palaeontology, 42, 231-242. SWOFFORD, D . L . 1998 . PAt/P* . Phylogenetic Analysis Using Parsimony (*and other methods). Version 4. Software diskette . Sinaue r Associates , Sunderland , MA. TOUCAS, A . 1907 . Etude s su r l a classificatio n e t 1'evolution de s Radiolitides : Agria & Praeradiolites. Memoires de la Societe geologique de France, Paleontologie, 14(36), 1-46. 1909. Etudes su r la classification e t revolution des Radiolitides: Sauvagesia & Biradiolites. Memoires de la Societe geologique de France, Paleontologie, 17(36), 79-132. VAN DOMMELEN , H . 1971 . Ontogenetic, phylogenetic an d taxonomic studies of the American species of Pseudovaccinites an d o/Torreites and the multiplefold hippuritids. Thesis , Universit y of Amsterdam. VICENS, E . 1992 . Intraspecifi c variabilit y i n Hippuritida e in th e souther n Pyrenees , Spain : Taxonomi c implications. Geologica romana, 28, 119-161. WOODWARD, S . P. 1855. O n th e structur e and affinitie s o f the Hippuritidae . Quarterly Journal o f th e Geological Society o f London, 11 , 40-61. YABE, H . & NAGAO , T . 1926 . Praecaprotina, nov.gen. , from th e Lowe r Cretaceou s o f Japan . Science Reports o f th e Tohoku University, 9(2) , 21-24. YANIN, B . T . 1975 . Epibiosis an d immuratio n amon g th e rudists (Monopleura). Paleontologicheskij Sbornik, 12, 72-76 . ZITTEL, K . A . 1885 . Handbuch de r Palaeozoologie. II . Mollusca un d Arthropoda. Oldenbourg, Munchen .

This page intentionally left blank

Relationships between the extant Anomalodesmata: a cladistic test ELIZABETH M. HARPER1, ELIZABETH A. HIDE2 & BRIAN MORTON3 1 Department of Earth Sciences, Downing Street, Cambridge CB2 3EQ, UK (e-mail: emh21@ cus.cam.ac.uk) 2 Department of Geology and Zoology, National Museums of Scotland, Edinburgh EH1 1JF, UK Present address: Department of Earth Sciences, Downing Street, Cambridge CB2 3EQ, UK 3 The Swire Institute of Marine Science and Department of Ecology and Biodiversity, The University of Hong Kong, Hong Kong Abstract: Althoug h ancien t anomalodesmatan s wer e apparentl y abundan t shallo w an d dee p burrowers, in Recent seas the subclass comprises some of the most specialized and rarest of all bivalves. Th e morphologica l adaptation s associate d wit h divers e lif e habit s ha s persistentl y frustrated attempt s t o achiev e a widel y accepte d schem e fo r th e relationship s betwee n extan t families. A cladistic analysis, using 43 informative anatomica l and shell characters for each of the extant anomalodesmatan families has produced a single, reasonably robust tree which is in broad, albeit imperfect, agreement with the known fossi l recor d of the subclass. This total evidence tree places the Pandoridae , Lyonsiidae , Cleidothaerida e an d Myochamidae , an d als o th e Thraciidae , Periplomatidae and Laternulidae in monophyletic groups. Carnivor y appear s diphyletic , with the Parilimyidae separate d fro m th e 'septibranch ' familie s (Cuspidariidae , Verticordiidae , Lyonsiellidae and Poromyidae) which form a monophyletic group. The enigmatic tube-dwelling Clavagellidae appear as a sister group to the 'septibranchs' . Re-analysis of the data matrix using onl y thos e 1 8 characters which could be scored from shell characters alone, produced a tree which contradicted the total evidence tree rather than producing a poorly resolved version. The degree of convergence shown b y shell characters make it, at least at present, difficult t o include the extinct anomalodesmatan families i n a cladistic analysis.

Nearly one-sixth of all bivalve families which ever restricte d geographi c ranges . Although they occu r lived are placed in the Anomalodesmata Dall, 1899. i n a wid e rang e o f habitat s fro m shallo w coasta l The earlies t recognize d anomalodesmatan , water s to the deep sea , th e niches o f many ar e so Arenigomya carinata Cope, is of Lower Ordovician highl y specialized , e.g . pholadomyids, parilimyid s (Lower Arenig ) ag e (Cop e 1996a) , an d fro m tha t an d clavagellids, tha t they ar e among the rarest of time onward s member s o f th e subclas s ar e al l know n bivalves . Virtuall y ever y lif e habi t abundant i n Palaeozoi c an d Mesozoi c shallow - exploite d b y an y bivalv e ha s bee n evolve d b y marine facies the world over. Then, the y occupied anomalodesmatans : shallo w and deep burrowing in predominantly shallo w an d deep-burrowin g lif e sof t sediment s (Pholadomyidae , Pandoridae , habits, bu t als o ha d endobyssat e representative s Thraciidae , Laternulida e an d Periplomatidae), an d (Bambach 1971 ; Runnega r 1974) . Durin g th e attachmen t to hard surfaces either by byssal threads Cenozoic, ther e was a marked proliferation i n both (Lyonsiidae ) o r b y permanen t cementatio n the numbe r o f recognize d anomalodesmata n (Cleidothaerida e an d som e Myochamidae) . The y families an d th e numbe r o f lif e habit s exploite d als o includ e deep-se a predator s an d scavenger s (Skelton e t al. 1990 , fig . 5.2) bu t there wa s als o a (Parilimyidae , Verticordiidae , Cuspidariida e an d concomitant decline in their abundance, many taxa Poromyidae ) an d th e enigmati c tube-dwellin g being highl y restricte d i n thei r distributions . Clavagellidae , som e o f whic h hav e th e abilit y Morton (1985a ) attributed thi s declin e t o a failure t o bor e int o har d substrata . Th e variou s to compete with more generalist heterodonts. adaptation s that attend this range of life habit s has There are currently 14 recognized extan t families produce d withi n th e anomalodesmatan s suc h of anomalodesmatan s (Tabl e 1) , mos t o f whic h differen t morphologie s tha t they hav e confounde d comprise fe w gener a an d man y occu r withi n previou s attempt s t o analys e thei r phylogeneti c From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology o f th e Bivalvia. Geological Society, London, Specia l Publications, 177 , 129-143 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

130

E. M . HARPE R E T AL.

Table 1. List of the extant familieso f Anomalodesmata and the representative taxa scored in this cladistic analysis along with the principal study utilized Family

Representative taxa

Prime references

Clavagellidae Clavagella australis Sowerby, 1830 * Brechites vaginiferus (Lamarck , 1818 )

Morton (1984a) Morton (1984/7 )

Cleidothaeridae Cleidothaerus

Morton (1974)

maorianus Finlay, 1827* t

Cuspidariidae Cuspidaria

cuspidata (Olivi , 1792)* t

Yonge & Morton (1980), Morton (1987)

Laternulidae Laternula

truncata (Lamarck, 1818) *

Morton (1973)

Lyonsiellidae Lyonsiella

formosa (Jeffreys , 1881) *

Morton (1984c)

Lyonsiidae Entodesma

saxicola Baird, 183 6

Yonge (1952), Morgan & Allen (1976)

Myochamidae Myadora striata (Quoy & Gaimard, 1835 ) Myochama anomioides Stutchbury , 1830* f

Morton (1977) Harper & Morton (2000)

Pandoridae Pandora

Allen (1954) Morton (1984rf )

inaequivalvis (Linnaeus, 1789)* f Frenamya ceylanica Sowerby , 183 5

Parilimyidae Parilimya

fragilis (Grieg , 1920) *

Morton 198 2

Periplomatidae Periploma

angasi Crosse & Fischer, 1864 *

Morton (1981/?)

Pholadomyidae Pholadomya Poromyidae Poromya

Morton (1980)

Candida Sowerby , 1823* t granulata (Nyst & Westendorp, 1839)* t

Thraciidae Trigonothracia

jinxingae Xu, 198 0

Verticordiidae Verticordia

triangularis Locard, 1898 *

Yonge (1928), Yonge &Morton (1980) Morton (1995) Allen & Turner (1974), Morton (1987)

Character 37 was also scored with reference to Morton (1985&) . *, Representatives of the type genus; t, typ e species; $, Morton (1974) considers that Cleidothaerus maorianus may be a synonym of the type species C. albidus (Lamarck , 1819).

interrelationships. I t i s likel y tha t thes e problem s are exacerbate d b y convergen t an d paralle l evolution, where lifestyles such as deep burrowing, cementing an d eve n predatio n appear t o hav e arisen independentl y i n a numbe r o f differen t anomalodesmatan taxa . A s a result , ther e ar e a plethora o f differen t model s t o describ e evolutio n within th e subclass . Difficultie s i n relatin g th e extant anomalodesmatan familie s to each other and to thei r Palaeozoi c an d Mesozoi c precursor s le d Morton (198la, p. 53) to regard them as 'the widely spaced outermost twigs of a tree, the roots of which have lon g sinc e perishe d ...' . A mor e reliabl e phylogeny o f th e Anomalodesmat a i s crucia l t o enable bette r understandin g o f th e natur e o f morphological evolutio n in the subclass, and would form a necessar y phylogeneti c basi s fo r a classification o f bot h fossi l an d moder n representatives o f the group. There ar e tw o avenue s o f researc h whic h ma y illuminate th e relationship s betwee n th e extan t anomalodesmatans: a molecula r phylogen y an d a cladistic stud y o f thei r morphologica l characters . Many o f the key anomalodesmata n taxa, however, are extremel y rare , fo r example , th e anatomica l studies o n Parilimya fragilis (Morto n 1982 ) wer e

carried ou t on a specimen collected i n 1910 , whilst the specime n o f Pholadomya Candida (th e sol e species o f the ancien t Pholadomyidae) , studie d b y both Runnega r (1979 ) an d Morto n (1980) , wa s collected i n 1838 . Althoug h ther e hav e bee n detailed anatomica l studie s o f at least on e membe r of eac h o f th e families , thi s scarcit y o f materia l precludes an y realisti c chanc e o f surveyin g th e molecular phylogen y o f th e subclas s compre hensively, a t leas t a t present . I n an y case , an y molecular stud y shoul d no t b e considere d i n isolation, bu t in conjunction with a comprehensiv e morphological study . In this paper the first cladisti c analyses o f th e subclas s i s presente d an d consideration i s give n t o th e possibilit y o f extending i t to cover extinct families .

Use of cladistics in reconstructing bivalve phylogenies Cladistic method s o f phylogeneti c reconstructio n use th e recognitio n o f shared , derive d character s (i.e. synapomorphies) to construct trees using these evolutionary innovation s t o suppor t clades . Approaches o f thi s typ e will , b y definition , wor k

RELATIONSHIPS BETWEE N TH E EXTAN T ANOMALODESMAT A

perfectly whe n all characters impl y the sam e tree, although experienc e show s tha t thi s i s rarel y th e case and evolutionary innovations can and do occur more tha n onc e durin g th e evolutio n o f a clade , with the result that different character s may imply different trees . Becaus e o f thes e characte r incompatibilities, i t i s necessar y t o invok e th e criterion o f parsimon y t o choos e betwee n competing hypothese s o f relationships. A data se t in whic h ther e i s eithe r littl e o r n o convergen t character stat e chang e wil l produc e a well supported cladogram ; conversely , on e i n whic h many evolutionar y reversal s an d paralle l change s occur will be poorly supported. Underlying the cladistic method, therefore, is the assumption tha t th e majorit y o f evolutionar y change is divergent. It is unlikely that this is true for either th e bivalve s a s a whol e o r th e Ano malodesmata i n particular . Yong e (1962) , fo r example, suggeste d that the adult byssus has been evolved repeatedl y amon g th e Bivalvia . Never theless, th e use o f cladistic methodolog y allow s a re-examination o f characters of al l types in a way which is consistent acros s thei r range . Although it is recognized that a cladistic dat a set can never be wholly objective , ther e ar e definit e advantage s in working wit h a wider ranging morphological dat a set compared to those studies which dwell on either one or a few characters, such as gills (Atkins 1936), stomach (Purcho n 1987a ) an d hing e structure s (Dall 1889 ; Douvill e 1913 ) o r a combinatio n o f these (Nevesskaya et al 1971) . Use of either single or restricte d character s i n phylogeneti c reconstructions makes the a priori assumptio n that the evolutio n o f tha t characte r ha s show n n o convergence. Purchon (1978, l9Slb) did recognize the importanc e o f considerin g multipl e character s in establishin g a classificatio n fo r th e Bivalvia , however, h e adopte d a pheneti c approac h which lacks an evolutionary basis. Cladistic studie s have been attempte d fo r bot h the highe r classificatio n o f the Mollusc a (Salvini Plawen & Steine r 1996 ) an d fo r intraclas s phylogenies; e.g . the y hav e bee n widel y use d within the gastropods (Taylor et al 1993 ; Hickman 1996) an d hav e bee n use d fo r th e scaphopod s (Steiner 1998) . However , ther e ar e fe w rigorou s computer-driven cladisti c studie s for th e Bivalvia. Most suc h studies concentrated o n relatively smal l taxonomic units, e.g. Cardioide a (Schneide r 1992 , 1995, 1998 ) an d th e Galeommatida e (Biele r & Mikkelsen 1992) . An early cladistic analysis of the anomalodesmatan Pandoroidea wa s undertaken by Boss (1978) but it was not supported by a character matrix, no r wa s i t possibl e a t tha t tim e t o us e computer-driven method s t o searc h fo r th e mos t parsimonious tree . Thu s far , th e onl y analyse s which have tackled highe r bivalve taxa have been

131

confined t o the Pteriomorph a (Walle r 1978 , 1998 ) and these also have lacked supporting information. At least part of this reluctance to embrace cladistic methodology ha s bee n summe d u p b y Seilache r (1984, p. 235), who suggested that convergence and parallelism ar e so common amongst the Bivalvia as to mak e th e techniqu e o f limite d use . Schneide r (1995), however, has countered this by pointing out that instea d o f maskin g relationship s a prope r multicharacter analysi s migh t revea l hithert o unnoticed polyphyleti c traits , a poin t wit h whic h the present authors concur. Certainly, bivalves seem to b e promisin g candidate s fo r cladisti c analysis , having a wid e range of definabl e shel l an d tissu e characters an d a n excellen t fossi l record , whic h exceeds th e leve l o f completenes s suggeste d b y Fortey & Jefferies (1982) , which would be useful in the recognitio n o f ancestra l state s an d i n discriminating betwee n variou s tree s (Harpe r 1998). The presen t authors ' decisio n t o undertak e a cladistic analysi s o f th e Anomalodesmat a form s part o f a wide r stud y o f th e evolutio n o f thi s enigmatic subclass. It has the advantage that one of us (BM ) ha s undertake n anatomica l studie s o f members of every living anomalodesmatan family , thus providin g a wealt h o f potentiall y usefu l phylogenetic informatio n an d als o a vita l consistency o f approac h t o th e recognitio n an d scoring o f characters . Morton' s origina l obser vations hav e bee n extende d t o includ e character s which relate to gross shell morphology and detailed microstructure. Although thi s stud y concentrate s o n th e extant anomalodesmatans, i t i s hope d tha t eventuall y extinct familie s ca n b e include d i n a n overal l phylogeny. T o thi s end , th e phylogeneti c infor mation o f a dat a se t whic h contain s onl y shel l characters i s specificall y compare d wit h a mor e comprehensive morphologica l dat a set . Thre e particular area s o f anomalodesmata n relationships have been identified to focus on, which are outlined below.

Relationships of the Pandoroidea In the Treatise, Kee n (i n Moore 1969 ) recognize d the Pandoroide a a s encompassin g th e extan t Pandoridae, Cleidothaeridae , Laternulidae , Lyonsiidae, Myochamidae , Periplomatida e an d Thraciidae [a s wel l a s th e extinc t Margaritidae , although Runnega r (1974 ) suggeste d thi s famil y belonged t o th e Pholadomyoidea] . Runnega r (1974) als o include d the Verticordiida e within the Pandoroidea, an d suggeste d tha t th e Cleido thaeridae were derived from them. Boss (1978) and Yonge & Morton (1980) , however , suggested , o n the basis o f hinge detail, that these familie s coul d

132

E. M . HARPE R E T AL.

be spli t int o tw o superfamilies ; th e Pandoroide a (Pandoridae, Cleidothaeridae , Lyonsiida e an d Myochamidae) an d the Thracioide a (Laternulidae , Periplomatidae an d Thraciidae). Furthermore , the y pointed ou t that suc h a division wa s supporte d b y the fossi l record . On e o f th e specifi c aim s o f thi s study, therefore, was to test the separation o f these two superfamilie s an d t o conside r th e positio n o f the Verticordiida e i n relatio n t o bot h o f them . Nevertheless, th e Treatise (Moor e 1969 ) classifi cation o f thes e tax a ha s bee n retaine d b y som e recent classifications (Amle r 1999). Relationships of the Clavagellidae to other anomalodesmatans Representatives o f the tube-dwelling Clavagellida e are som e o f th e mos t enigmati c bivalves . Tw o lineages hav e bee n define d (Savazz i 1982 ) base d on two extant genera, i.e. Clavagella (CretaceousRecent), whic h ar e facultative an d obligate borer s with thei r lef t valve s attache d t o th e adventitious tube, an d th e geologicall y younge r Brechites (Oligocene-Recent), whic h ha s bot h valve s incorporated int o it s tub e an d lack s th e abilit y t o bore. The relationships between these two taxa and other anomalodesmatan s ar e ope n t o considerabl e debate, havin g bee n place d consistentl y i n thei r own superfamily , th e Clavagelloide a withi n th e Pholadomyoida (Kee n & Smit h i n Moor e 1969 ; Runnegar 1974) . Som e author s sugges t a n origi n amongst the deep-burrowing Pholadomyoidea, e.g . Carter (1978) points to the Pandoroidea an d Morton (1984a, £>) , mor e specifically , t o th e Laternulidae , whilst Morto n (19810 ) an d Pojet a & Soh l (1987 ) consider th e Pholadomyida e t o b e putativ e ancestors. In contrast, Savazzi (1982) has suggested an endolithi c origin , arguin g tha t the borin g Clavagella i s the more primitive o f the two extant genera. Mos t recently , Savazz i (1999 ) ha s introduced th e possibilit y tha t Clavagella an d Brechites might exhibit parallel evolutio n and need not necessarily be closely related . Relationships of the carnivorous anomalodesmatans Carnivory has been recognized for some time in the deep-water Cuspidariidae , Poromyida e an d Verticordiidae whic h ar e know n t o inges t smal l arthropods and polychaetes (Pelseneer 1891; Yonge 1928; Knudse n 1970 ; Morto n 1987) . Th e actua l mechanism of prey capture has only been observed in the cuspidariids b y Reid & Reid (1974) and Reid & Crosb y (1980) . Th e carnivorous tax a shar e a number of morphological adaptation s t o this habit, including possessio n o f a n eversibl e raptoria l

inhalant siphon , a modified stomac h an d reductio n of th e gill , an d hav e ofte n bee n groupe d accordingly wit h variou s degree s o f formalit y a s the septibranch s (Knudse n 1970 ; Bernar d 1974 , 1979). More recently, Morton (1982) has suggeste d that specie s o f th e Parilimyida e ma y als o b e carnivores, becaus e o f thei r possessio n o f taenoi d muscles, a type-II stomach an d a modified siphon , and argue d tha t th e famil y ma y hav e bee n th e ancestral grou p o f th e othe r bette r know n septibranchs. Of al l th e problem s wit h anomalodesmata n relationships, i t i s thos e o f th e carnivorou s tax a which hav e bee n debate d most . Numerou s conflicting model s hav e bee n pu t forwar d t o explain th e relationship s betwee n thes e tax a an d other anomalodesmatan taxa. Figure 1 depicts these various hypotheses a s a series of trees. In essence , the hypotheses can be divided into two groups: (1) those whic h vie w th e carnivorou s tax a a s a monophyletic group , albei t wit h differen t relation ships withi n it (hypothese s A-D) ; (2 ) those whic h propose a t leas t a diphyleti c arrangement , eve n deriving som e o f th e carnivorou s group s fro m outside th e Anomalodesmata (hypothese s E-H) . I t should b e note d that some author s (Bernard 1979 ; Morton 1987 ) regar d th e verticordii d gener a Lyonsiella, Laevicardia and Policordia as members of a separat e family , th e Lyonsiellidae , whic h is , necessarily, the sister group of the Verticordiidae .

Materials and methods Sixteen tax a hav e bee n include d i n th e presen t analysis (Tabl e 1) , with on e specie s fro m eac h o f the currentl y recognize d familie s o f extan t Anomalodesmata. Ther e ha s bee n som e debat e about th e desirabilit y o f usin g suc h a n exempla r approach a s oppose d t o usin g th e ground-pla n approach (summarizin g the conditions found i n all supraspecific unit s i n a highe r taxon ) (Yeate s 1995). However , th e forme r i s th e onl y optio n available i n this study because i n the vast majority of case s th e taxo n used is th e onl y member o f th e family eve r to have been studie d i n adequate detai l for thi s analysis. As indicated i n Table 1 , the taxon used in the cladistic analysi s was a representative o f the typ e genu s and , mos t often , th e typ e specie s itself. Two species (Brechites an d Clavagella) from the Clavagellida e wer e include d an d thes e wer e scored separatel y s o a s t o tes t th e relationship s between them . Similarly, fo r the Myochamidae th e two gener a Myochama an d Myadora wer e treate d separately s o a s t o includ e tw o tax a displayin g different lif e habits , i.e. cementin g an d burrowing. Only the Pandoridae wa s scored a s a supraspecifi c taxon (combinin g informatio n fro m Pandora an d

RELATIONSHIPS BETWEE N TH E EXTANT ANOMALODESMATA 13

3

Fig. 1 . Summary o f the different hypotheses whic h hav e bee n suggested for the relationships of the carnivorou s families o f the Anomalodesmata . P , Poromyidae; C , Cuspidariidae; V, Verticordiidae; L, Lyonsiellidae; Pr , Parilimyidae; Pan, Pandoridae .

Frenamya) becaus e o f th e lac k o f a ver y detaile d study of either taxa. Forty-three character s wer e selecte d a s bein g potentially cladistically informative and all of these have discrete , non-continuou s character states , i n contrast to those employed by Schneider (1992 ) of which several wer e continuous. The characters an d character state s use d in this analysis ar e defined in Appendix 1 : the majorit y o f these character s hav e been discusse d b y Morto n (19850) . Character s were score d fro m eithe r previousl y publishe d descriptions (se e Tabl e 1 ) or, where the dat a were either missin g o r ambiguous , wer e investigate d specifically fo r this study. The resultant data matrix is given in Appendix 2. It was deliberatel y chose n not t o defin e an y Dollo , i.e . non-reversibl e characters, because of potential unreliability of this, e.g. the fourth pallia l apertur e seems , at first sight , to be a distinctive anomalodesmata n characte r bu t is know n t o als o occu r i n th e Mactrida e (Yong e 1948) an d Solenidae (Yong e 1952) . The choic e o f a meaningfu l outgrou p wa s complicated b y a lack of consensus concernin g th e relationships betwee n th e Anomalodesmat a an d other bivalv e taxa ; Morto n (1996 ) place s th e Myoida a s a siste r grou p to th e Anomalodesmata , whilst Cop e (19966 ) ha s suggeste d tha t the y ma y

have evolved from a palaeoheterodont ancestor. At this stage in the understanding of anomalodesmatan relationships, i t i s no t possibl e t o includ e a non anomalodesmatan a s a n outgrou p withou t favouring on e o r othe r o f th e hypothese s a s th e origin of the group. As a result, the Pholadomyida e has been chosen as the outgroup, on the basis of the known longevit y o f th e famil y [firs t recognize d from th e Hastaria n b y Skelto n & Bento n (1993) ] and the general acceptanc e o f the Pholadomyoide a as the ste m grou p of the Anomalodesmat a (Pojet a 1971; Runnega r 1974) . I n bot h tree s obtaine d during thi s analysis , th e Parilimyida e emerge d a s the closest taxon to Pholadomya, unsurprisingly as they wer e formerl y considere d t o belon g t o th e same famil y unti l Morto n (1982 ) remove d Parilimya and associated gener a to erect the family. As a result, here th e trees hav e bee n roote d usin g Pholadomya + Parilimya as the outgroup. The data were analysed usin g PAUP version 4. 0 b2 fo r Macintos h (Swoffor d 1998 ) wit h al l characters treate d a s unordere d an d unweighted . The accelerate d transformatio n (ACCTRAN ) wa s used. Multistat e character s wer e treate d a s polymorphic. Tw o differen t analyse s wer e performed. Th e firs t use d the entire dat a matrix of 43 characters , whil e th e secon d use d onl y th e 1 8

134

E. M . HARPE R E T AL.

characters whic h coul d b e score d fro m th e shell s alone, i.e . th e maximu m numbe r o f character s which could be scored for extinct taxa (identified in Appendix 1) . The secon d analysi s was undertaken in a n effort t o asses s th e reliability o f constructing trees base d o n character s whic h ma y b e score d from fossi l materia l an d thu s th e possibilit y o f adding extinc t tax a t o an y late r analysis . Branc h and boun d analyses wer e use d to fin d th e shortes t tree(s), and where an analysis produced mor e than one most parsimonious tree, stric t consensu s tree s were produced . Percentag e bootstra p figure s wer e obtained t o indicat e suppor t fo r th e branche s (Felstenstein 1985) . In orde r t o compar e th e result s o f th e cladisti c analyses wit h th e know n fossi l recor d o f th e families, a databas e wa s establishe d fo r th e firs t occurrence of each anomalodesmata n family usin g information derive d fro m Sepkosk i (1992 ) an d Skelton & Bento n (1993) , alon g wit h Sepkoski' s unpublished compilatio n o f generi c longevities . Completeness o f the fossil record ma y be assesse d in a number of different ways , as suggested b y Paul (1982). O f these , tw o ar e mos t applicabl e t o investigating th e incompletenes s o f record s o f whole extan t families o n a globa l basi s an d thes e were used to assess the incompleteness of the fossi l record fo r eac h o f th e extan t anomalodesmata n families: (1 ) recognitio n o f familie s wit h n o recognized fossi l records; (2) those for which there are gap s durin g th e know n stratigraphi c rang e o f the family when no representative gener a have been found. Results Total evidence analysis The analysi s o f th e complet e characte r matri x produced a single most parsimonious tree of length 147 (Fig. 3) with a consistency inde x (CI ) of 0.605 and a retention inde x (RI) of 0.570. As both CI and RI ar e intende d a s measure s o f th e exten t o f homoplasy withi n the dat a se t (wit h a valu e o f 1 indicating that the data are entirely consistent), they support th e contentio n tha t non-divergen t chang e occurs frequentl y withi n th e Anomalodesmata . Percentage bootstra p suppor t values, shown on the tree, var y fro m clos e t o 100 % dow n t o 58 % fo r more poorly supporte d branches . The total evidenc e tre e support s th e divisio n o f the Pandoroidea (sensu Kee n i n Moore 1969 ) int o two monophyleti c groups , th e Thracioide a an d Pandoroidea, a s recommended by Boss (1978) an d Yonge & Morton (1980). Indeed, it should be noted that Keen' s Pandoroide a wa s foun d t o b e non monophyletic. Th e Thracioide a for m a dee p branching group , th e siste r grou p t o th e res t o f

anomalodesmatans, implying tha t the y aros e earl y from the primitive anomalodesmatan stock , and the tree show s the Pandoroidea t o be the more derive d of th e tw o superfamilies . Withi n th e Thracioidea , the Laternulida e an d Periplomatida e ar e siste r groups an d ar e mor e derive d tha n th e Thraciidae . Within th e Pandoroidea , th e Cleidothaeridae , Pandoridae an d Myochama an d Myadora for m the sister group to the Lyonsiidae. The precise topolog y of tha t part o f th e tre e relatin g t o th e Pandoroide a fits neithe r o f th e tw o model s suggeste d b y Bos s (1978) an d ther e i s n o suppor t fo r th e contentio n that th e Verticordiida e shoul d b e allie d t o th e Pandoroidea a s the ancestors t o the Cleidothaerida e (Runnegar 1974) ; indeed , th e verticordiid s appea r to be highly derived . The tube-dwellin g Clavagella an d Brechites appear together , implyin g that they ar e at least no t distantly related, as a sister group of the septibranch taxa. This appear s a slightly anomalous placement which supports none of the previous hypotheses for their relationship s an d deserve s furthe r investigation. The tota l evidenc e tre e provide s som e robus t conclusions o n the relationships o f the carnivorou s anomalodesmatans. Th e fiv e familie s whic h ar e considered to be predatory are clearly differentiate d into tw o clades ; th e Parilimyida e grou p allie d closely wit h th e Pholadomyida e [i n whic h the y were onc e included unti l Morton (1982 ) separate d them], whilst th e Lyonsiellidae , Verticordiidae , Poromyidae an d Cuspidariida e for m a highl y derived monophyleti c siste r grou p t o th e clavagellids. The Lyonsiellida e an d Verticordiida e are sister groups, and are themselves a sister group to th e Cuspidariida e an d Poromyidae . Thi s tre e allows rejectio n o f hypothesi s D , whic h suggest s that al l carnivorou s tax a wer e derive d fro m a parilimyid ancesto r (Morto n 19810) , an d hypotheses E an d F , whic h separat e th e tax a amongst the other anomalodesmatans . Th e fact that they for m a derived clad e also implie s tha t models of relationship s suc h a s hypothesi s F (Runnega r 1974) an d model H (Healy 1996) , whic h place th e cuspidariids outsid e th e Anomalodesmata , shoul d be rejected. Of all the hypotheses presented i n Fig. 1, th e prsen t tre e support s hypothesi s A , a s proposed b y Pelseneer (1888) and Allen & Turner (1974).

The completeness of the fossil record of the Anomalodesmata The geological ranges of each of the extant families of anomalodesmatan s ar e show n i n Tabl e 2 . Al l families, wit h th e exceptio n o f th e Parilimyidae , have a fossi l record . Indeed , onl y nin e extan t genera i n th e entir e subclas s hav e n o recognize d

RELATIONSHIPS BETWEE N THE EXTAN T ANOMALODESMAT A

135

Table 2. Stratigraphic data for th e first recognized appearance i n the fossil record of each of the extant anomalodesmatan families Families

First appearance s

Clavagellidae

Clavagella - Cretaceou s (Cenomanian ) Brechites - Oligocene Lower Miocene Triassic (Ladinian ) Triassic (Rhaetian ) Pliocene Paleocene Thanetian ) Myochama - Uppe r Oligocen e Myador - Uppe r Eocen e Eocene (Ypresian ) Recent onl y [?Jurassi c (Callovian ) - Cretaceou s (Maastrichtian) Sepkoski unpublished ) Jurassic (Tithonian ) Carboniferous (Hastarian ) Cretaceous (Aptian ) Triassic (Rhaetian ) Cretaceous (Albian )

Cleidothaeridae Cuspidariidae Laternulidae Lyonsiellidae Lyonsiidae Myochamidae Pandoridae Parilimyidae Periplomatidae Pholadomyidae Poromyidae Thraciidae Verticordiidae

Data modified from Sepkosk i (1992) and Skelton & Benton (1993).

fossil record . Apar t fro m th e Parilimyidae , al l families hav e constituent gener a with a continuous Stratigraphic record . Suc h a level o f completenes s is hig h compare d wit h som e othe r highe r non molluscan taxa , e.g . echinoid s (Rau p 1979) , an d rather better than some other major bivalve clades , e.g. lucinoids (Harper 1998) . Only the Parilimyida e has n o widel y recognize d fossi l record. Th e thre e genera, Parilimya, Panacea an d Nippopanacca, placed withi n th e famil y b y Morto n (1982 ) ar e recognized fro m Recen t materia l only . Thi s may , however, b e a taxonomi c artefac t produce d b y the relativel y recen t erectio n o f th e famil y an d it ma y prov e tha t subsequen t revisio n o f th e Pholadomyoidea wil l remov e othe r fossi l gener a from th e Pholadomyida e t o th e Parilimyidae . Indeed, Runnega r (1974 ) suggeste d tha t th e Mesozoic genu s Procardia might be closely allie d to Panacea and, if this is so, it may be a parilimyid. Of al l the anomalodesmatan s the parilimyids have perhaps th e lowes t preservatio n potentia l bein g extremely thin shelled and living in deep water. The specimen o f Parilimya fragilis examine d b y Morton (1982) , fo r example , wa s collecte d fro m 1100 m in the North Atlantic. A thir d metho d o f assessin g incompletenes s i n the fossi l recor d o f a taxo n i s th e recognitio n o f monotypic taxa , o n th e assumptio n tha t a ver y incomplete fossi l wil l resul t i n recognize d tax a being s o distinctiv e a s t o b e give n anomolousl y high taxonomi c ran k (Pau l 1982) . O f th e extan t anomalodesmatan familie s onl y th e Cleido -

thaeridae ar e an d hav e bee n monogeneri c throughout thei r know n duratio n an d their coiled , highly inequivalv e morpholog y i s highl y distinctive. From th e above , i t appear s tha t th e Anomalodesmata hav e a fossi l recor d complet e enough t o b e usefu l i n discriminatin g betwee n cladistic hypothese s (Fortey & Jefferies 1982) . The total evidence tree (Fig. 2) fits the recognized fossi l record reasonabl y wel l withou t havin g t o invok e many lon g rang e extension s unsupporte d b y th e fossil recor d (Smit h 1994) . I n particular , a s noted by Bos s (1978) , th e divisio n o f th e Thracioide a from th e Pandoroide a i s wel l supporte d b y th e appearance of the former in the Mesozoic whilst the latter ar e firs t recorde d i n sediment s o f Cenozoi c age. Th e majo r discrepanc y betwee n th e fossi l record and the tree relates to the relationships o f the 'septibranchs'. The recognition o f the cuspidariid s in rock s o f Triassi c an d Jurassi c ag e require s a n extension o f th e fossi l record s o f th e thre e othe r septibranch familie s b y a t least 10 0 Ma. It may be possible to explain away this large gap in the fossil record b y th e fac t tha t thes e bivalve s ofte n tend t o liv e i n dee p wate r an d are , lik e al l anomalodesmatans, compose d o f diageneticall y unstable aragonite. However, it is noted that Yin & Fursich (1991 , p . 159 ) remar k tha t Jurassi c cuspidariids hav e been identified o n gross external morphology alone and thus their diagnosis may not be unequivocal , i n fact , the y poin t ou t thes e specimens resemble corbulids . If these records ar e

136

E. M . HARPE R E T AL.

Fig. 2 . Total evidence tree: Single most parsimonious tree produced from th e analysis of the entire data set. Bootstra p values > 50% given on various branching points.

rejected a s suspect , the n the stratigraphi c range of the Cuspidariida e onl y extends back a s fa r a s th e Upper Cretaceous (Kee n in Moore 1969) , which is more in keeping with the total evidence tree. Future work shoul d attemp t t o verif y whethe r o r no t th e Triassic and Jurassic tax a are correctly recognize d as cuspidariids. Shell character only tree Only 1 8 (at most) of the 43 character s use d i n th e above analysi s ca n b e score d fro m shell s alone . Reanalysis of the data using only these produced 16 most parsimoniou s tree s o f lengt h 49 . Th e stric t consensus tre e o f thes e i s show n i n Fig . 3 (CI = 0.714 an d R I = 0.750) an d i s markedl y different fro m th e total evidence tre e (Fig . 2) . The branching patter n i s muc h mor e pectinat e an d because it is a strict consensus tree, i.e . recognize s only thos e node s presen t i n al l 1 6 mos t parsimonious trees, it is unable to resolve many of the relationships . Nevertheless , th e separatio n o f the Thracioide a fro m th e Pandoroide a i s stil l supported, bu t th e orde r i n whic h th e tw o group s branch is reversed an d thus in direct oppositio n t o the orde r the y firs t appea r i n th e fossi l record , implying tha t th e pandoroid s hav e a lon g unrecognized fossil record . The reduced data set is

unable t o resolv e th e relationship s withi n th e Pandoroidea. Th e tube-dwellin g Clavagella an d Brechites appea r a s a ver y dee p branchin g group , again in oppositio n t o their firs t appearanc e i n th e fossil recor d whic h suggest s tha t they may have a substantial histor y whic h i s no t preserve d i n th e fossil record . The carnivorou s tax a d o no t for m a mono phyletic grou p an d Poromya branche s extremel y deeply, a positio n whic h i s no t supporte d b y an y accepted hypotheses of relationship (Fig. 2) nor the fossil record . Th e tre e als o implie s tha t th e Thracioidea aros e fro m carnivorou s ancestors , although non e o f th e thracioi d tax a ar e know n t o show that trait an d it seems mos t unlikel y that the very specialized multipl e adaptations for carnivory (e.g. modifie d siphons , ctenidia , palp s an d stomach) could ever reverse to suspension feeding. The Partition-Homogeneit y Tes t (Farri s e t al 1995) ca n be used to assess th e extent of apparen t incongruence betwee n tree s produce d fro m tw o partitions o f a complete dat a set . However, i n this case, th e tw o characte r set s ar e no t mutuall y exclusive as there are a number of characters whic h can b e score d fro m eithe r th e anatomica l o r th e shell character s alone , e.g . detail s o f th e musculature and valv e inequality . The tes t is therefore not appropriate i n this case.

RELATIONSHIPS BETWEE N TH E EXTANT ANOMALODESMAT A

137

Fig. 3 . Strict consensus tree of the 1 6 most parsimonious trees produced by the analysis of shell characters alon e (these characters are identified in Appendix 1). Bootstrap values > 50% given on various branching points.

Discussion Cladistic analysis of a wide array of anatomical and shell character s ha s produce d a singl e reasonabl y robust phylogenetic tree . Althoug h th e C I an d RI are no t high , th e tota l evidenc e tre e i s a t leas t a s robust a s mos t o f th e mollusca n cladisti c tree s published t o date. Furthermore, the total evidenc e tree i s broadl y supporte d b y th e orde r o f firs t appearance in the known stratigraphi c record. Th e analysis ha s resolve d a numbe r o f points : (1 ) i t clearly supports the division of the Pandoroidea and Thracioidea a s tw o monophyleti c clade s an d ha s further resolve d th e relationship s withi n thes e superfamilies; (2 ) i t ha s show n tha t carnivor y amongst th e anomalodesmatan s i s a t leas t diphyletic and supports hypotheses A-C (Fig . 1), in which th e 'septibranch ' tax a form a singl e clad e rather tha n th e suggestio n tha t thi s grou p i s polyphyletic, a s suggeste d i n hypotheses E an d F, or eve n tha t th e cuspidariid s fal l outsid e th e Anomalodesmata (hypotheses G and H). Since they form th e termina l grou p o f th e mor e derive d anomalodesmatans ther e i s scop e t o plac e th e septibranchs int o a separat e highe r taxon , a s proposed by Knudsen (1970) , althoug h this leaves the Anomalodesmat a as a paraphyletic clade . Th e present analysi s als o implie s tha t th e enigmati c tube-dwelling clavagellid s ar e th e siste r grou p of

the septibranchs , a conclusion whic h doe s no t si t comfortably wit h an y existin g theorie s o f clava gellid origin s an d whic h deserve s furthe r investigation. Despite th e fac t tha t thi s analysi s produce d a single, acceptably robust tree it is apparent that the subclass ha s bee n dogge d b y non-divergen t evolution. Thi s i s particularl y eviden t i f th e occurrence o f certai n ke y character s ar e mapped , e.g. th e presenc e o r absenc e o f hing e teet h (character 8) on to the total evidence tree (see Fig. 4). Similarly, the fourth pallial aperture, a character shared by many Anomalodesmata (Morton 19850), appears t o hav e bee n los t thre e time s (bu t never regained). Future refinement of characters migh t also lead to a mor e robus t tree . I n th e curren t analysi s character(s) fo r periostraca l spicule s (Carte r & Aller 1975 ) or shel l spinule s (Prezan t 1981 ) have not bee n include d becaus e o f uncertainly , i n th e present authors ' mind s a t least , abou t homolog y between these . Othe r characters , suc h a s th e apparent similarity o f odour shared by some of the pandoroid familie s [note d b y Bos s (1978) ] an d which may be phylogenetically usefu l ar e unlikely to be scorable for every family. The lac k o f congruenc e betwee n th e tota l evidence tre e an d tha t base d solel y o n shel l characters i s startling , despit e th e proportio n o f

138

E. M . HARPE R E T AL.

Fig. 4 . Reversals in character state for the presence/absence of hinge teeth (character 8) on the total evidence tree.

characters tha t coul d b e score d entirel y o n shel l knowledge an d the fac t tha t the tree produced ha s RI an d C I value s whic h indicat e i t i s acceptabl y robust to most investigators. This failure ma y have two explanations. Firstly, th e number of characters may b e to o lo w an d th e distributio n o f characte r states withi n them to o limite d t o b e sufficien t t o resolve th e phylogen y o f suc h a larg e numbe r of taxa. Alternatively, it ma y be tha t shel l character s are influenced to suc h an extent by environmenta l and lif e habi t tha t shel l for m mask s phylogeneti c information. These two explanations have the same net effect an d only the first is potentially rectifiable by furthe r investigation s tha t migh t yiel d ne w cladistically informativ e characters. Althoug h this may prov e t o b e th e case , th e fac t tha t th e shel l character tre e is not just a poorly resolve d versio n of th e tota l dat a tre e bu t clearl y contradict s it , argues for at least part of the problem being due to the second explanation. On the total evidence tree it is possibl e t o se e tha t certain shel l morphologica l traits (e.g. loss and gain of hinge teeth), which have been pivota l i n traditiona l classifications , ar e polyphyletic (Fig . 4) . I t i s thu s unlikely that shel l characters ar e suitabl e for us e a s the sol e basi s of phylogenetic reconstructio n i n th e Anomalo desmata. Thi s ha s obviou s implication s fo r an y future studie s that seek t o incorporate extinct taxa in an y cladisti c analysi s o f th e Anomalodesmata ,

especially sinc e th e unstabl e natur e o f thei r aragonitic shell s ove r geological timescale s means that i t ma y no t b e possibl e t o scor e eve n th e reduced characte r se t o f Palaeozoi c tax a wher e original shel l microstructur e an d detaile d information o n muscle attachmen t site s hav e bee n lost durin g diagenesis . Ful l scorin g o f th e shel l character matrix for extinct families must await the discovery o f specimen s showin g exceptionall y well-preserved shel l material . However , o n th e basis o f thi s study , a ful l cladisti c analysi s o f anomalodesmatan familie s (extan t an d extinct ) should procee d usin g th e tota l evidenc e characte r matrix, eve n thoug h fo r th e extinc t tax a a t leas t 50% o f th e characte r state s wil l b e encode d '?' . This findin g ha s obviou s relevanc e t o cladisti c studies o f other bivalv e groups. Relianc e o n hardpart characters alone is not necessarily a peculiarity of looking at fossil taxa; as it happens, the anatomy of al l th e extan t familie s o f th e Anomalodesmat a have been investigated in great detail but, as noted by Paul (1982) and Harper (1998), many molluscan taxa ar e know n onl y fro m conchologica l detail . Nevertheless, the bivalve fossil record i s excellen t and therefore stratigraphic ranges ar e invaluable in assessing and 'callibrating' th e trees, and provide a means o f determinin g th e polarit y o f som e characters.

RELATIONSHIPS BETWEE N THE EXTAN T ANOMALODESMAT A EMH hold s a Roya l Societ y Universit y Researc h Fellowship for which she is grateful. We are also gratefu l to th e Roya l Societ y o f Londo n fo r fundin g BM' s participation i n this project. Sharo n Capon redrafted Fig. I. We also thank Gonzalo Giribet an d Jay Schneide r fo r their constructiv e reviews . Thi s i s Cambridg e Eart h Science Publication No. 5896 .

Appendix 1: List of character and character states used in the cladistic analyses All characters were used for the total evidence analysis, whilst those used in thr shell character only analysis are marked with an asterisk . A. Shel l microstructure and gross shell morpholog y 1. Shel l microstructure*: (0) prismatic + nacre microstructures; (1) fine homogenous + nacre microstructures; (2) homogenous + homogenous microstructures; (3 ) coarse (> |im) homogenous + nacre microstructures 2. Adhesio n of foreign material to shell exterior*: (0) absent; (1) present 3. Valv e equality*: (0) equivalvy; (1) slight inequivalvy; (2) gross inequivalvy 4. Dorsa l crack in shell*: (0) absent; (1) present 5. Permanen t posterior gape* : (0) absent; (1) present 6. Permanen t anterior gape*: (0) absent; (1) present 7. Valv e concordance*: (0) concordant; (1) discordan t B. Hing e details 8. Hing e teeth*: (0) present, strong; (1) absent; (2) present, weak 9. Primar y ligament*: (0) external; (1) internal 10. Ligamen t and chondrophore*: (0) not sunken; (1) simple sunken; (2) sunken between chondrophore; (3) sunken between coiled chondrophore s II. Secondar y ligament: (0) thin; (1) thick 12. Lithodesma* : (0 ) absent; (1) present C. Genera l mantl e characters 13. Mantl e fusion typ e (Yonge 1982) : (0 ) type A; (1) type B; (2) type C 14. Arenophili c glands: (0) absent; (1) present 15. Fourt h pallial aperature : (0) absent; (1) present D. Sipho n characters 16. Sipho n length*: (0) pallial sinu s absent; (1) pallial sinus present but does not extend beyond the DV axis; (2) pallial sinu s present and extends beyond the DV axis 17. Sipho n separation: (0) separated; (1) fuse d 18. Sipho n symmetry: (0) asymmetric; (1) symmetric 19. Sipho n fusion typ e (Yonge 1982): (0 ) type A; (1) type B; (2) type C 20. Cilliar y sense organs: (0) absent; (1) present 21. Siphona l tentacles: (0 ) absent on both; (1) present on exhalant only; (2) present o n inhalant only; (3) present on both 22. Inhalan t siphon: (0) typical bivalve form; (1) extensible 'hood ' 23. Mucu s external lining: (0 ) absent; (1) present

139

E. Musculatur e 24. Adducto r musculature*: (0) isomyarian; (1) anterior larger; (2 ) posterior large r 25. Peda l gap e muscles: (0) normal; (1) Pholadomya type (see Morton 1980 ) 26. Peda l musculature*: (0) normal; (1) reduced; (2) absent 27. Taenoi d muscles: (0) absent; (1) present F. Genera l viscer a 28. Pal p type: (0) normal bivalve type; (1) funnel shaped; (2) short, no cilia 29. Gills : (0) plicate; (1) non-plicate 30. Gills : (0) type E; (1) 'septibranch' 31. Gills , inner demibranch attache d to the viscera l mass: (0) present; (1 ) absent 32. Lips : (0 ) simple, unfused; (1 ) laterally fused ; (2 ) medially fuse d 33. Stomac h type II (Purchon 1956): (0) absent; (1) present 34. Sortin g surfaces o n stomach: (0) absent; (1) present 35. Rectum : (0) above heart; (1) below heart; (2) penetrates heart 36. Rectum : (0) passes over kidneys; (1) penetrates kidneys 37. Statocys t type (see Morton 1985/?) : (0) A; (1) Bl; (2) B2; (3) B3; (4) C 38. Myadori d ray*: (0) absent; (1) present G. Reproductiv e character s 39. Reproduction : (0) simultaneous hermaphrodites: (1) dioecious 40. Gonadia l aperatures: (0) united; (1) separate; (2) united with urinary ducts H. Othe r characters 41. Abilit y to cement*: (0) absent; (1) present 42. Abilit y to build calcareous tubes*: (0) absent; (1) present 43. Post-larva l byssus*: (0) absent; (1) present

140

E. M . HARPE R E T AL.

Appendix 2: Data matrix for the cladistic analyses Representative taxa given in Table 1 .

1

Brechites 0 Clavagella 0 Cleidothaeridae 0 Cuspidariidae 2 Laternulidae 0 Lyonsiellidae 0 Lyonsiidae (0 3} Myadora 0 Myochama 0 Pandoridae 0 Parilimyidae 0 Periplomatidae 0 Pholadomyidae 0 Poromyidae {12 } Thraciidae 2 Verticordiidae 0

16 Brechites 0 Clavagella {01 Cleidothaeridae 0 Cuspidariidae 1 Laternulidae 0 Lyonsiellidae 0 Lyonsiidae 1 Myadora 0 Myochama 1 Pandoridae 0 Parilimyidae 1 Periplomatidae 1 Pholadomyidae 1 Poromyidae 0 Thraciidae 2 Verticordiidae 0

}

1

0 0 0 0

1

7 0 1 1

17 0 0 0

7

1

0 0

1

0

1

1

0

1

7 0 0

31 Brechites 0 Clavagella 0 Cleidothaeridae 0 Cuspidariidae 1 Laternulidae 0 Lyonsiellidae ? Lyonsiidae 0 Myadora 0 Myochama 0 Pandoridae 0 Parilimyidae 0 Periplomatidae 0 Pholadomyidae 0 Poromyidae 1 Thraciidae 0 Verticordiidae 0

2 3 0 0 0 0 0 2 0 {01} 1 1 1 0

32 0 0 0 0 0 2 0 0 0 0 7 1 1 0 0 2

1

2 2 2 0 2 0 0 1 0

18 0 0 0 1 0 7 7 0 7 0 1 0 0

1

0

1

33 0 0 0

1

0

1

0 0 0 0

1

0 0

1 1

0

4 0 0 0 0

1

0 0 0 0 0 0

1

0 0 0 0

5 7 7 1 0 0 1 {01} 1 1 1 0 0 0 1 0 1

6 1 1 1 1 0 1 1 1 1 1 0 0 0

20 1 1 0

22 0 0 0

37 3 3 2 4 {12} 1 1 {23} 3 1 {12} 2 0 1 {12} 1

1

0

1

0 0 0

1 0 1

21 3 3 2 3 3 7 2 3 0 3 0 3 0 3 3 3

34 7 7 1 0 1 7 1 1 1 1 7 1 0 7 0 0

35 2 2 0 2 2 2 2 2 2 0 2 2 1 2 2 2

36 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 1

19 2 2 0 1 2 0 1 0 0

1 1

0

1

1 1

1

0 0 0 0 0 0 0

7 8 9 7 1 0 7 1 {01} 1 1 0 0 {01} 1 0 1 {01} 0 1 1 0 0 1 1 1 0 1 1 0 1 1 0 0 {02} 0 1 1 0 0 {02} 0 0 0 0 0 1 1 1 1 0

1

23 0 0 0 0 0 0 0 0 0 0 0

1

0 0

1

0

1

0 0 0 0

0 0 0 0

1 1

0

38 0 0 0 0 0 0 0

1 1

0 0 0 0 0 0 0

10 11 12 13 14 15 1 0 2 1 1 1 1 {01} 0 2 1 1 1 1 1 3 0 0 2 1 1 0 0 1 1 2 1 0 0 1 7 1 0 1 1 1 1 {01} 1 1 1 1 7 1 0 1 2 1 2 1 0 0 0 1 1 1 {01} 0 0 1 0 0 0 1 1 0 1 {01} 1 1 {01} 2 1 1 0 0 0 0 0 0 0 0 0 {01} 7 2 1 1 1 0 1 {01} 1 1 {01} 0

24 2 2 1 0 2 0 0 0 0 0 0 0 0 0 0 0

25 0 0 0 0 0 7 0 0 0 0 1 0 1 0 0 0

26 1 1 2 1 1 1 1 1 1 1 2 1 0 1 2 1

27 0 0 0 0 0

28 0 0 0 2 0

0 0 0 0

0 0 0 0

0

0 0

39 0 0 0 1 0 7 0 0 0 0 0 0 0 0 1 0

40 1 1 1 1 2 7 1 1 1 0 0 0 0 0 0

41 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0

42 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

1

1

1 1

0 0 0

1

1 1

0

1

43 0 0 0 0 0

1 1

0 0 0 0 0 0 0 0

1

29 0 0 0 1 0 0 0 0 0 0 0 0 0

30 0 0 0

0 0

0 0

1

1

0 7 0 0 0 0 0 0 0

1

RELATIONSHIPS BETWEE N TH E EXTAN T ANOMALODESMAT A

References ALLEN, J . A . 1954 . On th e structur e an d adaptation s o f Pandora inaequivalvis an d P . pinna. Quarterly Journal o f Microscopical Science, 95, 473-482. & MORGAN , R . E . 1981 . Th e functiona l morphology o f Atlanti c dee p wate r specie s o f the familie s Cuspidariida e an d Poromyida e (Bivalvia): a n analysi s o f th e evolutio n o f th e septibranch condition . Philosophical Transactions of th e Royal Society o f London, Series B , 294 , 413-546. & TURNER, J. F. 1974. On the functional morpholog y of th e famil y Verticordiida e (Bivalvia ) wit h descriptions o f ne w specie s fro m th e abyssa l Atlantic. Philosophical Transactions o f th e Royal Society o f London, Series B, 268, 401-520. ALLER, R . C. 1974 . Prefabrication of shell ornamentatio n in the bivalve Laternula. Lethaia, 7, 43-56. AMLER, M. R. 1999. Synoptical classification of fossil and Recent Bivalvia. Geologica et Palaeontologica, 33, 237-248. ATKINS, D . 1936 . O n th e ciliar y mechanism s an d interrelationships o f lamellibranchs . Quarterly Journal o f Microscopical Research, 79, 181-308 . BAMBACH, R . K . 1971 . Adaptation s i n Grammysia obliqua. Lethaia, 4, 169-183. BERNARD, F. R. 1974 . Septibranchs o f the easter n Pacifi c (Bivalvia: Anomalodesmata) . Allan Hancock Monographs i n Marine Biology, 8, 1-279 . 1979. Ne w specie s o f Cuspidaria from th e north-easter n Pacifi c (Bivalvia : Anomalodesmata) wit h a proposed classificatio n o f the septibranchs . Venus, 38, 14-24. BIELER, R . & MIKKELSEN , P . M . 1992 . Preliminar y phylogenetic analysi s o f th e bivalv e famil y Galeommatidae. American Malacological Bulletin, 9, 157-164. Boss, K. J. 1978 . Taxonomic concepts and superfluity in bivalve nomenclature . Philosophical Transactions of th e Royal Society o f London, Series B , 284 , 417-424. CARTER, J . G . 1978 . Ecolog y an d evolutio n o f th e Gastrochaenacea (Mollusca , Bivalvia) with notes on the evolutio n o f th e endolithi c habitat . Bulletin o f the Peabody Museum o f Natural History, 41 , 1-92. CARTER, J . G . & ALLER , R. C . 1975 . Calcification o f th e bivalve periostracum. Lethaia, 8, 315-320. COPE, J. C. W. 1996a. Early Ordovician (Arenig ) bivalve s from th e Llangyno g inlier , Sout h Wales . Palaeontology, 39, 979-1025. I996b. Th e earl y evolutio n o f th e Bivalvia . In : TAYLOR, J . D . (ed. ) Origin an d Evolutionary Radiation of the Mollusca. Oxford University Press, Oxford, 361-370. DALL, W . H . 1889 . On th e hing e o f pelecypod s an d it s development wit h a n attemp t towar d a bette r subdivision o f th e group . American Journal o f Science, 38, 445^62. DOUVILLE, H . 1913 . Classification de s lamellibranches . Bulletin de la Societe geologique de France 4eme Serie, 12, 419-461. FARRIS, J . S. , KALLERSJO , M. , KLUGE , A . G . & BULT , C .

141

1995. Testin g significanc e o f incongruence . Cladistics, 10,315-319. FELSENSTEIN, J . 1985 . Confidence limit s o n phylogenies : an approac h usin g th e bootstrap . Evolution, 39 , 783-791. FORTEY, R . A . & JEFFERIES , R . P . S . 1982 . Fossils an d phylogeny - a compromise approach . In: JOYSEY, K. A. & FRIDAY , A. E. (eds) Problemsof Phylogenetic Reconstruction. Systematic s Associatio n Specia l Volume, 21, 197-234. HARPER, E . M . 1998 . Th e fossi l recor d o f bivalv e molluscs. In : Donovan, S . K. & PAUL, C. R. C. (eds) The Adequacy o f th e Fossil Record. John Wile y & Sons, Chichester, 243-267. & MORTON , B . 2000 . Cementatio n i n Myochama anomioides Stutchbury , 183 0 (Bivalvia : Anomalodesmata: Pandoroidea ) wit h referenc e t o cementation. Journal o f Molluscan Studies, 66 , 403-416. HEALY, J . M . 1996 . Mollusca n sper m ultrastructure : correlation wit h taxonomi c unit s withi n th e Gastropoda, Cephalopod a an d Bivalvia . In : TAYLOR, J . D . (ed. ) Origin an d Evolutionary Radiation of the Mollusca. Oxford University Press, Oxford, 99-113 . HICKMAN, C . S . 1996 . Phylogen y an d pattern s o f evolutionary radiatio n i n trochoidea n gastropods . In: TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation of th e Mollusca. Oxford University Press , Oxford, 177-198 . KNUDSEN, J. 1970. The systematics an d biology o f abyssal and hadal Bivalvia. Galathea Report, 11 , 7-236. MOORE, R . C . 1969 . Treatise o f Invertebrate Paleontology, Part N(l-2). The Geological Societ y of America , Boulder , CO , an d Th e Universit y o f Kansas, Lawrence, KS . MORGAN, R . E . & ALLEN , J . A . 1976 . On th e functional morphology an d adaptations o f Entodesma saxicola (Bivalvia: Anomalodesmacea) . Malacologia, 15 , 233-240. MORTON, B . 1973 . Th e biolog y an d functiona l morphology o f Laternula truncata (Lamarck, 1818) (Bivalvia: Anomalodesmata : Pandoracea) . Biological Bulletin, 145, 509-531 . 1974. Som e aspect s o f th e biolog y an d functiona l morphology o f Cleidothaerus maorianus Finla y (Bivalvia: Anomalodesmata : Pandoracea) . Proceedings of the Malacological Society of London, 41, 201-222. 1977. Th e biolog y an d functiona l morpholog y o f Myadora striata (Quo y & Gaimard ) (Bivalvia : Anomalodesmata: Pandoracea) . Journal o f Molluscan Studies, 43, 141-154. 1980. Th e anatom y o f th e 'livin g fossil ' Pholadomya Candida Sowerby , 182 3 (Mollusca : Bivalvia: Anomalodesmata) . Videnskabelige Meddelelser fra Dansk naturhistorik Forening i Kj0benhavn, 142 , 7-102. 198la. Th e Anomalodesmata . Malacologia, 21 , 35-60. 1981/7. Th e biolog y an d functiona l morpholog y o f Periploma (Offadesma) angasai (Bivalvia : Anomalodesmata: Periplomatidae) . Journal o f Zoology, London, 193, 39-70 .

142

E. M. HARPE R ET AL.

1982. Th e functiona l morpholog y o f Parilimya fragilis ( Grieg, 1920 ) (Bivalvia: Parilimyidae fam. nov.) wit h a discussion o f the origi n an d evolutio n of th e carnivorou s septibranch s an d a reclassification o f th e Anomalodesmata . Transactions of the Zoological Society of London, 36, 1-76 . 1984fl. Th e biolog y an d functiona l morpholog y o f Clavagella australis (Bivalvia : Anomalodesmata) . Journal o f Zoology, London, 202, 489-511. 1984/7. Adventitiou s tube construction in Brechites vaginiferus (Bivalvia : Anomalodesmata : Clavagellacea) wit h an investigation of the juvenile of ' 'Humphrey'sia strangei'. Journal o f Zoology, London, 203, 461^84. 1984c. Pre y captur e i n Lyonsiella formosa (Bivalvia: Anomalodesmata : Verticordiacea) . Pacific Science, 38, 283-297. 1984J. Aspect s o f th e biolog y an d functiona l morphology o f Frenamya ceylanica (Bivalvia : Anomalodesmata: Pandoracea) . Journal o f Conchology, 31, 359-371. 1985«. Adaptive radiation i n the Anomalodesmata . In: TRUMAN , R. R. & CLARK , M. R. (eds ) The Mollusca, Volume 10 , Evolution. Academi c Press , Sydney, 405-^59. 1985/7. Statocys t structur e i n th e Anomalodesmat a (Bivalvia). Journal o f Zoology, London, 206 , 23-34. 1987. Sipho n structur e and prey captur e a s a guide to affinitie s i n th e abyssa l septibranc h Anomalodesmata. Sarsia, 72, 49-69. 1995. Th e ecolog y an d functiona l morpholog y o f Trigonothracia jinxingae (Bivalvia : Anomalodesmata: Thracoidea ) fro m Xiamen , China. Journal o f Zoology, London, 237, 445^-68. 1996. The evolutionar y histor y o f the Bivalvia. In : TAYLOR, 3. D. (ed. ) Origin and evolutionary radiation of th e Mollusca. Oxfor d University Press , Oxford, 337-356. NEVESSKAYA, L. A., SCARLATTO, O. A., STAROBOGATOV , Y. A. & EBERZIN , A . G . 1971 . Ne w idea s o n bivalv e systematics. Paleontological Journal, 2, 141-155. PAUL, C . R . C . 1982 . The adequac y o f th e fossi l record . In: JOYSEY , K. A. & FRIDAY, A. E. (eds) Problems of Phylogenetic Reconstruction. Systematic s Association Specia l Volume , 21, 75-117. PELSENEER, P . 1888. Report o n th e anatom y o f th e deep sea Mollusca. Report on the Scientific Results o f th e Voyage of H.M.S. Challenger During the Years 1873-76, Zoology, 27(74), 8-40 . 1891. Contributio n a 1'etud e de s Lamellibranches . Archives de Biologie, Paris, 11 , 147-312. PLATE, L . 1897 . Gieb t e s septibranchiat e muscheln ? Sitzungsberichteder Gesellschajf naturforschender Freunde z u Berlin, 1897, 24-28. POJETA, J . 1971 . Revie w o f Ordovicia n pelecypods . U S Geological Survey, Professional Papers, 695, 1-46. & SOHL , N . F . 1987 . Ascaulocardium armatum (Morton, 1833) . New genus (Lat e Cretaceous) : th e ultimate variatio n on the bivalv e paradigm . The Paleontological Society Memoir, 24, 1-77 . PREZANT, R . S . 1981 . Comparative shel l ultrastructur e of lyonsiid bivalves. Veliger, 23 , 289-299.

PURCHON, R . D . 1956 . The stomac h i n th e Protobranchi a and Septibranchi a (Lamellibranchia) . Proceedings of th e Zoological Society o f London, 127 , 511-525. 1978. An analytica l approac h t o a classification o f the Bivalvia . Philosophical Transactions o f th e Royal Society o f London, Series B, 284, 425-436. 1987fl. Th e stomac h i n the Bivalvia . Philosophical Transactions of the Royal Society of London, Series B, 316, 183-276. 1987/7. Classification and evolution of the Bivalvia: an analytica l study . Philosophical Transactions o f the Royal Society o f London, Series B , 316 , 277-302. RAUP, D. M. 1979 . Biases i n the fossi l recor d o f specie s and genera . Bulletin o f th e Carnegie Museum o f Natural History, 13 , 85-91. REID, R. C. & CROSBY, S . P. 1980. The raptorial siphon of the carnivorou s septibranc h Cardiomya planetica Dall (Mollusca: Bivalvia) , wit h note s on feedin g and digestion . Canadian Journal o f Zoology, 58 , 670-679. REID, R . G. B. & REID, A. M. 1974 . The carnivorous habit of member s o f th e septibranc h genu s Cuspidaria (Mollusca: Bivalvia) . Sarsia, 56, 47-56. RUNNEGAR, B . 1974 . Evolutionar y histor y o f th e bivalve subclas s Anomalodesmata . Journal o f Paleontology, 48 , 904-939. 1979. Pholadomya Candida Sowerby : Th e las t cadaver unearthed. Veliger, 22, 171-172. SALVINI-PLAWEN, L . V . & HASZPRUNAR , G . 1982 . On th e affinities o f Septibranchi a (Bivalvia) . Veliger, 25 , 83-85. & STEINER , G . 1996 . Synapomorphie s an d plesiomorphies i n highe r classificatio n o f th e Mollusca. In : TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation o f th e Mollusca. Oxfor d University Press , Oxford, 29-51 . SAVAZZI, E . 1982 . Adaptations t o tub e dwellin g i n th e Bivalvia. Lethaia, 15 , 275-297. 1999. Boring , nestlin g and tube-dwelling bivalves . In: SAVAZZI , E. (ed. ) Functional Morphology o f th e Invertebrate Skeleton. Wile y & Sons , Chichester , 205-237. SCHNEIDER, J . A . 1992 . Preliminary cladisti c analysi s o f the bivalv e famil y Cardiidae . American Malacological Bulletin, 9 , 145-155 . 1995. Phylogen y o f th e Cardiida e (Mollusca , Bivalvia): Protocardiinae , Laevicardiinae , Lahilliinae, Tulogocardiina e subfam . n . an d Pleuriocardiinae subfam . n . Zoologica Scripta, 24 , 321-346. 1998. Phylogen y o f th e Cardiida e (Bivalvia) : phylogenetic relationship s an d morphologica l evolution withi n th e subfamilie s Clinocardiinae , Lymnocardiinae, Fragina e an d Tridacninae . Malacologia, 40 , 321-373. SEILACHER, A . 1984 . Constructiona l morpholog y o f bivalves: evolutionar y pathway s i n primar y versu s secondary soft-botto m dwellers . Palaeontology, 27 , 207-237. SEPKOSKI, J . J . 1992 . A compendiu m o f fossi l marin e animal families . Milwaukee Public Museum Contributions in Biology an d Geology, 83, 1-156 .

RELATIONSHIPS BETWEE N TH E EXTAN T ANOMALODESMAT A SKELTON, P . W . & BENTON , M . J . 1993 . 'Mollusca : Rostroconchia, Scaphopod a and Bivalvia' , In: BENTON, M. J . (ed.) The Fossil Record 2. Chapman & Hall, London, 237-263. , CRAME, J. A., MORRIS, N. J. & HARPER, E. M. 1990. Adaptive divergenc e an d taxonomi c radiatio n i n post-Palaeozoic bivalves . In : TAYLOR , P . D . & LARWOOD, G. (eds) Major Evolutionary Radiations. The Systematic s Associatio n Specia l Volum e 42 . Clarendon Press, Oxford, 91-117. SMITH, A . B . 1994 . Systematics and th e Fossil Record. Blackwell Scientific Publications, Oxford STEINER, G . 1998 . Phylogeny of Scaphopod a (Mollusca) in th e ligh t o f ne w anatomica l dat a o n th e Gadilinidae an d some Problematica, an d a reply t o Reynolds. Zoologica Scripta, 27, 73-82. SWOFFORD, D . L . 1998 . PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods). Version 4. Sinauer Associates Inc. , Sundereland, MA. TAYLOR, J . D. , KANTOR , Y . I . & SYSOEV , A . V . 1993 . Foregut anatomy , feedin g mechanisms , relationships an d classificatio n o f th e Conoide a (= Toxoglossa) (Gastropoda) . Bulletin o f th e Natural History Museum, London (Zoology), 59 , 125-170. WALLER, T . R . 1978 . Morphology, morphocline s an d a new classificatio n o f the Pteriomorphi a (Mollusca : Bivalvia). Philosophical Transactions of th e Royal Society o f London, Series B, 284, 345-365. 1998. Origin of the mollusca n class Bivalvi a and a phytogeny of the major groups. In: JOHNSTON , P. A. & HAGGART , J . W . (eds ) Bivalves: A n Eo n o f Evolution - Paleobiological Studies Honoring

143

Norman D . Newell. Calgar y Universit y Press , Calgary, 1 -45. YEATES, D. K. 1995. Groundplans and exemplars: paths to the tree of life. Cladistics, 11, 343-357. YIN, J . & FURSICH, F. T. 1991. Middle and Upper Jurassic bivalves o f th e Tanggul a Mountains , W . China . Beringeria, 4, 127-192 . YONGE, C . M. 1928 . Structure and function o f the organs of feedin g an d digestio n i n th e septibranchs , Cuspidaria an d Poromya. Philosophical Transactions of the Royal Society of London, Series B, 216, 221-263. 1948. Cleansing mechanisms and the function o f the fourth pallia l apertur e i n Spisula subtruncata (d a Costa) an d Lutraria lutraria (L.) . Journal o f th e Marine Biological Association of the United Kingdom, 27, 585-596. 1952. Structur e an d adaptatio n i n Entodesma saxicola (Baird ) an d Mytilimeria nuttallii Conrad . University of California Publications in Zoology, 55, 439^50. 1962. On the primitive significanc e of the byssus in the Bivalvia an d its effects i n evolution. Journal of the Marine Biological Association of the United Kingdom, 42, 112-125 . 1982. Mantl e margin s wit h a revision o f siphona l types in the Bivalvia. Journal of Molluscan Studies, 48, 102-103 . & MORTON , B . 1980 . Ligament an d lithodesm a i n the Pandorace a an d Poromyacea wit h a discussio n on the evolutionary history o f the Anomalodesmat a (Mollusca: Bivalvia) . Journal of Zoology, London, 191, 263-292.

This page intentionally left blank

Prodigious polyphyly in imperilled freshwater pearly-mussels (Bivalvia: Unionidae): a phylogenetic test of species and generic designations CHARLES LYDEARD 1, RUSSELL L. MINTON1 & JAMES D. WILLIAMS2 University of Alabama, Biodiversity and Systematics, Department of Biological Sciences, Box 870345, Tuscaloosa, Alabama 35487, USA (e-mail: clydeard@ biology.as. ua.edu) 2 US Geological Survey, Biological Resources Division, 7920 NW 71st Street, Gainesville, FL 32653, USA

1

Abstract: Unioni d bivalves or freshwate r pearly-mussel s (Unionoidea: Unionidae ) serv e a s an exemplary syste m fo r examinin g man y o f th e problem s facin g systematist s an d conservatio n biologists today. Most of the species and genera were described in the late 1800s and early 1900s , but fe w phylogeneti c studie s hav e bee n conducte d t o tes t conventiona l view s o f specie s an d classification. Pearly-mussel s o f Gulf Coastal drainages o f the southeaster n Unite d State s fro m the Escambia (southern Alabama to Florida) to the Suwannee Rivers (Florida) ar e a unique fauna comprised o f approximatel y 10 0 species , wit h abou t 3 0 endemi c t o th e region . I n thi s study , mitochondrial cytochrom e c oxidase subuni t I and 16 S rRNA gene sequence s wer e used to test the monophyl y an d t o estimat e evolutionar y relationships o f fiv e unioni d specie s representin g three differen t genera . Th e molecula r phylogenie s depic t al l thre e gener a a s polyphyletic. Th e prodigious polyphyly exhibited withi n unionids is due to incorrect notions of homology and false assumptions abou t missin g anatomica l data . I n contrast , th e molecula r phylogen y provide s evidence to suppor t the recognitio n o f all fiv e unioni d species a s distinct evolutionary entities. Furthermore, molecula r genealogica l evidenc e support s th e elevatio n o f Quincuncina infucata (Conrad) of the Suwannee River to species level, for which Q. kleiniana (Lea) i s available.

The Systematics Agenda 2000's global objective is imperille d groups of animals around the world with to discover , describ e an d classif y th e world' s 70 % o f th e recognize d specie s i n Nort h Americ a species o n th e basi s o f evolutionar y relationship s considere d either extinct, endangered, threatene d o r before organisms are lost to extinction (Systematics o f specia l concer n (William s e t al. 1993 ; Neves et Agenda 200 0 1994 ; Eshbaug h 1995) . Unioni d a l 1997 ; Master et al 1998) . bivalves o r pearly-mussel s (Unionoidea : Unioni d bivalv e specie s an d gener a ar e Unionidae) serv e a s an exemplary mode l fo r many diagnose d o n characteristic s o f th e shell , sof t of th e problem s facin g Systematic s an d conser - anatom y and length of the brooding seaso n (Hear d vation biologists today. Unionids are distributed in & Guckert 1970 ; Burc h 1975) . Initially, over 100 0 freshwaters o f Eurasi a an d Nort h America , bu t nomina l unionid species were described. This trend reach their greatest diversit y in North America with wa s followe d b y a reductio n i n th e numbe r o f nearly 300 recognized species (Burc h 1975; Bogan species , largely due to the thought that much of the 1993; Lydeard & May den 1995 ; Neves et al. 1997 ; observe d conchologica l variatio n represente d Turgeon e t a l 1998) . Despit e thei r ecologica l population-leve l phenomen a (Johnso n 1970) . significance a s dominan t macroinvertebrate s i n Likewise , th e numbe r o f Nort h America n unioni d many stream s an d river s (McMaho n 1991 ) o f th e gener a expande d fro m tw o (e.g . Le a 1834) , t o 2 7 southeastern Unite d State s an d thei r economi c (Simpso n 1914) , t o 4 6 (Burc h 1975 ) (systematists significance (i.e . a yearly 3 billion dolla r culture d initiall y treate d margaritiferid species a s unionids). pearl industry ; Jenkinson & Todd 1997) , relativel y Currently , 286 species and 51 genera (includin g 17 little i s know n about the lif e history , ecology an d monotypi c genera ) ar e recognize d throug h phylogeny o f th e majorit y o f taxa . Moreover , consensu s reached by a committee of malacologists unionids ar e recognize d a s on e o f th e mos t (Turgeo n et al. 1998) . Although relative taxonomic From: HARPER, E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177, 145-158 . 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000.

146

C. LYDEAR D £rAL.

stability ha s bee n achieve d ove r th e pas t decade , this has been don e largely b y subjective taxonomi c decisions with the understanding that many species and generic hypotheses need to be tested further . A pre-Hennigian classificatio n an d specie s checklis t gives th e fals e impressio n tha t biologist s reall y understand th e phylogeneti c relationship s an d species richnes s o f a group . Thi s informatio n i s subsequently use d to locate biologica l hotspot s fo r setting futur e conservatio n prioritie s (e.g . Dobso n et al. 1997 ; Maste r e t al 1998) . Followin g th e initial spate of descriptions in the early 1900s , most systematic activity focused on what the appropriat e name shoul d b e fo r a give n taxo n rathe r tha n determining whether the named taxon constitutes a real specie s o r is a member of a natural group (i.e. clade) worthy of a name in the first place . Recently, molecula r dat a hav e bee n use d t o address variou s phylogeneti c hypothese s withi n unionids. Lydear d e t al . (1996 ) constructe d a molecular phylogen y o f 2 3 gener a an d 2 9 specie s of unionid s an d showe d tha t th e classificatio n scheme currentl y employed (i.e . Hear d & Guckert 1970) doe s no t reflec t evolutionar y relationships . Mapping variou s conchologica l an d soft-par t anatomical character s tha t wer e th e primar y basi s of th e classificatio n schem e (Hear d & Gucker t 1970) o n th e molecula r phylogeny , and constructing a phylogeny based o n DNA and morphologica l data, reveale d man y o f th e ke y character s traditionally used i n higher unioni d systematic s to be homoplasti c (e.g . numbe r gill s use d a s marsupium, shel l texture) . Regrettably, fe w o f th e genera an d specie s examine d b y Lydear d e t al . (1996) wer e teste d fo r monophyly , so the question remains whethe r traditiona l view s o f specie s an d genera reflect natura l units. Unionids o f th e Gul f Coasta l drainage s o f th e southeastern Unite d State s fro m th e Escambi a (southern Alabam a an d Florida ) t o th e Suwanne e Rivers (Florida ) ar e a uniqu e faun a comprise d o f approximately 10 0 species, o f which abou t 3 0 ar e endemic t o th e regio n (William s & Butle r 1994) . The regio n ha s figure d prominentl y i n aquati c biogeographic studies , particularl y th e ichthyo fauna (e.g . Bermingha m & Avise 1986) . The mos t comprehensive loo k a t th e malacofaun a o f th e region was by Clench & Turner (1956). Subsequent studies consiste d primaril y o f additiona l notes o n the distributio n an d taxonom y o f th e specie s (e.g . Johnson 1969 ; Athear n 1970 ; Butle r 1989 ; Williams & Butle r 1994) . Whil e man y o f th e recognized species are threatened, endangered or of special concern, curren t taxonom y ma y not reflec t natural evolutionar y entitie s (William s & Butle r 1994). In the present study , mitochondrial cytochrome c oxidase subuni t I (COI ) an d 16 S rRN A gen e

sequences wer e use d t o tes t monophyl y an d t o estimate phylogeneti c relationship s o f fiv e Gul f Coastal unioni d species (Fig . 1 ) representing thre e different gener a (Fusconaia succissa, F. escambia, Quincuncina infucata, Q. burkei an d Obovaria rotulata). These five specie s were chose n because : (1) very little is known of their life history, ecology and taxonomi c statu s relativ e to specie s foun d in the Mississippi Basin ; (2 ) they ar e al l easternmos t representatives o f thei r respectiv e gener a an d endemic t o variou s drainage s o f th e easter n Gul f Coast; and (3) phylogenetic data will provide usefu l data fo r wisel y managin g the fiv e taxa , whic h ar e either endangered, threatene d o r of special concern .

Materials and method s Terminal taxa and vouchers Table 1 lists the taxa used in this analysis, localitie s and vouche r information . Ingrou p tax a wer e comprised of 23 unionid specimens representing 12 species an d fiv e genera . Quadrula quadrula, Pleurobema decisum, Fusconaia flava, F. ebena, Lampsilis teres, Obovaria unicolor and O. olivaria were included to place th e relationships of the fiv e Gulf Coasta l specie s i n a broade r evolutionar y context. It was attempted to include type species of each genu s whenever possible, however, Obovaria retusa an d Pleurobema clava ar e bot h federall y listed a s endangere d an d specimen s coul d no t b e secured for this study. The chosen species represen t the morpho type exhibite d b y the type species . As outgroups, one anodontin e (Anodonta cygned) an d one margaritiferi d specie s (Cumberlandia monodonta), base d o n highe r leve l molecula r an d morphological phylogeneti c analyse s (Lydear d e t al. 1996) , were used .

DNA processing sequence procurement, alignment and analysis Genomic DN A wa s isolate d fro m froze n o r 95 % ethanol-preserved specimen s usin g th e QIAam p Tissue Ki t (Qiagen™) . Mitochondria l DN A (mtDNA) sequences wer e obtained for an amplified segment (c. 550 nucleotides) o f the 16 S rRNA gene using primer s 16Sar-L-my t an d 16Sbr-H-my t (Lydeard et al. 1996) , an d the COI gene (c . 650 nt) using primers LCO1490 and HCO2198 (Folmer et al. 1994) . Detail s o f th e amplificatio n protocol s have been reported by Lydeard et al. (1996) for 16 S rRNA an d Ro e & Lydear d (1998 ) fo r th e CO I genes. Sequence s wer e determine d usin g eithe r manual sequencin g protocol s [se e Lydear d e t al . (1996) fo r 16 S rDNA an d Ro e & Lydear d (1998 ) for COI ] o r automate d sequencing , usin g a n Applied Biosystem s 373 A o r 377 DNA sequence r

UNIONID SPECIE S AN D GENER A

using Ta q DyeDeox y terminato r chemistr y according to the manufacturer's protocol. To ensure accuracy and to resolve any ambiguities, both DNA strands were sequenced . Sequences were entered in the software program

147

ESEE (Cabo t & Beckenbach 1989 ) and aligned by eye with the aid of bivalve (Mytilus edulis Linnaeus and Pecten maximus Linnaeus ) 16 S rRN A secondary structur e model s (Lydear d e t al 2000) . Insertions an d deletion s (indels ) wer e treate d a s

Fig. 1 . Distribution and collection localities (i.e. dot s on map) of : (a) Fusconaia an d Obovaria; (b) Quincuncina species of eastern Gulf Coasta l river s o f the southeaster n United States. See Table 1 for name s o f river s an d voucher information.

148

C. LYDEARD£7AL .

Table 1 . Material used for phylo genetic analysis Quincuncina burkei Walker 11 8

Limestone Creek , Choctawhatche e Drainage , Florid a UAUC575-577; AF232777 , AF232802

Q. burkei 1

Pittman Creek, Choctawhatche e Drainage , Florid a UAUC927-933; AF232779 , AF232804 Same a s above UAUC927-933; AF232778 , AF232803

Q. burkei 2 Q. infucata (Conrad ) 1 Q. infucata 4 5 Q. infucata 4 6 Q. infucata 5 7 Q. infucata 5 8 Lampsilis teres (Rafinesque) Obovaria unicolor (I. Lea) 0. olivaria (Rafinesque)

Ochlockonee River , Florid a UAUC919-926; AF232780, AF232805 Kinchafoonee Creek , Flin t River , Georgi a UAUC561; AF232782, AF23280 7 Same as above UAUC6O5; AF232781, AF23280 6 New River, Suwannee Drainage, Florid a UAUC564; AF232783, AF23280 8 Same a s abov e UAUCS67; AF232784 , AF232809 Yellowleaf Creek , Coos a Drainage , Alabam a UAUCOO6; AF232785 , AF23281 0 Sipsey River , Tombigbee Drainage , Alabam a UAUC51; AF232786, AF232811 Mississippi River , Missour i mantle cli p onl y - Bernar d Sietman ; AF232787 , AF232812

0. rotulata (Wright) 1

Conecuh River, Alabama UAUC5O8; AF232788 , AF232813

0. rotulata 2

Same as above UAUC522; AF232789, AF23281 4 Kentucky Reservoir, Tennessee Drainage , Tennesse e UAUC71; AF232790, AF23281 5 Conecuh River, Escambia Drainage, Alabam a UAUC1448; AF232791 , AF23281 6

Fusconaia ebena (I. Lea) F. escambia Clench and Turner 2 F escambia 1 1

Same a s abov e UAUC1449; AF232792 , AF23281 7

F. succissa (I . Lea) A

Conecuh River , Escambia Drainage , Alabam a UAUC9I 1-918 ; AF232796 , AF232821 Same a s abov e UAUC911-918; AF232793 , AF232818

F. succissa B F. succissa 8

Same a s abov e UAUC1456; AF232794, AF232819

F. succissa 11 9

Pea River, Choctawhatchee Drainage , Alabam a UAUC525-528; AF232795 , AF232820 Ohio River, Indiana-Kentuck y UAUC146; AF232797,AF232822 Sipsey River, Tombigbee Drainage, Alabam a AUC2O8; AF232776 , AF23280 1 Ohio River Indiana-Kentuck y UAUCI45; AF232798, AF23282 3

F. flava (Rafinesque ) Pleurobema decisum (I . Lea) Quadrula quadrula (Rafinesque ) Anodonta cygnea (Linnaeus) Cumberlandia monodonta (Say )

Lake Obertrurnerse e Salzburgh, Austria; mantle clip only - R . A. Patzner source; AF232799, AF23282 4 Clinch River, Tennesse e UAUCO07; AF232800, AF23282 5

Locality, University of Alabama Unionid Collection (UAUC ) numbers and GenBank accession numbers are provided.

UNIONID SPECIE S AN D GENER A

missing data . Aligne d sequence s wer e analyse d using maximu m parsimon y i n PAUP*, version 4.0b2a (Swoffor d 1998) . A boostra p analysi s (Felsenstein 1985 ) wit h 100 0 iteration s was conducted t o estimat e interna l stabilit y o f th e matrix an d Breme r suppor t inde x value s wer e calculated using Autodecay 3.03 (Erriksso n 1997) ; ten random-additio n sequence s wer e use d t o determine th e deca y valu e fo r eac h nod e o f eac h tree. A skewnes s tes t statisti c (g 1) wa s als o calculated, base d on the distribution o f tree lengths of a random sampl e o f 1 0 000 topologies (Hill s & Huelsenbeck 1992) . A partitio n homogeneit y tes t was conducte d t o examin e th e exten t o f conflic t between th e tw o gen e portion s usin g th e incongruence length difference (ILD ) test (Farris et al 1995 ) a s implemente d i n PAUP* (simpl e addition-sequence, tre e bisection-reconnection , heuristic searc h optio n wit h 50 0 replicate s analysed). The Evolutionar y Specie s Concep t (Mayde n 1997) was used as the primary model in the recognition o f evolutionar y lineages . Th e operationa l species definitio n employe d i s historicall y base d (Baum & Donughu e 1995 ) an d include s th e criterion o f monophyl y i n th e genera l sens e (d e Quieroz & Donoghu e 1988 ) o r 'exclusivity ' (i.e . where a n exclusiv e grou p o f organism s i s on e whose member s ar e mor e closel y relate d t o eac h other tha n the y ar e t o an y organism s outsid e th e group) to denote the recognition of species .

Results Sequence data The aligne d dat a matri x i s availabl e fro m th e authors. GenBank accession number s are shown in Table 1 . The region of 16S rDNA and COI that was sequenced resulted in an aligned data matrix of 838 base pair s (bp ) (38 5 b p 16 S rDN A an d 45 3 b p COI). Individual 16S rDNA sequences ranged from 375 (LampsHis teres) t o 38 4 (Cumberlandia monodontd); n o lengt h variation was foun d i n th e COI sequences . Th e mitochondria l 16 S rDN A sequences exhibite d unconnecte d p-distanc e values from 0 (Q . burkei an d Q. infucata) t o 2.1 % (Q . infucata Suwanne e Rive r v . Q . infucata Apalachicola, Chattahoochee , Flin t Basin ) withi n species an d 0 (F. escambia v. Q. burkei) t o 16.2 % (Lampsilis teres v . Q . infucata) amon g specie s within th e ingroup . Outgrou p an d ingrou p tax a differed b y 13.3-26.9% . Th e mitochondria l CO I gene exhibited uncorrecte d p-distance value s fro m 0 (Obovaria rotulata) t o 3.5% (F. escambia and Q . burkei) withi n specie s an d 0. 4 (F . ebena v . O . rotulata) t o 18.9 % (Quadrula quadrula v . F .

149

escambia) amon g specie s withi n th e ingroup . Outgroup an d ingrou p tax a differe d b y 13.2-20.5%. The mitochondrial 16S rDNA aligne d data matri x ha d 15 3 variabl e an d 9 7 parsimon y informative sites , whil e the CO I gen e portion ha d 171 variable an d 12 6 parsimony informativ e sites. The numbe r o f parsimon y informativ e site s fo r each codon position of the mtDNA COI gene is 1s t = 15 , 2nd = 6 and 3rd = 105 . Base compositiona l bia s i s commo n i n mito chondrial DN A sequences. The average nucleotid e base frequences for the COI gene for all taxa was A = 0.16 , C = 0.16, G = 0.26 an d T = 0.42, an d the 16S rRNA gene A = 0.35, C = 0.20, G = 0.22 and T = 0.23 . Ther e wa s n o significan t differenc e i n base frequencie s amon g taxa for either gen e (X 2 = 17.86, P = 1.00 , CO I gene; X 2 = 14.85 , P = 1.00 , 16S rRNA gene).

Phylogenetic analysis Maximum parsimony analysis of the COI gene was conducted b y treatin g eac h characte r trans formation a s unordere d an d o f equa l weight , an d weighting transversion s twic e transition s a t th e third codo n positio n base d o n evidenc e o f sit e saturation (se e Ro e & Lydear d 1998) . Parsimon y analysis o f th e CO I dat a usin g equa l weightin g resulted i n fou r equall y parsimoniou s tree s (consistency inde x (CI ) = 0.531; homoplasy index (HI) = 0.469 ; retentio n inde x (RI ) = 0.756 ; tota l length = 417). The strict consensus tree is shown in Fig. 2a. All four equally parsimonious trees support the monophyly of Fusconaia escambia, F. succissa, Quincuncina infucata an d Obovaria rotulata. Quincuncina burkei wa s paraphyletic , bu t a monophyletic Q . burkei tree is only one step longer and no t significantl y differen t t o th e mos t parsimonious topolog y base d o n Templeton' s (1983a, b ) Wilcoxon sign-ranke d tes t ( P = 0.835). The genera Obovaria, Fusconaia and Quincuncina were found to be polyphyletic, with Q. burkei sister to F. escambia, Q. infucata siste r to F. succissa and F. ebena siste r t o O . rotulata. A tre e constrainin g the gener a to be monophyletic is 10 0 steps longer, which i s significantl y longe r tha n th e mos t parsimonious tree s ( P < 0.001). Relationship s among the deepest nodes are poorly supporte d and differ amon g the most parsimoniou s trees . Indeed, the outgrou p specie s Cumberlandia monodonta i s part o f th e ingrou p fo r tw o o f th e fou r most parsimonious trees . Parsimony analysi s o f the COI data weighting transversions twice transitions in the third codo n positio n resulte d i n a singl e mos t parsimonious tre e (C I = 0.533 ; H I = 0.467 ; R I = 0.76; total length = 550). A phylogram is shown in Fig. 2b . Th e topolog y i s equivalen t t o on e o f th e

Fig. 2 . Most parsimonious strict consensus trees or phylograms generated from: (a ) mitochondrial cytochrome c oxidase sequences using equal weighting (strict consensus tree of four equally parsimonious trees); (b) mitochondrial cytochrom e c oxidase sequence s weightin g trans versions twice transitions in the third codon position (singl e most parsimonious phylogram; (c) mitochondrial 16 S rDNA sequences usin g equal weighting (strict consensus tree of three equally parsimoniou s trees) ; (d) mitochondrial cytochrom e c oxidase and 16S rDNA sequences combined (strict consensus tree of two equally parsimonious trees). Numbers above branches indicate the proportion of 100 0 bootstra p replicates that supported the depicted clades. Numbers below branches are Bremer support index values. Taxon names and numbers correspond to those shown on Table 1 .

152

C. LYDEARD^rAL.

four mos t parsimonious tree s obtaine d usin g equal weighting wit h th e ingrou p depicte d a s bein g monophyletic. Th e CO I dat a contain s significan t phylogenetic structur e (g 1 = -0.59887 and -0.559, equal and unequal weighting, respectively). Phylogenetic analysi s o f th e mitochondria l 16 S rDNA data was conducted treatin g al l substitutions as unordere d an d o f equa l weigh t (Lydear d e t al 1996; Mulve y e t al . 1997) . Thre e equall y parsimonious tree s wer e obtaine d fro m th e maximum parsimon y analysi s (C I = 0.643 ; H I = 0.356; R I = 0.617 ; tota l lengt h = 302) . A stric t consensus tree of the three most parsimonious trees is show n in Fig. 2c. The topology i s simila r t o the COI-based topologie s wit h th e monophyl y o f Fusconaia escambia, F. succissa, Quincuncina infucata and Obovaria rotulata. Quincuncina burkei i s paraphyletic , bu t a monophyleti c Q. burkei i s a n equall y parsimoniou s solutio n (tota l length = 302) . The gener a Obovaria, Fusconaia and Quincuncina wer e foun d t o b e polyphyletic , with Q . burkei siste r t o F . escambia, Q . infucata sister t o F . succissa an d F . ebena siste r t o 0 . rotulata, whic h i s identica l t o th e topologie s obtained usin g th e CO I gene . Th e primar y difference betwee n th e phylogenies obtaine d fro m the tw o gene s i s tha t th e O . rotulata + F. ebena clade is siste r to Pleurobema decisum + F. flava + F. escambia + Q. burkei o n th e 16 S rDNA-based phylogeny. This alternat e placement o f O . rotulata + F. ebena is not unusual given the generally wea k support of the deeper nodes. The mitochondrial 16 S rDNA sequence s exhibi t significan t phylogeneti c structure (g 1 = -0.474). Prior t o conductin g a phylogeneti c analysi s combining th e DN A sequence s fro m th e tw o mitochondrial genes , a partitio n homogeneit y tes t was conducted . Result s fro m th e partitio n homogeneity tes t wer e no t significan t ( P = 0.16), indicating that DNA sequence s from th e two genes could be combined. Maximu m parsimon y analysi s of the entire DNA sequence data matrix, treating all substitutions a s unordere d an d o f equa l weight , resulted i n tw o equall y parsimoniou s tree s (C I = 0.566; HI = 0.434; RI = 0.798; total length = 729). A stric t consensu s tre e o f th e tw o mos t parsimonious tree s i s show n i n Fig . 2d . Th e topology i s equivalen t t o on e o f th e mos t parsimonious tree s obtaine d fro m th e CO I phylogenetic analysi s (i.e. unordered an d o f equal weighting). Th e onl y differenc e betwee n th e combined gen e tre e topolog y an d th e 16 S rDNAbased topolog y i s the mor e basal placement of th e O. rotulata + F. ebena clade. Parsimony analysis of the entir e DN A sequenc e dat a matri x weightin g trans versions twic e transition s i n th e thir d codo n position o f th e CO I gen e resulte d i n tw o equall y parsimonious tree s (C I = 0.561; H I = 0.439 ; R I =

0.794; tota l lengt h = 863) that ar e identica l t o th e two equall y parsimoniou s tree s obtaine d usin g equal weighting.

Discussion Each o f the five Gul f Coastal specie s were initiall y recognized an d describe d base d o n a variet y o f conchological feature s that were implicitly thought to reflec t th e natura l history an d coherenc e o f th e species. I t i s eviden t tha t althoug h n o rigorou s quantitative method existe d a t the time eac h o f the Gulf Coasta l specie s wer e described , th e con chological 'bauplan ' capture d b y th e earl y naturalists seem s t o reflec t th e uniqu e historica l legacy o f eac h species . Th e molecula r phylogen y based o n th e tw o mitochondria l gen e sequence s combined depicte d fou r o f th e fiv e Gul f Coasta l unionid specie s (Fusconaia succissa, F. escambia, Obovaria rotulata an d Quincuncina infucata) a s monophyletic. Althoug h Quincuncina burkei wa s depicted a s paraphyletic , constrainin g th e monophyly o f th e specie s wa s no t foun d t o b e statistically significantl y different . Lac k o f reciprocal monophyl y betwee n Q . burkei an d it s sister taxon F. escambia is likely to be an indication of insufficien t time fo r th e tw o gene s t o coalesc e (Avise & Ball 1990) . Evidenc e fo r this supposition is foun d i n th e difference s obtaine d betwee n th e two genes . Th e mitochondria l 16 S rRN A gen e i s the most conservative o f the two genes examined i n this stud y an d neithe r specie s wa s monophyletic . The mor e rapidl y evolvin g CO I gene , however , exhibited muc h greate r variatio n an d substantia l genetic divergenc e o f a monophyletic F . escambia from th e paraphyleti c Q . burkei lineage s ( a minimum p-distanc e valu e o f 7.95 % between F . escambia an d Q . burkei}. I t i s hypothesize d tha t a more rapidly evolving gene would yield reciproca l monophyly between F. escambia and Q. burkei and its continue d recognitio n a s a distinc t specie s i s recommended. I t is probably bette r t o err in favour of recognition of a distinct evolutionary entity than to fai l t o recogniz e i t (Daughert y e t al . 1990) , particularly give n th e numerou s conchologica l differences betwee n th e two species (see below). It ha s bee n debate d whethe r th e issu e o f monophyly shoul d b e extende d fro m highe r categorical level s t o th e specie s leve l (e.g . d e Quieroz & Donoghu e 1988 ; Nixo n & Wheele r 1990). Som e version s o f the Phylogeneti c Specie s Concept recogniz e specie s a s minima l monophyletic group s (d e Queiro z & Donoghu e 1988, 1990 ; Mishler & Donoghue 1982; Donoghue 1985; Mishle r & Brandon 1987; McKitrick & Zink 1988; Mayde n 1997) . Thi s ha s prove n usefu l i n a variety o f studie s o n unionid s an d ha s resulte d i n synonymizing some species an d subspecies suc h as

UNIONID SPECIES AND GENER A

Megalonaias boykiniana an d Amblema plicata perplicata, an d th e discover y o f crypti c specie s such as Amblema elliottii (Mulvey et al 1997 ; Roe & Lydeard 1998; King et al 1999) . Molecula r dat a often provide s information that may not always be gleaned fro m morpholog y alone . Usin g a n 'exclusivity' approac h (Bau m & Donoghue 1995 ) to recognizin g specie s i t i s eviden t tha t th e Suwannee Rive r population s ar e geographicall y and genetically isolate d fro m population s fro m th e Apalachicola an d Ochlocone e Drainage s (Fig s 1 and 2) . Additionally , thi s geneti c isolatio n i s reinforced b y th e absenc e o f Q. infucata i n th e coastal drainages between the Ochlockonee and the Suwannee. Given the reciprocal monophyl y of the populations an d th e degre e o f geneti c differenti ation, thes e tw o population s shoul d b e accorde d specific status. In stark contrast to the species-level findings , all three Gul f Coasta l gener a examine d (Fusconaia, Quincunina an d Obovaria} wer e foun d t o b e polyphyletic. A genu s shoul d reflec t a historica l group o f specie s tha t shar e commo n ancestry . Ortmann & Walker (1922) placed Q . burkei and Q. infucata i n Quincuncina (typ e species : Q . burkei} based o n th e presenc e o f a comple x zig-za g sculpture o n th e shel l (Q . mitchelli, fro m Texas , was late r describe d an d i s no w presume d t o b e extinct; R . Howel l pers . comm.) . Simila r zig-za g patterns ar e als o foun d o n othe r unioni d species , including severa l specie s o f Quadrula an d Tritogonia verrucasa (Rafinesque) . Give n th e topology o f the molecula r phylogeny , it is eviden t the zig-zag pattern is not homologous. The onl y characte r describe d i n th e literatur e distinguishing th e genu s Fusconaia fro m othe r genera i s a subcylindrical-shape d placenta e (Ortmann 1912 ; Burc h 1975) . Sof t part s fro m gravid female s hav e bee n examine d i n F . flava (type specie s o f Fusconaia Ortman n 1912 ) an d Quincuncina burkei. Th e mos t characteristi c anatomical feature of Q . burkei noted by Ortmann & Walke r (1922 ) i s tha t th e gravi d femal e ha s subcylindrical placentae like Fusconaia. No reports of gravi d femal e sof t part s hav e bee n publishe d about F . succissa (Ortman n 1923 ) no r F . ebena (Ortmann 1912) , whic h wa s place d i n Fusconaia based o n th e similarit y o f th e shel l t o othe r Fusconaia species . Th e fac t tha t al l tax a tha t ar e thought to possess a subcylindrical-shaped placen tae for m a clade, support s th e hypothesi s tha t th e feature ma y b e homologous . I n contrast , Simpso n (1900) placed bot h F . succissa and Q . infucata i n the genus Quadrula because of the similarity of the shell. Th e molecula r phylogen y depict s bot h F. succissa an d Q. infucata a s sister taxa and sister to Quadrula quadrula (typ e specie s o f Quadrula Rafinesque, 1820) . Davi s (1984 ) conducte d a

153

phenetic analysi s of 1 4 allozyme loc i an d found Q . infucata clustere d wit h Quadrula, and that F. flava and F. succissa belong to different genera based on a hig h geneti c distanc e valu e an d their placemen t on an ordination diagram. The molecular phylogen y depict s Q . burkei + F. escambia as sister to F. flava, whic h in turn is sister to Pleurobema decisum. Th e primar y differenc e between Fusconaia an d Pleurobema, which were placed in the same tribe (Pleurobemini) b y Heard & Guckert (1970) , i s tha t al l fou r gill s ar e use d a s marsupia i n Fusconaia an d onl y th e oute r pai r i s used i n Pleurobema. Fusconaia ebena i s consistently place d outsid e th e Fusconaia flava + F. escambia + Q . burkei + Pleurobema clade . Lydeard e t al . (1996 ) showe d tha t th e numbe r of gills use d a s a marsupium is homoplastic wit h use of onl y the outer gills bein g the derived condition. Previous investigator s hav e debated th e placemen t of Fusconaia (Hear d & Gucker t 1970 ; Davi s & Fuller 1981) . Part of the problem may be due to the assumption tha t Fusconaia wa s monophyletic . Other unioni d specie s wil l hav e t o b e examine d before this issue is resolved fully . Obovaria i s comprise d o f si x specie s an d i s placed i n th e trib e Lampsilin i (Burc h 1975) , Several reproductiv e an d soft-par t anatomica l features ar e synapomorphie s o f the trib e (Lydear d et al . 1996 ) an d fou r o f fiv e Obovaria specie s possess thes e lampsiline features. Simpson (1900«, b) examine d Unio rotulata (Wrigh t 1899 ) an d placed i t i n th e genu s Obovaria based o n genera l similarity o f shel l characteristics . Subsequen t workers (Simpso n 1914 ; Johnso n 1967 , 1969 ; Turgeon e t al . 1998 ) continue d t o recogniz e rotulata a s a specie s o f Obovaria on th e basi s o f shell characters , bu t Butler (1989 ) an d Williams & Butler (1994) placed it in the genus Fusconaia also on the basis of shell character s (i.e . teet h an d dee p beak cavity) . Examinatio n o f sof t part s fro m a gravid femal e woul d easil y remed y th e situation , but the rarity of the species and difficulty i n finding gravid female s has preclude d an y investigatio n of soft parts . The specie s wa s completely overlooke d by Clenc h & Turne r (1956 ) an d formerl y onl y known by the holotype. Th e molecular phylogen y depicts th e lampsilin e specie s O . unicolor, O . olivaria and Lampsilis teres in a clade excluding O. rotulata, which is sister t o F. ebena. This is strong evidence fo r th e remova l o f O . rotulata from th e genus Obovaria, however, what to name this clad e awaits the inclusion of additional species , including type species . Phylogenetic taxonom y i s concerne d wit h th e representation of phylogenetic relationship, specifi cally, with issues related directl y t o the namin g of taxa (d e Queiro z & Gauthie r 1990 , 1992 , 1994) . Several case studies have been done advocating the

154

C. LYDEAR D £7 AL.

use o f phylogeneti c taxonom y (e.g . Bryan t 1996 ; Sereno 1999) . Ideally , classificatio n o f unionid s should reflect phylogeny (Lydear d & Roe 1998) . It is eviden t fro m th e molecula r phylogeneti c hypotheses o f eastern Gul f unionid genera tha t the current classificatio n schem e doe s no t reflec t phylogeny. A complete systemati c re-evaluation of all Nort h America n an d Ol d Worl d unionid s (e.g . Hoeh e t al. 2000) , usin g morphologica l an d molecular data, is recommended here to strive for a phylogenetically, base d classification .

Species accounts The following is a description of the taxa examined in thi s stud y includin g recommende d taxonomi c changes t o bette r reflec t pattern s o f cladogenesi s and genealogica l affinities . Unti l highe r orde r relationships ar e resolved , i t i s suggeste d tha t th e polyphyletic genera b e denoted with quotes. ' Quncuncina' infucata Sculptured pigtoe

(Conrad

, 1834

)-

Unio infucatus Conra d 1834 , p. 45, pi. 3, fig. 2. Unio securiformis Conra d 1849 , p . 300 ; Conra d 1850,p.275,pl. 37, fig. 1. Clench & Turner (1956) limited the type locality to the Flin t River , Albany , Doughert y County , Georgia, assumin g tha t thi s wa s probabl y wher e Conrad collected. A map of Conrad's route through Georgia i n 183 3 (Wheele r 1935 , p . 27 ) indicate s that Conrad crossed the Flint River near Knoxville, located i n Crawfor d County , Georgia , whic h i s most likel y t o b e wher e th e typ e specimen s wer e collected. Th e figure d type s o f Unio infucatus an d U. securiformis hav e no t bee n foun d (Johnso n & Baker 1973) . Description: Shel l small , attainin g a lengt h o f c. 50 mm; moderatel y thick , subcircula r i n outline and moderatel y inflated . Surfac e o f shel l varie s from almos t smoot h t o faintl y sculptured , wit h small nodule s o r nodulou s ridge s arrange d i n a chevron-shaped pattern . Periostracu m smoot h o n the disk, slightly roughened o n the posterior slope ; colour variable, ranging from greenis h i n juveniles to dar k brow n o r almos t blac k i n adults , th e majority o f specimen s bein g a dar k brown . Beak s high (usuall y severel y eroded) , anterio r t o th e centre, thei r sculptur e consistin g o f prominent , irregular ridges , whic h curv e u p sharpl y behind . Posterior slop e fla t t o slightl y concave ; th e posterior ridg e narrowl y rounded, shell taperin g t o a blunt point on the base line posteriorly. Ligament short an d thick , hing e plat e wid e an d moderatel y thick. Ther e ar e tw o pseudocardina l teet h i n eac h

valve, two laterals i n the left valv e and one, whic h is ofte n somewha t double , i n th e right . Th e bea k cavities ar e shallow , compressed . Anterio r an d posterior muscl e scar s clearl y outlined . Nacr e usually purplis h t o bluis h whit e an d iridescen t posteriorly. Soft anatomy: A brie f descriptio n o f sof t anatom y of th e sculpture d pigto e wa s presente d b y Le a (1863, pp . 40 and 43) based on specimens fro m th e Chattahoochee Rive r a t Columbus , Uche e Ba r below Columbus , an d Roswell , Cob b County , Georgia. Th e gill s ar e large , almos t semicircular , and th e inne r one s ar e large r tha n th e outer . Th e branchial uteru s occupie s al l fou r gills . Th e branchial openin g i s larg e wit h numerou s brow n papillae. Th e ana l openin g i s dar k bu t lack s papillae. Supraana l opening large , coloured , slightly united below. Colour o f the body is white. Distribution: Occur s i n th e Apalachicol a Rive r drainage in Alabama, Florida, an d Georgia, an d the Ochlockonee Syste m i n Florida an d Georgia . I t i s not know n t o occu r i n th e coasta l drainage s between the Ochlockonee an d Suwannee Rivers. Conservation status: Th e sculpture d pigto e i s considered o f Specia l Concer n (William s e t a l 1993; Lydear d e t a l 1999) . Thi s statu s appear s appropriate considerin g th e disappearanc e o f thi s species fro m th e entir e mai n channe l o f th e Chattahoochee Rive r an d portion s o f th e Apalachicola River . I t ha s neve r bee n considere d for endangere d or threatened status by the US Fish and Wildlife Service. 'Quincuncina' kleiniana (Lea) - Suwanne e pigto e Unio kleinianus Le a 18520 , p . 251 ; 1852/7 , p . 265, pi. 17 , fig. 18. Description: Shel l small , attainin g a lengt h o f 60mm; moderatel y thick , subcircula r i n outline , moderately inflated . Surfac e generall y covere d with nin e t o 1 2 nodulou s ridge s whic h originat e along th e posterior ridge , extendin g anteriorl y an d ventrally acros s th e disk , an d posteriorl y an d ventrally acros s th e posterio r slope , formin g chevron-shaped sculpture , ofte n breakin g u p i n larger (lengt h > 35 mm) individuals . Periostracu m smooth, dar k brow n t o black , somewha t shin y on the disk . Beak s (usuall y eroded ) moderatel y ful l and high, extending to or slightly above the margin of th e shel l i n specimen s wit h minima l bea k erosion. Posterior ridg e broadly rounded, ending at the bas e o f the shel l i n a blunt point; anterio r en d round; ventra l margi n straigh t o r slightl y curved ; posterior en d obliquel y truncated . Pseudocardina l teeth triangular , usuall y doubl e i n th e lef t valve , single i n the right. Bea k cavitie s moderatel y deep .

UNIONID SPECIE S AN D GENERA

Anterior scars small, the posterior scars about twice the diamete r o f th e anterior . Nacr e purplis h t o white. Quadrula kleiniana i s usuall y large r an d more sculptured than Q. infucata. Simpso n (1914), in comparin g kleiniana an d infucata, observe d 'there ar e intermediates tha t migh t almos t a s well be placed in one species as the other.' Distribution: Endemi c t o th e Suwanne e Rive r Drainage in northern Florida an d southern Georgia. It occurs in the Withlacoochee an d Alapaha Rivers, southcentral Georgia , an d th e Sant a F e Rive r i n northeast Florida , al l tributarie s o f th e Suwannee River. Conservation status: Th e specie s should b e considered threatened given that it has completely disappeared fro m larg e portion s o f th e mai n channel of the Suwannee River. 'Fusconaia' succissa (Lea, 18525 ) - Purpl e pigto e Unio succissus Lea 18525, p. 275, pi. 21, fig. 32. Unio cacao Lea, 1859 , p . 154 ; Le a 1860 , p . 26, pi. 56, fig. 169 . Quadrula wrightii Simpson, 1914 , p. 868 . Description: Shel l attain s a lengt h o f 6 1 mm, subcircular i n outline , moderatel y thic k shell , smooth and moderately inflated. Olivaceous brown when young (c. 3 0 mm i n length), becoming dar k brownish blac k i n large r individuals . Posterio r ridge broadl y rounded , poorl y defined , th e slop e nearly flat . Shel l outlin e rounde d anteriorl y an d convex posteriorly, the beaks to the ventral margin and almos t straigh t t o slightl y conve x ventrally . Umbos (usuall y eroded ) anterio r t o th e centre , broad an d exten d t o th e margi n o f th e shell . Ligament shor t an d narrow . Periostracum smoot h on th e dis k an d somewha t roughene d aroun d th e margin an d on the posterior slope . Nacre white to purplish, most young specimens are entirely purple. Muscle scars , anterio r an d posterior , ar e wel l defined. Bea k cavitie s rathe r deep . Hing e plat e moderately broa d an d moderatel y arcuate . Righ t valve usuall y wit h on e pseudocardina l an d on e lateral tooth , an d th e lef t valv e wit h two pseudo cardinal and two lateral teeth . Distribution: 'Fusconaia' succissa ranges from th e Escambia t o Choctawhatche e Rive r System s i n Alabama an d Florida . I t occur s i n thre e rive r drainages: th e Escambia , Yello w an d Choctawhatchee Rive r system s i n Alabam a an d Florida. Conservation status: Th e specie s i s considere d o f Special Concer n (William s e t al 1993 ; Lydeard et al 1999) .

155

' Quincuncina' burkei Walker - tapere d pigto e Quincuncina burkei Walker 1922 , p . 1-6 , pi s 1, 4. Description: Shel l small , attainin g a lengt h o f 75 mm. Shel l moderatel y inflated . Beak s onl y slightly elevate d abov e th e hing e line , thei r sculpture consistin g o f strong , subcircula r ridges , stronger alon g th e umbona l ridg e an d curve d u p sharply behind, fading out anteriorly and becoming nearly parallel wit h the growth lines. Anterio r end regularly rounded ; base lin e curved ; posterior en d somewhat produced , subtruncate , curvin g dow n rather abruptl y an d subangulate d as i t approache s the posterio r point , whic h is below th e media n of the disk. Posterior ridge strong and angulated by the junction of the surfac e ridges. Posterior slop e with strong ridges, curving upwards, extending from the posterior ridge to the posterior margin, these form a sharp angl e o n th e posterio r ridg e wit h heavie r ridges extendin g downward s an d forward , whic h become mor e o r les s broke n an d tuberculou s towards th e margi n an d muc h weake r o n th e anterior end , wher e the y assum e a rathe r quin cuncial arrangement . Epidermi s i n matur e shell s black o r sometime s dar k brown , i n youn g shell s brown o r occasionall y greenish-yellow , i n whic h case obscur e radia l stripe s o f darke r gree n ar e visible. Pseudocardinals doubl e i n both valves . I n the right valve the anterior i s low and oblique, the posterior stron g an d erect . I n th e lef t valv e th e anterior i s rathe r lon g an d project s obliquel y forward, th e posterior i s larger , erec t an d more or less split up. The laterals, tw o in the left valv e and (usually) one in the right, ar e only a little curved, that i n th e righ t valv e i s sometime s mor e o r les s inclined t o be double. Beak cavities no t very deep or compressed. Anterio r muscle scars well marked, the superior one deep and extending under the base of th e anterio r pseudocardinal . Posterio r muscl e scars distinct but not deeply impressed. Nacre light purplish, deeper i n the beak cavities an d iridescen t behind (Ortmann & Walker 1922) . Distribution: Quincuncina burkei is an endemic of the Choctawhatchee River System of Alabama and Florida. Conservation status: Quincuncina burkei i s considered threatene d (William s e t al . 1993 ; Lydeard et al. 1999) . 'Fusconaia' escambia Clenc h & Turner, 195 6 Narrow pigtoe Fusconaia escambia Clench & Turner 1956, pp. 152-153, pi. 7, fig. 34. Description: Fusconaia escambia i s a smal l species, rarel y exceedin g 5 0 mm i n lengt h an d

156

C. LYDEARD ETAL.

subcircular i n outline . It has a smooth, moderatel y heavy shell, somewhat inflated and with broad, ful l and hig h umbos . Th e posterio r ridg e i s wel l developed an d ends in a point (angle slightly > 90°) posteriorly. Th e posterior slop e i s slightly concave . Colour o f R escambia varie s fro m dar k reddis h brown t o blackish . Internally , th e hing e plat e i s broad, heav y an d slightl y arcuate . Ther e i s on e large pseudocardina l toot h i n th e righ t valv e an d two in the left valve . The nacre is highly iridescen t and white to salmon coloured . Distribution: Th e narro w pigto e wa s firs t discovered i n th e Escambi a Rive r nea r Century , Escambia and Santa Rosa Counties, Florida, whic h was designate d th e type locality (Clenc h & Turner 1956). Subsequently , i t wa s foun d t o occu r upstream in the Conecuh River below Gantt Lake, Covington County, Alabama. Johnson (1969, p. 35) reported th e firs t recor d o f Fusconaia escambia from th e Yellow River, Okaloosa County , Florida. Conservation status: Th e specie s i s considere d threatened (William s e t al. 1993 ; Lydear d e t al 1999). 'Obovaria' rotulata (Wright 1899 ) - roun d ebony shell Unto rotulata B. H. Wright, 1899 , pp. 22-23. Obovaria rotulata Simpson, 1900£ , p. 78, pi. IV,

fig. 2 . Description: 'Obovaria rotulata is a medium-sized species tha t attains a length o f c. 65 mm. I t has a n almost circula r outlin e an d a heavy , somewha t inflated, thic k shell with a smooth black epidermis. The pseudocardina l teet h ar e lo w an d usuall y double in the left valv e and single in the right valve. The latera l teet h ar e long , slightl y curved , an d separated fro m th e pseudocardinal teeth by a broad smooth interdentum. The nacre is typically white to silvery, and iridescent. Distribution: 'Obovaria rotulata is endemic t o the Escambia Rive r Drainag e i n Escambi a County , Alabama, and Escambia and Santa Rosa Counties, Florida (Johnso n 1969) . Conservation status: Th e specie s i s considere d endangered (William s e t al . 1993 ; Lydear d e t al . 1999). Thanks to A. Bogan, P. Harris, R. Mayden , K. Roe, P. J. West, the Advanced Systematics Discussion Group at UA, and an anonymous reviewer fo r helpful comment s on the manuscript. The illustrations of the shells were done by D. Neely. Thank s t o L . Harpe r fo r th e opportunit y t o contribute t o th e symposiu m volume . W e appreciate th e help Jayne Brim-Box, Christine O'Brien , Holl y Blalock , Malcolm Pierson , Patt y Morrison , Bernar d Sietma n fo r their assistance in obtaining specimens. This research was

supported i n part by a Research Grant s Committee Award (2-67858) fro m th e Universit y o f Alabama , U.S . Fish & Wildlife Service , th e U.S . Geologica l Survey , an d th e National Scienc e Foundatio n (DEB-9707623) .

References ATHEARN, H . 1970 . Discussion o f Dr . Heard' s pape r o n Eastern freshwater mollusks, the south Atlantic, and gulf drainages. Malacologia, 10 , 1-56 . AVISE, J . C . & BALL , R . M , J R 1990 . Principle s o f genealogical concordanc e i n specie s concept s an d biological taxonomy . Oxford Surveys i n Evolutionary Biology, 7 , 45-67. BAUM, D. A. & DONOGHUE, M. J. 1995 . Choosing amon g alternative 'phylogenetic ' specie s concepts . Systematic Botany, 20, 560-573. BERMINGHAM, E . & AVISE , J . C . 1986 . Molecula r zoogeography o f freshwate r fishe s i n th e southeastern United States. Genetics, 113, 939-965 . BOGAN, A . E . 1993 . Freshwate r bivalv e extinction s (Mollusca: Unionoida) : A searc h fo r causes . American Zoologist, 33, 599-609. BRYANT, H . N . 1996 . Explicitness , stability , an d universality in the phylogenetic definition an d usage of taxo n names : a cas e stud y o f th e phylogeneti c taxonomy of the Carnivora. Systematic Biology, 45, 174-189. BURCH, J . B . 1975 . Freshwater unionacean clams (Mollusca: Pelecypoda) o f North America. Revise d edition. Malacological Publications , Hamburg, MI. BUTLER, R. S. 1989 . Distributional records for freshwate r mussels (Bivalvia: Unionidae) in Florida an d south Alabama, with zoogeographic an d taxonomic notes . Walkeriana, 3, 239-261. CABOT, E . L . & BECKENBECK , A . T . 1989 . Simultaneous editing o f multipl e nuclei c aci d an d protei n sequences with ESEE. Cabios, 5, 233-234. CLENCH, W . J . & TURNER , R . D . 1956 . Freshwate r mollusks of Alabama, Georgia an d Florida fro m th e Escambia t o th e Suwanne e River . Bulletin o f th e Florida State Museum, Biological Sciences, 1, 95-239. CONRAD, T. A. 1834 . New fresh water shells of th e United States, with coloured illustrations and a monograph of th e genus Anculotus of Say. Also a synopsis of th e American naiades. Judah Dodson, Philadelphia . 1849. Descriptions o f new freshwater shells. Annals and Magazine o f Natural History, 4 , 2n d series , 300-303. 1850. Description s o f ne w freshwate r an d marin e shells. Journal o f th e Academy o f Natural Sciences of Philadelphia, Ne w Series, I , 275-280, pis 37-39. DAUGHTERTY, C . H. , CREE , A. , HAY , J . M . & THOMPSON , M. B . 1990 . Neglected taxonom y an d continuing extinctions o f tuatar a (Sphenodoh). Nature, 347 , 177-179. DAVIS, G . M . 1984 . Genetic relationship s amon g som e North America n Unionida e (Bivalvia) : siblin g species, convergence , an d cladisti c relationships . Malacologia, 25, 629-648. & FULLER , S . L . H . 1981 . Geneti c relationship s among recen t Unionace a (Bivalvia ) o f Nort h America. Malacologia, 20, 217-253.

UNIONID SPECIES AND GENER A DE QUEIROZ , K . & DONOGHUE , M . J . 1988 . Phylogeneti c systematics and the specie s problem . Cladistics, 4, 317-338. & 1990 . Phylogenetic systematic s and species revisited. Cladistics, 6, 83-90. & GAUTHIER , J . 1990 . Phylogen y a s a centra l principle i n taxonomy : phylogenetic definition s of taxon names. Systematic Zoology, 39 , 307-322. & 1992 . Phylogeneti c taxonomy . Annual Review o f Ecology an d Systematics, 23 , 449-480. & 1994 . Towar d a phylogeneti c syste m o f biological nomenclature . Trends i n Ecology an d Evolution, 9, 27-31. DOBSON, A . P. , RODRIGUEZ , J . P. , ROBERTS , W . M . & WILKCOVE, D . S . 1997 . Geographic distributio n o f endangered specie s i n th e Unite d States . Science, 275, 550-553. DONOGHUE, M . J . 1985 . A critiqu e o f th e biologica l species concep t an d recommendation s fo r a phylogenetic alternative . Bryologist, 88, 172-181. ERRIKSSON, T . 1997 . AutoDecay, Version 3.0. Botaniska Institutionen, Stockholm University, Stockholm. ESHBAUGH, W . H . 1995 . Systematics Agend a 2000 : a n historical perspective . Biodiversity an d Conservation, 4, 455-462. FARRIS, J . S. , KALLERSJO , M., KLUGE , A . G . & BULT , C . 1995. Testin g significanc e o f incongruence . Cladistics, W, 315-319. FELSENSTEIN, J . F . 1985 . Confidenc e limit s o n phylogenies: a n approac h usin g th e bootstrap . Evolution, 39, 783-791. FOLMER, O. , HOEH , W . R., BLACK , M. B . & VRIJENHOEK,

R. L . 1994 . DN A primer s fo r amplificatio n o f mitochondrial cytochrom e C oxidase subunit I from metazoan invertebrates . Molecular Marine Biology & Biotechnology, 3, 294-299. HEARD, W. H. & GUCKERT, R. H. 1970 . A re-evaluation of the Recen t Unionace a (Pelecypoda ) o f Nort h America. Malacologia, 10, 333-355. HILLIS, D. M. & HUELSENBACK, J. P . 1992. Signal, noise , and reliabilit y i n molecula r phylogeneti c analyses . Journal o f Heredity, 83 , 189-195 . HOEH, W . R. , BOGAN , A . E. , CUMMINGS , K . S . & GUTTMAN, S . I . 2000 . Evolutionar y relationship s among the highe r tax a of freshwate r mussel s (Bivalvia: Unionoida): inferences on phylogeny and character evolution from analyses of DNA sequenc e data. Malacological Review, in press. JENKINSON, J . J . & TODD , R . M . 1997 . Management o f native mollus k resource s In: BeNZ , G . W . & COLLINS, D . E . (eds ) Aquatic Fauna i n Peril: th e Southeastern Perspective. Specia l Publicatio n 1 , Southeast Aquati c Research Institute , Len z Desig n & Communications, Decatur, GA, 283-306. JOHNSON, R. I. 1967. Additions to the unionid fauna of the Gulf drainag e o f Alabama , Georgi a an d Florid a (Mollusca: Bivalvia) . Breviora Museum o f Comparative Zoology, 270, 1-21, pis 1-3 . 1969. Further addition s t o th e unioni d fauna o f the Gulf drainage of Alabama, Georgia and Florida. Th e Nautilus, 83, 34-35. 1970. Th e systematic s an d zoogeograph y o f th e Unionidae (Mollusca : Bivalvia ) o f th e souther n

157

Atlantic Slop e region . Bulletin o f th e Museum o f Comparative Zoology, 140, 263^50. & BAKER , H . B . 1973 . The type s o f Unionace a (Mollusca: Bivalvia ) i n th e Academ y o f Natura l Sciences o f Philadelphia . Proceedings o f th e Academy o f Natural Sciences of Philadelphia, 125 , 145-186, pis 1-10 . KING, T . L., EACKLES, M. S. , GJETVAJ , B. & HOEH, W. R . 1999. Intraspecifi c phylogeograph y o f th e freshwater bivalv e Lasmigona subviridis (Bivalvia : Unionidae): conservatio n implication s o f rang e discontinuity. Molecular Ecology, 8, S65-S78. LEA, I . 1834 . Observation s o n th e Naiades , an d descriptions o f ne w specie s o f tha t an d othe r families. Transactions o f th e American Philosophical Society, Ne w Series, 4 , 63-121 , pi s 1-18. 18520. Description s o f ne w specie s o f th e famil y Unionidae. Proceedings o f th e American Philosophical Society, 5, 251-252. 18522?. Description s o f ne w specie s o f th e famil y Unionidae. Transactions of the American Philosophical Society, Ne w Series, 10, 253-302, pis 12-30. 1859. Description o f seven new specie s o f Uniones from Sout h Carolina, Florida , Alabama, an d Texas. Proceedings of the Academy of Natural Sciences of Philadelphia, 11 , 154-155. 1860. Observations o n th e genus Unio, together with descriptions of new species, their soft parts, and embryonic forms in the family Unionidae, Volume 9 . Printed for the Author, Philadelphia . 1863. Observations o n th e genus Unio, together with descriptions of new species, their soft parts, and embryonic forms, in the family Unionidae. Volume 10 . Printed for the Author, Philadelphia . LYDEARD, C . & MAYDEN , R . L . 1995 . A divers e an d endangered aquati c ecosyste m o f th e Southeas t United States. Conservation Biology, 9 , 800-805. & ROE , K. J . 1998 . Phylogenetic systematics : th e missing ingredient in the conservation of freshwater unionid bivalves. Fisheries, 23, 16-17 . , MULVEY , M . & DAVIS , G . M . 1996 . Molecula r systematics an d evolutio n o f reproductiv e traits of North America n freshwate r unionacea n mussel s (Mollusca: Bivalvia ) a s inferre d fro m 16 S rRN A gene sequences . Philosophical Transactions of th e Royal Society o f London, Series B, 351, 1593-1603 . , GARNER , J . T. , HARTFIELD , P . & WILLIAMS , J . D . 1999. Freshwate r mussel s i n th e Gul f region : Alabama. Gulf o f Mexico Science, 1999 , 125-134. , HOLZNAGEL , W. E., SCHNARE , M. N . & GUTELL , R .

R. 2000 . Phylogeneti c analysi s o f mollusca n mitochondrial LSU rDNA sequences and secondary structures. Molecular Phylogenetics and Evolution, 15, 83-102 . McKiTRiCK, M. C. & ZINK, R. M. 1988 . Species concept s in ornithology. Condor, 90, 1-14 . McMAHON, R. F . 1991 . Mollusca: Bivalvia . In: THORP , J . H. & COVICH, A . P. (eds) Ecology and classification of North American freshwater invertebrates. Academic Press , Sa n Diego, CA, 315-400. MASTER, L . L. , FLACK , S . R . & STEIN , B . A . (eds ) 1998.

158

C. LYDEAR D £rAL.

Rivers of Life: Critical Watersheds for Protecting Freshwater Biodiversity. Th e Natur e Conservancy , Arlington, VA. MAYDEN, R. L. 1997. A hierarchy o f species concepts: the denouement in the sag a o f the specie s problem . In : CLARIDGE, M . E , DAWAH , H. A . & WILSON , M . R . (eds) Species: the Units o f Biodiversity. Chapman & Hall, New York. MISHLER, B . D . & BRANDON , R . N . 1987 . Individuality, pluralism, an d th e phylogeneti c specie s concept . Biology an d Philosophy, 2, 397-414. & DONOGHUE, M. J. 1982 . Species concepts : a case for pluralism . Systematic Zoology, 31, 491-503. MULVEY, M. , LYDEARD , C., PYER , D . L. , HICKS , K . M. , BRIM-BOX, J. , WILLIAMS , J . D . & BUTLER , R . S . 1997. Conservatio n genetic s o f Nort h America n freshwater mussel s Amblema an d Megalonaias. Conservation Biology, 11 , 868-878. NEVES, R . J., BOGAN , A . E. , WILLIAMS , J . D. , AHLSTEDT , S. A. & HARTFIELD, P. W 1997 . Status o f aquati c mollusks i n th e southeaster n Unite d States : a downward spira l o f diversity . In : BENZ , G . W . & COLLINS, D . E . (eds ) Aquatic Fauna i n Peril: th e Southeastern Perspective. Specia l Publicatio n 1 , Southeast Aquati c Research Institute , Lenz Desig n & Communications, Decatur , GA, 43-85. NIXON, K . C. & WHEELER , Q . D. 1990 . An amplificatio n of th e phylogeneti c specie s concept . Cladistics 6 , 211-223. OORTMANN, A . E . 1912 . Notes upo n th e familie s an d genera o f th e najades . Annals o f th e Carnegie Museum, 8 , 222-365, pis 18-20. 1923. Th e anatom y an d taxonom y o f certai n Unioninae an d Anondontina e fro m th e Gul f drainage. Th e Nautilus, 36, 73-85. & WALKER , B . 1922 . A ne w genu s an d specie s o f American naiades. Th e Nautilus, 35, 1-6 . ROE, K . J. & LYDEARD, C. 1998. Molecular systematic s of the freshwate r musse l genu s Potamilus (Bivalvia : Unionidae). Malacologia, 39, 195-205. SERNO, P. C. 1999 . Definitions in phylogenetic taxonomy : critique an d rationale . Systematic Biology, 48 , 329-351. SIMPSON, C. T. I900a. Synopsis o f the Naiades, o r pearly

fresh-water mussels . Proceedings o f th e United States National Museum, 22, 501-1044. 1900&. New an d unfigured Unionidae. Proceedings of the Academy of Natural Sciences of Philadelphia, 52, 74-86, pis 1-5 . 1914. A Descriptive Catalogue o f th e Naiades, o r Pearl Freshwater Mussels. An n Arbo r Press , An n Arbor, MI. SWOFFORD, D . L . 1998 . PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4.0bl. Sinauer Associates Inc. , Sunderland, MA. SYSTEMATICS AGENDA . 2000 . 1994 . Systematics Agenda 2000: Charting the Biosphere. Technical Report. Society o f Systematic Biologists, America n Society o f Plant Taxonomists, Will i Hennig Society , Association o f Systematics Collections , Ne w York. TEMPLETON, A . R. 1983a . Convergent evolutio n an d nonparametric inference s fro m restrictio n fragment and DNA sequenc e data . In : WEIR , B . (ed. ) Statistical Analysis o f DN A Sequence Data. Marce l Dekker , New York , 151-179. 1983/7. Phylogeneti c inferenc e fro m restrictio n endonuclease cleavag e sit e map s wit h particula r reference t o th e evolutio n o f human s an d apes . Evolution, 37, 221-244. TURGEON, D . D. , QUINN , JR , J . E , BOGAN , A . E . E T AL.

1998. Common an d Scientific Names o f Aquatic Invertebrates from the United States and Canada: Mollusks, 2n d edition. America n Fisherie s Society , Special Publicatio n 26 , Bethesda, MD. WHEELER, H . E . 1935 . Timothy Abbott Conrad, with Particular Reference to his Work in Alabama One Hundred Years Ago. Paleontologica l Researc h Institution, Ithaca, New York. WILLIAMS, J . D . & BUTLER , R . S . 1994 . Freshwate r bivalves. In : DEYRUP , M . & FRANZ , R . (eds ) Rare and Endangered Biota of Florida. Volume IV. University Press of Florida, Gainesville, 53-128 . , WARREN, M . L . JR, CUMMINGS, K. S., HARRIS, J . L . & NEVES , R . J . 1993 . Conservatio n statu s o f freshwater mussels of the United States and Canada. Fisheries, 18, 6-22. WRIGHT, B . H . 1899 . New souther n unios. The Nautilus, 13, 22-23.

On becoming cemented: evolutionary relationships among the genera in the freshwater bivalv e family Etheriida e (Bivalvia: Unionoida ) ARTHUR E. BOGAN1 & WALTER R. HOEH2 1 NorthCarolina State Museum of Natural Sciences, Research Laboratory, 4301 Reedy Creek Road, Raleigh, NC 27607, USA (e-mail: arthur. bogan @ncmail.net) 2 Department of Biological Sciences, Kent State University, Kent, OH 44242, USA Abstract: A robust phylogeny for the Unionoida is emerging and presumed relationships of some major clades are being questioned. The Etheriidae or freshwater oyster s ha s been a distinct famil y for ove r 16 0 years an d currentl y contain s thre e cemente d genera : Acostaea (Columbia , Sout h America), Pseudomulleria (India ) an d Etheria (Afric a an d Madagascar) . Starobogato v (1970 , Nauka, 1-372) , Mansur an d da Silva (1990 , Amazoniana, 11(2), 147-166 ) an d Bonetto (1997 , Biociencias, 5, 113-142) present conflicting testabl e hypotheses regarding the evolution o f these taxa. Usin g cytochrom e c oxidase subuni t I DN A sequence s th e evolutionar y relationship s of these three genera has been examined, by comparing them to representatives of 30 other unionoid taxa fro m aroun d th e world . Thes e analyse s plac e Acostaea an d Etheria withi n th e Mycetopodidae whil e Pseudomulleria fall s withi n th e Unionidae . A monophyleti c Etheriidae , composed o f cemente d freshwate r bivalves , i s no t supporte d b y th e presen t analyses . Furthermore, the analyses indicat e that cementation in the Unionoida has evolved at least twice.

In a pape r whic h discusse s th e evolutio n o f cementing bivalves , Yong e (1979 ) identifie d th e variety, origi n an d problem s o f convergenc e i n them, finding that over 20 families of bivalves have become cemented. This paper focuses on a group of bivalves which has become cemented in freshwater, namely, th e freshwate r oyster s (Unionoida : Etheriidae). Bivalves foun d i n freshwate r environment s represent familie s from mos t of the majo r bivalv e subclasses (Boga n 1993) . Th e greatest diversit y in freshwater bivalve s is found i n the radiation of the Unionoida. Currently this order is divided into two superfamilies, si x families and, it is estimated here, approximately 18 0 genera. The two major moder n unionoid radiation s occurre d i n th e southeaster n United State s (Boga n 1993 , 1998; William s e t al 1993) and China (Liu 1979) . Ou r understanding of evolutionary relationship s withi n the Unionoida i s based primaril y o n comparativ e anatom y (e.g. Simpson 1900 , 1914; Ortmann 1912 ; Parodiz & Bonetto 1963 ; Hear d & Guckert 1970) . The famil y Etheriida e ha s been recognized as a distinct taxo n fo r wel l ove r 16 0 year s (e.g. Deshayes 1830; Tr y on 1884 ; Fische r 1886 ; Thiel e 1934; Starobogato v 1970 ) but th e evolutionar y relationships o f thi s famil y t o othe r unionoi d families, an d amon g it s constituen t genera , hav e

been debated (se e Discussion). Most malacologist s recognize thre e cemente d gener a i n th e Etheriidae: Acostaea (Columbia , Sout h America) , Pseudomulleria (India ) an d Etheria (Afric a an d Madagascar). Prashad (1931) examined the convergence in the forms o f the freshwater bivalve fauna o f Southeas t Asia and compared it with similar fauna from South America. A t that time, he fel t tha t the Unionoide a was polyphyletic and the Mutelidae with a taxodont hinge was derived fro m th e Arcidae. H e suggeste d that the Etheriidae relationship s wer e undoubtedly with the Unionidae and that they were not related to the Mutelidae. Prashad also noted the similarities of Etheria, Acostaea and Pseudomulleria but felt they all belonge d t o distinc t gener a wit h independen t origins an d observe d tha t 'th e Etheriida e presen t the mos t noteworth y example s o f th e paralle l evolution o f simila r form s fro m distinc t ancestra l types, livin g unde r identica l condition s i n widel y separated countries. ' Prashad' s idea s represent th e multiple origin s hypothesi s fo r th e evolutio n o f cementation in the Unionoida. In contrast , Yonge (1978, p . 446), i n discussin g Acostaea an d th e evolutio n o f th e Etheriidae , posited, 'Certainl y Acostaea an d Pseudomulleria must have arisen from a common dimyarian stock; the mod e o f growt h an d o f assumptio n o f th e

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177, 159-168. 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

160

A. E . BOGA N & W . R. HOE H

monomyarian conditio n ar e to o remarkabl e fo r convergence t o b e contemplated. ' Yong e (1978 ) claimed that Acostaea, Etheria and Pseudomulleria were, in fact, eac h other s closest relative s an d so a monophyletic Etheriidae wa s supported. This is the single origi n hypothesi s fo r th e genesi s o f cementation in the Unionoida.

Development of a unionoid phylogeny Recent wor k o n th e evolutionar y relationship s among unionoi d highe r tax a ha s progresse d fro m the effort s o f Parodiz & Bonetto (1963) an d Heard & Gucker t (1970 ) t o th e immunoelectrophoreti c analyses o f Davi s & Fulle r (1981) . Th e cladisti c analysis o f 16 S DN A an d morpholog y dat a set s presented b y Lydear d e t al. (1996 ) ha s clarifie d phylogenetic relationship s amon g a numbe r o f North America n unionoi d genera , bu t di d no t include potentiall y closel y relate d tax a fro m othe r continents or a suitable outgroup taxon. Hoeh e t a l (1998£ ) examine d th e highe r leve l relationships o f th e Unionoid a base d o n cyto chrome c oxidas e subuni t I (COI ) sequence s an d supported th e hypothesi s tha t Neotrigonia (Trigonioida: Trigoniidae ) i s th e siste r grou p t o a monophyletic Unionoida . Thes e conclusion s support th e monophyl y o f th e Palaeoheterodont a (Trigonioida + Unionoida ) a s propose d b y Walle r (1990, 1998) . Hoeh et al (19980 ) presente d a COI sequence-based phylogen y fo r th e Unionoid a including 3 0 tax a representin g fiv e familie s (excluding representatives of the Etheriidae). Thei r analyses sugges t tha t th e hyriids , no t margariti ferids, ar e a product o f th e mos t basal cladogeni c event within the Unionoida an d that the glochidia l larvae i s th e ancestra l larva l type . Th e margariti ferids, mycetopodids, iridinids an d hyriids were all depicted a s monophyleti c groups , wit h th e Unionidae bein g paraphyletic . Hoe h e t a l (2001 ) have expanded on the data presented in Hoeh et a l (I998a) b y addin g a morphological dat a se t o f 2 8 characters an d produce d a tota l evidence-base d phylogeny fo r th e Unionoida . Th e tota l evidenc e analysis supporte d th e earlie r phylogen y an d character evolutio n hypothese s o f Hoe h e t a l (1998a). If it is assumed that the tree based on th e total evidenc e analysi s is a reasonable estimat e o f unionoid evolutionar y history, then morphological character evolution within the Unionoida was very homoplasious. Etheriid genera The Etheriida e a s use d toda y contain s thre e cemented genera : Acostaea, Etheria an d Pseudomulleria. Acostaea rivoli (Deshaye s 1830 )

was originall y describe d i n Mulleria Ferussac , 1823 [non Leach 1814 ] an d subsequently moved to Acostaea Orbigny , 1851 . Acostaea i s know n fro m the Ri o Magdalen a i n Columbia , Sout h America . Arteaga Sogamos o (1994 ) discovere d tha t th e larvae of Acosataea rivoli is a lasidium which, from the diagnoses o f the family Mycetopodidae, woul d argue that Acostaea belongs i n this family. The anatomy of Etheria elliptica Lamarck, 180 7 has bee n reported , illustrate d an d discusse d b y Rang & Cailliau d (1834 ) an d Anthon y (1905 , 1907). Heard & Vail (1976) examine d the anatomy of Etheria elliptica and suggested tha t it belongs in the Sout h America n famil y Mycetopodidae . Etheria elliptica is widespread i n Africa: the basins of the Nile, Lake Tanganyika and Lake Victoria; the basins of the Chad, Zaire, Nige r an d Senegal; par t of th e river s i n Angol a an d nort h Madagasca r (Daget 1998) ; and it is known from th e Miocene of northeast Zair e (Gautie r 1965 ; Gautie r & Va n Damme 1973) . Specimens o f Pseudomulleria dalyi (Smit h 1898), fro m th e Budr a Drainage , Kadu r district , State o f Mysore , souther n India , wer e initiall y placed i n th e genu s Mulleria an d i n th e famil y Etheriidae. Smit h (1898) observed that P. dalyi wa s cemented b y eithe r th e righ t o r th e lef t valves . Woodward (1898) , i n th e sam e volume , carefully described th e anatom y o f Pseudomulleria dalyi, reported the monomyarian condition and noted that the rectu m n o longe r passe d throug h th e heart . Woodward (1898 ) presente d a cross-sectio n diagram o f the anatom y an d figure d the coilin g o f the intestine . The intestina l coiling , a s figure d b y Woodward, appear s ver y simila r t o th e intestina l coiling o f examine d Nort h America n Unionida e (AEB, persona l observations) . Woodwar d (1898 ) concluded '.. . th e detail s o f th e gills , th e mantle lobes, and the kidney, Mulleria [ = Pseudomulleria] approximates to the Unionidae.' However , Preston (1915) placed Mulleria dalyi i n the Etheriidae an d cited extensivel y from Woodwar d on the anatomy. The mos t recen t coverag e o f th e freshwate r molluscan faun a o f Indi a b y Subb a Ra o (1989 ) follows th e taxonomy of the family put forward by Thiele (1934) , recognizin g Pseudomulleria a s a subgenus of Acostaea, Yonge (1953 ) recognize d a singl e genu s o f monomyarian unionoid , Acostaea, wit h tw o subgenera, Acostaea, an d Pseudomullaria. Bot h subgenera wer e monotypic an d both specie s begin life a s a youn g shel l whic h i s dimyaria n an d no t cemented. Yong e (1953 ) note d n o evidenc e fo r initial byssa l attachmen t an d observe d tha t cementation take s plac e an d growt h continue s a t the anterio r en d o f th e shel l wit h th e subsequent loss of the anterior regions o f the mantle, shell and the anterior adductor muscles.

FRESHWATER CEMENTIN G BIVALVE S

Family level classification Deshayes (1830) erected th e family Etheriidae fo r Etheria Lamarck , 180 7 an d fo r man y year s i t contained only Etheria. Lamarck (1819) placed the group close to the Chamidae and thought the group was marine, which confused th e placement o f this family (Fischer 1886) . Swainson (1835) recognized the gener a Etheria and Mulleria bu t place d the m not withi n th e Unionida e bu t rathe r withi n hi s Ostredea (sic), o r oysters . Swainso n (1840 ) recognized th e famil y Etheriida e an d include d Etheria an d Mulleria, an d place d th e famil y between th e Unionida e an d Ostreida e completin g his circle of related families . Tryon (1884 ) an d Fische r (1886 ) place d th e Etheriidae next to the Unionidae and included three genera: Etheria, Mulleria ( + Acostaea) an d Bartlettia. Simpso n (1896 , 1900 , 1914 ) di d no t mention th e Etheriida e i n an y o f his treatment s of the unionoid bivalves. Germain (1907) placed Etheria in the Etheriinae, which he considered a subfamily of the Unionidae because th e juvenil e Etheria looke d lik e a n Anodonta. Later , Dautzenber g & Germai n (1914) recognized Etheria a s belongin g t o a separat e family, Etheriidae , bu t di d no t commen t o n thi s change of rank. Thiele (1934 ) recognize d th e superfamil y Unionacea an d include d Margaritiferidae , Unionidae, Mutelida e an d Etheriida e [Bartlettia, Etheria, Acostaea (Acostaea) an d A . Pseudomulleria}. Model l (1942 , 1949 ) develope d an alternative classification fo r th e Unionoida. H e placed Acostaea an d Bartlettia i n a subfamil y Bartlettiinae, an d Etheria an d Pseudomulleria in the Etheriinae , bot h subfamilie s i n hi s inclusiv e Mutelidae. H e late r (Model l 1964 ) modifie d hi s ideas on the cemented bivalve placement, including only Etheria i n th e Etheriina e an d includin g Pseudomulleria a s a subgenu s unde r Acostaea, which he moved to the Bartlettiinae . Mandahl-Barth (1954 ) liste d Etheria i n th e Etheriinae withi n the Mutelida e an d subsequentl y (1988) decided that the group should have familial status. Pai n & Woodwar d (1961 ) reviewe d th e family Etheriida e an d included Etheria, Bartlettia, Acostaea an d Pseudomulleria. The y elevate d Pseudomulleria fro m subgeneri c t o generi c ran k based o n the disparat e distributio n o f Acostaea in South America and Pseudomulleria in India. Newell (1965) provided a complete classificatio n of the Bivalvia and placed al l of the living familie s of unionoi d bivalve s i n th e singl e superfamil y Unionacea, recognizin g fou r families ; Unionidae , Mutelidae, Etheriida e an d Margaritiferidae . Haa s (1969a, b ) recognize d th e familie s Etheriidae , Margaritiferidae, Mutelida e an d Unionidae , al l

161

within a singl e superfamily , th e Unionacea . H e included Etheria, Barlettia and Acostaea with two subgenera, Acostaea an d Pseudomulleria, i n th e Etheriidae. Starobogatov (1970 ) spli t wha t other s ha d lumped as the Etheriidae, placin g the three gener a into distinct families: Acostaea in the Mulleriidae , along wit h th e Mycetopodidae , formin g th e Mullerioidea; Etheria remained i n Etheriidae; an d Pseudomulleria i n Pseudomulleriidae , bot h families placed in the Etherioidea. Van Damme (1984 ) summarize d the freshwater molluscs o f norther n Afric a an d use d th e famil y Etheriidae. Kaba t (1997) provide d a n examination of the dates and priority of the various family group names fo r th e Etherioidea : Etheriida e Deshayes , 1830, Iridinidae Swainson , 1840(+ Mutelidae Gray 1847) an d Mycetopodida e Gray , 1840 , wit h thes e being the oldest availabl e names. Mansur & da Silv a (1990) recently supporte d a monophyletic vie w o f th e Etheriidae , includin g Bartlettia, based on anatomical analyses. However, Bonetto (1997 ) ha s place d Acostaea i n th e Acostaeinae i n th e Mycetopodidae , Etheria in th e Etheriinae an d Pseudomulleria i n th e Pseudo mulleriinae, wit h bot h subfamilie s place d i n th e Mutelidae. Recently, Daget (1998) has produced a complete catalogue o f the freshwate r bivalves of Africa an d has recognized a single genus within the Etheriidae, Etheria, wit h a singl e specie s Etheria elliptica Lamarck, 1807 . Thi s volum e contain s a ver y detailed listin g o f fou r generi c synonyms , 2 0 specific synonym s and a listing o f citation s usin g the various names and combinations. Good (1998) , i n discussin g th e Lat e Triassi c freshwater bivalv e faun a o f th e Nort h America n southwest, place d th e Etheriida e withi n th e Unionoida bu t withou t furthe r comment . H e observed tha t th e Etheriida e originate d o n Gondwanaland but erroneously included Australia as part of their modern range. Other cemented freshwater bivalves Recently, Boga n & Bouche t (1999 ) describe d Posostrea, a cemented corbiculi d fro m Lak e Poso , Sulawasi, Indonesia . Thi s i s th e firs t recor d o f cementation in the Corbiculidae an d represents the only known cemented freshwater bivalve outside of the Unionoida. Fossil record The fossi l recor d fo r th e thre e etherii d gener a examined her e i s restricte d t o Etheria, whic h occurs i n th e Miocen e (Gautie r 1965 ; Gautie r & Van Damm e 1973 ) o f Eas t Africa . Nothin g i s

162

A. E . BOGA N & W. R. HOE H

known of the fossil recor d regarding Acostaea and Pseudomulleria. The work s of Starobogato v (1970 ) an d Bonetto (1997), a s well as that of other authors, contradict the monophyleti c natur e o f th e Etheriidae , whic h has been supported most recently by Mansur & da Silva (1990), b y suggesting that the Etheriidae is a polyphyletic assemblage. The conflicting views on the evolutionar y relationship s surroundin g th e Etheriidae hinde r th e developmen t o f a basi c understanding of the circumstances involved in the evolution o f th e cemente d habi t i n freshwate r bivalves. Phylogeneti c analyse s o f CO I DN A sequences wil l b e use d herei n t o evaluat e th e taxonomic statu s o f th e Etheriidae , i.e . i s th e Etheriidae a monophyleti c assemblage ? Thes e analyses wil l enabl e th e followin g fundamental evolutionary question s t o b e addressed : di d th e cemented habi t i n unionoid s evolv e onc e (o r multiple times) ; fro m whic h non-cemente d ancestral taxon (or taxa) did it evolve?

Materials an d method s Organisms The 34 bivalve species examine d in this study are listed i n Tabl e 1 wit h thei r GenBan k accessio n numbers fo r th e CO I sequences . Th e CO I sequences representing the three etheriid genera are the onl y ne w sequence s adde d i n thi s paper . Th e other CO I sequence s hav e bee n analyse d previously i n Hoeh e t al (1996 , 1998« , b , 2001) . The name s fo r th e Nort h America n tax a follow TurgQonetaL (1998) .

Methods Total DN A wa s isolate d fro m somati c (mantle ) tissues fro m individual s representin g Acostaea, Etheria and Pseudomulleria. Male gonadal tissues were specificall y avoide d t o preven t comparison s of non-orthologous sequence s du e t o the actua l or potential presenc e o f doubl y uniparenta l inheritance o f mitochodria l (mt)DN A i n som e bivalve taxa (e.g. see Skibinski et al 1994 ; Zouros etal. 1994; Hoeh et al. 1996 , 1997) . Subsequently, a 71 0 bas e pai r (bp ) fragmen t o f CO I wa s polymerase chai n reactio n (PCR ) amplifie d an d cycle sequence d fo r eac h o f th e thre e tax a a s described elsewher e (Folme r e t a l 1994) . Bot h strands o f the COI fragmen t wer e sequenced fro m each of two individuals to guard against PCR-based contamination artifacts . Th e resultin g sequence s were readil y aligne d b y eye , usin g MacClad e (Maddison & Maddiso n 1997) , wit h th e on e trigonioid and 30 unionoid COI sequences analysed previously (Hoe h e t a l 19980) . O f th e 3 4 tota l

Table 1 . List o f specimens used i n this analysis an d their associated GenBank accession numbers Taxa

GenBank numbers

In-group, Order Unionoida Superfamily Etherioidea, Family Etheriidae Etheria elliptica Lamarck , 180 7 AF23174 Acostaea rivoli (Deshayes, 1827 ) AF23173 Pseudomulleria dalyi (Smith , 1898 ) AF23175

2 9 0

Family Iridinidae Mutela dubia (Gmelin , 1791 ) AF23173 Mutela rostrata (Rang, 1835 ) U5684

7 9

Family Mycetopodidae Anodontites guanarensis Marshall , 192 7 AF23174 Anodontites trigonus (Spix , 1827 ) AF23173 Monocondylaea minuan a (d'Orbigny , 1835 ) AF23174 Superfamily Unionoidea, Family Hyriidae Castalia stevensi (H . B. Baker, 1930 ) Diplodon deceptus (Simpson , 1914 ) Hyridella menziesi (Gray, 1843 ) Lortiella rugata (Sowerby , 1868 ) Velesunio angasi (Sowerby , 1867 )

1 8 5

AF231736 AF231744 AF231747 AF231746 AF231743

Family Margaritiferidae AF231753 Cumberlandia monodonta (Say , 1829 ) Margaritifera margaritifera (Linnaeus , 1758 ) U56847 Family Unionidae Actinonaias ligamentina (Lamarck , 1819 ) Amblema plicata (Say , 1817 ) Anodonta cygnea (Linnaeus , 1758 ) Coelatura aegyptiaca (Cailliaud , 1827 ) Cyrtonaias tampicoensis (Lea , 1838 ) Elliptic dilatata (Rafinesque , 1820 ) Fusconaia flava (Rafinesque , 1820 ) Glebula rotundata (Lamarck , 1819 ) Gonidea angulata (Lea , 1838 ) Ligumia recta (Lamarck, 1819 ) Pleurobema clava (Lamarck, 1819 ) Potamilus alatus (Say , 1817 ) Pyganodon grandis (Say , 1829 ) Quadrula quadrula (Rafinesque , 1820 ) Strophitus undulatus (Say , 1817 ) Toxolasma lividus (Rafinesque , 1831 ) Unio pictorum (Linnaeus, 1758 ) Unio tumidus (Retzius , 1788 ; 2 )

AF231730 U56841 U56842 AF231735 AF231749 AF231751 AF231733 AF231729 AF231755 AF231748 AF231754 AF231752 AF231734 AF231757 AF231740 AF231756 AF231731 AF231732

Outgroup, Orde r Trigonioid a Neotrigonia margaritacea (Lamarck , 1804) .

U56850

aligned COI sequences, 33 were of identical length (= 630bp) whil e tha t o f Acostaea ha d a singl e inferred codo n deletio n ( = 627bp). Th e autapo morphic natur e o f th e inferre d singl e codo n deletion i n Acostaea (i.e. i t is not share d wit h any other taxon) excludes this mutation from playin g a role in the subsequent phylogenetic analyses. The suitabilit y o f th e CO I dat a se t fo r

FRESHWATER CEMENTIN G BIVALVE S

phylogenetic analyses at this hierarchical leve l was evaluated b y plottin g th e substitutio n patter n o f transitions and transversion s for eac h codo n position (e.g . see Hoeh et al 1998&) . Furthermore, the degre e o f phylogeneti c signa l withi n the CO I data se t wa s evaluate d usin g th e g t statisti c o f a random tree distribution (fro m 1 0 000 000 random trees; e.g . se e Hilli s 1991 ; Hilli s & Huelsenbec k 1992) an d th e permutatio n tai l probabilit y (FTP ) test (Fait h & Cransto n 1991 ) a s implemente d i n PAUP * (Swoffor d 1998) . Phylogeneti c analyse s were carried ou t on the COI nucleotide sequence s using th e maximu m parsimon y (MP ) algorith m contained i n PAUP * (Swoffor d 1998) . Base d o n previous morphologica l (e.g . se e Atkin s 1937 ; Taylor e t a l 1969 , 1973 ; Teves z 1975 ; Popha m 1979; Teves z & Carter 1980 ; Smit h 1986 ; Heal y 1989; Walle r 1990 ) an d molecula r (Hoe h e t a l 1998/?) systemati c analyse s tha t indicate d th e Trigonioida i s th e siste r taxo n t o a monophyleti c Unionoida, Neotrigonia margaritacea wa s used to root the resulting topologies. One thousand random terminal taxon addition orde r runs, combined with global branc h rearrangemen t options , wer e employed t o generat e topologie s fro m th e M P analysis (al l substitution s received equa l weight) . These option s increase d th e probability o f finding the bes t topolog y unde r th e parsimon y criterio n (e.g. se e Maddiso n 1991) . Th e robustnes s o f th e resulting topologie s wa s evaluate d b y bootstra p (10 000 replicates) an d jackknife (50% deletion fo r 1000 replicates ) analyses . I n addition , characte r mapping, using MacClade (Maddison & Maddison 1997), was performed on the COI-based topologies to investigate their implications for the evolution of cementation within the Unionoida.

Results Scatter plot s o f th e relationshi p between th e number o f transitiona l an d transversiona l sub stitutions, an d th e percentag e o f tota l uncorrecte d sequence divergenc e a t eac h o f th e thre e codo n positions for the COI sequences, revealed that only transitional substitution s at the third codon position had reache d saturatio n (plot s no t shown) . Sinc e saturated categorie s o f substitutio n ca n contribut e to erroneous estimates of evolutionary history (e.g . see Swoffor d e t a l 1996) , al l firs t an d secon d position substitutions , togethe r wit h onl y trans versions at the third codon position, wer e included in the phylogenetic analyses. Of the 630 nucleotide positions i n the transformed COI data matrix, 383 were constan t whil e 19 4 wer e parsimon y informative. Analysis of the tree length distribution of 1 0 000 000 randoml y generate d trees , usin g al l 34 sequences, suggeste d tha t there i s a significant amount o f hierarchica l structur e withi n th e

163

transformed CO I dat a se t (g t =-0.487; wit h 24 7 variable sites , p<0.01 ; Hilli s & Huelsenbec k 1992). A PTP test o n the transforme d matrix als o indicated significan t hierarchica l structur e (P = 0.001). Th e finding s fro m th e plot s o f substitution pattern , g j statistic s an d the PT P tes t are consisten t wit h the hypothesi s tha t significan t phylogenetic signa l exist s i n the transformed COI nucleotide data matrix and validates it s use in this particular phylogeneti c contex t (e.g. se e Swoffor d et al 1996) . The stric t consensu s tree , derive d fro m te n equally parsimoniou s tree s (eac h o f 87 9 steps ; retention inde x = 0.5551 ) an d produce d b y M P analysis of the transformed COI nucleotide matrix , is presented i n Fig. 1 , along with bootstrap (abov e branches, 1 0 000 replicates ) an d jackknife (belo w branches, 100 0 replicates ) percentage s (onl y percentages > 50% are shown).

Discussion Evolutionary relationships within the Unionoida All te n equall y parsimoniou s tree s resultin g fro m analyses of the transformed COI nucleotide matri x supported th e monophyl y o f th e Hyriidae , Margaritiferidae, Iridinidae , Mycetopodida e an d Etherioidea (Mycetopodidae , Iridinida e an d Etheriidae) (e.g . Fig. 1) . However, the Unionoide a (Unionidae, Margaritiferidae, Hyriidae ) wa s foun d paraphyletic sinc e th e etherioid s ar e more closel y related t o the unionids tha n ar e the hyriids. Thes e higher leve l phylogeneti c relationship s withi n th e Unionoida are congruent with the results of Hoeh et al (19980 , 2001). The concept of the Etheriidae a s a monophyletic bivalve famil y containin g al l o f th e cemente d unionoid gener a i s rejecte d b y th e CO I sequenc e analyses herein. Rather , the Etheriidae is shown to be a polyphyleti c concep t becaus e tw o o f th e 'etheriid' gener a ar e closel y relate d t o myceto podids (Acostaea an d Etheria) whil e anothe r (Pseudomulleria) i s a unionid . Constrainin g th e parsimony analysi s t o produc e a monophyleti c Etheriidae produce d thre e equall y parsimoniou s trees o f 90 0 step s each . Thes e tree s ar e 2 1 step s (2.4%) longe r tha n th e unconstraine d trees . Therefore, th e analysi s o f CO I nucleotide s con tained herei n reject s the notio n o f a monophyletic Etheriidae. Furthermore , thes e result s sugges t that cementation evolve d a t leas t twic e (thre e time s if Deltran characte r optimizatio n i s used) within the Unionoida, and that it arose from both etherioid and unionid ancestors (Fig. 1) . Figure 1 clearly show s that, a s currently recog nized, the Etheriidae i s polyphyletic. However , the

164

A. E . BOGA N & W. R. HOE H

Fig. 1 . Strict consensu s tre e ofte n equall y parsimoniu s trees . Tree length : 87 9 steps; retention inde x = 0.5551. Numbers abov e th e branches ar e parsimony bootstra p percentage s based o n 1 0 000 replicates and those number s below th e line are parsimony jackknif e percentages based o n 100 0 replicates . Current famil y name s ar e listed on the right-hand sid e of the tree. Neotrigonia belong s t o the Trigoniidae, Trigonioida , an d is used as the outgroup (Hoe h e t al 1998&) . The three independen t origin s o f cementation, whic h are indicated b y Deltran characte r optimization, ar e mapped ont o the topology wit h hash marks.

present analyses used representatives of only 27 out of abou t 18 0 recognize d unionoi d genera . Th e topologies o f th e tree s an d evolutionar y relationships o f majo r clade s ma y continu e to chang e a s more tax a ar e added . Furthermore , du e t o th e incongruence betwee n th e tree s generate d fro m COI an d anatomical dat a set s (Hoe h e t al 2001) , and th e relativel y wea k suppor t fo r mos t basa l nodes (Fig . 1) , i t i s ver y prematur e t o reassig n higher taxa based on the clades produced herein. The CO I analysi s implie s tha t Pseudomulleria

falls withi n th e 'unionid ' clade . Th e Pseudomulleria placement on the tree (Fig. 1 ) suggests that the larva l structure , whe n discovered , wil l b e a glochidium. Morrison (1973 ) separate d thi s genus from Acostaea because the nacre was different. H e felt tha t Pseudomulleria belonge d withi n hi s Unionacea. Acostaea appear s closel y relate d t o th e Mycetopodidae (Fig . 1) . Morriso n (1973 ) place d the Acostaeidae close t o the Mycetopodidae in the Mutelacea a s then recognized. Arteag a Sogamos o

FRESHWATER CEMENTIN G BIVALVE S

(1994) confirmed that the Acostaea larval form was the lasidium. Etheria als o appear s closel y relate d t o th e Mycetopodidae but ther e is very weak support for this placement (Fig . 1) . The placemen t o f Etheria with th e Mycetopodida e herei n corroborate s th e hypothesis o f Hear d & Vail (1976). Hear d & Vail (1976) suggeste d tha t th e spli t o f th e Sout h American an d Africa n 'Mutelids ' int o Myceto podidae and Iridinidae based on geography needs to be re-examined , an d tha t som e Sout h America n genera suc h a s Leila actuall y belon g t o th e Iridinidae an d not the Mycetopodidae .

Cementation in freshwater bivalves: hypotheses Freshwater cemente d bivalve s hav e a tropical / subtropical distributio n whil e th e area s o f highes t unionoid diversity occu r in more temperate zones . What has influenced the biogeography of cemented freshwater bivalves ? Harpe r (1991 ) suggeste d a driving forc e i n th e evolutio n o f cementatio n i n marine bivalve s i s predatio n b y suc h group s a s crabs (Crustacea ) an d starfis h (Echinoderms) . Harper (1991 ) performe d a tes t o f th e predatio n hypothesis o n byssall y attache d v . cemente d bivalves an d foun d a significantl y higher leve l of predation on those animals attached with a byssus. She suggest s that cementation , as recorde d i n th e fossil record, may be due to the concurrent development o f crustacea n an d echinoder m bivalv e predators and notes their co-occurrence in the fossil record. Harper's (1991 ) ide a o f predatio n a s a drivin g force i n th e origi n o f cementatio n o f marin e bivalves can be extended to freshwater. In this case, the freshwater crayfis h and crabs may substitute for their marin e relative s an d th e echinoderms . A problem wit h thi s hypothesi s arise s i n Nort h America wit h th e world' s greates t diversit y o f Unionoidea (William s e t al 1993 ) an d a n equally diverse freshwater crayfish fauna but no freshwater crabs (Hobb s 1989 ; Taylo r et al 1996) . There are no cemented freshwater bivalves in North America. The same holds for Europe and northern Asia (Liu 1979) wher e ther e ar e crayfis h bu t n o cemente d bivalves or freshwate r crabs . The tropic s of Southeast Asia are home to Modellnaia, a crevassedwelling unionoid (Brandt 1974), an d Posostrea, a cemented corbiculid . Bot h o f thes e specie s apparently liv e wit h freshwate r crabs . Sout h America ha s a variet y o f freshwate r bivalves , which include s th e cemente d Acostaea an d th e crevasse-dwelling unionoid Bartlettia, as well as a variety of freshwater crabs . The same picture holds for Africa wit h Etheria, and is assumed to be true

165

for India with Pseudomulleria. Is the occurrence of cemented freshwate r bivalve s a reactio n t o predation b y crabs ? If thi s i s th e case , wh y i s th e number of cemented species s o low? An alternativ e hypothesi s woul d b e tha t th e cemented freshwater bivalves represent a relatively recent opportunisti c movemen t o f specie s int o high-energy environment s an d th e evolutio n o f local specie s int o crevass e dwellers , suc h a s Bartlettia i n Sout h Americ a an d Modellnaia i n Thailand. This scenario of local species evolving to fill th e cemented oyster niche in freshwater would explain wh y th e differen t cemente d bivalve s ar e from differen t families . Thi s migh t b e th e reaso n for th e development o f Posostrea in the absence of unionoids i n ancien t Lak e Poso . I n th e cas e o f Etheria, Acostaea an d Pseudomulleria, the y became full y cemente d a s oppose d t o crevass e dwellers. Acostaea and Pseudomulleria both begin life a s a dimyarian shel l an d later becam e wedge d in th e substrat e an d develope d int o cemente d freshwater oysters . Thes e tw o specie s tak e th e oyster habit to the extreme in becoming secondaril y monomyarian a s adult s (se e Yonge 1979) . How ever, thi s ecologica l nich e hypothesi s fail s t o explain the lack of cemented bivalve s in the highly diverse areas of the southeastern United States and China. We woul d lik e t o than k th e followin g colleague s fo r kindly donating specimens for this analysis: Jay Cordiero, AMNH, Ne w York , Ne w York , fo r th e specimen s o f Etheria fro m th e Congo ; Gami l Soliman , America n University, Cairo , Egypt , fo r th e Coelatura an d Mutela specimens from Egypt; Dr Madyashtha for the specimens of Pseudomulleria fro m India , an d Edga r Arteag a Sogamoso, Tolima , Columbi a fo r th e specimen s o f Acostaea. Paula Mikkelsen, AMNH, Kathie Way, BMNH and G . Thomas Walter s ar e al l gratefull y acknowledge d for thei r assistance with the literature. Gabriela M. Hogue very kindly provided a translation of the paper by Bonetto (1997).

References ANTHONY, R . 1905 . Influence d e la fixation pleurothequ e sur a l morphologi e de s mollusque s acephale s dimyaires. Annales de s Sciences Naturelles: Zoologie 9e. Series 1, 165-396, pis 7-9 . 1907. Etud e monographiqu e des Aetheriida e (Anatomie, morphogenie , systemematlque) . Annales de la Societe royale Zoologique et Malacologique d e Belgique, 41 , 322-430 , pi s 1 1 and 12 . ARTEAGA SOGAMOSO , E . 1994 . El Lasidiu m d e Acostae a rivoli Deshayes , 182 7 (Mollusca : Bivalvia : Etheriidae) y s u importanci a par a l a ubicacio n taxonomica d e est a especies . Boletin Ecotropica: Ecosistemas Tropicales, 27,1-9 . ATKINS, D . 1937 . O n th e ciliar y mechanism s an d

166

A. E . BOGA N & W . R. HOEH

interrelationships o f lamellibranchs. Part II: sorting devices o n th e gills . Quarterly Journal o f Microscopical Science, 79, 339-373. BOGAN, A . E . 1993 . Freshwate r bivalv e extinction s (Mollusca: Unionoida) : A searc h fo r causes . American Zoologist, 33(6), 599-609. 1998. Freshwater mollusca n conservatio n i n Nort h America: Problem s an d practices . Journal o f Conchology, Special Publication, 2, 223-230. & BOUCHET, P. 1999. Cementation in the freshwater bivalve family Corbiculidae (Mollusca : Bivalvia): a new genu s and species from Lak e Poso, Indonesia. Hydrobiologia, 389 , 131-139 . BONETTO, A . A . 1997 . La s 'ostra s d e agu a dulce ' (Muteloidea: Mutelidae) . S u taxonomi a y distribucion geografic a e n e l conjunt o d e la s Naiades de l Mundo. Biociencias, 5, 113-142. BRANDT, R . A . M . 1974 . Th e non-marin e aquati c Mollusca o f Thailand. Archiv fur Molluskenkunde, 105(1-4), 1-423. DAGET, J . 1998 . Catalogue raisonne de s Mollusques bivalves d'eau douce africains. Backhuy s Publishers, Leiden, and OSTROM, Paris. DAUTZENBERG, P . & GERMAIN , L . 1914 . Recolte s Malacologiques d u Dr . J. Bequear t dan s l e Cong o Beige. Revue Zoologique africaine, 4(1) , 1-73. DAVIS, G . M . & FULLER , S . L . H . 1981 . Geneti c relationships amon g recent Unionacea (Bivalvia ) of North America. Malacologia, 20(2), 217-253. DESHAYES, G . P . 183 0 [i n 1792-1832] . Mollusques . Volume 2 In : Encyclopedic methodique: histoire naturelle des vers. Panckoucke, Paris, 471-553. FAITH, D. P . & CRANSTON, P. S. 1991 . Could a cladogram this shor t hav e arise n b y chanc e alone ? O n permutation test s fo r cladistic structure . Cladistics, 7, 1-28 . FISCHER, P . 1880-1887 . Manuel d e Conchyliologie e t d e Paleontologie conchy liologique ou histoire naturelle de Mollusques vivants etfossiles. Librairi e F. Savy, Paris. FOLMER, O. , BLACK , M. , HOEH , W. , LUTZ , R . & VRIJENHOEK, R . 1994 . DN A primer s fo r amplification o f mitochondria l cytochrom e c oxidase subuni t I fro m divers e metazoa n invertebrates. Molecular Marine Biology an d Biotechnology, 3 , 294-299. GAUTIER, A. 1965 . Geological investigation in th e Sinda Mohari (Ituri, N.E. Congo), a monograph on the geological history of a region in the Lake Albert Rift. Ganda-Cong o Publications , Rijksuniversitei t Gent, 1-161 . & VAN DAMME, D. 1973 . A revision of the Miocen e freshwater mollusc s o f th e Mohar i Formatio n (Sinda-Mohari, Ituri , N . E . Zaire) . Annln. Kon. Mus. Midden Afrika, 8 , 45(8), 43-62. GERMAIN, L . 1907 . Le s Molluscque s terrestre s e t fluviatiles d e 1'Afriqu e Central e Francaise . In : CHEVALIER, A . (ed. ) 1'Afrique Central Franqaise. Mission Chari-Lac Tchad, 1902-1904. A . Challamel, Paris, 475-617, figs 5-100. GOOD, S . C . 1998 . Freshwate r bivalve fauna o f th e Lat e Triassic (Carnian-Norian ) Chinle , Dockum , an d Dolores Formation o f the Southwest United States . In: JOHNSTON , P . A . & HAGGART , J . W . (eds )

Bivalves: An Eon of Evolution - Paleobiological Studies Honoring Norman D. Newell. University of Calgary Press, Calgary, 223-249. HAAS, F . I969a. Superfamili a Unionacea . Da s Tierreich (Berlin), 88 . I969b. Superfamil y Unionacea . In : MOORE , R . C . (ed.) Treatise o n Invertebrate Paleontology. Part N. Mollusca I . Geologica l Societ y o f America and the University of Kansas, N411-N470. HARPER, E . M . 1991 . Th e rol e o f predatio n i n th e evolution of cementation in bivalves. Palaeontology 34(2), 455^60. HEALY, J . M . 1989 . Spermiogenesi s an d spermatozo a i n the relict bivalv e genu s Neotrigonia: Relevanc e t o trigonioid relationships , particularl y Unionoidea . Marine Biology, 103 , 75-85 . HEARD, W. H. & GUCKERT, R. H. 1970 . A re-evaluation of the recen t Unionace a (Pelecypoda ) o f Nort h America. Malacologia, 10(2), 333-355. & VAIL , V . A . 1976 . Anatomica l systematic s o f Etheria elliptica (Pelecypoda : Mycetopodidae . Malacological Review, 9,15-24. HILLIS, D. M. 1991 . Discriminating between phylogenetic signal an d rando m nois e i n DN A sequences . In : MIYAMOT, M. M. & CRACRAFT, J. (eds) Phylogenetic Analysis o f DN A Sequences. Oxfor d Universit y Press, New York, 278-294. & HUELSENBECK , J . P . 1992 . Signal , noise , an d reliability i n molecula r phylogeneti c analyses . Journal of Heredity, 83 , 189-195 . HOBBS, H . H. , J R 1989 . A n illustrate d checklis t o f th e American crayfishe s (Decapoda : Astacidae , Cambaridae, an d Parastacidae) . Smithsonian Contributions to Zoology, 480 . HOEH, W . R. , BOGAN , A . E . & HEARD , W . H . 2001 . A phylogenetic perspectiv e o n th e evolutio n o f morphological an d reproductiv e characteristic s i n the Unionoida. In: BAUER, G. & WACHTLER, G. (eds) Ecology and Evolutionary Biology of Freshwater Mussels [Superfamily Unionoidea]. Springe r Verlag, Berlin, 257-280. ,, CUMMINGS, K . S . & GUTTMAN , S . E. 1998a . Evolutionary relationships among the higher taxa of freshwater mussel s (Bivalvia : Unionoida) : inferences o n phylogen y an d characte r evolutio n from analyse s o f DN A sequenc e Data . Malacological Review, 31, 121-140. , STEWART , D. T. , SUTHERLAND , B. W . & ZOUROS , E . 1996. Multipl e origin s o f gender-associate d mitochondrial DNA lineages in bivalves (Mollusca: Bivalvia). Evolution, 50(6), 2276-2286. ,, SAAVEDRA , C. , SUTHERLAND , B . W . & ZOUROS, E . 1997 . Phylogeneti c evidenc e fo r role reversals o f gender-associate d mitochondria l DN A genomes i n Mytilus (Bivalvia : Mytilidae) . Molecular Biology and Evolution, 14, 959-967. , BLACK , M . B. , GUSTAFSON , R . G. , BOGAN , A . E. , LUTZ, R . A . & VRIJENHOEK , R. C . 1998£ . Testin g alternative hypothese s o f Neotrigonia (Bivalvia : Trigonioida) phylogeneti c relationship s usin g cytochrome c oxidas e subuni t I DN A sequences . Malacologia, 40 , 267-278. KABAT, A . 1997 . Correc t famil y name s fo r th e freshwater 'Muteloid ' bivalve s (Unionoida : Ether -

FRESHWATER CEMENTIN G BIVALVES iodea).Occasional Papers o n Mollusks, 5(72) , 379-392. LAMARCK, J . B . 1819 . Histoire Naturelle de s Animaux sans Vertebres. Tome Sixieme. Paris. Liu, Y.-Y. 1979 Freshwater Mollusks. Economic Fauna of China. Science Press, Beijing , People's Republic of China [in Chinese]. LYDEARD, C , MULVEY , M . & DAVIS , G . M . 1996 . Molecular systematic s an d evolutio n o f reproductive trait s o f Nort h America n freshwate r unionacean mussel s (Mollusca : Bivalvia ) a s inferred fro m 16 S rRN A gen e sequences . Philosophical Transactions of the Royal Society of London, Series B, 351(1347), 1593-1603. MADDISON, D. R. 1991 . The discover y and importance of multiple island s o f most-parsimoniou s trees . Systematic Zoology, 40 , 315-328. MADDISON, W . P . & MADDISON , D . R . 1997 . MacClade: Analysis of Phylogeny and Character Evolution. Sinauer Associates, Inc. , Sunderland, MA. MANDAHL-BARTH, G . 1954 . The freshwate r mollusk s o f Uganda and adjacent territories. Annales du Musee Royal du Congo Beige, Tervuren (Beligique) Series in 8°. Sciences Zoologiques, 32, 1-206 . 1988. Studies o n African Freshwater Bivalves. Danish Bilharziasis Laboratory , Charlottenlund . MANSUR, M . C . D . & D A SILVA , M . G . O . 1990 . Morfologia e microanatomi a comparad a d e Bartlettia stefanensis (Moricand , 1856 ) e Anodontoides tenebricosus (Lea , 1834) (Bivalvia, Unionoida, Muteloidea) . Amazoniana, 11(2) , 147-166. MODELL, H . 1942 . Das natiirlich e syste m de r najaden . Archiv fur Molluskenkunde, 74(5/6) , 161-191 . 1949. Das natiirliche system der najaden. 2 . Archiv fur Molluskenkunde, 78(1-3) , 29^8. 1964. Das natiirlich e system der najaden. 3 . Archiv fur Molluskenkunde, 93 , 71-129. MORRISON, J . P . E . 1973 . Th e familie s o f th e pearl y freshwater mussels . Bulletin of the American Malacological Union, Inc., 1972, 45-^46. NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitates, 2206. ORTMANN, A. E. 1912. Notes upon the families and genera of th e najades . Annals o f th e Carnegie Museum, 8(2), 222-365, pis 18-20 . 1921. South American naiades; a contribution to the knowledge o f th e fresh-wate r mussel s o f Sout h America. Memoirs o f th e Carnegie Museum, 8(3), 451-670, pis 34-48. PAIN, T . & WOODWARD , F . R . 1961 . A revisio n o f freshwater mussels of the family Etheriidae. Journal ofConchology,25(\),2-8. PARODIZ, J . J . & BONETTO , A . A . 1963 . Taxonomy an d zoogeographic relationships o f the South American naiades (Pelecypoda : Unionace a an d Mutelacea) . Malacologia, 1(2) , 179-213. POPHAM, J . D . 1979 . Comparativ e spermatozoo n morphology an d bivalve phylogeny. Malacological Review, 12, 1-20 . PRASHAD, B. 1931. Some noteworthy examples of parallel evolution i n the mollusca n faunas o f South-eastern Asia and Sout h America. Proceedings of th e Royal Society o f Edinburgh, 51(Part 1)(8) , 42-53 .

167

PRESTON, H . B . 1915 . Th e Fauna o f British India, Including Ceylon and Burma. Mollusca. (Freshwater Gastropoda & Pelecypoda). Taylo r & Francis, London . RANG, S . & CAILLAUD . 1834 . Memoire s su r l e genr e Aetherie. Nouv. Ann. Mus, series 3, 128-144. SIMPSON, C . T. 1896. The classificatio n an d geographica l distribution o f th e pearl y fresh-wate r mussels . Proceedings of the United States National Museum, 18(1068), 295-343. 1900. Synopsis of the naiades, or pearly fresh-water mussels. Proceedings of th e United States National Museum, 22(1205) , 501-1044 . 1914. A Descriptive Catalogue of th e Naiades, o r Pearly Fresh-water Mussels. Part s I—III . Bryan t Walker, Detroit, MI . SKIBINSKI, D . O . F. , GALLAGHER , C . & BEYNON , C . M . 1994. Sex-limite d rmtochondria l DNA transmission in the marine mussel Mytilus edulis. Genetics, 138, 801-809. SMITH, D . G.I986. The stomach anatomy of some eastern North America n Margaritiferida e (Unionoida : Unionacea). American Malacological Bulletin, 4 , 13-19. SMITH, E . A . 1898 . Description o f Mulleria dalyi, n . sp . from India . Proceedings o f th e Malacological Society o f London, 3, 14-16. STAROBOGATOV, YA . I . 1970 . Faun a o f mollusc s an d zoogeographical regionalizatio n o f continenta l water bodie s o f th e globe . Nauka, Leningra d [i n Russian]. SUBBA RAO, N . V. 1989. Handbook. Freshwater Molluscs of India. Zoological Surve y of India, Calcutta. SWAINSON, W . 1835 . Th e Elements o f Modern Conchology, Briefly and Plainly Stated, for the Use of Students and Ttravelers. Baldwin an d Craduce , London 1840. Th e Cabinet Cyclopaedia. Conducted by th e Rev. Dionysius Lardner Assisted by Eminent Literary and Scientific Men. Natural History. A Treatise on Malacology or Shells and Shell-fish. Longmans, London. SWOFFORD, D . L . 1998 . PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinaue r Associates Inc. , Sunderland, MA. , OLSEN, G . J., WADDELL, P . J. & HILLIS, D. M. 1996. Phylogenetic inference . In : HILLIS , D. M. , MORITZ, C. & MABLE , B . K . (eds ) Molecular Systematics Sinauer Associates , Inc. , Sunderland , MA , 407-514. TAYLOR, C . A. , WARREN , M . L . JR , FITZPATRICK, J . F . JR, HOBBS, J . J. Ill, JEZERINAC, R. F., PFLIEGER, W . L. & ROBSISON, H . W . 1996 . Conservatio n statu s o f crayfishes o f th e Unite d State s an d Canada . Fisheries, 21(4), 25-38. TAYLOR, J. D., KENNEDY, W. J. & HALL, A . 1969. The shel l structure an d mineralog y o f th e Bivalvia . Introduction. Nuculacea-Trigonacea. Bulletin of th e British Museum (Natural History), Zoology, Supplement, 3 , 1-125 . ,& 1973 . Th e shel l structur e an d mineralogy o f th e Bivalvi a II . Lucinacea Clavagellacea. Conclusions . Bulletin o f th e British Museum (Natural History), Zoology, 22, 256-294.

168

A. E . BOGA N & W . R. HOEH

TEVESZ, M . J. S. 1975 . Structure and habits o f the 'livin g fossil' pelecypo d Neotrigonia. Lethaia, 8, 321-327. & CARTER , J. G. 1980 . Environmental relationship s of shell form an d structur e of unionacean bivalves. In: RHOADS , D . C . & LUTZ , R . A . (eds ) Skeletal Growth of Aquatic Organisms: Biological Records of Environmental Change. Plenu m Press , Ne w York, 295-322. THIELE, J . 1934 . Handbuch de r systematischen weichtierkunde. Part 2(3) . Gusta v Fischer , Jena , 779-1022. TRYON, G . W. , J R 1884 . Structural an d Systematic Conchology: An Introduction to the Study of Mollusca. Volume 3 . Publishe d b y th e author , Philadelphia. TURGEON, D. D. , QUINN , J. R , JR, BOGAN , A. E. ET AL. 1998. Common an d Scientific Names o f Aquatic Invertebrates from the United States and Canada: Mollusks 2n d Edition. America n Fisherie s Society , Special Publicatio n 26 , ix-526. VAN DAMME , D . 1984 . Th e Freshwater Mollusca o f Northern Africa. Distribution, Biogeography and Palaeoecology. Developments in Hydrobiology, 25. Dr W. Junk Publishers, Dordrecht . WALLER, T. R. 1990. The evolution of ligament systems in the Bivalvia . In : MORTON, B . (ed.) The Bivalvia Proceedings of a Memorial Symposium in Honour of Si r Charles Maurice Yonge, Edinburgh. Hon g Kong University Press, Hong Kong , 49-71. 1998. Origin o f the molluscan Class Bivalvia and a phylogeny o f majo r groups . In: JOHNSTON , P. A. & HAGGART, J. W. (eds) Bivalves: an Eon o f Evolution

- Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgar y Press , Calgary , 1-45. WILLIAMS, J . D. , WARREN , M . L. , JR , CUMMINGS , K . S. , HARRIS, J . L . & NEVES , R . J . 1993 . Conservatio n status o f freshwate r mussel s o f th e Unite d State s and Canada. Fisheries, 18(9), 6-22 . WOODWARD, M . F . 1898 . O n th e anatom y o f Mulleria dalyi, Smith . Proceedings o f th e Malacological Society o f London, 3, 87-91. YONGE C . M . 1953 . The monomyaria n conditio n i n th e Lamellibranchia. Transactions of th e Royal Society of Edinburgh, 62(2), 443-478. 1962. On Etheria elliptica Lam. And th e cours e o f evolution, includin g assumptio no f monomyarianism, i n th e Famil y Etheriida e (Bivalvia: Unionacea) . Philosophical transactions of th e Royal Society o f London, Series B, 244(715), 423-458. 1978. O n th e monomyarian , Acostaea rivoli an d evolution i n th e famil y Etheriida e (Bivalvia : Unionacea). Journal o f Zoology, London, 184 , 429-448. 1979. Cementation i n bivalves . In : VA N DER SPOEL, S., VAN BRUGGEN, A. C . & LEVER, J. (eds) Pathways in Malacology. D r W. Junk. Publishers, Th e Hague , 83-106. ZOUROS, E. , BALL , A . O. , SAAVEDRA , C . & FREEMAN , K . R. 1994 . An unusua l typ e o f mitochondria l DN A inheritance in the blue mussel Mytilus. Proceedings of th e National Academy o f Science, USA, 91 , 7463-7467.

Comparative sperm ultrastructure in pteriomorphian bivalves with special reference to phylogenetic and taxonomic implications JOHN M. HEALY, JENNIFER L. KEYS & UNA Y M . DADDOW Department of Zoology and Entomology, University of Queensland, Australia, 4072 (e-mail: jhealy@ zen.uq.edu.au) Abstract: Pteriomorphia n spermatozoa , lik e thos e o f mos t othe r bivalves , ar e o f th e classi c aquasperm typ e (conica l acrosoma l vesicle , shor t t o rod-shape d nucleus , shor t midpiec e composed of two centrioles and a ring o f spherical mitochondria, a simple flagellum) . Wherea s most othe r bivalve subclasse s sho w a t least som e definin g acrosoma l feature(s) , thi s doe s no t appear t o b e th e cas e withi n th e Pteriomorphia . Whil e thi s coul d indicat e non-monophyleti c status, it also correlates with th e fact tha t the Pteriomorphia are a very ol d and very successfu l group o f bivalves . Acrosoma l similaritie s sugges t a clos e lin k betwee n th e Ostreoide a an d Limoidea (acrosomal vesicle with wedge-shaped apical zone; radiating plates present but not well developed); an d between the Pterioidea, Pinnoidea an d Pectinoidea (dens e anterior layer ; ver y well develope d radiatin g plates) . Fo r supposedl y closel y relate d taxa , th e Arcoide a an d Limopsoidea (bot h Arcoida ) diffe r markedl y fro m eac h othe r i n acrosoma l shap e an d substructure. The affinities o f the Anomioidea and even more so the Mytiloida remain uncertain, the latte r possibl y connecte d wit h th e Pterioid a or , more likely , remove d fro m th e res t o f th e Pteriomorphia (mytiloid acrosomes show concentri c lamellae). A very close relationship between the Pectinida e an d Spondylida e o f th e Pectinoide a i s demonstrate d (dens e anterio r laye r o f acrosome recurved) . Withi n th e Mytilida e (Mytiloidea ) ther e i s substantia l variatio n i n sper m morphology between supraspecific tax a especially at the subfamial level .

The subclas s Pteriomorphia, i n it s original , broa d sense (se e Beurle n 1944 ; Co x 1960 ) contain s a large proportion o f the world's mos t economicall y and ecologically important groups of Bivalvia [e.g. Mytiloidea (mussel s an d allies) , Ostreoide a (roc k oysters), Pterioide a (pear l oysters) , Pectinoide a (scallops an d allies)] . However , th e compositio n and status of the Pteriomorphia and its relationship to othe r bivalve highe r tax a remain controversial . Despite wid e acceptance o f the Pteriomorphia a s a subclass-level division of the Bivalvi a (Cox 1960 , 1969; Newel l 1965,1969 ; Bos s 1982 ; Alle n 1985 ; Vaught 1989 ; Wilso n 1998) , a number of workers have, on the basis of a reconsideration of anatomical an d shel l characters , suggeste d alternativ e classifications. Mos t notabl y th e Russia n schoo l (Nevesskaya et al. 1971 ; Scarlato & Starobogatov 1978; Starobogato v 1992 ) doe s no t recogniz e th e division Pteriomorphi a i n an y form , preferrin g instead t o regar d th e constituen t group s a s subdivisions (orders or suborders) of the superorder Autobranchia Grobbe n 189 4 [rename d Mytili formii b y Starobogato v (1992) ; th e tw o othe r recognized divisions of the Bivalvia in this scheme being th e Protobranchi a an d Septibranchi a -

renamed Nuculiformi i an d Conocardiiformii , respectively, b y Starobogato v (1992)] . Purcho n (1987) regarded the Pteriomorphia a s no more than an order of lamellibranchs, an d therefore unworthy of recognition as a discrete subclass. Waller (1978), using a cladisti c approach , redefine d th e autobranch 'superorder ' Pteriomorphi a t o exclud e the Mytiloid a an d Arcoida - th e latter tw o taxa being place d b y hi m int o th e superorder s Isofilibranchia Iredal e 193 9 an d Prionodont a MacNeil 1937 , respectively . More recently, Waller (1998) has returned to a 'traditional' concept of the Pteriomorphia an d agai n include d th e Mytiloid a and Arcoida . Nevertheless , th e relationshi p o f th e Mytiloida t o othe r bivalves , pteriomorphia n o r otherwise, has long posed a problem to students of bivalve evolution, partly because of the occurrence of th e modiolifor m shel l i n severa l fossi l line s o f uncertain affinitie s (e.g . se e Co x 1960 ; Walle r 1978). Pojeta (1971, 1978 ) has however argued that the Ordovicia n modiomorphid s 'ar e th e likel y ancestors o f th e Mytilidae ' an d tha t th e Isofili branchia should be considered as a distinct subclass from th e Pteriomorphia sensu lato [but , for a critical discussion of these issues, see Waller (1998)].

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177, 169-190 . 1-86239-076-2/007$ 15.00 © The Geological Society of London 2000.

170

J. M . HEAL Y £7 AL.

Comparative applicatio n o f transmissio n electron microscop y (TEM) , scannin g electro n microscopy (SEM ; including freeze-fracture ) an d most recently molecular genetic analyses (allozyme and rDN A sequenc e data ) hav e provide d fres h and thought-provokin g perspective s o n bivalv e phylogeny an d highe r classificatio n [fo r recen t discussions se e Heal y (1996) , Salvini-Plawe n & Steiner (1996) , Steine r & Miille r (1996) , Adamkewicz et al (1997) , Campbell et al (1998) , Canapa et a l (1999) , Giribe t & Carranz a (1999) , Steiner (19990 , b)]. I n mos t case s suc h 'new ' sources o f informatio n hav e beautifull y compli mented what is known of comparative anatomy and shell morphology , an d le d t o a n improve d understanding of bivalve relationships . Although sper m ultrastructura l studie s o f th e Bivalvia wer e firs t attempte d 4 0 year s ag o (e.g. Galtsoff & Philpott 1960 ) it i s onl y in th e las t 2 5 years or so that this field o f research has develope d a trul y comparative basi s t o match the earlier and more broad-rangin g ligh t microscopi c account s such a s thos e o f Retziu s (1904 , 1905) , Franze n (1955) and Dan & Wada (1955). TE M has prove d especially important because of its ability to reveal the fines t interna l details o f spermatozoa, an d i t is work conducte d usin g thi s techniqu e tha t ha s contributed mos t t o th e growin g understanding of bivalve sper m structure , biology an d developmen t [for class-wid e review s se e Popha m (1979 ) an d Healy (1996)] . Spermatozo a o f severa l group s o f pteriomorphians hav e no w bee n examine d usin g TEM, includin g th e Arcoidea , Limopsoidea , Mytiloidea, Pterioidea , Pinnoidea , Pectinoidea , Anomioidea and Ostreoidea (Tabl e 1) . The present study focuse s o n th e taxonomi c an d potentia l phylogenetic utilit y o f comparativ e sper m dat a i n the Pteriomorphi a sensu lato, base d o n availabl e literature an d ne w dat a fo r man y unstudie d o r incompletely studie d familie s includin g Noetiida e (Arcoidea), Glycymeridida e (Limopsoidea) , Ostreidae (Ostreoidea) , Limida e (Limoidea) , Spondylidae an d Pectinida e (bot h Pectinoidea) , Pteriidae an d Pulvinitida e (bot h Pteriodea) , an d Pinnidae (Pinnoidea ) (Tabl e 1) . Attentio n i s especially focuse d o n th e comparativ e shap e an d substructure o f th e acrosoma l comple x (= acrosomal vesicl e + subacrosomal material) and the adjoining nuclear apex. Material an d method s Material of the following species was processed fo r TEM (systemati c placemen t an d collectio n dat a indicated i n brackets) : Arcoide a (Noetiidae ) Striarca lactea (Linnaeus , 1758) , Adriati c Sea ; Limopsoidea (Glycymerididae ) - Glycymeris holsericus (Reeve , 1843) , dredge d 10m , Banan a

Banks, Moreto n Bay , souther n Queensland ; Limoidea (Limidae ) - Limaria fragilis (Gmelin , 1791), fro m cora l heads , Hero n Island , Grea t Barrier Reef, off mid-Queensland coast; Ostreoide a (Ostreidae) - Dendrostrea folium (Linnaeus , 1758) attached t o rock , 1 m depth , Orpheus Island , northern Queensland ; Pectinoide a (Pectinidae ) Gloripallium pallium (Linnaeus, 1758), from under plate coral , 9 m depth , Hero n Island ; Pectinoide a (Spondylidae) - Spondylus nicobaricus Schreibers , 1793, Lad y Musgrav e Islan d reef , 8 m depth ; Pinctada sp. , P. margaritifera (Linnaeus , 1758) , Orpheus Island , norther n Queensland ; Pinnoide a (Pinnidae) - Atrina vexillum (Born , 1778) , Lad y Musgrave Island , burie d i n san d i n ga p betwee n coral bommies , oute r ree f slope , 8 m depth . Voucher specime n shell s ar e deposite d wit h th e Queensland Museum , Brisban e (QMM O 66820-66826). Smal l (1- 2 mm 3) pieces o f mature testis o r ovotesti s wer e excise d fro m th e relaxe d animal an d place d directl y int o ice-col d 3 % glutaraldehyde (prepare d i n 0. 1 M sodiu m phos phate buffer containin g w/v 10 % sucrose) for 24 h, then rinsed i n buffer (4 5 min) before being place d into a 1 % solution of osmiu m tetroxide (buffe r a s for earlier steps) for 80 min. After a further rinse in buffer (4 5 min), tissues were dehydrated through a graded ethanol series (from 20% to absolute) before being graduall y embedde d i n Spurr s epox y resin . Semithin an d ultrathi n sections wer e cu t usin g an LKB 242 8 Ultrotom e IV , collecte d o n uncoate d 200 um mes h coppe r grid s an d staine d wit h lea d citrate and uranyl acetate according to the contrastenhancing metho d o f Daddo w (1986) . Staine d sections wer e examined an d photographed usin g a Hitachi A 30 0 transmissio n electro n microscop e operated a t a n acceleratin g voltag e o f 7 5 kV. Al l sperm organell e measurement s are based o n TEM observations. Spermatozoan features of the Pteriomorphia Mature spermatozo a o f al l examine d pterio morphian specie s ar e release d directl y int o th e ambient wate r and therefore can be termed 'aqua sperm' (Jamieso n 1987 ; Rouse & Jamieson 1987) or 'aquati c sperm ' (Baccett i & Afzeliu s 1976) . Rouse & Jamieso n (1987 ) an d Jamieso n (1987 , 1991) recognized tw o categories o f aquasperm: (1) 'ect-aquasperm' fo r sper m which , a t leas t poten tially, fertiliz e egg s withi n the surroundin g water; (2) 'ent-aquasperm ' fo r sperm whic h are shed into the surroundin g water but subsequentl y are swept by a feedin g o r inhalen t curren t int o th e mantl e cavity (in the case of molluscs) or tube (in the case of sedentar y polychaetes ) an d fertiliz e egg s there .

SPERMATOZOA O F THE PTERIOMORPHI A

Among the Pteriomorphia, most specie s appea r t o be free-spawner s (i.e . wit h ect-aquasperm ) bu t i n some families , suc h a s th e Ostreidae , th e occur rence of brooding in certain species indicates that at least som e pteriomorphian s fertiliz e withi n th e mantle cavit y (i.e . utiliz e ent-aquasperm) . Aqua sperm of pteriomorphians (and most other bivalves) exhibit, in anterio-posterior sequence, the following features: a n acrosoma l complex ; a condense d nucleus (usuall y with scattered , irregularl y shape d lacunae); a shor t midpiec e ( a pai r o f triple t microtubular centriole s surrounde d b y a rin g o f spherical mitochondria) ; a flagellum (tail) , alway s of 9 + 2 microtubular configuration . The following section detail s th e distinguishin g sper m ultra structural feature s o f th e variou s superfamilie s o f Pteriomorphia sensu lato (examine d familie s indicated b y *) . Currently , n o dat a exist s fo r th e Dimyoidea o r Plicatuloidea . Primar y emphasi s i s placed o n the morpholog y an d substructur e of th e acrosomal comple x (acrosoma l vesicl e + sub acrosomal material) and the shape of the nucleus. In addition to the micrographs of species examined , a diagrammatic summary of acrosomal ultrastructure is also presented, in order to facilitate comparison s between taxa (see Fig. 6).

Subclass Pteriomorphia - comparative spermatozoan structure Arcoidea (*Arcidae, *Noetiidae, Cucullaeidae) (Figs Id-f, 3a-c and 6a and b) Among the Arcoidea, thre e specie s o f the Arcida e have previousl y bee n examine d fo r sper m ultrastructure: Anadara trapezia (Deshayes , 1840 ) (Popham 1979) , Barbatia obliquata (Wood, 1828 ) and B.foliata (Forsskal , 1775 ) (Reunov & Hodgson 1994). Results presente d herei n fo r Striarca lactea (Linnaeus, 1758 ) (Noetiidae ) ar e i n genera l agreement wit h thos e obtaine d fo r arcids . Arcoidean spermatozo a consis t of : (1 ) a conical , deeply invaginate d acrosoma l vesicl e (lengt h 0.7-1.0 urn in Arcidae and 0.5 um in S. lactea), the contents o f whic h ar e finel y granula r an d homogeneous (with the exception of a thin, slightly less electron-dens e periphera l layer) ; (2 ) a n extensive deposi t o f coarsel y granula r sub acrosomal materia l fillin g the vesicle invagination and the gap between the base of the vesicle an d the nuclear ape x (i.e . th e acrosoma l vesicl e doe s no t rest directl y o n th e nuclea r surface) ; (3 ) a shor t (2.0-3.0 jam) spheroidal nucleu s (finely granula r in arcids, coarsel y granula r i n S . lactea)', (4 ) fou r t o five (rarel y six ) spherica l mitochondri a arrange d around a pai r o f centrioles ; (5 ) a satellit e fibr e complex connectin g th e dista l centriol e t o th e plasma membrane ; (6 ) a 9 + 2 patter n axonem e

171

within th e flagellum . Th e studie s b y Popha m (1979) an d Reuno v & Hodgso n (1994 ) hin t tha t sperm morpholog y doe s no t var y profoundl y between specie s o r even between gener a within the Arcidae. Striarca lactea differ s fro m th e thre e investigated arcid s by having a shallow depressio n in the nuclear ape x (v. apex flat or slightly conve x in arcids ) an d i n it s mor e anterio-posteriorl y compressed acrosoma l vesicle . Sper m ultra structural dat a fo r th e Cucullaeidae , an d fo r th e many unstudied gener a of Arcidae (Area, Trisidos, Bathyarca, Samacar) an d Noetiida e (Sheldonella, Arcopsis), ar e now required to test the generality of the sperm diagnosis outline d here . Limopsoidea (*Glycymerididae, Limopsidae, Philobryidae) (Figs la-c, 2d-f and 6c) Three species of the Limopsoidea hav e to date been examined for sperm ultrastructure, al l belonging t o the Glycymerididae : Glycymeris yessoensis Sowerby, 188 6 (Pashchenk o & Drozdo v 1990 , 1991), Glycymeris sp . (acrosome only ; Sousa et al. 1998) an d Glycymeris holsericus (Reeve , 1843 ) (this study). In G. yessoensis and G. holosericus the nucleus is slightly elongate (7.5-9.7 um and widest basally i n G. yessoensis', 4.8-5.0 um and widest in posterior third in G. holsericus) and the midpiece is composed o f spherica l mitochondri a (fiv e i n G . yessoensis', fou r i n G . holsericus) surroundin g a pair o f triple t substructur e centrioles . I n G . holosericus, a short , periodicall y bande d rootle t connects th e proxima l centriol e t o a shallo w posterior nuclea r foss a whil e the distal centriol e i s anchored t o th e plasm a membran e b y a radiatin g array o f nin e satellit e fibres . Th e mos t profoun d difference betwee n thes e specie s involve s th e morphology o f th e acrosoma l complex . Pashchenko & Drozdo v (1990 , 1991 ) hav e reconstructed th e acrosoma l vesicl e o f G . yessoensis a s being spherica l an d positione d o n a short colum n (0. 8 um) o f subacrosoma l materia l (the latte r attache d t o th e nuclea r apex) . Unfortunately, thei r micrograph s d o no t clearl y support this interpretation, althoug h they appear to have demonstrated a spherical acrosoma l vesicle in the mid-spermati d stag e o f G . yessoensis. Th e acrosomal configuratio n describe d b y Pashchenk o & Drozdo v (1990 , 1991 ) i s reminiscen t o f th e acrosomal comple x fro m heterobranc h gastropo d spermatozoa [se e Heal y (1996 ) fo r comparativ e figures an d discussion ] an d als o certai n echinoi d spermatozoa (e.g . se e Jamieso n 1991 ) and , i f confirmed, would be unique within the Bivalvia. It seems likel y tha t Pashchenk o & Drozdo v hav e either photographe d tangentiall y sectione d aero somes, o r tha t th e acrosoma l vesicl e i n thei r material is either immature or (less likely) partiall y

Table 1 . Sperm ultrastructure in the Pteriomorphia: taxa examined to date and sources of data Classification ARCOIDEA Arcidae Noetiidae LIMOPSOIDEA Glycymerididae

Species

Source

Anadara trapezia (Deshayes , 1840 ) Barbatia obliquata (Wood, 1828 ) Barbatia foliata (Forsskal , 1775 ) Striarca lactea (Linnaeus, 1758 )

Popham, 197 9 Reunov & Hodgson 199 4 Reunov & Hodgson 199 4 Present stud y

Glycymeris yessoensis (Sowerby , 1866 ) Glycymeris sp . Glycymeris holosericus (Reeve, 1843 )

Paschenko & Drozdov 1990 , 199 1 Sousa & Azevedo 199 8 Present stud y

Modiolus kurilensis Bernard, 198 3 Modiolus americanus (Leach, 1815 ) Aulacomya ater (Molina, 1782 ) Arcuatula capensis (Krauss, 1848 ) Septifer keenae Nomura, 193 6 Brachiodontes semistriatus (Krauss, 1848 ) Bathymodiolus thermophilus Kenk & Wilson, 1985 Bathymodiolus puteoserpenyis vo n Cosel, Metivier & Hashimoto 199 4 Bathymodiolus elongatus von Cosel, Metivier & Hashimoto, 199 4 Bathymodiolus childressi Gustafson, 199 8 AdulafalcatoidesHabe, 195 5 Mytilus edulis Linnaeus, 175 8

Drozdov & Reunov 19860 , b Hylander & Summers 197 7 Hodgson & Bernard 19860 , b\ Garrido & Gallardo 199 6 Reunov & Hodgson 199 4 Reunov & Drozdov 198 6 Reunov & Hodgson 199 4 Le Pennec & Beninger 199 7 Le Pennec & Beninger 199 7 Le Pennec & Beninger 199 7 Eckelbarger & Young 199 9 Reunov & Drozdov 198 6 Niijima & Dan, 1965 ; Long o & Dornfeld 1967 ; End o 1976 ; Drozdov & Reunov 19866 ; Hodgson & Bernard 19866 ; Tilney e t al 1987 ; Sousa & Azevedo 198 8 Reunov & Drozdov 198 7 Hodgson & Bernard 19866 ; Komaru et al. 199 5 Bourcart et al. 196 5 Garrido & Gallardo 199 6 Toledo e t al. 1990 ; Garrid o & Gallardo 199 6 Drozdov 1979 ; Drozdo v & Mashansky 1979 ; Drozdo v e t al. 1981 , 198 2 Garrido & Gallardo 199 6 Present stud y Garrido & Gallardo 199 6 Bernard & Hodgson 198 5 Reunov et al. 199 9 Bernard e t al. 198 8 Franzen 198 3

MYTILOIDEA Mytilidae

Mytilus coruscus Gould, 186 1 Mytilus galloprovincialis Lamarck, 181 9 Mytilus perna vo n Ihering, 189 7 Mytilus chilensis Hupe, 185 4 Choromytilus chorus (Molina, 1782 ) Crenomytilus gray anus (Dunker , 1853 ) Semimytilus algosus (Gould, 1850 ) Trichomya hirsuta (Lamarck, 1819 ) Perumytilus purpuratus (Lamarck , 1819 ) Perna perna (Linnaeus, 1758 ) Perna viridis Linnaeus, 175 8 Brachidontes virgiliae (Barnard, 1964 ) Musculus discors (Linnaeus, 1767 )

PTERIOIDEA Pteriidae

Pinctada margaritifera (Linnaeus , 1758 ) Pinctada sp . Isognomon isognomon (Linnaeus, 1758 ) Vulsella vulsella (Linnaeus, 1758 )

Thielley e t al 1993 ; present study Present stud y Healy 1989 , 199 6 Lamprell & Healy 199 8

Pinna nobilis Linnaeus, 175 8 Atrina vexillum (Born, 1778 )

De Gaulejac et al. 199 5 Present study

Spondylidae

Pecten maximus Linnaeus, 175 8 Aequipecten irradians (Lamarck, 1819 ) Placopecten magellanicus (Gmelin, 1791 ) Gloripallium pallium (Linnaeus , 1758 ) Spondylus nicobaricus Schreibers, 179 3

Anderson & Personne 1970a , £,1976; Dorange & Le Pennec 198 9 Linck 1973a , b Desilets ef a/. 199 5 Present study Present study

ANOMIOIDEA Anomiidae

Anomia trigonopsis Hutton, 187 7

Popham, 197 9

LIMOIDEA Limidae

Limaria fragilis (Gmelin , 1791 )

Present stud y

Ostrea edulis Linnaeus, 175 8 Dendrostrea folium (Linnaeus , 1758 ) Crassostrea virginica (Gmelin, 1791 ) Crassostrea angulata (Lamarck, 1819 ) Crassostrea gigas (Thunberg, 1793 )

O'Foighil 1989 ; Bozz o et al. 1993 ; Sous a & Oliveira 199 4 Present stud y Galtsoff & Philpott 1960 ; Daniel s e t al. 1971 ; Eckelbarger & Davis 199 6 Gutierrez e t al 1978 ; Sous a & Oliveira 199 4 Osanai & Kyozula 1982 ; Kyozuk a & Osanai 1985 ; Komar u et al 1994 ; Gwoetal. 199 6 Healy & Lester 1991 ; Molinia & Swan 1991 ; Present stud y

Isognomonidae Malleidae PINNOIDEA Pinnidae PECTINOIDEA Pectinidae

OSTREOIDEA Ostreidae

Saccostrea glomerata (Gould, 1850 )

174

J. M . HEAL Y ETAL.

Fig. 1 . Mature spermatozoa o f various Pteriomorphia. (a)-(c) Glycymeris holosericus (Glycymerididae, Limopsoidea). (a ) Longitudinal sectio n (LS ) through acrosomal comple x (acrosomal vesicle + subacrosoma l material), nucleus , midpiece an d flagellum. (b ) LS base o f nucleus and midpiece, showin g rootlet attache d to proximal centriole. (c) Transverse sectio n (TS ) junction of nucleus and midpiece. (d)-(f ) Srriarca lactea (Noetiidae , Arcoidea). (d ) LS acrosomal complex , nucleus , midpiece an d portion of flagellum. (e) TS junction of nucleus and midpiece. (f ) TS nucleus, (g) Limaria fragilis (Limidae , Limoidea), LS acrosomal complex , nucleus, midpiece. (h ) Gloripallium pallium (Pectinidae , Pectinoidea) . (i ) Dendrostrea foilum (Ostreidae , Ostreoidea) , acrosoma l complex , nucleus, midpiece. (j ) Pinctada sp . (Pteriidae, Pterioidea), acrosomal complex , nucleus and midpiece. Scal e bars are 0.5 um, except (b ) which is 0.25 um . a , Acrosomal complex ; c, centrioles; dc, distal centriole; f. flagellum; m, mitochondria; n , nucleus; nf, nuclear fossa; nl , nuclear lacuna; pc, proximal centriole, r, centriolar rootlet.

SPERMATOZOA O F THE PTERIOMORPHI A

reacted. Clearly , additiona l observation s o n th e mature spermatozo a o f G . yessoensis ar e require d to clarify wha t appears to be an anomalous result . In Glycymeris sp. , th e acrosoma l vesicle is tall conical in longitudinal profile (length 1.2 um), with subacrosomal materia l fillin g th e dee p posterio r invagination (Sous a e t al 1998) . Sous a e t al (1998) foun d a positiv e phosphotungsti c aci d reaction associated with the invagination portion of the acrosoma l membran e an d occasionall y a s a 'central cor d lik e element ' withi n th e vesicl e contents. Th e acrosoma l vesicl e o f G . sp . slightl y encloses the convex nuclear apex. In G . holsericus th e acrosoma l vesicl e ha s a wide, anteriorl y truncat e profil e (lengt h 0. 3 um, diameter 0. 7 um), wit h subacrosoma l materia l occupying th e extensiv e basa l invaginatio n o f th e vesicle (Fig s 2 d an d 6c) . Thi s acrosoma l morphology differ s substantiall y fro m tha t o f th e Arcoidea, no t onl y i n it s truncat e longitudina l profile bu t als o i n th e substructur e of it s content s (coarse granula r wit h a dens e periphera l layer , recurved posteriorl y v . homogeneou s content s i n Arcoidea). I n immatur e spermatozo a o f G . holosericus th e acrosoma l vesicl e i s high-conica l (Fig. 2f) . However , durin g th e fina l maturationa l phase, th e vesicl e assume s it s final , compressed conical form (Fig s 2 d and 6c). Th e substructure of the dense layer withi n the acrosomal vesicl e coul d not b e unequivocally establishe d - som e section s suggested periodi c plate s bu t other s indicate d a homogeneous texture . Th e resemblanc e o f th e mature acrosomal vesicle of G. holosericus to those of pandoroidea n Anomalodesmat a ha s previousl y been commente d upo n (Heal y 1996 ) an d seem s worthy o f furthe r study , especiall y i n relatio n t o spermiogenic stage s o f acrosoma l development . The recurve d natur e of the anterio r dens e laye r i n G. holosericus is also reminiscent of that seen in the Pectinoidea, bu t a s ye t n o fir m evidenc e o f radiating plate s ha s been observe d i n glycymeridid acrosomes. Comparativ e wor k o n th e thre e unstudied familie s o f limopsoideans (Philobryida e and Limopsidae) wil l undoubtedly yiel d ne w clues concerning relationship s withi n th e Limopsoide a and mayb e she d furthe r ligh t o n the group' s exac t relationship to the Arcoidea an d other bivalves.

Limoidea (*Limidae) (Figs Ig, 2g-i and 6g) As members of this important superfamily have not as ye t bee n examine d fo r sper m ultrastructure , details ar e presente d fo r a n Indo-Pacifi c species , Limaria fragilis (Gmelin , 1791) . Th e acrosoma l vesicle (lengt h 0. 4 um) ha s a low-conica l shap e with a dee p basa l invagination . Content s o f th e vesicle ar e moderatel y electro n dens e wit h th e exception o f a wedge-shaped, apical region which

175

is conspicuousl y les s electro n dens e an d coarsel y granular i n appearance . Short , radiatin g plate s ar e present withi n th e periphera l regio n o f th e acrosomal vesicl e (Fig. 2i) . Subacrosoma l materia l loosely fill s th e invaginatio n o f th e acrosoma l vesicle, a s well a s the broad , apica l depressio n o f the nucleu s which extends posteriorly a s a narrow canal (Fig s 2 g an d h an d 6g) . Th e narrownes s of this invagination almost certainly explains why it is usually not visible in longitudinal sections through the nucleus . Th e nucleu s i s rounde d bu t slightl y compressed anterio-posteriorl y an d its contents are coarsely granular , wit h scattered , electron-lucen t lacunae. Four , fiv e o r occasionall y si x spherica l mitochondria surroun d tw o triple t substructur e centrioles. Th e proxima l centriol e bear s a shor t rootlet for attachment to the nucleus while the distal centriole i s fixe d t o th e plasm a membran e b y a n array of nine satellite fibres . In general , th e spermatozo a o f Limaria fragilis resemble mos t closel y thos e o f th e Ostreida e (Galtsoff 1960 ; Daniel s e t a l 1971 ; O'Foighi l 1989; Heal y & Leste r 1991 ; Bozz o e t al . 1993 ; Gwo e t al . 1996) , an d to a lesser degre e thos e of Striarca lactea (Arcoide a herein ) an d Anomia trigonopsis Hutton , 187 7 (Anomioidea ; Popha m 1979). Especiall y significan t i s th e apica l zon e of the L fragilis acrosoma l vesicle , which also occur s in the Ostreidae. In ostreids, th e apical zon e o f the acrosomal vesicle often show s a layered or whorled internal substructur e (Fig. 6k) but in certain specie s such an ordered substructur e appears to be absent , as observe d i n L fragilis (se e followin g section Ostreoidea). In all ostreid species examined to date, a well-develope d axia l ro d form s a significan t component o f th e subacrosoma l material . N o ro d appears t o b e presen t i n L . fragilis althoug h th e narrow an d dee p invaginatio n of th e nuclea r ape x may perhap s contai n ro d precursors . A s Popha m (1979) an d Kafano v & Drozdo v (1998 ) hav e shown, th e occurrenc e o f a n axia l ro d amon g bivalves i s ofte n sporadi c (e.g . constan t i n Ostreidae, occurrin g onl y i n Mytilina e o f th e Mytilidae) an d it s presenc e amon g th e Pteriomorphia appear s t o be closel y linke d wit h a very dee p anterio r invaginatio n o f th e nucleus . Although the nucleus and midpiece morpholog y of Pectinoidea ar e simila r t o L . fragilis (an d othe r eupteriomorphans), th e pectinoidea n acrosoma l vesicle exhibit s a dens e reflecte d laye r an d n o apical, wedge-shape d zone (Dorang e & Le Pennec 1989; presen t study) .

Ostreoidea (*Ostreidae, Gryphaeidae) (Figs li, 3a-d and 6k) Sperm ultrastructur e i s know n fo r fiv e com mercially importan t specie s o f Ostreidae : Ostrea

176

J. M . HEALY£rAL .

Fig. 2 . Acrosomal morphology in Arcoidea, Limopsoidea an d Limoidea (a)-(c) Striarca lactea (Noetiidae, Arcoidea). (a ) Longitudinal sectio n (LS ) through acrosomal complex an d nuclear apex, (b) Transverse section (TS) through anterior region o f acrosomal complex , showin g radiating plates, (c) LS showing full exten t of anterior depression of nucleus, (d)-(f) Glycymeris holosericus (Glycymerididae, Limopsoidea) . (d) LS through acrosomal comple x an d nuclear apex, (e) TS through slightly immature acrosomal complex , (f) LS immature acrosomal comple x showin g conical shap e of acrosomal vesicle, (g)-(i) Limaria fragilis (Limidae , Limoidea). (g ) LS acrosomal complex and nuclear apex. Note wedge-shaped apical zon e anteriorly (lateral extent indicated by arrowheads), (h ) LS showing deep, narrow extension of anterior nuclear invagination (arrowhead), (i) TS showing radiating plate s (som e here indicated b y arrowheads) associate d wit h periphery o f acrosomal vesicle. Scale bars are 0.1 jum, except (b) and (i) which are 0.25 jam, (h ) which is 0.5 um . a, Acrosomal complex ; av , acrosomal vesicle; c , centrioles; f, flagellum; m, mitochondrion; n, nucleus; sm, subacrosomal material.

SPERMATOZOA O F THE PTERIOMORPHIA 17

Fig. 3 . Acrosomal morphology i n Ostreoidea, Mytiloidea . (a ) Saccostrea glomerata (Ostreidae, Ostreoidea) . Longitudinal section (LS) through acrosomal complex and nuclear apex. Arrowheads indicating lateral exten t of wedge-shaped apical zone, (b)-(d) Dendrostrea folium (Ostreidae , Ostreoidea) . (b ) LS through acrosomal comple x and nuclear apex. Arrowheads indicatin g latera l exten t o f wedge-shaped apica l zone, (c) and (d) Transverse sectio n (TS) through basal region of acrosomal complex showing radiating plates (some indicated by arrowheads).(e)-(g) Trichomya hirsuta (Mytilidae, Mytiloidea). (e) LS through acrosomal comple x (= acrosomal vesicle + subacrosomal material) and nuclear apex, (f) TS through basal region of acrosomal complex , showin g concentric layers, (g ) TS detail of fine, concentri c lamella e at periphery o f acrosomal vesicle. Scal e bars ar e 0.1 (am, except (e ) and (f) which are 0.25 um . ar, Axial rod (differentiate d component of subacrosomal material); av , acrosomal vesicle ; 1, fine, concentric lamellae o f acrosomal vesicle contents; n, nucleus; sm, subacrosomal material surroundin g axial rod.

7

178

J. M . HEALY£rAL.

edulis (Linnaeu s 1758) , Crassostrea gigas (Thunberg 1793) , C . virginica Gmelin , 1791 , C . angulata (Lamarc k 1819 ) an d Saccostrea glomerata (Gould 1850 ) (for a listing of studies see Table 1) . In addition, the firs t TE M sper m dat a for a specie s o f Dendrostrea [D . folium (Linnaeu s 1758)] and additional micrograph s o f S. glomerata are presented. Ostrei d spermatozo a exhibi t a broadconical acrosoma l whic h is deeply invaginate d an d apically show s a wedge-shape d zon e o f varyin g substructure (Fig . 3 a and b). I n addition , radiating plates ar e associate d wit h th e basa l regio n o f th e acrosomal vesicl e i n D. folium (Fig . 3 c and d ) but have not been detecte d ( ? or searched for ) in other examined ostreids . Subacrosoma l material , i n th e form o f a n axia l ro d surrounde d b y a granula r matrix, fill s no t onl y th e invaginatio n o f th e acrosomal vesicl e bu t als o th e dee p an d wid e anterior invagination of the nucleus (Figs l i and 3a and b) . Th e nucleu s i s shor t an d rounded , an d shows a smal l foss a posteriorl y t o whic h a centriolar rootle t fro m th e proxima l centriol e ar e attached. Nuclea r content s sho w a coars e fibro granular texture in addition t o occasional electron lucent lacunae . Fou r (rarel y five ) mitochondri a surround the centrioles an d a satellite fibre comple x connects th e distal centriol e t o th e plasm a membrane. I n term s of sper m organell e shape , th e five examine d species o f Ostreidae ar e remarkably uniform. However , there are interesting difference s between specie s i n relatio n t o th e apical , wedge shaped zon e o f th e acrosoma l vesicl e [homo geneous in Crassostrea virginica, Ostrea edulis and Dendrostrea folium (Fig . 3b) , whorls in C. gigas, or three t o fiv e paralle l layer s i n C . angulata an d Saccostrea glomerata (Fig s 3 a an d 6k)] . I n Dendrostrea folium, th e apica l zon e als o extend s posteriorly aroun d th e invaginatio n o f th e acro somal vesicl e (Fig . 3b) . Sous a & Oliveir a (1994 ) and Sous a e t al. (1998 ) hav e demonstrated , using phosphotungstic acid-chromi c aci d treatmen t o f unosmicated spermatozo a (withou t heav y meta l staining o f ultrathi n sections) , tha t ostreid s als o differ somewha t i n th e cytochemistr y o f th e acrosomal vesicl e contents . Th e apica l wedge shaped zone always reacts positively to PTA, but in Ostrea edulis a layer associate d wit h the posterio r rim of the acrosomal vesicle is also revealed (Sousa et al . 1998) . I t seem s likel y tha t acrosoma l substructure o f th e Ostreida e may b e o f consider able taxonomic significanc e onc e data are gathere d for unstudied species an d genera. Mytiloidea (*Mytilidae) (Figs 3e-g, 4 and 6d-f) Without doub t th e Mytilida e hav e bee n th e mos t thoroughly examined famil y of bivalves a s regard s

comparative sper m ultrastructur e (se e Tabl e 1) . A significant proportion o f the published work centres on widel y cultivated specie s o f the Mytilina e (e.g . Mytilus edulis Linnaeus, 1758 , M. galloprovincialis Lamarck, 1819 ) an d Crenomytilus gray anus (Dunker, 1853) , focusing in particular o n the aero some reaction , acrosoma l vesicl e cytochemistr y and sperm-egg interaction (for listing of studies see Table 1) . However, in recent years all the remainin g subfamilies (an d mos t extan t genera ) hav e bee n studied fo r sper m ultrastructur e fro m a com parative, ofte n taxonom y oriented , viewpoin t [se e Table 1 an d Kafano v & Drozdo v (1998)] . Thi s extensive bod y o f researc h ha s show n tha t sper m structure varies profoundl y within the Mytilidae partly i n connectio n wit h differin g eg g morph ologies an d fertilization environment s [ect-aquati c v. ent-aquatic fertilizatio n - fo r discussions o f other bivalves se e Popha m (1974 ) an d Franze n (1983) ] but als o reflectin g apparentl y natura l taxonomi c subdivisions withi n the family . Recently , Kafano v & Drozdo v (1998 ) hav e use d sper m feature s t o redefine thre e mytiliid subfamilie s based primaril y on nuclear morphology an d presence/absence of an axial ro d (Fig . 4) . Mytilii d spermatozo a sho w varying degree s o f acrosoma l vesicl e complexit y ranging fro m simpl e (e.g . Septifer an d Bathymodiolus) t o ver y comple x (e.g . Mytilus) (Figs 4 an d 6d-f). Typically , an oute r dens e laye r and a n inner electron-lucen t laye r ar e present , bu t sometimes accompanie d b y one or more additiona l zones (Fig . 4) . End o (1976 ) an d mor e recentl y Sousa & Azeved o (1995 ) hav e demonstrate d th e highly structured natur e of the acrosome of Mytilus edulis usin g silve r methenamin e an d phospho tungstic acid staining, and chemical an d enzymatic pretreatments (differentiatin g u p t o fiv e zone s within th e acrosoma l vesicl e contents ; see Fig. 4) . Fine, concentri c lamella e appea r t o b e charac teristic of mytilid acrosomes [se e Figs 3f and g and 4, also Garrid o & Gallardo (1996)] . However, i t is not know n whether lamella e occur i n the simples t mytilid acrosome s (e.g . fo r Septifer an d Bathymodiolus). Typically , mos t mytilii d sper m possess fiv e spherica l mitochondri a (surroundin g the standar d pai r o f centrioles ) bu t usuall y som e level o f variation from fou r t o fiv e i s observe d (a s with mos t bivalv e spermatozoa ) (Hodgso n & Bernard 19860 , b', Kafano v & Drozdo v 1998) . Spermatozoa o f Modiolus ar e exceptiona l amon g the Mytilida e and , i n fact , amon g th e Bivalvi a i n having a larg e number o f midpiec e mitochondri a (12-14; Drozdo v & Reuno v 19860 ; Kafano v & Drozdov 1998) . Recen t wor k b y Reuno v e t al . (1999) suggest s the possibilit y o f sper m polymor phism i n Perna viridis (Linnaeus , 1758 ) involving dua l pattern s o f acrosoma l an d tai l development.

SPERMATOZOA OF THE PTERIOMORPHI A

179

Fig. 4 . (a) Acrosomal vesicl e interna l substructur e in Mytilus edulis [Mytilidae, Mytiloide a - slightl y modifie d fro m Endo (1976)] . (b)-(d) Comparative sper m structur e in Mytiloidea [Mytilida e - slightl y modifie d fro m Kafano v & Drozdov (1998)]. am, Acrosomal vesicl e membrane ; ar , axial rod (differentiated componen t o f subacrosoma l material); av, acrosomal vesicle ; CP , central proximal portion o f acrosomal vesicle ; D, anterior portio n o f acrosoma l vesicle; La, lysin in axially located strand ; Lb, lysin in basal portion of acrosomal vesicle; 1m, lumen formed by invagination of acrosomal membrane; m, mitochondria; n, nucleus; pm, plasma membrane; PP, peripheral proxima l part of acrosomal vesicle; sm subacrosomal material. [Figure s reproduced with permission of Academic Press an d the Institute of Malacology (USA)]. Scale bars for (b)-(d) are 1. 0 urn.

180

J. M . HEALY ETAL.

Pinnoidea (*Pinnidae) (Figs 5a-c and 6j) Only a singl e specie s o f Pinnida e ha s previousl y been examine d fo r sper m ultrastructur e - Pinna nobilis Linnaeus , 175 8 (se e D e Gauleja c e t al. 1995). Althoug h the published informatio n allows reconstruction o f mos t feature s o f th e sper m o f P. nobilis, details of the most important organelle, the acrosomal complex , requir e furthe r elaboration . The presen t stud y o f th e spermatozo a o f Atrina vexillum (Born , 1778 ) i s i n essentia l agreemen t with th e findin g o f D e Gauleja c e t al . (1995 ) bu t has als o she d additiona l ligh t o n th e profil e an d substructure o f th e acrosoma l vesicle . Thi s ha s allowed th e followin g characterizatio n o f pin noidean sperm features: (1) the acrosomal vesicle is conical, c. 0.4 um lon g an d deepl y invaginate d basally; its contents are differentiated into a highly electron-dense anterio r laye r (exhibitin g closel y spaced radiatin g plates ) an d a less dens e posterio r layer; (2) very granular subacrosomal materia l fill s the vesicle invagination and nuclear depression; (3) the nucleus is short (length 1.8-2.0 um), squat and coarsely granula r i n texture , wit h a noticeabl e anterior depression; (4) five or , more uncommonly, four spherica l mitochondria are associated with the paired centriole s (an d associate d satellit e fibr e complex an d flagellum) . Th e well-develope d radiating plates , her e associate d wit h th e dens e anterior laye r withi n th e acrosoma l vesicle , i s essentially as seen in the Pterioidea and Pectinoidea (see previou s and followin g sections), an d sperm atologically differentiate s th e Pinnoide a fro m th e Anomioidea (acrosomal vesicle of simlar shape but evidently wit h homogeneou s contents ; Popha m 1979).

Pterioidea (*Pteriidae, * Isognomonidae, *Malleidae, Pulvinitidae) (Figs Ij, 5d-f and 61) Despite thei r economi c an d ecological importanc e it i s ver y surprisin g tha t onl y a fe w specie s o f

Pterioidea hav e bee n examine d fo r sper m ultrastructure [Pinctada margaritifera (Linnaeus , 1758), Isognomon isognomon (Linnaeus , 1758 ) (Isognomonidae) an d Vulsella vulsella (Linnaeus , 1758) (Malleidae) ; Tabl e 1] . T o this lis t i s adde d observations fo r Pinctada sp . Spermatozo a o f th e Pterioidea ca n b e characterize d b y th e followin g features: (1 ) a conical (usuall y short, low-conical , 0.4-0.7 um long ) acrosoma l vesicle , deepl y invaginated basally and exhibiting marked differen tiation of the acrosomal contents (a highly electrondense anterior layer containing radiating plates; one or more areas of lower electron opacity) ; (2) a short (1.5-2.0um long ) spheroida l nucleus , usuall y showing a broa d anterio r depressio n an d a basa l fossa; the apical depression i s limited to a fine pit or absent i n Vulsella vulsella', (3 ) usuall y fiv e (sometimes four or six) spherical mitochondria; (4) the standar d arrangemen t o f centriole s an d th e satellite fibre complex . I t is interesting to note that the differentiation of acrosomal vesicl e content s is more complex within the Pteriidae than in either the Isognomonidae o r Malleidae, perhap s mirroring the range o f complexit y occurrin g i n th e Mytilida e (Mytiloida).

Pectinoidea (^Pectinidae, *Spondylidae, Propeamussiidae, Syncyclonemidae) (Figs Ih, 5g-j and 6m) Given thei r economi c importance , i t i s surprisin g that sperm dat a are available fo r only three specie s of Pectinida e - Pecten maxima Linnaeus , 1758 , Aequipecten irradians (Lamarck , 1819 ) an d Placopecten magellanicus (Gmelin , 1791) . O f these, onl y Pecten maxima ha s bee n adequatel y examined. I n orde r t o clearl y establis h characteristic sper m feature s o f th e Pectinida e details ar e presente d fo r Gloripallium pallium (Linnaeus, 1758) , a common an d widespread Indo Pacific specie s (Fig s Ih , 5h- j an d 6m) . Althoug h Dan & Wada (1955) studie d the acrosome reaction

Fig. 5 . Acrosomal morpholog y i n Pterioidea, Pinnoidea, Pectinoidea . (a)-(c) Atrina vexillum (Pinnidae , Pinnoidea) . (a) Longitudinal sectio n (LS) throug h acrosoma l comple x ( = acrosomal vesicle + subacrosomal material ) and nuclea r apex, (b) Transverse section (TS) throug h anterior region of acrosomal complex, showing radiating plates (arrowheads), (c) TS acrosomal comple x belo w leve l o f (b). (d)-(f ) Pinctada sp . (Pteriidae, Pterioidea). (d) LS through acrosoma l comple x an d nuclear ape x showin g dens e anterio r laye r an d electron-lucent zone , (e) TS throug h anterior region o f acrosomal complex showin g radiatin g plate s (arrowheads) , (f ) T S acrosomal complex below leve l of (e). (g ) Spondylus nicobaricus (Spondylidae , Pectinoidea) LS acrosomal comple x and nuclear apex . Dens e anterior layer recurved posteriorly. Inset TS acrosomal complex, faintly showin g radiating plates, (h)-(j) Gloripallium pallium (Pectinidae, Pectinoidea) . (h) LS through acrosoma l comple x and nuclear apex . Dense anterior laye r recurve d posteriorly, (i) TS through anterio r regio n o f acrosomal comple x showin g radiatin g plate s (arrowheads) , (j) TS acrosomal comple x below level of (i) but stil l showin g radiatin g plate s (arro w heads) . Scale bars are 0.1 um. ar , Axia l rod (differentiated componen t of subacrosomal material); av, acrosomal vesicle; n, nucleus; sm, subacrosomal material.

SPERMATOZOA O F THE PTERIOMORPHI A

in Spondylus cruentus Lischke, 1868 , no TEM level sperm dat a hav e bee n publishe d fo r th e Spondylidae, promptin g inclusio n o f dat a fo r th e Indo-Pacific specie s S . nicobaricus Schreibers , 1793 (Fig. 5g). Although pectinoids sho w variation between specie s i n th e longitudina l profile o f th e

181

conical acrosoma l vesicl e (lengt h 0. 4 jum i n G . pallium\ 0.8-0. 9 um i n S . nicobaricus, vesicl e slightly ballooning anteriorly in Pecten maxima and in S. nicobaricus), the vesicle in all species exhibits a highl y electron-dens e interna l laye r whic h recurves posteriorly, giving a double-layered effec t

182

J. M . HEALY£rAL .

SPERMATOZOA O F THE PTERIOMORPHI A

through most of its length. Of special interest is the presence o f a very well-developed , radiatin g plat e substructure within the dense layer - mos t closel y resembling tha t see n i n th e Pinnoide a an d Pterioidea (although in these two superfamilies, the dense anterior layer does not recurve). Pectinoidea n sperm all have short, pyriform nuclei (with coarsely granular texture) and the midpiece exhibit s five o r sometimes four spherica l mitochondria (associate d with th e standar d paire d centrioles , th e satellit e fibre comple x an d the flagellum) .

Anomioidea (*Anomiidae) (Fig. 6h) Since Popham' s (1979 ) descriptio n o f th e spermatozoa ofAnomia trigonopsis (as A. descripta Iredale, 1936 ) n o additiona l dat a fo r th e Anomioidea hav e been published . Fortunately , hi s TEM micrograph s (onl y two , bu t informativ e longitudinal sections ) an d descriptio n ar e sufficiently detaile d t o allo w reconstructio n o f almost the entire spermatozoon, whic h in its overal l form resemble s thos e o f othe r eupteriomorphians . In A. trigonopsis the acrosoma l vesicle i s conical , deeply invaginate d an d it s content s homogeneous and moderatel y electro n dense . Subacrosoma l material fill s th e basa l invaginatio n o f th e shor t (length 0.3 um) acrosomal vesicle and an adjoining indentation o f th e nuclea r apex . Th e nucleu s i s rounded and short (length 1. 4 um) but the presenc e of a basal foss a has yet to be established. Popha m states tha t th e midpiec e contain s fou r spherica l mitochondria whic h surroun d tw o centriole s (th e latter arrange d a t 90° t o eac h other) , suggestin g a standard bivalv e midpiec e an d flagellu m arrangement.

Spermatozoa o f the Pteriomorphia taxonomic an d phylogenetic implication s The result s o f th e presen t stud y an d o f previou s accounts o n sper m ultrastructur e i n th e Pterio -

183

morphia sensu lato (an d i n bivalve s i n general ) provide a n opportunit y fo r discussio n o f pterio morphian classification and relationships. It is also timely tha t severa l molecula r studie s o f th e Bivalvia have been publishe d i n the last five years or so (e.g. Steine r & Mtiller 1996 ; Adamkewic z e t al 1997 ; Campbell e t al 1998 ; Canap a et al 1999 ; Giribet & Carranz a 1999 ; Steine r 1999a , b) because these, in addition to the extensive anatomical an d fossi l literature , provid e a meaningfu l context fo r any discussion o f sperm results . One of the most important points to emerge fro m this stud y i s tha t th e Pteriomorphi a eithe r i n th e broad sens e (i.e . includin g prionodont s an d isofili branchs; Beurle n 1944 ; Co x 1960 ) o r th e cladistically restricte d sens e o f Walle r (1978 ) [renamed Eupteriomorpha by Boss (1982) ] cannot be define d o n the basis o f sper m synapomorphies . Whether thi s add s suppor t t o th e vie w tha t th e Pteriomorphia ar e no t monophyleti c (e.g . Starobogatov 1992 ) o r simply reflects the fac t tha t the group is both old and successful , i s impossibl e to determine o n the basis o f sperm evidence alone . However, i t i s significan t tha t severa l pterio morphian (sensu lato) highe r tax a ca n b e recognized usin g th e shap e an d interna l sub structure of the acrosomal vesicl e and , occasionall y also nuclea r morphology . Unfortunately , complex spermatozoa suc h a s thos e o f caenogastropo d an d heterobranch gastropod s [e.g . see Healy (1996) for review], d o no t occu r i n th e Bivalvi a becaus e introspermic fertilizatio n i s unknow n withi n th e class. Henc e th e rang e o f sper m character s available fo r taxonomi c and/o r phylogeneti c scrutiny i n th e Bivalvi a i s limited . Th e mos t informative character s appea r t o b e th e shap e an d internal structur e of the acrosoma l vesicl e an d th e spatial relationshi p o f th e vesicl e t o th e nuclea r apex. Th e leas t informativ e bivalv e sper m characters include the structur e of the flagellum (a constant 9 + 2 pattern ) an d mitochondria l shap e [spheroidal in most, sometimes slightly elongate as

Fig. 6 . Diagrammatic summar y of acrosomal ultrastructure throughout the Pteriomorphia (based on all available literature and data presented in this study), (a) Anadara trapezia (Arcidae , Arcoidea). (b) Striarca lactea (Noetiidae , Arcoidea). (c) Glycymeris holosericus (Glycymerididae, Limopsoidea). (d) and (e) Trichomya hirsuta (Mytilidae , Mytiloidea; (e) is the transverse section (TS ) showin g peripheral lamellae which are probably characteristic of the Mytiloidea). (f) Bathymodiolus childressi (Mytilidae , Mytiloidea). (g) Limaria fragilis (Limidae , Limoidea). (h ) Anomia trapezoides (Anomiidae , Anomioidea). (i) and (j) Atrina vexillum (Pinnidae, Pinnoidea - not e dense anterior layer; (j) is TS showing radiating plates - suc h plates occur in all Pteriomorphia with the exception of the Arcoidea and Mytiloidea; the condition in the Anomioidea remains unknown), (k) Saccostrea glomerata (Ostreidae, Ostreoidea) note well-developed axial rod. (1 ) Pinctada margaritifera (Pteriidae , Pterioidea; note prominent dense anterior layer an d electron-lucent zone), (m) Gloripallium pallium (Pectinidae, Pectinoidea; note recurved anterior dense layer), ar, Axial rod (differentiate d componen t of subacrosomal material); av, acrosomal vesicle; n, nucleus; sm, subacrosomal material, (a ) and (h) based on micrographs of Popham (1979); (f) based on micrographs of Eckelbarger & Young (1999) ; all other figures base d on micrographs presented in this study. Scale bars are 0.3 (am , exept (d) and (f) whic h are 0.5 um .

184

J. M . HEAL Y £7 AL.

in som e Veneroida ; se e Healy (1995)] . Acrosoma l and nuclea r lengt h ar e probably tie d t o functional concerns such as the thickness of the egg jelly layer (acrosomal vesicl e large r i n mytiliid s wit h thicke r jelly coat s tha n thin coats) an d the environment of fertilization (ect-aquati c fertilizer s wit h larg e acrosomes an d rounde d nucle i v . ent-aquati c fertilizers wit h smalle r acrosome s an d mor e elongate nuclei ; Franzen 1983) . Some group s suc h as th e Ostreidae , wit h bot h ect-aquati c an d ent aquatic (brooding ) species , appea r t o sho w n o marked impac t o f altere d fertilizatio n biolog y o n sperm organelle shape. What follows is a group-bygroup discussio n o f taxonomi c an d phylogeneti c implications o f pteriomorphia n sper m ultra structure, based on all available source s o f data. As a framewor k for thi s discussio n th e classificatio n of Bos s (1982 ) i s adopte d (bu t altere d accordin g to th e Internationa l Cod e o f Zoologica l Nomen clature recommende d endin g o f '-oidea ' fo r superfamilies). Superorder Prionodonta [Order Arcoida (Arcoidea, Limopsoidea)] The observe d sper m ultrastructura l difference s between th e Arcoide a an d Limopsoide a ar e pronounced, an d surprisin g give n th e genera l acceptance o f a monophyleti c Arcoida . Th e absence o f marke d differentiatio n o f acrosoma l vesicle content s i n th e Arcoide a (content s finel y granular; no marked differentiation ) contrasts with the differentiated acrosomal vesicl e content s in the Limopsoidea (a n anterio r dens e laye r recurve d posteriorly; other contents coarse granular). Indeed, the onl y notabl e sper m featur e linkin g Arcoide a and Limopsoide a i s th e absenc e o r poo r develop ment of an anterior depression of the nucleus, here judged a s a likel y symplesiomorph y (occurrenc e and strength of the nuclear depression bein g highly variable amon g pteriomorphians) . Th e acrosoma l vesicle o f th e Arcoide a (low-conical , content s uniformly fin e granular ) ma y represen t a plesio morphic conditio n fro m whic h th e mor e comple x vesicle o f th e Limopsoide a ha s arisen . Thi s scenario would at least accord with the known later appearance o f the Limopsoidea i n the fossil recor d (Cox 1960 , 1969 ; Newel l 1969 ; Thoma s 1978 ; Waller 1978) . However, the similarity of immature acrosomes o f Glycymeris holsericus to those of the Pectinoidea, Pterioide a an d eve n certai n Anomalodesmata (Heal y 1996 ) hint s perhap s a t a more substantia l evolutionar y rol e fo r th e Limopsoidea o r their immediat e ancestors . Clearl y there exist s a need fo r comparativ e work on other limopsoideans i n orde r t o investigat e the relationship o f thi s grou p t o othe r pteriomorphians . I n particular, i t woul d b e o f interes t t o us e sper m

ultrastructure t o tes t th e suggestio n o f Thoma s (1978), base d o n a consideratio n o f hing e plat e structure, that the Glycymerididae an d Limopsida e may have arisen from th e Cucullaeidae. Superorder Isofilibranchia [Order Mytiloida (Mytiloidea)] Kafanov & Drozdo v (1998 ) hav e conclude d tha t available sper m dat a suppor t th e recognitio n (o r redefining) o f thre e subfamilie s withi n th e Mytilidae base d o n difference s i n th e for m o f subacrosomal material present and the shape of the nucleus (Fi g 4) : Modiolina e (e.g . Modiolus, Brachidontes, Choromytilus, Aulacomya, Arcuatula, Adula an d Septifer - acrosoma l vesicl e conical, sometime s elongate ; subacrosoma l material diffuse , withou t axia l rod ; nucleu s short , solid, withou t anterio r foss a fo r axia l rod) ; Mytilinae [e.g . Mytilus, Crenomytilus and Perna acrosomal vesicl e conica l an d usuall y elongate ; subacrosomal materia l featurin g well-develope d axial ro d o f preforme d (protein ) fibres ; nucleu s short, almos t completel y penetrate d b y narro w anterior foss a fo r housin g axia l rod ; se e als o o f Tilney e t al. 1987 , fig . 2] ; Musculina e (e.g . Musculus - acrosoma l vesicl e short , blunt-conical; nucleus elongat e wit h elongat e anterio r foss a t o house axia l rod) . Thi s revise d interpretatio n o f mytiliid classificatio n involve s movemen t o f certain genera from thei r more familiar subfamilia l placements (e.g . Musculus fro m Crenellina e t o Musculinae; Adula fro m Lithophagina e t o Modiolinae) an d undoubtedl y provides a fresh , i f somewhat radical , revie w o f th e subject . Furthe r comparative studie s of mytilid sper m ultrastructur e will still be necessary to test any major changes to traditional (e.g. Soot-Ryen & Newell 1969 ) mytilid classification. Th e simple , cap-shape d acrosoma l vesicle o f Bathymodiolus spp . (L e Penne c & Beninger 1997 ; Eckelbarge r & Youn g 1999 ) i s almost certainl y close r t o th e plesiomorphi c mytiloid acrosom e tha n th e highl y structure d Mytilus typ e (Fig. 6f) . The relationshi p o f th e mytiloid s t o othe r pteriomorphians (sensu lato) is not greatly clarified by sper m ultrastructure . Walle r (1978 , 1998 ) ha s consistently argue d tha t th e Mytiloid a for m th e sister taxo n t o al l othe r pteriomorphian s (Eupteriomorphia), wherea s Campbel l e t al . (1998), on the basis of 18S ribosomal DNA (rDNA) studies, hav e suggeste d a clos e relationshi p between mytiloidans and the Ostreoida + Pterioidea (i.e. firml y amon g th e Eupteriomorphia) . Th e substructural complexit y o f th e acrosoma l vesicl e and dominanc e o f th e highl y electron-dens e laye r anteriorly suggest s a possible connectio n betwee n the Mytiloida and the Pterioidea (Pteriidae ) but not

SPERMATOZOA O F THE PTERIOMORPHI A

with th e Ostreoide a [o r Ostreoid a sensu Walle r (1978)]. Certainly , th e developin g mytili d acrosomal vesicle i s reminiscent o f those o f some Pterioidea and the Pinnoidea (Hodgson & Bernard 1986a, figs 12-14). However, the dense layer in the Pterioidea, a s in the Pectinoide a an d Pinnoidea, i s associated with strongly developed radiating plates - structures which have never been observed in any of th e man y mytiloi d specie s examine d t o dat e (mytiloids instea d exhibitin g fine , concentri c lamellae; Garrid o & Gallard o 1996 ; thi s study) . Comparative studie s o f selectiv e stainin g o f acrosomal component s (e.g . phosphotungsti c acid and silve r methenamin e treatment ; End o 1976 ; Sousa e t al. 1998 ) i n mytiloid s an d pterioidean s will be needed to address the question of homology in acrosomal features. Superorder Eupteriomorphia [Order Pteroida (Suborder Pteriina (Pterioidea), Suborder Pinnina-Pinnoidea); Order Limoida (Limoidea); Order Ostreoida (Suborder Ostreina (Ostreoidea, Dimyoidea, Plicatuloidea), Suborder Pectinina (Pectinoidea, Anomioidea)] Acrosomal substructure differs substantiall y among the Eupteriomorphia [ = Pteriomorphia sensu Waller (1978)] but most appear to exhibit radiating plates indicating a possibl e synapomorphy . Thre e sub divisions see m apparen t base d o n sper m features : (1) the Ostreoidea and Limoidea (acrosomal vesicle contents showing wedge-shaped differentiated zone (granular or lamellate) apically) ; (2) the Pterioidea , Pinnoidea an d Pectinoide a (acrosoma l content s with a highly electron-dense layer associated with long radiatin g plates ; sometime s wit h additiona l differentiation zones) ; (3 ) th e Anomioide a (acrosomal vesicl e wit h homogeneou s contents ; presence of radiating plates unknown). Perhaps the only uncontroversia l aspec t o f thes e grouping s i s the implie d clos e lin k betwee n th e Pterioide a an d Pinnoidea. I n hi s cladisti c analysi s o f pteriomorphian relationships , Walle r (1978 ) determined th e Pterioid a t o b e th e siste r grou p to the Limoida + Ostreoida and that the Limoida was the siste r grou p to the Ostreoid a (Suborder s Ostreina an d Pectinina), bu t i n a recent reanalysi s of living and fossil Pteriomorphia he (Waller 1998 ) actually redefine s the Eupteriomorphi a t o exclud e the Arcoid a an d Limoida . Alle n (1985 ) foun d i t difficult t o accept Waller's (1978 ) conclusion s and favoured th e mor e traditiona l vie w (e.g . Thiel e 1935) tha t the true relationship o f the Limoida la y with the Pectinina rather than the Ostreina. Recen t 18S rDN A wor k b y Steine r (1999ft ) likewis e

185

favours thi s view . Morto n (1996 ) considere d th e Ostreoidea t o b e mos t closel y relate d t o th e Limoidea but , lik e Allen , Steine r (an d possibl y most authors), also recognized a firm bond between these taxa and the Pectinoidea. Accordin g to Waller (1978, 1998) , similaritie s betwee n limoidan s an d pectinids i n th e structur e o f th e mantl e tentacles , eyes an d calciti c shel l microstructur e ar e du e t o convergence. The fact that the acrosomal vesicl e of Limaria fragilis resemble s mor e closel y thos e o f the Ostreida e tha n thos e o f th e Pectinin a furthe r suggests tha t an y lin k betwee n th e Limoid a an d Pectinina is probably a distant one. Significantly, in trees derived from 18 s rDNA analyses, ostreids are consistently positione d fa r fro m th e pectinid s (Steiner & Muller 1996 ; Adamkewic z et al 1997 ; Campbell e t al 1998 ; Canap a et al 1999 ; Girribe t & Carranz a 1999 ; Steine r 1999a , ft) . I f Waller' s (1978) cladogra m i s accepted , the n th e acrosoma l similarities betwee n th e Ostrein a an d Limoid a (notably th e differentiated , apica l wedge-zone ) would hav e t o b e see n a s plesiomorphi c an d th e dense anterio r laye r i n th e Pectinoide a interprete d as convergent with that of the Pterioida. At present there is no evidence for either of these conclusions , but it will be vital to establish th e homology of the apical wedge-shape d zon e i n th e Limoide a an d Ostreoidea usin g TE M an d selectiv e stainin g properties o f matur e spermatozo a (e.g . Sous a & Azevedo 1998 ) an d detaile d observation s o n acrosomal vesicl e development . I t wil l b e particularly interesting , give n th e diversit y o f opinions amon g recen t authors , t o determin e whether th e acrosome s o f th e Dimyoide a an d Plicatuloidea resembl e thos e o f th e Limoidea , Ostreoidea, Anomioide a o r th e Pectinoidea . According t o Steine r (1999ft) , th e Plicatulidae , Anomiidae, Limida e an d Pectinidae for m a clade, based o n 1 8 rDNA sequence data , with plicatulid s and anomiids clustering together. The Dimyoidea + Plicatuloidea wer e regarded a s a sister group to the Ostreoidea by Waller (1978) and as a sister group to the Pectinoidea b y Morton (1996) [see also Watson (1930) an d Yong e (1973, 1975)] . Als o worth y of future stud y ar e th e suggestion s b y Scarlat o & Starobogatov (1975 ) an d Starobogatov (1992 ) tha t the Ostreoidea and Gryphaeoidea ar e most closely related t o th e Arcoid a bu t derive d fro m differen t arcoid ancestor s [althoug h se e Walle r (1998 ) fo r refutation o f th e diphyleti c Ostreoide a base d o n anatomical grounds] . Spermatologically , however, it would appear much easier to derive the Ostreoida and Limoid a fro m a n arcoi d stoc k tha n fro m an y other group of extant Pteriomorphia. The precis e natur e o f th e relationshi p o f th e Pterioidea an d Pinnoidea t o th e Pectinoide a (and , more generally , t o othe r pteriomorphians ) i s uncertain. The present stud y and those of Dorange

186

J. M . HEAL Y ETAL.

& Le Pennec (1989) and Thielley et al. (1993) have shown that all three superfamilie s exhibi t a highly electron-dense portio n o f the acrosoma l vesicl e i n addition t o ver y well-develope d radiatin g plate s (this association, a possible synapomorph y of these taxa). Thi s contrast s wit h acrosome s o f th e Mytiloida which, despite significan t differentiatio n of th e vesicl e contents , appea r t o lac k radiatin g plates i n the electron-dense laye r (e.g . Endo 1976 ; Hodgson & Bernard 19860, b\ Kafanov & Drozdov 1998; this study). For this reason, it is believed that derivation o f the Pinnoidea fro m th e Mytiloidea o r immediate antecedents (e.g. Allen 1985 ) is unlikely unless th e plateles s conditio n i s indee d plesio morphic. Interestingly , th e refolde d configuratio n of th e dens e laye r i n Pectinoide a (Pectinida e an d Spondylidae) could conceivably have been derived from th e acrosoma l configuratio n observe d i n prionodont Glycymeris holsericus (Limopsoidea , Arcoida), bu t radiating plate s hav e ye t t o b e demonstrated i n acrosome s o f th e Arcoida . Although Waller (1978) considered th e Pterioida t o be not far removed from the Arcoida, this is not the case wit h hi s positionin g o f th e Pectinoide a (furthest fro m th e Arcoid a i n hi s cladogram) . Molecular studie s offe r som e suppor t fo r a clos e connection betwee n th e Pectinoide a + Pterioidea and the Arcoida (Steiner & Miiller 1996 ; Canapa et al. 1999) and, on the basis of comparative anatomy, Allen (1985) see s the Arcoidea a s basal among all extant Pteriomorphia. As discussed above , th e ful l extent o f involvemen t o f th e Arcoid a i n pterio morphian evolution can only be clarified by furthe r investigation of livin g forms. Any suggestio n that the Pterioide a ma y b e diphyleti c [e.g . Steine r 1999&, grouping Pteriids wit h Ostreidae rather than with Pinnidae ; bu t se e als o Adamkewic z e t al . (1997)] does not receive strong support from sper m ultrastructure. However, it is interesting to note that within the Pterioidea, acrosomal morphology in the Malleidae (Lamprel l & Heal y 1998 ) an d Isognomonidae (Heal y 1989 , 1996 ) is less comple x than that of the Pteriidae (Thielle y e t al. 1993 ; this study), bu t ver y simila r t o tha t observe d i n th e Pinnoidea (D e Gauleja c e t al . 1995 ; thi s study) . Although molecula r studie s hav e produce d n o strong consensu s regardin g th e Pinnoidea Pterioidea relationshi p (Campbel l e t al . 1998 ; Steiner 1999&) , comparativ e anatom y (Walle r 1978, 1998 ; Morto n 1996; ) shel l microstructur e (Carter 1990 ) an d availabl e sper m dat a clearl y associate thes e taxa. The relationshi p o f th e Anomioide a t o othe r eupteriomorphians remain s far fro m clear . Morton (1996) considered th e group to be the sister taxon to the Pteriode a + Pinnoidea, wherea s Walle r (1978 ) concluded tha t anomioid s belonge d withi n th e Ostreoida, specificall y a s th e siste r taxo n t o th e

Pectinoidea (th e Ostreoide a bein g th e siste r taxo n to the Anomioidea + Pectinoidea). Purcho n (1987 ) affiliated th e Anomioide a mos t closel y wit h th e Pectinoidea an d Limoide a base d o n anatomica l features, as has Steiner (1999& ) based on molecula r data. Th e apparen t lac k o f differentiatio n o f acrosomal content s in Anomia trapezoides [shown in micrograph s b y Popha m (1979) ] immediatel y distinguishes th e Anomioidea fro m th e Ostreoide a and Limoide a o n th e on e han d an d fro m th e Pterioidea, Pinnoide a an d Pectinoidea o n the other. Has the anomioidean acrosom e become secondaril y simplified o r i s ther e a connectio n wit h th e Arcoidea (whic h also lac k differentiatio n o f acrosomal contents) ? A t th e presen t tim e i t i s impossible t o offe r an y judgemen t o n thi s issu e until more detailed an d comparative sperm data for the Anomiidae becom e available . Sperm data strongly suppor t the traditional vie w (e.g. Daki n 1928 ; Thiel e 1935 ) o f a clos e relationship betwee n th e Pectinida e an d th e Spondylidae, an d in fact ther e d o not appear t o be any sperm features separating the two families. The acrosomal vesicl e o f Gloripallium pallium show s an apica l constrictio n o f th e invaginatio n no t present in P. maximus, suggesting the possibility o f generic leve l difference s amon g th e Pectinidae . Future studie s o f th e Propeamussiida e an d Syncyclonemidae, an d further pectinid gener a such as Amusium, ma y she d furthe r ligh t ont o th e relationships withi n the Pectinoidea , an d between the Pectinoidea an d other Pteriomorphia . The author s than k T . Gorring e (Departmen t o f Zoolog y and Entomology ) fo r hi s assistanc e wit h aspect s of TE M and photography. Live or glutaraldehyde-fixed specimen s of Striarca lactea an d Glycymeris holosericus wer e generously supplie d b y G . Haszpruna r (Zoologisch e Staatssammlung Miimchen ) an d K . Lamprel l (Queensland Museum) , respectively . Thi s stud y wa s supported financiall y b y a Senio r Researc h Fellowshi p and a researc h gran t fro m th e Australia n Researc h Council (JH ) an d by University o f Queenslan d Research Grants (J H and JK). W e also thank th e Director and staf f of th e Queenslan d Universit y Hero n Islan d Researc h Station an d th e Orpheu s Islan d Researc h Statio n fo r making available thei r facilities fo r this project. Academi c Press and The Malacological Institute (USA) ar e thanked for grantin g permissio n t o reproduc e figure s fro m End o (1976) an d Kafano v & Drozdov (1998) . The manuscrip t has benefite d fro m constructiv e comment s b y A . N . Hodgson (Rhode s University) .

References ADAMKEWICZ, S . L. , HARASEWYCH , M . G. , BLAKE , J. , SAUDEK, D . & BULT , C . J . 1997 . A molecula r phylogeny o f the bivalve mollusks . Marine Biology and Evolution, 14, 619-629. ALLEN, J . A . 1985 . Th e Recen t Bivalvia : thei r for m an d

SPERMATOZOA O F THE PTERIOMORPHIA evolution. In : TRUEMAN , E. R . & CLARKE , M . R . (eds) Th e Mollusca, Volume 10 : Evolution. Academic Press, New York, 337-403. ANDERSON, W. A. & PERSONNE, P. 1970a. The localizatio n of glycoge n i n th e spermatozo a o f variou s invertebrate an d vertebrate species . Journal of Cell Biology, 44 , 29-51. & 1970& . Recen t cytochemica l studie s o n spermatozoa o n som e invertebrat e an d vertebrat e species. In : BACCETTI , B . (ed. ) Comparative Spermatology. Academi c Press , Ne w York , 431-449. BACCETTI, B . & AFZELIUS , B . A . 1976 . Biology o f th e Sperm Cell . Monographs o n Developmental Biology, Volume 10 . S. Karger, Basel. BERNARD, R . T . F . & HODGSON , A . N . 1985 . The fin e structure of the sperm and spermatid differentiation in th e brow n musse l Perna perna. South African Journal o f Zoology, 20 , 5-9 . , DAVIES , B . R . & HODGSON , A . N . 1988 . Reproduction i n a brackish-water mytilid : gameto genesis an d embryoni c development . Th e Veliger, 30, 278-290. BEURLEN, K . 1944 . Beitrage zu r Stammesgeschicht e de r Muscheln. Sitzungsberichte de r Bayererische Akademie de r Wissenschaften, 1944 , 133-145. Boss, K . J . 1982 . Mollusca . In : PARKER , S . P . (ed.) Synopsis and Classification of Living Organisms Volume 2 . McGraw-Hill, New York, 945-1166. BOURCART, C . LAVALLARD , R . & LUBET , P . 1965 . Ultrastructure d u spermatozoid e d e l a moul e (Mytilus perna vo n Ihering) . Compte Rendu Hebdomadaires des Seances de VAcademic des Sciences, Paris, D, 260, 5096-5099. Bozzo, M . G. , RIBES , E. , SAGRISTA , E., POQUET , M . & DURFORT, M . 1993 . Fin e structur e o f th e spermatozoa o f Crassostrea gigas (Mollusca , Bivalvia). Molecular Reproduction an d Development, 34 , 206-211. CAMPBELL, D. C., HOEKSTRA, K. J. & CARTER, J. G. 1998. 18S ribosomal DNA and evolutionary relationships within the Bivalvia . In: JOHNSON, P. A. & HAGGART, J. (eds ) Bivalves: A n Eo n o f Evolution - Paleobiological Studies Honoring Norman D. Newell. University of Calgary Press, Calgary, 75-85. CANAPA, A., MAROTA, I., ROLLO, F. & OLMO, E. 1999. The small-subunit rRNA gene sequences of venerids and the phylogen y o f Bivalvia . Journal o f Molecular Evolution, 48, 463-468. CARTER, J . G . 1990 . Evolutionary significanc e o f shel l microstructure i n th e Palaeotaxodonta , Pteriomorphia, an d Isofilibranchi a (Bivalvia : Mollusca). In : CARTER , J . (ed. ) Skeletal Biomineralization: Patterns, Processes and Evolutionary Trends, Volume V . Va n Nostran d Reinhold, New York, 135-296. Cox, L . R . 1960 . Thoughts o n th e classificatio n o f th e Bivalvia. Proceedings of th e Malacological Society of London, 34, 60-88. 1969. General features of Bivalvia. In: MOORE, R. C. (ed.) Treatise o n Invertebrate Paleontology. Part N. Volume L Mollusca 6, Bivalvia. Geological Societ y of America , Boulder , CO , an d th e Universit y o f Kansas Press, Lawrence, KS, N2-N129.

187

DADDOW, L . Y M . 1986 . A n abbreviate d metho d o f double lea d stai n technique . Journal o f Submicroscopic Cytology, 18 , 221-224. DAKIN, W . J . 1928 . Th e anatom y an d phylogen y o f Spondylus, wit h a particula r referenc e t o th e lamellibranch nervou s system . Proceedings of th e Royal Society o f London, Series B, 103, 337-354. DAN, J . C. & WADA, S. K. 1955. Studies of the acrosome . IV. Th e acrosom e reactio n i n som e bivalv e spermatozoa. Biological Bulletin, 109, 40-55. DANIELS, E . W. , LONGWELL , A . C. , MCNIFF , J . M . & WOLFGANG, R . W . 1971 . Ultrastructur e o f spermatozoa fro m th e American oyste r Crassostrea virginica. Transactions of the American Microscopical Society, 90, 275-282. DESILETS, J. , GICQUAUD , C . & DUBE , F . 1995 . A n ultrastructural analysi s o f earl y fertilizatio n event s in th e gian t scallop , Placopecten magellanicus (Mollusca, Pelecypoda) . Invertebrate Reproduction and Development, 27', 115-129 . DORANGE, G . & L E PENNEC , M . 1989 . Ultrastructura l characteristics o f spermatogenesi s i n Pecten maximus (Mollusca , Bivalvia) . Invertebrate Reproduction an d Development, 15, 109-117 . DROZDOV, A . L. 1979 . Spermiogenesis an d Ultrastructure of spermatozoa of Crenomytilus gray anus (Dunker). The Soviet Journal of Marine Biology, 5, 315-319. & MASHANSKY , V. F. 1979 . Acrosomal reaction o f the spermatozo a o f Crenomytilus gray anus. Tsitologiya, 21 , 657-66 1 [i n Russia n wit h Englis h summary 1. & REUNOV , A. A . 1986a . Spermatogenesi s an d th e sperm Ultrastructur e i n th e musse l Modiolus difficilis. Tsitologiya, 28 , 1069-107 4 [i n Russia n with English summary]. & 1986£ . The morpholog y o f the gamete s o f the blue mussel Mytilus edulis from th e White an d Japan Sea s an d Avach a Bay. The Soviet Journal of Developmental Biology, 12, 236-239. , PODGORNAYA , O . I . & MASHANSKY , V . F . 1981 .

Effect o f cytochalasi n B o n acrosoma l reactio n o f sperms o f gre y se a urchin s an d o f Gray' s mussel . Doklady Academii Nauk SSSR, 257 , 1244-1246 [in Russian with English summary] . 1982. Facto r preventin g o f acti n polymerization i n the sperm's acrosom e i n grey sea urchin an d Gray's mussel . Dokladi Academii Nauk SSSR, 267 , 479-48 1 [i n Russia n wit h Englis h summary]. ECKELBARGER, K . J . & DAVIS , C . V . 1996. Ultrastructure of th e gona d an d gametogenesi s i n th e easter n oyster, Crassostrea virginica. II . Testi s an d spermatogenesis. Marine Biology, 127, 89-96. & YOUNG , C . M . 1999 . Ultrastructur e o f gametogenesis i n a chemosynthetic mytili d bivalv e (Bathymodiolus childressi) fro m a bathyal, methane seep environmen t (norther n Gul f o f Mexico) . Marine Biology, 135, 635-646. ENDO, S . 1976 . Silver methenamin e an d phosphotungsti c acid stainin g o f th e acrosom e o f Mytilus edulis. Experimental Cell Research, 100, 71-78. FRANZEN, A . 1955 . Comparative morphologica l investi gations int o th e Spermiogenesi s amon g Mollusca . Zoologiska Bidrag Fran Uppsala, 30 , 399-456.

188

J. M . HEAL Y £7 AL.

1983. Ultrastructural studies of spermatozoa in three bivalve species with notes on evolution of elongate d sperm nucleu s i n primitiv e spermatozoa . Gamete Research, 7, 199-214. GALTSOFF, P . S. & PHILPOTT, D. E. 1960 . Ultrastructure o f the spermatozoo n o f th e oyste r Crassostrea virginica. Journal o f Ultrastructural Research, 3 , 241-253. GARRIDO, O . & GALLARDO , C . S . 1996 . Ultrastructure o f sperms i n bivalve molluscs o f the Mytilidae family . Invertebrate Reproduction an d Development, 29 , 95-102. GAULEJAC, DE , B., HENRY , M . & VICENTE , N . 1995 . An Ultrastructural study of gametogenesis o f the marine bivalve Pinna nobilis (Linnaeus , 1758) . II . Spermatogenesis. Journal ofMolluscan Studies, 61, 393-403. GIRIBET, G . & CARRANZA , S . 1999 . Poin t Counte r Point - Wha t ca n 18 S rDN A d o fo r bivalv e phylogeny? Journal o f Molecular Evolution, 48 , 256-258. GROBBEN, C . 1894 . Zur Kenntnis s de r Morphologic , de r Verwandtschaftsverhaltniss un d de s Systems de r Mollusken. Sitzungsberichte de r Akademie Wissenschaften Wien, 103, 61-86. GUTIERREZ, M. , PERE Z CRESPO , J . & PASCUAL , E. 1978. Ultraestructura d e ovocito s y espermatozoide s de l ostion, Crassostrea angulata Lmk . d e l a cost a sudatlantica de Espana. Investigacion Pesquera, 42, 167-178. Gwo, J.-C. , Liou , C.-H . & CHENG , C.-H . 1996 . Ultrastructure o f th e spermatozo a o f th e Pacifi c oyster Crassostrea gigas (Mollusca , Bivalvia , Ostreidae). Journal o f Submicroscopic Cytology and Pathology, 28, 395-400. HEALY, J . M . 1989 . Spermiogenesis an d spermatozo a i n the relic t bivalv e genu s Neotrigonia: relevanc e t o trigonioid relationships , particularl y wit h Unionoidea. Marine Biology, 103 , 75-85. 1995. Comparative sper m Ultrastructure in veneroi d bivalves (Mollusca) . In: JAMIESON , B . G . M. , Ausio, J . & JUSTINE , J.-L . (eds ) Advances i n Spermatozoal Phylogeny and Taxonomy. Memoire s du Museu m Nationa l d ' Histoir e Naturelle , 166 , 155-166. 1996. Mollusca n sper m Ultrastructur e : correlation with taxonomi c unit s withi n th e Gastropoda , Cephalopoda an d Bivalvia . In: TAYLOR , J. D . (ed.) Origin and Evolutionary Radiation of the Mollusca. Oxford Universit y Press, Oxford , 99-113. & LESTER, R. J. G. 1991 . Sperm Ultrastructure in the Australian oyste r Saccostrea commercialis (Iredal e & Roughley ) (Bivalvia , Ostreidae) . Journal o f Molluscan Studies, 57, 219-224. HODGSON, A . N . & BERNARD , R . T . F . 19860 . Ultrastructure of the sper m and Spermatogenesi s of three specie s o f Mytilida e (Mollusca , Bivalvia) . Gamete Research, 15, 123-135. & 1986& . Observations on the Ultrastructure of the spermatozoo n o f tw o mytilid s fro m th e south west coas t o f England . Journal o f th e Marine Biological Association o f th e United Kingdom, 66 , 385-390. HYLANDER, B . L . & SUMMERS , R . G . 1977 . A n

Ultrastructural analysi s o f th e gamete s an d earl y fertilization i n tw o bivalv e molluscs , Chama macerophylla an d Spisula solidissima wit h specia l reference t o gamet e binding . Cell an d Tissue Research, 182, 469-489. IREDALE, T . 1939 . Mollusca, Par t 1 . British Museum (Natural History) Great Barrier Reef Expedition, Scientific Reports, 5, 209-425. JAMIESON, B . G . M . 1987 . A biologica l classificatio n o f sperm types , wit h special reference t o annelids an d molluscs, an d a n exampl e o f spermiocladistics . In: MOHRI, H . (ed. ) Ne w Horizons i n Sperm Cell Research. Japa n Scientifi c Societie s Pres s an d Gordon an d Breach Scienc e Publishers , Ne w York, 311-332. 1991. Fish Evolution an d Systematics: Evidence from Spermatozoa. Cambridg e Universit y Press , Cambridge. KAFANOV, A . I . & DROZDOV , A . L . 1998 . Comparativ e sperm morpholog y an d phylogeneti c classificatio n of Recen t Mytiloide a (Bivalvia) . Malacologia, 39 , 129-139. KOMARU, A. , KONISHI , K . & WADA , K . T . 1994 . Ultrastructure of spermatozoa fro m induce d triploi d Pacific oyster . Crassostrea gigas. Aquaculture, 123, 217-222. , SCARPA , J. & WADA , K . T . 1995 . Ultrastructure o f spermatozoa i n induce d tetraploi d musse l Mytilus galloprovincialis (LMK) . Journal o f Shellfish Research, 14, 405-410. KYOZUKA, K . & OSANAI , K . 1985 . Sperm entry in oyste r (Crassostrea gigas} oocytes. Bulletin of th e Marine Biological Station, Asamushi, Tohoku University, 18, 25-34. LAMPRELL, K . & HEALY , J . 1998 . Bivalves o f Australia. Volume 2 . Backhuys Publishers, Leiden. LE PENNEC , M . & BENINGER , P . G. 1997 . Ultrastructural characteristics o f Spermatogenesi s in thre e specie s of deep-se a hydrotherma l ven t mytilids . Canadian Journal o f Zoology, 75, 308-316. LINCK, R . W . 19730 . Comparativ e isolatio n o f cili a and flagell a fro m th e lamellibranc h mollusc , Aequipecten irradians. Journal of Cell Science, 12, 345-367. 1973/7. Chemical an d structural differences between cilia an d flagell a fro m th e lamellibranc h mollusc , Aequipecten irradians. Journal of Cell Science, 12, 951-981. LONGO, F. J. & DORNFELD, E . J . 1967 . The fin e structur e of spermati d differentiatio n i n th e mussel , Mytilus edulis. Journal o f Ultrastructure Research, 20 , 462-480. MACNEIL, F . S . 1937 . The systemati c positio n o f th e pelecypod genu s Trinacria. Journal o f th e Washington Academy o f Science, 27, 452-458. MABUCHI, Y . & MABUCHI , I. 1973 . Acrosomal ATPas e in starfish an d bivalv e mollus k spermatozoa . Experimental Cell Research, 82, 271-279. MOLINIA, F . C . & SWAN , M. A . 1991 . Effec t o f ethano l and methano l o n th e motilit y o f Saccostrea commercialis sper m an d sper m models . Molecular Reproduction an d Development, 30, 241-249. MORTON, B . 1996 . Th e evolutionar y histor y o f th e Bivalvia. In : TAYLOR , J . D . (ed. ) Origin an d

SPERMATOZOA O F THE PTERIOMORPHI A Evolutionary Radiation o f th e Mollusca. Oxfor d University Press, Oxford, 337-359. NEVESSKAYA, L. A. , SCARLATO , O . A. , STAROBOGATOV , Y. I. & EBERZIN , A . G . 1971 . New idea s o n bivalv e systematics. Paleontological Journal, 5 , 141-155. NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitiates, 2206. 1-25 . 1969. Classification o f Bivalvia . In : MOORE , R . C . (ed.) Treatise o n Invertebrate Paleontology. Part N. Volume 1 . Mollusca 6, Bivalvia. Geological Societ y of America , Boulder , CO , an d th e Universit y o f Kansas Press, Lawrence, KS, N205-N224. NIIJIMA, L . & DAN , J . 1965 . The acrosom e reactio n i n Mytius edulis. Fine structure of the intact acrosome. Journal of Cell Biology, 25, 243-248. O' FOIGHIL , D . 1989 . Role o f spermatozeugmat a i n th e spawning ecolog y o f th e broodin g oyste r Ostrea edulis. Gamete Research, 24, 219-228. OSANAI, K . & KYOZUKA , K . 1982 . Cross fertilizatio n between se a urchi n egg s an d oyste r spermatozoa . Gamete Research, 5, 49-60. PASCHENKO, S . V . & DROZDOV , A . L . 1990 . Th e ultrastructural stud y o f th e spermatogenesi s i n th e surf cla m Glycymeris yessoensis. Tsitologiya, 32 , 325-330. & 1991 . The ultrastructure of gametes and the acrosome reactio n o f sper m i n the bivalv e mollus c Glycymeris yessoensis. Tsitologiya, 33 , 20-24. POPHAM, J . D . 1974 . Comparative morphometrics o f th e acrosomes o f th e sperm s o f 'externally ' an d 'internally' fertilizin g sperm s o f th e shi p worms (Teredinidae, Bivalvia , Mollusca). Cell an d Tissue Research, 150, 291-297. 1979. Comparativ e spermatozoo n morpholog y an d bivalve phylogeny . Malacological Review, 12 , 1-20. & MARSHALL , B . 1977 . The fin e structur e o f th e spermatozoon o f th e protobranc h bivalve , Nucula hartvigiana Pfeiffer . Veliger, 19 , 431-433. POJETA, J., JR 1971. Review of Ordovician pelecypods. US Geological Survey Professional Paper, 695. 1978. The origin and early taxonomic diversificatio n of pelecypods . Philosophical Transactions o f th e Royal Society o f London, Series, B , 284 , 225-246. PURCHON, R . D. 1987 . Classification an d evolution of th e Bivalvia : a n analytica l study . Philosophical Transactions of the Royal Society of London, Series B, 316, 277-302. REUNOV, A. A . & DROZDOV, A . L . 1986 . Ultrastructure of spermatozoa i n th e bivalve s Adula falcatoides an d Septifer keenae. Marine Biology (Vladivostok), 5, 74-76 [i n Russian with English summary] . & 1987 . Spermatogenesis and ultrastructure of spermatozoa o f th e musse l Mytilus cornuscus. Tsitologiya, 29 , 260-26 6 [i n Russian wit h Englis h summary]. & HODGSON , A . N . 1994 . Ultrastructure o f th e spermatozoa o f fiv e specie s o f Sout h Africa n bivalves (Mollusca) , an d a n examinatio n o f earl y spermatogenesis. Journal o f Morphology, 219 , 275-283. , Au, D. W. T. & Wu, R. S. S. 1999. Spermatogenesis

189

of th e green-lippe d musse l Perna viridis wit h dual patterns o f acrosom e an d tai l developmen t i n spermatids. Helgolander Marine Research, 53 , 62-69. RETZIUS, G . 1904 . Zu r Kenntni s de r Spermie n de r Evertebraten. Biologische Untersuchungen, 11 , 1-32, Pis I-XIII. 1905. Zur Kenntni s de r Spermie n de r Evertebrate n II. Biologische Untersuchungen, 12 , 1-32 , Pi s XI-XIX. ROUSE, G . W . & JAMIESON , B . G . M . 1987 . A n ultrastructural stud y o f th e spermatozo a o f th e polychaetes Eurythoe complanata (Amphinomidae), Clymenella laseroni an d Micromaldane laseroni (Maldanidae ) wit h definition o f sperm types in relation to reproductive biology. Journal o f Submicroscopic Cytology, 19 , 573-584. SALVINI-PLAWEN, L . v . & STEINER , G . 1996 . Synapomorphies an d plesiomorphie s i n highe r classification o f Mollusca . In : TAYLOR , J . D . (ed.) Origin and Evolutionary Radiation of the Mollusca. Oxford University Press, Oxford, 29-51. SCARLATO, O . A . & STAROBOGATOV , Y. I. 1975 . New dat a for constructin g a syste m o f classificatio n fo r th e Bivalvia. Malacological Review, 11, 65-66. & 1978 . Phylogenetic relation s an d th e early evolution o f th e clas s Bivalvia . Philosophical Transactions of the Royal Society of London, Series B, 284, 217-224. SOOT-RYEN, T . & NEWELL , N . D . 1969 . Mytilidae. In : MOORE, R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Volume 1. Mollusca 6, Bivlavia. Geologica l Societ y o f America , Boulder, CO, and the University of Kansas Press, Lawrence , KS,N271-N280. SOUSA, M . & AZEVEDO , C . 1988 . Comparativ e silve r staining analysi s o n spermatozo a o f variou s invertebrate species . International Journal o f Invertebrate Reproduction an d Development, 13 , 1-8. & OLIVEIRA , E . 1994 . An ultrastructura l stud y o f Crassostrea angulata (Mollusca , Bivalvia ) spermatogenesis. Marine Biology, 120, 545-551. , GUERRA , R. , OLIVEIRA , E . & TORRES , A . 1998 . Comparative PT A stainin g o f mollusca n spermatozoa. Journal o f Submicroscopic Cytology and Pathology, 30, 183-187 . STAROBOGATOV, Y . I . 1992 . Morphologica l basi s fo r phylogeny and classification of Bivalvia. Ruthenica, 2, 1-25 . STEINER, G . 1999a . What ca n 18 S rDNA do fo r bivalv e phylogeny? Respons e [t o Giribe t an d Carranza] . Journal o f Molecular Evolution, 48, 258-261. \999b. Molecula r phylogen y o f pteriomorp h Bivalvia inferre d fro m 18 s rDN A sequences . In : Biology and Evolution of the Bivalvia: Paper and Poster Abstracts. Malacological Societ y of London, 47-48. & MULLER , M . 1996 . What ca n 18 S rDNA d o fo r bivalve phylogeny. Journal of Molecular Evolution, 43, 58-70. THIELE, J . 1935 . In: BIELER , R . & MIKKELSEN , P . (eds) Handbuch der Systematischen Weichtierkunde.

190

J. M . HEAL Y ETAL.

[English translatio n b y BHATTI , J . S. ] Amerin d Publishing, New Delhi. THIELLEY, M. , WEPPE , M . & HERBAUT , C . 1993 . Ultrastructural stud y o f gametogenesi s i n th e French Polynesia n blac k pear l oyste r Pinctada margaritifera (Mollusca , Bivalvia) , I - spermato genesis. Journal of Shellfish Research, 12, 41-47. THOMAS, R . D . K . 1978 . Limit s t o opportunis m i n th e evolution o f th e Arcoid a (Bivalvia) . Philosophical Transactions of the Royal Society of London, Series B, 284, 345-365 . TILNEY, L . G. , FUKUI , Y . & DEROSIER , D . J . 1987 . Movement o f th e acti n filamen t bundle i n Mytilus sperm: a ne w mechanis m i s proposed . Journal o f Cell Biology, 104, 981-993. TOLEDO, P . H. , BELLOLIO , G . & DUPRE , E . 1990 . Fecundacion y desarroll o embrionari o d e Choromytilus chorus (Molina , 1782 ) (Bivalvia , Mytilidae). Revista Biologia Marina, Valparaiso, 25, 47-57. VAUGHT, K. C. 1989 . A Classification o f Living Mollusca. American Malacologists, Florida . WADA, S. , OKUNO , M. , NAKAMURA , K.-I . & MOHRI , H . 1992. Dynei n of sperm flagell a o f oyster belongin g to Protostomi a als o ha s a two-heade d structure . Biology of th e Cell, 76, 311-317. WALLER, T . R . 1978 . Morphology , morphocline s an d a

new classificatio n o f the Pteriomorphi a (Mollusca : Bivalvia). Philosophical Transactions of the Royal Society o f London, Series B, 284, 345-365 . 1998. Origin o f the molluscan clas s Bivalvia an d a phylogeny o f majo r groups . In : JOHNSON , P . A. & HAGGART, J. (eds) Bivalves: An Eon of Evolution Paleobiological Studies Honoring Norman D. Newell. University of Calgary Press , Calgary, 1^-5 . WATSON, H . 1930 . O n th e anatom y an d affinities o f Plicatula. Proceedings of the Malacological Society of London, 19, 25-31. WILSON, B. R. 1998 . Pteriomorphia. In : BEESLEY, P., Ross, G. & WELLS , A . (eds ) Mollusca: th e Southern Synthesis, Fauna of Australia, Volume 5, Part A. CSIRO Publishing , Melbourne , xvi , 1-563 , 858-862. YONGE, C . M . 1973 . Functiona l morpholog y wit h particular referenc e t o hing e an d ligamen t i n Spondylus an d Plicatula an d a discussio n o n relations withi n th e superfamil y Pectinace a (Mollusca: Bivalvia). Philosophical Transactions of the Royal Society o f London, Series B , 267 , 173-208. 1975. Th e statu s o f th e Plicatulida e an d th e Dimyidae i n relation to the superfamily Pectinace a (Mollusca: Bivalvia) . Journal o f Zoology, London, 176, 545-553 .

Relevance of sperm ultrastructure to the classification of giant clams (Mollusca, Cardioidea, Cardiidae, Tridacninae) JENNIFER L. KEYS & JOHN M. HEALY Department of Zoology and Entomology, The University of Queensland, Brisbane 4072 Qld, Australia (e-mail: jkeys@ zen.uq.edu.au) Abstract: Examination of sperm ultrastructure in si x out of eight of the living specie s of giant clams (Tridacnidae' ) support s reductio n i n statu s o f th e Tridacnida e t o a subfamil y o f th e Cardiidae (Tridacninae), as suggested by recent cladistic analyses based on shell, anatomical and molecular characters . Tridacnina e spermatozo a ar e al l o f th e aquasper m type , featuring , i n anterior-posterior sequence : a conica l acrosoma l vesicle , a n oblon g t o rod-shape d nucleus , a short midpiece region (proxima l an d distal centrioles surrounded by fou r roun d mitochondria); and a flagellu m ( 9 + 2 patter n axoneme) . Substantia l difference s occu r betwee n specie s wit h respect t o th e shap e an d lengt h o f th e nucleus , an d i n th e spatia l relationshi p betwee n th e acrosomal complex and the nuclear apex. Although the two extant genera can be distinguished on sper m feature s - Tridacna, nuclea r pe g associate d wit h acrosome , centriola r connectiv e absent; Hippopus, nuclea r peg absent, connective present - n o defining featur e o f the Tridacninae can be detected. Within Tridacna, the specie s T. (Chametrachea) maxima an d T . (C.) crocea ar e distinguished fro m othe r specie s o f the genu s by a much fine r nuclea r peg an d a considerably smaller acrosome . In contrast , an d agains t expectation, T . (C.) squamosa show s acrosomal and nuclear dimension s ver y clos e t o thos e obtaine d fo r T (Tridacna) gigas. Recentl y propose d phylogenies an d classificator y change s fo r 'tridacnids ' ar e discusse d i n th e ligh t o f availabl e sperm data.

The gian t clam s ('tridacnids' ) for m a smal l bu t significant grou p of heterodont bivalves , note d fo r their importanc e t o cora l ree f ecosystem s i n th e Indo-Pacific an d th e fac t tha t the y includ e th e largest livin g externall y shelle d mollusc s (Yong e 1932, 1936 ; Rosewater 1965 , 1982) . They range in size fro m c . 1 5 cm lon g i n Tridacna crocea Lamarck, 1819 , > 1 m in T. gigas (Linnaeus, 1758) . Traditionally, gian t clams have been regarded as a distinct family Tridacnidae Lamarck, 181 9 within the Orde r Veneroida . Ther e ha s bee n muc h discussion a s t o whethe r th e famil y shoul d b e placed int o it s ow n superfamily , Tridacnoide a (Keen 1969 ; Kafano v & Popov 1977 ; Bos s 1982 ; Purchon 19870 , b\ Brale y & Heal y 1998 ) o r included i n th e Cardioide a (Yong e 1975 , 1980 ; Schneider 1992 , 1995 , 1998b ; Maruyam a e t al 1998). Recently , Schneide r & O'Foighi l (1999 ) have concluded , afte r cladisti c analyse s o f shell , anatomical an d molecula r characters , tha t gian t clams for m a monophyleti c subfamil y withi n th e Cardiidae an d are therefore undeserving of either a separate family or superfamily. There are only eight extant species of giant clams (with possibl y a ninth , T . rosewateri Sirenk o & Scarlato 1991 ) mos t o f whic h ar e confine d t o th e Indo-West Pacifi c an d occu r sympatrically . Th e

widely accepted classification of the group follows that o f Rosewate r (1965) , wh o recognize d si x genera only two of which, Hippopus an d Tridacna, survive today. Since the appearance of Rosewater's system, a n additiona l thre e specie s hav e bee n described: T . rosewateri Sirenko & Scarlati, 1991 , T. tevoroa Luca s e t al., 199 0 an d Hippopus porcellanus Rosewater, 1982 . Th e genus Hippopus Lamarck, 1799 , consists of H. hippopus (Linnaeus , 1758) an d H . porcellanus Rosewater , 1982 . Th e genus Tridacna Bruguiere , 179 7 consist s o f thre e subgenera, Tridacna sensu stricto, Persikima an d Chametrachea. Tridacna sensu stricto contains T . gigas Linnaeu s 1758 , Persikima Iredale , 193 7 contains T . derasa (Roding, 1798) , an d T . tevoroa Lucas e t al . 199 1 an d Chametrachea comprises T. maxima (Roding , 1798) , T . squamosa Lamarck , 1819 an d T . crocea Lamarck , 1819 . Tridacna rosewateri fro m th e wester n India n Ocea n (fro m the Saya de Malha Bank) was described by Sirenk o & Scarlati (1991) on the basis o f shells onl y and is regarded b y Benzie & Williams (1998 ) a s a likel y junior synonym of T. squamosa. Although the general reproductive biology o f the giant clam s i s wel l know n (e.g . se e Brale y 1988 , 1992, 1994 ; Nas h et al 1988 ; Shell y & Southgate 1988; Norto n & Jone s 1992) , ver y fe w

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177, 191-205 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

192

J. L . KEY S & J. M . HEAL Y

ultrastructural studie s o f gamet e morpholog y o r development hav e bee n published , wit h th e exception o f a brie f transmissio n electro n micro scopical (TEM ) accoun t of mature and developin g oocytes o f T . crocea (Kawagut i et al 1982 ) an d approximate dimensions of the sper m acrosome of T. maxima (Healy 1995a). Comparative accounts of sperm an d spermatogeni c morpholog y hav e previously provide d valuabl e insight s int o th e taxonomy an d phylogen y o f bivalve s (e.g . se e Gharagozlou-Van Ginneki n & Pochon-Masso n 1971; Popham 1974 , 1979 ; Franzen 1983; Hodgson & Bernard 1986a , b\ Healy 1989 , 19950 , b, 1996Z?; Hodgson e t al . 1990) . Recently , Key s & Heal y (1999) hav e presente d a detaile d stud y o f sper m ultrastructure o f T . maxima (supplemente d b y comparative sperm data for the Cardiidae, both new and fro m th e literature) , th e result s o f whic h suggest tha t Schneide r (1992 , 19986 ) an d Schneider & O'Foighi l (1999 ) wer e probabl y correct in regarding the Tridacnidae as a subfamily of th e Cardiidae. Key s & Healy (1999 ) suggeste d that mor e informatio n wa s neede d bot h fo r th e Tridacnidae an d Cardiida e i n orde r t o understand supraspecific relationship s withi n th e Cardioide a better. In the present paper, sperm ultrastructure for six o f th e eigh t livin g specie s o f gian t clam s i s described an d the n thi s informatio n i s use d t o assess views, both current and past, concerning the classification an d phylogeny of the group.

Materials an d methods Sexually mature specimens of Tridacna (Tridacna) gigas, T . (Chametrachea) crocea an d Hippopus hippopus wer e collecte d fro m th e Orpheu s Islan d fringe ree f (18°37'S ; 146°30'E) , an d T . (C.) squamosa fro m th e Peloru s Islan d fringin g ree f (18°33'S; 146°30'E) , Centra l Sectio n o f the Grea t Barrier Ree f i n Novembe r 1998 . T . (C.) maxima was collected from th e Lady Musgrave Island Reef (23°54'S; 152°23'E) , Capricor n Bunke r Group , Mackay/Capricorn Sectio n o f th e Grea t Barrie r Reef i n Januar y 1998 . Th e individual s wer e collected by SCUBA diving at depths ranging fro m 2.5 t o 9 m. Gonada l (ovotestis ) materia l wa s removed an d fixe d fo r 6 h i n col d (2-6°C ) 1.5 % glutaraldehyde prepare d i n 0. 1 M sodiu m phosphate buffe r containin g 10 % w/ v sucrose . Museum materia l wa s use d fo r Hippopus porcellanus. Th e materia l wa s take n fro m a specimen hel d i n th e 'wet ' collectio n o f th e Australian Museu m (Sydney) . Th e specime n (C 159293) wa s collecte d fro m th e ree f nort h o f Fondeado Island , Hond o Bay , Palawan , Philippines, (9°57'N ; 118°55'E) in May 1989. Thi s specimen had been fixed an d stored in 3% buffere d formalin (prepare d i n seawater) . Gonada l material

was remove d an d furthe r fixe d i n 1. 5 % glutaraldehyde fo r 2 4 h. Museu m materia l o f Tridacna (Persikima) derasa an d T . (P.) tevoroa wa s als o dissected bu t prove d t o contai n n o spermiogeni c tissues. After initia l fixation , al l sample s wer e rinse d thoroughly i n 0. 1 M sodiu m phosphat e buffe r containing 10 % w/v sucrose , the n transferred to a 1 % osmium tetroxide solution (prepared in sucroseadjusted sodiu m phosphate buffer ) fo r 8 0 min (al l stages a t 0-6°C) . Osmicatio n wa s followe d b y further buffe r rinse s befor e bein g dehydrate d through a grade d ethano l serie s (20-100% ) an d infiltrated an d embedde d i n Spurr' s low-viscosit y resin. Semi-thi n surve y section s an d ultrathi n sections were cut using a diamond knife mounted in an LK B Bromma , Nov a Ultratome . Ultrathi n sections (silver-gol d interferenc e colour ) wer e collected o n uncoate d 20 0 mes h coppe r grids , stained accordin g t o th e contrast-enhancing , lea d citrate an d urany l acetat e metho d o f Daddo w (1986) an d examine d usin g a Hitach i 30 0 transmission electro n microscop e operate d a t 75 kV. Shells o f the specimen s use d i n this stud y have been retaine d a s vouche r materia l an d ar e lodge d with th e Queenslan d Museu m [QMM O 6540 6 Hippopus hippopus (Linnaeus , 1758) , QMM O 65407 Tridacna. (T.) gigas Linnaeus , 1758 , QMMO 6240 8 T . (C.) maxima (Roding , 1798) , 65408 T . (C.) squamosa Lamarck , 181 9 an d QMMO 65409 T. (C.) crocea Lamarck, 1819].

Results General description Mature sper m fro m al l specie s follo w th e sam e general construction , namely , a blunt-conica l acrosome positioned a t the ape x o f a n elongate o r oblong nucleus (acrosome + nucleus = collectivel y the 'head') , a pai r o f orthogonall y arrange d centrioles surrounde d b y a rin g o f fou r (rarel y three) rounde d mitochondria an d a flagellu m (Fig . 1). The acrosomal vesicl e i s membrane bound and deeply invaginated . Th e invaginatio n i s narro w posteriorly an d expand s int o a wid e cavit y anteriorly. Acrosoma l content s ar e differentiate d into a n extensiv e and highl y electron-dens e basa l ring, surrounde d b y a thi n laye r o f les s electron dense materia l whic h als o fill s th e anterio r regio n of th e vesicl e (Fig . la-g) . Th e proximal centriol e lies a t 90 ° relativ e t o th e dista l centriol e (an d spermatozoon's longitudina l axis) and is connected to a shallow, basal invagination of the nucleus by a thin layer of dense material. The distal centriole is continuous wit h the flagellu m and is attached , via an array of nine, terminally forked , satellite fibres,

Fie 1 Transmissio n electron micrograph s (longitudinal sections) o f mature spermatozoa of: (a)Tndacna (Chametrachea) maxima' (b ) an d (c) Tridacna (C.) crocea; (d) Tridacna (C.) squamosa; (e) Tndacna (Tndacna) gigas- (f ) Hippopus hippous- (g ) Hippopus porcellanus. a, Annulus; av, acrosomal vesicle; br , basal ring component of acrosomal vesicle contents; cc, centriole connective ; dc, distal centriole; f , flagellum; m, mitochondria; n, nucleus ; np, nuclear peg; pc, proximal centriole ; sf, satellite fibres. Al l to same scal e as indicated.

194

J. L . KEY S & J. M . HEAL Y

to a dens e annulu s linin g th e plasm a membran e (Fig. la , c, e and f). At the base of the nucleus occur four (o r thre e i n som e cases ) ovat e t o spherica l mitochondria with well-defined cristae (Fig. la-g). The flagellu m consist s o f a classi c 9 + 2 micro tubular substructur e axonem e sheathe d b y th e plasma membrane. Although details of the flagellar termination were not examined in detail, it appear s that ther e i s substantia l variatio n i n th e patter n o f microtubular changes. The doublets may eventually be transforme d int o singlet s an d th e centra l microtubules ma y o r ma y no t persis t posteriorly . The number of doublets or singlets decreases a s the terminal tip of the spermatozoon is approached . In al l Tridacna specie s th e sper m nucleu s exhibits a n apica l projection, terme d th e nuclea r peg (Fig . la, b , d an d e) . Th e degre e o f develop ment o f th e pe g varie s considerabl y betwee n species withi n th e genus . In contrast , th e sperma tozoa o f bot h specie s o f Hippopus lac k a nuclea r peg (Fig . If an d g ) bu t exhibi t a dens e structur e (possible rootlet ) linkin g the proximal centriole to the dista l centriol e an d t o th e bas e o f th e nucleus (Figs If and 2i-l). The ultrastructural features of the mature spermatozo a o f th e si x specie s o f gian t clams are summarized diagrammatically i n Fig. 3. The relativ e size s o f th e acrosome s an d nuclea r apex region s o f th e si x specie s o f gian t cla m ar e shown diagrammaticall y i n Fig . 4 . Al l th e dimensions give n i n th e result s ar e fro m on e specimen pe r specie s (al l n value s refe r t o th e number o f sper m measured) . Al l dimension s ar e from TE M micrograph s excep t fo r tota l lengths , which were obtained fro m ligh t microscopy. Tridacna (Chametrachea) maxima A detaile d descriptio n o f th e spermatozo a o f thi s species ha s bee n presente d b y Key s & Heal y (1999). However , fo r th e purpose s o f thi s comparative account , th e basi c spermatozoa n features o f Tridacna maxima are here summarized. Mature spermatozo a ar e c . 5 0 um ( n = 7 , x = 49.6 m ± SD = 1.6) in length (= head + flagellum). The acrosomal vesicle is c. 0.4 um long (n = 9, x = 0.37 u m ± SD = 0.02), membran e boun d an d deeply invaginated. The nucleu s i s solid , elongat e (length = 7.7 um; n = 4, x = 7.66 um ± SD = 0.23) and ro d shaped . Th e to p o f th e nucleu s project s deeply insid e th e invaginatio n o f th e acrosom e producing a nuclea r peg , with th e ti p swellin g noticeably (Fig. la). The peg is c. 0.3 um long (n = l,x = 0.28 um ± SD = 0.02) and narrow throughout most of its length (c. 0.1 urn; n = 6, x = 0.05 |um ± SD = 0.01) bu t markedl y expande d anteriorl y (diameter = 0. 1 urn ; n = 8, x = 0.11 u m ± S D = 0.01). Posterio r t o th e peg , the diamete r o f th e nucleus ranges from c. 0.4 um (n = 10, x = 0.36 um

± S D = 0.03) immediately belo w th e acrosom e t o 0.7 urn (n = 6, x = 0.69 jtim ± SD = 0.03) approaching th e mitochondria l regio n (Fig . la). Irregula r electron-lucent lacuna e are present throughou t the nucleus, includin g th e pe g region . Th e nucleu s exhibits a short, shallow basal invagination housing a thi n laye r o f dens e materia l linin g th e anterio r surface o f th e proxima l centriole . Indentation s o f the nucleus also occur in regions of contact with the mitochondria (Fig. la). At the base o f the nucleus occur fou r (o r thre e i n som e cases ) ovat e t o spherical mitochondri a wit h well-define d crista e (Figs la , 2 a and b). The flagellum is c. 40 um long (n = 7, x = 39.8 jum ± S D = 1.3 ) and 0. 2 ju m i n width (n = 7, x = 0.20 um ± SD = 0.01). Tridacna (Chametrachea) crocea Mature spermatozo a o f Tridacna crocea ar e th e same shap e a s thos e o f T . maxima, onl y differin g slightly in size. They measure c. 56 urn (n = 8, x = 56.2 u m ± S D = 2.3 ) in length . Th e acrosoma l vesicle is c. 0.4 |um long (n = 6, x = 0.39 um ± SD = 0.04) and 0.5 jum wide (n = 8, x = 0.45 jam ± SD = 0.02). The nucleus is solid, elongate (lengt h = 7.2 um; n = 4, x = 7.20 um ± S D = 0.08 ) and ro d shaped. The top of the nucleus narrows into a raised peg whic h project s insid e th e invaginatio n o f th e acrosome producin g a nuclea r pe g (Fig . Ib). Th e nuclear peg is c. 0.3 um long (n = 4, x = 0.29 um ± SD = 0.02 ) and narro w throughou t mos t o f it s length (c. O.lum; n = 4, x = 0.08 jim ± SD = 0.02) but expanded anteriorly (diamete r = 0.1 jam; n = 4, x = 0.12 um ± SD = 0.02). Posterior to the peg, the diameter of the nucleus ranges from c . 0.4 um ( n = 5,x = 0.37 um ± SD = 0.05) immediately below the acrosome (Fig. Ib) to 0.7 |um (n = 5, x = 0.71 |u m ± SD = 0.07) approaching th e mitochondria l regio n (Fig. Ic) . The flagellum is c. 45 urn long (n = 8, x = 44.5 um ± SD = 2.2) and 0.2 um in width (n = 8, x = 0.23 u m ± SD = 0.01). Tridacna (Chametrachea) squamosa Mature spermatozo a o f Tridacna squamosa measure c. 54 jum (n = 10, x = 54.0 um ± SD = 1.6) in length. The acrosomal vesicl e i s c. 0.5 um lon g (n = 7,x = 0.45 um ± SD = 0.03), and 0.6 um wide (n = S,x = 0.63 um ± SD = 0.02). The nucleus is short, solid and rod shaped (length = 3.7 urn; n = 5, x = 3.72 um ± SD = 0.11). The top o f the nucleus narrows into a raised peg which projects insid e the invagination o f the acrosom e producin g a nuclea r peg (Fig. Id). Posterior t o the peg, the diameter of the nucleus ranges from c . 0.7 jum (n = 6, x = 0.68 um ± SD = 0.05) immediately below the acrosome to 1. 0 u m ( n = 6 , x = 1.0 0 um ± S D = 0.06)

GIANT CLA M SPERMATOZO A

195

Fig. 2 . Transmission electro n micrograph s (transverse sections) of the mitochondrial region showing proximal and distal centrioles and the presence or absence of a centriolar connectiv e (possible rootlet) for: (a) and (b) Tridacna (C.) maxima; (c) and (d) Tridacna (C.) crocea; (e) and (f ) Tridacna (C.) squamosa; (g) and (h) Tridacna (T.) gigas; (i) and (j) Hippopus hippopus', (k ) an d (1) Hippopus porcellanus. cc, Centriolar connective ; dc, distal centriole; m, mitochondria; pc, proximal centriole. All to same scale as indicated.

approaching th e mitochondria l regio n (Fig . Id) . Tridacna (Tridacna) gigas The flagellum is c, 47 jam long (n = 10, x = 47.3 |a ± S D = 1.6 ) an d 0. 3 ja m i n widt h (n = 8, x = 0.25 Matur e spermatozo a o f Tridacna gigas measure c . urn ± SD = 0.01). 5 6 ur n (n = 10, jc = 55.9 ur n ± SD = 2.2) i n length.

196

J. L . KEY S & J. M . HEAL Y

Fig. 3 . Diagram summarizing comparative spermatozoa withi n the Tridacninae. Visual summary of longitudinal sections of the mature spermatozoa. All drawn to same scale as indicated. Oute r mitochondrial membran e an d nuclear membranes not shown.

The acrosoma l vesicl e i s c . 0. 6 ja m long ( n = 12 , x = 0.59 (am ± SD = 0.02) and 0.8 um wide (n = 12, x = 0.82 jam ± SD = 0.13) (Fig.le). The nucleus is short, solid and rod shaped (length = 3.0 um; n = 7, x = 3.02 um ± SD = 0.10). The top of the nucleus narrows into a raised peg which projects inside the

invagination o f th e acrosom e producing a nuclear peg (Fig. le) . Posterior to the peg, the diameter of the nucleus ranges from c . 0.9 urn (n = 11, x = 0.87 um ± S D = 0.05 ) immediatel y below th e acro some to 1. 2 um ( n = 7, x = 1.16 um ± SD = 0.05) approaching th e mitochondria l regio n (Fig . le) .

GIANT CLA M SPERMATOZO A

197

Hippopus porcellanus Mature spermatozoa of Hippopus porcellanus are c. 60.0 u m ( n = 1 ) long. Th e acrosoma l vesicl e i s c. 0.4 um long (n = l,x = 0.44 ur n ± SD = 0.02) and 0.6 um wide (n = 8, x = 0.60 um ± SD = 0.02). The invagination i s narro w posteriorly, expand s int o a wide cavity anteriorly an d is occupied b y subacro somal materia l (Fig . Ig) . Th e nucleu s i s soli d (length = 3.7 um; n = 6, x = 3.73 um ± SD = 0.21) and oblon g shape d wit h no evidenc e o f a nuclea r peg. The diameter of the nucleus ranges from c . 0.6 um (n = 8, x = 0.55 u m ± SD = 0.04) immediatel y below the acrosome to 0.9 urn (n = 6, x = 0.88 u m ± SD = 0.15) approachin g the mitochondrial regio n (Fig. Ig) . Ther e i s a well-develope d centriola r connective (possible rootlet) lying lateral to, and in contact with, the centrioles (Fig . 2) . The flagellum is c. 52.7um long (n = 1) and 0.2 u m in width (n = 11, jc = 0.21 u m ± SD = 0.01).

Discussion Fig. 4 . Diagram comparing acrosoma l and nuclear ape x morphology within th e Tridacninae. Note size differenc e between species and the presence of a nuclear peg in the Tridacna specie s and the absence of a nuclear peg in Hippopus species . All drawings t o sam e scal e as indicated. Nuclear membranes not shown.

The flagellum is c. 50 jam long (n = 10, x = 50.3 u m ± S D = 2.2) an d 0.2 u m i n width (n = 8, x = 0.2 3 um ± SD = 0.01). Hippopus hippopus Mature spermatozo a o f Hippopus hippopus measure c. 54 urn (n = 10, Jc = 53.9 urn ± SD = 2.6) in length. The acrosomal vesicle i s c. 0.5 urn long (n = 10, x = 0.49 urn ± SD = 0.02) and 0.6 urn wide (n = 60, x = 0.63 ur n ± S D = 0.03) (Fig.If) . Th e invagination i s narrow posteriorly , expand s int o a wide cavit y anteriorl y an d i s occupie d b y sub acrosomal material . Th e nucleu s i s soli d (lengt h = 3. 6 urn ; n = 7, x = 3.57 ur n ± S D = 0.09 ) an d oblong-shaped wit h no evidence o f a nuclear peg. The diameter o f the nucleus ranges from c . 0.6 u m (n = 5 , j c = 0.62u m ± S D = 0.03 ) immediatel y below the acrosome t o 1. 1 um ( n = 5, x = 1.05 u m ± SD = 0.11) approachin g the mitochondrial regio n (Fig. If) . Ther e i s a well-develope d centriola r connective (possibl e rootlet ) lyin g latera l to , an d in contac t with , th e centriole s (Fig . If) . Th e flagellum i s c. 47 um long (n = 10 , x = 46.9 u m ± SD = 2.6) and 0.3 um in width (n = 8, x = 0.26 u m ± SD = 0.01).

Structural comparisons Giant cla m spermatozo a ar e al l o f th e aquasper m type (sensu Jamieso n 1987 ; Rous e & Jamieso n 1987) an d sho w severa l similaritie s t o othe r bivalves [fo r a recen t comparativ e revie w o f bivalve sper m se e Heal y (1996a)] . I n particular , tridacnid sper m resembl e thos e o f othe r heterodonts, especiall y th e Cardiida e (Key s & Healy 1999 ; Fig . 5) . This resul t i s consistent wit h the traditional view of a close relationship between the Tridacnidae an d Cardiidae, bu t also with recent moves t o downgrad e tridacnids t o th e statu s o f a cardiid subfamily (Schneider 1992 , 1995 , 1998a , b\ Schneider & O'Foighil 1999) . Althoug h the results of th e present stud y suppor t Schneider' s decision , in genera l i n th e followin g discussio n th e vernacular name s 'tridacnids ' an d 'cardiids ' hav e been used in their traditiona l sense , partl y for eas e of referenc e an d als o t o avoi d ambiguit y [th e generic compositio n o f variou s nomina l subfamilies o f th e Cardiida e varie s significantl y between authors , a s pointe d ou t b y Schneide r (1992)]. The pronounce d basa l rin g o f th e acrosoma l vesicle i n al l examined tridacnid s (Key s & Healy 1999; presen t study ) (Fig . 4 ) occur s i n othe r cardiids (Popha m 1979 ; Sous a & Azeved o 1988 ; Sousa et al 1995 ) (Fig. 5) and all other investigated heterodonts, an d i s particularl y well-develope d i n the Veneroid a (e.g . Long o & Anderso n 1969 ; Gharagozlou-Van Ginneki n & Pochon-Masso n 1971; Hylande r & Summers 1977 ; Popha m 1979 ; Hodgson e t al . 1987 , 1990 ; Heal y 1995a , b, 1996a). Such a ring has also been demonstrate d i n

198

J. L . KEY S & J. M . HEAL Y

Fig. 5 . Diagram comparing T. maxima acrosome and nuclear apex morphology with that of various species of Cardiidae. Not e close similarity betwee n T , maxima and C. edule (bot h species hav e a distinct nuclear peg projecting deeply into the acrosomal vesicle invagination). Nuclear membranes no t shown. [(Copied from Key s & Healy 1999 : source s o f original dat a (micrographs) are: Tridacna maxima (Keys & Healy 1999), C. edule (Sousa & Azevedo 1988; Sousa et al. 1995), F . tenuicostata (Popham 1979) , an d L. hemicardium, F. unedo and A. reeveanum (Keys & Healy 1999)]

spermatozoa o f certai n pteriomorphian s suc h a s Mytilus spp . (Niijim a & Da n 1965 ; Hodgso n & Bernard 19860, b) but, as demonstrated by Kafanov & Drozdo v (1998) , thi s featur e i s no t eve n a consistent featur e o f th e Mytiliida e (Mytiloidea) . Although as yet uninvestigated, it is likely tha t the acrosomal comple x o f th e Tridacnida e interact s with the egg in the manner describe d b y Hylande r & Summers (1977 ) for Chama macerophylla (Gmelin 1791 ) (Chamoidea ) an d Spisula solidissima (Dillwyn , 1817 ) (Mactroidea) . Within th e Tridacnida e (Key s & Heal y 1999 ; present study ) an d amon g othe r investigate d members of the Cardiidae (Popha m 1979 ; Azevedo 1988; Sousa etal 1995 ; Keys & Healy 1999) , ther e is substantia l variatio n i n th e spatia l relationshi p between th e acrosoma l comple x an d th e nuclea r

apex (Fig s 3 an d 4) . A pronounce d nuclea r pe g occurs i n al l examine d member s o f th e genu s Tridacna (se e Fig . 4 ) and in at least on e species of Cardiinae, Cerastoderma edule (Linnaeus , 1758 ) (Sousa & Azevedo 1988 ; Sous a e t al 1995 ) (Fig . 5). Interestingly, a broad, low nuclear peg is present in the cardiids Fulvia tenuicostata (Lamarck, 1819 ) and Lunulicardia hemicardium (Linnaeus , 1758 ) (poorly develope d i n th e latte r species ) (Popha m 1979; Keys & Healy 1999 ) (Fig . 5 ) but is absent in both specie s o f Hippopus (Tridacnidae , presen t study) (Fig . 4 ) an d i n th e cardiid s Fragum unedo (Linnaeus, 1758 ) an d Acrosterigma reeveanum (Dunker, 1852 ) (Key s & Healy 1999 ) (Fig . 5) . The degree o f similarit y betwee n th e ver y fin e nuclea r peg o f Tridacna (Chametrachea) maxima an d T . (C.) crocea o n th e on e han d an d Cerastoderma edule o n th e othe r i s difficul t t o judge becaus e o f the lac k o f detai l i n th e micrograp h presente d b y Sousa & Azevedo (1988 ) an d Sousa et al (1995) . No apical swellin g of the peg is evident in C. edule and unlik e al l tridacnid s (bu t lik e certai n othe r cardiids) the nucleus of this species shows evidenc e of helica l coiling , a t leas t anteriorl y (Karpevic h 1961). Th e reaso n a s t o wh y th e pe g shoul d b e attenuate, broad o r even absen t in different specie s of tridacnid s an d cardiid s i s unknown . A nuclea r peg has not been reported i n other bivalves, or even in othe r molluscs , althoug h som e specie s o f th e gastropod Patella show a narrowing of the nucleus which sit s withi n th e acrosoma l invaginatio n (Hodgson & Bernard 1988 ; Hodgso n e t al 1996) . A simila r structur e t o th e nuclea r pe g ha s bee n noted in the spermatozo a of hagfish (se e Jesperse n 1975; Morisaw a 1999 . Presumabl y th e peg serve s to support the acrosomal vesicle or, in the case of T. (C.) maxima an d T . (C.) crocea, t o suppor t an d anchor the acrosomal vesicl e (i n these tw o species the pe g an d acrosoma l vesicl e exhibi t a ball-in socket configuration) . Clearl y ther e i s a nee d fo r comparative ultrastructura l dat a o n fertilizatio n within the Cardioidea i n order t o shed ligh t o n the function o f the nuclear peg. Popham (1974 ) ha s foun d tha t externall y fertilizing spermatozo a i n th e shipworm s (Teredinidae) hav e a large r acrosoma l vesicl e an d longer axia l ro d ( = 'acrosomal rod' , 'perfor atorium') tha n thos e tha t fertiliz e 'internally ' (i.e . within the mantle cavity after being drawn in by the siphonal currents) . Both T . (C.) maxima and T . (C.) crocea not only have much smaller acrosomes than all othe r investigate d tridacnid s bu t als o attenuat e nuclei - a combinatio n o f features suggestiv e of mantle cavit y fertilizatio n (cf . wit h Galeommatoidea; O'Foighil 1985). Giant clams are simultaneous hermaphrodite s an d gonad s contai n both male and female follicles. I n natural spawnin g situations clams will initially spawn sperm and later

GIANT CLA M SPERMATOZO A

spawn eggs , i f th e egg s ar e matur e (Luca s 1988 ; Nash e t al. 1988) . I n aquacultur e situations , fertilization ha s bee n show n t o occu r outsid e th e mantle cavit y (R . Braley , pers . comm. ; J . Lucas , pers. comm.) and it is likely that this also occurs in the field . Accordin g t o Franze n (1983 ) bivalve s with a n elongat e sper m nucleu s ofte n hav e larg e

199

eggs (diamete r > 90 um) an d ofte n exhibi t lecithotrophic o r direc t developmen t (se e als o Drozdov & Kasyano v 1986) . Withi n th e Tridacnidae ther e doe s no t appea r t o b e an y detectable correlatio n betwee n nuclea r lengt h an d egg size , althoug h i t i s interestin g t o not e tha t differences i n the diamete r o f eggs o f investigate d

Fig. 6 . (a) Results of the present stud y and those from Fig . 5 superimposed on consensus tree of Maruyama et a l (1998) derived from a n analysis of 18 S rDNA of zooxanmellate and azooxanthellate cardiodians (compared with other bivalves and a gastropod), (b), (c) Alternative topologies fo r Tridacna (als o from Maruyam a et al. 1998) .

200

J. L . KEY S & J. M . HEAL Y

Fig. 7 . Results of the present study superimposed on consensus tree of Benzie & Williams (1998) derived through cladistic study of protein allozymes.

Tridacna specie s ( = 100 urn) and of both species of Hippopus (=11 5 jam) (Kawagut i e t al 1982 ; Norton & Jone s 1992 ) d o correlat e wit h th e presence o r absence of a nuclear peg. In general, the morphology of the midpiece in all investigated tridacnid s (includin g th e interna l substructure an d arrangemen t of the mitochondria, positioning o f centrioles , presenc e o f a satellit e fibre complex an d annulus) and the morphology of the flagellu m (wit h 9 + 2 microtubula r patter n axoneme) is simila r t o that reported i n most othe r heterodonts [for a summary see Healy (19960, /?)]. An interestin g differenc e betwee n th e gener a Tridacna an d Hippopus i s the presence, in the latter, of a centriola r connectiv e (possibl e rootlet ) lyin g lateral t o th e proxima l an d dista l centrioles , an d appearing t o connec t th e tw o (se e Fig s 1-3) . A centriolar rootlet has been observed in a number of heterodonts (Teredinidae , Veneridae ) (Popha m 1974; Popha m e t el . 1974 ; Reuno v & Hodgso n 1994) and pteriomorphians (Arcidae, Spondylidae , Ostreidae, Mytilidae) (Daniels et al. 1971; Healy & Lester 1991 ; Reunov & Hodgson 1994 ; Gw o et al. 1996), bu t i n al l o f thes e case s th e rootle t i s attached t o th e adnuclea r surfac e of th e proxima l centriole. No periodic banding was observed in the connective o f Hippopus bu t i t mus t be adde d that the presence or absence of such substructure varies considerably withi n th e Bivalvia . I n general , th e function o f th e rootlet , lik e tha t o f th e satellit e

fibres complex , i s believed t o be fo r anchorag e of the centriole s and the attache d flagellum . I t would be o f grea t interes t t o determin e wh y th e spermatozoa o f Hippopus hav e evolve d a well developed centriola r connectiv e (possibl e rootlet ) whereas those of Tridacna hav e not.

Taxonomic and phylogenetic considerations In mos t recen t literature , th e gian t clam s ar e allocated to thei r ow n family , th e Tridacnida e an d allied wit h th e Cardiidae , usuall y withi n a superfamily Cardioide a (Yong e 1936, 1975 , 1980 ; Stasek 1962 ; Schneide r 1992 , 1995 , 19986) . I n view of their highly modified lifestyle they have, on occasions, als o bee n deeme d worth y of thei r ow n superfamily (Rosewater 1965; Keen 1969; Kafanov & Popov 1977 ; Boss 1982 ; Braley & Healy 1998) . On the basis of a detailed cladisti c analysi s of shell and anatomica l characters , Schneide r (1992 , 19986) foun d tha t tridacnid s forme d a mono phyletic grou p withi n th e Cardiida e an d shoul d therefore b e considere d a subfamily of that family (thereby avoidin g a paraphyleti c Cardiidae) . Questions about the relationship of the Tridacnida e to the Cardiidae an d the possibility tha t tridacnid s may constitute merely a subfamily of the Cardiida e were independentl y raise d b y Maruyam a e t al . (1998) base d o n thei r analysi s o f 18 S rDN A o f

GIANT CLA M SPERMATOZOA

201

Fig. 8 . Results of the present study superimpose d on consensus tree of Schneider & O'Foighil (1999) based on molecular stud y (18S rDNA).

zooxanthellate an d azooxanthellat e cardioidean s (compared with other bivalves and a gastropod). Results of the present stud y and previous sperm ultrastructural accounts of the Cardioidea (Popha m 1979; Sous a & Azevedo 1988 ; Sous a e t al. 1995 ; Keys & Healy 1999 ) confirm the most widely held view tha t a very close relationship exist s betwee n tridacnids an d cardiids . Th e vie w expresse d b y some authors that tridacnids are more closely allie d to the Carditidae than the Cardiidae (Hedle y 1921 ; McLean 1974 ; Alle n 1985 ) i s no t supportabl e in th e ligh t o f sper m ultrastructura l evidence . Spermatozoa of the Carditidae exhibit a number of distinctive feature s no t encountere d i n cardioi -

deans, includin g an elongat e acrosoma l vesicle , a midpiece wit h seve n t o eigh t tightl y packe d mitochondria an d transformatio n o f th e proxima l centriole int o a modifie d rootle t [feature s share d with the Crassatellidae; for comparative figures and further discussio n see Healy (I995b, 19960)] . Hippopus an d Tridacna ar e considered b y Stasek (1962) to have each evolved from a Byssocardiumlike ancesto r i n th e earl y Miocene . O f th e tw o extant genera, Hippopus i s usually accepted a s the more primitiv e (Rosewate r 1965 ; Yong e 1980) , partly fo r anatomica l reason s bu t als o becaus e it s fossil recor d extend s further bac k in time than any species o f Tridacna (Stase k 1962 ; Schneide r &

202

J. L . KEY S & J. M . HEALY

O'Foighil 1999) . Molecula r studie s hav e unequivocally supporte d no t onl y th e divisio n o f gian t clams into two genera (Hippopus an d Tridacnd) bu t also provide d clues , albei t sometime s conflicting , about relationship s withi n th e grou p (Benzi e & Williams 1998 ; Maruyama etal 1998 ; Schneider & O'Foighil 1999 ) (se e Figs 6-8) . The lack of a nuclear peg in Hippopus (presen t in Tridacnd} combine d wit h th e presenc e o f a centriolar rootle t (lackin g i n Tridacnd) sugges t either tha t thes e tw o gener a aros e fro m differin g ancestral source s o r tha t th e sper m difference s encountered ar e th e resul t o f a combinatio n o f secondary los s and/o r reappearanc e o f structures . The presenc e o f a well-develope d narro w nuclear peg i n th e cardii d Cerastoderma edule (Sous a & Azevedo 1988 ; Sous a e t al. 1995) , an d o f a mor e poorly develope d pe g or peg vestige i n some othe r examined cardiid s (Fulvia tenuicostata an d Lunulicardia hemicardium) (Popham 1979 ; Keys & Healy 1999), indicate that the nuclear peg cannot be regarded a s a n autapomorph y o f Tridacna (although th e expanded-ti p nuclea r pe g o f Chametrachea may prove to be a autapomorphy of that subgenus) . Indeed , th e absenc e o f a pe g i n Hippopus an d i n th e cardiid s Fragum unedo an d Acrosterigma reeveanum (Key s & Heal y 1999 ) makes it difficult t o determine if 'presence of a peg' or 'absenc e of a peg' represent s th e plesiomorphic state for this character in the Tridacninae. If Yonge (1936) is correct in concluding that tridacnids aros e from a Cerastoderma-like ancesto r [ a vie w endorsed b y Schneide r (1998&)] , the n th e absenc e of a nuclea r pe g i n Hippopus mus t b e du e t o secondary los s (?geneti c suppressio n o r genuin e loss). Clearly , sper m dat a fo r th e man y unstudie d cardiid gener a ar e require d t o establis h basi c defining feature s fo r eac h o f th e nomina l subfamilies. Suc h information should then allo w a more meaningfu l assessmen t o f cardioidea n classification a t the subfamily level. Most o f th e recentl y propose d phylogenie s fo r the genu s Tridacna agre e wit h th e traditiona l placement o f specie s amon g thre e subgenera : Tridacna sensu stricto, Persikima an d Chametrachea (Benzi e & William s 1998 ; Maruyama et al 1998 ; Schneider 1998Z? ) (see Fig s 6 an d 7) . However , Schneide r & O'Foighi l hav e concluded, on the basis of 16 S rDNA analyses, that T. (Persikima) tevoroa wa s th e siste r taxo n t o T . (Tridacna) gigas + T. (Persikima) derasa, thereb y rendering Persikima paraphyleti c (Fig . 8) . The y therefore abandone d th e subgenu s Persikima altogether an d incorporate d T . tevoroa an d T . derasa withi n Tridacna sensu stricto. Previousl y Lucas et al. (1991) had made the suggestion, base d on shell and anatomical details, that T. tevoroa may be transitiona l betwee n Hippopus an d T . derasa,

which t o som e exten t prompte d Schneide r & O'Foighil's re-evaluatio n o f Persikima. Unfortunately, n o sper m dat a ar e a s ye t availabl e for either T . (P.) tevoroa or T . (P.) derasa to test th e ideas expresse d b y Schneide r & O'Foighil (1999 ) and Lucas et al. (1991) . Within th e subgenu s Chametrachea, T . (Chametrachea) maxima an d T . (C.) crocea ar e distinguished fro m T . (C.) squamosa b y thei r strongly attenuat e nucleu s (featurin g a narrow , terminally expande d nuclea r peg ) an d relativel y small acrosom e (Fig . 3) . I n contrast , an d agains t expectation, T . (C.) squamosa shows acrosomal an d nuclear dimensions very close to those obtained for T. (Tridacna) gigas (Fig . 3) . Give n th e genera l agreement betwee n author s regardin g th e trul y monophyletic statu s o f Chametrachea (Schneide r 1992, 19986 ; Benzie & Williams 1998 ; Maruyam a et al. 1998 ; Schneide r & O'Foighil 1999 ) (se e Figs 6-8), th e sper m difference s betwee n T . (C.) squamosa on the on e hand and T . (C.) maxima + T. (C.) crocea o n th e othe r ar e ver y interesting , fo r they clearl y suppor t th e result s o f Benzi e & Williams (1998 ) (Fig . 7 ) an d a t leas t on e o f th e alternative tree s presente d b y Maruyam a e t al . (1998) (Fig . 6) . Acceptanc e o f Schneide r & O'Foighil's (1999 ) tre e (Fig . 8 ) an d on e o f th e alternative tree s o f Maruyam a e t al . (1998) , i n which T.(C.) maxima become s th e siste r taxo n t o T.(C.) squamosa + T.(C.) crocea, woul d entai l significant nuclea r and acrosomal change s i n T.(C.) squamosa. We expres s ou r thank s t o th e director s an d staf f o f th e Heron Island an d Orpheus Island Researc h Stations , and to M r B . O'Kane , M s N . Wilso n an d M r D . Soute r (Department o f Zoology an d Entomology , Universit y o f Queensland) for thei r assistance during the cours e o f the fieldwork. I n addition , w e than k M r I . Loch (Australia n Museum, Sydney ) fo r allowin g u s th e chanc e t o obtai n formalin-fixed tissue s from Hippopu s porcellanus held in the museu m collection . Mr s L . Daddo w an d M r T . Gorringe (Departmen t o f Zoolog y an d Entomology , University of Queensland) provided some assistance with aspects of electron microscopy and photography. We also thank Drs J. Schneider & D. O'Foighil for allowing us to see th e manuscrip t o f thei r pape r o n th e molecula r phylogeny o f th e Tridacniinae . Th e referee s ar e als o thanked fo r thei r constructiv e comment s o n th e origina l text. This stud y wa s supporte d financiall y b y a research grant and Senior Research Fellowship from the Australian Research Counci l (JH ) an d Universit y o f Queenslan d research grants (JH and JK).

References ALLEN, J . A . 1985 . The recen t Bivalvia : thei r for m an d evolution. In : TRUEMAN , E . R . & CLARKE , M . R . (eds) Th e Mollusca Volume 10 : Evolution. Academic Press, New York, 337-403. BENZIE, J . A . H . & WILLIAMS , S . T . 1998 . Phylogenetic

GIANT CLA M SPERMATOZO A relationships amon g gian t cla m specie s (Mollusca : Tridacnidae) determined by protein electrophoresis. Marine Biology, 132 , 123-133 . Boss, K . J . 1982 . Mollusca . In : PARKER , S . P . (ed.) Synopsis and Classification of Living Organisms, Volume 2 . McGraw-Hill , Ne w York, 945-1166. BRALEY, R. D . 1988 . Reproductive condition an d season of th e gian t clam s Tridacna gigas an d T . derasa utilising a gonad biopsy technique . In: COPLAND , J . W. & LUCAS, J. S. (eds) Giant Clams in Asia and the Pacific. Australia n Centr e fo r Internationa l Agricultural Research, Canberra, 98-104 . 1992. Th e Giant Clam: Hatchery an d Nursery Culture Manual, ACIAR Monograph, Volume 15. Australian Centr e fo r Internationa l Agricultura l Research, Canberra, 144. 1994. Reproductio n i n th e Gian t Cla m Tridacna gigas an d T . derasa i n situ o n th e North-Centra l Great barrie r Ree f Australia , an d Papu a Ne w Guinea. Coral Reefs, 3 , 221-227. & HEALY, J. M. 1998 . Superfamily Tridacnoidea. In: BEESLEY, P . L., Ross , G . J . B . & WELLS , B . (eds) Mollusca: The Southern Synthesis, Volume 1. CSIRO Publishing, Melbourne, 332-336 . DADDOW, L . Y . M . 1986 . A n abbreviate d metho d o f double lea d stai n technique . Journnal o f Submicroscopic Cytology, 18 , 221-224. DANIELS, E. , LONGWELL , A . C. , McNiFF , J . M . & WOLFGANG, R . W . 1971 . Ultrastructur e o f th e spermatozoa from th e American oyster Crassostrea virginica. Transactions of the American Microscopical Society, 90 , 275-282. DROZDOV, A . L . & KASYANOV , V . L . 1986 . Siz e an d form o f gamete s i n marin e bivalv e mollusks . Th e Soviet Journal o f Marine Biology, 11 , 204-21 2 [English translatio n o f Biologiya Morya, 1985 , 4, 33-40]. FRANZEN, A. 1983 . Ultrastructural studies of spermatozo a in three bivalve specie s wit h notes o n evolution of elongated sper m nucleus in primitive spermatozoa . Gamete Research, 7, 199-214 . GHARAGOZLOU-VAN GINNEKIN , I . D . & POCHON-MASSON , J. 1971 . Etud e comparativ e infrastructur e d u spermatozo'ide che z le s Palourde s d e France . Archives de Zoologie Experimental et Generale, 112, 805-817. Gwo, J.-C. , Liou , C.-H . & CHENG , C.-H . 1996 . Ultrastructure o f th e spermatozo a o f th e Pacifi c oyster Crassostrea gigas (Mollusca , Bivalvia , Ostreidae). Journal o f Submicroscopic Cytology and Pathology, 28 , 395^00. HEALY, J . M . 1989 . Spermiogenesis an d spermatozo a in the relic t bivalv e genu s Neotrigonia: relevanc e t o trigonioid relationships , particularl y Unionoidea . Marine Biology, 103 , 75-86 . 19950. Comparative spermatozoal Ultrastructure and its taxonomi c an d phylogenetic significanc e i n th e bivalve order Veneroida. In: JAMIESON, B. G. Ausio, J. & JUSTINE, J.-L. (eds) Advances in Spermatozoal Phylogeny an d Taxonomy, Volume 166. Memoires du Museu m Nationa l D'Histoir e Naturelle , Paris , 155-166. I995b. Sper m ultrastuctur e i n th e marin e bivalv e families Carditida e an d Crassatellida e an d it s

203

bearing o n unificatio n o f th e Crassatelloide a wit h the Carditoidea. Zoologica Scripta, 24 , 21-28. 19960. Molluscan sper m Ultrastructure: correlatio n with taxonomi c unit s withi n the Gastropoda , Cephalopoda an d Bivalvia . In : TAYLOR , J. D . (ed.) Origin and Evolutionary Radiation of the Mollusca Oxford University Press, Oxford, 99-113 . 1996b. Spermatozoan Ultrastructure in the trigonioid bivalve Neotrigonia margaritacea Lamarc k (Mollusca): Compariso n wit h other bivalves , especially Trigonioida and Unionoida. Helgoldnder Meeresuntersuchungen, 50 , 259-264. & LESTER, R . J. G. 1991. Sperm Ultrastructure in the Australian oyste r Saccostrea commercialis (Iredale and Roughley ) (Bivalvia , Ostreidae) . Journal o f Molluscan Studies, 57, 219-224. HEDLEY, C . 1921 . A revisio n o f th e Australia n Tridacna. Records o f th e Australian Museum, 13 , 163-172. HODGSON, A . N . & BERNARD , R . T . F . 19860 . Ultrastructure of the sper m and spermatogenesi s o f three specie s o f Mytilida e (Mollusca , Bivalvia) . Gamete Research, 15, 123-135. & 1986& . Observations o n the Ultrastructure of the spermatozoo n o f tw o mytilid s fro m th e south west coas t o f England . Journal o f th e Marine Biological Association o f th e United Kingdom, 66, 385-390. & 1988 . A comparison o f the structur e of the spermatozoa an d spermatogenesi s o f 1 6 species o f patellid limpe t (Mollusca : Gastropoda : Archaeogastropoda). Journal o f Morphology, 195 , 205-223. ,& VA N DER HORST, G . 1990 . Comparative spermatology o f three specie s o f Donax (Bivalvia) from Sout h Africa . Journal o f Molluscan Studies, 56, 257-265. , D E VILLIERS, C . J . & BERNARD , R . T . F . 1987 . Comparative spermatolog y o f two morphologicall y similar species ofSolen (Mollusca : Bivalvia). South African Journal of Zoology, 22 , 264-268. , RIDGWAY , S. , BRANCH , G . M . & HAWKINS , S . J . 1996. Spermatozoa n morpholog y o f 1 9 specie s o f prosobranch limpet s (Patellogastropoda ) wit h a discussion o f patelli d relationships . Philosophical Transactions of the Royal Society of London, Series B, 351, 339-347. HYLANDER, B . L . & SUMMERS , R . G . 1977 . A n ultrastructural analysi s o f th e gamete s an d earl y fertilization i n tw o bivalv e mollusc s Chama macerophylla an d Spisula solidissima with specia l reference t o gamet e binding . Cell an d Tissue Research, 182, 469-489. JAMIESON, B . G . M . 1987 . A biological classificatio n o f sperm types, with special referenc e to annelid s and molluscs, an d a n exampl e o f spermiocladistics . In : MOHRI, H . (ed. ) Ne w Horizons o f Sperm Cell Research, Japanese Scientific Societ y Press, Tokyo, 311-332. JESPERSEN, A . 1975 . Fine structur e of Spermiogenesi s i n eastern Pacific species of hagfish (Myxinidae). Acta Zoologica (Stockholm), 56 , 189-198 . KAFANOV, A . I . & DROZDOV , A . L . 1998 . Comparative sperm morpholog y an d phylogenetic classificatio n

204

J. L . KEY S & J. M . HEAL Y

of recen t Mytiloide a (Bivalvia) . Malacologia, 39 , 129-139. & POPOV, S. V. 1977. On the system of the Cenozoi c Cardioidea (Bivalvia) . Paleontological Journal, 1977,307-314. KARPEVICH, A . F . 1961 . Adaptiv e characte r o f spermatozoa an d eggs' morpholog y i n Bivalvia Molluscs. Zoologicheskii Zhurnal Akademiia Nauk SSSR, 40 , 340-350. KAWAGUTI, S. , MASUDA , Y . & MURAKOSHI , M . 1982 . Electron microscopi c studie s o n th e gona d o f th e boring clam , Tridacna crocea. Bulletin o f th e Kawasaki College of Applied Health Professions, 2 , 101-107. KEEN,M. 1969. Superfamily Tridacnacea Lamarck, 1819. In: MOORE , R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6. Volume 2. Bivalia. Geologica l Societ y o f America , Boulder , CO, and University of Kansas Press, Lawrence, KS, 594-595. KEYS, J. L. & HEALY, J. M. 1999 . Sperm ultrastructure in the gian t cla m Tridacna maxima (Tridacnidae : Bivalvia: Mollusc a ) fro m th e Grea t Barrie r Reef . Marine Biology, 135 , 41-46. LONGO, F. J. & ANDERSON, E. 1969. Spermiogenesis i n the surf clam Spisula solidissima with special reference to the formation of the acrosomal vesicle. Journal of Ultrastructure Research, 27, 435-443. LUCAS, J. S. 1988. Giant Clams: Description, distribution and lif e history . In: COPLAND , J. W . & LUCAS , J . S . (eds) Giant Clams in Asia an d th e Pacific, Volume 9. Australia n Centre fo r International Agricultural Research, Canberra, 21-32. , LEDUA, E. & BRALEY, R. D. 1990 . A new species of gaint clam (Tridacnidae) from Fiji and Tonga. Australian Centr e fo r Internationa l Agricultura l Research, Canberra . ,& 1991 . Tridacna teveroa Lucas, Ledua & Braley : A recentl y describe d Specie s o f Gian t Clam (Bivalvia ; Tridacnidae ) fro m Fij i an d Tonga. The Nautilus, 105, 93-103. McLEAN, R. A. 1974. A revision of the Pelecypod Famil y Tridacnidae. Notulae Naturae o f Th e Academy o f Natural Sciences of Philadelphia, 195 , 1-7 . MARUYAMA, T., ISHIKURA, M., YAMAZAKI , S. & KANAI, S . 1998. Molecula r phylogen y o f zooxanthellat e bivalves. Biological Bulletin, 195, 70-77. MORISAWA, S. 1999. Acrosome reaction in spermatozoa of the hagfis h Eptatretus burgeri (Agnatha) . Development, Growth an d Differentiation, 41 , 109-112. NASH, W . J., PEARSON, R. G . & WESTMORE, S. P. 1988. A histological stud y of reproduction i n the giant clam Tridanca gigas i n th e North-Centra l Grea t Barrie r Reef. In: COPLAND, J. W. & LUCAS, J. S. (eds) Giant Clams in Asia and the Pacific, Volume 9 . Australian Centre fo r Internationa l Agricultura l Research , Canberra, 89-94. NIIJIMA, L . & DAN , J. 1965 . Th e acrosom e reactio n in Mytilus edulis I . Fin e structur e o f th e intact acrosome . Journal o f Cell Biology, 25 , 243-248. NORTON, J. H. & JONES, G . W. 1992. The Giant Clam: an anatomical and histological atlas, ACIAR

Monograph. Australia n Centr e fo r internationa l Agricultural Research, Canberra, 142. O'FoiGHiL, D . 1985 . Sperm transfe r an d storag e i n th e brooding bivalv e Mysella tumida. Biological Bulletin, 169, 602-614. POPHAM, J . D . 1974 . Comparative morphometric s o f th e acrosomes o f th e sperm s o f 'externally ' an d 'internally' fertilizin g sperm s o f th e shipworm s (Teredinidae, Bivalvia , Mollusca) . Cell and Tissue Research, 150, 291-297. 1979. Comparativ e spermatozoo n morpholog y an d bivalve phylogeny . Malacological Review, 12 , 1-20. , DICKSON , M . R . & GODDARD , C . K . 1974 . Ultrastructural stud y of the matur e gametes o f tw o species o f Bankia (Mollusca , Teredinidae) . Australian Journal of Zoology, 22 , 1-12 . PURCHON, R . D . 1987« . Th e stomac h i n th e Bivalvia . Philosophical Transactions of the Royal Society of London, Series B, 316, 183-276 . 1987/?. Classification an d evolution of the Bivalvia : An analytica l study . Philosophical Transactions of the Royal Society o f London, Series B , 316 , 277-302. REUNOV, A. A. & HODGSON, A . N. 1994 . Ultrastructure of the spermatozoa of five species of Southern African bivalves (Mollusca) , an d a n examinatio n o f earl y spermatogenesis. Journal o f Morphology, 219 , 275-283. ROSEWATER, J. 1965 . The family Tridacnidae i n the IndoPacific. Indo-Pacific Molluca, 1, 347-396. 1982. A Ne w Specie s o f Hippopus (Bivalvia : Tridacnidae). Th e Nautilus, 96, 3-6 . ROUSE, G . W . & JAMIESON , B . G . M . 1987 . A n ultrastructural stud y o f th e spermatozo a o f th e polychaetes Eurythoe complanata (Amphinomidae), Clymenella laseroni an d Micromaldane laseroni (Maldanidae ) wit h definition o f sperm types in relation to reproductive biology. Journal o f Submicroscopic Cytology, 19 , 573-584. SCHNEIDER, J . A . 1992 . Preliminary cladisti c analysi s of the bivalv e famil y Cardiidae . American Malacological Bulletin, 9, 145-155 . 1995. Phylogen y o f th e Cardiida e (Mollusca , Bivalvia): Protocardiinae , Laevicardiinae , Lahilliinae, Tulongocardiina e subfam . n . an d Pleuriocardiinae subfam . n. Zoologica Scripta, 24, 321-346. 1998<3. Phylogen y o f stem-grou p eucardiid s (Bivalvia: Cardiidae ) an d th e significanc e o f th e transitional fossi l Perucardia. Malacologia, 40 , 37-62. 1998/7. Phylogen y o f th e Cardiida e (Bivalvia) : Phylogenetic relationship s an d morphologica l evolution withi n th e subfamilie s Clinocardiinae , Lymnocardiinae, Fragina e an d Tridacninae . Malacologia, 40, 321-373. & O'FoiGHiL , D . 1999 . Phylogen y o f gian t clams (Cardiidae : Tridacninae ) base d o n partia l mitochondrial 16 S rDN A gen e sequences . Molecular Phylogenetics an d Evolution, 13 , 59-66. SHELLY, C . C . & SOUTHGATE , P. C . 1988 . Reproductive

GIANT CLA M SPERMATOZO A periodicity and morphometry of Hippopus hippopus and Tridacna crocea. In: COPLAND , J. W. & LUCAS, J. S . (eds ) Giant Clams i n Asia an d th e Pacific, Volume 9 . Australia n Centr e fo r Internationa l Agricultural Research, Canberra, 86-89. SIRENKO, B . I . & SCARLATO , O . A . 1991 . Tridacna rosewateri sp . n. A new species o f giant clam fro m the Indian Ocean. La Conchiglia, 22, 4-9. SOUSA, M . & AZEVEDO , C . 1988 . Comparative silve r staining analysi s o n spermatozo a o f variou s invertebrate species . International Journal o f Invertebrate Reproduction an d Development, 13 , 1-8. , OLIVEIRA , E . & OLIVEIRA , V . 1995 . Comparative silver staining of molluscan spermatozoa. Memoires

205

du Museum National D'Histoire Naturelle, 166 , 179-187. STASEK, C . R . 1962 . The form , growth and evolutio n of the Tridacnisae (gian t clams). Archives de Zoologie Experimental e t Generale, 101, 1-40 . YONGE, C . M. 1932 . Giant Clams and Burrowing Clams. Natural History, 32 , 244-251. 1936. Mode o f life, feeding, digestion and symbiosis with zooxanthellae in the Tridacnidae. Grea t Barrier Reef Expedition 1928-2 9 Scientific Reports, 1(11), 283-321. 1975. Gian t Clams . Scientific American, 232 , 96-105. 1980. Functional morpholog y an d evolution i n th e Tridacnidae (Mollusca : Bivalvia : Cardiacea) . Records o f th e Australian Museum, 33, 735-777.

This page intentionally left blank

Functional anatomy, chemosymbiosis and evolution of the Lucinidae JOHN D. TAYLOR & EMILY A. GLOVER Department of Zoology, The Natural History Museum, London SW7 5BD, UK (e-mail: j.taylor@ nhm.ac.uk) Abstract: Al l Lucinida e specie s studie d s o fa r posses s sulphide-oxidizing , chemosymbioti c bacteria housed in bacteriocytes of gill filaments. Th e ecology, functional anatom y and evolution of th e Lucinida e mus t b e considere d i n relatio n t o thi s symbiosis . Th e ctenidi a hav e bee n extensively studied but other anatomical structures peculiar to lucinids have received much less attention. Reviewe d ar e the morphologica l diversity o f living lucinids, highlighting feature s o f their anatomy including ctenidia, pallial apertures, anterior adductor muscle, pallial blood vessel and mantl e gills . Th e latte r ar e muc h mor e comple x tha n previousl y understoo d an d ar e here redescribed. The y compris e folde d structure s locate d nea r th e anterio r adducto r muscl e i n Codakia, Phacoides an d Lucina, an d o n th e septu m o f Anodontia. Thes e ar e interprete d a s secondary respirator y surfaces , thei r locatio n enablin g th e separatio n o f th e anterio r inflo w o f oxygenated water from sulphide-containin g water. The latter is released from the sediment by the probing activities of the highly extensible foot and is pumped over the gill through the pedal gape and perhap s als o vi a th e exhalan t tube . Th e shel l feature s o f Ilionia fro m th e Siluria n Perio d suggests tha t the lucinid chemosymbiosis is an ancient association.

The discovery of chemoautotrophic endosymbioses between bivalv e mollusc s an d sulphur-oxidizin g bacteria has resulted in a burgeoning interest in the biology o f som e previousl y rathe r neglecte d bivalve group s (Rei d 1990 ; Diste l 1998) . O f th e five extan t families i n whic h th e chemosymbiosi s has been demonstrated, the Lucinidae are by far the most diverse , ar e geographicall y th e mos t widespread, liv e i n th e greates t variet y o f marin e habitats, an d hav e th e longes t an d riches t fossi l history. Despit e lucinid s bein g capabl e o f particl e feeding, carbo n isotope (6 13C) measurements fro m a fe w specie s demonstrat e tha t a considerabl e proportion o f th e hosts ' nutritio n i s derive d fro m the intracellular , bacteria l symbiont s (Gar y e t al. 1989; L e Pennec e t al 1995) . Th e ubiquity of the symbiosis i n lucinid s an d thei r nutritiona l dependence upo n i t (Fishe r 1990 ; Rei d 1990 ) demands tha t an y consideratio n o f evolutionar y history o f th e Lucinida e shoul d tak e int o accoun t the importance of adaptations to this association . In thi s paper , genera l aspect s o f th e biolog y o f Lucinidae ar e reviewed an d i t is the n show n how major feature s of their anatom y and, in particular , mantle respirator y structures , ar e relate d t o th e symbiosis. Finally , i t i s considere d ho w morpho logical evidenc e fro m th e shell s o f fossi l lucinid s may provide evidence for estimating the age of the symbiosis. Althoug h fou r familie s o f livin g bivalves (Lucinidae , Fimbriidae , Thyasirida e an d

Ungulinidae) ar e assigne d t o th e Lucinoidea , th e phylogenetic relationships between them are rather uncertain, and in this review only the Lucinidae and Fimbriidae ar e considered . Despit e th e biologica l interest in the family there is no recent phylogenetic framework, usin g eithe r morphologica l o r molecular characters , o n which to tes t hypothese s concerning evolutio n o f symbiosi s withi n th e group, the latest being the phenetic study of North American tax a b y Bretsk y (1970 , 1976) . Additionally, th e systemati c revisio n o f the whol e family (Chava n 1969 ) i s base d o n rathe r poorl y defined shel l character s an d ther e i s muc h confusion concernin g the definitio n o f subfamilie s and genera. It is also clear that Recent lucinids ar e much mor e divers e tha n ha s bee n previousl y recognized an d ther e ar e man y undescribe d taxa , particularly fro m th e tropic s (Glove r & Taylo r 1997; Taylor & Glover 1997a) .

The chemosymbiosis Bacteria [gamm a subdivisio n o f Proteobacteri a (Durand et al. 1996 ; Diste l 1998) ] have now been reported fro m bacteriocyte s i n modifie d gil l filaments o f a t leas t 3 0 specie s o f Lucinidae , representing 1 8 differen t gener a fro m severa l distinct clade s (Tabl e 1 ) and inhabiting a range of habitats fro m tropica l t o temperate latitudes . Fro m this i t ma y be a reasonable extrapolatio n tha t the

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177 , 207-225 . 1-86239-076-2/007$ 15.00 © The Geological Society of London 2000.

208 J

. D . TAYLO R & E. A. GLOVE R

Table 1. Genera and species ofLucinidae an d Fimbriidae confirmed with bacteria in bacteriocytes Anodontia alba (Link, 1807 ) - Gier e (1985 ) (a s A. philippiana) A. edentula (Linnaeus, 1758) - Jansse n (1992) A. philippiana (Reeve, 1850 ) - Taylo r & Glover unpublished A. omissa (Iredale, 1930 ) - Taylo r & Glover unpublished Callucina radians (Conrad, 1841 ) - Schweimann s & Felbeck (1985) , Giere (1985) Cardiolucina semperiana (Issel, 1871 ) - Taylo r & Glover (1997a ) C. australopilula Taylor & Glover 199 7 - Taylo r & Glover (1997a) Codakia orbicularis (Linnaeus, 1758) - Gro s et al (19980 ) C. tigerina (Linnaeus, 1758) - Jansse n (1992), Taylo r & Glover unpublished C. rugifera (Reeve , 1850 ) - Taylo r & Glover unpublished Ciena orbiculata (Montagu, 1808) - Ber g et al (1982 ) Myrtea spinifera (Montagu , 1803) - Southwar d (1986), Dando et al (1985 ) Loripes lucinalis (Lamarck, 1818 ) - Southwar d (1986), Kerr y et al (1988 ) Lucina pensylvanica (Linnaeus, 1758) - Gro s et al (1996 ) Lucinella divaricata (Linnaeus, 1758 ) - Kerr y & Le Pennec (1987 ) Lucinisca nassula (Conrad, 1846 ) - Ber g & Alatalo (1984) Lucinoma annulata (Reeve, 1850) - Diste l & Felbeck (1987 ) L. aequizonata (Stearns, 1890 ) - Diste l & Felbeck (1987) , Cary et al (1989 ) L. atlantis (McLean, 1936 ) - Kennicut t et al (1985 ) L. borealis (Linnaeus, 1758) - Southwar d (1986) Parvilucina multilineata (Tourney & Holmes, 1857 ) - Gier e (1985 ) P. tenuisculpta (Carpenter, 1864 ) - Rei d & Brand (1986) 'Parvilucina' costata (d'Orbigny, 1842 ) - Gier e (1985 ) Phacoides pectinatus (Gmelin, 1791 ) - Frenkie l et al (1996 ) Pillucina fischeriana (Issel , 1871 ) - Taylo r & Glover unpublished P. pisidium (Dunker, 1860) - Kiiashk o et al (1989) , Rodionov & Yushin (1991) Rasta thiophila Taylor & Glover, 199 7 - Taylo r & Glover (1997b) Stewartiafloridana (Conrad , 1833 ) - Fishe r & Hand (1984), Distel & Felbeck (1987 ) Wallucina assimilis (Angas, 1867 ) —Barnes & Hickman (1999), Taylo r & Glover unpublished Fimbria fimbriata (Linnaeus , 1758) - Jansse n (1992), Taylo r & Glover unpublished This list extend s th e previous compilations of Reid (1990) , Fisher (1990) and Anderson (1995). Some names have been update d fro m the original references.

symbiosis is present i n most, if not all, living taxa conditions . Molecula r evidenc e als o indicate s of Lucinidae . Indeed , th e associatio n ha s bee n environmenta l cyclica l transmissio n o f bacteri a i n regarded a s obligate (Rei d 1990 ; Anderso n 1995) . othe r lucini d species , includin g Lucinoma Bacteria have also been recorde d fro m th e gills o f aequizonata (Gros et al. 1998& , 1999) . Ther e i s no Fimbria fimbriata (Jansse n 1992 ; pers . obs.) . evidenc e fo r vertica l transmissio n o f bacteri a Additionally, some , bu t no t all , specie s o f through gametes a s foun d i n Solemya (Kreuge r e t Thyasiridae contai n chemosymbioti c bacteri a i n al . 1996 ) an d Calyptogena (Car y & Giovannon i gill filamen t bacteriocytes (Southwar d 1986 ; Rei d 1993) . 1990). Althoug h only a few specie s hav e yet been studied, ribsomal DNA (rDNA) sequence s sho w Habitat and mode of life of Lucinidae that th e symbiont s ar e no t necessaril y uniqu e t o each lucini d species . Fo r example , Codakia Lucinids , particularl y specie s o f Codakia, Ciena, orbicularis and Lucina pensylvanica host the same Lucina, Lucinisca, Loripes an d Anodontia, ar e symbiont, but this differs fro m tha t associated with commo n i n shallo w seagras s bed s (Thalassia Phacoides pectinatus (Durand et al 1996) . especially ) o f the tropical Atlantic and Indo-Pacific Experiments wit h Codakia orbicularis hav e Ocean s an d ar e ofte n th e numericall y dominan t shown that the bacterial symbiont s are transmitted bivalve s in these habitats (Allen 1958 ; Moore el al from th e seagras s sedimen t t o th e newl y settle d 1968 ; Stanley 1970; Taylor & Lewis 1970 ; Jackso n juveniles o f th e hos t lucini d (Gro s e t a l 19980) . 1973) . Lucinid s ar e als o presen t i n seagras s a t The bacteri a ente r b y endocytosi s a t th e apica l temperat e latitudes, e.g. Wallucina assimilis around poles o f undifferentiated cells i n th e gill filament s souther n Australia (Barnes & Hickman 1999 ) an d which then differentiate into bacteriocytes. Juvenile Lucinella divaricata i n th e northeaster n Atlanti c Codakia wit h symbiotic bacteria ar e twice as large (Herr y & Le Pennec 1987) . Ciena, Divaricella and as aposymbioti c individual s grow n i n th e sam e Divalinga species ofte n occu r in unvegetated sands

ANATOMY O F LUCINIDAE

of ree f habitat s (Alle n 1958 ; pers . obs.) . Som e lucinids ar e abundan t i n organic-ric h sediment s around mangroves , suc h a s Phacoides pectinatus (Frenkiel e t al. 1996) , Anodontia philippiana, Austriella corrugata (Deshayes , 1843 ) an d Pillucina spp . (pers . obs.) . Specie s fro m suc h habitats ofte n sho w considerabl e anaerobi c capabilities (Anderso n 1995) . Lucinoma borealis and Loripes lucinalis occu r i n intertida l mu d an d sands i n th e northeaster n Atlanti c (Dand o e t a l 1986; Southwar d 1986 ; Kerr y e t al 1988) . Othe r Lucinoma specie s occu r i n offshor e continenta l shelf an d slope habitats (Gary et al 1989 ; Okutan i & Hashimoto 1997) , around cold seep s (Callende r & Powel l 1997 ) an d i n oxygen-minimu m zone s (Bottjer e t a l 1995 ; P . G . Olive r pers . comm.) . Diverse assemblage s o f previousl y unknow n species and genera of lucinids have been recovered from deep-water (c. 1000 m) sediments with a high content o f decayin g vegetatio n of f Indonesi a an d the Philippine s (Vo n Cose l & Bouche t pers . comm.). However, Fimbriafimbriata live s in clean, coralline sand s (Morto n 1979 ) an d th e presen t authors have found Codakia rugifera i n New South Wales livin g o n thei r side s expose d i n permanen t intertidal rock pools with decaying algae. The symbiont bacteria utiliz e reduced sulphur as an energ y sourc e an d requir e acces s t o dissolve d sulphide fro m interstitia l water . Althoug h som e lucinids ar e associated wit h sediments wit h a high free-sulphide content (Fisher & Hand 1984), other s live i n habitats wher e the sulphid e concentration s are very low (Dando et al. 1985; Gar y et al 1989) , and variou s alternativ e pathway s hav e bee n proposed fo r th e sulphid e oxidation . Gar y e t al . (1989) suggeste d tha t Lucinoma aequizonata use d foot probin g t o exploi t isolate d pocket s o f sulphurous mud. Another mechanism proposed by Dando e t al (1994 ) fo r Lucinoma borealis, is the mining throug h oxidatio n o f insoluble , sediment bound, iron sulphide s b y oxygenated water drawn down th e anterio r inhalan t tub e o f th e bivalve . Details o f sulphu r acquisitio n strategie s ar e available fo r ver y few specie s bu t lucinid s exhibi t such a diversity of morphologies an d live in such a wide variet y o f habitat s tha t i t i s likel y tha t they utilize a numbe r o f differen t chemica l pathway s and behaviours to acquir e reduced sulphide s fro m the environment. Many lucinid s burro w deepl y an d live nea r th e interface o f aerobi c an d anaerobi c zones , o r eve n within th e latter . Mos t liv e vertically , hing e uppermost, i n th e sedimen t an d maintai n a n anterior, mucus-line d inhalan t connectio n t o th e surface whic h i s forme d by th e highl y extensibl e cylindrical foot. Observations of Lucinoma borealis and Myrtea spinifera sho w that the position o f th e anterior tube may be shifted every few days (Dando

209

et al 1985 , 1986) . Lucinids als o probe dow n with the foot into the reducing layers and Stanley (1970), using X-rays of Codakia orbicularis and Phacoides pectinatus in their life positions, demonstrate d tha t in addition t o the anterior inhalan t tube there were long, narrow , tube-lik e probing s radiatin g down wards fro m th e ventra l margi n o f shel l (se e als o Turner 1985 , fig . 3) . Simila r tunnel s hav e bee n reported fo r Lucinoma an d Myrtea (Dand o e t a l 1985) an d Gar y e t a l (1989 ) recorde d tha t Lucinoma aequizonata uses th e vermiform foot t o penetrate u p t o thre e time s it s bod y lengt h dow n into the sediment. Four to five tunnels were formed each wee k whic h laste d fo r period s o f te n t o 1 5 days wit h th e foo t remainin g extende d i n th e probings fo r prolonged period s o f time . Taylo r & Glover (1997 'b) suggeste d tha t th e long , perio stracal pipe s radiatin g fro m th e ventra l margi n of the shel l i n Rasta thiophila wer e mor e permanen t conduits fo r th e channellin g o f interstitia l wate r into th e mantl e cavity . B y contrast , Lucina pensylvanica ha s a differen t lif e positio n an d Stanley's (1970 , pi . 18 ) X-rays sho w th e anterio r end o f th e shel l uppermost , wit h a mor e o r les s vertical anterio r tub e t o th e sedimen t surfac e bu t with very long traces down into the sediment below the bivalve . Stanle y (1970 ) though t th e posterio r tunnels wer e made b y th e posterio r exhalan t tub e but they are more likely t o have been produced by the foot. Fimbria fimbriata live s shallowl y burie d with the anterior end close to the surface and there is no anterior tube formed by the foot, th e anterio r inflow o f water is directed fro m th e surface around the mantle edge (Morton 1979) .

Functional anatomy of Lucinidae It ha s lon g bee n recognize d tha t Lucinida e hav e many unusual anatomical feature s when compared with other bivalves but before the discovery o f the chemosymbiosis thes e were largely unexplained o r misunderstood. I n a n earl y account , Duverno y (1854) clearl y identifie d th e unusua l gill , th e reduced labia l palp s an d th e mantl e plication s a s rather peculiar features of lucinids. The most comprehensive anatomica l descriptio n o f Lucinidae i s that of Allen (1958) , who described th e functional anatomy o f nin e species , alon g wit h specie s o f Thyasiridae an d Ungulinidae . Otherwise , a fe w species wer e briefly described b y Pelseneer (1911 ) and mor e recentl y other s bee n describe d i n mor e detail, including Allen & Turner (1970) and Morton (1979) fo r Fimbria fimbriata, Narch i & Faran i Assis (1980 ) fo r Phacoides pectinatus, Olive r (1986) fo r Keletistes rhiwecus, Rei d & Bran d (1986) fo r Parvilucina tenuisculpta an d Taylo r & Glover (1997& ) fo r Rasta thiophila. Additionally, over th e las t 1 5 year s ther e hav e bee n man y

210

J. D . TAYLO R & E. A . GLOVE R

Fig. 1 . Rasta thiophila Taylo r & Glover, 1997 . Houtman Abrolhos Islands, Wester n Australia. General anatomy with left mantl e removed, aa, Anterior adductor muscle; ct, ctenidia; exa, exhalant aperture; f, foot; ina, inhalant aperture; k, kidney; Ip, labial palps; pa, posterio r adductor; r, rectum.

detailed studie s o f gil l morpholog y an d ultrastructure (see below). Major features of the anatomy (Fig. 1) which are characteristic o f Lucinida e are : a n anteriorl y extended body; an often elongat e anterior adductor muscle with a degree of separation from th e line of pallial attachment; an anterior inhalant tube formed by th e foot ; anterior-posterio r wate r flo w i n th e mantle cavity; a highly extensible vermiform foot; posterior exhalan t sipho n an d usuall y a posterio r 'inhalant' aperture ; ofte n a plicate d inne r mantl e surface nea r th e anterio r adducto r muscl e - th e mantle gills; thic k and large inner demibranchs of

ctenidia only , wit h th e oute r demibranch s absent ; specialized bacteriocyte s i n gil l filaments ; ver y small labia l palps ; simpl e stomac h an d shor t gut; and a larg e pallia l bloo d vesse l whic h run s diagonally from nea r the ventral tip of the anterior adductor muscle to the heart. The simplified , bu t thic k an d large , gills , th e highly reduced labial palps, the simple stomach and the shor t gu t ar e al l feature s associate d wit h th e nutritional dependenc e o f th e bivalve s o n chemo symbiosis. Simila r adaptation s occu r i n othe r chemosymbiotic bivalves , e.g . Solemya, Calyptogena an d Bathymodiolus (Fishe r 1990 ; Reid 1990) . However , th e significanc e o f som e other lucini d feature s i s les s clea r an d thes e ar e reviewed i n thi s paper ; thei r functio n i s then considered i n relatio n t o th e chemosymbioti c lifestyle o f th e Lucinidae . Severa l o f thes e distinctive anatomica l feature s (elongat e anterio r adductor muscle , mantl e gill s an d pallia l bloo d vessel) leave traces on the insides of the shells (Fig. 2) an d thes e ca n b e recognize d i n fossi l lucinid s back to the Silurian Period.

Ctenidia and bacteriocytes The structur e of the gills housin g the bacteria ha s been muc h studie d an d fin e structura l detail s ar e now availabl e fo r specie s o f severa l genera , fo r example: Gro s e t al (1996 ) for Lucina (a s Lingo) pensylvanica; Reid & Brand (1986) for Parvilucina tenuisculpta\ Frenkie l & Moue'z a (1995 ) fo r Codakia orbicularis; Diste l & Felbeck (1987 ) fo r Lucinoma aequizonata; Distel & Felbec k (1987 ) and Frankiel et al 1996 ) for Phacoides (as Lucina) pectinatus; Kerr y & L e Penne c (1987 ) fo r Lucinella divaricata; Kerr y e t a l (1988 ) an d

Fig. 2 . Internal views of right valves of: (a) Rasta thiophila; (b ) Loripes clausus (Philippi, 1849 ) Berbera, Somali a BMNH 1963341. These sho w scars of the elongate anterio r adductor muscle dorsally detache d fro m th e pallial lin e and the impression o f the pallial blood vessel , pbv, Pallial blood vessel .

ANATOMY O F LUCINIDAE

Southward (1986 ) fo r Loripes lucinalis an d othe r references cited in Table 1 . Although th e detaile d gil l structur e varie s between genera , th e basi c pla n i s simila r i n al l lucinids examined . Th e ctenidi a consis t o f inne r demibranchs only , whic h ar e larg e an d thic k compared with most other heterodont bivalves. The ctenidia o f Fimbria ar e relatively less voluminous and thinne r tha n thos e o f lucinids . Al l lucinid s possess a shallow , ventra l foo d groove . I n sectio n (Figs 3 an d 4) , individua l filament s compris e a narrow ciliate d zon e wit h frontal , eulatero-fronta l cirri an d latera l cili a simila r t o thos e o f othe r bivalves. Inwards of this is an intermediary zone of several larg e cell s [transitio n zon e o f Diste l & Felbeck (1987) ; storag e epitheliu m o f Rei d & Brand (1986)] , followe d by th e thic k bacteriocyt e zone of subfilamental tissue consisting of sheets of

Fig. 3 . Generalized diagra m o f part of a single gil l filament o f Codakia orbicularis. Base d on TEM figur e of Frenkiel & Moueza (1995 , fig. 4). be, Bacteriocyte; bs, blood space; ca, collagen axis of gill filament ; elle , eulatero-frontal cilia ; fc, frontal cilia; gc, granule cell ; ic . intermediary cell ; ical, intercalary cell ; Ic, latera l cilia .

211

domed cell s separate d b y narrow , central , bloo d space. Th e bacteriocyte s ar e packed wit h bacteri a which ar e usuall y ro d shape d an d containe d i n membrane-bound vesicles . Ofte n th e bacteri a ar e aligned wit h thei r lon g axe s norma l t o th e microvilli-covered, epithelia l surfac e (Fig . 4b) . Narrow intercalar y cell s separat e th e bacteriocyte s and lateral extension s fro m the m ofte n overla p th e outer surfac e of th e bacteriocyt e cell s (Fig s 3 and 4c). Occasiona l mucocyte s occur betwee n th e bacteriocytes. The functio n an d significanc e of th e intercalar y cells is unknown but has been th e subjec t of som e speculation. Th e intercalar y cell s ar e usuall y narrow a t the base an d broaden distally into lateral extensions. Thes e ofte n overla p th e apice s o f th e bacteriocyte cell s to form a partial 'cover ' (Fig . 4c) which has led to suggestions that they may functio n to periodicall y restric t th e contac t o f th e bacteriocytes wit h seawate r withi n th e mantl e cavity (Diste l & Felbeck 1987 ; but se e Frenkiel & Moue'za 1995) . Although th e structur e o f th e gil l filament s has been wel l describe d ther e ar e man y outstandin g problems concernin g th e symbiosis . Particularl y intriguing is the variety of granules seen in cells of the bacteriocyt e zon e o f differen t lucinid s (e . g . Reid & Bran d 1986 ; Frenkie l & Mouez a 1995 ; Anderson 1995 ; Frenkie l e t al 1996 ) an d th e functional significanc e o f thes e is , a s yet , unresolved. Remarkabl e ar e th e accumulation s o f rounded granule s (2- 5 ur n i n diameter ) whic h fil l cells within the bacteriocyte zone (Fig. 4d) of some genera (e.g . Codakia, Lucinisca an d Lucinoma', Southward 1986 ; Gro s e t a l 1996) . I n Codakia orbicularis (Gro s e t al . 1996) , wher e th e granul e cells ar e particularl y abundant , the y hav e bee n shown to be cystine rich an d proteinic (Frenkie l & Moueza 1995) , an d analytica l scannin g electro n microscopy (SEM ) show s them to be sulphu r rich (pers. obs.). Th e granule cells becom e mor e abun dant wit h ag e o f th e bivalv e an d i n C . orbicularis the latera l zon e o f th e gil l filament s become s divided int o a superficia l bacteriocyt e zon e an d a deeper zone dominated by granule cells (Frenkiel & Moueza 1995) . Also contained within the bacterio cyte cell s ar e a variety o f othe r granules , some of which ar e elementa l sulphu r (Vette r 1985 ; Anderson 1995 ) whils t other s ar e iro n ric h o r contain a variety of metals (Reid & Brand 1986) . Variation between lucinid genera i n the structur e of the gill filament s concern s the numbe r and types of cell s i n th e intermediar y /.one , th e presenc e an d abundance o f granul e cells , ih c abundanc e o f mucocytes an d th e presenc e o f perox i somes ani l cytoplasmic haemoglobi n i n bacteriocylc s (JTcnkiel & Mouc/ a 1W : hvnkie l e l ul. \W(v. (iros el til. 1 1 >W».

212

J. D . TAYLO R & E . A . GLOVER

Fig. 4 . (a) Pillucina cf.fischeriana (Issel , 1869) , Por t Douglas , Queensland , Australia . Section o f several gil l filaments showin g ciliate d zone , intermediar y zon e an d lateral zon e wit h bacteriocytes. Scal e bar, 2 0 jam . (b ) Pillucina cf.fischeriana. Sectio n o f gill filament with bacteria. Scal e bar , 1 0 um. (c ) Codakia tigerina (Linnaeus , 1758). Bacteriocyte zone of gill filament showin g bacteriocytes separate d b y intercalary cells . Scal e bar, 1 0 (am. (d) Codakia tigerina. Sectio n throug h gill filament showin g (upper ) cells packe d wit h spherica l granule s wit h bacteriocytes below . Scal e bar , 1 0 um. Al l figures SEMs o f critical-point drie d tissue , b, Bacteria i n bacteriocytes; fil , filament; gc , granule cell; ic , intercalary zone ; iz, intermediary zone .

Mantle gills and septum Mantle gill s ar e structure s locate d o n th e inne r mantle surfac e betwee n th e anterio r adducto r muscle an d the ventra l mantl e margin . The y wer e first notice d i n Codakia tigerina b y Duverno y (1854, p. 115 , pi. 5, fig. 1) and later Semper (1880 , fig. 48a ) figure d simila r structure s i n Lucina philippensis (possibl y Anodontia philippiand), calling the m mantl e gill s 'Mantelkiemen' . Subsequently, Pelsenee r (1911 ) illustrate d mantle gills in Lucina exasperata Reeve, 185 0 ( = Codakia tigerina) an d i n Lucina tumida Reeve , 185 0 (a n

Anodontia species) , an d suggeste d a possibl e respiratory functio n becaus e o f thei r similarit y t o the gill s of opisthobranc h gastropods . Later, Allen (1958) illustrate d and described, wit h sections, the mantle gill s o f Codakia orbicularis an d Lucina pensylvanica. Becaus e of the extensive blood space associated wit h the m h e als o interprete d the m a s respiratory surfaces. Additionally, Narchi & Farani Assis (1980 ) illustrate d in Phacoides pectinatus, a row o f mantl e gills locate d i n a channel alongside the elongate anterior adductor muscle. Present observation s sho w tha t mantl e gill s ar e more comple x tha n previousl y illustrate d an d

Fig. 6 . (a) Codakia tigerina. Mantl e gill s ventra l to anterior adducto r muscle . Scal e bar, 1 mm. (b) Anodontia philippiana (Reeve , 1850) . Septum and digitiform mantl e gills, anterio r o f bivalve to the right. Scal e bar, 1 mm. (c) Codakia tigerina. Sectio n through mantle gill s showin g blood space s an d inner epithelial surfac e wit h ciliary tufts . Scale bar , 50 0 um. (d ) Anodontia philippiana. Microvilli-covere d epitheliu m of mantle gill s wit h ciliary tufts . Scal e bar, 1 0 um. Al l figure s SEMs o f critical-point dried tissue.

ANATOMY O F LUCINIDAE

Fig. 5 . Codakia tigerina. Inner surfac e o f the left anterio r mantl e showin g th e highly plicat e mantle gill s located anterior an d ventral to the anterior adducto r muscle.

213

214

J. D . TAYLO R & E . A . GLOVE R

Fig. 7 . (a) Codakia orbicularis (Linnaeus, 1758) , Islamorada , Florid a Keys. Transvers e sectio n throug h mantl e edg e and mantle gill s ventral t o the anterior adducto r muscl e showin g th e extensive bloo d spaces, (b) Codakia tigerina, Leyte Island, Philippines. Semidiagrammatic transverse sectio n of mantle edg e and mantle gill s immediately ventral to the anterior adductor muscle . Mantl e gill s stippled , bs, Blood space; glc, gland cells ; imf, inne r mantl e fold ; 1m, longitudinal mantl e muscles ; mg , mantle gills ; mmf, middl e mantl e fold ; n, nerve; ome , oute r mantl e epithelium ; omf , outer mantle fold; p , periostracum; pal, pallia l attachment; pg, periostracal groove; pn, pallial nerve; rm, radial mantle muscles.

described herei n ar e th e mantl e gill s o f Codakia orbicularis, C. tigerina, Lucina pensylvanica, Anodontia philippiana an d A. omissa. In Codakia tigerina (Fig . 5 ) an d C . orbicularis the mantle gills are located aroun d the anterior and ventral sides of the anterior adductor muscles. They comprise a series o f highly plicate ridges (Fig. 6a) . Anterior to the adductor there is a grooved channel (Fig. 5 ) which is bounded on either sid e by ridges . The ridg e alongsid e th e adducto r muscl e bein g long, convoluted and continuous. After th e ventral termination o f th e muscl e th e ridge s exten d posteriorly an d ventrall y into th e peda l gap e area . Coalescence o f th e ridge s produce s a prominen t knot o f tissu e a t th e ventra l en d o f th e adducto r muscle. In section th e mantle gills (Figs 6c and 7) form a series of projecting outgrowths of the epithelium of the inne r mantl e surface . Th e number s o f ridge s seem variable but for the specimens sectione d there are 1 1 subparallel ridge s i n Codakia tigerina an d

seven i n C . orbicularis. On e o r tw o ridge s ar e located o n th e inne r surfac e o f thickene d mantl e edge. Eac h ridge has a thin epithelium o f low cells and abundan t ciliate d tuft s ove r th e surfac e (Fig s 6c, 7 an d 8) . Th e ridge s ar e convolute d i n profile and mainl y occupie d b y interconnectin g chamber s of blood spac e whic h join u p with the blood spac e of the inner mantle epithelium (Fig. 8) . Reinvestigation of Lucina pensylvanica reveale d that Allen' s (1958 , p . 430 , fig . 4) descriptio n an d illustration o f th e mantl e gil l onl y hinte d a t th e complexity o f thi s structure . Th e mantl e gill s ar e large bipectinat e structure s (Fig . 9 ) comprisin g anastomosing folds o f mantle epithelium whic h are aligned norma l t o an d joi n th e prominen t pallia l blood vessel . The y exten d postero-dorsall y fro m close t o th e posterio r ti p o f th e anterio r adducto r muscle acros s th e inne r surfac e o f th e mantle , following th e lin e o f th e pallia l bloo d vessel . I n section, a s illustrated by Alle n (1958 , fig . 5a), th e individual fold s o f th e mantl e gill s hav e a larg e

ANATOMY O F LUCINIDA E

215

Fig. 8 . Codakia orbicularis. Section of a single mantle gill, bs, Blood space; cit, ciliar y tufts ; ime , inner mantl e epithelium; n, nerve; ome, outer mantle epithelium.

Fig. 9 . Lucina pensylvanica. Uppe r Matecumbe Key, Florida. Inner surface of left mantl e nea r the anterio r adductor muscle showing the bipectinate mantle gill and the pallial blood vessel. Scale bar, 5 mm. aa, Anterior adductor muscle ; me , mantle edge; pbv, pallial blood vessel.

blood spac e an d ciliated epithelium . Th e histolog y is simila r t o tha t o f th e mantl e gill s o f Codakia orbicularis bu t lowe r i n profile. The ventra l tip of the mantl e gil l i s separate d fro m th e inne r fol d o f the mantl e edg e b y a thickene d ridg e o f mantl e epithelium whic h extend s posteriorl y fro m th e anterior adductor muscle. Structures possibl y homologou s t o th e mantl e gills of Codakia occu r in Anodontia species . Thes e possess sept a o f thin , ciliate d epithelia l tissu e across eac h sid e o f th e mantl e cavit y whic h originate fro m th e ventra l en d o f th e anterio r adductor muscl e an d ru n posteriorl y t o th e sit e of posterior mantl e fusio n (Fig . 10) . I n section , eac h septum i s see n t o divid e th e antero-ventra l par t of the mantl e cavity . I n Anodontia philippiana, th e anterior ends of the left an d right septa bear a series of highl y plicat e structure s whic h terminat e anteriorly i n finger-lik e projection s (Fig . 6b) . Th e innermost ridg e o f th e septu m i s thickl y ciliated , but mos t o f the ventra l flank s an d plication s carr y ciliary tuft s arisin g fro m a microvilli-covere d surface (Fig . 6d) . Sections throug h th e septu m an d digitifor m structures o f A. philippiana (Fig . 11 ) show that the septum comprises tw o epithelial layer s enclosing a narrow, centra l bloo d spac e whic h i s crosse d b y trabeculae. The epithelial layers consist of low cells with ciliar y tufts . A t th e sit e o f th e digitifor m structures, th e septu m i s throw n int o a serie s o f

216

J. D . TAYLO R & E. A . GLOVER

posteriorly fro m th e ventra l en d o f th e anterio r adductor muscle. Allen (1958 , fig s 1 7 and 18 ) also illustrates i n Divaricella quadrisulcata Orbigny , 1846 an d Pegophysema alba (a s Lucina chrysostoma) a 'triangular fold' locate d in the same position a s th e mantl e gills . Althoug h th e presen t authors di d no t repor t suc h structure s i n Rasta thiophila (Taylo r & Glover 1997Z? ) re-examinatio n of thi n section s show s tha t th e inne r mantl e ha s small plication s i n th e are a clos e t o th e anterio r adductor. Similar mantl e gill-lik e structure s ar e foun d i n another lucinoid family, the Fimbriidae. I n Fimbria fimbriata ther e ar e elongate , wedge-shape d structures arising fro m th e inner mantle epithelium which extend as ridges from th e ventral edge of the anterior adducto r muscl e (Alle n & Turne r 1970 ; Morton 1979) . A groove run s along th e summi t of the free margi n which is edge d b y convolute d lip s

Fig. 10 . Anodontia philippiana (Reeve , 1850) . Ventral view of septum an d digitiform mantl e gills . Left and right mantle lobe s and the foot removed (cu t surfac e indicated by cross-hatching), aa, Anterior adducto r muscle; f , foot; m, mantle; mg , mantle gills ; pfm, posterior mantle fusion ; pli, plications; s , septum; vm , visceral mass .

labyrinthine folds , th e plicate d surfac e bein g th e summits of the folds. The blood space s are broader and the trabeculae thicker on the outermost parts of the folds (Fig . lib) . Sections through the septum of Anodontia omissa reveal a similar histology but the labyrinthine folds ar e absent. Although few specie s have yet been examined , the septu m may prove to be a n autapomorph y o f Anodontia species , whils t the plicated knots may be present only in the larger species. The numbe r o f lucini d specie s bearin g mantl e gills i s no t ye t know n bu t likel y homologou s structures have been observed in species othe r than those describe d above . Narch i & Faran i Assi s (1980) illustrat e in Phacoides pectinata a series of 16 small , separated , plicat e ridge s locate d i n a channel betwee n th e elongate , anterio r adducto r muscle an d th e mantl e edge . Thes e ar e arrange d more o r les s transversel y t o th e anterio r wate r current (Fig. 12 ) and have a similar histology to the mantle plication s o f Codakia. I n Austriella corrugata (presen t authors ' unpublishe d observa tions) ther e ar e thick , singl e ridge s extendin g

Fig. 11 . Anodontia philippiana. (a ) Transvers e sectio n through the mantle gill s in the anterior par t o f the septum. Inner mantle surface a t base, (b) Enlargement of part of the septum showin g bloo d spaces and trabeculae . bs, Blood space ; If , labyrinthin e fold ; ims, inne r mantl e surface; ome , oute r mantl e epithelium ; s, septum; tf, thickened fold ; tr, trabeculae .

ANATOMY O F LUCINIDA E

Fig. 12 . Phacoides pectinatus (Gmelin, 1791) . Brazil [modified fro m Narch i & Farani Assis (1980)]. (a) General anatomy with th e left mantl e removed to show the row of mantle gills lying alongside the anterior adductor muscle, (b) Detail of single mantle gill, aa, Anterior adductor muscle; ct, ctenidia; exa, exhalan t aperture; f, foot; ia , inhalant aperture; k, kidney; m, mantle; mg, mantle gills; pa, posterior adductor muscle.

(Fig. 13) . In section, th e central are a of the ridge is a spong y networ k o f bloo d space s wit h thin , cellular walls and covered by a ciliated epithelium . The distal groov e i s lined wit h gland cell s openin g through th e epithelium . Th e bloo d space s connec t with th e pallia l bloo d vessel . A differen t interpre tation wa s presented b y Morton (1979 ) wh o calle d these sam e structure s mantl e palps . H e suggeste d that the y remove d particulat e materia l fro m th e foot, trappin g i t i n copiou s amount s o f mucu s

Fig. 13 . Fimbria fimbriata (Linnaeus , 1758 ) [fro m Morton (1979, fig. 14)] , Lizard Island, Queensland, Australia. Ventra l vie w o f anterior of the animal showin g mantle gills positioned in the inhalant water current, aia , Anterior inhalan t aperture ; ct, ctenidia; f, foot; mg , mantle gills; mmf, middl e mantle fold; mo , mouth; pr, pedal retractor muscle; vm, visceral mass.

217

produced by the epithelium in the glandular groove. The histology of the main part of these structure s in Fimbria i s similar t o that o f the ridges i n Codakia tigerina, althoug h th e dista l glandula r groov e an d the lip-like edges are not found in the latter species . From th e present authors ' observation s i t is als o clear tha t many othe r lucinids , particularl y th e small specie s i n gener a suc h a s Cardiolucina, Pillucina, Wallucina an d Parvilucina, d o no t possess an y obviou s mantl e gills . Nonetheless , i n these species , a s i n thos e wit h mantl e gills , a n extensive, thickene d bloo d spac e lie s beneat h th e inner ciliated mantl e epithelium. Although there ha s been n o direct physiologica l study, the histology, th e abundant blood supply , the highly plicate d surface s an d th e positio n i n th e incoming anterio r wate r curren t ar e al l stron g evidence tha t th e mantl e gill s i n thes e differen t lucinids ar e respiratory structures . Their histolog y and morphology are also very similar to the gills of opisthobranch gastropod s suc h as Acteon tornatilis (Fretter & Graha m 1954 ) an d th e pallia l gill s o f basommatophoran pulmonates . Section s throug h the gil l plication s o f Cylindrobulla (Morto n 1988 , fig. 6 c and d) show a structure very similar t o that of Codakia orbicularis and C. tigerina (Fig. 7), and the gills o f Akera bullata ar e thrown int o comple x folds (Morto n 1972 ) simila r t o thos e see n i n th e septum of Anodontia philippiana (Fig . 11) . Anterior adductor muscle There ar e tw o feature s o f th e anterio r adducto r muscle whic h ar e peculia r t o lucinids . Firstly , th e muscle i s enlarge d an d elongate d ventrall y an d sometimes dorsally , i n compariso n wit h th e posterior muscle which is reniform or subcircular in outline (Fig . 2) . Secondly , th e adducto r muscl e i s detached fro m th e lin e o f pallia l attachmen t fo r a proportion of its length (Fig. 2). These two features vary considerabl y betwee n lucini d genera . Thus , Miltha an d Phacoides (Fig . 12 ) hav e extremel y long, narrow adductor muscles which are extended ventrally an d detache d fro m th e pallia l lin e fo r much o f thei r length . A t th e othe r extreme , th e adductor muscl e o f Cardiolucina specie s i s smal l and detache d onl y slightl y fro m th e pallia l lin e a t the ventral end (Taylor & Glover 1991 a). However , in mos t lucinid s ther e i s ofte n a considerabl e elongation o f th e anterio r adducto r muscle , whil e the detachmen t o f the muscl e fro m th e pallial lin e has becom e a n importan t distinguishin g characte r of lucinids. Given th e widesprea d distributio n o f thes e tw o features of the anterior adductor muscle in lucinids, what, i f any , is thei r functiona l significance ? Th e present author s believ e tha t the y ar e functionall y linked an d associate d wit h th e anterio r inhalan t

218

J. D . TAYLO R & E. A . GLOVE R

tube an d the anterior-posterior water flo w throug h the mantl e cavity . I n lucinids , th e fusio n o f th e anterior mantl e i s locate d muc h furthe r antero dorsally tha n in mos t heterodont bivalve s and this exposes th e ciliate d oute r surfac e of th e adducto r muscle. Th e detachmen t o f th e ventra l en d o f th e muscle fro m th e pallia l lin e form s a n elongat e channel or approximately triangular area of mantle which i s als o ciliated . Th e cili a o n the fac e o f th e adductor muscl e an d in the anterior channe l creat e the flo w o f wate r dow n th e anterio r inhalan t tube and int o th e mantl e cavity . I n som e species , Phacoides pectinatus an d Codakia spp. , th e channel between th e anterior adducto r i s occupie d by mantl e gill s whic h als o exten d beyon d th e muscle posteriorly alon g the inner mantle surface. Only in Lucina pensylvanica hav e the mantle gills been observed extending dorsally from th e anterior adductor muscle. Allen (1958) showed that the area between the adductor muscle and mantle edge was responsible fo r sortin g mos t o f th e particulat e material entering via the inhalant tube and that little material passed to the gills. This area of the anterior mantle i s wel l endowe d wit h blood spac e an d th e large pallia l bloo d vesse l whic h run s t o nea r th e ventral end of the anterior adductor muscle links up with thes e bloo d spaces . I t i s conclude d tha t th e mantle aroun d th e anterio r adductor , wit h o r without th e mantl e gills , ha s becom e th e majo r respiratory surfac e o f th e lucinids . Th e elongat e adductor muscle also acts as a partition, effectivel y separating th e anterio r par t o f th e mantl e cavit y from th e ctenidia. This is seen to an extreme extent in Phacoides pectinatus (Fig . 12 ) an d Miltha childreni (Gray , 1825 ) wher e th e muscl e i s ver y long. In Anodontia species, an even larger partition is created by the septum which joins the ventral end of th e adducto r muscl e an d extend s nearl y t o th e posterior apertures (Fig. 10) . In Fimbria fimbriata, th e anterio r adducto r muscle i s shor t an d no t detache d fro m th e pallia l line. Thi s specie s burrow s wit h th e antero-dorsa l end clos e t o th e sedimen t surfac e and n o anterio r tube i s forme d (Morton 1979) . Th e anterio r wate r current i s draw n dow n th e antero-dorsa l mantl e edge int o th e mantl e cavit y an d ove r th e mantl e gills which lie in its path (Fig. 13 )

epithelium and , where present, the mantle gills and septum. The blood vessel often leaves an impressed diagonal groov e withi n th e inne r shel l laye r o f lucinids (Fig . 2) . This groov e is commonly visibl e on th e inne r shel l o f fossi l specie s an d i s particularly deepl y impresse d i n Megaxinus rostratus from th e Pliocene Period o f Italy (Glover & Taylor 1997 , fig. 7i). Posterior mantle apertures In mos t lucini d specie s ther e ar e tw o posterio r mantle apertures (Fig . 14 ) formed by fusio n o f th e inner and , i n a fe w species , middl e mantl e fold s (Allen 1958 ) [becaus e the middle mantle fold ofte n comprises severa l lobe s i n lucinid s (Fig . 7 ) th e homologies o f th e mantl e fold s ar e difficul t t o recognize]. Th e ventra l o f thes e tw o apertures , corresponding t o th e inhalan t apertur e o f mos t heterodont bivalves , i s a simpl e orifice , fringe d with papillae in some species. The extent of mantle fusion ventra l t o th e inhalan t apertur e varie s between lucini d genera, e.g. it is long in Anodontia and shor t i n Codakia. I n som e lucinids , e.g . Parvilucina tenuisculpta (Rei d & Brand 1986) , P. multilineata (pers . obs. ) an d Cardiolucina

Pallial blood vessel Another featur e o f lucinid s no t foun d i n othe r bivalves is the large pallial blood vessel (Figs 2 and 9). In Codakia, Lucina, Anodontia an d Phacoides, as i n al l lucinid s an d i n Fimbria, this large vesse l runs diagonall y antero-ventrally across th e mantle connecting the heart t o a sinus near the ventral ti p of th e anterio r adducto r muscle . Here i t branches, joining th e thic k bloo d spac e o f inne r mantl e

Fig. 14 . Pillucina cf. fischeriana Port Douglas, Queensland, Australia. SEM of critical-point dried preparation of posterior mantle fusion an d apertures. Scale bar, 0. 5 mm. exa, Exhalan t aperture, ina, inhalan t aperture.

ANATOMY O F LUCINIDA E

australopilula (Taylo r & Glover 1997a) , there is no fused inhalan t aperture . Th e dorsa l posterio r aperture, the exhalant, i s usually larger, sometime s fringed wit h papillae, an d comprises a n extensible , thin, bu t muscular , tub e whic h i s inverted , o n retraction, into the posterior mantl e cavity between the tw o gil l demibranchs . I n som e species , th e siphon ca n b e extende d t o a t leas t si x time s th e length o f th e shel l (Alle n 1958) . Th e inhalan t aperture ma y functio n onl y fo r th e rejectio n o f pseudofaeces. However , th e exhalan t sipho n i s clearly mor e activ e an d show s prominentl y i n Stanley's (1970) X-rays of lucinid life positions. As well a s directin g th e outwar d flo w o f wate r fro m the gills , Rei d (1998 ) ha s suggeste d tha t wate r could also be drawn into the suprabranchial mantl e cavity when the siphon is inverted. Reid & Bran d (1986 ) describe d i n Parvilucina tenuisculpta a tissu e connectio n betwee n th e posterior en d o f the ctenidi a an d the inne r mantl e close t o the exhalant aperture . The y suggeste d tha t this arrangemen t acte d a s a bellows, enablin g th e flushing of the suprabranchial chamber and thereby drawing i n sulphide-ric h water. Additionally , they speculated that this structure might be more widely distributed amongst lucinids but the present authors have see n i t onl y i n Cardiolucina australopilula (Taylor & Glover 1991 a), Parvilucina multilineata, Pillucina fischeriana and Wallucina assimilis. Foot The form o f lucini d foo t (Fig . 1 ) i s unusua l fo r heterodont bivalve s an d it s activitie s ar e a n important par t o f th e varie d behaviou r associate d with chemoautotrophy . As wel l a s burrowing , the foot form s th e anterior , mucus-lined, inhalant tube and th e ventra l tunnel s belo w th e animal . Additionally, th e foo t ma y b e responsibl e fo r drawing interstitial wate r up into the mantle cavity from th e ventral tunnel s eithe r b y piston actio n o r through currents created by the ciliated epithelium. In most lucinids the main part of foot is vermiform, long and cylindrical and can be extended for at least four t o six times th e lengt h of the animal. Fimbria fimbriata ha s a broader , les s extensibl e foo t (Morton 1979) . Man y lucini d specie s hav e a stubby, flattene d posterio r componen t - th e heel (Allen 1958 ) - bu t thi s i s absen t i n other s (e.g . Rasta', Taylo r & Glove r I991b). Th e long , cylindrical part of the foot has layers of circular and longitudinal muscl e (Alle n 1958 ; Taylo r & Glove r 1991 b) surroundin g a centra l bloo d space . Th e distal ti p i s bluntl y pointe d bu t ca n becom e bulbous. The outer epithelium consists of columnar cells whic h becom e highl y ciliate d nea r th e tip . Also at the tip, there are two types of subepithelia l gland cells wit h different stainin g properties (Alle n

219

1958; Morto n 1979) . I n Rasta, Taylo r & Glove r (1991b) showe d tha t re d stainin g glan d cell s extended furthe r back alon g th e foot than the blu e staining cell s whic h occupie d onl y th e ver y tip . Allen (1958 ) though t tha t thes e glan d cell s wer e responsible fo r producin g th e mucu s whic h line s the anterior inhalant tube, however, the presence of two type s o f cel l suggest s tha t thei r rol e i s mor e complex.

General functional summary The locatio n o f sulphide-oxidizing , bacteria l chemosymbionts in the gills of lucinids necessitates separation o f th e respirator y surface s fro m th e location o f th e chemosymbionts . Otherwise , sulphides in the water being drawn into the mantle cavity b y th e foo t an d by current s generate d fro m the ciliate d zon e o f th e gills , an d mayb e als o through the posterior apertures, woul d be oxidize d before reachin g th e bacteriocytes . Thus , th e relocation o f majo r respirator y surface s nea r th e anterior tube , partly separate d fro m th e rest o f th e mantle cavit y b y th e ofte n elongate d adducto r muscle, effectively partition s the sites of respiration and chemosynthesis . I n som e large r lucinid s th e anterior inne r mantl e surfac e become s highl y plicated t o form th e mantle gills, wherea s i n other species th e unfolde d inner mantl e i s th e probabl e respiratory surface . Th e septu m o f Anodontia species, extendin g posteriorl y fro m th e adducto r muscle, further divides off the antero-ventral part of the mantle cavity . The highly plicat e outer fac e of the septu m form s th e respirator y surface . Th e mantle gills of Lucina pensylvanica ar e positione d rather differently an d lie alongside the pallial blood vessel across the mantle. However, X-rays show the life positio n o f thi s specie s oriente d wit h th e anterior en d uppermost an d the hinge lin e vertica l in th e sediment , wit h posterio r tunnel s develope d vertically belo w th e bivalv e (Stanle y 1970) . Thi s probably allows an anterior-posterior separation of the oxygenate d wate r fro m th e interstitia l wate r being drawn in from the posterior. Th e anterior part of th e mantl e o f lucinid s als o ha s t o becom e th e main are a o f particl e sorting , removin g sedimen t particles alon g th e mantl e t o b e expelle d a s pseudofaeces throug h th e posterio r inhalan t aperture. Becaus e a t leas t som e lucinid s ar e partially heterotrophic , foo d particle s ar e passe d along th e surfac e o f th e adducto r muscl e t o th e mouth (Alle n 1958 ; Morto n 1979) . Thus, amongs t lucinids, the relatively enlarged anterio r end of the body, th e elongat e anterio r adducto r muscle , th e dorsal separatio n o f th e muscl e fro m th e lin e o f pallial attachmen t an d th e mantl e gill s ca n al l b e considered a s adaptation s t o th e chemosymbiosi s

220

J. D . TAYLO R & E . A . GLOVE R

enabling th e respirator y an d sulphide-oxidizin g functions t o b e spatiall y separate d withi n th e mantle cavity. Information o n th e lif e habit s o f lucinid s i s summarized diagrammaticall y i n Fig . 1 5 which i s based o n observation s o f Codakia species . Thi s highlights the location o f the respiratory area at the mantle gills in the path of the anterior curren t being drawn dow n the anterio r tube . The ciliate d foo t is active i n tunnellin g i n th e sedimen t belo w th e bivalve an d i n drawin g interstitia l wate r int o th e mantle cavity to the gills. It should be emphasize d that lucinids are diverse in morphology and occupy a wide range of different habitat s so that variations on this schematic model may be expected.

How old is the symbiosis? The pervasivenes s o f th e chemosymbiosi s amon g living lucinid s suggest s tha t th e associatio n wit h chemosynthetic bacteri a ma y b e ancien t an d ancestral t o the family (Rei d & Brand 1986) . I t is also possible , a s suggeste d b y Diste l (1998) , tha t the symbiosi s wa s acquire d late r an d sprea d laterally, wit h non-symbioti c tax a becomin g extinct. There are several approaches to the interpretation

of fossi l lucinid s an d determinin g whethe r the y possessed a chemoautotrophi c symbiosis , non e of which is direct. Thes e method s include th e examination of the association o f lucinids with particular habitats an d co-occurrin g faunas , an d compariso n with Recen t analogues , measuremen t o f th e isotopic signature s i n th e shell s (CoBab e 1991) , study o f symbiosis-associate d morphologica l features o n th e fossil s themselve s and , finally , a phylogenetic approac h whereb y phylogenies o f the bacteria migh t b e tracke d agains t thos e fo r th e bivalves. Fo r th e latte r metho d ther e is , a s yet, no robust phylogenetic framework, either molecular or morphological, fo r the lucinids. Species o f severa l chemosymbiont-bearin g bivalve familie s ar e associate d wit h hydrothermal vents an d cold-see p communitie s (Diste l 1998) . Recent lucinids are not usually associated wit h hot vents bu t the y (usuall y Lucinoma species ) ar e found commonl y i n cold-see p communitie s alon g with th e othe r bivalv e chemoautotroph s Bathymodiolus an d Calyptogena (Callende r & Powell 1997 ; Sibue t & Olu 1998) . This associatio n has bee n recognize d i n th e fossi l recor d fro m th e Mesozoic onwards, e.g. in the Jurassic (Oxfordian) of Franc e (Gaillar d e t al 1992 ; Peckman n e t al 1999); Early Cretaceous (Barremian ) of Greenland

Fig. 15 . Diagram summarizing the life position and major wate r currents of a typical lucinid based on Codakia spp . pbv, Pallia l blood vessel.

ANATOMY O F LUCINIDAE

(Kelly e t al 2000) ; Late Cretaceou s (Campanian ) Tepee Butte s o f Colorad o (Callende r & Powel l 1997; Kauffman e t al 1996) ; Eocene o f California (Squires & Gring 1996 ; Sau l e t a l 1996 ) an d th e 'calcari a Lucina' fro m th e Miocen e o f Ital y (Taviani 1994) . Recent lucinid s ar e als o frequentl y associate d with dysaerobi c habitat s (Bottje r et al 1995 ; Rei d 1998) an d suc h association s ar e als o see n i n th e fossil record (Hickma n 1994) . However, specie s of other bivalves , fro m familie s suc h a s Nuculidae , Mytilidae, Tellinida e an d Cardiidae, whic h d o not possess chemosymbionts , ar e als o ofte n foun d i n such habitats . Th e mer e presenc e o f bivalve s i n palaeohabitats interprete d a s dysaerobi c doe s no t necessarily mea n tha t the y possesse d chemo symbionts an d som e othe r corroborativ e evidenc e is needed. The mos t convincin g evidence fo r th e presenc e of chemosymbiosi s ma y com e fro m th e morphology o f th e shel l an d th e preserve d lif e positions o f the fossil lucinids. Many Cenozoic an d Mesozoic lucinid s ar e simila r t o livin g specie s i n shell morphology , wit h detache d anterio r muscl e scars an d th e trac e o f th e pallia l bloo d vesse l impressed into th e shell , an d th e presen t author s believe that these features indicate that the bivalves were chemosymbiotic . A n interestin g exampl e i s 'Lucind* pandata (Conrad , 1833 ) from th e Eocen e of Alabam a (Fig . 16) , i n whic h ther e i s a lin e o f discrete, claw-like , impression s locate d betwee n the elongat e anterio r adducto r muscl e an d th e pallial line . Thes e impression s ma y represent th e traces of a line of mantle gills similar t o those see n in the living Phacoides pectinatus (Fig . 12) . Although lucinid s ar e muc h mor e divers e an d abundant fro m th e lat e Mesozoi c onwards , the y

Fig. 16 . 'Lucina' pandata (Conrad , 1833) , Eocene, Claiborne Formation, Alabama, USA . BMN H Palaeontology Dept LL26958. Interior o f left valv e showing the lin e o f impressions o f the possible mantl e gills, cf. with Phacoides pectinatus in Fig. 12 .

221

have a long history into the Palaeozoic, possibly t o the earl y Ordovicia n Perio d (Pojet a 1978) . However, a majo r proble m wit h th e Palaeozoi c fossils i s th e actua l recognitio n o f lucinids , sinc e their history and systematics is rather confused and many tax a nee d reinvestigation . Fo r example , Johnston (1993) provides fin e illustration s o f some putative lucinoidean s fro m th e Devonia n o f Australia. Some , suc h a s Paracyclas proavia (Goldfuss 1840) , hav e lucinid-like features with an elongate, bu t no t detached , anterio r adducto r muscle scar . It is difficult t o place thes e fossils and they wer e accommodate d i n a ne w family , Paracycladidae, interprete d b y Johnsto n (1993 ) a s close relative s o f th e Ungulinidae . Despit e th e Ungulinidae being classified within the Lucinoidea, their relationshi p t o th e othe r familie s i s fa r fro m clear an d furthermor e n o evidenc e fo r chemo symbiosis ha s ye t bee n found . Also , Johnsto n & Goodbody (1988 ) illustrat e som e new genera fro m the Devonian of Arctic Canada similar t o Tanaodon which the y als o clai m hav e lucinoidea n features , but again their affinities remain uncertain . Although specie s o f th e Ordovicia n bivalv e Babinka hav e bee n claime d a s earl y lucinoids , o r their direc t ancesto r (McAleste r 1965 ; Pojet a 1978), the evidence i s equivocal an d other authors (Cope 1997 ) regar d th e genu s a s belonging to th e Actinodontoida. McAleste r (1965 ) highlighte d several feature s o f Babinka a s havin g lucinoi d affinities: a n anteriorl y expande d shel l shape ; th e elongate, anterio r adducto r muscle ; a simple , non sinuate pallia l line ; th e typica l lucinoi d hinge , dentition an d ligament . Althoug h th e shel l i s slightly anteriorl y extende d an d somewhat lucinoi d in appearance , McAleste r (1965 ) i n hi s advocac y exaggerated th e degree of elongation o f the anterio r adductor sca r which is, in fact, only slightl y large r than th e posterior . I t i s fel t tha t th e evidenc e connecting Babinka wit h th e lucinoid s i s stil l uncertain. Apart fro m Babinka, th e earlies t bivalv e which can b e confidentl y assigne d t o th e Lucinida e i s Ilionia prisca (Hisinger , 1837 ) fro m th e Siluria n Period (Ludlow ) o f Gotland , Swede n (Liljedah l 1991). This i s a relatively larg e bivalve , c . 65 mm in length . I t i s anteriorl y extende d wit h a large , elongate, anterio r adducto r muscl e whic h i s ventrally detached fro m the pallial line (Fig. 17) . In shape, Ilionia i s simila r t o th e Recen t lucini d Eomiltha voorhoevei (see Olive r 1995 , fig . 1029) . Ilionia ar e preserved i n life position i n a carbonate mud with the hinge line horizontal in the sediment. The onl y othe r commo n bivalv e i n th e habita t i s another likel y chemosymbion t host , th e solemyi d Janeia silurica. Liljedahl (1991, fig. 6b) interpreted Ilionia a s a lucinid wit h an anterior tube excavate d by the foot and an anterior-posterior water current .

222

J. D . TAYLO R & E . A . GLOVER

Fig. 17 . Ilionia prisca (Hisinger, 1837) . Silurian , Gotland, Sweden. BMNH Palaeontolog y Dept PL360. Internal cast , aas, Anterior adducto r scar ; pas, posterior adductor scar ; pi , pallial line .

The large anterior are a lying between the adducto r muscle an d th e pallia l lin e i s interpreted , b y comparison wit h Recen t species , a s th e sit e o f respiration. Th e ciliate d oute r surfac e o f th e adductor would generate the respiratory current and the elongat e muscl e projectin g deepl y int o th e mantle cavit y woul d functio n t o partitio n th e oxygenated wate r fro m th e sulphide-containin g water being drawn into the mantle cavity to the gills by the activity of the foot. Al l the internal features of Ilionia suppor t th e interpretatio n of th e anima l possessing chemosymbionts. The presence o f posterior mantl e fusion forming both inhalan t an d exhalan t apertures , a s i n mos t other heterodon t bivalves , suggest s tha t lucinid s may have originally been shallow burrowing, filter feeders. Rei d & Brand (1986) proposed a scenario whereby acquisitio n o f a loos e symbiosi s wit h sulphide-oxidizing bacteri a ma y hav e encourage d the bivalve s t o burro w mor e deepl y t o acces s sulphides from anoxi c sediment layers. It is known that some , perhap s all , lucinid s acquir e thei r symbionts b y cyclica l transmissio n fro m th e sediment (Gro s e t al 19980 ) an d tha t th e initia l association wa s mos t likel y derive d fro m thi s source. McFall-Ngai (1998) provides a model of an evolutionary progression o f increasing dependence of th e host an d microbia l cells . Bacteri a migh t initially hav e occupie d a superficia l extracellular position o n th e gill s bu t increasin g intimac y wit h the hos t ma y hav e progresse d t o a n intracellula r location wit h coevolved specialize d bacteriocytes . Increasing nutritiona l dependenc e o n th e chemo symbiosis necessitate d a reorganization of th e lif e position o f th e lucinids , wit h th e anterio r venti latory connectio n t o th e surfac e bein g maintaine d by th e elongat e foot . Th e posterio r inhalan t

aperture los t it s functio n a s th e mai n condui t o f water int o th e mantl e cavity . Th e gill s becam e simplified with the loss of the outer demibranch bu t thickened t o accommodat e mor e bacteriocyte s i n the subfilamenta l tissue . Los s o f th e oute r demi branch o f th e gills , th e reduce d labia l palps , th e simple gu t an d th e reversio n t o a n anterior posterior wate r flo w ar e al l likel y paedomorphi c features (Rei d & Bran d 1986 ; Rei d 1990) . Evidence suggests that chemosymbiosis ha s existed in Lucinidae since at least the Siluria n Period, an d accommodation an d morphologica l adaptatio n t o the symbiosi s were responsible fo r majo r changes in bod y organizatio n an d behaviour . Despit e th e probable earl y acquisitio n o f th e chemosyntheti c lifestyle, lucinid s remaine d onl y mino r fauna l constituents unti l th e lat e Mesozoic-Cenozoi c when the y diversifie d alon g wit h man y othe r heterodont clades (Skelton et al 1990) . We than k D . G . Rei d an d P . S . Rainbo w fo r usefu l discussions an d collectio n o f specimens . Thi s wor k i s partially supporte d b y a gran t fro m th e Australia n Biological Resources Stud y (ABRS) .

References ALLEN. J . A. 1958 . On the basic form an d adaptation s t o habitat i n th e Lucinace a (Eulamellibranchia) . Philosophical Transactions of the Royal Society of London, Series B, 241, 421^84. & TURNER , J. F . 1970. The morpholog y o f Fimbria fimbriata (Linne ) (Bivalvia : Lucinidae) . Pacific Science, 24 , 147-154 . ANDERSON, A . E . 1995 . Metabolic response s t o sulfu r i n lucinid bivalves . American Zoologist, 35 , 121-131. BARNES, P . A . G . & HICKMAN , C . S . 1999 . Lucini d bivalves an d marin e angiosperms : a searc h fo r causal relationships . In: WALKER , D . I. & WELLS, F. E. (eds) The Seagrass Flora an d Fauna ofRottnest Island, Western Australia. Wester n Australia n Museum, Perth , 215-238. BERG, C . J . & ALATALO , P . 1984 . Potentia l o f chemosynthesis i n mollusca n mariculture . Aquaculture, 39, 165-179 . ,, CAVANAUGH, C. M. , FELBECK , H. , JANNASCH , H. W . & SOMERO , G . N . 1982 . Possibl e chemoautotrophic nutritio n i n Bahamia n bivalves . In: PRUDER , C . D. , LANGDON , C . & CONCKLIN , D . (eds) Proceedings o f th e 2n d International Conference o n Aquaculture Nutrition. Louisian a State University, Bato n Rouge , 425. BOTTJER, D . J. , CAMPBELL , K , A. , SCHUBERT , J . K . & DROSER, M. L. 1995. Palaeoecological models, nonuniformitarianism, an d trackin g th e changin g ecology of the past. In: BOSENCE , D. W. & ALLISON , P. A . (eds ) Marine Palaeoenvironmental Analysis from Fossils. Geologica l Society , London , Specia l Publications, 83 , 7-26. BRETSKY, S . S . 1970 . Pheneti c an d phylogeneti c classification of the Lucinidae (Mollusca: Bivalvia).

ANATOMY O F LUCINIDAE Bulletin of the Geological Institute of the University of Uppsala, 2 , 5-23 . 1976. Evolutio n an d classificatio n o f th e Lucinidae (Mollusca: Bivalvia). Palaeontographica Americana, 8, 219-337. CALLENDER, W. R. & POWELL, E. N. 1997. Autochthonous death assemblages from chemautotrophic communities a t petroleu m seeps : palaeoproduction , energ y flow an d implication s fro m th e fossi l record . Historical Biology, 12, 165-198 . GARY, S . C . & GIOVANNONI , S . J . 1993 . Transovarial inheritance o f endosymbioti c bacteri a i n clam s inhabiting deep-se a hydrotherma l vent s an d col d seeps. Proceedings o f th e National Academy o f Sciences USA, 90, 5695-5699. , FRY, B., FELBECK , H. & VETTER, R . D. 1989. Habitat characterization an d nutritiona l strategie s o f th e endosymbiont-bearing bivalv e Lucinoma aequizonata. Marine Ecology Progress Series, 55 , 31-45. CHAVAN, A. 1969 . Superfamily Lucinace a Flemin g 1828. In: MOORE , R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6. Bivalvia Volume 2. Geological Societ y o f America an d University of Kansas, Lawrence, KS , N491-N518. COBABE, E. A. 1991 . Detection of chemosymbiosis in the fossil record: the use of stable isotopy on the organic matrix o f lucini d bivalves. In : DUDLEY , E . C . (ed.) The Unity o f Evolutionary Biology. Proceedings o f the Fourth International Congress of Systematic and Evolutionary Biology . Dioscoroides Press, Portland , OR, 669-673. COPE, J . C . W . 1997 . The earl y phylogen y o f th e Clas s Bivalvia. Palaeontology, 40, 713-746. DANDO, P. R., RIDGWAY, S. A. & SPIRO , B. 1994 . Sulphide 'mining' by lucinid bivalve molluscs: demonstrated by stabl e sulphu r isotop e measurement s an d experimental models . Marine Ecology Progress Series, 107, 169-175. , SOUTHWARD , A . J . & SOUTHWARD , E . C . 1986 . Chemoautotrophic symbiont s i n th e gill s o f th e bivalve mollus c Lucinoma borealis an d th e sediment chemistr y o f it s habitat . Proceedings o f the Royal Society o f London, Series B , 227 , 227-247. ,, , TERWILLIGER, N. B. & TERWILLIGER, R . C. 1985 . Sulphur-oxidisin g bacteri a an d haemoglobin in gills of the bivalve mollusc Myrtea spinifera. Marine Ecology Progress Series, 23 , 85-98. DISTEL, D . L . 1998 . Evolutio n o f chemoautotrophi c endosymbioses i n bivalves . Bioscience, 48 , 277-286. & FELBECK, H . 1987 . Endosymbiosis i n the lucini d clams Lucinoma aequizonata, Lucinoma annulata and Lucina floridana : a reexaminatio n o f th e functional morpholog y o f th e gill s a s bacteria bearing organs. Marine Biology, 96, 79-86. DURAND, P , GROS , O. , FRENKIEL , L . & PRIEUR , D . 1996 . Phylogenetic characterizatio n o f sulfur-oxidisin g bacterial endosymbiont s i n three tropica l Lucinida e by 16 S rDNA sequence analysis . Molecular Marine Biology an d Biotechnology, 5, 37-42. DUVERNOY, M . 1854 . Memoires su r l a system e nerveux

223

des mollusques acephales . Memoires de I'Academie des Sciences de I'lnstitut de France, 24, 1-210 FISHER, C . R . 1990 . Chemoautotrophi c an d methano trophic symbiose s i n marine invertebrates . Reviews in Aquatic Sciences, 2, 399-436. FISHER, M . R . & HAND , S . C . 1984 . Chemautotrophic symbionts i n th e bivalv e Lucina floridan a fro m seagrass beds . Biological Bulletin, Woods Hole, 167, 445-459. FRENKIEL, L. & MOUEZA, M . 1995 . Gill ultrastructure and symbiotic bacteria in Codakia orbicularis (Bivalvia, Lucinidae). Zoomorphology, 115, 51-61 . , GROS , O . & MOUEZA , M . 1996 . Gill structur e i n Lucina pectinata (Bivalvia : Lucinidae ) wit h reference to hemoglobin i n bivalves with symbioti c sulphur-oxidising bacteria . Marine Biology, 125 , 511-524. FRETTER, V . & GRAHAM , A . 1954 . Observatioins o n th e opisthobranch mollus c Acteon tornatilis (L.) . Journal of the Marine Biological Association, UK, 33,565-585. GAILLARD, C. , Rios , M. , ROLIN , Y . & Roux, M . 1992 . Fossil chemosynthetic communitie s relate d t o vents and seep s i n sedimentar y basins : th e pseudobioherms o f southeaster n Franc e compare d to other world examples. Palaios, 7, 451^65. GIERE, O . 1985 . Structur e an d positio n o f bacteria l endosymbionts i n th e gil l filament s o f Lucinida e from Bermud a (Mollusca , Bivalvia) . Zoomorphology, 105 , 296-301. GLOVER, E . A . & TAYLOR , J . D . 1997 . New specie s an d records o f Rastafaria an d Megaxinus (Bivalvia : Lucinidae) fro m th e western India n Ocea n an d Red Sea, wit h a reappraisa l o f Megaxinus. Journal o f Conchology, 36 , 1-18 . GROS, O. , DUPLESSIS , M . R . & FELBECK , H . 1999 . Embryonic developmen t an d endosymbion t transmission mod e in the symbiotic cla m Lucinoma aequizonata (Bivalvia : Lucinidae) . Invertebrate Reproduction an d Development, 36, 93-103. , FRENKIEL , L . & MOUEZA , M . 1996 . Gil l ultrastructure an d symbiotic bacteria in the tropica l lucinid, Linga pensylvanica (Linne) . Symbiosis, 20, 259-280. ,& 19980 . Gil l filamen t differentiation and experimental colonizatio n b y symbiotic bacteri a in aposymbioti c juvenile s o f Codakia orbicularis (Bivalvia: Lucinidae) . Invertebrate Reproduction and Development, 34, 219-231. , DURAND , P. , FRENKIEL , L . & MOUEZA , M . 1998fc . Putative environmenta l transmissio n o f sulfur oxidising gill endosymbionts in four tropical lucinid bivalves, inhabitin g variou s environments . FEMS Microbiology Letters, 160, 257-262. HERRY, A . & L E PENNEC , M . 1987 . Endosymbioti c bacteria i n the gill s o f the littora l bivalv e molluscs Thyasira flexuosa (Thyasiridae ) an d Lucinella divaricata (Lucinidae). Symbiosis, 4, 25-36. , DIOURIS , M . & L E PENNEC , M . 1988 . Chemoautotrophic symbiont s an d translocatio n o f fixed carbo n fro m bacteri a t o hos t tissue s i n th e littoral bivalv e Loripes lucinalis (Lucinidae) . Marine Biology, 101, 305-312 HICKMAN, C . S . 1994 . Th e genu s Parvilucina i n th e

224

J. D . TAYLO R & E. A . GLOVER

Eastern Pacific : makin g evolutionar y sens e o f a chemosymbiotic specie s complex . Veliger, 37 , 43-61 JACKSON, J . B . C . 1973 . The ecolog y o f mollusc s o f Thalassia communities , Jamaica , Wes t Indies . 1 . Distribution, environmenta l physiology , an d ecology o f common shallow-water species. Bulletin of Marine Science, 23, 313-350. JANSSEN, H . H . 1992 . Philippine bivalve s an d micro organisms: pas t research , presen t progres s an d a perspective for aquaculture. Philippine Scientist, 29, 5-32. JOHNSTON, P. A. 1993 . Lower Devonian Pelecypoda fro m southeastern Australia. Memoirs o f th e Association of Australasian Palaeontologists, 14, 1-134 . & GOODBODY , Q . H . 1988 . Middl e Devonia n bivalves fro m Melvill e Island , Arcti c Canada . Memoirs of the Canadian Society of Petroleum Geologists, 14(3), 337-345 KAUFFMAN, E. G. , ARTHUR , M. A. , HOWE, B . & SCHOLLE , P. A . 1996 . Widespread ventin g o f methane-ric h fluids i n Lat e Cretaceou s (Campanian ) submarin e springs (Tepe e Buttes) , Wester n Interio r seaway , U.S.A. Geology, 24, 799-802. KELLY, S . R . A. , BLANC , E., PRICE , S . P . & WHITMAN , A . G. 2000. Early Cretaceous giant bivalves from seep related limeston e mounds , Wollasto n Foreland , Northeast Greenland. This volume. KENNICUTT, M. C. , BROOKS, J . M., BIDIGARE, R . R. , FAY , R. R., WADE, T. L. & MCDONALD, T. J. 1985 . Vent type tax a i n a hydrocarbo n see p regio n o n th e Louisiana slope. Nature, 317, 351. KIIASHKO, S . I. , RODIONOV , I . A . & lusHiN , V . V. 1989. Contribution o f symbioti c chemoautotrophi c procaryota t o th e die t o f shallo w wate r lucinacea n bivalves. Doklady Akademii Nauk SSSR, 308(4) , 1021-1023. [in Russian]. KREUGER, D. M., GUSTAFSON, R. G. & CAVANAUGH, C. M . 1996. Vertica l transmissio n o f chemoautotrophi c symbionts in the bivalve Solemya velum (Bivalvia : Protobranchia). Biological Bulletin, 98, 60-65. LE PENNEC, M., BENINGER, P. & KERRY, A. 1995 . Feeding and digestiv e adaptation s o f bivalv e mollusc s t o sulphide-rich habitats . Comparative Biochemistry and Physiology, 111A, 183-189. LILJEDAHL, L . 1991 . Contrastin g feedin g strategie s in bivalve s fro m th e Siluria n o f Gotland . Palaeontology, 34, 219-235. MCALESTER, A . L . 1965 . Systematics, affinities , an d lif e habits ofBabinka, a transitional Ordovician lucinoid bivalve. Palaeontology, 8, 231-246. McFALL-NGAi, M . J . 1998 . Th e developmen t o f cooperative association s betwee n animal s an d bacteria: establishin g detent e amon g domains . American Zoologist, 38, 593-608. MOORE, H . B., DAVIES, L. T., FRASER, T. H., GOLRE, R. H . & LOPEZ, N . R. 1968 . Some biomass figures from a tidal fla t i n Biscayn e Bay , Florida. Bulletin o f Marine Science, 18, 261-279. MORTON, B . 1979 . Th e biolog y an d functiona l morphology o f th e coral-san d bivalv e Fimbria fimbriata (Linnaeus , 1758) . Records of the Australian Museum, 32, 389^20. MORTON, J . E . 1972 . The for m an d functionin g o f th e

pallial organ s i n th e opisthobranc h Akera bullata with a discussion o f the o f the natur e of th e gil l i n Notaspidea an d othe r tectibranchs . Veliger, 14 , 337-349. 1988. Th e pallia l cavity . In : TRUEMAN , E . R . & CLARKE, M . R . (eds ) Th e Mollusca, Volume 11 . Form & Function. Academi c Press , London , 253-286. NARCHI, W . & FARAN I Assis , R . C . 1980 . Anatomia functional d e Lucina pectinata (Gmelin , 1791 ) Lucinidae-Bivalvia. Boletim d e Zoologia Universidade d e Sao Paulo, 5, 79-110. OKUTANI, T . & HASHIMOTO , J . 1997 . A ne w specie s o f lucinid bivalv e (Heterodonta : Lucinidae ) fro m Kanesu-no-Se Bank near mouth of Surga Bay, with a revie w o f th e Recen t specie s o f th e chemosynthetic genu s Lucinoma from Japan. Venus, 56,271-280. OLIVER, P. G. 1986. A new lucinid bivalve from th e Niger Delta an d a n appraisa l o f th e Loripes grou p (Bivalvia, Lucinacea). Basteria, 50, 47-64. 1995. Bivalvia . In : DANCE , S . P . (ed.) Seashells o f Eastern Arabia. Motivat e Publishing , London , 196-281. PECKMANN, J. , THIELE , V , MICHAELIS , W , CLARI , P. , GAILLARD, C. , MARTIRE , L . & REITNER , J . 1999 . Cold see p deposit s of Beauvoisi n (Oxfordian : southeastern France ) an d Marmori o (Miocene : northern Italy) : microbiall y induce d authigeni c carbonates. International Journal of Earth Sciences, 88, 6-75. PELSENEER, P . 1911 . Le s lamellibranche s d e 1'expeditio n du Siboga , parti e anatomique . Siboga Expeditie., Siboga Expedition Monograph, 53a, 1-125. POJETA, J . 1978 . Th e origi n an d earl y taxonomi c diversificatiopn o f th e pelecypods . Philosophical Transactions of the Royal Society of London, Series B, 284, 225-246. REID, R . G . B . 1990 . Evolutionar y implication s o f sulphide-oxidising symbiose s i n bivalves . In : MORTON, B . (ed.) The Bivalvia - Proceedings o f a Memorial Symposium in Honour of Sir Charles Maurice Yonge, Edinburgh, 1986. Hon g Kon g University Press, 127-140 . 1998. Superfamil y Lucinoidea . In: BEESLEY , P . L., Ros s G . J . B . & WELLS , A . (eds ) Mollusca: the Southern Synthesis. Fauna of Australia. Volume 5, Part A . CSIR O Publishing , Melbourne , 309-315. & BRAND , D . G . 1986 . Sulfide-oxidising symbiosi s in lucinaceans : implication s fo r bivalv e evolution . Veliger, 29, 3-24. RODIONOV, I . A . & YUSHIN , V . V . 1991 . Procaryoti c symbionts i n gil l cell s o f th e bivalv e mollus c Pillucina pisidium. Biologiya Morya (Vladivostok) , 1991(1), 39-46 [in Russian]. SAUL, L. R., SQUIRES, R. L. & GOEDERT, J. L. 1996. A new genus of cryptic lucinid ? bivalv e fro m Eocen e col d seeps an d turbidite-influence d mudstone , wester n Washington. Journal of Paleontology, 70, 788-794. SCHWEIMANNS, M . & FELBECK , H . 1985 . Significance of the occurrenc e o f chemoautotrophi c bacteria l symbionts in lucini d clam s fro m Bermuda . Marine Ecology Progress Series, 24, 113-120.

ANATOMY O F LUCINIDAE SKELTON, P. W., CRAME , J . A. , MORRIS , N . J . & HARPER , E. M . 199 0 Adaptive divergenc e an d taxonomi c radiation in post-Palaeozoic bivalves. In: TAYLOR, P. D. & LARWOOD , G . P . (eds ) Major Evolutionary Radiations. Systemati c Association , Specia l Volume, 42, 91-117. SEMPER, K . 1880 . Die Naturlichen Existenzbedingungen der Thiere. F.A. Brockhaus, Leipzig. SIBUET, M . & OLU , K . 1998 . Biogeography, biodiversit y and flui d dependenc e o f deep-se a cold-see p communities a t activ e an d passiv e margins . DeepSea Research II, 45, 517-567. SOUTHWARD, E. C. 1986 . Gill symbionts in thyasirids and other bivalv e molluscs . Journal o f th e Marine Biological Association, UK , 66, 889-914. SQUIRES, R . L . & GRING , M . P . 1996 . Lat e Eocen e chemosynthetic? bivalve s fro m suspec t col d seeps , Wagonwheeel Mountain , Centra l California . Journal o f Paleontology, 70, 62-73. STANLEY, S. M. 1970 . Relatio n of shell form t o life habit s of th e Bivalvi a (Mollusca) . Geological Society o f America Memoir, 125, 1-296. TAVIANI, M . 1994 . The 'calcar i a Lucina' macrofaun a reconsidered: deep-sea fauna l oases fro m Miocene -

225

age col d vent s i n th e Romagn a Apennine , Italy . Geo-Marine Letters, 14 , 185-191. TAYLOR, J . D . & GLOVER , E . A . 1997« . Th e lucini d bivalve genu s Cardiolucina (Mollusca , Bivalvia , Lucinidae): systematics , anatom y an d relationships . Bulletin of the Natural History Museum, London (Zoology), 63 , 93-122. & 1997/7 . A chemosymbioti c lucini d bivalv e (Bivalvia: Lucinoidea ) wit h periostraca l pipes : functional morpholog y an d descriptio n o f a ne w genus an d species . In : WELLS , F . E . (ed. ) Th e Marine Flora and Fauna of the Houtman Abrolhos Islands, Western Australia. Wester n Australia n Museum, Perth, 335-361. & LEWIS , M . S . 1970 . Th e flora , faun a an d sediments o f th e marin e gras s bed s o f Mahe , Seychelles. Journal o f Natural History, 4, 199-220 . TURNER, R . D. 1985. Notes o n mollusks of deep-sea vents and reducin g sediments . American Malacological Bulletin, 1 , 23-34. VETTER, R . D . 1985 . Elemental sulphu r i n th e gill s o f three specie s o f clam s containin g chemautotrophi c symbiotic bacteria : a possibl e inorgani c storag e compound. Marine Biology 88, 33-42.

This page intentionally left blank

Early Cretaceous giant bivalves from seep-related limestone mounds, Wollaston Forland, Northeast Greenland SIMON R. A. KELLY, ERIC BLANC, SIMON P. PRICE1 & ANDREW G. WHITHAM CASP, University of Cambridge, West Building, 181A Huntingdon Road, Cambridge CBS ODH, UK 1 Present address: Shell UK Exploration and Production, 1 Aliens Farm Road, Nigg, Aberdeen AB12 3FY, UK Abstract: Anomalou s mound-formin g limestones , her e terme d th e Kuhnpasse t Beds , occu r within Lat e Barremia n (Earl y Cretaceous ) mudstone s o n Wollasto n Forland , Northeas t Greenland. Th e norma l mudstone s contai n a spars e faun a o f smal l nuculoids , arcoid s an d inoceramids; by contrast, th e mounds contai n an unusual fauna l assembage , dominated by large bivalves. Thes e includ e a n abundan t lucinid , Cryptolucina kuhnpassetensis sp . nov. , and , les s commonly, Solemya, bot h know n seep-associate d genera . Locally , a larg e modiomorphid , Caspiconcha whithami gen . e t sp . nov., i s commo n an d reaches > 30 0 mm in lengt h an d has a shell u p t o 2 8 mm thick . Also , th e wood-borin g bivalv e Turnus i s abundan t i n driftwood . Gastropods ar e rare , bu t th e associate d cephalopo d faun a include s ammonites , belemnites , nautiloids an d a remarkable large orthoconic phragmocone. The form of the mounds wit h calcitecemented tube systems , associate d laminated calcite crusts an d void fills , together with the fauna , is analogou s t o thos e o f methane-base d cold-see p complexes . However , preliminar y studie s indicate tha t muc h o f th e origina l aragoniti c shel l i s no w replace d b y silica . Thi s preclude d conclusive geochemica l studie s based o n the shell s themselves. I t is believed tha t th e mound s formed o n the seafloo r i n a mid- t o oute r shel f situatio n a t the en d o f a period o f extensiona l rifting on the eastern Greenland passive Atlanti c margin . Th e vents occu r near the footwall cres t of a tilted fault block. The underlying fault s ma y have provide d routes or influenced directio n of movement fo r nutrient migration . Source rocks were probably the Late Jurassic blac k shales from depths of < 600-1200 m. If methane was being generated, it was probably forming b y shallowdepth organic breakdown rather than b y thermogenic processes, which require greater burial.

Bivalves fro m deep-se a environment s hav e bee n muc h o f th e Phanerozoi c bac k t o th e Siluria n a t attracting increasing attention since the description least , bu t th e successio n i s incomplet e an d i s of Calyptogena b y Bos s & Turne r (1980 ) fro m patchil y known (Little et al 1999) . Vent-and seephydrothermal vents on the Galapagos Rift. Fauna s relate d faunas ar e not depth related an d are known are known from both hot vents and cold seeps. Hot- fro m environment s ranging from dee p sea (c. 4000 vent fauna s ma y b e associate d wit h variou s m depth; Mayer et al 1988 ) to intertidal (Dando et situations, includin g activ e generativ e plat e a l 1994) . The y ar e no t geographicall y restricte d margins a t mid-ocea n ridge s (Va n Dove r 1985) . an d th e geologica l recor d demonstrate s tha t the y Cold-seep fauna s ar e usuall y associate d wit h hav e occurre d fro m th e Arcti c (Beaucham p & migration o f fluid s o n continental shelve s an d ar e Savar d 1992 ) t o the Antarcti c (Kell y e t a l 1995) . known fro m forear c basin s an d fro m passiv e Th e limite d site s availabl e fo r thei r particula r margins, an d ar e ofte n relate d t o faulting at depth specialize d physiolog y t o functio n als o control s (Peek e t a l 1997) . Methane-see p fauna s ma y b e thei r distribution . Ephemera l chemoautotrophi c associated wit h localize d limeston e cementatio n assemblage s may even develop o n foundered shipand even chimney formation (Kulm & Suess 1990; pin g cargoes (Dand o et a l 1992 ) an d o n recently Campbell & Bottje r 1993 ; J0rgense n 1994) . dea d whal e carcasses (Smit h et a l 1989) , e.g . on Carbonates ma y b e als o associate d wit h sulphat e Oligocen e whal e carcasse s (Squire s e t a l 1991) . reduction fro m hydroge n sulphide . Massiv e Thes e sites are ephemeral and only exist with living sulphide deposit s ar e associate d wit h thei r ow n fauna s whil e th e ke y nutrients , suc h a s hydrogen specialized biota (Little et al 1999) . The geological sulphid e o r methane, are being generated . A s soon history o f vent-related bivalve s i s documented fo r a s the source declines, th e specialized biot a die. From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177 , 227-246 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

228

S. R . A . KELL Y E T AL.

Organisms requir e specia l lifestyle s t o inhabi t seeps. Bivalve s hav e adapte d t o living unde r suc h unusual conditions b y chemosymbiotic associatio n with bacteri a whic h ar e cultivate d o n modifie d gills. In the absence, or decrease in the significance of, filte r feedin g th e gu t ma y becom e reduce d i n lucinids (Rei d & Bran d 1986 ; Taylo r & Glove r 2000). Som e solemyid s ar e completel y gutles s (Cavanaugh 1985) . Ther e ar e tw o principa l chemautotrophic types : th e sulphu r oxidizers an d

the methanotroph s (Childres s e t al 1986) . Adul t bivalves are relatively stati c an d are life dependan t on th e activit y o f th e seep . Specia l reproductiv e strategies mus t b e adopte d fo r surviva l o f thei r species. Ideally, growth to sexual maturity must be rapid in case the seep ceases . Annual shell growth rates of 60 mm a -1 have been recorded (Lut z et al. 1985, 1994) . Th e larva e mus t develo p initiall y under see p condition s an d the n adap t t o norma l marine condition s durin g th e pelagi c dispersa l

Fig. 1 . The location of the Kuhnpasset seeps, (a), Greenland ; (b), easter n Greenland, showing location of Wollaston Forland; (c), detai l of the Kuhnpasset area.

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATE D LIMESTONE MOUND S

phase before seekin g a further seepage to colonize , and i n whic h t o gro w t o adulthoo d (Lut z e t al 1984; Berg 1985) . The initia l fiel d recognitio n o f fossi l methan e seeps ma y b e problematic , especiall y a t lo w latitudes, wher e limestone s ar e norma l shallow water sediments . However , a t hig h latitude s limestones ar e atypical . A t thes e latitude s th e occurrence o f anomalou s localize d limeston e bodies in sediments whic h otherwise sugges t deep water conditions is usually the firs t indicatio n that one i s dealin g wit h a seep . Fo r example , th e 3 m thick limeston e i n th e Fossi l Bluf f Grou p o f Antarctica described b y Kelly et al. (1995) was the only carbonat e be d i n c . 1 km o f forear c basi n clastic deposits . Authigeni c limestone s hav e no t been recorded previously from Cretaceou s rocks in eastern Greenland . However , i t i s onl y b y laboratory base d geochemica l studie s tha t th e methane source can be confirmed. This articl e document s th e discovery , b y Cambridge Arcti c Shel f Programm e (CASP ) geologists, of limestone mounds with an abundant bivalve faun a i n easter n Greenland . Th e sit e a t Kuhnpasset (Fig . Ic ) represent s a see p o f Barremian (Earl y Cretaceous ) ag e i n a passiv e margin situation. The observations made are based upon fiel d sedimentologica l description s an d observations o n th e unusua l bivalves themselves . Initial geochemica l studie s o f th e shell s faile d because of extensive silicification. However, futur e stable isotop e studie s o f th e adjacen t carbonate s should provid e mor e conclusiv e evidenc e o n th e nature of the fluids supportin g th e vent fauna.

General settin g The newl y discovere d limeston e mound s o f th e Kuhnpasset Bed s (Kell y e t a l 1999 ) occur i n a mudstone-dominated succession on the west side of Kuhnpasset, whic h form s th e easter n slope s o f Aucellabjerget, in western Wollaston Forland (Fig s 1-5). Th e mound s ar e distribute d laterall y fo r c . 2 km, a t a n altitud e o f c . 550-65 0 m, alon g th e outcrop o f near-horizonta l strata . Gneissi c Caledonian basemen t lie s a t dept h (Fig . 3) , probably a t abou t se a level , beneat h Kuhnpasset . Gneiss crops out in adjacent area s on the upthrown parts of tilted fault blocks. The basement is overlain unconformably by Middle-Late Jurassic sediments. These, i n turn, are overlai n unconformably by th e marine Wollasto n Forlan d Grou p (Surly k 1978) , which wa s deposite d durin g Volgian-Hauterivia n north-northeast-south-southwest extensiona l fault ing, with lithologies ranging from conglomerates to mudstones with red beds (Surlyk 1977). This dating is base d o n modification s t o th e buchii d bivalv e

229

stratigraphy o f Surly k & Zakharo v (1982) . A mudstone-dominated successio n o f Hauterivian Aptian ag e (N0hr-Hanse n 1993 ; thi s study ) i s overlain by Tertiary plateau basalts (Fig. 5 a and b). Albian strat a ar e know n furthe r eas t i n Wollasto n Forland (Mayn c 1949 ; N0hr-Hansen 1993) . There is no useful formal lithostratigraphy for the post-rif t mudstone-dominated successio n a t Kuhnpasset , although N0hr-Hanse n (1993 , fig . 3 ) use d th e generalized ter m 'mid-Cretaceou s sand y shal e sequence', whic h i s no t satisfactory . Thes e sediments correlat e wit h the fine r graine d part s of the Steensbybjerg Formation o f Hold with Hope to the south (Kelly et al 1998) . Strata her e attribute d t o th e Kuhnpasse t Bed s were first describe d b y Mayn c (1949 , p. 87) , who recognized larg e extremel y fossiliferou s concretions a t a n altitud e o f 550-56 0 m o n th e southeastern slop e o f Aucellabjerget . H e documented an 'Aptian' fauna, including Lytoceras polare Rav n etc., and large white-shelle d bivalve s (?Aucellina sp.) , gastropods an d fossi l woo d i n great quantities . Th e distinctiv e macrofaun a wa s not formall y describe d an d ha s no t bee n studie d until now. Maync's (1949) record of ?Aucellina has not been confirmed .

The sections The two principal stratigraphica l section s contain ing well-expose d Kuhnpasse t Bed s wit h ric h bivalve fauna s ar e show n i n Fig . 2 . I n sectio n B2301 a complet e sectio n throug h th e bed s i s steeply expose d i n a gully , bu t onl y contain s a single limestone mound in vertical section. Sectio n B2335 show s mound s a t differen t height s i n th e section. A single , poorl y exposed , moun d occur s near th e base , bu t a t leas t 2 6 mound s ar e concentrated alon g th e blun t crest o f a ridge (Fig . 4). Other poorer exposure s a t B2296 an d B2297 (Fig. 1) reveal much fragmentary limestone an d bivalv e material weatherin g out , but n o detaile d sectio n measurements were made.

Form and composition of mounds Over 3 0 limestone mound s have been recorde d i n the Kuhnpasse t area s o far (Fig s 1 and 4; Table 1 ) and the y hav e receive d individua l number s fo r recording purposes. Where they are best exposed in section B2335 , th e mounds vary from 1 to 3 m in diameter an d ar e u p t o 1. 8 m i n height . The y ar e subcircular t o subova l i n pla n view . Th e origina l profiles o f mos t mound s hav e bee n modifie d b y Recent erosion and weathering, as well as obscured by downwash . Th e presen t exposure s sho w generally lenticula r t o subconica l profile s wit h fairly fla t base s (Fig . 5c-f) . The y ow e thei r

230 S

. R. A . KELL Y ET AL.

Fig. 2 . Corrélation o f thé principal logge d sections a t Kuhnpasset. For location se e Fig. le .

prominence t o th é cémentatio n o f th é mounds , i n contrast t o th é poorl y cemente d adjacent , norma l mudstones. I n thi s respec t the y ar e simila r t o th é weathered-out carbonate mounds of thé Cretaceous

Teepee Buttes of Colorado (Pett a & Gerhard 1977 ; KmffmmetaL 1996) . The compositio n o f th é mound s i s no t unifor m and their characteristic features are shown in Table

Table 1. Distribution of lithological features an d fossils i n Kuhnpasset limestone mounds

B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 B2335 -BJ335 B2335 B2335 B2335' B2296

mm

i

%• •

2.5x2,5 2.5x3.0

U

to

3a 3b 3c 4 5 6 ?

inc 3.0 x 3.0 inc inc no record s no records

9 10 11 12 13 14 15 16 17 18 19 20

3.0 x 3.0 inc 1.5x1.5 0.3 1.5x2.0 0.8 no record s no records no records 1.Ox . 0 inc 1.Ox . 0 0.4 1.Ox . 0 c. 1. 0 1.Ox . 5 0.8 1.Ox . 5 0.8+ no record s

a

21 22

A

15x15 15x15

28

29

-30-.

P

0-8 0*8

P

P

P

P P

P

LO

no record s 15x25

26 27

P

2.0x3.0

25

inc iiie 2.0 - .

P

P P

P

inc toe

no records

P

inc 1.0 inc inc

iu£: IBC j

23

24

P

P P

P P P P

toe LO

p

P

i

cp p 1 pi

P

P P

pi p, 4

p

i

P

P

p p

P P

-p -

Pc

9

9

P

9

9

p P

11

P

P

p •p

1 i 2

P

P

1

p

pP

1.0 inc

c1

cp

p

c p

c

p

-I

9 o q

-' ' p-- -•-•-— jl

PC

c

i

P;

P

1 1 PP

For location of mounds se e Figs 1 and 4. Numeral, numbe r o f individuals; c , common/abundant; fr, frond; inc, incomplete exposure ; p , present; shaded , bivalv e bearing .

232 S

. R. A. KELL Y ET AL.

Fig. 3 . Simplified geological cross-sectio n o f west Wollaston Forland. Inset shows detail of position o f limestone mounds (circled).

Fig. 4 . Sketch ma p of the field occurrences o f numbered limestone mound s at Kuhnpasset.

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATE D LIMESTON E MOUND S

233

Fig. 5 . Kuhnpasset limestone mounds , (a) General view of the west face o f Kuhnpasset and Aucellabjerget an d (b) sketch of geological interpretation ; (c), view northward across locality B2335 with limestone mound 1 in foreground; (d), detail of shell-rich mound 1 ; (e), oblique view of top of mound 28 at locality B2296, showing cemented vertica l tube at top of seep; (f), lateral surface view of mound 4, locality B2335, showin g vertical cemented tube (arrowed) at base of seep.

1. The mound s themselves are constructed of grey, unbedded, muddy to sandy limestone. Beddin g has been homogenized, probably by burrowing activity. Betweeen th e mound s ar e dar k grey , poorl y consolidated silt y t o sand y mudstones. Withi n th e mounds preferentiall y cemente d tubula r structures commonly occur . The y ar e oblique to subvertical , usually c . 50-100 mm i n diamete r (Fig . 5 e an d f ) and probably represen t th e see p plumbing system . Septarian fracturin g ma y occu r a t th e cor e o f th e mounds. Irregular t o rounded, complex, laminate d carbonate structure s u p t o 30 0 mm i n diamete r occur i n severa l seeps . The y al l hav e a n almos t

blackened exterio r an d ar e partl y pin k o n th e interior. The y sho w comple x growt h histor y wit h laminations usuall y i n the < 1 mm scale , radiaxia l cements an d lat e stag e sparr y calcite . Thes e compare to those illustrated by Campbell & Bottjer (1993, p. 332, fig. 5) and Kelly et al (1995 , p. 278, fig. 6A) . Void s i n som e tubula r structure s an d steinkerns of bivalves usually have a sparry calcite infilling. The fauna within the mounds is preserved uncrushed, while that of the surrounding mudstones is usuall y flattened . Thi s demonstrate s earl y dia genetic cementation within the mounds. The shell s of most of the molluscs represented i n the mounds

234

S. R . A . KELL Y E T AL .

were originall y aragoniti c bu t ar e no w largel y silicified. Thi s alteratio n preclude s geochemica l study o f th e isotopi c composition s o f thes e shells , which coul d hav e establishe d mor e precisel y th e source o f the carbonate . Beneath th e principa l moun d occurrence , i n locality B2335 , i s a level o f regula r subspherical , sideritic(?) 100-15 0 mm concretions, which appear to b e relate d t o horizonta l burrow s o f a Thalassinoides type , becaus e the y occasionall y demonstrate partiall y preserve d Y-shape d branching an d vertical tube s typica l o f that genus . Some burrows show a diameter o f c. 40 mm. Age of the Kuhnpasset Beds Although Maync (1949) ascribed a n Aptian ag e to the strat a her e terme d th e Kuhnpasse t Beds , th e present author s believ e tha t the y ar e Lat e Barremian. Equivalen t mudstone s i n th e adjacen t Cardiocerasdal were regarded a s Aptian-Albian b y Surlyk (1977 , p . 47 , fig . 37) . However , th e limestone moun d level s occu r withi n th e dinoflagellate cyst Pseudoceratium toveae subzon e of the Batioladinium longicornutum zone, which is Late Barremia n i n ag e (N0hr-Hanse n 1993) . Thi s dating is confirmed by CASP's independen t studies on th e dinocyst s (A. M. Korain i pers. comm.) , b y the associate d ammonite s (lytoceratids , Sanmartinoceras, Audouliceras an d Epicheloniceras) (R. Case y an d P . F. Rawson pers . comm. ) an d b y the belemnites (Oxyteuthis} (P . Doyle pers. comm.).

The Lat e Barremia n Kuhnpasse t macrofauna s correlate wit h so-calle d Aptia n fauna s previousl y described fro m Kuh n 0 (B0gva d & Rosenkrant z 1934) an d Stor e Koldewe y (Frebol d 1935 ) [See also lis t o f Donova n (1957 , pp . 208-209) , especially tax a labelle d 'Uppe r Aptian'] . Deshayesitid ammonite s occu r i n th e sandstone s from abov e th e mound-bearin g level s o f Kuhnpasset a t localit y B230 3 (Fig . 5a an d b) an d indicate a n Earl y Aptia n ag e (Kell y & Whitha m 1999).

Fauna of the Kuhnpasset Beds The benthi c faun a o f th e limeston e mound s i s anomalous, bein g ver y loca l i n distribution , bu t very abundant , an d o f a n unusuall y larg e siz e i n comparison t o th e otherwis e undistinguishe d benthos i n adjacent sediments . Within th e mounds, the fauna i s dominated by bivalves, particularly by a larg e lucinid , Cryptolucina kuhnpassetensis sp. nov . (Fig s 6-8) , an d b y a modiomorphid , Caspiconcha whithami gen. et sp. nov. (Figs 9 and 10), whic h i s th e larges t o f the bivalves , reachin g > 300 mm i n lengt h (Appendi x 1) . Commo n driftwood i s presen t wit h abundan t wood-borin g Turnus, i n th e boring s o f Teredolites clavatus Leymerie, whic h ma y b e fortuitousl y associate d with th e seep s (Fig . 11). Al l thes e bivalve s occu r usually in life position . The Cryptolucina an d Caspiconcha are crowde d around the cores of some of the limestone mounds,

Fig. 6 . Cryptolucina kuhnpassetensis sp. nov., reconstruction o f right valve interior base d o n specimens fro m localit y B2335.

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATE D LIMESTONE MOUND S

with Solemya (Fig . 12 ) located les s commonl y i n the oute r part s o f th e mounds . Th e bivalve s ar e locally rock forming (Figs 5c and d and 8) but were present i n onl y 1 1 o f th e 3 2 mound s examine d (Table 1) . Other benthos i n the mounds are rare but include a bathrotomarii d an d a limpet-lik e gastropod. I n addition t o the ammonites mentione d above, othe r cephalopod s occur , includin g th e nautiloid Cymatoceras and a remarkable unidenti fied orthoconi c phragmocone , whic h reache s c . 300 mm i n lengt h an d > 150 mm in diameter , bu t with no evidence for a rostrum. These cephalopod s may represen t activ e predator s an d scavengers , presumably attracte d t o th e ric h faun a o f th e mounds. Lucinids (Figs 6-8) Lucinids ar e well known for their chemosymbioti c association wit h sulphide-oxidizin g bacteri a located o n modifie d gill s (Rei d & Bran d 1986 ; Taylor & Glove r 2000) . Th e grou p ha s a histor y going back at least to the Silurian (Liljedah l 1991) . Cryptolucina kuhnpassetensis occur s i n 1 3 o f th e 30 mounds , usuall y a s paire d valves . Locally , i t forms dens e clusters in lif e positio n (Fig . 8 ) at th e core o f mounds wit h scattere d isolate d valve s an d

235

fragments i n th e vicinity . I t i s referre d t o a n edentulous genus , Cryptolucina, originall y described fro m th e carbonat e mound s o f th e Humptulips Formation , Eocen e o f Washington , western USA (Saul et al 1996) . Lucinids ar e characteristi c o f man y methane seep limeston e mounds . The y ofte n reac h a ver y large size but few are systematically well described . Mesozoic example s include : the Oxfordia n Terre s Noires o f southeaster n Franc e (Roli n e t al . 1990 ; Gaillard e t al 1992) , u p to 14 5 mm in length; th e Tithonian Fossi l Bluf f Grou p o f Antarctica (Kell y et al . 1995) , reachin g onl y 3 0 mm i n length ; possibly th e Lat e Jurassic-Earl y Cretaceou s Knoxville Bed s of California (Sau l et al. 1996); the Hauterivian Lentiles a Peregrinelles of southeastern France (Thieulo y 1972 ; Lemoine e t al. 1982), up to 210mm i n length. Nymphalucina occur s i n th e Campanian Tepe e Butte s o f Colorad o (Pett a & Gerhard 1977 ; How e & Kauffma n 1986) . Sau l e t al. (1996 ) recor d post-Mesozoi c occurrence s o f Cryptolucina. Modiomorphids (Figs 9 and 10) Modiomorphids have a history o f see p associatio n going bac k t o th e Devonia n (Littl e e t al . 1999) .

Fig. 7 . Cryptolucina kuhnpassetensis sp . nov. (a ) and (b) K8394, silicified shel l exterior in right lateral and vertical aspects; (c), K8400 , silicified hinge of right valve and internal mould of left valve ; (d), K8314 , natural internal mould, right valve; (e), K9271 , natural internal mould, right valve.

236

S. R . A . KELL Y ET AL.

bacteria (Cavanaug h 1985) . Th e genu s i s know n from Lat e Jurassi c seep s associated with limeston e mounds i n Californi a (Campbel l & Bottje r 1993) . The Kuhnpassse t specimen s occu r wit h valve s i n occlusion i n lif e position , wit h the lon g axi s i n an inclined position . Specimen s ar e usually c. 50 mm in length an d occur isolated from the main cluster s of Cryptolucina an d Caspiconcha i n th e peripher y of the mounds. The figured specimen demonstrate s a gape in the antero-ventral margin. This specime n also shows an adherent limpet-type gastropod (Fig . 11).

Wood-boring bivalves (Fig. 12)

Fig. 8 . Loose block immediately belo w limestone moun d 7, locality B2335, showing dense i n situ cluste r of Cryptolucina kuhnpassetensis sp . nov.

Caspiconcha whithami gen. et sp. nov. is the largest bivalve from the Kuhnpasse t seeps , havin g a shel l length o f > 300 mm - al l specimens see n wer e of this general size. The species occurred i n six out of the 30 mounds. It was seen in close-packed cluster s at the core of two mounds, with valves in occlusion and havin g th e posterio r directe d obliquel y upwards. Th e elongat e shap e an d ventra l margi n inflexion sugges t that it was byssally attache d lik e a large mussel. Caspiconcha is more rectangular in profile tha n th e larg e vesicomyid , Calyptogena, which occur s i n a numbe r o f Tertiar y a s wel l a s Recent vent sites. Th e maximum dimension o f th e fossil Calyptogena i s also only c. 200 mm, although Recent examples have been collected u p to 400 mm in length (Corlis s & Ballard 1977) .

Solemyids (Fig. 11) Solemya i s wel l know n i n sulphide-ric h environments, occurrin g i n seep s (Kreuge r e t al. 1990), an d is known back to the Devonian (Cox in Cox et al. 1969). Modern Solemya is known to be a symbiont wit h sulphur-oxidizin g chemautotrophi c

Many well-preserve d piece s o f silicifie d wood , showing abundan t Teredolites clavatus Leymeri e borings (Kell y & Bromle y 1984) , occu r i n association wit h th e mounds . Th e boring s contai n Turnus sp. , which is well known as a wood-borin g bivalve i n th e Cretaceou s (Kell y 1988 ) an d i s global i n it s distribution . Th e boring s ar e u p t o 25 mm i n lengt h and 1 2 mm i n diameter , whic h is normal fo r Teredolites clavatus. Th e Turnus shell s occupy about one-third of the length of the borings, which suggest s tha t they were predominantly filte r feeding fro m th e wate r column , althoug h som e wood eatin g an d digestio n ma y als o hav e bee n taking place . Shell s whic h occup y a smalle r proportion o f th e borin g generall y hav e enlarge d guts t o hous e cellulose-digestin g bacteria , typica l of wood-eatin g bivalves . Whil e Turnus i s no t known to be an obligatory vent-inhabitin g bivalve , its preservatio n i n grea t number s her e i s possibl y related to the early carbonate cementing at the seep sites. Awa y from th e seeps , th e woo d woul d hav e undergone rapi d breakdown , an d th e fragil e an d thin shells of Turnus would have been destroyed b y a combination of premortal predation, pre- and post mortem breakdow n o f th e wood , an d post-morta l bioturbation an d diagenesis . Driftwoo d commonly occurs i n marin e sediments , an d ma y trave l grea t distances before becoming waterlogge d an d finall y reaching th e seafloor . Th e associatio n o f commo n bivalve-bored woo d wit h carbonat e mound s i s unusual. However , i t i s als o know n i n th e Lat e Cretaceous o f Vancouve r (P . A . Johnsto n pers . comm.) an d i n th e Tertiar y o f Alask a (K . A . Campbell pers. comm.).

Normal benthos The norma l benthi c faun a o f th e mudstone s adjacent to the seeps contrasts with that of the seeps themselves. Bivalve s ar e uncommon, and typically consist o f smal l nuculacean s an d arcaceans , wit h larger inoceramids . A comparabl e faun a has bee n described fro m th e so-called Aptia n o f Stor e

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATED LIMESTONE MOUNDS

237

Fig. 9 . Sketch reconstruction of Caspiconcha whithami gen. et sp. nov. (a), Right valve, exterior aspect ; (b) , lef t valv e interior aspect ; (c), valves in occlusion, dorsal aspect; (d), vertical section s showin g shell thickness a t sites a-e indicated on (C). Based on specimens from localit y B2335 .

238

S. R . A . KELL Y ET AL

Fig. 10 . Silicified shell s of Caspiconcha whithami gen. e t sp. nov. (a)-(c ) K8318, left valve , in lateral, interior and dorsal aspects, respectively; (d), K8939 , left valve , interior aspect. All specimens from limeston e mound 1 , locality B2335.

Koldewey b y Frebol d (1935) . Th e nuculacean s were deposi t feeders , collectin g organi c materia l from th e sediment ; th e arcacean s wer e likel y byssate filte r feeders . Th e inoceramid , Neocomiceramus subneocomiensis Glazunova , reached a diameter o f c. 15 0 mm; i t was a byssate, or reclining, filter feeder . Discussion

Large size of bivalves

Fig. 11 . Solemya sp . (a) and (b) K9269, natural internal mould in left latera l and dorsal aspects showing attached limpet-type gastropod, limestone mound 8, locality B2335.

The larg e siz e o f th e bivalve s deserve s comment . Cryptolucina reache s 2 6 mm lengt h an d Caspiconcha ove r 30 0 mm, whic h i s th e larges t known modiomorphid species . Normall y thic k and robust shell s indicat e a turbulen t high-energ y environment suc h a s encountere d i n shallow marine conditions, including rocky shore s o r reefs. However, the fine-grained nature of the Kuhnpasset Beds indicates a deeper, lower energy environment . The main reason fo r large siz e is probably the need to produce very large numbers of progeny to ensure successful an d multipl e colonizatio n o f an y othe r newly forme d seep s whic h ma y b e ver y distan t from th e hos t site . Recen t seep-relate d bivalves , such a s vesicomyids , reac h a lengt h o f 40 0 mm (Corliss & Ballar d 1977) . Ber g (1985 ) examine d

EARLY CRETACEOU S GIAN T BIVALVE S FROM SEEP-RELATE D LIMESTON E MOUND S

239

and th e compactnes s o f eac h mound , indicate s continuously activ e seepag e rathe r tha n on e i n which ponding o f gas, suc h as methane a t shallo w depth, erupts and causes pockmark structures, such as tha t whic h occur s toda y i n th e Nort h Se a (Hoviand & Judd 1988 ) o r that which occurred i n the Late Jurassic of Antarctica (Kelly et al. 1995) . There doe s no t appea r t o b e an y evidenc e fo r th e mound formin g a stron g topographica l featur e on the seafloor . I t i s mor e probabl e tha t th e uppe r surface o f th e moun d wa s onl y i n sligh t relief , a s demonstrated in Fig. 13 . In fact , th e term 'mound ' may be a misnomer for these structures, which only take thei r moun d form, standin g i n relief a s relic t features, whe n th e softe r sediment s surroundin g them have been removed . Fig. 12 . Silicified woo d with Teredolites clavatus Leymerie borings occupied by Turnus sp . K8408, limestone mound 7, locality B2335.

the reproductiv e strategie s o f mollusc s fro m hydrothermal vents and observed an unusually high fecundity in modern Calyptogena. This genus has a particularly larg e gonad , producin g copiou s lecithotropic larvae year round, as also recorded by Fiala-Medioni & L e Penne c (1989) . Th e bivalv e may simpl y reproduc e continuousl y becaus e it s food source , chemautotrophi c bacteria , i s alway s available. Wit h no seasonality i n growth, the shell s are free t o grow to large sizes. This also appears to be tru e fo r Mesozoi c brachiopod s (Campbel l & Bottjer 1995) . Therefore , th e larg e size s o f Cryptolucina an d Caspiconcha ma y b e t o house a well-developed gonad . Th e thic k shel l i n Caspiconcha coul d als o hav e deterre d powerfu l predators. On e ma y als o speculat e tha t th e thickness i s a by-produc t o f th e chemosymbioti c processing of large quantities of methane.

Faunal comparison with other seeps Faunally, th e Kuhnpasse t seep s ar e characterize d by larg e specie s o f Cryptolucina, wit h ver y larg e Caspiconcha gen . nov . and norma l size d Solemya occurring les s commonly . Cryptolucina i s particularly important in the Late Jurassic and Early Cretaceous seep s o f southeastern France (Lemoin e et al. 1982 ; Gaillard et al. 1992) . There does see m to be a strong relationship betwee n thi s genu s and methane-seep limestones . Th e presenc e o f

Shape of the limestone bodies The precis e shap e o f limeston e mound s a t Kuhnpasset is difficult t o assess because as soon as the mounds are exposed they are subject to erosion, and boundarie s ar e commonl y covere d b y downwash. However, their physical size and shape appears to be similar to the Late Eocene mounds at Menlo, Washington , describe d b y Goeder t & Squires (1990 ) an d illustrate d b y Campbel l & Bottjer (1993, fig. 9). The pyramidal shape of some Kuhnpasset mound s matche s tha t o f th e slightl y larger mound shown in cross-section (Campbel l & Bottjer 1993 , fig . 6 ) fro m th e Oligocen e Kease y Formation, Oregon . Th e absenc e o f brecciate d fragments o f limestone in the Kuhnpasset mounds,

Fig. 13 . Sketch reconstruction of appearance of a Kuhnpasset seep, cut awa y t o sho w interior. 1 , Cryptolucina kuhnpassetensis sp . nov.; 2, Caspiconcha whithami gen. e t sp. nov.; 3, Solemya sp. ; 4, Turnus sp . in waterlogged drift-wood .

240

S. R . A . KELL Y E T AL .

Caspiconcha i s difficul t t o compar e becaus e i t i s unique. However , a s a probable mussel-typ e habit is envisaged, this may compare with the Modiolusbearing seeps in the Eocene of Washington (Squires & Goeder t 1991) . Othe r Mesozoi c seep s ar e dominated b y brachiopod s wit h subordinat e bivalves suc h a s Grammatodon an d Nucula, a s i n the Albia n o f th e Northwes t Territorie s o f th e Canadian Arcti c (Beaucham p e t al . 1989) . Alternatively, the y ar e gastropo d dominated , a s in the Late Jurassic of the Antarctic (Kelly et al. 1995 ) and th e Mesozoi c o f Californi a (K . A . Campbell , pers. comm.). Brachiopods have not been foun d i n the Kuhnpasse t mound s an d gastropod s ar e uncommon.

Source rock A tota l o f c. 60 0 m o f sedimentar y rock s separat e the Kuhnpasse t Beds fro m th e directl y underlying Caledonian basemen t gneisses , an d laterall y thi s may exten d t o 120 0 m becaus e o f fault-bloc k rotation (Fig . 3) . Th e Kuhnpasse t Bed s li e within mudstones tha t postdat e th e extensiona l faultin g of th e Wollasto n Forlan d Grou p (Volgian Hauterivian). This, in turn, overlies unconformably block-faulted Middl e Jurassi c deposit s whic h res t on th e basement . Th e vent s occu r i n th e footwal l crest o f a tilted faul t block . Th e faultin g probabl y influenced the directio n of upward-migrating fluid and gas . Seepag e a t a lo w rat e throug h th e silt y mudstones durin g th e Lat e Barremia n le d t o th e development o f th e limeston e mound s a t th e sediment-water interface . By Early Aptian time the seepage ha d ceased . Th e sourc e o f th e seepag e probably lies in the breakdown of organic matter in the underlyin g Middl e Jurassic-Earl y Cretaceou s (Hauterivian) strata , i n whic h th e Bjernber g Formation (Oxfordian-Volgian ) dar k shale s ar e well-known a s bein g organi c rich , wit h tota l organic conten t level s o f u p t o 9 % (Pric e & Whitham 1997) . Fo r a furthe r descriptio n an d discussion o f hydrocarbo n source s an d trap s i n eastern Greenland see also Christensen (1994). The source, i f methane , i s unlikel y t o b e thermogeni c because of the relatively shallow depth to basement of 600-1200 m.

modiomorphid, Caspiconcha whithami gen . e t sp . nov., reaches > 300 mm in length and is one o f the larger recorde d vent-relate d bivalves . Thes e tax a occur i n dens e cluster s a t th e cor e o f th e mound s where many are preserved i n life position. Solemya in life position and common waterlogged driftwood infested wit h th e wood-borin g bivalv e Turnus ar e also associate d wit h the mounds. Th e arrangemen t of th e faun a aroun d th e vent s i s reconstructe d i n Fig. 13 . Th e vent s probabl y di d no t cause muc h topographic relie f a t the tim e o f formatio n but ar e today expose d a s mound s becaus e the y ar e mor e cemented tha n adjacen t rocks . Becaus e o f diagenetic silicification of most of the shells , it has not ye t bee n possibl e t o conclusivel y prov e a geochemical associatio n wit h methan e seepag e a t Kuhnpasset, bu t th e lithologica l an d fauna l association make this possibility very likely. Future stable isotop e geochemica l wor k o n th e carbonat e cements should indicate whether the limestones ar e derived fro m methane o r hydroge n sulphide . I t i s believed tha t the source o f the nutrient woul d hav e been fro m th e breakdow n o f organi c matte r i n th e underlying Jurassi c an d Cretaceou s rocks . I f methane i s present , a thermogeni c sourc e i s unlikely becaus e o f th e relativel y shallo w dept h available t o th e sourc e rock . Th e principa l sourc e would probabl y hav e bee n fro m th e organic-ric h shales o f th e underlyin g Bernjer g Formatio n (Oxfordian-Volgian). Th e nutrien t probabl y migrated alon g faulte d o r fault-relate d surface s which forme d durin g Volgian-Hauterivia n exten sional rifting , reachin g th e surfac e o f a tilted faul t block by seepage i n the Late Barremian. The author s than k th e following : th e consortiu m o f companies whic h supporte d th e CAS P Eas t Greenlan d Project; D . Pedersen (Iceland ) fo r assistanc e i n the field ; K. A. Campbell (Universit y o f Auckland, Ne w Zealand) , J. A. Crame (Britis h Antarcti c Survey , Cambridge ) an d L. R. Saul (Natural History Museu m o f Los Angeles County , California) fo r constructive criticis m o f early draft s of the article; T. Waller, J. Pojeta (USGS), N. J. Morris, J. Taylor (The Natura l Histor y Museum , London ) an d N. Malchu s (Berlin) fo r discussio n o f th e bivalves ; R . Case y (Th e Natural Histor y Museum , London ) an d P . F . Rawso n (University College , London ) fo r discussio n o f th e ammonites; A . M . Korain i (Petronas , Malaysia ) fo r dinoflagellate cys t dating ; an d P . Doyl e (Greenwic h University) fo r discussion o f the belemnites.

Conclusions Anomalous limeston e mound s occu r wit h a n abundant, thick-shelled, bivalve-dominated benthi c fauna i n th e Kuhnpasse t Beds i n a relatively low energy depositiona l environment . Th e bivalve s include especially abundan t and large Cryptolucina kuhnpassetensis sp . nov. , whic h i s th e mos t characteristic genu s i n th e mounds . Th e gian t

Appendix 1 : systematic description s of bivalves Simon R. A. Kelly All describe d specimen s ar e fro m th e 'mid-Cretaceou s sandy shales' , locality B233 5 (Fig. 1 ) on the wes t sid e of Kuhnpasset, Wollasto n Forland , Northeas t Greenland .

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATE D LIMESTON E MOUND S The describe d specimen s hav e been transferre d fro m th e CASP Collection s t o th e Sedgwic k Museum , Universit y of Cambridg e wher e X-prefixe d number s ar e allocated . CASP and the corresponding Sedgwic k Museum numbers are listed i n Appendix 2. Family Lucinidae Fleming 182 8 Subfamily Milthinae ? Chava n in Cox et al 196 9 Genus Cryptolucina Sau l et al. 199 6 Type species. Cryptolucina megadyseides Sau l e t al . 1996, fro m th e Humptulip s Formation , middle-Lat e Eocene, o f Gray s Harbour County , Washington, western USA. Diagnosis. Larg e thick-shelled lucinid lacking differenti ated antero-dorsa l an d postero-dorsa l areas , wit h commarginal ornamen t ove r whol e flan k an d trace s o f radial ornament in the mid-flank. Interior usuall y smooth to pustulose, sometimes showin g fine radial traces. Hinge strong bu t edentulous . Anterio r adducto r muscl e scar s large and elongate. Remarks. Sau l e t al . (1996 ) place d Cryptolucina wit h some doubt in the Subfamily Milthinae (Chavan in Cox et al. 1969) . However , th e Miltha lineag e itsel f i s characterized b y a well-develope d hing e an d dentitio n (Bretsky 1976 , fig . 6) . Severa l lucini d gener a ar e edentulous, such as Anodontia, Myrteopsis an d Stewartia, but the y hav e mor e differentiate d antero-dorsa l an d postero-dorsal regions . Pseudomiltha (Fische r 1887) , from th e Eocene o f France, has a discoidal shell , obsolete dentition an d show s stron g fin e radia l ornamen t o n th e exterior and a distinct pallial blood vesse l scar (Chavan in Cox e t al . 1969) . I n th e presen t study , th e edentulou s condition i s see n i n al l mediu m t o larg e siz e specimen s but ther e ar e no smal l individual s that can be checked t o show whethe r thi s conditio n exist s throughou t life . I t i s possible tha t th e youn g specimen s ma y demonstrat e dentition whic h become s obsolet e i n adults , bu t thi s cannot b e verifie d a t present . Cryptolucina i s slightl y elongate an d it s genera l externa l for m i s ver y clos e t o Nymphalucina (Spede n 1970) , whic h ha s a well developed dentition an d occurs i n seep limestones (Petta & Gerhar d 1977) . A numbe r o f elongat e lucinid s ar e recorded in the literature but few have proper description s including th e shel l interio r an d hinge . The y include : 'Lucina' colusaensis Stanto n (1895 , p . 60 , pi . 11 , figs 4 and 5) , fro m th e Lat e Jurassi c an d Earl y Cretaceou s Knoxville Beds, California, USA; specimens identified as an undetermine d lucinacea n fro m th e Oxfordia n o f th e Terres Noires, Drome, France (Roli n et al. 1990 , fig . 6a); and a n undescribe d specie s fro m th e Tithonia n o f th e Antarctic Peninsul a (Kell y e t al . 1995) . Whil e som e o f these tax a may eventuall y prove to be Cryptolucina, the Greenland materia l describe d her e represent s th e oldes t known example of the genus. Included taxa. Cryptolucina elassodyseides Sau l e t al . and C . megadyseides Sau l e t al . (1996) , Eocene , Washington State , USA ; C . kuhnpassetensis sp . nov. , Barremian o f northeas t Greenland ; possibl y als o unidentified lucinid s fro m Oxfordia n o f Franc e an d Tithonian of Antarctica.

241

Cryptolucina kuhnpassetensis sp. nov. (Figs 6-8) Type specimens. Holotype : K8400 ; paratypes : K8314 , K8315, K8393 , K8394 , K8395 , K8398 , K8399 , K8401 , K9271.K9272, K9273 . Description. Medium-larg e size d lucinid , u p t o c . 130 mm in length , slightl y mor e elongate than high , an d of moderat e inflation ; sub-ovat e i n latera l aspec t wit h weakly projecting prosogyrate umbone s and small beaks ; beak an d umb o no t coincident ; evenl y rounde d anterio r margin an d slightl y truncate d posterior. Smal l lanceolat e and shallo w lunule , wit h bea k slightl y overhangin g proximal end . Elongate , sharp-edged , lanceolat e escutcheon. Flan k ornamen t o f fin e commargina l growt h lines; posterior are a not differentiated, apart from slightl y increased curvatur e o f th e growt h line s a t th e postero ventral margin; ver y wea k radial ribbin g visibl e betwee n umbo and mid-flank on some specimens . Interio r smoot h with fin e radia l striae ; large r specimen s ofte n coarsel y pustulate. Adductor muscle scars lightly impressed, ofte n showing radial stria e simila r to elsewhere o n the interior ; anterior adducto r muscle sca r larg e an d elongate , an d separated fro m th e distinc t integripalliat e pallia l line ; posterior adducto r muscl e sca r sub-pyriform . Peda l elevator muscl e unde r hinge , immediatel y behin d bea k and below umbo. Pallial blood vessel scar not seen. Hinge plate well-develope d (onl y see n clearl y i n holotype , lef t valve, Fig . 7d , an d K8315 ) bu t edentulous ; nymp h elongate extendin g almos t whol e lengt h o f escutcheon . Ventral margi n smooth , bu t slightl y thickene d betwee n margin and pallial line . Dimensions. Specimen Heigh t Lengt h Lengt number (mm ) (mm ) posterio K8314 K8392 K8393 K8394 K9395 K9398 K9399 K8400 K9271 K9272

98 60 92 71 67 85 86 c. 95 63

115 97 114 _ 74 86 102 112 c. 12 9 75

74 60 58 _ 40 50 55 78 92 54

h Widt h r (mm ) (mm )

51*t 40* 50* 46* 33* 40*t 36*t 26 30f 33*t

*, Two valves; f , interna l mould .

Remarks. Cryptolucina kuhnpassetensis i s not as large as the type species, C. megadyseides, whic h reaches 180 mm in length and is characterized b y a more indented lunular margin. C . elassodyseoides (Sau l e t al . 1996 ) i s mor e elongate, havin g a straigh t t o slightl y indente d ventra l margin. Interna l mould s o f C . kuhnpassetensis compar e closely t o specimen s figure d a s 'Bivalvi a gen . indet.' b y Thieuloy (1972, pi. 1 , fig. 10; pi. 2, fig. 6; pi. 3, fig. 1) and identified a s Pseudomiltha aff . germaini (Picte t & Campiche 1864 ) by Lemoine e t al. (1982), which reaches 210mm i n lengt h bu t ha s a mor e rounde d posterior . However, the dentition of the type and other specimens of P. germaini is unknown.

242

S. R . A . KELL Y E T AL.

Subclass Anomalodesmat a Dall 188 9 Order Pholadomyoida Newel l 196 5 Superfamily Modiomorphoide a Miller 187 7 Family Modiomorphidae Miller 187 7 (= Permophoridae Van de Poel 1959 , pro Pleurophorida e Dall 1895 ) Subfamily Myoconchina e Newell 195 7 Genus Caspiconcha nov.

the beaks are located wel l to the anterior in Pleurophopsis, they d o no t overhan g th e anterio r adducto r sca r a s i n Caspiconcha. Range. Barremia n of northeast Greenland .

Caspiconcha whithami sp. nov. (Figs 9 and 10)

Etymology. Derive d fro m th e Cambridg e Arcti c Shel f Programme (CASP ) an d concha, th e lati n fo r a shel l (feminine).

Etymology. Afte r A . G . Whitham , wh o discovere d th e first specimen s an d ha s bee n th e leade r o f th e CAS P expeditions to eastern Greenlan d sinc e 1990 .

Type species. Caspiconcha whithami sp . nov.

Type specimens. Holotype : K831 8 (Fig . lOa-c) ; paratypes: K8319 , K8433 , K8434 , K8435 , K8439 , K8440, K8442, K8443, K8447, K9276.

Remarks. Th e only Cretaceous bivalve tha t Caspiconcha gen. nov . resemble s i s Myoconcha, sharin g th e modioliform shape, extreme reduction of the shell anterior and the deep set adductor muscle scars, and differing fro m it i n th e lac k o f externa l radia l ornamen t an d th e edentulous hinge. The Myoconchinae and Permophorina e were unite d i n th e Famil y Permophorida e whic h wa s placed i n the Carditacea by Chavan (in Cox et al 1969 , p. 543). However , Morri s (1978 , p . 273 ) believe d tha t th e Permophoridae wer e not carditaceans becaus e o f the pre sence of homogeneous shel l structure in permophorids, as opposed t o crossed lamell a an d complex crosse d lamell a shell structur e in carditoideans . Fan g Zong-ji e & Morri s (1997) synonymise d th e Permophorida e i n th e Modiomorphidae an d place d i t i n th e Subclas s Anomalodesmata. Despit e th e shell s o f Caspiconcha having bee n secondaril y replace d b y silica , th e origina l structure woul d hav e bee n aragonite . N . Malchu s (pers . comm.) believe d tha t th e shel l o f th e typ e specime n showed relic t nacreou s texture , whic h support s th e placement of Caspiconcha in the Anomalodesmata . Little e t al . (1999 ) describe d a Middl e Devonia n modiomorphid, Sibaya, from sulphid e ore deposits o f the Ural Mountains , Russia, thus demonstratin g a long-term association o f the modiomorphids with vent communities since the Palaeozoic. Caspiconcha is known only from the type specie s whic h occur s i n limeston e mound s o f Kuhnpasset. However , preliminar y observation s o n undescribed specimens fro m th e Raukumar a Peninsula , New Zealand , i n th e McKa y Collectio n (Institut e o f Geological & Nuclea r Sciences , Wellington , Ne w Zealand; J . S . Crampton , pers . comm.) , indicat e tha t a similar o r relate d larg e thick-shelle d bivalv e ma y hav e existed i n th e Lat e Cretaceou s (?Campanian Maastrichtian). Caspiconcha contrast s wit h a numbe r o f othe r modioliform an d othe r larg e vent-relate d bivalves . Th e mytilid, Bathymodiolus (Ken k & Wilson 1985 ) is calcitic and has a thin shell with a completely differen t hinge . The elongate aragonitic vesicomyid, Calyptogena (Dal l 1891) , has a heterodont dentition , a more rounded outline , an d a thinner an d les s attenuate d shel l anterior . Anothe r vesicomyid, Pleurophopsis (Va n Winkle 1919) , fro m th e Oligocene o f Trinidad, has deep-set adductor muscle scars with a n anterio r myophori c buttress , a well-develope d pair o f cardina l teet h i n eac h valv e an d a weak , bu t integripalliate, pallia l line . I t wa s describe d b y Kee n (i n Cox e t al . 1969 , p . 664 ) a s havin g a 'flang e abov e th e anterior adducto r scar'. This structur e could be analogous to the caspiconchid proces s (Fig s 9 b an d lOd) . Although

Description. Shel l larg e an d elongate , subtrapezoida l o r cuneiform t o modiolifor m i n latera l aspect , wit h wea k posterior carin a an d moderat e inflatio n wit h slightl y flattened flanks; c. 300 mm in length, c. 12 0 mm in height and c . 75 m m i n widt h (valve s in occlusion) . Equivalve , with strongly inequilateral valves. Beaks close t o anterior and situate d in fron t o f the anterio r adducto r muscl e sca r and belo w th e hing e lin e i n matur e specimens . Umb o flush wit h dorsa l margin . Shel l thicknes s variable , u p t o 28 mm thic k a t myophori c buttress , tendin g t o b e thic k around dorsal, anterior and ventral margins, and thinner at mid-flank; earl y forme d shel l becomin g partiall y enveloped withi n late r shel l growth . Dorsa l margi n straight i n lateral profil e for th e lengt h o f the nymp h and feebly curve d toward s th e posterior ; ventra l margi n weakly indented, probably fo r byssal attachment; anterio r margin shor t an d rounded ; posterio r margi n probabl y rounded - obliquel y truncated . Shel l onl y moderatel y inflated in dorsal aspect with bluntly rounded anterior and wedge-shaped posterior. Exterio r ornamen t commarginal , blunt i n mid-flan k t o slightl y lamellos e a t periphery . A change i n preservatio n fro m whit e inne r shel l t o brow n outer shel l ma y reflec t existenc e o f a well-develope d periostracum. Interio r smooth , excep t tha t th e mid-flan k area i s pitte d wit h smal l mantl e muscl e scars . Adducto r muscle scar s ver y deepl y inse t (Fig . lO a an d d) ; pallia l line marke d b y obliqu e ro w o f elongat e pit s fro m posterior adducto r muscl e sca r i n a postero-ventra l direction, before swingin g upwards in a more continuous line t o th e posterio r adducto r muscl e scar . Anterio r adductor sca r oval , deepl y se t o n dorsa l sid e t o shallo w along ventra l sid e ove r myophori c buttress ; floo r o f sca r showing ver y fine commargina l ornamen t an d fine radia l striae, i n whic h u p t o fou r stronge r radia l ribs ar e see n towards the postero-dorsal part ; postero-dorsal portio n of scar abut s onto base o f hinge plate, bu t dorsa l t o anterio r border overgrown by a recurved pointed area , here termed the caspiconchii d proces s (Fig s 9 b an d lOd) ; caspiconchiid proces s continuou s wit h mai n interio r o f shell; the ventral part of the caspiconchiid process having a numbe r o f irregula r pits , includin g a grou p o f large r ones at the posterior (belo w the point) and a larger are a of smaller pits to the anterior. Posterior adducto r muscle scar less deepl y inse t tha n anterio r one ; subquadrate , havin g panhandle shape at the antero-dorsal corne r at conjunction with posterior pedal retractor muscl e scar. Hinge stout but edentulous (Fig s 9b , lO a and d) , wit h ver y lon g straigh t nymph an d ligamen t groov e (Fig . lOc ) o n dorsa l sid e

243

EARLY CRETACEOU S GIANT BIVALVES FRO M SEEP-RELATED LIMESTONE MOUNDS supporting th e exterio r ligament . Resilife r obliquel y triangular an d elongat e wit h pointed anterio r en d belo w beak and greatest widt h immediately posterio r t o anterior adductor muscl e scar , taperin g gentl y posteriorl y an d terminating wel l befor e th e nymph . Th e earlie r forme d part o f th e shel l show s exfoliation ; trace s o f fin e radia l striae present in mid-flank areas lacking outer surface. Dimensions. Specimen Lengt h Lengt h Lengt h Heigh t Widt h number (mm ) (posterior ) (anterior ) (mm ) (mm) (mm) (mm )

K8318 K8319 K9276

c. 250 c. 220

c. 300

-

30 36 -

c. 108 38 c. 116 30

situated nea r th e centr e o f th e ventra l margi n i s a hemispherical-based borin g c. 1.5 mm deep into the shell, which is c. 1 1 mm in thickness .

Appendix 2: CASP and corresponding Sedgwick Museum catalogue numbers . Taxon

CASP number

Sedgwick Museum number

K8318 K8319 K8433 K8835 K8439 K8440 K8442 K8443 K8447 K9276

X30000 X30001 X30002 X30003 X30004 X30005 X30006 X30007 X30008 X30009

K8314 K8315 K8392 K8393 K8394 K8395 K8398 K8399 K8400 K8401 K9271 K9272 K9273

X30010 X30011 X30012 X30013 X30014 X30015 X30016 X30017 X30018 X30019 X30020 X30021 X30022

Solemya sp .

K9269

X30023

Turnus sp . in borings of Teredolites clavatus Leymerie

K8408

X30024

Caspiconcha whithami gen. et sp. nov.

110 72*

*, Two valves. Remarks. N o complet e valve s wer e collected . Th e mos t complete valve is that of the holotype, K8318, a left valve missing substantia l portions o f the posterior an d postero ventral margins. A paratype , K9276 , show s valve s i n occlusion but is missing parts of the shell, especially at the anterior an d posterio r ends . Precis e informatio n ha s no t been obtained for the morphology of the shell posterior t o the posterio r adducto r sca r bu t ha s bee n piece d togethe r from collecte d fragment s (Fig. 9). The relativel y smal l siz e o f th e shel l anterio r ma y indicate tha t th e siz e o f th e foo t i s relatively smal l (thus indicating a sedentary lifestyle). The presence of a weakly modioliform shap e with ventral indentation ma y indicate the presenc e o f a byssu s i n th e adult . Th e ver y larg e posterior t o th e shel l ma y hav e bee n fo r th e housin g o f modified gills for bacterial farming. It is likely that the gut was reduce d o r absent , a s i n chemosymbiotic-relate d bivalves. The strong adductor musculature may have been for protectio n fro m crustacea n an d mollusca n predators . The heav y degre e o f growt h aroun d th e hing e o f Caspiconcha ma y mea n tha t th e edentulou s stat e i s a secondary featur e which developed fro m a juvenile with hinge dentitio n bu t whic h became obsolet e i n th e adult ; however, this idea remains unproven . Irregularities i n growth lines an d evidenc e o f recovery from shel l damage , especiall y a t th e commissura l margins, durin g lif e ar e presen t i n severa l specimens . These structure s may be related t o shel l crowding within the seep or to predation. In K9276, ther e is a large lateral displacement o f th e commissura l margi n affectin g th e symmetry o f th e valves . On e ma y speculat e tha t thi s i s close t o the position wher e a byssus may be expected t o emerge, o r th e poin t a t whic h tw o individua l specimen s came i n contact withi n the seep but were unable t o move apart, henc e causin g growt h irregularity . Th e interio r surface o f the type specime n show s evidence o f irregular vermiform grooves , c . 1. 5 mm wide an d up t o 5 1 mm in length, an d wit h a semi-lunula r cross-section . Thei r position an d cross-section suggests tha t these were cause d by vermifor m organisms , presen t betwee n th e shel l interior an d the mantle, an d which perhaps wer e passiv e borers, inhibitin g shel l depositio n (Fig . lOa) . Thes e structures ar e analogou s t o thos e forme d durin g bioimmuration (Tod d 1993), but may have been caused by a burrowing organism moving between the mantle and the shell. A singl e exterio r borin g o n th e sam e specimen ,

Cryptolucina kuhnpassetensis sp. nov.

References BEAUCHAMP, B . & SAVARD , M . 1992 . Cretaceou s chemosynthetic carbonat e mound s in the Canadia n Arctic. Palaios, 7(4), 434-450. , KROUSE, H. R., HARRISON , J . C., NASSICHUK, W. W. & ELIUK , L . S . 1989 . Cretaceou s cold-see p communities and methane-derived carbonate s i n the Canadian Arctic. Science, 244, 53-56. BERG, C. 1985 . Reproductive strategie s o f mollusks fro m abyssal hydrothermal vent communities. Bulletin of the Biological Society of Washington, 6, 185-197 . B0GVAD, R . & ROSENKRANTZ, A . 1934 . Beitrag e zu r Kenntnis de r unter n Kreid e Ostgronlands . Meddelelser om Gr0nland, 93(1), 1-28 . Boss, K. J. & TURNER, R . D. 1980 . The giant white clam from th e Galapago s Rift , Calyptogena magnifica species novum . Malacologia, 20, 161-194 . BRETSKY, S . S . 1976 . Evolution an d classificatio n o f th e

244

S. R . A . KELL Y E T AL.

Lucinidae (Mollusca; Bivalvia). Palaeontographica Americana, 8(50), 215-337. CAMPBELL, K . A . & BOTTJER , D . J . 1993 . Fossil col d seeps. National Geographic Research an d Exploration, 9(3) , 326-343. & 1995 . Brachiopod s an d chemosymbioti c bivalves in Phanerozoic hydrothermal vent and cold seep environments. Geology, 23(4), 321-324 . CAVANAUGH, C. M. 1985 . Symbioses of chemoautotrophi c bacteria an d marin e invertebrate s fro m hydrothermal vent s an d reducin g sediments . In : JONES, M . L . (ed. ) The hydrotherma l vent s o f th e eastern Pacific : a n overview . Bulletin o f th e Biological Society of Washington, 6, 373-388. CHILDRESS, J. J., FISHER, C . R., BROOKS, J. M., KENNICUTT II, M. C., BIDIGARE, R. R. & ANDERSON, A. E. 1986. A methanotrophi c marin e mollusca n (Bivalvia : Mytilidae) symbiosis : mussel s fuele d b y gas . Science, 233, 1306-1308 . CHRISTENSEN, F . G . 1994 . Seep s an d othe r bitume n showings: a revie w o f origin , nomenclatur e an d occurences i n Greenland . Gr0nlands Geologiske Unders0gelse, Open File Series, 94/7, 1-21. CORLISS, J. B. & BALLARD, R. D. 1977. Oases of life in the cold abyss. National Geographic Magazine, 152(4) , 440-453. Cox, L . R. , NEWELL , N . D. , BOYD , D . W . ET AL. 1969. In: MOORE, R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Volume 1, Part 2. Mollusca 6, Bivalvia. Geologica l Societ y o f Americ a an d University of Kansas, Boulder, N491-N952. DALL, W . H . 1889 . On th e hing e o f pelecypod s an d it s development, wit h a n attemp t towar d a bette r subdivision o f th e group . American Journal o f Science, 38, 445-462. 1891. O n som e ne w o r interestin g wes t America n shells obtaine d fro m th e dredgings o f the U.S. Fish Commission steame r Albatros s i n 1888 , and fro m other sources . Proceedings o f th e United States National Museum, 14 , 173-191. 1895. Tertiar y mollusk s o f Florida . Par t 3 . A ne w classification o f th e Pelecypoda . Transaction of th e Wagner Free Institute o f Science, Philadelphia, 3 , 483-565. DANDO, P . R . & HOVLAND , M . 1992 . Environmenta l effects o f submarine seeping natural gas. In: DAVIES , A. M . (ed. ) Methan e i n marin e sediments . Continental Shelf Research, 12(10) , 1197-1207. , O'HARA , S. C . M., NlVEN, S. J., SCHMALJOHANN , R.,

SCHUSTER, U. & TAYLOR , L. J . 1994 . The effect s o f methane seepag e a t a n intertidal/shallo w subtida l site o n th e shor e o f th e Kattegat , Hedestrand , Vendsyssel, Denmark . Bulletin o f th e Geological Society o f Denmark, 41(1) , 65-79. , SOUTHWARD , A. J. , SOUTHWARD , E. C. , DIXON , D . R., CRAWFORD , A . & CRAWFORD , M . 1992 . Shipwrecked tube worms. Nature, 356, 667. DONOVAN, D . T . 1957 . Th e Jurassi c an d Cretaceou s systems i n Eas t Greenland . Meddelelser o m Gr0nland, 155(4), 1-214 . FANG ZONG-JI E & MORRIS , N . J . 1997 . Th e genu s Pseudosanguinolites an d som e modiolifor m bivalves (mainl y Palaeozoic) . Palaeoworld, 7 , 49-74.

FIALA-MEDIONI, A . & L E PENNEC , M . 1989 . Adaptiv e features o f bivalv e mollusc s associate d wit h flui d venting i n th e subductio n zone s of f Japan . Palaeogeography, Palaeo climatology and Palaeoecology, 71 , 161-167 . FISCHER, P . H . 1887 . Manuel d e conchyliologie e t d e paleontologie conchy Ho gique. Pt 3. Classe des pelecypodes. F . Savy, Paris. FLEMING, J. 1828 . A History o f British Animals, Exhibiting the Descriptive Characters and Systematical Arrangement of the Genera and Species of Quadrupeds, Birds, Reptiles, Fishes, Mollusca and Radiata of the United Kingdom; Including the Indigenous, Extirpated, and Extinct Kinds; Together with Periodical an d Occasional Visitants. Bel l & Bradfute, Edinburgh . FREBOLD, H . 1932 . Di e Lagerungsverhaltniss e de r Unterkreide im nordlichen teil von Ostgronland und die Frage der Pratertiaren Fjordanlage. Meddelelser om Gr0nland, 84(6), 1-40 . 1935. Marine s Aptie n vo n Koldewe y Inse l (nordliches Ostgronland) . Meddelelser o m Gr0nland,95(4}, 1-112 . GAILLARD, C. , Rio , M . & ROLIN , Y . 1992 . Fossi l chemosynthetic communitie s relate d t o vent s o r seeps in sedimentary basins : the pseudobioherms o f southeastern Franc e compare d t o othe r worl d examples. Palaios, 7(4), 451^-65. GOEDERT, J . L . & SQUIRES , R . L . 1990 . Eocene deep-se a communities i n localise d limestone s forme d b y subduction-related methan e seeps , southwester n Washington. Geology, 18 , 1182-1185. HOVLAND, M . & JUDD , A . G . 1988 . Seabed Pockmarks and Seepages. Impact on Geology, Biology and the Marine Environment. Graha m & Trotman , London. HOWE, B . & KAUFFMAN , E . G . 1986 . Th e lithofacies , biofacies an d depositiona l settin g o f tepe e buttes , Cretaceous submarin e springs , betwee n Colorad o Springs and Boone, Colorado. In : KAUFFMAN , E. G. (ed.) Cretaceous Biofacies of the Central Part of the Western Interior Seaway: A Field Guidebook. Th e 4th Nort h America n Paleontologica l Convention , Boulder, 155-175 . J0RGENSEN, N . O . (ed. ) 1994. Gas i n Marine Sediments, 2nd Conference. Bulleti n o f the Geological Societ y of Denmark, 41(1), 1-109 . KAUFFMAN, E. G. , ARTHUR , M. A. , HOWE, B. & SCHOLLE , PA. 1996 . Widesprea d ventin g o f methane-ric h fluids i n Lat e Cretaceou s (Campanian ) submarin e springs (Teepe e Buttes) , Wester n Interio r seaway . Geology, 24, 799-802. KELLY, S . R . A . 1988 . Cretaceous wood-borin g bivalve s from wester n Antarctic a wit h a revie w o f th e Mesozoic Pholadidae . Palaeontology, 31(2) , 341-372, pis 26 and 27. & BROMLEY, R. G. 1984 . Ichnological nomenclature of clavate borings. Palaeontology, 27(4) , 793-807 . & WHITHAM , A . G . 1999 . Deshayesitid ammonite s from th e lowe r Aptia n (Lowe r Cretaceous ) o f North-East Greenland . Scripta Geologica, Special Issue, 3, 83-95. , BLANC , E. , PRICE , S . P . & WHITHAM , A . G . 1999. Giant bivalves from a Barremian (Early Cretaceous)

EARLY CRETACEOU S GIAN T BIVALVE S FRO M SEEP-RELATE D LIMESTON E MOUND S

seep system in Wollaston Forland. Palaeontological Association Newsletter, 42, 24. , DITCHFIELD, P . W., DOUBLE D AY, P. A. & MARSHALL , J. D . 1995 . A n Uppe r Jurassi c methane-see p limestone fro m th e Fossi l Bluf f Grou p fore-ar c basin o f Alexande r Island , Antarctica . Journal o f Sedimentary Research, A65, 274-282 . , WHITHAM , A . G. , KORAINI , A . M . & PRICE , S . P . 1998. Lithostratigraph y o f th e Cretaceou s (Barremian-Santonian) Hold wit h Hope Group , NE Greenland. Journal o f th e Geological Society, London, 155(6), 993-1008. KENK, V . C . & WILSON , B . R . 1985 . A ne w musse l (Bivalvia, Mytilidae ) fro m hydrotherma l vent s in th e Galapago s Rif t zone . Malacologia, 26 , 253-271. KREUGER, D. M., GUSTAFSON, R. G. & CAVANAUGH, C. M . 1990. Vertica l transmissio n o f chemautotrophi c symbionts in the bivalve Solemya velum. Biological Bulletin, 98, 60-65. KULM, L . D . & SUESS , E . 1990 . Relationshi p betwee n carbonate deposit s an d flui d venting : Orego n accretionery prism . Journal o f Geophysical Research, 95(B6), 8899-8915 . LEMOINE, M. , ARNAUD-VANNAU , A. , ARNAUD , H. , LETOLLE, R. , MEVEL , C . & THIEULOY , J.-P . 1982 . Indices possibles d e paleo-hydrothermalisme marin dans l e Jurassiqu e e t l e Cretac e de s Alpe s occidentales (Ocea n Tethysie n e t s a marg e continentale europeene): essai d'inventaire. Bulletin de l a Societe Geologique d e France, 24(3) , 641-647. LILJEDAHL, L . 1991 . Contrastin g feedin g strategie s i n bivalves fro m th e Siluria n o f Gotland . Palaeontology, 34, 219-235. LITTLE, C . T . S. , MASLENNIKOV , V . V., MORRIS , N . J . & GUBANOV, A . P . 1999 . Tw o Palaeozoi c hydrothermal ven t communitie s fro m th e souther n Ural Mountains , Russia . Palaeontology, 42 , 1043-1078. LUTZ, R . A. , FRITZ , L . W . & RHOADS , D . C . 1985 . Molluscan growt h a t deep-se a hydrotherma l vents. In: JONES , M. L. (ed.) The hydrothermal vents of the eastern Pacific : a n overview . Bulletin o f th e Biological Society o f Washington, 6, 199-210 . , JABLONSKI , D . & TURNER , R . D . 1984 . Larva l development an d dispersa l a t deep-se a hydro thermal vents. Science, 226, 1451-1454 . , SHANK , T . M. , FORNARI , D . J. , HAYMON , R . A. , LILLEY, M . D., VON DAM, K . L. & DESBRUYERES, D . 1994. Rapi d growth at deep-sea vents . Nature, 371 , 663-664. MAYER, L. A. , SHOR , A . N. , CLARKE , J . H . & PIPER , D . J . W. 1988 . Dens e biologica l communitie s a t 385 0 m on th e Laurentian Fa n an d their relationshi p t o th e deposits o f th e 192 9 Gran d Bank s earthquake . Deep-Sea Research, 35(8), 1235-1246 . MAYNC, W . 1949 . Th e Cretaceou s bed s betwee n Kuh n Island an d Cap e Frankli n (Gaus s Peninsula) , northern Eas t Greenland . Meddelelser o m Gr0nland, 133(3), 1-291 . MILLER, S . A. 1877 . Th e American Palaeozoic Fossils, a Catalogue o f th e Genera and Species. S . A. Miller , Cincinnati!

245

MORRIS, N . J . 1978 . Th e infauna l descendant s o f th e Cycloconchidae: a n outlin e o f th e evolutionar y history an d taxonom y o f th e Heteroconchia , superfamilies Cycloconchace a t o Chamacea . Philosophical Transactions of the Royal Society of London, B284, 259-275. NEWELL, N . D . 1957 . Note s o n certai n primitiv e heterodont pelecypods . American Museum Novitates, 185 7 1-14 . 1965. Classificatio n o f th e Bivalvia . American Museum Novitates, 2206, 1-25 . N0HR-HANSEN, H . 1993 . Dinoflagellat e cys t stratigraphy of th e Barremia n t o Albian , Lowe r Cretaceous , northeast Greenland . Gr0nlands Geologiske Unders0gelse, Bulletin, 166 , 1-171 . PEEK, A . S. , GUSTAFSON , R . G. , LUTZ , R . A . & VRUENHOEK, R.C . 1997 . Evolutionar y relationship s of deep-sea hydrotherma l ven t and cold-seep clam s (Bivalvia: Vesicomyidae) : result s fro m mitochondrial cytochrom e oxidas e subuni t I . Marine Biology, 130 , 151-161 . PETTA, T . J. & GERHARD , L. C. 1977 . Marine gras s banks - possibl e explanatio n fo r carbonate lenses , Tepe e Zone, Pierr e Shal e (Cretaceous) , Colorado . Journal of Sedimentary Petrology, 47(3), 1018-1026 . PICTET, F . J . & CAMPICHE , G . 1864 . Descriptio n de s fossiles d u terrai n Cretac e de s environ s d e St e Croix. Materiaux pour l a Paleontologie Suisse, 2 , 701-752. POEL, L. VA N DE. 1959. Faune malacologique d u Hervien . Bulletin de I'Institut Royal des Sciences Naturelles de Belgique, 35 (15), 1-26 ; 35(16) , 1-28 . PRICE, S . P . & WHITHAM , A . G . 1997 . Exhume d hydrocarbon trap s i n Eas t Greenland : analog s fo r the Lower-Middl e Jurassi c pla y o f Northwes t Europe. American Association o f PetroleumGeologists, Bulletin, 81, 196-221. REID, R . G . B . & BRAND , D . G . 1986 . Sulfide-oxidisin g symbiosis i n Lucinaceans : implication s fo r bivalve evolution. The Veliger, 29 , 3-24 . ROLIN, Y., GAILLARD, C . & Roux, M. 1990 . Ecologi e de s pseudobiohermes de s terres noires jurassiques lies a des paleo-sous-marines . L e sit e Oxfordie n d e Beauvoisin (Drome , bassi n d u sud-est , France) . Palaeogeography, Palaeo climatology and Palaeoecology, 80(2) , 79-105 . SAUL, L. R., SQUIRES, R. L. & GOEDERT, J. L. 1996 . A new genus of cryptic lucinid ? bivalve fro m Eocen e col d seeps an d turbidite-influence d mudstone , wester n Washington. Journal o f Paleontology, 70(5) , 788-794. SMITH, C . R., KUKERT, H., WHEATCROFT, P . A., JUMARS, P. A. & DEMING , J . W . 1989 . Ven t faun a o n whal e remains. Nature, 341, 27-28 . SPEDEN, I . G . 1970 . Th e Typ e Fo x Hill s Formation , Cretaceous (Maestrichtian) , Sout h Dakota . Par t 2 . Systematics o f th e Bivalvia . Peabody Museum o f Natural History, Yale University, Bulletin, 33 , 1-222. SQUIRES, R . L . & GOEDERT , J . L . 1991 . New lat e Eocen e mollusks fro m localize d limestone deposit s forme d by subduction-relate d methan e seeps , southwester n Washington. Journal o f Paleontology, 65(3) , 412-416.

246

S. R . A . KELL Y E T AL.

,& BARNES , L . G . 1991 . Whal e carcasses . Nature, 349, 574 . STANTON, T. A. 1895 . Contribution to the Knoxville Beds. United States Geological Survey Bulletin, 133 , 1-132. SURLYK, F . 1977 . Stratigraphy , tectonic s an d palaeogeography o f th e Jurassi c sediment s o f th e areas nort h o f Kon g Osca r Fjord, Eas t Greenland . Gr0nlands Geologiske Unders0gelse, Bulletin, 123 , 1-56. 1978. Submarin e fa n sedimentatio n alon g faul t scarps o n tilte d faul t block s (Jurassic-Cretaceou s boundary), Eas t Greenland . Gr0nlands Geologiske Unders^gelse, Bulletin, 128 , 1-108 . & ZAKHAROV, V. A. 1982 . Buchiid bivalves from th e Upper Jurassi c an d Lowe r Cretaceou s o f Eas t Greenland. Palaeontology, 25(4), 727-753.

TAYLOR, J . & GLOVER , E . 2000 . Functiona l anatomy , chemosymbiosis, an d evolutio n o f th e Lucinidae . This volume. THIEULOY, J.-P . 1972 . Biostratigraphi e de s lentille s a peregrinelles (brachiopodes ) d e 1'Hauterivie n d e Rottier (Drome, France). Geobios, 5(1), 5-53 . TODD, J . A. 1993 . The bivalve shell as a preservation trap, as illustrate d b y th e Lat e Jurassi c gryphaeid , Deltoideum delta (Smith) . Scripta Geologica, 2 , 417-433. VAN DOVER , C . L . 1985 . Ecolog y o f mid-Atlanti c ridg e hydrothermal vents . In: PARSON , L . M . & WALKER , C. L . (eds ) Hydrothermal Venta an d Processes. Geological Society , London , Specia l Publications , 87, 257-294. VAN WINKLE , K. 1919 . Remark s on som e new species fro m Trinidad . Bulletins o f American Palaeontology, 8(33) , 19-33.

The function of pallial eyes within the Pectinidae, with a description of those present in Patinopecten yessoensis BRIAN MORTON The Swire Institute of Marine Science and Department of Ecology and Biodiversity, The University of Hong Kong, Hong Kong, China Abstract: Th e structur e o f the pallial, ectopi c ey e o f Patinopecten yessoensis i s described an d shown t o b e o f th e typica l pectini d form , locate d o n th e middl e mantl e fold . Th e corne a is , however, a tall epithelium and, with the lens, forms a Cartesian oval, unlike the lens alone in other pectinids whic h functions t o counter spherica l aberration . Th e basal cel l laye r beneath th e retina and argente a i s poorl y pigmented , althoug h thi s ma y b e countere d b y th e fac t tha t th e opti c tentacle epithelium itsel f is apically heavily pigmented . It is generally assume d tha t pectinid pallia l eyes , bein g abl e t o perceive a moving image , ar e used to warn of vicinal predators, resultin g in swimming. However, this does not seem to be the case; althoug h crab s an d starfish , i n particular, ar e known predators o f scallops , whic h respon d by swimming to the latter, they do so (usually) on receipt of mechanical an d chemical stimuli , not visual. Som e scallo p specie s liv e i n seagras s bed s an d ther e i s evidenc e tha t thes e ma y affor d protection. Scallop s ar e visually attracted t o the waving fronds . Scallops ma y als o mak e relocatio n movement s and , in more specialize d taxa , e.g . specie s of Amusium, ca n swi m for severa l metres . Th e visua l sens e o f scallop s i s poorly understoo d an d although pallia l eye s ma y hav e develope d earl y i n th e ancestr y o f th e Pectinidae , a s a n antipredation sense organ, they may, in the descendants, now have a different, but perhaps related , function, althoug h what this is, is unknown. Pectinid pallia l eye s ma y improve th e efficiency o f photon capture in low light intensity subtidal habitats but for what purpose is unclear, sinc e even if they ar e functionin g a s optica l 'burgla r alarms' , wha t coul d the y se e i n suc h a situation , especially a s there is no brain to formulate an image?

Pelseneer (1911 ) firs t attempte d t o classif y ey e structure i n th e Bivalvia , an d Morto n (2001 ) ha s reviewed cephali c an d pallia l ey e structur e i n th e class. Th e mos t well-understoo d bivalv e pallia l eyes belon g t o representative s o f the Pectinidae , a family i n which their development ha s been linke d to th e evolutio n o f swimmin g (Yong e 1936) . Th e first comprehensiv e stud y of a pectinid eye (Pecten maximus} wa s b y Daki n (1910) , wh o showed , importantly, tha t th e retina comprise d tw o cel l layers, proxima l an d distal , wit h a crystallin e argentea and a cup of pigmented cell s below it, and a Cartesian oval-shape d len s above. Suc h an eye is clearly sophisticate d an d Wenric h (1916 ) firs t suggested tha t i t migh t b e abl e t o for m a n image . Dakin (1928a ) subsequentl y wen t o n t o describ e the eye s o f Spondylus gaederopus an d Amusium pleuronectes, while Barbe r e t aL (1967 ) describe d the fin e structur e o f th e ey e o f Pecten maximus. Dakin (1928Z? ) als o showe d tha t th e pallia l opti c nerves connec t u p wit h the visceral gangli a which develop inequilatera l opti c lobe s relate d t o th e numbers o f eye s o n eac h mantl e lobe . Eve n so ,

however, suc h lobes ar e smal l i n compariso n wit h those of, say, an octopus, which has well-develope d visual acuity (Well s 1966) . Despit e a sophisticate d eye structure , therefore , i t i s doubtfu l i f th e bivalve's viscera l gangli a are capable o f recreatin g any image . The ey e i s o f a simila r constructio n i n al l pectinids, an d Morto n (1980 , 1993 , 1996 ) ha s described thei r genera l organizatio n an d relation ships wit h th e mantl e fold s i n Amusium pleuronectes, Leptopecten latiauratus an d Minnivola pyxidatus. Th e pallial eye s of the borea l Patinopecten yessoensis (Jay , 1857 ) hav e not bee n described an d thi s stud y remedie s thi s deficiency . The principal objectiv e of this study is, however, a review an d a n analysi s o f th e functio n o f such , a s will be shown, superficially complex eyes .

Materials an d method s Patinopecten yessoensis i s a boreal , free-livin g scallop fro m th e Bohai Se a (China), Korea an d the Sea o f Japan . I t i s importe d int o Hon g Kon g a s a

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology o f th e Bivalvia. Geological Society , London, Special Publications , 177 , 247-255 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y o f London 2000 .

248

B. MORTON

seafood wher e it is kept in chilled seawate r aquaria. Specimens wer e dissected an d pieces o f the mantle margin removed an d fixe d i n 5 % neutral formalin. Following routin e histologica l procedures , suc h tissues wer e sectione d a t 6 um an d alternate slide s stained i n either Ehrlich' s haematoxyli n an d eosi n or Mas son's trichrome.

Results As i n al l scallops , th e pallia l eye s o f Patinopecten yessoensis ar e develope d o n th e middl e mantl e fold, th e inne r formin g th e velu m tha t facilitate s swimming. I n adul t specimens , ther e ar e alway s more eyes on the lower right (n = c. 27), than on the upper left ( n = c. 45) mantl e margins. Sections o f th e eye s revea l th e followin g structure (see Fig.l). The eye is situated on its own tentacle, th e epithelia l surfac e o f whic h i s darkl y pigmented (POE ) an d which may be > 40 um tall . In Patinopecten yessoensis, a s i n Pecten (= Chlamys) pusio (Patte n 1886) , th e corne a i s enlarged an d comprise s cell s whic h ca n b e u p t o 40 um tall, each with, as in the general epithelium, a distal nucleus. Immediately under the cornea (C )

is a len s (L) , house d i n it s ow n chamber . I n P . yessoensis and P. pusio,the enlarged cornea and the lens for m a Cartesian oval , whereas i n P. maximus the len s alon e ha s thi s shape . Th e len s o f P . yessoensis i s c. 16 0 um i n diameter an d has a core of darkly staining cells, surrounde d by lighter ones. Beneath the lens is the distal retina (DR), from th e surface o f whic h aris e ciliar y appendages . Thes e eventually unit e t o for m th e dista l retina l nerv e (DRN) tha t emerges fro m th e eye s laterall y a t one point. The cells o f the distal retina have a proximal nucleus. Beneat h thi s i s th e proxima l retin a (PR) , also wit h proxima l nuclei an d fro m th e dista l surface o f whic h als o aris e ciliar y appendages , which eventuall y for m th e proxima l retina l nerv e (PRN). Th e membranou s appearanc e an d ciliar y character o f th e proxima l retina l appendage s suggest that they too, like those of the distal retina, are light receptive . Th e proxima l retina l nerv e emerges fro m th e opposit e sid e o f th e ey e t o th e distal retinal nerve, eventually uniting their bases . In life, formin g a union with the proximal retin a is the argente a (A) , or tapetum. Suc h a structure is one of the few examples of an invertebrate tapetum outside th e Arthropod a an d give s th e pectini d ey e

Fig. 1 . Patinopecten yessoensis - a section throug h a pallial eye . A, Argentea; C , cornea; DR, distal retina ; DRN , distal retina l nerve ; L , lens; ON , optic nerve ; OT, optic tentacle ; PC , pigment cell ; POE , pigmente d outer epithelium ; PR, proximal retina ; PRN , proxima l retina l nerve .

THE PALLIA L EYE S O F PATINOPECTEN YESSOENSIS

its metalli c appearance . Beneat h th e argente a i s a row o f cell s calle d th e pigmen t cu p (PC) ; i n Patinopecten yessoensis these cell s are only lightly pigmented but in P. maximus they are more heavil y pigmented (Daki n 1910 , 1928a) . The distal (DRN ) and proximal retinal nerves (PRN) unite outside the eye to become th e optic nerv e (ON) . The pectini d eye doe s no t hav e a n accessor y orga n (Morto n 2001), althoug h i t i s possibl e tha t on e o r mor e o f the complex arra y of tactile tentacles whic h ador n the middle mantl e fold, and surround each eye, can be considered suc h a structure. N o one has offere d an opinio n on th e functio n o f the accessor y organ, except fo r Laternula truncata, whic h Ada l & Morton (1973 ) suggeste d migh t protec t th e ey e when the tentacle on which it is located bends back, with th e others , t o flic k san d grain s ove r th e siphonal regio n fo r camouflag e (i.e . i t act s lik e a statocyst).

A review of the function of pectinid pallial eyes The most basic respons e t o light i n the Bivalvia is the shadow 'of f refle x leading to either adduction , siphonal withdrawa l o r diggin g (o r a combinatio n of al l three) , firs t describe d b y Shar p (1883) . Th e pallial eye s of pectinids ar e the only ones in which a well-resolved image is formed by reflexion (Land 1968, 1981) . Lan d (1965 , \966a) showe d tha t th e lens o f Pecten maximus ha d a foca l lengt h whic h was a t least twic e as great as the depth o f the eye, so that an y image mus t be forme d a t the spherica l argentea o n th e dista l retina . Hartlin e (1938 ) showed that the distal retin a responds to the offse t of light (the primitive 'of f shado w reflex), whereas the proxima l retina , whic h doe s no t receiv e a focused image , respond s t o th e onse t o f light , th e 'on' reflex . Th e overal l functio n o f suc h a n eye , therefore, i s t o permi t response s t o b e mad e t o moving object s whic h d o no t cas t direc t shadow s (Land 1966Z?) . Possibly , scallop s se e a simpl e image o f a n objec t a s i t goe s pas t thei r eye s i n sequence. Thus , Ree s (1957 , p . 23) records The y [Pecten maximus] ca n als o perceiv e movemen t whether o r no t i t involve s a change in brightness ; they will react by shutting their valves [my italics] when, say , a smal l whit e car d onl y three-fifth s inches squar e is moved against a black background more than a foot away' . Similarly , Hartlin e (1925 , p. 211) says of Pecten maximus: 'O n cutting off the light the animal is stimulated an d reacts by closing its valves [m y italics]' . If , however , th e viscera l ganglia initiat e a response , base d o n informatio n received from the pallial eyes, to nothing more than gross movement , wh y d o suc h sophisticate d eye s develop whe n th e sam e resul t coul d b e achieve d from the stimulus received from eyespots of a much

249

simpler construction? All bivalves (excep t probabl y bathyal species) , whethe r the y posses s pallia l eyespots o r not, have a shadow reflex which results in valv e adduction . Suc h shadow s ar e detected by photosensitive nerve s (Charle s 1966) . Of al l th e bivalves , representative s o f th e Pectinidae possess the most anatomically advance d eyes (Morton 2001). Buddenbrock & Moller-Racke (1953) showe d tha t scallop s (Pecten maximus} close thei r shel l valve s i n respons e t o smal l movements i n the environment . Bu t ho w valuabl e is thi s abilit y i n th e natura l environment ? I n a laboratory stud y o f Chlamys bifrons i n Sout h Australia, Pitcher & Butler (1987 , p. 237 ) showe d that control individual s mechanicall y stimulate d a t the mantl e margi n di d no t exhibi t a n escap e response even after 2 min of contact and that 'eve n severe disturbanc e o f th e scallo p di d no t alway s cause a response' . Moreover , whe n isolate d wit h the starfish Coscinasterias calamaria, 'the majority of C. bifrons responde d immediately t o contact [my italics] wit h starfish , man y responde d befor e contact and very few took > 1 s to respond'. The scallo p Minnivola pyxidatus i s a subtida l species in Hong Kong and possesses the usual array of advance d pallial eyes (Morto n 1996) . A known predator o f thi s scallo p i s th e murici d Rapana bezoar and in choice experiments with this species , and a rang e o f potentia l pre y wit h whic h th e gastropod wa s familiar , M . pyxidatus wa s alway s the firs t t o be attacke d (Morto n 1994) . Despit e it s complex eyes , M . pyxidatus coul d no t detec t th e large, advancing , predato r an d i t wa s no t unti l R. bezoar actually touched the long pallial tentacles of the scallo p tha t an y escap e respons e coul d b e detected, by which time it was usually too late (th e gastropod, literally jumping onto and immobilizing its victim) . Goul d (1971 , p . 79 ) state s tha t 'Placopecten an d Amusium respond to predators by flight (photographs in Rees 1957)'. However, Rees' photographs sho w n o suc h thin g an d are , o n th e contrary, o f Chlamys opercularis, a specie s whic h because o f functiona l desig n canno t swi m a t al l well (Chapma n e t al. 1979 ) an d respond s onl y t o the touc h o f a potentia l predator , th e asteroi d Asterias rubens, by gaping widely an d then only at the last minute attempting to swim (Rees 1957 , pp . 27-31, fig s I-VI). The photographs reproduced by Rees (1957 ) actuall y sho w som e C . opercularis overlain by the starfish , but stil l no t responding by flight.

The well-know n swimmin g escap e o f scallop s 'from contact with, o r odour of , asteroids [m y italics]' (Sloa n 1980 , p . 109 ) i s als o characterize d by differin g report s o f suc h responses . Hancoc k (1974) showed that Crossaster papposus woul d not stimulate escape behaviou r in Pecten maximus and Chlamys opercularis. Christensen (pers . comm . i n

250

B. MORTO N

Hancock 1974 ) observe d swimmin g b y C . opercularis t o C . papposus an d Macki e (pers . comm. in Hancock 1974 ) observed a weak reactio n in Pecten to an extract o f the sam e starfish . Dicki e & Medco f (1963 ) showe d tha t Placopecten wil l respond strongl y t o Asterias vulgaris but no t t o C. papposus. Finally , Fang e (1963 ) an d Thoma s & Gruffydd (1971 ) stated that Pecten responds only to Marthasterias glacialis. Stephen s (1978 ) use d a crude asteroi d extrac t t o stimulat e a swimmin g response in Aequipecten irregularis. Morphologically les s specialize d scallops , e.g . Chlamys opercularis, ca n swi m distance s o f between 3.5 and 6.6 m (Chapman et al. 1979). This same specie s wil l swi m when eithe r mechanicall y or chemicall y stimulate d b y extract s o f predator y starfish (Stephens & Boyle 1978). The same escap e response is also induced in Pecten ziczac by such a chemical stimulu s (Wilken s 1981) . O f particula r interest to this study, the same response was evoked in Patinopecten yessoensis (Karpenk o 1980) . I n this cas e th e scallop s responde d usin g chemo receptors i n their pallia l tentacle s t o Distolasterias nipon an d Patiria pectinifera (Asteroidea ) (Karpenko 1981) . Th e sam e escap e respons e t o these starfishes was also seen in Swiftopecten swifti (Dautov & Karpenk o 1984 ) i n th e Se a o f Japan . Clearly, i t i s th e arra y o f pallia l tentacle s o n th e middle mantl e fol d tha t ar e the mechanica l mean s by whic h scallop s detec t potentia l predators . However, pectinids, e.g. Placopecten magellanicus, also possess an osphradium an d an abdominal sens e organ t o sampl e wate r flowin g throug h the mantle cavity an d bot h ma y ac t a s mechanoreceptors , either t o monito r flo w rat e and/o r a s chemo receptors (Moir 1977) , detecting predator exudates. Starfish ofte n occu r on subtidal scallop beds and in a review of asteriod feedin g (Sloa n 1980 ) it ha s been suggeste d tha t thi s ha s le d t o the m bein g characterized as predator and prey. However, this is not necessaril y true . O n a subtida l scallo p be d i n Venezuala, c . 87 % o f th e die t o f Luidia barimae was ophiuroids (Penchaszadeh & Molinet i n Sloan 1980). O n an Isle o f Man scallop bed, 97.4% of the diet o f Luidia ciliaris wa s echinoderms , agai n mostly ophiuroid s (Bru n 1972 , p . 225) , wit h onl y 'small Pecten' foun d i n the gut s of two ou t o f 10 8 specimens studie d b y Hunt (1925) at Plymouth. In Venezuala, Luidia clathrata ha d a die t o f 45 % 'molluscs' an d 36 % ophiuroids , wherea s o n a North Carolin a scallo p be d thi s asteroi d wa s a scallop predato r (Schwart z & Porter 1977) , a s was Astropecten articulatus. Luidia alternata was , however, a specialis t predato r o n thes e coexistin g scallop predators . Barbeau & Scheiblin g (1994 ) undertoo k a n experiment wherei n tethere d an d untethere d Placopecten magellanicus were offered a s potential

prey t o th e cra b Cancer irroratus an d th e starfis h Asterias vulgaris. Tetherin g di d no t influenc e th e predation rat e b y th e cra b bu t i t di d limi t th e scallop's respons e t o th e starfish , thereb y increasing th e predatio n rate , demonstratin g tha t swimming i s a n effectiv e defenc e agains t thi s species. Ki m (1969 ) showe d tha t Asterias rubens could ope n Patinopecten yessoensis mor e quickl y than a variet y o f othe r cemente d an d slow swimming species. Thi s was, however, because the scallop wa s secure d t o it s substratu m and, i n life , might have been able to escape th e predator. Other scallo p prey-predato r interaction s include the cra b Dyspanopeus sayi feedin g o n juvenil e Argopecten irradians i n Lon g Islan d Sound , Ne w York (Strie b e t al . 1995) . I n th e Gul f o f S t Lawrence, smalle r Chlamys islandica ar e the prey of th e crab s Hyas araneus an d Cancer irroratus (Arsenault & Himmelma n 1996) . I n laborator y experiments, Pecten maximus wa s fe d o n b y Liocarcinus puber, Carcinus maenas an d Cancer pagurus (Lak e & Jone s 1987) . Placopecten magellanicus i s preye d upo n b y Cancer irroratus and th e America n lobste r Homarus americanus (Finer & Jamieso n 1979) . I n bot h th e laborator y and in the field, in Rhode Island, USA , Argopecten irradians i s fe d upo n b y th e murici d Urosalpinx cinerea (Ordzie & Garofalo 1980) . I n Nova Scotia , P. magellanicus is the prey o f Cancer irroratus and two starfishes , Asterias vulgaris an d A . forbesi (Barbeau e t al . 1998) . I n Norther n Chile , Argopecten purpuratus i s preye d upo n b y Cancer polydon, tw o starfishes , Meyenaster gelatinosus and Luidia magellanicus, an d tw o gastropods , Xanthochorus sp . an d Priene rude (Wolf f & Alarcon 1993) . A . irradians can , however , differentiate predator s fro m non-predators , bu t Asterias forbesi (Asteroidea ) an d th e gastropod s Eupleura caudata an d Urosalpinx cinerea, an d Thais lapillus an d Busycon canaliculatum al l provoked swimmin g (Ordzie & Garofalo 1980) . In th e Gul f o f S t Lawrence , USA , norma l movements b y Placopecten magellanicus reduce d the overal l predatio n rat e b y Cancer irroratus. However, experimentally tethered individuals were easily capture d (Stokesbur y & Himmelman 1996) , e.g. Patinopecten yessoensis an d Asterias amurensis (Ki m 1969) . I n Tasmania , Equichlamys bifrons i s predate d upo n b y th e starfis h Coscinasterias muricata and Octopus maorum, bu t the predation rat e was less in seagrass bed s (Wolf & White 1997) . In seagrass bed s o f Halodule wrightii and Zostera marina, predatio n upo n Argopecten irradians b y th e whel k Busycon carica, an d eve n by th e Ring-bille d gull , Larus delawarensis, an d the Herrin g gull , Larus argentum, wa s reduce d i n comparison wit h thos e scallop s livin g o n sand y areas. Zostera marina bed s als o provide d a

THE PALLIA L EYES O F PATINOPECTEN YESSOENSIS

significant refug e fo r juvenile scallops (Argopecten irradians) o f < 1 5 mm shel l length from predatio n by th e cra b Dyspanopeus sayi an d th e pufferfis h Sphoeroides maculatus (Bricel j e t al. 1993) . Thi s appears to be because smal l scallops ca n climb up the seagrass leaves and, thus, at high tide times are removed fro m th e vicinit y o f a t leas t th e crab . Caddy (1972) showed that juveniles of Placopecten magellanicus ca n remai n bysall y attache d u p t o a shell heigh t o f c . 12 0 mm an d suc h individual s show les s swimmin g respons e tha n large r adults . Therefore, seagras s beds may, at different stage s of the lif e cycle s o f som e scallops , confe r protection from predators , e.g . Argopecten irradians orient s towards them, perhaps visually sensing the moving fronds, fro m a distanc e o f 2 5 cm bu t n o furthe r (Hamilton & Koch 1996). Yonge (1936 ) considere d tha t th e mos t activ e scallop swimmers , i.e. P . (Chlamys) opercularis of European waters an d th e America n P . irradians, both o f whic h liv e i n shoal s o n sand y bottom s a t moderate depths , make extensiv e migration s fro m time t o time . Rolf e (1973 ) similarl y argue d tha t there wa s evidenc e t o sugges t tha t th e sudde n disappearance o f Chlamys opercularis fro m area s where previously good catches were obtained could be due to mass migration , perhap s a s the result of swimming activity assisted by tidal currents. In th e Clyd e Sea , th e spa t o f Chlamys septemradiata settl e nea r th e shor e wher e the y byssally attac h fo r 2 years . The y subsequentl y assume a swimmin g habi t an d migrat e t o deepe r waters (Alle n 1953) . Thaye r (1972 ) accepte d tha t the (reportedly ) enhance d swimmin g activit y an d adductor muscl e obliquit y i n th e youn g o f othe r scallop gener a migh t als o b e associate d wit h relocation o f the juveniles to suitable adult habitats . Such scallop s migh t b e respondin g t o subtl e changes i n ligh t intensit y because , a s ha s bee n shown by Gomez & Nasi (1997), the pallial eyes of Pecten irradians are capable o f light adaptation . Moore & Marshal l (1967 ) believe d tha t trans position o f Aequipecten irradians i n th e Nianti c Estuary ma y b e accounte d fo r b y tida l current s acting upo n the, albei t weakly, swimmin g scallop . On the sea bottom of Iles-de-la-Madeleine, Canada, Cliche et al. (1994) showed that, after 44 days, 49% of seede d Placopecten magellanicus ha d move d > 60 m preferentiall y downstrea m t o th e south . Baird (1966 ) ha s reviewe d th e literatur e o n migration in scallops, particularl y the researches of Gibson (1956) , Bair d & Gibso n (1956) , Maso n (1957) o n Pecten maximus, and Dickie (1955 ) an d Posgay (1963 ) o n Placopecten magellanicus, an d concluded tha t migration s d o no t occu r althoug h local movement s may . Baird (1966 ) believe d tha t the swimmin g habi t i n Pecten maximus i s employed to enable the animal to move away fro m

251

a substratu m whic h i s unsuitabl e fo r recessing . However, th e evidenc e agains t migratio n i s not a s unequivocal a s Bair d (1966 ) believed ; th e wid e distribution o f man y scallops , notabl y specie s o f Amusium (Knudse n 1967) , an d aspect s o f scallo p design, agai n especiall y observe d i n specie s o f Amusium, give the m th e potentia l t o b e efficient , long-distance swimmers . I t i s extremel y doubtfu l that the recorded swimmin g distances, c. 20-30 m, of Amusium pleuronectes ar e use d merel y fo r escape (Morto n 1980) . In thi s species , a recogniz able escap e reactio n comprise s betwee n on e t o three adduction s an d probabl y ha s th e effec t o f removing th e scallo p fro m a n immediate predator . Conversely, th e extende d swim s o f specie s o f Amusium (Morto n 1980 ; Jol l 1989) , lik e thos e o f Placopecten magellanicus (Cadd y 1968 ; Stanle y 1970), cove r man y metre s and , i n term s o f functional morpholog y (i.e . th e laterall y thin , smooth, ligh t shell , hydrodynamicall y efficien t with interna l ribs) , i t doe s no t see m logica l tha t such modification s aros e simpl y t o remov e th e animal from the immediate proximit y o f a predator. On the contrary, the adaptations of A. pleuronectes, including a fish-lik e crypsi s (Thaye r 1971) , al l point to a highly mobile mode of life. Under natural conditions i n Shar k Bay , Wester n Australia , A . balloti demonstrate d a maximu m swimmin g distance of 23 m, although a maximum, cumulativ e distance, swim of 31 m was recorded, a t a speed of c. 1.6 m s"1 (Joll 1989) . This species does not, however, mak e seasona l migration s (Jol l 1989 ) an d i t too had to be physically mad e to swi m by tappin g the shell. Swimming ha s probabl y evolve d independentl y in severa l pectinoi d lineage s wit h this, rathe r tha n shell robustness , bein g th e preferre d defens e against predator s (Hayam i 1991) . Specie s o f Amusium an d Placopecten have the usual comple x pectinid pallia l eye s an d representative s o f bot h genera ar e capable o f dramatic bout s of swimmin g (Caddy 1968 ; Morto n 1980) . I n th e cas e o f A . pleuronectes, however , the y rarel y d o s o naturall y and hav e t o b e encouraged , vigorously , t o swi m (Morton 1980) . Occurring , a s the y do , a t depth s down t o c . 20 0 m o n th e continenta l shelf , what , however, coul d the y se e moving anyway ? Finally , Morton (1980 ) point s ou t tha t th e distanc e A . pleuronectes ca n swim , i.e . > 10 m a t a spee d o f 0.73 m s"1, in combination with the hydrodynamic attributes identifie d earlier , ar e unlikel y t o b e adaptations evolved to avoid predation but, instead, point t o a highl y mobil e lifestyle , perhap s associated wit h life-cycle changes.

Discussion It appear s tha t scallops , i n general , respon d t o th e

252

B. MORTO N

presence o f possibl e predator s b y detectin g eithe r tactile o r chemica l cues , bu t rarel y visua l ones . They ma y possibl y als o see k ou t refuges , suc h a s seagrass beds, visually, but they can also swim, not just t o escap e predator s o r to fin d refuges , but fo r other reason s too , e.g . short - o r long-distanc e movements t o kee p awa y fro m predator s an d a s part of seasonal changes in the environment, which may b e relate d t o th e lif e cycle , respectively . Fo r example th e Antarcti c scallop , Adamussium colbecki, althoug h a poo r swimmer , i s amon g th e earliest immigrants to areas of seabed uncovered by the retrea t o f glacie r tongue s i n th e Ros s Se a (Ansell e t al. 1998) , an d populatio n densitie s ca n decline fro m ten s pe r squar e metr e t o zer o within hours (Ralp h & Maxwel l 1978) . I t i s thi s specie s too for which there is an, albeit anecdotal, record of swimming possibly being induce d by light . In situ observations o f A . colbecki usin g a remotel y operated vehicl e (ROV ) showe d that 'th e scallop s appeared t o b e stimulate d (t o swim ) eithe r b y mechanical stimul i or turbulence generated b y th e approach of the ROV or possibly b y the increase in light intensity [m y italics]' (Ansel l e t al . 1998 , p . 372). A second example is given by Dibden & Joll (1998, p . 5) , wh o state d tha t 'som e scallop s (Amusium balloti) usuall y bega n t o swi m i n response t o [th e light s of ] th e underwate r camera being towe d alon g th e botto m i n thei r immediat e vicinity an d th e fligh t respons e o f a fe w ofte n triggered a domino-effec t i n th e surroundin g scallops, resultin g in th e camer a vie w being fille d with swimming scallops'. Primitive member s o f th e Pectinidae , e.g . Eopecten, wer e byssall y attached, resting o n thei r right valves (Harper et al. 1996) . Subsequently, the swimming habi t wa s probabl y develope d i n a number o f lineage s (Hayam i 1991) , possibl y i n relation t o th e earl y Mesozoi c Marin e Revolution (Vermeij 1977 ) an d th e evolutio n of ne w suite s of predators whic h fe d on , amon g othe r things , bivalves. Ther e wa s possibl y a n increas e i n swimming tax a a t th e beginnin g o f th e Mesozoi c which migh t reflec t suc h a natura l selectio n pressure (Skelto n e t al . 1990) . I t ha s als o bee n argued tha t man y suspension-feedin g bivalve s became extinct during middle Palaeozoic an d postTriassic turbidit y increases , whil e deposi t feedin g and swimmin g (i.e . pectinid ) tax a diversifie d (Larson & Rhoads 1983 ; Thaye r 1983) . However , there i s littl e evidenc e t o suppor t this, and, on th e contrary, Skelton et al. (1990) suggest that over the last 250 Ma there has been progressiv e decline s in both the actual number of pteriomorph families , in which th e incidence of pallial eyes i s most diverse (Morton 2001) , an d their relativ e importance . Th e same i s tru e o f swimmin g families , e.g . th e Pectinidae, s o that, assuming there is a relationship

between swimmin g and the developmen t o f pallia l eyes, such sophistications have not led to enhanced success. Conversely, the more recently diversifying Heterodonta hav e achieve d thei r moder n succes s largely withou t eyes (Morton 2001) . So, a s discusse d i n thi s paper , i n moder n pectinids ther e seem s t o b e littl e correlatio n between the evolutio n of complex pallia l eye s an d swimming a s a n escap e respons e t o approachin g predators detecte d visually , an d t o light-induce d patterns o f short - o r long-ter m movement . I s i t possible, therefore, tha t the pectinid eye evolved i n an ancestor(s ) a s a resul t o f natura l selectio n imposed b y predation , change s i n turbidit y o r because o f a nee d t o hav e better visua l acuit y i n deeper waters , bu t hav e bee n retaine d i n thei r descendants an d no w constitut e a n exampl e o f overdesign. Morton (2001 ) ha s argued that simple r eyes, see n i n other bivalv e lineages , could achiev e the sam e functiona l bivalv e response t o perceive d predation, i.e . adduction , diggin g o r eve n swim ming, as those of the Pectinidae. A s Land (1981, p. 423) point s out , 'I t i s tru e tha t som e eye s ar e capable of supplying more information tha n other s but a t a higher cost i n terms o f spac e the y take u p and th e metaboli c energ y the y require'. Suc h eyes cannot, however , b e tha t energeticall y expensiv e because the y hav e bee n retaine d i n th e mor e modern Spondylus gaederopus (Spondylidae ) an d Leptopecten latiauratus (Pectinidae) , whic h ar e cemented an d byssall y attached , respectivel y (Dakin 1928a , b\ Morto n 1993) . Bot h posses s th e typically complex pallial eyes of the Pectinidae bu t neither specie s i s capabl e o f a n escap e respons e other tha n t o adduc t th e shel l valves . Clearly , th e complex pectini d ey e ha s bee n retaine d i n thes e immobile scallop s t o initiat e onl y th e mos t basi c bivalve defensive response, i.e. closur e o f the shell valves. Spondylus is , then , perhap s th e clu e t o th e significance o f th e pectini d eye . I f spondyli d an d pectinid eye s ar e homologous, a s they see m t o be, then this suggest s tha t they evolved befor e th e two families diverge d i n th e earl y Jurassic . Evolve d i n an ancestra l pectini d a s th e resul t o f unknow n natural selectio n pressures , sophisticate d pallia l eyes have , today , bee n retaine d an d ma y fulfi l a number o f poorl y understoo d function s i n th e variously adapte d descendants . It is, however, als o possible that the complex pectinid eye has evolve d from a simple r structur e to increas e th e efficienc y of photo n captur e i n lo w ligh t intensities , suc h a s occurs in the typical habitat of mobile scallop s (i.e . the continental shelves), but, again, what advantage this confers upon them, since predators still seem to be typicall y detected b y mechanica l an d chemica l means, is unknown. An ability to detect changes in light intensit y at deepe r depth s ma y b e importan t

THE PALLIA L EYES OF PATINOPECTEN YESSOENSIS for scallop s an d woul d explai n thei r mor e sophisticated eyes . But , i f so , wh y ar e the y no t needed i n th e muc h wide r arra y o f othe r subtida l bivalves whic h mus t have simila r need s t o detec t light (o r changes i n it) , e.g . t o detec t predator s o r coordinate reproductiv e cycles . A s Morto n (2001 ) concludes for bivalve pallial eye s in general: thos e of th e Pectinida e seem , a t present , t o def y explanation. Nilsso n (1994 ) suggest s tha t bivalv e eyes ar e optica l 'burgla r alarms' , detectin g non image-forming movement . This seem s probabl e in species occupying shallow, clear waters , but no t in those, lik e th e majorit y o f scallops , occupyin g turbid continenta l shelf waters : nor doe s i t explain why pectini d eyes ar e o f suc h a sophisticate d design whe n thos e o f eve n th e mos t basi c for m achieve the sam e objective. Perhaps natura l selectio n ha s acte d s o that eve n the smalles t degree s o f anatomica l refinemen t confer a survival advantage in the face of predation. Dr E. M. Harper, University of Cambridge, i s thanked for hosting the conference at which this pape r wa s presente d and fo r constructiv e criticism s o f th e firs t draf t o f th e manuscript.

References ADAL, M . N . & MORTON , B . 1973 . The fin e structur e o f the pallia l eye s o f Laternula truncata (Bivalvia : Anomalodesmata: Pandoracea). Journal of Zoology, London, 171, 533-556. ALLEN, J . A . 1953 . Observations o n th e epifaun a o f th e deep-water mud s of the Clyde Se a area, with special reference t o Chylamys septemradiata (Miiller) . Journal o f Animal Ecology, 22, 240-260. ANSELL, A . D. , CATTANEO-VIETTI , R . & CHIANTORE , M . 1998. Swimmin g i n th e Antarcti c scallo p Adamussium colbecki: analysis of in situ recordings. Antarctic Science, 10, 369-375. ARSENAULT, D. J. & HIMMELMAN, J. H. 1996. Size-related changes i n vulnerabilit y t o predator s an d spatia l refuge us e b y juvenil e Icelan d scallop s Chlamys islandica. Marine Ecology Progress Series, 140 , 115-122. BAIRD, R . H . 1966 . Note s o n a n escallo p (Pecten maximus} population in Holyhead Harbour . Journal of the Marine Biological Association of the United Kingdom, 46, 33-47. & GIBSON , F . A. 1956 . Underwater observation s o n escallop (Pecten maximus L. ) beds . Journal o f th e Marine Biological Association of the United Kingdom, 35, 555-562. BARBEAU, N . A . & SCHEIBLING , R. E . 1994 . Procedural effects o f pre y tetherin g experiments : predatio n o f juvenile scallop s b y crab s an d se a stars . Marine Ecology Progress Series, III, 305-310 . HATCHER , B . G . 1998 . Behavioura l ?& responses o f predatory crab s and sea stars to varying density o f juvenile se a scallops . Aquaculture, 169, 87-98.

253

BARBER, V . C, EVANS , E . M . & LAND , M . F . 1967 . The fine structur e o f th e ey e o f th e mollus c Pecten maximus. Zeitschrift fur Zellforschung und Mikroscopische Anatrome, 76 , 295-312. BRICELJ, V . M. , BAUER , S . & TANIKAWA-OGLESBY , S . 1993. Constrastin g foraging tactics of two predator s of juvenile Ba y scallops , Argopecten irradians, i n the eelgras s canopy . Journal o f Shellfisheries Research, 12 , 130-131. BRUN, E. 1972 . Foo d an d feeding habits of Luidia ciliaris Echinodermata: Asteroidea . Journal o f th e Marine Biological Association o f th e United Kingdom, 52 , 225-236. BUDDENBROCK, W. VO N & MOLLER-RACKE , I . 1953 . Ube r

den Lichtsin n vo n Pecten. Pubblicazioni delta Stazione Zoologica d i Napoli, 24, 217-245. CADDY, J . F . 1968 . Underwater observation s o n scallo p (Placopecten magellanicus} behavio r an d dra g efficiency. Journal o f th e Fisheries Research Board of Canada, 25, 2123-2141 . 1972. Progressiv e los s o f byssu s attachmen t wit h size i n th e se a scallop , Placopecten magellanicus. Journal of Experimental Marine Biology and Ecology, 9, 179-190. CHAPMAN, C . J., MAIN, J., HOWELL , T . & SANGSTER , G . I . 1979. Th e swimmin g spee d an d enduranc e o f th e Queen scallo p Chlamys opercularis i n relatio n t o trawling. Progress i n Underwater Science, 4 , 57-72. CHARLES, G . H . 1966 . Sense organ s (les s cephalopods) . In: WILBUR , K . M . & YONGE , C . M . (eds ) Physiology ofMollusca, Volume II. Academic Press , New York , 455-521. CLICHE, G. , GIGUERE , M . & VIGNEAU , S . 1994 . Dispersa l and mortalit y o f se a scallops , Placopecten magellanicus (Gmelin , 1791) , seede d o n th e se a bottom of f Iles-de-la-Madeleine . Journal o f Shellfisheries Research, 13 , 565-570. DAKIN, W. J. 1910 . The ey e o f Pecten. Quarterly Journal of Microscopical Science, 55 , 49-112, pis 6 and 7. 19280. Th e eye s o f Pecten, Spondylus, Amussium and allied lamellibranch s wit h a short discussion on their evolution . Proceedings o f th e Royal Society o f London, Series B, 103, 355-366. 1928&. Th e anatom y an d phylogen y o f Spondylus, with a particula r referenc e t o th e lamellibranc h nervous system. Proceedings of th e Royal Society of London, Series B, 103, 337-354 . DAUTOV, S . SH . & KARPENKO , A. A . 1984 . Behavior an d mechanisms of locomotio n of two specie s of scallops fro m th e Se a o f Japan . Soviet Journal o f Marine Biology, 9 , 271-275. DIBDEN, C . J . & TOLL , L . M . 1998 . A researc h vesse l survey o f bottom type s i n the are a o f the Abrolho s Islands an d mid-wes t traw l fishery . Fisheries Research Report, Fisheries Western Australia, 110, 1-21. DICKIE, L . M . 1955 . Fluctuations i n abundanc e o f th e giant scallop , Placopecten magellanicus (Gmelin) , in th e se a o f th e Ba y o f Fundy . Journal o f th e Fisheries Research Board of Canada, 12, 797-857. & MEDCOF, J. C. 1963. Causes o f mass mortalities of scallops (Placopecten magellanicus} i n th e southwestern Gul f o f St . Lawrence . Journal

254

B. MORTO N

of th e Fisheries Research Board o f Canada, 20 , 451^82. ELNER, R . W . & JAMIESON , G. S . 1979 . Predation o f se a scallops, Placopecten magellanicus, b y th e roc k crab, Cancer irroratus, an d th e America n lobster , Homarus americanus. Journal of the Fisheries Research Board of Canada, 36, 537-543. FANGE, R . 1963 . Toxic factor s i n starfishes . Sarsia, 10 , 19-21. GIBSON, F. A. 1956 . Escallops Pecten maximus L. in Irish waters. Scientific Proceedings o f th e Royal Dublin Society, 27, 253-270. GOMEZ, M . & NASI , E . 1997 . Light adaptatio n i n Pecten hyperpolarizing photoreceptors : insentivit y t o calcium manipulations . Journal o f General Physiology, 109 , 371-384. GOULD, S. J. 1971 . Muscular mechanic s an d the ontogen y of swimmin g in scallops. Palaentology, 14 , 61-94. HAMILTON, P. V. & KOCH, K. M. 1996 . Orientation towar d natural an d artificial grassbed s b y swimmin g Ba y scallops, Argopecten irradians (Lamarck, 1819) . Journal of Experimental Marine Biology and Ecology, 199 , 79-88. HANCOCK, D. A. 1974 . Some aspects of the biology of the sunstar Crossaster papposus (L.) . Ophelia, 13, 1-30. HARPER, E. M., RADLEY, J. D. & PALMER, T. J. 1996. Early Cretaceous cementing pectini d bivalves . Cretaceous Research, 17, 135-150 . HARTLINE, H . K . 1925 . Th e protosensor y mechanism s o f Pecten irradians - preliminar y note . American Journal o f Physiology, 122, 211-212. 1938. The discharges of impulses i n the opti c nerve of Pecten i n respons e t o illuminatio n o f th e eye. Journal of Cellular and Comparative Physiology, 11, 465-477. HAYAMI, I . 1991 . Living an d fossi l scallo p shell s a s airfoils: a n experimenta l study . Paleobiology, 17 , 1-18. HUNT, O . D . 1925 . The foo d o f th e botto m faun a o f th e Plymouth fishin g grounds . Journal o f th e Marine Biological Association o f th e United Kingom, 13 , 560-599. JOLL, L . M . 1989 . Swimmin g behaviou r o f th e scallo p Amusium balloti (Mollusca : Pectinidae) . Marine Biology, 102, 299-305. KARPENKO, A. A. 1980 . Starfish avoidance response in the scallop Patinopecten yessoensis (Mollusca : Bivalvia). Zoologicheskii Zhurnal, 59 , 146-148 . 1981. How a prey distinguishes it s predator; scallop starfish relationship . In: ZHIRMUNSKIJ , A . V . (ed. ) Physiology and Biochemistry of Adaptations in Marine Animals. Vladivostock , USSR, 147-153 . KIM, Y . S. 1969 . A n observatio n o n th e openin g bivalve mollusks by starfis h Asterias amurensis. Bulletin o f the Faculty o f Fisheries, Hokkaido University, 20 , 60-63. KNUDSEN, J . 1967 . The dee p se a Bivalvia . Scientific Reports o f th e John Murray Expedition, 11 , 237-343. LAKE, N. C . H . & JONES , M . B . 1987 . Cra b predatio n o n scallop (Pecten maximus} an d it s implication s fo r scallop culture . Journal o f th e Marine Biological Association o f th e United Kingdom, 67 , 55-64 .

LAND, M. F. 1965. Image formation by a concave reflecto r in th e ey e o f th e scallop , Pecten maximus. Journal of Experimental Biology, 179 , 138-153. I966a. A multilayer interferenc e reflecto r i n the eye of the scallop , Pecten maximus. Journal of Experimental Biology, 45 , 433-477. I966b. Activit y i n th e opti c nerv e i n Pecten maximus i n respons e t o change s i n ligh t intensity , and t o patter n an d movemen t i n th e optica l environment. Journal o f Experimental Biology, 45 , 83-99. 1968. Functional aspect s o f th e optica l an d retina l organization of the mollusc eye. In: CARTHY , J. D. & NEWELL, G . E . (eds ) Invertebrate Receptors. Symposia o f the Zoological Society o f London, 23 , 75-96. 1981. Optic s an d visio n i n invertebrates . In: AUTRUM, H. (ed.) Handbook o f Sensory Physiology. Volume VII/6H. Comparative Physiology and Evolution of Vision in Invertebrates. B. Invertebrate Visual Centers an d Behaviour I . Springe r Verlag , Berlin. 471-593. LARSON, D . W . & RHOADS , D . C . 1983 . The evolutio n o f infaunal communitie s an d sedimentar y fabrics . In : TEVESZ, M . J . S . & McCALL , D . C . (eds ) Biotic Interactions in Recent and Fossil Benthic Communities. Plenu m Press, Ne w York, 627-649. MASON, J . 1957 . The ag e an d growt h o f th e scallop , Pecten maximus L. , in Manx waters . Journal o f th e Marine Biological Association of the United Kingdom, 36, 473^92. MOIR, A . J . G . 1977 . On th e ultrastructur e o f th e abdominal sens e orga n o f th e giant-scallop , Placopecten magellanicus (Gmelin) . Cell an d Tissue Research, 184 , 359-366. MOORE, J . K . & MARSHALL , N . 1967 . A n analysi s o f th e movements o f ba y scallop s Aequipecten irradians in a shallo w estuary . Proceedings o f th e National Shellfisheries Association, 57 , 77-82. MORTON, B . 1980 . Swimmin g i n Amusium pleuronectes (Bivalvia: Pectinidae) . Journal o f Zoology, London, 190,375-404. 1993. Th e biolog y an d functiona l morpholog y o f Leptopecten latiauratus (Conrad , 1837) : a n opportunistic scallop . Veliger, 37, 5-22. 1994. Pre y preferenc e an d metho d o f attac k b y Rapana bezoar (Gastropoda: Muricidae ) from Hon g Kong. In : MORTON , B . (ed. ) Proceedings o f th e Third International Workshop on the Malacofauna of Hong Kong and southern China, Hong Kong 1992. Hon g Kon g Universit y Press , Hon g Kong , 309-325. 1996. Th e biolog y an d functiona l morpholog y o f Minnivola pyxidatus (Bivalvia : Pectinoidea ) i n Hong Kong . Journal o f Zoology, London, 240, 735-760. 2001. Th e evolutio n o f eye s i n th e Bivalvia . Oceanography and Marine Biology: an Annual Review, in press. NILSSON, D . -E . 1994 . Eye s a s optica l alar m system s i n fan worm s an d ar k clams . Philosophical Transactions of the Royal Society of London, Series B, 346, 195-212. ORDIZE, C . J . & GAROFALO , G . C . 1980 . Behavioral

THE PALLIA L EYES OF PATINOPECTEN YESSOENSIS recognition of molluscan and echinoderm predators by the Bay scallop, Argopecten irradians (Lamarck) at tw o temperatures . Journal o f Experimental Marine Biology and Ecology, 43, 29-37. PATTEN, W . 1886 . Eye s o f mollusc s an d arthropods . Mitteil, Zoologische Station Neapel, 6, 542-756, pis 28-32. PELSENEER, P . 1911 . Le s lamellibrancle s d e 1'expeditio n du Siboga . Parti e anatomique . Siboga Expeditie, 53a, 1-125 . PITCHER, C . R . & BUTLER , A . J . 1987 . Predatio n b y asteroids, escap e responses , an d morphometric s of scallops wit h epizoi c sponges . Journal o f Experimental Marine Biology an d Ecology, 112 , 233-249. POSGAY, J. A. 1963 . Tagging as a technique in population studies o f th e se a scallop . Special Publications o f the International Commission on Atlantic Fisheries, 4,268-271. RALPH, R . & MAXWELL , J . G . H . 1978 . Growth o f th e Antarctic lamellibranchs Adamussium colbecki and Laternula elliptica. Marine Biology, 42, 171-175. REES, W. J. 1957 . The living scallop. In: Cox, I. (ed.) The Scallop. London , Th e 'Shell ' Transpor t & Trading Co., Ltd, London, 15-32 . ROLFE, M . S. 1973 . Notes on Queen Scallops and How t o Catch Them. Shellfish Information Leaflet. Ministr y of Agriculture Fisheries an d Food, UK, 27, 1-13 . SCHWARZ, F . J . & PORTER , H . J . 1977 . Fishery Bulletin NOAA, 75, 427^46. SHARP, B. 1883 . On visua l organs i n Solen. Proceedings of the Academy of Natural Sciences, Philadelphia, 58, 248-249. SKELTON, P . W., CRAME , J . A. , MORRIS , N . J . & HARPER , E. M . 1990 . Adaptive divergenc e an d taxonomi c radiation in post-Palaeozoic bivalves . In: TAYLOR , P. D. & LARWOOD , G . P . (eds ) Major Evolutionary Radiations. Clarendon Press , Oxford , 91-117 . SLOAN, N . A . 1980 . Aspects o f th e feedin g biolog y o f asteroids. Oceanography an d Marine Biology: a n Annual Review, 18, 57-124. STANLEY, S. M. 1970 . Relation o f shell form to life habit s in th e Bivalvi a (Mollusca) . Memoirs o f th e Geological Society of America, 125 , 1-296 . STEPHENS, R J . 1978 . The sensitivit y an d contro l o f th e scallop mantl e edge . Journal o f Experimental Biology, 75, 203-221. & BOYLE, P. R. 1978. Escape responses of the Quee n scallop Chlamys opercularis (L. ) (Mollusc : Bivalvia). Marine Behaviour an d Physiology, 5 , 103-113.

255

STOKESBURY, K . D . E . & HIMMELMAN , J . H . 1996 . Experimental examination of movement of the giant scallop, Placopecten magellanicus. Marine Biology, 124,651-660. STRIEB, M . D. , BRICELJ , V . M . & BAUER , S . I . 1995 . Population biolog y o f th e mu d crab , Dyspanopeus sayi, an important predato r o f juvenile bay scallops in Lon g Islan d (USA ) eelgrass beds . Journal o f Shellfisheries Research, 14, 347-357. THAYER, C . W . 1971 . Fish-lik e crypsi s i n swimmin g Monomyaria. Proceedings o f th e Malacological Society o f London, 39, 371-375. 1972. Adaptive features of swimming monomyarian bivalves (Mollusca). Forma et Functio, 5, 1-32 . 1983. Sediment-mediate d biologica l disturbanc e and the evolution of marine benthos. In: TEVESZ, M . J. S . & McCALL , P . L. (eds ) Biotic Interactions i n Recent an d Fossil Benthic Communities. Plenu m Press, New York, 479-625. THOMAS, G . E . & GRUFFYDD , L . D . 1971 . The type s o f escape reaction s elicite d i n th e scallo p Pecten maximus b y selecte d sea-sta r species . Marine Biology, 10 , 87-93. VERMEIJ, G . J . 1977 . The Mesozoi c marin e revolution : evidence fro m snails , predator s an d grazers . Paleobiology, 3, 245-258. WELLS, M . J . 1966 . Th e brai n an d behaviou r o f cephalopods. In : WILBUR , K . M . & YONGE , C . M . (eds) Physiology of Mollusca. Academic Press , New York, 547-590. WENRICH, D . H . 1916 . Notes o n th e reaction s o f bivalve mollusks t o change s i n ligh t intensity : imag e formation in Pecten. Journal of Animal Behaviour, 6, 297-318. WILKENS, L . A . 1981 . Neurobiolog y o f th e scallo p (Pecten ziczac): 1 . Starfish-mediate d escap e behaviours. Proceedings o f th e Royal Society o f London, Series B, 211, 341-372 . WOLF, B . M . & WHITE, R . W . G. 1997 . Movements an d habitat us e o f th e Quee n scallop , Equichlamys bifrons, i n the D'Entrecasteaux Channe l an d Huron River estuary , Tasmania . Journal o f Shellfisheries Research, 16, 533-539. WOLFF, M . & ALARCON , E . 1993 . Structure o f a scallo p Argopecten purpuratus (Lamarck , 1819 ) dominated subtidal macro-invertebrat e asemblag e i n norther n Chile. Journal o f Shellfisheries Research, 12 , 295-304. YONGE, C. M. 1936. The evolution of the swimming habit in th e Lamellibranchia . Memoires d u Musee Royal d'Histoire Naturelle de Belgique, 3, 77-100 .

This page intentionally left blank

Functional anatomy of the digestive system of Neoteredo reynei (Bartsch, 1920) and Psiloteredo healdi (Bartsch , 1931) (Bivalvia: Teredinidae) SONIA G. B. C. LOPES, OSMAR DOMANESCHI, DANIELA T. DE MORAES, MARISA MORITA & GEORGEANA DE L. C. MESERANI Departamento de Zoologia, Institute de Biociencias, Universidade de Sao Paulo, PO Box 11.461, CEP 05422-970, Sao Paulo, Brazil (e-mail: sonialop@ uol.com.br) Abstract: Studies on the digestive system of the Teredinidae ar e useful for a better understanding of th e evolutio n o f thes e bivalve s in relatio n t o th e xylophagou s habit. Neoteredo reynei an d Psiloteredo healdi, two common species in Brazilian mangroves, have evolved differently in their methods t o us e woo d a s food , despit e th e similaritie s i n th e anatom y an d functionin g of thei r globular typ e II stomachs . N. reynei i s predominantly xylophagous throughout its life , whil e P. healdi, despit e it s predominan t suspension-feedin g habit , use s woo d mor e efficientl y a s th e animal grows older. The outstanding differences tha t allow these conclusions are the large size of the appendi x an d ana l cana l i n N. reynei, always conspicuou s an d packed wit h wood , an d th e small appendi x o f P . healdi, whic h increase s i n siz e wit h age . Base d o n anatomica l dat a an d revision of the literature, it is suggested that in both species the appendix, and also the anal canal in JV . reynei, is o f primar y importanc e i n th e digestio n o f woo d an d absorptio n o f nutrients , counterbalancing the reduced specialized digestive diverticula.

The Teredinidae ar e important organisms in marine and estuarin e ecosystems , contributin g t o th e reduction o f woo d i n th e sea . The y firs t appea r i n the fossi l recor d i n th e Lowe r Cretaceous , thei r radiation bein g relate d t o th e evolutio n o f wood y plants, whic h provid e substrat a i n th e for m o f driftwood, an d the evolutio n o f salt-toleran t plant s (Turner 1966 ; Turne r & Johnso n 1971) . I n th e course o f thei r evolution , th e woo d wa s use d primarily fo r protection and , later, a s food (Turne r & Johnson 1971 ; Hoaglan d & Turner 1981) .

Mechanisms of wood digestion The mechanisms of wood digestion, a s well a s the origin of necessary cellulolytic enzymes , have been revised by Nair & Saraswathy (1971), Rosenberg & Cutter (1973) , Morto n & McQuisto n (1974) , Morton (1978 , 1983 ) an d Man n (1984) . Endosymbiotic bacteri a have been demonstrate d i n the ctenidi a o f th e Teredinida e b y Popha m & Dickson (1973 ) an d wer e late r show n t o diges t cellulose i n vitro, fi x nitroge n (Warterbur y e t al. 1983), an d to produce proteolytic, xylanolyti c and cellulolytic enzymes (Greene & Freer 1986 ; Green e et a l 1988 , 1989) . Thes e bacteria l endosymbion t populations, previousl y describe d a s th e glan d o f Deshayes (Sigerfoo s 1908) , ar e now thought to be

essential i n this intriguing process of evolution that allowed th e Teredinida e t o us e woo d a s food . Similar bacteri a wer e recently demonstrate d i n the ctenidia o f tw o Xylophaga specie s (Pholadidae ) which are now considered the ecological equivalen t of the Teredinidae in the deep sea (Distel & Roberts 1997). Although th e symbion t activit y ar e appropriat e for a wood-based diet, no direct evidence exists for their participatio n i n th e woo d digestio n i n ship worms, no r i t i s clea r ho w th e digestiv e enzymes produce d b y th e endosymbion t i n th e ctenidia ar e transporte d t o th e lume n o f th e gu t (Distel & Roberts 1997) . In the Teredinidae, a welldefined duct , previousl y describe d b y Sigerfoo s (1908) a s a duc t o f th e Deshaye s gland , ca n b e traced insid e an d alon g th e extensio n o f eac h afferent branchia l vessel. The only reference in the literature that describes thes e ducts opening into an organ (the oesophagus) o f the digestive system , and discharging it s content s t o hel p i n th e digestiv e process, i s tha t o f Saraswath y & Nai r (1971 ) fo r Teredo furcifera vo n Martens 1894 .

Morphological adaptations The evolution of the capability of wood digestion in the Teredinidae i s also relate d t o the specializatio n

From: HARPER, E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications , 177 , 257-271 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

258

S. G . B . C . LOPE S ETAL.

of the digestive diverticula and modifications of the stomach. The y ar e uniqu e amon g th e lamelli branchs i n possessin g specialize d digestiv e diverticula relate d t o th e digestio n o f woo d i n addition th e norma l one s responsibl e fo r th e digestion o f suspensio n food s (Pott s 1923 ; Yong e 1926; Turne r 1966 ; Morto n & McQuisto n 1974 ; Morton 1983) . Three differen t type s o f stomac h occu r i n th e Teredinidae (Turne r 1966) : globula r typ e I ; globular typ e II; elongate typ e III. Globula r typ e I is exclusiv e t o th e Kuphinae , globula r typ e I I i s most frequently encountere d in the Teredininae and elongate typ e II I in th e Bankiinae . Morphologica l characteristics o f th e stomach , suc h a s it s elongation, reductio n o f th e crystallin e style , enlargement o f th e appendi x an d containe d typhlosole, hav e bee n considere d t o reflec t th e increasing abilit y o f the Teredinidae t o feed mainl y on woo d (Turne r 1966 ; Turne r & Johnso n 1971 ; Morton 1978 ; Hoaglan d & Turne r 1981) . Reduction o f th e labia l palps , an d lengt h an d height o f th e demibranchs , ar e indicativ e tha t th e suspension food s ar e relativel y les s importan t than woo d i n th e die t o f th e shipwor m (Turne r 1966). The Teredinina e specie s Neoteredo reynei an d Psiloteredo healdi, two common inhabitants in the same Brazilian mangroves, both have globular type II stomachs . Comparin g thei r ctenidia , palp s an d appendix, Turne r (1966 ) pointe d ou t difference s indicative tha t th e forme r specie s i s mor e dependent o n woo d a s a sourc e o f foo d tha n th e latter. Th e comparativ e analyse s o f th e interna l anatomy an d th e functionin g o f th e digestiv e system performe d i n thi s stud y provide ne w dat a which allo w a bette r understandin g o f ho w thes e two Teredininae specie s evolved differen t method s of usin g woo d a s food , despit e havin g th e sam e globular type II stomach.

Materials and methods Neoteredo reynei an d Psiloteredo healdi wer e collected i n the sam e mangrove are a i n Sa o Paul o State, Brazil (22°30'S; 45°15'W). Th e first specie s is more abundant in regions of the mangrove fores t less frequently covere d by seawater, while the latter is restricte d t o submerge d log s i n a sectio n o f a tributary river where the salinity is very low (Lopes & Narch i 1993) . Log s collecte d i n thes e region s were kept i n aquaria at a salinity of 20% c and 10% c for N. reynei an d P. healdi, respectively. More than 50 living, as well as many fixed, specimens o f each species were analysed in the present study. Some of the anatomica l detail s wer e obtaine d fro m transverse section s (8-1 0 jam thick ) staine d wit h

Mallory's tripl e stain , o r Ehrlichs' s hematoxyli n and eosin , accordin g t o th e method s describe d b y Pantin (1948) . The epithelium o f the appendi x an d anal cana l o f N . reynei wa s prepare d fo r exami nation unde r a scannin g electro n microscop e (SEM), usin g the sam e technique s adopte d by Leonel^a/. (1998) . Ciliary current s o n th e interna l wall s o f th e stomach were observed using powdered san d grains and suspension s o f carmine , Acquada g an d ver y fine sawdus t fragments. Sawdust wa s obtaine d b y rubbing a mangrove log with a dentist's drill . Such materials wer e applie d t o th e ciliar y tract s eithe r mixed o r separately . Variations i n th e diamete r o f th e appendi x o f P. healdi were evaluated in relation t o the shell length . The latter was adopted as a parameter to express the size o f th e specimens , sinc e thes e bivalve s shrin k when removed fro m wood .

Results General disposition of organs in the mantle cavity The disposition s o f the majo r organ s in the mantl e cavity of N. reynei an d P. healdi ar e show n in Fig . la an d b , respectively . Th e ctenidi a (prc ) o f N . reynei compris e onl y th e oute r demibranch s an d these exten d fro m th e bas e o f th e siphon s t o th e posterior extremit y o f th e viscera l mass , an d occupy c . 20 % o f th e bod y length . Th e demibranchs anteriorl y reduc e abruptl y i n height , becoming restricte d t o the foo d groov e (fg ) which extends forwar d t o mee t th e ver y reduce d labia l palps (1) . Th e anterio r portio n o f th e ctenidi a present i n mos t Teredinida e i s lackin g i n thi s species. The ctenidi a o f P. healdi diffe r fro m thos e o f N . reynei i n th e presenc e o f a n anterio r portio n (ape ) made u p o f onl y 15-1 9 filament s o f th e externa l lamella. Th e posterior region of the organ occupie s c. 68 % o f th e bod y lengt h an d i s highe r tha n th e corresponding regio n i n N. reynei. Immersed i n the tissue o f th e interlamella r junction s o f th e demibranchs o f bot h specie s occu r th e so-calle d gland o f Deshayes . Cellulolyti c nitrogen-fixin g bacterium was demonstrated i n the demibranchs of R healdi b y Waterbur y e t al (1983) . Histologica l sections allowed th e duct of the gland of Deshaye s to be traced inside each afferen t branchia l vessel of both species , bu t n o direc t connectio n wit h an y organ o f the digestiv e syste m wer e detecte d i n th e present work . The dorsa l labia l palp s o f P . healdi hav e a n expanded fre e dista l end , unlike those o f N. reynei, which ar e represente d b y a slende r an d lo w

DIGESTIVE SYSTE M O F NEOTEREDO AN D PS1LOTEREDO

259

Fig. 1 . (a) Neoteredo reynei an d (b) Psiloteredo healdi. General topograph y o f the organs and structures o f the mantle cavity, ach, Anterior cephalic hood; arc, anterior region of the ctenidium; dip, dorsal lappets; ec, epibranchial cavity; es, exhalant siphon; f, foot; fg , food groove ; he, hypobranchial cavity; is, inhalant siphon; ire, intermediate regio n of the ctenidium; 1 , labial palp ; m, mantle; me , mantle collar; p, pallet; prc, posterior regio n o f the ctenidium; pam , posterior adducto r muscle; pch, posterior cephali c hood ; vm, visceral mass .

epithelial fold . Th e ventra l labia l palp s o f bot h species ar e equall y reduce d t o slende r an d lo w folds.

General configuration of the digestive system The genera l configuratio n o f th e digestiv e syste m of N. reynei an d P. healdi are shown in Fig. 2 a and b, respectively . Th e nomenclatur e adopte d i n th e description o f thei r structure s i s th e sam e o f Purchon (1960 , 1987 ) an d Lopes e t al (1998) . A complete description i s given for N. reynei and only significant difference s i n the digestive syste m of P. healdi will be pointed out. N. reynei. Th e slit-lik e mout h is located dorsall y to th e foo t an d open s int o a ver y short , dorso ventrally flattened , oesophagu s (o ) tha t enter s th e stomach antero-dorsally . Th e stomac h (st ) ha s a globular regio n sheltere d withi n th e limit s o f th e shell valves , fro m whic h th e appendi x (a ) arises . This structur e is an elongate an d cylindrical pouch , corresponding to c. 3CM4 % of the body length. Its

diameter is relatively constan t and roughly equal to that o f th e globula r regio n o f th e stomach . Th e appendix open s int o the righ t sid e o f the posterior wall o f th e stomac h vi a a narro w aperture , the n enlarges abruptl y i n diamete r an d extend s backwards horizontall y throug h th e viscera l mas s which lies outside th e shell valves . The aperture of the appendi x int o th e stomac h i s precede d b y a corrugation o f th e stomac h wall , whic h begin s o n the dorsal side of the organ and extends to the right. Here the wall bulges in a conical fashion as it turns ventrally and , a t th e sam e time , i t spirals , embracing almos t completel y th e proxima l en d of the appendix. The globula r regio n give s als o ris e t o th e style sac (ess) , th e dorsa l hoo d (dh) , th e combine d lef t pouch an d left caecu m (Ip/lc ) and the right caecu m (re). Well-develope d norma l digestiv e diverticul a (NDD) surroun d the combine d lef t caecum/lef t pouch an d th e righ t caecum , an d hid e th e poorl y developed specialize d digestive diverticul a (SDD) . These tw o kind s o f digestiv e diverticul a ope n exclusively int o these embayment s of the stomac h

260

S. G . B . C . LOPE S ETAL.

Fig. 2 . (a) Neoteredo reynei an d (b) Psiloteredo healdi. Diagrammatic representation of the anterior third of the body dissected to expose the digestive system, a, Appendix; an, anus; an.c, anal canal; ess, crystalline style-sac; DD , digestive diverticula; dh, dorsal hood; ec, epibranchial cavity; f, foot; g , gonads; h, heart; he, hypobranchial cavity; i, intestine; k, main portion of the kidney; Ic/lp, combined lef t caecum/lef t pouch ; m, mantle; o, oesophagus; pam, posterior adducto r muscle; prc, posterior region o f the ctenidium; st, stomach.

and kee p th e sam e relativ e developmen t independently o f th e siz e o f th e specimen. Externally, th e ND D an d th e SD D ar e simila r i n appearance bu t diffe r i n thei r histologica l organization, whic h correspond s t o tha t illustrate d by Saraswath y & Nair (1971 ) fo r the specie s the y have analysed. A shor t an d distall y widene d style-sa c opens a t the floo r o f th e stomach , clos e to , bu t separate d

from, th e openin g o f th e intestin e (i) . Fro m it s opening i n the stomach , th e style-sa c slant s t o the right an d ventrall y ending where i t make s contac t with the sol e of the foot. Th e blind tip of the stylesac bear s a smal l bag-lik e evagination , th e appendix o f the style-sac . The dorsa l hoo d i s a larg e conica l pocke t tha t emerges fro m th e lef t dorsa l sid e o f th e stomac h and narrow s graduall y a s i t extend s forwar d an d

DIGESTIVE SYSTE M OF NEOTEREDO AN D PSILOTEREDO

describes a complete spiral . Thi s i s in a clockwise direction when the stomach is observed dorsally . The lef t caecu m an d th e lef t pouc h form a combined structur e which opens int o th e stomac h through a common and broad opening, with no gap between them. The left caecum lies anteriorly t o the dorsal hood an d can be define d by the presence of a smal l dorsa l swellin g an d tw o long , slender , antero-ventral compartments , int o whic h severa l ducts fro m th e ND D open . A fe w duct s fro m th e poorly develope d SD D ope n int o th e lef t caecum . The lef t pouc h i s a flattened, leaf-like , evaginatio n ventral t o th e dorsa l hood . Som e duct s fro m th e NDD ope n nea r th e blin d en d o f thi s pocket . Th e relationship between these ducts with the left pouch or left caecu m is difficult t o establish. The right caecum is a large evagination near the entrance o f th e oesophagu s int o th e stomach . Just after it s emergenc e fro m th e stomach , i t receive s ducts fro m th e SD D an d give s ris e t o thre e com partments. Th e shor t anterio r firs t compartmen t extends ventrally and receives duct s from th e NDD and th e SDD . A secon d compartment , longe r i n length an d wide r i n diamete r tha n th e precedin g one, extend s ventro-posteriorl y clos e t o th e stomach wal l an d receive s duct s onl y fro m th e NDD. The third compartmen t begin s dorsall y a s a broad cylindrical structur e that declines abruptly in diameter half-wa y alon g it s dista l end , whic h lie s dorsally t o th e posterio r adducto r muscle . Thi s compartment receives a large number of ducts fro m the ND D an d i s completel y envelope d b y thes e digestive glands. The intestin e leave s th e floo r o f th e globula r region o f th e stomac h nea r t o an d ventra l t o th e opening o f th e appendix . Thence , i t extend s ventralward fo r a shor t distance , an d the n turn s abruptly forward an d immediately swells to form a large bulbous region (bu). As the mid-gut proceeds forward, i t returns t o its initial diameter , curve s t o the righ t an d extend s ont o an d embrace s dorsall y the style-sac , making a loose loop . Fro m her e th e intestine extend s backwards , runnin g ventrall y t o the stomac h an d th e lon g appendix . A t th e dista l end o f the appendi x th e intestin e make s a loop t o run forwards, dorso-laterally to the structure. Then , the intestin e embrace s th e anterio r an d th e dorsa l sides o f the posterior adducto r muscle and finishe s in the anus (a), immediately afte r the posterior limi t of th e shel l valves . Thi s termina l par t o f th e intestine, dorsal to the posterior adductor muscle, is completely envelope d b y the NDD leading fro m the right caecum. The anu s (a) opens into the ana l canal (an.c), an enormous, dorsall y located , cylindrica l tub e tha t extends backwards throughout the extension of the visceral mass. A strong muscular sphincter controls the aperture o f the anal cana l int o the epibranchia l

261

chamber. Th e walls o f th e ana l cana l ar e richl y provided wit h bloo d vessels , cili a an d microvill i (Fig. 3a) . Th e specie s eliminate s powder y faece s and, eventually, small oval faecal pellets . Psiloteredo healdi. Th e genera l configuratio n o f the digestive system of this species is similar to that of N. reynei. Differences betwee n the m are mainly related to : th e longe r oesophagus ; th e less developed righ t caecum , wit h onl y tw o semi cylindrical compartments ; the shorte r appendi x (c . 15-20% o f th e bod y length) , whic h varie s i n diameter i n differen t specimens ; a smalle r semi spiral conica l projectio n i n P . healdi. This specie s also has smalle r amount s of SDD and a very larg e style-sac and crystalline style. In N . reynei th e gonad s d o no t surroun d th e appendix, whil e i n P . healdi the y almos t concea l this pocket in mature individuals. The development of th e appendi x an d gonad s o f P . healdi sho w a tendency to be inversely related t o the animals ag e (Fig. 4) . O f th e 3 8 specimen s examine d (Fig . 5) , most of those with a shell length < 7.5 mm (n = 20)

Fig. 3 . Neoteredo reynei. (a) SE M of the internal surfac e of the anal canal an d (b) SE M of the appendix, c, Cilia; mv, microvilli. Scale bars, 1. 0 jam.

262

S. G . B . C . LOPE S E T AL.

Fig. 4 . Psiloteredo healdi. Transvers e section through the visceral mass showing variation s in the development of the appendix an d gonads amon g 3 8 specimens fro m 3. 0 to 17. 0 m m in shell length, (a) Smal l appendi x an d poorl y developed gonads; (b) small appendix and well-developed gonads; (c) large appendix and well-developed gonads; (d) large appendi x an d poorly develope d gonads . a , Appendix; g , gonads; i , intestine; ta , typhlosole o f the appendix .

had a smal l appendi x frequentl y associate d wit h a well-developed gonad . Th e revers e situatio n occurred in all animals with a shell length < 2.5 mm (n = 5). Specimen s o f intermediat e siz e (8.0 12.0 mm) ( n = 13) exhibite d a mosai c o f th e preceding situations. The intestin e o f P. healdi differs fro m tha t o f N . reynei mainl y i n it s fina l portion , whic h extend s well behin d th e posterio r limi t o f th e shel l valve s and finishe s mid-wa y alon g th e pericardia l cavity . The ver y shor t ana l cana l begin s a t th e ana l opening, exhibitin g a uniform diameter, simila r t o that of the intestine, throughou t it s length. It s wid e opening int o th e epibranchia l cavit y lack s a muscular sphincte r an d faeces d o no t accumulat e within thi s compartmen t o f th e digestiv e system . Faeces ar e alway s eliminate d a s lon g cylindrica l rods.

Internal anatomy of the digestive system Neoteredo reynei. Th e interna l anatom y o f th e stomach o f N . reynei an d it s ciliar y current s ar e illustrated i n Fig s 6 an d 7 . Th e inne r wal l o f th e oesophagus (o) has longitudinal folds and two welldeveloped latera l grooves . Cili a impe l particle s entangled i n mucu s t o th e hea d o f th e crystallin e style. Isolate d particle s ar e passe d int o th e dorsa l

hood b y cili a o n a long fol d (R ) that extends fro m the lef t dorsa l sid e o f th e apertur e o f th e oesophagus to the distal end of the dorsal hood. The crystalline style (cs) is short an d pear shaped , with the part that projects int o the stomach bein g slende r and frequentl y twisted . The inne r dorsal surfac e of the style-sac (ess) has a longitudinal groove . The gastri c shiel d (gs ) i s a saddle-shape d structure. It lines the floor and the posterior wal l of the stomac h fro m th e openin g o f the style-sa c an d sends wing-shaped projections into the dorsal hood and lef t pouch . In severa l individuals , the gastri c shield wa s brillian t yellow . Th e dorsa l hoo d (dh ) has folds o n its inner wall (R, Rl, R2 and R4) and a sorting area (SA3 ) flanked by Rl an d R2. A fin e longitudinal striate d are a occur s betwee n fold s R 2 and R4 . Fold R l begin s a s a smooth , lo w ridg e i n th e distal en d of the dorsal hoo d becomin g higher; th e side facin g SA 3 i s slightl y transversel y plicate . I t leaves th e dorsa l hood , passe s dorsall y t o th e opening o f th e oesophagu s an d finishe s abruptl y dorsal t o th e openin g o f th e righ t caecum . Th e ciliary current s o n bot h face s o f fol d R l conduc t particles obliquely onto the crest, where cilia throw them ove r fol d R to be accumulated nea r th e win g of the gastric shield . Fold R 4 i s locate d posteriorl y an d begin s a s a

DIGESTIVE SYSTE M O F NEOTEREDO AN D PSILOTEREDO

263

smooth, lo w ridg e i n th e dista l en d o f th e dorsa l hood, immediatel y becomin g highe r wit h on e fac e slightly transversel y plicate . I t leave s th e dorsa l hood, passes dorsall y to the oesophagus, becomin g smooth, an d terminate s i n th e dorsa l sid e o f th e stomach. Ciliar y current s o n thi s fol d conduc t particles t o it s basa l regio n wher e the y ar e concentrated near the gastric shield . Fold R 2 an d SA 3 begin i n the dista l en d o f th e dorsal hood an d extend i n a dorsal directio n t o the dorsal right side of the stomach , terminating in the distal en d o f th e semi-spira l conica l projectio n (scp). Along the folds o f SA3, ciliary current s conduct small particles from crest to crest in the direction of the dorsa l hood . A s th e smal l particle s ar e transported the y ar e abl e t o for m larg e masses . These masses , an d larger particles, ar e captured by ciliary activit y i n th e groove s amon g th e fold s o f SA3. I n th e righ t dorsa l regio n o f th e stomach , these particles are conducted either to the intestinal groove or they pass over the typhlosoles and make contact with the strong ciliary current s on the floo r of th e stomach . I n th e regio n wher e fold s R l an d R2 delimit SA3 , the particles ar e conducted to Rl. The cili a o n R2 , an d o n th e longitudinall y striated are a between R 2 and R4, remove particle s from th e dorsa l hoo d toward s th e semi-spira l conical projection . Thi s structur e has a n extension of S A3 on its anterior wall and on the posterior wall there is another well-developed sortin g area (SA11) which extends dorsal wards around, and anterior to, the opening of the appendix into the stomach. Fol d R2 withi n th e 'scp ' separate s SA 3 fro m SAI L Deep troughs between the transverse folds of S All give th e externa l wal l o f th e 'scp ' a corrugate d appearance, whic h varie s accordin g t o th e contracted state of the stomach. Cilia on the folds of SA11 conduct particles obliquely from crest to crest onto the aperture of the appendix . At th e ventra l edg e o f th e mout h o f th e dorsa l hood, anothe r transversel y folde d sortin g are a (SA8) begins. It passes ventrally to the oesophagea l opening and ends on the roof of the entrance to the right caecum. Isolated particle s conducte d b y SA 8 in th e suboesophagea l regio n ar e caugh t b y a transverse ciliar y trac t nea r th e openin g o f th e oesophagus and are conducted onto fold Rl. Those particles conducte d by SA 8 o n the ventra l edge of the dorsa l hoo d ar e conducte d int o thi s structur e Fig. 5. Psiloteredo healdi. Relative percentages of the and caught by a ciliary tract that accumulates them variations described in Fig. 4 among specimens o f three in the margin of the gastric shield . classes of shell length: (a) 3.0-7.5 mm (n = 20); (b) On the anterio r wal l of the stomach , an d ventral 8.0-12.0 mm (n = 13); (c) 12.5-17. 0 mm (n = 5). Black to SA8 , there i s anothe r sortin g are a (SA7) segments, small appendix and poorly developed gonads ; consisting o f larg e an d well-space d folds , whic h cross-hatched segments , smal l appendix and wellslightly ente r th e righ t caecu m an d th e lef t on e developed gonads ; stippled segments , large appendi x and deeply. Withi n thes e caeca , SA 7 become s incon well-developed gonads; open segments, large appendix spicuous, bein g difficul t t o follo w alon g it s entir e and poorly developed gonads .

264

S. G . B . C . LOPE S ETAL.

Fig. 6 . Neoteredo reynei. Interna l anatomy of the stomach seen after bein g opened by a dorsal longitudina l incision, a, Appendix; cs , crystalline style ; dh, dorsal hood ; gs , gastric shield ; i , intestine; ig , intestinal groove ; Ic/lp, commo n opening of the combined lef t caecum/lef t pouch ; mt, minor typhlosole; o, oesophagus; P, R, Rl, R2 and R4, folds of the stomach wall ; rc/SDDD, openin g o f the right caecum/openings of ducts fro m th e specialized digestive diverticula at the entrance of the right caecum; SA3, SA6, SA7, SA8 and SA11, sorting areas; scp , semi-spira l conica l projection ; ta, typhlosole o f the appendix; ty, major typhlosole . Arrows show the main ciliary currents .

DIGESTIVE SYSTE M OF NEOTEREDO AN D PSILOTEREDO

265

Fig. 7 . Neoteredo reynei. Internal anatomies of: (a) the combined left caecum/lef t pouch; (b) the right caecum, gs, Wing of the gastric shield within the compartment corresponding t o the left pouch ; mt, minor typhlosole; NDDD and SDDD, openings of the ducts from th e normal and specialized digestiv e diverticula, respectively; P, fold o f the stomach wall; SA6 and SA7, sorting areas; ty, major typhlosole . Arrow s show the main ciliary currents.

266

S. G . B . C . LOPE S ETAL.

course. Wher e thi s sortin g are a i s evident, cili a on the folds carry particles on to SA8 and those on the troughs in an opposite direction. Large and/or dense particles o n the troughs of SA8 are conveyed to the intestinal groov e (ig) , whic h i s protecte d b y th e major typhlosol e (ty) , and light material is thrown over thi s fol d an d returne d t o genera l circulatio n within the stomach . The majo r typhlosol e i s accompanie d alon g it s entire course by the intestinal groove and begins as a low fold of the inner wall of the intestine, wher e it describe s a loo p ove r th e dorsa l surfac e o f th e style-sac. A t th e bulbou s regio n o f th e intestin e (bu), th e majo r typhlosol e become s talle r an d spiralled but, before entering the stomach, it returns to its initial height. The mino r typhlosol e (mt ) arise s withi n th e bulbous region o f the intestine an d runs parallel to the major typhlosole , flanking th e intestinal groove along it s entir e cours e insid e th e stomach . Th e minor typhlosol e i s no t alway s eviden t bu t th e major typhlosol e i s wel l developed , overlappin g and protectin g the intestina l groove and eve n the minor typhlosole. The typhlosole s emerg e fro m th e intestin e an d run latero-ventrally on the right side of the stomach, where the y penetrate deepl y int o the right caecum (re). Leavin g th e righ t caecum , th e typhlosole s cross the anterior floor of the stomach, ventrally to SA7 i n th e suboesophagea l region , an d penetrat e the left caecu m (Ic), where they terminate. The lef t caecu m an d th e lef t pouc h (Ip ) ar e no t separated internall y b y a wall ; thes e tw o pocket s are herei n regarde d a s th e combine d lef t caecum/left pouc h (Fig . 7) . Th e lef t caecu m i s defined b y th e cours e o f th e majo r typhlosole , which penetrate s deepl y withi n thre e mai n compartments, an d send s flare s int o th e mout h of some ducts from th e NDD. The major typhlosole i s always accompanie d b y th e mino r typhlosol e and the intestina l groove , circumnavigatin g th e lef t caecum i n a n anticlockwis e directio n whe n th e stomach i s observed dorsally, terminating near the mouth o f th e mos t ventral , long, tubular compartment. A few ducts from th e SDD open into the lef t caecum withi n th e are a delimite d b y th e majo r typhlosole. Suc h duct s ar e concentrate d nea r th e apertures o f th e tw o antero-ventra l compartments. Strong ciliar y current s alon g th e majo r typhlosol e and on the area circumscribed by this fold conduct particles onto the apertures of the ducts of the NDD and the SDD. Particles wer e not observed entering these ducts. Nevertheless, pressin g on the NDD and the SD D frequentl y evoke d th e regurgitation of an amorphous mass of microscopic particles. The lef t pouc h i s define d b y th e presenc e o f a wide sortin g are a (SA6 ) whic h comprise s fin e transverse striations . Thi s are a extend s alon g th e

roof an d floo r o f th e lef t pouch , an d extend s ove r the anterio r fac e o f a tall , shield-like , prominenc e (P) which protects tha t part o f the crystalline styl e emerging int o the stomach. Within the left pouch, a smooth are a divide s SA 6 int o tw o band s o f different widths , the narrower band being contiguous with the gastric shield . The portion of SA6 on the floo r o f th e lef t pouc h conduct s an d concen trates particle s nea r th e win g of th e gastri c shiel d within thi s pocket , whil e tha t o n th e roo f concentrates materia l o n it s anterio r margin . Material entangle d i n mucu s is probabl y capture d by the rotating crystalline style. On fold 'P' , sorting area SA 6 conducts particles to the crystalline style . The right caecum and its three compartments are invaded deepl y b y th e typhlosole s an d thei r accompanying intestinal groove (Fig. 7). The major typhlosole send s flares into some ducts of the NDD. Ducts from the SDD open into a shallow depression just at the entrance to the right caecum (Fig. 6) and into another one in the anterior compartment o f this pocket. Vigorou s ciliar y current s o n th e majo r typhlosole an d o n th e are a circumscribe d b y thi s fold conduc t particle s toward th e openin g o f th e ducts o f th e digestiv e glands . Onl y larg e particle s are passe d int o the intestina l groove an d removed from th e stomach. The appendi x ha s a well-develope d typhlosol e on it s floo r whic h extend s fro m th e mout h t o th e distal end of this pocket. The fre e dorsa l margi n of this fold form s a low irregularl y swolle n cres t that shows slow movements. A t the narrow entrance of the appendix , th e proxima l en d o f th e typhlosol e meets anothe r elevate d fol d comin g fro m th e aperture o f th e intestine , whic h act s a s a barrie r against rejectio n o f isolate d particle s withi n th e stomach. Al l dissecte d animal s ha d a n appendi x filled wit h woo d particles . I n a fe w specimens , weak ciliar y activit y wa s observe d o n th e epithelium o f th e appendix . Thi s epitheliu m i s richly provided with microvilli (Fig. 3b) . Particles selected on SA11 enter th e appendix a t its right side. Those particles contacting the crest of the typholosol e segregat e laterally . Longitudina l currents along the base of the crest conduct a string of mucu s wit h entangle d materia l ont o th e dista l end o f th e appendi x o n th e righ t side , an d i n th e opposite directio n o n th e lef t side . A simila r behaviour wa s detecte d o n th e floo r o f th e appendix, wher e ciliar y tract s conduc t particle s arriving fro m th e latera l wall s backwards towards the blind end of the appendix, and forwards and out of this pocket o n the right side . Such currents see m to exert little influence o n the wood packed within the appendix . Movement s o f th e appendi x an d contractions of the body may be responsible for the discharge of particles fro m th e appendix. Particles o n the right side of th e proximal ti p of

DIGESTIVE SYSTE M O F NEOTEREDO AN D PSILOTEREDO

the typhlosol e i n th e appendi x wer e slowl y removed ont o a blind depressio n contiguou s with and anterio r t o th e apertur e o f th e intestine . Th e major typhlosol e i s hig h a t th e entranc e o f th e intestine and, along with the fold emerging from the intestine and extending onto the appendix aperture, creates an efficient barrie r agains t excessive loss of material circulatin g withi n th e stomach . Vigorou s ciliary activit y on the cres t o f both folds recaptur e isolated particle s leaving the appendi x and SA 3 at the entranc e o f th e spira l conica l projection , returning them to the general circulation within the stomach. Onl y a fe w particle s escap e thi s barrie r and are rejected via the intestine. Ciliary mechanism s withi n th e righ t sid e o f th e appendix, and on the crest of the major typhlosole , may be responsible for the return of wood particles stored i n th e appendi x t o th e mai n cavit y o f th e stomach. Vigorous ciliary tracts on the floor o f this organ carry particles forward, segregating them into the right caecum and the combined left caecum/left pouch. Woo d particle s store d i n th e appendi x ca n thus b e resubmitte d t o th e sortin g device s o n th e stomach wal l an d re-presente d t o th e digestiv e glands. All materia l leavin g th e stomac h vi a th e intestinal groov e an d appendi x enters th e intestine and i s accumulate d i n th e enormou s ana l canal . This structur e wa s alway s full , mainl y wit h woo d particles. Despit e th e presenc e o f cili a o n it s epithelium, n o ciliar y current s wer e detecte d removing materia l int o th e epibranchia l cavity . Discharge o f materia l fro m th e ana l canal ma y b e largely accomplishe d b y muscula r activit y i n it s walls, an d improve d b y th e foreshortenin g o f th e animal. The efficient sphincte r at the aperture of the anal cana l control s th e exi t o f materia l an d contributes t o it s lon g residenc e i n thi s compartment o f the digestive system . Psiloteredo healdi. Th e anatomy and functionin g of th e stomac h o f thi s specie s (Fig s 8 an d 9 ) i s similar to that of N. reynei. Differences ar e mainly related to the anatomy of the organ, and refer to the greater extensio n o f fol d R4 , th e absenc e o f a smooth are a dividin g SA 6 withi n th e lef t pouch , SA7 i s no t detecte d withi n th e lef t caecu m an d SA11 is less developed .

Discussion The functiona l anatom y o f stomac h typ e I I o f Turner (1966 ) i s know n onl y fro m th e wor k o f Purchon (1960 ) an d from th e present study . Lazier (1924), Morto n (1970), Martine z (1987 ) an d Lopes et al (1998 ) studie d typ e II I stomachs . Th e fe w species analyse d b y thes e author s shar e th e sam e

267

structural typ e o f stomach , whic h correspond s t o type V o f Purcho n (1960) , regardles s o f thei r globular or elongate form. All o f the fold s described for th e stomac h o f N . reynei an d P . healdi, excep t fo r fol d R4 , ar e homologous t o th e correspondin g fold s describe d by Purcho n (1960) . Sinc e Purchon' s terminolog y was adopte d i n the present work , and he describe d only fold s R , Rl , R 2 an d R 3 i n th e stomach s h e studied, the newly described fold in N. reynei and P. healdi was identified a s R4. Elongation o f th e stomac h wa s considere d b y Turner (1966 ) t o be a specialization fo r increasin g the efficiency o f wood digestion. Stomac h typ e III is morphologicall y mor e comple x an d provide d with a larger amount of SDD than globular stomach type II. Intracellular digestion of wood fragments in these gland s (Morto n & McQuiston 1974) , and the finding o f a true cellulase withi n the SDD (Morton 1983), lea d t o th e conclusio n tha t i n th e specie s with larg e amoun t of SD D th e woo d i s relativel y more important than suspension i n their diet. N. reynei ha s a globula r stomac h typ e I I an d reduced SDD , condition s which , considere d sep arately, could indicate a predominantly suspension feeding mod e o f life . Othe r anatomica l character s indicative o f a preferre d woo d diet , suc h a s th e possession o f extremely reduce d labia l palps, shor t ctenidia, a small crystalline styl e and, particularly, a large appendix always packed with wood particles , do no t suppor t this conclusion . Th e las t conditio n indicates that the species keeps the wood store d for a long period o f time. The identificatio n of microvilli i n th e epithelia l cell s o f thi s pocke t strongl y suggests tha t the y pla y a n importan t rol e i n th e absorption o f nutrients , probabl y thos e derive d from th e digestio n o f it s store d wood . Th e microvillar borde r identifie d b y Bazylinsk i & Rosenberg (1983 ) i n th e epithelia l cell s o f th e appendix of several Teredo an d Bankia specie s le d these author s to attribut e an absorptive function t o this pocket . Man n (1984 ) subscribe s t o th e hypo thesis tha t th e appendi x act s a s a n activel y mixe d incubator fo r extracellula r cellulas e activity . Considering both hypothesis, the retention of wood fibres for a long period i n the appendix o f N. reynei could provid e th e necessar y tim e fo r extracellula r cellulase activity , followin g absorption , counter balancing th e scarcit y o f SD D an d enlargin g th e capability of the specie s t o feed o n wood. Wood particle s leavin g the appendix ca n return to the genera l circulation in the mai n cavity of the stomach an d be resubmitted t o the sortin g device s on its walls. Those captured by the vigorous ciliary tracts o n th e majo r typhlosol e an d o n th e floo r o f the organ may be conducted ont o the right caecu m and onto the combined left caecum/left pouch, to be taken to and digested by the SDD .

268

S. G . B . C . LOPE S ETAL.

Fig. 8 . Psiloteredo healdi. Internal anatomy of the stomach seen after bein g opened by a dorsal longitudina l incision. Specimen wit h an appendix o f small diameter, a, Appendix; cs , crystalline style ; dh, dorsal hood; gs , gastric shield ; i , intestine; ig, intestinal groove; Ic/lp, opening of the combined lef t caecum/lef t pouch ; mt, minor typhlosole; o, oesophagus; P , R, Rl, R2 and R4, folds of the stomach wall ; rc/SDDD, openin g o f the right caecum/opening s of ducts from th e specialized digestiv e diverticul a at the entrance of the right caecum; SA3, SA6, SA7 , SA 8 and SA11, sortin g areas; ty, major typhlosole. Arrow s show the main ciliary currents , x-y, boundary lin e tha t delimits th e region of the stomach depicted wit h modification i n Fig. 9c .

DIGESTIVE SYSTE M O F NEOTEREDO AN D PSILOTEREDO

269

Fig. 9 . Psiloteredo healdi. Internal anatomies of: (a) the combined left caecum/lef t pouc h and (b) the right caecum. (c) Posterior region of a stomach with a well-developed appendix. Section equivalent to the area circumscribed b y the broken line x-y i n Fig. 8. a, Appendix; gs, gastric shield; i, intestine; mt, minor typhlosole; NDDD and SDDD, openings of ducts from th e normal and specialized digestiv e diverticula, respectively; P, R2 and R4, folds o f the stomach wall; SA3 , SA6 and SA11, sorting areas; ta, typhlosole of the appendix; ty, major typhlosole . Arrows show the main ciliary currents.

270

S. G . B . C . LOPE S ETAL.

Long residenc e o f woo d particle s withi n th e enormous ana l cana l o f N. reynei ma y b e anothe r important device to allow enzymatic degradation of wood t o b e continued . Th e presenc e o f epithelia l cells richly supplied with microvilli, and the highly vascularized ana l cana l walls , sugges t tha t absorption occur s i n thi s pocket . Thes e probabl e roles played b y the anal canal greatly increase s the capability o f thi s specie s t o us e woo d a s food , despite th e globula r typ e I I stomac h an d reduce d SDD, a s compare d wit h stomac h typ e III . Thes e anatomical dat a ca n als o hel p t o explai n wh y thi s species i s mor e commo n i n mangrov e area s les s frequently submerge d b y the tides a s registered b y Rancurel (1971 ) an d Lopes & Narchi (1993) . Th e specialization fo r grea t storag e capacit y fo r woo d fragments in both the appendix and anal canal gives the specie s increase d independenc e o f suspende d food, contributin g t o th e successfu l occupatio n o f wood substrata, even at high tide levels. Anatomical character s suggestiv e o f a sus pension-feeding mod e o f life i n P. healdi are: long ctenidia; larg e crystallin e style ; minut e ana l cana l (always empt y o f faeca l material) ; reduce d appendix an d SI?D . Th e tendenc y o f progressiv e development o f th e appendi x a s th e anima l grow s older give s evidenc e o f feedin g flexibilit y i n P . healdi. When the appendix i s reduced, the animals rely mainly on suspended material. As the appendix enlarges, i t ca n ac t a s describe d fo r N . reynei, thereby allowin g th e anima l t o counterbalanc e it s reduced SD D b y usin g woo d a s foo d mor e efficiently. I n P . healdi, th e ana l cana l i s alway s reduced an d neve r retain s faeces , whic h ar e eliminated immediatel y fro m th e bod y a s lon g faecal pellets . Th e digestio n o f woo d apparentl y depends mainl y o n processes tha t occu r insid e th e appendix, sinc e th e reduce d SD D d o no t enlarg e following th e developmen t o f thi s pocke t an d th e anal canal is extremely reduced . Turner (1966 ) observe d i n Psiloteredo, an d i n other specie s wit h th e gonad s dorsa l t o th e appendix, tha t th e ana l cana l i s alway s empty , flattened an d inconspicuou s whe n th e gonad s ar e swollen. Consequently , suspensio n foo d become s more importan t tha n th e woo d i n th e reproductiv e period. Dat a obtaine d for P. healdi in the presen t work sho w tha t thi s relationshi p i s no t constant . Specimens wit h gonads , an d a n appendi x an d associated typhlosol e whic h wer e wel l developed , as wel l a s specimen s wit h a n inconspicuou s appendix an d poorl y develope d gonads , wer e present i n the studied sample . According t o Hoaglan d & Turne r (1981) , th e feeding flexibilit y i n th e Teredinida e ca n als o b e related t o crowding whe n activ e woo d borin g ma y cease i n favou r o f filte r feeding . Experiment s ar e required t o tes t i f crowdin g and/o r othe r

environmental circumstance s induc e switchin g from a wood- to a filter-feeding habit , or vice versa, in the species analyse d in the present work. Feedin g flexibility i s here demonstrate d onl y fo r P. healdi, where i t i s relate d t o age . Once th e hypothesi s o f digestion an d absorptio n i n th e appendi x an d ana l canal o f N . reynei i s confirmed , i t ca n b e state d unequivocally tha t th e larg e amoun t o f woo d kep t in thes e pocket s i s store d food , allowin g surviva l under condition s o f crowdin g o r whe n growt h i s impossible. Thi s ma y represent a n adaptive device , since N. reynei does not have the same capability to filter foo d a s other Teredinidae wit h large ctenidia , and i t occur s mainl y i n mangrov e area s les s frequently submerge d b y the seawater . The pathways whereb y digestiv e enzymes fro m the intracellula r symbioti c bacteria l populatio n present in the ctenidia of P. healdi, and probably in N. reynei, are ultimately transported to the lumen of the stomac h t o participate i n cellulose degradatio n remain t o b e elucidated . Histologica l section s di d not demonstrat e connectio n o f th e so-calle d duct s of the gland of Deshayes present within the afferen t branchial vesse l of both specie s with th e digestiv e system. According t o Distel & Roberts (1997) , th e plausibility of these symbioti c mechanisms depen d mainly o n th e demonstratio n o f a complet e rout e from th e bacterial populatio n i n the ctenidia t o the digestive system. The author s thanks the Fundaga o d e Ampar o a Pesquis a do Estad o d e Sa o Paul o (FAPESP) , Coordenaca o d e Aperfeicoamento d e Pessoal d e Nivel Superio r (CAPES ) and Conselho Naciona l d e Desenvolvimento Cientific o e Tecnologico (CNPq), Brazil , fo r financial suppor t o f this study. SE M facilitie s wer e mad e availabl e throug h th e Laboratorio d e Microscopi a Eletronica , Institut e d e Biociencias da Universidade d e Sao Paulo (IB-USP), and field facilitie s throug h th e Bas e Nort e d o Institut o Oceanografico d a USP . Thank s t o Eni o Matto s an d Marcio Valentim Cru z fo r technical suppor t i n the SEM, and Jos e Domingo s Batist a do s Rei s fo r maintenanc e of the teredinid s i n aquaria . Specia l acknowledgement s t o Drs Brian Morton, Elizabet h B. Andrews an d Liz Harpe r for thei r critical review of the text.

References BAZYLINSKI, D. A. & ROSENBERG, F. A. 1983 . Occurrence of a brus h borde r i n th e caecu m (appendix ) o f several Teredo an d Bankia species . Th e Veliger, 25 , 251-254. DISTEL, D . L . & ROBERTS , S . J . 1997 . Bacteria l endosymbionts i n th e gill s o f th e deep-se a wood boring bivalves Xylophaga atlantica and Xylophaga washingtona. Biological Bulletin, 192 , 253-261. GREENE, R . V . & FREER , S . N . 1986 . Growt h characteristics o f a nove l nitrogen-fixin g cellulolytic bacterium . Applied an d Environmental Microbiology, 52 , 982-986.

DIGESTIVE SYSTE M O F NEOTEREDO AN D PSILOTEREDO

GREENE, R . V. , COTTA , M . A . & GRIFFIN , H . L . 1989 . A novel, symbioti c bacteriu m isolate d fro m marin e shipworm secrete s proteolyti c activity . Current Microbiology, 19 , 353-356. , GRIFFIN , H . L . & FREER , S . N . 1988 . Purificatio n and characterizatio n o f a n extracellula r endoglucanase fro m th e marin e shipwor m bacterium. Archives o f Biochemistry an d Biophysics, 267,334-341. HOAGLAND, K . E . & TURNER , R . D . 1981 . Evolution an d adaptation radiatio n o f wood-borin g bivalve s (Pholadacea). Malacologia, 21, 111-148 . LAZIER, E . L . 1924 . Morphology o f the digestiv e tract of Teredo navalis. University of California Publications in Zoology, 22, 455-474. LEONEL, R . M . V. , LOPES , S . G . B. C . & ZAGO , D . 1998. Morphological basi s o f excretor y functio n i n Nausitora fusticula (Jeffreys , 1860 ) (Bivalvia, Teredinidae). Journal o f Molluscan Studies, 64 , 223-237. LOPES, S . G. B. C . & NARCHI , W . 1993. Levantament o e distribuigao das especies de Teredinidae (Mollusca : Bivalvia) n o mangueza l d a Prai a Dura , Ubatuba , Sao Paulo , Brasil . Boletim d o Instituto Oceanogrdfico, 41 , 29-38. ,& DOMANESCHI, O . 1998. Digestiv e trac t an d functional anatom y o f th e stomac h o f Nausitora fusticula (Jeffreys , 1860 ) (Bivalvia, Teredinidae) . TheVeliger, 41 , 351-365. MANN, R . 1984 . Nutrition i n th e Teredinidae . In : COSTLOW, J . D . & TIPPER , R . C . (eds ) Marine Eio deterioration: An Interdisciplinary Study. Proceedings of the Symposium on Marine Biodeterioration, Uniformed Services University of Health Science, 20-23 April 1981. Naval Institut e Press, Annapolis, MD, 24-29. MARTINEZ, J . C . 1987 . Structure e t fonctionnemen t d e 1'appareil digestif d e Teredo navalis L. (Teredinidae , Bivalvia). Haliotis, 16, 197-207. MORTON, B . 1970 . Th e functiona l anatomy o f the organ s of feeding and digestion of Teredo navalis Linnaeus and Lyrodus pedicellatus (Quatrefages) . Proceedings of the Malacological Society of London, 39, 151-167 . 1978. Feedin g an d digestio n i n shipworms . Oceanography and Marine Biology, Annual Review, 16, 107-144. 1983. Feedin g an d digestio n i n Bivalvia . In : HOCHACHKA, P . W. (ed. ) Th e Mollusca, Volume 5 . Academic Press , Ne w York, 65-147. & McQuiSTON , R . W . 1974 . Th e dail y rhyth m of activity i n Teredo navalis Linnaeus correlate d wit h the functionin g of th e digestiv e system . Forma e t Functio, 7, 59-80. NAIR, N . B . & SARASWATHY , M . 1971 . The biolog y o f

271

wood-boring teredini d molluscs . Advances i n Marine Biology, 9, 335-509 . PANTIN, C. F. A. 1948 . Notes on Microscopical Technique for Zoologists. Cambridg e Universit y Press , Cambridge. POPHAM, J . D . & DICKSON , M . R . 1973 . Bacterial associations i n th e tered o Bankia australis (Lamellibranchia, Mollusca) . Marine Biology, 19 , 338-340. POTTS, F . A. 1923 . The structur e and function of the live r of Teredo, th e shipworm . Proceedings o f th e Cambridge Philosophical Society, Biological Sciences, 1, 1-17. PURCHON, R . D . 1960 . Th e stomac h i n th e Eulamellibranchia: stomac h type s I V an d V . Proceedings of the Zoological Society of London, 135,431^89. 1987. Th e stomac h i n th e Bivalvia . Philosophical Transactions o f th e Royal Society o f London, B316, 183-276. RANCUREL, P . 1971 . Le s Teredinida e (Mollusque s Lamellibranches) dans les lagunes de Cote d'lvoire. Memoires Offices de la Recherche Scientifique et Technique Outre-Mer, Paris, 47, 1-235 . ROSENBERG, F . A . & CUTTER , J . 1973 . The rol e o f cellulolytic bacteri a i n the digestive processe s o f the shipworm. In: ACKER, R. F. ETAL. (eds ) Materials i n the Sea. Northwester n Universit y Press , Evanston , 778-796. SARASWATHY, M. & NAIR, N. B. 1971 . Observations on the structure o f th e shipworm s Nausitora hedleyi, Teredo furcifera an d Teredora princesae (Bivalvia : Teredinidae). Transactions o f th e Royal Society o f Edinburgh, 68, 507-566. SIGERFOOS, C . P . 1908. Natura l history, organizatio n an d late developmen t o f th e teredinida e o r shipworms . Bulletin of th e Bureau of Fisheries, Washington, 37, 191-231. TURNER, R. D. 1966. A survey and illustrated catalogue of the Teredinidae (Mollusca: Bivalvia). Th e Museu m of Comparative Zoology , Cambridge . & JOHNSON , A . C . 1971 . Biology o f th e marin e wood-boring molluscs . In : JONES , E . B . G . & ELTRINGHAM, S . K. (eds) Marine Borers, Fungi an d Fouling Organisms o f Wood. Organisatio n fo r Economic Co-operatio n an d Development , Paris , 259-301. WATERBURY, J . B. , GALLOWAY , C . B . & TURNER , R . D . 1983. A cellulolyti c nitrogen-fixin g bacteriu m cultured fro m th e glan d o f Deshaye s i n shipworms (Bivalvia : Teredinidae) . Science, 221, 1401-1403. YONGE, C . M . 1926 . The digestiv e diverticul a i n th e Lamellibranchs. Transactions o f th e Royal Society of Edinburgh, 54, 703-718 .

This page intentionally left blank

Evolutionary trajectories of a redundant feature: lessons from bivalve gill abfrontal cilia and mucocyte distribution s PETER G . BENINGER1 & SUZANNE C. DUFOUR 2 1 Laboratoire de Biologic Marine, Faculte des Sciences, Universite de Nantes, 44322 Nantes Cedex France (e-mail: Peter.Beninger@ isomer.univ-nantes.fr) 2 Scripps Institution of Oceanography, University of California, San Diego, La Jolla, CA 92093-0202, USA Abstract: Recen t data o n the distribution s o f cilia an d mucocytes on th e bivalve gil l abfrontal surface ar e analyse d wit h respect t o evolutionar y relationships o f the principa l autobranc h gil l types. Fro m th e primitiv e functio n a s a mucociliary cleanin g surfac e in th e protobranchs , tw o evolutionary trajectories ar e evident: (1 ) progressive reductio n o f both cili a an d mucocytes with resultant loss o f surfac e function, see n i n th e homorhabdi c filibranch s studied; (2 ) reduction of cilia but retention or increase in acid mucopolysaccharide-secreting (AMPS) mucocyte density in the eulamellibranchs , correspondin g t o th e assumptio n o f a ne w function , probabl y i n th e reduction of frictional resistance to flow in the water canals. Heterorhabdic gill abfrontal surfaces present a mixtur e o f thes e characteristics : reduction o f cili a an d mucocyte s o n th e ordinar y filaments, an d retention of both on the principal filaments. The retention of AMPS mucocytes on the abfronta l surface of the pseudolamellibranchs ma y b e relate d t o th e degre e o f interlamella r fusion, reducin g frictional resistance t o water flow a s in the eulamellibranchs. Th e gill abfrontal surface thu s constitutes an excellent candidat e for the study of the different evolutionar y options and trajectories of a redundant feature.

Compared t o th e intensiv e anatomica l an d functional studie s o f th e fronta l surfac e of bivalve gills [se e Winte r (1978) , J0rgense n (1990 ) an d Beninger & St-Jea n (1997 ) fo r review s an d references], th e abfrontal surfac e has been virtually ignored, wit h onl y ver y cursor y description s o f surface and histological characteristics . Thi s lack of interest is perhaps understandable from a functional point o f view , sinc e th e immens e majorit y o f bivalves ar e suspensio n feeder s an d th e fronta l surface o f th e gil l play s a ke y rol e i n particl e processing (Atkins 1938; Nelson 1960 ; Beninge r & St-Jean 1997 ; Beninger et al 1993 , 19970 ; Nielsen et a l 1993 ; Riisgar d e t al. 1996 ; Silverma n e t a l 1996; War d et a l 1998) . I n contrast, th e abfronta l surface i s no t involve d i n an y stag e o f particl e processing and , indeed , i f an y particle s wer e available t o it , ther e woul d b e n o rout e t o th e digestive tract . However , thi s surfac e present s a very interestin g peculiarit y i n tha t it s presumed original protobranc h cleanin g functio n ha s bee n obviated by the separation of the pallial cavity into more o r les s modifie d infra - an d suprabranchia l chambers (Yong e 1941 ; Morto n 1996 ; Walle r 1998), suc h tha t th e ris k o f foulin g i s virtuall y

absent i n contemporar y autobranch s (sensu Autobranchia, non-protobranc h bivalves ; Morto n 1996; Salvini-Plawe n & Steiner 1996) . It therefor e constitutes a n excellen t opportunit y t o stud y th e evolution o f a redundan t featur e throughou t th e Bivalvia. Tw o mai n evolutionar y trajectorie s ar e available t o suc h a structure : (1 ) retentio n o r augmentation o f th e origina l functiona l character istics, i n respons e t o eithe r neutra l o r positiv e selection fo r a new functio n t o whic h th e origina l features wer e pre-adapted; (2 ) reduction o r los s of the original functional characteristics i n response t o negative selection , i.e . th e metaboli c cos t o f maintaining these features. The chie f functiona l characteristic s o f th e primitive bivalve gill abfrontal surfac e are cilia and mucocytes, presen t i n th e protobranc h conditio n and variousl y reporte d i n th e autobranch s (Ridewood 1903 ; Atkin s 1936, 1938 ; Nelson 1960 ; Jones et al 1990 ; Richar d e t al 1991 ; Beninge r et al 19970 ; Dufour & Beninger in press). The types and abundance s o f thes e tw o characteristic s ma y thus serv e a s marker s t o trac e th e evolutionary trajectories o f th e abfronta l surface s withi n th e major bivalv e taxa. Here suc h a study is presented,

From: HARPER, E. M, TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of the Bivalvia. Geological Society , London, Special Publications, 177 , 273-278 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000 .

274

P. G . BENINGE R & S . C . DUFOU R

based largel y o n a recent detaile d accoun t o f cili a and mucocyte densities on the abfrontal surface s of eight bivalve species representing th e four principal autobranch gil l types , includin g primitiv e an d advanced conditions (Dufou r & Beninger in press). The elucidatio n o f suc h heretofor e poorl y studie d characteristics ma y als o reinforc e th e significanc e of gil l structur e i n taxonom y an d phylogen y (Salvini-Plawen 1980 ; Salvini-Plawe n & Steine r 1996).

Database To date , report s o n th e distributio n o f bivalv e abfrontal cili a an d mucocyte s hav e bee n confine d to indication s o f thei r presenc e o r absence , sometimes wit h subjectiv e comment s o n thei r abundance (e.g. Atkins 1938 ; Nelson 1960 ; Ebl e & Scro 1996) , an d no systemati c investigatio n o f th e entire abfronta l surfac e appear s t o hav e bee n carried ou t for any species. Th e data for the present work i s therefor e draw n fro m a systemati c investigation o f th e type s an d distributio n o f cili a and mucocyte s o f th e abfronta l surface s o f eigh t bivalve species, representing seve n families and the four majo r autobranc h gil l type s (Dufou r & Beninger i n press) . Briefly , thi s stud y showe d th e following. (1 ) I n th e homorhabdi c filibranchs , varying degree s o f reductio n o f th e abfronta l cili a and mucocyte s wer e observed ; Mytilus edulis presented th e greates t densit y o f cili a an d mucocytes, an d the most mucocyte secretio n types ; Modiolus modiolus presente d a muc h smalle r density o f bot h cili a an d mucocytes , an d fewe r mucocyte secretion types ; Area zebra displayed the greatest degree of reduction, with few cilia and low densities o f mucocytes , an d onl y on e mucocyt e secretion type . (2 ) I n th e homorhabdi c eulamelli branchs, reductio n o f cili a wa s extrem e an d onl y one mucocyt e secretio n typ e wa s presen t - aci d mucopolysaccharides (AMPS) . However , th e density o f mucocytes wa s high , with a n extraordi narily high density of Spisula solidissima. (3 ) In the heterorhabdic species , ciliatio n o f th e abfronta l surface o f the ordinar y filament s (OF) wa s greatl y reduced, whil e that o f the principa l filament s (PF ) was dense . Th e densit y o f mucocyte s wa s als o greater o n P F cf . OF , wit h a mixtur e o f mucopolysaccharide type s i n th e heterorhabdi c filibranch Placopecten magellanicus an d AMP S only i n th e pseudolamellibranc h Crassostrea virginica. Th e observation s o f cili a an d mucocyt e densities ma y b e summarize d graphically , usin g scaleless axe s i n whic h eac h quadran t embodie s a different functiona l outcom e (Fig . 1) . The relativ e positions o f th e gil l type s studie d ma y thu s b e interpreted fro m a functiona l an d evolutionar y standpoint.

Discussion The basic premis e o f this wor k is that functionally coupled organ s ke y t o th e succes s o f a n organis m respond mor e strongl y to their respectiv e selectiv e pressures tha n othe r organ s whos e functionin g i s not significantl y affected b y those pressures . I n the case o f th e Bivalvia , th e read y availabilit y o f planktonic particle s doubtles s conferre d a signifi cant advantag e t o thos e individual s whic h presented gil l modification s fro m th e primitiv e protobranch type , enablin g increasingl y efficien t capture an d processing . Hence , th e bivalv e gil l underwent rapid evolution within each o f the majo r taxa, while other organs, suc h as the heart, retaine d their form , a s witnesse d i n th e uniformit y o f thi s organ throughou t the class (Beninge r & Le Penne c 1991; Eble 1996) . I t is thus possible to use the data on gil l abfronta l ciliation t o trac e th e evolutionar y changes of this surface in the gill itself, and to relate these to changes in the overall form and function of the gill , independen t o f th e large r phylogeneti c trajectories. There is little doub t that the filibranch condition evolved fro m th e protobranc h gil l typ e (Yong e 1941; Morto n 1979 ; Salvini-Plawe n 1980 ; Morto n 1996; Walle r 1998) . Th e gil l o f th e famil y Nuculidae, whic h bes t represent s th e primitiv e protobranch conditio n (Yong e 1941) , i s char acterized b y a uniform , dens e abfronta l ciliatio n which participates i n particle transport, principall y in cleaning (Orto n 1912) . Although n o study of the mucocyte distributio n o n the nuculi d gil l ha s bee n made, particl e transport , an d especiall y cleanin g a ciliated surface, involves mucociliary transport (see Beninger e t al. 1997'/?) , an d thu s a dens e arra y o f mucocytes. Th e abfronta l surfac e o f th e contemporary autobranc h gil l i s mos t probabl y a vestigial mucociliar y epitheliu m (Dufou r & Beninger i n press) , whos e origina l protobranc h cleaning function wa s lost with the reflection o f the gill filament s t o for m th e homorhabdi c filibranc h gill, separatin g th e pallia l cavit y int o infra - an d suprabranchial chambers . Indeed , th e assumptio n of the filibranch condition may have been the most important facto r i n th e diversificatio n an d proliferation o f th e Bivalve s fro m th e earl y Ordovician (Cope 1996) . This is, however, the most primitive contemporar y autobranc h gil l type , present i n onl y 7 % o f extan t families . Give n th e large specie s number s and extensive habitats o f the eulamellibranch heterodonts , th e proportio n o f homorhabdic filibranc h specie s i s probabl y eve n smaller [dat a from Newel l (1965)]. Within the taxa presenting thi s gil l type , th e dat a sugges t a n evolutionary gradatio n o f th e abfronta l surface . Mytilus edulis presents the most abundantly ciliated abfrontal epithelium , followe d b y Modiolus

ABFRONTAL SURFAC E O F BIVALV E GILLS

275

Fig. 1 . Scaleless grap h of relative abfronta l mucocyt e and ciliary densities showin g functional significanc e of positions within each of the quadrants. In the upper right quadrant, the original (protobranch ) condition of high mucocyte and ciliary densities is situated, as well as eventual pre-adaptations o f this condition for new functions. In the upper left quadrant , high mucocyte densities and low ciliary densities indicate the loss o f the original cleaning function, wit h the assumption of a new function fo r this surface - possibl y i n reduction of drag and thus increase in efficiency o f water flow. I n the lower left quadrant , low mucocyte and ciliary densitie s indicat e a loss o f the origina l cleaning function, wit h no new surface function. Finally , in the lower right quadrant, low mucocyte densitie s an d high ciliary densities indicate loss o f the original cleaning function, an d assumption of a new function accomplishe d b y cilia alon e (e.g. water pumping).

modiolus, wit h Area zebra presentin g onl y ver y sparse cilia (Fig. 2). It i s no t know n whethe r th e mor e primitiv e Mytilus edulis homorhabdi c filibranc h gil l ha s retained th e origina l abfronta l cleanin g function , but sinc e thi s surfac e i s normall y expose d t o moving, 1 urn filtere d seawate r (M0hlenber g & Riisgard 1978) , an y cleaning would be restricted to occasional removal of faeces or gametes not voided in th e excurren t flow . Tw o mor e probabl e interpretations may be made: (1) the abfrontal cilia may b e vestigia l an d largel y non-functiona l in th e primitive homorhabdi c filibranc h gil l o f Mytilus edulis [othe r vestigia l mucociliar y surface s ar e known in this species , se e Beninger et al (1995)] ; or (2 ) th e dens e abfronta l ciliatio n i n M . edulis might assis t in wate r pumping (Orto n 1912 ; Jone s

et al . 1990 , 1992 ; Jone s & Richard s 1993) . I t i s currently impossibl e t o visualiz e simpl e cili a i n vivo, eve n usin g endoscop y (Beninge r 2000) , s o this interesting hypothesis cannot be unequivocally confirmed. I n thi s scenario , th e abfronta l ciliatio n would be a pre-adaptation for more efficien t wate r pumping, perhap s partl y responsibl e fo r th e numerical succes s o f th e Mytilidae . However , th e abfrontal mucocyte s woul d stil l b e non-functional and vestigial . The sparse ciliation and the few small mucocytes in Modiolus modiolus rende r cleanin g o r pumping functions impossible , a s do the near-bare abfronta l surface an d rare mucocytes o f Area zebra (Fig . 2) . These three specie s thu s present increasing degree s of reduction of the abfrontal mucociliary surface of the homorhabdi c filibranc h gill , fro m Mytilus

276

P. G . BENINGE R & S . C . DUFOU R

Fig 2 . Relative position s o f the gill type s examine d wit h respect to abfrontal mucocyt e an d cilia density. Not e ne w function assume d b y the abfronta l surfac e o f eulamellibranch gills, loss of surface functio n i n the advance d homorhabdic filibranchs Modiolus modiolus an d Area zebra. None o f the representatives o f the four principal gil l types presents reductio n o f mucocytes with retentio n o f cilia (lower righ t quadrant) .

edulis t o Area zebra, paralleling th e reduction an d disappearance o f the original cleanin g function . The grea t degre e o f reductio n o f th e abfronta l cilia i n th e eulamellibranc h gill s studie d clearl y demonstrates the extension of the trend to reduction and loss of the primitive mucociliary function i n the homorhabdic gil l typ e (Fig . 2) . However , th e retention o f a relativel y hig h densit y o f abfronta l mucocytes indicates that, in this gill type, there has either been neutral selection for this trait or that the mucocytes hav e bee n retaine d an d redirecte d toward a ne w functio n b y positiv e selection . Th e presence o f onl y AMP S (i.e . viscous)-secretin g mucocytes o n th e eulamellibranc h abfronta l surface, an d thei r extremel y dens e distributio n i n Spisula solidissima, argue s strongl y fo r th e latte r interpretation. Th e mos t probabl e ne w functio n o f the mucocyte s o f th e abfronta l surfac e i n thi s gil l type is the reduction o f frictional resistance t o water flow (Faillard & Schauer 1972 ; Hoy t 1975 ; Danie l 1981) acros s th e epitheli a o f th e suprabranchia l

chamber, whic h i s highl y modifie d t o for m wate r tubes. Thi s woul d increas e th e efficienc y o f wate r flow i n thes e specie s an d parallels th e pronounced morphological modification s o f th e gills , allowin g enhanced flo w a s wel l a s a consequentl y smalle r gill:pallial cavit y volume ratio . The eulamellibranch gil l is widely believed t o be derived fro m th e ancestra l homorhabdi c filibranc h condition (Orto n 1912 ; Yonge 1941 ; Morton 1979 ; Salvini-Plawen 1980 ; Alle n 1985 ; Walle r 1998) . The modification s t o th e abfronta l surfac e described i n the present stud y indicate tha t this gill type no t onl y continue s th e tren d t o reductio n o r loss o f the origina l cleanin g function , bu t tha t thi s surface ha s assumed a new function commensurat e with th e increase d efficienc y o f wate r flo w i n this gill type. In th e tw o heterorhabdi c gil l type s studied , th e total absence of cilia on the abfrontal surfac e of the OF plica e clearl y demonstrate s th e los s o f th e primitive mucociliar y cleanin g functio n i n thes e

ABFRONTAL SURFAC E OF BIVALV E GILL S

species. Th e presenc e o f abundan t ciliatio n an d high densitie s o f mucocyte s o n th e P F ma y b e related to the tardy evolutionary development of PF cf. OF. It is likely that PF are formed from modified OF, and both phylogenetic and ontogeneti c studie s show that PF arise wel l afte r O F (Le Pennec e t al 1988; Beninge r e t a l 1994) . Th e developmental sequence of the PF may thus be quite different fro m that o f th e OF , wit h th e notabl e retentio n o f th e primitive mucociliar y characters . I n Placopecten magellanicus, i t ha s bee n suggeste d tha t th e P F abfrontal mucocyte s ma y provid e th e lubricatio n necessary fo r the retraction of the gil l during rapid valve adduction , suc h a s th e swimmin g escap e response commo n i n juvenile s o r sudde n valv e closure i n adults (Beninger et al 1988) . However , only abou t two-third s o f th e abfronta l surfac e would actuall y b e i n contac t wit h th e apposin g mantle surfac e unde r suc h condition s (th e remaining third bein g th e fronta l surfac e o f th e ascending branch of the PF outer demibranch). The abfrontal secretion s ma y als o reduc e frictio n between apposed lamellae following collapse of the ascending lamella e fro m th e ciliar y attachmen t t o the mantl e prio r t o retraction , assistin g i n th e preservation o f structura l integrity durin g the cla p response. I n th e Ostreidae , th e relativel y hig h degree o f interlamella r an d interfilamenta r fusio n has resulte d i n a suprabranchia l cavit y akin t o th e water canal s i n eulamellibranchs ; th e retentio n of AMPS mucocytes only on the PF may indicate that they play a similar role in the reduction of frictional resistance t o wate r flow . I n an y event , th e unique context o f th e evolutionar y an d developmenta l history o f th e heterorhabdi c gil l ha s resulte d i n a mixed condition (Fig. 2) , with the phylogenetically older OF presenting a degree of reduction similar to the advanced homorhabdic filibranch or eulamellibranch condition , wherea s th e phylogeneticall y recent P F hav e retaine d th e origina l mucociliar y characters of the abfrontal surface . It i s noteworth y that n o gil l type s appea r i n th e lower righ t quadran t o f Fig . 2 . Th e abfronta l surface o f a gil l typ e i n thi s region woul d present reduced mucocyt e number s an d a hig h ciliar y density; the fact that a high ciliary density is always accompanied b y a moderat e t o hig h densit y o f mucocytes reinforce s th e conclusio n tha t thi s surface wa s originall y mucociliary . Th e onl y conceivable ne w functio n fo r th e abfronta l surface in this quadrant would be th e propulsion o f water; none of the gills examined appears to have derived from line s whic h selectivel y reduce d mucocyte s while retaining cili a for such a function . While the present study proposes an evolutionary paradigm for the distribution o f cilia and mucocytes on th e abfronta l surfac e of bivalve gills, i t clearl y requires additional data from al l gill types in order

277

to evaluat e th e universalit y o f thi s scheme . I n particular, observation s o f th e abfronta l surfac e of early developmenta l stage s wil l b e importan t i n validating th e evolutionar y sequence s propose d herein for the bivalve gill. The author s wis h t o acknowledg e fundin g fro m th e Region Pay s d e l a Loir e throug h th e Syndica t Mixt e d e Developpement d e 1'Aquacultur e au x Pay s d e l a Loir e during thi s work .

References ALLEN, J . A . 1985 . The recen t Bivalvia : thei r for m an d evolution. In : TRUEMAN , E . R . & CLARKE , M . R . (eds.) Th e Mollusca. Volume 10 . Evolution. Academic Press , Orlando, 337-403 . ATKINS, D . 1936 . O n th e ciliar y mechanism s an d interrelationships o f lamellibranchs . I . Ne w observations o n sortin g mechanisms . Quarterly Journal o f Microscopical Science, 79, 181-308 . 1938. O n th e ciliar y mechanism s an d interrelationships o f lamellibranchs . VII . Latero frontal cili a o f th e gil l filament s an d thei r phylogenetic value . Quarterly Journal o f Microscopical Science, 80, 346-430. BENINGER, P. G. 2000. Limits an d constraints: a commen t on premise s an d method s i n recen t studie s o f particle capture mechanism s i n bivalves. Limnology and Oceanography, 45 , 1196-1199 . & L E PENNEC , M . 1991 . Functional anatom y o f scallops. In: SHUMWAY , S. E. (ed.) Scallops: Biology, Ecology an d Aquaculture. Elsevier , Amsterdam , 133-223. & ST-JEAN, S. D. 1997. The role of mucus in particle processing b y suspension-feedin g marin e bivalves : unifying principles . Marine Biology, 129 , 389-397. , DUFOUR , S . C . & BOURQUE , J . 1997a . Particl e processing mechanism s o f th e eulamellibranc h bivalves Spisula solidissima an d My a arenaria. Marine Ecology Progress Series, 150, 157-169. , DWIONO , S . A . P . & L E PENNEC , M . 1994 . Early development o f the gill and implications for feedin g in Pecten maximus (Bivalvia : Pectinidae) . Marine Biology, 119 , 405-412. , L E PENNEC , M . & SALAUN , M . 1988 . Ne w observations o f th e gill s o f Placopecten magellanicus (Mollusca : Bivalvia) , an d impli cations for nutrition. I . General anatom y an d surfac e micro-anatomy. Marine Biology, 98 , 61-70. , ST-JEAN , S . D . & POUSSART , Y. 1995. Labial palp s of th e blu e musse l Mytilus edulis (Bivalvia : Mytilidae). Marine Biology, 123 , 293-303. , LYNN , J. W., DIETZ , T. H. & SILVERMAN , H. 19976 . Mucociliary transpor t i n living tissue : th e two-laye r model confirme d i n th e musse l Mytilus edulis L . Biological Bulletin, 193, 4-7. , ST-JEAN , S . D., POUSSART , Y. & WARD , J . E . 1993. Gill functio n an d mucocyt e distributio n i n Placopecten magellanicus an d Mytilus edulis (Mollusca: Bivalvia) : th e rol e o f mucu s i n particl e transport. Marine Ecology Progress Series, 98 , 275-282. COPE, J . C. W. 1996. The earl y evolutio n o f the Bivalvia .

278

P. G . BENINGER & S . C . DUFOU R

In: JOHNSTON , P . A . & HAGGART , J . W . (eds ) Bivalves: An Eon of Evolution - Paleobiological Studies Honouring Norman D . Newell. Universit y of Calgary Press , Calgary , 361-370 . DANIEL, T . L. 1981 . Fish mucus : i n situ measurements of polymer dra g reduction . Biological Bulletin o f th e Woods Hole Marine Laboratory, 160, 376-382. DUFOUR, S . C . & BENINGER , P. G. I n press . A functional interpretation o f cilia and mucocyte distributions on the abfronta l surfac e o f Bivalv e gills . Marine Biology. EBLE, A. F. 1996. The circulator y system. In: KENNEDY , V. S., NEWELL, R . I. E. & EBLE, A. F. (eds) The Eastern Oyster Crassostre a virginica . Marylan d Se a Gran t Program, Colleg e Park , 271-298. & SCRO, R. 1996 . General anatomy . In: KENNEDY , V. S., NEWELL, R. I. E. & EBLE, A. F. (eds) The Eastern Oyster Crassostre a virginica . Marylan d Se a Gran t Program, Colleg e Park , 19-73 . FAILLARD, H . & SCHAUER , R . 1972 . Glycoproteins a s lubricants, protectiv e agents , carriers , structura l proteins an d a s participant s i n othe r functions . In : GOTTSCHALK, A . (ed. ) Glycoproteins: Their Composition, Structure an d Function. Part B . 2n d Edition. Elsevier , Amsterdam , 1246-1267 . HOYT, J. W . 1975 . Hydrodynamic dra g reduction du e t o fish slimes . In : Wu , T . V . T. , BROKAW , C . J . & BRENNAN, C. (eds) Swimming an d Flying i n Nature. Plenum Press , New York, 653-673 . JONES, H . D. , RICHARDS , O . G . & HUTCHINSON , S . 1990. The rol e o f ctenidia l abfronta l cili a i n wate r pumping i n Mytilus edulis L . Journal o f Experimental Marine Biology an d Ecology, 143 , 15-26. ,, SOUTHERN , T . A . 1992 . Gil l dimensions , water pumpin g rat e an d bod y siz e i n th e musse l Mytilus edulis L . Journal o f Experimental Marine Biology an d Ecology, 155, 213-237. JONES, H . D . & RICHARDS , O . G . 1993 . The effect s o f acetylcholine, dopamine , an d 5-hydroxytryptamin e on wate r pumpin g rat e an d pressur e i n th e musse l Mytilus edulis L . Journal o f Experimental Marine Biology an d Ecology, 170, 227-240. J0RGENSEN, C . B . 1990 . Bivalve Filter-feeding: Hydrodynamics, Bioenergetics, Physiology and Ecology. Olse n and Olsen, Fredensborg . LE PENNEC, M., HERRY , A., LUTZ, R., FIALA-MEDIONI , A . 1988. Premiere s observation s ultrastructurales de la branchie d'u n Bivalv e Pectinida e hydrotherma l profond. Comptes rendus hebdomadaires d e I'Academie des Sciences de Paris, Serie III, 627-633. M0HLENBERG, F . & RusoARD , H . U . 1978 . Efficiency o f particle retentio n i n 1 3 specie s o f suspension feeding bivalves. Ophelia, 17, 239-246. MORTON, B . 1996 . Th e evolutionar y histor y o f th e Bivalvia. In : TAYLOR , J . D . (ed. ) Origin an d Evolutionary Radiation o f th e Bivalvia. Oxfor d University Press, Oxford , 337-359. MORTON, J . E. 1979 . Molluscs 5t h Edition. Hutchinson & Co., London .

NEILSEN, N . F. , LARSEN , P.S. , RIISGARD , H . U . & J0RGENSEN, C . B . 1993 . Fluid motio n an d particl e retention i n th e gil l o f Mytilus edulis: vide o recordings an d numerica l modelling . Marine Biology, 116, 61-1 \. NELSON, T. C. 1960. The feeding mechanism of the oyster . II. On the gill s and palp s of Ostrea edulis, Crassostrea virginica, an d C . angulata. Journal o f Morphology, 107 , 163-191 . NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitates, 2206 , 1-25 . ORTON, J . H . 1912 . The mod e o f feedin g o f Crepidula, with a n accoun t o f th e current-producin g mechanism i n the mantle cavity , and some remark s on th e mod e o f feedin g i n Gastropod s an d Lamellibranchs. Journal o f th e Marine Biological Association o f th e United Kingdom, 9 , 444^78. RICHARD, P . E. , DIETZ , T . H . & SILVERMAN , H . 1991 . Structure o f th e gil l durin g reproductio n i n th e unionids Anodonta grandis, Ligumia subrostrata and Carunculina parva texasensis. Canadian Journal o f Zoology, 64 , 1744-1754 . RIDEWOOD, W . G . 1903 . On th e structur e o f th e gill s o f Lamellibranchia. Philosophical Transactions of th e Royal Society o f London, Series B , 195 , 147-284. RIISGARD, H . U. , LARSEN , P . S . & NIELSEN , N . F . 1996. Particle captur e i n th e musse l Mytilus edulis: th e role o f latero-fronta l cirri . Marine Biology, 127 , 259-266. SALVINI-PLAWEN, L . v . 1980 . A reconsideratio n o f systematics in the Mollusca (phylogen y an d highe r classification). Malacologia, 19 , 249-278. & STEINER , G . 1996 . Synaptomorphie s an d plesiomorphies in higher classification of Mollusca. In: TAYLOR , J . D . (ed. ) Origin an d evolutionary radiation o f th e Bivalvia. Oxfor d University Press , Oxford, 29-51 . SILVERMAN, H., LYNN, J. W. & DIETZ, T. H. 1996 . Particle capture b y th e gill s o f Dreissena polymorpha: structure an d functio n o f latero-fronta l cirri . Biological Bulletin of the Woods Hole Marine Laboratory, 191 , 42-54 . WALLER, T . R . 1998 . Origi n o f th e Mollusca n clas s Bivalvia an d a phylogen y o f majo r groups . In : JOHNSTON, P . A. & HAGGART , J . W . (eds) Bivalves: An Eo n o f EVo/wft'on-Paleobiologica l Studie s Honouring Norma n D . Newell . Universit y o f Calgary Press , Calgary , 1^45 . WARD, J . E., LEVINTON, J. S., SHUMWAY, S. E. & Cucci, T. 1998. Particl e sortin g i n bivalves : i n vivo determination o f th e pallia l organ s o f selection . Marine Biology, 131 , 283-292 . WINTER, J. E. 1978 . A critical revie w o n some aspect s of filter-feeding i n lamellibranchiat e bivalves . Haliotis, 7, 71-87. YONGE, C . M . 1941 . The protobranchiat e Mollusca; a functional interpretatio n o f thei r structur e an d evolution. Philosophical Transactions o f th e Royal Society o f London, Series B, 230, 79-147.

Growth patterns o f noetiid ligaments: implications o f developmenta l models for the origin of an evolutionary novelty among arcoi d bivalves 1

R. D. K. THOMAS1, A. MADZVAMUSE 2, P . K. MAINI3 & A. J. WATHEN 2 Department of Geosciences, Franklin & Marshall College, Lancaster, Pennsylvania 17604-3003, USA (e-mail: r_thomas@ acad.fandm.edu) 2 Computing Laboratory, Wolfson Building, Parks Road, Oxford OX1 3QD, UK 3 Centre for Mathematical Biology, Mathematical Institute, 24-29 St Giles', Oxford OX1 3LB, UK Abstract: Th e dorsa l ligament s o f arcoi d bivalve s typicall y consis t o f oblique , lamella r an d fibrous sheets , alternatin g alon g th e hinge s o that their attachment s for m characteristic chevro n patterns. Ne w element s ar e adde d a t o r nea r th e middl e o f th e pattern , a s th e ligamen t grow s ventrally an d get s longer . Mos t Palaeozoi c arcoid s exhibi t thi s growt h pattern , whic h stil l predominates amon g their living descendants. Early i n the Cretaceous, a novel pattern emerged , with vertica l strip s o f lamella r ligamen t embedde d i n groove s i n th e shee t o f fibrou s ligamen t which i s attache d t o eac h valve . I n contras t wit h th e chevron , duplivincula r ligament , ne w elements are added to each end of the noetiid ligament, anteriorly and posteriorly. Thi s distinctive growth pattern is the defining characte r of the family Noetiidae . Remarkable variatio n amon g individual s withi n population s o f a livin g limopsi d arcoi d includes forms with vertical strip s o f lamellar ligament. Thes e variants sugges t how the noetii d growth patter n coul d hav e bee n derive d fro m th e duplivincula r pattern. Compute r simulation s show tha t suc h pattern s ca n b e generate d b y a reaction-diffusio n mechanis m o f th e sor t firs t conceived b y Turin g (1952 , Philosophical Transactions of th e Royal Society, London, Series B , 237, 37-72) . Moreover, th e noetiid growt h pattern ca n simply be derived fro m th e duplivincular pattern by a developmental switc h based, for example, on a change in boundary conditions. These results indicat e tha t striking difference s i n for m ma y aris e fro m modes t change s i n th e developmental process. The evolution of the Noetiidae, member s o f which ar e quite disparate in overall shell form, should be reassessed. The derived character on which this family is based may not be uniquely shared, s o the group could well be polyphyletic.

Debate arise s i n differen t context s ove r rate s o f nearshor e marin e habitats . Th e famil y is united by evolutionary chang e i n form , th e magnitud e o f th e uniqu e form o f th e ligamen t tha t link s th e tw o change tha t ca n occu r fro m on e generatio n t o th e valves , dorsall y (MacNei l 1937) . I t consist s o f next, an d the reliabilit y o f characters a s indicators vertica l strip s o f elastic , lamella r material , of common ancestry. However, these issues all turn embedde d i n fibrous ligament that is attached to the on pattern s o f chang e tha t hav e a commo n basis , cardina l are a o f eac h valv e (Fig . 1) . The soft-par t They al l depen d o n degree s o f geneticall y base d anatom y o f th e noetiid s ha s no t bee n system change tha t ar e constraine d b y wha t is , o r i s not , aticall y differentiate d fro m tha t o f othe r arcoids . permissible i n th e cours e o f individua l develop - Consequently , th e grou p i s define d b y a single , ment. Thus , the y ar e differen t aspect s o f a singl e rathe r striking character . problem. I f th e arcoid s bearin g thi s distinctiv e ligamen t The bivalv e famil y Noetiida e i s supposedl y ar e al l descended fro m a singl e commo n ancestor , defined by a constellatio n of shel l character s thi s trait is the synapomorphy that defines the clade, (Newell 1969) , but only one of these appear s i n no an d the famil y Noetiida e i s soundl y based. O n th e other arcoids . Noetii d specie s var y considerably i n othe r hand , i f ligament s o f thi s kin d appeare d size an d shel l sculpture . The y liv e attache d t o independently , mor e than once, the taxon would be rocks, nestl e in crevices or burrow near the surface polyphyletic . Th e forme r alternativ e i s mor e in sof t sediments , ove r a fairl y wid e rang e o f probabl e i f th e derive d characte r represent s a From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Specia l Publications , 177 , 279-289. 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000.

280

R. D . K . THOMA S ET AL.

Fig. 1 . (a) Left valv e o f Striarca lactea (Linne ) showin g allometric growth o f the ligament, achieved by expansion from a small, triangular are a to occupy a large proportion of the cardinal area in the adul t shell . Scale bar, 5 mm. (b) Enlargement of (a) showing vertica l strips of lamellar ligament embedded in fibrous ligamen t and not directly attached to the shell. Scale bar, 2 mm.

radical departur e fro m th e ancestra l condition . Multiple origins ar e more likely if the development of th e nove l ligamen t aros e a s a simpl e modifi cation o f th e preexistin g mechanis m o f patter n formation. In thi s paper, observation s o f unusual , naturally occurring ligament s ar e reported . Thes e lea d t o a hypothesis fo r th e mean s b y whic h change s i n ligament patter n formatio n hav e occurred , amon g the arcoids . Th e type s of developmental processe s by which such patterns can be formed are modelled to determin e ho w nove l pattern s ma y hav e arisen . Finally, the forms o f living and extinct noetiids are examined in relation to this analysis.

Growth and form of arcoid ligament s The typica l arcoi d ligamen t consist s o f multipl e sheets of lamellar material , embedde d i n a sheet of fibrous ligament. This is thinner, but possibly never entirely absen t wher e th e lamella r layer s ar e attached, an d thicker between the m (Waller 1990) . Dorsally, away from th e region of ligament growth along th e mantl e isthmus , th e brittl e fibrou s ligament split s a s the growin g valves diverge. Th e lamellar ligament is first stretched , exerting tension that cause s th e valve s t o sprin g ope n whe n th e adductor muscle s relax . Then , furthe r dorsally , i t

tears a s i t exceed s it s elasti c limi t (Owe n 1959 ; Trueman 1969) . I n man y burrowing bivalves , thi s unavoidable breakag e o f th e lamella r ligamen t occurs at its anterior extremity, immediately belo w the umbones , wher e mos t divergenc e o f earlie r growth stage s o f th e shel l take s place . I n mos t arcoids, th e umbone s ar e locate d abou t half-wa y back alon g th e shel l an d the y gro w muc h mor e rapidly awa y fro m on e another . I n thi s case , breakage o f th e earlie r forme d dorsa l part s o f th e ligament necessarily occur s alon g its whole length. In the majority o f living and extinc t arcoids, th e zones wher e lamella r ligamen t i s secrete d migrat e anteriorly an d posteriorly awa y from th e umbones, along th e mantl e isthmus , as th e shel l grows . Th e tracks o f thes e zone s for m tw o set s o f obliqu e ridges an d groove s o n th e ligamental area s wher e they ar e attached . Th e resultin g chevro n patter n (Fig. 2a) constitutes the duplivincular ligament that is characteristi c o f arcoid s an d man y extinc t Palaeozoic pteriomorph s (Newel l 1937) . Thi s ligament has been considere d primitiv e because it s materials, with different physica l properties, simpl y alternate rathe r tha n bein g segregate d i n position s appropriate t o thei r functiona l roles . I t i s mor e appropriate t o regard thi s seria l constructio n a s the simplest o f several strategie s tha t emerged earl y in the evolutionar y radiation o f th e bivalve s t o offse t the effect s o f breakage o f th e lamella r ligamen t i n animals of increasingly large r siz e (Thomas 1978) . A numbe r o f variant s o n thi s genera l pla n have evolved amon g th e arcoids , som e o f the m repeatedly (Fig . 3) . The ligamen t ma y be mor e o r less asymmetric , dependin g o n th e positio n o f th e umbones. Where the y lie unusually far forward, o r towards th e rear , th e anterior , o r occasionall y th e posterior, serie s o f lamella r sheet s ha s bee n eliminated. I n Cucullaea, which i s relatively larg e but has a thin shell, there is generally onl y one pair of sheet s o f lamella r ligament , inserte d i n well defined groove s a t th e anterio r an d posterio r extremities o f the cardinal area . Limopsis, whic h is small an d paedomorphic in several shel l character s (Tevesz 1977), likewise has a single pair of lamellar sheets, but here th e entire ligament i s inserted i n a small, triangular pit, near the midpoint of the hinge line. I n mos t arcoid s wit h multipl e sheet s o f lamellar ligament , thei r widt h an d spacin g i s remarkably uniform , bu t i n som e forms , notabl y Area itself, the pattern is quite irregular.

Growth and form of the noetiid ligamen t The growth pattern of the noetiid ligament (Fig. 2b) departs from thos e of all other arcoids in two ways. Here, lamellar ligament is inserted in vertical strips , as oppose d t o formin g obliqu e sheets . Thi s i s accomplished b y keepin g th e sit e o f secretio n o f

GROWTH PATTERN S O F NOETII D LIGAMENT S

281

Fig. 2 . Growth patterns of: (a) the duplivincular ligament typical of Anadara, Barbatia and Glycymeris\ (b ) the noetiid ligament . Each diagram shows a sagittal vie w of the ligament, a s it is inserted o n the attachment are a of eithe r valve, and a dorsal ew of the mantle isthmus where new material is secreted.

each lamellar stri p fixed, instead of migrating along the hing e axis . Consequently , ne w element s ar e added t o th e patter n a t it s anterio r an d posterio r extremities, rathe r tha n mediall y beneat h th e umbones. Thi s innovatio n evidentl y require d th e pattern-forming proces s responsibl e fo r formation of th e ligamen t t o b e decouple d fro m tha t whic h controls growth of the hinge plate. In other arcoids , growth o f th e ligamen t an d growt h o f th e ro w o f hinge teeth follow a common pattern. In both cases, new element s ar e inserted a t or near the middl e of the set, beneath the umbones.

A remarkabl e serie s o f specimen s o f Limopsis marionensis Smith from the vicinity of the Falkland Islands suggest s ho w thi s chang e i n patter n formation ma y hav e bee n accomplishe d (Fig . 4) . The shell s ar e larg e fo r thi s genus , wher e a maximum dimensio n o f 1- 2 cm i s usual . Thei r ligaments exhibi t stron g positivel y allometri c growth. Thi s i s characteristi c o f man y arcoid s o n account of the inherent weakness of their ligaments (Thomas 1976) . Th e juvenil e shell s hav e typica l limopsid ligament s wit h a singl e pai r o f anterio r and posterio r lamella r layers . Th e adult s ar e quite

282

R. D . K . THOMA S ET AL.

inhibition contro l th e productio n o f lamella r ligament that forms either oblique sheets or vertical strips, dependin g o n th e directio n i n whic h activation propagate s a s th e shel l grows . Ne w elements ar e adde d whereve r spac e availabl e between existing zones of activation exceeds a limit that defines the repeat interval of the pattern. If this model i s correct , onl y a single , simpl e chang e i n instructions to the narrow field o f cells constituting the mantle isthmus should be required to change the process fro m generatin g on e patter n t o produc e another. To asses s th e plausibilit y o f thi s model , th e present author s hav e develope d compute r simula tions o f arcoi d an d noetii d ligaments , base d o n growth programs that incorporate it s assumptions.

Harmonic bifurcation model A simple, one-dimensional model treat s the mantle isthmus a s a finite , expandin g spac e tha t ca n accommodate a n integra l numbe r o f waves . Thi s approach employ s th e kind of morphogenetic rules that wer e employe d b y Oste r e t al (1988 ) t o explain the patterns of cartilage condensation in the Fig. 3 . Representative growth pattern s of arcoid ligaments, (a) Glycymeris, Anadara, Barbatia, Parallelodon', (b ) Area', (c) Cucullaea\ (d) Limopsis; (e) Limopsis variant , no t uncommon i n some species ; (f) Noetia (Eontia).

different i n form, wit h varying numbers of more or less irregularly disposed, vertica l strip s o f lamellar ligament. I n th e mos t extrem e variants , th e ligament extends to the extremitie s o f the cardinal area and , apar t fro m it s irregularity , th e growt h pattern is that of a noetiid ligament. This growt h serie s show s that , afte r a phase o f isometric expansion , th e zone s o f secretio n o f th e initial lamellar components of the ligament stopped migrating anteriorl y an d posteriorly . A s a result , space fo r th e insertio n o f additiona l strip s o f lamellar ligamen t becam e availabl e a t the anterio r and posterior margin s o f the ligament , rathe r tha n medially a s i n othe r arcoids . Th e inferre d relationship between this growth pattern an d those of actua l noetiids i s confirmed by th e ligaments of living an d Cretaceou s specie s o f Striarca, wher e lamellar strip s ca n b e see n t o gro w firs t obliquel y and then perpendicular t o the hinge line (Fig. 5). In combinatio n wit h th e regularl y space d chevron patterns o f typical arcoi d ligaments , thes e observations sugges t a general mode l fo r develop ment o f th e observe d patterns . Alon g th e mantl e isthmus, alternatin g zone s o f activatio n an d

Fig. 4 . Ontogeny of the ligament of Limopsis marionensis Smith fro m th e South Atlantic , nea r the Falkland Islands. Scal e bar, 1 cm. Specimens fro m BMNH lot s 196457 6 and 1964581 , 'Discovery ' station s 819 and 652, describe d by Dell (1964), but withou t reference to this aberrant growth pattern.

GROWTH PATTERN S O F NOETIID LIGAMENTS

283

Fig. 5 . Scanning electron micrograp h o f the ligament of Striarca lactea (Linne) from th e Bay of Naples, Italy. Note strips o f lamellar ligamen t (arrows ) inserte d i n grooves in the fibrous ligament, turnin g awa y from th e margin of the attachment area to assume a vertical orientation .

development o f vertebrat e limbs . Here , a sin e function represent s th e ne t effec t o f activating an d inhibiting processes that control the serial repetitio n of lamella r sheet s a s the y gro w t o for m a typica l chevron ligament (Fig. 6). A threshold value of this function act s as a switch, calling for a change in the type of secretion each time it is passed. The level of the threshold determine s th e relative widths o f the lamellar sheet s an d th e fibrou s interval s betwee n them. As growt h increments , 8h, ar e adde d t o th e ligament are a of height h and length L, then: where f(8h) determine s th e shape of the attachment area (Fig. 7a). At growth stages in which the medial chevron i s a ne w lamella r sheet , th e relatio n between the length of the ligament an d the number of alternations is given by: where m is the number of lamellar sheets , a and b are th e length s o f th e lamella r sheet s an d fibrou s intervals in the plane of the hinge axis, respectively, and r lam i s th e lengt h o f th e newl y developin g lamellar shee t i n th e sam e plan e (Fig . 7b) . Likewise, when the medial chevron is a new fibrous interval, then:

where r fib i s th e lengt h o f th e newl y developin g fibrous interval . Ne w element s ar e adde d t o th e pattern when:

These relationship s defin e th e proportion s o f th e triangular ligamenta l are a a s a whol e an d the y maintain th e constan t width s an d spacin g o f th e elements o f the growth pattern. A compute r progra m incorporatin g thes e principles, writte n b y Luk e Kiskaddon , produce s simple graphi c simulation s o f th e growt h pattern s of arcoid ligaments. At each step in the process, th e preexisting patter n serve s a s a template for the next growth increment. A n instruction correspondin g t o f(Sh) control s th e rat e o f anterio r an d posterio r migration o f the zone s of secretio n o f lamellar an d fibrous material. This variable determine s th e angle of th e chevron s an d henc e th e shap e o f th e ligament's attachmen t are a (se e Equatio n 1 an d Figs 3 an d 7) . Th e introductio n o f ne w media l increments is controlled b y a sine function an d by a limiting valu e that trigger s th e switc h an d set s th e relative magnitudes of a and b (Fig. 8a) . The sam e mode l produce s noetii d growt h patterns if the zones of secretion o f the two types of ligamental materia l remain fixed , producin g strip s that expan d verticall y downward s onc e the y ar e established (Fig . 8b) . Here , th e sin e functio n

284

R. D . K . THOMA S E T AL.

Fig. 6 . Simple harmonic, sine wave model for control of secretion of lamellar and fibrous ligamen t along the mantle isthmus by arcoid bivalves.

governs th e introductio n o f ne w element s a t th e anterior an d posterio r margin s o f th e ligament , rather than medially. Thus, two simple changes in a program writte n t o simulat e typica l arcoi d ligaments ar e sufficien t t o conver t i t t o generat e noetiid growt h patterns . Actually , on e chang e would suffic e i f bot h program s wer e modifie d i n such a wa y a s t o promp t th e introductio n o f ne w elements whereve r th e availabl e spac e exceed s a limiting value. This is what one woul d predict i f a set o f morphogen s control s activatio n an d inhibi tion uniforml y alon g th e lengt h o f th e mantl e isthmus. These model s confir m tha t quite simple changes in instruction s ar e sufficien t t o deriv e a noetii d ligament fro m a developmenta l syste m originall y programmed t o produc e th e chevro n pattern s o f typical arcoids . Thes e simulation s represen t th e outcomes o f developmen t i n thi s syste m appropri ately. However , the y d o no t incorporat e th e dynamics o f diffusin g morphogens , o r cel l migration, that are generally inferred to control the process o f patter n formation . A mor e realisti c approach t o thi s proble m i s t o emplo y a Turin g model (Turin g 1952 ) tha t simulate s the kinetic s of the reactions that may be involved in development. Models o f this kind have been used extensively by Meinhardt (1984 , 1998 ) an d Meinhardt & Klingler (1987) t o simulat e th e developmen t o f colou r patterns observe d i n mollusca n shells . Som e o f these patterns are very similar, but not quite identical in form o r regularity, to those that are involved here.

Reaction-diffusion model The harmoni c bifurcatio n mode l simulate s inter action o f a sin e functio n wit h th e growt h o f a

bounded domain - the ligamental attachmen t area as a mechanis m tha t coul d generat e th e spatia l patterns o f arcoi d ligaments . However , i t doe s no t account fo r th e origi n o f th e oscillatin g signa l represented b y the sin e function . A model tha t has commonly bee n invoke d t o explai n patter n formation o f thi s sor t involves th e interactio n o f a short-range 'activator ' an d a n 'inhibitor ' wit h effects tha t exten d ove r a greate r distance . Turin g (1952) first showe d theoretically that such a system could spontaneousl y generat e heterogeneou s concentrations o f reactin g chemical s whic h could , in principle , lea d t o biologica l patter n formation . The stable , stead y stat e pattern s o f morphogen s predicted b y Turin g (1952 ) hav e ye t t o b e documented i n living systems , bu t the y hav e bee n produced experimentall y i n chemica l system s (Castets e t al 1990 ; Ouyan g & Swinne y 1991) , confirming th e feasibility of such models. Turing models ar e based o n the suppositio n that at least one of the reactants is migrating through the system b y diffusio n an d tha t ther e i s a n autocatalytic ste p i n a linked se t o f reactions. Th e concentration o f on e o f th e reactant s trigger s a specific developmenta l proces s whe n i t exceed s a certain threshold . Fixe d patterns , suc h a s th e segmentation of arthropod limbs (Meinhardt 1984) , can b e modelle d b y standin g wave s i n suc h a system. Migratin g colou r pattern s o f mollusca n shells (Meinhard t & Klingle r 1987 ) an d stripe s of growing angelfis h (Painte r e t al . 1999 ) ar e simulated by waves which move through time, due to growt h o f th e domain s wher e thes e pattern s occur. Th e pattern s generate d b y Turin g model s depend o n diffusio n rates , th e kinetic s o f th e reactions involved , th e siz e an d shap e o f thei r domain of activity, and whether or not the reactants can diffus e acros s the boundaries o f the domain.

GROWTH PATTERN S O F NOETIID LIGAMENTS

Models involvin g cell movemen t in response t o mechanochemical cue s hav e als o bee n invoke d t o explain spatia l patter n formation . Mos t o f thes e models also involve a mechanism involving shortrange activation and long-range inhibition (Murray 1993). Th e tw o sort s o f model s ar e sufficientl y similar mathematicall y tha t many developmenta l patterns ca n equall y wel l b e represente d b y either on e o f them . Consequently , on e o f th e simplest type s o f Turin g model s ha s bee n use d here t o simulat e th e growt h pattern s o f arcoi d ligaments. The Schnakenber g (1979 ) [an d se e Murra y (1993)] mode l i s base d o n a hypothetica l se t o f three reactions:

285

Applying the law of mass action simultaneously to these reactions , productio n o f the activator , X , and the inhibitor , F , occur s a t rate s k 2a -klu + k3u2v and k 4b - & 3w2v, respectively. Th e variables u, v, a and b ar e th e concentration s o f X, F , A an d # , respectively, and kv k 2, k3 and k4 are rate constants. The simplifyin g assumptio n that A an d B occu r in abundance i s made , s o tha t thei r concentration s may b e approximate d b y constants . Then , th e Schnakenberg model takes the form :

and

Fig. 7. Parameters o f a growing duplivincula r ligament . Gz , zone o f secretion at the mantle isthmus ; G , growth lines; h, height o f ligamental attachmen t area ; 8/z , height o f a growth increment; L , length o f ligamental attachmen t area ; a and b, lengths o f sheets of lamellar and fibrous material, respectively , i n the plane of the mantle isthmus ; r fib an d rlam, length o f the latest fibrou s o r lamellar element, respectively , bein g adde d t o the pattern; m , number o f pairs of ligament elements .

286

R. D . K . THOMA S E T AL.

Fig. 8 . Simulated growth patterns of: (a) the duplivincular o r chevron ligament ; (b ) the noetii d ligament; (a) and (b) generated by two variants of a computer mode l writte n b y Luke Kiskaddon . Ne w elements are added to the pattern whenever the length of the latest media n elemen t (a) or distal element s (b ) reaches a limiting value.

The last term in each equation models diffusion an d the syste m ha s bee n rescale d s o a s t o b e nondimensional, reducin g th e numbe r o f constan t parameters t o fou r (a, b, y an d d). Here , y i s a function o f th e siz e o f th e ligamen t relative t o th e strength of the reaction terms (Murray 1993 ) and d is th e rati o o f th e diffusio n coefficient s o f th e activator and inhibitor, X an d 7 , respectively. The boundary conditions fo r this system take the form:

where « n an d v n ar e th e derivative s o f u an d v , respectively, norma l t o the domain boundary ; the y account for the flo w o f chemicals in and ou t o f th e domain o f activity. 9 L, 0 R, u f an d v f ar e constants . The subscript s R and L denote right - an d left-han d boundaries o f the model domain , corresponding t o the anterio r an d posterior margin s of the ligament . By choosin g differen t value s fo r thes e constants , different boundar y condition s can be set . For example, whe n 9 L = 0R = 1, the n u an d v take th e fixed value s « f an d v f, respectively , o n th e boundaries. Alternatively, if 0L = 9R = 0, there is no chemical flu x acros s th e boundary , whic h i s considered t o b e impermeable . I n thi s model , growth i s represented b y increasing x alon g a one dimensional interval equivalent to the length of the ligament, fro m it s midpoint, a t any time, t (Fig. 9) . Initial conditions are given by: To simulat e pattern s o f ligamen t growt h o n th e

expanding domai n x v appropriat e parameter s mus t be set . Wit h a = 0.1 an d b = 0.9, th e mode l yield s the homogeneou s stead y stat e w s =1.0, v s = 0.9. This i s stabl e in the absenc e o f diffusion. Standar d linear stability analysis is then used to select values of d an d y at whic h thi s stead y stat e give s wa y t o linear instability, producing periodic concentration s of th e reactant s i n th e presenc e o f diffusion . Th e number o f sinusoida l peak s forrne d i n th e domai n of ligamen t growt h i s determine d b y th e value s of the parameters [se e Murray (1993) fo r full details] . In this analysis, the valu e of d is se t at ten an d y is increased unti l th e unifor m stead y stat e become s unstable. A t thi s point , y i s fixe d an d a n expo nentially increasin g functio n i s selecte d t o defin e domain growth, representing th e allometric growth of th e ligamenta l area . Change s i n th e spatia l pattern o f chemica l concentration s ca n no w b e simulated a s this domain expand s ove r time . In thi s system , the growt h pattern i s determine d by th e boundar y condition s an d y prescribe s th e number o f cycle s correspondin g t o alternation s between th e secretio n o f lamella r an d fibrou s ligament material . I f v = 0.7 a t the domai n boundaries, an d let u n = 0 at these boundaries, th e model simulates the symmetrical, chevro n growt h patter n of typica l arcoid ligaments . With y = 29 , a growth pattern wit h one anterior and one posterior sheet of lamellar ligamen t i s represente d (Fig . 9a) . Thi s corresponds t o th e ligament s o f mos t juvenil e arcoids an d t o th e adult s o f specie s wit h a singl e pair o f lamella r sheets , suc h a s Cucullaea an d normal forms of the paedomorphic genus Limopsis. With y = 185, the model simulates the characteristi c growth patter n o f a classic , symmetrica l dupli vincular ligament (Fig. 9b) . All that is necessary t o switch this syste m to the developmental patter n o f a noetii d ligamen t i s a change i n boundar y conditions . Wit h v = 0. 7 a t x = 0, instea d o f a t th e expandin g margi n o f th e domain, th e extremitie s o f the ligamenta l are a ar e no longer fixe d boundarie s tha t ancho r th e growth pattern. Now, the pattern originates belo w the umbo and ne w lamella r element s ar e adde d a t th e dista l margins of the ligament. Withou t any other chang e in th e underlyin g system , th e patter n simulatin g alternate lamella r an d fibrou s element s run s perpendicular t o the hinge axis , lik e th e ligament s of noetiids (Fig . 9c) . Furthermore, b y adjustin g th e concentration o f the activator , X , to u = 1.4 at th e expanding margin , o n th e righ t (Fig . 9d) , i t i s possible to simulate the transition fro m one or more oblique lamella r chevrons , runnin g paralle l t o th e margin o f the ligament, t o vertical strip s a s seen in the ontogeny of Limopsis marionensis (Fig. 4) and in the early growth stages of the noetiid ligamen t in some species o f Striarca (Fig . 5) . This interpretation of the models implies that the

GROWTH PATTERN S O F NOETIID LIGAMENTS

287

Fig. 9 . Schnakenberg models simulatin g the growth patterns o f arcoid ligaments . Colou r spectru m represent s th e concentration, u, of the activator. Limitin g value s of u model contro l ove r th e periodic insertion o f sheet s o f lamella r ligament, (a) Juvenile o f any arcoid wit h a duplivincular ligament , o r adult Limopsis. (b) Duplivincular ligamen t o f Glycymeris, Anadara, Idonearca o r Grammatodon. These tw o simulation s represen t differen t stage s o f developmen t under the same model , wit h v = 0.7 at the domain boundarie s an d with u n = 0 at these boundaries , (c) One side o f a noetiid ligament , simulate d wit h v = 0.7 and w n = 0 along x = 0, and with v n = 0 at the expanding, dista l margin o f the ligament, (d) Model o f an intermediate growt h pattern . Strip s o f lamellar ligament firs t ru n parallel t o the margin of the attachment area , the n tur n to run perpendicular t o the hinge axis . Here , v = 0.7 along x = 0, and u = 1.4 along th e distal margin , otherwise wit h zero flux .

concentration o f th e inhibitor , v , i s fixe d a t th e extremities o f th e ligamen t i n typica l arcoids , which is consistent with their growth patterns. It is less clear how the concentration of this morphogen might be fixed half-wa y alon g the mantle isthmus, as required to simulate the noetiid pattern. This may reflect th e establishmen t o f a patter n tha t itsel f serves as a template for the subsequent distribution of morphogens , excep t wher e growt h permits th e introduction o f ne w elements . Thi s call s fo r exploration of the possibility that a change in one of the rate-determinin g variables , rathe r tha n th e

boundary conditions, may serve as a developmental switch in this system (J. Hutchinson, pers. comm.).

Discussion The models developed in this work show that what might hav e seeme d t o b e rathe r fundamenta l differences i n growt h pattern , betwee n th e liga ments of typical arcoids and those of noetiids, may be controlled by little mor e than a relatively simpl e developmental switch. Shifting th e sit e of additio n of ne w element s t o th e pattern , fro m nea r th e

288

R. D . K . THOMA S E T AL.

midpoint of the ligament to its extremities, require s only a chang e i n boundar y condition s o f th e expanding morphogeneti c fiel d wher e growt h increments ar e adde d t o th e ligament . Conse quently, th e possibilit y tha t thi s evolutionar y innovation emerge d independentl y i n mor e tha n one lineage mus t be taken seriously . The noetiid s ar e quit e disparat e i n shel l form , including even the disposition o f the ligament. Th e genera assigne d b y MacNei l (1938 ) an d Newel l (1969) t o th e Noetiinae , includin g Noetia an d Eontia, seem t o constitute a cohesive group . They are generall y characterize d b y quit e strongl y opisthogyrate umbones , broa d primar y rib s an d crenulate interio r margins . I n thi s group , th e ligament extend s ove r muc h o f th e cardina l area , including al l the spac e tha t i s available anterio r t o the umbone s (MacNei l 1938) . Mos t o f thes e animals ar e o r wer e shallo w burrowers , broadl y comparable in shell form an d mode of life wit h the arcid Anadara. Widel y distribute d today , fro m temperate t o tropical latitudes , this group includes the earlies t recorde d noetiid , fro m th e earl y Cretaceous (Aptian) of Lebanon. The gener a place d i n th e Striarcina e ar e mor e varied. Thi s subfamil y i s define d primaril y b y th e restriction o f it s ligamen t t o a triangula r area , directly below the umbones, which tend to be more nearly orthogyrat e than those o f othe r noetiids . I n Striarca, a conservativ e genu s tha t appeare d ver y late i n Cretaceous an d is widel y distribute d today , the ligament is inserted in a shallow embayment on each cardina l area . It s growt h i s commonl y allometric, so that it occupies an increasingly large proportion o f th e cardina l are a i n late r ontogen y (Oliver & Cosel 1992) . In contrast, the ligaments of other gener a occup y small , dee p resilifer s o n cardinal areas that may be broad, as in Arcopsis, or very muc h constricted , a s i n Ovalarca. I n thi s subfamily, som e genera have fine radia l ribs while in other s th e exterio r surfac e i s marke d onl y b y concentric growt h lines . Th e form , numbe r an d angular dispositio n o f th e hing e teet h ar e ver y varied. I n short , i t i s by n o mean s certai n tha t th e members o f thi s grou p shar e a commo n ancestr y with one another or with members of the Noetiinae. A thir d subfamily , th e Trinacriinae , consist s o f three extinc t gener a wit h a limite d tempora l an d geographic distribution. This may well be a natural group, a s MacNei l (1937 ) ha s shown . Thes e ar e tiny forms, most of them shaped more like Corbula than a n arcoid , bu t wit h taxodon t hinge s an d vertically laminate d ligaments . Interestingly , i n different specie s an d genera, these ligaments range from occupyin g a narrowl y confine d pi t t o extending ove r th e entir e anterio r par t o f a n expanded cardinal are a (MacNeil 1937) . It i s no w apparen t tha t non e o f th e shel l

characters b y which the family Noetiidae has bee n distinguished an d subdivide d i s exemp t fro m pervasive homoplasy . Th e phylogeneti c relation ships o f thes e an d othe r arcoid s nee d t o b e reassessed. Arcoi d shell s ar e relativel y simpl e structures, so evolutionary reversals (Stanle y 1972 ) and convergence are not unexpected. Consequently , future attempt s t o infe r tru e phylogeneti c relationships withi n thi s grou p wil l requir e th e careful integratio n o f morphological , stratigraphi c and biogeographical data.

Conclusions The analysi s develope d her e show s ho w th e strikingly distinctiv e for m o f th e ligamen t tha t characterizes th e noetiid s i s related , i n term s o f plausible underlyin g developmenta l processes , t o the duplivincular ligaments o f more typica l arcoid s from whic h i t evolved . Model s indicat e tha t th e novel growth pattern of the noetiid ligamen t ca n be derived a s a resul t o f on e o r tw o ver y simpl e changes i n th e regulatio n o f developmen t o f a typical arcoi d ligament . Th e adaptiv e significanc e of this shift ha s not yet been determined. However , the strength and mechanical functio n o f the noetiid ligament are comparable, i n general terms, to those of more typical arcoid ligaments, such as that fro m which i t evolve d (Thoma s 1978) . Furthermore , extreme variant s i n a livin g specie s o f Limopsis develop a ligament that is incipiently convergen t in form wit h that of the noetiids . Together, thes e observation s sugges t tha t bivalves wit h 'noetiid ' ligament s ar e no t neces sarily monophyletic . Th e implication s o f thi s analysis fo r evolutionar y systematic s ar e quit e provocative. Th e evolutio n o f growt h pattern s which appear to be quite disparate, but are based on a common developmental process , ma y require n o more genetic divergence than more subtle character shifts. Wha t see m t o b e 'major ' characters , assumed t o b e o f grea t evolutionar y significance , are no t necessaril y les s labil e o r mor e constraine d than character s lik e detail s o f shel l sculptur e tha t are commonl y suppose d t o b e o f mor e loca l (lower taxonomi c level ) significance . Conse quently, growt h processe s mus t be take n int o ful l account whenever a character i s used to determin e phylogenetic relationships . The author s ar e gratefu l t o L . Kiskaddo n fo r hi s simulations, programme d whe n h e wa s a studen t a t Franklin & Marshall. His work established the viability of this project . W e are gratefu l t o K . L. Davi s fo r excellen t SEM photography (Fig. 5) . We also thank J. A. Crame, J. Hutchinson, P . W. Skelto n an d T . R . Walle r fo r detaile d and constructiv e review s tha t gav e ris e t o significan t improvements i n th e manuscript . W e ar e gratefu l fo r financial suppor t fro m Frankli n & Marshal l Colleg e

GROWTH PATTERN S O F NOETIID LIGAMENTS (RDKT) an d th e Nationa l Universit y o f Scienc e an d Technology o f Zimbabwe (AM) .

References CASTETS, V. , DULOS , E. , BOISSONADE , J . & D E KEPPER, P. 1990. Experimenta l evidenc e o f a sustaine d standing Turing-typ e nonequilibriu m chemica l pattern. Physical Review Letters, 64, 2953-2956. DELL, R . K . 1964 . Antarcti c and Subantarcti c Mollusca: Amphineura, Scaphopod a an d Bivalvia . Discovery Reports, 33, 93-250. MACNEIL, F . S . 1937 . Th e systemati c positio n o f th e pelecypod genu s Trinacria. Journal o f th e Washington Academy o f Sciences, 27, 452^58. 1938. Specie s an d gener a o f Tertiar y Noetinae . United States Geological Survey, Professional Paper, 189-A , 1-50 . MEINHARDT, H . 1984 . Model s fo r positiona l signalling , the threefol d subdivisio n o f segment s an d th e pigmentation pattern s o f molluscs . Journal o f Embryology an d Experimental Morphology, 83 , Suppl, 289-311. 1998. Th e Algorithmic Beauty o f Se a Shells, 2n d Edition. Springer , Berlin. & KLINGLER , M . 1987 . A mode l fo r patter n formation o n th e shell s o f molluscs . Journal o f Theoretical Biology, 126 , 63-89 . MURRAY, J. D. 1993 . Mathematical Biology, 2n d Edition . Springer, Berlin . NEWELL, N . D . 1937 . Lat e Paleozoi c pelecypods : Pectinacea. Kansas Geological Survey, Publications, 10(1), 1-123 . 1969. Family Noetiida e Stewart , 1930 . In : MOORE , R. C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6, Bivalvia. Geological Societ y of America, Boulder , CO , an d Universit y o f Kansas , Lawrence, KS, 261-264. OLIVER, P . G . & COSEL , R . VO N 1992. Taxonom y o f tropical Wes t Africa n bivalves . V . Noetiidae . Bulletin, Museum national d'Histoire Naturelle, Paris, 4e serie, 14, section A , 655-691.

289

OSTER, G . F. , SHUBIN , N., MURRAY , J. D . & ALBERCH , P . 1988. Evolutio n an d morphogenetic rules: the shap e of th e vertebrat e lim b i n ontogen y an d phylogeny. Evolution, 42, 862-884. OUYANG, Q . & SWINNEY , H. L . 1991 . Transitio n fro m a uniform stat e t o hexagona l an d stripe d Turin g patterns. Nature, 352, 610-612 . OWEN, G . 1959 . The ligament and the digestive system in the taxodon t bivalves . Proceedings o f th e Malacological Society of London, 33, 215-223. PAINTER, K. J., MAIM, P. K. & OTHMER, H. G. 1999 . Strip e formation i n juvenile Pomacanthus explaine d b y a generalized Turin g mechanis m wit h chemotaxis . Proceedings of the National Academy of Sciences, USA, 96 , 5549-5554. SCHNAKENBERG, J . 1979 . Simpl e chemica l reactio n systems wit h limi t cycl e behaviour . Journal o f Theoretical Biology, 81, 389^00. STANLEY, S . M . 1972 . Functiona l morpholog y an d evolution o f byssall y attache d bivalv e mollusks . Journal o f Paleontology, 46 , 165-212 . TEVESZ, M . J . S . 1977 . Taxonom y an d ecolog y o f th e Philobryidae an d Limopsida e (Mollusca : Pelecypoda). Peabody Museum, Yale University, Postilla, 171, 1-64 . THOMAS, R . D. K. 1976 . Constraint s o f ligament growth , form an d functio n o n evolutio n i n th e Arcoid a (Mollusca: Bivalvia). Paleobiology, 2, 64-83. 1978. Shell form and the ecological range of living and extinct Arcoida. Paleobiology, 4 , 181-194 . TRUEMAN, E . R . 1969 . Ligament . In: MOORE , R . C . (ed. ) Treatise on Invertebrate Paleontology. Part N. Mollusca 6 , Bivalvia. Geologica l Societ y o f America, Boulder , CO , an d Universit y o f Kansas , Lawrence, KS, 58-64. TURING, A . M . 1952 . Th e chemica l basi s o f morphogenesis. Philosophical Transactions o f th e Royal Society, London, Series B, 237, 37-72 . WALLER, T. R. 1990 . The evolution of ligament systems in the Bivalvia . In: MORTON, B . (ed. ) Th e Bivalvia Proceedings of a Memorial Symposium in Honour of Si r Maurice Yonge, Edinburgh, 1986. Hong Kong University Press , Hong Kong , 49-71.

This page intentionally left blank

Carboniferous praecardioid bivalves from the exceptional Buckhor n Asphalt biota of south-central Oklahoma, USA T. E. YANCEY & M. J. HEANEY, III Department of Geology and Geophysics, Texas A&M University, College Station, Texas 77843-3115, USA, (e-mail: tyancey@ tamu.edu) Abstract: Unusua l Pennsylvania n bivalve s recovere d fro m th e Buckhor n Asphal t Quarr y o f south-central Oklahoma are members of the Order Praecardioida , Family Lunulacardiidae. This is th e younges t occurrenc e o f praecardioid s i n Nort h America . Thes e praecardioid s hav e a n ontogeny characterize d b y a venerifor m juvenile shell , changing abruptl y t o a n elongat e adul t shell wit h shar p carinae , accompanie d b y stron g rotatio n o f th e juvenil e shel l an d chang e i n ligament. These shells provide new evidence o f dentition an d ligament for lunulacardiids an d the first documentatio n of praecardioid shel l microstructure. The Buckhorn taxa possess stout hinge teeth, indicatin g that lunulacardiids are not edentulous . Preserved ligamen t in multipl e growth stages indicate s tha t beak s ar e prosogyrou s an d th e flattene d truncate d portio n o f th e shel l i s posterior. A revised diagnosis of the Lunulacardiidae is presented. New taxa: Buckhornia carteri n. gen., n. sp.

The bivalv e faun a o f th e Carboniferous-age d Buckhorn Asphalt deposit of southern Oklahoma is unique, containin g shell s tha t ar e mineralogicall y and geochemicall y unaltere d an d very close to th e shell conditio n a t th e tim e o f deat h o f th e organisms. Shel l materia l accumulatin g o n th e seafloor wa s sealed in asphalt shortly after deat h of the organisms, keeping the skeletal remains isolated from por e fluid s an d protectin g the m fro m diagenetic alteration . Partl y mineralize d skeleta l material suc h a s ligamen t i s preserve d fo r man y species (Heane y & Yance y 1991 ) an d eve n th e organic matrix of shell (sheaths around crystallites ) is preserve d (Heane y & Yance y 1993) . Th e exceptional preservation of Buckhorn shell material reveals minut e shel l character s normall y obscure d in Palaeozoi c fossil s an d provide s unaltere d shel l for documentatio n o f majo r an d mino r elemen t chemistry (Cric k & Ottensma n 1983 ) an d stabl e isotope geochemistr y (Bran d 1987 ; Hewit t e t al 1989). This bivalv e faun a i s unusua l i n containin g a dominance of smal l shells, preserving shell s down to submillimetre siz e range (the smallest i s a larval shell o f 180u m maximu m dimension) . Som e o f these ar e juvenile s o f commo n Desmoinesia n bivalves, but many are shells of small taxa that have not been previously described. Bivalves of this size are no t normall y preserve d i n ancien t sediment s and have not been studied, although small bivalves are common i n modern biotas an d taxa of this siz e

range were probably also a common component of Palaeozoic biotas . The most unusual of the Buckhorn bivalves is the focus o f thi s study : a small , inflated , moderatel y ribbed bivalve with strong angulations on the shel l and a large, distinc t juvenile shel l stage . Th e mos t distinctive featur e is the change tha t occur s durin g transition fro m th e juvenil e t o th e adul t growt h stage, when the juvenile stag e is rotated relative to the orientation o f the adult shell. These ontogeneti c changes an d larg e juvenil e stag e indicat e a relationship wit h bivalve s o f th e Lat e Palaeozoi c genus Lunulacardium Munste r 184 0 an d mid Palaeozoic genus Patrocardia Fischer 1887 . The exceptiona l preservatio n o f Buckhor n material allows accurate documentation of the shell ontogeny, microstructure , ligamen t an d dentitio n for thi s typ e o f lunulacardiid , an d provide s muc h new dat a fo r th e Orde r Praecardioida . Althoug h praecardioids ar e usuall y describe d a s bein g edentulous, th e Buckhor n praecardioid s posses s stout hinge teeth. Despite this apparent discrepancy in hing e character , othe r shel l character s indicat e that the Buckhorn taxon is properly assigne d t o the Family Lunulacardiidae.

Location The materia l studie d i s fro m asphalt-impregnate d sediments o f th e Bogg y Formatio n withi n th e Buckhorn Asphalt Quarry south of Sulphur, Murray

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Specia l Publications, 177 , 291-301 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

292

T. E. YANCE Y & M. J . HEANE Y

County, Oklahoma (S E 1/4 , sec . 23, T. IS., R. 3E., Indian Baselin e an d Meridian ) (Fig . 1) . Th e Boggy Formation , o f Middl e Pennsylvania n (Desmoinesian Stage , Lat e Carboniferous ) age , i s part of the Deese Grou p and contains a diverse and abundant molluscan fauna . The shells are small and fragile an d were obtained by dissolving the asphalt matrix wit h carbo n tetrachlorid e i n a Soxhlet ™ hydrocarbon extractio n apparatus . Well-preserve d specimens wer e mounte d o n stub s an d examine d with JEO L T33 0 an d JEO L T640 0 scannin g electron microscope s (SEM ) for documentatio n o f surficial an d microstructural details.

Biotic assemblag e The Buckhor n praecardioid s occu r i n a bioti c assemblage tha t i s infrequentl y preserve d i n Palaeozoic strata , i.e . a n assemblag e characterize d by th e occurrenc e o f commo n orthocon e cephalo pods an d 'edentulous ' bivalves . Thi s unusua l assemblage i s bes t know n i n th e Siluria n an d Devonian cephalopo d limestone s o f Bohemi a described b y J . Barrande , an d a t man y othe r site s along th e margin s o f th e Proto-Tethy s Se a (Kfi z 1979), i n the Lat e Devonia n Naple s faun a o f New York describe d b y Clark e (1904 ) an d i n th e earl y Carboniferous Cul m facie s o f Europ e (Amle r 1998). Thes e assemblage s occu r i n fine-graine d

sediments deposited in shallow environments (Kfi z 1984), withi n basin s havin g connection s t o deep marine environments . Th e cephalopo d shel l concentrations ar e interprete d t o originat e fro m empty shells floated into the area and sinking to the seafloor (Kfi z 1984) , althoug h a n alternativ e interpretation is that the cephalopods occu r in death assemblages forme d afte r matin g activit y i n shallow waters . Sediments o f th e Buckhor n Asphal t deposi t accumulated i n moderatel y shallow-wate r condi tions, adjacen t t o a smal l lan d mas s nea r deep marine water s o f a n ope n ocea n basin . Thes e sediments are sandier than sediments containing the Silurian an d Devonia n assemblage s cite d above , and ar e par t o f a cyclothe m sequenc e deposite d under conditions of systematic variation in sea level causing regula r change s i n wate r dept h an d migration o f shorelines . Consequently , ther e i s a greater diversit y o f mollusc s an d non-mollusca n species i n th e Buckhor n biot a tha n i n olde r praecardioid-bearing assemblages . The Buckhor n Asphal t biot a i s preserve d i n mixed terrigenou s an d calcareous sedimen t withi n the uppe r par t o f a cyclothem . Base d o n th e presence o f plan t remain s an d scou r channel s i n some o f the beds expose d a t the Buckhor n Quarr y site, Squire s (1973 ) suggeste d tha t th e asphalt impregnated Buckhor n Quarr y sediment s wer e deposited i n a nearshore marin e environment unde r

Fig. 1 . Location o f the Buckhorn Asphal t Quarr y relativ e t o structural units o f the Arbuckle Mountains , Oklahoma . Tickmarks indicate boundarie s o f townships i n Indian Baselin e an d Meridian gri d syste m o f Oklahoma. Modifie d from Squire s (1973) .

BUCKHORN PRAECARDIOI D BIVALVES

moderately turbulen t conditions . Cric k & Ottensman (1983) postulated a depositional settin g below a fairweathe r wav e bas e i n a depositiona l environment characterize d b y episodi c distur bances. Th e occurrenc e o f abundan t shel l frag ments, alon g wit h som e woo d fragment s an d bitumen clast s i n sand s containin g th e fossils , suggests deposition unde r stor m conditions , whic h is compatibl e wit h th e conclusion s o f Cric k & Ottensman (1983) . Regiona l analysi s by Hewit t et al (1989 ) showe d tha t th e Buckhor n are a la y adjacent t o structural highs on the Ardmore Block, but near deep basinal waters of the Anadarko Basin and the oceanic basi n between Nort h America and Gondwana. Deposition o f the Buckhor n sediment s withi n a depth rang e o f 10-2 0 m ca n b e inferre d fro m sediment characteristic s an d th e microbore d condition o f th e shells . Buckhor n Asphalt Quarry sediments wer e deposite d belo w th e fairweathe r wave bas e an d abov e th e stor m wav e base . Th e depth of the fairweather wave base at the Buckhorn site provide s a mean s o f estimatin g th e minimu m water depth , onc e th e wav e conditio n o f ocea n waters in this region is inferred. A modern analogue is availabl e i n th e northwester n Gul f o f Mexico , where the fairweather wave base lies at 1 0 m water depth or less, as determined by changes in seafloo r sediments (Snedde n & Nummeda l 1991) . Man y gastropods an d bivalve s i n th e Buckhor n Asphal t deposit hav e thei r oute r surface s scarre d wit h microborings characteristi c o f th e uppe r photi c zone, providing a means to estimate a lower waterdepth limit . Th e microboring s consis t o f tin y tubules penetratin g th e shell , simila r t o boring s produced by cyanobacteria i n the upper photic zone microboring assemblag e o f Budd & Perkins (1980 ) on th e shelve s aroun d Puert o Rico . Th e dept h boundary between the upper photic zone and lower photic zon e aroun d moder n Puert o Ric o i s 2 0 m, although water s in Desmoinesia n marin e environments o f souther n Oklahom a ma y hav e bee n les s clear tha n water s aroun d Puert o Rico , s o a reasonable lowe r dept h limi t fo r th e Buckhor n deposits i s 15-2 0 m . Thus, sedimentologica l indi cators sugges t a dept h rang e o f 10-2 0 m fo r th e Buckhorn deposit .

Valve orientation In most descriptions o f lunulacardiid bivalve s (e.g . Clarke 1904 ; Kfi z & Serpagli 1993 ) th e flattene d or truncate d portio n o f th e shel l ['lunule ' o f Minister (1840) ] i s presume d t o b e anterior . Thi s convention is based on the assumption that the gape on this surface enclosed a byssus and the flattening was functiona l i n positioning th e shel l agains t th e

293

Fig. 2 . Juvenile shell, showing th e change in shape during growt h an d form of growth lines . Dashed line indicates limit of the prodissoconch growth stage . Position and extent of ligament groove indicated by bracket, although th e ligament groove is not visible from this viewpoint. The crowding o f growth line s on the ventral margi n o f the juvenile shel l corresponds wit h development o f a sharp angulatio n o n that margi n (cf . with partial juvenile shel l in Fig. 4a) .

sediment surface or substrate for byssal attachment. In thi s convention , th e beak s o f th e shel l ar e directed posteriorl y (opisthogyrous) . Th e positio n of th e ligamen t o n Buckhornia gen . nov . indicate s that the beaks ar e prosogyrous. Severa l specimen s preserve fibrou s ligamen t withi n a groov e o n th e juvenile shel l (Fig . 2 ) an d o n th e interare a o f th e early adult . Orientation i s apparent on the juvenile shell becaus e i t i s veneriform , wit h a ligamen t contained withi n a n elongat e groov e locate d adjacent t o th e beaks . Thi s i s a postero-dorsa l (opisthodetic) positio n (Newel l & Boyd 1987) . O n some specimens i t is possible t o trace the extensio n of th e juvenile ligamen t ont o th e interare a o f th e adult shel l (Fig . 5c) . Th e flattene d o r truncate d portion (sica l surface ) of th e adul t shel l (bounde d by a carina ) wit h it s gap e i s thu s posterior . Thi s provides confirmatio n o f Rathman n & Amler' s (1992) opinions , an d als o a minorit y o f othe r workers, tha t lunulacardii d bivalve s ar e proso gyrous. Th e prosogyrous orientatio n ma y als o apply t o othe r praecardioid s wit h a venerifor m juvenile stage . I n th e followin g discussions o f lunulacardiids, anterio r i s th e directio n i n whic h beaks ar e pointed , an d posterio r i s th e directio n where the sical surface and large gape are located. A prosogyrous conditio n ca n be inferred fo r the lunulacardiids Chaenocardiola Holzapfel 188 9 and Lunulacardium Ministe r 1840 . Th e presenc e o f a truncated margin ['lunule ' o f Minister (1840) ] with a sica l surfac e behin d th e beak s o f thes e gener a unites the m wit h Buckhornia gen . nov .

294

T. E . YANCE Y & M . J . HEANE Y

BUCKHORN PRAECARDIOI D BIVALVES

Chaenocardiola haliotoidea (Roemer ) ha s tw o other character s indicatin g a clos e relationshi p t o Buckhornia gen . nov. : (1 ) a venerifor m juvenil e shell strongl y rotate d relativ e t o th e adul t shel l (Holzapfel 1889 , pi. 7, fig. 5); (2) a wedge-shaped umbone (Holzapfel 1889 , pi. 7, fig. 6b). The nature of th e juvenil e shel l o n Lunulacardium semistriatum Minister is not known, but the wedgeshaped umbon e i s apparen t i n Minister' s origina l illustration o f the species . Clark e (1904 ) noted th e close relationshi p o f Lunulacardium an d Chaenocardiola, s o despit e limite d knowledg e o f Lunulacardium semistriatum Minister , a proso gyrous condition and veneriform juvenile shell can be inferred for the genus Lunulacardium.

Systematic Palaeontology Order Praecardioida Newell, 1965 Family Lunulacardiidae Fischer, 188 7 Diagnosis. Praecardioid s wit h a truncate d posterior margi n containin g a sica l surface , veneriform juvenile shell and prosogyrous beaks. Discussion. Th e sica l surfac e an d truncat e posterior margi n o f lunulacardiid s i s thei r mos t unusual feature an d serves best to distinguish them from othe r praecardioids. Despit e th e limite d knowledge o f th e typ e specie s o f Lunulacardium Minister 1840, the truncate margin was the basis on which th e genu s wa s erected , makin g i t a reliabl e character fo r famil y determination . Th e presen t diagnosis o f th e famil y accommodate s gener a o f late Devonia n an d Carboniferou s age , bu t severa l late Siluria n an d earl y Devonia n praecardioi d genera assigned to the Lunulacardiidae b y Kriz & Serpagli (1993) may not belong i n the family. Assignment o f the Lunulacardiidae to the Order Praecardioida wa s firs t suggeste d b y Johnsto n & Collom (1998) i n their provisional classificatio n of cryptodont bivalves . Th e assignmen t i s clearl y justified b y th e presenc e o f a veneriform juvenile shell, abrup t change s i n growt h for m durin g ontogeny an d a truncate d posterio r margi n o n genera o f lat e Palaeozoi c lunulacardiid s (se e discussion i n Remark s sectio n below) . Thi s combination o f character s i s distinctiv e t o th e praecardioids.

295

Genus Buckhornia gen. nov. Derivation of name. I n reference to the Buckhorn Asphalt Quarry, source of the specimens . Type species. Buckhornia carteri sp. nov. Diagnosis. Elongat e lunulacardiid s wit h flat , truncated posterior margin containing sical surface enclosing larg e gape ; difference s i n ribbin g o n anterior, medial , an d posterio r portion s o f valve , separated b y carinae ; larg e venerifor m juvenil e shell which rotates 90 ° or more during transition to adult growth stage; and several stou t teeth on hinge line. Included species. Buckhornia carteri sp . nov . from the Buckhorn Asphalt Quarry in the Arbuckle Mountains of south-central Oklahoma . Remarks. Buckhornia i s simila r t o th e gener a Lunulacardium Ministe r 1840 , Chaenocardiola Holzapfel 188 9 and Patrocardia Fischer 1887 . It is most similar t o Chaenocardiola, but differs fro m i t in bein g mor e elongat e an d i n havin g differen t types o f ribbin g o n th e anterior , media l an d posterior portion s o f th e valve , separate d b y carinae. The nature of the Lunulacardium juvenile shell i s unknown at this time, but assumin g it als o possesses a larg e venerifor m juvenil e shell , Buckhornia differ s fro m Lunulacardium i n bein g more elongate , havin g a larger posterio r gap e and sical surface , an d difference s i n ribbing . Buckhornia differ s fro m Patrocardia [which Kfi z & Serpagl i (1993 ) showe d t o posses s a larg e veneriform juvenil e shell ] i n havin g a larg e posterior gap e enclose d b y a well-developed sica l surface an d a highe r degre e o f rotatio n o f th e juvenile shell relative to the adult shell. Patrocardia has a truncated posterior margin , but a sical surface has not been documented fo r this genus and it may not belon g i n the Lunulacardiida e a s diagnosed in this report . Buckhornia i s th e onl y lunulacardii d genu s documented to possess stout hinge teeth, but this is not a reliable distinguishin g characte r a t thi s tim e because o f uncertaint y abou t th e hing e o f othe r lunulacardiid genera. The teet h o n Buckhornia are fragile and post-mortem loss of teeth by breakage is common, suggestin g that th e suppose d edentulou s condition o f othe r gener a ma y b e base d o n observations o f incomplete specimens .

Fig. 3 . Buckhornia carteri gen. nov., sp. nov.. (a)-(d) USNM 509755, holotype, righ t valve; posterior, lateral , anterio r and dorsal views, respectively ; scale bar, 1 mm; specimen covered with asphaltic residue, uncoated. (e ) and (f) USNM 509762 , paratype, righ t valve; (e ) hinge structure ; scal e bar, 25 0 um; (f ) oblique lateral view; scal e bar, 50 0 um. (g ) Paratype USN M 509763 , oblique posterior view, showing sica l surface an d dentition; scale bar, 50 0 urn. Specimens (e)-(g ) gold-palladium coated. Illuminatio n o n specimens (b ) and (c) exaggerates th e commarginal ribbin g and obscures radia l ribbing ; commarginal ribbin g become s inconspicuou s o n the medial portion s o f larger adul t shells.

296

T. E. YANCE Y & M . J . HEANE Y

Steal surface. Th e posterior portio n (shel l locate d posterior o f th e shar p carina ) o f th e adul t shel l o f Buckhornia consist s o f a fla t surfac e aligne d perpendicular t o th e plan e o f commissure , conspicuously differen t fro m th e strongl y inflated medial an d anterior portion s o f the shell . Thi s fla t surface contain s a large gap e bounded by a sickle shaped shel l are a o n bot h valves . Clark e (1904 ) proposed th e ter m sica l surfac e (o r sica ) fo r thi s feature. The sical surface contains narrow, crowded growth line s an d i s bounde d b y a shar p ridge , i n contrast t o th e dominan t radia l ribbin g presen t o n the remainde r o f th e adul t shell . Clark e (1904 ) interpreted th e sica l surfac e gap e as a byssal gape, similar t o th e interpretatio n o f Kff z (1985 ) fo r slavids an d othe r praecardioids , bu t th e sica l surface i s locate d o n th e posterio r slop e o f Buckhornia, opposit e th e anterio r positio n o f a byssal gape . Age an d distribution. Desmoinesia n Stage , Lat e Carboniferous, Oklahoma . Species Buckhornia carteri sp. nov. Derivation o f name. I n honou r o f D r Josep h Carter, University of North Carolina. Type material. Holotype . U S Nationa l Museu m of Natura l Histor y (USNM ) 509755 ; paratype s USNM 509756-509776 . Fro m assorte d block s o f asphaltic sandston e in Buckhorn Asphalt Quarry. Type locality. Th e Buckhor n Asphal t Quarry , i n the Arbuckle Mountains, south of town of Sulphur, Murray County, south-central Oklahoma. Township & Range reference: S E 1/4 , sec. 23 , T. IS., R. 3E., Indian Baseline an d Meridian . Diagnosis. Lunulacardii d wit h larg e venerifor m juvenile shell , whic h rotate s anteriorly 90 ° during growth t o adult ; shel l for m change s fro m veneriform juvenile shell to subtrigonal adult shell; three to four stout , wedge-like teeth on adult hinge; ligament change s fro m elongat e opisthodeti c t o wide monovincular ; wid e posterio r sica l surfac e enclosing a large gap e extendin g along the length of shell ; differen t field s o f ribbin g o n anterior , medial, an d posterio r portion s o f valve , separate d by carinae. Description. Juvenil e (nepioconch ) shel l veneri form i n outline ; reache s 1.2m m maximu m dimension; moderatel y inflated ; initiall y smooth , gradually acquirin g ornamentatio n o f widel y spaced fin e commargina l ribs , bes t develope d o n outer zone of juvenile shel l (Fig . 2) ; small, smoot h prodissoconch. Adult shel l small , subtrigonal , wel l inflated ; hinge line short; anterior margin rounded, separated from media l shel l b y a smal l carina ; posterio r

margin wit h fla t sica l surfac e an d larg e gape , separated fro m th e media l portio n o f th e shel l b y sharp, well-develope d carin a (Fig . 3d) ; th e posterior carina is acutely angled and raised to form a ridge on adult shells; anterior and medial portions of shel l ornamente d wit h closel y spaced , flat topped radial ribs (three to four per millimetre) an d broader commargina l rugae ; commargina l ruga e present only between anterior an d posterior carinae ; radial rib s grow to c. 0.2 mm in width and becom e flattened o n top ; ne w radia l rib s appea r b y intercalation; growt h line s o n ventra l margi n o f young adul t shell s nearl y linea r an d obliqu e t o direction of shell elongation, becoming rounded on mature shell s (Fig . 6) ; sica l surfac e wit h narrow , sharp commargina l growt h line s an d ridge s (Fig . 3f); anterio r an d media l shel l margin s strongl y denticulate (Fig . 5a) . Hinge. Juvenil e hing e teet h unknown ; juvenil e shell wit h elongate opisthodeti c ligamen t confine d to a narrow groove alon g postero-dorsa l margi n of shell. Adult shel l wit h stou t teeth , wedge-shape d i n cross-section; thre e teeth on right valve and three or four teeth on left valve , with the posterior tooth on each valv e smaller tha n other teeth ; teeth attached to inner edge of valve, which lacks a distinct hinge plate (Fig. 3e) , henc e are weakly attached to shell , resulting in post-depositional breakag e an d los s of teeth in many specimens; earl y secrete d portion s of teeth occu r a s thic k curve d ridge s adherin g t o interior o f umbona l cavity ; adul t shel l wit h larg e broad trapezoi d ligamen t interarea , truncate d o n posterior margi n and triangular on anterior margin (Fig. 3f) ; adul t ligament monovincular(?) , consists of fibrou s layer extendin g betwee n th e ligamenta l areas; abrup t transitio n fro m juvenil e t o adul t ligament type ; ligamen t fibres o f juvenil e shel l attach perpendicula r t o surfac e o f ligostracu m i n ligament groov e (Fig . 5e) ; ligament fibres of adult attach a t obliqu e angl e t o curve d surfac e o f ligament area (Fig . 4c) . Shell micro structure. Prismato-nacreous , wit h very thi n oute r prismati c laye r an d thick nacreou s inner layers ; a thi n laye r o f fibrou s prismati c ligostracum presen t i n th e ligamen t groov e o f juvenile shell (Fig . 5E) . Ontogeny. Durin g ontogeny , th e shel l o f Buckhornia passe s throug h thre e distinc t growt h stages separate d b y tw o abrup t developmenta l transformations. Th e firs t ontogeneti c chang e occurs a t th e transitio n fro m prodissoconc h t o juvenile growth stag e [name d nepioconc h b y Kff z (1997, 1984 , 1985) ] an d th e second , an d greatest , occurs a t th e transitio n fro m juvenil e t o adul t growth stage (Fig. 3 b and c).

Fig. 4 . Buckhornia carteri gen. nov., sp. nov.; paratypes. (a) USNM 509758, right valve , beak vie w of venerifor m juvenile shel l with commarginal ribbing ; scal e bar, 200 um. (b)-(d) USNM 509759, left valve ; (b ) view of ligamen t groove on juvenile shell; scal e bar, 10 0 |^m; (c) beak are a showing rotated juvenile shel l an d portion o f fibrou s ligament on interarea of adult shell; scale bar, 500 um; (d ) hinge teeth o f adult; scale bar, 200 jam. All specimen s gold-palladium coated .

298

T. E. YANCE Y & M . J . HEANEY

The prodissoconch-dissoconc h transitio n changes th e shell from a small (100 um ) typical Dshaped shell [o f a type illustrated by Lutz (1985)] to a distinctiv e juvenile shel l o f inequilatera l shape . The juvenile growt h stag e i s venerifor m (Fig . 4a ) and no t morphologically intermediat e betwee n th e morphology o f th e prodissoconc h an d adul t shell , either i n shel l form o r ornamentation . Instead , i t contains fin e commargina l ribbin g over the middle and oute r portion s o f thi s growt h stage , proso gyrous beaks, a n opisthodetic ligament confined t o a narrow ligamen t groov e alon g th e postero-dorsa l margin (Fig. 4b) and moderately inflate d valves . The greates t chang e i n for m occur s a t th e juvenile-adult transition , whe n th e shel l change s from a venerifor m shap e t o a conocardioi d shape . At this transition, the ventral margin of the juvenile shell become s sharpl y bent , formin g a n acut e angulation (Fig . 3f) , wit h ne w shel l growt h producing a shell surface perpendicular to the plane of commissure. Shell growth on this margin causes the valves to become highl y inflated. Concurrently , the hing e axi s shift s 90 ° posteriorly , changin g th e posterior margi n o f the juvenile shell t o the dorsa l margin o f th e adul t shell . Ornamentatio n change s from entirel y commargina l ribbin g o n the juvenile shell to dominantly radial ribbin g on the adult shel l (Figs 3 b an d 4a) . Th e acut e posterio r angulatio n develops into a sharp carina, separating the inflated, ribbed anterio r an d media l portion s o f th e shel l from th e fla t posterio r sica l surface . Wit h subsequent growth , a minor carin a appear s o n th e anterior portio n o f the shell , separatin g a n anterio r area o f shel l wit h dominan t commargina l ribbin g from th e medial are a with dominant radial ribbing. A profoun d chang e i n th e hing e occur s a t th e juvenile-adult transition , wit h developmen t o f a monovincular(?) ligament [ a ligament typ e defined by Johnsto n & Collo m (1998)] . Th e opisthodeti c ligament of the juvenile (Fig. 4b) abruptly expands out o f the ligamen t groov e o f the juvenile shel l t o form a broad planar ligament o f trapezoidal outlin e (Fig. 4a) . Additionally , thre e t o four stou t peg-lik e teeth gro w beneat h th e ligamen t are a (Fig . 3e-g) , although thi s portio n o f th e shel l lack s a well developed hing e plate to hold th e teeth. Among modern bivalves, when major changes in shell shap e occu r durin g ontogeny , i t correlate s with metamorphosis and change from larval growth

stage at the time of benthic settlement, as shown by Ito (1999 ) fo r a moder n pholadid . However , th e juvenile growt h stag e of Buckhornia reache s a siz e much large r tha n modern bivalv e larva l shell s an d secretes a n elongat e postero-dorsa l ligamen t tha t extends posteriorl y wit h growt h instea d o f a resilifer (expecte d o n a larval shell). Thes e features cannot readil y b e associate d wit h larva l life . Interpreting th e venerifor m growt h stag e a s a juvenile instea d o f a prodissoconc h i s a chang e from determination s presente d i n earlie r studie s of lunulacardiids (Clark e 1904 ; Kfi z & Serpagli 1993 ) and othe r praecardioi d familie s wit h venerifor m early growt h stages . However , th e presenc e o f a postero-dorsal ligamen t instea d o f a resilife r justifies thi s change in interpretation. Remarks. Th e differen t field s o f ribbin g o n anterior, medial and posterior portions of the valve, and the large veneriform juvenile shell, are the most distinctive features o f Buckhornia. Th e venerifor m juvenile shel l attain s a size o f 1. 2 mm. At the tim e the shel l lose s it s venerifor m shape , th e ornamen tation change s fro m entirel y commargina l ribbin g to dominantly radial ribbing . The largest specime n measures 1.5c m acros s th e media l an d posterio r width o f the shell , an d would b e c . 2 cm in heigh t and nearly 2 cm wide if complete. Buckhornia i s closel y relate d t o Lat e Devonia n specimens referred to as Lunulacardium clymeniae Clarke. Clark e (1904 , fig s 2-6 ) illustrate s individuals wit h a larg e venerifor m juvenil e shel l that rotates 90° during transition to the adult growth stage, possessin g th e sam e truncate d adul t shel l with a larg e gap e an d sica l surface , an d havin g a large interare a o n th e hinge , differin g onl y i n th e apparent lac k o f teet h o n th e hinge . However , th e loss o f hing e teet h b y post-morte m breakag e i s common i n Buckhornia, whic h suggests th e sam e fate fo r th e materia l illustrate d b y Clark e (1904) . Further study is needed to determine if L. clymeniae should be placed in Buckhornia or Chaenocardiola. Buckhornia i s unusua l i n havin g a n adul t shel l form simila r t o tha t o f severa l conocardioi d rostroconchs, although the presence o f strong teeth and a large ligamen t revea l i t to be a bivalve. Thi s homeomorphy extend s t o th e outlin e o f th e shell , shell ornament , th e presenc e o f gap e an d th e development of a strong angulation separating a flat

Fig. 5 . Buckhornia carteri gen . nov. , sp. nov., paratypes. (a ) USNM 509760, nacreous inne r shel l layers o n denticulate ventral margin; scale bar, 5 0 um. (b) USNM 509758 , thin prismatic outer shell layer on juvenile shell; scale bar , 1 0 urn. (c) USNM 509762 , transition o f juvenile ligamen t groov e (lower ) t o adult ligamen t interare a (upper); scale bar, 10 0 um. (d ) USNM 509759 , detail o f fibrous ligament o n interarea; scal e bar , 10 0 um. (e ) USN M 509762, ligament fibres o f juvenile shell, attached to fibrous prismati c ligostracum shell layer; scale bar, 1 0 urn. (f ) USNM 509763 , ligament fibre s i n juvenile ligament ; scal e bar , 2 um. Al l specimens gold-palladiu m coated.

BUCKHORN PRAECARDIOI D BIVALVE S

299

300

T. E. YANCE Y & M. J . HEANE Y

inability to dig rapidly through sediment, implyin g a shel l positio n a t o r nea r th e sediment-wate r boundary. Bone m (1982 ) discusse d probabl e conocardioid lifestyles , concludin g tha t fo r rostroconchs lik e Pseudoconocardium th e antero ventral gape opposit e th e rostrum lay embedded i n sediment or lay along the sediment surface, and the rostral gap e opene d int o overlyin g waters . A praecardioid bivalv e oriented in this manner would the hav e th e fla t posterio r sica l surfac e aligne d along, o r close to, the sediment surface .

Fig. 6 . Reconstruction o f adult shell, showin g the change in shape of growth lines on the medial portion of shell, from obliqu e and nearly linear to well-rounded on later growth stages. The actual density of growth lines and ribbing is greater than shown on the diagram, whic h is stylized for clarity. The posterior carin a on the largest portion of shell becomes strongl y produced. The sical surface is not visible from thi s shell orientation. Shell s attain dimensions o f c. 2 cm.

SEM images wer e produced a t the Electro n Microscop y Center o f Texa s A& M Universit y an d scannin g ligh t photography wa s produce d b y Larr y Wadswort h o f th e Health Sciences Department. Samples from the Buckhorn Asphalt Quarry were collected b y E. L. Grossman, Texas A&M University , an d Re x Crick , Universit y o f Texas , Arlington. Discussion s wit h Michae l Amler , Pau l Johnston an d Thomas Walle r hav e helped develo p som e ideas and interpretations presented in this study. This is a publication o f Paleoecology Researc h Progra m o f Texas A&M University.

References surface from the more rounded portions of the shell. The degree o f homeomorphy i s great enoug h that , without hing e characters , Buckhornia woul d b e misidentified a s a conocardioid; durin g the present authors' earl y studie s i t wa s confuse d wit h th e conocardioids. Yates (1962) placed (wit h question) the closel y relate d Chaenocardiola i n th e famil y Conocardiidae. Age an d distribution. Desmoinesia n Stage , Lat e Carboniferous, Oklahoma .

Homeomorphy with conocardioids The adul t morpholog y o f Buckhornia resemble s some species o f conocardioid rostroconch s an d the two group s ar e difficul t t o distinguis h i n th e absence o f knowledg e o f hing e characters . Th e truncated posterio r margi n i s ver y simila r t o th e rostrum o f conocardioi d rostroconchs . Althoug h the conocardioi d rostru m may hav e othe r feature s (e.g. carinae extended into a hood, small snout), the rostrum ha s th e distinctiv e character s o f a fla t surface o n th e conjoine d valve s aligne d perpen dicular t o th e plan e o f commissure , bounde d b y sharp carinae an d enclosing a distinct gape. Whil e there ar e othe r difference s tha t ca n b e use d t o distinguish Buckhornia fro m conocardioid s (especially th e large juvenile shel l o n Buckhornia), the homeomorphy o f adult shells i s remarkable . This strong homeomorphy suggest s that the two groups live d ver y simila r lifestyle s at comparabl e growth sizes . Th e inflate d shell s indicat e a n

AMLER, M . R . W. 1998 . Earl y Carboniferou s bivalve s o f the centra l European Cul m Facies. In : JOHNSTON , P. A. & HAGGART , J . W . (eds ) Bivalves: A n Eo n o f Evolution. Universit y o f Calgar y Press , Calgary , 51-67. BONEM, R . 1982 . Morpholog y an d paleoecolog y o f th e Devonian rostroconc h genu s Bigalea. Journal o f Paleontology, 56, 1362-1374. BRAND, E . 1987 . Biogeochemistr y o f nautiloid s an d paleoenvironmental aspect s o f Buckhor n seawate r (Pennsylvanian), Souther n Oklahoma . Palaeoecology, Palaeoclimatology, Palaeogeography, 62 , 255-264. BUDD, D . A . & PERKINS , R . D . 1980 . Bathymetri c zonation an d paleoecologica l significanc e o f microborings i n Puert o Rica n shel f an d slop e sediments. Journal o f Sedimentary Petrology, 50 , 881-904. CLARKE, J . M. 1904 . Naple s fauna i n western New York , Part 2 . Ne w York State Museum Memoirs, 6 , 199 454. CRICK, R . E. & OTTENSMAN, V . M. 1983 . Sr , Mg, Ca , an d Mn, chemistr y o f skeleta l component s o f a Pennsylvanian an d Recen t nautiloid . Chemical Geology, 39, 147-163. FISCHER, P . H . 1887 . Manue l d e conchyliologi e e t d e paleontologie conchyliologique . Histoire naturelle des mollusques vivants et fossiles, F . Savy (Paris) , 10, 897-1008. HEANEY, M . J . & YANCEY , T . E . 1991 . Exceptiona l preservation o f bivalved mollusc s i n th e Buckhorn Asphalt deposi t (Pennsylvanian ) o f Oklahoma . Geological Society of America Abstracts with Programs, 23(5), 166-167. & 1993 . Preserve d organi c matri x fro m Pennsylvanian age d Buckhor n asphal t Mollusca .

BUCKHORN PRAECARDIOI D BIVALVE S Geological Society of America Abstracts with Programs, 25(6), 55. HEWITT, R . A. , DOKAINISH , M . A. , E L AGHOURY , M . & WESTERMANN, G . E. G. 1989 . Bathymetric limits of a Carboniferou s orthoconi c nautiloi d deduce d b y finite elemen t analysis . Palaios, 4, 157-167. HOLZAPFEL, E . 1889 . Di e cephalopode n fiihrende n Kalkedes untere n Carbo n vo n Erdbach-Breitscheid bei Herborn . Palaontologische Abhandlungen, N . E, 1 . ITO, Y. 1999. Ontogenetic change s i n boring behavio r b y the rock-borin g bivalve , Barnea manilensis (Pholadidae). Veliger, 42, 157-168. JOHNSTON, P . A . & COLLOM , C . J . 1998 . The bivalv e heresies - Inoceramida e ar e Cryptodonta , no t Pteriomorphia. In : JOHNSTON , P . A. & HAGGART , J . W. (eds) Bivalves: An Eo n o f Evolution. University of Calgary Press, Calgary, 347-360. Kftz, J . 1979 . Silurian Cardiolida e (Bivalvia) . Sbornik Geologickych Ved [Journal of Geological Sciences], Paleontologie, 22. 1984. Autecology and ecology o f Silurian Bivalvia . Special Papers i n Palaeontology, 32, 183-195 . 1985. Siluria n Slavida e (Bivalvia) . Sbornik Geologickych Ved [Journal of Geological Sciences], Paleontologie, 27, 47-111. & SERPAGLI, E . 1993. Upper Silurian an d lowermos t Devonian Bivalvi a o f Bohemia n typ e fro m south western Sardinia . Bollettino della Societa Paleontologica Italiana, 32, 289-348.

301

LUTZ, R . A . 1985 . Identification o f bivalv e larva e an d postlarvae: a review o f recen t advances . American Malacological Bulletin Special Editions, 1, 59-78. MUNSTER, G . GRA F A U 1840. Die Versteinerunge n de s Ubergangskalkes mit Clymenien und Orthoceratiten von Oberfranken. Beitrdge zu r Petrefaktenkunde, 3 , 33-121. NEWELL, N . D . 1965 . Classificatio n o f th e Bivalvia . American Museum Novitates, 2206. & BOYD , D . W . 1987 . Iteratio n o f ligamen t structures i n pteriomorphia n bivalves . American Museum Novitates, 2875. RATHMANN, S . D. & AMLER, M. R. W. 1992. Bivalven au s dem Unter-Karbo n vo n Aprat h (Wuppertal , Bergisches Land). Geologica et Palaontologica, 26, 35-71. SNEDDEN, J . W . & NUMMEDAL , D . 1991 . Origin an d geometry o f storm-generate d san d beds i n moder n sediments o f th e Texa s continenta l shelf . International Association of Sedimentologists Special Publications, 14, 283-308. SQUIRES, R . L . 1973 . Burial environment, diagenesis, mineralogy, and Mg & Sr contents of skeletal carbonates in the Buckhorn Asphalt of Middle Pennsylvanian age, Arbuckle Mountains, Oklahoma. Ph D Thesis , Californi a Institut e o f Technology, Pasadena , California . YATES, P . J . 1962 . Th e palaeontolog y o f th e Namuria n rocks o f Sliev e Anieri n Co . Leitrim , Erie . Palaeontology, 5, 355^43.

This page intentionally left blank

Evolutionary significance of fossil larval shell characters: a case study from the Ostreoidea (Bivalvia : Pteriomorphia ) NIKOLAUS MALCHUS Institutfur Paldontologie, Freie Universitdt Berlin, Malteserstr. 74-100, Haus D, 12249 Berlin, Germany (e-mail: [email protected]) Abstract: Prodissoconch s o f Middl e Jurassi c oyster s posses s ke y character s fo r a ne w understanding of the hinge evolution within the Ostreoidea. The ancestral larval hinge most likely evolved fro m a mytilid-lik e provinculu m throug h accelerate d growt h i n a n antero-ventra l direction along a flat, helico-spiral trajectory. The posterior denticles moved into the centre of the hinge axi s whil e th e centra l an d anterio r denticle s wer e reduce d i n siz e an d eventuall y disappeared. Th e remaining , no w central , posterio r denticle s evolve d furthe r int o a secondar y symmetrical hinge . In most oysters, excep t fo r example Tiostrea, the larval ligament maintaine d its relative positio n betwee n posterio r an d anterior denticles , even though thi s i s not obvious i n the Ostreida e becaus e o f th e los s o f th e anterio r denticles . Larva l an d adul t ligament s ar e continuous. Th e examine d specimen s provid e furthe r evidenc e fo r th e plesiomorphi c stat e o f planktotrophy withi n th e superfamily . Althoug h additiona l direc t evidenc e i s lacking , consideration o f al l ne w availabl e dat a favou r th e hypothesi s tha t th e postero-dorsa l notc h i s uniquely derive d b y oysters . Th e idea s o n characte r evolutio n pu t forwar d i n thi s stud y ar e consistent wit h phylogen y hypothese s base d o n palaeontological-biologica l dat a an d recen t genetical studies.

Larval shell s an d nepioconch s o f fossi l bivalve s provide a n excellen t sourc e o f informatio n fo r phylogenetic inferences and decisions on characte r polarity (Malchu s 1998 , 1999 , 200(k , b) . Never theless, earl y shel l stage s ar e onl y know n fro m a very limite d numbe r o f fossi l taxa , amon g whic h oysters hav e attracte d mos t attention . Malchu s (1995) foun d evidenc e fo r th e presenc e o f th e postero-dorsal notc h (pd-notch ) (Walle r 1981 ) o f the prodissoconc h I I ( P II ) i n fossi l oyster s an d suggested tha t thi s characte r ma y b e uniquel y derived i n th e Ostreoidea . Furthermore , smal l prodissoconch I (P I) size s an d low P I:P I I ratios were taken a s indirect evidenc e that planktotrophy is th e ancestra l reproductiv e strateg y withi n th e superfamily. However , thi s conclusio n contradicts biological interpretation s o f Andrew s (1979 ) an d Chanley & Dinamani (1980) . Base d o n a detaile d comparison o f th e larva l hinge s (provinculum) , Malchus (1995 ) suggeste d tha t the pycnodonteini d (Gryphaeidae) typ e represent s th e ancestra l stat e from whic h th e othe r ostreoi d type s evolved . Bu t the palaeontologica l evidenc e wa s insufficient , because provincul a o f ancien t Gryphaeida e wer e unknown a t that time. Th e discover y o f larval an d early post-metamorphi c oyste r shell s fro m th e Middle Jurassic of Poland no w permits a reassessment o f th e previousl y draw n conclusions . I n

particular, th e materia l allow s a mode l fo r th e evolutionary change s of th e larva l oyste r hing e t o be propose d an d som e o f it s s o fa r enigmati c characteristics to be understood.

Materials and method s Most o f the ne w fossi l materia l referre d t o i n thi s study come s fro m a n ol d cor e throug h Bajocian Callovian sediment s recovere d i n 193 7 nea r th e village o f Klemme n (no w Kleby ) c . 5 0 km northeast o f Szczecin , northwester n Poland . Th e material i s owne d b y th e Bundesanstal t fli r Geowissenschaften und Rohstoffe (BGR ) in Berlin, Germany. Othe r specimen s wer e collecte d b y th e author i n Middl e Jurassi c (probabl y Bathonian ) sediments of a fresh cla y pit near Faustianka, north central Poland . Furthe r specimen s fro m th e Kimmeridgian o f souther n England , an d th e Eocene o f Franc e an d th e US A (Alabama ) wer e available fro m a previou s stud y (Malchu s 1995) . Live specimen s fo r compariso n wer e collecte d from coasta l water s i n th e northwester n Mediterranean an d could b e partl y reare d t o post metamorphic stage s a t th e Marin e Laborator y i n Banyuls s/M , France . Th e Polis h an d Mediterranean materia l i s house d i n th e BG R i n Berlin, German y (labelle d BG R Xxxxxx-x).

From: HARPER, E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications, 177 , 303-312 . 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000.

304

N. MALCHUS

Specimens labelle d IRSNB-T I ar e house d i n th e Institut roya l des Science s naturelles de Belgique, Brussels. The Kleby material was found alread y processed and th e dept h carefull y note d wit h eac h sample . Some of the remaining fragment s of the core wer e recently processe d fo r examinatio n o f gastropo d protoconchs and age determination wit h ostracode s (Grundel 1997 , 1999) . Th e preserve d oyster s comprise numerou s larval shell s [lef t valve s (LV) and right valves (RV)] and predominantly nepionic RV u p t o a siz e of c. 4000 urn. Most of th e shell s are Middle Callovian in age. All specimens were mounted on stubs and coated with gol d fo r examinatio n unde r a scannin g electron microscop e (SEM) . Sampl e processin g and handling under SEM followed Malchus (1995).

Description and determination of early shell stages The descriptio n concentrate s o n distinctiv e shel l features o f th e superfamil y an d feature s wit h a bearing o n characte r evolution . Mor e detaile d descriptions wil l be given elsewhere . Overall shell characters and determination Left prodissoconc h valve s sho w th e prominen t growth track o f the pd-notch an d th e inflectio n of the notch itself i n the shell margi n of the P II (e.g. Figs la , c , d an d f an d 2a). Right prodissoconch s are less easily identified because the notc h is only weakly expressed. However, the prodissoconchs of many oyster s (especiall y Ostreidae ) ar e mor e asymmetrical than those of most bivalves, and they generally possess a distinctly wavy (non-euclidean) rather than flat commissural plane (e.g. Figs. Id and 2g). Post-metamorphic shell s ar e characterized b y an irregula r morpholog y wit h rugos e growt h increments an d a n almos t entirel y calciti c foli -

aceous microstructure . Al l othe r co-occurrin g shells wit h simila r prodissoconch s lac k th e pd notch an d ar e nacro-prismati c a s adults . Many of the studied nepioconchs (all RV) still carry a wellpreserved larval shell as shown in Fig. Ib. The pronouncedl y opisthogyrat e umb o o f th e oyster prodissoconchs an d comparisons wit h Upper Jurassic Liostrea plastica fro m Englan d (Palme r 1989) sugges t tha t th e specimen s fro m Kleb y belong t o the Exogyrinae and/o r Liostreina e (Fig s Ib, d, e and g). The smaller, not fully grown , larval shells fro m th e Faustiank a cla y pi t hav e thicke r shells and relatively weaker opisthogyrate umbones (Figs I c an d 2a). These specimen s ar e tentatively assigned t o the Gryphaeinae. Th e P II stages o f all specimens posses s a rathe r strongl y develope d sculpture o f concentri c growt h welt s (Fig . la-c) . The variabl e shap e o f th e valves , a s wel l a s different P I sizes, strongly suggest the presence of different species . Nevertheless , mor e specifi c determinations ar e currentl y problemati c becaus e of the lack of post-nepionic shells with unequivocal characters. Shell dimensions All specimen s posses s P I size s o f 65-8 6 um (length) and 49-70 um (height) , an d the P II size s of fully grow n shells range from 30 0 to 400 um for both lengt h an d height . Th e P I:P II ratio s ar e therefore alway s < 0.35. The significanc e of these values will be discussed below. The provinculum The presenc e o f larva l shell s withou t post metamorphic overgrowt h permits a n unobstructed view ont o th e provincula r dentition an d ligament . All examine d specimen s shar e th e sam e genera l arrangement. Thi s consist s o f a posterio r an d anterior win g o f denticle s separate d b y th e larval , fibrous ligament , whic h grow s anteriorwards ,

Fig. 1 . Early shell stage s of Middle Jurassic Ostreoidea fro m Poland . Al l scale bars in um. (a ) Dorsal vie w of a LV prodissoconch o f an exogyrinid(?) oyster . The P II shows the postero-dorsal notc h and growth track (arrow ) characteristic of LV. Kleby, BGR XI0849-5. (b) Dorsal vie w of a RV nepioconch (wit h predatory drillhole ) and wellpreserved prodissoconch of an exogyrinid(?) oyster. Kleby, BGR X10849-3. (c) Dorsal view of a LV prodissoconch, probably not fully grow n because of the small size (138 x 13 4 urn), of a gryphaeinid(?) oyster. Arrow indicates position of the pd-notch. Faustianka, BGR XI0845-8. (d) Internal view of a LV-P II of an exogyrinid(?) oyster. Arrow indicates positio n o f the pd-notch. Kleby , BGR XI0849-5. (e) Close-up of hinge of (d) showing the posterior denticles in a pseudo-central position below the P I, somewhat reduced central and anterior denticles, an d the ligament groove in between, (f) Internal view of a LV-P I I of an exogyrinid(?) oyster. Arrow indicates position of the pd-notch. Kleby, BGR X10846-12. (g ) Close up of hinge of (f). (h) Close up of P I and part of the P II hinge of (f). The posterior denticle s (the middle one s of which are largest) ar e visible. The arrow points to the position o f three, rather weakl y developed, originall y centra l denticles abov e the ligament groove .

CHARACTER EVOLUTION IN LARVA L OYSTERS

subparallel t o th e interio r shel l margin , an d som e small, centra l denticle s abov e i t (Fig s le , g , h , 2 b and 3b) . The posterio r win g rests below th e larva l umbo and the P I, which itself is delimited ventrally by its straight hinge line (Fig. Ih). There are about

305

five to eight larger denticles below the umbo. These may b e subequa l i n siz e o r firs t increas e an d the n decrease, agai n toward s th e anterio r end . Th e central denticle s abov e th e ligamen t an d thos e o f the anterio r win g sho w a gradua l increas e i n siz e

306

N. MALCHU S

anteriorwards bu t withou t attainin g th e dimensio n of th e smalles t posterio r denticl e (e.g . Fig . le) . There ar e about three to eight central an d up to 1 2 anterior denticle s i n almos t full y grow n P II . Th e anterior row reaches far beyond the anterior front of the ligament.

Discussion Taxonomic problems Early post-metamorphi c ( = nepionic) shell s o f bivalves ofte n diffe r i n thei r shape , sculptur e an d internal feature s fro m th e adul t shel l o n whic h

CHARACTER EVOLUTION IN LARVA L OYSTERS

almost al l diagnose s ar e based . I n addition , knowledge o f larva l an d nepioni c shell character s of fossils is restricted to very few taxa (e.g. Palmer 1989; Malchus 1995 , 1999, 2000Z?; Yance y & Heaney, pers . comm.) . Thus , eve n th e subfamil y assignment o f th e Middl e Jurassi c specimen s remains rather vague. However, this fact is of minor importance in the present context. Origin and taxonomic distribution of the postero-dorsal notch In a comprehensiv e stud y on th e developmen t o n veliger larva e o f Ostrea edulis L. , Walle r (1981 ) demonstrated that the pd-notch marks the extrusion site of a ciliated organ (of unknown function) of the P II veliger stage. So far, the notch and its growth track have only been found i n the P II shells o f all living oysters, except in Tiostrea spp . (e.g. Chanley & Dinaman i 1980 ; Malchu s 199 5 and ref s cite d therein) and a number of fossil species belonging to the Liostreinae , Crassostreinae-Ostreina e (Ostreidae) an d Pycnodonteina e (Gryphaeidae ) (Malchus 1995) . Veliger s of othe r livin g bivalves apparently lac k this shel l characte r (Waller 1981) . The same is true of recently studied prodissoconchs of Jurassi c Atreta, Juranomia, Oxytoma, Camptonectes, Grammatodon, Nicaniella, Pressastarte, a trigoniid, numerous nacro-prismatic pterioids (Palme r 1989 , Malchus 1999 , 2000/? ) and some Carboniferou s specie s (Yance y & Heaney , pers. comm.). The taxonomi c distributio n strongl y suggest s that th e notc h i s symplesiomorphi c fo r th e Gryphaeidae and Ostreidae. It s absence in Tiostrea is related t o the unusually extended broodin g tim e (Malchus 1995 ; Josefowicz & O'Foighi l 1998 )

307

which effectivel y suppresse s th e developmen t of the P I I shel l stage ; i t i s thu s a derive d characte r state. It remains to be show n whether the notch is also presen t i n th e larva l shell s o f th e extinc t Palaeolophidae which , accordin g t o Malchu s (1990), ar e no t ancestra l t o th e moder n Lophina e (Ostreidae). Thi s latter view is supported b y recent genetic studie s o f O'Foighi l & Taylor (2000 ) an d Hammer & Steine r (pers . comm.) , whic h independently sugges t tha t th e Lophina e an d Ostreinae ar e derive d fro m th e Crassostreinae . I n this study, the presence of a pd-notch and its growth track wa s used , togethe r wit h indirec t evidenc e from othe r character s an d a compariso n wit h th e accompanying fauna , t o identif y isolate d larva l shells as oysters. Polarity of reproductive strategies All livin g oyster s wit h a completel y planktic planktotrophic larva l lif e cycle , i.e . th e Crassostreinae, posses s P I length s o f 45-7 5 um and smal l P I:P II ratios of between 0.25 an d 0.35. A rati o <0. 4 i s considere d indicativ e o f nonbrooding bivalve s (Berkma n e t al 1991) . Mos t ostreoids wit h parenta l care , i.e . Ostreina e an d Lophinae, hav e P I lengths > 12 0 um and P I:P II ratios > 0.4. On e exceptio n i s Cryptostrea permollis, with an average PI length of 117 um and a P I:P II ratio of just 0.4 (Buroker 1985 , tabl e 3). According to Berkman et al (1991) , a ratio o f 0.6 is a lowe r 'benchmark ' i n broodin g bivalves . However, th e correlation betwee n lengt h ratio and brooding i n livin g Ostreida e suggest s a threshol d value of c. 0.4 within this family. The reproductiv e mode o f livin g Gryphaeida e (Pycnodonteinae ) appears to be unknown (Harry 1985, table 3) ; their

Fig. 2 . Early shel l stages of fossil oyster s from Poland and Alabama and recent non-oysters fro m the Mediterranean. All scale bar s in um. (a ) Internal view o f LV prodissoconch of a gryphaeinid(?) oyster. Arro w indicate s position of pd-notch. Faustianka (Poland), BGR X10845-4. (b) Close-up of hinge of (a), LV. Posterior denticles of subequal size in a pseudo-central position below P I. The anterior denticles are reduced in size. The triangular groove between the two denticle rows is the site of the ligament (arrow), (c) Hinge of an early post-metamorphic, recent limid (Limatulctf sp.). Th e ligament emerges from th e centre of the provinculum which still shows three denticles on each side just below the straight hinge. Mediterranean, BGR X10848-3. (d) Hinge of a LV P II of a recent mytilid (Mytilus sp.) . The ligament (arrow) emerges posteriorly between a row of posterior denticles (left), an d a row of central (below P I) and anterior denticles. Mediterranean, BGR X10847-5. (e) Interior view o f a LV P II of Pycnodonte sp . 2 (Malchus 1995) . Pseudo-central denticles are more or less equal in size an d equidistant. Th e white arro w indicate s th e position o f the ligament, the black arrow point s a t the vestiges of few anterior denticles (ad). Middle Eocene, Alabama. [Originall y figured i n Malchus (1995 , pi. 7, fig. F)]. Specimen IRSNB-TI 6170. (f) Close-u p of dorso-anterior shell margin o f a LV P II of Pycnodonte sp . 2 [not identical to (e)]. Shell segment betwee n arrow s show s abou t te n very weakl y developed vestiges o f anterior denticles . Middle Eocene, Alabama, specime n IRSNB-TI 6171 [same specimen as in Malchus (1995 , pi. 7, fig. G, H) but different detail] , (g) Internal view o f a LV P II of Cubitostrea sellaeformis, Middle Eocene, Alabama. [Originall y figured i n Malchus (1995, pi. 4, fig. F)]. Specimen IRSNB-TI 6153. (h) Closeup of hinge of (g). Denticles are numbered afte r Malchus (1995), except for (1), which here symbolizes the socke t for denticle 1 of the corresponding RV. The ligament (arrow) emerge s in the lower right (anterior) corner of the pseudocentral, posterio r row of denticles. [Originally figured i n Malchus (1995, pi. 4, fig. D)].

308

N. MALCHUS

of al l bu t on e Middl e Jurassi c specie s described here (Fig . la, c an d h); th e exceptiona l specime n shown in Fig. 2a has a 'pycnodonteinid' P I length of 8 6 um, which is consistent with the P I lengths of the Eocene and living Pycnodonteinae. Thus, the new dat a suppor t th e previou s interpretatio n o f planktotrophy a s bein g th e ancestra l reproductiv e strategy in oysters. The genetic studies of O'Foighi l & Taylo r (2000 ) an d Hamme r & Steine r (pers . comm.) provid e additiona l evidence , a s bot h suggest tha t th e brooding Ostreina e an d Lophina e are derived fro m the non-brooding Crassostreinae .

Evolution of oyster provincula Many pteriomorphian provincula pertain t o one of two morphotypes. One is rather short in length and more or less symmetrical, with two or three equally sized taxodont denticles on each side of a centrally Fig. 3 . Hypothesis of hinge evolution of ancient larval emerging, larva l fibrou s ligamen t (Fig . 2c). The oysters fro m a mytilid-like hinge. Schemati c drawing s of other typ e i s longer , wit h thre e t o eigh t taxodon t two LV (not to scale); denticl e socket s i n black, ant, denticles o n eac h sid e an d ofte n a centra l ro w o f Anterior; HA, hinge axis; Lig, ligament; post, posterior, much smalle r denticle s whic h connect s th e tw o (a) Shell growth is more or less equal in anterior and wings. Th e larva l ligamen t emerge s eithe r i n a posterior direction s (bidirectional, double-headed arrow) central o r a posterior positio n fro m beneat h o r on and has a minimal (otherwise the shell would be flat ) the provincula r ledge . I n a posterior position , th e ortho-spiral growt h component. In consequence, al l denticles ar e near the (pivotal) hing e axis and their ligament separate s th e denticles asymmetricall y i n arrangement is almost symmetrical. Only the ligament is a posterior unit and a central row plus anterior unit. in a posterior position (arrow), (b) A change towards an A mytilid larval hinge may serve as a model for this anteriorly accelerated growt h (unidirectional arrow) with type (Figs 2d and 3a). Mytilids later develop som e a (rather compressed) helico-spira l componen t leads to hinge characters unique to this taxon (e.g. Bernard opisthogyry. The posterior denticle s com e to lie in a 1896; Le Pennec 1978) , but this is irrelevant in the central position wit h respect t o the hinge axis , whil e the present context. ligament grows anteriorly and becomes squeezed The provinculu m typ e o f th e Middl e Jurassi c between the posterior an d central denticles. Both central specimens ca n b e interprete d a s a mytilid-lik e and anterior denticles ar e at an angle with the hinge axis and become reduced . arrangement modified due to accelerated growth of the antero-ventra l part s o f th e sof t bod y alon g a shallow helico-spira l trajector y (Fig . 3b). Hence , the larval shel l i s opisthogyrate. Naturally , growt h P I length s ar e slightl y large r tha n thos e o f th e of th e provinculum follow s th e sam e trajector y s o Crassostreinae, bu t stil l rathe r smal l (70-10 0 |um) that the posterior denticle wing glides into a central (e.g. Ranson 1960, 1961 a, b\ Waller 1981), and the position wit h respec t t o bot h th e shel l an d th e P I: P I I rati o i s < 0.4. Presumably, the y ar e als o pivotal axis, and the ligament expands exclusively non-brooders. Anatomical difference s t o broodin g anteriorly and subparallel to the dorso-anterior shell ostreids ar e not decisiv e i n thi s respect unles s the margin (Fig s l e and g, 2b and 3). Thus, with view presence o f a supramya l passag e i s functionall y into th e LV , the entir e arrangement , includin g th e related t o the reproductive mod e (see Harry 1985, hinge axis, appears to have rotated clockwis e wit h table 3) . However, ther e i s no evidence fo r suc h a respect t o th e mytilid-lik e condition . A s a furthe r relation. consequence, th e small , centra l denticle s o f th e The larva l shel l length s an d ratio s o f fossi l model provinculu m o f Fig . 3 a becom e wedge d ostreid an d gryphaei d specie s examine d b y between the posterior win g plus ligament gutter and Malchus (1995) compare well with those of Recent the straight hinge of the PI (Fig.lh). Beyond these , crassostreinid and pycnodonteinid species (Fig. 2e). the anterio r denticle s emerg e withou t abrup t Malchus (1995 ) therefor e conclude d tha t parental changes i n siz e (Fig . 3b) . I n bot h wings , ne w care shoul d be th e phylogenetically derive d mod e denticles ar e adde d onl y anteriorly . Th e anterio r of reproductio n withi n th e superfamily . denticles apparently become progressively large r in 'Crassostreinid' dimension s ar e als o characteristi c this direction . I n contrast , thos e o f th e posterio r

CHARACTER EVOLUTION IN LARVA L OYSTERS

309

Fig. 4 . Hypothesis of hinge evolution within the Ostreoidea. Al l schematic drawings represent LV; scale bars, 50 (am. L, Ligament, (a) Mytilid-like hinge, (b) Opisthogyrate shel l with ancestral ostreoid hinge (e.g . exogyrinids). The step from (a ) to (b) is explained i n Fig. 3 . (c) Pycnodonteinid hing e [redraw n fro m Ranso n (1960, fig. 9)]. The centra l denticles are completely reduced but anterior denticles ar e still present as vestiges. The ligament sits between the two denticle rows, (d) Cubitostrea hinge: central and anterior denticles are completely reduced, an d the posterior denticle s become secondaril y symmetrica l wit h a small centra l socke t in the LV (arrow). The ligament maintain s it s origina l position, although this is not obvious because of the loss of the anterior denticle s as a reference (cf. Fig. 2h) . (e) Crassostreinid hinge: similar to (d) but the central socket of the LV, and thus ridge in the RV, become much longer, probably due to fusion o f the most central denticles, (f) Ostreinid hinge: similar t o (d) and (e) but instead of a central socket/ridge, a central platform evolves i n both valves that is longer tha n the central ridge of (e). Again, thi s enlargement is probably due to fusion o f more central denticles, (g) Tiostrea hinge: this type has a longer platform than (f) and only weakly developed denticles at its distant ends [redrawn from Ranso n (1960, fig . 133)]. The ligament apparently shifte d away from it s ancestral position .

wing firs t increas e an d the n decreas e i n siz e (e.g . Fig. I g an d h ) becaus e th e dorsa l an d ventra l boundary o f th e posterio r provincula r ledg e converge i n fron t o f th e ligamen t gutter . Th e relatively large r siz e o f th e posterio r denticle s compared wit h the anterio r one s i s related to thei r central positio n wit h respec t t o th e pivota l axi s which emphasizes their functional importance . The provinculu m typ e jus t describe d i s interpreted here as ancestral for the Ostreoidea, o r it is a t leas t ver y simila r t o th e ancestra l conditio n (Fig. 4 a an d b) . Usin g thi s a s a startin g point , further evolutio n withi n th e Ostreoide a followe d two independen t paths . On e lead s t o th e pycno donteinid, th e othe r t o th e ostrei d hing e type . Characteristically, Pycnodonteina e (Gryphaeidae ) possess a posterio r win g o f mor e o r les s equall y

sized an d equidistan t denticle s 4- 7 u m i n width . Alternatively, th e mos t centra l denticle s o f th e posterior win g ma y b e slightl y larger , suc h a s i n Fig. 4b . I n bot h cases , th e originall y centra l denticles an d th e mos t posterio r denticle s o f th e anterior win g are lost entirely, whil e vestiges o f the anterior wing are still present [Fig . 4c ; see Ranson (1960, 1961 a, b,) for numerous living species]. Reexamination o f tw o Eocen e specimen s figure d i n Malchus (1995 , pi . 7 , fig s F an d G ) confirm s th e presence o f anterio r vestige s i n thes e fossi l representatives too (Fig. 2 e and f). The secon d ostrei d pat h i s characterize d b y th e entire los s o f al l centra l an d anterio r denticles . Further evolutionary change s o f the posterior hinge led to a secondary symmetrica l reorganizatio n o f its denticles. Thi s pseudo-symmetry wa s the basis for

310

N. MALCHU S

a descriptive hing e formul a developed b y Malchu s (1995) fo r th e Ostreidae . Th e oldes t ostrei d typ e currently know n i s tha t o f th e (predominantly ) Eocene genu s Cubitostrea (Fig s 2 h an d 4d). Here, LV possess a central socke t of similar dimension to its flanking denticles [th e latter wer e coded 2a, p in Malchus (1995)]. This is filled b y the central ridge [denticle 1 o f Malchu s (1995) ] o f th e R V provinculum. Th e thre e centra l denticle s ar e c . 6-13 u m i n length . Th e hing e o f livin g Crassostreinae show s principall y th e sam e arrangement, but the siz e of the central socke t and ridge i n th e L V an d R V rang e betwee n 1 3 an d 23 urn, respectivel y (Fig . 4e ; H u e l al 1993) . Denticles 2a,p are sometimes ill-defined. The centra l ridge/socke t arrangemen t o f Cubitostrea and the Crassostreinae is substituted by a lon g ridg e o r platfor m i n bot h valve s o f man y living Ostreina e an d Lophina e (Ranso n 1960 , 1967fl, b\ Carrike r & Palme r 1979 ; Waller 1981; Hu e t al. 1993) . Thes e platform s mee t (approximately) withi n the commissural plan e an d normally measure 30-70 um in length (Fig. 4f), but they exten d > 120 um i n Tiostrea (Fig . 4g). I n Ostrea, th e platform s hav e rugge d surface s (e.g. Pascual 1972 ; Walle r 1981 ) whic h giv e th e impression o f ill-forme d denticles . I n addition , adjacent denticle s [code d 2 a an d 2 p i n Malchu s (1995)] are also sometimes incompletel y separate d from them . Thus , Malchu s (1995 ) suggeste d tha t the platform s for m b y fusio n o f severa l centra l denticles. Thi s probably applies to denticle 1 (RV ) of th e Crassostreina e a s well , wit h respec t t o denticle 1 of Cubitostrea. In consequence, denticle s 1, 2a and 2p , an d thos e following , in thes e gener a may no t b e strictl y homologous . I n Tiostrea, th e central platfor m i s apparentl y smoot h an d no t rugged, and there are at most one or two very smal l denticles a t eac h dista l en d (Fig . 4g), whic h i s another consequence of extended brooding as is the lack of a pd-notch (Josefowicz & O'Foighil 1998) . Most o f these change s di d no t affec t th e ancestra l position o f the ligamen t anterio r t o th e (posterior ) hinge denticles. Only in Tiostrea and in a few other ostreid specie s describe d b y Ranson (1960, 19670 , b) i s thi s arrangemen t apparentl y lost , wit h th e ligament emerging from beneath the anterior part of the platform (Fig. 4g). The gros s schem e o f characte r evolutio n a s outlined abov e i s consisten t wit h al l currentl y available palaeontological-biological data , a s well as with the most recent genetic studies of O'Foighi l & Taylo r (2000 ) an d Hamme r & Steine r (pers . comm.). The y al l indicat e monophyl y o f th e Gryphaeidae (Fig . 4c ) an d th e Ostreida e (Fig . 4e-g), an d a commo n ancesto r fo r bot h familie s (Fig. 4b). However, Fig. 4 presents only one of two possible evolutionar y path s withi n th e Ostreidae .

The figure d versio n suggest s th e independen t evolution o f the crassostreinid and ostreinid hinge s from th e Cubitostrea-type hing e (Fig . 4d) . Alternatively, hinge types 4g and 4f of Tiostrea and the Ostreinae-Lophinae , respectively , ma y hav e evolved fro m th e Crassostrea type (Fig . 4e). This ambivalence occur s i n al l dat a sets . Palaeonto logical evidenc e onl y indicate s tha t th e Cubitostrea-type hing e (Fig . 4d ) evolve d earlie r and tha t th e (apparentl y extinct ) genu s belong s t o the ste m lin e o f th e Ostreinae-Lophina e an d Crassostreinae; bu t i t doe s no t necessaril y contai n the ste m species . Larva l shel l character s lin k Cubitostrea wit h modern Crassostreina e whil e th e adult shel l i s neithe r typicall y crassostreini d no r ostreinid. For obvious reasons, the sof t anatom y or genetics o f extinc t tax a canno t b e examined . However, accordin g t o Malchus (1995) , there may still exis t som e relic t specie s o f th e Cubitostrea lineage. Bu t thes e wer e no t considere d i n th e respective analyses . The new data o n oyster hing e evolutio n allo w a reassessment o f some earlier interpretations . Thus , the vestigia l anterio r denticle s o f th e Pycnodonteinae and the pseudo-central denticle s of all oyster s wer e no t recognize d a s homologues o f the anterio r an d posterio r wing , respectively , o f other bivalv e larva l hinges . Instead , th e pycnodonteinid anterio r denticle s wer e interprete d as chomata b y Stenze l (1971 , fig s J39. 1 and 2). It was therefor e no t understoo d tha t th e larva l ligament in oysters originally occupied a central or posterior positio n withi n th e hinge . A posterio r position, a s depicte d i n Fig . 4a , woul d bette r explain the presence of small denticles between the PI and the ligament (Fig. Ih). Both conditions must be considere d plesiomorphi c a s both ar e foun d i n larval shell s o f othe r pteriomorphia n bivalves . Irrespective o f these details , th e larva l ligamen t of oysters i s no t a central , pointlike structur e a s indicated b y Tanak a (1960 , fig s 3 an d 5 ) an d Stenzel (1971, fig. J39), a fact that had been alread y pointed ou t b y L e Penne c (1978 ) an d Walle r (1981). But the respective descriptions of these two latter author s see m t o insinuate that oysters lack a larval ligamen t o r that it is not continuous wit h the adult ligament . Bot h assumption s no w appea r incorrect. Th e positio n o f th e primordia l adul t ligament i n lat e prodissoconch s i s identica l t o th e position o f the larval ligamen t betwee n posteriorl y present an d anteriorl y missin g hing e denticle s [cf . Figs l e an d g wit h Fig . 2h ; se e als o L e Penne c (1978) an d Carriker & Palmer (1979)] . Therefore , there i s n o reaso n t o assum e tha t th e tw o ar e discontinuous. Technically , th e larval oyste r hing e was alread y well described b y Bernard (1898 ) a s a 'demivinculum', althoug h h e wa s probabl y unaware of all of the connotations o f this term .

CHARACTER EVOLUTION IN LARVAL OYSTERS

Conclusions Firstly, earlier studie s strongly sugges t that the pdnotch an d it s growt h trac k ar e symplesiomorphi c for th e Gryphaeida e an d th e Ostreida e (Malchu s 1995). Here , thi s combine d characte r i s use d t o identify som e larva l shell s a s L V o f oysters ; therefore, thes e shell s presen t n o furthe r direc t evidence fo r th e hypothesis . However , som e additional observations, i.e. th e wavy commissure , the lac k o f a notc h i n co-occurring , morpho logically ver y simila r prodissoconch s wit h post metamorphic nacro-prismatic shells, an d its lack in all other bivalve s fro m th e sam e sampl e (Malchu s 1998, 200(k , b ) ar e a t leas t compatibl e wit h th e hypothesis. Secondly , th e observe d P I size s an d P I:P II ratio s o f th e Middl e Jurassi c oyster s confirm th e vie w o f planktotroph y a s bein g th e ancestral reproductiv e mod e within the Ostreoidea. Thirdly, th e ancestra l oyste r hing e i s a natura l derivative fro m a mytilid-lik e provinculum . Th e transformation i s though t t o b e mainl y du e t o mechanical constraint s tha t ar e relate d t o th e helico-spiral growt h o f th e larva l shell . Th e sam e constraints shoul d ac t on all bivalves wit h a strong spiral growt h component, b e it the larval, nepioni c or adult shell stage, an d independent o f an anterio r or posterio r growt h direction . Thus , th e resultin g modifications outline d abov e ma y als o hel p t o understand evolutionar y change s o f othe r bivalv e hinges. Fourthly, the hypothesized polarities i n the evolution o f larva l character s ar e consisten t wit h phylogeny hypothese s base d o n palaeontologicalbiological dat a an d result s fro m geneti c studie s of O'Foighil & Taylor (2000) an d Hammer & Steiner (pers. comm.) . Thi s fac t reciprocall y support s th e independently derived conclusions and emphasizes the utility of larval shell characters for phylogenetic inferences an d polarit y decision s i n studie s o f character evolution. I am indepted t o M. Machalski (Inst . Paleobiologii PAN , Warszawa) for his logistic suppor t and company on a field trip to Jurassic outcrops in north-central Poland. The fina l manuscript benefite d fro m th e critica l comment s o f P . Skelton (Ope n University ) an d a n unknow n reviewer . This stud y wa s supporte d by th e Deutsch e Forschungs gemeinschaft (DFG ; research grant MA 1259/3) which is gratefully acknowledged .

References ANDREWS, J . D . 1979 . Pelecypoda: Ostreidae . In : GIESE , A. C. & PEARSE, J. S . (eds) Reproduction of marine invertebrates, V . Academi c Press , Ne w York , 293-341. BERKMAN, P. A., WALLER, T. R. & ALEXANDER, S. P. 1991. Unprotected larva l developmen t i n th e Antarcti c scallop Adamussium colbecki (Mollusca : Bivalvia : Pectinidae). Antarctic Science, 3(2), 151-157 .

311

BERNARD, F . 1896. Troisieme note su r l e developpement et l a morphologi e d e l a coquill e che z le s lamellibranches (Anisomyaires) . Bulletin d e l a Societe geologique de France, 24(3), 412-449. 1898. Recherche s ontogenetique s e t morph ologiques su r l a coquill e de s lamellibranches , 1 partie: taxodonte s e t anisomyaires . Annales de s Sciences naturelles, Zoologie e t Paleontologie, 8 , 1-208. BUROKER, N. E. 1985. Evolutionary pattern s i n the family Ostreidae: Larviparit y vs . oviparity . Journal o f Experimental Marine Biology an d Ecology, 90 , 233-247. CARRIKER, M . R . & PALMER , R . E . 1979 . Ultrastructural morphogenesis o f prodissoconc h an d earl y dissoconch valve s o f th e oyste r Crassostrea virginica. Proceedings of the National Shellfisheries Association, 69, 103-128 . CHANLEY, P . E . & DINAMANI , D . P . 1980 . Comparative descriptions o f som e oyste r larva e fro m Ne w Zealand and Chile, and a description of a new genus of oyster, Tiostrea. New Zealand Journal of Marine and Freshwater Research, 14(2), 103-120 . GRUNDEL, J . 1997 . Zu r Kenntni s einige r Gastropoden Gattungen au s de m franzosische n Jur a un d allgemeine Bemerkungen zur Gastropodenfauna aus dem Dogge r Mittel - un d Westeuropas . Berliner geowissenschaftliche Abhandlungen, Reihe E , 25 , 69-129. 1999. Truncatelloide a (Littorinimorpha , Gastropoda) au s de m Lia s un d Dogge r Deutschlands un d Nordpolens . Berliner geowissenschaftliche Abhandlungen, Reihe E , 30 , 89-119. HARRY, H . W . 1985 . Synopsi s o f th e supraspecifi c classification o f livin g oyster s (Bivalvia : Gryphaeidae an d Ostreidae) . Veliger, 28(2) , 121-158. Hu, Y. , FULLER, S. C., CASTAGNA , M. , VRIJENHOEK , R . C . & LUTZ , R . A . 1993 . Shel l morpholog y an d identification o f earl y lif e histor y stage s o f congeneric specie s o f Crassostrea an d Ostrea. Journal of the Marine Biological Association of the UK, 73 , 47'1-496. JOZEFOWICZ, C . J . & O'FOIGHIL , D . 1998 . Phylogenetic analysis o f souther n hemispher e fla t oyster s base d on partial mitochondrial 16 S rDNA gene sequences . Molecular Phylogenetics an d Evolution, 10 , 426-435. LE PENNEC , M . 1978 . Genese d e l a coquille larvaire e t postlarvaire chez divers bivalves marins. Ph D Thesis, Brest (France). MALCHUS, N . 1990 . Revisio n de r Kreide-Auster n (Bivalvia: Pteriomorphia ) Agypten s (Biostrati graphie, Systematik) . Berliner geowissenschaftliche Abhandlungen, A, 125, 1-231 . 1995. Larva l shell s o f Tertiar y Cubitostrea Sacco , 1897, with a review of larval shell characters in the subfamilies Ostreina e an d Crassostreina e (Ostreoidea, Bivalvia) . Bulletin d e I'lnstitut royal des Sciences naturelles de Belgique, 65, 187-239 . 1998. Comparin g earl y ontogen y shell s o f phylogenetically relate d Jurassi c an d Recen t bivalves: a ste p towar d taxonomi c an d

312

N. MALCHU S

paleoenvironmental interpretations . In : BIELER , R . & MIKKELSEN , P . M . (eds ) World Congress o f Malacology, Washington DC , 1998, Unita s Malacologica, Abstracts, 203. 1999. Identificatio n o f larva l bivalv e shell s b y means o f simpl e statistics . Berliner geowissenschaftliche Abhandlungen, Reihe E , 30 , 147-160. 20000. Post-larva l an d larva l shell s o f Juranomia Ftirsich an d Werner , 1989 , an d Anomia Linnaeus, 1758 (Anomiidae , Bivalvia) . Paldontologische Zeitschrift, i n press. 2000/7. Larval shells of Middle Jurassic Oxytomidae (Bivalvia: Monotoidea ) fro m Poland . Journal o f Molluscan Studies, 66(2), 289-292 . O'FoiGHiL, D . & TAYLOR , D . J . 2000 . Evolutio n of parenta l car e an d ovulatio n behavio r i n oysters. Molecular Phylogenetics an d Evolution, in press. PALMER, C. P. 1989. Larval shells of four Jurassic bivalve molluscs. Bulletin o f th e British Museum o f Natural History (Geology), 45(1), 57-69. PASCUAL, E . 1972 . Estudi o d e la s concha s larvaria s d e Ostrea stentina, Payr . y Ostrea edulis L . Investigacion Pesqueras, 36(2), 297-310.

RANSON, G . 1960 . Le s prodissoconque s (coqille s larvaires) de s ostreides vivants. Bulletin de Vlnstitut oceanographique d e Monaco, 1183 , 1—41 . 19670. Le s espece s d'huitre s vivan t actuellemen t dans le monde, definies par leurs coquilles larvaire s ou prodissoconques . Etud e de s collection s d e quelques - un s des grands musees naturelles. Revue des traveaux de Vlnstitut des peches maritimes, 31(2), 127-199 . 1967/7. Le s espece s d'huitre s vivan t actuellemen t dans le monde, definie s par leurs coquilles larvaire s ou prodissoconques . Etud e de s collection s d e quelques - un s des grands musees naturelles, part 2. Revue des traveaux de I'lnstitut des peches maritimes, 31(3), 205-274. STENZEL, H . B . 1971 . Oysters . In: MOORE , R . C . (ed. ) Treatise on Invertebrate Paleontology. Part N. Bivalvia, Volume 3 . Geological Societ y o f Americ a and University of Kansas, N953-N1224. TANAKA, Y . 1960 . Identificatio n o f larv a o f Saxostrea echinata (Quo y & Gaimard). Venus, 21, 32-38. WALLER, T . R . 1981 . Functiona l morpholog y an d development o f velige r larva e o f th e Europea n oyster, Ostrea edulis Linne . Smithsonian Contributions to Zoology, 328, 1-70 .

Morphodynamics of Bryopa an d the evolution of clavagellids ENRICO SAVAZZ I HagelgrandS, 75646 Uppsala, Sweden, (e-mail: enrico.savazzi@ usa.net) Abstract: Typica l clavagellid s ar e eithe r tub e dweller s i n sof t sediment s o r facultativ e semiendolithic borers . Bryopa deviate s fro m thi s patter n b y bein g full y an d obligatoril y endolithic. The lef t valv e in Bryopa i s permanently attached to the wall of the borehole. I n spite of this, th e bivalve migrates forward s withi n th e substrat e throughou t growth . These seemingl y incompatible feats are achieved by continuously elongating the shell in the anterior direction and sliding forward s th e sof t parts , hing e an d righ t valv e withi n th e shell . Whil e th e lef t valv e becomes elongated , th e posterio r regio n o f th e righ t valv e i s continuousl y destroye d b y resorption. The resulting strongly inequivalve condition is unique among clavagellids, as well as endolithic bivalves . In th e lac k o f direc t evidence , th e evolutio n o f clavagellids fro m les s specialize d stock s remains open to alternative hypotheses . Probable paralle l evolutio n within the clavagellid stoc k further complicates the problem. Evolution of tube-dwelling clavagellids directly from burrowing ancestors i s a s likel y a s their evolutio n from a hypothetical, endolithi c protoclavagellid . I n th e latter case , however , B . lata i s probabl y to o specialize d t o reflec t th e adaptation s o f suc h a n ancestor.

The superfamil y Clavagelloide a d'Orbigny , 184 4 belongs i n th e Subclas s Anomalodesmat a (Ball , 1889), Orde r Pholadomyoid a Newell , 196 5 (se e Yokes 1967 ; Kee n & Smit h 1969) . Clavagelli d bivalves are remarkable i n several respects. In adult individuals, on e o r bot h valve s ar e fuse d t o a calcareous envelope, called a crypt (Savazzi 1982) , which surrounds the organism. A posterior openin g in th e cryp t allow s exposur e o f th e siphona l tips . The anterio r regio n o f th e cryp t typicall y bear s numerous openende d tubules , ofte n arrange d i n distinctive patterns . Softbotto m clavagellid s ar e believed t o burro w b y employin g a hydrauli c mechanism without external moving parts (Savazzi 1999, an d refs cited therein). The mod e o f life an d growth mechanism s o f Recen t clavagellid s hav e attracted th e attentio n o f severa l moder n authors , including Purcho n (1956 , 1960) , Smit h (1978) , Savazzi (1982 ) an d Morton (1984a , b). The genus Bryopa deviate s fro m thi s patter n i n bein g endolithic i n calcareou s substrate s an d i n cement ing its left valv e to the substrate. The Cretaceou s clavagelli d Ascaulocardium armatum (Morton , 1833 ) possesse s suc h bizarr e morphological specialization s tha t Pojet a & Soh l (1987, p . 1 ) called i t 'th e ultimate variation on th e bivalve paradigm' . Th e presen t pape r deal s wit h Bryopa, whic h display s extrem e morphologica l adaptations t o a life habit diametrically opposite , i n several respects, t o that of Ascaulocardium.

Materials an d methods Collection of the specimens Bryopa lata (Broderi p 1834 ) i s a Recen t species . However, th e present autho r wa s unable t o collect living specimens . Thi s i s du e t o a combinatio n of factors: endolithi c habits , scarcit y o f specimens , and a siphona l openin g o f th e borehol e tha t i s usually locate d o n th e undersid e o f cora l boulder s and is easy to confuse with that of other bivalves. In addition, collectin g o r breaking livin g corals in the study are a i s prohibited . O n th e othe r hand , dea d specimens o f B. lata can be collected wit h relativ e ease (se e below) . Fo r thes e reasons , a n actuo palaeontological approac h wa s followed. Along th e easter n coas t o f centra l Ceb u Island , the Philippines , boulder s ar e routinel y dredge d from intertida l an d shallo w subtida l flat s an d used to construct dr y piers. This provides eas y access to coral materia l an d t o thei r endolithi c molluscs . Corals an d thei r endolithi c host s rang e fro m well preserved an d devoi d o f epibiont s t o heavil y encrusted and, in a few instances, subfossil. In most cases, th e cora l ha d bee n dea d an d expose d t o seawater fo r a n extende d time , an d severa l generations of borers an d nestlers were present. Coral boulder s fro m dry pier s wer e fragmented with a sledgehammer . Mos t o f th e collecte d clavagellid borehole s wer e partl y expose d o n ol d fracture surfaces . A quantitativ e measur e o f th e

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications, 177, 313-327 . 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000 .

314

E. SAVAZZ I

frequency o f endolithic clavagellids i n the screene d material i s no t available . However , thei r rarit y i s indicated b y the fact tha t only six individuals were collected i n thi s way , togethe r wit h hundred s o f specimens o f other endolithic bivalves.

Taxonomy In spit e o f revisions o f the Clavagellida e b y Smit h (1962(3) and Smith (1976), the taxonomy of Bryopa at the species leve l is still very confused. Several of the early authors [especiall y Broderi p (1834) , Gray (1858) an d Lam y (1923) ] describe d numerou s species s o summaril y tha t the y ar e impossibl e t o characterize, althoug h the y ca n b e recognize d a s probably belongin g t o Bryopa. Mos t o f th e literature lack s illustration s of Bryopa, o r provides inadequate figures. Majima (1994 ) identified thre e right valves fro m the Recent of Okinawa as Clavagella (Bryopa) lata Broderip. Thi s pape r provide s probabl y th e bes t illustration of this species availabl e in the literature. Although th e materia l describe d i n th e presen t paper doe s no t agre e i n al l respect s wit h thes e illustrations, an d Majim a ha d onl y righ t valve s available, ther e ca n b e littl e doub t tha t th e specimens fro m th e Philippine s availabl e fo r th e present pape r (se e below ) belon g t o th e sam e species, o r to a closely related one . Since the shells of clavagellid s ar e notoriously variable i n siz e an d outline, the Recent material availabl e fo r this study is referred to B. lata. While Bryopa i s generall y regarde d a s a subgenus o f Clavagella (abov e references) , i n this paper i t i s treate d a s a genus , sinc e it s morphological character s an d lif e habit s (se e below) ar e conspicuously different .

Materials A single , dea d an d fragmentar y specime n o f Bryopa lata (specime n n . 1 , Fig s 5 c an d d ) wa s extracted from a dead coral boulder at a depth of c. 0.5 m below the low watermark along the edge of a bank o f cora l rubbl e i n fron t o f Ibo , o n th e northwestern coas t o f Macta n Island , th e Philippines (10 ° 20'30" N, 123 ° 59'0" E). Six individuals of Bryopa lata (Figs 2-5 a an d b) were collecte d fro m dr y pier s (se e above) nea r Tayud, o n th e easter n coas t o f Ceb u Island , th e Philippines (10 ° 21 /30//N, 123 ° 59/0//E). Specimen n. 2 is a cluster of three individuals, wit h two of the right valves present (Fig s 2b, d and f, 3a and d, and 4c an d d) . Specime n n . 3 i s a n almos t complet e crypt an d shel l (Fig s 2a , c an d e , 3b , c an d g) . Specimen n. 4 is a fragmentary crypt and left valve (Fig. 3 e an d f) . Specime n n . 5 is a small , isolate d right valve (Fig. 5 a and b).

A specimen o f Bryopa, hereafte r referred to as B. sp. 1 , from Ta t Tomna, Malt a (Depir u Bed , Uppe r Coral Limestone , Miocene ) wa s provide d b y Richard Bromley (Fig . 6) . Unless otherwise indicated in the figure captions, all illustrate d materia l i s i n th e possessio n o f th e author.

Preparation of the specimens After photography , borehole s o f th e abov e specimens wer e fille d wit h slowsettin g silicon e rubber unde r vacuum , i n orde r t o obtai n artificia l moulds. Sinc e th e substrat e i s highl y porous , i t proved impossibl e t o mechanicall y extrac t th e hardened rubbe r fro m th e borehole s an d th e substrate had to be etched awa y with diluted aceti c acid.

Substrate preferences Bryopa i s a bore r i n calcareou s substrate s (references below) . A Recent specime n fro m th e Red Sea, illustrated by Soliman (1971 , fig. la) , ha s the siphona l cana l surrounde d b y livin g coral , bu t this i s mos t likel y du e t o th e cora l overgrowin g a dead substrate . Othe r specimen s o f th e sam e species wer e found in rock (Soliman 1971) . Bryopa sp. 1 from th e Miocene o f Malta (Fig. 6) was a rock borer i n biogeni c calcirudite . Illustration s an d descriptions o f othe r specie s o f Bryopa i n th e literature (below ) confirm tha t thi s habit i s typical of the taxon . None of the available specimens o f B. lata shows overgrowth b y th e cora l aroun d th e siphona l opening of the crypt. This suggests boring of a dead substrate. I n addition , B . lata i s associate d wit h a rich assemblag e o f boring an d nestlin g organisms . Among these, th e mytilid Lithophaga i s especiall y useful fo r inferrin g th e lif e habit s o f Bryopa. Several studie s (e.g . Goha r & Solima n 1963 ; Kleemann 198 0 an d ref s cite d therein ) agre e tha t certain species o f Lithophaga ar e always associated with living coral, while other species ar e constantly found i n dead cora l o r other calcareou s substrates . No specie s i s know n t o occu r i n bot h livin g an d dead coral . The specime n o f B . lata i n Fig . 2 e ha s th e anteriormost regio n o f th e cryp t ver y clos e t o a large borehol e containin g a shel l o f Lithophaga teres (Philippi) . Thi s species , a s observe d b y th e present autho r i n Ib o (Macta n Island , th e Philippines), is a borer o f rock an d dead coral . Th e thin diaphrag m o f substrat e separatin g th e tw o boreholes (Fig . 2e ) i s riddle d wit h smal l borings , probably produce d b y a n endolithi c sponge . Th e proximity o f a n empt y Lithophaga borehol e allowed thi s spong e t o liv e becaus e th e surfac e of

MORPHODYNAMICS O F BRYOPA

the boulde r wa s to o fa r awa y t o allo w direc t communication wit h the ope n wate r an d n o othe r cavities ar e presen t i n th e surroundin g substrate . The wall of the Bryopa borehol e in proximity to the sponge boring s i s seale d b y a calcareou s linin g deposited b y th e bivalve, most likely as a reaction to the presence o f the sponge . Thi s show s that th e sponge coul d no t depen d o n a n empt y Bryopa borehole for access to water. Therefore, th e sponge, together with the Lithophaga borehole on which the sponge depende d fo r respiration , antedate s th e arrival o f Bryopa i n th e sam e regio n o f substrate , proving that it did not bore in a living coral . In conclusion, evidence shows that Bryopa bore s exclusively in calcareous roc k o r dead coral .

Morphology, growth and adaptations Shell morphology The lef t valv e o f Bryopa i s cemente d t o th e substrate by its entire oute r surface . The lef t valv e is elongate, with the body cavity constituting half to two-thirds of the valve length. The posterior regio n of th e inne r surfac e o f th e lef t valv e i s a raise d platform carrying coarse growt h lines an d irregular lines running in the antero-posterior direction (Figs 2b, d an d f , 3 a an d c , an d 5d) . Thi s platfor m i s referred to as the siphonal platform. Two indistinct, shallow depression s sometime s ru n i n th e antero posterior directio n alon g th e surfac e o f th e platform, i n correspondenc e o f th e inhalan t an d exhalant siphons. The distal portion of the platform often appear s t o hav e bee n secondaril y erode d i n order to allow the siphona l portion of the borehole to be enlarged for accommodating the growth of the siphons (Figs 2b and d). The oute r surfac e of the lef t valve , a s visible i n external shell moulds and fragments detache d fro m the substrate (Figs 5c and 6c), carries coarse growth lines. The right valve (Fig s 4 , 5a and b, and 6a and b) is much shorter than the lef t one , and is roughly of the sam e siz e an d shap e a s th e bod y cavity . Th e margin of the posterior region of this valve (Figs 4, and 5 a and b) has a variable geometr y an d lacks a siphonal platform. The outer surface (Figs 4a and c, 5a, and 6d) carries coarse growth lines, comparable with those of the lef t valve. The righ t valv e doe s no t for m a closel y fittin g commissure agains t the lef t one . In fact , ther e i s a broad, well-define d an d permanen t antero-ventral gape an d a n ill-define d siphona l o r posteroventral gape. The hing e i s devoi d o f teet h an d laterall y asymmetrical, wit h th e ligamen t inserte d ont o a platform projectin g fro m th e lef t valv e acros s th e

315

medial plan e (Fig . 2 a and e). This platfor m cause s the ligament plane to form a n angle of 45-60° with the commissura l plane . Th e hing e platfor m i s to o poorly differentiated from th e rest of the shell to be characterized a s a ligamenta l nymph . A simila r arrangement occur s i n a t leas t som e specie s o f Clavagella (Stirpulina) (Fig . Id ; note that this is an internal moul d o f th e cryp t an d lef t valve) . Th e ligament i n B. lota is located slightl y anteriorl y t o the centre of the body cavity. The musculatur e i s dimyaria n an d strongly anisomyarian, with the posterior adductor scar from four to eight times larger than the anterior one . The anterior muscl e sca r i s locate d nea r th e anterio r shell margin , whil e the posterior i s just behind th e hinge an d roughl y a t th e centr e o f th e anteroposterior axis . Th e muscl e scar s i n B. sp . 1 (Fig. 6 a and b) are deeply incised , while in B. lata they ar e lightl y incise d o r flus h wit h th e interna l valve surface. Both muscl e scar s ar e clos e t o th e dorsa l shel l margin and cannot therefore exert a strong leverage on the shell. Since both adductors are located belo w the hing e line , a diducto r functio n comparabl e t o that o f pholadid s (e.g . se e Rode r 1977 ) i s no t feasible. Th e function o f the laterally asymmetrical ligament i s no t clear . Thi s arrangemen t displace s the hinge line in the dorsal direction an d therefore allows the adductor muscle s to insert ont o the shell in a rathe r dorsa l position , an d stil l retai n a n adducting function . I n turn , thi s free s mos t o f th e shell interior for the placement of other organs. Bryopa differ s fro m th e larg e majorit y o f bivalves (including all other clavagellids) in that its ligament i s not located near th e umbo. I n fact, th e adult Bryopa ha s n o umbo . Th e apica l portio n o f the lef t (cemented ) valv e i s usuall y erode d (se e above). In th e righ t valve , a quic k compariso n o f th e external and internal surfaces (and, in particular, of the growt h line s o n th e oute r surfac e wit h th e placement of internal features) shows that up to half of th e origina l shel l surface , includin g th e apica l and juvenile portions, is missing (Figs 4a and c, and 5a). This ca n be demonstrate d mor e rigorousl y by a simple geometri c construc t (Fig . 7a) , i n whic h homologous points (in Fig. 7a, the anteriormost and the ventralmos t point s alon g th e commissure ) o n different growt h line s ar e connecte d b y straigh t lines. Thi s reconstructio n i s base d o n th e assumptions tha t th e righ t valv e grow s approximately isometricall y (a s show n by th e lef t valve in Fig . 6c ) an d that shel l curvatur e does no t introduce an appreciable erro r (which is reasonable , because curvatur e in the antero-posterio r directio n is only slight). Under these conditions, homologou s points ar e aligne d alon g a straigh t lin e passin g

316

E. SAVAZZ I

through th e umbo . Thus , th e intersectio n o f tw o lines passin g throug h tw o separat e set s o f homologous point s indicate s th e origina l positio n of th e umbo . Th e rightmos t portio n o f th e illustrated specime n i s no t use d becaus e o f it s obvious deviatio n fro m isometri c growt h (perhap s due to gerontic effects) . When th e abov e construc t i s made , i t become s evident tha t th e posteroventra l regio n o f th e commissure o f th e righ t valv e i s th e sit e o f secondary shel l resorption (Fig . 7b) , while it is the site of shell secretio n i n the opposite valv e (i.e. th e posterior platform) . As a result of this process, the hinge an d ligamen t i n Bryopa continuall y migrat e in th e anterio r directio n alon g th e dorsa l shel l margin. Thus , th e ligamen t i n Bryopa i s strongl y prosodetic wit h referenc e t o th e umbones . Th e ligament i n al l other clavagellids (a s well a s in the large majorit y o f bivalves) i s opisthodetic. A smal l amount o f shel l resorptio n als o take s plac e i n th e left valve , posterior to the ligamental projection . Illustrations o f th e lef t valv e o f Bryopa i n th e literature (e.g . Solima n 1971 ; Majima 1994 ) sho w clear evidenc e o f secondar y resorptio n o f earl y shell portion s (sinc e th e ape x an d juvenile regio n are missing , a s describe d above) . Apparently , however, th e occurrenc e o f secondar y shel l resorption escape d th e attention of these authors.

Crypt morphology The anterio r regio n o f th e borehol e extend s wel l beyond the reach of the right valve (Figs 2a, and 3e and f) . I n on e specime n (Fig . 6) , th e righ t valv e became disarticulate d afte r th e deat h o f th e organism an d moved t o the anterio r portio n o f th e borehole (a s shown by the offset betwee n right and left muscl e scar s i n Fig . 6b) . Thi s give s th e fals e impression o f a right valve reaching th e botto m of the borehole . I n turn , thi s featur e implie s that , a t least i n th e anterio r regio n o f th e borehole , th e boring proces s wa s carrie d ou t b y a mechanis m other than shell abrasion . In th e materia l availabl e t o th e presen t author , there ar e n o tubule s i n th e anterio r regio n o f th e crypt (Fig. 3e and f). On the contrary, one specimen (Fig. 2 a an d e ; se e als o above ) exhibit s a smoot h and thic k calcareou s linin g deposite d o n th e anteriormost regio n o f th e borehole . Ther e i s n o reason t o suppos e tha t al l th e specimen s availabl e for this study [as well as all specimens described b y Soliman (1971) ] are juveniles [thi s is made furthe r unlikely b y th e fac t tha t juvenile clavagellid s ar e unknown in the literature, wit h a single exception : Smith (1910 ) an d Morto n (1984a)] . I t i s no t possible t o decide whether th e specimen i n Fig. 5 a and b is a juvenile o r a small adult . Thus, the lac k of tubule s an d th e facultativ e linin g appea r t o b e

normal adul t feature s i n B . lata. Th e singl e available specime n o f B . sp . 1 i s als o devoi d o f tubules. A few other species , place d in Bryopa an d described i n the literature as possessing tubules , but not availabl e fo r direc t inspection , ar e discusse d below. Unlike othe r specie s o f Bryopa an d othe r clavagellid genera , B. lata (a t least i n the material available i n this study) builds no siphonal chimne y projecting abov e th e surfac e o f th e substrate . However, it deposits facultativel y a thin calcareou s lining i n th e siphona l regio n o f th e borehol e (Fig . 3g). I t ca n als o sea l th e borehole s o f othe r endolithic organism s encountere d whil e borin g b y building irregular calcareou s diaphragm s (arro w in Fig. 2f) . Judging from the haphazard aspect of these diaphragms, whic h contras t wit h th e smoot h an d regular lining s deposited i n direct contac t wit h the substrate (Fig . 2 a and e), it appears that B. lata can exert onl y poo r contro l ove r th e shap e o f a lining not supporte d b y th e substrate . Thi s suggest s tha t the capabilit y o f building a free o r semi-endolithi c crypt comparabl e t o tha t o f typica l clavagellid s i s lost in this species . In B. lata, the secretion of a lining onto the walls of th e borehol e seem s t o tak e plac e onl y i n th e presence o f large r cavitie s i n th e substrate . Th e natural porosit y o f th e cora l substrat e doe s no t trigger th e formatio n o f a lining . Th e wal l o f th e borehole facin g th e righ t valv e bear s a relie f matching th e valv e sculptur e (Fig . 2 c - th e matching valv e i s show n i n Fig . 4a) . Repaire d damage to the shell margin (Fig. 4a and c) suggests a mechanica l borin g process . Growt h o f th e righ t valve i n th e anterio r direction , couple d wit h resorption o f it s posterio r regio n (se e above) , gradually renews the outer valve surface and results in les s mechanica l wea r o n it s oute r surfac e tha n could otherwise be expected. O n the other hand, the anterior regio n o f th e cryp t canno t b e reache d b y the righ t valv e (i n particular , se e Fig . 3 e an d f) , indicating a n exclusivel y chemica l borin g mechanism, a t leas t i n thi s region . A combine d chemical-mechanical action i n Bryopa i s therefore likely. The availabl e materia l o f B . lata contain s a cluster o f a t leas t thre e boreholes (Fig . 3 a an d d) . Coupled wit h th e overal l scarcit y o f individuals , this suggest s gregariou s habits . Th e materia l described b y Solima n (1971 ) strengthen s thi s assertion. Thes e habit s ma y b e compare d wit h gregariousness i n th e coral-borin g coralliophili d gastropod Leptoconchus (Savazz i 1999 , an d ref s cited therein). The boreholes in these specimens are conspicuously bent, implying that B. lata is capable of steerin g th e directio n o f th e borehol e durin g growth. Thi s characte r is widesprea d in borin g bivalves (Savazz i 1999 , an d refs cite d therein) an d

MORPHODYNAMICS O F BRYOPA

adaptive i n avoidin g th e borehole s o f othe r endolithic organisms . I n a gregariou s species , i t relieves crowding of the substrate.

Growth Boring a calcareous substrate, either by chemical or mechanical means , i s no t a fas t proces s and , a s a consequence, boring molluscs tend to grow slowly. As a result of th e shif t t o a n endolithi c habitat, B. lata wa s force d to abando n the growt h process of typical clavagellid s - rapi d juvenil e growth , followed b y constructio n o f th e cryp t an d a n extended adul t stag e withou t furthe r change s i n

317

crypt siz e (excep t fo r secondar y growt h o f it s siphonal extremity ) (Savazz i 199 9 an d ref s cite d therein). The presence o f a non-growing adult stag e in B. lata canno t b e excluded . Indeed , othe r endolithi c bivalves (especially pholadids ) are characterized b y a non-growing adult stage (Savazzi 1999 , an d refs cited therein) . Unlik e tube-dwellin g clavagellids , this stage cannot be achieved by 'hurrying ' through a non-optimal adaptive stage devoid of a crypt. On the other hand, the endolithic environment provides essentially the same protection to juvenile and adult B. lata alike, so fast juvenile growth is not essential. Therefore, B . lata wa s abl e t o rever t t o th e

Fig. 1 . (a) Clavagella (Stirpulina) cf . oblita Michelotti, Uppe r Eocene, Costalung a nea r Possagno , Trevis o province , Italy, (Institut e o f Geology, University o f Padova, Italy , n. 26126). The crypt is broken in the anterior region, exposing the right valve, (b) Brechites (Foegia) veitchi Smith , Recent, Tropical Pacifi c (Institut e of Geology an d Palaeontology, Universit y of Tubingen, Germany , n. 1563/21) , ventra l vie w of crypt, (c ) Humphreyia (Nipponoclava) gigantea (Sowerby) , Recent, Red Sea (Swedish Museum o f Natural History, Stockholm , Sweden) , anterio r region of crypt with valves, (d) Clavagella (Stirpulina) veronensis Savazzi , holotype, Middl e Eocene , Negrar , Veron a province , Italy (Institut e o f Geology, University o f Padova, Italy , n . 26124), internal moul d o f crypt. Arro w point s to the projecting ligamental process o f the left valv e (lowermost), visibl e a s a cavity in the umbonal regio n o f the moul d (compare with Fig. 3c) . Scal e bars, 1 0 mm.

Fig. 2 . Bryopa lata (Broderip), Récent, Tayud, Cebu Island, thé Philippines, (a) Interior o f left valv e of spécimen 3 . (b) and (d) Oblique view s of siphonal régions o f spécimen 2 . The siphonal platform (arrows ) is évident, (c) Borehole wall facing right valve of spécimen 3 (thé right valve is shown in Fig. 4a). (e ) Anterior régio n o f borehole o f spécimen 3 , showing a thick calcareous lining. (f) Interio r o f borehole o f spécimen 2 . Arrow points to irregular lining deposited b y thé bivalve in thé borehole o f another endolithic organism. Th e siphonal régio n o f thé borehole of another individual is visible o n thé right. Scale bars, 5 mm.

MORPHODYNAMICS O F BRYOPA

319

Fig. 3 . Bryopa lata (Broderip) , Recent, Tayud, Cebu Island, the Philippines, (a) an d (d) Artificial mould of borehole s of specimen 2. (b) an d (c) Artificial mould of borehole o f specimen 3, in dorsal (b ) an d left latera l (c ) views (the upper arrow points to the siphona l platform and the lower arrow to the ligamental process), (e) and (f) Obliqu e anterior (e ) and left latera l (f ) views of artificial mould o f borehole of specimen 4 . The shel l an d borehole wall s are secondarily bored b y other organisms, (g) Siphonal openin g of borehole o f specimen 3 , showing a thin lining. Scal e bars, 5 mm.

Fig. 4 . Right valves of Bryopa lata (Broderip), Recent, Tayud, Cebu Island, the Philippines, (a ) and (b) Specime n 3 . (c) and (d) Specime n 2 . Scale bars, 2 mm.

MORPHODYNAMICS O F BRYOPA

321

Fig. 5 . Bryopa lata (Broderip), Recent, Tayud, the Philippines, (a) and (b) Cebu Island, right valve, specimen 5; (c) and (d) Ibo Island, posterior region of left valve , specimen 1 . Scale bars, 2 mm.

continuous growt h process (a t leas t fo r th e initia l part o f th e lif e span ) typica l o f bivalves . Thi s growth proces s i s recorde d i n th e growt h lines of Bryopa shell s an d i n th e ontogeneti c migration of their shell cavity. Several cemente d an d crevice-nestlin g bivalves are convergent with Bryopa i n having a body cavity that is consistently smaller than the cemented valv e and migratin g durin g growth . Man y ostreids , spondylids an d chamid s displa y thes e character istics (either facultatively or as a constant feature). Several soft-botto m bivalve s (e.g . Lithiotis, Cochlearites} posses s simila r characteristic s (Chinzei 1982 , an d refs cite d therein) . I n al l these forms, th e bod y cavit y migrate s i n th e ventra l direction during growth and the hinge is located in a dorsa l position . Bryopa, however , i s uniqu e i n that th e bod y cavit y an d hing e migrat e i n th e anterior direction. In this genus, a migration in the ventral directio n i s obviousl y impossible , a s thi s would preven t th e siphon s exitin g th e shel l an d borehole in a direction diametrically opposite to the direction of migration. In thi s context , i t ma y b e pointe d ou t tha t i t i s possible t o conceiv e a morphogeneti c proces s providing a n alternativ e t o resorptio n o f th e

posterior regio n o f the righ t valv e i n Bryopa. Fo r instance, a s i n th e bivalve s discusse d above , th e right valve of Bryopa coul d follow the migration of the hing e an d remai n smalle r tha n th e lef t valve . However, thi s woul d resul t i n tw o problems : (1 ) widely differen t rate s o f shel l growt h o f th e tw o valves i n the are a o f ligamental attachmen t would subject the ligament to a differential stress. In other bivalves, this is largely avoided by the fact that the hinge migrates i n th e ventral , rather tha n anterior, direction and that the growth rates of the two valves along a n axi s perpendicula r t o th e directio n o f migration are essentially the same. (2) This growth mechanism would not allow the gradual renewal of the surface of the right valve, thus making it mor e vulnerable t o abrasio n agains t th e substrat e (se e above).

Morphology and evolution of the Clavagellidae Taxonomy and stratigraphic ranges The Clavagellida e ar e characterize d b y th e construction o f a calcareou s envelope , o r crypt , with th e left , o r both , valve s formin g part o f th e

322

E. SAVAZZ I

Fig. 6 . Bryopa sp . 1, Miocene, Tat Tomna, Malta , (a) Composite external an d internal mould, wit h interio r of right valve visible , (b) Internal mould of shell in dorsal view. Th e offset o f the muscle scars i s a postmortem artefact, (c ) Artificial replica of borehole mould showing the outer surface o f the left valve, originally cemented to the substrate, and part of the siphonal canal, (d) Fragment of outer mould of right valve showing the shell sculpture. The borehole is filled wit h a fine-grained material , which stand s ou t in contrast wit h the coarser material of the rock substrate. Scale bars, 5 mm (a)-(c) and 2 mm (d).

crypt whic h i s visibl e o n it s oute r surface . Th e posterior regio n o f th e cryp t end s i n a siphona l opening an d the anterior region bear s a number of open tubules . Thre e distinc t morphologi c group s can b e recognize d within thi s family , describe d below. The Clavagella grou p (includin g th e gener a an d subgenera Clavagella, Stirpulina, Stirpuliniola, Parastirpulina, Dacosta an d Ascaulocardium). This grou p i s characterize d b y tub e dwellin g a s a normal habit, although Clavagella and Dacosta can be facultative semi-endolithic borers. Th e latter can be an extension of the juvenile habit of attaching to, or boring into, small calcareous substrate s in orde r to stabiliz e th e shel l i n soft-botto m environments . Specimens o f Clavagella completely embedde d i n the substrat e ar e rar e an d ca n b e explaine d a s a

result of juveniles settlin g i n pre-existing borehole s (e.g. Savazz i 1982) . C mullerae (Kilbur n 1974 ) is described a s a crevice dweller . Common to the Clavagella group is the left valve being part of the crypt and visible from th e outside, and the right valve articulated within the crypt (Fig. la an d d). Shel l morpholog y an d crypt lengt h ar e variable. Th e cryp t alway s bear s anterio r tubules , either arrange d into a circular fringe , or distribute d uniformly o n th e whol e anterio r region . Th e siphonal portio n o f th e cryp t ma y b e smooth , o r bear a series of annular fringes. The shell is roughly circular t o elongate d i n th e antero-posterio r direction, wit h th e valve s o f roughl y simila r sizes. Ascaulocardium ha s onl y four , exceptionall y long, anterio r tubule s an d a ring-shape d 'pipe ' which surround s th e posterio r regio n o f th e shel l

MORPHODYNAMICS O F BRYOPA

323

Fig. 7 . (a) Geometric reconstruction of the original position of the umbo, usin g homologous points (the anteriormos t and ventralmost commissur e points ) on different growt h lines, (b) Schematic drawin g o f right valv e of Bryopa lata, showing th e extent o f secondary shel l resorption. The dashed outline marks the original shell margin. Th e solid outline marks the adult shell margin .

chamber an d bears severa l shorte r tubule s (Pojet a & Soh l 1987) . Thi s pipe wa s apparently built by a bifurcated tentacl e inserte d ont o th e posterio r region o f th e mantl e an d wrappin g aroun d th e exterior surfac e of the crypt. The Clavagella lineage probably appeared in the Upper Cretaceou s o f th e Tethy s (Smit h 1962/?) , with earl y representative s describe d fro m th e United States (including the Turonian of California; Stallwood 1995) , Europ e an d Africa . I n th e Palaeocene, th e lineag e becam e restricte d t o Europe. I n th e Eocene , i t migrate d westward s t o Florida (Pojeta & Sohl 1988 ; Jone s & Nicol 1989), and i n the Oligocene eastward s to the Indo-Pacifi c region, reachin g Japa n an d th e Philippine s i n th e Miocene and Australasia in the Quaternary.

surface o f th e cryp t (Fig . I b an d c ) bu t ar e apparently incapable of boring. Representatives o f thi s lineag e ar e typicall y larger tha n othe r Clavagelloide a an d ma y reac h 325 mm in crypt length. A maximum crypt lengt h of 1 m has been repeatedly reported in the literature (usually a s a quotatio n fro m earlie r literature) . These reports may be due to confusion wit h crypts of th e Caenozoi c teredini d Kuphus, whic h ca n exceed 1 m i n length . Fo r difference s betwee n Kuphus an d clavagellids, se e Savazzi (1982, 1999). This lineag e probabl y appeare d i n th e Earl y Oligocene o f th e norther n Tethy s (Smit h 1962/? ) and subsequentl y migrate d int o th e Indo-Pacifi c region, o f whic h i t i s exclusiv e sinc e th e Neogene.

The Penicillu s group (including Penicillus o r Brechites, Humphreyia , Nipponoclava and Foegia ) This grou p is characterize d b y havin g both valves cemented t o the crypt and visible fro m th e outsid e (Fig. Ic) , an d b y obligator y tube-dwellin g habits . Members o f thi s lineag e ca n cemen t clast s (including non-calcareou s materials ) t o th e oute r

The Bryop a group [including th e genus (see above) Bryopa] This grou p i s distinguishe d b y obligator y borin g habits. Ther e i s disagreemen t i n th e literatur e o n whether Bryopa i s devoi d o f anterio r tubule s (Broderip 1834 ; Lam y 1923 ; Soliman , 1971 ; Appukuttan 1974 ) o r whethe r i t possesse s smal l

324

E. SAVAZZ I

and shor t one s (e.g . Gra y 1858 ; Smit h 19620 ; Smith 1976) . However, at least some of the authors who hav e reporte d th e presenc e o f tubule s ma y have bee n citin g earlie r literature , rathe r tha n reporting a n observed feature. There may also have been som e confusio n betwee n specie s o f Bryopa, Dacosta and Clavagella. Usually, Bryopa i s describe d a s havin g a secondarily elongated siphona l sheath which bears one or more reflected fringes. B. lata, as discussed in th e presen t paper , an d a n unname d specie s described by Soliman (1971) (which may well be a morph o f B. lata) ar e devoid o f a siphonal sheat h and of tubules in the anterior portion of the crypt. B. lata and B. sp. 1 also displays a variable amount of ontogenetic migratio n o f th e sof t part s i n th e anterior direction within the shell, accompanied by secondary resorptio n o f th e posterio r slop e o f th e right valv e (se e above) . Thi s als o applie s t o specimens describe d i n th e literature , albei t t o a smaller degree than the specimens available for this study. At present, it is not possible t o tell whether this group is homogeneous an d the representatives that possess tubules are closely related to B. lata and B. sp. 1 , or the y shoul d b e move d t o th e Clavagella group. However , i t is clear that the morphologica l and functiona l difference s betwee n B . lata an d typical Clavagella are at least as important as those existing between the Clavagella and the Penicillus lineages. Dacosta wa s liste d abov e a s a membe r o f th e Clavagella group. It differs fro m Bryopa i n several respects, especiall y th e semi-endolithi c habit , th e well-developed crypt with anterior tubules (Morton 1984&), an d a n apparen t lac k o f migratio n o f th e soft part s withi n th e lef t valv e an d secondar y resorption o f the right valve. It is similar to Bryopa in it s anisomyaria n condition . Morto n (19840 ) mentions othe r anatomica l difference s betwee n B . lata and Dacosta australis. On the basis of morphology alone, it is tempting to regard Dacosta as the member of the Clavagella group wit h th e closes t affinitie s t o Bryopa. However, evolutio n o f Bryopa fro m Dacosta i s made unlikely b y the stratigraphi c an d geographi c distribution o f th e latte r taxon , which i s fro m th e Australasian (Smit h 1971 ) and Japanese Holocen e (Majima 1994) . Dacosta ma y therefor e b e a lat e offshoot fro m Clavagella, partl y convergen t wit h Bryopa. Bryopa appeare d i n th e Lat e Oligocen e o f southern Europ e (Smit h 1962Z? ) an d subsequentl y migrated t o th e tropica l Indo-Pacific . I t eithe r survived the basal Neogene an d Pleistocene crise s in th e Mediterranean , o r subsequentl y re-entere d the Mediterranea n o n bot h occasions , an d it s occurrence i n thi s are a i s documente d fro m th e

Miocene an d Recent . I n th e Indo-Pacific , i t i s recorded fro m th e Recen t o f severa l localities , principally th e Re d Sea , souther n India , th e Philippines and Japan.

Evolution within the Clavagellidae The thre e group s describe d abov e appea r t o represent monophyleti c lineages : n o form s inter mediate betwee n thes e ar e know n t o th e presen t author. Tubule-carryin g Bryopa coul d constitut e such a n intermediat e form , but th e presen t autho r has bee n unabl e to inspect material , an d literatur e descriptions an d illustration s ar e insufficien t t o reach a decision . Eac h grou p ha s remaine d essentially constan t i n morpholog y throughou t it s known stratigraphi c range . Th e disappearanc e o f Ascaulocardium an d Parastirpulina (se e Pojet a & Johnson 1995 ) i n th e Uppe r Cretaceous , whic h reduced morphologica l diversit y withi n th e Clavagella group , is th e onl y remarkable even t in evolution withi n these lineages. The emergence of Dacosta is only a slight modification of the habits of Clavagella (s.s.). The compactness an d evolutionary conservatis m within the three groups should be acknowledged in the taxonomi c hierarchy , an d ma y justif y th e introduction o f thre e subfamilies . Suc h a n ide a i s not new , sinc e Lam y (1923 ) alread y di d s o i n a short stud y o f Recen t clavagellid s fro m th e Re d Sea. Moder n author s (Smit h 1962a ; Smit h 1971 , 1976, 1978) , however , di d no t recogniz e suc h a need. This compactnes s an d conservatis m ar e a n obstacle t o understandin g th e evolutio n o f clavagellids fro m a n earlie r stock , a s wel l a s th e evolution withi n th e thre e clavagelli d lineages . With a lac k o f objectiv e data , on e i s force d t o formulate a hypothetical evolutionar y process tha t must remain unverified until new material becomes available. No t surprisingly , tw o mutuall y incompatible pathways have been proposed fo r the evolution of the Clavagellidae (below) .

Evolution of the Clavagellidae from earlier stocks Savazzi (1982 ) envisage d th e evolutio n o f tube dwelling Clavagella from a n obligator y bore r no t unlike Bryopa. H e base d hi s hypothesi s o n th e description o f a n unname d specie s b y Solima n (1971). Note that this evolutionary mechanism does not necessaril y impl y clavagellid s evolve d fro m a non-clavagellid bore r (whic h i s rathe r unlikely) . Rather, the boring habit may have appeared early in the evolutio n o f th e Clavagellida e bu t afte r thei r differentiation fro m a pre-clavagellid stock.

MORPHODYNAMICS O F BRYOPA

According t o Savazz i (1982) , Penicillus an d related genera represent a further evolutionary step, originating a s a n offshoo t fro m th e Clavagella group. Within this framework, cementation o f both valves to the crypt caused the sudden divergence of this grou p fro m Clavagella. The proces s was , of necessity, a saltation, becaus e ther e are no feasible intermediates. O n th e othe r hand , cementatio n o f the lef t valv e wa s alread y par t o f th e clavagelli d Bauplan an d the muscula r mantle could take over the function o f the mobile righ t valve (see Savazzi 1982). Thus , al l th e necessar y morphogeneti c building block s wer e availabl e an d thi s sudde n evolutionary even t therefor e seem s plausible . A difficulty wit h this evolutionary pathway is that i t finds n o confirmatio n i n th e fossi l record , sinc e Bryopa appear s t o b e a fairl y recen t stoc k (se e above). Pojeta & Soh l (1987) , o n th e othe r hand , suggested tha t tube-dwellin g clavagellid s (th e Clavagella group in particular, being older than the others) evolve d fro m a burrowin g for m morphologically simila r t o Entovalva, whic h envelopes th e shel l withi n th e mantle , an d th e mantle i n thi s genu s doe s resembl e th e anterio r region o f a clavagelli d cryp t whe n extended . However, a difficult y wit h thi s vie w i s tha t th e mantle i n Entovalva i s bilaterall y symmetri c an d encloses bot h valves , wherea s th e Clavagella mantle is conspicuously asymmetric [see above and Savazzi (1982, 1999)] . The recognition o f such an ancestor i n th e fossi l recor d i s mos t likel y precluded b y th e lac k o f preservabl e diagnosti c characters. An intermediat e form betwee n a 'naked ' pre clavagellid an d a tube-dwelling clavagelli d migh t have possesse d a cryp t onl y partiall y envelopin g the organism . Suc h a for m coul d conceivabl y b e preserved, but it would be difficult t o distinguish it from a n incompletel y grow n clavagelli d (incidentally, ther e i s no fossil or Recent recor d of clavagellid specimen s in the earl y phase s o f crypt construction). Alternatively , a n intermediat e for m might have possessed a n organic or lightly calcifie d crypt, possibl y strengthene d b y agglutinate d sediment particles. Suc h a form could stand a better chance of being recognized i n the fossil record but its preservation is unlikely. Without evidence, neithe r o f the two competin g hypotheses i s completel y satisfactory . I n con clusion, bot h th e appearanc e o f th e Clavagellida e and th e divergenc e o f th e Penicillus lineage fro m the clavagelli d stoc k shoul d b e regarde d a s unsolved problems. Also , it cannot be excluded that the Clavagella an d Penicillus lineage s evolve d independently fro m pre-clavagellids , and that their similarities ar e only the result o f convergence and similar preadaptations . O n th e othe r hand , i f on e

325

accepts th e fossi l recor d a s indicativ e o f th e rea l stratigraphic range s o f th e clavagelli d groups , th e Bryopa lineag e i s relativel y eas y t o explain . Facultative borin g i n th e Clavagella lineage (se e Savazzi 1982 ) becam e obligator y i n Bryopa, wit h the consequen t reductio n o r los s o f th e anterio r tubules. The two-stag e growt h mechanis m o f tube dwelling clavagellids (i.e . rapid growth of a 'naked' stage, followed by crypt construction and no further increase i n size , excep t fo r elongatio n o f th e siphonal sheath ) i s unsuitabl e i n th e endolithi c environment, whic h require s th e capabilit y o f compensating fo r substrat e erosio n and/o r over growth, a s well as a slow growth to accommodate the necessaril y slo w borin g process . Migratio n of the sof t part s withi n th e shell , couple d wit h secondary resorptio n o f th e righ t valve , provide d the capability of compensating for substrate erosion by movin g within the substrate . This als o allowe d juveniles t o settl e o n th e surfac e o f th e substrat e and t o becom e endolithi c durin g growth , withou t having t o rel y o n pre-existin g cavities . Th e capability o f buildin g a calcareou s cryp t wa s reduced to the facultative deposition o f a lining on the wall s o f th e borehole . Constructio n o f a siphonal sheat h wa s retaine d i n som e specie s o f Bryopa a s a mechanis m t o figh t encrustatio n an d fouling o f the substrate. No othe r borin g bivalv e ha s th e shel l permanently cemente d t o the substrate. Thi s i s the factor tha t triggere d th e evolutio n o f th e uniqu e shell morpholog y o f Bryopa. Th e shif t i n habi t from cemented-epifauna l to cemented-endolithic i s extremely unusua l (it is unknown in other bivalve s and occurred just once i n gastropods; unpublishe d observations). The scarce and patchy fossil record of endolithi c clavagellids i s no t uniqu e amon g othe r suc h bivalves. Othe r example s ar e th e arci d Litharca (Nicol & Jone s 1986 ) an d th e pectini d Pedum (Savazzi 1998 , an d refs cite d therein) . Thei r shel l morphology i s highl y specialize d an d i s therefor e potentially recognizabl e i n fossils. I n spit e o f this , both genera lack a fossil record. I n both cases, thi s has bee n attribute d t o quic k evolutio n fro m ancestors wit h differen t morphologie s an d lif e habits. While this may be true (and also apply to the sudden appearance o f Bryopa), th e fossil record fo r Bryopa show s tha t thi s genu s ha s no t sub stantially change d sinc e it s appearance . Th e extreme rarit y o f fossi l Bryopa (eve n whe n compared wit h othe r clavagellids ) ma y b e du e to poo r preservabilit y (thei r shallo w borehole s are likely t o be secondarily occupie d an d modified by othe r organisms , and/o r t o b e destroye d b y erosion o f th e substrate ) couple d wit h individua l scarcity.

326

E. SAVAZZ I

Constructional morphology v. morphodynamics In th e terminolog y o f constructiona l morpholog y (Seilacher 1970 ) and biologica l morphodynamic s (Seilacher 1991) , th e preadaptations of Clavagella (juvenile cementatio n o f th e lef t valv e t o clasts ; construction o f a crypt ; a facultativ e semi endolithic habit) can be placed among phylogenetic factors. Cementatio n o f th e lef t valv e t o th e substrate, originall y par t o f th e phylogeneti c tradition, results in a constructional constraint that triggered th e evolutio n o f a uniqu e morphology . The switch in the immediate surroundin g environment, implici t i n a habita t chang e fro m th e sof t bottom to the endolithic, may have constituted the main even t tha t triggere d morphologica l specialization i n Bryopa.

Conclusions A larg e amoun t o f ontogeneti c migratio n o f th e hinge an d sof t part s i n th e anterio r direction , accompanied b y extensiv e secondar y shel l resorption i n th e righ t valve , characteriz e Bryopa lata an d B . sp . 1 . Judgin g fro m literatur e illustrations, thes e character s see m t o be incipien t in othe r specie s o f Bryopa. Bot h character s ar e adaptive i n th e contex t o f borin g i n substrate s subjected to surface erosion. Thus, B. lata seems to be adapted t o an endolithic lif e t o a higher degre e than any other clavagellid. This is achieved without a substantia l departure fro m th e buildin g pla n o f other specie s o f Bryopa: th e onl y 'innovative ' characters of Bryopa ar e migration of the soft parts within th e lef t valve , selectiv e resorptio n o f th e right valve, reverting to a slower and more gradual growth process , an d reductio n o f th e cryp t t o a facultative lining of the borehole. This combination of adaptation s result s i n a functioning paradox: a bivalve that cements one valve to the substrate, and yet continue s to bore an d mov e through it during growth. The stepping-ston e to this complex of coadaptations i s th e habi t o f juvenile Clavagella of cementing the left valv e to clasts, for stabilization , on sof t bottom s (Savazz i 1999 , and ref s cite d therein). Evolution o f th e Clavagellidae , an d within th e Clavagellidae, i s a t presen t insufficientl y docu mented. Several ke y forms linkin g the clavagellid s with their ancestors, as well as intermediate form s between the three known clavagellid lineages, still await discovery an d description. I n the meantime , two alternativ e hypothese s ca n b e formulate d o n the origi n an d evolutionar y developmen t o f thi s family, bu t ther e ar e n o compellin g ground s fo r preference of one over the other.

References APPUKUTTAN, K . K . 1974 . Rediscovery o f Clavagella (Bryopa) lata (Clavagellidae , Bivalvia ) fro m th e Gulf o f Mannar , Southeas t coas t o f India . Journal of th e Malacological Society o f Australia, 3 , 19-24. BRODERIP, W. J. 1834 . On Clavagella. Proceedings o f th e Zoological Society o f London, 2, 115-117 . CHINZEI, K . 1982 . Morphologica l an d structura l adaptations t o sof t substrate s i n th e Earl y Jurassi c monomyarians Lithiotis an d Cochlearites. Lethaia, 15, 179-197. GOHAR, H. A. F. & SOLIMAN, G. N. 1963. On three mytili d species borin g i n livin g corals . Publications o f th e Marine Biological Station Ghardaqa, 12 , 65-98. GRAY, J . E . 1858 . O n th e familie s o f Aspergillidae , Gastrochaenidae, an d Humphreyadae . Proceedings of th e Zoological Society o f London, 26 , 307-318. JONES, D . S . & NICOL , D . 1989 . Eocene clavagellid s (Mollusca: Pelecypoda ) fro m Florida : th e firs t documented occurrenc e i n th e Cenozoi c o f th e western hemisphere . Journal o f Paleontology, 63 , 320-323. KEEN, M . & SMITH , L . A . 1969 . Superfamil y Clavagellacea. In : MOORE , R . C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Mollusca 2. Geological Societ y o f Americ a an d Universit y o f Kansas, 857-859 . KILBURN, R . N . 1974 . A ne w specie s o f Clavagella s.s. (Bivalvia: Clavagellidae) from Natal, South Africa . Journal d e Conchyliologie, 111, 89-92. KLEEMANN, K . H . 1980 . Boring bivalve s an d thei r hos t corals fro m th e Grea t Barrie r Reef . Journal o f Molluscan Studies, 46, 13-54. LAMY, E . 1923 . Les Clavagelle s e t Arrosoir s d e l a Me r Rouge (d'apre s le s materiau x recueilli s pa r l e Dr. Jousseaume). Bulletin d u Museum national d'Histoire Naturelle, 19 , 104-107. MAJIMA, R . 1994 . Clavagellidae (Mollusca ; Bivalvia) i n Japan. Bulletin o f th e Japanese National Science Museum Series C , 20, 13-43. MORTON, B . 19840 . Adventitiou s tub e constructio n i n Brechites vaginiferus (Bivalvia : Anomalodesmata : Clavagellacea) with a n investigation o f the juvenil e of 'Humphreyia strange?. Journal o f Zoology, 204, 461-484. 1984&. Th e biolog y an d functiona l morpholog y o f Clavagella australis (Bivalvia : Anomalodesmata) . Journal o f th e Zoological Society o f London, 202, 489-511. NICOL, D. & JONES, D. S . 1986 . Litharca lithodomus an d adaptive radiatio n i n arcacea n pelecypods . Th e Nautilus, 100 , 105-109. POJETA, J. JR & JOHNSON, R. 1995 . Parastirpulina sohli: a new Cretaceou s clavagelli d pelecypod . Th e Geological Association o f Ne w Jersey, 12 , 14-23. & SOHL , N . F . 1987 . Ascaulocardium armatum (Morton, 1833) , ne w genu s (Lat e Cretaceous) : th e ultimate variatio n o n th e bivalv e paradigm . Th e Paleontological Society Memoir, 24 , 1-77 . & 1988 . Eocen e clavagellid s fro m Florida . Journal o f Paleontology, 62 , 8-26 .

MORPHODYNAMICS O F BRYOPA PURCHON, R. D. 1956 . A note on the biology o f Brechites penis (L.) (Lamellibranchia). Journal of the Linnean Society o f London, Zoology, 43 , 43-53. 1960. A furthe r not e o n th e biolog y o f Brechites penis (L. ) (Lamellibranchia) . Proceedings o f th e Malacological Society of London, 34, 19-23 . RODER, H . 1977 . Zur Beziehun g zwische n Konstruktio n und Substra t be i mekanisc h bohrende n Bohrmuscheln (Pholadidae , Teredinidae) . Senckenbergiana maritima, 9, 105-213 . SAVAZZI, E . 1982 . Adaptations t o tub e dwellin g i n th e Bivalvia. Lethaia, 15, 275-297. 1998. Constructiona l morpholog y o f th e bivalv e Pedum. In: JOHNSTON , P. A. & HAGGART, J. W. (eds) Bivalves: a n Eo n o f Evolution. Universit y o f Calgary Press, Calgary , 413-421. 1999. Boring, nestlin g an d tube-dwelling bivalves . In: SAVAZZI , E. (ed. ) Functional Morphology o f th e Invertebrate Skeleton. Wiley & Sons, 205-237. SEILACHER, A . 1970 . Arbeitskonzept zu r Konstruktions Morphologie. Lethaia, 3, 393-396. 1991. Self-organizin g mechanism s i n morphogenesis an d evolution . In : SCHMIDT KITTLER, N . & VOGEL , K . (eds ) Constructional Morphology an d Evolution. Springer-Verlag, Berlin, 251-271.

327

SMITH, B. J. 1971 . A revision of the family Clavagellida e (Pelecypoda, Mollusca ) fro m Australia , wit h descriptions o f tw o ne w species . Journal o f th e Malacological Society of Australia, 2, 135-161. 1976. Revision o f the Recen t specie s o f the family Clavagellidae (Mollusca , Bivalvia) . Journal o f th e Malacological Society of Australia, 3 , 187-209 . 1978. Furthe r note s o n th e Clavagellidae , wit h speculation o n the process o f tube growth . Journal of th e Malacological Society o f Australia, 4 , 77-79. SMITH, E . A . 1910 . Note o n th e ver y young stag e o f th e genus Humphrey ia. Proceedings o f th e Malacological Society of London, 9, 23-25. SMITH, L . A . 1962a . Revisio n o f th e Clavagellacea . Veliger, 4, 167-174 . I962b. Historica l zoogeographi c stud y o f th e Clavagellacea. Veliger, 5, 15-19. SOLIMAN, G . N. 1971 . On a new clavagellid bivalve fro m the Re d Sea . Proceedings o f th e Malacological Society o f London, 39, 389-397. STALLWOOD, R . B . 1995 . A Turonia n clavagelli d (Bivalvia) fro m th e Lad d Formatio n o f souther n California. Journal of Paleontology, 69, 84-88 . YOKES, H . E . 1967 . Genera o f th e Bivalvia . Bulletins o f American Paleontology, 51, 105-393 .

This page intentionally left blank

Calcium concretions in the interstitial tissues of the Australian freshwater mussel Hyridella depressa (Hyriidae ) MARIA BYRNE Department of Anatomy and Histology F13, University of Sydney, NSW 2006, Australia (e-mail: mbyrne @anatomy, usyd. edu.au) Abstract: The Australian freshwater musse l Hyridella depressa (Lamarck , 1819 ) has extensive deposits o f calciu m phosphat e granule s i n it s interstitia l connectiv e tissues . Th e structure , distribution an d elementa l profil e o f thes e granule s wer e documente d b y ligh t an d electro n microscopy. For the elemental study, granules in cryo-prepared mantle tissue were examined by X-ray microanalysis . The granules were bright orange and formed a conspicuous cover over the mantle an d palps , an d wer e als o abundan t i n th e viscera l mass . B y contrast , the y wer e no t common in the gills and foot. Th e granules were typically distributed in discrete clusters and, i n places, dominated the tissue space. Iron was a particularly important component of the granules and may account for their colour. The granules also contained other common elements, including Mg, Mn and Al, and trace elements, including Cu, Zn and Pb. Considering the important position of th e Hyriidae in understanding the evolutio n an d phylogeny o f the Unionoida, emphasis was placed on comparison of the calcium granules of H. depressa t o those in the Margaritiferidae and Unionidae. Granul e distributio n i n H . depressa wa s mos t simila r t o tha t describe d fo r margaratiferids an d contraste d wit h tha t describe d fo r unionids . Th e impressiv e capacit y t o accumulate extensive calcium deposits in their tissues is a unique feature o f the Unionoida, but the rational e underlyin g productio n o f thes e exces s calciu m store s i s no t understood . I t i s suggested that the granules may be a by-product of biomineralization processes in the Unionoida associated with th e highly efficient calciu m uptake system these bivalves evolved in conjunctio n with colonizatio n of freshwater environments .

The colonizatio n o f freshwate r b y th e marin e ancestors o f th e Unionoid a wa s followe d b y extensive radiatio n o f thes e bivalve s int o a wide variety o f freshwate r environments . Du e t o thei r local abundanc e an d larg e capacit y fo r filtration , unionoids pla y majo r ecologica l role s i n elemen t and nutrien t cycling , an d i n influencin g th e wate r quality o f aquatic systems (Green 1980 ; Nalep a e t al 1991) . A s par t o f thei r adaptatio n t o livin g i n freshwater, thes e bivalve s hav e evolve d a n impressive ability to sequester the calcium required for shel l formatio n i n low-calcium , freshwate r environments. They also sequester calcium in small granular concretion s deposite d i n thei r tissue s (Pynnonen e t al 1987 ; Silverma n 1988 ; Byrn e & Vesk 1996 , 2000 ; Pekkarine n & Valovirt a 1997 ; Vesk & Byrne 1999). Calcium is deposited in these granules a s relatively insolubl e phosphate s suc h as orthophosphate, pyrophosphat e o r a mixtur e o f these two anions (Silverma n e t al. 1983 ; Jeffre e e t al 1993 ; Maso n & Jenkins 1995 ; Langsto n e t a l 1998). Th e granule s ofte n dominat e freshwate r mussel tissue s an d compris e u p t o hal f th e dr y tissue weigh t (Silverma n e t al 1985 ; Pynnone n et

al 1987) . I n Anodonta specie s granule s ar e particularly abundan t in the connective tissue of the gills (Silverman et al 1985 ; Pynnonen et al 1987) . Like thei r norther n hemispher e relatives , Australian hyrii d mussel s deposi t calciu m phosphate granule s i n thei r tissue s (Jeffre e & Simpson 1984 ; Byrn e & Vesk 1996 , 2000 ; Adam s et a l 1997 ; Ves k & Byrne 1999) . Th e granule s of Hyridella depressa (Lamarck , 1819 ) sequeste r a range o f element s fro m th e environmen t an d several studie s hav e highlighte d thei r applicatio n for monitorin g metal pollution (Jeffre e & Simpso n 1984; Byrn e & Ves k 1996 , 2000 ; Adam s e t a l 1997; Ves k & Byrn e 1999) . I n H . depressa, th e calcium i n the granules i s bound to pyrophosphat e and/or hydroge n phosphat e (Jeffre e e t a l 1993) . This musse l i s a n importan t componen t o f th e macrobiota o f aquati c system s i n southeaster n Australia, an d aspect s o f it s lif e histor y an d conservation biolog y hav e bee n documente d i n several studies (Jupiter & Byrne 1997 ; Byrne 1998 ; Walker e t a l 2000) . I n th e presen t study , th e distribution, structur e an d elemental conten t o f the calcium granule s i n H . depressa i s describe d b y

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Special Publications, 177, 329-337 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

330 M

. BYRNE

Fig. 1 . (a) The granules form a conspicuous orange cover over the mantle (M) of Hyridella depressa. The viscera l mass has been dissected (arrow ) to show the high density of granules below the epithelium, (b) Detail o f mantle edg e showing granule clusters whic h are seen as orange flecks. F, foot; GI, gill. Scale bars: (a ) 2.0 mm; (b) 1. 0 mm.

light an d electro n microscopy . Th e element s contained i n th e granule s wer e characterize d in cryo-prepared mantl e tissu e b y X-ra y micro analysis. Thi s metho d allowed direct analysi s of granules preserve d in a near-nativ e state (Ves k & Byrne 1999) and avoided the problems of elemental loss and redistribution associated with the aqueous techniques use d i n previou s studie s (Jeffre e & Simpson 1984 ; Silverman e t al 1985 , 1987). Considering th e importan t role o f th e Hyriida e i n understanding th e evolutio n and phylogeny o f th e Unionoida (Gra f 2000 ; Walke r e t a l 2000) , emphasis i s placed on comparison of th e granules and their distribution in the tissues of H. depressa with those documented for the Margaritiferidae and Unionidae. Whil e granul e accumulatio n i s a

synapomorphic featur e o f th e Unionoida , thi s phenomenon i n H . depressa exhibite d severa l features differen t fro m thos e seen in their northern hemisphere counterparts.

Materials and methods Specimens o f Hyridella depressa wer e collecte d from three sites at Lake Burragorang, a major water storage locate d c . 60k m wes t o f Sydney , Ne w South Wales [se e map in Byrne (1998)]. The sites were Kedumba (33°51'S; 150°20'E) , Pocke t Creek (33°56'S; 150°25'E ) an d Rippl e Cree k (33°54'S ; 150°33'E). A t eac h sit e mussel s wer e collecte d from withi n th e majo r siz e class present and shell

Fig. 2 . LM of Hyridella depressa. (a), (c)-(e), (h) and (i) Paraffin sections (6.0 urn thick); (b), (f) an d (g) semi-thin sections (0.5 u m thick), (a) Grazing section o f the mantle showing clusters of granules (G) throughout the interstitium between the inner (left ) an d outer (right) epithelia (E) . (b) Mantle section showin g granules (G) aligned belo w th e epithelium (E ) and surrounding haemocoel (H) spaces, (c) Granule clusters in mantle interstitium. (d ) Massiv e deposition of granules in the visceral.mass, (e) Granules i n visceral mass near foot. Note the absence of granules in the foot muscl e (M) region, (f) Cluster of granules among spermatogenic ascini. S, sperm, (g) Single large granul e (top) and small granules (bottom ) in the gill, (h) and (i) Historically, a positive reaction o f the granules to Alizarin red (h) and Perl's stain (i), indicated th e presence of Ca and Fe, respectively. Scal e bars: (a) 0.5 mm; (b) 5.0 um; (c), (d) and (i) 50 urn; (e) and (h ) 12 5 um; (f ) 30 um; (g ) 1 0 um.

CALCIUM GRANULE S I N THE TISSUES O F HYRIDELLA DEPRESSA 33

1

332

M.BYRNE

lengths wer e measured wit h vernie r calipers . Th e mussels fro m Kedumb a wer e 50-6 5 tnm (shel l length), while those from Pocket and Ripple Creeks were 40-5 8 mm (shel l length) . H . depressa wer e collected during the non-breedin g periods o f 199 5 and 199 6 (between April and July). For light (LM) and transmission electron (TEM ) microscopy, smal l piece s o f tissue wer e place d i n 2.5% glutaraldehyd e i n 0.0 2 M HEPE S an d post fixed in 2% OsO4 in 0.01 M HEPES, dehydrated in ethanols an d placed i n 100 % acetone . Th e tissue s were embedde d i n Spurr' s resi n an d sectioned . Ultrathin sections wer e stained with uranyl acetate and lead citrate, then viewed in a Phillips 400 TEM or a JOEL 101 0 TEM. Semi-thin sections (0. 5 urn) were staine d wit h toluidin e blue . Fo r scannin g electron microscop y (SEM) , mantl e an d pal p tissues, fixed a s described above, were dehydrated, critical-point dried , mounte d on stub s and coated , then examined with a JOEL 35C SEM. Tissue sample s fo r histolog y wer e fixe d i n Bouin's fluid , dehydrate d i n grade d ethanols , embedded i n paraffin , sectione d ( 6 um thick ) and stained wit h haematoxylin and eosin , o r wit h th e Alizarin Re d S an d Perl' s stai n fo r C a an d Fe , respectively (Kiernan 1981) . Methods fo r X-ra y microanalysi s hav e bee n described i n detai l (Byrn e & Ves k 1996 ; Ves k & Byrne 1999) and will only be outlined here. Mantle tissue, cryo-fixe d i n liqui d nitrogen , wa s freeze substituted wit h acetone an d embedded i n Spurr' s resin. Dry-cu t section s (0. 5 um thick) , place d o n nickel slo t grids , wer e analyse d b y X-ra y microanalysis i n a Philip s C M 12 scannin g transmission electron microscope (STEM ) operate d at 12 0 kV an d equippe d wit h a n Eda x energ y dispersive X-ra y detector. Results Granule distribution The granule s o f Hyridella depressa wer e brigh t orange an d forme d a conspicuou s cove r ove r th e surface o f th e mantl e an d palp s (Fig . l a an d b) . They were not evident on surface views of the gills or foot . A n incisio n o f the viscera l mas s reveale d abundant granule s just below th e epitheliu m (Fig . la). I n paraffi n sections , th e granule s were distributed i n cluster s throughou t th e interstitia l con nective tissue of the mantle, palps and visceral mass (Fig. 2a-f) . Thes e cluster s varie d i n siz e and , i n places, th e granule s completel y dominate d th e tissue space (Fig. 2d). The granules were refractil e and, i n unstaine d sections , wer e a gold-yello w colour. The y exhibite d a positiv e respons e t o Alarizin Re d A an d Perl' s stain , indicatin g th e presence of Ca and Fe, respectively (Fig. 2h and i).

Their prominenc e i n th e mantl e an d palp s wa s evident with the scanning view, where each cluster was comprised of tightly packed spherica l granules (Fig. 3a-d). Sections of the mantle shows groups of granules aligned below the epithelium and scattered throughout th e interstitiu m betwee n th e inne r and outer mantl e epitheli a (Fig . 2 a an d b) . Althoug h granules were encountered in the gill, they were not abundant and were usually distribute d singl y or in small groups (Fig. 2g) . Their general absenc e fro m the foo t appear s t o b e du e t o th e paucit y o f extracellular spac e i n thi s highl y muscula r tissu e (Fig. 2e) . Ultrastructure The connectiv e tissu e o f th e mantl e an d viscera l mass contains amoebocyte-like (connective tissue) cells, larg e vesicular cells, muscle , collagen an d a sinusoidal network of vascular spaces (Figs 3 a and b, 4c, d an d g) . Th e connectiv e tissu e cell s ha d a complex profil e an d gave ris e t o numerou s filipodial-like cel l processe s tha t pervade d th e tissue (Fig. 4d and g). These processes containe d a well-developed cytoskeleton of microfilaments and microtubules. They provided a supportive network for th e interstitia l tissues and surrounde d vascular spaces and groups of granules (Fig. 4c and g). The vesicular cell s containe d larg e vesicle s fille d with amorphous material . The y als o gav e ris e t o elongate processe s tha t appeare d t o pla y a supportive role. Th e vesicula r cell s appea r simila r to the storage cells characteristic of bivalve tissues. In ultrathi n sections, th e calciu m granule s wer e round, electro n opaqu e an d range d i n diamete r from 0.5 to 2.5 um (Fig. 4a-f). Compound granules were als o evident . Althoug h th e granule s wer e often foun d near a haemal space, or associated wit h cellular processes , many were no t associate d wit h other tissu e structures . I n chemically fixe d mantl e and viscera l tissu e prepare d fo r TEM , som e granules wer e distinctl y annulate d whil e other s were no t (cf . Fig . 4 e an d f). Th e annulate d for m usually ha d a n electron-dense cor e surrounde d b y dense an d clea r annulation s (Fig . 4 f an d h) . Granules i n froze n mantl e tissu e prepare d fo r STEM, however , di d no t hav e a n annulate d structure (Fig . 4b) , indicatin g tha t annulation s in mantle granule s ma y b e a n artefac t o f chemica l fixation. A typica l energ y dispersiv e X-ra y spectrum fro m microanalysi s o f on e calciu m granule fro m mantl e tissue show s dominant P, Ca and Fe peaks (Fig. 5). They also contained variable amounts o f Mn , Mg , Al , Cu , Pb , Z n an d Ba . Although it is not known how the calcium granules form, th e initia l stage s o f thei r developmen t appeared t o occu r i n th e connectiv e tissu e cells . Annulated granules in various stages of synthesis or

CALCIUM GRANULE S IN THE TISSUE S O F HYRIDELLA DEPRESSA

333

Fig. 3 . SEM of Hyridella depressa. (a ) and (b) Mantle; cluster s o f closely packed granules (G ) in the interstitial tissu e and adjacent haema l (H) spaces, (c) and (d) Palp, detail of the area indicated by the arrow in (c) shows granules (G) dominating the interstitial space. R, ciliated ridges. Scale bars: (a) and (b) 1 0 urn; (c) 250 urn; (d) 1 2 urn.

degradation were present in the cytoplasm of these cells (Fig . 4 g an d h). Connectiv e tissu e cell s als o served a phagocytic function i n granule turnover. In additio n t o calciu m granules , th e connectiv e tissue cell s als o containe d roug h endoplasmi c reticulum, Golg i bodies , lysosome s an d residua l bodies whic h varied i n appearance . Microanalysis of som e o f thes e lysosoma l structure s revealed a dominant S peak and elevated levels of Cu, Pb and Zn, suggestin g tha t the y ma y b e derive d fro m metallothioneins (Vesk & Byrne 1999). Amorphous S-rich structure s wer e als o encountere d i n th e extracellular tissue (Fig. 4a).

Discussion The abundanc e of calcium granules in the mantle, palps and visceral mass of Hyridella depressa wa s readily visualized by macroscopic examination due

to thei r strikin g orang e colour. Thi s ha s no t bee n previously reporte d fo r th e Unionoida , althoug h may b e commo n i n Australian hyriid s (Alliso n & Simpson 1989 ; Colvill e 1994 ; pers . obs.) . Th e orange colour and high Fe conten t of the granules suggests tha t the y contai n iro n oxides . Hig h F e concentrations ar e characteristi c o f th e aquati c environment inhabited by H. depressa an d this has been attribute d to loca l litholog y (Standar d 1969 ; Markich & Brown 1998; Byrne & Vesk 2000). The orange colour o f the granule s i n H. depressa fro m Lake Burragorang may be du e to wate r chemistr y rather tha n bein g a species-specifi c characte r (Byrne & Ves k 2000) . Examinatio n o f specimen s from Fe-poo r environment s is required to confir m this. Interestingly , th e Fe-poo r gil l an d Fe-ric h midgut granule s i n th e unioni d Anodonta cygnea zellensis (Gmelin, 1791 ) are white and dark brown, respectively (Pynnone n e t al 1987) . Hig h F e a s

Fig. 4 . STE M of cryo-prepared mantl e tissu e [(a ) and (b) ] and TEM o f chemically fixe d mantl e [(c) , (e) and (h)] and gonad [(f ) an d (g) ] tissue, (a ) an d (b) Cluste r o f electron-dense calciu m phosphat e granule s and adjacen t S-rich (S ) granules, (c ) Small grou p o f granules (G ) surrounded b y cell processe s (P) . (d) Connectiv e tissu e cells giv e rise to processes (P) that extend throug h th e interstitia l space. N, nucleus , (e ) Dense an d (f ) annulated granule s i n fixe d tissue. Intracellula r annulated granule s being : (g ) broken down ; o r (h) synthesize d fo r release. Scale bars : (a ) 5.0 um ; (b) 0.4 um; (c ) 4.0 um; (d ) 1. 0 um; (e ) 0.8 um; (f ) and (h) 0.2 jam; (g) 0.5 um .

CALCIUM GRANULE S I N TH E TISSUE S O F HYRIDELLA DEPRESSA

seen in the granules of H. depressa, however , does not appea r t o b e typica l o f tissu e granule s i n th e Unionoida. The presenc e o f calciu m granule s i n th e interstitial tissue s o f Hyridella depressa an d othe r hyriids, including two Velesunio specie s (Jeffre e & Simpson 1984; Colville 1994; Vesk & Byrne 1999), is simila r t o tha t describe d fo r unioni d an d margaritiferid mussel s (Petit et al. 1980 ; Machado et al . 1988) . Lik e H . depressa, Margaritifera margaritifera (Linnaeus , 1758 ) ha s extensiv e aggregations of calcium granules in the mantle and few granule s i n th e gil l (Isti n & Mason i 1973; Pekkarinen & Valovert a 1997) . Thi s differ s fro m the patter n describe d fo r severa l unionids , including Anotonta an d Ligumia species , wher e granules occur in their highest concentrations in the gills an d ar e no t abundan t in th e mantl e (Istin & Masoni 1973 ; Silverman e t al 1985 ; Pynnonen et al 1987 ; Silverman 1988) . I n unionids , calciu m granules accoun t fo r 20-50 % o f th e dr y tissu e weight o f th e gill s an d granul e calcium stores ar e mobilized fo r larva l shel l formatio n (Silverma n e t al 1985 ; Pynnonen et al 1987 ; Silverman 1988) . By contrast , th e paucity of granules i n the gills of H. depressa suggest s that they are not a significant source o f calciu m fo r hyrii d glochidia . A simila r conclusion wa s reache d fo r M . margaritifera (Pekkarinin & Valoverta 1997). It is not known if the similarities an d difference s in granul e distributio n i n hyriids , margaritiferid s and unionid s ar e taxo n specifi c but , i f so , th e granules may be a useful characte r in phylogenetic analyses. I n recen t time s th e phylogeneti c relationships in the Unionoida have been examined

335

using a numbe r o f molecula r an d morphologica l characters, an d inclusion o f the Hyriidae has bee n important i n assessin g clad e relationship s (Gra f 2000). The calciu m granule s o f Hyridella depressa varied i n th e exten t t o whic h annulation s wer e evident i n chemicall y fixe d tissue s prepare d fo r TEM, while annulations were not evident in cryoprepared tissue s prepared fo r STEM. Paired X-ray microanalyses o f granule s i n fixe d an d cryo prepared mantl e tissu e fro m individua l mussel s revealed tha t th e granule s loos e a substantia l proportion o f thei r elements , particularl y Ca , o n exposure t o a n aqueou s mediu m an d gai n othe r elements, b y transfer , i n th e waterbat h (Ves k & Byrne 1999) . Thi s suggest s tha t som e o f th e differences i n calciu m granul e structur e i n chemically fixed an d cryo-prepared tissues may be an artifact due to element loss or redistribution. Th e lighter annulations seen in granules in fixed tissues may be due to the loss of electron-opaque elements from regions where they are less tightly bound. In a previous study, granules in chemically fixe d gona d tissue o f H . depressa wer e note d t o b e mor e distinctly annulate d compare d wit h thos e i n th e mantle (Adam s et al 1997) . A comparative study of th e structur e an d elementa l profil e o f calciu m granules i n cryo-prepare d gill , gona d an d mantl e tissues i s require d t o determin e i f the y exhibi t tissue-specific differences . Considerin g th e different physiologica l roles o f these tissues, some differences betwee n thei r granule s migh t b e expected. The form o f phosphate varie s i n differen t type s of calciu m phosphat e granule s an d i s crucia l t o

Fig. 5 . Typical energy dispersive X-ra y spectrum from a calcium phosphate granul e in Hyridella depressa mantl e tissue. Note characteristic P, Ca and Fe peaks (th e Ni peak is due to the support grid).

336

M. BYRNE

granule solubility , and thei r physiological role s a s calcium store s an d detoxificator y sink s fo r trac e elements (Jeffre e e t al. 1993 ; Maso n & Jenkin s 1995; Langston et al. 1998) . In Hyridella depressa, all th e mantl e granule s examine d ha d a simila r elemental profile and appeared to comprise a single type o f granule . Althoug h th e abundanc e o f granules i n th e mantl e wit h it s extensiv e bloo d supply suggest s tha t the y ma y functio n a s solubl e calcium stores , th e presenc e o f a rang e o f othe r elements i n th e granules , includin g trac e metals , suggests that they also play a role in detoxification. The granule s of H. depressa ar e known to contain orthophosphate and/o r hydrogen phosphate (Jeffre e et al. 1993) , whic h suggest s tha t they are unlikely to be remobilized (Langsto n e t al. 1998) . I t would be useful t o determine the phosphate species in the mantle, gil l an d gona d granule s o f H . depressa t o gain insights into their potential functions . The presenc e o f granule s i n variou s stage s o f synthesis an d degradatio n i n th e cytoplas m o f connective tissu e cell s o f Hyridella depressa i s similar to that reported for several unionids (Petit et al 1980 ; Silverma n e t al 1989) . Thes e cell s have been variousl y calle d concretion-formin g cells , calcium cells , phagocyte s an d amoebocyte s (Peti t et al 1980 ; Machad o e t al 1988 ; Silverma n e t a l 1989). Lik e thes e cell s i n H . depressa, granule containing cell s i n othe r freshwate r mussel s ar e variable i n for m an d hav e numerou s processes . They ar e suggeste d t o b e derive d fro m a n amoebocyte-like stem cell (Silverma n e t al 1989) . In H . depressa, th e granule-containin g connectiv e tissue cells appea r to play a major rol e a s a site for nucleation an d initia l developmen t o f calciu m granules. The y als o functio n i n th e phagocyti c breakdown o f th e granules . Afte r newl y forme d granules are released int o the extracellular compart ment, their composition and size is likely to change in respons e t o th e elementa l environmen t i n th e tissues and to the ionic exchange mechanisms. The different size s of the calcium granules in the tissues of H . depressa suggest s tha t thei r post-releas e phase involves changes i n size and composition i n a dynami c interactio n betwee n the m an d th e surrounding tissues . Detail s o f th e processe s underlying granule formation , releas e an d post release change , however , wer e no t eviden t i n th e sectioned tissue s o f H. depressa. A s see n her e fo r H. depressa, th e connectiv e tissu e cell s o f freshwater mussel s often contai n a number of other electron-dense inclusions which diffe r i n structure from th e calcium granules (Machado et al. 1988) . The extensiv e contributio n o f calciu m granule s to th e bod y mas s o f freshwate r mussel s an d thei r ability t o sequeste r a rang e o f element s ha s generated interes t i n th e granule s fo r studie s o f metal pollutio n (Jeffre e & Simpso n 1984 ;

Pynnonen et al 1987 ; Silverman et al 1987 ; Byrne & Vesk 1996 , 2000; Vesk & Byrne 1999). Although less abundant , S-ric h lysosoma l granule s als o occurred i n th e tissue s o f Hyridella depressa. The high S conten t o f thes e structure s an d thei r incorporation of trace metals suggest s they contain metallothioneins (metal-bindin g proteins ) whic h function i n detoxification (Maso n & Jenkins 1995 ; Vesk & Byrne 1999) . Bot h the calcium- an d S-ric h granules functio n a s element-uptak e site s i n H . depressa, an d provide focal structure s for analyses of elemen t dynamic s an d accumulatio n i n th e tissues (Byrne & Vesk 1996 ; Ves k & Byrne 1999) . Although th e presenc e o f extensiv e calciu m granule deposits i s a unique feature of biominerali zation i n th e Unionoida , th e rational e underlyin g production o f wha t appea r t o b e exces s calciu m stores b y thes e bivalve s i s no t understood . Suggestions for the function o f the granules include calcium homeostasis , biomineralization , detoxifi cation o f harmfu l element s an d a s calciu m store s for glochidia l shel l formatio n (Peti t e t a l 1980 ; Silverman e t a l 1985 , 1987 ; Maso n & Jenkin s 1995). The y ma y als o b e a by-produc t o f ioni c regulation o r biomineralizatio n processe s i n th e Unionoida associate d wit h th e highl y efficien t calcium-uptake syste m thes e bivalve s evolve d i n conjunction wit h colonizatio n o f freshwate r environments. P. Vesk , A . Cerra , S . Adam s an d P . Selvakumaraswam y provided assistanc e in th e laborator y an d in th e field . R . Smith assiste d wit h photography . Staf f o f th e Electro n Microscope Unit , Universit y o f Sydney , ar e thanke d fo r expert advic e an d provisio n o f facilities , particularl y D r C. Nockolds. Special thanks to I. Wright an d G. Capararo, Catchment Services , Sydne y Wate r Corporation , fo r providing boa t acces s an d fiel d support . Numerou s div e buddies assiste d an d specia l thank s goe s t o G . Hunter . This stud y wa s supporte d b y th e Ne w Sout h Wale s Government throug h it s Environmenta l Trust s an d th e Australian Researc h Council .

References ADAMS, S . M. , SHOREY , C . D . & BYRNE , M . 1997 . A n ultrastructural an d microanalytica l stud y o f metal ion content i n granular concretions of the freshwate r mussel Hyridella depressa. Micron, 28 , 1-11. ALLISON, H . E & SIMPSOM , R . D . 1989 . Element concentrations i n the freshwater mussel, Velesuni o angasi, i n th e Alligator Rivers Region. Technica l Memorandum 25 . Supervisin g Scientis t fo r th e Alligator River s Region , Australia n Governmen t Publishing Services, Canberra . BYRNE, M . 1998 . Reproductio n o f rive r an d lak e populations o f Hyridella depressa (Unionacea : Hyriidae) i n Ne w Sout h Wales : Implication s fo r their conservation . Hydrobiologia, 389(38) , 29-43. & VESK , P . A. 1996 . Microanalysi s o f element s i n

CALCIUM GRANULE S I N TH E TISSUE S OF HYRIDELLA DEPRESSA granules i n Hyridella depressa (Bivalvia) : multivariate analysi s an d biomonitorin g potential . Australasian Journal o f Ecotoxicology, 12 , 91-97. & 2000 . Elementa l compositio n o f mantl e tissue granule s i n Hyridella depressa (Unionida ) from th e Hawkesbury-Nepea n Rive r syste m Australia: Inference s fro m catchmen t chemistry . Marine an d Freshwater Research, 51, 183-192. COLVILLE, A. E. 1994 . Comparison of granular structures and chemistry, and growth rates, in the freshwater bivalves Hyridella depressa, Hyridella australis and Velesunio ambiguus from th e Nepean River. MS c Thesis, University of Technology, Sydney. GRAF, D . L . 2000 . Th e Etheriode a revisited : a phylogenetic analysi s o f hyrii d relationship s (Mollusca: Bivalvia: Unionoida) of North America . Journal ofMolluscan Studies, in press. GREEN, R . H. 1980 . Role o f a unionid clam population in the calcium budget o f a small arti c lake . Canadian Journal o f Fisheries an d Aquatic Sciences, 37 , 219-224. ISTIN, M . & MASONI , A . 1973 . Absorptio n e t redistribution d u calciu m dan s l e mantea u de s lamellibranches e n relatio n ave c l a structure . Calcified Tissue Research, 11, 151-162. JEFFREE, R . A . & SIMPSON , R . D . 1984 . Radium-226 i s accumulated in calcium granules in the tissue of the freshwater mussel , Velesunio angasi: suppor t fo r a metabolic analogu e hypothesis . Comparative Biochemistry an d Physiology, 79A, 61-72. , MARKICH, S. J. & BROWN , P . L. 1993 . Comparative accumulation o f alkalin e eart h metal s b y tw o freshwater musse l specie s fro m th e Nepea n River , Australia - consistenc y an d a resolve d paradox . Australian Journal of Marine and Freshwater Research, 44, 609-634. JUPITER, S . D . & BYRNE , M . 1997 . Light an d scannin g electron microscop y o f th e embryo s an d glochidi a larvae o f th e Australia n freshwate r bivalv e Hyridella depressa (Hyriidae) . Invertebrate Reproduction an d Development, 32, 177-186. KIERNAN, J.A . 1981 . Histological an d Histochemical Methods: Theory an d Practice. Pergamo n Press , New York. LANGSTON, W . J., BEBIANNO , M. J . & BURT , G . R . 1998. Metal handlin g strategie s i n molluscs . In : LANGSTON, W . J . & BEBIANNO , M . J . (eds ) Metal Metabolism i n Aquatic Environments. Chapma n & Hall, London, 219-283. MACHADO, J. , CASTILHO , E , COIMBRA , J. , MONTEIRO , E. , SA, C . & REIS , M . 1988 . Ultrastructura l an d cytochemical studie s i n th e mantl e o f Anodonta cygnea. Tissue & Cell, 20, 797-807. MARKICH, S. J. & BROWN, P. L. 1998. Relative importance of natural and anthropogenic influences on the fres h

337

surface water chemistry o f the Hawkesbury-Nepean River, south-easter n Australia . Th e Science o f th e Total Environment, 217, 201-230. MASON, A . Z . & JENKINS , K . D . 1995 . Meta l detoxification i n aquatic organisms . In: TESSIER , A . & TURNER , D . R . (eds ) Metal Speciation an d Bioavailability i n Aquatic Systems. Joh n Wile y & Sons, New York, 479-589. NALEPA, T. E, GARDNER , W. S . & MALCZYK , J. M . 1991. Phosphorus cycling b y mussel s (Unionidae : Bivalvia) i n Lak e St . Clare . Hydrobiologia, 219 , 239-250. PEKKARINEN, M . & VALOVERTA , I . 1997 . Histochemical and x-ray studies on tissue concretions an d shells of Margaritifera margaritifera (Linnaeus) . Journal o f Shellfish Research, 16, 169-177 . PETIT, H. , DAVIS , W . L , JONES , R . G . & HAGLER , H . K . 1980. Morphologica l studie s o n th e calcificatio n process i n the fresh-water mussel Amblema. Tissue & Cell, 12, 13-28 . PYNNONEN, D. A., HOLWERDA, D. I. & ZANDEE, D. 1.1987. Occurrence o f calciu m concretion s i n variou s tissues of freshwater mussels , an d their capacity fo r cadmium sequestration . Aquatic Toxicology, 10 , 101-114. SILVERMAN, H . 1988 . For m an d functio n o f calciu m concretions i n unionids . In : CRICK , R . E . (ed. ) Origin, Evolution and Modern Aspects of Biomineralization i n Plants an d Animals. Plenu m Press, Ne w York, 367-384 . , MCNEIL , J. W. & DIETZ, T. H. 1987 . Interaction o f trace metals Zn, Cd and Mn, with Ca concretions i n the gill s o f freshwate r unioni d mussels . Canadian Journal o f Zoology, 65, 828-832. , STEFFENS, W . L. & DIETZ, T. H. 1985 . Calcium from extracellular concretion s in the gills of a freshwater unionid musse l i s mobilize d durin g reproduction . Journal o f Experimental Zoology, 236, 137-147. , RICHARD , P . E. , GODDARD , R . H . & DIETZ , T . H . 1989. Intracellular formation of calcium concretion s by phagocyti c cell s i n freshwate r mussels . Canadian Journal o f Zoology, 67 , 198-207. STANDARD, J . C . 1969 . Hawkesbury sandstone . Journal of th e Geological Society o f Australia, 16 , 407^15. VESK, P . A . & BYRNE , M . 1999 . Metal level s i n tissu e granules o f th e freshwate r bivalv e Hyridella depressa (Unionida ) fo r biomonitoring : th e importance o f cryopreservation . Th e Science o f th e Total Environment, 225, 219-229. WALKER, K . F., BYRNE , M., HICKEY, C. W. & ROPER, D . S . 2000. Freshwater mussel s (Hyriidae , Unionidae) of Australasia. In : BAUER , G . & WACHTEL , K . (eds) Ecology and Evolution of the Freshwater Mussels Unionoida. Springer , Berlin, in press.

This page intentionally left blank

Teranota an d its implications on anomalodesmatan phylogeny NICOLE S. ROGALLA & MICHAEL R. W. AMLER Institutfur Geologic und Paldontologie der Philipps-Universitat Marburg, Abteilung Invertebraten-Palaontologie, Hans-Meerwein-Strasse, 35032 Marburg, Germany (e-mail: rogalla@ mailer.uni-marburg.de & amler@ mailer.uni-marburg.de) Abstract: Bedde d carbonaceou s siltstone s fro m th e Bueche l Subformatio n o f th e Bergisch Gladbach-Paffrath Syncline , Germany , o f Middle Devonian (Middl e Givetian) ag e have yielde d a remarkable sampl e o f extremel y elongated , articulate d bivalve s preserve d i n lif e orientation . The specimens are associated with a single left valv e embedded horizontally in the bedding plane and further isolated but articulated shells . Combining th e information give n by the specimens and the palaeobiologica l interpretation s allow s th e reconstructio n o f the complet e morpholog y an d probable life habits. Th e very distinc t morphologica l features le d to the erection of a new taxon , Teranota ebbighauseni Rogall a & Amler, 2000, provoking discussio n o n habitats, lif e habits and evolutionary trend s i n anomalodesmata n bivalves . A combinatio n o f character s typica l o f th e orthonotids an d th e modiomorphids , a s well a s the preserve d lif e positio n a t a n angl e o f som e 60-70° relative to the bedding plane, suggest s tha t these specimens were par t o f a minor branch off th e mai n evolutionar y lineage s withi n th e Anomalodesmata . I t i s propose d tha t thes e animals represent a convergent line of endobenthic bivalves distantl y related to true siphonat e forms.

A large slab of carbonaceous siltstone has yielded specimens o f elongate d bivalves which have been described a s th e ne w genu s an d ne w specie s Teranota ebbighauseni Rogall a & Amler , 200 0 (Fig. 1) . The extraordinarily well-preserve d speci mens ar e embedde d i n lif e orientatio n an d allo w interpretation o f life habits and evolution (Rogall a & Amle r 2000) . Accordingly , discussio n o n th e systematic positio n o f orthonoti d bivalve s withi n higher systematic categories, previousl y debated in Pojeta (1971, 1978 , 1986, 1987) , Runnegar (1974), Pojeta & Gilbert-Tomlinso n (1977) , Pojet a & Runnegar (1985) , Bradsha w & McCarta n (1991) , Morris el al (1991) , Johnsto n (1993) , Amle r (1999) an d Bradsha w (1999) , i s reinvestigate d in this study.

Fossil material Altogether, six specimens of differing preservation (internal an d externa l moulds, shelly material , all incomplete, tw o conjoined ) wer e collecte d b y D r Volker Ebbighausen , Odenthal , Germany , fro m fine-grained sandstone s an d siltstone s o f th e Buechel Subformatio n o f th e Bolsdor f Formatio n of lat e Middl e Givetia n age . The localit y i s a temporary outcro p nea r Bergisch-Gladbac h (R77140, H52580 , geologica l ma p 1:25 000, Sheet 4908 Burscheid) , situate d i n th e Bergisch -

Gladbach-Paffrath Synclin e o f th e Rheinische s S chief ergebirge northeas t o f Cologn e (Koln) . The materia l i s kep t i n th e collectio n o f th e Naturkunde Museu m Berli n (collectio n no . MB.M.1169-1171).

Morphology The combination of all the information given by the specimens in life position accompanie d by isolate d but articulated shell s allowe d the reconstruction of the complet e morpholog y [Fig s 2-6 ; se e als o Rogalla & Amle r (2000)] . Th e mos t distinctiv e morphological feature of Teranota ebbighauseni is the unusua l lengt h o f th e shell s o f > 1 5 cm. A heightlength rati o o f 1:1 0 anteriorl y an d 1: 5 posteriorly indicate s an increase in height towards the posterior , where the valve s gape permanently. This gap e i s accentuate d a s th e valve s becom e concave towards the posterior margin. The ventral margin, otherwis e straight , bear s a ver y shallo w sinus antero-ventrally . Th e minut e umbone s ar e placed i n th e anterio r sixt h o f th e dorsa l margin, which i s ver y lon g an d straight . Th e adducto r muscle scars are interpreted as being anisomyarian. The anterio r sca r form s a dee p impressio n i n th e shell and the posterior sca r is apparently larger, but weakly developed. Th e hinge margin is edentulous and no t thickene d a s a hinge plate ; externally , a n

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177, 339-346. 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

340

N. S . ROGALL A & M . R . W . AMLER

Fig. 1 . Slab of carbonaceous siltston e fro m th e Buechel Subformatio n (Middl e Givetian , Germany ) wit h thre e specimens of Teranota ebbighauseni Rogalla & Amler, 2000, preserved in life position. Scale bar, 5 cm.

elongate opisthodetic , parivincula r ligamen t i s developed. Th e externa l shel l ornamentatio n consists of sharp commarginal fila, thickened in the posteriormost regio n only , formin g a fe w coars e commarginal rugae . Additionally , on e sligh t anterior ridge , a fe w obscur e radia l furrow s an d oblique radiatin g line s ar e present . Th e radia l anterior ridg e form s th e posterio r borde r o f a shallow depressio n whic h lead s int o th e antero ventral sinus . Thus , i n externa l vie w th e posterio r

shell region i s slightly raised abov e the anterior. In cross-section th e shel l i s separate d int o a n umbonally inflated but ventrally narrowing anterior portion an d a wider but flattened posterior one (se e Figs 3 and 6).

Palaeobiology Some of the studied specimen s ar e preserved i n life orientation bu t there is only limited evidenc e abou t

Fig. 2 . Teranota ebbighauseni Rogalla & Amler, 2000, holotype, right valve, internal moul d and remains o f shell, damaged anteriorly and posteriorly. Scale bar, 5 cm.

TERANOTA AN D IT S IMPLICATION S ON ANOMALODESMATA N PHYLOGEN Y

341

Fig. 3 . Teranota ebbighauseni Rogall a & Amler, 2000, paratype. (a) Right valve latera l view; (b ) dorsal view wit h preserved parivincula r ligament . Scal e bar, 5 cm.

the former burrowing depth of the anima l (Fig. 1) . Nevertheless, thi s typ e o f preservation , combine d with morphologica l reconstruction , ca n yiel d information abou t relationship s betwee n th e animals and the substrate-water interfac e (Fig. 7). The specimen s found embedde d i n lif e positio n are orientate d a t angle s o f 60-70° t o th e substrate surface, inferrin g a n endobenthi c mod e o f life . Most Palaeozoi c endobenthi c tax a ar e recognize d as possessin g elongate d valves , a byssa l sinus , a reduced bu t rounde d anterio r area , a tendenc y towards anisomyaria n musculatur e an d a lac k o f ventral flattenin g (Stanle y 1972) . I n Teranota, th e very shallow sinus in the antero-ventral margin also indicates byssa l attachment . A s ther e i s n o indication o f a byssal sli t within the ventra l commissure, it can be assumed that the development of the byssus , a s i n man y endobyssat e forms , ma y have bee n quit e weak . Th e shallo w ventra l sinus further narrow s the tapering anterio r shel l portion , hence, th e foo t wa s rathe r small , an d probabl y

incapable o f advance d an d rapi d burrowing . Th e shape o f suc h elongat e endobenthi c tax a doe s no t allow rotational movements during burrowing as in ovate tax a lik e moder n veneroids . Th e possessio n of a permanent anterior shell gape, e.g. as in Recent members o f Ensis, allow s th e anima l t o burro w parallel to its long axis (Stanley 1970) . In contrast, Teranota doe s no t posses s a n anterio r gap e and , additionally, th e reduced anterio r region , a s well as the attachment sit e of the anterior adductor muscle , suggests that the foot extruded obliquely t o the long axis o f th e shell . Thi s featur e account s fo r th e observed lif e orientatio n an d agree s wit h th e observations o f Stanle y (1972 ) o n postulate d lif e habits i n modiomorphids , pholadomyoid s an d semi-infaunal mytiliids . Possessio n o f a byssu s would have stabilized the shell in the substrate and supported th e wea k foo t i n th e burrowin g process (Runnegar 1974) . Th e narrow anterior shel l cross section may have been advantageous fo r the animal in cutting through the substrate. Where the margins

Fig. 4 . Teranota ebbighauseni Rogall a & Amler, 2000, paratype right valve internal mould. Scale bar in mm.

342

N. S . ROGALL A & M. R . W . AMLER

Fig. 5 . Teranota ebbighauseni Rogall a & Amler, 2000, paratype lef t valve shel l specimen, partly crushed . Scale bar in

mm.

of the valves are subparallel and become concave to form the pronounced posterior gape, that part of the shell mus t hav e protrude d fro m th e sedimen t surface a s i t canno t hav e bee n seale d b y th e periostracum (Morris e t al. 1991) . Due to the risks of engulfmen t and , conversely , th e risk o f bein g winnowed out, and its weak burrowing action, it is suggested her e tha t th e environmen t wher e Teranota live d wa s cal m an d tha t sedimen t input and movemen t were reduced , s o consequently, no strong currents occurred. Thi s opinion is supporte d by th e grai n siz e o f the surroundin g sedimen t an d the overall sedimentar y sequence . Pojeta (1978) an d Bradshaw & McCartan (1991 ) argued that orthonotids could have possessed shor t siphons. Th e presen t author s d o no t subscrib e t o this poin t o f view , especiall y fo r th e endobyssat e taxa. O n the one hand, endobyssate lif e habit s and

the possessio n o f siphon s ar e mutuall y exclusiv e (Stanley 1972) , o n th e othe r hand , siphon s ar e produced throug h mantl e fusio n an d thi s di d no t appear unti l later i n the Palaeozoi c (Stanle y 1968 , 1972; P . A. Johnsto n pers . comm.) . Althoug h th e presence o f ver y shor t siphon s i s no t necessaril y indicated by a sinuate pallial line, there is no single evidence of definite sinupalliate orthonotids i n th e fossil record .

Systematic positio n an d discussion Any attemp t t o link the specimens wit h previously described specie s o f elongated Palaeozoi c bivalve s must includ e a genera l discussio n o f th e morphology an d evolutio n o f 'sword-shaped ' bivalves i n th e Earl y an d Middl e Palaeozoic . Palaeozoic posteriorl y elongate d bivalve s hav e

Fig. 6 . Teranota ebbighauseni Rogall a & Amler, 2000. (a) Reconstruction of left valve morphology and external ornamentation; (b) cross-section through complete shell in anterior area; (c) cross-section in posterior area.

TERANOTA AN D IT S IMPLICATION S ON ANOMALODESMATA N PHYLOGEN Y

Fig. 7 . Life orientatio n of Teranota ebbighauseni Rogalla & Amler, 2000, reconstructed after preserved specimens show n i n Fig. 1 .

been classifie d a s bein g member s o f th e Isofilibranchia, th e Heterodont a o r th e Anomalodesmata (e.g . Pojet a 1971 , 1978 , 1986 , 1987; Runnega r 1974 ; Morri s e t al 1991) . Th e systematic positio n an d ran k o f thes e tax a i s difficult to unravel because most higher taxa are not characterized b y generall y accepte d autapo morphies and , therefore, lac k adequat e differentia l diagnoses. Additionally , morphologica l character s have been weighted differentl y b y various authors, leaving difficultie s i n phylogeneti c relationship s unresolved. Teranota seem s t o combin e character s o f orthonotids and elongat e modiomorphids . The development o f a ventra l sinu s an d th e distinc t posterior increase in shell height are modiomorphid characters (se e als o Pojet a 1987) , wherea s th e elongate shel l form , th e anterio r shel l shape , th e ligament an d th e externa l ornament , consistin g o f radial an d diagonal lines an d furrows, ar e feature s exhibited by the orthonotids. Based o n th e morphologica l feature s describe d above, th e preserve d lif e orientatio n an d phylogenetic lineages , Teranota i s classifie d a s a member of the Family Orthonotidae Miller, 187 7 in the Superfamil y Pholadomyoide a (King , 1844 ) Gray, 184 7 [Orde r Pholadomyoid a Newell, 1965 , Superorder Anomalodesmat a Ball , 188 9 (1899) ] [for general bivalve classification see Amler (1999) and Cope (1996, 199 7 an d refs cited therein)]. The position of the orthonotids has been a matter of debat e fo r decades . Newel l (1969a ) place d orthonotids, e.g . th e gener a Orthonota an d Palaeosolen, in the Anomalodesmata; Cymatonota was regarde d a s membe r o f th e Modiomorphida e (Newell 1969£) . Pojet a (1971) , i n hi s revie w o f Ordovician bivalves , followe d thi s assignment . In

343

contrast, Runnegar (1974) rejected this opinion and excluded orthonotid s fro m th e Anomalodesmata , considering th e solenifor m gener a t o b e ancestra l Solenoidea, thu s belonging to the Heterodonta; thi s was supporte d b y Pojet a & Gilbert-Tomlinso n (1977). Pojet a (1978 ) accepte d th e separat e position o f the solenifor m orthonotid s an d erecte d the Subclass Orthonotia Pojeta, 1978 , includin g the genera Cymatonota, Orthodesma, Palaeosolen, Psiloconcha, Orthonota, Solenomorpha, Prothyris and a new, unnamed genus. Later, he included th e group in the Subclass Isofilibranchi a (Pojet a 1986 , 1987). Thi s procedur e wa s no t followe d b y late r authors an d mos t recen t classification s plac e th e Orthonotidae i n th e Anomalodesmat a [Amle r 1999; se e Johnsto n (1993 ) an d Bradsha w (1999 ) for extensiv e discussion] . Morri s e t al . (1991 ) argued tha t placin g orthonotid s withi n th e Anomalodesmata woul d onl y b e a matte r o f convention, as they share no synapomorphie s with this group . Consequently , thos e author s regarde d the group as a separate order; the Orthonotoida. At the generic level, Teranota is morphologicall y and phylogenetically closely linked with Orthonota Conrad, 184 1 (typ e specie s O . undulata Conrad , 1841). Bot h shar e th e elongat e shel l shap e an d similar shel l proportions . Th e relativel y highe r shell o f Teranota ha s le d t o difference s i n th e position o f ventra l an d dorsa l margin s compare d with Orthonota: wherea s ventra l an d dorsa l margins run parallel in Orthonota, in Teranota they diverge in a posterior direction . Furthe r differences are the stronger development of diagonal ridges and a narrow sulcus in several species o f Orthonota, but those may serve as diagnostic features a t species or subgenus levels only. The shel l ornamentatio n of Cymatonota Ulrich , 1893 (typ e specie s C . typicalis Ulrich , 1893 ) consists o f growt h lines onl y (Pojet a 1971) . Thi s total lack of radial element s differ s fro m th e abov e mentioned taxa. The main diagnostic feature i s the presence o f a broa d latera l sulcu s leadin g t o a central ventra l sinus; both ar e generall y absen t i n Orthonota Conrad , 184 1 an d hav e a completel y different form in Teranota. In addition, both ventral and dorsa l margin s ru n nearl y parallel , an d th e umbones ar e broa d an d prominent . Pre-Devonia n members o f Cymatonota posses s posteriorl y diverging dorsal and ventral margins which may be ancestral. Some authors have assigned Cymatonota as ancestral to Orthonota (Pojeta 1971 ; J. G. Carter pers. comm.). A generall y accepte d diagnosi s i s not , a s yet , present for species of Palaeosolen Hall, 188 5 (type species Orthonota siliquoidea Hall , 1870) . Th e various specie s ar e characterize d b y a n elongat e shell shape and nearly terminally situated , flattened umbones (se e als o Beushause n 1895) . Quit e

344

N. S . ROGALLA & M . R . W . AMLER

distinct from Teranota is the truncated anterior shel l portion an d th e anteriorl y an d posteriorl y gapin g valves (Driscol l 1965 ; Bradsha w & McCarta n 1991). Th e dorsal an d ventral margins run parallel to eac h other . Th e externa l shel l ornamentatio n consists o f commargina l growt h line s whic h coarsen posteriorly. In addition, P. chapmani and P. costatus bea r externa l radia l elements , wherea s P. frontisocurvus show s radia l element s onl y interiorly. I n P. quadrangularis a single, plate-lik e cardinal tooth is developed i n each valve, ventrally supported by a buttress. Shells o f th e genu s Solenomorpha Cockerell , 1903 (typ e specie s S . minor M'Coy , 1844 ) ar e distinctly elongate an d differ fro m al l other taxa as well a s Teranota b y thei r posteriorl y taperin g shells. Th e nasut e anterio r shel l portio n wit h a concave antero-dorsal margin, e.g. in S. minor, and a convex ventral margin, e.g. in S. dorsocurva an d S. scalpriformis, distinguis h the m fro m T . ebbighauseni. Johnsto n (1993 ) postulate d th e presence of posteriorly gaping valves. Superficially, member s o f th e followin g gener a may resembl e th e studie d specimen s i n gros s morphology, bu t diffe r largel y i n thei r shel l shap e by bein g mor e compac t rathe r tha n strongl y elongate. Member s o f Sphenosolen Pojet a & Gilbert-Tomlinson, 197 7 (typ e specie s S . draperi Pojeta & Gilbert-Tomlinson , 1977 ) sho w a shel l posteriorly increasin g i n heigh t lik e Teranota, bu t shell proportion s ar e no t simila r an d n o externa l radial ornamentation is developed . The generi c nam e Spathella Hall , 188 5 (typ e species S . typic a Hall , 1885 ) ha s bee n use d fo r bivalves wit h elongate d cylindrica l shell s an d distinctly develope d commargina l ornamentation , but withou t a n increas e i n shel l heigh t i n th e posterior direction . Detaile d shel l character s ar e largely unknow n in thi s taxon, which presently i s placed in the modiomorphids (Amler 1996) . Sanguinolites M'Coy , 184 4 (typ e specie s S . discors M'Coy , 1844) , recentl y revise d b y Morri s et al. (1991) , exhibit s a t least on e ver y prominent diagonal ridge where external shell sculpture bends and strengthens postero-dorsally. Furthe r radial and commarginal ribs and fila may be developed. Some elongated tax a previousl y classifie d a s Sanguinolites ar e no w groupe d i n Pleurophorella Girty, 190 4 (typ e species P. papillosa Girty , 1904 ) and Siliquimya Morris , Dickin s & Astafieva Urbaitis, 199 1 (typ e species Sanguinolaria plicata Portlock, 1843) , bu t thes e diffe r markedl y fro m Teranota du e to their 'sword-shaped ' outline . Although considere d b y som e author s t o b e closely related to the above (Runnegar 1974; Pojeta 1978; Bradshaw 1999) , th e genera Prothyris Meek (1869), 1871 and Citothyris Ruzicka & Rehor, 1964 (see Amler 1996 ) ar e here considere d t o belong t o

a separate branch of anomalodesmatans. Thes e taxa have a quit e distinc t synapomorph y - a narro w anterior lobe of unknown function. Contrasting morpholog y i s show n b y modiomorphid taxa , which ar e her e considere d t o be member s o f th e Palaeoheterodont a (se e Amle r 1999). Wit h Teranota the y shar e onl y tw o characters, th e distinc t antero-ventra l sinu s i n th e shell margin and a posterior increase in shell height. However, al l known modiomorphids ar e generall y more compac t withou t elongation. Onl y member s of th e genu s Liromytilus LaRoque , 195 0 ar e somewhat elongate d but , a s i n othe r modiomorphoids (an d mytiloids) , slightl y curve d (mytiliform, myaliniform) . Thes e features are here considered t o b e eithe r convergen t t o Teranota o r symplesiomorphies.

Evolutionary relationships Evolutionary relationship s withi n th e earl y Anomalodesmata ar e poorly understood . Base d on morphology, Teranota i s interprete d her e t o b e related t o Orthonota an d Cymatonota. Pojet a (1987) figure d a n unconvincin g Cymatonota fro m the Ordovician whic h could form an early ancestor . No direc t descendent s o f Lat e Devonia n o r Earl y Carboniferous ag e ar e know n fo r Orthonota an d Teranota. Consequently , Teranota i s her e inter preted a s a minor , lo w divers e branc h of f mai n evolutionary line s withi n th e Orthonotidae . I n contrast t o mos t othe r anomalodesmatan s o f th e Palaeozoic, Teranota reache s a n enormou s size , which i s not , per se, a diagnosti c featur e bu t i s worth mentioning , a s i t i s a convergen t characte r shared with Solenomorpha (Anomalodesmata) and, to a lesse r extent , Liromytilus (?Isofilibranchia) . The presenc e o f th e byssu s is her e interprete d a s plesiomorphic retention o f this structure . Teranota probably became extinct near the end of the Middle Devonian o r durin g th e Frasne-Famenn e Crisi s (Kellwasser Event) , a s ther e ar e n o simila r form s known fro m th e highl y divers e Famennia n o r Lower Carboniferou s fauna s (d e Koninc k 1885 ; Beushausen 1895 ; Hin d 1896-1900 ; Amler 1996) . This contrast s wit h th e successfu l surviva l o f Solenomorpha int o the Carboniferous . Apart fro m Solenomorpha, al l othe r elongate d Carboniferou s anomalodesmatans are either edmondiid, sanguinolitid or siliquimyoid in overall shell shape, differin g from Teranota i n severa l characteristic s (a s described above) . Apparently , som e o f the m developed siphon s (e.g. Wilkingia Wilson , 1959 ) as a more advance d ai d to deep burrowing . Thus, the evolutionary pathwa y o f Teranota i s interprete d here a s leadin g int o a blin d alley , a s i t enable d neither faste r o r deepe r burrowing , no r stronge r

TERANOTA AN D IT S IMPLICATION S O N ANOMALODESMATA N PHYLOGEN Y byssal attachment . I t ma y b e regarde d a s on e o f many evolutionar y experiment s o f th e anomalo desmatan bloom of the late Palaeozoic .

Conclusion The specimen s studie d wer e describe d a s a ne w taxon, Teranota ebbighauseni Rogall a & Amler , 2000, becaus e they bear a combination of morphological character s no t know n fro m othe r taxa . Although som e modiomorphoi d feature s ar e present, th e genu s Teranota i s place d withi n th e Anomalodesmata. Th e distinc t combinatio n o f characters suppor t th e hypothesi s o f a commo n ancestor fo r th e Anomalodesmat a an d modio morphoids. Base d o n externa l an d interna l morphology, Teranota i s place d i n th e Famil y Orthonotidae an d i s closel y relate d t o th e Gener a Orthonota an d Cymatonota. Wit h referenc e t o hinge morpholog y an d ligament , Teranota als o supports th e placemen t o f th e Orthonotida e i n th e Superorder Anomalodesmata , confirmin g th e assumption o f previou s authors , althoug h mos t other morphologica l character s o f orthonotid s ar e rather plesiomorphic . Th e mai n evolutionar y line s within th e Anomalodesmat a followe d on e o f tw o pathways - epibenthi c o r endobenthic. Teranota is interpreted a s an endobenthic strategist , suggestin g that thes e evolutionar y pathway s wer e als o followed b y mino r groups . Thes e extremel y elongated shells, which did not occur (again) in the Late Palaeozioc, are interpreted as a (finally) faile d early attemp t t o develo p anatomica l structure s comparable wit h tru e siphons , whic h occurre d convergently som e millions o f years later . We woul d lik e t o than k th e followings : V . Ebbighause n provided u s wit h th e materia l an d transferre d th e specimens t o th e Naturkundemuseu m Berlin , K . Biebe r and K. Schaumann undertook careful preparation ; and A. Weisbrod carrie d ou t th e photographi c work . Finally , Chris Peel improved the final language of the manuscript. Both anonymou s referee s ar e thanke d fo r thei r querie s and suggestions.

References AMLER, M . R . W . 1996 . Die Bivalvenfaun a de s Obere n Famenniums West-Europas , 2 . Evolution , Palao geographie, Palaookologie , Systemati k 2 . Palaeotaxodonta un d Anomalodesmata . Geologica et Palaeontologica, 30, 49-117. 1999. Synoptical classification o f fossil and Recent Bivalvia. Geologica e t Palaeontologica, 33 , 237-248. BEUSHAUSEN, L . 1895 . Di e Lamellibranchiate n de s rheinischen Devo n mi t Ausschlus s de r Aviculiden. Abhandlungen der Ko'niglich Preussischen geologischen Landesanstalt, Neue Folge, 17 , 1-514.

345

BRADSHAW, M . A . 1999 . Lower Devonia n bivalve s fro m the Reefto n Group , Ne w Zealand . Memoirs o f th e Association o f Australasian Palaeontologists, 20 , 1-171. & MCCARTAN , L . 1991 . Palaeoecolog y an d systematics o f Earl y Devonia n bivalve s fro m th e Horlick Formation , Ohi o Range , Antartica . Alcheringa, 15, 1^2. COPE, J . C. W. 1996. The earl y evolutio n of the Bivalvia. In: TAYLOR , J . (ed. ) Origin an d Evolutionary Radiation of th e Mollusca. Oxford University Press, Oxford, 361-370. 1997. Th e earl y phylogen y o f th e clas s Bivalvia . Palaeontology, 40 , 713-746. DRISCOLL, E . G . 1965 . Dimyaria n Pelecypod s o f th e Mississippian Marshal l Sandston e o f Michigan . Paleontographica Americana, 5(35) , 67-128 . HIND, W . 1896-1900 . A monograp h o f th e Britis h Carboniferous Lamellibranchiata , 1 . Palaeontographical Society Monographs, 50-54 , 1-416. JOHNSTON, P. A. 1993 . Lower Devonian Pelecypoda fro m southeastern Australia . Memoirs o f th e Association of Australasian Palaeontologists, 14 , 1-134. KONINCK, L . G . D E 1885. Faune d u Calcair e Carbonifer e de l a Belgique , 5 . Lamellibranches . Annales d u Musee Royal d'Histoire Naturelle d e Belgique, 11, 1-283. MORRIS, N . J. , DICKINS , J . M . & ASTAFIEVA-URBAITIS , K. 1991. Uppe r Palaeozoi c Anomalodesmata n Bivalvia. Bulletin o f th e British Museum (Natural History) Geology, 47(1), 51-100. NEWELL, N . D . 19690 . Family Orthonotidae . In : MOORE , R. C . (ed. ) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6, Volume 2 , Bivalvia. Geological Society o f America an d University o f Kansas Press , N818-819. 1969/7. Orde r Modiomorphoida . In : MOORE , R . C . (ed.) Treatise o n Invertebrate Paleontology. Part N. Mollusca 6 , Volume 1 , Bivalvia. Geological Societ y of Americ a and Universit y of Kansa s Press , N393-N401. POJETA, J . J R 1971 . Revie w o f Ordovicia n pelecypods . US Geological Survey Professional Paper, 695 , 1-46. 1978. The origin and early taxonomic diversification of pelecypods . Philosophical Transactions o f the Royal Society o f London, Series B , 284 , 225-246. (ed.) 1986. Devonian Rock s an d Lower an d Middl e Devonian Pelecypod s o f Guangxi , China , an d th e Traverse Grou p of Michigan. U S Geological Survey Professional Paper, 1394, 1-108. 1987. Clas s Pelecypoda . In : BOARDMANN , R . S. , CHEETHAM, A . & ROWELL , A . J . (eds ) Fossil Invertebrates. Blackwell, Pal o Alto, 365^35. & GiLBERT-ToMLiNSON , J . 1977 . Australia n Ordovician Pelecypod Molluscs . Bureau of Mineral Resources, Geology an d Geophysics Bulletin, 174 , 1-64. & RUNNEGAR , B. 1985 . Th e earl y evolutio n o f diasome Molluscs . In : TRUEMAN , E. R . & CLARKE , M. R . (eds ) The Mollusca, Volume 10 , Evolution. Academic Press, Orlando , 295-336. ROGALLA, N . S . & AMLER , M . R . W . 2000 . Teranota n .

346

N. S . ROGALL A & M . R . W . AMLER

gen. (Bivalvia ; Anomalodesmata ) au s de m Mittel Devon (Givetium ) de s Rheinische n Schieferge birges. Paldontologische Zeitschrift, 74 , 69-73. RUNNEGAR, B . 1974 . Evolutionary history o f th e bivalv e subclass Anomalodesmata . Journal o f Paleontology, 48 , 904-939. STANLEY, S . M . 1968 . Post-Paleozoic adaptiv e radiatio n of infauna l bivalv e mollusc s - a consequenc e of

mantle fusio n an d sipho n formation . Journal o f Paleontology, 42 , 214-229. - 1970 . Relation o f shel l for m t o lif e habit s o f th e Bivalvia (Mollusca). Memoirs o f Geological Society of America, 125, 1^-96. - 1972 . Functiona l morpholog y an d evolutio n o f byssally attache d bivalve d mollusks . Journal o f Paleontology, 46 , 165-212 .

The nature and origin of taxonomic diversity gradients in marine bivalves J. A. CRAM E British Antarctic Survey, High Cross, Madingley Road, Cambridge CBS OET, UK Abstract: Bivalve s hav e bee n fundamenta l i n developin g th e understandin g o f large-scal e biodiversity pattern s i n th e marin e realm . A ne w stud y based o n 2 9 regiona l bivalv e fauna s indicates that both latitudinal an d longitudinal gradients are not s o regular in for m a s was once imagined. Th e norther n hemispher e latitudina l gradien t ha s a marke d step , o r inflection , a t 20-30°N, an d i n th e souther n hemispher e Australi a form s a distinc t diversit y hotspot . A longitudinal gradien t run s betwee n a larg e tropica l hig h diversit y focu s i n th e souther n China-Indonesia-Australia regio n an d a somewha t smalle r on e i n th e Panamic-Caribbea n region. It is unlikely that the marked asymmetry in both latitudinal an d longitudinal gradient s can be explained entirel y by either the geometric patterns of species range s in relation t o geographica l boundaries (the mid-domain effect) o r the operation of contemporary, or equilibrium, factors. The role of history must be considered too, and in some cases this could involve a timescale of at least 60 Ma. For example, Australia has moved progressively northwards throughout the Cenozoic era and thi s seem s t o hav e le d t o th e developmen t o f a uniqu e assemblag e o f bot h tropica l an d temperate tax a aroun d the continent . When Australi a eventuall y collide d wit h southeas t Asia , some 1 5 Ma ago , thre e previousl y distinc t tropica l marin e fauna s wer e brough t int o clos e juxtaposition. However, somethin g els e seem s t o have bee n involve d i n orde r t o generat e a marked pantropical Neogene diversification event in bivalves and other marine invertebrate taxa. It is striking how this event coincided with a prolonged interval of global cooling and the suggestion has been made that glacioeustatic cycles may have promoted the formation of a tropical species diversity pump. In concert with regular and profound sea-level changes, new taxa were created in marginal tropical regions an d then concentrated i n certain core regions. These sam e glacioeustatic cycles may also have served to accentuate the latitudinal limits of many tropical taxa. As th e knowledg e o f large-scal e taxonomi c diversit y gradient s i n th e marin e real m ha s increased, s o too has the realization that they are at least the partial products of major historical events.

Bivalves hav e prove d t o b e on e o f th e mos t undertake n (Crame 2000a). The principal aim here successful group s fo r investigatin g th e natur e an d wa s t o investigat e systemati c change s i n th e origin o f taxonomi c diversit y gradient s i n th e taxonomi c compositio n o f bivalv e fauna s wit h marine realm. Widely distributed in all the world's respec t to latitude. Do all the main group s sho w a oceans, the y hav e bee n th e subjec t o f intens e regula r decreas e i n number s wit h increasin g taxonomic investigations and are known to have an latitude , or i s th e declin e more dramati c i n som e extensive fossil record. Early studies, such as those group s tha n i n others ? I n addition , ca n th e by Stehl i e t al (1967 , 1969 ) an d Stehl i (1968) , taxonomi c compositio n o f bivalv e fauna s tel l u s illustrated thei r considerabl e potential i n thi s somethin g abou t th e relativ e age s o f bivalv e respect, an d this has bee n confirme d b y the mor e latitudina l gradients? Twenty-nine regional bivalve recent wor k o f bot h Fless a & Jablonsk i (1995 , fauna s were used in this study (see below) and, as a 1996) an d Cram e (2000a) . Marin e bivalve s sho w prelud e t o th e taxonomi c investigations , som e clear an d stron g latitudina l diversit y gradient s i n genera l comments were made about the form of the each hemisphere, as well as a pronounced pattern of latitudina l gradient in each hemisphere. A degree of longitudinal variation in the equatorial region (e.g. hemispheri c asymmetr y wa s note d bu t it s ful l Stehli et al. 1967 , fig. 3). significanc e wa s not discussed. Similarly, this new In a recent companion paper, a major revision of stud y displayed , bu t di d no t examin e i n detail , a global pattern s i n bivalv e specie s diversit y wa s pronounce d longitudinal gradient. From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177 , 347-360 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

348

J. A . CRAM E

It i s th e intentio n o f thi s pape r t o pa y close r attention t o th e for m o f taxonomi c diversit y gradients in marine bivalves on a global scale , and what this may, in turn, be able to tell us about how they originated. Using the same basic data set as in the previous stud y (Crame 20000), an attempt will be made t o characterize th e latitudina l gradien t i n each hemispher e an d th e overal l longitudina l gradient. If the formation of large-scale taxonomic diversity gradient s i s bein g controlle d b y essentially contemporaneous , o r equilibrium , factors, the n i t migh t b e expecte d tha t the y ar e regular in form. On the other hand, if historical (i.e. evolutionary o r non-equilibrium ) processe s hav e prevailed the n it might be expected tha t both types of gradien t ar e les s regular . Th e relativ e role s o f equilibrium v . non-equilibriu m factor s i n th e generation an d maintenance o f global biodiversit y patterns i s currentl y unde r intens e scrutin y (e.g. Ricklefs 1995) . It shoul d als o b e emphasize d her e tha t a n important recen t serie s o f nul l model s hav e demonstrated ho w significan t taxonomic diversit y gradients ca n b e generate d i n th e absenc e o f environmental gradient s o n eithe r ecologica l o r evolutionary timescale s (Colwel l & Lee s 2000) . These model s ar e based o n a phenomenon known as th e mid-domai n effect , a n emergen t statistica l property o f taxonomicall y define d biotas whereby there i s a n increasin g overla p o f specie s range s towards th e centr e o f a share d geographica l domain. The latitudinal gradient predicted b y such models i s typicall y unimoda l an d bilaterall y symmetrical (Colwell & Lees 2000). Methods Twenty-nine majo r marin e bivalv e fauna s wer e selected t o cove r mos t o f th e principa l shallow water region s o n th e Earth' s surfac e (Tabl e 1) . Region 1 is the Arctic, region 2 9 is the Antarctic, and in between are 27 lower latitude regions within the Pacific, Atlantic and Indian Oceans. Somewhat inevitably, these regions var y substantially in size , but there are no systematic increases or decreases in region are a wit h eithe r latitud e o r longitude . Fo r each region a full systemati c list o f living bivalve species wa s constructe d fro m a variet y o f taxonomic sources. Full details are given in Crame (20000). For this study, the number of species was plotted v. th e mid-poin t latitud e an d longitud e o f eac h region (Fig s 1 an d 2) . T o judg e th e form o f latitudinal diversit y gradients, simpl e curve s were fitted b y eye to an outer envelope o f points in each hemisphere (with some points in the northern hemisphere bein g exclude d fo r reason s give n below ) (Fig. 1) . I n addition , classica l linea r regression s

were performe d o n th e relationshi p betwee n th e number o f specie s an d th e latitud e i n eac h hemisphere. Longitudina l gradient s wer e assesse d by dividing the data points into three basic groups : northern temperat e ( > 32°N), tropica l (32°N 25°S) and southern temperate (> 25°S) (Table 1 and Fig. 2) . A three-dimensiona l mes h plo t wa s als o constructed to assist with the interpretation o f both types of gradient ( Fig. 3). The form of the latitudinal gradien t Northern hemisphere Initial investigations indicated wha t appeared t o be a regula r declin e i n bivalv e diversit y wit h increasing latitud e i n th e norther n hemispher e (Stehli e t al 1967 ; Schopf 1970 ; Valentine 1973) . They were heavily influenced by the seminal study of Stehl i et al (1967) , whic h employed a series of contour-fitting technique s t o ra w dat a fro m 2 6 regional localities . Thes e ver y neatl y picke d ou t two peak s o f tropica l hig h diversit y tha t wer e almost exactl y coinciden t wit h th e Equator , an d then regula r northwar d reductions in th e numbers of species , gener a an d families (Stehl i e t al 1967 , figs 2-8) . Thes e latitudina l gradient s seeme d t o accord well with those known in a number of other marine and terrestrial groups (Stehli 1968) . In a major revisio n of bivalve diversity patterns, Flessa & Jablonsk i (1995 ) plotte d th e globa l distribution of c. 600 genera from 1 4 superfamilies. Their norther n hemispher e gradient , whic h wa s based o n dat a fro m ove r 6 0 localities , strongl y suggested that the decline i n numbers of taxa with increasing latitud e is not i n fac t a s regular a s was previously imagined. Clearly , ther e is a very stee p fall i n values that is approximately coincident with the norther n margi n of the tropics (i.e . 30°N), and thereafter a muc h gentle r declin e (Fless a & Jablonski 1995 , fig.l). Stehl i (1968 , fig s 13B , 33 and 50 ) ha d earlie r commente d o n tw o compar atively smal l marin e gastropod taxa , the cypraeid s and strombid s (Genu s Strombus), tha t seeme d t o show stee p diversit y decline s a t th e tropica l margins, an d Ro y e t a l (1994 , 1996 ) foun d a decidedly steppe d profil e fo r a combine d bivalv e and gastropo d gradien t alon g th e wester n coas t o f North America. In this study, a statistically significan t decline in the number of species wit h increasing latitud e was found i n th e norther n hemisphere , bu t i t i s agai n apparent tha t thi s i s somewha t irregula r (Fig . 1). The outer envelope of points used to assess its form was not placed throug h th e very large valu e (1176 species) for the East China Sea region (32°N ; Table 1) a s thi s diversit y hotspo t ha s bee n displace d substantially northward s by th e warm-wate r Kuro

TAXONOMIC DIVERSIT Y GRADIENT S IN MARIN E BIVALVES

349

Table 1 . Estimate o f th e number of living marine bivalve species i n 29 major regions of th e world Region

No. o f specie s

Mid-point Latitude

Mid-point Longitude

Arctic Norwegian Sea Aleutian Far-eastern Russi a British Isle s NW Atlantic Oregonian Mediterranean East China Sea California Eastern Arabi a Red Se a Caribbean Indonesia-Philippines Panamic Andaman Sea Sri Lank a West Africa East Afric a Brazil Queensland-Northern Territor y Peru-Chile Western Australia South Afric a Eastern Sout h America South Australia New Zealan d Magellan Antarctica

199 268 173 261 319 293 215 318 1176 277 384 416 658 1211 846 369 349 360 255 391 911 177 658 356 148 757 381 119 162

70°N 63°N 58°N 55°N 54°N 48°N 45°N 38°N 32°N 30°N 23°N 20°N 20°N 14°N 10°N 9°N 8°N 4°S 5°S 12°S 20°S 24°S 25°S 31°S 33°S 35°S 41°S 49°S 70°S

_ 2°W 150°W 160°E 3°W 65°W 127°W 22°E 124°E 117°W 54°E 43°E 64°W 120°E 97°W 98°E 78°E 6°W 40°E 43°W 142°E 78°W 119°E 24°E 53°W 139°E 173°E 67°W

Mid-point latitud e and longitud e of each region also shown. Data taken fro m Cram e (2000a).

Fig. 1 . A comparison o f marine bivalve latitudinal gradients in species diversity in the northern an d southern hemispheres. Dat a points taken fro m th e 2 9 localities liste d in Table 1 and curves fitted b y ey e to, essentially, an outer envelope o f points (se e tex t for further details) . Latitudinal range from 80° N t o 80°S. Statistical analysis of the gradients undertake n by performing classical linea r regressions on data fro m th e northern an d southern hemispheres , respectively. In each case , latitud e was held a s the independent variable and the number of species (lo g transformed) as the dependent one. Result s - expresse d a s percentage varianc e accounted for (i.e. the adjusted R2 valu e x 100 ) and a t test on the null hypothesis tha t the regression coefficient (p) = 0 - ar e as follows: norther n hemisphere , 38.4%, t = -3.31*; southern hemisphere, 6.5%, t = -1.33 (* , significant at/7 = 0.05). It should be noted tha t these results could be affected b y the data being, at least to some extent , spatially dependent (or autocorrelated).

350

J. A . CRAM E

Fig. 2. A composite longitudinal gradient in species diversity for marine bivalves. Data points taken from Tabl e 1, with the exceptions o f of the Arctic an d Antarctic, for which no suitable mid-point longitude s ca n be established. A , Northern temperate localities (> 32°N); •, tropica l (32°N-25°S); T, souther n temperate (> 25°S).

Shio Current. Instead, the line of the curve has been set bac k close r t o tha t fo r Indonesia-Philippine s (14°N, 121 1 species ) (Fig . 1) ; whethe r i t shoul d then pas s aroun d thi s poin t an d actuall y decreas e into the lowest northern latitudes is uncertain.

What i s mor e apparen t i s that , fro m a poin t o f origin somewher e betwee n th e East Chin a Se a and Indonesia-Philippines localities , th e curv e fall s very steeply a t c. 20°N. At c. 20-25°N it then level s off abruptly , giving i t a distinct stepped , o r bench-

Fig. 3. Three-dimensional mesh graph to illustrate both latitudinal and longitudinal gradients in species diversit y in marine bivalves. Dat a taken from Tabl e 1 , but Arctic and Antarctic regions exclude d becaus e n o suitable mid-poin t longitudes can be established. Latitudinal range from 80° N to 60°S; longitudinal range from 150° E to 150°W .

TAXONOMIC DIVERSIT Y GRADIENT S IN MARIN E BIVALVES

351

birds (Gaston & Blackburn 1996), deep-sea isopods and gastropod s (Re x e t a l 1993) , an d deep-se a benthic foraminifer a (Culve r & Buza s 2000) , respectively. However, it should be pointed out that in thes e studie s there i s generally less information available from th e highest southern latitudes. In contras t t o thes e previou s investigations , th e curve constructe d throug h th e oute r envelop e o f data point s i n thi s stud y suggest s tha t diversit y values fo r marin e bivalves ar e somewha t lower i n the southern hemisphere (Fig. 1) . It also indicates a considerable degre e o f hemispheri c asymmetry . From the maximu m value s obtaine d in the Queensland-Northern Territor y regio n (20°S , 91 1 species) there is a steep, but by no means vertical, drop in values to the mid- and high-latitude regions. The pronounce d step , o r platform , i s onl y weakl y developed here, but it has to be remembered that , in comparison wit h th e north , ther e ar e fa r fewe r shallow-shelf localities . It would also appear that there may be a genuine drop i n diversit y value s fro m th e Queensland Northern Territor y regio n int o th e thre e lowes t latitude southern hemisphere regions (West Africa , 4°S, 36 0 species ; Eas t Africa , 5°S , 25 5 species ; Brazil, 12°S , 391 species). This part of the curve is only tentativel y complete d i n Fig . 1 becaus e collection failure cannot be ruled out as a reason for these abnormall y lo w value s (Cram e i n 2000#) . However, this may be, at best, only a partial explanation fo r thi s phenomeno n an d i t i s becomin g increasingly apparen t tha t th e thre e Australasia n regions for m a distinc t diversit y 'bulge ' (o r hotspot) in the southern hemisphere (Figs 1 and 3). In contrast to the northern hemisphere, th e declin e in number of species with increasing latitude in the southern hemispher e i s no t statisticall y significan t (Fig. 1) . Southern hemisphere The hug e regiona l variatio n i n souther n Although comprehensiv e dat a set s hav e alway s hemisphere bivalve faunas i s brough t home when been a t a premium , ther e ha s bee n a genera l the overall latitudinal gradient is broken dow n into impression tha t souther n hemispher e latitudina l its componen t part s (Fig . 4) . Ther e i s a shallo w diversity gradients were broadly similar in form t o gradient along the western coast of South America , those known in the north. This was true of both the a somewhat steeper one along the eastern coast and terrestrial an d marin e realms, an d le d t o a widely then, in both cases, a slight rise from the Patagonian held vie w tha t gradient s wer e approximatel y region int o Antarctica . Nevertheless , i t ha s t o b e symmetrical abou t the Equator (Stehl i e t al. 1961 \ pointed ou t tha t al l th e Antarcti c dat a hav e bee n Stehli 1968). In many respects this is still held to be pooled int o on e ver y larg e regio n (Cram e 2000a ) the canonica l vie w o f globa l biodiversit y (e.g . and if smaller subunits, such as the Weddell or Ross Ricklefs 1995) . It is only comparatively recently, as Seas, had been used, then diversity would continue many souther n hemisphere biotas hav e come to be to drop into the highest souther n latitudes. Ther e is better known, that this concept has, at least to some a moderatel y stee p fal l i n bivalv e number s fro m extent, been brought into question. For a number of West Africa, vi a South Africa, int o Antarctica, but contrasting taxonomi c group s ther e i s a genera l by far the most profound latitudina l gradient in the impression tha t diversit y tend s t o b e slightl y t o southern hemisphere is that from th e Queenslandconsiderably higher in the south (Gaston 1996 , an d Northern Territory region , throug h South Australi a refs cite d therein) , an d thi s i s confirme d b y th e and New Zealand, t o Antarctica (Fig . 4). The very latitudinal gradient s establishe d fo r Ne w Worl d marked differenc e i n diversit y declin e wit h like, profil e overal l (Fig . 1) . Suc h a for m agree s well wit h that describe d fo r bivalve s b y Fless a & Jablonski (1995, fig. 1) , and for marine gastropod s by Taylor & Taylor (1977, figs 1 and 2) and Roy et al (1998 , fig , 1) . I t shoul d als o b e note d tha t a sharp, step-lik e rise in scleractinia n coral diversity occurs a t 21-23° N i n th e Atlanti c Ocea n an d a t 16-19°N i n a mor e globa l compilatio n o f dat a (Rosen 1981 , figs 9. 3 and 9.4). There ar e som e indication s tha t th e marke d inflection see n a t 20-30° N i n bivalve s an d othe r marine tax a als o occur s i n th e terrestria l realm . Stehli (1968 , fig. 15 ) demonstrated it s presence in lizards, an d i t ma y als o b e characteristi c o f amphibians an d snake s too. Bats also sho w a very marked reduction in numbe r of specie s a t c. 24°N (Rozenzweig 1992 , fig . la ) an d there i s a distinc t step-like fal l i n the numbers of New World birds at 20-25°N (Gasto n & Blackbur n 1996 , fig . Ib) . Taken together , thes e marin e an d terrestria l dat a sets ar e beginnin g to sugges t that revisio n o f th e concept o f the latitudina l diversit y gradien t i n th e northern hemisphere is needed. There are signs of a consistent an d ver y stee p dro p i n diversit y that i s more or less coincident with the edge of the tropics (20-30°N) an d thereafte r a muc h gentle r declin e into higher latitudes. Data for marine bivalves (Fig . 1) indicate that the reduction in taxa, at the species level, across this tropical step could be by as much as 66% . I t i s als o apparen t tha t thi s tropical temperate divide marks a point of major turnover in the compositio n o f biotas . Valentin e (1973) , fo r example, estimated a n 80% turnover in the species composition of marine molluscan faunas alon g the western coast of North America at this level.

352

J. A . CRAME

Fig. 4 . Four bivalve latitudinal diversity gradients in species diversity in the southern hemisphere. 1 , eastern Australia gradient betwee n Queensland-Norther n Territory, Sout h Australia , New Zealand and Antarctica; 2, western Afric a gradient betwee n Wes t Africa, Sout h Africa an d Antarctica; 3 , eastern Sout h Americ a gradien t betwee n Brazil , Eastern Sout h America, Magella n regio n an d Antarctica; 4, western Sout h America gradien t betwee n Peru-Chile , Magellan regio n an d Antarctica. Al l regions an d data points taken from Table 1 .

increasing latitude between the eastern and western sectors of the southern hemisphere i s also shown in the three-dimensional plot given in Fig. 3.

The form of the longitudinal gradien t Although muc h les s ofte n discusse d tha n thei r latitudinal counterparts , longitudinal gradients ar e real phenomen a that occu r o n a variet y of spatia l scales in both the terrestrial and marine realms (e.g . Simpson 1964 ; Stehl i 1968 ; Ormon d & Robert s 1997; William s e t al 1997 ; Elliso n e t al 1999) . That produce d i n thi s stud y agai n pick s ou t tw o tropical peaks or foci: a southern China-IndonesiaAustralia on e betwee n c . 11 0 an d 150°E , an d a Caribbean-Panamic on e between c. 65 and 110° W (Figs 2 an d 3) . Th e longitudina l gradien t i s particularly steep either side of these two peaks but then remarkabl y fla t betwee n c . 50° W an d 100° E (i.e. much of the Atlantic and Indian Oceans). Of course, this two-humped pattern could also be attributed t o a taxonomi c artefac t produce d b y understudy o f th e Sout h America n an d Africa n low-latitude regions, and extensive over splitting of faunas in both the Indonesian and central American regions. Nevertheless , i t i s agai n though t unlikely that thi s woul d hav e bee n o n suc h a scal e a s t o produce th e observe d features . It i s interestin g to

note tha t simila r tropica l hig h diversit y foc i hav e also been observed i n zooxanthellate coral s (Rose n 1988; Veron 1995), mangroves (Ricklefs & Latham 1993; Elliso n e t al . 1999) , an d certai n terrestria l groups suc h a s palms , mosquitoe s an d parrot s (Stehli 1968) . Brigg s (1996 ) ha s use d a com pendium o f coral , mollusc , echinoder m an d crustacean dat a to show that the Indo-West Pacifi c focus i s consistentl y riche r i n tax a tha n th e Caribbean-Panamic one . Suc h a conclusio n i s confirmed by the results obtained in this study (Figs 2 and 3).

The causes of latitudinal gradient s Some general considerations At present, large-scale dat a sets, such as these fro m the marin e realm , hav e no t bee n teste d agains t an appropriate geometri c nul l model . I t i s entirel y possible tha t th e mid-domai n effec t (Colwel l & Lees 2000) coul d be influencing bivalve latitudinal gradients, bu t o n wha t scal e i s simpl y unknown. However, b y analog y wit h studie s tha t hav e bee n made i n the terrestrial realm , i t might be expecte d that th e mid-domai n richnes s pea k woul d b e essentially symmetrica l abou t th e Equator . Th e degree of asymmetry noted here would suggest that something else must also be involved.

TAXONOMIC DIVERSIT Y GRADIENT S IN MARIN E BIVALVE S

Northern Hemisphere. Ther e would see m to be a simple, bu t fundamental , lin k betwee n latitudina l diversity gradient s an d temperature . Withi n th e shallow-marine real m ther e i s a hig h therma l gradient from c. 30°C at the Equator to < 0°C in the polar regions ; a contou r ma p o f se a surfac e temperatures, assumin g winte r i n bot h hemi spheres, show s a stron g latitudina l patter n (Stehl i 1968, fig . 2). In turn, higher tropica l temperature s generate th e highe r level s o f primar y productivity that, i n som e way , underpi n mor e divers e eco systems. Ther e i s currentl y a rang e o f powerfu l species-energy hypothese s t o accoun t fo r large scale diversit y pattern s i n bot h th e marin e an d terrestrial realms (e.g. Wright et al 1993 ; Brown & Lomolino 1998) . It i s importan t t o emphasiz e that , withi n th e tropics as a whole, patterns of primary productivity are ver y uneven . Many oceani c island s an d atoll s are surrounde d b y nutrient-poor , oligotrophi c waters that support comparatively small numbers of suspension-feeding organism s suc h as bivalves. In marked contrast, many high islands and continental margins are bathed by nutrient-rich waters in which bivalve specie s abundanc e an d diversit y ca n b e extremely hig h (Taylo r 1997) . A prim e exampl e here woul d b e th e Eas t Chin a Se a an d th e Indonesia-Philippines regions, whic h benefit fro m heavy pulse s o f nutrients generate d b y monsoona l rainfall o n th e margin s o f th e southeas t Asia n continent (Cram e 2000a) . It mus t also b e stresse d that th e precis e mechanis m whereb y thi s hig h productivity i s translate d int o hig h taxonomi c diversity i s uncertain . Hig h tropica l productivit y should in fact onl y lead t o a latitudinal gradien t i n biomass, s o something els e is required t o generat e a large number of tropical species . Here, tw o quite distinct processes are being dealt with and it may be illogical to assume that both are subject to the same set of controls (Blackburn & Gaston 1996) . It is also far from clear why diversity should drop so steeply i n bivalves and other marin e taxa at the edge of the tropics (i.e. at c. 23°N; Figs 1 and 3). It is known that there is a broad belt, c. 50° latitude in width, o f homogenou s temperature s withi n th e tropics (Rosenzwei g 1992 , fig . 2 ) bu t thereafte r temperature decline s uniforml y wit h increasin g latitude. Th e shar p inflectio n i n norther n hemi sphere latitudinal diversity gradients is not matched in temperature profiles (Rosen 1981, fig s 9.3-9.6). As a n alternativ e t o temperatur e pe r se, wate r density ma y be important , fo r i t is known that th e tropical pycnocline is a unique feature in all oceans that runs from 20° N t o 20°S (Longhurs t 1998) . In the North Atlantic the transition between the strong tropical pycnoclin e an d th e wea k subtropica l on e occurs a t 22-23°N, coinciden t wit h th e margi n of the Norther n Equatoria l Current . I n marke d

353

contrast t o this, the Southern Equatoria l Curren t i s considerably broade r an d mor e diffus e tha n it s northern equivalent , an d ther e i s n o matchin g boundary at 22-23°S (Longhurst 1998) . Here , then , may be at least a partial explanatio n fo r asymmetry in tropical-subtropica l diversit y patterns , bu t i t again has to be stressed tha t the precise mechanis m whereby wate r densit y exert s a contro l on taxonomic diversit y patterns is unknown. A further chang e in the stability of oceanic water masses occur s a t 40 ° latitude . A t latitude s lowe r than thi s level , near-surfac e water s (i.e . < 100 m) remain thermally stratified throughout the year, but above i t wintertim e coolin g result s i n convectiv e overturn an d mixing , resupplyin g nutrient s bac k into th e surfac e waters . This mean s that , althoug h mean annua l primar y productivit y i s generall y higher i n th e high-latitud e an d pola r regions , i t i s markedly seasonal . Thi s chang e fro m annua l t o seasonal pattern s o f primar y productivit y a t 40 ° latitude may have been a control on the taxonomic diversification o f a number o f pelagic an d benthi c marine groups (Taylor & Taylor 1977 ; Angel 1996 , 1997; Culve r & Buzas 2000). Southern hemisphere. I t ha s bee n argue d else where (Cram e 20000 ) that the Australian 'hotspot ' in bivalv e diversit y ma y b e directl y relate d t o a distinctive se t o f oceanographi c condition s i n th e southern hemisphere . Th e impositio n o f col d boundary current s alon g th e wester n coasts , an d major rive r syste m outflow s o n th e easter n ones , has severel y restricte d th e developmen t o f cora l reef an d associate d sedimentar y environment s i n South Americ a an d Africa . Onl y alon g th e north eastern an d northwester n coast s o f Australi a ar e reefs extensivel y developed , wit h th e riches t scleractinian coral faunas anywher e in the souther n hemisphere occurring in the northern Great Barrie r Reef, and moderately diverse ones being associate d with th e Northwester n Shel f Reef s (Vero n 1995) . Carbonate mud s ar e stil l widel y distribute d alon g much o f th e Sout h Australia n coas t an d overal l there i s though t t o b e a muc h greate r habita t heterogeneity fo r benthi c marin e organisms , suc h as bivalves, aroun d the entir e Australia n continent (Crame 2000a).

The effects of history Within th e las t decad e ther e ha s bee n a dramati c increase i n the understanding of the ways in which regional processe s ca n structur e natura l communities (e.g . Huston 1999 ; Ricklef s 1999 , and refs cited therein) . Thes e regional processe s can be divided int o tw o categories : (1 ) thos e tha t ar e directly attributabl e t o the physical propertie s o f a large area , suc h a s it s size , climate , geolog y an d

354

J. A . CRAM E

age; (2 ) thos e tha t ar e du e t o som e for m o f contingent even t (suc h as the sudden imposition o f a barrier to dispersal or a mass extinction event). In both cases, such processes ar e reflected in changes in immigratio n o r emigratio n an d speciatio n o r extinction rates . Regiona l processe s ca n occu r o n timescales o f u p t o millions, o r eve n ten s o f millions, o f years (e.g. Caley & Schluter 1997) . Northern hemisphere. I f a n obviou s contem porary explanatio n canno t b e foun d fo r th e ver y marked ste p i n diversit y profile s mor e o r les s coincident wit h th e edg e o f th e tropics , the n perhaps ther e i s som e for m o f historica l expla nation. Rosen (1981) , fo r example, ha s pointed ou t how oceani c island s and smalle r lan d areas within the tropics ma y hav e been particularl y susceptible to a combinatio n o f climati c an d tectoni c event s throughout th e Cenozoi c era . H e wa s particularly concerned wit h zooxanthellat e corals, notin g how their normal depth range was often exceede d by the scale o f glacioeustati c sea-leve l fluctuations , an d how the y wer e sharpl y bounde d b y a minimu m temperature (normall y the 20°C isotherm) an d thus a maximu m latitude . Rose n (1981 , p . 125 ) argue d that ther e mus t b e a sudde n latitudina l ris e i n th e susceptibility o f corals t o climate-tectonic events . During th e lat e Neogen e (i.e . th e las t c . 1 5 Ma), a marked intensificatio n o f glacioeustati c cycle s would hav e lef t reef s repeatedl y an d abruptl y stranded. Thi s ha s serve d t o accentuat e thei r northern limits , especiall y in the wester n Atlantic and western Pacific Oceans. It i s quit e likel y tha t othe r tropica l marin e invertebrate tax a wer e als o affecte d b y climate tectonic events . I n a stud y o f th e effect s o f Lat e Cenozoic sea-leve l fluctuation s on tropical oceani c islands, Paula y (1990 ) ha s show n tha t bivalve s restricted t o inner-ree f habitat s wer e particularl y liable to extinction. This is where the soft substrate s predominate o n mos t tropica l island s an d atolls , and durin g a sea-leve l regressio n significantl y greater number s o f infauna l rathe r tha n epifauna l taxa wer e prone t o a t least loca l extinction . Seria l restriction of coral reef an d associated sedimentary habitats woul d have serve d to repeatedly limi t th e latitudinal range of a variety of marine invertebrate taxa. Southern Hemisphere. No t only may Australia be unique amon g th e souther n continent s i n it s oceanographic settin g a t the present day , but ther e is som e evidenc e t o sugges t tha t it may have bee n so throug h th e pas t too . Sinc e th e mid - t o Lat e Cretaceous dispersion of the component Gondwana continents, i t i s eviden t tha t Australi a has move d considerably furthe r north , relativ e t o Antarctica , than either South America or Africa (e.g . Lawver et

al. 1992) . Approximatel y 10 0 Ma ag o Australi a was stil l attache d t o Antarctic a i n a high-latitud e position. I t wa s characterize d b y a distinctive , temperate marin e faun a tha t comprise d par t o f a n austral, o r Weddellian , provinc e (Zinsmeiste r 1982). By the end of the Cretaceous period (6 5 Ma ago) ther e wer e probabl y shallo w sea s betwee n Australia an d Antarctica , an d b y 5 0 Ma ag o (i.e . late Earl y Eocene ) ful l deep-wate r separatio n ha d been achieved (Crame 1999 , an d refs cited therein). Throughout th e Cenozoi c er a Australi a move d progressively northward s int o lower , an d warmer , latitudes an d b y th e earl y Middl e Miocen e (c . 17 Ma ago ) Indo-Pacifi c (i.e . tropical ) mollusca n genera reache d a maximu m developmen t i n southeastern Australi a (Darrag h 1985) . Thereafte r the percentag e o f tropica l tax a i n Sout h Australia has declined , an d toda y th e Australia n molluscan fauna ca n be split into essentially northern tropical and souther n warm-temperat e components ; thes e are separated b y extensive zones o f overlap on the southeastern an d southwester n coasts, respectivel y (e.g. Ponder & Wells 1998 , fig . 1.87) . This stron g admixtur e o f tropical an d temperat e faunal element s ma y wel l b e a prim e reaso n fo r high regional diversit y values around the Australian continent. A s i t ha s move d steadil y northward s through time , i t ha s literall y carrie d a numbe r o f originally cool-temperat e tax a int o progressivel y warmer climatic belts. Australia at the present day seems t o represen t a zon e o f genuin e overla p between severa l majo r biogeographi c realms . I t should be possible to test this hybrid biogeographic province hypothesi s usin g a combinatio n o f biological an d palaeobiological data . Alread y i t i s striking ho w th e relict bivalv e genu s Neotrigonia, as wel l a s representative s o f tax a suc h a s Eucrassatella an d Talabrica (bot h member s o f th e 'ancient' famil y Crassatellidae), ca n be found righ t around the continent (Lamprel l & Whitehead 1992 ; Darragh 1998 ; Slack-Smit h 1998) .

The causes o f longitudinal gradient s Some general considerations In theory , the mid-domain effec t shoul d appl y just as muc h t o longitudina l gradient s a s t o latitudina l ones (Colwell & Lees 2000). However, eve n less is known abou t ho w i t ma y hav e influence d longitudinal gradient s i n th e marin e realm , an d crucial t o th e constructio n o f nul l model s i n thi s context wil l b e th e definitio n o f geographicall y distinct domains . If th e vas t Indo-Pacific provinc e constitutes a single , discret e domain , the n i t i s possible tha t the Indo-West Pacifi c hig h diversity focus represent s som e for m o f mid-domai n diversity peak. Nevertheless, if this is the case then

TAXONOMIC DIVERSIT Y GRADIENT S I N MARIN E BIVALVES

it is not nearly so easy to explain the presence of the second, Panamic-Caribbea n peak . Clearly , thi s i s an issu e tha t need s considerabl e furthe r investigation. The existenc e o f bivalv e longitudina l gradient s may als o b e explaine d entirel y b y recours e t o maintenance, o r ecological , processes . Th e Indo Pacific fauna l real m i s ver y muc h larger tha n th e Atlantic one , an d ther e i s a muc h greate r concentration o f oceani c island s i n th e Indo-Wes t Pacific hig h diversity focus tha n in the Caribbean . On species area grounds alone, the southern ChinaIndonesia-Australia diversit y pea k woul d b e expected t o be larger than the Caribbean-Panamic one (Fig s 2 an d 3) . A consideratio n o f tropica l current flo w an d dispersa l patterns woul d suggest that taxa should accumulate on the western margins of both the Pacific an d Atlantic Ocean s (e.g . Ladd 1960), an d i t i s noticeabl e ho w som e o f th e monsoonal coasts o f the Indian Ocean have rather low diversity values. Nevertheless, Rose n (1984 ) ha s questione d whether ecologica l factor s alon e ar e sufficien t t o account fo r th e ver y marke d disparit y i n cora l faunas betwee n th e tw o region s (wit h there being 24 coral genera in the Atlantic as opposed to 8 7 in the Ind o Pacific) . Thi s i s especiall y s o whe n th e geological historie s o f th e tw o fauna s ar e considered and it is found that in the early Cenozoic (i.e. Palaeocen e an d Eocene ) th e globa l centr e of coral diversit y wa s ver y muc h i n th e Atlantic , Caribbean an d Mediterranea n region s (Rose n 1984). Al l the availabl e palaeontologica l evidenc e suggests that , a t leas t fo r scleractinia n corals , th e later Cenozoi c (i.e . Neogene ) wa s a perio d o f relative decline fo r Atlantic-Caribbean fauna s an d one o f spectacula r developmen t fo r Indo-Wes t Pacific one s (Rosen 1988) . The effects of history Further evidenc e o f th e potentia l importanc e o f historical event s i n determinin g th e for m o f present-day longitudina l diversity gradients comes from cladisti c analyse s o f tropica l cora l faunas . Recent studies by both Rosen & Smith (1988) and Pandolfi (1992) have revealed a series of distinctive overlapping distribution patterns that seem to imply the presenc e o f essentiall y north-sout h trendin g physical barriers . I t woul d appea r tha t a onc e homogenous cora l fauna , tha t has been repeatedl y subdivided by both climatic an d tectonic events, is being observed. It i s importan t t o emphasiz e tha t som e for m o f physical differentiatio n withi n th e vas t tropica l shallow-water tropical realm can be traced back to either the earliest part of the Cenozoic era, or even the lates t Cretaceou s (i.e . a t leas t 50-6 0 Ma ago) .

355

Barriers t o dispersa l cause d b y tectoni c event s i n the present-da y Middl e Eas t an d th e deep-wate r eastern Pacifi c Ocea n coul d b e o f a t least this ag e (Newell 1971 ; Ka y 1984 ; Rose n 1988) . Neverthe less, it was not until the beginning o f the Miocen e (i.e. c . 20 Ma ago ) tha t ver y stron g differentiatio n between th e Atlanti c an d Indo-Pacifi c province s began. Thi s wa s th e tim e o f collisio n betwee n Africa-Arabia an d Europe an d the fina l closur e of the Tethya n Ocean . Thereafter , th e continue d northward movement of Africa and Europe took the Mediterranean regio n ou t o f th e ree f bel t an d lef t the Atlanti c provinc e progressivel y mor e isolate d (Frost 1977 ; Rosen 1988) . However, ther e wa s als o anothe r cruciall y important Neogen e tectoni c even t i n th e tropica l ocean, involvin g th e northwar d movemen t o f th e Australian plat e unti l it collided wit h Indonesia i n the lat e Middl e Miocen e (i.e . c . 1 5 Ma ago) . O f course, thi s di d no t resul t i n th e formatio n o f a complete terrestria l barrie r and , indeed , ma y wel l have le d t o a perio d o f convergenc e betwee n previously semi-isolated , shallow-wate r fauna s (Rosen & Smit h 1988) . Thi s may , i n turn , hav e accounted fo r th e obviou s mid - t o lat e Miocen e pulse of Indo-West Pacific coral diversification (see below; Rosen 1988) . Perhaps the most intriguing feature about the late Middle Miocen e collisio n o f Australi a wit h Indonesia i s tha t i t wa s coinciden t wit h a marke d deterioration i n globa l climat e (cause d by a majo r expansion of the Antarctic ice sheet; Kennett et al 1985). Thi s woul d certainl y hav e le d t o a n intensification i n th e frequenc y an d scal e o f glacioeustatic sea-leve l cycles , whic h wer e the n imposed o n a new geographica l patter n o f island s (Rosen 1984) . A t th e ver y least , thi s woul d hav e triggered a significan t increas e i n vicarian t event s when the Indonesia n archipelag o wa s very largely left exposed during the low stands. However, Rosen (1984) went on to suggest that the pattern of islands throughout th e centra l Indo-Pacifi c provinc e ma y now hav e bee n suc h a s t o creat e a significan t taxonomic diversity pump. An outer zon e of mor e widely space d islands, situated in both the western Pacific an d Indian Oceans, was the putative site of vicariance durin g repeated lo w stands . During th e subsequent high stands, the new specie s create d i n this oute r zon e wer e pumpe d int o th e centra l Indonesian focus , whic h become s a refug e comprising numerou s sympatri c species . I t i s th e geographical patter n o f island s withi n th e centra l Indo-Pacific province , couple d wit h a prolonge d sequence of glacioeustatic cycles , that is the key to its curren t hig h diversity . Th e sam e proces s ha s been les s effectiv e i n th e Atlanti c becaus e o f a much sparser pattern of outlying islands relative to the Caribbean focu s (Rose n 1984) .

356

J. A . CRAM E

The composition of bivalve latitudinal gradients In th e companio n study , Cram e (20000 ) demon strated tha t th e present-da y latitudina l gradien t i n marine bivalve s (i n bot h hemispheres ) i s over whelmingly underpinne d b y a tropica l an d low latitude concentratio n o f infauna l taxa . Thes e ar e very largely containe d withi n the extensive hetero conch clad e (whic h comprise s commo n familie s such a s th e Veneridae , Tellinidae , Cardiida e an d Mactridae), bu t ther e ar e als o concentration s o f burrowing anomalodesmatan s an d certai n arcoid s (principally fro m th e Subfamil y Anadarinae) . There i s a latitudina l gradien t i n epifauna l pteriomorph bivalves at the present day (principally pectinids, ostreid s an d limids) bu t i t i s o n nothing like the same scale (Crame 20000). It i s als o becomin g apparen t tha t latitudina l gradients i n infauna l tax a can be trace d bac k ove r very considerable periods o f time. They have been detected (in both hemispheres) for the Late Jurassic Tithonian stage (i.e. c. 150 Ma ago), where they are underpinned b y tropica l an d low-latitud e concen trations o f palaeoheteroconch s (i.e . trigoniids) , older heteroconc h familie s suc h a s the Astartidae , and newe r one s suc h a s th e Tancrediidae , Quenstedtiidae an d Arcticida e (Cram e 1996) . There i s eve n som e evidenc e t o suggest tha t infaunal gradient s ca n b e detecte d i n th e Lat e Palaeozoic er a (i.e. c. 290 Ma ago; Bambach 1990) . The progressiv e infaunalizatio n o f th e Bivalvi a through geological time is , of course, b y now well established (e.g . Cram e 2000/? , an d ref s cite d therein), bu t why should it have been concentrate d in tropica l an d low-latitud e regions ? Perhap s th e simplest solutio n is that it can be directly attribute d to a concomitan t ris e i n variou s durophagou s predatory groups, many of which clearly show their maximum developmen t a t th e presen t da y i n th e tropics (Vermei j 1978) . Th e spectacula r ris e i n tropical predator s ove r th e las t 10 0 Ma ha s bee n matched b y a simila r rise i n their infauna l bivalv e prey, providing a striking example o f evolutionary escalation (Vermei j 1978) . A further importan t point to consider here is that there ma y b e mor e infauna l tax a i n th e tropic s simply becaus e ther e i s mor e fin e sedimen t available for the m to burro w in. Wherea s at the present day c . 50% o f the are a of inner continental shelves in th e tropic s i s compose d o f fine mu d (o f mostly alga l origin) , th e equivalen t figur e fo r 60 ° latitude i s onl y 10 % (ther e bein g a muc h highe r proportion o f sand , grave l an d roc k fragment s o f glacial origin ) (Haye s 1967) . Thi s woul d indee d seem to be a tenable explanation a t the present da y but is perhaps les s applicabl e furthe r bac k in time . For example, i n the Late Jurassic ther e wer e clea r

latitudinal gradient s i n infauna l bivalve s bu t n o polar ice caps (Cram e 1996) . This lead s t o consideratio n o f whethe r som e form o f physiologica l explanatio n fo r th e low latitude concentratio n o f infauna l bivalve s migh t not be more appropriate. O f the various alternative s that coul d b e discusse d here , tw o ca n b e chose n which ar e know n t o var y systematicall y wit h latitude (Clark e 1993 ) - seasonalit y o f food supply and rate of shell calcification. Nevertheless, i t is not at all obvious wh y either o f these processes should produce suc h a steep gradient a t the present da y in the heteroconchs an d yet have comparatively littl e influence o n other clades suc h as the protobranchs, lucinoids o r mytiloids. What shoul d be considere d is a physiologica l proces s tha t i s muc h mor e specific to infaunal taxa - i.e . the rate of burrowing. In a classic stud y based o n a wide variety of taxa, Stanley (1970) showed conclusively that burrowing rates ar e strongl y influence d b y temperature . Maximum rate s wer e observe d i n th e 20-30° C range, an d a t lowe r value s there wa s a very shar p decline in burrowing activity. It may be very much easier fo r bivalve s t o burrow , an d thu s escape th e attentions o f predators , i n low - rathe r tha n high latitude regions.

Discussion There remain s a grea t dea l t o b e learn t abou t th e nature and origin o f the larger scal e patterns o f lif e on Earth . Followin g o n fro m th e classi c earl y studies o f Stehl i (1968 ) an d Stehl i e t al (1967 , 1969), ther e was , perhaps , a tendenc y t o over simplify thes e features ; diversit y wa s perceived t o vary regularl y wit h latitude , wit h pattern s i n th e south largel y mirrorin g thos e i n th e north . Suc h a concept wa s understandable becaus e Stehl i (1968 ) had employed a variety of techniques t o smooth his data. He was, after all , using generalized taxonomic diversity gradient s t o tes t hypothese s o f pola r wandering and continental drift. The pattern s o f regiona l bivalv e diversit y presented her e ca n be adde d t o a growing volume of evidenc e whic h suggest s tha t latitudina l gradients i n particula r ar e muc h mor e comple x i n form tha n wa s originall y envisage d (e.g . Gasto n 1996; Gasto n & Spice r 1998) . I n th e northern hemisphere, a consisten t patter n i s beginnin g t o emerge o f a gradient that drops ver y steepl y a t the edge of the tropics (20-30°N) but then declines a t a much lowe r rate in higher latitude s (Fig . 1) . Quite why ther e shoul d b e thi s stee p edge , o r 'wall' , t o tropical hig h diversity value s i s uncertain . Th e promotion o f tropical diversit y b y the mid-domai n effect, an d equilibriu m processe s suc h a s hig h annual primary productivity an d the habitat hetero geneity associate d wit h coral reef s - bot h the latter

TAXONOMIC DIVERSIT Y GRADIENT S I N MARIN E BIVALVE S

two processe s i n particula r ma y hav e bee n important i n governin g th e accumulatio n o f larg e numbers o f infaunal , suspension-feedin g hetero conch bivalves - shoul d not be dismissed. As the gradient is clearly not uniform, and there is no simple relationship betwee n the tropical 'wall ' and temperatur e (o r indee d an y othe r environmental parameter) , consideratio n i s required o f whether non-equilibrium, o r historical , factors ma y als o hav e bee n importan t i n it s formation. Man y tropica l marin e organism s ar e indeed adapte d t o narro w temperatur e an d dept h ranges, an d repeate d exposur e durin g Cenozoi c tectonic-climatic cycle s ma y hav e serve d t o accentuate thei r latitudina l limit s (sensu Rose n 1981). Thi s hypothesi s need s t o b e teste d furthe r and t o d o thi s close r examinatio n o f th e precis e nature of the 'wall' is needed. I s it of the same scale and in the sam e position i n all three major oceans ; does it vary in intensity between major groups ; and how complete is the turnover of taxa across it? There i s a n impressio n o f muc h stronge r inter regional variabilit y i n bivalv e diversit y i n th e southern hemisphere , wit h Australi a formin g a distinct hotspo t (Fig s 1-3) . Thi s coul d agai n b e attributed largel y t o equilibriu m processes , a s northeastern and northwestern Australia exhibit the richest developmen t o f cora l reef s i n th e souther n hemisphere. Nevertheless , i t is strikin g ho w Sout h Australia bear s a divers e temperat e bivalv e assemblage tha t seem s t o compris e a n unusuall y high percentag e o f endemi c tax a (e.g . Ponder & Wells 1998) . Thi s phenomeno n ma y als o b e repeated i n othe r Sout h Australia n benthi c marin e invertebrate tax a suc h a s th e peracari d Crustace a (Poore & Wilson 1993) . I t is known that, ove r th e last 5 0 Ma, th e continen t ha s move d northward s from th e edg e o f Antarctic a t o tropica l latitudes , and this may have led to a unique juxtaposition o f temperate an d tropical fauna s (Darrag h 1985) . The same northward movement of Australia may also have led to the overlap of three once-separated tropical marin e fauna s (i.e . the India n Ocea n an d the western Pacific and tropical Australian faunas), and thu s the generatio n o f a significan t Indo-Wes t Pacific hig h diversit y focus . But then th e questio n remains a s t o whethe r thi s proces s o f simpl e overlap alon e woul d hav e bee n sufficien t t o produce suc h a high diversity peak? Presumably, it involved som e for m o f highe r leve l diversit y differentiation a t the between-habitat an d between community level s (i.e . p an d y diversification). In addition, it is likely that the area of coral reefs in the Indonesian regio n mus t hav e increase d substantially a t this time too. However, there is now a considerable volum e of evidence to suggest that a marked Neogene pulse in species diversificatio n wa s pan-tropica l i n nature .

357

Besides scleractinia n coral s (Rose n 1988 ; Veron 1995), i t has also been detecte d i n bivalves (Fless a & Jablonsk i 1996 ; Cram e 2000a) , gastropod s (Taylor e t al 1980 ; Kohn 1990 ) and planktoni c foraminifera (We i & Kennett 1986). This pulse als o affected th e Panami c an d Caribbea n provinces , although it s effect s her e hav e to som e exten t bee n masked b y hig h level s o f loca l extinctio n i n th e Late Pliocen e (Jackso n e t a l 1993 ; Allmon e t al . 1996). Thi s lead s t o an inference tha t somethin g i n addition t o th e majo r collisio n o f th e Australia n plate with southeast Asia must have been involved in the amplification o f these tropical hig h diversit y foci, and it would seem only logical to turn to som e sort o f mechanis m tha t involve s globa l climat e change. In a serie s o f stimulatin g papers , Rose n (1981 , 1984, 1988 ) has suggested ho w a glacioeustaticall y driven specie s diversit y pum p ma y hav e operate d over th e las t c . 1 5 Ma i n th e tropica l regions . Th e key here i s not so much the scal e an d regularity of temperature-sea-level changes a s the geographica l pattern o f tropica l island s upo n whic h the y wer e superimposed. Tha t i n th e centra l Indo-Pacifi c region i s thought to have been idea l fo r generating peripheral isolate s during lo w sea-level stands an d then 'pumping ' newly formed species into a central reservoir durin g hig h stands . I n thi s model , th e Indo-West Pacific high diversity focus represents a refugium fo r a large numbe r o f sympatri c specie s and this seems to fit well with the observed mosaics of overlappin g distributio n pattern s fo r man y ree f corals (Rosen 1988; Pandolfi 1992). It is these same glacioeustatic cycle s tha t ar e though t t o hav e accentuated th e latitudinal range s o f many tropica l taxa, especially i n the northern hemisphere . Fewer islands , especiall y i n the critical outlying regions, mean s tha t th e postulated diversit y pum p may hav e bee n les s effectiv e i n th e Caribbea n region. I t i s als o apparen t tha t thi s regio n wa s progressively isolated throug h the Neogene b y th e continued northwar d movemen t o f th e African Mediterranean bloc k an d coolin g o f th e worl d ocean (Rose n 1984 ; Rosen & Smit h 1988) . Th e final separatio n o f th e Panami c an d Caribbea n provinces wa s achieve d b y th e Lat e Pliocen e emergence o f the Isthmus of Panama (Jackson et al. 1993). Summary and conclusions • Becaus e o f thei r widesprea d geographica l distribution, bot h a t th e presen t da y an d i n th e geological past , bivalve s ar e on e o f th e mos t useful taxonomi c group s fo r investigatin g th e nature an d origi n o f large-scal e biodiversit y patterns i n the marine realm .

358

J. A . CRAME

• A composite latitudinal gradient for the northern hemisphere show s a pronounce d step , o r inflection, mor e or less coincident with the edg e of th e tropic s (20-30°N) , an d thi s i s a featur e repeated i n a range of other marine and terrestria l groups. Th e databas e fo r th e souther n hemisphere i s les s complete . Ther e i s a ver y sharp fall in the number of bivalve specie s alon g the easter n coas t o f Australia into New Zealan d and Antarctica , bu t elsewher e th e gradient s ar e much flatter . Australi a seems t o for m a distinct diversity hotspo t i n th e low- to mid-latitude s of the southern hemisphere . • A strikin g longitudina l gradien t i n marin e bivalves occurs between a large southern ChinaIndonesia-Australia high-diversit y focu s an d a somewhat smaller Caribbean-Panamic one. • Ther e i s n o simpl e matc h betwee n latitudina l gradients i n temperatur e an d specie s diversity . Some form o f species-energy hypothesi s may be more appropriate , bu t i f s o it mus t explain wh y taxonomic diversity is so obviously concentrated in some parts of the tropics but not in others. The pycnocline i s a prominent asymmetrica l featur e of th e tropica l ocea n whos e influenc e o n taxonomic diversity is unknown. • I t i s possibl e tha t th e shee r siz e o f the tropica l biome, couple d wit h th e greate r amoun t o f incident energ y tha t i t receives , underpin s th e taxonomic diversity gradients seen at the present day. Th e bivalv e gradient s could , i n turn , b e enhanced by the fact that the rate of burrowing is positively correlated with temperature. However, it i s unlikel y tha t thes e processe s o n thei r ow n can explain either the very steep 'wall ' to tropical diversity, th e asymmetr y betwee n th e tw o hemispheres o r the asymmetr y between th e tw o tropical high diversity foci . • Bot h latitudina l an d longitudina l gradient s i n bivalve diversit y coul d b e influence d b y th e geometric theor y o f specie s richnes s know n a s the mid-domai n effect , bu t t o wha t exten t i s unknown. Th e marke d asymmetr y i n thes e gradients may b e a n indication that it cannot be the only underlying cause. • T o full y explai n th e for m o f present-da y taxonomic diversit y gradient s th e rol e o f historical, o r contingent, processe s als o need s t o be assessed . Ther e woul d appea r t o b e a lon g history o f vicarian t event s withi n th e tropica l oceans but of particular importance are those that have occurre d withi n th e Neogen e perio d (i.e. within th e las t c . 2 0 Ma). Within thi s timespa n the Tethya n Ocea n wa s finall y close d an d th e Atlantic an d Indo-Pacific marin e faunas becam e sharply differentiated. • Th e northwar d movemen t o f Australi a throughout th e Cenozoi c er a i s see n as a crucial

historical event . I t seem s t o hav e resulte d i n a genuine admixtur e o f tropica l an d temperat e faunas aroun d the continent , an d th e generatio n of exceptionally high levels of endemism. When the northern edge of the Australian plate collide d with southeas t Asi a 1 5 Ma ag o th e resultin g overlap o f tropica l fauna s i n th e Indonesian region ma y hav e le d t o a marke d phas e o f diversification there . • I t i s becomin g apparen t tha t a shar p puls e o f Neogene diversificatio n wa s pan-tropica l i n nature an d no t jus t confine d t o th e Indonesia n region. Quit e wh y ther e shoul d b e a puls e o f tropical diversificatio n at thi s tim e i s uncertain, especially a s global climate s ar e known to have deteriorated significantl y ove r th e las t 1 5 Ma. One intriguin g possibilit y i s tha t glacioeustati c sea-level cycle s acte d a s a typ e o f species diversity pump , wit h ne w tax a bein g forme d i n peripheral region s durin g lo w stand s an d the n being 'pumped ' int o centra l refugi a during hig h stands. The sam e climati c cycle s tha t drove this process ma y als o hav e serve d t o accentuat e th e latitudinal limit s o f a wid e rang e o f tropica l organisms. • A combinatio n o f tropica l vicarian t event s and glacioeustatic processe s throug h th e Neogen e may have left a n indelible imprint on the presentday, large-scal e pattern s of life on Earth. I am grateful to two anonymous referee s an d J. D. Taylo r for comment s an d suggestions that helped to significantl y improve thi s paper .

References ALLMON, W . D. , ROSENBERG , G. , PORTELL , R . W . & SCHINDLER, K . 1996 . Diversity o f Pliocene-Recen t mollusks i n th e Wester n Atlantic : extinction , origination, an d environmenta l change . In : JACKSON, J . B . C. , BUDD , A . F . & COATES , A . G . (eds) Evolution an d Environment i n Tropical America. Universit y o f Chicag o Press , Chicago , 271-302. ANGEL, M . V . 1996 . Ocean diversity . In : SUMMERHAYES , C. P . & THORPE , S . A . (eds ) Oceanography. A n Illustrated Guide. Manso n Publishing , London , 228-243. 1997. Pelagi c biodiversity . In : ORMOND , R . F . G. , GAGE, J . D . & ANGEL , M . V . (eds ) Marine Biodiversity. Patterns an d Processes. Cambridg e University Press , Cambridge , 35-68 . BAMBACH, R . K . 1990 . Late Palaeozoi c provincialit y i n the marine realm . In: MCKERROW, W. S. & SCOTESE , C. R . (eds ) Palaeozoic Palaeogeography an d Biogeography. Geologica l Society , London , Memoir, 12, 307-323. BLACKBURN, T . M . & GASTON , K . J . 1996 . A sideway s look a t patterns i n species richness, o r why there ar e so fe w specie s outsid e th e tropics . Biodiversity Letters, 3, 44-53.

TAXONOMIC DIVERSIT Y GRADIENT S I N MARIN E BIVALVE S BRIGGS, J . C . 1996 . Tropical diversit y an d conservation . Conservation Biology, 10 , 713-718. BROWN, J . H . & LOMOLINO , M . V . 1998 . Biogeography, 2nd Edition. Sinauer Associates, Sunderland , MA. CALEY, M . J . & SCHLUTER , D . 1997 . The relationshi p between loca l an d regiona l diversity . Ecology, 78 , 70-80. CLARKE, A . 1993 . Temperature and extinctio n in the sea: a physiologist's view. Paleobiology, 19 , 499-518. COLWELL, R . K . & LEES , D . C . 2000 . Th e mid-domai n effect: geometri c constraint s o n th e geograph y o f species richness . Trends i n Ecology & Evolution, 15, 70-76. CRAME, J . A . 1996 . Antarctic a an d th e evolutio n o f taxonomic diversit y gradient s i n the marin e realm . Terra Antarctica, 3, 121-134. 1999. An evolutionary perspective on marine faunal connections betwee n southernmos t Sout h Americ a and Antarctica . Scientia Marina, 6 3 (Suppl . 1) , 1-14. 2000a. Evolutio n o f taxonomi c diversit y gradient s in the marine realm: evidence from th e composition of Recen t bivalv e faunas . Paleobiology, 26 , 188-214. 2000/7. Intrinsi c an d extrinsi c control s o n th e diversification o f th e Bivalvia . In: CULVER , S . J . & RAWSON, P . F . (eds ) Biotic Response t o Global Change: th e Last 14 5 Million Years. Cambridg e University Press, Cambridge, 136-148 . CULVER, S . J . & BUZAS , M . A . 2000 . Globa l latitudina l species diversit y gradien t i n deep-se a benthi c foraminifera. Deep-Sea Research I, 47, 259-275. DARRAGH, T . A . 1985 . Mollusca n biogeograph y an d bio stratigraphy o f th e Tertiar y o f southeaster n Australia. Alcheringa, 9, 83-116 . 1998. Order Trigonioida . In: BEESLEY , P . L., Ross , G. J. B. & WELLS, A . (eds) Mollusca: Th e Southern Synthesis. Part A. Fauna of Australia. Volume 5. CSIRO Publishing, Melbourne , 294-296 . ELLISON, A . M., FARNSWORTH, E. J. & MERKT, R . E. 1999. Origins of mangrove ecosystems and the mangrove biodiversity anomaly . Global Ecology an d Biogeography, 8 , 95-115. FLESSA, K . W . & JABLONSKI , D . 1995 . Biogeography o f Recent marine bivalve molluscs and its implications for paleobiogeograph y an d th e geograph y o f extinction: a progress report. Historical Biology, 10, 25-47. & 1996 . Geography o f evolutionary turnover. In: JABLONSKI , D., ERWIN , D . H . & LIPPS , J . (eds) Evolutionary Paleobiology. Chicag o Universit y Press, Chicago, 376-397. FROST, S . H . 1977 . Miocene t o Holocen e evolutio n o f Caribbean reef-buildin g corals. Proceedings of th e Third International Coral Reef Symposium, 2 , 353-359. GASTON, K . J. 1996 . Biodiversity - latitudina l gradients. Progress in Physical Geography, 20, 466—476. & BLACKBURN, T. M. 1996. The tropics as a museum of biologica l diversity : a n analysi s o f th e Ne w World avifauna. Proceedings of th e Royal Society o f London, B263, 63-68 . & SPICER , J . L. 1998 . Biodiversity. A n Introduction. Blackwell, London .

359

HAYES, M. O. 1967. Relationship between coastal climate and bottom sedimen t typ e o n the continenta l shelf . Marine Geology, 5, 111-132. HUSTON, M . A . 1999 . Loca l processe s an d regiona l patterns: appropriat e scale s fo r understandin g variation i n th e diversit y o f plant s an d animals . Oikos, 86, 393-401. JACKSON, J. B . C., JUNG, P., COATES, A . G . & COLLINS , L . S. 1993 . Diversit y an d extinctio n o f tropica l American mollusk s an d emergenc e o f th e Isthmu s of Panama. Science, 260, 1624-1626. KAY, E . A. 1984 . Patterns o f speciatio n i n the Indo-Wes t Pacific. Special Publications of th e Bernice Pauahi Bishop Museum, 72, 15-31. KENNETT, J . P. , KELLER , G . & SRINIVASAN , M . S . 1985 . Miocene planktonic foraminiferal biogeography and paleooceanographic developmen t o f th e Indo Pacific region. In: KENNETT , J . P. (ed.) The Miocene Ocean: Paleoceanography and Biogeography. Memoir of the Geological Societ y o f America, 163, 197-236. KOHN, A . J . 1990 . Temp o an d mod e o f evolutio n i n Conidae. Malacologia, 32, 55-67. LADD, H . S. 1960 . Origin of the Pacifi c island molluscan fauna. American Journal of Science, 258, 137-150. LAMPRELL, K . & WHITEHEAD , T . 1992 . Bivalves o f Australia. Volume 1 . Crawfor d Hous e Press , Bathurst. LAWVER, L. A., GAHAGAN, L. M. & COFFIN, M . 1992 . The development o f paleoseaway s aroun d Antarctica . In: KENNETT , J . P . & WARNKE , D . A . (eds ) Th e Antarctic Paleoenvironment: A Perspective on Global Change. Part One. Antarcti c Researc h Series, 56, 7-30. LONGHURST, A . 1998 . Ecological Geography o f th e Sea. Academic Press , London . NEWELL, N . D . 1971 . A n outlin e histor y o f tropica l organic reefs . American Museum Novitates, 2465 , 1-37. ORMOND, R . F . G . & ROBERTS , C . M . 1997 . Th e biodiversity o f cora l reef fishes . In: ORMOND , R . F . G., GAGE , J . D . & ANGEL , M . V . (eds ) Marine Biodiversity. Patterns an d Processes. Cambridg e University Press, Cambridge, 216-257 . PANDOLFI, J . M . 1992 . Successiv e isolatio n rathe r than evolutionar y centre s fo r th e originatio n Indo Pacific ree f corals . Journal o f Biogeography, 19 , 593-609. PAULAY, G . 1990 . Effect s o f lat e Cenozoi c sea-leve l fluctuations o n th e bivalv e fauna s o f tropica l oceanic islands. Paleobiology, 16, 415^434. PONDER, W . F . & WELLS , F . E . 1998 . Distribution an d relationships o f marin e an d estuarin e fauna . In : BEESLEY, P . L., Ross , G . J . B . & WELLS , A . (eds) Mollusca: The Southern Synthesis. Fauna of Australia. Volume 5 . Part A . CSIR O Publishing , Melbourne, 77-80. POORE, G . C. B. & WILSON, G . D. F. 1993. Marine species richness. Nature, 361, 597-598. REX, M . A. , STUART , C . T., HESSLER , R . R., ALLEN , J . A., SANDERS, H . L . & WILSON , G . D . F . 1993 . Globalscale latitudina l pattern s o f specie s diversit y i n th e deep-sea benthos. Nature, 365, 636-639. RICKLEFS, R. E. 1995. 3.2 The distribution of biodiversity.

360

J. A . CRAM E

In: HEYWOOD , V . H . (ed. ) Global Biodiversity Assessment. Cambridg e Universit y Press , Cambridge, 139-173 . 1999. Globa l pattern s o f tre e specie s richnes s in mois t forests : distinguishin g ecologica l influences an d historica l contingency . Oikos, 86 , 369-373. & LATHAM, R. E. 1993 . Global patterns of diversity in mangrov e floras . In : RICKLEFS , R . E . & SCHLUTER, D. (eds ) Species Diversity i n Ecological Communities. Historical and Geographical Perspectives. University of Chicago Press, Chicago , 215-229. ROSEN, B. R. 1981. The tropical hig h diversity enigma the corals'-ey e view . In : FOREY , P . L . (ed. ) The Evolving Biosphere. Britis h Museu m (Natura l History), Londo n an d Cambridge Universit y Press, Cambridge, 103-129 . 1984. Reef cora l biogeography an d climate throug h the late Cainozoic: just islands in the sun or a critica l pattern of islands? In: BRENCHLEY, P. J. (ed.) Fossils and Climate. Wiley, Chichester, 201-262. 1988. Progress , problem s an d pattern s i n th e biogeography o f ree f coral s an d othe r tropica l marine organisms . Helgoldnder Meeresuntersuchungen, 42,269-301. & SMITH , A . B . 1988 . Tectonics fro m fossils ? Analysis o f reef-cora l an d sea-urchi n distribution s from lat e Cretaceou s t o Recent , usin g a ne w method. In: HALLAM, A. & AUDLEY-CHARLES, M. G . (eds) Gondwana an d Tethys. Geologica l Society , London, Special Publications , 37, 275-306. ROSENZWEIG, M. L. 1992 . Species diversit y gradients : we know mor e an d les s tha n w e thought . Journal o f Mammalogy, 73 , 715-730. ROY, K., JABLONSKI , D. & VALENTINE, J. W. 1994. Eastern Pacific mollusca n province s an d latitudina l diversity gradient : N o evidenc e fo r 'Rapoport' s rule'. Proceedings o f th e National Academy o f Sciences of th e USA, 91, 8871-8874. ,& 1996 . Highe r tax a i n biodiversit y studies: pattern s fro m easter n Pacifi c marin e molluscs. Philosophical Transactions o f th e Royal Society o f London, B351, 1605-1613. ,& 1998 . Marin e latitudina l diversit y gradients: Test s o f causa l hypotheses . Proceedings of th e National Academy o f Sciences of th e USA, 95, 3699-3702. SCHOPF, T . J. M . 1970 . Taxonomic diversit y gradients i n ectoprocts an d bivalve s an d thei r geologi c implications. Geological Society o f America Bulletin, 81, 3765-3768. SIMPSON, G. G. 1964 . Species densit y of North American Recent mammals . Systematic Zoology, 13 , 57-73. SLACK-SMITH, S . M . 1998 . Superfamil y Crassatelloidea . In: BEESLEY , P. L., Ross, G. J. B. & WELLS, A. (eds) Mollusca: The Southern Synthesis. Fauna of

Australia. Volume 5 . Part A . CSIR O Publishing , Melbourne, 325-328 . STANLEY, S. M. 1970 . Relation of shell form t o life habits of th e Bivalvi a (Mollusca) . Geological Society o f America Memoir, 125, 1-296. STEHLI, F. G. 1968. Taxonomic diversit y gradient s i n pole location: The Recen t model. In : DRAKE , E . T . (ed.) Evolution an d Environment. Yal e University Press , New Haven, 163-227 . , DOUGLAS, R. G. & NEWELL, N. D. 1969 . Generation and maintenanc e o f gradient s i n taxonomi c diversity. Science, 164, 947-949. , MCALESTER , A . L . & HELSLEY , C . E . 1967. Taxonomic diversit y o f Recen t bivalve s an d som e implications fo r geology . Geological Society o f America Bulletin, 78, 455^66. TAYLOR, J . D . 1997 . Diversit y an d structur e o f tropica l Indo-Pacific benthi c communities : relatio n t o regimes o f nutrien t input . In : ORMOND , R . F . G. , GAGE, J . D . & ANGEL , M . V . (eds ) Marine Biodiversity. Patterns and Processes. Cambridg e University Press, Cambridge, 178-200 . & TAYLOR , C . N . 1977 . Latitudina l distributio n o f predatory gastropod s o n th e easter n Atlanti c shelf . Journal o f Biogeography, 4, 73-81. , MORRIS , N . J . & TAYLOR , C . N . 1980 . Foo d specialisation an d th e evolutio n o f predator y prosobranch gastropods . Palaeontology, 23 , 375^09. VALENTINE, J. W. 1973. Evolutionary Paleoecology o f th e Marine Biosphere. Prentice-Hall, Englewoo d Cliffs , NJ. VERMEIJ, G . J . 1978 . Biogeography an d Adaptation. Harvard Universit y Press , London . 1987. Evolution an d Escalation. Princeto n University Press, Princeton, NJ . VERON, J . E . N . 1995 . Corals i n Space an d Time. Th e Biogeography and Evolution of the Scleractinia. Comstock/Cornell, London. WEI, K.-Y . & KENNETT , J. P . 1986. Taxonomic evolutio n of Neogen e planktoni c foraminifer a an d pale oceanographic relations . Paleooceanography, 1 , 67-84. WILLIAMS, P . H., GASTON, K . J. & HUMPHRIES, C. J. 1997 . Mapping biodviersity values worldwide: combining higher-taxon richnes s fro m differen t groups . Proceedings o f th e Royal Society o f London, B264 , 141-148. WRIGHT, D . H. , CURRIE , D . J . & MAURER , B . A . 1993. Energy suppl y an d pattern s o f specie s richnes s o n local an d regiona l scales . In : RICKLEFS , R . E . & SCHLUTER, D. (eds) Species Diversity i n Ecological Communities: Historical and Geographical Perspectives. Chicag o Universit y Press , Chicago , 66-74. ZINSMEISTER, W. J. 1982 . Late Cretaceous-Earl y Tertiar y molluscan biogeograph y o f th e souther n circum Pacific. Journal o f Paleontology, 56 , 84-102 .

Analysing th e latitudinal diversit y gradien t in marine bivalve s DAVID JABLONSKI 1, KAUSTUV ROY2 & JAMES W. VALENTINE3 Department of Geophysical Sciences, University of Chicago, 5734 South Ellis Avenue, Chicago, IL 60637, USA (e-mail: djablons @ midway, uchicago. edu) 2 Department of Biology, University of California at San Diego, 9500 Oilman Drive, La Jolla, CA 92093-0116, USA 3 Department of Integrative Biology, University of California, Berkeley, CA 94720, USA Abstract: Marin e bivalve s o f th e easter n Pacifi c continenta l shel f sho w a stron g diversit y gradient fro m the Arctic Ocean to the tropics. This gradient is underlain by strong diversity trend s in bot h infauna l an d epifauna l bivalves , contrar y t o Thorson' s influentia l hypothesi s (1952 , Verhandlungen de r Deutschen Zoologischen Gesellschaft, 1951 , 267-327) , an d i s significantly correlated wit h mea n sea-surfac e temperature ; eithe r ra w dat a o r a residual s analysi s yield s p< 0.0001. Pattern s diffe r accordin g t o trophi c grou p an d phylogeny ; however , suspensio n feeders confor m to the general bivalve diversity gradient , a s do facultative deposit feeder s such as tellinids, while deposit feeding protobranchs d o not. Infaunal and epifaunal diversity gradient s have differen t slope s s o that their rati o change s wit h latitude ; dat a o n Jurassi c an d Cretaceou s bivalves suggests that this ratio has varied in slope an d intercept over geological time .

The latitudina l diversit y gradient , wit h maximu m taxonomic richnes s in the tropics, is one of the most pervasive biologica l patterns , bu t it s basi c configuration an d it s tempora l dynamic s remai n poorly know n fo r marin e organism s (e.g . Clark e 1992; Gasto n 1996 ; Clark e & Cram e 1997) . Her e the result s o f a n analysi s o f 93 0 o f th e c . 96 0 bivalve specie s know n fro m th e easter n Pacifi c continental shel f (fro m th e souther n borde r o f th e tropics i n northwes t Per u t o th e nort h coas t o f Alaska i n th e Arcti c Ocean ) ar e presented . Distributional dat a wer e derive d fro m th e primar y literature [includin g th e excellen t ne w volum e b y Coan et al. (2000)] and museum collections . The marin e bivalve s a s a whol e sho w a stron g latitudinal gradient , wit h a sharp, 50 % decreas e i n diversity at the northern edg e of the tropics (2 3 °N) (Fig. la) . Bot h infauna l an d epifauna l bivalve s exhibit stron g diversit y trend s (Fig . I b an d c) , contrary t o Thorson' s (1952 , 1957 , 1965 ) long standing an d influentia l hypothesi s tha t onl y epifaunal group s increas e i n diversit y toward s th e tropics. Thorso n argue d tha t infauna l specie s should b e s o buffere d fro m spatia l an d tempora l environmental variation that their diversity patterns should not be affected by global climate trends. An alternative approach , whic h has gaine d increasin g support, view s diversit y a s a positiv e functio n o f

available energ y rather tha n a n inverse functio n o f environmental variabilit y o r harshness (e.g . Wrigh t et a l 1993 ; Frase r & Curri e 1996 ; Turne r e t al . 1996). For bivalve s a s a group , an d fo r infauna l an d epifaunal bivalve s taken separately , mea n sea surface temperatur e (SST ) i s a highl y significan t predictor o f bivalv e diversit y - fo r al l bivalve s r2 = 0.70, p < 0.0001; for infaun a only , r 2 = 0.65 , p < 0.0001 ; fo r epifaun a only , r 2 = 0.81 , p < 0.0001. However , becaus e bot h diversit y an d temperature ar e correlated wit h latitude, along with many othe r bioticall y importan t factors , th e relationship betwee n th e tw o variable s wa s examined furthe r b y usin g a residual s analysis . Using thi s approach, th e relationships betwee n th e residuals o f a regression o f temperatur e v . latitude and th e residual s o f a regressio n o f diversit y v . latitude, ar e highly significan t (r 2 = 0.92, 0.9 1 an d 0.94 fo r al l bivalves , infaun a an d epifauna , respectively) (Fig . 2) . These result s are : consisten t with species-energy hypotheses; strongly contradict Thorson's hypothesis ; an d corroborat e a simila r analysis fo r gastropod s o f th e easter n Pacifi c an d western Atlantic (Roy et al. 1998) . Becaus e SST is sensitive t o factor s rangin g fro m sola r inpu t t o seasonal upwelling , whic h i n tur n affec t nutrien t variability an d productivity , th e mechanism s tha t

From: HARPER , E. M., TAYLOR , J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Specia l Publications, 177, 361-365 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

362

D. JABLONSKIZ7AL .

Fig. 1 . Latitudinal diversit y gradient s fo r eastern Pacifi c continenta l shel f marin e bivalves , (a) Gradient for all species combined ( N = 930 species), (b) Gradien t fo r infaunal specie s only ( N = 776 species) , (c) Gradient for epifauna l species only (N= 15 4 species).

relate SS T t o th e diversit y gradien t remai n uncertain (cf . Valentine 1983) . When bivalve s ar e partitione d accordin g t o trophic groups , a mor e comple x patter n emerges . Suspension feeder s sho w a diversit y gradien t similar t o that see n fo r bivalves a s a whole, while deposit feeder s exhibit two diversity plateaus (Fig . 3a and b). When the deposit feeder s are partitione d phylogenetically, th e tellinids , whic h ar e facultative, surfac e deposi t feeder s (Pohl o 1969 ;

Levinton 1991 ; Kamerman s 1994) , follo w a latitudinal diversit y tren d simila r t o tha t o f suspension feeders . I n contrast , th e protobranchs , which are subsurface deposit feeders (e.g. Jumars et al. 1990) , lac k a latitudina l diversit y gradien t despite the taxonomi c turnove r seen a t 23° N (Fig . 3c an d d) . Th e anomalou s protobranc h diversit y trend ma y b e relate d t o thei r commitmen t t o a relatively lo w fecundity , lo w dispersa l mod e o f reproduction (see Valentine & Jablonski 1983) .

ANALYSING TH E LATITUDINA L DIVERSITY GRADIEN T IN MARIN E BIVALVES

363

Fig. 2 . Relationship betwee n specie s diversity an d mean sea-surfac e temperatur e (SST), using a residuals analyse s (residuals from th e regression of mean SST v. latitude, regressed v. the residuals from th e regression of diversity v. mean SST) . (a ) All bivalves only , r 2 = 0.92, p < 0.0001. (b) Infaunal bivalves, r2 = 0.91, p < 0.0001. (c) Epifauna l bivalves, r2 = 0.94, p < 0.0001.

Infaunal an d epifaunal bivalves both increase in diversity fro m pole s t o Equator , but the y d o s o a t different rate s s o tha t thei r rati o change s significantly wit h latitude , showin g a relativ e increase i n infaun a (Fig . 4) . However , Cram e (1996) show s th e opposit e relationshi p wit h latitude, approximatin g a 1: 1 rati o i n th e lates t Jurassic (se e als o Crame 2000). Th e data on latest Cretaceous bivalve s compiled by Raup & Jablonski (1993) and Jablonski & Raup (1995) als o sho w an inverse trend in the infaunal: epifaunal ratio relativ e to modern seas, but approximating 3:1. Clearly, this is a dynami c gradient , wit h change s i n slop e an d intercept driven by climate changes and differentia l diversification o f th e tw o functiona l groups . Th e transition t o a moder n tren d i n th e infaunal : epifaunal ratio ma y have been drive n by: (1) clade dynamics, wit h th e ongoin g diversificatio n o f siphonate infauna l suspensio n feeder s an d th e relative declin e o f immobil e suspensio n feeder s

(e.g. Stanle y 1968 , 1977 ; Skelto n e t al 1990) ; (2 ) extinction events suc h as the end-Cretaceous mas s extinction (althoug h thi s particula r extinctio n ha s not ye t yielde d a clea r patter n o f differentia l infaunal v . epifauna l survivorship ; Jablonsk i & Raup 1995) ; and/o r (3 ) climat e change , e.g . th e transition fro m greenhous e t o icehous e world s i n the mid-Cenozoic , wit h accompanying change s i n temperature, seasonalit y an d othe r environmenta l factors. Comparativ e analysis of these trends along other latitudina l transect s i n moder n an d ancien t faunas woul d be ver y interesting , an d ma y revea l further complexit y i n th e regiona l pattern s tha t underlie global diversity gradients. We thank th e organizers fo r the opportunity t o participate in suc h a stimulatin g meeting ; th e Nationa l Scienc e Foundation fo r suppor t o f this research ; and J. A. Crame and S. M. Kidwell for valuable comments.

364

D. JABLONSKI^TML .

Fig. 3 . Latitudinal diversity gradients in functional group s and clades of eastern Pacific bivalves, (a) Suspension feeders; (b ) deposit feeders ; (c ) the facultative deposit-feeding Tellinida e (• ) exhibi t a diversity gradien t simila r t o that of the suspension-feeding Veneridae (D); (d) the deposit-feeding protobranchs fail t o conform to the overall bivalve diversity gradient. After Ro y et al. (2000).

References

Fig. 4 . The infaunal:epifaunal rati o varies with latitude in eastern Pacific bivalves. As shown in Fig. I b and c, infauna ar e not increasing at the expense of the epifauna but are decreasing more slowly with latitude. Note, however, the downward trend within the tropics (5°S-23°N), despite th e overall increase from th e tropics to the poles.

CLARKE, A . 1992 . I s ther e a latitudinal diversit y cline i n the sea ? Trends i n Ecology an d Evolution, 7 , 286-287. & CRAME , J . A . 1997 . Diversity , latitude an d time : patterns i n th e shallo w sea . In: ORMOND , R . F . G. , GAGE, J . D . & ANGEL , M . V . (eds ) Marine Biodiversity: Patterns an d Processes. Cambridg e University Press, Cambridge, 122-147 . COAN, E. V. , SCOTT, P . V. & BERNARD, F. R. 2000. Bivalve Seashells o f Western North America. Sant a Barbara Museum of Natural History Monographs, Studies in Biodiversity, 2. CRAME, J . A . 1996 . Antarctic a an d th e evolutio n o f taxonomic diversit y gradients i n th e marin e realm . Terra Antarctica, 3, 121-134 . 2000. The nature and origin o f taxonomic diversit y gradients in marine bivalves. This volume. FRASER, R . H . & CURRIE , D . J . 1996 . Th e specie s richness-energy hypothesi s i n a syste m wher e historical factors are thought to prevail: Coral reefs. American Naturalist, 148 , 138-159 . GASTON, K . J. 1996 . Biodiversit y - latitudina l gradients . Progress in Physical Geography, 20 , 466^76.

ANALYSING TH E LATITUDINA L DIVERSIT Y GRADIEN T I N MARIN E BIVALVE S JABLONSKI, D . & RAUP , D . M . 1995 . Selectivit y o f end Cretaceous marin e bivalv e extinctions . Science, 268, 389-391 . JUMARS, P . A. , MAYER , L . M. , DEMING , J . W. , BAROSS , J. A. & WHEATCROFT, R A. 1990 . Deep-se a deposit feeding strategie s suggeste d b y environmenta l an d feeding constraints . Philosophical Transactions o f the Royal Society o f London, A331 , 85-101 . KAMERMANS, P . 1994 . Similarit y i n foo d sourc e an d timing an d feedin g i n deposit - an d suspension feeding bivalves . Marine Ecology Progress Series, 104, 63-75. LEVINTON, J . S . 1991 . Variable feedin g behavio r i n thre e species o f Macoma (Bivalvia , Tellinacea ) a s a response t o wate r flo w an d sedimen t transport . Marine Biology, 110 , 375-383. POHLO, R . H . 1969 . Confusio n concernin g deposit feeding i n th e Tellinacea . Proceedings o f th e Malacological Society o f London, 38, 361-364. RAUP, D . M . & JABLONSKI , D. 1993 . Geograph y o f end Cretaceous marin e bivalv e extinctions . Science, 260,971-973. ROY, K. , JABLONSKI , D . & VALENTINE , J . W . 2000 . Dissecting latitudinal diversity gradients: functional groups an d clade s o f marine bivalves . Proceedings of th e Royal Society o f London, B267 , 293-299. ,, , & ROSENBERG , G . 1998 . Marin e latitudinal diversit y gradients : test s o f causa l hypotheses. Proceedings o f th e National Academy of Sciences USA, 95, 3699-3702 . SKELTON, P . W. , CRAME , J . A. , MORRIS , N . J . & HARPER, E . M . 1990 . Adaptiv e divergenc e an d taxonomic radiatio n i n post-Palaeozoi c bivalves . In: TAYLOR , P . D . & LARWOOD , G . P . (eds ) Major Evolutionary Radiations. Systematic s Associatio n Special Volume , 42 , Clarendo n Press , Oxford , 91-117.

365

STANLEY, S. M. 1968 . Post-Paleozoi c adaptive radiation o f infaunal bivalv e mollusc s - a consequenc e o f mantle fusio n an d sipho n formation . Journal o f Paleontology, 46 , 165-212. 1977. Trends , rates , an d pattern s o f evolutio n i n Bivalvia. In : HALLAM , A . (ed. ) Patterns o f Evolution. Elsevier, Amsterdam, 209-250 . THORSON, G . 1952 . Zu r jetzige n Lag e de r marine r Bodentier-Okologie. Verhandlungen der Deutschen Zoologischen Gesellschaft, 1951 , 276-327 . 1957. Botto m communitie s (sublittoral o r shallo w shelf). Geological Society o f America Memoirs, 67(1), 461-534. 1965. The distributio n o f benthic marin e Mollusc a along th e N.E . Atlanti c shel f fro m Gibralta r t o Murmansk. Proceedings o f th e First European Malacological Congress, 5-23 . TURNER, J . R . G. , LENNON , J . J . & GREENWOOD , J . J . D . 1996. Doe s climat e caus e th e globa l diversit y gradient? In : HOCHBERG , M . E. , CLOBERT , J . & BARBAULT. R . (eds ) Aspects o f th e Genesis an d Maintenance o f Biological Diversity. Oxfor d University Press, Oxford , 199-220 . VALENTINE, J . W . 1983 . Seasonally : effect s i n marin e benthic communities . In : TEVESZ , M . J . S . & McCALL, P . L. (eds ) Biotic Interactions i n Recent and Fossil Benthic Communities. Plenu m Press , New York , 121-156. & JABLONSKI , D . 1983 . Larva l adaptation s an d patterns o f brachiopod diversit y i n spac e an d time . Evolution, 37 , 1052-1061. WRIGHT, D . H. , CURRIE , D . J . & MAURER , B . A . 1993 . Energy suppl y an d pattern s o f specie s richnes s o n local an d regiona l scales . In : RICKLEFS , R . & SCHLUTER, D . (eds ) Species Diversity i n Ecological Communities. Universit y o f Chicag o Press , Chicago, 66-74.

This page intentionally left blank

Marine bivalves of the Florida Keys: discovered biodiversity 1

PAULA M. MIKKELSEN 1 & RUDIGER BIELER 2 Division of Invertebrate Zoology, American Museum of Natural History, Central Park West at 79th Street, New York, New York 10024-5192, USA (e-mail: mikkel@ amnh.org) 2 Department of Zoology (Invertebrates), Field Museum of Natural History, 1400 S. Lake Shore Drive, Chicago, Illinois 60605-2496, USA Abstract: A survey o f marine bivalve biodiversity in the Florida Keys, a n island archipelago off southern Florida, was compiled fro m origina l collecting, museum specimens and the literature. Assembly o f over 6000 records resulted i n 325 species, 47% of which ca n be considered common to abundan t i n th e Keys . Thi s represent s a 100 % increas e ove r th e previousl y know n fauna , largely attributabl e to critical review o f museum specimens . Capture of species occurrences from the literature, especially when non-traditiona l source s (newsletters, agency reports) are excluded, is show n t o be least effective, producin g onl y 44 % o f the total. Bivalve distributions withi n th e Keys sho w tha t the fauna i s tropical. One-third of the species are wide ranging alon g th e islan d chain; however , a latitudina l clin e i n fauna l similarit y exist s fro m th e Uppe r Key s southwestwards t o Dry Tortugas. The fauna of Florida Bay is the most divergent within th e stud y region an d also compared to other, ecologically complex , western Atlantic tropical-subtropical regions. Limite d historica l record s indicat e littl e specie s turnove r i n th e Keys , althoug h population reduction s alon g th e mai n highwa y an d habita t shift s (fro m natura l t o artificia l substrata) ar e evident. Thes e results have implications for biodiversity survey method s and, mor e locally, for management of the Florida Keys Nationa l Marine Sanctuary .

Estimates o f biodiversit y an d zoogeographica l comparison ar e onl y meaningfu l whe n base d o n empirical data . I n th e wester n Atlantic , n o subtropical mollusca n faun a ha s see n mor e attention by malacologists an d shell collectors tha n southern Florida, most especially the Florida Keys. Comprehensive knowledg e o f th e mollusc s o f the Florid a Key s i s importan t for severa l reasons . Firstly, th e Key s ar e o f grea t interes t zoogeo graphically, du e t o thei r locatio n i n a regio n overlapping th e subtropica l northwester n Atlantic , the temperat e t o tropica l Gul f o f Mexic o an d th e tropical Caribbea n Sea . Secondly , the y ar e important malacologicall y a s on e o f th e bes t sampled regions of the eastern USA, but one whose history an d relevanc e have neve r bee n examined . The onl y formal compilatio n o f shallow - t o deep water molluscs of the Keys was produced by Lyons & Quin n (1995 ) a s par t o f th e preliminar y Draf t Management Pla n o f th e Florid a Key s Nationa l Marine Sanctuar y (FKNMS) . Thi s list , compile d from th e literature , th e collection s o f th e Florid a Department o f Environmenta l Protectio n an d th e authors' personal experiences, included 582 marine species, 16 3 of which were marine bivalves . Thirdly, in the absence of an y molluscan survey predating huma n developmen t i n th e Keys , thi s

analysis i s sorel y neede d b y manager s o f th e FKNMS i n helping thei r futur e attempt s t o asses s the effectivenes s o f enforce d preservatio n measures. This project involves data obtained fro m a multi-year effort o f original field collecting b y the authors, combined with critical analyses of selected museum collection s an d a n exhaustiv e literatur e review. The Florid a Keys , a t th e southernmos t ti p o f continental USA , i s a chai n o f ove r 80 0 small , geologically youn g (Pleistocene Period) , limeston e islands mu d islands , an d reef s stretchin g 36 2 km from Ke y Largo to Key West and westwards to the Dry Tortuga s Archipelag o (extendin g c . 24 ° 20'25°2rN an d 80-83°W). Th e populated limeston e islands, c . 3 0 of which are interconnecte d by roa d bridges, reac h a n elevatio n o f 6 m. T o the marin e biologist, th e Key s ar e ye t mor e extensive , com prising c . 1 0 000 km2 of marin e habitat , includin g hypersaline ponds , mangrov e thickets , seagras s meadows, mu d banks and tidal channels , sandbars , coral reefs , patc h reefs , an d dee p san d plains , reaching int o Florida Bay , the Gulf o f Mexico an d the Atlanti c Strait s o f Florida . Th e physica l environment o f the Strait s o f Florida i s dominate d by the Florida Current which is known to transport Caribbean biot a (e.g . cora l larvae ) int o the Florid a

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177 , 367-387 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000.

368

P. M. MIKKELSE N & R . BIELE R

Keys (Jaa p 1984) . Th e nee d fo r conservatio n an d management o f thi s uniqu e natura l resource , including Nort h America' s onl y livin g barrie r reef, ha s bee n wel l recognized . Th e FKNM S (est. 1990 ; NOA A 1996 , als o http://www.nos . noaa.gov/nmsp/fknms) i s th e newes t o f ove r a dozen active historical an d ecological preservatio n areas i n the Keys, and is the second largest marine sanctuary i n th e USA , encompassin g th e entir e island chai n (9100km 2) ou t t o th e 9 1 m (300ft ) isobath.

Data sources/collecting history The Florida Keys have a rich history of popular and professional mollus c collecting , spannin g ove r a century an d generatin g a vas t accumulatio n o f specimens in a wide variety of museum and private collections. Author s suc h a s Pilsbry , McGinty , Rehder, Morrison , Schwenge l an d Houbrick , collected i n th e Key s an d publishe d o n thei r molluscan discoveries. Man y others (e.g. Sowerby, Dall, Bartsch, Clench, Turner, Boss, Abbott, Yokes and Petuch ) hav e describe d mollusca n specie s having type localities i n the Keys. Notable amon g the amateu r collector s frequentin g th e Key s (an d whose collection s no w resid e i n majo r museu m collections) wer e Koto , Bijur , Schilling , Feinber g and Germer . Th e dredging s o f J . R . Black , i n th e 1970s, of f th e Dr y Tortuga s als o supplie d deep water Keys specimens to many collectors . Few researc h vesse l expedition s hav e include d the Key s t o an y extent . Th e U S Coas t Surve y Steamer Blake include d fou r deep-wate r dredg e stations i n 1877-187 8 of f Ke y Wes t an d th e Dr y Tortugas [molluscs published by Dall (1886, 1889)] although th e expeditio n concentrate d mor e extensively o n th e Gul f o f Mexic o an d th e Caribbean Sea . Later , throughou t th e 1950s , th e privately owne d cabi n cruise r Triton mad e additional deep-wate r dredge s fo r mollusc s of f Sombrero Ke y an d Ke y Wes t (Thompso n e t al. 1951; Pilsbr y & Olsso n 1953 ; McGint y 1955 , 1962; Pilsbr y 1955 ; McGint y & McGint y 1957) . Most recently , Nationa l Oceanographi c an d Atmospheric Administration' s (NOAA ) Center for Coastal Monitorin g an d Assessment ha s sponsore d a serie s o f Macrobenthi c Communit y Assessment cruises alon g th e U S easter n seaboard , s o fa r including si x cruises with stations off the Key s (as here defined) ; th e report s o f thes e cruise s s o fa r exist onl y a s interagenc y report s (e.g . Vitto r & Associates 1998 , als o http://ccma.nos.noaa.gov / datapg2.html) an d man y mollusca n identifications are incomplete . The most extensive sampling for molluscs in the Florida Key s wa s made b y Joh n B . Henderso n Jr , Regent o f th e Smithsonia n Institution . Henderson

outfitted hi s 5 0 ft yach t Eolis specificall y fo r dredging an d sample d ove r 38 0 station s i n th e western Atlantic , mostly i n Florida , Cub a an d th e Bahamas. During seven cruises in 1910-1915, over 80 station s wer e sample d i n th e Key s (a s her e defined), fro m shor e t o 36 6 m. Thi s comprise s probably th e best samplin g effor t alon g th e extent of th e island s an d coul d serv e a s a n invaluabl e historical record o f the malacofauna o f the Keys in the early part of the century. Unfortunately, except for anecdota l report s o f th e dredgin g (Henderso n 1911, 1913 , 1914) , th e result s an d statio n information hav e neve r bee n full y assesse d o r published (see Abbott 1950). Fortunately, > 31 400 sorted specimen lots, although mainly incompletely unidentified, ar e catalogue d i n th e Nationa l Museum o f Natural History (USNM) . Man y Eolis lots have been cite d i n scattere d systemati c paper s (e.g. Clenc h & Turner 1950 ; Turne r & Boss 1962 ; Boss & Merril l 1965 ; Houbric k 1987) , bu t a comprehensive treatment of this collection - whic h would requir e tray-by-tra y manua l extractio n o f Eolis lots from th e largest mollusc collection i n the world - remain s to be accomplished.

Goals The curren t stud y investigate s th e exten t an d quality o f availabl e baselin e dat a o n marin e bivalves of the Florida Keys , and their applicatio n to th e knowledg e an d assessmen t o f regiona l biodiversity. Followin g compilatio n o f a lis t o f species recorde d fro m th e Florid a Keys , an d characterization o f tha t fauna , thes e additiona l questions wer e addressed : (1 ) is th e Florid a Key s bivalve fauna a single entity (from Upper to Middle to Lowe r Key s t o Dr y Tortugas , fro m ba y side t o oceanside, fro m intertida l t o shallo w t o dee p water)?; (2 ) ho w muc h o f thi s recorde d diversit y can b e recaptured/verifie d fro m critica l literatur e studies, surve y o f museu m collection s an d ne w field collecting, an d how effective ar e each of these data sources? ; (3 ) ca n a recent histori c recor d b e reconstructed from museum and literature data and, if so , have there bee n change s t o the bivalve faun a in th e pas t centur y (conceivabl y associate d wit h anthropogenic impact s t o Keys ecology cause d by, for example , bridg e construction , th e touris t industry and/or recreational diving)?; (4) how doe s the Florid a Key s bivalv e faun a compar e t o othe r subtropical wester n Atlanti c fauna s o f simila r ecological complexity ?

Materials an d methods The Florid a Key s i s her e define d a s th e water s surrounding th e entir e islan d chai n fro m Broa d Creek (c. 25°21'N, 80°15'W) at the northern end of

MARINE BIVALVE S O F TH E FLORID A KEY S

Key Largo (including Car d Sound but not Biscayne Bay, southwes t of, bu t no t including , Ol d Rhode s Key) t o th e Dr y Tortugas . A tangentia l east-wes t approximate midlin e wa s draw n throug h Florid a Bay i n th e Uppe r an d Middl e Keys , eliminatin g what is more properly considere d th e southern end of the Florida Everglades. No ocean ward limit was set. T o facilitat e analysi s o f th e Key s faun a b y region or zone, traditional political boundaries wer e employed bu t explicitl y define d a s Uppe r Key s (Key Larg o t o Crai g Key) , Middl e Key s (Fiest a Key t o the western end o f Seven-Mile Bridge ) and Lower Key s (Littl e Duc k Ke y t o Rebecc a Shoal , west o f th e Marquesas) ; th e Dr y Tortuga s Archipelago was treated separately. Delimitation of these fou r zones , althoug h primarily employe d by government agencie s fo r land-plannin g us e (Chiappone 1996a) , is als o base d upo n geologica l and hydrologica l boundarie s (Marszale k e t al. 1977; Shinn et al 1989) . While the entire Keys are founded upo n a n ancient cora l reef know n a s Key Largo Limestone, tha t facies is exposed onl y in the Upper an d Middl e Keys , whil e th e Lowe r Key s (and part of Florida Bay ) are overlain by a marine oolitic ban k o f the Miami Limeston e (Hoffmeiste r & Multe r 1968 ; Mitchell-Tappin g 1980) . Hydrological flo w pattern s favou r th e selecte d boundary between the Upper and Middle Key s (N. P. Smith , pers . comm.) . Th e Dr y Tortugas i s physically separate d b y a dee p channe l fro m Rebecca Shoal and the Lower Keys, at the western edge o f th e Southwes t Continenta l Shel f (NOA A 1996). Dept h categorie s use d wer e base d upo n sampling techniques : intertidal , wadin g dept h (c . 0-1 m) ; shallow , snorkelling-divin g dept h (c . 1-35 m) ; deep , beyon d norma l scub a dept h [i.e . > 35 m o r (10 0 ft)] ; n o maximu m depth limi t wa s set for this survey. Qualitative informatio n o n bivalv e occurrence s in the Florida Keys was assembled from critical use of literatur e source s an d museu m lots , an d fro m original collections . Fou r hundre d an d fift y separate publication s containin g Florid a Key s molluscan record s wer e compile d b y scannin g appropriate boo k publication s (e.g . Johnso n 1934 ; Abbott 1974) , entir e series runs (e.g. Th e Nautilus, The Veliger, Bulletin of Marine Science, American Malacological Bulletin, Journal of Molluscan Studies), shel l clu b newsletter s (e.g . American Conchologist, Texas Conchologisi), th e publishe d papers o f malacologists known to have worke d i n the Key s (e.g . Pilsbry , McGinty , Houbrick ) and , importantly, les s readil y availabl e agenc y report s (e.g. Lyon s & Quin n 1995 ; Vitto r & Associate s 1998). Literature records are acknowledged as that portion o f th e dat a se t fo r whic h specie s identifi cations coul d no t b e verifie d unles s sufficientl y illustrated. Here , 2 8 literatur e record s ar e con -

369

sidered unverifie d (i.e . no t illustrate d o r par t o f revisionary systemati c work ; '* ' i n Tabl e 1) , e.g. Thracia corbuloides, recorde d onl y fro m th e literature, claime d a s 'onl y i n Europe' (Turgeo n et al. 1998 , p . 198 ) an d withou t vouche r specimen s for verification. Selected museu m collection s wer e surveye d manually fo r Key s bivalv e specimens . Th e American Museu m of Natural Histor y (Ne w York; AMNH), th e Fiel d Museu m o f Natura l Histor y (Chicago; FMNH ) an d th e Carnegi e Museu m o f Natural Histor y (Pittsburgh ; CMNH ) wer e surveyed i n full; partia l holding s wer e accesse d a t the Academ y o f Natura l Science s o f Philadelphi a (ANSP), the Delaware Museum of Natural History (Wilmington; DMNH), the Santa Barbara Museum of Natura l Histor y (California ; SBNMH) , th e Bailey-Matthews Shel l Museu m (Sanibe l Island , Florida; BMSM) , th e Harbo r Branc h Oceanographic Museu m (F t Pierce , Florida ; HBOM) an d th e Nationa l Museu m o f Natura l History (Washington , DC ; USNM). Identification s were confirme d b y th e authors . Revisionary , original systematic work resulting from this survey, as wel l a s a full y annotate d compilatio n o f th e literature sources , wil l be published separately . Most importantly , a five-yea r samplin g pro gramme o f origina l fiel d collection s wa s initiated , involving hand-collecting , roc k washing , shovel and-sieving, snorkelling , scub a diving , coral-roc k smashing an d dredging , a t ove r 26 0 'FK ' station s throughout th e Keys . Additiona l pre-surve y samples b y th e author s i n th e Key s extende d th e original collections ' portio n o f thi s wor k bac k t o 1988, covering 289 stations over a total of 1 2 years. Original collection s ar e vouchere d a t AMN H an d FMNH, with partial duplicate serie s a t DMNH and BMSM. From thes e sources , a database o f 614 5 record s was compile d (a s a Microsof t Excel spreadsheet) , comprising 59 8 record s fro m th e literature , 222 3 records fro m museu m lot s an d 332 4 records fro m original collections . Withi n th e database , eac h record wa s coded , wheneve r possible , fo r Key s zone, specifi c islan d o r reef , dept h zone , bayside / oceanside o f th e automobil e highwa y (no t code d for Dr y Tortugas ) and decad e o f collection ; thes e allowed th e dat a se t t o b e subsample d an d manipulated in a variety of ways to explore various questions. Each lo t wa s als o code d a s live - o r dead collected. Mollusc s ar e on e grou p o f ver y fe w marine organisms that leave behind extensive death assemblages an d i t is no t uncommo n t o fin d wha t collectors cal l 'fresh-dead ' shells , stil l includin g organic element s (e.g . periostracum, ligament). To be conservativ e here , al l lot s wer e recorde d a s dead-collected unles s sof t tissu e wa s stil l attache d

370

P. M. MIKKELSE N & R. BIELE R

to on e o r mor e specimens , o r unles s th e labellin g indicated 'live-collected' . I t i s controversial , however, whether dead-collected specimen s shoul d play a role in faunal analyses. Ecological studie s on benthic invertebrate s generall y 'count ' onl y thos e individuals (includin g molluscs ) tha t hav e bee n collected alive . Yet , a s Kidwel l (i n press ) ha s s o elegantly demonstrate d i n he r analysi s o f 1 7 separate biodiversit y surveys , live-onl y investi gations usuall y resul t i n tw o t o thre e time s lowe r species richnes s tha n that represented i n the deat h assemblage. Sh e ha s corroborate d th e presen t authors' subjectiv e impression s tha t empt y shell s are indeed reflectiv e o f the local malacofauna, an d considerably mor e practica l t o asses s whe n resources are limited, rapid assessment is mandated or when marine harvesting is restricted i n protecte d zones. O n this basis, al l analyses presented herei n include all specimens, whether recorded a s live- or dead-collected. Four othe r wester n Atlanti c area s wer e selecte d for whic h comprehensiv e specie s list s coul d b e compiled fo r compariso n wit h th e Florid a Key s fauna: (1 ) th e Gul f o f Mexic o [compile d fro m Steger (1962) , Wes t Florida ; Haa s (1940 ) an d Gundersen (1998) , Sanibe l Island ; Lip e (1984) , Tampa Bay ; Le e (1999) , Ceda r Key ; Shelto n (1997), Alabama ; Lipk a (1974) , Flowe r Garde n Bank; an d article s i n Texas Conchologist (1964 1999), Texas)] ; (2 ) Cub a [fro m Aguay o & Jaume (1947-1948) an d Espinos a e t al (1994)] ; (3 ) Yucatan [fro m Ekdal e (1974 ) an d Yoke s & Yoke s (1984)] an d (4 ) easter n Florid a [fro m Vos s e t a l (1969), Biscayn e National Monument; McGinty & Nelson (1972) , Pompan o Beach ; Ree d & Mikkelsen (1987) , Oculina cora l reefs ; Lyon s (1989), Hutchinson Island; Mikkelsen et al (1995) , Indian River Lagoon]. These areas were selected a s those having similar ecological complexity , including estuarine/mangrov e habitats , cora l reef s an d shallow- t o deep-wate r components . Incompletel y identified tax a (e.g . t o genus or family level only ) were excluded from thes e analyses. Because o f th e natur e o f th e data , onl y presence/absence comparison s wer e conducte d using the Bray-Curti s (Czekanowski ) similarit y routine 'Cluster ' i n the software packag e PRIMER ver. 4. 0 [Plymout h Routine s i n Multivariat e Ecological Research; Car r (1997)]. Entries for each desired analysi s wer e extracte d fro m th e origina l Microsoft Exce l spreadshee t ( a format compatibl e with PRIMER) ; duplicat e record s wer e remove d manually an d th e dat a condensed , thu s manually transforming th e dat a t o presence/absenc e format . One taxonomi c grou p - Galeommatoide a - was omitted fro m al l analyse s i n vie w o f it s extrem e taxonomic uncertaint y a t family , generi c an d species levels . Result s fro m thes e analyse s ar e

presented b y PRIME R a s dendrogram s an d a s a table of similarity indices.

Results an d discussion Effectiveness of data sources Of th e tota l (614 5 records , 32 5 species) , ne w original collections produce d mor e tha n half o f all records (Fig . la) , ye t only recovered abou t half of all specie s (Fig . Ib) . On e hundred an d thirty-four species (41% ) wer e foun d b y al l thre e source s (museum, literatur e an d origina l collecting) . Museum collection s represente d onl y abou t one third o f al l records , ye t produce d th e greates t percentage o f al l specie s o f an y sourc e (77%) . Although localit y dat a accompanyin g museu m specimens ar e not always complete, an d extraction of the m i s ofte n laboriou s (i n th e absenc e o f ful l computerization), th e identification s o f suc h specimens ar e verifiabl e and , i f vouchers , ca n extend th e valu e o f publishe d specie s accounts . Literature data produced th e least databas e records (599), bu t recovere d 23 7 specie s o r c . 70 % o f th e total. However , 'grey ' literatur e playe d a signifi cant rol e i n thi s total ; traditiona l literatur e (book s and peer-reviewe d journals ) misse d 3 8 specie s listed only by Lyons & Quinn (1995), plu s anothe r 57 specie s foun d onl y i n agenc y report s o r shel l club newsletters, leaving a total of only 142 species (44%). Thi s lend s sever e implication s t o studie s based entirel y o n published specie s list s fro m thi s region an d elsewhere. Figur e I b summarize s that , in effect , origina l collecting misse d 45% , museum collections misse d 23 % an d th e literatur e misse d 27% (o r traditiona l literatur e 56% ) o f al l species . Seven specie s wer e uniqu e to the present authors ' original collection s an d thu s ne w record s fo r th e Keys a s a resul t o f thi s surve y are : Mytilopsis leucophaeata, Crassostrea virginica, Ennucula tennis, Thyasira trisinuata, Crassinella dupliniana, Cardiomya ornatissima and Tivelafloridana. Sixty two (19% ) additiona l specie s wer e uniqu e t o museum collections; 38 species (12%) were unique to literature data.

Species composition The Florid a Key s marin e mollusca n specie s lis t currently comprise s ove r 140 0 specie s (group s other tha n bivalve s stil l unde r revie w b y th e authors), 32 5 o f which are bivalves (Tabl e 1) . The Florida Key s bivalv e faun a represent s a wid e taxonomic diversity , includin g 60 families an d 167 genera. Th e mos t divers e familie s were Tellinida e (41 species) , Venerida e (32) , Pectinida e (22 ) an d Mytilidae (20). The species list includes 53% of the

MARINE BIVALVE S O F THE FLORID A KEY S

371

Fig. 1 . Sources o f Florida Keys bivalve data , (a) Percentage o f total records (6145) from the literature (n = 598), museum lot s (n = 2223) and original collections (n = 3324). (b) Percentage of al l species (325) obtaine d from eac h source: the literature (n = 201), museu m lot s (n - 259 ) an d original collections (n - 179) .

marine bivalves in the western Atlantic (Turgeon et al 1998 ) an d 77% of the shallow-water bivalves of Florida (Lyon s 1997). Compare d with the Lyons & Quinn (1995) Florida Keys bivalve species list, this survey represents a 100% increase in the number of species (325 v. 163), an 88% increase in the number of gener a an d a 70 % increas e i n th e numbe r o f families. Thes e number s ar e no t inflate d b y taxonomic 'splitting' , although systematic scrutiny has played a part in developing the species list. For example, severa l crypti c specie s pair s commonl y known unde r a singl e taxonomi c nam e hav e bee n recognized a s morphologicall y differen t an d associated wit h differen t habitat s (e.g . 'Limaria pellucidcC an d 'Pinctada imbricata' i n estuarin e Florida Ba y v . oceanic coral reefs) ; these analyse s are in preparation an d will be published elsewhere . Some tax a ar e stil l imperfectl y resolve d Cuspidariidae, Galeommatoidea , Nuculida e an d Nuculanidae ar e group s fo r whic h fe w identifie d specimens exist , o r tha t ar e base d largel y o n unverified literature records, and , as a consequence, substantial uncertaint y surround s thei r species -

level identifications . I n vie w o f thes e incomplet e identifications, th e specie s lis t i s a t wors t a n underestimate o f th e actua l Florid a Key s bivalv e fauna. Not surprisingly , the Key s bivalve fauna ca n be considered substantiall y tropica l i n character . Species ranges [mainl y taken fro m Abbot t (1974) ] could b e documente d fo r 31 2 (96% ) o f th e 32 5 species. On e hundre d an d seventy-seve n specie s (54%) ca n b e considere d 'widel y ranging' , wit h their distribution s extendin g bot h nort h an d sout h of th e Florid a Key s region . Onl y 1 4 species (4% ) have their southern distributional limi t in the Keys, while 12 0 species (37%) , or 89 % of the 'narrowl y ranging' species , hav e thei r norther n limi t i n th e Keys. Th e Florid a Key s marin e bivalv e faun a includes n o endemic specie s an d no threatened o r endangered species . Tw o specie s o f th e bivalv e Mytilopsis appea r to have been recently introduced to th e Key s b y extensio n thei r otherwis e widespread western Atlantic ranges (see below). Although thi s i s a qualitative study , the numbe r of collection events, o r the frequency of encounte r

Table 1 . Florida Keys bivalves: summary Family

Species

Florida Depth* Side§ Live Recs" L&Q^ No Pre- 190 0 191 0 192 0 193 0 1940 195 0 1960 1970 1980 1990 date1 1900 keys 1 distribution ^

Anomiidae Arcidae

Anomia simplex d'Orbigny, 184 2 Anadara baughmani Hertlein, 1951 *

UMLT T L UMLT M UMLT UMLT UMLT UMLT UMLT UMLT T UT UMLT UMLT UMLT UMLT ULT

Anadara floridana (Conrad, 1869)

Astartidae Cardiidae

Carditidae

Chamidae

Condylocardiidae Corbiculidae

Anadara notabilis (Roding, 1798 ) Anadara ovalis (Bruguiere, 1789 ) Anadara transversa (Say, 1822 ) Area imbricata Bruguiere, 178 9 Area zebra (Swainson, 1833 ) Barbatia cancellaria (Lamarck, 1819 ) Barbatia Candida (Helbling , 1779 ) Barbatia domingensis (Lamarck , 1819 ) Bathyarca glomerula (Dall , 1881 ) Astarte nana Dall, 188 6 Americardia guppyi Thiele , 191 0 Americardia media (Linne, 1758 ) Laevicardium laevigatum (Linne, 1758 ) Laevicardium mortoni (Conrad, 1 830) Laevicardium pictum (Ravenel, 1861 ) Laevicardium sybariticum (Dall, 1886)* Nemocardium peramabile (Dall, 1881 ) Nemocardium tinctum (Dall, 1881 ) Papyridea semisulcata (Gray , 1825 ) Papyridea soleniformis (Bruguiere , 1789 ) Trachycardium egmontianum (Shuttleworth, 1856 ) Trachycardium magnum (Linne, 1758 ) Trachycardium muricatum (Linne, 1758 ) Carditamera floridana Conrad , 183 8 Glans dominguensis (d'Orbigny , 1842 ) Pleuromeris tridentata (Say, 1826 ) Pteromeris perplana (Conrad , 1841 ) Arcinella cornuta Conrad, 186 6 Chama congregata Conrad, 183 3 Chama florida Lamarck , 181 9 Chama lactuca Dall, 188 6 Chama macerophylla Gmelin, 179 1 Chama sarda Reeve, 184 7 Chama sinuosa Broderip, 183 5 Pseudochama inezae Bayer, 143 Pseudochama radians (Lamarck, 1819 ) Carditopsis smithii (Dall, 1896 ) Polymesoda maritima (d'Orbigny, 1842 )

ISD D j ISD SD ISD ISD ISD ISD ISD D D ISD ISD ISD ISD SD

OB -

x -

OB OB OB OB OB OB OB 0 OB OB OB OB OB

x -

UL LT UMLT UMLT UMLT UMLT UML UMLT UMLT UMLT UMLT ULT UMLT UMLT UML UMLT UMLT UMLT

D D S ISD ISD IS IS IS ISD ISD SD ISD ISD ISD ISD ISD SD IS

0 OB OB OB OB OB OB OB OB OB OB OB OB OB OB 0 OB

UMLT UMLT UML

ISD ISD IS

OB OB OB

u

s

o

X

x X X

x X

x X X

x x X

_ X

x X X X X

x X X

x X X

x X X

27 1 1 60 3 13 109 80 175 33 61 1 3 24 58 94 74 7

o

6 3 16 29 31 6 47 85 11 20 8 27 64 24 7 110 10 11 \ 44 21 27

_ x x X

x x X

X X

x X

x X

x X X X

x

X X X

x x

X

x x X X

x

X

m 1 m ml m m ml ml ml ml ml m 1 ml ml ml \ ml 1 ml ml ml 1 ml ml ml 1 ml ml ml ml 1 ml ml ml 1 ml ml ml

_

m

m

_

om

-

m m _ m m m m m _ _ _ _ _ _

-m mm mm mm mm mm -

m m _ _

mm mm -m

m m m m m m m m m m m

m m 1 ml _ o -

-

ml m m m ml m m m m m m

m -

om om om oml om o o _ o ol om oml o

1 _ _ _ _ _ _ _ _ _ _ m _ _ _ _ _ m 1 1 _ _ _ _ _ 1 _ _ _ _ _ - m _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ ml _ _ _ _ _ _ _ _ _ _

_ m -m -m -

m m m ml m m m m ml m _ ml -

m m m m m m m m m m m -

_ 1 om m m _ ml -

ml m

m m

m m m

_

_

- _ _ 1 1- - - _ _ _ _ _ _ 1 ml m - _ _

_

_

-

_

_ _ _

_

m -

_

m -

_

_ _ _ _ _ _ _ _ _ _ - m

m -m mm mm -m ml ml m -m m ml

0

_ o 0

ol o om om ol ol 0

ol ol o om 0

o 0 0

om

Corbulidae

Crassatellidae

Cuspidariidae

Cyrenoididae Donacidae Dreissenidae Galeommatoidea

Gastrochaenidae Glycymerididae

Gryphaeidae Hiatellidae Isognomonidae Limidae

Corbula barrattiana C. B. Adams, 185 2 Corbula caribaea d'Orbigny, 184 2 Corbula contracta Say, 1822 * Corbula dietziana C . B. Adams, 185 2 Corbula swiftiana C . B. Adams, 185 2 Varicorbula limatula (Conrad, 1846) 2 Varicorbula philippii (E . A. Smith, 1885) 2 Crassinella dupliniana (Dall, 1903 ) Crassinella lunulata (Conrad, 1834 ) Crassinella martinicensis (d'Orbigny, 1842 ) Eucrassatella speciosa (A. Adams, 1852 ) Cardiomya costellata (Deshayes, 1830 ) Cardiomya glypta (Bush , 1885 ) Cardiomya ornatissima (d'Orbigny, 1842 ) Cardiomya perrostrata (Dall, 1881) * Cuspidaria gigantea Verrill, 188 4 Cuspidaria rostrata (Spengler, 1793 ) Leiomya claviculata (Dall, 1881) * Myonera limatula (Dall, 1881) * Plectodon granulatus (Dall, 1881 ) Cyrenoida floridan a (Dall , 1896 ) Donax variabilis Say, 182 2 Iphigenia brasiliana (Lamarck, 1818 ) Mytilopsis leucophaeata (Conrad, 1831 ) Mytilopsis sallei (Recluz, 1849 ) Cymatioa sp . Kellia suborbicularis (Montagu, 1803 ) Lasaea adansoni (Gmelin , 1791 ) Mysella planulata (Krause , 1885 ) Orobitella floridana (Dall , 1899 ) Semierycina sp . Gastrochaena Mans (Gmelin , 1791 ) Gastrochaena ovata Sowerby, 183 4 Spengleria rostrata (Spengler, 1783 ) Glycymeris americana (DeFrance, 1829 ) Glycymeris decussata (Linne, 1758 ) Glycymeris pectinata (Gmelin, 1791 ) Glycymeris undata (Linne, 1758) * Neopycnodonte cochlear (Poli, 1795 ) Hiatella arctica (Linne, 1767 ) Isognomon alatus (Gmelin, 1791 ) Isognomon bicolor (C. B. Adams, 1845 ) Isognomon radiatus (Anton, 1839 ) Ctenoides floridanus Olsson & Harbison, 1953 2 Ctenoides planulatatus (Dall , 1886) 2 Ctenoides sanctipauli Stuardo, 1982 2 Ctenoides scaber (Born, 1778) 2

u

S ID

B B

D S SD D S ISO SD D S

OB B OB O O OB B

MLT T ULT U ULT LT M UMLT LT ULT L T T LT L T T T U UL UM U U U U U MT UMLT MLT UM UMLT UMLT UMLT UT UMLT UMLT

IS

O B

I I S D IS ISD IS IS ISD SD SD SD ISD ISD

B B O O O B OB OB OB OB O O O OB

UML ULT UML UMLT UMLT UMLT L MLT UMLT

ISD SD IS ISD ISD ISD D ID ISD

O O OB OB OB OB

x x X

X X

X

1

8

m

18 2 1 18 5 5 2

ml

x x

m

1

m m 1

3

B OB

X

x x X X X X

x

X X

X X X

x

X X

x X

x

2 1 2 3 1 2 2 1 1 4 5 3 2 24 9 11 3 15 111 0 5 5 60 59 31 66 1 4 58

m m

1 1 m

1 1

m

m m

m

m

o ol ol

m m

m

o

1

o

1

1

1 1

D

m o 1 o m ol

m

1

OB

D D

1

6

ml

1 1 m m

m ml m 1

o o

m m

1

m

o ol ol

m m

ol o o o o oml

m X X X

ml 1 ml

X X

ml ml 1 m

x X

x

X X

x

ml ml ml ml m m ml

m 1

m m

1

m ml

m m

m m m m

m

m

m m

ml

m m

m

m

m

m

m

m m m m m m

m

m

m

m m

m

m m m m

m m m

m

o ol om om o o

ml

o

o m m

Table 1. Continue,d Family

Limidae Limopsidae

Lucinidae

Lyonsiidae Mactridae

Malleidae Myidae Mytilidae

Species

Divarilima albicoma (Dall, 1886 ) Lima caribaea d'Orbigny, 1842 2 Limaria pellucida (C . B. Adams, 1846 ) Limopsis aurita (Brocchi, 1814 ) Limopsis cristata Jeffreys, 187 6 Limopsis minuta Philippi, 183 6 Limopsis sulcata Verrill & Bush, 189 8 Anodontia alba Link, 180 7 Anodontia philippiana (Reeve , 1850 ) Codakia costata (d'Orbigny, 1842) * Codakia orbicularis (Linne, 1758 ) Codakia orbiculata (Montagu, 1808 ) Codakia pectinella (C . B. Adams, 1852 ) Divalinga quadrisulcata (d'Orbigny, 1842 ) Divaricella dentata (Wood, 1815 ) Lucina amianta (Dall, 1901 ) Lucina floridan a Conrad , 183 3 Lucina leucocyma (Dall , 1886 ) Lucina pectinata (Gmelin , 1791 ) Lucina pensylvanica (Linne , 1758 ) Lucina radians (Conrad, 1841 ) Lucina sombrerensis (Dall, 1886 ) Lucina trisulcata Conrad, 184 1 Lucinisca muricata (Spengler , 1798) * Lucinisca nassula (Conrad, 1846 ) Lucinoma filosu m (Stimpson, 1851 ) Myrtea sagrinata (Dall, 1886)* Parvilucina multilineata (Tuome y & Holmes, 1857 ) Entodesma beana (d'Orbigny, 1842 ) Lyonsia floridan a Conrad , 184 9 Anatina anatina (Spengler, 1802 ) Mactrotoma fragilis (Gmelin , 1791 ) Raeta plicatella (Lamarck , 1818 ) Rangia flexuos a (Conrad , 1840) * Spisula raveneli (Conrad, 1831 ) Malleus candeanus (d'Orbigny, 1842 ) Sphenia antillensis Dall & Simpson, 190 1 Amygdalum papyrium (Conrad , 1 846) Amygdalum politum (Verrill & Smith, 1880 ) Amygdalum sagittatum Rehder, 193 4 Botulafusca (Gmelin , 1791 )

Depth* Side§ Live Recs" L&QH No Pre - 190 0 191 0 192 0 193 0 1940 195 0 196 0 1970 1980 199 0 Florida date1 190 0 keys distribution UMLT UMLT T T T UT UMLT L UMLT UMLT T UMLT UML UMLT L UT UML UMLT UT UMLT UMLT L UMLT T UMLT UMLT ULD M UML UL UM UMLT U UM T LT UMLT

D ISO ISD D D D D ISD ISD ISD D ISD IS ISD D D SD ISD D ISD ISD ISD D D ISD ISD IS IS IS SD S S D SD

! OB OB O OB OB OB OB OB OB O O OB OB B OB OB OB OB OB B OB OB 0 B B B OB

X X

X X

-

X X

-

X X

X X X

X

X

X X X

x X X X X X X X

89 61 1 1 1 3 33 1 0 172 154 1 42 18 19 1 3 5 119 2 10 10 0 61 1 1 22 13 3 1 29 2 0 2 11 1 2 2 2 20

X X

X X X X X X X X X X

X X X

X X

1 m l m m— ml 1 __

m m m

mm mm __

m m _

- __ m m 1 ml m l - m ml 1 1 m 1 _ _ _ _ _ ml m ml m m 1 _ _ _ _ _

- - - -

m m

mm mm _ mmm

m m m -

- - -

m -

-

ml ml _ _ _ _ _ ml m l - m __ _ _ __ 1 _ _ _ _ _ 1 ml m __ _ _ 1 1 m ml _ _ _ _ _

-

mm - m

mm-

— m

-

X

1

_

_

_

__

-

m _ ! _ _

_

_

- _

X

ml -

m

m m m m m m

-

-

m m m m -

m

- _

-

m m l _ m

m m m m m m m

m_

ml m 1

_

-

l

m

X

_

-

l l

mo - om _ -o

_

0

mo -o oml -o -m ml om

-

ol - om -

m

-

l

oml ol oml -o

m om 0

-m -m -o ml

m-

l

1

-o

-

m

oml om l mo m

m m

l

0

Noetiidae Arcopsis Nuculanidae Nuculana

Nuculidae Ennucula

Ostreidae Crassostrea

Pandoridae Pandora Pectinidae Aequipecten

Brachidontes domingensis (Lamarck , 1819 ) Brachidontes exustus (Linne, 1758 ) Brachidontes modiolus (Linne, 1767 ) Crenella decussata (Montagu , 1808 ) Dacrydium elegantulum hendersoni Salas & Gofas, 199 7 Geukensia granosissima (Sowerby , 1914 ) Gregariella coralliophaga (Gmelin , 1791 ) hchadium recurvum (Rafinesque, 1820 ) Liobems castaneus (Say, 1822 ) Lithophaga antillarum (d'Orbigny , 1842 ) Lithophaga aristata (Dillwyn , 1817 ) Lithophaga bisulcata (d'Orbigny, 1842 ) Lithophaga nigra (d'Orbigny, 1842 ) Modiolus americanus (Leach, 1815 ) Modiolus modiolus squamosus Beauperthuy , 196 7 Musculus lateralis (Say , 1822 ) adamsi (Dall , 1886 ) Noetia ponderosa (Say , 1822 ) acuta (Conrad, 1832 ) Nuculana concentrica (Say , 1824 ) Nuculana pusio (Philippi , 1844) * Nuculana solidula (E . A. Smith, 1885) * Nuculana verrilliana (Dall , 1886) * tenuis (Montagu, 1808 ) Nucula aegeensis Jeffreys , 1879 * Nucula calcicola Moore , 197 7 Nucula crenulata A. Adams, 1856 * Nucula proxima Say, 182 2 rhizophorae (Guilding , 1828) * Crassostrea virginica (Gmelin , 1791 ) Cryptostrea permollis (Sowerby, 1871 ) Dendostrea frons (Linne , 1758 ) Ostreola equestris (Say , 1834 ) bushiana Dall, 188 6 Pandora inflata Bos s & Merrill, 196 5 glyptus (Verrill , 1882 ) Amusium laurentii (Gmelin, 1791 ) Amusium papyraceum (Gabb , 1873 ) Argopecten gibbus (Linne , 1758 ) Argopecten irradians (Lamarck , 1819 ) Argopecten lineolaris (Lamarck, 1819 ) Argopecten nucleus (Born , 1778 ) Brachtechlamys antillarum (Recluz , 1853 ) Caribachlamys imbricata (Gmelin , 1791 ) Caribachlamys mildredae (Bayer , 1941 ) Caribachlamys ornata (Lamarck , 1819 )

UML UML UML

IS IS IS ISD

OB OB OB OB

L M UML UL

j)

Q

S

0

UMLT

UMLT UMLT

LT UML

UMLT UMLT UMLT UMLT UMLT

UML

UMLT

MLT L

s

IS SD SD S S ISD IS ISD ISD SD D D D

UML

IS

UML T

IS _ ISD I IS I ISD IS SD ISD D SD ISD ISD SD IS IS IS S IS

UMLT

UMLT

L UL UML

UMLT

UML UT

UMLT

LT LT LT

UMLT

UML MLT UML

UMLT UMLT UMLT

UML

OB OB OB 0 OB OB OB OB OB OB OB OB

x X X X

55 69 49 20

x _ x X

X X X X

X X

3 3 11 26 6 19 23 60 26 27 118 5 14 g

x _

1

X

1

x X X

x X

OB OB OB OB

o

OB 0 _ OB OB O OB OB 0 O OB

X

_

X

_

X X X y

X

_ X X

X X

_ -

-

X

ml ml m1

-

-

ml ml ml ml ml m

1 1

I I

5 7 7 1 23 1 7 9 54 16 2 14 8 2 7 36 21 11 37 35 19 7 9

-

m -

x x

_

m m - m

m _ m -

__ _ _ - m _ - m 1m m m - m - m _ m m - m _ _

_ _ _ m _ m _ _ m -

__ __

_ _ _ _

m-

-

m

mm mm mm

oo o om mo

-

-

__

-o

_ m

__

l l

ol

m oml

-o

m

0 0

__ mm

-o mo

-

mm mm m-m

m

ol oml

m om

-

\ I \

o

OB g OB _ OB

m -

1

I 2 X X X X X X

ml ml ml ml

l

oml ol

1 _ _

1

_

1

_

_ X

_

_ _ _

1

x x x X X

x

m

- _

\

ml m m ml 1 ml m ml ml ml ml ml m

_ _

1

ml ml 1

-

X

1

_ _

-

-

-

m

m

__ _ _ _ _ __ _ _ - m m m _ - m m m m -1 1 _

m m _ _ _ _ _ m _ ml m m _ _ _

__ __ __

-o __ 0

_

m

m

mm

m

_ _

-m m-

mm mm mm __ mm

m m 0

__

m

-m m-

__ mo -o

ol m

1o

-

m

om mo 10

m-o

Table 1. Continued Family

Pectinidae

Periplomatidae Petricolidae Pharidae Pholadidae

Pinnidae

Plicatulidae Poromyidae Propeamusiidae

Psammobiidae Pteriidae Semelidae

Species

Caribachlamys sentis (Reeve , 1853 ) Cryptopecten phrygium (Dall , 1886 ) Euvola chazaliei (Dautzenberg, 1900 ) Euvola raveneli (Dall, 1898 ) Euvola ziczac (Linne, 1758 ) Laevichlamys multisquamata (Dunker, 1864) * Lindapecten exasperatus (Sowerby, 1842 ) Lindapecten muscosus (Wood , 1828 ) Lyropecten kallinubilosus (Bayer, 1943 ) Nodipecten nodosus (Linne , 1758 ) Spathochlamys benedicti (Verril l & Bush, 1897 ) Periploma anguliferum (Philippi , 1847 ) Periploma tenerum Fischer, 1882 Choristodon robustum (Sowerby, 1834 ) Petricola lapicida (Gmelin , 1791 ) Petricolaria pholadiformis (Lamarck , 1818 ) Ensis minor Dall, 190 0 Barnea truncata (Say, 1822) * Cyrtopleura costata (Linne , 1758 ) Martesia cuneiformis (Say , 1822) Martesia striata (Linne, 1758 ) Xylopholas altanai Turner, 197 2 Atrina rigida (Lightfoot , 1786 ) Atrina seminuda (Lamarck , 1819 ) Atrina serrata (Sowerby, 1825 ) Pinna carnea Gmelin, 179 1 Pinna rudis Linne, 175 8 Plicatula gibbosa Lamarck, 180 1 Cetoconcha margarita (Dall , 1886 ) Poromya granulata (Nys t & Westendorp, 1839 ) Poromya rostrata Render, 194 3 Cyclopecten sp . Propeamussium dalli (E. A. Smith, 1 885) Propeamussium pourtalesianum (Dall, 1886 ) Propeamussium sayanum (Dall , 1886 ) Asaphis deflorata (Linne , 1758 ) Heterodonax bimaculatus (Linne, 1758 ) Pinctada imbricata Roding, 179 8 Pinctada longisquamosa (Dunker, 1 852) 2 Pteria colymbus (Roding , 1798 ) Abra aequalis (Say , 1822 )

11 Depth* Side§ Live Recs L&Q^ No Pre - 190 0 191 0 192 0 193 0 1940 195 0 196 0 197 0 198 0 1990 Florida date1 190 0 keys distribution1^

UMLT MLT UMLT MLT LT

ISD D SD SD SD

OB OB 0 0 OB

M UML L ULT LT L M UMLT UMLT L L

S ISD S SD D

0 OB 0 0

IS IS

OB OB

L L UL UML UM UML UMLT

I D IS S SD ISD

x

X

x x

OB OB OB OB

x x x x

OB

x

UMLT T T M T L T T UML

D D D IS

OB

x

UML UMLT UMLT ULT

ISD ISD ISD SD

OB OB OB OB

x x

SD D D D

0

X X

80 8 11 16 27 0 7 35 1 25 6 1 1 22 26 1 1 0 2 1 4 1 10 2 4 51 0 35 2 2 1 1 1 1 1 12 0 110 59 59 12

x x x x X

X

x x x

X X

x X

X X

x X

ml m ml ml m ml m - \ ml _ _ _ _ _ ml m ml ml ml 1 _ _ _ _ _ ml m ml m - m m 1 m1 ml 1 _ _ _ _ _ ml 1 _ _ _ _ _ ml _ _ _ _ _ ml m m ml 11 ml m m m ml m - ml ml m - m m ml m ml - m m m 1 _ _ _ _ _

mm m m ml m m —m m m -m mm

lm — -

- 1

- mm

m

m m

-m - -

mm m

l

0

0

-

o

m -

m o 0

- mm

m m

m —

- -

-

m

—

o o

-

-

m

-

m

m—

m

-m

mm mm mm

m m

m

m

-

m m m

m

m

m m — lm

l

-

m m -

0

-

m — m

om om m om

l

om om om oml

Abra lioica (Dall, 1881 ) M Cumingia coarctata Sowerby, 183 3 UML Cumingia tellinoides vanhyningi Rehder, 193 9 U M Ervilia concentrica (Holmes , 1860 ) UML Ervilia nitens (Montagu, 1806 ) M Ervilia subcancellataE. A. Smith , 188 5 UML Semele bellastriata (Conrad , 1837 ) UML Semele proficua (Pulteney , 1799 ) UML Semele purpurascens (Gmelm, 1791 ) UML Semelina nuculoides (Conrad , 1841) * L Solecurtidae Solecurtus cumingianus Dunker, 186 1 M L Tagelus divisus (Spengler , 1794 ) U M Tagelus plebeius (LigMoot, 1786 ) U Solemyacidae Solemya occidentalis Deshayes, 185 7 UML Spondylidae Spondylus americanus Hermann, 178 1 UML Spondylus gussoni O. G. Costa , 182 9 L Spondylus ictericus Reeve, 185 6 UML Sportellidae Basterotia elliptica (Recluz , 1850) * Bastewtia quadrata (Hanley , 1843) * Tellinidae Cymatoica orientalis hendersoni Rehder, 193 9 M Leporimetis intastriata (Say, 1827 ) U M Macoma brevifrons (Say , 1834 ) UML MacomacerinaC. B. Adams , 184 5 UML Macoma constricta (Bruguiere, 1792 ) U Macoma mitchelli Dall, 189 5 U Macoma tageliformis Dall , 190 0 L Macoma tenta (Say, 1834 ) U L Strigilla carnaria (Linne, 1758 ) L Strigilla gabbi Olsson & McGinty, 195 8 L Strigilla mirabilis (Philippi, 1841 ) UML Strigilla pisiformis (Linne , 1758 ) L Tellidora cristata (Recluz, 1842 ) U Tellina aequistriata Say , 182 4 U L Tellina agilis Stimpson, 185 7 L Tellina alternata Say, 182 2 UML Tellina americana Dall, 190 0 L Tellina angulosa Gmelin, 179 1 L Tellina candeana d'Orbigny, 184 2 M Tellina consobrina d'Orbigny, 184 2 UML Tellina fausta Pulteney , 179 9 UML Tellina gouldii Hanley, 184 6 UML Tellina iris Say, 1822 UML Tellina laevigata Linne, 175 8 U M Tellina UneataTuTton, 181 9 U Tellina listen Roding, 179 8 UML Tellina magna Spengler, 179 8 UML Tellina martinicensis d'Orbigny, 184 2 L

LD O 2 m l TI SO Bx 3 3x m l- m -m - -o l L I S O B x 3 7 - m l - _ _ _ _ _ _ _O ml m T IS O O B 7 x m l m o l L I S O B - 4x 1 _ _ _ _ _ _ _ _ _ O T- 7 _ l _ _ _ _ _ _ _ _ _ _ _ TS DO Bx 1 6x m l- -m m m - o l T IS O O B x 3 0x m l -m - mm m om l T IS D O B - 2 2x m i lm m m m -o TB 3 x 1 ! T S D O - 5 m - _ _ _ _ _ _o m m LS O B x 6 m o m S B x i _ _ _ _ _ _ _ _ _ _ _ _ m B x l 2 x m l - -— - - - - -m om l T I S T S D O x 1 9x m l- m m m m m I _ _ i _ m m l - ---m m m m o T IS D O B x 4 3x Q x l Q x l T S D O B 5 _ i _ _ _ _ _ _ _ _ _ _ o L I S O B - l O x m l -m - m -o T IS D O B x 5 x l m m - om l T IS D O B x 31 m ---m - m o m 2 m m S B x i _ _ _ _ _ _ _ _ _ _ _ _ m i _ _ _ _ _ _ _ _ _ _ _ _ m TS D O B x l O - - - - - - - - - - m - o m 4 x l m l m - 3x 1 T IS D OB - 2 0x m l- m o - 2 - m l1 - LS B x 4 x m l - - m l TD O x 8 x m l m m l I B i _ _ _ _ _ _ _ _ _ _ _ _ m T S D O B x 8 x m l - - o m D O - 2x 1 - 2 x 1 m LO 8 x m l m TO - 7x 1 T IS DO B- 8 5x m lm l- m m m m lm m lo TI S O B x 3 0 x m l - - - - - m m - - o TI SO Bx 2 7- m l- m m - -o l LS O - 4x 1 o LS B x 9 x m l l m m m m x 3 9x m l m l -m m m m - om l T IS D O B TS O 6 x m l m T S D OB 7 x l o

Table 1. Continued Family

Species

Depth* Side§ Live Recs" L&Ql No Pre - 190 0 191 0 192 0 193 0 1940 195 0 196 0 197 0 198 0 1990 Florida date1 190 0 keys distribution^

Tellinidae

Tellina me m Say , 183 4 Tellina nitens C. B. Adams, 184 5 Tellina paramera Boss , 196 4 Tellina persica Bal l & Simpson, 190 1 Tellina probrina Boss , 196 4 Tellina punicea Born, 177 8 7H/ma ra<#ata Linne, 175 8 Tellina similis Sowerby , 180 6 Tellina squamifera Deshayes , 185 5 Tellina sybaritica Dall , 188 1 Tellina tampaensis Conrad , 186 6 Tellina texana Dall, 190 0 Tellina versicolor DeKay , 184 3 Bankia carinata (Gray , 1827 ) Nototeredo knoxi (Bartsch , 1917 ) Teredo clappi Bartsch , 192 3 Asthenothaerus balesi Rehder , 1 943 Asthenothaerus hemphilli Dall , 188 6 Thracia corbuloides Blainvill e 1824 *

UMLT L ULT L MLT UMLT UMLT UMLT ULT UL UMLT UMLT MU UL L ULT L

Teredinidae Thraciidae

Thracia phaseolina Lamarck, 1822*

Thyasiridae Trapezidae Ungulinidae Veneridae

Thracia stimpsoni Dall , 1886 * Thyasira trisinuata (d'Orbigny , 1842 ) Coralliophaga coralliophaga (Gmelin , 1791 ) Diplo donta punctata (Say , 1822 ) Diplodonta semiaspera Philippi , 183 6 Anomalocardia auberiana (d'Orbigny , 1842 ) Callista eucymata (Dall , 1890 ) Chione cancellata (Linne , 1767 ) Chione mazyckii Dall , 190 2 Chione paphia (Linne , 1767 ) Circomphalus strigillinus (Dall , 1902 ) Cyclinella tennis (Recluz, 1852 ) Dosinia discus (Reeve , 1850 ) Dosinia elegans (Conrad , 1 843) Globivenus rigida (Dillwyn , 1817 ) Globivenus rugatina (Heilprin , 1886 ) Gouldia cerina (C . B. Adams, 1845 ) Lirophora latilirata (Conrad , 1841 ) Macrocallista maculata (Linne , 1758 ) Macrocallista nimbosa (Ligntioot , 1786 )

LT T MLT UML UMLT UMLT UMLT UMLT UMLT LT MLT UMLT MLT UMLT T LT UMLT LT ULT ULT

Mercenaria campechiensis (Gmelin, 1791)

T

ISD D S D SD ISD ISD D I IS IS ISD I I S SD D D D S S IS ISD D ISD ISD D D SD SD D ISD D ISD

OB 0 0 O OB O OB OB OB OB OB OB B B O 0 OB OB O OB OB 0 O OB OB 0 OB OB OB

X

X X

X X X X X

X

X

X

X X X X

X X X

X X X

X

X V

104 3 4 1 15 1 39 128 11 10 18 18 28 1 1 2 3 3 2 ] 4 1 12 9 9 38 13 158 69 4 6 9 3 7 1 2 58 15 19 2 1

X

x X X

X X X X X X X

-

ml 1 _ ml

-

\ _ _ 1 _ _ ml m l - ml 1 ml _ ml ml m ml ml -

X

__ 1 1

-

\ \ 11

-

_

_

_ _

_

_ _ _

_

_

_

_

_ _

_ _

_ _

_

m m _

-

m m

_

_ _

_

_ _

_

_ _

_

-m - -

m m

m -

m -

oml -

- m - mm mm m l mm m m m l - m _ _ _ _ _ mm _ _ _ _ _ _ _ _ _ _ - - m -

_

-

_

m m -

_

-

_

_

o 0

oml 0

ol om oml oml ml 1 0

X X X X

X

X

X

X X X

ml m ml _ _ _ _ _ ml ml m ml ml m l - m m_ _ _ 1 m - ml 1 _ _ _ _ _ m ml _ _ _ _ _ ml m ml m ml _ _ _ _ _ ml mm - m

mm mm m- mm mm --m _ _ - -

- m - m m m mm m — m m - m _ _ m m -

- m—m -m

m m m m m — m m m

m — _ -

0

o oml oml m oml 0

om 1 om oml o ol

Verticordiidae

Mercenaria mercenaria forma notata (Linne, 1758) Parastarte triquetra (Conrad, 1846 ) UML Periglypta listen (Gray , 1838 ) UML Pitar cordatus (Schwengel, 1951 ) L Pitar fulminatus (Menke , 1828) L Pitar simpsoni (Dall , 1 895) UML Protothaca granulata (Gmelin, 1791)* Puberella intapurpurea (Conrad , 1849) UML Puberella pubera (Bory SaintVincent, 1827)* Timoclea grus (Holmes, 1858 ) UML Timoclea pygmaea (Lamarck , 1818 ) UML Tivela floridana Rehder , 193 9 U Transenella conradina Dall, 188 4 UML Transenella cubaniana (d'Orbigny, 1842 ) M Transenella culebrana Dall & Simpson, 1901 * Transenella stimpsoni Dall , 190 2 UM Haliris fischeriana (Dall, 1881) T Trigonulina ornata d'Orbigny, 1842 U Verticordia acuticostata Philippi, 184 4 L

M

T

I ISO O IS O DO D0 ISD O

T

SD O

B

T T

ISD O IS O I0 ISD O SO D I

B B

X

B B

X

T T T T

T L T

D0 D0

O B B B

– X

x X X

B

X

X

2 13 58 10 4 68 0 14 0 17 8 1 34 4 1 3 1 3 4

-

-

-

x

ml ml ml ml \ ml \

-

-

X

ml -

-

-

X

ml 1 \ 1m m m -

-

-

X X

x X

1

m m m m - m

m

mm

-

m

mm m mm

- -

m

m

m-

- -

-

m

m-

ni m

l

o om o 1 oml 0

ol 0 0

X X

-

-

ol o

-

-

1

m

m m-

- m

-

-

-

-

1

-

- m

-

-

-

-

r

a

-

-

*unverified identificatio n (unillustrated literature citatio n only , not part of a revisionary systematic work). Uj, Upper Keys; M, Middle Keys ; L, Lower Keys; T, Dry Tortugas. *i, intertidal; S, shallow; D, deep. § O, oceanside; B , bayside. "Number of records i n database, tyons & Quinn (1995). ! m, Museum specimen record ; o , original collectio n record; 1, literature record . 2 A11 Nomenclature follows Turgeon et al. (1998) except fo r those taxa indicated b y 2, which are modified according to recent systemati c research by the present authors .

380

P. M. MIKKELSE N & R . BIELE R

Fig. 2 . Frequency o f encounter o f Florida Keys bivalv e specie s from : (a ) all sources ( n = 309); (b ) origina l collectio n records onl y ( n = 179) .

(i.e. records/specie s i n th e database) , i s a fai r approximation of species rarity. Three hundred and nine (95% ) of the 32 5 specie s wer e represente d i n the databas e (th e remainin g 1 6 species , wit h '0 ' records i n Tabl e 1 , ar e know n onl y fro m dat a indicating 'Florida Keys' an d thus were not entered into the database) . Accordingly, it can be sai d that 40 species (12% ) were abundant (> 50 records), 96 species (29% ) wer e commo n (10-4 9 records ) an d 172 specie s (53% ) wer e rar e ( < 10 records) (Fig . 2a). T o eliminat e an y possibl e artefac t i n th e database cause d b y samplin g bia s o f othe r collec tors, thes e sam e statistic s ca n b e considere d fo r original collectio n record s onl y (17 9 species ; Fig . 2b): abundant , 1 7 specie s (9%) ; common , 7 3 species (41%) ; rare , 8 9 specie s (50%) . Th e mos t frequently collecte d specie s wer e Barbatia cancellaria (17 5 records , 10 2 origina l records) , Codakia orbicularis (17 2 records , 10 0 origina l records), Chione cancellata (15 8 records , 11 6 original records ) an d Codakia orbiculata (15 4 records, 11 3 original records) .

Bray-Curtis similarit y analysi s o f al l dat a b y Florida Key s regio n (Fig . 4 ) reveale d a regiona l northeast-southwest gradient , wit h greates t similarity (82% ) betwee n th e Uppe r an d Middl e Keys regions , an d leas t similarit y (72% ) betwee n the Dr y Tortuga s an d othe r Key s regions . Usin g original dat a onl y (17 6 species ; wit h Uppe r Keys , 132 species ; Middl e Keys , 13 9 species ; Lowe r Keys, 13 8 species; an d Dry Tortugas, 10 2 species) , similarities betwee n th e Upper, Middl e an d Lowe r Keys region s forme d a nea r trichotom y a t 87% , while Dr y Tortuga s remaine d mos t dissimila r (67%) to the other three . Most Florida Keys bivalves liv e on both side s of the island chain : 23 7 species (72% ) could be code d for ocean - o r bay side o f the Key s axis ; 5 7 species (17%) were recorded a s oceanside only; 26 species (8%) wer e baysid e only ; an d th e remainin g 15 4 species (47% ) were recorded fro m bot h ocean- an d bayside. The close similarit y betwee n Uppe r an d Middl e

Regional similarity Within the database of 6145 records , 6076 record s (99%) could be assigned to one of the Florida Keys zones. Whil e th e Upper , Middl e an d Lower zone s were nearly equally sampled, Dry Tortugas records represented less than half of each of the other zones (Fig. 3) , probably in part the result of its inaccessibility an d it s muc h smalle r are a compare d t o th e other thre e regions . Thre e hundre d an d si x o f th e 325 species (94%) were coded for at least one zone; 118 specie s (36% ) wer e recorde d fro m al l Florid a Keys zone s (UML T in Tabl e 1) ; 79 specie s (24% ) were restricte d t o a singl e zon e (Uppe r Key s 15 ; Middle Keys 10; Lower Keys 31; Dry Tortugas 23). The remainin g 10 9 specie s (33% ) wer e recorde d from tw o or more zones .

Fig. 3 . Sampling effor t - percentag e o f total bivalv e records fro m the four Florida Keys zones : Uppe r Key s (n = 1513), Middle Keys ( n = 1688), Lower Keys ( n = 2311) and Dry Tortugas (n = 565) .

MARINE BIVALVE S O F THE FLORIDA KEYS

381

Fig. 4 . Bray-Curtis similarity dendrogra m o f bivalve species presence/absence i n the four geographica l region s of the Florida Keys. Total analysis, 30 6 species; Uppe r Keys, 201 species; Middl e Keys , 17 8 species; Lowe r Keys , 241 species; Dry Tortugas, 19 4 species.

Keys region s coul d b e a resul t o f th e ecologica l differences betwee n ocean - an d bayside . Florid a Bay, bayside of the Upper and Middle Keys (only), is overal l shallo w i n dept h (1.5- 5 m) an d experi ences greater wate r temperature an d salinity fluctuations tha n doe s th e oceansid e o f th e Uppe r an d Middle Key s (Chiappon e I996b). Ther e ar e 1 2 bivalve species unique to Florida Ba y (although all are rare in frequency) an d another seven are unique to baysid e o f th e Lowe r Key s (outsid e o f Florid a Bay). T o test whethe r th e stron g similarit y o f th e Upper an d Middle Key s is due t o the influenc e of Florida Bay , a Bray-Curtis similarit y analysi s wa s conducted i n whic h bay - an d oceansid e list s fo r Upper, Middl e an d Lowe r Key s wer e separate d (Dry Tortugas remained a s a single unit because it s oceanic locatio n doe s no t allo w distinctio n o f exposures). Th e resul t o f thi s analysi s (Fig . 5 ) shows that the Upper and Middle baysid e together form a grou p (71 % similarity ) whic h ha s lowes t similarity (64% ) wit h th e remainin g area s combined, includin g th e Dr y Tortugas . Baysid e of the Lower Keys showed stronger similarity with the oceansides o f al l regions , plu s th e Dr y Tortugas . This suggest s tha t the Florid a Ba y exert s a stron g influence o n the bivalve fauna o f the Florida Keys. About one-quarter of Florida Keys bivalves were recorded from al l depths, from intertida l to shallow

to deep waters ; 269 specie s (83% ) were coded fo r depth zone ; 8 5 specie s (26% ) wer e recorde d a s ranging fro m shallo w t o deep ; 1 4 specie s (4% ) were recorde d fro m onl y intertida l depths ; 2 9 species (9% ) wer e recorde d fro m onl y shallo w depths; an d 5 8 specie s (18% ) wer e recorde d fro m only deep depths. Forty-three specie s (13%) ranged from intertida l t o shallo w an d 3 8 specie s (12% ) ranged from shallo w to deep . The dissimilarit y o f th e Dr y Tortuga s t o th e remaining Key s region s coul d b e a n artifac t o f deep-water sampling - 1 5 of the 23 species unique to the Dry Tortugas are from dee p water (the othe r eight ar e o f unrecorde d depth) . Alternatively , th e Dry Tortuga s coul d b e dissimila r du e to : (1 ) a genuinely different faun a (associated with its lesser habitat diversity and/o r recruitment by larvae fro m other regions) ; o r (2 ) a n artefac t o f overal l poo r sampling (se e Fig . 3) . To test whethe r deep-wate r records are the primary cause of the dissimilarity of the Dr y Tortuga s fauna , a Bray-Curti s similarit y analysis wa s conducte d i n whic h al l deep-wate r records were first eliminated. Thi s resulted in a data set of 270 species from intertidal o r shallow depths , rather evenl y distribute d fro m Uppe r ( n = 191 spp.), Middl e ( n = 169), Lowe r ( n = 220) an d Dr y Tortugas ( n = 133) regions . Th e resultin g dendro gram wa s nearl y identica l t o tha t produced b y al l

382

P. M. MIKKELSE N & R . BIELE R

Fig. 5 . Bray-Curtis similarity dendrogram of bivalve species presence/absence i n the four geographica l region s of the Florida Keys , with Upper, Middle and Lower Key s separated into bay- and oceanside records . Tota l analysis, 256 species; uppe r oceanside, 14 7 species; middle oceanside, 14 9 species; lowe r oceanside, 16 0 species; uppe r bay side, 119 species; middle bayside , 9 1 species; lower bayside, 12 9 species; Dry Tortugas, 19 2 species.

records (Fig . 4) , wit h a slightl y stronge r affinit y (82%) betwee n Uppe r an d Middl e Keys , an d a slightly weake r similarit y (63% ) betwee n Dr y Tortugas and all other regions. The difference in the Dry Tortuga s i s likel y no t a n artefac t o f fewe r samples overall , becaus e thi s metho d o f analysi s condenses on e o r man y record s equall y int o a single entry. It is thus likely that the Dry Tortugas is faunistically distinct , a n assumptio n tha t i s als o subjectively corroborate d b y th e conspicuou s apparent absenc e o f severa l ubiquitou s Key s bivalves (e.g . Isognomon alatus, Brachidontes exustus, Argopecten nucleus, Pinctada imbricata, Trachycardium muricatum). One of the factors that could pla y a rol e i s th e differen t exposur e o f th e Dry Tortugas . Ther e i s evidenc e tha t th e Gul f o f Mexico Loop Curren t has a significant influenc e in this region , whil e othe r area s o f th e Florid a Key s (such a s th e Lowe r Keys ) ar e generall y protecte d from th e Loo p Curren t b y th e blockin g effec t o f larger islands (Shinn et al 1989) .

Losses and gains Within th e databas e of 6145 records , 502 2 record s (82%) representin g 26 1 specie s (80% ) wer e associated wit h dated collection records . Excluding the 332 3 record s amasse d b y origina l collection s for thi s survey , th e vas t majorit y o f th e date d records wer e collected afte r 193 0 (1572 , or 92% of 1699 museu m an d literatur e records) . Figur e 6 a shows this pattern clearly, with a distinct lull in data being amasse d durin g th e perio d fro m 190 0 t o 1929. Th e greates t numbe r of records (467 , o r 8% of th e total ) wa s generate d i n th e 1960s . Th e percentage o f the tota l specie s recorde d fro m eac h decade show s th e sam e pattern , althoug h th e greatest percentag e i s i n th e 1990s , reflectin g th e original collection s mad e durin g thi s stud y (Fig . 6b). Surprisingly , a fai r numbe r o f records (63 , o r 1%) and species (48 , o r 18% ) wer e recorde d fro m the decades prior to the year 1900 , with the earlies t from th e 1870s .

MARINE BIVALVE S O F TH E FLORID A KEYS

383

Fig. 6 . Coverage b y decade of collection, (a) Number o f literature and museum record s (i.e . excludin g 332 3 original collection records ) pe r decade, (b) Percentage of total specie s (327) recorde d from each decade: pre-1900, n = 48 species; 1900s, n = 1; 1910s, n = 11; 1920s, n = 4; 1930s , n = 59; 1940s , n = 90; 1950s , n = 82; 1960s, n = 123 ; 1970s, n = 124; 1980s , n = 53; 1990s , n = 201.

The tempora l patter n o f collectio n record s correlates subjectivel y wit h accessibilit y o f th e Keys, vi a constructio n o f th e Flagler' s extende d East Coast Railroad (completed in 1912), converted to th e Oversea s Highwa y (U S Rout e 1 ) i n 193 8 (following destructio n o f the railroa d b y th e 193 5 hurricane). Severa l interestin g specie s anecdote s also emerg e fro m thes e date d dat a relate d t o th e human influenc e i n th e Keys . Firstly , Nodipecten nodosum, th e popula r 'Lion' s Paw ' scallop , tha t lives o n deep-wate r ledge s an d (nowadays ) shipwrecks, was not recorded before the 1950 s bu t has been collected ever y decad e sinc e then; this is probably strongl y relate d t o th e developmen t o f scuba divin g i n th e area . Secondly , tw o specie s of brackish-wate r fals e mussels , Mytilopsis leucophaeata an d M . sallei, hav e onl y bee n recorded from the 1990s in the Upper Keys. Both of these species ar e otherwise widely distributed in the western Atlanti c (Marell i & Gra y 1983 ) bu t hav e not been previously recorded from th e Keys, where marine habitat s ar e largel y oceani c i n salinity . Although a direct correlatio n ha s not been prove n

and the present population s ar e small , thei r recen t introduction coul d b e th e anthropogeni c resul t o f increased traffi c o f recreationa l boat s (t o whic h these mussel s attach ) and/o r increase d freshwate r input int o Florid a Ba y throug h extensiv e channelling i n southern Florid a an d the Everglade s (NOAA 1996) . There are no currently active commercial bivalve fisheries i n Florid a Key s waters . However , th e impact o f marine-lif e collector s (fo r the commer cial an d recreationa l aquariu m trade ) ha s bee n substantial throug h remova l o f larg e quantitie s o f 'live rock ' an d rubble , an d th e targetin g o f charismatic macrofauna l species . A dramati c example was reported b y Bohnsack et al (1994 ) of annual collection s o f mor e tha n 5 0 000 'Roug h Fileclams' (i n thi s contex t encompassin g th e tw o limid specie s Ctenoides scaber an d C . floridanus) during the period 1990-1992 . The lac k o f a collectin g recor d doe s no t prov e that a species wa s i n fact absent , therefore specie s losses or gains over time, in the absence of previous species inventorie s fro m th e Keys , ar e difficul t t o

384

P. M. MIKKELSE N & R . BIELE R

Fig. 7 . Bray-Curtis similarity dendrogram of bivalve specie s o f the Florida Keys . Florida Bay , n = 136 species; oceanside group, n = 214; and Dry Tortugas, n = 191 (see text). Eastern Florida, n = 240; Gul f of Mexico, n = 402; Cuba, n = 364; Yucatan , n = 238. Total analysis, 549 species.

prove. I f a sufficien t quantit y o f record s fro m a single locatio n (i.e . singl e islan d o r reef ) coul d b e assembled, change s i n th e faun a migh t becom e apparent i f the y hav e occurred . I n thi s database , restricted a s it is to bivalves, the localities wit h the greatest numbe r o f record s ar e Maratho n (742) , Key Larg o (702) , Ke y Wes t (613) , Grass y Ke y (274), Missouri Key (241), Lower Matecumbe Key (231) an d Summerlan d Ke y (214) . Unfortunately , the vast majority of records i n each o f these set s i s from th e 1990 s an d the sprea d of data across othe r decades is too thin to be informative. This is due in part t o the deficient attentio n pai d t o Florida Key s bivalves (a s oppose d t o gastropods ) b y bot h malacological author s and collectors. An y possibl e analyses of this kind must await the addition of data on othe r mollusca n classe s (e.g . gastropod s currently in preparation by the present authors). Taking th e Florid a Key s a s a whole , specie s occurrences acros s th e decade s recorde d b y thi s survey indicat e littl e specie s turnove r i n mos t bivalves. Al l abundan t specie s an d nearl y al l common specie s rang e int o th e present decade . Of

the 61 species no t recorded fro m th e 1990s , al l but six are rare (fewer than ten records) in the database. Likewise, o f the specie s no t recorded sinc e earlie r decades (thre e no t sinc e th e 1930s , fou r no t sinc e the 1940s , tw o not since the 1950 s an d 1 3 not since the 1960s) , al l rank as rare, an d so probably d o not reflect losses . Anecdotal observation s relat e fewe r encounters along the main highway (US Route 1 ) in certain 'collectible ' mollusca n specie s (e.g . th e gastropod Nerita peloronta, althoug h larg e popu lations of this species occur in areas less exposed to the casual collector). Habita t shift s fro m natura l to artificial substrat a ar e als o eviden t i n certai n species, e.g . Isognomon alatus, a species formerl y best associated wit h mangrove prop roots that now successfully populates concret e seawall s and bridge abutments.

Comparative analyses To compare th e bivalve species compositio n o f the Florida Key s wit h thos e o f othe r wester n Atlanti c locations, a sequenc e o f Bray-Curti s similarit y

MARINE BIVALVE S OF TH E FLORID A KEY S

analyses was performed. The non-Keys localities in all analyses formed two consistent groups: (1) Cuba and th e Gul f o f Mexic o (67 % similarity) ; an d (2 ) Yucatan an d easter n Florid a (75%). I n th e firs t analysis, the Florida Key s were treated a s a single entity. Th e resul t showe d th e Key s faun a t o b e closer in similarit y t o Yucata n and eastern Florid a (74%) than to Cuba and the Gulf of Mexico (71%). In th e secon d analysis , th e Key s faun a wa s spli t because earlie r test s (Fig s 4 an d 5 ) showe d th e Keys t o b e compose d o f severa l differen t fauna l components: (1 ) Uppe r an d Middl e Key s ba y side (Florida Bay) ; (2) Upper, Middle an d Lower Keys oceanside (plu s Lowe r Key s ba y side; oceansid e group); (3 ) th e Dr y Tortugas . I n thi s secon d analysis (Fig . 7) , th e separate d Key s component s retained thei r earlie r relationships (se e Fig. 5): Dry Tortugas wa s mos t simila r t o th e oceansid e grou p (79% similarity) , with the Florida Ba y less simila r to the other two (60% and 70%, respectively). The final tw o analyse s wer e conducte d b y removin g either Florid a Ba y o r bot h Dr y Tortuga s an d th e oceanside group; these analyses helped to elucidate the relationship s o f eac h o f thes e tw o combine d areas t o th e fou r non-Key s regions . Th e result s showed th e 'oceansid e plu s Tortugas ' grou p wit h greatest similarit y t o Yucata n and easter n Florid a (68%), whil e Florid a Ba y showe d rathe r lo w similarity (54% ) wit h th e non-Key s regions . Th e similarity matri x for the dendrogram in Fig. 7 (th e second analysis ) show s tha t Florid a Ba y had onl y 46-47% similarit y wit h Cub a an d th e Gul f o f Mexico. The relationship o f the Keys fauna t o that of th e Gul f i s perplexin g i n vie w o f hydrologica l influence o f th e Gul f o f Mexic o Loo p Curren t (Shinn et al 1989) , and long-term net flow from the Gulf thoug h tida l channel s o f th e Middl e an d Lower Key s (Smit h 1994) . Th e clos e similarit y with Yucatan, however, may relate to the northward flow of the Florida Current, past the eastern coast of Yucatan, along th e Keys and north to join the Gulf Stream (NOA A 1996) . These result s shoul d no t b e overinterprete d because they are based on bivalve data only (rather than tota l mollusca n faunas ) and , additionally , because th e comparativ e list s hav e no t bee n a s rigorously prepare d a s the present list for the Keys. The completenes s o f th e latte r determine s th e accuracy o f similarit y indice s i n comparativ e analyses an d point s t o th e nee d fo r robus t molluscan survey s i n critica l tropical/subtropica l regions (e.g . Bahamas , Bermuda , Grea t Barrie r Reef). I n spit e o f thes e shortcomings , severa l interesting indication s emerg e fro m thes e results : (1) th e Florid a Ba y bivalv e faun a i s distinctl y different, showin g lo w similarit y no t onl y agains t the res t o f th e Key s bu t als o agains t othe r teste d western Atlanti c localities ; (2 ) th e Dr y Tortuga s

385

bivalve fauna, despite the differences show n earlier within the Keys , i s more simila r t o the rest o f the Keys (o r mor e accurately , th e oceansid e group ) than to other western Atlantic regions.

Conclusions • Bivalve s o f th e Florid a Key s compris e 32 5 species, representin g a 100 % increas e ove r th e single previously assembled list (Lyons & Quinn 1995). Accordin g to frequency of encounter, 15 3 species (47% ) ar e commo n t o abundant . Th e most commo n specie s ar e Barbatia cancellaria, Codakia orbicularis, C . orbiculata an d Chione cancellata. • Florid a Key s bivalves ar e mainly tropical , wit h 96% o f th e specie s rangin g southwar d fro m th e Keys into th e wester n Atlanti c tropics . Th e faunal lis t include s n o endemic s an d n o threatened o r endangere d species , althoug h past overharvesting fo r th e aquariu m trad e warrant s continued vigilance . Tw o recentl y introduce d species appear to be due to increased boat traffi c and brackish habitat. No species losses over time were eviden t fro m date d record s bu t change s in abundance alon g th e mai n highwa y throug h th e Keys, an d i n habita t (fro m natura l t o artificia l substrata), are noticeable. Within the Keys, about one-third o f bivalv e specie s inhabi t al l Key s zones (Upper, Middle an d Lower Keys, and Dry Tortugas); 72 % o f al l specie s occu r o n bot h bayside an d oceanside of the island chain . • Museu m collection s wer e mos t successfu l i n generating the species list, producing 77% of the total, an d 62 species no t found b y other sources . Extensive origina l collectin g effort s ove r fiv e years capture d 55 % an d produce d th e bes t detailed information , includin g live-dea d dis tinctions. Literatur e source s (includin g news letters an d agency reports) produced 73 % of the species, bu t an exhaustive searc h o f the massiv e traditional literatur e (i.e . books , peer-reviewe d journals) recovere d onl y 44% . Biodiversit y studies tha t d o no t tak e advantag e o f thes e multiple source s (eac h capturin g taxa missed b y the othe r methods) , especiall y valuabl e existin g museum collections , ris k missin g significan t portions of the known fauna o f a region. Review of traditiona l literatur e alon e i s viewe d a s th e least effective approach . • Accordin g t o bivalve data , a latitudinal gradien t in fauna l similarit y exist s fro m th e Uppe r Key s south westwards to the Dry Tortugas. When bayand oceansid e ar e considere d separately , th e bayside o f th e Uppe r an d Middl e Key s (i.e . components o f the Florid a Bay ) i s show n t o b e the mos t divergent ; th e bivalv e fauna s o f thes e two area s ar e ver y similar , bu t togethe r diffe r

386

P. M . MIKKELSE N & R . BIELER

substantially fro m al l othe r areas , bay - o r oceanside. The faunisti c differenc e in the Dry Tortugas i s no t du e t o biase d o r undersampling and noticeabl y lack s a numbe r o f otherwis e ubiquitous Florida Key s bivalves. • I n comparison with fou r othe r western Atlantic regions (easter n Florida , th e Gul f o f Mexico , Cuba an d Yucatan) , th e bivalve s of th e Florid a Keys are closest t o those of Yucatan and eastern Florida. Florid a Ba y agai n showe d th e lowes t similarity, no t onl y wit h othe r Key s area s bu t also wit h al l comparativ e regions . Th e Dr y Tortugas i s mor e simila r t o the res t o f the Keys than t o othe r wester n Atlanti c regions . Thes e results ar e considere d preliminar y to : (1 ) improvement o f comparativ e fauna l lists ; (2 ) completion o f th e Florid a Key s mollusca n survey. We wish to gratefully acknowledge B . Haskell (FKNMS) , D. Savag e (NOAA ) an d M . Ric e (Smithsonia n Marin e Station, F t Pierce , Florida ) fo r thei r interes t an d fo r facilitating ou r field work through permit s (FKNM S 080 98) an d practica l assistance ; M . Ric e (Smithsonia n Marine Station , F t Pierce , Florida ) an d J . Lea l (BMSM ) for additiona l permits ; T . Collins , Florid a Internationa l University, and the crew of the R/V Bartlett for facilitating collections i n th e Marquesa s an d Dr y Tortugas ; W . G . Lyons (Florida Department o f Environmental Protection ) and B . W . Gotthol m (NOAA ) fo r unpublishe d dat a an d interagency reports ; G . Rosenber g (ANSP) , J . Lea l (BMSM), H . Chanc y (SBMNH) , C . Stur m (CMNH) , T . Pearce an d A . F . Chadwic k (DMNH) , D . Krum m (HBOM), an d M. G . Harasewyc h (USNM ) for acces s t o the museum collection s under their care ; and A. Littman , L. Crowley, J. Slapcinsky, M. Baker, J. Karb, K. Mobley, C. Breedlove , D . Gonsalves-Jackson , C . Miles , B . Kubricht, R . Pric e an d C . Bea r fo r field/collection s assistance and/or data entry. Field an d laboratory wor k in Florida wa s facilitate d i n part throug h Visiting Scientists Awards by the Smithsonian Marin e Station ; M . Rice an d the statio n staf f ar e gratefull y acknowledge d fo r thei r support. Additiona l fiel d suppor t wa s provide d ove r th e course o f thi s projec t b y Harbo r Branc h Oceanographi c Institution (F t Pierce, Florida), DMNH and AMNH. Field collecting i n th e Florid a Key s wa s supporte d throug h supplementary funding fro m th e Bertha LeBus Charitabl e Trust an d FMNH' s Marshal l Fiel d Fund . Thi s i s Smithsonian Marine Station contribution no. 504 .

References ABBOTT, R. T. 1950. Voyage s of the 'Eolis'. Johnsonia, 2 , 219-220. 1974. American Seashells: th e Marine Mollusca o f the Atlantic and Pacific Coasts of North America, 2nd Edition. Va n Nostrand Reinhold , Ne w York. AGUAYO, C . G . & JAUME , M. L . 1947-1948 . Catalogo d e Los Moluscos d e Cuba, nos. 1-363. Privatel y published, Havana , Cuba . BOHNSACK, J . A. , HARPER , D . E . & MCCLELLAN , D . B .

1994. Fisherie s trend s fro m Monro e County , Florida. Bulletin o f Marine Science, 54 , 982-1018. Boss, K . J . & MERRILL , A . S . 1965 . Th e famil y Pandoridae i n th e wester n Atlantic . Johnsonia, 4 , 181-216. CARR, M . R . 1997 . PRIMER User Manual: Plymouth Routines in Multivariate Ecological Research. Plymouth Marine Laboratory, Plymouth . CHIAPPONE, M . 1996a . Site Characterization fo r th e Florida Keys National Marine Sanctuary and Environs, Volume 1. Geology and Paleontology of the Florida Keys an d Florida Bay. Th e Natur e Conservancy & The Preserver, Zenda , Wisconsin . 1996Z?. Site Characterization fo r th e Florida Keys National Marine Sanctuary and Environs, Volume 2. Oceanography and Shallow-Water Processes o f th e Florida Keys and Florida Bay. The Nature Conservanc y & Th e Preserver , Zenda , Wisconsin. CLENCH, W . J . & TURNER , R . D . 1950 . Th e gener a Sthenorytis, Cirsotrema, Acirsa, Opalia an d Amaea in the western Atlantic . Johnsonia, 2 , 221-248. DALL, W . H. 1886 . Repor t o n th e result s o f dredging b y the Unite d State s Coas t Surve y Steame r 'Blake' . XXIX. Repor t o n the Mollusca. Par t I. Brachiopoda and Pelecypoda . Bulletin o f th e Museum o f Comparative Zoology, Harvard University, 12 , 171-318, pis 1-9 . 1889. Reports o n the results o f dredging, unde r th e supervision o f Alexande r Agassiz , i n th e Gul f o f Mexico (1877-78 ) an d i n th e Caribbea n Se a (1879-80), b y th e U . S . Coas t Surve y steame r 'Blake', Lieut.-Commander C. D. Sigsbee, U . S. N., and Commande r J . R . Bartlett , U . S . N. , commanding. XXIX . Repor t o n th e Mollusca . Par t 2. Gastropod a an d Scaphopoda . Bulletin o f th e Museum o f Comparative Zoology, 18 , 1-492 , pi s 10-40. EKDALE, A . A . 1974 . Marin e mollusc s fro m shallow water environment s ( 0 t o 6 0 meters ) of f th e northeast Yucatan coast, Mexico. Bulletin o f Marine Science, 24, 638-668. ESPINOSA, J., FERNANDEZ-GARCES , R . & ROLAN , E . 1994 . Catalogo de los moluscos marino s actuale s de Cuba. Cuadernos Investigaciones Biologica (Bilbao), 18 , 85-154. GUNDERSEN, R . W . 1998 . Th e Seashells o f Sanibel an d Captiva Islands. Privatel y published , Kenosha , Wisconsin. HAAS, F . 1940 . Ecologica l observation s o n th e commo n mollusks o f Sanibe l Island , Florida . American Midland Naturalist, 24 , 369-378. HENDERSON, J. B. 1911. Extracts fro m the log of the Eolis. The Nautilus, 25 , 71-72, 81-82. 1913. Marine shells from drif t o n Upper Matecumb e Key, Florida. The Nautilus, 27 , 59-60. 1914. Notes. Th e Nautilus, 27 , 120 . HOFFMEISTER, J . E . & MuLTER , H . G . 1968 . Pleistocen e limestones o f the Florida Keys. In: GINSBURG , R . N. (ed.) Guidebook for Field Trip. Geologica l Societ y of America, Miami, Florida, 1 , 57-61. HOUBRICK, R . S . 1987 . Transfe r o f Cerithiopsis crystallina Dal l t o th e genu s Varicopeza Griindel ,

MARINE BIVALVE S O F TH E FLORIDA KEYS

387

Lagoon, Florida . Bulletin o f Marine Science, 57 , family Cerithiida e (Prosobranchia : Gastropoda) . 94-127. The Nautilus, 101 , 80-84. MITCHELL-TAPPING, H . J . 1980 . Depositiona l histor y o f JAAP, W. C. 1984 . Th e Ecology of th e South Florida Reefs: the oolit e o f th e Miam i Limeston e formation . a Community Profile. Unite d States Fish & Wildlife Florida Scientist, 43, 116-125. Service, Washington , DC, FWS/OBS-82/08. NOAA (NATIONA L OCEANI C & ATMOSPHERI C JOHNSON, C . W . 1934 . Lis t o f marin e Mollusc a o f th e ADMINISTRATION). 1996 . Florida Keys National Atlantic coas t fro m Labrador to Texas. Proceedings Marine Sanctuary, Final Management of th e Boston Society o f Natural History, 40 , Plan/Environmental Impact Statement. Volume 1-204. I-III. Unite d State s Governmen t Printin g Office , KID WELL, S. M. i n press. Ecological fidelit y of molluscan Washington, DC . death assemblages . In: ALLER , J . Y, WOODIN , S . A. PILSBRY, H . A . 1955 . Another Florida n Conus. Th e & ALLER , R . C . (eds ) Organism-Sediment Nautilus, 69, 47-48, pi. 3. Interactions. Bell e W . Baruc h Symposium , & OLSSON , A . A . 1953 . Material s fo r a revision o f University o f Sout h Carolin a Press , Columbia , i n east coas t an d Florida n volutes . Th e Nautilus, 67 , press. 1-13, pi s 1-3. LEE, H . G . (WIT H TH E JACKSONVILL E SHEL L CLUB) . REED, J . K . & MIKKELSEN , P . M . 1987 . Th e mollusca n 1999. Cedar Ke y Marine Mollusks. Worl d Wid e community associate d wit h the scleractinia n coral , Web address : http://home.sprynet.com/~wfrank / cedarkey.htm. Oculina varicosa. Bulletin o f Marine Science, 40 , LIFE, R . 1984 . Tamp a Ba y Shells . Conchologists o f 99-131. SHELTON, D . N . 1997 . A Systematic List o f Mollusks America Bulletin, 12, 26-27'. in the Northern Gulf of Mexico off the Coast LIPKA, D . A . 1974 . Biota o f th e West Flower Garden of Alabama. Worl d Wid e We b Address : Bank. Gulf Publishing Company, Houston. http://fly.hiwaay.net/Mlwills/marine/alamarsp.html. LYONS, W . G . 1989 . Nearshor e marin e ecolog y a t Hutchinson Island , Florida : 1971-1974 . X L SHINN, E. A., LIDZ, B. H., HALLEY, R. B., HUDSON , J. H. & Mollusks. Florida Marine Research Publication, KINDINGER, J. L. 1989 . Reefs o f Florida an d th e Dr y 47, 1-131 . Tortugas. Field Trip Guidebook T176. America n 1997. Preliminary Check-list of Littoral, Estuarine, Geophysical Union , Washington, DC. and Shallow-water Marine Mollusks of Florida. SMITH, N . P . 1994 . Long-ter m Gulf-to-Atlanti c transport Unpublished report (copy on file in reprint library of through tidal channels in the Florida Keys . Bulletin Division o f Invertebrat e Zoology , America n of Marine Science, 54, 602-609. Museum of Natural History, New York). STEGER, D . 1962 . Check List, Ba y an d Beach Mollusca, & QUINN , J . F. , J R 1995. Appendi x J . Marin e an d West Coast of Florida, Cedar Keys to Marco Id. terrestrial specie s an d algae : Phylu m Mollusca . Unpublished report (copy on file in reprint library of Florida Keys National Marine Sanctuary Draft Delaware Museum of Natural History, Wilmington). Management Plan/Environmental Impact THOMPSON, A . R. , McGiNTY , P . L . & McGiNTY , T . L . Statement, Volume III. Unite d State s Governmen t 1951. Dredgin g fro m th e cruise r Triton. Th e Printing Office , Washington , DC, J-10-J-26. Nautilus, 65, 37^3. McGiNTY, P. L. 1955 . New marine mollusks from Florida . TURGEON, D . D. , QUINN , J . F. , JR , BOGAN , A . E . E T AL. Proceedings of the Academy of Natural Sciences of 1998. Common an d Scientific Names o f Aquatic Philadelphia, 107 , 75-85. Invertebrates from the United States and Canada: 1962. Caribbea n marin e shells . Th e Nautilus, 76 , Mollusks, 2n d Edition. America n Fisherie s Society , 39-^4, pi. 3. Special Publications , 26. & McGiNTY , T . L . 1957 . Dredging fo r dee p TURNER, R. D. & Boss, K. J. 1962 . Th e genus Lithophaga water shell s i n souther n Florida. Th e Nautilus, 71 , in the western Atlantic. Johnsonia, 4, 81-116. 37^7. VITTOR (BARR Y A. ) & ASSOCIATES , INC . (FOR NOAA, SILVER SPRING , MARYLAND) . 1998 . Florida & NELSON , M . M . 1972 . Mollusca Dredged of f Pompano Beach, Florida, in 10 Fathoms. Keys to Dry Tortugas Benthic Community Unpublished report (copy on file in reprint library of Assessment. Worl d Wid e We b Address : http://ccma.nos.noaa.gov/datapg2.html. Division o f Invertebrat e Zoology , America n YOKES, H. E. & YOKES, E. H. 198 4 (1983). Distribution of Museum of Natural History, New York). shallow-water marin e Mollusca , Yucata n Peninsula , MARELLI, D . C . & GRAY , S . 1983 . Conchological Mexico. Mesoamerican Ecology Institute, redescriptions o f Mytilopsis sallei an d Mytilopsis Monograph 1; Middle American Research Institute, leucophaeta o f th e brackis h wester n Atlantic . Th e Publications, 54. Veliger, 25 , 185-193 . Voss, G. L., BAYER , F. M., ROBINS , C . R. , GOMON , M . & MARSZALEK, D. , BABASHOFF , G. , JR , NOEL , M . R . & LARGE, E . T . 1969 . A Report t o th e National Park WORLEY, D . R . 1977 . Ree f distributio n i n sout h Service, Department of the Interior, On the Marine Florida. Proceedings o f th e Third International Ecology of the Biscayne National Monument. Coral Reef Symposium, 2 , 223-229. Institute o f Marin e an d Atmospheri c Sciences , MlKKELSEN, P . M. , MlKKELSEN , P . S . & KARLEN , D . J . University of Miami . 1995. Mollusca n biodiversit y i n th e India n Rive r

This page intentionally left blank

Genetic relationships o f Mytilus galloprovincialis Lamarc k populations worldwide: evidence from nuclear-DNA markers CLAIRE DAGUIN & PHILIPPE BORSA Laboratoire Genome Populations Interactions and IRD, Station Mediterraneenne de rEnvironnement Littoral, 1 Quai de la Daurade, 34200 Sete, France (e-mail: daguin @ univ-montp2.fr) Abstract: Allozym e survey s o f geneti c variatio n i n Mytilus galloprovincialis Lamarc k throughout th e worl d hav e identifie d thre e group s withi n thi s species : a northeaster n (NE ) Atlantic grou p tha t als o include s th e M . galloprovincialis populatio n o f Sout h Africa , a Mediterranean group that also includes the M. galloprovincialis populations from th e eastern and the western coast s o f the Nort h Pacific , an d a n Australasian group . Hypothese s that have bee n proposed t o account for the genetic differentiation patterns and disjunct, worldwide distribution of M . galloprovincialis includ e th e recen t introductio n o f thi s specie s int o th e souther n hemisphere an d the North Pacific through human agency, and an alternative hypothesis that each of th e thre e groups i s endemic . I n thi s study , tw o nuclear-DN A marker s (th e polyphenoli c adhesive protein gene G/w-5'and the first intron of the actin gene mac-1) were used to investigate in mor e dept h th e geneti c relationship s amon g M. galloprovincialis populations. Sample s wer e taken betwee n 199 6 an d 199 9 fro m California , th e N E Atlantic , the Mediterranea n Sea , Sout h Africa, Korea , Wester n Australia , Tasmani a an d Ne w Zealand . N E Atlanti c M . edulis L . wer e used a s a n outgroup . Whil e al l M . galloprovincialis sample s wer e fixed , o r nearl y so , fo r th e diagnostic G allel e a t locu s Glu-5', correspondenc e analysi s o f mac-1 allel e frequenc y dat a highlighted the genetic distinctness of Australasian mussels relative to other M. galloprovincialis populations. The latter consisted of two differentiated groups (NE Atlantic and Mediterranean) as formerly reporte d a t allozym e loci . Anothe r sample , fro m Chile , wa s nearl y identica l t o Mediterranean M . galloprovincialis. Nuclear-DN A dat a thu s enforc e th e ide a tha t M . galloprovincialis hav e probabl y bee n introduce d fro m th e Mediterranea n t o th e Nort h Pacifi c (and no w Chile) , an d fro m th e N E Atlanti c t o Sout h Africa . I t i s argue d i n thi s stud y tha t Australasian mussel s deriv e fro m a proto - M . galloprovincialis populatio n introgresse d b y M .
Smooth-shelled Mytilus spp . mussels ar e distri - thi s systemati c distinction, geographical differenti buted over the temperate and subpolar regions of all atio n wa s als o detecte d withi n eac h species . Fo r oceans. Globa l survey s o f allozym e variatio n i n example , McDonal d e t al. (1991 ) recognize d Mytilus spp . population s hav e focuse d o n th e Australasia n (Australia , Tasmania , Ne w Zealand ) clarification o f th e systematic s o f th e genu s Mytilus a s M . galloprovincialis, bu t note d som e (McDonald & Koeh n 1988 ; Varvi o e t a l 1988 ; difference s i n allel e frequenc y betwee n th e latte r Koehn 1991 ; McDonal d e t al . 1991) . Thes e an d their northern hemisphere conspecifics . unambiguously showe d tha t al l smooth-shelle d Th e presen t stud y i s concerne d wit h worldwid e Mytilus population s i n th e souther n an d th e geneti c variatio n i n Mytilus galloprovincialis. Th e northern hemisphere s coul d b e ascribe d t o on e o f mai n objective was to test, with novel nuclear-DNA three specie s - M . edulis Linnaeus , 1758 , M . markers , th e biogeographica l hypothese s arisin g galloprovincialis Lamarck , 181 9 o r M . trossulus fro m th e analysis of allozyme loci . Gould, 1850. Full species status is warranted by the Allozym e surveys of genetic variation in Mytilus fact that each of these entities maintains its genetic galloprovincialis alon g th e Iberia n Peninsul a hav e integrity ove r broad geographical areas , i n spite o f demonstrate d clear-cu t geographica l isolatio n hybridization i n areas o f overlap an d in the face o f betwee n th e northeaster n (NE ) Atlanti c an d th e potential fo r long-distanc e dispersa l b y plankto - Mediterranea n populations of this species (Sanjuan trophic larvae (Koehn 1991). Although the majority e t al 1994 ; Quesad a e t al 1995) . Compilation an d of th e geneti c difference s wer e accounte d fo r b y analysi s o f th e dat a se t generate d b y th e abov e From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177 , 389-397 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

390

C. DAGUI N & P . BORSA

allozyme studie s ha s sinc e clarifie d th e world wide pictur e o f th e geographi c structur e i n M . galloprovincialis (Sanjua n e t al 1997) . Thes e authors examine d th e allel e frequenc y dat a a t fiv e allozyme loc i usin g multidimensiona l scalin g analysis o n th e matri x o f Nei' s geneti c distanc e estimates between populations. Unfortunately, they did no t conside r an y outgroup , s o thei r geneti c networks wer e unrooted . The y foun d evidenc e fo r three geneticall y differentiate d group s o f M . galloprovincialis: a N E Atlanti c grou p tha t als o included M. galloprovincialis fro m Sout h Africa, a Mediterranean grou p tha t als o include d M . galloprovincialis fro m Californi a an d easter n Siberia, an d a thir d grou p fro m Wester n Australi a and Tasmania. New Zealand Mytilus appeare d to be more closel y relate d t o Nort h Pacifi c M . galloprovincialis tha n t o th e othe r Australasia n populations. Phylogenetic inference is desirable for a more indepth understanding of the evolutionary processes , including colonizatio n an d vicariance , tha t shap e the geneti c compositio n o f species . Figur e 1 is a neighbour-joining tree , roote d b y Mytilus edulis, inferring th e phylogen y o f M . galloprovincialis

populations fro m allel e frequenc y dat a a t seve n allozyme loc i (McDonal d e t a l 1991 ; Vainol a & Hvilsom 1991; Quesada et al 1995) . The seven loci considered here included the five loc i examined by Sanjuan e t al (1997) . Jackknife resampling o f loci, where each locus was omitted i n turn from th e data set, supporte d a principa l separatio n betwee n N E Atlantic-Mediterranean M . galloprovincialis (samples Sesimbr a an d Palavas ) an d Australasia n M. galloprovincialis (sample s Albany , Huon River and Wellington) . Figur e 1 als o confirm s tha t Californian M . galloprovincialis (Lo s Angeles ) i s genetically close r t o th e Mediterranea n tha n th e Atlantic population . Th e Wellingto n (Ne w Zealand) sampl e occurre d withi n an Australasia n clade (i.e . togethe r wit h Alban y an d Huo n River ) four t o seven times, whereas in the remaining thre e to seven pseudotrees i t diverged slightl y before th e node separatin g th e Australia n (Alban y + Huo n River) clad e fro m th e N E Atlantic-Mediterranea n clade. Kenchington et al (1995 ) obtained th e sequence of 18 S rDN A fo r severa l Mytilus spp . samples . These include d M . galloprovincialis fro m a n introduced and farme d populatio n in Puge t Soun d

Fig. 1 . Mytilus galloprovincialis. Neighbour-joinin g tre e (Saito u & Nei 1987 ; NEIGHBO R procedur e of PHYLIP: Felsenstein 1993 ) constructe d fro m th e matrix o f absolute geneti c distanc e estimate s (Gregorius 1984) , based on electromorph frequency dat a a t seven allozym e loc i (Ap, Est-D, Gpi, Lap, Mpi, Od h and Pgm) i n samples from : Lo s Angeles, Californi a (McDonal d e t al. 1991) , Palavas (Mediterranean ) an d Sesimbra (N E Atlantic) (Quesad a e t al. 1995); Yaldad Bay, Chile, Albany, Wester n Australia , Huon Rive r Estuary, Tasmania , and Wellington, New Zealand (McDonald e t al. 1991) . Numbers a t a node ar e scores o f across-locus jacknife resampling . Electromorp h identitie s were deduce d fro m cross-comparison s o f electromorph frequencie s i n McDonald & Koehn (1988) , McDonal d e t al. (1991), Vainol a & Hvilsom (1991 ) an d Quesada e t al. (1995). M. edulis sampl e Skagerra k of Vainola & Hvilso m (1991) [whic h i s also SW E of Varvio et al. (1988)] was used a s outgroup t o root th e tree. These samples wer e chose n because o f their geographica l proximit y wit h sample s o f the present stud y (se e Fig . 2 ) as follows: BOD, Lo s Angeles ; CHL, Yalda d Bay; STB, Sesimbra ; SET , Palavas ; AUS , Albany ; TAS, Huo n River ; NZL, Wellington ; FLO , Skagerrak. Rootin g th e entire tre e with M. trossulus sampl e Tillamook , Oregon , o f McDonald e t al. (1991), did not change it s topology (dat a no t shown) , confirming tha t the choice o f M edulis a s outgroup fo r all M. galloprovincialis was appropriate. Scal e bar, 0.1 unit absolute genetic distanc e

GEOGRAPHICAL STRUCTUR E O F MYTILUS GALLOPROVINCIALIS

in th e easter n Nort h Pacific , M . edulis planulatus Lamarck, 181 9 fro m southeaster n Tasmani a [McDonald e t al (1991 ) ha d conclude d tha t M . edulis planulatus wer e M . galloprovincialis according t o bot h allozym e frequenc y an d morphometric data] , an d severa l M. edulis and M. trossulus samples . Kenchingto n et al . (1995 ) als o analysed a n 'M . galloprovincialis' sampl e fro m Morgat (Britanny, France), but th e present authors have disregarde d thi s identificatio n becaus e th e location lie s withi n th e Europea n hybri d zon e between M . edulis an d M . galloprovincialis (Coustau et al 1991 ; Gosling 1992) , wher e there is no evidenc e fo r th e presenc e o f non-introgresse d M. galloprovincialis (Cousta u e t al . 1991 ; C . Daguin, F. Bonhomme and P. Borsa, pers, comms). The phylogen y inferre d fro m th e 18 S rDN A sequences (Kenchingto n e t al . 1995 ) strongl y suggests an early separation of northern hemisphere M. galloprovincialis from th e other smooth-shelled Mytilus spp. , including M. edulis, M. trossulus and Australasian M. galloprovincialis. A numbe r o f hypothese s hav e bee n suggeste d to accoun t fo r th e differentiatio n pattern s an d disjunct worldwid e distributio n o f Mytilus galloprovincialis. (1 ) Mytilus galloprovincialis has been introduced to South Africa, th e western North Pacific, th e easter n Nort h Pacific , an d perhap s Australasia, through human agency (Wilkins et a l 1983; Gran t & Cherry 1985 ; McDonal d & Koehn 1988; McDonal d e t al. 1991 ; Vermei j 1992) . Thi s hypothesis is based on the lac k of evidence for M. galloprovincialis-\ike mussel s i n th e fossi l record, and thei r absenc e fro m th e literatur e an d museu m collections in South Africa an d in the North Pacific until recently (Wilkins et al 1983 ; Grant & Cherry 1985; McDonal d & Koeh n 1988 , an d ref s cite d therein; Gelle r 1999) . However, sub-fossi l Mytilus are presen t i n Aborigina l midden s i n Tasmania , southern Australia and New Zealand (McDonald et al 1991 , an d refs cite d therein) . This lead s t o th e following, modifie d hypothesi s fo r th e geneti c affinities o f Australasia n M . galloprovincialis. (2 ) Introduced Mytilus galloprovincialis hav e displaced nativ e Australasia n Mytilus spp . [suggested, althoug h believe d t o b e unlikely , b y McDonald e t a l (1991) ] o r introgresse d wit h th e latter (Seed 1992) . Sanjua n e t al (1997 ) also write that 'a human introduction of North Pacific mussels into Australia i s [... ] possibl e (Carlton 1987 ) [and ] may explai n th e geneti c heterogeneit y o f Australasian samples' . Bot h displacemen t an d introgression b y presumabl y introduce d M . galloprovincialis hav e affecte d nativ e M. trossulus in Californi a (McDonal d & Koeh n 1988 ; Gelle r 1999). (3 ) Nort h Pacifi c Mytilus galloprovincialis have recentl y bee n introduce d fro m th e Sout h Pacific. Quotin g Koeh n (1991) : 'A s M .

391

galloprovincialis i s probabl y nativ e t o larg e area s of th e Sout h Pacific , introduction s int o norther n Pacific site s [... ] ma y no t hav e originate d i n Europe.' However , this is contradicted by the quite large geneti c dissimilarit y betwee n Nort h Pacifi c and South Pacific M . galloprovincialis, which is at variance wit h th e clos e geneti c similaritie s between Nort h Pacifi c an d Mediterranea n M . galloprovincialis (Goslin g 1992) . (4) Australasian , North Pacifi c an d Mediterranea n Mytilus galloprovincialis al l deriv e fro m a n ancestra l Pacific stoc k (Sanjua n e t al . 1997) . Whil e hypotheses (1 ) an d (2 ) her e abov e rel y o n th e presumption tha t M . galloprovincialis is nativ e t o the N E Atlantic-Mediterranean , Sanjua n e t a l (1997) conside r th e alternativ e hypothesi s tha t either Australasi a o r th e Nort h Pacifi c b e th e geographic origi n o f M. galloprovincialis. According t o thi s hypothesis , proto-M . galloprovincialis crossed th e Equato r i n th e Pacifi c Ocean ; Nort h Pacific M . galloprovincialis subsequentl y crosse d the Arcti c t o coloniz e th e N E Atlanti c an d th e Mediterranean. Thi s amount s t o proposin g tha t present-day Australasian , Nort h Pacifi c an d Mediterranean population s ar e endemi c form s o f M. galloprovincialis. However , th e dat a provide d by Sanjua n e t a l (1997 , tabl e 4 ) faile d t o substantiate part of this scenario , sinc e the genetic distance estimate between the North Pacific and the Mediterranean [ D = 0.029 (0.011 - 0.057) ] was not significantly large r tha n tha t amon g sub populations within th e Mediterranea n [ D = 0.028 (0.007-0.054)]. The allozyme-base d phylogen y propose d i n Fig. 1 suggest s tha t Australasia n Mytilus galloprovincialis differentiate d earl y o n fro m al l the othe r M . galloprovincialis, supportin g th e hypothesis tha t Australasia n M . galloprovincialis are endemi c (Koeh n 1991 ; McDonal d e t al . 1991). Figur e 1 further show s that th e divergenc e between N E Atlanti c an d Mediterranea n M . galloprovincialis is more recent than the separatio n between th e Australasia n an d th e N E Atlantic Mediterranean groups . The clos e geneti c relation ship o f California n wit h Mediterranea n M . galloprovincialis (se e above ; Fig . 1 ) reflect s a n even mor e recen t commo n origin , whic h is indee d compatible wit h the hypothesi s tha t Nort h Pacifi c M. galloprovincialis wer e introduce d fro m th e Mediterranean throug h huma n agency . Sanjua n et al. (1997 ) instea d propos e tha t ' a geneti c mixin g between [M . galloprovincialis an d M . edulis}, perhaps combine d wit h selectiv e pressure , ma y explain the larger allozym e divergenc e betwee n M. galloprovincialis o f Mediterranea n v s Atlanti c populations, than between Mediterranean v s North Pacific populations' . I f thi s hypothesi s wer e true, allel e frequencie s i n N E Atlanti c M .

392

C. DAGUI N & P . BORSA

galloprovincialis woul d b e intermediat e betwee n those o f M . edulis an d Mediterranea n M . galloprovincialis. Thi s appear s t o b e th e cas e a t only one (Ap), perhap s tw o (adding Gpi), ou t of the six loc i (Ap, Est-D, Gpi, Lap, Mpi, Odh) at which the mos t significan t difference s wer e observe d between the NE Atlantic and the Mediterranean M. galloprovincialis (Quesad a e t al 1995) , an d which were also scored in M. edulis (Skibinski et al. 1980 ; Coustau e t a l 1991 ; Sanjua n e t al . 1994) . Al l o f these loc i wer e take n int o accoun t fo r computin g the neighbour-joinin g tre e o f Fig . 1 . Th e distinctness of the NE Atlantic v. the Mediterranean M. galloprovincialis thu s fa r appear s t o reflec t vicariance mor e tha n differentia l introgressio n b y M. edulis allozyme genes. To what extent do nuclear-DNA markers enforce and refin e th e conclusion s draw n fro m allozym e data?

Methods Mytilus galloprovincialis population s wer e sampled i n (al l abbreviation s followin g locations refer t o Fig. 2) : California (BOD) , the NE Atlantic (STB), the Mediterranean Se a (SET), Sout h Afric a (SAP), easter n Asi a (KOR) , Wester n Australi a (AUS), Tasmani a (TAS ) an d New Zealan d (NZL ) between 199 6 an d 1999 . Referenc e M . edulis samples were collected in the North Sea (GFP), the Skagerrak (FLO ) an d th e Kattega t (GIL ) i n 199 6 and 1997 . A sampl e o f uncertain taxonomi c statu s

was collecte d i n souther n centra l Chil e (CHL ) i n 1998. Al l musse l shell s i n thi s sampl e wer e M . galloprovincialis accordin g to morphology. Mytilus samples fro m Chil e examine d s o fa r a t allozym e loci an d usin g morphometrics wer e M . edulis-like (McDonald e t al. 1991 ; Fig. 1) , but a sample fro m southern Chil e recentl y analyse d a t nuclear DNA an d mitochondrial-DN A loc i exhibite d alleles identica l to thos e of New Zealan d M. galloprovincialis (Tor o 1998) , raisin g th e possi bility tha t thi s specie s migh t als o b e presen t i n southern Chile. The total genomic DNA was extracted from each individual an d use d a s a templat e fo r polymeras e chain reactions (PCR ) using primer pairs specific to a fragmen t o f th e polyphenoli c adhesiv e protei n gene Glu-5 \and a fragment o f intron 1 of the actin gene mac-1. The Glu-5' marker wa s developed b y Inoue & Odo (1994) and Rawson et al. (1996). Th e mac-1 marke r wa s develope d b y Ohresse r e t al . (1997) an d Daguin & Borsa (1999) . Protocol s fo r DNA extraction , PCR , ge l electrophoresi s an d allele nomenclatur e a t locu s Glu-5' hav e bee n reported i n Bors a e t al . (1999) . Thos e fo r locu s mac-1 hav e bee n detaile d i n Dagui n & Bors a (1999): mac-1 is th e onl y non-coding locus ou t of the ten nuclear loci (als o including seven allozyme loci, 18 S rDN A an d Glu-5 0 considere d i n thi s paper. Correspondence analysi s (FCA: Benzecr i 1982 ) was performe d usin g th e AF C procedur e implemented i n BIOMECO (Lebreto n e t al. 1990 )

Fig. 2 . Sampling site s for Mytilus galloprovincialis. Abbreviation s fo r samples: BOD , Bodeg a Bay , California; CHL , Dichato, souther n Central Chile ; STB , Setubal , Portugal; SET , Sete , France [sampl e SET E of Daguin & Bors a (1999)]; SAF, Bloubergstrand , Sout h Africa ; KOR , wester n coas t of South Korea ; AUS, Nedlands , Western Australia ; TAS, d'Entrecasteau x Channel , Tasmania ; NZL, Dunedin , Ne w Zealand. Symbol s refe r t o the present nuclear-DN A characterization o f samples: • . Mediterranea n M . galloprovincialis ; •, Atlanti c M. galloprovincialis ; +, Australasian M . galloprovincialis. A , M . edulis referenc e samples : FLO, Flodevigen , Skagerrak; GFP, Gran d For t Philippe, Nort h France; GIL , Gilleleje , Kattega t [sampl e GIL L o f Daguin & Borsa (1999)] .

393

GEOGRAPHICAL STRUCTUR E O F MYTILUS GALLOPROVINCIALIS

on the matrix of allelic frequencies per sample. This method, previousl y use d b y Cousta u e t al. (1991 ) on allozym e data , i s well-adapte d t o expres s th e genetic differences presen t in a data set because the eigenvalues o f eac h FC A axi s ar e analogou s t o S . Wright's Fst (Guinand 1996) .

Results an d discussion Table 1 gives the allele frequencies at locus Glu-5'. Allele G was fixed , o r nearl y fixed , i n al l Mytilus galloprovincialis sample s [thereb y extendin g th e preliminary finding s of Rawso n e t al . (1996 ) an d Borsa e t al (1999) ] an d in the Mytilus sp . sampl e from Chile . Th e Glu-5' marker , bein g quasi monomorphic, i s therefor e o f littl e hel p i n analysing th e geneti c relationship s amon g M . galloprovincialis populations . In contrast , preliminar y survey s o f geneti c variation a t th e mac-1 locu s hav e demonstrate d considerable polymorphism , wit h u p t o 1 8 siz e alleles i n Mytilus galloprovincialis sample s fro m the NE Atlantic and the Mediterranean (Dagui n & Borsa 1999) . Here , allel e frequenc y dat a a t locu s mac-1 suggeste d close r geneti c affinitie s o f Australasian Mytilus wit h M. edulis rather tha n M. galloprovincialis (Tabl e 2) : al l thre e Australasia n samples possesse d mac-1 allel e a l a t a hig h fre quency (this allele is found at a moderate frequenc y in NE Atlantic M. edulis, but a t significantly lower frequency i n M. galloprovincialis: Daguin & Borsa 1999; Tabl e 2) ; th e Tasmania n an d Ne w Zealan d samples di d not possess an y of the allele s (b2, c2) inferred t o b e characteristi c o f Mediterranea n an d NE Atlantic M. galloprovincialis (Daguin & Borsa 1999; Tabl e 2) , althoug h thes e wer e presen t a t a moderate frequenc y i n Wester n Australia . Th e three-dimensional projectio n o f th e FC A o f M . galloprovincialis sample s collecte d worldwid e (Fig. 3 ) illustrate s th e clea r distinctnes s o f Australasian Mytilus, wit h th e firs t axi s o f FC A

separating M. edulis and Australasian mussels fro m all the other samples . Th e secon d axi s then clearly distinguished Australasia n mussel s fro m M. edulis. The thir d axi s yielde d evidenc e o f (compara tively slighter ) furthe r distinctio n betwee n N E Atlantic (STB ) an d Mediterranea n (SET ) M . galloprovincialis. The homogeneity of mac-1 allele frequencies withi n eac h o f th e tw o latte r region s has bee n reporte d elsewher e (Dagui n & Bors a 1999). Sout h Africa n mussel s clustere d togethe r with N E Atlanti c M . galloprovincialis, whil e mussel sample s fro m California , Chil e an d Kore a clustered togethe r wit h Mediterranea n M . galloprovincialis. The estimate o f 0 , the equivalent of Wright' s Fs t (Wei r & Cockerha m 1984) , wa s 9 = 0.027 betwee n thes e tw o groups . Thi s valu e compares wit h th e valu e reporte d a t locu s mac-1 between N E Atlanti c (northwester n African ) an d Western Mediterranea n M . galloprovincialis (£ = 0.016; p = 0.02; Dagui n & Bors a 1999 ) an d with th e mea n Gs t value reported fo r 1 3 allozym e loci betwee n sample s fro m th e wester n an d th e eastern coast s o f th e Iberia n Peninsul a (Gst = 0.029; p < 0.001; Quesada et al. 1995) . Thus, mac-1 dat a (Dagui n & Bors a 1999 , thi s study) are in accordance with the results o f forme r allozyme-based survey s in : (1 ) allowin g a clea r distinction between NE Atlantic and Mediterranean Mytilus galloprovincialis population s (Sanjua n e t al. 1994 , 1997 ; Quesad a e t al . 1995) ; (2 ) demonstrating th e geneti c affinitie s o f Sout h African M . galloprovincialis wit h N E Atlanti c M . galloprovincialis (Sanjua n e t al . 1997) ; (3 ) demonstrating th e geneti c affinitie s o f M . galloprovincialis fro m bot h th e easter n an d th e western coast s o f th e Nort h Pacifi c wit h Mediterranean M . galloprovincialis (Sanjua n e t al. 1997; Fig . 1) ; (4 ) arguin g agains t th e possibilit y that Australasia n M . galloprovincialis wer e transported t o th e Nort h Pacifi c (Goslin g 1992 ; Fig. 1) .

Table 1 . Allele frequencies a t locus Glu-5 ' i n samples o f Mytilu s galloprovinciali s from th e northern an d southern hemispheres, an d i n two M. edulis reference samples Allele*

Sample1"

BOD CH

E E' E" G T

0.98 0.02

(AO*

(23) (48

L ST

B SE

T SA

0.01

F KO

R AU

S TA

S NZ

L FL

0.05

1.00 1.0

0 0.9

9 0.9

5

) (19

) (56

) (65

) (19

1.00 1.0

0 1.0

0 1.0

0

) (46

) (25

) (77

) (35

O GI

L

0.89 0.5 0.11 0.4

0 7 0.03

) (16

)

* Nomenclature of Borsa et al. (1999). t Abbreviations for samples as in legend to Fig. 2; data for GIL, BOD and SET from Bors a et al. (1999); additional data for SET from Rawson et al (1996) . * Sample size.

394

C. DAGUI N & P . BORSA

Table 2 . Allele frequencies at locus mac- 1 i n samples
Allele*

Sample,t BOD

fl fl

/3

bO b05 b2 b\ b3 b4 b5 c\ c\2 cl5 c2 c3 c4 c6 aO a05 a\ al5 dl a3 a4 a5 a6 al aS a9 d (AO*

_ _ 0.04 0.32 0.04 0.41 0.01

-

0.03 0.10 0.01 0.01

-

(34) (76

CHL 0.01 0.05 0.32 0.01 0.08 0.01 0.39 0.01 0.03 0.01 0.01 0.01 0.03 0.05 -

) (26

STB

0.02 _ _ 0.04 0.15 0.02 0.02 0.10 _ 0.50 0.02 0.02 0.02 0.04 0.02 0.04 ) (68

SET 0.05 0.21 0.07 0.54 0.01

-

-

0.01

-

0.01 0.04 0.06 ) (62

SAP

KOR AU

0.02 0.01 0.01 0.01 _ 0.04 0.09 0.10

__ _ _ __ __ 0.02 0.42 0.0 0.02 _ _ 0.05 _ __ 0.43 0.1 _ __ _ __ _ _

-

0.01 0.53 0.04 0.01

-

0.02 0.03 0.02 0.02 0.04 0.01 ) (30

S TA

NZL FL

4

_

6 _

0.04 9 1

0.01 0.92 0.1 0.02 0.2 -

- -

) (47

P

0.01

-

0.01

- -

0.02 0.06 0 9 0.07 0.38

0.01 0.01 ) (79

GIL GF - __ - _-

0.05

-

_

) (40

O

- - 0.02 __ - - - -

_ _

0.01 0.02 0.6 2 0.9 0.16 0.0 _ __ _ 0.01 0.03 0.02 _ _ ) (38

S

_

0.02 0.02 0.0 1 0.15 0.2 0 0.31 0.2 4 0.17 0.1 8 0.27 0.2 9 0.08 0.0 4 -

) (26

) (42 )

* Nomenclature of Daguin & Borsa (1999); alleles are presented from th e slower migrating (/I) to the faster migratin g (d). ^ Abbreviation s for samples as in legend to Fig. 2; data for GIL an d SE T fro m Dagui n & Borsa (1999). * Sample size.

Australasian Mytilus ar e M . galloprovincialis when considerin g allozym e dat a (McDonal d e t a l 1991), eve n thoug h substantia l difference s wit h northern hemispher e M . galloprovincialis wer e detected usin g multidimensiona l scalin g (Sanjua n et a l 1997 ) an d neighbour-joinin g phylogeneti c inference (Fig . 1) . Australasia n Mytilus remaine d grouped wit h M . galloprovincialis whe n considering G/w-5'dat a (Table 1) . However, mac-1 data (Tabl e 2 ; Fig . 3 ) reveale d stron g difference s between Australasia n Mytilus an d norther n hemisphere M . galloprovincialis. Th e summin g up of al l dat a availabl e regardin g th e geneti c char acterization o f Australasia n Mytilus (McDonal d e t al 1991 ; Kenchingto n e t a l 1995 ; thi s study ) shows noticeabl e discrepancie s amon g loci . Fo r instance, if allele frequency patterns at the four loci (allozyme loc i Est-D an d Mpi\ nuclear-DN A loc i

Glu-5' an d mac-1) whic h ca n b e considere d a s diagnostic betwee n M . galloprovincialis an d M . edulis are examined (Skibinski et al 1983 ; Rawso n et a l 1996 ; Dagui n & Bors a 1999) : Australasia n Mytilus posses s fixed , o r nearl y fixed , M . galloprovincialis allele s a t Mpi an d Glu-5', while at Est-D the frequency of M . edulis alleles was zero in sample Wellington, c. 0.25 in sample Albany and c. 0.5 in sample Huon River (McDonal d e t al. 1991) ; at locu s mac-1, Australasia n Mytilus possess , a t high frequency , a siz e allel e (02 ) whic h is more characteristic o f M . edulis tha n o f M . galloprovincialis (Tabl e 2) . At other allozym e loci , Australasian mussel s ca n b e considere d a s eithe r closer t o M. galloprovincialis tha n M. edulis (Aap, Ap, Gp i an d Lap), o r th e contrar y (Pgm), o r quit e different fro m bot h (Odh) (McDonal d e t al 1991) . Finally, 18 S rDNAs o f Tasmania n Mytilus showe d

GEOGRAPHICAL STRUCTUR E O F MYTILUS GALLOPROVINCIAL1S

Fig. 3 . Mytilus galloprovincalis and M. edulis. Three dimensional representation o f the outcome of correspondence analysi s (Benzecri 1982 ) on the matrix of mac-1 allelic frequencies per sample . Se e Fig. 2 for abbreviations.

higher sequenc e similarit y wit h M. edulis (an d M. trossulus) tha n wit h M . galloprovincialis (Kenchington et al 1995) . The present results provid e ne w insight int o the biogeography o f Mytilus galloprovincialis. Firstly , Australasian Mytilus no w appea r t o b e clearl y distinct fro m al l M . galloprovincialis population s elsewhere i n th e world . Therefore , th e hypothesi s that thes e mussel s wer e recentl y introduce d b y humans (e.g . fro m th e Nort h Pacific) , o r tha t they may hav e undergone recent , substantia l intro gression b y alie n M . galloprovincialis (e.g . See d 1992) i s her e rejected . Instead , Australasia n M . galloprovincialis hav e a patch y geneti c archi tecture, wit h a hig h frequenc y o f M . edulis-\ike alleles at some loci and of M. galloprovincialis-likQ alleles a t others . Assumin g tha t th e choic e o f M. edulis as an outgroup o f M. galloprovincialis hold s valid, thi s suggest s tha t Australasia n Mytilus originates fro m a proto-M . galloprovincialis population tha t underwen t introgression b y proto M. edulis. I n othe r words , introgressio n b y M . edulis-\ikQ allele s wa s detecte d i n Australasia n mussels a t loc i mac-1 an d Est-D (and , perhaps , Pgm), but this may be ancient since at locus mac-1 these allele s ar e now fixed o r quasi-fixed. It is also possible tha t th e M . edulis-likz gene s o f Australasian mussels do not derive from a proto-M. edulis for m bu t originat e fro m mor e moder n southern hemispher e M . edulis (Sout h America , Falklands, Kerguelen ; McDonald e t al. 1991) . I t is

395

expected tha t sequencin g analysi s wil l confir m whether th e mac-1 allele s presen t i n Australasia n mussels ar e phylogeneticall y close r t o thos e fro m northern hemisphere , o r souther n hemispher e M . edulis. On the basis of the close morphological an d allozymic resemblanc e born e b y Australasia n mussels t o M . galloprovincialis (McDonal d e t al . 1991), it is proposed her e tha t these be attributed a subspecific ran k within M. galloprovincialis. Secondly, th e hypothesis , implici t i n Sanjua n et al. (1997) , tha t Nort h Pacifi c an d Mediterranea n mussels ar e endemic form s of M. galloprovincialis is rejected here , becaus e ther e wa s n o evidence o f genetic differentiation between populations of these two regions. The close genetic similarit y at all loci, including mac-1, of populations separate d b y suc h geographical distance s an d geographica l barrier s (e.g. continents ) conform s t o th e hypothesi s o f recent introductio n b y humans . Sinc e fossi l M . galloprovincialis hav e bee n foun d i n th e Mediterranean (Mar s 1956 ) an d hav e no t bee n reported fro m th e Nort h Pacifi c (se e above) , i t i s legitimate t o presum e tha t Nort h Pacifi c M . galloprovincialis wer e introduce d fro m th e Mediterranean an d no t th e contrary . Rejectin g th e present existenc e o f endemi c Nort h Pacifi c M . galloprovincialis does not necessarily imply that M. galloprovincialis i s a Mediterranea n offshoo t o f North Atlantic M. edulis, a s is frequently assumed (Barsotti & Meluzz i 1968 ; Skibinsk i e t a l 1983 ; Gosling 1984 , 1992 ; Gran t & Cherr y 1985 ; See d 1992; Rawso n & Hilbish 1998) . A s emphasized by Vermeij (1992) , 'I t i s possibl e tha t th e origina l Tethyan Mytilus persiste d i n th e Mediterranea n regions throughou t th e Neogene , an d tha t th e Pleistocene an d Recent M . galloprovincialis i s derived fro m thi s purported stoc k rathe r tha n fro m the Pacific-derive d trossulus-edulis group ' although fossi l evidenc e fo r thi s scenari o remain s to be found . Thirdly, M. galloprovincialis was here identified for th e firs t tim e i n Chile . It s hig h geneti c similarity, a t locus mac-1, with Mediterranean an d North Pacifi c M . galloprovincialis suggest s i t ha s been recentl y introduce d t o Chil e fro m eithe r o f these regions by maritime transport or, perhaps, by unreported, intentiona l transplantation . Th e population fro m whic h ou r Chilea n sampl e originates thu s appears t o b e differen t fro m an y of the M. edulis-like Chilea n population s sample d b y McDonald e t al. (1991) , but i t is perhaps the sam e as the one sampled by Toro (1998). In this case, the taxonomic statu s propose d b y Tor o fo r thes e mussels ( a subspecie s o f M . edulis} shoul d b e disregarded. Note adde d i n proof : A recen t mitochondrial-DN A survey aime d a t elucidating th e origi n o f the antitropica l

396

C. DAGUI N & P . BORSA

distribution patter n o f Mytilus spp . (Hilbish e t al. 2000 , Marine Biology, 136 , 69-77) yielded results that confir m the mai n conclusion s o f th e presen t study . Mos t Australasian Mytilus spp . female mitochondria l lineage s clustered int o a singl e clad e (Z)2 ) whos e closes t relativ e was th e D clad e foun d i n norther n M. galloprovincialis (Dl), demonstratin g bot h th e originalit y o f Australasian Mytilus sp . an d thei r clos e relatednes s t o M . galloprovincialis. However , a fe w Australasia n mussel s possessed mitochondri a of the A typ e characteristic of M. edulis: thi s i s consisten t wit h ou r hypothesi s tha t thes e Australasian mussel s deriv e fro m a proto-M . galloprovincialis populatio n introgresse d b y M . edulislike genes. Mitochondrial-DNA data were also consistent with th e hypothesi s tha t Nort h Pacifi c M . galloprovincialis originat e fro m th e Mediterranea n through huma n agenc y (al l mussel s fro m Sa n Diego , California, posses s mitochondri a o f type Dl o r A, a s do Mediterranean mussels) . Hilbis h e t al . (2000 , Marine Biology, 136 , 69-77 ) faile d t o detec t D l haplotype s i n their Chilean samples . We are grateful to: N. Bierne, F. Bonhomme, B. Delay, M. Raymond and R. D. Ward for discussions; to J. Taylor, R. D. War d an d a n anonymou s referee fo r comment s o n a n earlier manuscript; to J. Beesley, W . Borgeson, P . Boudry, P. Freon, A. Leitao, C . Lemaire, D. Moraga, M. Ohresser, J. Panfili , C . Perrin , M . Raymon d an d C . Riquelm e fo r providing samples; t o V . Rolland for carefull y examinin g the Chilean Mytilus galloprovincialis shells ; to S. Ramo s Caetano fo r assistanc e i n th e laboratory ; t o IFREME R URM 1 6 for research funds ; t o MENRT and IR D for ou r salaries.

References BARSOTTI, G . & MELUZZI , C . 1968 . Osservazion i s u Mytilus edulis L . e Mytilus galloprovincialis Lamarck. Conchiglie, 4, 50-58. BENZECRI, J.-P . 1982 . L'Analyse de s Donnees. 2 . L'Analyse de s Correspondances. Dunod, Paris. BORSA, P. , DAGUIN , C., RAMO S CAETANO , S . & BONHOMME, F . 1999 . Nuclear-DNA evidenc e tha t northeastern Atlanti c Mytilus trossulus mussel s carry M. edulis genes. Journal ofMolluscan Studies, 65,524-527. CARLTON, J . T . 1987 . Patterns o f transoceani c marin e biological invasions in the Pacific Ocean. Bulletin of Marine Science, 41, 452^65. COUSTAU, C. , RENAUD , F . & DELAY , B . 1991 . Genetic characterization o f th e hybridizatio n betwee n Mytilus edulis an d M . galloprovincialis o n th e Atlantic coas t o f France . Marine Biology, 111 , 87-93. DAGUIN, C. & BORSA, P. 1999. Genetic characterisation of Mytilus galloprovincialis Lmk . i n Nort h Wes t Africa usin g nuclea r DN A markers . Journal o f Experimental Marine Biology an d Ecology, 235 , 55-65. FELSENSTEIN, J . 1993 . PHYLIP 3. 5 (Phylogeny Inference Package). Universit y o f Washington , Seattle , Washington, USA. GELLER, J. B. 1999 . Decline of a native mussel masked by

sibling specie s invasion . Conservation Biology, 13 , 661-664. GOSLING, E . M . 1984 . The systemati c statu s o f Mytilus galloprovincialis i n wester n Europe : a review . Malacologia, 25 , 551-568. 1992. Systematic s an d geographi c distributio n o f Mytilus. In : GOSLING , E . (ed. ) The Mussel Mytilus : Ecology, Physiology, Genetics and Culture. Developments i n Aquacultur e an d Fisherie s Science, 25, 1-20 . Elsevier , Amsterdam . GRANT, W . S . & CHERRY , M . I . 1985 . Mytilus galloprovincialis i n Sout h Africa . Journal o f Experimental Marine Biology an d Ecology, 90 , 179-191. GREGORIUS, H . R . 1984 . A n uniqu e geneti c distance . Biometrical Journal, 26 , 13-18 . GUINAND, B . 1996 . Use o f a multivariat e mode l usin g allele frequenc y distributions to analys e pattern s of genetic differentiatio n amon g populations . Biological Journal o f th e Linnean Society, 58 , 173-195. INOUE, K. & ODO, S . 1994. The adhesive protein cDNA of Mytilus galloprovincialis encode s decapeptid e repeats bu t n o hexapeptid e motif . Biological Bulletin, 186 , 349-355. KENCHINGTON, E. , LANDRY , B . & BIRD , C . J . 1995 . Comparison o f taxa of the mussel Mytilus (Bivalvia) by analysis of the nuclear small-subunit rDNA gene sequence. Canadian Journal o f Fisheries an d Aquatic Sciences, 52 , 2613-2620. KOEHN, R. K. 1991. The genetics and taxonomy of specie s in the genus Mytilus. Aquaculture, 94 , 125-145. LEBRETON, J.-D., Roux , M., BANCO , G . & BACOU , A.-M. 1990. BIOMECO (Biometrie-ecologie), Logiciel d'Ecologie Statistique pour PC et Compatibles. Version 3.9. Centr e Nationa l d e l a Recherch e Scientifique, Montpellier , France. MCDONALD, J . H . & KOEHN , R . K . 1988 . The mussel s Mytilus galloprovincialis an d M . trossulus o n th e Pacific coast of North America. Marine Biology, 99, 111-118. , SEED , R . & KOEHN , R . K . 1991 . Allozyme s an d morphometric characters o f three specie s o f Mytilus in th e norther n an d souther n hemispheres . Marine Biology, 111 , 323-333. MARS, P . 1956. Faunes malacologiques d u Pliocen e e t du Quaternaire d e Milazz o (Sicile) . Bulletin d u Museum d'Histoire Naturelle d e Marseille, 16 , 33-52. OHRESSER, M. , BORSA , P . & DELSERT , C . 1997 . Intron length polymorphism a t the actin gene locus mac-1: a geneti c marke r fo r populatio n studie s i n th e marine mussel s Mytilus galloprovincialis Lm k an d M. edulis L . Molecular Marine Biology an d Biotechnology, 6 , 123-130 . QUESADA, H. , ZAPATA , C . & ALVAREZ , G . 1995 . A multilocus allozym e discontinuit y i n th e musse l Mytilus galloprovincialis: th e interactio n o f ecological an d life-history factors. Marine EcologyProgress Series, 116, 99-115. RAWSON, P . D . & HILBISH , T . J . 1998 . Asymmetri c introgression o f mitochondria l DN A amon g European population s of blu e mussel s (Mytilus spp.). Evolution, 52 , 100-108 .

GEOGRAPHICAL STRUCTUR E O F MYTILUS GALLOPROVINCIALIS , JOYNER , K . L. , MEETZE , K . & HILBISH , T . J. 1996. Evidence fo r intrageni c recombinatio n withi n a novel geneti c marke r tha t distinguishe s mussel s i n the Mytilus edulis specie s complex. Heredity, 77 , 599-607. SAITOU, N . & NEI , M . 1987 . Th e Neighbor-Joinin g method: a ne w metho d fo r reconstructin g phylogenetic trees . Molecular Biology an d Evolution, 4, 406^25. SANJUAN, A. , ZAPATA , C . & ALVAREZ , G . 1994 . Mytilus galloprovincialis an d M. edulis o n the coast s o f th e Iberian Peninsula. Marine Ecology-Progress Series, 113, 131-146 . ,& 1997 . Geneti c differentiatio n i n Mytilus galloprovincialis Lmk . throughou t th e world. Ophelia, 47, 13-31 . SEED, R . 1992 . Systematics, evolutio n and distributio n of mussels belongin g t o th e genu s Mytilus: a n overview. American Malacological Bulletin, 9 , 123-137. SKIBINSKI, D . O . R , BEARDMORE , J . A . & CROSS , T . F . 1983. Aspects o f the population genetics of Mytilus (Mytilidae; mollusca) in the British Isles. Biological Journal o f th e Linnean Society, 19 , 137-183 . , CROSS , T . F . & AHMAD , M . 1980 . Electrophoretic investigation o f systemati c relationship s i n th e marine mussel s Modiolus modiolus L. , Mytilus

397

edulis L. , an d Mytilus galloprovincialis Lmk . (Mytilidae; Mollusca) . Biological Journal o f th e Linnean Society, 13 , 65-73. TORO, J . E . 1998 . PCR-base d nuclea r an d mtDN A markers an d shel l morpholog y a s a n approac h t o study th e taxonomi c statu s o f th e Chilea n blu e mussel, Mytilus chilensis (Bivalvia) . Aquatic Living Resources, 11 , 347-353. VAINOLA, R. & HVILSOM, M . M. 1991 . Genetic divergenc e and a hybri d zon e betwee n Baltic an d Nort h Se a Mytilus populations . Biological Journal o f th e Linnean Society, 43, 127-148. VARVIO, S.-L. , KOEHN , R . K . & VAINOLA , R . 1988 . Evolutionary genetics of the Mytilus edulis comple x in th e Nort h Atlanti c region . Marine Biology, 98 , 51-60. VERMEIJ, G . J . 1992 . Trans-equatoria l connection s between biota s i n th e temperat e easter n Atlantic . Marine Biology, 112 , 343-348 . WEIR, B . S . & COCKERHAM , C . C . 1984 . Estimating F statistics fo r th e analysi s o f populatio n structure . Evolution, 38, 1358-1370 . WILKINS, N . P. , FUJINO , K . & GOSLING , E . M . 1983 . The Mediterranean musse l Mytilus galloprovincialis Lmk. i n Japan . Biological Journal o f th e Linnean Society, 20, 365-374.

This page intentionally left blank

Size: all it's shape d up to be? Evolution of shape through the lifespan of the Cenozoic bivalv e Spissatella (Crassatellidae ) JAMES S . CRAMPTON1 & PHILLIP A. MAXWELL2 1 Institute of Geological and Nuclear Sciences, PO Box 30-368, Lower Hutt, New Zealand (e-mail: j. crampton @ gns. cri. nz.) 2 Bathgates Road, RD 10, Waimate, New Zealand Abstract: Outline shape is a key morphological characte r of infaunal bivalve s that reflects both phylogenetic histor y an d function. A new metho d o f Fourier shap e analysi s has bee n use d her e to study the evolution of shape and size in the Cenozoic genus Spissatella (Crassatellidae), using material from New Zealand. The Fourier method can be used to construct a map of morphological 'geography', to generate syntheti c averag e o r extreme morphologies, an d to visualize margina l growth field s and allometries . The result s demonstrat e tha t growt h in Spissatella was strongl y allometric and that differences between individual growth stages are commonly far greater than evolutionary change s i n shap e spannin g 2 0 Ma. I n al l taxa , allometr y wa s dominate d b y th e relative elongation of the posterior margin with growth, an inferred functional adaptatio n for lif e in relatively high-energy environments. Heterochrony was the dominant evolutionary mechanism and, followin g an initia l peramorphi c expansio n int o morphospace , bot h paedomorphosi s an d peramorphosis probabl y occurre d i n approximatel y equa l proportions . I n general , i t i s no t possible to decouple patterns of shape and size evolution. The data reveal no directional trends in evolution of these traits. The ontogenetic pathway followed by Spissatella may be a key genuslevel taxonomi c characte r an d apparentl y represent s a developmenta l constrain t tha t largel y controlled evolutio n within the genus.

Relationships betwee n ontogeneti c development , ecology, selectio n an d evolutio n ar e increasingl y the focus of diverse studies that bridge the interface of developmenta l biolog y an d palaeontolog y (e.g . Gould 1977 , 1989 ; Atchle y 1987 ; Foot e & Cowi e 1988; McKinne y & McNamar a 1991 ; Zelditc h e t al 1992 ; Poll y 1998) . Fossi l bivalv e molluscs ar e an ideal subjec t for such studies because they have a readil y preserve d shel l tha t retain s a complet e record o f externa l trait s fo r al l post-larva l growt h stages. I n addition , th e shel l possesse s interna l features tha t can b e use d t o infe r soft-par t morphology, such as the pallial line and muscle scars. The present analysis is based upon the outline shape and size o f th e latera l profil e o f th e bivalv e genu s Spissatella Finlay , 192 6 (famil y Crassatellidae) . Outline shap e i s a ke y morphologica l characte r that, i n mos t bivalves , reflect s bot h phylogeneti c history, and function an d life habit . Spissatella wa s a shallow-burrowing , non-siphonate , infauna l suspension feeder . I t i s likel y tha t undisturbe d adults were largely sessile within the substrate. The exhalent an d inhalen t current s wer e locate d a t th e posterior margi n o f th e shel l tha t mus t hav e bee n positioned at, or jus t above , the sediment-wate r

interface, a s i s th e cas e fo r mos t livin g Crassatellidae (Slack-Smit h 1998) . Livin g cras satellids are, in some areas, heavily preyed upon by octopuses, borin g gastropod s an d shell-crushing chondrichthyans (Slack-Smit h 1998) , an d survival is, t o a grea t extent , dependen t upo n buria l dept h and spee d o f reburia l followin g disintermen t b y predators o r wate r currents . Th e sam e mus t hav e been true for Spissatella, i n which burial depth was limited b y th e overal l lengt h o f th e shel l and , a s with mos t infauna l bivalves , burrowing speed wa s determined primaril y b y shape , inflatio n an d sculpture (Stanle y 1970 , 1975 ; Kond o 1987 ; Watters 1993) . Th e lengt h an d shap e o f th e shell , therefore, ar e likel y t o hav e bee n ke y target s o f directional and/o r stabilizin g selection . Thi s prediction i s corroborated , i n part , b y th e wor k of Stanley & Yang (1987) wh o studie d 1 9 PlioceneRecent infauna l bivalve s an d inferre d tha t shap e was indeed subject to stringent stabilizing selection pressure withi n species , wherea s overal l siz e wa s not. Similarly , Soare s e t a l (1998 ) studie d th e living infauna l bivalv e Donax an d attribute d intraspecific shap e difference s t o directiona l selection related t o habitat.

From: HARPER , E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications, 177, 399-423 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

400

J. S . CRAMPTO N & P . A. MAXWEL L

This pape r examine s th e relationship s betwee n ontogenetic an d othe r intraspecifi c variation s i n shape an d siz e o n th e on e hand , an d th e evolutionary histor y o f Spissatella o n th e other . Specifically, three questions are addressed: (1 ) how do shap e an d siz e var y or covar y withi n species? ; (2) how d o intraspecific patterns of shape an d siz e variation var y betwee n species? ; (3 ) phenotypi c variation, a t th e populatio n level , i s th e ra w material of evolutionary selection - t o what extent is suc h variatio n controlle d b y interna l developmental processes throughout the lifespan of this bivalv e genus ? As note d by Gould (1989 , p. 537), 'Natura l histor y i s a scienc e o f relativ e frequencies'; advanc e in many fields of palaeonto logical debat e require s compilatio n o f detaile d observations acros s divers e fossi l group s an d time spans . Thi s pape r represent s suc h a contribution.

The genus Spissatella an d material studied Spissatella i s a moderately speciose genu s of small to medium-size d crassatellid s tha t i s well repre sented i n mid-Cenozoi c shallow-wate r sandstone s and siltstone s i n th e Sout h Island , Ne w Zealan d (Finlay 1926 ; Be u & Maxwel l 1990) . Ther e ar e very few occurrences i n the North Island. The only convincing recor d o f th e genu s fro m outsid e th e New Zealan d regio n i s th e Earl y Oligocen e S . maudensis (Pritchard , 1903 ) fro m Victoria , Australia (Darrag h 1965 , p . 110) , althoug h i t i s possible tha t som e Argentinia n Miocen e specie s belong here (Beu et al 1997 , table 1). Beu & Maxwel l (1990 ) liste d te n nomina l species ranging in age from Lat e Eocene to Middle Miocene; anothe r specie s ma y b e Crassatellites cordiformis Suter , 191 7 (lat e Oligocene?), bu t thi s is based o n very poorly preserve d materia l an d it s relationships ar e obscure . Th e earlies t typica l member o f the genu s is Spissatella acculta Finlay, 1926 (Earl y Oligocene) , bu t som e olde r cras satellids (Late Eocene-Early Oligocene), including S. media (Marwick , 1926) , probabl y belon g her e despite thei r muc h smalle r size s (Fig s 1 an d 2) . These earliest Spissatella-like form s were probably derived from the genus Eucrassatella. Most records of Spissatella ar e fro m Lat e Oligocen e t o Earl y Miocene sites, particularly in South Canterbury and North Otag o on the eas t coast o f the Sout h Island. Thereafter, the genus became rare and is last known from th e Earl y Pliocene . Extinctio n o f Spissatella may hav e been relate d t o Late Miocen e an d Early Pliocene cooling . Tw o o f th e specie s currentl y assigned to Spissatella - S. scopalveus and S. concisa Finlay , 192 6 - ar e mor e appropriatel y referred t o Eucrassatella, base d o n detail s o f

sculpture, shape , ontogeneti c developmen t an d shell thickness (unpublishe d data) . In additio n t o havin g th e genera l appea l o f bivalves note d previously , Spissatella i s a n attractive subjec t fo r a morphometri c analysi s o f evolution for several reasons. Firstly, the genus has a restricte d geographi c range : th e vas t majority o f species occu r in , an d ar e apparentl y restricte d to , New Zealand. Hence it seems reasonable to assume that evolutio n withi n th e genu s occurre d largel y within th e Ne w Zealan d region . Secondly , well preserved specimen s o f Spissatella ar e abundant in many collection s fro m a variet y o f shallow-wate r facies in the South Island o f New Zealand. Thirdly, the genus displays obvious an d intriguing changes in morpholog y bot h throug h ontogen y an d geo logical time. Fourthly, these changes are difficult t o describe o r quantif y usin g mor e traditiona l descriptive o r morphometri c techniques . Lastly , Spissatella ha s a reasonable histor y o f description and a n existin g taxonomi c framework . Thi s taxonomy i s base d o n a variet y o f interna l an d external characters i n addition to the outlin e shape studied here , notabl y hing e structure s an d sculpture. In total , 29 9 individual s wer e include d i n th e morphometric study . Collectio n an d localit y information i s summarize d i n Table 1 . For eas e of communication, collections ar e identified throughout the text using bold italic labels shown on Table 1. O n al l bu t th e smalles t shells , tw o o r thre e growth stage s o f eac h specime n wer e include d i n the analysis. The study is, therefore, based on both longitudinal (i.e . dat a fro m severa l ontogeneti c stages o f each individual ) and cross-sectiona l dat a (i.e. data fro m man y individuals of differin g size) . The descriptio n o f intraspecifi c variatio n i n shap e has bee n emphasized , informatio n tha t allow s th e significance o f variation s betwee n population s t o be gauged. The majority of specimens (650 outlines from 25 4 individuals) are from 1 8 main collections of Spissatella tha t spa n th e Lat e Eocene-Earl y Miocene (Table 1, Fig. 1) . Where possible, approximately 2 0 individual s wer e sample d fro m eac h collection. Al l holotype s o f describe d specie s an d subspecies wer e include d i n th e analysis . Th e remaining specimen s (9 7 outline s fro m 4 5 individuals) represen t tax a formerl y include d i n Spissatella an d herei n referre d t o Eucrassatella, other comparativ e specimen s of Eucrassatella an d a collectio n o f Salaputium animula, a ver y smal l species closel y relate d to , an d hitherto assume d to be derived from, Spissatella o r Eucrassatella. Thi s was originally described a s Chattonia animula, the type specie s o f Chattonia Marwick, 1929 , an d ha s been include d i n Salaputium Iredale , 1924 , following Finlay' s (1930 ) questionabl e synonymy of Chattonia with Salaputium.

SHAPE EVOLUTION IN CENOZOI C SPISSATELLA

401

Fig. 1 . Geological timescale, showin g correlations betwee n th e International an d New Zealand units for the study interval [afte r Morgan s e t al. (1996)], stratigraphic range s of studied taxa an d inferred phylogeny fo r Spissatella. Al l taxa for which ranges ar e shown are illustrated in Fig. 2 .

402 J

. S . CRAMPTO N & P. A. MAXWELL

Fig. 2 . Representative specimens of the principal taxa studied here. Photographs (a)-(i ) are species o f Spissatella, (j) , (k) an d (m ) are specie s o f Eucrassatella, and (1) is Salaputium. Localit y an d age details are given in Table 1 . All specimens are whitened with magnesium oxide. Scale bar, 1 0 mm; all photographs are life siz e except (j ) and (1) . (a) Spissatella media, holotype, TM4299, righ t valve, (b ) S. n. sp. A aff. media, TM7843 (GS11214) , lef t valve , (c ) S. n. sp. B, TM7844 (GS9536), righ t valve, (d) 5. acculta, TM7845 (GS11195), right valve, (e) 5. subobesa, holotype, TM4300, righ t valve , (f ) S. poroleda, holotype , AK70725, lef t valve , (g ) S. n. sp . C, TM7846 (SCIP041) , right valve , (h) S. trailli, TM7847 (GS9685), lef t valve , (i) S. clifdenensis, TM784 8 (GS10365) , left valve , (j) Eucrassatella ampla, TM7849 (GS3600) , lef t valve , (k ) E . n. sp., TM7850 (SCIP080) , lef t valve . (1) Salaputium animula, TM787 2 (GS9806), righ t valve, (m) Eucrassatella scopalveus, holotype, AK70726 , right valve.

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

Methods Allometric heterochrony This pape r i s concerned , i n part , wit h th e identification o f heterochron y (e.g . McKinne y & MacNamara 1991) . Th e stud y o f heterochron y requires, b y definition , som e mean s o f calibratin g the rat e an d timin g o f developmenta l event s an d growth betwee n differen t individuals . Mos t workers hav e assume d tha t chronologica l tim e i s the mos t appropriat e o r practica l referen t ['age structured' studies ; bu t se e discussio n i n Hal l (1992)]. In th e present study , i t has no t been possibl e t o establish th e chronologica l ag e o f individua l specimens. Th e us e o f stabl e isotope s an d growth line analyse s t o ag e mollusc s ar e wel l establishe d and could , potentially , allo w age-structure d analysis o f th e Spissatella dat a (e.g . Jone s 1988 ; Brey & Mackense n 1997 ; Jone s & Goul d 1999 ; Tojo & Ohn o 1999) . Specimen s o f Spissatella, however, generall y d o no t posses s conspicuou s growth lines o r discontinuities i n the commargina l sculpture tha t migh t represen t annua l increments . In som e cases , growt h line s ar e visibl e o n th e juvenile an d immature parts of the shell , bu t thes e typically ar e absen t o n th e adult . Henc e sclero chronology would , b y necessity , rel y o n isotopi c analyses o r examinatio n o f radia l section s o f th e shell, method s tha t ar e destructiv e o f material an d were considered impractica l in the present study. In this study , therefore, siz e has been use d as an implicit prox y fo r tim e an d th e dat a ar e siz e structured, even though the assumption of age-size equivalence i s almos t certainl y flawe d (e.g . Jone s 1988). Inference s o f heterochron y base d o n size structured dat a ar e distinguishe d a s allometri c heterochrony (McKinne y 1988) . Th e potentia l pitfalls o f thi s approac h hav e bee n discusse d b y many workers (e.g. Blackstone & Yund 1989; Jones & Gould 1999) . Fourier shape analysis Fourier shap e analysi s operate s o n population s of digitized outline traces and, for each outline, yields a suit e o f Fourie r coefficient s tha t describ e a spectrum o f harmonicall y relate d trigonometri c curves or harmonics. Thes e coefficient s furnish th e input to standard multivariate statistical analyses. Digitized outlines were captured via a two-stage process: • Th e growt h lin e o f interes t wa s drawn usin g a camera lucida attache d t o a Wil d binocula r microscope. Specimen s wer e arranged s o that the growth line lay within the plane of view. Studie d growth line s wer e space d a t c . 1 0 mm interval s

403

along the axial length (AL) or conspicuous carina that extends from the umbo to the postero-ventral margin. Specimen s wer e reoriente d beneat h th e microscope befor e eac h growt h line wa s drawn. Because o f the vagarie s o f preservation, growt h lines could not be selected at constant intervals of AL, althoug h th e distributio n o f A L value s i s strongly trimoda l wit h mode s a t c . 8 , 1 9 an d 34 mm. • Th e outlin e drawing s wer e digitize d auto matically usin g th e pc-base d imag e analysi s software Optimas, v. 5.10 (Optima s Corporatio n 1995). Outline s wer e trace d i n a standar d orientation (usin g th e hing e line ) an d sense , starting from th e umbo, and 2000 xy coordinate s were written to file. Fourier coefficient s wer e compute d an d manipu lated usin g the suit e o f programs Hangle , Hmatc h and Hcurve, written by John Haine s (Crampto n & Haines 1996 ; Haine s & Crampto n 2000) . Te n Fourier harmonics wer e generated fo r each outline ; the firs t harmoni c ha d n o shap e significanc e an d was ignore d during subsequent statistica l analysis . Ten harmonics captured all biologically meaningful shape information in the outlines (Crampton 1995) . For eac h harmonic , Hangl e produce d tw o Fourier coefficients. During processing, a number of adjustments and standardizations wer e necessary : (1 ) outlines wer e automatically smoothe d i n progra m Hangl e t o eliminate th e corruptin g effect s o f hig h frequenc y pixel digitizatio n 'noise ' (Haine s & Crampto n 2000). (2 ) Outline s wer e automaticall y standard ized for size in program Hangle based on perimeter length. This i s appropriate give n that the effect s o f size, i f not removed, wil l dominat e an y analysis of shape. Size information was retained separatel y an d reincorporated into the study at a later stage. In this way, siz e an d shap e wer e separate d an d coul d b e studied independently, a s recommended b y Stanle y & Yan g (1987) . (3 ) Righ t valve s wer e auto matically mirrore d i n progra m Hangle , prio r t o computation o f th e Fourie r coefficients , t o elimi nate th e effect s o f primitive bilatera l symmetr y i n bivalves (Crampto n 1995) . Followin g thi s procedure, a perfectly equivalve left and right valv e pair will appear identica l during statistical analysi s and separatio n wil l increas e wit h increasin g inequivalveness. (4) Outlines were standardized for starting positio n o f th e digitize d trac e usin g th e program Hmatch . Previou s studie s hav e demonstrated tha t Fourie r method s ar e ver y sensitive t o th e startin g positio n (an d thereb y orientation) o f th e digitize d trac e (Haine s & Crampton 2000) . Thi s i s a proble m i n th e Spissatella dat a se t wher e th e onl y landmar k tha t could be used to start the trace, the umbo, is broadly

Table 1 . Summary of al l specimens and collections included i n the analysis Collections* Aget

Label

Species

1 2

Spissatella acculta Finlay, 192 6 AK70722 GS11195 Spissatella acculta

3 4

S. clifdenensis Finlay , 192 6 S. clifdenensis

AK70723 GS11182

Altonian(a) Altonian(a)

5

S. clifdenensis

GS 10344

Altonian(b)

6

S. clifdenensis

Altonian(c)

7

S. discrepans Finlay, 192 6

GS 10365, SCIP053 AK70724

8 9 10 11

S. media (Marwick, 1926 ) S. media S. poroleda Finlay , 192 6 S. poroleda

12 13

S. subobesa (Marshal l & Murdoch, 1919 ) 5". subobesa

14

Whaingaroan Duntroonian

Locality*

Facies an d inferred ^ palaeoenvironment

Number (individuals/ outlines)

Wharekuri, Otag o I40/f349; hea d o f Lake Waitaki, South Canterbury Clifden section , Waiau River, Southlan d D45/f8819; Clifde n section, Waiau River, Southland D45/f8483; Clifden section , Waia u River, Southland D45/f8598; Clifden Section, Waiau River, Southland Lake Wakatipu, Southland

Glauconitic sandstone ; inne r shel f Glauconitic sandstone; inner shelf

1/3 9/27

Massive siltstone; inner to mid-shel f Massive siltstone ; inner to mid-shelf

1/3 17/44

Sandstone; inne r shel f

20/56

Muddy sandstone; mid- shelf?

10/24

Unknown

1/3

DuntroonianWaitakian Kaiatan Kaiatan Duntroonian Duntroonian

J41/f8460; Lome, near Weston, North Otag o J41/f8025; Lome, near Weston, North Otag o Shell Gully , Chatton, Southland F45/f9668; Shel l Gully, Chatton, Southland

Debrite; flan k o f seamoun t Debrite; flan k o f seamount Shelly sandstone ; inner shelf Shelly sandstone ; inner shelf

1/1 2/3 1/3 11/36

Duntroonian

Head of Lake Waitaki, South Canterbury

Glauconitic sandstone ; inner shelf

1/6

Duntroonian

I40/fl; head of Lake Waitaki, Sout h Canterbur y

Glauconitic sandstone ; inne r shel f

24/68

S. trailli (Hutton, 1873)

GS 10837, SCIP011 GS11154

Otaian

Siltstone; outer shelf

20/41

15

S. trailli

GS11283

Otaian

S. trailli S. trailli

Altonian(a) Altonian(a)

1/3 20/55

18

S. trailli

Altonian(b)

J41/f9499b; Pukeuri , Nort h Otag o

Siltstone; mid-shel f

6/18

19

S. n. sp . A aff. media

TM2859 GS1160, SCIP006 GS9685, OU10193 GS11214, SCIP084

Massive to poorly bedded siltstone ; outer shelf Poorly bedded siltstone ; mid - shelf Poorly bedded siltstone ; mid- shelf

9/24

16 17

J39/f26; Moun t Horrible, Pareor a River, South Canterbur y J39/f7500c; Blu e Cliffs, Otai o River, South Canterbury Awamoa Creek, North Otag o J41/f8499; Awamo a Creek, North Otago

Runangan

J42/fl26; Bridg e Point , North Otago

Debrite; flank of sea-mount

9/12

TM4299 GS9481 AK70725 GS9806, SCIP046 TM4300

6/8

20

S. n. sp. B

GS9536

Whaingaroan

J42/f6032; Gees Point, Kakanui, North Otago

21 22

S. n. sp. C 5. n. sp. C

GS1473 SCIP039

Waitakian(a) Waitakian(a)

20/51 15/32

23

S. n. sp. C

Waitakian(b)

24

S. n. sp. C

GS7166, SCIP040 SCIP041

25

GS3600

Waitakian

26

Eucrassatella ampla (Zittel, 1864 ) £. australis (Hutton, 1873 )

I40/f9519; Trig Z, Otiake, North Otago I40/f345; Brothers Stream, Hakataramea valley, South Canterbury I40/f7551; Brothers Stream, Hakataramea valley, Glauconitic siltstone; mid- shelf? South Canterbury Calcareous siltstone ; mid- to outer shelf I40/fl88B; Sister s Creek, Hakataramea valley, South Canterbury Sandy mudstone F46/f8492; Mataur a River, Southland

GS9959

Bortonian

Gravely sandstone

1/4

27 28 29

E. concisa (Finlay, 1926 ) E. kingicola (Lamarck, 1805 ) E. n. sp.

AK70727 WM2982 SCIP080

Altonian Recent Altonian

Shelly sandstone ; mid-shel f Shelly sandstone ; inne r shel f

1/3 1/4 9/22

30 31

E. scopalveus (Finlay, 1926 ) E. scopalveus

Altonian Altonian

Shelly sandstone ; inner shel f Shelly sandston e

1/3 18/60

32

Duntroonian

Shell Gully, Chatton, Southlan d

Shelly sandstone ; inne r shel f

10/10

33

Salaputium animula (Marwick, 1929 ) Salaputium animula

AK70726 GS951, OU189 M1847

J40/f6610; Pentland Hills , Waihao River, South Canterbur y Target Gully, Oamaru, North Otag o Australia (localit y unknown) J39/f244; Pareor a Rive r near end of Purves Road, South Canterbury Target Gully, Oamaru, Otag o J41/f8498; Target Gully, Oamaru, North Otago

Duntroonian

F45/f9668; Shell Gully, Chatton , Southlan d

Shelly sandstone; inne r shel f

10/10

34

S. animula

TM6758, GS9806 GS9805

Duntroonian

F44/f9501; Coal Creek, Wendon valley , Southland

Carbonaceous pebbl y sandston e

10/10

Waitakian(b)

Calcareous, fin e agglomerate ; flan k o f sea-mount Sandy limestone; inner to mid-shelf Glauconitic sandstone ; inner shelf

20/55

20/51 1/5

*Collection number s shown in bold indicate holotypes. All material i s housed i n New Zealand institutions , and specimen an d collection number s are prefixed with the followin g repository identifiers : AK, type Mollusca number , Auckland University, Auckland; GS , collectio n number , Institut e o f Geologica l an d Nuclea r Science s (IGNS) , Lowe r Hutt ; M , typ e Mollusc a number , Museu m o f Ne w Zealand , Wellington; SCIP , private collections o f the author (PAM) ; TM, type Mollusca number , IGNS; WM, world Mollusca collection , IGNS. ^Age s are given i n terms o f New Zealand local ages; correlations with the internationa l timescal e ar e shown in Fig. 1 . Relative position s within age s ar e indicated, in ascending order , by (a) , (b) , etc . ^Fossi l localities are registered in the Fossi l Recor d Fil e (FRF), a national database administered by the Geological Societ y o f New Zealand . The file i s arrange d according to NZMS260 serie s 1:5 0 000 topographical map shee t areas . FR F number s appear i n the forma t J41/fl23 , where J41 refers t o the map sheet area and f!23 refers t o a unique locality number within that sheet. § Palaeoenvironments are inferred from tota l fossil faunas, facies and stratigraphic considerations .

406

J. S . CRAMPTO N & P. A. MAXWEL L

rounded an d canno t b e define d wit h precision . Other Fourie r program s hav e standardize d fo r starting positio n usin g propertie s o f individua l outlines. Program Hmatch , on the other hand, uses properties o f the entire sample of outlines (i.e. 747 outlines) an d i s a consistentl y robus t approac h t o standardization fo r startin g positio n (Haine s & Crampton 2000) . 'Matching ' i n thi s wa y ha s th e effect o f minimizin g th e firs t eigenvalu e durin g statistical analysis (see below). Fourier coefficient s wer e examine d usin g thre e statistical methods , principa l component s analysis (PCA), discriminan t functio n analysi s (DFA ) an d analysis of variance (ANOVA) . Statistical analyses were performe d usin g th e pc-base d softwar e NTSYS-pc, v . 1.8 0 (Rohl f 1993 ) an d th e Unix based progra m S-plu s v . 5. 0 (Mathsof t 1998) . Multivariate analyse s (PC A an d DFA) were base d on the variance-covariance matrix and the Fourier coefficients wer e no t standardize d fo r amplitud e [see explanation in Crampton (1995)]. In the DFA, the significanc e o f difference s betwee n grou p means was tested using the Wilks' lambd a statistic transformed t o an F-statistic. Becaus e o f relatively small grou p size s an d th e requiremen t tha t th e number o f individual s excee d th e numbe r o f variables, i n som e case s i t wa s necessar y t o limi t the numbe r of harmonics inpu t to DFA to th e firs t five o r six . Test s wit h varyin g number s o f harmonics indicate d tha t eliminatin g th e highe r order harmonic s ha s littl e impac t o n grou p discrimination. Th e numbe r o f harmonic s use d i s reported i n th e tex t wit h th e result s o f DFA . Th e ANOVA used principal component scores for each outline an d correspondin g specime n sizes , a s measured by the AL, to examine linear relationships between shape and size. In many cases correlations are non-linea r and/o r sho w scale-dependen t increase o f varianc e with size, a condition termed heteroscedasticity tha t contravene s an assumption of th e ANOV A method . T o eliminate o r minimiz e these problems , A L wa s log-transforme d prio r t o analysis (cf. Foote & Cowie 1988) .

Results Presentation of results Interpretation wa s base d largel y o n th e result s o f PCA o f the tota l data set. For eas e o f comparison , all data are show n ordinated agains t the firs t thre e principal componen t (PC ) axe s an d al l plot s ar e homologous. Th e firs t thre e P C axe s o r eigenvectors explain 51 , 1 6 and 11% , respectively, of the total variance in the data. Both a scree plot of eigenvalues an d th e broken-stic k mode l (Joliff e 1986; Jackso n 1993 ) sugges t tha t onl y th e firs t

three eigenvectors ar e significant and explain mor e variance than expected b y chance alone. Hence the remaining eigenvectors were ignored in subsequent interpretation. Th e P C axe s ar e cas t i n unit s o f standard deviatio n an d centre d abou t th e overal l mean. Their lengths are scaled to be proportional to the variance explained by each eigenvector and also normalized so that they are consistent with average taxonomic distance s amongs t a set of object s (Rohlf 1993) . Ordinated against the three PC axes of Fig. 3 are a suit e o f wholl y syntheti c outlin e shape s corresponding t o uni t standar d deviatio n step s along eac h axi s ( ± tw o standar d deviations) . Th e outline positioned a t the origin i s the overall mea n shape. Figur e 3 als o show s a grey-scal e ma p o f size, base d o n AL, fo r the firs t tw o P C axes . Not e that PC s 2 an d 3 sho w n o consisten t size-shap e correlations and , fo r simplicity , th e siz e ma p i s omitted fro m thi s plot . Siz e dat a ar e examine d i n more detai l belo w usin g ANOVA. The outline s of Fig. 3 facilitat e eas y interpretatio n o f th e distributions of the real data and should be used as a referenc e fo r th e followin g discussions . The y translate a n arbitrary mathematica l spac e int o th e biologically meaningfu l 'morphospace' , upo n which th e presen t interpretation s ar e based . I n combination wit h the siz e data, the y transfor m the PC axe s int o a ma p depictin g morphologica l 'geography'. In th e followin g plots , subset s o f th e dat a ar e summarized b y 95 % confidenc e ellipse s o n thei r group means . I n othe r words , eac h grou p population mea n ha s a 95 % probabilit y o f lyin g within it s confidenc e ellipse . Similarly , i n som e diagrams th e distribution s o f individua l points ar e summarized usin g 95% probability ellipses . These ellipses are expected to enclose 95 % of data points for an y particula r group . Th e meanin g an d relationships of confidence and probability ellipse s are illustrated in Fig. 4. The ellipses were generated using the method of Altman (1978), modified to the F-statistic followin g Soka l & Rohl f (1995) . Confidence an d probabilit y ellipse s ar e a convenient way to summarize and represent a large number of individual data points. In addition , they allow th e reade r t o gaug e (approximately) th e significance o f differences betwee n group means. It shoul d be remembered, however , tha t PCA i s an ordinatio n tha t maximize s separatio n o f individual points in multivariate space fo r the data set a s a whole . I t doe s no t identif y axe s tha t optimally discriminat e an y particula r pai r o f subgroups of the data (e.g. collection or size groups etc.). Hence , wher e relevant , mor e rigorou s pairwise comparison o f group means was achieved using DFA, results of which are reported in the text. In order to test for patterns of allometric growth ,

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

407

against these axes are a suite of wholly synthetic outline shape s corresponding t o unit standard deviation step s alon g each axis. These shape s facilitate eas y interpretation o f distributions o f real data and should be used as a reference for subsequent plots. Syntheti c outline shapes were generated usin g the inverse Fourier program Hcurve and the procedure outlined in Haines & Crampton (2000). Also shown v. the first two axes is a grey-scale map of average shell size (based on axial length, AL), calculated a s the average AL for all data points within each rectangle o f an arbitrary grid. White grid rectangles correspon d t o an average size of 0 mm (i.e. no data) and black rectangle s correspond to an average size of 54 mm (i.e. the largest averag e AL encountered). The map reveals a n approximately uniform increas e in size towards the upper left corne r o f the plot (see text for further discussion). Note that specimen s of Eucrassatella were omitted during computation of the size map. Size data show no consistent patter n v. PC 2 and 3 and have, for clarity, been omitted . For reference, smal l plots o n the bottom right of the diagram show the distributions of the real data v. the first thre e PC axes.

data wer e divide d int o thre e arbitrary siz e classes based o n th e A L (remembering , o f course , tha t outlines hav e bee n standardize d fo r siz e pe r se). These siz e classe s were chose n t o reflec t th e siz e modes of the digitized outlines (see above) and are: (1) AL < 15 mm; (2) 15 mm < AL < 30 mm; and (3) AL > 30 mm. By convention, and for convenience, these are referred to as juvenile, immature and adult growth stages , respectively , wit h th e cavea t tha t certain size classes will not correspond to the same absolute age classes in different taxa . Lines linkin g differen t growt h stage s o f individual specimen s or grou p mean s are termed ontogenetic trajectories (Fig . 5a). As noted above, outlines wer e standardize d fo r siz e durin g

processing and , therefore, tw o outlines tha t hav e identical shape s an d diffe r onl y i n siz e wil l plot at the sam e poin t i n morphospace . Th e degre e o f separation i s a measur e o f shap e difference . Consequently, th e degre e o f separatio n between different growt h stage s of a singl e individual is a measure o f allometry . Conversely , i f growt h i s isometric, tw o ontogeneti c stages of a n individua l will occup y th e sam e poin t i n morphospace. Clearly, i n som e tax a allometri c growt h i s pronounced an d individual ontogenetic trajectorie s traverse muc h o f th e tota l morphospac e occupie d by the data set as a whole (Fig. 5a). Using overlain real o r syntheti c average outlines, it is possible to visualize changes in the location, extent or intensity

408

J. S . CRAMPTO N & P . A. MAXWELL

Fig. 4 . First tw o P C axe s showin g al l data for one collectio n o f S. subobesa (12,13) an d includin g the holotype (lef t and righ t valves , TM4300,12). Data points ar e distinguished accordin g t o siz e clas s and, fo r each siz e class , the 957c probability an d confidenc e ellipse s are shown . Als o shown, fo r the lef t valv e of the holotype , i s one exampl e o f an individual ontogeneti c trajectory . Thi s plot illustrate s th e relationship betwee n th e actual dat a point s an d thei r probability an d confidence ellipses , and serve s a s a reference fo r later figures .

of marginal growt h field s and to thus specify shap e allometries. Thi s i s illustrate d i n Fig . 5c , showin g size-standardized outline s fo r thre e growt h stage s of a singl e individual . Region s o f negativ e an d positive relative growth are indicated using shading and arrows. Thi s method o f visualization i s utilized below. Th e region s thu s identifie d ar e empirica l analogues o f the apertur e map s o f Rice (1998 ) that depict the relative magnitudes of shell production at different point s aroun d th e aperture s o f hypothetical gastropods . Where relevant , syntheti c averag e shape s fo r specific subset s o f th e dat a ar e show n wit h th e statistical plots . Thes e outline s wer e generate d using th e average d Fourie r coefficient s fo r th e group i n question an d th e invers e Fourier progra m Hcurve. The y allo w th e reade r t o gaug e morphological difference s between specific subsets of the data . The se t o f 74 7 outline s wa s examine d b y collection, geologica l age , facies , a prior i taxo nomic grouping s an d siz e class . Du e t o th e larg e number o f ways th e data hav e bee n explored , onl y

significant result s an d relevan t plot s ar e presente d here.

Interpretation of the principal component axes: the shape morphospace Using the syntheti c outline s of Fig . 3 , it is possible to assig n morphologica l meanin g t o th e thre e significant P C axes . Th e firs t principa l componen t can b e explained largel y b y the degree of posterior elongation: individual s with lo w score s o n P C 1 have a n extende d posterio r margin , ar e strongl y inequilateral an d hav e a rostrat e posterior ; thos e with hig h scores hav e a truncated posterior margi n and ar e relativel y equilateral . P C 2 code s fo r several traits, most importantly the prominence and inflation o f the umbo, the length of the anterior part of th e shell , an d th e heigh t an d roundnes s o f th e posterior margin . Individuals wit h lo w P C 2 score s have relativel y weakl y inflate d umbones , extended anterior region s an d hig h umbona l angle s approaching 180° . Shell s wit h hig h P C 2 score s

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

409

Fig. 5 . (a) First two PC axes showing actual, size-normalize d outlines for three growth stages each of two individuals. The upper outlin e is S. subobesa (holotype , TM4300,12, left valve ) and the lower outline is S. poroleda (TM7873 , SCIP046, //, right valve), (b) The same three outlines for TM4300 shown in their true size proportions, (c) Sizenormalized outlines for TM4300 overlain to reveal regions of positive (shaded) and negative (white) marginal allometry. Arrows highlight the sense of allometry for each segment of the margin. The thinnest outline indicates juvenile growth stag e and the thickest outline the adult growt h stage.

have prominen t umbones , shor t anterio r region s and low umbonal angles close to 90°. With increasing PC 2, the outlines becom e les s rectangular an d increasingly triangula r i n appearance . P C 3 accounts largely for convexity of the ventral margin and th e angularit y o f th e postero-umbona l carina : low score s correspon d t o a relativel y straigh t ventral margi n an d shar p carina , hig h score s cod e for a more convex margin and carina. General taxonomic observations Examination o f the data by collection ha s revealed that, wit h almos t n o exceptions , individua l collections occup y continuou s region s o f morphospace and , for an y particular size class, d o not defin e mor e tha n on e discret e cluster . Thi s suggests that, in general, each collection comprises a single taxonomic unit, based o n shape alone, and that different species , if truly coeval, did not coexist at a single site but were partitioned by facies and/or palaeogeographic setting .

Morphometric and evolutionary patterns through time At a gross scale, Fig. 6 reveals long-ter m patterns in the evolutio n o f adul t shap e throughou t th e Lat e Eocene-Early Miocene , bot h i n term s o f morpho logical disparit y an d averag e form . Durin g th e latest Eocen e an d Earl y Oligocene , diversity wa s low, comprisin g a singl e taxo n a t eac h level , an d shape is restricted to relatively high scores on PC 1 . Over this period, and into the Late Oligocene, ther e was progressiv e expansio n o f adul t for m int o regions o f morphospac e correspondin g t o lo w scores on PC 1 . During the middle Late Oligocen e there were at least two lineages of Spissatella (Fig . 1) an d morphologica l disparit y wa s greates t ove r this interval; three species ar e recognized an d their average shape s ar e widel y separate d i n morphospace. Subsequently , durin g th e lates t Oligocene-Early Miocene, ther e wa s a contraction in tota l morphospac e occupatio n an d grou p averages are restricted largel y t o the upper hal f o f

410

J. S . CRAMPTO N & P. A. MAXWELL

Fig. 6 . First tw o PC axes showin g 95 % confidence ellipse s for largest growt h stag e o f all major collections o f Spissatella. Confidenc e ellipse s on PC 3 are largely overlapping an d are not shown here . Ages are coded according to the New Zealand local timescale but approximate correlations with the international epochs are indicated (see Fig . 1 for mor e precise correlations). Ellipses are identified usin g the collection labels of Table 1 .

the plot . Fo r thi s interva l o f time , confidenc e ellipses fo r collection s ar e relativel y tightl y clustered and, in many cases, overlapping. Overall, following th e initia l morphological expansion , there i s n o directiona l tren d i n morphospac e occupation through time. Figure 6 reveals patterns of convergenc e an d repeate d occupation s o f particular regions of morphospace. Relationships at specific time s an d betwee n particular group s ar e explored i n more detai l below , i n stratigraphicall y ascending order . From independen t analysi s o f both interna l an d external characters , an d th e clos e stratigraphi c proximity o f the studie d topotyp e collections , i t is inferred tha t S . acculta (2 ) wa s immediatel y ancestral to S. subobesa (12,13) in the middle Late Oligocene. I n addition , availabl e evidenc e favours evolution of latest Oligocene-earliest Miocene S. n. sp. C (21) from S . subobesa. Average ontogeneti c trajectories fo r thes e thre e specie s ar e virtuall y parallel in three-dimensional morphospace an d they differ primaril y i n lengt h (Fig . 7a) . Thi s arrangement o f successiv e trajectorie s ca n b e readily explaine d a s evolutio n b y globa l hetero -

chrony: th e thre e form s displa y near-identica l patterns of shape development, varying only in the rate and/or timing of progress along the ontogenetic pathway. I n addition , however , the y als o sho w progressive translation s o f thei r ontogeneti c trajectories toward s highe r P C 2 score s tha t correspond t o increase d prominenc e o f th e umb o and slightl y increase d inflatio n (cf . Fig. 3) . In th e case o f 5. n. sp . C, the offse t i s clearly significan t and th e increas e i n inflatio n i s expresse d earl y i n ontogeny. Thi s offse t migh t represen t a non heterochronic, morphologica l innovatio n i n earl y ontogeny, terme d a cenogeni c even t b y som e authors (e.g . Swa n 1988) . Alternatively , i t i s ver y likely tha t increase d inflatio n wa s itsel f a consequence o f heterochroni c evolution , althoug h this has not been studie d i n detail here . Th e shap e data fo r these thre e specie s ca n be recas t wit h PC score v. size AL to create a series of plots equivalen t to thos e use d b y McKinne y (1988 ) t o illustrat e different form s o f allometri c heterochron y (Fig . 7b). Thus, the inferred transition from S . acculta to 5. subobesa represents evolution via a combination of allometri c acceleratio n an d hypermorphosis ,

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

whereas the transition fro m S . subobesa to S. n. sp. C represent s evolutio n primaril y vi a allometri c progenesis (cf. McKinney & McNamara 1991 , fig s 2-15). By way of contrast , the ontogeneti c trajectory fo r middle Lat e Oligocene S . poroleda is conspicuously non-paralle l t o th e other s an d ha s opposed polarity on PC 3. It is inferred here that S. poroleda either evolved from a rather different, an d as yet unknown, ancestor or that its evolution fro m the commo n ancesto r t o S . acculta involve d mechanisms othe r than heterochrony. These result s can b e viewe d anothe r way , using overlain , size standardized, averag e outline s fo r eac h growt h stage (Fig . 7c, cf . Fig. 5c). In th e thre e specie s S . acculta, S. subobesa an d S . n . sp . C , positiv e an d negative allometri c growt h field s ar e distribute d similarly around the growing margin and vary only in their magnitude in S . subobesa. S. poroleda, on the othe r hand , ha s strongl y negativ e allometri c growth at the postero-ventral extremity of the shell, a pattern no t observe d o n the othe r species , an d it clearly follow s a rathe r differen t ontogeneti c growth pattern . Thes e difference s ar e mirrore d by its relatively low inflation and differences i n hinge structures (unpublishe d data) , suggestin g tha t perhaps S . poroleda shoul d b e referre d t o it s ow n subgenus. Evolution o f Spissatella durin g th e lates t Oligocene-earliest Miocen e i s rathe r mor e problematic. Fou r collections hav e been examine d and thes e ca n b e groupe d into olde r an d younger pairs of collections base d o n associated planktonic foraminifera (Tabl e 2) . Tw o o f th e collections , 2 2 and 23, are closel y associate d i n the sam e sectio n and spa n a microfossi l zona l boundary . The olde r collections, 2 1 an d 22, hav e substantiall y differen t mean shapes , althoug h ther e i s overla p betwee n their immatur e probabilit y ellipse s (Fig . 8) . Th e younger pai r o f collections , 2 3 an d 24, ar e indis tinguishable o n th e basi s o f shape , thei r mean s having a 63% probability o f being drawn from th e same populatio n (Tabl e 1) . I n al l othe r com parisons, mean s ar e significantl y differen t fro m each othe r a t probabilitie s o f > 99.9% (Table 2) . Individual immature data points for the four groups all overla p wit h al l other s t o varyin g degrees an d together occup y a continuou s regio n o f morpho space (the 95% probability ellipses of Fig. 8). Shift s in mea n position s ar e no t consisten t throug h tim e and do not define a uniform trend. Shape variability in thes e collection s i s matche d b y comparabl e variation i n th e strengt h an d distributio n o f commarginal sculptur e (unpublishe d data) . Although th e possibility tha t the older collections , 21 an d 22 , represen t distinc t specie s canno t b e discounted, fro m availabl e evidenc e i t i s inferre d that th e fou r collection s ar e draw n fro m a single , highly variabl e species . Variabilit y may have been

411

related t o ecophenotypi c effect s associate d wit h facies and/o r t o evolutio n b y rando m walk , o r t o evolution i n respons e t o a fluctuatin g selectio n regime. Th e presen t dat a d o no t allo w thes e hypotheses to be tested. It is worth noting, however, that th e tw o indistinguishabl e collection s ar e derived fro m simila r siltston e facies ; the other two collections ar e from sandston e and limestone facies (Table 1) . Th e influenc e o f facie s an d palaeo environment is discussed below . Stratophenetic pattern s durin g th e middle-lat e Early Miocen e hav e bee n examine d usin g seve n collections o f tw o species , S . trailli an d S . clifdenensis (Tabl e 1) . Two collections o f S. trailli of middl e Earl y Miocen e ag e (1 4 an d 15 ) ar e morphologically simila r to each other (Fig. 9a) and their means are not significantly different (Tabl e 3). Although no t shown , these tw o sample s includ e a few large r individual s tha t ar e indistinguishabl e from adul t S . trailli i n th e succeedin g lat e Earl y Miocene collection (17). Topotype collections o f S. trailli an d S . clifdenensis fro m th e lat e Earl y Miocene hav e ver y simila r shape s (Fig . 9b, lowe r outlines) an d ther e i s a hig h degre e o f overla p between their populations (Fig. 9a inset, 4 and 17). Their mea n shape s are , however , significantl y different a t the 99.5% level of confidence (Table 3). They als o diffe r i n detail s o f th e hing e line : S . clifdenensis ha s a relativel y hig h hing e an d shor t resilifer. Subsequently , bot h specie s diverg e morphologically fro m th e ancestra l populations , moving i n opposit e sense s o n th e P C plot . Th e geologically younges t sample s ( 6 an d 18 ) ar e widely separated , thei r 95 % probabilit y ellipse s barely touc h (Fig . 9a) an d the y hav e distinc t outlines (Fig . 9b , uppe r outlines) . Th e geologicall y youngest S . trailli are morphologically convergen t upon immatur e S . subobesa an d th e tw o youngest collections o f S . clifdenensis ar e indistinguishabl e on th e basi s o f shap e (Tabl e 3) . Usin g overlai n average outlines for each growth stage (Fig. 9c), it is apparent that increasing difference s between th e species resul t fro m rathe r subtl e change s i n th e magnitudes o f growt h field s o n th e ventra l an d postero-ventral margins . I n particular , negativ e allometry on the ventral margin that is visible in all other Spissatella is suppressed i n S. clifdenensis i.e. growth on the ventral margin is isometric. Even though ontogeneti c trajectorie s ar e non-parallel , these pattern s ma y recor d loca l heterochroni c changes i n particula r margina l growt h field s tha t occurred without significant global change in adult size (cf . Figs 3 an d 9a) . Patterns o f shap e chang e during th e Earl y Miocene , therefore , sugges t th e following evolutionar y hypotheses (Fig . 10). First, negligible evolutio n of S. trailli through the middle Early Miocen e conform s t o a mode l o f stasis . Secondly, it is inferred that S. clifdenensis evolve d

412

J. S . CRAMPTO N & P. A. MAXWEL L

by cladogenesi s fro m S . trailli at some time in th e middle Earl y Miocene . Thirdly , morphologica l divergence o f the tw o specie s occurre d durin g th e late Earl y Miocen e an d suggest s anageneti c evolution withi n bot h lineages , althoug h thi s requires thoroug h testin g wit h additional , strati graphically closel y space d samples . Fourthly , th e youngest populations of S. clifdenensis experience d apparent stasi s fo r a n appreciabl e lengt h o f time . Note tha t th e inferenc e o f anagenesi s (withi n lineage evolution ) make s n o statemen t abou t evolutionary rate, for which stratigraphic resolution would need to be improved, perhaps by an order of magnitude (cf. Chiba 1996) .

Overall correlations between size and shape Looking at the data set as a whole, the most striking feature i s th e stron g negativ e correlatio n betwee n PC 1 scor e an d siz e (Fig . 3) , an d th e consisten t separation o f juvenile an d adul t siz e classes along this axi s (Fig . 11) . Th e genera l patter n o f siz e change show n in Fig . 3 is interrupte d by a singl e 'peak' in size around PC 1 = 0 and PC 2 = -1. This peak represent s S . acculta, which is, compare d t o

other taxa , anomalousl y larg e fo r it s adul t shape . Overall relationships betwee n siz e an d shape wer e studied in more detail using ANOVA. As explaine d previously, thi s i s use d her e t o explor e linea r correlations betwee n P C score s an d thei r corres ponding log-transformed value s o f AL (size) . Fou r nested models wer e fitte d fo r each o f the principa l components. Thes e model s identif y th e relativ e proportions o f the total varianc e tha t are explained by: (1 ) overal l size-shap e correlations ; (2 ) differ ences i n size-shap e correlation s betwee n collec tions; (3 ) difference s betwee n individual s fro m each collectio n an d th e mea n regressio n fo r tha t collection; an d (4 ) residua l o r unexplaine d variations. Results o f ANOV A ar e presente d i n Tabl e 4 . These reveal that 63% of the shape variance o n PC 1 is explained b y the correlation betwee n siz e an d shape. I n morphologica l terms , thi s correlatio n corresponds to increasing posterior elongation with increasing siz e (Fig . 3) . Nearly al l th e remainin g variance, 30%, is explained by differences between collections; th e scatte r o f individual s abou t th e mean regressio n fo r eac h collectio n i s negligibl e (< 3%). The value for the residual on PC 1 (4%) is

SHAPE EVOLUTION IN CENOZOI C SPISSATELLA

413

Fig. 7 . (a, opposite) Firs t three PC axes showing data for latest Eocene-Late Oligocene Spissatella. Note that, for clarity, immature ellipses ar e omitted from al l plots an d juvenile ellipses ar e omitted from th e lower plot, (b) Dat a for S. acculta, S. subobesa an d S. n. sp. C (collection GS1473) ordinated on PC v. AL (i.e . size) plots for PC 1 and 2. These three species are inferred t o form a n evolutionary lineage, (c) Overlain, size-normalized averag e outlines for three growth stages each of S. acculta, S. subobesa, S. n. sp. C and S. poroleda, showing regions of positive and negative allometry on the shell margin (cf. Fig. 5c) .

surprisingly lo w and emphasizes the high explanatory importance of size. On PC 2 and 3, the greatest component o f variance is explained by difference s between collections (5 5 and 50%, respectively) and overall size-shap e correlation s ar e relativel y unimportant t o negligible . Take n together, th e weighted sum s for the three PC sho w that close t o half (45% ) o f th e tota l varianc e i n th e P C Ai s explained by siz e and over one-third (37% ) relates to difference s betwee n collections . Onl y a mino r part, < 7%, i s explaine d b y intracollectio n scatte r between individuals . Overall , th e residua l o r unexplained varianc e i s lo w (11%) . Furthe r

analysis o f th e residual s reveal s that , fo r eac h collection, ther e i s n o significan t correlatio n between th e residua l an d th e fitte d P C score ; i n other words , th e varianc e o r scatte r o f th e indi vidual points about the size-shape regression doe s not chang e significantl y wit h size . Thi s bot h satisfies a n assumptio n o f th e ANOV A an d indicates tha t th e shap e o f Spissatella doe s no t become mor e or less variable with growth. These result s ca n be visualize d b y referenc e t o Fig. 11 , which show s averag e ontogeneti c trajec tories fo r al l collection s o f Spissatella. O n a n ordination o f P C 1 v . P C 2 , al l ontogeneti c

Table 2. Results ofpairwise discriminant Junction analyses (DFA)for immature growth stages of al l latest Oligocene-earliest Miocene collections, based on harmonics 2-6 GS1473 (27)

SCIP039 (22 )

GS7166, SCIP040(23)

SCIP039 (22 )

0.000 (F= 13.872 , v1 = 10 , V2 = 23)

GS7166, SCIP040(23)

0.000 (F = 5.767, V j = 10 , V2 = 37)

0.000 (F= 8.698, v1 = 10,v 2 = 37)

SCIP041 (24)

0.000 (F = 6.528, V j = 10 , V2 = 30 )

0.000 (F= 12.732 , vx = 10 , V2 = 30)

0.626 (F = 0.804, Vj = 10,v 2 = 44)

The null hypothesis states that any two collections are drawn from th e same population. The first valu e in each cell is the probability that the null hypothesis is true.

Table 3. Results ofpairwise discriminant function analyses (DFA)for adult growth stages of selected collections ofS. traill i and S. clifdenensis S. trailli

GS 11 154 (14} 1. Aquitanian-e. Burdigalia n S. trailli G

S 11283 (15) 0.27 5 1. Aquitanian-e. Burdigalia n ( F = 1.326, vl = 10, V2 = 23)

S. clifdenensis G

S 11182 (4) late Burdigalian(a) ( GS 10344 (5 ) late Burdigalian(b)

0.00

S. clifdenensis GS1160, SCIP006(77) late Burdigalian(a )

5 F = 3.986, v 1 = 10, V2 = 19)

GS 10344 (5 ) late Burdigalian(b )

0.000 (F = 5.994, v 1 = 10,v 2 = 20)

GS 10365 (6 ) late Burdigalian(c )

0.679 (F = 0.711,Vi = 8 , v2 = 19)

Analyses based on harmonics 2-6 excep t for 5 v, 6 which, because of small sample sizes, is based o n harmonics 2-5. Th e null hypothesis states that any two collections are drawn from th e same population. The first valu e in each cell is the probability that the null hypothesis is true.

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

415

Fig. 8 . First three PC axes showing data for latest Oligocene-earliest Miocene S. n. sp. C. Ninety-five pe r cent probability ellipses are shown for the immature size class on the upper plot. For clarity, probability and juvenile confidence ellipse s are omitted from th e lower plot. Larger specimens are lacking or uncommon in some collections and hence comparisons are based largely on the immature size class. Also shown i n the legend are average immature outlines for each collection. Based on associated planktonic foraminifera, th e four collection s are grouped into two older and two younger samples. Collections are compared statistically in Table 2.

trajectories, excep t fo r one , ar e approximatel y parallel an d sho w monotoni c juvenil e t o adul t trends fro m righ t t o left . Juvenil e confidenc e ellipses cluste r withi n a relatively smal l regio n of morphospace. Th e oldes t definit e Spissatella examined, S . n . sp . A aff . S . media (19), i s high lighted an d lie s clos e t o th e intersectio n poin t o f nearly all trajectories. In contrast, on a plot of PC 2 v. PC 3 , ontogenetic trajectorie s are widel y divergent an d sho w n o consisten t trend , eve n withi n trajectories. Correlations between fades and shape At the level of individual species , th e present dat a cannot resolv e whethe r o r no t ecophenotypi c variation is a n important influence on the shap e of Spissatella. Thi s i s becaus e i t i s difficul t t o eliminate othe r potentia l source s o f variatio n an d study facies effects i n isolation. For example, in the latest Oligocene-earlies t Miocen e collection s illustrated i n Fig . 8 , shap e variatio n i s correlate d with bot h facie s an d geologica l age , an d i t i s

unclear whethe r either , bot h o r neithe r o f thes e factors influence d shape variation . To resolve thi s question would require a number of very well dated collections fro m a variety of facies, material that is currently not available . At a larger scale , however , ther e ar e ver y clea r correlations betwee n immature-adul t shape , substrate type and inferred palaeoenvironment (Fig . 12). Collections fro m sand y facies and/o r inferred shallow-water environments display a much greater variance tha n thos e fro m siltston e facie s and/o r inferred mid - t o outer-shel f settings . Furthermore , low score s o n P C 1 , corresponding t o th e larges t and mos t inequilatera l shell s wit h elongat e posterior margins , ar e restricte d t o shallow-wate r Spissatella. Comparisons with other closely related genera Figure 1 3 shows data for a number of other, closel y related, fossi l an d Recen t crassatellid s tha t wer e included i n the analysi s fo r comparative purposes .

416

J. S . CRAMPTO N & P . A. MAXWELL

Fig. 9 . (a) First tw o PC axes showin g data for middle-late Early Miocene S . trailli and 5. clifdenensis. Adul t 95% probability ellipse s are shown for the youngest collections o f each specie s and , inset, for the topotype collections . These two species are not discriminated on PC 3 and, for simplicity, a plot of PC 2 v. PC 3 is omitted, (b) Overlai n size-normalized averag e adul t outlines fo r oldest (lowe r outlines ) an d youngest late Early Miocene collection s o f S. trailli and S. clifdenensis. Th e older outline s ar e very simila r (althoug h statistically different) , whereas th e younge r outlines ar e quite distinct , (c) Overlain, size-normalized averag e outlines fo r three growth stage s each of older and younger late Early Miocene S . trailli and S. clifdenensis. Thes e revea l evolutionar y changes i n allometry through thi s interval o f time .

Five o f thes e ar e specie s o f Eucrassatella, including th e typ e specie s E . kingicola. Tw o o f these, E . scopalveus an d E . n . sp. , wer e formerl y included withi n Spissatella bu t ar e herein referred to Eucrassatella o n th e basi s o f shape , thei r relatively thic k shell s an d thei r commargina l sculpture that becomes obsolet e o n the flanks a t an

early stag e o f growth . Al l fiv e specie s o f Eucrassatella hav e ontogeneti c trajectorie s tha t distinguish them fro m Spissatella, although thi s i s based on single individuals for three of the species. In Eucrassatella, ontogenetic trajectories originate in an area of morphospace not occupied by juvenile Spissatella, an d th e tw o set s o f trajectorie s hav e

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

417

Fig. 10 . Hypothesized evolutionary relationships between studied collections of S, trailli and S. clifdenensis. Collections are identified usin g same fill patterns as in Fig. 9 a and using numeric labels of Table 1 . Values of statistical significance ar e given in Table 3.

different orientation s i n morphospac e (cf . Figs 1 1 and 13) . Thes e result s sugges t tha t genus-leve l differences i n developmen t apparentl y affec t earl y stages o f ontogeny tha t are not studie d her e (i.e . a t the larva l o r immediatel y post-larva l stage ) an d result i n differen t 'startin g conditions ' fo r subsequent ontogenetic trajectories . Also shown is the 95% confidence ellipse for the juvenile (an d only ) siz e clas s o f Salaputium animula. This small species has been regarded a s a separate clade derived by paedomorphosis from the common ancesto r o f Spissatella o r Crassatella (Finlay 1930) . S. animula, however , occupie s morphospace tha t is well removed from the general ontogenetic trajector y o f Spissatella an d henc e i s unlikely t o hav e bee n derive d fro m a Spissatellalike ancesto r b y simpl e paedomorphosi s actin g o n the shape of the growing margin. This conclusion is corroborated b y difference s i n microsculptur e between thes e gener a (unpublishe d data) . Th e evolutionary origin s o f Salaputium remai n unknown, bu t i t i s possibl e tha t i t evolve d eithe r from a different crassatelli d grou p outside the New Zealand region or by innovation early in ontogeny.

Discussion Three results demonstrate that, throughout much of the lifespa n o f Spissatella, shap e variatio n i s ver y highly correlated wit h size and is explained largel y by a consistent patter n of allometric growt h acros s all specie s withi n th e genus. In othe r words , ther e was littl e evolutio n o f siz e withou t concomitan t evolution i n adul t shape , an d vic e versa . Thi s pattern i s expresse d a s approximatel y paralle l development o f individua l an d species-average d ontogenetic trajectorie s i n multidimensiona l mor phospace. Difference s betwee n specie s primaril y involve th e magnitud e o f mea n ontogeneti c shap e and size change along their average trajectories . In addition, the shapes of the geologically oldes t (and smallest) specie s an d th e juvenil e stage s o f al l younger specie s ar e highly conservativ e an d trend towards a singl e poin t i n morphospace . Together , these result s demonstrat e a correspondenc e between individua l and species ontogenie s an d the evolution o f adul t form , an d sugges t tha t hetero chrony has been the major evolutionary mechanism throughout th e lifespa n o f th e genus . Earl y

418

J. S . CRAMPTO N & P . A. MAXWEL L

Fig. 11 . First three P C axes showing average ontogenetic trajectorie s for all collections o f Spissatella. Ninety-fiv e per cent confidence ellipses fo r juveniles an d adults (but not for the immature size class) ar e shown on the upper plot but have, for clarity, been omitte d fro m the lower plot .

evolution wa s apparentl y dominate d b y pera morphosis. Apar t fro m thi s earl y expansio n int o morphospace during the middle Late Oligocene, n o other conspicuou s directiona l trend s i n shap e o r size evolutio n hav e bee n identifie d an d th e genu s

records repeatedl y convergen t evolutio n o f shape . These pattern s sugges t tha t paedomorphosi s an d peramorphosis occurre d i n approximatel y equa l frequencies fro m th e latest Oligocen e onwards. As noted i n the introduction, th e burial dept h o f

Table 4 . Results o f analysis o f variance (ANOVA) o f linear relationships between shape, a s measured along each o f three principal component (PC) axes, and th e axial length of th e outline (AL , i.e. size) Size

Total variance % Collections Individual

PC 1 PC 2 PC 3

63.2 17.7 0.3

29.8 54.7 47.9

2.6 11.0 18.4

4.4 16.6 33.4

Weighted su m

45.2

37.4

6.5

10.9

s

Residual

The ANOVA was computed fo r Spissatella dat a only. For eac h PC , the analysi s identifies the proportion o f total shap e varianc e that is explained by: (1) overall size-shap e correlations; (2 ) differences in size-shape correlations betwee n collections ; (3 ) differences between individuals fro m eac h collectio n an d the mean regressio n fo r tha t collection; an d (4 ) residual o r unexplained variations . Th e weighte d sum i s th e su m acros s th e thre e PCs , eac h component bein g weighte d b y it s relativ e contributio n t o th e PC A (i.e . weighte d b y it s eigenvalue as a proportion o f the sum of the first three eigenvalues). The weighted sum s reveal, for the PCA a s a whole, th e proportion s of total shape varianc e that are explained b y size-shape correlations, difference s betwee n collections an d intracollection variations .

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

419

Fig. 12 . First tw o PC axes showing 95% probability ellipses based o n data for all immature and adult Spissatella plotted by facies (upper plot) and inferred palaeoenvironment (lower plot). Facies an d inferred palaeoenvironments for eac h collection are summarized i n Table 1 .

Spissatella wa s limited by the overall length of the shell. Hence , th e genera l patter n o f posterio r elongation wit h increasin g siz e ha s a clea r functional interpretation . Increasin g th e lengt h o f the posterior margin allowed the animal to bury the visceral bul k o f th e shel l comparativel y deepl y whilst retainin g contac t wit h th e water . This , together with an overall increase in size and weight, would hav e enhance d stabilit y i n shiftin g sub strates, an d unde r energeti c condition s (Stanle y 1970). Furthermore, th e compressed, rostrate shap e of th e elongat e posterio r probabl y reduce d curren t scour of sediment fro m aroun d th e exposed part of the shel l (Stanle y 1977 , p . 881) . Therefore , th e dominant componen t o f ontogeneti c size-shap e variation i n Spissatella i s interprete d her e a s a n adaptation fo r lif e i n coarse r substrate s an d mor e energetic environments . It is inferred that selectio n targeted increasin g size , increasin g elongation , o r (most probably ) bot h trait s simultaneously . Thi s

result i s consisten t wit h th e observatio n tha t th e largest, most elongate species wer e restricted t o the coarsest substrate s in the shallowest waters . Clearly, however , posterio r elongatio n wa s no t the only successful adaptatio n to increasing energy , since specie s fro m sandston e facie s an d inferre d shallow water s hav e th e greates t overal l interspecific variance , occup y th e ful l rang e o f Spissatella morphospace , an d includ e small , equilateral, juvenile s an d adults . I t i s likel y tha t such form s gaine d adaptiv e advantag e fro m a n ability t o burro w an d rebur y rapidl y followin g disinterment, a s has been inferre d fo r livin g inter and subtida l Donax (Scare s e t al. 1998 ; se e als o Stanley 1970 , p . 58). In contras t t o th e coarse r facies , specie s fro m siltstones tha t wer e deposite d i n relativel y stable , mid- t o outer-shel f palaeoenvironment s ar e al l comparatively smal l in size and occupy a restricte d region of morphospace .

420

J. S . CRAMPTO N & P . A. MAXWELL

Fig. 13 . First three P C axes showin g dat a for species of Eucrassatella an d Salaputium animula. Also shown i s the 95% probability ellipse for all juvenile Spissatella. Fo r clarity, confidenc e ellipse s are omitted from the lower plot. E. ampla, E. australis an d E. kingicola (th e type specie s of the genus) are represented b y a single specime n each . E . scopalveus an d E. n. sp. are represented b y collections. Bot h wer e formerl y include d withi n Spissatella an d are here referred t o Eucrassatella. Becaus e o f the smal l numbe r of adult specimens , th e adult confidenc e ellips e is omitte d from th e data fo r E. n. sp. (See tex t for discussion.)

From a study of 1 9 lineages of infaunal Neogen e bivalves, Stanley & Yang (1987, p. 134 ) concluded that 'size is much more labile than shape in phyletic evolution' an d that this 'constitute s a basic rule of evolution'. They recommended tha t these two traits be considere d separatel y i n th e calculatio n o f evolutionary rates . Likewise , Bud d & Johnso n (1991) inferred that size and shape were decoupled (i.e. behaved independently) during evolution in the gastropod Strombina. Bot h thes e studie s ar e i n accord wit h th e elegan t theoretica l mode l o f gastropod morphogenesi s develope d b y Ric e (1998). H e hypothesize d tha t alteration s i n th e 'shape of the aperture map', or allometric changes in th e relativ e magnitud e o f shel l productio n a t different point s aroun d the aperture , are mor e difficult t o achiev e i n evolutio n tha n thos e tha t require a change in globa l rate or siz e parameters. In contras t t o thes e studies , th e presen t result s

demonstrate that , withi n Eocene-Miocen e Spissatella, evolutio n o f siz e an d shap e ar e inextricably linked , the y co-var y i n a predictable manner alon g a restricte d allometri c pathwa y and they cannot be considered independently . Onl y one significant evolutionar y transitio n ha s bee n identified i n this study, where shape changes occur in the absence of overall adult size changes, namely in th e divergenc e o f lat e Earl y Miocen e S . trailli and S . clifdenensis. If , a s implie d b y Stanle y & Yang (1987) , siz e an d shap e typicall y behav e independently durin g evolutio n o f infauna l bivalves, the n Spissatella represent s a significan t departure from th e norm. Similarly, numerou s author s hav e postulate d a general correspondenc e betwee n decreasin g bod y size wit h increasing environmenta l disturbanc e (rselection) an d vic e vers a (^f-selection ) (e.g . McKinney 1986 ; Chib a 1998) . Althoug h th e

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA

concept o f r-K selectio n i s overly simplistic , som e predictions such as the general relationship of body size t o environmenta l stabilit y remai n consisten t with the recent 'intermediat e disturbance model' of evolution propose d b y McKinne y & Allmo n (1995). Fo r molluscs, suc h a relationship has bee n inferred, fo r example , i n Ordovicia n nuculoi d bivalves (Snyde r & Bretsk y 1971 ) an d i n Miocene-Recent columbelli d gastropod s (Bud d & Johnson 1991) . Again, the present results are not in accord wit h thi s genera l hypothesis . Th e larges t species o f Spissatella wer e apparently restricted t o the coarses t substrate s i n th e shallowes t waters : environments that are likely to have been relatively high energy and unstable. It is considered here that the contradictions o f the previous tw o paragraph s ar e inevitabl e conse quences arising from th e interplay of rigid developmental constraint s combine d wit h functiona l selection fo r lif e i n shallo w water. Maynard Smith et al. (1985 , p . 265 ) define d developmenta l constraints a s 'biase s o n th e productio n o f variant phenotypes or limitations on phenotypic variability caused b y the structure , character , composition , or dynamics o f th e developmenta l system' . I n th e present context , thre e ke y developmenta l constraints ar e recognized i n Spissatella; thes e ar e historical o r phylogeneti c constraint s sensu Goul d (1989) [an d local constraints sensu Maynard Smith et al. (1985)]. The first tw o are the lack of a siphon in Crassatellidae and the 'primitive', approximately equilateral, shap e o f earl y Spissatella. Thes e constraints defin e th e 'startin g condition ' fo r evolution withi n th e genus . Th e thir d an d most important constraint , inferre d b y th e presen t authors, is the ontogenetic pathway followed by all Spissatella', i t is this that caused the genus to 'break the rules ' describe d above . Th e ontogeneti c con straint acte d t o channe l variance . Withi n eac h species, varianc e orthogona l t o th e mea n onto genetic trajector y wa s negligible , a s recorde d b y the lo w residual s i n th e ANOVA , an d directiona l selection apparentl y targete d availabl e variatio n parallel t o th e ontogenetic pathway . Give n thes e conditions an d selectiv e pressur e t o adap t t o shallow-water, high-energ y environments , Spissatella 'responded ' alon g the onl y pathwa y available: peramorphic elongatio n o f th e posterior margin wit h increasin g size . Selectio n ma y hav e targeted increasin g size , increasin g posterio r elongation or , quit e probably , bot h trait s simultaneously. I n thi s wa y th e presen t result s ar e in accor d wit h Jones & Goul d (1999) , wh o stres s that 'constraints ' ma y be positiv e i n tha t selectio n may targe t tw o (o r more ) correlate d an d 'constrained' traits , eac h o f whic h promote s evolutionary advantages of the other. The develop mental constrain t describe d her e i n Spissatella i s

421

certainly not universal to all non-siphonate infaunal bivalves, e.g . a s evidence d b y th e spectacula r morphological diversit y o f th e trigoniid s (e.g . Stanley 1977) .

Conclusions • Th e lateral outline shap e o f infaunal, burrowin g bivalves is a key determinant of burrowing speed and dept h an d is , therefore , subjec t t o stron g selection pressure . Thi s stud y seek s t o understand majo r evolutionar y processe s an d controls on outline shape throughout the lifespa n of th e infaunal , non-siphonate , crassatelli d bivalve Spissatella. • Fourie r shap e analysi s i s a useful morphometri c technique fo r th e descriptio n o f outline shap e in landmark-poor bivalve outlines. The method can be use d t o construc t a morphologica l 'map' , t o project ontogeneti c trajectorie s onto this map, to generate syntheti c averag e an d extrem e morph ologies, an d t o visualiz e margina l growt h allometries. • Growt h i n Spissatella wa s strongl y allometric . Ontogenetic change s i n th e shape s o f individual shells are , i n man y cases , fa r greate r tha n tota l evolutionary change s withi n th e genu s throughout c . 2 0 Ma. Furthermore , ontogeneti c trajec tories for different specie s ar e essentially paralle l in morphospace and vary primarily in length, i.e. they involv e consisten t pattern s o f allometri c growth aroun d th e margin o f the shell , bu t these growth field s diffe r i n magnitude . I n general , ontogenetic pattern s involve : (1 ) moderat e t o weak negativ e allometr y o n th e postero-dorsa l margin; (2 ) moderat e t o negligibl e negativ e allometry o n th e ventra l margin ; an d (3 ) moderate t o stron g positiv e allometr y o n th e posterior margin . T o varyin g degrees , al l Spissatella displa y increasin g elongatio n o f th e posterior an d becom e increasingl y inequilatera l with growth. • I t i s inferre d her e tha t posterio r elongatio n i n Spissatella wa s a functiona l adaptatio n fo r increased dept h o f buria l an d stabilit y i n relatively coars e substrate s an d i n relativel y high-energy, shallow marine environments . • Preliminar y comparison s wit h th e gener a Eucrassatella an d Salaputium sugges t tha t th e orientation o f mea n ontogeneti c trajectorie s i n morphospace ma y b e a ke y genus-leve l taxonomic characte r i n Crassatellida e and , b y inference, othe r bivalv e groups . Genus-leve l differences i n developmen t apparentl y affec t early stage s o f ontogen y (i.e . a t th e larval o r immediately post-larva l stage ) an d resul t i n different 'startin g conditions' fo r the ontogenetic transitions studied here .

422

J. S . CRAMPTO N & P . A. MAXWEL L

• Base d o n th e correspondenc e betwee n specie s ontogenies an d evolutionar y change s i n adul t form, it is inferred here that heterochrony was the dominant evolutionar y mechanis m throughou t the lifespa n o f Spissatella. Followin g a n earl y peramorphic morphologica l expansion , bot h paedomorphosis an d peramorphosi s probabl y occurred i n approximatel y simila r proportions . The data reveal no other directional trends in size or shap e evolution . Contrar y t o som e othe r studies, i t i s generall y no t possibl e t o decoupl e patterns of shape and size evolution in the genus. • Stratigraphi c resolutio n withi n th e present dat a set is to o imprecis e t o reliabl y quantif y specie s evolutionary rates , an d t o distinguis h gradua l evolution from punctuate d evolution and random walk [e.g. see recent discussion in Roopnarine et al (1999)] . Th e result s do , however , suppor t models o f stasi s i n S . trailli durin g th e middl e Early Miocen e an d i n S . clifdenensis durin g the late Early Miocene. In contrast, variability within S. n . sp . C durin g th e lates t Oligocene-earlies t Miocene ma y hav e resulted fro m rando m walk , evolution i n respons e t o a fluctuatin g selectio n regime, ecophenotypi c effects , o r som e combination o f these factors. • I t i s conclude d tha t th e ontogeneti c pathwa y followed b y Spissatella represent s a rigi d developmental constrain t tha t largel y controlle d morphological evolutio n within the genus. This paper is Institute of Geological an d Nuclear Science s (IGNS) contribution 1781. This research was supported in part by the Marsden Fund project entitled 'Heterochrony , evolution an d extinctio n i n Mesozoi c an d Cenozoi c Mollusca', administere d b y th e Roya l Societ y o f Ne w Zealand an d funde d b y th e Foundatio n fo r Research , Science an d Technology . Th e Commonwealt h Scienc e Council generously contributed funds tha t enabled on e of us (JSC) to attend the meeting 'Biolog y and Evolution of the Bivalvia ' hel d i n Cambridge , UK , Septembe r 1999 . This work i s based , t o a grea t extent , o n th e Fourie r software develope d b y J . Haine s (Universit y o f Cambridge). Fo r assistanc e wit h som e o f th e statistica l tests, w e woul d lik e t o than k D . Rhoade s (IGNS) , E . Abrahams (Nationa l Institut e o f Wate r an d Atmospheri c Research) an d G . Scot t (IGNS) . Thanks als o t o G . Scot t for foraminifera l ag e determinations . Earl y draft s o f th e manuscript wer e substantiall y improved b y th e thorough reviews o f A . Be u (IGNS) , M . Foot e (Universit y o f Chicago), G . Scot t an d A . Swa n (Kingsto n University). Roger Tremai n digitize d approximatel y hal f th e outlines. The photographs of Fig. 2 were prepared by W. St George.

References ALTMAN, D . G . 1978 . Plottin g probabilit y ellipses . Applied Statistics, 27, 347-349. ATCHLEY, W . R . 1987 . Developmenta l quantitativ e

genetics and the evolution of ontogenies. Evolution, 41, 316-330 . BEU, A . G . & MAXWELL , P . A. 1990 . Cenozoic Mollusc a of Ne w Zealand . Ne w Zealand Geological Survey Paleontological Bulletin, 58, 1-518 . , GRIFFIN , M . & MAXWELL , P . A. 1997 . Opening o f Drake Passag e gatewa y an d Lat e Miocen e t o Pleistocene coolin g reflecte d i n Souther n Ocea n molluscan dispersal : evidenc e fro m Ne w Zealan d and Argentina. Tectonophysics, 281 , 83-97. BLACKSTONE, N . W . & YUND , P . O. 1989 . Morphological variation in a colonial marine hydroid: a comparison of size-base d an d age-base d heterochrony . Paleobiology, 15 , 1-10 . BREY, T . & MACKENSEN , A . 1997 . Stable isotope s prov e shell growt h band s i n th e Antarcti c bivalv e Laternula elliptica t o b e forme d annually . Polar Biology, 17, 465-^68. BUDD, A . F & JOHNSON , K . G . 1991 . Size-relate d evolutionary patterns amon g specie s an d subgener a in th e Strombina grou p (Gastropoda : Colum bellidae). Journal o f Paleontology, 65, 417^-34. CHIBA, S . 1996 . A 40,000-yea r recor d o f discontinuou s evolution o f islan d snails . Paleobiology, 22 , 177-188. 1998. A mathematical mode l fo r long-term pattern s of evolution : effect s o f environmenta l stabilit y an d instability o n macroevolutionary pattern s an d mass extinctions. Paleobiology, 24 , 336-348. CRAMPTON, J . S . 1995 . Elliptic Fourie r shap e analysi s of fossil bivalves : som e practica l considerations . Lethaia,28, 179-186 . & HAINES , A . J . 1996 . Users' manua l for program s HANGLE, HMATCH , an d HCURV E fo r th e Fourier shap e analysis of two-dimensional outlines . Institute of Geological and Nuclear Sciences Science Report, 96/37, 1-28 . DARRAGH, T . A . 1965 . Revisio n o f th e specie s o f Eucrassatella an d Spissatella i n th e Tertiar y o f Victoria an d Tasmania . Proceedings o f th e Royal Society o f Victoria, 78, 95-114 . FINLAY, H. J. 1926. New shells from New Zealand Tertiary beds: par t 2 . Transactions o f th e Ne w Zealand Institute, 56, 227-258. 1930. Note s o n recen t paper s dealin g wit h th e Mollusca o f ne w Zealand . Transactions of th e Ne w Zealand Institute, 61, 248-258. FOOTE, M . & COWIE , R . H . 1988 . Developmenta l buffering a s a mechanism fo r stasis : evidenc e fro m the pulmonat e Theba pisana. Evolution, 42 , 396-399. GOULD, S . J . 1977 . Ontogeny an d Phylogeny. Harvar d University Press, Cambridge . 1989. A developmenta l constrain t i n Cerion, wit h comments o n th e definitio n an d interpretatio n o f constraint in evolution. Evolution,43, 516-539. HAINES, A. J . & CRAMPTON , J. S . 2000. Improvements t o the metho d o f Fourie r shap e analysi s a s applie d i n morphometric studies. Palaeontology, i n press. HALL, B . K . 1992 . Evolutionary Developmental Biology. Chapman & Hall, London . IREDALE, T . 1924 . Results fro m Ro y Bell' s mollusca n collections. Proceedings o f th e Linnean Society o f New South Wales, 49, 179-278 .

SHAPE EVOLUTIO N I N CENOZOI C SPISSATELLA JACKSON, D . A . 1993 . Stoppin g rule s i n principa l components analysis : a compariso n o f heuristica l and statistical approaches . Ecology, 74, 2204-2214. JOLIFFE, I . T . 1986 . Principal Component Analysis. Springer-Verlag, New York. JONES, D . S . 1988 . Sclerochronology an d th e siz e versus age problem . In : McKiNNEY , M . L . (ed. ) Heterochrony in Evolution: A Multidisciplinary Approach. Plenu m Press, New York, 93-108. & GOULD , S . J. 1999 . Direct measuremen t of age in fossil Gryphaea: th e solution to a classic problem in heterochrony. Paleobiology, 25 , 158-187 . KONDO, Y . 1987. Burrowing depth of infaunal bivalve s observation of living species an d its relation to shell morphology. Transactions an d Proceedings o f th e Palaeontological Society of Japan, Ne w Series, 148, 306-323. McKiNNEY, M . L . 1986 . Ecologica l causatio n o f heterochrony: a tes t an d implication s fo r evolutionary theory. Paleobiology, 12 , 282-289. 1988. Classifying heterochrony: allometry , size and time. In : McKiNNEY , M . L . (ed. ) Heterochrony i n Evolution: A Multidisciplinary Approach. Plenu m Press, New York, 17-34 . & ALLMON , W . D . 1995 . Metapopulation s an d disturbance: fro m patc h dynamic s t o biodiversit y dynamics. In: ERWIN , D . H . & ANSTEY , R . L . (eds) New Approaches to Speciation in the Fossil Record. Columbia Universit y Press, New York, 123-183 . & McNAMARA , K . J . 1991 . Heterochrony; Th e Evolution o f Ontogeny. Plenum Press, Ne w York. MARWICK, J . 1926 . Molluscan faun a o f th e Waiareka n Stage o f th e Oamar u Series . Transactions o f th e New Zealand Institute, 56, 307-316. 1929. Tertiar y mollusca n faun a o f Chatton , Southland. Transactions o f th e Ne w Zealand Institute, 59, 903-934. MATHSOFT 1998 . S-Plus statistica l software , version 5.0. MathSoft, Inc . Seattle, Washington . MAYNARD SMITH , J. , BURIAN , R. , KAUFFMAN , S . E T AL. 1985. Developmenta l constraint s an d evolution . Quarterly Review o f Biology, 60 , 265-287. MORGANS, H . E . G. , SCOTT , G . H. , BEU , A . G. , GRAHAM , I. G., MUMME, T . C, ST GEORGE, W . & STRONG , C . P. 1996 . New Zealan d Cenozoi c timescal e (versio n 11/96). Institute of Geological and Nuclear Sciences Science Report, 96/38, 1-12 . OPTIMAS CORPORATIO N 1995 . Optimas 5 Software. Optimas, Washington. POLLY, P . D. 1998 . Variability, selection , an d constraints : development an d evolutio n i n viverravi d (Carnivora, Mammalia ) mola r morphology . Paleobiology, 24, 409^29. PRITCHARD, G . B . 1903 . Contribution s t o th e palaeontology o f th e Olde r Tertiar y o f Victoria . Lamellibranchs. Par t 3 . Proceedings o f th e Royal Society o f Victoria, 15, 87-103.

423

RICE, S . H . 1998 . The bio-geometr y o f mollus c shells . Paleobiology, 24 , 133-149 . ROHLF, R J . 1993 . NTSYS-pc; Numerical Taxonomy an d Multivariate Analysis System; Version 1.80. Exete r Software, Setauket . ROOPNARINE, P . D. , BYARS , G . & FITZGERALD , P . 1999. Anagenetic evolution , stratopheneti c patterns , an d random walk models. Paleobiology, 25 , 41-57. SLACK-SMITH, S . M . 1998 . Superfamily Crassatelloidea . In: BEESLEY , P . L., Ross, G. J. G. & WELLS, A. (eds) Mollusca: The Southern Synthesis. Fauna of Australia. Volume 5 . CSIR O Publishing , Melbourne, 325-328 . SNYDER, J . & BRETSKY , P . W . 1971 . Lif e habit s o f diminutive bivalv e mollusc s i n th e Maquoket a Formation (Uppe r Ordovician) . American Journal of Science, 271, 227-251. SOARES, A . G. , CALLAHAN , R. K . & DE RUYCK, A. M . C . 1998. Microevolutio n an d phenotypi c plasticit y i n Donax serra Roding (Bivalvia: Donacidae) o n high energy sand y beaches . Journal o f Molluscan Studies, 64,407^121. SOKAL, R. R. & ROHLF, F . J. 1995 . Biometry, 3r d Edition . W. H. Freeman, Ne w York. STANLEY, S. M. 1970 . Relation o f shell form to lif e habit s of th e Bivalvi a (Mollusca) . Geological Society o f America Memoir, 125 , 1-296 . 1975. Wh y clam s hav e th e shap e the y have : a n experimental analysi s o f burrowing . Paleobiology, I 48-58 . 1977. Coadaptation i n the Trigoniidae, a remarkable family o f burrowin g bivalves . Palaeontology, 20 , 869-899. & YANG , X. 1987 . Approximate evolutionar y stasi s for bivalv e morpholog y ove r million s o f years : a multivariate, multilineag e study . Paleobiology, 13 , 113-139. SUTER, H . 1917 . Descriptions o f ne w Tertiar y Mollusc a occurring i n Ne w Zealand , accompanie d b y a fe w necessary change s i n nomenclature . Ne w Zealand Geological Survey Palaeontological Bulletin, 5 , 1-93. SWAN, A . R . H . 1988 . Heterochroni c trend s i n Namurian ammonoid evolution . Palaeontology, 31 , 1033-1051. TOJO, B . & OHNO , T . 1999 . Continuou s growth-lin e sequences i n gastropo d shells . Palaeogeography, Palaeoclimatology, Palaeoecology, 145 , 183-191. WAITERS, G . T . 1993 . Som e aspect s o f th e functiona l morphology o f th e shel l o f infauna l bivalve s (Mollusca). Malacologia, 35 , 315-342. ZELDITCH, M . L. , BOOKSTEIN , F . L. & LUNDRIGAN , B . L . 1992. Ontogen y o f integrate d skul l growt h i n th e cotton ra t Sigmodon fulviventer. Evolution, 46 , 1164-1180.

This page intentionally left blank

The Queen Scallop Aequipecten opercularis: a new source of information on late Cenozoic marine environments in Europe A. L. A. JOHNSON1, J. A. HICKSON 1, J. SWAN 1, M. R. BROWN 2, T. H. E. HEATON 3, S. CHENERY 4 & P. S. BALSON4 1 Division of Earth Sciences, University of Derby, Derby DE22 1GB, UK (e-mail: A.L.A.Johnson@ derby.ac.uk) 2 Division of Computing, University of Derby, Derby DE22 1GB, UK 3 NERC Isotope Geosciences Laboratory, Keyworth, Nottingham NG12 5GG, UK 4 British Geological Survey, Keyworth, Nottingham NG12 5GG, UK Abstract: Fe w dat a exis t o n seasona l variatio n i n th e temperature (o r othe r aspect s o f th e environment) o f lat e Cenozoi c shel f sea s i n Europe . Ontogeneti c record s i n th e shel l o f Aequipecten opercularis, a widespread, fast-growing and typically well-preserved bivalve , are a potential source . Study of modern form s has shown that oxygen stabl e isotopes are incorporated in equilibrium with surrounding seawater (hence providing a faithful recor d o f temperature) and data fro m lat e Holocen e A . opercularis o f th e souther n Nort h Se a Basi n (SNSB ) indicat e tha t extreme winte r (a s wel l a s summer ) temperature s ar e registered . Oxyge n isotop e dat a fro m apparently well-preserved , mid-Pliocen e shell s o f th e SNS B indicat e seasona l temperature s similar to present, whereas microgrowth increment data suggest substantially warmer conditions, in accordanc e wit h othe r evidence . Th e balanc e o f evidenc e thu s implie s crypti c diageneti c corruption o f th e isotopi c temperatur e signatur e i n mid-Pliocen e shells . However , i t woul d b e premature to discount the possibility of cooler mid-Pliocene condition s than currently recognized. Ontogenetic variatio n i n carbo n isotopi c compositio n withi n shell s i s mino r an d apparentl y unrelated t o environment , bu t difference s betwee n mid-Pliocene , lat e Holocen e an d moder n shells probably relate to changes in atmospheric CO2 concentration. Unlike certain taxa, seasonal variation i s not eviden t in the strontiu m or magnesium contents o f the A. opercularis shell , bu t may b e displaye d b y othe r trac e elements , henc e affordin g (togethe r wit h seasona l incremen t width variation ) a mean s o f independen t tempora l calibratio n o f isotop e profiles . Ontogeneti c records o f environment from A. opercularis can be complete (and , in the case of increment data, easily recovered ) bu t ar e o f shor t duration . The y mus t b e complemente d b y (les s complete ) records fro m longe r live d tax a to obtai n the fulles t possibl e environmenta l history . Seasona l cycles i n Ontogeneti c record s affor d a mean s o f establishin g ag e an d growt h rate , an d ca n therefore provid e informatio n o f valu e fo r evolutionar y studie s an d managemen t o f livin g populations.

Concerns ove r th e possibl e effec t o n climat e o f bee n determine d mor e b y change s i n the suppl y of anthropogenic CO 2 emission s t o th e atmospher e hea t throug h ocea n current s tha n b y alteration s i n have promote d interes t i n th e exten t an d caus e o f atmospheri c retentio n o f reflected sola r radiation a s recent natural climatic fluctuation , an d have hence a result of shift s i n CO 2 level . Thus , reduce d Gul f directed attentio n t o th e lat e Cenozoi c interval . Strea m hea t suppl y ha s bee n plausibl y invoke d t o Variations i n atmospheri c CO 2 content have , wit h explai n interval s o f relativ e col d durin g th e little doubt , contributed to changes i n globa l mea n Pleistocen e i n the Europea n are a (Broecke r 1997) , temperature durin g th e lat e Cenozoic , e.g . i n th e whil e durin g th e mid-Pliocene , Gul f Strea m hea t mid-Pliocene whe n atmospheri c CO 2 wa s appar - suppl y wa s apparentl y substantiall y enhance d ently 30-35 % abov e th e pre-industria l moder n (Dowset t e t al. 1992 ) an d presumably , a t leas t i n level (Kurschne r e t aL\996\ Raym o e t al . 1996 ) part , th e caus e o f warme r condition s o n lan d i n and th e globa l mea n temperatur e a n estimate d Europ e (Thompson & Fleming 1996) . 3.6°C higher (Sloa n e t al 1996) . However , locally Althoug h the geographic pattern of mid-Pliocen e and, i n particular , i n th e northeaster n Nort h warmin g i n th e Nort h Atlanti c favour s enhance d Atlantic area , climati c variatio n ma y wel l hav e Gul f Strea m hea t supply , th e reduce d overal l From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society, London, Special Publications, 177, 425-439. 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

426

JOHNSON ETAL.

latitudinal temperatur e gradien t i n th e ocean s (Dowsett e t al. 1996 ) make s thi s a theoretica l improbability (Crowle y 1996) . Th e evidenc e o f temperature i n th e mid-Pliocen e Nort h Atlanti c (and of ocean temperatures generally) derive s fro m the distributio n o f variou s element s o f th e microbiota and is not immune from question , being based on analogy with the temperature association s of moder n representative s o f taxa . Th e sam e applies t o almos t al l estimate s o f se a temperatur e on th e Europea n continenta l shel f i n th e Pliocen e (e.g. Raff i e t al . 1985 ; Woo d e t a l 1993 ; Hea d 1997, 1998 ) an d Pleistocen e (e.g . Funnel l e t a l 1979; Gibbard e t al. 1991 ; Meijer & Preece 1995) ; only scant evidence is available from the alternative approach of oxygen isotope thermometry (Buchardt 1978). Lack of secure palaeotemperature estimates for th e European continental shelf sea is regrettable because this area, transitional between land and the Atlantic Ocea n proper , i s surel y key t o evaluating the influenc e o f variation s i n Gul f Strea m hea t supply on climate of the European landmass . From the fac t tha t a t present , summe r an d winte r se a temperatures o n th e Atlanti c seaboar d o f Europ e are approximatel y equall y elevate d abov e thos e (uninfluenced b y th e Gul f Stream ) a t th e sam e latitude of f Nort h Americ a (Nationa l Oceani c an d Atmospheric Administratio n o f th e Unite d State s 1999), i t ca n b e expecte d tha t enhance d Gul f Stream hea t suppl y woul d b e manifeste d i n shel f temperature increases of about the same magnitude in summe r an d winte r (an d likewis e diminishe d supply b y approximatel y equa l decreases) . I t ha s been predicted , b y contrast , that , a t th e latitud e of Europe, markedl y discrepant increase s i n summe r and winter atmospheric (an d by inference oceanic) temperatures woul d resul t fro m elevate d atmos pheric CO 2 (Crowley 1991) . It i s eviden t fro m th e abov e tha t accurat e dat a on seasona l se a temperatur e variatio n i n th e European area during the late Cenozoic would be of value bot h t o tes t existin g temperatur e estimate s and t o investigat e th e cause s o f secula r change . Such data , togethe r wit h informatio n o n othe r aspects of environment, are potentially recoverable from chemica l an d morphologica l ontogeneti c records containe d i n accretionar y skeletons . Th e Queen Scallop, Aequipecten opercularis (L.), has a large, rapidl y accrete d shel l and , a s a commo n component o f Miocene-Recen t marin e fauna s i n Europe, appear s t o b e a promisin g subjec t fo r research. I n thi s paper th e genera l suitabilit y of A. opercularis fo r provisio n o f environmenta l information fro m ontogeneti c record s i s reviewed, and the n the qualit y an d implications o f dat a fro m three specifi c source s - stabl e isotopes , micro growth increment s an d trac e element s - ar e discussed.

General suitability of Aequipecten opercularis As a scallop , A . opercularis (Fig . 1 ) ha s a predominantly calciti c shel l which , whil e no t guaranteeing faithfu l preservatio n o f ontogeneti c records o f environment , i s unlikel y t o suffe r th e wholesale alteratio n o r dissolutio n commo n i n aragonitic taxa. Being epibenthic, scallops are more likely t o provid e a recor d o f genera l wate r con ditions tha n infauna l forms, whos e carbo n isotopi c composition, a t least , ma y reflec t porewate r geochemistry (Krant z e t al . 1987) . Shelf-dwellin g scallops ar e generall y fast-growin g an d A . opercularis i s no exception, reaching a height of c. 40 mm afte r on e yea r an d 5 5 mm afte r tw o years , with growt h occurrin g durin g th e winte r month s (Ursin 1956 ; Hickso n 1997) . Thi s provides , i n principle, fo r a well-resolved an d complet e recor d of seasona l environmental variation . Against thes e favourabl e growt h characteristic s must b e se t th e relativel y shor t lifespa n o f A . opercularis (rarel y mor e tha n si x years ; Broo m 1976) and the sharp decline in growth rate with age, such tha t i f a n anima l reache s si x year s ol d it s growth i s almos t zer o (Taylo r & Venn 1978) . Thi s precludes recover y o f a long continuou s history of environment. However , suc h limite d dat a a s exis t provide no indication tha t any other species with an accretionary skeleton , foun d widel y i n th e lat e Cenozoic deposit s o f Europe , combine s sub -

Fig. 1 . Right valve of the Queen Scallop, Aequipecten opercularis (L.) , from th e Coralline Crag (mid-Pliocene ) of Suffolk , easter n England. Specimen: University of Derby, Division of Earth Science s (UD ) 52795. Scal e bar, 1 0 mm.

PALAEOENVIRONMENTAL DAT A FROM THE QUEEN SCALLOP stantially greate r longevit y wit h significan t growth at al l time s o f year . Mytilis edulis i s quit e widespread fro m earl y Pleistocen e time s onwar d and, accordin g t o See d (1976) , live s fo r u p t o 1 6 years. However , winte r growt h i s only c . 5 mm in the first year and even less in the second; in view of a decline in annual growth rate, winter growth must be negligibl e i n olde r animal s [se e als o Jone s (1983)]. Pinna nobilis, locall y commo n a t presen t in th e Mediterranea n Sea , reache s 1 3 years an d i s still growing rapidl y (probabl y i n winter as well a s summer) a t eigh t year s (Richardso n e t al 1999) . Unfortunately, however , thi s specie s appear s t o be restricted t o war m waters , no t extendin g int o northern Europ e eve n i n th e Pliocen e (Raff i e t al . 1985). Th e infauna l bivalv e Arctic a islandica reaches very much greater ages (200+ years ; Jones 1983) but ceases growing in winter (Weidman et al. 1994). Evidenc e fro m Nort h America n specie s suggests that seasonal growt h interruptions may be characteristic o f relativel y long-live d infauna l bivalves (Jone s 1980 ; Jone s e t al . 1989 ; Jone s & Quitmyer 1996) . A. opercularis i s a commo n an d widesprea d species a t present, breedin g population s extendin g from norther n Norway around the Atlantic coast of Europe and as far east into the Mediterranean as the Adriatic (Walle r 1991 ; Margu s 1991) . I t thu s occupies waters rangin g i n temperatur e fro m a n average winte r minimu m o f c . 5° C t o a n averag e summer maximu m o f c . 24° C (Nationa l Oceani c and Atmospheri c Administratio n o f th e Unite d States 1999) . Thi s toleranc e predispose s A . opercularis t o be usefu l a s a tool fo r documentin g temperature in that its own occurrence is unlikely to be affected b y this variable, something borne out by the presenc e o f th e specie s in , fo r instance , cold water deposits of the Pleistocene i n eastern England (Funnell e t al . 1979 ) an d warm-wate r deposit s o f the Pliocen e i n souther n Spai n (Aguirr e e t al . 1996). A. opercularis also occurs over a substantial depth rang e (fro m lo w wate r t o 18 3 m) an d i s tolerant o f a wid e variet y o f substrates , bein g abundant a t presen t o n sediment s rangin g fro m sandy mu d t o sand y grave l an d shel l hash (Tebbl e 1976). Although eurytopi c i n th e abov e respects , A . opercularis require s som e curren t flo w (Ursi n 1956) and is tolerant only of quite small, short-ter m departures fro m norma l marin e salinit y (Pau l 1980). A s a resul t o f th e latter , whil e i t ma y b e common i n full y marin e lat e Cenozoi c sequence s [e.g. i n th e souther n Nort h Se a Basi n (SNSB) , the Pliocene Corallin e an d Re d Cra g formation s o f eastern England , an d th e Oosterhou t Formatio n o f the Netherlands] , th e specie s i s absen t fro m sequences deposite d unde r stron g fluvia l influenc e (e.g. muc h o f th e Pleistocen e o f th e Netherlands ;

427

Gibbard e t al. 1991) . Thi s featur e a t leas t ensure s that salinity-relate d variatio n i n th e isotopi c composition o f ambient wate r can be largely rule d out a s a factor influencing shel l isotopi c composi tion, henc e simplifyin g interpretatio n o f isotopi c data (see below) . The frequency with which A. opercularis occur s in British Geological Surve y cores of late Holocen e deposits beneat h th e souther n Nort h Se a i s i n marked contrast to its rarity in surface grab sample s from th e sam e are a (A . Weller , pers . comm.) . Indigenous moder n individual s als o exhibi t mor e interrupted growt h (se e below) . Give n tha t condi tions of temperature, salinity , tides an d substrate in modern an d lat e Holocen e time s wer e almos t identical (Camero n et al. 1992) , it seems likely that present-day occurrenc e an d growt h characteristic s in th e souther n Nort h Se a reflec t som e for m o f pollution rather than a natural control . Although affecte d b y som e natura l and , apparently, anthropogeni c factors , A . opercularis exhibits remarkabl e short-ter m hardines s whic h makes i t highl y suitabl e fo r i n vivo experimenta l studies. Thus, animals used in the North Sea culture referred to below suffered n o ill effects i n a 12 h car journey fro m thei r sourc e (wester n Scotland ) merely envelope d i n we t seawee d an d ice . Moreover, growt h occur s a t a healthy rat e eve n i n specimens tightl y packe d withi n onio n nets , a method o f culture used experimentall y of f wester n Scotland (J . P . Mikolajunas , pers . comm.) . Suc h tolerance suggest s tha t experiment s involvin g artificial manipulatio n o f condition s t o asses s th e fidelity o f ontogeneti c record s (e.g . temperatur e control o f oxyge n isotopi c compositio n an d microgrowth incremen t width; control of shell trace element conten t by environmental concentratio n see discussions below) could be conducted withou t risk o f mortality.

Data from modern, late Holocene and midPliocene shells Stable isotope data Although investigations of ontogenetic variatio n in the stabl e isotopi c compositio n o f th e A . opercularis shel l wer e initiate d onl y recentl y (Hickson 1997 ; Hickso n e t al . 1999) , studie s o f scallop specie s occurrin g outsid e Europ e starte d some tim e ag o (e.g. Krantz et al. 1984) , an d stabl e isotope dat a hav e bee n use d a s a sourc e o f information o n seasona l variatio n i n temperatur e (including water-colum n stratification ) an d th e timing o f up welling events , phytoplankto n bloom s and freshwate r influxe s (e.g . Krant z e t al . 1987 , 1988; Krant z 1990 ; Jone s & Allmo n 1995) . Al l such inference s ar e base d o n th e assumptio n o f

428

JOHNSON E T AL .

something clos e t o equilibriu m incorporatio n o f elemental isotope s int o shel l carbonate ; i.e . incorporation i n accordanc e wit h thei r relativ e abundance i n th e immediat e environmen t an d a fractionation facto r which , i n th e cas e o f oxygen , varies strongl y wit h temperature . A t th e smalles t spatial an d tempora l scal e equilibriu m i s probabl y unavoidable, bu t a t large r scales , e.g . where seawater surroundin g a shel l i s take n t o b e th e immediate environmen t rather than the extrapallia l fluid fro m whic h i t i s actuall y precipitated , th e condition doe s not necessaril y hold . Thus , in the scallop Pecten maximus (Mitchell et al. 1994; C. A. Richardson, pers. comm.) the interposition o f som e effect relatin g t o th e biolog y o f th e organism , perhaps slo w replenishmen t fro m seawate r o f ion s in th e extrapallial flui d (resultin g i n significan t 'pollution' by , o r reequilibratio n with , mantle derived ions ; cf . Hickso n e t al . 1999) , result s i n disequilibrium between shel l an d seawater . Equilibrium betwee n shel l an d externa l environment ha s bee n demonstrate d convincingl y for th e scallop s Placopecten magellanicus (Krant z et a l 1984 ) an d Adamussium colbecki (Barrer a e t al 1990 ) but, given th e evidenc e fro m Pecten maximus, canno t be assume d for othe r species . Indeed, the whole issue of the detailed mechanism s by whic h carbonat e precipitates , an d thei r effect s on it s isotopi c composition , i s a subjec t o f activ e debate (Sper o e t al 1997 ; Zeeb e 1999) . I t was for these reason s that , preparator y t o analysi s o f ancient A . opercularis, a n investigatio n o f th e occurrence o f isotopi c equilibriu m wa s conducte d on moder n examples . Thi s involve d analysi s o f shells whic h ha d grow n unde r know n environ mental conditions , th e animal s concerned eithe r having been maintained i n monitored cultures over an autumn-winter perio d i n the southern North Sea or collected live from site s for which environmental data wer e availabl e fro m genera l monitorin g programmes. Th e result s hav e bee n publishe d elsewhere (Hickso n e t a l 1999 ) and ar e onl y summarized below, attention being concentrated on the implications o f dat a fro m lat e Holocen e an d mid-Pliocene shells . Oxygen isotopes. Isotopi c ratio s ar e expressed i n the 8 notation , i n pe r mi l (%o) , wher e 5 18O (o r 5 13 C)-[^ sample /^ standard )-l]xl03. R i s th e 18 O/16O (o r 13 C/12C) ratio , an d th e standard s ar e Vienna Pee Dee Belemnite (VPDB ) for carbonate s and Vienn a Standar d Mea n Ocea n Wate r (VSMOW) fo r wate r (Cople n 1994) . Unde r conditions o f isotopi c equilibriu m th e differenc e between th e 8 18O valu e o f calcit e an d th e 8 18O value o f th e wate r fro m whic h i t precipitate s i s dependent o n temperature , an d fo r wate r wit h a

seasonally constan t isotopi c compositio n (a s i s usually th e cas e fo r full y marin e waters ) th e change in 818Ocalcite as a function o f temperature i s c. -0.24%0 °C-1 (O'Neil et al 1969) . For th e investigatio n o f modern shell s (Hickso n et al 1999) , seawate r temperature s an d 8 18O were either measure d (fo r culture d animals ) o r derive d from othe r record s (fo r indigenou s animals) . Solutions o f th e equatio n o f O'Nei l e t a l (1969) , relating th e differenc e betwee n 8 18Ocaldte an d 818Owater as a function of temperature, the n yielde d predictions o f 8 18O for shell s growin g i n isotopi c equilibrium. Th e rang e o f 8 18Oshell value s fro m both culture d an d indigenou s animal s (accordin g quite closel y wit h th e predicte d values) , an d th e pattern of change in the former (increasing 818Oshell with decreasing temperature) , sho w that somethin g (at least ) ver y nea r t o isotopic equilibriu m existe d between shell s an d seawate r a t th e tim e o f precipitation. Indigenou s shell s (e.g . Fig. 2a ) uniformly exhibi t 8 18O maxim a (i.e . extrem e winter values ) slightl y les s tha n value s corre sponding t o th e minimu m temperature s experi enced. Rathe r tha n disequilibrium , thi s almos t certainly reflect s a brie f interruptio n o f growt h during the coldest month s because i n each cas e the 818O maximu m correspond s t o a marke d 'growt h ring' (formed of a group of very small microgrowth increments - se e below), whic h i s evidentl y th e culmination o f a slowdow n i n growt h (show n b y the relativel y shar p increas e i n 8 18O against shel l height in Fig. 2a). Data fro m a late Holocen e shel l fro m the SNS B (Fig. 2b ) describ e a strikingl y differen t winte r record, wit h a n asymptoti c approac h t o th e 8 18O maximum whic h i s greate r (reflectin g a lowe r temperature) tha n in an y modern indigenou s shell ; no growth ring is developed. Th e same features are observed i n isotopi c profile s fro m th e firs t tw o years o f growt h o f othe r lat e Holocen e shells , ranging in age from c . 1 to 3 Ka, and only rarely is there a significan t growt h rin g associate d wit h the maximum 8 18O valu e (Hickso n 1997) . Thi s evidence, whic h i s matche d b y dat a fro m culture d shells, show s that, under appropriat e circumstance s (evidently not abnormally warm winter conditions), A. opercularis doe s no t merel y exhibi t growt h i n the overal l winte r perio d bu t actuall y grow s significantly i n th e coldes t months . Give n tha t a t present i n th e souther n Nort h Sea , where winte r growth interruptions are observed, A. opercularis is uncommon (presumabl y a s a resul t o f som e unfavourable featur e o f th e environment ; se e above), i t ma y b e that , unde r condition s whic h support large r populations , growt h durin g th e coldest months is the norm, at least in the first yea r or two o f life .

PALAEOENVIRONMENTAL DATA FROM THE QUEEN SCALLOP

429

Fig. 2 . Examples of oxygen (8 18O) and carbon (8 13C) stable isotopic composition s of : (a) indigenous modern ; (b ) subfossil (lat e Holocene) Quee n Scallop s fro m th e southern North Sea. I n accordance wit h convention, 8 values are shown decreasing upward s on the y-axis. High 5 18O at a shell height o f 1 0 mm in (b) almost certainl y reflects an instrumental aberration. Temperatures show n were calculated fro m 8 18O values using the equation o f O'Neil et al. (1969) an d 818Owater = +0.1% 0 (v. VSMOW). A , Positio n o f growth ring (growt h cessation). Uncorrecte d 14 C AMS date of late Holocene specimen : 276 0 ± 50 years BP (Lab. Code AA-27134) . Specimens: (a ) Naturmuseum Senckenberg DOG D 25 ; (b) British Geological Surve y Zt 9954 [PB4 of Hickson (1997)] .

Data (Fig. 3) from two apparently well-preserve d mid-Pliocene specimen s o f A. opercularis from th e SNSB exhibit a cyclicity similar to that seen in data from younge r shells , indicatin g a primar y (temperature) control . However , whilst assemblag e analysis an d th e fe w existin g isotopi c dat a (see above) sugges t tha t mid-Pliocen e temperature s were substantiall y highe r tha n now , th e temperatures represented by both 618O maxima and minima i n Fig. 3 are not significantl y greate r tha n typical winte r (5.5-7.5°C) an d summe r (16-18°C ) extremes in the current southern North Sea (Lane & Prandle 1996) . Shell UD 52797 (Fig. 3b) provide s evidence o f slightl y warme r extrem e winte r temperatures (8.8°C ) bu t th e summe r extrem e i s

indistinguishable fro m present , an d tha t indicate d by shel l U D 5279 6 (Fig . 3a ) is , a t 13.0°C , substantially belo w typica l moder n extrem e summer temperatures . These last two findings could be explained by the existence o f a summe r growt h hal t (resultin g i n failure t o registe r th e highes t temperature s experi enced), a s in warm water populations of the bivalve Mercenaria (Jone s & Quitmye r 1996) . However , while th e 'peaks ' (i n fact , relativel y lo w 6 18O values) i n th e isotop e profile s ar e rathe r narrowe r than thos e fro m lat e Holocen e an d moder n shell s (Fig. 2) , suc h growt h ring s a s exis t ar e conspic uously no t coinciden t wit h the m (Fig . 3a). Othe r than the rathe r remot e possibilit y tha t previou s

430

JOHNSON ETAL.

Fig. 3 . Isotopic profile s from mid-Pliocen e (Corallin e Crag ) Queen Scallop s fro m easter n England . Format a s in Fig. 2. In calculating temperatures, n o correction wa s made for possible ice-volum e effects du e to a lack of consensus over the most appropriate valu e (cf. Jones & Allmon 1995) . All suggested correction s woul d result in a lowering of calculated temperatures . Specimens : (a ) UD 52796; (b) UD 52797 .

temperature estimates are all markedly in error, two potential explanation s remain : tha t th e analyse d shells live d durin g anomalousl y coo l year s o r that they underwen t crypti c diageneti c alteration , resulting i n corruptio n o f th e isotopi c signature . The latter possibility is supported by evidence fro m microgrowth incremen t width s (se e below) whic h indicate warmer conditions than present. Carbon isotopes. Isotop e mas s balance equations relating t o 13 C an d 12 C, an d incorporatin g appro priate fractionatio n factors , indicat e that , unlik e other marin e bivalv e species , a maximu m o f 20 % of carbon in the shel l carbonate o f A. opercularis is derived fro m metaboli c source s (Hickso n e t al. 1999). This , i n turn, suggests that somethin g clos e to isotopi c equilibriu m exist s a t th e tim e o f precipitation betwee n shel l carbo n an d dissolve d inorganic carbo n (DIG ) i n seawater . Ther e i s n o

measurable temperatur e effec t o n 13 C/12C fraction ation betwee n DI G an d carbonate (Romane k e t al . 1992), hence, given isotopic equilibrium , variations in o" l3Cshell wil l reflec t change s i n 8 13CDIC. Shortterm variation s o f o* 13CDIC i n shel f sea s relat e t o factors suc h a s loca l phytoplankto n bloom s (causing increase d 8 13CDIC by remova l int o tissu e of a relatively high proportion o f 12 C) and influxe s of freshwate r o r deep-marin e water s (typicall y causing reduce d 8 13CDIC by introductio n o f wate r relatively ric h i n 12 C fro m th e deca y o f organi c matter). Ove r th e longe r term , change s i n 8 13C of atmospheric CO 2 (caused partly by variations in the rate o f oxidatio n o f organi c matte r an d henc e related t o th e atmospheri c concentratio n o f CO 2) might be expected t o influence 5 13CDIC by air-sea exchange (Charle s e t al . 1993) , althoug h th e relatively larg e siz e of the oceanic carbon reservoi r would ten d t o dam p fluctuations . Tha t change s i n

PALAEOENVIRONMENTAL DATA FROM THE QUEEN SCALLOP

atmospheric CO 2 conten t ar e indee d reflecte d i n 613CDIC, an d recorde d i n skeleta l calciu m carbonate, i s show n b y th e reductio n i n 5 13C o f shallow-depth foraminifera l an d spong e materia l over th e perio d o f significan t anthropogeni c addition t o atmospheri c CO 2; apparently , preservation o f th e atmospheri c signa l i s du e t o incomplete mixin g o f shallo w an d deepe r water s (Beveridge & Shackleton 1994 ; Bohm et al. 1996) . Unlike records fro m moder n scallop s o f the U S Atlantic Coast (Krant z et al. 1988) , 8 13C data fro m modern t o mid-Pliocen e A . opercularis o f th e SNSB exhibi t littl e withi n shel l variation , rarel y > \%c ove r th e lifespa n (o r perio d o f Nort h Se a growth) o f th e organis m (Fig s 2 an d 3 ; Hickso n 1997; Hickson e t al 1999) . Thi s i s consistent with evidence (fro m direc t measuremen t o r th e composition o f bioti c assemblages ) o f relativel y invariant salinitie s a t th e location s o f th e shell s concerned an d th e considerabl e distanc e o f th e southern Nort h Se a (dept h generall y < 40 m) fro m any substantia l are a o f significantl y deepe r wate r (hence eliminatin g th e possibilit y o f majo r up welling effects) . A sprin g phytoplankto n proli feration occurs , bu t unlik e man y othe r area s (including th e norther n Nort h Sea ) is no t immedi ately followe d b y a depletio n o f resource s an d population crash (Tett & Walne 1995). It is possible that thi s protracte d 'bloom ' cause s littl e pertur bation of o* 13CDIC and consequently of o* 13Cshell. With respect to longer term changes, the modern shell represente d i n Fig . 2a an d th e mid-Pliocen e shells represented i n Fig. 3 all exhibit 8 13C values which ar e generall y les s tha n thos e o f th e lat e Holocene shel l represente d i n Fig. 2b. This patter n is confirmed by compariso n o f mean values for al l data availabl e fro m moder n and lat e Holocen e (Hickson 1997 ) and mid-Pliocen e (Fig . 3) shells , [-0.04 ( n = 197), +0.7 9 ( n = 209) an d +0.3 4 (n = 43), respectively]. It is in accordance with , for the present time, evidence from direct measurement and, fo r th e Pliocene , consisten t prox y evidenc e (Kurschner e t a l 1996 ; Raym o e t a l 1996 ) of relatively high atmospheric CO 2 concentrations. In view o f rathe r limite d ontogeneti c variatio n i t appears, therefore , tha t 8 13C value s o f A . opercularis shel l coul d b e use d t o char t lat e Cenozoic change s i n atmospheri c CO 2 content , although independen t evidence o f phytoplankto n levels (e.g. from trace element data; see below) and the exten t o f upwellin g woul d b e necessar y t o obtain an accurate picture.

Microgrowth increment data Except i n case s o f extrem e abrasion , th e shel l exterior o f A . opercularis display s a conspicuou s record o f th e patter n o f fine-scal e accretio n i n th e

431

Fig. 4. Enlarged vie w of the ventral part o f the shell illustrated in Fig. 1, showing microgrowth increments of varying width but no growth ring (i.e. group of very small microgrowth increment s marking a growth cessation). Are a outlined is enlarged further and analysed in Fig. 6. Scale bar, 4 mm.

form o f microgrowt h increment s o f varyin g widt h (Fig. 4) . Regula r examinatio n o f animal s grow n under semi-natura l condition s ha s reveale d that , at certain time s o f yea r (May-July) , th e numbe r o f increments deposite d approaches , bu t doe s no t exceed, th e numbe r o f day s elapse d (Broo m & Mason 1978) . Therefore , i t ma y b e tha t eac h increment corresponds to one day's growth. Even if this i s s o ( a contrastin g interpretatio n ha s bee n made i n th e cas e o f simila r increment s i n Pecten maximus; Gruffydd 1981) , it cannot be the case that growth occurs ever y da y becaus e a t other time s of year ther e i s a marke d discrepanc y betwee n th e number o f day s an d increments . Broo m & Mason (1978) also recorded a marked seasonal variation in the widt h o f microgrowt h increments . The y suggested that this is determined b y food suppl y as

432

JOHNSON ETAL.

much a s temperature , bu t thei r dat a (Broo m & Mason 1978 , fig . 5), which sho w increasin g incre ment width s durin g Ma y an d Jun e whils t th e phytoplankton standin g cro p underwen t a majo r

reduction, sugges t tha t temperatur e i s th e primar y control, a t leas t whe n foo d suppl y i s abov e th e minimum for body maintenance . Measurement o f incremen t width s i n Nort h Se a

Fig. 5 . Profiles o f microgrowth increment width in modern [(a)-(d) ] and mid-Pliocene [(e)-(h) ] Queen Scallo p shells , measured using a microscope fitte d wit h an eyepiece graticule . Modern animal s had been spawne d in spring-summer 1993 an d cultured on the west coast of Scotland until October 1994 , when they were transferred to nets in the southern North Sea until February 1995 , alongside animals spawned in spring-summer 1994 . The pattern o f growth in the latter, together wit h published information on growth rates (e.g. Broom & Mason 1978 ; Paul 1981) , confirms identification o f seasons represented i n former prior (ope n symbol ) to second winter (solid symbol ) growth . Interpretation o f seasons in mid-Pliocene shell s assume s autumn spawning. Specimens (al l UD): (a) 52791; (b ) 52792; (c ) 52793; (d ) 52794 ; (e ) 52796; (f ) 52797; (g ) 52798; (h ) 52799 . Profiles i n (e) and (f) cannot be precisel y compared with isotopic profile s fro m the same specimen s (Fig. 3) because 'shel l height' in increment plots is derived by addition of increment widths; hence, even a slight systematic error i n measurement of the latter wil l result in a significant departur e from tru e shell height a t large sizes.

PALAEOENVIRONMENTAL DATA FROM THE QUEEN SCALLOP

cultured shell s (se e above) confirm s th e existenc e of a seasonal cycle of variation; a similar pattern is evident amongs t mid-Pliocene shell s fro m easter n England (Fig . 5), including th e two (Fig. 5e and f ) for whic h isotop e dat a ar e available . Th e midPliocene shells , however , sho w markedl y highe r increment width maxima and minima (presumably corresponding t o extrem e summe r an d winte r temperatures) and , in association , highe r averag e increment width s (rang e o f mean s fo r four increment groups : 1.00-1.5 5 fo r Pliocen e shell s and 0.82-0.8 6 fo r moder n shells) . O n th e basis o f the incremen t width-temperatur e relationship , thi s indicates substantiall y warme r condition s i n th e mid-Pliocene, a findin g i n agreemen t wit h al l previous view s (se e above) an d a t varianc e wit h isotopic evidenc e (Fig . 3) fro m th e shell s repre sented in Fig. 5e and f. While thes e result s sugges t tha t growt h incre ment dat a fro m A . opercularis migh t provid e a n independent mean s of determining secula r temper ature chang e throug h th e lat e Cenozoic , th e approach require s testin g b y analysi s o f moder n forms fro m differen t temperatur e regimes . Th e specific matte r of the accurac y of increment-base d temperature estimate s fo r th e mid-Pliocen e coul d be investigate d wit h dat a fro m Mediterranea n populations, whic h experience temperatures simila r to those generally inferred for the SNSB in the midPliocene. Eve n i f i t shoul d prov e unjustifiabl e t o attach absolut e temperature s t o incremen t widt h values, i t seem s ver y likel y tha t incremen t width s will suppl y a reliabl e indicatio n o f seaso n an d hence provid e th e basi s fo r a n independen t temporal scal e t o calibrat e isotop e profiles . Suc h calibration i s o f considerabl e valu e fo r isotop e profiles fro m fossil shells , where it is never entirely possible t o exclud e th e possibilit y o f crypti c diagenesis an d the existence o f spurious peaks an d troughs (providin g misleadin g indication s o f seasonal temperatur e variation) . Incremen t widt h data migh t als o b e use d t o distinguis h betwee n growth ring s resultin g fro m traumati c cause s (e.g. storms o r attempte d predation , bot h o f whic h ar e likely t o be represente d by a n abrup t reductio n i n the widt h o f microgrowt h increments ) an d thos e growth rings due to cessations o f growth associate d with summe r o r winte r extreme s o f temperatur e (likely t o b e precede d b y gradua l reductio n o f increment widths) . Not onl y ar e microgrowt h increment s i n A . opercularis generall y wel l preserved , widt h dat a can be recovered easily an d quite quickly by direc t measurement unde r th e microscope . Eve n mor e rapid dat a acquisitio n ca n b e envisage d b y appli cation o f image-analysis software . Figur e 6 shows a 'brightness ' trac e fo r the area of shell outlined i n Fig. 4 . Th e edge s o f increment s ar e faithfull y

433

identified a s major peak s an d it is a simple matte r to translat e th e position s o f thes e int o a plo t depicting increment width variation (Fig. 7). Use of this technolog y [se e Chavau d e t al (1998 ) an d Diou et al. (1999) for similar approaches] offers th e opportunity t o obtain reall y larg e dat a sets , a boon for investigation s o f palaeotemperatur e wher e substantial variatio n abou t th e mea n i s t o b e expected an d a smal l bod y o f dat a migh t giv e a

Fig. 6 . Enlargement o f area outlined i n Fig. 4 with plot of 'brightness ' (arbitrar y scale ) measure d alon g left edg e of display. Majo r peaks, in general, correspon d precisely with edges o f microgrowth increments . Double pea k at * is caused by presence o f adherent sedimen t particle ; suc h 'noise' migh t be removed by use of an appropriat e wavelength filter. Image analysi s usin g Wit Version 5.2 (Logical Vision).

434

JOHNSON ETAL.

Fig. 7 . Plot of increment widths for area of shell analysed in Fig. 6 ; produced by automatic measurement o f distances between major peaks (define d her e a s those with a brightness value > 200). Th e plot clearl y reflect s the overal l change in increment widths evident in the display in Fig. 6 .

misleading impression (cf . interpretation of oxygen isotope data from mid-Pliocen e A. opercularis). At least on the right valve (against the substrate), the recor d o f microgrow m increment s i s usuall y obscured b y abrasio n o n th e earlies t forme d c . 15 mm of shell, representing the first 4-8 month s of life (Pau l 1981) . Whil e this shorten s the increment record that can be recovered fro m a shell, the effec t is th e sam e o n a n isotop e recor d obtaine d (a s conventional fo r scallops ) fro m th e outermos t par t of th e oute r shel l layer . Thi s i s becaus e materia l deposited beneat h th e shel l surface , as sampled o n an abrade d shell , i s no t contemporaneou s wit h surface materia l (markin g the advanc e o f the shel l edge) and , i n an y case , ma y no t hav e bee n precipitated i n isotopi c equilibriu m wit h seawate r (Hickson et al 1999) .

Trace element data In certai n invertebrat e taxa , th e concentration s i n skeletal material s o f the trace elements magnesium and strontiu m show some correlation wit h temperature (Rosenberg 1980 , 1990) , although the contro l is probably metaboli c rat e (strongly influenced by temperature i n invertebrates ) rathe r tha n temper ature itsel f (Rosenber g & Hughes 1991) . Fo r tax a with accretionar y skeleton s i n whic h th e relation -

ship applies there is thus the prospect o f identifyin g seasons, i f not absolut e temperature s o f growth. I n the sam e wa y a s microgrowth incremen t evidenc e of season , thi s would be a valuable complemen t t o stable isotope data . The magnesiu m an d strontiu m content s o f fou r North Se a culture d A . opercularis shell s wer e investigated usin g th e recentl y introduce d tech nique of laser ablatio n inductively coupled plasm a mass spectrometry ; b y reaso n o f th e tin y sampl e sizes involved , thi s facilitate s constructio n o f very detailed ontogenetic profiles (e.g. Fuge et al. 1993). Contrary t o wha t ha d bee n hoped , profile s o f strontium concentration sho w almost no fluctuation and whil e magnesiu m display s som e cyclicit y thi s is of much shorter tha n seasonal perio d (Fig . 8 ; cf. Leng & Pearc e 1999) . Evidently , therefore , strontium an d magnesiu m concentration s i n A . opercularis shel l sho w n o correlatio n wit h temperature an d canno t provid e independen t temporal calibratio n o f isotop e profiles . (Note : magnesium profile s woul d b e o f som e us e i f th e cause and/o r tempora l basi s o f cyclicity , currently unknown, could be established.) Other trace element s ma y yet prove t o be usefu l indicators o f th e seaso n o f shel l growth . Th e concentrations o f cobalt , copper , iron , lead , manganese, nicke l an d zin c al l var y seasonall y in

Fig. 8 . Profiles of magnesium and strontium concentration for four Queen Scallops initially cultured on the west coast of Scotland and then transferred to the southern North Sea. Oxygen isotope data included in (d), showing summer-winter seasonality , demonstrate that variation in Mg content of this specimen [an d those in (a)-(c)] does not have a seasonal basis. Specimen s (al l UD): (a) 52800 (S2/5); (b ) 52801 (N4/A2) ; (c) 52802 (N4/A28); (d ) 52803 (N4/A9) . Alphanumeri c code s i n brackets wer e used by Hickson (1997 ) and Hicksonetal. (1999) .

436

JOHNSON E T AL.

soft tissues of A. opercularis, probably in relation to sequestering b y phytoplankto n (Brya n 1973) , an d the fac t tha t ontogeneti c profile s fro m shell s o f other scallo p specie s exhibi t seasona l variatio n i n concentration o f the trace element cadmium , again probably i n relatio n t o phytoplankto n uptak e (Krantz e t al. 1988) , makes it reasonable t o expect that concentrations of elements in the former group would show seasonal variatio n in the A. opercularis shell.

Conclusions and wider application s A. opercularis is well suited for investigation of late Cenozoic marin e environment s i n Europe . Th e species ha s man y propitious features, amongst the most importan t o f whic h are equilibriu m (or near) stable isotop e incorporation , an d th e capacit y t o furnish severa l detaile d an d independen t onto genetic records o f environment from a n individual shell, henc e enabling check s fo r accuracy. It is not, however, a perfect tool: it has the notable defect of a relativel y shor t lifespa n whic h prevent s acqui sition o f long-ter m records . I n thi s respect , i t i s distinctly inferio r t o th e bivalv e Arctica islandica which lives to over 200 years and has been dubbed 'the tree of the North Atlantic' (Thompso n & Jones 1977; Weidma n et al. 1994) . However , unlike this species, A . opercularis exhibit s rapid , year-roun d growth whic h enable s recover y o f well-resolved , complete record s o f seasona l variatio n in environment (principall y temperature) . Combine d us e o f these species represents a means of constructing the fullest possibl e environmenta l history. With respec t t o th e particula r majo r issue s identified a t th e outset , carbo n isotop e dat a fro m mid-Pliocene A . opercularis o f th e SNS B ar e consistent wit h the notio n of relatively high level s of atmospheri c CO 2 an d henc e o f potentia l 'greenhouse' warmin g o f atmospher e an d oceans . Microgrowth incremen t dat a appea r t o indicat e higher summe r an d winte r se a temperature s tha n present but, until the increment width-temperatur e relationship i s calibrate d throug h furthe r researc h on moder n forms , th e relativ e magnitude s o f summer and winter temperature increases cannot be determined, an d henc e th e rol e o f greenhous e heating (a s v . Gulf Strea m hea t supply ) canno t b e fully evaluated . Indeed, further researc h o n modern forms i s necessar y t o confir m tha t growt h incre ments ca n provid e a reliabl e indicatio n o f differ ences i n general temperatur e regime . Oxyge n isotope data indicate mid-Pliocene sea temperatures little differen t fro m now in the SNSB. The balanc e of evidenc e suggest s tha t thes e ar e erroneou s estimates, resultin g fro m crypti c diageneti c alter ation o f th e origina l isotopi c signature . However , there ar e no more direc t indication s that this is the

case; hence, pending results from furthe r studie s of growth increment s i n moder n forms , i t canno t b e ruled ou t tha t previou s notion s o f relativel y hig h sea temperature s i n th e SNS B durin g th e mid Pliocene ar e significantly in error. Information o n th e ag e an d growt h rat e o f organisms i s o f fundamenta l importanc e fo r management o f commerciall y exploite d popula tions and for investigations o f the evolutionary rol e of heterochron y (change s i n th e rat e an d time s of onset-cessation o f developmenta l processes) . Seasonal cycle s i n oxygen isotopi c compositio n o f skeletal material s hav e bee n use d a s a basi s fo r obtaining suc h informatio n i n bot h context s (e.g . Jones 1988 ; Dar e & Deith 1991) . However , whil e seemingly reliable , th e oxyge n isotop e approac h demands substantial investment of time and money. Microgrowth incremen t analysi s ha s been adopte d in the management of some scallop fisheries (Dar e 1995), bu t th e recen t analysi s b y Jone s & Goul d (1999) of annual increments i n the oyster Gryphaea is on e o f ver y fe w instance s wher e an y kin d o f increment siz e dat a ha s bee n employe d i n evolutionary studies . A t leas t fo r scallops , readil y obtainable microgrowt h incremen t dat a offe r th e prospect o f answerin g many questions concernin g the role of heterochrony i n evolution (e.g . Johnso n 1984). Stable-isotope analysi s wa s carrie d ou t a t th e NER C Isotope Geoscience s Laboratory , Keyworth , unde r a n award o f service s t o ALA J (IP/417/0994) . W e than k H . Sloane an d C. Arrowsmith for assistanc e wit h analysi s of carbonates and waters , respectively . The investigatio n was mainl y conducte d durin g tenur e by JAH o f a NER C studentship (GT4/94/322) . Additiona l suppor t fo r trac e element analysi s (performe d a t th e Britis h Geologica l Survey, Keyworth ) wa s provide d b y th e Universit y o f Derby. W e than k J . P . Mikolajunas (formerl y a t Seafis h Industry Authority , Ardtoe ) for supply o f specimens use d in Nort h Se a culture , R . Jansse n (Naturmuseu m Senckenberg, Frankfurt ) fo r suppl y o f Nort h Se a indigenous specimen s an d R . Pouwe r (Netherland s Institute of Applied Geoscience , Utrecht) fo r provision o f information o n the occurrence of Pliocene A. opercularis in th e Netherlands . W e than k A . Welle r (Britis h Geological Survey , Keyworth ) an d C . A . Richardso n (University o f Wales , Bangor ) fo r permissio n t o quot e unpublished finding s relatin g t o A . opercularis an d Pecten maximus, respectively.

References AGUIRRE, J. , BRAGA , J . C. , JIMENEZ , A . P . & RIVAS , P . 1996. Substrate-relate d change s i n pectini d fossi l asemblages. Palaeogeography, Palaeoclimatology, Palaeoecology, 126 , 291-308 . BARRERA, E. , TEVESJ , M . J . S . & CARTER , J . G . 1990 . Variations i n oxyge n an d carbo n isotopi c compositions an d microstructur e o f th e shel l o f

PALAEOENVIRONMENTAL DATA FROM THE QUEEN SCALLOP Adamussium colbecki (Bivalvia) . Palaios, 5 , 149-159. BEVERIDGE, N. A . S . & SHACKLETON , N. J . 1994 . Carbo n isotopes i n recent planktoni c foraminifera : A record of anthropogenic CO 2 invasion of the surface ocean. Earth and Planetary Science Letters, 126, 259-273 . BOHM, R , JOACHIMSKI , M . M. , LEHNERT , H. , MORGENROTH, G. , KRETSCHMER , W. , VACELET , J . &

DULLO, W.-C . 1996 . Carbo n isotop e record s fro m extant Caribbea n an d Sout h Pacifi c sponges : Evolution o f 6 13C in surfac e water DIC. Earth and Planetary Science Letters, 139 , 291-303 . BROECKER, W . S . 1997 . Thermohalin e circulation , th e Achilles hee l of our climate system : Will man-mad e CO2 upse t th e curren t balance ? Science, 278 , 1582-1588. BROOM, M . J . 1976 . Synopsis o f Biological Data o n Scallops Chlamy s (Aequipecten ) operculari s (Linnaeus), Argopecten irradian s (Lamarck), Argopecten gibbu s (Linnaeus). Foo d an d Agriculture Organizatio n o f th e Unite d Nations , Fisheries Synopsis , 114 . & MASON , J . 1978 . Growt h an d spawnin g i n th e pectinid Chlamys opercularis i n relatio n t o temperature an d phytoplankto n concentration . Marine Biology, 47, 277-285. BRYAN, G . W . 1973 . Th e occurrenc e an d seasona l variation o f trac e metal s i n th e scallop s Pecten maximus (L.) and Chlamys opercularis (L.). Journal of the Marine Biological Association of the United Kingdom, 53, 145-166. BUCHARDT, B . 1978 . Oxyge n isotope palaeotemperature s from th e Tertiar y perio d i n th e Nort h Se a area . Nature, 275 , 121-123 . CAMERON, T . J. , CROSBY , A., BALSON , R S. , JEFFREY , D . H., LOTT, G. K. , BULAT , J. & HARRISON, D. J . 1992 . The Geology of th e Southern North Sea. HMSO, fo r the British Geologica l Survey. CHARLES, C . D. , WRIGHT , J . D . & FAIRBANKS , R . G . 1993. Thermodynami c influence s o n th e marin e carbon isotop e record . Paleooceanography, 8 , 691-697. CHAUVAUD, L., GERARD, T . & PAULET, Y.-M. 1998. Effect s of environmental factors on the daily growth rate of Pecten maximus individual s i n th e Ba y o f Bres t (France). Journal o f Experimental Marine Biology and Ecology, 227, 83-111 . COPLEN, T . B. 1994 . Reportin g o f stable hydrogen, carbo n and oxygen isotopic abundances . Pure and Applied Chemistry, 66 , 273-276. CROWLEY, T . J . 1991 . Modellin g Pliocen e warmth . Quaternary Science Reviews, 10 , 272-282. 1996. Pliocene climates: th e nature o f the problem . Marine Micropaleontology, 27, 3-12 . DARE, P . J . 1995 . Us e o f externa l shel l microgrowt h patterns fo r determinin g growt h an d ag e i n th e scallop Pecten maximus (L.) . IFREMER, Actes d e Colloques, 17,211-217. & DEITH , M . R . 1991 . Ag e determinatio n o f scallops, Pecten maximus (L.) , using stable oxygen isotope analysis , wit h som e implication s fo r fisheries managemen t i n Britis h waters . In : SHUMWAY, S . E . & SANDIFER , P . A . (eds ) A n International Compendium of Scallop Biology and

437

Culture. World Aquacultur e Society, Bato n Rouge , 118-133. Diou, A. , DUMONT , C. , LALLGANT , O. , TOUBIN , M. , TRUCHETET, F , VERRECCHIA , E . P . & ABIDI , M . A . 1999. Multiscale analysis of range image: its use for growth incremen t characterization . Optical Engineering, 38, 2016-2021. DOWSETT, H. , BARRON , J . & POORE , R . 1996 . Middl e Pliocene se a surfac e temperatures : a globa l reconstruction. Marine Micropaleontology, 27 , 13-25. , CRONIN , T . M. , POORE , R . Z. , THOMPSON , R . S. , WHATLEY, R . C . & WOOD , A . M . 1992 . Micropaleontological evidenc e fo r increase d meridional transpor t i n th e nort h Atlanti c Ocea n during the Pliocene. Science, 258, 1133-1135 . FUGE, R. , PALMER , T. J., PEARCE , N . J . G . & PERKINS , W . T. 1993 . Mino r an d trac e elemen t chemistr y o f modern shells : a laser ablatio n inductivel y couple d plasma mas s spectrometr y study . Applied Geochemistry, Supplement, 2, 111-116. FUNNELL, B . M. , NORTON , R E . P . & WEST , R . G . 1979 . The Cra g a t Bramerton , nea r Norwich , Norfolk . Philosophical Transations of the Royal Society of London, B287, 489-534. GIBBARD, P. L., WEST, R. G. , ZAGWIJN, W. H. ETAL. 1991 . Early an d earl y Middl e Pleistocen e correlation s i n the souther n Nort h Se a basin . Quaternary Science Reviews, 10, 23-52. GRUFFYDD, LL . D . 1981 . Observation s o n th e rat e o f production o f external ridges o n the shel l o f Pecten maximus i n th e laboratory . Journal o f th e Marine Biological Association o f th e United Kingdom, 61 , 401-411. HEAD, M . J . 1997 . Thermophili c dinoflagellat e assemblages fro m th e mi d Pliocen e o f easter n England. Journal o f Paleontology, 71, 165-193 . 1998. Pollen and dinoflagellates fro m th e Red Cra g at Walton-on-the-Naze , Essex : evidenc e fo r a mil d climatic phas e durin g th e earl y Lat e Pliocen e o f eastern England . Geological Magazine, 135 , 803-817. HICKSON, J . A . 1997 . Stable isotope profiles i n shells o f the bivalve Aequipecte n operculari s (L.) a s environmental indicators. PhD Thesis, University of Derby. , JOHNSON , A. L . A. , HEATON , T . H. E . & BALSON , R S. 1999 . Th e shel l o f th e Quee n Scallo p Aequipecten opercularis (L.) as a promising tool for palaeoenvironmental reconstruction : evidenc e an d reasons fo r equilibriu m stable-isotop e incorpor ation. Palaeo geography, Palaeoclimatology, Palaeoecology, 154 , 325-337 . JOHNSON, A. L. A. 1984 . The palaeobiology o f the bivalve families Pectinida e an d Propeamussiida e i n th e Jurassic of Europe. Zitteliana, 11. JONES, D . S . 1980 . Annua l cycl e o f shel l growt h incre ment formatio n i n tw o continenta l shel f bivalve s and its paleoecologic significance . Paleobiology, 6, 331-340. 1983. Sclerochronology : readin g th e recor d o f the mollusca n shell . American Scientist, 71 , 384-391. 1988. Sclerochronolog y an d th e siz e versu s ag e

438

JOHNSON E T AL .

problem. In : McKiNNEY , M . (ed. ) Heterochrony i n Evolution. A Multidisciplinary Approach. Plenum , New York , 93-108. & ALLMON , W . D . 1995 . Record s o f u p welling, seasonality an d growt h in stable-isotop e profile s of Pliocene mollus k shell s fro m Florida . Lethaia, 28 , 61-74. & GOULD , S . J. 1999 . Direct measurement of age i n fossil Gryphaea: th e solution to a classic problem in heterochrony. Paleobiology, 25, 158-187 . & QUITMYER , I. R. 1996 . Marking time with bivalve shells: oxyge n isotope s an d seaso n o f annua l increment formation. Palaios, 11 , 340-346. , ARTHUR , M . A . & ALLARD , D . J . 1989 . Sclerochronological record s o f temperatur e an d growth from shell s o f Mercenaria mercenaria fro m Narragansett Bay , Rhode Island . Marine Biology, 102, 225-234 . KRANTZ, D . E . 1990 . Mollusk-isotop e record s o f Plio Pleistocene marin e paleoclimate , U.S . Middl e Atlantic Coastal Plain. Palaios, 5, 317-335. , JONES, D. S . & WILLIAMS, D . F. 1984. Growth rates of th e se a scallop , Placopecten magellanicus, determined from th e 18 O/16O record in shell calcite. Biological Bulletin, 167, 186-199. , KRONICK , A . T . & WILLIAMS , D. F . 1988 . A mode l for interpretin g continenta l shel f hydrographi c processes fro m th e stabl e isotop e an d cadmium : calcium profiles of scallop shells . Palaeogeography, Palaeoclimatology, Palaeoecology, 64, 123-140 . , WILLIAMS , D . F . & JONES , D . S . 1987 . Ecological and paleoenvironmenta l informatio n usin g stabl e isotope profile s fro m livin g an d fossi l molluscs . Palaeogeography, Palaeoclimatology, Palaeoecology, 58, 249-266. KURSCHNER, W . M. , VA N DER BURGH, J., VISSCHER , H . & DILCHER, D . L . 1996 . Oak leave s a s biosensor s o f late Neogen e an d earl y Pleistocen e paleoatmospheric CO 2 concentrations . Marine Micropaleontology, 27 , 299-312. LANE, A . & PRANDLE, D. 1996 . Inter-annual variability in the temperature o f the North Sea. Continental Shelf Research, 16, 1489-1507. LENG, M . J. & PEARCE , N . J. G . 1999 . Seasonal variatio n of trac e elemen t an d isotopi c compositio n i n th e shell o f a coasta l mollusk , Mactra isabelleana. Journal o f Shellfish Research, 18 , 569-574. MARGUS, D . 1991 . Yugoslavia. In: SHUMWAY , S. E . (ed.) Scallops: Biology, Ecology and Aquaculture. Elsevier, Amsterdam, 789-793. MEIJER, T. & PREECE, R . C. 1995 . Malacological evidenc e relating t o th e insularit y of th e Britis h Isles during the Quaternary . In : PREECE , R . C . (ed. ) Island Britain: a Quaternary Perspective. Geologica l Society, London, Special Publications, 96, 89-110. MITCHELL, L. , FALLICK, A. E. & CURRY, G. B. 1994. Stable carbon and oxygen isotope composition s o f mollusc shells fro m Britai n an d Ne w Zealand . Palaeogeography, Palaeoclimatology, Palaeoecology, 111, 207-216. NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION OF THE UNITE D STATE S 1999 . COAD S monthl y climatology. Worl d Wid e We b Address : http .V/ferret. wrc .noaa. go v/fbin/climate_server.

O'NEIL, J . R. , CLAYTON , R . N . & MAYEDA , T . K . 1969 . Oxygen isotop e fractionatio n i n divalen t meta l carbonates. Journal o f Chemical Physics, 51 , 5547-5558. PAUL, J. D. 1980. Salinity-temperature relationship s in the queen scallo p Chlamys opercularis (L.) . Marine Biology, 56, 295-300. 1981. Natural settlement and early growth of spat of the quee n scallo p Chlamys opercularis (L.) , wit h reference t o th e formatio n o f the firs t growt h ring . Journal ofMolluscan Studies, 47, 53-58 . RAFFI, S. , STANLEY , S . M . & MARASTI , R . 1985 . Biogeographic pattern s an d Plio-Pleistocen e extinction o f Bivalvi a i n th e Mediterranea n an d southern North Sea. Paleobiology, 11 , 368-388. RAYMO, M . E. , GRANT , B. , HOROWITZ , M . & RAU , G . H . 1996. Mid-Pliocen e warmth : stronge r greenhous e and stronge r conveyor . Marine Micropaleontology, 27,313-326. RICHARDSON, C . A. , KENNEDY , H. , DUARTE , C . M. , KENNEDY, D . P . & PROUD , S . V . 1999 . Ag e an d growth o f th e fa n musse l Pinna nobilis fro m south-east Spanis h Mediterranea n seagras s (Posidonia oceanicd) meadows . Marine Biology, 133, 205-212. ROMANEK, C . S. , GROSSMAN , E . L. & MORSE, J. W. 1992. Carbon isotopic fractionatio n in syntheti c aragonite and calcite: effect s o f temperature an d precipitation rate. Geochimica e t Cosmochimica Acta, 56 , 419-430. ROSENBERG, G . 1980 . A n ontogeneti c approac h t o th e environmental significanc e o f bivalv e shel l chemistry. In : RHOADS , D . C . & LUTZ , R . A . (eds) Skeletal Growth o f Aquatic Organisms. Plenum , New York , 133-168 . 1990. Th e 'vita l effect ' o n skeleta l trac e elemen t content a s exemplifie d b y magnesium . In: CARTER , J. G . (ed. ) Skeletal Biomineralisation: Patterns, Processes an d Evolutionary Trends. Volume 1 . Van Nostrand Reinhold, New York, 567-577. & HUGHES , W . W. 1991. A metabolic mode l fo r th e determination o f shel l compositio n i n th e bivalv e mollusc, Mytilus edulis. Lethaia, 24, 83-96 . SEED, R . 1976 . Ecology. In : BAYNE , B . L . (ed. ) Marine Mussels: Their Ecology and Physiology. Cambridg e University Press, 13-65 . SLOAN, L . C. , CROWLEY , T . J . & POLLARD , D . 1996 . Modelling o f middl e Pliocen e climat e wit h th e NCAR GENESI S genera l circulatio n model . Marine Micropaleontology, 27 , 51-61. SPERO, H . J., BIJMA, J., LEA, D . W . & BEMIS , B. E . 1997. Effect o f seawate r carbonat e concentratio n o n foraminiferal carbo n an d oxyge n isotopes . Nature, 390, 497-500 . TAYLOR, A . C . & VENN , T . J. 1978 . Growth o f th e quee n scallop, Chlamys opercularis, fro m th e Clyd e Se a area. Journal o f th e Marine Biological Association of th e United Kingdom, 58, 687-700. TEBBLE, N . 1976 . British Bivalve Seashells. HMSO , Edinburgh. TETT, P. & WALNE, A. 1995 . Observations and simulations of hydrography , nutrient s an d plankto n i n th e southern Nort h Sea. Ophelia, 42, 371^416. THOMPSON, I. L. & JONES, D . S. 1977 . The ocea n quahog,

PALAEOENVIRONMENTAL DATA FROM THE QUEEN SCALLOP Arctica islandica, 'tree' o f the North Atlantic shelf . Geological Society of America, Abstracts with Programs, 9, 1199 . THOMPSON, R . S . & FLEMING , R . F . 1996 . Middl e Pliocene vegetation : reconstructions , paleoclimati c inferences, an d boundar y condition s fo r climat e modeling. Marine Micropaleontology, 27 , 27^4-9. URSIN, E . 1956 . Distributio n an d growt h o f th e queen , Chlamys opercularis (Lamellibranchiata), in Danish and Faroes e waters . Meddelelser fr a Danmarks Fiskeri- og Havunders0gelser, 1 , 1-31 . WALLER, T . R . 1991 . Evolutionar y relationship s amon g commercial scallop s (Mollusca : Bivalvia : Pectinidae). In : SHUMWAY , S . E . (ed. ) Scallops: Biology, Ecology an d Aquaculture. Elsevier , Amsterdam, 1-73 .

439

WEIDMAN, C . R., JONES , G . A . & LOHMANN , K . C . 1994 . The long-live d mollus c Arctica islandica: A ne w palaeoeceanographic too l fo r th e reconstructio n o f bottom temperature s fo r th e continenta l shelve s of the norther n Nort h Atlanti c Ocean . Journal o f Geophysical Research - Oceans, 99 , 1 8 305 18314. WOOD, A . M. , WHATLEY , R. C. , CRONIN , T. M. & HOLTZ , T. 1993 . Pliocen e palaeotemperatur e reconstructio n for th e souther n Nort h Se a base d o n Ostracoda . Quaternary Science Reviews, 12 , 747-767. ZEEBE, R . E . 1999 . A n explanatio n o f th e effec t o f seawater carbonat e concentratio n o n foraminifera l oxygen isotopes . Geochimica e t Cosmochimica Acta, 63, 2001-2007.

This page intentionally left blank

The myth o f metabolic cold adaptation: oxygen consumption in stenothermal Antarctic bivalve s LLOYD S. PECK & LUCY Z. CONWA Y British Antarctic Survey, High Cross, Madingley Road, Cambridge CB3 OET, UK (e-mail: l.peck@ bas.ac.uk) Abstract: Antarctic marin e ectotherm s ar e often describe d a s only bein g capabl e of livin g i n a restricted temperature range, i.e . the y ar e stenothermal . However, few dat a exis t demonstratin g that fo r a given grou p thi s i s th e case. Th e Antarctic bivalve mollusc s Laternula elliptica an d Limopsis marionensis ar e simila r t o othe r Antarcti c invertebrate s an d ca n onl y exis t withi n a temperature windo w o f 6-12°C. This is two to six times smaller than the range for temperate and tropical bivalves , thu s demonstratin g thei r stenotherma l nature . Th e possibilit y o f elevate d metabolic rates of cold-water ectotherm s has been a topic of debate over many years . Recently, the suggestion that metabolic rates must be elevated at low temperatures to overcome constraints has been supporte d by finding s tha t mitochondria l contents of muscles i n ectotherms ar e higher at low temperatures. Data, presente d here for standard o r routine metabolic rates of 41 species of bivalve mollusc from polar, temperate and tropical sites, indicate that oxygen consumptio n i s not elevated at low temperatures. Indeed, analysis of Q10 coefficients betwee n 0 and 25°C suggests that metaboli c rates o f polar species may be lower than woul d b e expected by comparison wit h temperate bivalves .

In th e earl y par t o f th e twentiet h century , Krog h (1916) noted that species living at low temperatures were stil l capabl e o f significan t activit y and , comparing thi s with the ver y low metabolis m and limited locomotor y capabilities o f goldfish held a t low temperatures, postulated that metabolic rates of polar ectotherms shoul d be elevated t o compensat e for th e physiological constraints imposed by living near o r belo w 0°C . I n th e 1950 s an d 1960 s dat a were produced to suppor t this hypothesis, and th e concept o f metaboli c col d adaptatio n (MCA) wa s put forwar d b y Scholande r e t al (1953 ) an d Wohlschlag (1964) . Holeto n (1974) , however , showed tha t som e o f th e previou s dat a indicating elevated metabolism were probably the product of stress, an d Clark e (1980 , 1983 ) provide d con vincing argument s to sho w polar ectother m metabolic rate s ar e no t elevated . Mor e recen t studie s have continue d t o sho w lo w restin g metabolism s for pola r specie s (Chapell e & Pec k 1995 ; Pec k 1989, 2000 ; Portne r e t a l 1999) , wit h a fe w exceptions (e.g. Wells 1987). Low temperatur e physiolog y ha s bee n a n increasing fiel d ove r th e las t 5-1 0 years , an d the findings tha t som e processe s ar e wel l adapte d t o low temperatures, e.g . th e cycling o f microtubule s (Detrich et al. 1989), have led to the resurrection of the ide a tha t metaboli c cost s mus t be elevate d a t low temperatures . Thi s argumen t ha s bee n sup -

ported particularl y by the finding that the muscle s of polar fish species contain approximately twice as many mitochondria per unit mass as muscles fro m species livin g normall y a t 20° C (Johnsto n e t al . 1994; Guderley 1998) . It i s no t possibl e t o tes t th e MC A concep t adequately b y using measures o n single, o r even a few, species . A rigorou s evaluatio n require s dat a from many species a t their normal habitat temperatures, s o tha t a robus t measur e o f th e leve l o f metabolic rate s i n pola r specie s ca n b e mad e i n comparison wit h lowe r latitud e types . Ther e ar e very few taxa where there are sufficient data for this approach but , i n a recent stud y o f percifor m fish , Clarke & Johnsto n (1999 ) foun d n o elevatio n o f metabolism a t lo w temperatures . Thi s pape r provides a similar comparison for bivalve molluscs and is the first suc h data for an invertebrate taxon . Phylogenetic constraint s an d environmenta l history ar e importan t whe n investigatin g evolu tionary adaptations . Comparisons should , as far a s possible, b e mad e withi n a phylogeneticall y consistent group . The ag e an d environmental consistency of an environment are also important becaus e if curren t condition s hav e existe d fo r onl y a shor t period o n evolutionary timescales it is unlikely: (1) that man y specie s wil l hav e evolve d adaptations; or (2) that evolved adaptations will have reached a stable equilibrium . Thi s i s tru e fo r al l

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Specia l Publications, 177 , 441^50 . 1-86239-076-2/007 $ 15.00 © The Geological Society of London 2000 .

442

L. S . PEC K & L . Z . CONWA Y

environmental types , whethe r ther e i s significan t temperature variatio n o r not , i.e . organism s nee d sufficient tim e t o evolv e adaption s t o ambien t conditions irrespective o f the type of environment. In thi s context , dat a fo r Antarcti c ectotherm s ar e particularly valuable . Th e Antarcti c marin e environment is one of extreme thermal stability; sea temperatures var y b y < 3°C annuall y a t maritim e Antarctic sites , an d b y < 0.2°C a t som e hig h Antarctic site s (Clark e 1988) . Also , thes e conditions hav e bee n i n existenc e fo r a t leas t 5-10 Ma, possibl y eve n sinc e Antarctic a becam e isolated fro m othe r continent s 15-2 5 M a ag o (Clarke & Cram e 1992) . Dat a ar e availabl e fo r metabolic rate s fro m severa l specie s o f Antarcti c bivalve molluscs , an d comparisons with temperate and tropical specie s can be expected t o be robust. Data are presented her e for oxygen consumptio n in th e Antarcti c bivalve s Laternula elliptica an d Cyclocardia astartoides. These dat a ar e combined with previously published measure s of metabolism and therma l toleranc e i n bivalve s worldwid e t o show tha t Antarcti c specie s ar e stenotherma l an d can i n n o wa y b e construe d t o posses s elevate d metabolic rates.

Materials and methods Experimental specimens were collected from Borge Bay, Signy Island, South Orkney Islands (60°43 /S, 45°36/W). Laternula elliptica wer e collecte d b y scuba diver s fro m depth s o f 10-2 0 m an d

Cyclocardia astartoides were collected b y Agassiz trawl fro m depth s o f 50-15 0 m. Specimen s wer e transported b y ship and held i n the UK in refriger ated aquari a a t 0° ± 1.0° C under conditions of lo w light. Experimental animals were kept in the UK for 3-9 month s prior to measurements being made and remaining stock s wer e stabl e fo r a furthe r 1 8 months in the aquarium system prior to them bein g used i n othe r experiments . Unde r norma l holdin g conditions animal s wer e fe d fortnightl y b y addin g 2 1 each o f culture s of Thalassiosira pseudonanna and Tetraselmis suecica to the circulating seawater . Bivalves were not fed during experiments . Measures of oxygen consumption were made on individuals hel d i n acryli c o r glas s respirometers , using closed-bottle respirometr y technique s simila r to those o f Chapelle & Peck (1995) and Former et al (1999) . Water oxygen contents were obtained by couloximetry (Pec k & Uglow 1990) . Experimenta l animals wer e carefully place d i n respirometers fo r the duratio n o f eac h tria l bu t wer e no t expose d t o air durin g thi s process . Behaviou r wa s observed ; the L . elliptica commence d pumpin g withi n minutes of being placed in respirometers an d the C. astartoides opened soon after being moved. During trials bivalve s wer e hel d i n a 50 1 jackete d waterbath linke d t o a thermocirculator. Th e whol e system was held i n a controlled-temperature room . Using this method experimental temperatures wer e held t o 0 ± 0.2°C. Oxyge n content s o f respiro meters wer e not allowe d t o fal l belo w 75 % o f ful l saturation during trials .

Fig. 1 . Laternula elliptica: timecours e evaluatio n o f oxygen consumptio n (j^ l O 2 animal"1 h"1) over th e firs t 2 4 h after animals were placed in respirometers. Data are the mean o f measures for eight animals and are presented as values per standard 12. 5 g tissue dr y mass animal . Thi s value was close t o the mean mas s fo r the group (12.55 g).

OXYGEN CONSUMPTIO N I N STENOTHERMA L ANTARCTI C BIVALVES

At th e en d o f th e experimen t interna l tissue s were removed fro m th e bivalves, drie d to constan t weight at 60°C and weighed. The mean tissue mass of th e C . astartoides wa s 10. 8 m g ( n = 8, SE = 1.97) an d fo r th e L . elliptica 12. 5 g ( n = 20, SE = 2.80).

Results Metabolic rates Timecourse evaluation s o f oxyge n consumptio n (MO2) reveale d tha t initia l metaboli c rate s wer e elevated b y u p t o thre e time s compare d wit h th e acclimated rate s fo r bot h Laternula elliptica (Fig . 1) an d Cyclocardia astartoides (Fig . 2) . Thus , a standard 12. 5 g tissue dry mas s L. elliptica ha d a n oxygen consumptio n rat e o f 840 0 u l O 2 rr1 afte r 1.5 h , whic h decline d t o c . 300 0 \il O 2h~l afte r 20-25 h. Fo r a standar d 1 1 mg tissu e dry mas s C. astartoides thes e value s wer e 1.5 1 ul O 2 h~ 1 afte r 2.5 h, which fell t o c . 0.5 ul O 2 rr1 afte r 20-2 5 h. Converting th e acclimate d dat a (rate s obtaine d between 1 5 and 24 h after the start of trials) to mass specific oxygen consumption rates produced values of 46. 3 u l O 2 g dr y tissu e mass" 1 h"1 fo r C . astartoides an d 23 9 ul O 2 g dr y tissu e mass" 1 h"1 for L elliptica. Values for L elliptica ar e high and those fo r C . astartoides ar e lo w fo r Antarcti c species, bu t bot h ar e withi n th e rang e o f oxyge n

443

consumption rate s previousl y reporte d fo r pola r bivalve mollusc s (Tabl e 1) . There is great variability in the data presented in Table 1 , with rates varying by over eight times fro m 35 to 292 ul O 2 g dry tissue mass" 1 h"1. However, when thes e dat a ar e compare d wit h thos e fo r bivalves fro m othe r latitudes , i t i s clea r tha t suc h variability is characteristic o f the group as a whole and no t jus t o f pola r region s (Fig . 3) , a s fo r al l temperatures there is around a ten fold range in the values reported . Som e o f thi s variabilit y wil l b e explained b y difference s in technique s an d siz e of animal, sinc e mass-specifi c dat a ar e onl y strictl y comparable whe n th e mas s exponen t i s 1 . Mas s exponents fo r bivalv e mollusc s ar e c . 0.7 3 (Griffiths & Griffiths 1987 ) and so the variability i n the data in Table 1 because of this will not be great. The siz e rang e use d i n eac h temperatur e regim e was simila r an d th e ecologica l niche s represente d were also broad. There i s also a small temperature bias i n thes e data . Value s hav e bee n presente d i n volumes of oxygen consumed because most studies have use d thes e units . However , th e volum e occupied b y a ga s varie s wit h temperatur e an d 1 mol o r 1 g o f oxyge n a t 30 ° C occupie s c . 11 % more volum e tha n a t 0°C . Comparison s betwee n polar (0°C) and temperate (15°C) sites, and tropical (30°C) an d temperate (15°C ) site s woul d diffe r b y 5% compare d wit h dat a expresse d o n a mola r o r mass basis.

Fig. 2 . Cyclocardia astartoides: timecours e evaluation o f oxygen consumptio n (u l O^ animal l h ! ) over th e first 24 h after animal s wer e placed in respirometers. Data ar e the mean o f measures for 20 individuals an d data ar e presente d as oxygen consume d pe r standard 1 1 mg tissue dr y mass animal . Thi s value was close to the mean mas s o f the grou p (10.81 mg) .

444

L. S . PEC K & L . Z . CONWA Y

Table 1 . Metabolic rates of polar bivalve molluscs Species

Temperature (°C)

MO2* (Ml g" 1 h-1)

Arctic/Antarctic

Reference

Gaimardia trapesina Yoldia eightsi Limopsis marionensis Laternula elliptica Laternula elliptica Cyclocardia astartoides Chlamys islandica Chlamys islandica Clinocardium ciliatum

0 0 0 0.5 0 0 2 0 0

292 164 121 144 239 46.3 190 113 35-40

Antarctic Antarctic Antarctic Antarctic Antarctic Antarctic Arctic Arctic Arctic

Ralph & Maxwell (1977 ) Davenport (1988 ) Former e f «/ . (1999 ) Ahn & Shim (1998 ) This study This study Vahl (1978) Schmid (1996 ) Schmid (1996 )

*Data are presented as (a l O 2 consumed per gram of dry tissue mass per hour.

Metabolic rat e varie d significantl y wit h temperature (ANOVA , F = 2.74, 85 df, P < 0.001). An Arrhenius plot of the dat a (In rate v. reciprocal of absolute temperature, T) produce s a relationship between metaboli c rat e an d temperatur e (Fig . 4 )

which i s significantl y modelle d b y a linea r relationship: In MO 2 = 26.7 - 5.95(1000/7 ) (r2 = 0.47, F = 74.33, P< 0.001 )

Fig. 3 . Oxygen consumption value s (ul O2 g dry tissue mass" 1 rr1) for bivalve molluscs from differen t latitudes . Data presented ar e resting routine or standard rates for specie s a t their normal temperatures. Wher e dat a wer e available for winter and summer rates for species inhabiting a wide temperature range , more than one value is included. O , Polar species; D, temperate species ; A , tropica l species . Specie s an d authorities are as follows: Ruditapes philipinarum (Kim et al. 1999) ; Cerastoderma glaucum (Wilso n & Ekhaim 1997) ; Saccostrea cucullata, Crassostrea belcheri, Crassostrea iradelei (Davenport & Wong 1992) ; Donax variabilis (Wilso n 1999) ; Tellina tennis (Trevallion 1971) ; Arctica islandica (Taylor & Brand 1975) ; Arctica islandica, Laevicardium crassum, Mytilus edulis (Bayn e 1971) ; Placopecten magellanicus (MacDonal d & Thompson 1986) ; Macoma balthica, Mulinia lateralis, Mya arenaria (Kennedy & Mihursky 1972) ; Scrobicularia plana (Worral et al. 1983) ; Geloinia ceylonica, Anadara granosa (Bayn e 1973); Donax vittatus (Ansell 1973) ; Mya arenaria (Low e & Trueman 1972) ; Chlamys islandica, Clinocardium ciliatum (Schmid 1996) ; Chlamys hasata, Clinocardium nuttali (Bernar d & Noakes 1990) ; Chlamys opercularis (McKlusky 1973) ; Chlamys islandica (Vahl 1978); Polymesoda caroliniana (Deato n 1991) ; Modilous demissus, Mytilus edulis, Mytilus californianus, Perna perna (Bayn e 1976) ; Chlamys varia (Shafe e 1980) ; Argopecten irradians (Bricelj e t al. 1987) ; Yoldia eightsi (Davenport 1988) ; Gaimardia trapesina (Ralp h & Maxwell 1977) ; Geukensia demissa, Cardium edule, Mytilus calif ornianus, Tridacna gigas, Cardium glaucum, Mytilus galloprovincialis (Mingoa-Licuanan 1993) ; Limopsis marionensis (Forme r et al. 1999) ; Laternula elliptica (Ah n & Shim 1998) ; Crassostrea virginica (Dame 1972) ; Ostrea edulis (Rodhouse 1978) ; Mytilus chilensis (Navarr o & Winter 1982) ; Laternula elliptica, Cyclocardia astartoides (this study).

OXYGEN CONSUMPTIO N I N STENOTHERMA L ANTARCTI C BIVALVE S

445

Fig. 4 . Arrhenius plot of bivalve metabolic rates as In oxygen consumed g dry tissue mass"1 Ir1 v. the reciprocal of absolute temperature (1000/7). O, Polar species; D, temperate species; A, tropica l species. Note the reversal of the temperature axis to scale with increasing temperature to the right.

However, th e for m o f th e dat a doe s sugges t some curvilinearity. Assessing whether metabolic rates at low temperature s ar e elevate d compare d t o othe r latitudes i s not easy, even from thes e types of data. Fitting nonlinea r models , o r transformin g an d fitting severa l regression s to differen t temperatur e ranges an d the n testin g t o se e i f th e slope s o f th e relationships obtaine d ar e less a t low temperature , is fraught wit h problems. Fittin g nonlinea r model s and testin g fo r significan t change s i n slope s o f tangents i s technicall y non-trivial , requirin g ver y large amounts of data throughout the range so that estimates of the variance o f tangents can be made. A simila r problem exist s whe n analysing differen t regressions fo r subsection s o f th e overal l relationship; becaus e ;c-axi s range s ar e restricted , and fewe r dat a ar e use d i n eac h regression , comparisons are perforce coarser. An alternativ e approac h i s t o spli t th e dat a int o 5°C blocks and compare means at each temperature step using Q 10 coefficients. I f rates ar e elevated a t low temperatures , Q 10 coefficient s shoul d progressively decreas e a s temperatur e i s reduced . When the bivalve oxygen consumption dat a in Fig. 3 ar e treate d thi s wa y n o significan t relationshi p between Q 10 and temperature i s obtained ove r the 0-30°C temperatur e rang e [Pearso n correlatio n coefficient (PCC ) = -0.18, P = 0.77] an d the mean Q10 value is 2.56 (Fig. 5). However, if the analysis is restricted t o 0-25°C a significant relationshi p is obtained (PC C = -0.987, P = 0.013). Thi s woul d indicate that Q10 values are higher at polar latitudes

than in temperate or tropical zones, and hence that metabolic rate s ar e lower at low temperatures than would be predicte d b y extrapolatio n fro m warme r sites. Temperature tolerances Data o n th e temperatur e range s tha t Antarcti c bivalve molluscs can survive are scarce. In parallel with th e presen t oxyge n consumptio n study , measures o f surviva l i n relatio n t o elevate d temperature were made on L elliptica (L . S. Peck, H.-O. Portne r & I . Hardewig , unpublishe d data) . Specimens wer e held in the temperature-controlle d system fo r respirometr y an d temperature s progressively elevate d fro m 0 t o 3°C , an d the n 6-9°C. Specimen s wer e allowe d on e wee k t o acclimate t o eac h ne w temperatur e befor e temperatures wer e raise d again . Thi s tim e wa s allowed becaus e Peck (1989 ) found tha t long-term acclimation occurre d i n simila r trial s wit h th e gastropod Nacella concinna. A t 6° C an d abov e siphons wer e dramatically extende d an d had much less turgo r tha n previously . Afte r 4 day s a t 9°C , 50% o f th e specimen s died . Fo r shor t period s o f time th e L . elliptica coul d surviv e highe r temperatures tha n this, because it took several days for the m t o di e a t 9°C . However , suc h short-ter m exposures woul d no t b e representativ e o f th e species true upper lethal limits. The only other data on upper lethal temperature limits for a n Antarctic bivalve mollus c ar e fo r Limopsis marionensis,

446

L. S . PEC K & L. Z . CONWA Y

Fig. 5 . Q10 values for the relationship between bivalve metabolic rat e (ul O 2 g dry tissue mass" 1 tr1) and temperature (°C). Data have been groupe d int o 5°C blocks an d means ( ± SE) plotted. Q 10 values show n are for difference s between means in successive 5°C blocks.

which ha d a n uppe r letha l temperatur e o f +4.5° C (Former e t al 1999) . Thes e value s ar e simila r t o those for other Antarctic groups , but are two to fiv e times les s than for temperate an d tropical bivalve s (Fig. 6) .

Discussion In L . elliptica an d C . astartoides oxyge n con sumption rate s ar e simila r t o previousl y reporte d values fo r pola r bivalv e molluscs , an d ar e lo w compared t o specie s fro m temperat e an d tropica l

localities. Dat a fo r 4 1 bivalv e specie s acros s th e 0°-30°C temperatur e rang e showe d a significan t temperature effec t o n metabolism . I t ha s bee n argued tha t a n Arrheniu s relationshi p i s th e bes t descriptor o f th e relationshi p betwee n whole animal metabolis m an d temperatur e (Clark e & Johnston 2000) . Th e Arrheniu s relationshi p establised i n thi s stud y indicate s tha t a ris e i n temperature fro m 0 to 30° C cause s a n elevation i n metabolism of 8.6 times. Thi s woul d be equivalent to a Q10 of 2.05 over the whole range, which is well within the normally expecte d range . The ide a o f metaboli c col d adaptatio n (MCA )

Fig. 6 . Temperature tolerance windows for Antarctic bivalves, fish, echinoderms , brachiopods and gastropods , compared wit h temperate an d tropical bivalves . Dat a from Portne r e t al (1999) , Pec k (1989) , Somer o & De Vries (1967), Davenpor t & Wong (1992), Rodhous e (1978), Kennedy & Mihursky (1972), MacDonald & Thompson (1986 ) and Bricelj et al. (1987) .

OXYGEN CONSUMPTIO N I N STENOTHERMA L ANTARCTI C BIVALVE S

was originall y base d o n within-specie s relation ships betwee n metabolis m an d temperatur e fo r eurythermal temperat e tax a and extrapolating thos e relationships to polar temperatures. Even using this philosophy, a bod y o f dat a hav e bee n produce d suggesting that metabolic rate s of polar specie s are not elevate d compare d t o extrapolation o f data fo r temperate species . However , severa l author s stil l purport t o have data supportin g the MCA concep t (Forster el al 1987 ; Wells 1987 ; Torres & Somero 1988). Hardewi g e t a l (1998 ) hav e als o recentl y produced dat a indicatin g pola r eelpou t hav e metabolic rate s whic h ar e relativel y elevate d compared t o expectation s fro m measure s o n temperate species. These data are compelling when viewed i n isolation . However , a s pointe d ou t b y both Zimmerma n & Hubold (1998 ) an d Clarke & Johnston (1999) , th e bes t metho d fo r testin g th e hypothesis of elevated metabolism at polar latitudes is to analys e standard or resting metabolic rates of species a t their norma l habitat temperatures across a wide temperature range . Thi s wa s the procedur e used by Clarke & Johnston (1999) for fish an d was repeated her e fo r bivalv e molluscs . I t shoul d b e emphasized her e tha t neithe r th e dat a fo r fis h no r the present data provide any support for significant elevation o f whole-organis m metabolis m a t lo w temperatures. Indeed , th e highe r Q 10 value s a t lower temperature s fo r bivalv e mollusc s suggest s that resting and basal metabolic rates may even be lower tha n woul d b e expecte d fro m extrapolatio n from temperat e groups . This i s because highe r Q 10 coefficients indicat e a greate r differenc e betwee n the low and high temperature metabolic rates, i.e. a greater slop e o n th e rate-temperatur e graph . Th e present data , th e firs t o n a n invertebrat e taxon , strongly suppor t th e conclusio n o f Clark e & Johnston (1999 ) fo r fis h tha t 'metaboli c col d adaptation (sensu Krog h 1916 ) doe s not exist'. Clearly, pola r ectotherm s ar e adapte d t o lo w temperatures i n that the y surviv e and carry ou t all the necessary biological functions. Also, changes in enzyme kinetic properties an d quantities have been demonstrated (Somer o e t a l 1998 ) an d mito chondrial densitie s ar e elevate d (Johnsto n e t a l 1994, 1998 ; Guderle y 1998) . Portner e t al (1998 ) have argue d persuasivel y tha t eve n thoug h individual mitochondria l cost s wil l b e reduce d under long-term permanently cold conditions, such as thos e i n Antarctica , mitochondria l proliferatio n must inevitabl y lea d t o som e elevatio n o f restin g metabolism becaus e o f enhanced requirement s fo r mitochondrial synthesi s an d maintenance . The y correctly poin t ou t tha t a majo r componen t o f baseline metabolic costs is the maintenance of ionic gradients and , in this respect, th e compensation fo r H+ leakag e acros s mitochondria l membrane s wil l mean that they are more costly to maintain per unit

447

volume tha n othe r cellula r elements . Th e cos t o f mitochondrial maintenanc e ha s bee n estimate d t o be 45 % o f standar d metaboli c cost s i n animal s (Brand 1990) , whic h emphasizes this point. The reconciliation o f the fac t tha t mitochondrial proliferation mus t carr y a n enhance d cost , i n contrast wit h th e findin g her e tha t ther e i s n o detectable incremen t i n whole-anima l metabolis m at low temperatures (which may even be lower than expected i n bivalves ) can b e explaine d b y on e of three mechanisms . (1 ) Mitochondrial maintenance costs ar e reduced a t lo w temperatures. Thi s i s certainly no t th e cas e fo r within-specie s comparisons ove r adaptationa l timescales , a s pointed ou t for Arenicola marina by Portner e t a l (1998), wh o cite d dat a showin g mitochondria l proliferation an d elevate d low-temperatur e metabolism fro m Nort h Se a t o Whit e Se a populations. However , within-specie s dat a ar e contradictory, with many species showin g lowered metabolisms in lowe r temperatur e population s (Clarke & Johnsto n 1999) . Dat a d o exis t whic h show tha t mitochondri a functio n mor e slowl y a t low temperature s (Guderle y 1998 ; Johnsto n et a l 1998). However , th e sam e proble m exist s her e a s for evaluation s o f whole-anima l metabolism ; namely tha t dat a o n mitochondria l maintenanc e costs ar e neede d fro m man y specie s ove r a wide temperature range before evolutionary implications can b e assessed . Th e presen t dat a o n bivalve s indicate that , ove r evolutionar y time , reduce d mitochondrial maintenanc e cost s shoul d no t b e ruled out. (2) Other physiological functions ma y be so reduced in low temperature species that the increment i n mitochondrial cost i s balanced. Thi s runs contrary to the Krogh hypothesis, in that if this is th e case , lo w temperatur e reduce s th e cost s o f functions, suc h a s nervou s conduction , io n exchange an d protei n turnover , t o suc h a n extent that overall costs are reduced. There are insufficien t data t o dra w conclusion s i n this respect ; however , as pointed out by Clarke & Johnston (1999), resting metabolism doe s represen t a cos t t o th e anima l which evolutio n shoul d b e expecte d t o minimize , and lowere d temperature s allo w organism s t o reduce suc h costs . (3 ) Whole animal maintenance costs are elevated at low temperatures but the increment i s to o small t o measure. Th e dat a o n bivalves produc e a mea n Q 10 valu e ove r th e 10-30°C temperatur e rang e o f 2.2 9 (S E = 0.54); the value for 0°C-5°C is 3.64 an d for this valu e to be lowere d t o 2.2 9 woul d requir e th e restin g metabolic rates of the polar bivalves in this study to be raise d b y 25% . Fo r a significan t elevatio n i n metabolic cost s abov e tha t predicte d b y a Q 10 of 2.29, published oxyge n consumption rates for polar species woul d hav e t o b e underestimate d b y 50-100%. It is possible tha t the metabolic rate s of

448

L. S . PEC K & L . Z . CONWA Y

the eigh t pola r bivalve s presente d her e ar e al l underestimated by 25-100%, but it is unlikely.

Temperature tolerances Although pola r ectotherm s ar e ofte n describe d a s stenothermal, dat a evaluatin g th e exten t o f thei r stenothermality ar e scarce , possibl y restricte d t o a handful o f publishe d report s (Somer o & DeVrie s 1967; Arnau d 1985 ; Pec k 1989 ; Portne r e t al 1999). Few , i f any , dat a exis t comparin g temper ature toleranc e envelope s fo r polar , temperat e an d tropical specie s withi n a give n taxonomi c group . Polar bivalv e mollusc s liv e withi n a temperatur e range o f -2-+4 t o +10°C , a n envelope o f 6-12°C (Fig. 5) . Conservativ e estimate s fo r temperat e species indicat e a n envelop e o f 15-30° C an d th e limited dat a for tropical bivalves sugges t the y may be abl e to surviv e over a range of 30-40°C. Thus, the temperature window in which polar species can exist is c. 2.5 to three time s smalle r tha n temperate and tropica l species , an d ma y b e u p t o si x time s smaller. Thes e limit s fo r surviva l hav e bee n associated wit h critica l temperature s (Somme r e t al. 1997 ) whic h ar e characterize d b y a transfe r t o anaerobic metabolism, and oxygen supply has been strongly implicate d i n settin g uppe r an d lowe r temperature limit s (Portne r e t al . 1998 , 1999 , 2000). The restrictio n i n temperatur e envelop e an d th e low metabolic rates are evolutionary adaptations. In studies o f this type one should be aware of the past history o f the environment. Data showing elevated metabolism a t low temperature s within species ar e investigating adaptational changes where costs may be higher because species colonizing lower temperature regime s nee d t o adap t t o reduce d tempera tures prio r t o losin g character s associate d wit h warmer habitats . I n thi s context , dat a fro m phylogenetically relate d specie s whic h hav e inhabited differin g therma l regime s ove r lon g evolutionary timescale s will be of more valu e than others. The long timescale over which the Antarctic marine environmen t has existe d i s possibly one of the best suc h cases an d specie s fro m suc h systems should b e give n precedenc e i n th e examinatio n o f the evolution of physiological characters. We thank the staf f o f th e Britis h Antarctic Surve y Signy Island Station, especially the diving officer Ro b Wood and the marin e assistan t Simo n Brockington . Jo n War d gav e invaluable assistanc e i n th e maintenanc e of stoc k i n th e UK.

References AHN, I.-Y. & SHIM, J. H. 1998. Summer metabolism o f the Antarctic clam , Laternula elliptica (Kin g an d Broderip) in Maxwell Bay, King George Island and

its implications . Journal o f Experimental Marine Biology an d Ecology, 224, 253-264. ANSELL, A. D. 1973 . Oxygen consumption by the bivalve Donax vittatus (Da Costa). Journal of Experimental Marine Biology and Ecology, 11 , 311-328. ARNAUD, P. M. 1985 . Essai de Synthese des particularites eco-biologiques (adaptations ) de s invetrebre s benthiques antarctiques. Oceanis, 11, 117-124. BAYNE, B. L. 1971 . Oxygen consumption b y three species of lamellibranc h mollus c i n declinin g ambien t oxygen tension . Comparative Biochemistry an d Physiology, 40A, 955-970. 1973. Th e response s o f thre e specie s o f bivalv e mollusc t o declinin g oxyge n tensio n a t reduce d salinity. Comparative Biochemistry and Physiology, 45A, 793-806 . 1976. Marine Mussels: Their Ecology an d Physiology. Cambridg e Universit y Press , Cambridge. , WIDDOWS , J . & NEWELL , R . I . E . 1977 . Physiological measurement s o n estuarin e bivalv e molluscs in th e field . In: KEEGAN , B. F. , CEIDIGH , P. O. & BOADEN , P . J . S.(eds ) Biology o f Benthic Organisms, Proceedings of the llth European Symposium o n Marine Biology. Pergamo n Press , Oxford, 57-68. BERNARD, F . R . & NOAKES , D . J . 1990 . Pumping rates, water pressur e an d oxyge n us e i n eigh t specie s o f marine bivalv e mollusc s fro m Britis h Columbia . Canadian Journal of Fisheries and Aquatic Science, 47, 1302-1306 . BRAND, M . D . 1990 . The contributio n o f th e lea k o f protons across the mitochondrial inner membrane to standard metaboli c rate . Journal o f Theoretical Biology, 145 , 267-286. BRICELJ, V . M. , EPP , J. & MALOUF , R . E . 1987 . Comparative physiolog y o f youn g an d ol d cohort s of ba y scallo p Argopecten irradians irradians (Lamarck): mortality , growt h an d oxyge n consumption. Journal o f Experimental Marine Biology an d Ecology, 112, 73-91 . CHAPELLE, G . & PECK , L . S . 1995 . Th e influenc e o f acclimation an d substratu m o n th e metabolis m o f the Antarcti c amphipod s Waldeckia obesa (Chevreux 1905 ) an d Bovallia gigantea (Pfeffe r 1888). Polar Biology, 15, 225-232. CLARKE, A . 1980 . A reappraisa l o f th e concep t o f metabolic col d adaptatio n i n pola r marin e invertebrates. Biological Journal o f th e Linnean Society, 14 , 77-92. 1983. Life in cold water: th e physiological ecology of polar marin e ectotherms. Oceanography Marine Biology Annual Reviews, 21, 341^-53. 1988 Seasonalit y i n th e Antarcti c marin e environment. Comparative Biochemistry an d Physiology, 90B , 461-473. & CRAME , J. A. 1992 . The Souther n Ocean benthi c fauna an d climat e change : a historical perspective . Philosophical Transactions of the Royal Society of London, 338B, 299-309. & JOHNSTON, N. 1999 . Scaling of metabolic rate and temperature i n teleos t fish . Journal o f Animal Ecology, 68, 893-905. DAME, R . F . 1972 . The ecologica l energetic s o f growth,

OXYGEN CONSUMPTIO N I N STENOTHERMA L ANTARCTI C BIVALVE S respiration an d assimilatio n i n th e intertida l American oyster , Crassostrea virginica. Marine Biology, 17 , 243-250. DAVENPORT, J. 1988 . Oxygen consumption and ventilation rate a t lo w temperature s i n th e Antarcti c protobranch bivalve mollusc Yoldia (= Aequiyoldia) eightsii (Courthouy) . Comparative Biochemistry and Physiology, 90A, 511-513. & WONG , T . M . 1992 . Effects o f temperatur e an d aerial exposur e o n thre e tropica l oyste r species , Crassostrea belcheri, Crassostrea iradelei an d Saccostrea cucullata. Journal of Thermal Biology, 17, 135-139 . DEATON, L. E. 1991 . Oxygen uptake and heart rate of th e clam Polymesoda carliniana Bos c i n ai r an d i n seawater. Journal o f Experimental Marine Biology and Ecology, 147, 1-7 . DETRICH, H . W . Ill , JOHNSON , K . A . & MARCHESE RAGONA, S . P . 1989 . Polymerisation o f Antarcti c fish tubulin s a t low temperature : energeti c aspects . Biochemistry, 28, 1 0 085-10 093. FORSTER, M . E. , FRANKLIN , C . E. , TAYLOR , H . H . & DAVISON, W . 1987 . Th e aerobi c scop e o f a n Antarctic fish , Pagothenia borchgrevinki, an d it s significance fo r metaboli c col d adaptation . Polar Biology, 8, 155-159 . GRIFFITHS, C . L . & GRIFFITHS , R . J . 1987 . Bivalvia. In : PANDIAN, T . J . & VERNBERG , F . J . (eds ) Animal Energetics, Volume 2, Bivavlia through Reptilia. Academic Press , San Diego, 1-88 . GUDERLEY, H . 1998 . Temperatur e an d growt h a s modulators o f th e metaboli c capacitie s o f fis h muscle. In: PORTNER , H.-O. & PLAYLE, J. (eds) Cold Ocean Physiology. Society for Experimental Biology Seminar Series, 66 . Cambridge Universit y Press, Cambridge , 58-87. HARDEWIG, L, VA N DIJK, P. L. M. & PORTNER, H. O . 1998. High energy turnover at low temperatures: recovery from exercis e i n Antarcti c an d commo n celpon t (Zoarcidae). American Journal o f Physiology, 274(R), 1789-1796 . HOLETON, G . F. 1974. Metabolic col d adaptatio n o f pola r fish: fac t o r artefact ? Physiologica l Zoology , 47 , 137-152. JOHNSTON, I. A., CALVO, J., GUDERLEY, H., FERNANDEZ, D. & PALMER , L . 1998 . Latitudinal variatio n i n th e abundance an d oxidativ e capacitie s o f muscl e mitochondria i n percifor m fishes . Journal o f Experimental Biology, 201, 1-12. , GUDERLEY , H . E. , FRANKLIN , C . E . CROCKFORD , T . & KAMUNDE , C. 1994 . Are mitochondri a subject to evolutionary temperatur e adaptation . Journa l o f Experimental Biology, 195, 293-306. KENNEDY, V . S . & MIHURSKY , J . A . 1972 . Effects o f temperature o n th e respirator y metabolis m o f thre e Chesapeake Ba y bivalves. Chesapeake Science, 13, 1-22. KIM, W . S. , HUH , H . T. , LEE, J.-H. , RUMOHR , H . & KOH , C. H . 1999 . Endogenous circatida l rhyth m i n th e manila cla m Ruditapes philipinarum (Bivalvia : Veneridae). Marine Biology, 134, 107-112 . KROGH, A . 1916 . Respiratory Exchange o f Animals an d Man. Longmans , Green , London . LOWE, G . A. & TRUEMAN, E. R. 1972. The heart and water

449

flow rate s o f My a arenaria (bivalvia : mollusca ) at differen t metaboli c levels . Comparative Biochemistry an d Physiology, 41A, 481-494. MACDONALD, B . A. & THOMPSON, R. J. 1986. Influence of temperature an d food availability o n the ecologica l energetics o f th e gian t scallo p Placopecten magellanicus. Marine Biology, 93, 37-48. MCKLUSKY, D. S . 1973 . The effec t o f temperature o n th e oxygen consumptio n an d filtration rat e o f Chlamys (Aequipecten) opercularis (L.) (Bivalvia). Ophelia, 10, 141-154. MINGOA-LICUANAN, S . S. 1993. Oxygen consumption and ammonia excretio n i n juvenil e Tridacna gigas (Linne, 1785) : effect s o f emersion . Journal o f Experimental Marine Biology an d Ecology, 171 , 119-137. NAVARRO, J . M . & WINTER , J . E . 1982 . Ingestion rate , assimilation efficiency , an d energ y balanc e i n Mytilus chilensis i n relatio n t o bod y siz e an d different alga l concentrations . Marine Biology, 67 , 255-266. PECK, L . S . 1989 . Temperature an d basa l metabolis m i n two Antarcti c marin e herbivores . Journal o f Experimental Marine Biology an d Ecology, 127 , 1-12. 2000. Ecophysiolog y o f Antarcti c marin e ectotherms: limit s t o life . Keynot e contribution , SCAR Ecolog y o f th e Antarcti c Sea-Ic e Zone , Bremerhaven, June 1999. Polar Biology, in press. & UGLOW , R . F . 1990 . Tw o method s fo r th e assessment o f the oxygen content of small volumes of seawater . Journal o f Experimental Marine Biology an d Ecology, 141, 53-62. PORTNER, H . O. , HARDEWIG , I. , SARTORIS , F . J . & VAN DIJK, P . L . M . 1998 . Energeti c aspect s o f col d adaptation: critica l temperature s i n metabolic , ionic an d acid-bas e regulation . In : PORTNER , H.-O. & PLAYLE , J . (eds ) Cold Ocean Physiology. Society for Experimental Biology Seminar Series, 66. Cambridg e Universit y Press , Cambridge , 88-120. , PECK , L . S. , ZIELINSKI , S . & CONWAY , L. Z . 1999. Intracellular p H an d energ y metabolis m i n th e highly stenotherma l Antarcti c bivalv e Limopsis marionensis a s a functio n o f ambien t temperature . Polar Biology, 22, 17-30 . , VA N DIJK, P. , HARDEWIG , I . & SOMMER , A . 2000 . Levels o f metaboli c col d adaptation : tradeoff s i n eurythermal an d stenotherma l ectotherms . In : DAVISON, W . & HOWAR D WILLIAMS , C . (eds ) Antarctic Ecosystems: Models for Wider Ecological Understanding. Caxto n Press , Christchurch , Ne w Zealand, in press. RALPH, R . & MAXWELL , J . H . G . 1977 . The oxyge n consumption o f th e Antarcti c lamellibranc h Gaimardia trapesina trapesina i n relatio n t o col d adaptation i n pola r marin e invertebrates . British Antarctic Survey Bulletin, 45, 41-46. RODHOUSE, R R . G . 1978 . Energy transformatio n b y th e oyster Ostrea edulis L . i n a temperat e estuary . Journal of Experimental Marine Biology and Ecology, 34, 1-22 . SCHOLANDER, P . R , FLAGG , W , WALTERS , V . & IRVING ,

L. 1953 . Climati c adaptatio n in Arcti c and

450

L. S . PEC K & L. Z . CONWA Y

tropical poikilotherms . Physiological Zoology, 26 , 67-92. SCHMID, M . K . 1996 . O n th e distributio n an d oxyge n consumption o f ecologicall y importan t benthi c animals in the waters around Svalbard. Berichte zur Polarforschung, 202 , 1-92 . SHAFEE, M . S . 1980 . Ecophysiological studies o n a temperate bivalve Chlamy s varia (L ) from Lanveoc (Bay o f Brest). PhD Thesis, Universite de Bretagn e Occidentale. SOMERO, G . N . & D E VRIES , A . L . 1967 . Temperatur e tolerance o f som e Antarcti c fishes . Science, 156 , 257-258. , FIELDS, P. A., HOFMANN, G . E., WEINSTEIN , R . B. & KAWALL, H. 1998 . Col d adaptation an d stenothermy in Antarcti c notothenioi d fishes : wha t ha s bee n gained an d wha t ha s bee n lost ? In: D I PRISCO, G. , PISANO, E. & CLARKE, A. (eds) Fishes o f Antarctica. A biologica l overview , Springer-Verlag , Milan , 97-109. SOMMER, A. , KLEIN , B . & PORTNER , H . O . 1997 . Temperature induce d anaerobiosi s i n tw o populations o f th e polychaet e wor m Arenicola marina. Journal o f Comparative Physiology, 167B , 25-35. TAYLOR, A. C . & BRAND , A . R . 1975 . Effect s o f hypoxi a and bod y siz e o n th e oxyge n consumptio n o f th e bivalve Arctica islandica (L.) . Journal o f Experimental Marine Biology an d Ecology, 19 , 187-196. TORRES, J . J . & SOMERO , G . N . 1988 . Metabolism , enzymic activitie s an d col d adaptatio n i n Antarctic mesopelagic fishes. Marine Biology, 98, 169-180. TREVALLION, A. 1971 . Studies on Tellina tenuis Da Costa .

III. Aspect s o f genera l biolog y an d energ y flow . Journal of Experimental Marine Biology and Ecology, 1 , 95-122. VAHL, O. 1978 . Seasona l changes i n oxygen consumptio n of th e Icelan d scallo p (Chlamys islandica(O.F. Muller)) from 70°N . Ophelia, 17, 1-24 . WELLS, R . M . G . 1987 . Respiratio n o f Antarcti c fishe s from McMurd o Sound . Comparative Biochemistry and Physiology, 88A , 411-424. WILSON, J . G . 1999 . Populatio n dynamic s an d energ y budget fo r a populatio n o f Donax variabilis (Say ) on a n expose d Sout h Carolin a beach . Journal o f Experimental Marine Biology an d Ecology, 239 , 61-83. & EKAIM , B . 1997 . Seasona l an d geographica l differences i n oxyge n consumptio n wit h temperature o f Cerastoderma glaucum an d a comparison wit h C . edule. Estuarine, Coastal an d Shelf Science, 45, 571-577. WOHLSCHLAG, D . E . 1964 . Respirator y metabolis m an d ecological characteristics o f som e fishe s i n McMurdo Sound , Antarctica . Antarctic Research Series o f th e American Geophysical Union, 1 , 33-62. WORRAL, C . M. , WIDDOWS , J . & LOWE , D . M . 1983 . Physiological ecolog y o f thre e population s o f th e bivalve Scrobicularia plana. Marine Ecology Progress Series, 12 , 267-279. ZIMMERMAN, C . & HUBOLD , G . 1998 . Respiratio n an d activity o f Arcti c an d Antarcti c fis h wit h differen t modes o f life : a multivariat e analysi s o f experimental data . In : D I PRISCO, G. , PISANO , E . & CLARKE, A. (eds) Fishes o f Antarctica. A Biological Overview. Springer-Verlag, Milano, 163-174 .

Phenotypic plasticit y o f burrowing dept h i n the bivalve Macoma balthica: experimenta l evidenc e an d general implication s PIM EDELAA R Netherlands Institute for Se a Research (NIOZ), P O Box 59, 7790 AB Den Burg, The Netherlands, (e-mail: [email protected]) and Centre for Ecological and Evolutionary Studies (CEES), University ofGroningen, PO Box 14, 9750 AA Haren, The Netherlands Abstract: Dept h o f burrowin g i n bivalves present s th e individua l wit h a trade-off : burrowin g more deepl y increase s safet y agains t predator s bu t shallo w burrowin g increase s foo d intake . Large variatio n i n burrowin g dept h exist s bot h betwee n an d withi n species . Thi s stud y investigated whethe r par t o f thi s variatio n i n dept h i n th e tellini d Macoma balthica ca n b e attributed t o phenotypic plasticity . A predatory cra b and food availabilit y wer e eithe r offered o r withheld i n separat e aquari a an d th e respons e i n burrowin g dept h measured . Individual s burrowed mor e deepl y i n th e presenc e o f a cra b bu t onl y t o shallo w depth s i n th e presenc e of food. Thi s suggest s tha t individual s ca n asses s thei r environmen t an d subsequentl y mak e decisions o n their burrowin g depth . Phenotypic plasticit y lik e thi s flexibl e anti-predatio n behaviou r i n M. balthica ca n hav e far ranging effects. I n the presence of predators burrowing depth increases, reducing energy uptake and subsequent growt h an d reproduction, wherea s increase d burrowing depth s reduces mortalit y by predation, furthe r affectin g prey an d predator population dynamics .

Many bivalve s burro w in relativel y sof t substrata , like sand , mud , peat o r eve n wood . Rapi d burrowing probabl y evolve d i n th e Siluria n an d became increasingl y common , especiall y durin g the Cretaceou s (Vermei j 1993) . I t i s no w widel y distributed amongs t severa l bivalv e familie s (e.g . Stanley 1970). Burrowing reduces predation risk by decreasing visibilit y an d accessibility t o predators . Decreased visibility lowers the rate of detection and decreased accessibilit y increase s handlin g times , making burie d pre y les s profitabl e (e.g. Zwart s e t al. 1996) . Burrowin g deepl y ma y eve n provid e a refuge agains t (some ) predator s (e.g . Blundo n & Kennedy 1982 ; Zwarts & Wanink 1993). But burrowing is no t just beneficial; amon g the conceivable disadvantages , bein g burie d deepl y within th e sedimen t reduce s th e acces s t o foo d resources lik e suspende d an d deposite d foo d particles. These resources are typically found in the water colum n o r a t th e substrate-wate r interface , i.e. som e distanc e awa y fro m th e burie d anima l (Kamermans 1994) . If burie d deepe r in the sediment, food uptake rates for a suspension feede r are likely to be reduced by the increased resistance of th e current s throug h th e outstretche d siphons . For a deposi t feeder , th e sedimen t surfac e are a available for deposit feeding will decrease owing to

the limitation s i n extensio n o f th e siphon . Whe n individual M. balthica were experimentally fixed at certain depth s i n th e sediment , fles h growt h decreased wit h increasin g burrowin g dept h (Fig.l: linea r regression ; proportio n fles h growth = 0.15 - 0.04 9 x burrowing dept h (cm), n=l26, /? 2 = 0.11, p = 0.0005 fo r constant , p = 0.0001 for slope) . Zakla n & Ydenberg (1997 ) found that food intake decreased with an increase in burrowing dept h whe n suspension-feedin g My a arenaria wer e positione d a t fixe d depth s i n th e sediment, whereas De Goeij & Luttikhuizen (1998) found th e same effect fo r growth in M. balthica. Burrowing depth therefor e ca n be regarded a s a trade-off betwee n predatio n ris k (cost ) an d foo d intake (benefit) . Fo r successfu l reproductio n a n animal has to survive and have energy available for gamete production; lifetime reproductive success in a sequentia l reproduce r i s th e summatio n o f th e reproductive output at age / times the probability to survive until age /, over all ages i (Steams 1992) . A rather generalize d mode l show s thi s graphicall y (Fig. 2) . Give n genera l assumption s abou t th e relationship betwee n burrowin g dept h an d foo d intake o r surviva l (eac h monotonousl y decreasin g and increasing , respectively , wit h increasin g depth), reproductiv e outpu t ca n b e maxima l a t

From: HARPER, E. M., TAYLOR, J. D. & CRAME, J. A. (eds) Th e Evolutionary Biology o f th e Bivalvia. Geological Society, London, Specia l Publications, 177 , 451^58. 1-86239-076-2/007 $ 15.00 © The Geological Society o f London 2000 .

452

P. EDELAA R

Fig. 1 . The effect o f experimentally fixe d burrowin g depth o n flesh growth i n Macoma balthica. Individual s collected in the field wer e positione d i n a wire mes h frame an d subsequently burie d o n an intertidal mudfla t from 2 8 April 199 9 unti l 1 8 May 1999 . Th e fram e enabled the m to reach the sediment surfac e wit h thei r siphons fo r respiration an d foraging, an d to mov e horizontally, bu t prevented the m fro m movin g vertically , thus fixing the depth i n the sedimen t a t which they lived. Flesh growth wa s estimated b y measuring th e final ash free dr y weight (AFDW) , and subtracting th e estimated initial AFD W (base d o n a regression equation o f AFDW measurements o f subsamples taken a t the star t o f the experiment v . shell length) . Fles h growth wa s defined a s the change in AFDW divided by the estimated initial AFDW. Se e text fo r statistics .

some intermediate burrowing depth. As a result of natural selection , burrowin g dept h ma y hav e evolved toward s thos e value s tha t maximiz e fitness. Figure 2 reflect s th e situatio n i n a constan t environment. Mor e realistically , environmenta l conditions var y bot h o n ecologica l an d evolu tionary timescales . Th e trai t valu e that maximize s fitness wil l therefor e var y too . Th e questio n o f interest is whether individual organisms ca n adjus t to change s i n optimu m trai t valu e b y modifyin g their phenotype (like depth of burrowing). Following th e framewor k o f quantitative genetics , th e phenotype o f a n individua l is usuall y divided int o the followin g additivel y contributin g components : genotypic valu e (al l additive , dominan t an d epistatic geneti c effects) ; commo n environmenta l effects (genera l effect s workin g o n al l individuals of a population equally) ; genotyp e x environment

interactions (no t al l genotype s respon d identicall y to a particula r environment) ; specifi c environ mental effect s (rando m deviation due to individual uniqueness i n tim e an d space ; i.e . unexplaine d variation) (Lync h & Wals h 1998) . Phenotypi c adjustment t o environmenta l variatio n i s possibl e for a n individua l i f th e commo n environmenta l effects and/o r genotyp e x environmen t interactio n statistically explai n par t o f th e variatio n i n phenotype betwee n individuals . Thi s ca n b e summed unde r th e ter m phenotypi c plasticity . I f such plasticit y doe s no t exist , change s i n th e environment ca n onl y b e tracke d b y natura l selection o n genotypi c values . Thus , phenotypi c plasticity can be viewed as any individual response to environmenta l chang e wit h respec t t o morphology, physiolog y o r behaviou r (als o including phenotypi c flexibility ; Piersm a & Lindstrom 1997) . Appropriate adjustment s ca n only be made if the means t o sens e an d proces s environmenta l information an d th e decision-makin g tool s hav e evolved (Dusenber y 1992) . I t i s know n tha t burrowing dept h differ s widel y betwee n specie s (e.g. Stanle y 1970) , bu t t o wha t exten t ha s phenotypic plasticit y i n thi s behaviou r evolved ? Can bivalve s respon d t o environmenta l change s that affect the costs and benefits of this behaviour? M. balthica, a smal l tellini d bivalve , is foun d mainly i n intertida l area s an d th e shallo w subtida l

Fig. 2 . Hypothetical relationshi p betwee n burrowin g depth an d survival, foo d intak e an d reproductive output . Burrowing increase s survival b y reduction o f predatio n risk bu t decreases food intake . Reproductiv e outpu t is a multiplication o f survival an d energy investment , s o reproductive outpu t is non-linearly related to burrowin g depth. Th e burrowing dept h tha t maximizes reproductiv e output wil l b e at some intermediat e value .

FLEXIBILITY O F BURROWIN G DEPTH I N M. BALTHICA

(at leas t i n Europe) . I t burrow s i n sof t sediments , usually muddy sands, and feeds both on suspended food particles , mainl y microalgae , a s wel l a s o n deposited foo d particle s an d diatom s growin g o n the sediment surface (Kamermans 1994) . Predators on adults includ e fishes , crab s an d birds. Predatio n is ofte n linke d t o th e siz e o f th e predators , wit h smaller predator s takin g smalle r M . balthica due to preference or even foraging constraints (e.g. Zwarts & Wanink 1993; See d & Hughes 1995) . Burrowing depth show s extrem e variability i n th e field , bot h between an d within sites (Zwart s & Wanink 1989 ; Piersma e t al. 1994) . I t i s not clea r t o wha t extent this phenotypi c variatio n represent s individua l responses t o environmenta l fluctuation s (phenotypic plasticity). In th e sectio n 'Experimenta l evidence' (below) , this stud y firs t explore s whethe r th e burrowin g depth o f M. balthica represents flexibl e behaviour , responsive to food and predators, or behaviour that is constan t fo r individuals . Implication s o f plasticity in depth of burrowing for shell formation, population dynamic s an d (i n general) evolution o f traits and species will then be discussed in 'General implications'.

Experimental evidenc e Methods Individual M . balthica wer e collecte d a t fiv e locations i n th e Dutc h Wester n Wadde n Se a an d were kep t fo r thre e month s fo r acclimatizatio n i n outdoor container s fille d wit h san d an d supplie d with unfiltered seawater. Suspende d foo d wa s thus available, but predators were excluded. At th e beginnin g o f th e experiment , thi n nylon threads, lengt h o f 1 0 cm an d wit h individuall y numbered labels, were glued to the right valve of a total o f 48 0 individual s wit h shel l length s o f 10-25 mm , following the method of Zwarts (1986). Subsequently, fou r randoml y assigne d individual s of eac h o f th e fiv e population s wer e release d i n each o f 2 4 aquari a (4 0 x 50 x 30 cm), containin g 15 cm o f sand y sedimen t an d 1 5 cm o f filtere d (food-free) water . N o renewa l o f wate r occurre d during th e experimen t bu t th e wate r wa s oxygenated continuously. The individuals were fre e to burro w i n th e sand . Burrowin g dept h wa s measured by gentl y pulling the threa d unti l it was perpendicular t o th e sedimen t surfac e an d unde r tension, an d the n pullin g the individua l out o f th e sand and measuring the length of thread which was buried underneat h the sediment . Th e sam e indivi duals were used during two manipulations, the firs t with predators present, and then with food present . Individuals tha t faile d t o burro w successfull y i n

453

either of the two manipulations were excluded fro m the analyses (33 out of 480, i.e. < 7% - thi s was due to poo r condition , damag e durin g handlin g o r th e valves becoming inadvertentl y glued together) . Comparing th e firs t an d secon d dept h o f burrowing o f eac h individua l i n th e tw o control s (i.e. no predators o r food present), it is clear tha t it is very consistently maintaine d i n these completely extracted individual s (Fig . 3 : Pearson' s r = 0.86, n = 111, p < 0.001). This indicates that this metho d of measurement does not cause disturbance and that the measure d dept h yield s relevan t informatio n concerning th e dept h i n th e sedimen t tha t a n individual occupies a t any point i n time during the experiment. The predator manipulation consisted of exposing the burie d M . balthica t o cue s fro m feedin g shorecrabs (Carcinus maenas). Separat e smal l mesh cage s with a closed floor were place d in the aquaria an d were stocke d wit h either a crab o r no crab, yieldin g n = 12 replicat e aquari a fo r eac h manipulation. Water was free t o move between th e crab cage and the rest of the aquarium, but the crab was prevente d fro m reachin g th e bivalves . Al l crabs wer e fe d wit h tw o M . balthica eac h day . Excrement an d prey remain s wer e prevente d fro m falling onto the sediment surfac e as the closed floo r of th e cra b cag e wa s fitte d wit h a smal l ledge . Burrowing dept h wa s firs t measure d afte r seve n days.

Fig. 3 . Repeatability of burrowing depth in Macoma balthica. Only individuals tha t wer e no t subjected t o food o r a crab i n both manipulation s wer e selected . Individuals wer e fre e to burrow twic e for seven day s and burrowing dept h was measured b y extracting th e individuals completely. See text for statistics.

454

P. EDELAAR

Subsequently, the crabs and cages were removed and th e bivalve s wer e replace d i n thei r aquariu m and allowe d t o re-burrow . Wate r wa s completel y replaced an d flowe d freel y i n orde r t o remov e potential chemica l predatio n cues . Afte r si x days , food wa s provide d t o th e M . balthica i n 1 2 out o f the 24 aquaria (balance d with regards to the previous manipulatio n t o avoi d unwante d correlatio n between th e foo d an d predato r manipulations) . Food wa s provide d b y addin g 0. 5 g o f finel y pulverized drie d spinac h t o lOOm L o f filtere d seawater an d pourin g thi s suspensio n int o th e aquarium. Pilo t experiment s showe d tha t M. balthica uses these fine particles a s food: th e water was cleared , an d inspectio n o f th e intestine s showed that the spinach was accepted a s food, an d not jus t remove d a s pseudo-faeces . Th e contro l manipulation consiste d o f th e additio n o f 10 0 mL of filtered seawater only . After two days, burrowing depth was measured and all individuals were stored frozen fo r subsequent analyses. The statistica l uni t used fo r two-facto r ANOV A was th e burrowin g dept h average d ove r al l individuals in a single aquarium. This i s necessar y because individual s wer e groupe d withi n a singl e aquarium an d th e measure d burrowin g depth s cannot be considered a s independent. Inspection of the mea n depth s reveale d tha t thei r distribution s were skewed. Transforming the data by calculating the logarith m resulte d i n ver y acceptabl e norma l distributions an d thes e transforme d value s wer e used for subsequent parametric statistica l analyses. Testing fo r th e effec t o f cra b an d foo d wa s per formed b y two-facto r ANOV A o n th e mea n burrowing depth s o f bot h manipulations . Bot h

factors, cra b an d food , wer e included i n the test of each o f th e tw o manipulation s i n orde r t o us e th e appropriate degree s o f freedom . Additionally , testing fo r th e effec t o f foo d wa s performe d b y testing fo r a difference betwee n th e two categories of th e foo d manipulatio n i n th e chang e i n averag e burrowing depth . Thi s chang e i n dept h wa s use d since i t represent s a muc h mor e sensitiv e measurement. Because burrowing depth was highly correlated betwee n th e two depth measurement s in individuals (Fig . 3) , the sam e i s tru e fo r th e mea n burrowing depth s o f th e aquaria , bu t variatio n between aquaria was large. By taking the change in burrowing depth as the response variable, this large but consisten t variatio n is accounte d for (as in a paired f-test) .

Results The averag e depth s o f th e firs t an d secon d measurements for each aquarium are plotted in Fig. 4. The output of the two-factor ANOVA on the firs t depth measurement , th e secon d measuremen t an d the chang e i n burrowin g dept h betwee n th e tw o measurements ar e give n i n Tabl e 1 . I t shoul d b e noted tha t i n th e ANOV A o f th e firs t dept h measurement, th e effec t o f foo d i s expecte d t o b e non-significant sinc e thi s wa s no t manipulated ; i t tests fo r systemati c error s i n the initia l desig n tha t might explai n late r significan t result s o f th e foo d manipulation. In th e firs t measurement , individual s burrowe d more deepl y whe n i n th e presenc e o f a cra b (mean = 38.7 mm) compare d t o n o cra b presen t (mean = 24.6 mm) (Fig . 4 : triangle s v . circles). I n

Fig. 4 . Aquarium mea n burrowin g depth s - firs t dept h measuremen t v . second depth measurement fo r each of the four treatments. I n the first manipulation , crab s wer e eithe r presen t (triangles ) or absent (circles ) . In the second manipulation, foo d wa s either present (closed symbols) o r absent (ope n symbols) . Se e text fo r statistics.

455

FLEXIBILITY O F BURROWIN G DEPT H IN M. BALTHICA

Table 1 . F- and p-va/wes of two-factor ANOVA o n first and second depth measurement, and on the change in burrowing depth ( n = 24 for al l tests) Treatment

First burrowing depth

Second burrowing depth

Change in depth

Crab

F, 20 = 73.6 p < 0.0001

F120 = 20.8 p = 0.0002

Fuo = 20. 3 p = 0.0002

Food

F120 = 2.18 n.s.

F120 = 2.63 n.s.

F 120 =19.4 p = 0.0003

Crab x foo d

F120 = 2.85 n.s.

F1>20 = 0.11 n.s.

F120 = 3.0 6 n.s.

n.s., non significant .

the secon d measurement , M . balthica overal l burrowed mor e deepl y (i.e . 9 2 ou t o f 11 1 for th e individuals o f Fig . 3) . Ther e wa s n o significan t effect o f the food manipulation on burrowing depth but, despit e th e fac t tha t th e crab s ha d bee n removed, th e effec t o f cra b presenc e wa s stil l significant. Whe n th e chang e i n burrowin g dept h was teste d for th e effec t o f food, i t was foun d tha t the chang e i n dept h wa s no t identica l fo r indivi duals fro m th e tw o feedin g categories; individual s burrowed les s deepl y i n th e presenc e o f foo d compared t o foo d no t bein g presen t (Tabl e 1 and Fig. 4: closed v. open symbols).

Discussion Variation in burrowing depth can be as large as two orders of magnitude (Fig. 3) . Most of this variation is probabl y explaine d b y difference s i n siz e an d condition, a s i s tru e i n fiel d sample s (Zwart s & Wanink 1993 ; pers . obs.) . Sinc e th e individual s were randoml y assigne d t o th e aquaria , n o syste matic differences betwee n manipulation categories were expected and indeed they were statistically fa r from significan t i n the analyses. More interesting is the fac t tha t burrowin g dept h i s highl y consisten t (Fig. 3) . Som e mechanis m ma y b e constrainin g burrowing depth s o r perhaps a preferred dept h fo r each individual exists. When comparing the second measurement of burrowing depth with the first one, it was foun d that mos t individual s burrowe d mor e deeply th e secon d time . Burrowin g dept h o f th e first measuremen t wa s therefor e no t (completely ) constrained, indicatin g tha t dept h i s ope n t o individual decisio n making . I t i s possibl e tha t individuals burrowed more deeply the secon d tim e as a resul t o f th e experienc e o f bein g completel y extracted fro m th e sedimen t an d handle d outsid e the water . Suc h experience s ma y indicat e ris k o f predation o r erosion. These experiment s sho w that , throug h varyin g their burrowin g depth , individual s respon d t o exposure to food an d predators. Shallow burrowing

became beneficia l a s foo d wa s added , wit h th e animals stayin g close r t o th e surface . Addin g a predator to the aquarium increase d the (perceived) costs of shallow burrowing, and the animals buried, on average , 57 % deeper . I s i t difficul t t o sa y ho w much th e increas e i n surviva l rat e woul d b e a s depth increase s fro m 2 5 t o 3 9 mm, sinc e thi s i s completely dependent on the foraging behaviour of the predato r - a complex functio n o f profitability and density of many classes o f potential prey types (e.g. Kreb s & Davie s 1987) . However , i t seem s highly likel y tha t i t wil l increas e surviva l rate , a s was foun d i n other studie s concerned wit h burrow depth an d predation ris k o f various predator s (e.g . Blundon & Kennedy 1982; Zwarts & Wanink 1993; Zwarts e t al. 1996) . Thi s i s especiall y s o a s shorecrabs forag e mainl y i n th e uppe r fe w centi metres of the sediment (pers. obs.). However, th e presenc e o f a cra b feedin g o n M balthica may not be directly causally related t o the increased burrowin g depth . Fo r instance , th e condition o f th e wate r i n th e tan k ma y hav e changed in biotic or abiotic parameters. A s feeding remains an d cra b excremen t wer e prevente d fro m falling ont o th e sediment , i t i s unlikel y tha t M . balthica wil l have fe d o n them . I t i s possibl e tha t bacterial loads increased, but since bacteria are also utilized as food sourc e by M. balthica (Kamermans 1994), a decreas e i n burrowing dept h woul d hav e been expecte d (i.e . a s in th e foo d additio n manip ulation). In contrast, an increase in burrowing depth when crab s wer e presen t wa s observed , an d therefore thi s possibilit y wa s dismissed . Simila r reasoning i s vali d fo r potentia l confoundin g b y abiotic variable s suc h a s oxyge n saturatio n an d detrimental chemicals. Due to the aeration, oxygen would no t hav e been limiting . I t i s known that M. balthica i s ver y abl e t o cop e wit h stressfu l situations withou t larg e change s i n surviva l o r functioning (Jah n e t al . 1997 ; Modi g & Olafsso n 1998). Moreover , whe n the chemica l environmen t deteriorates the usual response is to reduce burrowing depth, or even to leave the sediment completely (pers. obs.), and not to increase it .

456

P. EDELAA R

Individuals o f M. balthica, as ha s bee n demon strated befor e i n many other specie s (Lim a & Dill 1990), see m t o hav e th e capacit y t o adaptivel y respond t o change s i n th e environmen t that affec t the trade-of f betwee n foo d an d predatio n risk. Without dismissin g th e possibilit y tha t thi s trade off i s ope n t o natura l selectio n o n a longer , evolutionary, timescal e (Stearn s 1992) , the experiments sho w tha t thi s trade-of f i s ope n t o individual decisio n makin g (i.e . a behavioura l response to environmental input; Krebs & Kacelnik 1991). This ma y see m unexpecte d for a 'sluggish ' creature like a bivalve. However, there is one other study documentin g increase d burrowin g dept h under stimul i o f increased ris k o f predation. Here, Mya arenaria responde d t o variou s stimuli tha t mimicked increase d ris k o f predatio n b y re d roc k crabs (Zakla n & Ydenber g 1997) . Exactl y ho w bivalves sens e (chemically? ) an d process th e cue s presented to them is unclear (cf. Dusenbery 1992) . Also, it is not clear whethe r M. balthica responde d solely t o th e presenc e o f crabs , th e presenc e o f crushed and eaten conspecifics, or a combination of the two. This distinction is not an issue here as each of thes e source s o f informatio n indicate s a n increased risk . Rathe r the n speculatin g abou t th e mechanism, furthe r discussio n wil l focu s o n th e repercussions o f behavioura l plasticit y o n ecological an d evolutionary processes.

General implications Flexibility in anti-predation behaviour resulting in, for example , increase d burrowin g depth ma y hav e far rangin g ecological consequences . I f individuals find themselve s expose d t o greate r danger , con tinued increase d burrowin g dept h result s i n decreased foo d intake (Zakla n & Ydenberg 1997) . With les s energ y available , growt h slow s dow n (Fig. 1 ; De Goeij & Luttikhuizen 1998) . In specie s with growth rings spaced in time, this effect shoul d be visible , eve n afte r th e deat h o f th e individual . Decreased growth can affect shap e and thickness of the shel l (Vermei j 1978) . Moreover , shel l size , shape and thickness have been found t o be flexibl e anti-predation trait s to o (e.g . Appleto n & Palme r 1988; Crow l & Covic h 1990 ; Trussel l 1996) . Palaeontologists an d neontologist s shoul d avoi d interpreting suc h phenotypi c difference s betwee n populations a s geneti c difference s withou t du e acknowledgment o f th e possibilit y o f phenotypi c plasticity. No r shoul d the y attribut e suc h differ ences t o th e wron g environmenta l variables , suc h as a lo w foo d availabilit y tha t constrain s growt h instead o f hig h predato r densit y resultin g i n th e choice to grow slowly but remain safe. Information on predator abundanc e is usually collected directl y

(e.g. catches , fossi l counts ) o r indirectl y (e.g . b y determining the proportion of predated shells) . Yet, the leve l o f predator-induce d damag e o n shell s i s not necessaril y a reliabl e estimato r o f predato r density, a s a few predators ma y be ver y successful in a situatio n wher e bivalve s d o no t benefi t i n taking refuge a t the cost o f reduced food intake . Besides the effects o f flexibility i n behaviour o n individuals, populatio n dynamic s ca n als o chang e (Komers 1997) . Adaptive anti-predation behaviour changes outcome s o f simpl e populatio n dynami c models a s a consequenc e o f change d predatio n mortality rates (Fryxell & Lundberg 1997) . In more complex models , eve n withou t an y substantia l predation mortality, a population ca n even become extinct if reduced reproductive rates due to reduced food intak e canno t compensat e adul t mortalit y (Matsuda & Abrams 1994) . Especially i n situations where fertilization, larval survival , settlement, spa t and adult survival, or other demographic variables , are densit y dependent , adaptiv e change s i n anti predation behaviou r ca n seriousl y chang e pre y and/or predator population dynamics (e.g. Matsuda et al 1993 ; Jennings 1997 ; McCann et al 1998) . In summary, modeller s o f predator-pre y interaction s that hav e include d flexibilit y o f behaviou r hav e stressed its importance i n model outcomes . Unfortunately, hardl y an y fiel d measurement s and experiments have focused on these longer-term population consequences o f behavioural flexibility. Long-term experiments ar e hard to fun d an d prone to failure, an d it is almost impossible to desig n a n experiment tha t onl y affect s th e behaviou r o f a focal organis m an d no t al l othe r interactin g organisms too. Untangling the total response o f the populations int o th e causa l component s i s thu s extremely difficult; measurin g only the final overall change i s hardl y enlightening . Her e lie s a majo r task wit h whic h t o furthe r integrat e th e field s o f behavioural and community ecology. Finally, is there an effect o f phenotypic plasticity on th e evolutio n o f biodiversity ? Plasticit y help s organisms to cope with changes in the environment (Via e t al . 1995) . I f plasticit y cam e withou t cost s and limits , lif e woul d stil l hav e evolved bu t no t as we kno w it (DeWit t e t al 1998) . Cost s an d limit s can be found and measured in organisms in genetic, ontogenetic an d energeti c terms . I n a completel y stable environment , adaptiv e plasticity is expected to b e selecte d against , a s maintainin g th e geneti c coding fo r al l aspect s o f plasticity , a s well a s maintaining th e sensor y system s fo r monitorin g potential chang e i n th e environment , woul d b e energetically wastefu l (DeWit t e t al . 1998) . Th e mere presence of plasticity in an organism therefore already point s ou t tha t it s environmen t varie s sufficiently an d predictabl y enoug h t o 'justify ' it s evolution (e.g . Pijanowsk a e t al . 1993 ; Vi a e t al .

FLEXIBILITY O F BURROWIN G DEPT H I N M. BALTHICA 1995; Storfe r & Si h 1998) . Indeed , plasticit y i s higher i n specie s tha t liv e i n mor e variabl e environments (Komers 1997) . Plasticity ca n increase adaptivenes s i n more then one environment (Via et al. 1995) . Whe n plasticit y is perfect, variation in time o r spac e o f a particular potential selectiv e force does not result in evolution by mean s o f natura l selection . I n effect , th e fossi l record document s that species wit h (assumed) high levels o f adaptiv e phenotypi c plasticit y ar e mor e resilient an d less responsive to changes in selectiv e regimes (Sheldo n 1990) . Highly plastic specie s ar e diverging a t a lowe r rat e an d ar e evolutionar y longer live d the n les s plastic species . Intriguingly , in a recen t review , Jackso n & Cheetha m (1999 ) found tha t new specie s o f marine biot a aris e not by gradual chang e bu t b y 'punctuate d equilibria' ; quick shift s i n morpholog y wit h n o intermediat e types found i n the fossil record . Thi s indicate s tha t speciation come s about b y sudde n change s i n th e environment, lik e th e occurrenc e o f geographi c barriers wit h subsequen t allopatri c speciation , whereas th e inevitabl e mino r environmenta l changes apparentl y di d no t resul t i n speciation . This i s i n lin e wit h th e though t tha t plasticit y prevents speciation . The study of plasticity o f trait s (by means of experimental manipulations ) of living taxa migh t therefor e explai n som e o f th e evolu tionary pattern s o f stasi s v . adaptiv e radiatio n between differen t group s (Scare s e t al . 1998) . A s many species o f bivalves have a larval phase with a potentially ver y high dispersal capacity , high level s of plasticit y ma y indicat e realize d hig h level s o f dispersal an d gen e flo w (e.g . Parson s 1997 , 1998) , thus preventing local adaptatio n an d speciation . I would like to thank J. Drent, P. Luttikhuizen, T. Piersma, J. Van der Meer, D. Welink, W. Wolff, th e editors an d two anonymous referees , fo r comment s an d discussio n o n earlier versions . This study was supported by a PIONIER grant o f th e Netherland s Organizatio n fo r Scientifi c Research (NWO ) to T. Piersma. This is NIOZ publication 3482.

References APPLETON, R . D . & PALMER , A . R . 1988 . Water-borne stimuli release d b y predator y crab s an d damage d prey induc e mor e predator-resistan t shell s i n a marine gastropod . Proceedings o f th e National Academy o f Sciences, USA, 85, 4387-4391. BLUNDON, J . A . & KENNEDY , V S . 1982 . Refuges fo r infaunal bivalve s fro m th e Blu e crab , Callinectus sapidus (Rathbun) , predatio n i n Chesapeak e Bay. Journal of Experimental Marine Biology and Ecology, 65,67-81 . GROWL, T . A . & COVICH , A . P . 1990 . Predator-induced life-history shift s in a freshwater snail. Science, 247, 949-951. DE GOEIJ , P . & LUTTIKHUIZEN , P . 1998 . Deep-burying

457

reduces growt h i n intertida l bivalves : fiel d an d mesocosm experiment s wit h Macoma balthica. Journal of Experimental Marine Biology and Ecology, 228 , 327-337. DEWITT, T. , SIH , A. & WILSON , D . S . 1998 . Costs an d limits o f phenotypic plasticity. Trends i n Ecology & Evolution, 13,77-81. DUSENBERY, D. B. 1992 . Sensory Ecology. How Organisms Acquire and Respond to Information. Freeman, Ne w York. FRYXELL, J . M . & LUNDBERG , P . 1997 . Individual Behaviour & Community Dynamics. Chapma n & Hall, London. JACKSON, J . B . C . & CHEETHAM , A . H . 1999 . Tempo an d mode o f speciation i n the sea . Trends i n Ecology & Evolution, 14 , 72-77. JAHN, A., JANAS, U., THEEDE , H . & SZANIAWSKA , A. 1997. Significance o f body size in sulphide detoxification in th e Balti c cla m Macoma balthica (Bivalvia , Tellinidae) i n th e Gul f o f Gdansk . Marine Ecology Progress Series, 154, 175-183 . JENNINGS, S . 1997 . Aquatic lif e cycl e strategies : surviva l in a variabl e environment . Trends i n Ecology & Evolution, 12 , 384-385. KAMERMANS, P . 1994 . Similarit y i n foo d sourc e an d timing of feedin g in deposit - and suspension feeding bivalves . Marine Ecology Progress Series, 104, 63-75 . KREBS, J . R . & DAVIES , N . B . 1987 . An Introduction t o Behavioural Ecology. Blackwell, Oxford. & KACELNIK, A. 1991 . Decision making . In: KREBS , J. R. & DAVIES, N . B. (eds) Behavioural Ecology, An Evolutionary Approach. Blackwell , Oxford. KOMERS, P . E . 1997 . Behavioural plasticit y i n variabl e environments. Canadian Journal o f Zoology, 75 , 161-169. LIMA, S . L . & DILL , L . M . 1990 . Behavioural decision s made unde r th e ris k o f predation : a revie w an d prospectus. Canadian Journal o f Zoology, 68 , 619-640. LYNCH, M . & WALSH , B . 1998 . Genetics and Analysis o f Quantitative Traits. Sinaue r Associates , Inc. , Sunderland. McCANN, K. , HASTINGS , A . & HUXEL , G . R . 1998 . Weak trophic interaction s an d th e balanc e o f nature . Nature, 395, 794-798. MATSUDA, H . & ABRAMS , P . A. 1994 . Timid consumers : self-extinction du e t o adaptiv e chang e i n foragin g and anti-predato r effort . Theoretical Population Biology, 45 , 76-91. ,& HORI , M . 1993 . Th e effec t o f adaptiv e anti-predator behaviou r o n exploitative competitio n and mutualis m betwee n predators . Oikos, 68 , 549-559. MODIG, H . & OLAFSSON , E . 1998 . Responses o f Balti c benthic invertebrate s t o hypoxi c events . Journal o f Experimental Marine Biology an d Ecology, 229 , 133-148. PARSONS, K . E . 1997 . The rol e o f dispersa l abilit y in th e phenotypic differentiatio n an d plasticit y o f tw o marine gastropods . I . Shape . Oecologia, 110 , 461-471. 1998. The role o f dispersal ability in the phenotypic differentiation an d plasticit y o f tw o marin e

458

P. EDELAA R

gastropods. II . Growth . Journal o f Experimental Marine Biology an d Ecology, 221, 1-25. PIERSMA, T . & LINDSTROM , A . 1997 . Rapid reversibl e changes i n orga n siz e a s a componen t o f adaptiv e behaviour. Trends i n Ecology & Evolution, 12 , 134-138. , VERKUIL , Y . & TULP , I . 1994 . Resources fo r long distance migratio n o f knot s Calidris canutus islandica an d C . c . canutus: ho w broa d i s th e temporal exploitation window of benthic prey in the western an d easter n Wadde n Sea ? Oikos, 71 , 393-407. PIJANOWSKA, J. , WEIDER , L . J . & LAMPERT , W . 1993 . Predator-mediated genotypi c shift s i n a pre y population: experimenta l evidence . Oecologia, 96 , 40^2. SEED, R . & HUGHES , R . N . 1995 . Criteria fo r pre y size selection i n molluscivorou s crab s wit h contrastin g claw morphologies . Journal o f Experimental Marine Biology an d Ecology, 193, 177-195. SHELDON, P . R. 1990 . Shaking u p evolutionar y patterns . Nature, 245, 772. SOARES, A . G. , CALLAHAN , R. K . & DE RUYCK, A . M . C . 1998. Microevolutio n an d phenotypi c plasticit y i n Donax serra Rb'ding (Bivalvia: Donacidae) on high energy sand y beaches . Journal o f Molluscan Studies, 64,407-421. STANLEY, S . M . 1970 . Relation o f Shell Form t o Life Habits o f th e Bivalvia (Mollusca). Th e Geologica l Society o f America, Boulder , CO. STEARNS, S . C . 1992 . Th e Evolution o f Life Histories. Oxford Universit y Press, Oxford . STORFER, A . & SIH , A . 1998 . Gene flo w an d ineffectiv e antipredator behavio r i n a stream-breedin g salamander. Evolution, 52, 558-565.

TRUSSELL, G . C . 1996 . Phenotypi c plasticit y i n a n intertidal snail: the role of a common cra b predator . Evolution, 50 , 448-454. VERMEIJ, G . J . 1978 . Biogeography an d Adaptation. Harvard University Press , Cambridge , MA . 1993. A Natural History o f Shells. Princeto n University Press, Princeton , Ne w Jersey. VIA, S. , GOMULKIEWICZ , R. , D E JONG , G. , SCHEINER , S . M., SCHLICHTING , C . D . & VA N TlENDEREN, P . H .

1995. Adaptiv e phenotypi c plasticity : consensu s and controversy. Trends i n Ecology & Evolution, 10 , 212-217. ZAKLAN, S . D . & YDENBERG , R . 1997 . Th e bod y size-burial dept h relationshi p i n th e infauna l cla m Mya arenaria. Journal of Experimental Marine Biology an d Ecology, 215, 1-17 . ZWARTS, L . 1986 . Burying dept h o f th e benthi c bivalv e Scrobicularia plana (Da Costa) in relation to siphon cropping. Journal o f Experimental Marine Biology and Ecology, 101, 255-289. & WANINK , J . H . 1989 . Siphon siz e an d buryin g depth i n deposit - an d suspension-feedin g benthi c bivalves. Marine Biology, 100, 227-240. & 1993 . How th e foo d suppl y harvestable b y waders in the Wadden Se a depends o n the variation in energ y density , bod y weight , biomass , buryin g depth an d behaviou r o f tidal-fla t invertebrates . Netherlands Journal o f Se a Research, 31 , 441-476. , ENS, B . J., GOSS-CUSTARD, J . D., HULSCHER, J. B. & LE V . DI T DURELL , S . E . A . 1996 . Cause s o f variation i n pre y profitabilit y an d it s consequences fo r th e intak e rat e o f th e Oystercatcher Haematopus ostralegus. Ardea, 84A, 229-268.

Herring gulls feeding on a recent invader in the Wadden Sea, Ensis directus GERHARD C . CADEE Netherlands Institute for Se a Research (NIOZ), P O Box 59, 7790 AB Den Burg, The Netherlands (e-mail: Cadee@ nioz.nl) Abstract: The American razor clam Ensis directus has been a successful non-indigenou s invader in the Wadden Sea since the late 1970s . It often show s poorly understood mass mortalities i n the winter half-year, which are also known from it s native area. During such mass mortalities Ensis directus partly leaves its burrow and, as it is unable to re-burrow, is an easy prey for herring gulls during low tide. During a mass mortality in March 1999 , Ensis consumption by herring gulls was studied. Shel l fragmentatio n was achieve d b y shakin g th e shel l vigorously , not b y hammering . This caused characteristic shel l fragmentation rangin g from smal l fragments broke n fro m on e or both valve s nea r the middle , t o bot h valve s broken nea r th e middle , bu t stil l connecte d b y th e ligament. About one-quarter of the shells remained undamaged. No other predators are known to produce simila r Ensis shel l fragments . I n taphonomi c studie s th e importanc e o f predator s i n fragmenting shell s should be taken into account.

Invasions by exotic species into coastal zones have escalated i n recen t years , mainl y du e t o increase d human activitie s suc h a s ballast-wate r transpor t (Carlton & Gelle r 1993) . I n th e ne w environmen t these invader s ofte n sho w populatio n explosion s due t o th e absenc e o f thei r natura l predators , parasites an d diseases . Thei r succes s ma y distur b the nativ e ecosystem , e.g . a s illustrate d b y th e invasion of the ctenophore Mnemiopsis leidyi i n the Black Sea leading to a collapse o f pelagic fisheries (Gesamp 1997) . Althoug h n o report s exis t o n extinction o f nativ e marin e specie s relate d t o invasions, successfu l invader s cause d disappear ance o f th e origina l communities . A s a result , natural biodiversit y a t th e communit y an d eco system level decreased (Carlto n 1996) . Apar t fro m these negativ e effects , invader s offe r ne w opportunities to study aspects of species richness in ecosystem processes , a topi c of discussio n in biodiversity studie s (e.g . Lawto n 1997) , an d als o relations between invasions and extinction of native species (e.g. Vermeij 1989) . Finally, these invasions offer opportunitie s t o stud y th e evolutio n o f predator-prey relations . Fo r example , Vermei j (1982) studie d possible increas e i n shel l thicknes s of Littorina littorea shells afte r introductio n of th e predatory cra b Carcinus maenas o n America n shores. In thi s paper , th e reactio n o f on e predator , th e herring gul l (Larus argentatus Pontoppidan) , to^ a

recent invader , th e America n razo r cla m Ensis directus (Conrad) , i n th e Dutc h Wadde n Sea , i s reported. Whether this predator produces character istic shel l fragments , usefu l i n taphonomi c studie s that tr y t o differentiat e betwee n biologica l an d physical agents in the production of shell fragments (Parsons & Bret t 1991 ; Cade e 1968 , 1994 , 1995 , and refs cite d therein), was also studied . The American razor clam Ensis directus has been a successfu l ballast-wate r invader in the North Se a coastal are a sinc e the late 1970s . Its disseminatio n has been studied regularly and more papers are now written on this species in its new habitat than in its native area (Beukema & Dekker 1995 ; Armonies & Reise 1999) . E . directus show s characteristic mas s mortalities i n th e winte r half-yea r an d suc h mortalities ar e poorl y understoo d (Muhlenhardt Siegel et al 1983 ; Cade e e t al 1994 ; Armonie s & Reise 1999) ; they have been related, amongst othe r things, to: parasites ; th e influenc e of cold periods ; energy depletion afte r spawning . Comparable mas s mortalities i n sprin g als o occu r i n it s nativ e are a (e.g. i n th e Gul f o f S t Lawrence ; E . Kenchingto n pers. comm.) . Durin g suc h mas s mortalitie s E . directus protrudes a t least hal f its length above th e sediment an d i s unabl e t o re-burro w (Cade e & Cadee-Coenen 1994 ; Armonie s & Reise 1999 , fig. 3). This makes them an easy prey for herring gulls, which otherwis e woul d b e unabl e t o collec t thi s normally rapidl y burrowin g bivalv e (Cade e &

From: HARPER , E. M., TAYLOR, J. D. & CRAME, J. A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Specia l Publications, 177, 459-464 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y of London 2000.

460

G. C . CADE E

Cadee-Coenen 1994) . Probabl y onl y som e oystercatchers specialize d fo r feedin g o n E . directus ar e abl e t o catc h health y specimen s (Swennen e f 0/ . 1985) .

Methods Observations o n herrin g gull s consumin g Ensis directus were made i n early March 199 9 alon g th e Wadden Sea dyke of the souther n part of the island of Texel , the Netherlands. Between 1 and 5 March 1999 al l shell s tha t accumulate d alon g th e dyk e studied (an d stil l containin g part s o f th e adducto r muscles) wer e collected. In this way, a total o f 750 Ensis specimen s wer e collecte d fo r th e stud y o f fragmentation. O f these , 20 0 wer e use d fo r lengt h measurements (wit h vernie r callipers ) an d ag e determination (usin g annual rings). Th e pictur e of the Ensis shell s (Fig . 2 ) was made by a direct sca n method usin g a Hewlet t Packar d Flatbe d scanne r (ScanJet 620 0 C). Direc t scannin g has als o prove d to be very efficien t metho d fo r objects tha t ar e not completely flat , suc h a s Ensis shell s (se e als o Bromley & Richter 1999) .

Results Processing Ensi s by herring gulls Herring gulls were observed t o collect Ensis during low tide . The y swa m aroun d i n area s o f som e 40 cm o r les s wate r depth, lookin g fo r protrudin g Ensis. Onc e the y had discovere d one , the y trie d t o collect th e specime n b y diving . Herrin g gull s ar e not true divers and cannot disappear entirel y belo w the wate r surface . T o get momentu m the y firs t lif t themselves somewha t ou t o f th e wate r an d the n dive fo r th e Ensis. Onc e the y ha d collecte d a specimen the y brough t i t t o th e neares t dr y place , flying wit h the Ensis squar e in the beak. Alon g the Wadden Sea dyke this dry place wa s the foot of the dyke (Fig . 1) . After arrival the y starte d shakin g th e Ensis in their beak fo r some seconds , subsequentl y dropping i t an d tryin g t o consum e th e fles h protruding fro m th e shell . Thi s proces s o f shakin g and droppin g wa s repeate d severa l times . I n general, 1- 2 min wer e sufficien t t o consum e th e Ensis, leaving only the empty shell. If it took longer this was usually due to disturbance by other herring gulls. Th e whol e proces s o f shakin g an d droppin g the pre y i s ver y simila r t o thei r handlin g o f shorecrabs (Carcinus maenas).

Fig. 1 . Herring gull (jus t arrived ) a t the foot o f the Wadden Se a dyke wit h Ensis directus squar e in its beak and starting t o shake Ensis to free th e flesh; specime n stil l undamaged . I n the background ar e empty specimen s of Ensis left ove r by herring gulls . [Drawin g kindl y mad e by Sytsk e Dijkse n (Texel)] .

461

HERRING GULL S AN D ENSIS DIRECTUS

Fragmentation Shaking o f th e shell s b y herrin g gull s cause d damage in the middle part of the valves. Gulls were observed als o t o hac k a t th e shell s whe n the y ha d dropped the m on the ground afte r shaking , but this was mainl y t o cut the adducto r muscle s o r remove flesh attache d to the shells , no t to break th e shells . The amoun t o f resultin g fragmentatio n wa s variable, wit h fou r grade s o f damag e bein g discernable (Fig. 2 and Table 1) . About one-quarter of th e shell s showe d n o damag e a t all ; thes e wer e apparently specimen s whic h opene d easil y an d which ha d los t th e fles h earl y i n th e handlin g (shaking) process, probabl y becaus e the y had bee n dead fo r som e time . I n th e remainin g three quarters, however, shel l damag e wa s apparent; this varied from smal l damage to one or both shells, via one valv e broken i n th e middle , t o bot h valve s broken in the middle. I n all cases the anterior parts of th e valve s wer e stil l connecte d b y th e ligamen t (Fig. 2).

Size-frequency distribution and growth The averag e lengt h o f 20 0 specimen s o f Ensis consumed wa s 139. 5 m m (standar d deviatio n 13.4 mm); th e rang e wa s 82.8-168. 5 mm (Fig . 3) . Based on the counts of the annual rings (not clearly visible i n al l specimens , du e t o th e formatio n o f disturbance rings) , th e majorit y consiste d o f specimens from the 199 6 (45.5%) and 199 4 cohort s (34%) - thei r size-frequenc y distribution s ar e given separately in Fig. 3 . As found i n most earlie r mass mortalitie s o f Ensis directus, thi s mortalit y was mainl y restricte d t o olde r animal s (Muhlenhardt-Siegel et al 1983 ; Cadee et al 1994 ; Armonies & Reis e 1999) ; thi s als o applie s t o mortalities i n thei r nativ e land s i n th e Gul f o f S t Lawrence (E . Kenchingto n pers . comm.) . Onl y Armonies & Reise (1999 ) repor t mas s mortality in cohorts o f < 1 yea r ol d observe d i n th e lowe r intertidal o f Konigshave n (Sylt , Germany ) i n March 198 0 an d February 198 2 (bu t apparently not observed since) .

Fig. 2 . The four grades of shell damage discerned (fro m top to bottom): undamaged; small damage in the middle part of one or both valves, on e valve broken ; both valves broken. Length of top specimen, 142. 2 mm .

By measuring annua l rings on the shells, growt h of th e 199 4 an d 199 6 cohort s coul d b e estimated , and in Table 2 these data are compared wit h growth data fo r othe r cohort s o f Ensis directus fro m th e same tidal-fla t are a borderin g th e souther n par t of Texel, the Schanserwaar d an d elsewhere. I t can b e seen tha t there i s a large variatio n in growth i n the first year , bu t thi s the n diminishe s i n late r years . Growth dat a fal l withi n th e rang e observe d i n European coastal water s (Dorjes 1992 ; Beukema & Dekker 1995 ; Rasmusse n 1996) . I t seem s high , however, whe n compare d wit h th e fe w publishe d data on growth (onl y given for the firs t year ) in its native land , o f c . 3 0 mm (McDermot t 1976 ; Kenchington et al. 1998) .

Table 1 . Type an d presence of damage i n 75 0 Ensis directu s specimens consumed b y herring gulls Grade of damage

Number

No damage One or two valves slightl y damaged One valve broken in the middle Both valve s broke n in the middl e

198 156 196 200

26.4 20.8 26.1 26.7

Total

750

100.0

Percentage

462

G. C . CADE E

Fig. 3 . Size-frequency distributio n of 200 specimens o f Ensis directus consumed b y herring gull s between 1 and 5 March 1999 . Size-frequenc y distributio n o f 199 4 ( n = 68) and 199 6 ( n = 91) cohorts (th e bulk of the sample ) ar e als o given separately .

Discussion In the Wadden Sea, the optimal zone for E. directus is th e lower , rarel y emerging , regio n o f th e intertidal and the upper subtidal zones, in relatively exposed area s wit h almos t silt-fre e sediment s (1 % or les s < 60 (am). This are a i s generall y poo r i n macrobenthos an d thu s ma y hav e provide d a n 'empty' nich e fo r thi s rapidl y burrowin g bivalv e adapted t o maintai n it s positio n i n a n expose d habitat (Beukema & Dekker 1985) . I t is apparently also relatively undisturbed here by predators. Onl y some oystercatcher s ar e specialize d i n feedin g o n Ensis (Swenne n e t al. 1985) , bu t the y ca n reac h only th e intertida l specimens . Herrin g gulls , an d probably als o eiderducks , fee d onl y o n protrudin g specimens durin g mas s mortalitie s (Cade e &

Cadee-Coenen 1994 ; thi s study) . Herrin g gull s either collec t suc h specimen s themselve s durin g low tid e (th e mai n metho d observe d i n Marc h 1999) or by stealing them from eiderducks wh o had collected the m b y divin g (observe d frequentl y i n 1994; Cade e & Cadee-Coenen 1994) . Predatio n o n these dyin g Ensis wil l not influenc e densit y o f the population. The omnivorous herring gull, and more specialized mollusca n predator s suc h a s oyster catcher an d eiderduc k (Swenne n e t al . 1985) , rapidly adde d thi s invader t o their diet . Invasion o f E . directus starte d i n a perio d o f increasing phytoplankton primary production in the Wadden Sea , doublin g i n th e lat e 1970 s an d remaining hig h i n th e 1980 s an d 1990 s (Cade e 1986; Cade e & Hegeman 1993 ; Cade e pers . obs.) . Besides it s occupatio n o f a n empt y niche , thi s

Table 2. Position o f annual rings in various cohorts* (first column) o f Ensi s directu s Year-class

n

1st ring mm (SD)

2nd ring mm (SD)

3rd ring mm (SD)

4th ring mm (SD)

1984 1988 1991 1994 1996

200 31 100 68 91

48.4(11.1) 26.4 (4.5 ) 59.2 (10.5 ) 73.5(13.1) 49.0 (15.3 )

98.5 (15.3 ) 80.4 (6.3 ) 120.5(7.1) 120.7 (8.8 ) 112.4(11.9)

124.2(11.6) 124.5 (5.4 ) 134.5 (7.1 ) 133.4 (7.9) ) 133.5 (8.8 )

133.7 (10.9 ) 144.6 (5.9 )

147.2 (8.3 )

5th ring mm (SD)

151.2(8.9)

Reference Cadee 198 9 Swennen 199 2 Cadee e t al, 199 4 Present stud y Present stud y

*A11 specimens from th e sam e tidal flat (Schanserwaard) bordering the souther n part of the island of Texel, based o n published dat a and this study, n, Number of shells used; SD, standard deviation of measurements .

HERRING GULL S AN D ENSIS DIRECTUS might have favoured its successfu l development i n the Dutc h coasta l area , wher e i t woul d hav e t o compete wit h othe r suspensio n feeder s suc h a s mussels an d cockles . However , usin g thei r long term monitorin g programme s (1970-1990 ) Beukema & Cadee (1997) were able to indicate that food limitatio n fo r macrozoobentho s i n th e Balgzand, a well-studie d are a o f th e wester n Wadden Sea, only occurred in the middle part of the intertidal zon e an d no t i n th e lowe r par t inhabite d by E. directus, where exposure to currents and wind limited macrobenthos. E. directus shel l fragment s produced b y herrin g gulls ar e characteristi c fo r thi s predator . Ensis consumed b y oystercatcher s onl y showe d damag e to the posterior par t of the shell (C . Swennen, pers. comm.). Thi s add s anothe r exampl e t o th e lis t o f characteristic predato r mark s produce d o n shell s (e.g. Vermei j 1978 , 1987 ; Cadee e t al 199 7 and refs cited therein). The broken Ensis directus shells reported b y Rasmusse n (1996 ) fro m th e Isefjor d (Denmark) wer e mor e heavil y fragmente d tha n those consume d b y oystercatchers , an d i t i s likel y that thi s fragmentatio n wa s als o du e t o herrin g gulls. The specimens wer e collected i n April 1994, when a n enormou s mas s mortalit y o f Ensis als o occurred i n the Wadden Sea (Cadee et al 1994 ; de Wolf & Cade e 1995) , causin g muc h highe r numbers of dead Ensis than in March 1999 . This stud y indicates the importance o f predator s in producin g shel l fragments . Biologica l factors , and i n particula r predation , ar e mor e importan t i n shell fragmentatio n i n th e Wadde n Se a tha n ar e physical factors (Cadee 1994,1995) . In taphonomic studies the role o f predators i n shel l fragmentation should be taken into account. Although i n the past, 2 6 non-indigenous macrobenthic species , includin g E . directus, hav e bee n introduced b y humans , successfull y invadin g German an d Dutch coastal waters , thi s has not ye t led t o drasti c change s i n th e functionin g o f th e ecosystem (Nehrin g & Leuch s 1999) . Ther e are , however, indications that the native Ensis species in the coasta l zon e o f th e ope n Nort h Sea , no t discussed in this study, are declining, as fresh shell s are becomin g rare r i n beac h drift , wherea s E . directus ha s becom e a n abundan t shel l o n th e beaches. This is part of a larger low-budget project in shell damage and shell repair of the Paleobiology departmen t of NIOZ; it i s NIOZ publicatio n no . 3485 . Withou t th e hel p o f herring gulls , alertin g m e t o th e mas s mortalit y o f Ensis directus an d als o providin g m e wit h th e Ensis material , this stud y woul d hav e bee n impossible . I a m furthe r grateful t o Sytsk e Dijkse n for the drawin g of the herrin g gull handling an Ensis directus, and to Jan Beukema, Joh n Davenport, Alistair Cram e and an anonymous referee fo r critically reading the manuscript.

463

References ARMONIES, W . & REISE , K . 1999 . On th e populatio n development o f th e introduce d razo r cla m Ensis americanus nea r th e islan d o f Sylt . Helgoldnder Meeresuntersuchungen, 52 , 291-300. BEUKEMA, J. J. & DEKKER, R. 1995 . Dynamics and growth of a recent invader into European coastal waters: the American razor clam, Ensis directus. Journal o f th e Marine Biological Association o f th e UK, 75 , 351-362. & CADEE , G . C . 1997 . Local difference s i n macrozoobenthic respons e to enhanced foo d suppl y caused b y mil d eutrophicatio n i n a Wadde n Se a area: foo d i s onl y locall y a limitin g factor . Limnology an d Oceanography, 42, 1424-1435. BROMLEY, R . G . & RICHTER , B . 1999 . Direkt e skanning : Ny technik ti l illustrerin g a f geologisk e materiale . Geologisk Tidsskrift, 1998(4) , 1-10 . CADEE, G . C . 1968 . Mollusca n biocoenose s an d thanatocoenoses i n the Ria de Arosa, Galicia, Spain . Zoologische Verhandelingen Leiden, 95 , 1—121 . 1986. Increased primary production in the Marsdiep. Netherlands Journal o f Se a Research, 20, 285-290. 1989. Size-selective transpor t o f shells by birds an d its palaeoecologica l implications . Palaeontology, 32, 429-437. 1994. Eider, shelduck , and other predators, the main producers o f shel l fragment s i n th e Wadde n Sea: palaeoecological implications . Palaeontology 37 , 181-202. 1995. Bird s a s producer s o f shel l fragment s i n th e Wadden Sea , in particula r th e rol e o f th e Herrin g gull. Geobios, Memoir Special, 18 , 77-85. & CADEE-COENEN, J . 1994 . Hoe Zilvermeeuwe n Amerikaanse zwaardschede n (Ensis directus) vangen. Correspondentieblad de r Nederlandse Malacologische Vereniging, 278, 64-67. & HEGEMAN , J . 1993 . Persisting hig h level s o f primary productio n a t declinin g phosphat e concentrations in the Dutch coastal are a (Marsdiep) . Netherlands Journal o f Se a Research, 31, 147-152 . , CADEE-COENEN , J . & WITTE , J . IJ . 1994 . Massal e sterfte va n Ensis directus o p d e Schanserwaar d e n elders blijf t raadselachtig . Correspondentieblad de r Nederlandse Malacologische Vereniging, 279 , 86-93. , WALKER , S . E . & FLESSA , K . W 1997 . Gastropo d shell repai r i n th e intertida l o f Bahi a l a Choy a (N. Gul f o f California) . Palaeogeography, Palaeoclimatology, Palaeoecology, 136 , 61-IS. CARLTON, J. T . 1996 . Marine bioinvasions : th e alteratio n of marin e ecosystem s b y nonindigenou s species . Oceanography, 9 , 36-43. & GELLER , J . B . 1993 . Ecological roulette : th e global transpor t o f nonindigenou s marin e organisms. Science, 261, 78-82. DE WOLF , P . & CADEE , G . C . 1995 . Shells o f Ensis directus o n th e beache s o f Texel . Annual Report 1994 Netherlands Institute for Se a Research, 74-75. DORIES, J . 1992 . Die amerikanisch e Schwertmusche l Ensis directus (Conrad) in den Deutschen Bucht. III. Langzeitentwicklung nac h1 0 Jahren . Senckenbergiana Maritima, 22, 29-35.

464

G. C . CADE E

GESAMP (IMO/FAO/UNESCO-IOC/WMO/WHO / IAEA/UN/UNEP JOIN T GROU P O F EXPERT S O N THE SCIENTIFIC ASPECT S O F MARIN E ENVIRONMENTA L

PROTECTION). 1997 . Opportunistic settler s an d th e problem o f th e ctenophor e Mnemiopsis leidyi invasion i n th e Blac k Sea . GESAMP Reports an d Studies, 58, 1-84 . KENCHINGTON, E., DUGGAN , R . & RIDDELL, T . 1998 . Early life histor y characteristic s o f th e razo r cla m (Ensis directus) an d th e moonsnai l (Euspira spp. ) with applications t o fisheries an d aquaculture. Canadian Technical Report of Fisheries and Aquatic Sciences, 2223, 1-32 . LAWTON, J . H . 1997 . The rol e o f specie s i n ecosystems : aspects o f ecologica l complexit y an d biologica l diversity. In : ABE , T., LEVIN , S . A . & HIGASHI , M . (eds) Biodiversity: A n Ecological Perspective. Springer, New York, 215-228. MCDERMOTT, J. J. 1976 . Predation of the razor clam Ensis directus b y th e nemertea n wor m Cerebratulus lacteus. Chesapeake Science, 17, 299-301. MUHLENHARDT-SlEGEL, IL , DORJES , J . & VO N COSEL, R .

1983. Di e amerikanisch e Schwertmusche l Ensis directus (Conrad ) i n de r Deutsche n Bucht . II . Populationsdynamik. Senckenbergiana Maritima, 15,93-110. NEHRING, S . & LEUCHS , H . 1999 . Neozoa (Makrozoo benthos) a n de r deutsche n Nordseektist e - Ein e Ubersicht. Bundesantalt fu r Gewasserkunde, Koblenz, Bericht BfG, 1200, 1-131.

PARSONS, K . M . & BRETT , C . E . 1991 . Taphonomi c processes an d biase s i n moder n marin e environments: a n actualistic perspectiv e o n fossi l assemblage preservation . In : DONOVAN , S . K . (ed.) The Processes o f Fossilization. Belhave n Press , London, 22-65 . RASMUSSEN, E . 1996 . Ny t o m de n amerikansk e knivmuslin (Ensis americanus Goul d 187 0 ( = E. directus (Conrad) ) i dansk e farvande . Flora o g Fauna, 101 , 53-60. SWENNEN, C . 1992 . D e groe i va n d e Amerikaans e zwaardschede (Ensis americanus) in de Waddenzee. HetZeepaard, 52 , 129-131 . , LEOPOLD , M . F . & STOCK , M . 1985 . Note s o n growth an d behaviou r o f th e America n razo r cla m Ensis directus in the Wadden Se a and the predatio n on it by birds. Helgoldnder Meeresuntersuchungen, 39,255-261. VERMEIJ, G . J . 1978 . Biogeography an d Adapatation. Harvard University Press, Cambridge , MA . 1982. Environmenta l chang e an d th e evolutionar y history o f th e periwinkl e (Littorina littorea) i n North America. Evolution, 36, 561-580. 1987. Evolution an d Escalation. Princeto n University Press, Princeton NJ . 1989. Invasion and extinction: th e last three million years of North Sea pelecypod history . Conservation Biology, 3, 274-281.

Marine mussels, their evolutionary success, ecological significanc e and use as chronometers o f environmental chang e R. SEED, C. A. RICHARDSON & K. SMITH School of Ocean Sciences, University of Wales-Bangor, Menai Bridge, Anglesey LL59 5EY, UK (e-mail: r.seed@ bangor.ac.uk) Abstract: Th e evolutio n o f the heteromyaria n for m an d neotenous retentio n o f the byssus into the adult stage were central to the colonization o f hard substrata and the subsequent evolutionary success o f epibyssate mytilids . In addition, these mussels ar e suprem e filter feeder s an d exhibi t many structural , behavioura l an d life-histor y trait s whic h mak e the m particularl y successfu l colonizing species . A s competitivel y dominan t species , mussel s ca n potentiall y monopoliz e epibenthic communities with a consequent reduction in diversity of the primary space-occupyin g species. However, mussel patches themselves are extremely diverse, offering numerou s resources which are exploited by a range of associated organisms from most animal phyla. Mussel beds can influence large-scale coasta l and estuarine processes suc h as productivity and eutrophication, and can significantly alter sedimen t biogeochemistry. Annual growth lines an d tidal bands in mussel shells have been used to estimate age, and to investigate the effects o f environmental factors such as seawate r an d ai r temperature , spring-nea p luna r tida l cycle s an d exposur e t o chlorination regimes i n powe r statio n culverts . Analysi s o f th e elementa l compositio n o f th e incrementa l record i n long-live d mytilid s ha s bee n use d t o asses s th e effect s o f anthropogeni c input s int o coastal waters.

Mytilid mussels , especiall y thos e belongin g t o the genus Mytilus, ar e amongs t th e mos t intensivel y researched marin e organism s wit h entir e book s devoted solel y t o thei r stud y (e.g . Bayn e 1976 ; Stefano 1990 ; Goslin g 1992) . Ther e ar e man y reasons fo r suc h scientifi c interest ; e.g . thes e mussels ar e widel y distribute d an d exceedingl y abundant throughou t th e world' s oceans ; the y ar e important ecologicall y a s dominan t space occupying organisms , particularl y i n coasta l an d estuarine waters (e.g. Seed & Suchanek 1992); they are importan t economicall y a s foo d an d foulin g organisms (e.g. Hickman 1992) . Moreover, fro m a s early a s 1976 , whe n the Mussel Watc h Monitorin g Program wa s initiated , mussel s hav e bee n widel y used a s sentinel s o r biomonitor s o f coasta l wate r quality (e.g . Goldber g 1986 ; Widdow s & Donki n 1992). Som e species , suc h a s th e commo n blu e mussel (Mytilus edulis Linnaeus), have also proved to b e mode l organism s i n studie s o f physiology , biochemistry an d population genetic s (se e relevant chapters in Gosling 1992) . Moreover, musse l bed s are amongs t th e mos t productiv e assemblage s o n Earth, ofte n rivallin g th e productivit y o f tropica l rain forest s an d kel p beds , whils t i n histori c an d prehistoric time s Mytilus shell s wer e use d extensively fo r tool s b y nativ e Nort h America n

Indians as well as by the Pilgrim settlers (Suchane k 1985). Amongst th e marine mussels , specie s of Mytilus are particularl y widesprea d throughou t th e coole r waters o f bot h th e norther n an d souther n hemi spheres, attache d b y mean s o f byssu s thread s t o rock an d othe r har d o r semi-consolidate d surface s [see McDonal d e t al (1991 ) an d Suchane k e t al (1997) fo r curren t taxonom y an d globa l distri butions o f thes e species] . I n tropica l an d sub tropical latitudes , however , thi s genu s i s replace d by othe r dominan t zone-formin g gener a suc h a s Perna an d Septifer. Whils t mos t marin e mussel s occur i n shallow inshor e waters, dens e population s of highl y specialize d specie s hav e bee n reporte d from cold-seep areas and sites of hydrothermal vent activity i n th e dee p se a (e.g . Hessle r e t a l 1988 ; Jahnke e t a l 1995) . Thes e bathymodiolid s filte r particulate materia l fro m th e wate r colum n i n th e usual way but , remarkably , can als o tap othe r nutrient source s i n th e for m o f sulphur - and/o r methane-oxidizing bacteri a containe d withi n thei r own tissues (e.g. Rei d 1990 ; Kocheva r e t al 1992 ; Fisher e t al 1993) . Ther e ar e now over 2 0 known species of Bathymodiolus, the larges t o f whic h (B . boomerang n . sp.) ca n attai n a shel l lengt h o f 360 mm and is probably th e largest recorded livin g

From: HARPER , E . M., TAYLOR, J. D. & CRAME, J . A. (eds) The Evolutionary Biology of th e Bivalvia. Geological Society , London, Special Publications, 177 , 465-^78 . 1-86239-076-2/007 $ 15.00 © The Geological Societ y o f London 2000.

466

R. SEED£rAL .

mussel (vo n Cose l & Ol u 1998) . I n additio n t o these bathymodiolids , specie s o f Idas an d Adipicola liv e associate d wit h sunke n decayin g wood an d othe r organi c remain s i n dee p wate r (Horikoshi & Tsuchid a 1984 ; Ware n 1991) ; Idas simpsoni (Marshall ) curiousl y occur s o n whal e skeletons or in drifting sper m whale blubber - thes e mussels ma y als o hous e symbioti c bacteria . Othe r unusual mussel s includ e thos e whic h construc t byssal nests (e.g. Amygdalum), liv e within the tests of ascidian s (e.g . Musculus) o r bor e int o th e substratum (e.g. Adula). Thus, althoug h th e marin e mytilid s exhibi t a remarkably wid e diversit y o f lifestyles , thi s pape r focuses only on those epibyssate colonizer s o f hard intertidal an d shallo w subtida l substrata . Firstly , some o f th e adaptiv e feature s tha t underpi n th e success o f epibyssat e mytilid s wil l b e explored , then the ecological significanc e of this success wil l be examined, i n particular thei r competitive abilit y and th e importanc e o f musse l bed s a s island s o f enhanced biodiversity . Finally , th e potentia l valu e of mytilid s a s chronometer s o f environmenta l change an d a s environmenta l biomonitor s wil l b e considered.

Evolution and adaptatio n Of th e man y factor s tha t ar e undoubtedl y responsible fo r th e succes s o f mytilid mussels, th e evolution o f th e heteromyaria n for m associate d with th e neotenou s retentio n o f th e byssu s i s o f particular significanc e [se e See d (1983 ) an d Morton (1992 ) fo r reviews] . Th e secretio n o f byssus threads b y a special glan d a t the base of the foot provide d a n effectiv e mean s o f attachmen t onto har d surface s an d enable d variou s bivalv e classes, includin g mussels, to become independen t of th e sof t sediment s inhabite d b y thei r ancestors . Thus, th e neotenou s retentio n int o adul t lif e o f a post-larval characteristic , originall y use d fo r temporary attachmen t durin g metamorphosis , created th e opportunit y fo r a marke d shif t i n evolutionary direction . Th e broadl y triangula r heteromyarian for m o f th e 'typical ' mussel , coupled wit h secur e byssa l attachmen t throughout life, proved t o be the ideal solutio n for bivalves lik e epibyssate mussel s whic h liv e i n hig h populatio n densities o n har d o r moderatel y consolidate d substrata. Indeed , s o successfu l wa s thi s solutio n that i t ha s bee n evolve d independentl y amongs t otherwise unrelate d bivalve lineages, mos t notably the freshwater dreisseni d mussels an d their marin e counterparts th e mytilids , thu s providin g a particularly clea r an d elegan t exampl e o f convergence. Factors othe r tha n shel l morpholog y an d byssa l attachment hav e contribute d t o th e succes s o f

mytilid mussels . On e suc h facto r i s thei r suprem e efficiency a s filter-feedin g organisms . Individua l mussels ca n filte r severa l litre s o f wate r pe r hou r and ar e capabl e o f extractin g extremel y smal l particles, suc h as bacteria; thi s is one of the reasons why the y ca n b e a potentiall y seriou s threat t o public healt h (e.g . Shumwa y 1989) . However , thi s filtering efficienc y ha s als o bee n pu t t o us e fo r clearing pollute d docklan d sites : e.g . i n th e tw o years followin g th e introductio n o f mussel s t o Liverpool docks , wate r quality and oxygen conten t of bot h th e wate r colum n an d th e sedimen t improved significantl y a s bacteri a an d othe r suspended particulat e materia l wer e remove d b y the mussels (Alle n & Hawkins 1993) . Marine mytilids , a s wel l a s som e brackis h an d freshwater bivalve s suc h a s th e zebr a mussel , Dreissena polymorpha (Pallas) , posses s severa l life-history trait s whic h mak e the m especiall y effective a s colonizin g species . Fo r example ; the y are highl y fecund ; the y occu r a t hig h populatio n densities, producin g larg e number s o f planktotrophic larva e whic h ensur e rapi d an d widespread dispersa l (furthe r facilitate d b y bysso pelagic driftin g o f juveniles); the y ar e toleran t o f extended periods o f aerial exposur e an d thus easily transported, often accidentally , fro m on e locality to another [fo r general review s se e Bayne (1976) an d Gosling (1992)] . Onc e establishe d the y can , b y virtue o f thei r competitiv e superiorit y (se e later) , quickly becom e th e dominan t space-occupyin g members o f th e community , wit h th e potentia l t o completely eliminat e mos t othe r sessil e species . This colonizin g abilit y o f mussel s ca n creat e potentially seriou s economi c problem s fo r industry, in particula r t o nuclea r powe r stations , i f musse l larvae presen t i n the coolin g wate r ar e allowe d t o settle an d fou l th e vulnerabl e condense r tube s (Thompson e t al. 1997). Specific adaptation s t o condition s prevailin g a t opposite end s o f a n environmenta l gradien t ar e exhibited b y Perna viridis (Linnaeus ) an d Septifer virgatus (Wiegmann). Althoug h thes e two commo n mytilids ar e widel y distribute d throughou t th e coastal water s o f Hong Kong , onl y rarel y d o thei r local distribution patterns overlap, Perna occurrin g predominantly i n sheltered, often heavil y polluted , waters an d Septifer o n cleaner , wave - expose d shores o f th e oute r coast . Thes e mussel s hav e evolved contrastin g suite s o f structura l an d behavioural trait s whic h correlat e wel l wit h a presumed advantag e fo r eac h specie s withi n it s preferred habita t (See d & Richardson 1999) . Thus, whereas Septifer possesse s a more robust, ventrally flattened shel l an d stronger byssa l attachmen t tha n Perna, characteristics wel l suite d fo r lif e o n high energy rock y shores , Perna produce s copiou s amounts o f mucu s an d ha s unusuall y larg e labia l

EVOLUTION AN D BIOLOG Y O F MARINE MUSSEL S

palps wit h stron g ciliar y rejectio n tracts , feature s more appropriate for coping with the high sediment loadings ofte n associate d wit h sheltered , low energy habitats . Moreover , i t ha s bee n suggeste d that excessive mucus production may be associate d with th e eliminatio n o f toxi c trac e metal s suc h a s copper (Sz e & Lee 1995) . Perna als o possesse s a larger, mor e mobil e foo t an d crawl s mor e readil y than Septifer. I n particular , i t exhibit s a marke d propensity to climb verticall y upwards , a respons e which effectivel y elevate s thi s musse l abov e an y accumulated sediment ; Septifer, b y contrast , doe s not exhibi t thi s behavioura l trait . Simila r adaptations hav e bee n previousl y reporte d fo r Mytilus californianus (Conrad ) an d M . edulis which occup y wave-swep t an d sheltere d habitats , respectively, alon g th e Pacifi c coas t o f Nort h America (Harge r 1972) .

Ecological significance an d biodiversit y An importan t organizing principl e i n man y space limited communities, such as those associated with the rock y intertida l zon e wher e mos t o f th e common specie s ar e sedentary , i s the existenc e of an approximat e hierarch y i n th e competitiv e abilities o f th e primar y space-occupyin g species . Such hierarchies, i f left undisturbed, can eventuall y lead to extreme dominance (monopolization) by the competitively superior species. However, moderate levels o f disturbance , eithe r physica l (e.g . waves ) or biological (e.g . predation), operatin g o n species high in the hierarchy can promote specie s richness by interruptin g th e competitiv e proces s an d creating patche s o f bar e roc k whic h ca n the n b e exploited, a t leas t temporarily , b y lowe r rankin g opportunistic species . Lo w level s o f disturbance may b e insufficien t t o preven t competitiv e monopolization whils t hig h level s ma y reduc e species richness by acting adversely on all species . Keystone predator s ar e thos e whic h consum e competitively dominan t species . O n rocky shores , mussels are often simultaneousl y the competitively dominant specie s an d th e preferre d pre y fo r th e keystone predator , typicall y a starfish , strongl y suggesting tha t commo n mechanism s serv e t o organize rock y shor e communitie s i n differen t geographical area s (Boade n & See d 1985) . Th e diversity promotin g rol e o f predatio n ha s bee n elegantly demonstrate d i n th e Mytilus-Pisaster interaction o n th e wave-expose d shore s o f Washington Stat e (Pain e 1974) . At sites wher e th e starfish wa s regularl y remove d th e numbe r o f primary space-occupyin g specie s withi n th e community (c . 25 ) decline d an d afte r a perio d o f approximately te n years only mussels remained; a t the undisturbe d contro l sites , wher e starfis h wer e left t o forag e o n th e mussels , specie s richnes s

467

remained high throughout th e experimental period . The strikin g result s o f thes e predato r exclusio n experiments provid e a clea r an d unambiguou s demonstration o f an ecological principle operatin g in nature. The tida l restrictio n o f mos t marin e predator s often results in distinct predation line s below whic h established prey population s ar e rare. Thus, on the east coas t o f England , predator y starfis h [Asterias rubens (Linnaeus) ] an d dogwhelk s [Nucella lapillus (Linnaeus) ] effectivel y remov e Mytilus edulis fro m muc h of the lowe r shor e (See d 1969) . Predation i n th e uppe r shore , b y contrast , i s minimal an d mussels occurrin g ther e can ofte n b e exceptionally lon g live d ( > 20 years) . Similarly , experiments carrie d ou t o n th e Pacifi c Coas t o f North America have shown that Pisaster ochraceus (Brandt) effectivel y control s the distributio n o f it s main prey , Mytilus californianus, o n th e lowe r shore. Whe n thi s starfis h wa s experimentall y removed fro m a section o f shore , ove r a period o f five years , th e lowe r edg e o f th e musse l zon e gradually extende d downshore , bu t whe n th e starfish wa s allowe d t o re-ente r th e syste m th e lower limi t o f mussel s graduall y returne d t o th e previous stat e (Pain e 1974) . Simila r downwar d shifts i n th e distributio n o f Perna canaliculus (Gmelin) i n Ne w Zealan d an d Perumytilus purpuratus (Lamarck ) in Chile have been observe d following th e remova l o f majo r predator y starfis h Stichaster an d Heliaster, respectivel y (Pain e e t al. 1985). The impac t o f th e larg e predator y gastropo d Concholepas concholepas (Bruguiere ) o n th e distribution o f mussel s ha s bee n demonstrate d o n the rock y coastlin e o f centra l an d souther n Chil e where the intertidal zone is typically dominated b y Perumytilus purpuratus. Whe n th e gatherin g o f Concholepas, a prize d commercia l species , wa s halted, b y excludin g fisherme n fro m a designate d Marine Reserve , th e intertida l zon e switche d dramatically fro m one dominated b y mussels t o one dominated by barnacles. N o suc h chang e occurre d outside th e reserv e wher e Concholepas wa s stil l heavily harvested . Moreover , whe n Perumytilus was experimentally protecte d from Concholepas by cages deploye d insid e th e reserv e th e musse l population soo n became re-establishe d (Moren o et al. 1986) . Thus , th e ac t o f simpl y protectin g a n important natura l predato r cause d th e entir e land scape of the intertidal zone to change, and it therefore appears that the mussel-dominated communit y normally observe d alon g much of the Chilean coast is i n a n artificiall y altere d stat e whic h i s largel y shaped and maintained by human factors. A relativel y ne w an d excitin g fiel d o f researc h involving mussel s concern s th e exten t t o whic h these densel y aggregated , filter-feedin g organism s

468

R. SEE D ETAL.

act a s processor s o f inshor e water . Thi s researc h involves th e us e o f larg e (c . 10 m long ) plasti c tunnels which are placed across the mussel bed and secured firml y t o the substratum. Water is sample d as i t enter s an d leave s th e tunne l whils t monitors , placed within the tunnel, enable the flow dynamics of water over the mussel bed to be established. An y changes i n th e qualit y o f th e inflowin g an d outflowing wate r ca n the n b e attribute d t o th e activities o f th e mussels . Result s hav e show n tha t mussel bed s ca n remov e larg e quantitie s o f suspended particulat e organi c matte r an d als o release dissolve d metabolite s bac k int o th e environment wher e they are readily utilized by th e phytoplankton (Fig . 1) . Biodeposit s (faece s an d pseudo-faeces) produce d b y th e mussel s ar e incorporated int o th e sedimen t an d ente r th e mineralization process . Thes e tunne l experiment s have demonstrate d tha t musse l bed s (an d oyste r reefs) ca n have a profound influence on large-scale coastal an d estuarine processes such as productivity and eutrophication , an d tha t the y ca n als o alte r significantly th e biogeochemistry o f the underlying sediment (Dam e 1996) . It is clear fro m th e abov e that, in the absenc e of adequate levels of disturbance, mussels, as superior spatial competitors , ca n effectivel y monopoliz e large area s o f the rocky intertidal zone by denying access t o th e weake r mor e opportunisti c species . Such loss of species richness, however, applies only to thos e specie s tha t compet e fo r th e primar y resource - attachmen t spac e - o n the rock surface . In contrast , the comple x three-dimensiona l struc ture o f th e musse l patche s themselve s provid e a suitable habitat fo r ric h assemblage s o f associate d organisms, includin g representatives fro m mos t of the majo r anima l phyl a (e.g . Suchane k 1979 ;

Tsuchiya & Nishihir a 1986 ; On g Ch e & Morto n 1992). Aggregations o f mussel s ca n drasticall y modif y the loca l environmen t throug h enhance d wate r retention, biodepositio n o f faecal an d pseudofaeca l material ( = 'mussel mud') , an d th e provisio n o f additional attachmen t surfac e an d shelte r b y th e mussels themselve s - feature s whic h serv e t o encourage specie s enrichmen t in habitats wherever mussels ar e present i n abundance. Mussel s ar e thus effective 'ecosyste m engineers' , a ter m use d b y Lawton & Jone s (1995 ) t o describ e specie s tha t either directl y o r indirectl y modulat e th e avail ability o f resource s t o othe r specie s b y causin g physical state changes in biotic or abiotic materials , thereby modifying , maintainin g an d creatin g habitats. Musse l patche s suppor t ric h assemblage s of associated organism s (Seed 1996). Some of these organisms liv e attache d t o th e musse l shell s (= epibiota), other s typicall y liv e amongs t th e ric h sediments an d shell fragments which accumulate at the bas e o f th e be d ( = infauna), whils t mobil e organisms rove freel y throug h the comple x matri x of shells an d interconnecting byssu s threads. Table 1 documents the number of macroinverte brate tax a associate d wit h severa l rock y shor e mytilids fro m wave-expose d rocky shore s togethe r with som e o f th e dominan t specie s foun d withi n these communities. A striking feature is that simila r taxa, ofte n fro m th e sam e genus , regularl y recu r within thes e communitie s worldwide . Moreover , with th e exceptio n o f Mytilus californianus - a much large r bodie d musse l whic h form s thic k multilayered bed s - th e number of associated tax a is broadl y comparabl e betwee n species . Suc h observations sugges t tha t th e numbe r o f niche s available withi n these structurally simila r 'habitats '

Fig. 1 . A conceptual summary of the processes occurrin g in and around dense systems of filter-feeding bivalve s such as mussels [after Dam e (1996)] .

469

EVOLUTION AN D BIOLOG Y OF MARINE MUSSEL S Table 1. Macroinvertebrate fauna associated with various species o f rocky shore mytilids [after Seed (1996}] Mussel specie s

No. Dominan

(location)

taxa Mollusc

Septifer virgatus* (Hong Kong )

52 Lasaea

t specie s within community Crustacea

Polychaeta

nipponica Hormomya mutabilis Isognomon legumen

Hyale sp . Chthamalus sinensis

Ty posy His sp .

a

Mytilus edulis^ 5 (North Wales)

6

Lasaea rubra

Semibalanus balanoides

Brachidontes rostratus^ 5 (Southeast Australia)

6

Lasaea australis Xenostrobus pulex

Chthamalus antennatus Allorchestes compressa

Typosyllis sp . Perinereis sp .

M. californianus^ c (North America)

. 270

Lasaea subviridis Barleeia sanjuanensis

Hyale sp . Semibalanus cariosus Chthamalus dalli

Typosyllis adamanteus Syllis sp .

Perumytilus purpuratus 6 (Chile)

5

Lasaea petitiana Semimytilus algosus Siphonaria lessoni

Hyale sp . Chthamalus scabrosa Jehlius cirratus

Typosyllis sp . Perinereis sp . Pseudonereis sp .

*Ong Che & Morton (1992); tLinta s & Seed (1994); *Peak e & Quinn (1993); § Suchanek (1979) .

is limite d an d tha t whe n th e associate d com munities ar e at , o r near , equilibriu m thes e ar e occupied by taxonomically and functionally similar species. I t seem s therefor e tha t th e patter n o f parallel communitie s on rock y shore s may be replicated o n a muc h fine r scal e withi n musse l patches (See d 1996) . Despit e thei r generall y hig h levels o f biodiversity , whic h ca n var y bot h temporally (e.g. Peake & Quinn 1993) and spatially according to the age, size and structural complexity of the patch, the degree of aerial and tidal exposure and th e amoun t o f accumulate d sedimen t (e.g . Tsuchiya & Nishihira 1986 ; Linta s & Seed 1994) , intertidal musse l communitie s ar e typicall y dominated b y a few ver y abundant species. Figure 2 shows the rank abundance of the fauna associated with thre e specie s o f rock y shor e mytilids . Th e overall distribution s ar e simila r fo r al l thre e communities and indicate high dominance by a few common species . The macroinvertebrat e communitie s associate d with rock y intertida l musse l patches , particularl y when thes e patche s experienc e simila r physica l conditions an d ar e o f simila r siz e an d structura l complexity, ofte n exhibi t a remarkabl e degre e o f conformity when compared using simple univariate statistics. However , suc h techniques , whic h typically collapse the full se t of species counts into a singl e coefficient , ten d t o grossl y oversimplif y complex systems and reveal little about community organization (Schulte r & Ricklef s 1993) . Thus , although thi s group's , a s ye t unpublished , dat a show tha t th e communitie s associate d wit h

Perumytilus purpuratus i n centra l Chil e an d Mytilus edulis i n th e U K ar e indistinguishabl e i n terms o f thei r specie s richness , diversit y an d evenness, significan t difference s i n communit y structure d o emerg e (Fig . 3 ) whe n multivariat e techniques ar e applied t o these sam e communities. For example , whils t th e P . purpuratus communit y supports surprisingl y larg e number s o f se a anemones an d grazin g gastropods , thes e tax a ar e only rarely encountere d withi n the M. edulis community which , i n turn , support s larg e number s o f meiofaunal tax a includin g nematodes, nemerteans and mites . Th e preliminar y data o n P . purpuratus further suggest s tha t dominanc e b y relativel y fe w species i s mos t pronounce d in thos e communities that experienc e enhance d level s o f anthropogeni c stress. A s biodiversit y typicall y reflect s environ mental health , musse l patc h communitie s coul d prove t o b e valuabl e bioindicators o f coasta l an d estuarine water quality.

Mussels a s chronometers of environmental change In mussels, a s in most bivalves, change s in growth are permanently recorded in the shell in the form of rings or bands. A well-established technique which enables the internal structur e of mussel shells to be examined for the presence of annual growth checks and microgrowth patterns involves the preparation of acetat e peel replicas o f cut, polished an d etche d radial shel l section s (Rhoad s & Lut z 1980 ;

470

R. SEE D ETAL.

umbo and in the nacreous laye r (Fig . 4 b an d c). In Mytilus edulis (Lutz 1976 ; Richardso n e t al. 1990 ) and Geukensia demissa (Dillwyn ) (Lut z & Castagna 1980 ) thes e inne r nacreou s line s hav e been show n to be deposited annually . This fac t ha s enabled determinatio n o f the ag e an d growt h rate s of M. edulis (e.g. Bayne & Worrall 1980 ; Rodhouse et al. 1984) , thereby also allowing individual linear growth rate s t o b e determined , providin g tha t th e relationship betwee n growt h o f th e nacreou s line s and shel l length ha s firs t bee n established (Seed & Richardson 1990) . A potentiall y usefu l techniqu e for validatin g th e positio n o f th e annua l ring s i n temperate water mussels, and other bivalve species , utilizes th e rati o o f naturall y occurrin g oxyge n isotopes ( 18O/16O) withi n th e calcit e o f th e shell . This rati o i s temperatur e dependen t an d sample s taken a t known intervals alon g th e shel l provid e a temperature profil e whic h ma y reflec t seasona l variations i n growt h rat e (Margosia n e t al . 1987) . Dodd (1965 ) demonstrate d a stron g negativ e correlation between strontium concentrations i n the nacre an d temperature (13-19°C ) in Mytilus edulis

Fig. 2 . Rank abundance plots showing the diversity of the macroinvertebrate fauna associate d wit h Mytilus edulis fro m Nort h Wales (•); Septifer virgatus fro m Hong Kong (O); an d Perumytilus purpuratus fro m Central Chile (A). Inset : Cumulative abundance of the ten most common species withi n each community. M. edulis an d S. virgatus data from Linta s & Seed (1994 ) and Ong Che & Morton (1992), respectively.

Richardson 1989 , 1990) . Whe n thes e peel s ar e viewed unde r a light microscop e a clearly define d pattern of growth bands or growth lines can be seen in variou s regions o f th e shell . Figur e 4 a show s a diagrammatic sectio n throug h a generalized musse l shell. The shell typically consists of a periostracum, an outer prismatic shell layer of calcite or aragonite, an inne r nacreou s laye r an d a n umbo . Prominen t growth line s ca n b e see n a s a pattern o f ligh t an d dark line s (arrows ) in th e interna l structur e of th e

Fig. 3 . Non-metri c multidimensional scalin g (MDS) plo t for intertida l mussel bed communities at eight sites in the UK and eight in Chile. Stres s value , 0.1; ANOSI M Global R, 0.886 (p < 0.05); these values indicate significant difference s in the communities a t these two major geographica l sites .

Fig. 4 . (a ) Schemati c diagram of a shell section of Mytilus edulis chilensis to illustrate the layers o f the shell : p, periostracum; pi, prismatic layer; n, nacreous layer; u, umbo. (b)-(g) Photomicrographs o f acetate peels o f sections of Mytilus: (b ) annual growth lines (arrows) in the umbone and (c) annual growth lines (arrows) in the nacreous layer of M. e. chilensis from th e Falkland Islands ; (d ) position of the winter growth check (arrow ) in the shell o f M. e. chilensis', (e) a disturbance check (arrow ) in the prismatic layer of the shel l of M. e. chilensis; (f) ver y faint band s deposited during a period of non-chlorination in the shell o f Mytilus edulis; (g) disturbance t o the normal ban d patter n (arrow) in M. edulis exposed t o chlorination from a power station culvert. Scale bars, 10 0 |um.

EVOLUTION AN D BIOLOGY O F MARINE MUSSELS 47

1

472

R. SEE D ET AL.

and Mytilus californianus collecte d fro m Californian waters . Magnesiu m concentration s i n the outer prismatic layer of Mytilus edulis increased markedly wit h decreasin g salinit y an d showe d a weak positiv e correlatio n wit h temperatur e (Dod d 1965, 1967) . Magnesium/calcium ratio s determine d i n sequentially drille d sample s i n the shel l o f Mytilus trossulus fro m Britis h Columbia , Canada , wer e found t o provid e a n accurat e measur e o f seawate r temperature (Klei n e t al. 1996) . Moreover , i t ha s recently bee n suggeste d tha t th e actua l volum e o f calcite deposite d i n Mytilus shell s i s inversel y related t o water temperature (Carte r & Seed 1998) , a relationshi p whic h offer s som e potentia l fo r estimating sea-surfac e palaeotemperature s fro m fossil material. Variation in the 13 C/12C ratios in the shell o f Mytilus californianus ha s bee n show n t o correspond t o upwelling events, thus providing an opportunity fo r determinin g th e frequenc y o f palaeoupwelling event s i n fossi l musse l shell s (Killingley & Berger 1979) . The outer shell layer of Mytilus edulis contains a series of fine microscopic alternatin g light and dark bands (Fig . 4d) . Dar k band s hav e a semi-diurna l periodicity o f formation, each band being deposite d when th e musse l is emersed a t low tide; th e wide r lighter bands are laid down during immersion when the musse l i s activel y feedin g (Richardso n 1989) . Under continuously immersed condition s th e bands are weaker in definition and reflect an endogenou s rhythm in shell deposition (Richardson 1989). Tidal bands i n th e oute r laye r hav e bee n use d t o determine th e annua l rate s o f growt h o f severa l mytilid species . Growt h increments var y along th e shell i n respons e t o seasona l environmenta l changes. Durin g th e summe r (May-Augus t i n northern latitudes , December-Marc h i n souther n latitudes), whe n seawate r temperature s ar e maxi mal, shell growth is rapid an d wide increments ar e deposited. Wit h th e onse t o f autumn , shel l formation graduall y slow s an d th e increment s become progressivel y narrower . Thi s seasona l pattern in the narrowing of the increments results in annual growth checks i n the outer shel l laye r (Fig . 4d) and the distance between successiv e check s can be measure d directly fro m th e peel , thu s allowin g the growth rate of individual mussels, and hence the population growth rate, to be determined. However , the presenc e o f seasona l pattern s i n incremen t width ma y no t necessaril y b e associate d wit h sea sonal changes in water temperatures. Richardson et al. (1995 ) showe d tha t i n Septifer virgatus, Hon g Kong, two group s o f narrowly space d tida l bands , representing periods of reduced linear growth, were deposited eac h year . One of these groups appeare d to b e associate d wit h lo w seawate r temperature s during winte r (February-March ) whils t th e othe r

appeared t o b e relate d t o a perio d o f post reproductive stres s aggravate d b y hig h temper atures during summer (July-August) . A confound ing facto r i n estimatin g ag e i s th e presenc e o f growth disturbance s i n the shell (Fig . 4e ) resultin g from, fo r example , remova l o f cage-hel d mussel s during cag e cleanin g (Richardso n e t al . 1990) . These checks aris e due to withdrawal of the mantle edge durin g disturbanc e an d a chang e i n th e direction o f shell growth , whic h coul d b e misinter preted a s an annual growth check. A sudde n interruption to the normal banding pattern distinguishes these growt h check s fro m th e seasonall y induce d changes i n shell growth . Shell growt h rate s ca n b e obtaine d eithe r b y measuring the width of the most recently deposite d growth increment , correspondin g t o on e tide s growth (Fig. 5a) , or the width of a number of incre ments equivalen t t o severa l day s (tides ) growth . Intertidal mussels sho w variations in the definition of the growth bands and differences in shell growt h rate durin g th e spring-nea p luna r tida l cycle . Mussels occupyin g th e lowe r intertida l zone s deposit dar k band s whe n the y ar e emerse d durin g spring lo w tides , an d weakl y define d band s an d enhanced shel l growth rates during neap tides when they ar e continuousl y immerse d (Fig . 5 a an d b) . Mussels growing in the middle an d upper zone s of the shor e displa y a pronounced spring-nea p luna r banding patter n wit h narrowl y space d increment s and strongl y defined bands laid dow n at neap tides when the y ar e emerse d fo r longe r period s tha n a t spring tides . Thes e consisten t an d obviou s differences i n ban d strengt h an d incremen t width , documented in musse l shell s fro m differen t tida l levels worldwid e (Richardso n e t al . 1990 , 1995 ; Gray 1997) , coul d hav e palaeoecologica l signifi cance. Growth pattern s i n fossi l o r subfossi l musse l shells, o r thos e fro m deat h assemblages , fo r instance, coul d b e use d t o reconstruc t tida l conditions an d determine th e shore leve l whic h the mussels ha d occupied : weakl y define d pattern s would indicat e subtida l growt h whils t a n obviou s 14 da y spring-nea p luna r variatio n i n incremen t width, wit h pronounce d narrowin g o f increment s together wit h th e presenc e o f dar k growt h bands , would b e indicativ e o f a hig h shor e existence . Differences i n th e natur e o f th e amplitud e o f th e tides migh t b e discerne d fro m variation s i n increment widt h an d definitio n o f adjacen t tida l bands. Mytilus edulis exposed to a semi-diurnal tide of simila r amplitud e (emersio n twic e daily ) i n th e Menai Strait , Nort h Wales , deposi t tida l band s o f uniform definitio n (Richardso n 1989) , wherea s M . e. chilensis (Hupe) inhabiting a mixed semi-diurnal tidal regime , e.g . i n the Falklands (Fig . 5c) , wher e there i s unequa l tida l amplitud e a t sprin g tide s

EVOLUTION AN D BIOLOGY OF MARINE MUSSELS 47

3

Fig. 5 . (a ) Photomicrograph of an acetate peel replica of a shell sectio n of Mytilus edulis chilensis from th e Falkland Islands showing the variation in growth increment width during spring (S) and neap (N) tides; scale bar, 10 0 jam. The mussel was date marked (larg e arrow) and grown for 56 days. A clearly define d band was deposited a t low tide during an anomalously hig h air temperature (smal l arrow) . P, periostracum; PL, prismatic layer , (b ) Camera lucid a drawing of the positions of the bands in the prismatic layer in (a), (c) Predicted tida l cycle during the experimental period; horizontal line marks the tidal height where the mussel was growing, (d ) Combined records of seawater temperatures during immersion and air temperatures during emersion; * , the anomalously high air temperature which occurred whe n the mussel was emersed fo r several hour s during spring low tide [data from Gra y (1997)].

474

R. SEED ETAL.

(daily emersion) , deposi t on e dar k widel y space d band during emersion an d two narrow bands a day during emersio n a t nea p tide s (emersio n twic e daily) (Gra y 1997) . Pannell a (1976 ) ha s demon strated tha t suitabl y preserve d fossi l bivalve shell s may be used to reconstruct th e tidal regime o f past oceans, an d evidence fro m experimentall y marked and transplante d mussels (Richardso n 1989 ; Gray 1997) indicate s tha t i t i s feasibl e t o determin e th e animal's tida l elevation o n the shore from th e shel l banding patterns. Since th e tida l increment s ca n b e use d t o measure variation s i n shel l growt h rate s the y ca n also b e use d t o investigat e th e effect s o f environ mental factors on shell growth. Peels of shells of M. edulis collecte d fro m powe r statio n culvert s (Fig. 4f), unlik e thos e fro m naturall y occurrin g musse l populations, sho w onl y a ver y fain t bandin g pattern. Thes e culver t mussel s annuall y receive , between June and November, continuous exposure to chlorinatio n designe d t o reduc e biofoulin g within th e culvert . Mussel s tha t surviv e chlori nation leav e evidenc e o f thi s even t a s a serie s o f dark prominen t band s whic h resul t fro m reduce d growth when the shell valve s remain tightly close d (Fig. 4g) . Chlorinated wate r discharge d fro m th e power statio n int o coasta l waters ma y als o affec t the natural mussel populations. Examination of the internal structur e of musse l shell s fro m withi n th e culvert for the presence of prominent growt h bands has enabled the efficiency o f chlorination in retarding shel l growt h t o b e assesse d (Thompso n e t al. 2000). The technique could be extended to investigate the impact o f chlorinated wate r discharges o n the natural mussel populations in the vicinity of the culvert. Using experimentall y marke d M . e . chilensis, transplanted fo r 5 6 days onto th e shor e a t Camill a Creek, Falklands, Gray (1997) demonstrated that an unusually distinc t band wa s deposite d i n th e shel l which coincide d wit h a n anomalousl y hig h ai r temperature durin g emersio n o n on e sprin g lo w tide. Th e growt h ban d pattern , i n whic h eac h increment an d ban d wa s assigne d a date , wa s analysed an d compare d wit h continuou s i n situ hourly records of seawater and air temperatures. On 20 January 1996 , when the mussels were emerse d during sprin g lo w tid e fo r severa l hour s the y experienced a temperature of 28°C whic h resulte d in the formation o f a distinct ban d (Fig. 5a and d). During nea p tides , however , althoug h unusuall y high ai r temperature s wer e recorded , th e mussel s were no t emerse d an d n o distinc t band s wer e deposited. Mussels have many attributes which have led to their us e a s 'sentinel ' o r 'indicator ' organsism s in environmental monitoring programme s (Phillip s 1980; Widdows & Donkin 1992) . The y are, as was

demonstrated earlier , dominan t members o f coasta l and estuarin e communitie s an d hav e a wid e geographical distribution ; the y ar e sedentar y an d therefore bette r tha n mobil e specie s a s integrator s of chemica l contaminatio n i n a give n area ; the y process larg e volume s o f wate r an d concentrat e many chemical s i n thei r tissue s and , as the y ar e commercially important , contaminatio n o f thei r tissues i s of concern t o public health . Mos t metal s occur in forms which are highly soluble in seawate r and are taken up directly from solutio n into the sof t tissues. Metal s ca n als o b e absorbe d an d incor porated int o th e shell , thu s providing th e potentia l for long-ter m record s o f changes i n environmenta l contamination. Metal s suc h a s lea d ar e highl y concentrated in the periostracum coverin g the shell (Sturesson 1976) . However there does not appear to be a relationship betwee n meta l levels in the whole shell an d th e tissue s (Brya n & Uysa l 1978) , although Bourgoi n (1990 ) recentl y showe d tha t nacre lea d level s i n Mytilus edulis wer e strongl y correlated with the tissue lead concentrations; nacr e contained one-tenth of the lead in the tissues. Using modern analytica l tools , e.g . electro n prob e (Rosenberg & Jones 1975) and, more recently, laser ablation inductivel y couple d plasma-mas s spectrometry (LA-ICP-MS ) (Gra y 1982) , i t ha s been possible t o analyse the chemical compositio n of th e shell , particularl y wit h respec t t o environ mentally sensitiv e element s suc h a s lead , copper , cadmium an d zinc , an d t o biogeni c element s suc h as calcium , strontiu m an d magnesiu m whic h comprise th e natura l structur e o f th e shell . Sinc e mytilids contai n annua l pattern s o f linea r growt h within their shell s an d some, e.g. the horse musse l Modiolus modiolus, attai n age s o f > 50 year s (Anwar e t al . 1990) , th e possibilit y exist s fo r studying bot h annua l an d seasona l variation s i n a range o f element s i n th e chemica l recor d o f shel l growth. Using electro n microprob e step-sca n analysi s across th e inne r nacreou s laye r o f a sectione d Mytilus edulis shell , Lut z (1981 ) conclude d tha t there was no correlation between strontiu m and the inner nacreou s growt h lines . Usin g LA-ICP-MS , Perkins (1992 ) demonstrated tempora l variations in magnesium, an d geographi c variation s i n copper , lead and zinc in shells of M. edulis from aroun d the coastline o f Wales . Richardso n e t al (2000 ) analysed th e chemica l compositio n o f th e incremental growt h recor d i n M . modiolus shell s collected i n 198 4 from tw o site s i n the Nort h Sea: one of these, a 'waste dump' (impacted ) sit e to the east o f th e Humbe r Estuary , ha d historicall y received a mixture of sewage sludg e and industrial sludge (1. 1 x 10 5 we t tonne s an d 5 x 10 3 we t tonnes, respectively , i n 1986) , wherea s th e othe r site, of f th e Norfol k coast , wa s distan t fro m an y

Fig. 6 . Contaminan t element concentrations i n horse mussel, Modiolus modiolus, shells (1-5) fro m a n impacted site and shells (6-9) fro m a control sit e between 196 2 and 1984 . (a) and (b) copper levels; (c) and (d) zinc levels; (e) and (f) lea d levels (from Richardso n et al. 2000).

476

R. SEE D ETAL.

known point-sourc e input s (contro l site) . Th e ag e of th e shell s wa s determine d fro m th e alternatin g pattern o f light (summer ) an d dar k (winter ) line s present i n th e shell s (Anwa r e t al. 1990) , an d a Spectron frequenc y quadruple d Nd:YA G laser ablation microprob e operatin g i n th e far-U V (266 nm) and linked to a light microscope wa s used to ablate 40 um diameter, 50 um depth samples. U p to 2 2 summe r an d winte r line s ( = 22 year s o f mussel life) in the oldest shells , covering the period of 1962-1984 , wer e sample d (Richardso n e t al . 2000). ICP-M S analysi s o f ablate d shel l materia l demonstrated that the shells fro m th e impacted sit e contained elevate d level s o f copper , zin c an d especially lea d betwee n 196 8 an d 197 6 (Fig . 6a , c and e) , coincidin g wit h a chang e i n contaminan t inputs between the early 1960 s an d 198 4 whe n the mussels wer e collected . Durin g th e sam e period , concentrations o f thes e element s i n contro l shell s remained aroun d background levels (Fig . 6b , d and f). I n 197 4 th e Dumpin g a t Se a Ac t wa s enacted , which subsequentl y becam e th e Foo d an d Environment Protection Act , and Richardson et al . (2000) speculate d tha t introductio n o f thi s legislation wa s likel y t o hav e ha d a n impac t o n trace elemen t concentration s i n th e shell s betwee n 1964 an d 1984 . Th e observe d level s o f heav y metals i n shell s fro m th e impacte d sit e durin g a period o f dumping of sewage sludg e an d industrial sludge fro m th e Humbe r Estuary , followe d b y a decline i n meta l concentration s i n th e shell s afte r the mid-1970s , suggeste d tha t th e shell s wer e indeed providing a record of metal contamination at this particular site.

References ALLEN, J . R . & HAWKINS , S . J . 1993 . Ca n biologica l filtration b e use d t o improv e wate r quality ? In: WHITE, K. N., BELLINGER, E. G., SAUL , A. J., SYMES, M. & HENDRY , K. L. (eds ) Urban Waterside Regeneration: Problems an d Prospects. Elli s Horwood Press, 377-385. ANWAR, N. A., RICHARDSON, C. A. & SEED, R. 1990 . Age determination, growth rate and population structure of th e hors e musse l Modiolus modiolus. Journal o f the Marine Biological Association o f th e UK, 70 , 441-457. BAYNE, B. L. (ed.) 1976. Marine Mussels: Their Ecology and Physiology. Cambridge Universit y Press. & WORRALL, C. M. 1980 . Growth and production of mussels Mytilus edulis fro m tw o populations . Marine Ecology Progress Series, 3, 317-328. BOADEN, R J . S . & SEED , R . 1985 . An Introduction t o Coastal Ecology. Blackie . BOURGOIN, B . P . 1990 . Mytilus edulis shel l a s a bioindicator o f lea d pollution : consideration s o n bioavailability an d variability . Marine Ecology Progress Series, 61, 253-262. BRYAN, G . W . & UYSAL , H . 1978 . Heavy metal s i n th e

burrowing bivalv e Scrobicularia plana fro m th e Tamar estuar y i n relatio n t o environmenta l levels . Journal of the Marine Biological Association of the UK, 58 , 89-108 . CARTER, J. G. & SEED , R. 1998 . Thermal potentiation an d mineralogical evolutio n i n Mytilus (Mollusca ; Bivalvia). In: JOHNSTON , P. & HAGGART , J. W . (eds) Bivalves: An Eon of Evolution - Paleobiological Studies Honoring Norman D. Newell. Universit y o f Calgary Press, 87-117 . COSEL, R. VO N & OLU , K . 1998 . Gigantism in Mytilidae. A new Bathymodiolus fro m cold see p area s o n the Barbados accretionar y prism . Comptes Rendus d e I'Academic des Sciences Serie III, Sciences de la Vie, 321 , 655-663. DAME, R . F . 1996 . Ecology o f Marine Bivalves: A n Ecosystem Approach. CR C Marine Scienc e Press. DODD, J . R . 1965 . Environmental contro l o f strontiu m and magnesiu m i n Mytilus. Geochimica e t Cosmochimica Acta, 29, 385-398 . 1967. Magnesiu m and strontiu m in calcareou s skeletons: a review . Journal o f Paleontology, 41 , 1313-1330. FISHER, C. , BROOKS , J . M. , VODENICHAR , J. S. , ZANDE , J . M., CHILDRESS , J. J. & BURKE , R. A. 1993 . The co occurrence o f methanotrophi c sulfur-oxidisin g bacterial symbiont s in a deep-se a mussel . Marine Ecology, 14 , 277-289. GOLDBERG, E . D . 1986 . Th e musse l watc h concept . Environmental Monitoring an d Assessment, 7 , 91-103. GOSLING, E. M. (ed.) 1992. The Mussel Mytilus: Ecology, Physiology, Genetics and Culture. Elsevier. GRAY, A . L . 1982 . Soli d sampl e introductio n b y lase r ablation for inductively coupled plasma source mass spectrometry. Analyst, 10 , 551-556. GRAY, A . P . 1997 . Th e ecology o f th e mussel Mytilu s edulis chilensi s from three sites i n th e Falkland Islands. Ph D Thesis, Universit y of Wales, Bangor. HARGER, J . R . E . 1972 . Competitiv e coexistence : maintenance o f interactin g association s o f se a mussels, Mytilus edulis and Mytilus californianus. Veliger, 14 , 387^08. HESSLER, R . R. , SMITHEY , W . M. , BOUDRIAS , M . A. , KELLER, C . H., LUTZ, R. A. & CHILDRESS, J. J. 1988. Temporal change s i n megafaun a a t th e Ros e Garden hydrothermal vent (Galapagos Rift ; easter n tropical Pacific) . Deep Se a Research, 35 , 1681-1709. HICKMAN, R.W. 1992. Mussel Cultivation. In: GOSLING, E . M. (ed. ) The Mussel Mytilus: Ecology, Physiology, Genetics and Culture. Elsevier, 465-510. HORIKOSHI, M. & TSUCHIDA , E. 1984 . Distribution, mod e of lif e an d allometri c growt h o f a deep-sea mytili d bivalve, Adipicola longissima (Thiel e an d Jaekel) . Venus, Japanese Journal o f Malacology, 43 , 86-100. JAHNKE, L . L. , SUMMONS , R . E. , DOWLING , L . M . & ZAHIRALIS, K . D . 1995 . Identificatio n o f methanotrophic lipi d biomarker s i n cold-see p mussel gills : chemica l an d isotopi c analysis . Applied an d Environmental Microbiology, 61 , 576-582. KILLINGLEY, J. S . & BERGER , W. H. 1979 . Stable isotope s

EVOLUTION AN D BIOLOGY OF MARINE MUSSELS in a mollus k shell : detectio n o f upwellin g events . Science, 205, 186-188. KLEIN, R . T. , LOHMANN , K . C . & THAYER , C . W . 1996. Sr/Ca an d 13 C/12C ratio s i n skeleta l calcit e o f Mytilus trossulus: covariatio n wit h metaboli c rate , salinity, an d carbo n isotopi c compositio n o f seawater. Geochimica e t Cosmochimica Acta, 60 , 4207-4221. KOCHEVAR, R . E. , CHILDRESS , J . J. , FISHER , C . R . & MINNICH, E . 1992 . The methan e mussel : role s o f symbiont an d hos t i n th e metaboli c utilizatio n o f methane. Marine Biology, 112 , 389-401. LAWTON, J. H. & JONES , C . G. 1995 . Linking specie s an d ecosystems: organism s a s ecosystem engineers . In : JONES, C. G. & LAWTON, J. H. (eds) Linking Species and Ecosystems. Chapma n & Hall, 141-150 . LINTAS, C. & SEED, R . 1994 . Spatial variation in the faun a associated wit h Mytilus edulis o n a wave-expose d rocky shore . Journal o f Molluscan Studies, 60 , 165-174. LUTZ, R . A . 1976 . Annual growt h layer s i n th e shel l o f Mytilus edulis. Journal of the Marine Biological Association of th e UK , 56, 723-731. 1981. Electron probe analysis of strontium in mussel (Bivalvia, Mytilidae ) shells : feasibilit y o f estimating wate r temperature . Hydrobiologia, 83 , 377-382. & CASTAGNA , M . 1980 . Ag e compositio n an d growth rat e o f a musse l (Geukensia demissa) population i n a Virgini a sal t marsh . Journal o f Molluscan Studies, 46, 106-115 . MCDONALD, J . H. , SEED , R . & KOEHN , R . K . 1991 . Allozymes an d morphometri c character s o f thre e species o f Mytilus i n th e norther n an d souther n hemispheres. Marine Biology, 111 , 323-335. MARGOSIAN, A. , TAN, F . C., CAI, D. & MANN, K . H. 1987. Seawater temperature records from stabl e profiles in the shel l o f Modiolus modiolus. Estuarine, Coastal and Shelf Science, 25, 81-89. MORENO, C . A. , LUNECKE , K . M . & LEPEZ , M . I . 1986. The respons e o f a n intertida l Concholepas concholepas (Gastropoda ) populatio n t o protectio n from ma n i n souther n Chil e an d th e effect s o n benthic assemblages . Oikos, 46, 359-364 . MORTON, B . 1992 . Th e evolutio n an d succes s o f th e heteromyarian for m i n th e Mytiloida . In : GOSLING , E. M . (ed. ) Th e Mussel Mytilus: Ecology, Physiology, Genetics an d Culture. Elsevier , 21-52. ONG CHE , R. G . & MORTON , B . 1992 . Structur e an d seasonal variation s i n abundanc e o f th e macroinvertebrate communit y associate d wit h Septifer virgatus (Bivalvia : Mytilidae ) a t Cap e d'Aguilar, Hon g Kong . Asian Marine Biology, 9 , 217-233. PAINE, R . T . 1974 . Intertida l communit y structure : experimental studie s o n the relationshi p betwee n a dominant competito r an d it s principa l predator . Oecologia, 15, 93-120. , CASTILLA , J . C . & CANCINO , J . 1985 . Perturbation and recover y pattern s o f starfis h dominate d intertidal assemblage s i n Chile , Ne w Zealan d an d Washington State . American Naturalist, 125 , 679-691.

477

PANNELLA, G . 1976 . Tidal growt h pattern s i n recen t an d fossil mollus c bivalv e shells : a too l fo r th e reconstruction o f paleotides . Naturwissenchaften, 63,539-543. PEAKE, J . & QUINN , G . P . 1993 . Temporal variatio n i n species-area curve s fo r invertebrate s i n clump s o f an intertidal mussel . Ecography, 16 , 269-277. PERKINS, W . T. 1992. Role of inductively couple d plasm a mass spectrometr y in natural environment research . Journal o f Analytical Atomic Spectrometry, 7 , 25-34. PHILLIPS, D . J . H . (ed. ) 1980 . Quantitative Aquatic Biological Indicators: Their Use to Monitor Trace Metal an d Organochlorine Pollution. Applie d Science Publisher s Ltd, London. REID, R . G . B . 1990 . Evolutionar y implication s o f sulphide-oxidizing symbiose s i n bivalves . In : MORTON, B . (ed. ) The Bivalvia: Proceedings o f a Memorial Symposium in Honour of Sir Charles Maurice Yonge (1899-1986), Edinburgh, 1986. Hong Kon g University Press, 127-140 . RHOADS, D. & LUTZ, R. A. (eds) 1980. Skeletal Growth of Aquatic Organisms. Plenum Press , Ne w York. RICHARDSON, C. A. 1989 . An analysis of the microgrowt h bands i n the shel l of the mussel Mytilus edulis (L.). Journal of the Marine Biological Association of the UK, 69 , 477-491. 1990. Tidal rhythm s in the shel l secretio n o f living bivalves. In : BROSCHE , P . & SUNDERMANN , J . (eds) Earth's Rotation from Eons t o Days. Springer Verlag, 215-226 . , SEED , R . & NAYLOR , E . 1990 . Us e o f interna l growth band s fo r measurin g individua l an d population growt h rate s i n Mytilus edulis fro m offshore productio n platforms . Marine Ecology Progress Series, 66, 259-265. ,, BROTOHADIKUSUMO, N. A. & OWEN, R . 1995. Age, growth and allometric relationship s i n Septifer virgatus (Bivalvia : Mytilidae) . Asian Marine Biology, 12 , 39-52. RICHARDSON, C . A. , CHENERY , S . R . N . & COOK , J . M . 2000. Assessing th e history o f trace meta l (Cu , Zn, Pb) contaminatio n i n th e Nort h Se a throug h lase r ablation-ICP-MS o f hors e mussel , Modiolus modiolus shells. Marine Ecology Progres s Series , in press. RODHOUSE, P . G. , RODEN , C . M. , BURNELL , G . M. ,

HENESEY, M . P. , MCMAHON , T. , OTTWAY , B . & RYAN, T. J. 1984. Food resource, gametogenesis an d growth o f Mytilus edulis o n th e shor e an d i n suspended culture : Killar y Harbour , Ireland . Journal of the Marine Biological Association of the UK, 64 , 513-529. ROSENBERG, G . D . & JONES , C . B . 1975 . Approache s to chemica l periodicitie s i n mollusc s an d stromatolites. In : ROSENBERG , G. D . & RUNCORN , S. K. (eds ) Growth Rhythms an d th e History o f th e Earth's Rotation. Joh n Wiley an d Sons, 223-242. SCHULTER, D. & RICKLEFS, R. E. 1993 . Species Diversity: An Introduction t o th e Problem. Universit y o f Chicago Press . SEED, R . 1969 . Th e ecolog y o f Mytilus edulis (Lamellibranchiata) o n expose d rock y shores . 2 . Growth and mortality. Oecologia, 3, 317-350.

478

R. SEE D E T AL.

1983. Structural organisation, adaptive radiation and classification o f molluscs . In : HOCHACHKA , P . W . (ed.) Th e Mollusca L Metabolic Biochemistry and Molecular Biomechanics. Academi c Press , 1-54. 1996. Pattern s o f biodiversit y i n th e macro invertebrate faun a associate d wit h musse l patche s on rock y shores . Journal o f th e Marine Biological Association of th e UK, 76 , 203-210. & RICHARDSON , C . A. 1990 . Mytilus growt h an d it s environmental responsiveness . In: STEFANO , G . B . (ed.) Th e Neurobiology o f Mytilus edulis. Manchester University Press, 1-37 . & 1999 . Evolutionary traits i n Perna viridis (Linnaeus) an d Septifer virgatus (Wiegmann ) (Bivalvia: Mytilidae) . Journal o f Experimental Marine Biology and Ecology, 239, 273-287. & SUCHANEK , T . H . 1992 . Populatio n an d community ecolog y o f Mytilus. In : GOSLING , E . M . (ed.) Th e Mussel Mytilus: Ecology, Physiology, Genetics and Culture. Elsevier, 87-169 . SHUMWAY, S . E . 1989 . A seriou s threa t t o shellfis h aquaculture. World Aquaculture, 20, 65-74. STEFANO, G . B . (ed. ) 1990. The Neurobiology o f Mytilus edulis. Manchester University Press. STURESSON, U. 1976 . Lead enrichment in shells o f Mytilus edulis. Ambio, 5, 253-256. SUCHANEK, T . H . 1979 . Th e Mytilu s californianu s community. Studies on the composition, structure, organization an d dynamics o f a mussel bed. PhD Thesis, Universit y of Washington, Seattle. 1985. Mussel s an d thei r rol e i n structurin g rocky shore communities . In : MOORE , P . G . & SEED , R .

(eds) Th e Ecology o f Rocky Coasts. Hodde r & Stoughton, 79-96. , GELLER, J . B., KREISER, B. R. & MITTON, J. B. 1997. Zoogeographic distributio n o f th e siblin g specie s Mytilus galloprovincialis an d Mytilus trossulus (Bivalvia, Mytilidae ) an d their hybrids i n the North Pacific. Biological Bulletin, 193 , 187-194. SZE, P . W. C . & LEE , S. Y . 1995 . The potentia l rol e o f mucus in the depuration of copper fro m th e mussels Perna viridis (Linnaeus ) an d Septifer virgatus (Weigmann). Marine Pollution Bulletin, 31 , 390-393. THOMPSON, I . S., RICHARDSON, C. A., SEED, R. & WALKER , G. 2000 . Quantificatio n of musse l (Mytilus edulis} growth fro m powe r statio n coolin g water s i n response t o chlorinatio n procedures . Biofouling, i n press. , SEED , R. , RICHARDSON , C . A. , Hui , L . & WALKER , G. 1997 . Effects o f lo w leve l chlorinatio n o n th e recruitment, behaviou r an d shel l growt h o f Mytilus edulis Linnaeu s i n powe r statio n coolin g water . Scientia Marina, 61 , 77-85. TSUCHIYA, M. & NISHIHIRA, M . 1986 . Islands of Mytilus a s habitat for small intertidal animals: effect o f Mytilus age structur e o n th e specie s compositio n o f th e associated faun a an d communit y organization . Marine Ecology Progress Series, 31, 171-178. WAREN, A . 1991 . Ne w an d littl e know n Mollusc a fro m Iceland and Scandinavia. Sarsia, 76, 53-124. WIDDOWS, J . & DONKIN , P . 1992 . Mussel s an d environmental contaminants : bioaccumulatio n an d physiological aspects . 7n : GOSLING , E . M . (ed. ) The Mussel Mytilus: Ecology, Physiology, Genetics and Culture. Elsevier, 383-424 .

Index of subjects Page numbers i n italics refer t o figures; thos e in bold type to tables.

abdominal sens e orga n 49 , 50 abfrontal surfac e 273-27 8 acrosomal comple x 17 0 acrosomes 776, 777, 757 Pteriomorphia 182 tridacnids 193, 197, 198 actinodonty 6 1 Adams consensus tree , Palaeozoi c tax a 55 adductor muscl e 47, 59 Lucinidae 210, 217-218 adoral sens e orga n 5 0 Aequipecten opercularis, and palaeoenvironments 425^39 allele frequencies , Mvtilus galloprovincialis 389 , 390,

391,393,394

allometrics 403, 406-407, 421 allozyme studie s 153 , 389 ammonites 23 4 anaerobic capability 209 Anomalodesmata 12 , 21, 25, 53 carnivory 132 , 133 characters 133-134 , 138, 13 9 cladistic studie s 129-14 3 data matrix 14 0 evolution 6 4 families 129 , 130 fossil recor d 134-136,13 5 orders 34 phylogeny 339-346 relations 4 4 species list s 130 strict consensu s tre e 13 7 superorder 90-9 1 Anomioidea 19 , 20, 22, 43 sperm 170 , 183, 185 , 18 6 Antarctica 441^50 aquarium trade 383 aquasperm 170 , 197 aragonite 13 5 Arcoida 55 , 92, 16 9 basal 4 2 clades 59 , 60, 65 monophyletic 54 sperm evidenc e 18 4 Arcoidea 64 , 92 basal branch 19 ligaments 280 relationships i n 23 sperm 170 , 171 , 184 Autolamellibranchiata 2 , 49, 57, 58 subclass 88-92 bacteria sulphur using 86 wood digestin g 257 bacterial transmissio n 208 , 222 bacteriocytes 207 , 210, 211 ballast wate r 459 Baltica, bivalve s in 82 behavioural responses 453, 456 belemnites 23 4

bio-indicators, mussel s as 469-476 biodiversity, mussel s a s indicators 469, 470 biofouling 47 4 biogeography, Mytilus galloprovincialis 389-39 7 bird predation, o n Ensis directus 459-464 bivalve size, seep communities 238-239 bootstrap tes t 11 7 tree, rudist s 779 branch swappin g 24, 35 Bray-Curtis analysis 380, 381, 382, 384 brooding 171 , 184 Buckhorn Asphalt 291-301 map 292 burrowing dept h and fles h growt h 452 Macoma balthica 451-458, 453, 454, 455 burrowing habit anomalodesmatans 12 9 chemosymbionts 209, 222 byssus Lyonsiidae 12 9 retention of 89, 466 scallops 25 1 Teranota 34 1 calcium granules 329-337 , 331, 333, 334 calcium phosphate 329 , 335-336 carbon isotope s 430-431 carbonate mud s 353 carnivory anomalodesmatans 13 2 deep-sea 3 cellulase 267 celluloprismatic structur e 11 5 cementation evolution o f 16 3 bivalves 3, 129 , 159-168,315 centriolar rootlet 20 0 Cenozoic era 129 , 425-436 Paleogene 409-411 , 415, 422 Neogene 347 , 354-358, 400, 412, 415, 422 character coding, rudists 114-116, 114, 122-123 character definition s 66-71 character stat e changes 74-75 , 138 characters Anomalodesmata 133-134 , 139 linked 111-11 3 Palaeozoic tax a 50-53 Pteriomorphia 2 6 rudists 111-114 , 123-12 4 chemoreceptors 25 0 chemosymbiosis 4 , 8, 207-225 fossil evidenc e 220-222 cilia, abfrontal 27 4 cilia density 27 6 ciliary currents 258, 262, 263 cladistic analysis Anomalodesmata 129-14 3 Pteriomorphia 1 rudists 11 6

480 clams, giant 191-205 Clavagellidae 129 . 132,314 evolution 324-32 5 taxonomy 321-324 cleaning mechanism s 275 , 277 climate chang e 6 , 355. 357 COIgene 31 cold seeps , see seep communitie s collecting dates. Florida Keys 382, 383 commercial collectin g 383 community structur e 469 computer models, ligament growth 282-288 contamination 475 continental collisio n 35 5 convergent evolutio n 42 coral reefs , a s habitats 35 6 corals, diversity 351. 352. 354 correspondence analysi s 392. 395 crabs, predation by 165 . 250. 453 crevasse habitat s 16 5 ctenidia Lucinidae210-211 Teredinidae 25 8 types 50 current flow, oceani c 35 5 current scour 419 cypraeids 348 cytochrome C oxidase subunit I 146 . 162 data matrix Anomalodesmata 14 0 rudists 116 Unionidae 14 9 death assemblages 292, 369 decay indice s 35. 41 demivinculum 310 deposit feeders 451 depositional environment s 292-293 depth, specie s records 381 digestive system s Neoteredo reynei 259-261 , 260. 267. 264. 265 Psihteredo healdi 261-262. 260, 262, 267, 268. 269 Teredinidae 257-27 1 dinoflagellates 23 4 discriminant functio n analyses 41 4 diversity, and sea surface temperature 363 diversity gradient s 347-360, 361-36 5 Southern Hemisphere 352 diversity pump 357 DNA. see nuclear DNA. rDN A DNA extractio n 12 , 146. 162 dredge survey s 368 Dry Tortuga s 368. 369. 380, 381 dysaerobic habitats 221 East Chin a Sea 348, 350, 352 egg jelly laye r 18 4 emersion 474 endemism 357 Ensis directus. bird predation 459—464, 460. 461 environmental pollution 474-476 environments an d evolution, mussel s 465-478 enzyme kinetics 447 Etheriidae 3 . 159-168 family classificatio n 16 1 fossil record 161-16 2 polyphyly 16 3 evolutionary rate s 43

INDEX evolutionary relationships . Spissatella 41 7 Evolutionary Specie s Concep t mode l 14 9 eyes pallial 4, 248 Pectinidae 247-255 facies, an d shell shape 415 faunal analysi s 384-385 filtering efficienc y 466 flesh growth , and burrowing depth 45 2 Florida Curren t 367 Florida Key s bivalve faun a 367-38 7 collecting date s 382. 383 data sources 373 definition 368-36 9 species frequency 38 0 species lists 372-379 foot Lucinidae 219 vermiform 21 0 Fourier analysi s 403^406 freshwater communitie s 3. 159 . 329 Gastropoda 11.2 5 cladistic studie s 13 1 monophyly 21.4 1 geological timescale 401 gills Anomalodesmata 9 0 filaments 4 filibranch 2 . 84. 88. 274 Lucinidae 211-212. 211. 21 2 protobranch 84 . 85. 274 see also mantl e gills glacial cycles 354. 357 Gondwana. bivalves in 82 granule cells 21 1 growth rates 426. 427. 470 growth rings 429. 431. 463. 469 Gulf Coast" 146 Gulf o f Mexico Loop Current 382. 385 Gulf Strea m 425. 426. 436 harmonic bifurcation mode l 282-284 heterochrony 40 3 Heteroconchia characterization 59 . 61 evolution 57 monophyly 42 phylogeny 2 . 11 . 12 . 19 . 25 superorder 9 1 Heterodonta 12 . 21. 43. 54 . 55 monophyly 42 orders 34 hinge teeth, ancestral character 48. 49 denticulate teeth 89. 90 rudists 115 . 12 1 edentulous hinges 51 heterotaxodont teet h 5 3 palaeotaxodont teet h 5 3 pretaxodont teet h 5 3 pseudotaxodont teet h 53 hinges asymmetry 8 9 evolution 30 9 larval 5

INDEX homology 11 3 hydrocarbon sources , Kuhnpasse t 240 Indonesia-Philippines region 350 , 353 infaunal tax a 35 6 infaunal-epifaunal reati o 36 4 inshore facie s 9 2 interstitial water , channelin g 209 , 219 iron, i n granules 332-333 islands, an d speciation 355 , 357 isotopic composition s 429, 430 Kuhnpasset, ma p 225 Kuhnpasset Bed s 229 , 230, 231 Kuro Shi o Curren t 35 0 lamello-fibrillar structur e 47 larvae glochidial 160 , 16 4 shells 303-312, 305, 306, 308 lasidium 160 , 165 lateral toot h 5 1 latitudinal gradients 347 , 349, 350, 356, 358, 361-365, 362, 364 life habits , Lucinida e 22 0 ligaments differentiation 4 7 duplivincular 5, 49, 280 growth pattern s 287 , 282, 285, 286, 287 lamellar 5 Noetiidae 279-289 , 283 parinvincular 87 rudists 11 5 types 49, 51,52-53 limestone mound s 229-234 , 233, 239 long-branch attractio n effec t 24 , 34, 41, 44 longitudinal gradient s 352-355 , 35 8 lucinid symbionts , specie s lists 208 Lucinidae 4 , 18,25,207-22 5 adductor muscl e 210 , 217-218 anatomy 209-21 9 ctenidia210-211 foot 21 9 fossil 23 5 functional summar y 219-22 0 Macoma balthica, burrowing dept h 451^-5 8 magnesium an d strontiu m concentrations 434 , 435 magnesium/calcium ratios 47 2 majority rul e consensus tre e Palaeozoic tax a 56 rudists 77 8 Mantle plicated 21 0 apertures 278 , 218-219 gills 4, 212, 273, 274, 275, 276, 277 marine sanctuary , Florida Key s 36 7 markers 39 3 mass extinction , K- T boundary even t 6 mass mortalit y 459, 463 maximum likelihoo d analysi s 16, 17 , 20 higher tax a 27 Pteriomorphia 22 , 26 maximum parsimon y analysi s 35 mechanoreceptors 250 Mesozoic era 129-130 , 240 Jurassic 229-230 , 239-240, 252, 303-311 Cretaceous 66 , 97-98, 132, 227-230, 239

metabolic col d adaptatio n 7 , 441-450 metabolic rate s bivalves 444, 445 and temperatur e 446, 447-448 metallo-thioneins 33 6 metals, trac e element s 434^36 methanotrophs 22 8 microgrowth increment s 431^434, 431, 432, 433, 436 microtubules, cycling of 441 mid-domain effec t 348 , 352, 354 mineralization 5 mitochondria maintenance 44 7 polar fis h 44 1 tridacnid sper m 79 5 mitochondrial sequence s 3 , 31 Modiomorphidae 4 fossil 235-23 6 molecular methods, phylogen y 1 , 34-3 5 Molluscan phyl a 1 1 monophyly Bivalvia25, 41 Gastropoda 21,4 1 Heteroconchia 4 2 Heterodonta 4 2 higher taxa 1 8 Palaeoheterodonta 4 2 scaphopods 2 1 Unionidae 15 2 monoplacophorans 2 , 47 morphogenesis 283-28 4 morphological phylogenies , Pteriomorphi a 1 2 morphometrics 392, 400, 409 mucocytes 5 , 211, 274, 276, 277 mucopolysaccharides 274 , 276, 277 museum collections 38 5 mussels and environmenta l cange 469^76 environments an d evolution 465^78 role i n water processin g 46 8 Myoida phylogeny 12 , 21, 4 2 polyphyletic nature of 2, 18 , 25, 4 4 spicules 90 myophores 98 , 100 , 105 , 109 configuration 11 5 posterior 11 3 Mytilus galloprovincialis population genetic s 389-39 7 sampling site s 392 Mytiloidea origins 1 2 relationships 19 , 22, 23, 26 , 43, 6 4 sperm 170 , 178, 779, 184, 18 6 Nacre 4 7 neighbour-joining analyse s 22 , 35, 38 neighbour-joining tree , geneti c population s 39 0 Noetiidae 5 , 170 , 171 ligaments 279-289 polyphyly 28 9 North Se a Basin 7 Northern hemisphere , diversit y 348-351 nuclear DNA, My tills galloprovincialis 389-39 7 nuclear morpholog y 18 3 nuclear peg 198,200,20 2 nutrient pulses, monsoona l 35 3 nymphae, ligamenta l 87, 88, 90

481

482

INDEX

oocytes 19 2 opisthobranchs 217 orders 34 Ostreoidea basal 1 2 larval shell s 303-312, 305, 306, 308 relationships 19 , 20, 22 , 24 , 4 3 sperm 170 , 175-178, 18 5 outline shape , evolutio n o f 399^423 oxygen consumption , Antarcti c bivalve s 442, 443 oxygen isotope s 428-430, 470 palaeoenvironments, evidence fro m Aequipecten opercularis 425-439 Palaeoheterodonta 54 , 55 monophyly 42 , 16 0 orders 34 Palaeotaxodonta 47 . 53, 84 early 8 5 evolution 57 . 61 Palaeozoic er a 43, 129-130 , 279-280. 342 Cambrian 41,47-50 , 65, 81 Ordovician 41, 43, 65-66. 81-95, 12 9 Silurian 65 Devonian 65-66 , 339 Carboniferous 65-66 , 291-292 Palaeozoic tax a 5 0 Adams consensu s tre e 5 5 characters 50-5 3 cladogram 5 8 majority rul e consensus tre e 5 6 species list s 65-66 strict consensu s tre e 53 , 54 pallial blood vesse l 210 , 214, 217, 218 pallial canal s 100 , 111 pallial lin e 48, 51 pallial tentacle s 25 0 palps food-gathering 8 5 reduced 21 0 Panamic-Caribbean regio n 352 , 355 parallel evolutio n 1 1 paraphyly, scaphopod s 1 8 parsimony analyse s 16 , 17 Unionidae 149-15 2 partial sequence s 2 5 PCR, se e polymerase chai n reactio n Pectinidae4. 19 . 170 eyes 247-255 Pectinoidea relationships i n 19 , 20, 22 , 24 . 4 2 sperm 170 , 180-183, 185 . 186 periostracum, thickness o f 8 5 phenotypic plasticit y 456-457 phylogenetic studie s cladistics i n 130-13 1 higher tax a 18-2 3 materials an d methods 12-13 , 16-1 7 phylogenetic taxonom y 153-15 4 physiological character s 7 Pinnoidea phylogeny 12 . 19.20.22.26 relationships 4 3 sperm 170 , 180, 185, 186 placentae, unionid s 15 3 plasticity, phenotypic 456-457 polymerase chai n reactio n 12-13 , 392 polymorphic character s 50-5 1

polyphyly Etheriidae 16 3 Noetiidae 28 9 Unionoidae 145-15 8 population genetics , Mytilus galloprovincialis 389-39 7 postero-dorsal notc h 30 7 predation birds 7 , 25 0 and cementatio n habi t 16 5 crabs 7 , 250 fish 25 1 on mussel s 46 7 starfish 249-25 0 primary productivit y 352, 356 principal componen t analysi s 406, 407, 408, 409^13. 416, 418^20 prodissoconchs 5 . 303-311 programs BIOMECO 39 2 CLUSTALW 1 6 DCSE 1 6 fastDNAml 17.2 0 HADTREE 1 7 LINTRE 1 6 MacClade 16 3 PAUP 17.20,35.53 . 133 . 149 PREPARE 1 7 PRIMER 37 0 Tree-Rot 17.3 5 TREE VIEW 1 7 Protobranchia 2 . 48, 16 9 orders 3 4 phylogeny 12 , 18 . 21. 2 5 subclass 85-8 8 provincula 303, 308-310 pseudofaeces 84 , 88 pseudogenes 4 2 pseudohinges 5 1 pseudopillars 11 5 Pterioidea2, 12 , 1 9 relationships 24. 43 sperm 170 . 180, 184, 185 Pteriomorphia acrosomes 78 2 characters 2 6 cladistic analysi s 1 . 11-29 , 13 1 early 9 2 evolution o f 47. 4 8 intra-group relationships 23-24. 25-2 6 maximum likelihoo d analysi s 22, 26 monophyly 1 2 morphological phylogenie s 12 . 13. 26. 27 orders 3 4 Palaeozoic 5 9 phylogenetic studie s 2, 1 1 species lis t 14-16, 172-173 spectral analysi s 23 sperm ultrastructur e 169-190 , 17 4 strict consensu s tre e 2 0 Queensland-Northern Territor y regio n 351 radial canal s 100 , 114 rDNA sequence s 16S 14 6 18S 11-29.31-46,39 0 28S26. 31 lengths of 17 . 35

INDEX reaction-diffusion mode l 284-288 regional processe s 354 relative rat e test 16 , 18, 25 reproductive strategie s 307-30 8 resilium, interna l 8 4 respiration 4 , 219 rock boring 313, 314 rostroconchs 1 rudists 2 characters 111-114 , 123-12 4 cladistic analysi s 106-12 1 classification 99-10 6 dentition 115 , 12 1 families 10 9 ligaments 11 5 most parsimoniou s tre e 12 0 phylogeny 97-127 , 108 shell symmetr y 11 5 species lists 110 taxa analysed 106-11 1 Scaphopoda 12 , 25 cladistic studie s 13 1 monophyly 2 1 paraphyly 1 8 sea-surface temperatur e 6 , 361 and diversit y 363 seagrass 208, 250-25 1 seasonal growt h 431 , 433^35 sediment volumes , and infauna l tax a 35 6 seep communities 4, 209, 227-246 bivalve size 238-239 selection pressur e 399 , 419 shape evolution o f 399-423 and siz e correlatio n 41 8 shape analysis 403-406 shell character s anomalodesmatans 13 6 and lif e habit s 3 , 82 shell damage, b y birds 461 shell growt h rat e 228, 472 shell sections , Mytilus edulis 47 1 shell shape , an d facies 41 5 shell symmetry , rudists 11 5 shells aragonite prism s 90 larval 5 microstructure 85-86, 91 nacre 86 , 470 outer layer s 114 , 12 1 prismatic 90 , 470 prismato-nacreous 9 0 used a s tools 46 5 shipworms 4 siphon, raptoria l 13 2 siphonal sheat h 32 5 Solemyoida 53 , 57, 85-88 origins 87-8 8 reduced gu t 8 6 Southern hemisphere , diversit y 351-352 speciation event s 2 4 species enrichment , b y mussels 46 8 species frequency , Florida Keys 38 0 species introduction s 391 , 463 species list s Anomalodesmata 13 0 Bivalvia 32-33

Florida Keys 372-379 lucinid symbiont s 20 8 metabolic rates 444 Palaeozoic tax a 65-6 6 Pteriomorphia 14-16, 172-173 rocky shore s 46 9 rudists 11 0 Spissatella 404-40 5 Unionoida 16 2 species turnove r 384 spectral analysis , Pteriomorphia 23 sperm ultrastructure Pteriomorphia 169-190 , 174 taxonomy an d phylogeny 183-18 6 Tridacninae 191-20 5 spicules 9 0 Spissatella, specie s lists 404-405 stable isotop e dat a 427-431 starfish 249-250 , 467 steinkerns 233 stomach types , Teredinida e 25 8 strict consensus tre e Anomalodesmata 13 7 Bivalvia 35, 36, 37, 39, 40 higher tax a 1 9 Palaeozoic tax a 53 , 54 pteriomorphs 20 Unionidae 150-151 Unionoida 163 , 164 strombids 34 8 strontium, see magnesiu m and strontium subclasses, Bivalvi a 34, 84 suborders 3 4 substitution rates 11 , 24, 2 5 sulphide bacteria 4, 209, 228 suspension feedin g 4 swimming behaviour 250-252 symbiosis, see also chemosymbiosi s Systematics Agend a 200 0 145 tabulae 11 4 tapetum 248 taxonomic sampling , density of 2 4 Teepee Butte s 230 teeth denticulate 89, 90 heterotaxodont 5 3 palaeotaxodont 5 3 pretaxodont 5 3 pseudotaxodont 5 3 temperature and diversit y 352 and metaboli c rate s 446, 447-448 temperature toleranc e 445-446, 446, 448 Teredinidae 3 4 digestive system s 257-27 1 filter feedin g 27 0 stomach type s 25 8 Tethys closure 6 , 355, 359 rudist radiation i n 97 total evidenc e tree s 134 , 136 phylogeny, Unionida 16 0 trace elemen t dat a 434-436 transition/transversion ratio 24 transmission electro n microscop y 17 0 Treatise o n Invertebrate Paleontology , treatmen t of Bivalvia 1 , 8

483

484

INDEX

Tridacnidae 18,25 , 191-20 5 consensus tree 799. 200, 20 1 Tridacninae, sper m ultrastructure 191-205, 193, 795 , 796, 79 7 tropical-temperate divide 351, 356 Turing model s 284 typhlosoles 266, 267 Unionidae data matri x 14 9 distribution map 14 7 family 16 1 intestinal coiling 160 material 14 8 polyphyly 145-15 8 species accounts 154-156 Unionoida 3 . 5. 12 . 25. 42 phylogeny 16 0 shell microstructur e 90

sister group 18 species lists 16 2 strict consensus tree 163 . 76 4 Veneroida relationships 12 , 21. 43. 43 , 5 4 Tridacnidae i n 191 . 19 7 vent communities 4. 227 Wadden Se a 459. 462 water density, variations 353 water flo w 27 6 water pumping 27 5 water temperature, oxygen isotopes 42 8 Wollaston Forelan d Group 229. 232 wood 234. 236, 24 0 digestion o f 4. 257-258. 267. 270 X-ray analysis , calcium granules 332. 33 5

Systematic Inde x Page numbers in italics refer t o figures .

Abra aeqiialis 376 A. lioica 377 Acanthopleura granulata 1 5 Acar plicata 1 4 Acharax 50, 58 A. (Nacrosolemya ) trapezoides 65 . 8 6 Acila castrensis 32 Acostaea 3. 159 . 161. 164, 16 5 Acosteidae 16 4 A. rivoli 160 , 16 2 Acrosterigma reeveanum 198 , 20 2 Acteon tornatilis 217 Actinodontoida 49 Actinodonta 6 4 A. cuneata 64. 65. 91 Actinonaias ligamentina 16 2 Adamussium colbecki 252. 428 Adipicola 46 6 Adula 184.46 6 A. falcatoides 17 2 Aequipecten gl\ptus 37 5 A. irradicms 173 , 180.25 1 A. irregiilaris 250 A. opercularis 7 . 26. 425-439. 426 Agriopleura 110 , 114, 116, 12 2 A. blumenbachi 107 A. marticensis 10 7 Akera biillata 21 7 Alytodonta 64 . 92 A. gibbosa 6 6 Amblema elliotti 15 2 A. plicata 16 2 Ambom'chia mdiata 6 6 Ambonychoidea 55, 59, 92 Americardia guppyi 37 2

A. media 37 2 Amphitriscoelus \\~ahngi 107 . 11 0 Amu shim 18 6 A. balhti25\,252 A. laurentii 375 A. papyraceum 37 5 A. pleiironectes 247. 251 Amygdahun 46 6 A. papyrium 37 4 A. politum 37 4 A. sagittatum 37 4 Anabarella 47. 53. 60 A. plcma 50 . 6 5 Anadara 28 8 A. baughmani 37 2 A. floridana 37 2 A. notabilis 37 2 A. ovalis 14 . 372 A. transversa 37 2 A. trapezia 171 , 17 2 Anauterodonta oretanica 6 5 Anatina anatina 374 Anisodoris nobilis 32 Anodonta 33 5 A. cygnea 146 . 16 2 A. c. zellensis 33 3 A. imbecilis 1 5 Anodontia 20 8 A. alba 208. 37 4 A. edentula 20 8 A. OW/.V. M 208. 216 A. philippiana 208 , 209. 212 . 215, 217. 374 Anodonthes guanarensis 16 2 A. trigonus 16 2 Anomalocardia auberiana 37 8

INDEX Anomia 26 A. ephippium 1 4 A. simplex 372 A. trapezoides 18 6 A. trigonopsis 173 , 175 , 183 Anomioidea 19 , 20, 22 , 4 3 Antalis inaequicostata 1 6 A. vulgaris 1 6 Antillocaprina occidentalis 110 , 111 , 11 7 Antillocaprinidae 111 Area 43, 171,28 0 A. imbricata 37 2 A. woa * 14 , 23, 26 , 3 2 A. -^ra 274, 275 , 276 , 372 Arcidae 43, 44, 159 , 171 Arcinella cornuta 372 Arcodonta 8 5 Arcoida 55, 92, 16 9 Arcoidea 64, 92 Arcopsis 17 1 A. adamsi 375 Arctica islandica 15 , 3 3 Arcticoidea 43 Arcuatula 18 4 A. capensis 17 2 Arenicola marina 44 7 Arenigomya 9 0 A. carinata 12 9 Argopecten gibbus 375 A. irradians 14 , 23, 24, 32, 250, 251 , 375 A. lineolaris 37 5 A. rtMctews 375, 38 2

A. purpuratus 250 Arhouriella opheodontoides 49 , 82, S3 Asaphis deflorata 33 , 37 6 Ascaulocardium 322 A. armatum 313 Astarte nana 372 Astartidae 6 1 Asterias amurensis 250 A. /0rfo.s/ 25 0 A. rwfo/ w 250 , 46 7 A. vulgaris 250 Asthenothaerus balesi 378 A. hemphilli 37 8 Astropecten articulatus 250 Afreta 30 7 A/rwfl 24 , 43 A. pectinata 14 , 32 A. r/g/Vf a 14 , 37 6

A. seminuda 37 6 A. serrata 37 6 A. vex/7/w/ n 170 , 173 , 18 0

Aucellina 229 Audouliceras 234 Aulacomya 18 4 A. flte r 17 2 Austriella corrugata 209, 21 6 Autobranchia 34, 48, 88 , 16 9 Autolamellibranchiata 2, 49, 57 , 58 Babinka48, 50, 64, 221 5. prima 66 Bankia carinata 37 8 Barbatia 25 , 43 5. cancellaria 372, 380 5. Candida 37 2 5. domingensis 372 B.foliata 171 , 172

B. obliquata 171, 17 2 B. virescens 14, 32 Barnea truncata 376 Barrettia monilifera 110 , 111 , 774 , 115 , 117 , 12 1 Bartlettia 161 , 16 5 Basterotia elliptica 33 , 377 5. quadrata 377 Bathyarca 17 1 5. glomerula 372 Bathymodiolus 178 , 184 , 210, 46 5 5. boomerang 465 £. childressi 172 5. elongatus 17 2 5. puteoserpenyis 17 2 Z?. thermophilus 17 2 Batioladinium longicornutum 234 Biradiolites angulosissimus 110 Botula fusca 37 4 Brachidontes 23 , 26, 18 4 5. domingensis 375 5. <*.r«s?« s 32, 375 , 38 2

5. modiolus 375 5. rostratus 469 5. semistriatus 17 2 5. variabilis 14 5. virgiliae 17 2 Brachiopoda 3 4 Brachtechlamvs antillarum 37 5 Brechites 132, " 134, 136,32 2 5. vaginiferus 13 0 5. veitchi 317 Bryopa 313-32 7 5. terra 313, 316 , 375, 379, 320, 327, 323 , 32 4 Buckhornia carteri 294, 295-300, 297, 29 9 fiwrvtf ra/tf l 1 6

Busycon canaliculatum 250 fl. rar/ca 250 Byssocardium 20 1 Callista chione 15 , 3 3 C. eucymata 37 8 Callucina radians 208 Calyptogena 208 , 210 , 23 6 Camptonectes 30 7 Camya 8 2 Cancer irroratus 250 C. pa gurus 250 C. polydon 25 0 Caprina adversa 101, 107 , 11 0 C. douvillei 10 1 Caprinidae 12 2 Caprininae 12 2 Caprinuloidea 10 3 Caprinuloidinae 12 2 Caprotina 103 , 116 , 117 , 12 0 C. srriflta 707 , 110 , 11 1 Carcinus maenas 7, 250, 453, 45 9 Cardiidae 24 , 41, 192 , 197 , 200 Cardioidea 18 , 44, 131 , 192 , 201 Cardioidei 44 Cardiolaria 49, 89 C. beirensis 65 Cardiolariidae 50, 57, 61, 84, 88 Cardiolucina 21 7 C. australopilula 208 , 21 9 C. semperiana 15 , 20 8 Cardiomya costellata 37 3 C. £/y/?ta 37 3

485

486 C. ornatissima 370, 373 C. perrostrata 37 3 Carditamera 41 , 42 C.floridana 33 , 372 Carditidae 201 Carditoidea 4 4 Carditopsis smithii 372 Caribachlamys imbricata 37 5 C. mildredae 37 5 C. ornata 37 5 C. senft' s 37 6 Carminodonta 89 , 91 Caspiconcha whithami 234, 235, 237. 238, 240, 242-243 Castalia stevensi 16 2 Catamarcaia 49, 64, 92 C. chaschuilensis 66 Catamarcaidae 92 Caudofoveata 1 7 Cephalopoda 29 2 Cerastoderma edule 198 , 20 2 Cetoconcha margarita 37 6 Chaenocardiola haliotoidea 293, 29 5 Chaetodermomorpha 34 Chama 9 7 C. congregata 37 2 C /tonWt f 37 2 C. lactuca 37 2 C. macerophylla 198 , 372 C sore/ a 372 C. sinuosa 37 2 Chametrachea 3 Chamoidea 4 3 Chattonia 40 0 Chiapasella radiolitifonnis 109 , 110, 11 5 C/H'owe cancellata 37838 0 C. mazyckii 37 8 C. paphia 37 8 Chlamys 24 , 26 C. &(/rof w 24 9 C. hastata 1 4 C. islandica 14,32,250,44 4 C. opercularis 249 , 250, 25 1 C. septemradiata 25 1 Choristodon robustum 376 Choromytilus 18 4 C. chorus 17 2 Circomphalus strigillinus 378 Citothyris 34 4 Clavdgella 132 , 134, 136, 322, 324, 325 C. australis 13 0 C. mullerae 32 2 C oblita317 C. veronensis 317 Clavagellidae 129 , 132,31 4 Clavagelloidea 313 Cleidothaeridae 129 , 131, 134 Cleidothaerus maorianus 13 0 Cleionychia 9 2 Clinocardium ciliatum 444 Clinopistha 8 6 Coalcomana ramosa 107 , 11 0 Cochlearites 321 Codakia costata 37 4 C. orbicularis 208, 209, 210, 211, 212, 214, 374, 380 C. orbiculata 374, 380 C. pectinella 37 4 C rugifera 208 , 20 9 C. tigerina 208, 272 , 214

INDEX Coelatura aegyptiaca 16 2 Colpomya hugini 6 6 Colpomyidae 49, 54, 64, 90, 91 Concholepas concholepas 46 7 Conocardiformii 48 , 16 9 C0/?Mms 64, 89,91 C. browni 6 5 Coralliochama 11 1 Coralliophaga coralliophaga 37 8 Corbieula leana 15 , 3 3 Corbiculidae 16 1 Corbiculoidea 4 3 Corbula barrattiana 37 3 C. contracta 15 , 37 3 C. dietziana 37 3 C. swiftiana 37 3 Corbulidae 1 8 Corculum cardissa 15 , 33 Coscinasterias calamaria 249 C. muricata 25 0 Cosmetodon obsoletus 66 Cosmogoniophorina 9 2 C. tenuicostata 8 5 Coxiconcha 48, 50 Crania 97 Crassadoma 24 , 26 C. gigantea 1 5 Crassatellidae 39 9 Crassatellites cordiformis 40 0 Crassatelloidea 44 , 64 Crassinella dupliniana 370 , 373 C. lunulata 37 3 C. martinicensis 37 3 Crassostrea 24 , 310 C.angulata 173 , 178 C. g/gas 173 , 178 C. rhizophorae 37 5 C. virginica 14 , 32, 41, 173 , 178, 274, 370. 375 Crassostreinae 2 4 Crenella decussata 37 5 Crenomynlus 18 4 C. grayanus 172 , 178 Crepidula adunca 16 , 32 Crossaster papposus 249 , 25 0 Cryptochiton stelleri 15 , 32 Cryptodonta 5 Cryptolucina kuhnpasselensis 234, 235, 236. 239. 241-242 Cryptopecten phrygium 37 6 Cryptostrea permollis 375 Cte/?0 20 8 C. divergens 1 5 C. orbiculata 20 8 Ctenodonta 61 , 85 C. famatinensis 8 7 C. jonesii 87 C. laevigata 8 7 C. logani 87 C. macalesteri 8 7 C. miniscularia 8 7 C. nasuta 8 7 C. tennesseensis 65 C. youngi 87 Ctenodontidae 48 , 49, 50, 61 Ctenoides annulatus 14 , 17 C.floridanusm, 38 3 C. planulatus 37 3 C. sanctipauli 37 3

INDEX C. scaber 373, 383 Cubitostrea 310 Cucullaea 280 Cucullaeidae 171 , 184 Cumberlandia monodonta 146 , 149, 162 Cumingia coarctata 377 C. tellinoides 37 7 Cuspidaria cuspidata 13 0 C. gigantea 37 3 C. rostrata 37 3 Cuspidariidae 129 , 132, 134 Cyclinella tenuis 378 Cyclocardia astartoides 442, 444 Cyclochoncha 6 4 C. mediocardinalis 6 5 C. milleri 6 4 Cycloconchidea 59 , 64 Cycloconchoidea 64 Cyclopecten 37 6 Cylindrobulla 2 17 Cymatioa 37 3 Cymatoceras 23 5 Cymatoica orientalis hendersoni 37 7 Cymatonota typicalis 34 3 Cyrenoidea 43 Cyrenoidea flo ridana 37 3 Cyrtodonta saffordi 60 , 6 6 Cyrtodontidae 55, 64 Cyrtodontoida 54, 64, 92 Cyrtodontoidea 49, 60 Cyrtonaias tampicoensis 16 2 Cyrtopleura 2 1 C. owfflte 15 , 37 6 Dacosta 322, 324 Dacrydium elegantulum hendersoni 37 5 Decatopecten 2 6 Deceptrix 85 , 89 Dendrostrea folium 170 , 173, 178 D.frvns315 Dentalium bisexangulatum 16 £>. laqueatum 16 , 18 , 2 5 Diceras97, 115 , 117 £>. arietinum 99, 107 , 110 Dictyoptychus morgani 110 , 111 , 114 , 11 7 Dimyoidea 18 5 Diplodon deceptus 16 2 Diplodonta 2 5 £>. punctata 37 8 D. semiaspera 37 8 D. subrotundata 1 5 Discina 9 7 Discinisca tenuis 32 Distolasterias nipon 25 0 Divalinga 208 A quadrisulcata 374 Divaricella 208 A quadrisulcata 216 , 374 Divarilima albicoma 37 4 Divariscintilla yoyo 15 , 32 Donacidae 18 , 44 Domz* 399, 419 D. variabilis 15 , 33, 37 3 Dosinia discus 15 , 378 £>. elegans 37 8 Dreissena polymorpha 46 6 Dreissenoidea 43 Durania cf . apula 10 4

D. cornupastoris 107 , 110, 11 4 Dyspanopeus sayi 250, 251 Dystactella 8 6 Ekstadia 6 1 £. tricarinata 65 Electroma alacorvi 14 , 24 Elliptio complanata 15 , 33 £. dilatata 16 2 Ennucula aegeensis 5 3 E. ttenuis 370, 375 Ensiculus cultellus 3 3 £>ww21,25, 341 £. directus 15 , 25, 33, 459-464 £". minor 37 6 Entodesma beana 374 E. saxicola 13 0 Entovalva 32 5 £6w/wi61,64 £. tenuistriata 49, 59, 66 Eodonidae 64 Eohemithiris grayii 3 2 Eomiltha voorhoevei 221 £0rt//0 288 Eoradiolites plicatus 107 , 110 Epicheloniceras 23 4 Epidiceras 115 , 11 7 £. sinistrum 107 , 110 £. speciosum 99 Equichlamys bifrons 25 0 Eritropidae 8 8 Eritwpis 57 , 61, 88 £. peregrinata 83 , 65 Ervilia concentrica 37 7 £. m'te/w 377 E. subcancellata 37 7 Erycinoinei 43 £f/z<™ 3 , 159 , 161, 165 £. elliptica 160 , 16 2 Etheriidae 3, 159-168 Eucrassatella 40 0 £". ampla 40 5 £. australis 405 £". concisa 40 5 £. kingicola405,4l6 E. scopalveus 405, 416 £. speciosa 37 3 Eupleura caudata 25 0 Eupteriomorphia 65, 184 , 185-186 Euvola chazaliei 37 6 E. ziczac 37 6 Evyana 5 7 E. "iba/ricfl 59 , 6 6 Excellichlamys 2 4 £". spectabilis 1 5 Falcatodonta costata 66 Falcatodontidae 55 Falcatodontoidea 60 , 64 Fimbria fimbriata 208, 209, 216, 218, 219 Fimbriidae 20 7 Flexopecten glaber 14 , 17 , 24 Foegia 32 3 Fordilla 2 , 47, 48, 49, 57, 59, 60, 82, 85 /^ troyensis 6 5 Fortowensia 6 4 /^ grandis 6 5 Fragum 1 6

487

488 F. fragum 3 3 E imedo 15 . 198.202 Freja 64 . 9 2 F. fecunda 6 6 Frejidae 6 4 Frenamya 13 3 E ceylanica 13 0 Fulvia miitica 15 , 33 E tenuicostata 198 . 202 Eusconaia ebena 146 , 149, 152 E escambia 146 . 149, 152. 155 F.flava 146 . 162 £ sitccissa 146 . 152. 153. 155 Gaimardia trapesina 44 4 Galeomatoidea 43, 44 Galeomma taki 15 . 33 Galeommatidae 18 , 21, 25 . 131 , 37 0 Gastrochaena hians 37 3 G. ovata 37 3 G. stimpsoni 3 3 Gastrochaenoidea 43 Gastropoda 11,2 5 Geukensia 23 . 26 G. demissa 14,32.47 0 G. granosissima 37 5 Glaus dominguensis 37 2 Glebula rotundata 16 2 Globivenus rigida 37 8 G. rugatina 37 8 Gloripallium pallium 170 . 173. 180-181. 18 6 Glossomyophorus costatus 110 , 117 . 12 1 Glotndia pyramidata 3 2 Glycimeridae 43. 170 . 171 Glycimeris 25 G. americana 37 3 G. decussata 37 3 G. gl\cimeris 32 G. holosericus 170 , 171. 172 . 175, 184, 186 G. pectinata 37 3 G. pendunciihis 1 4 G. undata 37 3 G.yessoensis 171 . 172, 175 Glyptarca49. 9 1 G. strata 66. 89 Glyptarcidae 64 Glyptarcoidea 49, 91.92 Gonidea angulata 16 2 Gouldia cerina 37 8 Grammatodon 240 , 307 Gregariella corallophaga 37 5 Gryphaea 43 6 Gryphaeidae 24 . 26. 43. 185 . 303. 309, 310 Gyropleum 10 0 Haliris fischerian a 37 9 Halodule \vrightii 25 0 Heliaster 467 Heteroconchia (se e subject s index) Heterodonax bimaculatus 37 6 Heterodonta 12.21,43.54,5 5 Hiatella arctica 37 3 Himemelites 110 , 11 5 //. VH/W r 1 1 1

Hippopus 200 . 201.202 #. hippopus 15 . 33, 191 . 197 H. porcellanus 15 . 191 . 197 Hippurites91, 110 . 11 7

INDEX //. ('Batolites') organisans 121 //. radiosus 102. I ll //. .voc/fl// s 70 2 Hippuritidae 3 . 120 . 122 Homarus americanus 250 Horiopleura 100 . 103 H. dumortieri 109 . 110. 121 //../H.Y/ 12 1

H. lamberti 109 . 110 Hwnphreyia 32 3 //. gigantea 317 Hyas araneits 25 0 Hyotissa hyotis 14 . 32. 41 //. nwnisma 14 Hyriidae 32 9 Hyridella depressa 329-337 . ^JO //. menziesi 162 Ichthyosarcolites triangularis J04, 110 . 111 . 11 7 Wfl.s simpsoni 46 6 Ilionia 4 . 64 /.pracer 66. 221.222 Inaequidens 8 8 Iphigenia brasiliana 37 3 Ischadium recun'um 375 Isofilibranchia 34 . 47. 48. 91. 169 . 184-185 hognomon 24. 25 /. «/«m. v 14 . 373. 382. 384 /. fc/coW 373 /. isognomon 32 . 173 . 18 0 /. legumen 1 4 /. radiants 373 . 373 Isognomonidae 24. 43 Janeia silurica 22 1 Juranomia 30 7 Keletistes rhizoecus 209 Kellia suborbicularis 37 3 Kuphus 32 3 Laevicardia 13 2 Laevicardium laevigatum 37 2 L. mortoni 37 2 L. pictum 37 2 L. sybariticum 37 2 Laevichlamys multisquamaui 37 6 Lamellodonla 8 1 Lampsilis teres 146 , 149. 153 Larus argentus 250 . 459 L. delawarensis 25 0 Lasaea adansoni 37 3 Laternula elliptica 442 . 444 L. truncata 130 , 24 9 Laternulidae 129 . 131. 13 4 Lectopecten latiauratus 247, 252 L^/7« 16 5 Leiom\a claviculata 373 Leiopecien 6 0 L. praerectangularis 6 6 Leiopectinoidea 6 4 Lepidochitona corrugata 15 . 32 Leporimetis intastriata 377 Leptoconchus 31 6 Ligumia 33 5 L. rect a 16 2 L/w« caribaea 37 4 L. ///?? « 1 4

INDEX Limariafragilis 170 , 173 , 175 , 18 5 L. hians 14 Lpellucida 371,37 4 Limicolaria kambeul 3 2 Limidae 64, 92, 17 0 Limina 60 Limioidea 2 , 3, 19,22,6 4 Limoida 18 5 Limoidea 175 , 18 5 Limopsis 5 , 280 L. aurita 37 4 L. cristata 37 4 L. marionensis 281, 287, 444, 44 5 L. minuta 37 4 L. sulcata 374 Limopsoidea 3 , 170 , 171 , 175 , 18 4 Lindapecten exasperatus 37 6 L. muscosus 376 Lingula anatina 32 Lioberus castaneus 375 Liocarcinus puber 250 Liolophura japonica 15 , 16 , 32 Liostrea plastica 304 Lirophora latirilata 37 8 Litharca 32 5 Lithiotis 32 1 Lithophaga antillarum 375 L. aristata 37 5 L. bisulcata 37 5 L. lithophaga 1 4 L. m'gra 37 5 L. fere s 31 4 Lithophaginae 2 6 Littorina littorea 32 , 459 Lo//go 18,2 1 L. peafe/ 16 , 24, 2 5 Lo/7/w 2 4 L. cristagalli 1 4 Lor/pes 208 L. clausus 21 0 L. lucinalis 208, 20 9 Lortiella rugosa 16 2 Lwcma 20 8 L. amianta 37 4 L. chrysostoma 21 6 L. exasperata 21 2 L. floridan a 37 4 L. leucocyma 37 4 'L.' pandata 221 L. pectinata 374 L. pensylvanica 208 , 209 , 210 , 212 , 214, 218, 37 4 L. philippensis 21 2 L. radians 37 4 L. sombrerensis 37 4 L. trisulcata 37 4 L. tumida 21 2 Lucinella divaricata 208 , 21 0 Lucinda 18 , 21 Lucinidae4, 18,25,207-22 5 Lucinisca nassula 208, 37 4 Lucinoida 54, 59 Lucinoidea 44 Lucinoidea 43 Lucinoma aequizonata 208 , 209 , 21 0 L. annulata 20 8 L. ar/an/w 20 8 L. forea/ w 208 , 20 9 L. filosum 37 4

Luidia alternata 25 0 L. barimae 25 0 L. ciliaris 25 0 L. clathrata 25 0 L. magellanicus 25 0 Lunulacardiidae 5 Lunulacardium 29 1 Lunulacardium clymeniae 29 8 L. semistriatum 29 5 Lunulicardia hemicardium 198 , 202 Lyonsia floridan a 33 , 374 Lyonsiella 13 2 L. formosa 13 0 Lyonsiellidae 13 4 Lyonsiidae 129 , 13 1 Lyrodesma59, 61, 89 L. mo/i w 50 , 65 , 8 9 Lyrodesmatoidei 48 Lyromytilus 34 4 Lyropecten kallinubilosus 37 6 Lytoceras polare 22 9 Macoma balthica 7 , 451^58 M. brevifrons 37 7 M. cerina 37 7 M. constricta 37 7 M. mitchelli 37 7 M. tageligformis 37 7 M. tent o 37 7 Macrocallista maculata 37 8 M. nimbosa 37 8 Mac rotoma frag His 37 4 Mactridae 1 8 Mactroidea 4 3 Mactromeris polynyma 15 , 3 3 Malleidae 24, 26, 18 6 Malletiidae 85 Malleus candeanus 37 4 Malvufundus 24 , 2 6 M. regulatus 1 4 Manzanellidae 86 , 88 Margaritidae 13 1 Margaritifera margaritifera 33 , 162 , 33 5 Margaritiferidae 16 1 Martesia cuneiformis 37 6 M. sfriflt a 37 6 Marthasterias glacialis 25 0 Matheria 5 7 M. fe/te r 6 6 Matheriidae 55 , 57, 64 Matheronia salevensis 107 , 11 0 Megalodontidae 98 , 106-10 7 Megalonaias boykiniana 15 2 Megaxinus rostratus 218 Mercenaria 42 9 M. campechiensis 37 8 M. mercenaria 15 , 33, 37 9 Metapadia 5 7 M. matapediensis 6 6 Meyenaster gelatinosus 250 Microgloma yongei 53 Miltha2\l M. children! 218 Mimachlamys varia 14 , 24, 2 6 Minnivola pyxidatus 247 , 24 9 Mitrocaprina 103 , 111 Mnemiopsis leidyi 45 9 Modellnaia 16 5

489

490 Modiolinae 26. 18 4 Modiolodon 48 , 57 M. oviformis 6 6 Modiolodontidae 55 , 64, 90, 91 Modiolopsidae 49 , 51, 54, 64, 90, 91 Modiolopsis 57 , 60, 90 M. modiolaris 6 6 Modiolopsoidea 6 4 Modiolus 50 , 57 , 60, 178 , 184 M. americanus 32, 172 , 37 5 M. auriculatus 1 4 M. kurilensis 17 2 M. meeki 6 6 M. modiolus 274, 275, 474 M. m. squamosus 37 5 Modiomorpha 57 , 59, 64, 90 M. concentrica 6 6 Modiomorphidae 4 Modiomorphoida 49 Modiomorphoidea 90 Monocondylaea minuana 16 2 Monodonta labio 18 , 25, 16 , 32 Monopleura 10 0 M. taurica 107 , 11 0 M. varians99, 107, 110 Montanaria 5 9 M. honguedoensis 6 5 Mulinia lateralis 15 , 33 Mulleria 160 , 161 Musculinae 18 4 Musculista senhousia 17 2 Miisculus 184,46 6 M. disc ors 17 2 M. lateralis 32 . 37 5 Mutela dubia 16 2 M. rostrata 16 2 Mutelidae 159 . 161 , 165 Mvfl arenaria 15 . 33, 451, 45 6 Myadora 132 , 134 M. sfriflt a 13 0 Mycetopodidae 160 , 164, 165 Myochama 132 . 134 M. anomioides 13 0 Myochamidae 129 , 131 Myodakryotus 64 , 92 M. deigryn 6 6 Myoida (see subjects index) Myodiea 43 My oner a3 3 M. I imamI a 37 3 Myrtea sagrinata 37 4 M. spinifera 208 , 209 Mysella plamdata 37 3 Mytilidae 55, 60 , 17 8 Mytiliformii 48 . 16 9 Mytilinae 23 . 18 4 Mytiloida53, 169 , 184 Mytiloidea (see subjects index) Mytilopsis leucophaeata 370 , 373, 383 M. sallei 373 . 383 Mytilus 16 , 24, 26 . 184 , 19 8 Mytilus californianus 14 , 32, 467. 468, 469, 472 M. chilensis 17 2 M. coruscus 17 2 M. edulis 32 , 172 , 178 , 274, 276, 389, 465-478 M. e . chilensis 472 , 474 M. e . planulatus 39 1 M. galloprovincialis 14 , 172 , 178, 389

INDEX A/, perna \ 72 M. trossulus 389, 467, 472 Nacella concinna 44 5 Nassarius siquijorensis 1 6 Neilonella subovata 32 Nemocardium peramabile 372 M tine turn 37 2 Neocomiceramus subneocomiensis 238 Neocrania anomala 32 Neopycnodonte cochlear 373 Neorhynchia 3 2 Neotaxodonta 42. 92 Neoteredo reynei 4 , 258, 259 Neotrigonia 42 . 89 , 16 0 M margaritacea 162 , 163 Nerita albicilla 16 , 3 2 W. peloronta 38 4 Nicaniella 30 7 Nipponoclavata 32 3 Nippopanacca 13 5 Nodipecten nodosum 376 , 383 Atom 288 N. ponderosa 37 5 Noetiidae5, 170 , 171 Noradonta59, 61.64 , 89 yV. redoniaeformis 61 , 83. 8 9 M shergoldi6\, 65,83 Nototeredo knoxi 378 Nucella lapillus 46 7 Nucinella 85 , 86 yV. M/?/ / S3, 8 6 yV. UY7/V/ J 8 6 Nucinellidae 49, 86 , 88 Nucinelloidea 86 , 8 8 yVwcw/tf 84 , 85 , 24 0 M aegeensis 37 5 M calcicola 37 5 N. crenulata 37 5 N. proxima 15 , 32, 37 5 Nuculana 8 6 yv. fla/t a 37 5 yV. concentrica 37 5 yV. minuta 3 2 Ar.p?//fl 15 , 1 8 yv. pusio 37 5 M S0//WH/ 0 37 5 yV. verrilliana 37 5 Nuculanidae 21 , 8 5 Nuculaniformii 61 , 16 9 Nuculanoidea 2 . 41. 57 Nuculidae44, 53, 61 Nuculiformii 48 . 61 Nuculites 5 7 yV oblongatus 6 5 Nuculoida57, 61 , 85 Nuculoidea2, 44, 50, 61 Nuculoidea 57 , 8 4 yV. pinguis 51 , 57 . 6 5 Mmstf 59 , 64 yV. dorsata 6 5 Nyassidae 59 , 64 Nymphahicina 23 5 Obovaria olivaria 146 , 153 0. remstf 146 0. ra/M/fl/ a 146 . 149, 152, 153, 15 6 0. unicolor 146 , 153

INDEX Octopus maorum 25 0 Onchidella celtica 16 , 32 Orobitella floridana 37 3 Orthodesma 34 3 Orthonota undulata 34 3 Orthonotidae 5, 343 Ortonella 60, 64 O. hairiest 6 6 Osculigera 107 , 110 , 11 5 Ostrea 24, 25 a erfw/ w 14 , 32, 173, 178 , 307 O. equestris 1 4 Ostreidae 24, 26, 170,31 0 Ostreina 18 5 Ostreioda 55 , 59, 60, 65, 185 Ostreoidea (se e subjects index) Ostreola equestris 37 5 Ovatoconcha 86 , 87 O. fragilis 83 Oxyteuthis 23 4 Oxytoma 30 7 Pachyrisma 11 5 P. grande99, 106 , 11 0 Pachytraga 100 , 103 , 109 , 114 P. tubiconcha 107 , 11 0 Palaelima 60 P retifera 6 6 Palaeoheterodonta 54, 55 Palaeoneilo 57 P. fecunda 6 5 P iruyensis 87 Palaeosolen 343 P chapmani 344 P costatus 344 P frontisocurvus 34 4 P. quadrangularis 34 4 Palaeotaxodonta 47, 53, 84 Panacea 13 5 Pandora 13 2 P. are nos a 3 3 P bushiana 375 P inaequivalvis 130 P. ifi/Zflt a 37 5 Pandoridae 129 , 131 , 13 4 Pandoroidea 131-132 , 134 Panopea japonica 15 , 21, 2 5 Papyridea semisulcata 37 2 P soleniformis 372 Paracycladidae 221 Paracyclas proavia 22 1 Parallelodontidae 64, 92 Parastarte triquetra 37 9 Parastirpulina 32 2 Parilimya 13 5 P. fragilis 13 0 Parilimyidae 129 , 133 , 134 , 135 Parvilucina costata 208 P. multilineata 208 , 218 , 374 P tenuisculpta 208 , 209 , 210, 217, 218 Pate/to 198 Patinopecten yessoensis 4, 247-255 Patina pectinifera 25 0 Patrocardia 29 1 Paulinea 85 , 88 Pecten 24 , 26 P maximus 14 , 32, 173 , 180 , 181 , 186 , 247, 249 , 251 , 428,431

491

P /7KSI 0 248 P ziczfl c 250 Pectinidae4, 19 , 170 Pectinina60, 185 Pectinoida 54, 55, 59, 60, 65 Pectinoidea (see subject s index) P^wm 24, 325 P spondyloideum 1 5 Pegophysema alba 21 6 Penicillus 323, 32 4 Pensarnia 85 , 88 Periglypta listen 379 Periploma angasi 13 0 P anguliferum 37 6 P. tenerum 37 6 Periplomatidae 129 , 131, 134 Permophoridae 90 P
492 Plicatuloidea 2 . 22. 42. 43. 18 5 Pododesmus caelata 1 4 P. macrochisma 3 2 Pojetaia 2 , 47. 48. 49. 57. 60-61, 82. 85 P. nmnegari 6 5 P. sarhoensis 5 3 Policordia 13 2 Polyconites 100 . 10 9 Polyconitidae 109 . 12 2 Polymesoda maritima 37 2 Polyplacophora 11.4 1 Pommy a 13 6 P. granulata 130 . 37 6 P. rostrata 37 6 Poromyidae 129 . 132 . 13 4 Posostrea 161 . 16 5 Potamilus alatus 162 Praecaprina various 107 . 11 0 Pmecaprotina yaegashii 109 . 110 . 772 Praecardioida 5 Praeluda subtilis 53. 65 Praenucula 57 P. faba 57 . 6 5 P. infirma 5 7 Praenuculidae 53 . 84. 85 Praetorreites omanensis 110 . 111 . 114 . 11 7 Pressastarte 307 Priene rude 25 0 Prionodonta 169 . 18 4 Pristiglomidae 6 1 Procardia 13 5 Pmlobella 64 Propeamussiidae 18 6 Propeaimissium dalli 37 6 P. sayanum 37 6 Prothyris 34 3 Protobranchia 2 . 48. 16 9 Pmtothcica granulata 37 9 Pseudoceratium tovae 23 4 Pseudochama inezae 37 2 P. radians 37 2 Pseiidoconocardium 30 0 Pseudomulleria 159 . 161 . 164 . 16 5 P
INDEX P\ganodon grandis 16 2 Quadrula quadrula 146 . 149 . 152 . 16 2 (2- \\rightii 15 5 Quincuncina bitrkei 146 . 149 . 152 . 153 . 155 0. //z/z/cflt a 146 . 149 . 153 . 154 '£>.' kleiniana 15 4 0. mitchelli 15 3 Radiolites 97 7?. sauvagesi 104 Radiolitidae 3 . 12 2 Tta^ta plicatella 37 4 Rangia flexuos a 37 4 Rapana bezoar 249 Ttosm thiophila 208 . 209 . 270 . 216 Redtmia 59 . 61. 64 7?. bohemica 61 . 6 5 Redoniidae 59. 64 /to/zfl 100 . 11 7 7?. tulae 107 . 11 0 Rhombopteriidae 65 Ribeiria junior 4%. 50. 53. 65 7?. /z/cw z 50 . 6 5 Rostriconchia 48. 60 Rousselia 10 3 Sabinia aniensis 10 9 Saccostrea 2 4 5. cucullata 1 4 5. glomerata 173 . 17 8 Salaputium animula 400. 405 . 41 7 Samacar 17 1 Sanguinolites discors 34 4 Sanmartinoceras 234 Sauvagesia inacroplicata 107 . 11 0 Scaphopoda 12 . 25 Schizodidae 89 . 90 Scutopus ventrolineatus 15 . 16 Semele bellastriata 377 5. proficua 37 7 5. purpurascens 37 7 Semelina nuculoides 37 7 Semierycina 37 3 Semim\tilus algo.sus 17 2 Septibranchia 49. 132 . 135 . 169 Septifer 24 . 26 . 178 . 184 . 46 5 5. bilocularis 14 . 32 5. keenae 17 2 5. v/Vgaru v 466. 469 . 47 2 Septim\alina perattenuata 66 Sheldonella 17 1 Siliquimya 34 4 Silurozodus 5 9 S. gotlandicus 6 5 Similodonta 8 5 Solecurtus cumingianus 377 So/ewvfl 4 . 86. 208. 210 . 235. 236 . 2J S 5. occidentalis 37 7 5. parkinsoni 8 6 5. togflt a 14 . 17 . 2 5 S. velum 2 5 Solemyidae 48. 88 Solemyoida 53. 57. 85-88 Solemyoidea 2 . 61. 8 8 Solenomorpha 34 3 5. dorsocunw 34 4 5. minor 34 4

INDEX 5. scalpriformis 34 4 Spathella typica 34 4 Spathochlamys benedicti 37 6 Spengleria rostrata 37 3 Sphaerulites 9 7 Sphenia antillensis 374 Sphenosolen draperi 34 4 Sphoeroides maculatus 251 Spissatella 399^23 , 402 5. acculta400, 404, 410, 411 5. clifdenensis 404 , 411, 412, 420 5. concisa 40 0 5. discrepans 40 4 5. maudensis 40 0 5. media 404, 4\5 S. poroleda 404, 41 1 5. scopalveus 40 0 5. subobesa 404, 410 S. rra/7//404, 411,412, 420 Spisula raveneli 37 4 5. jo/Kf a 15 , 33 5. solidissima 198 , 274, 276 Spondylidae 19,43 , 17 0 Spondylus 24 S. americanus 377 5. crassisquamatus 14 5. emeritus 18 1 5. gaederopus 247 , 252 5. gussoni 377 5. /zvsfr/. r 14 , 2 3 5. nicobaricus 170 , 173, 18 1 5. sinensis 32 5". tetericus 37 7 Sportellidae 43, 44 Stewartia floridana 20 8 Stichaster 467 Stirpulina 32 2 Stirpuliniola 32 2 S/r/tfrc0 /flcte a 14 , 23, 170 , 171 , 172, 175, 250, 2 8 Strigilla carnaria 377 5. £flta/ 37 7 S1. mirabilis 37 7 S. pisiformis 37 7 Strombina 420 Strombus 348 Strophitus undulatus 16 2 Swiftopecten swiffi 25 0 Tagelus divisus 37 7 7] plebeius 37 7 Tanaodon59, 64 , 221 £ louderbacki 65 Tancrediopsis 6 1 7! contract a87 £ gotlandica 65 Tellidora cristata 37 7 Tel Una aequistriata 37 7 T: fl£// w 37 7 7^ alternata 37 7 7] americana 37 7 Z angulosa 37 7 7^ candeana 37 7 7! consobrina 37 7 7:/tfwsta377 7] gouldii 37 7 T: /m 37 7 7] laevigata 37 7 7: /weflta 37 7

T: to n 37 7 7] magna 37 7 7^ martinicensis 37 7 T: mera 37 8 T: m'tens 37 8 Z paramera 378 7! persica 37 8 7^ punicea 37 8 T: radwt a 37 8 7: j/'/n/V w 37 8 7^ squamifera 37 8 7] sybaritic a 37 8 7] tampaensis 37 8 7! texana 37 8 T: versicolor 15 , 33, 37 8 Tellinoidea 43, 44 Tepeyacia 115 , 117 , 120, 121 , 122 T: corrugata 109 , 110, 772 7^ multicostata 10 9 Teranota ebbighauseni 339-346, 340 , 347, 342 Terebratalia transversa 3 2 Teredinidae 34 , 258 Teredo clappi 37 8 7^ furcifera 25 7 Teredolites clavatus 234, 236 Tetraselmis suecica 442 Thais clavigera 3 2 T: /a/HV/i w 25 0

Thalassia 20 8 Thalassinoides 23 4 Thalassiosira pseudonanna 442 Thecidellina blochmanni 32 Thoralia 5 0 7] languedociana 6 5 Thoraliidae 53, 59 Thracia corbuloides 369, 37 8 7! stimpsoni 37 8 Thraciidae 129 , 131 , 13 4 Thracioidea 13 2 Thyasira trisinuata 370, 37 8 Thyasiridae 207 Timoclea grus 379 7^ pygmaea 37 9 Tiostrea 307 , 310 Tironucula 5 7 7! jugata 57, 6 5 Tironuculidae 50, 53 Tivela floridana 370 , 37 9 Tolmaia erugisulca 6 6 Torreites 109 , 114, 115 , 11 7 T: sanchezi 110 , 11 1 Toucasia carinata 107 , 110 Toxolasma lividus 16 2 Trachycardium egrnontianum 372 7] magnum 37 2 7! muricatum 372, 382 Transenella couradina 37 9 7! cubaniana 37 9 7] culebrana 37 9 7] stimpsoni 37 9 Trecanolia 64 , 92 7! acincta 6 6 Tresus nutalli 15 , 3 3 Trichomya hirsuta 17 2 Tridacna 16 , 201, 20 2 T: crac^33, 191 , 192, 194,20 2 T:
493

494 T. maxima 191 . 192, 194.202 T. rosewateri 19 1 T.squamosa 15 . 191 , 194 , 202 T. tevoroa 19 1 Tridacnidae 18,25 , 191-20 5 Tridacninae 191-205 , 193, 195, 196, 19 7 Trigonioida 53, 54, 59, 89-90 Trigonioidea 2, 42 Trigonothracia jinxingae 13 0 Trigonulina oniata 37 9 Trisidos 17 1 Tritogonia verrucosa 15 3 Tromelinodonta 8 9 Tropidomya abbreviata 15 , 21 , 2 5 Tuarangia 2 , 48, 50, 60-61. 82 T. gravgaerdensis 6 5 T. g . tenuiumbonata 4 8 Turnus 234 . 236 Umburra 60 . 65 U. cinefacta 6 6 Umburridae 59 . 65 Ungulinidae 207 Unio cacao 15 5 U. infucatus 15 4 U. kleinianus 15 4 U. pictorum 16 2 U. rotulata 153 , 156 £7. securiformis 15 4 (7. succissus 15 5 (/. titmidits 16 2 Unionacea 16 1 Unionidae (see subjects index ) Unioniformes 4 8 Unionoida 3, 5. 12,25,4 2 Urosalpinx cinerea 25 0 Uskardita 9 2

INDEX Utterbackia imbecilis 33 Vaccinites galloprovincialis 102 Valletta 98 , 103 . 107, 115. 11 7 V awra 11 0 Varicorbula limatula 37 3 Vasticardium flavum 15 . 33 Velesunio 33 5 V{ angasi 16 2 Venerida 18.2 5 Veneridae 1 8 Veneroida (see subjects index) Veneroidea 4 3 Veneroidei 43, 44 Venus verrucosa 15 , 33 Verticordia acuticostata 37 9 V( triangularis 13 0 Verticordiidae 129 , 131, 132. 134 Vulsella 14 . 24, 2 6 tf vulsella 173 , 18 0 Wallucina assimilis 208, 217. 21 9 Watsonella 47 , 53. 60 W cross&y / 48. 50 . 6 5 Whiteavesia 57 . 60 W cincinnatiensis 6 6 Wilkingia 34 4 Xanthochorus 25 0 Xenoturbella 8 X\lopholas altanai 376 ybW/'fl eights! 44 4 X limatula 1 5 Yoldiella nana 15 . 17 . 18,2 3 Zostera marina 25 0